MINISTRY OF FORESTRY OF INDONESIA

IN COOPERATION WITH
INTERNATIONAL TROPICAL TIMBER ORGANIZATION
IT TO

ITTO PD425/06 Rev. 1 (I)

Production and Utilization Technology

for Sustainable Development of Eaglewood (Gaharu)
in Indonesia

TECHNICAL REPORT NO. 2

Better Inoculation Engineering

Techniques

by :
Erdy Santoso, Ragil S.B. Irianto, Irnayuli R. Sitepu and Maman Turjaman

R & D CENTRE FOR FOREST CONSERVATION AND REHABILITATION

FORESTRY RESEARCH AND DEVELOPMENT AGENCY (FORDA)
MINISTRY OF FORESTRY
INDONESIA
2011
TECHNICAL REPORT NO. 2

Better Inoculation Engineering

Techniques


MINISTRY OF FORESTRY OF INDONESIA

IN COOPERATION WITH
INTERNATIONAL TROPICAL TIMBER ORGANIZATION
IT TO

ITTO PD425/06 Rev. 1 (I)

Production and Utilization Technology

for Sustainable Development of Eaglewood (Gaharu)
in Indonesia

TECHNICAL REPORT NO. 2

Better Inoculation Engineering

Techniques

by :
Erdy Santoso, Ragil S.B. Irianto, Irnayuli R. Sitepu and Maman Turjaman

R & D CENTRE FOR FOREST CONSERVATION AND REHABILITATION

FORESTRY RESEARCH AND DEVELOPMENT AGENCY (FORDA)
MINISTRY OF FORESTRY
INDONESIA
2011
Authors : Erdy Santoso, Ragil S.B. Irianto, Irnayuli R. Sitepu and Maman
Turjaman
Institutions full name, address : R&D Centre for Forest Conservation and Rehabilitation; Jalan Gunung
Batu No. 5 Bogor, Indonesia; e-mail : [email protected]
The place and date the report : Bogor, July 1, 2011.
was issued
Disclaimer : Copyright @ 2011
This Proceeding is a part of Program ITTO PD425/06 Rev. 1 (I) :
Production and Utilization Technology for Sustainable Development of
Gaharu (Gaharu) in Indonesia
Published by : Indonesias Work Programme for 2011 ITTO PD425/06 Rev.1 (I)
R&D Centre for Forest Conservation and Rehabilitation
Jalan Gunung Batu No. 5 Bogor, Indonesia
Phone :62-251-8633234
Fax :62-251-8638111
E-mail : [email protected]
ISBN : 978-979-3145-82-2
Cover by : Bintoro

Project number : PD425/06 Rev. 1 (I)

Host Government : Indonesia
Name of the Executing : Forestry Research and Development Agency (FORDA), Dr. Ir. Maman
Agency and Project Turjaman, DEA
Coordinator
Starting date of the project : May 1, 2008
Duration of the project : 36 months

ii
 PREFACE

This report signifies as part of research results from the output entitled Better
Inoculation-Engineering Techniques, which comprised three activities, namely (1)
Selecting Suitable Inoculums; (2) Developing Several Prospective Inoculants in Large
Scale; and (3) Implementing Several Prospecting Inoculums for Artificial Inducement. The
technical report of this output reflects the very substantial spirits as accomplished from
the development of gaharu-inoculation technology funded by the ITTO PD425/06 Rev.1
(I) Project, entitled Production and Utilization Technology for Sustainable Development
of Eaglewood (Gaharu) in Indonesia.

Those three above-mentioned activities presented the research which was very
closely related and conducted by the expert researchers who were very proficient in
their field. The isolates of gaharu-developing fungi were procured from the Indonesias
tropical forest, then selected and tested in adequate sample-amount, thereby greatly
assisting their selection process based on multi-locations and differing-conditions.

This report provides information about the selection process and testing on isolates
that developed gaharu at different species of indicatively gaharu-yielding trees, and the
realization process was measured and evaluated thoroughly and properly.

Maman Turjaman
Project Coordinator ITTO PD425/06 Rev.1 (I)
R & D Centre for Forest Conservation and
Rehabilitation
FORDA, the Ministry of Forestry, Indonesia

iii


SUMMARY

Gaharu is formed as an gaharu producing-tree responsed to particular factors which

are the plant physiology and fungal infection. Fungi isolates which are potential to induce
gaharu-forming have been isolated from various regions. This activity was carried in order
to provide information about the diversity of isolates that have been collected. Natural
infected wood samples were taken from several locations, from cultivated plants as well
as nature (Java, Sumatera, Kalimantan, Sulawesi, and Maluku). Isolation, purification, and
cultivation were done with adding standard medium, while qualification was carried with
observing Aquilaria mallacensis and A. microcarpa characteristics. Cultured isolates on
Potato Dextrose Agar (PDA) medium were incubated in room temperature for seven days.
Isolates that have been collected include Fusarium solani (Mart), Appell and Walenw,
F. sambunicum, and F. tricinctum. Inoculation of four isolates of Fusarium to Aquilaria
microcarpa was carried in KHDTK Carita, Banten. Inoculation of Gorontalo-originated
Fusarium to Aquilaria microcarpa stems caused the largest and fastest infection compared
to Fusarium originated from West Sumatera, West Kalimantan, or Jambi in 2-6 months.

From the molecular identification as inflicted by 36 gaharu-yielding fungi strains,

could be acquired the species of the so-called Fusarium solani which became the most
dominant of the other strains. Fusarium solani species presented as the best inoculant that
developed gaharu at the four gaharu-yielding tree species, and this species comes from
consecutively Gorontalo and Jambi. Morphologically, the Fusarium spp. isolates were
dominated by while-colored mycelia, but there existed colonies with weak red, yellow,
and violet colors. Almost all the isolates exhibited the aerial-mycelium characteristics.
Histologically, the Fusarium spp. isolates afforded the macroconidia characteristics
dominated by elliptical shape. The fungi originated from Gorontalo exhibited viability
and virulence which was very excellent compared to those of other fungi from Jambi,
West Kalimantan, as well as West Sumatera. At the different research locations, the
Fusarium spp. fungi could induce the gaharu trees more excellently compared to other
fungi from Jambi, West Kalimantan, as well as Padang (West Sumatera), due to among
others the fungi suitability, fungi violence, and the resistance of the trees themselves.

The uses of Fusarium solani fungi isolates from Gorontalo seems the most
recommendable, since this isolate affords high viability and virulence, and hence can
be implemented to various gaharu-yielding tree species, which grow on several regions
in Indonesia. This is so by considering and following inoculation protocols as enacted
by the FORDA (Forestry Research and Development Agency, administratively under the
Indonesias Ministry of Forestry). For the isolates recommended as the second-best
rank, it is the Fusarium solani originated from Jambi, since this fungal isolate exhibits
superiority and afford evolving the fragrant aromas which differs from those of isolates
with Gorontalo origin.

FORDA developed fermentation technique for large scale production and establish
quality control procedure to produce inoculant of high quality. Quality control of inoculant
plays an important role in ensuring the effectiveness and virulence of inoculant for
certain period of time. For large scale production, one shaker with capacity of 500 liter
inoculants per month has been placed in Forest Microbiology Laboratory, FORDA.

It still deserves the further tests on developing Fusarium spp. fungi originated from
various regions, and have been collected by the FORDA to assess the potency of gaharu
development at other gaharu-yielding tree species in the different locations.

v
 LIST OF CONTENTS

PREFACE.........................................................................................iii

SUMMARY....................................................................................... v

LIST OF CONTENTS........................................................................vii

LIST OF TABLE............................................................................... ix

LIST OF FIGURE.............................................................................. xi

1
1. INTRODUCTION..........................................................................

2. APPLIED METHODOLOGY.......................................................... 3
2.1 Selecting suitable inoculums...............................................................................3
2.2 Developing several prospect inoculums in large scale........................................3
2.3 Implementing several prospecting inoculums for artificial inducement..............5

3. PRESENTATION OF THE DATA.................................................... 9

3.1 Selecting suitable inoculums...............................................................................9
3.2 Developing several prospect inoculum in large scale.......................................10
3.3 Implementing several prospecting inoculums for artificial inducement............13
4. ANALYSIS AND INTERPRETATION OF THE DATA AND
RESULTS................................................................................... 23
4.1 Selecting suitable inoculums.............................................................................23
4.2 Developing several prospect inoculum in large scale.......................................23
4.3 Implementing several prospecting inoculums for artificial inducement............24

27
5. CONCLUSION...........................................................................

6. RECOMMENDATION................................................................. 29

7. IMPLICATION FOR PRACTICE................................................... 31

ANNEX...........................................................................................33

BIBLIOGRAPHY.............................................................................55

vii


LIST OF TABLE

Table 1. Molecular identification of 36 strains of gaharu-inducing fungi collected

from 17 provinces in Indonesia..........................................................................9

Table 2. Variety of morphology of Fusarium spp. from several location........................10

Table 3. Histology Character of Fusarium spp. Isolates from different location...........11

Table 4. Caracteristic different of morphology of Fusarium spp..................................12

Table 5. Viability test for four isolates of Fusarium origin from Gorontalo, Jambi,
Kalbar, and Sumbar ........................................................................................14

Table 6. Virulence test to Aquilaria spp. seedlings in greenhouse condition................15

Table 7. Chemical compound of gaharu in Aquilaria sp. dan Gyrinops sp...................21

ix


LIST OF FIGURE

Figure 1. Protocol for molecular identification of Fusarium sp........................................4

Figure 2. Processing of mass production of gaharu inoculant production in large

scale.................................................................................................................5

Figure 3. Gaharu inoculation technology by FORDA.......................................................6

Figure 4. A tool for making an inoculation hole made by radial of motor cyclist............6

Figure 5. Automatic injection for liquid inoculum............................................................7

Figure 6. Colony of Fusarium spp. from different location in Indonesia........................13

Figure 7. Mass production of prospect inoculums in large scale..................................13

Figure 8. The virulence test of Fusarium spp. to gaharu seedling in greenhouse

conditions.......................................................................................................14

Figure 9. Bargraph Aquilaria microcarpa inoculated by four isolates of

Fusarium spp. after 75 days inoculation at KHDTK Carita, Banten................16

Figure 10. Bargraph A. crassna inoculated by four isolates of Fusarium spp.

after 75 days inoculation in Sukabumi, West Java.........................................17

Figure 11. Bargraph A. beccariana inoculated by four isolates of

Fusarium spp. after 75 days inoculation at Sengoret, Sanggau,
West Kalimantan.............................................................................................17

Figure 12. Bargraph G. versteegii inoculated by four isolates of Fusarium spp.

after 75 days inoculation in Nagekeo, Flores Island, West Nusa Tenggara....18

Figure 13. Vertical response of A. beccariana after inoculation by four isolates of

Fusarium spp. in Sanggau, West Kalimantan.................................................19

Figure 14. Horizontal response of A. beccariana after inoculation by four isolates of

Fusarium spp. in Sanggau, West Kalimantan.................................................19

Figure 15. Vertical Response of G. versteegii after inoculation by four isolates of

Fusarium spp., Lombok Island, West Nusa Tenggara (NTB)..........................20

Figure 16. Horizontal Response of G. versteegii after inoculation by four isolates of

Fusarium spp, Lombok Island, West Nusa Tenggara (NTB)...........................20

xi
 1
INTRODUCTION

Gaharu, which is a comercial product which has a highly economical value, is actually
a resin deposit which is accumulated in wood tissue as a reaction toward wounding
or pathogen infection. Gaharu has been traded since hundreds years ago. According
to Suhartono and Mardiastuti (2002), the trading of this product in Indonesia was first
registered in fifth century, and China was reported as the main buyer. In international
trading this comodity was known with several names; agarwood, aloeswood, karas,
kresna, jinkoh, oudh, and many others. Trading shape varies from chunks, chips, powder,
and gaharu oil (Surata and Widyana 2001). Oil-formed comodity was usually achieved
by distilation or extraction from low quality chips.

Nowadays, gaharu has a high sale value especially from its fragrant resin which is
called Scent of God, although the usage of gaharu is not limited to fragrance industry. In
principal, gaharu can be used for medicine, incense, and fragrance (Barden et al., 2000).
Gaharu incense is used in beliefs rituals and religious ceremonies, as room fragrance,
and religious accecories such as rosario and tasbih (Barden et al., 2000). Meanwhile, in
medical industry, gaharu is used as analgesic and anti-inflammatory agent (Trupti et al.,
2007) and is known has benefits to cure various diseases like toothache, kidney pain,
reumatics, asthma, diarrhea, tumor, diuretic, liver, hepatitist, cancer, smallpox, malaria,
tonic for pregnancy and after-labor, and also has anti-toxic, anti-microbes, and neuron
and digestive stimulant characteristics (Heyne, 1987; Barden et al., 2000; Adelina, 2004;
Suhartono and Mardiastuti 2002).

Researches concerning various aspects related to gaharu have been done for a
long time and is still developing. These researches were primely initiated by the nature-
dependent gaharu comodity. Due to the high gaharu-collecting activity which was solely
dependent to nature, the main genus of gaharu-producing tree, Gyrinops and Aquilaria
were included in Appendix II CITES. Not all gaharu-producing trees contain gaharu which
is only synthesized under certain stress conditions. Gaharu forming process requires
a long time, in which during the process various levels of quality are formed and at the
end of the process, gaharu with highest quality will be achieved (Sumadiwangsa and
Harbagung, 2000).

Gaharu-forming is initiated by biotic or abiotic factors. To synthesize gaharu artificially,

one of these methods can be used; mechanical wounding on the stem, or chemical
inducing methods (methyl jasmonic, oil, or brown sugar). Abiotic gaharu forming as
mentioned above did not distribute its mechanism to other regions in the tree which
are not directly affected by the abiotic factor. On the contrary, gaharu-forming by biotic
factor such as fungi or other microbes let the mechanism spread into other region on
the tree. Due to the spreading of gaharu-forming mechanism to other tissues, the quality
and quantity of the gaharu product would be more satisfying.

Process of natural gaharu production occurs due to the injury inflicted on its
corresponding host trees and then infected by pathogens. Meanwhile, from the results
of isolation could be identified the species of gaharu-synthesizing microbes from various

1
production-center regions. At each of the isolates could be found the pathogenic-fungi
genus with the particular species such as Fusarium spp., Phytium sp. and Botrydiplodia
sp, Penicilium sp., Rhizoctonia sp., Acremonium sp., Cystosphaera sp., Thielaviopsis
sp., Libertella sp., Trichoderma sp. and Scytalidium sp. (Sumarna and Santoso, 2002).
Further, it was reported that results of purification on those gaharu-synthesizing fungi
were presumably dominated by the species of Fusarium spp. (Santoso et al., 2006). Still
further, Sumarna and Santoso (2002) also reported that the production of gaharu could
be artificially engineered. The presumed gaharu-yielding tree-stem after being injured
was further engineered using the tree-boring method on that injured stem by injecting
into it the pathogen inoculant. For the pathogen species to be inoculated, those species
should be originated from the environment-ecology condition where that trees species
themselves grow, and are suitable with the trees themselves.

Novel findings by gaharu teams have revealed important aspects that determine
the successful of gaharu formation by artificial induction, i.e. methods of injection,
fungal strain type, and growing media for delivering the fungi. These methods are more
practice, effective, and efficient.

The objective of this technical report is to give thorough information concerned

with selection of pathogens for gaharu (eaglewood) inoculation. This technical report
based on three activities of the project, as follows : (i) selecting suitable inoculums; (ii)
developing several prospect inoculums in large scale; and (iii) implementing several
prospecting inoculum for artificial inducement.

2
 2
APPLIED METHODOLOGY

2.1 Selecting suitable inoculums

Thirty six isolates of inoculums originated from Jambi, Padang, Mentawai, Bohorok,
West Kalimantan, Central Kalimantan, Gorontalo, Maluku, and Papua (and other regions not
yet mentioned) were grown in PDA (Potato Dextrose Agar) medium. The isolation of DNA
was done with Wizard Genomic DNA Purification Kit (Promega, madison, USA). A region
of 443 bases were amplified by PCR using primer Fus1 (5-TGAAATCTGGCTCTCGGG)
and Fus2 (5-CATGCGCGAACCTCAGTC) (Hannequin et al. 1999). PCR reaction for
50L were including 5L buffer, 1 L dNTP mix PCR Grade (Qiagen, Germany), 2.5 L
Fus1, 2.5 L Fus2, 0.5 L Amplitaq 360 DNA Polymerase Grade (Qiagen, Germany),
2.5 L DNA template, and 36 L MilliQ. The PCR condition was started at 95oC for 10
minutes; followed by 30 cycles of 94oC for 1 minute, 55oC for 1 minute, and 72oC for 1
minute; and post extension at 72oC for 1 minute. PCR product purification prior to cycle
sequencing was carried out with Wizard SV Gel and PCR Clean-Up Systems (Promega,
USA). Purified PCR products were sequenced using ABI 3130 Genetic Analyzer (Applied
Biosystem, USA). Sequenced results were analyzed using FinchTV software and aligned
with GeneBank database using BLASTN program. Multiple sequence alignments were
run using Clustal X 2.0 software (Higgins, Germany). Neighbor-joining method used
for trees and matrix distances of the Phylip package. Species names were determined
based on matching identity (Figure 1.).

2.2 Developing several prospect inoculums in large

scale

2.2.1 Preparation of the inoculant media

The solid media inoculant was already developed prior to the start of this project.
The media composition consisted of sawdust from legume-tree wood and rice husk,
then mixed with PDA solution. All the mixture as such was put into the bottle of 250-
cc capacity. Before being used, all the glassware and raw materials were sterilized
at 121oC under one-atmosphere pressure for 20 minutes. The mouths of the bottles
were each closed with aluminum foil, and further the closed bottles with their contents
inside incubated in a dark room at ambient temperature for 21 days. The liquid media
for inoculant was prepared using PDA solution, and added with several vitamins for the
sake of inoculant growth. The thread pieces (mycelia) of Fusarium sp. fungi were put
into the sterilized liquid media. Those bottles were shaken vigorously using the shaker
device, through the fermentation process. The inoculant was incubated for 14 days,
and shaken at 125 rpm speed. The morphology characterization of mycelia growth
from as many as 21 fungi isolates that synthesized gaharu was observed during their
growth process.

3
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Routine protocol for molecular identification in FORDA

TTTTGGTGAGGTGCCTTCCGAGTTCCCTG
GAACGGGACGCCATAGAGGGTGAGAGC
CCCGnnTnCnTnGGACGCCGAACCTCTGT
AAAGCTCCTTCGACGAGTCGAGTAGTTT
GGGAATGCTGCTCTAAATGGGAGGTATA
TGTCTTCTAAAGCTAAATACCGGCCAGAG
Blast ACCGATAGCGCACAAGTAGAGTGATCGA
AAGATGAAAAGAACTTTGAAAAGAGAGTT
Pure Isolate nucleotide: AAACAGTACGTGAAATTGTTGAAAGGGAA
NCBI/DDBJ AGCGCTTGTGACCAGACTTGGGCTTGGT
TGATCATCCGGGGTTCTCCCCGGTGCAC
TCTTCCGGCCCAGGCCAGCATCAGTTCG
CCCTGGGGGACAAAGGCTTCGGGAACG
TGGCTCTCTCCGGGGAGTGTTATAGCCC
GTTGCGTAATACCCTGTGGCGGACTGAG
GTTCGAGCATG

Sequencing
DNA Genus/ using
extraction species: ABI3130
Fusarium sp. Genetic
analyzer

PCR with Purification

Purification
Fus1 and Cycle of cycle
of PCR
Fus2 sequencing seq.
product
primers product

Figure 1. Protocol for molecular identification of Fusarium sp.

2.2.2 Mass production of inoculant

Trial test on inoculant production was already carried out at the larger-scale work
by using large plastic bottles each of l0-litre capacity. By using liquid PDA media, the
pieces of Fusarium sp. inoculant were incubated for 14 days. Before being used, all the
glassware and raw materials were sterilized at 121oC under one-atmosphere pressure
for 20 minutes. Each work was done aseptically, and the oxygen consumption was
met by using rotor continuously, in order that the development of Fusarium sp. biomass
could proceed more and more intensively throughout the days. The process of inoculant
packaging was done by providing plastic bottles each of 300 ml or 600 ml capacity.
This size (capacity) was practical viewed from its purpose for uses, inoculant security,
quality stabilization, storage, transportation, as well as for commercialization (Figure 2).

4
 APPLIED METHODOLOGY
Implementing several prospecting inoculums for artificial inducement

Figure 2. Processing of mass production of gaharu inoculant production in

large scale.

2.3 Implementing several prospecting inoculums for

artificial inducement
In the realization to find the best inoculums to synthesize gaharu, in the initial stage
there were four isolates of Fusarium sp. which seemed prospective for the trial test.
Those four isolates were originated from consecutively Gorontalo, Padang, Jambi,
and West Kalimantan. Further, those four isolates have been identified molecularly,
and already tested at laboratory and greenhouse scales. Those four inoculums were
entirely produced at liquid media. Several modification methods were already conducted
beginning from scrutinizing the distance between injection holes, the injection depth,
size of drill bits, until the number of inoculants as injected into each of the holes (Figure
3). Size of drill bits was 3 mm as a tool for inoculating hole, made by radial of motor
cyclist (Figure 4). There were four gaharu-yielding trees which have been trial tested,
comprising consecutively Aquilaria microcarpa, A. crassna, A. beccariana, and Gyrinops
versteegii. Automatic injection was used to determine a dosage of liquid inoculum for
each hole, i.e. 1 ml per hole, 2 ml per hole, etc. (Figure 5).

5
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Figure 3. Gaharu inoculation technology by FORDA.

Figure 4. A tool for making an inoculation hole made by radial of motor cyclist.

6
 APPLIED METHODOLOGY
Implementing several prospecting inoculums for artificial inducement

Figure 5. Automatic injection for liquid inoculum.

7
 3
PRESENTATION OF THE DATA

3.1 Selecting suitable inoculums

Results of molecular identification on 36 gaharu-developing fungi strains as collected
from 17 provinces are presented in Table 1. From the 36 strains after being analyzed
molecularly, it turned out that 100% of the identified fungi belonged to the genus of
Fusarium. Specifically, results of such molecular identification strongly indicated that
Fusarium solani was the most dominant (>80%).

Table 1. Molecular identification of 36 strains of gaharu-inducing fungi

collected from 17 provinces in Indonesia

No. Isolate Number Origin (Province) Molecular identification

1 FORDACC506 North Sumatra Fusarium solani

2 FORDACC509 Gorontalo Fusarium solani
3 FORDACC503 West Sumatra Fusarium solani
4 FORDACC512 Papua Fusarium solani
5 FORDACC500 Jambi Fusarium solani
6 FORDACC501 West Sumatra Fusarium solani
7 FORDACC510 Molucca Fusarium solani
8 FORDACC497 Central Kalimantan Fusarium solani
9 FORDACC499 West Kalimantan Fusarium solani
10 FORDACC2372 East Nusa Tenggara Fusarium solani
11 FORDACC504 Riau Fusarium solani
12 FORDACC514 Papua Fusarium solani
13 FORDACC502 West Sumatra Fusarium ambrosium
14 FORDACC515 East Nusa Tenggara Fusarium sp.
15 FORDACC2379 Molucca Fusarium solani
16 FORDACC511 West Nusa Tenggara Fusarium solani
17 FORDACC2370 Bangka Belitung Fusarium solani
18 FORDACC517 Bangka Belitung Fusarium solani
19 FORDACC513 Papua Fusarium solani
20 FORDACC519 West Java Fusarium falciforme
21 FORDACC2375 East Kalimantan Fusarium oxysporum
22 FORDACC520 West Java Fusarium solani f. batatas
23 FORDACC518 Babel Fusarium solani f. batatas
24 FORDACC2371 Babel Fusarium solani
25 FORDACC2377 West Java Fusarium solani

9
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

No. Isolate Number Origin (Province) Molecular identification

26 FORDACC507 Lampung Fusarium solani f. batatas

27 FORDACC498 Central Kalimantan Fusarium solani
28 FORDACC2369 West Sumatra Fusarium ambrosium
29 FORDACC495 South Kalimantan Fusarium solani
30 FORDACC2373 West Nusa Tenggara Fusarium solani f. batatas
31 FORDACC2374 East Kalimantan Fusarium solani
32 FORDACC508 Bengkulu Fusarium sp.
33 FORDACC505 North Sumatra Fusarium solani
34 FORDACC496 South Kalimantan Fusarium solani f. batatas
35 FORDACC516 Babel Fusarium solani
36 FORDACC2378 West Java Fusarium solani
Note: FORDA CC: Forestry Research and Development Agency Culture Collection (Source: Sitepu et al., in preparation
for publication).

3.2 Developing several prospect inoculum in large

scale
From the results of developing from 21 inoculant which were multiplied through the
PDA media, could be obtained the data about the morphology characterization of each
gaharu-developing fungi colony (Table 2). Such morphology characters as measured
covered colony size, the body ability on media surface, and colony color on PDA media
(Figure 6).

From the results regarding the production development of gaharu-synthesizing

inoculum, could be acquired the technology of mycelia multiplication using a simple
shaker and the liquid-PDA growth-media. As such, it could multiply the inoculums, which
in volume reached 500 litres a month. For the mass and commercial scale operation,
the inoculum packaging has been tried using the bottles each with 300-ml and 600-ml
capacity, which were easily transported and practical in the field (Figure 7).

Table 2. Variety of morphology of Fusarium spp. from several location

Morphology characters
Isolate
No. Origins Colony diameter Aerial
codes Color on PDA medium
mm/7 days miselium
1 Ga-1 Kalteng 61 Yes,+++ White, bright yelloW
2 Ga-2 Maluku 49 Yes,++ White, bright brown
3 Ga-3 Sukabumi 48 Yes,+ Bright brown
4 Ga-4 Kalsel 50 Yes,++ White
5 Ga-5 Kaltim 45 Yes,++ White
6 Ga-6 Belitung 38 Yes,+ White
7 Ga-7 Riau 59 Yes,++ Cream white
8 Ga-8 Bengkulu 49 Yes,++ White

10
 PRESENTATION OF THE DATA
Developing several prospect inoculum in large scale

Morphology characters
Isolate
No. Origins Colony diameter Aerial
codes Color on PDA medium
mm/7 days miselium
9 Ga-9 Jambi 59 Yes,+++ Cream white, bright brown
10 Ga-10 Padang 61 Yes,+++ White
11 Ga-11 Gorontalo 58 Yes,+++ Brownish white
12 Ga-12 Lampung 58 Yes,+++ Bony white, pink
13 Ga-13 Bangka 59 Yes,+++ White
14 Ga-14 Bogor 61 Yes,++ White
15 Ga-15 Mentawai 56 No Brown, yellow, white
16 Ga-16 Kaltim LK 57 Yes,+ White, purple
17 Ga-17 Kalbar 59 Yes,+++ Creamy white
18 Ga-18 Yanlapa 58 Yes,++ White, bright yellow
19 Ga-19 Mataram 52 Yes,++ White
20 Ga-20 Kalsel MIC 50 Yes,++ White, bright yellow
21 Ga-21 Kaltel TL 69 Yes,++ White, creamy

Table 3. Histology Character of Fusarium spp. Isolates from different

location

Characteritic of histology
isolate Macroconidia Microconidia
No code Number of Relative abun-
conidiofor shape
Septa dance
1 Ga-1 3 Simple Many Elips
2 Ga-2 4 Branch Many Elip, oval
3 Ga-3 3 Simple Many Elips
4 Ga-4 -) -) -) -)
5 Ga-5 2 Simple Little Elips
6 Ga-6 3 Simple Little Elips, oval
7 Ga-7 2 Simple Little Elips, oval
8 Ga-8 2 Simple Little Elips, oval
9 Ga-9 5 Simple Little Elips, septa
10 Ga-10 3 Simple Many Elips, septa
11 Ga-11 -) branch Many Elips
12 Ga-12 5-6 Simple Many Elips
13 Ga-13 3-4 Simple Many Elips
14 Ga-14 3 Simple Little Elips
15 Ga-15 3-4 Branch Many Elips
16 Ga-16 6-7 Simple Little Elips, septa 3
17 Ga-17 5 Branch Little Elips
18 Ga-18 3 Branch Many Elips
19 Ga-19 3-4 Branch Many Elips

11
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Characteritic of histology
isolate Macroconidia Microconidia
No code Number of Relative abun-
conidiofor shape
Septa dance
20 Ga-20 3 Branch Little Elips, oval
21 Ga-21 3 Branch Many Elips
-) not observed.

Table 4. Caracteristic different of morphology of Fusarium spp.

Morphology
No Isolat Code location
Basal cell Apical cell
1 Ga-1 Kalteng papillate hooked
2 Ga-2 Maluku blunt conical
3 Ga-3 Sukabumi blut blunt
4 Ga-4 Medan -) -)
5 Ga-5 Kaltim blunt blunt
6 Ga-6 Belitung -) -)
7 Ga-7 Riau blunt conical
8 Ga-8 Bengkulu -) -)
9 Ga-9 Jambi foot shaped blunt
10 Ga-10 Padang papillate blunt
11 Ga-11 Gorontalo -) -)
12 Ga-12 Lampung blunt conical
13 Ga-13 Bangka blunt nipple-like
14 Ga-14 Bogor -) -)
15 Ga-15 Mentawai -) -)
16 Ga-16 Kaltim LK blunt conical
17 Ga-17 Kalbar foot shaped blunt
18 Ga-18 Yanlapa blunt hooked
19 Ga-19 Mataram blunt nipple-like
20 Ga-20 Kalsel MC -) -)
21 Ga-21 Kalteng TL -) -)
-) Not Observed.

12
 PRESENTATION OF THE DATA
Implementing several prospecting inoculums for artificial inducement

Figure 6. Colony of Fusarium spp. from different location in Indonesia

Figure 7. Mass production of prospect inoculums in large scale.

3.3 Implementing several prospecting inoculums for

artificial inducement
Prior to conducting inoculum tests on the stem of gaharu-yielding tree at the
field stage, those four gaharu-developing isolates, each originated from consecutively

13
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Gorontalo, Jambi, West Kalimantan, and West Sumatera were tested with regard to the
levels of their growth ability and viability on the PDA media (Table 5).

Table 5. Viability test for four isolates of Fusarium origin from Gorontalo, Jambi,
Kalbar, and Sumbar

Fungal Isolate
Gorontalo Jambi West Kalimantan West Sumatera
No Fungal growth viability Fungal growth viability Fungal growth viability Fungal growth viability
week week week week
1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
1 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
2 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
3 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
4 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
5 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
6 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ ++++ +++ ++ ++
7 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ ++++ +++ ++ ++
8 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
9 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ ++++ +++ ++ ++
10 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ +++ ++ ++ +++ +++ ++ ++
Note :
+ : very weak
++ : weak
+++ : strong
++++ : very strong

After going through the viability test, those four gaharu-developing fungi were tested
of their virulence. Such test was conducted on the gaharu-yielding tree-seeds with their
age still in the range of 6-12 months old. The virulence tests would detect the level of
fungi attack on the stem of gaharu-yielding tree (Figure 8 and Table 6).

Figure 8. The virulence test of Fusarium spp. to gaharu seedling in greenhouse

conditions

14
 PRESENTATION OF THE DATA
Implementing several prospecting inoculums for artificial inducement

Table 6. Virulence test to Aquilaria spp. seedlings in greenhouse condition

fungal virulensi level

Amount of
Fungal Isolate week
seedling
1 2 3
Gorontalo 1 +++ +++
2 +++ +++
3 +++ +++
4 +++ +++
5 +++ ++
Jambi 1 ++ ++
2 ++ ++
3 ++ ++
4 ++ ++
5 ++ ++
West Kalimantan 1 - +
2 + -
3 - +
4 + -
5 - +
West Sumatra 1 + -
2 - +
3 + -
4 - +
5 + -
note :
+ : withered symptoms
++ : languish, withered symptoms and yellowish
+++ : death

In the realization to find the inoculums which were satisfactorily prospective in the
gaharu development, inoculation has been experimentally conducted on the species
of Aquiliaria microcarpa trees that grew at the KHDTK Carita (Forest Area for Special
Purpose), situated in Banten Province. There were four inoculum species already trial
tested, and each of those inoculums originated from Jambi. Gorontalo, Padang (West
Sumatra), and West Kalimantan. Scrutinizing those four isolates as inoculated on A.
microcarpa, it turned out that 75 days afterwards, the symptom of gaharu development
on A. microcarpa stems occurred with 100% chance to all the inoculation holes on those
stems. In the control treatment, where the tree stems were holed, but the isolate liquid
was not injected into the resulting holes, no gaharu development occurred (Figure 9).

15
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Figure 9. Bargraph Aquilaria microcarpa inoculated by four isolates of Fusarium

spp. after 75 days inoculation at KHDTK Carita, Banten

Further, on A. microcarpa stems that revealed the symptom of gaharu development,

some gaharu thin-slices were taken randomly from the portion of those stems. Those
slices as taken and selected should be blackish brown in color to be further tested
qualitatively regarding the fragrant aroma of gaharu as evolved. The results of inoculation
that have reached 75-day age could already develop gaharu with satisfactory qualities.

The same treatment was also conducted on the species of Aquilaria crassna. The
research for conducting such treatment took place in Sukabumi. As such, the A. crassna
trees have already reached 8-year age, which grew on the former rubber plantation. In
number, as many as 80 A. crassna trees grew there. It turned that those four isolates
which were trial tested, entirely afforded the gaharu development 75 days after their
inoculation. Likewise, in the control treatment, no gaharu development occurred (Figure
10).

16
 PRESENTATION OF THE DATA
Implementing several prospecting inoculums for artificial inducement

Figure 10. Bargraph A. crassna inoculated by four isolates of Fusarium spp. after
75 days inoculation in Sukabumi, West Java

In realization, the trial test on gaharu development that seemed prospective at

Aquilaria beccariana species was already done in Sanggau Regency, West Kalimantan
(Figure 11). The trial-test method as implemented was similar to that done on A.
microcarpa dan A. crassna. Those four Fusarium spp. isolates were inoculated to
Aquilaria beccariana-tree stems, and when the inoculation reached 75-day age, all the
isolates afforded the symptom of gaharu development.

Figure 11. Bargraph A. beccariana inoculated by four isolates of Fusarium spp.

after 75 days inoculation at Sengoret, Sanggau, West Kalimantan

17
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

These research results was also added with the data/information as acquired from
the trial test on the gaharu-yielding Gyrinops vergeestii tree species, which grew on
Nagekeo Regency, Flores Island, East Nusa Tenggara (Figure 12). The stem of these
gaharu-yielding trees measured over 20 cm in diameter and 8 meters in height. Those
four isolates was already inoculated to those Gyrinops versteegii trees, and 75 days
afterwards there found the symptom of gaharu development at each tree sample.

Figure 12. Bargraph G. versteegii inoculated by four isolates of Fusarium spp.

after 75 days inoculation in Nagekeo, Flores Island, West Nusa
Tenggara

When the length was measured either horizontally or vertically on the symptom of
gaharu development at the stem of A. beccariana trees, it turned out that the isolate
originated from Gorontalo exhibited the fastest response compared to the other
three isolates (Figure 13 and Figure 14). Likewise, for the species of A. crassna dan
A.microcarpa (data are not provided)., the symptom of gaharu development on these
two species due to the isolate inoculation revealed similar responses as those occurred
to A. beccariana species.

18
 PRESENTATION OF THE DATA
Implementing several prospecting inoculums for artificial inducement

Gaharu-forming of vertical response

1.00
0.80
Average

0.60
(cm)

0.40
0.20
0.00
Gorontalo Padang Jambi West Kalimantan
Origin of inoculum

Figure 13. Vertical response of A. beccariana after inoculation by four isolates of

Fusarium spp. in Sanggau, West Kalimantan

Gaharu-forming of horizontal response

3.50
3.00
Average

2.50
(cm)

2.00
1.50
1.00
0.50
0.00
Gorontalo Padang Jambi West Kalimantan
Origin of inoculum

Figure 14. Horizontal response of A. beccariana after inoculation by four isolates

of Fusarium spp. in Sanggau, West Kalimantan

Special for the realization of the inoculation at the gaharu-yielding trees of Gyrinops
versteegii species, it was already done so at Lombok island, whereby the results of
horizontal and vertical response judged as the fastest were inflicted by the Fusarium
spp. isolates originated from Gorontalo (Figures 15 and 16).

19
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

Gaharu-forming of vertical response

5.00

4.00

3.00
Average
(cm)

2.00

1.00

0.00
Gorontalo Padang Jambi West Kalimantan
Origin of inoculum

Figure 15. Vertical Response of G. versteegii after inoculation by four isolates of

Fusarium spp., Lombok Island, West Nusa Tenggara (NTB)

Gaharu-forming of horizontal response

0.90
0.80
0.70
0.60
Average
(cm)

0.50
0.40
0.30
0.20
0.10
0.00
Gorontalo Padang Jambi West Kalimantan
Origin of Inoculum

Figure 16. Horizontal Response of G. versteegii after inoculation by four isolates

of Fusarium spp, Lombok Island, West Nusa Tenggara (NTB)

Several gaharu samples that resulted from the inoculation work were analyzed of their
chemical-compound content. This intended to determine which chemical compounds
inside those samples that either qualitatively or quantitatively brought about the fragrant

20
 PRESENTATION OF THE DATA
Implementing several prospecting inoculums for artificial inducement

aroma/smell as evolved from the gaharu yielded by the species of Aquilaria spp. and
Gyrinops spp. (Tabel 7).

Table 7. Chemical compound of gaharu in Aquilaria sp. dan Gyrinops sp.

Aromatic compounds
No Name of compounds Aquilaria sp. Gyrinops sp.
1 Cyclopropyl carbinol 3.87 4.76
2 Benzene, 1, 2, 3, D-trimethoxy, 5-methyl- 0.85 0.82
(CAS) Tolerene, 3, 4, D-trimethoxy
3 2. Butanone (CAS) Methylethyl ketone 3.26 -
4 Benzene : 1, 4 - dimethoxy-(CAS) DMB - 2.52
5 1, 2. Cyclopentanedione 3.45 5.17
6 Cyclopentanone (CAS) Dumasin 1.2 1.36
7 2, 2 - Binapthalene, 5, 5', 6, 6', 7, 7', 8, 8'- 0.38 -
octahydro

21
 4
ANALYSIS AND INTERPRETATION OF
THE DATA AND RESULTS

4.1 Selecting suitable inoculums

Dr. Erdy Santoso and Ir. Ragil SB. Irianto, MSc. and their team R&D for Forest
Conservation and Rehabilitation, FORDA have started exploration for potential gaharu-
inducing fungi before the project. The pure cultures of isolates are maintained in the
laboratory and have been screened for their efficiency and effectiveness in inducing the
formation of gaharu (Annex 1-17). In addition, They have been conducting concurrent
activities including searching for potential fungal isolates from gaharu in their natural
habitats and gaharu plantation forests, and in-vitro and in-vivo screenings for their
efficiency and effectiveness, and mass formulation of product for artificial inductions.
Selection of potent gaharu-inducing fungi has been conducted in in vitro (laboratory) and
in the field. Four potent fungi that showed high ability to induce gaharu were selected:
Isolate-G-06, isolate-J-06, isolate WK-06 and isolate WS-06 isolated from natural gaharu-
producing tree in Gorontalo-Sulawesi, Jambi-Sumatra, Sanggau-West Kalimantan, and
Padang-Sumatera. These isolates were maintained in both solid and liquid media in
order to keep the virulence. Their efficiency in inducing gaharu is ongoing on Aquilaria
microcarpa in Forest area with specific purpose (KHDTK) Carita, Java. Selection of potent
inoculant for gaharu induction has been 100% completed. Four isolates designated as
Gt, Kb, Jb, and Pd were selected as the most efficient gaharu-inducing isolates. The
second fiscal year may further screen other isolates collected from many localities in
Indonesia to select more potent isolates in inducing gaharu. These isolates are collections
of FORDA-CC microbe bank of Forest Microbiology Research Group.

Molecular identification of gaharu-inducing fungi by means of 28S rRNA partial gene

sequencing. We believe that the formation of gaharu follows a pathological process
initiated with an infection of fungi on stem/branch tissues of certain tree species. We
have isolated 36 fungi from infected gaharu trees from 17 provinces in Indonesia. Some
of these fungi have been identified as Fusarium spp. conventionally by observing their
morphological characteristics, however this identification needs to be confirmed with
molecular identification by means of 28S rRNA partial gene sequencing. Identification
was conducted in the Laboratory of Forest Microbiology, FORDA. FUS1 and FUS2
primers were used that enabled amplification of up to 460-bp fragment. Most isolates
identified were members of Fusarium solani species complex (Table 1). Only one isolate,
FORDACC-02375, originated from East Kalimantan showed high similarity to Fusarium
oxysporum. This study highlighted a rapid molecular identification protocol for gaharu-
inducing fungi over the conventional measure.

4.2 Developing several prospect inoculum in large

scale
This activity has focused on formulating inoculant for large scale production.
Inoculant can be formulated as solid, pellet, alginate bead or liquid inoculant. For large

23
Te c h n i c a l R e p o r t N o.2
Better Inoculation Engineering Techniques

scale production, this activity has focused on producing liquid inoculants of the four
potent isolates: Gorontalo, West Kalimantan, Jambi, and Padang following protocols
developed by FORDA researchers. We developed fermentation technique for large
scale production and establish quality control procedure to produce inoculant of high
quality. Quality control of inoculant plays an important role in ensuring the effectiveness
and virulence of inoculant for certain period of time. For large scale production, one
shaker with capacity of 500 liter inoculants per month has been purchased and placed
in Forest Microbiology Laboratory.

The development of inoculant in more practical shapes kept inside the bottles each
with 10-15 litres capacity should be done, in order that the farmer group are able to
produce the gaharu themselves. Meanwhile, the sources of core isolates are kept being
held by the research institutions in order that the qualities of the gaharu-developing
fungi could be maintained. Other methods which seem possible to be done are among
others the isolate extract should be packaged using the so-called swelling with 20-30
ml capacity, and in this way that system would be more practical to be carried away in
the field for its application. The farmers are just to dissolve the isolate extract into the
sterile water as much as 2 liters, afterwards the resulting solution is vigorously agitated to
render the resulting solution evenly distributed, and further can be applied by the users.

4.3 Implementing several prospecting inoculums for

artificial inducement
By paying attention thoroughly to Table 5 and Table 6, results of viability and virulence
tests indicated that the fungi originated from Gorontalo, which developed the disease
symptom, worked out better compared to other fungi from Jambi, West Kalimantan,
and West Sumatera, since the latter fungi (i.e. from Jambi, West Kalimantan, and West
Sumatera) caused the death to the inoculated trees. For example, the trees inoculated
with the fungi from Jambi sooner or later suffered from unhealthy growth with their leaves
withering and in color turning yellow. Meanwhile, likewise, the trees inoculated with the
fungi originated from West Kalimantan and Padang (West Sumatera) only showed the
sign that their leaves withered.

From the results of molecular identification as inflicted by 36 gaharu-yielding fungi

strains, could be acquired the species of the so-called Fusarium solani which became
the most dominant of the other strains. Fusarium solani species presented as the best
inoculant that developed gaharu at the four gaharu-yielding tree species, and this species
comes from consecutively Gorontalo and Jambi. Morphologically, the Fusarium solani
isolates were dominated by while-colored mycelia, but there existed colonies with weak
red, yellow, and violet colors. Almost all the isolates exhibited the aerial-mycelium
characteristics.

According to histologically, the Fusarium solani isolates afforded the macroconidia

characteristics dominated by elliptical shape. The fungi originated from Gorontalo
exhibited viability and virulence which was very excellent compared to those of other
fungi from Jambi, West Kalimantan, as well as West Sumatera. At the different research
locations, the Fusarium spp. fungi could induce the gaharu trees more excellently
compared to other fungi from Jambi, West Kalimantan, as well as Padang (West Sumatera),
due to among others the fungi suitability, fungi violence, and the resistance of the trees
themselves.

24
 ANALYSIS AND INTERPRETATION OF THE DATA AND RESULTS
Implementing several prospecting inoculums for artificial inducement

From the results of chemical analysis, it indicated that the wood portion (particularly
sapwood) in Aquilaria sp. and Gyrinops sp. afforded material characteristics or released
specific fragrant smell. Particular for Aquilaria sp., its wood portion contained 2-butanone
compounds as commonly encountered inside the gaharu, in high concentration (3.26%).
From the chemical analysis on both samples as described above (Aquilaria sp. and
Gyrinops sp.), it turned out that each isolate species or each gaharu-yielding tree species
exhibited or released different fragrant-smell characteristics. Further, regarding the
active contents, were also analyzed the gaharu as yielded by those two tree species
(i.e. Aquilaria sp. and Gyrinops sp.).

Secondary metabolites in plants defense system, like phytoantisipin or phytoalexin,

play a big role (Verpoorte et al., 2000). Phytoantisipin is an active compound with anti-
microbe activity which present in plant, but sometimes its activity is stimulated by
wounds. Phytoalexin is an anti-microbial active compound which is produced de novo
after wounding or infection. The biosynthesis of both compound are stimulated in gene
level (Verpoorte et al., 2000; Vidhyasekaran, 2000).

Plants secondary metabolites which are derivated from terpenoid have various
functions in plants; like as an anti-microbial agent (sesqui-, di-, and triterpena). Based
on the various functions, the expression of the related biosynthesis pathways would
be different. There are biosynthesis pathways that are stimulated in gene level after
wounding or infection and there are others that occur in compounds level, where the
already present compounds are to change enzimatically into active compounds when
there is a wound. For instance, certain sesquiterpena biosynthesis in solanaceae is
stimulated when there is microbe infection, whereas in other plants, sequiterpenoid
biosynthesis is a common expression. In Morinda citrifolia, anthraquinone can be found
in all area of the plant (Verpoorte, 2000).

The secondary metabolite concentration varies between species, inter-tissues (the

highest is in the derm, teras wood, roots, branch base, and wounding tissues), between
trees in the same species, inter-species, and is also season-dependent. Tropical and
sub-tropical species usually contain higher extractive amount than temperate trees
(Forestry Comission GIFNFC, 2007).

Under the condition facing the infection by fungi, the gaharu-yielding trees will
exhibit their responses to defend and restore themselves. The resistance of trees will
determine which will be winner between the infected trees and the diseases inflicted
by such gaharu-developing fungi. In the aspects of gaharu development, certainly the
pathogen fungi are expected to be the winner, thereby the gaharu products could be
yielded as desired. The chemical compounds owned by the tree body serves as one
attempt to defend those trees themselves against the pathogen attacks. Meanwhile, the
chemical compounds in the gaharu have been identified as among others sesquiterpenes,
acting as defending compound of phytoalexin type. The vulnerability of trees in facing
the pathogen infection will be related to the gaharu as developed, and these are each
reflected by the extent of infection and the content of other compounds.

Some modification of inoculation engineering technique have been tried in Lombok

(West Nusa Tenggara). There was a problem about environmental condition in mix
plantation between Gyrinops spp. and cacao trees. The local condition is very high
humidity and high rainy intensity. Some of Gyrinops tree were decay condition after
inoculation. They used some nails with pores and also plastic pipe to ensure the liquid
of inoculum inside in stem of gaharu tree (Annex 18 and Annex 19).

25
 Novel findings by gaharu teams have revealed important aspects that determine
the successful of gaharu formation by artificial induction, i.e. methods of injection, fungal
strain type, and growing media for delivering the fungi. Intensive studies for several
years have confirmed efficient gaharu inducing methods, as follows: (i) Injection hole is
of small size of about 3 mm in diameter. The holes will be closed naturally by the plant,
not long after inoculants injection. This closing process of the injection hole is important
in stimulating the formation of gaharu; (ii) Inoculant is delivered in the form of liquid by
injection with a syringe of about 1 ml per hole; (iii) Type of fungal strain determines the
gaharu formed, so screening of efficient strain using few samples in several locations
to confirm its efficiency is essential prior to establishing large demonstration plots; (iv)
Spaces in between holes should be wide enough (about 25 cm apart) to prevent from
overlapping of vertical disease development from each others hole; (v) The quality
of gaharu formed becomes higher with longer incubation time. the Gaharu product
harvested after three years of induction using this method was classified as tanggung a
grade higher than kemedangan, while gaharu harvested from shorter incubation period
was considered as kemedangan grade A-B.
 5
CONCLUSION

From the molecular identification as inflicted by 36 gaharu-yielding fungi strains,

could be acquired the species of the so-called Fusarium solani which became the most
dominant of the other strains. Fusarium solani species presented as the best inoculant that
developed gaharu at the four gaharu-yielding tree species, and this species comes from
consecutively Gorontalo (coded as 0509) and Jambi (coded as 0500). Morphologically,
the Fusarium spp. isolates were dominated by while-colored mycelia, but there existed
colonies with weak read, yellow, and violet colors. Almost all the isolates exhibited
the aerial-mycelium characteristics. Histologically, the Fusarium spp. isolates afforded
the macroconidia characteristics dominated by elliptical shape. The fungi originated
from Gorontalo exhibited viability and virulence which were very excellent compared
to those of other fungi from Jambi, West Kalimantan, as well as West Sumatera. At
the different research locations, the Fusarium spp. fungi could induce the gaharu trees
more excellently compared to other fungi from Jambi, West Kalimantan, as well as
Padang (West Sumatera), due to among others the fungi suitability, fungi violence, and
the resistance of the trees themselves.

FORDA developed fermentation technique for large scale production and establish
quality control procedure to produce inoculant of high quality. Quality control of inoculant
plays an important role in ensuring the effectiveness and virulence of inoculant for
certain period of time. For large scale production, one shaker with capacity of 500
litres inoculants per month has been placed in Forest Microbiology Laboratory, FORDA.

27
 6
RECOMMENDATION

The uses of Fusarium spp. fungi isolates from Gorontalo seems the most
recommendable, since this isolate affords high viability and virulence, and hence can
be implemented to various gaharu-yielding tree species, which grow on several regions
in Indonesia. This is so by considering and following inoculation protocols as enacted
by the FORDA (Forestry Research and Development Agency, administratively under the
Indonesias Ministry of Forestry). For the isolates recommended as the second-best
rank, it is the Fusarium spp. fungi originated from Jambi, since this fungi isolate exhibits
superiority and afford evolving the fragrant aromas which differs from those of isolates
with Gorontalo origin.

It still deserves the further tests on developing Fusarium spp. fungi originated from
various regions, and have been collected by the FORDA to assess the potency of gaharu
development at other gaharu-yielding tree species in the different locations.

29
 7
IMPLICATION FOR PRACTICE

Novel findings by gaharu teams have revealed important aspects that determine
the successful of gaharu formation by artificial induction, i.e. methods of injection,
fungal strain type, and growing media for delivering the fungi. These methods are more
practice, effective, and efficient.

31
ANNEX

33
Annex 1. Pure culture of Fusarium solani from Gorontalo (Sulawesi Island)

34
Annex 2. Pure culture of Fusarium solani from Jambi

35
Annex 3. Pure culture of Fusarium solani from West Kalimantan

36
Annex 4. Pure culture of Fusarium solani from Padang (West Sumatra)

37
Annex 5. Pure culture of Fusarium solani from West Nusa Tenggara
Annex 6. Pure culture of Fusarium solani from Lampung

39
Annex 7. Pure culture of Fusarium solani from Central Kalimantan

40
Annex 8. Pure culture of Fusarium solani from Mollucas.
Annex 9. Pure culture of Fusarium solani from South Kalimantan
Annex 10. Pure culture of Fusarium solani from Riau

43
Annex 11. Pure culture of Fusarium solani from Sukabumi (West Java)

44
Annex 12. Pure culture of Fusarium solani from Yanlapa (West Java)

45
Annex 13. Pure culture of Fusarium solani from Bahorok (Nort Sumatra)

46
Annex 14. Pure culture of Fusarium solani from Bengkulu

47
Annex 15. Pure culture of Fusarium solani from Bogor (West Java)

48
Annex 16. Pure culture of Fusarium solani from East Kalimantan

49
Annex 17. Pure culture of Fusarium solani from Bangka Island.

50
Annex 18. Pure culture of Fusarium solani from Medan (North Sumatra)

51
Annex 19. Nail with pores designed by Forest Research Institute (FRI) Mataram, Lombok (West
Nusa Tenggara).

52
Annex 20. Plastic pipe to keep liquid inoculum inside of gaharu stem in West Nusa Tenggara.

53
54
 BIBLIOGRAPHY

Adelina, N. 2004. Seed Leaflet : Aquilaria malaccensis Lamk. Forest and Landscape
Denmark. www.SL.kvl.dk. [2 February 2007].

Barden, A., A.A. Nooranie, M. Teresia, and S. Michael. 2000. Heart of The Matter
Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis,
TRAFFIC Network.

Forestry Commission GIFNFC. 2007. Chemicals from Trees. http://treechemicals. csl.

gov.uk/review/extraction.cfm. [14 July 2007].

Hannequin, C., Abachin, E.,Symoens, F., Lavarde, V., Reboux, G., Nolard, N., Berche,
P. 1999. Identification of Fusarium species involved in human infection by 28S
rRNA gene sequencing. Journal of Clinical Microbiology Vol. 37 (11):3586-3589.

Heyne, K. (1987). Tumbuhan Berguna Indonesia. Edition III. Badan Litbang Kehu-tanan.
Jakarta. pp. 267-269.

Suhartono, T., A. Mardiastuti. 2002. CITES and Implementation in Indonesia. Nagao

Natural Environment Foundation. Jakarta.

Sumadiwangsa, E. S. dan Harbagung. 2000. Laju Pertumbuhan Tegakan Gaharu (Aquilaria

malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual.
Info Hasil Hutan 6 (1) : 1-16. Pusat Penelitian Hasil Hutan. Bogor.

Surata, I K., I M. Widnyana. 2001. Teknik Budidaya Gaharu. Aisuli 14. Balai Penelitian
Kehutanan Kupang.

Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore,

K. Kain. 2007. Analgesik and Anti-Imflamatoryactivity of Heartwood of Aquilaria
agallocha in Laboratory Animal. Pharmacology-online 1 : 288-298.

Verpoorte, R.; R van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte,
R. and Alfermann, A. W. (Editors). Metabolic Engineering of Plant Secondary
Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p : 31-50.

Verpoorte, R. 2000. Plant Secondary Metabolism. In : Verpoorte, R. and Alfermann, A. W.

(Editors). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic
Publisher. Dordrecht, Boston, London. p : 1-30.

Vidhyasekaran P. 2000. Physiology of Disease Resistant in Plant. Boca Raton, Florida:

CRC Press Inc.

Santoso. E., L. Agustini, M. Turjaman, Y. Sumarna, dan R.S.B. Irianto, 2006. Biodiversitas
dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Temu Pakar Gaharu,
PHKA-ASGARIN. Surabaya.

Sumarna.Y dan E. Santoso. 2002. Budidaya dan Pengembagan Rekayasa Produksi

Gaharu. (Unpublished), Makalah Semiloka Gaharu, Mikoriza, Arang, Cuka Kayu,
Biro KLN dan Investasi, Setjen Departeman Kehutanan. Jakarta.

55
TECHNICAL REPORT NO. 2

Better Inoculation Engineering

Techniques

ISBN 978-979-3145-82-2

9 789793 145822