American Association of Avian Pathologists Avian Diseases
American Association of Avian Pathologists Avian Diseases
REFERENCES
Linked references are available on JSTOR for this article:
https://www.jstor.org/stable/1590612?seq=1&cid=pdf-reference#references_tab_contents
You may need to log in to JSTOR to access the linked references.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide
range of content in a trusted digital archive. We use information technology and tools to increase productivity and
facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected].
Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at
https://about.jstor.org/terms
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Biotechnology Symposium-
H. Graham Purchase
23 July 1985
SUMMARY. The major biotechnological advances that can be applied in the poultry in-
dustry will include molecular genetics, molecular immunology, and solid-state reactions. The
elucidation of the genetic code and the development of techniques to manipulate genes offer
new opportunities for changing pathogenic agents and changing chickens to reduce the effect
of disease and improve productivity. The monoclonal antibody technique and the discovery
that cells of the immune response communicate with one another through peptide factors will
permit improved diagnostic techniques and enhanced immune responses to vaccines. Immu-
nologic and biochemical reactions that occur on a solid substrate can be used to simplify and
accelerate diagnostic tests and to purify antigens and antibodies. These advances will lead to
improvements in diagnosis, disease resistance, and productivity of poultry.
Biotechnology may be defined as the appli- old students will be able to take genes out of a
cation of knowledge and techniques of advancedcommon salivary bacterium and insert them into
biological science and bioengineering to theanother
re- (12).
search, development, or production of commer- It is my ambitious objective to outline some
cial products or processes. It is one of the of
fourthe biotechnological techniques and to ex-
major scientific revolutions of our generation, on possible future applications of those tech-
amine
a par with unlocking the atom, escaping the earth's
niques. I will attempt to bridge the gap between
gravity, and the computer revolution. Biotech-
the scientist in the white lab coat who uses a
nology is permeating our society. Our schools jargon that only he and his peers understand and
are beginning to teach and practice biotechnol-the scientist who was trained a generation ago
ogy. Students are learning a new meaning toand "seehas spent his life on the important practical
Spot run." With "Dr. Cloner's Genetic Engi- aspects of poultry husbandry.
neering Home Cloning Kit," the 10-to- 14-year- In this paper, I will discuss only selected tech-
niques in molecular genetics and immunology. I
will focus on those techniques that I think have
Based on a paper presented at the Annual Meeting
of the American Veterinary Medical Association,future
Las applications in poultry. Of necessity, my
Vegas, Nevada, July 23, 1985. discussion of the techniques will be brief.
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
48 H. Graham Purchase
GT4:Oi.GTCCCG O CCAC
CA
T T G GG C A ATACTAGTATACTT A CTT GTA GT AiC':CAGGCGTC
G S: C GGTT
DNA ACACCGTTA:t'l:'^T. GTATGAT TACATCT:A''': , A.'t:
TRANSCRIPTION
HaN III Eco RI Hae III
RNA A
GT.iS" =iG TCCCGO CCACAACTGGAGCT GGGTGA'G'.t i;GGA
C;A !:CAC GGGCAiG -"iGGTGTTGACCTCGACCCACCT/C!( QGGCCT
UG G CAA AUC:'AN::<., -GU ACUACUAUGU
IELECTROPHOR ESIS
32 15
NUCLEUS
Eco il / /
CYTOPLASM 1 I.. / / / / /
Eco Ra H.. / / / / /
N NA A A Ct 30 26 12 6 4
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 49
SOUTHERN BLOT
NUCLEIC ACID HYBRIDIZATION
RADIOLABELLED
DNA FRAGMENTS
DNA
DNA ATGTGGCAAATGCA C
DNA TACACCGTTTACGT T C
DNA ATGTGGCAAATGCACG'CC
RNA UACACCGUUUACGUUGC4AUC
?B LV"'l Q'RADIOGRAPH
Fig. 3. Nucleic acid hybridization. Strands of DNA
or RNA match up where the messages are identicalFig. 4. A blotting test (Southern b
and stick together (hybridize). Stretches in which the
be tested is digested with enzymes, an
messages are even slightly different remain separate.
are separated by size by electropho
onto a special piece of paper onto w
firmly. Radioactively labelled fragm
of both the starting DNA and the enzyme used the paper hybridize to complementary
to cut it up. Changes in the DNA base sequence to the paper. The excess fragments
by as little as one letter can prevent the enzyme Radiation from the radioactive fragm
from attacking the DNA at that site. The result- film. Where the x-ray film is exposed
of the radioactive and test fragments
ing fragments are different. When DNAs from
different strains of viruses (such as strains of in-
fectious laryngotracheitis virus) or individual
chickens of the same line are treated with re- taining a complementary messa
striction enzymes, they yield fragments oftwo dif- strands stick together wher
ferent sizes (restriction fragment length poly- are complementary and separate
morphisms), which can be used to distinguish sages are dissimilar. The pairing
between the strains. Like fingerprints, theygether can is known as hybridization
be used to trace the origin of the organism. In
complementary nucleic acid stran
comparing organisms, those with the most been sim-heated to stretch them out and separate
ilar patterns of fragments are considered to thembe out into individual strands, are gradually
evolutionarily most closely related. cooled. The degree of specificity of hybridization
As more is known about the genetics ofcan or-be controlled by changing the constituents
ganisms, rapid tests can be developed which ofcan
the medium in which the hybridization occurs.
be used epidemiologically to determine where Under optimum conditions, it is very highly spe-
agents came from (introduced viruses willcific be and hybridization will occur only between
traced to the premises where the original intro- nucleic acids which have significant portions that
duction occurred), etiologically to determine arethe
complementary.
cause of disease, prophylactically to identify Hybridization is used to detect genes or por-
avirulent strains that can be used as vaccines, tions of genes in the DNA of organisms. The
and immunologically to identify chickens thatpresence of a portion of a gene may be used as
produce a high immune response. an indication that the whole gene is present or
Nucleic acid hybridization. Nucleic acids are even that the whole organism is present. The
either DNA that carries the original or RNA that "Southern blot" (Fig. 4) allows one to determine
carries the transcribed instructions or messages. the size of the gene fragment on which the por-
Because A and T always pair and G and C always tion of the gene occurs. In the procedure, DNA
pair, a strand of nucleic acid with a particular is cut into fragments using a restriction enzyme
message will match up or pair with a strand con- (Fig. 2), and the fragments are separated by size
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
50 H. Graham Purchase
AMPLIFICATION OR 'SANDWICH'
DNA
TO BE
TESTED
INDICATOR
MOLECULES
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 51
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
52 H. Graham Purchase
genes are being sequenced. For example, a recentpieces of genetic information that code for small
search of the National Institutes of Health da- sections of the protein may be all that is necessary
tabank (L. B. Crittenden, personal communica-to produce a function. The peptide analog of So-
tion) revealed that 142 chicken somatic genes ormatostatin produced by Merck, Inc., is half the
parts of genes have been sequenced. The list in-size of the original protein yet 50-100 times as
cludes parts of 3 duck, 2 quail, and 1 pigeon potent (20). There is a bright future for producing
genes, 50 avian leukosis/sarcoma genes, 6 reticu-peptide neurohormones, growth factors, lym-
loendotheliosis genes, 2 avian adenovirus genes, phokines, and antigens by these techiques.
and 200 genes of influenza viruses of chickens, Recombining and cloning of genes. The abil-
ducks, and turkeys. ity to recombine DNA from two different or-
Chemical synthesis of DNA has been highly ganisms is fundamental to genetic engineering.
automated by using solid-state chemistry in "geneSome restriction enzymes that cut DNA at spe-
machines." There is similar automation of pro- cific sites leave single-stranded protrusions called
tein synthesis (18). "sticky ends" (Fig. 9). Ends stick to one another
Sequencing and synthesis are powerful tools because the bases are complementary. Two DNAs
in determining the function of genes. They can from different organisms cut by the same enzyme
be used to identify the portions of a virus that become "annealed" by base pairing. These
are antigenic and to which antibody binds. Once strands can be permanently joined by a ligating
the sequence of an antigen is known, it can be enzyme.
synthesized from the amino acid building blocks, Genes from one organism, such as the anti-
as has been done with foot-and-mouth disease genic protein of foot-and-mouth disease virus,
can be spliced into a plasmid from a bacterium,
virus (3). It is important to note that very short
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 53
fQCOMAINANT DB&
such as Escherichia coli (Fig. 10). (Plasmids are
circular, self-replicating DNA containing hered- DNAI DNA 2
itary material that is not part of the chromosome ' i:'''::'? ' :-." ::'::::::t':": . .GGATCC
":e::ric:ion nsy*'r:&'"c::'?t:on E....m.
of a bacterium.) The plasmid is referred to as a
"vector." The plasmid DNA containing the
I ANNEAL
spliced-in DNA of foot-and-mouth disease virus
can be inserted into the bacterium. The bacte-
rium uses its internal machinery to produce cop-
DNA LIGASE4 ' c
ies of the plasmid containing the virus DNA, and
i:!'::% GAT
in turn the plasmid causes production of quan- RECOMBINED DNA
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
54 H. Graham Purchase
from E. Coli 9
Bacterium
VP3 Protein*
RNA Core
RNA is Splice
VP3Codons template for VP3-specific
DNA cDNA fragment
synthesis into plasmids
0
a
0
Insert
VP3 '"
Growing E. Coli bacteria may produce VP3 for
use as vaccine for foot-and-mouth disease. No
virus or infectious RNA is produced by the
harmless bacteria strain.
*VP3 is the protein from the shell of the virus which can act as a vaccine for immunizing
livestock against foot-and-mouth disease. The idea outlined above is to make this VP3
protein without making any virus or infectious RNA.
Fig. 10. Cloning of foot-and-mouth antigen in E. coli. The sequence for VP, (which used to be nam
the protective antigen of the virus, was known. The virus contains only RNA, so a complementary D
was made using the viral RNA as template. The DNA was spliced into a plasmid (circular piece of
the bacterium, which was inserted back into the bacterium. The bacterium transcribed and translated th
for VP, and made the VP, protein.
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 55
incorporation into vaccinia virus should follow tibodies. In a manner similar to the hybridization
similar lines. Incorporation of complementary technique (Fig. 6), the sensitivity of a reaction of
DNA of RNA viruses such as Newcastle and monoclonal antibody with an antigen can be in-
infectious bronchitis should be possible, and creased
thegreatly by use of the "sandwich" tech-
use of fowl or pigeon pox as a vector maynique have or by amplification using enzymes or ra-
advantages over vaccinia. Work on recombining dioassay. The antibodies should always be
pox viruses with Marek's disease, avian leukosis, available, because they can be stored away fro-
and infectious bronchitis viruses is underway. zen, whereas obtaining more of a polyclonal an-
Live recombinant virus vaccines likely will tibodyin- is prevented by the death of the animal.
duce a better cellular immunity, and theHowever, im- monoclonal antibodies have many
munity will persist longer than with killed disadvantages.
or Sometimes the hybridomas are
subunit vaccines. not stable, produce antibodies of low affinity, or
produce antibodies with a short shelf life. Mono-
The use of eukaryotic cells in culture as a host
for the production of biologically active proteinsclonal antibodies may be too specific and give
poor epitope coverage. To date, monoclonal an-
is also a possibility. It offers the advantage that
the product would not have to be purified iftibodiesit can be produced only by using mouse
was used on the same species, because it did not tumor cells and either mouse or bovine lympho-
contain any foreign proteins. Because the phys- cytes. The mouse or bovine immune response
may not always be optimal. Problems in com-
iology of eukaryotic cells is so different from that
of prokaryotic cells, it may not be possible mercial
to production include high cost and diffi-
biosynthesize many compounds in prokaryotic culty in ensuring purity.
cells. In these instances, eukaryotic cells offer the In both diagnosis and prophylaxis, monoclo-
best opportunity. nal antibodies have an advantage where the added
specificity over polyclonal antibodies is needed.
MOLECULAR IMMUNOLOGY Polyclonal antibodies may have an advantage
where group reactions are sought or where the
Monoclonal antibodies. When an animal is antigens being sought are very variable and are
exposed to antigen (a foreign substance), notcells of to pathogenicity.
related
the immune system (lymphocytes) recognize an-
Monoclonal antibodies can be used in a variety
tigenic sites (epitopes) on the antigen and startincluding agglutination, precipitation,
of tests,
producing antibodies that bind with those sites.
neutralization, lysis, antibody-dependent cyto-
Each lymphocyte that responds divides toxicity, into a radioimmunoassay (RIA), enzyme-
clone of cells, and each member of the clone linked immunosorbent assay (ELISA), fluores-
produces identical antibody molecules. Antigens cence, and luminescence. Monoclonal antibodies
usually have many epitopes; therefore, at any one can also be used for affinity chromatography to
time, many clones of cells are responding to the isolate and purify antigens. The antibodies are
antigens by producing antibodies of different particularly useful in the identification of the
types. Thus the antibody produced in normal products of immune-response genes.
animals is polyclonal antibody, i.e., many clones In the future, it is likely that chicken/mouse
of cells producing antibody of many different hybridomas and even chicken/chicken hybrid-
types. Using the hybridoma technique described omas will be developed that produce avian im-
elsewhere in this symposium, a single clone of munoglobulins. Although it is unlikely that the
cells which produces just one type of antibody transfer of passive immunity to chicks using
to one epitope (monoclonal antibody) is isolated monoclonal antibodies will be profitable in the
from a recently immunized animal. Hybridomas poultry industry, chicken antibodies would be
that are the fusion products of cancer and normal useful in research.
antibody-producing cells grow indefinitely, a trait Antibody-drug conjugates are being explored
acquired from the tumor, and they produce an- extensively for the treatment of human cancer.
tibody of only one type, a trait acquired from the The antibody takes the drug to the target cell so
clonal progeny of the responding lymphocytes. that the effect of the drug is focused and much
Monoclonal antibodies, because they recog- less drug is needed. It seems unlikely that this
nize only one epitope, are always much more technique would offer therapeutic prophylactic
highly specific and uniform than polyclonal an- possibilities for poultry.
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
56 H. Graham Purchase
INDUCTION EXPANSION DIFFERENTIATION Study and exploitation of these has just begun.
O ANT tGEN
Interferon (13), interleukins- 1 (11) and -2 (16),
LYMPHOBLAST HELPER and several growth factors (9) have been cloned
* and expressed. Undoubtedly many other peptide
T-CELL
factors will be produced commercially. Some of
T'^l^ -CELL ^^U \^^^^/SUPPRESSOR them will be species-specific, and others will cross
species boundaries. In either instance, commer-
SECRETING KILLER
IL2 cial production of these substances may be ex-
"CSECRETING
IL I : ,
ploited in the poultry industry. For example, the
peptides that stimulate the immune response or
l. ")I?GE Let --@i @AMPLIFIER
MACROPHA
substances that stimulate the production of pep-
T-CELL
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 57
SOLID-STATE REACTIONS
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
58 H. Graham Purchase
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Future of biotechnology in poultry 59
18. Spatola, A. F. Automated solid phase peptide R. S. Nussenzweig, and V. Nussenzweig. Rationale
synthesis. Am. Biotech. Lab. 2:14-22. 1984. for development of synthetic vaccine against Plas-
19. Stanley, C. J., F. Paris, A. Plumb, W. Webb, and modium falciparum malaria. Science 228:1436-1440.
A. Johannson. Enzyme amplification: a new technique 1985.
for enhancing the speed and sensitivity of enzyme im-
munoassays. Am. Biotech. Lab. 3:48-53. 1985.
ACKNOWLEDGMENTS
20. Veber, D. F., R. Saperstein, R. F. Nutt, F. M.
Freidinger, S. F. Brady, P. Curley, D. S. Perlow, W. J. The author thanks Paul P. Padovano for the art work
Paleveda, and C. D. Colton. A super active cyclic hexa
and L. Knutson, John B. Dame, Lila Vodkin, and Louis
peptide analog ofsomatostatin. Life Sci. 34:1371. 1984.
Gasbarre for critical review of the manuscript.
21. Zavala, F., J. P. Tam, A. H. Cochrane, I. Quakyi,
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms