Alexandria Journal of Veterinary Sciences 2016, Apr.

49 (1): 24-28
ISSN 1110 -2047, www.alexjvs.com
DOI: 10.5455/ajvs.210050

Authentication and Mislabeling Detection in Canned Meat Using Multiplex PCR

Zizy I. Elbialy1 , Walaa M. Elkassas 2 , Nasema A.Elkatatny1

1
Department of Biotechnology, Animal Health Research Institute, Egypt
2
Department of Food Hygiene, Animal Health Research Institute, Egypt
ABSTRACT
Key words: Detection of species adulteration in meat products is important for consumer protection and food
Adulteration, Canned labeling law application. The threat and risk of food adulteration and mislabeling have become a
meat, M ultiplex PCR large concern and challenge for the food control authorities and consumers. In this study 10
samples of Luncheon (beef) and 10 samples of Corned beef were collected from the local
markets in Kafrelsheikh Governorate and examined for mislabeling detection by means of
multiplex PCR. Results showed that 8 of the 10 samples Luncheon and all the 10 samples
Corned beef were adulterated with goat's meat, while one sample of Luncheon was adulterated
with equine meat, which were not in compliance with the label on the examined product. So, a
strict national program by the concerned authority is required to protect consumers and prevent
adulteration of food stuff.
*Corresponding Author : Zizy I. Elbialy; [email protected]

1-INTRODUCTION and dairy products, and other foods has been

performed primarily by genetic (Terzy et al., 2005)
In many countries, great value is placed on and immunological techniques (Liu et al., 2006).
labelling requirements to facilitate accurate and safe
animal identification by the consumers. The risk and Legislative authority establishes that meat
threat of food adulteration and mislabeling have products must be accurately labeled regarding species
become a large concern and challenge for the food content. Meat species adulteration in ground and
control authorities and consumers (Chandrika et al., comminuted products has been a widespread problem
2010). Additionally, fraudulent adulteration of food in retail markets. Identification of the species of origin
products may be objectionable for health reasons, as in meat samples is relevant to consumers for several
well as religious concerns, since consumption of reasons: (i) possible economic loss from fraudulent
products containing, undeclared constituents may substitution or adulteration, (ii) medical requirements
cause problems such as allergy in sensitized of individuals who might have specific food allergies,
individuals (Mackie, 1996). and (iii) religious reasons. Thus, reliable and sensitive
analytical tools are required for detection and
In this context, food components identification of animal food ingredients (Asensio et
identification has been mostly performed in the last al., 2008). DNA-based methods and ELISA
few years by different techniques. Chromatographic techniques have been the most widely used for meat
and electrophoretic techniques have proved to be authentication. As it has been shown that DNA-based
useful in food components identification (Mackie et methods are the most specific and sensitive methods
al., 2000; Mayer, 2005; Berrini et al., 2006). for meat species identification, although they require
However, although they are considerable value in some expensive laboratory equipment and a certain
certain instances, these methods are not convenient degree of knowledge (Macedo-Silva et al., 2000).
for routine sample analyses because they are relatively
costly, time consuming, and complex to perform. In recent years, more and more cases of
Consequently, in the last years the identification of adulteration including mislabeling, fraud and
meat and meat-based products, fish and seafood, milk substitution with cheaper fish arose in the fish market.

24
 Elbialy et al. /Alexandria Journal of Veterinary Sciences 2016, April. 49(1): 24-28

Hence, techniques that enable authentication of The processed meat samples were stored in -20°C
commercial fishery products are highly requested to until examined. A suitable amount from each sample
guarantee accurate labeling and fraudulent was obtained (1 gram) and transferred in 1.5ml micro
substitution. Species identification of fish is typically centrifuge tube for DNA extraction.
based on morphological characteristics. However,
most of the external features allowing morphological 2.2 Extraction of genomic DNA
identification of whole fish are not apparent after
processing. DNA and protein based methods are also The methodology described by Doyle and
used for fish identification. Protein method has less Doyle (1987) was used for DNA isolation from raw
advantage on processed sample in which protein may and processed meat by CTAB (cetyl
be already denatured or degraded. DNA based trimethylammonium bromide) as follows:
methods tend to be more favorite and reliable due to In a sterile labeled pot, approximately 1 g
their high specificity and sensitivity, strong stability from the sample is grounded with a pestle, mixed with
and easy application (Chen et al., 2014). 5 ml from CTAB solution, after complete mixing the
solution is transferred to a new sterile 15 ml
A number of Polymerase chain reaction polypropylene tube and the tube cap is closed. The
(PCR) based assays have been developed, evaluated tubes were incubated for approximately 1-2 hour at
and have shown superior for species detection in 65ºC in a water bath under constant shaking. One ml
foodstuff (Jonker et al., 2008) and mislabeling of the suspension (looks a bit like watery soup) was
discovery (Machado-Schiaffino et al., 2008). transferred into a labelled 1.5 ml eppendorf tube and
10µl from Proteinase K solution (20 mg/ml) were
In fact, identification of a mixture of more than one
added to the solution. Then the tubes were incubated
species is possible by PCR (Hubalkova et al., 2008).
for approximately overnight at 55ºC under current
The genetic identification of different species is made
agitation overnight, until the animal tissue was
possible by using a lot of molecular markers such as
completely digested. After digestion, the tubes were
forensically informative nucleotide sequencing
centrifuged for 5 minutes at approximately 11,600 g
(FINS) (Blanco et al., 2008), randomly amplified
(~15,000rpm). The supernatant was transferred into a
polymorphic DNA (RAPD) (Calvo et al., 2001),
new labelled eppendorf and 600 µl of chloroform
amplified fragment length polymorphism (AFLP)
were added and shaken vigorously. The tubes were
(Fumiere et al., 2003), RFLP (restriction fragment
centrifuge for 10 min. at approximately 11,600 g. The
length polymorphism) (Bellagamba et al., 2001),
625 µl of the supernatant was then transferred into a
Real-time polymerase chain reaction (qPCR) (Prado
new labelled eppendorf and 500 µl of isopropanol
et al., 2007; Jonker et al., 2008) and single nucleotide
were added, the tubes incubated 30 minutes at room
polymorphisms (SNP) (Zhao et al., 2006). These
temperature without agitation. The tubes were
methods differ in genetic information, in
centrifuged for 15 minutes at approximately 11,600 g
standardization of protocols, in the interpretation of
and the supernatant was discarded, the pellet was
results and in equipment that are required. washed with 500 μL ethanol (70%) and the samples
Therefore, this study was performed to detect were centrifuged for 5 minutes at approximately
the adulteration in canned meat samples (corned beef 11,600 g. The pellet resolved in 200 μl TE buffer (pH
and beef luncheon) collected from the local markets in 8.0) as stock solution and incubated at 37 °C for 2 hrs
Kafrelsheikh Governorate with other types of animal until it completely dissolved.
species rather than beef. 2.3 Genomic DNA detection
2-MATERIALS AND METHODS The integrity of the DNA extracts was
determined by electrophoresis by running 5μl of the
2.1 Sample collection and processing extracted DNA on a 1% agarose (Sigma, Germany) at
Processed food samples were purchased from 100 V in 1x Tris-acetate acid-EDTA (TAE) buffer,
the local markets in Kafrelsheikh Governorate for pH 8.0. Four microliters of 100bp DNA Ladder
examination. The number of samples was ten samples (Intron biotechnology) was used as size marker. The
from each product (corned beef and beef luncheon). electrophoresis was run. Etidium bromide (1 μg/ml)

25
 Elbialy et al. /Alexandria Journal of Veterinary Sciences 2016, April. 49(1): 24-28

was incorporated into the gel. The gel image was 3- RESULTS
visualized using UV trans-illuminator (SybGene). The
presence of an intense band, with minimal 3.1 DNA quantification and PCR amplification
degradation, indicated intact genomic DNA. The
concentration and purity of the extracted DNA were Genomic DNA extracted from the collected
processed meat samples showed smears indicating
measured using Nanodrop.
that some samples had degraded DNA which may be
2.4 Multiplex PCR amplification due to the use of dead animals. The A260/A280 ratios
of the samples ranged from 50 to100 ng/ μL, the
PCR was performed using primers for results of the multiplex PCR performed on the
different animal species according to Ilhak and Arslan examined samples are shown in figures (1,2) for
(2007) in one reaction as follows: Luncheon and Corned beef respectively. The PCR
results indicated adulteration of all corned beef
The PCR mixture contained: 2x PCR master mix (25 samples with goat meat with PCR fragment of 157bp
μL), genomic DNA (4 μL), from each primer pair 1 and of 8 samples from 10 examined Luncheon with
μL of 20 pmole working solution (from both forward goat meat and one sample of Luncheon with equine
and reverse primers) was added, dd water up to 50 μL. meat with PCR fragment of 439bp with the presence
Quality control included both positive and negative of beef meat with PCR fragment of 271bp in all
controls and PCR amplified in parallel with all samples. All samples were negative for swine, dog,
specimens. The primers used and target sizes are cat and sheep.
shown in table (1).
Table (1): Primers used for PCR amplification and target sizes for each animal species
Primer sequence Target
size
Buffaloe Fr GCCATATACTCTCCTTGGTGACA 271 bp
Re GTAGGCTTGGGAATAGTACGA
Ovine Fr TTAAAGACTGAGA GCATGATA 225bp
Re ATGAAAGAGGCAAATAGATTTTCG
Swine Fr GCCTAAATCTCCCCTCAATGGTA 212bp
Re ATGAAAGAGGCAAATAGATTTTCG
Cat Fr CATGCCTATCGAAACCTAA CATAA 274bp
Re AAAGAAGCTGCA GGA GA GTGA GT
Dog Fr GATGTGATCCGA GAA GGCACA 322bp
Re TTGTAATGAATAAGGCTTGAA G
Goat Fr GACCTCCCA GCTCCATCAAACATCTCATCTTGATGAAA 157bp
Re CTCGACAAATGTGA GTTA CA GA GGGA
Equine Fr GACCTCCCA GCTCCATCAAACATCTCATCTTGATGAAA
Re CTCAGATTCACTCGA CGA GGGTA GTA 439bp

Figure (1): 2% agarose gel electrophoresis of multiplex PCR of Luncheon samples using primers for different animal species
(bovine 271bp, horse 439bp, sheep 225bp, goat 157bp, dog 322bp, swine 212bp and cat 274bp). M: molecular weight marker
(100bp DNA ladder), L1-L10: Luncheon samples from 1-10.

26
 Elbialy et al. /Alexandria Journal of Veterinary Sciences 2016, April. 49(1): 24-28

Figure (2): 2% agarose gel electrophoresis of multiplex PCR of Corned beef samples using primers for different
animal species (bovine 271bp, horse 439bp, sheep 225bp, goat 157bp, dog 322bp, swine 212bp and cat 274bp).
M: molecular weight marker (100bp DNA ladder), b1-b10: Corned beef samples from 1-10.

4- DISCUSSION AND CONCLUSION Begona, 2004). However, in this study, the CTAB
method proved to be successful in examination of
Adulteration recently become a serious DNA from processed meat and inspite of added
problem and frequently found in meat and meat ingredients to the meat during processing operations,
products. In 2013, the Food Standard Agency of which act as PCR inhibitors, PCR amplification was
United Kingdom found 11 from 18 beef lasagna successfully performed and yielded satisfactory
products contained 60-100% horse meat. British meat results.
industries also threatened by porcine and horse DNA
finding in meat samples from three processing plants In conclusion, our results showed adulteration
which two from Ireland and one from Britain. In in almost all examined samples with other types of
addition the health risks caused by Salmonellosis and meat which is considered violation to the labeling
Trichinosis that may find their way into beef products instructions of the examined samples. So,
when poultry and pork meats, respectively, are added Identification of the species of origin in meat samples
(Wadege et al., 2006). Also, consumption of products is important not only for economic, health, religious
containing, undeclared constituents may cause and ethical reasons, but also to ensure fair trade and
problems such as allergy in sensitized individuals compliance with legislation. Therefore, calls for a
(Mackie, 1996). national control program to protect both the
consumers and the meat industry, and also to prevent
Ensuring food safety has resulted in increased unfair competition in the meat business. Also, highly
interest in the development of food detection sensitive and specific tests are required for use by
technique. In many countries, food traceability regulatory control officers in setting legislative
systems are becoming mandatory, they are measures and in detecting what is supposed to be a
particularly important for tracing livestock and pure product.
species in animal products. Molecular identification
techniques are specifically developed to detect species 5- REFERENCES
origins in feedstuff or processed food (Khairalla et al., Asensio, L., Gonzalez, I., Garcıa, T., Martın, R. 2008.
2007; Jonker et al., 2008) and mainly based on PCR- Determination of food authenticity by enzyme-linked
based assays. In this study we used a multiplex PCR immunosorbent assay (ELISA). Food control, 19(1):1-8.
technique to detect the presence of other meat sources Bellagamba, F., Moretti, V. M., Comincini, S., Valfre, F.
in the examined samples rather than determined by 2001. Identification of species in animal feedstuffs by
polymerase chain reaction--restriction fragment length
the label. polymorphism analysis of mitochondrial DNA. J.
Agricult. Food and Chem. 49(8): 3775-3781.
Detection of DNA from canned meat products
Berrini, A., Tepedino, V., Borromeo, V., Secchi, C. 2006.
was assessed by some investigators and was reported Identification of freshwater fish commercially labelled
to be non-practical. As food processing involving ‘‘perch’’ by isoelectric focusing and two-dimensional
excessive heat treatment specially processing canned electrophoresis. Food Chemistry, 96,163–168.
food product which in turn causes a significant Blanco, M., Perez-Martin, R. I., Sotelo, C. G. 2008.
degradation to the DNA structure (Miguel and Identification of shark species in seafood products by

27
 Elbialy et al. /Alexandria Journal of Veterinary Sciences 2016, April. 49(1): 24-28

forensically informative nucleotide sequencing (FINS). J. Merluccius. J. Agricult. Food and Chem. 56(13): 5091-
Agricult. Food Chem.56 (21): 9868-9874. 5095.
Calvo, J. H., Zaragoza, P., Osta, R. 2001. Random Macedo-Silva, A., Barbosa, S. F. C., Alkmin, M. G. A.,
amplified polymorphic DNA amplification of species in Vaz, A. J., Shimokomaki, M., Tenuta-Filho, A. 2000.
poultry pate. Poultry Science 80:522-524 Hamburger meat identification by dot-ELISA. Meat Sci.
Chandrika, M., Maimunah, M., Zainon, M. N. and Son, R. 56: 189-192.
2010. Identification of the species origin of commercially Mackie, I. M. 1996. Authenticity of fish. In P. R. Ashurt
available processed food products by mitochondrial DNA and M. J. Dennis (Eds.), Food authentication (pp. 140–
analysis. Int. Food Res. J. 17: 867-876. 170). London: Blackie Academic and Professional.
Chen, S., Zhang ,Y. , Li, H., Wang, J., Chen, W., Zhou, Y., Mackie, I. M., Craig, A., Etienne, M., Je´roˆme, M.,
Zhou, S. 2014. Differentiation of fish species in Taiwan Fleurence, J., Jessen, F., et al. 2000. Species identification
Strait by PCR-RFLP and lab-on-a-chip system. Food of smoked and gravad fish products by sodium
Cont. 44: 26-34. dodecylsulphate polyacrylamide gel electrophoresis, urea
Doyle, J.J., Doyle, J.L. 1987. A rapid DNA isolation isoelectric focusing and native isoelectric focusing: A
procedure for small quantities of fresh leaf tissue. collaborative study. Food Chem.71: 1-7.
Phytochem. Bull.19:11-15. Mayer, H. K. 2005. Milk species identification in cheese
Fumiere, O., Dubois, M., Gregoire, D., Thewis, A., Berben, varieties using electrophoretic, chromatographic and PCR
G. 2003. Identification on commercialized products of techniques. Int. Dairy J. 15: 595-604.
AFLP markers able to discriminate slow- from fast- Miguel, A. P., Begona, P.-V. 2004. Identification of
growing chicken strains. J. Agricult. Food Chem. 51(5): commercial canned tuna species by restriction site
1115-1119. analysis of mitochondrial DNA products obtained by
Hubalkova, Z., Kralik, P., Kasalova, J., Rencova, E. 2008. nested primer PCR. Food Chem. 86:143-150.
Identification of gadoid species in fish meat by Prado, M., Berben, G., Fumiere, O., van Duijn, G.,
polymerase chain reaction (PCR) on genomic DNA. J. Mensinga-Kruize, J., Reaney, S., Boix, A., von Holst, C.
Agricult. Food Chem. 56(10): 3454-3459. 2007. Detection of ruminant meat and bone meals in
Ilhak, O.I., Arslan, A. 2007. Identification of meat species animal feed by real-time polymerase chain reaction: result
by polymerase chain reaction (PCR) technique. Turk. J. of an inter-laboratory study. J. Agricult. Food and Chem.
Vet. Anim. Sci. 31(3): 159-163 55(18): 7495-7501.
Jonker, K. M., Tilburg, J. J., Hagele, G. H., de Boer, E. Terzy, V., Morcia, C., Gorrini, A., Stanca, A. M., Cegrı´, P.
2008. Species identification in meat products using real- R., Faccioli, P. 2005. DNA-based methods for
time PCR. Food additives & contaminants. Part A, identification and quantification of small grain cereal
Chemistry, Analysis, Control, Exposure and Risk Assess. mixtures and fingerprinting of varieties. J. Cereal Sci. 41:
25(5): 527-533. 213-220.
Khairalla, K. M., Aradaib, I. E., Bakhiet, A. O., Hassan, T., Wadege, J., Nasinyama, G.W., Kang’ethe, E.K., Olaho-
Hago, B. E., Saeed, A. R. 2007. A simple and rapid assay Mukani, W. 2006. Adulteration of beef sausages with
for specific identification of bovine derived products in pork sold in supermarkets in Kampala-Uganda. Afr. J.
biocomplex materials. Pakistan J. Biol. Sci.10(8): 1170- Anim. Biomed. Sci., 1 (1):41-45.
1174. Zhao, C. J., Wang, C. F., Deng, X. M., Gao, Y., Wu, C.
Liu, L. H., Chen, F. C., Dorsey, J. L., Hsieh, Y. H. P. 2006. 2006. Identification of single-nucleotide polymorphisms
Sensitive monoclonal antibody-based sandwich ELISA in 5’ end and exons of the PRKAG3 gene in Hubbard
for the detection of porcine skeletal muscle in meat and White broiler, Leghorn layer, and three Chinese
feed products. J. Food Sci. 71: M1-M6 indigenous chicken breeds. J. Animal Breed. Genet.
Machado-Schiaffino, G., Martinez, J. L., Garcia- Vazquez, 123(5): 349-352.
E. 2008. Detection of mislabeling in hake seafood
employing mtSNPs-based methodology with
identification of eleven hake species of the genus

28