0% found this document useful (0 votes)
2K views

UIUC MCB 150 Practice Exam 02 Fall 2009

This document contains a 26 question practice exam for MCB 150 covering topics in molecular biology and genetics. The questions test knowledge of DNA replication, transcription, translation, cellular respiration, and chromatin structure. Multiple choice answers are provided for each question testing concepts like DNA base pair percentages, RNA polymerase movement, steps in translation initiation, and molecules involved in aerobic respiration.

Uploaded by

Carlos Guiteriz
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
2K views

UIUC MCB 150 Practice Exam 02 Fall 2009

This document contains a 26 question practice exam for MCB 150 covering topics in molecular biology and genetics. The questions test knowledge of DNA replication, transcription, translation, cellular respiration, and chromatin structure. Multiple choice answers are provided for each question testing concepts like DNA base pair percentages, RNA polymerase movement, steps in translation initiation, and molecules involved in aerobic respiration.

Uploaded by

Carlos Guiteriz
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 15

MCB 150 Practice Exam II, Fall 2009

1
1. Which one of the following represents a pair of molecules involved in the full aerobic
respiration of a hexose sugar, from which no more usable energy is likely to be obtained?
A. Glucose and oxygen
B. Pyruvate and ATP
C. NADH and FADH
2
D. Acetyl CoA and GTP
E. Carbon dioxide and water
2. An organism's DNA is analyzed and found to contain 28% guanine. What percentage of
that organism's DNA would be thymine?
A. 72%
B. 56%
C. 44%
D. 28%
E. 22%
3. True or False: Under identical conditions, the DNA in the organism described in the
previous question would be expected to have a higher T
m
than an organism with 32%
guanine.
A. True
B. False
4. Relative to the DNA it is bound to, approximately how many base pairs does E. coli RNA
polymerase move during the transition from closed promoter complex to open promoter
complex?
A. 3
B. 10
C. 35
D. 60
E. RNA polymerase does not move relative to the DNA during the transition from
closed promoter complex to open promoter complex.
MCB 150 Practice Exam II, Fall 2009
2
5. Which one of the following steps in translation initiation requires an input of energy?
A. Hybridization of initiator charged tRNA to mRNA
B. Joining of the large ribosomal subunit to the rest of the initiation complex
C. Binding of translation initiation factors
D. Identification of the correct start signal
E. None of the above steps in translation initiation require an input of energy.
6. The reaction (A) (B) is a normal cellular reaction, coupled to the hydrolysis of two
molecules of ATP in vivo. ATP hydrolysis has a G of 7 kcal/mol. Which one of the
following statements about the reaction (A) (B) is incorrect?
A. The reaction is endergonic.
B. The reaction has a G of greater than 7 kcal/mol.
C. The reaction would most likely proceed if coupled to the hydrolysis of only one ATP.
D. The reaction is biosynthetic.
E. All of the above statements about the reaction (A) (B) are correct.
7. How many replicons are found in the E. coli chromosome?
A. 0
B. 1
C. 2
D. 3
E. 4
8. Which one of the following E. coli enzymes is an RNA-dependent, DNA-synthesizing
enzyme?
A. DNA polymerase III
B. RNA polymerase holoenzyme
C. Primase
D. DNA polymerase I
E. None of the above enzymes are RNA-dependent, DNA-synthesizing enzymes.
MCB 150 Practice Exam II, Fall 2009
3
Use the following figure to answer the next two (2) questions.
9. If the sequence at the region labeled (B) was 5'-GCA-3', then the amino acid labeled on the
right would be:
A. cysteine.
B. alanine.
C. threonine.
D. arginine.
E. methionine.
10. The energy required to add the amino acid to the tRNA molecule comes from ,
and the reaction is catalyzed by an enzyme called a(n) .
A. removal of the nucleotide at the 3' end of the tRNA; ribonuclease
B. GTP hydrolysis; aminoacyl tRNA synthetase
C. GTP hydrolysis; elongation factor
D. ATP hydrolysis; aminoacyl tRNA synthetase
E. ATP hydrolysis; peptidyl transferase
MCB 150 Practice Exam II, Fall 2009
4
11. "Phase 2" of aerobic respiration involves both the conversion of pyruvate into Acetyl CoA
and the Krebs cycle. For every molecule of pyruvate that enters Phase 2, how many
molecules of the two major biological coenzymes are oxidized? [Note: for this question,
ignore what may have preceded Phase 2 or what might occur as a result of Phase 2.]
A. 0
B. 4
C. 5
D. 8
E. 10
12. Which one of the following statements about chromatin organization is incorrect?
A. Although the amino acids in a histone tail do not adopt appreciable secondary
structure, those amino acids play an important role in regulation of chromatin
accessibility.
B. Histones are evolutionarily ancient molecules, as evidenced by their conserved
sequences in all three domains.
C. Linker DNA between core nucleosomes can be degraded without disrupting the
structure of the core nucleosome itself.
D. The similarity in primary structure of a given histone, when compared among many
species, suggests a strongly negative consequence of significant variation from the
established sequence.
E. All of the above statements about chromatin organization are correct.
13. Which one of the following molecules would least likely be involved in the production of a
mature human messenger RNA?
A. RNA polymerase II
B. TFIID
C. Poly-A polymerase
D. snRNPs
E. 40S ribosomal subunit
MCB 150 Practice Exam II, Fall 2009
5
14. One strand of a section of DNA reads:
5 CTCGATCGGTCAACGTGCCAT 3
What would be the sequence of the polypeptide expressed from this region of DNA if this
strand was used as a template during transcription?
A. Glu-Leu-Ala-Ser-Cys-Thr-Val
B. Leu-Asp-Arg-Ser-Thr-Cys-His
C. Met-Ala-Arg
D. Tyr-Arg-Ala-Thr-Gly
E. None of the above polypeptide sequences would be expressed from this template
DNA.
15. When FADH
2
donates electrons to the electron transport chain, the eventual yield of ATP
is lower than when NADH donates electrons to the electron transport chain. Which one of
the following statements most accurately explains this observation?
A. The energy released during the transfer of electrons from FADH
2
is used to move
fewer protons into the mitochondrial intermembrane space, contributing less to the
electrochemical gradient.
B. There is less energy in the electrons donated by FADH
2
than there is in the electrons
donated by NADH, resulting in fewer protons moved in an equal number of
opportunities.
C. The FADH
2
is generated in the cytoplasm but releases its electrons in the
mitochondrial matrix, therefore a transport cost is involved that reduces the overall
yield of ATP for each molecule of FADH
2
involved.
D. FADH
2
is a significantly lower energy molecule than NADH, resulting in a lower
overall G for the electron transport chain and contributing less to the
electrochemical gradient.
E. None of the above statements accurately explain the observation described in the
question.
MCB 150 Practice Exam II, Fall 2009
6
The following figure shows an E. coli replication bubble. Arrows with pointed arrowheads
indicate newly synthesized molecules of DNA; arrows with circular arrowheads serve as
pointers. Use the figure to answer the next five (5) questions.
16. The region of the strand labeled (A) is the end of that strand.
A. 5'
B. 3'
C. N-terminal
D. C-terminal
E. coding
17. How many primers would have been synthesized in this replication bubble up to this point?
A. 2
B. 3
C. 4
D. 6
E. 8
18. Which one of the following molecules is least likely to be found in the region labeled (B) at
this moment? [Note: the letter (B) is not pointing at a specific structure, it is identifying an
area at the edge of the replication bubble.]
A. Helicase
B. DNA polymerase III
C. DNA ligase
D. Primase
E. Single strand DNA binding proteins
MCB 150 Practice Exam II, Fall 2009
7
19. The region labeled (C) would be most accurately referred to as a(n):
A. promoter.
B. Shine-Dalgarno sequence.
C. ribosome binding site.
D. ori.
E. splice site.
20. The fragment of DNA initiated the earliest during this process would be , and
the fragment of DNA initiated most recently would be .
A. (E); (G)
B. (G); (H)
C. (D); (G)
D. (E); (F)
E. (D); (E)
21. True or False: Catalytic activity within a snRNP can be found in a ribonucleic acid
molecule.
A. True
B. False
22. It's the year 2012, and the Kepler planet-hunting spacecraft returns with a good candidate
for an Earth-like planet. You lead a subsequent mission to study that planet, and discover a
single-celled life form. Upon closer biochemical inspection, you determine that this
organism has a genome of nucleic acid composed of five different nucleotides.
Furthermore, this organism appears to have intermediate nucleic acid molecules read in
groups of three bases by structures resembling ribosomes. Through additional experiments,
you determine that five of these codons specify the termination of protein synthesis. How
many of this organism's codons specify amino acids?
A. 59
B. 120
C. 125
D. 130
E. 238
MCB 150 Practice Exam II, Fall 2009
8
23. The covalent addition of a phosphate group to adenosine diphosphate, powered by the
kinetic movement of hydrogen ions in an attempt to balance out a concentration gradient, is
most accurately referred to as:
A. polymerization.
B. substrate level phosphorylation.
C. oxidative phosphorylation.
D. charging.
E. replication.
24. Which one of the following statements about the initiation of DNA replication in E. coli is
correct?
A. DNA polymerase III requires a primer of a specifically defined length, and will not
extend a shorter primer even if the primer is stably attached to a ss-DNA template.
B. DNA polymerase III requires a primer whose bases have ribose, and will not extend a
primer whose bases have deoxyribose even if one were provided in vitro.
C. DNA polymerase III requires an unoccupied hydroxyl group at the 3' end of an
existing nucleic acid molecule from which to extend, and will not initiate a new
strand without that hydroxyl group.
D. (A) and (C)
E. (A), (B) and (C)
25. Consider the following two statements about an allosteric regulator molecule named BM1:
1) BM1 can decrease the activity of one enzyme and increase the activity of another
enzyme.
2) BM1 can either decrease or increase the activity of a given enzyme depending on
the regulatory needs of the cell.
Determine which one of the statements below is correct.
A. Statement 1) and statement 2) are both true.
B. Statement 1) and statement 2) are both false.
C. Statement 1) is true; statement 2) is false.
D. Statement 1) is false; statement 2) is true.
MCB 150 Practice Exam II, Fall 2009
9
26. The sequences shown below represent possible sequences to lie upstream of the +1 base of
an E. coli mRNA gene. In each sequence, the underlined base represents the +1 base.
From which one of the sequences would you predict the most efficient levels of expression
of that mRNA?
A. GAATATAATGCTCAACGTACGCAGACGTTGACACGTACCGA
B. TGCGATCAGACGTACTATTGACAGCGTATAATACGCTAGAA
C. ATTGACACGATATAATGGCTAGCTAGTCAGTTGCATCGAGA
D. CGCTTGTCATCCTGAAGCCGACTCCCTATAATGCGCCTCCA
E. GCCGATCAGTCTTGACATGACACGTTAGCGAGCGTATAATA
27. The molecule needed to examine the sequences in the previous question looking for an
appropriate signal would most accurately be referred to as:
A. RNA polymerase core enzyme.
B. RNA polymerase holoenzyme.
C. RNA polymerase I.
D. RNA polymerase II.
E. RNA polymerase III.
28. What is the most likely identity of the molecule labeled (X) in the figure below?
A. E. coli Primase
B. Human RNA polymerase II
C. E. coli DNA polymerase III
D. E. coli DNA polymerase I
E. Human telomerase
MCB 150 Practice Exam II, Fall 2009
10
29. You are studying the effects of oxygen deprivation on human muscle tissue. As oxygen is
depleted from your tissue sample, which one of the following observations would you most
likely make?
A. The amount of ATP produced during glycolysis alone per unit of time will not change
during the course of the experiment.
B. As the oxygen level decreases, FADH
2
levels will rise.
C. As oxygen levels fall, the rate limiting step in glycolysis will become increasingly
regulated by ADP as opposed to ATP.
D. Ethanol will accumulate as a by-product, but will quickly be metabolized and
converted into a product usable by the tissue.
E. Each of the above observations is equally unlikely to be made during this experiment.
30. Order the events of translation from earliest to latest. Assume one round of elongation
only, followed by a stop codon.
a. movement of the ribosome 3 bases closer to 3' end of mRNA
b. successful binding of accessory protein to codon; subunits dissociate
c. hybridization of codon and anticodon in the A site
d. appropriate selection of initiator codon
e. peptide bond formation
f. release of amino acid from tRNA in the P site
A. d : f : c : a : e : b
B. d : b : a : c : f : e
C. d : c : f : e : a : b
D. b : d : e : f : c : a
E. c : d : e : f : a : b
31. Non-coding DNA that lies within a protein coding gene is most accurately referred to as
a(n) , while non-coding DNA that lies between genes is most accurately
referred to as a(n) .
A. exon; intron
B. intron; spacer
C. promoter; terminator
D. intron; exon
E. mRNA; tRNA
MCB 150 Practice Exam II, Fall 2009
11
The following figure shows DNA being compacted in a eukaryotic nucleus. Use the figure to
answer the next four (4) questions.
32. The amount of DNA between the region labeled (A) and the region labeled (B) is most
likely to be approximately:
A. 10 base pairs.
B. 30 base pairs.
C. 146 base pairs.
D. 166 base pairs.
E. 200 base pairs.
33. The diameter of the structure labeled (C) is most likely to be approximately:
A. 10 nm.
B. 30 nm.
C. 146 nm.
D. 166 nm.
E. 200 nm.
34. If a region of chromosomal DNA was found in the "zig-zag" form shown in the figure, it
would be referred to as and would most likely be .
A. euchromatin; transcriptionally silent
B. euchromatin; transcriptionally active
C. heterochromatin; transcriptionally silent
D. heterochromatin; transcriptionally active
MCB 150 Practice Exam II, Fall 2009
12
35. Which one of the following codons (each given 5'-3' below) would you expect to find with
the highest frequency within the mature mRNA of one of the polypeptide chains within the
structure labeled (C)? Consult the table of amino acid side chains and/or codon table
attached to this exam packet if necessary.
A. UUU
B. AAA
C. AUG
D. GAG
E. UGA
36. As electrons are passed from NADH to the terminal electron acceptor through the electron
transport chain, energy is released. How is this energy directly utilized?
A. The energy release is secondary to the movement of electrons and inconsequential,
and is therefore lost as heat.
B. The energy is used to directly phosphorylate a molecule of ADP.
C. The energy is used to ferment two molecules of pyruvate for every molecule of
glucose that entered glycolysis.
D. The energy is used to reduce NAD
+
into NADH.
E. None of the above describe how the energy released during the electron transport
chain is directly utilized.
37. Which one of the following statements about gene expression is incorrect?
A. A messenger RNA molecule can be translated by multiple ribosomes at a time.
B. Translation of bacterial messenger RNAs does not occur until the 5' cap and poly-A
tail have been added.
C. Simultaneous transcription and translation can occur in bacteria because those
processes occur in the same cellular compartment.
D. Bacteria can produce multiple different proteins from a single messenger RNA.
E. Higher eukaryotes can synthesize different proteins from a single gene by using
different combinations of exons.
38. Which one of the following processes occurs in the nucleus of eukaryotic cells?
A. Poly-A tail addition
B. DNA replication
C. Transcription
D. (B) and (C)
E. (A), (B) and (C)
MCB 150 Practice Exam II, Fall 2009
13
39. In which one of the following organisms would you expect to find circular molecules of
double-stranded DNA?
A. Eukaryotes
B. Archaea
C. Bacteria
D. (B) and (C)
E. (A), (B) and (C)
Use the following figure to answer the next two (2) questions.
40. Using only the information provided in the figure, you could reasonably deduce that
reaction is endergonic, and reaction is exergonic.
A. 5; 1
B. 3; 4
C. 3; 1
D. 1; 3
E. 1; 2
41. If product (Y) is a feedback inhibitor of its own production, which step is product (Y) most
likely to inhibit?
A. (1)
B. (2)
C. (3)
D. (4)
E. (5)
MCB 150 Practice Exam II, Fall 2009
14
42. The energy to power peptide bond formation comes directly from:
A. hydrolysis of a covalent bond between an amino acid and a nucleotide.
B. hydrolysis of ATP into ADP and inorganic phosphate.
C. hydrolysis of GTP into GDP and inorganic phosphate.
D. hydrolysis of ATP into AMP and pyrophosphate.
E. Peptide bond formation is exergonic and therefore requires no input of energy.
43. A messenger RNA is 963 nucleotides long, including the sequences for the initiator and
termination codons, and ignoring the untranslated regions at the 5' and 3' ends. The
number of amino acids in the protein made from this mRNA would be:
A. 2889.
B. 963.
C. 321.
D. 320.
E. 319.
44. In a typical mitotic chromosome, the number of chromosome arms equals the number of:
A. centromeres.
B. origins of replication.
C. telomeres.
D. identical double helices.
E. sister chromatids.
45. One of the enzymes in glycolysis is named phosphohexose isomerase. Which one of the
following would most accurately describe the function of this enzyme?
A. Covalent addition of a phosphate group onto a six carbon sugar
B. Covalent addition of a second phosphate group onto a phosphorylated six carbon
sugar
C. Conversion of a five carbon sugar to a six carbon sugar
D. Conversion of one phosphorylated six carbon sugar to a different phosphorylated six
carbon sugar
E. Conversion of one phosphorylated six carbon sugar into two phosphorylated three
carbon sugars
MCB 150 Practice Exam II, Fall 2009
15
46. True or False: The reaction catalyzed by the enzyme in the previous question would most
likely occur in the payoff phase of glycolysis.
A. True
B. False
47. Which one of the following statements about a 50S ribosomal subunit is correct?
A. It consists of multiple proteins and three different pieces of rRNA.
B. It would be found in the cytoplasm of all living cells.
C. It recognizes an mRNA molecule via a ribosome binding site (RBS).
D. The site of its assembly would be the nucleolus.
E. These subunits have catalytic activity in the form of RNA molecules.
48. Which one of the following types of molecules would least likely be found in a
spliceosome?
A. Messenger RNA
B. Small nuclear RNA
C. Protein
D. Ribosomal RNA
E. All of the above types of molecules are equally likely to be found in a spliceosome.
49. The X-ray diffraction data generated by Franklin and Wilkins directly demonstrated that
DNA:
A. is a double helical molecule.
B. has a uniform width.
C. has the bases stacked on the outside and alternating sugars and phosphates on the
inside.
D. (A) and (B)
E. (A), (B) and (C)
50. The protein complexes of the electron transport chain in bacteria are found in the:
A. plasma membrane.
B. inner mitochondrial membrane.
C. cytoplasm.
D. outer mitochondrial membrane.
E. nucleus.

You might also like