This article was downloaded by: [J.H.

von Thuenen Institut]

On: 24 January 2012, At: 00:26
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Journal of Aquatic Food Product

Technology
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/wafp20

Evaluation of a Rapid PCR-Based Method

for Species Identification of Raw and
Processed Fish and Shrimps
a a
Hartmut Rehbein & Karin Schiefenhövel
a
Max Rubner-Institute, Federal Research Institute of Nutrition and
Food, Department of Safety and Quality of Milk and Fish, Hamburg,
Germany

Available online: 23 Jan 2012

To cite this article: Hartmut Rehbein & Karin Schiefenhövel (2012): Evaluation of a Rapid PCR-Based
Method for Species Identification of Raw and Processed Fish and Shrimps, Journal of Aquatic Food
Product Technology, 21:1, 86-96

To link to this article: http://dx.doi.org/10.1080/10498850.2011.584017

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden.
The publisher does not give any warranty express or implied or make any representation
that the contents will be complete or accurate or up to date. The accuracy of any
instructions, formulae, and drug doses should be independently verified with primary
sources. The publisher shall not be liable for any loss, actions, claims, proceedings,
demand, or costs or damages whatsoever or howsoever caused arising directly or
indirectly in connection with or arising out of the use of this material.
 Journal of Aquatic Food Product Technology, 21:86–96, 2012
Copyright © Taylor & Francis Group, LLC
ISSN: 1049-8850 print / 1547-0636 online
DOI: 10.1080/10498850.2011.584017

Evaluation of a Rapid PCR-Based Method for

Species Identification of Raw and Processed Fish
and Shrimps

HARTMUT REHBEIN AND KARIN SCHIEFENHÖVEL

Max Rubner-Institute, Federal Research Institute of Nutrition and Food,
Department of Safety and Quality of Milk and Fish, Hamburg, Germany
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

The increase of mislabeled seafood and illegal fisheries demands rapid methods to
control fishery products. We have tested a rapid deoxyribonucleic acid (DNA) extrac-
tion and amplification method to identify raw and processed fish and shrimp using
polymerase chain reaction (PCR)-based techniques. The KAPA Express Extract Kit
delivered DNA from raw, cooked, canned, and marinated products that was suitable
for mutation detection. Segments of mitochondrial genes, sized from 123 to 464 base
pairs (bp), were amplified by PCR kits from two vendors. Amplicons of raw fish fillets
were differentiated by single strand conformation polymorphism (SSCP) analysis, raw
or cooked shrimps were analyzed by restriction fragment length polymorphism (RFLP),
and the PCR product obtained for marinated herring was sequenced. The extracted
DNA was not degraded during storage in the refrigerator for about 1 week or in the
freezer-cabinet for 1 month.

Keywords fish, shrimp, rapid PCR, KAPA

Introduction
Over the last 2 decades, polymerase chain reaction (PCR)-based deoxyribonucleic acid
(DNA) analysis has become the most important tool for seafood authentication (Rasmussen
and Morrissey, 2008; Teletchea, 2009; Espineira et al., 2010).
Faster thermocyclers and the development of highly processive DNA polymerases
have resulted in amplification of gene fragments in a short time. Further development in
the characterization of amplicons has allowed detailed and reliable analysis.
Due to technical improvements in the construction of thermocyclers and progress in
detection and characterization of amplicons, setup and performance of PCR takes less than
2 h for amplicons to be produced and analyzed; e.g., by real-time PCR combined with
melting point analysis (Dalmasso et al., 2007) or using TaqMan probes (Herrero et al.,
2010).

The authors would like to thank Ron McEwan and Ross Wadsworth at KAPA BIOSYSTEMS
for advice and support of this study. Gratitude is expressed to Alexandra Oliveira and Gabi Näumann
for providing authenticated fish samples. The skillful technical performance of experiments by
Roswitha Koch and Rainer Kündiger is gratefully acknowledged.
Address correspondence to Hartmut Rehbein, Max Rubner-Institute, Federal Research Institute
of Nutrition and Food, Department of Safety and Quality of Milk and Fish, Palmaille 9, 22767
Hamburg, Germany. E-mail: [email protected]

86
 Rapid PCR for Seafood Identification 87

On the other hand, the extraction and purification of DNA suitable for PCR is rela-
tively time-consuming and costly compared to PCR (Chapela et al., 2007). Additionally,
fishery products may contain compounds that are potent PCR inhibitors, caviar being an
example (U.S. Patent No. 5,786,144, 1998). This has lead to the development of simple
and reliable methods to improve DNA extraction protocols. Severe degradation of DNA
can occur during seafood processing, due to continued glycolysis in tissues resulting in
acidic conditions or heat damage, as has been described with canned tuna (Quinteiro et al.,
1998). Minimizing any further DNA damage in the purification step is highly advanta-
geous. Some of the short and simple extraction protocols such as alkaline lysis of tissue
(Ivanova et al., 2009) or removal of inhibitors by treatment of solubilized tissue by means
of Chelex resin (Estoup et al., 1996) are useful for raw fish, but not for processed fish;
furthermore, treatment with NaOH is not well-suited for protein-rich muscle tissue. Rapid
methods of PCR-based DNA analysis are necessary to enable fish species identification
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

without delaying movement of goods; e.g., at the borders.

The aim of the study was to test the applicability of a rapid DNA extraction method
for PCR-based analysis of processed fish and shrimps and to demonstrate that the extracted
DNA could be used directly for PCR-single strand conformation polymorphism (PCR-
SSCP), PCR-restriction fragment length polymorphism (PCR-RFLP), and sequencing of
amplicons allowing identification of mislabeled seafood products.
Here we report on results obtained with the KAPA Express Extract Kit. This kit con-
tains a thermostable protease and a very efficient lysis buffer. We have quickly and reliably
extracted DNA from a variety of products from fish muscle tissue. The DNA extracted was
then used without further purification to amplify several mitochondrial DNA segments by
means of two PCR kits: (a) The KAPA 2G DNA Robust Polymerase with improved toler-
ance to a range of common PCR inhibitors; (b) the HotFirePol DNA polymerase from Solis
Biodyne representing an enzyme not specifically adapted to the KAPA Express Extraction
Kit (KAPA BIOSYSTEMS, Woburn, MA, USA).

Materials and Methods

Fish and Shrimp Samples

A total number of 20 reference samples representing the species Atlantic sole (Solea solea),
plaice (Pleuronectes platessa), fourspotted megrim (Lepidorhombus bosci), and herring
(Clupea harengus) were collected on research cruises of the Max Rubner-Institute into
North Atlantic waters. One or two samples of each species were used for analysis.
Fillet of Indian halibut (Psettodes erumei) was a gift from the Institute of Hygiene
and Environment in Hamburg, Germany; reference samples (five samples of each species)
of Pacific flatfishes (either fish or fillet), southern rock sole (Lepidopsetta bilineata),
northern rock sole (Lepidopsetta polyxystra), yellowfin sole (Limanda aspera), Pacific
halibut (Hippoglossus stenolepis), flathead sole (Hippoglossoides elassodon), and butter
sole (Isopsetta isolepis) were delivered by the University of Alaska in Fairbanks. Samples
were stored at −25◦ C in a freezer cabinet. Samples of Pacific white shrimp (Litopenaeus
vannamei) were collected at a shrimp farm located near Kiel in Schleswig-Holstein
(Northern Germany).
In total, 16 commercial products have been analyzed: canned herring and canned tuna
were purchased in retail shops in Hamburg; marinated herring (Sauerlappen) were obtained
from a fish processor located in Marne in Schleswig-Holstein. Seven deep-frozen fillets
declared to be made from yellowfin sole (Limanda aspera) were bought from a home
 88 H. Rehbein and K. Schiefenhövel

delivery company of frozen food to be used for SSCP analysis. Deep-frozen black tiger
shrimp (Penaeus monodon) and speckled shrimp (Metapenaeus monoceros) were obtained
from the fish market in Hamburg-Altona.
Cooking of shrimps was performed by placing tail meat in a plastic bag and incubating
the bag for 10 min in a water bath at 70◦ C.

Analytical Methods

DNA Extraction
Pieces of white muscle of fish or shrimp tail meat were taken for DNA extraction using the
KAPA Express Extract Kit following the instructions of the vendor. In brief, 10 or 20 mg
of seafood tissue was added to a lysis solution containing buffer and protease (100 or 200
µL) and incubated for 10 or 30 min at 60◦ C in 0.2 mL Eppendorf tubes as described in
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

the Technical data sheet. The samples were vortexed prior to the lysis protocol for a few
seconds or gently shaken during the 30-min incubation time.
The protease was inactivated by incubation for 5 min at 95◦ C; after completion the
tubes were vortexed for 2–3 s and centrifuged for 1 min to precipitate non-dissolved cell
debris. The supernatant containing the DNA extract was either used directly in PCR or
diluted 1:5 with Tris-EDTA buffer (TE). The undiluted and diluted DNA extracts were
stored in the refrigerator (8◦ C) or a freezer-cabinet (−40◦ C) until analysis.

PCR Assays
PCR primers (Cyt b L14735/Cyt b H 15149ad; Hering 5/Hering 6; 59-3/59-5; 16S
312F/16S 312R) were delivered by Whatman-Biometra (Göttingen, Germany). PCR
assays were performed using either KAPA Biosystems 2X KAPA2G Robust HotStart
Ready Mix (KAPA-PCR) or reagents (HotFirePol DNA polymerase I, BD buffer) from
Solis Biodyne (Solis-PCR, Tartu, Estonia) as advised by the manufacturers:
1. In the case of raw flatfish, a 464-base pairs (bp) sequence of the mitochondrial
cytochrome b gene (Wolf et al., 2000) was amplified by preheating at 95◦ C for 3 min,
40 cycles at 95◦ C/15 s, 50◦ C/30 s, 72◦ C/30 s, and final extension at 72◦ C for 10 min;
the primer concentration (Cyt b L14735/Cyt b H 15149ad) was 0.5 µM; 2 µL of DNA
extract were added to KAPA-PCR (assay volume: 25 µL).
2. In the case of herring products, a 139-bp sequence of the cyt b gene was amplified
with the recently developed primers Hering 5 (5’-CCC TCC AAT ATT TCA GTA TGA
TGA AAC TTT GGG TC) and Hering 6 (5’-AAA TGT GTA TTA CAG AGG AGA
ATG CGG TTG CGA TG; Rehbein, unpublished results) under the following PCR
conditions: preheating at 95◦ C for 3 min, 35 cycles at 95◦ C/15 s, 50◦ C/15 s, 72◦ C/15 s,
and final extension at 72◦ C for 10 min; the primer concentration was 0.5 µM; 2 µL of
DNA extract was added to the KAPA-PCR and Solis-PCR (assay volume: 25 µL).
3. DNA of canned tuna was amplified by means of the primer pair 59-3/59-5 as described
previously, yielding a 123-bp amplicon from the cyt b gene (Rehbein et al., 1997). PCR
conditions (KAPA-PCR) were: preheating at 95◦ C for 3 min, 35 cycles at 95◦ C/15 s,
53◦ C/15 s, 72◦ C/15 s, and final extension at 72◦ C for 10 min; the primer concentration
was 0.5 µM; 2 µL of DNA extract were added to the PCR reaction (assay volume:
25 µL).
4. Shrimps were analyzed using the primers 16S 312F and 16S 312R (16S rRNA gene,
amplicon size: 312 bp) by Solis-PCR (Schiefenhövel and Rehbein, 2010) and by
 Rapid PCR for Seafood Identification 89

KAPA-PCR under the following conditions: preheating at 95◦ C for 3 min, 35 cycles
at 95◦ C/15 s, 53◦ C/15 s, 72◦ C/15 s, and final extension at 72◦ C for 10 min; the primer
concentration was 0.5 µM; 2 µL of DNA extract was added to each PCR reaction (assay
volume: 25 µL).
PCR products were either run on 2% agarose gels and stained with ethidium
bromide (312- and 464-bp amplicon) or analyzed by native polyacrylamide gel elec-
trophoresis (PAGE) using CleanGel 10 or 15% according to the instructions of the
vendor (Gelcompany, Tübingen, Germany; 123- and 139-bp amplicon). DNA bands were
visualized by silver staining (Schiefenhövel and Rehbein, 2010).

Single Strand Conformation Polymorphism Analysis

SSCP analysis of the 464-bp amplicon—including denaturation of dsDNA into single
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

strands, native PAGE (CleanGel HP, Gelcompany), and silver staining—was performed
according to Rehbein (2005).

Restriction Fragment Length Polymorphism Analysis

The 312-bp amplicon obtained by amplification of the 16S rRNA gene of shrimps was cut
by the restriction endonucleases Alu I and Vsp I, according to Schiefenhövel and Rehbein
(2010). Restriction digest products were analyzed by 2% agarose gels.

DNA Sequencing
Clean-up of PCR products (139-bp amplicon) was performed by removing non-
incorporated primers with Exonuclease I (ExoI) and degradation of nucleotides by
Thermosensitive Alkaline Phosphatase (FastAPTM ; Fermentas, St. Leon-Rot, Germany).
Fifteen µL of the PCR assays were mixed with 1.5 µL ExoI (30 units) and 3 µL FastAPTM
(3 units) and incubated for 15 min at 37◦ C; then, enzymes were inactivated by heating the
mixture for 15 min at 85◦ C. The DNA concentration was measured with Hoechst 33258
(Downs and Wilfinger, 1983).
Sequencing was done in both directions using the ABI Prism BigDye Terminator
Cycle Sequencing Ready Reaction Kit, Version 1.1 (Applied Biosystems, Foster City,
CA, USA) with the same primer pairs as taken for PCR. Conditions of cycle sequencing
were: 25 cycles of 10 s/96◦ C, 20 s/50◦ C, and 4 min/60◦ C. Unincorporated dye-labeled
dideoxy nucleoside triphosphates (ddNTPs) were removed with DyeEx 2.0 Spin Kit
(Qiagen, Hilden, Germany); the sequencing assays were dried in a vacuum centrifuge.
The nucleotide sequences were determined by the University Medical Centre Hamburg-
Eppendorf (Hamburg, Germany) using the ABI Prism® 3100 DNA Sequencer. The
determined DNA sequences were compared with nucleotide sequences from GenBank
(National Center for Biotechnology Information, NCBI) with the program BLAST (Basic
Local Alignment Search Tool).

Results and Discussion

Extraction of DNA
In general, the extraction protocol given by KAPA BIOSYSTEMS was followed with a few
modifications to improve the reliability of the procedure and the yield of DNA. The amount
of muscle tissue should not be <10 mg, as fish fillet has a high water content and low
 90 H. Rehbein and K. Schiefenhövel

concentration of DNA, especially in white muscle (Rehbein, 2009). We found 10−20 mg

of muscle tissue suitable to release enough DNA for PCR of mitochondrial gene segments.
Shaking or vortexing the suspension during tissue lysis gave a further improvement of
the reliability of the extraction procedure (data not shown). Total time needed for DNA
extraction was about 60 to 90 min, depending on the time period chosen for tissue lysis.
Compared to other methods for the extraction of DNA from fishery products
(Cawthorn et al., 2011), the KAPA Express Extract Kit has two advantages: (a) reduc-
tion of extraction time and (b) less possibilities for contamination. These advantages are
the consequence of the omission of DNA purification steps.

Amplification of Extracted DNA

Segments of mitochondrial DNA ranging in size from 123 to 464 bp were successfully
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

amplified by the KAPA2G Robust HotStart Ready Mix (Table 1). Raw fish or shrimp mus-
cle and heated (cooked or canned) or marinated products gave high yields of PCR products,
as indicated by strong bands in electrophoresis (Table 1). Replacing the KAPA PCR Kit
by reagents of another vendor, Solis Biodyne, gave PCR products (312-bp amplicon) of
similar quality, as seen in Figure 2.

Stability of Extracted DNA

It would be very convenient to extract DNA in a stabilizing solution for repetition of
experiments, performing ring-trials, and transport of DNA samples. To have information
about the stability of extracted DNA at different temperatures, DNA extracted using KAPA
Express Extract from raw fillet and canned or marinated herring was stored in the refriger-
ator or a freezer for up to 1 month and analyzed at regular intervals by PCR using primer
pair Hering 5/Hering 6 (139-bp amplicon). In addition, the effect of diluting the extract
with TE buffer (1:5) prior to storage was tested, because it has been recommended by
KAPA to dilute DNA extracts in TE buffer for long-time storage at −20◦ C.
The results compiled in Table 2 demonstrate sufficient stability of the DNA. Storage
of the original extract for at least 1 week in the refrigerator and 1 month in the freezer
did not result in a drop in end-point PCR performance, as indicated by intensity of DNA
bands, using the KAPA2G Robust HotStart Ready Mix. Assay of the diluted extract gave
the same results as non-diluted extract. Similar results were obtained with the Solis-PCR
Kit (data not shown).

Suitability of PCR Products for Subsequent Analysis

SSCP Analysis
SSCP can be considered as a rapid, simple, and cost effective method for characterization
of amplicons (Sunnucks et al., 2000). It has been applied to fish species identification to
authenticate different types of products, like raw or processed fish, as well as sturgeon
caviar (Rehbein, 2010).
Testing the compatibility of extraction and amplification of DNA using the rapid pro-
tocol combined with subsequent SSCP analysis resulted in specific SSCP patterns for a
number of flatfish species (Figure 1). Mislabeling of commercial flatfish products was
detected in several cases. SSCP analysis was not negatively influenced by carryover of
compounds from the lysis buffer to the SSCP assay.
 Rapid PCR for Seafood Identification 91

Table 1
PCR success of samples extracted and amplified using KAPA reagents

PCR
Type of product PCR target (gene, amplicon
Animal species (n = 1) amplicon size) produced
Fish species
Solea solea, Atlantic Raw fillet, reference Cyt b, 464 bp +
sole∗∗ sample
Pleuronectes Raw fillet, reference Cyt b, 464 bp +
platessa, plaice sample
Psettodes erumei, Raw fillet, reference Cyt b, 464 bp +/−∗∗∗
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

Indian halibut sample

Lepidopsetta Raw fillet, reference Cyt b, 464 bp +
bilineata, sample
Southern rock sole
L. polyxystra, Raw fillet, reference Cyt b, 464 bp +
Northern rock sole sample
Lepidorhombus Raw fillet, reference Cyt b, 464 bp +
bosci, Fourspotted sample
megrim
Limanda aspera, Raw fillet, reference Cyt b, 464 bp +
Yellowfin sole sample
Hippoglossus Raw fillet, reference Cyt b, 464 bp +
stenolepis, Pacific sample
halibut
Hippoglossoides Raw fillet, reference Cyt b, 464 bp +
elassodon, sample
Flathead sole
Isopsetta isolepis, Raw fillet, reference Cyt b, 464 bp +
Butter sole sample
Clupea harengus∗ Canned herring in Cyt b, 139 bp +
tomato sauce
Clupea harengus Raw fillet, reference Cyt b, 139 bp +
sample
Clupea harengus# Marinated herring Cyt b, 139 bp +
Clupea harengus∗ Canned herring with Cyt b, 139 bp +
mango and curry
Tuna spp.∗ Canned tuna Cyt b, 123 bp +
Tuna spp.∗ Canned tuna Cyt b, 123 bp +
Shrimp species
Penaeus monodon∗∗ Raw tail muscle 16S rRNA, +
312 bp
Penaeus monodon∗∗ Heated tail muscle 16S rRNA, +
312 bp

(Continued)
 92 H. Rehbein and K. Schiefenhövel

Table 1
(Continued)

PCR
Type of product PCR target (gene, amplicon
Animal species (n = 1) amplicon size) produced
L. vannamei Raw tail muscle, 16S rRNA, +
reference sample 312 bp
L. vannamei Heated tail muscle, 16S rRNA, +
reference sample 312 bp
M. monoceros∗∗ Raw tail muscle 16S rRNA, +
312 bp
M. monoceros∗∗ Heated tail muscle 16S rRNA, +
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

312 bp
∗
Indicated on the product label.
∗∗
Indicated on the product label and authenticated by DNA sequencing (Schiefenhövel and
Rehbein, 2010).
∗∗∗
(+): strong DNA band, (+/−): faint DNA band.
#
Commercial sample from fish processor.

Table 2
Stability of DNA extracted from herring products as determined by PCR using the
KAPA2G Robust HotStart Ready Mix; amplicon size was 139 bp

Storage conditions PCR products PCR products from PCR products from
of DNA extract from raw fillet marinated herring canned herring
1 day
Refrigerator + + +
Freezer nd∗ nd nd
2 days
Refrigerator + + +
Freezer + + +
9 days
Refrigerator + + +
Freezer + + +
2 weeks
Refrigerator nd nd nd
Freezer + + +
1 month
Refrigerator nd nd nd
Freezer + + +
∗
nd: not determined.

RFLP Analysis
For many years, RFLP analysis was the method of choice for identification of fish
and shrimp species (Rehbein, 2009). In many applications it was not necessary to
purify the PCR products before being digested by restriction endonucleases. Therefore,
 Rapid PCR for Seafood Identification 93

100-bp ladder
Plaice
Northern rock sole
Southern rock sole
Atlantic sole
Four-spotted megrim
Psettodes erumei
Southern rock sole*
Yellowfin sole*
Yellowfin sole
Pacific halibut*
Butter sole*
Flathead sole*
Butter sole*
Northern rock sole*
cathode ssDNA dsDNA
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

Figure 1. SSCP analysis of flatfish species using a 464-bp cyt b gene sequence; commercial sam-
ples are marked by an asterisk (∗ ), mislabeled products (all declared as Yellowfin sole, Limanda
aspera) are underlined. The correct species was identified by sequencing the 464-bp fragment
and comparison with sequences in GenBank using BLAST. Native PAGE with CleanGel HP 10%
(Gelcompany).

Samples from left to right:

1 2 3 4 5 6 7 8 9 10 11 12 13 14 First row: amplicons cut with Alu I

----- KAPA ----- ---------Solis -------- 1. Lvc, 2. Lvc, 3. Mmc, 4. Lvr,
5. Lvr, 6. Mmr, 7. Lvc, 8. Lvc,
9. Mmc, 10. Lvr, 11. Lvr, 12. Mmr,
13. P. monodon (uncut), 14. PCR
control (-DNA), 100-bp ladder
Samples 1–6: KAPA PCR Kit,
samples 7–12, control: Solis PCR
Kit.
1 2 3 4 5 6 7 8
-KAPA- -Solis- Second row: amplicons cut with
Vsp I
All samples were from
P. monodon.
1–3: KAPA PCR Kit, 4–6: Solis
PCR Kit, 7: uncut amplicon, 8:
control (Solis PCR Kit)

Figure 2. Differentiation of raw (r) or cooked (c) shrimps by RFLP. DNA fragments were separated
on a 2% agarose gel. Lvr: L. vannamei, raw; Lvc: L. vannamei, cooked. Mmr: M. monoceros, raw;
Mmc: M. monoceros, cooked. Lane 7, first row: no amplicon obtained.

PCR-RFLP was applied to differentiate raw or cooked shrimp (L. vannamei, P. monodon,
M. monoceros) using an aliquot of the PCR assay directly, without any purification. In the
same experiment, the performance of two PCR kits—KAPA2G Robust HotStart Ready
Mix and reagents from Solis Biodyne (HotFirePol DNA polymerase I)—was compared.
The results, as shown in Figure 2, demonstrate that amplicon digestion was not ham-
pered by residual compounds from the lysis solution and PCR buffer. With Alu I, the
 94 H. Rehbein and K. Schiefenhövel

Clupea harengus (EU552606) voucher H80 cytochrome b (cytb) gene, partial

cds; mitochondrial EU552606
Length=1149

Score = 128 bits (69), Expect = 2e-27

Identities = 69/69 (100%), Gaps = 0/69 (0%)
Strand=Plus/Plus

Query 1 CCTGCTCGGATTATGCCTAGCGGCACAAATCTTAACAGGACTGTTTTTAGCTATACACTA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 105 CCTGCTCGGATTATGCCTAGCGGCACAAATCTTAACAGGACTGTTTTTAGCTATACACTA
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

Query 61 CACTTCCGA 69
|||||||||
Sbjct 165 CACTTCCGA 173

Figure 3. Identification of marinated herring by DNA sequencing.

following fragment lengths were obtained: 105 and 180 bp for L. vannamei and 60, 74,
and 123 bp for M. monoceros, whereas the amplicon of P. monodon remained uncut as
described previously (Schiefenhövel and Rehbein, 2010). The enzyme Vsp I gave two frag-
ments (125 and 150 bp) in the case of P. monodon, as was expected (Schiefenhövel and
Rehbein, 2010). Both PCR kits could be successfully used for PCR-RFLP analysis; how-
ever, in one case (lane 7, first row of Figure 2) no PCR product was obtained with the Solis
PCR Kit, possibly due to a mistake in delivery of DNA to the assay tube.

DNA Sequencing
Finally, the reliability and robustness of the rapid DNA extraction and PCR protocol was
evaluated by DNA sequencing of the 139-bp amplicon obtained for marinated herring.
No problems were encountered when clean-up of PCR products was performed by remov-
ing non-incorporated primers with Exonuclease I (ExoI) and degradation of nucleotides
by Thermosensitive Alkaline Phosphatase. As observed for SSCP- and RFLP-analysis, no
inhibiting substances were transported from the lysis solution or PCR kit to the clean-up
and sequencing reactions. Part of the sequence (69 bp after removal of primers) was used
for BLAST, giving the species (herring, Clupea harengus) as expected (Figure 3).

Conclusions
The recent developments to accelerate release and amplification of DNA are supporting
food control laboratories in their efforts to combat illegal fisheries and deception of con-
sumers. The results of this study demonstrate that in many cases lengthy procedures for
isolation of DNA (Cawthorn et al., 2011) are not necessary for species identification of
fishery products by PCR. The DNA solution obtained by KAPA Express Extract can be
directly used for PCR.
 Rapid PCR for Seafood Identification 95

During preparation of the manuscript, two other new kits for rapid PCR were intro-
duced into the market. The Phire® Animal Tissue Direct PCR Kit (New England Biolabs,
Frankfurt/Main, Germany) can be used either by the so-called direct protocol or by the
dilution protocol. The second procedure is similar to the KAPA method, whereas in the
direct protocol a piece of tissue is given directly to the PCR assay. The protocol of the Fast
Tissue-to-PCR Kit (Fermentas, St. Leon-Rot, Germany) resembles the procedure described
in this work.

References
Cawthorn, D.-M., Steinman, H. A., and Witthuhn, R. C. 2011. Comparative study of different meth-
ods for the extraction of DNA from fish species commercially available in South Africa. Food
Control 22: 231–244.
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012

Chapela, M. J., Sotelo, C. G., Perez-Martin, R. I., Pardo, M. A., Perez-Villareal, B., Gilardi, P., and
Riese, J. 2007. Comparison of DNA extraction methods from muscle of canned tuna for species
identification. Food Control 18: 1211–1215.
Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Secchi, C., and Bottero, M. T. 2007. Identification
of four tuna species by means of real-time PCR and melting curve analysis. Vet. Res. Commun.
31(Suppl. 1): 355–357.
DeSalle, R., and Birstein, V. J. 1998. U.S. Patent No. 5,786,144. Washington, DC: U.S. Patent and
Trademark Office.
Downs, T. R., and Wilfinger, W. W. 1983. Fluorimetric quantification of DNA in cells and tissues.
Anal. Biochem. 131: 538–547.
Espineira, M., Vieites, J., and Santaclara, F. J. 2010. Species authentication of octopus, cuttlefish,
bobtail and bottle squids (families Octopodidae, Sepiidae and Sepiolidae) by FINS methodology
in seafoods. Food Chem. 121: 527–532.
Estoup, A., Largiarder, C. R., Perrot, E., and Chourrout, D. 1996. Rapid one-tube DNA extraction
for reliable PCR detection of fish polymorphic markers and transgenes. Mol. Mar. Biol. Biotech.
5: 295–298.
Herrero, E., Madrinan, M., Vieites, J. M., and Espineira, M. 2010 Authenication of Atlantic cod
(Gadus morhua) using real time PCR. J. Agri. Food Chem. 58: 4794–4799.
Ivanova, N. V., Borisenko, A. V., and Hebert, P. D. N. 2009. Express barcodes: Racing from specimen
to identification. Mol. Ecol. Resour. 9(Suppl. 1): 34–41.
Quinteiro, J., Sotelo, C. G., Rehbein, H., Pryde, S. E., Medina, I., Perez-Martin, R. I., Rey-Mendez,
M., and Mackie, I. M. 1998. Use of mtDNA direct polymerase chain reaction (PCR) sequencing
and PCR-restriction fragment length polymorphism methodologies in species identification of
canned tuna. J. Agri. Food Chem. 46: 1662–1669.
Rasmussen, R. S. and Morrissey, M. 2008. DNA-based methods for the identification of commercial
fish and seafood species. Compr. Rev. Food Sci. F. 7: 280–295.
Rehbein. H. 2005. Identification of the fish species of raw or cold-smoked salmon and salmon
caviar by single-strand conformation polymorphism (SSCP) analysis. Eur. Food Res. Technol.
220: 625–632.
Rehbein, H. 2009. DNA-base methods. In: Fishery Products—Quality, Safety and Authenticity.
Rehbein, H., and Oehlenschläger, J. (Eds). Chichester, United Kingdom: Wiley-Blackwell.
pp. 363–387.
Rehbein, H. 2010. Single-stranded conformation polymorphism analysis. In: Molecular Biological
and Immunological Techniques and Applications for Food Chemists. Popping, B., Diaz-Amigo,
C., and Hoenicke, K. (Eds.). Hoboken, NJ: John Wiley & Sons, pp. 105–117.
Rehbein, H., Kress, G., and Schmidt, T. 1997. Application of PCR-SSCP to species identification of
fishery products. J. Sci. Food Agri. 74: 35–41.
Schiefenhövel, K., and Rehbein, H. 2010. Identification of tropical shrimp species by RFLP and
SSCP analysis of mitochondrial genes. Arch. Lebensmittelhyg. 61: 50–56.
 96 H. Rehbein and K. Schiefenhövel

Sunnucks, P., Wilson, A. C. C, Beheregary, L. B., Zenger, K., French, J., and Taylor, A. C.
2000. SSCP is not so difficult: The application and utility of single-stranded conformation
polymorphism in evolutionary biology and molecular ecology. Mol. Ecol. 9: 1699–1710.
Teletchea, F. 2009. Molecular identification methods of fish species: Reassessment and possible
applications. Rev. Fish Biol. Fisher. 19: 265–293.
Wolf, C., Burgener, M., Hübner, P., and Lüthy, J. 2000. PCR-RFLP analysis of mitochondrial DNA:
Differentiation of fish species. Lebensm. Wiss. Technol. 33: 144–150.
Downloaded by [J.H. von Thuenen Institut] at 00:26 24 January 2012