0% found this document useful (1 vote)
1K views

3D Printed Microfluidic Devices

gg

Uploaded by

Danny Daniel
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (1 vote)
1K views

3D Printed Microfluidic Devices

gg

Uploaded by

Danny Daniel
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 214

3D Printed

Microfluidic
Devices
Edited by
Savas Tasoglu and Albert Folch
Printed Edition of the Special Issue Published in Micromachines

www.mdpi.com/journal/micromachines
3D Printed Microfluidic Devices
3D Printed Microfluidic Devices

Special Issue Editors


Savas Tasoglu
Albert Folch

MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade


Special Issue Editors
Savas Tasoglu Albert Folch
University of Connecticut University of Washington
USA USA

Editorial Office
MDPI
St. Alban-Anlage 66
4052 Basel, Switzerland

This is a reprint of articles from the Special Issue published online in the open access
journal Micromachines (ISSN 2072-666X) in 2018 (available at: https://www.mdpi.com/journal/
micromachines/special issues/3d printed microfluidic devices)

For citation purposes, cite each article independently as indicated on the article page online and as
indicated below:

LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number,
Page Range.

ISBN 978-3-03897-467-3 (Pbk)


ISBN 978-3-03897-468-0 (PDF)

Cover image courtesy of Nirveek Bhattacharjee and Albert Folch.


c 2018 by the authors. Articles in this book are Open Access and distributed under the Creative
Commons Attribution (CC BY) license, which allows users to download, copy and build upon
published articles, as long as the author and publisher are properly credited, which ensures maximum
dissemination and a wider impact of our publications.
The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons
license CC BY-NC-ND.
Contents

About the Special Issue Editors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii

Preface to ”3D Printed Microfluidic Devices” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

Savas Tasoglu and Albert Folch


Editorial for the Special Issue on 3D Printed Microfluidic Devices
Reprinted from: Micromachines 2018, 9, 609, doi:10.3390/mi9110609 . . . . . . . . . . . . . . . . . 1

Sander van den Driesche, Frieder Lucklum, Frank Bunge and Michael J. Vellekoop
3D Printing Solutions for Microfluidic Chip-To-World Connections
Reprinted from: Micromachines 2018, 9, 71, doi:10.3390/mi9020071 . . . . . . . . . . . . . . . . . . 4

Ludovic Serex, Arnaud Bertsch and Philippe Renaud


Microfluidics: A New Layer of Control for Extrusion-Based 3D Printing
Reprinted from: Micromachines 2018, 9, 86, doi:10.3390/mi9020086 . . . . . . . . . . . . . . . . . . 16

Megan Carve and Donald Wlodkowic


3D-Printed Chips: Compatibility of Additive Manufacturing Photopolymeric Substrata with
Biological Applications
Reprinted from: Micromachines 2018, 9, 91, doi:10.3390/mi9020091 . . . . . . . . . . . . . . . . . . 27

.Frederik Kotz, Patrick Risch, Dorothea Helmer and Bastian E. Rapp


Highly Fluorinated Methacrylates for Optical 3D Printing of Microfluidic Devices
Reprinted from: Micromachines 2018, 9, 115, doi:10.3390/mi9030115 . . . . . . . . . . . . . . . . . 48

Nurul Mohd Fuad, Megan Carve, Jan Kaslin and Donald Wlodkowic
Characterization of 3D-Printed Moulds for Soft Lithography of Millifluidic Devices
Reprinted from: Micromachines 2018, 9, 116, doi:10.3390/mi9030116 . . . . . . . . . . . . . . . . . 59

Yong Tae Kim, Kurt Castro, Nirveek Bhattacharjee and Albert Folch
Digital Manufacturing of Selective Porous Barriers in Microchannels Using
Multi-Material Stereolithography
Reprinted from: Micromachines 2018, 9, 125, doi:10.3390/mi9030125 . . . . . . . . . . . . . . . . . 70

Martin D. Brennan, Fahad F. Bokhari and David T. Eddington


Open Design 3D-Printable Adjustable Micropipette that Meets the ISO Standard for Accuracy
Reprinted from: Micromachines 2018, 9, 191, doi:10.3390/mi9040191 . . . . . . . . . . . . . . . . . 81

Eric Lepowsky and Savas Tasoglu


Emerging Anti-Fouling Methods: Towards Reusability of 3D-Printed Devices for
Biomedical Applications
Reprinted from: Micromachines 2018, 9, 196, doi:10.3390/mi9040196 . . . . . . . . . . . . . . . . . 93

Sein Oh and Sungyoung Choi


3D-Printed Capillary Circuits for Calibration-Free Viscosity Measurement of Newtonian and
Non-Newtonian Fluids
Reprinted from: Micromachines 2018, 9, 314, doi:10.3390/mi9070314 . . . . . . . . . . . . . . . . . 112

Michael J. Beauchamp, Hua Gong, Adam T. Woolley and Gregory P. Nordin


3D Printed Microfluidic Features Using Dose Control in X, Y, and Z Dimensions
Reprinted from: Micromachines 2018, 9, 326, doi:10.3390/mi9070326 . . . . . . . . . . . . . . . . . 123

v
Mohamed Sharafeldin, Abby Jones and James F. Rusling
3D-Printed Biosensor Arrays for Medical Diagnostics
Reprinted from: Micromachines 2018, 9, 394, doi:10.3390/mi9080394 . . . . . . . . . . . . . . . . . 135

Yonghee Kim, Jinyeop Lee and Sungsu Park


A 3D-Printed Millifluidic Platform Enabling Bacterial Preconcentration and DNA Purification
for Molecular Detection of Pathogens in Blood
Reprinted from: Micromachines 2018, 9, 472, doi:10.3390/mi9090472 . . . . . . . . . . . . . . . . . 157

Christopher Lim, Yangchung Lee and Lawrence Kulinsky


Fabrication of a Malaria-Ab ELISA Bioassay Platform with Utilization of Syringe-Based and 3D
Printed Assay Automation
Reprinted from: Micromachines 2018, 9, 502, doi:10.3390/mi9100502 . . . . . . . . . . . . . . . . . 169

Eric Lepowsky, Reza Amin and Savas Tasoglu


Assessing the Reusability of 3D-Printed Photopolymer Microfluidic Chips for Urine Processing
Reprinted from: Micromachines 2018, 9, 520, doi:10.3390/mi9100520 . . . . . . . . . . . . . . . . . 185

vi
About the Special Issue Editors
Savas Tasoglu joined the University of Connecticut (UCONN) in 2014 as an Assistant Professor in
the Department of Mechanical Engineering. He received his Ph.D. in 2011 from UC Berkeley, with
a research focus on transport phenomena and the pharmacokinetics of anti-HIV microbicide drug
delivery. Dr. Tasoglu held a postdoctoral appointment at Harvard Medical School and Harvard-MIT
Division of Health Sciences and Technology until he joined UConn in 2014. His current research
interests are point-of-care diagnostic devices, bioprinting, magnetic focusing, microfluidics, and
regenerative medicine. He serves on the editorial board of several journals including Bioprinting
(Elsevier), Scientific Reports (Nature), Journal of 3D Printing in Medicine (FSG), and International
Journal of Bioprinting. Dr. Tasoglu’s achievements in research and teaching have been recognized
by fellowships and awards including Chang-Lin Tien Fellowship in Mechanical Engineering,
Allen D. Wilson Memorial Scholarship, and UC Berkeley Institute Fellowship for Preparing Future
Faculty. Dr. Tasoglu has published 50+ co-author articles in journals such as Nature Communications,
Nature Materials, Advanced Materials, PNAS, Small, ACS Nano, Chemical Society Reviews, Trends in
Biotechnology, and Physics of Fluids. His work has been featured on the cover of Advanced Materials,
Small, Trends in Biotechnology, and Physics of Fluids and highlighted in Nature, Nature Physics, Nature
Medicine, Boston Globe, Reuters Health, and Boston Magazine.

Albert Folch received his BSc in physics from the University of Barcelona (UB), Spain, in 1989.
In 1994, he received his PhD in surface science and nanotechnology from the UB’s Physics Dept.
During his PhD, he was a visiting scientist from 1990–91 at the Lawrence Berkeley Lab working on
AFM. From 1994–1996, he was a postdoc at MIT developing MEMS. In 1997, he joined Mehmet
Toner’s laboratory at Harvard. He has been at UW BioE since June 2000, where he is now a
full Professor, accumulating over 7,600 citations (averaging >82 citations/paper). His lab works at
the interface between microfluidics, 3D-printing, and cancer. In 2001 he received a NSF Career
Award, and in 2014 he was elected to the AIMBE College of Fellows. Albert Folch is the author
of four books, including “Introduction to BioMEMS”, a textbook now adopted by more than 78
departments in 18 countries. Since 2007, the lab has run a celebrated outreach art program called
BAIT (Bringing Art Into Technology), which has produced 7 exhibits, a popular resource gallery
(>2,000 free BioMEMS-related images), and a YouTube channel (>133,000 visits since 2009).

vii
Preface to ”3D Printed Microfluidic Devices”
Three-dimensional (3D) printing has revolutionized the microfabrication prototyping workflow
over the past few years. With recent advances in 3D printing and 3D computer-aided design
(CAD) technologies, highly complex microfluidic devices can be fabricated via single-step,
rapid, and cost-effective protocols as a promising alternative to the time-consuming, costly, and
sophisticated poly(dimethylsiloxane) (PDMS) molding and traditional cleanroom-based fabrication.
Microfluidic devices have enabled a wide range of biochemical and clinical applications, such
as cancer screening, micro-physiological system engineering, high-throughput drug testing, and
point-of-care diagnostics. Using 3D printing fabrication techniques, the alteration of design features
is significantly faster and easier than with traditional fabrication, enabling agile iterative and modular
design, 3D printing services and marketplaces, and rapid prototyping. Biocompatible resins for 3D
printing are now available that, contrary to PDMS, feature very low drug absorption and are thus
very good material candidates for building complex 3D organ-on-a-chip systems in the future. These
advances will make microfluidic technology more accessible to researchers in various fields and
will accelerate innovation in the field of microfluidics. Accordingly, this Special Issue showcases
14 research papers, communications, and review articles that focus on novel methodological
developments in 3D printing and its use for various biochemical and biomedical applications. The
papers of this special issue explore the following aspects of 3D printing and how it pertains to
microfluidic devices: (1) fabrication methods and materials, (2) applications for equipment and tools,
(3) biological applications, and (4) biological compatibility.

Savas Tasoglu, Albert Folch


Special Issue Editors

ix
micromachines

Editorial
Editorial for the Special Issue on 3D Printed
Microfluidic Devices
Savas Tasoglu 1,2,3,4,5, * and Albert Folch 6, *
1 Department of Mechanical Engineering, University of Connecticut, Storrs, CT 06269, USA
2 The Connecticut Institute for the Brain and Cognitive Sciences, University of Connecticut,
Storrs, CT 06269, USA
3 Department of Biomedical Engineering, University of Connecticut, Storrs, CT 06269, USA
4 Institute of Materials Science (IMS), University of Connecticut, Storrs, CT 06269, USA
5 Institute for Collaboration on Health, Intervention, and Policy (InCHIP), University of Connecticut,
Storrs, CT 06269, USA
6 Department of Bioengineering, University of Washington, Seattle, WA 98195, USA
* Correspondence: [email protected] (S.T.); [email protected] (A.F.)

Received: 19 November 2018; Accepted: 19 November 2018; Published: 21 November 2018

Three-dimensional (3D) printing has revolutionized the microfabrication prototyping workflow


over the past few years. With recent advances in 3D printing and 3D computer-aided design
(CAD) technologies, highly complex microfluidic devices can be fabricated via single-step, rapid,
and cost-effective protocols as a promising alternative to the time-consuming, costly, and sophisticated
poly(dimethylsiloxane) (PDMS) molding and traditional cleanroom-based fabrication. Microfluidic
devices have enabled a wide range of biochemical and clinical applications, such as cancer screening,
micro-physiological system engineering, high-throughput drug testing, and point-of-care diagnostics.
Using 3D printing fabrication techniques, the alteration of design features is significantly faster and
easier than with traditional fabrication, enabling agile iterative and modular design, 3D printing
services and marketplaces, and rapid prototyping. Biocompatible resins for 3D printing are now
available that, contrary to PDMS, feature very low drug absorption and are thus very good material
candidates for building complex 3D organ-on-a-chip systems in the future. These advances will
make microfluidic technology more accessible to researchers in various fields and will accelerate
innovation in the field of microfluidics. Accordingly, this Special Issue showcases 14 research
papers, communications, and review articles that focus on novel methodological developments
in 3D printing and its use for various biochemical and biomedical applications. The papers of
this special issue explore the following aspects of 3D printing and how it pertains to microfluidic
devices: (1) fabrication methods and materials, (2) applications for equipment and tools, (3) biological
applications, and (4) biological compatibility.
1. Fabrication methods and materials: Fuad et al. [1] characterized additively manufactured
molds fabricated via stereolithography and material jetting, as well as the positive replicas produced
by soft lithography and PDMS molding. They showed that stereolithography provides finer part
resolution with no toxicity observed in the corresponding positive replicas. Beauchamp et al. [2]
demonstrated a custom 3D printer which, via optical dosage control, provides very high-resolution
printing capabilities down to ~ 30 μm and ~ 20 μm scales for positive and negative surface features,
respectively. The custom printer was used to fabricate and optimize various microfluidic particle traps.
Kim et al. [3] also developed a novel printing scheme: specifically, a sequential stereolithographic
co-printing process which utilizes two different molecular weight poly(ethylene glycol) diacrylate
(PEG-DA) resins to produce microchannels with embedded porous barriers. The semi-autonomous
fabrication process reduced the processing time, manufacturing costs, and eliminated complications
with assembly. In addition to fabrication methods, Kotz et al. [4] presented work on materials

Micromachines 2018, 9, 609; doi:10.3390/mi9110609 1 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 609

formulated for 3D printing, namely highly fluorinated perfluoropolyether (PFPE) methacrylates,


for which 3D printing has seldom been demonstrated. The developed formulations, printed and
cured using stereolithography, exhibited high light transmittance and high chemical resistance to
organic solvents.
2. Applications for equipment and tools: Brennan et al. [5] utilized the capabilities of 3D
printing technology to create an open source design for micropipettes which can be assembled
from 3D-printed parts and a disposable syringe. The open source design exemplifies scientific
tools that can be produced via 3D printing as inexpensive alternatives to commercial products.
Oh et al. [6] also developed 3D-printed laboratory equipment to measure the viscosity of fluids,
which is applicable, for example, to the quality assurance of liquid products and for monitoring
the viscosity of clinical fluids. They designed 3D-printed capillary circuits, with graduations to
serve as a flow meter for easy readability and a syringe modified with an air chamber to generate
pressure-driven flow, to provide equipment and calibration-free viscosity measurement of Newtonian
and non-Newtonian fluids. Van den Driesche et al. [7] presented methods for a wide variety of
applications to design and fabricate microfluidic chip holders with integrated fluidic and electric
connections, such as fluidic sealing by O-rings and electric connections by spring-probes without glue
or wire bonding. Microfluidics can also be applied to 3D printing technologies, as demonstrated by
Serex et al. [8]. For application to bioprinting, Serex et al. demonstrated the integration of micromixers,
micro-concentrators, and microfluidic switches into the tip of the print heads for extrusion-based 3D
printing, thereby enabling new prospects in 3D bioprinting.
3. Biological applications: There are countless biological applications for 3D-printed microfluidic
devices, a few of which are included in this Special Issue. Lim et al. [9] reported an automated
platform for a colorimetric malaria-Ab assay, assembled from stereolithographic-printed elastomeric
reservoirs, fused deposition modeling-printed framework, plastic tubing, servomotors, and an Arduino
microcontroller chip. Kim et al. [10] demonstrated a 3D-printed millifluidic platform for bacterial
preconcentration and genomic DNA (gDNA) purification, by immunomagnetic separation and
magnetic silica-bead-based DNA extraction, to improve the molecular detection of pathogens in
blood samples. The platform was verified for preconcentrating E. coli in blood, suggesting that the
platform is a useful tool for lowering limitations on molecular detection. In addition to these research
articles, Sharafeldin et al. [11] wrote a review on the applications of 3D-printed microfluidic devices in
biomedical diagnostics and on how 3D printing enables low-cost, sensitive, and geometrically complex
devices. Three-dimensional printing can be used for the fabrication of microfluidics, supporting
equipment, optical and electrical components, in addition to 3D bioprinting which can incorporate
living cells or biomaterials into diagnostic systems.
4. Biological compatibility: In their work on connections and holders for microfluidic devices,
for bioanalysis applications, van den Driesche et al. [7] addressed the possible cytotoxicity of cured
3D-printed resin by introducing a surface coating of parylene-C. Carve et al. [12] reviewed commonly
used vat polymerization and material jetting materials with respect to the materials’ biocompatibility,
in addition to discussing methods to mitigate material toxicity to promote the application of 3D-printed
devices in biomedical and biological research, such as for monolithic lab-on-chip devices. In addition
to biocompatibility with cells, interactions with biomolecules such as protein have been studied by
Lepowsky et al. [13]. They demonstrated a simple cleaning chip design with an integrated cleaning
procedure to study the long-term cyclic biofouling burden on 3D-printed microfluidic devices, and
verified the cleaning chip for urine sampling handling for a protein assay. Lepowsky et al. [14] also
provided a perspective on traditional and emerging anti-fouling methods as applicable to enabling the
greater reusability of 3D-printed microfluidic devices for biomedical applications.
We wish to thank all authors who submitted their papers to this Special Issue. We would also like
to acknowledge all the reviewers for dedicating their time to provide careful and timely reviews to
ensure the quality of this Special Issue.

2
Micromachines 2018, 9, 609

Conflicts of Interest: A.F. declares no conflict of interest. S.T. is a founder of, and has an equity interest in mBiotics,
LLC, a company that is developing microfluidic technologies for point-of-care diagnostic solutions and QRfertile,
LLC, a company that is developing technologies for fertility testing. S.T.’s interests were viewed and managed
in accordance with the conflict of interest policies. The authors have no other relevant affiliations or financial
involvement with any organization or entity with a financial interest in or financial conflict with the subject matter
or materials discussed in the manuscript apart from those disclosed.

References
1. Fuad, N.M.; Carve, M.; Kaslin, J.; Wlodkowic, D. Characterization of 3D-printed moulds for soft lithography
of millifluidic devices. Micromachines 2018, 9, 116. [CrossRef] [PubMed]
2. Beauchamp, M.J.; Gong, H.; Woolley, A.T.; Nordin, G.P. 3D printed microfluidic features using dose control
in X, Y, and Z dimensions. Micromachines 2018, 9, 326. [CrossRef] [PubMed]
3. Kim, Y.T.; Castro, K.; Bhattacharjee, N.; Folch, A. Digital manufacturing of selective porous barriers in
microchannels using multi-material stereolithography. Micromachines 2018, 9, 125. [CrossRef] [PubMed]
4. Kotz, F.; Risch, P.; Helmer, D.; Rapp, B.E. Highly fluorinated methacrylates for optical 3D printing of
microfluidic devices. Micromachines 2018, 9, 115. [CrossRef] [PubMed]
5. Brennan, M.D.; Bokhari, F.F.; Eddington, D.T. Open design 3D-printable adjustable micropipette that meets
the ISO standard for accuracy. Micromachines 2018, 9, 191. [CrossRef] [PubMed]
6. Oh, S.; Choi, S. 3D-printed capillary circuits for calibration-free viscosity measurement of Newtonian and
non-Newtonian fluids. Micromachines 2018, 9, 314. [CrossRef] [PubMed]
7. van den Driesche, S.; Lucklum, F.; Bunge, F.; Vellekoop, M.J. 3D printing solutions for microfluidic
chip-to-world connections. Micromachines 2018, 9, 71. [CrossRef] [PubMed]
8. Serex, L.; Bertsch, A.; Renaud, P. Microfluidics: A new layer of control for extrusion-based 3D printing.
Micromachines 2018, 9, 86. [CrossRef] [PubMed]
9. Lim, C.; Lee, Y.; Kulinsky, L. Fabrication of a Malaria-Ab ELISA Bioassay Platform with Utilization of
Syringe-Based and 3D Printed Assay Automation. Micromachines 2018, 9, 502. [CrossRef] [PubMed]
10. Kim, Y.; Lee, J.; Park, S. 3D-Printed Microfluidic Platform Enabling Bacterial Preconcentration and DNA
Purification for Molecular Detection of Pathogens in Blood. Micromachines 2018, 9, 472. [CrossRef] [PubMed]
11. Sharafeldin, M.; Jones, A.; Rusling, J. 3D-Printed Biosensor Arrays for Medical Diagnostics. Micromachines
2018, 9, 394. [CrossRef] [PubMed]
12. Carve, M.; Wlodkowic, D. 3D-printed chips: Compatibility of additive manufacturing photopolymeric
substrata with biological applications. Micromachines 2018, 9, 91. [CrossRef] [PubMed]
13. Lepowsky, E.; Amin, R.; Tasoglu, S. Assessing the Reusability of 3D-Printed Photopolymer Microfluidic
Chips for Urine Processing. Micromachines 2018, 9, 520. [CrossRef] [PubMed]
14. Lepowsky, E.; Tasoglu, S. Emerging Anti-Fouling Methods: Towards Reusability of 3D-Printed Devices for
Biomedical Applications. Micromachines 2018, 9, 196. [CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

3
micromachines

Article
3D Printing Solutions for Microfluidic
Chip-To-World Connections
Sander van den Driesche 1,2,∗ , Frieder Lucklum 1,2 , Frank Bunge 1,2 and Michael J. Vellekoop 1,2
1 Institute for Microsensors, -actuators and -systems (IMSAS), University of Bremen, 28359 Bremen, Germany;
[email protected] (F.L.); [email protected] (F.B.);
[email protected] (M.J.V.)
2 Microsystems Center Bremen (MCB), University of Bremen, 28359 Bremen, Germany
* Correspondence: [email protected]; Tel.: +49-421-218-62652

Received: 2 January 2018; Accepted: 3 February 2018; Published: 6 February 2018

Abstract: The connection of microfluidic devices to the outer world by tubes and wires is
an underestimated issue. We present methods based on 3D printing to realize microfluidic
chip holders with reliable fluidic and electric connections. The chip holders are constructed
by microstereolithography, an additive manufacturing technique with sub-millimeter resolution.
The fluidic sealing between the chip and holder is achieved by placing O-rings, partly integrated
into the 3D-printed structure. The electric connection of bonding pads located on microfluidic chips
is realized by spring-probes fitted within the printed holder. Because there is no gluing or wire
bonding necessary, it is easy to change the chip in the measurement setup. The spring probes and
O-rings are aligned automatically because of their fixed position within the holder. In the case of
bioanalysis applications such as cells, a limitation of 3D-printed objects is the leakage of cytotoxic
residues from the printing material, cured resin. This was solved by coating the 3D-printed structures
with parylene-C. The combination of silicon/glass microfluidic chips fabricated with highly-reliable
clean-room technology and 3D-printed chip holders for the chip-to-world connection is a promising
solution for applications where biocompatibility, optical transparency and accurate sample handling
must be assured. 3D printing technology for such applications will eventually arise, enabling the
fabrication of complete microfluidic devices.

Keywords: 3D printing; stereolithography; microfluidics; chip-holder; fluidic and electric connections

1. Introduction
3D printing technology has evolved remarkably the last couple of years. Instead of a plastic
melting machine that creates low-resolution structures with a high surface roughness, now, liquid
resin-based 3D printers with a resolution of tens of micrometers and a surface roughness of a few
micrometers have become affordable [1–7]. With two-photon polymerization-based 3D printers,
it is even possible to attain a resolution down to 100 nanometers [8,9]. 3D printing has become
an attractive tool to fabricate measurement setup components. It enables the fabrication of sample
holders for various applications such as electron paramagnetic resonance measurements [10], surface
plasmon resonance spectroscopic measurements to align various illumination angles [11] and for
single-plane illumination microscopy [12]. It allows the construction of cartridge components to align
the optical setup containing a smart-phone, battery, cuvette and electrical circuitry for fluorescence
measurements [13], a smart-phone adapter including fluidic reservoirs [14], a connector to realize
the electrical connection to a digital microfluidic chip to conduct droplet size analysis by color
measurements [15] and lab ware [16]. In microfluidics, 3D printing is also becoming an accepted
technology. There is a series of 3D-printed microfluidic devices described in the literature, including
micromixers [17–19], flow channels [20] and valves [21,22]. Besides the printing of such structures,

Micromachines 2018, 9, 71; doi:10.3390/mi9020071 4 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 71

also the integration of fluidic and electric connections can be realized [23]. A 3D-printed holder was
presented that compartmentalizes a glass microscope slide [24]. In this holder, recesses were made to
fit an electrochemical sensor and PEEK tubings to make fluidic connections. 3D-printed microfluidic
circuits that handle multiple fluid streams were presented that consist of integrated chip-to-world
interconnects [25]. A fluidic interconnect based on a 3D-printed clamping structure yielded a maximum
sealing pressure up to 416 kPa [26].
Apart from the many advantages, there are several limitations in 3D printing for direct fabrication
of microfluidic devices [2,4]. The removal of support material, structures that are required to
temporarily reinforce the design to prevent its collapse during the printing process, of small fluidic
geometries requires careful handling. Furthermore, it is hard to print microfluidic channels with
a diameter of less than several hundred micrometers. The surface roughness of constructed designs,
material selection and biocompatibility to biological samples are also not optimal to realize devices
that from a functional point of view can compete with silicon and glass chips [2,27,28].
Microfluidic devices constructed from hard non-cytotoxic materials, like silicon and glass, have
many advantages for the analysis or actuation of biological samples. The chips can be fabricated
by standard clean-room processes. The channel geometry ensures a closed and thus controlled
environment that can be optimized for the sample [29]. However, the connection of microfluidic
devices to the outer world by tubes and wires is an underestimated issue. The diversity in microfluidic
chip dimensions, the fluidic inlet and outlet amount, geometry of the channel, bonding pad sizes and
number to connect the electrodes, as well as optical measurement window geometry make it infeasible
to design a universal chip holder. This means that almost every designed chip requires a specialized
holder. The gluing of bonded-port connectors directly on the chip is a possible solution [30]. However,
these connectors have a relatively large footprint that might not fit on the chip. In addition, they
incur considerable expenses, and gluing is a process with limited reliability for fluidic interconnects.
A method is needed to quickly construct and easily redesign holders for different microfluidic chips.
The following design criteria should be taken into account: (i) the holder should have integrated fluidic
and electric connections; (ii) easy exchange of the chip; no gluing; (iii) the dimension of the holder
should be as small as possible. A useful overview of fluidic connections and electrical interconnects in
microfluidics is given in the Design Guideline for Microfluidic Side Connect [31] and the Guidelines for
Packaging of Microfluidics: Electrical Interconnections [32]. Both documents are part of an initiative to
standardize microfluidic devices and component interfaces [33,34].
Injection molding and micro-milling are existing techniques to construct customized microfluidic
chip holders [35]. However, these techniques require specialized expensive equipment or molds.
A separate mold is needed for every design. Furthermore, these techniques do not give many degrees
of freedom for the design of geometric channel structures within the holder. This makes them
impractical when multiple fluidic and electric interconnects have to be accommodated. 3D printing
has several advantages compared to injection molding and micro-milling. It allows the integration
of complex geometric structures such as curved and closed sub-millimeter channels and specialized
fluidic and electric connector ports printed directly within the holder. Injection molding for mass
production of simple chip holder geometries has certain advantages compared to standard 3D printing
technology. However, when the fluidic chip-to-world connections consist of an inner channel structure
with curves, 3D printing shows enormous advantages. In this work, we combine the best of two worlds:
clean-room technology for the fabrication of silicon and glass microfluidic chips with submicrometer
resolution and 3D printing to make chip holders with integrated electric connections and fluidic
connections that do not require a very high resolution. Several designed and assembled microfluidic
chip holders are presented, including fluidic and electric connections, to show 3D printing as the
solution for chip-to-world connections.

5
Micromachines 2018, 9, 71

2. Materials and Methods

2.1. Stereolithography
Stereolithography, a form of additive manufacturing that is based on layer-by-layer
photopolymerization of liquid resins, is a technology to create high resolution complex 3D-printed
microfluidic geometries. The design of 3D-printed devices can easily be created and adapted in CAD
software such as Inventor (Autodesk, San Rafael, CA, USA) or SolidWorks (Dassault Systèmes SolidWorks
Corp., Waltham, MA, USA). The completed design is exported in the STL (Standard Tessellation Language)
format at high resolution for pre-processing with the 3D printer software. Pre-processing the designs
includes checking for and fixing any errors to create a completely valid STL file, orienting the part on
the build platform and adding support structures for overhangs as necessary. Finally, the 3D printer
software slices the STL file and supports into individual layers. In most cases, these pre-processing steps
are automated and just takes a few mouse clicks to confirm the proposed changes.
There are many different additive fabrication technologies, each with its strengths and
weaknesses [1,36]. Stereolithography technology is recommended to construct parts with a feature
size on the sub-millimeter scale. It features a high lateral resolution and high surface smoothness.
Microstereolithography with DLP (Digital Light Processing) micromirror array projection reliably
yields feature sizes (such as channels, holes and walls) down to 100 μm [37].
In this work, a high-resolution microstereolithography DLP printer (Perfactory Micro HiRes,
EnvisionTEC Inc., Dearborn, MI, USA) was used to fabricate the chip holders. A high-resolution,
high-temperature, low viscosity acrylic polymer resin (HTM140 M, EnvisionTEC Inc., [38]) is used
as the printing material. E-Shell 300 [39], a Class IIa biocompatible resin used for hearing aid shell
manufacturing, was tested for cytotoxic effects on the growth of mammalian cells. Prior to printing,
the stirred resin is filtrated into the carefully-cleaned printer bath for optimal printing conditions.
The process is set to a lateral (x/y) resolution of 31 μm and a slicing thickness (z) of 25 μm. The exposure
time is typically set to 3000 ms per slice. The maximum build size is 40 mm× 30 mm× 100 mm.
After printing, all constructed parts are removed from the build platform and rinsed with
isopropanol in an ultrasonic bath. Then, the realized part is dried with nitrogen or air, and the
support structures are removed. Finally, all parts are cured in a UV flood chamber for at least
five minutes. The total processing time is primarily dependent on the height of the printed structure,
typically ranging from one to a few hours, which highlights the rapid prototyping characteristics of
this approach.

2.2. Cell Line for Biocompatibility Test


The influence on the viability of Madin-Darby Canine Kidney cells (MDCK, ATCC CCL-34,
a gift from Dr. Manfred Radmacher, Institute for Biophysics, University of Bremen, Bremen,
Germany) and HaCaT cells (a gift from Dr. Ursula Mirastschijski, Centre for Biomolecular Interactions
Bremen, University of Bremen, Bremen, Germany) exposed to UV-cured 3D-printed structures has
been investigated. The epithelial kidney cell line MDCK and keratinocyte skin cell HaCaT are
well-established models used in many biological studies [40,41].

2.3. Cell Line Preparation


The MDCK and HaCaT cells were cultivated in Glasgow Minimum Essential Medium (GMEM)
and 10% fetal calf serum, supplemented with 100 units/mL penicillin and 100 μg/mL streptomycin
(all obtained from Sigma-Aldrich, Darmstadt, Germany). The cell culture was kept in a humidified
atmosphere containing 5% CO2 and 95% ambient air at 37 °C.

2.4. Coating of 3D-Printed Structures with Parylene-C


Parylene-C is a USP Class VI and ISO-10993-6 certified biocompatible material [42–44]. We have
coated 3D-printed structures with parylene-C with a Labcoater series 300 (Plasma Parylene Systems

6
Micromachines 2018, 9, 71

GmbH, Rosenheim, Germany) to investigate the inhibition of cytotoxic effects on mammalian cells.
The deposition process of parylene-C is depicted in Figure 1.

Figure 1. The deposition process of parylene-C. First, parylene-C dimer powder or granulate is
vaporized at 150 °C, followed by a pyrolysis step at 730 °C to obtain parylene-C diradical monomers.
At a temperature of 50 °C and a pressure of approximately 10 Pa, the monomer vapor condensates and
forms a conformal coating on the substrate.

3. Results and Discussion


The cytotoxicity of printing material is discussed in Section 3.1; followed by Sections 3.2 and 3.3,
where methods are described about how to realize reliable fluidic and electric chip-to-world
connections, all based on 3D printing. Several chip holder concepts for on-chip cell growth and/or
analysis are presented in Section 3.4.

3.1. Cytotoxicity Tests of MDCK and HaCaT Cells Exposed to 3D-Printed Structures
In the case of bioanalysis applications, a strong influence on cellular behavior of mammalian
cells and bacteria exposed to 3D-printed structures realized from liquid resins was observed [29].
The resins commonly used for stereolithography 3D printing contain UV-sensitive photo-initiators,
which exhibit a pronounced cytotoxic effect [45]. Biocompatible classified resins such as E-Shell 300
from Envisiontec [39] or Med610 from Stratasys [46] need a thorough post-processing, including
UV-flood exposure to cross-link residual monomers. However, the 3D-printed microfluidic chip
holders contain inner channel structures with regions inaccessible to UV light. When measurements
are conducted with sensitive biological cells, an efficient and attractive method to prevent such
cytotoxic effects is by coating the 3D-printed structures with parylene [47]. During the deposition
process of parylene-C, reactive monomer diffuses into the 3D-printed channel, coating the inner
structure. This assures that liquid sample, pumped from syringes into the chip, does not become
contaminated with resin residues that are toxic for the biological sample.
In Figure 2, measurement results are depicted of MDCK cells grown in a multi-well plate for 24 h
exposed to 3D-printed parts with and without a 10 μm-thick parylene-C coating. Two samples were
prepared for each test.
The printed structures from the resins E-Shell 300 and HTM140 both show a strong cytotoxic effect
on MDCK cells (Figure 2b,c). The cells did not attach to the bottom of the culture well within the 24 h of
incubation. The parylene-C coating strongly inhibits the cytotoxic effect of the resin. The MDCK cells
behavior in Figure 2d is similar compared to the negative control sample shown in Figure 2a (viability of
respectively 84% and 85%), while the cells exposed to uncoated parts die. HaCaT cells yielded the
same coated versus uncoated viability results as the MDCK cell measurements. For each HaCaT test,
four samples were prepared, and the exposure time to 3D printed structures was 72 h. The control
group and the parylene-C coated samples both yielded a HaCaT cell viability of >95%. The viable tests
were conducted by trypan blue staining (Thermo Fischer Scientific, Darmstadt, Germany).
The measurements show that the coating of 3D-printed HTM140 structures with parylene-C
is an easy and effective method preventing toxic resin components from diffusing into the
biological sample.

7
Micromachines 2018, 9, 71

Figure 2. Cytotoxicity tests of MDCK cells exposed to 3D-printed structures built from E-Shell 300 and
HTM140 resin and a 10-μm parylene-C-coated structure. The MDCK cells were grown in a multi-well
plate for 24 h in Glasgow Minimum Essential Medium (GMEM) supplemented with 10% fetal bovine
serum and antibiotics. (a) Negative control. MDCK cells attached to the bottom of a well plate show
normal cell proliferation. (b,c) MDCK cells exposed to a 3D-printed part made from E-Shell 300 or
HTM140 resin, respectively. The cells did not attach to the well-plate. (d) MDCK cells exposed to
a 3D-printed part coated with a 10-μm parylene-C layer. The cell attached to the bottom of the well,
showing similar behavior as the negative control sample.

3.2. Fluidic Chip Holder Connections


In microfluidic applications where a continuous flow of sample and/or carrier liquids is required,
the chip needs to be connected to syringe pumps. In Figure 3, a method for fluidic connections is
depicted where the holder acts as an interface between the chip and the syringe pumps.

Figure 3. Methods to realize the fluidic connection between microfluidic chips and syringe pumps.
(a) A schematic of an O-ring positioned in a recess and a tube fitted in a conically-shaped channel
geometry; (b) a 3D rendered image visualizing the inner channel geometry; (c) a Labsmith one-piece
fitting connection integrated in a chip holder.

The fluidic connections between the microfluidic chip and 3D-printed holder are sealed by O-rings.
By creating half doughnut-shaped recesses in the 3D-printed holder, the O-ring positions are secured,
which simplifies the assembly of chip and holder. These recesses are designed in such a way that 80%
(height) of the O-rings are located within the holder. The width of the recesses are 110% of the O-ring

8
Micromachines 2018, 9, 71

diameter, allowing the rubber material to be pressed by the chip, yielding an air- and liquid-tight
chip-to-holder connection (Figure 3).
The fluid connections from the holder to syringes are realized by fixing PEEK tubing with an inner
and outer diameter of 250 μm and 800 μm, respectively, directly into the holder (Figure 3a,b). A channel
structure with a diameter of 0.7 mm starting at the O-ring recess is directed within the holder to the
tube connection, fitting the PEEK tubing. This connection is achieved by mechanically clamping the
tubing in a conically-shaped geometry integrated in the channel. A fluid-tight connection is obtained
by gluing the tubing with two-component epoxy resin adhesive to the chip holder. An alternative
method that does not require the gluing of the tubing to the holder is depicted in Figure 3c. Here,
the tubing is placed in a Labsmith one-piece fitting (T132-100 [30]), which clamps the tube when
mounted in a metal 2-56 UNC nut, integrated in the holder. The other end of the tube is connected to
a syringe by a Luer-lock connector.
A series of leakage tests was conducted to investigate the O-ring-based chip-to-world sealing.
More than ten 3D-printed chip holders, each containing four to six fluidic connections, were each
assembled up to fifty times. Fluidic tests were performed up to 100 kPa. In none of the O-rings did
leakage occur. For three measurements, a pressure of 700 kPa was applied to a holder assembly by
a Hamilton Gastight 1 mL syringe (Sigma-Aldrich), placed in a KD Scientific Legato 180 dual syringe
pump (KD Scientific, Holliston, MA, USA). A fitting glass slide was placed to seal off the O-rings.
To allow slow pressure increase, a gas plug was used in the syringe; the rest was filled with water.
The applied pressure was measured by a LabSmith uPS0800-C360 pressure sensor set (LabSmith,
Livermore, CA, USA) containing fluidic connection adapters and PEEK tubing. Within approximately
four minutes at a flow rate of 0.1 mL/min, a pressure of 700 kPa was reached. Also in these tests,
no leakage was detected. This demonstrates the reliability of the presented O-ring method.

3.3. Electric Chip Holder Connections


The electric connection between the bonding pads of the chip and 3D-printed holder can be
realized by integrating spring probes within the holder. Because the probes are positioned at
fixed, predefined locations, they are automatically aligned to the bonding pads during chip and
holder assembly. In Figure 4, a 3D render of a chip holder with two electric connections is depicted.
The recesses printed into the holder have a 100-μm wider diameter than the spring probes. They are
fixed into the holder by soldering a wire at the end of the pin. The reliability of spring probe connections,
a well-known solution in microelectronics, remains high, even after multiple re-assemblies of the chip
and holder [32].

Figure 4. A method to electrically connect a microfluidic chip to the outer world by applying spring
probes fitted into a 3D-printed holder.

3.4. 3D-Printed Microfluidic Chip Holders for Cell-Growth and Cell-Analysis Experiments
In this section, four dedicated 3D-printed chip holder designs for different cell growth and cell
analysis experiments are presented. The holder aspects illustrated by these designs are the method of
fluid supply connection (O-ring (#1), screwed (#2) or glued(#3,4)), the realization of fluid reservoirs on
top of the chip (#1) and an assembly with multiple electric connections (#2,3). In addition, a holder
that furthermore allows optics is presented (#4). All printed holder parts that are in contact with

9
Micromachines 2018, 9, 71

biological samples were coated with parylene-C. The first design, a 3D-printed chip holder for
a mammalian cell growth chip, is depicted in Figure 5 [29]. The 18 mm× 13 mm× 1.4 mm chip is
sandwiched between a top and a bottom holder fitted by M3-screws and nuts. The total system,
chip and holder, has a dimension of 22 mm× 29 mm× 8 mm. Each top holder contains three fluid
reservoirs of 20–40 μL, which are sealed on the microfluidic chip inlets by O-rings. Because of the
open reservoirs, liquids can be supplied much more easily and more reliably with a pipette compared
to pipetting directly into the chip. Furthermore, these reservoirs can be designed with a depth and
spacing allowing a pipetting robot to handle the liquids. The optical window, the area located in
the center of the chip, is easily accessible with a microscope objective, allowing optical investigation
of biological samples. When measurements are conducted with mammalian cells or bacteria, it is
recommended to use medical-grade O-rings. Standard O-rings are oiled and therefore might be
toxic for the biological sample. We used O-rings made from E3609-70, which is a special Ethylene
Propylene Diene Monomer rubber (EPDM), purchased from Parker Hannifin GmbH, Kaarst, Germany.
According to the manufacturer, this material passed ISO 10993-5 and -10 testing, and it is compliant
with USP Class VI and USP <87> , proving its biocompatibility and non-cytotoxicity.

Figure 5. The assembly of a microfluidic chip and holder (22 mm× 29 mm× 8 mm). The chip is
sandwiched between two top holder parts and a bottom holder. The three printed parts are fixed by
M3 screws and nuts. Liquid reservoirs, integrated in the top holder, have a volume of 20–40 μL and are
connected with O-rings to the chip inlets. (a) The schematic; (b) cut-out visualizing the fluid reservoirs
and O-rings; and (c) a photo of the assembly.

The second design, a microfluidic device utilized for bacterial growth experiments, is depicted
in Figure 6. The chip has integrated heating and temperature measurement elements. These require
electrical connections from the chip to an external control circuitry. Four spring probes with a diameter
of 1.6 mm and a length of 6.2 mm (Harwin Part Number P70-2300045R) were used to accomplish these
electric connections. The fluidic chip-to-world connection consist of an O-ring placed between the
chip and holder, an inner holder channel construction with a geometry fitting a 2-56 UNC nut and
a conically-shaped structure allowing a Labsmith one-piece fitting tube connection.
The third design, depicted in Figure 7, is a microfluidic device used to position and analyze
biological samples at predefined regions in the chip [48]. The chip holder has an optical window
accessible with an inverted microscope, three fluidic and nine electric connections. The spring probes
have a diameter of 0.68 mm, a length of 16.55 mm, and a travel distance of 2.65 mm (Multicomp Part
Number P50-B-120-G).
In the fourth design, a measurement assembly fitting the microfluidic chip and external optical
components are 3D-printed (Figure 8). This measurement setup is used for monitoring the oxygen
consumption of mammalian cell cultures [49]. The setup is constructed from a 3D-printed chip
holder (Figure 8b) and a 3D-printed optical alignment structure, fitting the chip holder and additional
components, such as LEDs, a Raspberry Pi camera module and an optical filter at any desired position.
The optical alignment structure was printed by a Form 1 3D printer (Formlabs, Somerville, MA, USA).

10
Micromachines 2018, 9, 71

Figure 6. (a) A photo of a microfluidic chip holder (19 mm× 26.5 mm× 10 mm) with six fluidic and
four electric connections. The fluidic outer connection is realized by placing 2-56 UNC metal nuts at
the end of a channel structure. The chip (7 mm× 12 mm× 1 mm) has three measurement chambers
that are deep reactive-ion etched in a silicon wafer. The chambers are closed by an anodically-bonded
borosilicate glass wafer. (b) A 2D cut to visualize the fluidic inner channel structure and Labsmith
one-piece fitting connection.

Figure 7. A microfluidic chip holder (21 mm× 30 mm× 8(21) mm) including three fluidic and nine
electric connections. (a) The bottom holder part contains doughnut-shaped recesses where O-rings
connecting the chip to the channel structure within the printed holder fit. (b) A glass-silicon-glass chip
(13 mm× 17 mm× 1.4 mm) fitted in the bottom holder. (c) The top holder including spring probes to
connect the bonding pads of the chip. (d) A photo of the assembled chip and holder.

Figure 8. The measurement setup to investigate biological samples. The LEDs, optical filter and
Raspberry Pi camera are utilized to conduct fluorescence experiments of the samples, located in
the chip. (a) A 3D rendered image of the measurement setup; (b) the microfluidic chip holder
(17 mm× 24 mm× 11.5 mm) containing fluidic and electric connections; (c) photo of the measurement
setup (52 mm× 68 mm× 69 mm).

A 3D-printed part with a thickness of approximately 2.5 mm is strong enough to support


a microfluidic chip. The holder design allows the easy exchange of the chip. None of the connections
between the chip and holder are glued. Because of the 3D printing, the assembly including all fluidic,
electric and optical components is much more compact compared to standard laboratory systems.
Consequently, the devices can be easily transported out of the lab and be used even at remote locations.

11
Micromachines 2018, 9, 71

The 3D printing of microfluidic chip holders brings high flexibility to research laboratories.
When multiple parts are required, the fabrication can easily be up-scaled for small series production. One of
the current drawbacks of 3D printing for mass production is the speed to fabricate devices. However,
3D printing technology is evolving quite fast, and the printing speed is a parameter that is increasing
rapidly. Two interesting 3D printing technologies have recently been presented. TNO (The Hague,
The Netherlands) has developed a microstereolithography device (Lepus) that constructs up to 1200 layers
per hour (30 mm/h at a resolution of 25 μm per layer). The light synthesis technology (CLIP) from Carbon
(USA) yields printing speeds of 100–1000 mm/h [50,51]. This reduces the printing time by a factor of
a hundred. In the hearing aid industry [52], dentistry [53] and footwear industry [54], 3D printing has
already evolved from a rapid prototyping technology into a manufacturing tool for mass production.
Other advantages of 3D printing that could revolutionize the manufacturing industry are
on-demand direct fabrication of production parts stored in a digital library, customized product
designs without additional cost, reduction of assembly work because structures of higher complexity
can be constructed from a single printed part and the reduction of logistic hassle because the storage
of production parts can be reduced [55].

4. Conclusions
The given examples show that 3D printing is a versatile tool to realize microfluidic chip holders.
The flexibility of 3D printing allows the quick redesign of chip holders and adaptation for other chip
geometries. Reliable chip and holder assembling is achieved by applying O-rings and spring probes to
attach the fluid and electric connections. This solves the challenge of connecting fluidic and electrical
parts of microfluidics to the outer world. When the 3D-printed structures are used in combination with
biological samples, cytotoxic effects due to resin components can be prevented by coating 3D-printed
structures with parylene-C.
The combination of silicon/glass microfluidic chips fabricated with highly-reliable clean-room
technology and 3D-printed chip holders for the chip-to-world connection is a promising solution for
applications where biocompatibility, optical transparency and accurate sample handling must be assured.

Acknowledgments: The authors would like to thank André Bödecker and Lukas Immoor for depositing
parylene-C on the 3D-printed structures.
Author Contributions: The work presented in this paper was a collaboration of all authors. S.v.d.D., F.L. and F.B.
designed and fabricated the devices. The biocompatibility tests, conducted by F.B., were designed by S.v.d.D., F.B.
and M.J.V. The results were interpreted by S.v.d.D., F.L., F.B. and M.J.V. The manuscript was written by S.v.d.D.
and discussed by all authors.
Conflicts of Interest: The authors declare no conflict of interest.

Abbreviations
The following abbreviations are used in this manuscript:

CLIP Continuous Liquid Interface Production


DLP Digital Light Processing
EPDM Ethylene Propylene Diene Monomer
GMEM Glasgow Minimum Essential Medium
MDCK Madin-Darby Canine Kidney
PEEK Polyether Ether Ketone
STL Standard Tessellation Language

References
1. Vaezi, M.; Seitz, H.; Yang, S. A review on 3D micro-additive manufacturing technologies. Int. J. Adv.
Manuf. Technol. 2013, 67, 1721–1754.
2. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013.

12
Micromachines 2018, 9, 71

3. He, Y.; Wu, Y.; Fu, J.Z.; Gao, Q.; Qiu, J.J. Developments of 3D printing microfluidics and applications in
chemistry and biology: A review. Electroanalysis 2016, 28, 1658–1678.
4. Chen, C.; Mehl, B.T.; Munshi, A.S.; Townsend, A.D.; Spence, D.M.; Martin, R.S. 3D-printed microfluidic
devices: Fabrication, advantages and limitations—A mini review. Anal. Methods 2016, 8, 6005–6012.
5. Mao, M.; He, J.; Li, X.; Zhang, B.; Lei, Q.; Liu, Y.; Li, D. The emerging frontiers and applications of
high-resolution 3D printing. Micromachines 2017, 8, 113.
6. Xu, Y.; Wu, X.; Guo, X.; Kong, B.; Zhang, M.; Qian, X.; Mi, S.; Sun, W. The boom in 3D-printed sensor
technology. Sensors 2017, 17, 1166.
7. Krujatz, F.; Lode, A.; Seidel, J.; Bley, T.; Gelinsky, M.; Steingroewer, J. Additive Biotech—Chances, challenges,
and recent applications of additive manufacturing technologies in biotechnology. New Biotechnol. 2017,
39, 222–231.
8. Cumpston, B.H.; Ananthavel, S.P.; Barlow, S.; Dyer, D.L.; Ehrlich, J.E.; Erskine, L.L.; Heikal, A.A.;
Kuebler, S.M.; Lee, I.Y.; McCord-Maughon, D.; et al. Two-photon polymerization initiators for three-
dimensional optical data storage and microfabrication. Nature 1999, 398, 51–54.
9. Xing, J.F.; Zheng, M.L.; Duan, X.M. Two-photon polymerization microfabrication of hydrogels: An advanced
3D printing technology for tissue engineering and drug delivery. Chem. Soc. Rev. 2015, 44, 5031–5039.
10. Niemöller, A.; Jakes, P.; Kayser, S.; Lin, Y.; Lehnert, W.; Granwehr, J. 3D printed sample holder for in-operando
EPR spectroscopy on high temperature polymer electrolyte fuel cells. J. Magn. Reson. 2016, 269, 157–161.
11. Hill, R.T.; Kozek, K.M.; Hucknall, A.; Smith, D.R.; Chilkoti, A. Nanoparticle–film plasmon ruler interrogated
with transmission visible spectroscopy. ACS Photonics 2014, 1, 974–984.
12. Desmaison, A.; Lorenzo, C.; Rouquette, J.; Ducommun, B.; Lobjois, V. A versatile sample holder for single
plane illumination microscopy. J. Microsc. 2013, 251, 128–132.
13. Friedrichs, A.; Busch, J.; van der Woerd, H.; Zielinski, O. SmartFluo: A method and affordable adapter to
measure chlorophyll a fluorescence with smartphones. Sensors 2017, 17, 678.
14. Cevenini, L.; Calabretta, M.M.; Tarantino, G.; Michelini, E.; Roda, A. Smartphone-interfaced 3D printed
toxicity biosensor integrating bioluminescent “sentinel cells”. Sens. Actuators B Chem. 2016, 225, 249–257.
15. Yafia, M.; Ahmadi, A.; Hoorfar, M.; Najjaran, H. Ultra-portable smartphone controlled integrated digital
microfluidic system in a 3D-printed modular assembly. Micromachines 2015, 6, 1289–1305.
16. Lücking, T.H.; Sambale, F.; Beutel, S.; Scheper, T. 3D-printed individual labware in biosciences by rapid
prototyping: A proof of principle. Eng. Life Sci. 2015, 15, 51–56.
17. Shemelya, C.; Cedillos, F.; Aguilera, E.; Espalin, D.; Muse, D.; Wicker, R.; MacDonald, E. Encapsulated copper
wire and copper mesh capacitive sensing for 3-D printing applications. IEEE Sens. J. 2015, 15, 1280–1286.
18. Plevniak, K.; Campbell, M.; Myers, T.; Hodges, A.; He, M. 3D printed auto-mixing chip enables rapid
smartphone diagnosis of anemia. Biomicrofluidics 2016, 10, 054113.
19. Bhargava, K.; Ermagan, R.; Thompson, B.; Friedman, A.; Malmstadt, N. Modular, discrete micromixer
elements fabricated by 3D printing. Micromachines 2017, 8, 137.
20. Gong, H.; Bickham, B.P.; Woolley, A.T.; Nordin, G.P. Custom 3D printer and resin for 18 μm × 20 μm
microfluidic flow channels. Lab Chip 2017, 17, 2899–2909.
21. Au, A.K.; Bhattacharjee, N.; Horowitz, L.F.; Chang, T.C.; Folch, A. 3D-printed microfluidic automation.
Lab Chip 2015, 15, 1934–41.
22. Gong, H.; Woolley, A.T.; Nordin, G.P. High density 3D printed microfluidic valves, pumps, and multiplexers.
Lab Chip 2016, 16, 2450–8.
23. Van den Driesche, S.; Bunge, F.; Lucklum, F.; Vellekoop, M.J. 3D-Printing: An attractive tool to realize
microfluidic chip holders. In Proceedings of the 3rd International Conference on MicroFluidic Handling
Systems, Enschede, The Netherlands, 4–6 October 2017; pp. 94–97.
24. Oomen, P.; Mulder, J.; Verpoorte, E.; Oleschuk, R. Controlled, synchronized actuation of microdroplets by
gravity in a superhydrophobic, 3D-printed device. Anal. Chim. Acta 2017, 988, 50–57.
25. Bhargava, K.C.; Thompson, B.; Malmstadt, N. Discrete elements for 3D microfluidics. Proc. Natl. Acad.
Sci. USA 2014, 111, 15013–15018.
26. Paydar, O.; Paredes, C.; Hwang, Y.; Paz, J.; Shah, N.; Candler, R. Characterization of 3D-printed microfluidic
chip interconnects with integrated O-rings. Sens. Actuators A Phys. 2014, 205, 199–203.
27. Alharbi, N.; Wismeijer, D.; Osman, R. Additive manufacturing techniques in prosthodontics: Where do we
currently stand? A critical review. Int. J. Prosthodont. 2017, 30, 474–484.

13
Micromachines 2018, 9, 71

28. Osman, R.B.; van der Veen, A.J.; Huiberts, D.; Wismeijer, D.; Alharbi, N. 3D-printing zirconia implants;
a dream or a reality? An in-vitro study evaluating the dimensional accuracy, surface topography and
mechanical properties of printed zirconia implant and discs. J. Mech. Behav. Biomed. Mater. 2017, 75, 521–528.
29. Bunge, F.; van den Driesche, S.; Vellekoop, M. Microfluidic platform for the long-term on-chip cultivation of
mammalian cells for lab-on-a-chip applications. Sensors 2017, 17, 1603.
30. Labsmith One-Piece Fitting. Available online: http://products.labsmith.com/one-piece-fitting (accessed on
25 October 2017).
31. Buesink, W.; Heeren, H. Design Guideline for Microfluidic Side Connect. Available online: http:
//www.enablingmnt.co.uk/wp-content/uploads/2017/06/Design-Guidelines-for-Microfluidic-Side-Connect-
version-1.0.pdf (accessed on 5 Februar 2018).
32. Bullema, J.E.; Heeren, H.; Buesink, W. Guidelines for Packaging of Microfluidics: Electrical
Interconnections. Available online: http://mf-manufacturing.eu/wp-content/uploads/Guidelines-for-
Electrical-Interconnections-to-microfluidic-devices-version-1.0.pdf (accessed on 5 Februar 2018).
33. Heeren, H.; Atkins, T.; Verplanck, N.; Peponnet, C.; Hewkin, P.; Blom, M.; Buesink, W.;
Bullema, J.E.; Dekker, S. Design Guideline for Microfluidic Device and Component Interfaces
(Part 1). Available online: http://www.enablingmnt.co.uk/wp-content/uploads/2016/05/Design-for-
Microfluidic-Interfacing-White-Paper-part-1-version-2.pdf (accessed on 5 Februar 2018).
34. Heeren, H.; Atkins, T.; Verplanck, N.; Peponnet, C.; Hewkin, P.; Blom, M.; Buesink, W.;
Bullema, J.E.; Dekker, S. Design Guideline for Microfluidic Device and Component Interfaces (Part 2).
Available online: http://www.enablingmnt.co.uk/wp-content/uploads/2017/06/Design-for-Microfluidic-
Interfacing-White-Paper-part-2-version-3.0.pdf (accessed on 5 Februar 2018).
35. Guckenberger, D.J.; de Groot, T.E.; Wan, A.M.D.; Beebe, D.J.; Young, E.W.K. Micromilling: A method for
ultra-rapid prototyping of plastic microfluidic devices. Lab Chip 2015, 15, 2364–2378.
36. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742.
37. Sun, C.; Fang, N.; Wu, D.; Zhang, X. Projection micro-stereolithography using digital micro-mirror dynamic
mask. Sens. Actuators A Phys. 2005, 121, 113–120.
38. EnvisionTec HTM140 Resin. Available online: https://envisiontec.com/wp-content/uploads/2016/09/
2018-HTM-140-V2-1.pdf (accessed on 25 October 2017).
39. EnvisionTec E-Shell 300 Resin. Available online: https://envisiontec.com/wp-content/uploads/2016/09/
2018-E-Shell-300-Series.pdf (accessed on 26 January 2018).
40. Kip, S.N.; Strehler, E.E. Characterization of PMCA isoforms and their contribution to transcellular Ca2+ flux
in MDCK cells. Am. J. Physiol. Ren. Physiol. 2003, 284, F122–F132.
41. Rehders, M.; Grosshäuser, B.B.; Smarandache, A.; Sadhukhan, A.; Mirastschijski, U.; Kempf, J.; Dünne, M.;
Slenzka, K.; Brix, K. Effects of lunar and mars dust simulants on HaCaT keratinocytes and CHO-K1
fibroblasts. Adv. Space Res. 2011, 47, 1200–1213.
42. Parylene Coating . Available online: https://www.plasmaparylene.de/en/parylene-coating/parylene-
rosenheim.php (accessed on 5 February 2018).
43. ISO 10993-6:2016, Biological Evaluation of Medical Devices—Part 6: Tests for Local Effects after Implantation.
Available online: https://www.iso.org/standard/61089.html (accessed on 5 February 2018).
44. Chang, T.Y.; Yadav, V.G.; De Leo, S.; Mohedas, A.; Rajalingam, B.; Chen, C.L.; Selvarasah, S.; Dokmeci, M.R.;
Khademhosseini, A. Cell and protein compatibility of parylene-C surfaces. Langmuir 2007, 23, 11718–11725.
45. Schmelzer, E.; Over, P.; Gridelli, B.; Gerlach, J.C. Response of primary human bone marrow mesenchymal
stromal cells and dermal keratinocytes to thermal printer materials in vitro. J. Med. Biol. Eng. 2016,
36, 153–167.
46. Stratasys MED610 Resin. Available online: http://www.stratasys.com/de/materials/search/biocompatible
(accessed on 29 January 2018).
47. Akhtar, M.; van den Driesche, S.; Bödecker, A.; Vellekoop, M.J. Long-term storage of droplets on a chip by
Parylene AF4 coating of channels. Sens. Actuators B Chem. 2018, 255, 3576–3584.
48. Van den Driesche, S.; Bunge, F.; Tepner, S.; Kotitschke, M.; Vellekoop, M.J. Travelling-wave dielectrophoresis
allowing flexible microchannel design for suspended cell handling. Proc. SPIE 2017, 10247, 102470H.

14
Micromachines 2018, 9, 71

49. Bunge, F.; van den Driesche, S.; Waite, A.; Mirastschijski, U.; Vellekoop, M.J. μRespirometer to determine
the oxygen consumption rate of mammalian cells in a microfluidic cell culture. In Proceedings of the 2017
IEEE 30th International Conference onMicro Electro Mechanical Systems (MEMS), Las Vegas, NV, USA,
22–26 January 2017; pp. 414–417.
50. TNO–Improved Stereolithography. Available online: https://www.tno.nl/en/focus-areas/industry/
roadmaps/flexible-free-form-products/additive-manufacturing/improved-micro-stereolithography/
(accessed on 5 February 2018).
51. Tumbleston, J.R.; Shirvanyants, D.; Ermoshkin, N.; Janusziewicz, R.; Johnson, A.R.; Kelly, D.; Chen, K.;
Pinschmidt, R.; Rolland, J.P.; Ermoshkin, A.; et al. Continuous liquid interface production of 3D objects.
Science 2015, 347, 1349–1352.
52. Sandström, C.G. The non-disruptive emergence of an ecosystem for 3D Printing—Insights from the hearing
aid industry’s transition 1989–2008. Technol. Forecast. Soc. Chang. 2016, 102, 160–168.
53. Dawood, A.; Marti, B.M.; Sauret-Jackson, V.; Darwood, A. 3D printing in dentistry. Br. Dent. J. 2015,
219, 521–529.
54. Jones, D.; Larson, R. Footwear Assembly Method with 3D Printing. U.S. Patent 9,005,710, 14 April 2015.
55. Weller, C.; Kleer, R.; Piller, F.T. Economic implications of 3D printing: Market structure models in light of
additive manufacturing revisited. Int. J. Prod. Econ. 2015, 164, 43–56.

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

15
micromachines

Article
Microfluidics: A New Layer of Control for
Extrusion-Based 3D Printing
Ludovic Serex *, Arnaud Bertsch and Philippe Renaud
EPFL STI IMT LMIS4, Station 17, CH-1015 Lausanne, Switzerland; arnaud.bertsch@epfl.ch (A.B.);
philippe.renaud@epfl.ch (P.R.)
* Correspondence: ludovic.serex@epfl.ch; Tel.: +41-21-69-36728

Received: 1 February 2018; Accepted: 15 February 2018; Published: 16 February 2018

Abstract: Advances in 3D printing have enabled the use of this technology in a growing number
of fields, and have started to spark the interest of biologists. Having the particularity of being cell
friendly and allowing multimaterial deposition, extrusion-based 3D printing has been shown to be
the method of choice for bioprinting. However as biologically relevant constructs often need to be
of high resolution and high complexity, new methods are needed, to provide an improved level of
control on the deposited biomaterials. In this paper, we demonstrate how microfluidics can be used
to add functions to extrusion 3D printers, which widens their field of application. Micromixers can
be added to print heads to perform the last-second mixing of multiple components just before resin
dispensing, which can be used for the deposition of new polymeric or composite materials, as well as
for bioprinting new materials with tailored properties. The integration of micro-concentrators in the
print heads allows a significant increase in cell concentration in bioprinting. The addition of rapid
microfluidic switching as well as resolution increase through flow focusing are also demonstrated.
Those elementary implementations of microfluidic functions for 3D printing pave the way for more
complex applications enabling new prospects in 3D printing.

Keywords: micro-fluidic; additive manufacturing; 3D printing; bio-printing; lab on a tip

1. Introduction
Three-dimensional (3D) printing, also commonly referred to as additive manufacturing or rapid
prototyping, is a set of techniques that consist in building 3D parts layer by layer. This fabrication
principle dates from the early 1980s [1] and has seen a number of different implementations based
on the use of multiple deposition techniques [2]. While photopolymers and thermoplastic polymers
were initially used in 3D printing techniques, the choice of materials that can be used has been
significantly widened, and includes metals [3,4], ceramics [5] and biomaterials [6–11]. Current research
in this field includes the development of “smart materials” [12,13] that can evolve with time and
bring additional functions to the fabricated objects. If 3D printing was first used for automotive and
aerospace applications [14,15], many other application fields currently use these techniques, including
medical application [16–19], tissue enginering [20–24], biosensors [25], microfabrication [26,27] or even
construction [28] and the food industry [29]. With hobbyists now having access to 3D printing, it is
likely that its field of applications will expand even more.
Among these 3D printing methods, stereolithography (SLA) and extrusion based system dominate
the market. SLA is known for its very high resolution [30], but is subject to limitations directly related
to the process itself, such as the limited biocompatibility of the materials that can be used (often linked
to the use of photoinitiators) and the very challenging implementation of multi-material printing
machines. On the other hand, extrusion-based processes are increasingly popular [31] as they are
relatively cheap and easy to use. However, this printing technique suffers from its limited number

Micromachines 2018, 9, 86; doi:10.3390/mi9020086 16 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 86

of printable materials: only low melting temperature materials such as ABS for fused deposition
modeling or fast crosslinking materials for bio-printing can be used. Additionally, in recent years,
the need for smarter dispensing tools has emerged, in particular in the field of bioprinting to answer
the need to print complex materials for cells [32–34]. As the field increasingly aims toward regenerative
medicine [9,35–37]. A few implementations of such smart dispensing tools have been already presented
in the literature, such as print heads made from needles used for manufacturing perfusable vascular
constructs [38]. To further overcome this limitation, extrusion-based 3D printing can benefit from more
complex microfluidic systems, which can implement a number of fluidic manipulation functions at the
micro-scale. Microfluidics has seen major developments in recent years, and has contributed to the
emergence of the concept of “Lab on a chip” by allowing the implementation of many fluidic functions
such as micro-mixers [39–41], switching valve [42–44], flow focusing [45], particles focusing [46–48],
in-channel detection [49] or particles and cell sorting [49–52] in compact, microfabricated devices.
Up until now, these functionalities have mainly been used on chip to perform various analysis.
In this paper, we propose to exploit the potential of microfluidics to develop a “lab on a tip” that could
perform various operations on the dispensing solution directly in the print head of the 3D printer.
Using this principle, we demonstrate multiple smart printing heads that allow the use of new materials,
enhance the print resolution, or allow the printing of composite parts or multi-material parts that were
only possible using expensive 3D printing techniques.

2. Materials and Methods

2.1. Probe Fabrication


All the print head dispensing tips that are presented in this paper were manufacture in a similar way
using specific microchannel designs depending on the targeted application. A 500 nm SiO2 layer is first
grown by wet oxidation on a single-side polished silicon wafer. Standard photolithography is performed
to pattern the fluidic channels and the silicon oxide is etched to create a hard mask. In the case of the
herringbone mixer presented in Section 3.3, which requires a two-level microchannel to be manufactured,
an additional photoresist mask, silicon etching and resist striping is performed as described in the previous
literature [39]. Then, the channels are etched to 300 μm in depth using deep reactive ion etching, and the
top-layer oxide is etched away as well to expose the silicon for anodic bonding. Next, a borofloat® 33 glass
wafer is mechanically drilled to create the probes inlets. The two wafers are cleaned with a piranha solution
and bonded by anodic bonding. The wafer stack is then diced, revealing the dispensing outlet in a similar
fashion as described in the previous literature [53].

2.2. 3D Printer Setup


The printer setup is similar to the one presented in previous work [53]. A DLT-180, Double Delta 3D
printer has been purchased from He3D and adapted to fit the fabricated probes. The printing path and
speed was either hard-coded in G-code or automatically generated using a slicer as is usually done for
standard 3D printing.

3. Results
In this section we present four different probes that can perform specific tasks. Those probes
demonstrate how microfluidics can be implemented to improve extrusion-based 3D printing in terms
of printed materials, resolution or material switching.

3.1. Multi-Material
One limitation of extrusion-based 3D printers is that each print head can only print a single material.
Printing an object made of multiple materials is usually achieved by using a 3D printing machine with
multiple extrusion heads placed next to each other. By switching between print heads, different materials
can then be printed [54]. In addition to requiring specific equipment, printing multi-material components

17
Micromachines 2018, 9, 86

with extrusion-based 3D printers is generally a very slow process, and a smooth transition between printed
materials is not always guaranteed. A number of microfluidic systems allowing switching between different
liquids have already been presented in the literature, including some that could be implemented in 3D
printers [44]. Here, we will show a very simple system that is easy to implement and allows a fast switching
between materials.
The print head we designed is composed of three micro-channels merging into one right before
the ejection point, as presented in Figure 1A. Each of these three channels can be connected to a syringe
containing a different material and actuated by a syringe pump. By choosing the sequence of actuation
of the syringe pumps and synchronizing it with the geometry of the part being built, a seamless
transition between multiple materials can be achieved during the object manufacturing process.
Furthermore, as microfluidic benefits from very small dead volumes, it is possible to rapidly switch
between materials. In our case, a complete transition between two materials can be performed in
500 ms, as presented in Figure 1B, where the transition between different colored liquids was recorded
using a camera connected to a microscope focused at the tip of the print head we used.
The print head was then mounted on a 3D printer, and colored alginate solutions were printed on
an agarose 4% and CaCl2 1% bed, inducing the alginate gelation by diffusion of the calcium ions into
the alginate deposit. Figure 1C shows the smooth transition between colors obtained as the printing
process goes.
By combining extrusion 3D printing with ultraviolet (UV) light irradiation of the printed layers,
it is possible to print and crosslink photosensitive inks using the same print head based on merging
microchannels. Thus, multimaterial components can be made by the extrusion method by selecting
photosensitive resins having the desired properties, chosen from the large catalogue of materials developed
for the stereolithography process. As an example, we used Formlabs resins RS-F2-GPCL-04 (which
results in a transparent and rigid material once cured), RS-F2-GPWH-04 (which is a white resin) and
RS-F2-GPBK-04 (which is a black resin). By switching between these resins, we were able to print multicolor
parts, as shown in Figure 1D. Formlabs also developed a flexible resin (RS-F2-GPGR-02). By alternating
rigid and flexible areas, we can create parts with varying Young’s moduli. In this example, a two-hinge
part was printed (Figure 1E).

Figure 1. Multi-channel print head. (A) Schematic of the microfluidic channel design. (B,C) Switching
of three colored liquids as recorded at the tip of the print head. (D) Clear, white and black part.
(E) Two-hinges part printed with two different inks (one rigid and one flexible). All scale bars
correspond to 1 cm.

18
Micromachines 2018, 9, 86

Switching between two different materials can be performed in a cleaner and faster way that the
one used in the very simple multi-channel print head presented in Figure 1, for example by using
actuated virtual valves similar to the ones presented by Braschler et al. [42]; however, this method
induces the waste of larger amounts of printing material, which can be a problem.
In the examples we presented, the materials were deposited alternately one after the other,
using microfluidic switching, but multiplexing can also be implemented directly in the print head,
allowing the alternation of materials both laterally and during printing. Microfluidic devices
capable of performing such types of multiplexing have been demonstrated in Lab on Chips,
using polydimethylsiloxane (PDMS) as structural material, as it allows a simple fabrication and
actuation of valves, but its use in print heads for 3D printing may be limited, as the flexibility of PDMS
would limit the extrusion pressure [55].

3.2. Enhanced Resolution


Microfluidic flows present a laminar behavior [45]. This property can be exploited to change
the resolution of the printed material by focusing it while it is dispensed using sheath flows [25].
Hydrodynamic focusing only requires a very rudimentary microfluidic setup, the most common
configuration being a 3-channel device, where the center flow stream is pinched between two side flow
streams, resulting in a shrinking of the width of the center flow. Implementing hydrodynamic focusing
in the print head of an extrusion-based 3D printer, its resolution can be not only be significantly
increased, but it can be adjusted while printing by simply varying the ratio between the core and
lateral flows. Figure 2A demonstrates the principle of sheath flow. Alginate filaments (in blue) are
focused using de-ionized (DI) water with 4% CaCl2 . Depending on the ratio of the alginate core flow
to the CaCl2 solution sheath flow (Figure 2B), the obtained filaments can vary in diameter from 800 μm
to below 200 μm, providing a fivefold resolution increase. Figure 2C shows the evolution of the size of
the deposited filaments as a function of the ratio between sheath and core flows.
One issue of the use of sheath flows for increasing the printing resolution is the fact that the liquid
used in the sheath flow for focusing is also “printed” alongside the actual material of interest. In our
example, using a water-based solution, large quantities of water are ejected from the probe and may
disrupt the printing. On Figure 2D, a printed filament with changing diameter is presented. The first
section of the filament is small and soaked in the sheath flow that will ultimately dry. The filament
then widens and the surplus of liquid produced by the sheath flow becomes almost nonexistent as it is
reduced to a minimum. To solve the problem of residual fluid, Perfluoro(methyldecalin) (PFD) was
used as sheath flow. Given that it is a highly volatile material, it will quickly evaporate, leaving only
the desired focused filament. One limitation of this technique is that when the sheath flow becomes
much larger than the core flow, flow instabilities occur, limiting the use of hydrodynamic focusing
for enhancing the resolution of the dispensed material. In this case, there is always the possibility of
reducing the dimensions of the microfabricated channels provided on the print head for improving
the resolution. However, this implies the use of larger values of pressure to drive the various liquids in
the microchannels. Furthermore, it is important to note that as liquids are being printed, the tuning of
the printed filament through flux control of the core flow only without flow focusing can be achieved.
With a constant printing speed, an increase of the flux will result in a larger printed filament (Figure 2E).
This presents the advantage of not having residual liquid from the sheath flow, but the crosslinking
must be performed from the probe either by UV light or, in this case, by printing alginate on a CaCl2
bed, which is not suitable for high structures.
Adjusting the printer resolution on the fly opens new ways of controlling the printed part.
It would thus be possible to choose the resolution depending on the importance of the part being
printed while printing. This methods allows the printing of coarse filament for the filling of the printed
part, while at the same time, for the wall, the filament can be refined to obtain fast and precise printing.

19
Micromachines 2018, 9, 86

Figure 2. Print head based on flow focusing. (A) Principle of hydrodynamic flow focusing with the
core flow in blue and the sheath flow in white. (B) Flow focusing at different sheath flow/core flow
ratios (R). (C) Printed fiber diameter as a function of the flow ratio. (D) Printed filament going from
small filament (1) to large filament (2) whilst the ratio R is changed. (E) First layer of a printed part
with fine edge (1) and coarse filling (2). Scale bars = 5 mm.

3.3. New Materials


Laminar flows have the particularity that they do not mix easily, as turbulence does not occur
in this flow regime. Mixing relies solely on the diffusion phenomenon, which can be enhanced by
splitting and rearranging the flow using a mixer. Many micro-mixers [41] have been devised for
microfluidic applications; of these static micro-mixers have the advantage of being passive structures
that provide efficient mixing in laminar conditions and that can be integrated directly in the print head
nozzles used for 3D printing.
In a previous work, we demonstrated the use of a meander-based static micro-mixer for
performing the mixing of slow reacting materials used to 3D print carboxymethylcellulose-based
cryogels [53]. A micro-fabricated dispensing print head allowing both the last-second mixing of
cryogel precursors and the temperature control of the extruded material during printing was used.
This allowed the 3D printing of multi-layer cryogels with on-demand local pore size change through
the control in temperature of the dispensed solution. The seeding and culture of cells in specific areas
of the obtained 3D cryogel structure was also demonstrated after its functionalization.
There are, however, static mixers much more efficient than meander-based micro-mixers.
Herrigbone mixers [39] still remain to this day among the most efficient static micro-mixers,
but their manufacturing using microfabrication technologies is slightly more complicated than that
of meander-based mixers, as they are two-level structures and require a larger number of fabrication
steps. By implementing herringbone micro-mixers at the tip of a dispensing print head, even viscous
materials can be mixed in structures of only a few millimeters in length. This principle is demonstrated
in Figure 3A, where colored glycerol streams (in blue and white) are pushed through two three-inlet

20
Micromachines 2018, 9, 86

devices, one being a simple straight microchannel, the other accommodating a herringbone micro-mixer.
Mixing occurs within the first 5 mm of the herringbone structure, whereas there is no apparent mixing
in the straight channel. Because different materials can be efficiently mixed, gradients can be created
by variating their ratio. As an example, black and white Formlabs resins were printed going from fully
black to fully white in a smooth gradient (Figure 3B). Therefore by adding the 3 primary colors to the
mix, any color can be printed in a very simple manner.
Moreover, as mixing is performed, fast-reacting material can be brought in contact, just before
they are deposited by 3D printing. As a demonstration, we performed the mixing of a two-component
polymerizable resin based on polyethylene glycol 400 diacrylate, one component containing 3%
N,N,N’,N’ Tetramethyl-ethylenediamine, the other containing 3% benzoyl peroxide. The benzoyl
peroxide/amine system is known as an initiator for free-radical polymerization of acrylates [56] and
the reaction is fast when all materials are brought in contact. By adequately choosing the amine
component, the crosslinking speed can be adapted. Figure 3C shows a 3D printed filament made by
mixing these components at the last second.

Figure 3. Herrigbone micro-mixer integrated at the tip of the probe. (A) Colored glycerol streams
pushed through a simple T-junction and through a herringbone micro-mixer at 0 mm, 2 mm and
4 mm after the merging point. The mixer allows rapid and efficient mixing of viscous materials.
Scale bar = 300 μm. (B) Mixing of white and black Formlabs resins at different ratios results in smooth
gradients from one material to the other Scale bar = 1 cm. (C) Printed acrylate filament made using
a two-component material. Scale bar = 1 cm.

The use of micro-mixers placed at the output of the print head of extrusion based 3D printers
allows to mix reactive components right before dispensing them. This allows materials that are not
usually used in 3D printing to be printed, such as polymer systems initiated by peroxides, as well as
biomaterials such as hydrogels or cryogels. Additionally, more conventional materials can be mixed
with a chosen ratio between them, allowing blends of materials to be created. This is of interest in the
production of materials with gradients of properties in an object. It can simply be a gradient of colors
if two resins of different color are used, but gradients of mechanical properties can also be fabricated,
for example by mixing resins resulting in flexible and hard polymers or by mixing composite resins,
charged with a filler material.

21
Micromachines 2018, 9, 86

3.4. Concentration
In the previous paragraphs, print heads based on very simple microfluidic components were
presented; however, microfabrication techniques can be used to manufacture much more complex
structures. In this paragraph, we demonstrate a print head allowing the concentration of particles
in solution, which can be used to increase the filler concentration of a composite resin just before
it is printed or to concentrate cells in bioprinting. Figure 4A shows a schematic of the print head.
A solution containing particles or cells enters the device by the inlet and flows in a straight channel
equipped with a crossflow filter towards the outlet. This crossflow filter allows some of the liquid
to be withdrawn between inlet and outlet simply by adequately imposing the flows both at the inlet
and the waste outlet, thus concentrating the particles in solution. The extracted liquid is removed
from the device through the waste outlet, while the concentrated solution is 3D printed. To separate
micrometric-sized particles, the crossflow filter must feature small openings. This is made by a series
of 50 μm tall, 2 μm wide pillars with a 4 μm pitch, as shown in Figure 4B. This structure is fabricated in
a single etching step. Figure 4C–E demonstrates the concentration of a solution containing 8 μm beads.

Figure 4. Crossflow filter for particle concentration. (A) Schematic of the print head. (B) Scanning
electron micrograph of the crossflow filter. (C–E) Concentration of 8μm beads by adjusting the
withdrawing factor. Scale bar = 250 μm.

Concentrating particles in solution before their being dispensed by 3D printing can find
applications in various fields. It is known that the concentration of particles in composite materials is
a major factor in their physical properties [57]. With the device we presented, the physical properties
of the printed composites could be changed during printing. This is of particular interest when high
concentrations of filler material need to be present in the printed material, making it very viscous.
Concentrating the particles in a composite material at the last second when printing makes it possible to
work with diluted (thus of low viscosity) solutions for the whole process and still produce composites
of the desired composition, removing the excess liquid just before dispensation.

22
Micromachines 2018, 9, 86

Concentrating cells in solution is of even bigger interest in the field of bio-printing, as intercellular
communications rely heavily on intercellular distance [58], and thus on the cell concentration. However,
working with high concentrations of cells in bioprinting is often inappropriate, as a large quantity of
cells would be lost in pipes and other dead volumes, and the cells would be subjected to large shear
forces because of the high viscosity of the solution. In general bioprinting techniques use solutions
containing roughly 1 million cells per milliliter of solution, which results in cell-laden gels containing
a cell concentration orders of magnitude lower than in native tissue [56].
By concentrating the cell right at the tip of the printer, it is possible to print tissue with biologically
relevant cell concentration, without wasting large numbers of cells in dead volumes or subjecting them
to high shear stress.

4. Discussion
Stereolithography and extrusion-based 3D printing are the most commonly used additive
manufacturing techniques. Extrusion-based techniques are easy to use and are cost effective, but have
seen almost no improvement in terms of process development since their creation. On the contrary,
microfluidic techniques have seen major developments in terms of device design and fabrication,
and these developments can now be applied to significantly improve the print heads of extrusion-based
3D printers.
In this paper, we explored the integration of four relatively simple microfluidic systems at the
tip of the print head of extrusion-based 3D printers to create smart dispensing tools that can perform
different functions right before printing. The integration of additional functions to print heads is of
particular importance for bioprinting applications. We demonstrated fast switching between two or
more materials to create multimaterial parts, but when applied to bioprinting, it can be used to switch
between the different cell types needed in a cell co-culture. Enhancing the printing resolution using
sheath flows can also be used for centering cells inside hydrogel filaments. Micro-mixers can be used
to prepare hydrogels or cryogels from their components, to insert cells into the printing medium or to
create gradients of composition or of cell types while printing. Concentration using crossflow filters
makes it possible to reach cell concentrations close to native tissue without adverse effects during
their manipulation.
Thanks to microfabrication, more complex functions can also be integrated in the print heads,
taking advantage of all the knowledge available in the field of Lab on Chip devices, but such
developments would probably have precise needs in terms of specific applications. For example,
combining fluidic functions with in-channel spectroscopy could provide continuous feedback on the
printed material quality, implementing dielectrophoresis electrodes could be used for filtering particles
and cells and could make it possible to print only the viable cells, and detecting the passage of cells of
interest while they flow through the microchannels and filtering out the excess of liquid medium could
make it possible to print each cell at a precisely chosen location. Many other microfluidic functions
can be integrated, such as fast switching valves, digital microfluidic, microfluidic gradient generators,
cell concentrator or micro-heaters, each bringing the potential of using new materials and developing
new applications for extrusion-based 3D printing.
The integration of customized microfluidic functions into the print heads of 3D printers has the
potential to be a game changer in fields where additive manufacturing is used, and in particular for
bioprinting. Compared to more conventional 3D printing, there is an additional level of complexity
involved when making biological constructs out of different types of cells and scaffold materials,
and the use of cells in bioprinting applications requires more care than the usual materials used in
additive manufacturing techniques. Bioprinting is often described as the key development to go
towards artificial organs and engineered biological tissues, but to obtain the level of complexity needed
to form such complex cell constructs, major improvements in 3D printing techniques are needed,
and one of the keys to achieving this is clearly the integration of microfluidic functions into print heads.

23
Micromachines 2018, 9, 86

5. Conclusions
New opportunities generally arise when merging different technologies, and the present paper
attempts to show the value of bringing microfluidics closer to extrusion-based 3D printing techniques.
By applying some concepts developed over the years for Lab on Chip applications to create smart print
heads, we tried to open the way and demonstrate improved dispensing functionalities. Four different
microfluidic functions were implemented at the tip of print heads: Micro-mixers were used to mix
reactive components before dispensing and to blend materials with varying ratios. Sheath flows
were implemented to improve the print resolution. Fast switching was demonstrated to create
multimaterial components and crossflow filtration was shown to concentrate particles or cells in
the deposited material. By using microfluidic functions in the world of 3D printing, an additional layer
of control can be added, enabling the fabrication of components that were impossible to print before.
This methodology can be scaled, and has the potential to revolutionize the way we print, in particular
in the field of bioprinting, where new challenges need to be faced in going towards the fabrication of
engineered 3D biological tissues.

Acknowledgments: The authors of the paper would like to acknowledge the staff of the EPFL center of
micronanotechnology for their support in the cleanrooms as well as Matthieu Rüegg for his help.
Author Contributions: Ludovic Serex conceived, designed and performed the experiments. Arnaud Bertsch
designed the chemistry of the printed media. Ludovic Serex and Arnaud Bertsch wrote the paper. Research
discussions were executed by all authors.
Conflicts of Interest: The authors confirm that there are no known conflict of interest associated with this
publication and there has been no significant financial support for this work that could have influenced its outcome.

References
1. Kodama, H. Automatic method for fabricating a threedimensional plastic model with photo hardening
polymer. Rev. Sci. Instrum. 1981, 52, 1770–1773. [CrossRef]
2. Gibson, I.; Rosen, D.; Stucker, B. Additive Manufacturing Technologies. In Additive Manufacturing Technologies,
2nd ed.; 3D Printing, Rapid Prototyping, and Direct Digital Manufacturing; Springer: Berlin, Germay, 2015.
[CrossRef]
3. Todd, I. Metallurgy: Printing steels. Nat. Mater. 2017, 17, 13–14. [CrossRef] [PubMed]
4. Sames, W.J.; List, F.A.; Pannala, S.; Dehoff, R.R.; Babu, S.S. The metallurgy and processing science of metal
additive manufacturing. Int. Mater. Rev. 2016, 61, 315–360. [CrossRef]
5. Eckel, Z.C.; Zhou, C.; Martin, J.H.; Jacobsen, A.J.; Carter, W.B.; Schaedler, T.A. Additive manufacturing of
polymer-derived ceramics. Science 2016, 351, 58–62. [CrossRef] [PubMed]
6. Hockaday, L.A.; Kang, K.H.; Colangelo, N.W.; Cheung, P.Y.C.; Duan, B.; Malone, E.; Wu, J.; Girardi, L.N.;
Bonassar, L.J.; Lipson, H.; et al. Rapid 3D printing of anatomically accurate and mechanically heterogeneous
aortic valve hydrogel scaffolds. Biofabrication 2012, 4, 035005. [CrossRef] [PubMed]
7. Jang, J.; Park, J.Y.; Gao, G.; Cho, D.W. Biomaterials-based 3D cell printing for next-generation therapeutics
and diagnostics. Biomaterials 2018, 156, 88–106. [CrossRef] [PubMed]
8. Murphy, S.V.; Atala, A. 3D bioprinting of tissues and organs. Nat. Biotechnol. 2014, 32, 773–785. [CrossRef]
[PubMed]
9. Hospodiuk, M.; Dey, M.; Sosnoski, D.; Ozbolat, I.T. The bioink: A comprehensive review on bioprintable
materials. Biotechnol. Adv. 2017, 35, 217–239. [CrossRef] [PubMed]
10. Kolesky, D.B.; Homan, K.A.; Skylar-Scott, M.A.; Lewis, J.A. Three-dimensional bioprinting of thick
vascularized tissues. Proc. Natl. Acad. Sci. USA 2016, 113, 3179–3184. [CrossRef] [PubMed]
11. Pataky, K.; Braschler, T.; Negro, A.; Renaud, P.; Lutolf, M.P.; Brugger, J. Microdrop Printing of Hydrogel
Bioinks into 3D Tissue-Like Geometries. Adv. Mater. 2012, 24, 391–396. [CrossRef] [PubMed]
12. Sydney Gladman, A.; Matsumoto, E.A.; Nuzzo, R.G.; Mahadevan, L.; Lewis, J.A. Biomimetic 4D printing.
Nat. Mater. 2016, 15, 413–418. [CrossRef] [PubMed]
13. Khoo, Z.X.; Teoh, J.E.M.; Liu, Y.; Chua, C.K.; Yang, S.; An, J.; Leong, K.F.; Yeong, W.Y. 3D printing of smart
materials: A review on recent progresses in 4D printing. Virtual Phys. Prototyp. 2015, 10, 103–122. [CrossRef]

24
Micromachines 2018, 9, 86

14. Guo, N.; Leu, M.C. Additive manufacturing: Technology, applications and research needs. Front. Mech. Eng.
2013, 8, 215–243. [CrossRef]
15. Chu, M.Q.; Wang, L.; Ding, H.Y.; Sun, Z.G. Additive Manufacturing for Aerospace Application.
Appl. Mech. Mater. 2015, 798, 457–461. [CrossRef]
16. Prasad, L.K.; Smyth, H. 3D Printing technologies for drug delivery: A review. Drug Dev. Ind. Pharm. 2016,
42, 1019–1031. [CrossRef] [PubMed]
17. Bose, S.; Ke, D.; Sahasrabudhe, H.; Bandyopadhyay, A. Additive Manufacturing of Biomaterials.
Prog. Mater. Sci. 2017, 93, 45–111. [CrossRef]
18. Davia-Aracil, M.; Hinojo-Pérez, J.J.; Jimeno-Morenilla, A.; Mora-Mora, H. 3D printing of functional
anatomical insoles. Comput. Ind. 2018, 95, 38–53. [CrossRef]
19. Rengier, F.; Mehndiratta, A.; Von Tengg-Kobligk, H.; Zechmann, C.M.; Unterhinninghofen, R.; Kauczor, H.U.;
Giesel, F.L. 3D printing based on imaging data: Review of medical applications. Int. J. Comput. Assist.
Radiol. Surg. 2010, 5, 335–341. [CrossRef] [PubMed]
20. Zhang, Y.S.; Yue, K.; Aleman, J.; Mollazadeh-Moghaddam, K.; Bakht, S.M.; Yang, J.; Jia, W.; Dell’Erba, V.;
Assawes, P.; Shin, S.R.; et al. 3D Bioprinting for Tissue and Organ Fabrication. Ann. Biomed. Eng. 2017,
45, 148–163. [CrossRef] [PubMed]
21. Wu, Z.; Su, X.; Xu, Y.; Kong, B.; Sun, W.; Mi, S. Bioprinting three-dimensional cell-laden tissue constructs
with controllable degradation. Sci. Rep. 2016, 6, 24474. [CrossRef] [PubMed]
22. Dvir-Ginzberg, M.; Gamlieli-Bonshtein, I.; Agbaria, R.; Cohen, S. Liver tissue engineering within alginate
scaffolds: Effects of cell-seeding density on hepatocyte viability, morphology, and function. Tissue Eng. 2003,
9, 757–766. [CrossRef] [PubMed]
23. Zadpoor, A.A.; Malda, J. Additive Manufacturing of Biomaterials, Tissues, and Organs. Ann. Biomed. Eng.
2017, 45, 1–11. [CrossRef] [PubMed]
24. Roth, E.A.; Xu, T.; Das, M.; Gregory, C.; Hickman, J.J.; Boland, T. Inkjet printing for high-throughput cell
patterning. Biomaterials 2004, 25, 3707–3715. [CrossRef] [PubMed]
25. Lind, J.U.; Busbee, T.A.; Valentine, A.D.; Pasqualini, F.S.; Yuan, H.; Yadid, M.; Park, S.J.; Kotikian, A.;
Nesmith, A.P.; Campbell, P.H.; et al. Instrumented cardiac microphysiological devices via multimaterial
three-dimensional printing. Nat. Mater. 2017, 16, 303–308. [CrossRef] [PubMed]
26. Vaezi, M.; Seitz, H.; Yang, S. A review on 3D micro-additive manufacturing technologies. Int. J. Adv.
Manuf. Technol. 2013, 67, 1721–1754. [CrossRef]
27. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-Printed Microfluidics. Angew. Chem. Int. Ed. 2016,
55, 3862–3881. [CrossRef] [PubMed]
28. Salet, T.A.M.; Bos, F.P.; Wolfs, R.J.M.; Ahmed, Z.Y. 3D concrete printing—A structural engineering perspective.
In Proceedings of the 2017 fib Symposium—High Tech Concrete: Where Technology and Engineering Meet,
Maastricht, The Netherlands, 12–14 June 2017.
29. Kouzani, A.Z.; Adams, S.; Oliver, R.; Nguwi, Y.Y.; Hemsley, B.; Balandin, S. 3D printing of a pavlova.
In Proceedings of the Region 10 Conference (TENCON), Singapore, 22–25 November 2016; pp. 2281–2285.
[CrossRef]
30. Bertsch, A.; Bernhard, P.; Vogt, C.; Renaud, P. Rapid prototyping of small size objects. Rapid Prototyp. J. 2000,
6, 259–266. [CrossRef]
31. Turner, B.N.; Strong, R.; Gold, S.A. A review of melt extrusion additive manufacturing processes: I. Process
design and modeling. Rapid Prototyp. J. 2014, 20, 192–204. [CrossRef]
32. Liu, W.; Zhang, Y.S.; Heinrich, M.A.; De Ferrari, F.; Jang, H.L.; Bakht, S.M.; Alvarez, M.M.; Yang, J.; Li, Y.C.;
Trujillo-de Santiago, G.; et al. Rapid Continuous Multimaterial Extrusion Bioprinting. Adv. Mater. 2017,
29, 1–8. [CrossRef] [PubMed]
33. Hardin, J.O.; Ober, T.J.; Valentine, A.D.; Lewis, J.A. Microfluidic printheads for multimaterial 3D printing of
viscoelastic inks. Adv. Mater. 2015, 27, 3279–3284. [CrossRef] [PubMed]
34. Nie, M.; Mistry, P.; Yang, J.; Takeuchi, S. Microfluidic enabled rapid bioprinting of hydrogel μfiber based
porous constructs. In Proceedings of the 2017 IEEE 30th International Conference on Micro Electro
Mechanical Systems (MEMS), Las Vegas, NV, USA, 22–26 January 2017; pp. 589–591. [CrossRef]
35. Tan, X.P.; Tan, Y.J.; Chow, C.S.L.; Tor, S.B.; Yeong, W.Y. Metallic powder-bed based 3D printing of
cellular scaffolds for orthopaedic implants: A state-of-the-art review on manufacturing, topological design,
mechanical properties and biocompatibility. Mater. Sci. Eng. C 2017, 76, 1328–1343. [CrossRef] [PubMed]

25
Micromachines 2018, 9, 86

36. Yu, Y.; Moncal, K.K.; Li, J.; Peng, W.; Rivero, I.; Martin, J.A.; Ozbolat, I.T. Three-dimensional bioprinting using
self-Assembling scalable scaffold-free ‘tissue strands’ as a new bioink. Sci. Rep. 2016, 6, 1–11. [CrossRef]
[PubMed]
37. Duan, B. State-of-the-Art Review of 3D Bioprinting for Cardiovascular Tissue Engineering. Ann. Biomed. Eng.
2017, 45, 195–209. [CrossRef] [PubMed]
38. Jia, W.; Gungor-Ozkerim, P.S.; Zhang, Y.S.; Yue, K.; Zhu, K.; Liu, W.; Pi, Q.; Byambaa, B.; Dokmeci, M.R.;
Shin, S.R.; et al. Direct 3D bioprinting of perfusable vascular constructs using a blend bioink. Biomaterials
2016, 106, 58–68. [CrossRef] [PubMed]
39. Stroock, A.D.; Dertinger, S.K.; Ajdari, A.; Mezić, I.; Stone, H.A.; Whitesides, G.M. Chaotic mixer for
microchannels. Science 2002, 295, 647–651. [CrossRef] [PubMed]
40. Liu, Y.Z.; Kim, B.J.; Sung, H.J. Two-fluid mixing in a microchannel. Int. J. Heat Fluid Flow 2004, 25, 986–995.
[CrossRef]
41. Lee, C.Y.; Chang, C.L.; Wang, Y.N.; Fu, L.M. Microfluidic Mixing: A Review. Int. J. Mol. Sci. 2011,
12, 3263–3287. [CrossRef] [PubMed]
42. Braschler, T.; Theytaz, J.; Zvitov-Marabi, R.; Van Lintel, H.; Loche, G.; Kunze, A.; Demierre, N.; Tornay, R.;
Schlund, M.; Renaud, P. A virtual valve for smooth contamination-free flow switching. Lab Chip 2007,
7, 1111–1113. [CrossRef] [PubMed]
43. Liepsch, D.; Versorgungstechnik, F.; Germany, W.; Karlsruhe, U.; Vlachos, N.S. Measurement and calculations
of laminar in A ninety degree bifurcation. J. Biomech. 1982, 15, 473–485. [CrossRef]
44. Devaraju, N.S.G.K.; Unger, M.A. Pressure driven digital logic in PDMS based microfluidic devices fabricated
by multilayer soft lithography. Lab Chip 2012, 12, 4809–4815. [CrossRef] [PubMed]
45. Knight, J.B.; Vishwanath, A.; Brody, J.P.; Austin, R.H. Hydrodynamic focusing on a silicon chip: Mixing
nanoliters in microseconds. Phys. Rev. Lett. 1998, 80, 3863–3866. [CrossRef]
46. Martel, J.M.; Toner, M. Inertial focusing in microfluidics. Annu. Rev. Biomed. Eng. 2014, 16, 371–396.
[CrossRef] [PubMed]
47. Xuan, X.; Zhu, J.; Church, C. Particle focusing in microfluidic devices. Microfluid. Nanofluid. 2010, 9, 1–16.
[CrossRef]
48. Aoki, R.; Yamada, M.; Yasuda, M.; Seki, M. In-channel focusing of flowing microparticles utilizing
hydrodynamic filtration_Supplementary material. Microfluid. Nanofluid. 2009, 6, 571–576. [CrossRef]
49. Gascoyne, P.R.C.; Vykoukal, J. Review Particle separation by dielectrophoresis. Electrophoresis 2002,
23, 1973–1983. [CrossRef]
50. Huang, L.R.; Cox, E.C.; Austin, R.H.; Sturm, J.C. Lateral Displacement. 2004; 304, 987–991.
51. Valero, A.; Braschler, T.; Demierre, N.; Renaud, P. A miniaturized continuous dielectrophoretic cell sorter
and its applications. Biomicrofluidics 2010, 4, 022807. [CrossRef] [PubMed]
52. Yamada, M.; Seki, M. Hydrodynamic filtration for on-chip particle concentration and classification utilizing
microfluidics. Lab Chip 2005, 5, 1233–1239. [CrossRef] [PubMed]
53. Serex, L.; Braschler, T.; Filippova, A.; Rochat, A.; Béduer, A.; Bertsch, A.; Renaud, P. Pore Size Manipulation
in 3D Printed Cryogels Enables Selective Cell Seeding. Adv. Mater. Technol. 2018, 1700340. [CrossRef]
54. Colosi, C.; Costantini, M.; Barbetta, A.; Dentini, M. Microfluidic bioprinting of heterogeneous 3d tissue
constructs. Methods Mol. Biol. 2017, 1612, 369–380. [PubMed]
55. Constantinescu, V.N. Laminar Viscous Flow; Springer: New York, NY, USA, 1995. [CrossRef]
56. Sideridou, I.D.; Achilias, D.S.; Karava, O. Reactivity of benzoyl peroxide/amine system as an initiator for
the free radical polymerization of dental and orthopaedic dimethacrylate monomers: Effect of the amine
and monomer chemical structure. Macromolecules 2006, 39, 2072–2080. [CrossRef]
57. Alsson, B.E.O.P. Effective intercellular communication distances are determined by the relative time constants
for cyto/chemokine secretion and diffusion. Engineering 1997, 94, 12258–12262.
58. Bianconi, E.; Piovesan, A.; Facchin, F.; Beraudi, A.; Casadei, R.; Frabetti, F.; Vitale, L.; Pelleri, M.C.; Tassani, S.;
Piva, F.; et al. An estimation of the number of cells in the human body. Ann. Hum. Biol. 2013, 4460, 463–471.
[CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

26
micromachines

Review
3D-Printed Chips: Compatibility of Additive
Manufacturing Photopolymeric Substrata with
Biological Applications
Megan Carve 1,† and Donald Wlodkowic 1,2, *,†
1 School of Science, RMIT University, Melbourne, VIC 3083, Australia; [email protected]
2 Centre for Additive Manufacturing, School of Engineering, RMIT University,
Melbourne, VIC 3083, Australia
* Correspondence: [email protected]; Tel.: +61-3-9925-7157
† These authors contributed equally to this work.

Received: 27 January 2018; Accepted: 19 February 2018; Published: 23 February 2018

Abstract: Additive manufacturing (AM) is ideal for building adaptable, structurally complex,
three-dimensional, monolithic lab-on-chip (LOC) devices from only a computer design file.
Consequently, it has potential to advance micro- to milllifluidic LOC design, prototyping,
and production and further its application in areas of biomedical and biological research. However,
its application in these areas has been hampered due to material biocompatibility concerns. In this
review, we summarise commonly used AM techniques: vat polymerisation and material jetting.
We discuss factors influencing material biocompatibility as well as methods to mitigate material
toxicity and thus promote its application in these research fields.

Keywords: lab-on-a-chip; bioassay; toxicity; additive manufacturing; polymers; 3D printing

1. Introduction
Additive manufacturing (AM), colloquially known as three-dimensional (3D) printing, is an
automated computer-assisted design (CAD) and fabrication method developed in the 1980’s [1].
Via AM, structurally complex monolithic devices can be built from a range of materials, such as
liquid-polymer or powder grains, with various material, mechanical, and physical properties. AM
is a versatile and agile technology platform suited to the rapid development of prototypes and
the fabrication of adaptable high-value products. Expansion of innovative desktop AM systems,
exhibiting fast build-speeds and improved printing resolutions, coupled with decreasing prices of
AM technologies, is enabling their rapid adoption in small-scale industries and laboratories. By 2020,
the global AM industry revenue is predicted to exceed $21 billion [2]. It’s growing popularity is due to
the advantages it has over traditional ’subtractive’ or ’formative’ manufacturing techniques, which
rely on economies of scale and are comparatively wasteful [3].
Demand for inexpensive prototyping and fabrication of lab-on-a-chip (LOC) devices has
stimulated substantial interest in alternative fabrication methods. In this regard, AM has attracted
interest within the LOC community, which aims to reduce the cost and complexity of prototyping
and developing bespoken devices [4]. AM circumvents cumbersome processes inherent to traditional
manufacturing methods (e.g., photolithography), such as complex multi-step fabrication techniques
and the use of expensive clean room facilities. Specifically, the vat polymerisation AM methods,
stereolithography (SLA), multi-photon polymerisation, and digital light processing (DLP), provide
elegant fabrication alternatives.
Vat polymerization AM can produce optically transparent structurally complex monolithic devices
with functional elements such as integrated fluidic interconnects, valves, pumps, and lenses [5]. In this

Micromachines 2018, 9, 91; doi:10.3390/mi9020091 27 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 91

method, a solid object is built in a layer-by-layer fashion by the selective exposure of a photosensitive
polymer resin to a focused laser beam or light projection (Figure 1) [6]. Presently, most consumer-grade
3D printers build objects by a process known as fused deposition modelling (FDM). This involves
melting and depositing a filament of plastic material such as acrylonitrile butadiene styrene (ABS)
and poly(lactic acid) acid (PLA) in a layer-by-layer fashion. Decreasing costs of vat polymerisation
machines means they are no longer only affordable to large-scale industries but are accessible to the
individual consumer.

Figure 1. Examples of additive manufacturing (AM) systems that use polymer materials: (a) Material
jetting, where a photo-sensitive photopolymer is deposited in droplets that are then polymerized by
a passing light source. The process is repeated so that the solid object is built up layer by layer on the
build tray. (b) Vat polymerization, where a photosensitive polymer contained in a vat is polymerized
in a layer-by-layer fashion either by a light-beam (stereolithography and multi-photon polymerization)
or by light-projection (digital light processing ). (c) Material extrusion, where the polymer filament is
softened as it passes through a heating block and extruded in a layer-by-layer fashion.

A critical limitation of AM systems for LOC applications, however, is the printing resolution.
In general, AM systems are capable of producing a minimum printable feature size 70–300 μm and
a z-axis layer height of >20 μm [1,7]. While current generation AM systems appear less suited to the
fabrication of true microfluidic systems, they are suited to the fabrication of milllifluidic or mesofluidic
devices, the latter is characterised by a channel’s cross-dimensions ranging from 250 μm to 2000 μm and
high aspect ratios. Design and structural constraints make them particularly difficult to fabricate using
conventional photolithography techniques, thus demanding non-standard fabrication approaches
ideally suited to AM [8–10]. Emerging applications in biomedical research and ecological toxicity
testing include in-situ analysis of embryos and small metazoan organisms [11–15].
Despite the perceived advantages, reports on the toxicity of AM photosensitive polymeric
materials have curtailed their application in AM-LOC technologies aimed at in vitro bioassays and
biotests [13,16–19]. Resin compounds such as photoinitiators (PIs), monomers, short-chain polymers,
and auxiliary compounds may leach from final printed parts in aqueous media and consequently
may compromise part biocompatibility. Furthermore, attempting to eliminate these potentially toxic
compounds by following standard manufacturer-recommended part-cleaning procedures might not
adequately mitigate toxicity. This review focuses on the perceived toxicity of AM photosensitive
polymeric materials as well as current approaches to alleviate toxicity, with the aim of facilitating
applications in biomedical and biological research.

2. Overview of Additive Manufacturing (AM) Fabrication Technologies


AM technologies are classified according to the initial condition of the build material and the
physical principles underlying the solidification process (Figure 1) [1]. In 2017, photo-polymerisation
AM, which encompasses material jetting (MJ) and vat polymerisation (SLA and DLP), accounted for
the majority of materials used in the global AM market [20].

28
Micromachines 2018, 9, 91

The vat polymerization process produces a solidified 3D object by localised irradiation and
polymerisation of a light sensitive resin (contained in a vat) by a spatially controlled light source [1].
The light source used in SLA is a spot laser that irradiates the resin as it scans in an x–y direction of
each plane, whereas the light source used in DLP is a projector and the whole x–y plane is irradiated in
a single flash. For both, the final object is built in a layer-by-layer fashion as the build platform moves
through the resin along the z-axis, whereas multi-photon, also known as two-photon, polymerisation
(MPP), produces a solid object by focusing a femtosecond laser beam into the resin vat. The laser
moves in any direction within the resin, so it is not a layer-by-layer technique [21,22].
In contrast, MJ is a process similar to inkjet printing and involves jetting droplets of photosensitive
polymer resin onto the build platform (Figure 1). Resin is solidified by a passing light source,
and the process is repeated in a layer-by-layer fashion, as the object is built from the bottom up.
Vat polymerization technology, more than MJ, can accelerate micro/milllifluidic device development
since it is capable of achieving finer resolutions. It has been used to build LOC and micro-devices from
optically transparent materials [5,23–25].
SLA and DLP has been used in LOC design and manufacture. The authors of Au et al. [26]
built a peristaltic pump and cell perfusion chamber with integrated fluidic valves, and the authors
of Comina et al. [27] built a monolithic LOC with integrated check-valves. In addition, LOC devices
have been fabricated via replica moulding in poly(dimethylsiloxane) PDMS from moulds [28,29].
SLA and DLP are applied in dental implant design and production, surgical planning, the building of
anatomical prosthetic devices, and tissue engineering [5,30,31].
MPP is suited to the design of microfluidic devices, as it can build structures down to 200 nm from
materials classified as biocompatible [32]. It has been used to build micro-needle arrays for vaccine and
drug delivery [33] and develop complex suspended micro-channel resonators for LOC biomechanical
sensing applications [34] as well as integrative optofluidic refractometers with microtubes of various
diameters and wall thicknesses [35].

3. Photopolymerization and Stereolithographic Resins


Polymerization, by chemical reactions, connects unsaturated monomer molecules to propagate
a polymer-chain network [36,37]. To create a 3D solid object, a photo-sensitive stereolithographic
polymer resin is solidified by the successive vitrification of the photopolymer by a light-initiated
chemical reaction that leads to the cross-linking of polymers by produced reactive species
(free radicals, cations or anions) [38]. The photo-polymerisation process is consistent with ‘chain-growth’
polymerization in that it requires initiation, propagation, chain transfer, and termination [36,37,39].
Resin components include a photo-sensitive polymer and a photoinitiator system along with
other additives and fillers, such as inhibitors, plasticizers, light stabilizers, and pigments (e.g., shown
in Tables 1–3). Auxiliary compounds may improve polymerisation (in the industry termed ‘curing’)
efficiency and enhance mechanical, physical, and aesthetic properties of the final printed part.
Ultimately, final material properties depend on the post-cleaning and post-curing process.
In radical polymerization, photolytic energy is absorbed by the PI and the produced reactive
species is a free radical, a molecular fragment having one unpaired electrons (Figure 2) [36].
The propagating site of reactivity is a carbon radical [40]. Free radicals are transferred from monomer
to monomer during chain growth. Radical polymerization terminates when two radicals, either the
forming polymer chains or PI fragments, combine.
In cationic polymerization, photolytic energy is absorbed by the PI to release free radicals and
a Lewis or a Brönsted acid [40,41]. The propagating site of reactivity is a carbocation. Charge is
transferred from monomer to monomer during chain growth. Termination occurs via unimolecular
rearrangement within the counterion, i.e., where an anionic fragment of the counterion combines with
the propagating chain end, inactivating the growing chain, and reducing the concentration of the
initiator complex [42].

29
Micromachines 2018, 9, 91

Two polymerisation steps are required to produce the final object built using vat polymerisation
AM [31]. The first-step occurs in the vat of the machine and is by the light emitted by the machine.
This step produces a partially cured object, referred to as ‘green’. While the object at this stage has its
final shape and form, a second curing step is need to optimise its mechanical properties. Typically,
the ‘green’ object is first rinsed in a solvent to remove polymerised resin. The second curing step occurs
in a purpose-built ‘post-curing’ oven that emits a (stroboscopic) light at a wavelength that should be
matched to the resin type. The object typically must be systematically re-orientated during this step,
so that exposure of each surface of the geometry to the light source is maximised.

Figure 2. The two photoinitiator (PI) mechanisms are radical (a,b) and cationic (c,d). In the
radical system, absorption of light (hv) produces a free radical by homolytic cleavage, propagating
polymerization, for example, as in (a) hydroxyacetophenone and (b) phosphine-oxide, where R
represents a methyl group in (a) and a phenyl ring in (b). In the cationic PI system, in PIs
such as (c) triarylsulfonium hexafluoroantimonate salts and (d) bis(4-tert-butylphenyl)iodonium
perfluoro-1-butanesulfonate, light is absorbed causing heterolytic and homolytic cleavage that forms
a cationic portion (labeled in green) and anionic portion (labeled in pink). The generated molecules are
reactive with monomers, forming an acid and free radicals, propagating polymerization (open source
image adapted from [36]).

3.1. Photoinitiator Systems


A PI compound (examples are shown in Table 1) acts as catalyst for photopolymerisation by
converting absorbed light energy into chemical energy, free radicals, and/or cations [43]. To enhance
the efficiency and depth of polymerization, stereolithographic resins will typically contain multiple
‘PIs’ and a thermal initiator compound. A thermal initiator, such as benzoyl peroxide or Lauroyl
peroxide, ideally does not affect the resin during printing, but operates during ‘post-curing’ to aid in
interior part polymerization. Radical PI systems are classified by their mode of operation as either
a Norrish Type I or Norrish Type II. The Norrish Type I PI molecule undergoes homolytic cleavage to
produce free radicals upon the absorption of light [38], whereas the Norrish Type II PI is a bimolecular
system, where absorption of light, typically ultra-violet (UV)-C, causes a light absorbing molecule
(or sensitizer) to interact with a second molecule (a co-initiator) to generate free radicals [44].
A cationic PI system consists of a cationic and anionic pair, and each component has an explicit
role in the polymerization mechanism [37]. The cationic portion of the PI molecule absorbs light to
produce an excited electron state, whereas the anionic portion of the PI molecule absorbs light to
produce an acid [41]. The excited electron state causes the PI molecule to undergo homolytic cleavage
to yield several free radicals and heterolytic cleavage to produce another cationic species and an acid.
Typically, cationic PIs are either sulfonium or iodonium salts (e.g., 4-octyloxy-phenyl-phenyl iodonium
hexafluoroantimonate). Cationic photopolymerization is used for monomers, such as epoxides and
vinyl ethers, which cannot be polymerized by free radical mechanisms [45].
For photopolymerization to proceed efficiently, the absorption wavelength of the PI must overlap
with the emission spectrum of the light source and there must be minimal competing absorption
by the other resin components [46]. Optimal absorption of each PI occurs at a specific wavelength

30
Micromachines 2018, 9, 91

range, for example, phosphine-oxide compounds will typically have an absorption maximum between
360 nm and 400 nm, and camphorquinone has an absorption maximum at a wavelength of 468 nm [30].
Catatonic PIs absorb in the wavelength range between 220 nm and 280 nm, with the different molecular
configurations around the sulphur or iodine atom determining the specific absorption maximum for
each PI [39].

Table 1. Summary of toxicity data available for photoinitiators used in stereolithography resins.

Compound w/w Available Toxicological Information


Fertility impairing effect [47], acute and chronic toxic for aquatic
organisms [48], toxic effect on mouse NIH 3T3 cells [38]. Not readily
Phosphine oxide FORMlabs e.g., biodegradable by OECD criteria [48,49].
compounds 1 0.1–5% Dental and LD50 Oral rat > 5000 mg/kg (OECD) [48]
(Type II) E-Shell series LC50 (48 h) Oryzias latipes—6.53 mg/L (JIS K 0102-71) [49,50]
EC50 (48 h) Daphnia magna—3.53 mg/L (OECD 202) [48,50]
EC50 (72 h) Pseudokirchneriella subcapitata—1.56 mg/L (OECD 201) [49]
Readily biodegradable (OECD 301B) [51]
Hydroxy-
LD50 Oral Rat—2.240 mg/kg [51]
acetophenone
LC50 (96 h) Salmo gairdneri—25 mg/L [51]
(Type II)
EC50 (48 h) Daphnia magna—50 mg/L [51]
Causes liver hypertrophy and kidney adenoma in rats [52]
EC50 (24 h) Daphnia magna—0.28 mg/L [53]
Benzophenone
LC50 (96 h) Pimephales promelas—14.2 mg/L [53]
compounds 2 <10% UV-cured inks
BP-3 and BP-4:
(Type II)
LC50 (48 h) Daphnia magna—1.09 and 47.47 mg/L
LC50 (96 h) Brachydanio rerio—3.89 and 633.00 mg/L
Camphorquinone Dental resins EC50 mouse fibroblasts—235 μM [30]
1-hydroxy cyclo LC50 (96 h) Danio rerio—24 mg/L [54]
FORMlabs
hexyl phenyl EC50 (48 h) Daphnia magna—59.3 mg/L (OECD 202) [54]
Irgacure 184
ketone EC50 (72 h) Desmodesmus subspicatus—14.4 mg/L (OECD 201) [54]
Triarylsulfonium EC50 (24 h) Daphnia magna—4.4 mg/L [55]
1–10% 3D Systems
salt (Cationic)3 EC50 (48 h) Daphnia magna—0.68 mg/L [55]
1 Including diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide (TPO) and bis acyl phosphine oxide (BAPO).
2 Including benzophenone-3 (BP-3), benzophenone-4 (BP-4) [56]. 3 50% propylene carbonate and 50% mixed
triarylsulfonium salts, i.e., an antimonate mixture.

3.2. Photopolymer Matrix/Systems


Photopolymers are mono-, di- and trifunctional monomers, acting as cross linkers, and
hyper-branched oligomers that are multifunctional, acting as both cross linkers and diluents [57].
Classical photopolymer systems contain a single type of photopolymer (e.g., acrylic, epoxide,
vinyl-ether, or a thiol-ene), whereas commercially available resins have combinations of photopolymers
to enhance mechanical properties of the final fabricated object and to overcome the limitations of single
polymer systems (e.g., low strength and high anisotropy). Examples of photopolymers are shown
in Table 2.
Most free-radical curing resins employ the unsaturated functionality of acrylate and methacrylates;
however, allyl- and vinyl-based formulations are also available [1]. An acrylate oligomer backbone
can be modified to be of a different polymer class to achieve the material properties desired in
the final object. For example, material properties are customized when an acrylate oligomer is
combined with highly flexible polybutadienes, rigid and chemically resistant bisphenol A epoxies,
and flexible yet tough polyurethanes [58]. Polyester- and acrylic-based acrylate oligomers are also
commercially available.
The biocompatibility of candidate photopolymeric materials for the AM of biomedical devices has
been carefully scrutinised. Organically modified ceramic (ORMOCER) composite resins, for example,
have been used with MPP and SLA to build devices including scaffolds for tissue engineering,
microneedles for drug delivery, and dental implants [33,59,60]. ORMOCER-based photopolymer
resins contain silicon alkoxides, organically modified silicon alkoxides, several metal alkoxides

31
Micromachines 2018, 9, 91

and in/organic monomers [61]. Typically, they operate either as methacrylate alkoxysilane systems,
initiated via radical polymerization, or epoxysilane systems initiated via cationic polymerization. The
biocompatibility of ORMOCER copolymer resins increases as the content of inorganic co-polymers
decreases, such that leaching of toxic residues is minimised [62]. For example, a polymerized object
made from an ORMOCER-based resin may contain up to 50% unreacted methacrylate monomer. These
are liable to leach in an aqueous medium and cause toxicity.
Polyethylene glycols (PEGs) are polymers of ethylene oxide [63]. PEGs are non-toxic, except
when they are administered at exceedingly high doses (for humans, >10 mg/(kg·day−1 )). Material
properties of PEGs can be fine-tuned by modifying the molecular weight (MW) of the PEG backbone
and by cross-linking them with acrylate groups. Polyethylene glycol diacrylate (PEG-DA) contains
double-bond acrylate groups at each end of the PEG chain.
PEG-DA is a relatively biocompatible material [64,65]. While PEG-DA is used in biomedical
applications, toxicity of PEG-DA can arise from unreacted monomers and PIs. Consequently,
assessment on biocompatibility precedes each application [64]. The authors of Urrios et al. [66],
for example, built transparent microfluidic devices in PEG-DA (MW 250) using SLA. To mitigate
the toxicity of unreacted PEG-DA monomers and PI, the surfaces were subjected to an additional
curing step in a UV bath to allow residual compounds to leach. The authors of Traore and Behkam
[67] combined PEG-DA hydrogels with photolithography to produce LOC devices for use in cellular
assays. To mitigate toxicity, gels were soaked in PBS overnight to remove excess PI and unreacted
monomers.
Direct AM of PDMS is still in its early stages of development. The authors of Femmer et al. [68]
used AM to create the first membrane made from PDMS using DLP. They fabricated features in
the range of 150 and 300 μm from a custom PDMS-based resin. However, the optical clarity of the
material was reduced because PI concentration and biocompatibility assays were not undertaken.
PDMS materials have been applied, to a degree, in the development of microfluidic LOC using AM.
The authors of He et al. [69] produced an LOC using FDM, sugar, and PDMS. Micro-channels were
created by extruding melted sugar on a PDMS-based layer. PDMS was cast over the sugar layer and
the sugar was removed with water. The authors of Comina et al. [29] used AM master moulds to cast
PDMS into LOC. In addition, PDMS has been used to coat AM LOC to improve biocompatibility.

32
Micromachines 2018, 9, 91

Table 2. Summary of toxicity data available for photopolymers used in stereolithography resins.

Compound w/w Available Toxicological Information


Toxic or harmful to various species of fish, algae and water
microorganisms [49]. Potential mutagens and a reproductive and
Acrylate monomers, FORMlabs
developmental toxicant.
Acrylate and Autodesk
5–60% LD50 Oral rat >5000 mg/kg [49]
Urethane acrylate Envisiontec
LC50 (96 h) Brachydanio rerio—10.1 mg/L (OECD 203) [70]
oligomers 3D Systems
LC50 (96 h) Cyprinus carpio—1.2 mg/L (OECD 203) [71]
LC50 (96 h) Pimephales promelas—34.7 mg/L (OECD 203) [70]
Assessment of repeated dose toxicity indicates potential to affect the
liver and kidneys as indicated in animal studies [72]. Potential
mutagen, and a reproductive and developmental toxicant, aquatic
toxicant, and genotoxic in mammalian cell culture [73].
LC50 (96 h) Salmo gairdneri—3.4 mg/L (OECD 203) [73]
LC50 (96 h) Cyprinodon variegatus—1.1 mg/L (OECD 203) [73]
Methyl methacrylate FORMlabs
EC50 (48 h) Daphnia magna—2.6 mg/L (OECD 202) [73]
monomers 1 , 5–90% Envisiontec
EC50 (72 h) Selenastrum capricornutum—3.55 mg/L (OECD 201) [73]
and oligomers Dental resin
EC50 (96 h) Mysidopsis bahia—1.6 mg/L (OPP 72-3) [73]
LC50 (96 h) Lepomis macrochirus—283 mg/L * [74]
LC50 (96 h) Oncorhynchus mykiss—5.2 mg/L * [75]
EC50 (48 h) Daphnia magna—8.74 mg/L * [75]
EC50 (72 h) Pseudokirchneriella subcapitata—5.2 mg/L * [75]
LD50 Oral rat—7900 mg/kg * [74]
LD50 Oral rat—6800 mg/kg (OECD 401) [76]
Tripropylene Glycol LC50 (96 h) Leuciscus idus >4.6–10 mg/L [76]
3D Systems
diacrylate EC50 (48 h) Daphnia magna—89 mg/L [76]
EC50 (72 h) Scenedesmus subspicatus—65.9 mg/L [76]

Table 2. Cont.

Compound w/w Available Toxicological Information


Hydroxyethyl EC50 (48 h) Daphnia magna—380 mg/L (OECD 202) [77]
Dental resins
Methacrylate EC50 (72 h) Selenastrum capricornutum—836 mg/L (OECD 201) [77]
3,4-Epoxy
cyclohexylmethyl EC50 (48 h) Daphnia magna—40 mg/L [78]
3,4-epoxy- 25–60% 3D Systems LC50 (96 h) Oncorhynchus mykiss—24 mg/L [78]
cyclohexane LC50 Oral rats—5000 mg/kg [78]
carboxylate
Not easily biodegradable (according to OECD-criteria) [79]
1,6-bis(2,3-epoxy EC50 (48 h) Daphnia magna—47 mg/L [79]
15–30% 3D Systems
propoxy) hexane LC50 (96 h) Leuciscus idus—30 mg/L [79]
LD50 Oral rats—2190 mg/Kg [79]
Bisphenol
A-diglycidyl
Dental resins EC50 mouse fibroblasts—9.35 μM [30]
dimethacrylate
(Bis-GMA)
Autodesk
LC50 (96 h) Cyprinus carp—1.2 mg/L 2 [80]
Tetraacrylate 2,3 30–60% Evisiontec
LC50 (96 h) Danio rerio—7.9 mg/L 3 [80]
FORMlabs
1 Degrades to methacrylic acid: LD50 Oral rat—1320 mg/kg, LC50 (96 h) Oncorhynchus mykiss—85 mg/L [81].
2 Alkox. pentaerythritol tetraacrylate. 3 Di(trimethylolpropane)tetra-acrylate.

Additives and fillers are auxiliary compounds included for the purpose of enhancing and
customizing qualities of the printed part. For example, vertical print resolution and transparency
is improved, and solubility is reduced, by inclusion of ‘light-blocker’ compounds, such as carbon
black and Naphthol-based pigments, and UV blockers, such as 2,2’-(2,5-thiophene diyl) bis(5-tert-butyl
benzoxazol) Liu and He [82]. All acrylate-based resins require auxiliary compounds to extend
resin shelf life. Inhibitors, which are usually a quinone-based compound such as butylated
hydroxytoluene, hydroquinone, hydroquinone monomethyl ether, and benzoquinone, prevent
spontaneous polymerization during storage [83].

33
Micromachines 2018, 9, 91

In general, commercially available resins utilize a wide range of auxiliary compounds that serve
various purposes such as tuning material, mechanical, physical, and aesthetic propertis. Several
examples of auxillary compounds are shown in Table 3. Further example compounds include silica,
titanium dioxide, zinc, iron oxides, silver, silicon nitrides, calcium, lead, cerium, tin, zirconium,
strontium, barium, borosilicate glasses, kaolin, quartz, talc, rubber impact modifiers, thermoplastic and
cross-linked polyurethanes, polyethylene, polypropylene, polycarbonates, and poly-epoxides [83–89].

4. Compatibility of AM Substrata with Biological Applications


Biocompatibility of polymeric substrata used to fabricate LOC technologies is critical for any
biological and biomedical applications. Bioassays on living cells and tissues are conducted in aqueous
media and leaching of any chemicals from 3D printed plastics after contact with water can directly affect
test specimens. Until recently, critical biocompatibility issues and potential hazard risk implications
of widespread usage of 3D printed polymers have received only marginal attention [13,17–19,56,90].
Data on toxicity, bioaccumulative potential, persistence, and degradability of photopolymer materials
is largely lacking [4]. This is in part due to a lack of available information on resin composition,
which constrains independent evaluation of environmental and human health risk.
Typically, commercial resin formulas are proprietary. Only known hazardous materials are
declared in material product safety data sheets (SDS). Compounds considered by the manufacturer as
posing no significant risk are omitted. Open source and patent documents showed limited insight on the
potential formulas and compounds used in resins. This indicates that formulas are complex, potentially
containing greater than 20 compounds [82–88]. Consequently, it is difficult to predict which compounds
may leach and to estimate and measure the toxicity of individual and mixtures of compounds.
Comprehensive biological and chemical testing is a consequence necessary to evaluate biocompatibility.
Generally, substrata used for MJ and vat photopolymerization AM can have greater toxicity
than those used in material extrusion AM [17,91]. Typically, photopolymerization AM is reliant on
acrylate- and methacrylate-based compounds, which have up to a 90% weight-to-weight ratio (w/w),
and phosphine-oxide-based PI systems, which are less than 5% w/w (Tables 1 and 2). These compounds
are known to be acutely and chronically toxic to aquatic test organisms, including fish, algae, and water
microorganisms. In mammals, chronic exposure to these compounds has sublethal effects that include
impaired reproductive, liver, and kidney function and abnormal growth and development. Despite
this, studies investigating AM polymer toxicity have primarily focused on the emission hazards of
fumes resulting from material extrusion techniques, and photopolymerization materials have been
largely ignored [12,13,18,92,93].
The two principal mechanisms by which compounds can be released from a polymerized
object are (1) degradation or erosion and (2) extraction by solvent or aqueous medium, the latter
often referred to as a leaching of toxic residues [91]. Erosion, which may be caused by
photo, thermal, mechanical, or chemical factors, and the solubility of the resin-matrix also
influence the release of compounds. For example, UDMA-based resins (urethane dimethacrylate,
1,6-bis(methacryloyloxy-2-methoxycarbonyl amino)-trimethylhexane) are less water-soluble than
materials containing bisphenol-A-glycidyl methacrylates and are thus more susceptible to erosion [91].
Salivary esterases can erode the surfaces of resin-based dental materials, releasing methacrylic
substances that subsequently enter the intestine via swallowing, diffuse into the circulatory system,
and remain in the body until metabolized [94]. Unpolymerized co-monomers, triethylene glycol
dimethacrylate (TEGDMA) and 2-hydroxyethyl methacrylate (HEMA), released from polymerized
parts used as dental implants, have been detected in the human circulatory system [95].

34
Micromachines 2018, 9, 91

Table 3. Summary of toxicity data available for auxiliary compounds used in stereolithography resins.

Compound w/w% Available Toxicological Information


Toxic or harmful to various species of fish, algae, and water
microorganisms [96]
Butylated LD50 Oral rat >6000 mg/kg (OECD 401) [96]
Dental resins
hydroxytoluene LC50 (48 h) Oryzias latipes—5.3 mg/L [96]
EC50 (48 h) Daphnia magna—0.48 mg/L (OECD 202) [96]
EC50 (24 h) Protozoa—1.7 mg/L [96]
Toxic to aquatic life with long lasting effects [49], not readily
biodegradable (OECD 301B) [49,97]
LD50 Oral rat—3230 mg/kg (OECD 423) [49,97]
FORMlabs LC50 (96 h) Lepomis macrochirus—0.97 mg/L (OECD 203) [49,97]
Sebacate
<5% e.g., Dental LC50 (96 h) Oncorhynchus mykiss—7.9 mg/L (OECD 203) [49]
compounds 1
Envisiontec LC50 (96 h) Brachydanio rerio—0.9 mg/L (OECD 203) [49]
LC50 (48 h) Daphnia magna—8.58 mg/L (OECD 202) [97]
EC50 (72 h) Pseudokirchneriella subcapitata—1.1 mg/L (OECD 201) [97]
EC50 (72 h) Desmodesmus subspicatus—1.68 mg/L (OECD 201) [49]
LC50 (96 h) Danio rerio—9 mg/L [80]
Methylthiophenol Autodesk EC50 (72 h) Pediastrum boryanum—1.7 mg/L [80]
compounds 2 EC50 (24 h) Daphnia magna—15 mg/L [80]
Evidence of mutagenicity in mammal studies, toxic to aquatic life;
absorption, in sufficient concentrations, leads to cyanosis [98]
LC50 (96 h) Oncorhynchus mykiss—0.04 mg/L [98]
Hydroquinone Dental resins
EC50 (48 h) Daphnia magna 0.13 mg/L [98]
EC50 (72 h) Pseudokirchneriella subcapitata—0.34 mg/L [98]
LD50 Oral rat—367.3 mg/kg [98]
1 Bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate, Pentamethyl-piperidyl sebacate.
2 2-methyl-1-(4-methylthiophenol)-2-Morpholinopropan-1-one.

Leaching of toxic residues to aqueous media is significantly more important for implementations
of AM in bioanalytical LOC technologies. Recent reports have shown that leaching of compounds from
plastic parts is relatively high in the first 24 h [30]. The rate of compound leaching is influenced partly
by geometry, characteristics of resin components, and polymerization extent [36,99]. Several studies
have isolated compounds such as residual monomers, additives, and photoinitiators by means of
extraction with aqueous media including distilled water, natural or artificial saliva, Ringer’s solution,
and organic diluents such as methanol, ethanol, and acetone. We have recently tested a random sample
of photopolymer leachate from several SLA systems using gas chromatography–mass spectrometry
(GC-MS) analysis. Our qualitative data based on different retention times in GC confirmed the presence
of a photoinitiator 1-hydroxycyclohexyl phenyl ketone (1-HCHPK) and a substance closely related but
not identical to methacrylate monomer (Figure 3).
Interestingly, 1-HCHPK has recently been reported as toxicant leaching from polyethylene
ampoules used for intravenous injections [100]. Such pilot GC-MS analysis highlighted its limited
detection capability for substances that are polar and non-volatile. Indeed, subsequent toxicity profiling
of identified pure compounds suggested that they were responsible for only half of the cumulative
toxicity effect. This warrants additional analysis to enable quantitative and conclusive identification
of compounds that leach out of the 3D-printed plastic parts. Combined, these data signify possible
biological risks associated with photoinitiators use in different plastic materials.

35
Micromachines 2018, 9, 91

Figure 3. Qualitative analysis of Form Labs photopolymer leachate using gas chromatography-mass
spectrometer (GC-MS) indicating the presence of photoinitiator 1-hydroxycyclohexyl phenyl ketone
(1-HCHPK) and a substance closely related but not identical to methacrylate monomer.

Incomplete polymerization of photo-reactive resins amid MJ, SLA, and DLP processes can lead
to greater levels of uncured and highly toxic substratum in the manufactured object, which can
potentially increase the leaching rate [31]. Even under optimal conditions, the conversion of monomers
to polymers is usually incomplete, and even the most efficient systems achieve approximately 55–60%
of complete polymerization [101]. Early termination of polymerization may further result from
a higher-than-optimal PI concentration in the resin, which over-produces reactive species, or the
presence of oxygen [102]. The above issues can be further intensified by part geometry. The latter
affects polymerization since initiation is due to ‘line of sight’, making shadowed areas more difficult
to cure, particularly at the ‘post-curing’ stage. Since the PI, compounds are not typically indicated
by the resin manufacturer, mismatch of the absorption characteristics of the resin to the emission
characteristics of the chosen curing method, is a potential problem that may result in incomplete
polymerization. For example, most UV photoinitiators, in particular those for cationic polymerization,
exhibit very weak or no absorption at 365 nm, 400 nm, and 465 nm, which makes the MPM lamps and
LEDs inefficient light sources for curing [45].
When considering AM systems such as SLA, MJ and DLP for any biological applications it
is important to consider that PIs, auxiliary compounds, monomers, and short chain polymers,
as well as their metabolites, may not be exhausted during or after polymerization. Furthermore,

36
Micromachines 2018, 9, 91

they are not entirely bound to or within the printed object [103,104]. For example, small
photoinitiators of 200–250 Da used in food packaging, such as 4-methyl benzophenone (4-MBP)
and isopropylthioxanthone, were found to migrate from the packaging into the food, raising significant
food safety concerns [105]. The authors of Short et al. [90] found that the PI antimony, a toxic heavy
metal, leached from AM objects over a 24 h period. In addition, several studies on human tissues have
shown that PI metabolites were implicated in material toxicity [106].
Key metabolites of PIs are free radicals, also known as reactive oxygen species (ROS), such as
peroxides and peroxy radicals [40,44]. These are implicated in the damage of DNA and proteins by
oxidative stress mechanisms [107]. The pathophysiology of ageing and various age-related diseases,
including chronic inflammatory of the gastrointestinal tract, diseases associated with cartilage,
and other neurology disorders, have been linked to oxidative damage [108].
Recent clinical investigations of biocompatibility of AM-fabricated polymeric dental implants
have shown a correlation between leachate and irritation of the oral mucosa [30]. Compounds such as
MMA, formaldehyde (a degradation of a copolymer formed from oxygen and methacrylate during
polymerization), and dibutyl phthalate (a plasticizer) have been detected in saliva. The authors of
Schweikl et al. [109] demonstrated that methacrylate monomers, such as HEMA, leach from dental
materials and induce cell apoptosis as a response to the associated DNA damage. Epoxides are
highly reactive molecules that are also implicated in DNA damage, apoptosis, and carcinogenic and
mutagenic effects [94]. The leached PI camphorquinone has moderate cytotoxic effects as shown in
human submandibular-duct cells [110]. It has been associated with cytotoxicity and correlated with
a significant increase in intracellular ROS in human pulp fibroblasts [111].
A commonly used endpoint for the determination of adverse systemic effects is acute oral
toxicity in rats (Tables 1–3). This quantifies the single-dose required to kill 50% of test animals (LD50 ).
Since photopolymerised resin-based materials release compounds in relatively small amounts, acute
oral toxicity in rats is less relevant to the assessment of the biocompatibility of these materials
compared with tests documenting sublethal endpoints [91]. The latter determines the effective
concentrations, which induce a response in 50% of the test animals (EC50 ), sometimes determined
along with the concentration required to kill 50% of the test organisms (LC50 ). These values
allow comparisons between relative biocompatibility of materials. For example, the authors of
Geurtsen [111] investigated cytotoxic effects of 35 single compounds used in stereolithographic resins,
in permanent 3T3 cells, and in three primary human oral fibroblast cultures. They showed that
EC50 values varied significantly among compounds, and that the PI 2,6-di-t-butyl-4-methylphenol,
the auxiliary compound 2-hydroxy-4-methoxy benzophenone, and the PI diphenyliodonium chloride
had relatively elevated cytotoxic effects.
Several recent studies have investigated the biocompatibility of parts made by vat polymerization
and MJ (Table 4). These studies utilized the fish embryo toxicity (FET) test, which is an established and
sensitive, phenotype-based physiological analysis of developing zebrafish (Danio rerio) embryos. It is
a relatively non-biased approach and is used extensively in the process of elucidating organ-specific
toxicity and environmental adaptations at the organ, tissue, and systems level [112]. The embryonic
developmental stage is considered one of the most sensitive to environmental perturbations and can
be readily applied to assess the impacts of any potential toxic effects of chemicals or solid phases.
Despite SLA and MJ parts being post-processed according to manufacturer specifications,
they appear to leach compounds. The authors of Macdonald et al. [13] investigated the biocompatibility
of commercial resins—VisiJet Crystal EX200, VisiJet S300, Watershed 11122 XC, ABSplus P-430,
and Fototec SLA-7150-Clear—using FET and found that these resins may leach toxic compounds
(Table 4). Leachate from several caused malformations during embryonic development (teratogenicity)
of zebrafish embryos. The authors of Oskui et al. [17] tested the biocompatibility of a Form Clear
(Form Labs, Inc., Somerville, MA, USA) resin and found that exposure to leachate lowered survival
rates of zebrafish embryos and elevated rates of malformations (yolk sac edema, heart edema,
embryo length deformation, spine flexures, a lack of melanophore development, and a lack of swim

37
Micromachines 2018, 9, 91

bladders). In a similar study, the authors of Alifui-Segbaya et al. [16] showed that 48 h of exposure
to a VisiJet (3D Systems Inc., Rock Hill, SC, USA) crystal-printed part leachate had lethal, sublethal,
and teratogenic effects on zebrafish embryos.

Table 4. Summary of recent assessments on biocompatibility of parts printed with commercially


available SLA and MJ printing polymers.

Resin Organism Toxicological Information


VisiJet Crystal Algae 1 At 24 h ∼70% growth inhibition [18].
Flea 2 At 24 h 100% mortality [18]
Rotifer 3 At 24 h 100% mortality [18]
Stunted growth, missing eyes, reduced pigmentation and yolk sac, abnormal
Zebrafish 4 shapes and also appear darker [13]. Greater than 90% mortality observed at
48 h [16] and 100% mortality observed at at 72 h [13].
Watershed 11122XC Algae 1 At 24 h >90% growth inhibition [18]
Rotifer 3 At 24 h ∼ 100% mortality [18]
Flea 2,5 At 24 h ∼ 100% mortality [18]
Fototec 7150 Clear Algae 1 At 24 h >90% growth inhibition [18]
Rotifer 3 At 24 h ∼ 100% mortality [18]
Flea 2,5 At 24 h ∼ 100% mortality [18]
Form Clear Algae 1 At 24 h ∼60% growth inhibition [18]
Rotifer 3 At 24 h ∼100% mortality [18]
Flea 2,5 At 24 h ∼ 100% mortality [18]
At 72 h higher rate of mortality, malformations (yolk sac edema, heart
Zebrafish 4 edema, embryo length deformation, spine flexures, lack of melanophore
development, and a lack of swim bladders) [17].
VisiJet Clear Zebrafish 4 At 48 h >90% mortality of embryos [16].
Algae 1 At 24 h >90% growth inhibition [18]
Rotifer 3 At 24 h ∼ 100% mortality [18]
Flea 2,5 At 24 h ∼ 100% mortality [18]
MED610/620 Zebrafish 4 >50% lethality [16].
1Freshwater algae (Pseudokirchneriella subcapitata)—OECD 201 Growth Inhibition Test. 2 Freshwater water
flea Daphnia sp.—OECD 202 Acute Immobilization Test. 3 Freshwater rotifer Brachionus calycifloru—ASTM
E1440-91 Acute Toxicity Test. 4 Zebrafish Danio rerio embryo—OECD 236 Fish Embryo Acute Toxicity (FET)
Assay. 5 Freshwater water flea Ceriodaphnia dubia—USEPA Acute Toxicity Test.

38
Micromachines 2018, 9, 91

Zhu et al. [18] expanded upon the above studies and performed a battery of cell-based and whole
organism bioassays to assess the biocompatibility of several polymers including Watershed 11122
XC, Dreve Fototec 7150 Clear, VisiJet Crystal, Form Clear, and VisiJet SL Clear (Table 4). This work
for the first time provided an in-depth and multispecies view of potential biological implications of
fabricating devices using AM technologies. The published results demonstrated that leachate from
polymerized parts were toxic to vertebrates and several invertebrate model organisms. All of the zebra
fish larvae exposed to MJ and SLA leachates developed complete paralysis within 5 min of exposure,
indicating the effect leachates may have on the central nervous system of zebrafish larvae.
These results identified VisiJet Crystal polymer as toxic despite its being classified as a substance
with favourable biocompatibility, as evidenced by United States Pharmacopeia (USP) Class VI
certification [13,18,113]. However, its USP Class VI certification is dependent on specific post-curing
and cleaning steps [113]. These recent studies, though, have demonstrated that compounds, which are
potentially toxic, remain and can leach. Furthermore, standard and specialised post-processing steps
may not be adequate for removing toxicity, which still may occur in ranges affecting LOC bioassays.
While advances in AM of microfluidic and biomedical devices empower a rapidly growing
number of applications, the above studies suggest that considerable caution must be exercised to
mitigate biocompatibility concerns. The AM of biomicrofluidic LOC devices may not be suitable for in
vitro bioassays applications. Ongoing research is aimed at solving these biocompatibility concerns by,
for example, the development of AM systems capable of using biologically compatible substrata such
as PDMS and PEG-DA [114].

5. Methods for Mitigating Toxicity of Polymeric Resins


AM is undoubtedly an elegant approach to the fabrication of monolithic functional LOC devices.
Its ability to produced LOC with integrated fluidic interconnects and functional elements such as
valves has been proven. In addition, several different approaches aimed at ensuring biocompatibility
of photopolymer resins have been explored. Beyond customizing resin formulas to select for less toxic
compounds, carefully managed post-cleaning and post-curing processes, or coating of surfaces with
various biocompatible compounds, can increase biocompatibility.
While cross-linked polymer matrix may not leach, unreacted monomers, short-chain polymers,
additives and PI residues are prone to leaching when the part is in aqueous media (Tables 1–3). For this
reason, dentures and orthodontic devices, made using proprietary resins, are routinely stored in
water for up to 24 h (depending on the type of resin) to allow uncured compounds to be released,
thus reducing unwanted side effects [30]. For microfluidic LOC and biomedical devices made using
proprietary photopolymer resins, coating with PDMS, a nontoxic and transparent elastomer, has also
been used to overcome the limitation of unknown surface chemistry and toxicity [114,115].
Biocompatibility increases when polymerizing and post-curing light sources, and emission
regimes, are matched to meet the absorption requirements of the resin compounds [46]. To optimize
polymerization, the absorption maximum of PIs present in the photopolymer resin should overlap
with the wavelength emitted by the polymerizing light source [45,116]. Commonly used light sources
for polymerization are light-emitting diodes (LEDs), medium pressure mercury (MPM) lamps, and the
UV-light-emitting diodes (UV LEDs). LED curing units emit at two wavelength peaks (400 nm and
465 nm), MPM lamps emit at one wavelength peak (365 nm) and UV LED can emit at four wavelength
peaks (320 nm, 345 nm, 365 nm, and 390 nm). The total energy (light intensity times exposure time)
irradiating the surface is also essential to polymerization [117]. Thus, it is necessary that the chosen
polymerizing light source emits a sufficient intensity, and at wavelengths matching the absorption
range of the PIs present in the SL resin.
Differences in the structure of printed parts will influence the effectiveness of post-curing
treatments. To maximize exposure of the printed parts surface to the polymerizing light source,
commercial curing ovens often have a rotating inner table and several floodlights that project from
the inner walls and ceiling. However, LOCs have enclosed inner channels that are likely to be shaded

39
Micromachines 2018, 9, 91

from polymerizing light. The degree of which will depend on the penetration depth of the light source
through the part, the thickness of the part, and part geometry. Shading will result in incomplete curing
and less than optimal mechanical properties. For this reason, post-curing alone may not effectively
remove toxicity.
Photopolymer resins classed as biocompatible require thorough post-cleaning [113]. For example,
a standard cleaning procedure for a part printed in VisiJet clear consists of soaking the part in isopropyl
alcohol (IPA), brushing lightly if needed, rinsing in IPA, and air-drying, followed by 10–30 min of
post-curing. Cleaning procedures required for a USP Class VI certification involve soaking the part for
20 min in IPA, followed by scrubbing, and afterward four repeat cycles of soaking the part for 5 min
in IPA, again followed by scrubbing. Each repeat soak is to be conducted in fresh IPA. Subsequently
excess solvent is removed from the surface of the part using clean compressed air, and the part is
air-dried for a minimum of 6 h, during which the part must be flipped periodically to facilitate equal
drying. After this, the part must be cured for 1 h per side in a ProJet Curing Unit.
To reduce leaching, Macdonald et al. [13] experimented with coating SLA printed parts with wax
and found that the coating was only effective at delaying the onset of toxicity (by ∼40 h). The authors
of van den Driesche et al. [118] removed the toxicity of parts printed by DLP in resins, E-Shell 300
and HTM140, by coating them in parylene-C, which is an ultra-thin biocompatible polymer coating.
Coating parts with biocompatible hydrogels (e.g., PEG-DA) or PDMS may also be an effective strategy
to remove toxicity of easily accessible photopolymeric resins.
In another attempt to mitigate toxicity of photopolymeric resins by minimizing leaching in situ,
the authors of Popov and Evseev [119] experimented with post-processing SLA-printed anatomical
implants with supercritical carbon dioxide and found that, without treatment, the implant caused
severe inflammation, whereas, with treatment, the implant was biocompatible [119].
Commercially available resins vary in how effective post-curing and cleaning techniques are at
reducing toxicity. The authors of Macdonald et al. [13] treated parts by washing them in 99% ethanol
and found that this increased biocompatibility of some printed parts, such as Fototec 7150 polymers.
However, VisiJet Crystal still showed toxicity after treatment and 100% mortality of zebrafish embryos
at 72 h was observed. The authors of Oskui et al. [17] reduced toxicity of the Form Clear SLA polymer
by post-curing each side for 30 min. However, while survival and hatching rates of embryos increased
compared to those exposed to non-treated parts, the majority of larvae still had elevated rates of
malformations (e.g., yolk sac and heart edema and slower swim bladder development).
To improve the safety of photosensitive polymers, alternative compounds can replace those
that exhibit higher toxicity. PIs that are less toxic and less likely to leach are being developed.
For example, PIs derived from grafting or condensing low-molecular-weight PIs to linear,
dendritic, or hyper-branched polymers exhibit reduced leaching compared to their corresponding
low-molecular-weight analogues [120]. The authors of Nguyen et al. [106] used riboflavin (Vitamin
B2) as an alternative PI, and this had the effect of significantly increasing the biocompatibility
of 3D-printed objects, compared to those made with other commercial PIs such as Irgacure 2959
and Irgacure 369. Acrylates, which are cytotoxic, can be replaced by less toxic methacrylates and
thiol-ene systems (Table 2). In general, cationic photopolymerizable systems are characterized by
decreased toxicity and are, to a degree, a viable alternative to acrylate-radical photopolymerization
systems Sangermano [40]. Compounds such as methacryloxypropyl trimethoxysilane-zirconium
propoxide copolymer have demonstrated biocompatibility and have been used to build
microneedles [121]. As previously discussed, materials such as PDMS, ORMOCER, and PEG-DA are
considered relatively non-toxic.

6. Outlook
The AM industry is projected to grow by 17.8% by 2025 due to the expansion of AM applications,
the adoption of industry standards, the improvements in material quality, and its technological
capabilities [2]. Currently, SLA and DLP AM occupy ∼32% of the market share, and FDM and SLS,

40
Micromachines 2018, 9, 91

∼36% and ∼33%, respectively [20]. Photopolymerization AM (namely, SLA, MJ, and DLP) systems
represent by far the largest and most attractive market segment. SLA, DLP, and MPP are AM methods
that are highly relevant to LOC design and manufacture as they offer higher resolution than alternatives
and can utilize optically transparent materials.
While advances in AM of micro-milllifluidic devices is enabling a rapidly growing number of
applications, the studies discussed in this work suggest that caution is required when devices are
fabricated for biological applications. Further improvement in resin compositions by, for example,
improving the depth of curing and selecting environmentally benign compounds will mitigate toxicity
and simultaneously improve print resolution. The treatment of parts with organic solvents and
dedicated surface modifications has been shown to minimize toxicity in some cases. These methods can
be considered as a practical, albeit limited, stopgap solution to improve biocompatibility. However, due
to limited knowledge about proprietary polymers and their interactions with biological specimens, such
methods lack in-depth studies evaluating their effectiveness. Moreover, solvent extraction methods
during post-processing steps are inherently variable and may not remove the potential for long-term
effects resulting in chronic toxicity.
To solve biocompatibility issues, ongoing research efforts aim to develop AM systems proficient
at using biologically compatible substrata such as ORMOCER PDMS and PEG-DA [114,122–124].
Despite some recent progress, these techniques are still at early stages of development and not readily
available on the market.
This review highlights that, despite the obvious advantages of AM, the leaching and toxicity
mechanisms of AM photopolymers need to be clarified so that innovative AM technologies can be
used to advance the LOC field. In this context, we also have to become aware of the larger picture
associated with AM technologies. We expect that, with their increasingly use, many relevant questions
about waste disposal and about environmental and human health effects will soon emerge. Relatively
little is known about long-term impacts of AM materials on human health as well as wellbeing of the
environment. New research efforts exploring the above and related issues are necessary [125].

Acknowledgments: All sources of funding of the study should be disclosed. Please clearly indicate grants that
you have received in support of your research work. Clearly state if you received funds for covering the costs to
publish in open access.
Conflicts of Interest: The authors declare no conflict of interest.

Abbreviations
The following abbreviations are used in this manuscript:

MDPI Multidisciplinary Digital Publishing Institute


AM Additive manufacturing
3D Three-dimensional
CAD Computer-assisted design
LOC Lab-on-a-Chip
ABS Acrylonitrile butadiene styrene
PLA Polylactic acid
SLA Stereolithography
MJ Material jetting
DLP Digital light processing
2PP Multiphoton polymerization
PI Photoinitiator
UV Ultra-violet
TEGDMA Triethylene glycol dimethacrylate
HEMA 2-hydroxyethyl methacrylate
w/w weight-to-weight
GC-MS Gas Chromatography-Mass Spectrometry
1-HCHPK 1-hydroxycyclohexyl phenyl ketone

41
Micromachines 2018, 9, 91

LED Light-emitting diodes


MPM Medium pressure mercury
USP United States Pharmacopeia
PDMS Poly(dimethylsiloxane)
PEG-DA Poly(ethylene glycol) diacrylate
OECD Organisation for Economic Co-operation and Development
FET Fish embryo toxicity
EC Effective concentration
LC Lethal concentration
LD Lethal dose
TPO Diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide
BP-3 Benzophenone-3
BP-4 Benzophenone-4
BAPO Bis Acyl Phosphine oxide
MMA Methyl methacrylate
UDMA Urethane dimethacrylate
ROS Reactive oxygen species
MW Molecular weight
IPA Isopropyl alcohol

References
1. Ligon, S.C.; Liska, R.; Stampfl, J.; Gurr, M.; Mulhaupt, R. Polymers for 3D Printing and Customized Additive
Manufacturing. Chem. Rev. 2017, 117, 10212–10290.
2. Transparency Market Research (TMR). 3D Printing Market (Use—Commercial and Personal;
Technology—PolyJet, Fused Deposition Modeling (FDM), Selective Laser Sintering (SLS), and
Stereolithography (SLA); By Application—Consumer Products and Electronics, Automotive, Medical,
Industrial, Aerospace, Military & Defense, Architecture, and Education)—Global Industry Analysis, Size,
Share, Growth, Trends and Forecast 2017–2025. Available online: https://www.transparencymarketresearch.
com/3d-printing-industry.html (accessed on 23 Feburary 2018).
3. Petrick, I.J.; Simpson, T.W. 3D Printing Disrupts Manufacturing: How Economies of One Create New Rules
of Competition. Res. Technol. Manag. 2013, 56, 12–16.
4. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013.
5. Campana, O.; Wlodkowic, D. The undiscovered country: Ecotoxicology meets microfluidics. Sens. Actuators
B Chem. 2018, 257, 692–704.
6. Lee, J.Y.; An, J.; Chua, C.K. Fundamentals and applications of 3D printing for novel materials.
Appl. Mater. Today 2017, 7, 120–133.
7. Bhushan, B.; Caspers, M. An overview of additive manufacturing (3D printing) for microfabrication.
Microsyst. Technol. 2017, 23, 1117–1124.
8. Akagi, J.; Khoshmanesh, K.; Evans, B.; Hall, C.J.; Crosier, K.E.; Cooper, J.M.; Crosier, P.S.; Wlodkowic,
D. Miniaturized embryo array for automated trapping, immobilization and microperfusion of zebrafish
embryos. PLoS ONE 2012, 7, e36630.
9. Huang, Y.; Reyes Aldasoro, C.C.; Persoone, G.; Wlodkowic, D. Integrated microfluidic technology for
sub-lethal and behavioral marine ecotoxicity biotests. In Proceedings of the SPIE—The International Society
for Optical Engineering, Barcelona, Spain, 5–6 May 2015.
10. Huang, Y.; Persoone, G.; Nugegoda, D.; Wlodkowic, D. Enabling sub-lethal behavioral ecotoxicity biotests
using microfluidic Lab-on-a-Chip technology. Sens. Actuators B Chem. 2016, 226, 289–298.
11. Lee, W.; Kwon, D.; Choi, W.; Jung, G.Y.; Au, A.K.; Folch, A.; Jeon, S. 3D-Printed Microfluidic Device
for the Detection of Pathogenic Bacteria Using Size-based Separation in Helical Channel with Trapezoid
Cross-Section. Sci. Rep. 2015, 5, 1–7.
12. Zhu, F.; Skommer, J.; Macdonald, N.P.; Friedrich, T.; Kaslin, J.; Wlodkowic, D. Three-dimensional printed
millifluidic devices for zebrafish embryo tests. Biomicrofluidics 2015, 9, doi:10.1063/1.4927379.

42
Micromachines 2018, 9, 91

13. Macdonald, N.P.; Zhu, F.; Hall, C.J.; Reboud, J.; Crosier, P.S.; Patton, E.E.; Wlodkowic, D.; Cooper, J.M. Lab
on a Chip Assessment of biocompatibility of 3D printed photopolymers using zebrafish embryo toxicity.
Lab Chip 2016, 16, 291–297.
14. Fuad, N.M.; Kaslin, J.; Wlodkowic, D. Lab-on-a-Chip imaging micro-echocardiography (iμEC) for rapid
assessment of cardiovascular activity in zebrafish larvae. Sens. Actuators B Chem. 2018, 256, 1131–1141.
15. Wlodkowic, D.; Khoshmanesh, K.; Akagi, J.; Williams, D.E.; Cooper, J.M. Wormometry-on-a-chip: Innovative
technologies for in situ analysis of small multicellular organisms. Cytom. Part A 2011, 79A, 799–813.
16. Alifui-Segbaya, F.; Varma, S.; Lieschke, G.J.; George, R. Biocompatibility of Photopolymers in 3D Printing.
3D Print. Addit. Manuf. 2017, 4, 185–191.
17. Oskui, S.M.; Diamante, G.; Liao, C.; Shi, W.; Gan, J.; Schlenk, D.; Grover, W.H. Assessing and Reducing the
Toxicity of 3D-Printed Parts. Environ. Sci. Technol. Lett. 2016, 3, 1–6.
18. Zhu, F.; Friedrich, T.; Nugegoda, D.; Kaslin, J. Assessment of the biocompatibility of three-dimensional-
printed polymers using multispecies toxicity tests. Biomicrofluidics 2015, 9, doi:10.1063/1.4939031.
19. Zhu, F.; Skommer, J.; Friedrich, T.; Kaslin, J.; Wlodkowic, D. 3D printed polymers toxicity profiling: A caution
for biodevice applications. Proc. SPIE 2015, 9668, doi:10.1117/12.2202392.
20. Columbus, L. The State of 3D Printing, 2017.
21. Fourkas, J.T. Fundamentals of Two-Photon Fabrication. In Three-Dimensional Microfabrication Using
Two-Photon Polymerization; William Andrew: Norwich, NY, USA, 2016; Chapter 1.3, pp. 45–61.
22. Obata, K.; El-Tamer, A.; Koch, L.; Hinze, U.; Chichkov, B.N. High-aspect 3D two-photon polymerization
structuring with widened objective working range (WOW-2PP). Light Sci. Appl. 2013, 2, 8–11.
23. Horváth, B.; Ormos, P. Nearly Aberration-Free Multiphoton Polymerization into Thick Photoresist Layers.
Micromachines 2017, 8, 219.
24. Sochol, R.D.; Sweet, E.; Glick, C.C.; Venkatesh, S.; Avetisyan, A.; Ekman, K.F.; Raulinaitis, A.; Tsai, A.;
Wienkers, A.; Korner, K.; et al. 3D printed microfluidic circuitry via multijet-based additive manufacturing.
Lab Chip 2016, 16, 668–678.
25. Yazdi, A.A.; Popma, A.; Wong, W.; Nguyen, T.; Pan, Y.; Xu, J. 3D printing: An emerging tool for novel
microfluidics and lab-on-a-chip applications. Microfluid. Nanofluid. 2016, 20, 1–18.
26. Au, A.K.; Lee, W.; Folch, A. Mail-Order Microfluidics: Evaluation of Stereolithography for the Production of
Microfluidic Devices. Lab Chip 2014, 14, 1294–1301.
27. Comina, G.; Suska, A.; Filippini, D. 3D printed unibody lab-on-a-chip: Features survey and check-valves
integration. Micromachines 2015, 6, 437–451.
28. Suzuki, H.; Mitsuno, K.; Shiroguchi, K.; Tsugane, M.; Okano, T.; Dohi, T.; Tsuji, T. One-step micromolding of
complex 3D microchambers for single-cell analysis. Lab Chip 2017, 17, 647–652.
29. Comina, G.; Suska, A.; Filippini, D. PDMS lab-on-a-chip fabrication using 3D printed templates. Lab Chip
2014, 14, 424–430. [arXiv:cs/9605103].
30. Schmalz, G.; Arenholt-Bindslev, D. Biocompatibility of Dental Materials; Springer: Berlin/Heidelberg, Germany,
2009; pp. 1–379.
31. Melchels, F.P.W.; Feijen, J.; Grijpma, D.W. Biomaterials A review on stereolithography and its applications in
biomedical engineering. Biomaterials 2010, 31, 6121–6130.
32. Nanoscribe GmbH. Nanoscribe; Nanoscribe GmbH.: Eggenstein-Leopoldshafen, Germany.
33. Gittard, S.D.; Ovsianikov, A.; Chichkov, B.N.; Doraiswamy, A.; Narayan, R.J. Two Photon Polymerization of
Microneedles for Transdermal Drug Delivery. Expert Opin. Drug Deliv. 2010, 7, 513–533.
34. Accoto, C.; Qualtieri, A.; Pisanello, F.; Ricciardi, C.; Pirri, C.F.; Vittorio, M.D.; Rizzi, F. Two-Photon
Polymerization Lithography and Laser Doppler Vibrometry of a SU-8-Based Suspended Microchannel
Resonator. J. Microelectromech. Syst. 2015, 24, 1038–1042.
35. Li, Y.; Fang, Y.; Wang, J.; Wang, L.; Tang, S.; Jiang, C.; Zheng, L.; Mei, Y. Integrative optofluidic microcavity
with tubular channels and coupled waveguides via two-photon polymerization. Lab Chip 2016, 16, 4406–4414.
36. Fouassier, J.P.; Lalevée, J. Photochemical Production of Interpenetrating Polymer Networks; Simultaneous
Initiation of Radical and Cationic Polymerization Reactions. Polymers 2014, 6, 2588–2610.
37. Ophardt, C.; Reusch, W. Organic Chemistry; 2015, Available online: https://chem.libretexts.org/Core/
Organic_Chemistry (accessed on 23 Feburary 2018).

43
Micromachines 2018, 9, 91

38. Bail, R.; Patel, A.; Yang, H.; Rogers, C.M.; Rose, F.R.A.J.; Segal, J.I.; Ratchev, S.M. The effect of a type I
photoinitiator on cure kinetics and cell toxicity in projection-microstereolithography. Procedia-Soc. Behav. Sci.
2013, 5, 222–225.
39. Gotro, J. Cationic Photopolymerization; 2016, Available online: https://polymerinnovationblog.com/uv-
curing-part-five-cationic-photopolymerization/ (accessed on 23 Feburary 2018).
40. Sangermano, M. Advances in cationic photopolymerization. Pure Appl. Chem. 2012, 84, 2065–2133.
41. Crivello, J.V. The discovery and development of onium salt cationic photoinitiators. J. Polym. Sci. Part A
Polym. Chem. 1999, 37, 4241–4254.
42. Subramanian, M.N. Basics of Polymer Chemistry; River Publishers: London, UK, 2017.
43. Wang, X.; Jiang, M.; Zhou, Z.; Gou, J.; Hui, D. 3D printing of polymer matrix composites: A review and
prospective. Compos. Part B Eng. 2017, 110, 442–458.
44. Lago, M.A.; de Quirós, A.R.-B.; Sendón, R.; Nieto, M.T.; Paseiro, P.; Lago, M.A. Food Additives &
Contaminants: Part A Photoinitiators: A food safety review. Food Addit. Contam. Part A 2015, 32, 779–798.
45. Nowak, D.; Ortyl, J.; Kamińska-Borek, I.; Kukuła, K.; Topa, M.; Popielarz, R. Photopolymerization of hybrid
monomers: Part I: Comparison of the performance of selected photoinitiators in cationic and free-radical
polymerization of hybrid monomers. Polym. Test. 2017, 64, 313–320.
46. Czech, Z.; Klementowska, P.; Drzycimska, A. Choosing the right initiator. Eur. Coat. J. 2007, 2, 26.
47. Clear Photoreactive Resin for Formlabs 3D Printers. Available online: https://formlabs.com/media/upload/
Clear__Resin_SDS_EU.pdf (accessed on 21 February 2018).
48. Sigma-Aldrich. SAFETY DATA SHEET: Diphenyl(2,4,6-trimethylbenzoyl)phosphine Oxide, version 5.4;
Sigma-Aldrich: St. Louis, MO, USA, 2016.
49. Dental LT Clear. Available online: https://formlabs.com/media/upload/DentalLTClear-SDS-EN.pdf
(accessed on 21 February 2018).
50. SAFETY DATA SHEET: NextDent Ortho IBT, ID:M-NOIBT-2015-01-UK. Available online: https://nextdent.com/
wp-content/uploads/2016/02/UK_SDS-NextDent-Ortho-IBT-V01-2015.pdf (accessed on 21 February 2018).
51. SIGMA-ALDRICH. SAFETY DATA SHEET: 4-Hydroxyacetophenone, version 3.5; Sigma-Aldrich: St. Louis,
MO, USA, 2016.
52. Anadón, A.; Bell, D.; Binderup, M.L.; Bursch, W.; Castle, L.; Crebelli, R.; Engel, K.H.; Franz, R.; Gontard, N.;
Haertlé, T.; et al. Toxicological Evalatuion of Benzophenone. Eur. Food Saf. Auth. 2009, 2009,
doi:10.2903/j.efsa.2009.1104.
53. SIGMA-ALDRICH. SAFETY DATA SHEET: Benzophenone, version 3.12; Sigma-Aldrich: St. Louis, MO,
USA, 2017.
54. SIGMA-ALDRICH. SAFETY DATA SHEET: 1-Hydroxycyclohexyl Phenyl Ketone, version 5.2; Sigma-Aldrich:
St. Louis, MO, USA, 2014.
55. 3D Systems Inc. Safety Data Sheet: VisiJet SL Clear, ID: 24672-S12-04-A; 3D Systems Inc.: Rock Hill, SC,
USA, 2016.
56. Du, Y.; Wang, W.Q.; Pei, Z.T.; Ahmad, F.; Xu, R.R. Acute Toxicity and Ecological Risk Assessment of in
Ultraviolet (UV)-Filters. Int. J. Environ. Res. Public Health 2017, 14, 414.
57. Zhang, J.; Xiao, P.; Dietlin, C.; Campolo, D.; Dumur, F.; Gigmes, D.; Morlet-savary, F.; Fouassier, J.P.; Lalevée, J.
Cationic Photoinitiators for Near UV and Visible LEDs: A Particular Insight into One-Component Systems.
Macromol. Chem. Phys. 2016, 217, 1214–1227.
58. Maurya, S.D.; Kurmvanshi, S.K.; Mohanty, S.; Nayak, S.K. A Review on Acrylate-Terminated Urethane
Oligomers and Polymers: Synthesis and Applications. Polym.-Plast. Technol. Eng. 2017, 57, 625–656.
59. Gittard, S.D.; Narayan, R.J. Laser direct writing of micro- and nano-scale medical devices. Expert Rev.
Med. Dev. 2010, 7, 343–356.
60. Ovsianikov, A.; Chichkov, B.; Mente, P.; Monteiro-Riviere, N.A.; Doraiswamy, A.; Narayan, R.J. Two
photon polymerization of polymer-ceramic hybrid materials for transdermal drug delivery. Int. J. Appl.
Ceram. Technol. 2007, 4, 22–29.
61. Haas, K.H.; Wolter, H. Synthesis, properties and applications of inorganic-organic copolymers
(ORMOCER R
s). Curr. Opin. Solid State Mater. Sci. 1999, 4, 571–580.
62. Comparative evaluation of residual monomer content and polymerization shrinkage of a packable composite
and an ormocer. J. Conserv. Dent. 2012, 15, 161, doi:10.4103/0972-0707.94592

44
Micromachines 2018, 9, 91

63. Webster, R.; Elliott, V.; Park, B.K.; Walker, D.; Hankin, M.; Taupin, P. PEG and PEG conjugates toxicity:
Towards an understanding of the toxicity of PEG and its relevance to PEGylated biologicals. In PEGylated
Protein Drugs: Basic Science and Clinical Applications; Veronese, F.M., Ed.; Birkhäuser: Basel, Switzerland, 2009;
pp. 127–146.
64. McAvoy, K.; Jones, D.; Thakur, R. Synthesis and Characterisation of Photocrosslinked poly(ethylene glycol)
diacrylate Implants for Sustained Ocular Drug Delivery. Pharm. Res. 2018, 35, doi:10.1007/s11095-017-2298-9.
65. Hahn, M.S.; Taite, L.J.; Moon, J.J.; Rowland, M.C.; Ruffino, K.A.; West, J.L. Photolithographic patterning of
polyethylene glycol hydrogels. Biomaterials 2006, 27, 2519–2524.
66. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Garcia-Cordero, J.L.; et al. 3D-printing of transparent bio-microfluidic
devices in PEG-DA. Lab Chip 2016, 16, 2287–2294.
67. Traore, M.A.; Behkam, B. A PEG-DA microfluidic device for chemotaxis studies. J. Micromech. Microeng.
2013, 23, doi:10.1088/0960-1317/23/8/085014.
68. Femmer, T.; Kuehne, A.J.C.; Wessling, M. Print your own membrane: Direct rapid prototyping of
polydimethylsiloxane. Lab Chip 2014, 14, 2610.
69. He, Y.; Qiu, J.; Fu, J.; Zhang, J.; Ren, Y.; Liu, A. Printing 3D microfluidic chips with a 3D sugar printer.
Microfluid. Nanofluid. 2015, 19, 447–456.
70. Safety Data Sheet: E-shell 600 Clear. Available online: https://envisiontec.com/wp-content/uploads/2016/
09/MSDS-EShell-600.pdf (accessed on 21 February 2018).
71. Autodesk-Inc. SAFETY DATA SHEET: Autodesk Resin: PR57-K-v.2 Black; Autodesk-Inc.: San Rafael, CA,
USA, 2016.
72. Dormer, W.; Gomes, R.; Meek, M. Concise International Chemical Assessment Document: Methyl methacrylate;
Technical Report; World Health Organization: Geneva, Switzerland, 1998.
73. BASF CORPORATION. Safety Data Sheet: METHYL ACRYLATE, version: 3; BASF CORPORATION:
Ludwigshafen, Germany, 2016.
74. SIGMA-ALDRICH. SAFETY DATA SHEET: Methyl Methacrylate, version 5.4; Sigma-Aldrich: St. Louis, MO,
USA, 2015.
75. SIGMA-ALDRICH. SAFETY DATA SHEET: Methyl Acrylate, version 3.9; Sigma-Aldrich: St. Louis, MO,
USA, 2015.
76. Allnex-USA. SAFETY DATA SHEET: Tripropyleneglycol Diacrylate, version 0021157; Allnex-USA: Alpharetta,
GA, USA, 2016.
77. SIGMA-ALDRICH. Safety Data Sheet: 2-Hydroxyethyl Methacrylate, version 4.9; Sigma-Aldrich: St. Louis, MO,
USA, 2015.
78. Safety Data Sheet: Accura 40. Available online: http://infocenter.3dsystems.com/materials/sites/
default/files/sds-files/production/sla/Accura_40/24022-s12-02-asds_ghsenglishaccura_40.pdf (accessed
on 21 February 2018).
79. PAGEL Spezial-Beton GmbH & Co. KG. Safety Data Sheet: EH130 A, version 2.21; PAGEL Spezial-Beton
GmbH & Co. KG: Essen, Germany, 2016.
80. Autodesk-Inc. SAFETY DATA SHEET: Autodesk PR57 CMYKW Resins; Autodesk-Inc.: San Rafael, CA,
USA, 2016.
81. SIGMA-ALDRICH. SAFETY DATA SHEET: Methacrylic Acid, version 4.7; Sigma-Aldrich: St. Louis, MO,
USA, 2014.
82. Liu, H.; He, C. Additive use in Photopolymer Resin for 3D Printing to Enhance the Appearance of Printed
Parts. U.S. Patent US9574039B1, 21 February 2017.
83. Sun, B.J.; Kennedy, C.R.; Sundar, V.; Lichkus, A.M. Three-Dimensional Fabricating Material Systems for
Producing Dental Products. U.S. Patent US20140131908A1, 15 May 2014.
84. Murphy, E.J.; Ansel, R.E.; Krajewski, J.J. Method of forming a three-dimensional object by stereolithography
and composition therefore, U.S. Patent US4942001A, 17 July 1990.
85. Ramos, M.J.; Harrison, J.P.; Coats, A.L.; Hay, J.S.; Harrison, J.P.; Hay, J.S.; Ramos, M.J. Stereolithography
Resins and Methods. U.S. Patent US7211368B2, 1 May 2007.
86. Steinkraus, W.J.; Woods, J.; Rooney, J.M.; Jacobine, A.F.; Glaser, D.M. Thiolene Compositions on Based
Bicyclic ’Ene Compounds. U.S. Patent US4808638A, 28 February 1989.

45
Micromachines 2018, 9, 91

87. Sun, F. Methods for Making Dental Restorations Using Two-Phase Light Curing Materials. U.S. Patent
US7939575B2, 10 May 2011.
88. Vanmaele, L.; Daems, E.; De Voeght, F.; Van Thillo, E. 3D-Inkjet Printing Methods. U.S. Patent US8142860B2,
27 March 2012.
89. EnvisionTEC. Safety Data Sheet: Photopolymer ABS Tough Series (Includes ABS Tough, ABS Tough M, ABS 3SP
Tough); EnvisionTEC: Gladbeck, Germany, 2015.
90. Short, D.B.; Volk, D.; Badger, P.D.; Melzer, J.; Salerno, P.; Sirinterlikci, A. 3D Printing (Rapid Prototyping)
Photopolymers: An Emerging Source of Antimony to the Environment. 3D Print. Addit. Manuf. 2014,
1, 24–33.
91. Geurtsen, W. Biocompatibility of resin-modified filling materials. Crit. Rev. Oral Biol. Med. 2000, 11, 333–355.
92. Azimi, P.; Zhao, D.; Pouzet, C.; Crain, N.E.; Stephens, B. Emissions of Ultrafine Particles and Volatile Organic
Compounds from Commercially Available Desktop Three-Dimensional Printers with Multiple Filaments.
Environ. Sci. Technol. 2016, 50, 1260–1268.
93. Zhu, F.; Macdonald, N.P.; Cooper, J.M.; Wlodkowic, D. Additive manufacturing of lab-on-a-chip devices:
Promises and challenges. SPIE—Int. Soc. Opt. Eng. 2013, 8923, doi:10.1117/12.2033400.
94. Yang, Y.; He, X.; Shi, J.; Hickel, R.; Reichl, F.X.; Högg, C. Effects of antioxidants on DNA double-strand
breaks in human gingival fibroblasts exposed to dental resin co-monomer epoxy metabolites. Dent. Mater.
2017, 33, 418–426.
95. De Souza Costa, C.A.; Do Nascimento, A.B.L.; Teixeira, H.M. Response of human pulps following acid
conditioning and application of a bonding agent in deep cavities. Dent. Mater. 2002, 18, 543–551.
96. SIGMA-ALDRICH. SAFETY DATA SHEET: Butylated Hydroxytoluene, version 5.2.; Sigma-Aldrich: St. Louis,
MO, USA, 2014.
97. SIGMA-ALDRICH. SAFETY DATA SHEET: 1-Bis(2,2,6,6-tetramethyl-4-piperidyl) Sebacate, version 4.4;
Sigma-Aldrich: St. Louis, MO, USA, 2015.
98. SIGMA-ALDRICH. SAFETY DATA SHEET: Hydroquinone, version 4.2; Sigma-Aldrich: St. Louis, MO,
USA, 2017.
99. Cebe, M.A.; Cebe, F.; Cengiz, M.F.; Cetin, A.R.; Arpag, O.F.; Ozturk, B. Elution of monomer from different
bulk fill dental composite resins. Dent. Mater. 2015, 31, e141–e149.
100. Yamaji, K.; Kawasaki, Y.; Yoshitome, K.; Matsunaga, H.; Sendo, T. Quantitation and Human Monocyte
Cytotoxicity of the Polymerization Agent 1-Hydroxycyclohexyl Phenyl Ketone (Irgacure 184) from Three
Brands of Aqueous Injection Solution. Biol. Pharm. Bull. 2012, 35, 1821–1825.
101. Ferracane, J.L.; Condon, J.R. Post-cure heat treatments for composites: Properties and fractography.
Dent. Mater. 1992, 8, 290–295.
102. Ogunyinka, A.; Palin, W.M.; Shortall, A.C.; Marquis, P.M. Photoinitiation chemistry affects light transmission
and degree of conversion of curing experimental dental resin composites. Dent. Mater. 2007, 23, 807–813.
103. Aparicio, J.L.; Elizalde, M. Migration of photoinitiators in food packaging: A review. Packag. Technol. Sci.
2015, 28, 181–203.
104. Schmalz, G.; Galler, K.M. Biocompatibility of biomaterials – Lessons learned and considerations for the
design of novel materials. Dent. Mater. 2017, 33, 382–393.
105. Anderson, W.A.; Castle, L. Benzophenone in cartonboard packaging materials and the factors that influence
its migration into food. Food Addit. Contam. 2003, 20, 607–618.
106. Nguyen, A.K.; Gittard, S.D.; Koroleva, A.; Schlie, S.; Gaidukeviciute, A.; Chichkov, B.N.; Narayan, R.J.
Two-photon polymerization of polyethylene glycol diacrylate scaffolds with riboflavin and triethanolamine
used as a water-soluble photoinitiator. Regen. Med. 2013, 8, 725–738.
107. Stohs, S.J. The role of free radicals in toxicity and disease. J. Basic Clin. Physiol. Pharmacol. 1995, 6, 205–228.
108. Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247.
109. Schweikl, H.; Petzel, C.; Bolay, C.; Hiller, K.A.; Buchalla, W.; Krifka, S. 2-Hydroxyethyl methacrylate-induced
apoptosis through the ATM- and p53-dependent intrinsic mitochondrial pathway. Biomaterials 2014,
35, 2890–2904.
110. Atsumi, T.; Murata, J.; Kamiyanagi, I.; Fujisawa, S.; Ueha, T. Cytotoxicity of photosensitizers camphorquinone
and 9-fluorenone with visible light irradiation on a human submandibular-duct cell line in vitro.
Arch. Oral Biol. 1998, 43, 73–81.

46
Micromachines 2018, 9, 91

111. Geurtsen, W. Substances released from dental resin composites and glass ionomer cements. Eur. J. Oral Sci.
1998, 106, 687–695.
112. Scholz, S.; Fischer, S.; Gündel, U.; Küster, E.; Luckenbach, T.; Voelker, D. The zebrafish embryo model in
environmental risk assessment—Applications beyond acute toxicity testing. Environ. Sci. Pollut. Res. 2008,
15, 394–404.
113. 3D Systems Inc. VisiJet SL Clear cleaning procedure for USP Class VI; Library Technology Reports; 3D Systems
Inc.: Rock Hill, SC, USA, 2013; pp. 1–2.
114. Hinton, T.J.; Hudson, A.; Pusch, K.; Lee, A.; Feinberg, A.W. 3D Printing PDMS Elastomer in a Hydrophilic
Support Bath via Freeform Reversible Embedding. ACS Biomater. Sci. Eng. 2016, 2, 1781–1786.
115. Gross, B.C.; Anderson, K.B.; Meisel, J.E.; McNitt, M.I.; Spence, D.M. Polymer Coatings in 3D-Printed Fluidic
Device Channels for Improved Cellular Adherence Prior to Electrical Lysis Bethany. Anal. Chem. 2015,
87, 6335–6341.
116. Abedin, F.; Ye, Q.; Camarda, K.; Spencer, P. Impact of light intensity on the polymerization kinetics and
network structure of model hydrophobic and hydrophilic methacrylate based dental adhesive resin. J. Biomed.
Mater. Res. B Appl. Biomater. 2016, 104, 139–148.
117. Emami, N.; Söderholm, K.J.M.; Berglund, L.A. Effect of light power density variations on bulk curing
properties of dental composites. J. Dent. 2003, 31, 189–196.
118. van den Driesche, S.; Lucklum, F.; Bunge, F.; Vellekoop, M. 3D Printing Solutions for Microfluidic
Chip-To-World Connections. Micromachines 2018, 9, 71.
119. Popov, V.K.; Evseev, A.V. Laser stereolithography and supercritical fluid processing for custom-designed
implant fabrication. J. Mater. Sci. Mater. Med. 2004, 15, 123–128.
120. Han, Y.; Wang, F.; Lim, C.; Chi, H.; Chen, D.; Wan, F. High-Performance Nano-Photoinitiators with Improved
Safety for 3D Printing. Appl. Mater. Interfaces 2017, 9, 32418–32423.
121. Versace, D.L.; Soppera, O.; Lalevée, J.; Croutxé-Barghorn, C. Influence of zirconium propoxide on the radical
induced photopolymerisation of hybrid sol–gel materials. New J. Chem. 2008, 32, 2270–2278.
122. Lee, D.S.; Kim, S.J.; Sohn, J.H.; Kim, I.G.; Kim, S.W.; Sohn, D.W.; Kim, J.H.; Choi, B. Biocompatibility of
a PDMS-coated micro-device: Bladder volume monitoring sensor. Chin. J. Polym. Sci. (Engl. Ed.) 2012,
30, 242–249.
123. Peterson, S.L.; McDonald, A.; Gourley, P.L.; Sasaki, D.Y. Poly(dimethylsiloxane) thin films as biocompatible
coatings for microfluidic devices: Cell culture and flow studies with glial cells. J. Biomed. Mater. Res—Part A
2005, 72, 10–18.
124. xia Zheng, G.; jie Li, Y.; lin Qi, L.; ming Liu, X.; Wang, H.; ping Yu, S.; hua Wang, Y. Marine phytoplankton
motility sensor integrated into a microfluidic chip for high-throughput pollutant toxicity assessment.
Mar. Pollut. Bull. 2014, 84, 147–154.
125. Kellens, K.; Baumers, M.; Gutowski, T.G.; Flanagan, W.; Lifset, R.; Duflou, J.R. Environmental Dimensions of
Additive Manufacturing: Mapping Application Domains and Their Environmental Implications. J. Ind. Ecol.
2017, 21, S49–S68.

c 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

47
micromachines

Article
Highly Fluorinated Methacrylates for Optical 3D
Printing of Microfluidic Devices
Frederik Kotz † , Patrick Risch † , Dorothea Helmer and Bastian E. Rapp *
Institute of Microstructure Technology, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1,
76344 Eggenstein-Leopoldshafen, Germany; [email protected] (F.K.); [email protected] (P.R.);
[email protected] (D.H.)
* Correspondence: [email protected]; Tel.: +49-721-608-28981
† Contributed equally to this work.

Received: 31 January 2018; Accepted: 7 March 2018; Published: 8 March 2018

Abstract: Highly fluorinated perfluoropolyether (PFPE) methacrylates are of great interest for
transparent and chemically resistant microfluidic chips. However, so far only a few examples of
material formulations for three-dimensional (3D) printing of these polymers have been demonstrated.
In this paper we show that microfluidic chips can be printed using these highly fluorinated polymers
by 3D stereolithography printing. We developed photocurable resin formulations that can be printed
in commercial benchtop stereolithography printers. We demonstrate that the developed formulations
can be printed with minimal cross-sectional area of 600 μm for monolithic embedded microfluidic
channels and 200 μm for open structures. The printed and polymerized PFPE methacrylates show a
good transmittance above 70% at wavelengths between 520–900 nm and a high chemical resistance
when being exposed to organic solvents. Microfluidic mixers were printed to demonstrate the great
variability of different designs that can be printed using stereolithography.

Keywords: 3D printing; perfluoropolyether; additive manufacturing; microfluidics; stereolithography

1. Introduction
Three-dimensional (3D) printing is of high interest for microfluidics due to the multitude of
channel systems that need to be tested in the course of lab-on-a-chip device development. With 3D
printing, prototypes and devices can be produced in a fast and effective manner. While many different
techniques exist for 3D printing of microfluidic devices [1–3], for example, fused deposition modeling
(FDM) [4], inkjet printing [5], two-photon printing [6], or stereolithography. While two-photon
printing has been used to fabricate optical submicron structures [7,8], stereolithography remains
the method of choice for most laboratories to fabricate microfluidic chips as it combines affordable
machinery with high resolution [9]. Microfluidics started out with chips made from silicon and
glass, but today polymers (thermosets, elastomers) are the preferred material class because polymer
processing and structuring is considerably easier when compared to glass and silicon. One of
the main perspectives of microfluidics is automation and miniaturization in biological as well as
in chemical devices. While alternative materials, such as glass [10,11], are extremely chemically
resistant, polymers are still the preferred choice for rapid fabrication as they do not require
specialized fabrication equipment [12,13]. However, most polymers that are used for printing
and fabrication of microfluidic chips are not stable when exposed to even low concentrations of
chemicals, especially organic solvents. This is why there has been increasing interest in recent years
in developing resistant materials, which could pave the way to simple fabrication techniques of
solvent-resistant microfluidic chips. Concerning durability and chemical resistance, fluoropolymers
stand out specifically. Fluorination affords the lowest known surface energies: the difluoromethylene
(-CF2 -) group, the difluoromethyl group (-CF2 H), and the trifluoromethyl group (-CF3 ) possess surface

Micromachines 2018, 9, 115; doi:10.3390/mi9030115 48 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 115

energies of ~18 mN/m, ~15 mN/m, and ~6 mN/m, respectively [14]. For comparison, methyl groups
(-CH3 ) have surface energies of ~23 mN/m [14]. In addition, the carbon/fluorine bond is the shortest
bond in organic chemistry which makes fluorinated polymers outstandingly stable also in direct contact
with organic solvents. There is a high interest in using fluoropolymers for microfluidic chips, and many
applications have been reported. Commercial fluorinated thermoplasts such as Viton and Dyneon
can be structured by hot embossing [15,16], or selectively bonded to parts of the chip that require
chemical stability [17]. Commercially available perfluoropolyether (PFPE) polymers, like SIFEL, have
been used for chip fabrication via, e.g., casting [18] or spin-coating [19]. Another strategy is to employ
chemical vapor deposition techniques to deposit fluoropolymer films on microfluidic devices [20].
Photolithographic direct structuring of highly fluorinated polymers has been first reported using
PFPE acrylates [21], which are now widely used for the fabrication of microfluidic devices [22,23].
Despite the interesting features of fluoropolymers, few attempts have been reported to structure
fluoropolymers via 3D printing or for the fabrication of microfluidic devices. Recently, a method to
fabricate pillar arrays (100 μm diameter, 400 μm height, 50 μm layer thickness, 150–200 μm spacing)
by printing a custom-synthesized PFPE tetraacrylate was reported [24]. Here, we present a simple
method for 3D printing of PFPE dimethacrylates for the fabrication of microfluidic devices. To the
best of our knowledge, this is the first technique for 3D printing of microfluidic chips in highly
fluorinated polymers.

2. Materials and Methods


Materials: All of the chemicals were used as received and were not purified any further. PFPE
Fluorolink MD700 was purchased from Acota, Shrewsbury, UK. Acetone, 2-propanol, methanol
(MeOH), dichloromethane (DCM), dimethylformamide (DMF), tetrahydrofuran (THF), toluene,
and n-heptane were purchased from Merck, Darmstadt, Germany. Diphenyl(2,4,6-trimethylbenzoyl)
phosphine oxide (TPO), phenylbis(2,4,6-trimethylbenzoyl)phosphine oxide (PPO) was purchased
from Sigma Aldrich, Taufkirchen, Germany. Tinuvin 384-2 (T384-2) and Tinuvin 326 (T326) were
kindly provided by BASF, Ludwigshafen, Germany. Sudan Orange G (SOG) was purchased from
Sigma Aldrich. Elastosil RT 601 A/B was purchased from Wacker, Munich, Germany. Formlabs Tough
was purchased from Formlabs, Somerville, MA, USA. The microfluidic channels were filled with a
black, blue, and yellow printing ink that was purchased from ESM online, Hirschberg, Germany.
Stereolithography: The benchtop stereolithography printer Asiga Pico 2 was used for printing,
postcuring of the printed parts was done with the ultraviolet radiation lamp Asiga Flash DR-301C
(both Asiga, Alexandria, Australia). Single layer thickness was 50 μm and an overcuring of 125 μm was
adjusted to avoid delamination of the individual layers during the printing process. Single layer
thickness of 50 μm was chosen for giving good printing results at adequate printing speeds.
The overcure of 125 μm was necessary to prevent the parts from delaminating during printing.
Overcuring does not cause the channel structures to be blocked because the Asiga Slicing Software
compensates for the overcuring when void or free hanging structures are printed. Compensation
is achieved by the so-called z-compensation, which adds the overcure thickness to the size of the
channel void (see Supplementary Figure S1 for details). The spectrum of the blue LED was measured
using a BTC112E Fibre Coupled TE Cooled Linear CCD array spectrometer (B&W Tek, Newark,
DE, USA). UV-Vis measurements were performed on an Evolution 201 UV-Vis spectrophotometer
(Thermo Fisher, Waltham, MA, USA). Quartz Suprasil high precision cells were purchased from Hellma,
Müllheim, Germany. HybriWell chambers were purchased from Grace Bio-Labs, Bend, OR, USA. Layer
thicknesses were measured using a MT 60 M length gauge (Heidenhain, Traunreut, Germany). A Stemi
508 microscope (Zeiss, Oberkochen, Germany) with an AxioCam ERc 5s was used for microscopy.
LED spectrum measurements: The spectrum of the blue LED of the Asiga Pico 2 was measured using
a BTC112E spectrometer. A background spectrum of the surrounding area was recorded, then the
printer LED light was switched on and the spectrometer was held above the optical setup, which
was close to the printing focus of the (removed) build tray. Spectra were recorded with the BWSpec

49
Micromachines 2018, 9, 115

software (version 4.03_23_C, B&W Tek, Newark, DE, USA). Spectra have been normalized to the
maximum value.
UV-Vis measurements: Initiators were weighed into microcentrifuge tubes, dissolved in acetone
and diluted to a concentration of 12.5 mg/mL. The solutions were transferred to a quartz glass Suprasil
high precision cell and measured in an UV-Vis spectrophotometer against a blank measurement of pure
acetone. Absorbers were weighed in microcentrifuge tubes, dissolved in acetone, and were diluted to a
concentration of 3.76 mg/mL. The SOG solution was further diluted to a concentration of 0.12 mg/mL.
Preparation of printing mixtures: Stock solutions of the initiator TPO or PPO and acetone were
prepared in a vortex mixer of type Reax Top (Heidolph, Schwabach, Germany). The required amount
of absorber SOG, T326, or T384-2 was added in a glass vial and the initiator/acetone stock solution was
added up to their respective concentrations. After mixing with the vortex mixer, the PFPE Fluorolink
MD700 was added to this solution up to the final concentrations listed in Table 1. After agitating the
glass vial, entrapped air bubbles in the solution where removed by using an ultrasonic bath Sonorex
Da 300 (Bandelin electronic, Berlin, Germany) for 2 min at 25 ◦ C.

Table 1. Composition of printing formulations mix 1–5.

Mix 1 Mix 2 Mix 3 Mix 4 Mix 5


Initiator (mg/mL) 1 6.25 TPO 9 PPO 6.25 TPO 6.25 TPO 9 PPO
Absorber (mg/mL) 1 1.88 T326 10 T384-2 0.235 SOG - 0.5 T326
1 Final concentration in MD700.

Preparation of poly(dimethylsiloxane) (PDMS): Elastosil RT 601 A and B were mixed in a ratio of


9:1 wt %. Entrapped air bubbles were removed using a desiccator and a vacuum pump. The material
was polymerized at a temperature of 70 ◦ C for 30 min.
Determination of optimal printing parameters: To determine the layer thicknesses in dependence of
the exposure time under the LED of the printer, the printing mixtures were pipetted into a rectangular
cutout of a PDMS form to a height of 2 mm and were placed above a circular light spot of the printer
with a diameter of approximately 3 mm and were exposed to the light for time periods between 4 s
and 20 s. The polymer layer thicknesses were measured at three different spots using a length gauge.
The results were plotted and analyzed for the slope of the resulting plots. The light intensity was set to
8.8 mW·cm−2 .
Solvent compatibility: Solvent compatibility of the printed PFPE material was determined using
8 mm × 8 mm × 3 mm printed blocks of mix 3 and 5. The blocks were weighted three times
and consecutively immersed in eight solvents (water, MeOH, DCM, DMF, THF, toluene, acetone,
and n-heptane—approximately 5 mL each) for 24 h. The blocks were retrieved from the solvents,
the solvent on the outside was quickly dabbed away and the blocks were immediately placed on
the balance and the initial weight was recorded. The block was then re-immersed in the solvent and
after weighting of the next eight blocks, the block was measured again. In this way, the weight was
determined a total of three times.
Contact angle measurement: Contact angles were measured with an OCA15 Pro (Data Physics,
San Jose, CA, USA). Static contact angles were measured using 5 μL water droplets. The surface energy
was calculated using the Owens, Wendt, Rabel, and Kaelble (OWRK) method. 5 μL of diiodomethan
and water were used as the nonpolar and polar testing liquid, respectively.

3. Results and Discussion


Several printing mixtures were used to produce PFPE microfluidic devices. To determine the
optimum mixture, spectra of initiators and absorbers were recorded, mixtures were prepared and
the optimum printing parameters were tested. Microfluidic devices were printed and tested for their
performance. The solvent compatibility and the spectra of the printed materials were characterized.

50
Micromachines 2018, 9, 115

3.1. UV-Vis Spectra of Initiators and Absorbers


In order to obtain embedded microchannels with a height of less than 1 mm, a printing formulation
requires an effective initiator and a significant amount of absorber, thus ensuring that the light does
not penetrate too deep into the material which would lead to undesired polymerization in layers
below the lowermost layer facing the light source. The absorber must cover the whole spectral
range of the light source. The UV LED of the Asiga Pico 2 emits light at 370–430 nm (see Figure 1).
Two phosphine based initiators, PPO and TPO were tested for their absorption properties. At the
relevant concentrations for 3D printing, PPO effectively absorbs light between 325–465 nm, while TPO
shows a less broad absorption spectrum between 325 nm–415 nm (see Figure 1a). Both initiators absorb
within the spectrum of the UV LED of the Asiga Pico 2 printer and were suitable for the printing
process. Three absorbers, T326, T384-2, and SOG were tested for their absorption properties (Figure 1b).
The absorption spectrum of T326 is well suited for printing with the UV light source, but the powder
could only be mixed at a significant amount with MD700 if dissolved in acetone first (mix 1). However,
this renders the printing formulation unstable for storage due to the volatility of acetone. T384-2 could
also only be mixed with MD700 if being dissolved in acetone first and additionally didn’t cover the
whole range of the UV LED. SOG is a very effective absorber at wavelengths between 325 nm and
560 nm. In addition, it was readily dissolvable in MD700 and the formulation was stable for storage.

Figure 1. Absorption spectra of initiators and absorbers tested in comparison to the spectrum
emitted by the UV LED of the Asiga Pico 2 printer (three-dimensional (3D) printer LED):
(a) Absorption spectrum of the initiators phenylbis(2,4,6-trimethylbenzoyl)phosphine oxide (PPO)
and Diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide (TPO). TPO (325–415 nm) shows a less broad
absorption spectrum than PPO (325–465 nm); (b) Absorption spectra of the absorbers tested: Tinuvin
326 (T326), Tinuvin 384-2 (T384-2), and Sudan Orange G (SOG).

3.2. Optimum Printing Parameters


The aim of this work was to print microfluidic channels with a layer thickness of 50 μm. To prevent
the layers from delaminating during the printing process, an additional overcuring of 125 μm was
required. The printing parameters for the different mixtures were optimized by analyzing the
measured polymerization thickness in dependence of the exposure time (see Figure 2). The optimum
printing curve should have a small slope (when plotted on a lin-log semi-logarithmic graph) to
achieve most accurate printing results, but should allow for the printing of layers with a thickness
of 175 μm (50 + 125 μm) within reasonable time [25]. The SOG absorber shows an optimum slope for
a concentration of 0.235 mg SOG per mL of MD700, which affords a total layer thickness of 175 μm
after an exposure time of 11.250 s (see Figure 2a). The T326 formulations (Figure 2b) show this
optimum slope for 1.88 mg T326 per mL of MD700 (9.5 s for 175 μm layer thickness) and the T384-2
formulations at 10 mg T384-2 per mL of MD700 (6.5 s for 175 μm thickness, Figure 2c). As discussed

51
Micromachines 2018, 9, 115

above, these high amounts of absorbers (both T326 and T384-2) were not readily soluble in the final
formulations and thus required acetone as a solvent, thereby impairing storage stability due to the
volatility of acetone. Additionally, these mixtures led to a decrease of the optical transparency of the
printed parts (see characterization in Section 3.5). Therefore, SOG was chosen as suitable absorber
due to the fact that low concentrations are sufficient to obtain adequate light absorption and high
transparency of the final parts. In the course of this work, mix 3 with an SOG concentration of 0.235 mg
per mL of MD700 was used for printing the embedded microfluidic channels.

Figure 2. Layer thickness of printing formulations as a function of the exposure time.


The polymerization curve flattens with increasing absorber concentration (final absorber concentration
in MD700). Layer thickness as a function of the exposure time for different SOG (a), T326 (b), and T384-2
(c) concentrations.

3.3. Printing Embedded Microfluidic Chips


Two exemplary microfluidic gradient generators were printed with the formulation using SOG
as absorber (mix 3, see Table 1). The chips were printed with a channel width and height of 800 μm
and 600 μm, respectively, with a single layer thickness of 50 μm (Figure 3a–d). After printing,
the microfluidic chips were washed out with 2-propanol in an ultrasonic bath for 15 min at a
temperature of 45 ◦ C. Afterwards, the printed parts were postcured for 15 min. The microfluidic chips
were filled with black ink to highlight the 3D channel networks.

Figure 3. 3D printed perfluoropolyether (PFPE) microfluidic chips: (a) Front view of a gradient
generator with a channel width and height of 800 μm, filled with black printing ink (scale bar: 2 mm);
(b) Photomicrograph of the 800 μm gradient generator (scale bar: 500 μm); (c) Isometric view of the
600 μm gradient generator, filled with black printing ink (scale bar: 2 mm); and, (d) Photomicrograph
of the 600 μm gradient generator (scale bar: 500 μm).

In Figure 4, the microfluidic gradient generator with a channel width and height of 800 μm was
filled with a blue printing ink at the upper entrance and a yellow printing ink at the lower entrance

52
Micromachines 2018, 9, 115

to demonstrate the gradient generation along the mixer cascade. See Supplementary Information in
Figure S2 for image analysis of the RGB red channel pixel brightness evaluation.

Figure 4. Gradient generation in a 3D printed PFPE microfluidic chip with a channel height and width
of 800 μm. The upper entrance is filled with a yellow ink, the lower entrance is filled with a blue ink
(scale bar: 2 mm).

3.4. Characterization of Printed Microfluidic Channels


We measured the channel height and width of the printed channel to characterize the homogeneity
of the printed microfluidic chips. The channel height and width were measured on printed channels
with a length of 24 mm at five different spots (see Figure 5a). The highest reduction of the channel
height was measured in the middle of the channels at 12 mm from the inlet. For the 1000 μm and
the 800 μm channel, a reduction of 20.3% and 21.5% of the theoretical channel height was measured
at 12 mm from the inlet. The highest reduction of the channel height was measured for the 600 μm
channel, with a reduction of 57.2%. The cross sections of the 800 μm and the 600 μm channel at the
inlet and for the middle spot are shown in Figure 5b–e.

Figure 5. Characterization of the channel height of the printed PFPE methacrylates: (a) Height
of a printed rectangular PFPE methacrylate channel for different spots from the inlet to the outlet.
Channel heights decrease with distance from the inlet/outlet; (b) Lateral view of the 800 μm channel at
the inlet, channel width of 800 μm, height of 692 μm (scale bar: 250 μm); (c) Cross section of the 800 μm
channel in the middle, channel width of 800 μm, height of 628 μm (scale bar: 250 μm); (d) Lateral view
of the 600 μm channel at the inlet, channel width of 600 μm, height of 500 μm (scale bar: 250 μm);
and, (e) Cross section of the 600 μm channel in the middle, channel width of 600 μm, height of 257 μm
(scale bar: 250 μm).

The minimum channel dimensions of 600 μm that could be printed with the developed MD700
formulations are comparable to minimum channel sizes of around 500 μm, which have been
described in literature for printing microfluidic chips using benchtop stereolithography printers [26].

53
Micromachines 2018, 9, 115

The minimum channel dimensions in this work were mainly limited by the high viscosity (850 mPas,
according to the manufacturer’s information) of the commercially available PFPE methacrylate MD700.
These highly viscous resins are difficult to fully wash out of the printed microfluidic chips especially
for long channels. Developing resin formulations with lower viscosities by using fluorinated acrylates
with lower molecular weight and lower viscosity could help in solving this problem. Adding an
appropriate solvent, like 1-butanol, to the resin formulation [27] could be another strategy to reduce
the viscosity of the resin formulation with the additional advantage that the shrinkage of the material
during solvent evaporation could further reduce the minimum channel dimensions.
The formulation for printing open-channel structures or replication masters (mix 4) was identical
to mix 3 for printing embedded microfluidic chips with the sole exception that no absorber was
required. Rectangular open channels with a height and width from 500 μm to 200 μm were printed.
As can be seen in Figure 6a, the channels show a high uniformity of the width along the channel
length. The width was measured at three different spots: The 500 μm channel possesses a width of
499 ± 14 μm, the 400 μm channel a width of 413 ± 14 μm, the 300 μm channel a width of 300 ± 13 μm,
and the 200 μm channel a width of 205 ± 22 μm. Figure 6b shows the cross section of the printed
open channels and demonstrates the high accuracy of the printed channel height. The 500 μm channel
possess a height of 491 ± 6 μm, the 400 μm channel a height of 403 ± 8 μm, the 300 μm channel a
height of 307 ± 6 μm, and the 200 μm channel a height of 209 ± 7 μm. Figure 6c,d shows an exemplary
printed PFPE methacrylate structure with a 500 μm chess board structure.

Figure 6. PFPE-printed open channels with a height and width of 500 μm, 400 μm, 300 μm, 200 μm
and an exemplary printed PFPE chessboard structure: (a) The top view of the open channels shows a
high conformity of the channel width (scale bar: 500 μm); (b) The lateral view shows the accordance of
the channel heights with the set values. The inset shows the cross section of the 500 μm channel with a
channel height of approximately 491 μm (scale bars: 500 μm); (c) Exemplary printed PFPE methacrylate
chessboard structure (scale bar: 2 mm); and, (d) Microscope image of the chessboard from (c) (scale bar:
500 μm).

3.5. Characterization of Printed PFPE Methacrylates


Solvent compatibility of printed PFPE methacrylates of mix 3 and 5 were tested and compared to
replicated PDMS components and the printed commercial stereolithography resin Formlabs Tough.
Therefore, blocks (8 × 8 × 3 mm3 ) were immersed in the following solvents: water, MeOH, DCM,
DMF, THF, toluene, acetone, and n-heptane. As can be seen in Figure 7, the printed PFPE methacrylates

54
Micromachines 2018, 9, 115

show a higher solvent compatibility than the printed commercial resin and the replicated PDMS blocks.
The printed PFPE methacryates show a maximum swelling of around 14% in THF and 11% in DCM.
In comparison, PDMS showed a swelling of 146% in THF and 175% in DCM. The printed Formlabs
Tough parts showed the highest swelling of around 78% in DCM and 76% in DMF. However, the
printed Formlabs Tough parts that were immersed in DCM, DMF, THF, and acetone were strongly
damaged by the solvents (see Figure 7b,c). We further tested if the used absorbers and initiators affect
the chemical resistance of the printed PFPE methacrylates. For this we compared blocks made from
mix 5 (initiator: PPO, absorber: T326) and from mix 3 (initiator: TPO, absorber: SOG). As can be seen
from Figure 7, the printed polymers from both mixtures show a similar swelling, suggesting that
the absorbers and initiators do not have major impacts on the swelling of the printed PFPE parts.
We also determined the surface energies of the printed PFPE methacrylates, which were measured at
19.5 ± 0.5 mN/m. Given this relatively low value, the printed PFPE methacrylates showed a high water
contact angle of 107 ± 0.8◦ , which is comparable to the values described in literature [21]. Although
the contact angle for water on MD700 is relatively high, at 107◦ the capillary pressure (calculated using
Laplace-Young equation [28]) is around −1.4 mbar for a printed channel with a circular cross-section
of 600 μm. Therefore, the channels do not oppose microfluidic flow in a significant manner.

Figure 7. Solvent compatibility of printed PFPE methacrylates compared to poly(dimethylsiloxane)


(PDMS) and the printed commercial stereolithography resin Formlabs Tough: (a) Rectangular
8 × 8 × 3 mm3 blocks were immersed in eight different solvents and the weight increase was measured
after 24 h. The PFPE blocks show a lower weight increase than the PDMS blocks and the Formlabs
Tough resin, which were immersed in the solvents dichloromethane (DCM), tetrahydrofuran (THF),
toluene, acetone, and n-heptane. Mix 5 (initiator: PPO, absorber: T326) and mix 3 (initiator: TPO,
absorber: SOG) show a similar swelling, which demonstrates that the absorbers and initiators have
no major impact on the swelling of the printed PFPE parts; (b) Polymerized Formlabs Tough resin
after immersion in the respective solvents for 24 h. The parts were strongly damaged by DCM,
dimethylformamide (DMF), THF, and acetone; (c) Photograph of a Formlabs Tough block (left) and a
PFPE methacrylate block (mix 3, middle) and PDMS (right) after 24 h immersion in THF.

We further characterized the transmittance of the printed PFPE methacrylates using UV-Vis
spectroscopy. The transmittance of the printed PFPE methacrylates was further compared to
polymerized PDMS parts. The transmission spectra of polymerized PFPE sheets with a thickness
of 250 μm are shown in Figure 8a. Mix 1 with the absorber T326 shows a transparency above 30%
between 400–900 nm, mix 2 (T384-2) a transparency above 35% between 400–900 nm. Mix 3 (SOG)
shows a transmittance of over 70% between 520–900 nm. Mix 4 without any absorber shows the highest
transparency above 75% between 350–900 nm. Mix 1 and mix 3 show a peak at about 330 nm and
280 nm in the UV-range, which is most likely an artefact from the photoinitiator TPO. Figure 8b shows
two blocks printed from mix 1 and 2 and a microfluidic mixer that is printed from mix 3 (from left to

55
Micromachines 2018, 9, 115

right, thickness: 3.5 mm) placed on top of the logo of our lab (NeptunLab, Eggenstein-Leopoldshafen,
Germany) showing the varying transparencies of the printed PFPE parts. As mentioned above, the high
concentration of T326 and T384-2 required for printing microfluidic channels below 1 mm is not readily
soluble in the formulation and required a prior dissolving in acetone. Consequently, a decrease of the
transparency of the printed PFPE methacrylates was observed. SOG, which possesses a high light
absorption at low concentrations, is readily soluble in the mixture and the printed parts have a higher
optical clarity.

Figure 8. UV-Vis spectroscopy of PDMS and the printed PFPE methacrylates from mix 1, 2, 3 and
4 show different transparencies between 190–900 nm: (a) Transmission spectra of polymerized PDMS
and PFPE methacrylates from mixtures 1, 2, 3 and 4 (thickness: 250 μm). Mix 1 shows a transparency
of about 30% between 400–900 nm, mix 2 a transparency above 35% between 400–900 nm and mix 3
has a transmission above 70% between 520–900 nm. Mix 4 has a transparency of over 75% between
350–900 nm. Peaks at 330 and 280 nm are measured for the formulations prepared with TPO as
photoinitiator. For comparison the UV-Vis spectrum of PDMS is shown; (b) Three microfluidic chips
printed from mixtures 1, 2, and 3 (from left to right) show different transparencies as a function of the
used absorber (scale bar: 4 mm).

4. Conclusions
In this work, we have demonstrated a new method to fabricate microfluidic chips in highly
fluorinated PFPE methacrylates using stereolithography 3D printing. We have developed material
formulations that can be printed in commercial stereolithography printers. We have shown that
by adjusting the amount of initiator and absorber transparent microfluidic chips can be printed.
The printed chips show high chemical resistance in the tested organic solvents. We believe that
printing highly fluorinated PFPE methacrylates will find numerous applications from chemical resistant
microfluidic valves to chemistry-on-chip applications.

Supplementary Materials: The following materials are available online at http://www.mdpi.com/2072-666X/9/


3/115/s1, Figure S1: Overcuring and z-compensation of the Asiga Pico 2 printer: (a) Initial CAD file; (b) Slicing of
the CAD file without the overcuring effect. The sliced CAD file has the same dimension like the initial CAD file;
(c) Overcuring (l+o) is needed to prevent the slices from delamination during the printing process; (d) During the
slicing process the overcuring is taken into account by the so called z-compensation. The shown sliced channel
structure is higher than the initial CAD file; (e) The difference is polymerized by the overcuring during the
printing process. The printed channel has the height of the initial CAD file. Figure S2: Determination of the color
intensity in a PFPE-printed microfluidic channel (800 μm channel height and width) at different mixing positions:
(a) The color intensity ((red+green+blue)/3) at different measurement spots shows the gradient generation in the
microfluidic chip; (b) Greyscale image of the microfluidic chip showing the position of the measurement spots.
Acknowledgments: This work was funded by the German Ministry of Education and Research (BMBF), funding
code 03X5527 “Fluoropor”.

56
Micromachines 2018, 9, 115

Author Contributions: F.K. printing experiments and formulations, P.R. printing experiments and formulations,
D.H. UV-Vis measurements and writing of the paper, B.E.R. concept idea and writing of the paper.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
2. Bhattacharjee, N.; Urrios, A.; Kanga, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742. [CrossRef] [PubMed]
3. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-printed microfluidics. Angew. Chem. Int. Ed. 2016, 55,
3862–3881. [CrossRef] [PubMed]
4. Tsuda, S.; Jaffery, H.; Doran, D.; Hezwani, M.; Robbins, P.J.; Yoshida, M.; Cronin, L. Customizable 3D printed
‘plug and play’ millifluidic devices for programmable fluidics. PLoS ONE 2015, 10, e0141640. [CrossRef]
[PubMed]
5. Su, W.J.; Cook, B.S.; Fang, Y.N.; Tentzeris, M.M. Fully inkjet-printed microfluidics: A solution to low-cost
rapid three-dimensional microfluidics fabrication with numerous electrical and sensing applications. Sci. Rep.
2016, 6. [CrossRef] [PubMed]
6. Ho, C.M.B.; Ng, S.H.; Li, K.H.H.; Yoon, Y.-J. 3D printed microfluidics for biological applications. Lab Chip
2015, 15, 3627–3637. [CrossRef] [PubMed]
7. Malinauskas, M.; Žukauskas, A.; Hasegawa, S.; Hayasaki, Y.; Mizeikis, V.; Buividas, R.; Juodkazis, S. Ultrafast
laser processing of materials: From science to industry. Light Sci. Appl. 2016, 5, e16133. [CrossRef]
8. Jonušauskas, L.; Gailevičius, D.; Mikoliūnaitė, L.; Sakalauskas, D.; Šakirzanovas, S.; Juodkazis, S.;
Malinauskas, M. Optically clear and resilient free-form μ-optics 3D-printed via ultrafast laser lithography.
Materials 2017, 10, 12. [CrossRef] [PubMed]
9. Gong, H.; Bickham, B.P.; Woolley, A.T.; Nordin, G.P. Custom 3D printer and resin for 18 μm × 20 μm
microfluidic flow channels. Lab Chip 2017, 17, 2899–2909. [CrossRef] [PubMed]
10. Kotz, F.; Plewa, K.; Bauer, W.; Schneider, N.; Keller, N.; Nargang, T.; Helmer, D.; Sachsenheimer, K.;
Schafer, M.; Worgull, M.; et al. Liquid glass: A facile soft replication method for structuring glass. Adv. Mater.
2016, 28, 4646–4650. [CrossRef] [PubMed]
11. Kotz, F.; Arnold, K.; Bauer, W.; Schild, D.; Keller, N.; Sachsenheimer, K.; Nargang, T.M.; Richter, C.; Helmer, D.;
Rapp, B.E. Three-dimensional printing of transparent fused silica glass. Nature 2017, 544, 337–339. [CrossRef]
[PubMed]
12. De Mello, A. Focus: Plastic fantastic? Lab Chip 2002, 2, 31N–36N. [CrossRef] [PubMed]
13. Kotz, F.; Arnold, K.; Wagner, S.; Bauer, W.; Keller, N.; Nargang, T.M.; Helmer, D.; Rapp, B.E. Liquid PMMA:
A high resolution polymethylmethacrylate negative photoresist as enabling material for direct printing of
microfluidic chips. Adv. Eng. Mater. 2017. [CrossRef]
14. Jarvis, N.L.; Zisman, W.A. Surface Chemistry of Fluorochemicals; Report of NRL Progress; U.S. Naval Research
Laboratory (NRL): Washington, DC, USA, 1965.
15. Begolo, S.; Colas, G.; Viovy, J.L.; Malaquin, L. New family of fluorinated polymer chips for droplet and
organic solvent microfluidics. Lab Chip 2011, 11, 508–512. [CrossRef] [PubMed]
16. Sharma, G.; Klintberg, L.; Hjort, K. Viton-based fluoroelastomer microfluidics. J. Micromech. Microeng. 2011,
21. [CrossRef]
17. Ogilvie, I.R.G.; Sieben, V.J.; Cortese, B.; Mowlem, M.C.; Morgan, H. Chemically resistant microfluidic valves
from viton® membranes bonded to COC and PMMA. Lab Chip 2011, 11, 2455–2459. [CrossRef] [PubMed]
18. Goyal, S.; Desai, A.V.; Lewis, R.W.; Ranganathan, D.R.; Li, H.R.; Zeng, D.X.; Reichert, D.E.; Kenis, P.J.A.
Thiolene and SIFEL-based microfluidic platforms for liquid-liquid extraction. Sen. Actuators B Chem. 2014,
190, 634–644. [CrossRef] [PubMed]
19. Renckens, T.J.A.; Janeliunas, D.; van Vliet, H.; van Esch, J.H.; Mul, G.; Kreutzer, M.T. Micromolding of
solvent resistant microfluidic devices. Lab Chip 2011, 11, 2035–2038. [CrossRef] [PubMed]
20. Riche, C.T.; Zhang, C.C.; Gupta, M.; Malmstadt, N. Fluoropolymer surface coatings to control droplets in
microfluidic devices. Lab Chip 2014, 14, 1834–1841. [CrossRef] [PubMed]

57
Micromachines 2018, 9, 115

21. Rolland, J.P.; Van Dam, R.M.; Schorzman, D.A.; Quake, S.R.; DeSimone, J.M. Solvent-resistant photocurable
“liquid teflon” for microfluidic device fabrication. J. Am. Chem. Soc. 2004, 126, 2322–2323. [CrossRef]
[PubMed]
22. Vitale, A.; Quaglio, M.; Marasso, S.L.; Chiodoni, A.; Cocuzza, M.; Bongiovanni, R. Direct photolithography
of perfluoropolyethers for solvent-resistant microfluidics. Langmuir 2013, 29, 15711–15718. [CrossRef]
[PubMed]
23. De Marco, C.; Gaidukeviciute, A.; Kiyan, R.; Eaton, S.M.; Levi, M.; Osellame, R.; Chichkov, B.N.; Turri, S. A
new perfluoropolyether-based hydrophobic and chemically resistant photoresist structured by two-photon
polymerization. Langmuir 2013, 29, 426–431. [CrossRef] [PubMed]
24. Credi, C.; Levi, M.; Turri, S.; Simeone, G. Stereolithography of perfluoropolyethers for the microfabrication
of robust omniphobic surfaces. Appl. Surf. Sci. 2017, 404, 268–275. [CrossRef]
25. Melchels, F.P.W.; Feijen, J.; Grijpma, D.W. A review on stereolithography and its applications in biomedical
engineering. Biomaterials 2010, 31, 6121–6130. [CrossRef] [PubMed]
26. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Garcia-Cordero, J.L. 3D-printing of transparent bio-microfluidic devices
in peg-da. Lab Chip 2016, 16, 2287–2294. [CrossRef] [PubMed]
27. Ligon, S.C.; Liska, R.; Stampfl, J.; Gurr, M.; Mülhaupt, R. Polymers for 3D printing and customized additive
manufacturing. Chem. Rev. 2017, 117, 10212–10290. [CrossRef] [PubMed]
28. Rapp, B.E. Microfluidics: Modeling, Mechanics and Mathematics; William Andrew: Norwich, NY, USA, 2016.

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

58
micromachines

Technical Note
Characterization of 3D-Printed Moulds for Soft
Lithography of Millifluidic Devices
Nurul Mohd Fuad 1 , Megan Carve 1 , Jan Kaslin 2 and Donald Wlodkowic 1,3, *
1 School of Science, RMIT University, Melbourne, VIC 3083, Australia; [email protected] (N.M.F.);
[email protected] (M.C.)
2 Australian Regenerative Medicine Institute, Monash University, Clayton, VIC 3800, Australia;
[email protected]
3 Centre for Additive Manufacturing, School of Engineering, RMIT University, Melbourne, VIC 3083, Australia
* Correspondence: [email protected]; Tel.: +61-3-9925-7157

Received: 2 February 2018; Accepted: 7 March 2018; Published: 8 March 2018

Abstract: Increased demand for inexpensive and rapid prototyping methods for micro- and
millifluidic lab-on-a-chip (LOC) devices has stimulated considerable interest in alternative
cost-effective fabrication techniques. Additive manufacturing (AM)—also called three-dimensional
(3D) printing—provides an attractive alternative to conventional fabrication techniques. AM has been
used to produce LOC master moulds from which positive replicas are made using soft-lithography
and a biocompatible elastomer, poly(dimethylsiloxane) (PDMS). Here we characterize moulds made
using two AM methods—stereolithography (SLA) and material-jetting (MJ)—and the positive replicas
produced by soft lithography and PDMS moulding. The results showed that SLA, more than MJ,
produced finer part resolution and finer tuning of feature geometry. Furthermore, as assessed by
zebrafish (Danio rerio) biotoxicity tests, there was no toxicity observed in SLA and MJ moulded PDMS
replicas. We conclude that SLA, utilizing commercially available printers and resins, combined with
PDMS soft-lithography, is a simple and easily accessible technique that lends its self particularly well
to the fabrication of biocompatible millifluidic devices, highly suited to the in-situ analysis of small
model organisms.

Keywords: stereolithography; material jetting; soft lithography; Lab-on-a-Chip; millifluidic; biodevices;


biotests; polydimethylsiloxane

1. Introduction
Lab-on-a-chip (LOC) devices permit the manipulation of extremely small volumes of fluids and
regents within networks of miniaturized channels, and are being readily adopted in the fields of
biomedical and ecological testing [1–7]. Consequently, interest in the development of superior rapid
and inexpensive prototyping and fabrication techniques has increased.
Traditionally, LOC devices have been prototyped and produced by methods such as laser cutting,
micro milling, or soft lithography [5,8,9]. However, these techniques often require multiple stages of
assembly, a high degree of technical expertise, and the use of clean room facilities. In the case of laser
cutting, low resolution and heat-related substratum deformations may occur.
Additive manufacturing (AM) techniques such as stereolithography (SLA) and material jetting
(MJ) provide an elegant and practical alternative LOC fabrication method [2–4,10]. By using
computer-assisted design (CAD), SLA and MJ produce a solid monolithic three-dimensional (3D)
object by the successive polymerization of a light-sensitive resin. The produced part requires minimal
post-processing. The multiple stages of assembly and the high degree of technical proficiency required
by conventional LOC manufacturing techniques is thus avoided. AM has been used to produce

Micromachines 2018, 9, 116; doi:10.3390/mi9030116 59 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 116

optically transparent LOC devices with integrated fluidic interconnects and functional elements such
as pumps and valves [11–14].
The sub-millimeter resolution achieved by the market-dominant SLA and MJ machines makes
them highly suited to application in millifluidic LOC device prototyping and production. SLA
machines such as the FORM 2 and ProJet 7000 HD, are capable of printing layers as thin as ≥25 μm,
and MJ machines such as the Objet J750 can print layers as thin as ≥14 μm. The minimum feature
size achievable by SLA and MJ is dependent on accuracy, z-axis layer thickness, and laser-spot (SLA)
or droplet (MJ) size. For SLA machines, features may be produced as small as ∼70 μm, and for MJ,
∼100 μm [3,14,15].
Millifluidic LOC devices typically require designs customized to the selected model metazoan
organism which are typically ≤50 mm in size [10]. Consequently, LOC geometric features which
are often required include channel cross-section dimensions ranging from 250–2000 μm and features
with high aspect ratios (width-to-height). In general, millifluidic LOC devices are difficult to rapidly
prototype, customize, and fabricate using traditional techniques and materials.
Biocompatibility of the LOC material is critical [10,16,17]. The material used in SLA and MJ is a
liquid light-sensitive resin composed of a polymer–photoinitiator system, and auxiliary compounds
for tuning material mechanical and aesthetic properties [18]. Companies recommend using their
proprietary resins in their AM machines to optimize final print resolution and mechanical properties.
However, studies have identified that quantities of toxic compounds may leach from proprietary AM
materials, reviewed in [19]. For example, Zhu et al. [9] showed that leachate from several commonly
available AM materials were toxic to a variety of model organisms, with exposure having both sublethal
and lethal affects. Tsuda et al. [20] found that the leaching of unknown compounds from materials can
unpredictably affect test organisms, and may compromise the outcomes of biological tests.
In some respects, the results found by Zhu et al. [9], and similar studies conducted by
Oskui et al. [21], Alifui-Segbaya [22], and Macdonald et al. [17], were unexpected because some
of the materials tested (e.g., VisiJet SL Clear) have been awarded a United States Pharmacopoeia (USP)
Class VI certification [23]. However, it is important to note that this certification is highly dependent
on strict adherence to post-processing cleaning procedures.
Nonetheless, these studies highlight a potential obstacle in the use of proprietary AM resins
for fabricating LOC devices intended for biological applications. Since advances in AM LOC
devices can enable a growing number of applications [6], ongoing research aims to develop the
capability of AM systems capable of using biologically compatible substrata. Several proprietary
resins are reported to be biocompatible, including the E-Shell series (Envision Tec. Inc., Dearborn, MI,
USA). E-shell has been successfully applied in micro-needle fabrication with SLA-based two-photon
polymerization systems [24,25].
Custom-designed open-source resins, primarily consisting of poly(ethylene glycol) diacrylate
(PEG-DA), are also reported to be biocompatible [10,26–28]. Bhattacharjee et al. [10] used PEG-DA
to fabricate biocompatible petri dishes. After printing, the petri dishes were rendered biocompatible
by post-curing under ultraviolet light, followed by 24 h extraction in water to remove potential toxic
compounds (i.e., uncreated monomers and photoinitiators). Rogers et al. [13] used a B9 Creator SLA
printer and a PEG-DA custom resin to manufacture microfluidic valves and channels designed to be
as narrow as 350 μm in diameter. Using the the AM technique of material extrusion, Tsuda et al. [20]
created biocompatible LOC devices printed in thermoplastic materials, rendered biocompatible by
post-treatment with oxygen plasma bonding of a silicone-based polymer.
Those involved in the design and application of AM for LOC in vitro bioassays should exercise
caution in their approach, and aim to avoid the use of potentially toxic materials which may leach from
AM-printed parts in aqueous media. Compared to the direct AM of LOC devices, transfer moulding
has been explored as a more rapid and economic manufacturing method [29]. Transfer moulding
involves the AM of moulds which are used to cast a relief in a material which has the desired properties,
such as biocompatible poly(dimethylsiloxane) (PDMS). For example, Glick et al. [29] used transfer

60
Micromachines 2018, 9, 116

moulding to produce a biocompatible LOC with geometrically complex components and rounded
channels as narrow as 100 μm. In this example, the ProJet 3000 SLA printer was used to produce the
moulds, and PDMS was used for casting.
The main motivation of our work was to demonstrate an easily and widely accessible user-friendly
and inexpensive fabrication method using “off-the-shelf” resins and commercially available AM
printers to produce biocompatible millifluidic systems for application in bioengineering, biomedical
and toxicological fields, and for use in laboratories that may or may not have direct access to
AM facilities. This method utilizes standard technology and materials and requires minimum
infrastructure investments, thus reducing the entry barrier to this technology when compared to
conventional techniques.
In this work, we use two different AM methods—SLA (ProJet 7000 HD) and MJ (Objet350)—to
produce moulds for casting PDMS, and compare these AM methods for application in PDMS transfer
moulding for the production of biocompatible millifluidic LOC devices. We characterize both the
moulds and PDMS replicas, and assess the toxicity of PDMS replicas by using zebrafish (Danio rerio)
toxicity tests.

2. Materials and Methods

2.1. Metrology
Scanning electron micrographs were taken using a Quanta 200 SEM (FEI Inc., Hillsboro, OR, USA)
operating at 20.0 kV and 5.0 Spot size in high vacuum. Samples were coated with Au/Pd using an
in-house sputter coater operating at 15 mA for 2 min [9]. Optical profilometry was performed using a
ContourGT-I 3D Optical Microscope (Bruker Daltonics Inc., Billerica, MA, USA) with stitching enabled,
as described by Zhu et al. [9]. Images were analysed with Image J.

2.2. Additive Manufacturing


AM prototypes were designed using SolidWorks 2011 (Dassault Systems SolidWorks Corp.,
Waltham, MA, USA). The CAD was exported as a .stl file and processed by the AM machine software
packages. SLA was performed with ProJet 7000 HD in VisiJet SL Clear resin (3D Systems Inc., Rock Hill,
SC, USA), and MJ performed with Objet350 Connex, in VeroClear resin (Stratasys Inc., Eden Prairie,
MN, USA) and as described earlier [9,30].

2.3. Soft-Lithography
Replica moulding was performed in PDMS (Sylgard 184; DowCorning Corp, Midland, MI, USA)
according to a standard protocol as described earlier [31]. Briefly, the PDMS was mixed at a 10:1
weight-to-weight (w/w) ratio of elastomer base to curing agent, then degassed at 40 Torr to remove
any residual air bubbles. PDMS was then poured on master moulds to achieve approximately 5 mm
thickness and cured thermally at 75 ◦ C for up to 1 h.

2.4. Non-Contact Laser Machining


Controls were fabricated using infra-red computer numerical control (CNC) laser machining of
poly(methyl methacrylate) (PMMA) substrate by the methods described by Khoshmanesh et al. [32]
and Akagi et al. [31]. The laser cutting system achieved x–y accuracy of up to 5 μm.

2.5. Toxicological Profiling


The OECD 236 Fish Embryo Acute Toxicity (FET) Assay [33] and fish behavioural toxicity
test [9,30] were employed to assess toxicity as described previously [9,30]. Five days post-fertilisation
(DPF) zebrafish (Danio rerio) embryos were used in all tests. Animals were treated according to Monash
University Ethics Committee regulations and protocols.

61
Micromachines 2018, 9, 116

3. Results and Discussion


A combination of AM negative relief moulds and soft lithography were used to produce a
biocompatible millifluidic LOC. Preliminary validation experiments showed that this approach is
highly suited to the design, prototyping, and production of LOC with cages designed to mirror the
shape of the biological specimen.
The reproduction quality of geometric features of the printed moulds made by two different
AM techniques was compared, and PDMS replicas were assessed using SEM and quantitative 3D
topographic surface mapping using optical profilometry. The x–y and z resolution of the printed
moulds were also evaluated and compared. Of the two techniques, SLA was found most suitable for
this application.
The two AM machines used in this study were the Objet350 Connex (MJ) and ProJet 7000 HD
(SLA), and both are claimed to have ”ultra-high definition” capabilities. Positive relief test structures
(moulds) were fabricated using the ProJet 7000 HD in VisiJet SL Clear resin, and the Objet350 Connex
in VeroClear resin. Accuracy of the moulds was evaluated by comparing the fabricated dimensions
to the dimensions in the CAD. There was variability between SLA and MJ in terms of accuracy
(Figures 1 and 2).

Figure 1. Physical characteristics of moulds fabricated using additive manufacturing processes:


(A) SEM image of the cross-section of millifluidic positive relief pattern made with infrared laser
cutting (and subsequent thermal bonding to obtain a complete mould), ProJet 7000 HD (in VisiJet SL
Clear resin), and Objet350 Connex (in VeroClear resin). (B) Deviation from designed feature geometry
of high aspect ratio poly(dimethylsiloxane) (PDMS) replicas. Dotted boxes represent the designed
geometry superimposed on SEM images of PDMS channel cross-sections. (C) Quantitative analysis of
AM moulds. Angle parameter denotes an average deviation from the designed geometry measured
top plane edges of positive relief moulds. Measurements were performed on cross-sectional views
obtained using SEM. Measurements were made with ImageJ software (n = 20).

In general, we found that the smallest feature reliably produced by both machines was ∼300 μm
in width and height. Features such as rectangular channel geometries with straight sidewalls fabricated
by the ProJet 7000 HD more closely matched the theoretical CAD design than the features fabricated
by the Objet350 Connex.

62
Micromachines 2018, 9, 116

Figure 2. Physical characteristics of millifluidic channel replicas obtained from stereolithography (SLA;
ProJet) or material jetting (MJ; Objet350 Connex) printed moulds: (A) SEM image of the channel with
rectangular cross-section formed by moulding PDMS on a positive relief pattern made with ProJet 7000
HD (in VisiJet SL Clear resin). The channel was obtained from two identical and sandwiched PDMS
replicas; (B) Relationship between the designed and actual width parameter of rectangular channels
fabricated using SLA or MJ; (C) The relationship between the designed and actual height parameter of
rectangular channels fabricated using SLA or MJ; (D) SEM micrographs of the channel with circular
cross-section formed by moulding PDMS on a positive relief pattern made with ProJet 7000 HD in
VisiJet SL Clear resin; (E) Relationship between the designed and actual feature width (defined here as
a diameter in the centre plane) of circular channels fabricated using SLA or MJ; and (F) The relationship
between the designed and actual height parameter (defined here as a diameter in the vertical plane) of
circular channels fabricated using SLA or MJ. Measurements using ImageJ software were performed
on cross-sectional views obtained using SEM (n = 20).

For positive relief test structures fabricated by the ProJet 7000 HD, deviation from the designed
geometry was typically <10%, irrespective of feature dimension, and vertical walls exhibited an angular
skew in the vertical plane of 6–9◦ compared to the design parameters (Figure 1). In contrast, those
fabricated by the Objet350 Connex failed to reproduce straight edges and corners. Considerable edge
rounding—up to 60◦ —occurred at the bottom and top planes of the channels. Rounding was more
pronounced when fabricating features ≤600 μm in height, which resulted in deviations from the designed
geometry >40%.
The Objet350 Connex tended to exceed the designed channel width; for example, when printing
features designed to be smaller than 400 μm, the printed object feature was ∼650 μm (±25 μm)
(Figure 2). Accuracy improved when fabricating channels designed to be larger than 900 μm in
width. While the printer achieved excellent results in terms of height deposition, significant edge
rounding artefacts prevented the printed channels having a rectangular shape as specified by design.
Furthermore, the Objet350 Connex could not reproduce semicircular geometries reliably, and deviations
from the designed geometry exceeded 40%.
We explored the fabrication of millifluidic channels with both rectangular and circular
cross-sections (Figure 2, and Figure S1). When fabricating channels with both rectangular and circular
cross-sections from two sandwiched PDMS replicas, the ProJet 7000 HD achieved the most consistency
with theoretical design parameters. For instance, a channel with a designed geometry of 500 × 500 μm,
width and height, was reproduced with dimensions of 520 ± 6 μm × 484 ± 5 μm (Figure 2). This
corresponded to average deviations from a desired CAD geometry in x and y-axis of ∼5%. Overall, the
ProJet 7000 HD tended to exceed channel width by 5–7%. The ProJet 7000 HD also failed to match the

63
Micromachines 2018, 9, 116

CAD file with respect to height. The degree of inaccuracy varied depending on the designed height.
Precision decreased for designed rectangular channel heights of 1000 μm and for circular cross-section
heights of 400 μm (Figure 2).
The control method—infra-red laser cutting—was unable to fabricate an optically transparent
positive relief pattern with a channel width <300 μm. Achievable laser x–y accuracy was up to 5 μm.
The vertical walls exhibited an angular skew in the vertical plane of ∼8◦ compared to the specified
design parameters (Figure 1). This is likely due to significant thermal deformation and melting damage
of PMMA sheets (data not shown). These results show that these geometries are not easily fabricated
by laser micromachining or photolithography methods.
A considerable advantage of using SLA to fabricate LOC moulds is that it permits fine control
over complex topologies without any additional cost or complex protocols. Accordingly, we explored
the capability of fabricating miniaturized 3D-cages that mirrored the shape of the selected biological
specimen, larval zebrafish (D. rerio) (Figure 3). Such 3D geometries are typically difficult to achieve
using conventional methods such as laser micromachining or photolithography. In addition, these
methods require multiple stages of assembly, multiple masks, repeated coatings, photoresist re-flow,
development, and alignment procedures.

Figure 3. Fabrication of miniaturized 3D cages that mirror the shape of the biological specimens such
as the larval stages of zebrafish (Danio rerio) using SLA moulds: (A) Microphotograph of a positive
relief pattern fabricated using a ProJet 7000 HD in VisiJet SL Clear resin. The mould is the size of a
standard microscope slide 25 mm × 75 mm. The dashed box denotes a single 3D cage; (B) Topographic
surface analysis of a single 3D cage (marked as dashed box in (A) using scanning electron microscopy
(SEM); (C) D. rerio larvae immobilized inside a PDMS cage, made from an SLA mould and that mirrors
the organisms shape; and (D) High-resolution fluorescence imaging of a transgenic Fli1a:EGFP D. rerio
larva showing green fluorescent protein (GFP)-expressing vasculature. Larger and smaller vessels are
clearly distinguishable in the trunk region (boxed area, red outline).

Soft-lithography moulds the size of a standard microscope slide (25 mm × 75 mm; Figure 3) were
fabricated using SLA process in under 40 min, and cost ∼US$2 per template. In comparison, laser
machining soft-lithography moulds took ∼5 min, and cost ∼US$0.2 per mould. However, the control
method was more labour intensive than SLA. It required the cutting of independent PMMA layers,

64
Micromachines 2018, 9, 116

subsequent alignment for assembly in 3D structures, and then thermal bonding for >60 min. Whereas
AM required transferring the CAD to the AM software.
PDMS cured well on the VisiJet SL Clear moulds and VisiJet SL Clear moulds were geometrically
stable during the PDMS curing process at 70 ◦ C for 1 h. In addition, the releasing of PDMS replicas
did not require any application of releasing agents. However, the curing of PDMS on VeroClear resin
experienced several polymerization issues, and were more difficult to release.
Importantly, the SLA mould could be used multiple times without any degradation or deformation
of pattern geometries observed during the repeated PDMS curing cycles.
Quantitative 3D topographic surface mapping using optical profilometery revealed that PDMS
replicas had low surface roughness (Figure 4). Median surface roughness of PDMS replicas made from
VisiJet SL Clear resin moulds was higher than the control PMMA moulds (Ra = 850 nm vs. 200 nm,
respectively). The SLA moulds had had an average surface roughness of 1.7 ± 0.4 μm (taking into
account both the tops of channels and bases of troughs). Consequently, following plasma treatment,
PDMS replicas achieved proper hydraulic sealing to both glass and PDMS surfaces.
The PDMS millifluidic LOC produced from the SLA mould was optically transparent, thus
enabling high-resolution fluorescence imaging (Figure 3).
Several studies have shown that photoinitiator and short-chain polymer residues that may leach
from SLA devices exhibit a level of toxicity to test organisms [17,21,22,30,34]. This indicates that
compounds remaining in the SLA-printed parts are not irreversibly trapped or adequately removed
in standard manufacturer recommended post-processing protocols (e.g., solvent extraction and
post-curing) [23]. This has cast doubt on the appropriateness of using SLA to produce biomicrofluidic
LOC devices intended for in vitro bioassays [9,16,17,35]. However, using AM to create moulds, and
the final LOC being produced by soft-lithography in PDMS side-steps these concerns.
Biocompatibility of PDMS replicas fabricated from SLA moulds was evaluated by using the
well-established and very sensitive standard OECD FET test on developing D. rerio embryos [9,17].
The embryonic developmental stage is considered to be the most sensitive to environmental
perturbations, and can be readily applied to assess impacts of any potential toxic effects of chemicals
and solid phases [9,33].
The FET bioassay showed no observable toxicity of PDMS replicas fabricated using SLA moulds
(Figure 4). At 24 h, all D. rerio embryos exposed to PDMS replicas survived without any developmental
abnormalities. In contrast, at 24 h, the survival rate of embryos exposed to test parts fabricated by
SLA and post-processed using standard cleaning procedures was ∼0% (data not shown). Behavioural
toxicity bioassay revealed a lack of any behavioural abnormalities in zebrafish larvae exposed to PDMS
replicas. In contrast, D. rerio larvae exposed to parts made with SLA exhibited sudden and complete
paralysis. This suggests that toxic compounds did not transfer from SLA moulds to PDMS during the
casting and curing process.
One of the main limitations of conventional soft lithography for millifluidic devices is the low
availability of inexpensive master-mould fabrication techniques, and AM presents an attractive solution
to overcoming this obstacle. Current-generation SLA technologies are generally able to print with
resolutions >100 μm in the x–y dimension and >25 μm in the z dimension. Consequently, this
technology is particularly suitable for fabricating millifluidic devices such as those designed with
channel minimum cross-section dimensions ranging from 500 to 1500 μm for use with metazoan model
organisms. While AM cannot match the performance and resolution of photolithography, it does
permit the design and manufacture of complex geometries. SLA, rather than MJ, was shown to be a
better choice for the fabrication of the millifluidic devices used in our study.
Despite some practical limitations, the significance and convenience of PDMS replica moulding
and PDMS-on-glass-LOC is still high. Due to high metabolic rate, gas diffusion through PDMS layer is
particularly advantageous for devices aimed at bioassays on model metazoan organisms. Moreover,
the elastic properties of PDMS can alleviate mechanical damage during the loading and immobilization
process of fragile embryonic stages. The replicas achieved a suitable level of pattern fidelity, with

65
Micromachines 2018, 9, 116

only a relatively insignificant deviation from the desired geometry of the fluidic channels. PDMS
replicas also permitted bright field and fluorescent imaging at relatively high resolution. In addition,
we showed that there was no transfer of toxic compounds from AM moulds to PDMS replicas.

Figure 4. Characterization of PDMS replicas obtained from both control (CTRL) laser-cutting methods
and SLA-AM (ProJet 7000 HD) positive relief moulds: (A) Quantitative topographic surface analysis of
a representative 500 μm × 500 μm section of a millifluidic channel fabricated in PDMS from moulds
made with laser cut and thermally bonded PMMA moulds; PMMA surface topography such as
valleys (peak-to-peak value of 200 ± 20 nm) are thermal deformations formed during laser cutting
and subsequent oven bonding. (B) Surface roughness renders of PDMS replicas obtained from ProJet
7000 HD printed moulds. Surface topography characteristic of SLA was peak-to-peak = 850 ± 70 nm.
Measurements consisting of at least three independent samples were taken using ContourGT-I 3D
optical profilometery. (C,D) Toxicity profiling of PDMS test wells casted on a mould fabricated using
ProJet 7000 HD in VisiJet SL Clear resin. PDMS replicas were tested using OECD 236 Fish Embryo
Acute Toxicity (FET) Assay with zebrafish (Danio rerio). Comparative analysis between negative control
polystyrene wells (CTRL), SLA moulds printed in VisiJet Clear SL (PROJET), and wells made from
moulding PDMS with Visijet Clear SL moulds (PROJET-PDMS): (C) survival of D. rerio larvae, and
(D) behavioural responses of D. rerio larvae, measured as the change in total distance travelled (±S.E)
after 5 min in wells. Results represent data from at least three independent experiments performed
in triplicate.

Here we present a combinatorial fabrication approach utilizing SLA and soft lithography in PDMS
as a viable method for the inexpensive production of high-definition biocompatible millifluidic LOC
devices. These devices are easily adaptable for use in a range of studies using small to large metazoan
model organisms. The presented technique offers the possibility of prototyping millifluidic devices

66
Micromachines 2018, 9, 116

and iterating multiple designs per day to support fast optimization cycles and achieve significant
advancement in the definition of manufactured structures. Due to the growing availability of AM
facilities, which enables the outsourced fabrication of small batches of prototypes at a very low cost,
our described manufacturing method is readily accessible to any biological laboratory. In addition,
issues previously observed with polymer toxicity were avoided.

Supplementary Materials: The following are available online at www.mdpi.com/2072-666X/9/3/116/s1,


Figure S1: Physical characteristics of semi-circular positive relief patterns fabricated using additive manufacturing
processes. (A) Pattern fabricated in VisJet Clear material using the ProJet 7000 HD system; (B) PDMS replica
obtained from the master depicted in (A); (C) Pattern fabricated in Vero Clear using the Objet350 Connex system;
(D) PDMS replica obtained from the master depicted in (C). Dotted lines represent the designed CAD geometry
superimposed on SEM images of representative cross-sections.
Acknowledgments: This work was supported by: the Australian Research Council DECRA [DE130101046] (D.W.);
Vice-Chancellor’s Senior Research Fellowship, RMIT University, Australia (D.W.), National Health and Medical
Research Council [GNT1068411] (J.K.), Eva and Les Erdi foundation (J.K.). We acknowledge the assistance of:
RMIT Micro Nano Research Facility (MNRF) during optical profilometry; RMIT Microscopy and Microanalysis
Facility (RMMF) during SEM imaging experiments; Monash University FishCore in zebrafish breeding and
embryo culture. Zebrafish husbandry and biotests were performed according to the regulations of Monash
University Animal Ethics Committee.
Author Contributions: D.W. and N.M.F. conceived and designed the experiments; N.M.F. performed the
experiments; N.M.F. analyzed the data; J.K. contributed materials; D.W. and M.C. wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest. The funding sponsors had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the
decision to publish the results.

Abbreviations
The following abbreviations are used in this manuscript:

LOC Lab-on-a-Chip
AM A dditive manufacturing
MJ Material jetting
3D Three-dimensional
PDMS Poly(dimethylsiloxane)
SLA Stereolithography
PEG-DA poly(ethylene glycol) diacrylate
USP United States Pharmacopeia
PMMA Poly(methyl methacrylate)
CNC Computer numerical control
OECDv Organisation for Economic Co-operation and Development
CAD Computer-assisted design
DPF Days post-fertilisation
SEM Scanning electron microscope
GFP Green fluorescent protein

References
1. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013.
2. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-Printed Microfluidics. Angew. Chem. Int. Ed. 2016,
55, 3862–3881.
3. Ho, C.M.B.; Ng, S.H.; Li, K.H.H.; Yoon, Y.J. 3D printed microfluidics for biological applications. Lab Chip
2015, 15, 3627–3637.
4. Chen, C.; Mehl, B.T.; Munshi, A.S.; Townsend, A.D.; Spence, D.M.; Martin, R.S. 3D-printed microfluidic
devices: Fabrication, advantages and limitations—A mini review. Anal. Methods 2016, 8, 6005–6012.
5. Cartlidge, R.; Nugegoda, D.; Wlodkowic, D. Millifluidic Lab-on-a-Chip technology for automated toxicity
tests using the marine amphipod Allorchestes compressa. Sens. Actuators B Chem. 2017, 239, 660–670.

67
Micromachines 2018, 9, 116

6. Campana, O.; Wlodkowic, D. The undiscovered country: Ecotoxicology meets microfluidics. Sens. Actuators
B Chem. 2018, 257, 692–704.
7. Wlodkowic, D.; Khoshmanesh, K.; Akagi, J.; Williams, D.E.; Cooper, J.M. Wormometry-on-a-chip: Innovative
technologies for in situ analysis of small multicellular organisms. Cytom. Part A 2011, 79, 799–813.
8. Zhu, F.; Wigh, A.; Friedrich, T.; Devaux, A.; Bony, S.; Nugegoda, D.; Kaslin, J.; Wlodkowic, D. Automated
Lab-on-a-Chip Technology for Fish Embryo Toxicity Tests Performed under Continuous Microperfusion
(μFET). Environ. Sci. Technol. 2015, 49, 14570–14578.
9. Zhu, F.; Skommer, J.; MacDonald, N.P.; Friedrich, T.; Kaslin, J.; Wlodkowic, D. Three-dimensional printed
millifluidic devices for zebrafish embryo tests. Biomicrofluidics 2015, 9, doi:10.1063/1.4927379.
10. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742.
11. Gong, H.; Woolley, A.T.; Nordin, G.P. High density 3D printed microfluidic valves, pumps, and multiplexers.
Lab Chip 2016, 16, 2450–2458.
12. Au, A.K.; Bhattacharjee, N.; Horowitz, L.F.; Chang, T.C.; Folch, A. 3D-printed microfluidic automation.
Lab Chip 2015, 15, 1934–1941.
13. Rogers, C.I.; Qaderi, K.; Woolley, A.T.; Nordin, G.P. 3D printed microfluidic devices with integrated valves.
Biomicrofluidics 2015, 9, doi:10.1063/1.4905840.
14. Macdonald, N.P.; Cabot, J.M.; Smejkal, P.; Guijt, R.M.; Paull, B.; Breadmore, M.C. Comparing Microfluidic
Performance of Three-Dimensional (3D) Printing Platforms. Anal. Chem. 2017, 89, 3858–3866.
15. Bhushan, B.; Caspers, M. An overview of additive manufacturing (3D printing) for microfabrication.
Microsyst. Technol. 2017, 23, 1117–1124.
16. Zhu, F.; Skommer, J.; Friedrich, T.; Kaslin, J.; Wlodkowic, D. 3D printed polymers toxicity profiling: A caution
for biodevice applications. Proc. SPIE 2015, 9668, doi:10.1117/12.2202392.
17. Macdonald, N.P.; Zhu, F.; Hall, C.J.; Reboud, J.; Crosier, P.S.; Patton, E.E.; Wlodkowic, D.; Cooper, J.M.
Assessment of biocompatibility of 3D printed photopolymers using zebrafish embryo toxicity assays.
Lab Chip 2016, 16, 291–297.
18. Ligon, S.C.; Liska, R.; Stampfl, J.; Gurr, M.; Mulhaupt, R. Polymers for 3D Printing and Customized Additive
Manufacturing. Chem. Rev. 2017, 117, 10212–10290.
19. Carve, M.; Wlodkowic, D. 3D-Printed Chips: Compatibility of Additive Manufacturing Photopolymeric
Substrata with Biological Applications. Micromachines 2018, 9, 91.
20. Tsuda, S.; Jaffery, H.; Doran, D.; Hezwani, M.; Robbins, P.J.; Yoshida, M.; Cronin, L. Customizable 3D printed
‘Plug and Play’ millifluidic devices for programmable fluidics. PLoS ONE 2015, 10, e0141640.
21. Oskui, S.M.; Diamante, G.; Liao, C.; Shi, W.; Gan, J.; Schlenk, D.; Grover, W.H. Assessing and Reducing the
Toxicity of 3D-Printed Parts. Environ. Sci. Technol. Lett. 2016, 3, 1–6.
22. Alifui-Segbaya, F.; Varma, S.; Lieschke, G.J.; George, R. Biocompatibility of Photopolymers in 3D Printing.
3D Print. Addit. Manuf. 2017, 4, 185–191.
23. 3D Systems Inc. VisiJet SL Clear Cleaning Procedure for USP Class VI; Library Technology Reports; 3D Systems Inc.:
Valencia, CA, USA, 2013; pp. 1–2.
24. Miller, P.R.; Skoog, S.A.; Edwards, T.L.; Lopez, D.M.; Wheeler, D.R.; Arango, D.C.; Xiao, X.; Brozik, S.M.;
Wang, J.; Polsky, R.; et al. Multiplexed microneedle-based biosensor array for characterization of metabolic
acidosis. Talanta 2012, 88, 739–742,
25. Gittard, S.D.; Ovsianikov, A.; Monteiro-Riviere, N.A.; Lusk, J.; Morel, P.; Minghetti, P.; Lenardi, C.;
Chichkov, B.N.; Narayan, R.J. Fabrication of polymer microneedles using a two-photon polymerization and
micromolding process. J. Diabetes Sci. Technol. 2009, 3, 304–311.
26. Rogers, C.I.; Pagaduan, J.V.; Nordin, G.P.; Woolley, A.T. Single-monomer formulation of polymerized
polyethylene glycol diacrylate as a nonadsorptive material for microfluidics. Anal. Chem. 2011, 83, 6418–6425,
27. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Garcia-Cordero, J.L.; et al. 3D-printing of transparent bio-microfluidic
devices in PEG-DA. Lab Chip 2016, 16, 2287–2294.
28. Hinton, T.J.; Hudson, A.; Pusch, K.; Lee, A.; Feinberg, A.W. 3D Printing PDMS Elastomer in a Hydrophilic
Support Bath via Freeform Reversible Embedding. ACS Biomater. Sci. Eng. 2016, 2, 1781–1786.

68
Micromachines 2018, 9, 116

29. Glick, C.C.; Srimongkol, M.T.; Schwartz, A.J.; Zhuang, W.S.; Lin, J.C.; Warren, R.H.; Tekell, D.R.; Satamalee,
P.A.; Lin, L. Rapid assembly of multilayer micro fl uidic structures via 3D-printed transfer molding and
bonding. Microsyst. Nanoeng. 2016, 2, 16063.
30. Zhu, F.; Friedrich, T.; Nugegoda, D.; Kaslin, J.; Wlodkowic, D. Assessment of the biocompatibility of three-
dimensional-printed polymers using multispecies toxicity tests. Biomicrofluidics 2015, 9, doi:10.1063/1.4939031.
31. Akagi, J.; Khoshmanesh, K.; Evans, B.; Hall, C.J.; Crosier, K.E.; Cooper, J.M.; Crosier, P.S.; Wlodkowic, D.
Miniaturized embryo array for automated trapping, immobilization and microperfusion of zebrafish
embryos. PLoS ONE 2012, 7, e36630.
32. Khoshmanesh, K.; Akagi, J.; Hall, C.J.; Crosier, K.E.; Crosier, P.S.; Cooper, J.M.; Wlodkowic, D. New rationale for
large metazoan embryo manipulations on chip-based devices. Biomicrofluidics 2012, 6, doi:10.1063/1.3699971.
33. OECD. Test No. 236: Fish Embryo Acute Toxicity (FET) Test Section 2: Effects on Biotic Systems. In OECD
Guidelines for the Testing of Chemicals; OECD: Paris, France, 2013; Chapter 2.
34. Cebe, M.A.; Cebe, F.; Cengiz, M.F.; Cetin, A.R.; Arpag, O.F.; Ozturk, B. Elution of monomer from different
bulk fill dental composite resins. Dent. Mater. 2015, 31, e141–e149.
35. Zhu, F.; Macdonald, N.; Skommer, J.; Wlodkowic, D. Biological implications of lab-on-a-chip devices fabricated
using multi-jet modelling and stereolithography processes. SPIE Microtechnol. 2015, 9518, doi:10.1117/12.2180743.

c 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

69
micromachines

Communication
Digital Manufacturing of Selective Porous Barriers in
Microchannels Using
Multi-Material Stereolithography
Yong Tae Kim *,† , Kurt Castro † , Nirveek Bhattacharjee and Albert Folch
Department of Bioengineering, University of Washington, Seattle, WA 98195, USA; [email protected] (K.C.);
[email protected] (N.B.); [email protected] (A.F.)
* Correspondence: [email protected]; Tel.: +1-206-685-2257
† These authors contributed equally to this work.

Received: 1 February 2018; Accepted: 13 March 2018; Published: 14 March 2018

Abstract: We have developed a sequential stereolithographic co-printing process using two different
resins for fabricating porous barriers in microfluidic devices. We 3D-printed microfluidic channels
with a resin made of poly(ethylene glycol) diacrylate (MW = 258) (PEG-DA-258), a UV photoinitiator,
and a UV sensitizer. The porous barriers were created within the microchannels in a different resin
made of either PEG-DA (MW = 575) (PEG-DA-575) or 40% (w/w in water) PEG-DA (MW = 700)
(40% PEG-DA-700). We showed selective hydrogen ion diffusion across a 3D-printed PEG-DA-575
porous barrier in a cross-channel diffusion chip by observing color changes in phenol red, a pH
indicator. We also demonstrated the diffusion of fluorescein across a 3D-printed 40% PEG-DA-700
porous barrier in a symmetric-channel diffusion chip by measuring fluorescence intensity changes
across the porous barrier. Creating microfluidic chips with integrated porous barriers using
a semi-automated 3D printing process shortens the design and processing time, avoids assembly
and bonding complications, and reduces manufacturing costs compared to micromolding processes.
We believe that our digital manufacturing method for fabricating selective porous barriers provides
an inexpensive, simple, convenient and reproducible route to molecule delivery in the fields of
molecular filtration and cell-based microdevices.

Keywords: multi-material stereolithography; porous barrier; diffusion; microfluidics

1. Introduction
Precise control of small molecule diffusion through porous materials and its application to analyze
cell behavior is an important technology in fundamental biology, biomedicine, and pharmaceutics [1–5].
Lab-on-a-chip research has progressed over the last decades by adapting microfabrication technology from
semiconductor fabrication processes that bring advantages such as miniaturization, uniformity, accuracy,
reproducibility, and fluid/cell/tissue manipulations [6–12]. Hydrogels, which are three-dimensional (3D)
polymer networks with high porosity, have been employed in the field of tissue engineering, drug delivery
systems, biomaterials, and size-selective separation, among others [13–18]. The pore size of hydrogels can
be easily tuned by manipulating their crosslinking density.
Researchers have used microfluidic architectures in combination with hydrogel materials for
delivery of chemicals in cell and tissue engineering applications [19–22]. For example, Lee et al.
developed a macroporous polyacrylamide and poly(ethylene glycol) diacrylate (PEG-DA) hydrogel
array within a microchannel to monitor solute transport into the hydrogel; they fabricated
macroporous hydrogels composed of polyacrylamide and analyzed the diffusion of both glutathione
S-transferase-green fluorescent protein and dextran-fluorescein isothiocyanate into the hydrogel;
they also produced PEG-DA (MW = 700) (PEG-DA-700) hydrogels and tested the penetration of

Micromachines 2018, 9, 125; doi:10.3390/mi9030125 70 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 125

250 kDa dextran into the hydrogel [23]. Huang et al. reported a 3D microfluidic platform, which was
fabricated using typical photolithography methods, to observe cell to extracellular matrix and cell to cell
interactions; they filled multiple adjacent channels with type-I collagen and Matrigel by balancing the
capillary forces and surface tension; the different patterned gels in the microchannels enabled real-time
observation of intercellular interactions in co-cultures using MDA-MB-231 cell and RAW cells [24].
Sung et al. announced a microfluidic device for testing drug toxicity in a pharmacokinetic-based
manner that included multiple hydrogel-based cell culture chambers connecting to microfluidic
channels to mimic multi-organ interactions [25]. However, fabrication of porous microstructures in
a microfluidic chip usually requires the assembly and bonding of an additional membrane or hydrogel
structure, a process that is complex, costly, and time-consuming, and often requires the intervention of
a trained specialist.
3D printing has emerged as an attractive alternative technique for manufacturing microfluidic
devices because of its attributes, i.e., 3D design, semi-automated and assembly-free 3D fabrication,
rapidly decreasing costs, and faster production time [26,27]. 3D printing has also been extensively
used to build hydrogel scaffolds [28,29]. For example, Mohanty et al. fabricated scalable scaffolds
using a combined 3D-fused deposition modeling printing and salt leaching process for precise control
of the geometry and dimensions of the scaffolds [30,31]. He et al. investigated the printability of
a sodium alginate and gelatin mixture hydrogel using an extrusion-based 3D bioprinting system
and demonstrated the viability of L929 mouse fibroblasts on the 3D-printed hydrogel scaffold [32].
Hinton et al. recently reported a complex 3D biological structure using a thermoreversible gelatin
support bath that enabled freeform reversible embedding of hydrogel to suspend alginate, fibrin,
collagen type I, and Matrigel [33]. However, multi-material printing has not been used yet for the
production of porous barriers in microfluidics.
Integrating the fabrication of a porous microstructure within a microfluidic device using
an automated process such as 3D printing allows for materials and performance modeling prior
to fabrication, shortens the duration of design iterations, and reduces overall manufacturing costs.
In this work, we developed a stereolithographic co-printing process to enable the inexpensive
microfabrication of selective porous barriers in order to control the diffusion of small ions or
molecules within a microchannel. We explored two different hydrogels—PEG-DA (MW = 575)
(PEG-DA-575) and 40% (w/w in water) PEG-DA-700 (40% PEG-DA-700)—for printing the porous
barriers separating two adjacent microchannels. The microchannels were fabricated with PEG-DA
(MW = 258) (PEG-DA-258) [34]. Diffusion of hydrogen ions and fluorescein was demonstrated with
a 3D-printed cross-channel diffusion chip (PEG-DA-575 barrier) and a 3D-printed symmetric-channel
diffusion chip (40% PEG-DA-700 barrier), respectively.

2. Materials and Methods

2.1. Resin Composition for Multi-Material Stereolithography Printing


Photocurable resins for stereolithography printing were developed for the microfluidic chips that
have selective porous barriers within their microchannels. The resin for creating the microchannel
floor, walls, and roof is based on PEG-DA-258 (Sigma Aldrich, St. Louis, MO, USA) mixed with 0.6%
(w/w) Irgacure 819 (IRG, BASF Corporation, Florham Park, NJ, USA) as a photoinitiator and 0.6%
(w/w) 2-isopropylthioxanthone (ITX) as a photosensitizer. The resin for the porous barrier of the
3D-printed cross-channel diffusion chip contains PEG-DA-575 (Sigma Aldrich), 0.6% IRG, and 0.6%
ITX. 40% PEG-DA-700 (Sigma Aldrich) in distilled water conjugated with 0.6% IRG is used for printing
the porous barrier of the 3D-printed symmetric-channel diffusion chip.

2.2. Stereolithography—Setup and Printing


Both the cross-channel and symmetric-channel diffusion chip were designed with Autodesk
Inventor® and saved in STL formats. In order to slice the designed object, we used Autodesk

71
Micromachines 2018, 9, 125

Print Studio (Autodesk, Inc., San Rafael, CA, USA), which has a function for automatic mesh
analysis and healing. After slicing the designed object into 25 μm-thick layers, the sliced images
and the UV exposure settings for each layer outlined in a CSV file named layersettings.csv were
compressed into a zipped folder. The folder was then sent to the 3D printer to fabricate the object.
The fabrication of the multi-material diffusion microfluidic chip was carried out in bat configuration
with an Ember DLP® 3D Printer (Autodesk, Inc.), which has a 405 nm wavelength LED, 50 μm
in-plane resolution, and 10~100 μm out-of-plane resolution controlled by a digital light projector
(DLP). To make transparent prints, we used a glass slide (75 mm (L) × 50 mm (W) × 1.0 mm (T)) as the
substrate on which the designed object was built [34]. Prior to using the glass slide, the glass surface
was thoroughly cleaned with acetone, isopropyl alcohol, and deionized (D.I.) water and dried at 70 ◦ C
overnight. The surface of the glass slide was plasma-activated with oxygen plasma for 180 s and
treated with 3-(trimethoxysilyl) propyl methacrylate (TMSPMA) (Sigma-Aldrich) in an 85 ◦ C chamber
for 8 h. The silanized glass slide was attached to the aluminum build plate by coating one side of it
with uncured PEG-DA-258 resin and exposing it to UV light using a broadband UV lamp (B-100 A,
UVP). For the microchannel fabrication, the PEG-DA-258 resin was poured into a resin tray and then
the build plate was lowered until it reached the resin tray for calibration. After calibration, the object
was printed with repeated cycles of UV curing, resin tray separation from the current print position,
Z-Axis overlift, and resin tray approach to the new print position. This process was repeated until the
whole object was fabricated. For multi-material printing, the printer was paused at the desired layer
and the PEG-DA-258 resin tray was changed to the other material (PEG-DA-575 or 40% PEG-DA-700),
or vice versa. The glass slide with the printed object was removed from the build plate and cleaned
using D.I. water and pressurized air.

2.3. Molecule Diffusion Analysis


To test the hydrogen ion diffusion through the porous barrier printed using PEG-DA-575 in the
3D-printed cross-channel diffusion chip, phenol red (Sigma) was employed to observe color changes
corresponding to changes in acidity. Then 0.1 M HCl was injected into the bottom channel of the
cross-channel diffusion chip and phenol red was loaded into the top channel of the diffusion chip.
The color change of the phenol red was recorded using a Nikon SMZ1500 stereomicroscope (Nikon,
Tokyo, Japan) fitted with a Canon Rebel EOS 5D Mark II DSLR camera (Canon, Tokyo, Japan).
The 3D-printed symmetric-channel diffusion microchip was utilized to transport fluorescein
molecules through its porous barrier made of 40% PEG-DA-700 resin. The 0.1 M fluorescein was
inserted into Channel 1 of the symmetric-channel diffusion chip while PBS buffer was loaded into
Channel 2. The diffusion of fluorescein across the porous barrier from one channel to the other was
measured for 1 hour using an inverted epifluorescence microscope (Nikon Eclipse Ti, Plan Apo λ
2× objective).

3. Results and Discussion

3.1. Selection of Resin Components


We have fabricated selective porous barriers in microchannels using multi-material
stereolithography. We chose PEG-DA-258 to print microfluidic channels due to its characteristics
such as photo-curability, water impermeability, transparency, and low cost [34]. We added 0.6% IRG to
the PEG-DA-258 resin because of its ability to absorb energy and initiate free radical polymerization at
longer UV wavelengths (405 nm), corresponding to that of the printer DLP projector. We also added
ITX at 0.6% to increase the Z-resolution of 3D-printed microchannels. ITX, which is a sulfur-type
photosensitizer, is widely used in UV curing to promote the polymerization of photopolymers because
of its UV absorption characteristics. PEG-DA with higher molecular weights were chosen as porous
barrier materials since it had been shown before that PEG-DA hydrogel networks (MW = 575 to 20,000)
have a mesh size of 0.1 to 10 nm [35–37]. A porous barrier in the cross-channel diffusion chip was

72
Micromachines 2018, 9, 125

printed using PEG-DA-575 mixed with 0.6% IRG and 0.6% ITX for small ion diffusion such as hydrogen
ions. We also used 40% PEG-DA-700 in D.I. water containing 0.6% IRG to make a porous barrier for
the transport of larger molecules since adding 60% water to PEG-DA-700 resin increases the pore size
in a hydrogel polymer matrix [16].

3.2. Fabrication of a 3D-Printed Cross-Channel Diffusion Chip


Figure 1A shows the fabrication process of a cross-channel diffusion chip. We developed two
different resins to print the 3D-printed cross-channel diffusion chip: a resin to build the porous barrier
(PEG-DA-575) and a microfluidic channel resin (PEG-DA-258). Prior to the printing of the 3D-printed
cross-channel diffusion chip, the designed object was sliced into 25 μm-thick layers. A PEG-DA-258
resin tray and a PEG-DA-575 resin tray were prepared to build the microchannel part and the porous
barrier part, respectively. First, the PEG-DA-258 resin tray was inserted into the Ember DLP® 3D
Printer and the first layer was created with 6 s UV exposure to aid the adhesion of the device to the
glass slide. After printing a 100 μm-thick bottom layer, a 1 mm high bottom channel was fabricated
using the PEG-DA-258 resin with a 0.3 s exposure setting for each layer. Prior to build the porous
barrier, PEG-DA-258 residue was washed using D.I. water. The PEG-DA-575 resin tray was inserted
into the printer for fabricating the porous barrier. The 100 μm-thick porous barrier was printed by
irradiating each layer for 0.8 s. Compared to PEG-DA-258, PEG-DA-575 needs longer exposure times
to fabricate polymer structures because, for the same polymer mass, PEG-DA-575 has less active
sites (diacrylate groups) for photopolymerization than PEG-DA-258; the smaller number of active
sites results in a slower reaction speed in PEG-DA-575. The lower molecular weight monomers in
PEG-DA-258 have a higher mobility in the resin, which increases the probability of radical initiation on
the carbon-carbon double bond (this radical initiation is the first step of the polymerization process).
Moreover, due to its higher mobility compared to PEG-DA-575, the PEG-DA-258 molecule has a greater
chance of encountering other molecules, which also results in a faster reaction speed. To fabricate
a 1 mm-high top channel, the resin tray was switched back to the PEG-DA-258 resin tray after rinsing
the PEG-DA-575 residue and the top channel was fabricated with the same conditions as the bottom
channel. In order to prevent the microchannel from clogging with PEG-DA-258 residue due to
overexposure, the resin in the microchannels was removed after printing a 100 μm-thick top channel
roof and the fabrication continued until the diffusion chip was completed. At the end of the print
process, the microchannels were flushed in a dark room with distilled water to remove any PEG-DA
resin from the channel.

73
Micromachines 2018, 9, 125

Figure 1. (A) Fabrication process in cross-section schematics (top row) and 3D view (bottom row) of
a 3D-printed cross-channel diffusion microchip containing a PEG-DA-575 porous barrier. The process
depicts the fabrication of (i) the bottom layer; (ii) the bottom channel; (iii) the porous barrier; (iv) the top
channel; and (v) the roof and inlets; (B) CAD representation of the finished 3D-printed cross-channel
diffusion chip (left) and its cross-sectional schematic (right); (C) photograph (top view) of the 3D-printed
cross-channel diffusion chip; the top channel is filled with red dye and the bottom channel is filled with
blue dye for visualization purposes.

Figure 1B illustrates a CAD design of the 3D-printed cross-channel diffusion chip and its
cross-sectional view. A photo image of the 3D-printed cross-channel diffusion chip is displayed
in Figure 1C. The bottom channel is filled with blue dye while the top channel is filled with red dye.

3.3. Hydrogen Ion Diffusion Test


We confirmed the selective diffusion of hydrogen ions through a PEG-DA-575 barrier by observing
pH shifts as color changes with the pH-sensitive phenol red dye. The phenol red color was shown
to gradually shift from yellow to red over the pH range 6.8 to 8.2 [38]. 0.1 M HCl solution was
injected into the bottom channel of the cross-channel diffusion chip and then 0.5% phenol red in PBS
was loaded into the top channel. Hydrogen ion diffusion was recognized by observing the color
change of phenol red as shown in Figure 2. The phenol red solution at 0 s gradually took on a yellow
color at 10 s at the porous barrier area, corresponding to the overlap between the two microchannels.
The phenol red turned completely yellow after 70 s. The color change happened only in the top
channel, which means hydrogen ions can pass through the porous barrier from the bottom channel to
the top channel, while phenol red remains in the top channel, as illustrated in the cross-section view
of Figure 2.

Figure 2. Hydrogen ion diffusion experiment (top row) and cross-section schematic (bottom row)
using the 3D-printed cross-channel diffusion chip. The phenol red in the channel (t = 0 s) gradually
changed to yellow at the channel intersection (t = 10 s) until it turned completely yellow (t = 70 s),
while the bottom channel did not change color.

74
Micromachines 2018, 9, 125

3.4. Fabrication of a 3D-Printed Symmetric-Channel Diffusion Chip


Small-ion diffusion was successfully carried out with the 3D-printed cross-channel diffusion chip
(see Section 3.3). However, some biomedical applications may require the delivery of larger molecules
such as dyes and drugs. To make a hydrogel barrier with larger pores, we used 40% PEG-DA-700 mixed
with 60% water. The higher molecular weight of PEG-DA can produce larger pores in the hydrogel
because of its longer chain length, which increases the mesh size of the polymer network. To polymerize
a dilute PEG-DA-700 resin, a longer exposure time is required, which increases the risk of clogging
channels under the porous barrier. We changed the diffusion chip design to a symmetric-channel
chip having a porous barrier in between two channels, which ensured that the longer exposure time
required to polymerize 40% PEG-DA-700 did not occlude the channels.
The fabrication process of a 3D-printed symmetric-channel diffusion chip is described in Figure 3A.
PEG-DA-258 resin and 40% PEG-DA-700 resin in D.I. water were used to print the symmetric-channel
and porous barrier, respectively. Prior to printing, the 3D designed symmetric-channel diffusion chip
was sliced into 25 μm thick layers similar to the cross-channel chip. As explained before, a 100 μm-thick
bottom layer was printed with 6 s exposure and then eight layers of the channel (200 μm) were
fabricated with 0.3 s UV irradiation for each layer. Next, the PEG-DA-258 residue was washed using
D.I. water and the 40% PEG-DA-700 resin tray was inserted. The porous barrier was created by a single
6.5 s exposure of the resin, which allowed the PEG-DA-700 hydrogel structure to grow down and attach
to the glass slide. The porous barrier is designed as the shape of an extruded rectangle between two
microchannels and is, by design, 200 μm tall, 300 μm wide and 2 mm long. The PEG-DA-258 resin tray
was re-installed in the 3D printer to build the last of the channel layers after cleaning the PEG-DA-700
residue. To avoid clogging of the microchannels, they were cleaned after printing a 100 μm-thick roof
layer and then the diffusion chip fabrication was completed. The microchannels were washed using
distilled water to remove uncured PEG-DA resin. Figure 3B,C show a schematic cross section and
a photograph, respectively, of the device.

Figure 3. (A) Fabrication process in cross-section schematics (top row) and 3D view (bottom row) of
a 3D-printed symmetric-channel diffusion microchip with a 40% w/w PEG-DA-700 porous barrier.
The process depicts the fabrication of (i) the bottom layer; (ii) the channel part 1; (iii) the porous
barrier; (iv) the channel part 2; and (v) the roof and inlets; (B) CAD representation of the 3D-printed
symmetric-channel diffusion chip (left) and its cross-sectional schematic (right); (C) photograph of the
3D-printed symmetric-channel diffusion chip; Channel 1 is filled with blue dye and Channel 2 is filled
with red dye for visualization purposes.

75
Micromachines 2018, 9, 125

3.5. Fluorescein Diffusion Test


Molecular diffusion across the 40% PEG-DA-700 barrier in the 3D-printed symmetric-channel
chip was tested by observing the transport of fluorescein (as a model of a small drug) using an
inverted epifluorescence microscope. 0.1 mM fluorescein was loaded into Channel 1 while PBS
buffer was loaded into Channel 2. The change in fluorescence intensity as fluorescein diffused from
Channel 1 to Channel 2 was measured for 1 h. The results of the fluorescein diffusion are shown
in Figure 4. The green signal was observed only in Channel 1 when fluorescein was loaded into
it (Figure 4A). Then, fluorescein molecules transferred to Channel 2 through the 40% PEG-DA-700
hydrogel barrier (Figure 4B). After 60 min, the green color was clearly observed in Channel 2 as seen
with the fluorescence image in Figure 4C. The fluorescence intensity was quantitatively analyzed and
plotted in Figure 4D. The fluorescence intensity gradually increased with time from 0 to 60 min in both
the 40% PEG-DA-700 hydrogel barrier and Channel 2.
Fick’s second law of diffusion was employed to calculate the diffusivity of fluorescein molecules
into the 40% PEG-DA-700 barrier [39]:
∂C ∂2 C
= D 2, (1)
∂t ∂x
where D represents the diffusivity of fluorescein in 40% PEG-DA-700 and C indicates the concentration
of fluorescein.
The solution to Equation (1) can be expressed as
   
Cx − C0 x x
C ( x, t) = = 1 − er f √ = er f c √ , (2)
Cs − C0 2 Dt 2 Dt

where C ( x = 0) = Cs is the concentration of fluorescein at the junction of the porous barrier and
the channel containing fluorescein (“Channel 1”), and C ( x = ∞) = C0 = 0 corresponds to the initial
concentration of fluorescein in PEG-DA [39]. We assume that Cs and C0 remain constant over time.
The characteristic diffusion length (L) at a given time (t) is defined as the distance at which
the concentration of the diffusing species reaches 50% of the source concentration (Cs ), and can be
approximated as [39]:
L ≈ ( Dt) /2 .
1
(3)

To determine the diffusivity of fluorescein in the 40% PEG-DA-700 barrier, we acquired time-lapse
images of fluorescein diffusion through the hydrogel from 0 min to 10 min using an inverted
epifluorescence microscope. The fluorescent time-lapse images were analyzed using ImageJ to obtain
the diffusion profiles, which show that the fluorescein molecules diffuse into the porous barrier
(Figure 4E). For the duration of the experiment (t = 10 min), since C ( x = 200 μm) = 0, we can
assume that there is negligible mass loss from the porous barrier into Channel 2. We plotted the
experimentally observed characteristic diffusion length (L) as a function of the square root of time
(t1/2 ) and performed a linear regression analysis to determine the diffusivity (D). The diffusivity of
fluorescein in 40% PEG-DA-700 was estimated to be ~4.6 × 10−7 cm2 /s from the slope (D1/2 ) of the
fitted curve (L = 6.77951t1/2 , adjusted R2 = 0.99343) (Figure 4E inset).

76
Micromachines 2018, 9, 125

Figure 4. Fluorescein diffusion test using the 3D-printed symmetric-channel diffusion microchip.
(A–C) Fluorescein diffused through the 40% PEG-DA-700 hydrogel barrier from 0 min to 60 min;
(D) graph of the fluorescein intensity profiles obtained across the microchannel in the three images
above, showing that the fluorescein intensity gradually increased in Channel 2; (E) concentration
profile of fluorescein in the 40% PEG-DA-700 hydrogel barrier from 1 min to 10 min. (Inset) Plot of the
characteristic diffusion length as a function of the square root of time (dots); the red line is a linear fit of
the dots, L = 6.77951t1/2 (adjusted R2 = 0.99343).

4. Conclusions
Our simple 3D-printed microfluidic channel with an integrated porous barrier is the
first step toward 3D-printed devices capable of more advanced functionalities. We developed
a stereolithographic co-printing process to demonstrate the selective diffusion of small ions or
fluorescein molecules through a 3D-printed porous barrier. The 3D-printed cross-channel chip
and the 3D-printed symmetric-channel chip were successfully printed using PEG-DA-575 and 40%
PEG-DA-700, respectively, for the porous barrier and PEG-DA-258 for the microchannels. We were
able to confirm the selective hydrogen ion diffusion through the PEG-DA-575 hydrogel barrier by
observing the color change of phenol red. Fluorescein diffusion was demonstrated using the 3D-printed
symmetric-channel chip, which has a 40% PEG-DA-700 hydrogel barrier in the microchannel.
The proposed stereolithographic co-printing process for fabricating selective porous barriers will
provide an inexpensive, simple, convenient, and reproducible molecule delivery platform that can
be applied in the fields of tissue engineering, drug delivery systems, and biomaterials. 3D-printed
hydrogels with larger porosities could potentially be used for filtering particles from bodily fluids such
as circulating tumor DNA, exosomes, bacteria, and circulating tumor cells, and in general 3D-printed
hydrogels could be used for immobilizing biomolecules within microfluidic devices for biosensing
applications. Moreover, the biocompatibility of 3D-printed PEG-DA-258 microdevices as well as

77
Micromachines 2018, 9, 125

PEG-DA-700 structures makes our strategy of printing porous barriers inside a microchannel amenable
to the development of cell-based assays and organ-on-chip platforms [40,41].

Acknowledgments: This research was partially supported by the National Cancer Institute (Grant No.
5R01CA181445) and the BioNano Health-Guard Research Center funded by the Ministry of Science, ICT (MSIT) of
Korea as Global Frontier Project (Grant No. H-GUARD_2014M3A6B2060302).
Author Contributions: Yong Tae Kim fabricated the diffusion chips, tested the ion and molecule diffusion using
the diffusion chips, and wrote the paper. Kurt Castro developed the stereolithographic co-printing methods
and PEG-DA-575 hydrogel printing conditions. Nirveek Bhattacharjee discussed the details of experiments and
advanced 3D printing using PEG-DA-258 resin. Albert Folch advised on and enabled funding for the project.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Novikov, D.S.; Fieremans, E.; Jensen, J.H.; Helpern, J.A. Random walks with barriers. Nat. Phys. 2011, 7,
508–514. [CrossRef] [PubMed]
2. Nance, E.A.; Woodworth, G.F.; Sailor, K.A.; Shih, T.-Y.; Xu, Q.; Swaminathan, G.; Xiang, D.; Eberhart, C.;
Hanes, J. A dense poly(ethylene glycol) coating improves penetration of large polymeric nanoparticles eithin
brain tissue. Sci. Transl. Med. 2012, 4, 149ra119. [CrossRef] [PubMed]
3. Verhulsel, M.; Vignes, M.; Descroix, S.; Malaquin, L.; Vignjevic, D.M.; Viovy, J.L. A review of microfabrication
and hydrogel engineering for micro-organs on chips. Biomaterials 2014, 35, 1816–1832. [CrossRef] [PubMed]
4. Gizzatov, A.; Key, J.; Aryal, S.; Ananta, J.; Cervadoro, A.; Palange, A.L.; Fasano, M.; Stigliano, C.; Zhong, M.;
Di Mascolo, D.; et al. Hierarchically structured magnetic nanoconstructs with enhanced relaxivity and
cooperative tumor accumulation. Adv. Funct. Mater. 2014, 24, 4584–4594. [CrossRef] [PubMed]
5. Park, H.B.; Jung, C.H.; Lee, Y.M.; Hill, A.J.; Pas, S.J.; Mudie, S.T.; Wagner, E.V.; Freeman, B.D.; Cookson, D.J.
Polymers with cavities tuned for fast selective transport of small molecules and ions. Science 2007, 318,
254–258. [CrossRef] [PubMed]
6. El-Ali, J.; Sorger, P.K.; Jensen, K.F. Cells on chips. Nature 2006, 442, 403–411. [CrossRef] [PubMed]
7. Unger, M.A. Monolithic microfabricated valves and pumps by multilayer soft lithography. Science 2000, 288,
113–116. [CrossRef] [PubMed]
8. Sackmann, E.K.; Fulton, A.L.; Beebe, D.J. The present and future role of microfluidics in biomedical research.
Nature 2014, 507, 181–189. [CrossRef] [PubMed]
9. Ren, K.; Zhou, J.; Wu, H. Materials for microfluidic chip fabrication. Acc. Chem. Res. 2013, 46, 2396–2406.
[CrossRef] [PubMed]
10. Hsu, C.H.; Folch, A. Spatio-temporally-complex concentration profiles using a tunable chaotic micromixer.
Appl. Phys. Lett. 2006, 89, 144102. [CrossRef]
11. Scott, A.; Weir, K.; Easton, C.; Huynh, W.; Moody, W.J.; Folch, A. A microfluidic microelectrode array for
simultaneous electrophysiology, chemical stimulation, and imaging of brain slices. Lab Chip 2013, 13, 527–535.
[CrossRef] [PubMed]
12. Lai, H.; Folch, A. Design and dynamic characterization of “single-stroke” peristaltic PDMS micropumps.
Lab Chip 2011, 11, 336–342. [CrossRef] [PubMed]
13. Seliktar, D. Designing cell-compatible hydrogels. Science 2012, 336, 1124–1128. [CrossRef] [PubMed]
14. Vagias, A.; Košovan, P.; Koynov, K.; Holm, C.; Butt, H.J.; Fytas, G. Dynamics in stimuli-responsive
poly(N-isopropylacrylamide) hydrogel layers as revealed by fluorescence correlation spectroscopy.
Macromolecules 2014, 47, 5303–5312. [CrossRef]
15. Nguyen, K.T.; West, J.L. Photopolymerizable hydrogels for tissue engineering applications. Biomaterials 2002,
23, 4307–4314. [CrossRef]
16. Zustiak, S.P.; Boukari, H.; Leach, J.B. Solute diffusion and interactions in cross-linked poly(ethylene glycol)
hydrogels studied by fluorescence correlation spectroscopy. Soft Matter 2010, 6, 3609–3618. [CrossRef]
[PubMed]
17. Hubbell, J.A. Hydrogel systems for barriers and local drug delivery in the control of wound healing.
J. Control. Release 1996, 39, 305–313. [CrossRef]
18. Tourovskaia, A.; Figueroa-Masot, X.; Folch, A. Long-term microfluidic cultures of myotube microarrays for
high-throughput focal stimulation. Nat. Protoc. 2006, 1, 1092–1104. [CrossRef] [PubMed]

78
Micromachines 2018, 9, 125

19. Hou, X.; Zhang, Y.S.; De Santiago, G.T.; Alvarez, M.M.; Ribas, J.; Jonas, S.J.; Weiss, P.S.; Andrews, A.M.; Aizenberg, J.;
Khademhosseini, A. Interplay between materials and microfluidics. Nat. Rev. Mater. 2017, 2, 17016. [CrossRef]
20. Khademhosseini, A.; Langer, R. Microengineered hydrogels for tissue engineering. Biomaterials 2007, 28,
5087–5092. [CrossRef] [PubMed]
21. Peppas, N.A.; Hilt, J.Z.; Khademhosseini, A.; Langer, R. Hydrogels in biology and medicine: From molecular
principles to bionanotechnology. Adv. Mater. 2006, 18, 1345–1360. [CrossRef]
22. Cosson, S.; Lutolf, M.P. Hydrogel microfluidics for the patterning of pluripotent stem cells. Sci. Rep. 2014, 4, 4462.
[CrossRef] [PubMed]
23. Lee, A.G.; Arena, C.P.; Beebe, D.J.; Palecek, S.P. Development of macroporous poly(ethylene glycol) hydrogel
arrays within microfluidic channels. Biomacromolecules 2010, 11, 3316–3324. [CrossRef] [PubMed]
24. Huang, C.P.; Lu, J.; Seon, H.; Lee, A.P.; Flanagan, L.A.; Kim, H.-Y.; Putnam, A.J.; Jeon, N.L. Engineering
microscale cellular niches for three-dimensional multicellular co-cultures. Lab Chip 2009, 9, 1740–1748.
[CrossRef] [PubMed]
25. Sung, J.H.; Kam, C.; Shuler, M.L. A microfluidic device for a pharmacokinetic–pharmacodynamic (PK–PD)
model on a chip. Lab Chip 2010, 10, 446–455. [CrossRef] [PubMed]
26. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-Printed Microfluidics. Angew. Chem. Int. Ed. 2016, 55,
3862–3881. [CrossRef] [PubMed]
27. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742. [CrossRef] [PubMed]
28. Kirchmajer, D.M.; Gorkin, R., III; in het Panhuis, M. An overview of the suitability of hydrogel-forming
polymers for extrusion-based 3D-printing. J. Mater. Chem. B 2015, 3, 4105–4117. [CrossRef]
29. Pantani, R.; Turng, L.S. Manufacturing of advanced biodegradable polymeric components. J. Appl. Polym. Sci.
2015, 132. [CrossRef]
30. Mohanty, S.; Larsen, L.B.; Trifol, J.; Szabo, P.; Burri, H.V.R.; Canali, C.; Dufva, M.; Emnéus, J.; Wolff, A.
Fabrication of scalable and structured tissue engineering scaffolds using water dissolvable sacrificial 3D
printed moulds. Mater. Sci. Eng. C 2015, 55, 569–578. [CrossRef] [PubMed]
31. Mohanty, S.; Sanger, K.; Heiskanen, A.; Trifol, J.; Szabo, P.; Dufva, M.; Emnéus, J.; Wolff, A. Fabrication of
scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle
leaching. Mater. Sci. Eng. C 2016, 61, 180–189. [CrossRef] [PubMed]
32. He, Y.; Yang, F.; Zhao, H.; Gao, Q.; Xia, B.; Fu, J. Research on the printability of hydrogels in 3D bioprinting.
Sci. Rep. 2016, 6, 29977. [CrossRef] [PubMed]
33. Hinton, T.J.; Jallerat, Q.; Palchesko, R.N.; Park, J.H.; Grodzicki, M.S.; Shue, H.-J.; Ramadan, M.H.;
Hudson, A.R.; Feinberg, A.W. Three-dimensional printing of complex biological structures by freeform
reversible embedding of suspended hydrogels. Sci. Adv. 2015, 1, e1500758. [CrossRef] [PubMed]
34. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Garcia-Cordero, J.L.; et al. 3D-printing of transparent bio-microfluidic
devices in PEG-DA. Lab Chip 2016, 16, 2287–2294. [CrossRef] [PubMed]
35. Cruise, G.M.; Scharp, D.S.; Hubbell, J.A. Characterization of permeability and network structure of
interfacially photopolymerized poly(ethylene glycol) diacrylate hydrogels. Biomaterials 1998, 19, 1287–1294.
[CrossRef]
36. Mellott, M.B.; Searcy, K.; Pishko, M.V. Release of protein from highly cross-linked hydrogels of poly(ethylene
glycol) diacrylate fabricated by UV polymerization. Biomaterials 2001, 22, 929–941. [CrossRef]
37. Russell, R.J.; Axel, A.C.; Shields, K.L.; Pishko, M.V. Mass transfer in rapidly photopolymerized poly(ethylene
glycol) hydrogels used for chemical sensing. Macromolecules 2001, 42, 4893–4901. [CrossRef]
38. Pick, E.; Keisari, Y. A simple colorimetric method for the measurement of hydrogen peroxide produced by
cells in culture. J. Immunol. Methods 1980, 38, 161–170. [CrossRef]
39. Kirby, B.J. Micro- and Nanoscale Fluid Mechanics: Transport in Microfluidic Devices; Cambridge University Press:
Cambridge, UK, 2010; ISBN 978-0-521-11903-0.

79
Micromachines 2018, 9, 125

40. Cvetkonic, C.; Raman, R.; Chan, V.; Williams, B.J.; Tolish, M.; Bajaj, P.; Sakar, M.S.; Asada, H.H.; Saif, M.T.;
Bashir, R. Three-dimensionally printed biological machines powered by skeletal muscle. Proc. Natl. Acad.
Sci. USA 2014, 111, 10123–10130.
41. Khademhosseini, A.; Yeh, J.; Jon, S.; Eng, G.; Suh, K.Y.; Burdick, J.A.; Langer, R. Molded polyethylene glycol
microstructures for capturing cells within microfluidic channels. Lab Chip 2014, 4, 425–430. [CrossRef]
[PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

80
micromachines

Article
Open Design 3D-Printable Adjustable Micropipette
that Meets the ISO Standard for Accuracy
Martin D. Brennan, Fahad F. Bokhari and David T. Eddington *
Department of Bioengineering, University of Illinois at Chicago, Chicago, IL 60607, USA;
[email protected] (M.D.B.); [email protected] (F.F.B.)
* Correspondence: [email protected]; Tel.: +1-312-355-3278

Received: 30 March 2018; Accepted: 17 April 2018; Published: 18 April 2018

Abstract: Scientific communities are drawn to the open source model as an increasingly utilitarian
method to produce and share work. Initially used as a means to develop freely-available software,
open source projects have been applied to hardware including scientific tools. Increasing convenience
of 3D printing has fueled the proliferation of open labware projects aiming to develop and share
designs for scientific tools that can be produced in-house as inexpensive alternatives to commercial
products. We present our design of a micropipette that is assembled from 3D-printable parts and some
hardware that works by actuating a disposable syringe to a user-adjustable limit. Graduations on the
syringe are used to accurately adjust the set point to the desired volume. Our open design printed
micropipette is assessed in comparison with a commercial pipette and meets the ISO 8655 standards.

Keywords: open source labware; 3D printing; functional prototyping

1. Introduction
The open source development model, initially applied to software, is thriving in the development
of open source scientific equipment due in part to increasing access of 3D printing [1,2]. Additive
manufacturing methods have existed for decades although the recent availability of inexpensive
desktop printers [3,4] has made it feasible for consumers to design and print prototypes and even
functional parts, as well as consumer goods [5,6]. The proliferation of free CAD software [7–10]
and design sharing sites [11–14] has also supported the growth and popularity of open designed
parts and projects. Open design 3D-printable lab equipment is an attractive idea because, like
open source software, it allows free access to technology that is otherwise inaccessible due to
proprietary and/or financial barriers. Open design tools create the opportunity for scientists and
educational programs in remote or resource-limited areas to participate with inexpensive and easy
to make tools [15–20]. Open source development also enables the development of custom solutions
to meet unique applications not met by commercial products that are shared freely and are user
modifiable [5,21–26]. Some advanced, noteworthy, open source scientific equipment include a PCR
device [27], a tissue scaffold printer [28] and a two-photon microscope [29], although simple tools have
the potential to be impactful as they can serve a wider community.
Some simple and clever printable parts that have emerged are ones that give a new function to
a ubiquitous existing device, such as a drill bit attachment designed to hold centrifuge tubes, allowing
a dremel to be used as a centrifuge [30]. Although this may make a rather crude centrifuge, it may be an
adequate solution for a fraction of the cost of a commercial centrifuge. Other examples of open source
research tools that utilize 3D-printed parts include optics equipment [31], microscopes [32,33], syringe
pumps [34,35], reactionware [36–39] and microfluidics [40,41], and the list continues to grow [42].
One example of an everyday scientific tool that provides the opportunity for an open design
solution is the micropipette. An open design micropipette that can be made inexpensively affords

Micromachines 2018, 9, 191; doi:10.3390/mi9040191 81 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 191

more options for labs and educational settings. Micropipettes are an indispensable tool used routinely
in lab tasks and can easily cost $1000 USD for a set. Often, a lab will require several sets each for
a dedicated task. Some pipettes may even be re-calibrated for use with liquids of different properties.
Air displacement pipettes use a piston operating principle to draw liquid into the pipette [43].
In a typical commercial pipette. the piston is made to be gas-tight with a gasketed plunger inside
a smooth barrel. Consumer-grade fused deposition modeling (FDM) printers are unable to build
a smooth surface due to the formation of ridges that occur as each layer is deposited [44]. The ridges
formed by FDM make it impractical to form a gas-tight seal between moving parts, even with a gasket.
Existing printable open-design micropipettes get around this limitation by stretching a membrane over
one end of a printed tube, which when pressed causes the displacement. The displacement membrane
can be made from any elastic material such as a latex glove. A few open design micropipettes exist
including a popular one, which in addition to the printed parts, uses parts scavenged from a retractable
pen [45]. A major limitation of this design is that there is no built-in feature such as a readout for
the user to set the displacement to a desired volume. This requires the user to validate the volumes
dispensed with a high precision scale. Without verification with a scale, the volumes dispensed
can only be estimated based on the calculations of the deflection of the membrane, which is not
a practical protocol.
We submit a new design whose major strength is the ability to adjust to any volume aided by the
built-in scale. Our open design 3D-printable micropipette works by actuating a disposable syringe to
a user-adjustable set point. This allows the user to set the pipette to a volume by reading the graduations
on the syringe barrel. We have also designed an adjusted graduation scale, to be used in place of the
printed on scale, that corrects for the compressibility of air, which allows the pipette to be set accurately.
Additionally, our pipette offers a simplified assembly requiring no glue, tape or permanent connections.

2. Materials and Methods


Our printed pipette is designed to actuate a 1-mL or 3-mL syringe to a user-set displacement.
The core of the design is two printed parts, the body and the plunger, which are able to be printed on
a consumer-grade FDM printer (Figure 1), in this case a Makerbot Replicator.

Figure 1. CAD renderings of printable parts and cross-sections. (A) The printed plunger part is a shaft
that pushes on the syringe plunger and slides in the printed body part. The printed plunger has
a latching tongue and button, which interfaces with the printed body part. (B) The printed body part
holds the syringe and interfaces with the printed plunger part. The body part features the unlatching
button and slots to hold the syringe in place by its flanges. The body part also has two cutouts in the
top for the plunger button and for the hex nut and bolt. STL files of the printable parts are available
in the Supplementary Materials.

82
Micromachines 2018, 9, 191

A 1-mL or 3-mL syringe twists to lock in the body part and is held into place by the syringe
flanges. The 30–300-μL configuration uses a 1-mL pipette, and the 100–1000-μL configuration uses
a 3-mL pipette. The plunger part slides freely in the body part and actuates the syringe by pushing
the thumb button (Figure 2). The pipette is spring loaded towards a set point, which is adjustable by
a set-screw. When the thumb button is pressed, the system locks when it reaches the latched position,
where it is ready to draw in fluid. The plunger is held in place with a latching mechanism, which
when released, draws in fluid. The displacement is equal to the distance between the set position
and the latched position. The pipette can also be pressed past the latched position to ‘blow-out’ the
transferred fluid completely from the pipette tip. For a demonstration of the assembly and operation,
see the videos in the Supplementary Materials. Additional materials required for assembly include
two springs, a nut and a bolt (Tables A1 and A2). Attempts to make a printable luer lock adapter for
tips was abandoned as the surface of printed parts is too rough to make an air-tight seal with the luer
or pipette tip. Instead, a combination of a barbed luer adapter and elastic tubing is used to attach the
pipette tips. Our printed pipette mimics commercial pipettes in design, function and user operation,
making it intuitive to use.

Figure 2. CAD renderings of assembled pipette and function. The pipette actuates the syringe to three
positions. (A) The latched position. When the plunger is pressed, the pipette locks at this position.
The tip is then placed in a liquid, and the unlatching button is pressed to release the pipette back to
the set position (B), drawing in liquid. (B) The set position. The position of the screw determines
the total displacement that the plunger moves. The pipette is spring loaded to return to this position.
(C) The blow-out position. The fluid is transferred by pressing the plunger past the latched position to
blow-out all the liquid. (D) Return to the latched position. The pipette returns to the latched position
ready to perform another transfer.

83
Micromachines 2018, 9, 191

Our pipette uses the air-displacement method, where a vacuum is applied to a pocket of air
to draw liquid into the pipette. As air is a compressible fluid, this pocket of air expands due to the
weight of the liquid pulling on it. Due to this effect, the graduations on the syringe are not accurate,
as they are designed for measuring liquid within the syringe. At larger volumes, this effect is more
pronounced, resulting in the volume measured being greater than the amount of liquid pulled into the
syringe. We remedied this by creating a new scale to account for the expansion. The scale is printed on
a transparency sheet and is taped onto the syringe for accurate measurements (the scales appear in
Appendix A: Figures A1 and A2).

2.1. Fabrication and Assembly


Two parts are printed at normal resolution with rafts on a Makerbot Replicator (STL files are
available in the Supplementary Materials). A disposable syringe and a few extra parts are used to
assemble the pipette (Figure 3). A small amount of paraffin wax is applied to the screw to prevent slop
from causing the set point to drift after each actuation. The nut is sunk into the hex inset in the printed
body part. The bolt is threaded in from the top of the body into the nut. Two springs are threaded
onto the plunger of a 1-mL syringe for the 30–300-μL configuration. Springs are placed inside a 3-mL
syringe for the 100–1000-μL configuration. The plunger part is inserted in the body, and the syringe
assembly is pushed in and locked from the syringe flanges to the body part to complete assembly
(Figure 4). Parts and cost are listed in Tables A1 and A2 in Appendix A.

Figure 3. Photo of the parts to make the pipette. (A) Printed body part. (B) Printed plunger part.
(C) Springs. (D) M3 hex nut and M3 bolt. (E) Disposable syringes. (F) Two sizes of tubing to adapt
pipette tips to luer barbs. (G) Luer lock syringe-to-barb adapters. (H) Pipette tips. A list of parts is
in Appendix A: Tables A1 and A2.

84
Micromachines 2018, 9, 191

Figure 4. Photos of assembled pipettes. (A) Two assemblies of the pipette: the 100–1000-μL configuration
(top) and the 30–300-μL configuration (bottom). (B) Close-up photo of the taped on scale for each of
the syringes. Scales are available in the Appendix A: Figures A1 and A2.

2.2. Validation
The printed pipette’s accuracy and precision were characterized and compared to a commercial
pipette, as well as ISO 8655. The printed pipette was adjusted to the target volume by eye from the
syringe graduations. Deionized water was transferred and measured with a high precision scale.
Five transfers were recorded and averaged to account for random variability. Data were taken for
printed pipettes with existing syringe graduations, as well as with our adjusted scale. Data were taken
with commercial pipettes of 30–300 μL and 100–1000 μL to compare to the printed pipette. Accuracy
and precision are expressed as systematic error and random error, respectively, and are calculated
according to ISO 8655 [43] (Tables 1 and 2). The systematic error, or accuracy, is calculated according to
the following equations where accuracy (A) is the difference of the mean volume (V̄) and the nominal
volume (Vo ):
A = V̄ − Vo , A% = 100% × A/Vo (1)

The precision or random error is the standard deviation (s) of the measurements, and (cv) is the
coefficient of variation: 
∑in=1 (Vi − V̄ )2
s= , cv = 100% × s/V̄ (2)
n−1

3. Results
Using the adjusted syringe graduation scale, our printed pipette meets ISO 8655 standards,
but using the existing syringe graduation scale does not meet the ISO standard for accuracy. According
to ISO 8655 for a pipette with the maximum nominal volume of 1000 μL, the systematic error
cannot exceed 8 μL, and the random error cannot exceed 3 μL [43]. For the maximum nominal

85
Micromachines 2018, 9, 191

volume of 300 μL, the systemic error cannot exceed 4 μL, and the random error cannot exceed
1.5 μL. The commercial pipettes met these standards handily, but in our initial tests with our printed
pipette, we noticed large negative systematic error, suggesting that we were missing a biasing
factor. This error was exaggerated while transferring larger volumes (Figures 5 and 6). After further
investigation, we realized that the water in the tip pulls on the air due to gravity, which causes the
air to expand, making measuring with the graduations inaccurate. The graduations are intended to
measure incompressible fluids within the syringe, while we were using them to measure air while
under vacuum. The syringe graduations could not be expected to accurately indicate the volume of
water pulled into the tip, because the air had expanded under vacuum. This explains the negative
systematic error we were experiencing.
Our solution was to replace the built-in scale with a scale that accounted for the expansion.
We compared expected volumes with actual measurements and noticed a linear relationship. We scaled
up the graduations by a factor of 1:1.027 for both the 100–1000-μL, and 30–300-μL configurations.
These adjusted scales are printed on paper or a transparency sheet and taped onto the syringe with
the zero at the plunger when the pipette is in the latched position (scales appear in Appendix A:
Figures A1 and A2). With the new scale taped on the syringe, our validation testing met the ISO 8655
standard. Replacing the built-in scale with our scale corrected this effect. Our printed pipette with the
adjusted scale meets ISO standards for accuracy and precision (Tables 1 and 2).

Figure 5. Comparison of the accuracy, or systematic error, among 100–1000-μL pipettes. The box plot
indicates the range of the ISO standard; the plotted circle indicates the commercial pipette; and the
plotted squares are the printed pipette. Empty squares are with the printed pipette with our adjusted
graduation scale, and the filled squares are measurements taken with the syringe’s existing graduations
(data from Table 1.)

86
Micromachines 2018, 9, 191

Figure 6. Comparison of the accuracy, or systematic error, among 30–300-μL pipettes. The box plot
indicates the range of the ISO standard; the plotted circle indicates the commercial pipette; and the
plotted squares are the printed pipette. Empty squares are with the printed pipette with our adjusted
graduation scale, and the filled squares are measurements taken with the syringe’s existing graduations
(data from Table 2.)

Table 1. ISO 8655 for 100–1000-μL comparing a commercial pipette with our printed pipette used with
the existing 3-mL syringe scale and an adjusted scale.

Mean Systematic Error % Sys. Err. Random Error % Rand. Err.


ISO 8655, 100–1000 μL 1000 8.00 0.80 3.00 0.30
Commercial Pipette 1002.98 2.98 0.30 1.72 0.17
1000 μL
Printed Pipette 949.29 −50.71 −5.07 0.60 0.06
Printed Pipette Scale 1003.57 3.57 0.36 0.89 0.09
ISO 8655, 100–1000 μL 500 8.00 1.60 3.00 0.60
Commercial Pipette 503.67 3.67 0.73 0.49 0.10
500 μL
Printed Pipette 475.99 −24.01 −4.80 4.75 1.00
Printed Pipette Scale 503.62 3.62 0.72 1.64 0.33
ISO 8655, 100–1000 μL 200 8.00 4.00 3.00 1.50
Commercial Pipette 204.61 4.61 2.30 0.15 0.07
200 μL
Printed Pipette 186.55 −13.45 −6.72 1.31 0.70
Printed Pipette Scale 201.87 1.87 0.94 1.47 0.73
ISO 8655, 100–1000 μL 100 8.00 8.00 3.00 3.00
Commercial Pipette 104.29 4.29 4.29 1.65 1.58
100 μL
Printed Pipette 94.02 −5.98 −5.98 4.81 5.12
Printed Pipette Scale 101.00 1.00 1.00 1.05 1.04

87
Micromachines 2018, 9, 191

Table 2. ISO 8655 for 30–300-μL comparing a commercial pipette with our printed pipette used with
the existing 3-mL syringe scale and an adjusted scale.

Mean Systematic Error % Sys. Err. Random Error % Rand. Err.


ISO 8655, 30–300 μL 300 4.00 1.33 1.50 0.50
Commercial Pipette 301.19 1.19 0.40 0.53 0.18
300 μL
Printed Pipette 286.91 −13.09 −4.36 0.42 0.15
Printed Pipette Scale 299.11 −0.89 −0.30 0.48 0.16
ISO 8655, 30–300 μL 200 4 2 1.5 0.75
Commercial Pipette 200.06 0.06 0.03 0.46 0.23
200 μL
Printed Pipette 193.40 −6.60 −3.30 2.86 1.48
Printed Pipette Scale 200.57 0.57 0.28 0.86 0.43
ISO 8655, 30–300 μL 50 4 8 1.5 3
Commercial Pipette 49.02 −0.98 −1.96 0.10 0.20
50 μL
Printed Pipette 49.62 −0.38 −0.76 1.26 2.53
Printed Pipette Scale 48.73 −1.27 −2.54 1.11 2.27
ISO 8655, 30–300 μL 30 4 13.3 1.5 5
Commercial Pipette 29.08 −0.92 −3.06 0.09 0.31
30 μL
Printed Pipette 29.22 −0.78 −2.59 0.31 1.07
Printed Pipette Scale 27.78 −2.22 −7.41 1.37 4.93

4. Discussion and Conclusions


Our printed pipette improves on existing open design pipettes in several ways. Most significantly,
the user is able to adjust the syringe accurately without verifying the volume with a scale. The pipette
can be adjusted to any discrete volume within range. In addition, the assembly requires no permanent
connections using tape or glue, which allows for re-configuration and easy replacement of parts.
Conveniently, our design can also reach to the bottom of a 15-mL conical tube allowing tasks such
as aspirating supernatant fluid from a cell pellet. Unlike existing designs, our design does not use
a membrane that may wear out and require replacement. The only major limitation of this design
compared to the biropipette [45] is the option for a pipette tip ejector. The biropipette also uses arguably
easier to source parts (a pen vs. a syringe) relative to what is required for our design. The biropipette
also was developed in OpenSCAD, which is free and open source CAD software, whereas our design
was created in Solidworks, a proprietary software. This creates a limitation for users who may not
have access to the proprietary software used to make the design. Fortunately, the produced STL files
are universal and can be imported and modified by any CAD software.
The luer to pipette tip connection is a good candidate for a 3D-printed solution. Unfortunately,
the current state of FDM cannot make this adapter with high enough resolution or, critically, surface
smoothness [44]. Other printing techniques, such as stereolithography (SLA) and multijet printing
(MJP), provide higher resolution and smoother finishing, yet FDM is the the most widely available
and affordable of the printing technologies. SLA printers are coming down in price, but are still
significantly more expensive, especially considering the higher cost of the consumable resin vs. FDM
filament. Ultimately, the goal of this project is to make this pipette inexpensive and easy to make.
Our design relies heavily on the syringe, a specialized part, for the core function, as well as
accuracy. Fortunately, as disposable syringes are a regulated medical device, they must meet high
standards, making them a reliable part for this design. As good as the performance of our printed
pipette is, a commercial pipette should be expected to be more reliable and preferred for critical
procedures. Adjusting our printed pipette to the desired volume requires more time and attention,
which would be tedious for procedures requiring many adjustments. On the other hand, due to the $6
cost to make it, many printed pipettes could be assembled and pre-set, each for a planned transfer,
rather then re-adjusting one commercial pipette for each step. The printable pipette can also be used
as a disposable, sparing the commercial micropipette when damage from volatile reagents is a concern

88
Micromachines 2018, 9, 191

or in situations were cross-contamination and resterilization is required. This pipette would also be
ideal for high school and teaching labs or any resource-limited program.
The open design nature of this project encourages anyone to use and submit changes to improve
and add features to this design. All of the working files and documentation are kept in a public
repository [46]. Future directions for this project include developing a tip ejection system and additional
configurations for transferring volumes below 30 μL, as well as increasing overall user friendliness,
such as making the adjusting bolt easier to grip and improving ergonomics. It is our hope that this
project will be under continuous development where improvements and compatibility with different
syringes and printers can be crowd-sourced from community contributors.

Supplementary Materials: The following are available online at https://zenodo.org/record/1220094#


.WtcQ2FKSCJ1: File S1: body-clip.STL, File S2: plunger.STL, Video S1: Assembly of the pipette, Video S2:
Operation of the pipette.
Acknowledgments: We would like to acknowledge the UIC Bioengineering Senior Design team of 2014 for initial
work on this project: Oluwafemi Aboloye, Pedro Hurtado, Rafael Romero and Vivian Sandoval.
Author Contributions: M.D.B. wrote the manuscript. M.D.B. and F.F.B. designed the device, collected and
analyzed data and made the figures. D.T.E. advised and reviewed the manuscript.
Conflicts of Interest: Martin Brennan and David Eddington are founders of Go Go Micro LLC and have equity
interest in the company.

Appendix A. Additional Materials

Table A1. Parts and cost for the 30–300-μL pipette.

30–300 mL Configuration: Source Unit Price Part Number


Filament Makerbot $1.63 NA
1-mL Syringe BD Biosciences $0.15 309628
M3 Bolt, 35 mm McMaster-Carr $0.12 91287A026
M3 Nut McMaster-Carr $0.01 90591A121
Music Wire Compression Springs * (2) Jones Spring Co $1.23 C10-022-048
Female Luer to 1/8" Hose Barb Adapter Cole-Parmer $0.40 EW-30800-08
Tygon Tubing, 1/16” ID × 3/16” OD Cole-Parmer $0.03 EW-06407-72
300-μL Tips (10) Fisher Scientific $0.34 02-707-447
Total $3.91
* Spring specifications: Overall length 38 mm, OD 7.62 mm, wire diameter 0.56 mm, Max load 0.86 kg, with
closed and flat ends. Also available from McMaster-Carr P/N: 9657K347.

Table A2. Parts and cost for the 100–1000-μL pipette.

100–1000 mL Configuration: Source Unit Price Part Number


Filament Makerbot $1.63 NA
3-mL Syringe BD Biosciences $0.73 309657
M3 Bolt, 35 mm McMaster-Carr $0.12 91287A026
M3 Nut McMaster-Carr $0.01 90591A121
Music Wire Compression Springs * (2) Jones Spring Co $1.23 C10-022-048
Female luer to 5/32" Hose Barb Adapter Cole-Parmer $0.66 EW-45508-06
Tygon Tubing, 1/8" ID × 1/4" OD Cole-Parmer $0.05 EW-06407-76
1000-μL Tips (10) Fisher Scientific $0.41 02-707-400
Total $4.84
* Spring specifications: Overall length 38 mm, OD 7.62 mm, wire diameter 0.56 mm, Max load 0.86 kg, with
closed and flat ends. Also available from McMaster-Carr P/N: 9657K347.

89
Micromachines 2018, 9, 191

Figure A1. Adjusted scale graduations for the 30–300-μL pipette. Adjusted scale graduations that can
be printed on paper or a transparency sheet and taped onto a 1-mL syringe. Using these graduations
will correct for expansion of air and allow ISO standards to be met. One-inch and 1-cm marks to check
the scale are included, as well as a reproduction of the existing 1-mL syringe graduation marks.

Figure A2. Adjusted scale graduations for the 100–1000-μL pipette. Adjusted scale graduations that can
be printed on paper or a transparency sheet and taped onto a 3-mL syringe. Using these graduations
will correct for expansion of air and allow ISO standards to be met. One-inch and 1-cm marks to check
the scale are included, as well as a reproduction of the existing 3-mL syringe graduation marks. Print
this image to 100% scale.

References
1. Baden, T.; Chagas, A.M.; Gage, G.; Marzullo, T.; Prieto-Godino, L.L.; Euler, T. Open Labware: 3-D Printing
Your Own Lab Equipment. PLoS Biol. 2015, 13, e1002086. [CrossRef]
2. Pearce, J. M. Open-Source Lab: How to Build Your Own Hardware and Reduce Research Costs; Newnes:
New South Wales, Australia, 2013.
3. Makerbot Industries. Makerbot. 2018. Available online: https://www.makerbot.com/ (accessed on 18 April 2018).
4. RepRap Project. RepRap. 2018. Available online: reprap.org (accessed on 18 April 2018).

90
Micromachines 2018, 9, 191

5. Fullerton, J.N.; Frodsham, G.C.M.; Day, R.M. 3D printing for the many, not the few. Nat. Biotechnol. 2014, 32,
1086–1087. [CrossRef]
6. Wittbrodt, B.; Glover, A.G.; Laureto, J.; Anzalone, G.C.; Oppliger, D.; Irwin, J.L.; Pearce, J.M. Life-cycle
economic analysis of distributed manufacturing with open-source 3-D printers. Mechatronics 2013, 23,
713–726. [CrossRef]
7. Kintel, M. OpenSCAD. 2018. Available online: http://www.openscad.org/ (accessed on 18 April 2018).
8. Blender Foudation. Blender. 2018. Available online: www.blender.org (accessed on 18 April 2018).
9. Trimble Inc. SketchUp. 2016. Available online: www.sketchup.com (accessed on 18 April 2018).
10. Autodesk Inc. Autodesk 123D. 2018. Available online: www.123dapp.com (accessed on 18 April 2018).
11. Makerbot Industries. Thingiverse. 2018. Available online: https://www.thingiverse.com/ (accessed on
18 April 2018).
12. National Institutes of Health. NIH 3D Print Exchange. 2018. Available online: http://3dprint.nih.gov/
(accessed on 18 April 2018).
13. Stratasys. GrabCAD. Available online: https://grabcad.com/ (accessed on 18 April 2018).
14. GitHub Inc. GitHub. 2018. Available online: https://github.com/ (accessed on 18 April 2018).
15. Marzullo, T.C.; Gage, G.J. The SpikerBox: A Low Cost, Open-Source BioAmplifier for Increasing Public
Participation In Neuroscience Inquiry. PLoS ONE 2012, 7, e30837. [CrossRef]
16. Lang, T. Advancing global health research through digital technology and sharing data. Science 2011, 331,
714–717. [CrossRef]
17. Fobel, R.; Fobel, C.; Wheeler, A.R. DropBot: An open-source digital microfluidic control system with precise
control of electrostatic driving force and instantaneous drop velocity measurement. Appl. Phys. Lett. 2013,
102, 1–5. [CrossRef]
18. Baker, E. Open source data logger for low-cost environmental monitoring. Biodivers. Data J. 2014, e1059.
[CrossRef]
19. Cybulski, J.S.; Clements, J.; Prakash, M. Foldscope: origami-based paper microscope. PLoS ONE 2014, 9, e98781.
[CrossRef]
20. Bhamla, M.S.; Benson, B.; Chai, C.; Katsikis, G.; Johri, A.; Prakash, M. Hand-powered ultralow-cost paper
centrifuge. Nat. Biomed. Eng. 2017, 1, 0009. [CrossRef]
21. Pearce, J.M. Building Research Equipment with Free, Open-Source Hardware. Science 2012, 337, 1303–1304.
[CrossRef]
22. Rankin, T.M.; Giovinco, N.A.; Cucher, D.J.; Watts, G.; Hurwitz, B.; Armstrong, D.G. Three-dimensional
printing surgical instruments: are we there yet? J. Surg. Res. 2014, 189, 193–197. [CrossRef]
23. Sulkin, M.S.; Widder, E.; Shao, C.; Holzem, K.M.; Gloschat, C.; Gutbrod, S.R.; Efimov, I.R. Three-dimensional
printing physiology laboratory technology. Am. J. Physiol.-Heart Circ. Physiol. 2013, 305, H1569–H1573.
[CrossRef]
24. Dryden, M.D.M.; Wheeler, A.R. DStat: A versatile, open-source potentiostat for electroanalysis and
integration. PLoS ONE 2015, 10, 1–17. [CrossRef]
25. Costa, E.T.; Mora, M.F.; Willis, P.A.; Lago, C.L.; Jiao, H.; Garcia, C.D. Getting started with open-hardware:
Development and control of microfluidic devices. Electrophoresis 2014, 35, 2370–2377. [CrossRef]
26. Tek, P.; Chiganos, T.C.; Mohammed, J.S.; Eddington, D.T.; Fall, C.P.; Ifft, P.; Rousche, P.J. Rapid prototyping
for neuroscience and neural engineering. J. Neurosci. Methods 2008, 172, 263–269. [CrossRef]
27. Chai Biotechnologies Inc. Open PCR. 2017. Available online: http://openpcr.org/ (accessed on 18 April 2018).
28. Trachtenberg, J.E.; Mountziaris, P.M.; Miller, J.S.; Wettergreen, M.; Kasper, F.K.; Mikos, A.G. Open-source
three-dimensional printing of biodegradable polymer scaffolds for tissue engineering. J. Biomed. Mater. Res.
Part A 2014, 102, 4326–4335. [CrossRef]
29. Rosenegger, D.G.; Tran, C.H.T.; LeDue, J.; Zhou, N.; Gordon, G.R. A High Performance, Cost-Effective,
Open-Source Microscope for Scanning Two-Photon Microscopy that Is Modular and Readily Adaptable.
PLoS ONE 2014, 9, e110475. [CrossRef]
30. Garvey, C. DremelFuge. 2009. Available online: https://www.thingiverse.com/thing:1483 (accessed on
18 April 2018).
31. Zhang, C.; Anzalone, N.C.; Faria, R.P.; Pearce, J.M. Open-Source 3D-Printable Optics Equipment. PLoS ONE
2013, 8, e59840. [CrossRef]

91
Micromachines 2018, 9, 191

32. Baden, T. Raspberry Pi Scope. 2014. Available online: http://3dprint.nih.gov/discover/3dpx-000609


(accessed on 18 April 2018).
33. Walus, K. A Fully Printable Microscope. 2014. Available online: http://3dprint.nih.gov/discover/3dpx-000304
(accessed on 18 April 2018).
34. Wijnen, B.; Hunt, E.J.; Anzalone, G.C.; Pearce, J.M. Open-Source Syringe Pump Library. PLoS ONE 2014, 9, e107216.
[CrossRef]
35. Patrick, W.G.; Nielsen, A.A.; Keating, S.J.; Levy, T.J.; Wang, C.W.; Rivera, J.J.; Mondragón-Palomino, O.;
Carr, P.A.; Voigt, C.A.; Oxman, N.; et al. DNA assembly In 3D printed fluidics. PLoS ONE 2015, 10, 1–18.
[CrossRef]
36. Symes, M.D.; Kitson, P.J.; Yan, J.; Richmond, C.J.; Cooper, G.J.; Bowman, R.W.; Vilbrandt, T.; Cronin, L.
Integrated 3D-printed reactionware for chemical synthesis and analysis. Nat. Chem. 2012, 4, 349–354.
[CrossRef]
37. Kitson, P.J.; Rosnes, M.H.; Sans, V.; Dragone, V.; Cronin, L. Configurable 3D-Printed millifluidic and
microfluidic ‘lab on a chip’ reactionware devices. Lab Chip 2012, 12, 3267–3271. [CrossRef]
38. Mathieson, J.S.; Rosnes, M.H.; Sans, V.; Kitson, P.J.; Cronin, L. Continuous parallel ESI-MS analysis of
reactions carried out In a bespoke 3D printed device. Beilstein J. Nanotechnol. 2013, 4, 285–291. [CrossRef]
39. Kitson, P.J.; Marshall, R.J.; Long, D.; Forgan, R.S.; Cronin, L. 3D Printed high-throughput hydrothermal
reactionware for discovery, optimization, and scale-up. Angew. Chem. Int. Ed. 2014, 53, 12723–12728.
[CrossRef]
40. Brennan, M.D.; Rexius-Hall, M.L.; Eddington, D.T. A 3D-Printed Oxygen Control Insert for a 24-Well Plate.
PLos ONE 2015, 10, e0137631. [CrossRef]
41. Dragone, V.; Sans, V.; Rosnes, M.H.; Kitson, P.J.; Cronin, L. 3D-printed devices for continuous-flow organic
chemistry. BeilsteIn J. Org. Chem. 2013, 9, 951–959. [CrossRef]
42. Plos Collections. Open Source Toolkit Hardware. 2017. Available online: http://collections.plos.org/open-
source-toolkit-hardware (accessed on 18 April 2018).
43. International Organization for Standardization. Piston-Operated Volumetric Apparatus—Part 1: Terminology,
General Requirements and User Recommendations; ISO 8655-1:2002(en); ISO: Geneva, Switzerland, 2002.
44. Takagishi, K.; Umezu, S. Development of the Improving Process for the 3D Printed Structure. Sci. Rep. 2017,
7, 39852. [CrossRef]
45. Baden, T. Biropette: Customisable, High Precision Pipette. 2014. Available online: http://www.thingiverse.
com/thing:255519 (accessed on 18 April 2018).
46. Eddington Lab. 3D Printable Micropipette. 2017. Available online: https://github.com/Biological-
Microsystems-Laboratory/micropipette (accessed on 18 April 2018).

c 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

92
micromachines

Perspective
Emerging Anti-Fouling Methods: Towards
Reusability of 3D-Printed Devices for
Biomedical Applications
Eric Lepowsky 1 and Savas Tasoglu 1,2,3,4,5, *
1 Department of Mechanical Engineering, University of Connecticut, Storrs, CT 06269, USA;
[email protected]
2 Department of Biomedical Engineering, University of Connecticut, Storrs, CT 06269, USA
3 Institute of Materials Science, University of Connecticut, Storrs, CT 06269, USA
4 Institute for Collaboration on Health, Intervention, and Policy, University of Connecticut,
Storrs, CT 06269, USA
5 The Connecticut Institute for the Brain and Cognitive Sciences, University of Connecticut,
Storrs, CT 06269, USA
* Correspondence: [email protected]; Tel.: +1-860-486-5919

Received: 21 March 2018; Accepted: 19 April 2018; Published: 20 April 2018

Abstract: Microfluidic devices are used in a myriad of biomedical applications such as cancer
screening, drug testing, and point-of-care diagnostics. Three-dimensional (3D) printing offers a
low-cost, rapid prototyping, efficient fabrication method, as compared to the costly—in terms of time,
labor, and resources—traditional fabrication method of soft lithography of poly(dimethylsiloxane)
(PDMS). Various 3D printing methods are applicable, including fused deposition modeling,
stereolithography, and photopolymer inkjet printing. Additionally, several materials are available
that have low-viscosity in their raw form and, after printing and curing, exhibit high material strength,
optical transparency, and biocompatibility. These features make 3D-printed microfluidic chips ideal
for biomedical applications. However, for developing devices capable of long-term use, fouling—by
nonspecific protein absorption and bacterial adhesion due to the intrinsic hydrophobicity of most
3D-printed materials—presents a barrier to reusability. For this reason, there is a growing interest
in anti-fouling methods and materials. Traditional and emerging approaches to anti-fouling are
presented in regard to their applicability to microfluidic chips, with a particular interest in approaches
compatible with 3D-printed chips.

Keywords: 3D printing; microfluidic chips; anti-fouling; surface coatings

1. Introduction
Microfluidic devices are widely used in numerous fields. Pertaining specifically to biotechnology,
microfluidic devices have been used for cancer screening [1–3], microphysiological system
engineering [4,5], high-throughput drug testing [6,7], and point-of-care diagnostics [8–10]. Within
the broad field of microfluidics, novel technologies have been reported, such as paper-based
microfluidics and three-dimensional (3D) printed devices. Each of these alternative methods addresses
different drawbacks of the conventional soft lithography fabrication of poly(dimethylsiloxane) (PDMS)
microfluidic devices. Using paper as a substrate alleviates the need for external pumps, in addition to
the added benefits of low-cost fabrication and disposability [11–16]. Three-dimensional (3D) printing
is a relatively new technique in microfluidics that offers rapid prototyping of a variety of materials,
enabling fabrication of high resolution molds, as well as direct fabrication of 3D-printed chips [17–24].
The latter is of particular interest, as microfluidic chips can be designed using computer aided design
(CAD) software and printed with high resolution. Compared to the laborious fabrication involved

Micromachines 2018, 9, 196; doi:10.3390/mi9040196 93 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 196

with PDMS chips, 3D-printed chips are low-cost, efficient, and highly customizable. Microfluidic
devices, of all forms and methods, are indispensable tools in biomedical engineering. Accordingly,
there is a need for reusable, long-term use of microfluidic chips for applications such as long-term
health monitoring. Efforts towards designing long-term use microfluidic chips can be aided by the
low-cost, high-throughput capabilities offered by 3D-printing.
Fostered by biomedical research, a transformation of the healthcare industry is imminent.
There is an unmet need for transformative technologies that are essential for enabling the shift from
hospital-centered, reactive care to proactive, person-centered care which focuses on individuals’
well-being [25]. Next-generation technologies are the vital factor in developing affordable and
accessible care, while also lowering the costs of healthcare. A promising solution to this challenge
is low-cost continuous health monitoring; this approach allows for effective screening, analysis, and
diagnosis and facilitates proactive medical intervention. In a study reported by Health Affairs, it was
shown that a 90% increase in specific preventative screenings back in 2006 would have saved more than
2 million lives without a significant increase in healthcare costs—in fact, a 0.2% decrease in costs was
estimated [26]. Not only does public health benefit, but savings in healthcare costs could be drastically
increased by further research focused on the development and implementation of preventative care
methods and tools. To support this much-needed approach, there is an impending demand for low-cost,
compact, and innovational technologies to perform routine health measurements across the population.
Microfluidic devices have a proven record for being effective analytical devices, capable of controlling
the flow of fluid samples, containing reaction and detection zones, and displaying results, all within a
compact footprint [27–30]. The next crucial step within microfluidic technologies is to address the need
for microfluidic chips capable of long-term use, with a particular interest in designing microfluidic
chips that can be embedded within sophisticated medical devices without the need for replacement by
the user [31,32].
A primary challenge in producing microfluidic devices for long-term use is the biofouling that often
occurs on the surface of integrated channels and features [33,34]. This phenomenon occurs due to surface
interactions between the walls of the channels and the biological sample flowing through the channels.
As a result, there is an accumulation of unwanted substances on the surface of the microfluidic channels,
thereby adversely affecting the performance of the device. Specifically, protein fouling, or nonspecific
protein absorption, is the cause of failure for many microfluidic devices [31]. Furthermore, once a protein
layer is formed, bacterial attachment and growth of biofilms is facilitated. To address the long-term
use of microfluidic devices, there has been a growing research interest in developing new anti-fouling
methods and materials [31,32,35–39]. If fouling can be reduced to miniscule levels, a device may be
considered reusable for the purpose of point-of-care, long-term health monitoring performed ex vivo.
Possible solutions for reducing or preventing biofouling have been explored, including dynamic coating
and chemical modification. Additionally, with the advent of 3D-printed microfluidic devices, there is a
newfound interest in studying the protein absorption of 3D-printed materials [40–42]. Directly associated
with protein absorption are possible anti-fouling techniques which may be implemented to improve the
surface properties of 3D-printed devices. With continued research, these anti-fouling methods applied
to 3D-printed microfluidic devices will work towards the future of reusable, long-term use, low-cost,
point-of-care biomedical devices. Herein, we assess the reusability of 3D-printed chips for biomedical
applications through a review of 3D-printed microfluidic fabrication techniques, 3D-printable materials,
and traditional and emerging anti-fouling methods and materials.

2. 3D-Printed Microfluidics

2.1. Fabrication Methods for 3D-Printed Microfluidics


There are several 3D printing techniques, including the following: fused deposition modeling
(FDM), stereolithography (SLA), photopolymer inkjet printing, selection laser sintering (SLS),
binder deposition, laminated object manufacturing [19], two-photon polymerization (2PP), and

94
Micromachines 2018, 9, 196

micromirror-controlled projection printing [20]. In FDM, depicted in Figure 1a, a thermoplastic filament
is fed through a nozzle [17,19,20,43]. Within the nozzle, rollers force the solid filament through heaters
which melt the filament prior to extrusion. The melted filament is then deposited onto the print-bed
where it solidifies post-extrusion. SLA 3D printers use light to cure layers of photosensitive resin,
as seen in Figure 1b [17,19,20,43]. The resin is cured by photopolymerization caused by a laser or
digital projector that is directed towards the surface of the resin by motorized mirrors. SLA offers
high resolution, as defined by the size of the laser spot and the type of resin. Photopolymer inkjet
printing, modeled in Figure 1c, also prints with a photosensitive polymer, but functions on the concept
behind inkjet printing: the liquid photopolymer is deposited onto the print-bed by an inkjet printing
head [17,19,20,43,44]. By printing layer-by-layer, each layer is deposited and subsequently cured
by UV light. Two powder-based 3D printing methods are SLS and binder jetting. In SLS, a laser
is used to thermally bind precursor polymer powders in a layer-by-layer fashion [19,45]. In binder
jetting, a liquid adhesive, or binder, is deposited by a print head onto a bed of powder [19,43].
For both SLS and binder deposition, a roller is used to form layers of powder. Another 3D printing
method used for microfabrication is 2PP, which uses a near-IR light with high peak power within a
UV-photopolymerizable resin. The photo-initiator within the resin absorbs one UV photon and two
near-IR photons, causing it to radicalize, thereby breaking its current monomer bonds and forming
polymer bonds [19,46,47]. In terms of application in microfluidic device fabrication, FDM, SLA, and
photopolymer inkjet printing are the most commonly implemented [18].

Figure 1. Schematic representation of 3D printing methods commonly applied in the fabrication of


microfluidic devices. (a) Fused deposition modeling (FDM) [48]: a solid filament is fed from an external
spool through the extrusion head, in which the filament is heated and extruded; (b) Stereolithography
(SLA) [49]: a laser is directed at a scanning mirror which focuses the laser on a pool of photo-sensitive
resin; (c) Photopolymer inkjet printing [50]: photopolymer material and support material are fed into
an inkjet printing head which deposits the material in layers while an attached UV lamp cures the
printed material. Illustrations courtesy of [48–50].

95
Micromachines 2018, 9, 196

2.2. Materials for 3D-Printed Microfluidics


Beyond the fabrication methods, another important aspect of 3D-printed microfluidic devices is
the material itself. Certain mechanical properties are very relevant to 3D printability, including the
elastic modulus and tensile strength of the post-printed material, and the viscosity of the pre-printed
material (Table 1) [17]. The elastic modulus is representative of the mechanical relationship between
stress and strain. The 3D-printed materials must withstand high internal pressures from the fluid
flow; due to the high fluid-induced stress, the resulting degree of strain is an important factor in
choosing a material [51]. Likewise, tensile strength also helps to characterize the mechanical properties
of the material in terms of the forces it can withstand. Additionally, the viscosity of the material before
printing (for resins) is an important factor in determining the printability and resolution of the print.
The material must be thin enough (low viscosity) to be precisely deposited in minute quantities but
must also be sufficiently thick (high viscosity) such that it does not spread, migrate, or deform during
the printing process. Viscosity also plays a role in the ease of cleaning the microfluidic channels
post-printing—a lower viscosity is preferred for easier and quicker emptying and rinsing of channels
and semi-enclosed geometries.
Additional material properties that are necessary for microfluidics include high optical
transparency, hydrophobicity or hydrophilicity, and biocompatibility (Table 1). Optical transparency
is extremely useful for microfluidic applications since visual observation and imaging are often
necessary. In particular, a transparent microfluidic chip allows for qualitative observations—a visual
check on proper fluid flow and reagent interactions—as well as quantitative, through-chip imaging
using either visible transmitted light or fluorescence detection. PDMS is widely used for microfluidic
device fabrication and has excellent transparency [52]. Several 3D-printable resins have comparable
transparency. However, these resins may suffer from fogginess or discoloration over time due to
excessive UV-light exposure after fabrication. In some cases, such as for Formlabs clear resin, a thin
layer of isopropyl alcohol, oil, or PDMS can be applied to the exterior surfaces of the printed chip to
facilitate transparency. Additionally, some commonly used materials in 3D printing exhibit natural
fluorescence due to the photo-initiators used for curing, contributing to fluorescent background noise,
which could be problematic in fluorescent imaging systems—a challenge which can be mitigated
by proper calibration of the imaging process [43,53,54]. Another important property of materials in
microfluidics is their intrinsic hydrophobicity or hydrophilicity. Hydrophobic surfaces are more prone
to suffering from fouling due to surface interactions, whereas hydrophilic surfaces can facilitate a
protective hydration layer [31,55]. Since practically all 3D-printable resins are hydrophobic, either
copolymerization, material grafting, or a surface treatment is necessary for anti-fouling purposes.
While it should not absorb or react with biological agents in the fluid sample, such as proteins or
bacteria, the material should be biocompatible. In biomedical applications, it is likely that living cells
may come into contact with the 3D-printed material. Fortunately, the majority of 3D-printable resins
are reportedly biocompatible or can be UV-treated to reduce cytotoxicity [20,40,56].

Table 1. Materials for 3D printing.

3D Printing Properties Important Properties for Microfluidics

Elastic Tensile Viscosity


Material/Example Optical Transparency Hydro-Phobicity/Philicity Bio-Compatibility
Modulus (GPa) Strength (MPa) (cps)

Poly(dimethylsiloxane)
High transparency
(PDMS) (for 0.00132–0.00297 3.51–7.65 N/A Hydrophobic Biocompatible
(standard)
comparison) [52,57]

MakerBot polylactic Hydrophobic, easily Biocompatible,


3.368 56.6 N/A Semi-transparent
acid (PLA) [40,58,59] modified biodegradable

MakerBot acrylonitrile
butadiene styrene 1.807 28.5 N/A Opaque Hydrophobic Biocompatible
(ABS) [40,58]

Formlabs proprietary
methacrylate 2.7 61.5 850–900 Transparent, discolors Hydrophobic N/A
[40,43,60–62]

Asiga PlasCLEAR
polypropylene/ABS N/A 52.6 342 Semi-transparent N/A N/A
[43,63,64]

96
Micromachines 2018, 9, 196

Table 1. Cont.

3D Printing Properties Important Properties for Microfluidics

Elastic Tensile Viscosity


Material/Example Optical Transparency Hydro-Phobicity/Philicity Bio-Compatibility
Modulus (GPa) Strength (MPa) (cps)

Stratasys Object
acrylates and acrylics 2–3 50–65 N/R Transparent, discolors Hydrophobic Biocompatible
[19,43,65]

3DSystems VisiJet
0.866–2.168 20.5–49 150–260 Semi-transparent N/A Biocompatible
Clear Class [40,66–69]

Somos WaterShed
2.77 50.4 260 Transparent, discolors Hydrophobic Biocompatible
XC [19,40,43,70–72]

MiiCraft acrylates
(BV-007 Clear N/A N/A N/A Semi-transparent N/A Biocompatible available
Resin) [43,73]

DWS Lab Vitra 429 &


1.38 32–35 600–850 Transparent N/A Short-term biocompatible
DS3000 [74]

2.3. Benefits and Applications of 3D-Printed Microfluidics


Given the variety of fabrication methods and materials available for 3D printing, it is also
important to consider the benefits and applications of 3D-printed microfluidics. The conventional
method for fabricating microfluidic devices is soft lithography, which involves casting PDMS based on
a semi-3D mold [20]. A channel pattern, designed using CAD software, is used to fabricate a master
negative-mold. The mold is fabricated, most often by a photoresist process, consisting of spin coating
SU-8 on a wafer and exposing it to an ultraviolet source filtered by a photomask. The master mold is
then filled with PDMS, which is then allowed to cure. After curing, the PDMS is peeled away from
the master, cut into the shape of the desired device, and inlet ports are punched. The cast PDMS is
then oxygen plasma treated to improve adhesion to a glass substrate, resulting in the final microfluidic
device, in which one of the four channel walls is provided by the glass. This conventional fabrication
process is extremely time consuming, involves extensive manual operation, and requires new molds for
different designs [75–77]. Additionally, the channel height of traditional PDMS microfluidic chips cast
using soft lithography, determined by the material properties of the photoresist, is extremely limited.
Although photoresist-based molds can have a very high resolution, fabricating complex designs is
a tedious and exacting process, requiring photomasks to be perfectly aligned, to expose sequential
layers of photoresist [78]. Even with multiple layers of photoresist, three-dimensional PDMS chips are
not feasible, as 3D PDMS designs are produced by layering and thus cannot be arbitrarily complex.
Three-dimensional (3D) printing offers a solution to these challenges, yet it comes with its own unique
set of limitations [19]. The resolution achievable by 3D printing cannot match that of soft lithography.
Similarly, the smooth surface of PDMS cannot be recreated by 3D-printed materials. 3D printing can
be implemented in two ways: (1) to fabricate a mold, and (2) to directly print the device.
While conventional photoresist-based molds yield smoother surface topology and smaller feature
sizes, this method is often economically unfeasible, inaccessible, and involves a lengthy prototyping
process [79]. On the other hand, molds can be fabricated by 3D printing, which enables low-cost
production of more complex designs. Fabrication of PDMS microfluidic chips using 3D-printed master
molds provides many of the advantages of 3D printing fabrication while maintaining the desirable
material properties of PDMS, such as biocompatibility and gas permeability [17]. The mold benefits
from rapid prototyping techniques, reducing the overall cost and time required for fabrication and
enabling a simple method for printing new mold designs. Additionally, 3D-printed molds enable
considerably more complex channel geometries: circular cross-section channels [80], non-planar
channels such as helices and pillars [81], and even complex intermingling internal patterns supported
by sacrificial scaffolds which can be dissolved or melted away post-production [82–84].
Three-dimensional (3D) printing can also be implemented to directly fabricate microfluidic
devices. Rather than designing a negative-mold for the chip, the chip is printed using the 3D-printed
material. This method reduces fabrication costs, increases the speed of production, and is ideal for rapid
prototyping and low-cost microfluidic devices. Since the whole device is directly printed, 3D printing
eliminates the assembly steps required by conventional molding processes and allows for quick

97
Micromachines 2018, 9, 196

changes to the design, simply requiring a few hours for the new design to print. Another advantage of
progressing beyond mold-based fabrication is the ability to produce arbitrarily defined structures in a
fully 3D space, with no significant increase in fabrication complexity and time [78,85]. Furthermore, a
wide variety of microfluidic components can be fabricated by 3D printing, including passive, which
rely on external actuation or capillary forces, and active, which apply energy to manipulate fluid flow
components. Examples of passive 3D-printed components include a micromixer, gradient generator,
droplet generator, reaction zones, and check valves [17,86–89]. Active 3D-printed components which
have been demonstrated include active valves, flow switches, and pumps [17,54,70].
Fully-functional 3D-printed microfluidic chips have also been designed for biomedical applications
(Figure 2), such as a chip for inertial focusing and separation of bacteria [90], high-throughput drug
transport and cell viability testing [91], electrochemical detection [92], pathogen detection of bacteria
and viruses [93,94], biological assays and cell observations [95,96], and cancer assays and studies
on cell migration [97]. Figure 2a demonstrates a mixing scheme which has broad applicability to
high-throughput combinatorial testing applications, such as drug screening, biochemical assays,
lab-on-chip devices, and biosensors [98]. Figure 2b shows an bacteria detection device which separates
captured bacteria using inertial focusing [90]. The fabrication of this device’s complex helical geometry
and trapezoidal cross-section channels was only made possible by the capabilities of 3D printing.
Figure 2c depicts a single-valve 3D-printed microfluidic device which allows for the controlled
opening and closing of channels [70]. While soft-lithographic automation generally involves PDMS
layering, alignment, and bonding, the pictured device offers a rapid, prototyped alternative, which
is completely fabricated by stereolithography. Additionally, two-valve and four-valve switches have
also been demonstrated. Such actuated switches can be pivotal in microfluidic sample handling
for various assays. Figure 2d shows a three-dimensional microfluidic device built from identical,
individual elements [99]. As another example of enhanced control of fluid flow, these modular
3D-printed elements allow for a wide variety of fluidic circuits to be constructed. Figure 2e offers
an example of a 3D-printed mini-bioreactor (MBRA) for cultivating fecal microbial communities
to study epidemic Clostridium difficile strains [100]. The MBRAs used in this study benefitted from
the simple, high-throughput fabrication process offered by 3D printing. Figure 2f demonstrates
another 3D-printed microfluidic mixing device; however, instead of solely relying on two-dimensional
serpentines and splitters, the pictured device utilizes three-dimensional channel patterns to improve
the gradient generation [86]. Finally, Figure 2g,h detail a multi-material 3D-printed device for the
microphysiological study of cardiac tissues [101]. The functionality of the device relies on contractions
of cardiac tissue to deflect a cantilever substrate, thereby stretching an embedded strain gauge
which generates a resistance chance proportional to the stress of the tissue (Figure 2g). The device
itself was printed with multiple materials to form the cantilever base, strain gauge wire, wire cover,
tissue-guiding microfilaments, electrical leads, and surrounding wells. The inset images of Figure 2h
show (1) a confocal microscopy image of the immunostained cardiac tissues tested using this device,
(2) an image of an active cantilevered device, and (3) an example of the resistance signal from the
cantilever deflection. These examples demonstrate the wide applicability of 3D-printed microfluidics
to biomedical applications.

98
Micromachines 2018, 9, 196

Figure 2. Biomedical applications of 3D-printed microfluidic devices; (a) A combinatorial mixer


which generates four titrations of two dye solutions and produces combinatorial mixes of the dye
titrations to deliver sixteen mixture combinations into separate outlet microchannels (reproduced,
with permission, from [98]); (b) a helical-shaped 3D microfluidic device with trapezoidal-shaped
channels for the detection of pathogenic bacteria by inertial focusing (reproduced, with permission,
from [90]); (c) automated 3D-printed microfluidic single-valve device. Below are micrographs of the
valve unit in its open and closed states (reproduced, with permission, from [70]); (d) single-outlet
sub-circuit elements are connected to form a four-outlet mixer. Each sub-circuit element is identical,
constituted by a single inlet splitter (reproduced, with permission, from [99]); (e) example of a simple,
high-throughput mini-bioreactor array (MBRA) used for the cultivation of microbial communities
(reproduced, with permission, from [19,100]); (f) Three-dimensional gradient generator for the mixing
of two dyes, consisting of three levels of combining, mixing, and splitting (reprinted, with permission,
from [86], Copyright 2014 American Chemical Society); (g,h) instrumented cardiac microphysiological
device fabricated by multi-material 3D printing; (g) illustration of the working principles of the
microphysiological device; (h) images of the fully-printed device (reproduced, with permission,
from [101]).

3. Anti-Fouling Methods and Materials

3.1. Traditional Anti-Fouling Methods and Materials


Attributed to the hydrophobicity of PDMS, microfluidic devices fabricated using this traditional
material exhibit low wettability and are prone to biofouling from nonspecific protein and analyte
absorption and cell and bacterial adhesion [102]. To counteract the fouling, coatings aim to minimize
intermolecular forces and interactions between the surface and samples. Pertaining to protein fouling,
absorption into the substrate can be due to hydrogen bonding, electrostatic forces, charge-transfers,
or hydrophobic interactions [55].

99
Micromachines 2018, 9, 196

Considerable work has been done to create a hydrophilic PDMS surface with anti-fouling
properties [31,36]. Physical methods to accomplish this adaptation rely on changing the state of
the PDMS surface via physical processes. For instance, a coating material may be absorbed by the
PDMS by hydrophobic or electrostatic interaction. Alternatively, the surface can be treatment-activated
by plasma, ozone, or ultraviolet exposure. There are also chemical modification methods that have
been studied, such as covalent bonding between a coating material and the PDMS. Both physical and
chemical methods have their respective drawbacks—physical modification results in only temporary
anti-fouling, with the effectiveness decreasing over time, while chemical modification requires complex
processes with several reagents and procedural steps. Consequently, these methods may not be ideal
for commercialization, particularly for fabricating long-term use or low-cost devices, since they
are often ephemeral and laborious. Polymer chain length is an important factor when considering
anti-fouling mechanisms [31]. Protein resistance can be achieved by a hydration layer of short chain
length polymers, which forms due to the hydrophilicity of the short chains. In addition to forming a
hydrophilic hydration layer, long chain length materials have the added benefit of steric repulsion
from the flexible polymer chains. When tuning the protein resistance of a material, longer chain
lengths are therefore preferred since they exhibit both a hydration layer and steric repulsion. Beyond
hydrophilicity, anti-fouling mechanisms should be electrically neutral and should only have hydrogen
bond acceptors—no hydrogen bond donors [103].
A widely used anti-fouling surface treatment is a poly(ethylene oxide) (PEO) or poly(ethylene
glycol) (PEG) coating. PEO and PEG are hydrophilic and nontoxic [104,105]. They can be added
as a coating on PDMS by physical or chemical absorption, direct covalent attachment, or graft
copolymerization. The addition of PEG chains to the surface of the microfluidic channels offers
anti-fouling capabilities due to a hydration layer and steric repulsion, the strength of which is dependent
on factors such as surface density and the length of the PEG chains [106–110]. Another class of materials
that has been demonstrated for anti-fouling purpose is zwitterions. Polyzwitterion-based coatings
have an equal amount of positively and negatively charged groups and thus exhibit electrical neutrality,
which is a desirable characteristic [31]. Zwitterionic materials are able to form thick hydration
layers by bonding with water molecules, forming a shield across the surface to prevent protein
absorption [111–116]. Other types of anti-fouling coatings to prevent the absorption of nonspecific
proteins include saccharide-based coatings [117–120], polyhydroxy-polymer-based coatings [121,122],
amide-containing-hydrophilic-polymer-based coatings [36,123,124], and fluorinated-polymer-based
coatings [125–128].

3.2. Emerging Anti-Fouling Methods and Materials


The numerous methods proposed for anti-fouling of PDMS suggest that reusable microfluidic
devices are plausible. However, other materials and methods are needed for anti-fouling coatings of
3D-printed microfluidic devices. Novel advancements from the Wyss Institute at Harvard University
have yielded SLIPS (Slippery Liquid-Infused Porous Surfaces). SLIPS is an ultra-repellent, self-healing,
transparent surface coating for industrial and medical materials [129]. While most repellent surface
materials can repel aqueous substances, they often fail to repel other liquids, fail or degrade under
physical stress, cannot self-heal after repeated use, and may be very costly to implement [129–131].
The SLIPS technology relies on nano- and micro-structured porous material infused with lubricating
fluid [129]. The commonality between the traditional methods and materials described above and SLIPS
is the implementation of a lubrication or hydration layer. High optical transparency and compatibility
with a myriad of substrates are what differentiate SLIPS from other coatings. These features also make
SLIPS an ideal anti-fouling material for 3D-printed microfluidic chips for biomedical applications,
in addition to a variety of previously reported applications [130–133].
As a transparent, anti-fouling material, SLIPS was demonstrated for implementation on an
endoscope lens to prevent vision loss after repeated submersions in blood and mucus [37]. The coating
exhibited conformability, mechanical adhesion, high transparency, biocompatibility, and high resistance

100
Micromachines 2018, 9, 196

to fogging and fouling by bodily fluids (Figure 3a,b) [134,135]. These material characteristics were
attributed to the liquid-infused structure of the coating, which consisted of a porous silica particle
network infiltrated with various oils, such as silicone oil which is already used in a variety of
medical applications due to its biocompatibility and proven clinical performance [37,130,136–138].
By applying the coating to the lens, cleaning procedures in between uses of the endoscope were
unnecessary or, in the worst cases, reduced to ten-to-fifteen times shorter than for an untreated lens.
Additionally, the surface coating maintained a clear view through the lens, which is also extremely
important for 3D-printed microfluidic chips for diagnostic applications, as diagnostics often rely on
through-chip imaging.
As opposed to the stationary lens of an endoscope, in an environment with interfaces under flow,
such as the channels of a microfluidic chip, it is also important to consider the stability and longevity of
immobilized hydration layers as surface coatings. The surface hydration layer provides a low-adhesion
interface that deters the attachment of fouling materials. However, as fouling material-laden fluid
flows over the hydration layer, there is an increase in the instability of the interface [139]. Experimental
results and mathematical modeling by Howell et al. provided several important findings: (1) initial
conditioning to flush out excess lubricant from the surface reduces further losses; (2) surface structure
and lubricant viscosity do not cause significant differences in performance; and (3) the formation of an
air–water interface within the channel causes disruptions in the lubricant layer.
SLIPS technology has also been applied as a coating for medical materials that can effectively
suppress thrombosis, even under high-pressure and high-shear flow [35]. An anti-thrombogenic
surface coating was formed by covalently binding a flexible tethered perfluorocarbon (TP) layer on
the material surface, which was then coated by a layer of a liquid perfluorocarbon (LP). The resulting
bilayer is referred to as a tethered-liquid perfluorocarbon (TLP) surface. The TLP is capable of repelling
blood and preventing the adhesion of blood components and bacteria, thereby reducing thrombosis
without the need for anti-coagulants (Figure 3c). Even when subjected to a flowing fluid, the TP
maintains the LP hydration layer. The TLP is also simple to fabricate—virtually any substrate can be
modified by low-plasma surface modification, a procedure which is commonly used for the commercial
modification of materials and is independent of surface geometry and properties [140]. The TLP coating
is ideal for treating the surfaces of 3D-printed microfluidic channels as it is compatible with a large
variety of materials and exhibits anti-thrombogenic, anti-bacterial, and anti-fouling properties.
Another lubricant-infused coating that has been applied to polymeric biomedical devices is
a new, advanced type of the traditional fluorinated-polymer-based coatings. Badv et al. recently
demonstrated an omniphobic, lubricant-infused coating which was applied to catheters to prevent
thrombosis [141]. The proposed omniphobic coating functioned on a similar liquid lubricant concept
as SLIPS—a biocompatible liquid lubricant is held to the surface of the catheter to form an anti-fouling
coating. However, instead of forming a hydrophilic hydration layer as SLIPS aims to accomplish,
the coating developed by Badv et al. was based on a self-assembled monolayer (SAM) of hydrophobic
organosilanes which attenuates clotting. Recently, omniphobic, lubricant-infused coatings have
been developed as a new class of coatings created by tethering biocompatible, perfluorocarbon
lubricants onto SAMs of hydrophobic organosilanes [35,130]. In greater detail, fluorous molecules
can be physically adsorbed onto fluorous-containing surfaces, facilitated by the strong intermolecular
interaction between the fluorinated lubricant and the fluorosilane layer. Such omniphobic coatings are
excellent for resisting blood clot formation and are more effective than traditional anti-fouling methods,
such as PEG grafting, for blocking non-specific adhesion of cells and bacteria [142,143]. In addition
to the great effectiveness of omniphobic coatings, they are stable and durable when exposed to shear
stress [35,139].
A feature that sets the work of Badv et al. apart from other traditional omniphobic, fluorinated
-polymer-based coatings is the method of application. The most common technique for applying SAMs
of fluorine-based silanes is liquid phase deposition (LPD). LPD has a few notable drawbacks and
limitations. LPD is not commercially feasible due to the high volume of solvent waste that it produces

101
Micromachines 2018, 9, 196

which is harmful to the environment [144]. Another limitation is that the self-polymerization of silanes
in the liquid may prevent homogenous silane layer formation [145]. Additionally, LPD-treated surfaces
are likely to be exposed to impurities and reaction side products which may have detrimental effects
on the surface itself [144]. Conversely, the proposed surface coating was applied via chemical vapor
deposition (CVD), which has the following benefits: a simplified application process, a lesser effect
on the topography of the receiving substrate, and greater effectiveness. CVD was performed by
oxygen plasma treatment of the catheters, followed by silanization, and completed by the addition of a
biocompatible liquid lubricant.

Figure 3. Emerging anti-fouling methods and materials: SLIPS (Slippery Liquid-Infused Porous
Surfaces). (a,b) Evolution of the reduction in the visible area of an endoscope surface coated by SLIPS
as a function of the number of dips. Silicone oil of low viscosity (10 cSt) was used as the lubricating
liquid. Red corresponds to an uncoated endoscope, which fails immediately after a single dip. Green,
blue, and black correspond to three replicates of SLIPS coated endoscopes; (a) endoscope dipped in
whole porcine blood. Inset images show the visibility of the field of view at 70, 08, and 100 dips for
the poorest performing sample; (b) endoscope dipped in mucus. Insets show the visibility of a coated
endoscope after repeated dips compared to an untreated endoscope (reproduced, with permission,
from [37]). (c) Comparison of the repellency of a tethered-liquid perfluorocarbon (TLP) treated surface
to an untreated surface (reproduced, with permission, from [35]).

3.3. Anti-Fouling Methods Applied to 3D-Printed Materials


Biofouling from nonspecific protein and analyte absorption and cell and bacterial adhesion is not a
detriment of only PDMS; biofouling can occur on the surfaces of all microfluidic chips, of all materials.
While extensive work has been conducted to address the anti-fouling of PDMS, disproportionately
less work has been reported for 3D printing. Nonetheless, recent studies and reviews have considered
the biofouling of 3D-printed materials, demonstrating its significance and importance in the field.
The objective of a study done by Siddiqui et al. was to propose a strategy for developing, characterizing,
and testing 3D-printed feed spacers, both numerically by membrane fouling simulator (MFS) studies
and experimentally [42]. Although the biofouling of the 3D-printed device was not directly assessed,

102
Micromachines 2018, 9, 196

the results showed that a 3D-printed feed spacer was similar. Feed spacers are commonly used devices
in spiral-wound reverse osmosis and nanofiltration membrane systems to enhance water mixing and
to reduce biofouling. As reported by Baker et al., the surface of feed spacers is prone to the initial
deposition of fouling which can accumulate and spread [146]. Van Paassen et al. then showed that
biofouling accumulated on feed spacers causes an exponential increase in the pressure drop across
the membrane module containing the feed spacer [147]. To remedy the biofouling of feed spacers,
various solutions have been proposed [148,149]. More recently, researchers have focused on the surface
chemistry of the feed spacers. Multiple studies have considered anti-fouling coatings; however, these
are more likely to wear out over time [150–154]. The solution proposed by Siddiqui et al. considered
the native anti-fouling properties of 3D-printed materials. Their findings demonstrated the benefits of
3D-printing—feed spacers can be designed and printed with complex geometries to reduce the effects
of biofouling. This studied demonstrates an example of the importance and application of studying
the fouling of 3D-printed materials.
In reporting on the 3D printing of biopolymers for tissue engineering applications, Li et al.
discussed the biocompatibility of common 3D-printed materials, such as polycaprolactone (PCL),
poly-lactic acid (PLA), and acrylonitrile butadiene styrene (ABS) [41]. While PCL and PLA are natively
biocompatible, ABS is not as ideally suited for biomedical applications. For this reason, there is
considerable interest in possible methods for modifying the surface of printed ABS to render it
hydrophilic and biocompatible. A traditional anti-fouling method which is compatible with a wide
variety of materials, including ABS and other 3D-printed materials, is surface modification by the
grafting of PEG [41,110]. As an alternative, McCullough and Yadavlli utilized an acetone solution to
transform a porous ABS device fabricated by fused deposition modeling into a water-tight microfluidic
device [155]. The acetone-treated microfluidic device retained the structural fidelity of microstructures
as small as 250 μm, while benefiting from improved water impermeability, hydrophilicity, and
biocompatibility. In addition to the acetone soaking, a traditional process of photo-induced PEG
grafting was performed to further facilitate the formation of a stable, biocompatible surface by reducing
biofouling behavior [155].
Anti-fouling methods have also been applied to 3D-printed molds for microfluidic device
fabrication. Villegas et al. utilized omniphobic, lubricant-infused coatings, similar to the previously
coating implemented by Badv et al., to fabricate 3D-printed molds for fabricating smooth PDMS
microfluidic channels [79,141]. While the use of 3D-printed molds for casting PDMS microfluidic
devices has been previously reported and described above, methods to improve the surface topology
of the mold have not been previously studied [81,82]. The surface topology of a 3D-printed mold is
likely to exhibit high variability and roughness, thereby increasing the difficulty of creating smooth,
defined microfluidic channels from the mold [80]. In the recent study by Villegas et al., they addressed
this challenge by investigating the use of lubricant-infused surfaces as a method for decreasing
surface roughness—in addition to the more common use of lubricant-infusion for creating omniphobic
slippery surfaces, which can be used in a multitude of applications including anti-biofouling.
In this particular study, the mold was 3D-printed using a multi-jet modeling printer equipped with
high-resolution nozzles [156]. The mold was then sonicated in ethanol and oxygen plasma treated
before a self-assembled monolayer of fluorosilane was applied by chemical vapor deposition. Finally,
a fluorocarbon lubricant was applied to form the smooth, lubricant-infused interface. This study,
therefore, demonstrated the compatibility of 3D-printed material with omniphobic lubricant-infused
coatings applied via chemical vapor deposition.

4. Conclusions
Microfluidic devices are invaluable tools in biomedical engineering. Microfluidics have a
proven record of being effective analytical and diagnostic devices. Presently, there is an ongoing
evolution in the field of microfluidics as researchers explore 3D printing as a viable fabrication method.
3D printing is revolutionizing the fabrication workflow of microfluidics. As opposed to the time-

103
Micromachines 2018, 9, 196

and resource-intensive process of soft lithography for PDMS chip fabrication, 3D printing offers a
low-cost, customizable platform for the direct fabrication of microfluidic chips. There are several 3D
printing methods, of which fused deposition modeling, stereolithography, and photopolymer inkjet
printing are applicable to 3D-printed microfluidic chips. Additionally, many materials are offered that
may be compatible, boasting features such as high mechanical strength post-printing, low viscosity
pre-printing, optical transparency, and biocompatibility.
The diagnostic capabilities of microfluidic chips and the benefits of 3D printing can be leveraged
to address the unmet need for the long-term use of microfluidic chips for biomedical applications, such
as for long-term health monitoring. Long-term, routine health monitoring has the capacity to improve
public health while also reducing healthcare costs. A noteworthy obstacle in developing long-term
diagnostic microfluidic chips is the fouling that is common on the surfaces of integrated microchannels
and features. Similar to traditional PDMS, 3D-printed resins are most often hydrophobic, which means
they are prone to surface interactions between the walls of the channels and the biological sample
flowing through the channels. The resulting accumulation of unwanted substances on the surface of
the microfluidic channels adversely affects the performance of the device. To combat fouling, there has
been a growing research interest in developing new anti-fouling methods and materials. Traditional
anti-fouling relies on chemical and/or physical surface modification. As an emerging solution, SLIPS
(Slippery Liquid-Infused Porous Surfaces) offers a transparent, durable and robust surface treatment
that can be applied to practically any surface, including the channels of a 3D-printed microfluidic chip.
Continued research and characterization will result in reusable 3D-printed microfluidic chips that are
low-cost, robust, transparent, and biocompatible.

Acknowledgments: S.T. acknowledges the American Heart Association Scientist Development Grant
(15SDG25080056), Connecticut Innovations Biopipeline Award, and the University of Connecticut Research
Excellence Program award for financial support of this research.
Conflicts of Interest: S.T. is founder of, and have an equity interest in mBiotics, LLC, a company that is developing
microfluidic technologies for point-of-care diagnostic solutions. S.T.’s interests were viewed and managed in
accordance with the conflict of interest policies of the University of Connecticut. The authors have no other
relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial
conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.

References
1. Wankhede, S.P.; Du, Z.; Berg, J.M.; Vaughn, M.W.; Dallas, T.; Cheng, K.H.; Gollahon, L. Cell detachment
model for an antibody-based microfluidic cancer screening system. Biotechnol. Prog. 2006, 22, 1426–1433.
[CrossRef] [PubMed]
2. Leoncini, E.; Ricciardi, W.; Cadoni, G.; Arzani, D.; Petrelli, L.; Paludetti, G.; Brennan, P.; Luce, D.; Stucker, I.;
Matsuo, K.; et al. Lab-on-a-chip for oral cancer screening and diagnosis. Head Neck 2014, 36, 1391. [CrossRef]
3. Kim, L. Overview of the Microfluidic Diagnostics Commercial Landscape; Humana Press: Totowa, NJ, USA, 2013;
Volume 949, ISBN 978-1-62703-133-2.
4. Srinivasan, V.; Pamula, V.K.; Fair, R.B. An integrated digital microfluidic lab-on-a-chip for clinical diagnostics
on human physiological fluids. Lab Chip 2004, 4, 310–315. [CrossRef] [PubMed]
5. Hsu, Y.-H.; Moya, M.L.; Hughes, C.C.W.; George, S.C.; Lee, A.P. A microfluidic platform for generating
large-scale nearly identical human microphysiological vascularized tissue arrays. Lab Chip 2013, 13, 2990.
[CrossRef] [PubMed]
6. Toh, Y.-C.; Lim, T.C.; Tai, D.; Xiao, G.; van Noort, D.; Yu, H. A microfluidic 3D hepatocyte chip for drug
toxicity testing. Lab Chip 2009, 9, 2026. [CrossRef] [PubMed]
7. Yu, L.; Chen, M.C.W.; Cheung, K.C. Droplet-based microfluidic system for multicellular tumor spheroid
formation and anticancer drug testing. Lab Chip 2010, 10, 2424. [CrossRef] [PubMed]
8. Chin, C.D.; Linder, V.; Sia, S.K. Commercialization of microfluidic point-of-care diagnostic devices. Lab Chip
2012, 12, 2118. [CrossRef] [PubMed]
9. Sia, S.K.; Kricka, L.J. Microfluidics and point-of-care testing. Lab Chip 2008, 8, 1982. [CrossRef] [PubMed]

104
Micromachines 2018, 9, 196

10. Foudeh, A.M.; Fatanat Didar, T.; Veres, T.; Tabrizian, M. Microfluidic designs and techniques using
lab-on-a-chip devices for pathogen detection for point-of-care diagnostics. Lab Chip 2012, 12, 3249. [CrossRef]
[PubMed]
11. Amin, R.; Ghaderinezhad, F.; Li, L.; Lepowsky, E.; Yenilmez, B.; Knowlton, S.; Tasoglu, S. Continuous-Ink,
Multiplexed Pen-Plotter Approach for Low-Cost, High-Throughput Fabrication of Paper-Based Microfluidics.
Anal. Chem. 2017, 89. [CrossRef] [PubMed]
12. Cate, D.M.; Adkins, J.A.; Mettakoonpitak, J.; Henry, C.S. Recent developments in paper-based microfluidic
devices. Anal. Chem. 2015, 87, 19–41. [CrossRef] [PubMed]
13. Martinez, A.W.; Phillips, S.T.; Whitesides, G.M.; Carrilho, E. Diagnostics for the developing world:
Microfluidic paper-based analytical devices. Anal. Chem. 2010, 82, 3–10. [CrossRef] [PubMed]
14. Yetisen, A.K.; Akram, M.S.; Lowe, C.R. Paper-based microfluidic point-of-care diagnostic devices. Lab Chip
2013, 13, 2210. [CrossRef] [PubMed]
15. Lepowsky, E.; Ghaderinezhad, F.; Knowlton, S.; Tasoglu, S. Paper-based assays for urine analysis.
Biomicrofluidics 2017, 11. [CrossRef] [PubMed]
16. Ghaderinezhad, F.; Amin, R.; Temirel, M.; Yenilmez, B.; Wentworth, A.; Tasoglu, S. High-throughput
rapid-prototyping of low-cost paper-based microfluidics. Sci. Rep. 2017, 7, 1–9. [CrossRef] [PubMed]
17. Amin, R.; Knowlton, S.; Hart, A.; Yenilmez, B.; Ghaderinezhad, F.; Katebifar, S.; Messina, M.;
Khademhosseini, A.; Tasoglu, S. 3D-printed microfluidic devices. Biofabrication 2016, 8, 022001. [CrossRef]
[PubMed]
18. Amin, R.; Joshi, A.; Tasoglu, S. Commercialization of 3D-printed microfluidic devices. J. 3D Print. Med. 2017,
1, 85–89. [CrossRef]
19. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-Printed Microfluidics. Angew. Chemie Int. Ed. 2016, 55,
3862–3881. [CrossRef] [PubMed]
20. Ho, C.M.B.; Ng, S.H.; Li, K.H.H.; Yoon, Y.-J. 3D printed microfluidics for biological applications. Lab Chip
2015, 15, 3627–3637. [CrossRef] [PubMed]
21. Sochol, R.D.; Sweet, E.; Glick, C.C.; Wu, S.; Yang, C.; Restaino, M.; Lin, L. Microelectronic engineering 3D
printed microfluidics and microelectronics. Microelectron. Eng. 2018, 189, 52–68. [CrossRef]
22. Knowlton, S.; Yu, C.H.; Ersoy, F.; Emadi, S.; Khademhosseini, A.; Tasoglu, S. 3D-printed microfluidic chips
with patterned, cell-laden hydrogel constructs. Biofabrication 2016, 8, 25019. [CrossRef] [PubMed]
23. Knowlton, S.; Yenilmez, B.; Tasoglu, S. Towards Single-Step Biofabrication of Organs on a Chip via 3D
Printing. Trends Biotechnol. 2016, 34, 685–688. [CrossRef] [PubMed]
24. Knowlton, S.; Joshi, A.; Syrrist, P.; Coskun, A.F.; Tasoglu, S. 3D-Printed Smartphone-Based Point of Care
Tool for Fluorescence- and Magnetophoresis-Based Cytometry. Lab Chip 2017, 17, 2839–2851. [CrossRef]
[PubMed]
25. National Science Foundation. Smart and Connected Health (SCH). Available online: https://www.nsf.gov/
pubs/2016/nsf16601/nsf16601.htm (accessed on 27 November 2017).
26. Ward, B.W.; Clarke, T.C.; Nugent, C.N.; Schiller, J.S. Early Release of Selected Estimates Based on Data From
the 2015 National Health Interview Survey (05/2016). National Health Interview Survey Early Release
Program. Available online: https://www.cdc.gov/nchs/data/nhis/earlyrelease/earlyrelease201605.pdf
(accessed on 27 November 2017).
27. Ashraf, M.W.; Tayyaba, S.; Afzulpurkar, N. Micro Electromechanical Systems (MEMS) based microfluidic
devices for biomedical applications. Int. J. Mol. Sci. 2011, 12, 3648–3704. [CrossRef] [PubMed]
28. Jivani, R.R.; Lakhtaria, G.J.; Patadiya, D.D.; Patel, L.D.; Jivani, N.P.; Jhala, B.P. Biomedical
microelectromechanical systems (BioMEMS): Revolution in drug delivery and analytical techniques.
Saudi Pharm. J. 2016, 24, 1–20. [CrossRef] [PubMed]
29. Fujii, T. PDMS-based microfluidic devices for biomedical applications. Microelectron. Eng. 2002, 61–62,
907–914. [CrossRef]
30. Dario, P.; Carrozza, M.C.; Benvenuto, A.; Menciassi, A. Micro-systems in biomedical applications. J. Micromech.
Microeng. 2000, 10, 235–244. [CrossRef]
31. Zhang, H.; Chiao, M. Anti-fouling coatings of poly(dimethylsiloxane) devices for biological and biomedical
applications. J. Med. Biol. Eng. 2015, 35, 143–155. [CrossRef] [PubMed]

105
Micromachines 2018, 9, 196

32. Picher, M.M.; Küpcü, S.; Huang, C.-J.; Dostalek, J.; Pum, D.; Sleytr, U.B.; Ertl, P. Nanobiotechnology advanced
antifouling surfaces for the continuous electrochemical monitoring of glucose in whole blood using a
lab-on-a-chip. Lab Chip 2013, 13, 1780. [CrossRef] [PubMed]
33. Wong, I.; Ho, C.M. Surface molecular property modifications for poly(dimethylsiloxane) (PDMS) based
microfluidic devices. Microfluid. Nanofluid. 2009, 7, 291–306. [CrossRef] [PubMed]
34. Goyanes, A.; Buanz, A.B.M.; Hatton, G.B.; Gaisford, S.; Basit, A.W. 3D printing of modified-release
aminosalicylate (4-ASA and 5-ASA) tablets. Eur. J. Pharm. Biopharm. 2015, 89, 157–162. [CrossRef] [PubMed]
35. Leslie, D.C.; Waterhouse, A.; Berthet, J.B.; Valentin, T.M.; Watters, A.L.; Jain, A.; Kim, P.; Hatton, B.D.;
Nedder, A.; Donovan, K.; et al. A bioinspired omniphobic surface coating on medical devices prevents
thrombosis and biofouling. Nat. Biotechnol. 2014, 32, 1134–1140. [CrossRef] [PubMed]
36. Tu, Q.; Wang, J.C.; Liu, R.; He, J.; Zhang, Y.; Shen, S.; Xu, J.; Liu, J.; Yuan, M.S.; Wang, J. Antifouling properties
of poly(dimethylsiloxane) surfaces modified with quaternized poly(dimethylaminoethyl methacrylate).
Colloids Surf. B Biointerfaces 2013, 102, 361–370. [CrossRef] [PubMed]
37. Sunny, S.; Cheng, G.; Daniel, D.; Lo, P.; Ochoa, S.; Howell, C.; Vogel, N.; Majid, A.; Aizenberg, J. Transparent
antifouling material for improved operative field visibility in endoscopy. Proc. Natl. Acad. Sci. USA 2016,
113, 201605272. [CrossRef] [PubMed]
38. Defense Sciences Office. DARPA DARPA-RA-17-01: Young Faculty Award. Available online: https://www.
darpa.mil/attachments/DARPA-RA-17-01FAQ11-17-17.pdf (accessed on 27 November 2017).
39. Wan, A.M.D.; Devadas, D.; Young, E.W.K. Recycled polymethylmethacrylate (PMMA) microfluidic devices.
Sens. Actuators B Chem. 2017, 253, 738–744. [CrossRef]
40. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742. [CrossRef] [PubMed]
41. Li, X.; Cui, R.; Sun, L.; Aifantis, K.E.; Fan, Y.; Feng, Q.; Cui, F.; Watari, F. 3D-printed biopolymers for tissue
engineering application. Int. J. Polym. Sci. 2014, 2014. [CrossRef]
42. Siddiqui, A.; Farhat, N.; Bucs, S.S.; Linares, R.V.; Picioreanu, C.; Kruithof, J.C.; Van Loosdrecht, M.C.M.;
Kidwell, J.; Vrouwenvelder, J.S. Development and characterization of 3D-printed feed spacers for spiral
wound membrane systems. Water Res. 2016, 91, 55–67. [CrossRef] [PubMed]
43. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
44. Singh, M.; Haverinen, H.M.; Dhagat, P.; Jabbour, G.E. Inkjet printing-process and its applications. Adv. Mater.
2010, 22, 673–685. [CrossRef] [PubMed]
45. Mazzoli, A. Selective laser sintering in biomedical engineering. Med. Biol. Eng. Comput. 2013, 51, 245–256.
[CrossRef] [PubMed]
46. Xing, J.-F.; Zheng, M.-L.; Duan, X.-M. Two-photon polymerization microfabrication of hydrogels: an
advanced 3D printing technology for tissue engineering and drug delivery. Chem. Soc. Rev. 2015, 44,
5031–5039. [CrossRef] [PubMed]
47. Maruo, S.; Nakamura, O.; Kawata, S. Three-dimensional microfabrication with two-photon-absorbed
photopolymerization. Opt. Lett. 1997, 22, 132–134. [CrossRef] [PubMed]
48. Additively. Fused Deposition Modeling (FDM). Available online: https://www.additively.com/en/learn-
about/fused-deposition-modeling (accessed on 27 November 2017).
49. Additively. Stereolithography (SL). Available online: https://www.additively.com/en/learn-about/
stereolithography (accessed on 27 November 2017).
50. Additively. Photopolymer Jetting (PJ). Available online: https://www.additively.com/en/learn-about/
photopolymer-jetting (accessed on 27 November 2017).
51. Stone, H.A.; Stroock, A.D.; Ajdari, A. Engineering Flows in Small Devices: Microfluidics Toward a
Lab-on-a-Chip. Annu. Rev. Fluid Mech. 2004, 36, 381–411. [CrossRef]
52. Mata, A.; Fleischman, A.J.; Roy, S. Characterization of polydimethylsiloxane (PDMS) properties for
biomedical micro/nanosystems. Biomed. Microdevices 2005, 7, 281–293. [CrossRef] [PubMed]
53. Qaderi, K. Polyethylene Glycol Diacrylate (PEGDA) Resin Development for 3D-Printed Microfluidic Devices.
Master’s Thesis, Brigham Young University, Provo, UT, USA, May 2015.
54. Rogers, C.I.; Qaderi, K.; Woolley, A.T.; Nordin, G.P. 3D printed microfluidic devices with integrated valves.
Biomicrofluidics 2015, 9, 016501. [CrossRef] [PubMed]

106
Micromachines 2018, 9, 196

55. Liu, J.; Lee, M.L. Permanent surface modification of polymeric capillary electrophoresis microchips for
protein and peptide analysis. Electrophoresis 2006, 27, 3533–3546. [CrossRef] [PubMed]
56. Oskui, S.M.; Diamante, G.; Liao, C.; Shi, W.; Gan, J.; Schlenk, D.; Grover, W.H. Assessing and Reducing the
Toxicity of 3D-Printed Parts. Environ. Sci. Technol. Lett. 2016, 3, 1–6. [CrossRef]
57. Johnston, I.D.; McCluskey, D.K.; Tan, C.K.L.; Tracey, M.C. Mechanical characterization of bulk Sylgard 184
for microfluidics and microengineering. J. Micromech. Microeng. 2014, 24, 35017. [CrossRef]
58. Tymrak, B.M.; Kreiger, M.; Pearce, J.M. Mechanical properties of components fabricated with open-source
3-D printers under realistic environmental conditions. Mater. Des. 2014, 58, 242–246. [CrossRef]
59. Ramot, Y.; Haim-Zada, M.; Domb, A.J.; Nyska, A. Biocompatibility and safety of PLA and its copolymers.
Adv. Drug Deliv. Rev. 2016, 107, 153–162. [CrossRef] [PubMed]
60. Ma, Y.; Cao, X.; Feng, X.; Ma, Y.; Zou, H. Fabrication of super-hydrophobic film from PMMA with intrinsic
water contact angle below 90◦ . Polymer (Guildf.) 2007, 48, 7455–7460. [CrossRef]
61. Brandhoff, L.; van den Driesche, S.; Lucklum, F.; Vellekoop, M.J. Creation of hydrophilic microfluidic devices
for biomedical application through stereolithography. SPIE Microtechnol. 2015, 9518, 95180D. [CrossRef]
62. Formlabs Formlabs Clear Safety Data Sheet. Available online: https://formlabs.com/media/upload/Clear-
SDS_u324bsC.pdf (accessed on 27 November 2017).
63. Takenaga, S.; Schneider, B.; Erbay, E.; Biselli, M.; Schnitzler, T.; Schöning, M.J.; Wagner, T. Fabrication of
biocompatible lab-on-chip devices for biomedical applications by means of a 3D-printing process. Phys. Status
Solidi Appl. Mater. Sci. 2015, 212, 1347–1352. [CrossRef]
64. Asiga PlasCLEAR Technical Datasheet. Available online: https://www.asiga.com/media/main/files/
materials/PlasCLEAR_us_en.pdf (accessed on 27 November 2017).
65. Stratasys Stratasys PolyJet Materials Material Safety Data Sheets. Available online: http://www.stratasys.
com/materials/material-safety-data-sheets/polyjet/transparent-materials (accessed on 27 November 2017).
66. Martino, C.; Berger, S.; Wootton, R.C.R.; deMello, A.J. A 3D-printed microcapillary assembly for facile double
emulsion generation. Lab Chip 2014, 14, 4178–4182. [CrossRef] [PubMed]
67. 3D System Material Selection Guide for Stereolithography—SLA. Available online: https://www.3dsystems.
com/sites/default/files/2017-06/3D-Systems_SLS_MaterialSelectionGuide_USEN_2017.06.28_WEB.pdf
(accessed on 27 November 2017).
68. 3D Systems VisiJet S300 Specification Sheet. Available online: http://infocenter.3dsystems.com/projetmjp3600/
user-guide/introduction/important-safety-information/visijet%C2%AE-s300-specification-sheet (accessed on
27 November 2017).
69. 3D Systems VisiJet MP200, VisiJet M3 StonePlast Safety Data Sheet. Available online: http://infocenter.3dsystems.
com/materials/sites/default/files/sds-files/professional/24156-s12-02-asds_ghsenglishvisijet_mp200_and_m3_
stoneplast.pdf (accessed on 27 November 2017).
70. Au, A.K.; Bhattacharjee, N.; Horowitz, L.F.; Chang, T.C.; Folch, A. 3D-Printed Microfluidic Automation.
Lab Chip 2015, 15, 1934–1941. [CrossRef] [PubMed]
71. Wood, S.; Krishnamurthy, N.; Santini, T.; Raval, S.; Farhat, N.; Holmes, J.A.; Ibrahim, T.S. Design and
fabrication of a realistic anthropomorphic heterogeneous head phantom for MR purposes. PLoS ONE 2017,
12, e0183168. [CrossRef] [PubMed]
72. Proto Labs Product Data: Somos WaterShed XC 11122. Available online: https://www.protolabs.com/
media/1010884/somos-watershed-xc-11122.pdf (accessed on 27 November 2017).
73. MiiCraft. MiiCraft-Technical Data Sheet: BV-007 Clear Resin. Available online: http://www.miicraft.com/
support/ (accessed on 27 November 2017).
74. DWS Lab Materials Range. Available online: http://www.dwslab.com/materials-range/?v=7516fd43adaa
(accessed on 27 November 2017).
75. Choudhury, D.; Mo, X.; Iliescu, C.; Tan, L.L.; Tong, W.H.; Yu, H. Exploitation of physical and chemical
constraints for three-dimensional microtissue construction in microfluidics. Biomicrofluidics 2011, 5.
[CrossRef] [PubMed]
76. Waldbaur, A.; Rapp, H.; Länge, K.; Rapp, B.E. Let there be chip—Towards rapid prototyping of microfluidic
devices: One-step manufacturing processes. Anal. Methods 2011, 3, 2681. [CrossRef]
77. O’Neill, P.F.; Ben Azouz, A.; Vázquez, M.; Liu, J.; Marczak, S.; Slouka, Z.; Chang, H.C.; Diamond, D.;
Brabazon, D. Advances in three-dimensional rapid prototyping of microfluidic devices for biological
applications. Biomicrofluidics 2014, 8, 52112. [CrossRef] [PubMed]

107
Micromachines 2018, 9, 196

78. Spivey, E.C.; Xhemalce, B.; Shear, J.B.; Finkelstein, I.J. 3D-printed microfluidic microdissector for
high-throughput studies of cellular aging. Anal. Chem. 2014, 86, 7406–7412. [CrossRef] [PubMed]
79. Villegas, M.; Cetinic, Z.; Shakeri, A.; Didar, T.F. Fabricating smooth PDMS microfluidic channels from
low-resolution 3D printed molds using an omniphobic lubricant-infused coating. Anal. Chim. Acta 2018,
1000, 248–255. [CrossRef] [PubMed]
80. Hwang, Y.; Seo, D.; Roy, M.; Han, E.; Candler, R.N.; Seo, S. Capillary Flow in PDMS Cylindrical Microfluidic
Channel Using 3-D Printed Mold. J. Microelectromech. Syst. 2016, 25, 238–240. [CrossRef]
81. Hwang, Y.; Paydar, O.H.; Candler, R.N. 3D printed molds for non-planar PDMS microfluidic channels.
Sensors Actuators, A Phys. 2015, 226, 137–142. [CrossRef]
82. Saggiomo, V.; Velders, A.H. Simple 3D Printed Scaffold-Removal Method for the Fabrication of Intricate
Microfluidic Devices. Adv. Sci. 2015, 2, 1–5. [CrossRef] [PubMed]
83. Gelber, M.K.; Bhargava, R. Monolithic multilayer microfluidics via sacrificial molding of 3D-printed isomalt.
Lab Chip 2015, 15, 1736–1741. [CrossRef] [PubMed]
84. He, Y.; Qiu, J.; Fu, J.; Zhang, J.; Ren, Y.; Liu, A. Printing 3D microfluidic chips with a 3D sugar printer.
Microfluid. Nanofluid. 2015, 19, 447–456. [CrossRef]
85. Bonyár, A.; Sántha, H.; Ring, B.; Varga, M.; Kovács, J.G.; Harsányi, G. 3D Rapid Prototyping Technology
(RPT) as a powerful tool in microfluidic development. Procedia Eng. 2010, 5, 291–294. [CrossRef]
86. Shallan, A.I.; Smejkal, P.; Corban, M.; Guijt, R.M.; Breadmore, M.C. Cost-effective three-dimensional printing
of visibly transparent microchips within minutes. Anal. Chem. 2014, 86, 3124–3130. [CrossRef] [PubMed]
87. Kitson, P.J.; Rosnes, M.H.; Sans, V.; Dragone, V.; Cronin, L. Configurable 3D-Printed millifluidic and
microfluidic “lab on a chip” reactionware devices. Lab Chip 2012, 12, 3267. [CrossRef] [PubMed]
88. Donvito, L.; Galluccio, L.; Lombardo, A.; Morabito, G.; Nicolosi, A.; Reno, M. Experimental validation of a
simple, low-cost, T-junction droplet generator fabricated through 3D printing. J. Micromech. Microeng. 2015,
25. [CrossRef]
89. Comina, G.; Suska, A.; Filippini, D. 3D printed unibody lab-on-a-chip: Features survey and check-valves
integration. Micromachines 2015, 6, 437–451. [CrossRef]
90. Lee, W.; Kwon, D.; Choi, W.; Jung, G.Y.; Au, A.K.; Folch, A.; Jeon, S. 3D-Printed microfluidic device for the
detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.
Sci. Rep. 2015, 5, 1–7. [CrossRef] [PubMed]
91. Anderson, K.B.; Lockwood, S.Y.; Martin, R.S.; Spence, D.M. A 3D printed fluidic device that enables
integrated features. Anal. Chem. 2013, 85, 5622–5626. [CrossRef] [PubMed]
92. Erkal, J.L.; Selimovic, A.; Gross, B.C.; Lockwood, S.Y.; Walton, E.L.; McNamara, S.; Martin, R.S.; Spence, D.M.
3D printed microfluidic devices with integrated versatile and reusable electrodes. Lab Chip 2014, 14,
2023–2032. [CrossRef] [PubMed]
93. Chudobova, D.; Cihalova, K.; Skalickova, S.; Zitka, J.; Rodrigo, M.A.M.; Milosavljevic, V.; Hynek, D.; Kopel, P.;
Vesely, R.; Adam, V.; et al. 3D-printed chip for detection of methicillin-resistant Staphylococcus aureus
labeled with gold nanoparticles. Electrophoresis 2015, 36, 457–466. [CrossRef] [PubMed]
94. Krejcova, L.; Nejdl, L.; Rodrigo, M.A.M.; Zurek, M.; Matousek, M.; Hynek, D.; Zitka, O.; Kopel, P.; Adam, V.;
Kizek, R. 3D printed chip for electrochemical detection of influenza virus labeled with CdS quantum dots.
Biosens. Bioelectron. 2014, 54, 421–427. [CrossRef] [PubMed]
95. Sugioka, K.; Hanada, Y.; Midorikawa, K. 3D microstructuring of glass by femtosecond laser direct writing
and application to biophotonic microchips. Prog. Electromagn. Res. Lett. 2008, 1, 942–946. [CrossRef]
96. Hanada, Y.; Sugioka, K.; Shihira-Ishikawa, I.; Kawano, H.; Miyawaki, A.; Midorikawa, K. 3D microfluidic
chips with integrated functional microelements fabricated by a femtosecond laser for studying the gliding
mechanism of cyanobacteria. Lab Chip 2011, 11, 2109. [CrossRef] [PubMed]
97. Huang, T.Q.; Qu, X.; Liu, J.; Chen, S. 3D printing of biomimetic microstructures for cancer cell migration.
Biomed. Microdevices 2014, 16, 127–132. [CrossRef] [PubMed]
98. Neils, C.; Tyree, Z.; Finlayson, B.; Folch, A. Combinatorial mixing of microfluidic streams. Lab Chip 2004, 4,
342–350. [CrossRef] [PubMed]
99. Bhargava, K.C.; Thompson, B.; Malmstadt, N. Discrete elements for 3D microfluidics. Proc. Natl. Acad.
Sci. USA 2014, 111, 15013–15018. [CrossRef] [PubMed]

108
Micromachines 2018, 9, 196

100. Robinson, C.D.; Auchtung, J.M.; Collins, J.; Britton, R.A. Epidemic Clostridium difficile strains demonstrate
increased competitive fitness compared to nonepidemic isolates. Infect. Immun. 2014, 82, 2815–2825.
[CrossRef] [PubMed]
101. Lind, J.U.; Busbee, T.A.; Valentine, A.D.; Pasqualini, F.S.; Yuan, H.; Yadid, M.; Park, S.J.; Kotikian, A.;
Nesmith, A.P.; Campbell, P.H.; et al. Instrumented cardiac microphysiological devices via multimaterial
three-dimensional printing. Nat. Mater. 2017, 16, 303–308. [CrossRef] [PubMed]
102. Guan, A.; Wang, Y.; Phillips, K.S.; Li, Z. A contact-lens-on-a-chip companion diagnostic tool for personalized
medicine. Lab Chip 2016, 16, 1152–1156. [CrossRef] [PubMed]
103. Chapman, R.G.; Ostuni, E.; Liang, M.N.; Meluleni, G.; Kim, E.; Yan, L.; Pier, G.; Warren, H.S.; Whitesides, G.M.
Polymeric thin films that resist the adsorption of proteins and the adhesion of bacteria. Langmuir 2001, 17,
1225–1233. [CrossRef]
104. Zhang, H.; Hao, R.; Ren, X.; Yu, L.; Yang, H.; Yu, H. PEG/lecithin–liquid-crystalline composite hydrogels for
quasi-zero-order combined release of hydrophilic and lipophilic drugs. RSC Adv. 2013, 3, 22927. [CrossRef]
105. Goddard, J.M.; Hotchkiss, J.H. Polymer surface modification for the attachment of bioactive compounds.
Prog. Polym. Sci. 2007, 32, 698–725. [CrossRef]
106. Zheng, J.; Li, L.; Tsao, H.-K.; Sheng, Y.-J.; Chen, S.; Jiang, S. Strong Repulsive Forces between Protein and
Oligo (Ethylene Glycol) Self-Assembled Monolayers: A Molecular Simulation Study. Biophys. J. 2005, 89,
158–166. [CrossRef] [PubMed]
107. Herrwerth, S.; Eck, W.; Reinhardt, S.; Grunze, M. Factors that determine the protein resistance of oligoether
self-assembled monolayers-Internal hydrophilicity, terminal hydrophilicity, and lateral packing density.
J. Am. Chem. Soc. 2003, 125, 9359–9366. [CrossRef] [PubMed]
108. Vermette, P.; Meagher, L. Interactions of phospholipid- and poly(ethylene glycol)-modified surfaces with
biological systems: Relation to physico-chemical properties and mechanisms. Colloids Surf. B Biointerfaces
2003, 28, 153–198. [CrossRef]
109. Morra, M. On the molecular basis of fouling resistance. J. Biomater. Sci. Polym. Ed. 2000, 11, 547–569.
[CrossRef] [PubMed]
110. Zhang, Z.; Wang, J.; Tu, Q.; Nie, N.; Sha, J.; Liu, W.; Liu, R.; Zhang, Y.; Wang, J. Surface modification of PDMS
by surface-initiated atom transfer radical polymerization of water-soluble dendronized PEG methacrylate.
Colloids Surf. B Biointerfaces 2011, 88, 85–92. [CrossRef] [PubMed]
111. Bernards, M.T.; Cheng, G.; Zhang, Z.; Chen, S. Nonfouling Polymer Brushes via Surface-Initiated,
Two-Component Atom Transfer Radical Polymerization—Macromolecules (ACS Publications). Macromolecules
2008, 41, 4216–4219. [CrossRef]
112. Bernards, M.; He, Y. Polyampholyte polymers as a versatile zwitterionic biomaterial platform. J. Biomater.
Sci. Polym. Ed. 2014, 25, 1479–1488. [CrossRef] [PubMed]
113. Anthony Yesudass, S.; Mohanty, S.; Nayak, S.K.; Rath, C.C. Zwitterionic–polyurethane coatings for
non-specific marine bacterial inhibition: A nontoxic approach for marine application. Eur. Polym. J.
2017, 96, 304–315. [CrossRef]
114. Li, G.; Xue, H.; Gao, C.; Zhang, F.; Jiang, S. Nonfouling polyampholytes from an ion-pair comonomer with
biomimetic adhesive groups. Macromolecules 2010, 43, 14–16. [CrossRef] [PubMed]
115. Parker, A.P.; Reynolds, P.A.; Lewis, A.L.; Kirkwood, L.; Hughes, L.G. Investigation into potential
mechanisms promoting biocompatibility of polymeric biomaterials containing the phosphorylcholine moiety:
A physicochemical and biological study. Colloids Surf. B Biointerfaces 2005, 46, 204–217. [CrossRef] [PubMed]
116. Murphy, E.F.; Keddie, J.L.; Lu, J.R.; Brewer, J.; Russell, J. The reduced adsorption of lysozyme at the
phosphorylcholine incorporated polymer/aqueous solution interface studied by spectroscopic ellipsometry.
Biomaterials 1999, 20, 1501–1511. [CrossRef]
117. Yu, L.; Li, C.M.; Liu, Y.; Gao, J.; Wang, W.; Gan, Y. Flow-through functionalized PDMS microfluidic channels
with dextran derivative for ELISAs. Lab Chip 2009, 9, 1243. [CrossRef] [PubMed]
118. Hu, S.G.; Jou, C.H.; Yang, M.C. Protein adsorption, fibroblast activity and antibacterial properties of
poly(3-hydroxybutyric acid-co-3-hydroxyvaleric acid) grafted with chitosan and chitooligosaccharide after
immobilized with hyaluronic acid. Biomaterials 2003, 24, 2685–2693. [CrossRef]
119. McArthur, S.L.; McLean, K.M.; Kingshott, P.; St John, H.A.W.; Chatelier, R.C.; Griesser, H.J. Effect of
polysaccharide structure on protein adsorption. Colloids Surf. B Biointerfaces 2000, 17, 37–48. [CrossRef]

109
Micromachines 2018, 9, 196

120. Martwiset, S.; Koh, A.E.; Chen, W. Nonfouling characteristics of dextran-containing surfaces. Langmuir 2006,
22, 8192–8196. [CrossRef] [PubMed]
121. Zhao, C.; Li, L.; Wang, Q.; Yu, Q.; Zheng, J. Effect of film thickness on the antifouling performance of
poly(hydroxy-functional methacrylates) grafted surfaces. Langmuir 2011, 27, 4906–4913. [CrossRef] [PubMed]
122. Wu, D.; Luo, Y.; Zhou, X.; Dai, Z.; Lin, B. Multilayer poly(vinyl acohol)-adsorbed coating on
poly(dimethylsiloxane) microfluidic chips for biopolymer separation. Electrophoresis 2005, 26, 211–218.
[CrossRef] [PubMed]
123. Huang, X.; Doneski, L.J.; Wirth, M.J. Surface-Confined Living Radical Polymerization for Coatings in
Capillary Electrophoresis. Anal. Chem. 1998, 70, 4023–4029. [CrossRef] [PubMed]
124. Huang, X.; Wirth, M.J. Surface-initiated radical polymerization on porous silica. Anal. Chem. 1997, 69,
4577–4580. [CrossRef]
125. Yu, H.J.; Luo, Z.H. Novel superhydrophobic silica/poly(siloxane-fluoroacrylate) hybrid nanoparticles
prepared via two-step surface-initiated ATRP: Synthesis, characterization, and wettability. J. Polym. Sci. Part
A Polym. Chem. 2010, 48, 5570–5580. [CrossRef]
126. Wang, Y.; Betts, D.E.; Finlay, J.A.; Brewer, L.; Callow, M.E.; Callow, J.A.; Wendt, D.E.; Desimone, J.M.
Photocurable amphiphilic perfluoropolyether/poly(ethylene glycol) networks for fouling-release coatings.
Macromolecules 2011, 44, 878–885. [CrossRef]
127. Sundaram, H.S.; Cho, Y.; Dimitriou, M.D.; Finlay, J.A.; Cone, G.; Williams, S.; Handlin, D.; Gatto, J.;
Callow, M.E.; Callow, J.A.; et al. Fluorinated amphiphilic polymers and their blends for fouling-release
applications: The benefits of a triblock copolymer surface. ACS Appl. Mater. Interfaces 2011, 3, 3366–3374.
[CrossRef] [PubMed]
128. Martinelli, E.; Agostini, S.; Galli, G.; Chiellini, E.; Glisenti, A.; Pettitt, M.E.; Callow, M.E.; Callow, J.A.;
Graf, K.; Bartels, F.W. Nanostructured films of amphiphilic fluorinated block copolymers for fouling release
application. Langmuir 2008, 24, 13138–13147. [CrossRef] [PubMed]
129. Wyss Institute. SLIPS (Slippery Liquid-Infused Porous Surfaces). Available online: https://wyss.harvard.
edu/technology/slips-slippery-liquid-infused-porous-surfaces (accessed on 27 November 2017).
130. Wong, T.-S.; Kang, S.H.; Tang, S.K.Y.; Smythe, E.J.; Hatton, B.D.; Grinthal, A.; Aizenberg, J. Bioinspired
self-repairing slippery surfaces with pressure-stable omniphobicity. Nature 2011, 477, 443–447. [CrossRef]
[PubMed]
131. Epstein, A.K.; Wong, T.-S.; Belisle, R.A.; Boggs, E.M.; Aizenberg, J. Liquid-infused structured surfaces with
exceptional anti-biofouling performance. Proc. Natl. Acad. Sci. USA 2012, 109, 13182–13187. [CrossRef]
[PubMed]
132. Vogel, N.; Belisle, R.A.; Hatton, B.; Wong, T.S.; Aizenberg, J. Transparency and damage tolerance of
patternable omniphobic lubricated surfaces based on inverse colloidal monolayers. Nat. Commun. 2013, 4,
1–10. [CrossRef] [PubMed]
133. Juthani, N.; Howell, C.; Ledoux, H.; Sotiri, I.; Kelso, S.; Kovalenko, Y.; Tajik, A.; Vu, T.L.; Lin, J.J.; Sutton, A.;
et al. Infused polymers for cell sheet release. Sci. Rep. 2016, 6, 1–9. [CrossRef] [PubMed]
134. Kota, A.K.; Kwon, G.; Tuteja, A. The design and applications of superomniphobic surfaces. NPG Asia Mater.
2014, 6, e109. [CrossRef]
135. Li, X.-M.; Reinhoudt, D.; Crego-Calama, M. What do we need for a superhydrophobic surface? A review
on the recent progress in the preparation of superhydrophobic surfaces. Chem. Soc. Rev. 2007, 36, 1350.
[CrossRef] [PubMed]
136. Grinthal, A.; Aizenberg, J. Mobile interfaces: Liquids as a perfect structural material for multifunctional,
antifouling surfaces. Chem. Mater. 2014, 26, 698–708. [CrossRef]
137. Kim, P.; Kreder, M.J.; Alvarenga, J.; Aizenberg, J. Hierarchical or not? Effect of the length scale and hierarchy
of the surface roughness on omniphobicity of lubricant-infused substrates. Nano Lett. 2013, 13, 1793–1799.
[CrossRef] [PubMed]
138. Maccallum, N.; Howell, C.; Kim, P.; Sun, D.; Friedlander, R.; Ranisau, J.; Ahanotu, O.; Lin, J.J.; Vena, A.;
Hatton, B.; et al. Liquid-Infused Silicone As a Biofouling-Free Medical Material. ACS Biomater. Sci. Eng. 2015,
1, 43–51. [CrossRef]
139. Howell, C.; Vu, T.L.; Johnson, C.P.; Hou, X.; Ahanotu, O.; Alvarenga, J.; Leslie, D.C.; Uzun, O.; Waterhouse, A.;
Kim, P.; et al. Stability of surface-immobilized lubricant interfaces under flow. Chem. Mater. 2015, 27,
1792–1800. [CrossRef]

110
Micromachines 2018, 9, 196

140. Keller, D.; Besch, W. Plasma-Induced Surface Functionalization of Polymeric Biomaterials in Ammonia
Plasma. Contrib. Plasma Phys. 2001, 41, 562–572. [CrossRef]
141. Badv, M.; Jaffer, I.H.; Weitz, J.I.; Didar, T.F. An omniphobic lubricant-infused coating produced by chemical
vapor deposition of hydrophobic organosilanes attenuates clotting on catheter surfaces. Sci. Rep. 2017, 7,
1–10. [CrossRef] [PubMed]
142. Milton Harris, J.; Chess, R.B. Effect of pegylation on pharmaceuticals. Nat. Rev. Drug Discov. 2003, 2, 214–221.
[CrossRef] [PubMed]
143. Sotiri, I.; Overton, J.C.; Waterhouse, A.; Howell, C. Immobilized liquid layers: A new approach to
anti-adhesion surfaces for medical applications. Exp. Biol. Med. 2016, 241, 909–918. [CrossRef] [PubMed]
144. Zhang, F.; Sautter, K.; Larsen, A.M.; Findley, D.A.; Davis, R.C.; Samha, H.; Linford, M.R. Chemical vapor
deposition of three aminosilanes on silicon dioxide: Surface characterization, stability, effects of silane
concentration, and cyanine dye adsorption. Langmuir 2010, 26, 14648–14654. [CrossRef] [PubMed]
145. Liu, Z.Z.; Wang, Q.; Liu, X.; Bao, J.Q. Effects of amino-terminated self-assembled monolayers on nucleation
and growth of chemical vapor-deposited copper films. Thin Solid Films 2008, 517, 635–640. [CrossRef]
146. Baker, J.; Stephenson, T.; Dard, S.; Cote, P. Characterisation of fouling of nanofiltration membranes used to
treat surface waters. Environ. Technol. 1995, 16, 977–985. [CrossRef]
147. Van Paassen, J.A.M.; Kruithof, J.C.; Bakker, S.M.; Kegel, F.S. Integrated multi-objective membrane systems
for surface water treatment: Pre-treatment of nanofiltration by riverbank filtration and conventional ground
water treatment. Desalination 1998, 118, 239–248. [CrossRef]
148. Cornelissen, E.R.; Vrouwenvelder, J.S.; Heijman, S.G.J.; Viallefont, X.D.; Van Der Kooij, D.; Wessels, L.P.
Periodic air/water cleaning for control of biofouling in spiral wound membrane elements. J. Membr. Sci.
2007, 287, 94–101. [CrossRef]
149. Majamaa, K.; Aerts, P.E.M.; Groot, C.; Paping, L.L.M.J.; van den Broek, W.; van Agtmaal, S. Industrial
water reuse with integrated membrane system increases the sustainability of the chemical manufacturing.
Desalin. Water Treat. 2010, 18, 17–23. [CrossRef]
150. Miller, D.J.; Araújo, P.A.; Correia, P.B.; Ramsey, M.M.; Kruithof, J.C.; van Loosdrecht, M.C.M.; Freeman, B.D.;
Paul, D.R.; Whiteley, M.; Vrouwenvelder, J.S. Short-term adhesion and long-term biofouling testing of
polydopamine and poly(ethylene glycol) surface modifications of membranes and feed spacers for biofouling
control. Water Res. 2012, 46, 3737–3753. [CrossRef] [PubMed]
151. Ronen, A.; Resnick, A.; Lerman, S.; Eisen, M.S.; Dosoretz, C.G. Biofouling suppression of modified feed
spacers: Localized and long-distance antibacterial activity. Desalination 2015, 393, 159–165. [CrossRef]
152. Ronen, A.; Lerman, S.; Ramon, G.Z.; Dosoretz, C.G. Experimental characterization and numerical simulation
of the anti-biofuling activity of nanosilver-modified feed spacers in membrane filtration. J. Membr. Sci. 2015,
475, 320–329. [CrossRef]
153. Wibisono, Y.; Yandi, W.; Golabi, M.; Nugraha, R.; Cornelissen, E.R.; Kemperman, A.J.B.; Ederth, T.;
Nijmeijer, K. Hydrogel-coated feed spacers in two-phase flow cleaning in spiral wound membrane elements:
Anovel platform for eco-friendly biofouling mitigation. Water Res. 2015, 71, 171–186. [CrossRef] [PubMed]
154. Araújo, P.A.; Kruithof, J.C.; Van Loosdrecht, M.C.M.; Vrouwenvelder, J.S. The potential of standard and
modified feed spacers for biofouling control. J. Membr. Sci. 2012, 403–404, 58–70. [CrossRef]
155. McCullough, E.J.; Yadavalli, V.K. Surface modification of fused deposition modeling ABS to enable rapid
prototyping of biomedical microdevices. J. Mater. Process. Technol. 2013, 213, 947–954. [CrossRef]
156. Upcraft, S.; Fletcher, R. The rapid prototyping technologies. Assem. Autom. 2003, 23, 318–330. [CrossRef]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

111
micromachines

Article
3D-Printed Capillary Circuits for Calibration-Free
Viscosity Measurement of Newtonian and
Non-Newtonian Fluids
Sein Oh and Sungyoung Choi *
Department of Biomedical Engineering, Kyung Hee University, 1732 Deogyeong-daero, Giheung-gu, Yongin-si,
Gyeonggi-do 17104, Korea; [email protected]
* Correspondence: [email protected]; Tel.: +82-31-201-3496

Received: 25 May 2018; Accepted: 16 June 2018; Published: 21 June 2018

Abstract: Measuring viscosity is important for the quality assurance of liquid products, as well as
for monitoring the viscosity of clinical fluids as a potential hemodynamic biomarker. However,
conventional viscometers and their microfluidic counterparts typically rely on bulky and expensive
equipment, and lack the ability for rapid and field-deployable viscosity analysis. To address these
challenges, we describe 3D-printed capillary circuits (3D-CCs) for equipment- and calibration-free
viscosity measurement of Newtonian and non-Newtonian fluids. A syringe, modified with an
air chamber serving as a pressure buffer, generates and maintains a set pressure to drive the
pressure-driven flows of test fluids through the 3D-CCs. The graduated fluidic chambers of the
3D-CCs serve as a flow meter, enabling simple measurement of the flow rates of the test fluids
flowing through the 3D-CCs, which is readable with the naked eye. The viscosities of the test fluids
can be simply calculated from the measured flow rates under a set pressure condition without
the need for peripheral equipment and calibration. We demonstrate the multiplexing capability of
the 3D-CC platform by simultaneously measuring different Newtonian-fluid samples. Further, we
demonstrate that the shear-rate dependence of the viscosity of a non-Newtonian fluid can be analyzed
simultaneously under various shear-rate conditions with the 3D-CC platform.

Keywords: viscometer; 3D printing; capillary circuit; microfluidics; Newtonian fluid; non-Newtonian fluid

1. Introduction
Measuring viscosity is important for assessing the quality of liquid products [1–5], optimizing
the performance of microfluidic devices [6,7], and monitoring the viscosity of clinical fluids as a
hemodynamic biomarker [8]. Testing the viscosity of liquid products is an indispensable process
to maximize production efficiency and to screen formulation candidates across diverse industrial
fields [1–5]. Whole blood viscosity has a significant correlation with Alzheimer’s disease and can
be used as a potential biomarker for the monitoring and control of the disease [8]. Hyperviscosity
syndrome is a combination of clinical symptoms (e.g., mucosal hemorrhage, visual abnormalities,
or neurological disorders) caused by increased blood viscosity. It can be diagnosed by measuring
whole blood viscosity or plasma viscosity, and treated by plasmapheresis and blood transfusion [9].
Two types of viscometers are commonly used for such applications and categorized into cone-plate
viscometers [10] and capillary viscometers [11]. Cone-plate viscometers utilize a rotating cone that
applies a shearing force and measures the resistance of a test fluid between the cone and a stationary
plate [10]. Although cone-plate viscometers allow viscosity measurement over a wide range of
viscosities and shear rates, their use at the sampling point for rapid and on-site viscosity measurement is
typically limited by low measurement throughput and the requirement of bulky and costly equipment.
Capillary viscometers are based on the Hagen-Poiseuille law and determine the viscosity of a test

Micromachines 2018, 9, 314; doi:10.3390/mi9070314 112 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 314

fluid from a measured flow rate under a given pressure condition or a measured pressure under a
given flow-rate condition [11]. While relatively small and simple to operate, capillary viscometers
require expensive, high-precision sensors and actuators for accurate viscosity measurement, thereby,
increasing the cost of analysis.
Recently, miniaturized viscometers have been developed by adopting the advantages of
microfluidic technologies, including low sample consumption, cost-effectiveness, small device
footprint, and ease-of-use [12], and can be categorized as being based on a single microchannel [13,14],
a falling ball [15], droplet microfluidics [16,17], a microfluidic comparator [18–20], or an optical
tweezer [21]. The microchannel approach utilizes the relationship between the flow rate and viscosity
of a test fluid flowing through a microchannel under a given capillary pressure [13,14]. Falling-ball
viscometers measure the settling velocity of a ball falling in a test fluid that is correlated to the
viscosity of the fluid of interest [15]. In droplet-based viscometers, micro-droplets are generated
through a flow-focusing device and the length of the droplets, which is a function of rheological
parameters, determines the viscosity of an aqueous or non-aqueous fluid [16,17]. The comparator
approach uses a parallel microchannel in which the co-flowing laminar streams of two fluids,
namely, a reference fluid with a known viscosity and a test fluid with an unknown viscosity,
can form different interfacial positions or equilibrium states depending on their viscosities [18–20].
Thereby, the stream-width ratio or the flow-rate ratio of the two fluids determines the relative
viscosity of the test fluid. An optical tweezer has been used to measure viscosity by monitoring
the trajectory of an optically-trapped bead [21]. Although this method enables accurate viscosity
measurement with low sample consumption in a few microliters per measurement, it typically requires
complex and costly optical setup and lacks the ability to perform multiplexed viscosity measurement.
The above approaches have been proven effective to analyze various kinds of fluids, such as whole
blood [15,18,19], blood plasma [13], and polymer products [14], but there are limitations that impede
the wide-spread use of these approaches in industrial and clinical applications. The microchannel
approach requires cumbersome microscopic flow observation for viscosity measurement. The falling
ball approach lacks sufficient controllability to generate a range of shear rates for the analysis
of a non-Newtonian fluid. The comparator and droplet-based viscometers rely on bulky and
high-precision pumps for the stable and accurate generation of co-flowing laminar streams and
micro-droplets, respectively, which increases the size and cost of the overall system. To address these
challenges, our group has recently developed 3D-printed capillary circuits (3D-CCs) that consist of
parallel capillary channels for simple viscosity measurement [22,23]. The 3D-CCs, though enabling
equipment-free and multiplexed viscosity measurement, is highly dependent on the accuracy of a
reference-fluid viscosity, requiring its additional calibration for accurate viscosity measurement.
Here, we report new 3D-CCs that enable equipment- and calibration-free viscosity measurement
of Newtonian and non-Newtonian fluids (Figure 1). The 3D-CC platform enables simple flow-rate
measurement using the graduated fluidic chambers of the 3D-CCs and portable generation of a set
pressure using a modified syringe, called a ‘smart pipette’, that is powered by hand. Based on the
Hagen-Poiseuille law, the viscosities of test fluids flowing through the capillaries of the 3D-CCs can
be calculated from the measured flow rates under a set pressure condition. The number of test fluid
samples to be simultaneously analyzed can be augmented simply by adding more fluidic channels.
We demonstrated the multiplexed capability of the 3D-CC platform by simultaneously measuring
four Newtonian fluid samples within two minutes and comparing the measurement results with a
conventional cone-plate viscometer. We also demonstrated that the 3D-CC platform enables simple
analysis of a non-Newtonian fluid under multiple shear-rate conditions, proving the potential of the
3D-CC platform for rapid and on-site viscosity analysis of Newtonian and non-Newtonian fluids.

113
Micromachines 2018, 9, 314

Figure 1. Working principle of the 3D-printed capillary circuit (3D-CC) platform for equipment- and
calibration-free viscosity measurement. (a) (Top) Fabrication process of the 3D-CC having four identical
fluidic channels for the multiplexed analysis of Newtonian fluids. (Bottom) Optical image of the
fabricated 3D-CC filled with red ink for visualization; (b) schematic of the operation process: (top) Scale
reading after withdrawing test liquids and (bottom) expelling the liquids by fully depressing the
plunger. The volumetric flow rate (Q) of each test fluid can be measured by the number of scale ticks
(ns ) counted for a given time. Knowing the Q, capillary dimensions, and drop in pressure through each
capillary, the viscosities of the test liquids can be simultaneously determined without cumbersome
calibration and expensive equipment; (c) experimental setup for multiplexed viscosity measurement
using the 3D-CC platform composed of the 3D-CC and smart pipette.

2. Materials and Methods

2.1. Device Fabrication


The 3D-CCs were fabricated by assembling a 3D-printed housing and cut tubing pieces to be used
as the capillaries and fluidic chambers of the 3D-CCs (Figure 1). The 3D-printed parts were fabricated
using a stereolithography-based 3D printer (DWS Systems, Thiene, Italy). The details of fabrication
using stereolithography can be found in previous literature [24,25]. Tygon® tubings, with an inner
diameter of 0.508 and 3.17 mm (Cole-Parmer, Vernon Hills, IL, USA), were cut into pieces to serve
as the capillaries and fluidic chambers of the 3D-CCs, respectively. The air chamber, with an inner
volume of 1.27 L, was fabricated using a 3D printer. Luer-Lock fittings were attached to the ends of the
chamber for reversible and airtight interconnection between a 3D-CC and a syringe (Figure 1c). A film
mask with scale ticks was fabricated, cut into pieces, and attached to the assembled 3D-CC for volume
indication (Figure 1).
A microfluidic viscometer for comparison with the 3D-CC for analysis of a non-Newtonian fluid
was fabricated by photolithography and polydimethylsiloxane (PDMS) replica molding processes as
previously reported (Figure S1) [22]. The comparator is composed of an inlet device and an outlet
device. The inlet device has two inlets, a junction channel, and two outlets, and the outlet device has
two inlets and one outlet. The devices were connected through cut tubing pieces, having an inner
diameter of 0.508 mm and a length of 20 cm. The microfluidic comparator is based on the comparison
of two different fluid streams (i.e., a test fluid and a reference fluid) in the junction channel. The ratio
of their viscosities can be determined by the ratio of their flow rates at the equilibrium state, where the
interfacial position of the fluids is stationary in the junction channel. This approach requires additional
calibration for the reference-fluid viscosity to calculate the absolute viscosity of the test fluid.

114
Micromachines 2018, 9, 314

2.2. Sample Preparation and Analysis


A glycerol solution was purchased from Sigma-Aldrich (St. Louis, MO, USA) and diluted in
distilled water at various concentrations (50 to 64.5 wt %) for the preparation of Newtonian fluids of
different viscosities. The viscosities of the glycerol-water mixtures were determined using a cone-plate
viscometer (Brookfield AMETEK Inc., Middleborough, MA, USA). A xanthan gum solution was
obtained from Sigma-Aldrich and diluted in distilled water at a concentration of 0.1 wt % for analysis
of a non-Newtonian fluid. All experiments with the 3D-CCs were recorded using a smartphone and
changes in liquid level were measured during 15 s. The volumetric flow rate in each channel of the
3D-CCs was calculated by multiplying the cross-sectional area of the fluidic chamber by the number
of measurement ticks counted per unit time. The microfluidic comparator was operated using two
syringe pumps (KD Scientific, Holliston, MA, USA), and the flow rates of the test and reference fluids
were manually adjusted to determine the equilibrium state.

2.3. Computational Fluid Dynamics Simulation


The pressure drop profile along the channel of the 3D-CC for multiplexed analysis of Newtonian
fluids was analyzed using COMSOL Multiphysics (COMSOL, Burlington, MA, USA) to verify the
design criterion for the pressure-drop ratio between the capillary and fluidic chamber. The wall shear
rate and pressure drop along the length of each capillary of the 3D-CC for analysis of a non-Newtonian
fluid were also analyzed using COMSOL Multiphysics to determine capillary lengths to achieve
desired shear-rate conditions. Three-dimensional finite element models were created in the same
dimensions as the 3D-CCs and solved using the incompressible Naiver-Stokes equation. The inlet
boundary condition was set to a constant pressure, while the outlet boundary condition was set to
atmospheric pressure. All other boundary conditions were set with no-slip boundary conditions.

3. Results and Discussion

3.1. Measurement Principle


The 3D-CC platform is composed of a 3D-CC and a smart pipette to measure the volumetric flow
rates (Q) of test fluids discharging through the channels of the 3D-CC and to pump the fluids at a
fixed pressure drop, respectively (Figure 1). The channels of the 3D-CC are arranged in a successive
structure of a capillary and a fluidic chamber. The scales marked on the fluidic chamber enable accurate
measurement of the liquid volume discharging through each channel over a given time (Δt), thereby,
determining Q. The smart pipette has an air chamber serving as a pressure buffer, thereby, generating
a fixed pressure condition [26–29]. The Hagen-Poiseuille law is the basis of the 3D-CC platform to
measure viscosity without a reference fluid [30]:

πr4 ΔP
Q= (1)
8 μL

where ΔP is the pressure drop through each capillary of the 3D-CC, r is the capillary radius, μ is
the fluid viscosity, and L is the capillary length. Test fluids of an unknown viscosity are filled and
dispensed through the channels of the 3D-CC under a fixed pressure-drop condition (Figure 1b). The Q
of each test fluid can be measured by the number of scale ticks (ns ) for Δt. Knowing the Q, capillary
dimensions and drop in pressure through each capillary, the viscosities of test fluids can be simply
calculated using Equation (1).
There are two design parameters that affect viscosity measurement accuracy. The first parameter
is the volume setting of the smart pipette. Depressing the syringe plunger in a set volume (V 1 )
compresses the air inside the air chamber and generates a desired pressure (P). Since the product of
pressure and volume is a constant at a constant temperature based on Boyle’s law, P can be defined
as P = (V 1 /V 2 )Patm , where V 2 is the volume of compressed air. However, a continual expansion in

115
Micromachines 2018, 9, 314

V 2 occurs due to the discharging volume of liquid, V 3 , thereby, affecting P. Thus, V 1 and V 2 should
be sufficiently larger than V 3 to maintain P. The smart pipette was, thus, designed with a large air
chamber volume of 1.27 L, at which V 3 becomes negligible. At (V 1 )min = 20 mL, V 2 = 1.27 L and
(V 3 )max = 0.5 mL, the smart pipette can, theoretically, maintain P within 99.96%. A pressure sensor can
be further integrated into the smart pipette for accurate pressure measurement.
The resistance ratio between the capillary and fluidic chamber of the 3D-CC is another design
parameter for accurate viscosity measurement. Under a fixed P, the applied pressure drops along the
capillary and fluidic chamber. In the serial connection, the upstream fluidic chamber resistance (Rf ) can
affect the downstream ΔP, i.e., the pressure drop through the capillary. During liquid dispensation,
Rf decreases due to a decrease in the length of the liquid filling in each fluidic chamber. The decreasing
Rf can result in changes in ΔP, leading to an inaccurate viscosity measurement. To maintain the
pressure drop through the capillary at P regardless of Rf , it is necessary to have a capillary, Rc > 410Rf ,
as previously reported [22], where Rc is the capillary resistance. Under this condition, it can be assumed
that P drops only in the capillaries of the 3D-CC. Q can be measured by multiplying the cross-sectional
area of the 3D-CC chamber and the length difference of the liquid meniscuses moved during liquid
dispensation. As a result, Equation (1) can be rewritten as:
 
πr4 πr4 Δt V1
μ= P=   Patm (2)
8LQ 8L πr2f l dns V2

where rfl is the radius of the fluidic chamber and d is the distance between adjacent scale ticks.
Therefore, simply pushing the plunger of the smart pipette by V 1 and counting ns during Δt enables
accurate viscosity measurement by calculating Equation (2), with a set P, known geometric dimensions,
and measured ns . The concept of connecting multiple capillaries and generating fluid flows through
the capillaries using the portable pressure generator enables multiplexed viscosity analysis of different
fluid samples, equipment-free viscosity measurement and viscosity analysis of a non-Newtonian fluid
over a range of shear rates, and provides ease of use similar to a conventional pipette, as well as a new
perspective for 3D-printed fluidic sensors.

3.2. Multiplexed Analysis of Newtonian Fluids


We first tested the ability of the 3D-CC platform for multiplexed analysis of Newtonian fluids.
The 3D-CC for multiplexed analysis of Newtonian fluids was fabricated by incorporating 12 cm-long
Tygon® tubing pieces (inner diameter: 0.508 mm) as a capillary, 3.9 cm-long Tygon® tubing pieces (inner
diameter: 3.17 mm) as a fluidic chamber, and a scale-patterned film into a 3D-printed part (Figure 1).
Under this condition, the ratio of Rc and Rf was greater than 4000 and the pressure drop along the
fluidic chamber was negligible, satisfying the above design criteria (Figure 2). Glycerol-in-water
mixtures in different weight ratios were used as a model system for Newtonian fluids of different
viscosities. Their viscosities of the glycerol solutions were measured using a commercial cone-plate
viscometer and compared with the results obtained from the 3D-CC. Viscosity measurements were
performed by a simple two-step process: Withdrawing and dispensing test fluids through the channels
of the 3D-CC. At P = 2.4 kPa and Δt = 15 s, ns highly depended on the viscosity of a fluid discharging
through each channel of the 3D-CC (Figure 3a). As shown in Figure 3b, the viscosity data obtained
using the 3D-CC in the range of V 1 (30 to 50 mL), which corresponds to the range of P (2.4 to 4.0 kPa),
had good agreement with those measured using the cone-plate viscometer. We note that the coefficient
of variation (CV) for V 1 = 20 mL and μc = 14.4 cP was 9.1%, which was significantly higher than
the averaged CV of 3.5% for other V 1 and μc conditions (range; 0–6.7%) (Figure 3b), where μc is
the viscosity measured using the cone-plate viscometer. This is likely due to the low count of ns at
V 1 = 20 mL and μc = 14.4 cP, which was 6.7 ± 0.6. If ns is too low, then the measured μ may not be
representative of the actual μ due to an increased effect of stochastic variables. It was, thus, necessary
to use ns ≥ 9 to ensure reliable viscosity measurement. In addition, the viscosity value (15.6 ± 1.4 cP)

116
Micromachines 2018, 9, 314

measured using the 3D-CC at V 1 = 20 mL and μc = 14.4 cP was higher than μc (14.4 ± 0.1 cP) (Figure 3b).
This might be due to the low shear rate condition (108.7 s−1 ) for viscosity measurement under which
fluid-wall interactions and gravitational effects can become dominant. Such additional effects make
the test fluid appear to have a high viscosity. As shown in Figure 4, V 1 or the corresponding shear rate
condition is an important operational parameter for accurate viscosity measurement at fixed capillary
geometry and V 2 . The shear rate condition for 3D-CC operation should be higher than 108.7 s−1 for
accurate viscosity measurement.

Figure 2. Computational fluid dynamics simulation showing the pressure profile along the fluidic
channel of the 3D-CC for multiplexed analysis at μ = 11.0 cP and P = 2.4 kPa. Compared to the capillary,
the drop in pressure along the fluidic chamber is negligible.

Figure 3. Multiplexed analysis of Newtonian fluids using the 3D-CC, having four identical fluidic
channels. (a) Glycerol-water mixtures with different viscosities were analyzed using the 3D-CC
platform at V 1 = 30 mL. Their viscosities were 6.1, 8.8, 11.0, and 14.4 cP (from top to bottom) as
determined by the cone-plate viscometer. The blue arrows indicate meniscuses; (b) effect of V 1 on
viscosity measurement. Solid lines denote linear regressions, while dotted lines represent a unity slope.
Error bars: s.d. (n = 3).

117
Micromachines 2018, 9, 314

Figure 4. Relative errors of the 3D CC-based viscosity measurement results in Figure 3b as a function of
V 1 and the absolute viscosities measured using the cone-plate viscometer. Optimal operation conditions
for accurate viscosity measurement can be determined from the color map for further experiments.

3.3. Analysis of a Non-Newtonian Fluid versus Shear Rate


We next tested the capability of the 3D-CC platform to analyze a non-Newtonian fluid, xanthan
gum, at different shear-rate conditions. The 3D-CC for analysis of a non-Newtonian fluid was fabricated
using Tygon® tubing pieces (inner diameter: 0.508 mm) in different lengths for the generation
of different shear-rate conditions (Figure 5a). To generate a range of shear rates (150 to 900 s−1 ),
the viscosities of a 0.1 wt % xanthan gum solution were first measured at γ = 178, 353, 653, and 930 s−1
using a conventional microfluidic comparator (Figure S1); where γ is the wall shear rate. With the
measured viscosities, we numerically calculated ΔP per unit capillary length (1 cm) required for
the operation of the 3D-CC (Figure 6a). The capillary lengths of the 3D-CC were then determined
using Equation (1) at ΔP = 2.8 kPa and r = 0.254 mm, which were 8.4, 10.4, 14.6, and 20.6 cm for
γ = 930, 653, 353, and 178 s−1 , respectively (Figure 6b). For convenience of fabrication, L was set to
8.5, 10.9, 15.5, and 20.0 cm, and rfl of the 3D-CC was set to 1.59 mm. The dimensional conditions
satisfy the design criteria described above, while the resistance ratio between the capillary and fluidic
chamber was greater than 4000. Depressing the plunger of the smart pipette, set at V 1 = 35 mL,
simultaneously generated four-different shear-rate conditions according to capillary length (Figure 5b),
which corresponded to 864, 541, 257, and 159 s−1 for L = 8.5, 10.9, 15.5, and 20.0 cm, respectively.
For all conditions, ns at Δt = 15 s was greater than 9, satisfying the design criteria described above.
As shown in Figure 5c, the viscosity results measured using the 3D-CC were closely matched with those
obtained using the microfluidic comparator, demonstrating the effectiveness of the 3D-CC platform
for simultaneously testing multiple shear-rate conditions. Compared with current state-of-the-art
viscometers [13–22], the proposed 3D-CC platform allows rapid, simple, and intuitive operation
without bulky, complicated, high-precision equipment and additional calibration. Thus, non-experts
can easily carry out the necessary procedures in a similar manner to a conventional micropipette.
In addition, the scalability of the 3D-CC enables further enhancement in measurement throughput
by simply adding more channels. Although xanthan gum, as a model system of a non-Newtonian
fluid, was tested for proof-of-principle demonstration, the 3D-CC platform can be widely applicable
for quality-control testing of liquid products and for clinical analysis of blood viscosity as a potential
hemodynamic biomarker.

118
Micromachines 2018, 9, 314

Figure 5. 3D-CC for analysis of a non-Newtonian fluid under multiple shear-rate conditions. (a) Optical
image of the fabricated 3D-CC having four-different fluidic channels in length. The lengths were 8.5,
10.9, 15.5, and 20.0 cm (from top to bottom). The channels of the 3D-CC are filled with red ink for
visualization; (b) a xanthan gum solution, which served as a non-Newtonian fluid, was analyzed
using the 3D-CC at different shear-rate conditions of 864, 541, 257, and 159 s−1 (from top to bottom);
(c) analysis results for the xanthan gum solution using the 3D-CC and microfluidic viscometer. Error
bars: s.d. (n = 3).

119
Micromachines 2018, 9, 314

Figure 6. Computational fluid dynamics simulation for determining the capillary lengths of the 3D-CC
for analysis of the xanthan gum solution under multiple shear-rate conditions. (a) Simulated pressure
profiles along the capillaries (0.508 mm in inner diameter) at different μ and γ to calculate the pressure
drop per unit length at each condition. The viscosities were obtained using the microfluidic comparator
and varied according to the corresponding γ; (b) the different capillary lengths were determined
from the relationship between ΔP and L, the Hagen-Poiseuille law, at the different μ and γ conditions.
The dotted lines denote the relationships between ΔP and L for μ = 4.5, 5.2, 6.8, and 9.5 cP from left to
right. At ΔP = 2.8 kPa, the capillary lengths were, respectively, determined as 8.4, 10.4, 14.6, and 20.6 cm
that can, subsequently, generate the corresponding γ conditions for the 3D-CC.

4. Conclusions
We present a new 3D-CC platform for equipment- and calibration-free analysis of Newtonian and
non-Newtonian fluids. The viscometer platform allows hand-powered generation of pressure-driven
flows and visual (naked-eye) determination of flow rates in parallel capillary networks.
We demonstrated multiplexed viscosity measurement of Newtonian fluids of different viscosities
and viscosity measurement of a non-Newtonian fluid at various shear-rate conditions. Given these
novel features and the importance of viscosity measurement as a quality control means of liquid
products and a diagnostic tool for evaluating hemorheological disorders, we believe that the proposed
platform represents a promising approach for viscosity measurement in various industrial and
clinical applications.

Supplementary Materials: The following are available online at http://www.mdpi.com/2072-666X/9/7/314/s1,


Figure S1: Schematic showing a microfluidic viscometer to measure a test fluid of unknown viscosity.
Author Contributions: S.C. conceptualized and directed the research project. S.C. and S.O. prepared the
manuscript. S.O. performed the experiments and data analysis with S.C. All authors discussed the results
and commented on the manuscript.
Funding: This research was supported by a grant from the Pioneer Research Center Program through the
National Research Foundation (NRF) of Korea funded by the Ministry of Science, ICT & Future Planning (MSIP)
(2013M3C1A3064777), a NRF grant funded by the Korea government (MSIP) (2015R1C1A1A01053990), and a NRF
grant funded by the Korea government (MSIP) (2016R1A5A1010148).

120
Micromachines 2018, 9, 314

Conflicts of Interest: The authors declare no conflict of interest.

References
1. Fügel, R.; Carle, R.; Schieber, A. Quality and authenticity control of fruit purées, fruit preparations and
jams—A review. Trends Food Sci. Technol. 2005, 16, 433–441. [CrossRef]
2. Hoekman, S.K.; Broch, A.; Robbins, C.; Ceniceros, E.; Natarajan, M. Review of biodiesel composition,
properties, and specifications. Renew. Sustain. Energy Rev. 2012, 16, 143–169. [CrossRef]
3. Lebedeva, N.; Malkova, E.; Vyugin, A.; Koifman, O.; Gubarev, Y. Spectral and hydrodynamic studies of
complex formation of tetraalkoxy substituted zinc(II)phthalocyanines with defatted and nondefatted bovine
serum albumin. Biochip J. 2015, 10, 1–8. [CrossRef]
4. Jimtaisong, A.; Saewan, N. Utilization of carboxymethyl chitosan in cosmetics. Int. J. Cosmet. Sci. 2014, 36,
12–21. [CrossRef] [PubMed]
5. Tao, W.; Ma, Y.; Chen, Y.; Li, L.; Wang, M. The influence of adhesive viscosity and elastic modulus on laser
spot weld bonding process. Int. J. Adhes. Adhes. 2014, 51, 111–116. [CrossRef]
6. Chiarello, E.; Derzsi, L.; Pierno, M.; Mistura, G.; Piccin, E. Generation of Oil Droplets in a Non-Newtonian
Liquid Using a Microfluidic T-Junction. Micromachines 2015, 6, 1825–1835. [CrossRef]
7. Sklodowska, K.; Debski, P.R.; Michalski, J.A.; Korczyk, P.M.; Dolata, M.; Zajac, M.; Jakiela, S. Simultaneous
Measurement of Viscosity and Optical Density of Bacterial Growth and Death in a Microdroplet.
Micromachines 2018, 9, 251. [CrossRef]
8. Smith, M.M.; Chen, P.C.Y.; Li, C.-S.; Ramanujam, S.; Cheung, A.T.W. Whole blood viscosity and microvascular
abnormalities in Alzheimer’s Disease. Clin. Hemorheol. Microcirc. 2009, 41, 229–239. [CrossRef] [PubMed]
9. Gertz, M.A.; Kyle, R.A. Hyperviscosity syndrome. J. Intensive Care Med. 1995, 10, 128–141. [CrossRef]
[PubMed]
10. McKennell, R. Cone-plate viscometer. Anal. Chem. 1956, 28, 1710–1714. [CrossRef]
11. Cooke, B.M.; Stuart, J. Automated measurement of plasma viscosity by capillary viscometer. J. Clin. Pathol.
1988, 41, 1213–1216. [CrossRef] [PubMed]
12. Gupta, S.; Wang, W.S.; Vanapalli, S.A. Microfluidic viscometers for shear rheology of complex fluids and
biofluids. Biomicrofluidics 2016, 10, 043402. [CrossRef] [PubMed]
13. Srivastava, N.; Davenport, R.D.; Burns, M.A. Nanoliter viscometer for analyzing blood plasma and other
liquid samples. Anal. Chem. 2005, 77, 383–392. [CrossRef] [PubMed]
14. Srivastava, N.; Burns, M.A. Analysis of non-Newtonian liquids using a microfluidic capillary viscometer.
Anal. Chem. 2006, 78, 1690–1696. [CrossRef] [PubMed]
15. Kim, W.-J.; Kim, S.; Huh, C.; Kim, B.K.; Kim, Y.J. A novel hand-held viscometer applicable for point-of-care.
Sens. Actuators B 2016, 234, 239–246. [CrossRef]
16. Liu, M.; Xie, S.; Ge, J.; Xu, Z.; Wu, Z.; Ru, C.; Luo, J.; Sun, Y. Microfluidic Assessment of Frying Oil
Degradation. Sci. Rep. 2016, 6, 27970. [CrossRef] [PubMed]
17. Li, Y.; Ward, K.R.; Burns, M.A. Viscosity Measurements Using Microfluidic Droplet Length. Anal. Chem.
2017, 89, 3996–4006. [CrossRef] [PubMed]
18. Kang, Y.J.; Yang, S. Integrated microfluidic viscometer equipped with fluid temperature controller for
measurement of viscosity in complex fluids. Microfluid. Nanofluid. 2013, 14, 657–668. [CrossRef]
19. Kang, Y.J.; Ryu, J.; Lee, S.-J. Label-free viscosity measurement of complex fluids using reversal flow switching
manipulation in a microfluidic channel. Biomicrofluidics 2013, 7, 44106. [CrossRef] [PubMed]
20. Choi, S.; Park, J.K. Microfluidic rheometer for characterization of protein unfolding and aggregation in
microflows. Small 2010, 6, 1306–1310. [CrossRef] [PubMed]
21. Tassieri, M.; Del Giudice, F.; Robertson, E.J.; Jain, N.; Fries, B.; Wilson, R.; Glidle, A.; Greco, F.; Netti, P.A.;
Maffettone, P.L.; et al. Microrheology with optical tweezers: Measuring the relative viscosity of solutions ‘at
a glance’. Sci. Rep. 2015, 5, 8831. [CrossRef] [PubMed]
22. Oh, S.; Kim, B.; Lee, J.K.; Choi, S. 3D-printed capillary circuits for rapid, low-cost, portable analysis of blood
viscosity. Sens. Actuators B 2018, 259, 106–113. [CrossRef]
23. Oh, S.; Kim, B.; Choi, S. A 3D-Printed Multichannel Viscometer for High-Throughput Analysis of Frying Oil
Quality. Sensors 2018, 18, 1625. [CrossRef] [PubMed]

121
Micromachines 2018, 9, 314

24. Mao, M.; He, J.; Li, X.; Zhang, B.; Lei, Q.; Liu, Y.; Li, D. The Emerging Frontiers and Applications of
High-Resolution 3D Printing. Micromachines 2017, 8, 113. [CrossRef]
25. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
26. Kim, B.; Choi, S. Smart Pipette and Microfluidic Pipette Tip for Blood Plasma Separation. Small 2016, 12,
190–197. [CrossRef] [PubMed]
27. Kim, B.; Hahn, Y.K.; You, D.; Oh, S.; Choi, S. A smart multi-pipette for hand-held operation of microfluidic
devices. Analyst 2016, 141, 5753–5758. [CrossRef] [PubMed]
28. Kim, B.; Oh, S.; You, D.; Choi, S. Microfluidic Pipette Tip for High-Purity and High-Throughput Blood
Plasma Separation from Whole Blood. Anal. Chem. 2017, 89, 1439–1444. [CrossRef] [PubMed]
29. You, D.; Oh, S.; Kim, B.; Hahn, Y.K.; Choi, S. Rapid preparation and single-cell analysis of concentrated blood
smears using a high-throughput blood cell separator and a microfabricated grid film. J. Chromatogr. A 2017,
1507, 141–148. [CrossRef] [PubMed]
30. Truskey, G.A.; Yuan, F.; Katz, D.F. Transport Phenomena in Biological Systems, 1st ed.; Pearson Education:
Upper Saddle River, NJ, USA, 2004.

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

122
micromachines

Article
3D Printed Microfluidic Features Using Dose Control
in X, Y, and Z Dimensions
Michael J. Beauchamp 1 , Hua Gong 2 , Adam T. Woolley 1, * and Gregory P. Nordin 2, *
1 Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602, USA;
[email protected]
2 Department of Electrical and Computer Engineering, Brigham Young University, Provo, UT 84602, USA;
[email protected]
* Correspondence: [email protected] (A.T.W.); [email protected] (G.P.N.); Tel.: +1-801-422-1701 (A.T.W.);
+1-801-422-1863 (G.P.N.)

Received: 6 June 2018; Accepted: 26 June 2018; Published: 28 June 2018

Abstract: Interest has grown in recent years to leverage the possibilities offered by three-dimensional
(3D) printing, such as rapid iterative changes; the ability to more fully use 3D device volume; and
ease of fabrication, especially as it relates to the creation of complex microfluidic devices. A major
shortcoming of most commercially available 3D printers is that their resolution is not sufficient to
produce features that are truly microfluidic (<100 × 100 μm2 ). Here, we test a custom 3D printer for
making ~30 μm scale positive and negative surface features, as well as positive and negative features
within internal voids (i.e., microfluidic channels). We found that optical dosage control is essential
for creating the smallest microfluidic features (~30 μm wide for ridges, ~20 μm wide for trenches),
and that this resolution was achieved for a number of different exposure approaches. Additionally,
we printed various microfluidic particle traps, showed capture of 25 μm diameter polymer beads,
and iteratively improved the trap design. The rapid feedback allowed by 3D printing, as well as the
ability to carefully control optical exposure conditions, should lead to new innovations in the types
and sizes of devices that can be created for microfluidics.

Keywords: 3D printing; microfluidics; particle traps; stereolithography

1. Introduction
3D printing is a valuable technique for custom and rapid design change and optimization
in fabrication of millifluidic devices [1]. Miniature device applications stand to benefit from the
advantages offered from 3D printing, such as the ability to create and test devices with rapid feedback,
allowing changes to be quickly tested. Device optimization based on empirical results could save time
and money compared to traditional device fabrication techniques that involve conventional machining
or micromachining.
A number of groups have recently sought to use 3D printing to produce fluidic devices for various
applications. Devices for nitrite [2] or anemia [3] detection, measuring endocrine secretion [4], sorting
bacteria [5], and cell culture [6,7], have all been shown to name a few. Although these are promising
assays, a key issue from these works is the size of printed features. Most commercially available printers
and resins are only able to achieve feature sizes down to 250 μm, with typical features around 500 μm,
which are not suitable for many microfluidics applications. Additionally, these commercial printers lack
flexibility in terms of resin development, individual layer custom exposure time control, or multiple
exposures per layer. For 3D printing of fluidic devices with low surface roughness, stereolithography
(SLA) printers are the best suited [8]. The material left in the channels after printing is a liquid and thus
is much easier to clear than solid sacrificial materials formed with either polyjet or fused deposition
modeling printers [9–11]. Reviews of 3D printing over the past several years have offered helpful

Micromachines 2018, 9, 326; doi:10.3390/mi9070326 123 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 326

insights regarding types of printers and their applications. Many different outlooks are given for future
directions in 3D printing of fluidic devices, such as resin improvements, material removal techniques,
throughput, and printer resolution [1,12–16]. Several groups have undertaken work to investigate
and compare the resolution of various 3D printers in an effort to make fluidic devices [8,11,17–19];
however, much of this work is still well above 100 μm needed for most microfluidic applications.
Our group has developed an SLA 3D printer, as well as a custom resin formulated specifically
for creating truly microfluidic structures with this printer [20], and we have made small (18 × 20 μm)
microfluidic channels [21], as well as fluid control systems involving pumps and valves [22]. To make
the smallest channels, an edge compensation technique was employed which overexposed the pixels
at the channel edge to make it narrower [21]. However, we have not yet examined how this edge
compensation approach affects features in the channels.
In this work, we investigate precise control over printing exposure areas and dosage conditions
to create microscale substructures within microfluidic features. First, we look at positive and negative
features on the exterior of prints to see what size features can be printed with various exposure
times and with exposure edge compensation. Next, we evaluate positive and negative features in
interior void areas to see the impact of exposure times and edge compensation. Finally, we create
microfluidic particle traps to demonstrate how the ability to control specific dosing parameters allows
improved function.

2. Materials and Methods

2.1. Material Sources


Acetone, 2-propanol (IPA), and 25 μm polystyrene microspheres were purchased from
Thermo-Fisher Scientific (Salt Lake City, UT, USA). Triethoxysilyl propylmethacrylate, hydroxypropyl
cellulose (HPC) and polyethylene glycol diacrylate (PEGDA, 258 Da MW) were purchased from
Sigma-Aldrich (Milwaukee, WI, USA). Toluene and glass microscope slides (3” × 1” × 1.2 mm) were
purchased from Avantor (Center Valley, PA, USA). 2-Nitrodiphenylsulfide (NPS) was purchased from
TCI America (Portland, OR, USA). Phenylbis (2,4,6-trimethylbenzoyl)phosphine oxide (Irgacure 819)
was provided by BASF (Midland, MI, USA). All chemicals were used as received.

2.2. Glass Slide Preparation


Glass microscope slides were scored on one side using a laser cutter (Universal Laser Systems,
Scottsdale, AZ, USA). The settings for cutting were 50% power, 10% speed, and 165 points per inch.
The glass slides were then broken along the scored mark, washed with acetone and IPA, and dried with
air. A fresh preparation of 10% triethoxysilyl propylmethacrylate in toluene was made. Glass slides
were submerged in this silane solution in a shallow covered dish for a minimum of two hours, after
which they were rinsed with IPA and dried with air. For longer term storage, slides were kept in a
container under toluene.

2.3. Resin Preparation


The resin was prepared by mixing 2% NPS with 1% Irgacure 819 in 97% PEGDA. The resin
was sonicated until all solid components dissolved and was stored in an amber bottle wrapped in
aluminum foil to protect it from light. Details regarding resin formulation can be found in reference [21]
for the choice of photoinitiator and absorber matched to the LED of the printer.

2.4. Device Designs


Designs for 3D printed parts were made using open source OpenSCAD software (openscad.org).
Schematics of the resolution prints can be seen in Figure 1. For the exterior ridges (Figure 1a) and
trenches (Figure 1b), the features are 100 μm tall or deep, and the widths are from 1 to 10 pixels (7.6 to
76 μm), with a spacing between individual ridges or trenches of 100 pixels.

124
Micromachines 2018, 9, 326

For the interior resolution features (Figure 1c), the height of the feature area is 100 μm. The internal
ridges are all 5 pixels wide, 250 pixels long, and have heights from 1 to 10 layers (10 to 100 μm). For the
trench sections, the trenches are all 100 μm deep and vary in width from 1 to 10 pixels. The pillars are
designed with diameters ranging from 1 to 10 pixels, and all of the pillars in a given row are identical.
In between each internal feature (or set of features with the pillars) is a support beam to help hold
up the microchannel ceiling. These ceiling supports are all 5 pixels wide and go from the floor of the
feature areas to the ceiling.
The trapping devices consist of 6 straight channels 30 pixels wide and 8 layers tall with fluidic
reservoirs at both ends (Figure 1d). The traps consist of two L-shaped pieces facing each other that
are 8 pixels long, 4 pixels wide, and spaced 2 pixels apart (Figure 1e). The traps are spaced 20 pixels
apart down the length of the channel. Each print contains 6 different channels for testing a variety of
trap layouts. Three different configurations of the traps were tested, one with traps only down the
center of the channel, one with traps staggered along the edges, and one with traps staggered in the
middle of the channel and along the sides (see Figure 1d, inserts).

1 mm 1 mm
(a) (b)

1 mm

(c)

Figure 1. Cont.

125
Micromachines 2018, 9, 326

1 mm
(d) 10 ʅm
(e)

Figure 1. OpenSCAD designs of prints for exterior and interior resolution features. (a) Ridge device.
The ridges are shown in red and there is a support box around the ridges. The ridges are 100 μm
tall and have widths of 1–10 pixels (7.6–76 μm) from left to right. The cutout shows a zoom view;
(b) Trench device with the trenches shown in orange. The trenches are 100 μm deep and have widths
of 1–10 pixels (7.6–76 μm) from left to right. The cutout shows a zoom view; (c) Interior features device.
The top layers of the device have been removed in the schematic to show the features. From left
to right the regions are ridges, trenches with exposure compensation, pillars, and trenches without
exposure compensation. Each set of features has a series of ceiling support ridges running the length of
the feature area. Below each feature void area is a zoom view; (d) Bead trap device design showing
6 channels and traps within channels. Inserts show a zoom view of the three different trap layouts;
(e) Schematic of bead trap. The large gap is designed to allow the beads to enter and the smaller gap
allows fluid to pass through the trap.

2.5. 3D Printing Parameters


The 3D printer used for this work is the same as described in reference [21]. This printer operates
with a nominally 385 nm light source and 7.6 μm pixel size in the image plane. The build layer
height for all prints was 10 μm, the image plane irradiance was 21.2 mW·cm−2 , and the exposure
time was chosen to be either 500, 750, 1000, or 1500 ms to ensure thorough attachment of the print
to the glass slide the first four layers were overexposed for 20, 10, 5, and 1 s, respectively. For prints
in which the normal layer exposure time exceeded 1 s, only the first three layers were exposed in
this manner. After printing, the remaining liquid resin in the print was flushed out three times with
IPA using vacuum. Finally, the device was cured under an 11 mW 430 nm LED (ThorLabs, Newton,
NJ, USA) for 10 min before use. This LED allows the photoinitiator to further cure the print at a
wavelength at which the UV absorber (NPS) does not absorb the light.

2.6. Edge Compensation Technique


An edge compensation technique similar to the one in reference [21] was used where indicated
for both interior and exterior trenches (negative features). This technique exposes the two pixels
forming the edge of the trench for double the normal exposure time. The purpose of this technique is
to cause a wider trench design to be narrower when printed. For example, a 3D printed trench that
is designed to be 4 pixels wide without compensation has the same width as a 6 pixel wide design
formed with compensation.

2.7. Measurement of Print Featuures


Exterior feature heights, depths, and widths were measured using a Zeta 20 optical profilometer
(Zeta Instruments, San Jose, CA, USA). The width was measured as the full width at half height
or depth. SEM imaging was done using an ESEM XL30 (FEI, ThermoFisher Scientific, Waltham,
MA, USA). Samples were prepared by cutting them open with a razor blade and sputtering with 80:20

126
Micromachines 2018, 9, 326

Au:Pd to allow the side profile to be observed. Images were processed using ImageJ (NIH) to measure
the widths and heights of interior pillars, ridges, and trenches.
For trapping experiments, imaging was done using a Zeiss AXIO Observer A1 inverted
microscope (Thornwood, NY, USA) using a 10× objective connected to a Photometrics coolSNAP HQ2
CCD camera (Tucson, AZ, USA). The exposure time for the CCD was 10 ms. The images were recorded
and processed using ImageJ. Measurement of print features was performed three times (n = 3), and the
standard deviation is given for each measurement.
For our printer and this resin, surface roughness has previously been characterized using optical
profilometry with prints at various exposure times [22]. For all exposure times tested (600–1200 ms),
the RMS surface roughness was less than 100 nm, typically 55–60 ± 15 nm. While some surfaces may
appear to show pixelation (Figure 4 and Supplementary Materials) as they did in this previous work,
it is expected that the surface roughness should still be the same.

2.8. Trapping Opperation


The bead solution for trapping was made by suspending the beads in deionized water at a
concentration of 1 mg/mL with 0.5% HPC to prevent aggregation. 1.5 μL of bead solution was
pipetted into the left reservoir as oriented in Figure 1d and drawn through the channel with vacuum
over ~7 s, which resulted in a flow rate of 13 μL/min. This was repeated three times so a total of 4.5 μL
of bead solution was pulled through the channel, after which CCD images were taken.

3. Results and Discussion

3.1. Exterior Features

3.1.1. Ridges
Initial testing focused on the exterior resolution features of our 3D printer by testing a set of ridges
and trenches on the surface of prints. The purpose of these features is to evaluate how positive features
turn out on the surface of print. For the surface ridges, the design shown in Figure 1a was created;
the design was printed three times with exposure times of 500, 1000, or 1500 ms for each build layer.
We found that the ends of the ridges became warped when they were not anchored, so a support box
was placed around the ridges. A photograph though the microscope can be seen in Figure 2a, showing
example ridges that are 3 and 4 pixels wide for 1500 ms exposure. The complete set of images can
be found in the Supplementary Materials (Figures S1–S3). The heights and widths of these features
were then measured with an optical profilometer. Figure 3a shows the measured ridge width plotted
against the designed width for ridges that reached >90% of the full height. This shows that increasing
light dosage from 500 ms (blue line in Figure 3a) to 1500 ms (red line in Figure 3a) allows smaller
ridges to successfully reach full height and be closer to their designed width. Additionally, a ridge
that is designed to a certain width will print smaller than expected if the exposure time is insufficient.
The minimum width ridge that could be successfully printed was 30 ± 1 μm, which was with an
exposure time of 1500 ms. These positive features benefit from increased light exposure, indicating the
need to be able to give sufficient exposure to positive features.

127
Micromachines 2018, 9, 326

(a) (b)

(c) (d)

(e)

Figure 2. Images of 3D printed features. (a) Top view photograph of 1500 ms exposure ridges designed
3 and 4 pixels (23 and 30 μm) wide. The ridges measured 25 ± 1 and 29 ± 1 μm; (b) Top view
photograph of a 500 ms exposure (without compensation) trench designed 4 pixels (30 μm) wide,
which measures 21 ± 0.5 μm; (c) SEM images of 1000 ms exposure interior ridges designed 5 and 6
layers tall. The ridges measured 46 ± 1 and 55 ± 1 μm tall, respectively; a support pillar is in the
middle of the image; (d) SEM image of interior trenches at 1000 ms exposure without compensation
designed 5 and 6 pixels (38 and 46 μm) wide, which measured 22 ± 0.7 and 34 ± 2 μm wide; (e) SEM
image of interior pillar structures at 1500 ms exposure designed to be 5–7 pixels (38–53 μm) in diameter.

128
Micromachines 2018, 9, 326

(a) (b)

(c) (d)

(e)
Figure 3. Designed feature width versus measured width for different exposure conditions.
Only features that reached >90 μm in height (ridges) or depth (trenches) were included. For the
pillars, only those that were attached floor to ceiling were included. Standard deviations are indicated
for each included point (n = 3). (a) Exterior ridges; (b) Exterior trenches; (c) Interior ridges; (d) Interior
trenches; (e) Interior pillars.

3.1.2. Trenches
For the exterior negative features, we created the design shown in Figure 1b. This design was
printed with and without the exposure compensation pattern at 500, 1000, and 1500 ms for a total

129
Micromachines 2018, 9, 326

of six prints. An example microscope image showing a trench 4 pixels wide with 500 ms exposure
can be seen in Figure 2b with the full data in Figures S4–S9. The heights and depths of these trenches
were measured with optical profilometry. As seen in Figure 3b, measured width was plotted against
designed width; only the features that achieved >90% of the designed feature depth were included.
The first observation is that the compensation pattern caused the trenches to turn out narrower than
the uncompensated devices due to the additional exposure at the trench edge. The second effect that
can be seen is that increasing the layer exposure time for the uncompensated case results in narrower
trenches, as expected. Finally we note that, to achieve a minimum trench width at full depth, there
are three different possibilities: 500 ms exposure without compensation, 1000 ms exposure without
compensation, or 1000 ms exposure with compensation. All three of these approaches produced a
trench 100 μm deep and about 20 ± 0.5 μm wide; however, the designed widths were all different (4,
5, and 6 pixels, respectively). These results show that having precise control over both exposure and
printing parameters allows for careful control of final feature sizes for exterior trenches.

3.2. Interior Features


For interior feature resolution, we undertook a similar study of positive and negative features
in a confined space according to our design in Figure 1c. When prototyping this design, we found
that a large void space without a support for the ceiling resulted in irregular top layers and erratic
feature measurements. Thus, an alternating pattern of feature and ceiling support pieces exists in
each of the interior feature areas. Each print contains two sets of trenches, either with or without
exposure compensation, such that both could be tested in a single print. Additionally, Figure 2c–e
shows characteristic SLA printing artifacts including uneven sides showing where each layer of the
print sits on the next one, as well as a somewhat trapezoidal shape for the interior ridges and ceiling
support pieces. Smaller layer thicknesses (finer z resolution) could help mitigate the layering, while
the trapezoidal shape may be a result of material shrinkage.

3.2.1. Ridges
We again used ridges as positive features to determine the types of structures that could be
placed in an interior void in a 3D printed part. Five pixels width was chosen, because it formed
reliably for surface ridges. An example SEM image of two ridges at 1000 ms exposure is shown in
Figure 2c; the interior ridge 5 layers tall is shown on the left, with the ceiling support in the middle,
and the ridge 6 layers tall is on the right. For interior ridges, we measured the gap between the
top of the ridge and the ceiling of the void area, which gave information about interior z resolution.
Gap distance (excluding any ridges that attached to the ceiling) is plotted for these interior ridges
as shown in Figure 3c. The 500 ms exposure time resulted in a void region that was taller than the
designed 100 μm, due to insufficient adhesion between layers, as can be observed in the Supplementary
Materials (Figure S10). The ceiling support pieces appear to have broken off, resulting in voids taller
than the designed size. For 1000 and 1500 ms, the void height is smaller than designed, likely due
to exposure of the top layer of the chamber polymerizing significantly more than to 10 μm of resin,
thereby making the first ceiling layer substantially thicker than designed, resulting in reduced overall
chamber height and hence reduced gap size (Figures S11–S12). This is consistent with our previous
work, in which we analyzed the layer exposure profile as a function of z [20]. The height of the void
area was about 70–75 μm instead of 100 μm, and thus any ridges designed to be >7 layers tall were
attached to the ceiling. For the ridges that were not attached, however, there was a linear relationship
between the designed and measured gap distance. From this data, gaps between the feature and ceiling
area as small as 7 ± 0.7 μm can be produced with either 1000 or 1500 ms exposures. As long as the
print receives sufficient light exposure (>500 ms for this formulation), the gap height between features
and ridges is independent of the exposure time for 1000 and 1500 ms exposures, as seen in Figure 3c.

130
Micromachines 2018, 9, 326

3.2.2. Trenches
For the interior trenches, a similar approach to the exterior trenches was used. The widths of
printed trenches were measured with SEM imaging, and an example image is shown in Figure 2d for
1000 ms exposure (without compensation) of trenches that were designed to be 5 and 6 pixels (38 and
46 μm) wide. In this image the trench 6 pixels wide is on the left, and the trench 5 pixels wide is on the
right, with the ceiling support pillar in the middle. The full set of interior trench images can been found
in the Supplementary Materials Figures S13–S18. The measured width was compared to the designed
width in Figure 3d, including only those trenches that reached >90% of full depth. The 500 ms trenches
(both with and without compensation) turn out wider than the 1500 ms trenches, indicating that lower
exposure times work better for forming wider trenches. Similar to the effect observed with the exterior
trenches, the use of a compensation pattern leads to trenches smaller than they would have otherwise
printed, as the compensated trenches are all narrower than the uncompensated ones. Similar to the
exterior trenches, the smallest trenches that successfully formed were about 20 μm wide, though they
were printed with different exposure times: 5 pixels wide for 1000 ms with compensation (21 ± 0.8 μm),
6 pixels wide for 1500 ms without compensation (21 ± 0.7 μm), and 7 pixels wide for 1500 ms with
compensation (18 ± 0.7 μm). This again demonstrates the concept that there are several different ways
to obtain a minimum feature size if the right exposure conditions are determined, especially when
there is full control over the exposure properties.

3.2.3. Pillars
A final type of resolution feature we investigated was cylindrical pillars in the interior of a
void area. SEM images were taken of the pillars, and an example can be seen in Figure 2e showing
1500 ms exposure pillars that are 5–7 pixels wide (38–53 μm), with more data in Figures S19–S21 of
the Supplementary Materials. Figure 3e shows a plot comparing the designed pillar diameter and the
measured diameter, including only those pillars which were fully formed. From this graph, it can be
seen that the pillars all printed narrower than their designed width and followed the trend that longer
exposure times led to wider pillars. The smallest pillars that were successfully printed were about
14 ± 1 μm in diameter, printed with 1000 ms exposure for a 5 pixel designed width. The dependency
of pillar diameter on light exposure is another example of how control over dosing parameters is
essential to achieve desired feature dimensions during SLA 3D printing.

3.2.4. Trapping Devices


To demonstrate the utility of tight control of both positive and negative interior features we
created trapping devices to catch particles as they flowed through a channel, as a first step toward
trapping of cells. The beads selected were 25 μm in diameter, approximately the same size as the
smallest trench that was successfully printed. Because our 3D printing designs can be easily edited to
optimize configurations and print parameters, we attempted a number of different trap placements
(see Figure 1d inserts) to determine the best trapping efficiency. Figure 4 shows images of channels
after trapping experiments were carried out. We found that traps exclusively in the center of the
channel (Figure 4a) did not trap as efficiently as traps along the sides (Figure 4b), which in turn were
not as efficient as traps that alternated between the channel sides and center (Figure 4c). This was
largely due to the flow of the beads around (instead of through) the traps. Additionally, we found that
traps that were 3 layers tall did not trap as efficiently as traps that were the full height of the channel;
when the traps are shorter many beads simply pass over the traps.
Finally, it is critical to have traps that have the correct dimensions. The degree of trap openness
could be controlled through the exposure time used for the print. If the exposure time was too short
(<600 ms), the traps would be partially formed, and the beads would pass through the trap without
getting caught. Conversely, if the exposure time was too high (>1000 ms), the traps would end up
overexposed, and there would be no flow through the traps, which would result in no beads being

131
Micromachines 2018, 9, 326

trapped and, often, small bubbles that stuck instead. The exposure time of ~750 ms was nearly ideal
for forming traps that worked well for beads. Figure 4 shows this effect, with underexposed in (d),
optimal exposure in (e), and overexposed in (f).

(a) (b) (c)

(d) (e) (f)

Figure 4. CCD images showing the effect of trap placement and different exposure times on trap shape.
(a) Channel with traps exclusively in the center; (b) Channel with traps staggered along the sides;
(c) Channel with traps staggered along the sides and in the middle of the channel; (d) Prints exposed
500 ms showing partially formed traps with no bead capture; (e) Prints exposed for 750 ms with beads
trapped well; (f) Prints exposed at 1000 ms showing overexposed traps. Bubbles are stuck at the front
and back of the traps hindering bead capture.

4. Conclusions
In this work, we have characterized the 3D printing of sub-100 μm external and internal positive
and negative resolution features. We have shown the importance of controlling light dosage, as well as
the benefits of multiple different exposure patterns within one layer of a print. Finally, we created a
particle trapping device and leveraged the rapid iterative design capabilities of 3D printing to improve
trap placement and efficiency.
These developments demonstrate the need for careful control of dosing parameters in making
complex 3D printed microfluidic devices. More customization of printer control, resin development,
and higher resolution projectors should lead to smaller, more intricate 3D printed microfluidic systems.
Improved microfluidics of this type could provide even smaller traps, potentially allowing their use in
cell capture or isolation experiments.

Supplementary Materials: The following are available online at http://www.mdpi.com/2072-666X/9/7/326/s1:


Figure S1: exterior features, ridges, 500 ms exposure; Figure S2: exterior features, ridges, 1000 ms exposure;
Figure S3: exterior features, ridges, 1500 ms exposure; Figure S4: exterior features, trenches with edge
compensation, 500 ms; Figure S5: exterior features, trenches with edge compensation, 1000 ms; Figure S6:
exterior features, trenches with edge compensation, 1500 ms; Figure S7: exterior features, trenches without edge
compensation, 500 ms; Figure S8: exterior features, trenches without edge compensation, 1000 ms; Figure S9:
exterior features, trenches without edge compensation, 1500 ms; Figure S10: interior features, ridges, 500 ms;
Figure S11: interior features, ridges, 1000 ms; Figure S12: interior features, ridges, 1500 ms; Figure S13: interior
features, trenches with edge compensation, 500 ms; Figure S14: interior features, trenches with edge compensation,
1000 ms; Figure S15: interior features, trenches with edge compensation, 1500 ms; Figure S16: interior features,
trenches without edge compensation, 500 ms; Figure S17: interior features, trenches without edge compensation,

132
Micromachines 2018, 9, 326

1000 ms; Figure S18: interior features, trenches without edge compensation, 1500 ms; Figure S19: interior features,
pillars, 500 ms; Figure S20: interior features, pillars, 1000 ms; Figure S21: interior features, pillars, 1500 ms.
Author Contributions: Conceptualization: A.T.W., G.P.N. and M.J.B.; methodology: A.T.W., G.P.N., H.G. and
M.J.B.; software: H.G.; validation: A.T.W. and M.J.B.; formal analysis: A.T.W. and M.J.B.; investigation: M.J.B.;
data curation: M.J.B.; writing—original draft preparation: M.J.B.; writing—review & editing: A.T.W., G.P.N. and
M.J.B.; visualization: M.J.B.; supervision: A.T.W. and G.P.N.; funding acquisition: A.T.W. and G.P.N.
Funding: This research was funded by The United States National Institutes of Health grant numbers R01EB006124
and R15GM123405-01A1.
Conflicts of Interest: The authors declare no conflict of interest. The founding sponsors had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the
decision to publish the results.

References
1. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-printed microfluidics. Angew. Chem. Int. Ed. 2016, 55,
3862–3881. [CrossRef] [PubMed]
2. Shallan, A.I.; Smejkal, P.; Corban, M.; Guijt, R.M.; Breadmore, M.C. Cost effective 3D printing of visible
transparent microchips within minutes. Anal. Chem. 2014, 86, 3124–3130. [CrossRef] [PubMed]
3. Plevniak, K.; Campbell, M.; Myers, T.; Hodges, A.; He, M. 3D Printed Auto-Mixing chip enables rapid
smartphone analysis of anemia. Biomicrofluidics 2016, 10, 054113. [CrossRef] [PubMed]
4. Brooks, J.C.; Fort, K.I.; Holder, D.H.; Holtan, M.D.; Easley, C.J. Macro to micro interfacing to microfluidic
channels using 3d printed templates: Application to time resolved secretion sampling of endocrine tissue.
Analyst 2016, 141, 5714–5721. [CrossRef] [PubMed]
5. Lee, W.; Kwon, D.; Choi, W.; Jung, G.Y.; Au, A.K.; Folch, A.; Jeon, S. 3D-printed microfluidic device for the
detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.
Sci. Rep. 2015, 5, 7717. [CrossRef] [PubMed]
6. Takenaga, S.; Schneider, B.; Erbay, E.; Biselli, M.; Schnitzler, T.; Schöning, M.J.; Wagner, T. Fabrication of
biocompatible lab-on-chip devices for biomedical applications by means of a 3D-printing process. Phys. Status
Solidi A 2015, 212, 1347–1352. [CrossRef]
7. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Carcia-Cordero, J.L.; et al. 3D printing of transparent bio-microfluidic
devices in PEGDA. Lab Chip 2016, 16, 2287–2294. [CrossRef] [PubMed]
8. Macdonald, N.P.; Cabot, J.M.; Smejkal, P.; Guit, R.M.; Paull, B.; Breadmore, M.C. Comparing microfluidic
performance of three-dimensional (3D) printing platforms. Anal. Chem. 2017, 89, 3858–3866. [CrossRef]
[PubMed]
9. Sochol, R.D.; Sweet, E.; Glick, C.C.; Venkatesh, S.; Avetisyan, A.; Ekman, K.G.; Raulinaitis, A.; Tsai, A.;
Wienkers, A.; Korner, K.; et al. 3D printed microfluidic circuitry via multijet based additive manufacturing.
Lab Chip 2016, 16, 668–678. [CrossRef] [PubMed]
10. Lee, K.G.; Park, K.J.; Seok, S.; Shin, S.; Kim, D.H.; Park, J.Y.; Heo, Y.S.; Lee, S.J.; Lee, T.J. 3D printed modules
for integrated microfluidic devices. RSC Adv. 2014, 4, 32876–32880. [CrossRef]
11. Lee, J.M.; Zhang, M.; Yeong, W.Y. Characterization and evaluation of 3D printed microfluidic chip for cell
processing. Microfluid. Nanofluid. 2016, 20, 1–15. [CrossRef]
12. He, Y.; Wu, Y.; Fu, J.; Gao, Q.; Qiu, J. Developments of 3D printing Microfluidics and Applications in
Chemistry and Biology: A Review. Electroanalysis 2016, 28, 1–22. [CrossRef]
13. Yazdi, A.A.; Popma, A.; Wong, W.; Nguyen, T.; Pan, Y.; Xu, J. 3D Printing: An emerging tool for novel
microfluidics and lab-on-a-chip applications. Microfluid. Nanofluid. 2016, 20, 1–18. [CrossRef]
14. Chen, C.; Mehl, B.T.; Munshi, A.S.; Townsend, A.D.; Spence, D.M.; Martin, R.S. 3D-printed microfluidic
devices: Fabrication, advantages and limitations-a mini review. Anal. Methods 2016, 8, 6005–6012. [CrossRef]
[PubMed]
15. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
16. Beauchamp, M.J.; Nordin, G.P.; Woolley, A.T. Moving from millifluidic to truly microfluidic sub-100 μm
cross-section 3D printed devices. Anal. Bioanal. Chem. 2017, 409, 4311–4318. [CrossRef] [PubMed]

133
Micromachines 2018, 9, 326

17. Ukita, Y.; Takamura, Y.; Utsumi, Y. Direct digital manufacturing of autonomous centrifugal microfluidic
device. Jpn. J. Appl. Phys. 2016, 55, 06GN02. [CrossRef]
18. Walczak, R.; Adamski, K. Inkjet 3D printing of microfluidic structures-on the selction of the printer towards
printing your own microfluidic chips. J. Micromech. Microeng. 2015, 25, 085013. [CrossRef]
19. Fuad, N.M.; Carve, M.; Kaslin, J.; Wlodkowic, D. Characterization of 3D-printed moulds for soft lithography
of millifluidic devices. Micromachines 2018, 9, 116. [CrossRef]
20. Gong, H.; Beauchamp, M.J.; Perry, S.; Woolley, A.T.; Nordin, G.P. Optical approach to resin formulation for
3D printed microfluidics. RSC Adv. 2015, 5, 106621–106632. [CrossRef] [PubMed]
21. Gong, H.; Bickham, B.P.; Woolley, A.T.; Nordin, G.P. Custom 3D printer and resin for 18 μm × 20 μm
microfluidic flow channels. Lab Chip 2017, 17, 2899–2909. [CrossRef] [PubMed]
22. Gong, H.; Woolley, A.T.; Nordin, G.P. 3D printed high density, reversible, chip-to-chip microfluidic
interconnects. Lab Chip 2018, 4, 639–647. [CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

134
micromachines

Review
3D-Printed Biosensor Arrays for Medical Diagnostics
Mohamed Sharafeldin 1,2 , Abby Jones 1 and James F. Rusling 1,3,4,5, *
1 Department of Chemistry (U-3060), University of Connecticut, 55 North Eagleville Road, Storrs, CT 06269,
USA; [email protected] (M.S.); [email protected] (A.J.)
2 Analytical Chemistry Department, Faculty of Pharmacy, Zagazig University, Zagazig 44519, Sharkia, Egypt
3 Institute of Materials Science, University of Connecticut, 97 North Eagleville Road, Storrs, CT 06269, USA
4 Department of Surgery and Neag Cancer Center, UConn Health, Farmington, CT 06032, USA
5 School of Chemistry, National University of Ireland, Galway, University Road, Galway, Ireland
* Correspondence: [email protected]; Tel: +1-860-486-4909

Received: 14 June 2018; Accepted: 2 August 2018; Published: 7 August 2018

Abstract: While the technology is relatively new, low-cost 3D printing has impacted many aspects
of human life. 3D printers are being used as manufacturing tools for a wide variety of devices in a
spectrum of applications ranging from diagnosis to implants to external prostheses. The ease of use,
availability of 3D-design software and low cost has made 3D printing an accessible manufacturing
and fabrication tool in many bioanalytical research laboratories. 3D printers can print materials with
varying density, optical character, strength and chemical properties that provide the user with a vast
array of strategic options. In this review, we focus on applications in biomedical diagnostics and
how this revolutionary technique is facilitating the development of low-cost, sensitive, and often
geometrically complex tools. 3D printing in the fabrication of microfluidics, supporting equipment,
and optical and electronic components of diagnostic devices is presented. Emerging diagnostics
systems using 3D bioprinting as a tool to incorporate living cells or biomaterials into 3D printing is
also reviewed.

Keywords: 3D printing; diagnostics; optics; bioprinting; electronics; microfluidics

1. Introduction
Charles W. Hull in 1986 was the first to report stereolithography [1] as a tool to fabricate 3D
structures. Since then, 3D printing has evolved into a multifunctional fabrication tool that offers
unique advantages for biomedical applications including diagnostics [2], scaffolds for 3D implants [3],
prosthesis [4] and tissue engineering [5]. In recent years, the ability to convert computer-assisted design
(CAD) files into 3D-printed pieces, also known as additive manufacturing, has sparked significant
progress in the field of diagnostics [6]. 3D printing has been utilized in a wide spectrum of applications
with excellent design and performance. As an additive manufacturing technique, production costs
are lower compared to traditional subtractive manufacturing techniques like milling or ablation
due to reduction of the labor and material cost. In addition, versatile 3D printers can be used to
produce different devices and parts without the need for pre-fabrication changes normally required
in subtractive manufacturing techniques [7,8]. These criteria make 3D printing a valuable tool in
prototyping, testing and production of tools and equipment for analytical and diagnostic laboratories.
In principle, CAD files of previously reported devices can be downloaded and printed in any laboratory.
In this way, advanced diagnostic tools can be directly utilized by researchers without the need for
purchase from a commercial vendor. This approach has the potential to bring advanced diagnostic
tools more rapidly to the research lab than ever before.
In this review, we focus on applications of 3D printing techniques in medical diagnostics.
We discuss different 3D printing techniques and how these techniques impact many design aspects

Micromachines 2018, 9, 394; doi:10.3390/mi9080394 135 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 394

including resolution, cost and fabrication of complex diagnostic devices in a continuous process [9–11].
3D-printed microfluidic devices have been used to fabricate semi and fully automated diagnostic
approaches for diseases like cancer [12,13], infectious diseases [14–16], and xenobiotic genotoxicity [17].
3D printing can also make tailored supporting devices that improve performance of existing diagnostics
like spectrophotometers [18] and Polymerase Chain Reaction (PCR) devices [14,19] and is used to
assist with smartphone integration for remote sensing [20,21]. The ability to print materials with
special properties allows for the creation of new equipment that can dramatically reduce the cost of
diagnostic devices like Surface Plasmon Resonance (SPR) [22]. All these applications use 3D printing
for cost-effective multifunctional production to integrate several functions in one device [23].
Fabrication of diagnostic devices with embedded electronics and circuits have also been
accomplished by 3D printing. The ability to print different materials simultaneously permits the
fabrication of electrodes that can be incorporated into the insulator plastic matrices allowing for
subsequent electrochemical detection of metals [24–26], organic compounds [27,28] and biologically
active molecules [29]. 3D printing avoids disadvantages associated with screen printing like the need
for masking and drying steps, while exhibiting better resolution and faster fabrication [30].
3D bioprinting is another emerging modification to traditional 3D printing where cells, enzymes
or proteins may be encapsulated or loaded into printable bio-ink solutions [31]. A major focus of
this technique is to provide cell growth medium for tissue and organ repair and regeneration, but it
has also been explored as a tool for diagnostic applications [32]. Bioprinting offers an opportunity to
fabricate 3D-printed implantable sensors that are biocompatible, geometrically complex, and cheap.
With 3D printing, there is a limited need for specialized training, and devices can be tailored to the
users’ requirements [33,34]. In this review, the most common techniques for 3D-printed diagnostics
are briefly described with several examples of diagnostic platforms incorporating microfluidics, device
supports, optical components, electronics and biomaterials.

2. Additive Manufacturing Techniques

2.1. Fused Deposition Modeling (FDM)


This technique utilizes thermoplastic polymeric materials extruded to print objects layer-by-layer
from a heated nozzle onto a surface or platform where it is cooled to below its thermoplastic
temperature (Figure 1). Several materials have been utilized in this printing technique, including
acrylonitrile butadiene styrene (ABS), polycarbonate (PC), PC-ABS blend, and polylactic acid
(PLA) [35]. Single-, double- and triple-print-head machines are available for FDM, making it a good
choice for simultaneous multi-material 3D printing [36]. The ability to incorporate conductive materials
like pyrolytic graphite, graphene, carbon nanotubes and metal nanoparticles into the thermoplastic
matrix enables FDM printing of conductive inks to fabricate electrodes and circuits [37–40]. FDM
is good for rapid prototyping and fabrication of holders and supporting devices, but still suffers
from several limitations, including mechanical strength, roughness and shape integrity of the final
product. Microfluidic devices printed using FDM can show leakage and shape deformation if printing
parameters and the thermoplastic polymer are not carefully tuned [37]. FDM has been successfully
used to print 3D scaffolds that can be seeded with living cells without loss of cell viability [41,42] and
to print bio-friendly polymer materials [43,44].

136
Micromachines 2018, 9, 394

Figure 1. Schematic representation of a dual-head fused deposition modeling 3D printer. Thermoplastic


polymer is extruded from a heated nozzle into a printing platform, where it is cooled to below its
thermoplastic temperature. Reproduced with permission from [35]. Copyright (2015) Springer.

2.2. Direct Ink Writing


Similar to fused deposition modeling, Direct Ink Writing (DIW) relies on extrusion of ink through
a fine deposition nozzle to form a 3D structure in layer-by-layer approach [45]. Two different strategies
are utilized in this technique, based on the ink type. First is the extrusion of low-viscosity ink that
undergoes gelation via a chemical, photochemical or noncovalent process [46]. The second strategy
is the use of a shear thinning hydrogel ink that possesses a viscoelastic response toward applied
pressure. Hydrogels like sodium alginate and gelatin are commonly used [47]. In addition to hydrogel
inks, epoxy-based direct writing was developed by Compton and Lewis [48], where epoxy ink with
significant shear thinning is extruded through the printing nozzle. Once extruded, the ink has sufficient
shear to maintain its printed filamentary shape. Direct ink writing is utilized in the 3D fabrication of
injectable therapeutics [49], cell-laden scaffolds [50,51], degradable biomaterials [52] and stretchable
complex cellularized structures [53]. The utilization of DIW in bioprinting offers a tool to develop
multifunctional diagnostic devices with high resolution, which may improve assay sensitivities.

2.3. Stereolithography
Stereolithography, or digital light processing, employs a photocurable polymeric resin which,
when exposed to light, cures into a solid. Initially, curing was only possible with UV light, but polymers
cured with visible wavelengths have recently been introduced. Highly focused lasers or LED beams
with high intensity are used and the spot size of the light beam determines printing resolution [54].
Each layer of the object is printed as a point-by-point 2D cross section cured by the scanning focused
beam onto a printing platform immersed in a photocurable tank that holds the liquid resin [5]

137
Micromachines 2018, 9, 394

(Figure 2A). Recently, projection-based stereolithography has been introduced with a promise to
decrease print time while maintaining almost the same resolution as line-based stereolithography.
Projection-based stereolithography replaces point-by-point curing with entire-layer curing under
one single UV or visible light exposure [55,56] (Figure 2B). Stereolithography resin materials have
been extensively studied to produce devices with different properties, including transparency, color,
flexibility and thermal stability [57]. Stereolithography has also been used for printing cells using
biocompatible resins maintaining >90% cell viability after printing [58].

Figure 2. Schematic representation of stereolithographic 3D printing. (A) Scanning laser stereolithography,


where the focused laser beam scans point-by-point to cure a layer of resin on top of a previously
fabricated layer. (B) Projection-based stereolithography, where an entire layer is printed in a single
step by projecting the entire layer on top of the previous layer. In both strategies, a printing platform
is immersed in a tank filled with liquid photocurable resin. Reproduced with permission from [54].
Copyright (2014) American Chemical Society.

2.4. Photopolymer Inkjet Printing (Multi-Jet Modeling—MJM)


This technique utilizes multi-head printers with print heads similar to inkjet printers. The print
head extrudes layers of photocurable resin or molten wax, usually with a second head printing support
material to maintain the shape of the design until cured (Figure 3). After printing, the object is cured
by UV irradiation or heat and support material can be removed by heating or dissolving in a specific
solvent [59]. Researchers have been able to utilize this printing technique to print metal nanoparticles
for printed electronics [60], preceramic polymers for 3D-printed ceramics [61] and even metallic
electrodes on flexible substrates [62]. The ability to print multiple materials with varying chemical and
physical properties simultaneously makes MJM a good candidate for diagnostic device fabrication.
Microfluidic channels integrated with either electrodes for electrochemical signal detection [63] or
porous membranes that can be seeded with viable cells for drug permeability and toxicity studies have
been printed using this technique [64]. Most printing resins and materials are proprietary, which makes
the cost of using MJM relatively higher than other 3D-printing techniques [65].

138
Micromachines 2018, 9, 394

Figure 3. Schematic representation of multi-jet printing technique, a photocurable resin is printed


simultaneously with a support material that can be removed after curing. Up to 10 printing heads can
be used. Reproduced with permission from [59]. Copyright (2014) American Chemical Society.

2.5. Selective Laser Sintering (SLS)


A focused Infra-Red (IR) laser beam supplies enough localized energy to sinter a fine powdered
polymer into layers of solid. The IR laser scans through the surface of powder in the shape of
each layer of the sliced 3D design (Figure 4). Due to the high energy required to sinter powders,
high-energy CO2/Nd:YAG laser sources are typically used [66]. SLS can be divided into two distinctive
subcategories based on the printing temperature. The first is solid-state sintering, where binding
occurs at a temperature lower than the melting temperature and is usually used with polymers like
polycarbonate. The second is full melting SLS and is used for metals and ceramics where sintering
requires a high temperature above the melting temperature [67]. Printing resolution is affected by
powder particle size and can be controlled by the scan speed and intensity of the laser beam, which also
affects the density and strength of the printed parts [68]. SLS has utilized several printing substrates,
including natural and synthesized polymers like cellulose and polycarbonate, making it compatible
with bioprinting for tissue engineering and cartilage repair [69]. Other printing substrates include
metals, ceramics and polymer/ceramic composites. It is important to note that the printing resolution
of polymers is much lower compared to that of metals or ceramics [70]. Due to the high-energy laser
source required and the substrate specifications, SLS is currently considered to be the most expensive
3D printing technique [71]. Recently, Formlabs introduced Fuse1, a desktop SLS printer that provides
end-users with a more affordable option [72].

Figure 4. Schematic representation of Selective Laser Sintering, a rolling ball pushes powdered substrate
to the surface of the printing platform. A high-energy focused laser beam scans the surface where it
sinters the powder particles into a solid layer. The printing chamber is sealed under vacuum or inert
gas atmosphere. Reproduced with permission from [70]. Copyright (2015) Springer Nature available
under Creative Commons Attribution.

139
Micromachines 2018, 9, 394

2.6. Direct Laser Writing (DLW) 3D Lithography


Direct laser writing is an emerging technique for 3D printing of high-resolution structures utilizing
a highly pulsed femtosecond laser beam to cure a photosensitive resin material [73]. Two-photon
absorption and polymerization facilitates fast fabrication of 3D scaffolds with high resolution [74].
This short pulsed laser is suitable for encapsulating living cells and biomaterials in 3D structures as it
does not generate localized overheating or UV toxicity. Due to versatility in substrate materials and the
ability to print high-resolution 3D scaffolds, DLW has been used in piezoelectric scaffolds for in vitro
cell stimulation [74], cartilage tissue engineering [75] and cells and whole organisms containing 3D
structures [76–78]. Due to the high resolution achieved by DLW, it has been utilized in fabrication of
microvalve assembly [79], custom microstructures [80,81] and complex microfluidic constructs [82,83].

2.7. Summary of 3D Printing Techniques


In order to select the appropriate 3D printing technique, the user must have in mind the properties
required for the printed piece. Several criteria, such as flexibility, resolution, complexity, transparency,
thermal and chemical stability, are crucial in determining the best technique. Table 1 summarizes the
3D printing techniques discussed in this section.

Table 1. Summary of 3D printing techniques. FDM: fused deposition modeling, PLA: polylactic
acid, ABS: acrylonitrile butadiene styrene, PC: polycarbonate, DIW: direct ink writing, SLA:
stereolithography, MJM: multijet modeling, SLS: selective laser sintering, DLW: direct laser writing.

3D Printing Commercially
Principle Materials Pros Cons
Technique Available Printers
FDM PLA, ABS, PC, Inexpensive, Fast, Low resolution, Makerbot,
Filament Extrusion
[35,36] Acrylates Multiple Materials Roughness, Leakage Ultimaker Prusa
Alginates, Gelatin, Extensive
DIW Biocompatible, 3D-Bioplotter,
Ink Extrusion Hyaluronates, Optimization
[46–48] High Resolution BioAssemblyBot
Epoxy resin Required
SLA Light Assisted Good Resolution, Form2, FabPro,
Acrylates Single Material
[54,55] Polymerization Flexibility Nobel
Printable
MJM Multiple Materials,
Photocurable Resin Multiple Materials Expensive ProJet, Multijet
[59,64,65] High Resolution
on Support
Good Resolution,
SLS IR Beam to Sinter Ceramics, Metals, Expensive, Special
Variety of Fuse 1, Sintratec
[67,68] Powdered Polymer Polymers handling
Substartes
Two-Photonn Exceptional
DLW Femtowriter,
Absorption and Polymeric Resin Resolution, Bulky Instrument
[73,74] Tungsten-LAM
Polymerization Biocompatible

3. Applications of 3D Printing in Diagnostics


3D printing has improved biomedical diagnostics in many ways, specifically with advantages
in ease of onsite design and fabrication, providing researchers with the means to develop or modify
devices and equipment. Here we concentrated on the main areas in which biomedical diagnostic
research has been focused recently.

3.1. 3D-Printed Microfluidics


The most representative use of 3D printing technology in diagnostics is the design and
development of microfluidic devices. The ability to fine-tune geometrically complex structures
at the micrometer level is an attractive feature 3D printing can offer while maintaining low-cost
and time-efficient processing. Several applications that have used 3D-printed microfluidic devices
are discussed.

140
Micromachines 2018, 9, 394

3.1.1. Sample Pretreatment


Sample pretreatment is an essential step in many diagnostics, as it helps reduce the complexity of
the matrix and improve the sensitivity of the assay. 3D-printed microfluidics facilitates the integration
of sample pretreatment compartments into real applications including sample injection valves [84,85],
preconcentration [86] and sample reactors [87]. Rafeie et al. utilized 3D printing to fabricate an
ultrafast microfluidic blood plasma separator, an essential sample pretreatment step in most assays
requiring blood samples. They were able to fabricate a spiral microfluidic device (Figure 5A) where
cells would flow close to the inner wall of the channel and concentrate in a narrow band near the
outlet allowing the separation of cell/platelet free plasma. [88]. Lee et al. separated pathogenic
bacteria, E. coli, from milk using a 3D-printed helical channel [89]. They flowed magnetic nanoclusters
through the helical microfluidic channel (Figure 5B) where free magnetic nanoclusters were separated
from bacteria-bound clusters. Yan et al. proposed a portable hand operated microfluidic device
that can specifically separate platelets from peripheral blood mononuclear cells [90]. Their device
is composed of a microfluidic channel equipped with a groove (Figure 5C) that effectively sorts
platelets from blood samples with 100% purity where the user pumps the fluid manually with a
hand-held syringe. While fluctuation in the flow rate did not affect the platelet purity, the percent
recovery of blood mononuclear cells varied. A microfluidic pre-concentrator for detection of E. coli
was also proposed by Park et al. [91]. Magnetic nanoparticles labeled with E. coli-specific antibodies
were allowed to capture bacteria from blood samples. The microfluidic device was equipped with a
magnet to separate (Figure 5D) magnetic nanoparticles from the blood matrix which then transferred
with buffer for adenosine triphosphate (ATP) luminescence analysis. Although these devices are
interesting applications for 3D printing in sample pretreatment, they still require a manual transfer of
the treated samples for detection. This manual transfer can negatively affect the assays sensitivity and
reproducibility required for a good diagnostic approach.

Figure 5. 3D-printed devices for sample pretreatment. (A) Spiral microfluidic device to separate blood
cells and platelets from plasma, as the cells and platelets tend to flow in a narrowing band near the
inner wall of the spiral channel. Reproduced with permission from [88]. Copyright (2016) Royal
Society of Chemistry. (B) Helical microfluidic device to separate magnetic nanoclusters coupled to
E. coli from free magnetic nanoclusters. Reproduced with permission from [89]. Copyright (2015)
Springer Nature, available under Creative Commons Attribution. (C) A hand-driven microfluidic
channel with a groove-like structure to separate platelets from blood mononuclear cells. Reproduced
with permission from [90] Copyright (2018) Springer Nature. (D) Trapezoidal filter equipped with a
microfluidic channel for the preconcentration of E. coli captured on magnetic beads. Reproduced with
permission from [91] Copyright (2017) Elsevier.

141
Micromachines 2018, 9, 394

3.1.2. Microfluidic Flow Devices


Microfluidic devices offer the most promising approach for miniature fluidic devices due
to their ability to handle small sample volumes and assay reagents in a controlled manner. 3D
printing has pushed prototyping and development of microfluidics forward by supporting fast and
easy design with lower production costs compared to traditional microfabrication techniques. 3D
printing also offers an efficient tool to generate geometrically complex microfluidic devices with the
aid of 3D design software, thus eliminating the hassle associated with traditional manufacturing
tools. Utilizing these advantages, Oh et al. designed and fabricated a 3D-printed blood viscosity
analysis capillary circuit [92]. They designed a hand-held device that can be operated and read
manually that measures blood viscosity using the same principle as commercial viscometers which
are very expensive and complex (Figure 6A). Surprisingly, their device did not utilize the resolution
advances of 3D printing, but instead they added Tygon tubing, with inner diameter of 0.508 mm, to
build a capillary circuit inside a 3D-printed channel. Santangelo et al. proposed a highly sensitive
3D-printed continuous-flow microfluidic device for quantification of adenosine triphosphate (ATP)
molecules (Figure 6B). The device comprised two main functions: mixing of the ATP sample
with the luminescence reagent mixture (Luciferin/Luciferase mixture) and a detection chamber
that brings the produced luminescence close to a silicon photomultiplier detector [93]. Tang et al.
utilized 3D printing to fabricate a unibody ELISA-inspired chemiluminescence assay to detect and
quantify prostate specific antigen (PSA) and platelet factor-4 (PF-4) as cancer biomarker proteins
(Figure 6C) [94]. They proposed a design that can reduce the assay time to 30 min while approaching
an ultra-low sensitivity. Their design is divided into three connected compartments: first, a mixing
chamber to accelerate the interaction between reagents; second, a compartment of sample and reagent
reservoirs; and third, a transparent detection compartment. The ability to 3D print transparent objects
allowed them to directly detect the chemiluminescent signal in their device using a CCD camera
without the need for complex processing. Recently, a Lego-like modular microfluidic capillary-driven
3D-printed flow device was introduced by Nie et al. [95]. This approach proposed a strategy to build
microfluidic devices tailored to different applications. Flow in such devices is driven by capillary forces,
with improved flow rate programmability and biocompatibility. They were able to design different
modules assembled in various designs and utilized them in diverse applications, like degradable bone
scaffolds and cell culture. Kadimisetty et al. proposed a 3D-printed microfluidic unit that manually
controls the flow of sample and assay reagents for electrochemiluminescent detection of PSA, PF-4 and
prostate specific membrane antigen (PSMA) in human serum [12]. The printed device had a slot to
incorporate a screen-printed carbon electrode labeled with detection antibodies for each of the selected
protein biomarkers (Figure 6D). Similar 3D-printed microfluidic flow devices were fabricated and
utilized for flow chemical analysis [96], evaluation of blood components [97], electrochemiluminescence
DNA studies [98] and salivary cortisol detection [99]. In these discussed examples, 3D printing was
the key for better diagnostic performance by providing low-cost incorporation of multiple fluidic
functions easily and without the need for laborious manufacturing procedures.

142
Micromachines 2018, 9, 394

Figure 6. 3D-printed microfluidic devices for flow control. (A) Viscometer like 3D-printed syringe
attachment for blood viscosity measurement. Reproduced with permission from [92]. Copyright (2018)
Elsevier. (B) Mixing and detection microfluidic device for luminescent detection of ATP. Reproduced
with permission from [93]. Copyright (2018) Elsevier. (C) Unibody 3D-printed microfluidic chip for
detection of PSA and PF-4. Reproduced with permission from [94]. Copyright (2017) Royal Society of
Chemistry. (D) Manually controlled flow regulatory system for electrochemiluminescence detection of
PSA, PSMA and PF-4. Reproduced with permission from [12]. Copyright (2016) Elsevier.

3.1.3. Microfluidic Mixers


Efficient mixing can be used to improve diagnostic tests by enhancing interaction kinetics between
reactants. Microfluidics can be configured for efficient mixing to enhance chaotic convection in
solutions, increasing the frequency of interactions between solution components [100]. 3D-printed
microfluidic mixers have been successfully used to improve passive mixing enhancing mixing efficiency
that improve diagnostics sensitivity [101]. Devices equipped with 3D-printed mixers have been used
in amperometric quantitation of hydrogen peroxide [102] and DNA assembly [103]. 3D-printed mixers
have been successfully integrated with optical spectroscopic probes including UV/Vis, infrared and
fluorescence probes [104]. Plevniak et al. proposed a 3D-printed microfluidic mixer for diagnosis
of anemia (Figure 7A). In their work, they were able to integrate the device with smartphone-aided
colorimetric signal detection to overcome the distance barrier for efficient screening [105]. The device
can analyze a finger prick of blood (~5 μL) driven by capillary force into the mixing chamber where it
is mixed with an oxidizing agent in less than 1 sec with cost 50 cents/chip. Another mixing device
was introduced by Mattio et al. [106], where a complex valve design was fabricated using 3D printing
(Figure 7B). The device has eight inlets for sample and reagents connected to a valve where samples
and reagents are mixed and transferred to detector. The device was used to quantify Lead and
Cadmium in water samples extracted from soil. One inlet was used for nitric acid required for column
conditioning, other inlets were used for fluorescence reagent, Rhod-5N™, and co-reagents potassium
iodide, N,N,N ,N -tetrakis-(2-Pyridylmethyl)ethylenediamine (TPEN) and ammonium oxalate.

143
Micromachines 2018, 9, 394

Figure 7. 3D-printed microfluidic mixers. (A) Microfluidic mixer for tele-diagnosis of anemia. Less than
one second of mixing required for the blood sample with the oxidizing agent; generated colorimetric
signal detected with a smartphone. Reproduced with permission from [105]. Copyright (2016) AIP
Publishing. (B) A lab on valve complex 3D-printed microfluidic chip for quantification of lead and
cadmium in water samples. Reproduced with permission from [106]. Copyright (2018) Elsevier.

3.1.4. Multifunctional Microfluidics


In the previous examples, 3D printing was utilized to fabricate microfluidics that served
only one purpose. Several researchers have proposed multifunctional 3D-printed microfluidic
devices capable of performing several tasks simultaneously. Kadimisetty et al. introduced a
microfluidic device that can analyze extracts from e-cigarette vapors [17]. The device is equipped
with sample and reagent reservoirs, in addition to an electrochemiluminescence signal detection
compartment (Figure 8A). Another multifunctional microfluidic device was also introduced recently
by Kadimisetty et al. [9], where they were able to extract, concentrate and isothermally amplify
nucleic acids in different bodily fluids as an approach for microfluidic point of care diagnostics
(Figure 8B). The microfluidic device is integrated with a membrane to isolate nucleic acids, then
placed in a chamber where loop mediated isothermal amplification is induced. Finally, the signal is
either detected colorimetrically by a mobile phone or by fluorescence with a portable USB fluorescence
microscope. This demonstrates the promising utility of 3D-printed microfluidic devices in Point-of-care
(POC) applications. Other multifunctional microfluidic devices have been proposed to detect Human
immunodeficiency virus (HIV) antibodies [107], zika virus [108] and glucose [109].

Figure 8. Multifunctional 3D-printed microfluidics. (A) A 3D-printed chip to detect genotoxicity of


metabolites from e-cigarette extracts. The device has a sample and reagent reservoir compartment
and a detection compartment equipped with platinum counter electrode and Ag/AgCl reference
electrode. Reproduced with permission from [17]. Copyright (2017) American Chemical Society. (B) A
3D-printed microfluidic array for isolation of nucleic acids equipped with a separation membrane and
heating compartment to amplify nucleic acids using loop mediated isothermal amplification that can
be attached to a USB microscope for fluorescence detection. Reproduced with permission from [9].
Copyright (2018) Elsevier.

144
Micromachines 2018, 9, 394

3.2. 3D-Printed Sensing Electronics


A number of researchers, especially those employing electrochemistry, are interested in 3D
printing for its ability to design and fabricate sensing electronics. Supported by the versatility of
printable materials, 3D printers have the ability to produce well defined shapes without masking
required in traditional screen printing or photolithography This enables 3D printing to fabricate
integrated electrode biosensors and electronic sensors that can be utilized as personal diagnostics
devices and POC sensors. Li et al. used a home-made 3D printer to print a conductive polymer in
polydimethylsiloxane (PDMS) or EcoflexTM to fabricate stretchable electrode sensors [110] (Figure 9A).
Using this 3D printer, they achieved a resolution of 400 μm with an electrode height of 1 mm and
detected sodium chloride electrochemically with a 1 μM detection limit and good sensitivity and
reproducibility. Another approach for 3D printing electrodes using fused deposition modeling was
proposed by Palenzuela et al. [111]. A commercially available graphene/polylactic acid filament was
used to print electrodes of distinctive shapes designed on CAD software (Figure 9B). The printed
electrodes were characterized using different redox probes and utilized to detect picric acid and
ascorbic acid in solution. In order to fabricate more complex electronics, Leigh et al. used a triple-head
fused deposition modeling printer to impede conductive filament within a nonconductive ABS or PLA
matrix [38]. Using this approach, they were able to fabricate a variety of complex functional objects
like a 3D flex sensor, capacitive buttons and a smart vessel (Figure 9C). The ability of 3D printing
to develop electronic biosensing devices was demonstrated in the fabrication of strain sensors in
biological systems [112,113] and skin-like sensors using thermo-responsive hydrogels [114]. Most of
these applications are directed towards the fabrication of electronic skin, a promising diagnostic tool
that composed of flexible and stretchable sensor that can perform several health monitoring functions
like temperature, glucose, sodium chloride and pressure sensing [115].

Figure 9. 3D-printed electronics. (A) 3D-printed tactile electrode sensor. Conductive PDMS doped
with carbon nanotubes were printed on PDMS or EcoflexTM to fabricate flexible electrode sensors.
Reproduced with permission from [110]. Copyright (2018) IOP Publishing. (B) A 3D-printed
graphene/polylactic acid electrode with ring or disc shape. Reproduced with permission from [111].
Copyright (2018) American Chemical Society. (C) A 3D-printed conductive carbon black electrode
in different objects from left to right: flexible glove sensor, capacitive buttons and smart vessel.
Reproduced from [38]. Copyright (2012) PLOS available under Creative Commons Attribution.

145
Micromachines 2018, 9, 394

3.3. 3D-Printed Supporting Devices


Versatility, ease of design and modification in a fast and economic manner made 3D printing
the method of choice to develop the supporting equipment and pieces required for diagnostics.
Shanmugam et al. used 3D printing to fabricate a custom designed mobile phone microscopy
support unit. This unit perfectly aligns the sample compartment with simple optics and a mobile
phone camera (Figure 10A) [116]. They also proposed a holder that can incorporate a microfluidic
chamber for analyzing flowing samples rather than stationary samples (Figure 10B). Using such
equipment, they were able to perform screening of soil-transmitted parasitic worms in resource-limited
areas. Another supporting device for a paper-based electrochemical sensor was proposed by
Scordo et al. [117]. A reagent-free sensor was proposed to test butyrylcholinesterase activity by
detecting thiocholine. A 3D-printed support equipped with a sample application hole was used to
provide the supporting strength and insulation required for electric connections (Figure 10C). Several
3D-printed supports for mobile phone-assisted diagnostics have been developed [118–120], in addition
to equipment pieces that can lower the cost of current diagnostic strategies [19,121,122] without
compromising performance.

Figure 10. 3D-printed support devices. (A) Soil analysis system with 3D-printed mobile phone holder
equipped with a glass slide holder where samples were fixed in a lens in between the mobile camera
and the sample holder. This jig has a replaceable filter just above the lens for fluorescence imaging.
Reproduced from [115]. Copyright (2018) PLOS available under Creative Commons Attribution.
(B) Alternate soil analysis system with the same support components, but modified to hold a
microfluidic chip for flowing samples. Reproduced from [115]. Copyright (2018) PLOS available under
Creative Commons Attribution. (C) Support device with sample application hole for paper-based
electrochemical detection of butyrylcholinesterase activity. Reproduced with permission from [116].
Copyright (2018) Elsevier.

3.4. 3D-Printed Optics


Despite the current limitations of the 3D printing of fully transparent surfaces without defects
that could affect light reflection and transmission, researchers have tried to print functional optical
components to reduce the cost and improve the performance of diagnostic devices. An interesting
example from Hinamn et al. describes a 3D-printed prism that can be used for plasmonic sensing [22]
(Figure 11A). In order to prove functionality, they deposited a layer of gold on one side of the prism
and used it to detect cholera toxins. They also printed prisms with different geometries and used
them to monitor nanoparticle growth (Figure 11B). Other researchers used two-photon polymerization
3D printing to fabricate high-resolution micro-optic components of optic fiber ends [123] and other
micro-optics [124]. 3D-printed optical tweezers for sample trapping [125] were also developed to aid
chemical and spectroscopic sample analysis. Some other 3D-printed fine optics that have not been
used yet in diagnostics have also been proposed [126,127]. Integrating compact, lost-cost, effective

146
Micromachines 2018, 9, 394

optical components is a crucial development for POC diagnostics. These examples are good candidates
for integration in POC optical diagnostic systems for medical testing [128].

Figure 11. 3D-printed optics. (A) 3D-printed prism polished with simple benchtop polishing decorated
with a layer of gold and used for plasmonic sensing of cholera toxins. Reproduced with permission
from [22]. Copyright (2017) American Chemical Society. (B) 3D-printed prism with a different geometry
than (A) used to monitor nanoparticle growth. Reproduced with permission from [22]. Copyright
(2017) American Chemical Society.

3.5. 3D Bioprinting
The ability to use biocompatible 3D printing substrates allowed the incorporation of biomaterials
in 3D-printed scaffolds. This facilitated the further investigation of multifunctional 3D-printed devices
that could express biomimetic activity in diagnostic applications. A bioinspired microfluidic chip
that can be attached to a whole organ was proposed by Singh et al. [129]. This microfluidic chip was
fabricated based on structured light scanning of a whole organ followed by stereolithographic 3D
printing using the scanned conformation. The as-printed device was attached to porcine kidney for
biomarker extraction and profiling (Figure 12A) without the need for tissue removal. This approach
enables the study of metabolic activities in a living whole organ, paving the way for further
investigation into drug toxicity screening and biomarker discovery.

147
Micromachines 2018, 9, 394

Figure 12. 3D bioprinting. (A) 3D-printed perfusion chip for extraction of metabolites and
biomarkers from whole organs. Reproduced with permission from [129]. Copyright (2017) Royal
Society of Chemistry (B) 3D-printed bone-like scaffold carrying bone stromal cells to study their
interactions with breast cancer cells. Reproduced with permission from [34]. Copyright (2016) American
Chemical Society.

A cell-laden bone matrix was proposed by Zhou et al. [34] to study breast cancer metastasis.
They printed a gelatin-based methacrylate hydrogel with incorporated bone stromal cells to study their
interactions with breast cancer cells (Figure 12B). An in vivo alkaline phosphatase testing platform
was introduced by Park et al. [32] using 3D-printed biocompatible calcium-deficient hydroxyapatite.
Although 3D bioprinting developments are mainly used in tissue constructs for therapeutics [130],
they offer great advancement opportunities in the field of diagnostics. These developments include
the immobilization of aptamers on silicon nitride surfaces [131], functionalizing gold electrodes with
bacterial reaction centers [132] and embedding bacteria in 3D constructs [133], all which can be useful
in diagnostic applications.

4. Conclusions and Outlook


Evolving applications and developments suggest that 3D printing will be a major player in
fabricating readily available, cheap, miniaturized, multifunctional and sensitive diagnostic devices.
Researchers from different backgrounds have developed diagnostic assays using this versatile
technology. 3D printing has been used as a tool for device prototyping and development with
photolithography most commonly used because of the availability of materials exhibiting different
properties and high resolution. However, its applications now go well beyond prototyping into
real-world device fabrication technology. That is, the fully optimized device becomes the final
diagnostic tool to be used in hospitals and clinics. In addition, 3D printing is pushing biomedical
diagnostic research towards multifunctional devices that can perform several functions, like protein
and metabolite extraction and detection using optical and electrochemical signal detection.

148
Micromachines 2018, 9, 394

3D printing technology still needs improvement in order to enhance current diagnostic abilities.
First, simultaneous printing of multiple materials with high resolution and good compatibility
is essential, especially for functional materials like conductive inks and biomimetic substrates.
Printing multiple materials with different physical properties would greatly improve the capabilities of
3D printers to produce more complex functional architectures. The ability to print active biomaterials
like enzymes and proteins in 3D formats without compromising their basic activity is also an important
requirement for better diagnostic devices.
Given the progressive nature of 3D printing, more complex microfluidic architectures can
be expected in the near future. Recent research has focused on the development of microfluidic
pumps [134], automated flow control valves [135], atomic force microscopes [136] and sophisticated
scanning electron microscope sample holders [137]. These are examples of very complex architectures
that cannot be readily approached in the averaged bioanalytical laboratory without 3D printers.
This illustrates again the significance of incorporating 3D printing in bioanalytical and diagnostic
testing research providing a platform for achieving what was believed to be imaginary in the pre-3D
printing era.

Funding: The authors thank the University of Connecticut for an Academic Plan Project Grant and NIH and for
Grants No. ES03154 from the National institute of Environmental Health Sciences (NIEHS), and No. EB016707
from the National Institute of Biomedical Imaging and Bioengineering (NIBIB), for financial support in preparing
this article.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Hull, C. Apparatus for Production of Three-Dimensional Objects by Stereolithography. U.S. Patent
No 4,575,330, 11 March 1986.
2. Gross, B.; Lockwood, S.Y.; Spence, D.M. Recent Advances in Analytical Chemistry by 3D Printing. Anal. Chem.
2017, 89, 57–70. [CrossRef] [PubMed]
3. Chia, H.N.; Wu, B.M. Recent advances in 3D printing of biomaterials. J. Biol. Eng. 2015, 9, 4. [CrossRef]
[PubMed]
4. Diment, L.E.; Thompson, M.S.; Bergmann, J.H. Three-dimensional printed upper-limb prostheses lack
randomised controlled trials: A systematic review. Prosthet. Orthot. Int. 2018, 42, 7–13. [CrossRef] [PubMed]
5. Bose, S.; Vahabzadeh, S.; Bandyopadhyay, A. Bone tissue engineering using 3D printing. Mater. Today 2013,
16, 496–504. [CrossRef]
6. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
7. Why 3D Printing Could Be a Manufacturing and Logistics Game Changer. Available online:
https://www.manufacturing.net/blog/2013/10/why-3d-printing-could-be-manufacturing-and-lo
gistics-game-changer (accessed on 30 April 2018).
8. Au, A.K.; Lee, W.; Folch, A. Mail-order microfluidics: Evaluation of stereolithography for the production of
microfluidic devices. Lab Chip 2014, 14, 1294–1301. [CrossRef] [PubMed]
9. Kadimisetty, K.; Song, J.; Doto, A.M.; Hwang, Y.; Peng, J.; Mauk, M.G.; Bushman, F.D.; Gross, R.; Jarvis, J.N.;
Liu, C. Fully 3D printed integrated reactor array for point-of-care molecular diagnostics. Biosens. Bioelectron.
2018, 109, 156–163. [CrossRef] [PubMed]
10. Yazdi, A.A.; Popma, A.; Wong, W.; Nguyen, T.; Pan, Y.; Xu, J. 3D printing: An emerging tool for novel
microfluidics and lab-on-a-chip applications. Microfluid. Nanofluid. 2016, 20, 50. [CrossRef]
11. Zhang, Z.; Xu, J.; Hong, B.; Chen, X. The effects of 3D channel geometry on CTC passing pressure—Towards
deformability-based cancer cell separation. Lab Chip 2014, 14, 2576–2584. [CrossRef] [PubMed]
12. Kadimisetty, K.; Mosa, I.M.; Malla, S.; Satterwhite-Warden, J.E.; Kuhns, T.M.; Faria, R.C.;
Lee, N.H.; Rusling, J.F. 3D-printed supercapacitor-powered electrochemiluminescent protein immunoarray.
Biosens. Bioelectron. 2016, 77, 188–193. [CrossRef] [PubMed]

149
Micromachines 2018, 9, 394

13. Damiati, S.; Peacock, M.; Leonhardt, S.; Damiati, L.; Baghdadi, M.A.; Becker, H.; Kodzius, R.; Schuster, B.
Embedded Disposable Functionalized Electrochemical Biosensor with a 3D-Printed Flow Cell for Detection
of Hepatic Oval Cells (HOCs). Genes 2018, 9, 89. [CrossRef] [PubMed]
14. Mulberry, G.; White, K.A.; Vaidya, M.; Sugaya, K.; Kim, B.N. 3D printing and milling a real-time PCR device
for infectious disease diagnostics. PLoS ONE 2017, 12, e0179133. [CrossRef] [PubMed]
15. Singh, H.; Shimojima, M.; Shiratori, T.; An, L.V.; Sugamata, M.; Yang, M. Application of 3D Printing
Technology in Increasing the Diagnostic Performance of Enzyme-Linked Immunosorbent Assay (ELISA) for
Infectious Diseases. Sensors 2015, 15, 16503–16515. [CrossRef] [PubMed]
16. Chudobova, D.; Cihalova, K.; Skalickova, S.; Zitka, J.; Rodrigo, M.A.M.; Milosavljevic, V.; Hynek, D.; Kopel, P.;
Vesely, R.; Adam, V.; et al. 3D-printed chip for detection of methicillin-resistant Staphylococcus aureus
labeled with gold nanoparticles. Electrophoresis 2015, 36, 457–466. [CrossRef] [PubMed]
17. Kadimisetty, K.; Malla, S.; Rusling, J.F. Automated 3-D Printed Arrays to Evaluate Genotoxic Chemistry:
E-Cigarettes and Water Samples. ACS Sens. 2017, 2, 670–678. [CrossRef] [PubMed]
18. Schäfer, M.; Bräuler, V.; Ulber, R. Bio-sensing of metal ions by a novel 3D-printable smartphone spectrometer.
Sens. Actuators B Chem. 2018, 255, 1902–1910. [CrossRef]
19. Mendoza-Gallegos, R.A.; Rios, A.; Garcia-Cordero, J.L. An Affordable and Portable Thermocycler for
Real-Time PCR Made of 3D-Printed Parts and Off-the-Shelf Electronics. Anal. Chem. 2018, 90, 5563–5568.
[CrossRef] [PubMed]
20. Wang, L.-J.; Sun, R.; Vasile, T.; Chang, Y.-C.; Li, L. High-Throughput Optical Sensing Immunoassays on
Smartphone. Anal. Chem. 2016, 88, 8302–8308. [CrossRef] [PubMed]
21. Chen, Y.; Fu, Q.; Li, D.; Xie, J.; Ke, D.; Song, Q.; Tang, Y.; Wang, H. A smartphone colorimetric reader
integrated with an ambient light sensor and a 3D printed attachment for on-site detection of zearalenone.
Anal. Bioanal. Chem. 2017, 409, 6567–6574. [CrossRef] [PubMed]
22. Hinman, S.S.; McKeating, K.S.; Cheng, Q. Plasmonic Sensing with 3D Printed Optics. Anal. Chem. 2017,
89, 12626–12630. [CrossRef] [PubMed]
23. Rusling, J.F. Developing Microfluidic Sensing Devices Using 3D Printing. ACS Sens. 2018, 3, 522–526.
[CrossRef] [PubMed]
24. Lee, K.Y.; Ambrosi, A.; Pumera, M. 3D-printed Metal Electrodes for Heavy Metals Detection by Anodic
Stripping Voltammetry. Electroanalysis 2017, 29, 2444–2453. [CrossRef]
25. Rymansaib, Z.; Iravani, P.; Emslie, E.; Medvidović-Kosanović, M.; Sak-Bosnar, M.; Verdejo, R.; Marken, F.
All-Polystyrene 3D-Printed Electrochemical Device with Embedded Carbon Nanofiber-Graphite-Polystyrene
Composite Conductor. Electroanalysis 2016, 28, 1517–1523. [CrossRef]
26. Honeychurch, K.C.; Rymansaib, Z.; Iravani, P. Anodic stripping voltammetric determination of zinc at a
3-D printed carbon nanofiber–graphite–polystyrene electrode using a carbon pseudo-reference electrode.
Sens. Actuators B Chem. 2018, 267, 476–482. [CrossRef]
27. Cheng, T.S.; Nasir, M.Z.M.; Ambrosi, A.; Pumera, M. 3D-printed metal electrodes for electrochemical
detection of phenols. Appl. Mater. Today 2017, 9, 212–219. [CrossRef]
28. Tan, C.; Nasir, M.Z.M.; Ambrosi, A.; Pumera, M. 3D printed electrodes for detection of nitroaromatic
explosives and nerve agents. Anal. Chem. 2017, 89, 8995–9001. [CrossRef] [PubMed]
29. Liyarita, B.R.; Ambrosi, A.; Pumera, M. 3D-printed electrodes for sensing of biologically active molecules.
Electroanalysis 2018, 30, 1319–1326. [CrossRef]
30. Lewis, J.A.; Ahn, B.Y. Device fabrication: Three-dimensional printed electronics. Nature 2015, 518, 42–43.
[CrossRef] [PubMed]
31. Derakhshanfar, S.; Mbeleck, R.; Xu, K.; Zhang, X.; Zhong, W.; Xing, M. 3D bioprinting for biomedical devices
and tissue engineering: A review of recent trends and advances. Bioact. Mater. 2018, 3, 144–156. [CrossRef]
[PubMed]
32. Park, C.S.; Ha, T.H.; Kim, M.; Raja, N.; Yun, H.; Sung, M.J.; Kwon, O.S.; Yoon, H.; Lee, C.-S. Fast and sensitive
near-infrared fluorescent probes for ALP detection and 3D printed calcium phosphate scaffold imaging
in vivo. Biosens. Bioelectron. 2018, 105, 151–158. [CrossRef] [PubMed]
33. Knowlton, S.; Onal, S.; Yu, C.H.; Zhao, J.J.; Tasoglu, S. Bioprinting for cancer research. Trends Biotechnol. 2015,
33, 504–513. [CrossRef] [PubMed]

150
Micromachines 2018, 9, 394

34. Zhou, X.; Zhu, W.; Nowicki, M.; Miao, S.; Cui, H.; Holmes, B.; Glazer, R.I.; Zhang, L.G. 3D bioprinting a
cell-laden bone matrix for breast cancer metastasis study. ACS Appl. Mater. Interfaces 2016, 8, 30017–30026.
[CrossRef] [PubMed]
35. Mohamed, O.A.; Masood, S.H.; Bhowmik, J.L. Optimization of fused deposition modeling process
parameters: A review of current research and future prospects. Adv. Manuf. 2015, 3, 42–53. [CrossRef]
36. Dul, S.; Fambri, L.; Pegoretti, A. Fused deposition modelling with ABS–graphene nanocomposites.
Compos. Part Appl. Sci. Manuf. 2016, 85, 181–191. [CrossRef]
37. Wang, X.; Jiang, M.; Zhou, Z.; Gou, J.; Hui, D. 3D printing of polymer matrix composites: A review and
prospective. Compos. Part B Eng. 2017, 110, 442–458. [CrossRef]
38. Leigh, S.J.; Bradley, R.J.; Purssell, C.P.; Billson, D.R.; Hutchins, D.A. A Simple, Low-Cost Conductive
Composite Material for 3D Printing of Electronic Sensors. PLoS ONE 2012, 7, e49365. [CrossRef] [PubMed]
39. Cruz, M.A.; Ye, S.; Kim, M.J.; Reyes, C.; Yang, F.; Flowers, P.F.; Wiley, B.J. Multigram synthesis of cu-ag
core–shell nanowires enables the production of a highly conductive polymer filament for 3D printing
electronics. Part. Part. Syst. Charact. 2018, 25, 1700385. [CrossRef]
40. Lee, J.-Y.; An, J.; Chua, C.K. Fundamentals and applications of 3D printing for novel materials. Appl. Mater.
Today 2017, 7, 120–133. [CrossRef]
41. Rimington, R.P.; Capel, A.J.; Christie, S.D.; Lewis, M.P. Biocompatible 3D printed polymers via fused
deposition modelling direct C 2 C 12 cellular phenotype in vitro. Lab Chip 2017, 17, 2982–2993. [CrossRef]
[PubMed]
42. Rosenzweig, D.H.; Carelli, E.; Steffen, T.; Jarzem, P.; Haglund, L. 3D-Printed ABS and PLA Scaffolds for
Cartilage and Nucleus Pulposus Tissue Regeneration. Int. J. Mol. Sci. 2015, 16, 15118–15135. [CrossRef]
[PubMed]
43. Skliutas, E.; Kasetaite, S.; Jonušauskas, L.; Ostrauskaite, J.; Malinauskas, M. Photosensitive naturally derived
resins toward optical 3-D printing. Opt. Eng. 2018, 57, 041412. [CrossRef]
44. Voet, V.S.D.; Strating, T.; Schnelting, G.H.M.; Dijkstra, P.; Tietema, M.; Xu, J.; Woortman, A.J.J.; Loos, K.;
Jager, J.; Folkersma, R. Biobased acrylate photocurable resin formulation for stereolithography 3D printing.
ACS Omega 2018, 3, 1403–1408. [CrossRef]
45. Malek, S.; Raney, J.R.; Lewis, J.A.; Gibson, L.J. Lightweight 3D cellular composites inspired by balsa.
Bioinspir. Biomim. 2017, 12, 026014. [CrossRef] [PubMed]
46. Smith, P.T.; Basu, A.; Saha, A.; Nelson, A. Chemical modification and printability of shear-thinning hydrogel
inks for direct-write 3D printing. Polymer 2018, in press. [CrossRef]
47. He, Y.; Yang, F.; Zhao, H.; Gao, Q.; Xia, B.; Fu, J. Research on the printability of hydrogels in 3D bioprinting.
Sci. Rep. 2016, 6, 29977. [CrossRef] [PubMed]
48. Compton, B.G.; Lewis, J.A. 3D-printing of lightweight cellular composites. Adv. Mater. 2014, 26, 5930–5935.
[CrossRef] [PubMed]
49. Loebel, C.; Rodell, C.B.; Chen, M.H.; Burdick, J.A. Shear-thinning and self-healing hydrogels as injectable
therapeutics and for 3D-printing. Nat. Protoc. 2017, 12, 1521–1541. [CrossRef] [PubMed]
50. Fedorovich, N.E.; Schuurman, W.; Wijnberg, H.M.; Prins, H.-J.; van Weeren, P.R.; Malda, J.; Alblas, J.;
Dhert, W.J.A. Biofabrication of osteochondral tissue equivalents by printing topologically defined, cell-laden
hydrogel scaffolds. Tissue Eng. Part C Methods 2011, 18, 33–44. [CrossRef] [PubMed]
51. Billiet, T.; Gevaert, E.; De Schryver, T.; Cornelissen, M.; Dubruel, P. The 3D printing of gelatin methacrylamide
cell-laden tissue-engineered constructs with high cell viability. Biomaterials 2014, 35, 49–62. [CrossRef]
[PubMed]
52. Ifkovits, J.L.; Burdick, J.A. Review: Photopolymerizable and degradable biomaterials for tissue engineering
applications. Tissue Eng. 2007, 13, 2369–2385. [CrossRef] [PubMed]
53. Hong, S.; Sycks, D.; Chan, H.F.; Lin, S.; Lopez, G.P.; Guilak, F.; Leong, K.W.; Zhao, X. 3D printing of highly
stretchable and tough hydrogels into complex, cellularized structures. Adv. Mater. 2015, 27, 4035–4040.
[CrossRef] [PubMed]
54. Gross, B.C.; Erkal, J.L.; Lockwood, S.Y.; Chen, C.; Spence, D.M. Evaluation of 3D Printing and Its Potential
Impact on Biotechnology and the Chemical Sciences. Anal. Chem. 2014, 86, 3240–3253. [CrossRef] [PubMed]

151
Micromachines 2018, 9, 394

55. Gauvin, R.; Chen, Y.-C.; Lee, J.W.; Soman, P.; Zorlutuna, P.; Nichol, J.W.; Bae, H.; Chen, S.; Khademhosseini, A.
Microfabrication of complex porous tissue engineering scaffolds using 3D projection stereolithography.
Biomaterials 2012, 33, 3824–3834. [CrossRef] [PubMed]
56. Zhang, A.P.; Qu, X.; Soman, P.; Hribar, K.C.; Lee, J.W.; Chen, S.; He, S. Rapid Fabrication of Complex
3D Extracellular Microenvironments by Dynamic Optical Projection Stereolithography. Adv. Mater. 2012,
24, 4266–4270. [CrossRef] [PubMed]
57. Macdonald, N.P.; Cabot, J.M.; Smejkal, P.; Guijt, R.M.; Paull, B.; Breadmore, M.C. Comparing Microfluidic
Performance of Three-Dimensional (3D) Printing Platforms. Anal. Chem. 2017, 89, 3858–3866. [CrossRef]
[PubMed]
58. Lin, H.; Zhang, D.; Alexander, P.G.; Yang, G.; Tan, J.; Cheng, A.W.-M.; Tuan, R.S. Application of
visible light-based projection stereolithography for live cell-scaffold fabrication with designed architecture.
Biomaterials 2013, 34, 331–339. [CrossRef] [PubMed]
59. Hofmann, M. 3D printing gets a boost and opportunities with polymer materials. ACS Macro Lett. 2014,
3, 382–386. [CrossRef]
60. Kamyshny, A.; Steinke, J.; Magdassi, S. Metal-based inkjet inks for printed electronics. Open Appl. Phys. J.
2011, 4, 19–36. [CrossRef]
61. Zocca, A.; Gomes, C.M.; Staude, A.; Bernardo, E.; Günster, J.; Colombo, P. SiOC ceramics with ordered
porosity by 3D-printing of a preceramic polymer. J. Mater. Res. 2013, 28, 2243–2252. [CrossRef]
62. Bucella, S.G.; Nava, G.; Vishunubhatla, K.C.; Caironi, M. High-resolution direct-writing of metallic electrodes
on flexible substrates for high performance organic field effect transistors. Org. Electron. 2013, 14, 2249–2256.
[CrossRef]
63. Munshi, A.S.; Martin, R.S. Microchip-based electrochemical detection using a 3-D printed wall-jet electrode
device. Analyst 2016, 141, 862–869. [CrossRef] [PubMed]
64. Anderson, K.B.; Lockwood, S.Y.; Martin, R.S.; Spence, D.M. A 3D printed fluidic device that enables
integrated features. Anal. Chem. 2013, 85, 5622–5626. [CrossRef] [PubMed]
65. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742. [CrossRef] [PubMed]
66. Williams, J.M.; Adewunmi, A.; Schek, R.M.; Flanagan, C.L.; Krebsbach, P.H.; Feinberg, S.E.; Hollister, S.J.;
Das, S. Bone tissue engineering using polycaprolactone scaffolds fabricated via selective laser sintering.
Biomaterials 2005, 26, 4817–4827. [CrossRef] [PubMed]
67. Shirazi, S.F.S.; Gharehkhani, S.; Mehrali, M.; Yarmand, H.; Metselaar, H.S.C.; Kadri, N.A.; Osman, N.A.A.
A review on powder-based additive manufacturing for tissue engineering: Selective laser sintering and
inkjet 3D printing. Sci. Technol. Adv. Mater. 2015, 16, 033502. [CrossRef] [PubMed]
68. Kolan, K.C.R.; Leu, M.C.; Hilmas, G.E.; Velez, M. Effect of material, process parameters, and simulated body
fluids on mechanical properties of 13-93 bioactive glass porous constructs made by selective laser sintering.
J. Mech. Behav. Biomed. Mater. 2012, 13, 14–24. [CrossRef] [PubMed]
69. Yeong, W.Y.; Sudarmadji, N.; Yu, H.Y.; Chua, C.K.; Leong, K.F.; Venkatraman, S.S.; Boey, Y.C.F.; Tan, L.P.
Porous polycaprolactone scaffold for cardiac tissue engineering fabricated by selective laser sintering.
Acta Biomater. 2010, 6, 2028–2034. [CrossRef] [PubMed]
70. Wu, G.-H.; Hsu, S. Review: Polymeric-based 3D printing for tissue engineering. J. Med. Biol. Eng. 2015,
35, 285–292. [CrossRef] [PubMed]
71. Olakanmi, E.O.; Cochrane, R.F.; Dalgarno, K.W. A review on selective laser sintering/melting (SLS/SLM) of
aluminium alloy powders: Processing, microstructure, and properties. Prog. Mater. Sci. 2015, 74, 401–477.
[CrossRef]
72. Fuse 1: Benchtop Selective Laser Sintering (SLS) 3D Printer. Available online: https://formlabs.com/3d-pr
inters/fuse-1/ (accessed on 10 July 2018).
73. Malinauskas, M.; Žukauskas, A.; Hasegawa, S.; Hayasaki, Y.; Mizeikis, V.; Buividas, R.; Juodkazis, S. Ultrafast
laser processing of materials: From science to industry. Light Sci. Appl. 2016, 5, e16133. [CrossRef]
74. Marino, A.; Barsotti, J.; de Vito, G.; Filippeschi, C.; Mazzolai, B.; Piazza, V.; Labardi, M.; Mattoli, V.;
Ciofani, G. Two-photon lithography of 3D nanocomposite piezoelectric scaffolds for cell stimulation. ACS
Appl. Mater. Interfaces 2015, 7, 25574–25579. [CrossRef] [PubMed]

152
Micromachines 2018, 9, 394

75. Mačiulaitis, J.; Deveikytė, M.; Rekštytė, S.; Bratchikov, M.; Darinskas, A.; Šimbelytė, A.; Daunoras, G.;
Laurinavičienė, A.; Laurinavičius, A.; Gudas, R.; et al. Preclinical study of SZ2080 material 3D
microstructured scaffolds for cartilage tissue engineering made by femtosecond direct laser writing
lithography. Biofabrication 2015, 7, 015015. [CrossRef] [PubMed]
76. Ovsianikov, A.; Mühleder, S.; Torgersen, J.; Li, Z.; Qin, X.-H.; Van Vlierberghe, S.; Dubruel, P.; Holnthoner, W.;
Redl, H.; Liska, R.; et al. Laser photofabrication of cell-containing hydrogel constructs. Langmuir 2014,
30, 3787–3794. [CrossRef] [PubMed]
77. Torgersen, J.; Ovsianikov, A.; Mironov, V.; Pucher, N.; Qin, X.; Li, Z.; Cicha, K.; Machacek, T.; Liska, R.;
Jantsch, V.; et al. Photo-sensitive hydrogels for three-dimensional laser microfabrication in the presence of
whole organisms. J. Biomed. Opt. 2012, 17, 105008. [CrossRef] [PubMed]
78. Gruene, M.; Deiwick, A.; Koch, L.; Schlie, S.; Unger, C.; Hofmann, N.; Bernemann, I.; Glasmacher, B.;
Chichkov, B. Laser printing of stem cells for biofabrication of scaffold-free autologous grafts. Tissue Eng.
Part C Methods 2011, 17, 79–87. [CrossRef] [PubMed]
79. Schizas, C.; Melissinaki, V.; Gaidukeviciute, A.; Reinhardt, C.; Ohrt, C.; Dedoussis, V.; Chichkov, B.N.;
Fotakis, C.; Farsari, M.; Karalekas, D. On the design and fabrication by two-photon polymerization of a
readily assembled micro-valve. Int. J. Adv. Manuf. Technol. 2010, 48, 435–441. [CrossRef]
80. Qu, J.; Kadic, M.; Naber, A.; Wegener, M. Micro-structured two-component 3D metamaterials with negative
thermal-expansion coefficient from positive constituents. Sci. Rep. 2017, 7, 40643. [CrossRef] [PubMed]
81. Jonušauskas, L.; Skliutas, E.; Butkus, S.; Malinauskas, M. Custom on demand 3D printing of functional
microstructures. Lith. J. Phys. 2015, 55, 227–236. [CrossRef]
82. Amato, L.; Gu, Y.; Bellini, N.; Eaton, S.M.; Cerullo, G.; Osellame, R. Integrated three-dimensional filter
separates nanoscale from microscale elements in a microfluidic chip. Lab Chip 2012, 12, 1135–1142. [CrossRef]
[PubMed]
83. Paiè, P.; Bragheri, F.; Carlo, D.D.; Osellame, R. Particle focusing by 3D inertial microfluidics. Microsyst.
Nanoeng. 2017, 3, 17027. [CrossRef]
84. Rogers, C.I.; Qaderi, K.; Woolley, A.T.; Nordin, G.P. 3D printed microfluidic devices with integrated valves.
Biomicrofluidics 2015, 9, 016501. [CrossRef] [PubMed]
85. Su, C.-K.; Hsia, S.-C.; Sun, Y.-C. Three-dimensional printed sample load/inject valves enabling online
monitoring of extracellular calcium and zinc ions in living rat brains. Anal. Chim. Acta 2014, 838, 58–63.
[CrossRef] [PubMed]
86. Su, C.-K.; Peng, P.-J.; Sun, Y.-C. Fully 3D-printed preconcentrator for selective extraction of trace elements in
seawater. Anal. Chem. 2015, 87, 6945–6950. [CrossRef] [PubMed]
87. Su, C.-K.; Yen, S.-C.; Li, T.-W.; Sun, Y.-C. Enzyme-Immobilized 3D-Printed Reactors for Online Monitoring of
Rat Brain Extracellular Glucose and Lactate. Anal. Chem. 2016, 88, 6265–6273. [CrossRef] [PubMed]
88. Rafeie, M.; Zhang, J.; Asadnia, M.; Li, W.; Warkiani, M.E. Multiplexing slanted spiral microchannels for
ultra-fast blood plasma separation. Lab Chip 2016, 16, 2791–2802. [CrossRef] [PubMed]
89. Lee, W.; Kwon, D.; Choi, W.; Jung, G.Y.; Au, A.K.; Folch, A.; Jeon, S. 3D-printed microfluidic device for the
detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.
Sci. Rep. 2015, 5, 7717. [CrossRef] [PubMed]
90. Yan, S.; Tan, S.H.; Li, Y.; Tang, S.; Teo, A.J.T.; Zhang, J.; Zhao, Q.; Yuan, D.; Sluyter, R.; Nguyen, N.T.; et al.
A portable, hand-powered microfluidic device for sorting of biological particles. Microfluid. Nanofluid. 2018,
22, 8. [CrossRef]
91. Park, C.; Lee, J.; Kim, Y.; Kim, J.; Lee, J.; Park, S. 3D-printed microfluidic magnetic preconcentrator for the
detection of bacterial pathogen using an ATP luminometer and antibody-conjugated magnetic nanoparticles.
J. Microbiol. Methods 2017, 132, 128–133. [CrossRef] [PubMed]
92. Oh, S.; Kim, B.; Lee, J.K.; Choi, S. 3D-printed capillary circuits for rapid, low-cost, portable analysis of blood
viscosity. Sens. Actuators B Chem. 2018, 259, 106–113. [CrossRef]
93. Santangelo, M.F.; Libertino, S.; Turner, A.P.F.; Filippini, D.; Mak, W.C. Integrating printed microfluidics
with silicon photomultipliers for miniaturised and highly sensitive ATP bioluminescence detection. Biosens.
Bioelectron. 2018, 99, 464–470. [CrossRef] [PubMed]
94. Tang, C.K.; Vaze, A.; Rusling, J.F. Automated 3D-printed unibody immunoarray for chemiluminescence
detection of cancer biomarker proteins. Lab Chip 2017, 17, 484–489. [CrossRef] [PubMed]

153
Micromachines 2018, 9, 394

95. Nie, J.; Gao, Q.; Qiu, J.; Sun, M.; Liu, A.; Shao, L.; Fu, J.; Zhao, P.; He, Y. 3D printed Lego® -like modular
microfluidic devices based on capillary driving. Biofabrication 2018, 10, 035001. [CrossRef] [PubMed]
96. Symes, M.D.; Kitson, P.J.; Yan, J.; Richmond, C.J.; Cooper, G.J.T.; Bowman, R.W.; Vilbrandt, T.; Cronin, L.
Integrated 3D-printed reactionware for chemical synthesis and analysis. Nat. Chem. 2012, 4, 349–354.
[CrossRef] [PubMed]
97. Chen, C.; Wang, Y.; Lockwood, S.Y.; Spence, D.M. 3D-printed fluidic devices enable quantitative evaluation of
blood components in modified storage solutions for use in transfusion medicine. Analyst 2014, 139, 3219–3226.
[CrossRef] [PubMed]
98. Bishop, G.W.; Satterwhite-Warden, J.E.; Bist, I.; Chen, E.; Rusling, J.F. Electrochemiluminescence at bare
and dna-coated graphite electrodes in 3D-printed fluidic devices. ACS Sens. 2016, 1, 197–202. [CrossRef]
[PubMed]
99. Zangheri, M.; Cevenini, L.; Anfossi, L.; Baggiani, C.; Simoni, P.; Di Nardo, F.; Roda, A. A simple and compact
smartphone accessory for quantitative chemiluminescence-based lateral flow immunoassay for salivary
cortisol detection. Biosens. Bioelectron. 2015, 64, 63–68. [CrossRef] [PubMed]
100. Suh, Y.K.; Kang, S. A review on mixing in microfluidics. Micromachines 2010, 1, 82–111. [CrossRef]
101. Shallan, A.I.; Smejkal, P.; Corban, M.; Guijt, R.M.; Breadmore, M.C. Cost-effective three-dimensional printing
of visibly transparent microchips within minutes. Anal. Chem. 2014, 86, 3124–3130. [CrossRef] [PubMed]
102. Bishop, G.W.; Satterwhite, J.E.; Bhakta, S.; Kadimisetty, K.; Gillette, K.M.; Chen, E.; Rusling, J.F. 3D-printed
fluidic devices for nanoparticle preparation and flow-injection amperometry using integrated prussian blue
nanoparticle-modified electrodes. Anal. Chem. 2015, 87, 5437–5443. [CrossRef] [PubMed]
103. Patrick, W.G.; Nielsen, A.A.K.; Keating, S.J.; Levy, T.J.; Wang, C.-W.; Rivera, J.J.; Mondragón-Palomino, O.;
Carr, P.A.; Voigt, C.A.; Oxman, N.; et al. DNA assembly in 3D printed fluidics. PLoS ONE 2015, 10, e0143636.
[CrossRef] [PubMed]
104. Kise, D.P.; Reddish, M.J.; Dyer, R.B. Sandwich-format 3D printed microfluidic mixers: A flexible platform for
multi-probe analysis. J. Micromech. Microeng. 2015, 25, 124002. [CrossRef] [PubMed]
105. Plevniak, K.; Campbell, M.; Myers, T.; Hodges, A.; He, M. 3D printed auto-mixing chip enables rapid
smartphone diagnosis of anemia. Biomicrofluidics 2016, 10, 054113. [CrossRef] [PubMed]
106. Mattio, E.; Robert-Peillard, F.; Vassalo, L.; Branger, C.; Margaillan, A.; Brach-Papa, C.; Knoery, J.;
Boudenne, J.-L.; Coulomb, B. 3D-printed lab-on-valve for fluorescent determination of cadmium and lead in
water. Talanta 2018, 183, 201–208. [CrossRef] [PubMed]
107. Guo, T.; Patnaik, R.; Kuhlmann, K.; Rai, A.J.; Sia, S.K. Smartphone dongle for simultaneous measurement
of hemoglobin concentration and detection of HIV antibodies. Lab Chip 2015, 15, 3514–3520. [CrossRef]
[PubMed]
108. Chan, K.; Weaver, S.C.; Wong, P.-Y.; Lie, S.; Wang, E.; Guerbois, M.; Vayugundla, S.P.; Wong, S. Rapid,
affordable and portable medium-throughput molecular device for zika virus. Sci. Rep. 2016, 6, 38223.
[CrossRef] [PubMed]
109. Fernandes, A.C.; Semenova, D.; Panjan, P.; Sesay, A.M.; Gernaey, K.V.; Krühne, U. Multi-function microfluidic
platform for sensor integration. New Biotechnol. 2018, in press. [CrossRef] [PubMed]
110. Li, K.; Wei, H.; Liu, W.; Meng, H.; Zhang, P.; Yan, C. 3D printed stretchable capacitive sensors for highly
sensitive tactile and electrochemical sensing. Nanotechnology 2018, 29, 185501. [CrossRef] [PubMed]
111. Manzanares Palenzuela, C.L.; Novotný, F.; Krupička, P.; Sofer, Z.; Pumera, M. 3D-printed
graphene/polylactic acid electrodes promise high sensitivity in electroanalysis. Anal. Chem. 2018,
90, 5753–5757. [CrossRef] [PubMed]
112. Lind, J.U.; Busbee, T.A.; Valentine, A.D.; Pasqualini, F.S.; Yuan, H.; Yadid, M.; Park, S.-J.; Kotikian, A.;
Nesmith, A.P.; Campbell, P.H.; et al. Instrumented cardiac microphysiological devices via multimaterial
three-dimensional printing. Nat. Mater. 2017, 16, 303–308. [CrossRef] [PubMed]
113. Muth, J.T.; Vogt, D.M.; Truby, R.L.; Mengüç, Y.; Kolesky, D.B.; Wood, R.J.; Lewis, J.A. Embedded 3D printing
of strain sensors within highly stretchable elastomers. Adv. Mater. 2014, 26, 6307–6312. [CrossRef] [PubMed]
114. Lei, Z.; Wang, Q.; Wu, P. A multifunctional skin-like sensor based on a 3D printed thermo-responsive
hydrogel. Mater. Horiz. 2017, 4, 694–700. [CrossRef]
115. Skin to E-Skin. Available online: https://www.nature.com/articles/nnano.2017.228 (accessed on
3 August 2018).

154
Micromachines 2018, 9, 394

116. Shanmugam, A.; Usmani, M.; Mayberry, A.; Perkins, D.L.; Holcomb, D.E. Imaging systems and algorithms
to analyze biological samples in real-time using mobile phone microscopy. PLoS ONE 2018, 13, e0193797.
[CrossRef] [PubMed]
117. Scordo, G.; Moscone, D.; Palleschi, G.; Arduini, F. A reagent-free paper-based sensor embedded in a
3D printing device for cholinesterase activity measurement in serum. Sens. Actuators B Chem. 2018,
258, 1015–1021. [CrossRef]
118. Xiao, W.; Huang, C.; Xu, F.; Yan, J.; Bian, H.; Fu, Q.; Xie, K.; Wang, L.; Tang, Y. A simple and compact
smartphone-based device for the quantitative readout of colloidal gold lateral flow immunoassay strips.
Sens. Actuators B Chem. 2018, 266, 63–70. [CrossRef]
119. Knowlton, S.; Joshi, A.; Syrrist, P.; Coskun, A.F.; Tasoglu, S. 3D-printed smartphone-based point of care tool
for fluorescence- and magnetophoresis-based cytometry. Lab Chip 2017, 17, 2839–2851. [CrossRef] [PubMed]
120. Kühnemund, M.; Wei, Q.; Darai, E.; Wang, Y.; Hernández-Neuta, I.; Yang, Z.; Tseng, D.; Ahlford, A.;
Mathot, L.; Sjöblom, T.; et al. Targeted DNA sequencing and in situ mutation analysis using mobile phone
microscopy. Nat. Commun. 2017, 8, 13913. [CrossRef] [PubMed]
121. Park, J.; Park, H. Thermal cycling characteristics of a 3D-printed serpentine microchannel for DNA
amplification by polymerase chain reaction. Sens. Actuators Phys. 2017, 268, 183–187. [CrossRef]
122. Mulberry, G.; White, K.A.; Kim, B.N. 3D printed real-time PCR machine for infectious disease diagnostics.
Biophys. J. 2017, 112, 462a. [CrossRef]
123. Bianchi, S.; Rajamanickam, V.P.; Ferrara, L.; Fabrizio, E.D.; Liberale, C.; Leonardo, R.D. Focusing and imaging
with increased numerical apertures through multimode fibers with micro-fabricated optics. Opt. Lett. 2013,
38, 4935–4938. [CrossRef] [PubMed]
124. Malinauskas, M.; Žukauskas, A.; Belazaras, K.; Tikuišis, K.; Purlys, V.; Gadonas, R.; Piskarskas, A. Laser
fabrication of various polymer microoptical components. Eur. Phys. J. Appl. Phys. 2012, 58, 20501. [CrossRef]
125. Liberale, C.; Cojoc, G.; Bragheri, F.; Minzioni, P.; Perozziello, G.; Rocca, R.L.; Ferrara, L.; Rajamanickam, V.;
Fabrizio, E.D.; Cristiani, I. Integrated microfluidic device for single-cell trapping and spectroscopy. Sci. Rep.
2013, 3, 1258. [CrossRef] [PubMed]
126. Kirchner, R.; Chidambaram, N.; Schift, H. Benchmarking surface selective vacuum ultraviolet and thermal
postprocessing of thermoplastics for ultrasmooth 3-D-printed micro-optics. Opt. Eng. 2018, 57, 041403.
[CrossRef]
127. Thiele, S.; Arzenbacher, K.; Gissibl, T.; Giessen, H.; Herkommer, A.M. 3D-printed eagle eye: Compound
microlens system for foveated imaging. Sci. Adv. 2017, 3, e1602655. [CrossRef] [PubMed]
128. Zhu, H.; Isikman, S.O.; Mudanyali, O.; Greenbaum, A.; Ozcan, A. Optical imaging techniques for
point-of-care diagnostics. Lab Chip 2013, 13, 51–67. [CrossRef] [PubMed]
129. Singh, M.; Tong, Y.; Webster, K.; Cesewski, E.; Haring, A.P.; Laheri, S.; Carswell, B.; O’Brien, T.J.;
Aardema, C.H.; Senger, R.S.; et al. 3D printed conformal microfluidics for isolation and profiling of
biomarkers from whole organs. Lab Chip 2017, 17, 2561–2571. [CrossRef] [PubMed]
130. Jang, J.; Park, J.Y.; Gao, G.; Cho, D.-W. Biomaterials-based 3D cell printing for next-generation therapeutics
and diagnostics. Biomaterials 2018, 156, 88–106. [CrossRef] [PubMed]
131. Chatzipetrou, M.; Massaouti, M.; Tsekenis, G.; Trilling, A.K.; van Andel, E.; Scheres, L.; Smulders, M.M.J.;
Zuilhof, H.; Zergioti, I. Direct Creation of Biopatterns via a combination of laser-based techniques and click
chemistry. Langmuir 2017, 33, 848–853. [CrossRef] [PubMed]
132. Chatzipetrou, M.; Milano, F.; Giotta, L.; Chirizzi, D.; Trotta, M.; Massaouti, M.; Guascito, M.R.; Zergioti, I.
Functionalization of gold screen printed electrodes with bacterial photosynthetic reaction centers by laser
printing technology for mediatorless herbicide biosensing. Electrochem. Commun. 2016, 64, 46–50. [CrossRef]
133. Schaffner, M.; Rühs, P.A.; Coulter, F.; Kilcher, S.; Studart, A.R. 3D printing of bacteria into functional complex
materials. Sci. Adv. 2017, 3, eaao6804. [CrossRef] [PubMed]
134. Alam, M.N.H.Z.; Hossain, F.; Vale, A.; Kouzani, A. Design and fabrication of a 3D printed miniature pump
for integrated microfluidic applications. Int. J. Precis. Eng. Manuf. 2017, 18, 1287–1296. [CrossRef]
135. 3D Printing: A New Era for Valve Manufacturing? Available online: http://www.valvemagazine.com/web-
only/categories/trends-forecasts/7689-3d-printing-a-new-era-for-valve-manufacturing.html (accessed on
8 May 2018).

155
Micromachines 2018, 9, 394

136. Building Atomic Force Microscope with 3D Printing, Electronics and LEGO. Available online: http://www.ro
baid.com/tech/building-atomic-force-microscope-with-3d-printing-electronics-and-lego.htm (accessed on
8 May 2018).
137. Meloni, G.N.; Bertotti, M. 3D printing scanning electron microscopy sample holders: A quick and cost
effective alternative for custom holder fabrication. PLoS ONE 2017, 12, e0182000. [CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

156
micromachines

Article
A 3D-Printed Millifluidic Platform Enabling Bacterial
Preconcentration and DNA Purification for Molecular
Detection of Pathogens in Blood
Yonghee Kim † , Jinyeop Lee † and Sungsu Park *
School of Mechanical Engineering, Sungkyunkwan University, Suwon 16419, Korea;
[email protected] (Y.K.); [email protected] (J.L.)
* Correspondence: [email protected]; Tel.: +82-31-290-7431
† The authors contributed equally to this work.

Received: 13 August 2018; Accepted: 14 September 2018; Published: 17 September 2018

Abstract: Molecular detection of pathogens in clinical samples often requires pretreatment techniques,
including immunomagnetic separation and magnetic silica-bead-based DNA purification to obtain the
purified DNA of pathogens. These two techniques usually rely on handling small tubes containing a
few millilitres of the sample and manual operation, implying that an automated system encompassing
both techniques is needed for larger quantities of the samples. Here, we report a three-dimensional
(3D)-printed millifluidic platform that enables bacterial preconcentration and genomic DNA (gDNA)
purification for improving the molecular detection of target pathogens in blood samples. The device
consists of two millichannels and one chamber, which can be used to preconcentrate pathogens bound
to antibody-conjugated magnetic nanoparticles (Ab-MNPs) and subsequently extract gDNA using
magnetic silica beads (MSBs) in a sequential manner. The platform was able to preconcentrate very
low concentrations (1–1000 colony forming units (CFU)) of Escherichia coli O157:H7 and extract their
genomic DNA in 10 mL of buffer and 10% blood within 30 min. The performance of the platform
was verified by detecting as low as 1 CFU of E. coli O157:H7 in 10% blood using either polymerase
chain reaction (PCR) with post gel electrophoresis or quantitative PCR. The results suggest that the
3D-printed millifluidic platform is highly useful for lowering the limitations on molecular detection in
blood by preconcentrating the target pathogen and isolating its DNA in a large volume of the sample.

Keywords: immunomagnetic separation (IMS); bacterial pathogen; 3D printing; preconcentration;


DNA purification; molecular diagnostics

1. Introduction
It is important to accurately detect pathogens in clinical samples at very low concentrations [1,2].
Methods for detecting pathogens in clinical samples, such as blood and saliva, include bacterial culture
and polymerase chain reaction (PCR) [3]. However, when detecting pathogens in clinical samples,
there are limitations because of the presence of substances that inhibit PCR [3,4]. Thus, such methods
of detection still require sample pretreatment to isolate the target microorganisms and purify their
nucleic acids [3–5]. Among these pretreatment techniques, immunomagnetic separation (IMS) [5,6] and
magnetic silica bead (MSB)-based DNA purification [7–9] are the most popular. However, these two
technologies usually rely on handling small tubes containing several millilitres of the sample and
manual operation; thus, there is an urgent need for automated systems that can process large volumes
of the samples simultaneously because higher concentrations of purified DNA can be obtained by
preconcentrating the pathogens and purifying DNA from larger volumes of samples.
In the past few decades, microfluidic devices (μFDs) have been developed as platforms that
can detect pathogens [10–12]. In particular, μFDs offer several advantages for detection when

Micromachines 2018, 9, 472; doi:10.3390/mi9090472 157 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 472

integrating IMS. For example, μFDs have a large surface area, thus allowing antibody-conjugated
magnetic nanoparticles (Ab-MNPs) and targeted bacterial cells to quickly bind to each other [13].
In addition, the magnetic interaction between the Ab-MNPs and permanent magnets is very strong
in the thin microchannels of the μFDs, and the bacteria–Ab-MNP complexes can be trapped easily
and quickly [14]. Recently, efforts have been made to extract and isolate target DNA using either
MSBs or IMS in μFDs [7–9,15,16]. However, conventional μFDs [13–16] are typically not suitable for
processing samples larger than 1 mL due to the small dimensions (~1 mm) of their microchannels.
In addition, their fabrication requires multiple layers and several bonding steps, making them difficult
to mass-produce. Most recently, we have demonstrated that a three-dimensional (3D)-printed μFD
(3DpμFD) is an excellent platform for detecting pathogens because of its high speed, integration,
and automation [17]. Compared to photolithography and soft lithography, 3D printing has many
advantages when printing μFDs because this technique easily enables the printing of high aspect ratio
structures and does not require complex binding steps to form a monolithic structure. In recent years,
considerable efforts have been devoted to the development of 3D printing microfluidic platforms for
separation and detection [17–19]. However, to the best of our knowledge, there have been no reports
showing the integration of both IMS and DNA purification functions into a single device.
In the present study, we report a 3D-printed millifluidic device (3DpmFD) that can perform IMS
and DNA purification of the target pathogen in 10 mL or higher volumes of samples. The performance
of the 3DpmFD was tested with Escherichia coli O157:H7 and Staphylococcus aureus in a buffer and
spiked blood samples. The performance of the device was verified by standard methods, such as
colony counting, PCR, and quantitative PCR (qPCR).

2. Materials and Methods

2.1. 3D Printing of the Millifluidic Device


The millifluidic device was 3D-printed using a digital light processing (DLP) 3D printer (IM-96)
(Carima Co., Seoul, Korea). This 3D-printing technique was based on photopolymerisation by emitting
visible light at 405 nm onto a photocurable resin. The 3D sketch of the device was designed using
the Student edition of Inventor® Professional (Autodesk Inc., Seoul, Korea). This 3D sketch was cut
into 100-μm-thick layers in the z-axis direction using the Carima Slicer software and was separated
into 115 layers. Each layer was irradiated for 1.5 s. After the 3D-printing, the printed structure was
washed with 70% ethanol for 5 min to eliminate any uncured resin. Then, the structure was solidified
for 10 min using visible light to improve its mechanical strength. The entire process, including the
solidification step, takes 30 min and does not require any additional assembly steps.
Figure 1a,b show that the 3DpmFD (width × length × height dimensions of 20 × 30 × 10 mm3 )
consists of a cylindrical chamber (diameter: 5 mm, height: 2 mm) connected to two microchannels,
a sample inlet (diameter: 2 mm), and DNA and waste outlets (diameter: 2 mm).

158
Micromachines 2018, 9, 472

Figure 1. Bacterial preconcentration and genomic DNA (gDNA) purification on the three-dimensional
(3D)-printed microfluidic device (μFD) (3DpmFD). (a) Design of the 3DpmFD. (b) A scale image of the
3DpmFD. (c) Schematic of the operational processes: (i) preconcentrating bacteria–Ab-MNP complexes;
(ii) extracting gDNA from the complexes with lysis-binding buffer; (iii) removing buffer and bacterial
debris by withdrawing flow using a pump; and (iv) eluting gDNA from MSBs with elution buffer.

2.2. Bacterial Culture


The bacterial strains used in this study were E. coli O157:H7 (ATCC 43894) (American Type Culture
Collection, Bethesda, MD, USA) and S. aureus (ATCC 29213) (ATCC, The strains were grown overnight
in Luria broth (LB)) (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) at 200 rpm and 37 ◦ C.
The culture was then diluted 100-fold with fresh LB and incubated again at 200 rpm and 37 ◦ C until
the optical density of the sample at 600 nm (OD600 ) was 1. Before preconcentration, the samples were
serially diluted 10 times with phosphate-buffered saline (PBS) (pH 7.4).

2.3. Synthesis of Ab-MNPs


Amine-modified superparamagnetic nanoparticles (MNPs) of 50 nm diameter were purchased
from Chemicell Co. (Berlin, Germany). The MNPs were sonicated for about 40 s to prevent aggregation.
A solution of the MNPs (1 mg/mL) in PBS was then made to react with glutaraldehyde (2.5% v/v) in
PBS at room temperature (RT) for 1 h using a rotary incubator and then washed with borate buffer
(10 mM, pH 7.0) [20]. Aldehyde-functionalised MNPs were then mixed with 50 μg/mL of affinity
purified anti-E. coli O157:H7 antibody (SeraCare Life Sciences Inc., Milford, MA, USA) or affinity
purified anti-S. aureus antibody (SeraCare Life Sciences Inc.) in borate buffer and incubated at RT
overnight. Next, Ab-MNPs were washed with 500 μL of borate buffer and then mixed with 1%
bovine serum albumin (BSA) (Thermo Fisher Scientific, Waltham, MA, USA) in PBS to block unreacted
aldehyde groups on the Ab-MNPs at RT for 1 h. To remove the unbound BSA, the Ab-MNPs were
washed with 500 μL of borate buffer again. Then, the Ab-MNPs were treated with 20 mg/mL of
sodium cyanoborohydride (Sigma-Aldrich, St. Louis, MO, USA) in borate buffer. Finally, the Ab-MNPs
were washed with Tris-HCl buffer (pH 8.0) and stored in PBS at 4 ◦ C until their use.

159
Micromachines 2018, 9, 472

2.4. Effect of Flow Rates on Bacteria Capturing Efficiency in the 3DpmFD


Ten millilitres (10 mL) of PBS containing E. coli O157:H7 at 104 colony-forming units (CFU)/mL
were mixed with 200 μL of MNPs (1013 particles/mL, final concentration) conjugated with
affinity-purified E. coli O157 antibodies and the mixture was incubated at 37 ◦ C and 200 rpm for
20 min in a beaker. Then, the mixture was injected into the 3DpmFD through the sample inlet using a
syringe pump (Harvard Apparatus, Boston, MA, USA) at various flow rates (1–10 mL/min) while
placing a permanent magnet (diameter: 15 mm, height: 1.5 mm, magnetic flux density: 1720 G)
underneath the chamber of the 3DpmFD.
The number of preconcentrated bacterial cells was estimated by counting the difference between
the number of uncaptured bacterial cells and the total number of bacterial cells using the standard
colony counting method [21]. Bacteria capturing efficiency was calculated using the following
equation [17]:
Capturing efficiency (%) = (Nt − Ne)/Nt × 100% (1)

where Nt is the number of bacterial cells in the sample and Ne is the number of uncaptured bacterial
cells in the sample.

2.5. Effect of MSB and Bacterial Concentration on DNA Purification


The 3DpmFD packed with MSBs (Chemicell Co., Berlin, Germany) was prepared by introducing
1 mL of PBS containing different concentrations (109 to 5 × 1010 particles/mL) of MSBs at 2 mL/min
through the sample inlet while placing a permanent magnet under the chamber and closing the DNA
outlet with a plastic pin. Different volumes (1–100 mL) of PBS containing E. coli O157:H7 or S. aureus at
various concentrations (1–105 CFU/mL, final concentration) were first mixed with MNPs conjugated
with antibodies specific to the pathogens and the mixture was incubated at 37 ◦ C and 200 rpm for
20 min in a beaker. Then, the mixture was injected into the 3DpmFD packed with MSBs through the
sample inlet using a syringe pump at 2 mL/min as shown in Figure 1c-i.
To lyse preconcentrated bacterial cells, 100 μL of Lysis and Binding buffer (Chemicell Co.) were
loaded into the chamber as shown in Figure 1c-ii. The 3DpmFD was agitated by the automated
mini-vibration system (DVM-N20 vibration motor, D&J WITH Co., Ltd., Seoul, Korea) at RT for 5 min
and the blocking pins were removed from the 3DpmFD before placing it on the magnet. The buffer was
removed from the chamber through the waste channel, and then 500 μL of washing buffer I (Chemicell
Co.) and 500 μL of 70% ethanol were injected into the 3DpmFD sequentially. For the elution step,
50 μL of RNase free water was loaded into the 3DpmFD without placement on the magnet. After all
the inlets and outlets were blocked with the pins again, the device was agitated on a thermo-shaker
at 1200 rpm and 65 ◦ C for 15 min. Finally, the DNA released from the MSBs was removed from the
device through the DNA outlet.

2.6. Effect of Dilution Factor of Blood on Efficiency of Sample Preparation in 3DpmFD


The use of blood was approved by the Institutional Review Board (IRB) of the university (SKKU)
and its approval number was SKKU 2017-11-006. Whole blood was purchased from Innovative
Research, Inc. (Novi, MI, USA) and this product was treated with 0.1% K2 ethylenediaminetetraacetic
acid (EDTA) to prevent blood coagulation. The hematocrit (hct) value was about 39%, which was
measured using FisherbrandTM Microhematocrit capillary tubes (Fisher Scientific Co LLC, Pittsburgh,
PA, USA) and a MicroHematocrit Centrifuge (Thomas Scientific Inc., Swedesboro, NJ, USA). Then,
1 mL of whole blood containing 105 CFU/mL of E. coli O157:H7 was diluted to 10, 25, and 50% with
PBS and 200 μL of Ab-MNPs.

160
Micromachines 2018, 9, 472

2.7. Bacterial Preconcentration and DNA Purification in Spiked Blood Samples


Then, 1 mL of whole blood was mixed with 8 mL of PBS, 1 mL of E. coli O157:H7 (10–104 CFU/mL),
and 200 μL of Ab-MNPs. The subsequent procedures were the same as those for the bacterial
preconcentration and DNA purification steps.

2.8. Detection of Bacteria by PCR and qPCR Samples


Purified bacterial genomic DNA (gDNA) was amplified by PCR, and the amplification of target
genes was verified by gel electrophoresis. The primers that were designed to amplify the 150-base
pairs (bp) of eae gene coding intimin adherence protein in E. coli O157:H7 consist of a forward
primer (GGCGGATTAGACTTCGGCTA) and a reverse primer (CGTTTTGGCACTATTTGCCC).
The 207-bp of nuc gene coding the thermonuclease of S. aureus consists of a forward
primer (ACACCTGAAACAAAGCATCC) and a reverse primer (TAGCCAAGCCTTGACGAACT).
The conventional PCR was performed using a PCR reagent by MJ MINI™ thermocycler (Bio-RAD,
Hercules, CA, USA). The PCR products were separated in a 1.5% TAE (Tris base, acetic acid, and EDTA)
(50 ×) agarose gel at 100 V for 30 min.
The qPCR was performed using LightCycler® Nano (Roche, Basel, Switzerland), and its cycle
threshold (Ct) value was determined. The same primer sets as those used for the PCR were used here.

3. Results and Discussion

3.1. Effect of Flow Rate on Bacteria Capturing Efficiency in the 3DpmFD


The capturing efficiencies at flow rates of 1, 2, 5, and 10 mL/min were 94%, 92.5%, 62.1%,
and 47.9%, respectively (Figure 2). The results show that it is difficult to capture bacteria–Ab-MNPs
complexes at high flow rates, such as 5 mL/min and 10 mL/min, with the magnetic force of the
permanent magnet located at the bottom of the device. Since there was no statistical difference in
1 mL/min and 2 mL/min, we selected 2 mL/min as a flow rate for the following experiments.

Figure 2. Effect of flow rate on bacteria capturing efficiency in 3DpmFD. Ten millilitres (10 mL)
of PBS containing E. coli O157:H7 (104 CFU/mL) and Ab-MNPs (1013 particles/mL) were injected
into 3DpmFD at different flow rates (1–10 mL/min). *: p < 0.05, ***: p < 0.001. Student t-test.
Sample number = 3.

161
Micromachines 2018, 9, 472

3.2. Optimisation of MSB Concentrations for DNA Purification using 3DpmFD


To find the optimal number for MSBs for DNA purification using the 3DpmFD, it was packed with
different particle numbers (1 × 109 to 5 × 1010 ) of MSBs before introducing 10 mL of PBS containing
103 CFU/mL and Ab-MNPs containing 1013 particles/mL. All the bacteria capturing efficiencies were
about 90%, suggesting that the number of MSBs does not affect the bacterial capturing efficiency on
the 3DpmFD.
Figure 3a shows that gDNA concentrations obtained using the 3DpmFDs increase as MSB
concentrations in the range of 109 to 1010 particles/mL increase. The maximum gDNA concentration
was obtained using the 3DpmFD packed with 1010 particles/mL of MSBs. However, the gDNA
concentrations at 5 × 1010 MSBs/mL were lower than those at 1010 MSBs/mL. This may be
attributed to the fact that 50 μL of the elution buffer was not sufficient to fully wet the MSBs in
the 3DpmFD. Thus, some DNA might not have been released from some of the MSBs, resulting in
lower gDNA concentrations.

Figure 3. Effect of MSB and bacteria concentrations on DNA purification on the 3DpmFD: (a) gDNA
concentration with different concentrations (109 –5 × 1010 particles/mL) of MSBs for 103 CFU/mL of E.
coli O157:H7; (b) gDNA concentration with different concentrations (1–105 CFU/mL) of E. coli O157:H7
using 1010 particles/mL of MSBs *: p < 0.05, ***: p < 0.001. Student t-test. Sample number = 3.

When the 3DpmFDs packed with 1010 MSBs/mL were injected along with 10 mL of PBS containing
E. coli O157:H7 at different concentrations (1–105 CFU/mL) at a rate of 2 mL/min, the gDNA
concentration obtained using the 3DpmFDs increased as the bacterial concentrations increased in the
range of 1 to 103 CFL/mL, but did not increase any further at concentrations of 104 and 105 CFU/mL
(Figure 3b), thus indicating that the surfaces of the MSBs were saturated with gDNA at such high
concentrations. For such high concentrations, the sample solutions should be diluted to obtain
accurate measurements.

3.3. Effect of Preconcentration and gDNA Purification Using 3DpmFD on Molecular Amplification of Genes
in PBS
Once 10 mL of the Gram-negative pathogen E. coli O157:H7 at different concentrations
(1–103 CFU/mL) was preconcentrated and its gDNA was purified in a sequential manner using
the 3DpmFD, the gDNA was amplified using either PCR or qPCR to verify the yield. The results

162
Micromachines 2018, 9, 472

were compared to those obtained from either untreated samples or samples prepared with only the
preconcentration step using 3DpmFD. In the samples with the preconcentration–purification steps,
a concentration as low as 1 CFU/mL was detectable using PCR with gel electrophoresis (Figure 4c),
whereas in the untreated samples and samples with only the preconcentration step, concentrations
as low as 103 CFU/mL and 10 CFU/mL were detectable, respectively (Figure 4a,b). A similar trend
was observed with qPCR. Considering that Ct values below 35 are reliable, a concentration as low as
1 CFU/mL was detectable in the samples with the preconcentration–purification steps using qPCR
because its Ct value was 30.7 (Figure 4f). Concentrations as low as 103 CFU/mL and 10 CFU/mL
were respectively detectable in the untreated samples and samples with only the preconcentration step
because their respective Ct values were 30.8 and 33.4 (Figure 4d,e). This remarkable improvement in
the samples with the preconcentration–purification steps in detection using PCR and qPCR can be
explained as follows. In the sample with only the preconcentration step, the Ab-MNPs can improve the
detection by providing higher numbers of bacterial cells to the PCR and qPCR. However, Ab-MNPs and
cell debris can inhibit DNA polymerase, so that the benefit offered by the bacterial preconcentration is
decreased due to the modest interference from Ab-MNPs and cell debris in DNA amplification [22].
By including both preconcentration and purification steps in the 3DpmFD, only purified gDNA can be
provided to the PCR and qPCR. This results in the enhancement in detection using PCR and qPCR.

Figure 4. Confirmation of E. coli O157:H7 preconcentrating and DNA purifying efficiency using either
PCR with gel electrophoresis and qPCR; (a) Gel electrophoresis of PCR products (eae gene) from 10 mL
PBS containing E. coli O157:H7 at different concentrations (1–103 CFU/mL) before preconcentration;
(b) after preconcentration; (c) after bacterial preconcentration and DNA purification; (d–f) qPCR results
of (a–c), respectively.

The performance of the 3DpmFDs were further tested by preconcentrating the Gram-positive
pathogen S. aureus at different concentrations (1–103 CFU/mL) and purifying its gDNA using
the 3DpmFD. Similar to the results (Figure 4) for E. coli O157:H7, significant improvements in
the detection of S. aureus by both molecular diagnostics techniques, PCR post gel electrophoresis
and qPCR, were observed in the samples with the preconcentration–purification steps. The lowest
concentration for the detection in the samples with both preconcentration–purification steps using

163
Micromachines 2018, 9, 472

PCR post gel electrophoresis was 102 CFU/mL (Figure 5c), whereas those for the samples with only
the preconcentration step were 103 CFU/mL (Figure 5b). However, S. aureus at all the concentrations
(1–103 CFU/mL) in the untreated samples was not detectable (Figure 5a). A similar trend was
observed using qPCR. The cell walls of Gram-positive bacteria are thicker than those of the
Gram-negative ones [7] and are hard to lyse by thermocycling of PCR. As a result, even at 103 CFU/mL,
the concentration of gDNA released from the lysed cells was not sufficient to be detected using PCR
gel electrophoresis and qPCR. With the preconcentration step, bacterial numbers increased and their
gDNA was detectable in the sample containing 103 CFU/mL. Further improvement in the detection
was possible when the preconcentration and purification steps were included in the 3DpmFD because
the Lysis and Binding buffer in the DNA purification step induces cell lysis. Together with the
results in samples containing E. coli O157:H7, these results suggest that gDNA purification is required
as an addition in the 3DpmFD to improve the detection of bacterial pathogens using molecular
diagnostic methods.

Figure 5. Confirmation of Staphylococcus aureus preconcentrating and DNA purifying efficiency using
PCR with gel electrophoresis and qPCR; (a) Gel electrophoresis of PCR products (nuc gene) from 10 mL
PBS containing S. aureus at different concentrations (1–103 CFU/mL) before preconcentration; (b) after
preconcentration; (c) after bacterial preconcentration and DNA purification; (d–f) qPCR results of
(a–c), respectively.

3.4. Dilution Effect on Preconcentration–Purification Efficiency in Blood Samples


We investigated the effect of dilution of blood on the preconcentration–purification efficiency by
3DpmFD. The bacteria capturing efficiency increased as the dilution factor increased. It was about 82%
in the whole blood, while it was about 100% in 10% blood. These results suggest that the capturing
efficiency was negatively affected by blood and blood dilution is required for the preconcentration
step (Figure S1).
Post gel electrophoresis with PCR (Figure 6a) shows that blood should be diluted at least 50% to
detect 105 CFU/ml of E. coli O157:H7 in the blood samples (Figure 6a). A similar trend was observed
in the qPCR result (Figure 6b). There, 105 CFU/ml of E. coli O157:H7 in all the diluted blood samples
was detectable because their Ct values were lower than 35. However, Ct values increased as the ratio

164
Micromachines 2018, 9, 472

of blood in the diluted blood samples increased, suggesting that the ratio of blood should be lowered
to 10%.

Figure 6. Confirmation of effect of dilution factor of blood on preconcentrating and gDNA purification
efficiency with E. coli O157:H7 using PCR with gel electrophoresis and qPCR; (a) Gel electrophoresis of
PCR products (eae gene) from different blood dilutions (10, 25, 50, and blood) containing 105 CFU/mL
of E. coli O157:H7 after bacterial preconcentration and DNA purification; (b) qPCR result.

3.5. Spike Test in 10% Blood


Blood has a lot of molecular diagnostic inhibitors, such as hematin and haemoglobin, and they
prevent the action of Taq polymerase [23]. IgG in the blood also interferes with the activation of
Taq polymerase as it interacts with single-strand DNA at high temperatures [24]. To minimize this
inhibitory effect on molecular amplification, users have to use commercial kits and systems for
purifying bacterial DNA from blood [25–28]. The QIAamp blood mini kit can purify DNA in 200 μL
of blood without any dilution but cannot differentiate bacterial DNA from the DNA of blood cells.
Microfluidic devices are not suitable for processing a large volume of samples, such as 10 mL, due to
its slow flow rates in the range of 1–10 μL/min [27,29]. The hollow spinning disk system does not
require the dilution of blood samples but only about 40% of bacteria can be isolated from the plasma by
the system [30]. Figure 7 shows that the performance of the 3DpmFD for the sample preparation from
10 mL of 10% diluted blood with E. coli O157:H7 is excellent because E. coli O157:H7 can be detected
for a concentration of up to 1 CFU/mL with the preconcentration and purification steps, which is 100
and 10 times lower than without sample treatment (Figure 7a,b). These results are also confirmed by
qPCR through the difference between the Cq values of the samples (Figure 7d–f). The Cq value of
the 1 CFU/mL is 30.6 and that of the 103 CFU/mL without sample preparation is 33.8. These results
suggest that the 3DpmFD can selectively preconcentrate the bacterial pathogen of interest and purify
bacterial DNA from diluted blood samples.
For this reason, Figure 7a shows that the limit of detection is 103 CFU/mL without sample
preparation. Thus, it is very hard to detect pathogens in blood samples using PCR without any sample
preparation steps. However, Figure 7c shows that the 3DpmFD can eliminate the molecular diagnostic
inhibitors effectively. This is equivalent to a 50-fold improvement of sensitivity compared with the
microfluidic device for the detection of E. coli O157:H7 in 10% blood [31]. These results suggest that

165
Micromachines 2018, 9, 472

3DpmFD is well-suited for improving the level of detection (LOD) in blood by including both bacterial
preconcentration and DNA purification steps.

Figure 7. Confirmation of preconcentrating and DNA purification efficiency of E. coli O157:H7 in 10%
blood using PCR with post gel electrophoresis after PCR (a–c) and qPCR (d–f). (a) Gel electrophoresis of
PCR products (eae gene) from 10 mL of 10% blood containing E. coli O157:H7 at different concentrations
(1–103 CFU/mL) without preconcentration; (b) after preconcentrating; (c) after preconcentrating and
DNA purification; (d–f) qPCR results of (a–c), respectively.

4. Conclusions
In this study, we report an improvement in detection for molecular diagnostics by successfully
integrating both bacterial preconcentration and DNA purification in the 3DpmFD. The performance
of the 3DpmFD shows that it is possible to preconcentrate very low concentrations of pathogens in
10 mL of 10% blood within 30 min, and 1 CFU/mL of E. coli O157:H7 can be detected by either PCR
with post gel electrophoresis or qPCR. These results demonstrate that it is highly useful for improving
molecular diagnostic methods in blood samples with the addition of the DNA purification step.

Supplementary Materials: The following are available online at t http://www.mdpi.com/2072-666X/9/9/472/s1,


Figure S1: The effect of the dilution factor of blood on capturing efficiency with 103 CFU/mL of E. coli O157:H7 *:
p < 0.05, Student’s t-test. Sample number = 3.
Author Contributions: Conceptualisation, Y.K. and S.P.; Methodology, Y.K. and J.L.; Data Curation, Y.K. and J.L.;
Writing (Original Draft Preparation), Y.K. and J.L.; Writing (Review & Editing), J.L. and S.P.; Supervision, S.P.
Acknowledgments: This research was supported by the BioNano Health-Guard Research Center as a Global
Frontier Project (H-guard NRF-2018M3A6B2057299) through the National Research Foundation (NRF) of the
Ministry of Education, Science and Technology (MEST) in Korea.
Conflicts of Interest: The authors declare no conflict of interest.

166
Micromachines 2018, 9, 472

References
1. Yang, L.; Banada, P.P.; Chatni, M.R.; Lim, K.S.; Bhunia, A.K.; Ladisch, M.; Bashir, R. A multifunctional
micro-fluidic system for dielectrophoretic concentration coupled with immuno-capture of low numbers of
listeria monocytogenes. Lab Chip. 2006, 6, 896–905. [CrossRef] [PubMed]
2. Hara-Kudo, Y.; Takatori, K. Contamination level and ingestion dose of foodborne pathogens associated with
infections. Epidemiol. Infect. 2011, 139, 1505–1510. [CrossRef] [PubMed]
3. Varshney, M.; Li, Y.; Srinivasan, B.; Tung, S. Microfluidics and interdigitated array microelectrode-based
impedance biosensor in combination with nanoparticles immunoseparation for detection of Escherichia coli
O157:H7 in food samples. Sens. Actuators B Chem. 2007, 128, 99–107. [CrossRef]
4. Pengsuk, C.; Chaivisuthangkura, P.; Longyant, S.; Sithigorngul, P. Development and evaluation of a highly
sensitive immunochromatographic strip test using gold nanoparticle for direct detection of Vibrio cholerae
O139 in seafood samples. Biosens. Bioelectron. 2013, 42, 229–235. [CrossRef] [PubMed]
5. Weagent, S.D.; Bound, A.J. Evaluation of techniques for enrichment and isolation of Escherichia coli O157:H7
from artificially contaminated sprouts. Int. J. Food. Microbiol. 2001, 71, 87–92. [CrossRef]
6. Banada, P.P.; Chakravorty, S.; Shah, D.; Burday, M.; Mazzella, F.M.; Alland, D. Highly sensitive detection of
Staphylococcus aureus directly from patient blood. PLoS ONE 2012, 7, 31126. [CrossRef] [PubMed]
7. Chung, Y.C.; Jan, M.S.; Lin, Y.C.; Lin, J.H.; Cheng, W.C.; Fan, C.Y. Microfluidic chip for high efficiency DNA
extraction. Lab Chip. 2004, 4, 141–147. [CrossRef] [PubMed]
8. Karle, M.; Miwa, J.; Czilwik, G.; Auwärter, V.; Roth, G.; Zengerle, R.; von Stetten, F. Continuous microfluidic
DNA extraction using phase-transfer magnetophoresis. Lab Chip. 2010, 10, 3284–3290. [CrossRef] [PubMed]
9. Geng, T.; Bao, N.; Sriranganathanw, N.; Li, L.; Lu, C. Genomic DNA extraction from cells by electroporation
on an integrated microfluidic platform. Anal. Chem. 2012, 84, 9632–9639. [CrossRef] [PubMed]
10. Azimi, S.M.; Nixon, G.; Ahern, J.; Balachandran, W. A magnetic bead-based DNA extraction and purification
microfluidic device. Microfluid. Nanofluid. 2011, 11, 157–165. [CrossRef]
11. Witek, M.A.; Llopis, S.D.; Wheatley, A.; McCarley, R.L.; Soper, S.A. Purification and preconcentration
of genomic DNA from whole cell lysates using photoactivated polycarbonate (PPC) microfluidic chips.
Nucleic Acids Res. 2006, 34, e74. [CrossRef] [PubMed]
12. Mahalanabis, M.; Al-Muayad, H.; Kulinski, M.D.; Altman, D.; Klapperich, C.M. Cell lysis and DNA extraction
of gram-positive and gram-negative bacteria from whole blood in a disposable microfluidic chip. Lab Chip.
2009, 9, 2811–2817. [CrossRef] [PubMed]
13. Xia, N.; Hunt, T.P.; Mayers, B.T.; Alsberg, E.; Whitesides, G.M.; Westervelt, R.M.; Ingber, D.E. Combined
microfluidic-micromagnetic separation of living cells in continuous flow. Biomed. Microdevices 2006, 8, 299.
[CrossRef] [PubMed]
14. Ganesh, I.; Tran, B.M.; Kim, Y.; Kim, J.; Cheng, H.; Lee, N.Y.; Park, S. An integrated microfluidic PCR system
with immunomagnetic nanoparticles for the detection of bacterial pathogens. Biomed. Microdevices 2016,
18, 116. [CrossRef] [PubMed]
15. Jayamohan, H.; Gale, B.K.; Minson, B.; Lambert, C.J.; Gordon, N.; Sant, H.J. Highly sensitive bacteria
quantification using immunomagnetic separation and electrochemical detection of guanine-labeled
secondary beads. Sensors 2015, 15, 12034–12052. [CrossRef] [PubMed]
16. Lein, K.Y.; Liu, C.J.; Lin, Y.C.; Kuo, P.L.; Lee, G.B. Extraction of genomic DNA and detection of single
nucleotide polymorphism genotyping utilizing an integrated magnetic bead-based microfluidic platform.
Microfluid. Nanofluid. 2009, 6, 539–555. [CrossRef]
17. Park, C.; Lee, J.; Kim, Y.; Lee, J.; Park, S. 3D-Printed microfluidic magnetic preconcentrator for the
detection of bacterial pathogen using an atp luminometer and antibody-conjugated magnetic nanoparticles.
J. Microbiol. Methods 2017, 132, 128–133. [CrossRef] [PubMed]
18. Lee, W.; Kwon, D.; Choi, W.; Jung, G.Y.; Au, A.K.; Folch, A.; Jeon, S. 3D-Printed microfluidic device for the
detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.
Sci. Rep. 2015, 5, 7717. [CrossRef] [PubMed]
19. Lee, W.; Kwon, D.; Chung, B.; Jung, G.Y.; Au, A.; Folch, A.; Jeon, S. Ultrarapid detection of pathogenic
bacteria using a 3D immunomagnetic flow assay. Anal. Chem. 2014, 86, 6683–6688. [CrossRef] [PubMed]

167
Micromachines 2018, 9, 472

20. Zhao, L.; Yang, B.; Dai, X.; Wang, X.; Gao, F.; Zhang, X.; Tang, J. Glutaraldehyde mediated conjugation of
amino-coated magnetic nanoparticles with albumin protein for nanothermotherapy. J. Nanosci. Nanotechnol.
2010, 10, 7117–7120. [CrossRef] [PubMed]
21. Herigstad, B.; Hamilton, M.; Heersink, J. How to optimize the drop plate method for enumerating bacteria.
J. Microbiol. Methods 2001, 44, 121–129. [CrossRef]
22. Higashi, T.; Minegishi, H.; Nagaoka, Y.; Fukuda, T.; Echigo, A.; Usami, R.; Maekawa, T.; Hanajiri, T. Effects
of superparamagnetic nanoparticle clusters on the polymerase chain reaction. Appl. Sci. 2012, 2, 303–314.
[CrossRef]
23. Akane, A.; Matsubara, K.; Nakamura, H.; Takahashi, S.; Kimura, K. Identification of the heme compound
copurified with deoxyribonucleic acid (DNA) from bloodstrains, a major inhibitor of polymerase chain
reaction (PCR) amplification. J. Forensic Sci. 1994, 39, 362–372. [CrossRef] [PubMed]
24. Al-Soud, W.A.; Jönsson, L.J.; Rådström, P. Identification and characterization of immunoglobulin G in blood
as a major inhibitor of diagnostic PCR. J. Clin. Microbiol. 2000, 38, 345–350. [PubMed]
25. Hassan, M.M.; Ranzoni, A.; Cooper, M.A. A nanoparticle-based method for culture-free bacterial DNA
enrichment from whole blood. Biosens. Bioelectron. 2018, 99, 150–155. [CrossRef] [PubMed]
26. Lopes, A.L.K.; Cardoso, J.; dos Santos, F.R.C.C.; Silva, A.C.G.; Stets, M.I.; Zanchin, N.I.T.; Soares, M.J.;
Krieger, M.A. Development of a magnetic separation method to capture sepsis associated bacteria in blood.
J. Microbiol. Methods 2016, 128, 96–101. [CrossRef] [PubMed]
27. Zelenin, S.; Hansson, J.; Ardabili, S.; Ramachandraiah, H.; Brismar, H.; Russom, A. Microfluidic-based
isolation of bacteria from whole blood for sepsis diagnostics. Biotechnol. Lett. 2015, 37, 825–830. [CrossRef]
[PubMed]
28. Jin, C.E.; Koo, B.; Lee, E.Y.; Kim, J.Y.; Kim, S.-H.; Shin, Y. Simple and label-free pathogen enrichment via
homobifunctional imidoesters using a microfluidic (slim) system for ultrasensitive pathogen detection in
various clinical specimens. Biosens. Bioelectron. 2018, 111, 66–73. [CrossRef] [PubMed]
29. Wu, Z.; Willing, B.; Bjerketorp, J.; Jansson, J.K.; Hjort, K. Soft inertial microfluidics for high throughput
separation of bacteria from human blood cells. Lab Chip. 2009, 9, 1193–1199. [CrossRef] [PubMed]
30. Alizadeh, M.; Wood, R.L.; Buchanan, C.M.; Bledsoe, C.G.; Wood, M.E.; McClellan, D.S.; Blanco, R.;
Ravsten, T.V.; Husseini, G.A.; Hickey, C.L.; et al. Rapid separation of bacteria from blood—Chemical
aspects. Colloids Surf. B 2017, 154, 365–372. [CrossRef] [PubMed]
31. Wang, S.; Inci, F.; Chaunzwa, T.L.; Ramanujam, A.; Vasudevan, A.; Subramanian, S.; Chi Fai Ip, A.;
Sridharan, B.; Gurkan, U.A.; Demirci, U. Portable microfluidic chip for detection of Escherichia coli in
produce and blood. Int. J. Nanomed. 2012, 7, 2591.

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

168
micromachines

Article
Fabrication of a Malaria-Ab ELISA Bioassay Platform
with Utilization of Syringe-Based and 3D Printed
Assay Automation
Christopher Lim 1 , Yangchung Lee 1 and Lawrence Kulinsky 2, *
1 Department of Chemical Engineering and Materials Science, University of California, Irvine,
916 Engineering Tower, Irvine, CA 92627-2575, USA; [email protected] (C.L.);
[email protected] (Y.L.)
2 Department of Mechanical and Aerospace Engineering, University of California, Irvine,
5200 Engineering Hall, Irvine, CA 92627-2700, USA
* Correspondence: [email protected]; Tel.: +1-949-824-6769

Received: 30 August 2018; Accepted: 30 September 2018; Published: 2 October 2018

Abstract: We report on the fabrication of a syringe-based platform for automation of a colorimetric


malaria-Ab assay. We assembled this platform from inexpensive disposable plastic syringes,
plastic tubing, easily-obtainable servomotors, and an Arduino microcontroller chip, which allowed
for system automation. The automated system can also be fabricated using stereolithography (SLA)
to print elastomeric reservoirs (used instead of syringes), while platform framework, including rack
and gears, can be printed with fused deposition modeling (FDM). We report on the optimization of
FDM and SLA print parameters, as well as post-production processes. A malaria-Ab colorimetric test
was successfully run on the automated platform, with most of the assay reagents dispensed from
syringes. Wash solution was dispensed from an SLA-printed elastomeric reservoir to demonstrate
the feasibility of both syringe and elastomeric reservoir-based approaches. We tested the platform
using a commercially available malaria-Ab colorimetric assay originally designed for spectroscopic
plate readers. Unaided visual inspection of the assay solution color change was sufficient for
qualitative detection of positive and negative samples. A smart phone application can also be
used for quantitative measurement of the assay color change.

Keywords: diagnostics; liquid handling; microfluidics; multiplex assays and technology;


stereolithography; sample preparation; 3D printing

1. Introduction

1.1. Preface
Lab-on-a-chip systems are used to perform personalized health diagnostic tests (like bioassays)
away from the lab [1]. Implementation of bioassay automation reduces the cost of medical personnel
and diminishes the incidence of human errors [2,3]. Point-of-care (POC) diagnostic platforms are
required to have low cost, low power use, be reliably automated, and free of sophisticated detection
technologies [4]. POC platforms have already been realized in the form of lateral flow immunoassays
(pregnancy tests) and paper fluidic colorimetric assays [5]. Unfortunately, the aforementioned POC
devices are based on capillary flow, and therefore do not work well when more complex multi-step
bioassays are performed [6]. In these cases, some other fluid propulsion mechanisms instead of
capillary flow are required. There are many POC devices that rely on active propulsion techniques,
like centrifugal propulsion, electrowetting, and magnetic beads [7,8]. These tests typically entail
increased fabrication and material cost, complex automation schemes, and sophisticated hardware.

Micromachines 2018, 9, 502; doi:10.3390/mi9100502 169 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 502

In this work, we developed two distinct approaches for the realization of an inexpensive
automated colorimetric immunoassay with multiple wash steps: (1) A fused deposition modeling
(FDM)-printed (non-disposable) frame was used and a disposable fluidic chip that includes an
elastomeric dome and fluidic channels fabricated using SLA, was printed, where the fluidic
movement was facilitated by servomotors pushing on the elastomeric dome, and propelling the
reagents or wash from the domed reservoirs through fluidic channels to the test chamber, or (2) an
FDM-printed non-disposable frame was used, with servomotors connected to standard inexpensive
and readily-available disposable plastic syringes filled with wash and reagents to automate the steps
of the assay.
Draining of the test chamber was performed with a syringe attached to a servomotor,
where negative pressure was created by the pulling on the syringe plunger. All automation was
controlled by a program uploaded to the Arduino-based electronic board of the platform via a computer.
The test results of the colorimetric bioassay can be assessed by eye (for qualitative measurements) or
with a smart phone for quantitative measurement, and e-mailed or texted to a hospital or doctor’s
office [9,10]. In this work, we created a proof-of-principle platform that utilized elements of both
approaches (1) and (2), as outlined above.
We used plastic syringes for most of the platform reagent reservoirs, including drainage and waste.
The wash reservoir consisted of an SLA-printed elastomeric dome. Thus, the feasibility of both
approaches was tested at the same time. The automated platform demonstrated in the presented work
proved the viability of both approaches: (1) Construction of an automated bioassay platform using
syringes only, or (2) a printed dome-based bioassay platform. To our knowledge, this study constitutes
the first demonstration of an SLA-based dome bioassay platform and a syringe-based automated
bioassay platform. The concepts developed in the present work build on prior research that utilized
FDM to fabricate a fluidic chip with embedded microchannels [11]. Fluid leakage was a recurring issue
in the design, due to the layer-by-layer deposition nature of FDM. Our present fabrication approach
utilizes syringes and photocurable resin crosslinked using SLA, thus mitigating the problem of fluid
leakage. The present platform employs FDM printing for the fabrication of parts that are not in contact
with fluids, such as the non-disposal platform frame and the gear/rack mechanisms. Additionally,
the prior fluidic platform design used molded silicone domes that needed to be sealed to the body of
3D printed fluidic chip. Our present fabrication route avoids the need to seal the domes to the plastic
chip by 3D-printing the integrated dome.
The proposed approach is useful in making POC bioassays more widespread. All of the parts and
materials required for the demonstrated platforms are inexpensive and widely available. For example,
a hospital in rural India with an FDM printer could be sent a stereolithography file (STL file) to print
a frame. The Arduino electronic board and other parts, such as servomotors, can be easily acquired.
All the parts and materials to produce our automated platform cost less than $100, while all disposable
materials, including syringes, tubing, and reagents, cost around $5 per test.
If an exclusively syringe-based platform is utilized, the only disposable parts needed are plastic
syringes. The syringes would be filled with a prescribed volume of reagents, and the required program
uploaded to the Arduino board. This approach provides the most flexibility to perform a wide range
of bioassays on the spot, as it does not require all the reagents in typical pre-packaged volumes.
This simplifies assay logistics, including that of cold storage of reagents [12]. We expect that our
proposed recipes and programs will be readily available for download by non-profit organizations
and reagent makers.
There is a growing interest in manufacturing functional parts inexpensively with high-aspect-ratio
geometry and complex topologies [13]. Additive manufacturing (AM), including various types of 3D
printing, is an increasingly popular form of fabrication [14]. The AM process requires a part to be
designed using a CAD program, such as SolidWorks, followed by the extrapolation of the structural
information into an STL file. The STL file partitions the CAD drawing into a series of volumetric
pixels, which are digitally sliced into layers along the Z direction [15]. These layers are physically

170
Micromachines 2018, 9, 502

deposited onto a substrate in layer-by-layer manner, using various AM methods, including FDM
and SLA. FDM and SLA accommodate a variety of material choices, including elastomeric materials,
allowing for the fabrication of flexible parts such as the dome-based elastic pumps presented in
this work.
In this work, we conducted a brief review of microfluidic device fabrication methods,
and emphasized recent developments in additive manufacturing. We followed this review with
a description of the fabrication processes selected for our bioassay platform. Lastly, we detailed an
outline of our experimental procedures, and described the experimental results of a malaria bioassay
performed on our automated platform.

1.2. Fabrication Techniques for Microfluidic Devices


The first traditional microfluidic devices were fabricated using glass and silicon, utilizing mostly a
toolbox of lithographic techniques employed in the semiconductor industry [16]. Equipment selection
was subsequently further developed to include femtosecond lasers to fabricate glass microfluidic
chips [17,18], and the selection of materials employed for fluidic chips was also expanded to include
such materials as “liquid Teflon” [19] and environmentally-sensitive materials such as hydrogels [20].
With the advent of soft lithography and 3D printing, there was a push to develop inexpensive and
reliable microfluidic platforms with biocompatible plastics and resins, demonstrated by the recent
fabrication trends outlined below [21–24].

1.2.1. Soft Lithography


Soft lithography is based on a three-step process where microfabrication techniques are first used
to produce a reusable mold, which is then filled with a curable epoxy Polydimethylsiloxane (PDMS)
and subsequently separated from the mold after an appropriate curing time. The molded part is
typically attached to a glass substrate using plasma treatment [25]. The soft lithography approach
allows for the usage of more expensive high-precision cleanroom lithographic techniques to produce
a mold. Once the mold is produced, it can be used multiple times to fabricate identical fluidic chips,
dramatically reducing the cost of individual fluidic microdevices.
The soft lithography approach has allowed for much more widespread adoption of lab-on-a-chip
devices, and for the production of intricate parts such as elastomeric valves. For example, the PDMS
valves used by the Quake group have facilitated the implementation of large-scale microfluidic
bioreactors for drug discovery and other applications [26]. However, when the device is assembled
from separately produced parts, the manufacturability is restricted, due to cumbersome alignment,
bonding, and assembly [24,27].
3D printing presents an approach where a complete microfluidic device is produced without
post-processing alignment and assembly steps. Commercial 3D printers are beginning to challenge the
resolutions achievable by soft lithography [28].

1.2.2. Inkjet 3D Printing (i3DP)


Inkjet 3D printing is based on inkjet technology and can operate in continuous or
drop-on-demand mode. To achieve high accuracy performance in i3DP, there are four critical
elements that must be considered: ink material, substrate properties, printing platform, and droplet
generation [29]. Inconsistency or change in any of the parameters affects the process reliability.
To maintain steady performance, i3DP needs to be used regularly; the clogging of apertures in a
print head due to drying of the ink is a persistent problem. There is considerable cost involved
in changing from one material to another, since the previous material must be flushed out by the
new resin.
One of the greatest advantages of i3DP is its ability to deliver multiple materials at the same
time during the fabrication process, allowing for a wide range of material properties (hard and soft
plastics, elastomers), and the utilization of inks of different color [30,31]. Creating prototypes with

171
Micromachines 2018, 9, 502

smooth finishes and complex shapes is possible with i3DP; flow channels have been integrated with
porous semi-permeable membranes supporting cell culture to study the transport and profiling of
drugs [32,33].
Hwang et al. utilized i3DP to print pillars with a diameter of 250 μm and found that the resolution
of the process depended on the droplet size, the printer nozzle spacing, and the reflow of the material
prior to UV curing. These factors affected the droplet spreading, changing the final dimensions of the
printed devices [34].
Paydar et al. examined multi-material 3D printing for microfluidic interconnects. They fabricated
a specialized interconnector part, composed of two rigid clamps for the mechanical attachment of a
flexible elastomeric O-ring gasket to a microfluidic device. The parts were printed in a single step,
eliminating the need for adhesives or additional assembly. While the cost of manufacturing was low,
the interconnector was characterized by low maximum sealing pressure due to material fatigue [35].

1.2.3. Two-Photon Polymerization (2PP)


Two-photon polymerization (2PP) is a laser-based technique that utilizes a femtosecond laser to
create 3D structures in the bulk of photocurable epoxy resin, employing a highly localized process
where two photons are absorbed simultaneously by the molecule being cured [36]. The synergistic
effects of optical, chemical, and material non-linearity make it possible to achieve reproducible
resolution of tens of nanometers [37].
2PP has shown great potential for fabrication in microfluidics. Kumi et al. described the fabrication
of a master for casting PDMS with rectangular microchannels of high aspect ratios by modifying SU-8
resist (material for the master) with a photoacid generator that then allows for the use of 2PP on
SU-8 resist. By using the modified resin, the fabrication speed was also increased from 200 μm·s−1 to
10,000 μm·s−1 with a print time of 1 h. This technique required extensive resin preparation and had a
slow build speed [38].
Kawata et al. achieved resolutions of 120 nm, and other attempts included the use of new
photo-initiators, a continuous scanning mode, a shorter wavelength, a longer exposure time,
and confining the polymerization phenomenon using a quencher molecule [39]. Sugioka et al.
conducted a comprehensive review of the fundamentals and fabrication of 3D micro- and
nano-components based on 2PP [40].
While 2PP currently produces the highest resolution for microfabricated three-dimensional
structures, it is a very time-consuming process: the time required to fabricate a 1 mm3 volume
microfluidic structure exceeds 104 days [41]. The high cost of femtosecond lasers, positioning systems,
optics, and the difficulty of working with multi-material systems are some factors hindering the
utilization of 2PP for the mass-production of microfluidic devices.

1.2.4. Fused Deposition Modeling (FDM)


FDM is one of the most widely used additive manufacturing techniques. Many polymers used
with FDM techniques are inherently biocompatible [42]. In FDM, filament material is extruded through
nozzles and deposited onto a heated substrate [43]. Due to the inherent propensity of melted fiber
to solidify as a line, there are limitations in the dimensional accuracy and the surface texture of the
produced parts, resulting in a staircase pattern that is ubiquitous on many parts that are produced
with FDM.
Lee et al. printed microfluidic features via FDM and evaluated the printing resolution, accuracy,
biocompatibility, and surface roughness of acrylonitrile butadiene styrene (ABS) with P430 filament.
They found that the accuracy of the printed features had an average deviation of 60.8 μm and 71.5 μm
along the Y and X axis, respectively. The surface of the printed channels was rough with protruding
filament strands [44].
Kitson et al. fabricated polypropylene reactionware with cylindrical channels 0.8 mm in diameter.
The devices could be fabricated in a few hours and could avoid blockages due to the formation of

172
Micromachines 2018, 9, 502

precipitates. The potential of 3D manufacturing was demonstrated by stopping mid-point in the


fabrication process to deposit solid reagents into a chamber, which was then sealed with the printer.
This is a valuable feature not so easily realized with i3DP or stereolithography [45].
Bishop et al. created a semi-transparent fluidic device using poly(ethyleneterephthalate) with
threaded ports, enabling the integration of commercial tubing as well as specially designed 3D
fittings [46]. The transparent device included 800 μm × 800 μm square channels. A low-cost desktop
Makerbot (New York, NY, USA) 3D printer was used for fabrication of the device. Prussian blue
nanoparticles were synthesized in their lab and mixed in a 3D printed channel and applied to electrode
surfaces for sensing of H2 O2 .
Recently, Dolomite (Royston, UK) launched a production line that offered an FDM printer
specifically designed for fabrication of microfluidic platforms [47]. The printer head design allowed
for reliable printing of cyclic olefin copolymer (COC). Their new software guided the production to
guarantee smooth surface finish inside the channels. This is contrasted with conventional 3D printing,
which emphasizes outside surface texture.

1.2.5. Stereolithography (SLA)


SLA is an attractive option for microfluidics due to increasing availability of SLA printers utilizing
inexpensive micromirror-based projectors, including some printer kits costing as little as $100 [48].
The performance of SLA printers is quantified by the dimensional accuracy and the surface roughness
of the printed object [49,50]. These factors are influenced by the fabrication settings: object orientation,
layer thickness, resin properties, and build style. The minimum cross-sectional area of a microchannel
made by SLA depends on the laser spot size and the resin viscosity. This resin must be drained
post-print [51].
Recent developments have expanded the SLA material selection for a single print to include
elastomers and ceramics, while some printers are capable of using multiple resins. It is predicted
that in the future it will be possible to use SLA to fabricate metallic sensors and actuators on flexible
membranes [51–53].
Comina et al. used a Miicraft (Hsinchu, Taiwan) 3D printer to fabricate a reusable mold for PDMS
casting [54]. The molds had structures of multiple feature sizes ranging from 50 μm to several mm.
The resin had to be manually coated with protective ink to be properly used with PDMS. The Miicraft
was also used to print a device with open fluidic channels that are subsequently sealed on top with the
adhesive tape. In another study, Comina et al. printed a unibody lab-on-a-chip (LOC) consisting of
a separate microfluidic level, and a layer with optical components. The integrated finger pump was
used to initiate the preparatory sequence of mixing two reagents and three analytes. The colorimetric
glucose sensing assay was read by a smart phone [55].
Wang et al. demonstrated an effective approach to fabricating structural devices using 3D printing.
A monomer initiator was added to the Miicraft resin to allow for modification of the surface properties
such as hydrophobicity and hydrophilicity [56].
Shallan et al. used a Miicraft printer for the fabrication of a transparent microfluidic device with
enclosed 250 μm diameter channels [57]. The dimension of the printed channels had a deviation of 50 to
100 μm from the designed dimensions, and the roof of the sealing channel was rough. This could be
improved through changing the curing depth, intensity, exposure wavelength, and time. They argued
that inexpensive Miicraft provides a sufficient resolution for most microfluidic devices.
Patrick et al. printed fluidic open channels using a laser-rastering SLA printer (Form1+, Formlabs,
Somerville, MA, USA) [58]. They found that the smallest achievable diameter of a circular channel was
900 μm, and the smallest channel side for a square channel was 650 μm. The surface topology was
inspected using SEM and visible striations were discovered. Overall, the cost of the materials for each
fluidic chip was around $6.
A sample library of standardized microfluidic components was manufactured using SLA
by Lee et al. and Bhargava et al. [59,60]. These parts were then used to create a number of

173
Micromachines 2018, 9, 502

modular and reconfigurable microfluidic units. This approach allowed for the creation of complex
microfluidic designs based on simple interlocking fluidic modules. The library allowed for the further
miniaturization of microfluidic elements and materials.
The Folch lab has printed diaphragm valves and a peristaltic pump integrated within a LOC
device printed using SLA with biocompatible Somos WaterShed XC 11122 resin (Elgin, IL, USA) [61].
The valves were leakage free at a closing pressure of 6 psi (provided by the compressed air), and they
were operated over many cycles. These valves are regarded as functional modules: two valves can
be paired to build a switch, or three valves can be put together in a series to build a pump [62].
However, the portability of these microfluidic devices was limited by the need to use peripherals such
as gas canisters.

1.3. Combining Several Fabrication Techniques to Manufacture an Automated Fluidic Malaria Enzyme-Linked
Immunosorbent Assay (ELISA) Bioassay Platform
Each of the techniques discussed thus far has its own set of advantages and disadvantages.
For example, stereolithography, while allowing for higher resolution, is more expensive and less
accessible than fused deposition modelling [63]. Therefore, in this work, we applied a combination of
fabrication techniques.
In one approach when only an FDM printer is available, we developed a system based on
disposable plastic syringes coupled to programmable servomotors. FDM was used to print the
non-disposable frame for an automated colorimetric malaria detection test based on enzyme-linked
immunosorbent assay (ELISA). In another approach, when the end user has access to an SLA
system, we developed a fabrication approach for SLA to produce elastomeric domes with
integrated microfluidic channels. Flow of reagents was facilitated by servomotors compressing
the elastomeric dome, and propelling the reagents through a microfluidic channel into a connected
test chamber. In this approach, the frame was still printed using an FDM printer. We avoided
fabricating microfluidic channels using FDM, because filament-based deposition often resulted in a
“staircase effect” as discussed previously, causing fabricated structures to be prone to leakages.

2. Materials and Methods

2.1. Fused Deposition Modeling and Stereolithography


The FDM parts were manufactured using a acrylonitrile butadiene styrene (ABS) filament
on a dual extruder AirWolf HD2x printer (Costa Mesa, CA, USA). The printing parameters,
including extrusion, travel speeds, and printer head temperature, were optimized as discussed in the
“Results and Discussion” section below. A Formlabs’ (Somerville, MA, USA) Form 1+ SLA printer was
used to produce the elastomeric domes and integrated fluidic microchannel from proprietary flexible
clear resin GPCL02 sold by Formlabs.

2.2. Automation of Malaria-Ab Colorimetric ELISA


A malaria-Ab ELISA colorimetric detection kit (IBL International GmbH, Hamburg, Germany)
was used to test functionality of the fabricated automated platform. The colorimetric assay was
designed to detect antibodies in subjects infected with four Plasmodium species that cause malaria.
The most significant parasitic diseases in humans are: P. falciparum, P. vivax, P. ovale, and P. malariae [64].
The ELISA kit contained clear polystyrene wells coated with recombinant antigens. When the test
sample (either serum or plasma) was added to the well, the specific antibodies in the sample combined
with antigens in the well. Subsequently, a conjugate solution of recombinant antigens conjugated to
horseradish peroxidase was added to the well, and these antigens reacted with the specific antibodies,
if they were present.
When the substrate solution of urea peroxide and tetramethyl benzidine was added to the well,
it led to a change in solution color from colorless (in case of no specific antibodies present) to blue

174
Micromachines 2018, 9, 502

(when antibodies were present), and finally to yellow when the stop solution was added. It is possible
to determine the concentration of the antibodies in the sample by measuring the color intensity with
spectral analysis, but in this proof-of-concept study, we limited our experiments to the positive and
negative controls provided with the kit. The full details on the recommended volumes of reagents
and incubation temperatures were provided by the kit manufacturers and they are summarized in
Table 1 [65].

Table 1. Malaria-Ab Enzyme-linked Immunosorbant Assay (ELISA) instructions as provided by the kit
manufacturer and modified steps executed by the automated bioassay platform.

ELISA Step Malaria-Ab ELISA Kit Instruction Automated Assay Modifications


Add 50 μL of the undiluted sample to
a coated well. Mix on a plate shaker 50 μL of sample is pipetted into the wells (O).
Sample
for 30 s. Incubate (covered) at 37 ◦ C Incubation occurs for 1 hr at room temperature.
for 30 min.
The well is flushed with 300 μL wash solution
contained within the elastomeric dome (N) as
the movable arm (M) compresses the dome.
Wash five times with 300 μL of The arm is controlled by the servomotor (L)
working strength wash buffer. A short and Arduino board (J). The dirty wash solution
Wash soak time of about 30 s is is aspirated from the well using an aspiration
recommended between each syringe located on the bottom platform.
wash cycle. Tap out excess liquid. The syringe is driven by 3D printed
rack-and-gear set (B) and the servomotor (C).
The wash/aspiration cycle is repeated
three times.
50 μL of diluted malaria conjugate is dispensed
into the reagent well (O) from a syringe (F).
Add 50 μL of diluted (1:10) conjugate
Conjugate The barrel of this syringe is pushed using a
to each well. Incubate (covered) at
Incubation servomotor (H) controlled by the Arduino
37 ◦ C for 30 min.
board (D). Incubation occurs for 30 min at room
temperature.
Wash See wash step above. See wash step above.
Add 50 μL substrate /chromogen
Tetramethylbenzidine (TMB) mixture 50 μL of TMB substrate solution is dispensed
to each well. Incubate at room into the reagent well (O) from a syringe on the
Substrate temperature for 30 min. As the syringe platform (F). The barrel of this syringe
Incubation substrate is photosensitive, it is is pushed using a servomotor (G) controlled by
recommended that the plate be the Arduino board (D). Incubation occurs for
protected from light during 15 min.
this incubation.
50 μL of stop solution is dispensed into the
Add 50 μL stop solution to each well. reagent well (O) from a syringe (F). The barrel
Stop
(Blue color changes to yellow). of this syringe is pushed using a servomotor (E)
controlled by the Arduino board (D).
Read with fluorescent microplate A color change is accessed visually or via a cell
reader at 450 nm (A450). Use of a phone positioned on the frame (P) with phone
Detection reference filter at 620–690 nm will camera aligned to the reagent wells (O) to read
eliminate the effects of scratches, the results using a colorimetric
bubbles, etc. detection application.

We performed incubation not at the recommended 37 ◦ C, but at a room temperature, usually 20 ◦ C


to 23 ◦ C. Where the kit instructions recommended draining the test tube and tapping it to make sure
that all fluid exited the tube, we implemented automation where a plastic tube is placed within the test
well to reach the bottom. This tube was connected to the aspiration syringe (labeled “I” on Figure 1)

175
Micromachines 2018, 9, 502

whose plunger was pulled out by the gear and rack hardware controlled by the servomotor. Pulling of
the plunger created the suction necessary to aspirate solutions from the test well.

Figure 1. The automated bioassay platform is composed of two stackable boards: The bottom platform
contains a battery (A), an aspiration syringe (I) connected via a printed rack-and-gear set (B) to the
servomotor (C), which is controlled with an Arduino board (D) that also controls other servomotors
(E, G, H) that push on syringes (F) with conjugate, substrate, and stop solutions. The syringes on
the bottom board are connected via plastic tubes (4 mm outer diameter, 2 mm inner diameter) to the
well (O) on the top platform, where another battery (K) and Arduino board (J) power and control the
servomotor (L) that through arm (M), presses on an elastomeric dome (N) containing wash. The top
platform also contains a printed frame (P) onto which a smart phone can be placed to detect color
changes in the well.

Each fluidic step of the assay was performed by an action of a servomotor controlled through the
Arduino board. The servomotors’ plastic arms pushed onto the plungers of plastic syringes filled with
reagents (conjugate solution, substrate, stop solution). We elected to dispense the wash solution from
an SLA-printed elastomeric dome containing integrated microfluidic channels, in order to demonstrate
an alternative part to syringes for all steps of the assay. The elastomeric dome is easily substituted
with another syringe to transition to a completely syringe-based automated fluidic ELISA platform.
The complete automated bioassay platform is presented in Figure 1.
The sequence of the bioassay steps is summarized below. Steps of the malaria-Ab ELISA assay as
recommended by the kit manufacturer, and the modified steps are executed by the automated platform
are listed in Table 1.

(1) Pipette 50 μL of sample into the wells (O). Incubate for 1 hr at room temperature.
(2) Aspirate the sample from the well. Flush the well with wash solution contained within the
elastomeric dome (N). The wash solution is dispensed using the movable arm (M) to compress
the dome.
(3) Aspirate the dirty wash solution from the well using an aspiration syringe located on the bottom
platform. Repeat three times.

176
Micromachines 2018, 9, 502

(4) Dispense 50 μL of malaria conjugate into the reagent well (O) from a syringe (F). The barrel of
this syringe is pushed using a servomotor (H). Incubate for 30 min at room temperature.
(5) Aspirate the conjugate from the well. Repeat step 3.
(6) Dispense 50 μL of the TMB substrate solution into the reagent well (O) from a syringe on the
syringe platform (F). The barrel of this syringe is pushed using a servomotor (G). Incubate for
15 min at room temperature.
(7) Dispense 50 μL of stop solution into the reagent well (O) from a syringe on the syringe platform (F).
The barrel of this syringe is pushed using a servomotor (E).
(8) Visually inspect the color change if the platform is used for qualitative, rather than quantitative
analysis. Alternatively, position a cell phone on the frame (P) and align the phone camera to the
reagent wells (O) to read the results using a special colorimetric detection app, Color Catcher
(Cloud Innovation Team, Austin, TX, USA) [66]. This app reads RBG values from scanned or
photographed images.

2.3. Hardware
There were five servomotors used with this automated assay platform: three TowerPro-SG5010
(Shenzhen Hao Qi Core Technology Co., Ltd., Shenzhen, China) servomotors (E, G, and H on Figure 1).
These servomotors were used to push onto the plungers of syringes with the stop solution, with TMB
substrate, and with the malaria conjugate. A continuous Airtronics Servo 94102 (Sanwa Denshi Co.,
Tokyo, Japan) (part C in Figure 1) was used in conjunction with a 3D printed rack-and-gear set (B)
to pull out the plunger of the aspiration syringe. An Ultra Torque HS-645MG (Hitec RCD USA Inc.,
Poway, CA, USA) (M) servomotor was used to rotate the arm that pushed on the elastomeric dome (N)
containing the wash. The servomotors were programmed to follow the ELISA steps, dispensing the
appropriate amount of reagent between each step. These directions were uploaded to the Arduino
boards (D, J) (Seeedstudio, Shenzen, China) controlling the servomotors. The arm position of a
servomotor was determined by the pulse width-modulated (PWM) signal sent via the control board.

3. Results

3.1. Fused Deposition Modeling Optimization


The extrusion temperature for FDM was tested in the range from 225 ◦ C to 240 ◦ C in 5 ◦ C
increments. At 225 ◦ C, the filament did not have sufficient adhesion to the base plane of the printer,
while at 240 ◦ C, the filament extruded out of the nozzle was difficult to control, as it was not viscous
enough. The optimal extrusion temperature was found to be in the range between 230 ◦ C and 235 ◦ C.
The travel speed of the printer head significantly influenced the quality of the final build. Figure 2
presents the test samples produced with the optimized extrusion temperature, and with travel speeds
of 15, 20, and 30 mm/s (left to right). The test samples had a geometry of 2.5 cm × 2.5 cm square, with a
thickness of 1.5 mm. On top of the sample, there were two structures: a T-shaped wall placed at the
edge of the test sample, and a microfluidic channel in the middle of the test sample. The microfluidic
channel had an inner diameter of 1.5 mm and an outer diameter of 3 mm. As Figure 2 indicates,
the best quality of the printed structures resulted with the extruder’s travel speed of 15 mm/s.

177
Micromachines 2018, 9, 502

Figure 2. Test samples produced with fused deposition modeling (FDM) using travel speeds of the
extruder (left to right) of 15, 20, and 30 mm/s.

3.2. Stereolithographic Fabrication Optimization


For microfluidic parts produced with SLA, one of the major challenges was the process of clearing
out the uncrosslinked resin from the enclosed microfluidic channel [67]. We evaluated the smallest
channel diameter achievable with SLA by printing chips with 1 cm, 3 cm, and 5 cm long microchannels.
Each sample contained five channels with different hydraulic diameters of 0.7 mm, 1.0 mm, 1.4 mm,
1.7 mm, and 2.1 mm (Figure 3a). The longer the channel and the smaller its diameter, the more difficult
it was to clear the channel from uncross-linked resin. For example, all of the channels in the 5 cm long
test chip were clogged, even with 30 min of soaking time in isopropyl alcohol (IPA).

a b

Figure 3. Test Samples containing microchannels with diameters of 2.1 mm, 1.7 mm, 1.4 m, 1.0 mm,
and 0.7 mm (right to left). The test chip lengths are 5 cm, 3 cm, and 1 cm. Prolonging the isopropyl
alcohol (IPA) soak from 30 min (a) to 6 h (b) helps with clearing the microchannels from uncrosslinked
resin. (c) A comparison between IPA soaking cleaning (left) and IPA injection cleaning (right) for the
3 cm long microchannels. IPA injection cleaning achieved superior results in cleaning the channels
from uncrosslinked resin.

Extending the IPA soak time of the SLA fabricated sample from 30 min (Figure 3a) to 6 h (Figure 3b)
helped to clear out channels better. Further extending the soak time in IPA past 6 h did not result in
any noticeable change, while the cross-linked resin started to deteriorate. The channels with diameters
of 1.75 mm and larger were cleared out even in the 5 cm long test pieces.
For straight channels, it was possible to remove the uncross-linked resin by feeding a thin wire
through the channel, but in case of tortuous channels (of sinusoidal or zig-zag geometry), this technique
was difficult to execute successfully, as the wire could not navigate the bends of the tortuous channels.

178
Micromachines 2018, 9, 502

Instead, we implemented the manual injection of IPA with a syringe directly into the channels.
This technique was more efficient and superior to the IPA soak method.
As can be seen on Figure 3c, the 3 cm long microchannels were still clogged after a 6 h IPA soak,
while the IPA injection successfully cleared the microchannels in another sample of the same geometry.
IPA injection is capable of clearing channels all the way down to microchannels with 1 mm diameter.

3.3. Channel Deformation


Channel cross-sections were distorted during FDM and SLA fabrication. Measurements in the
X and Y directions (width and height of the channels’ cross-sections, respectively) were obtained for
all channels and compared to the designed values. The cross-sections of all the channels were oval,
meaning that the diameter in the Y direction was larger than in the X direction. Figure 4 compares
the designed and measured diameters in the X and Y direction for channels made with both FDM
and SLA.

Figure 4. Deformations of hollow channels printed with Stereolithography (SLA) and Fused Deposition
Modeling (FDM) technologies. A total of five samples were measured for each experimental point,
and error bar heights represent one standard deviation. Designed vs measured channel diameter
measurements are presented for (a) the deformation of channels in the X direction (width of the
channels) and for (b) the deformation of channels in the Y direction (height of the channels).

It was seen that in all cases, SLA produced channel diameters that were more representative of
the initial design, while FDM was far less accurate due to spreading of the liquid filament during
printing. Both methods produced distorted channel heights due to the sagging of unsupported
filaments. However, SLA-fabricated samples channels tended to sag less than the FDM-fabricated
channels. The highest deviation observed corresponded to FDM-printed channels that were larger
than 1 mm diameter in the X direction.

3.4. Performance of the Automated System


The finalized printed LOC platform was assembled using tubes to connect the syringes to the
reservoir wells. The reagents contained within the syringes were injected into the wells (boxed in red
in Figure 5). The dead volume of the system, comprising the inner space of the tubes connecting the
syringes and the test well, equaled 0.14 ± 0.02 cm3 for each syringe. In order to compensate for that
dead volume, correspondingly larger volumes were dispensed from the syringes.

179
Micromachines 2018, 9, 502

Figure 5. Top view of the assembled automated ELISA bioassay platform. Test wells are indicated by
the red frame on the picture. See the caption of Figure 1 for a description of the individual components
of the automated platform.

An assay was performed using the automation process described in the Section 2.2 above.
A close-up photo of the positive and negative results is provided in Figure 6. The wells with the
blue solution were the positive controls, and the colorless wells represented the negative control.
The positive control solution changed from blue to yellow when the stop solution was added, while the
colorless negative controls did not change color. The positive and negative control color change was
correct, signifying the successful demonstration of the automated malaria-Ab assay.

Figure 6. Colorimetric bioassay results after the stop solution is added. The wells with the blue solution
are the positive controls and the colorless wells represent the negative controls.

Five assays were performed on the automated platform. Each assay consisted of four test wells:
two wells with positive controls and two wells with negative controls. The tests were performed
using one well at a time. Subsequent test runs were performed by replacing the tubes and manually
positioning them into another test well. All of the assays were performed successfully without any
false readings. Minor test-to-test variations (within 0.05 cm3 ) of the dispensed wash did not affect the
test results.

180
Micromachines 2018, 9, 502

A Windows Nokia Lumia 521 (Nokia, Espoo, Finland) smart phone with the installed Color
Catcher (Cloud Innovation Team, Austin, TX, USA) app was used to capture the RBG color code of the
solution in the well at the end of each test. There was no need to withdraw the tubes from the test well
during this image acquisition. While the color change was easily distinguishable with the naked eye,
such captured color codes are useful for performing quantitative bioassays. The video of the operation
of the automated bioassay platform during the test can be viewed online as part of the Supplemental
Materials for this article.

4. Conclusions
We have reported on the fabrication of an automated colorimetric Malaria-Ab immunoassay
platform based on readily-available parts, such as servomotors and disposable syringes. We have
also outlined an alternative syringe-based automated assay that utilizes elastomeric reservoirs
(printed using SLA) with programmable servomotors compressing elastomeric reservoirs to inject
reagents or to wash a test well. The aspiration syringe actuated by a continuous servomotor facilitated
the draining of test wells after specific assay steps.
To demonstrate the validity of our approach, we fabricated a hybrid system that included syringes
for all of the reagents except for the wash, which was contained in an elastomeric dome reservoir.
Successful validation of the automated platform was performed with positive and negative controls,
and with the reagents included in the commercial malaria-Ab immunoassay kit.
The demonstrated syringe-based automation is easily expanded to a wide variety of assays to
create flexible and affordable point-of-care platforms. Implementation of the platform is simplified
by providing rural clinics with syringe kits with pre-measured reagent syringes sealed in metallized
pouches. These pouches can be punctured by the syringe plunger during the corresponding assay
step when conducting the bioassay. Additional validation is required before the application of the
presented automated platform for qualitative (rather than quantitative) tests.

Supplementary Materials: The following are available online at http://www.mdpi.com/2072-666X/9/10/502/


s1,Video S1: Validation of a syringe-based automated point-of-care malaria-Ab immunoassay.
Author Contributions: Conceptualization, C.L., Y.L., and L.K.; methodology, C.L. and L.K.; software, Y.L.;
validation, C.L. and Y.L.; formal analysis, C.L., Y.L., and L.K.; investigation, C.L. and Y.L.; resources, L.K.; data
curation, C.L. and Y.L.; writing—original draft preparation, C.L.; writing—review and editing, C.L., Y.L., and L.K.;
visualization, C.L.; supervision, L.K.; project administration, L.K.; funding acquisition, L.K.
Funding: This research received no external funding.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Urrios, A.; Parra-Cabrera, C.; Bhattacharjee, N.; Gonzalez-Suarez, A.M.; Rigat-Brugarolas, L.G.; Nallapatti, U.;
Samitier, J.; DeForest, C.A.; Posas, F.; Garcia-Cordero, J.L.; et al. 3D-printing of transparent bio-microfluidic
devices in PEG-DA. Lab Chip 2016, 16, 2287–2294. [CrossRef] [PubMed]
2. Crowther, J. The Elisa Guidebook; Springer Science & Business Media: Berlin, Germany, 2009; p. 54.
3. Wiltbank, T.; McCaroll, D.; Wartick, M. An undetectable source of technical error that could lead to false
negative results in enzyme linked immunosorbent assay of antibodies to HIV-1. Rapid Commun. 1988,
29, 75–77. [CrossRef]
4. Knowlton, S.; Yu, C.H.; Ersoy, F.; Emadi, S.; Khademhosseini, A.; Tasoglu, S. 3D-printed microfluidic Chips
with patterned, cell-laden hydrogel constructs. Biofabrication 2016, 8, 025019. [CrossRef] [PubMed]
5. Ellerbee, A.K.; Phillips, S.T.; Siegel, A.C.; Mirica, K.A.; Martinez, A.W.; Striehl, P.; Jain, N.; Prentiss, M.;
Whitesides, G.M. Quantifying colorimetric assays in paper-based microfluidic devices by measuring the
transmission of light through paper. Anal. Chem. 2009, 81, 8447–8452. [CrossRef] [PubMed]
6. Lutz, B.; Liang, T.; Fu, E.; Ramachandran, S.; Kauffman, P.; Yager, P. Dissolvable fluidic time delays
for programming multi-step assays in instrument-free paper diagnostics. Lab Chip 2013, 13, 2840–2847.
[CrossRef] [PubMed]

181
Micromachines 2018, 9, 502

7. Schaller, V.; Sanz-Velasco, A.; Kalabukhov, A.; Schneiderman, J.F.; Öisjöen, F.; Jesorka, A.; Astalan, A.P.;
Krozer, A.; Rusu, C.; Enoksson, P.; et al. Towards an electrowetting-based digital microfluidic platform for
magnetic immunoassays. Lab Chip 2009, 9, 3433–3436. [CrossRef] [PubMed]
8. Nguyen, N.T.; Hejazian, M.; Ooi, C.H.; Kashaninejad, N. Recent advances and future perspectives on
microfluidic liquid handling. Micromachines 2017, 8, 186. [CrossRef]
9. Cevenini, L.; Calabretta, M.M.; Tarantino, G.; Michelini, E.; Roda, A. Smartphone-interfaced 3D printed
toxicity biosensor integrating bioluminescent “sentinel cells”. Sens. Actuators 2016, 225, 249–257. [CrossRef]
10. Comina, A.; Suska, A.; Filippini, G. A 3D printed device for quantitative enzymatic detection using cell
phones. Anal. Methods 2016, 8, 6135–6142. [CrossRef]
11. Bauer, M.; Kulinksy, L. Fabrication of a lab-on-chip device using material extrusion (3D printing) and
demonstration via Malaria-Ab ELISA. Micromachines 2018, 9, 27. [CrossRef]
12. Crowther, J. The Elisa Guidebook; Springer Science & Business Media: Berlin, Germany, 2009; p. 332.
13. Becker, H.; Locascio, L. Polymer microfluidic devices. Talanta 2002, 56, 267–287. [CrossRef]
14. Zhang, Y.; Wu, L.; Kane, S.; Deng, Y.; Jung, Y.G.; Lee, G.H.; Zhang, J. Additive manufacturing of metallic
materials: A review. J. Mater. Eng. Perform. 2018, 27, 1–13. [CrossRef]
15. Parra-Cabrera, C.; Achille, C.; Kuhn, S.; Ameloot, R. 3D printing in chemical engineering and catalytic
technology: Structured catalysts, mixers and reactors. Chem. Soc. Rev. 2018, 47, 209–230. [CrossRef]
[PubMed]
16. Betancourt, T.; Brannon-Peppas, L. Micro- and nanofabrication methods in nanotechnological medical and
pharmaceutical devices. Int. J. Nanomed. 2006, 1, 483–495. [CrossRef]
17. Sugioka, K.; Cheng, Y. Femtosecond laser processing for optofluidic fabrication. Lab Chip 2012, 12, 3576.
[CrossRef] [PubMed]
18. Yalikun, Y.; Hosokawa, Y.; Lino, T.; Tanaka, Y. An all-glass 12 μm ultra-thin and flexible micro-fluidic chip
fabricated by femtosecond laser processing. Lab Chip 2016, 16, 2427–2433. [CrossRef] [PubMed]
19. Rolland, J.P.; Van Dam, R.M.; Schorzman, D.A.; Quake, S.R.; DeSimone, J.M. Solvent-resistant photocurable
“liquid teflon” for microfluidic device fabrication. J. Am. Chem. Soc. 2004, 126, 232. [CrossRef] [PubMed]
20. Beebe, D.J.; Moore, J.S.; Yu, Q.; Liu, R.H.; Kraft, M.L.; Jo, B.H.; Devadoss, C. Microfluidic tectonics:
A comprehensive construction platform for microfluidic systems. Proc. Natl. Acad. Sci. USA 2000,
97, 13488–13493. [CrossRef] [PubMed]
21. Lee, S.; Kim, H.; Lee, W.; Kim, J. Finger-triggered portable PDMS suction cup for equipment-free microfluidic
pumping. Micro Nano Syst. Lett. 2018, 6, 1–5. [CrossRef]
22. Yazdi, A.; Popma, A.; Wong, W.; Nguyen, T.; Pan, Y.; Xu, J. 3D printing: an emerging tool for novel
microfluidics and lab-on-a-chip applications. Microfluid. Nanofluid. 2016, 20, 50. [CrossRef]
23. He, Y.; Wu, Y.; Fu, J.Z.; Gao, Q.; Qiu, J.J. Developments of 3D printing microfluidics and applications in
chemistry and biology: A review. Electroanalysis 2016, 28, 1658–1678. [CrossRef]
24. Zhang, C.; Bills, B.; Manicke, N. Rapid prototyping using 3D printing in bioanalytical research. Bioanalysis
2017, 9, 329–331. [CrossRef] [PubMed]
25. Tang, S.; Whitesides, G. Basic Microfluidic and Soft Lithographic Techniques. Available online: https:
//gmwgroup.harvard.edu/pubs/pdf/1073.pdf (accessed on 25 May 2018).
26. Unger, M.A.; Chou, H.P.; Thorsen, T.; Scherer, A.; Quake, S.R. Monolithic microfabricated valves and pumps
by multilayer soft lithography. Science 2000, 288, 113–116. [CrossRef] [PubMed]
27. Thorsen, S.; Maerkl, S.J.; Quake, S.R. Microfluidic large-scale integration. Science 2002, 298, 580–584.
[CrossRef] [PubMed]
28. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: Enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
29. Hopkinson, N.; Smith, P. Handbook of Industrial Inkjet Printing: A full System; John Wiley & Sons: Hoboken,
NJ, USA, 2018.
30. Pilipović, A.; Raos, P.; Šercer, M. Experimental analysis of properties of materials for rapid prototyping. Int. J.
Adv. Des. Manuf. Technol. 2009, 40, 105–115. [CrossRef]
31. Mueller, J.; Courty, D.; Spielhofer, M.; Spolenak, R.; Shea, K. Mechanical properties of interfaces in inkjet 3D
printed single- and multi-material parts. 3D Print. Addit. Manuf. 2017, 4, 193–199. [CrossRef]
32. Anderson, K.B.; Lockwood, S.Y.; Martin, R.S.; Spence, D.M. A 3D printed fluidic device that enables
integrated features. Anal. Chem. 2013, 85, 5622–5626. [CrossRef] [PubMed]

182
Micromachines 2018, 9, 502

33. Lockwood, S.Y.; Meisel, J.E.; Monsma, F.J., Jr.; Spence, D.M. A diffusion-based and dynamic 3D-printed
device that enables parallel in vitro pharmacokinetic profiling of molecules. Anal. Chem. 2016, 88, 1864–1870.
[CrossRef] [PubMed]
34. Hwang, Y.; Paydar, O.; Candler, R. 3D printed molds for non-planar PDMS microfluidic channels.
Sens. Actuators A Phys. 2015, 226, 137–142. [CrossRef]
35. Paydar, O.H.; Paredes, C.N.; Hwang, Y.; Paz, J.; Shah, N.B.; Candler, R.N. Characterization of 3D-printed
microfluidic chip interconnects with integrated O-rings. Sens. Actuators A Phys. 2014, 205, 199–203.
[CrossRef]
36. Staudinger, U.; Zyla, G.; Krause, B.; Janke, A.; Fischer, D.; Esen, C. Development of electrically conductive
microstructures based on polymer/CNT nanocomposites via two-photon polymerization. Microelectron. Eng.
2017, 179, 48–55. [CrossRef]
37. Xing, J.F.; Zheng, M.L.; Duan, X.M. Two-photon polymerization microfabrication of hydrogels: An advanced
3D printing technology for tissue engineering and drug delivery. Chem. Soc. Rev. 2015, 44, 5031–5039.
[CrossRef] [PubMed]
38. Kumi, G.; Yanez, C.; Belfield, K.; Fourkas, J.T. High-speed multiphoton absorption polymerization:
Fabrication of microfluidic channels with arbitrary cross-sections and high aspect ratios. Lab Chip 2010,
10, 1057–1060. [CrossRef] [PubMed]
39. Kawata, S.; Sun, H.B.; Tanaka, T.; Takada, K. Finer features for functional microdevices. Nature 2001,
412, 697–698. [CrossRef] [PubMed]
40. Sugioka, K.; Cheng, Y. Femtosecond laser three-dimensional micro- and nanofabrication. Appl. Phys. Rev.
2014, 1, 041303. [CrossRef]
41. Ziemian, C.M.; Crawn, P.M. Computer aided decision support for fused deposition modelling.
Rapid Prototyp. J. 2001, 7, 138–147. [CrossRef]
42. Modjarrad, K.; Ebnesajjad, S. Handbook of Polymer Applications in Medicine and Medical Devices;
William Andrew Publishing: Norwich, NY, USA, 2014.
43. Chia, H.; Wu, B. Recent advances in 3D printing of biomaterials. J. Biol. Eng. 2015, 9, 4. [CrossRef] [PubMed]
44. Lee, J.; Zhang, M.; Yeong, W. Characterization and evaluation of 3D printed microfluidic chip for cell
processing. Microfluid. Nanofluid. 2016, 20, 1–15. [CrossRef]
45. Kitson, P.J.; Symes, M.D.; Dragone, V.; Cronin, L. Combining 3D printing and liquid handling to produce
user-friendly reactionware for chemical synthesis and purification. Chem. Sci. 2013, 4, 3099–3103. [CrossRef]
46. Bishop, G.W.; Satterwhite, J.E.; Bhakta, S.; Kadimisetty, K.; Gillette, K.M.; Chen, E.; Rusling, J.F. 3D-printed
fluidic devices for nanoparticle preparation and flow-injection amperometry using integrated prussian blue
nanoparticle-modified electrodes. Anal. Chem. 2015, 87, 5437–5443. [CrossRef] [PubMed]
47. Sher, D. “Dolomite’s Fluidic Factory 3D Prints $1 Microfluidic Chips.” 3D Printing Industry, 2015. Available
online: https://3dprintingindustry.com/news/dolomites-fluidic-factory-3d-prints-1-microfluidic-chips-
60883/ (accessed on 25 May 2018).
48. 3D Systems, Inc. Available online: https://www.3dsystems.com/ (accessed on 25 May 2018).
49. Au, A.; Lee, W.; Folch, A. Mail-order microfluidics: Evaluation of stereolithography for the production of
microfluidic devices. Lab Chip 2014, 14, 1294–1301. [CrossRef] [PubMed]
50. Zhou, C.; Chen, Y.; Yang, Z.G.; Khoshnevis, B. Development of a multi-material mask-image-projection-based
stereolithography for the fabrication of digital materials. Rapid Prototyp. J. 2013, 19, 153–165. [CrossRef]
51. Zhang, X.; Jiang, X.N.; Sun, C. Micro-stereolithography of polymeric and ceramic microstructures.
Sens. Actuators A Phys. 1999, 77, 149–156. [CrossRef]
52. Amend, P.; Hentschel, O.; Scheitler, C.; Baum, M.; Heberle, J.; Roth, S.; Schmidt, M. Fast and flexible
generation of conductive circuits. J. Laser Micro/Nanoeng. 2013, 8, 276–286. [CrossRef]
53. Comina, G.; Suska, A.; Filippini, D. PDMS lab-on-a-chip fabrication using 3D printed templates. Lab Chip
2014, 14, 424–430. [CrossRef] [PubMed]
54. Comina, G.; Suska, A.; Filippini, D. Low cost lab-on-a-chip prototyping with a consumer grade 3D printer.
Lab Chip 2014, 14, 2978–2982. [CrossRef] [PubMed]
55. Comina, G.; Suska, A.; Filippini, D. Autonomous chemical sensing interface for universal cell phone readout.
Chem. Int. Ed. 2015, 54, 8708–8712. [CrossRef] [PubMed]
56. Wang, X.; Cai, X.; Guo, Q.; Zhang, T.; Kobe, B.; Yang, J. i3DP, a robust 3D printing approach enabling genetic
post-printing surface modification. Chem. Commun. 2013, 49, 10064–10066. [CrossRef] [PubMed]

183
Micromachines 2018, 9, 502

57. Shallan, A.I.; Smejkal, P.; Corban, M.; Guijt, R.M.; Breadmore, M.C. Cost-Effective Three-Dimensional
Printing of Visibly Transparent Microchips within Minutes. Anal. Chem. 2014, 86, 3124–3130. [CrossRef]
[PubMed]
58. Patrick, W.G.; Nielsen, A.A.; Keating, S.J.; Levy, T.J.; Wang, C.W.; Rivera, J.J.; Mondragón-Palomino, O.;
Carr, P.A.; Voigt, C.A.; Oxman, N.; et al. DNA assembly in 3D printed fluidics. PLoS ONE 2015, 10, 1–18.
[CrossRef] [PubMed]
59. Lee, K.G.; Park, K.J.; Seok, S.; Shin, S.; Park, J.Y.; Heo, Y.S.; Lee, S.J.; Lee, J.L. 3D printed modules for
integrated microfluidic devices. RSC Adv. 2014, 4, 32876–32880. [CrossRef]
60. Bhargava, K.; Thompson, B.; Malmstadt, N. Discrete elements for 3D microfluidics. PNAS 2014,
111, 15013–150138. [CrossRef] [PubMed]
61. Lai, H.; Folch, A. Design and dynamic characterization of “single-stroke” peristaltic PDMS micropumps.
Lab Chip 2011, 11, 336–342. [CrossRef] [PubMed]
62. Bhushan, B.; Caspers, M. An overview of additive manufacturing (3D printing) for microfabrication.
Microsyst. Technol. 2017, 23, 1117. [CrossRef]
63. Garcia, J.; Yang, Z.; Mongrain, R.; Leask, R.L.; Lachapelle, K. 3D printing materials and their use in medical
education: A review of current technology and trends for the future. BMJ. Simul. Technol. Enhanc. Learn.
2018, 4, 27–40. [CrossRef] [PubMed]
64. World Health Organization. Malaria. Available online: http://www.who.int/mediacentre/factsheets/
fs094/en (accessed on 26 May 2018).
65. Malaria-Ab-ELISA. Available online: http://www.ibl-international.com/media/catalog/product/R/E/
RE58601_IFU_en_Malaria-Ab_ELISA_V4_2011-08-03_sym3.pdf (accessed on 26 May 2018).
66. Color Catcher. Available online: http://appcrawlr.com/android/color-catcher-free (accessed on
26 May 2018).
67. Zhou, Y. The recent development and applications of fluidic channels by 3D printing. J. Biomed. Sci. 2017,
24, 80. [CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

184
micromachines

Article
Assessing the Reusability of 3D-Printed
Photopolymer Microfluidic Chips for
Urine Processing
Eric Lepowsky 1 , Reza Amin 1 and Savas Tasoglu 1,2,3,4,5, *
1 Department of Mechanical Engineering, University of Connecticut, Storrs, CT 06269, USA;
[email protected] (E.L.); [email protected] (R.A.)
2 Department of Biomedical Engineering, University of Connecticut, Storrs, CT 06269, USA
3 Institute of Materials Science, University of Connecticut, Storrs, CT 06269, USA
4 Institute for Collaboration on Health, Intervention, and Policy, University of Connecticut,
Storrs, CT 06269, USA
5 The Connecticut Institute for the Brain and Cognitive Sciences, University of Connecticut,
Storrs, CT 06269, USA
* Correspondence: [email protected]; Tel.: +1-860-486-5919

Received: 26 September 2018; Accepted: 14 October 2018; Published: 15 October 2018

Abstract: Three-dimensional (3D) printing is emerging as a method for microfluidic device fabrication
boasting facile and low-cost fabrication, as compared to conventional fabrication approaches, such as
photolithography, for poly(dimethylsiloxane) (PDMS) counterparts. Additionally, there is an increasing
trend in the development and implementation of miniaturized and automatized devices for health
monitoring. While nonspecific protein adsorption by PDMS has been studied as a limitation for
reusability, the protein adsorption characteristics of 3D-printed materials have not been well-studied or
characterized. With these rationales in mind, we study the reusability of 3D-printed microfluidics chips.
Herein, a 3D-printed cleaning chip, consisting of inlets for the sample, cleaning solution, and air, and a
universal outlet, is presented to assess the reusability of a 3D-printed microfluidic device. Bovine serum
albumin (BSA) was used a representative urinary protein and phosphate-buffered solution (PBS) was
chosen as the cleaning agent. Using the 3-(4-carboxybenzoyl)quinoline-2-carboxaldehyde (CBQCA)
fluorescence detection method, the protein cross-contamination between samples and the protein
uptake of the cleaning chip were assessed, demonstrating a feasible 3D-printed chip design and
cleaning procedure to enable reusable microfluidic devices. The performance of the 3D-printed
cleaning chip for real urine sample handling was then validated using a commercial dipstick assay.

Keywords: microfluidics; 3D printing; reusability; biofouling

1. Introduction
There is significant interest in microfluidics due to its large variety of applications, including cancer
screening [1–3], micro-physiological system engineering [4,5], high-throughput drug testing [6,7],
and point-of-care diagnostics [8–13]. In particular, point-of-care devices can help to enable routine
health monitoring and preventative care, which can improve public health while increasing healthcare
savings. In a study reported by Health Affairs, it has been shown that a 90% increase in specific
preventative screenings back in 2006 would have saved more than 2 million lives without a significant
increase in healthcare costs—in fact, a 0.2% decrease in costs was estimated [14]. Microfluidic devices
have a proven record of being effective analytical devices, capable of controlling the flow of fluid
samples, containing reaction and detection zones, and displaying results, all within a compact footprint,
and are therefore appropriate for addressing this need for routine and preventative care [15–20].

Micromachines 2018, 9, 520; doi:10.3390/mi9100520 185 www.mdpi.com/journal/micromachines


Micromachines 2018, 9, 520

While microfluidic devices are low-cost in terms of material cost, conventional fabrication
is challenging and costly. Furthermore, there is an unmet need to address the convenience of
implementing microfluidic devices in sophisticated medical devices: users should not need to replace
the chips routinely. To address the burdensome and expensive fabrication of microfluidic devices,
as well as the need for convenience with respect to medical devices, there is an increasing need to
develop microfluidic devices for long-term use [21–24]. While single-use microfluidic chips may
be practical for some applications, such as for prototyping and experimental testing, devices that
allow for multiple uses are better suited for high-throughput testing and point-of-care diagnostics,
as the limited lifetime of microfluidic devices has been cited as a barrier to commercialization [25].
Furthermore, market trends indicate that by 2018, the field of microfluidics was estimated to
reach $3.6–5.7 billion [26], demonstrating the continued growth of the field, particularly within
clinical diagnostics, pharmaceutical research, point-of-care diagnostics, and analytical applications.
Thus, multiuse devices will prove very useful while combatting the waste that accumulates
with disposable chips in these applications. For these reasons, the reusability of conventional
poly(dimethylsiloxane (PDMS) microfluidic devices has previously been assessed [24].
Microfluidic devices are traditionally fabricated by combining photolithography techniques for
making a master mold and soft lithography using PDMS and bonding. The process as a whole
is complex, expensive, laborious, as well as time-consuming [27]. There exist several alternative
approaches, one of which being 3D printing. Using hydrogels, Beebe et al. developed an ultrafast
fabrication platform combining liquid-phase polymerization and lithography compatible with a
variety of geometries and valve designs [28]. Another alternative is Teflon, which was demonstrated by
Rolland et al. [29]. Unlike PDMS, the liquid-Teflon, a type of photocurable perfluoropolyether (PFPE),
is resistant to swelling in common organic solvents, in addition to being liquid at room temperature
and exhibiting low surface energy, low modulus, high gas permeability, and low toxicity. Glass
can also be used for microfluidic device fabrication. For instance, femtosecond laser direct writing
can modify the interior of glass through multiphoton absorption to form microfluidic channels and
optofluidic components [30]. Femtosecond laser processing can even be used to fabricated ultrathin,
flexible microfluidic chips [31]. Microfluidic devices can also be fabricated using plastics. A study
by Wan et al. indicated that poly(methyl methacrylate) (PMMA) can be recycled for biological
microfluidic device applications. In this experiment, researchers pumped bleach and ethanol through
the microfluidic channels after the chip was used, and then they melted the PMMA so that the plastic
could be reused for multiple chip iterations [32]. While studies have indicated that the recycling
of plastic-based microfluidic chips is possible, there is a lack of research being conducted on the
reusability of microfluidic chips. Reusability is advantageous over recyclability since recycling involves
the remanufacturing of the device. Investigation is needed to determine if merely rinsing the channels
with a cleaning agent, such as a phosphate-buffered solution (PBS) or deionized (DI) water, will allow
for the microfluidic chip to be reused with negligible protein absorption and cross-contamination
between samples.
3D printing is a new technique that can bypass many limitations seen with PDMS-based
approaches, such as expensive equipment and clean room facilities, thus making the fabrication
process easier, cheaper, and more flexible [26,27,33,34]. There are various 3D printing techniques that
can be used to fabricate microfluidics. The most applicable ones to microfluidics are stereolithography
(SLA), multijet modeling (MJM), and fused deposition modeling (FDM) [27,33–35]. All techniques
use a computer-aided design (CAD) sketch as a blueprint and build the structure layer-by-layer from
printing material, which can be plastic filaments, liquid resin, or powder [27,36]. The most commonly
used commercialized 3D printing technology for micro-fabrication is the SLA technique, which is
defined as a method for making solid objects by successively printing thin layers of a curable material
(i.e., a UV-curable liquid resin) on top of the other [35]. In SLA printing, a laser beam or projector is
used to crosslink the resin in the predetermined pattern [33]. For microfluidic devices, a microchannel
is built by photo-polymerizing the channel walls and then draining the uncured resin from the channel

186
Micromachines 2018, 9, 520

cavity after the printing is complete [37]. For the purpose of microfluidic devices which involve
imaging, clear resin is available.
When a microfluidic device is first manufactured and put into use, it is assumed that the channels
will provide a clean environment for the samples to flow through. However, the size and composition
of these devices can make it unusable after just a few experiments if not designed with reusability
in mind [38]. Within the channels of a microfluidic device, the surface area-to-volume ratio is high,
meaning more of the fluid is exposed to the surfaces of the channel per unit volume. If the device
is made of a porous or hydrophobic material, it can allow molecules to stick to the channel walls,
rendering it unusable. In addition, the charge on a molecule can cause them to stick to the channel
walls if the chip is made of a polar material [39]. Further, if there are areas in the channel where the
fluid flow becomes static, especially around channel intersections, there is a high likelihood that a
molecule buildup will occur, causing elevated levels of absorption or contamination by the molecule,
or even reducing or completely inhibiting the flow through that channel [38]. Nonetheless, the change
in flow through the channel should not overshadow the larger issue: the buildup of molecules,
and possibly cells, can cause largely inaccurate results in sample testing. A primary challenge in
producing microfluidic devices for long-term use is the biofouling that often occurs on the surface of
integrated channels and features [39,40]. This phenomenon occurs, due to surface interactions between
the walls of the channels and the biological sample flowing through the channels. To address the
long-term use of microfluidic devices, there has been a growing research interest in developing new
anti-fouling methods and materials [21,22,41–43]. Additionally, other alternatives, such as recyclable
chips or reusable chips, are actively being explored [23,24,32,44].
Leveraging the advantages of 3D printing with the aim of addressing the need for reusable
microfluidic devices due to their potential societal impact, herein, a 3D-printed microfluidic chip
was designed to assess the reusability of 3D-printed chips by means of quantifying its absorption
characteristics. The proposed solution serves to validate the ability to deliver a sample and clean the
device for reusability. The core function of the demonstrated 3D-printed microfluidic cleaning chip
is to integrate a cleaning procedure into a pre-existing single-use device such that the chip/device
may be reused (Figure 1b). To facilitate the cleaning process, the cleaning chip is connected to a
syringe pump to deliver either the sample, cleaning solution, or air, at a controlled rate, depending
upon which inlet the pump is attached to; the inlet channels converge to a single outlet. In a
real-world application, the sample would flow from the outlet of the cleaning chip into the sample
handling portion of the pre-existing device (Figure 1a,b). For the purpose of assessing the protein
uptake by the chip, a calibration curve (Figure 1c) was created by injecting protein samples of
known concentration into channels of equal dimensions to the cleaning chip, performing fluorescent
assays, and using a fluorescence microscope to quantify the fluorescent light intensity, in which
a greater light intensity corresponds to a greater concentration of protein present. Specifically,
the 3-(4-carboxybenzoyl)quinoline-2-carboxaldehyde (CBQCA) fluorescence detection method was
used, in which the CBQCA fluoresces green in the presence of protein when excited by a blue light
source. For assessing the cross-contamination between samples, the sample from the outlet was
collected, CBQCA was added to the samples, and a plate reader was used to quantify the fluorescence,
thereby reflecting the amount of protein present in the samples. By performing the CBQCA assay on
samples over time during the cleaning procedure, the cross-contamination as a function of washing
volume was determined (Figure 1d).

187
Micromachines 2018, 9, 520

Figure 1. Design, core functionality, and experimental overview: (a) Generalized design of cleaning
chip. The cleaning chip device consists of inlets for the sample, cleaning solution, and air, all connected
to a single outlet. This design allows for a cleaning procedure to be performed on the chip itself and
any external microfluidic device that is connected to the cleaning chip’s outlet; (b) Core functionality
of the cleaning chip. The cleaning chip may be used in conjunction with a pre-existing microfluidic
device, which may itself perform sample handling, analysis, quantification, etc., in order to render
the external device a reusability microfluidic device by connecting the outlet of the cleaning chip to
the inlet of the pre-existing device; (c) Experimental preview of chip protein uptake. The 3D-printed
cleaning chip was connected to a syringe pump, and the cleaning solution was collected from the outlet
of the cleaning chip for protein cross-contamination quantification, while the chip itself was assessed
for protein absorption. A fluorescence detection method was used to determine the concentration of
protein present in the collected samples from the outlet and within the chip itself; the CBQCA assay
used fluoresces green by excitation with blue light. Above, the two images shown provide an example
of the fluorescent images with their respective protein concentrations. Below, the calibration curve
used for determining protein uptake by the chip was constructed by injecting known concentrations of
protein into channels of a chip and imaging the channels using a fluorescence microscope, where the
raw light intensity (on a scale from 0 to 255) was used as the independent variable; (d) Experimental
preview of cross-contamination results. Collected samples were quantified by using a plate reader
to measure the fluorescence of the cleaning solution from the outlet. The observed trend showed the
decreasing protein concentration with the increasing washing volume.

2. Materials and Methods

2.1. Design and Fabrication of 3D-Printed Microfluidic Cleaning Chip


Microfluidic cleaning chips were designed using SolidWorks CAD modeling software (SolidWorks
2017–2018, Dassault Systèmes SOLIDWORKS Corp, Waltham, MA, USA), as seen in Figure 2a. The chip

188
Micromachines 2018, 9, 520

consisted of four channels: a biological sample inlet, a cleaning solution inlet, an air inlet, and a
universal outlet. For each iteration of the chip, the outer dimensions were slimmed down to reduce
material waste, and a viewing window was added to the top and bottom of the chip to improve
through-chip visibility, while the channel width was held constant at 1000 μm. The CAD models were
then fabricated using the Formlabs Form 2 3D SLA printer (Form 2, Formlabs Inc., Somerville, MA,
USA). This 3D printer was chosen due to its high-resolution capabilities. Furthermore, clear resin was
used to fabricate the chips, so it would be possible to view the channels externally (Clear Resin GPCL04,
Formlabs Inc., Somerville, MA, USA). The clear resin also allowed for fluorescence readings to be taken
through the chip. After 3D-printed chips were fabricated, 1 mL of PDMS (Cell Guard Encapsulation Kit,
ML Solar, Campbell, CA, USA) was deposited to the viewing windows on each side of the chip in order
to improve clarity by filling pores of the surface roughness of the 3D-printed material (Figure 2a,b).
The PDMS was degassed and then baked for 20–25 min at 80 ◦ C. The refractive indices of PDMS and
the clear resin have been reported as 1.4 and 1.5, respectively [45,46]. For reference, the refractive
index of mineral oil, which is often used to improve optical clarity of a rough surface, is around 1.47;
however, the bottom viewing window of the 3D-printed chip would necessitate the mineral oil-coated
surface to be overturned, which could pose a risk to the microscope used for protein quantification [47].
Due to the very similar refractive indices of the PDMS and 3D-printed material used in the fabrication
of the chip, there was negligible light interference at the interface between the two materials.

Figure 2. Overview of fabrication and experimental methods: (a) Microfluidic chip is first designed in
SolidWorks, and then 3D-printed using a Formlabs Form 2 printer. Post-printing, a thin layer of PDMS
is poured and cured on both faces of the chip; (b) Addition of the PDMS coating on the outside of the
chip improves visibility. See a comparison of the chip with PDMS (on the left) to the chip without PDMS
(on the right); (c) Image of experimental setup, showing the 3D-printed chip connected to a syringe
pump. The sample from the outlet of the chip was collected in microcentrifuge tubes for fluorescence
detection analysis; (d) Schematic representation of the experimental design and implementation of
the 3D-printed microfluidic chip. The concentrated BSA solution, and phosphate buffered solution
(PBS) as a cleaning solution, and air each have designated inlets which all converge to a single outlet.
The sample from the outlet, collected at set intervals, and the chip itself are then analyzed for the protein
concentration by the CBQCA quantitation method using a plate reader and microscope, respectively.

To determine the optimum channel height for the microfluidic chip, dimensions ranging from
100 μm to 1000 μm were tested. Printing success was assessed by measuring the length of each open
channel and comparing this to the expected channel length. Using 500 μm as a benchmark channel

189
Micromachines 2018, 9, 520

height, which printed semi-reliably and of which success depended greatly on printing parameters,
the ideal printing orientation was determined by analyzing the printing success, as described above,
in relation to print orientation with respect to the build platform of the 3D printer. Ultimately, the chips
were printed with an angled vertical orientation, such that the channels could self-drain excess resin
during printing. Additionally, the Form 2 had higher resolutions in the x- and y-directions than in
the z-direction. The highest-resolution layer height, 0.025 mm, was used; in the x- and y-directions,
the laser could fabricate lines down to 140 microns and holes down to 25 microns. By orienting the
chips vertically, the smallest feature size (the channels) benefited from the higher resolution of the
printer. Furthermore, by angling the chips, the cross-sectional area of the features was effectively
increased. The final chip design was assessed for printing accuracy by measuring the width of the
printed channels using a desktop microscope and comparing this to the expected 1000 μm width.

2.2. Cleaning Procedure


The 3D-printed cleaning chip was designed to enable the reusability of microfluidic chips by
implementing a simple cleaning procedure to reduce biofouling and cross-contamination between
the samples. The cleaning procedure utilized a syringe pump and the four channels of the cleaning
chip (Figure 2c,d). First, the biological sample inlet was used: a representative protein sample,
2 mL of bovine serum albumin (BSA) at a high concentration (20 mg/mL), was pumped through
the chip, with the cleaning solution and air inlets sealed, using a syringe pump set to 1 mL/min
(Thermo Fisher Scientific, Waltham, MA, USA). Following the BSA, air was pumped from the air inlet
and through all three non-air channels individually by sealing the remaining two channels, with 0.5 mL
of air for each channel, also set at 1 mL/min. The cleaning agent was then pumped, with the biological
sample and air inlets sealed, for a total of 10 mL at 1 mL/min. Pure PBS and DI water were tested
as the cleaning agent (Thermo Fisher Scientific, Waltham, MA, USA); PBS was determined to be the
superior choice. The cleaning procedure ended with a second round of the air to dry all the channels
of the chip.

2.3. Protein Cross-Contamination Quantification


While a cleaning agent was pumped through the chip during the cleaning procedure, 200 μL
samples from the outlet were collected at 13 intervals: 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800,
2000, 3000, 5000, and 10,000 μL. The protein level of these samples passing through the device was
quantified using a CBQCA fluorescence detection method (CBQCA Protein Quantitation Kit (C-6667),
Molecular Probes, Inc., Eugene, OR, USA). Using this method, BSA protein as little as 10 ng can
be detected. In the presence of protein, the CBQCA fluorescence green when excited by blue light.
To measure the cross-contamination level of the cleaning solution after passing through the system,
5 μL of KCN (20 mM) and 10 μL of CBQCA reagent (5 mM) were added to 135 μL of each sample
in a microplate. After allowing the samples in the microplate to incubate for 1 hour in darkness,
the fluorescence level was measured using a BioTek Synergy H1 plate reader (Synergy H1 Hybrid
Multi-Mode Reader, BioTek, Winooski, VT, USA).

2.4. Protein Uptake by Cleaning Chip Calibration and Quantification


In order to quantify the protein uptake by the cleaning chip, a calibration chip consisting of 10
channels of equal width and height as the channels of the cleaning chip was designed and 3D-printed.
Each channel was filled with 135 μL of a BSA-in-PBS solution of known concentrations (1, 0.5, 0.25,
0.1, 0.08, 0.06, 0.04, 0.02, 0.01, and 0 mg/mL) mixed with 5 μL of KCN (20 mM) and 10 μL of CBQCA
reagent (5 mM). After incubating for 1 hour in darkness, the channels of the chip were imaged using
a Zeiss Observer z1 fluorescence microscope (Carl Zeiss Microscopy GmbH, Jena, Germany) on the
2.5x objective. The greater the concentration of protein present, the greater the intensity of the green
fluorescence. Intensity was measured using ImageJ (v1.48k, National Institutes of Health, Bethesda,
MD, USA).

190
Micromachines 2018, 9, 520

The protein absorption by the chip—the same chip as the cross-contamination experiment after
being exposed to the 20 mg/mL BSA solution—was then characterized by adding a mixture of 135 μL
of PBS, 5 μL of KCN (20 mM), and 10 μL of CBQCA reagent (5 mM) to the chip’s channels. After a
1-hour incubation period in darkness, the channels of the chip were imaged using the fluorescence
microscope. The light intensity of the channels was compared to the intensity of the calibration chip to
determine the amount of protein absorbed by the chip. The protein uptake was quantified for four
cases: a single-use chip with DI, a single-use chip with PBS, a 6-cycle chip with PBS, and a 6-cycle
chip with PBS and a post-cleaning treatment of 10 mL of 0.25% trypsin (Trypsin-EDTA (0.25%), phenol
red, 25200-056, Thermo Fisher Scientific, Waltham, MA, USA). Trypsin is a protease which hydrolyses
other proteins, and therefore reduces the levels of protein uptake by the cleaning chip significantly by
digesting the adhered and absorbed proteins.

2.5. Longitudinal Protein Cross-Contamination


The longitudinal sample protein cross-contamination was characterized by repeatedly performing
the same analysis as for protein cross-contamination. After completion of each round of pumping
samples through the chip, the chip was cleaned following the prescribed cleaning process.
This procedure of flowing the biological/protein sample, collecting the PBS samples from the outlet,
and cleaning the chip was repeated to demonstrate the collective contamination as a result of repeated
use of the chip.

2.6. Protein Quantification for Urine Processing


The reusability of the 3D-printed cleaning chip for real urine sample handling was validated
by assessing the protein cross-contamination between samples and the protein uptake by the chip.
Urine samples were collected from volunteers according to protocol # H17-043, approved by the
University of Connecticut Institutional Review Board. All subjects provided informed consent.
For studying cross-contamination, samples were pumped through the microfluidic device and collected
in microcentrifuge tubes. Commercially available urine analysis dipsticks (Urinalysis Reagent Strips,
HealthyWiser LLC., Los Angeles, CA, USA) were then dipped into the collected samples and allowed
to incubate for 60 seconds before being imaged with a DSLR camera (REBEL T6, Canon, Melville,
NY, USA) in the RAW image mode with flash for consistent lighting. The captured images were then
converted to grayscale, such that the light intensity of the grayscale image could be correlated to a
specific protein concentration. To facilitate this quantification, a calibration curve was constructed by
least-squares curve fitting of the light intensities from images of the dipstick protein assay pads for
various BSA concentrations (0, 0.15, 0.3, 1, 3, 10, and 20 g/L).
The cross-contamination was studied for an “extreme-case” scenario, in which pumped samples
alternated between urine and high-concentration (20 g/L) BSA. A modified cleaning procedure was
performed between each sample: in addition to pumping PBS (the cleaning solution) through the
universal exit channel, PBS was also pumped through the sample inlet channel. For each cycle,
four samples were collected and analyzed using the dipstick assay: urine, post-urine PBS, BSA, and
post-BSA PBS. The protein uptake by the chip was also studied for this “extreme-case,” in addition to
exposure to pumped urine samples for 30 and 90 min. The total sample volume of the “extreme-case”
was approximately equal to the volume of the 30-min exposure to urine. For each of the three urine
experiments, protein uptake by the chip was quantified using the previously described CBQCA
fluorescent detection method and fluorescent microscope.

3. Results

3.1. Design and Fabrication of 3D-Printed Microfluidic Cleaning Chip


An early chip design (the top-most design depicted in Figure S1a in Supplementary Materials)
was fabricated with a 500 μm channel height by 3D printing at different orientations. That is, the chip

191
Micromachines 2018, 9, 520

was oriented, with respect to the print platform, at the (Formlabs Preform software, v2.17.1, Formlabs
Inc., Somerville, MA, USA) default 45-degree angle, vertically, horizontally, and lied flat flush along
the print platform. The channels of the printed chips were then injected with food dye to visualize
the printed length of each channel. The printed length (i.e., the length colored by the food dye) was
measured and reported as a fraction of the total expected length; these results are presented in Table 1.
The outlet channel consistently had the lowest printing success, attributed to the fact that the outlet
was the furthest from the print platform. As the chip was printed, the distance from the print platform
increased, allowing for greater deflection that results in misalignment and misprints. The default
orientation was chosen as the optimal orientation, despite the vertical orientation having slightly better
success, since the default angled orientation allowed for a greater amount of supports. The final chip
design (Figure S1b, Supplementary Materials) was also assessed for printing accuracy. A desktop
microscope was used to image the width of the channels. The measured printed width and the percent
error are reported in Table 2. It should also be noted that in both Tables 1 and 2, the left inlet exhibited
greater printing success than the right inlet; this can be attributed to the slight rotation about the
vertical axis used by the default orientation setting, which positions the left inlet was marginally closer
to the print platform than the right inlet. The low average percent error in printing was deemed
sufficient to not warrant a redesign of the chip’s channels.

Table 1. Analysis and comparison of print orientations. A 500 μm channel height chip was printed
using the four different possible orientations: the default angle, vertical, horizontal (along the chip’s
side), and flat (face-down). The 500 μm channel height was chosen for this quantification since it
was at the threshold of printability. The channels of the chip were injected with red dye, and the
fraction of the channel that was open was measured and recorded. For all values presented, there was
measurement error of ±0.03 (1 mm measure per 38 mm channel length). The outlet channel consistently
had inferior results due to its further distance from the build platform during printing. Vertical and
the default angled orientations provide the best results, as evidenced by the highest average channel
success values.

Print Inlet Inlet Inlet Average Printing


Outlet
Orientation (Left) (Middle) (Right) Success
Default (45◦ ) 0.83 0.57 0.57 0.03 0.5
Vertical 0.83 0.73 0.67 0.13 0.59
Horizontal 0.5 0.07 0.17 0.07 0.2025
Flat 0 0 0 0 0

Table 2. Measurements and analysis of printing success of the final 3D-printed microfluidic chip design.
The expected width of all channels was 1000 μm. For all values presented, there was a measurement
error of ±0.01 μm. The actual printed width and percent error are presented.

Channel Printed Width (μm) Percent Error (%)


Outlet 924.73 7.53
Inlet (Left) 946.25 5.38
Inlet (Middle) 913.98 8.60
Inlet (Right) 892.47 10.75
Average 919.36 8.07

The progression of the chip design process is depicted in Figure S1a (Supplementary Materials),
from top to bottom. The initial chip was created with a specific focus on developing the interior channel
pattern, as well as the channel inlet/outlet ports along the perimeter of the chip. As the design iterations
continued, changes were made to the outer dimensions of the chip, reducing material usage and print
time by removing excess solid portions (Figure S1e, Supplementary Materials). In addition, a viewing
window was added, first to the top only and then to both faces of the chip, to increase through-chip

192
Micromachines 2018, 9, 520

visibility, which is particularly important for performing fluorescence imaging on the chip. The final
chip design is presented in Figure S1b (Supplementary Materials), which features large viewing
windows and an overall slim design with channels of 1000 μm wide by 750 μm high. To determine
the ideal channel height, a parallel channel chip was designed, as seen in Figure S1c (Supplementary
Materials), where each channel had a constant width of 1000 μm and the height was varied for 100,
200, 300, 400, 500, and 1000 μm. By eliminating channels that did not print (i.e., the channel was filled
with cured resin), it was deduced that the optimal channel height was between 500 μm and 1000 μm.
The final chip design was then printed with 500 μm, 625 μm, and 750 μm channel heights, and 750 μm
was ultimately the dimension with the best and most reliable printability. Using the final channel
dimensions, a calibration chip was printed (Figure S1d, Supplementary Materials), which consisted of
ten channels; each channel was then filled with different concentrations of BSA and imaged using the
fluorescence microscope.

3.2. Characterization of Protein Cleaning Procedure


The effectiveness of the cleaning process (explained graphically in Figure 3a) for reducing the
degree of cross-contamination between samples and the protein absorption by the chip was assessed
using CBQCA assay for various scenarios: after one cycle use of the chip with DI water as the cleaning
agent (i.e., the BSA sample was applied and the channels were dried and washed with the cleaning
agent), after one cycle use of the chip with PBS as the cleaning agent, after six cycles of repeated use of
a chip with PBS as the cleaning agent, and a repeat of the six cycles of repeated use with PBS and an
additional post-treatment of trypsin. For each experiment, 13 samples were collected from an outgoing
cleaning agent at different time/volume points, as described above in Methods. Two cleaning agents,
PBS and DI water, were used separately for comparison. For both of the cleaning reagents, the BSA
concentration is high at first and then decreases with the more washing volume; this decreasing BSA
cross-contamination trend follows an exponential decay as a function of washing volume. A negligible
amount of BSA was seen in PBS samples after 3000 μL, while this value was 5000 μL for DI water
(Figure 3b). These results showed that using PBS as a cleaning agent is over 4 times more effective
than using DI water, in terms of cross-contamination.
In addition to cross-contamination, the amount of protein absorption by the chip was measured
after one-cycle use and repeated cycles of sample introduction and cleaning. The fluorescent
microscope was used to measure the amount of protein in the channels after adding CBQCA. The light
intensities in the images were analyzed for each channel. The light intensities inside and outside the
channel were calculated using ImageJ software (v1.48k, National Institutes of Health, Bethesda, MD,
USA). The light intensity outside the channel was used as a control as there was no protein, and hence
no illumination occurred in that area. Figure 3c shows the average amount of protein absorption after
cleaning with PBS and DI water. The chip that was cleaned with DI water shows significantly more
absorbed BSA than the chip cleaned with PBS, (794 ± 99) ng/cm2 compared to (486 ± 104) ng/cm2 ,
respectively. This leads to the conclusion that cleaning with PBS is over 1.6 times as effective as cleaning
with DI water, in terms of chip protein uptake. Therefore, in further experiments, PBS was chosen as
the cleaning reagent.
The longitudinal cross-contamination was also investigated to validate the proposed 3D-printed
microfluidic chip and cleaning process for application in a setting, where a single device could be used
repeatedly. After flowing the BSA sample through the inlet, the channels were dried and washed by
flowing air and PBS through the chip. This cycle was repeated six times, with the 13 samples collected
for each cycle, and all the collected samples were analyzed with the CBQCA assay. Comparing the
obtained plate reader fluorescence results, it was clear that the amount of protein in the collected
samples is reduced by increasing the amount of washing volume (Figure 3d). The average BSA
concentration in the first 200 μL of PBS collections of all cycles was (392 ± 200) μg/mL (standard
deviation is depicted in Figure 3d using error bars) and this amount is decreased sharply within 1000 μL
of washing with PBS and then dwindled to zero. The overall trend is similar to the results of one-cycle

193
Micromachines 2018, 9, 520

cross contamination assessment. As seen in Figure 3d, the standard deviation in the measured BSA
concentration for the first four samples of each cycle is significant due to the accumulation of BSA
in the chip after each cycle; in other words, the large error bars represent the variation between
the increased number of cycles. For example, higher cycles would lie closer to the top of the error
bars, while the beginning cycles would be towards the bottom. The error bars shorten afterwards,
which demonstrated that no matter how many times the chip was used, after washing with as much as
5000 μL, all the possible BSA has been removed, or only negligible BSA is present afterwards. It should
be noted that it does not mean that all the BSA has been washed out, as some of the BSA was absorbed
and accumulated in the chip.

Figure 3. Protein cleaning characterization: (a) Graphical representation of one-cycle of the cleaning
procedure. The PBS from the outlet was collected at set intervals for the cross-contamination
results; (b) Cross-contamination of a single-use chip using deionized (DI) water compared to PBS
as a cleaning solution with the BSA concentration in the output PBS or DI sample using a new
chip. Cross-contamination is significantly reduced by using PBS, as compared to DI; (c) Protein
absorption by a single-use 3D-printed chip after cleaning with DI compared to PBS. After cleaning
with PBS, approximately half as much protein uptake remained, as compared to after cleaning with DI;
(d) Cross-contamination of a repeated-use chip with the BSA concentration in the output PBS sample
for 6 cycles using the same chip repeatedly, graphed as the mean with standard deviation error bars;
(e) Protein absorption by the 3D-printed chip after 6 cycles of repeated use. By adding a post-cleaning
treatment of trypsin after the 6 cycles of repeated use, the protein uptake is decreased by nearly half.

The protein uptake after six repeated cycles was shown to be (758 ± 30) ng/cm2 (Figure 3e),
which is approximately twice the amount of uptake after single use of the chip. This showed a
promising trend that even after six repeated cycles of use, chip protein uptake less-than doubles,
demonstrating a favorable relationship in that there was not a one-to-one relationship between cycles

194
Micromachines 2018, 9, 520

(and therefore exposure to BSA sample) and protein uptake. This can be taken to mean that the total
protein uptake by the chip may approach a plateau after a relatively low number of cycles of use.
Furthermore, by flowing 10 mL of trypsin after the six cycles of samples and cleaning, the protein
uptake was reduced to (412 ± 66) ng/cm2 . These favorable results are due to the protease function
of the trypsin, which digests a portion of the BSA on the chip. This means that by adding trypsin,
the effectiveness of the cleaning procedure can be further improved.

3.3. Protein Quantification for Urine Processing


The 3D-printed cleaning chip was demonstrated for application to urine testing using
commercially available dipstick protein assay pads. For handling multiple samples, the cleaning
procedure, depicted graphically in Figure 4a, was slightly modified to include PBS cleaning of both the
sample inlet channel and the universal outlet channels. Additionally, the volume of cleaning solution
was reduced to 300 μL. Using this modified cleaning procedure, urine samples and high-concentration
(20 g/L) BSA were alternatingly pumped through the chip. The resulting protein uptake by the chip
was (657 ± 69) ng/cm2 (Figure 4b). Comparatively, the protein uptake after 30 min of pumping urine
(approximately the same total sample volume) with no intermediate cleaning was (364 ± 54) ng/cm2 .
The difference between these values is attributed to the high-concentration BSA, which was used in
the former experiment. When the exposure time to urine without cleaning was increased to 90 min,
the protein uptake was (443 ± 70) ng/cm2 . This is a favorable result because for tripling the exposure
time to urine, and tripling the volume of urine processed by the chip, the protein uptake only increased
by 21.7%.
The cross-contamination between samples was also studied for the alternating urine and
high-concentration (20 g/L) BSA. The protein assay pads of commercially available dipsticks were
dipped in BSA samples of various concentrations (0, 0.15, 0.3, 1, 3, and 10 g/L). The resulting color
change was converted into a change in grayscale light intensity. A calibration curve was created using
least-squares curve fitting; the resulting curve, depicted on the left of Figure 4c, was found to be
y = −0.000002618x4 + 0.001382x3 + 0.2630x2 + 20.8829x − 552.0138 with a correlation coefficient of
R2 = 0.963. The calibration curve was then verified by comparing the protein concentration calculated
via image analysis to the actual protein concentration of the samples, as shown on the right of Figure 4c.
Figure 4d shows the longitudinal quantification of protein concentration for 20 cycles of urine
samples, post-urine PBS cleaning solution, BSA samples, and post-BSA PBS cleaning solution (a total
of 81 pumping steps). The average protein concentration in the urine samples after pumping through
the cleaning chip, represented by the orange dotted line, was 0.8072 g/L, as compared to the true value
of 0.4958 g/L. This deviation is attributed to the low sensitivity of the urine dipstick assay for low
protein concentrations; in fact, for this range of protein concentration, the color key provided by the
dipstick manufacturer only discerns between 0.3 g/L and 1.0 g/L. The average protein concentration
of the PBS, represented by the green dotted line, was 4.0715 g/L. Although there is no protein present
in the PBS cleaning solution originally, the protein concentration after pumping through the chip is
elevated as it washes out protein from the previous sample. Despite the cross-contamination between
the high-concentration BSA and subsequent PBS cleaning solution, the cleaning and air-drying steps
are sufficient for yielding consistent urine concentration results. Figure 4e shows images of the dipstick
pads for the gray region of Figure 4d.

195
Micromachines 2018, 9, 520

Figure 4. Performance of 3D-printed cleaning chip for urinary protein measurement: (a) Graphical
representation of one-cycle of the modified cleaning procedure; (b) Protein absorption by the 3D-printed
cleaning chip after 30 min of pumping urine (without cleaning), 90 min of pumping urine (without
cleaning), and 20 cycles of alternating urine and high-concentration BSA samples (with cleaning
between samples); (c) Left: calibration curve for the actual protein concentration versus the grayscale
intensity of protein assay pads, calculated by least-squares curve fitting. Right: comparison of the
calculated protein concentration using the calibration curve versus the actual concentration of the
samples. Far right: photographs of the protein assay pads for 0, 0.15, 0.3, 1, 3, 10, and 20 g/L,
shown in full color and grayscale; (d) Longitudinal protein concentration measurement for 20 cycles
(81 pumping steps) of urine, PBS cleaning, high-concentration BSA, and a second round of PBS cleaning.
Urine samples, PBS and BSA are represented by blue, green, and blue lines, respectively. Dotted lines
represent the average protein concentration for the respective sample; (e) Photographs of the protein
assay pads for Cycle 6, Steps 21–25.

4. Discussion
Reusability of microfluidic devices is critical for any devices that will go to market; however,
fouling of the devices’ channels can pose a significant challenge. For a microfluidic device capable
of being commercialized, it must work reliably over a long period of time and for a wide variety of

196
Micromachines 2018, 9, 520

samples [38]. Characterization of the protein absorption of 3D-printed material, specifically Formlabs
Clear Resin for SLA printing, was performed to validate the reusability of 3D-printed microfluidic
chips. Furthermore, the cleaning chip and cleaning procedure proposed here is an efficient and cost-
and time-effective solution for enabling the reusability of microfluidic devices. 3D printing is a low-cost,
rapid-prototyping method for fabrication that is simpler, cheaper, and faster than soft lithography.
The reusable design of this 3D-printed microfluidic chip also replaces the need for fabrication and
disposal of many separate devices for the delivery and testing of multiple samples.
As the proposed cleaning chip design has shown favorable results, i.e., minimal protein
cross-contamination and protein absorption has occurred, our work here sets a precedent for
considering reusability when designing 3D-printed microfluidic devices. Future research directions
may look to further assess other factors contributing to the reusability of devices. It is known
that the nature of the sample, the materials from which the device is fabricated, and the flow of
samples can all contribute to the fouling that occurs. Other 3D-printed materials may be studied
to determine their respective absorption characteristics. BSA, a protein often found in urine,
was chosen as a representative protein sample; however, different mixtures of proteins may exhibit
different absorption characteristics based on charge, hydrophobicity/hydrophilicity, or other surface
interactions. With different constituents in the mixture, proteins may unfold; for instance, a protein may
be hydrophilic on the surface, but upon unfolding, it might expose a hydrophobic interior, which can
affect its absorption behavior. Additionally, since bacteria can feed on residual samples left in the
chip and can further contribute to the fouling problem, bacteria adsorption and cross-contamination
studies may be performed. It is important to quantify and characterize the bacterial contamination as
bacteria could negatively impact the results of some assays. Other future work may also consider the
influence of flow rate. Finally, in order to achieve the goal of integrating the demonstrated cleaning
chip into a functional microfluidic chip, in the future, the cleaning procedure should be automated
and self-contained.

Supplementary Materials: The following is available online at http://www.mdpi.com/2072-666X/9/10/520/s1,


Figure S1: Design iterations of the 3D-printed microfluidic chip for reusability assessment.
Author Contributions: S.T. designed the experiments. E.L. and R.A. performed the experiments. E.L. and S.T.
wrote and edited the manuscript.
Acknowledgments: S.T. acknowledges the American Heart Association Scientist Development Grant
(15SDG25080056), Connecticut Innovations Biopipeline Award, and the University of Connecticut Research
Excellence Program award for financial support of this research. The authors acknowledge Julia Dugas, Patrick
Madaus, and Farnoosh Saeedinejad for their assistance.
Conflicts of Interest: S.T. is a founder of, and has an equity interest in mBiotics, LLC, a company that is developing
microfluidic technologies for point-of-care diagnostic solutions. S.T. and R.A. are a founder of, and has an equity
interest in QRfertile, LLC, a company that is developing microfluidic technologies for fertility testing. S.T.’s and
R.A.’s interests were viewed and managed in accordance with the conflict of interest policies. The authors have
no other relevant affiliations or financial involvement with any organization or entity with a financial interest in
or financial conflict with the subject matter or materials discussed in the manuscript, apart from those disclosed.

References
1. Wankhede, S.P.; Du, Z.; Berg, J.M.; Vaughn, M.W.; Dallas, T.; Cheng, K.H.; Gollahon, L. Cell detachment
model for an antibody-based microfluidic cancer screening system. Biotechnol. Prog. 2006, 22, 1426–1433.
[CrossRef] [PubMed]
2. Leoncini, E.; Ricciardi, W.; Cadoni, G.; Arzani, D.; Petrelli, L.; Paludetti, G.; Brennan, P.; Luce, D.; Stucker, I.;
Matsuo, K.; et al. Lab-on-a-chip for oral cancer screening and diagnosis. Head Neck 2014, 36, 1391. [CrossRef]
3. Kim, L. Overview of the microfluidic diagnostics commercial landscape. In Microfluidic Diagnostics. Methods
in Molecular Biology (Methods and Protocols); Jenkins, G., Mansfield, C., Eds.; Humana Press: Totowa, NJ, USA,
2013; Volume 949.
4. Srinivasan, V.; Pamula, V.K.; Fair, R.B. An integrated digital microfluidic lab-on-a-chip for clinical diagnostics
on human physiological fluids. Lab Chip 2004, 4, 310–315. [CrossRef] [PubMed]

197
Micromachines 2018, 9, 520

5. Hsu, Y.-H.; Moya, M.L.; Hughes, C.C.W.; George, S.C.; Lee, A.P. A microfluidic platform for generating
large-scale nearly identical human microphysiological vascularized tissue arrays. Lab Chip 2013, 13, 2990.
[CrossRef] [PubMed]
6. Toh, Y.-C.; Lim, T.C.; Tai, D.; Xiao, G.; van Noort, D.; Yu, H. A microfluidic 3D hepatocyte chip for drug
toxicity testing. Lab Chip 2009, 9, 2026. [CrossRef] [PubMed]
7. Yu, L.; Chen, M.C.W.; Cheung, K.C. Droplet-based microfluidic system for multicellular tumor spheroid
formation and anticancer drug testing. Lab Chip 2010, 10, 2424. [CrossRef] [PubMed]
8. Chin, C.D.; Linder, V.; Sia, S.K. Commercialization of microfluidic point-of-care diagnostic devices. Lab Chip
2012, 12, 2118. [CrossRef] [PubMed]
9. Sia, S.K.; Kricka, L.J. Microfluidics and point-of-care testing. Lab Chip 2008, 8, 1982. [CrossRef] [PubMed]
10. Foudeh, A.M.; Fatanat Didar, T.; Veres, T.; Tabrizian, M. Microfluidic designs and techniques using
lab-on-a-chip devices for pathogen detection for point-of-care diagnostics. Lab Chip 2012, 12, 3249. [CrossRef]
[PubMed]
11. Yenilmez, B.; Knowlton, S.; Tasoglu, S. Self-Contained Handheld Magnetic Platform for Point of Care
Cytometry in Biological Samples. Adv. Mater. Technol. 2016, 1, 1600144. [CrossRef]
12. Knowlton, S.; Joshi, A.; Syrrist, P.; Coskun, A.F.; Tasoglu, S. 3D-Printed Smartphone-Based Point of Care
Tool for Fluorescence- and Magnetophoresis-Based Cytometry. Lab Chip 2017, 17, 2839–2851. [CrossRef]
[PubMed]
13. Lepowsky, E.; Ghaderinezhad, F.; Knowlton, S.; Tasoglu, S. Paper-based assays for urine analysis.
Biomicrofluidics 2017, 11, 051501. [CrossRef] [PubMed]
14. Maciosek, M.V.; Coffield, A.B.; Flottemesch, T.J.; Edwards, N.M.; Solberg, L.I. Greater use of preventive
services in U.S. health care could save lives at little or no cost. Health Aff. 2010, 29, 1656–1660. [CrossRef]
[PubMed]
15. Ashraf, M.W.; Tayyaba, S.; Afzulpurkar, N. Micro Electromechanical Systems (MEMS) based microfluidic
devices for biomedical applications. Int. J. Mol. Sci. 2011, 12, 3648–3704. [CrossRef] [PubMed]
16. Jivani, R.R.; Lakhtaria, G.J.; Patadiya, D.D.; Patel, L.D.; Jivani, N.P.; Jhala, B.P. Biomedical microelectromechanical
systems (BioMEMS): Revolution in drug delivery and analytical techniques. Saudi Pharm. J. 2016, 24, 1–20.
[CrossRef] [PubMed]
17. Fujii, T. PDMS-based microfluidic devices for biomedical applications. Microelectron. Eng. 2002, 61–62, 907–914.
[CrossRef]
18. Dario, P.; Carrozza, M.C.; Benvenuto, A.; Menciassi, A. Micro-systems in biomedical applications.
J. Micromech. Microeng. 2000, 10, 235–244. [CrossRef]
19. Knowlton, S.; Yu, C.H.; Jain, N.; Ghiran, I.C.; Tasoglu, S. Smart-phone based magnetic levitation for
measuring densities. PLoS ONE 2015, 10, 1–17. [CrossRef] [PubMed]
20. Knowlton, S.; Yenilmez, B.; Tasoglu, S. Towards Single-Step Biofabrication of Organs on a Chip via 3D
Printing. Trends Biotechnol. 2016, 34, 685–688. [CrossRef] [PubMed]
21. Zhang, H.; Chiao, M. Anti-fouling coatings of poly(dimethylsiloxane) devices for biological and biomedical
applications. J. Med. Biol. Eng. 2015, 35, 143–155. [CrossRef] [PubMed]
22. Picher, M.M.; Küpcü, S.; Huang, C.-J.; Dostalek, J.; Pum, D.; Sleytr, U.B.; Ertl, P. Nanobiotechnology advanced
antifouling surfaces for the continuous electrochemical monitoring of glucose in whole blood using a
lab-on-a-chip. Lab Chip 2013, 13, 1780. [CrossRef] [PubMed]
23. Lepowsky, E.; Tasoglu, S. Emerging Anti-Fouling Methods: Towards Reusability of 3D-Printed Devices for
Biomedical Applications. Micromachines 2018, 9, 196. [CrossRef]
24. Amin, R.; Li, L.; Tasoglu, S. Assessing reusability of microfluidic devices: Urinary protein uptake by
PDMS-based channels after long-term cyclic use. Talanta 2018, 192, 455–462. [CrossRef]
25. Shields, C.W.; Ohiri, K.A.; Szott, L.M.; López, G.P. Translating microfluidics: Cell separation technologies
and their barriers to commercialization. Cytom. Part B Clin. Cytom. 2017, 92, 115–125. [CrossRef] [PubMed]
26. Amin, R.; Joshi, A.; Tasoglu, S. Commercialization of 3D-printed microfluidic devices. J. 3D Print. Med. 2017,
1, 85–89. [CrossRef]
27. Amin, R.; Knowlton, S.; Hart, A.; Yenilmez, B.; Ghaderinezhad, F.; Katebifar, S.; Messina, M.; Khademhosseini, A.;
Tasoglu, S. 3D-printed microfluidic devices. Biofabrication 2016, 8, 022001. [CrossRef] [PubMed]

198
Micromachines 2018, 9, 520

28. Beebe, D.J.; Moore, J.S.; Yu, Q.; Liu, R.H.; Kraft, M.L.; Jo, B.-H.; Devadoss, C. Microfluidic tectonics: A
comprehensive construction platform for microfluidic systems. Proc. Natl. Acad. Sci. USA 2000, 97, 13488–13493.
[CrossRef] [PubMed]
29. Rolland, J.P.; Van Dam, R.M.; Schorzman, D.A.; Quake, S.R.; DeSimone, J.M. Solvent-Resistant Photocurable
“Liquid Teflon” for Microfluidic Device Fabrication. J. Am. Chem. Soc. 2004, 126, 2322–2323. [CrossRef] [PubMed]
30. Sugioka, K.; Cheng, Y. Femtosecond laser processing for optofluidic fabrication. Lab Chip 2012, 12, 3576–3589.
[CrossRef] [PubMed]
31. Yalikun, Y.; Hosokawa, Y.; Iino, T.; Tanaka, Y. An all-glass 12 μm ultra-thin and flexible micro-fluidic chip
fabricated by femtosecond laser processing. Lab Chip 2016, 16, 2427–2433. [CrossRef] [PubMed]
32. Wan, A.M.D.; Devadas, D.; Young, E.W.K. Recycled polymethylmethacrylate (PMMA) microfluidic devices.
Sens. Actuators B Chem. 2017, 253, 738–744. [CrossRef]
33. Au, A.K.; Huynh, W.; Horowitz, L.F.; Folch, A. 3D-Printed Microfluidics. Angew. Chem. Int. Ed. 2016, 55,
3862–3881. [CrossRef] [PubMed]
34. Ho, C.M.B.; Ng, S.H.; Li, K.H.H.; Yoon, Y.-J. 3D printed microfluidics for biological applications. Lab Chip
2015, 15, 3627–3637. [CrossRef] [PubMed]
35. Waheed, S.; Cabot, J.M.; Macdonald, N.P.; Lewis, T.; Guijt, R.M.; Paull, B.; Breadmore, M.C. 3D printed
microfluidic devices: enablers and barriers. Lab Chip 2016, 16, 1993–2013. [CrossRef] [PubMed]
36. Brennan, M.D.; Bokhari, F.F.; Eddington, D.T. Open design 3D-printable adjustable micropipette that meets
the ISO standard for accuracy. Micromachines 2018, 9. [CrossRef]
37. Bhattacharjee, N.; Urrios, A.; Kang, S.; Folch, A. The upcoming 3D-printing revolution in microfluidics.
Lab Chip 2016, 16, 1720–1742. [CrossRef] [PubMed]
38. Mukhopadhyay, R. When Microfluidic Devices Go Bad. Anal. Chem. 2005, 77, 429A–432A. [CrossRef] [PubMed]
39. Wong, I.; Ho, C.M. Surface molecular property modifications for poly(dimethylsiloxane) (PDMS) based
microfluidic devices. Microfluid. Nanofluidics 2009, 7, 291–306. [CrossRef] [PubMed]
40. Goyanes, A.; Buanz, A.B.M.; Hatton, G.B.; Gaisford, S.; Basit, A.W. 3D printing of modified-release
aminosalicylate (4-ASA and 5-ASA) tablets. Eur. J. Pharm. Biopharm. 2015, 89, 157–162. [CrossRef] [PubMed]
41. Leslie, D.C.; Waterhouse, A.; Berthet, J.B.; Valentin, T.M.; Watters, A.L.; Jain, A.; Kim, P.; Hatton, B.D.;
Nedder, A.; Donovan, K.; et al. A bioinspired omniphobic surface coating on medical devices prevents
thrombosis and biofouling. Nat. Biotechnol. 2014, 32, 1134–1140. [CrossRef] [PubMed]
42. Tu, Q.; Wang, J.C.; Liu, R.; He, J.; Zhang, Y.; Shen, S.; Xu, J.; Liu, J.; Yuan, M.S.; Wang, J. Antifouling properties
of poly(dimethylsiloxane) surfaces modified with quaternized poly(dimethylaminoethyl methacrylate).
Colloids Surf. B Biointerfaces 2013, 102, 361–370. [CrossRef] [PubMed]
43. Sunny, S.; Cheng, G.; Daniel, D.; Lo, P.; Ochoa, S.; Howell, C.; Vogel, N.; Majid, A.; Aizenberg, J. Transparent
antifouling material for improved operative field visibility in endoscopy. Proc. Natl. Acad. Sci. USA 2016,
113, 201605272. [CrossRef] [PubMed]
44. Carve, M.; Wlodkowic, D. 3D-printed chips: Compatibility of additive manufacturing photopolymeric
substrata with biological applications. Micromachines 2018, 9. [CrossRef]
45. Whitesides, G.M.; Tang, S.K.Y. Fluidic optics. Proc. SPIE 2006, 6329, 63290A. [CrossRef]
46. Refractive Index of Clear Resin. Available online: https://forum.formlabs.com/t/refractive-index-of-clear-
resin/9282 (accessed on 14 October 2018).
47. International Gem Society Refractive Index List of Common Household Liquids. Available online:
https://www.gemsociety.org/article/refractive-index-list-of-common-household-liquids/ (accessed on
14 October 2018).

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

199
MDPI
St. Alban-Anlage 66
4052 Basel
Switzerland
Tel. +41 61 683 77 34
Fax +41 61 302 89 18
www.mdpi.com

Micromachines Editorial Office


E-mail: [email protected]
www.mdpi.com/journal/micromachines
MDPI
St. Alban-Anlage 66
4052 Basel
Switzerland
Tel: +41 61 683 77 34
Fax: +41 61 302 89 18
www.mdpi.com ISBN 978-3-03897-468-0

You might also like