0% found this document useful (1 vote)
14K views

E

DNA fingerprinting is now used routinely to solve crimes. This activity provides in-depth instruction about how restriction enzymes cleave DNA. Students analyze six different samples of plasmid DNA.

Uploaded by

Cedric Kanyinda
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (1 vote)
14K views

E

DNA fingerprinting is now used routinely to solve crimes. This activity provides in-depth instruction about how restriction enzymes cleave DNA. Students analyze six different samples of plasmid DNA.

Uploaded by

Cedric Kanyinda
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 72

Biotechnology Explorer

DNA Fingerprinting Kit

Instruction Manual

Catalog Number
166-0007-EDU

www.explorer.bio-rad.com

Lyophilized reagents can be stored at room temperature. Store DNA


markers at 4 ºC, or colder within 4 weeks of arrival.

Duplication of any part of this document is permitted for


classroom use only

For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723)
Can DNA evidence solve human problems?
DNA fingerprinting is now used routinely to solve crimes. In recent years, news stories have
reported how miniscule amounts of DNA have been used to identify individuals involved in
incidents even many years in the past, as well as exonerate innocent people from incrimina-
tion.
The power of DNA as a tool for individual identification captures students’ imaginations.
This activity provides in-depth instruction about how restriction enzymes cleave DNA, how
electrophoresis is used to separate and visualize DNA fragments, and how these techniques
can be combined to obtain a DNA fingerprint. Principles of restriction analysis, plasmid map-
ping and DNA fragment size determination can also be documented with this kit.
Open the door to rich discussions about scientific, ethical, and legal implications of DNA
profiling. DNA fingerprinting is used in medical and forensic procedures, as well as in pater-
nity determinations to discern genetic relationships between individuals at the molecular level.
This kit allows students to play the role of a forensic scientist and make a positive ID. That
is, to simulate using real DNA as evidence and figure out for themselves: “Who done it?”
In this activity, students analyze six different samples of plasmid DNA. One sample collect-
ed from a hypothetical “crime scene” and five samples obtained from “suspects” are digest-
ed with two restriction enzymes. The resulting DNA fragments are separated and visualized
in agarose gels using Bio-Rad’s Bio-Safe DNA staining solution. Based on the restriction
fragment patterns, students compare the evidence and match one of the suspects’ DNA to the
sample collected at the crime scene.
As an alternative to the classical human forensic applications for this kit, have your students
imagine they are high tech pathologists investigating an outbreak of an aggressive infectious
disease that has never been seen before. The Centers for Disease Control and Prevention sus-
pects that a new strain of bacteria has arisen that not only is the cause of the new disease, but
also has acquired multiple resistance plasmids from some other bacterial strains. Their job is
to develop a DNA diagnostic tool for identifying the culprit plasmids. They decide to use
restriction enzyme analysis and “DNA electrophoresis fingerprinting” to identify and distin-
guish different suspect plasmids and track their spread through the environment. DNA from
the cultures of a number of stricken patients has been isolated. Have your students identify the
new killer bug before the pathogen gets out into the general population and starts a true epi-
demic!
We strive to continually improve our Biotechnology Explorer kits and curricula. Please share
your stories, comments and suggestions!

Ron Mardigian
Dr. Patti Taranto
Bio-Rad Laboratories
[email protected]
[email protected]
1-800-424-6723
DNA Fingerprinting Curriculum
Intended Audience
This investigation is intended to be used by any high school or college student, indepen-
dent of the degree of prior familiarity with the chemistry of nucleic acids.

Goals of the Curriculum


That all students who participate in this investigation:
1) Become challenged by the task and intrigued by the methodology of the investigation.
2) Develop an understanding of some of the basic scientific principles involved in DNA
fingerprinting.
3) Weigh evidence and be able to analyze and interpret the data that is generated in this
investigation with clarity and confidence.
4) Have a clear understanding of the thought processes involved in scientific work.
5) Develop the curiosity and confidence to further explore questions and issues involving
scientific investigations.

Teaching Strategies
This curriculum is designed to simulate human forensic testing but can also be used to
simulate a wide range of applications for genetic analysis. The actual scenario employed is up
to the discretion of the instructor. (Refer to alternative scenarios in Appendix A).
The analysis sections of this investigation are intended to guide students through the
process of discovering and understanding concepts that are of significance to the procedures
and the analysis of the data at each step along the way. It is hoped that this approach (as com-
pared to the teacher giving the students all of the background information) will make the
entire investigation more comprehensible to a greater number of students. So long as the
teacher has the opportunity to check on the progress and levels of understanding of each
group, some degree of self pacing is possible, if so desired. We have found that this approach
allows a larger number of the diverse population of students we work with to experience the
goals that have been identified above.

The curriculum for this activity was developed in collaboration with:

Len Poli and Russ Janigian:


S.F. Base - Biotechnology Program
San Francisco

1
Table of Contents
Teacher’s Guide Page

Kit Inventory Check List Kit Components and Required Accessories ....................3
Background For Teacher Setting the Stage for Your Students..................................4
Implementation Timeline Advance Preparation and Student Lessons ......................8
Workstation Check List Student and Instructor Lab Setups ....................................9
Advance Preparation Lab Prep and Lesson Highlights ....................................11
Quick Guide Graphic Laboratory Protocol ..........................................16

Student Manual
Lesson 1 Introduction to DNA Fingerprinting ..............................19
Lesson 2 Restriction Digests of DNA Samples ............................21
Lesson 3 Electrophoresis and Staining of DNA Samples..............28
Lesson 4 Analyzing the DNA Patterns and Drying Gels ..............33

Appendices
Appendix A Alternative DNA Fingerprinting Scenarios....................41
Appendix B Prelab Activities ..............................................................44
Review of Restriction Enzymes ..............................44
Review of Electrophoresis ......................................49
Appendix C Teacher’s Answer Guide ................................................51
Appendix D Plasmid DNA and Restriction Enzymes ........................65

2
✔) List
Kit Inventory: Check (✔

Components Provided in this Kit Class Kit ✔)


(✔
1. Crime Scene (CS) DNA with buffer, lyophilized, 60 µg 1 vial ❑
2. Suspect 1 (S1) DNA with buffer, lyophilized, 60 µg, 1 vial ❑
3. Suspect 2 (S2) DNA with buffer, lyophilized, 60 µg 1 vial ❑
4. Suspect 3 (S3) DNA with buffer, lyophilized, 60 µg 1 vial ❑
5. Suspect 4 (S4) DNA with buffer, lyophilized, 60 µg 1 vial ❑
6. Suspect 5 (S5) DNA with buffer, lyophilized, 60 µg 1 vial ❑
7. EcoRI/PstI, restriction enzyme mix, lyophilized, 1800 units 1 vial ❑
8. Sterile water, 2.5 ml 1 vial ❑
9. Lambda HindIII DNA markers (0.2 µg/µl), 100 µl 1 vial ❑
10. DNA sample loading dye 1 vial ❑
11. DNA staining solution (500x) 1 ml 1 vial ❑
12. Microtubes, 1.5 ml, assorted colors
clear 30 ❑
green 10 ❑
blue 10 ❑
orange 10 ❑
violet 10 ❑
red 10 ❑
yellow 10 ❑
13. Agarose, 5 g 1 ❑
14. TAE buffer (50x) 100 ml 1 ❑
15. Foam test tube racks 16 ❑
16. Gel staining trays 10 ❑

Accessories Not Included in this Kit No. ✔)


(✔
Micropipet, 2-20 µl (catalog number 166-0506-EDU) 1–8 ❑
Pipet tips - 1 box, 5 racks of 200 (catalog number 223-9338-EDU) 1 ❑
Electrophoresis chamber (catalog number 170-4406-EDU) 1–8 ❑
Power supply (catalog number 170-5050-EDU) 1–2 ❑
Permanent markers 1 ❑
Microwave oven 1 ❑
Distilled water 1 ❑
250 ml Erlenmeyer flask for microwaving agarose 1 ❑
500 ml flask or beaker for DNA stain 1 ❑
Ice bucket with ice 1 ❑
Optional Accessories
Microcentrifuge (catalog number 166-0503-EDU) 1 ❑
37 °C water bath (catalog number 166-0504-EDU) 1 ❑
Gel Bond gel drying sheets (catalog number 170-2984-EDU) 1 ❑

3
Background Information for the Instructor
Introduction
Technicians working in forensic labs are often asked to do DNA profiling or “finger-
printing” to analyze evidence in law enforcement cases and other applications.1 DNA
fingerprinting may involve polymerase chain reaction (PCR2 ) amplification to analyze minute quan
ties of DNA or restriction fragment length polymorphism (RFLP3) analysis, if large amounts of DNA a
recovered. A step in human RFLP analysis requires the student to compare band patterns produced b
cleavage of DNA samples when separated on an agarose gel. The patterns in this exercise are produce
from one sample that represents DNA taken at the crime scene and five samples obtained from suspec
in the case. It may be important for you to point out to your students that this laboratory exercise mode
the more elaborate technique that is performed on complex human DNA samples.

Restriction Enzymes
Restriction enzymes sit on a DNA molecule and slide along the helix until they recognize
specific sequences of base pairs that signals the enzyme to stop sliding. The enzymes then
digest (chemically separate) the DNA molecule at that site—called a "restriction site"—act-
ing like molecular scissors, cutting DNA at a specific sequence of base pairs.
If a specific restriction site occurs in more than one location on a DNA molecule, a restric-
tion enzyme will make a cut at each of those sites, resulting in multiple fragments. Therefore,
if a given linear piece of DNA is cut with a restriction enzyme whose specific recognition
code is found at two different locations on the DNA molecule, the result will be three
fragments of different lengths. If the given piece of DNA is circular and is cut with a restric-
tion enzyme whose specific recognition code is found at two different locations on the DNA
molecule, the result will be two fragments of different lengths. The length of each fragment
will depend upon the location of restriction sites on the DNA molecule.
When restriction enzymes are used to cut strands of circular plasmid DNA, such as the
samples included in this kit, fragments of varying sizes are produced. DNA that has been cut
with restriction enzymes can be separated and observed using a process known as agarose gel
electrophoresis. The term electrophoresis means to carry with electricity.

Agarose Gel Electrophoresis


Electrophoresis separates DNA fragments according to their relative size. DNA
fragments are loaded into an agarose gel slab, which is placed into a chamber filled with a
conductive liquid buffer solution. A direct current is passed between wire electrodes at each
end of the chamber. DNA fragments are negatively charged, and when placed in an electric
field will be drawn toward the positive pole. The matrix of the agarose gel acts as a molecu-
lar sieve through which smaller DNA fragments can move more easily than larger ones. Over
a period of time smaller fragments will travel farther than larger ones. Fragments of the same
size stay together and migrate in single "bands" of DNA.
An analogy would be to equate this situation to your classroom in which all the desks
and chairs have been randomly scattered around the room. An individual student can wind
his/her way through the maze quickly and with little difficulty, whereas a string of four
students holding hands would require more time and have difficulty working their way through
the maze of chairs.

4
DNA Fingerprinting
Each person has similarities and differences in DNA sequences. To show that a piece of
DNA contains a specific nucleotide sequence, a radioactive complementary DNA probe can
be made that will recognize and bind that sequence. Radioactive probes allow molecular biol-
ogists to locate, identify, and compare the DNA of different individuals. This probe can be
described as a "radioactive tag" that will bind to a single stranded DNA fragment and produce
a band in a gel or a band on a piece of nylon blotting membrane that is a replica of the gel (also
known as a Southern blot). Because of its specificity, the radioactive probe can be used to
demonstrate genotypic similarities between individuals. In DNA fingerprinting, the relative
positions of radiolabeled bands in a gel are determined by the size of the DNA fragments in
each band. The size of the fragments reflect variations in individuals’ DNA.
We are rapidly getting beyond the scope and intention of this manual. For more detailed
information, we recommend a review of the references listed on page 7.
The evidence needed for DNA fingerprinting can be obtained from any biological
material that contains DNA: body tissues, body fluids (blood and semen), hair follicles, etc.
The DNA analysis can even be done from dried material, such as blood stains or mummified
tissue. If a sample of DNA is too small it may be amplified using PCR techniques. The DNA
is then treated with restriction enzymes that cut the DNA into fragments of various length.4

Restriction Digestion of DNA


Because they cut DNA, restriction enzymes are the "chemical scissors" of the molecular
biologist. When a particular restriction enzyme "recognizes" a particular four - or six -base
pair (bp) recognition sequence on a segment of DNA, it cuts the DNA molecule at that point.
The recognition sequences for two commonly-used enzymes, EcoRI and PstI, are shown
below. The place on the DNA backbones where the DNA is actually cut is shown with a (✄)
symbol:


G A AT T C
For the enzyme: EcoRI C T TA A G


For the enzyme: PstI CTGCAG
GACGTC

Like all enzymes, restriction enzymes function best under specific buffer and
temperature conditions. The proper restriction enzyme buffer has been included with the DNA
sample, so that when the rehydrated DNA and enzymes are mixed, the ideal conditions are
created for the enzymes to function optimally. The final reaction buffer consists of 50 mM Tris,
100 mM NaCl, 10 mM MgCl2, 1 mM DDT, pH 8.0, which is the ideal condition for EcoRI
and PstI enzymes to function.

5
Visualizing DNA Restriction Fragments
DNA is colorless so DNA fragments in the gel can’t be seen during electrophoresis. A blue
loading buffer, containing two blue loading dyes, is added to the DNA solution. The loading
dyes do not stain the DNA but make it easier to load the gels and monitor the progress of the
DNA electrophoresis. The dye fronts migrate toward the positive end of the gel, just like the
DNA fragments. The “faster” dye co-migrates with DNA fragments of approximately 500
bp, while the “slower” dye co-migrates with DNA fragments approximately 5 kb in size.
Staining the DNA pinpoints its location on the gel. When the gel is immersed in a dilute
solution of Bio-Safe DNA stain, the dye molecules attach to the DNA molecules trapped in
the agarose gel. To enhance contrast and to easily visualize the DNA bands, excess back-
ground stain can be removed from the gel by destaining the gel with water. When the bands
are visible, your students can compare the DNA restriction patterns of the different samples
of DNA.
The gel below shows the DNA pattern that will be obtained by your students following
electrophoresis. The DNA from the crime scene has been labeled CS, that from Suspect #1,
S1 and so on. The DNA from the crime scene is placed in lane 2; one suspect’s DNA is placed
in each of lanes 3, 4, 5, 6 and 7. Lane 1 contains HindIII DNA size markers. By convention,
the lanes are numbered from the top left. The students’ task is to look at the DNA banding pat-
terns and see if any of the suspects’ bands match those of the DNA found at the crime scene.

M CS S1 S2 S3 S4 S5
1 2 3 4 5 6 7 8

It’s easy to see that the DNA taken from the crime scene and the DNA from S3 is
identical. You may want to point out how "strong or weak" this evidence is in convicting a
suspect. The DNA evidence may place the suspect at the scene, but other evidence may be
needed to prove him or her guilty!5,6
You may point out to your students that this is a simulation. In actual DNA fingerprint-
ing, technicians analyze much larger segments of DNA and many more bands and lanes are
produced. These technicians are looking for a specific DNA segment, common to a given
population, that will produce a unique banding pattern for each individual.

6
Reliability of DNA Evidence
Two major factors affecting the reliability of DNA fingerprinting technology in forensics
are population genetics and genetic statistics. In humans there are thousands of RFLP loci or
DNA segments that can be selected and used for fingerprinting analysis. Depending on demo-
graphic factors such as ethnicity or geographic isolation, some segments will show more vari-
ation than others.
Some populations show much less variation in particular DNA segments than others. The
degree of variation will affect the statistical odds of more than one individual having the same
sequence. If 90% of a given population has the same frequency in its DNA fingerprinting
pattern for a certain DNA segment, then very little information will be attained. But if the
frequency of a DNA pattern turning up in a population for a particular segment is extremely
low, then this segment can serve as a powerful tool to discriminate between individuals in
that population. Different populations show different patterns in their genotypes due to the
contributions made to their individual gene pools over time.
Therefore, in analyzing how incriminating the DNA evidence is, one needs to ask the
question:
“Statistically how many people in a population may have the same pattern as that taken
from a crime scene: 1 in 1,000,000? 1 in 10,000? Or, 1 in 10?”

References
1. DNA Profiling Fast Becoming Accepted Tool For Identification, Pamela Zurer, Chemical and
Engineering News, Oct. 10, 1994.
2. PCR means polymerase chain reaction; it is a technique used to amplify small amounts of DNA (in
this case so that further analysis of the DNA can occur).
3. RFLP means restriction fragment length polymorphisms..."riff-lips" in biotech jargon...Pieces of
DNA are cut with restriction enzymes into fragments of various lengths. Individuals possess
variable restriction recognition sites so that two pieces of DNA from separate sources may have
different fragment lengths when their DNA is cut by the same enzyme.
4. An excellent resource for the classroom teacher is Genetic Fingerprinting, Pauline Lowrie and
Susan Wells, New Scientist, 16 November 1991.
5. Is DNA Fingerprinting ready for the courts?, William C. Thompson and Simon Ford, New Scientist,
March 31, 1990.
6. When Science Takes the Witness Stand, Peter Neufeld and Nevelle Coleman, Scientific American,
Vol. 262: 5, May 1990.

7
Implementation Timeline
There are five student lessons in this fingerprinting curriculum. All lessons are designed
to be carried out in consecutive 50 minute periods. All lessons include:
• A series of prelab considerations for students
• An active student investigation
• Questions for analysis and interpretation of lab results

Student Schedule
Lesson 1: Introduction to DNA Fingerprinting
Activity Lecture and discussion
Prelab Considerations 1 and 2
Lesson 2: Restriction Digest of DNA Samples
Activity Pour gels; perform the restriction digests
Complete preliminary analysis and review questions
Lesson 3: Electrophoresis of DNA Samples
Activity Load and run gels; stain gels overnight
Do analysis and review questions
Lesson 4: Analysis and Interpretation of Results
Activity Destain gels
Do analysis questions
Generate standard curve
Discuss results and weigh evidence

Instructor’s Advance Preparation Overview


This sections outlines the recommended schedule for advanced preparation on the part of
the instructor. A detailed Advance Preparation Guide is provided on pages 11–15.
Activity When Time required
Read Fingerprinting manual Immediately 1 hour

Prepare electrophoresis TAE Prior to or during Lesson 2 1 hour


buffer and pour agarose gels

Rehydrate lyophilized DNA/ Prior to Lesson 2 20 minutes


buffer samples and enzyme
mix and aliquot

Prepare Bio-Safe
DNA stain Prior to Lesson 2 10 minutes

Set up workstations The day of student labs 10 minutes/day

8
Workstation Check (✔) List
Student Workstations: Materials and supplies that should be present at each student work-
station prior to beginning each lab experiment are listed below. The components provided in
this kit are sufficient for 8 student workstations.
Instructor’s (Common) Workstation: A list of materials, supplies, and equipment that
should be present at a common location that can be accessed by all student groups is also
listed below. It is up to the discretion of the teacher as to whether students should access
common buffer solutions/equipment, or whether the teacher should aliquot solutions and
operate equipment.

Lesson 2 Restriction Digests of DNA Samples


Student Workstations Number/Station ✔)
(✔
EcoRI/PstI enzyme mix 1 tube (80 µl) ❑
Pipet tips 15 tips ❑
P-10 or P-20 micropipet 1 ❑
Color coded microtubes:
green, blue, orange, violet, red, yellow 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Ice bucket with ice 1 ❑

Instructor’s Workstation
Crime Scene DNA with buffer, rehydrated 1 vial ❑
Suspect 1 DNA with buffer, rehydrated 1 vial ❑
Suspect 2 DNA with buffer, rehydrated 1 vial ❑
Suspect 3 DNA with buffer, rehydrated 1 vial ❑
Suspect 4 DNA with buffer, rehydrated 1 vial ❑
Suspect 5 DNA with buffer, rehydrated 1 vial ❑
Incubator or bath - (37 °C) 1/class ❑
Molten agarose (See Advance Prep) 35–40 ml/gel ❑
Gel trays 1/station ❑
Lab tape for gel trays 1/station ❑

Protective eye goggles should be worn in the laboratory at all


times.

Proper safety precautions, such as no eating or drinking,


should always be practiced.

9
Lesson 3 Electrophoresis of DNA Samples
Student Workstations Number/Station ✔)
(✔
Agarose gel 1 ❑
Digested DNA samples 5 ❑
DNA sample loading dye 1 ❑
Marking pen 1 ❑
Pipet tips 1 box ❑
P-10 or P-20 micropipet 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Gel box and power supply 1 ❑
Gel staining tray 1 ❑

Instructor’s Workstation
1x TAE Electrophoresis buffer 275 ml gel/box ❑
Bio-Safe DNA stain - 1x solution 500 ml ❑
HindIII DNA markers 1 ❑

Lesson 4 Analysis of Results


Student Workstations Number/station ✔)
(✔
Water for destaining gels 60 ml ❑
Millimeter ruler 1 ❑
Semi-log graph paper 1 ❑

Instructor’s Workstation
None required

10
Instructor’s Advanced Preparation for Labs
This section describes the preparation that needs to be performed by the instructor before
each laboratory. An estimation of preparation time is included in each section.

Lesson 2 (Lab) Restriction Digests of DNA Samples


Advance Preparation
Objectives: Rehydrate DNA/buffer samples and restriction enzymes
Aliquot restriction enzymes
Set up student and instructor workstations
Pour agarose gels, or, if you have your students pour their own gels dur-
ing the lab, prepare the agarose ahead of time. Agarose, once pre-
pared, may be kept in a water bath set at 50–55 °C until used by the
students.
Set temperature of 37 °C for water bath
Time required: Thirty minutes to 1 hour (will vary depending on how you choose to pre-
pare agarose gels)
What’s required: Electrophoresis gel boxes, casting trays and combs
Electrophoresis buffer (50x TAE)
Agarose powder
16 clear microtubes

Procedures
1. Rehydrate samples:
Note: All of the DNA and enzyme vials should contain a white residue, which may appear
as a loose powder in the DNA vials. The lyophilized DNA samples have color-coded
labels on clear glass vials. The lyophilized EcoRI/PstI enzyme mix is in an amber vial.
A. To rehydrate DNA/buffer samples, add 200 µl of sterile water to each lyophilized
DNA vial and swirl to resuspend. Allow DNA/buffer samples to rehydrate at room tem-
perature for 5 minutes or until dissolved. Gentle heating at 37 °C for 10 minutes may be
necessary. You may choose to transfer the rehydrated DNA/buffer samples to color-
coded, labeled 1.5 ml microtubes to make pipetting easier for your students.
The rehydrated DNA samples are now at a concentration of 0.3 µg/µl in 100 mM
Tris, 200 mM NaCl, 20 mM MgCl2, 2 mM DTT, pH 8.0. Once the DNA in buffer is
added to the enzyme, the final concentration of buffer will be 50 mM Tris, 100 mM NaCl,
10 mM MgCl2, 1 mM DTT, pH 8.0, which is the ideal condition for EcoRI and PstI
enzymes to function.
B. To rehydrate EcoRI/PstI enzyme mix, add 750 µl sterile water and swirl to resus-
pend the enzymes. Allow enzymes to rehydrate on ice for 5 minutes. It is critical that the
enzyme mix is kept on ice, but not frozen, once it has been rehydrated. The rehydrated
enzymes should be used within 12 hours.
2. Aliquot enzyme mix: Transfer 80 µl of the rehydrated enzyme mix into each of eight,
1.5 ml microtubes labeled ENZ.

11
3. Prepare electrophoresis buffer. TAE (Tris, acetate, EDTA) electrophoresis buffer is avail-
able as a 50x concentrated solution. In addition to the 1x TAE buffer needed to make the
agarose gels, approximately 275 ml is also required for each electrophoresis chamber.
Three liters of 1x TAE buffer will be sufficient to run 8 electrophoresis chambers and
pour 8 agarose gels. To make 3 liters of 1x TAE from a 50x TAE concentrate add 60 ml
of 50x concentrate to 2.94 liters of distilled water.
4. Prepare agarose. These procedures may be carried out 1 to 2 days ahead of time by the
teacher or done during class by the individual student teams.
A. The recommended gel concentration for this classroom application is 1% agarose.
This concentration of agarose provides excellent resolution and minimizes run time
required for electrophoretic separation of DNA fragments. To make a 1%
solution, add 1 gram of agarose to 100 ml of 1x TAE electrophoresis buffer. The
agarose must be made using electrophoresis buffer, not water.
If gel boxes are limiting, you can use a 7 x 10 cm tray and two 8-well combs to pour a gel
that can be used to run two sets of student digests.
Use this table as a guide for gel volume requirements when casting single or multiple
gels.
Volume of 1% agarose for:
Number of gels 7 x 7 cm tray 7 x 10 cm tray
1 40 ml 50 ml
2 80 100
4 160 200
8 320 400

B. Add the agarose powder to a suitable container (e.g. 500-ml Erlenmeyer flask for
200 ml or less). Add the appropriate amount of 1x TAE electrophoresis buffer and
swirl to suspend the agarose powder in the buffer. If using an Erlenmeyer flask,
invert a 25-ml Erlenmeyer flask into the open end of the 500 ml Erlenmeyer flask
containing the agarose. The small flask acts as a reflux chamber, thus allowing long
or vigorous boiling without much evaporation. The agarose can be melted for gel
casting by boiling until agarose has melted completely on a magnetic hot plate, hot
water bath, or in a microwave oven.
Caution: Always wear protective gloves, goggles, and lab coat while preparing and casting
agarose gels. Boiling molten agarose or the vessels containing hot agarose can cause severe
burns if allowed to contact skin.
Microwave Oven Method. This technique is the fastest and safest way to dissolve agarose.
Place the gel solution in an appropriate bottle or flask into the microwave. LOOSEN THE CAP
IF YOU ARE USING A BOTTLE. Use a medium setting and set to 3 minutes. Stop the
microwave oven every 30 seconds and swirl the flask to suspend any undissolved agarose. Boil
and swirl the solution until all of the small translucent agarose particles are dissolved. Set
aside to cool to 55-60 °C before pouring.
Magnetic Hot Plate Method. Add a stir bar to the undissolved agarose solution. Heat the
solution to boiling while stirring on a magnetic hot plate. Bubbles or foam should disrupt
before rising to the neck of the flask.
Boil the solution until all of the small translucent agarose particles are dissolved. Set aside to
cool to 55-60 °C before pouring gels.

12
If you choose, you can melt the agarose several hours in advance and keep it in a waterbath
at 55-60 °C until you or your students are ready to pour the gels.
5. Pour agarose gels. This lab activity requires that each gel has at least 8 sample loading
wells. Follow the above instructions to prepare the agarose and determine what volume
of 1% agarose will be needed. Pour enough agarose to cover the gel comb teeth or to a
depth of 0.5–0.75 cm. Do not move or handle the gel tray until the gel has solidified.
When solidified, gels can be stored in sealable bags at room temperature or in the refrig-
erator until use on the next day. Have students label their plastic bags. The time needed
to pour gels by an entire class is approximately 30 minutes. If possible, pour one or two
extra gels for back-up.
6. Restriction Digests. A 45 minute incubation at 37 °C is the optimum digestion condi-
tion. If a 37 °C heating block, water bath, or incubator is not available, samples can be
digested by placing tubes in foam racks, floating them in a large volume (1 liter or more)
of 37 °C water, and allowing them to incubate overnight as the water cools to room tem-
perature.
Procedure for casting gels
Using Bio-Rad’s Mini Sub-Cell® GT system, gels can be cast directly in the gel box by
using the casting gates with the gel tray.
This section outlines the conventional tape-the-tray method for casting gels. Other meth-
ods are detailed in Bio-Rad's Sub-Cell GT instruction manual.
Step 1. Seal the ends of the gel tray securely with strips of standard laboratory tape. Press
the tape firmly to the edges of the gel tray to form a fluid-tight seal.

Step 2. Level the gel tray on a leveling table or workbench using the leveling bubble pro-
vided with the instrument.

Step 3. Prepare the desired concentration and amount of agarose in 1x TAE electrophore-
sis buffer.

Step 4. Cool the agarose to at least 60 °C before pouring.

Step 5. While the agarose is cooling to 60 °C, place the comb into the appropriate slot of the
gel tray. Gel combs should be placed within 3/4 of an inch of the end of the gel
casting tray (not in the middle of the gel).

Step 6. Allow the gel to solidify at room temperature for 10 to 20 minutes—it will appear
cloudy, or opaque, when ready to use.

Step 7. Carefully remove the comb from the solidified gel.

Step 8. Remove the tape from the edges of the gel tray.

Step 9. Place the tray onto the leveled DNA electrophoresis cell so that the sample wells are
at the cathode (black) end of the base. DNA samples will migrate towards the anode
(red) end of the base during electrophoresis.
To pour a double gel using the 7 x 10 cm tray and two 8-well combs, place one comb at
one end of the tray and the other comb in the middle of the tray.

13
Lesson 3 (Lab) Electrophoresis and Staining of DNA Samples
Advance Preparation
Objective: Aliquot DNA sample loading dye
Prepare Lambda HindIII size markers
Prepare 1x Bio-Safe DNA staining solution
Set up student and instructor workstations
Time required: Twenty minutes
What’s required: Stock solution: DNA sample loading dye
Stock solution: Bio-Safe DNA staining solution
Stock solution: DNA size marker (Lambda HindIII digest)
1. Aliquot loading dye.
A. Label 8 clear microtubes "LD" for Loading Dye. Aliquot 35 µl of loading dye into
8 clear microtubes that are labeled "LD". Distribute to student workstations.
B. Add 20 µl of loading dye to the stock tube containing the HindIII DNA Size Markers.
If possible, heat the markers to 65 °C for 5 minutes, then chill on ice—this results in
better separation of the marker bands. Label clear microtubes "M". Aliquot 15 µl of
the DNA markers containing loading dye to the 8 clear microtubes labeled “M”.
Distribute to student workstations.
2. Prepare Bio-Safe DNA staining solution.
Dilute the 1 ml volume of 500x DNA stain in 499 ml of distilled water in an appropriate
sized flask. Cover the flask and store at room temperature until ready to use.
3. Electrophoresis of samples.
Suggested running time is 30 minutes. If your laboratory schedule allows, increasing run-
ning time to 40 minutes will enhance the resolution.

DNA Staining Procedure—Bio-Safe DNA Staining Solution


The volume of 1x Bio-Safe solution needed to stain one 7 x 7 or 7 x 10 cm gel is
approximately 60 ml. Gels should be removed from the gel tray before staining. This is
easily accomplished by holding the base of the gel in one hand, and gently pushing out the gel
with the thumb of the other hand. Special attention must be given to supporting the well
portion of the gel since it can crack along the well line. Pour enough stain into the tray to
cover the gel(s) completely.
For best results, shake gels while staining overnight. If you have a rocking platform,
multiple gels can be stained in one large container if they are marked to distinguish different
student groups’ gels, by cutting off different corners, for example. If the provided staining
trays are used, each gel should be stained in an individual staining tray.
Stain the gels overnight in 1x Bio-Safe stain. The next day, rinse the stained gel with
water and destain at least 10 minutes. To produce maximum contrast, the gels can be destained
overnight with water. This stain is nontoxic; however, you should use latex or vinyl gloves
while handling gels to keep your hands from being stained.

14
Lesson 4 Drying Gels and Analyzing the DNA Patterns
Advance Preparation
Objective: Set up workstations
Time required: 10 minutes
Procedures: There are no reagents to make or aliquot for this laboratory.

To obtain a permanent record of the gel, before it is dried, either trace the gel outline,
including wells and DNA bands on a piece of paper or acetate, or take a photograph using
standard cameras and film (Bio-Rad's standard Polaroid gel documentation system).
Dry the Agarose Gel as a Permanent Record of the Experiment
Note: Drying agarose gels requires the use Bio-Rad’s specially formulated high strength
analytical grade agarose. Other gel media may not be appropriate for this purpose. There
are two methods that can be used to dry destained agarose gels.
Method 1
Method 1 is the preferred method and requires the use of Bio-Rad's exclusive gel support
film (catalog number 170-2984-EDU). Simply remove the destained agarose gel from its
staining tray and trim away any unloaded lanes with a knife or razorblade. Place the gel direct-
ly upon the hydrophilic side of a piece of gel support film. Water will form beads on the
hydrophobic side but will spread flat on the hydrophilic side of the film. Center the gel on the
film. Place the film on a sheet of paper towel and dry, avoiding direct exposure to light. As
the gel dries it will bond to the film and will not shrink. If left undisturbed on the support
film, the gel will dry completely at room temperature after 2–3 days. The result will be a flat, trans-
parent and durable record of the experiment.

Method 2
After staining and destaining the gel, leave the gel in the plastic staining tray. Let it air dry
for 2–3 days. As the gel dries it will shrink considerably, but proportionately. If left undisturbed
in the tray, the gel should remain relatively flat but may wrinkle as it dries.

Gel Support Film

Method 1 Method 2

Note: Avoid extended exposure of dried gels to direct light to prevent band fading.
Graphing the Data
Many of your students may not be familiar with logarithms and semi-log graph paper. It
is suggested that you prepare a short lesson presented on the overhead or computer to demon-
strate the proper way to label coordinates and plot points. You may choose to include a les-
son on the different uses of semi-log vs. standard graph paper in this instance. A math
extension implemented here may provide a perfect opportunity to explore linear and expo-
nential (arithmetic and geometric) sequences of numbers. We have included both semi-log and
standard graph paper on pages 38 and 39 of this manual.

15
Quick Guide for DNA Fingerprinting Kit

Day 1 Preparing the DNA Samples

1. Place the tube containing the restriction


enzyme mix, labeled ENZ, on ice.

2. Label one of each colored microtube as ENZ Ice


follows:
green CS = crime scene
blue S1 = suspect 1
orange S2 = suspect 2
violet S3 = suspect 3
red S4 = suspect 4
yellow S5 = suspect 5

Label the tubes with your name, date, and


lab period. Place the tubes in the foam CS S1 S2 S3 S4 S5
microtube rack.

3. Pipet 10 µl of each DNA sample from the


stock tubes and transfer to the corre-
sponding colored microtubes. Use a sepa- DNA Samples
rate tip for each DNA sample. Make sure +
the sample is transferred to the bottom of Enzyme Mix
the tubes.
4. Pipet 10 µl of enzyme mix (ENZ) into the
very bottom of each tube. Use a separate
tip for each ENZ sample.

Stock CS S1 S2 S3 S4 S5

5. Cap the tubes and mix the components by


gently flicking the tubes with your finger.
If a microcentrifuge is available, pulse
spin in the centrifuge to collect all the liq-
uid in the bottom of the tube. Otherwise,
tap the tube on a table top. Flick Tap

6. Place the tubes in the floating rack and


incubate 45 min at 37 °C or overnight at
room temperature in a large volume of Water bath
water heated to 37 °C.

7. After the incubation period, remove the


tubes from the water bath and place in the
refrigerator until the next laboratory period.

16
Day 2 Gel Electrophoresis
1. Remove your digested DNA samples from the
refrigerator. If a centrifuge is available, pulse
spin the tubes in the centrifuge to bring all of the
liquid into the bottom of the tube. Centrifuge

2. Using a separate tip for each sample, add 5 µl of


loading dye "LD" into each tube. Cap the tubes DNA Loading Dye
and mix by gently flicking the tube with your
finger.
3. Place an agarose gel in the electrophoresis appa-
ratus. Fill the electrophoresis chamber with 1x
TAE buffer to cover the gel, using approximate-
ly 275 ml of buffer.
4. Check that the wells of the agarose gels are near
the black (-) electrode and the base of the gel is
near the red (+) electrode.
5. Using a separate tip for each sample, load the (+)
indicated volume of each sample into 7 wells of
the gel in the following order: (–)
Lane 1: M, DNA size marker, 10 µl
Lane 2: CS, green, 20 µl
Lane 3: S1, blue, 20 µl
Lane 4: S2, orange, 20 µl
Lane 5: S3, violet, 20 µl
Lane 6: S4, red, 20 µl
Lane 7: S5, yellow, 20 µl
6. Place the lid on the electrophoresis chamber. The
lid will attach to the base in only one orientation.
The red and black jacks on the lid will match
with the red and black jacks on the base. Plug
the electrodes into the power supply.

7. Turn on the power and electrophorese your


samples at 100 V for 30 minutes.

8. When the electrophoresis is complete, turn off


the power and remove the top of the gel box.
Carefully remove the gel and tray from the gel
box. Be careful—the gel is very slippery! Slide
the gel into the staining tray.

9. Add 60 ml of DNA stain to the tray. Cover the


tray with plastic wrap. Let the gel stain
overnight, with shaking for best results.

Day 3 Analysis of the Gel 2.


1.
1. Pour off the DNA stain into a bottle. Add 60 ml
of water to the gel and let the gel destain 15 min-
utes.
2. Pour off the water into a waste beaker. Analyze
the results with the help of your teacher. 3.
3. Let the gel dry on gel support film or on your lab
bench until completely dry. When the gel is dry,
tape into your lab notebook for a permanent 17
record.
DNA Fingerprinting

Student Manual
Contents Page

Lesson 1 Introduction to DNA Fingerprinting ..............................................................19


Lesson 2 Restriction Digests of DNA Samples ............................................................21
Lesson 3 Electrophoresis and Staining of DNA Samples..............................................28
Lesson 4 Drying Gels and Analyzing the DNA Patterns ..............................................33

18
Lesson 1 Introduction to DNA Fingerprinting
You are about to perform a procedure known as DNA fingerprinting. The data obtained
may allow you to determine if the samples of DNA that you will be provided with are from
the same individual or from different individuals. For this experiment it is necessary to review
the structure of DNA molecules.

The Structure of DNA

The schematics above represent a very small section of DNA from three different
individuals. In this representation of DNA the symbol system is as follows:

Side Chains
S = Five carbon SUGAR molecule known as deoxyribose
P = PHOSPHATE molecule composed of a phosphorous and oxygen atoms
DNA Nucleotide Bases:
A = adenine C = cytosine G = guanine T = thymine
Analysis of the three DNA samples above (see next page) might help us detect similari-
ties and differences in samples of DNA from different people.

19
Lesson 1 Introduction to DNA Fingerprinting

Consideration 1 What is the structure of DNA?

1. Compare the “backbone” of the sugar-phosphate arrangement in the side chains of all
three figures. Are there any differences?

2. In the above figure, do all three samples contain the same bases? Describe your obser-
vations.

3. Are the bases paired in an identical manner in all three samples? Describe the pattern of
the base pair bonding.

4. In your attempt to analyze DNA samples from three different individuals, what conclu-
sions can you make about the similarities and differences of the DNA samples?

5. What will you need to compare between these DNA samples to determine if they are
identical or non-identical?

20
Lesson 2 Restriction Digests of DNA Samples

Consideration 2 How can we detect differences in base sequences?


At first sight, your task might seem rather difficult. You need to determine if the linear
base pair sequence in the DNA samples is identical or not! An understanding of some rela-
tively recent developments in recombinant DNA technology might help you to develop a
plan.
In 1968, Dr. Werner Arber at the University of Basel, Switzerland and Dr. Hamilton
Smith at the Johns Hopkins University, Baltimore, discovered a group of enzymes in bacte-
ria, which when added to any DNA will result in the breakage [hydrolysis] of the sugar-
phosphate bond between certain specific nucleotide bases [recognition sites]. This causes
the double strand of DNA to break along the recognition site and the DNA molecule becomes
fractured into two pieces. These molecular scissors or “cutting” enzymes are restriction
endonucleases.
[Can you figure out why they are called restriction endonucleases?]
Two common restriction endonucleases are EcoRI and PstI which will be provided to
you in this lab procedure. To better understand how EcoRI and PstI may help you in
performing your DNA fingerprinting test, first you must understand and visualize the nature
of the "cutting" effect of a restriction endonuclease on DNA :


AT G A AT T C T C A AT TA C C T
TA C T TA A G A G T TA AT G G A

The line through the base pairs represents the sites where bonds will break if a restriction
endonuclease recognizes the site GAATTC. The following analysis questions refer to how a
piece of DNA would be affected if a restriction endonuclease were to "cut" the DNA molecule
in the manner shown above.
1. How many pieces of DNA would result from this cut? ___________

2. Write the base sequence of both the left and right side DNA fragments.
Left: Right:

3. What differences are there in the two pieces?

21
4. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate
the size of the fragments [mention any discrepancy you may detect].
a) The smaller fragment is ___________ base pairs (bp).
b) What is the length of the longer fragment? ______________

5. Consider the two samples of DNA shown below - single strands are shown for simplicity:

Sample #1
CAGTGATCTCGAATTCGCTAGTAACGTT

Sample #2
TCATGAATTCCTGGAATCAGCAAATGCA

If both samples are treated with a restriction enzyme [recognition sequence GAATTC]
then indicate the number of fragments and the size of each fragment from each sample of
DNA.
Sample # 1 Sample # 2

# of fragments:________ # of fragments:_________

List fragment size in order: largest ——> smallest

Sample # 1 Sample # 2

22
Lesson 2 Restriction Digestion of DNA Samples

Laboratory Procedure
Upon careful observation, it is apparent that the only difference between the DNA of dif-
ferent individuals is the linear sequence of their base pairs. In the lab, your team will be given
6 DNA samples. Recall that your task is to determine if any of them came from the same
individual or if they came from different individuals.
Thus far your preliminary analysis has included the following:
• The similarities and differences between the DNA from different individuals.
• How restriction endonucleases cut [hydrolyze] DNA molecules.
• How adding the same restriction endonuclease to two samples of DNA might provide
some clues about differences in their linear base pair sequence.
Now that you have a fairly clear understanding of these three items you are ready to pro-
ceed to the first phase of the DNA fingerprinting procedure—performing a restriction digest
of your DNA samples.

✔) List
Your Workstation Check (✔
Make sure the materials listed below are present at your lab station prior to beginning the
Lab.

Student workstations (8) Number ✔)


(✔
Pipet tips 15 ❑
EcoRI/PstI enzyme mix (ENZ) 1 tube (80 µl) ❑
P-10 or P-20 micropipet 1 ❑
Color coded microtubes:
green, blue, orange, violet, red, yellow 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Ice bucket with ice 1 ❑

Instructors workstation
Crime Scene DNA 1 vial ❑
Suspect 1 DNA 1 vial ❑
Suspect 2 DNA 1 vial ❑
Suspect 3 DNA 1 vial ❑
Suspect 4 DNA 1 vial ❑
Suspect 5 DNA 1 vial ❑
Incubator or bath—(37 °C) 1/class ❑

23
Lesson 2 Laboratory

Digest the DNA Samples

1. Label reaction tubes.

A. Obtain one each of the the following colored microtubes. Label the 5 colored micro-
tubes as follows:
Green CS (crime scene)
Blue S1 (suspect 1)
Orange S2 (suspect 2)
Violet S3 (suspect 3)
Red S4 (suspect 4)
Yellow S5 (suspect 5)
Put your name and period number on the tubes! The restriction digests will take place in
these tubes. These tubes may now be kept in your rack.

CS S1 S2 S3 S4 S5

2. Locate the clear microtube that contains the restriction enzyme mix, labeled “ENZ”.
ENZ = Enzyme mix

ENZ

3. Obtain your DNA samples.


Using a fresh tip for each sample, transfer 10 µl of each DNA sample from the colored
stock tubes into each of the corresponding labeled colored tubes.

DNA

Stock DNA CS S1 S2 S3 S4 S5

24
Observations
1) Describe the samples of DNA (physical properties).

2) Is there any observable difference between the samples of DNA?

3) Describe the appearance of the restriction endonuclease mix.

4) Combine and react.


Using the micropipet, and a new pipet tip for each sample, transfer 10 µl of the enzyme
mix “ENZ” to each reaction tube as shown below.
Note: Change tips whenever you switch reagents, or, if the tip touches any of the liquid
in one of the tubes accidentally. When in doubt, change the tip! DNA goes in the tube
before the enzyme. Always add the enzyme last.

ENZ CS S1 S2 S3 S4 S5

25
Now your DNA samples should contain:

Total
DNA Samples EcoRI/PstI Reaction
(10 µl each) Enzyme Mix Volume
Crime Scene [CS] 10 µl 20 µl
Suspect 1 [S1] 10 µl 20 µl
Suspect 2 [S2] 10 µl 20 µl
Suspect 3 [S3] 10 µl 20 µl
Suspect 4 [S4] 10 µl 20 µl
Suspect 5 [S5] 10 µl 20 µl

5. Mix the contents.


Close the caps on all the tubes. Mix the components by gently flicking the tubes with
your finger. If there is a centrifuge available, pulse the tubes for two seconds to force the
liquid into the bottom of the tube to mix and combine reactants. (Be sure the tubes are in
a BALANCED arrangement in the rotor). If your lab is not equipped with a centrifuge,
briskly shake the tube (once is sufficient) like a thermometer. Tapping the tubes on the lab
bench will also help to combine and mix the contents.

CS S1 S2 S3 S4 S5 Flick Tap

6. Incubate the samples.


Place the tubes in the floating rack and incubate them at 37 °C for 45 minutes.
Alternatively, the tubes can be incubated in a large volume of water heated to 37 °C and
allowed to slowly reach room temperature overnight. After the incubation, store the DNA
digests in the refrigerator until the next lab period.

Water bath

26
Lesson 2 Restriction Digestion of DNA Samples

Review Questions
1. Before you incubated your samples, describe any visible signs of change in the contents
of the tubes containing the DNA after it was combined with the restriction enzymes.

2. Can you see any evidence to indicate that your samples of DNA were fragmented or
altered in any way by the addition of EcoRI/PstI? Explain.

3. In the absence of any visible evidence of change, is it still possible that the DNA samples
were fragmented? Explain your reasoning.

4. (Answer the next day)


After a 24 hour incubation period, are there any visible clues that the restriction enzymes
may have in some way changed the DNA in any of the tubes? Explain your reasoning.

27
Lesson 3 Electrophoresis and Staining of DNA Samples

Consideration 3 How can we detect the position of EcoRI and PstI restriction
sites on our DNA samples?
Since we are attempting to detect changes at the molecular level, and there are no visible
clues for us to analyze, this task might seem beyond our capabilities and impossible to do.
Let’s see if we can figure this out. One way to determine the location of restriction sites might
be to determine the following:
1) How many different sizes of DNA fragments are in each sample?

2) What are the relative sizes of each fragment?

Therefore, you must somehow get evidence to answer the following question: Do the
EcoRI and PstI restriction sites occur at the same locations in any of the DNA samples?
The following facts will be helpful to you in your attempt to determine the actual range
of DNA fragment sizes in your samples.

Restriction Digestion Analysis


The 3-dimensional structure of restriction enzymes allows them to attach themselves to
a double-stranded DNA molecule and slide along the helix until they recognize a specific
sequence of base pairs which signals the enzyme to stop sliding. The enzymes then digest
(chemically separate) the DNA molecule at that site—called a "restriction site"—acting like
molecular scissors, they cut DNA at a specific sequence of base pairs.
If a specific restriction site occurs in more than one location on a DNA molecule, a restric-
tion enzyme will make a cut at each of those sites resulting in multiple fragments. The length
of each fragment will depend upon the location of restriction sites contained within the DNA
molecule.
When restriction enzymes are used to cut a long strand of DNA, fragments of varying
sizes may be produced. The fragments can be separated and visualized using a process known
as agarose gel electrophoresis. The term electrophoresis means to carry with electricity.

Agarose Gel Electrophoresis


Electrophoresis separates DNA fragments according to their relative size. DNA frag-
ments are loaded into an agarose gel slab, which is placed into a chamber filled with a con-
ductive liquid buffer solution. A direct current is passed between wire electrodes at each end
of the chamber. DNA fragments are negatively charged, and when placed in an electric field
will be drawn toward the positive pole. The matrix of the agarose gel acts as a molecular
sieve through which smaller DNA fragments can move more easily than larger ones. Over a
period of time smaller fragments will travel farther than larger ones. Fragments of the same
size stay together and migrate in single "bands" of DNA.
An analogy: Equate this situation to your classroom in which all the desks and chairs
have been randomly scattered around the room. An individual student can wind his/her way
through the maze quickly and with little difficulty, whereas a string of four students holding
hands would require more time and have difficulty working their way through the maze of
chairs. Try it!

28
Lesson 3 Electrophoresis of DNA Samples

✔) List
Laboratory Check (✔
Student workstations Number/Station ✔)
(✔
Agarose gel 1 ❑
Digested DNA samples 5 ❑
DNA sample loading dye "LD" 1 ❑
Marking pen 1 ❑
Pipet tips 1 box ❑
P-10 or P-20 micropipet 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Gel box and power supply 1 ❑
Gel staining tray 1 ❑
HindIII DNA size markers "M" 1 ❑

Instructors workstation
1x TAE electrophoresis buffer 275 ml gel/box ❑
Bio-Safe DNA stain—1x solution 500 ml ❑

29
Lesson 3 Laboratory
Electrophoresis of DNA Samples
1. Obtain a prepoured agarose gel from your teacher, or if your teacher instructs you to do so,
prepare your own gel.
2. After preparing the gel, remove your digested samples from the refrigerator.
Using a new tip for each sample add 5 µl of sample loading dye "LD" to each tube:
DNA Samples Loading dye
Crime Scene [CS] 5 µl
Suspect 1 [S1] 5 µl
Suspect 2 [S2] 5 µl
Suspect 3 [S3] 5 µl
Suspect 4 [S4] 5 µl
Suspect 5 [S5] 5 µl

Loading Dye

CS S1 S2 S3 S4 S5 Flick Tap

LD

Close the caps on all the tubes. Mix the components by gently flicking the tubes with
your finger. If a centrifuge is available, pulse spin the tubes to bring the contents to the bot-
tom of the tube. Otherwise, tap the tubes upon a table top.
3. Place the casting tray with the solidified gel in it, into the platform in the gel box. The wells
should be at the (-) cathode end of the box, where the black lead is connected. Very
carefully, remove the comb from the gel by pulling it straight up.
4. Pour ~ 275 ml of electrophoresis buffer into the electrophoresis chamber. Pour buffer in
the gel box until it just covers the wells.

-
+

5. Locate your lambda HindIII DNA size marker in the tube labeled "M".
Gels are read from left to right. The first sample is loaded in the well at the left hand
corner of the gel.

30
6. Using a separate pipet tip for each sample, load your gel as follows:
Lane 1: HindIII DNA size marker, clear, 10 µl
Lane 2: CS, green, 20 µl
Lane 3: S1, blue, 20 µl
Lane 4: S2, orange, 20 µl
Lane 5: S3, violet, 20 µl
Lane 6: S4, red, 20 µl
Lane 7: S5, yellow, 20 µl

7. Secure the lid on the gel box. The lid will attach to the base in only one orientation: red
to red and black to black. Connect electrical leads to the power supply.
8. Turn on the power supply. Set it for 100 V and electrophorese the samples for 30–40
minutes.

-
+

While you are waiting for the gel to run, you may begin the review questions on the
following page.

9. When the electrophoresis is complete, turn off the power and remove the lid from the gel
box. Carefully remove the gel tray and the gel from the gel box. Be careful, the gel is
very slippery! Nudge the gel off the gel tray with your thumb and carefully slide it into
your plastic staining tray.

10. Pour 60 ml of Bio-Safe DNA stain into your plastic staining tray, cover with plastic wrap,
and let the gel stain overnight, shaking intermittently if no rocking platform is available.

31
Lesson 3 Electrophoresis of Your DNA Samples

Review Questions

1. The electrophoresis apparatus creates an electrical field with positive and negative poles
at the ends of the gel. DNA molecules are negatively charged. To which electrode pole
of the electrophoresis field would you expect DNA to migrate? (+ or -)? Explain.

2. What color represents the negative pole?

3. After DNA samples are loaded into the sample wells, they are “forced” to move through
the gel matrix. What size fragments (large vs. small) would you expect to move toward
the opposite end of the gel most quickly? Explain.

4. Which fragments (large vs. small) are expected to travel the shortest distance from the
well? Explain.

32
Lesson 4 Drying Gels and Analyzing the DNA Patterns

Consideration 5 Are any of the DNA samples from the suspects the same as
an individual at the crime scene?
Take a moment to think about how you will perform the analysis of your gel. In the final
two steps, you will:
A. Visualize DNA fragments in your gel.

B. Analyze the number and positions of visible DNA bands on your gel.

Making DNA Fragments Visible


Unaided visual examination of gels indicates only the positions of the loading dyes and
not the positions of the DNA fragments. DNA fragments are visualized by staining the gel with
a blue dye. The blue dye molecules have a high affinity for the DNA and strongly bind to the
DNA fragments, which makes them visible. These visible bands of DNA may then be traced,
photographed, sketched, or retained as a permanently dried gel for analysis.
The drawing below represents an example of a stained DNA gel after electrophoresis.
For fingerprinting analysis, the following information is important to remember:
• Each lane has a different sample of DNA

• Each DNA sample was treated with the same restriction endonucleases.

With reference to the numbered lanes, analyze the bands in the gel drawing below, then
answer the questions on the following page.

Lane 1 2 3 4 5 6

33
Lesson 4 Questions

1. What can you assume is contained within each band?

2. If this were a fingerprinting gel, how many samples of DNA can you assume were placed
in each separate well?

3. What would be a logical explanation as to why there is more than one band of DNA for
each of the samples?

4. What caused the DNA to become fragmented?

5. Which of the DNA samples have the same number of restriction sites for the restriction
endonucleases used? Write the lane numbers.

6. Which sample has the smallest DNA fragment?

7. Assuming a circular piece of DNA (plasmid) was used as starting material, how many
restriction sites were there in lane three?

8. Which DNA samples appear to have been "cut" into the same number and size of
fragments?

9. Based on your analysis of the gel, what is your conclusion about the DNA samples in the
photograph? Do any of the samples seem to be from the same source? If so, which ones?
Describe the evidence that supports your conclusion.

34
Lesson 4 Analyzing the DNA Patterns

Laboratory Procedure
Student Workstations Number ✔)
(✔
Water for destaining gels 60 ml ❑
Millimeter ruler 1 ❑
Linear graph paper 1 ❑
Semi-log graph paper 1 ❑

Instructor’s Workstation
None required

Gel Staining and Destaining Steps


1. Pour off the Bio-Safe DNA stain into a bottle or another appropriate container and destain
the gel with 60 ml of water for ~15 minutes.

2. Pour the water out of the staining tray. Ask the instructor how to properly dispose of the
stain.

3. Trim away any empty lanes of the gel with a knife or razorblade. Let the gel dry on the
hydrophilic side of a piece of gel support film or in your staining tray on your lab bench
for 3–5 days. When the gel is dry, tape it into your lab notebook for a permanent record.

35
Quantitative Analysis of DNA Fragment Sizes

If you were on trial, would you want to rely on a technician’s eyeball estimate of a match,
or would you want some more accurate measurement?
In order to make the most accurate comparison between the crime scene DNA and the sus-
pect DNA, other than just a visual match, a quantitative measurement of the fragment sizes
needs to be created. This is done below:

1. Using the ruler, measure the migration distance of each band. Measure the distance in
millimeters from the bottom of the loading well to each center of each DNA band and
record your numbers in the table on the next page. The data in the table will be used to con-
struct a standard curve and to estimate the sizes of the crime scene and suspect restriction
fragments.

2. To make an accurate estimate of the fragment sizes for either the crime scene or the sus-
pects, a standard curve is created using the distance (x-axis) and fragment size (y-axis) data
from the Lambda/HindIII size marker. Using both linear and semi-log graph paper, plot
distance versus size for bands 2–6. On each graph, use a ruler and draw a line joining the
points. Extend the line all the way to the right hand edge of the graph.
Which graph provides the straightest line that you could use to estimate the crime scene
or the suspects’ fragment sizes? Why do you think one graph is straighter than the other?

3. Decide which graph, linear or semi-log, should be used to estimate the DNA fragment
sizes of the crime scene and suspects. Justify your selection.

4. To estimate the size of an unknown crime scene or suspect fragment, find the distance that
fragment traveled. Locate that distance on the x-axis of your standard graph. From that
position on the x-axis, read up to the standard line, and then follow the graph line to over
to the y-axis. You might want to draw a light pencil mark from the x-axis up to the stan-
dard curve and over to the y-axis showing what you’ve done. Where the graph line meets
the y-axis, this is the approximate size of your unknown DNA fragment. Do this for all
crime scene and suspect fragments.

5. Compare the fragment sizes of the suspects and the crime scene.
Is there a suspect that matches the crime scene?

How sure are you that this is a match?

36
Lambda/HindIII Crime Scene Suspect 1 Suspect 2 Suspect 3 Suspect 4 Suspect 5
size marker
Band Distance Actual Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx.
(mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp)
1 23,130
2 9,416

37
3 6,557
4 4,361
5 2,322
6 2,027
38
39
Lesson 4 Analyzing the DNA Patterns

Interpretation of Results
Attach a photo, photocopy, or your actual dried gel in this space. Indicate which sample
is in each well.

1. What are we trying to determine? Restate the central question.

2. Which of your DNA samples were fragmented? What would your gel look like if the
DNA were not fragmented?

3. What caused the DNA to become fragmented?

4. What determines where a restriction endonuclease will "cut" a DNA molecule?

5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can
you assume is identical about the molecules at that location?

6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the
same location as the DNA from the crime scene?

7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the
same individual as the DNA from the crime scene? Describe the scientific evidence that
supports your conclusion.

40
Appendix A

Alternative DNA Fingerprinting Scenarios!


DNA typing, DNA profiling, and DNA fingerprinting are all names for the same pro-
cess, a process which uses DNA to show relatedness or identity of individual humans, plants,
or animals. DNA typing has become the subject of much debate and interest because of its uses
for forensics analysis in prominent criminal cases such as the O. J. Simpson case. The appli-
cations of DNA typing, however, are much broader than forensic science alone and are hav-
ing a profound impact on our society.
DNA typing is used in forensics, anthropology, and conservation biology not only to
determine the identity of individuals but also to determine relatedness. This process has been
used to free innocent suspects, reunite children with their relatives, identify stolen animals, and
prove that whale meat has been substituted for fish in sushi. It is used in times of war to help
identify the remains of soldiers killed in combat. It is also being used to find genetic linkages
to inherited diseases. In addition, scientists are learning a great deal about our evolutionary his-
tory from DNA analysis.
Each of the following paragraphs describes a scenario in which DNA has been used to
show how individuals are related to each other, or to show that a person is (or is not) the per-
petrator of a crime. These scenarios provide a context for using DNA typing for use in teach-
ing molecular biology, conservation biology, and biotechnology. Have your students research
a scenario that is interesting to them and present their findings to the class.
1. Food identification (endangered species identification).
The purity of ground beef (or impurity) has been proven using DNA typing. Hamburger
has been shown to often be a mixture of pork, and other non-beef meats. Using portable
testing equipment, authorities have used DNA typing to determine that the fish served in
sushi was really meat from whales and dolphins. These are, many times, endangered
species that are protected by international law.
2. Accused and convicted felons set free because of DNA typing.
A man imprisoned for 10 years was released when DNA testing, unavailable when he
was convicted, was used to show that he could not have been the rapist. Statistics show
that about one-third of all sexual assault suspects are freed as a result of DNA testing.
3. Identifying of human remains.
Scientists have used DNA typing to confirm that the body in the grave was (or was not)
the person that was supposed to be there. Bones found in Russia are believed to be those
of the Romanovs, Russia’s last imperial family. Czar Nicholas II and his family were
executed by the Bolsheviks in 1918. Experts from around the world have been studying
the bones to match skulls, teeth, and other features with photographs. DNA from the
bones will be compared to that of known descendants to determine whether the bones do
indeed belong to the Czar and his family.

41
4. Determining relatedness of humans.
DNA typing has shown that the 5000 year old Ice Man found in a melting glacier is most
closely related to modern Europeans. ("Iceman Gets Real." Science, Vol. 264:1669. June
17, 1994.) The DNA typing evidence also “removes all the suspicions that the body was
a fraud—that it had been placed on the ice” says Svante Paabo of the University of
Munich. (Science, Vol. 264:1775. June 17, 1994).
5. Studying relatedness among ancient peoples.
DNA found at archeological sites in western Montana is being used to help determine
how many related groups of people (families) lived at a particular site. (Morell, Virginia.
"Pulling Hair from the Ground." Science, Vol. 265:741-745 August 1994.)
6. DNA testing of families.
DNA testing of families has been used in Argentina and El Salvador to identify the chil-
dren of at least 9,000 citizens of these countries who disappeared between 1975 and 1983,
abducted by special units of the ruling military and police. Many of the children born to
the disappeared adults were kidnapped and adopted by military "parents" who claimed to
be their biological parents. After genetic testing of the extended family revealed the true
identity of a child, the child was placed in the home of its biological relatives. It was
feared that transferring a child from its military "parents" who were kidnappers, but who
had reared the child for years, would be agonizing. In practice, the transferred children
became integrated into their biological families with minimal trauma.
7. Identifying organisms that cause disease.
Eva Harris, a UCSF scientist, is helping scientists in Nicaragua and Ecuador to learn to
use DNA technology to detect tuberculosis, and identify the dengue virus and various
strains of Leishmania. Other available tests cause waits of many weeks while disease
organisms are cultured and sent to foreign labs to be identified. (Marcia Barinaga, "A
Personal Technology Transfer Effort in DNA Diagnostics." Science, 266:1317-1318.
Nov. 25, 1994.)
8. Identifying birth parents (paternity testing).
Girls in Florida were discovered to have been switched at birth when one girl died of a
hereditary disease. The disease was not in her family, but was known to be in the family
of another girl, born in the same hospital and about the same time she was born.
9. Proving paternity.
A woman, raped by her employer on Jan. 7, 1943, her 18th birthday, became pregnant.
The child knew who her father was, but as long as he lived, he refused to admit being
her father. After the man died, DNA testing proved that she was his daughter and she
was granted a half of his estate. ("A Child of Rape Wins Award from Estate of Her
Father." New York Times, July 10, 1994.)

42
10. Determining effectiveness of bone marrow transplants.
"DNA fingerprinting can help doctors to monitor bone marrow transplants. Leukemia is
a cancer of the bone marrow and the diseased marrow must be removed. The bone mar-
row makes new blood cells, so the leukemia sufferer will die without a transplant of
healthy marrow. Doctors can quickly tell whether the transplant has succeeded by DNA
typing of the patient and the donor. If the transplant has worked, a fingerprint from the
patient’s blood shows the donor’s bands. But if the cancerous bone marrow has not been
properly destroyed, then the cancerous cells multiply rapidly and the patient’s own bands
predominate." ("Our Ultimate Identity Card in Sickness and in Health," in "Inside
Science", New Scientist, Nov. 16, 1991.)
11. Proving relatedness of immigrants.
DNA fingerprinting has been used as proof of paternity for immigration purposes. In
1986, Britain’s Home Office received 12,000 immigration applications from the wives and
children of Bangladeshi and Pakistani men residing in the United Kingdom. The burden
of proof is on the applicant, but establishing the family identity can be difficult because
of sketchy documentary evidence. Blood tests can also be inconclusive, but DNA fin-
gerprinting results are accepted as proof of paternity by the Home Office. (DNA finger-
prints, source unknown: Based on A. J. Jeffreys, et al., "Positive Identification of an
Immigration Test-Case Using Human DNA Fingerprints." Nature, 317:818-819, 1985.)
12. Confirming relatedness among animals.
Scientists who extracted DNA from the hair of chimpanzees throughout Africa now have
evidence that there might be a third species of chimpanzee. At the same time they have
learned things about chimp behavior and kinship patterns that would have once taken
years to theorize. They discovered a group of chimps living in western Africa to be genet-
ically distinct from the chimps living in other parts of Africa, suggesting that the group
may be an endangered species. The have discovered that male chimps living in a given
area are often as closely related as half-brothers, and many so-called sub-species may all
be part of a single species. The male chimps’ relatedness may explain why, unlike other
primates, the males are quite friendly to each other.
13. DNA testing of plant material puts murderer at the scene.
Two small seed pods caught in the bed of his pick-up truck put an accused murderer at the
murder scene. Genetic testing showed that DNA in the seed pod exactly matched the
DNA of a plant found at the scene of the murder. The accused had admitted he had given
the victim a ride, but he denied ever having been near the crime scene.

43
Appendix B
Prelab Activity 1 A Review of Restriction Enzymes
DNA consists of a series of nitrogen base molecules held together by weak hydrogen
bonds. These base pairs are in turn bonded to a sugar and phosphate backbone. The four dif-
ferent nitrogen bases are adenine, thymine, guanine and cytosine. (A, T, G, and C:
Remember the base-paring rule is A-T and G-C). Refer to Figure 1 to review the structure of
a DNA molecule.

Fig. 1. The Structure of DNA

If a segment of DNA is diagrammed without the sugars and phosphates, the base-pair
sequence might appear as:
Read to the right----> A C T C C G T A G A A T T C....>
<....T G A G G C A T C T T A A G <----Read to the left
Look at the linear sequence of bases (As, Ts, etc.) on each of the strands:
• Describe any pattern you might see in the upper sequence of bases.

• Compare the bases in the upper portion of the molecule to those in the lower portion.
Describe any relationship you can see.

• Now look at the upper sequence of bases and compare it to the lower. Do you notice any
grouping of bases that when read to the right and read to the left are exactly the same
order?

44
You may have discovered that the base sequence seems to be arranged randomly and that
the two strands seem to complement each other; As are paired with Ts, etc. You may have also
noticed that a portion of the top strand GAATTC (read to the right) has a counterpart in the
lower strand CTTAAG (read to the left). Similar sequences are AAGCTT and TTCGAA;
and CTGCAG and GACGTC. These sequences, called palindromes, are quite common along
the DNA molecule.
A major “enemy” of bacteria are viruses called bacteriophages, such as lambda. These
viruses infect bacteria by injecting their own DNA into bacteria in an attempt to take over
the operations of the bacterial cell. Bacteria have responded by evolving a natural defense
(called restriction enzymes) to cut up and destroy the invading DNA. These enzymes search
the viral DNA looking for certain palindromes (GAATTCs, for example) and cut up the DNA
into pieces at these sites. The actual place in the palindrome where the DNA is cut is called
a restriction site.
Look at the DNA sequence below:

Palindrome

G T A G A AT T C A T T C A C G C A
C A T C T TA A G T A A G T G C G T

Restriction site

GTAG ATTCATTCACGCA
CATCTTAA GTAAGTGCGT

Fragment 1 Fragment 2

A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome.
• How many base pairs are there to the left of the "cut"?

• How many base pairs are there to the right of the "cut"?

• Counting the number of base pairs, is the right fragment the same size as the left fragment?

• How could you describe fragment size in reference to the number of base pairs in the
fragment?

45
An important fact to learn about restriction enzymes is that each one only recognizes a spe-
cific palindrome and cuts the DNA only at that specific sequence of bases. A palindrome can
be repeated a number of times on a strand of DNA, and the specific restriction enzymes will
cut all those palindromes at their restriction sites.
The table below shows three kinds of palindromes that may be present in a strand of DNA
along with the specific enzyme that recognizes the sequence.

Name of enzyme that


Palindrome on the DNA molecule recognizes the palindrome
GAATTC EcoRI
AAGCTT HindIII

If the GAATTC palindrome is repeated four times on the same piece of DNA, and the
restriction enzyme that recognizes that base sequence is present.
• How many DNA fragments will be produced?

• If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then
what can you say about the size of the fragments that will be produced?

46
Let’s summarize what we learned so far.

• The base sequence in one strand of DNA can have a palindrome in the other strand.
(GAATTC and CTTAAG).
• Palindromes can be detected by restriction enzymes.
• Restriction enzymes cut the palindromes at restriction sites.
• A restriction enzyme only recognizes one specific kind of palindrome.
• Cutting DNA at restriction sites will produce DNA fragments.
• Fragment sizes can be described by the number of base pairs they contain.

Applying what you have learned.

• If a linear DNA molecule had the restriction sites A and B for a specific palindrome, how
many fragments would be produced?

• Number each fragment.

• Which fragment would be the largest?

• Which fragment would be the smallest?

47
• Draw a DNA molecule that has 5 randomly spaced restriction sites for a specific palin-
drome. How many fragments would be produced if they were each cut by a restriction
enzyme?

• Label each fragment.

• Rank them in order of size from largest to smallest.

In this diagram, A and B are different palindrome sequences on a DNA strand. Only the
restriction enzyme that recognizes site B is present.

• Explain why only two fragments would be produced.

48
Prelab activity 2 Review of Electrophoresis

How can one see the DNA fragments?

Agarose gel electrophoresis is a procedure that can be used to separate DNA fragments.
DNA is a molecule that contains many negative electrical charges. Scientists have used this
fact to design a method that can be used to separate pieces of DNA. A liquid solution con-
taining a mixture of DNA fragments is placed in a small well formed into the gel. (The gel
looks like Jello™ dessert). Electricity causes the molecules to move. Opposite electrical
charges attract each other; negative (-) charges move towards the positive (+) charge.
Imagine the gel as a "strainer" with tiny pores that allow small particles to move through it very
quickly. The larger the size of the particles, however, the slower they are "strained" through
the gel. After a period of exposure to electricity, the fragments will sort themselves out by size.
Fragments that are the same size will tend to move together through the gel. The group
will tend to form concentrations, called bands, of pieces that are all the same size.

A linear piece of DNA is cut into 4 fragments as


shown in the diagram. A solution of the 4 fragments
is placed in a well in an agarose gel. Using the infor-
mation given above, draw (to the right) how you
think the fragments might separate themselves.
Label each fragment with its corresponding letter.

• Have your teacher check your diagram before you proceed.

• Where would the larger fragments—those with the greater number of base pairs—be
located; toward the top of the gel or the bottom? Why?

49
• Suppose you had 500 pieces of each of the four fragments, how would the gel appear?

• If it were possible to weigh each of the fragments, which one would be the heaviest?
Why?

• Complete this rule for the movement of DNA fragments through an agarose gel:

The larger the DNA fragment, the ...

This diagram represents a piece of DNA cut with HindIII at each of the restriction sites
pointed to by the arrows. The numbers represent the number of base pairs in each fragment.

2,027 23,130 6,557 9,416 4,361 2,322

Well
• How many fragments Negative
were produced by the
restriction enzyme HindIII?
On the gel diagram at the
right, show how you believe
these fragments will sort out
during electrophoresis.
Positive Agarose gel
• Label each fragment with
its correct number of
base pairs.

50
Appendix C
Teacher’s Answer Guide

Lesson 1 Introduction to DNA Fingerprinting


1. Compare the "backbone" of sugar-phosphate arrangement in the side chains of all three
figures. Are there any differences?

The arrangement is identical for all three samples.


2. In the above figure, do all three samples contain the same bases? Describe your obser-
vations.

All samples contain the same bases: adenine, thymine, guanine and cytosine.
3. Are the bases paired in an identical manner in all three samples? Describe the pattern of
the base pair bonding.

The adenine is always bonded with thymine and the cytosine is always bond-
ed with the guanine.
4. In your attempt to analyze DNA samples from three different individuals, what conclu-
sions can you make about the similarities and differences of the DNA samples?

The sugar phosphate arrangement is the same for all samples and so are the
kind of bases; what is different is the arrangement of bases among the three
samples.
5. What will you need to compare between these DNA samples to determine if they are
identical or nonidentical?

The sequence of base pairs in each individual sample.

51
Lesson 2 Restriction Digests of DNA Samples

1. How many pieces of DNA would result from this cut ? 2


2. Write the sequence of the DNA fragments.
ATG AATTCTCAATTACCT
TACTTAA GAGTTAATGGA

3. What differences are there in the two pieces?


Each fragment is a different size.
4. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate
the size of the fragments [mention any discrepancy you may detect].
One fragment is short and one is long; also some bases are unpaired.
a) The smaller fragment is 3 base pairs (bp).
b) What is the length of the longer fragment ? 11

Consider the two samples of DNA shown below [single strands are shown for simplicity]:
Sample #1: CAGTGATCTCGAATTCGCTAGTAACGTT

Sample #2: TCATGAATTCCTGGAATCAGCAAATGCA


If both samples are treated with a restriction enzyme [recognition sequence GAATTC]
then indicate the number of fragments and the size of each fragment from each sample of
DNA.
Sample # 1 Sample # 2

# of fragments: 2 # of fragments: 2

List fragment size in ascending order: largest ——> smallest

Sample # 1 Sample # 2
17 bp fragment 23 bp fragment
11 bp fragment 5 bp fragment

52
Lesson 2 Restriction Digestion of DNA Samples
Observation Questions:
1. Describe the samples of DNA (physical properties).
The DNA samples are clear, colorless liquid samples.

2. Is there any observable difference between the samples of DNA?


No. All samples appear similar.

3. Describe the appearance of the restriction endonuclease mix.


The restriction enzymes appear to be clear, colorless liquids.

53
Lesson 2 Restriction Digestion of DNA Samples
Review Questions:
1. Before you incubated your samples, describe any visible signs of change in the contents
of the tubes containing the DNA combined with the restriction enzymes.
DNA + EcoRI/PstI enzyme mix:
No visible change apparent in the tubes.

2. Can you see any evidence to indicate that your samples of DNA were fragmented or
altered in any way by the addition of EcoRI/PstI? Explain.
No. No visible change apparent in the tubes.

3. In the absence of visible evidence of change, is it still possible that the DNA samples
were fragmented? Explain your reasoning.

Yes. They may be chemically changed but the changes may not be visible. Enzymes
may have cut the DNA.

4. After a 24 hour incubation period, are there any visible clues that the restriction enzymes
may have in some way changed the DNA in any of the tubes? Explain your reasoning.

No. No visible change apparent in the tubes but the enzymes may have cut the
DNA. The reactions are at the molecular level and too small to be seen.

54
Lesson 3 Electrophoresis of your DNA samples
Review Questions:

1. The electrophoresis apparatus creates an electrical field [positive and negative ends of
the gel]. DNA molecules are negatively charged. To which pole of the electrophoresis
field would you expect DNA to migrate (+ or -)? Explain.
Positive.

2. What color represents the negative pole?


Black.

3. After DNA samples are loaded in wells, they are "forced" to move through the gel matrix.
Which size fragment (large vs small) would you expect to move toward the opposite end
of the gel most quickly? Explain.
Smaller. There is less resistance to their movement through the gel matrix.

4. Which fragments are expected to travel the shortest distance [remain closest to the well]?
Explain.
Larger. There is more resistance to their movement through the gel matrix.

55
Lesson 4 Thought Questions

1. What can you assume is contained within each band?


DNA fragments.

2. If this were a fingerprinting gel, then how many kinds (samples) of DNA can you assume
were placed in each separate well?
One.

3. What would be a logical explanation as to why there is more than one band of DNA for
each of the samples?
The DNA must have been cut into fragments by restriction enzymes.

4. What probably caused the DNA to become fragmented?


The chemical action of the restriction enzymes cutting at specific base sequences.

5. Which of the DNA samples have the same number of restriction sites for the restriction
endonuclease used? Write the lane numbers.
Lanes 2, 3, and 4 (CS, S1, and S2).

6. Which sample has the smallest DNA fragment?


The sample in lane 5 (S3).

7. How many restriction sites were there in lane three?


Two sites that cut the sample into two fragments.

8. Which DNA samples appear to have been "cut" into the same number and size of frag-
ments?
Lanes 2 and 4 (CS and S2).

9. Based on your analysis of the photograph, what is your conclusion about the DNA sam-
ples in the photograph? Do any of the samples seem to be from the same source. If so
which ones? Describe the evidence that supports your conclusion.
The DNA samples in lanes 2 and 4 (CS and S2) are from the same individual because
they have identical restrictions sites that yield identical fragments.

56
Lambda/HindIII Crime Scene Suspect 1 Suspect 2 Suspect 3 Suspect 4 Suspect 5***
size marker
Band Distance Actual Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx.
(mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp)
1 11.0 23,130 19.0 3,679 21.0 2,860** 21.0 2,860** 19.0 3,679 21.0 2,860** 21.0 2,860**
2 13.0 9,416 20.5 2,860** 23.5 1,199 25.0 1,700 20.5 2,860** 29.5 1,093 24.0 1,986
3 15.0 6,557 32.0 828 30.5 941 28.5 1,159 32.0 828 29.5 1,093
4 18.0 4,361*

57
5 23.0 2,322
6 24.0 2,027
*This fragment may appear faint if the markers were not heated to 65 ºC. Lamba HindIII digestion also generates bands of 564 and 125 bp that are usually too faint to see on a gel.
**The measured migration distance for these bands varies depending upon the thickness of the bands. See Appendix D to understand why the bands are so intense in S4 and S5.
***S4 and S5 DNA lanes may also contain a very faint band of 500 bp.
DNA Standard Band Migration

To estimate the size of any unknown crime scene or suspect fragment, you first need to
determine the distances the specific fragment travelled. Locate the distance on the X-axis of
your standard graph. For example, Suspect 5, Band 2 migrated 24 mm (A). From the 24 mm
mark on the X-axis, read up to the standard line; when you intersect your standard curve,
mark the spot with a shaded circle (B). Follow the intersect point over to the Y-axis and deter-
mine where the graph line meets the Y-axis this is the approximate size of the fragment (C).
Suspect 5, Band 2 is approximately 2000 bp. Repeat this procedure for the Crime Scene and
all Suspects fragments. As you determine the approximate the approximate fragment sizes,
fill the data into the data table.

58
59
Lesson 4 Analyzing DNA Patterns
Review Questions:

1. What are we trying to determine? Re-state the central question.


We are trying to determine if samples of DNA that we were provided with are from
the same individual or from different individuals.

2. Which of your DNA samples were fragmented? What would your gel look like if the
DNA were not fragmented?
The number of fragmented samples will vary. They will have one band on the gel if
the DNA was not cut.

3. What caused the DNA to become fragmented?


The addition of restriction enzymes.

4. What determines where a restriction endonuclease will "cut" a DNA molecule?


A special sequence of bases on the DNA called restriction sites.

5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can
you assume is identical about the molecules at that location?
The restriction sites are identical.

6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the
same location as the DNA from the crime scene?
The samples in lanes 2 and 5 match (CS and S3).

7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the
same individual as the DNA from the crime scene? Describe the scientific evidence that
supports your conclusion.
The CS and S3 samples appear to be identical. They both produce similar banding
patterns on the gel.

60
Prelab Activity 1 (from Appendix B)

Look at the linear sequence of bases (As, Ts, etc.) on each of the strands:
• Describe any pattern you might see in the upper sequence of bases.
There is no specific type of pattern associated with the upper sequence of bases.

• Compare the bases in the upper portion of the molecule to those in the lower portion.
Describe any relationship you can see:
A always pairs with T; G always pairs with C.

• Now look at the upper sequence of bases and compare it to the lower. Do you notice any
grouping of bases that when read to the right and read to the left are exactly the same
order?
GAATTC.
A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome.
• How many base pairs are there to the left of the "cut"?
4

• How many base pairs are there to the right of the "cut"?
10

• Counting the number of base pairs, is the right fragment the same size as the left fragment?
No, it is larger.

• How could you describe the fragment size in reference to the number of base pairs in the
fragment.
Fragment 1 is a 4 base pair fragment.
Fragment 2 is a 10 base pair fragment.
If the GAATTC palindrome is repeated four times on the same piece of DNA, and the
restriction enzyme that recognizes that base sequence is present.
• How many DNA fragments will be produced?
5
• If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then
what can you say about the size of the fragments that will be produced?
Random sized fragments will be produced.

61
• If a DNA molecule had the restriction sites A and B for a specific palindrome, how many
fragments would be produced?
3

• Number each fragment.

• Which fragment would be the largest?


Fragment 3.
• Which fragment would be the smallest?
Fragment 2.
• Draw a DNA molecule that has 5 randomly spaced restriction sites for a specific palin-
drome, how many fragments would be produced if they were each cut by a restriction
enzyme?
Answers will vary.
• Label each fragment
Answers will vary.
• Rank them in order of size from largest to smallest.
Answers will vary.

In this diagram. A and B are different palindrome sequences on a DNA strand. Only the
restriction enzyme that recognizes site B is present.

• Explain why only two fragments would be produced.


The enzyme would cut at site B, producing 2 DNA fragments.

62
Prelab Activity 2 Review of Electrophoresis
A piece of DNA is cut into 4 fragments as
shown in the diagram. A solution of the 4
fragments is placed in a well in an agarose
gel. Using the information given above,
draw (to the right) how you think the frag-
ments might be separated. Label each frag-
ment with its corresponding letter.

• Have your teacher check your diagram before you proceed.


• Where would the larger fragments — those with the greater number of base pairs — be
located; towards the top of the gel or the bottom? Why?
The large fragments would be toward the top of the gel because it is more difficult
for the larger pieces to strain through the gel.
• Suppose you had 500 pieces of each of the four fragments, how would the gel appear?
There would still be only 4 bands present.
• If it were possible to weigh each of the fragments, which one would be the heaviest?
Why?
Fragment D would be heaviest because it is the largest piece of DNA and would thus
have the greatest mass.
• Complete this rule for the movement of DNA fragments through an agarose gel:
The larger the DNA fragment, the slower it migrates through an agarose gel.

63
This diagram represents a piece of DNA cut with HindIII at each of
the restrictions sites pointed to by the arrows. The numbers
represent the number of base pairs in each fragment.

2,027 23,130 6,557 9,416 4,361 2,322

• How many fragments were pro-


duced by the restriction enzyme
HindIII?
6
On the gel diagram at the right, show how
you believe these fragments will sort out
during electrophoresis.
• Label each fragment with its correct
number of base pairs.

64
Appendix D: Plasmid DNA and Restriction Enzymes

The Crime Scene and Suspect DNA samples in this kit do not contain human DNA but
consist of plasmid DNA isolated from bacteria. Plasmids are small, circular pieces of DNA
that can replicate inside bacterial cells. In nature, bacteria evolved plasmids containing genes
that enabled them to survive antibiotics produced by other microorganisms in the environ-
ment. This antibiotic resistance gave the bacteria with plasmids a selective advantage over
their competitors. Bacteria were able to pass the beneficial plasmid DNA to other bacteria
via conjugation.
Scientists have taken advantage of plasmid DNA because its small size makes it easy to
purify, and it can be reintroduced into bacterial cells using a procedure called transformation.
Scientists have also benefited from another natural, bacterial defense mechanism: the restric-
tion enzyme. Bacteria evolved enzymes to destroy DNA from invading viruses, or bacterio-
phages, when they inject their DNA. Restriction enzymes recognize specific DNA sequences
within the phage DNA and then cut, or restrict, the DNA at that site. The fragmented phage
DNA can no longer pose a threat to bacterial survival. Once purified in the laboratory, these
restriction endonucleases (nuclease = enzyme that cuts, endo = within, nucleic acids) are
named for the bacteria from which they were isolated. For example, EcoRI was isolated from
Escherichia coli. Purified restriction enzymes can then be used in the laboratory to cut DNA
isolated from any source at completely predictable sites.
After plasmids are cut with a restriction enzyme, they can be joined to foreign DNA,
from any source, that has been cut with the same enzyme. The resulting hybrid DNA can
then be transformed into bacterial cells. The hybrid plasmids can perpetuate themselves in
bacteria just as before, except that the foreign DNA that was joined to them is also being per-
petuated. Every hydrid plasmid now contains a perfect copy of the piece of foreign DNA
joined to it. We say that the foreign piece of DNA has been cloned, and the plasmid DNA that
carried it is called a vector.
The Crime Scene and Suspect DNA samples in this kit were created by joining PstI-
digested bacteriophage lambda DNA with PstI-digested plasmid vector pTZ18U. Recombinant
plasmids were selected that gave distinct, striking banding patterns, or restriction fragment
length polymorphisms (RFLPs again!), when digested with the restriction enzymes PstI and
EcoRI and analyzed on an agarose gel.
Complete restriction maps of each of the Crime Scene and Suspect plasmids, the parent
vector pTZ18U, and the donor lambda phage are included for further classroom discussion and
exploration. Try this: predict the number of base pairs in the S4 and S5 plasmids, based on your
gel results. How do these sizes compare with the number of base pairs indicated on the S4 and
S5 plasmid maps? How can you explain the discrepancy? How could you get a more accu-
rate estimate of the plasmid sizes using restriction analysis and agarose electrophoresis? (Hint:
perhaps other restriction enzymes would generate different banding patterns on the gel.)
Which enzymes would you choose?

65
Plasmid Maps

Suspect 1 DNA Sample

Suspect 2 DNA Sample

66
Crime Scene/Suspect 3 DNA Sample

Suspect 4 DNA Sample

67
Suspect 5 DNA Sample

68
Plasmid Parent Vector

69
Bio-Rad
Laboratories

Life Science Website www.bio-rad.com Bio-Rad Laboratories Main Office 2000 Alfred Nobel Drive, Hercules, CA 94547, Ph. (510) 741-1000, Fx. (510)741-5800
Group Also in: Australia Ph. 02 9914 2800, Fx. 02 9914 2889 Austria Ph. (01) 877 89 01, Fx. (01) 876 56 29 Belgium Ph. 09-385 55 11, Fx. 09-385 65 54
Canada Ph. (905) 712-2771, Fx. (905) 712-2990 China Ph. 86-10-62051850/51, Fx. 86-10-62051876 Denmark Ph. 45 39 17 99 47, Fx. 45 39 27 16 98
Finland Ph. 358 (0)9 804 2200, Fx. 358 (0)9 804 1100 France Ph. 01 43 90 46 90, Fx. 01 46 71 24 67 Germany Ph. 089 318 84-0, Fx. 089 318 84-100
Hong Kong Ph. 852-2789-3300, Fx. 852-2789-1257 India Ph. (91-11) 461-0103, Fx. (91-11) 461-0765 Israel Ph. 03 951 4127, Fx. 03 951 4129
Italy Ph. 39-02-216091, Fx.39-02-21609-399 Japan Ph. 03-5811-6270, Fx. 03-5811-6272 Korea Ph. 82-2-3473-4460, Fx. 82-2-3472-7003
Latin America Ph. 305-894-5950, Fx. 305-894-5960 Mexico Ph. 514-2210, Fx. 514-2209 The Netherlands Ph. 0318-540666, Fx. 0318-542216
New Zealand Ph. 64-9-4152280, Fx. 64-9-4152284 Norway Ph. 22-74-18-70, Fx. 22-74-18-71 Russia Ph. 7 095 979 98 00, Fx. 7 095 979 98 56
Singapore Ph. 65-2729877, Fx. 65-2734835 Spain Ph. 34-91-661-7085, Fx. 34-91-661-9698 Sweden Ph. 46 (0)8-55 51 27 00, Fx. 46 (0)8-55 51 27 80
Switzerland Ph. 01-809 55 55, Fx. 01-809 55 00 United Kingdom Ph. 0800-181134, Fx. 01442-259118

Bulletin 0000 US/EG Rev A 00-000 0099 Sig 031799

4006096 Rev E

You might also like