JARV5N23
JARV5N23
net/publication/281086818
CITATIONS READS
0 103
9 authors, including:
Some of the authors of this publication are also working on these related projects:
Genetic polymorphism of Major Histocompatibility Complex (MHC) alleles and their association with disease resistance in cattle and buffalo View project
All content following this page was uploaded by Jay Prakash Gupta on 12 January 2018.
ABSTRACT
Bovine tropical theileriosis is a major haemoprotozoan disease associated with high rates of morbidity and mortality particularly
in exotic and crossbred cattle. Recent studies suggest that a number of immune response genes, expressed differentially in
exotic and indigenous breeds play an important role in breed specific resistance to tropical theileriosis. In the present study,
expression of CXCL3 gene which has chemotactic activity for neutrophils, controls migration and adhesion of monocytes and
ultimately mediates its effects on target cells by interacting with a cell surface chemokine receptor called CXCR2 was studied in
crossbred cattle. The in vitro experimental result revealed significant difference in CXCL3 gene expression in Theileria annulata
challenged peripheral blood mononuclear cells of crossbred animals as compared to healthy controls and a 2.53 fold increase
(p < 0.05) was recorded. The results of current study indicate that CXCL3 may be involved in host-pathogen interaction during
tropical theileriosis.
Keywords: Crossbred, Theileria annulata, CXCL3, PBMCs
Bovine tropical theileriosis is a debilitating disease caused cells (PBMCs) with T. annulata showed significant
by the protozoan parasite Theileria annulata, transmitted differential regulation of genes in crossbreds as compared
by Hyalomma anatolicum anatolicum and has a wide to indigenous cattle (Dewangan et al., 2015). With the
geographical distribution from the Mediterranean basin burgeoning information in genetics and genomics, new
to China. This disease is associated with high levels of opportunities to identify factors controlling disease
morbidity and mortality, principally in exotic and crossbred resistance can now be explored (Soller and Andersson,
cattle as compared to indigenous cattle. The disease 1998). Chemokines are chemotactic cytokines controlling
identified as a major constraint on the improvement of the migratory patterns and positioning of immune cells.
cattle farming in several developing countries (Minjauw Chemokine (C-X-C motif) ligand 3 (CXCL3) is a small
and McLeod, 2003). As per the last estimate, the cost of cytokine belonging to the CXC chemokine family, controls
tropical theileriosis in India is approximately US$ 384.3 migration and adhesion of monocytes and mediates its
million (Minjauw and McLeod, 2003). The ideal approach effects on target cells by interacting with a cell surface
to control tropical theileriosis, as with other tick-borne chemokine receptor called CXCR2 (Smith et al., 2005;
diseases, includes a portfolio of integrated strategies that Ahuja and Murphy, 1996). The T. annulata parasite
are economically and environmentally sustainable. An infects mainly cells of the myeloid lineage which are also
attractive control strategy is to exploit pre-existing genetic the main producers of inflammatory cytokines. Genes
resistance (Glass and Jensen, 2007). A study comprised encoding these inflammatory cytokines in macrophages
of expression profile of many immune related genes are up-regulated in response to Theileria infection (Brown
by in vitro challenge of peripheral blood mononuclear et al., 1995). The present study was conducted with the
Kumar et al.
Primer Amplicon
Genes Primers Primer length
sequence size
CXCL3 RT- CXCL3 F GCTTGTCTCAACCCTGAAGC 20 bp 139 bp
RT- CXCL3 R TCCTCTATGAGCAGAGACCACT 22 bp
GAPDH RT-GAPDH F GGCGTGAACCACGAGAAGTATAA 23 bp 194 bp
RT-GAPDH R CCCTCCACGATGCCAAAGT 19 bp
objective to see the changes, if any, in mRNA expression of Protozoology Laboratory, Division of Parasitology, of the
CXCL3 in PBMCs challenged with T. annulata sporozoite institute was used to infect the cells in vitro. Sporozoite
in early hours. suspension was mixed at the rate of 0.5 tick equivalents in
2x106cells/ml. The PBMCs were incubated at 37° C in a
Four crossbred calves of around three months of age having
5% CO2 incubator for 2 h.
good general health maintained at Cattle and Buffalo
Farm, Indian Veterinary Research Institute Izatnagar RNA isolation was done using RNeasy Plus Mini Kit
were used in present study. Calves were screened for (Qiagen) as per the manufacturer’s instructions. RNA was
tropical theileriosis by blood smears examination before quantified by NanoDrop ND 1000 Spectrophotometer
proceeding for further experiment. (Thermo Scientific, Wilmington, DE, USA). Primers were
designed (Table 1) and Real time PCR reactions were
Peripheral blood was collected aseptically and
performed using Fast SYBR® Green Master mix (Applied
immediately stored on ice. Peripheral blood mononuclear
Biosystems, Warrington, UK). The qPCR thermal cycling
cells (PBMC) were separated under cold conditions by
program consisted of one cycle at 95°C for 10 min,
density gradient centrifugation (Histopaque-1.083 g ml−1,
followed by 40 cycles at 95°C for 15 s and 60°C for 1 min.
Sigma, Poole, Dorset, UK). The cells were resuspended
A dissociation step was included to confirm amplification
at 2x106 cells/ml in RPMI-1640 medium supplemented
specificity. Four biologicals (crossbred calves) and three
with 20% FBS and aliquot into a 6-well plate. The T.
technical replicates were used in the present study. Data
annulata sporozoites, (Parbhani isolate) maintained in the
generated were analysed by comparative CT method
(Schmittgen and Livak, 2008).