PracticeQuestions Exam1 Sp2015 KEY
PracticeQuestions Exam1 Sp2015 KEY
Codon Table!
STOP STOP
STOP
NOTE: We have included the Bloom’s level for each practice question (written in blue after each question).
This is a ranking of the type of thinking required to answer a question, which we discussed on the 1st day of
class. You may find it useful to go through the exam and assess how well you answered the different types of
questions to help you focus your studying for the next exam.
Knowledge
Comprehension
Application
Analysis
Synthesis
Evaluation
1. You are studying a protein that consists of a single polypeptide. You discover a mutant form of the protein
in which the leucine amino acid at the amino terminus of the protein has been replaced by a phenylalanine.
Which of the following level(s) of protein structure would be affected by this change? (Circle the best answer)
(COMPREHENSION)
1) primary only
2) primary and secondary
3) primary, secondary and tertiary
4) primary, secondary, tertiary and quaternary
A. The location of several proteins are indicated by numbered circles on the diagram in Fig. 1. Write the
names of the correct proteins in the table from the choices below. Briefly describe the function of the enzyme.
Choices: Primase, Ligase, DNA polymerase I, DNA polymerase III, single-stranded DNA binding protein
(SSBP), helicase, and topoisomerase. (COMPREHENSION)
B. You have a drug that blocks the activity of Primase. Which of the following would be affected by this
drug? (circle one) (APPLICATION)
a. Synthesis of a complete lagging strand
b. Synthesis of a complete leading strand
c. Synthesis of both a complete lagging strand and a complete leading strand
d. No effect, both strands would be synthesized normally
Q2 cont.
C. Looking at the portion of the replication fork shown in Fig.1, which is the leading strand?
Upper strand Lower strand
Describe what effect this drug would have on replication of the lagging strand. Explain your reasoning in one
sentence or less.
The Okazaki (short or discontinuous) fragments would be synthesized but would remain as short pieces since
there is no “glue” to join them together.
3. Of the following four 15-bp double-stranded DNA sequences, which will be most stable at higher
temperatures? In other words, which will most likely remain in a double-stranded form?
(Note: only one strand is shown here) Choose the single best answer. (APPLICATION)
1. CATCCTAGCGACTAT
B 2. CTATACGACATAGCC
3. AAATGCATACATCTT Answer: ___4_____
4. CCCGCATCGCCATCG
4. You have a drug that stops a cell from dividing. Which of the following processes would not be needed for
cells treated with this drug to survive? Choose the single best answer. (APPLICATION)
a. Transcription
b. Translation
c. DNA replication Answer: ____c________
d. Transcription and translation
e. Transcription, translation and DNA replication
5. Where in a eukaryotic cell do you expect to find the enzyme RNA polymerase? (1 word)
(COMPREHENSION)
___Nucleus_______________________
6. Below is the sequence of a complete mRNA from a bacterial cell:
(APPLICATION)
5’ ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3’
7. The antibiotic streptomycin interferes with prokaryotic translation but not eukaryotic translation. Note:
prokaryotes use a different initiating amino acid (f-met) than is found in eukaryotes.
You have a drug that blocks the initiation of prokaryotic translation
List 2 targets that this drug could be blocking. These targets could be molecules or specific parts of a molecule.
Be as specific as possible in less than one sentence. (ANALYSIS)
A. Attachment site for f-met on tRNA OR aminoacyl transferase for f-met tRNA (+3)
B. anticodon on f-met tRNA (+3)
This question came from the key concept that there are 2 parts of a tRNA that are different from one tRNA
to another (the anticodon and the amino acid attachment).
8. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1
base pair are indicated, as well as the polarity of the two DNA strands.
(APPLICATION)
+1 -10 -35
... 3' TTGCATCCGAAACGTACGATCGATCGGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' ...
... 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3' ...
a. Write below the letters for the bases of the first 6 nucleotides of the RNA molecule transcribed
from this gene. Be sure to indicate the 5’ and 3’ ends of the strand.
__5’-CUAGCU-3’___ (full credit required correct sequence, and correct labeling of 5’ and 3’ ends
You find a mutant with a 10-bp insertion between the start site of transcription (+1) and the ribosome
binding site (not shown in the figure). This insertion is composed only of C and G nucleotides.
9. Name one step in the processing of DNA to protein that can be regulated only in a eukaryote.
(<5 words) (KNOWLEDGE)
mRNA processing or transporting mRNA out of nucleus….other possibilities
10.
a) You figure out a way to replicate DNA in a
test tube by adding double-stranded DNA
template, dNTPs, NTPs and all the proteins
needed for replication. However, you forget to
add DNA ligase. Fill in the following parts of
the growing replication fork shown.
1) Fill in any replicated nucleic acids, using at
least 2 Okazaki fragments where appropriate
2) Label the new strands as “leading” or
“lagging”
3) Label the 5’ and 3’ ends of all nucleic acid
strands that you draw
4) Draw a circle representing the location of
DNA helicase (do not include any other
proteins in your drawing)
APPLICATION
• Labeling both leading and lagging strand
• Labeling 5’ and 3’ ends correctly
• Continuous DNA on leading strand
• Arrows on nucleic acids showing direction of
synthesis
• Okazaki fragments on lagging strand, not connected
• Circle showing DNA helicase (could be on either strand or both, but should be at or close to the replication
fork (but not past the fork)
b) When you look at the replicated DNA at the end of the experiment described in part “a”, do you expect to
see any RNA present on either strand? Explain your reasoning (one or two sentences maximum).
NO, the DNA polymerase I will still be able to remove the RNA primers (laid down by primase), and replace
them with DNA.
Note: for full credit you needed to explain why there was no longer any RNA at the replication fork, not
simply that the ligase wasn’t involved in this step.
c) If you made a mistake and instead of adding dNTPs to your reaction, you added dideoxynucleotide
triphosphates (ddNTPs) which lack both a 2’ and 3’ OH group, which of the following enzymes would be
directly affected? (Circle all that apply)
APPLICATION
Primase DNA polymerase I DNA polymerase III Topoisomerase Helicase
11. For each different mutant cell described below, assume that ONE specific molecule or part of a
molecule is mutated in that cell so that the molecule’s function has changed. Name as many
molecules that could result in the description (but remember that for the mutant phenotype, you are
considering each mutation by itself).
(ANALYSIS)
________________________
The tRNA with the alanine anticodon has a threonine attached to it instead of an alanine
(alternatively, you could say that the amino-acyl tRNA synthetase that normally “charges” the
alanine tRNA is mutated so it binds threonine instead)
release factor
________________________
Cell 3: About a third of all new proteins in a mutated cell are not doing their jobs correctly. When
you compared to proteins in a healthy cell, these proteins appear much larger overall.
Some tRNA has changed it’s anticodon to recognize one of the three STOP codons, so this is
erroneously continuing to elongate all proteins that normally use that STOP codon
12. You have done a genetic screen looking for mutants in the Compound D synthesis pathway
(shown below). Compound D is essential for life. Fill in the table with the expected phenotype (LIVE
or DIE) for cells carrying mutations in each of the listed enzymes.
13. You are studying a plant that grows in the forest and has red flowers. You learn that flower color in this
plant is determined by a single gene that codes for red pigment. You discover a different species of this plant
in a nearby meadow that has white flowers instead of red. You discover that this meadow species contains a
“white allele” with a single nucleotide difference upstream of the start site of transcription of the red pigment
gene, as shown in Fig. 1.
Fig. 1. Red Pigment Gene. The single nucleotide difference found in the white allele is indicated by an
asterisk (*). The start site of transcription is indicated by a +1. Transcription proceeds in the direction of
the arrow.
a) What molecular event could have caused this mutation? DNA damage or DNA polymerase error
COMPREHENSION
0 points for stating "DNA replication", "translation", "insertion", "deletion" or "point mutation"
b) Propose a hypothesis for how this nucleotide change could result in white flowers at the molecular level. In
your hypothesis, propose specific molecular interactions and cellular processes that would be impacted by the
nucleotide change (2 or 3 sentences max). SYNTHESIS
The mutation could be in the promoter and prevent the basal/general transcription factors from binding and
initiating transcription (partial credit for RNA polymerase). If there is no transcription of the pigment gene
there will be no pigment protein and the plant would have white flowers.
+2 points for stating that the mutation is in an upstream noncoding region
+2 points for stating that the gene will not be transcribed
+2 points for stating that the general transcription factors will not be able to bind
Note: need to connect the idea of no transcription back to the phenotype for full credit
c) Interestingly you find that the forest species is pollinated by hummingbirds whereas the meadow species is
pollinated only by bees. What could explain the continued presence of the white allele in the meadow plant
population through several generations? SYNTHESIS
There may be fewer hummingbirds and more bees in the meadow. Therefore the flowers that can be pollinated
by bees will have increased reproductive success or fitness, resulting in natural selection for the white allele
in meadow grown plants.
Note: need to connect the idea of the white allele and reproductive success or fitness for full credit