E
E
Instruction Manual
Catalog Number
166-0007-EDU
www.explorer.bio-rad.com
For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723)
Can DNA evidence solve human problems?
DNA fingerprinting is now used routinely to solve crimes. In recent years, news stories have
reported how miniscule amounts of DNA have been used to identify individuals involved in
incidents even many years in the past, as well as exonerate innocent people from incrimina-
tion.
The power of DNA as a tool for individual identification captures students’ imaginations.
This activity provides in-depth instruction about how restriction enzymes cleave DNA, how
electrophoresis is used to separate and visualize DNA fragments, and how these techniques
can be combined to obtain a DNA fingerprint. Principles of restriction analysis, plasmid map-
ping and DNA fragment size determination can also be documented with this kit.
Open the door to rich discussions about scientific, ethical, and legal implications of DNA
profiling. DNA fingerprinting is used in medical and forensic procedures, as well as in pater-
nity determinations to discern genetic relationships between individuals at the molecular level.
This kit allows students to play the role of a forensic scientist and make a positive ID. That
is, to simulate using real DNA as evidence and figure out for themselves: “Who done it?”
In this activity, students analyze six different samples of plasmid DNA. One sample collect-
ed from a hypothetical “crime scene” and five samples obtained from “suspects” are digest-
ed with two restriction enzymes. The resulting DNA fragments are separated and visualized
in agarose gels using Bio-Rad’s Bio-Safe DNA staining solution. Based on the restriction
fragment patterns, students compare the evidence and match one of the suspects’ DNA to the
sample collected at the crime scene.
As an alternative to the classical human forensic applications for this kit, have your students
imagine they are high tech pathologists investigating an outbreak of an aggressive infectious
disease that has never been seen before. The Centers for Disease Control and Prevention sus-
pects that a new strain of bacteria has arisen that not only is the cause of the new disease, but
also has acquired multiple resistance plasmids from some other bacterial strains. Their job is
to develop a DNA diagnostic tool for identifying the culprit plasmids. They decide to use
restriction enzyme analysis and “DNA electrophoresis fingerprinting” to identify and distin-
guish different suspect plasmids and track their spread through the environment. DNA from
the cultures of a number of stricken patients has been isolated. Have your students identify the
new killer bug before the pathogen gets out into the general population and starts a true epi-
demic!
We strive to continually improve our Biotechnology Explorer kits and curricula. Please share
your stories, comments and suggestions!
Ron Mardigian
Dr. Patti Taranto
Bio-Rad Laboratories
[email protected]
[email protected]
1-800-424-6723
DNA Fingerprinting Curriculum
Intended Audience
This investigation is intended to be used by any high school or college student, indepen-
dent of the degree of prior familiarity with the chemistry of nucleic acids.
Teaching Strategies
This curriculum is designed to simulate human forensic testing but can also be used to
simulate a wide range of applications for genetic analysis. The actual scenario employed is up
to the discretion of the instructor. (Refer to alternative scenarios in Appendix A).
The analysis sections of this investigation are intended to guide students through the
process of discovering and understanding concepts that are of significance to the procedures
and the analysis of the data at each step along the way. It is hoped that this approach (as com-
pared to the teacher giving the students all of the background information) will make the
entire investigation more comprehensible to a greater number of students. So long as the
teacher has the opportunity to check on the progress and levels of understanding of each
group, some degree of self pacing is possible, if so desired. We have found that this approach
allows a larger number of the diverse population of students we work with to experience the
goals that have been identified above.
1
Table of Contents
Teacher’s Guide Page
Kit Inventory Check List Kit Components and Required Accessories ....................3
Background For Teacher Setting the Stage for Your Students..................................4
Implementation Timeline Advance Preparation and Student Lessons ......................8
Workstation Check List Student and Instructor Lab Setups ....................................9
Advance Preparation Lab Prep and Lesson Highlights ....................................11
Quick Guide Graphic Laboratory Protocol ..........................................16
Student Manual
Lesson 1 Introduction to DNA Fingerprinting ..............................19
Lesson 2 Restriction Digests of DNA Samples ............................21
Lesson 3 Electrophoresis and Staining of DNA Samples..............28
Lesson 4 Analyzing the DNA Patterns and Drying Gels ..............33
Appendices
Appendix A Alternative DNA Fingerprinting Scenarios....................41
Appendix B Prelab Activities ..............................................................44
Review of Restriction Enzymes ..............................44
Review of Electrophoresis ......................................49
Appendix C Teacher’s Answer Guide ................................................51
Appendix D Plasmid DNA and Restriction Enzymes ........................65
2
✔) List
Kit Inventory: Check (✔
3
Background Information for the Instructor
Introduction
Technicians working in forensic labs are often asked to do DNA profiling or “finger-
printing” to analyze evidence in law enforcement cases and other applications.1 DNA
fingerprinting may involve polymerase chain reaction (PCR2 ) amplification to analyze minute quan
ties of DNA or restriction fragment length polymorphism (RFLP3) analysis, if large amounts of DNA a
recovered. A step in human RFLP analysis requires the student to compare band patterns produced b
cleavage of DNA samples when separated on an agarose gel. The patterns in this exercise are produce
from one sample that represents DNA taken at the crime scene and five samples obtained from suspec
in the case. It may be important for you to point out to your students that this laboratory exercise mode
the more elaborate technique that is performed on complex human DNA samples.
Restriction Enzymes
Restriction enzymes sit on a DNA molecule and slide along the helix until they recognize
specific sequences of base pairs that signals the enzyme to stop sliding. The enzymes then
digest (chemically separate) the DNA molecule at that site—called a "restriction site"—act-
ing like molecular scissors, cutting DNA at a specific sequence of base pairs.
If a specific restriction site occurs in more than one location on a DNA molecule, a restric-
tion enzyme will make a cut at each of those sites, resulting in multiple fragments. Therefore,
if a given linear piece of DNA is cut with a restriction enzyme whose specific recognition
code is found at two different locations on the DNA molecule, the result will be three
fragments of different lengths. If the given piece of DNA is circular and is cut with a restric-
tion enzyme whose specific recognition code is found at two different locations on the DNA
molecule, the result will be two fragments of different lengths. The length of each fragment
will depend upon the location of restriction sites on the DNA molecule.
When restriction enzymes are used to cut strands of circular plasmid DNA, such as the
samples included in this kit, fragments of varying sizes are produced. DNA that has been cut
with restriction enzymes can be separated and observed using a process known as agarose gel
electrophoresis. The term electrophoresis means to carry with electricity.
4
DNA Fingerprinting
Each person has similarities and differences in DNA sequences. To show that a piece of
DNA contains a specific nucleotide sequence, a radioactive complementary DNA probe can
be made that will recognize and bind that sequence. Radioactive probes allow molecular biol-
ogists to locate, identify, and compare the DNA of different individuals. This probe can be
described as a "radioactive tag" that will bind to a single stranded DNA fragment and produce
a band in a gel or a band on a piece of nylon blotting membrane that is a replica of the gel (also
known as a Southern blot). Because of its specificity, the radioactive probe can be used to
demonstrate genotypic similarities between individuals. In DNA fingerprinting, the relative
positions of radiolabeled bands in a gel are determined by the size of the DNA fragments in
each band. The size of the fragments reflect variations in individuals’ DNA.
We are rapidly getting beyond the scope and intention of this manual. For more detailed
information, we recommend a review of the references listed on page 7.
The evidence needed for DNA fingerprinting can be obtained from any biological
material that contains DNA: body tissues, body fluids (blood and semen), hair follicles, etc.
The DNA analysis can even be done from dried material, such as blood stains or mummified
tissue. If a sample of DNA is too small it may be amplified using PCR techniques. The DNA
is then treated with restriction enzymes that cut the DNA into fragments of various length.4
✄
G A AT T C
For the enzyme: EcoRI C T TA A G
✄
✄
For the enzyme: PstI CTGCAG
GACGTC
✄
Like all enzymes, restriction enzymes function best under specific buffer and
temperature conditions. The proper restriction enzyme buffer has been included with the DNA
sample, so that when the rehydrated DNA and enzymes are mixed, the ideal conditions are
created for the enzymes to function optimally. The final reaction buffer consists of 50 mM Tris,
100 mM NaCl, 10 mM MgCl2, 1 mM DDT, pH 8.0, which is the ideal condition for EcoRI
and PstI enzymes to function.
5
Visualizing DNA Restriction Fragments
DNA is colorless so DNA fragments in the gel can’t be seen during electrophoresis. A blue
loading buffer, containing two blue loading dyes, is added to the DNA solution. The loading
dyes do not stain the DNA but make it easier to load the gels and monitor the progress of the
DNA electrophoresis. The dye fronts migrate toward the positive end of the gel, just like the
DNA fragments. The “faster” dye co-migrates with DNA fragments of approximately 500
bp, while the “slower” dye co-migrates with DNA fragments approximately 5 kb in size.
Staining the DNA pinpoints its location on the gel. When the gel is immersed in a dilute
solution of Bio-Safe DNA stain, the dye molecules attach to the DNA molecules trapped in
the agarose gel. To enhance contrast and to easily visualize the DNA bands, excess back-
ground stain can be removed from the gel by destaining the gel with water. When the bands
are visible, your students can compare the DNA restriction patterns of the different samples
of DNA.
The gel below shows the DNA pattern that will be obtained by your students following
electrophoresis. The DNA from the crime scene has been labeled CS, that from Suspect #1,
S1 and so on. The DNA from the crime scene is placed in lane 2; one suspect’s DNA is placed
in each of lanes 3, 4, 5, 6 and 7. Lane 1 contains HindIII DNA size markers. By convention,
the lanes are numbered from the top left. The students’ task is to look at the DNA banding pat-
terns and see if any of the suspects’ bands match those of the DNA found at the crime scene.
M CS S1 S2 S3 S4 S5
1 2 3 4 5 6 7 8
It’s easy to see that the DNA taken from the crime scene and the DNA from S3 is
identical. You may want to point out how "strong or weak" this evidence is in convicting a
suspect. The DNA evidence may place the suspect at the scene, but other evidence may be
needed to prove him or her guilty!5,6
You may point out to your students that this is a simulation. In actual DNA fingerprint-
ing, technicians analyze much larger segments of DNA and many more bands and lanes are
produced. These technicians are looking for a specific DNA segment, common to a given
population, that will produce a unique banding pattern for each individual.
6
Reliability of DNA Evidence
Two major factors affecting the reliability of DNA fingerprinting technology in forensics
are population genetics and genetic statistics. In humans there are thousands of RFLP loci or
DNA segments that can be selected and used for fingerprinting analysis. Depending on demo-
graphic factors such as ethnicity or geographic isolation, some segments will show more vari-
ation than others.
Some populations show much less variation in particular DNA segments than others. The
degree of variation will affect the statistical odds of more than one individual having the same
sequence. If 90% of a given population has the same frequency in its DNA fingerprinting
pattern for a certain DNA segment, then very little information will be attained. But if the
frequency of a DNA pattern turning up in a population for a particular segment is extremely
low, then this segment can serve as a powerful tool to discriminate between individuals in
that population. Different populations show different patterns in their genotypes due to the
contributions made to their individual gene pools over time.
Therefore, in analyzing how incriminating the DNA evidence is, one needs to ask the
question:
“Statistically how many people in a population may have the same pattern as that taken
from a crime scene: 1 in 1,000,000? 1 in 10,000? Or, 1 in 10?”
References
1. DNA Profiling Fast Becoming Accepted Tool For Identification, Pamela Zurer, Chemical and
Engineering News, Oct. 10, 1994.
2. PCR means polymerase chain reaction; it is a technique used to amplify small amounts of DNA (in
this case so that further analysis of the DNA can occur).
3. RFLP means restriction fragment length polymorphisms..."riff-lips" in biotech jargon...Pieces of
DNA are cut with restriction enzymes into fragments of various lengths. Individuals possess
variable restriction recognition sites so that two pieces of DNA from separate sources may have
different fragment lengths when their DNA is cut by the same enzyme.
4. An excellent resource for the classroom teacher is Genetic Fingerprinting, Pauline Lowrie and
Susan Wells, New Scientist, 16 November 1991.
5. Is DNA Fingerprinting ready for the courts?, William C. Thompson and Simon Ford, New Scientist,
March 31, 1990.
6. When Science Takes the Witness Stand, Peter Neufeld and Nevelle Coleman, Scientific American,
Vol. 262: 5, May 1990.
7
Implementation Timeline
There are five student lessons in this fingerprinting curriculum. All lessons are designed
to be carried out in consecutive 50 minute periods. All lessons include:
• A series of prelab considerations for students
• An active student investigation
• Questions for analysis and interpretation of lab results
Student Schedule
Lesson 1: Introduction to DNA Fingerprinting
Activity Lecture and discussion
Prelab Considerations 1 and 2
Lesson 2: Restriction Digest of DNA Samples
Activity Pour gels; perform the restriction digests
Complete preliminary analysis and review questions
Lesson 3: Electrophoresis of DNA Samples
Activity Load and run gels; stain gels overnight
Do analysis and review questions
Lesson 4: Analysis and Interpretation of Results
Activity Destain gels
Do analysis questions
Generate standard curve
Discuss results and weigh evidence
Prepare Bio-Safe
DNA stain Prior to Lesson 2 10 minutes
8
Workstation Check (✔) List
Student Workstations: Materials and supplies that should be present at each student work-
station prior to beginning each lab experiment are listed below. The components provided in
this kit are sufficient for 8 student workstations.
Instructor’s (Common) Workstation: A list of materials, supplies, and equipment that
should be present at a common location that can be accessed by all student groups is also
listed below. It is up to the discretion of the teacher as to whether students should access
common buffer solutions/equipment, or whether the teacher should aliquot solutions and
operate equipment.
Instructor’s Workstation
Crime Scene DNA with buffer, rehydrated 1 vial ❑
Suspect 1 DNA with buffer, rehydrated 1 vial ❑
Suspect 2 DNA with buffer, rehydrated 1 vial ❑
Suspect 3 DNA with buffer, rehydrated 1 vial ❑
Suspect 4 DNA with buffer, rehydrated 1 vial ❑
Suspect 5 DNA with buffer, rehydrated 1 vial ❑
Incubator or bath - (37 °C) 1/class ❑
Molten agarose (See Advance Prep) 35–40 ml/gel ❑
Gel trays 1/station ❑
Lab tape for gel trays 1/station ❑
9
Lesson 3 Electrophoresis of DNA Samples
Student Workstations Number/Station ✔)
(✔
Agarose gel 1 ❑
Digested DNA samples 5 ❑
DNA sample loading dye 1 ❑
Marking pen 1 ❑
Pipet tips 1 box ❑
P-10 or P-20 micropipet 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Gel box and power supply 1 ❑
Gel staining tray 1 ❑
Instructor’s Workstation
1x TAE Electrophoresis buffer 275 ml gel/box ❑
Bio-Safe DNA stain - 1x solution 500 ml ❑
HindIII DNA markers 1 ❑
Instructor’s Workstation
None required
10
Instructor’s Advanced Preparation for Labs
This section describes the preparation that needs to be performed by the instructor before
each laboratory. An estimation of preparation time is included in each section.
Procedures
1. Rehydrate samples:
Note: All of the DNA and enzyme vials should contain a white residue, which may appear
as a loose powder in the DNA vials. The lyophilized DNA samples have color-coded
labels on clear glass vials. The lyophilized EcoRI/PstI enzyme mix is in an amber vial.
A. To rehydrate DNA/buffer samples, add 200 µl of sterile water to each lyophilized
DNA vial and swirl to resuspend. Allow DNA/buffer samples to rehydrate at room tem-
perature for 5 minutes or until dissolved. Gentle heating at 37 °C for 10 minutes may be
necessary. You may choose to transfer the rehydrated DNA/buffer samples to color-
coded, labeled 1.5 ml microtubes to make pipetting easier for your students.
The rehydrated DNA samples are now at a concentration of 0.3 µg/µl in 100 mM
Tris, 200 mM NaCl, 20 mM MgCl2, 2 mM DTT, pH 8.0. Once the DNA in buffer is
added to the enzyme, the final concentration of buffer will be 50 mM Tris, 100 mM NaCl,
10 mM MgCl2, 1 mM DTT, pH 8.0, which is the ideal condition for EcoRI and PstI
enzymes to function.
B. To rehydrate EcoRI/PstI enzyme mix, add 750 µl sterile water and swirl to resus-
pend the enzymes. Allow enzymes to rehydrate on ice for 5 minutes. It is critical that the
enzyme mix is kept on ice, but not frozen, once it has been rehydrated. The rehydrated
enzymes should be used within 12 hours.
2. Aliquot enzyme mix: Transfer 80 µl of the rehydrated enzyme mix into each of eight,
1.5 ml microtubes labeled ENZ.
11
3. Prepare electrophoresis buffer. TAE (Tris, acetate, EDTA) electrophoresis buffer is avail-
able as a 50x concentrated solution. In addition to the 1x TAE buffer needed to make the
agarose gels, approximately 275 ml is also required for each electrophoresis chamber.
Three liters of 1x TAE buffer will be sufficient to run 8 electrophoresis chambers and
pour 8 agarose gels. To make 3 liters of 1x TAE from a 50x TAE concentrate add 60 ml
of 50x concentrate to 2.94 liters of distilled water.
4. Prepare agarose. These procedures may be carried out 1 to 2 days ahead of time by the
teacher or done during class by the individual student teams.
A. The recommended gel concentration for this classroom application is 1% agarose.
This concentration of agarose provides excellent resolution and minimizes run time
required for electrophoretic separation of DNA fragments. To make a 1%
solution, add 1 gram of agarose to 100 ml of 1x TAE electrophoresis buffer. The
agarose must be made using electrophoresis buffer, not water.
If gel boxes are limiting, you can use a 7 x 10 cm tray and two 8-well combs to pour a gel
that can be used to run two sets of student digests.
Use this table as a guide for gel volume requirements when casting single or multiple
gels.
Volume of 1% agarose for:
Number of gels 7 x 7 cm tray 7 x 10 cm tray
1 40 ml 50 ml
2 80 100
4 160 200
8 320 400
B. Add the agarose powder to a suitable container (e.g. 500-ml Erlenmeyer flask for
200 ml or less). Add the appropriate amount of 1x TAE electrophoresis buffer and
swirl to suspend the agarose powder in the buffer. If using an Erlenmeyer flask,
invert a 25-ml Erlenmeyer flask into the open end of the 500 ml Erlenmeyer flask
containing the agarose. The small flask acts as a reflux chamber, thus allowing long
or vigorous boiling without much evaporation. The agarose can be melted for gel
casting by boiling until agarose has melted completely on a magnetic hot plate, hot
water bath, or in a microwave oven.
Caution: Always wear protective gloves, goggles, and lab coat while preparing and casting
agarose gels. Boiling molten agarose or the vessels containing hot agarose can cause severe
burns if allowed to contact skin.
Microwave Oven Method. This technique is the fastest and safest way to dissolve agarose.
Place the gel solution in an appropriate bottle or flask into the microwave. LOOSEN THE CAP
IF YOU ARE USING A BOTTLE. Use a medium setting and set to 3 minutes. Stop the
microwave oven every 30 seconds and swirl the flask to suspend any undissolved agarose. Boil
and swirl the solution until all of the small translucent agarose particles are dissolved. Set
aside to cool to 55-60 °C before pouring.
Magnetic Hot Plate Method. Add a stir bar to the undissolved agarose solution. Heat the
solution to boiling while stirring on a magnetic hot plate. Bubbles or foam should disrupt
before rising to the neck of the flask.
Boil the solution until all of the small translucent agarose particles are dissolved. Set aside to
cool to 55-60 °C before pouring gels.
12
If you choose, you can melt the agarose several hours in advance and keep it in a waterbath
at 55-60 °C until you or your students are ready to pour the gels.
5. Pour agarose gels. This lab activity requires that each gel has at least 8 sample loading
wells. Follow the above instructions to prepare the agarose and determine what volume
of 1% agarose will be needed. Pour enough agarose to cover the gel comb teeth or to a
depth of 0.5–0.75 cm. Do not move or handle the gel tray until the gel has solidified.
When solidified, gels can be stored in sealable bags at room temperature or in the refrig-
erator until use on the next day. Have students label their plastic bags. The time needed
to pour gels by an entire class is approximately 30 minutes. If possible, pour one or two
extra gels for back-up.
6. Restriction Digests. A 45 minute incubation at 37 °C is the optimum digestion condi-
tion. If a 37 °C heating block, water bath, or incubator is not available, samples can be
digested by placing tubes in foam racks, floating them in a large volume (1 liter or more)
of 37 °C water, and allowing them to incubate overnight as the water cools to room tem-
perature.
Procedure for casting gels
Using Bio-Rad’s Mini Sub-Cell® GT system, gels can be cast directly in the gel box by
using the casting gates with the gel tray.
This section outlines the conventional tape-the-tray method for casting gels. Other meth-
ods are detailed in Bio-Rad's Sub-Cell GT instruction manual.
Step 1. Seal the ends of the gel tray securely with strips of standard laboratory tape. Press
the tape firmly to the edges of the gel tray to form a fluid-tight seal.
Step 2. Level the gel tray on a leveling table or workbench using the leveling bubble pro-
vided with the instrument.
Step 3. Prepare the desired concentration and amount of agarose in 1x TAE electrophore-
sis buffer.
Step 5. While the agarose is cooling to 60 °C, place the comb into the appropriate slot of the
gel tray. Gel combs should be placed within 3/4 of an inch of the end of the gel
casting tray (not in the middle of the gel).
Step 6. Allow the gel to solidify at room temperature for 10 to 20 minutes—it will appear
cloudy, or opaque, when ready to use.
Step 8. Remove the tape from the edges of the gel tray.
Step 9. Place the tray onto the leveled DNA electrophoresis cell so that the sample wells are
at the cathode (black) end of the base. DNA samples will migrate towards the anode
(red) end of the base during electrophoresis.
To pour a double gel using the 7 x 10 cm tray and two 8-well combs, place one comb at
one end of the tray and the other comb in the middle of the tray.
13
Lesson 3 (Lab) Electrophoresis and Staining of DNA Samples
Advance Preparation
Objective: Aliquot DNA sample loading dye
Prepare Lambda HindIII size markers
Prepare 1x Bio-Safe DNA staining solution
Set up student and instructor workstations
Time required: Twenty minutes
What’s required: Stock solution: DNA sample loading dye
Stock solution: Bio-Safe DNA staining solution
Stock solution: DNA size marker (Lambda HindIII digest)
1. Aliquot loading dye.
A. Label 8 clear microtubes "LD" for Loading Dye. Aliquot 35 µl of loading dye into
8 clear microtubes that are labeled "LD". Distribute to student workstations.
B. Add 20 µl of loading dye to the stock tube containing the HindIII DNA Size Markers.
If possible, heat the markers to 65 °C for 5 minutes, then chill on ice—this results in
better separation of the marker bands. Label clear microtubes "M". Aliquot 15 µl of
the DNA markers containing loading dye to the 8 clear microtubes labeled “M”.
Distribute to student workstations.
2. Prepare Bio-Safe DNA staining solution.
Dilute the 1 ml volume of 500x DNA stain in 499 ml of distilled water in an appropriate
sized flask. Cover the flask and store at room temperature until ready to use.
3. Electrophoresis of samples.
Suggested running time is 30 minutes. If your laboratory schedule allows, increasing run-
ning time to 40 minutes will enhance the resolution.
14
Lesson 4 Drying Gels and Analyzing the DNA Patterns
Advance Preparation
Objective: Set up workstations
Time required: 10 minutes
Procedures: There are no reagents to make or aliquot for this laboratory.
To obtain a permanent record of the gel, before it is dried, either trace the gel outline,
including wells and DNA bands on a piece of paper or acetate, or take a photograph using
standard cameras and film (Bio-Rad's standard Polaroid gel documentation system).
Dry the Agarose Gel as a Permanent Record of the Experiment
Note: Drying agarose gels requires the use Bio-Rad’s specially formulated high strength
analytical grade agarose. Other gel media may not be appropriate for this purpose. There
are two methods that can be used to dry destained agarose gels.
Method 1
Method 1 is the preferred method and requires the use of Bio-Rad's exclusive gel support
film (catalog number 170-2984-EDU). Simply remove the destained agarose gel from its
staining tray and trim away any unloaded lanes with a knife or razorblade. Place the gel direct-
ly upon the hydrophilic side of a piece of gel support film. Water will form beads on the
hydrophobic side but will spread flat on the hydrophilic side of the film. Center the gel on the
film. Place the film on a sheet of paper towel and dry, avoiding direct exposure to light. As
the gel dries it will bond to the film and will not shrink. If left undisturbed on the support
film, the gel will dry completely at room temperature after 2–3 days. The result will be a flat, trans-
parent and durable record of the experiment.
Method 2
After staining and destaining the gel, leave the gel in the plastic staining tray. Let it air dry
for 2–3 days. As the gel dries it will shrink considerably, but proportionately. If left undisturbed
in the tray, the gel should remain relatively flat but may wrinkle as it dries.
Method 1 Method 2
Note: Avoid extended exposure of dried gels to direct light to prevent band fading.
Graphing the Data
Many of your students may not be familiar with logarithms and semi-log graph paper. It
is suggested that you prepare a short lesson presented on the overhead or computer to demon-
strate the proper way to label coordinates and plot points. You may choose to include a les-
son on the different uses of semi-log vs. standard graph paper in this instance. A math
extension implemented here may provide a perfect opportunity to explore linear and expo-
nential (arithmetic and geometric) sequences of numbers. We have included both semi-log and
standard graph paper on pages 38 and 39 of this manual.
15
Quick Guide for DNA Fingerprinting Kit
Stock CS S1 S2 S3 S4 S5
16
Day 2 Gel Electrophoresis
1. Remove your digested DNA samples from the
refrigerator. If a centrifuge is available, pulse
spin the tubes in the centrifuge to bring all of the
liquid into the bottom of the tube. Centrifuge
Student Manual
Contents Page
18
Lesson 1 Introduction to DNA Fingerprinting
You are about to perform a procedure known as DNA fingerprinting. The data obtained
may allow you to determine if the samples of DNA that you will be provided with are from
the same individual or from different individuals. For this experiment it is necessary to review
the structure of DNA molecules.
The schematics above represent a very small section of DNA from three different
individuals. In this representation of DNA the symbol system is as follows:
Side Chains
S = Five carbon SUGAR molecule known as deoxyribose
P = PHOSPHATE molecule composed of a phosphorous and oxygen atoms
DNA Nucleotide Bases:
A = adenine C = cytosine G = guanine T = thymine
Analysis of the three DNA samples above (see next page) might help us detect similari-
ties and differences in samples of DNA from different people.
19
Lesson 1 Introduction to DNA Fingerprinting
1. Compare the “backbone” of the sugar-phosphate arrangement in the side chains of all
three figures. Are there any differences?
2. In the above figure, do all three samples contain the same bases? Describe your obser-
vations.
3. Are the bases paired in an identical manner in all three samples? Describe the pattern of
the base pair bonding.
4. In your attempt to analyze DNA samples from three different individuals, what conclu-
sions can you make about the similarities and differences of the DNA samples?
5. What will you need to compare between these DNA samples to determine if they are
identical or non-identical?
20
Lesson 2 Restriction Digests of DNA Samples
✄
AT G A AT T C T C A AT TA C C T
TA C T TA A G A G T TA AT G G A
✄
The line through the base pairs represents the sites where bonds will break if a restriction
endonuclease recognizes the site GAATTC. The following analysis questions refer to how a
piece of DNA would be affected if a restriction endonuclease were to "cut" the DNA molecule
in the manner shown above.
1. How many pieces of DNA would result from this cut? ___________
2. Write the base sequence of both the left and right side DNA fragments.
Left: Right:
21
4. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate
the size of the fragments [mention any discrepancy you may detect].
a) The smaller fragment is ___________ base pairs (bp).
b) What is the length of the longer fragment? ______________
5. Consider the two samples of DNA shown below - single strands are shown for simplicity:
Sample #1
CAGTGATCTCGAATTCGCTAGTAACGTT
Sample #2
TCATGAATTCCTGGAATCAGCAAATGCA
If both samples are treated with a restriction enzyme [recognition sequence GAATTC]
then indicate the number of fragments and the size of each fragment from each sample of
DNA.
Sample # 1 Sample # 2
# of fragments:________ # of fragments:_________
Sample # 1 Sample # 2
22
Lesson 2 Restriction Digestion of DNA Samples
Laboratory Procedure
Upon careful observation, it is apparent that the only difference between the DNA of dif-
ferent individuals is the linear sequence of their base pairs. In the lab, your team will be given
6 DNA samples. Recall that your task is to determine if any of them came from the same
individual or if they came from different individuals.
Thus far your preliminary analysis has included the following:
• The similarities and differences between the DNA from different individuals.
• How restriction endonucleases cut [hydrolyze] DNA molecules.
• How adding the same restriction endonuclease to two samples of DNA might provide
some clues about differences in their linear base pair sequence.
Now that you have a fairly clear understanding of these three items you are ready to pro-
ceed to the first phase of the DNA fingerprinting procedure—performing a restriction digest
of your DNA samples.
✔) List
Your Workstation Check (✔
Make sure the materials listed below are present at your lab station prior to beginning the
Lab.
Instructors workstation
Crime Scene DNA 1 vial ❑
Suspect 1 DNA 1 vial ❑
Suspect 2 DNA 1 vial ❑
Suspect 3 DNA 1 vial ❑
Suspect 4 DNA 1 vial ❑
Suspect 5 DNA 1 vial ❑
Incubator or bath—(37 °C) 1/class ❑
23
Lesson 2 Laboratory
A. Obtain one each of the the following colored microtubes. Label the 5 colored micro-
tubes as follows:
Green CS (crime scene)
Blue S1 (suspect 1)
Orange S2 (suspect 2)
Violet S3 (suspect 3)
Red S4 (suspect 4)
Yellow S5 (suspect 5)
Put your name and period number on the tubes! The restriction digests will take place in
these tubes. These tubes may now be kept in your rack.
CS S1 S2 S3 S4 S5
2. Locate the clear microtube that contains the restriction enzyme mix, labeled “ENZ”.
ENZ = Enzyme mix
ENZ
DNA
Stock DNA CS S1 S2 S3 S4 S5
24
Observations
1) Describe the samples of DNA (physical properties).
ENZ CS S1 S2 S3 S4 S5
25
Now your DNA samples should contain:
Total
DNA Samples EcoRI/PstI Reaction
(10 µl each) Enzyme Mix Volume
Crime Scene [CS] 10 µl 20 µl
Suspect 1 [S1] 10 µl 20 µl
Suspect 2 [S2] 10 µl 20 µl
Suspect 3 [S3] 10 µl 20 µl
Suspect 4 [S4] 10 µl 20 µl
Suspect 5 [S5] 10 µl 20 µl
CS S1 S2 S3 S4 S5 Flick Tap
Water bath
26
Lesson 2 Restriction Digestion of DNA Samples
Review Questions
1. Before you incubated your samples, describe any visible signs of change in the contents
of the tubes containing the DNA after it was combined with the restriction enzymes.
2. Can you see any evidence to indicate that your samples of DNA were fragmented or
altered in any way by the addition of EcoRI/PstI? Explain.
3. In the absence of any visible evidence of change, is it still possible that the DNA samples
were fragmented? Explain your reasoning.
27
Lesson 3 Electrophoresis and Staining of DNA Samples
Consideration 3 How can we detect the position of EcoRI and PstI restriction
sites on our DNA samples?
Since we are attempting to detect changes at the molecular level, and there are no visible
clues for us to analyze, this task might seem beyond our capabilities and impossible to do.
Let’s see if we can figure this out. One way to determine the location of restriction sites might
be to determine the following:
1) How many different sizes of DNA fragments are in each sample?
Therefore, you must somehow get evidence to answer the following question: Do the
EcoRI and PstI restriction sites occur at the same locations in any of the DNA samples?
The following facts will be helpful to you in your attempt to determine the actual range
of DNA fragment sizes in your samples.
28
Lesson 3 Electrophoresis of DNA Samples
✔) List
Laboratory Check (✔
Student workstations Number/Station ✔)
(✔
Agarose gel 1 ❑
Digested DNA samples 5 ❑
DNA sample loading dye "LD" 1 ❑
Marking pen 1 ❑
Pipet tips 1 box ❑
P-10 or P-20 micropipet 1 ❑
Lab marker 1 ❑
Waste container 1 ❑
Styrofoam microtube rack 1 ❑
Gel box and power supply 1 ❑
Gel staining tray 1 ❑
HindIII DNA size markers "M" 1 ❑
Instructors workstation
1x TAE electrophoresis buffer 275 ml gel/box ❑
Bio-Safe DNA stain—1x solution 500 ml ❑
29
Lesson 3 Laboratory
Electrophoresis of DNA Samples
1. Obtain a prepoured agarose gel from your teacher, or if your teacher instructs you to do so,
prepare your own gel.
2. After preparing the gel, remove your digested samples from the refrigerator.
Using a new tip for each sample add 5 µl of sample loading dye "LD" to each tube:
DNA Samples Loading dye
Crime Scene [CS] 5 µl
Suspect 1 [S1] 5 µl
Suspect 2 [S2] 5 µl
Suspect 3 [S3] 5 µl
Suspect 4 [S4] 5 µl
Suspect 5 [S5] 5 µl
Loading Dye
CS S1 S2 S3 S4 S5 Flick Tap
LD
Close the caps on all the tubes. Mix the components by gently flicking the tubes with
your finger. If a centrifuge is available, pulse spin the tubes to bring the contents to the bot-
tom of the tube. Otherwise, tap the tubes upon a table top.
3. Place the casting tray with the solidified gel in it, into the platform in the gel box. The wells
should be at the (-) cathode end of the box, where the black lead is connected. Very
carefully, remove the comb from the gel by pulling it straight up.
4. Pour ~ 275 ml of electrophoresis buffer into the electrophoresis chamber. Pour buffer in
the gel box until it just covers the wells.
-
+
5. Locate your lambda HindIII DNA size marker in the tube labeled "M".
Gels are read from left to right. The first sample is loaded in the well at the left hand
corner of the gel.
30
6. Using a separate pipet tip for each sample, load your gel as follows:
Lane 1: HindIII DNA size marker, clear, 10 µl
Lane 2: CS, green, 20 µl
Lane 3: S1, blue, 20 µl
Lane 4: S2, orange, 20 µl
Lane 5: S3, violet, 20 µl
Lane 6: S4, red, 20 µl
Lane 7: S5, yellow, 20 µl
7. Secure the lid on the gel box. The lid will attach to the base in only one orientation: red
to red and black to black. Connect electrical leads to the power supply.
8. Turn on the power supply. Set it for 100 V and electrophorese the samples for 30–40
minutes.
-
+
While you are waiting for the gel to run, you may begin the review questions on the
following page.
9. When the electrophoresis is complete, turn off the power and remove the lid from the gel
box. Carefully remove the gel tray and the gel from the gel box. Be careful, the gel is
very slippery! Nudge the gel off the gel tray with your thumb and carefully slide it into
your plastic staining tray.
10. Pour 60 ml of Bio-Safe DNA stain into your plastic staining tray, cover with plastic wrap,
and let the gel stain overnight, shaking intermittently if no rocking platform is available.
31
Lesson 3 Electrophoresis of Your DNA Samples
Review Questions
1. The electrophoresis apparatus creates an electrical field with positive and negative poles
at the ends of the gel. DNA molecules are negatively charged. To which electrode pole
of the electrophoresis field would you expect DNA to migrate? (+ or -)? Explain.
3. After DNA samples are loaded into the sample wells, they are “forced” to move through
the gel matrix. What size fragments (large vs. small) would you expect to move toward
the opposite end of the gel most quickly? Explain.
4. Which fragments (large vs. small) are expected to travel the shortest distance from the
well? Explain.
32
Lesson 4 Drying Gels and Analyzing the DNA Patterns
Consideration 5 Are any of the DNA samples from the suspects the same as
an individual at the crime scene?
Take a moment to think about how you will perform the analysis of your gel. In the final
two steps, you will:
A. Visualize DNA fragments in your gel.
B. Analyze the number and positions of visible DNA bands on your gel.
• Each DNA sample was treated with the same restriction endonucleases.
With reference to the numbered lanes, analyze the bands in the gel drawing below, then
answer the questions on the following page.
Lane 1 2 3 4 5 6
33
Lesson 4 Questions
2. If this were a fingerprinting gel, how many samples of DNA can you assume were placed
in each separate well?
3. What would be a logical explanation as to why there is more than one band of DNA for
each of the samples?
5. Which of the DNA samples have the same number of restriction sites for the restriction
endonucleases used? Write the lane numbers.
7. Assuming a circular piece of DNA (plasmid) was used as starting material, how many
restriction sites were there in lane three?
8. Which DNA samples appear to have been "cut" into the same number and size of
fragments?
9. Based on your analysis of the gel, what is your conclusion about the DNA samples in the
photograph? Do any of the samples seem to be from the same source? If so, which ones?
Describe the evidence that supports your conclusion.
34
Lesson 4 Analyzing the DNA Patterns
Laboratory Procedure
Student Workstations Number ✔)
(✔
Water for destaining gels 60 ml ❑
Millimeter ruler 1 ❑
Linear graph paper 1 ❑
Semi-log graph paper 1 ❑
Instructor’s Workstation
None required
2. Pour the water out of the staining tray. Ask the instructor how to properly dispose of the
stain.
3. Trim away any empty lanes of the gel with a knife or razorblade. Let the gel dry on the
hydrophilic side of a piece of gel support film or in your staining tray on your lab bench
for 3–5 days. When the gel is dry, tape it into your lab notebook for a permanent record.
35
Quantitative Analysis of DNA Fragment Sizes
If you were on trial, would you want to rely on a technician’s eyeball estimate of a match,
or would you want some more accurate measurement?
In order to make the most accurate comparison between the crime scene DNA and the sus-
pect DNA, other than just a visual match, a quantitative measurement of the fragment sizes
needs to be created. This is done below:
1. Using the ruler, measure the migration distance of each band. Measure the distance in
millimeters from the bottom of the loading well to each center of each DNA band and
record your numbers in the table on the next page. The data in the table will be used to con-
struct a standard curve and to estimate the sizes of the crime scene and suspect restriction
fragments.
2. To make an accurate estimate of the fragment sizes for either the crime scene or the sus-
pects, a standard curve is created using the distance (x-axis) and fragment size (y-axis) data
from the Lambda/HindIII size marker. Using both linear and semi-log graph paper, plot
distance versus size for bands 2–6. On each graph, use a ruler and draw a line joining the
points. Extend the line all the way to the right hand edge of the graph.
Which graph provides the straightest line that you could use to estimate the crime scene
or the suspects’ fragment sizes? Why do you think one graph is straighter than the other?
3. Decide which graph, linear or semi-log, should be used to estimate the DNA fragment
sizes of the crime scene and suspects. Justify your selection.
4. To estimate the size of an unknown crime scene or suspect fragment, find the distance that
fragment traveled. Locate that distance on the x-axis of your standard graph. From that
position on the x-axis, read up to the standard line, and then follow the graph line to over
to the y-axis. You might want to draw a light pencil mark from the x-axis up to the stan-
dard curve and over to the y-axis showing what you’ve done. Where the graph line meets
the y-axis, this is the approximate size of your unknown DNA fragment. Do this for all
crime scene and suspect fragments.
5. Compare the fragment sizes of the suspects and the crime scene.
Is there a suspect that matches the crime scene?
36
Lambda/HindIII Crime Scene Suspect 1 Suspect 2 Suspect 3 Suspect 4 Suspect 5
size marker
Band Distance Actual Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx.
(mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp)
1 23,130
2 9,416
37
3 6,557
4 4,361
5 2,322
6 2,027
38
39
Lesson 4 Analyzing the DNA Patterns
Interpretation of Results
Attach a photo, photocopy, or your actual dried gel in this space. Indicate which sample
is in each well.
2. Which of your DNA samples were fragmented? What would your gel look like if the
DNA were not fragmented?
5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can
you assume is identical about the molecules at that location?
6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the
same location as the DNA from the crime scene?
7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the
same individual as the DNA from the crime scene? Describe the scientific evidence that
supports your conclusion.
40
Appendix A
41
4. Determining relatedness of humans.
DNA typing has shown that the 5000 year old Ice Man found in a melting glacier is most
closely related to modern Europeans. ("Iceman Gets Real." Science, Vol. 264:1669. June
17, 1994.) The DNA typing evidence also “removes all the suspicions that the body was
a fraud—that it had been placed on the ice” says Svante Paabo of the University of
Munich. (Science, Vol. 264:1775. June 17, 1994).
5. Studying relatedness among ancient peoples.
DNA found at archeological sites in western Montana is being used to help determine
how many related groups of people (families) lived at a particular site. (Morell, Virginia.
"Pulling Hair from the Ground." Science, Vol. 265:741-745 August 1994.)
6. DNA testing of families.
DNA testing of families has been used in Argentina and El Salvador to identify the chil-
dren of at least 9,000 citizens of these countries who disappeared between 1975 and 1983,
abducted by special units of the ruling military and police. Many of the children born to
the disappeared adults were kidnapped and adopted by military "parents" who claimed to
be their biological parents. After genetic testing of the extended family revealed the true
identity of a child, the child was placed in the home of its biological relatives. It was
feared that transferring a child from its military "parents" who were kidnappers, but who
had reared the child for years, would be agonizing. In practice, the transferred children
became integrated into their biological families with minimal trauma.
7. Identifying organisms that cause disease.
Eva Harris, a UCSF scientist, is helping scientists in Nicaragua and Ecuador to learn to
use DNA technology to detect tuberculosis, and identify the dengue virus and various
strains of Leishmania. Other available tests cause waits of many weeks while disease
organisms are cultured and sent to foreign labs to be identified. (Marcia Barinaga, "A
Personal Technology Transfer Effort in DNA Diagnostics." Science, 266:1317-1318.
Nov. 25, 1994.)
8. Identifying birth parents (paternity testing).
Girls in Florida were discovered to have been switched at birth when one girl died of a
hereditary disease. The disease was not in her family, but was known to be in the family
of another girl, born in the same hospital and about the same time she was born.
9. Proving paternity.
A woman, raped by her employer on Jan. 7, 1943, her 18th birthday, became pregnant.
The child knew who her father was, but as long as he lived, he refused to admit being
her father. After the man died, DNA testing proved that she was his daughter and she
was granted a half of his estate. ("A Child of Rape Wins Award from Estate of Her
Father." New York Times, July 10, 1994.)
42
10. Determining effectiveness of bone marrow transplants.
"DNA fingerprinting can help doctors to monitor bone marrow transplants. Leukemia is
a cancer of the bone marrow and the diseased marrow must be removed. The bone mar-
row makes new blood cells, so the leukemia sufferer will die without a transplant of
healthy marrow. Doctors can quickly tell whether the transplant has succeeded by DNA
typing of the patient and the donor. If the transplant has worked, a fingerprint from the
patient’s blood shows the donor’s bands. But if the cancerous bone marrow has not been
properly destroyed, then the cancerous cells multiply rapidly and the patient’s own bands
predominate." ("Our Ultimate Identity Card in Sickness and in Health," in "Inside
Science", New Scientist, Nov. 16, 1991.)
11. Proving relatedness of immigrants.
DNA fingerprinting has been used as proof of paternity for immigration purposes. In
1986, Britain’s Home Office received 12,000 immigration applications from the wives and
children of Bangladeshi and Pakistani men residing in the United Kingdom. The burden
of proof is on the applicant, but establishing the family identity can be difficult because
of sketchy documentary evidence. Blood tests can also be inconclusive, but DNA fin-
gerprinting results are accepted as proof of paternity by the Home Office. (DNA finger-
prints, source unknown: Based on A. J. Jeffreys, et al., "Positive Identification of an
Immigration Test-Case Using Human DNA Fingerprints." Nature, 317:818-819, 1985.)
12. Confirming relatedness among animals.
Scientists who extracted DNA from the hair of chimpanzees throughout Africa now have
evidence that there might be a third species of chimpanzee. At the same time they have
learned things about chimp behavior and kinship patterns that would have once taken
years to theorize. They discovered a group of chimps living in western Africa to be genet-
ically distinct from the chimps living in other parts of Africa, suggesting that the group
may be an endangered species. The have discovered that male chimps living in a given
area are often as closely related as half-brothers, and many so-called sub-species may all
be part of a single species. The male chimps’ relatedness may explain why, unlike other
primates, the males are quite friendly to each other.
13. DNA testing of plant material puts murderer at the scene.
Two small seed pods caught in the bed of his pick-up truck put an accused murderer at the
murder scene. Genetic testing showed that DNA in the seed pod exactly matched the
DNA of a plant found at the scene of the murder. The accused had admitted he had given
the victim a ride, but he denied ever having been near the crime scene.
43
Appendix B
Prelab Activity 1 A Review of Restriction Enzymes
DNA consists of a series of nitrogen base molecules held together by weak hydrogen
bonds. These base pairs are in turn bonded to a sugar and phosphate backbone. The four dif-
ferent nitrogen bases are adenine, thymine, guanine and cytosine. (A, T, G, and C:
Remember the base-paring rule is A-T and G-C). Refer to Figure 1 to review the structure of
a DNA molecule.
If a segment of DNA is diagrammed without the sugars and phosphates, the base-pair
sequence might appear as:
Read to the right----> A C T C C G T A G A A T T C....>
<....T G A G G C A T C T T A A G <----Read to the left
Look at the linear sequence of bases (As, Ts, etc.) on each of the strands:
• Describe any pattern you might see in the upper sequence of bases.
• Compare the bases in the upper portion of the molecule to those in the lower portion.
Describe any relationship you can see.
• Now look at the upper sequence of bases and compare it to the lower. Do you notice any
grouping of bases that when read to the right and read to the left are exactly the same
order?
44
You may have discovered that the base sequence seems to be arranged randomly and that
the two strands seem to complement each other; As are paired with Ts, etc. You may have also
noticed that a portion of the top strand GAATTC (read to the right) has a counterpart in the
lower strand CTTAAG (read to the left). Similar sequences are AAGCTT and TTCGAA;
and CTGCAG and GACGTC. These sequences, called palindromes, are quite common along
the DNA molecule.
A major “enemy” of bacteria are viruses called bacteriophages, such as lambda. These
viruses infect bacteria by injecting their own DNA into bacteria in an attempt to take over
the operations of the bacterial cell. Bacteria have responded by evolving a natural defense
(called restriction enzymes) to cut up and destroy the invading DNA. These enzymes search
the viral DNA looking for certain palindromes (GAATTCs, for example) and cut up the DNA
into pieces at these sites. The actual place in the palindrome where the DNA is cut is called
a restriction site.
Look at the DNA sequence below:
Palindrome
✄
G T A G A AT T C A T T C A C G C A
C A T C T TA A G T A A G T G C G T
✄
Restriction site
GTAG ATTCATTCACGCA
CATCTTAA GTAAGTGCGT
Fragment 1 Fragment 2
A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome.
• How many base pairs are there to the left of the "cut"?
• How many base pairs are there to the right of the "cut"?
• Counting the number of base pairs, is the right fragment the same size as the left fragment?
• How could you describe fragment size in reference to the number of base pairs in the
fragment?
45
An important fact to learn about restriction enzymes is that each one only recognizes a spe-
cific palindrome and cuts the DNA only at that specific sequence of bases. A palindrome can
be repeated a number of times on a strand of DNA, and the specific restriction enzymes will
cut all those palindromes at their restriction sites.
The table below shows three kinds of palindromes that may be present in a strand of DNA
along with the specific enzyme that recognizes the sequence.
If the GAATTC palindrome is repeated four times on the same piece of DNA, and the
restriction enzyme that recognizes that base sequence is present.
• How many DNA fragments will be produced?
• If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then
what can you say about the size of the fragments that will be produced?
46
Let’s summarize what we learned so far.
• The base sequence in one strand of DNA can have a palindrome in the other strand.
(GAATTC and CTTAAG).
• Palindromes can be detected by restriction enzymes.
• Restriction enzymes cut the palindromes at restriction sites.
• A restriction enzyme only recognizes one specific kind of palindrome.
• Cutting DNA at restriction sites will produce DNA fragments.
• Fragment sizes can be described by the number of base pairs they contain.
• If a linear DNA molecule had the restriction sites A and B for a specific palindrome, how
many fragments would be produced?
47
• Draw a DNA molecule that has 5 randomly spaced restriction sites for a specific palin-
drome. How many fragments would be produced if they were each cut by a restriction
enzyme?
In this diagram, A and B are different palindrome sequences on a DNA strand. Only the
restriction enzyme that recognizes site B is present.
48
Prelab activity 2 Review of Electrophoresis
Agarose gel electrophoresis is a procedure that can be used to separate DNA fragments.
DNA is a molecule that contains many negative electrical charges. Scientists have used this
fact to design a method that can be used to separate pieces of DNA. A liquid solution con-
taining a mixture of DNA fragments is placed in a small well formed into the gel. (The gel
looks like Jello™ dessert). Electricity causes the molecules to move. Opposite electrical
charges attract each other; negative (-) charges move towards the positive (+) charge.
Imagine the gel as a "strainer" with tiny pores that allow small particles to move through it very
quickly. The larger the size of the particles, however, the slower they are "strained" through
the gel. After a period of exposure to electricity, the fragments will sort themselves out by size.
Fragments that are the same size will tend to move together through the gel. The group
will tend to form concentrations, called bands, of pieces that are all the same size.
• Where would the larger fragments—those with the greater number of base pairs—be
located; toward the top of the gel or the bottom? Why?
49
• Suppose you had 500 pieces of each of the four fragments, how would the gel appear?
• If it were possible to weigh each of the fragments, which one would be the heaviest?
Why?
• Complete this rule for the movement of DNA fragments through an agarose gel:
This diagram represents a piece of DNA cut with HindIII at each of the restriction sites
pointed to by the arrows. The numbers represent the number of base pairs in each fragment.
Well
• How many fragments Negative
were produced by the
restriction enzyme HindIII?
On the gel diagram at the
right, show how you believe
these fragments will sort out
during electrophoresis.
Positive Agarose gel
• Label each fragment with
its correct number of
base pairs.
50
Appendix C
Teacher’s Answer Guide
All samples contain the same bases: adenine, thymine, guanine and cytosine.
3. Are the bases paired in an identical manner in all three samples? Describe the pattern of
the base pair bonding.
The adenine is always bonded with thymine and the cytosine is always bond-
ed with the guanine.
4. In your attempt to analyze DNA samples from three different individuals, what conclu-
sions can you make about the similarities and differences of the DNA samples?
The sugar phosphate arrangement is the same for all samples and so are the
kind of bases; what is different is the arrangement of bases among the three
samples.
5. What will you need to compare between these DNA samples to determine if they are
identical or nonidentical?
51
Lesson 2 Restriction Digests of DNA Samples
Consider the two samples of DNA shown below [single strands are shown for simplicity]:
Sample #1: CAGTGATCTCGAATTCGCTAGTAACGTT
# of fragments: 2 # of fragments: 2
Sample # 1 Sample # 2
17 bp fragment 23 bp fragment
11 bp fragment 5 bp fragment
52
Lesson 2 Restriction Digestion of DNA Samples
Observation Questions:
1. Describe the samples of DNA (physical properties).
The DNA samples are clear, colorless liquid samples.
53
Lesson 2 Restriction Digestion of DNA Samples
Review Questions:
1. Before you incubated your samples, describe any visible signs of change in the contents
of the tubes containing the DNA combined with the restriction enzymes.
DNA + EcoRI/PstI enzyme mix:
No visible change apparent in the tubes.
2. Can you see any evidence to indicate that your samples of DNA were fragmented or
altered in any way by the addition of EcoRI/PstI? Explain.
No. No visible change apparent in the tubes.
3. In the absence of visible evidence of change, is it still possible that the DNA samples
were fragmented? Explain your reasoning.
Yes. They may be chemically changed but the changes may not be visible. Enzymes
may have cut the DNA.
4. After a 24 hour incubation period, are there any visible clues that the restriction enzymes
may have in some way changed the DNA in any of the tubes? Explain your reasoning.
No. No visible change apparent in the tubes but the enzymes may have cut the
DNA. The reactions are at the molecular level and too small to be seen.
54
Lesson 3 Electrophoresis of your DNA samples
Review Questions:
1. The electrophoresis apparatus creates an electrical field [positive and negative ends of
the gel]. DNA molecules are negatively charged. To which pole of the electrophoresis
field would you expect DNA to migrate (+ or -)? Explain.
Positive.
3. After DNA samples are loaded in wells, they are "forced" to move through the gel matrix.
Which size fragment (large vs small) would you expect to move toward the opposite end
of the gel most quickly? Explain.
Smaller. There is less resistance to their movement through the gel matrix.
4. Which fragments are expected to travel the shortest distance [remain closest to the well]?
Explain.
Larger. There is more resistance to their movement through the gel matrix.
55
Lesson 4 Thought Questions
2. If this were a fingerprinting gel, then how many kinds (samples) of DNA can you assume
were placed in each separate well?
One.
3. What would be a logical explanation as to why there is more than one band of DNA for
each of the samples?
The DNA must have been cut into fragments by restriction enzymes.
5. Which of the DNA samples have the same number of restriction sites for the restriction
endonuclease used? Write the lane numbers.
Lanes 2, 3, and 4 (CS, S1, and S2).
8. Which DNA samples appear to have been "cut" into the same number and size of frag-
ments?
Lanes 2 and 4 (CS and S2).
9. Based on your analysis of the photograph, what is your conclusion about the DNA sam-
ples in the photograph? Do any of the samples seem to be from the same source. If so
which ones? Describe the evidence that supports your conclusion.
The DNA samples in lanes 2 and 4 (CS and S2) are from the same individual because
they have identical restrictions sites that yield identical fragments.
56
Lambda/HindIII Crime Scene Suspect 1 Suspect 2 Suspect 3 Suspect 4 Suspect 5***
size marker
Band Distance Actual Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx. Distance Approx.
(mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp) (mm) size (bp)
1 11.0 23,130 19.0 3,679 21.0 2,860** 21.0 2,860** 19.0 3,679 21.0 2,860** 21.0 2,860**
2 13.0 9,416 20.5 2,860** 23.5 1,199 25.0 1,700 20.5 2,860** 29.5 1,093 24.0 1,986
3 15.0 6,557 32.0 828 30.5 941 28.5 1,159 32.0 828 29.5 1,093
4 18.0 4,361*
57
5 23.0 2,322
6 24.0 2,027
*This fragment may appear faint if the markers were not heated to 65 ºC. Lamba HindIII digestion also generates bands of 564 and 125 bp that are usually too faint to see on a gel.
**The measured migration distance for these bands varies depending upon the thickness of the bands. See Appendix D to understand why the bands are so intense in S4 and S5.
***S4 and S5 DNA lanes may also contain a very faint band of 500 bp.
DNA Standard Band Migration
To estimate the size of any unknown crime scene or suspect fragment, you first need to
determine the distances the specific fragment travelled. Locate the distance on the X-axis of
your standard graph. For example, Suspect 5, Band 2 migrated 24 mm (A). From the 24 mm
mark on the X-axis, read up to the standard line; when you intersect your standard curve,
mark the spot with a shaded circle (B). Follow the intersect point over to the Y-axis and deter-
mine where the graph line meets the Y-axis this is the approximate size of the fragment (C).
Suspect 5, Band 2 is approximately 2000 bp. Repeat this procedure for the Crime Scene and
all Suspects fragments. As you determine the approximate the approximate fragment sizes,
fill the data into the data table.
58
59
Lesson 4 Analyzing DNA Patterns
Review Questions:
2. Which of your DNA samples were fragmented? What would your gel look like if the
DNA were not fragmented?
The number of fragmented samples will vary. They will have one band on the gel if
the DNA was not cut.
5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can
you assume is identical about the molecules at that location?
The restriction sites are identical.
6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the
same location as the DNA from the crime scene?
The samples in lanes 2 and 5 match (CS and S3).
7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the
same individual as the DNA from the crime scene? Describe the scientific evidence that
supports your conclusion.
The CS and S3 samples appear to be identical. They both produce similar banding
patterns on the gel.
60
Prelab Activity 1 (from Appendix B)
Look at the linear sequence of bases (As, Ts, etc.) on each of the strands:
• Describe any pattern you might see in the upper sequence of bases.
There is no specific type of pattern associated with the upper sequence of bases.
• Compare the bases in the upper portion of the molecule to those in the lower portion.
Describe any relationship you can see:
A always pairs with T; G always pairs with C.
• Now look at the upper sequence of bases and compare it to the lower. Do you notice any
grouping of bases that when read to the right and read to the left are exactly the same
order?
GAATTC.
A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome.
• How many base pairs are there to the left of the "cut"?
4
• How many base pairs are there to the right of the "cut"?
10
• Counting the number of base pairs, is the right fragment the same size as the left fragment?
No, it is larger.
• How could you describe the fragment size in reference to the number of base pairs in the
fragment.
Fragment 1 is a 4 base pair fragment.
Fragment 2 is a 10 base pair fragment.
If the GAATTC palindrome is repeated four times on the same piece of DNA, and the
restriction enzyme that recognizes that base sequence is present.
• How many DNA fragments will be produced?
5
• If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then
what can you say about the size of the fragments that will be produced?
Random sized fragments will be produced.
61
• If a DNA molecule had the restriction sites A and B for a specific palindrome, how many
fragments would be produced?
3
In this diagram. A and B are different palindrome sequences on a DNA strand. Only the
restriction enzyme that recognizes site B is present.
62
Prelab Activity 2 Review of Electrophoresis
A piece of DNA is cut into 4 fragments as
shown in the diagram. A solution of the 4
fragments is placed in a well in an agarose
gel. Using the information given above,
draw (to the right) how you think the frag-
ments might be separated. Label each frag-
ment with its corresponding letter.
63
This diagram represents a piece of DNA cut with HindIII at each of
the restrictions sites pointed to by the arrows. The numbers
represent the number of base pairs in each fragment.
64
Appendix D: Plasmid DNA and Restriction Enzymes
The Crime Scene and Suspect DNA samples in this kit do not contain human DNA but
consist of plasmid DNA isolated from bacteria. Plasmids are small, circular pieces of DNA
that can replicate inside bacterial cells. In nature, bacteria evolved plasmids containing genes
that enabled them to survive antibiotics produced by other microorganisms in the environ-
ment. This antibiotic resistance gave the bacteria with plasmids a selective advantage over
their competitors. Bacteria were able to pass the beneficial plasmid DNA to other bacteria
via conjugation.
Scientists have taken advantage of plasmid DNA because its small size makes it easy to
purify, and it can be reintroduced into bacterial cells using a procedure called transformation.
Scientists have also benefited from another natural, bacterial defense mechanism: the restric-
tion enzyme. Bacteria evolved enzymes to destroy DNA from invading viruses, or bacterio-
phages, when they inject their DNA. Restriction enzymes recognize specific DNA sequences
within the phage DNA and then cut, or restrict, the DNA at that site. The fragmented phage
DNA can no longer pose a threat to bacterial survival. Once purified in the laboratory, these
restriction endonucleases (nuclease = enzyme that cuts, endo = within, nucleic acids) are
named for the bacteria from which they were isolated. For example, EcoRI was isolated from
Escherichia coli. Purified restriction enzymes can then be used in the laboratory to cut DNA
isolated from any source at completely predictable sites.
After plasmids are cut with a restriction enzyme, they can be joined to foreign DNA,
from any source, that has been cut with the same enzyme. The resulting hybrid DNA can
then be transformed into bacterial cells. The hybrid plasmids can perpetuate themselves in
bacteria just as before, except that the foreign DNA that was joined to them is also being per-
petuated. Every hydrid plasmid now contains a perfect copy of the piece of foreign DNA
joined to it. We say that the foreign piece of DNA has been cloned, and the plasmid DNA that
carried it is called a vector.
The Crime Scene and Suspect DNA samples in this kit were created by joining PstI-
digested bacteriophage lambda DNA with PstI-digested plasmid vector pTZ18U. Recombinant
plasmids were selected that gave distinct, striking banding patterns, or restriction fragment
length polymorphisms (RFLPs again!), when digested with the restriction enzymes PstI and
EcoRI and analyzed on an agarose gel.
Complete restriction maps of each of the Crime Scene and Suspect plasmids, the parent
vector pTZ18U, and the donor lambda phage are included for further classroom discussion and
exploration. Try this: predict the number of base pairs in the S4 and S5 plasmids, based on your
gel results. How do these sizes compare with the number of base pairs indicated on the S4 and
S5 plasmid maps? How can you explain the discrepancy? How could you get a more accu-
rate estimate of the plasmid sizes using restriction analysis and agarose electrophoresis? (Hint:
perhaps other restriction enzymes would generate different banding patterns on the gel.)
Which enzymes would you choose?
65
Plasmid Maps
66
Crime Scene/Suspect 3 DNA Sample
67
Suspect 5 DNA Sample
68
Plasmid Parent Vector
69
Bio-Rad
Laboratories
Life Science Website www.bio-rad.com Bio-Rad Laboratories Main Office 2000 Alfred Nobel Drive, Hercules, CA 94547, Ph. (510) 741-1000, Fx. (510)741-5800
Group Also in: Australia Ph. 02 9914 2800, Fx. 02 9914 2889 Austria Ph. (01) 877 89 01, Fx. (01) 876 56 29 Belgium Ph. 09-385 55 11, Fx. 09-385 65 54
Canada Ph. (905) 712-2771, Fx. (905) 712-2990 China Ph. 86-10-62051850/51, Fx. 86-10-62051876 Denmark Ph. 45 39 17 99 47, Fx. 45 39 27 16 98
Finland Ph. 358 (0)9 804 2200, Fx. 358 (0)9 804 1100 France Ph. 01 43 90 46 90, Fx. 01 46 71 24 67 Germany Ph. 089 318 84-0, Fx. 089 318 84-100
Hong Kong Ph. 852-2789-3300, Fx. 852-2789-1257 India Ph. (91-11) 461-0103, Fx. (91-11) 461-0765 Israel Ph. 03 951 4127, Fx. 03 951 4129
Italy Ph. 39-02-216091, Fx.39-02-21609-399 Japan Ph. 03-5811-6270, Fx. 03-5811-6272 Korea Ph. 82-2-3473-4460, Fx. 82-2-3472-7003
Latin America Ph. 305-894-5950, Fx. 305-894-5960 Mexico Ph. 514-2210, Fx. 514-2209 The Netherlands Ph. 0318-540666, Fx. 0318-542216
New Zealand Ph. 64-9-4152280, Fx. 64-9-4152284 Norway Ph. 22-74-18-70, Fx. 22-74-18-71 Russia Ph. 7 095 979 98 00, Fx. 7 095 979 98 56
Singapore Ph. 65-2729877, Fx. 65-2734835 Spain Ph. 34-91-661-7085, Fx. 34-91-661-9698 Sweden Ph. 46 (0)8-55 51 27 00, Fx. 46 (0)8-55 51 27 80
Switzerland Ph. 01-809 55 55, Fx. 01-809 55 00 United Kingdom Ph. 0800-181134, Fx. 01442-259118
4006096 Rev E