chemistry-technical-document-CHTD 500 v1 Revo 07jul2016 PDF
chemistry-technical-document-CHTD 500 v1 Revo 07jul2016 PDF
Protocols are updated regularly, please check this is the latest version before proceeding. This protocol is for research only.
Overview
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1
Overview .....
. . . . . . . . . . . . . kits
Available . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2
.....
. . . . . . . . . . . .Sequencing
Ligation . . . . . . . . . . . . . . . .Kit
. . . .family
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2
.....
. . . . . . . . . . . . . . kits
Barcoding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .7
.....
. . . . . . . sequencing:
RNA . . . . . . . . . . . . . . . . . direct,
. . . . . . . . .and
. . . . . .via
. . . . cDNA
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .15
......
. . . . . . . . .Kit
Wash . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .17
......
Technological considerations
......................................................................................................................................................................... 18
. . . . . . . . . . . . . . . . .speeds
Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .23
......
. . . . . . . . . . . . . . . . .throughput
Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .23
......
Applications
......................................................................................................................................................................... 25
. . . . . . . . . . . . . .reads
Ultra-long . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .26
......
. . . . . . .analysis
16S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .27
......
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 2 of 27
Chemistry Technical Document
Available kits
Version: CHTD_500_v1_revO_07Jul2016
Available kits
Chemistry Technical Document
Ligation chemistry
The Ligation Sequencing Kit is compatible with gDNA, amplicons, or cDNA starting material. The 1D 2 kit is compatible with gDNA,
and can also sequence amplicons and cDNA. However, laboratory procedures and analysis tools are still in development, so this will
require some advanced understanding by customers choosing to use it.
The Ligation Sequencing Kit is supplied with a Flow Cell Priming Kit (EXP-FLP001), while the 1D 2 Sequencing Kit is supplied with a
Library Loading Bead Kit (EXP-LLB001), which contains beads for loading the library onto a flow cell.
The Ligation Sequencing Kit is designed to prepare genomic, amplicon, and cDNA, with or without barcoding, for sequencing on
Oxford Nanopore devices to produce 1D reads. This kit can be used to prepare libraries from whole genome amplified DNA, starting
with as little as 10 pg genomic DNA.
The kit features an adapter, which must be ligated onto end-repaired and A-tailed fragments. This adapter is loaded with the motor
protein that translocates DNA through the nanopore. The workflow for nanopore sequencing consists of steps for template
preparation, and then steps required for adapter ligation.
1D PCR-free gDNA
High molecular weight gDNA
Optional fragmentation
(for 100-500 ng input)
Ligation of sequencing
T
adapters
Loading
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 3 of 27
Chemistry Technical Document
Available kits
Version: CHTD_500_v1_revO_07Jul2016
The Ligation Sequencing kit 1D 2 offers a flexible method of preparing libraries for nanopore sequencing in 90 minutes. 1D2 library
preparation uses special sequencing adapters that encourage the complement strand to immediately follow the template strand.
This method of sequencing, when used with 1D2 analysis, produces higher accuracy reads (modal accuracy 97%) than 1D alone.
The library preparation involves ligating the 1D 2 adapter onto end-repaired and A-tailed fragments. Sequencing adapters are then
added.
Below are further details about some of the key Ligation Sequencing Kit components.
The DNA calibration strand (DCS) is a 3.6 kb amplicon of the Lambda genome. The calibration strand is added to DNA samples
after fragmentation step, and is processed and included in the sample library.
EPI2ME workflows automatically detect calibration strand reads. This information can be used to assess how well basecalling has
worked in situations where this cannot be quickly determined from the basecalls of the experimental data, and to confirm that the
sample preparation was successful.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 4 of 27
Chemistry Technical Document
Available kits
Version: CHTD_500_v1_revO_07Jul2016
Lambda DNA (LMD) is the control DNA for preparation of a standard library to use in the Lambda Control Experiment protocol.
The Sequencing Buffer provides fuel, and the optimal chemical conditions for powering DNA translocation through the nanopore.
Adapters (AMX)
The adapter (also known as the Y-adapter) is found in the Adapter mix (AMX) tube. Its purpose is to bring the DNA fragments to the
nanopore.
The adapters are ligated to the end-repaired, dA-tailed DNA fragments during the adapter ligation step in the protocol. The ligation
is assisted by hybridisation of the A and T overhangs of the DNA fragments and adapters, respectively. The aim of this step is to
prepare fragments which are adapted at both ends.
The Y-adapter contains a loaded processive enzyme that regulates the DNA passage through the nanopore. The enzyme is active
in solution, however specialised bases in the adapter prevent it from contacting the rest of the DNA before loading onto the
nanopore.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 5 of 27
Chemistry Technical Document
Rapid Sequencing Kit family
Version: CHTD_500_v1_revO_07Jul2016
Tethers
The tethers have a dual function of tethering the DNA strand to the membrane of the flow cell, and reducing the diffusion of the DNA
strands from three to two dimensions. Together, these functions improve DNA capture by approximately three orders of magnitude
compared to capture without the tethers.
The tethers are found in the Flush Tether (FLT) tube in the Flow Cell Priming Kit.
Adapter sequences
Adapter Y top:
Adapter Y bottom:
Note: some sequence motifs are proprietary and are not shown.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 6 of 27
Chemistry Technical Document
Rapid Sequencing Kit family
Version: CHTD_500_v1_revO_07Jul2016
Rapid sequencing is a faster method of sample preparation, which allows 1D sequencing of DNA. Instead of shearing the genomic
DNA in a Covaris g-TUBE, the DNA is fragmented using a transposase, which simultaneously attaches adapters to the free ends.
Leader adapters are then added. The entire process takes approximately 10 minutes.
The Rapid 1D sequencing protocol is suitable for applications where the input material has long fragments (>30 kb) and is not
recommended for inputs such as amplicons. The starting DNA will be fragmented by the transposase, and consequently use of
amplicons and cDNAs could result in lots of short reads.
There is also a barcoding version of this kit: Rapid Barcoding Kit (code SQK-RBK001), described in more detail in the "Barcoding
Kits" section of this document.
Adapter sequences
Adapter Y top:
Adapter Y bottom:
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 7 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
The PCR Sequencing Kit is designed to prepare sequencing libraries when there is a limited amount of starting gDNA available
(<100 ng).
The library preparation requires ~60 mins hands-on time. Although the time taken for library prep is longer than for other Rapid kits,
the PCR Sequencing Kit uses rapid attachment primers, without ligation-based chemistry.
There is also a barcoding version of this kit: PCR Barcoding Kit (code SQK-PBK004).
Barcoding kits
Oxford Nanopore's barcoding kits are designed to allow pooling and running multiple libraries on Oxford Nanopore devices. There
are three types of barcoding kits:
The first 12 barcodes are identical across all kits, except for the Rapid PCR Barcoding Kit, which contains barcode 12a instead of
barcode 12 (sequences shown below). However, the regions around the barcode are different across the barcoding kits.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 8 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
The PCR Barcoding Kit I and PCR Barcoding Kit 96 are both expansion packs to be used together with the Ligation Sequencing Kit.
These barcoding kits includes adapters, and forward and reverse PCR primers with the same barcode in both forward and reverse
primers. The barcodes have been carefully designed and extensively purified to minimise cross-talk.
The barcoding protocol can be adapted to work for genomic DNA, amplicons, or cDNA:
There are four barcoding kits that use Rapid sequencing chemistry. Most of these are barcoding equivalents of one of the Rapid-
based sequencing kits:
- Rapid Barcoding Sequencing Kit (code SQK-RBK001)
- Rapid PCR Barcoding Kit (code SQK-RPB004)
- 16S Rapid Amplicon Barcoding Kit (code SQK-RAB204)
- PCR Barcoding Kit (code SQK-PBK004)
Each kit contains 12 barcoded primers, which amplify DNA with containing Oxford Nanopore PCR adapters on the ends (or in the
case of the 16S Barcoding Kit, the 16S sequence), and simultaneously add one of the 12 barcodes to the fragment. The DNA is
then ready for attachment of sequencing adapters.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 9 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
The Native Barcoding Kit is an expansion pack to be used together with the Ligation Sequencing Kit. This barcoding kit includes
adapters with barcodes on the ends, which are ligated to DNA ends without the need for PCR. The barcodes have been carefully
designed and extensively purified to minimise cross-talk.
The lack of a PCR step means that native DNA can be sequenced, removing the risk of PCR bias and allowing analysis of base
modifications.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 10 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
Barcode sequences
Component Sequence
RB12A GTTGAGTTACAAAGCACCGATCAG
96 barcode sequences
Component Sequence
BC01 AAGAAAGTTGTCGGTGTCTTTGTG
BC02 TCGATTCCGTTTGTAGTCGTCTGT
BC03 GAGTCTTGTGTCCCAGTTACCAGG
BC04 TTCGGATTCTATCGTGTTTCCCTA
BC05 CTTGTCCAGGGTTTGTGTAACCTT
BC06 TTCTCGCAAAGGCAGAAAGTAGTC
BC07 GTGTTACCGTGGGAATGAATCCTT
BC08 TTCAGGGAACAAACCAAGTTACGT
BC09 AACTAGGCACAGCGAGTCTTGGTT
BC10 AAGCGTTGAAACCTTTGTCCTCTC
BC11 GTTTCATCTATCGGAGGGAATGGA
BC12 CAGGTAGAAAGAAGCAGAATCGGA
BC13 AGAACGACTTCCATACTCGTGTGA
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 11 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
Component Sequence
BC14 AACGAGTCTCTTGGGACCCATAGA
BC15 AGGTCTACCTCGCTAACACCACTG
BC16 CGTCAACTGACAGTGGTTCGTACT
BC17 ACCCTCCAGGAAAGTACCTCTGAT
BC18 CCAAACCCAACAACCTAGATAGGC
BC19 GTTCCTCGTGCAGTGTCAAGAGAT
BC20 TTGCGTCCTGTTACGAGAACTCAT
BC21 GAGCCTCTCATTGTCCGTTCTCTA
BC22 ACCACTGCCATGTATCAAAGTACG
BC23 CTTACTACCCAGTGAACCTCCTCG
BC24 GCATAGTTCTGCATGATGGGTTAG
BC25 GTAAGTTGGGTATGCAACGCAATG
BC26 CATACAGCGACTACGCATTCTCAT
BC27 CGACGGTTAGATTCACCTCTTACA
BC28 TGAAACCTAAGAAGGCACCGTATC
BC29 CTAGACACCTTGGGTTGACAGACC
BC30 TCAGTGAGGATCTACTTCGACCCA
BC31 TGCGTACAGCAATCAGTTACATTG
BC32 CCAGTAGAAGTCCGACAACGTCAT
BC33 CAGACTTGGTACGGTTGGGTAACT
BC34 GGACGAAGAACTCAAGTCAAAGGC
BC35 CTACTTACGAAGCTGAGGGACTGC
BC36 ATGTCCCAGTTAGAGGAGGAAACA
BC37 GCTTGCGATTGATGCTTAGTATCA
BC38 ACCACAGGAGGACGATACAGAGAA
BC39 CCACAGTGTCAACTAGAGCCTCTC
BC40 TAGTTTGGATGACCAAGGATAGCC
BC41 GGAGTTCGTCCAGAGAAGTACACG
BC42 CTACGTGTAAGGCATACCTGCCAG
BC43 CTTTCGTTGTTGACTCGACGGTAG
BC44 AGTAGAAAGGGTTCCTTCCCACTC
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 12 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
Component Sequence
BC45 GATCCAACAGAGATGCCTTCAGTG
BC46 GCTGTGTTCCACTTCATTCTCCTG
BC47 GTGCAACTTTCCCACAGGTAGTTC
BC48 CATCTGGAACGTGGTACACCTGTA
BC49 ACTGGTGCAGCTTTGAACATCTAG
BC50 ATGGACTTTGGTAACTTCCTGCGT
BC51 GTTGAATGAGCCTACTGGGTCCTC
BC52 TGAGAGACAAGATTGTTCGTGGAC
BC53 AGATTCAGACCGTCTCATGCAAAG
BC54 CAAGAGCTTTGACTAAGGAGCATG
BC55 TGGAAGATGAGACCCTGATCTACG
BC56 TCACTACTCAACAGGTGGCATGAA
BC57 GCTAGGTCAATCTCCTTCGGAAGT
BC58 CAGGTTACTCCTCCGTGAGTCTGA
BC59 TCAATCAAGAAGGGAAAGCAAGGT
BC60 CATGTTCAACCAAGGCTTCTATGG
BC61 AGAGGGTACTATGTGCCTCAGCAC
BC62 CACCCACACTTACTTCAGGACGTA
BC63 TTCTGAAGTTCCTGGGTCTTGAAC
BC64 GACAGACACCGTTCATCGACTTTC
BC65 TTCTCAGTCTTCCTCCAGACAAGG
BC66 CCGATCCTTGTGGCTTCTAACTTC
BC67 GTTTGTCATACTCGTGTGCTCACC
BC68 GAATCTAAGCAAACACGAAGGTGG
BC69 TACAGTCCGAGCCTCATGTGATCT
BC70 ACCGAGATCCTACGAATGGAGTGT
BC71 CCTGGGAGCATCAGGTAGTAACAG
BC72 TAGCTGACTGTCTTCCATACCGAC
BC73 AAGAAACAGGATGACAGAACCCTC
BC74 TACAAGCATCCCAACACTTCCACT
BC75 GACCATTGTGATGAACCCTGTTGT
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 13 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
Component Sequence
BC76 ATGCTTGTTACATCAACCCTGGAC
BC77 CGACCTGTTTCTCAGGGATACAAC
BC78 AACAACCGAACCTTTGAATCAGAA
BC79 TCTCGGAGATAGTTCTCACTGCTG
BC80 CGGATGAACATAGGATAGCGATTC
BC81 CCTCATCTTGTGAAGTTGTTTCGG
BC82 ACGGTATGTCGAGTTCCAGGACTA
BC83 TGGCTTGATCTAGGTAAGGTCGAA
BC84 GTAGTGGACCTAGAACCTGTGCCA
BC85 AACGGAGGAGTTAGTTGGATGATC
BC86 AGGTGATCCCAACAAGCGTAAGTA
BC87 TACATGCTCCTGTTGTTAGGGAGG
BC88 TCTTCTACTACCGATCCGAAGCAG
BC89 ACAGCATCAATGTTTGGCTAGTTG
BC90 GATGTAGAGGGTACGGTTTGAGGC
BC91 GGCTCCATAGGAACTCACGCTACT
BC92 TTGTGAGTGGAAAGATACAGGACC
BC93 AGTTTCCATCACTTCAGACTTGGG
BC94 GATTGTCCTCAAACTGCCACCTAC
BC95 CCTGTCTGGAAGAAGAATGGACTT
BC96 CTGAACGGTCATAGAGTCCACCAT
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 14 of 27
Chemistry Technical Document
Barcoding kits
Version: CHTD_500_v1_revO_07Jul2016
The native barcode sequences are the reverse complement of the corresponding barcode sequence in other kits:
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 15 of 27
Chemistry Technical Document
RNA sequencing: direct, and via cDNA
Version: CHTD_500_v1_revO_07Jul2016
In addition to the barcodes themselves, the barcoding primers have additional flanking sequences, which add an extra level of
context during analysis. The flanking sequences differ depending on the kit:
PCR Barcoding Expansion 1-12 (EXP-PBC001) and PCR Barcoding Expansion 1-96 (EXP-PBC096)
Native Barcoding Expansion 1-12 (EXP-NBD104) and Native Barcoding Expansion 13-24
The top and bottom strand of this primer carry different flanking sequences:
5' - ATCGCCTACCGTGAC - barcode - ACTTGCCTGTCGCTCTATCTTC - 3'
5' - ATCGCCTACCGTGAC - barcode - TTTCTGTTGGTGCTGATATTGC - 3'
The top and bottom sequences are different to avoid 5’ and 3’ end sequences annealing to each other and forming a loop.
The 3' flanking sequence contains a wobble base (denoted by M; in the primer the base is either an A or a C) in a variable region of
the 16S gene.
5' - ATCGCCTACCGTGAC - barcode - AGAGTTTGATCMTGGCTCAG - 3'
Barcode concentrations
The barcode primer concentration in our range of PCR and Rapid barcoding kits is 10 µM.
The Native Barcoding adapters are shipped at 640 nM.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 16 of 27
Chemistry Technical Document
RNA sequencing: direct, and via cDNA
Version: CHTD_500_v1_revO_07Jul2016
Nanopore sensing enables the detection of any analyte that comes into contact with, or passes through, a nanopore. Although
initially developed as a DNA sequencing platform, Oxford Nanopore Technologies now offers the possibility to sequence RNA: both
directly (without a reverse transcription step), or via cDNA.
The Direct RNA Sequencing kit is used to prepare any RNA for 1D sequencing on Oxford Nanopore devices. The kit contains
reagents to synthesize the complementary (reverse transcribed) strand of the RNA, and attach sequencing adapters to the ends of
the DNA-RNA hybrid. There is no PCR step, meaning that native RNA can be analysed.
Note that only the RNA strand, not the RT strand, is sequenced.
The kit is designed to prepare polyA-tailed RNA, however the user can design their own adapter to target a specific RNA sequence.
The two cDNA sequencing kits allow the preparation of cDNA libraries with or without PCR.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 17 of 27
Chemistry Technical Document
Wash Kit
Version: CHTD_500_v1_revO_07Jul2016
RTA
Top:
5' - GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC - 3'
Bottom:
5' - GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCTTTTTTTTTT - 3'
RMX
Top:
5' - TGATGATGAGGGATAGACGATGGTTGTTTCTGTTGGTGCTGATATTGCTTTTTTTTTTTTTATGATGCAAGATACGCAC - 3'
Bottom:
5' - GAGGCGAGCGGTCAATTTGCAATATCAGCACCAACAGAAACAACCATCGTCTATCCCTCATCATCAGAACCTACTA - 3'
VNP
SSP
cPRM
Forward (PR2):
5' - TTTCTGTTGGTGCTGATATTGC - 3'
Reverse (3580F):
5' - ACTTGCCTGTCGCTCTATCTTC - 3'
PR2
Wash Kit
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 18 of 27
Chemistry Technical Document
Technological considerations
Version: CHTD_500_v1_revO_07Jul2016
The Wash Kit allows sequential runs of multiple sequencing libraries in the same flow cell. It works by washing out the first library,
and refreshing the system ready for a subsequent library to be loaded. This procedure provides the opportunity to utilise the same
flow cell a number of times, maximising the available run time particularly for cases where less data per library is required. Following
the wash step, Storage Buffer is introduced into the flow cell, allowing storage of the flow cell before subsequent library addition.
Please note that although the wash procedure should remove most of the library, some residual DNA may remain in the flow cell.
For this reason, users may prefer to barcode their libraries when used in conjunction with the Wash Kit, such that reads from
different libraries can be separated from each other. Successful deconvolution of reads has been demonstrated in Oxford
Nanopore's internal development:
For users who wish to use barcoding to run multiple libraries at one time rather than washing the flow cells, please see the Native
Barcoding Kit and the PCR Barcoding Kit.
Technological
Chemistry Technical Document
considerations
Currently, two methods of DNA sample preparation are supported by Oxford Nanopore Technologies: ligation-based and
transposase-based. The choice of sample prep method is dictated by the quantity of available DNA, the yield and purity of
DNA produced, and the length of time required to answer the experimental question.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 19 of 27
Chemistry Technical Document
Technological considerations
Version: CHTD_500_v1_revO_07Jul2016
In all protocols that use the Ligation Sequencing Kit 1D (SQK-LSK108), DNA can be fragmented, if necessary, in a Covaris g-TUBE,
after which sequencing adapters are ligated to the DNA ends.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 20 of 27
Chemistry Technical Document
Technological considerations
Version: CHTD_500_v1_revO_07Jul2016
In protocols that use the Rapid Sequencing Kit (SQK-RAD004), a transposase simultaneously fragments the template DNA and
attaches adapters to the newly-formed ends in a process referred to as tagmentation. Leader adapters with pre-loaded motor
protein are then attached to the ends, and the template is ready for sequencing.
The Rapid Sequencing Kit protocol differs to the Ligation Sequencing Kit protocol in two ways:
it requires 400 ng input DNA, compared to the recommended 1 µg for the Ligation Sequencing Kit
it allows for a faster library prep; a two-step, 10 minute protocol compared to the multi-step, 70 minutes on for the Ligation
Sequencing Kit
Long reads can be achieved with both ligation- and transposase-based library prep methods, however the length of the reads also
depends on the starting length and quality of the DNA. Shearing DNA in a Covaris g-TUBE results a narrower distribution of read
lengths than tagmenting with the Rapid Sequencing Kit. A method for the enrichment of long reads using the BluePippin platform is
also available.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 21 of 27
Chemistry Technical Document
Technological considerations
Version: CHTD_500_v1_revO_07Jul2016
Throughput
Throughput is affected by the library prep method; currently fragmentation in a g-TUBE yields the highest throughput.
The Rapid Sequencing Kit is transposase-based and fragmentation occurs as the ends of the DNA are tagged with adapters, to
facilitate sequencing. Unlike the Ligation Sequencing Kit, fragmentation of DNA with this kit is unavoidable. Consequently there is a
trade-off in making sure that the DNA is fragmented/tagmented enough to generate sufficient threadable ends to maximise
sequencing throughput, but not over-fragmenting, which will compromise read length.
The protocol and reagents were optimised based on experiments with Lambda DNA as the input sample. Tagmentation results in a
shift from a single band on a gel (when intact) to a smear when fragmented. The amount of transposome added is sufficient to
cause most of the Lambda band to disappear, although some still remains.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 22 of 27
Chemistry Technical Document
Technological considerations
Version: CHTD_500_v1_revO_07Jul2016
Sequencing analysis shows a wide distribution of strand lengths, with the median read length in the kb range with some longer
strands present.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 23 of 27
Chemistry Technical Document
Sequencing speeds
Version: CHTD_500_v1_revO_07Jul2016
Sequencing speeds
Part of the ongoing research and development work at Oxford Nanopore Technologies explores the capability of the DNA
processing enzyme to run at different speeds. With the upgrade in sequencing chemistry from SQK-MAP006 to SQK-NSK007, the
DNA turnover rate was increased from 70 bps to 250 bps. In the latest iteration of the chemistry (SQK-LSK108 kit), the sequencing
speed is increased even further to 450 bps. The Direct RNA sequencing chemistry still runs at 70 bps; this is expected to improve in
future iterations of the kit.
The DNA processing speed is determined both by the intrinsic properties of the motor protein that translocates the DNA through the
nanopore, and experimental conditions such as temperature and fuel concentration.
E8 30 mM 450
E7 11 mM 250
E6 10 mM 70
Oxford Nanopore Technologies sequencing chemistry first saw a speed upgrade from 30 b/s to 70 b/s in the SQK-MAP006
sequencing kit. In the SQK-NSK007 kit, the modifications to the motor, change in temperature to 34 °C and an increase in fuel
concentration facilitated a further increase to 250 b/s. In the most recent SQK-LSK108 chemistry version with the E8 motor protein,
the speed has increased to a further 450 b/s. However, there are no known chemistry limitations to increasing the processing speed
even more; this can be achieved for example at a different temperature, or with future motor improvements.
Sequencing throughput
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 24 of 27
Chemistry Technical Document
Sequencing speeds
Version: CHTD_500_v1_revO_07Jul2016
Sequencing throughput
The throughput is proportional to sequencing speed, but is also influenced by sample quality and experimental conditions. The
maximum theoretical throughput per run can be calculated as:
In practice, and despite the fact that theoretically there is no limit to how long a nanopore can sequence, sequencing runs do not
reach the maximum theoretical throughput. This observation is referred to as system slowdown.
Resolving system slowdown is an active area of research and development, and improvements to both the platform and sample
preparation are expected to increase the throughput in the near future.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 25 of 27
Chemistry Technical Document
Applications
Version: CHTD_500_v1_revO_07Jul2016
The amount of starting material needed for each experiment is stated in the relevant protocols. Most protocols require 1 µg high
molecular weight genomic, amplicon or cDNA, or 1.5 µg if performing FFPE repair.
The success of the protocol is based on having 1 µg of 6-8 kb fragments. The End-prep step is optimised for 0.2 pmoles of DNA.
Having substantially more input material (e.g. from a more highly-fragmented library) will result in a poorer End-prep; adapter ligation
will also be affected. However, the sample prep will still work with half the quantity of input DNA.
When selecting for long reads, a starting amount of 5 µg is required to account for losses during BluePippin fragment selection, and
the lower number of longer fragments.
The nanopore captures and processes short and long DNA strands in the same way. However, the average length of DNA
fragments can have an effect on throughput, as the concentration of free DNA ends will be different (e.g. short fragments give a
higher concentration of DNA ends), which impacts on the efficiency of adapter ligation. Most Oxford Nanopore protocols are
optimised for 0.2 pmoles of DNA.
Libraries composed of long fragments typically give lower throughput than short fragments, as there are fewer molecules and they
take longer to be captured by the pore. This also results in more sequencing time spent in open pore. If BluePippin size selection is
performed as part of library prep, this can lower throughput further due to fragments outside a particular range being excluded.
Throughput expectations
Applications
Chemistry Technical Document
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 26 of 27
Chemistry Technical Document
Ultra-long reads
Version: CHTD_500_v1_revO_07Jul2016
Sequence capture is a targeted approach that enables a subset of the genome(s) of interest to be sequenced. Exome sequencing is
a typical example of where sequence capture may be used, targeting the sequencing towards all the protein-coding DNA in a given
genome. Sequence capture is an alternative enrichment strategy to amplicon sequencing, and is the method of choice where there
is a large number of target regions, and amplification is impractical.
Experimental comparisons at Oxford Nanopore showed that the Agilent SureSelect approach, which uses in-solution hybridisation
of RNA probes to the target DNA, gave the highest percentage of on-target reads when sequencing was performed on the MinION.
The process favours DNA fragments of 1–2 kb; this has resulted in a recommendation that genomic DNA be fragmented to this size
rather than the ~8 kb recommended for the Lambda Control Experiment.
Ultra-long reads
Long reads can be achieved with both ligation- and transposase-based library prep methods, however the length of the reads also
depends on the starting length and quality of the DNA. Shearing DNA in a Covaris g-TUBE results a narrower distribution of read
lengths than tagmenting with the Rapid Sequencing Kit. A method for the enrichment of long reads using the BluePippin platform is
also available.
As seen from the above graphs, using the Rapid Sequencing Kit or the Ligation Sequencing kit without fragmentation can yield
reads of up to 100 kbases. However, these make up a small proportion of the total reads in the library.
Oxford Nanopore Technologies has developed a library prep protocol that uses the BluePippin device, which enables the user to
select only reads of a particular length. After size selection on the BluePippin, the library is prepared using the Ligation Sequencing
kit.
Additionally, some members of the Nanopore Community have developed their own library prep methods. Using Oxford Nanopore
kits, customers have sequenced fragments of up to 1 Mbase.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy
Nanopore Technical document Page 27 of 27
Chemistry Technical Document
16S analysis
Version: CHTD_500_v1_revO_07Jul2016
16S analysis
Due to the presence of both highly conserved (adequate for universal primers and phylogenetic signal) and highly variant regions
(different across species), the 16S rRNA gene is often used for sequence-based bacterial identification. The workflow requires
amplifying the 16S genes from a biological sample and sequencing them on the MinION. The 16S workflow in EPI2ME classifies the
reads and reports the taxa present in the sample.
The 16S gene can be amplified from a mixed sample using the 16S Rapid Amplicon Barcoding Kit. The kit contains primers that
anneal to conserved sequences within the gene.
Oxford Nanopore Technologies, the Wheel icon, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore
Technologies Limited in various countries. © 2008 - 2017 Oxford Nanopore Technologies. All rights reserved. Registered Office: Oxford Science Park, Oxford OX4 4GA, UK |
Registered No. 05386273 | VAT No 874 642494 | Privacy Policy