Yuval T Plos 2007 PDF
Yuval T Plos 2007 PDF
1 Department of Physics of Complex Systems, The Weizmann Institute of Science, Rehovot, Israel, 2 Department of Molecular Cell Biology, The
Weizmann Institute of Science, Rehovot, Israel
Background. Transcription factors (TF) regulate expression by binding to specific DNA sequences. A binding event is
functional when it affects gene expression. Functionality of a binding site is reflected in conservation of the binding sequence
during evolution and in over represented binding in gene groups with coherent biological functions. Functionality is governed
by several parameters such as the TF-DNA binding strength, distance of the binding site from the transcription start site (TSS),
DNA packing, and more. Understanding how these parameters control functionality of different TFs in different biological
contexts is a must for identifying functional TF binding sites and for understanding regulation of transcription. Methodology/
Principal Findings. We introduce a novel method to screen the promoters of a set of genes with shared biological function
(obtained from the functional Gene Ontology (GO) classification) against a precompiled library of motifs, and find those motifs
which are statistically over-represented in the gene set. More than 8000 human (and 23,000 mouse) genes, were assigned to
one of 134 GO sets. Their promoters were searched (from 200 bp downstream to 1000 bp upstream the TSS) for 414 known
DNA motifs. We optimized the sequence similarity score threshold, independently for every location window, taking into
account nucleotide heterogeneity along the promoters of the target genes. The method, combined with binding sequence and
location conservation between human and mouse, identifies with high probability functional binding sites for groups of
functionally-related genes. We found many location-sensitive functional binding events and showed that they clustered close
to the TSS. Our method and findings were tested experimentally. Conclusions/Significance. We identified reliably functional
TF binding sites. This is an essential step towards constructing regulatory networks. The promoter region proximal to the TSS is
of central importance for regulation of transcription in human and mouse, just as it is in bacteria and yeast.
Citation: Tabach Y, Brosh R, Buganim Y, Reiner A, Zuk O, et al (2007) Wide-Scale Analysis of Human Functional Transcription Factor Binding Reveals
a Strong Bias towards the Transcription Start Site. PLoS ONE 2(8): e807. doi:10.1371/journal.pone.0000807
a functional binding event is that the TF has been shown to bind at Functional binding: operational definition
the site on a gene’s promoter, and this binding has been To define functional binding in a computation-based manner we
demonstrated experimentally to affect the level of transcription use one or both of two criteria that go beyond the sequence
of the gene. Clearly, only functional binding is relevant for information contained in the PSSM; conservation of the binding
understanding regulation of transcription. Such experimental data motif between species and it’s co-occurrence on the promoters of
are, however, scarce and difficult to obtain on a scale that covers functionally related genes.
all genes and all known transcription factors (and our work poses The conservation-based approach is to compare the regulatory
questions on this scale, as explained below). In principle, had we regions of orthologous genes in different species to identify
known all functional BSs, as defined above, for every TF and every functionally conserved motifs [13,14,15,16,17,18]. If a TF is
gene, we could have provided a definitive answer to the question bound at a certain location and the binding is not functional, the
posed above, regarding the positional distribution of functional probability for conservation of the binding sites across several
BSs. In human the number of known TFs is on the scale of species is low. Using this method, Xie et al [16] showed that BS
a thousand and the number of genes runs in tens of thousands; conserved in four mammalian species exhibited a strong location
hence there are tens of millions of possible TF-promoter pairs. bias relative to the TSS. However, for a genomic region to be
Measuring reliably binding events of all possible TF-promoter functional, evolutionary conservation is neither necessary [19,20]
pairs is a tall order, but may be forthcoming [7] in a few years. nor sufficient [21,22]. Furthermore, their method is restricted to
However, establishing functionality for each bound TF-promoter genes that have orthologues over four species, and have TF
combination, or even obtaining a large enough unbiased sampling binding sites with conserved consensus sequences over all these
of such pairs, is clearly unrealistic. For this reason we work with species. For these reasons conservation is a hard test and
a modified ‘‘operational’’ definition of functional binding, that can imposing it is believed to lead to many false negatives (missed
be used within a computation-based attempt to identify functional functional BSs). For example, their failure to identify the TATA
BSs. box (see Fig 1D) as a conserved motif at a specific distance from
the TSS is indicative of the limitations of relying on conservation
Computational approach alone.
Binding of a TF to DNA at a particular location (BS) is The other criterion we use is based on the premise or hypothesis
influenced by a variety of factors that affect the energetics of the [23,24] that functionally related genes tend to be co-regulated,
bound TF-DNA complex. The first factor is the binding and hence if BSs of a TF are highly represented on the
sequence–i.e. the sequence of bases that appear at a putative promoters of such a group of genes, there is a good chance that
BS. Another factor is the structure (e.g. bending) of the DNA at this TF is involved in their regulation, and hence these BSs are
the BS; obviously epigenetic changes (such as methylation of functional. In order to implement this criterion in a genome-wide
nucleotides in or near the BS) are very important as well. The study, we have to produce lists of functionally related and co-
proximity of nucleosomes and the methylation, phosphorylation regulated genes and to test, in a statistically reliable manner, for
or acethylation states of their constituent histones also affect the over-representation of BSs of a TF on their promoters. Such
chemical environment ‘‘seen’’ by the TF (reviewed in:[8] ) The a group of genes may be obtained, for example, from cluster
same holds for other proteins that may be bound near the BS, analysis of expression data, which yields groups of co-expressed
whose presence can either inhibit binding of the TF on which we genes. It is standard procedure [25,26,27,28] to perform on such
focus, or enhance binding by modifying it’s conformation, or that a group of genes a Gene Set Enrichment Analysis (GSEA) [29]
of the DNA. to search for functional Gene Ontology (GO) [30] classes whose
Intense recent computational efforts were devoted to identifi- member genes are over-represented in the expression-based gene
cation of BSs for various TFs [1,2,9,10,11]. These works focused group. This way one produces a list of genes with the desired
property–they are co-expressed and functionally related, and
largely on few or a single one of the factors listed above, namely
hence are likely to be co-regulated. If a high fraction of these
recognizing BSs on the basis of their sequences. These studies
genes’ promoters contains BSs of a TF, it is a likely regulator of
relied on information accumulated from various experiments, that
these genes. The problem with implementing this standard
reported binding of the TF of interest to DNA segments that have
approach in our context is that expression data are available only
been sequenced [12]. On the basis of simple statistical analysis of
for a limited number of special conditions, cell types and tissues,
the frequency of appearance of various sequences among observed
and are mostly biased towards several pathologies and diseases.
binding events, a position specific score matrix (PSSM) is
As a result, there are no available experiments and correspond-
constructed for the TF, that allows an easy calculation (see
ing co-expression lists for all genes and all functional groups. In
Methods) of a binding score for every DNA sequence. Since
order to overcome this problem and generate comprehensive and
sometimes a set of similar sequences is identified as binding a yet
less biased gene lists, we make a key assumption: the genes that belong to
unidentified TF, in general each PSSM is associated with a motif
a functional GO class as our putative co-regulated group G. We
M (rather than with a TF). A sequence whose score exceeds
introduce and implement a novel algorithm that searches for
a threshold is defined as a ‘‘hit’’, e.g. as corresponding to a binding binding sites on the promoters of the genes of such a GO-based
event. Since sequence is only one of the several relevant factors group. If the genes that do have a particular binding site are
that govern binding, the accuracy of a PSSM-based method to over-represented in the group, this is viewed [31] as indicative of
predict TF binding is limited. functionality of the corresponding BSs.
Predicting functional binding is an even more difficult problem.
A TF may bind to a site on the DNA (one that has a high-scoring
sequence), without this ‘‘stray’’ binding having any effect on Outline of our method and main differences from
transcription. Since the biological definition of functional binding existing ones
can be tested only experimentally, for a bioinformatic analysis we Existing techniques [9,26,32,33,34] search for BSs by scanning
need to define functional binding in a way that can be used in one by one the promoters of various genes and comparing the
silico. PSSM-based score of every sequence to a threshold, which is
Figure 1. The TATA box score and GC content versus location on the promoters. A. Each 11bp-long sequence, located in the interval [+200, 21000]
bp with respect to the TSS on the promoters of 22,000 human genes, was scored using the PSSM of the TATA box. Scores above 210.4 were
identified as hits and marked by a point whose horizontal coordinate represents the location of the hit and the vertical coordinate represents the
value of its score. The high density of hits at about 25 and 35bp upstream from the TSS identifies these locations as most likely to be functionally
relevant. The 3 colored dotted lines represent 3 different thresholds (T) and the numbers next to each one of them are the % of TATA BS that were
found in the location window [2100,TSS]. B. The GC content as a function of location in the interval [+200, 21000] bp with respect to the TSS. The
vertical axis represents the percentage of promoters of 22,000 human genes that have a G or a C at each location. Pronounced dips are observed at
the TATA box and at the TSS. C. Distribution of identified hits obtained for various values of the threshold, marked by red, green and blue horizontal
lines on Fig 1A, with the % of hits found within the proximal peak also given there, for each threshold. As the threshold increases, the overall number
of hits decreases, but the relative weight of the proximal peak increases from 8% (for threshold T = 210.6) to 27% (for T = 26.5). D. Our method
identified BSs on 55 out of 81 promoters known to have proximal TATA BSs (see text), in the window [TSS, 2100], and none in any of the other
location windows (red dot). The threshold selected by our method was 210.27; if this threshold is used uniformly in the entire [200, 21000] interval,
about 250 hits are found outside the first upstream interval. The black dots denote the number of hits in and outside the first window, with the
numbers next to each point indicating the value of the uniform threshold used. The blue point shows the hits found by Xie et al, demonstrating that
their conservation-based method is also effective in eliminating false positives, but has a much larger number of false negatives than our method.
doi:10.1371/journal.pone.0000807.g001
fixed for the entire genome. We follow a different strategy: we Methods. Using this method, we performed a comprehensive
execute the search for BSs associated with a motif M simultaneously bioinformatic analysis that encompassed promoters of the 8110
for a group G of (probably) co-regulated genes, but the analysis is most annotated human genes, 23,400 mouse genes and the
carried out separately for each location window W, obtained by known [35] PSSMs of 414 motifs M, using all functional GO
dividing the promoters to short (100, 200 etc bp long) windows. groups to define the gene sets G that are scanned for enrichment.
A threshold value T is set, and we count the number of genes in To reduce false positives further, we repeated the same analysis
G that scored a hit in W–i.e. a score above T has been recorded, for the orthologue genes of mouse. Requiring that the same motif
using the PSSM of the tested motif M. Next, a hypergeometric is overrepresented in the same location window on the mouse
test is used to calculate an enrichment p-value, p(T,G,W,M), for orthologues of the same GO-based genes, is a demanding filter
the number of hits in G, compared to the number of hits [16]; hence passing it increases significantly our confidence in the
expected in W, using the same T, for a reference group of validity of the hit.
promoters. The reference group contains all known promoter Nevertheless, as stated above, the only way to prove functionality
sequences of the genome. It is very important to use the same of a BS is by a series of careful experiments. This, unfortunately,
window on the promoters of the reference group, since there is cannot be done in the context of a wide-scale search for binding
a significant systematic variation of the GC content within the sites. The best one can do is to present a large number of
region on which we focus (21000 to +200 bp). For further supporting pieces of evidence and consistency checks; our work is
details, including control of the false discovery rate (FDR), see to be viewed in this spirit.
BSs, and has a relatively large number of false negatives (7 BSs had an MGLC in human and mouse, albeit not necessarily at the
were found out of the window [2100 ,TSS] ). same location windows. Each row of Fig 3A corresponds to one
of these 333 (M,G) pairs, with each bar representing an MGLC.
Global analysis of Motif, GO and Location The corresponding 159 motifs (38% of the total 414 motifs in the
analysis–see Table S2) are associated with 56 GO gene groups
Combinations (MGLC) (42% of the 134 GO gene groups that were examined). A black
Having demonstrated the advantages of our method in a case bar represents a conserved MGLC, one that appears in human and
when the association between location and functionality is very mouse, at the same location window; a grey bar–an MGLC in
clear, we turn now to present our central results, based on a large- human only or mouse only. There are 337 conserved (black)
scale analysis. Here we use our operational definition of MGLCs, out of the maximal possible number of 785 (p-
functionality (see Introduction), to investigate the location bias of value,102320); they correspond to 114 different motifs. On the
the functional BSs associated with 414 vertebrate motifs with basis of their affiliation with GO groups we assign the MGLCs to
known PSSMs [35], in the promoters of 8110 human and 23,400 one of two classes: the majority belong to a ‘‘general GO group’’
mouse genes. As described in the Introduction, we used the GO (see below); the distribution of these conserved MGLCs
annotation database [30] to assemble groups of 30 or more unique according to location windows (see Fig 3B) reveals a strong bias
functionally related genes (smaller groups will not yield good towards the TSS. The second class of conserved MGLCs are
enrichment statistics); there were 134 such different functional GO spread somewhat further upstream from the TSS (see Fig 3C).
classes. In total, 7062 human genes (promoters) were assigned to at The division of the MGLCs into these two classes is a result of
least one GO group. For each motif M and GO group G, we our analysis and is seen clearly in Fig 3A: we noticed that the
performed enrichment analyses [29,48] in 12 consecutive location- MGLCs that belong to the second class are based on four
dependent windows W, each of length 100bp, from 200bp functional GO groups, and the (M,G) pairs were grouped in
downstream from the TSS to 1000bp upstream. In addition to Fig 3A accordingly.
the 100bp long windows analysed here, we examined also The very strong location bias of the MGLCs that belong to the
windows of different sizes (of 200 bp ,300 bp, 400 bp and general GO group is our central finding: it has been validated (for
700 bp), with and without overlap (Table S2). We found that those genes that have orthologues in human, mouse and rat) using
irrespective of the window size we use, in windows that did not a very different method and a different database of TF binding
contain the region [100,-200] (or part of it) almost no over sites (see Text S1, Figure S3 and Table S3).
represented motifs were found for most of the GO groups. It is
important to note that as the window size increases, a larger part
of the important functional location range [100, 2200] is covered The ‘‘General GO Group’’; locational bias and
by one window. Because of this reason the number of identified experimental verification for cell cycle motifs
significant BSs increased. On the other hand, using small window This group contains 177 conserved MGLCs that belong to 93%
gives better location specificity and better control on the GC (52/56) of the significant GO groups: these include cell cycle,
content of the background–which reduces the number of false immune response, protein biosynthesis as well as others (see Table
positives and yields better location resolution. We decide to focus S2). This group shows a strong location bias relative to the TSS:
on the 100bp window but the results for all the windows are 86% (153/177) of the conserved MGLCs were found in the two
presented in Table S2. Hence 4146134612 = 665,712 separate promoter windows 0–200 upstream to the TSS, while only 3% (5/
tests were carried out, one for every (M,G,W) combination, 177) were found in windows [2200,21000], and the remaining 19
represented as a path through the top three layers of boxes in MGLCs are downstream to the TSS (see Fig 3B). As a further
Fig 2A. The score threshold was determined independently for every demonstration of our general claim of association between
(M,G,W) combination, as described in Methods and in Fig. 2B. proximal location-specificity of the BS and functionality, we show
Controlling the False Discovery Rate [49] (FDR, see Methods) at for the cell cycle related functional class and associated TFs (for
the level of 0.10, we identified 6331 statistically significant which experimental expression data are available), that proximal
(M,G,W) combinations (134 GOs and 414 M’s appear in BSs are much more likely to be functional than those located further
4130 M,G pairs, as listed in Table S2). Statistical significance of upstream.
such an (M,G,W) combination means that motif M is over- We focused on the five cell-cycle associated motifs: CHR,
represented in window W on the promoters of the genes that CAAT, and three NFY-family motifs, whose MGLCs were
belong to the human functional GO group G. We refer to such overrepresented close to the TSS in both human and mouse. To
a significant (M,G,W) as a Motif, GO-group and Location test functionality in cell cycle, we used 3,308 genes for which we
Combination (MGLC). had both expression data measured during three cell cycles [36] in
Since some of our assumptions may not always hold (e.g. our HeLa cells, as well as promoter sequences. We calculated the cell
operational definition of functionality, the assumption that cycle periodicity index CCP [51] of each of these genes from the
functionally related genes are likely to be co-regulated, etc), expression data, and searched their promoter sequences, from
a significant fraction of these 6331 MGLCs may be false +200 to 21000 bp from the TSS, for every one of the 5 motifs. A
positives. As explained in the Introduction, conservation constitutes high CCP indicates strong cell-cycle dependence. We assembled
an independent and rather strict filter. We submitted our (see Methods) 5612 = 60 groups of genes (one for each of 5 motifs
MGLCs to a test of co-appearance for human and mouse M studied over 12 non-over lapping windows W of 100 bp). Each
[16,50], risking overshoot and producing now a list of MGLCs such group had NMW genes on whose promoters we registered a hit
with many false negatives. By repeating the same analysis for the (see Methods for details) for the motif M in window W. Next, for
mouse orthologues of the human genes that had been tested each MW combination, the distribution of the CCP scores of the
above, we found 785 MGLCs in mouse. The lower number of NMW target genes was calculated and compared to the background
MGLCs in mouse, compared to human, is probably caused by distribution of the CCP scores over all the 3,308 genes studied. A
translation to orthologues; as a result, the GO groups of mouse sequence of these distributions (see Figure S1), demonstrates that
were of 15%–30% smaller size. 333 (M,G) pairs (see Table S2) the distribution of the CCP scores associated with those genes,
Figure 2. Our method of search for BSs. A. Schematic method of search: we used groups of human genes that belong to 134 different functional GO
classes G, to search for each one of 414 motifs M in twelve 100bp-long windows W in the interval [+200, 21000] bp with respect to the TSS. In total,
4146134612 = 665,712 independent analyses were carried out, one for every (M,G,W) combination, represented as a path through the top three
layers of boxes. Each analysis produced the number of genes of G for which the score of M in the window W exceeded a threshold T. The extent of
over-representation of such hits was assessed by the hypergeometric test, which compared their number with similar hits in a random selection of |G|
out of all 8,110 human genes used. A variation of the resulting p-values p (M,G,W) with the threshold T was studied. All resulting p-values were
submitted to FDR analysis, and the statistically significant (M,G,W) combinations were intersected with those that were found significant also in
mouse. B. The dependence of –log[ p (M,G,W)] on the score threshold T is shown for 12 windows, for G = Mitosis GO class and M = NFY1. For the
window [TSS, 2100] bp we get a very prominent peak, for the windows in [2100, 2300] bp the peak is much smaller and broader, and for the other
windows it is within the noise. We find significant enrichment for the [TSS,2100] window, with the optimal threshold derived from the location of the
peak.
doi:10.1371/journal.pone.0000807.g002
Figure 3. Summary of our main results. A. Using FDR of 0.1 we identify the over-representation of motif M on promoters of genes of functional GO
class G, in location window W. Each row corresponds to one of 333 (M,G) pairs, composed of 56 GO classes and 159 motifs. Each bar represents an
MGLC: grey–either human only or mouse only, and black-human and mouse. The 56 GO clusters divide into two groups, a ‘‘general GO group’’ of 52
GO classes and a ‘‘transcriptional GO group’’ of 4 GO classes. The motifs M of the latter are GC-rich–see first column, where orange denotes GC
content above 60%, blue–below 30% and white–between both these values. B. Number of conserved MGLCs of the General GO group, in each
window. 93% are in the [2200,0] bp range. C. Same for the transcriptional GO group. The distribution is broad and peaks between 300–500bp
upstream from the TSS. D. Distributions of BSs according to their GC content, plotted separately for BSs associated with the two GO groups.
doi:10.1371/journal.pone.0000807.g003
whose CHR motif is found in the [2100,0] and [0,100] windows, 10% FDR. These include all the 5 motifs that were tested, with
differs significantly from the background distribution (of all the windows located near the TSS.
genes), with an enhanced number of genes with CCP scores as It is gratifying to note the agreement between the statistically
high as 5–10. A quantitative measure of the difference between significant MW combinations, obtained here from the expression-
distributions associated with each MW versus the background was based CCP distributions, and the results obtained from the
produced by the Kolmogorov-Smirnov test, yielding a p-value for sequence-based hyper-geometric over-representation scores
each MW. As seen in Fig 4A, 12 CCP distributions (out of the 60) (Fig 4B). This agreement demonstrates (a) the reliability of our
had p-values below 0.05 and 9 differed from the background at BS detection method to identify functionally important MGLCs
Figure 6. Testing our method on ATM-induced expression data. A. Analysis of G = 138 ATM-dependent genes [37] for M = NF-kB.01 over
representation. The dependence of –log[ p (M,G,W)] on the score threshold T is shown for 23 overlapping windows. Three upstream windows, (TSS-
100), (50–150) and (100–200) passed the hypergeometric test at an FDR of 10%. B. putative NF-kB.01 BSs of the 138 ATM-dependent genes; score
(vertical axis) versus location (horizontal axis). Our algorithm identifies the location and scores that are indicative of functionality of the BS (rectangle
enclosed by the red dashed line). Solid colored symbols mark genes whose expression was validated by PCR. The other genes in the box are marked
with blank colored symbols, those that are likely targets of NF-kB outside the box–by X. We list next to the gene names the fold change as measured
by the microarray and by PCR (in parentheses). The black dots are belong to the rest of the 138 genes,with putative BS outside the area indicative of
functionality.
doi:10.1371/journal.pone.0000807.g006
representation in the promoters of a functional GO class and next window of 200–400 bp, or even 400–600, whereas our main
conservation across species. results indicate a very strong bias to the first 200 bp, not the first
A possible point of criticism concerns ‘‘discovery bias’’: the 2000. Had we claimed overrepresentation of binding sites in the
known transcription factor motifs used here represent probably first 2000 bp, discovery bias would have been a valid concern.
only a small fraction of all transcription factors that exist in the Our main finding was obtained by a new motif-discovery
human genome. Because of the ways these factors are discovered, method introduced here. The method is characterized by several
these motifs are almost certainly biased towards proteins that bind novel features which make it both flexible and sensitive, identifying
to proximal promoter regions of genes. However, our results hits in a way that takes into account the location, genomic
cannot be attributed to this bias. Simply stated, since the background and a group of potentially co-regulated genes. We
traditional experimental analysis of promoters typically covers performed a high throughput wide scale analysis, for all commonly
regions of about 1000–2000 bp, there is no discovery bias that used motif PSSMs in a large variety of biological functional classes.
prefers the first 200 nucleotides upstream to the TSS over say the We found that the GO classes are divided into two groups: the
‘‘transcriptional GO group’’ of 1476 genes, whose promoters have NCBI RefSeq database. Focus chip genes are very suitable for our
relatively high GC concentrations upstream of 200bp from the analysis since they are highly annotated, have low redundancy and
TSS (giving rise to a broad distribution of BSs, peaking at , their putative promoters are assigned (We identified promoters for
2400 bp), and a ‘‘general GO group’’, of 6646 genes (with BSs 8,110 genes out of the 8,500 of the Human genome Focus chip).
concentrated in the first 200bp upstream of the TSS). The
information about the different GO groups and the motifs that Scoring a Binding Site
were found to be over represented in each are listed in Table S2 The score S (M; {n}) of a putative binding sequence of L
These results were substantiated by showing agreement between nucleotides, (n1,n2,…,nL), for a particular motif M is the log-
our sequence-based analysis with an expression based identifica- likelihood score calculated from the motif’s PSSM. The entries mi
tion of BSs that are functional in cell cycle regulation. (n) of the PSSM are the probabilities of finding nucleotide
Furthermore, we were able to show, using only NF-kB BS ni = C,G,A,T at site i :
locations and scores, that NF-kB BSs tend to lose their regulatory
effect when found at a distance beyond several hundred bp from
X
L
the TSS, and demonstrated that BS location and score are S(M; n1 ,::,nL )~ log (mi (ni ))
predictive of the relative expression level of the activated gene. i~1
The principal role played by the proximal region to the TSS
emerged also from analysis of BSs that were classified as conserved
over human, mouse and rat. Finally, we carried out an experiment
whose aim was to test our prediction in the most direct way. By Determining the threshold T(M,G,W)
measuring the transcriptional activity of the TF Myocardin when set some low initial value for T for the threshold, and count
its binding site is placed at several distances from the TSS on the N(M,G,W), the number of genes (of the GO group G) for which
promoter of the SM22 gene, we demonstrated that the effect of the motif M registered a hit (score.T) in the window W. Now repeat
TF on transcription of the target decreases significantly as the the process for the same motif, window and T, but use the
distance of its BS from the TSS increases. Whilst the result of this promoters of all the 8,110 human genes to count the number of
experiment cannot be viewed as a proof of our very general claims, hits in the same window, N0(M,W). Now we determine (by the
it is consistent with a necessary condition for our main finding, and hypergeometric test [48,63] p(M,G,W), the p-value for over-
hence provides a robust opportunity to falsify our conclusions. representation, i.e. the probability of finding more than N(M,G,W)
Had we found that Myocardin’s transcriptional activity is position hits for motif M within window W for |G| genes selected at
dependent, but peaks far (say 5–600 bp downstream) from the random from the 8,110. Finally, increase T (steps of 0.1) and
TSS, this would have contradicted our prediction. Several recent repeat the procedure; plots of p(T) are shown in Fig 2B for
diverse studies strongly support our results that the first 200 bp G = mitosis GO group and the motif M = NFY1, for all 12
upstream to the TSS are different, especially in terms of windows. For each of the a = 1,2, …665,712 (M,G,W) combina-
functionality; e.g. the conservation of promoters and BS between tions we choose as the corresponding threshold Ta the value of T
species [16,57]; the high percentage of functional promoter which gives the largest enrichment, i.e. maximal -log pa(T).
polymorphisms found within the first 100 bp [58]; the central Evidently, for the window (TSS-100bp upstream) we get a clear
importance of the first 300 bp upstream to the TSS for core prominent peak, for the next two windows (2100bp–2300bp) the
promoter activity [59]; pronounced depletion of repeatable peak is much smaller and broader, and for all the more distal
element concentration near the TSS [57,60]; identification of windows it is within the noise. This way we get the optimal
about 200 bp long nucleosome-free regions on either side of the thresholds and corresponding p-values, pa(Ta), as well as the full
TSS in yeast [61,62] and in higher Eukaryotic genomes [62]. set of pa(Ta), for each M,G,W. On the average, 500 different values
TFs are proteins that in order to be functional should be in of T were used for each M.
a physical, contact-based interaction with the transcriptional
machinery they regulate, which must have components near the Controlling the False Discovery Rate
TSS. Therefore, the simplest way to produce such physical We assembled the full set of values pa(T) and applied on it the FDR
interactions is to bind at a location near the TSS, and our findings controlling procedure [49]. The test-statistics corresponding to all the
are consistent with this ‘‘Occam’s razor’’. This does not imply, tests cannot be assumed independent of each other, due to several
however, that all functionally important BSs appear near the TSS. aspects: First, there is an overlap in the genes assembling the different
Regulatory regions, such as enhancers, that extend many GOs such that two different GO could contain almost the same
thousands of bp from the TSS may create complicated stable genes. Second, each score S comprises all the binding sites equal to S
3D structures that influence expression by physical interaction or better. As a result, the score S contains all binding sites obtained
with the proximal promoter. Our analyses do indicate, however, using more conserved scores. Third, there is spatial correlation
that the most prevalent transcriptionally functional mechanisms among neighboring motifs that are tested with regard to the distance
involve binding in the vicinity of the TSS. from the TSS. Forth, different PSSM could be very similar and by
that to assign the same promoter sequence as a ‘‘hit’’. Since all these
METHODS imply common biological factor affecting the test, these types of
dependencies are potential causes of positive correlation between the
Identifying promoter sequences test-statistics. The procedure we applied has been shown to control
DNA sequences upstream of human ORFs were downloaded from the FDR also for positively correlated test-statistics [64].
the GoldenPath server at UCSC http://genome.ucsc.edu/gold-
enPath/hg16/bigZips/. Putative regulatory regions for the
different genes were obtained (+200 to 21000 bp with respect to Assigning genes to an (M,W) group to test the CCP
the TSS). We used as our working set of genes the GeneChip score distribution
Human Genome Focus Array (Affymetrix, Santa Clara, CA, USA) A hit was recorded for gene g when the score of M exceeded
that represents over 8,500 verified human sequences from the a threshold. We described above how the threshold T (M,G,W)
was derived. For each gene we have to identify the proper G to be different location windows (of 100bp) with respect to the TSS. The
used. For genes that do not belong to any cell cycle related GO black curve is our background: the CCP score distribution of all
class we used the T that was calculated for the cell cycle GO class. the genes in the experiment(Whitfield et al. 2002).
If g belongs to a single cell-cycle related GO class, we use this as Found at: doi:10.1371/journal.pone.0000807.s001 (2.60 MB TIF)
our G. For genes that belong to more than one cell-cycle related
Figure S2 Over representation of GC and C rich ‘‘artificial’’
GO class we use the one that was most enriched in M.
motifs The hits found in various windows for two ‘‘artificial’’
The GC content of a motif was obtained for a PSSM by
PSSMs that contain G/C or C with high probability (Table S1)
calculating for each position the probability to get G or C, and
were over represented in human and mouse. MGLC analysis was
averaging it over the L positions of the PSSM. For a GO class of n
done for the different windows and for all GO classes (Table S2) as
genes we calculate the percent (P) of G and C along the n
explained in the text. Thirty five MGLCs were found, all of which
promoters. The p-value for being GC rich was obtained by
are associated with one of the 4 GO classes that comprise the
selecting randomly, 10000 times, groups of n genes and
transcriptional GO group.
calculating the fraction of such groups that had GC percentage
Found at: doi:10.1371/journal.pone.0000807.s002 (4.23 MB TIF)
higher than P.
Figure S3 Location distribution of conserved BSs, with high
Construction of reporters for Myocardin from SM22 similarity in human, mouse and rat. Location bias analysis of
conserved BSs, with high similarity in human, mouse and rat,
promoter that were downloaded from the UCSC browser[65] and are
SM22-luciferase reporter constructs were generated by cloning based on PSSMs obtained from the Transfac Matrix Data-
a genomic fragment of the SM22 gene spanning from 166 to base v8.3 created by Biobase [66] . The motifs were aligned
257 bp relative to the TSS into a pGL3 luciferase reporter according to their distance from the closest TSS and the
vector (Promega). Briefly, the genomic region was amplified from histogram of these distances was plotted. The total number of
human genomic DNA using the primers 59 agcatgcagagaatgtctcg conserved binding sites of these motifs is 39829; 11829 (30%) of
39 and 59 acagacaggatggggcgctg 39 and ligated into pGEM-T these were found in the first 200bp, compared to about 4%
easy vector (Promega). Recognition sequences for either BglII, found in each of the other 200bp long windows between 400bp
SmaI or NheI restriction enzymes were added to each primer at to 3000bp upstream.
the 59 end for the following steps. The Myocardin BS, known as Found at: doi:10.1371/journal.pone.0000807.s003 (1.51 MB TIF)
CArG box within the cloned SM22 region, was mutated using
QuikChange Site–Directed Mutagenesis kit (Stratagene) and the Table S1 PSSMs used in our work: TATA PSSM provided by
primers 59 ggtgtCctttcccGaaTtCtggagcc 39 and 59 ggctcca- MatIspector (Quandt et al. 1995), and two artificial motifs that
GaAttCgggaaagacacc 39 (Capital letters designate mutated base were generated by us: poly C motif and GC rich motif. The rows
pairs). The SM22 fragments that contained either an intact are the different nucleotides; the columns represent the nucleo-
Myocardin motif or one which was mutated were then cloned in tides’ position j in the motif. Each entry mj (n) is the probability to
three consecutive steps into pGL3 vector using the BglII, SmaI find nucleotide n at position j.
and NheI restriction enzymes. Four final luciferase reporters Found at: doi:10.1371/journal.pone.0000807.s004 (0.01 MB
were constructed, all of which contained three tandem repeats of PDF)
the ,220bp of SM22 regulatory region upstream of the Table S2 Full results for over-representation of binding sites.
luciferase coding sequence, but each harboring an intact or Comprehensive study of the appearances of 414 vertebrate BSs
mutated Myocardin motif in a different order or distances from with known PSSMs [34] in the promoters of 8110 human and
the luciferase TSS. 23,400 mouse genes. We used groups of human genes that belong
The transcriptional activity of these constructs was measured in to 134 different functional GO classes G, to search for each one
the HT1080 fibrosarcoma cell line, in which Myocardin is not of 414 motifs M in twelve 100bp-long windows W in the interval
expressed [65]. The reporters were transiently transfected into [+200, 21000] bp with respect to the TSS. We examined
these cells either in the absence or the presence of a small amount windows of different sizes (200bp ,300bp, 400bp and 700bp), with
of a Myocardin expression vector. To control for the transfection and without overlap between the windows. In this paper we
efficiency in each sample, the activity of a cotransfected construct focous mainly on the analysis of the 100bp window since its gave
coding for the Renilla-luciferase under the regulation of a CMV us better location specificity and better control on the background
promoter was measured. GC content. In total, for the 100bp windows,
Transfections and Reporter Assays HT1080 fibrosarco- 4146134612 = 665,712 independent analyses were carried out,
ma cells were plated at 26104 cells/well in a 24-well plate, one for every (M,G,W) combination. The analysis was carried out
24 hours prior to transfection. Cells were transfected using for human and mouse, and the statistically significant (M,G,W)
FuGene transfection reagent (Roche), with 500ng/well of combinations are shown. Each row represents an (M,G) pair (first
luciferase reporter construct, 5 ng/well of CMV-Renilla expres- two columns) with a statistically significant over-representation
sion vector for normalization of transfection efficiency, and either score (passed FDR of 0.10-see text), in at least one location
with or without 2.5ng/well pcDNA3 expression plasmid coding window in Human (grey with the letter H) or Mouse (grey with
for the mouse Myocardin gene (E.Olson). Cell extracts were the letter M) or in both (black box). The BS symbol and its GC
prepared 24 hours following transfection Luciferase and Renilla content are also given.
activities were determined using commercial reagents and Found at: doi:10.1371/journal.pone.0000807.s005 (0.87 MB
procedures (Promega). All experiments were conducted in PDF)
triplicate.
Table S3 Analysis of conserved BS in human mouse and rat.
39829 conserved BS in human mouse and rat from 409 Transfac
SUPPORTING INFORMATION PSSMs (v8.3 created by Biobase) (Wingender et al. 2000) were
Figure S1 Distributions of the CCP scores of 12 groups of genes downloaded from UCSC browser (Kent et al. 2002). For each
that contain the CHR binding motif in their promoters, at 12 motif (first column) the number of BS found in the first 3000bp
from the closest downstream TSS is given in the second column, ACKNOWLEDGMENTS
the number of BSs found in the first 200bp upstream of the TSS We thank R. Elkon and Y.Groner for most useful comments and a reviewer
are presented in the third column and the corresponding for most constructive and helpful criticism and suggestions.
percentage and P-value for this over-representation (derived using
the binomial distribution) are given in the fourth and fifth columns
Found at: doi:10.1371/journal.pone.0000807.s006 (0.03 MB
Author Contributions
PDF) Conceived and designed the experiments: VR ED YT. Performed the
experiments: YT. Analyzed the data: YT. Contributed reagents/materials/
Text S1 analysis tools: AY OZ AR MK. Wrote the paper: ED YT. Other:
Found at: doi:10.1371/journal.pone.0000807.s007 (0.03 MB Performed the biological experiment: RB. Conceived and designed the
DOC) biological experiment: RB YB.
REFERENCES
1. Elnitski L, Jin VX, Farnham PJ, Jones SJ (2006) Locating mammalian 25. Roth FP, Hughes JD, Estep PW, Church GM (1998) Finding DNA regulatory
transcription factor binding sites: a survey of computational and experimental motifs within unaligned noncoding sequences clustered by whole-genome
techniques. Genome Res 16: 1455–1464. mRNA quantitation. Nat Biotechnol 16: 939–945.
2. Aerts S, Thijs G, Coessens B, Staes M, Moreau Y, et al. (2003) Toucan: 26. Haverty PM, Hansen U, Weng Z (2004) Computational inference of
deciphering the cis-regulatory logic of coregulated genes. Nucleic Acids Res 31: transcriptional regulatory networks from expression profiling and transcription
1753–1764. factor binding site identification. Nucleic Acids Res 32: 179–188.
3. Gerland U, Moroz JD, Hwa T (2002) Physical constraints and functional 27. Zheng J, Wu J, Sun Z (2003) An approach to identify over-represented cis-
characteristics of transcription factor-DNA interaction. Proc Natl Acad Sci U S A elements in related sequences. Nucleic Acids Res 31: 1995–2005.
99: 12015–12020. 28. Tabach Y, Milyavsky M, Shats I, Brosh R, Zuk O, et al. (2005) The promoters of
4. Allison DB, Cui X, Page GP, Sabripour M (2006) Microarray data analysis: human cell cycle genes integrate signals from two tumor suppressive pathways
from disarray to consolidation and consensus. Nat Rev Genet 7: 55–65. during cellular transformation. Mol Syst Biol 1: 2005–0022.
5. Ambesi-Impiombato A, Bansal M, Lio P, di Bernardo D (2006) Computational 29. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, et al. (2005)
framework for the prediction of transcription factor binding sites by multiple Gene set enrichment analysis: a knowledge-based approach for interpreting
data integration. BMC Neurosci 7 Suppl 1: S8. genome-wide expression profiles. Proc Natl Acad Sci U S A 102: 15545–
6. Blais A, Dynlacht BD (2005) Constructing transcriptional regulatory networks. 15550.
Genes Dev 19: 1499–1511. 30. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, et al. (2000) Gene
7. Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, et al. (2000) Genome- ontology: tool for the unification of biology. The Gene Ontology Consortium.
wide location and function of DNA binding proteins. Science 290: 2306–2309. Nat Genet 25: 25–29.
8. Lam AL, Pazin DE, Sullivan BA (2005) Control of gene expression and assembly 31. Li H, Rhodius V, Gross C, Siggia ED (2002) Identification of the binding sites of
of chromosomal subdomains by chromatin regulators with antagonistic regulatory proteins in bacterial genomes. Proc Natl Acad Sci U S A 99:
functions. Chromosoma 114: 242–251. 11772–11777.
9. Elkon R, Linhart C, Sharan R, Shamir R, Shiloh Y (2003) Genome-wide in 32. Hertz GZ, Stormo GD (1999) Identifying DNA and protein patterns with
silico identification of transcriptional regulators controlling the cell cycle in statistically significant alignments of multiple sequences. Bioinformatics 15:
human cells. Genome Res 13: 773–780. 563–577.
10. Ho Sui SJ, Mortimer JR, Arenillas DJ, Brumm J, Walsh CJ, et al. (2005) 33. Kel AE, Gossling E, Reuter I, Cheremushkin E, Kel-Margoulis OV, et al. (2003)
oPOSSUM: identification of over-represented transcription factor binding sites MATCH: A tool for searching transcription factor binding sites in DNA
in co-expressed genes. Nucleic Acids Res 33: 3154–3164. sequences. Nucleic Acids Res 31: 3576–3579.
11. Liu R, McEachin RC, States DJ (2003) Computationally identifying novel NF- 34. Frith MC, Fu Y, Yu L, Chen JF, Hansen U, et al. (2004) Detection of functional
kappa B-regulated immune genes in the human genome. Genome Res 13: DNA motifs via statistical over-representation. Nucleic Acids Res 32:
654–661.
1372–1381.
12. Frech K, Quandt K, Werner T (1997) Finding protein-binding sites in DNA
35. Quandt K, Frech K, Karas H, Wingender E, Werner T (1995) MatInd and
sequences: the next generation. Trends Biochem Sci 22: 103–104.
MatInspector: new fast and versatile tools for detection of consensus matches in
13. McCue L, Thompson W, Carmack C, Ryan MP, Liu JS, et al. (2001)
nucleotide sequence data. Nucleic Acids Res 23: 4878–4884.
Phylogenetic footprinting of transcription factor binding sites in proteobacterial
36. Whitfield ML, Sherlock G, Saldanha AJ, Murray JI, Ball CA, et al. (2002)
genomes. Nucleic Acids Res 29: 774–782.
Identification of genes periodically expressed in the human cell cycle and their
14. Rajewsky N, Socci ND, Zapotocky M, Siggia ED (2002) The evolution of DNA
expression in tumors. Mol Biol Cell 13: 1977–2000.
regulatory regions for proteo-gamma bacteria by interspecies comparisons.
37. Rashi-Elkeles S, Elkon R, Weizman N, Linhart C, Amariglio N, et al. (2006)
Genome Res 12: 298–308.
Parallel induction of ATM-dependent pro- and antiapoptotic signals in response
15. McGuire AM, Hughes JD, Church GM (2000) Conservation of DNA regulatory
to ionizing radiation in murine lymphoid tissue. Oncogene 25: 1584–1592.
motifs and discovery of new motifs in microbial genomes. Genome Res 10:
744–757. 38. Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, et al. (2000)
16. Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, et al. (2005) Systematic Molecular Cell Biology W. H. Freeman. .
discovery of regulatory motifs in human promoters and 39 UTRs by comparison 39. Harbison CT, Gordon DB, Lee TI, Rinaldi NJ, Macisaac KD, et al. (2004)
of several mammals. Nature 434: 338–345. Transcriptional regulatory code of a eukaryotic genome. Nature 431: 99–104.
17. Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES (2003) Sequencing and 40. Pfeifer D, Kist R, Dewar K, Devon K, Lander ES, et al. (1999) Campomelic
comparison of yeast species to identify genes and regulatory elements. Nature dysplasia translocation breakpoints are scattered over 1 Mb proximal to SOX9:
423: 241–254. evidence for an extended control region. Am J Hum Genet 65: 111–124.
18. Cliften P, Sudarsanam P, Desikan A, Fulton L, Fulton B, et al. (2003) Finding 41. Kimura-Yoshida C, Kitajima K, Oda-Ishii I, Tian E, Suzuki M, et al. (2004)
functional features in Saccharomyces genomes by phylogenetic footprinting. Characterization of the pufferfish Otx2 cis-regulators reveals evolutionarily
Science 301: 71–76. conserved genetic mechanisms for vertebrate head specification. Development
19. Plessy C, Dickmeis T, Chalmel F, Strahle U (2005) Enhancer sequence 131: 57–71.
conservation between vertebrates is favoured in developmental regulator genes. 42. Howard ML, Davidson EH (2004) cis-Regulatory control circuits in de-
Trends Genet 21: 207–210. velopment. Dev Biol 271: 109–118.
20. Emberly E, Rajewsky N, Siggia ED (2003) Conservation of regulatory elements 43. Ling JQ, Li T, Hu JF, Vu TH, Chen HL, et al. (2006) CTCF mediates
between two species of Drosophila. BMC Bioinformatics 4: 57. interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1. Science
21. Nobrega MA, Zhu Y, Plajzer-Frick I, Afzal V, Rubin EM (2004) Megabase 312: 269–272.
deletions of gene deserts result in viable mice. Nature 431: 988–993. 44. Carninci P, Sandelin A, Lenhard B, Katayama S, Shimokawa K, et al. (2006)
22. Clark AG, Glanowski S, Nielsen R, Thomas PD, Kejariwal A, et al. (2003) Genome-wide analysis of mammalian promoter architecture and evolution. Nat
Inferring nonneutral evolution from human-chimp-mouse orthologous gene Genet 38: 626–635.
trios. Science 302: 1960–1963. 45. Sharan R, Ben-Hur A, Loots GG, Ovcharenko I (2004) CREME: Cis-
23. DeRisi JL, Iyer VR, Brown PO (1997) Exploring the metabolic and genetic Regulatory Module Explorer for the human genome. Nucleic Acids Res 32:
control of gene expression on a genomic scale. Science 278: 680–686. W253–256.
24. Hughes JD, Estep PW, Tavazoie S, Church GM (2000) Computational 46. Amir-Zilberstein L, Ainbinder E, Toube L, Yamaguchi Y, Handa H, et al.
identification of cis-regulatory elements associated with groups of functionally (2007) Differential Regulation of NF-{kappa}B by Elongation Factors Is
related genes in Saccharomyces cerevisiae. J Mol Biol 296: 1205–1214. Determined by Core Promoter Type. Mol Cell Biol 27: 5246–5259.
47. Yang C, Bolotin E, Jiang T, Sladek FM, Martinez E (2007) Prevalence of the 56. Eto A, Muta T, Yamazaki S, Takeshige K (2003) Essential roles for NF-kappa B
initiator over the TATA box in human and yeast genes and identification of and a Toll/IL-1 receptor domain-specific signal(s) in the induction of I kappa B-
DNA motifs enriched in human TATA-less core promoters. Gene 389: 52–65. zeta. Biochem Biophys Res Commun 301: 495–501.
48. Barash Y, Bejerano G, Friedman N (2001) A Simple Hyper-Geometric 57. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, et al. (2005) The
Approach for Discovering Putative Transcription Factor Binding Sites transcriptional landscape of the mammalian genome. Science 309: 1559–1563.
Algorithms in Bioinformatics: Springer Berlin/Heidelberg. 58. Buckland PR, Hoogendoorn B, Coleman SL, Guy CA, Smith SK, et al. (2005)
49. Benjamini Y, Hochberg Y (1995) Controlling the False Discovery Rate: A Strong bias in the location of functional promoter polymorphisms. Hum Mutat
practical and powerful approach to multiple testing. J Roy Stat Soc B, 57: 26: 214–223.
289–300. 59. Cooper SJ, Trinklein ND, Anton ED, Nguyen L, Myers RM (2006)
50. Wasserman WW, Palumbo M, Thompson W, Fickett JW, Lawrence CE (2000) Comprehensive analysis of transcriptional promoter structure and function in
Human-mouse genome comparisons to locate regulatory sites. Nat Genet 26: 1% of the human genome. Genome Res 16: 1–10.
225–228. 60. Marino-Ramirez L, Lewis KC, Landsman D, Jordan IK (2005) Transposable
51. Tavazoie S, Hughes JD, Campbell MJ, Cho RJ, Church GM (1999) Systematic elements donate lineage-specific regulatory sequences to host genomes.
determination of genetic network architecture. Nat Genet 22: 281–285.
Cytogenet Genome Res 110: 333–341.
52. Wang Z, Wang DZ, Hockemeyer D, McAnally J, Nordheim A, et al. (2004)
61. Yuan GC, Liu YJ, Dion MF, Slack MD, Wu LF, et al. (2005) Genome-scale
Myocardin and ternary complex factors compete for SRF to control smooth
identification of nucleosome positions in S. cerevisiae. Science 309: 626–630.
muscle gene expression. Nature 428: 185–189.
53. Wang D, Chang PS, Wang Z, Sutherland L, Richardson JA, et al. (2001) 62. Segal E, Fondufe-Mittendorf Y, Chen L, Thastrom A, Field Y, et al. (2006) A
Activation of cardiac gene expression by myocardin, a transcriptional cofactor genomic code for nucleosome positioning. Nature 442: 772–778.
for serum response factor. Cell 105: 851–862. 63. MacIsaac KD, Fraenkel E (2006) Practical strategies for discovering regulatory
54. Pipes GC, Sinha S, Qi X, Zhu CH, Gallardo TD, et al. (2005) Stem cells and DNA sequence motifs. PLoS Comput Biol 2: e36.
their derivatives can bypass the requirement of myocardin for smooth muscle 64. Benjamini Y, Yekutieli D (2001) The control of the false discovery rate in
gene expression. Dev Biol 288: 502–513. multiple testing under dependency. The Annals of Statistics 29: 1165–1188.
55. Yao GQ, Sun BH, Insogna KL, Weir EC (2000) Nuclear factor-kappaB p50 is 65. Milyavsky M, Shats I, Cholostoy A, Brosh R, Buganim Y, et al. (2007)
required for tumor necrosis factor-alpha-induced colony-stimulating factor-1 Inactivation of myocardin and p16 during malignant transformation contributes
gene expression in osteoblasts. Endocrinology 141: 2914–2922. to a differentiation defect. Cancer Cell 11: 133–146.