KINGSBOROUGH COMMUNITY COLLEGE

CITY UNIVERSITY OF NEW YORK

DEPARTMENT OF BIOLOGICAL SCIENCES

GENERAL BIOLOGY I (BIO 01300) SYLLABUS

Spring 2020 – Summer 2020

COURSE DESCRIPTION:
BIO 1300, 1400 – GENERAL BIOLOGY I AND II (4 crs. 6 hrs. each semester) A one-year, two-semester course
for students who plan to major in biological sciences, or prepare for a preprofessional program. Classroom and
laboratory sessions focus on biological topics as they apply to all life, to recent scientific findings and how they
advance understanding classical concepts, the interaction of environmental and biological forces to produce life.
Prerequisites for BIO 1300: Passing scores on the CUNY Reading and Writing exams and the COMPASS Math
Skills Test. Prerequisite for BIO 1400: BIO 1300

STUDENT LEARNING OUTCOMES

Upon completion of the course students should be able to:

• Demonstrate knowledge of the structure and function of cells.

• Develop a hypothesis to a scientific question, design an experiment to test the hypothesis, and write a
scientific paper on the results of an experiment.
• Use a light microscope to view cell structure and document findings using drawings.
• Analyze biological data and develop a conclusion using scientific reasoning.
• Solve problems involving Mendelian inheritance and genetics.

GRADES
The General Biology I course will be graded as follows:
50% Lecture, 20% of which will be the final examination, and
50% Laboratory
Additional details regarding examinations, assignments, etc. will be provided by your lecture instructor; details
regarding quizzes, papers, other assignments, etc. will be provided by your laboratory instructor.

ATTENDANCE
Kingsborough Community College has a class attendance policy. For a course that meets 6 hours a week, students
cannot miss more than 12 hours of lecture. You may also not miss more than 2 labs. A student that has missed more
hours of class than is allowed by the College attendance policy will receive a grade of WU. An INC (incomplete)
grade is only assigned if a student is doing passing work, but missing an assignment or an examination. An INC
grade changes to a “FIN,” if work is not made up by the 10th week of the next 12-week module

TEXTBOOKS
The required textbook readings and lab manual for this course are both provided online by the instructor.
ADDITIONAL REQUIREMENTS
Students must purchase a knee-length laboratory coat & goggles. Laboratory coats will be worn at all times during classes in
the laboratory. Students that do have a laboratory coat will not be allowed into a biology laboratory. Students wearing open-
toed shoes will not be allowed into a biology laboratory. Gloves will not be provided but may be purchased by students if they
wish to use gloves.

ACCESSIBILITY
Access-Ability Services (AAS) serves as a liaison and resource to the KCC community regarding disability issues,
promotes equal access to all KCC programs and activities, and makes every reasonable effort to provide appropriate
accommodations and assistance to students with disabilities. Please contact this office if you require such
accommodations and assistance. Your instructor will be glad to make the accommodations you need, but you must have
documentation from the Access-Ability office for any accommodations.

CIVILITY
The following statement is from KCC’s Website on Civility: “Kingsborough Community College is committed to the
highest standards of academic and ethical integrity, acknowledging that respect for self and others is the foundation of
educational excellence. Civility in the classroom and respect for the opinions of others is very important in an academic
environment. It is likely you will not agree with everything that is said or discussed in the classroom. Courteous behavior
and responses are expected. Therefore, in this classroom, any acts of harassment, and/or discrimination based on matters
of race, gender, sexual orientation, religion, and/or ability is not acceptable. Whether we are students, faculty, or staff, we
have a right to be in a safe environment, free of disturbance and civil in all aspects of human relations.”

ACADEMIC INTEGRITY
Academic Dishonesty is prohibited in The City University of New York and is punishable by penalties, including failing
grades, suspension, and expulsion, as provided herein. Additional information can be found in the College catalog
(http://www.kingsborough.edu/sub-registration/Pages/catalog.aspx )

Plagiarism as a violation of academic integrity

Students will be asked to write papers and laboratory assignments. During this endeavor, they should be careful to avoid
plagiarism. Plagiarism is the intentional theft(s) of someone else’s intellectual property without attribution (proper credit).
Determination and penalty – ranging from grade reduction to course failure – will be decided by the instructor.
Internet plagiarism includes submitting downloaded term papers or parts of term papers, paraphrasing or copying
information from the internet without citing the source, and “cutting & pasting” from various sources without proper
attribution.

VISION AND CHANGE

This course has been aligned with National Science Foundation’s Vision and Change. To this end, creative teaching strategies
have been developed to facilitate student learning. The objectives of the course are structured to achieve the course learning
outcomes. Assessment of some or all course learning outcomes is done every semester, the results are analyzed, and
suggestions for improving student learning, and meeting the course learning outcomes, are discussed. In addition, suggestions
are provided on assessment strategies. Finally, the incorporation of the following lecture and lab activities, which are
important in developing competencies that last beyond the classroom, are encouraged:
1. Lab activities that are inquiry-based
2. Activities that foster critical thinking
3. Activities that promote quantitative competencies
4. Activities that relate the scientific information to real world practices

Recommendations to the Student:

• Textbook pages as well as laboratory assignments should be read before class.
• Observe all safety precautions as instructed in the laboratory. They are for your protection.
• Each student is responsible for the proper and safe maintenance of their laboratory work area. Bench tops and
microscopes must be properly cleaned before and after use.
 LECTURE TOPIC OUTLINE
BIOLOGY 13

LECTURE TOPICS

1. Introduction to biology and the scientific method

Evolution, the Themes of Biology, and Scientific Inquiry

2. Review of basic chemistry and properties of water

The Chemical Context of Life
Water and Life
Carbon and the Molecular Diversity of Life

3. Macromolecules
The Structure and Function of Large Biological Molecules

4. Cell Structure and Function

A Tour of the Cell
Membrane Structure and Function

5. Metabolism and cellular respiration

An Introduction to Metabolism
Cellular Respiration and Fermentation

6. Photosynthesis
Photosynthesis

7. The cell cycle, mitosis and meiosis

The Cell Cycle
Meiosis and Sexual Life Cycles

8. Classical genetics
Mendel and the Gene Idea
The Chromosomal Basis of Inheritance

9. Molecular biology
The Molecular Basis of Inheritance

10. Gene expression

Gene Expression: From Gene to Protein

11. Techniques used in molecular biology

DNA Tools and Biotechnology
 LABORATORY OUTLINE
BIOLOGY 13

Laboratory Exercises are Provided Online by the Instructor

Week Topic Exercises

1 Laboratory Safety Rules and Guidelines Handout

The Metric System: Measurements and Laboratory Lab Topic 1A
Equipment

2 The Process of Scientific Inquiry Lab Topic 2A

Scientific Inquiry Experiment Lab Topic 2B

3 Basic Chemistry: Atoms, Molecules, Electrolytes, Acids, Lab Topic 3

Bases, pH, Buffers, Organic Chemistry Exercises 3.1-3.3, 3.5, 3.7-3.10
Macromolecules Lab Topic 4 Part 2
Exercises 4.1A, 4.1B, 4.2-4.4

4 Microscopy: Theory and Practice Lab Topic 4 Part 1

Protozoan Wet Mount

5 Structure and Function of Living Cells Lab Topic 5A

Diffusion, Osmosis and the Functional Significance Lab Topic 5B
of Biological Membranes. Exercises 5.2, 5.3A-5.3D

6 Enzymes: Catalysts of Life Lab Topic 6

Exercises 6.1-6.4

7 Cellular Respiration Lab Topic 8

Exercise 8.1

8 Photosynthesis: Capture of Light Energy Lab Topic 7

Exercises 7.1, 7.4-7.8

9 Chromosomes and Cell Division Lab Topic 9

Exercises 9.1, 9.2

10 The Process of Meiosis Lab Topic 9

Exercise 9.3
Heredity: Classic Genetics Lab Topic 10
Exercise 10.1

11 Heredity: Classic Genetics Lab Topic 10

Exercises 10.2, 10.3
Lab Topic 11B, 11C

The Dissection Microscope Lab Topic 10

Exercise 10.4A, 10.4B

12 Molecular Biology: Forensics Lab Topic 11

Bio 13 COURSE OBJECTIVES

INTRODUCTION TO BIOLOGY AND THE SCIENTIFIC METHOD

1. Define the following terms: (a) biodiversity; (b) biology.

2. Briefly state 1 unifying theme that characterize the biological sciences.
3. Name 3 characteristics of life shared by all cells.
4. State whether a given object is living or non-living based on the characteristics of life it possesses.
5. Draw a diagram showing the hierarchy of structural levels in biological organization.
6. Define and give an example of each of the following levels of biological organization: (a) biosphere; (b)
ecosystem; (c) community; (d) population; (e) organism; (f) organ system; (g) organ; (h) tissue; (i) cell; (j)
organelle; (k) molecule; (l) atom.
7. Give 1 example of how novel properties of life emerge from complex organization.
8. Distinguish between prokaryotic and eukaryotic cells.
9. List and distinguish between the 3 domains of life.
10. List and distinguish between the 3 kingdoms of multicellular, eukaryotic life.
11. State 3 major criteria used by the biologist to classify organisms.
12. Name the 6 kingdoms starting from the most primitive to the most evolved following the criteria used to
classify them.
13. Draw a flow chart that illustrates the steps of the scientific method.
14. Define each step of the scientific method from the flow chart drawn in objective #13.
15. Distinguish between a null hypothesis and an alternate hypothesis.
16. Define the following terms: (a) independent variable; (b) dependent variable; (c) extraneous variable.
17. Distinguish between a hypothesis and a theory.

REVIEW OF BASIC CHEMISTRY AND PROPERTIES OF WATER

1. Distinguish between the following: (a) element; (b) atom; (c) compound; (d) molecule.
2. Identify the four elements that make up 96% of living matter.
3. Define the following terms: (a) neutron; (b) proton; (c) electron; (d) atomic number; (e) mass number; (f)
atomic weight; (g) isotope.
4. Draw and label a shell diagram for an atom of each of the four elements identified in objective #2.
5. Distinguish between covalent, ionic and hydrogen bonds.
6. State how the structure of water leads to its properties.
7. Draw and label a diagram that shows the structure of two water molecules held together with hydrogen
bonds.
8. State and define the 4 properties of water that allow life on Earth to exist.
9. Given a diagram of the pH scale, identify the following: (a) acid region; (b) neutral point; (c) basic
(alkaline) region; and relate these regions to hydrogen ion and hydroxide ion concentrations.
MACROMOLECULES

1. State the number of bonds formed in organic molecules by carbon, nitrogen, oxygen, and hydrogen atoms.
2. State two properties of carbon that enable it to se serve as a “backbone” for the formation of an almost
limitless variety of organic molecules.
3. Draw a diagram to illustrate variation in the carbon skeleton between two molecules.
4. Label the following functional groups in a molecule if given its molecular structure: (a) hydroxyl; (b)
carbonyl; (c) carboxyl; (d) amino; (e) sulfhydryl; (f) phosphate; (g) methyl.
5. State the 4 types of macromolecules.
6. State the difference between a monomer and a polymer
7. In 1-2 sentences, explain the difference between a dehydration synthesis reaction and a hydrolysis reaction
8. State the monomers for each of the 4 types of macromolecules.
9. For each of the 4 types of macromolecules, state the specific bond used to join two monomers together to
create a polymer.
10. Distinguish between a monosaccharide, disaccharide, and polysaccharide.
11. Provide 2 examples each of a monosaccharide, disaccharide, and polysaccharide.
12. Compare and contrast the structure of a fat and a phospholipid.
13. Compare and contrast the structure of a saturated and unsaturated fatty acid.
14. State one function each of a fat, a phospholipid, and a steroid.
15. State the 3 types of amino acid R-groups.
16. Provide 2 functions of proteins.
17. State and define the 4 levels of protein structure.
18. State the 3 types of molecules that make up a nucleotide.
19. Provide the complementary sequence for the following DNA sequence:
5′ CCCATGCCATCGCTATAGCC 3′
20. State 3 differences between the structures of DNA and RNA.

CELL STRUCTURE AND FUNCTION

1. State 2 structures/features common to all cells.

2. In 2-3 sentences, explain the advantages of compartmentalization in eukaryotic cells.
3. Given a diagram of a generalized cell, identify the following cellular structures and organelles: (a) cell
membrane; (b) cell wall; (c) centriole; (d) chloroplast; (e) cilia; (f) cytoplasm; (g) endoplasmic reticulum
(rough and smooth); (h) flagella; (i) Golgi apparatus; (j) lysosome; (k) microfilaments; (l) microtubules; (m)
mitochondria; (n) nucleoli; (o) nucleus; (p) peroxisome; (q) ribosome; (r) vacuole.
4. State one major function for each of the cell structures in objective #4.
5. Define the following terms: (a) hydrophilic; (b) hydrophobic.
6. State the 2 major molecules that make up the cell membrane.
7. Draw and label a diagram showing the “fluid mosaic” model of the cell membrane.
8. In 2-3 sentences, explain the structure of the cell membrane drawn in objective #7.
9. In 2-3 sentences, explain how the cell membrane controls transport into and out of a cell.
10. In 2-3 sentences, explain how the cell membrane contributes to “recognition” and “communication” with
other cells and cell products.
11. Define the following term: diffusion.
12. In a paragraph, compare diffusion with facilitated diffusion and active transport.
13. Define the following terms: (a) osmosis; (b) isotonicity; (c) hypertonicity; (d) hypotonicity.
14. Compare the osmotic effect of placing animal cells in distilled water versus sea water.
15. Compare the osmotic effect of placing plant cells in distilled water versus sea water.
 16. In 2-3 sentences, describe the process of endocytosis (phagocytosis and pinocytosis) and the formation of
food vacuoles.
17. In 2-3 sentences, describe the process of exocytosis and formation of a new cell membrane.
18. Cite 1 type of cell junction and state an essential feature of each.

METABOLISM AND CELLULAR RESPIRATION

1. Define the following terms: (a) metabolism; (b) anabolism; (c) catabolism; (d) endergonic reaction; (e)
exergonic reaction.
2. Using the following chemical reaction, identify the reactants and the products:
CH4 + 2O2 → CO2 + 2H2O + Energy
3. Write chemical reactions for the anabolism of: (a) carbohydrates; (b) lipids; (c) proteins; (d) nucleic acids.
4. Write chemical reactions for the catabolism of: (a) carbohydrates; (b) lipids; (c) proteins; (d) nucleic acids.
5. Define the following terms: (a) enzymes; (b) coenzymes; (c) cofactors.
6. State the metabolic function for the molecules defined in objective #5 and provide an example of each.
7. Define the following terms: (a) oxidation reactions; (b) reduction reactions.
8. State the function of redox reactions in metabolism.
9. Using the following chemical reaction, identify compound being oxidized and the compound being reduced
and the products: CH4 + 2O2 → CO2 + 2H2O + Energy
10. Explain the function of glycolysis, Krebs cycle and electron transport in cellular respiration.
11. Identify the locations within a eukaryotic cell where glycolysis, Krebs cycle, and electron transport take
place.
12. Identify the locations within a prokaryotic cell where glycolysis, Krebs cycle, and electron transport take
place.
13. Distinguish oxidative phosphorylation from substrate level phosphorylation.
14. Explain the difference between an anaerobic process and anaerobic respiration.
15. Explain the difference between aerobic respiration and anaerobic respiration.
16. Define the following term: fermentation.
17. Give 2 examples of types of fermentation.

PHOTOSYNTHESIS

1. In 3-4, provide a general summary of the process of photosynthesis.

2. Write a generalized equation of photosynthesis that shows the raw materials, energy source, and end
products of the process.
3. List the raw materials, energy sources and end products of photosynthesis
4. Explain the relationship of the following membrane structures to the overall process of photosynthesis
within the structure of the chloroplast: (a) grana; (b) stroma; (c) thylakoid discs; (d) thylakoid spaces.
5. Write a paragraph summarizing the steps of the light dependent reaction of photosynthesis.
6. Describe the role of the following in the light dependent reactions of photosynthesis: (a) H2O; (b)
chlorophyll; (c) NADP+; (d) ADP; (e) Pi; (f) electron carriers.
7. State the products of the light dependent reactions of photosynthesis.
8. Write the steps of the Calvin Cycle, show the raw materials and end products of this process.
9. State the importance and relationship between the light dependent phase and light independent (Calvin
Cycle) phase of photosynthesis.
10. State the purpose of the pigments, other than chlorophyll, found in cellular chloroplasts.
11. Compare cyclic and non-cyclic photophosphorylation, and describe how cyclic photophosphorylation
benefits some plant cells under certain conditions.
 12. Describe the differences between and importance of both C-3 and C-4 plants as it relates to photosynthesis.
13. Explain the overall importance and significance of photosynthesis to life as we know it on our planet.

THE CELL CYCLE, MITOSIS AND MEIOSIS

1. Write a series of steps to describe the process of cell division.

2. Define the following term: (a) genome.
3. Distinguish between somatic cells and gametes.
4. List the phases of the cell cycle.
5. In 2-3 sentences each, explain the major events for each of the phases of the cell cycle listed in objective #5.
6. In 2-3 sentences, explain the importance of the cell cycle control system.
7. Draw and label a diagram showing the structure of a chromosome.
8. Define the following terms: (a) mitotic spindle; (b) centrosome; (c) kinetochore.
9. State the mitotic phases in the order they occur and list the events occurring in each phase.
10. Draw a diagram showing the phases of mitosis in a diploid cell with 4 chromosomes.
11. State the importance of mitosis.
12. Define the following term: (a) sexual reproduction.
13. State the significance of meiosis in sexual reproduction.
14. Define the following terms: (a) homologous chromosomes; (b) sex chromosomes; (c) autosomes; (d)
diploid cells; (e) haploid cells.
15. State the meiotic phases in the order they occur and list the events occurring in each phase.
16. Draw a diagram showing the phases of meiosis in a diploid cell with 4 chromosomes.
17. State the importance of meiosis.
18. Compare and contrast mitosis and meiosis.
19. Define the following terms: (a) crossing over; (b) recombination
20. List 2 events in meiosis that lead to genetic variation.
21. State how each event in objective #20 leads to genetic variation.

CLASSICAL GENETICS

1. Define the following terms: (a) character; (b) trait; (c) gene; (d) allele; (e) dominant allele; (f) recessive
allele; (g) genotype; (h) phenotype; (i) heterozygous; (j) homozygous.
2. Draw a diagram to illustrate Mendel's Law of Segregation.
3. Draw a diagram to illustrate Mendel's Law of Independent Assortment.
4. Define the following terms: (a) monohybrid cross; (b) dihybrid cross.
5. Given that red flowers (R) are dominant over with white flowers (r), use a Punnett square to show the
results of a parental cross between true-breeding parents.
6. List the genotypes and genotype frequencies in the F1 generation for the parental cross in objective #4.
7. List the phenotypes and phenotype frequencies in the F1 generation for the parental cross in objective #4.
8. Use a Punnett square to show the results of a cross using the offspring from the F1 generation obtained
from the cross in objective #5.
9. List the genotypes and genotype frequencies in the F2 generation for the parental cross in objective #7.
10. List the phenotypes and phenotype frequencies in the F1 generation for the parental cross in objective #7.
11. Given the yellow peas (Y) and round pea pods (r) are dominant a green peas (y) and wrinkled pea pods (r)
are recessive, use a Punnett to show the results of the following dihybrid cross: YyRr × YyRr.
12. List the genotypes and genotype frequencies for the dihybrid cross in objective #11.
13. List the phenotypes and phenotype frequencies for the dihybrid cross in objective #11.
14. Distinguish between complete dominance, codominance, and incomplete dominance.
 15. Define the following terms: (a) epistasis; (b) pleiotropy.
16. Given that red eye color (R) in flies is dominant over white eye color (r) and that eye color is sex linked,
perform the following cross: true-breeding red-eyed females crossed with white eyed males.
17. List the genotypes and genotype frequencies for the cross in objective #16.
18. List the phenotypes and phenotype frequencies for the cross in objective #16.
19. Define the following term: genetic linkage.
20. State the importance of pedigree analysis for human genetics,
21. State 2 human disorders that follow Mendelian inheritance.

MOLECULAR BIOLOGY

1. State one reason that scientists originally thought protein, not DNA, was the hereditary material.
2. In a series of steps, describe the experiments performed by (a) Griffith; (b) Avery, McCarty and MacLeod;
and (c) Hershey and Chase and explain how these experiments show DNA is the hereditary material.
3. Prepare a drawing that illustrates the structure of DNA and label the following: (a) 5′ end; (b) 3′ end; (c)
phosphate group; (d) deoxyribose; (e) nitrogenous base; (f) nucleotide; (g) hydrogen bond.
4. Define the following term: semiconservative replication.
5. State the function of each of the following in the process of DNA replication: (a) origin of replication; (b)
RNA primer; (c) DNA polymerase.
6. In a series of steps, describe the process of DNA replication.
7. Distinguish between the leading strand and the lagging strand.
8. Explain the differences between DNA proofreading, mismatch repair, and nucleotide excision repair.
9. Define the following terms: (a) telomeres; (b) telomerase
10. State the role of telomerase in replicating the ends of chromosomes.

GENE EXPRESSION

1. In a series of steps, describe the experiment performed by Beadle and Tatum.

2. In a 3-4 sentences, explain how Beadle and Tatum’s experiment led to the one gene–one polypeptide
hypothesis.
3. Give 1 example of a gene that does not lead to the production of a polypeptide.
4. Draw a flow chart to illustrate the flow of genetic information, the central dogma of molecular biology.
5. Distinguish between the flow of genetic information in bacterial cells and eukaryotic cells.
6. Explain the process of transcription using the following terms: (a) RNA polymerase; (b) promoter; (c)
initiation; (d) elongation; and (e) termination in your explanation.
7. Using the following DNA sequence, write the sequence of the mRNA produced by transcribing this DNA.
3′ CCCATGCCATCGCTATAGCC 5′
8. Define the following terms: (a) exon; (b) intron; (c) RNA splicing.
9. Name three types of post-transcriptional modifications of pre-RNA that occur in eukaryotes.
10. Define the following terms: (a) codon; (b) anticodon.
11. Distinguish between the function of the codon and the anticodon in the process of translation.
12. Describe the role of each of the following in the process of translation: (a) mRNA; (b) tRNA; (c) rRNA.
13. In a series of steps, describe the process of translation.
14. Using the following DNA sequence and the codon table in your biology textbook, write the sequence of the
polypeptide produced by transcribing and translating this DNA: 3′
CCCATGCCATCGCTATAGCC 5′
15. Define the following term: mutation.
16. Use the DNA sequence in objective #14 to illustrate the effect of the following types of point mutations: (a)
 frameshift mutation; (b) insertion mutation, on the polypeptide sequence produced by transcribing and
translating the mutated DNA sequence.

TECHNIQUES USED IN MOLECULAR BIOLOGY

1. Define the following terms: (a) recombinant DNA; (b) plasmid; (c) restriction enzyme.
2. Explain how restriction enzymes are used to produce recombinant DNA.
3. In a series of steps, describe how plasmids are used to clone genes in bacteria.
4. Prepare a diagram that illustrates how a specific region of DNA is copied and amplified using the
polymerase chain reaction.
5. Distinguish between cloning a gene and cloning an organism.
6. List one specific technique used to study gene expression
7. List one specific technique used to study gene function.
8. Define the following term: (a) stem cell.
9. State one difference between a stem cell and a cell that is not a stem cell.
10. Describe one medical application of DNA technology.
11. State one practical application of DNA technology in bacteria.
12. State one practical application of DNA technology in plants.
13. State one practical application of DNA technology in animals.
14. In 2-3 sentences, explain what is meant by the following term: genetically modified organism.
15. List 2 ethical concerns of genetically modifying bacteria, plants or animals.