Purification, Polymerase Chain Reaction,

and Sequencing of Extracted Cheek DNA

February 20, 2019

Jaima Ferguson

Genetics 218

Dr. Kamps
Introduction

Polymerase Chain Reaction (PCR) is a technique used to amplify sequences of DNA using short

sequences of DNA and primers. This modern form of DNA production was discovered in 1993 by Kary

Mullis (D. S. T. Nicholl, 2002). Using PCR, recurrence of mutations can be found (Lee, M., Chang et. Al

1987). Florescent probes are used to find the presence of mutations after a PCR experiment has been

conducted (Vogelstein, B., & Kinzler, K. 1999) The temperature changes that occur in the PCR help the

DNA Helicase unwind the DNA and DNA Primase to make copies of the DNA sequences. The procedure

occurs in vitro to control the DNA produced in short bursts of time. The main steps of PCR occur as

listed: PCR Denaturation, Primer Annealing, and Extension. Denaturation occurs by denaturing and

separating the template DNA by heating the solution created to weaken the hydrogen bonds and

separate the 3’ and 5’ strands of DNA. The next step, Annealing reduces the temperature to allow the

primers to bind to the correct parts of the DNA. In Extension, the enzyme Taq Polymerase binds to the

nucleotides to the correct base pair on the DNA. These three steps repeat for approximately 30 cycles.

Amplifying the DNA with PCR is important because a large portion of DNA can be enlarged to sequence.

Because DNA sequencing is redundant, you would see repeating sequencing in large portions of the DNA

instead of focusing on smaller parts of the DNA sequence to see the errors.

The mix of primers with the template DNA directly affect the concentration of enzymes, DNA,

dNTP’s, and primers. If the concentration is too high, the primers cannot anneal to the template DNA

because they will inhibit each other. In denaturation the strands of DNA will not be able to separate

correctly and during annealing, the single stranded DNA will anneal to each other instead of the primers

making the PCR malfunction. Incorrect concentrations of dNTP’s then affect the extension period

because if the concentration off, the nucleotides will attach to the incorrect base pairs.
 Using gel electrophoresis, the size of an amplified DNA fragment will be analyzed and sized.

Within the sequence provided, the DNA primers are listed and give the estimated DNA length.

Highlighted below are the primers used in the sequencing process that indicated where the DNA is

located.

TGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCG
CCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAA
GCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCT
CCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTATAAACTAATACACCAGTCTTGTAAACCGGAG
ATGAAAACCTTTTTCCAAGGACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTA
ATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACC
GCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACA
TAAAAACCCAATCCACATCAAAACCCCCCCCTCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACA
TCAACTGCAACTCCAAAGCCACCCCTCACCCATTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACA
TAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGG
TCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACT
TGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGT
TCCCCTTAAATAAGAC

The estimated length of the sequenced DNA is 608 nucleotides based from the provided DNA sequence

including the primers.

Materials and Methods

DNA was extracted from cheek squamous cells utilizing the protocol with chelex that binds

metal ions that may be involved in the degradation of DNA and/or protentional inhibitors in later

reactions. The quantity and quality of the DNA was assessed using a nanodrop spectrophotometer

assaying for dsDNA. Two trials of the template DNA were conducted due to incorrect saline solution

being provided for the initial trial. Found in Table 1 were the components used for the in vitro reaction.

PCR was performed with the reagents as presented in Table 1 and a cycling program of 95 degrees

Celsius for 5 minutes, 95 degrees for 45 seconds, 58 degrees for 1 minute, 72 degrees for 1 minute,

returning to step 2 and looping through steps 2-4 for 29 times. Then 95 degrees for 45 seconds, 72

degrees for 1 minute, and finishing at 12 degrees until the PCR is removed. Gel electrophoresis was

performed using a 0.8% agarose gel and 1X TAE (Tris Acetic Acid EDTA) buffer. Due to poor quality DNA,
the final step for diluting and sending off to be sequenced was skipped. The concentration was not high

enough to dilute therefore the gel electrophoresis for the diluted DNA post PCR was also skipped.

Table 1. Components used for in vitro DNA PCR experiment.

Component Quantity in ul for 40 ul reaction
10 uM Forward Primer 5'-CACCAGTCTTGTAAACCGGA-3 1.72 ul
10 uM Reverse Primer 5'-CCTGAAGTAGGAACCAGATG-3’ 1.72 ul
2X Taq MasterMix (includes the buffer solution and dNTPs) 20 ul
Template DNA 7.04 ul
Sterile Water 9.52 ul

Results

The DNA that was extracted underwent different stages of lengths throughout the experiment.

The quality of the DNA began poor with a low quantity ng/ul as seen in Table 2. The table information

was acquired through a nanodrop and was necessary for the experiment because the quality of the DNA

was given. The gel electrophoresis for the template DNA was a smear of DNA under the UV light. Seen in

Figure 1 the experimented column was labeled “10”.

Table 2. Template DNA Nanodrop data

Sample # Replicate OD260 OD280 OD260/280 OD230 Quantity ng/ul
4 1 3.545 2.339 1.52 1.67 177.2
5 2 3.536 2.346 1.51 1.67 176.8
Average 3.541 2.343 1.515 1.67 177.0

Figure 1. Bioline Ladder gel with genomic DNA attempt 1

A second image was captured of the genomic DNA by the instructor with the same template DNA but

used a different ladder for imaging. As seen in Figure 2. The ladders were a hat in appearance instead a

smear. Many of the DNA structures became visible under the UV light. The experimented DNA column

was labeled with a 16.

Figure 2. kb Ladder gel with genomic DNA attempt 2

The quality for the PCR reaction DNA was very poor as seen in Table 3. The quantity assayed was very

low compared to the target quantity. Due to the poor quality of the original DNA it was expected for the

PCR DNA quantity to be poor as well.

Table 3. PCR DNA Nanodrop data 1

Sample # Replicate OD260 OD280 OD260/280 OD230 Quantity ng/ul
1 1 0.155 0.100 1.55 0.212 7.75
2 2 0.158 0.114 1.39 0.161 7.89
Average 0.1565 0.122 1.47 0.1865 7.82

Along with poor quantity results of the PCR data from the Nanodrop, the gel electrophoresis as seen in

Figure 3 shows the poor quality of the PCR DNA. The appearance of the gel was supposed to resemble
lines in the gel but instead resembled smears like Figure 1 of the template DNA. The experimented lane

was labeled with “10”.

Figure 3. Strategene KB Ladder gel with PCR amplified DNA attempt 1

Due to the poor quality of PCR DNA, a second trial was conducted through the instructor. The quality of

the DNA was still low but higher than the first trial as seen in Table 4. The OD230 wavelength for the

Nanodrop Re-Do was not provided in the chart.

Table 4. PCR DNA Nanodrop Re-Do data

Sample # Replicate OD260 OD280 OD260/280 OD230 Quantity ng/ul
9 1 0.25 0.158 1.55 12.5
10 2 0.25 0.136 1.39 12.5
Average 0.25 0.147 1.455 12.5
An additional gel electrophoresis trial was conducted for the second attempt of the PCR. As seen in

Figure 4 a band appeared near the 500-nucleotide marker on the gel. The experimented lane was

labeled with “16”.

Figure 4. kb Ladder gel with PCR DNA attempt 2

Discussion

There were parts of this experiment process that did not go as expected. The unexpected

outcomes were due to the crude protocol that was provided. Many parts had to be repeated in the

processes. However, the original hypothesis was supported because the nucleotide sequence was found

to be between 500 and 750 whereas the hypothesis consisted of 608 nucleotides. An unexpected

outcome from the experiment came from the nanodrop data. The quality of the DNA was low and low in

quantity. As previously stated, this was due to the crude protocol and obtaining and continuing to use

“dirty” template DNA after not being cleaned thoroughly enough with the protocol’s primers. In future

trials of this experiment, the protocol can be improved by using different primers and performing

multiple trials of the DNA data.

References

Vogelstein, B., & Kinzler, K. (1999). Digital PCR. Proceedings of the National Academy of Sciences

of the United States of America, 96(16), 9236-9241.

Nicholl, D. S. (2008). An introduction to genetic engineering. Cambridge: Cambridge University Press.

YANG, D., ENG, B., & SAUNDERS, S. (2003). Hypersensitive PCR, Ancient Human mtDNA, and

Contamination. Human Biology, 75(3), 355-364.

Lee, M., Chang, K., Cabanillas, F., Freireich, E., Trujillo, J., & Stass, S. (1987). Detection of Minimal

Residual Cells Carrying the t(14;18) by DNA Sequence Amplification. Science, 237(4811),

175-178.