See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/323865205

Expression of genes for enzymes synthesizing lysophosphatidic acid, its

receptors and follicle developmental factors derived from the cumulus-oocyte
complex is dependent on the ova...

Article  in  Animal Reproduction Science · March 2018

DOI: 10.1016/j.anireprosci.2018.03.018

CITATIONS READS

0 25

7 authors, including:

Emilia Sinderewicz Katarzyna Grycmacher

Institute of Animal Reproduction and Food Research of Polish Academy of Sciences Institute of Animal Reproduction and Food Research of Polish Academy of Sciences
23 PUBLICATIONS   104 CITATIONS    14 PUBLICATIONS   51 CITATIONS   

SEE PROFILE SEE PROFILE

Dorota Boruszewska Joanna Staszkiewicz-Chodor

Institute of Animal Reproduction and Food Research of Polish Academy of Sciences Institute of Animal Reproduction and Food Research of Polish Academy of Sciences
27 PUBLICATIONS   171 CITATIONS    1 PUBLICATION   0 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Jsps oka View project

All content following this page was uploaded by Izabela Woclawek-Potocka on 16 October 2018.

The user has requested enhancement of the downloaded file.

 Animal Reproduction Science 192 (2018) 242–250

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Expression of genes for enzymes synthesizing lysophosphatidic

T
acid, its receptors and follicle developmental factors derived from
the cumulus-oocyte complex is dependent on the ovarian follicle
type in cows
Emilia Sinderewicza, Katarzyna Grycmachera, Dorota Boruszewskaa,
Ilona Kowalczyk-Ziębaa, Joanna Staszkiewicz-Chodora, Krzysztof Łukaszukb,
⁎
Izabela Wocławek-Potockaa,
a
Department of Gamete and Embryo Biology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, 10-747 Olsztyn,
Poland
b
Department of Nursing, Medical University, 80-210 Gdansk, Poland

A R T IC LE I N F O ABS TRA CT

Keywords: Cumulus-oocyte complexes (COCs) release factors potentially involved in follicular growth and
Cow development, such as growth and differentiation factor 9 (GDF9), bone-morphogenetic protein
Cumulus-oocyte complex 15 (BMP15), follistatin (FST) and cathepsins (CTSs). Moreover, the quality of the oocytes and
Follicular development follicles may be related to both the lipid composition of the follicle cells and follicular fluid. One
Lysophosphatidic acid
of the lipids, locally regulating the reproductive functions in ovaries of cattle, is lysophosphatidic
acid (LPA). In this study, the expression was investigated of the genes for LPA and other factors in
COCs of follicles at different stages of development and regression. The relative abundances of
mRNA were determined by real-time PCR for receptors for LPA (LPARs), enzymes synthesizing
LPA (autotaxin (AX) and phospholipase A2 (PLA2)), BMP15, GDF9, CTSZ, CTSB and FST in COCs
isolated from healthy, transitional and atretic follicles. The expression of genes for the LPARs,
AX, PLA2 and the factors involved in follicular development in cattle COCs is follicle-type de-
pendent. Greater expression of LPAR1-3 and AX genes were detected in the healthy follicles
compared to the atretic and transitional follicles (P < 0.05). The relative abundance of GDF9,
BMP15, CTSZ and CTSB was also greater in COCs from healthy follicles than from transitional
and atretic follicles (P < 0.05). It is postulated that the greater expression of LPARs and AX
genes in healthy follicles compared with atretic follicles indicates an enhanced role of LPA in
follicular development. Results of the present study also suggest the regulatory role of factors
derived from the COCs in the growth and development of follicles.

1. Introduction

The ovarian follicle is the functional unit of the ovary, in which the somatic (theca and granulosal cells) and germ (oocyte)
components are in close proximity to each other and have interdependent functions (Moenter et al., 1992; Aerts and Bols, 2010). The
ovarian follicular microenvironment and maternal signals, which are mediated primarily through granulosal and cumulus cells, are

⁎
Corresponding author.
E-mail address: [email protected] (I. Wocławek-Potocka).

https://doi.org/10.1016/j.anireprosci.2018.03.018
Received 19 December 2017; Received in revised form 5 March 2018; Accepted 16 March 2018
Available online 19 March 2018
0378-4320/ © 2018 Elsevier B.V. All rights reserved.
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

responsible for nurturing the oocyte growth and gradual acquisition of developmental competence (Gilchrist et al., 2008). Ad-
ditionally, the cumulus-oocyte complexes (COCs) release factors that are involved in follicular growth and development, such as
members of the transforming growth factor beta (TGFβ) superfamily (Bodensteiner et al., 1999). Furthermore, the oocyte quality may
be closely related to both oocyte and the follicular fluid lipid composition (Lapa et al., 2011; Prates et al., 2013). Among the lipids
that regulate female reproductive functions is lysophosphatidic acid (LPA). It has been documented that LPA is responsible for
modulation of prostaglandin (PG) synthesis and secretions in the endometrium and progesterone from the corpus luteum (Ye et al.,
2005; Woclawek-Potocka et al., 2010). The endogenous LPA also positively affected conception rates of cattle (Woclawek-Potocka
et al., 2010). In the granulosal and thecal cells of cattle, expression of genes for the receptors of LPA and enzymes regulating the
production of LPA correlate with factors involved in follicular growth and development (Sinderewicz et al., 2018). In vitro studies
have been conducted that indicate LPA increased oocyte maturation rates and cumulus cell expansion and decreased apoptosis in
COCs of cattle (Boruszewska et al., 2015; Zhang et al., 2015). The expression of genes for LPA in COC’s derived from the different
follicle types have not previously been investigated. Considering the regulatory role of LPA in the reproductive tract of cattle, the
follicle-type-dependent gene expression and role of LPA in granulosal and thecal cells and the interdependence of all follicular
components, the aim of the present study was to investigate the expression of LPA genes in COCs of cattle originating from different
follicle types (healthy, transitional and atretic). In this study, there was also assessment of whether oocyte quality markers (follistatin
(FST), growth and differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), and the cysteine proteinases-cathepsins
(CTSB and CTSZ)) gene expression is follicle-type-dependent. Furthermore, it was hypothesized that expression of the genes for the
enzymes regulating LPA production, receptors for LPA and factors derived from cumulus-oocyte complexes is follicle-type-dependent.

2. Materials and methods

2.1. Collection of the ovaries

All experimental procedures were approved by the Local Animal Care and Use Committee in Olsztyn, Poland (Agreement No. 34/
2012/N). Ovaries of cattle, without consideration of the stage of the estrous cycle, were collected at a local abattoir and transported
to the laboratory in sterile phosphate buffered saline (PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2KPO4, 1.8 mM KH2PO4,
pH = 7.4)), supplemented with 0.4% gentamycin (Sigma Aldrich, Saint Louis, MO, USA; #G-1397), within 40 min.

2.2. Collection of the experimental material

The follicular fluid was aspirated using a syringe from a single, subordinate ovarian follicles (diameter < 5 mm). Based on the
intra-follicular estradiol:progesterone (E2:P4) ratio (according to Grimes and Ireland, 1986), the ovarian follicles were divided into
three categories: healthy (E2:P4 > 1), transitional (0.01 < E2:P4 < 1) and atretic (E2:P4 < 0.01). The E2 and P4 concentrations
were measured in the follicular fluid using the RIA method (with, respectively, the DIAsource E2–RIA–CT Kit (sensitivity: 2.7 pg/mL,
intra-assay precision: CV = 5.6%, inter-assay precision: CV = 10.4%), KIP0629, Diasource and the DIAsource PROG–RIA–CT Kit
(sensitivity: 0.05 ng/mL, intra-assay precision: CV = 5.2%, inter-assay precision: CV = 8.6%), KIP1458, Diasource, Ottignies-Lou-
vain-la-Neuve, Belgium). After collection of the follicular fluid, the antral cavity of each follicle was flushed with cold PBS to recover
the COCs under the stereoscopy microscope (SZX10, Olympus, Poland). The COCs, obtained from single follicles, categorized as
healthy (n = 12), transitional (n = 12) or atretic (n = 12) were used for the study. The samples were collected in Extraction Buffer
(#KIT0204, Arcturus PicoPure RNA Isolation Kit, Applied Biosystems, Life Technologies, Carlsbad, CA, USA) and stored at −80 °C
until the RNA extraction process.

2.3. Total RNA extraction, reverse transcription (RT) and real-time PCR

The samples were processed for RNA isolation according to manufacturer's instructions (#KIT0204, Arcturus PicoPure RNA
Isolation Kit, Applied Biosystems, Life Technologies, Carlsbad, CA, USA). DNase treatment was performed to remove genomic DNA
contamination using RNase-free DNase Set (#79254, Qiagen, Hilden, Germany). Samples were stored at −80 °C until reverse
transcription procedures were conducted. Before use, the RNA content and quality were evaluated by spectrophotometric mea-
surements. Reverse transcription (RT) was performed using oligo (dT)12–18 primers (#18418-012, Thermo Scientific, Carlsbad, CA,
USA) by Super Script III reverse transcriptase (#18080-044, Thermo Scientific, Carlsbad, CA, USA) in a total volume of 20 μL. The RT
products were stored at −20 °C until real-time PCR amplification.
The relative abundance of mRNA for the enzymes responsible for LPA synthesis (phospholipase A2 – PLA2 and autotaxin – AX),
receptors for LPA (LPAR1–LPAR4) and oocyte quality markers (BMP15, GDF9, FST, CTSB, CTSZ) was measured by real-time PCR
using specific TaqMan probes. Real-time PCR was performed with an ABI Prism 7900 (Applied Biosystems, Life Technologies,
Carlsbad, CA, USA) sequence detection system using Maxima Probe/ROX qPCR Master Mix (#K0231, Thermo Scientific, Carlsbad,
CA, USA). The PCR reactions were performed in 384-well plates. The mRNA transcription results were normalized to the β-actin
(ACTB, an internal control) amount of mRNA and expressed as arbitrary units. The housekeeping gene was chosen using the
NormFinder software by comparing the following two candidate genes: GAPDH and β-actin (Andersen et al., 2004). The primers and
probes were designed using an online software package (http://frodo.wi.mit.edu/primer3/input.htm). The data for primer sequences
and the sizes of the amplified fragments of all of the transcripts are included in Table 1. For the relative abundance quantification of
mRNA, the Miner software was used, based on the kinetics of individual PCR reactions. The Miner algorithm allows direct calculation

243
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

Table 1
Sequences of PCR primers (F = forward, R = reverse), TaqMan probes (P), and GenBank codes for gene transcripts used to assess the relative mRNA abundance of LPA
receptors, enzymes synthetizing LPA and oocyte quality markers in COCs isolated from healthy, transitional and atretic types of ovarian follicles of cattle.

Gene GenBank ID Primer sequences Primer size, bp Amplicon size, bp

ACTB AY141970.1 F: 5’CGTCCACCGCAAATGCTT’3 18 85

R: 5’TCTCGTTTTCTGCGCAAGTTAG’3 22
P: 5’TAGGCGGACTGTTAGC’3 16

LPAR1 NM_174047.2 F: 5’GTTCAACACAGGGCCCAATACT’3 22 85

R: 5’AACCGTCAGGCTGGTGTCA’3 19
P: 5’TGACTGTCAGCACGTGGCTCCTGC’3 24

LPAR2 NM_001192235.1 F: 5’GTCTCTGAGCCTGCGGGTTA’3 20 80

R: 5’TGACTTCAGAGCCCAATTCTTG’3 22
P: 5’CATCTATGCAACTGGGAG’3 18

LPAR3 NM_001192741.2 F: 5’TCAAGTAAAGCACGGGCAGAA’3 21 90

R: 5’CGGGTGAGAACGCATTGTG’3 19
P: 5’AGGACACGTGCATTTACAGA’3 20

LPAR4 NM_001098105.1 F: 5’ATCACCAATCTGGCCCTCTCT’3 21 80

R: 5’CAGTGGCGGTTGAAATTGTAAAA’3 23
P: 5’CTCTTTGTCTGCACTCTA’3 18

AX NM_001080293.1 F: 5’CCATTATTCCCACAAGTTCACAGTA’3 19 80
R: 5’TGTCAAGCATGTCACCAAAGGT’3 20
P: 5’TGCCACAAAAGTGACAAA’3 18

PLA2 NM_001075864.1 F: 5’CCATTATTCCCACAAGTTCACAGTA’3 25 80

R: 5’TGTCAAGCATGTCACCAAAGGT’3 22
P: 5’TGCCACAAAAGTGACAAA’3 18

GDF9 AC_000164.1 F: 5’ATGGCGCTTCCCAACAAA’3 18 80

R: 5’GGCTGAGAATCAAGGCTAATAGGA’3 24
P: 5’TCTTCCTTTGGTTTTGCTGCTTTGCCTG’3 28

BMP15 AC_000187.1 F: 5’CCATCATCCAGAACCTTGTCAA’3 22 110

R: 5’CCCATTTGCCTCAATCAGAAG’3 21
P: 5’TGTCCCTCAGCCTTCCTGTGTCCCTTAT’3 28

FST AC_000177.1 F: 5’GTGTGTGGGCTGGATGGAA’3 19 100

R: 5’ATTTGCCCTGGTACTGGACTTG’3 22
P: 5’AACGAATGTGCACTCCTCAAGGCCAG’3 26

CTSB AC_000165.1 F: 5’TGCCCTCTAATCCACAGTGAAAC’3 23 100

R: 5’TTTATTGGCAGCCATTCCTTGT’3 22
P: 5’CTTGTACCTTTTGCAATCACTGCTTCACCC’3 30

CTSZ AC_000170.1 F: 5’CCCGGCCTCATGAGTACCT’3 19 75

R: 5’AGTTGACCCCATTCACATTGC’3 21
P: 5’TCCCCGTCGGATCTCCCCAAG’3 21

of the reaction efficiency and the fractional cycle number at threshold (CT) (http://www.miner.ewindup.info).

2.4. Statistical analysis

Statistical analyses were conducted using the GraphPad PRISM v. 6.0 software (GraphPad Software, Inc., San Diego, CA, USA). All
experimental data are provided as the mean ± SEM, and differences were considered significantly different at the 95% confidence
level (P < 0.05). Analyses were performed using a one-way ANOVA, followed by Tukey’s multiple comparison test (Figs. 1–3,
Table 2) or t-student test (Table 3).

3. Results

3.1. Relative abundance of mRNA for LPA receptors in the COCs

The relative abundance mRNA for all of the LPA receptors was determined in COC’s of healthy, transitional and atretic ovarian
follicles (Fig. 1). The greatest relative abundances of mRNA were detected for LPAR2 in the three follicle types (Table 2, P < 0.05).
The relative abundance for mRNA of LPAR1 and LPAR2 was greater in the healthy follicles than transitional and atretic follicles
(Fig. 1 A, P = 0.0237; Fig. 1B, P < 0.0001, respectively). The relative abundance of mRNA for LPAR3 was greater in the healthy and
transitional follicles than in atretic follicles (Fig. 1C, P = 0.0125). There were similar relative abundances of mRNA for LPAR4 in the
healthy, transitional and atretic follicle types (Fig. 1D, P = 0.9449).

244
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

Fig. 1. The mRNA relative abundance of the receptors for LPA, including LPAR1 (Fig. 1A), LPAR2 (Fig. 1B), LPAR3 (Fig. 1C), and LPAR4 (Fig. 1D), in cumulus−oocyte
complexes originating from healthy, transitional and atretic ovarian follicles. Small superscript letters a and b indicate differences in the respective mRNA ratios within
the various types of follicles (P < 0.05), as determined by a one-way ANOVA followed by Tukey’s multiple comparison test.

Fig. 2. The mRNA relative abundance of autotaxin (AX; Fig. 2A) and phospholipase A2 (PLA2; Fig. 2B) in cumulus−oocyte complexes originating from healthy,
transitional and atretic ovarian follicles. Small superscript letters a and b indicate differences in the respective mRNA ratios within the various types of follicles
(P < 0.05), as determined by a one-way ANOVA followed by Tukey’s multiple comparison test.

3.2. Relative abundance of autotaxin and phospholipase A2 in the COCs

The mRNA for both enzymes involved in LPA synthesis was detected in healthy, transitional and atretic ovarian follicles (Fig. 2A,
B). There was a greater relative abundance of mRNA for AX than PLA2 (Table 3, P < 0.05). The relative abundance of AX mRNA was

245
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

Fig. 3. The mRNA relative abundance of the factors involved in follicular development (bone morphogenetic protein (BMP15; Fig. 3A)), growth and differentiation
factor 9 (GDF9; Fig. 3B), cathepsin B (CTSB; Fig. 3C), cathepsin Z (CTSZ; Fig. 3D), and follistatin (FST; Fig. 3E) in the cumulus−oocyte complexes originating from
healthy, transitional and atretic ovarian follicles. Small superscript letters a and b indicate differences in the respective mRNA ratios within the various types of
follicles (P < 0.05), as determined by a one-way ANOVA followed by Tukey’s multiple comparison test.

246
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

Table 2
The mRNA relative abundance of the receptors for LPA in cumulus−oocyte complexes originating from healthy, transitional and atretic ovarian follicles. Small
superscript letters a and b indicate differences in the respective mRNA ratio of the LPARs from healthy, transitional or atretic follicle types (P < 0.05), as determined
by a one-way ANOVA followed by Tukey’ multiple comparison test.

Type of receptors for LPA

Follicle type LPAR1 LPAR2 LPAR3 LPAR4

healthy 0,0315a ± 0,0017 0,8694b ± 0,0566 0,0006a ± 0,0001 0,0139a ± 0,0007

transitional 0,0103a ± 0,0037 0,0739b ± 0,0365 0,0007a ± 0,0001 0,0138a ± 0,0012
atretic 0,0022a ± 0,0007 0,0077b ± 0,0008 0,0002a ± 0,00001 0,0135c ± 0,0006

Table 3
The mRNA relative abundance of the enzymes synthesizing LPA in cumulus−oocyte complexes originating from
healthy, transitional and atretic ovarian follicles. Small superscript letters a and b indicate differences in the re-
spective mRNA ratio within the PLA2 and AX from healthy, transitional or atretic follicle types (P < 0.05), as
determined by a t-student test.

Enzymes synthesizing LPA

Follicle type PLA2 AX

a
healthy 0,0003 ± 0,00002 0,0075b ± 0,0001
transitional 0,0008a ± 0,00005 0,0021b ± 0,0006
atretic 0,0001a ± 0,00001 0,0003b ± 0,00001

less in atretic and transitional follicles than in healthy follicles (Fig. 2A, P = 0.02642). There was the greatest relative abundance of
PLA2 mRNA in the transitional follicle type (Fig. 2B, P = 0.0200).

3.3. Relative abundance of oocyte quality markers (BMP15, GDF9, CTSB, CTSZ, FST) in COCs

The mRNA for all factors was detected in healthy, transitional and atretic ovarian follicles (Fig. 3). The relative abundance of
mRNA for BMP15 and GDF9 was greater in healthy follicles than in transitional and atretic follicles (Fig. 3A, P = 0.0002; Fig. 3B,
P = 0.0065, respectively). Similarly, the relative abundance of mRNA for CTSB (Fig. 3C, P = 0.0076) and CTSZ (Fig. 3D, P = 0.0006)
was greater in the healthy follicles than in the transitional and atretic follicles. Similar relative abundances of mRNA of FST were
observed in healthy, transitional and atretic follicle types (Fig. 3E, P = 0.0914).

4. Discussion

The role of LPA in the female reproductive tract has been studied intensively for almost 10 years. Previous studies showed that
LPA was locally produced and was involved in regulation of the uterus (Woclawek-Potocka et al., 2009a,b,c; Woclawek-Potocka
et al., 2010), oviduct (Sinderewicz et al., 2016) and ovary (Kowalczyk-Zieba et al., 2012; Boruszewska et al., 2013) of cattle. More
recent reports demonstrated the presence and role of LPA in the oocyte and cumulus cells of cattle (Komatsu et al., 2006;
Boruszewska et al., 2014, 2015), although the present study is the first report of LPA in COCs originating from three different follicle
types. In the present study relative abundance of mRNA was determined for the four types of LPARs in COCs in all examined follicle
types. The greatest relative abundance of mRNA for LPAR1-3 was in COCs of healthy follicles, and the least was in atretic follicles,
with there being a marked relative abundance for LPAR2 in all types of follicles. Of the LPARs, the relative abundance of LPAR2 was
also the greatest in corpus luteum (Kowalczyk-Zieba et al., 2012), oocytes and cumulus cells of cattle (Boruszewska et al., 2014).
Interestingly, in the population of granulosal cells, regardless of the follicle type, the dominant isoform of LPARs was LPAR1
(Boruszewska et al., 2013), which may have occurred because of the relatively large volume of mural granulosal cells in the ovarian
follicles of cattle.
In the present study, the presence of mRNA for enzymes synthesizing LPA – AX and PLA2 – was confirmed in COCs originating
from different follicle types. The relative abundance of mRNA for AX was greater than for PLA2 in all follicle classes. In the study of
Boruszewska et al. (2014), there was a greater relative abundance of mRNA for AX than for PLA2 in oocytes of cattle. Surprisingly,
the relative abundances for these mRNAs was the opposite for cumulus cells as compared with oocytes. Moreover, the relative
abundance of mRNA for AX was greater in COCs that had been isolated from healthy follicles than in the transitional and atretic
follicles, which is consistent with the results where it was reported that the greatest mRNA relative abundances were for the main
enzyme synthetizing LPA in theca and granulosal cells (Sinderewicz et al., 2017a,b). The relative abundance of LPA in the ovarian
follicular fluid of cattle was also follicle-type dependent: the greatest concentration of LPA being in the healthy and dominant follicles
compared with the transitional and atretic follicles (Sinderewicz et al., 2017a). The follicular fluid forms a unique microenvironment,
which provides the energy required for the appropriate oocyte growth and maturation. Boruszewska et al. (2015) documented the
influence of LPA on the maturation process by providing the proper conditions for glucose transfer and metabolism. The glucose in

247
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

the follicular fluid may be an alternative source of energy, and the accumulation of fatty acids is an integral component of energy
storage in oocytes. With these considerations, as well as the lesser mRNA relative abundances for LPARs and LPA in COCs isolated
from atretic follicles compared with healthy follicles, which are the predominant follicle precursors, it is postulated that LPA en-
hances the developmental processes of COCs prior to ovulation. Furthermore, it is also postulated that the LPARs and AX are essential
factors for the viability of COCs, therefore, these factors may be a reliable marker indicating the quality of oocytes.
The complete folliculogenesis and development of the oocyte require constant and bilateral communication among the oocytes,
cumulus cells and other somatic cells of the follicle (Edson et al., 2009; Wigglesworth et al., 2013). Among the factors secreted by the
oocyte are members of the TGFβ superfamily (GDF9 and BMP15), which are required to regulate the growth and development of the
follicle and to control proliferation and function of granulosal cells (Juengel and McNatty, 2005; Gilchrist et al., 2008; Li et al., 2014).
In the present study, the presence was assessed of mRNA for both GDF9 and BMP15 in healthy, transitional and atretic types of
ovarian follicles. The greatest mRNA relative abundances of GDF9 and BMP15 were detected in COCs originating from healthy
follicles compared to those from the transitional and atretic follicles. The presence of the molecules in the different follicle categories
may indicate the function of these factors, which is the activation of primordial follicles and the subsequent follicular development
and differentiation (Dong et al., 1996; Bodensteiner et al., 1999). The oocyte-derived GDF9 and BMP15 are also involved in the
steroidogenesis of granulosal cells (Gilchrist et al., 2008; Paulini and Melo, 2011) because the most consistent characteristic of the
dominant follicle in cattle is great amount of estradiol production. The greatest relative abundance of GDF9 mRNA was in healthy
follicles suggesting that GDF9, in addition to being the oocyte quality marker, may be an important marker of follicle quality and
function of cumulus cells. Although GDF9 in cattle is exclusively present in oocytes, in other ruminants, it is also present in cumulus
cells (Varnosfaderani et al., 2013).
In the present study, ovarian follicles were divided into three categories using the previously published criteria of Grimes and
Ireland (1986), however, the characteristics – structural, functional or both – of the follicles in the three categories had not previously
been investigated. The follicle-type-dependent relative abundance of GDF9 and BMP15 mRNA indicates the functional diversity of
ovarian follicles of cattle, and is consistent with findings in previous studies (Sinderewicz et al., 2017a,b), which postulated the
follicle-type-dependent expression of the LPA gene. Moreover, previous studies (Hickey et al., 2004; Otsuka et al., 2011) documented
that proteins of the TGFβ family protect cells against atresia, which is consistent with the present results, which in turn indicate that
the least GDF9 and BMP15 mRNA relative abundances were present in the atretic follicles. The disruption of folliculogenesis resulting
from the absence of any of these growth factors has been described previously (Dong et al., 1996; Carabatsos et al., 1998; Eppig,
2001; Gittens et al., 2005). Although the disruption of folliculogenesis in the transitional and atretic follicles was not investigated, the
lesser gene expression for the antiapoptotic factors, such as GDF9 and BMP15, may be one of the causes of atresia in these follicle
types.
Follistatin has an important role in the ovary. The presence of the inhibin/activin/FST system was documented in primate
follicular cells (Sidis et al., 1998), in domestic species, such as cattle (Knight and Glister, 2006), goats (Silva et al., 2004) and pigs
(van de Pavert et al., 2001). There is marked expression of the follistatin gene in granulosal cells of developing follicles (Shimasaki
et al., 1989; Nakatani et al., 1991) and this protein is released from the oocyte (Rajput et al., 2013). In the present study, there was a
presence of FST mRNA in COCs of cattle that had been isolated from the different follicle types. There were not, however, any
significant differences in the FST mRNA abundance among the healthy, transitional and atretic groups of follicles. Similar relative
abundances of FST mRNA may be the result of the twofold function of the FST in ovarian follicle. First, FST is known to be an
inhibitor of follicle growth and function because it suppresses the release of follicle-stimulating hormone (FSH; Brady and Iscove,
1993; Thompson et al., 2005). Moreover, FST is a competitive inhibitor of the action of the TGFβ superfamily proteins (Brady and
Iscove, 1993; Thompson et al., 2005). The relatively greater mRNA abundance of FST in the COCs of the transitional and atretic
follicles may suggest its action in the ovarian follicle. It is suspected that the FST detected in COCs of the transitional and atretic
follicles that suppresses follicle development is derived from the cumulus cells. In contrast, in cattle, an increased transcript abun-
dance of FST was observed in relatively greater-quality oocytes compared with relatively lesser-quality oocytes (Patel et al., 2007;
VandeVoort et al., 2009; Rajput et al., 2013). Because these greater-quality oocytes originate mainly from healthy follicles, in which
the oocytes have matured as the time of ovulation approaches, the presence of the FST derived from an oocyte may support its
maturation and enhance its fertilization capacity. The bilateral role of the FST makes this molecule an important factor in regulating
the follicles that were in the different categories of the present study.
Cathepsins are cumulus-derived cysteine proteases that are associated with oocyte competence and are involved in either direct or
indirect cell death (Droga-Mazovec et al., 2008; Vancompernolle et al., 1998; Balboula et al., 2010). Previous studies revealed a
negative relationship between cumulus cell mRNA relative abundances of cathepsin B, K, S and Z and oocyte quality (Bettegowda
et al., 2008; Ashry et al., 2015). In contrast to the finding in these studies, there were greater relative abundances of mRNA for both
CTSB and CTSZ in the COCs originating from the healthy follicles than in those originating from the transitional and atretic follicles.
In mammals, relatively few follicles reach maturation and have the capacity to undergo ovulation, with the majority – including
healthy follicles – undergoing atresia (Ginther et al., 1989; Hsu and Hsueh, 1997). Ovarian follicular atresia is initiated with the
apoptosis of granulosal cells (Matsuda et al., 2012), and the participation of lysosomal enzymes originating from COCs, such as
cathepsins (Droga-Mazovec et al., 2008; Balboula et al., 2010; Matsuda et al., 2012), in this process cannot be excluded. The role of
cathepsins in caspase-independent (Foghsgaard et al., 2001) and caspase-dependent cell death due to the decrease in the Bcl-2/Bax
ratio and activation of Caspase-9 and Caspase3 (Malla et al., 2010) was documented previously. The role of these proteins in follicular
atresia, however, needs to be studied further. The initiating signal for the caspase-dependent cascade may be the cathepsins derived
from the cumulus cells, especially in healthy follicles, in which atresia is initiated later as compared with atretic follicles and in which
the mechanism of the initiation of apoptosis is still unclear.

248
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

To summarize, in the present study, the follicle-type-dependent expression was elucidated for the receptor genes of LPA and the
enzymes involved in LPA production in cumulus-oocyte complexes of cattle. Because the greatest expression of LPARs and AX genes
occurred in healthy follicles and the least occurred in atretic follicles, it is suggested that LPA has a role in ovarian follicle devel-
opment, with AX and LPAR2 having important roles in LPA synthesis and action. It was also documented that there was a follicle-
type-dependent gene expression of the factors derived by the COCs in regulation of follicular development (GDF9 and BMP15) by
enhancing the growth of healthy follicles, and the presence of CTSB and CTSZ via the initiation of apoptosis in the follicles destined
for atresia. It is suggested that the growth and development of the ovarian follicles of cattle are also regulated by the factors from the
COCs, such as GDF9, BMP15, FST, CTSB and CTSZ.

Funding

This research was supported by the Grants-in-Aid for Scientific Research from the Polish National Science Centre (2012/05/E/
NZ9/03480). Emilia Sinderewicz, Dorota Boruszewska and Ilona Kowalczyk-Zieba were supported by the European Union within the
European Social Fund (RIM WiM).

Conflict of interest

The authors declare that there is no conflict of interest that may prejudice the impartiality of this report.

Acknowledgement

The authors are indebted to Marek Domin, the owner of the slaughterhouse (Zaklady Miesne “Warmia”, Biskupiec, Poland), for
facilitating material collection.

References

Aerts, J.M.J., Bols, P.E.J., 2010. Ovarian follicular dynamics: a review with emphasis on the bovine species. Part I: Folliculogenesis and pre-antral follicle development.
Reprod. Domest. Anim. 45, 171–179.
Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantative reverse transcription-PCR data: A model based variance estimation approach to
identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250.
Ashry, M., Lee, K., Mondal, M., Datta, T.K., Folger, J.K., Rajput, S.K., Zhang, K., Hemeida, N.A., Smith, G.W., 2015. Expression of TGFβ superfamily components and
other markers of oocyte quality in oocytes selected by brilliant cresyl blue staining: Relevance to early embryonic development. Mol. Reprod. Dev. 82, 251–264.
Balboula, A.Z., Yamanaka, K., Sakatani, M., Hegab, A.O., Zaabel, S.M., Takahashi, M., 2010. Cathepsin B activity is related to the quality of bovine cumulus oocyte
complexes and its inhibition can improve their developmental competence. Mol. Reprod. Dev. 77, 439–448.
Bettegowda, A., Patel, O.V., Lee, K.B., Park, K.E., Salem, M., Yao, J., Ireland, J.J., Smith, G.W., 2008. Identification of novel bovine cumulus cell molecular markers
predictive of oocyte competence: functional and diagnostic implications. Biol. Reprod. 79, 301–309.
Bodensteiner, K.J., Clay, C.M., Moeller, C.L., Sawyer, H.R., 1999. Molecular cloning of the ovine growth/differentiation factor-9 gene and expression of growth/
differentiation factor-9 in ovine and bovine ovaries. Biol. Reprod. 60, 381–386.
Boruszewska, D., Sinderewicz, E., Kowalczyk-Zieba, I., Skarzynski, D.J., Woclawek-Potocka, I., 2013. Influence of lysophosphatidic acid on estradiol production and
follicle stimulating hormone action in bovine granulosa cells. Reprod. Biol. 13, 344–347.
Boruszewska, D., Torres, A.C., Kowalczyk-Zieba, I., Diniz, P., Batista, M., Lopes-da-Costa, L., Woclawek-Potocka, I., 2014. The effect of lysophosphatidic acid during in
vitro maturation of bovine oocytes: embryonic development and mRNA abundances of genes involved in apoptosis and oocyte competence. Mediators Inflamm.
670670.
Boruszewska, D., Sinderewicz, E., Kowalczyk-Zieba, I., Grycmacher, K., Woclawek-Potocka, I., 2015. The effect of lysophosphatidic acid during in vitro maturation of
bovine cumulus-oocyte complexes: cumulus expansion, glucose metabolism and expression of genes involved in the ovulatory cascade, oocyte and blastocyst
competence. Reprod. Biol. Endocrinol. 13, 44.
Brady, G., Iscove, N.N., 1993. Construction of cDNA libraries from single cells. Methods Enzymol. 225, 611–623.
Carabatsos, M.J., Elvin, J., Matzuk, M.M., Albertini, D.F., 1998. Characterization of oocyte and follicle development in growth differentiation factor-9-deficient mice.
Dev. Biol. 204, 373–384.
Dong, J., Albertini, D.F., Nishimori, K., Kumar, T.R., Lu, N., Matzuk, M.M., 1996. Growth differentiation factor-9 is required during early ovarian folliculogenesis.
Nature 383, 531–535.
Droga-Mazovec, G., Bojic, L., Petelin, A., Ivanova, S., Romih, R., Repnik, U., Salvesen, G.S., Stoka, V., Turk, V., Turk, B., 2008. Cysteine cathepsins trigger caspase-
dependent cell death through cleavage of bid and antiapoptotic Bcl-2 homologues. J. Biol. Chem. 283, 19140–19150.
Edson, M.A., Nagaraja, A.K., Matzuk, M.M., 2009. The mammalian ovary from genesis to revelation. Endocr. Rev. 30, 624–712.
Eppig, J.J., 2001. Oocyte control of ovarian follicular development and function in mammals. Reproduction 122, 829–838.
Foghsgaard, L., Wissing, D., Mauch, D., Lademann, U., Bastholm, L., Boes, M., Elling, F., Leist, M., Jäättelä, M., 2001. Cathepsin B acts as a dominant execution
protease in tumor cell apoptosis induced by tumor necrosis factor. J. Cell Biol. 153, 999–1010.
Gilchrist, R.B., Lane, M., Thompson, J.G., 2008. Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum. Reprod. Update 14, 159–177.
Ginther, O.J., Kastelic, J.P., Knopf, L., 1989. Composition and characteristics of follicular waves during the bovine estrous cycle. Anim. Reprod. Sci. 20, 187–200.
Gittens, J.E.I., Barr, K.J., Vanderhyden, B.C., Kidder, G.M., 2005. Interplay between paracrine signaling and gap junctional communication in ovarian follicles. J. Cell.
Sci. 118, 113–122.
Grimes, R.W., Ireland, J.J., 1986. Relationship of macroscopic appearance of the surface of bovine ovarian follicles concentrations of steroids in follicular fluid, and
maturation of oocytes in vitro. Biol. Reprod. 35, 725–732.
Hickey, T.E., Marrocco, D.L., Gilchrist, R.B., Norman, R.J., Armstrong, D.T., 2004. Interactions between androgen and growth factors in granulosa cell subtypes of
porcine antral follicles. Biol. Reprod. 71, 45–52.
Hsu, S.Y., Hsueh, A.J.W., 1997. Hormonal regulation of apoptosis. An ovarian perspective. Trends Endocrinol. Metab. 8, 207–213.
Juengel, J.L., McNatty, K.P., 2005. The role of proteins of the transforming growth factor-beta superfamily in the intraovarian regulation of follicular development.
Hum. Reprod. Update 11, 143–160.
Knight, P.G., Glister, C., 2006. TGF-beta superfamily members and ovarian follicle development. Reproduction 132, 191–206.
Komatsu, J., Yamano, S., Kuwahara, A., Tokumura, A., Irahara, M., 2006. The signaling pathways linking to lysophosphatidic acid-promoted meiotic maturation in
mice. Life Sci. 79, 506–511.

249
E. Sinderewicz et al. Animal Reproduction Science 192 (2018) 242–250

Kowalczyk-Zieba, I., Boruszewska, D., Saulnier-Blache, J.S., Lopes Da Costa, L., Jankowska, K., Skarzynski, D.J., Woclawek-Potocka, I., 2012. Lysophosphatidic acid
action in the bovine corpus luteum -an in vitro study. J. Reprod. Dev. 58, 661–671.
Lapa, M., Marques, C.C., Alves, S.P., Vasques, M.I., Baptista, M.C., Carvalhais, I., Silva Pereira, M., Horta, A.E., Bessa, R.J., Pereira, R.M., 2011. Effect of trans-10 cis-12
conjugated linoleic acid on bovine oocyte competence and fatty acid composition. Reprod. Domest. Anim. 46, 904–910.
Li, Y., Li, R.Q., Ou, S.B., Zhang, N.F., Ren, L., Wei, L.N., Zhang, Q.X., Yang, D.Z., 2014. Increased GDF9 and BMP15 mRNA levels in cumulus granulosa cells correlate
with oocyte maturation, fertilization, and embryo quality in humans. Reprod. Biol. Endocrinol. 12, 81.
Malla, R., Gopinath, S., Alapati, K., Gondi, C.S., Gujrati, M., Dinh, D.H., Mohanam, S., Rao, J.S., 2010. Downregulation of uPAR and cathepsin B induces apoptosis via
regulation of Bcl-2 and Bax and inhibition of the PI3K/Akt pathway in gliomas. PLoS One 5, e13731.
Matsuda, F., Inoue, N., Manabe, N., Ohkura, S., 2012. Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. J.
Reprod. Dev. 58, 44–50.
Moenter, S.M., Brand, R.M., Midgley, A.R., Karsch, F.J., 1992. Dynamics of gonadotropin-releasing hormone release during a pulse. Endocrinology 130, 503–510.
Nakatani, A., Shimasaki, S., DePaolo, L.V., Erickson, G.F., Ling, N., 1991. Cyclic changes in follistatin messenger ribonucleic acid and its protein in the rat ovary during
the estrous cycle. Endocrinology 129, 603–611.
Otsuka, F., McTavish, K.J., Shimasaki, S., 2011. Integral role of GDF-9 and BMP-15 in ovarian function. Mol. Reprod. Dev. 78, 9–21.
Patel, O.V., Bettegowda, A., Ireland, J.J., Coussens, P.M., Lonergan, P., Smith, G.W., 2007. Functional genomics studies of oocyte competence: evidence that reduced
transcript abundance for follistatin is associated with poor developmental competence of bovine oocytes. Reproduction 133, 95–106.
Paulini, F., Melo, E.O., 2011. The role of oocyte-secreted factors GDF9 and BMP15 in follicular development and oogenesis. Reprod. Domest. Anim. 46, 354–361.
Prates, E.G., Alves, S.P., Marques, C.C., Baptista, M.C., Horta, A.E., Bessa, R.J., Pereira, R.M., 2013. Fatty acid composition of porcine cumulus oocyte complexes (COC)
during maturation: effect of the lipid modulators trans-10, cis-12 conjugated linoleic acid (t10,c12 CLA) and forskolin. In Vitro Cell. Dev. Biol.–Anim. 49, 335–345.
Rajput, S.K., Lee, K., Zhenhua, G., Di, L., Folger, J.K., Smith, G.W., 2013. Embryotropic actions of follistatin: paracrine and autocrine mediators of oocyte competence
and embryo developmental progression. Reprod. Fertil. Dev. 26, 37–47.
Shimasaki, S., Koga, M., Buscaglia, M.L., Simmons, D.M., Bicsak, T.A., Ling, N., 1989. Follistatin gene expression in the ovary and extragonadal tissues. Mol.
Endocrinol. 3, 651–659.
Sidis, Y., Fujiwara, T., Leykin, L., Isaacson, K., Toth, T., Schneyer, A.L., 1998. Characterization of inhibin/activin subunit, activin receptor, and follistatin messenger
ribonucleic acid in human and mouse oocytes: evidence for activin's paracrine signaling from granulosa cells to oocytes. Biol. Reprod. 59, 807–812.
Silva, J.R., van den Hurk, R., van Tol, H.T., Roelen, B.A., Figueiredo, J.R., 2004. Gene expression and protein localisation for activin-A, follistatin and activin receptors
in goat ovaries. J. Endocrinol. 183, 405–415.
Sinderewicz, E., Grycmacher, K., Boruszewska, D., Kowalczyk-Zięba, I., Yamamoto, Y., Yoshimoto, Y., Woclawek-Potocka, I., 2016. Lysophosphatidic acid synthesis
and its receptors’ expression in the bovine oviduct during the oestrous cycle. Reprod. Domest. Anim. 51, 541–549.
Sinderewicz, E., Grycmacher, K., Boruszewska, D., Kowalczyk-Zięba, I., Woclawek-Potocka, I., 2017a. Lysophosphatidic acid expression in theca cells depends on the
type of bovine ovarian follicle. Reprod. Domest. Anim. 52, 28–34.
Sinderewicz, E., Grycmacher, K., Boruszewska, D., Kowalczyk-Zięba, I., Staszkiewicz, J., Ślężak, T., Woclawek-Potocka, I., 2017b. Expression of factors involved in
apoptosis and cell survival is correlated with enzymes synthesizing lysophosphatidic acid and its receptors in granulosa cells originating from different types of
bovine ovarian follicles. Reprod. Biol. Endocrinol. 15, 72.
Sinderewicz, E., Grycmacher, K., Boruszewska, D., Kowalczyk-Zięba, I., Staszkiewicz, J., Ślężak, T., Woclawek-Potocka, I., 2018. Bovine ovarian follicular growth and
development correlate with lysophosphatidic acid expression. Theriogenology 106, 1–14.
Thompson, T.B., Lerch, T.F., Cook, R.W., Woodruff, T.K., Jardetzky, T.S., 2005. The structure of the follistatin:activin complex reveals antagonism of both type I and
type II receptor binding. Dev. Cell 9, 535–543.
van de Pavert, S.A., Boerjan, M.L., Stroband, H.W., Taverne, M.A., van den Hurk, R., 2001. Uterine-embryonic interaction in pig: activin, follistatin, and activin
receptor II in uterus and embryo during early gestation. Mol. Reprod. Dev. 59, 390–399.
Vancompernolle, K., Van Herreweghe, F., Pynaert, G., Van de Craen, M., De Vos, K., Totty, N., Sterling, A., Fiers, W., Vandenabeele, P., Grooten, J., 1998.
Atractyloside-induced release of cathepsin B, a protease with caspase-processing activity. FEBS Lett. 438, 150–158.
VandeVoort, C.A., Mtango, N.R., Lee, Y.S., Smith, G.W., Latham, K.E., 2009. Differential effects of follistatin on nonhuman primate oocyte maturation and pre-
implantation embryo development in vitro. Biol. Reprod. 81, 1139–1146.
Varnosfaderani, Sh.R., Ostadhosseini, S., Hajian, M., Hosseini, S.M., Khashouei, E.A., Abbasi, H., Hosseinnia, P., Nasr-Esfahani, M.H., 2013. Importance of the GDF9
signaling pathway on cumulus cell expansion and oocyte competency in sheep. Theriogenology 80, 470–478.
Wigglesworth, K., Lee, K.B., O’Brien, M.J., Peng, J., Matzuk, M.M., Eppig, J.J., 2013. Bidirectional communication between oocytes and ovarian follicular somatic cells
is required for meiotic arrest of mammalian oocytes. Proc. Natl. Acad. Sci. U S A. 110, E3723–3729.
Woclawek-Potocka, I., Brzezicka, E., Skarzynski, D.J., 2009a. Lysophosphatic acid modulates prostaglandin secretion in the bovine endometrial cells differently on
days 8–10 of the estrous cycle and early pregnancy. J. Reprod. Dev. 55, 393–399.
Woclawek-Potocka, I., Kondraciuk, K., Skarzynski, D.J., 2009b. Lysophosphatidic acid stimulates prostaglandin E2 production in cultured stromal endometrial cells
through LPA1 eeceptor. Exp. Biol. Med. 234, 986–993.
Woclawek-Potocka, I., Komiyama, J., Saulnier-Blache, J.S., Brzezicka, E., Bah, M.M., Okuda, K., Skarzynski, D.J., 2009c. Lysophosphatic acid modulates prostaglandin
secretion in the bovine uterus. Reproduction 137, 95–105.
Woclawek-Potocka, I., Kowalczyk-Zieba, I., Skarzynski, D.J., 2010. Lysophosphatidic acid action during early pregnancy in cow: in vivo and in vitro studies. J. Reprod.
Dev. 56, 411–420.
Ye, X., Hama, K., Contos, J.A., Suzuki, H., Amano, T., Arai, H., Aoki, J., Chun, J., 2005. LPA3-mediated lysophosphatidic acid signalling in embryo implantation and
spacing. Nature 435, 104–108.
Zhang, J.Y., Jiang, Y., Lin, T., Kang, J.W., Lee, J.E., Jin, D.I., 2015. Lysophosphatidic acid improves porcine oocyte maturation and embryo development in vitro. Mol.
Reprod Dev. 82, 66–77.

250

View publication stats