Protocols for Macroalgae

Research
Protocols for Macroalgae
Research

Edited by
Bénédicte Charrier
Thomas Wichard
C.R.K. Reddy
Central cover photo courtesy of (c) Station Biologique de Roscoff, Yann Fontana.

CRC Press
Taylor & Francis Group
6000 Broken Sound Parkway NW, Suite 300
Boca Raton, FL 33487-2742

© 2018 by Taylor & Francis Group, LLC

CRC Press is an imprint of Taylor & Francis Group, an Informa business

No claim to original U.S. Government works

Printed on acid-free paper

International Standard Book Number-13: 978-1-4987-9642-2 (Hardback)

This book contains information obtained from authentic and highly regarded sources. Reasonable
efforts have been made to publish reliable data and information, but the author and publisher cannot
assume responsibility for the validity of all materials or the consequences of their use. The authors and
publishers have attempted to trace the copyright holders of all material reproduced in this publication
and apologize to copyright holders if permission to publish in this form has not been obtained. If any
copyright material has not been acknowledged please write and let us know so we may rectify in any
future reprint.

Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced,
transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or
hereafter invented, including photocopying, microfilming, and recording, or in any information
storage or retrieval system, without written permission from the publishers.

For permission to photocopy or use material electronically from this work, please access www.
copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC),
222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that
provides licenses and registration for a variety of users. For organizations that have been granted a
photocopy license by the CCC, a separate system of payment has been arranged.

Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are
used only for identification and explanation without intent to infringe.

Library of Congress Cataloging‑in‑Publication Data

Names: Charrier, Bénédicte, author.

Title: Protocols for macroalgae research / Bénédicte Charrier, Thomas
Wichard, and CRK Reddy.
Description: Boca Raton : Taylor & Francis, 2018. | Includes bibliographical
references.
Identifiers: LCCN 2017048183 | ISBN 9781498796422 (hardback : alk. paper) |
ISBN 9781351132954 (ebook)
Subjects: LCSH: Marine algae--Research--Popular works.
Classification: LCC QK570.2 .C49 2017 | DDC 579.8/177--dc23
LC record available at https://lccn.loc.gov/2017048183

Visit the Taylor & Francis Web site at

http://www.taylorandfrancis.com

and the CRC Press Web site at

http://www.crcpress.com
Contents
Preface .................................................................................................................ix
Editors .............................................................................................................. xiii
Contributors ......................................................................................................xv

Section I: Cultivating and preserving seaweeds

Chapter 1 Seaweed in high-energy environments: Protocol

to move Saccharina cultivation offshore ............................... 3
Bela H. Buck and Britta Grote

Chapter 2 Cultivation protocol for Saccharina latissima ................... 37

Silje Forbord, Kristine Braaten Steinhovden,
Kaia Kjølbo Rød, Aleksander Handå, and Jorunn Skjermo

Chapter 3 Derivation of clonal stock cultures and hybridization

of kelps: A tool for strain preservation and breeding
programs ..................................................................................... 61
Inka Bartsch

Chapter 4 Cryopreservation of macroalgae ............................................ 79

John G. Day

Chapter 5 Unraveling seaweeds bacteriomes: From field site

to computer screen .................................................................... 95
Tânia Aires, Gerard Muyzer, Ester A. Serrão, and
Aschwin H. Engelen

Chapter 6 Heavy metal ecotoxicity on the early life history

stages of macroalgae............................................................... 115
Pablo P. Leal and Michael Y. Roleda

v
vi Contents

Chapter 7 A simple protocol for a rapid and consistent

production of a large number of viable protoplasts
from the Ulvophycean species ............................................. 129
Vishal Gupta and C.R.K. Reddy

Chapter 8 Purification of sporulation and swarming inhibitors

from Ulva: Application in algal life-cycle controlling .....139
Ralf W. Kessler, Taghreed Alsufyani, and Thomas Wichard

Chapter 9 Preparation of axenic cultures in Ulva (Chlorophyta)......159

Gianmaria Califano and Thomas Wichard

Section II: Chemical composition

Chapter 10 Biochar production from seaweeds ..................................... 175

Loretto Contreras-Porcia, Matías Araya,
Elizabeth Garrido-Ramírez, Cristian Bulboa,
Jean Pierre Remonsellez, Javier Zapata, Camila Espinoza,
and Jorge Rivas

Chapter 11 Identification and quantification of laminarins

in brown algae ......................................................................... 187
Angelika Graiff, Wolfgang Ruth, and Ulf Karsten

Chapter 12 Determination of carbohydrate composition

of macroalgae ........................................................................... 199
Wouter J.J. Huijgen, E.M. Cobussen-Pool, B.F. van Egmond,
and J.W. van Hal

Chapter 13 Quantification of proteins in seaweeds .............................. 211

Carl Safi, Jelle van Leeuwen, Yvette Telleman,
Nicole Engelen-Smit, Lambertus van den Broek,
and Paulien Harmsen

Chapter 14 Comprehensive phytohormone quantification

in the red alga Pyropia yezoensis by liquid
chromatography–mass spectrometry.................................. 225
Takakazu Matsuura, Izumi C. Mori, Yoko Ikeda,
Takashi Hirayama, and Koji Mikami

Chapter 15 Total phenolic content and antioxidant capacity

analysis of seaweed biomass ................................................ 237
Xiaoru Hou, Randi Neerup, and Anne-Belinda Bjerre
Contents vii

Chapter 16 Extraction of phycocyanin and phycoerythrin pigments .... 249

Stewart William Beattie, Michèle Morançais, Paul Déléris,
Joël Fleurence, and Justine Dumay

Chapter 17 Quantification and localization of reactive oxygen

species in marine macrophytes ............................................ 267
Manoj Kumar, Loretto Contreras-Porcia, Nirali M. Kumar,
and Peter J. Ralph

Chapter 18 Metabolomics of intra- and extracellular metabolites

from micro- and macroalgae using GC–MS
and LC–MS ............................................................................... 279
Constanze Kuhlisch, Gianmaria Califano, Thomas Wichard,
and Georg Pohnert

Chapter 19 Preparative extraction of exometabolites

from seaweed surfaces ........................................................... 301
Florian Weinberger

Chapter 20 Disruption-free solid-phase extraction of surface

metabolites from macroalgae ............................................... 309
Emilio Cirri and Georg Pohnert

Section III: Cellular and molecular characterization

Chapter 21 The immunodetection and in situ imaging of

cell-wall polysaccharides in brown algae .......................... 323
Amandine Siméon, Delphine Duffieux, Cécile Hervé,
Sophie Le Panse, Paul Knox, and Thomas Torode

Chapter 22 Atomic force microscopy based analysis of cell-wall

elasticity in macroalgae ......................................................... 335
Thomas Torode, Marina Linardic, J. Louis Kaplan,
and Siobhan A. Braybrook

Chapter 23 Dynamic and microscale mapping of cell growth:

Case of Ectocarpus filament cells ........................................ 349
Hervé Rabillé, Bernard Billoud, Elodie Rolland,
and Bénédicte Charrier
viii Contents

Chapter 24 Actin fluorescent staining in the filamentous brown

alga Ectocarpus siliculosus .................................................. 365
Hervé Rabillé, Maria Koutalianou, Bénédicte Charrier,
and Christos Katsaros

Chapter 25 Cryofixation of brown algae for transmission

electron microscopy................................................................ 381
Chikako Nagasato, Christos Katsaros, and Taizo Motomura

Chapter 26 Probing the subcellular topography of

seaweeds: Transmission electron microscopy,
immunocytochemistry, and correlative light
microscopy ............................................................................... 391
Sandra C. Raimundo and David S. Domozych

Chapter 27 Coralline algae preparation for scanning electron

microscopy and optical microscopy .................................... 411
S. Kaleb, G. Alongi, and A. Falace

Chapter 28 Extraction of high quality RNA from brown algae

for transcriptomic analysis ................................................... 429
Sandra Heinrich

Chapter 29 Induction of sexual reproduction in Spirogyra

cultures for laser capture microdissection of gametes
and zygotes ............................................................................... 441
Denis Saint-Marcoux and Jane A. Langdale

Chapter 30 Cloning and expression strategies for the

postgenomic analysis of brown algae ................................ 453
Agnès Groisillier

Chapter 31 Polyethylene glycol-mediated transformation in

the green macroalga Ulva mutabilis (Chlorophyta):
A forward genetics approach................................................ 469
Jens Boesger, Michiel Kwantes, and Thomas Wichard

Index ................................................................................................................ 485

Preface
Macroalgae are multicellular, (usually) macroscopic organisms that
inhabit either marine or freshwater environments. They are vital organ-
isms on our coastlines, where they are the major primary producers and
an essential link in the food chain. However, macroalgae are not only of
high ecological importance, they also hold great economic value, being
rich in vitamins, nutrients, and other organic substances making them
useful for humans in many ways. Their direct use as food, feed, and fertil-
izers, or as sources of polysaccharides, minerals, and proteins for the food,
pharmaceutical, and textile industries, together promote seaweeds as a
promising resource for diverse human activities.
Macroalgae are attractive study organisms owing to their unique
biological and evolutionary features. They have evolved independently
of terrestrial plants and have hence developed some inherently specific
cellular features. For example, their chlorophyll pigments are partly dif-
ferent from those found in land plants and genome sequence analyses
have revealed the acquisition of novel genes, often by horizontal transfers
that have resulted in the selection of distinct biosynthesis and regulation
pathways. Furthermore, the marine environment imposes several specific
conditions: mechanical forces are much higher than on land, light inten-
sities are reduced, and high salinity promotes chemical modifications of
cell components. Nevertheless, despite significant achievements in funda-
mental research over the past decades, macroalgae remain largely under-
investigated. The stumbling blocks to work with macroalgae are practical
ones: growing them and getting them to reproduce in controlled condi-
tions are difficult at best. Macroalgae are highly sensitive to seawater com-
position, and this seawater is often artificially reconstituted in labs distant
from the shore. Fertility and reproduction can be intractable in artificial
conditions—as in animals—making genetic approaches sometimes close
to impossible in the laboratory. Macroalgal growth and development can
be further complicated by reciprocally beneficial interactions with bacte-
ria. These few examples illustrate that working with these organisms poses
many challenges, requiring intellectual flexibility and the development of

ix
x Preface

specific, innovative tools. Opportunely, seaweed research is now experi-

encing an enormous impetus, driven by their potential applications.
This book is a collection of well-established methodologies, including
current and updated protocols for research on macroalgae. It is not only
intended for neophytes starting out in the study of this exciting group
of organisms, but also for confirmed phycologists who are interested in
the extraordinary possibilities offered by these organisms to address
essential questions in algal physiology, developmental biology, and sus-
tainable aquaculture. How do specific environments affect their growth
and development? To what extent have they explored evolutionary alter-
natives, in comparison with their terrestrial counterparts? Answering
these questions requires the development of a full range of cutting-edge
techniques dedicated explicitly to macroalgae, the focus and the feature
of this book. Progress in technological developments has now reached a
stage where many techniques initially developed in and for other organ-
isms can finally be transferred to macroalgae; genomics is one of the most
convincing examples. Nevertheless, even straightforward extraction tech-
niques require adjustment to be effective on macroalgae.
This book contains 31 chapters written by experts and reflects the
variety of studies conducted recently on brown, red, and green macroal-
gae, both in the seaweed aquaculture sector and academic research. It is
divided into three sections dedicated to Cultivating and preserving seaweeds
(Section I), Chemical composition (Section II), and Cellular and molecular char-
acterization (Section III), and each chapter offers the necessary Tips and
Tricks to carry out the protocols successfully.
Section I (Chapters 1 through 9) deals with growing macroalgae in
their natural environment. Standardizing material preparation and moni-
toring algal growth are a prerequisite to any attempt to study their biology
in this changing environment. This first section covers protocols describ-
ing the production of standardized juveniles in the laboratory (Chapter
2 by Forbord et  al., Chapter 3 by I. Bartsch, and Chapter 9 by Califano
and Wichard), their transfer offshore, and the monitoring of their growth,
sometimes in hostile environments (Chapter 1 by Buck and Grote and
Chapter 6 by Leal and Roleda). Each step in the sustainable cultivation
requires good knowledge on algal biology throughout its life cycle, start-
ing with the early stages (Chapters 2, 3, and 6). Deciphering regulatory
checkpoints in the life cycle is also of prime importance to improve aquacul-
ture practices, but difficult to investigate at the molecular level (Chapter 8
by Kessler et al., and Chapter 9).
In Section II (Chapters 10 through 20), protocols provide access to
the chemical substances found in seaweeds, which can be recognized as
chemical factories. Approaches have been adapted to extract substances of
various chemical composition, such as charcoal as a soil amendment (bio-
char; Chapter 10 by Contreras-Porcia et al.), and to identify and quantify a
Preface xi

series of specific types of molecules, such as sugars (Chapter 11 by Graiff

et al., and Chapter 12 by Huijgen et al.), proteins (Chapter 13 by Safi et al.),
phytohormones (Chapter 14 by Matsuura et al.), antioxidants (Chapter 15
by Hou et al.), pigments (Chapter 16 by Beattie et al.), and oxygen species
(Chapter 17 by Kumar et al.). Often inspired by research on microalgae,
mass spectrometry techniques now offer a view of the general land-
scape of the metabolic activities occurring in macroalgae (Chapter 18 by
Kuhlisch et al.). Most important, together with genomics-mediated iden-
tification of the holobiome (Chapter 5 by Aires et al.), surface metabolic
profiling contributes to a better understanding of the cross talk between
macroalgae and their biotic environment (Chapter 19 by F. Weinberger,
and Chapter 20 by Cirri and Pohnert).
In Section III (Chapters 21 through 31), the experimenter will find
approaches for the acquisition of data at the cellular level. Special attention
is given to studies carried out at the surface of individual cells including
in situ mapping of polysaccharides (Chapter 21 by Siméon et al.), elastic-
ity measurements (Chapter 22 by Torode et al.), and growth patterning
(Chapter 23 by Rabillé et al.) of the cell wall. These studies are extended
further to other, additional levels, that is, the subcellular (e.g., cytoskel-
eton organization; Chapter 24 by Rabillé et al.) and tissue levels, with a
fine-scale description of the spatial organization of tissues. Work on these
levels requires adjustments of traditional microscopy techniques due to
the special biological (e.g., for calcareous seaweeds; Chapter 27 by Kaleb
et al.) and chemical (e.g., the high polysaccharide content; Chapter 25 by
Nagasato et al., and Chapter 26 by Raimundo et al.) features of algal cells.
New technologies, such as laser capture microdissection, shed light on
the gene expression at the single-cell level (Chapter 29 by Saint-Marcoux
et al.) and will be an important complementary technique in the transcrip-
tomics of macroalgae (Chapter 28 by S. Heinrich). All these approaches
aim to put together an instructive and coherent atlas of the features at
the tissue, cellular, and subcellular levels. Furthermore, the determined
differences between the various tissues, organs, or cells of the thallus will
pave the way to improved knowledge on how macroalgae develop into
multicellular organisms and will allow us to address new questions that
may be relevant for the potential applications of macroalgae.
The last chapters raise prospects as to developing genetic engineer-
ing alternatives to the exploitation of natural, wild populations. In vitro
production of native proteins in heterologous organisms is now possible
for some species (Chapter 30 by A. Groisillier), and genetic transformation
(Chapter 31 by Boesger et al.) offers the possibility to modify the activity
of macroalgal cells in a targeted and controlled approach (e.g., in Ulva).
Cross-breeding (Chapter 3) and protoplast fusions (Chapter 7 by Gupta
and Reddy) are alternative approaches to modifying the genetic traits of
seaweeds. The modification of the macroalgal genetic heritage should be
xii Preface

accompanied by enhanced development of cryopreservation protocols,

still too limited for these species (Chapter 4 by J. Day). Further develop-
ments in algal genetics (Chapters 30 and 31) in an ethical, regulated, and
optimally legislated framework will enlighten fundamental research and
increase the economic value of macroalgae as food sources or possible
alternatives for the production of renewable energy.
This book is a production of the COST Action FA1406 Phycomorph
(2015–2019), which endeavors to acquire knowledge on the biological
mechanisms that control macroalgal development, growth, and reproduc-
tion (http://www.cost.eu/COST_Actions/fa/FA1406). The COST Action
workshops and training schools carried out as part of the Phycomorph
inspired us to compile the collective experience and knowledge of the
participating phycologists to provide a sorely needed manual on the well-
established and novel methodologies in Protocols for Macroalgae Research.
We thank all the authors for their enthusiastic collaboration in the devel-
opment and constitution of this book that, we hope, will inspire readers
and researchers.

Bénédicte Charrier
Roscoff, France

Thomas Wichard
Jena, Germany

C.R.K. Reddy
Bhavnagar, India
Editors
Dr. Bénédicte Charrier is a senior scientist from Centre National de la
Recherche Scientifique (CNRS) working at Station Biologique de Roscoff,
Roscoff, France. She is a specialist in macroalgae morphogenesis and
development, with an expertise on the filamentous alga Ectocarpus silicu-
losus. She is currently the Chair of the European network Phycomorph, sup-
ported by the Cooperation in Science & Technology (COST) Association
(2015–2019), which aims to coordinate research in growth, reproduction,
and morphogenesis of macroalgae in Europe and in association with
Asian and North American laboratories.

Dr. Thomas Wichard is a research group leader at the Institute for

Inorganic and Analytical Chemistry of the Friedrich Schiller University
Jena, Jena, Germany. The main focus of his research group is to elucidate
the mutualistic interactions between bacteria and the marine macroalga
Ulva (cross-kingdomcross-talk). The group applies various methodologies in
analytical chemistry, chemical ecology, and molecular biology to under-
stand the basis of ecophysiological processes.

Dr. C.R.K. Reddy is a chief scientist in Seaweed Biology and Bio-

technology Cultivation at CSIR–Central Salt and Marine Chemicals
Research Institute in Bhavnagar, India. He is an expert in marine mac-
roalgae, making significant contributions to macroalgae tissue culture
and protoplast techniques, including genetic improvement of seaweeds,
seaweed biomass for chemicals and biofuels, seaweed biodiversity, and
seaweed biology and cultivation.

xiii
Contributors
Tânia Aires* and
Centro de Ciencias do Mar
Centro de Investigación Marina
(CCMAR)
Quintay (CIMARQ), Facultad de
CIMAR, Universidade do Algarve
Ecología y Recursos Naturales
Faro, Portugal
Universidad Andres Bello
Quintay, Chile
G. Alongi
Department of Biological, Inka Bartsch*
Geological and Environmental Alfred-Wegener-Institute
Sciences Helmholtz Center for Polar and
University of Catania Marine Research
Catania, Italy Bremerhaven, Germany

Taghreed Alsufyani Stewart William Beattie

Institute for Inorganic and Mer, Molécule, Santé
Analytical Chemistry (IAAC) Université de Nantes
Friedrich Schiller University Jena Nantes, France
Jena, Germany
and Bernard Billoud
Morphogenesis of Macroalgae
Algal Research Laboratory Station Biologique de Roscoff
Taif University Roscoff, France
Taif, Saudi Arabia
Anne-Belinda Bjerre
Matías Araya Center of Bioresource and
Departamento de Ecología Biorefinery
y Biodiversidad, Facultad Danish Technological Institute
de Ecología y Recursos Taastrup, Denmark
NaturalesUniversidad Andres
Bello
Santiago, Chile

xv
xvi Contributors

Jens Boesger and

Institute for Inorganic and
Applied Marine Biology
Analytical Chemistry
Bremerhaven University of
Friedrich Schiller University
Applied Sciences
Jena
Bremerhaven, Germany
Jena, Germany
and Cristian Bulboa
Departamento de Ecología y
Leibniz Institute on Aging–Fritz
Biodiversidad, Facultad de
Lipmann Institute (FLI)
Ecología y Recursos Naturales
Jena, Germany
Universidad Andres Bello
Santiago, Chile
Kristine Braaten Steinhovden
SINTEF Ocean
Trondheim, Norway Gianmaria Califano
Institute for Inorganic and
Siobhan A. Braybrook* Analytical Chemistry
The Sainsbury Laboratory Friedrich Schiller University Jena
University of Cambridge Jena, Germany
Cambridge, United Kingdom
and Bénédicte Charrier*
Morphogenesis of Macroalgae
Department of Molecular, Station Biologique de Roscoff
Cell, and Developmental Roscoff, France
Biology E-mail: Benedicte.Charrier@
University of California at Los sb-roscoff.fr
Angeles
Los Angeles, CA
Emilio Cirri
Bioorganic Analytics, Institute
Lambertus van den Broek
for Inorganic and Analytical
Wageningen Food & Biobased
Chemistry
Research
Friedrich Schiller University
Wageningen, the Netherlands
Jena, Germany
Bela H. Buck*
Alfred-Wegener Institute E.M. Cobussen-Pool
Helmholtz Centre for Biomass & Energy Efficiency
Polar and Marine Research Energy Research Centre of the
(AWI) Netherlands (ECN)
Bremerhaven, Germany Petten, the Netherlands
Contributors xvii

Loretto Contreras-Porcia* Justine Dumay*

Departamento de Ecología y Mer, Molécule, Santé
Biodiversidad, Facultad de Université de Nantes
Ecología y Recursos Naturales Nantes, France
Universidad Andres Bello
Santiago, Chile B.F. van Egmond
Biomass & Energy Efficiency
and Energy Research Centre of the
Center of Applied Ecology & Netherlands (ECN)
Sustainability (CAPES) Petten, the Netherlands
Pontificia Universidad Católica de
Chile, Avda Aschwin H. Engelen
Santiago, Chile Centro de Ciencias do Mar
(CCMAR)
and CIMAR, Universidade do Algarve
Centro de Investigación Marina Faro, Portugal
Quintay (CIMARQ), Facultad de
Nicole Engelen-Smit
Ecología y Recursos Naturales
Wageningen Food & Biobased
Universidad Andres Bello
Research
Quintay, Chile
Wageningen, the Netherlands
John G. Day* Camila Espinoza
Culture Collection of Algae and Departamento de Ecología y
Protozoa, Scottish Association Biodiversidad, Facultad de
for Marine Science Ecología y Recursos Naturales
Scottish Marine Institute Universidad Andres Bello
Oban, United Kingdom Santiago, Chile
Paul Déléris and
Mer, Molécule, Santé Centro de Investigación Marina
Université de Nantes Quintay (CIMARQ), Facultad de
Nantes, France Ecología y Recursos Naturales
Universidad Andres Bello
David S. Domozych* Quintay, Chile
Department of Biology and
Skidmore Microscopy Imaging A. Falace*
Center Department of Life Sciences
Skidmore College University of Trieste
Saratoga Springs, New York Italy

Delphine Duffieux Joël Fleurence

Marine Biology Mer, Molécule, Santé
Station Biologique de Roscoff Université de Nantes
Roscoff, France Nantes, France
xviii Contributors

Silje Forbord* J.W. van Hal

SINTEF Ocean Biomass & Energy Efficiency
Trondheim, Norway Energy Research Centre of the
Netherlands (ECN)
and
Petten, the Netherlands
Department of Biology
Norwegian University of Science Aleksander Handå
and Technology (NTNU) SINTEF Ocean
Trondheim, Norway Trondheim, Norway

Elizabeth Garrido-Ramírez
Centro de Investigación para la Paulien Harmsen
Sustentabilidad, Facultad de Wageningen Food & Biobased
Ecología y Recursos Naturales Research
Universidad Andres Bello Wageningen, the Netherlands
Santiago, Chile
Sandra Heinrich*
Angelika Graiff* Biozentrum Klein Flottbek
Applied Ecology and Phycology, University of Hamburg
Institute of Biological Sciences Hamburg, Germany
University of Rostock
Rostock, Germany Cécile Hervé*
Marine Biology
Agnès Groisillier* Station Biologique de Roscoff
Algal Biology and Interactions Roscoff, France
with the Environment
Station Biologique de Roscoff
Roscoff, France Takashi Hirayama
Institute of Plant Science and
Britta Grote Resources
Alfred-Wegener Institute Okayama University
Helmholtz Centre for Polar and Kurashiki, Japan
Marine Research (AWI)
Bremerhaven, Germany Xiaoru Hou*
Center of Bioresource and
Vishal Gupta Biorefinery
Biological Oceanography Division Danish Technological Institute
CSIR–National Institute of Taastrup, Denmark
Oceanography
Goa, India
Contributors xix

Wouter J.J. Huijgen* Maria Koutalianou

Biomass & Energy Efficiency Section of Botany, Department of
Energy Research Centre of the Biology
Netherlands (ECN) National and Kapodistrian
Petten, the Netherlands University of Athens
Athens, Greece
Yoko Ikeda
Institute of Plant Science and Constanze Kuhlisch
Resources Bioorganic Analytics, Institute
Okayama University for Inorganic and Analytical
Kurashiki, Japan Chemistry
Friedrich Schiller University Jena
S. Kaleb
Jena, Germany
Department of Life Sciences
University of Trieste
Manoj Kumar*
Italy
Climate Change Cluster (C3),
Ulf Karsten Faculty of Science
Applied Ecology and Phycology, University of Technology Sydney
Institute of Biological Sciences (UTS)
University of Rostock Sydney, Australia
Rostock, Germany
Nirali M. Kumar
Christos Katsaros* Faculty of Science, Medicine,
Section of Botany, Department of and Health (SMAH), School of
Biology Chemistry
National and Kapodistrian University of Wollongong
University of Athens Wollongong, Australia
Athens, Greece
Michiel Kwantes
Ralf W. Kessler Institute for Inorganic and
Institute for Inorganic and Analytical Chemistry
Analytical Chemistry Friedrich Schiller University Jena
Friedrich Schiller University Jena Jena, Germany
Jena, Germany

Kaia Kjølbo Rød Jane A. Langdale

Seaweed Energy Solutions Department of Plant Sciences
Trondheim, Norway University of Oxford
Oxford, United Kingdom
Paul Knox
Centre for Plant Sciences, Faculty Sophie Le Panse
of Biological Sciences Merimage Platform
University of Leeds Station Biologique de Roscoff
Leeds, United Kingdom Roscoff, France
xx Contributors

Pablo P. Leal* Izumi C. Mori

Instituto de Fomento Pesquero Institute of Plant Science and
(IFOP) Resources
Puerto Montt, Chile Okayama University
Kurashiki, Japan
Jelle van Leeuwen
Wageningen Food & Biobased Taizo Motomura
Research Muroran Marine Station, Field
Wageningen, the Netherlands Science Center for Northern
Biosphere
Hokkaido University
Marina Linardic
Muroran, Japan
The Sainsbury Laboratory
University of Cambridge Gerard Muyzer
Cambridge, United Kingdom Microbial Systems Ecology,
Department of Freshwater and
J. Louis Kaplan Marine Ecology, Institute for
The Sainsbury Laboratory Biodiversity and Ecosystem
University of Cambridge Dynamics
Cambridge, United Kingdom University of Amsterdam
Amsterdam, the Netherlands
Takakazu Matsuura
Institute of Plant Science and Chikako Nagasato*
Resources Muroran Marine Station, Field
Okayama University Science Center for Northern
Kurashiki, Japan Biosphere
Hokkaido University
Muroran, Japan
Koji Mikami*
Faculty of Fisheries Sciences
Hokkaido University Randi Neerup
Hakodate, Japan Center of Bioresource and
Biorefinery
College of Fisheries and Life Danish Technological Institute
Science Taastrup, Denmark
Shanghai Ocean University
Shanghai, China Georg Pohnert*
Bioorganic Analytics, Institute for
Michèle Morançais Inorganic and Analytical
Mer, Molécule, Santé Chemistry
Université de Nantes Friedrich Schiller University Jena
Nantes, France Jena, Germany
Contributors xxi

Hervé Rabillé Jorge Rivas

Morphogenesis of Macroalgae Departamento de Ciencias
Station Biologique de Roscoff Químicas, Facultad de Ciencias
Roscoff, France Básicas
Universidad de Chile
Sandra C. Raimundo Santiago, Chile
Department of Biology and
and
Skidmore Microscopy Imaging
Center Instituto de Ciencias Químicas
Skidmore College Aplicadas, Facultad de
Saratoga Springs, New York Ingeniería
Universidad Autónoma de Chile
Peter J. Ralph San Miguel, Chile
Climate Change Cluster (C3),
Faculty of Science
Michael Y. Roleda
University of Technology Sydney
Norwegian Institute of
(UTS)
Bioeconomy Research
Sydney, Australia
Bodø, Norway
C.R.K. Reddy*
Discipline of Marine Elodie Rolland
Biotechnology and Ecology Morphogenesis of Macroalgae
CSIR–Central Salt and Marine Station Biologique de Roscoff
Chemicals Research Institute Roscoff, France
Bhavnagar, India
E-mail: [email protected]
Wolfgang Ruth
Analytical and Technical
Jean Pierre Remonsellez
Chemistry, Institute of
Departamento de Ecología y
Chemistry
Biodiversidad, Facultad de
University of Rostock
Ecología y Recursos Naturales
Rostock, Germany
Universidad Andres Bello
Santiago, Chile
Carl Safi*
and
Wageningen Food & Biobased
Facultad de Administración y Research
Economía Wageningen, the Netherlands
Universidad de Santiago de Chile,
Avda
Santiago, Chile
xxii Contributors

Denis Saint-Marcoux* Florian Weinberger*

Université de Lyon GEOMAR Helmholtz-Zentrum für
UJM-Saint-Étienne Ozeanforschung Kiel
Saint-Étienne, France Kiel, Germany
and
Thomas Wichard*
Department of Plant Sciences Institute for Inorganic and
University of Oxford Analytical Chemistry
Oxford, United Kingdom Friedrich Schiller University Jena
Jena, Germany
Ester A. Serrão E-mail: Thomas.Wichard@uni-
Centro de Ciencias do Mar jena.de
(CCMAR)
CIMAR, Universidade do Algarve Javier Zapata
Faro, Portugal Departamento de Ecología
y Biodiversidad, Facultad
Amandine Siméon de Ecología y Recursos
Marine Glycobiology Naturales
Station Biologique de Roscoff Universidad Andres Bello
Roscoff, France Santiago, Chile
and
Jorunn Skjermo
SINTEF Ocean Centro de Investigación
Trondheim, Norway Marina Quintay (CIMARQ),
Facultad de Ecología y Recursos
Yvette Telleman Naturales
Wageningen Food & Biobased Universidad Andres Bello
Research Quintay, Chile
Wageningen, the Netherlands

Thomas Torode
Centre for Plant Sciences, Faculty
of Biological Sciences
University of Leeds
Leeds, United Kingdom
and
The Sainsbury Laboratory
University of Cambridge
Cambridge, United Kingdom

* Corresponding author.
section one

Cultivating and preserving
seaweeds
chapter one

Seaweed in high-energy
environments
Protocol to move Saccharina
cultivation offshore
Bela H. Buck and Britta Grote

Contents
1.1 Introduction to offshore aquaculture..................................................... 4
1.2 State of the art of offshore seaweed cultivation.................................... 5
1.3 Land-based preparation and site selection ........................................... 8
1.3.1 Site selection .................................................................................. 9
1.3.1.1 Site selection: Advance information
of the local area ashore and at sea ............................. 10
1.3.1.2 Site selection: Site-specific, oceanographic,
and water quality parameter ...................................... 11
1.3.1.3 Site selection: Economic/technical/expansion
feasibility ....................................................................... 12
1.3.2 Equipment and system design .................................................. 13
1.3.2.1 System design for the offshore seaweed farm ......... 17
1.3.3 Seeding procedure ...................................................................... 18
1.4 Transfer at sea .......................................................................................... 20
1.4.1 Deployment of the offshore farm ............................................. 20
1.4.1.1 Deployment of the farm .............................................. 21
1.4.2 Operation, maintenance, and harvest...................................... 24
1.4.2.1 Operation and maintenance at sea ............................ 24
1.4.2.2 Harvest .......................................................................... 25
1.4.3 Problems and failures ................................................................ 26
1.4.3.1 Prevention of mistakes ................................................ 27
1.5 Multi-use of offshore installations ....................................................... 29
References.......................................................................................................... 32

3
4 Protocols for Macroalgae Research

1.1 Introduction to offshore aquaculture

In recent years, the development of offshore aquaculture to increase global
aquaculture production has become a new challenging frontier of the Blue
Revolution. Driven by the stagnating or in parts even decreasing capture
fisheries, a strong shift towards the growth in aquaculture production
to fulfill the increasing global food demand could be observed in recent
years (FAO 2016). As a significant expansion of coastal aquaculture is
constrained in most areas by the fact that suitable areas are already used
for aquaculture and competition for space between different stakeholders
thus limits the aquaculture expansion, substantial research and develop-
ment to explore the possibilities of aquaculture in the open sea is in prog-
ress. Offshore aquaculture refers to the cultivation of marine organisms not
only far from coastal areas but also mainly at the sites exposed to the high-
energy environment of the open ocean (Ryan 2005). However, somewhat in
contrast to aquaculture development in coastal areas, offshore aquaculture
faces numerous additional technological, operational, economic, and polit-
ical challenges (Langan 2009). In most cases, offshore operations are set in
the exclusive economic zone (EEZ), which is defined by the United Nations
Convention on the Law of the Sea (UNCLOS) as a 200-nautical mile zone
beyond the 12 nautical mile coastal sea of a state. The EEZ is a special zone,
either controlled or allocated in a number of different ways under various
legal systems, such as national and international law, depending on the
respective country. Besides the heavy institutional setup for marine spatial
planning, offshore operations also face challenges pertaining to the tech-
nology of aquaculture structures, operation, and maintenance. All these
need to be able to withstand the harsh environment under high-energy
conditions. Over the past decade, considerable international research
efforts have fostered major technological advances, and new offshore use
concepts and several have been successfully tested at small scale. However,
currently only a few offshore aquaculture businesses are in service, and
the implementation of the research results is hence limited.
In addition, the installation of offshore aquaculture systems needs
to be accompanied by the development of sustainable solutions for
commercial aquaculture to minimize adverse effects on the ecosystem
(Buck and Langan 2017a). To achieve this goal, the waste management of
most aquaculture operations can be improved by using extractive species
to take up access nutrients, and therefore mitigate environmental impacts
(Neori et al. 2004, Corey et al. 2012). Thus, seaweed is an ideal extractive
component for eco-intensification of aquaculture operations, leading to an
integrated multitrophic aquaculture (IMTA). However, for offshore culti-
vation, candidate species must tolerate the harsh and exposed conditions
and concurrently provide enough economic potential to counterbalance
the high costs involved in offshore cultivation.
Chapter one: Seaweed in high-energy environments 5

1.2 State of the art of offshore seaweed cultivation

In 2012, 95.6% of seaweed production was derived from mariculture (FAO
2014, Chopin 2014, Clements and Chopin 2016). The Asian countries, such
as China, Indonesia, the Philippines, the Republic of Korea, Japan, and
Malaysia host the highest seaweed production of about 96.3% of the total
yield (Clements and Chopin 2016). The central focus of the production is
hereby placed on the cultivation of the brown seaweed Saccharina japon-
ica and Undaria pinnatifida as well as on the red seaweed Porphyra tenera
and Eucheumatoids (species of Kappaphycus and Eucheuma) (McHugh
2003). In many Asian countries, people are growing, harvesting, and
cooking temperate seaweed species in large quantities, whereas cultiva-
tion in the western countries reached only 54,000 tons with an annual
value of U.S.$51  million in 2013 (FAO 2016). Interestingly, despite that
seaweed cultivation can be viewed as an emerging new industry in
western countries, the western market request is increasing due to a
rising demand for the pharmaceutical and cosmetics production, the
health food industry, for animal feed, or newly as a substrate for biofuel
production (Edwards and Dring 2011).
Moving the cultivation of seaweed from coastal areas into the
offshore realm could solve currently existing spatial and environmental
constraints. New technological approaches to move aquaculture offshore
were investigated in the Americas and Europe in the course of the past
15 years. However, depending on species, technology, and selected sites,
there are still problems to be solved before upscaling to a commercial
level can take place. In the early 1990s, predominantly Laminarian
seaweed was used for first offshore cultivation trials in Europe (Lüning
and Buchholz 1996). Subsequently, the first trials of offshore seaweed
cultivation in France and Germany were followed about 10  years later
by UK and Ireland. Nowadays, countries such as Germany, Belgium,
Norway, the Netherlands, France, the United Kingdom, Denmark, Spain,
Portugal, the United States, the Republic of Korea, and China, are all car-
rying out research and/or seaweed farming trials further off the coast,
most of which are still in pilot scale. Only a few offshore operations for
seaweed cultivation are commercial-scale businesses, such as enterprises
in Germany (CRM 2001), Norway (SES 2015a, b), and the Netherlands
(Hortimare 2016).
One of the leading institutes in offshore seaweed research is the Alfred
Wegener Institute (AWI) Helmholtz Centre for Polar and Marine Research
in Bremerhaven (Germany) (Figure 1.1), where trials of offshore seaweed
cultivation started already in the early 1990s with focus on the system
design that investigates the suitability of longline, ladder, grid, and ring con-
structions (Lüning and Buchholz 1996). Subsequent studies concentrated
on reproduction, seeding strategies, growth, and site selection (Lüning
6 Protocols for Macroalgae Research

(a) (b)

Figure 1.1   Alfred Wegener Institute Helmholtz Centre for Polar and Marine
Research (AWI) in Bremerhaven (Germany). The image shows the main build-
ing with two research vessels in front. (a) RV Heincke vessel was used to carry
the equipment for the offshore farm and for deploying the moorings, and
(b) RV Uthörn vessel was used to install the complete harness, including system
design, buoyancy, seeded Laminarian ropes, and for O&M and harvest. (Courtesy
of Müller-Elsner and AWI.)

and Buchholz 1996; Buck and Buchholz 2004a, 2005). The technology used
in earlier studies was then revised with a focus on the easy deployment,
maintenance, harvesting, strength and connectedness to the foundations of
offshore wind turbines (Lüning and Buchholz 1996, Buck 2001; Buck 2004;
Buck and Buchholz 2004a, b). For this purpose, the first co-use studies for
the combination of aquaculture and offshore wind farms emerged (Buck
2004). One result of these studies was the patented ring construction for the
offshore cultivation of seaweed on an industrial scale (Buck and Buchholz
2004a, b).
Similar to the research in Germany, the offshore seaweed cultiva-
tion is discussed in co-use with existing offshore structures in Norway
(Skjermo et  al. 2014). The main reason to relocate aquaculture offshore
is the negative impact of nutrient-rich effluents from the Norwegian
salmon farms on marine ecosystems in coastal areas. In 2011, the project
SWEEDTECH investigated the development of an economic system for
commercial-scale offshore seaweed cultivation, including the develop-
ment of seeding strategies of carrier material, design, and improvement
for a structural rig, and of innovative deployment and harvesting methods
(SES 2015a, b). As a result of this project, a new seaweed cultivation
Chapter one: Seaweed in high-energy environments 7

development in Norway, AquaCulture Engineering (ACE) AS and SINTEF

Fisheries and Aquaculture will start Laminarian seaweed cultivation in a
3 ha site with an anticipated production of 1500 tons per year (ACE 2015).
Furthermore, the enterprise Seaweed Energy Solutions (SES) AS pat-
ented (SES 2015a) the first modern structure for industrial-scale seaweed
cultivation in Norway. This sheet-like structure, named Seaweed Carrier,
copies a huge seaweed thallus, moving freely in the sea connected to a
single mooring on the seabed. So far, two major tangible prototypes of the
carrier (SES 2015b) were tested with promising results. In the long run,
this structure should be deployed in deeper and more exposed waters for
offshore seaweed cultivation.
In the Netherlands, Ecofys and Hortimare undertook one of the first
co-use trials of the seaweed cultivation in an offshore wind farm in 2012 to
test whether cultivation at this site is feasible. The 400 m2 large cultivation
site comprises a set of steel cables, set up at 2  m below the sea surface
attached to anchors and floating buoys. Connected to these cables are hor-
izontal nets of 100 m2 seeded with Laminarian sporophytes. In June 2015,
Hortimare successfully cultivated brown seaweed at a small scale 10 km
north–east from the Island of Texel in the Dutch North Sea. More sea-
weed cultivation trials are planned in an offshore area off the coast of
Scheveningen (The Hague).
In some offshore areas, where nutrients are limiting factor for opti-
mal seaweed growth, an offshore IMTA is recommendable (Troell et al.
2009; Buchholz et al. 2012). The current technological possibilities make
kelp species ideal candidates for such type of cultivation as they have low
maintenance requirements and are relatively easy to harvest. However,
recent research with a focus on the strain development could lead to
seaweed cultures with desired morphological and physiological traits
accommodating site-specific aquaculture demands while providing high-
production output. This would also ease the pressure on wild stocks used
for seed collection.
In the Americas and Europe, mainly kelp species (primarily the sugar
kelp, Saccharina latissima) have been cultivated during the past two decades
(Buck and Buchholz 2004a, 2005; Barrington et al. 2009; Broch et al. 2013;
Kraemer et al. 2014; Kim et al. 2015; Marinho et al. 2015). Laminarian spe-
cies are some of the most robust seaweed with high potential for offshore
aquaculture because of their morphology, followed by the red seaweed
Palmaria sp. and the green seaweed Ulva sp. Laminarian species can adapt
to high currents and reach high growth rates if deployed offshore as
young individuals (Buck and Buchholz 2004a, 2005).
In the following chapter, we present a protocol for offshore seaweed
aquaculture with a focus on the sugar kelp S. latissima, including different
aspects and challenges of offshore cultivation, also in multi-use settings.
The described protocol is based on research efforts and experience since
8 Protocols for Macroalgae Research

2000 until today (Buck et  al. 2008; Buck et  al. 2017a, b). Several types of
seaweed cultivation in the offshore realm were tested, such as longline
or ring constructions (Buck and Buchholz 2004a). The protocol briefly
describes the land-based preparation, including a list of equipment
needed, the seeding procedure, and the preparations to move offshore.
However, as this chapter is focusing on the offshore cultivation of seaweed,
for example, S. latissima, we do not go into detail regarding the complete
life cycle and reproduction of this species and will describe the cultiva-
tion mainly about the offshore aspect, including the technical design. For
detailed descriptions of the life cycle of S. latissima, the seedling protocol
and hybridization of kelp also refer Chapter 2 by Forbord et al. (2017) and
Chapter 3 by Bartsch within this compilation.

1.3 Land-based preparation and site selection

In the following, the different offshore seaweed technologies and system
design will be described. Procedures before the transfer at sea are in most
parts similar to the process described by Bartsch (Chapter 3) and Forbord
et al. (Chapter 2). Only the seeding procedure at a certain stage slightly dif-
fers from common technologies and will be presented as follows.
In the late 1980s and early 1990s, macroalgal farming of Laminarian
species was tried out at some places further off the coast. For instance,
Neushul and coworkers installed a pilot farm in a hostile environment off
the Californian coast (Neushul and Harger 1985). Here, longline technolo-
gies were deployed to test the biomass yield from a nearshore test farm
of approximately 0.5 ha in size. Further, Neushul et al. (1992) measured
water flow and nitrate uptake to show that flow rates over a crop in the
sea can be controlled. Similar studies were done in Europe: at the Isle
of Man (Kain 1991) and the Ile d’Ouessant (Perez et  al. 1992). However,
all these studies used equipment adapted to nearshore, mainly sheltered
conditions. The move into a high-energy environment, however, needs
equipment that withstands the forces induced by strong current velocities
and high waves (Buck et al. 2017b).
In 1993, another feasibility study on the offshore algal culture in the
North Sea was launched. One major component of this research was to
develop an appropriate technical device to grow macroalgae, which with-
stands the harsh environmental conditions of the German North Sea shelf
with maximum wind speeds of 150–180  km/h, a wave height of up to
5–8  m during storms. This was the first study to move seaweed farm-
ing into severe sea states and was funded by the German government
and conducted at the marine station of the Biologische Anstalt Helgoland
(BAH) off the island of Helgoland (North Sea). Because of the extreme
drawbacks caused by too strong wave climate conditions and resulting
loss and damage of material, the research was conducted again starting in
Chapter one: Seaweed in high-energy environments 9

the early 2000 (Buck 2004). As a result, a ring design was developed that
resisted all sea conditions, whereas at the same time producing approxi-
mately one ton of seaweed biomass (wet weight) on roughly 20 m2 (Buck
and Buchholz 2004a,b). Since then, several system designs were developed
offshore from different institutions and withstood storm conditions.
In the following section, we summarize the major design criteria when
moving from nearshore sheltered conditions in offshore environments:

1.3.1 Site selection

Locating an offshore site involves much prior research, integrating sci-
entific, technological, biological, socioeconomic, and legislative issues.
The decision to build an offshore installation, therefore, requires not only
finance but also a dedicated interdisciplinary team, the right equipment,
and the correct biological parameters that endorse all profits and growth
performance of the crop (McElwee 1997).
Before a seaweed farm is deployed at a respective area, a meticulous
site assessment must be conducted to gather a variety of parameters. These
parameters can be subdivided into three parameter categories, which will
be carefully evaluated: (1) advance information of the local area ashore
and at sea; (2) site-specific, oceanographic, and water quality parameter;
and (3) information on the economic/technical/expansion feasibility.
A complete list of parameters and a progression of site visits and investi-
gation is shown in Figure 1.2. The actual values from the selected site and
the target value for the seaweed enterprise depends on the species, the
size of the farm, economic potential, etc.; a generalization of parameters
for all seaweed species does not exist and is not feasible, because every
species has certain requirements, which are reflected in different max and
min values compared to other selected species, and every site is different.
However, important is the fact that some parameters need special atten-
tion when moving into the open ocean. These parameters are designated
with an exclamation mark (!) in Figure 1.2.
To find the perfect site is not easy and requires time, patience, and
staying power. It is important to take this into account as some potential
young seaweed growers would like to start soon and may ignore that the
processes of finding the farm site, selecting the appropriate design of the
farm that is tailored to the respective site, and the permitting procedures
at the authorities and finances tend to last long and must be viewed very
strategically (because of local regulations/stakeholders/permits/banks,
etc.). Following Benetti et al. (2010), there are two primary issues during
site selection: (1) it is essential to understand that site selection finally is a
compromise and a process of elimination in which the majority of areas
initially identified as suitable are eliminated because of user conflicts
and (2) depending on the project size, the level of investment, and the
10 Protocols for Macroalgae Research

Third stage:

Second stage: Other emerging

issues
Environmental
baseline,
First stage: assessment and
Gather advance monitoring
information
Information of the potential sites: Site-specific and Other important requirements:
- Data availability (GIS, satellite) oceanographic parameter: - Potential of expansion
- Maps with geologic/geographic/bathymetric/topo- - Current velocity, wave height, and - Technical feasibility (!)
graphic/navigational and hydrographic data (!) direction (!) - Economic feasibility (!)
- Previous usages, future plans by the local community - Year-round climate conditions
- Other stakeholders (wind exposure, fetch, storm
- Jurisdiction and regulations (current/future use) (!) conditions, ice drift, etc.) (!)
Information of the local area (land-based): - Depth and seafloor conditions (!)
- Accessibility from land (roads, harbour, electricity, - Distance from shore and tides (!)
phone cables, land-based facilities, etc.) (!) Water quality parameter:
- Experiences/educated workers available (!) - Temperature, pH and salinity regime
- Equipment available (spare parts, farm harness) (!)
- Oxygen/nutrient concentrations (!)
- Subcontractors available (deployment at sea,
- Turbidity and attenuation
security, harvest vessels, further processing,
- Effects of river run-offs
transport, etc.)
- Red tides and plankton blooms
- Proximity to processing plants, airport, other
ports, markets - Predators
- Community related support: Permit, taxation and
cofinance. (!) First sites selected Selected sites reduced Final site selected

Figure 1.2 Site-selection process for a seaweed farm, including typical seaweed
site-selection criteria. First stage is the start of the selection process and will end
through the second stage at the end of the third stage. At the end of each stage, several
sites are identified but will be reduced to the specification process (grey arrows).
Parameters with an exclamation mark need special attention when moving off the
coast into a hostile environment.

timeframe for development, it may be necessary to create infrastructure.

However, the list of issues is long and at various planning levels to be con-
ducted in the planning process (see list in Section 1.3.1.1).

1.3.1.1 Site selection: Advance information of the local

area ashore and at sea
What is the coastal population/community size and setup next to your site?

• This will influence the acceptance of the local community, which, in

turn, could provoke stakeholder conflicts.
• This issue is also relevant to have access to skilled workers, subcon-
tractors, and equipment.
• Size/organizational level of the local community could influence
the developmental stage of roads, harbors, and electricity, and
the proximity to other important infrastructure facilities (airport,
highways, etc.)
Chapter one: Seaweed in high-energy environments 11

Is there an aquaculture act, any legal framework, an experienced person

(authority delegate) in charge, and information on taxation and finance for
that respective site?

• It could be relevant for the permit, and any other emerging issues
related to regulations and jurisdictions. It could support or hin-
der the issue of a lease and can be influenced if there are already
reserved areas, which, in turn, would have the marginal potential for
stakeholder conflicts.
• It could also be important for potential cofinance, any other finan-
cial support, and taxation.

Is information on the selected site (geology, sediment, topography, and

depth) available?

• The condition of the seafloor (soft bottom, hard substrate, and depth)
will reduce the number of selected sites, and therefore ease the site
selection process.
• Preapproved areas for aquaculture would support the selection of
good sites.

1.3.1.2 Site selection: Site-specific, oceanographic, and water

quality parameter
Is reliable information available on physical, biological, geographical, and
other local parameters of the selected site?

• This could influence the growth, morphology, and health, and the
biofouling on the seaweed (nutrient concentration, light, water qual-
ity, etc., on short-term and an annual level). Most of the conditions
should be stable year round.
• The offshore conditions (wave/swell, current velocity, wind/fetch,
etc.), and the depth/topography, will affect the technology needed,
as the construction should, of course, withstand all potential
worst-case conditions while also having a long, expected lifetime.
• It is urgent to have a land-based facility close to the shore/harbor/
pier to allow quick and logistically easy handling.

Is there any information on potential local users or other factors, which

could influence the water quality?

• This information is needed to avoid areas with harmful river

run-offs or other issues influencing the seaweed production
(predator, sediment loads/suspended matter/turbidity/light
attenuation).
12 Protocols for Macroalgae Research

• Further, freshwater or brackish water from rivers/creeks/estuarine

areas cannot be tolerated as these conditions would also harm the
plant and the production results.

1.3.1.3 Site selection: Economic/technical/expansion feasibility

Is the selected site feasible taking the current technology development
and system design into account?
• There is plenty of information that is available to design a seaweed
farm from a technological and O&M perspective. However,
depending on the local parameters, the site may be unfeasible
because of the prevailing wave climate, current conditions, and
etc., as this could lead to the loss of biomass/parts of the con-
struction, permanently harm or destroy the construction, and
increase the level of blade tip loss.
• The technology can be floating, semi-submerged, or fully
submerged. This could affect the growth of the seaweed as some
species would extremely reduce their growth rate in submerged
conditions/deeper environments.
Is the selected site perfect regarding economic feasibility?
• With regard to the selected site, it is also important to calcu-
late the distance to shore, the access to the farm depending on
weather conditions (how many days at sea per month/year?),
and the equipment needed to run an offshore business (adapted
system design, vessels adapted to severe weather conditions, etc.)
as these parts are different as compared to inshore or sheltered
farms and farm equipment.
• The production costs per ton of biomass could be more expensive
for offshore cultivated seaweed. This could be slightly reduced
depending on the complete production volume of the entire
farm. Even then, does the local market balance these higher pro-
duction costs? Is the selected site too small, and therefore the
produced biomass too low for a break even?
Is the selected site restricted to a certain production amount?
• In the case of a perfect site for seaweed cultivation, this would
reduce the potential to expand the business in the future.
• The selected site could be too small to run it economically feasible.

The success of the planning procedure of the enterprise and the site selec-
tion will depend to a large extent on a thorough site survey and proper
assessment about the project development.
Chapter one: Seaweed in high-energy environments 13

1.3.2 Equipment and system design

For the farming of Laminarian species there are plenty of systems used,
either in sheltered or in hostile conditions: (1) longlines, (2) ladder, and
(3) grid systems (Figure 1.3a–g), ring devices (Figure 1.4a–d) and technologies
mounted to the seafloor (e.g., extensive fixed off-bottom longline tech-
nique in the Baltic Sea—Kiel/Germany; CRM 2001). In direct compari-
son, installations in the open ocean need modifications in system design
to cope with the hostile conditions offshore. Therefore, to establish the

(a) Ball-like floats for Marker/corner buoy (b) Torpedo/corner buoy Pencil-like floats
buoyancy (small) (large) (large) for buoyancy
Longline/ (small)
backbone

50−150 m
30 m

(c) Marker/corner 20 m (3x)

(1) buoy (large) Culture units
(d)
60 m
Anchors/
(2)
concrete blocks
10 m
(e)
5m [see C (1)]
(3)
Carrier Multiple Longline/
Anchor rope
ropes backbone backbone
with anchor
Pencil-like floats chain
dddd
[see C (3)] [see C (2)]
Unusable
segment Submerged floats

Anchor Connecting
Ball-like Pencil-like rope rings Subanchor Main anchor
float float
(f ) (g)

Figure 1.3 (a–g): System design and the concept of seaweed cultivation devices.
(a) Longline (backbone) system with floating buoyancy and the seaweed culture
unit hanging perpendicular in the water column; (b) large grid design with float-
ing buoyancy and rectangular culture units; (c) connection devices with (C 1)
rings as coupling center piece, connection of floats to the backbone within the
strands of the rope (C 2), or by using metal tiles (C 3); (d) ladder construction
with culture units attached to the multiple backbone of the system; (e) unit at one
end of a backbone with different anchors, holding devices (chains, ropes), and
flotation; (f) different buoy shapes and dipping depths when riding the swell;
and (g) backbone with floating and submerged flotation and the unusable segment.
(Modified after Buck 2007 and Buck & Buchholz 2004.)
14 Protocols for Macroalgae Research

Central buoy
AWI Central
guide ring Carrier
ropes

Thimble Upper
crow’s
foot
Metal
cuff Culture
(c) line

(b) Steel cable

Lower
crow’s
foot
Warble
Central
(d)
steel
cable

(a)

Figure 1.4 (a–d): Offshore-ring device for the cultivation of seaweed. (a) Ring
construction for the culture of Laminarian species at offshore locations, includ-
ing major elements magnified in; (b) metal cuffs, to which the upper and lower
crow’s feet, the ring tube, and the carrier ropes are attached; (c) the central guide
ring with attached carrier ropes and culture lines; and (d) transition between the
central steel cable of the mooring and that of the lower crow’s foot. (Modified after
Buck and Buchholz 2004a.)

farm in such a hostile environment will cost more in capital equipment

and running costs. Further, no matter what system design one chooses,
it must be durable, flexible, sturdy, noncorroding, hardy, workable, and
accessible to work on (McElwee 1997). All parts of the installation, such
as anchors, concrete blocks, wires, ropes, and chains, all parts for cou-
pling, buoys, and floats and pipes (ring device) and other parts, are impor-
tant; however, special attention should be given to the mooring design
(Figures 1.5 and 1.6).
In the following section, we give some important hints when choos-
ing the equipment and designing the installation.
Chapter one: Seaweed in high-energy environments 15

(a) (b)

(c) (d)

(e) (f )

Figure 1.5 (a–f): Different development steps of the offshore-ring device. (a) Shows
the center piece in the first stage, which was because of the severe conditions in
the open ocean exchanged by the central guide ring; (c) connection of the carrier
ropes to the ring and the modified coupling devices (d); (e) small ring device with
2.5–3.0 m in diameter and the version with 5 m in diameter during the harvest (f).
(Modified after Buck et al. 2017b.)
16 Protocols for Macroalgae Research

(a)

(c) (b)

(d) (e)

Figure 1.6 (a–e): Farm equipment stored on land/board before deployment.

(a)  Wires of different length according to the depth of the mooring site,
(b)  typical corner/marker buoy with radar reflectors for later identification of
the mooring positions, (c) concrete blocks at the peer before transfer on the
deck of the service vessel (during winter time), (d) concrete blocks lashed on
the board of the service vessel RV Heincke, and (e) mooring chains of various
length depending on the depth of the farm to anchor the system to the con-
crete blocks.
Chapter one: Seaweed in high-energy environments 17

1.3.2.1 System design for the offshore seaweed farm

Vessel
• It would be most beneficial to use those vessels that are appro-
priate for offshore aquaculture with a size of approximately
15–25 m in length (minimum) to allow enough space aboard to
prepare the harness, moorings, flotation, etc.
• The vessel should be equipped with a crane having enough
power to easily lift the moorings and all the other equipment.
• In addition, the vessel should have a slip hook at midship and
a large freeboard to assure easy handling of all floating devices
from the entire installation.
• A vessel, which could maneuver accurate to a meter at the spot
of deployment to guarantee the right placement of the anchor
stones/concrete blocks, is necessary.
Ropes and connecting pieces
• Ropes and lines will have different diameters and are made of
different materials as well. For the seeding ropes polypropylene
(PP) lines of 6, 8, and 10  mm proved well (Buck and Buchholz
2004). Ropes used as backbones are mostly made of either PP
or polyethylene (PE) and are usually much thicker from 15 to
32 mm depending on the length and local conditions.
• The backbone holds the seeded line coiled around the backbone
or hanging down from the backbone in single droppers or in
loops. As current velocity and waves are strong and quite fre-
quent, offshore spacing between loops and droppers is important
to avoid the entanglement of the seeded ropes, which would lead
to abrasion and detachment or loss of the plants (see Figures 1.3,
1.4, and 1.6).
• Seeded ropes could either be coiled around the backbone in a
continuous version or lashed to the backbone where the loops
and droppers meet the backbone.
Flotation
• All floats are normally lashed to the backbone or other parts of
the system. If the farm site is extremely hostile, it may be possible
to use shackles.
• Corner/marker buoys are normally at a single chain or mooring
rope/wire and do not have a direct contact to the backbone (see
Figure 1.3).
• The spacing of floats depends on the various parameters and the
size of the floats. Larger floats, of course, increase the buoyancy
per length of rope and decrease the number of floats to be used.
On the other hand, large floats experience stress as due to the
large surface the load forces increase.
18 Protocols for Macroalgae Research

• Further, different types of floats are available: ball-like floats

ride the swell, and therefore directly impact everything hang-
ing below the floats, whereas pencil-like floats partly dip into the
impinging wave, and therefore decrease the stress on the system
(Figure 1.3).
Mooring
• There are different mooring devices available on the market:
concrete blocks, metal, tension, and drill anchors. These various
mooring parts can be used in combinations but mainly depend
on the condition and depth of the seafloor.
• Concrete blocks are usually used if the bottom is hard substrate.
In softer conditions, anchors of all types can be used at the
seafloor.

1.3.3 Seeding procedure

To prevent the loss of seaweed in high-energy environments, the hold-
fasts need to adapt to offshore expected forces. Buck and Buchholz (2005)
investigated the sensibility of macroalgal aquaculture in the offshore
realm of the North Sea. They measured and compared the drag forces
on Laminarian blades originating from sheltered sites (undulated/ruf-
fled margin and wide blade) and offshore adapted species (elongated/
streamlined and flat/narrow blade). As the drag varied according to
(1) frond size, (2) current velocity, and (3) acceleration reaction, dislodge-
ment of Laminarian holdfasts and the forces necessary to break the stipe
depend on the blade length and the surface area. Both measured and
our calculated values of drag did not exceed those forces occurring off-
shore. Even during storm conditions with maximum current velocities of
1.52 m s−1 and wave heights of up to 6.4 m L. saccharina (S. latissima) with-
stood the high-energy environment.
To support the adaptation to offshore stress conditions, indoor
seeding strategies should be conducted by using Automated Laminaria–
Saccharina Seeding Drums (Figure 1.7) coiled with ropes, to be seeded by
the spores (Buck and Buchholz 2004a; Buck et al. 2017a). First, these seed-
ing bodies allow a several 100 m long seeding rope as substrate (instead of
curtain systems) for the sporophytes to grow. Further, the drums rotate
slowly at early stages (up to 20 days) and then exceed their speed. The
advantage is that because of this induced current at the drum/rope to
the water surface, which can be increased by accelerating the rotation
velocity of the drums, that this velocity impinging the plant stipes and
holdfasts stresses the sporophytes leading to an adaptation to more hos-
tile environments (Buck et  al. 2017a, b). When transferring the plants
at sea in high-energy environments, plants will not detach from its
Chapter one: Seaweed in high-energy environments 19

Offshore

Streamlined,
flad and narrow

Undulated,
ruffled and wide
Row of tanks with
automated seeding drums
(a) (b) Sheltered

Shaft

Power
reel
(d)
Seeding drums
with ropes
Motor

(c) (e)

(f ) (g) (h)

Figure 1.7 (a–h): Preparation of seeded ropes for the transfer to the offshore farm.
(a) Seaweed production site with greenhouse and seaweed production tanks at the
AWI in List (Sylt, North-Germany); (b) adaptation of seaweed blades (Saccharina
latissima) originating from offshore and sheltered environments; (c–e) tanks with
seeding drums and its motorization; (f–h) seeding rope preparation from empty
curtain devices to young sporophytes ready for transfer at sea. Red arrows display
the process from prepared empty curtain-like ropes (f) to seeded ropes coiled on
drums (c), through young sporophytes (g)  to storage for the transfer at sea (h).
(Modified after Buck & Buchholz 2005; Buck et al. 2017a.)
20 Protocols for Macroalgae Research

substrate (Buck and Buchholz 2005). Major growth of young sporophytes

first takes place in forming a withstanding holdfast and later followed by
a blade length increase.

1.4 Transfer at sea

1.4.1 Deployment of the offshore farm
As a first step, the installation of aquaculture devices offshore needs a
full suite of complementary oceanographic, environmental, topographic,
and site-specific dataset, a complete understanding of the water motions
on the farm structure, and its associated candidates. Even if most of these
data were already gathered during the site-selection process, it is of prime
importance to get the data updated. Depending on current weather condi-
tions, the identification of the right time slot for the entire installation is
crucial because this step may take several days in a row.
By and large, one of the major features for the seaweed farm should be
the ability to survive the described conditions, where it will be deployed,
while at the same time allow suitable growth performance. To avoid major
stress on the installation induced by prevailing and worst-case condi-
tions, the major part of the farm installations should be submergible. That
means that a significant part of the entire culture unit is located beneath
the surface, whereas the bulk of the structure’s mass is mounted on the
surface to allow buoyancy and stabilization. Further, the entire mooring
devices should be below the zone of turbulence and wave action (Starchild
1980). None of these technologies and system designs are available off the
shelf on the market as every site is different. A One size fits all way to solve
this is not existing and a far cry from being a solution.
One very important lesson is as follows: any preparation, which can
be conducted on land, should be done on land! The farm could be in an
extreme location subject to full rigors of the environment at all times. That
said, everything prepared offshore is not only more expensive about the
vessel time, it is also not convenient because of offshore and weather con-
ditions, which will even complicate the work and endanger the work staff
(e.g., Figure 1.12). Only the installation of the farm should be done offshore.
The farm cannot be deployed without having experts calculating the
various forces using the oceanographic, topographic, and climatic param-
eters to conduct the numerical modeling. Even if these calculations have
been done and a farm design was suggested, the deployment still can only
be done by experienced experts/crews. Therefore, we will not explain in
detail how to maneuver the vessel, how the various pieces of the system
design will be carried with the cranes to be deployed at the site. In the fol-
lowing section, we will provide some considerations for the farm deploy-
ment, which support the planning process.
Chapter one: Seaweed in high-energy environments 21

1.4.1.1 Deployment of the farm

Vessel
• It would be most beneficial to have somebody/a crew member on
the service vessel with mooring experience.
• Check the equipment of the vessel to be appropriate to lift and
lower heavy stones, anchors, chains, etc., with enough service loads
(e.g., cranes, winches, slip hooks, and line hauler). It is also impor-
tant to use vessels that can not only operate in sheltered environ-
ments, but also navigate through narrow passages (e.g., between
other farms) and maneuver on the spot (Figures 1.8 and 1.9).
• The vessel should have enough freight hold to allow the transfer
of the complete farm harness.

(b)

(a)

(c) (d)

Figure 1.8 (a–d): Deployment at sea under harsh conditions. (a) Short time
slots are not rare and should be used if necessary to deploy heavy equipment
(e.g., concrete blocks); (b) the vessel needs to maneuver on the spot; (c) equipment
can be extremely heavy and needs the entire crew to handle, also at night times;
(d)  typical harsh conditions at the seaweed farm site at Roter Sand, 17  nautical
miles off the coast of the city of Bremerhaven (Germany).
22 Protocols for Macroalgae Research

(a) (b)

(c)

(d) (e)

(f)
(g) (h)

(i) (j)

Figure 1.9 (a–j): Deployment of the seaweed farm at the offshore site. (a)–(c)
concrete anchor clocks (2 tons) lashed on board of the service vessel RV Heincke
and deployment of the concrete blocks at the farm site; (d) floating-ring device
(first generation) after deployment; (e) coupling of various ring devices before
towing them to the farm site; (f) mooring line length adjusting and preparation
depending on different depths; (g) torpedo-like sensor for towing tests to examine
force loads resulting from and on farm devices; (h) deployment of farm designs
in a connected mode; (i)  O&M vessel Aade at the farm site; (j) longlines after
deployment. (Modified after Buck et al. 2017a,b.)

Ropes, equipment connections, and buoyancy

• Every possible connection, which does not complicate, block, or
hinder the deployment, should be done land-based (Figure 1.10).
The remaining work will be done onsite.
• It is important that previous to the deployment all calculations
with regard to buoyancy force, flotation, and gravity force on the
various bodies used, load and resistance forces, and rope sizing
(mooring, backbone, connections, buoys, and anchors) had been
done to complete satisfaction.
Chapter one: Seaweed in high-energy environments 23

(a) (b)

(c)

Figure 1.10 (a–c): Land-based work previously conducted before the system will
be transferred at sea. (a) Preparation and arrangement of swivels, thimbles, and
shackles with the Laminarian seeding line; (b) heat preparation of rope ends
by using an electric heat cutter to avoid unraveling and opening of rope ends;
(c) image shows the size of chains, shackles, swivels, and thimbles to connect the
buoyancy to the backbone.

Mooring
• Care and consideration should be taken for the moorings pro-
cedure to deploy the backbone and the entire seaweed harness.
• Topography conditions and sediment type is an important infor-
mation to ease the mooring procedure.
• The mooring device is only effective if it remains in its posi-
tion under the farm load at all times unless the farm should be
retrieved for any reason.
Diving at the farm site
• Diving in the open ocean is another challenge and needs expe-
rienced divers with the right certificate while also following all
potential safety regulations.
• However, diving still needs to be done as the farmer from time
to time needs to know what is happening with the system under
24 Protocols for Macroalgae Research

the surface: Is the mooring still in place, are the ropes, chains
connected, how is the condition of the connecting material (swiv-
els, thimbles, shackles, etc.)?

1.4.2 Operation, maintenance, and harvest

It is well known that blades from, for example, S. latissima and other
Laminarian species behave similar to budging belts of tissue, abrading at
the blade tips while growing at the meristem next to the stipe/blade tran-
sition zone. This leads to the fact that a total year’s growth may amount
to 1–5 times the initial blade length through tip loss (Mann 1972). These
characteristics slightly increase when transferring the plants at an off-
shore farm because of the physical stress resulting from stronger currents
and wave action (Buck and Buchholz 2005). However, when following the
seeding process for offshore cultivated seaweed (see subchapter “Seeding
procedure” and Figure 1.7), the biomass loss will be reduced.
After deployment of the farm and the installation of the seeded ropes,
the work at sea can be divided into two major work areas: (1) operation
and maintenance (O&M) and (2) harvest. O&M mainly focuses on bio-
logical and technical issues, whereas harvesting the biomass depends
on species, distance from shore, skill level of workers, and equipment.
Normally, it is a short procedure when blades reach market size at the
end of the growing season. For the complete work at the farm site next
to the skilled workforce, a suitable sturdy work boat with the equipment
needed to conduct O&M (crane, low deck, etc.) and harvest (strong crane,
storage space, etc.) is required. The O&M vessel does not necessarily have
to be the same vessel as it is used for harvest. Harvest vessels typically
are larger in size as these vehicles need to have large space to store the
harvested biomass.

1.4.2.1 Operation and maintenance at sea

Biological issues
• Observe the length increment of the plant during the grow-out.
At the beginning of the cultivation process, seeding density and
early growth should be determined. In the further grow-out
weekly/two-weekly visits are sufficient during normal weather
conditions.
• In the case of prolonging severe conditions or storm events, a site
visit after that is of prime importance as seaweed detachment or
complete loss could occur.
Technical issues
• The system design and the entire farm equipment also need a
detailed inspection at any time during the visits to prevent fail-
ures or the damage/loss of equipment.
Chapter one: Seaweed in high-energy environments 25

• Moorings (still at the same place?), connecting pieces (shack-

les, thimbles, swivels, rings, etc., are ok and service loads not
exceeded?), backbones or other ropes, and chains of the harness
(no unraveled or entangled parts?), and the complete buoyancy
(too deep, fully submerged, loss?) need to be scrutinized.
• The system has to be controlled for fouling organisms settling
potentially on all hard substrates of the harness. If the fouling
increases a certain biomass, the entire system will experience too
much stress because of the increase in volume and the resulting
surface. Due to the increasing surface the drag coefficient will
change resulting into higher loads.
• As already mentioned earlier, after prolonging severe conditions,
a farm visit is mandatory.

1.4.2.2 Harvest
Identification of market size
• To find the right time of harvest, a certain length of the cultivated
plants should be gained. Market size depends on species, seed-
ing density, time of the year, and site conditions (nutrients, physi-
cal stress, etc.). For example, S. latissima grown in the North Sea
(East Atlantic) normally reach a market size of approximately
200 cm between May–June (Figure 1.11).
• If the harvest will be conducted too early, it is important to plan
the further process. As open ocean locations could be subject to
swift weather condition change, it might be necessary to harvest
the crop, even if the plant lamina did not reach the planned mar-
ket size. Here, it is essential to check the local weather forecast.
• Further, if the harvest will be planned too late, an increased tip
loss could result as fouling organisms settle on the blades and

Between
180–240 cm

Figure 1.11 Single Saccharina latissima plant at the harvest size.

26 Protocols for Macroalgae Research

induce a different less streamlined morphology in the flow fur-

ther resulting into increased load forces and bending.
Harvest procedure
• The service vessel conducting the harvest need to have a certain
time at sea. Therefore, it is of prime importance that the weather
conditions are appropriate to fulfill safety regulations while also
allowing an easy navigation and maneuvering at the farm site.
• The service vessel and its equipment can only be handled by
experienced personnel as offshore conditions can change quickly
and waves, swell, and wind could hamper the operation. If the
wave height exceeds a certain altitude, the harvest cannot be
conducted. Otherwise, next to safety regulations embed for the
crew and the operation procedure, system damage, and loss of
harvested biomass could result.
• If weather conditions are acceptable, each backbone or seeded line
will be detached from the farm harness, transferred to the deck of
the boat, and the seaweed cutoff the lines. After finalizing this pro-
cess, the harvested biomass will be transferred to the land-based
facility for further processing (washing in seawater to eliminate
fouling, transport to the processing company, drying, etc.).
• Once the seaweed is harvested the farming process starts again
from the seeding procedure.

1.4.3 Problems and failures

In general, living, working, and operation conditions offshore, and techni-
cal requirements, are in stark contrast to any other aquaculture environ-
ment (Figure 1.12). Materials have to be stronger in terms of service loads
and expected live time, and technical constructions have to resist extreme
hostile conditions to avoid breaking free traveling their own way through
the offshore realm. Heavy sea states influence the operation at the farm
and increase the risk for workers while also reducing working days per
year. However, the major problem is that some of these hostile conditions
may last for a longer period, with the waves impinging the farm every
5–8  s the whole day year round. In the case of severe problems at the
farm, it might be possible that a service vessel cannot sail out because of
the prevailing weather conditions, which in turn could even worsen the
problem at the farm site. Therefore, all potential worst-case scenarios have
to be considered thoroughly in the first place, calculations have to be done
with enough room concerning safety, robustness, and life expectancy, and
the entire farm and operation need to have worst-case contingency plans
in place. To the contrary, the suggested culture candidates can quickly
adapt to these offshore conditions and would therefore not pose a prob-
lem (Buck & Buchholz 2005).
Chapter one: Seaweed in high-energy environments 27

(a) (b)

Figure 1.12 (a–b): Conditions in a high-energy environment. (a) Shows a slightly

stronger but typical wave climate at the offshore farm in the German Bight during
winds. The device with the white table top is normally used to prepare the sen-
sor equipment for the seaweed farm; and (b) shows the same table during hostile
environments.

In the following section, some of the problems and failures are listed,
which should be taken into account before a seaweed enterprise would
be installed in the open ocean. Offshore aquaculture constructions were
engineered to withstand tremendous forces for many years, but can be
damaged or destroyed during heavy storms. Staying ahead of the O&M
required on the ring device proved problematic during the project, and
it was a constant challenge for personnel to maintain the integrity of the
installation and mooring. Entanglement, damage, and loss occurred dur-
ing continuing storm and heavy seas conditions and even exacerbated in
the next round of damage if repairs could not be organized quickly between
weather events (Figure 1.13). Other problems accumulated in designing
incorrect dimensions in size, connectedness, attachment, coupling, and
space (Figure 1.13), and resulted in further entanglement, increased loads,
and, corresponding to the service load, in too much biomass per size of
construction. Escaping the wave and current energy at the water surface
into a submerged mode is critical, as the seaweed need a certain amount of
irradiance to allow photosynthesis. Learning from these miscalculations
and setbacks, the following issues have to be taken into account.

1.4.3.1 Prevention of mistakes

Operation
• Eliminate modes of failure in all parts of the production system,
starting from land-based precultivation to transfer at sea and
deployment. Keeping the complete operation and the entire farm
design, including the harness, the buoyancy, and the mooring,
strong, but as simple as possible to prevent the reveal of compo-
nent weaknesses by the waves and currents, which could often
result in a catastrophe.
28 Protocols for Macroalgae Research

(a) (b) (c)

(d) (e) (f )

Figure 1.13 (a–f): Failures and miscalculations from first offshore seaweed farms
at Helgoland and at the offshore light house Roter Sand (a,b) Moreover, displays
submerged buoys in full and collapsed shape; (c) shows a ravel of buoys, ropes,
seeding lines, and connecting pieces after a heavy storm event; (d) shows a bro-
ken buoy rope leading to the loss of equipment; (e) is an image of an unstable
ring device (First generation in 1994) with a too large biomass for harvest; and
(f) shows the entanglement of little ring devices resulting from a wrong mooring
and harness calculation. (Modified after Kaiser and Chambers 2017; Buck and
Langan 2017b.)

Planning
• Ocean conditions and weather determine everything offshore,
so plans must be made and adjusted accordingly. Nothing can be
forced if conditions do not allow it as the ocean will always win
in that situation.
• Redundancy and backup systems where applicable, especially
with regards to moorings, which are arguably the most critical
components of the farm system.
• Prepare as much equipment as possible while the system is
onshore. It becomes exponentially harder to work on ropes,
chains, anchors, backbones, shackles, etc., the moment it enters
the water.
Chapter one: Seaweed in high-energy environments 29

1.5 Multi-use of offshore installations

As the marine aquaculture sector is proliferating, competition for space
by different coastal stakeholders and emerging environmental prob-
lems in coastal ecosystems caused by intensification of aquaculture
operations, drive the development of offshore cultivation as a solution.
Nevertheless, moving the aquaculture offshore is related to economic
drawbacks because of higher costs for operation and maintenance and
an increased risk of loss of cultures because of a high-energy environ-
ment. As a result, the idea of a co-use of offshore structures by differ-
ent marine sectors emerged (Figure 1.14a–d). However, also further
development of offshore aquaculture activities often overlaps with
other marine interests, leading to competing claims for the ocean space

Offshore ring

Pylon
Mooring
1, 5–5 m
1, 5–5 m

Buoyancy
Offshore ring
Longline

Macroalgae
Blue mussels Concrete
Mooring block

(a) (b)

Figure 1.14 (a–b): First drawings to show the Multi-use concept combining aqua-
culture with wind farms. (a) Top a birds-eye view of longline constructions. Special
pylon anchorages ensure access and maintenance of the wind energy plants by ship;
down side view of a submerged mussel and seaweed longline culture. The wind
energy plant pylon is used as the anchorage for one end of the long line. The line
can reach a length of 100–300 m. Longer lines may be mounted to the next pylon;
(b) top A bird’s-eye view of the described ring construction. The combined rings are
fixed around the pylon and a pylon with a single offshore ring construction using
two anchorages; down side view of a pylon with offshore ring construction used for
cultivation of algae and mussels. An anchor stone is placed at the outermost point
of the ring construction; (Continued)
30 Protocols for Macroalgae Research

Rotating drum

Buoyancy SOSSEC
Longline
Macroalgae
Oyster
trays
Oyster cage Concrete
block
Blue mussels

(c) (d)

Figure 1.14 (Continued) (c–d): First drawings to show the Multi-use concept com-
bining aquaculture with wind farms. (c) side view of a turbine–oyster culture
combination (oyster trays fixed to a longline and a rotating oyster cage/drum);
and (d) SOSSEC design (Submersible Offshore Shellfish and Seaweed Cage),
which is in a submerged mode and can be lifted to the surface for harvest during
culture. (Buck 2000, 2004; Buck and Langan 2017.)

(Holm et al. 2017). These claims can not only lead to user conflicts but
also to smart combinations of multiple uses of marine space with eco-
nomic and ecological benefits (Michler-Cieluch et al. 2009; Krause et al.
2011; Van Hoof et al. 2014). Such multi-use concepts are not new ideas as
diverse marine activities already coexisted for decades, such as fishing
and shipping, nature conservation, and a mussel fishery, and artificial
reefs and angling.
Resulting from the Blue Growth strategy of the European
Commission, the importance of the perspective of offshore aquaculture
is increasing. Moving aquaculture offshore has the potential for further
growth of the industry in many European offshore areas (Troell et  al.
2009; Rosenthal et al. 2012a, b). In recent years, many studies investigat-
ing the co-use of offshore structures and areas have been conducted or
are still ongoing (i.e., MERMAID, COEXIST, TROPOS, ICES WGAQUA,
and MUSES).
The North Sea is, for example, a highly used marine space with
fisheries, tourism, shipping, oil and gas extraction, cables and
Chapter one: Seaweed in high-energy environments 31

pipelines, gravel extraction and wind farms, and marine protected

areas (MPAs) such as Natura 2000 areas (Jongbloed et al. 2014). Some
of these activities and MPAs may limit the development of aquacul-
ture, some combinations of marine activities with offshore aquaculture
were identified as beneficial, and others are economical or for safety
reasons not feasible (COEXIST project: Poelman and Bolman 2010;
Stelzenmüller et al. 2013). Most promising in this regard is the co-use
of offshore wind farms, certain types of fishery and nature conserva-
tion in combination with aquaculture (Buck et al. 2004; Benassai et al.
2014; Lagerveld et  al. 2014; Gimpel et  al. 2015). However, the multi-
use concepts can be highly site-specific dependent on environmental
requirements, and address legal and logistic issues (Naylor et al. 2000;
Stickney and McVey 2002; Stuiver et  al. 2012). Overall, the feasibility
of a combined seaweed aquaculture enterprise with offshore wind
farming depends on the biological feasibility, the technological imple-
mentation, the environmental sustainability of farming aquatic organ-
isms, and the economic revenue of this commercial operation (Buck
and Krause 2012).
There are quite a few studies available on the feasibility of offshore
seaweed culture in combination with offshore structures such as wind
farms. For instance, German scientists are involved in the cooperation
for a project planning to integrate seaweed cultivation within a projected
wind farm in Nantucket Sound (Massachusetts, USA) (Buck et  al. 2011).
However, progress on how to appropriately connect the seaweed culture
devices to offshore foundations of wind turbines is still limited (Buck and
Krause 2012).
Results from stakeholder analyses point out that economic and tech-
nical feasibility are prerequirements to convince wind farm operators and
mariculturists to support the multi-use concept (Michler-Cieluch et  al.
2009; Krause et al. 2011; Buck and Krause 2012). Stakeholders need to be
engaged at an early stage, and site-specific data on risk assessment, pro-
duction rate, and product quality should be available to convince stake-
holders to participate.
More often than not, the economic revenues are only based on the
market value of the aquaculture production, whereas the value of eco-
system services is neglected (Costanza and Folke 1997, Chopin 2014).
Seaweeds provide ecosystem services as they can be used for biore-
mediation of the fed aquaculture in IMTAs or of nutrients from other
sources (Chopin 2014, Grote 2016). They can form new habitats for fish
or even whole communities and can be used for habitat restoration.
Furthermore, as photosynthetic organisms, they produce oxygen and
take up carbon dioxide, thereby locally increasing oxygen and pH of
the seawater and similarly acting locally against oxygen depletion and
ocean acidification (Clements and Chopin 2016).
32 Protocols for Macroalgae Research

References
ACE 2015. ACE expands with seaweed site. Accessed February 20, 2017, at http://
aceaqua.no/en/2015/09/ace-expands-with-seaweed-site
Barrington, K., Chopin, T., and Robinson, S. 2009. Integrated multi-trophic aqua-
culture (IMTA) in marine temperate waters. In: D. Soto (Ed.), Integrated
Mariculture: A  Global Review. FAO Fisheries and Aquaculture Technical Paper
No. 529, Rome, Italy: FAO, pp. 7–46.
Bartsch, I. 2017. Derivation of clonal stock cultures and hybridisation of kelps: Tool
for strain preservation and breeding programs. In: B. Charrier, T. Wichard,
and C.R.K. Reddy (Eds.), Protocols for Macroalgae Research, Chapter 3. Boca
Raton, FL: CRC Press, Taylor & Francis Group.
Benassai, G., Mariani, P., Stenberg, C., and Christoffersen, M. 2014. A sustainabil-
ity index of potential co-location of offshore wind farms and open water
aquaculture. Ocean Coast. Manag. 95: 213–218.
Benetti, D., Benetti, G.I., Rivera, J.A., and O’Hanlon, B. 2010. Site selection criteria
for open ocean aquaculture. Mar. Tech. Soc. J. 44(3): 22–35.
Broch, O.J., Ellingsen, I.H., Forbord, S., Wang, X., Volent, Z., Alver, M.O., Handå, A.
et  al. 2013. Modelling the cultivation and bioremediation potential of the
kelp Saccharina latissima in close proximity to an exposed salmon farm in
Norway. Aquac. Environ. Interact. 4: 186–206.
Buchholz, C.M., Krause, G., and Buck, B.H. 2012. Seaweed and man. In: C. Wiencke
and C. K. Bischof (Eds.), Seaweed Biology, Ecological Studies. Berlin, Germany:
Springer-Verlag, pp. 471–493.
Buck, B.H. 2000. Open ocean aquaculture und offshore-windparks: Eine mach-
barkeitsstudie über die multifunktionale nutzung von offshore-windparks
und offshore-marikultur im raum nordsee. Reports on Polar and Marine
Research, 412. Alfred Wegener Institute for Polar and Marine Research,
Bremerhaven, Germany.
Buck, B.H. 2001. Combined utilisation of wind farming and mariculture in the
North Sea. Biennial Report of Science Highlights at the Alfred Wegener
Institute Helmholtz Centre for Polar and Marine Research, Bremerhaven,
Germany, pp. 33–39.
Buck, B.H. 2004. Farming in a high energy environment: Potentials and con-
straints of sustainable offshore aquaculture in the German bight (North
Sea), PhD Thesis, Alfred Wegener Institute for Polar and Marine Research
Bremerhaven, 214 p., Bremen, Germany: University of Bremen.
Buck, B.H. 2007. Experimental trials on the feasibility of offshore seed produc-
tion of the mussel Mytilus edulis in the German bight: Installation, tech-
nical requirements and environmental conditions. Helgol. Mar. Res. 61:
87–101.
Buck, B.H. and Buchholz, C.M. 2004a. The offshore-ring: A new system design for
the open ocean aquaculture of macroalgae. J. Appl. Phycol. 16: 355–368.
Buck, B.H. and Buchholz, C.M. 2004b. Support device for the cultivation of macro
organisms in marine waters. Patent: PCT/DE2005/000234.
Buck, B.H. and Buchholz, C.M. 2005. Response of offshore cultivated Laminaria
saccharina to hydrodynamic forcing in the North Sea. Aquaculture 250:
674–691.
Chapter one: Seaweed in high-energy environments 33

Buck, B.H. and Krause, G. 2012. Integration of aquaculture and renewable energy
systems. In: R.A. Meyers (Ed.), Encyclopaedia of Sustainability Science and
Technology Vol. 1. Berlin, Germany: Springer Science+Business Media LLC.
Chapter No. 180, pp. 511–533.
Buck, B.H. and Langan, R. (Eds.) 2017a. Aquaculture Perspective of Multi-use Sites in
the Open Ocean: The Untapped Potential for Marine Resources in the Anthropocene.
Springer, 404 p.
Buck, B.H. and Langan, R. 2017b. Epilogue—Pathways towards sustainable ocean
food production. In: B.H. Buck and R. Langan (Eds.), Aquaculture Perspective
of Multi-Use Sites in the Open Ocean: The Untapped Potential for Marine Resources
in the Anthropocene. Cham, Switzerland: Springer International Publishing
AG, pp. 394–404.
Buck, B.H., Ebeling, M., and Griffin, R. 2011. Seaweed aquaculture as a co-use
in an offshore wind farm—Feasibilities and constraints of economic via-
bility for cape wind (Massachusetts). AWI-Report – Project No. USA 11/
A01—12 p.
Buck, B.H., Krause, G., and Rosenthal, H. 2004. Extensive open ocean aquacul-
ture development within wind farms in Germany: The prospect of off-
shore co-management and legal constraints. Ocean Coast. Manag. 47(3–4):
95–122.
Buck, B.H., Krause, G., Michler-Cieluch, T., Brenner, M., Buchholz, C.M., Busch,
J.A., Fisch, R., Geisen, M., and Zielinski, O. 2008. Meeting the quest for spa-
tial efficiency: Progress and prospects of extensive aquaculture within off-
shore wind farms. Helgol. Mar. Res. 62: 269–281.
Buck, B.H., Krause, G., Pogoda, P., Grote, B., Wever, L., Goseberg, N., Schupp,
M.F., Mochtak, A., and Czybulka, D. 2017b. Case study German bight:
Pioneer projects of aquaculture-wind farm multi-uses. In: B.H. Buck and
R. Langan (Eds.), Aquaculture Perspective of Multi-use Sites in the Open Ocean:
The Untapped Potential for Marine Resources in the Anthropocene. Cham,
Switzerland: Springer International Publishing AG, pp. 253–354.
Buck, B.H., Nevejan, N., Wille, M., Chambers, M., and Chopin, T. 2017a. Offshore
and multi-use aquaculture with extractive species: Seaweeds and bivalves.
In: B.H. Buck and R. Langan (Eds.), Aquaculture Perspective of Multi-Use
Sites in the Open Ocean: The Untapped Potential for Marine Resources in the
Anthropocene. Cham, Switzerland: Springer International Publishing AG,
pp. 23–69.
Chopin, T. 2014. Seaweeds: Top mariculture crop, ecosystem service provider.
GAA 17: 54–56.
Clements, J. and Chopin, T. 2016. Ocean acidification and marine aquaculture in
North America: Potential impacts and mitigation strategies. Rev. Aquacult.
1–16. doi: 10.1111/raq.12140.
Corey, P., Kim, J.K., Garbary, D.J., Prithiviraj, B., and Duston, J. 2012. Bioremediation
potential of Chondrus crispus (Basin Head) and Palmaria palmata: Effect
of temperature and high nitrate on nutrient removal. J. Appl. Phycol. 24:
441–448.
Costanza, R. and Folke, C. 1997. Valuing ecosystem services with efficiency, fair-
ness and sustainability as goals. In: G. Daily (Ed.), Nature’s Services: Societal
Dependence on Natural Ecosystems. Washington, DC: Island Press, pp. 49–70.
34 Protocols for Macroalgae Research

CRM. 2001. Wirtschaftliches und ökologisches Potential einer Laminarien-Farm in

Deutschland (Economic and ecologic potentials of algae farming in Germany).
Kiel, Germany: Coastal Research, Management.
Edwards, M.D. and Dring, M.J. 2011. Open sea cultivation trails of the red alga,
Palmaria palmata from seeded tetraspores in Strangford Laugh, Northern
Ireland. Aquaculture 317: 203–209.
FAO. 2014. The State of World Fisheries and Aquaculture. Rome, Italy: Food and
Agriculture Organization, 223 p.
FAO. 2016. The State of World Fisheries and Aquaculture. Rome, Italy: Food and
Agriculture Organization, 190 p.
Forbord, S., Steinhovden, K.B., Rød, K.K., Handå, A., and Skjermo, J. 2017.
Cultivation protocol for Saccharina latissima. In: B. Charrier, T. Wichard, and
C.R.K. Reddy (Eds.), Protocols for Macroalgae Research, Chapter 2. Boca Raton,
FL: CRC Press, Taylor & Francis Group.
Gimpel, A., Stelzenmüller, V., Grote, B., Buck, B.H., Floeter J., and Núnez-Riboni,
I. 2015. A GIS modelling framework to evaluate marine spatial planning
scenarios: Co-location of offshore wind farms and aquaculture in the
German EEZ. Mar. Policy 55: 102–115.
Grote, B. 2016. Bioremediation of aquaculture wastewater: Evaluating the pros-
pects of the red alga Palmaria palmata (Rhodophyta) for nitrogen uptake.
J. Appl. Phycol. 28: 3075–3082.
Holm, P., Buck, B.H., and Langan, R. 2017. Introduction: New approaches to sustain-
able offshore food production and the development of offshore platforms. In:
B.H. Buck and R. Langan (Eds.), Aquaculture Perspective of Multi-Use Sites in
the Open Ocean: The Untapped Potential for Marine Resources in the Anthropocene.
ISBN(1): 978-3-319-51157-3 – ISBN(2) 978-3-319-51159-7 (eBook), pp. 1–20.
Hortimare. 2016. Propagating Seaweed for a Sustainable Future. Accessed online
October 22, 2016, at http://www.hortimare.com/.
Jongbloed, R.H., van der Wal, J.T., and Lindeboom, H.J. 2014. Identifying space for
offshore wind energy in the North Sea. Consequences of scenario calcula-
tions for interactions with other marine uses. Ener. Policy 68: 320–333.
Kain, (Jones) J.M. 1991. Cultivation of attached seaweeds. In: M.D. Guiry and
G. Blunden (Eds.), Seaweed Resources in Europe: Uses and Potential. Chichester,
UK: Wiley, pp. 309–377.
Kaiser, J.B. and Chambers, M.D. 2017. Offshore platforms and mariculture in the
US. In: B.H. Buck and R. Langan (Eds.), Aquaculture Perspective of Multi-Use
Sites in the Open Ocean: The Untapped Potential for Marine Resources in the
Anthropocene. ISBN(1): 978-3-319-51157-3—ISBN(2) 978-3-319-51159-7 (eBook).
pp. 375–391.
Kim, J.K., Kraemer, G.P., and Yarish, C. 2015. Sugar kelp aquaculture in long Island
sound and the bronx river estuary for nutrient bioextraction associated with
biomass production. Mar. Ecol. Prog. Ser. 531: 155–166.
Kraemer, G.P., Kim, J.K., and Yarish, C. 2014. Seaweed Aquaculture: Bioextraction
of Nutrients to Reduce Eutrophication. Association of Massachusetts Wetland
Scientists Newsletter. April 2014 No. 89, pp. 16–17.
Krause, G., Griffin, R.M., and Buck, B.H. 2011. Perceived concerns and advocated
organisational structures of ownership supporting offshore wind farm—
Mariculture integration. In: G. Krause (Ed.), From Turbine to Wind Farms:
Technical Requirements and Spin Off Products. Rijeka, Croatia: InTech, Open
Access Publisher, pp. 203–218.
Chapter one: Seaweed in high-energy environments 35

Lagerveld, S., Röckmann, C., and Scholl, M. (Eds.) 2014. Combining offshore
wind energy and large-scale mussel farming: Background and technical,
ecological and economic considerations. IMARES report number C056/14
http://www.maritimecampus.nl/sites/default/files/C056%2014%20Report-
Blauwdruk-_SLMS-lcs.pdf
Langan, R. 2009. Opportunities and challenges for offshore farming. Chapter 29
In: G. Burnell and G. Allen (Eds.), New Technologies in Aquaculture: Improving
Production Efficiency, Quality and Environmental Management. Cambridge,
UK: Woodhead Publishing Limited.
Lüning, K. and Buchholz, C. 1996. Massenkultur mariner makroalgen bei helgo-
land zur gewinnung von phycokolloiden und zur verwendung als biosorp-
tionsmittel. Helgoland, Germany: BAH Report, 75 p.
Mann, K.H. 1972. Ecological energetics of the sea-weed zone in a marine bay on
the Atlantic coast of Canada. II. Productivity of the seaweeds. Mar. Biol. 14:
199–209.
Marinho, G.S., Holdt, S.L., Birkeland, M.J., and Angelidaki, I. 2015. Commercial
cultivation and bioremediation potential of sugar kelp, Saccharina latissima,
in Danish waters. J. Appl. Phycol. doi: 10.1007/s10811-014-0519-8.
McHugh, D.J. 2003. A guide to the seaweed industry. FAO Fisheries Technical
Papers T441.
McElwee, J. 1997. Practical experience in off-shore cage rearing, the good, the
bad and the ugly. In: C. Hesley (Ed.), Open Ocean Aquaculture: Chartering the
Future of Ocean Farming. Proceedings of an International Conference, April 23–25,
1997, Maui, Hawaii: UNIHI-Seagrant-CP-98-08, Maui, University of Hawaii
Sea Grant College Program, pp. 89–105.
Michler-Cieluch, T., Krause, G., and Buck, B.H. 2009. Reflections on integrating
operation and maintenance activities of offshore wind farms and maricul-
ture. Ocean Coast. Manag. 52(1): 57–68.
Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky, N., Beveridge, M.C., Clay, J.,
Folke, C., Lubchenco, J., Mooney, H., and Troell, M. 2000. Effect of aquacul-
ture on world fish supplies. Nature 405(6790): 1017–1024.
Neori, A., Chopin, T., Troell, M., Buschmann, A.H., Kraemer, G., Halling, C.,
Shpigel, M., and Yarish, C. 2004. Integrated aquaculture: Rationale, evolu-
tion and state of the art emphasizing seaweed biofiltration in modern aqua-
culture. Aquaculture 231: 361–391.
Neushul, M. and Harger, B.W.W. 1985. Studies of biomass yield from a near-shore
macroalgal test farm. J. Solar Energy Eng. 107: 93–96.
Neushul, M., Benson, J., Harger, B.W.W., and Charters, A.C. 1992. Macroalgal
farming in the sea: Water motion and nitrate uptake. J. Appl. Phycol. 4:
255–265.
Perez, P., Kaas, R., Campello, F., Arbault, S., and Barbaroux, O. 1992. La Culture des
Algues Marines Dans le Monde. Nantes, France: IFREMER.
Poelman, M. and Bolman, B. 2010. Task 1.3 COEXIST: Inventory of possible com-
binations of different forms of aquaculture and/or fisheries and other
activities. Accessed March 24, 2017, at http://www.coexistproject.eu/
images/COEXIST/deliverables/WP1/COEXIST_245178_D1.3_FINAL.pdf
Rosenthal, H., Costa-Pierce, B.A., Krause, G., and Buck, B.H. 2012a. Bremerhaven
Declaration on the Future of Global Open Ocean Aquaculture, Part I: Preamble
and Recommendations. Bremerhaven, Germany: The Bremerhaven Economic
Development Company.
36 Protocols for Macroalgae Research

Rosenthal, H., Costa-Pierce, B.A., Krause, G., and Buck, B.H. 2012b. Bremerhaven
Declaration on the Future of Global Open Ocean Aquaculture—Part II:
Recommendations on Subject Areas and Justifications. Aquaculture Forum on
Open Ocean Aquaculture Development—From Visions to Reality: The Future
of Offshore Farming. Bremerhaven, Germany: The Bremerhaven Economic
Development Company.
Ryan, J. 2005. Offshore aquaculture—Do we need it, and why is it taking so long?
International Salmon Farmers Association (Ireland). Expert workshop on
sustainable aquaculture, DG JRC European Commission, pp. 17–18. January
2005, Seville, Spain: Institute for Prospective Technological Studies.
SES. 2015a. Patented Seaweed Carrier system by SES, Patent No. EP 09 836 439.1.
SES—Seaweed Energy Solutions, Trondheim, Oslo, Norway.
SES. 2015b. Seaweed Carrier system for the cultivation of macroalgae in offshore
environments patented by SES—Seaweed Energy Solutions, Trondheim,
Norway.
Skjermo, J., Aasen, I.M., Arff, J., Broch, O.J., Carvajal, A., Christie, H., Forbord, S.
et  al. 2014. A new Norwegian bioeconomy based on cultivation and pro-
cessing of seaweed: Opportunities and R&D needs. SINTEF Fisheries and
Aquaculture, Norway, March 6, 2014, 46 p.
Starchild, A. 1980. Seaward Ho!—The ocean frontier. In: Office of Technology
Assessment (Ed.), Energy from open ocean kelp farms (pp. 83–98). Honolulu,
Hawaii: University Press of the Pacific.
Stelzenmüller, V., Schulze, T., Gimpel, A., Bartelings, H., Bello, E., Bergh, O.,
Bolman, B. et al. 2013. Guidance on a better integration of aquaculture, fish-
eries, and other activities in the coastal zone: From tools to practical exam-
ples. Coexist project—Interaction in coastal waters.
Stickney, R.R. and McVey, J. 2002. Responsible Aquaculture. Wallingford,
Oxfordshire: CABI Press.
Stuiver, M., Gerritsen, A.L., Fontein, R.J., and Agricola, H.J. 2012. Multifunctionele
platforms: Perspectief voor de toekomst? Aquacultuur 27(5): 6–12
Troell, M., Joyce, A., Chopin, T., Neori, A., Buschmann, A.H., and Fang, J.G. 2009.
Ecological engineering in aquaculture: Potential for integrated multi-trophic
aquaculture (IMTA) in marine offshore systems. Aquaculture 297: 1–9.
Van Hoof, L.J.W., Steenbergen, J., Bolman, B.C., Rockmann, C., Kraan, M.L., Piet,
G.J., Jak, R.G. et  al. 2014. Zee op Zicht: Inzicht; een zoektocht naar een
integraal afwegingskader voor het gebruik van de zee. IMARES Report.
Accessed March 24, 2017, at http://www.wageningenur.nl/nl/Publicatie-
details.htm?publicationId=publication-way-343835313839
chapter two

Cultivation protocol for

Saccharina latissima
Silje Forbord, Kristine Braaten Steinhovden,
Kaia Kjølbo Rød, Aleksander Handå, and Jorunn Skjermo

Contents
2.1 Introduction ............................................................................................. 38
2.1.1 The life cycle of laminariales .................................................... 39
2.2 State of the art .......................................................................................... 41
2.3 Materials................................................................................................... 41
2.3.1 Collection of sporophytes and induction of sori .................... 41
2.3.2 Sori disinfection, dehydration, spore release,
and spore counting ..................................................................... 42
2.3.3 Starting gametophyte cultures ................................................. 42
2.3.4 Maintenance of gametophyte cultures .................................... 42
2.3.5 Fertility test .................................................................................. 43
2.3.6 Seeding ......................................................................................... 43
2.4 Experimental procedures ...................................................................... 43
2.4.1 Seed supply and sporulation..................................................... 43
2.4.1.1 Collection of sporophytes and induction
of sorus.....................................................................43
2.4.1.2 Sorus disinfection ........................................................ 45
2.4.1.3 Dehydration .................................................................. 45
2.4.1.4 Spore release ................................................................. 45
2.4.1.5 Spore density ................................................................ 46
2.4.2 Gametophyte cultivation ........................................................... 46
2.4.2.1 Starting-up gametophyte cultures............................. 46
2.4.2.2 Maintenance of gametophyte cultures ..................... 48
2.4.2.3 Contamination control ................................................ 49
2.4.2.4 Fertility test ................................................................... 49
2.4.3 Seeding ......................................................................................... 49
2.4.3.1 Seeding with spores..................................................... 50
2.4.3.2 Seeding with gametophytes ....................................... 50
2.4.3.3 Hatchery systems ......................................................... 50

37
38 Protocols for Macroalgae Research

2.4.3.4 Cultivation under controlled laboratory

conditions .....................................................................51
2.4.3.5 Development of seedlings under optimal
conditions ...................................................................... 52
2.4.4 Deployment ................................................................................. 53
2.4.4.1 Transport ....................................................................... 53
2.4.4.2 Deployment at sea ........................................................ 53
2.5 Notes ......................................................................................................... 56
References.......................................................................................................... 57

2.1 Introduction
The sugar kelp Saccharina latissima (Linnaeus) as discussed by Lane,
Mayes, Druehl, and Saunders (synonym: Laminaria saccharina [Linnaeus]
Lamouroux) is a cold-water species distributed circumpolar in the north-
ern hemisphere (Bolton et  al. 1983) where it occurs from the intertidal
down to the bottom of the photic zone. It is present on both sides of the
Atlantic from Nova Scotia to Europe and in the Pacific along the North
American coast and some areas outside Japan and in the Arctic Russia
(Wilce 1965; van den Hoek and Donze 1967; Druehl 1970; Druehl and
Kaneko 1973; Sjøtun 1985). Temperature, exposure, and competition are
the limiting factors of the propagation of the species, and the southern limit
is highly determined by temperature (Lüning 1990). Their natural growth
sites are clear and turbid coastal waters (Borum et  al. 2002), and water
temperatures between 10°C and 15°C have been found to give optimum
growth (Fortes and Lüning 1980; Bolton and Lüning 1982). S. latissima is
one of the fastest growing species of kelp in European waters with annual
production capacities estimated at 75–170  tons wet weight per hectare
at sea (Broch et  al. 2013). Cultivation of S. latissima is characterized by
fast growth, but with low predictability of production volumes and bio-
mass quality due to seasonal-, regional-, and site-dependent growth and
composition and different cultivation strategies. In cool-temperate North
Atlantic waters, S. latissima shows a seasonal- and depth-dependent
growth pattern with faster growth close to the surface in autumn and
winter and fast growth also at deeper depths in the photic zone in spring
and early summer. From late spring to late summer, heavy fouling and
necrosis of the distal end of the blade occurs. Harvesting should therefore
take place in early summer to avoid destruction of the crop and loss of
biomass (Handå et al. 2013; Førde et al. 2016). Europe’s contribution to
global macroalgae cultivation is neglectable (FAO 2016). However, new
consumer trends, market demands, and opportunities for multiple use
of macroalgae such as food, bioactive components for functional food
and feed ingredients, fertilizers, and biofuels (Shahidi 2009; Holdt and
Chapter two: Cultivation protocol for Saccharina latissima 39

Kraan 2011; Rajapakse and Kim 2011; Fleurence et al. 2012; Hafting et al.
2012; Tabarsa et al. 2012; Wargacki et al. 2012; Fernand et al. 2016) have
strengthened the motivation for industrial macroalgae cultivation in
Europe. Industrial, cost-effective cultivation requires novel technology of
the whole production line targeting mechanization and automation of the
seedling processes, deployment at sea and the harvesting operation, but
the necessary equipment for industrial-scale production does not exist.
Cultivation equipment must be developed for different environmental
conditions, and logistic challenges during deployment and harvesting
must be solved. An in-depth understanding of the life cycles and the
environmental and biological requirements of macroalgae is a prerequi-
site to establish protocols for all phases of the cultivation. In the current
chapter, we present a protocol for year-round production of S. latissima
seedlings that is applicable for small-scale laboratory studies and that can
be upscaled for mass production.

2.1.1 The life cycle of laminariales

The sporophyte of the S. latissima consists of a lamina (blade), stipes (stem),
and hapter (holdfast). The lamina grows from an intercalary meristem
located between the lamina and the stipes, which is short, round, and
attached to the substrate with a branched hapter. The sporophyte can
reach up to 3 m in length (Hollenberg 1939). S. latissima has a diplohap-
lontic, heteromorphic life cycle, with alternation between a microscopic
haploid (n) gametophyte generation and a macroscopic diploid (2n) spo-
rophyte generation, as shown in Figure 2.1 (Kain 1979). The life cycle is
common for all the different Laminariales with minor differences. S. latis-
sima are fertile during winter (October–January in mid Norway) when the
days are short and temperatures are low. Sorus with sporangia develops
on the lamina and meiosis produces 32 motile meiospores (zoospores) per
sporangium (Schreiber 1930 cited in Kain 1979). When the spores become
mature, they are released into the surrounding water and spread with
water currents until they settle at a suitable substrate. The meiospores are
4–8 µm long and have two flagella. After settlement, the flagella are lost,
and the initial germling growth phase starts with the formation of a germ
tube in the distal end of the spore. The germ tubes are filled with the
cell content of the spore, making a primary cell, which further develops
into male and female gametophytes (Williams 1921 cited in Kain 1979;
Sauvageau 1916 cited in Kain 1979). Gametophytes increase in length
by cell division while progressively developing branches. Male gameto-
phytes are thin and heavily branched, whereas the female have thicker
cells and are less branched (Hollenberg 1939). Gametogenesis in Laminaria
is induced by blue light (400–512 nm), whereas the optimum temperature
varies with geographical distribution (Lüning and Dring 1975; Lüning
40 Protocols for Macroalgae Research

2. Vegetative phase

1. Germination Male gametophyte

3. Reproductive phase
Female gametophyte -induced by optimal
Zoospores
Sori conditions

Sporangia Antheridia
Oogonia

Spermatozoid
Egg
Gametophytic
haploid generation
Sporophytic
diploid generation

Developing sporophyte

Mature sporophyte

Figure 2.1  Schematic presentation of the life cycle of S. latissima. The sporophyte
produces unilocular sporangia with meiospores that are released into surround-
ing waters when mature. These develop into male and female gametophytes.
When exposed to blue light, the male gametophytes produce antheridia with
spermatozoids, and the female gametophytes produce oogonia with one egg.
Fertilization leads to development of small sporophytes that grow into the full-
sized sporophytes. (Courtesy of Sanna Matsson.)

and Neushul 1978; Lüning 1980). Once the light and temperature condi-
tions are suitable, the development of reproductive structures is triggered
(Lüning 1980). Female gametophytes produce an oogonium, which when
fertile produces one nonmotile spherical gamete (oosphere/egg). The
male gametophyte develops spermatocysts that produce spermatozoids
with two flagella. A signal chemical attracts the spermatozoids, which
swim to the oogonium and fertilize the egg (Müller et  al. 1979; Müller
1989). The fertilized gametes develop into a microscopic sporophyte that
grows into the full-sized sporophyte. The haploid gametophyte stage can
be cultivated under controlled environmental conditions in a laboratory.
Gametophytes are dark tolerant and can survive in the darkness for up
Chapter two: Cultivation protocol for Saccharina latissima 41

to 18 months (Druehl and Boal 1981; tom Dieck 1993). In weak red light,
gametophytes have vegetative growth and will increase in size, without
producing gametes or spermatocysts. Fertilization can be induced at any
moment by modifying the light regime and expose the gametophytes to
blue light. Studies have shown that the ability to produce gametes is still
good after 30 years of cultivation under red-light conditions in many kelp
species (Druehl et al. 2005).

2.2 State of the art

To cultivate kelp at sea requires production of seedlings on substrate to
be deployed at sea farms. Cultivation protocols have been established for
the most attractive kelp species, such as S. latissima, Alaria esculenta, and
Laminaria digitata (Arbona and Molla 2006; Edwards and Watson 2011;
Redmond et  al. 2014). There are three main strategies for seedling pro-
duction of kelp, aiming for seeding of the growth substrate with spores,
gametophytes, or small sporophytes, whereof seeding with spores and
gametophytes thus far is the most incorporated technique. Seeding with
spores requires fertile sporophytes and is seasonal dependent if these are
collected in natural habitats, but fertility can also be induced by artificial
day rhythm and thus enable access to spores independent of natural sea-
sons (Pang and Lüning 2004). Gametophytes can be kept in continuous
cultures and can be available for year-through seeding or production of
microscopic sporophytes for direct seeding. This is advantageous as the
use of incubation facilities can be shortened by several weeks or, in the
case of direct seeding, omitted completely.
The presented protocol focus on S. latissima seedlings production
from spores and gametophytes and is adapted to the infrastructure and
equipment that is available at typical aquaculture research laboratories,
although some adjustments may be necessary to meet the needs of the
different life stages of the species.

2.3 Materials
2.3.1 Collection of sporophytes and induction of sori
• Boxes or plastic bags
• Coolers (if outdoor or transport temperature is above 15°C)
• Scissors for trimming the sporophytes
• Temperature-regulated room holding 10°C
• Tanks with nutrient-rich seawater and fluorescents lamps for storage
and conditioning of sporophytes
• Time switch
• Pressurized air or electrical aquarium pump for aeration
42 Protocols for Macroalgae Research

2.3.2 Sori disinfection, dehydration, spore release,

and spore counting
• Refrigerator holding 4°C
• Fume cupboard or workplace outside
• Light microscope
• Containers (three for disinfection and one for spore release)
• Plastic bag or plastic box with lid for storage
• Scissors
• Paper towel
• Autoclaved or sterilized seawater
• Gloves
• Protecting glasses
• Spatula
• Filter cloth (20–40 µm)
• Counting chamber with glass covers
• Pipette
• Sodium hypochlorite (NaOCl; 200 ppm) or other disinfectant

2.3.3 Starting gametophyte cultures

• Climate cabinet or a light-tight climate room holding 10°C
• Pressurized air or electrical aquarium pump for aeration
• Silicon tube for aeration
• Pipette for aeration
• Culture flask
• Rubber top or Parafilm
• Membrane filter (0.2 µm)
• Provasolis-Enriched Seawater (PES) or other culture media
• Germanium dioxide (GeO2)

2.3.4 Maintenance of gametophyte cultures

• Blender
• Blender container
• Culture flask
• Culture flask top or Parafilm
• Pipette for aeration
• Silicon tube for aeration
• Membrane filter (0.2 µm; change if clogged)
• Squeeze bottle
• Funnel
Chapter two: Cultivation protocol for Saccharina latissima 43

• Filter cloth (20–40 µm)

• Autoclaved seawater
• PES or other culture media
• Germanium dioxide (GeO2)

2.3.5 Fertility test

• Cultivation room with white-light holding 10°C
• Light microscope
• Petri dish
• PES or other culture media
• Germanium dioxide (GeO2)

2.3.6 Seeding
• Temperature-regulated room with white-light holding 10°C
• Filtered and UV-treated nutrient-rich seawater
• Seeding substrate (string, rope, and sheet)
• Container
• Spray bottle

2.4 Experimental procedures

2.4.1 Seed supply and sporulation
The spores used in the seedling production can be obtained from sporo-
phytes either by releasing them from mature tissue (sorus) or by inducing
the spores artificially in the laboratory.

2.4.1.1 Collection of sporophytes and induction of sorus

Adult sporophytes are collected from natural stocks or from beach cast.
It  is preferable to get healthy, big sporophytes with low biofouling, and
diving may be necessary to find good specimens. Pack the collected spo-
rophytes in large plastic boxes/bags or in coolers when outdoor tempera-
ture is above 15°C. It is important to keep the sporophytes cooled and
moist during transport. If the sporophytes are collected during a time
of the year when the sporophytes are not fertile, sori can be induced.
Sporophytes are trimmed after arrival at the lab. Distal ends and 5–15 cm
of the meristem are cutoff the lamina to ensure fresh tissue and prevent
putative sporulation inhibitors (Pang and Lüning 2004). After trimming,
the sporophytes are kept in flow-through tanks with short-day condi-
tions until sori appear, as shown in Figure 2.2 (Note 1). Depending on the
44 Protocols for Macroalgae Research

Figure 2.2  The dark area on the thallus of S. latissima is called sorus and contains
millions of zoospores.

Table 2.1 Key parameters for conditioning of sporophytes

Key parameters
Light intensity at water surface 70–100
(µmol m−2 s−1)
Water treatment Sand filter or other coarse filter
Water intake (m depth) >50
Water flow (times exchange per day) 15
Aeration Unfiltered
Water temperature (°C) 10
Light regime (L:D) (h) 8:16
Light source Fluorescent tubes (warm white, cool
white, day light)

season, this can take from 4 to 12 weeks but normally from 6 to 8 weeks
(Forbord et al. 2012; see Table 2.1 for key parameters).
Tanks of 200–300  L are sufficient for 20–30 sporophytes (Note 2).
Tanks are illuminated 8  h per day with fluorescent lamps providing a
light intensity of around 70–100 µmol photons m−2 s−1 at the water surface.
Chapter two: Cultivation protocol for Saccharina latissima 45

The seawater source should ensure water with a high and stable level of
nutrients and temperatures not exceeding 10°C. Water intake below 50 m
depth may be necessary. The seawater is filtered before use. Aeration is
used to keep the sporophytes suspended and circulating in the water
column so that all individuals are equally illuminated.

2.4.1.2 Sorus disinfection

Sori are always disinfected before spores release to mitigate contaminat-
ing organisms in gametophyte cultures and seedling cultivation. NaOCl
is a suitable chemical for disinfection, but there are several other chemi-
cals that can be used as well, for instance iodide-based Betadine or Lugol’s
solution. Optimum concentration, temperature, and reaction time should
be evaluated in the case of changing disinfectant.
The areas of mature sori are cut from the sporophytes, and the pieces
are immersed in a disinfecting NaOCl bath (200 ppm, 10°C) (Note 3). In the
case of fouling or sediments on the lamina, the sporophytes are mechani-
cally cleaned with paper towels before disinfection. The sori are left for
2 min with some gentle stirring with a clean spatula. After disinfection,
the sori are rinsed two times for 30  s in sterile seawater (10°C). Stir the
sporophytes during rinsing so that all parts of the sori are thoroughly
rinsed (Rød 2012).

2.4.1.3 Dehydration
Disinfected sori are dried with paper towel to remove the surface water
without leaving the surface withered. Dried sori are stored in a plastic
bag/box with lid for 18–48 h at 4°C to dehydrate.

2.4.1.4 Spore release

Dehydrated sori are placed in a beaker or another convenient container
filled with sterile seawater holding a temperature of 10°C. Water should
just cover the sori, to obtain a dense spore solution. Spores will be released
as a response to osmotic shock combined with a temperature shock (Kain
1979). As the spores are released, the seawater becomes brown and cloudy,
and the solution can be gently stirred with a clean spatula to enhance the
spore release (Note 4). The spore solution is filtered through a 20–40 µm fil-
ter cloth placed in a funnel to remove bigger plankton and organic debris.
If the spore solution is poor, the rehydrated sori can be reused by repeat-
ing the above-mentioned dehydrating procedures. Sori are discarded
after the spores are released if the color of the sori patches is pale or the
lamina/sori have started to decompose. Healthy lamina with dark-brown
patches of sori can be placed back in the conditioning tank for a second
spore release at a later stage.
46 Protocols for Macroalgae Research

2.4.1.5 Spore density

The amount of spores released (spore density) shows great variation and
is believed to vary between sporophytes (Kain 1975), within the sorus,
with season, and with age of the mature sorus (Joska and Bolton 1987).
Spore density is estimated by the use of a Neubauer improved counting
chamber in a light microscope with at least 10× magnification (Note 5).
Density is estimated from the average of the counted squares in the cham-
ber using Equation 2.1:

Total number of cells × 10,000

Concentration (cell/mL) = (2.1)
Number of squares

Other counting chambers can be used, for example, Sedgewick Rafter and
Burker’s chamber.

2.4.2 Gametophyte cultivation

S. latissima development can be held at the gametophyte life stage by
keeping the gametophyte culture in red light under controlled environ-
mental conditions. Fertilization can be induced by modifying the light.

2.4.2.1 Starting-up gametophyte cultures

Spore release is done using the procedure as described in Section 2.4.1,
followed by inoculation of the spores in a growth medium. Several
growth media can be used in gametophyte cultivation, with the most
common being the PES (see Harrison and Berges 2005 for recipe). Divide
the spore solution in cultivation flasks dependent on the wanted spore
density, and refill with culture medium until the flask is full. Inoculation
of ≥250,000 spores mL−1 will ensure dense cultures. Add 0.1 mL germa-
nium dioxide (GeO2) L−1 medium for contamination control (for more
details see Section 2.4.2.3). Label the flasks with date and origin of the
stock. After inoculation, the culture flasks are left in constant red light
with light intensity of 20–30 µmol photons m−2 s−1 at the surface of the
culture vessel, as shown in Figure 2.3 (Note 6). A light regime of 16–24 h
per day can be used. Exposure to white light must be strictly limited as
this induces fertility in the cultures. Cultures are kept at 10°C either by
use of a climate cabinet or a light-tight climate room. Filtered air (0.2 µm)
is provided through silicon tubes (3 mm) attached to a glass pipette for
aeration (see Table 2.2 for key parameters). The culture flask is either
covered with a rubber top with a central hole for the pipette or with
Chapter two: Cultivation protocol for Saccharina latissima 47

Figure 2.3  Gametophyte cultures held under red-light conditions.

Table 2.2 Key parameters for gametophyte cultures

Key parameters
Growth medium Provasolis-Enriched Seawater
(Harrison and Berges 2005)
Light intensity (µmol m−2 s−1) 20–30
Light regimes (L:D) (h) 24:0 or 16:8
Temperature (°C) 10

Parafilm. Culture flasks of 250–500 mL are used in the initial stage, and
as the biomass increases, the culture is either split into two or the total
volume of the culture is scaled up, as shown in Figure 2.4a. After mini-
mum four weeks, the growth medium can be renewed the first time, and
to ensure a minimal evaporation rate, the cultures are gently aerated.
The water level is marked on the culture vessel at inoculation so that
evaporation can be monitored and distilled water added in case of heavy
evaporation.
48 Protocols for Macroalgae Research

(a) (b)

Figure 2.4   (a) Gametophyte cultures after two months of inoculation and
(b) gametophytes grown under red-light condition for 32 days (20× magnification).

2.4.2.2 Maintenance of gametophyte cultures

After the first renewing of the growth medium, the cultures are main-
tained every 7–14 days to keep them in a healthy and steady growing con-
dition following these procedures (Note 7):

1. Remove rubber top/Parafilm and silicon tube.

2. Transfer the culture solution from the culture flask to a blender con-
tainer. Make sure that you scrape the flask with a clean, long spatula
to get out the gametophytes settled in the bottom or on the walls.
3. Blend the solution until the gametophyte culture is homogenized
(about 30–60 s).
4. Filter the old culture medium back into the culture flask by placing
the filter cloth in the funnel. The gametophytes will accumulate in
the filter (20–40 µm).
5. Rinse the filter with a squeeze bottle holding sterile seawater or cul-
ture medium so that all gametophytes are transferred into a new
culture flask.
6. Remove a small sample with a pipette to check the culture for con-
tamination and traces of juvenile sporophytes in the microscope see
Figure 2.4b.
7. Fill the new culture flask with fresh growth medium. GeO2 can be
used (0.1 mL GeO2 L−1 medium) if diatoms are present in the culture.
8. Seal the culture flask with a rubber top or Parafilm.
Chapter two: Cultivation protocol for Saccharina latissima 49

9. Label the flasks with origin and date and mark the water level.
10. Place the flasks back in the red-light culture room/climate cabinet.
11. Allow gentle aeration so that the gametophytes stay suspended.

2.4.2.3 Contamination control

Contaminating organisms such as diatoms and other algae, ciliates, and
nematodes should be kept to a minimum in the gametophyte cultures.
There are several ways to minimize contamination:

• Glassware and equipment: All equipment is autoclaved or sterilized in

other ways before used in gametophyte cultivation.
• Mitigation of contamination from sori: Sori are always disinfected as
described in Section 2.4.1.2. The spore solution is filtered through
a plankton filter (20–40 µm) before inoculation to remove plankton
and organic debris.
• Germanium dioxide (GeO2): To mitigate the growth of diatoms that
may be introduced to the culture from sori, seawater, equipment,
and so on, GeO2 is always added to the growth medium at inocula-
tion. A solution of GeO2 is made by using 0.894 g GeO2 dissolved in
200 mL distilled fresh water. Use 0.1 mL GeO2 solution L−1 of culture
(Shea and Chopin 2007).
• Water: Autoclaved/sterilized seawater is used in all stages of game-
tophyte cultivation.
• Air: Pressurized air or an electrical air pump with a membrane filter
(0.2 µm) is used for aeration.

2.4.2.4 Fertility test

A fertility test can be carried out to check if the gametophytes are able to
become fertile and grow into viable sporophytes. This is relevant in case
the cultures have been maintained for up to one year or more. Transfer
gametophytes to Petri dishes containing PES after blending the culture.
Use for instance three replicas from each culture. Place the Petri dishes
under white light at around 30–60  µmol light intensity, with a 16:8  h
light:dark regime and at a surrounding temperature of 10°C. Change the
culture medium weekly and monitor the tests with respect to juvenile
sporophytes after two weeks and then weekly until sporophytes are pres-
ent. In a healthy culture, sporophytes should be visible after 2–4 weeks.

2.4.3 Seeding
Different kind of substrates can be used for seeding (strings, ropes, and sheets)
with different materials (nylon, polypropylene, polyester, and polyester silk),
and the ropes and strings can be both twisted and braided. This protocol is
adapted to cultivation on strings (1–2 mm) and ropes (5–10 mm) (Note 8).
50 Protocols for Macroalgae Research

2.4.3.1 Seeding with spores

Spores are acquired as described in Section 2.4.1.4. A spray bottle can be
used to distribute the spores evenly onto the substrate, the spore solution
can be poured over the substrate, or alternatively the substrate can be
bathed in the spore solution. It is recommended to adjust the spore den-
sity to 300,000–600,000 spores per mL before seeding. The substrate is left
in air for 10–15 min to allow the spores to settle after spraying (Note 9).

2.4.3.2 Seeding with gametophytes

Fertility can be induced for vegetative gametophytes cultured in red
light (see Section 2.4.2.1) by changing the culture conditions. The growth
medium is renewed (see Section 2.4.2.2) and the cultures are placed in
white light that is provided by fluorescent tubes holding 30–60 µmol light
intensity, light regime of 16:8 h light:dark, and surrounding temperature
of 10°C for 8–10 days. When a large number of eggs and small sporophytes
are visible, the culture is gently blended for 30–60  s until the gameto-
phytes are evenly distributed in the solution. The gametophyte solution
is seeded by pouring it over the substrate or by placing the substrate in a
gametophyte bath. Alternatively, a spray bottle can be used, but the spray
jet can be clogged by the gametophyte tufts. After spray and bath seed-
ing, the substrate is left in air for 15–20 min to allow the gametophytes to
settle (Note 10).

2.4.3.3 Hatchery systems

Different hatchery systems can be used to produce seedlings in a labora-
tory. Given below is a description of two different setups. The design of
the hatchery can be adapted to the space and equipment available.

a. Cylinder system: A number of 300 L plastic cylinders filled with sea-

water are illuminated by four fluorescent tubes evenly distributed
on the cylinder wall, as shown in Figure 2.5a. A thin string (1–2 mm)
is densely coiled around cylindrical Polyvinyl chloride (PVC) spools
(40 cm in length, 6 cm in width) with the use of a lathe or a drilling
machine. The spools with the string are washed in hot water without
any detergents to get rid of any chemical residues on the string.
b. Tank system: Flat, rectangular tanks of 60 (l)  ×  35 (w)  ×  17 (d) cm
as shown in Figure 2.5b are used. Ropes of 5–10  mm are twined
between screws on one side of PVC plates of 57 × 33.5 cm and placed
on the bottom of the tanks. Luminous tubes are placed 60 cm above
the incubator surface. The ropes are washed in hot water in a dish-
washer without any detergents to get rid of any chemical residues on
the string.
Chapter two: Cultivation protocol for Saccharina latissima 51

(a) (b)

Figure 2.5 (a) Seedling cultivation systems with cylinders and (b) seedling culti-
vation systems with tanks.

2.4.3.4 Cultivation under controlled

laboratory conditions
For the first three days, the incubators are left stagnant without aeration.
Water flow is set to 1.5 L min−1 and increased gradually to 2–2.5 L min−1 after
3–4  weeks to strengthen the haptera of the juvenile sporophytes before
deployment. The light intensity is set to around 70 µmol outside the incu-
bation cylinders. Gentle aeration and water flow is allowed in the incuba-
tors after the initial three-day period. Water flow is adjusted with flow
meters, or with a stopwatch and a liter measure. The water is preferably
taken from >50 m depth and is sand-filtered, particle-filtered (1 µm), and
UV-treated (Note 11). If the weather conditions are not suited at the time
that the sporophytes are ready for deployment in the sea, the light inten-
sity can be reduced to around 20 µmol to keep the sporophytes in a steady
state in the hatchery. The seeded substrate is incubated in the hatchery for
4–6 weeks until seedlings have reached a length of about 1–5 mm before
deployment, as shown in Figure 2.6a and b. Gametophytes need a shorter
time than spores to develop into juvenile sporophytes. See Table 2.3 for
key parameters for seedling cultivation.
52 Protocols for Macroalgae Research

(a) (b)

Figure 2.6 (a) Four-week-old juvenile seedlings grown on a thin string (1, 2 mm
twisted nylon) and (b) spools with seedlings ready for deployment at sea after
six weeks in the hatchery.

Table 2.3 Key parameters for seedling cultivation

  Key parameters
−2
Light intensity (µmol m s ) −1 20–70
Light regimes (L:D)(h) 16:8
Light source Fluorescent lamps (warm white, cool white,
and day light)
Temperature (°C) 10
Water treatment Sand-filtered, particle-filtered, UV
Aeration Unfiltered, cooled
Water flow (L min−1) 1.5–2.5

Spools and microscope slides are monitored closely to follow seed-

lings’ development and contamination in the hatchery. If diatom contami-
nation becomes visible (as brown, circular patches), the water flow can be
stopped and the stagnant water is treated with GeO2 (0.1 mL L−1) for three
days (Note 12). When the water flow is turned on, the chemical is diluted
and eventually removed from the system.

2.4.3.5 Development of seedlings under optimal conditions

During the first three days after seeding, the spore will develop into a
primary cell. The primary cell is recognized as a brown, round cell with
the remains of the spore seen as a tiny black dot. The two are connected
through a transparent, elongated germination tube, which might be diffi-
cult to see. Over the following days, the primary cell increases in size, and
Chapter two: Cultivation protocol for Saccharina latissima 53

if the conditions are optimal, an egg can be seen as early as on day 8 after
seeding. The egg looks similar to the primary cell but is distinguished by
its larger size and the empty, transparent membrane of the primary cell left
behind it. The empty membrane has the same size and shape as the egg cell
and is the best indication of the cell being an egg and not a primary cell.
Fertilized eggs will develop rapidly into juvenile sporophytes. The first cell
divisions are usually horizontal, and at the size of approximately five cells,
the cells start to divide vertically. Figure 2.7 shows the development from
spores to seedlings under optimal lab conditions, but one can clearly see
the development of contaminating diatoms as the sori have not been disin-
fected prior to spore release. In commercial production, the development
might take slightly more time as larger cultivation systems normally give
less degree of control and evenness in the system.

2.4.4 Deployment
2.4.4.1 Transport
Seedlings must be protected from dehydration and extreme temperatures
during transport. Spools and ropes are therefore wrapped in a thin layer
of plastic to avoid evaporation of surface water and stored in coolers if the
ambient temperature is below 0°C or above 15°C. Transportation of seed-
lings over a period up to 12 h have shown good results.

2.4.4.2 Deployment at sea

S. latissima seeded on ropes can be deployed directly at sea after incubation
in the lab. The seeded ropes can be mounted as vertical drop lines or in V- or
U-shaped patterns on preinstalled horizontal carrier lines (e.g., 14–22 mm).
The horizontal carrier lines and the seeded ropes are placed at depths
selected on the basis of seasonal variation in light, temperature, nutrients,
and local hydrodynamic conditions to obtain optimum growth while mini-
mizing tearing of the farm equipment.
S. latissima seeded on string coiled on spools must be twisted onto a
thicker rope before deployed on preinstalled horizontal carrier lines. This
can be done by hand, with handheld tools or with a twisting machine. The
twisting machine shown in Figure 2.8a is an example of a mechanical tool
for twisting of string meant for R&D and small-scale cultivation. It takes
about 20 min to spin a magazine with four spools with 60 m string on each
spool onto a thicker rope, as shown in Figure 2.8b, ready for deployment
on preinstalled horizontal carrier lines. With a helix length of, for example,
4 cm between each turn of string, it takes 1.8 m string per 1 m of 14 mm thick
rope (Figure 2.8b). Accordingly, 12 spools with a total of 720 m string can be
twisted onto 400 m thick rope ready for deployment per hour. New machin-
ery with higher capacity is required for industrialization. Sporophytes of
 54

Figure 2.7  Development of spores to sporophytes under optimal lab conditions, but without any sorus disinfection before spore
release. Pictures are taken regularly over 21 days (day 3, 6, 8, 11 [picture 1–4, upper row], 14, 16, 18, and 21 [picture 4–8 lower row]
post seeding). Pictures 1–2 show primary cells; in picture three eggs are clearly visible and pictures 4–8 show the development of
juvenile sporophytes and contaminating diatoms.
Protocols for Macroalgae Research
Chapter two: Cultivation protocol for Saccharina latissima 55

(a) (b)

(c)

Figure 2.8  (a) Twisting machine with thick rope in the center and seeded thin
strings on spools, (b) thick rope with the thin seedling string twisted onto it,
and (c) S. latissima cultivated three months in the sea, from mid-February to
mid-May.
56 Protocols for Macroalgae Research

S. latissima can be deployed from early autumn to late winter before the main
growth season in spring. Figure 2.8c shows S. latissima after three months of
cultivation in the sea. High and predictable productivity and reduced bio-
fouling during sea cultivation claim for novel production technology com-
bined with seasonal and regional cultivation strategies.

2.5 Notes
Note 1: Conditioning tanks are preferably kept separate from the hatch-
ery to avoid transfer of contaminating organisms from sporophytes
to gametophyte cultures and seedlings.
Note 2: The size and shape of the conditioning tanks are of minor
importance for the sori induction.
Note 3: Always use gloves and protecting glasses when working with
NaOCl or other hazardous chemicals and work with good ventila-
tion (fume cupboard or outside).
Note 4: The spore release peaks during the first 35–40  min after ini-
tiation (Arbona and Molla 2006) but can be continued for at least
90 min if spore density is scarce after the first 40 min.
Note 5: Spores are counted in the squares, and a minimum of 4 squares
should be counted if the density is very high, and all 10  squares
should be counted if the density is lower.
Note 6: Red light is acquired either by LED lights (620–750 nm) or by
fluorescent tubes covered in red cellophane or red plexiglass.
Note 7: All equipment is cleaned with hot water and detergent and auto-
claved/sterilized between each culture maintenance.
Note 8: Make sure that the substrate for seeding is hydrophilic (water
loving) so that the spore solution/gametophytes is/are absorbed and
not repelled by the substrate.
Note 9: If you have a low amount of spore solution available after the
spore release or in the case of a very low-spore density, you can col-
lect the spore solution that runs off from the spraying and reuse it or
consider bathing the substrate instead of spraying.
Note 10: Microscope slides are seeded and incubated together with the
spools/ropes to check the development using a light microscope
during the incubation phase.
Note 11: The hatchery normally has activity between August and
February, so in the months between production, the water and cool-
ing systems should be turned off to let the hatchery dry out. Disinfect
or wash all equipment such as ropes, water hoses, flow meters, and
so on, and chlorinate the pipe system one week in advance before
you start the production.
Note 12: Treatment with GeO2 may have a negative effect on the juvenile
sporophytes, causing deformation and reduced growth.
Chapter two: Cultivation protocol for Saccharina latissima 57

References
Arbona J.F and Molla M. 2006. Aquaculture explained: Cultivation of the brown
seaweed Alaria esculenta. In: Watson L (Ed.), Dublin: Bord Iascaigh Mhara,
50 p.
Bolton, J.J., Germann, I., Lüning, K. 1983. Hybridization between Atlantic and
Pacific representatives of the Simplices section of Laminaria (Phaeophyta).
Phycologia 22:133–140.
Bolton, J.J. and Lüning, K. 1982. Optimal growth and maximal survival tem-
peratures of Atlantic Laminaria species (Phaeophyta) in culture. Mar Biol
66:89–94.
Borum, J., Pedersen, M., Krause-Jensen, D., Christensen, P., Nielsen, K. 2002.
Biomass, photosynthesis and growth of Laminaria saccharina in a high-arctic
fjord, NE Greenland. Mar Biol 141:11–19.
Broch, O.J., Ellingsen, I., Forbord, S., Wang, X., Volent, Z., Alver, M.O., Handå, A.
et  al. 2013. Modelling the cultivation and bioremediation potential of the
kelp Saccharina latissima in close proximity to an exposed salmon farm in
Norway. Aquac Environ Interact 4:187–206.
Druehl, L.D. 1970. The pattern of Laminariales distribution in the northwest
Pacific. Phycologia 9(3/4):237–247.
Druehl, L.D. and Boal, R. 1981. Manipulation of the laminarialean life-cycle and its
consequences for kombu mariculture. Proc Internat Seaweed Symp 6:161–170.
Druehl, L.D., Collins, J.D., Lane, C.E., Saunders, G.W. 2005. An evaluation of
methods used to assess intergeneric hybdridization in kelp using Pacific
Laminariales (Phaeophyceae). J Appl Phycol 41:250–262.
Druehl, L.D. and Kaneko, T. 1973. On the Laminaria saccharina from Hokkaido. Bot
Mag Tokyo 86:323–326.
Edwards, M. and Watson, L. 2011. Aquaculture Explained Cultivating Laminaria
Digitata. Irish Sea Fisheries Board, Dunlaoghaire, Ireland.
FAO. 2016. The state of world fisheries and aquaculture 2016. Contributing to Food
Security and Nutrition for All. Food and Agricultural Organization of the
United Nations, Rome, Italy, 200 pp.
Fernand, F., Israel, A., Skjermo, J., Wichard, T., Timmermann, K.R., Golberg, A.
2016. Offshore macroalgae biomass for bioenergy production: Environmental
aspects, technological achievements and challenges. Renew Sus Energ Rev
doi: 10.1016/j.rser.2016.10.046.
Fleurence, J., Morancais, M., Dumay, J., Decottignies, P., Turpin, V., Munier, M.,
Garcia-Bueno, N., Jaouen, P. 2012. What are the prospects for using seaweed
in human nutrition and for marine animals raised through aquaculture?
Trends Food Sci Technol 27:57–61.
Forbord, S., Skjermo, J., Arff, J., Handå, A., Reitan, K.I., Bjerregaard, R., Lüning, K.
2012. Development of Saccharina latissima (Phaeophyceae) kelp hatcheries
with year-round production of zoospores and juvenile sporophytes on
culture ropes for kelp aquaculture. J Appl Phycol 24:393–399.
Førde, H., Forbord, S., Handå, A., Fossberg, J., Arff, J., Johnsen, G., Reitan, K.I. 2016.
Development of bryozoan fouling on cultivated kelp (Saccharina latissima) in
Norway. J Appl Phycol 28:1225–1234.
Fortes, M.D. and Lüning, K. 1980. Growth rates of North Sea macroalgae in rela-
tion to temperature, PAR and photoperiod. Helgoländer Meeresuntersuchungen
34:15–29.
58 Protocols for Macroalgae Research

Hafting, J.T., Critchley, A.T., Cornish, M.L., Hubley, S.A., Archibald, A.F. 2012.
On-land cultivation of functional seaweed products for human usage. J Appl
Phycol 24:385–392.
Handå, A., Forbord, S., Wang, X., Broch, O.J., Dahle, S.W., Størseth, T.S., Reitan, K.I.,
Olsen, Y., Skjermo, J. 2013. Seasonal- and depth-dependent growth of culti-
vated kelp (Saccharina latissima) in close proximity to salmon (Salmo salar)
aquaculture in Norway. Aquaculture 414–415:191–201.
Harrison, P.J. and Berges, J.A. 2005. Marine culture media. In: Algal Culturing
Techniques R. Andersen (Ed.), pp. 21–33. Academic Press, New York.
Holdt, S. and Kraan, S. 2011. Bioactive compounds in seaweed: Functional food
applications and legislation. J Appl Phycol 23:543–597.
Hollenberg, G.J. 1939. Culture studies of marine algae. I. Eisenia arborea. Amer J Bot
26:34–41.
Joska, M. and Bolton, J. 1987. In situ measurement of zoospore release and sea-
sonality of reproduction in Ecklonia maxima (Alariaceae, Laminariales). Brit
Phycol J 22:209–214.
Kain, J.M. 1975. The biology of Laminaria Hyperborea VII. Reproduction of the spo-
rophyte. J Mar Biol Assoc U.K. 55:567–582.
Kain, J.M. 1979. A view of the genus Laminaria. Oceanogr Mar Biol Ann Rev
17:101–161.
Lüning, K. 1980. Critical levels of light and temperature regulating gametogenesis
of three Laminaria species. J Phycol 16:1–15.
Lüning, K. 1990. Seaweeds. Their Environment, Biogeography, and Ecophysiology.
Wiley, New York.
Lüning, K. and Dring, M.J. 1975. Reproduction, growth and photosynthesis of
gametophytes of Laminaria saccharina grown in blue and red light. Mar Biol
29:195–200.
Lüning, K. and Neushul, M. 1978. Light and temperature demands for growth
and reproduction of laminarian gametophytes in southern and central
California. Mar Biol 45:297–309.
Müller, D.G. 1989. Sexuality and sexual attraction. In: Algae as Experimental Systems,
A.W. Coleman, L.J. Goff, and J.R. Stein-Taylor (Eds.), pp. 201–213. A.R. Liss,
New York.
Müller, D.G., Gassmann, G., Lüning, K. 1979. Isolation of a spermatozoid—
Releasing and attracting substance from female gametophytes of Laminaria
digitata. Nature 279:430–431.
Pang, S. and Lüning, K. 2004. Breaking seasonal limitation: Year-round sporo-
genesis in the brown alga Laminaria saccharina by blocking the transport of
putative sporulation inhibitors. Aquaculture 240:531–541.
Rajapakse, N. and Kim, S.K. 2011. Nutritional and digestive health benefits of sea-
weed. Adv Food Nutr Res 64:17–28.
Redmond, S., Green, L., Yarish, C., Kim, J., Neefus, C. 2014. New England Seaweed
Culture Handbook-Nursery Systems. Connecticut Sea Grant CTSG-14-01. 92 p.
http://nsgl.gso.uri.edu/nhu/nhuh14001.pdf.
Rød, K.K. 2012. Sori disinfection in cultivation of Saccharina latissima—Evaluation
of chemical treatments against diatom contamination. Master thesis,
Norwegian University of Science and Technology, Trondheim, Norway.
Sauvageau, C. 1916. Sur les gametophytes de deux Laminaires. C R Acad Sci
56:1–240.
Chapter two: Cultivation protocol for Saccharina latissima 59

Schreiber, E. 1930. Untersuchungen über Parthenogenetische Geschlechtsbestimmung

und Bastardierungsvermögen bei Laminarien. Planta 12:331–353.
Shahidi, F. 2009. Nutraceuticals and functional foods: Whole versus processed
foods. Trends Food Sci Technol 20:376–387.
Shea, R. and Chopin, T. 2007. Effects of germanium dioxide, an inhibitor of dia-
tom growth, on the microscopic laboratory cultivation stage of the kelp,
Laminaria saccharina. J Appl Phycol 19:27–32.
Sjøtun, K. 1985. Ei autoøkologisk undersøkjing av Laminaria saccharina (L.) Lamour
i Espegrend-området. Master thesis, University of Bergen. In Norwegian,
Bergen, Norway.
Tabarsa, M., Rezaei, M., Ramezanpour, Z., Waaland, J.R., Rabiei, R. 2012. Fatty
acids, amino acids, mineral contents, and proximate composition of some
brown seaweeds. J Phycol 48:285–292.
tom Dieck, I. 1993. Temperature tolerance and survival in darkness of kelp game-
tophytes (Laminariales, Phaeophyta): Ecological and biogeographical impli-
cations. Mar Ecol Prog Ser 100:253–264.
van den Hoek, C. and Donze, M. 1967. Algal phytogeography of the European
coasts. Blumea 15 (1):63–89.
Wargacki, A.J., Leonard, E., Win, M.N., Regitsky, D.D., Santos, C.N.S., Kim, P.B.,
Cooper, S.R. et al. 2012. An engineered microbial platform for direct biofuel
production from brown macroalgae. Science 335:308–313.
Wilce, R.T. 1965. Studies in the genus Laminaria III. A revision of the north
Atlantic species of the Simplices section of the Laminaria. Bot Gothenburg
3:247–256.
Williams, J.L. 1921. The gametophytes and fertilization in Laminaria and Chorda.
Ann Bot Lond 35:603–607.
chapter three

Derivation of clonal stock cultures

and hybridization of kelps
A tool for strain preservation
and breeding programs
Inka Bartsch

Contents
3.1 Introduction ............................................................................................. 62
3.2 State of the art .......................................................................................... 63
3.3 Materials................................................................................................... 64
3.3.1 Facilities and equipment for collection of sporogenous
material and release of spores................................................... 64
3.3.1.1 In the field ..................................................................... 64
3.3.1.2 In the laboratory ........................................................... 65
3.3.2 Facilities and equipment list for isolation and
propagation of clonal cultures .................................................. 65
3.3.3 Facilities and equipment list for performing
laboratory-scale hybridization programs ................................ 66
3.4 Experimental procedures ...................................................................... 66
3.4.1 Collection and preparation of fertile sporophytes ................. 66
3.4.2 Induced spore release ................................................................. 66
3.4.3 Conditions to keep gametophytes vegetative ......................... 69
3.4.4 Isolation of clonal gametophyte cultures ................................ 70
3.4.5 Propagation of clonal cultures .................................................. 71
3.4.6 Hybridization of clonal gametophyte cultures ...................... 72
3.5 Notes ......................................................................................................... 75
Acknowledgment ............................................................................................. 76
References.......................................................................................................... 76

61
62 Protocols for Macroalgae Research

3.1 Introduction
The term kelp is the common name of all species of the marine brown algal
order Laminariales, but as common names often do not have a precise
definition, in the literature, it is partially also used for other big brown
algae of the order Fucales or Desmarestiales, all of which form coastal
underwater forests. Here, we only deal with kelps in the restricted defini-
tion, that is, the Laminariales. Kelps thrive along rocky shores of polar to
cold-temperate waters worldwide, or more seldom in cooler deep-waters
of warm-temperate to tropical sites, such as the Mediterranean Sea or the
Galapagos islands (Lüning 1990; Bolton 2010). Besides their considerable
ecological role as ecosystem engineering species, a few taxa, especially
of the genera Laminaria, Saccharina, Undaria, and Macrocystis, are of major
economic importance, either being harvested in the field or cultivated,
the latter particularly in Asia and in Chile (FAO 2016). Interest in kelps
and kelp cultivation as a resource for food products, alginates, and biofuel
production among others is growing steadily and thus strain preserva-
tion, in combination with genetic engineering of strains or classical breed-
ing programs, may become more and more important in the future. This
is especially significant under the threat of global warming where wide
stretches of coasts currently harboring seaweed aquacultures will become
tropical to subtropical (Bartsch et al. 2012) and may require warm-tolerant
cultivars.
One prerequisite for the easy selection and maintenance of strains is
the life cycle of Laminariales. Kelps are diploid macroscopic algae, which
consist of a lamina (blade), stipe (stem), and haptera (holdfast), and are
mostly perennial. When they become fertile, groups of sporangia (sorus)
develop either on the main blade or in some species on smaller special
blades, the so-called sporophylls. During spore formation, meiosis takes
place resulting in mobile isomorph haploid male and female spores of
approximately 4–8  µm length. After spore germination, single-celled
gametophytes may either directly enter reproduction (gametogenesis) or
initiate vegetative growth depending on environmental conditions. The
latter process is used to derive clonal stock cultures for multiuse purposes.
For a scheme of the life cycle and further details, see Chapter 2 by Forbord
et al. (2017) and Bartsch et al. (2008). The capacity of microscopic clonal
gametophytes to grow and preserve their ability for sexual reproduction
even after >30  years of maintenance (Druehl et  al. 2005; Bartsch, pers.
comm.) is a prerequisite for the long-term preservation of clonal male and
female gametophytes.
The current chapter elucidates kelp cultivation aspects that have not
been addressed in Chapter 2. The skilled researcher or application man-
ager will be able to combine both protocols for specific needs. General
seed supply and sporulation protocols described in Chapter 2 are a good
Chapter three: Derivation of clonal stock cultures 63

starting point to obtain freshly released spores. In addition to this, this

chapter will provide details that specifically focus on isolation and vege-
tative propagation of unialgal (but not axenic) clonal gametophyte strains.
As described in Chapter 2, spores can either be obtained by collection of
seasonally fertile field sporophytes or by artificial induction of fertile tis-
sue. This enables spore production independent of the season (Buchholz
and Lüning 1999; Pang and Lüning 2004).

3.2 State of the art

During the last century, before the advent of viable molecular methods,
inter- and intraspecific hybridization experiments of kelps were used to
reveal potential relationships within and between kelp genera and fam-
ilies. This interest was mostly driven by basic science. One example of
these times highlights the applied potential of hybrid kelp sporophytes:
It  became evident that digitate species of the genus Laminaria from the
North and South Atlantic were not interfertile if co-occurring but still
retained the ability to hybridize when they were geographically sepa-
rated. As all these species have a slightly different temperature tolerance,
F1-hybrid sporophytes showed different temperature growth characteris-
tics than their parents (tom Dieck and Oliveira 1993). This aspect can be
used for aquaculture purposes to develop cultivars better adapted to the
required conditions than the wild type. Ethical considerations may, how-
ever, prohibit a fruitful application in cases in which respective hybrids
may be considered as foreign species introductions.
Full intraspecific hybridization was obtained between geographi-
cal isolates of several species or species complexes (e.g., in N-Atlantic
Laminaria digitata, Atlantic and Pacific Saccharina species complex, Alaria
esculenta, and Pacific Macrocystis) (Funano 1980; Lewis and Neushul 1994;
overview of hybridization in Laminaria and Saccharina: Bartsch et al. 2008;
Kraan et al. 2000). Successful hybridization is possible even between gen-
era, as has recently been shown by Hwang et  al. (2012) for Undariopsis
petersiana and Undaria pinnatifida. On the other hand, even within spe-
cies, reciprocal crossbreeds are not always successful, especially when
involving strains/clones from widely separated localities (Bolton et  al.
1983; Müller et al. 2008). Many issues involved in the verification of inter-
generic hybrid sporophytes and kelp hybridization, in general, have been
discussed in detail by Druehl et al. (2005). Sexual compatibility and the
ability to hybridize seems to be a gradual process that probably involves
several genes and prezygotic or postzygotic reproductive isolation mech-
anisms (e.g., Lewis and Neushul 1995; Druehl et al. 2005). As the need for
genetic modification of marine macroalgae for industrial purposes has
increased (Robinson et al. 2013), the focus on kelp hybridization changed
to application issues during the last decades.
64 Protocols for Macroalgae Research

The search for species, populations, or cultivars with a high com-

mercial value for aquaculture including respective breeding programs
has a long tradition, especially in China. Cultivars propagated through
spores from a limited number of sporophytes are however prone to
inbreeding depression, leading to the loss of originally well-performing
strains (Loureiro et  al. 2015). Thus, intra- or interspecific crossbreeds
originating from clonal gametophytes are a potential tool to prevent
long-term degeneration (Note 1). It may help generating first filial hybrid
sporophytes with an increased vigor, higher productivity, or growth
than the respective parental generations—which is considered to repre-
sent a heterosis effect.
In Asia and Chile, new superior cultivars with a stable genotype were
developed with the help of clonal gametophyte cultures to overcome the
restraints from inbreeding. In 2007, selected gametophyte clones from
Saccharina japonica and S. longissima (=Laminaria japonica and L. longissima)
were crossed, and it was an effective tool of utilizing kelp heterozygous
vigor (Li et al. 2007). This line of research was constantly pursued in China
resulting in several new cultivars with superior commercial value. In S.
japonica, intraspecific crosses of gametophyte clones from distant sites led
to a new cultivar with superior blade quality, high alginate and iodine
contents, higher stress tolerance, and reduced biomass loss during the hot
summer season. These results are on the basis of data from five seasons.
The seeding of the clonal gametophytes successfully prevented inbreed-
ing depression compared with seeding with spores (Li et al. 2016; Zhao
et al. 2016). In U. pinnatifida, a highly efficient cultivar was also developed
through crosses of intraspecific gametophyte clones and further selection
(Shan et  al. 2016). Similar strategies have been proposed for Macrocystis
which is a valuable resource of high commercial interest in Chile, to over-
come its severe over-exploitation. On a lab-based scale, this was already
achieved, but the large-scale application has yet to be accomplished
(Westermeier et al. 2010).

3.3 Materials
In general, all listed materials should be clean or where possible sterile.

3.3.1 Facilities and equipment for collection of

sporogenous material and release of spores
3.3.1.1 In the field
• Zip-lock bags.
• Labels (for discrimination of specific plants, e.g., for genotyping and
phenotyping).
Chapter three: Derivation of clonal stock cultures 65

• Coolers or ice packs to keep the temperature at the same or below

the environmental seawater temperature.
• Scissors, knife, or cork borer for collecting sorus from sporophytes.
• Optional: Cotton or tissue paper for cleaning.
• For expedition: Sterile Falcon tubes or cryovessels filled with glass
slides.

3.3.1.2 In the laboratory

• Tissue paper.
• Distilled water.
• Glass or plastic dishes for preparation of wet chambers of sufficient
size with lid, alternatively covering with aluminum foil.
• Temperature-regulated room keeping 5°C–15°C and/or refrigerator
(4°C); adapt to your local environmental conditions.
• Filtered seawater (≤2 µm) enriched with 0.5 mL of a saturated GeO2
solution per liter seawater (Shea and Chopin 2007) to suppress dia-
tom growth.
• Pipettes of any type (e.g., Eppendorf and Pasteur).
• Small plastic Petri dishes.
• Microscope slides, cover glasses, and glass cutter.
• Microscope/ideally inverted microscope.
• Extendable closing foil (such as Parafilm).
• Permanent marker.

3.3.2 Facilities and equipment list for isolation

and propagation of clonal cultures
• Dissecting microscope.
• Inverted microscope (optional).
• Plastic Petri dishes (do not use microwell plates as they are difficult
to monitor and do not contain sufficient medium).
• Pasteur glass pipettes.
• Pipette suction ball (silicon) (only silicon balls have the right pressure,
avoid Peleus balls or other bigger pipette aids as they do not allow
for the fine movement skills you need for isolation). Alternatively,
you can use a silicon tube, which is connected with the pipette and
your mouth.
• Gas flame.
• Forceps.
• Pestle and mortar.
• Seawater enriched with ½ PES (Provasoli nutrient solution) (Provasoli
1968).
• Extendable closing foil (such as Parafilm).
• Steady hand.
66 Protocols for Macroalgae Research

3.3.3 Facilities and equipment list for performing

laboratory-scale hybridization programs
• Vegetative clonal male and female gametophyte cultures of different
parental origin representing different phenotypes or genotypes.
• Pasteur pipettes.
• Mortar and pestle.
• Glassware, tubing, and air filters.
• Filtered nutrient-enriched seawater (½ PES).

3.4 Experimental procedures

This protocol focuses on kelps in general and applies to any species as
long as adjustments are made according to the temperature demands
of the respective species. With this protocol as a baseline, modifications
can easily be applied depending on the local situation and the preferred
personal procedures. Similar, but less detailed protocols are available
elsewhere (e.g., Druehl et al. 2005).

3.4.1 Collection and preparation of fertile sporophytes

Sorus development is gradual, and a ripe sorus ready to release spores is
discernable by a uniform dark-brown color (Figure 3.1), it elevates above
the surface of the blade and thereby is palpable and sometimes a transpar-
ent membrane is detaching from the surface. See Note 2 for the fertility of
sporophytes.

• Collect fertile kelp tissue (sorus) in the field.

• Take care that the sorus does not suffer from high irradiance, tem-
peratures >10°C–15°C, or frost and remains wet during transporta-
tion. Adapt size of transport container to size or quantity of material
and field situation.
• Cooling can be achieved by use of ambient seawater; otherwise, add
ice packs, but take care to protect kelp tissue from freezing.
• Sporogenous tissue keeps fresh and healthy for two days under
these conditions.

3.4.2 Induced spore release

As the aim is to obtain uncontaminated healthy unialgal spores, spread
out well separated on the substrate, spores have to be sown in a rather
low density, and only a small piece of healthy and ripe sorus is needed.
Chapter three: Derivation of clonal stock cultures 67

Figure 3.1  Sporophylls of Alaria esculenta showing different stages of sorus rip-
ening. Scale bar = 1 cm.

The smaller the piece of sorus is, the higher the probability that it is not
contaminated by diatoms or other organisms.

1. Cut out sorus; small pieces of ripe sori are sufficient for the purpose.
2. Clean sorus with tissue paper wetted with distilled water and wipe
dry. Chemical disinfection is not needed.
3. Avoid material that is infected by endophytes or epiphytes
(Figure 3.2) or shows signs of biofouling.
4. Store the sorus in a humid chamber (e.g., by addition of wet paper
towels) overnight at low temperatures (e.g., 4°C in the refrigerator).
Adapt size of the chamber to the size of the sorus. In our case, a Petri
dish is sufficient. Take care that the sorus does not come into contact
with freshwater (Note 3).
5. Rehydrate sorus piece in a clean Petri dish with sterile seawater
(10°C–15°C) the next day.
6. Subject to light and relatively warm but nonlethal temperatures
(~15°C). Spores are usually released within 10–30 min.
7. After spore release, remove the sorus and discard.
68 Protocols for Macroalgae Research

Figure 3.2  Fertile sorus of Saccharina latissima infected by endobiota.

8. Check for mobility and density of spores (if possible).

9. Dilute a few drops of the spore suspension in a new Petri dish filled
with sterile seawater and GeO2.
10. Ideally, a low spore density is generated (<10,000 spores cm−²) so that
spores will settle separately from each other in distances of >200 µm
(Figure 3.3). It can easily be achieved if you initiate a dilution series
from which you can choose later. This is particularly useful if you
cannot check for spore density after release.
11. Label Petri dish and seal with Parafilm.

The shorter the release period, the less chance there is for any unwanted
contamination. In contrast to the protocol by Forbord et al. 2017 (Chapter 2),
a mass release of spores is not essential.
During expeditions/field—work without direct laboratory access, the
following protocol may be useful to collect spores:

• Fill Falcon tubes, cryovessels, or similar equipment with two clean

glass slides firmly pressed together or cut appropriate pieces of
slides to fit into the sterile tubes.
Chapter three: Derivation of clonal stock cultures 69

50 μm

Figure 3.3  Germinated kelp spores in a density that should ideally be less than
shown for isolation purposes.

• Fill up with cool, sterile seawater and GeO2.

• Place a small piece of freshly cleaned sorus (as above-mentioned)
into prelabeled tubes.
• Protect tubes from heat and direct sun light.
• Discard the sorus after approximately 30 min–2 h.
• Back in the laboratory, transfer the slides with the outer side up into
sterile plastic Petri dishes freshly filled with sterile seawater and
GeO2 after spores have settled (approx. 24 h).
• Label and seal the dishes by using Parafilm.

After sowing the spores, these germinate autonomously into unicellular

gametophytes within a few days.

3.4.3 Conditions to keep gametophytes vegetative

Unicellular gametophytes have to be prevented from becoming fertile.
Otherwise, a rapid transition into sporophytes takes place, and no game-
tophytes are left for isolation of clones. Blue light initiates gametogenesis
and even low intensities, especially if combined with low temperatures,
are extremely inducing (Lüning and Dring 1975; Bartsch pers. obs.). Red
light or very low-light intensities should be applied. Modern white LED
lamps often have a much higher irradiance in the blue spectrum than
fluorescent lamps that were predominantly used in laboratories until
recently. Thus, care should be taken that no blue light source is close to
your gametophyte cultures. Nutrients, especially those including iron,
70 Protocols for Macroalgae Research

also induce gametogenesis (Motomura and Sakai 1981; Lewis et al. 2013).
Thus, the nutrient medium is ideally iron-free and, during the first four
weeks, should not be exchanged at all. Later on, medium change is suffi-
cient once per month. As long-term exposition to GeO2 may also be harm-
ful to kelps, exchange the initial seawater after approximately four weeks,
and only add P and N according to the protocol of Zhang et al. (2008) or
≤ ½ PES. The application of relatively high temperatures is another pos-
sibility to inhibit gametogenesis. Kelp gametophytes normally do not
become fertile if exposed to temperatures ~4°C lower than their upper
survival limit (e.g., tom Dieck and Oliveira 1993).

3.4.4 Isolation of clonal gametophyte cultures

• Check the original gametophyte cultures every 2–4  weeks after
sowing.
• Take care that no gametogenesis takes place.

One to two months after inoculation, gametophytes normally have grown

to sufficient size to be isolated under the dissecting microscope or the
inverted microscope. By then, the gametophytes have differentiated into
multicellular bigger female and smaller male gametophytes. Ideally, you
begin isolating when gametophytes are big enough to be seen and treated
under the dissecting microscope.

• Draw out glass Pasteur pipettes to get a narrower mouth or just melt
the tip of the glass pipette to smooth the outer margin of the mouth
or take a microcapillary tube. Avoid forceps for isolation purposes.
Even fine forceps are not suitable as the gametophytes easily stick to
them.
• Identify well-separated male and female gametophytes.
• Select one single gametophyte with your pipette.
• Transfer the droplet of water with the single gametophyte into a new
sterile Petri dish.
• Scrutinize this droplet under the (inverted) microscope to verify
that you selected a single gametophyte and verify the sex.
• Fill up with sterile ½ PES (ideally iron free) or sterile seawater just
enriched with N and P (Zhang et al. 2008).
• Seal with Parafilm, label, and replace into conditions allowing for
vegetative growth.
• Repeat this process with the opposite sex so that you generate at
least one clonal pair of gametophytes per parental sporophyte.

It should be noted that single isolated gametophytes may not be visible in

the Petri dish until they have grown to a larger size.
Chapter three: Derivation of clonal stock cultures 71

3.4.5 Propagation of clonal cultures

Approximately 3–6 months later, the separated gametophyte has formed
a small vegetative cushion of approximately 1–3 mm in diameter. You can
now use this clone to propagate it further (Figure 3.4):

• Take the gametophyte cushion with a sterile one-way pipette and

place it into a sterile mortar.
• Very carefully crush the cushion, without applying a lot of pressure,
add a bit of sterile seawater, and pour the fragments into a bigger
Petri dish.

(a) (b)

(c) (d)

(e)

Figure 3.4 Vegetative clonal gametophytes and their propagation. (a) Red light
grown gametophytes, (b) vegetative gametophyte cushions, (c) sterile mortar with
small vegetative gametophyte cushions, (d) carefully fragmented gametophytes,
and (e) fragmented gametophytes filled up with seawater for sowing.
72 Protocols for Macroalgae Research

• Fill up with sterile iron-free nutrient-enriched seawater or ≤½ PES.

• Label the dishes and seal with Parafilm.
• Transfer back into conditions allowing for vegetative growth.

Another several months later, there is enough material to initiate either

sporophyte production for hybridization experiments or to further prop-
agate the clonal gametophytes for aquaculture purposes (e.g., Zhang
et al. 2008).

3.4.6 Hybridization of clonal gametophyte cultures

Once established, clonal gametophytes allow for controlled experiments
or induction of cultivars with specific characteristics. This is useful for
various applied purposes or investigations of trait inheritance through
classical or molecular methods.

• Choose the male and female clonal gametophyte strains to be

crossed.
• Take a similar amount of vegetative gametophyte material from all
strains and sexes.
• Always use one-way pipettes for handling to avoid contamination of
clones with opposite sex.
• Carefully crush each gametophyte clone separately in a sterile mor-
tar (as above-mentioned) and produce separate stock solutions for
each clone.

To observe the phenology and/or physiology of sporophytes resulting

from crosses, the following cultures have to be initiated by combining
similar amounts of the respective clonal male and female gametophyte
stock solutions (Table 3.1).
A parthenogenetic control is needed as all female gametophytes
that become fertile, release eggs and those that are not fertilized by
male spermatia may also develop haploid or polyploid parthenospo-
rophytes. An apogamic control only produces sporophytes in seldom
cases but should be monitored for if the response of the species or
strain is unknown. Parthenosporophytes and apogamic sporophytes
are often misshaped without a clear basipetal orientation and often lack
the development of basal rhizoidal filaments (tom Dieck and Oliveira
1993; Figure 3.5). In some species, parthenosporophytes with normal
Chapter three: Derivation of clonal stock cultures 73

Table 3.1 Breeding scheme of gametophyte crossings and controls

for detection of performance effects in the filial F1-sporophyte
generation
Breeding treatment Crossing scheme of parental genotypes
Selfings1 Strain 1 ♂ × strain 1 ♀ Strain 2 ♂ × strain 2 ♀
Hybrids2 Strain 1 ♂ × strain 2 ♀ Strain 2 ♂ × strain 1 ♀
Parthenogenesis Strain 1 ♀ Strain 2 ♀
control3
Apogamic control4 Strain 1 ♂ Strain 2 ♂
1 Combination of single parental genotypes; control of original phenotype.
2 Combination of  two  parental genotypes; resulting phenotypes of sporo-
phytes will be controlled against selfings, parthenogenetic, and apogamic
control sporophytes.
3 Control whether female gametophytes may convert unfertilized eggs into
sporophytes.
4 Control whether male gametophytes may develop sporophytes asexually
through transformation of gametophyte cells.

Figure 3.5  Saccharina latissima: Microscopic sporophytes (with rhizoids) and pre-
sumable parthenosporophytes (deformed sporophytes without rhizoids). Scale
bar = 50 µm.
74 Protocols for Macroalgae Research

morphology have been reported growing into fertile adult sporophytes

and producing only haploid female gametophytes, whereas misshaped
parthenosporophytes were polyploid (Fang et  al. 1978; Lewis et  al.
1993). The comparison of the morphological development of sporo-
phytes allows for the visual interpretation of successful hybridiza-
tion without molecular genotyping techniques, although they cannot
replace the latter.

• After initiation of crosses, subject cultures to conditions inducing

gametogenesis and growth of juvenile sporophytes (see Forbord
et al. 2017 in Chapter 2).
• Microscopic sporophytes develop within 14  days under opti-
mum conditions, which differs for different kelp species. In gen-
eral, temperatures between 5°C and 15°C and an irradiance of
20–40 µmol photons m−2 s−1 in a 16:8 light:dark cycle will produce
good results.
• Avoid continuous daylengths for the induction of gametogen-
esis and sporophyte production as egg release will no longer be
synchronized (Lüning 1981). As a consequence, the formation of
sporophytes is greatly reduced, and a considerable number of pre-
sumable parthenosporophytes with abnormal morphology appear
(Figure 3.5).
• When sporophytes are discernible by the naked eye (approxi-
mately 1–2 mm in length) they should be transferred into aerated
sterile glass beakers.
• Change the nutrient-enriched seawater at least once per week.
• Adapt the size of the glassware according to the size of the sporo-
phytes (rule of thumb example: approximately hundred 2 cm spo-
rophytes grow well in 5 L beakers). Also take care that the density
of sporophytes is adjusted during their growth. Sporophytes need a
lot of nutrients during this phase. Thus, the number of beakers will
increase continuously.
• Replace glassware and tubing every 2–3  weeks with clean, sterile
items.
• Within 3–4  months, you obtain sporophytes of 2–5  cm length
(Figure  3.6), which can be used for subsequent controlled physi-
ological or transcriptomic experiments, enabling the comparison
of strain characteristics with the evaluation of possible heterosis
effects.
Chapter three: Derivation of clonal stock cultures 75

Figure 3.6  Sporophyte cultures in aerated 5 L glass beakers.

3.5 Notes
Note 1: Advantages and disadvantages of clonal gametophytes:
Clonal gametophytes are rather easy to obtain and to maintain for
requirements of basic research and commercial applications. The
advantages of clonal gametophytes are that (1) they can be kept
for decades, (2) probably remain genetically relatively stable (final
evidence is still missing), and (3) sporophytes can be initiated at
any time of the year and can thus uncouple seeding from the sea-
sonal availability of spores. The disadvantages of clonal gameto-
phytes are that (1) much time is needed for their establishment, that
(2) they have to be protected from fatal contamination or disease,
and that (3) care has to be taken that clones stay vegetative but
grow sufficiently.
Note 2: Fertility of sporophytes: The season of sporophyte fertility is
different from species-to-species (see, e.g., Bartsch et al. 2008). Most
species are fertile during autumn to winter, some over summer, and
in some species/regions, fertile material may be found year-round
but with different intensities. In instances where environmental
76 Protocols for Macroalgae Research

conditions have been stressful, it may occur that sori looking per-
fect do not release viable spores, and germination capacity is low.
This has been shown for L. digitata in summer (Bartsch et al. 2013).
Note 3: Spore release methods: Each laboratory has its own methods
to release spores. Some protocols keep cleaned sori for 2  h in the
air, whereas others keep them for two days in the refrigerator with-
out the wet chamber. The disadvantage of the forced spore release
procedure is that not only ripe but also unripe sporangia burst and
release healthy motile and unripe spores with no swimming activ-
ity. The motility status of spores should thus be checked under the
microscope after release. In some cases, the tissue may release con-
siderable amounts of mucus (alginate) that can be harmful to the
spores and may require immediate attention (e.g., filtration through
net-gauze or dilution with sterile seawater or the transfer of the
spore solution into new tubes/Petri dishes).

Acknowledgment
I thank Klaus Lüning who initiated my interest in kelps many years ago,
provided the initial training in the described methods, and fostered my
early career. I thank Bertrand Jacquemin for introducing me to the spore
capture method in the Falcon tubes without induced spore release. I thank
A. Wagner and D. Liesner for checking of inconsistencies and J. Bartsch
for polishing the English of the manuscript.

References
Bartsch, I., J. Vogt, C. Pehlke, and D. Hanelt. 2013. Prevailing sea surface tem-
peratures inhibit summer reproduction of the kelp Laminaria digitata at
Helgoland (North sea). J. Phycol. 49:1061–1073.
Bartsch, I., C. Wiencke, K. Bischof et  al. 2008. The genus Laminaria sensu lato:
Recent insight and development. Eur. J. Phycol. 43:1–86.
Bartsch, I., C. Wiencke, and T. Laepple. 2012. Global seaweed biogeography under
a changing climate: The prospected effects of temperature. In Seaweed
Biology. Novel Insights into Ecophysiology, Ecology and Utilization, Wiencke, C.
and Bischof, K. (Eds.), Springer, Heidelberg, Germany, pp. 383–406.
Bolton, J.J. 2010. The biogeography of kelps (Laminariales, Phaeophyceae):
A  global analysis with new insights from recent advances in molecular
phylogenetics. Helgol. Mar. Res. 64:263–279.
Bolton, J.J., I. Germann, and K. Lüning. 1983. Hybridization between Atlantic and
Pacific representatives of the Simplices section of Laminaria (Phaeophyta).
Phycologia 22:133–140.
Buchholz, C. and K. Lüning. 1999. Isolated, distal blade discs of the brown alga
Laminaria digitata form sorus, but not discs near to the meristematic transi-
tion zone. J. Appl. Phycol. 11:579–584.
Chapter three: Derivation of clonal stock cultures 77

Druehl, L.D., J.D. Collins, C.E. Lane, and G.W. Saunders. 2005. An evaluation of
methods used to assess intergeneric hybridization in kelp using Pacific
Laminariales (Phaeophyceae). J. Phycol. 41:250–262.
Fang, T.C., J.H. Tai, Y.L. Ou, C.C. Tui, and T.C. Chen. 1978. Some genetic observa-
tions on the monoploid breeding of Laminaria japonica. Sci. Sin. 21:401–408.
Food and Agriculture Organization of the United Nations. 2016. Fisheries and
Aquaculture Information and Statistics Services. Retrieved from http://www.
fao.org/figis/ (accessed May 3, 2016).
Forbord, S., K.B. Steinhovden, K.K. Rød, A. Handå, and J. Skjermo. 2017. Cultivation
protocol for Saccharina latissima. In Protocols for Macroalgae Research, B.
Charrier, T. Wichard, and C.R.K. Reddy (Eds.), Chapter 2. Boca Raton, FL:
CRC Press, Taylor & Francis Group.
Funano, T. 1980. Crossing experiments between several species of Laminaria in
Hokkaido. Hokusuishi-Geppo 37:181–207 (in Japanese).
Hwang, E.K., Y.G. Gong, and C.S. Park. 2012. Cultivation of a hybrid of free-living
gametophytes between Undariopsis peterseniana and Undaria pinnatifida:
Morphological aspects and cultivation period. J. Appl. Phycol. 24:401–408.
Kraan, S., A.V. Tramullas, and M.D. Guiry. 2000. The edible brown seaweed Alaria
esculenta (Phaeophyceae, Laminariales): Hybridization, growth and genetic
comparisons of six Irish populations. J. Appl. Phycol. 12:577–583.
Lewis, R.J. and M. Neushul. 1994. Northern and southern hemisphere hybrids of
Macrocystis (Phaeophyceae). J. Phycol. 30:346–353.
Lewis, R.J. and M. Neushul. 1995. Intergeneric hybridization among five genera
of the family Lessoniaceae (Phaeophyceae) and evidence for polyploidy in a
fertile Pelagophycus × Macrocystis hybrid. J. Phycol. 31:1012–1017.
Lewis, R.J., M. Green, and M.E. Azfal. 2013. Effects of chelated iron on oogenesis and
vegetative growth of kelp gametophytes (Phaeophyceae). Phycol. Res. 61:46–51.
Lewis, R.J., B. Jiang, M. Neushul, and X.G. Fei. 1993. Haploid parthenogenetic spo-
rophytes of Laminaria japonica (Phaeophyceae). J. Phycol. 29:363–369.
Li, X., Y. Cong, G. Yang et al. 2007. Trait evaluation and trial cultivation of Dongfang
No.  2, the hybrid of a male gametophyte clone of Laminaria longissima
(Laminariales, Phaeophyta) and a female one of L. japonica. J. Appl. Phycol.
19:139–151.
Li, X., Z. Zhang, S. Qu et  al. 2016. Breeding of an intraspecific kelp hybrid
Dongfang no. 6 (Saccharina japonica, Phaeophyceae, Laminariales) for suit-
able processing products and evaluation of its culture performance. J. Appl.
Phycol. 28:439–447.
Loureiro, R., C.M.M. Gacon, and C. Rébours. 2015. Seaweed cultivation: Potential
and challenges of crop domestication at an unprecedented pace. New
Phytologist 206:489–492.
Lüning, K. 1981. Egg release in gametophytes of Laminaria saccharina: Induction by
darkness and inhibition by blue light and UV. Br. Phycol. J. 16:579–593.
Lüning, K. 1990. Seaweeds: Their Environment, Biogeography, and Ecophysiology. New
York: Wiley.
Lüning, K. and M.J. Dring. 1975. Reproduction, growth and photosynthesis of
gametophytes of Laminaria saccharina grown in blue and red light. Mar. Biol.
29:195–200.
Motomura, T. and Y. Sakai. 1981. Effect of chelated iron in culture media on oogen-
esis in Laminaria angustata. Bull. Japan Soc. Sci. Fish. 47:1535–1540.
78 Protocols for Macroalgae Research

Müller, R., C. Wiencke, and K. Bischof. 2008. Interactive effects of UV radiation

and temperature on microstages of Laminariales (Phaeophyceae) from the
Arctic and North Sea. Clim. Res. 37:203–213.
Pang, S.J. and K. Lüning. 2004. Breaking seasonal limitation: Year-round sporo-
genesis in the brown alga Laminaria saccharina by blocking the transport of
putative sporulation inhibitors. Aquaculture 240:531–541.
Provasoli, L. 1968. Media and prospects for the cultivation of marine algae. In
Cultures and Collections of Algae, A. Watanabe and A. Hattori (Eds.), Proceedings
of the US Japan Conference, Hakone 1966. Tokio, Japan: Japanese Society of
Plant Physiology, pp. 63–75.
Robinson, N., P. Winberg, and L. Kirkendale. 2013. Genetic improvement of mac-
roalgae: Status to date and needs for the future. J. Appl. Phycol. 25:703–716.
Shan, T.F., S.F. Pang, J. Li et al. 2016. Breeding of an elite cultivar Haibao No. 1 of
Undaria pinnatifida (Phaeophyceae) through gametophyte clone crossing and
consecutive selection. J. Appl. Phycol. 28:2419–2426.
Shea, R. and T. Chopin. 2007. Effects of germanium dioxide, an inhibitor of dia-
tom growth, on the microscopic laboratory cultivation stage of the kelp,
Laminaria saccharina. J. Appl. Phycol. 19:27–32.
tom Dieck, I. and E.C. de Oliveira. 1993. The section Digitatae of the genus
Laminaria (Phaeophyta) in the northern and southern Atlantic: Crossing
experiments and temperature responses. Mar. Biol. 115:151–160.
Westermeier, R., D.J. Patiño, H. Müller, and D.G. Müller. 2010. Towards domestica-
tion of giant kelp (Macrocystis pyrifera) in Chile: Selection of haploid parent
genotypes, outbreeding, and heterosis. J. Appl. Phycol. 22:357–361.
Zhang, Q.S., S.C. Qu, Y.Z. Cong, S.J. Luo, and X.X. Tang. 2008. High throughput
culture and gametogenesis induction of Laminaria japonica gametophyte
clones. J. Appl. Phycol. 20:205–211.
Zhao, X.B., S.J. Pang, F. Liu et al. 2016. Intraspecific crossing of Saccharina japon-
ica using distantly related unialgal gametophytes benefits kelp farming by
improving blade quality and productivity at Sanggou Bay, China. J. Appl.
Phycol. 28:449–455.
chapter four

Cryopreservation of macroalgae
John G. Day

Contents
4.1 Introduction.............................................................................................. 79
4.2 State of the art .......................................................................................... 82
4.3 Materials ................................................................................................... 86
4.3.1 Materials required for both methods ....................................... 86
4.3.2 Materials for conventional colligative cryopreservation ....... 86
4.3.3 Materials required for a vitrification-based approach........... 87
4.4 Experimental procedures ....................................................................... 87
4.4.1 Method for conventional colligative cryopreservation.......... 87
4.4.2 Method for a vitrification-based approach .............................. 88
4.5 Notes.......................................................................................................... 90
Acknowledgment ............................................................................................. 91
References.......................................................................................................... 92

4.1 Introduction
Cryopreservation is most usually considered to be the storage of living
cells at ultra-low cryogenic temperatures, most commonly in liquid, or
vapor phase, liquid nitrogen (–196°C), and it has achieved a status of rou-
tine and confident application for many organisms (Fuller et  al. 2004).
However, in the vast majority of cases, purely plunging samples straight
into liquid nitrogen will result in total disruption of cellular and intra-
cellular architecture and function. Therefore, methodologies have been
developed, which reduce or prevent cryoinjury; these can be categorized
under two main approaches: (1) traditional controlled cooling-rate freez-
ing and (2) vitrification (Figure 4.1).
In the first approach, cells are cryoprotected using colligative, pen-
etrating cryoprotectants, often described as cryoprotective additives,
which lower the freezing point and ameliorate the damaging effects of
excessive solute concentration (Mazur, 2004). These are commonly used
in association with osmotic additives, which are sometimes applied in
a growth phase, before cryopreservation, in which the freezable water
content is reduced (Withers, 1975). Carefully regulated slow cooling is

79
80 Protocols for Macroalgae Research

Conventional Vitrification
slow cooling approaches

Culture medium Culture medium

Before
Cryoprotectant Vitrification solution
cooling
(CPA) and/or desiccation
treatment

Ice nucleation

During ∼1°C min−1 Slow cooling >100,000°C min−1 Ultra-rapid cooling

cooling (Cryodehydration)

Cryogenic
storage Storage Storage
(−196°C)

Figure 4.1   Schematic outlining the principal stages in conventional colligative

cryopreservation and vitrification.

achieved using a computer-programmed freezer, or alternatively a sol-

vent containing chiller/passive freezer, designed to have an average cool-
ing rate of approximately −1°C  min−1, may be employed. In traditional
cryogenic protocols, the cells are dehydrated as a result of a nonequilib-
rium vapor pressure gradient being formed when extracellular ice nucle-
ation has occurred. This gradient results in the movement of unfrozen
water from the inside of the cell to the extracellular space, thus reducing
the amount of freezable water within individual cells. The cells are suc-
cessfully cryopreserved when a critical balance between ice nucleation
and dehydration is achieved, such that when plunged into liquid nitro-
gen the ice crystals that are spontaneously formed are too small to cause
damage, or alternatively they form an amorphous glass. Where this is
not achieved, intracellular ice may be nucleated, and ice crystal growth
will almost inevitably occur. The resultant chemical and physical stresses
within the alga will result in severe damage to cellular architecture and
ultrastructure (Figure 4.2). Successful traditional controlled rate freezing
requires the careful application/choice of colligative cryoprotectants that
include methanol, dimethyl sulfoxide (DMSO), and glycerol (Day and
Brand, 2005) and commonly involves an empirical experimental design
approach, sequentially optimizing the various factors involved (Withers,
1975; Morris, 1976; Mazur, 2004). Success or failure to retain viability is
affected by the rate of cooling, the temperature of ice nucleation, the ter-
minal transfer temperature before exposure to liquid nitrogen, and the
holding times at these respective steps.
Chapter four: Cryopreservation of macroalgae 81

(a) (b)

Figure 4.2 Cryophotomicrograph of the coenocytic alga Vaucheria sessilis pre-

treated with 5% (w/v) DMSO cooled at −1°C min−1 to −40°C. (a) Image taken
using  phase contrast microscopy. From the top: sample at room temperature;
sample cooled to −20°C dehydrated and embedded in extracellular ice; sample
during rewarming at −6°C with mechanical damage to the tip of the bud; thawed
sample with ruptured membrane and obvious mechanical damage to the tip of
the bud. (b) Image taken using differential interference contrast (DIC) microscopy/
Nomarski microscopy. Dendritic ice crystals touching the algal thallus and induc-
ing ice nucleation within the alga, as evidenced by the presence of flashing, that is,
the formation of refractive ice crystals, which appear black under DIC.

The second approach, that is vitrification, involves the formation of a

stable glass (i.e., the solidification of a liquid in the absence of crystalliza-
tion). Complete vitrification (i.e., that of the entire system including both
the extra- and intracellular components of the sample) may be achieved
82 Protocols for Macroalgae Research

through increasing the samples’ viscosity by evaporative desiccation

(e.g., in sterile air streams or over silica gel) and/or employing osmotic
dehydration in some instances in conjunction with the use of penetrating
cryoprotectants (Harding et  al. 2004). For both higher plants and some
algae, vitrification may involve the application of multiple-component
chemical protective additives (Sakai, 2004), such as plant vitrification solu-
tion 2 (PVS2) with osmotic and/or evaporative dehydration and desicca-
tion (Fabre and Dereuddre, 1990). These procedures may include alginate
encapsulation and combinations of encapsulation–vitrification (Sakai,
2004). Vitrification has facilitated the cryopreservation of previously
cryogenic-storage recalcitrant germplasm (Engelmann and Takagi 2000;
Benson 2004) and has been successfully applied to both eukaryotic algae
and cyanobacteria (Harding et al. 2004). The process of vitrification is crit-
ically dependent on the formation of a stable glass on both cooling and
rewarming, and it is important to optimize the cryoprotective dehydra-
tion step within the natural desiccation tolerance range of the germplasm
to be cryopreserved, which may be a significant issue for aquatic organ-
isms such as algae (Harding et  al. 2010). A fundamental understanding
of the physical aspects of cryobiology may assist in developing improved
cryoprotection strategies, and the use of analytical approaches such as
differential scanning calorimetry may enable the precise profiling of
water-phase behavior in tissues (Dumet et al. 2000; Harding et al. 2004).

4.2 State of the art

Over the past 40  years, cryopreservation has been employed by algal
Biological Resource Centers (BRCs) to conserve their holdings of micro-
algae (Morris 1976; Watanabe et al. 1992; Bodas et al. 1995; Wood et al.
2008), although today well in excess of the >3000 strains conserved in
the COBRA project (Day et al. 2005) are held by collections worldwide
in a cryopreserved state, many taxa remain recalcitrant to conventional
cryopreservation methodologies. However, to date, relatively very few
macroalgae have been held by collections in this format (Heesch et al.
2012), although there is considerable potential to do so. This section pro-
vides an overview of the current status of macroalgal cryopreservation,
and Table 4.1 summarizes exemplar methodologies that have been suc-
cessfully applied. It is clear from the relatively limited literature that
there is, in some cases, a lack of understanding of the basic principles
of cryopreservation, and to some extent, this may explain some of the
problems that have been observed. For example, where materials are
held at high subzero temperatures, samples will not remain in a vitre-
ous state, so over time, ice crystal formation and growth will undoubt-
edly result in damage at a cellular level. This will inevitably reduce
the capacity of any sample to revive and regenerate a normal thallus.
 Table 4.1 Reports of successful cryopreservation of macroalgae with storage at −196°C
Alga Procedure Storage duration Reported viabilitya Reference
Chapter four:

Undaria pinnatifida Conventional two-step 9 days Survival Arbault et al. 1990

(gametophytes) cooling + cryoprotective
additives (CPA)
Porphyra yezoensis Conventional two-step Up to 300 days 60% Kuwano et al. 1993
cooling + CPA
Porphyra linearis Conventional two-step 20 min at −196°C up to 70% Arbault and Delanoue,
cooling + CPA 1994
Porphyra miniata Conventional two-step Long-term storage Viable Day, 1998
cooling + CPA (>10 years)
Vegetative thalli (apical tips) Conventional two-step Viable, regeneration Lalrinsanga et al. 2009
of: cooling + CPA of thalli
Gracilaria corticata
Cryopreservation of macroalgae

Ulva lobata Hypnea musiformis

Gametophytic thalli of Ulva Conventional two-step 120 days >90% Lee and Nam, 2016
prolifera cooling + CPA
Laminaria japonica spores Conventional two-step 24 h 50% Zhang et al. 2007
cooling + CPA
Ectocarpus thalli and spores Conventional two-step 1 month 5%–50% Heesch et al. 2012
cooling + CPA
Female gametophytic cells of: Conventional two-step >12 h 5%–53% Kuwano et al. 2004
Laminaria japonica cooling + wide range of
CPA
(Continued)
83
 84

Table 4.1 (Continued) Reports of successful cryopreservation of macroalgae with storage at −196°C
Alga Procedure Storage duration Reported viabilitya Reference
L. longissima 37%–60%
Kjellmaniella crassifolia 8%–67%
Ecklonia stolonifera 28%–60%
E. kurome 1%–42%
Undaria pinnatifida 1%–60%
Gametophytic cells of Eisenia Conventional two-step 200 days 27% Male Kono et al. 1998
bicyclis cooling + CPA 31% female
Gametophytes of Undaria Conventional two-step Renard et al. 1992
pinnatifida cooling + CPA
Sporelings and apical Conventional two-step >1 h 0%–93% van der Meer and
segments of mature thalli of cooling + CPA Simpson, 1984
the marine red alga Gracilaria
tikvahiae
Gracilaria foliifera Thallus 36%
Sporelings 43%
Devaleraea ramentaceae Thallus 100%
Sporelings 100%
Palmaria palmata Thallus 100%
Sporelings 100%
Chondrus crispus Thallus 70%
Sporelings 86%
Ulva lactuca Thallus 100%
(Continued)
Protocols for Macroalgae Research
 Chapter four:

Table 4.1 (Continued) Reports of successful cryopreservation of macroalgae with storage at −196°C
Alga Procedure Storage duration Reported viabilitya Reference
Enteromorpha intestinalis Conventional two-step >1 week 100% Fleck, 1998
thallus cooling + CPA
Gametophytic thalli of One-step plunge in >80% Choi et al. 2013
Porphyra yezoensis cryostraw + CPA
Protoplasts of Porphyra Conventional vitrification 2 days 67% Liu et al. 2004
yezoensis with a range of
vitrification solutions
Undaria pinnatifida Encapsulation 31% Male Wang et al. 2011
gametophytes dehydration with PVS2, 26% female
Cryopreservation of macroalgae

vitrification
Gametophytes of Laminaria Encapsulation 25%–75% Vigneron et al. 1997
digitata dehydration in sucrose
followed by slow cooling
then plunge
a In many cases, these data are on the basis of positive assessment using a vital and/or a mortal stain to differentiate between live and dead cells
rather than the capacity of individual spores, cells, or thalli to regrow. The available data are from samples assessed at least 24 h after thawing/
rewarming, as materials immediately post-thaw will inevitably provide an overestimate of viability levels.
85
86 Protocols for Macroalgae Research

The author has observed this phenomenon for a range of eukaryotic

algal taxa stored at temperatures of −80°C and higher (unpublished
data). This has also been reported by Taylor and Fletcher (1999) who
stored Enteromorpha intestinalis spores for up to five weeks at −20°C.
There are a number of similar reports in the literature summarized
by Taylor and Fletcher (1998), but the majority of these involved short-
term storage, usually in the order of days, and it is, from the authors
experience, unlikely that samples stored at high subzero temperatures
would remain viable for longer than a few months. These reports and
more recent papers, including Zhuang et  al. (2015), who successfully
stored filaments of the brown alga, Scytosiphon lomentaria, for a month
at −20°C, have been omitted from Table 4.1.

4.3 Materials
4.3.1 Materials required for both methods
• Incubator/growth cabinet, a class I biological safety cabinet/laminar
flow cabinet
• Appropriate cryosafety personal protective equipment, including
goggles/face shield/visor, gloves (rated for liquid nitrogen emer-
sion), and long cryo apron
• Disposable pipettes/disposable plastic Pasteur pipettes (PastettesTM)
• 2 mL cryogenic tubes
• A small (~1 L) dewar
• A heated water bath
• Storage cryostat/refrigerator with an appropriate inventory
system
• Long forceps
• Culture medium: Modified Provasoli, f/2, or another appropriate
medium
• 70% (v/v) ethanol
• Liquid nitrogen

4.3.2 Materials for conventional colligative cryopreservation

• A programmable, controlled rate cooler, or alternatively a passive
cooling unit and a −80°C freezer (Note 1)
• Cryoprotectant solutions: 10% (v/v) DMSO and 9% (v/v) d-sorbitol in
an appropriate culture medium
• Plasticware: membrane filters (0.5 µm pore size)
• Petri dishes (5 cm diameter)
• Universal tubes (20 mL)
Chapter four: Cryopreservation of macroalgae 87

4.3.3 Materials required for a vitrification-based approach

• Alginate (5% w/v) encapsulation solution is made from Sigma low-
viscosity (3%) sodium salt. The alginate solution is prepared in
preheated (60°C) culture medium in a 250 mL Schott bottle; 5 g of
sodium alginate is directly added to the bottle containing deionized
water (which should contain a magnetic stirring rod). The bottle
contents are vigorously shaken (not stirred) until the alginate is wet
(it will not completely dissolve) and thoroughly dispersed in the
solution. Autoclave the alginate 121°C for 15 min. Remove the bottle
between 80°C and 100°C and place it on a magnetic stirrer until the
alginate dissolves (this can be overnight).
• Calcium chloride (100 mM) solution is prepared in deionized water.
• Sucrose (0.5 and 0.75 M) dehydration medium is made in the appro-
priate culture medium.
• Sterile 9 cm filter papers.
• Sterile 9 cm Petri dishes.
• Multiwell recovery plates (Biddy Sterilin Ltd., 100 mm square Petri
dish, or equivalent).
• Sterile forceps.
• Heated magnetic stirrer.
• Oven for determining dry weights (set at 105°C).
• Thermometer and humidity meter (optional).

4.4 Experimental procedures

4.4.1 Method for conventional colligative cryopreservation
The method outlined below is based on Heesch et al. (2012) and has been
successfully employed at the Culture Collection of Algae and Protozoa
(CCAP) for a number of different macroalgal taxa. As for all cryopreser-
vation procedures, it is normally optimal to employ a healthy, vigorous,
relatively dense, late log phase or early stationary phase, and cultures.
Furthermore, if available axenic strains, or those with low levels of bac-
terial contaminants should be used and, those contaminated with other
eukaryotes should be avoided.

1. One to two weeks before cryopreservation separate thalli into

smaller pieces (approximately 1–2  mm in length). Then transfer to
Erlenmeyer flasks containing 100 mL of culture medium under the
same culture conditions (Note 2).
2. Prepare 10 mL aliquots of cryoprotectant solution (10% [v/v] DMSO
and 9% [v/v] d-sorbitol in the appropriate culture medium) and
filter-sterilize into a sterile universal tube.
88 Protocols for Macroalgae Research

3. Aseptically transfer 1 mL aliquots of sterilized cryoprotectant

solution into 2 mL cryovials.
4. Aseptically transfer intact sections of thalli to each cryovial, seal the
cryovials, and incubate for 15–30 min at room temperature (Note 3).
5. Program the controlled cooler: Start temperature 20°C; ramp, cool at
−1°C min−1 to −40°C; dwell, hold at −40°C for 10 min (Notes 1 and 4).
6. Start the program to purge the system with nitrogen vapor and to
allow the system to stabilize at the start temperature.
7. On reaching the start temperature (most systems have an audible
alarm), transfer the cryovials to the cooling chamber of the pro-
grammable cooler and initiate the cooling ramp.
8. After the end of the program, an alarm will sound; rapidly transfer
the cryovials to a small dewar containing liquid nitrogen using long
forceps (Note 5).
9. Samples for storage should be transferred to the cryostat (ultra-cold
freezer) in the liquid nitrogen containing dewar. Transfer of cryovi-
als to the storage system should be performed rapidly using long
forceps (Note 6).
10. To recover cultures, vials are thawed by placing in a preheated water
bath (40°C) and agitated until the last ice crystal has just melted
(Note 7).
11. On thawing, rapidly transfer to a laminar flow/biological safety cab-
inet and wipe the outside of the vial with 70% (v/v) ethanol (Note 8).
12. By using a disposable plastic pipette (Pastette), the cryoprotectant
solution is aseptically removed, discarded, and replaced by 1 mL of
fresh sterile medium. The thallus is then aseptically transferred to a
labeled Petri dish containing 10 mL of an appropriate medium. Then
cover in aluminum foil and relabel with the strain designation and
date (Note 9).
13. Incubate at the standard culturing temperature for the cryopre-
served organism; after 24  h, partially remove the foil and after a
further 24–96 h, remove all the foil covering (Note 10).
14. After one week, by using standard aseptic techniques, replace the
medium (see Note 11).
15. After an appropriate period (2–8  weeks, depending of the strain),
a normal culture should be obtained. This may be maintained by
routine serial transfer, or employed for experimental use.

4.4.2 Method for a vitrification-based approach

The below-mentioned method outlined is based on Harding et al. (2008)
and has been successfully employed for a large number of different micro-
algal taxa (Elster et al. 2008; Harding et al. 2008; Lukešová et al. 2008), as
Chapter four: Cryopreservation of macroalgae 89

well as for Laminaria gametophytes at the CCAP. In addition, the prin-

ciples involved and the methodology are very similar to the method of
Vigneron et  al. (1997) who successfully cryopreserved gametophytes of
L. digitata using this approach.

1. One to two weeks before cryopreservation, separate thalli into

smaller pieces (approximately 1  mm in length). Then transfer to
Erlenmeyer flasks containing 100 mL of culture medium, under the
same culture conditions (see Note 2).
2. Remove the supernatant and add ~10 mL of 5% (w/v) alginate (see
Note 12).
3. Gently swirl the mixture of algae and alginate to evenly distribute
the sections of thalli, but ensure that air bubbles are not formed.
4. By using a disposable sterile plastic Pastette and holding it in a
vertical position, slowly dispense the alginate/algal solution drop-
wise into a 150 mL of 100 mM CaCl 2 and allow the beads to equili-
brate for 60 min.
5. Carefully, decant off the calcium solution and transfer the beads to
0.5 M sucrose in culture medium to osmotically dehydrate the cells
for 24 h (under standard light and temperature conditions).
6. Decant this medium and replace with 0.75  M sucrose in culture
medium for another 24  h (under standard light and temperature
conditions).
7. Remove the beads from the preculture sucrose solution and remove
excess liquid sucrose medium by blotting the surface of the beads on
sterile filter (7–8 cm) papers placed on Petri dishes.
8. Transfer the beads to sterile Petri dishes (9 cm) ensuring that they
are not touching each other and that they are evenly distributed
throughout the dish.
9. Place the open Petri dishes with the beads (closest to the air source)
in a horizontal flow laminar airflow cabinet. Note and monitor the
temperature (~25°C optimum) and laboratory relative humidity.
10. Air-dry the beads in the airflow (~1 m s−1) for 3 to 4 h. This normally
results in beads with a residual moisture content of ~25%–30% (w/w)
(Note 13).
11. Transfer the desiccated beads into cryovials (10 beads per cryovials)
and plunge directly into liquid nitrogen in a 1 L dewar.
12. Samples for storage should be transferred to the cryostat (ultra-cold
freezer) in the liquid nitrogen containing dewar. Transfer of cryovi-
als to the storage system should be performed rapidly using long
forceps (Note 6).
13. Remove samples from the storage dewar; if necessary, transport
them in a small dewar containing liquid nitrogen to the lab. Then
rapidly remove the cryovials and place them in a heated water bath
90 Protocols for Macroalgae Research

(+40°C) to rewarm for 2–3 min (do not completely cover the cryovials
in water). Carefully, wipe the cap and tube with a tissue containing
70% ethanol to ensure sterile conditions.
14. Transfer the (now very sticky) beads from the cryovial (with a small
spoon spatula) to 5  mL of culture medium for 1  h (for bead pre-
swelling and rehydration), and then transfer each bead (10 beads
per cryovial) into one square of the (5 × 5 squares) Petri dish (Biddy
Sterilin, or equivalent), with each square containing 1  mL of fresh
medium. Alternatively, place beads in a small Petri dish containing
fresh sterile medium. Then cover in aluminum foil and relabel with
strain designation and date (Note 9).
15. Incubate under the standard culturing temperature for the cryo-
preserved organism; after 24  h, partially remove the foil, and
after another 24–96 h, remove all the foil coverings (Notes 10 and 14).
16. After one week, using standard aseptic techniques, replace the
medium (Note 11).
17. After an appropriate period (2–8  weeks, depending of the strain),
a normal culture should be obtained. This may be maintained by
routine serial transfer, or employed for experimental use.

4.5 Notes
Note 1: Alternatively, for many materials, a passive freezer unit such as
Mr FrostyTM may be used. These units have usually been designed to
have a nonlinear cooling rate of ~1°C min−1 when placed in a −80°C
freezer. Follow the manufacturer’s instructions provided as these
may vary between units.
Note 2: Exchange culture medium once a week prior to cryopreserva-
tion, to maximize culture quality and minimize the bacterial num-
bers in nonaxenic strains. This is to prevent overgrowth of the alga
by bacteria stimulated by nutrient released on cutting the algal thalli.
All algae interact both positively and negatively with their associated
bacterial flora. For some taxa, if the associated flora are removed,
altered, or diminished, growth and phenotypic abnormalities may
be observed (Wichard and Oertel, 2010; Spoerner et al. 2012).
Note 3: At the CCAP, 15 vials are normally filled and processed (see
Note 6).
Note 4: In general, mechanical seeding of ice has not been used for
algal cryopreservation, but if it is an option in the system employed,
empirical experimentation may be used to ascertain if it results in
higher post-thaw viability.
Note 5: It is essential that the cryovials are not allowed to warm up
before plunging into liquid nitrogen.
Chapter four: Cryopreservation of macroalgae 91

Note 6: Storage temperature is critical and should be <−130°C. It is

advisable that replicate samples are stored in at least two separate
refrigerators. At CCAP, 10 cryovials are normally stored in a working
bank, 2 vials are stored in a master/backup bank, and 3 are used to
check viability/efficacy of the protocol.
Note 7: For most marine taxa, it is important not to prolong their incuba-
tion at 40°C. Alternatively, slower warming, for example, in a 25°C
water bath may be beneficial for some strains, but in general rapid
warming is optimal as it avoids/minimizes ice crystal regrowth.
Note 8: There may be high levels of viable bacterial and fungal spores in
liquid nitrogen that may contaminate recovered cultures.
Note 9: It is optimal to prevent further biochemical-based injuries; to do
this as standard practice is to incubate revived samples for a period
in the dark.
Note 10: It is important to ensure that cells are not subjected to light
levels likely to induce photo-oxidative stress during the recovery
phase.
Note 11: Because of the lysis of cells killed by the cryopreservation
procedure, it is necessary to exchange culture medium after a
week to reduce the bacterial numbers in nonaxenic strains. For
more heavily bacterized cultures, this should be done more
frequently to maximize the possibility of recovering a healthy
culture.
Note 12: For freshwater taxa, one makes up the alginate in the appro-
priate medium; however, for marine strains, the high levels of
Na+ in the medium prevent gelation, and as a result, the bead
formation and strength is poor, so alginate is prepared in deion-
ized water.
Note 13: The level of dehydration is critical to the formation of a stable
glass; if residual moisture levels significantly exceed 30%, the mate-
rial will not successfully vitrify.
Note 14: On incubation, the high levels of Na+ in marine media will
result in depolymerization of the calcium alginate, and the beads
will soften and eventually disintegrate releasing the encapsu-
lated alga.

Acknowledgment
The author acknowledges National Capability funding from the UK
Natural Environment Research Council for the CCAP. In addition, he
would like to thank Roland Fleck (King’s College London) for provid-
ing the images used in Figure 4.2 and Rachel Saxon (SAMS) for technical
assistance in creating the figure.
92 Protocols for Macroalgae Research

References
Arbault, S. and Delanoue, G. 1994. Cryopreservation of Porphyra linearis
Conchocelis phase. Cryptogamie Algologie 15:65–72.
Arbault, S., Renard, P., Perez, R., and Kaas, R. 1990. Cryopreservation trials on
gametophytes of the food alga Undaria pinnatifida (Laminariales). Aquatic
Living Resources 3:207–215.
Benson, E. E. 2004. Cryoconserving algal and plant diversity: Historical perspec-
tives and future challenges. In Life in the Frozen State, B. Fuller, N. Lane, and
E. E. Benson (Eds.), pp. 299–328. Boca Raton, FL: CRC Press.
Bodas, K., Brennig, C., Diller, K. R., and Brand, J. J. 1995. Cryopreservation of blue-
green and eukaryotic algae in the culture collection at the University of
Texas at Austin. CryoLetters 16:267–274.
Choi, Y. H., Nam, T. J., and Kuwano, K. J. 2013. Cryopreservation of gametophytic
thalli of Porphyra yezoensis (Rhodophyceae) by one-step fast cooling. Journal
of Applied Phycology 25:531–546.
Day, J. G. 1998. Cryo-conservation of microalgae and cyanobacteria. CryoLetters
Supplement 1:7–14.
Day, J. G., Benson, E. E., Harding, K., Knowles, B., Idowu, M., Bremner, D.,
Santos, F. et al. 2005. Cryopreservation and conservation of microalgae: The
development of a pan-european scientific and biotechnological resource
(the COBRA project). CryoLetters 26:231–238.
Day, J. G. and Brand, J. J. 2005. Cryopreservation methods for maintaining cultures.
In Algal Culturing Techniques, R. A. Andersen (Ed.), pp. 165–187. New York:
Academic Press.
Dumet, D. J., Block, W., Worland, R., Reed, B. M., and Benson, E. E. 2000. Profiling
cryopreservation protocols for Ribes ciliatum using differential scanning
calorimetry. CryoLetters 21:367–378.
Elster, J., Lukavský, J., Harding, K., Benson, E. E., and Day, J. G. 2008. Deployment
of the encapsulation/dehydration protocol to cryopreserve polar micro-
algae held at the Czech Republic academy of sciences institute of botany.
CryoLetters 29:27–28.
Engelmann, F. and Takagi, T. 2000. Cryopreservation of Tropical Plant Germplasm;
Current Research Progress and Application. JIRCAS International Agriculture
Series No. 8. Rome, Italy: IPGRI.
Fabre, J. and Dereuddre, J. 1990. Encapsulation-dehydration: A new approach to
cryopreservation of potato shoot-tips. CryoLetters 11:413–426.
Fleck, R. A. 1998. The Assessment of Cell Damage and Recovery in Cryopreserved
Freshwater Protists. PhD thesis. Dundee, Scotland: University of the Abertay
Dundee.
Fuller, B., Lane, N., and Benson, E. E. 2004. Life in the Frozen State. Boca Raton, FL:
CRC Press.
Harding, K., Day, J. G., Lorenz, M., Timmerman, H., Friedl, T., Bremner, D. H., and
Benson, E. E. 2004. Introducing the concept and application of vitrification
for the cryo-conservation of algae- a mini-review. Nova Hedwigia 79:207–226.
Harding, K., Müller, J., Lorenz, M., Timmerman, H., Friedl, T., Day, J. G., and
Benson, E. E. 2008. Deployment of the encapsulation/dehydration proto-
col to cryopreserve microalgae held at SammLung von Algenkulturen,
Universität Göttingen Germany. CryoLetters 29:15–20.
Chapter four: Cryopreservation of macroalgae 93

Harding, K., Müller, J., Timmermann, H., Lorenz, M., Day, J. G., and Friedl, T. 2010.
The use of amplified fragment length polymorphism (AFLP) markers to
verify the identity and genetic stability of euglenoids cryopreserved using
encapsulation dehydration cryoprotective strategies. CryoLetters 31:460–472.
Heesch, S., Day, J. G., Yamagishi, T., Kawai, H., and Küpper, F. C. 2012.
Cryopreservation of the model alga Ectocarpus (Phaeophyceae). CryoLetters
33:327–336.
Kono, S., Kuwano, K., and Saga, N. 1998. Cryopreservation of Eisenia bicyclis
(Laminariales, Phaeophyta) in liquid nitrogen. Journal of Marine Biotechnology
6:220–223.
Kuwano, K., Argua, Y., and Saga, N. 1993. Cryopreservation of the conchocelis of
the marine alga Porphyra yezoensis Ueda (Rhodophyta) in liquid nitrogen.
Plant Science 94:215–225.
Kuwano, K., Kono, S., Jo, Y. H., Shin, J. A., and Saga, N. 2004. Cryopreservation
of the gametophytic cells of Laminariales (Phaeophyta) in liquid nitrogen.
Journal of Phycology 40:606–610.
Lalrinsanga, P. L., Deshmukhe, G., Chakraborty, S. K., Dwivedi, A., Barman, N.,
and Kumar, N. 2009. Preliminary studies on cryopreservation of vegetative
thalli of some economically important seaweeds of India. Journal of Applied
Aquaculture 21:250–262.
Lee, Y. N. and Nam, K. W. 2016. Cryopreservation of gametophytic thalli of Ulva
prolifera (Ulvales, Chlorophyta) from Korea. Journal of Applied Phycology
28:1207–1213.
Liu, H. Q., Yu, W. G., Dai, J. X., Gong, Q. H., Yang, K. F., and Lu, X. Z. 2004.
Cryopreservation of protoplasts of the alga Porphyra yezoensis by vitrifica-
tion. Plant Science 166:97–102.
Lukešová, A., Hrouzek, P., Harding, K., Benson, E. E., and Day, J. G. 2008.
Deployment of the encapsulation/dehydration protocol to cryopreserve
diverse microalgae held at the Institute of Soil Biology, Academy of Sciences
of the Czech Republic. CryoLetters 29:21–26.
Mazur, P. 2004. Principles of cryobiology. In Life in the Frozen State, B. Fuller,
N. Lane, and E. E. Benson (Eds.), pp. 3–66. Boca Raton, FL: CRC Press.
Morris, G. J. 1976. The Cryopreservation of Chlorella 1. Interactions of cooling, pro-
tective additive and warming rate. Archives of Microbiology 107:57–62.
Renard, P., Arbault, S., Kaas., R., and Perez, R. 1992. A method for the cryo-
preservation of the gametophytes of the food alga Undaria pinnatifida
(Laminariales). Comptes Rendus De I Academie des Science Serie III Life
Science 315:445–451.
Sakai, A. 2004. Plant cryopreservation. In Life in the Frozen State, B. Fuller, N. Lane,
and E. E. Benson (Eds.), pp. 329–346. Boca Raton, FL: CRC Press.
Spoerner, M., Wichard, T., Bachhuber, T., Stratmann, J., and Oertel, W. 2012.
Growth and thallus morphogenesis of Ulva mutabilis (Chlorophyta) depends
on a combination of two bacterial species excreting regulatory factors.
Journal of Phycology 48:1433–1447.
Taylor, R. and Fletcher, R. L. 1998. Cryopreservation of eukaryotic algae—A
review of methodologies. Journal of Applied Phycology 10:481–501.
Taylor, R. and Fletcher, R. L. 1999. A simple method for the freeze-preservation of
zoospores of the green macroalga Enteromorpha intestinalis. Journal of Applied
Phycology 11:257–262.
94 Protocols for Macroalgae Research

van der Meer, J. P. and Simpson F. J. 1984. Cryopreservation of Gracilaria tikvahiae

(Rhodophyta) and other macrophytic marine algae. Phycologia 23:195–202.
Vigneron, T., Arbault, S., and Kaas, R. 1997. Cryopreservation of gametophytes of
Laminaria digitata (L) lamouroux by encapsulation dehydration. CryoLetters
18:93–98.
Wang, B., Zhang, E., Gu, Y., Ning, S., Wang, Q., and Zhou, J. 2011. Cryopreservation
of brown algae gametophytes of Undaria pinnatifida by encapsulation–
vitrification. Aquaculture 317:89–93.
Watanabe, M. M., Shimizu, A., and Satake, K. 1992. NIES-microbial culture col-
lection at the national institute of environmental studies: Cryopreservation
and database of culture strains of microalgae. In Proceedings of Symposium on
Culture Collection of Algae, M. M. Watanabe (Ed.), pp. 33–42. Tsukuba, Japan:
NIES.
Wichard, T. and Oertel, W. 2010. Gametogenesis and gamete release of Ulva muta-
bilis and Ulva lactuca (Chlorophyta): Regulatory effects and chemical charac-
terization of the “swarming inhibitor.” Journal of Phycology 46:248–259.
Withers, L. A. 1975. Freeze-preservation of cultured cells and tissues. In Frontiers
of Plant Tissue Culture, T. A. Thorpe (Ed.), pp. 297–306. Calgary, Alberta:
International Association of Plant Tissue Cultures, University of Calgary.
Wood, S. A., Rhodes, L. L., Adams, S. L., Smith, J. F., Tervit, H. R., and Cary S. C.
2008. Maintenance of cyanotoxin production by cryopreserved cyanobacte-
ria in the New Zealand culture collection. New Zealand Journal of Marine and
Freshwater Research 42:277–283.
Zhang, Q. S., Cong, Y. Z., Qu, S. C., Luo, S. J., Li, X. J., and Tang, X. X. 2007. A simple
and highly efficient method for the cryopreservation of Laminaria japonica
(Phaeophyceae) germplasm. European Journal of Phycology 42:209–213.
Zhuang, Y., Gong, X., Zhang, W., and Gao, W. 2015. Cryopreservation of fila-
ments of Scytosiphon lomentaria by vitrification. Journal of Applied Phycology
27:1337–1342.
chapter five

Unraveling seaweeds bacteriomes

From field site to computer screen
Tânia Aires, Gerard Muyzer, Ester A. Serrão,
and Aschwin H. Engelen

Contents
5.1 Introduction ............................................................................................. 95
5.2 State of the art .......................................................................................... 97
5.3 Materials................................................................................................. 100
5.4 Experimental procedures .................................................................... 100
5.4.1 Sampling .................................................................................... 100
5.4.2 DNA extraction ......................................................................... 101
5.4.3 16S rRNA amplification............................................................ 102
5.4.4 16S rRNA amplicon sequencing data analysis ..................... 103
5.4.5 Functional prediction based on 16S rRNA gene
sequencing ................................................................................. 105
5.5 Notes ....................................................................................................... 108
Acknowledgments ..........................................................................................110
References.........................................................................................................110

5.1 Introduction
Evidence shows that marine macroalgae (seaweeds) rely on their associated
microbiome for basic functions, such as growth, development, nutrient sup-
ply, protection, and, in some cases, adaptation and acclimation to environ-
mental stresses (Singh and Reddy 2014; Wichard 2015; Dittami et al. 2016).
The term holobiont was first coined for corals because of their dependency
on associated microbes for survival (Rosenberg et al. 2007), but empirical
evidence broadened this term to other organisms, such as seaweeds (Barott
et al. 2011). It is now widely recognized that it is essential to consider the
entire holobiont (i.e., the host and its associated microbiota) to understand
how seaweeds adapt and evolve (Singh and Reddy 2014; Dittami et al. 2016).

95
96 Protocols for Macroalgae Research

The use of state-of-the-art molecular techniques as high throughput 16S

rRNA amplicon sequencing and omics allow not only to reveal the impor-
tance of seaweed–bacteria interactions but also to explore the role of the
different community players in seaweeds ecology and evolution.
Regardless of their location (surface biofilm, endophytically, or both),
seaweed-associated bacteria have been shown to be primarily determined
by host species (Lachnit et  al. 2009; Eigemann et  al. 2013; Aires et  al.
2015; Aires et al. 2016; Vieira et al. 2016). A continental-scale study of the
bacterial community associated with the dominant kelp Ecklonia radiata
(Marzinelli et al. 2015) displayed variations along the latitudinal distribu-
tion. Host health conditions were shown to be determining in shaping
this kelp’s bacterial community, suggesting that stress can disrupt this
stable bacteria/host association. Other biotic (e.g., disease and herbivory)
and abiotic factors influence seaweed-associated bacterial communities.
Local environment factors, such as pollution and/or contamination, can
impact the associated bacterial guild: A shift to bacterial taxa related to
hydrocarbon degradation and heavy metals detoxification was associ-
ated with the invasive species Asparagopsis taxiformis growing in polluted
waters (Aires et al. 2016).
Seaweed-associated bacterial assemblages are also not temporally
fixed. Studies on brown seaweeds (Laminaria hyperborea by Bengtsson
et al. 2010 and Fucus vesiculosus by Stratil et al. 2013) have shown changes
across seasons. Those changes can be related to, for example, seawater
temperature, which may influence the antifouling capacity of the seaweed
and result in some unwanted pathogenic associations (Stratil et al. 2013),
or to the growth cycle of the seaweed in which the aging process leads to
a mature and more diverse biofilm (Bengtsson et al. 2010, Mancuso et al.
2016). Hence, the seaweed-associated bacterial community is the result
of several interacting factors whereby host phylogeny takes the lead, but
environment and geography may change the way (Hollants et al. 2013).
The vital importance of seaweed-associated bacterial communities has
also been demonstrated in experimental studies in which manipulation
revealed their determining role in seaweed development and adaptation/
acclimation (Matsuo et  al. 2005; Dittami et  al. 2016). The normal devel-
opment and morphogenesis of most Ulvales is, for example, dependent
on bacteria from the Cytophaga–Flavobacterium–Bacteroides group (Matsuo
et  al. 2005; Spoerner et  al. 2012; Weiss et  al. 2017), and the capacity of
Ectocarpus to cope with transitions from salt to freshwater is lost in the
absence of its associated bacterial community (Dittami et al. 2016). These
(and several others) studies provide empirical evidence on how microbes
can be essential to algae, impacting their development, physiological
response, metabolism regulation, and adaptation to different environ-
ments. The importance of seaweed-associated bacteria probably goes
beyond the immediate effects; their role on driving/facilitating speciation
Chapter five: Unraveling seaweeds bacteriomes 97

is now being considered in evolutionary studies, and this has also raised
interest from the seaweed industry (Charrier et  al. 2017). The way sea-
weed–bacterial associations are established and how microbial recruit-
ment is initiated is still an ongoing discussion. The most accepted theory
relies on a combination of stochastic processes and niche selection consis-
tent with the competitive lottery model as proposed by Burke et al. (2011).
In Burke’s study, bacterial community taxonomic structure was different
between samples and over time but functionally equivalent. Thus, it is
proposed that a set of functional characteristics is required to allow colo-
nization of a certain niche (in this case, the seaweed itself and its own
niche) and that determines which bacteria are recruited from the available
guild. But the specific phylogenetic shifts directly related to environmen-
tal stresses remain to be explained; experimental studies are needed to
fully understand the recruitment process.
Besides their invaluable ecological role as habitat-structuring spe-
cies, seaweeds are rich in biologically active compounds, which led to
their exploitation in several economical areas, including their use as food
resource (Gupta and Abu-Ghannam 2011), source of medicinal and phar-
maceutical components (Smit 2004), and antifouling properties (Qian
et al. 2010). Seaweed-associated microbiome studies can improve seaweed
aquaculture by increasing productivity and fitness (Singh and Reddy
2016) and by preventing diseases, just as manipulation of bacteria associ-
ated with human gut and crops can improve human health and agricul-
tural yield, respectively.
The growing need to understand these vital interactions and the role
played by bacterial communities on seaweed evolution, adaptation, and
development has promoted development of laboratory and informatics
techniques. In the past decades, next-generation sequencing (NGS) and
powerful bioinformatic tools allowed one to unveil the previously hidden
world of seaweeds.

5.2 State of the art

The study of seaweed–bacteria associations and their main drivers goes
back to the early 1970s when culturing and microscopy techniques already
detected species, tissues, and seasonal-specific associations (Bolinches et al.
1988 and Cundell et al. 1977 in Egan et al. 2013). The obvious advantage of
culturing is the possibility of sequencing the complete genome of bacteria
of interest and to perform manipulative studies to provide information
about their ecological roles and the understanding of their interactions
(Allen-Vercoe 2013). However, standard culturing techniques applied
to environmental samples generally only provide about 1% of the real
bacterial diversity, and those numbers just go slightly up when specific
conditions are applied to specific environments (Riesenfeld et  al. 2004).
98 Protocols for Macroalgae Research

Yet, when allied to microscopy, these early techniques managed to reveal

important seaweed/bacteria associations as the famous endosymbiotic
bacteria found in Caulerpa taxifolia, allowing seaweed survival in oligo-
trophic environments. These endosymbionts collaborate with biofilm bac-
teria from the rhizoids, which take up carbon, nitrogen, and phosphorus
from the substrata and translocate their products to the photoassimilatory
organs (Chisholm et  al. 1996). The development of culture-independent
methods revealed an amazing diversity of the microbial world, and more
than half of the recognized microbial phyla have no cultured represen-
tatives (Riesenfeld et  al. 2004). The most popular culture-independent
technique is PCR amplification, cloning, and sequencing of the 16S rRNA
gene, a phylogenetic powerful marker that allowed recognition of the
bacterial diversity as known today (Schäfer and Muyzer 2001). However,
when studying seaweed-associated bacterial communities, as mentioned
earlier, different factors should be considered. The inclusion of seasonal
and environmental dynamics and spatial variation in studies of seaweed-
associated microbial communities will result in an enormous number of
samples to be analyzed. So, cloning and sequencing of 16S rRNA genes, a
laborious and time-consuming method, are not the best choice to analyze
such a large number of samples (Schäfer and Muyzer 2001). With these
limitations, the genetic fingerprinting techniques emerged, and several
seaweed-associated bacteria were characterized mainly through dena-
turing gradient gel electrophoresis (DGGE) and terminal restriction fragment
length polymorphism (T-RFLP) (See e.g., Meusnier et al. 2001; Delbridge et al.
2004; Burke et al. 2009; Bengtsson et al. 2010; Nylund et al. 2010; Tujula et al.
2010; Hollants et al. 2011; Lachnit et al. 2011). Still, there are some drawbacks
associated with fingerprinting techniques. Besides the higher number of
replicates required for accuracy and reproducibility, a bias towards the
most abundant taxa, which likely hides less abundant ones, is observed.
Results/banding pattern interpretation can also be dubious and difficult.
With the emergent necessity of getting a more complete picture of the
seaweed holobiont, state-of-the-art high-throughput techniques known
as omics have been widely used in the latest seaweed holobiont studies.
Along with powerful bioinformatics tools and data storage, massive
16S rRNA amplicon pyrosequencing, metagenomics, metatranscrip-
tomics, metaproteomics, and metabolomics (see Figure 5.1 for a complete
description) are widely applied. The isolated use and integration of these
new techniques allow one to answer the questions “Who is there? What
are they doing? How do they do it?” in a more reliable way, increasing
our knowledge on the identity and functionality of seaweed-associated
microbiomes.
In the current chapter, we describe the methodologies from field
sampling to the comprehensive in silico analysis of seaweed-associated
 PCR
16S rRNA amplicon sequencing
454, Illumina MiSeq

Bacteria diversity

on
Metagenomics

cti
ra
Direct Pyrosequencing, Illumina

t
ex
sequencing MiSeq/HiSeq

A
DN
RNA extraction
Metatranscriptomics
HiSeq
Protein extraction
Bacteria potentiality

To ex
Metaproteomics

m
ta tra
l c ac
Holobiont IEF, SDS-page,

o ti
Bacteria functionality

un
mass spectrometry

po on
(seaweed+associated microbiome)

ds
Metabolomics
NMR,
mass spectrometry
activity
Bacteria
Chapter five: Unraveling seaweeds bacteriomes

Figure 5.1  Schematic diagram representing the different metaomics techniques and respective outputs, used to uncover seaweed
microbiome identity/diversity, potentiality, functionality, and activity. 16S amplicon sequencing, metagenomics, and metatranscrip-
tomics analyses can be achieved using 454 Roche GS FLX+ and Illumina (Mi-Seq or Hi-Seq) sequencing methods. Subsequently,
software programs such as QIIME and Mothur can be used for bacterial community diversity studies, whereas MG-RAST, IMG/M,
METAREP, CAMERA, and MEGAN4 can be used for metagenomes’ functional annotation. Metaproteomic data can be analyzed by
isoelectric focusing (IEF), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE), matrix-assisted laser desorption/
ionization time-of-flight mass spectrometry (MALDI–TOF–MS), and liquid chromatography–mass spectrometry (LC–MS). Bacterial
activity (metabolome) can be assessed by nuclear magnetic resonance spectroscopy and diverse mass spectrometry methods. Here
we describe the sequencing of the 16S amplicon used to determine the diversity of the microbial communities and the identity of
99

their community members. Image and legend are adapted from Singh and Reddy (2016).
100 Protocols for Macroalgae Research

bacterial communities. Our focus is on bacterial identity, diversity, and

predicted functional profiles based on 16S rRNA amplicon sequencing
(although the same methodology can be used for metagenomics up to
PCR amplification). This can be considered as a starting point for further
functional studies using more powerful approaches, such as metagenom-
ics and metatranscriptomics.

5.3 Materials
• Latex or nitrile gloves
• Scalpel and blades or scissors
• 96% (v/v) ethanol
• Paper tissue
• Permanent marker
• 2 mL tubes (or cryotubes in case you use liquid nitrogen)
• Xpedition™ Lysis/Stabilization Solution (Zymo Research) or liquid
nitrogen
• Storage box for 2 mL tubes
• DNA decontaminating solution (e.g., 10% [v/v] bleach)
• Nitrile gloves
• Micropipettes (different volumes) and their respective pipette tips
with filters
• 96% (v/v) ethanol
• Beaker
• Tweezers
• Scalpel and blades
• Bunsen burner
• Bead-beater
• Ice bath
• Microcentrifuge
• Vortex
• UV light (optional, but recommended)
• Water bath or heating block (Note 1)

5.4 Experimental procedures

5.4.1 Sampling
Sampling seaweeds for associated bacterial community studies implies
some more aseptic measures than regular sampling. Sometimes, field
sampling is carried out in rough conditions, although simple steps should
be followed to avoid undesirable further contamination of any source.
Chapter five: Unraveling seaweeds bacteriomes 101

1. Always use gloves to handle samples.

2. Samples should be thoroughly cleaned from attached sediment par-
ticles and epiphytes. Use the surrounding seawater to help in this
process.
3. As a rule of thumb, use a minimum of five replicates (within the
same location/treatment) that should represent the variation present
(so, in the field, no neighboring individuals should be sampled).
4. Associated bacterial communities (Note 2) tend to be tissue specific.
When sampling seaweeds featuring differentiated structures (e.g.,
holdfast, stipe and blades, and reproductive structures when pres-
ent), these should be separated without representing different repli-
cates of the same individual (for each sample/replicate use distinct
or ethanol-disinfected scissors or scalpel). A small piece of the tissue
fitting in a 2 mL tube is enough.
5. Sampling preservation should be performed by separating the
above-mentioned structures into different tubes. Make sure that
individual replicates are clearly labeled (using a permanent marker):
for example, after tissue separation in three different tubes, replicate
1 from species X should be labeled X1_tissue_structure (Notes 3 and 4).
6. Samples should be preserved fresh in the field. There are two
options: (1) emerge the tissue completely in a preservation buffer
as the Xpedition™ Lysis/Stabilization Solution (Zymo Research) in
individual tubes (regular 2 mL tubes with no more than 500 µL of
buffer), or (2) flash freeze the individualized tissues in liquid nitro-
gen (use adequate cryotubes).
7. Moreover, environmental reference samples as seawater and sedi-
ment should be sampled (replicates of 0.5 L of seawater [depending
on the bacterial abundance] and about 1 mL of sediment). Seawater
should preferably be filtered directly in the field using 0.2  µm fil-
ters. Seawater filters and sediment should be stored using the same
method as for the seaweed tissues. The current chapter does not
include details on dealing with these samples.

5.4.2 DNA extraction

Several commercial kits can be used to perform the extraction of seaweed-
associated bacterial DNA. In this protocol, we have chosen to describe the MO
BIO’s PowerSoil™ DNA Isolation Kit protocol, which is probably the most
widely used for several other host organisms (e.g., the Seagrass Microbiome
Project—https://seagrassmicrobiome.org). Other extraction kits, as the
FastDNA™ SPIN Kit for soil from MP biomedicals, and the Quick-gDNA™
MiniPrep from Zymo Research also performed well to our experience (Notes
5 and 6). Changes to the users’ manual are referred in Notes 2, 5 and 6.
102 Protocols for Macroalgae Research

Before starting the extraction, make sure that the workspace is clean
by disinfecting all surfaces with bleach or other DNA decontaminating
solution (consider placing pipettes, scalpel, and tweezers under UV light
before the procedure). Prepare a beaker with ethanol in which your han-
dling material (tweezers and scalpel) will be placed. Use gloves during
the entire process.
Sample preparation should be carried out right before extraction,
and transfer of samples into the MO BIO bead-beating tubes should
be performed close to a flame. If samples stored in Xpedition™ Lysis/
Stabilization solution are used, vortex the sampling tubes and transfer
a small piece of tissue into the MO BIO bead-beating tube, followed by
100 µL of the stabilization solution. Samples stored in liquid nitrogen ide-
ally should not be thawed before the tissue transference. Disinfect the
scalpel and tweezer using ethanol and flame in between transfers to avoid
contamination from one sample to another.
After sample preparation, start with step 3 of the MO BIO PowerSoil®
DNA Isolation Kit’s Experienced User Protocol (Note 7).

5.4.3 16S rRNA amplification

In contrast to other hosts, the biggest drawback when studying bacterial
communities associated with photosynthetic organisms is the cyanobac-
terial origin of the chloroplast lineage (Whatley et al. 1979) (Note 8). The
use of the conserved, and most widely used, 16S rRNA primers (Wang
and Qian 2009; Apprill et al. 2015) will lead to the cross-amplification of
plastid DNA interfering with the 16S rRNA characterization of bacteria
and masking the real bacterial contribution. If one does not aim to study
the seaweed bacterial biofilm (in which the swab sampling technique
itself avoids chloroplast contamination), selective methods need to be
used to eliminate (or turn to residual) the chloroplast interference. Most
recent studies have been mainly using two different techniques to avoid
PCR amplification of 16S rRNA genes from plastids: (1) the use of block-
ing primers based on peptide nucleic acid (PNA) PCR clamps, developed
by Lundberg et al. (2013), which bind to chloroplast amplicons inhibiting
their further amplification and (2) the use of primers that were specifically
designed and modified to not bind to the chloroplast DNA. The first method
is promising, although still seldom used, but can be time-consuming
(each host species might require specific PNAs) and expensive. The use
of modified primers is, for some, considered an added bias to the PCR.
However, Hanshew et  al. (2013) reviewed and improved a collection of
chloroplast avoiding primer testing and attesting their efficiency and unde-
tectable bias. Here, we suggest two sets of primers, which have been work-
ing efficiently in our lab, depending on the sequencing technology used
Chapter five: Unraveling seaweeds bacteriomes 103

(454 pyrosequencing or Illumina MiSeq). For 454 technology, which allows

fragment sequencing up to 600 bp, we have selected the less biased and
best on chloroplast amplicons avoidance from Hanshew study (2013)—
the primer pair 799Fmod3 (5′-CMGGATTAGATACCCKGG-3′) and 1392R
(5′-ACGGGCGGTGTGTRC-3′) amplifying the V5–V8 region of the 16S.
This primer pair has shown no bias toward any taxa and the chloroplast
contamination was a low as 0%–0.88% and has been proven to work well
for seaweed associated bacteria (Aires et al. 2016).
For Illumina MiSeq technology (paired end), in which frag-
ments sequencing can nowadays go up to 2 × 250 bp (~500 bp) and the
choice of primers is limited, our lab has tested the primer pair used by
Bodenhausen et  al. (2013)—799F (5′-AACMGGATTAGATACCCKG-3′)
and 1193r (5′-ACGTCATCCCCACCTTCC-3′) that amplify a ~400  bp
amplicon from the V5–V7 region of the 16S rRNA gene. These primers
were also successfully tested in our lab for the amplification of bacteria
from brown seaweeds (Vieira et al. 2016), and from marine angiosperms
(unpublished data).
Despite the suggestions given, we strongly encourage a literature
search related to the objectives and the seaweed species addressed in the
study before deciding on the 16S rRNA amplification strategy (Note 9).

5.4.4 16S rRNA amplicon sequencing data analysis

As molecular techniques advance to deliver more data, the software pro-
grams also have to keep up with ways to analyze that ever increasingly
large amount of information (Note 10). When it comes to 16S rRNA ampli-
con sequencing, there are two popular analysis programs: (1) Mothur
(Schloss et al. 2009) and (2) QIIME (Caporaso et al. 2010). The later has been
widely used in several studies, from human to thermal vents-associated
microbiomes. QIIME’s popularity is due to its user-friendly native Python
coding, supplemented with very detailed and easy-to-understand tuto-
rials and an extremely helpful and responsive discussion forum. Here,
we are going to guide readers through the initial 16S rRNA data QIIME
(version 1.8.0) processing and suggesting possible statistical programs to
use afterwards.
First, computer must be suitable for QIIME installation along with all the
dependencies (http://QIIME.org/install/install.html). Depending on the
sequencing technology used (454 or Illumina) and the format of the sequences,
the quality filtering/demultiplexing step will require different arguments. Before
starting, the respective tutorials should be read, and data should be pre-
pared accordingly—454 tutorial (http://QIIME.org/tutorials/tutorial.html)
and Illumina tutorial (http://nbviewer.jupyter.org/github/biocore/
QIIME/blob/1.9.1/examples/ipynb/illumina_overview_tutorial.ipynb).
104 Protocols for Macroalgae Research

Qiime

Quality filtering/ Representative

OTU Picking
Demultiplexing set
Pick_otus.py
Split_libraries.py Pick_rep_set.py

Align sequences OTU Abundance

table Assign taxonomy
Align_seqs.py make_otu_table.py
Filter_alignment.py Assign_taxonomy.py
Closed-reference
OTU table

PICRUSt

Phylogenetic tree Statistics and diversity analysis OTU Normalization

Core_diversity_analysis.py Normalize_by_copy_number.py
Make_phylogeny.py

Metagenomes prediction
Predict_metagenomes.py
Alpha and beta diversity,
rarefaction, taxa abundance,
heatmap, and so on Functional characterization
Categorize_by_function.py

Other software
(e.g., PAST, PRIMER-
E+PERMANOVA, R
[Vegan, Phyloseq])

Multivariate analysis (e.g., PERMANOVA,

PCA, CAP), SIMPER, Venn diagrams

Figure 5.2  Schematic diagram representing the initial and main steps (along with
the respective scripts) to analyze 16S amplicon sequencing data in QIIME (gray
shaded area) and subsequent functional profiles prediction using PICRUSt (dark-
gray shaded area). Downstream statistical and diversity analysis, and respective
visualization using QIIME, are represented by gray-shaded areas. Other sug-
gested software (with QIIME/PICRUSt generated OTU/KEGG pathways table)
are represented by the white-shaded area.

Once data and metadata are prepared, the following steps can be followed
(also illustrated in Figure 5.2):

1. split_libraries.py: This script assigns the reads according to samples

and on the basis of each differentiated barcode (given on your meta-
data file). Quality filtering is also carried out in this step by remov-
ing any low quality or ambiguous reads.
2. pick_otus.py: This script should be adapted to the operational
taxonomic unit (OTU) picking strategy of your choice (see http://
QIIME.org/tutorials/otu_picking.html). This script clusters all the
Chapter five: Unraveling seaweeds bacteriomes 105

sequences into OTUs on the basis of their similarity. In QIIME,

OTUs are clusters of sequences representing taxonomic similarity.
3. pick_rep_set.py: The file created previously will be used in this script
to extract a representative sequence from each OTU that will be used
in downstream analysis.
4. assign_taxonomy.py: This script will assign each representative
sequence, picked in step 3, to a certain taxon.
5. make_otu_table.py: In this step, the OTU map created in step 2 and
the taxonomic assignments from step 4 will be assembled as a table
of OTU abundances for each sample with taxonomic predictions for
each OTU (Note 11).
6. align_seqs.py: The representative set of sequences created in step 3
can be aligned using this script through a method of your choice.
7. filter_alignment.py: This script will remove gaps created during
alignment to further generate a useful phylogenetic tree relating the
sequences.
8. make_phylogeny.py: This script uses the filtered alignment created in the
previous step and builds a phylogenetic tree in which the relatedness
of the OTUs representative sequences can be visualized (Note 12).
9. core_diversity_analysis.py: This script represents a workflow gather-
ing several QIIME diversity analyses beginning with an OTU table, a
metadata file, and an optional phylogenetic tree. We strongly advise
the individual use of each script comprising this workflow script.

In every step, arguments and parameters can be changed to fit the data
and methodologies of choice (for details, see individual QIIME scripts
here: http://QIIME.org/scripts/index.html).
The analysis process described in this point is illustrated and summa-
rized in Figure 5.2. As an example of a possible output from the process
explained above, Figure 5.3 depicts part of the results’ analysis of a study
on bacterial community associated with two different red seaweed spe-
cies (based on 16S rRNA amplicon sequencing).

5.4.5 Functional prediction based on 16S rRNA gene sequencing

Metagenomics and metatranscriptomics are still expensive and time-
consuming techniques. Some tools have been developed to help giving the
first insight into the bacterial community potential function. Phylogenetic
Investigation of Communities by Reconstruction of Unobserved States
(PICRUSt) is a software program that allows one to predict the functional
composition of a metagenome using 16S rRNA gene data and a known data-
base of reference genomes (Langille et al. 2013). Similar to QIIME, PICRUSt
uses Python coding, and its installation process can be consulted in the fol-
lowing website: https://picrust.github.io/picrust/install.html#install.
106 Protocols for Macroalgae Research

0.2

Group I

Group III

0 A. armata Mainland p = 0.001

CAP2

A. taxiformis Islands
p = 0.001

−0.2
p = 0.002
Group II

A. taxiformis Mainland
−0.4
−0.2 0 0.2 0.4
CAP1

Figure 5.3 Example of a possible output of seaweed-associated bacterial com-

munity analysis using QIIME and PRIMER-E+PERMANOVA. In this example,
the table with OTU abundances, created in QIIME (step 5 of point 2.4), was used
for Canonical Analysis of Principle coordinates (CAP) (based on Bray–Curtis dis-
tances) in PRIMER-E+PERMANOVA. The figure shows the clustering of the dif-
ferent seaweed samples (two Asparagopsis species in two contrasting locations),
on the basis of bacterial communities’ composition. Associated bacteria cluster
by both species and habitat, showing the influence of these two factors on shap-
ing the communities. Statistical analyses (PERMANOVA) p values are depicted
between the different groups (groups considered significantly different if p < 0.05).
For more detail, see the complete study by Aires et al. (2016).

Once the necessary files are in the right format and the adequate
database is used (Note 13), PICRUSt predicts the functional profile of the
seaweed bacterial community. The main steps (scripts) to obtain a pre-
dicted metagenome table are the following:

1. normalize_by_copy_number.py: This script uses the OTU table created

in QIIME and normalizes it by dividing each OTU by the known/
predicted 16S copy number abundance.
2. predict_metagenomes.py: This script uses the normalized table cre-
ated in the previous step to create the final metagenome functional
Chapter five: Unraveling seaweeds bacteriomes 107

predictions. The output is a table with the Kyoto Encyclopedia of

Genes and Genomes (KEGG) Orthologous and respective proteins
predictions for each sample.
3. categorize_by_function.py: The metagenome predictions calculated
in the step before are collapsed, by this script, to a specified level
within the pathway hierarchy (e.g., KEGG Orthologouss will be col-
lapsed into KEGG pathways).

Similar to QIIME, arguments and parameters can be changed in every

step according to the user’s preferences (see https://picrust.github.io/
picrust/tutorials/metagenome_prediction.html). The output table from
the metagenome predictions and function characterization are in BIOM
format that makes possible to use it for core analysis in QIIME (see step 9
of point 2.4) and have access to the same diversity analysis as for the OTU
data (please be aware of the BIOM formats incompatibilities mentioned
above). Using the –f argument in steps 2 and 3 delivers a text file table that
can be used in several other statistic and diversity analysis programs (see
point 2.4). For data visualization and basic statistics, STAMP (Parks et al.
2014) is popular within PICRUSt users. The use of PICRUSt is schematized
in Figure 5.2. An example of a possible output, after PICRUSt analysis and
using the table generated in step 3, is shown in Figure 5.4.

0.52

0.50
Proportion of sequences assigned to

0.48
Nitrogen Metabolism (%)

0.46

0.44

0.42

0.40

0.38

0.36

0.34
Phyllosphere Rhizoids
(fronds and stolon)

Figure 5.4   Example of a possible output of seaweed-associated bacterial com-

munity analysis using PICRUSt level 3 KEGG pathways’ predictions. Box plot
showing the distribution in the proportion of sequences assigned to nitrogen
metabolism. The top of the box indicates the third quartile, the bottom the first
quartile, and the line in the middle is the median. (Unpublished results).
108 Protocols for Macroalgae Research

5.5 Notes
Note 1: For the DNA extraction step, the listed materials only refer
to those not provided in the MO BIO’s PowerSoil™ DNA Isolation
Kit.
Note 2: This protocol comprehends total bacterial community (both
endo- and epiphytic bacteria). If one is interested in just sampling the
bacterial biofilm, cotton swabs should be rubbed on the tissue sur-
face and stored as described earlier. For sampling endophytic bacte-
ria, please consider the protocol provided by, for example, Delbridge
et al. (2004), Hollants et al. (2010), Aires et al. (2012).
Note 3: Sampling strategy and labeling will depend on the researcher’s
question/hypothesis. This protocol is designed to sample the entire
individual by considering tissue specificity.
Note 4: Field sampling tends to be messy and makes the required asep-
tic conditions challenging. Organizing all the storage material in
advance facilitates the process and avoids undesirable contamina-
tions. Example: Sampling tubes can be labeled in advance according
to sampling expectations, samples to be preserved in the stabili-
zation solution should be placed in a plastic box and kept vertical
to avoid spills and, when possible, tubes should be isolated using
Parafilm tape.
Note 5: In step 4, if Zymo solution is being used as a preservation
method, it might interact with solution C1 and form a white precipi-
tate. The precipitate should be removed by placing the tubes at 65°C
for 5 min.
Note 6: Immediately place the tubes in the bead-beater for, at least, two
min (the time might depend on the tissue type and facility of disrup-
tion) and resume to step 6 of the experienced user protocol.
Note 7: Extraction process should be performed as quickly as possible
in a sterile environment. To do so, prepare and label all the required
tubes beforehand, keep all the materials you need close by, and keep
the Bunsen burner flame on during the entire extraction. To avoid
undesirable spills and subsequent contamination, in step 15 of the
experienced user protocol for PowerSoil® DNA Isolation Kit, load
600  µL of the supernatant mixed with the C4 buffer onto the spin
filter (instead of the recommended 675  µL). More than three loads
might be needed. Always make a blank extraction to evaluate pos-
sible contamination.
Note 8: PCR specifications should be optimized in each lab according to
the reagents, primers, and the thermocycler machine used. However,
the entire PCR process should always be carried out under sterile
Chapter five: Unraveling seaweeds bacteriomes 109

conditions (PCR chamber or laminar flow hood), and a proofreading

Taq polymerase should be used.
Note 9: From our experience, bacterial communities associated with
some seaweed species might be difficult to amplify, either because
of the small size of the sample, or because of the high content of
polyphenols in seaweeds, that could hamper the PCR and result in
low-yield amplifications. Performing a nested PCR using the 16S
universal primers 27F and 1492r (Lane, 1991) before the modified
primers above-mentioned can solve this problem. To avoid a large
bias, the second PCR should have a reduced number of cycles (Aires
et al. 2016).
Note 10: In silico analysis’ methodologies depend on the addressed
question. Therefore, only advice on the software usage and initial
guidance on taxonomic identification of bacterial communities is
given in this chapter.
Note 11: After performing step 5, the OTU table (in BIOM format) can
be converted into, for example, a text or excel file and used in sev-
eral other programs for statistic and diversity analysis, as well as
for visualization of the results (e.g., Excel, STAMP, PAST, PRIMER-
E+PERMANOVA and the R packages Vegan and Phyloseq). The con-
version can be done using a command line in QIIME, see: http://
biom-format.org/documentation/biom_conversion.html.
Note 12: The alignment and phylogeny inference steps are only neces-
sary if phylogenetic metrics (e.g., UniFrac) are used in downstream
analysis. The use of the next suggested script might require the use
of a phylogenetic tree.
Note 13: Some important tips must be noted before using PICRUSt:
(a) PICRUSt uses the bacterial community taxonomic profile and
abundances (OTU table generated in QIIME) to predict functional
potential, so all the reads have to be assigned and get hit to a
particular reference sequence collection. To obtain a fully tax-
onomy assigned OTU table, the OTU picking strategy (step 2 of
the previous point) is the closed-reference OTU picking. Using the
default 97% identity assignment is highly recommended; (b) to
date, PICRUSt works best with the 16S rRNA sequence database
Greengenes v13.5 as a reference sequence collection (download can
be done here: http://greengenes.secondgenome.com/downloads),
and that is the database to be used for closed-reference OTU pick-
ing (using the files 97_otus.fasta and 97_otu_taxonomy.txt as –r
and –t arguments, respectively, in the QIIME script pick_otus.py);
(c) QIIME latest versions use BIOM 2.1 version (hdf5 format) to
create the OTU table, whereas PICRUSt version 1.0.0 uses an older
110 Protocols for Macroalgae Research

BIOM 1.3.1 version (json format) so, some incompatibilities may

arise and conversion of different tables versions may be needed,
for that please consult http://biom-format.org/documentation/
biom_conversion.html. In the latest PICRUSt version 1.1.0, the
BIOM version should not be an issue.

Acknowledgments
We thank the Phycomorph COST action (FA1406) and acknowledge
the financial support of FCT (SFRH/BPD/107878/2015 (AE), SFRH/
BPD/116774/2016 (TA) and GENEKELP).

References
Aires, T., Marbà, N., Serrao, E. A., Duarte, C. M., Arnaud-Haond, S. 2012. Selective
elimination of chloroplastidial DNA for metagenomics of bacteria associ-
ated with the green alga Caulerpa taxifolia (Bryopsidophyceae). J Phycol 48 (2):
483–490.
Aires, T., Moalic, Y., Serrao, E. A., Arnaud-Haond, S. 2015. Hologenome theory
supported by co-occurrence networks of species-specific bacterial commu-
nities in siphonous algae (Caulerpa). FEMS Microbiol Ecol 91: 1–14.
Aires, T., Serrão, E. A., Engelen, A. H. 2016. Host and environmental specificity
in bacterial communities associated to two highly invasive marine species
(Genus Asparagopsis). Front Microbiol 7: 559.
Allen-Vercoe, E. 2013. Bringing the gut microbiota into focus through microbial
culture: Recent progress and future perspective. Curr Opin Microbiol 16 (5):
625–629.
Apprill, A., Mcnally, S., Parsons, R., Weber, L. 2015. Minor revision to V4 region
SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterio-
plankton. Aquat Microb Ecol 75 (2): 129–137.
Barott, K. L., Rodriguez-Brito, B., Janouškovec, J. et  al. 2011. Microbial diversity
associated with four functional groups of benthic reef algae and the reef-
building coral Montastrea annularis. Environ Microbiol 13 (5): 1192–1204.
Bengtsson, M. M., Sjøtun, K., Øvreås, L. 2010. Seasonal dynamics of bacterial bio-
films on the Kelp Laminaria hyperborea. Aquat Microb Ecol 60 (1): 71–83.
Bodenhausen, N., Horton, M. W., Bergelson, J. 2013. Bacterial communities asso-
ciated with the leaves and the roots of Arabidopsis thaliana. PLoS One 8 (2):
e56329.
Bolinches, J., Lemos, M. L., Barja, J. L. 1988. Population dynamics of heterotrophic
bacterial communities associated with Fucus vesiculosus and Ulva rigida in an
estuary. Microb Ecol 15 (3): 345–357.
Burke, C., Kjelleberg, S., Thomas T. 2009. Selective extraction of bacterial DNA
from the surfaces of macroalgae. Appl Environ Microbiol 75 (1): 252–256.
Burke, C., Steinberg, P., Rusch, D., Kjelleberg, S., Thomas, T. 2011. Bacterial com-
munity assembly based on functional genes rather than species. PNAS
108 (34): 14288–14293.
Chapter five: Unraveling seaweeds bacteriomes 111

Caporaso, J. G., Kuczynski, J., Stombaugh, J. et  al. 2010. Correspondence QIIME
allows analysis of high-throughput community sequencing data intensity nor-
malization improves color calling in SOLiD sequencing. Nature 7 (5): 335–336.
Charrier, B., Coates, J. C., Stavridou, I. 2017. Surfing amongst oil-tankers:
Connecting emerging research fields to the current international landscape.
Trends Plant Sci 22 (1): 1–3.
Chisholm, J. R. M., Dauga, C., Ageron, E., Grimont, P. A. D., Jaubert, J. M. 1996.
Roots’ in mixotrophic algae. Nature 381: 382.
Cundell, A. M., Sleeter, T. D., Mitchell, R. 1977. Microbial populations associated
with the surface of the brown alga Ascophyllum nodosum. Microb Ecol 4 (1):
81–91.
Delbridge, L., Coulburn, J., Fagerberg, W., Tisa, L. S. 2004. Community profiles of
bacterial endosymbionts in four species of Caulerpa. Symbiosis 37: 335–344.
Dittami, S. M., Duboscq-Bidot, L., Perennou, M. et al. 2016. Host–microbe interac-
tions as a driver of acclimation to salinity gradients in brown algal cultures.
ISME J 10: 51–63.
Egan, S., Harder, T., Burke, C., Steinberg, P., Kjelleberg, S., Thomas, T. 2013. The
seaweed holobiont: Understanding seaweed-bacteria interactions. FEMS
Microbiol Rev 37 (3): 462–476.
Eigemann, F., Hilt, S., Salka, I., Grossart, H. P. 2013. Bacterial community composi-
tion associated with freshwater algae: Species specificity versus dependency
on environmental conditions and source community. FEMS Microbiol Ecol
83 (3): 650–663.
Gupta, S., Abu-Ghannam, N. 2011. Bioactive potential and possible health effects
of edible brown seaweeds. Trends Food Sci Technol 22 (6): 315–326.
Hanshew, A. S., Mason, C. J., Raffa, K. F., Currie, C. R. 2013. Minimization of chlo-
roplast contamination in 16S rRNA gene pyrosequencing of insect herbivore
bacterial communities. J Microbiol Methods 95 (2): 149–155.
Hollants, J., Decleyre, H., Leliaert, F., De Clerck, O., Willems, A. 2011. Life without
a cell membrane: Challenging the specificity of bacterial endophytes within
Bryopsis (Bryopsidales, Chlorophyta). BMC Microbiol 11: 255.
Hollants, J., Leliaert, F., De Clerck, O., Willems, A. 2010. How endo- is endo-? Surface
sterilization of delicate samples: A Bryopsis (Bryopsidales, Chlorophyta) case
study. Symbiosis 51: 131–138.
Hollants, J., Leliaert, F., Verbruggen, H., Willems, A., De Clerck, O. 2013. Permanent
residents or temporary lodgers: Characterizing intracellular bacterial com-
munities in the siphonous green alga Bryopsis. Proc Biol Sci 280: 20122659.
Lachnit, T., Blümel, M., Imhoff, J. F., Wahl, M. 2009. Specific epibacterial commu-
nities on macroalgae: Phylogeny matters more than habitat. Aquat Biol 5:
181–186.
Lachnit, T., Meske, D., Wahl, M., Harder, T., Schmitz, R. 2011. Epibacterial commu-
nity patterns on marine macroalgae are host-specific but temporally vari-
able. Environ Microbiol 13: 655–665.
Lane, D. J. 1991. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial
Systematic, E. Stackebrandt and M. Goodfellow (Eds.), pp. 115–175. New York:
John Wiley & Sons.
Langille, M. G. I., Zaneveld, J., Caporaso, J. G. et  al. 2013. Predictive functional
profiling of microbial communities using 16S rRNA marker gene sequences.
Nature Biotechnol 31 (9): 814–821.
112 Protocols for Macroalgae Research

Lundberg, D. S., Yourstone, S., Mieczkowski, P., Jones, C. D., Dangl, J. L. 2013.
Practical innovations for high-throughput amplicon sequencing. Nat Meth
10 (10): 999–1002.
Mancuso, F. P., D’Hondt, S., Willems, A., Airoldi, L., De Clerck, O. 2016. Diversity
and temporal dynamics of the epiphytic bacterial communities associated
with the canopy-forming seaweed Cystoseira compressa (Esper) Gerloff and
Nizamuddin. Front Microbiol 7: 476.
Marzinelli, E. M., Campbell, A. H., Valdes, E. Z. et al. 2015. Continental-scale vari-
ation in seaweed host-associated bacterial communities is a function of host
condition, not geography. Environ Microbiol 17(10): 4078–4088.
Matsuo, Y., Imagawa, H., Nishizawa, M., Shizuri, Y. 2005. Isolation of an algal
morphogenesis inducer from a marine bacterium. Science 307: 1598.
Meusnier, I., Olsen, J. L., Stam, W. T., Destombe, C., Valero, M. 2001. Phylogenetic
analyses of Caulerpa taxifolia (Chlorophyta) and of its associated bacterial
microflora provide clues to the origin of the Mediterranean introduction.
Mol Ecol 10: 931–946.
Nylund, G. M., Persson, F., Lindegarth, M., Cervin, G., Hermansson, M., Pavia,
H. 2010. The red alga Bonnemaisonia asparagoides regulates epiphytic bacte-
rial abundance and community composition by chemical defence. FEMS
Microbiol Ecol 71 (1): 84–93.
Parks, D. H., Tyson, G. W., Hugenholtz, P., Beiko, R. G. 2014. STAMP: Statistical anal-
ysis of taxonomic and functional profiles. Bioinformatics 30 (21): 3123–3124.
Qian, P., Xu, Y., Fusetani, N. 2010. Natural products as antifouling compounds:
Recent progress and future perspectives. Biofouling 26 (2): 223–234.
Riesenfeld, C. S., Schloss, P. D., Handelsman, J. 2004. Metagenomics: Genomic
analysis of microbial communities. Annu Rev Genet 38: 525–552.
Rosenberg, E., Koren, O., Reshef, L., Efrony, R., Zilber-Rosenberg, I. 2007. The
role of microorganisms in coral health, disease and evolution. Nature Rev
Microbiol 5: 355–362.
Schäfer, H., Muyzer, G. 2001. Denaturing gradient gel electrophoresis in marine
microbial ecology. Method Microbiol 30: 425–468.
Schloss, P. D., Westcott, S. L., Ryabin, T. et  al. 2009. Introducing mothur: Open-
source, platform-independent, community-supported software for describ-
ing and comparing microbial communities. Appl Environ Microbiol 75 (23):
7537–7541.
Singh, R. P., Reddy, C. R. K. 2014. Seaweed-microbial interactions: Key functions of
seaweed-associated bacteria. FEMS Microbiol Ecol 88: 213–230.
Singh, R. P., Reddy, C. R. K. 2016. Unraveling the functions of the macroalgal
microbiome. Front Microbiol 6: 1–8.
Smit, A. J. 2004. Medicinal and pharmaceutical uses of seaweed natural products:
A Review. J Appl Phycol 16 (4): 245–262.
Spoerner, M., Wichard, T., Bachhuber, T., Stratmann, J., Oertel, W. 2012. Growth
and thallus morphogenesis of Ulva mutabilis (Chlorophyta) depends on a
combination of two bacterial species excreting regulatory factors. J Phycol
48 (6): 1433–1447.
Chapter five: Unraveling seaweeds bacteriomes 113

Stratil, S. B., Neulinger, S. C., Knecht, H., Friedrichs, A. K., Wahl, M. 2013.
Temperature-driven shifts in the epibiotic bacterial community composi-
tion of the brown macroalga Fucus vesiculosus. Microbiologyopen 2: 338–349.
Tujula, N. A., Crocetti, G. R., Burke, C., Thomas, T., Holmström, C., Kjelleberg, S.
2010. Variability and abundance of the epiphytic bacterial community asso-
ciated with a green marine Ulvacean alga. ISME 4 (2): 301–311.
Vieira, C., Engelen, A. H., Guentas, L. et  al. 2016. Species specificity of bacteria
associated to the brown seaweeds Lobophora (Dictyotales, Phaeophyceae)
and their potential for induction of rapid coral bleaching in Acropora
muricata. Front Microbiol 7: 316.
Wang, Y., Qian, P. Y. 2009. Conservative fragments in bacterial 16S rRNA genes
and primer design for 16S ribosomal DNA amplicons in metagenomic stud-
ies. PLoS One 4 (10): e7401.
Weiss, A., Costa, R., Wichard, T. 2017. Morphogenesis of Ulva mutabilis
(Chlorophyta) induced by Maribacter species (Bacteroidetes, Flavobacteriaceae).
Botanica Marina 60 (2): 197–206.
Whatley, J. M., John, P., Whatley F. R. 1979. From extracellular to intracellular: The
establishment of mitochondria and chloroplasts. Proc Biol Sci 204: 165–187.
Wichard, T. 2015. Exploring bacteria-induced growth and morphogenesis in the
green macroalga order Ulvales (Chlorophyta). Front Plant Sci 6: 86.
chapter six

Heavy metal ecotoxicity on the

early life history stages
of macroalgae
Pablo P. Leal and Michael Y. Roleda

Contents
6.1 Introduction ............................................................................................115
6.2 State of the art .........................................................................................116
6.3 Materials..................................................................................................118
6.3.1 Trace metal cleaning ..................................................................118
6.3.2 Algal material for spore release and toxicity test..................118
6.4 Experimental procedures .....................................................................119
6.4.1 Trace metal clean techniques ...................................................119
6.4.2 Algal material ............................................................................ 120
6.4.3 Toxicity test ................................................................................ 120
6.4.4 End points .................................................................................. 122
6.4.5 Adaptation of the protocol to microalgae and adult
macroalgal specimens .............................................................. 124
6.5 Notes ....................................................................................................... 124
References........................................................................................................ 125

6.1 Introduction
Marine ecotoxicology is a branch of toxicology dealing with the study
of the toxic effects, caused by natural or synthetic pollutants, with fun-
damental focus on the members of the marine ecosystems, for example,
flora and fauna. The objective of ecotoxicological studies is to determine
the impacts of anthropogenic toxic waste discharged to marine environ-
ments (Chapman 1995). The main tool used in ecotoxicological research
is a short-term assay to measure the toxicity of a pollutant (e.g., heavy
metals) on different physiological parameters of a key species (Burridge
and Bidwell 2002). Empirical data can be used to estimate the long-term

115
116 Protocols for Macroalgae Research

negative effects of the pollutants on the population of the investigated

species (Anderson et al. 1990, Contreras et al. 2007).
Macroalgae are the foundation species in coastal environments that
create three-dimensional habitats. They are at the base of the food web
providing energy to higher trophic levels and provide nursery grounds
and habitats for diverse assemblages of invertebrates and fish. All mac-
roalgae have microscopic phases within their life cycle, and these phases
may be the most susceptible life stage to environmental stressors (Roleda
et  al. 2007, 2009). Macroalgal spores and gametes are liberated into the
water column, settle on the rocky coastline, undergo sexual reproduc-
tion, and give rise to the next macroscopic generation. Macroalgae pro-
duce enormous numbers of propagules, for example, different types of
spores and gametes, but only a small fraction germinates and survive to
maturity.
Performing ecotoxicity tests on the early life-history stages of eco-
logically relevant marine benthic macroalgae will provide fundamental
knowledge on the relative susceptibility of their microscopic stages that
give rise to macroscopic, multicellular, and usually morphologically com-
plex adult stages. Negative effects on the early life-history stages and the
consequent failure to establish the next macroscopic generation of key
macroalgal phyla will have cascading effects on coastal ecosystems as
they provide habitat and food to invertebrates and fish. Thus, knowing the
species’ survival thresholds is relevant for policy-makers and managers to
help in preserving marine biodiversity and preventing the local extinc-
tion of key marine species.
Ecotoxicity tests are performed in controlled laboratory conditions.
The test organism is exposed to a range of concentrations of the toxicant,
for example, heavy metal, to estimate the concentration at which it can
negatively affect the physiology and ontogenetic development of the test
organism (Burridge and Bidwell 2002, Eklund and Kautsky 2003, van Dam
et al. 2008). To facilitate comparison between studies, we recommended
reporting the half maximal effective concentration EC50, that is, the effec-
tive concentration at which 50% of the physiological and/or metabolic pro-
cesses are affected by the toxicant (Leal et al. 2016a, b).

6.2 State of the art

The field of heavy metal ecotoxicology has become increasingly important
over the past few decades to assess the impacts of industrial pollution
on marine coastal ecosystems. For example, bioaccumulation of heavy
metals in algae can cause health risks to other organisms in the food
chain, including humans. Hence, generation of robust data from rigorous
Chapter six: Heavy metal ecotoxicity on the early life history stages 117

ecotoxicological studies is paramount not only for risk assessment but

also for rehabilitation measures. Moreover, ecotoxicity tests will provide
basic information on the species’ responses and survival thresholds to
heavy metals.
In the absence of trace metal clean procedures, most published
studies on trace metal ecotoxicology prior to the mid-1970s, especially in
the field of marine biology, are considered inaccurate and unreliable. In
this regard, Maienthal and Becker (1976) recommended the routine use
of trace metal clean techniques to produce accurate and reliable data on
ecotoxicology of marine algae. However, the early recommendations have
largely been ignored in subsequent trace metal studies. For example,
recent review appraising copper ecotoxicological studies on marine algae
covering studies from 1977 to 2015 showed alarming methodological defi-
ciencies (Leal et al. 2016a). Despite the availability of trace metal clean pro-
cedures for more than 40 years, ∼70% of the literatures reviewed did not
follow the recommended protocols. Half of the studies did not specify the
labware, whereas the remaining 50% reported the use of glassware (∼25%)
and plasticware (∼25%) and only ∼30% of the studies specified cleaning
protocols to remove trace metal impurities of the labware. The copper
form used to prepare the stock solutions was specified in most studies
(∼80%) but acidification to stabilize the dissolved copper was performed
in only ∼20%. These studies generally reported the nominal concentra-
tions, but only ∼40% measured the actual dissolved copper concentrations
(Leal et al. 2016a).
A rigorous exotoxicity test procedure must include trace metal clean
techniques and stabilization of the heavy metal stock solution: This will
substantially reduce the subsequent procedural contamination and the
depletion of the toxicant’s actual dissolved concentration, respectively
(Leal et  al. 2016a). The protocol includes proper labware cleaning and
storage, stock solution preparation and stabilization with acidifica-
tion, and trace metal clean experimental and sampling procedures
(Leal et al. 2016a). The labware composition is also important, because
glass can adsorb some metals (e.g., copper) and leach others, altering
metal concentrations in the solution (Richter 2003). Therefore, the use
of plastic bottles and culture dishes (e.g., Teflon or polyethylene) dur-
ing stock solution preparation and storage, and performance of toxic-
ity test, respectively, are recommended (Garman et  al. 1994, Burridge
and Bidwell 2002, Leal et al. 2016a, b). Failure to follow these steps will
compromise the validity of any ecotoxicity test result as the negative
effect of a toxicant, for example, a heavy metal, may be underestimated
because of metal contamination or overestimated because of metal loss
by adsorption (Leal et al. 2016a).
118 Protocols for Macroalgae Research

6.3 Materials
6.3.1 Trace metal cleaning
• Distilled and deionized water (~18 MΩ cm): Several liters are required
for trace metal cleaning.
• Nonabrasive soap, detergent, or cleaning powder.
• Acid solution: Prepare 10% 2 M HCl in deionized water.
• 5–10 L basin for soaking labwares.
• 500 mL polyethylene plastic bottles.
• Polystyrene tissue culture vessels: Six-well plate (Costar 3516,
Corning Inc.).
• All labwares for handling algal materials, spore release, and ecotox-
icity test: For example, beakers, graduated cylinder, screw-capped
tubes, trays, and containers, among others.
• Laminar flow hood.
• Laboratory gown.
• Hand gloves.

6.3.2 Algal material for spore release and toxicity test

• Reproductive algal material: for example, sorus (Figure 6.1).
• Natural seawater: Collect into polystyrene containers preferably
within the vicinity and simultaneous with algal material collection
(Synthetic seawater, e.g., Sea salts S9883 Sigma, may also be used).
• Seawater filtration system with 0.2 µm pore size filters: Filtered natu-
ral seawater siphoned into new acid-washed polystyrene containers
should be stored in the dark and under low temperature (e.g., 5°C).
• High-precision balance.
• Beakers.
• Graduated cylinder.
• Tissue paper.
• Soft-bristled brush.
• Hemocytometer: (Neubauer-improved, Marienfeld Superior).
• Compound microscope for counting spores.
• Environmental chamber: Set temperature, irradiance, and light:dark
cycle according to the experimental design, for example, 12°C,
50 µmol photons m−2 s−1, and 12:12 light:dark cycle, respectively.
• Metal-stock solution: Dissolve the toxicant chemical in deionized
water (e.g., 2 g Cu2+ L−1). To stabilize the solution and avoid adsorp-
tion into the container walls, reduce the solution to pH 2 with 1 M
HCl.
• 10 mL screw-capped polyethylene plastic tubes: To store media for
the analysis of total dissolved heavy metal concentration.
Chapter six: Heavy metal ecotoxicity on the early life history stages 119

(a) (b)

Figure 6.1 Reproductive tissue aka sorus from (a) sporophylls of Alaria esculenta
and (b) lamina of Saccharina latissima.

• HNO3: To acidify media for the analysis of total dissolved heavy-

metal concentration.
• Micropipettes (2–200 µL; 1–1000 µL) and corresponding tips.
• Inverted microscope with digital camera for documenting meio-
spores ontogenetic development.
• Personal computer and digital imaging software.

6.4 Experimental procedures

6.4.1 Trace metal clean techniques
Labware cleaning must be performed in a trace metal clean area (e.g., lam-
inar flow hood). Wear gloves and proper laboratory garments during the
cleaning process.

1. Wash labware with nonabrasive soap and rinse thoroughly with

distilled water and then with deionized water.
2. Soak labware in an acidic solution (10% 2  M HCl) for at least one
week. Then rinse labware with deionized water three times.
3. Dry labware inside the trace metal clean area (e.g., laminar flow hood).
120 Protocols for Macroalgae Research

6.4.2 Algal material

To test macroalgal reproductive cells, for example, spores and gametes,
fertile individuals are collected to induce spore or gamete release. For
kelps, for example, reproductive tissue (sorus) occurs on different parts of
the thallus (Figure 6.1; Leal et al. 2014). Spore release can be induced from
dehydrated mature sorus kept overnight at 4°C and subsequent tempera-
ture shock on submersion into seawater at 12°C (Leal et al. 2016b). Use at
least five replicates (Note 1).

1. After collection of reproductive plants, cutoff blades with mature

sori and clean of epibionts by soft brushing under filtered seawater
(Note 2).
2. Blot dry blades and wrap in moist tissue paper overnight at 4°C. The
next day, partial spore release may be observed as brown staining on
the tissue paper.
3. From each reproductive blade excise soral disks (e.g., 2 cm ∅) using
a cork borer or weigh soral tissue.
4. Immerse a defined number of soral disks or tissue weight in a known
volume of filtered (12°C) seawater (e.g., 2 × of 2 cm2 disks in 50 mL or
50 g tissue in 500 mL filtered seawater) (Figure 6.2a).
5. After a defined period, for example, 15–30  min, remove the soral
disks or blades (Figure 6.2b). Slightly mix the suspension, draw a
subsample (Note 3), and measure spore density using a hemocytom-
eter (Guillard and Sieracki 2005).
6. Dispense × µL of known density and adjust to 25,000 spores mL−1
(final volume = 12 mL) onto each well of the six-well culture vessels
(Note 4). Allow meiospores to settle for 3 h. Then, renew the culture
medium to eliminate unsettled meiospores and rest detritus.

6.4.3 Toxicity test

After settlement, meiospores can now be exposed to the predefined nomi-
nal metal concentrations (Note 5). For comparison between studies, it is
essential to report the experimental exposure frequency (chronic or one-
time exposure) and period. For one-time exposure, the duration, that is,
the number of hours or days in some cases, must be clearly specified in
subsequent report or publication.

1. Prepare the nominal metal concentrations in different polyethyl-

ene plastic bottles. After 3 h settlement and elimination of unsettled
meiospores and detritus, renew the culture medium in each well of
the six-well culture vessels with corresponding predefined nominal
metal concentrations.
Chapter six: Heavy metal ecotoxicity on the early life history stages 121

(a) (b)

Figure 6.2  Induction of meiospore release by temperature shock: (a) Rehydration

of soral blades in 12°C seawater after overnight storage of the blotted-dry blades
in cold chamber (4°C) and (b) spore released after 15  min submersion of the
blades.

2. Renew the culture medium with the appropriate metal concentra-

tion every 2–3 days to simulate chronic metal exposure and to avoid
inorganic carbon and nutrient depletion. Analytical blanks (i.e.,
treatment without meiospores) corresponding to each copper treat-
ment must also be prepared.
3. To measure the total dissolved metal concentrations, collect
fresh and old media (2–3 days old) corresponding to each nomi-
nal concentration into 10  mL polyethylene screw-capped tubes
using trace metal clean procedure. From each replicate of each
heavy metal treatment (with meiospores) and the corresponding
analytical blanks, collect 0.15  mL of culture medium, dilute in
4.25  mL of ultrapure water, and acidify with 0.09  mL of HNO3
(acidified sample, 4.5 mL 2% HNO3) and store until analysis (Note 6).
This will allow one to calculate and distinguish metal loss
because of adsorption in stock solution bottle and in culture ves-
sels and absorption by the cell, and possible metal contamination
because of unsterile environment. The metal absorbed by the cell
can then be calculated as metal loss in treatment A–metal loss in
blank A.
122 Protocols for Macroalgae Research

6.4.4 End points

End points such as meiospore germination, germling growth rate, game-
tophyte sex differentiation, and sex ratio can be measured from photo-
graphs of the meiospores cultivated under different metal concentrations.

1. Take digital photographs of at least five visual fields of each

experimental unit under an inverted microscope. The visual field
may be haphazardly chosen or determined by random sampling.
A  10×  objective is recommended. Photographs in time series,
for example, every two days, are necessary to quantify different
response variables. Photographs can be analyzed by using different
software such as ToupView 3.5 (Abràmoff et al. 2004).
2. The following response variables can be qualified and quantified in
the photographs:
a. Meiospore germination is visible after two days. Meiospores
are considered germinated when the germ tube is visible.
Germination percentage (%) is calculated from 350 individuals
in each experimental unit.
b. Germling growth rate can be measured from day three and
thereafter. Measure the size of at least 30 germlings (i.e., sexu-
ally ambiguous growing meiospores) in each experimental
unit. Germling growth rate in each treatment can be calculated
using the equation described by Yong et al. (2013): Growth rate
(%·day−1) = ([(Wt/W0)1/t – 1]) × 100, where W0 is the initial size, Wt
is the final size, and t is days of culture.
c. Sexually differentiated gametophyte development and sex
ratio can be measured after 15  days and thereafter. Measure
the size of at least 30 male and 30 female gametophytes in each
experimental unit. Gametophyte growth rate can be calculated
using the above-mentioned formula. From haphazardly chosen
visual fields, count at least 200 gametophytes and classify them
as male or female (Figure 6.3). A sex ratio can be expressed as
the frequency of males per progeny, that is, number of males/
(number of males + number of females) (Roleda et  al. 2012).
The sex ratio of 0.5: equal number of males and females, >0.5:
sex ratio is biased toward males, and <0.5: sex ratio is biased
toward females.
3. The EC50, that is, the concentration of the toxicant (e.g., metal) that
caused the inhibition of 50% of an end point (e.g., meiospore germi-
nation or germling growth) can be calculated using statistical soft-
ware (Figure 6.4).
Chapter six: Heavy metal ecotoxicity on the early life history stages 123

Figure 6.3  Sexually differentiated kelp gametophytes after 15 day cultivation.

70
y = 0.2946x + 3.209
60
Germination inhibition (%)

R2 = 0.8814
50

40

30

20

10

0
0 50 100 150 200
Dissolved metal concentration (μg L−1)

Figure 6.4  Relationship between dissolved heavy metal concentration and ger-
mination rate expressed as percentage. Linear regression was used to obtain
dose–response relationship. The calculated half maximal effective concentration
EC50 is 159 µg L−1 dissolved metal.
124 Protocols for Macroalgae Research

6.4.5 Adaptation of the protocol to microalgae

and adult macroalgal specimens
The earlier protocol may also be used for toxicity tests on microalgae and
adult macroalgal specimens with corresponding modifications.

1. During exponential growth phase, microalgal cells are transferred

to different media with known concentrations of the toxicant (Levy
et al. 2007). Most of the microalgal toxicity tests measure the decrease
in growth rates (aka cell division rate) after 48–72 h of exposure to
the toxicant (Stauber 1995, Levy et al. 2007). The inhibitory effects
of the toxicant on the photosynthetic rates can also be measured
(Abalde et  al. 1995, Magnusson et  al. 2008) using standard proto-
cols for dissolved oxygen measurement using oxygen electrode or
optode.
2. For adult macroalgal specimens, whole juvenile individual or meri-
stematic pieces of the adult thalli (e.g., excised discs or tips) are
exposed to a range of known nominal concentrations of the toxicant.
When using excised tissue, the marginal wounds must be allowed to
heal first before experimental exposure to the toxicant. This can be
performed by cultivating the macroalgal pieces under optimal con-
dition for at least 1–2 days. Then the toxicity assay can be performed
under standard culture conditions with constant aeration and/or
water movement. The starting biomass per unit volume of seawater
(biomass to volume ratio) must be optimized (e.g., 1 g fresh weight
L−1). The starting biomass, for example, tissue size or weight, of each
experimental unit is recommended to be comparable among differ-
ent treatments, that is, concentrations of the toxicant (Haglund et al.
1996). The surface area or weight of the sample can be measured every
2–3 days to calculate growth inhibition and biomass loss/reduction
(Haglund et al. 1996). Inhibition of photosynthetic efficiency can be
measured using a pulse amplitude modulated (PAM) chlorophyll
fluorometer (Baumann et al. 2009). For chronic exposure to toxicants
(e.g., heavy metal), the ambient or nutrient replete seawater with the
respective nominal metal concentration must be renewed every two
days; this will avoid nutrient (e.g., nitrogen, phosphorous, and car-
bon) depletion (Stauber 1995, Leal et al. 2016b), which may confound
the effects of the toxicant.

6.5 Notes
Note 1: Ideally, it is recommended to use different individuals as rep-
licates to measure individual variability to a given stress factor.
However, in the case of extensive experimental variables and levels
Chapter six: Heavy metal ecotoxicity on the early life history stages 125

of treatment to contend with, working with several spore suspen-

sions released from different individuals (e.g., n = 5) may be logis-
tically unworkable. Therefore, spores released from sori of at least
10 individuals may be pooled into one stock spore suspension, and
experimental replication of n = 5 can be dispensed from the pooled
spore suspension (Leal et al. 2017).
Note 2: After removing visible epibionts and thorough cleaning, blades
may be treated with germanium oxide solution to eradicate nonvis-
ible microalgae, for example, diatoms (Andersen and Kawashi 2005).
The concentration must be carefully adjusted such that chemical
residues on the blade during subsequent spore release should not
have any negative effects on the vitality and viability of spores.
Note 3: We recommend sampling the uppermost layer of the spore
suspension in which swimming meiospores are likely to be concen-
trated, whereas exudates, detritus, and unviable meiospores precipi-
tate to the bottom of the container.
Note 4: Recommended spore suspension density to ensure well-
dispersed and even spore settlement density (Figure 6.3).
Note 5: Determination of the concentration range (low and high range)
of the heavy metal must consider the ecological significance of the
treatment or the mechanistic effect of the toxicant. The stock solution
(with nominal concentration) must be prepared during the sched-
uled day for the renewal of the medium and must be used within
1 h of preparation.
Note 6: Total dissolved metal concentrations can be quantified using
inductively coupled plasma mass spectroscopy (Leal et  al. 2016b),
among other standard protocols.

References
Abalde, J., Cid, A., Reiriz, S., Torres, E., and Herrero, C. 1995. Response of the
marine microalga Dunaliella tertiolecta (Chlorophyceae) to copper toxicity in
short time experiments. Bull. Environ. Contam. Toxicol. 54:317–324.
Abràmoff, M.D., Magalhães, P.J., and Ram, S.J. 2004. Image processing with image.
J. Biophotonics Int. 11:36–42.
Andersen, R.A. and Kawashi, M. 2005. Traditional microalgae isolation tech-
niques. In Andersen, R. A. (Ed.) Algal Culturing Techniques. 1st ed. Elsevier
Academic Press, Burlington, NJ, pp. 83–100.
Anderson, B.S., Hunt, J.W., Turpen, S.L., Coulon, A.R., and Martin, M. 1990.
Copper toxicity to microscopic stages of giant kelp Macrocystis pyrifera:
Interpopulation comparisons and temporal variability. Mar. Ecol. Prog. Ser.
68:147–156.
Baumann, H.A., Morrison, L., and Stengel, D.B. 2009. Metal accumulation and
toxicity measured by PAM-Chlorophyll fluorescence in seven species of
marine macroalgae. Ecotoxicol. Environ. Saf. 72:1063–1075.
126 Protocols for Macroalgae Research

Burridge, T.R. and Bidwell, J.R. 2002. Review of the potential use of brown algal
ecotoxicological assays in monitoring effluent discharge and pollution in
southern Australia. Mar. Pollut. Bull. 45:140–147.
Chapman, P.M. 1995. Ecotoxicology and pollution—Key issues. Mar. Pollut. Bull.
31:167–177.
Contreras, L., Medina, M.H., Andrade, S., Oppliger, L.V., and Correa, J.A. 2007.
Effects of copper on early developmental stages of Lessonia nigrescens Bory
(Phaeophyceae). Environ. Pollut. 145:75–83.
Eklund, B.T. and Kautsky, L. 2003. Review on toxicity testing with marine mac-
roalgae and the need for method standardization—Exemplified with copper
and phenol. Mar. Pollut. Bull. 46:171–181.
Garman, G.D., Pillai, M.C., and Cherr, G.N. 1994. Inhibition of cellular events dur-
ing early algal gametophyte development: Effects of select metals and an
aqueous petroleum waste. Aquat. Toxicol. 28:127–144.
Guillard, R.R.L. and Sieracki, M.S. 2005. Counting cells in cultures with the
light microscope. In Andersen, R. A. (Ed.) Algal Culturing Techniques. 1st ed.
Elsevier Academic Press, Burlington, NJ, pp. 239–252.
Haglund, K., Björklund, M., Gunnare, S., Sandberg, A., Olander, U., and Pedersén,
M. 1996. New method for toxicity assessment in marine and brackish
environments using the macroalga Gracilaria tenuistipitata (Gracilariales,
Rhodophyta). Hydrobiologia. 326/327:317–325.
Leal, P.P., Hurd, C.L., Fernández, P.A., and Roleda, M.Y. 2017. Ocean acidification
and kelp development: reduced pH has no negative effects on meiospore
germination and gametophyte development of Macrocystis pyrifera and
Undaria pinnatifida. J. Phycol. 53:557–566.
Leal, P.P., Hurd, C.L., and Roleda, M.Y. 2014. Meiospores produced in sori of non-
sporophyllous laminae of Macrocystis pyrifera (Laminariales, Phaeophyceae)
may enhance reproductive output. J. Phycol. 50:400–405.
Leal, P.P., Hurd, C.L., Sander, S.G., Armstrong, E.A., and Roleda, M.Y. 2016a.
Copper ecotoxicology of marine algae: A methodological appraisal. Chem.
Ecol. 32:786–800.
Leal, P.P., Hurd, C.L., Sander, S.G., Kortner, B., and Roleda, M.Y. 2016b. Exposure
to chronic and high dissolved copper concentrations impede meiospore
development of the kelps Macrocystis pyrifera and Undaria pinnatifida
(Ochrophyta). Phycologia. 55:12–20.
Levy, J.L., Stauber, J.L., and Jolley, D.F. 2007. Sensitivity of marine microalgae to
copper: The effect of biotic factors on copper adsorption and toxicity. Sci.
Total Environ. 387:141–154.
Magnusson, M., Heimann, K., and Negri, A.P. 2008. Comparative effects of herbi-
cides on photosynthesis and growth of tropical estuarine microalgae. Mar.
Pollut. Bull. 56:1545–1552.
Maienthal, E. and Becker, D. 1976. A survey of current literature on sampling,
sample handling, and long term storage for environmental materials. Natl.
Bur. Stand. (U.S.), Tech. Note 929:40 p.
Richter, R. 2003. Clean Chemistry Techniques for the Modern Laboratory. First.
Milestone Press, Shelton, CT. 96 p.
Roleda, M.Y., Campana, G.L., Wiencke, C., Hanelt, D., Quartino, M.L., and Wulff,
A. 2009. Sensitivity of Antarctic Urospora penicilliformis (Ulotrichales,
Chlorophyta) to ultraviolet radiation is life-stage dependent. J. Phycol.
45:600–609.
Chapter six: Heavy metal ecotoxicity on the early life history stages 127

Roleda, M.Y., Morris, J.N., McGraw, C.M., and Hurd, C.L. 2012. Ocean acidification
and seaweed reproduction: Increased CO2 ameliorates the negative effect of
lowered pH on meiospore germination in the giant kelp Macrocystis pyrifera
(Laminariales, Phaeophyceae). Glob. Chang. Biol. 18:854–864.
Roleda, M.Y., Wiencke, C., Hanelt, D., and Bischof, K. 2007. Sensitivity of the early
life stages of macroalgae from the northern hemisphere to ultraviolet radia-
tion. Photochem. Photobiol. 83:851–862.
Stauber, J.L. 1995. Toxicity testing using marine and freshwater unicellular algae.
Australas. J. Ecotoxicol. 1:15–24.
van Dam, R.A., Harford, A.J., Houston, M.A., Hogan, A.C., and Negri, A.P. 2008.
Tropical marine toxicity testing in Australia: A review and recommenda-
tions. Australas. J. Ecotoxicol. 14:55–88.
Yong, Y.S., Yong, W.T.L., and Anton, A. 2013. Analysis of formulae for determina-
tion of seaweed growth rate. J. Appl. Phycol. 25:1831–1834.
chapter seven

A simple protocol for a rapid and

consistent production of a large
number of viable protoplasts
from the Ulvophycean species
Vishal Gupta and C.R.K. Reddy

Contents
7.1 Introduction ........................................................................................... 129
7.2 State of the art ........................................................................................ 130
7.3 Materials................................................................................................. 131
7.3.1 Reagents ..................................................................................... 131
7.3.2 Equipment .................................................................................. 131
7.3.3 Reagent setup ............................................................................ 132
7.4 Experimental procedures .................................................................... 132
7.5 Notes ....................................................................................................... 135
Acknowledgments ......................................................................................... 136
References........................................................................................................ 136

7.1 Introduction
Protoplasts, the plant somatic cells devoid of cell wall, offer a unique
experimental material for cellular biology and biotechnology (Davey et al.
2005). The most remarkable achievement of protoplast research has been
the development of various agricultural crop varieties with improved
agronomic traits by somatic hybridization (Bajaj 2004). Protoplasts have
also been extensively employed in genetic transformation studies because
of their amenability for genetic manipulation techniques (Eeckhaut et al.
2013). The recent developments in modern biotechnology techniques have
further broadened the scope of application of protoplast research in fur-
ther understanding the genetic regulations involved in dedifferentiation
(Xiao et al. 2012), organelle distribution and epigenetic changes (Jiang et al.

129
130 Protocols for Macroalgae Research

2013), signal transduction (Costa et  al. 2012), transient gene expression
system (Miao and Jiang 2007; Yoo et al. 2007; Zhang et al. 2011; Pitzschke
and Persak 2012; Thévenin et al. 2012), interaction between transcription
factors and genes (Li et  al. 2011; Wehner et  al. 2011; Huha et  al. 2013;
Ge  et  al.  2013), cell-wall biosynthesis (Zhao et  al. 2008; Bhargava et  al.
2013), gene deletion, and mutation library creation (Ge et al. 2013). Recent
interest on cell-specific expression profiling has further provided impetus
to the protoplast research (Robert et al. 2007; Tohge et al. 2011). In addition,
plant protoplasts have also been employed as simple, fast, reliable, and
versatile one-hybrid like screening system to investigate the interaction
studies between transcription factors and their associated genes offering
advantages over the yeast two-hybrid system (Thévenin et al. 2012).
The protoplast isolation from terrestrial plants was first initiated by
Von Hannstein in 1880 by using the mechanical method and was subse-
quently refined by Plowe in 1931 (Cocking 1961). Cocking in 1961 showed
the first successful isolation of protoplasts from tomato seedling root tips
using cellulase extracted from fungus Myrothecium verrucariae (Cocking
1961). The successful regeneration of plant protoplasts with the enzymatic
treatment of tissue was first published by Takebe et al. (1971) in tobacco,
almost a decade later from the first report of protoplasts isolation. As com-
pared with higher plants, marine macroalgal protoplast research is in a
nascent stage and dates back to 1970.

7.2 State of the art

Similar to higher plants, the initial studies have followed mechanical
methods for isolation of protoplasts from siphonaceous coenocytic algae
(Tatewaki and Nagata 1970; Enomoto and Hirose 1972; Kobayashi 1975).
The success in producing a large number of viable protoplasts has become
possible only after the development of an enzymatic method by Millner
et al. (1979) for Enteromorpha intestinalis (Linnaeus) Nees. Since then, con-
siderable efforts have been made to isolate and culture protoplasts from
diverse marine macroalgal species (Reddy et  al. 2008, 2010). The proto-
plasts’ yield, viability, and regeneration rate have been attributed to sev-
eral factors, including the enzyme constituents, their concentrations, pH,
osmotic conditions and ionic strength of the isolation medium, incubation
temperature, physiological state and age of donor plant, and its culture
conditions (Reddy and Fujita 1989, 1991; Krishna Kumar et al. 1999; Reddy
et al. 2006). The complexity and associated variations in cell-wall composi-
tion of seaweeds further pose difficulties in protoplast preparation using
the enzymes commonly used for terrestrial plants. The enzyme composi-
tions thus far employed for protoplast preparation from seaweeds have
been complex and include either one or a mixture of crude enzymes that
were mostly sourced from microbes or marine animals (abalone, aplysia,
Chapter seven: A simple protocol for protoplasts production 131

and top shell) guts (Reddy et al. 2008). In addition to these complexities,
most of the enzyme formulations previously employed for isolation of
protoplasts from Ulvophycean species were made in seawater (Saga 1984;
Saga and Kudo 1989; Uppalapati and Fujita 2002). The high-ionic potential
of the medium was reported to interfere with studies on electrofusion,
and other investigation on ion channels. Consequently, enzyme formula-
tions made in distilled water supplemented with a higher concentration of
osmolyte, for example, mannitol (1 M), have been preferred (Zhang 1983;
Fujita and Migita 1985). However, the viability (30%) and regeneration
abilities (50% of viable protoplasts) of such isolated protoplasts have been
found to be markedly low as compared with those obtained with seawater-
based enzyme mixture. The high-osmotic medium has been reported to
affect the regeneration rate and subsequent morphogenesis of cultured
protoplasts (Saga et  al. 1986). The use of higher concentrations of osmo-
lytes (sugar alcohols) is prone to cause microbial contamination imposing a
gradual dilution of it in protoplast culture medium to improve and induce
morphogenesis. Therefore, the development of a facile, reliable, and uni-
fied protocol for routine protoplast preparation with reproducible yield is
of paramount importance to circumvent the inherent problems associated
with the use of previously reported enzyme mixtures regarding variabil-
ity in yield, regeneration rate, and developmental morphogenesis.

7.3 Materials
7.3.1 Reagents
• Sodium chloride (NaCl).
• 2-(N-Morpholino) ethanesulfonic acid.
• Dextran sulfate sodium salt.
• Mannitol.
• Cellulase Onozuka R-10 (Yakult Co. Ltd., Tokyo, Japan).
• Macerozyme R-10 (Yakult Co. Ltd., Tokyo, Japan).
• Deionized water (Millipore water).

7.3.2 Equipment
• Weighing balance (analytical type).
• Weighing boats.
• Magnetic stirrer with stirring rod and bar.
• pH meter.
• Refrigerated centrifuge.
• Centrifuge tubes (polypropylene).
• Tube racks.
• Cryovials.
132 Protocols for Macroalgae Research

• Cryovial storage box.

• Tissue chopping plates.
• Single-edge surgical blades.
• Orbital platform shaker.
• Glass funnel.
• Glass beakers.
• Nylon mesh (30 µm pore diameter).
• Centrifuge glass tubes (Pyrex).
• Petri dish (tissue culture grade).
• Glass pipettes.
• Microscope upright.
• Refrigerator (4°C and −20°C).

7.3.3 Reagent setup

Enzyme mixture is prepared by dissolving 2% of cellulase Onozuka
R-10 in precooled (4°C) deionized water with 1% of NaCl, 25  mM of
2-(N-Morpholino) ethanesulfonic acid (Sigma-Aldrich, USA), and 0.5%
dextran sulfate (Sigma-Aldrich, USA) adjusted to pH 6.0. Later, the mix-
ture was centrifuged at 10,000 × g for 20 min at 4°C, and the clear superna-
tant was used for isolating protoplasts. Mannitol was added as osmoticum
to a final concentration of 0.8 M in the enzyme solution just before com-
mencing the protoplast isolation experiment (Notes 1 and 2).

7.4 Experimental procedures

1. Take clean and healthy thallus of 100 mg of fresh weight (Note 3).
2. Chop the tissue with a sharp razor blade to a size of <2 mm.
3. Transfer the chopped material to a glass tube.
4. Add autoclave seawater to it to remove debris.
5. Repeat step 4 for 3–4  times till clear supernatant was obtained.
6. Decant sweater completely from the glass tube.
7. Add enzyme solution to chopped tissue in a glass tube and transfer
the material to a Petri dish.
8. Incubate the Petri dish at a temperature of 22°C–25°C on an orbital
shaker at a speed of 60 rpm under dark.
9. After 2  h of incubation, take first microscopic observation for the
release of protoplasts.
10. After the release of protoplasts, filter the solution using a nylon mesh
of pore size of 30 µm and collect the solution in a centrifuge tube.
11. Centrifuge the solution at 800 rpm for 3–5 min (Note 4).
12. Remove the supernatant in another tube without disturbing the pel-
let (Note 5).
13. Wash the pellet with sterile seawater.
Chapter seven: A simple protocol for protoplasts production 133

14. Repeat steps 11 and 12.

15. Gently dispense the pellet containing protoplasts in 1 mL of sterile
seawater.
16. Estimate the protoplasts yield by traditional hemocytometer method.

The schematic description of the protocol is shown in Figure 7.1. The iso-
lated protoplasts following this protocol from different species of genus
Ulva were spherical in shape, ranging from 20 to 32 µm in size and con-
tained a cup-shaped parietal chloroplast. The resultant protoplast yields,
and regeneration rate are summarized in Table 7.1. Regeneration rate of
protoplasts was calculated on the basis of the number of cells dividing
and regenerating into germlings. Most of the protoplasts under opti-
mal culture conditions (temperature 25°C and photon flux intensity of
15 µM m−2 s−1) regenerated cell wall after 72 h and subsequently initiated
cell division. The dedifferentiation of protoplast to develop germlings is
shown in Figure 7.2. Cell-wall development was confirmed as the emission
of blue fluorescence after staining with calcofluor white MR2 (Fluorescent
brightener 28, Sigma Aldrich, USA) (Figure 7.2).

Chopping Transferred Rinsing with

seawater

Algal Thalli

is
Debr l
Enzyme Seawater va
remo
ion mix removal
b at
cu
In
Filtra
ion t

Centrifuge Protoplasts

Figure 7.1   Schematic diagram of the protocol developed for rapid isolation of
protoplasts from Ulvophycean species.
134 Protocols for Macroalgae Research

Table 7.1 Protoplasts yields and regeneration rates obtained from different
Ulvophycean species following the described protocol
Protoplasts yield
Species (×106 cells/g fresh wt.) Regeneration rate (%)
Ulva conglobata 85.2 ± 2.9 92.3 ± 6.8
U. fasciata 81.4 ± 2.1 90.7 ± 7.3
U. lactuca (wild) 74.5 ± 1.6 89.4 ± 5.6
U. lactuca (sterile mutant) 76.6 ± 1.2 91.2 ± 4.5
U. pertusa (sterile mutant) 74.4 ± 1.9 92.3 ± 6.2
U. reticulata 88.6 ± 2.3 90.3 ± 6.7
U. rigida 79.6 ± 1.1 89.5 ± 2.4
Enteromorpha tubulosa 89.7 ± 1.9 91.4 ± 4.7
E. flexuosa 95.4 ± 2.2 91.4 ± 4.8
E. compressa 82.5 ± 1.5 90.5 ± 5.9
Monostroma oxyspermum 102.8 ± 1.8 90.5 ± 6.5

40 μm 40 μm 50 μm
(a) (b) (c)

50 μm 100 μm 500 μm

(d) (e) (f )

1 mm 60 μm

(g) (h) (i)

Figure 7.2 Developmental morphogenesis of cultured protoplasts. (a) Freshly iso-

lated protoplasts, (b) Cell wall regeneration in 3 day old protoplast, (c) Protoplast
regeneration after 4 days, (d) 6 days, (e) 8 days, (f) 12 days, and (g) 18 days, (h) small
germlings in the Petri dish after 25 days, (i) 4 day old protoplast with spore formation.
Chapter seven: A simple protocol for protoplasts production 135

7.5 Notes
Note 1: While preparing and handling the enzyme mix, it is advised
to maintain the temperature at 4°C. Exposing the enzyme mix at
room temperature for long durations is detrimental to its activity
and results in poor or no yields of protoplasts.
Note 2: Store enzyme mix at −20°C.
Note 3: The exponentially growing algal tissue is required to obtain
good yields of protoplasts (Table 7.2).
Note 4: Protoplasts are highly fragile because of the lack of rigid cell
wall; therefore, they advised to handle very carefully. Shake or acci-
dental jerks may lead to the rupture of released protoplast.
Note 5: The supernatant after step 12 can be collected and stored at
−20°C for further reuse as enzyme mix for protoplast preparation.
This can be continued for five times.

Table 7.2 Troubleshooting table

Problem Possible reason Solution
Poor yields Health of the Assure the exponential growth
algal tissue of the alga before processing
for protoplasts isolation
Chopping Assure fine chopping of the
tissue to the level of size of
<2 mm
pH of the Check and adjust the pH of the
enzyme mix enzyme mix to 6.0
Enzyme Enzyme mix should be stored at
handling low temperature
Incubation Check and incubate the algal
temperature tissue with enzyme mix at
temperature of 25°C
Bursting or shrinking Osmotic Check and adjust the osmotic
of released balance balance of protoplasts isolation
protoplasts medium with 0.8 M mannitol
along with 2% NaCl (w/v)
Low-regeneration Handling error Assure gentle handling of
rate protoplasts as they rupture
with shake and jerks
Centrifugation Check and centrifuge at low
speed in swing-bucket rotor
Use of pipettes Check and use wide mouth
glass pipettes instead of
micropipette
136 Protocols for Macroalgae Research

Acknowledgments
The financial support received from the FP7 program of European
Commission under grant agreement no. 241383 is gratefully acknowl-
edged. VG thanks, CSIR-NIO, Goa for infrastructural support in writing
this protocol.

References
Bajaj, Y.P.S. 2004. Biotechnology in agriculture and forestry. In Somatic Hybridization
in Crop Improvement I, vol. 27. Springer-Verlag, Berlin, Germany.
Bhargava, A., Ahad, A., Wang, S., Mansfield, S.D., Haughn, G.W., Douglas, C.J.,
and Ellis, B.E. 2013. The interacting MYB75 and KNAT7 transcription fac-
tors modulate secondary cell wall deposition both in stems and seed coat in
Arabidopsis. Planta 237: 1199–1211.
Cocking, E.C. 1961. Properties of isolated plant protoplasts. Nature 191: 780–782.
Costa, A. et  al. 2012. The Arabidopsis central vacuole as an expression system
for intracellular transporters: Functional characterization of the Cl−/H+
exchanger CLC-7. J. Physiol. 590: 3421–3430.
Davey, M.R., Anthony, P., Power, J.B., and Lowe, K.C. 2005. Plant protoplasts: Status
and biotechnological perspectives. Biotechnol. Adv. 23: 131–171.
Eeckhaut, T., Lakshmanan, P.S., Deryckere, D., van Bockstaele, E., and van
Huylenbroeck, J. 2013. Progress in plant protoplast research. Planta 238:
991–1003.
Enomoto, K. and Hirose, H. 1972. Culture studies on artificially induced apla-
nospores in the marine alga Boergesenia forbesii (Harvey) Feldman
(Chlorophyceae, Siphonocladales). Phycologia 11: 119–122.
Fujita, Y. and Migita, S. 1985. Isolation and culture of protoplasts from seaweeds.
Bull. Fac. Fish. Nagasaki Univ. 57: 39–45.
Ge, C.Y., Duan, Y.B., Zhou, M.G., and Chen, C.J. 2013. A protoplast transformation
system for gene deletion and complementation in Sclerotinia sclerotiorum.
J. Phytopathol. 161: 800–806.
Huha, S.U., Kimb, M.J., and Paeka, K.H. 2013. Arabidopsis Pumilio protein APUM5
suppresses Cucumber mosaic virus infection via direct binding of viral
RNAs. Proc. Natl. Acad. Sci. USA. 110: 779–784.
Jiang, F., Zhu, J., and Liu, H.L. 2013. Protoplasts: A useful research system for plant
cell biology, especially dedifferentiation. Protoplasma 250: 1231–1238.
Kobayashi, K. 1975. Growth of extra cellular protoplast of Bryopsis maxima in an
agar medium. Bull. Tokyo Gakugei Univ. Ser. 27: 1–5.
Krishna Kumar, G.R., Addepalli, M.K., and Reddy, C.R.K. 1999. Regeneration of
the thallus of Monostroma oxyspermum (Chlorophyta) from protoplasts in
axenic culture. Phycologia 38: 503–507.
Li, E., Wang, S., Liu, Y., Chen, J.G., and Douglas, C.J. 2011. Ovate family protein4
(OFP4) interaction with KNAT7 regulates secondary cell wall formation in
Arabidopsis thaliana. Plant J. 67: 328–341.
Miao, Y. and Jiang, L. 2007. Transient expression of fluorescent fusion proteins in
protoplasts of suspension cultured cells. Nat. Protoc. 2: 2348–2353.
Millner, P.A., Callow, M.E., and Evans, L.V. 1979. Preparation of protoplasts from
the green alga Enteromorpha intestinalis (L.). Planta 147: 174–177.
Chapter seven: A simple protocol for protoplasts production 137

Pitzschke, A. and Persak, H. 2012. Poinsettia protoplasts—A simple, robust and

efficient system for transient gene expression studies. Plant Methods 8: 14.
Reddy, C.R.K., Dipakkore, S., Krishnakumar, G.R., Jha, B., Cheney, D.P., and Fujita,
Y. 2006. An improved enzyme preparation for rapid mass production of pro-
toplasts as seed stock for aquaculture of macrophytic marine green algae.
Aquaculture 260: 290–297.
Reddy, C.R.K. and Fujita, Y. 1989. Protoplasts isolation and fusion of Ulvapertusa
and U. conglobata. In Current Topics in Marine Biotechnology, Miyachi, S.,
Karube, I., and Ishida, Y. (Eds.), pp. 235–238. The Japanese Society of Marine
Biotechnology, Tokyo, Japan.
Reddy, C.R.K. and Fujita, Y. 1991. Regeneration of plantlets from Enteromorpha
(Ulvales, chlorophyta) protoplasts in axenic culture. J. Appl. Phycol. 3:
265–275.
Reddy, C.R.K., Gupta, M.K., Mantri, V.A., and Jha, B. 2008. Seaweed protoplasts:
Status, biotechnological perspectives and needs. J. Appl. Phycol. 20: 619–632.
Reddy, C.R.K., Gupta, V., and Jha, B. 2010. Developments in biotechnology of red
algae. In Red Algae in the Genomic Age, Cellular Origin, Life in Extreme Habitats
and Astrobiology, Seckbach., J. and Chapman, D.J. (Eds.), pp. 1309–1341.
Springer Publication, Dordrecht, the Netherlands.
Robert, S., Zouhar, J., Carter, C., and Raikhel, N. 2007. Isolation of intact vacuoles
from Arabidopsis rosette leaf–derived protoplasts. Nat. Protoc. 2: 259.
Saga, N. 1984. Isolation of protoplasts from edible seaweeds. Bot. Mag. Tokyo 97:
423–427.
Saga, N. and Kudo, T. 1989. Isolation and culture of protoplasts from the marine
green alga Monostroma angicava. J. Appl. Phycol. 1: 25–30.
Saga, N., Polne-Fuller, M., and Gibor, A. 1986. Protoplasts from seaweeds:
Production and fusion. Beih Nova Hedwegia 83: 37–43.
Takebe, I., Labib, G., and Melchers, G. 1971. Regeneration of whole plants from
isolated mesophyll protoplasts of tobacco. Naturwissenschaften 58: 318–320.
Tatewaki, M. and Nagata, K. 1970. Surviving protoplasts in vitro and their devel-
opment in Bryopsis. J. Phycol. 6: 401–403.
Thévenin, J. et al. 2012. A new system for fast and quantitative analysis of heter-
ologous gene expression in plants. New Phytol. 193: 504–512.
Tohge, T. et al. 2011. Toward the storage metabolome: Profiling the barley vacuole.
Plant Physiol. 157: 1469–1482.
Uppalapati, S.R. and Fujita, Y. 2002. A simple method for mass isolation of pro-
toplasts from species of Monostroma, Enteromorpha and Ulva (chlorophyta,
Ulvales). J. Appl. Phycol. 14: 165–168.
Wehner, N., Hartmann, L., Ehlert, A., Bottner, S., Onate-Sanchez, L., and
Droge-Laser, W. 2011. High-throughput protoplast transactivation (PTA)
system for the analysis of Arabidopsis transcription factor function. Plant J.
68: 560–569.
Xiao, L., Zhang, L., Yang, G., Zhu, H., and He, Y. 2012. Transcriptome of proto-
plasts reprogrammed into stem cells in Physcomitrella patens. PLoS One 7(4):
e35961.
Yoo, S., Cho, Y., and Sheen, J. 2007. Arabidopsis mesophyll protoplasts: A versatile
cell system for transient gene expression analysis. Nat. Protoc. 2: 1565–1572.
Zhang, D. 1983. Study on the protoplasts preparation, culture and fusion of
somatic cells from two species of green algae Ulva linza and Monostroma
angicava Kjellm. J. Shandong Coll. Oceanol. 13: 57–65.
138 Protocols for Macroalgae Research

Zhang, Y. et  al. 2011. A highly efficient rice green tissue protoplast system for
transient gene expression and studying light/chloroplast-related processes.
Plant Methods 7: 30.
Zhao, M., Morohashi, K., Hatlestad, G., Grotewold, E., and Lloyd, A. 2008. The
TTG1-bHLH-MYB complex controls trichome cell fate and patterning
through direct targeting of regulatory loci. Development 135: 1991–1999.
chapter eight

Purification of sporulation and

swarming inhibitors from Ulva
Application in algal life-cycle controlling
Ralf W. Kessler, Taghreed Alsufyani, and Thomas Wichard

Contents
8.1 Introduction ........................................................................................... 140
8.2 State of the art .........................................................................................141
8.3 Materials................................................................................................. 142
8.3.1 Ulva culture................................................................................ 142
8.3.2 Culturing of U. mutabilis on a large scale .............................. 142
8.3.3 Harvesting of Ulva biomass for the extraction and the
bioassay-guided fractionation of inhibitors .......................... 143
8.3.4 Induction of gametogenesis/sporogenesis and
bioassay-guided fractionation of the inhibitors ................... 143
8.3.5 Sporulation inhibitor 1: Extraction ......................................... 144
8.3.5.1 Sporulation inhibitor 1: Size-exclusion
chromatography for cleanup .................................... 144
8.3.6 Sporulation inhibitor 2: Extraction and bioassay-guided
fractionation............................................................................... 144
8.3.7 Swarming Inhibitor: Extraction and bioassay-guided
fractionation............................................................................... 145
8.4 Experimental procedures .................................................................... 145
8.4.1 Cultivation of U. mutabilis under standardized
conditions ................................................................................145
8.4.2 Induction of the gametogenesis/zoo sporogenesis and
preparation of the bioassays .................................................... 147
8.4.3 Sporulation inhibitor 1 ............................................................. 149
8.4.3.1 Extraction of the sporulation inhibitor 1 from
thallus .......................................................................... 149
8.4.3.2 Extraction of the sporulation inhibitor 1 from
(axenic) growth medium ........................................... 150

139
140 Protocols for Macroalgae Research

8.4.3.3 Bioassay-guided cleanup of sporulation

inhibitor 1 with size-exclusion chromatography .......150
8.4.4 Sporulation inhibitor 2 ............................................................. 152
8.4.4.1 Extraction of the sporulation inhibitor 2 ................ 152
8.4.4.2 Bioassay-guided cleanup of the sporulation
inhibitor 2 .................................................................... 153
8.4.5 Swarming inhibitor .................................................................. 153
8.4.5.1 Extraction and bioassay-guided cleanup of the
swarming inhibitor .................................................... 153
8.4.5.2 Bioassay-guided cleanup of the swarming
inhibitor .........................................................................154
8.5 Notes ....................................................................................................... 155
Acknowledgments ......................................................................................... 156
References........................................................................................................ 156

8.1 Introduction
Ulva species (Chlorophyta), also known as sea lettuce, are the most abun-
dant representatives of green macroalgae and can be found in coastal ben-
thic areas worldwide. They cause seasonal algal blooms in eutrophic waters
and even in areas contaminated with heavy metals (Gao et al. 2010). The
model organism, Ulva mutabilis, is a multicellular haplodiplontic alga, which
differentiates into a thallus and a holdfast. The thallus is made of blade
cells and the holdfast of stem and rhizoid cells (Løvlie 1964). The blade cells
develope into gametangia (sporangia) and release 16 biflagellated gametes
per gametangium (16 tetraflagellated zoospores) (Løvlie 1964, 1968; Wichard
and Oertel 2010). After merging of the two mating types of the gametes mt+
and mt–, zygotes are formed which develop into the sporophytes. However,
if the gametes do not find a mating partner, they develop into new gameto-
phytes, which allow the maintenance of haploid strains (Wichard 2015, see
Ulva′s life cycle in Chapter 9 by Califano and Wichard 2018).
The sporulation processes, gametogenesis and zoosporogenesis, are
key parts of Ulva reproduction and still an understudied field. Both the
gametophytes and sporophytes of the haplodiplontic Ulva have the same
morphological characteristics but form either biflagellated gametes or
quadriflagellated zoids. Sporulation can artificially be induced by cutting
the mature algae into smaller pieces and washing them. This treatment
removes sporulation inhibitors (SI-1 and SI-2), which regulate the differ-
entiation of blade cells into gametangia and sporangia in Ulva. (Nilsen
and Nordby 1975; Løvlie 1978; Stratmannet al. 1996). In addition, further
studies revealed that switching temperatures, as experienced by certain
tropical Ulva species, can induce the cell differentiation (Carl et al. 2014).
Moreover, Lüning et al. (2008) found that the reproduction rhythmicity of
U. pseudocurvata is also controlled by the moon phases (Lüning et al. 2008).
Chapter eight: Purification of sporulation and swarming inhibitors 141

The gametogenesis is subdivided into a determination phase (36 h),

within vegetative growth could be resumed by addition of SIs, and a
differentiation phase afterwards, insensitive to SIs when gametogenesis
occurred. (Wichard and Oertel 2010; Katsaros et al. 2017). After the point
of no return (36 h after induction), 16 progametes are formed and the pore
caps are completed during the third night after induction. The molecu-
lar changes during cell differentiation processes can also be monitored
through specific biomarkers in Ulva by mass spectrometric imaging
(Kessler et  al. 2017). The gamete discharge is controlled by the swarm-
ing inhibitor (SWI), a low-molecular weight factor (Wichard and Oertel
2010). On removal of the SWI, the gametes are discharged in the light.
As the orchestrated action of the inhibitors synchronizes both the sporu-
lation processes and the release of gametes, the mating probability of the
gametes can be highly increased. Sporogenesis and zoid release in sporo-
phytes are induced principally in the same way as in gametophytes, but
the latter are mainly used in this protocol for the purification of regulative
factors.

8.2 State of the art

Originally, sporulation inhibiting substances were extracted from a sus-
pension of living fragments of U. mutabilis (Nilsen and Nordby 1975). The
factor can be washed out and purified for further characterization by cut-
ting U. mutabilis into small pieces (Stratmann et al. 1996). Stratmann et al.
(1996) showed, by using bioassay-guided size-exclusion chromatography
(SEC), that the SI-2 activity belongs to a bouquet of at least three differ-
ent factors, equally biologically active, with molecular weights around
1000 Da. Moreover, the same research group extracted another SI, a gly-
coprotein (SI-1), from both the Ulva cell wall and Ulva culture medium
(UCM). This protein is unusually stable and showed an extremely high-
apparent molecular mass of 1–4 × 107 Da extracted from axenic callus-like
cultures of Ulva. However, when Ulva developed normally in the pres-
ence of their symbiotic bacteria, smaller forms of SI-1 accumulated in the
growth medium because of the bacterial decomposition processes. In this
context, gametogenesis-inhibiting glycoproteins (2–4  ×  104  Da) were also
found in the water-soluble extracts of the thallus of U. prolifera (Jonsson
et  al. 1985). Further attempts to characterize the glycoprotein revealed
that the substance binds to an anionic ion exchanger and to concanavalin
A-Sepharose, which captures glycosylated biomolecules.
Significantly, cross-testing studies between Ulva species showed that the
SI-2 factor was interchangeable between U. mutabilis and U. rigida, but not the
SI-1 factor, whereas both factors were interchangeable between U. mutabilis
and U. linza (Stratmann et al. 1996; Vesty et al. 2015). Gametes are finally dis-
charged by the gametangium when an SWI, which is released into the growth
142 Protocols for Macroalgae Research

SI-2 Isolation Solid-phase

(immediately) extraction
Rinsing Bioassay
fragments with guided
10 mM
Tris/HCI fractionation
Size exclusion SI-2 Isolation Cultivation Induction of
chromatogr. (mature culture) gametogenesis
Bioassay Phenol Harvesting of Fragmentation
guided extraction gametophytes of the thallus
fractionation of U. mutabilis
SWI-Isolation Solid-phase
(upon 24 hrs) extraction
Collecting Bioassay
supernatant guided
fractionation

Figure 8.1  All-in-one workflow for the partial purification of known inhibitors (sporu-
lation inhibitor 1 [SI-1], sporulation inhibitor 2 [SI-2], swarming inhibitor [SWI])
regulating the gametogenesis, and release of gametes in Ulva. On removal of SI-1
and SI-2, the SWI production can be induced by putting the fragmented algae into
fresh UCM. The best SI-1 extraction results can be achieved with axenic or with
young Ulva thalli.

medium during gametogenesis, declines below a threshold concentration.

After C18 solid-phase extraction, the mass spectrometric analysis revealed the
molecular ion of SWI at m/z 293 [M+H+] (Wichard and Oertel 2010).
The presented extraction protocol aims to purify all inhibitors from
one upscaled Ulva culture (Figure 8.1) and is based on earlier studies
(Stratmann et al. 1996; Vesty et al. 2015). Overall, the approach provides
partially purified regulative factors, for example, for studies in algal aqua-
culture for life-cycle controlling.

8.3 Materials
8.3.1 Ulva culture
The material necessary for the standard cultivation of Ulva was described
previously (Stratmann et al. 1996; Alsufyani et al. 2017). Gametophytes of
the same species, U. mutabilis (Føyn), were also used in the protocols of the
Chapters 9, 18, and 31.

8.3.2 Culturing of U. mutabilis on a large scale

Standardized cultures grown preferentially under axenic conditions or
with defined associated bacteria are recommended for reproducible extrac-
tion yields of the inhibitors (Stratmann et al. 1996, Alsufyani et al. 2017).

• 10 L UCM (see Chapter 9).

• 25 L polycarbonate bottle and sterile filters for air bubbling system
(Alsufyani et al. 2017).
Chapter eight: Purification of sporulation and swarming inhibitors 143

• About 1000–5000 two-week-old U. mutabilis germlings (ca. 5  mm

length) as seed stock (see Chapter 9 for detailed information about
the preparation of the seed stock).
• Bacterial cultures of Maribacter sp. MS6 and Roseobacter sp. MS2
cultured in half-strength Marine Broth (Carl, Roth, 40 g L–1 solved in
water) in sterile culture flasks (50 mL). A quantity of 1 mL of each bac-
terial culture (optical density at 620 nm = 1.0) is added to 10 L of UCM.
• An ultraviolet–visible (UV–vis) spectrometer for monitoring the
optical density of bacterial growth in Marine Broth.
• Autoclavable plastic sieve or mesh nets for harvesting Ulva.

8.3.3 Harvesting of Ulva biomass for the extraction and

the bioassay-guided fractionation of inhibitors
On account of the inducibility of gametogenesis and the determination
of SWI activity, three phases (Table 8.1) of growth can be defined in the
tripartite community of U. mutabilis (gametophytes of the natural devel-
opmental mutant, slender) (Alsufyani et al. 2017). The time point of har-
vesting of the Ulva samples has to be carefully selected depending on the
purpose of the experiment (Table 8.1).

8.3.4 Induction of gametogenesis/sporogenesis and

bioassay-guided fractionation of the inhibitors
• Growth stage of Ulva: Artificially inducible gametogenesis (A.I.G.)
(Table 8.1).
• Ulva culture medium (Stratmann et al. 1996).
• Reverse osmosis water.
• Herb chopper (e.g., Zick-Zick Food Chopper, Zyliss, Switzerland).

Table 8.1 Growth stage-dependent inducibility of sporulation in Ulva mutabilis

Age of culture
Growth stage on inoculation Recommended for
Noninducible <14 days - SI-1 and SI-2 extractions.
gametogenesis
(N.I.G.)
Artificially inducible 14–21 days - Combined extraction of SI-2 and SWI.
gametogenesis - Preparation of any bioassay
(A.I.G.) described.
Spontaneously >21 days - The culture already contains a
inducible mixture of different growth stages.
gametogenesis Gametogenesis of thalli still not
(S.I.G.) differentiated can be induced to
produce gametes for other purposes.
144 Protocols for Macroalgae Research

• Pipettes (1–100 µL) for preparing a dilution series.

• A total of 24- or 96-well plate (Sarstedt, Nümbrecht, Germany) for
performing multiple bioassays in parallel.
• Inverted microscope for monitoring the differentiation of blade cells
into gametangia (or sporangia) and the discharge of the gametangia.

8.3.5 Sporulation inhibitor 1: Extraction

• Growth stage of Ulva: Noninducible gametogenesis (N.I.G.) or axenic cul-
tures (Table 8.1).
• Liquid nitrogen.
• Pestle and mortar.
• Dounce tissue grinder set (Sigma Aldrich, München, Germany).
• Buffer: 10 and 50 mM Tris–HCl (pH 8.0) at room temperature.
• Extraction solution: Phenol saturated with 100  mM Tris–HCl and
1  mM EDTA adjusted to pH  7.5 in a brown glass bottle at room
temperature.
• Three-necked flask.
• Acetone.
• Absolute ethanol at −20°C.
• Bench top refrigerated centrifuge (at 0°C).
• Camaprene® (Honeywell, USA) or equivalent security gloves.

8.3.5.1 Sporulation inhibitor 1: Size-exclusion

chromatography for cleanup
• Sephadex G-50-Superfine (GE Healthcare, Germany); size: 18.8 × 1.1 cm
column; solvent: 30 mM NaCl, 10 mM Tris–HCl (pH 8) at 5.3 mL h−1.
• Peristaltic pump.
• Bradford protein quantification assay Rotiquant® (Carl Roth,
Karlsruhe, Germany).
• UV–vis spectrometer.

8.3.6 Sporulation inhibitor 2: Extraction and

bioassay-guided fractionation
• Growth stage of Ulva: We recommend using Ulva material of the
growth stage A.I.G. to combine the extraction of SI-2 and SWI
(Table 8.1).
• 10 mM Tris–HCl (pH 8.0).
• Different filters and membranes: Stainless steel filter in a funnel,
Whatman GF/C glass microfiber filter (GE Healthcare, Germany)
and cellulose acetate membranes (CA, 0.45 µm) (Carl Roth, Karlsruhe,
Germany).
Chapter eight: Purification of sporulation and swarming inhibitors 145

• Biotech dialysis membrane tubing (cutoff >500  Da <1000  Da)

(SpectrumLabs, Rancho Dominguez, USA).
• Sephadex LH-20 (GE Healthcare, Freiburg, Germany), column size:
27.5 × 1.7 cm, solvent: 1 mM ammonium acetate buffer at 5.3 mL h−1.
• Bench top refrigerated centrifuge (at 0°C).

8.3.7 Swarming Inhibitor: Extraction and

bioassay-guided fractionation
• Growth stage of Ulva: A.I.G. (Table 8.1).
• Solid-phase extraction (SPE): Sep-Pak C18 Plus Long Cartridge, 900 mg
sorbent per cartridge, 37–55 µm particle size (Waters, UK).
• Solvent for elution from SPE: Aqueous methanol.
• Fast protein liquid chromatography (FPLC): Column Superdex™ Peptide
10/300 GL (Sigma Aldrich, München, Germany), 30 × 1 cm.
• Ultrahigh pressure liquid chromatography: The column was a Polar-
Premium solvent (10 cm × 3 mm, particle size 2.6 µm; ThermoFisher
Scientific, Massachusetts, USA). The linear gradient was performed
with water (A) and acetonitrile (B) at a flow rate of 0.4  mL  min−1
over 11.5 min. The gradient was from 0% to 40% B in 1.0 min, from
40% to 52% B in 8  min, and from 52% to 100% (B) in 0.5  min, fol-
lowed by 1  min at initial conditions (0% B). The LC was coupled
to a QExactive–Quadrupole–Orbitrap LC–MS (Thermo Scientific,
Massachusetts, USA). The temperature of the source was main-
tained at 120°C and the desolvation temperature at 400°C. The cone
voltage was 10 V.
• High-pressure liquid chromatography (HPLC): The column was a
Purospher® Star RP-18e (25 × 1 cm, particle size 5 µm; MerckMillipore,
Massachusetts, USA). The linear gradient was performed with water
(A) and acetonitrile (B) at a flow rate of 2 mL min−1 over 36 min. The
gradient was from 0% to 40% B in 8 min; from 40% to 52% B in 20 min,
and from 52% to 100% in 2 min, followed by a hold for 5 min at initial
conditions (0% B).
• SpeedVac concentrator (SpeedVac RVC 2-25, Christ, Osterode,
Germany) to evaporate solvent.

8.4 Experimental procedures

8.4.1 Cultivation of U. mutabilis under standardized conditions
1. Haploid gametophytes from the fast-growing developmental mutant
slender (sl) of U. mutabilis Føyn (mt+) are cultured. A seed stock of
axenic gametes should be prepared for the cultivation of Ulva in bio-
reactors (see Chapter 9).
146 Protocols for Macroalgae Research

2. Gametes are separated from the accompanying bacteria according

to the well-established procedure by Spoerner et al. (2012) and are
finally used for the inoculation of an axenic (bacteria free) culture of
Ulva in UCM.
3. Axenic gametes (about 103 gametes) are incubated overnight in
250  mL sterile UCM in polycarbonate tissue culture flasks (BD
Falcon, Franklin Lake, NJ, USA) in the dark, allowing settlement of
the germ cells.
4. The bacterial strains, Roseovarius sp. MS2 (Genbank EU359909) and
Maribacter sp. MS6 (Genbank EU359911), essential for Ulva’s growth
and morphogenesis, are cultivated at 20°C in Marine Broth medium
on an orbital shaker. These bacteria were originally isolated from
U. mutabilis. The bacterial pellets were washed three times by resus-
pending them with sterile UCM before axenic germlings were inoc-
ulated with the two bacteria to establish the tripartite community.
5. Axenic germlings (feedstock) are used for the inoculation of the 25 L
bioreactors filled with 15 L UCM (Figure 8.2).
6. Standard culture conditions: Cultures are illuminated in a 17:7 h light/
dark regime at 20°C with 60–120 µmol photons (m−2 s2) (50% GroLux,
50% daylight fluorescent tubes; OSRAM, München, Germany).

(g) (f ) (e)

(b)

(c)

(d)
(a)

Figure 8.2 Drawing of the 25  L bioreactor used for cultivation of Ulva mutabilis:
(a)  air inlet; (b) sterile HEPA-Vent (Ø  =  50  mm, Whatman) filter; (c) air outlet;
(d) sampling outlet; (e) bubbling tube (Duran glass, Ø = 4 mm); (f) sampling tube
(Teflon, Ø = 1 mm); and (g) hose clamp to control the sampling flow. (Adapted
from Alsufyani, T. et al. 2017, With permission, CC-BY.)
Chapter eight: Purification of sporulation and swarming inhibitors 147

8.4.2 Induction of the gametogenesis/ zoo sporogenesis

and preparation of the bioassays
With the described conditions (8.4.1), spontaneous gametogenesis does
not occur until algae are older than four weeks, but gametogenesis can be
artificially induced by the removal of SIs (Alsufyani et al. 2017) (Table 8.1).
Culture conditions certainly have a strong impact on the age-dependent
growth stages influencing the inducibility of the gametogenesis.

1. Wash five U. mutabilis fertile thalli (3–5 cm length) with UCM and
incubate them in 0.2 L UCM for 15 min at room temperature.
2. Mince the alga into 3–5 mm² by using the herb chopper and incubate
the fragments in 50% UCM for 15 min at room temperature; repeat
the washing step twice (for further details see Chapter 9). Recover
the algal fragments through a mesh of 100 µm.
3. Prepare the dilution series of the potentially active test sample
with UCM in the 96-well plate. The total volume per well is 200 µL
(Figure 8.3a). The ratio of a standard dilution series might be, for
example, 1:5, 1:10, 1:50, and 1:100, but the dilution factor must be
adjusted if the SWI concentration is higher.
4. Do not forget a negative control: Only UCM (i.e., no inhibitor) is added
and, thus, all blade cells should differentiate into gametangia. In
the case of the positive control, a defined amount of SI (100 U mL−1,
see definition in step 9) of the laboratory quality control sample is
added. The blade cells should, thus, not differentiate into gametan-
gia or sporangia, respectively (Figure 8.3a). The quality control sam-
ples should be treated in the same manner as the test samples and
are used to validate the test run.
5. Transfer the sieved algal pieces with forceps into the multiwell plates
(40–80 pieces per well). When transferring the fragments (from step 2)
into the test well, remove the leftover liquid with a paper towel to
avoid the dilution of the test solution.
6. The algal fragments should be cultured under standard conditions
for the next three days.
7. On the morning of the third day after induction, the fragments must
be inspected in each test well under an inverted microscope. Those
fragments that show on blade cells are classified as noninduced; all
others with gametangia are classified as induced (Figure 8.3b). If the
positive control does not show any inhibition, the experiment needs to be
repeated with a new batch of younger algae, which can still perceive the
sporulation inhibitor.
148 Protocols for Macroalgae Research

1 2 3 4 5

Pos. Pos. Pos. Pos.

A Neg.
control control control control
control
1:5 1:10 1:20 1:50

B Neg. Sample 1 Sample 1 Sample 1 Sample 1

control 1:5 1:10 1:20 1:50

Neg. Sample 2 Sample 2 Sample 2 Sample 2

C control 1:5 1:10 1:20 1:50

(a)

(i) (ii)

Sample
without SI

100 μm 10 μm

(iii) (iv)

Sample
with SI

100 μm 100 μm
(b)

(i) (ii)

Sample
without SWI
Gametes
10 μm 10 μm

(iii) (iv)

Sample
with SWI

10 μm 10 μm
(c)

Figure 8.3   Set up for both sporulation and swarming inhibitor bioassays. (a) Multiwell-
based bioassay-guided fractionation and semiquantification through dilution series of
the biologically active samples. (a) The general principle of the bioassay activity test
for the sporulation inhibitors (SI-1 or SI-2) or the swarming inhibitor (SWI) is shown:
The negative control contains no inhibitor, all blade cells develop into gametangia. The
positive control contains a defined amount of SI or SWI. (b) Light microscopy reveals
the blade cells before the experiment (i, iii). Without SI-1 or SI-2 in the test sample,
(ii) cells develop into gametangia within three days. (c) Gametangia are shown (i, iii).
Without SWI in the test sample, (ii) gametangia are completely discharged within
15 min. The effect of inhibitory samples for both bioassays (b, c) is shown in (iv).
Chapter eight: Purification of sporulation and swarming inhibitors 149

8. As a proof of principle, induced fragments discharge the gametes

after an additional medium exchange. The whitish fragments can be
counted easily and subtracted from the total number of fragments
investigated (Equation 8.1):
Inhibitory rate ( % ) =
 Total amount of fragments − Amount of fragments 
  (8.1)
 with gametangia 
∗ 100
Total amount of fragments

9. 1 U of the SI-1 and SI-2 is hereby defined as the minimal amount of
the factor that inhibits differentiation of a blade cell into a gametan-
gium (=gametogenesis) with an inhibitory rate >50% in 1 mL UCM
within three days under standard conditions. If the test sample, for
example, diluted in a ratio of 1:5 reveals an inhibitory rate of 85%, but
only 40% in a ratio of 1:10, the sample contains 5 U mL−1 of the inhibi-
tor. Fragments (size: 1–5 mm²) sometimes show a mixture of the blade
and differentiated cells. Those fragments counted as induced, which
harbor more than 50% of differentiated cells (i.e., gametangia).

8.4.3 Sporulation inhibitor 1

Blade cells of U. mutabilis and U. linza excrete regulatory high-molecular
weight factors, which are probably unknown glycoproteins of various
molecular weights, into their cell wall and into the environment. As SI-1 accu-
mulates in the growth medium, it can be purified from media of (preferen-
tially) axenically growing algae, whose life cycle and morphogenesis were
abnormal (Spoerner et al. 2012). Mostly smaller SI-1 forms were detected in the
growth medium and in the cell walls under nonaxenic conditions (Stratmann
et al. 1996), because of potentially enzymatic digestion by the bacteria.

8.4.3.1 Extraction of the sporulation inhibitor 1 from thallus

1. The extraction of SI-1 must be carried out with a phenol solution.
Therefore, gloves (e.g., Campren®) are recommended for safety reasons.
2. Wash 1 g of thalli with distilled water and grind in liquid nitrogen
using a pestle and mortar.
3. Add 5 mL 50 mM Tris–HCl (pH 8.0) and treat the suspension with a
Dounce homogenizer (Note 1).
4. Insoluble material can be recovered by centrifugation (3800  rpm,
15 min, 0°C).
5. Wash the insoluble material with the same buffer once more and
then suspend it in 2 mL of 10 mM Tris–HCl (pH 8.0) buffer.
6. Mix the suspension at 60°C with the same volume of phenol (satu-
rated with 100 mM Tris–HCl, 1 mM EDTA, pH 7.5) and mix vigor-
ously for 20 min on an orbital shaker.
150 Protocols for Macroalgae Research

7. After cooling down the sample, the phases are separated by

centrifugation.
8. The phenol phase must be washed with 10 mM Tris–HCl (pH 8.0) by
again mixing, separating, and collecting the phenol phase.
9. Three volumes of acetone are added to the phenol phase and incu-
bated at −20°C for ≥30 min (Note 2).
10. The precipitate can be recovered by centrifugation (3800 rpm, 20 min,
0°C).
11. Wash the precipitate twice with absolute ethanol (Note 3).
12. After drying in the vacuum, resuspend the precipitate with 100 mM
Tris–HCl (pH 8.0) and store the sample at −20°C for further purifica-
tion steps.

8.4.3.2 Extraction of the sporulation inhibitor 1

from (axenic) growth medium
1. SI-1 should be prepared from growth medium of an Ulva specimen,
whose gametogenesis is not inducible (N.I.G.).
2. Growth medium must be filtered under sterile conditions through a
cellulose-acetate filter (0.22 µm).
3. Mix vigorously 1 L conditioned medium with 100 mL phenol (satu-
rated with 100 mM Tris–HCl, 1 mM EDTA, pH 7.5) on a shaker for
15 min at room temperature.
4. After centrifugation, transfer the phenol phase to a (siliconized)
plastic centrifuge tube.
5. This extraction should be repeated once and the phenol phases can
be combined afterward (Note 4).
6. After reextraction with the same volume of 10  mM Tris–HCl (pH
8.0), the phenol phase was mixed with three volumes of acetone and
incubated at −20°C for >30 min (Note 2).
7. The precipitate can be recovered by centrifugation (3800 rpm, 20 min,
0°C) and washed twice with absolute ethanol (Note 3).
8. After drying in the vacuum, suspend the precipitate with 100 mM
Tris–HCl (pH 8.0) and store the sample at −20°C for further purifica-
tion steps.

8.4.3.3 Bioassay-guided cleanup of sporulation inhibitor 1

with size-exclusion chromatography
1. Prepare the Sephadex G-50 column and equilibrate the gel bed with
the mobile phase (10 mM Tris–HCl).
2. Add the SI-1 extract carefully into the column and follow the stan-
dard procedure for SEC.
3. Perform the bioassay as described in 8.4.2 to identify the fraction
with SI-1 activity (Figure 8.4a).
Chapter eight: Purification of sporulation and swarming inhibitors 151

4000
6 6
Biological activity of SI-1 (Units mL )

Total protein concentration (μg mL−1)

Absorbance (arbitrary units)

−1

5 5
3000

at 233 nm
4 4

3 3 2000

2 2
1000
1 1
(c)
0 0
2500

activity of SWI (Units mL )

−1
0 5 10 15 20 25 30
2000
(a) Elution volume (mL)

Biological
1500

1000

500
100
(d)
14
80
Biological activity of SI-2

in counts per second (10 )

8
12
Inhibitory rate (%)

Intensity of m/z 293

60 10
8
40
6
4
20
2
0 0
0 5 10 15 20 25 14 16 18 20 22 24 26 28 30
(b) Elution volume (mL) (e) Retention time (min)

Figure 8.4   Bioassay-guided fractionations and cleanup of the various inhibitors by

(a,  b) size-exclusion chromatography (SEC) and (c–e) fast performance liquid chroma-
tography (FPLC): (a) SEC (Sephadex G-50) of the sporulation inhibitor 1 (SI-1)
extracted from UCM of axenic Ulva cultures. Biological activity (dark-black line)
was determined by the sporulation inhibitor bioassay, and the total protein con-
centration was determined by a Bradford assay (light-gray line). (b) SEC of the
sporulation inhibitor 2 (SI-2) extract (50 U mL−1). The bioassay was performed in
dilution steps of 1:5. The SI-2 was biologically determined, if the inhibitory rate
was higher than 50%. (c–e) FPLC UV–vis of the SWI extracted 24 h on induction
of the gametogenesis. The elution was monitored (c) by a UV detector at 233 nm,
(d) by the SWI-activity through the bioassay, and (e) by a mass spectrometric anal-
ysis (UHPLC-QExactive-Orbitrap-MS) at m/z 293  [M+H+]. The elution rate was
0.25 mL min−1 and fractions were collected every 0.25 min.
152 Protocols for Macroalgae Research

4. Prepare the Bradford assay:

• Add 10 µL Rotiquant® to 180 µL of each SI-1 fraction.
• Dilute with 200 µL distilled water and homogenize the solution.
• Measure the absorbance at 595 nm.
• Perform the calibration of the analysis with albumin by using
five equidistant concentrations and a minimum of three repli-
cates for each calibration standard.
5. The partially purified inhibitor can now be applied, for example, for
experiments of life-cycle controlling in Ulva.

8.4.4 Sporulation inhibitor 2

8.4.4.1 Extraction of the sporulation inhibitor 2
The SI-2 can be found in the lumen of the bilayered thallus of U. mutabi-
lis, U. linza, and U. rigida (Stratmann et al. 1996; Vesty et al. 2015). As the
SI-2 concentration is constant during the life time of the alga (Stratmann
et al. 1996), the time point of harvesting is not as critical as in the case
of purification of the SI-1 and SWI. However, the extraction should be
carried out with a dense solution of Ulva fragments (2–5  mm²). After
the exhaustive extraction of both SI-1 and SI-2, the gametogenesis is
induced and the SWI production starts. The following procedure for
SI-2 extraction is based on 1  g fresh weight of U. mutabilis fragments.
Ulva harvested directly from natural seawater samples must be cleaned
more carefully before processing. Alga should be washed and spin-
dried with a salad spinner in the first place for the processing of larger
amounts of biomass.

1. Harvest Ulva, dry it carefully with paper towels, and weigh the
biomass.
2. Wash the alga with UCM twice and incubate the biomass for 15 min
in 0.2 L UCM at room temperature to remove any leftover traces of
the SI-1.
3. An amount of 1 g of dried Ulva is suspended in 1 mL of 10 mM Tris–
HCl (pH 8) and minced into pieces with the herb chopper.
4. Add 3 mL of 10 mM Tris–HCl (pH 8) to the suspension and incubate
the alga for 15 min at room temperature.
5. Filter the algae with a stainless steel filter in a funnel.
6. Transfer the suspension to a 5 mL plastic cup (Eppendorf, Germany)
for centrifugation at 3800 rpm for 10 min at 4°C.
7. The supernatant is passed initially through a GF/C filter and then
through a cellulose-acetate membrane (0.45 µm).
8. All samples should be stored at −20°C.
Chapter eight: Purification of sporulation and swarming inhibitors 153

8.4.4.2 Bioassay-guided cleanup of the sporulation inhibitor 2

1. The extracted SI-2 from U. mutabilis must be freeze-dried carefully for
concentration, but not to dryness, and filtered through a cellulose-
acetate membrane (Note 5).
2. An amount of 40 mL of SI-2 is used with dialysis tubing with a cutoff
>500 Da <1000 Da for 24 h, which retains the SI-2, but removes the
high amounts of Tris–HCl (pH 8.0) from the sample (Note 6).
3. Due to the dilution effects of the membrane, cleaned up SI-2 has to
be freeze-dried again, but not to dryness (Note 5).
4. Prepare the Sephadex LH-20 column and the mobile phase (1 mM
ammonium acetate). (As the SI-2 is smaller than 1000 Da, the cleanup
should be carried out with Sephadex G-25-superfine or Sephadex
LH-20.)
5. Add the SI-2 sample carefully onto the SEC column (diameter of
the column: 1.7  cm, height: 27.5  cm). The elution at a flow rate of
0.2 mL min−1 should be carried out with 1 mM ammonium acetate
under neutral conditions.
6. Perform the bioassay (as described in Section 8.4.2) to identify those
fractions with SI-2 activity (Figure 8.4b).
7. After pooling the active fractions, the partially purified inhibitor can
now be applied for experiments of life-cycle controlling in Ulva.

8.4.5 Swarming inhibitor

8.4.5.1 Extraction and bioassay-guided cleanup
of the swarming inhibitor
Washing and mincing remove SI-1 and SI-2, the gametogenesis will be
induced. The SWI can be already measured about 12  h after induction
and is accumulating in the growth medium. To avoid potential decom-
position, the SWI should be isolated from the growth medium at an early
phase of gametogenesis (Wichard and Oertel 2010).

1. Wash the algal fragments, already used for the SI-2 extraction, three
times with half-strength UCM.
2. Transfer the fragments into UCM and incubate them for 24 h under
standard conditions (Note 7).
3. Remove the algal fragments, for example, with a stainless steel filter
in a funnel.
4. Pass the growth medium through a GF/C filter and subsequently
through a cellulose-acetate membrane (0.45 µm).
5. Load the filtrate onto a SepPaktC18 Plus Long Cartridge at 2 mL min−1.
Up to 2 L can be loaded onto one cartridge.
154 Protocols for Macroalgae Research

6. A stepwise elution with 15  mL should be adopted as follows: (1)

water, (2) 25% methanol, (3) 50% methanol, (4) 75%, and (5) 100%
methanol has to be performed (v:v).
7. All samples should be stored at −20°C.

8.4.5.2 Bioassay-guided cleanup of the swarming inhibitor

1. A dilution series that has at least six steps ranging from 10 to
1000  U  mL−1  of the SWI is recommended. One unit of the SWI is
defined as the concentration that inhibits the swarming of gametes
out of the gametangia (i.e., fragmented thallus) completely in 1 mL
of UCM for 15 min at 20°C.
2. Induction of gametogenesis: Wash the Ulva with 50% UCM for
15 min.
3. Mince the alga into pieces with an herb chopper, transfer the frag-
ments (3–5 mm²) into fresh UCM for 15 min, and repeat the washing
step twice (see Chapter 9).
4. Transfer the minced algae into a Petri dish filled with 20 mL UCM
and incubate the algal fragments for three days (Note 8).
5. On the morning of the third day after induction, pipet the test sam-
ples extracted in 8.4.5.1 in a dilution series into the 96-well plate and
add 20–30 algal fragments (Figure 8.3c). Before transferring the gam-
etangia into the 96-well plates, dip the fragments quickly into fresh
UCM and blot them dry softly with paper.
6. Always keep a negative control (no SWI, gametes should swarm out)
and positive control (SWI inside, gametes should not swarm out).
7. After 15 min, check the well plate for released gametes and the dis-
charged gametangia under the microscope.
8. Determine the amount of SWI in the test sample performing a dilu-
tion series of the fractions with UCM. Here, we define 1 U of SWI
as the minimal amount of the factor-inhibiting gamete released in
1 mL UCM under standard conditions (Figure 8.4c–e).
9. Dry the extracted SWI carefully using a SpeedVac and dissolve it
in 500 µL water. The partially purified SWI can already be used for
further physiological tests.
10. Samples must be cleaned up with an FPLC Superdex™ Peptide
10/300 column for further purification and structure elucidation.
Elution at a rate of 0.25 mL min−1 was conducted by using methanol,
monitored by a UV detector at 233 nm, and fractionated in 0.25 mL
steps (Figure 8.4a).
11. The fractions collected should be analyzed, for example, by a high-
resolution Q-Exactive-Orbitrap mass spectrometer and by the SWI
bioassay (Figure 8.4d, e).
Chapter eight: Purification of sporulation and swarming inhibitors 155

12. Combine the FPLC fractions with high SWI activity.

13. Clean up the biologically active samples through HPLC (Polar-
Premium C18 column) and monitor the absorbance of the SWI at
233 nm (Wichard and Oertel 2010).
14. Analyze the fractions again by UPLC-Q-Exactive-Orbitrap-MS mea-
surements and bioassays.
15. Combine the HPLC fractions with high SWI activity and determine
the final SWI concentrations in U mL−1.

8.5 Notes
In several Ulva species, gametogenesis and subsequent gamete release
can be artificially induced by the removal of sporulation and swarming
inhibitors, but thus far, neither these inhibitors nor the signaling pathways
inducing gametogenesis have been characterized. Ongoing attempts to
elucidate the structure of the SIs will result in a deeper understanding of
the molecular mechanism in a midterm run. However, the compounds
already partially purified can be used as a tool to manipulate Ulva’s life
cycle to extend the vegetative growth of algal aquaculture.

Note 1: Extract thoroughly with the Dounce homogenizer to get higher

yields.
Note 2: It is recommended to precipitate the protein overnight for the
best yields.
Note 3: Additional centrifugation might be necessary to get rid of the
ethanol. It is important to use pure ethanol because the protein is
soluble in water.
Note 4: The second SI-1 extraction step increases the yields.
Note 5: Attention: Freeze-drying of the SI-2 might result in loss of yields.
Note 6: It is important to exchange the rinsing water several time to
remove most of the buffer.
Note 7: After 24  h, the highest SWI concentration is reached during
gametogenesis, which was shown by Wichard and Oertel (2010).
Note 8: The density of thallus fragments applied to the SWI bioassay
should be 500 ± 100 fragments mL−1. Too many fragments of the thal-
lus might result in self-inhibition because of the de novo production
of inhibitors during the determination phase of the gametogenesis.
Few fragments would also produce only minor amounts of the SWI.
Therefore, gametes would be released immediately on the morning of
the third day.
156 Protocols for Macroalgae Research

Acknowledgments
This work was funded by the Deutsche Forschungsgemeinschaft (DFG)
through the Collaborative Research Centre 1127 “Chemical Mediators
in complex Biosystems” (T.W., R.K.) and the Deutsche Bundesstiftung
Umwelt for the PhD fellowship (R.K.).

References
Alsufyani, T., A. Weiss, and T. Wichard. 2017. Time course exo-metabolomic pro-
filing in the green marine macroalga Ulva (Chlorophyta) for identification
of growth phase-dependent biomarkers. Mar. Drugs 15 (1):14. doi: 10.3390/
md15010014.
Califano G. and T. Wichard. 2018. Preparation of axenic cultures in Ulva
(Chlorophyta). In Biotechnology Protocols for Macroalgae Research, B. Charrier,
T. Wichard, and C.R.K. Reddy (Eds.), Chapter 9. Boca Raton, FL: CRC Press,
Taylor & Francis Group.
Carl, C., R. de Nys, R. J. Lawton, and N. A. Paul. 2014. Methods for the induction
reproduction in a species of filamentous Ulva. PLoS One 9 (5). doi: 10.1371/
journal.pone.0097396.
Gao, S., X. Y. Chen, Q. Q. Yi, G. C. Wang, G. H. Pan, A. P. Lin, and G. Peng. 2010.
A Strategy for the proliferation of Ulva prolifera, main causative species of
green tides, with formation of sporangia by fragmentation. PLoS One 5 (1):
e8571. doi: 10.1371/journal.pone.0008571.
Jonsson, S., M. H. Laur, and L. Pham-Quang. 1985. Mise en évidence de differentes
types de glycoprotéines dans un extrait inhibiteur de la gamétogenése chez
Enteromorpha prolifera Chlorophycée marine. Cryptogamie/Algologie 6:253–264.
Løvlie, A. 1964. Genetic control of division rate and morphogenesis in Ulva muta-
bilis Føyn. CR Trav. Lab. Carlsb. Comptes. 34:77–168.
Løvlie, A. 1968. On the use of a multicellular alga (Ulva mutabilis Føyn) in the
study of general aspects of growth and differentiation. Nytt. Magasin.
Zoologi. 16:39–49.
Løvlie, A. 1978. Genetic control of cell cycles during morphogenesis in Ulva muta-
bilis. Develop. Biol. 64 (1):164–177.
Katsaros, C., A. Weiss, I. Llangos, I. Theodorou, and T. Wichard. 2017. Cell struc-
ture and microtubule organisation during gametogenesis of Ulva mutabilis
Føyn (Chlorophyta). Bot. Mar. 60 (2):123–135. doi: 10.1515/bot-2016-0073.
Kessler, R. W., A. C. Crecelius, U. S. Schubert, and T. Wichard. 2017. In situ moni-
toring of molecular changes during cell differentiation processes in marine
macroalgae through mass spectrometric imaging. Anal. Bioanal. Chem. 409 (20):
4893–4903. doi: 10.1007/s00216-017-0430-7.
Lüning, K., P. Kadel, and S. J. Pang. 2008. Control of reproduction rhythmicity by
environmental and endogenous signals in Ulva pseudocurvata (Chlorophyta).
J. Phycol. 44 (4):866–873. doi: 10.1111/j.1529-8817.2008.00535.x.
Nilsen, G. and O. Nordby. 1975. Sporulation inhibiting substance from vegetative
thalli of green alga Ulva mutabilis Føyn. Planta 125 (2):127–139.
Chapter eight: Purification of sporulation and swarming inhibitors 157

Spoerner, M., T. Wichard, T. Bachhuber, J. Stratmann, and W. Oertel. 2012. Growth

and thallus morphogenesis of Ulva mutabilis (Chlorophyta) depends on a
combination of two bacterial species excreting regulatory factors. J. Phycol.
48:1433–1447. doi: 10.1111/j.1529−8817.2012.01231.x.
Stratmann, J., G. Paputsoglu, and W. Oertel. 1996. Differentiation of Ulva mutabilis
(Chlorophyta) gametangia and gamete release are controlled by extracel-
lular inhibitors. J. Phycol. 32 (6):1009–1021.
Vesty, E. F., R. W. Kessler, T. Wichard, and J. C. Coates. 2015. Regulation of gameto-
genesis and zoosporogenesis in Ulva linza (Chlorophyta): Comparison with
Ulva mutabilis and potential for laboratory culture. Front. Plant Sci. 6:15. doi:
10.3389/fpls.2015.00015.
Wichard, T. 2015. Exploring bacteria-induced growth and morphogenesis in the
green macroalga order Ulvales (Chlorophyta). Front. Plant Sci. 6:86. doi:
10.3389/fpls.2015.00085.
Wichard, T. and W. Oertel. 2010. Gametogenesis and gamete release of Ulva
mutabilis and Ulva lactuca (Chlorophyta): Regulatory effects and chemical
characterization of the swarming inhibitor. J. Phycol. 46 (2):248–259. doi:
10.1111/j.1529-8817.2010.00816.x.
chapter nine

Preparation of axenic cultures

in Ulva (Chlorophyta)
Gianmaria Califano and Thomas Wichard

Contents
9.1 Introduction ........................................................................................... 159
9.2 State of the art .........................................................................................161
9.3 Materials................................................................................................. 163
9.3.1 Equipment .................................................................................. 163
9.3.2 Consumables and reagents...................................................... 163
9.3.2.1 Consumables............................................................... 163
9.3.2.2 PCR Reagents .............................................................. 164
9.3.3 Ulva culture medium ............................................................... 164
9.4 Experimental procedures .................................................................... 165
9.4.1 Induction of gametogenesis and release of gametes ........... 165
9.4.2 Enrichment of gamete density ................................................ 165
9.4.3 Purification of gametes from bacteria .................................... 166
9.4.4 Measuring gamete density: Flow cytometry .........................167
9.4.5 Axenicity proof of gametes ......................................................167
9.4.5.1 Test of axenicity on agar medium............................ 168
9.4.5.2 Test of axenicity by PCR ............................................ 168
9.5 Notes ....................................................................................................... 169
Acknowledgments ......................................................................................... 170
References........................................................................................................ 171

9.1 Introduction
The green marine alga Ulva, also commonly known as the sea lettuce, is a
cosmopolitan seaweed. It alternates between the isomorphic life stages of
gametophyte (haploid) and sporophyte (diploid). Gametophytes produce
biflagellate phototactic germ cells (gametes) through mitosis. Meanwhile,
diploid sporophytes generate photophobic tetraflagellate germ cells (zoo-
spores or zoids) (Figure 9.1) (Løvlie 1964). Hereby, sporulation inhibitors
control the gametogenesis/zoosporogenesis and production of germ cells
(Chapter 8 by Kessler et al. 2018).

159
160 Protocols for Macroalgae Research

Gametophyte

mt (+) mt (−)

Gametes

Zygote

Sporophyte

mt (+/−)

Zoids

Figure 9.1 The isomorphic life cycle of Ulva. All Ulva species are isomorphic and
alternate between gametophytic and sporophytic life stages with similar mor-
phologies. The gametophytes are haploid (n) and the sporophytes are diploid
(2n). The mating types (mt) are indicated by (+) and (−). Dashed arrows show the
parthenogenetic development of gametophytes derived from unfused gametes.
Blade cells differentiate into gametangium or sporangium (dark-gray margins).
(From Wichard, T., Front. Plant Sci., 6, 86, 2015. With permission CC-BY.)

Axenic gametes of Ulva, exemplified by Ulva mutabilis (Chlorophyta),

develop into callus-like colonies consisting of undifferentiated cells.
However, the complete morphogenesis can be recovered either by the com-
bination of the two bacterial strains Roseovarius sp. MS2 and Maribacter sp.
MS6 or by morphogenetic compounds (MS2 and MS6 factor) extracted
from the bacterial supernatant (Spoerner et al. 2012; Wichard 2015; Weiss
et  al. 2017). In addition, the Roseovarius species exhibits a specific che-
motactic affinity to the rhizoid cells of U. mutabilis (Kessler et al. 2018)
and seems to cooperate with both the Maribacter strain and the alga by
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 161

chemical  communication, forming a symbiotic tripartite community.

Rhizoid cells attach to the substratum by an adhesive poly-glycoprotein
for the formation and maintenance of this cross-kingdom assembly.
Various effects on the algal development by changing the microbiome
(through the application of antibiotics) have been observed in the past by
various research groups (see review by Wichard 2015); however, the defi-
nite growth- and morphogenesis-promoting effects of the associated bac-
teria can only be studied if truly axenic cultures are available.

9.2 State of the art

The methods used mostly in phycology facilitate a mix of antibiotics and
chemical treatments to inhibit bacterial growth. However, this does not
result in the elimination of all marine bacteria that are associated to mac-
roalgae. Antibiotics might also cause negative side effects on the macroalgal
development (Andersen 2005). Here, we present a detailed protocol to sepa-
rate germ cells from their accompanying bacteria (as reviewed in Wichard
2015). In principle, the axenicity of gametes can be achieved by their photo-
tactic movement through glass capillary pipettes (Tatewaky and Provasoli
1964; Stratmann et al. 1996; Spoerner et al. 2012, Vesty et al. 2015). The process
of obtaining gametes from algal thalli is defined as gametogenesis. It can be
artificially started on the removal of the sporulation inhibitors by mincing
the mature thallus into small single-layered fragments and washing them
intensively. During the second day after induction, the cells differentiate
into gametangia containing 16 progametes, which mature during the fol-
lowing night into fully developed gametes ready for swarming. However,
these gametes cannot be released the next morning until a further swarm-
ing inhibitor (SWI), which accumulates in the medium during gametogen-
esis, had been removed (Wichard and Oertel 2010) (see also Chapter 8). The
gametes assemble at the brightest spot of the sporulation dish where they
can be isolated. A dense suspension of gametes can then be harvested and
loaded into a horizontally placed glass capillary filled with sterile Ulva cul-
ture medium (UCM). Gametes move horizontally to the tip (conical open-
ing) of the pipette, where they can be collected in a few microliters of sterile
UCM before the purification has to be repeated (Figure 9.2). The gametes
out-compete the accompanying microflora on a total length of about 0.5 m
after three purification rounds (Wichard 2015).
The confirmation of axenicity is practically achieved, in concise time,
by the application of the 16S rRNA gene amplification testing the superna-
tant of the purified gametes. When the purification of gametes from bacte-
ria does not succeed, denaturing gradient-gel electrophoresis (Alsufyani
et  al. 2017) or next-generation sequencing techniques are compelling
162 Protocols for Macroalgae Research

(1) Induction of gametogenesis (∼4 h)

Washing
(× 3)
Mincing Removal Filtration Cultivation
of SI for 72 h

(2) Release of gametes and (3) concentration step (∼3 h)

Washing
Removal Collection of
of SWI gametes

(4) Purification of gametes (∼4 h)

Gemetes gather at the
light spot

Pipette
loading (× 3)

(5) Quantification of gametes (∼0.5 h)

FL3 - Chlorophyll
Side scatter - H

Measurement: Data analysis:

Flow cytometry Density
extrapolation Forward scatter - H Forward scatter - H
Reference beads are framed by the
smaller boxes, gametes by the larger
(6) Axenicity test
ones (top right).
After Before
Axenic sample Marker purification purification

Plating PCR test

of 1000 bp

gametes

Contaminated
sample

Figure 9.2 The workflow of obtaining axenic gametes from Ulva includes six
operational steps. The working time is given in parenthesis. Gametogenesis is
induced by removal of sporulation inhibitors (SI). On the morning of the third
day after induction and removal of a swarming inhibitor (SWI), phototactic gam-
etes can be collected and purified from the accompanying bacteria. Axenicity test:
Contaminated samples can be identified by plating gametes on agar (cultivable
bacteria) or by PCR (non-cultivable bacteria).
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 163

techniques to characterize the diversity and to identify the accompanying

bacterial community.
Axenic cultures are an essential tool, for example, (1) to study the
chemical ecology of macroalgal−bacterial interactions, (2) to identify
(allelopathic) compounds released by the macroalgae, (3) to study the
effects of bacterial morphogenetic compounds on the algal growth,
and (4) to have a controlled feedstock for algal aquacultures. In all
cases, the precise counting of gametes ensures the experimental accu-
racy and reproducibility of the suggested approach, based on the work
of Spoerner et al. (2012).

9.3 Materials
9.3.1 Equipment
• Sterile laminar flow cabinet, providing a minimum working area of
0.55 m².
• Benchtop centrifuge with rotor adaptation for plastic microtubes
(Eppendorf-Centrifuge 5415D, maximum speed of 16,100 g).
• Thermocycler device for polymerase chain reaction (PCR).
• Flow cytometer (BD Accuri C6, USA) equipped with 488 nm argon
laser and emission long pass filters for the wavelength of 670 nm.
• Portable light source (e.g., fluorescent tube).
• Automatic pipettes.

9.3.2 Consumables and reagents

9.3.2.1 Consumables
• Nitrile gloves.
• Autoclaved and dried borosilicate glass Pasteur pipette long tips
(23 cm).
• Membrane filter tips for automatic pipettes.
• Polystyrene filter-capped tissue culture flask 50  mL (Sarstedt,
Germany).
• Sterile support to hold glass Pasteur pipettes in a horizontal position.
• Plastic microtubes with a volume of 1.5 mL (VWR, Germany).
• Plastic tubes 15 mL (VWR, Germany).
• Fluorescent reference beads for a more accurate quantification to
apply to the samples for the flow cytometer (Note 1).
• Autoclaved and sterile-filtered Ulva culture medium (UCM).
• Aqueous glutaraldehyde, 25% (v:v) (Sigma-Aldrich, Germany).
• Marine broth (Carl Roth, Germany).
164 Protocols for Macroalgae Research

• Agar for solid microbiological medium (Agar−Agar Kobe I, Carl

Roth, Germany).
• Bleaching solution for chemical inactivation of the algae.

9.3.2.2 PCR Reagents

• 10% of buffer Taq polymerase (10 × DreamTaq buffer, which includes
20 mM of MgCl2, [Thermo Scientific, Germany]).
• 5 U µL−1 DNA polymerase (Dream Taq, Thermo Scientific, Germany).
• Primers (27f [GGG TTT GAT CCT GGC TCA G] and 1390r [ACG
GGC GGT GTG TRC AA]), 0.2 mM of dNTPs-mix (Thermo Scientific,
Germany).
• Dimethyl sulfoxide (DMSO; Sigma-Aldrich, Germany).
• Bovine serum albumin (BSA; Thermo Scientific, Germany).

9.3.3 Ulva culture medium

A specific UCM was developed that allows Ulva and its associated bacte-
ria to develop sufficiently (Table 9.1) (Stratmann et al. 1996).

Table 9.1 Ingredients of Ulva culture medium (UCM)

Solution Ingredients
I 19.14 g L NaCl, 7.28 g L Na2SO4 · 10 H2O, 8.68 g L−1 MgCl2 · 6 H2O,
−1  −1 

1.24 g L−1 CaCl2 · 6 H2O, 85 mg L−1 NaNO3, 6.6 mg L−1 (NH4)2SO4.

II 0.7 g L−1 NaH2PO4 · H2O, 8.8 g L−1 NaHCO3, 10.0 g L−1 Tris−OH.
III 7.84 g L−1 KBr, 54.2 g L−1 KCl, 1.95 g L−1 SrCl2 · 6 H2O.
IV 668.4 mg L−1 EDTA, 1140 mg L−1 H3BO3, 199 mg L−1 FeSO4 · 7 H2O,
3.9 mg L−1 CuSO4 · 5 H2O, 12.6 mg L−1 Na2MoO4 · 2 H2O, 36 mg
L−1 MnCl2 · 4 H2O, 44 mg L−1 ZnSO4 · 7 H2O, 3.3 mg L−1 Co(NO3)2 ·
6 H2O, 2.3 mg L−1 NH4VO3, 3.9 mg L−1 KJ, 263 µg L−1 Na2SeO3 · 5 H2O,
9.3 µg L−1 As2O3, 6.6 µg L−1 Na2WO4 · 2 H2O, 3.4 µg L−1 TeO2,
pH is adjusted to 8.0 with NaOH.
V 0.05 mg L−1 B12, 0.2 g L−1 thiamine · HCl, 0.1 g L−1 niacin, 0.1 g
L−1 Ca−panthothenate, 0.04 g L−1 pyridoxine · HCl, 0.01 g
L−1 p−aminobenzoic acid, 5 mg L−1 biotin, 0.8 g L−1 thymine, 1.0 g
L−1 inositol, 0.26 g L−1 orotic acid, 0.2 mg L−1 folinic acid
(citrovorum), 2.5 mg L−1 folic acid, 0.04 g L−1 putrescine · 2HCl, 5 mg
L−1 riboflavin, 0.02 g L−1 pyridoxamine · 2HCl, 0.36 g L−1 choline
chloride.
Note: One L of solution I has to be supplemented with 10 mL of solutions II–IV and 2 mL of
solution V. The pH is adjusted to 8.1 with HCl. Solution I is autoclaved; solution II–V
are sterile filtered.
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 165

9.4 Experimental procedures

9.4.1 Induction of gametogenesis and release of gametes
1. Collect the algae from the growth medium (up to 2 g fresh weight) in
the morning and dry them softly with paper towels (a bit of moisture
is necessary for the following process).
2. Mince the algae into small fragments (3–5  mm²) using a chopper.
The two cell layers of the blade tissue must be separated for the effi-
cient induction of the gametogenesis (see also Chapter 8).
3. Wash the algal fragments with a solution of 50% UCM for 15 min.
4. Recover the algal fragments through a mesh of 100 µm.
5. Repeat steps 3 and 4 twice to remove all the sporulation inhibitors.
6. Transfer the fragments of the thallus into a filter-capped tissue cul-
ture flask with UCM (e.g., add 50  mL of UCM for a tissue culture
flask with an area of 355 cm²).
7. Incubate the flask with fragmented algae at Ulva standard growing
conditions (i.e., at 18°C with a light−dark rhythm of 17/7 h; at an illu-
mination of 60–120 µmol photons m2 s−1 using 50% GroLux and 50%
daylight fluorescent tubes [OSRAM, München, Germany] without
additional aeration) for three days.
8. On the morning of the third day after the induction of the gametogen-
esis, replace the growth medium with UCM to remove the SWI (Note 2).
9. Expose the flask containing the Ulva fragments to the daylight (e.g.,
in front of a window) or bulb light. Gametes are released and assem-
bled at the brightest spot close to the light source (Figure 9.2).

9.4.2 Enrichment of gamete density

Before the gametes can be loaded into a Pasteur pipette for purification from
the accompanying bacteria, the density of the gametes should be enriched.

1. Gametes gather at the spot light, forming a visible green line on the
flask wall directly exposed to the light (Note 3).
2. Collect the gametes with a pipette into a 15 mL plastic tube (the plas-
tic tube is covered with an aluminum foil except for the bottom part)
and again expose the gametes to light.
3. After approximately 10 min, remove the clear supernatant (without
gametes) carefully and transfer the green fraction into a 1.5 mL tube
(Figure 9.2).

Repeat this procedure until an adequate number of gametes have been

collected. The number of axenic gametes that are sufficient depends on
each experiment. 1–2 × 107 gametes, for example, are required to obtain
166 Protocols for Macroalgae Research

1  µg of total DNA. Therefore, under optimal conditions, 1  cm² of algal

thallus releases about 1 × 107 gametes. Considering that up to 90% of the
gametes are lost during purification, 10 cm² of the thallus has to be used
at the beginning of the purification process (Note 4).

9.4.3 Purification of gametes from bacteria

1. Place a light source directly behind the transparent wall (if available)
of the sterile laminar flow cabinet. Alternatively, the light source can
be sterilized and placed inside the hood.
2. Use a plastic tube holder or a homemade support to keep the Pasteur
pipettes horizontal (Figure 9.3).
3. Fill the Pasteur pipettes carefully with the sterile UCM from the
wide side of the pipette, leaving about 1 cm of space for the gamete
suspension (Note 5). Avoid any air bubbles in the Pasteur pipette.

Glass pipettes Laminar

during purification flow cabinet

Light
source

Pipette
support

(a)

(b)

Figure 9.3 Photographs of the two pipette supports: (a) Supports are used during
the purification process. The Pasteur glass pipette is placed on the supports inside
the laminar flow cabinet, and the light source is placed outside the enclosure. (b) A
plastic tube rack can be also used as safe support for the glass pipettes.
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 167

4. Load between 100 and 150  µL (depending on the density of the

gamete suspension) into each Pasteur pipette. Transfer the gamete
suspension very carefully into the pipette, which is already in place
horizontally, without any disturbance (Note 6).
5. Wait until the gametes gather at the opposite opening, forming a
green spot (Note 7). It should not take longer than 30 min!
6. Incline the pipettes slightly and rotate them to collect up to 5 drops
of the bright green suspension with gametes into a sterile 1.5  mL
plastic tube (Note 8).
7. Repeat steps 2 to 5 twice (Note 9) to purify the same batch of gametes
3 times sequentially. Ten glass pipettes can be handled at the same
time. Considering that gametes have to swim 3 times through the
Pasteur pipette, a minimum number of 30 sterile pipettes filled with
UCM are necessary (Note 10).
8. Finally, a bright green suspension is expected. Split the sample into
several aliquots.

9.4.4 Measuring gamete density: Flow cytometry

The period in which germ cells conserve their motile state is rela-
tively short (10 to 12 h) before they settle onto the surface of the vessel.
During this time, the cell density of gametes must be quantified and
distributed in the final vessels, where experiments are carried out. At
this time, the determination of the cell density is an essential step to
guarantee the same conditions between replicates and the experimen-
tal reproducibility.

1. Homogenize the gamete suspension by turning the plastic tube

several times (9.4.3 step 8) (Note 11).
2. Collect 10 µL of the gamete suspension and mix it with 200 µL UCM
and glutaraldehyde (final concentration of 2% [v:v]).
3. Prepare four replicates.
4. Analyze at a flow rate of 14 µL min−1.
5. Choose the far-red wavelength region (670-LP) filter to quantify the
gamete (Figure 9.2).

9.4.5 Axenicity proof of gametes

The missing axenicity test is a pitfall of many studies (Wichard 2015).
Therefore, Spoerner et al. (2012) recommended amplifying the highly con-
served 16S rRNA of bacteria collected from the supernatant via PCR using
specific primer pairs optimized for marine bacteria. In line with this rec-
ommendation, we suggest two tests that should be performed to prove the
axenicity of the gamete suspension.
168 Protocols for Macroalgae Research

9.4.5.1 Test of axenicity on agar medium

1. Plate 50 µL of the gamete suspension in triplicate on marine broth
(agar 1%) (Note 12).
2. Incubate the agar plates at room temperature for three days.
3. Examine the plate to assure the absence of colony-forming units.

9.4.5.2 Test of axenicity by PCR

1. Ensure gametes settle on the surface of the experimental vessel (wait
for more than 48 h after the inoculation of the gametes).
2. Collect 2 mL of the supernatant (Note 13).
3. Spin down the potential contaminant bacteria at a maximum speed
16,100 × g for 5 min (Centrifuge 5415 D, Eppendorf, Germany).
4. Remove the supernatant and add 50 µL of ultrapure sterile water to
the (non-visible) pellet.
5. Boil the sample for 15 min.
6. Keep the sample on ice for 5  min and then centrifuge down the
debris and proteins (maximum speed for 5 min).
7. Take 3.5 µL of the supernatant as a DNA template for a PCR reaction
(total volume = 25 µL) (Table 9.2).
8. PCR cycle: Preheating lid at 99°C, initial denaturation at 95°C for
5 min, 30 cycles of 0.5 min at 95°C, 0.5 min at 58°C, 1.5 min at 72°C,
and a final elongation for 7 min at 72°C.
9. Perform the PCR also with positive controls, which are samples from
non-axenic cultures of Ulva (Figure 9.2 and Table 9.2).
10. A typical contaminated culture with bacteria releasing the
Roseovarius-factor is shown in Figure 9.4.

Table 9.2 PCR list of reagents and volumes

Reagents Volume (µL) Final concentration
Ultrapure water 14.6 N/A
10 × Dream taq buffer 2.5 10%
Primer 27f 1 0.4 µM
Primer 1392r 1 0.4 µM
dNTPs-mix 0.5 N/A
BSA 1.6 0.64 mg mL−1
DMSO 0.5 2% (v:v)
TAQ polymerase 0.15 0.75 units
DNA template 3.5 N/A
Total volume 25 N/A
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 169

(a) (b)

Figure 9.4 Ten−day−old cultures of Ulva mutabilis are shown: (a) axenic culture, (b)
typically contaminated culture (after purification) with bacteria possessing the same
activity as the Roseovarius sp. MS2. Although the typical cell wall protrusion of axenic
cultures are visible in (b) as well, the longitudinal cell divisions indicate the presence
of morphogenetic compounds released by bacteria. Magnification bar = 100 µm.

9.5 Notes
Note 1: An exact amount of reference beads is necessary for an accurate
quantification, depending on the flow cytometer available. Choose
the beads on the basis of the specific excitation and emission wave-
length of the laser and filters installed in the equipment.
Note 2: The SWI accumulates in the growth medium during gameto-
genesis and prevents the discharge of the gametes on the morning
of the third day after induction. Induced fragments will change their
color from the dark green of the blade cell to the brownish of the
gametangium.
Note 3: Most gametes are discharged from the gametangia on medium
exchange within the first minutes. However, if the cell division of
the cultures is not completely synchronic, the formation and release
of gametes will be affected, and the gametes will be continuously
released from the gametangium over a period of 2–4 h.
Note 4: There is a significant loss of gametes during the purification
steps (up to 90%). Not all gametes will reach the tip of the pipette. If
the density of gametes is too high, self-shading of the gametes will
prevent them from going through the pipette.
Note 5: Avoid the formation of gas bubbles, which will hinder the move-
ment of the gametes’ during the filling of UCM and loading of gam-
etes in the Pasteur pipettes.
Note 6: In the case of gamete suspension with low density, apply up to
800 µL of the suspension into the wide opening of the pipette.
Note 7: If the movement of the gametes takes longer than 30 min for 15 cm
because of slow-swimming, the separation from the accompanying
bacteria will be insufficient.
170 Protocols for Macroalgae Research

Note 8: Alternative sampling: The ends of the capillaries were connected

by silicon tubing with the open ends of short (3 cm) capillaries with
closed other end. The additional tubing makes the harvesting of
the gametes easier than collecting drops directly from the tip of the
Pasteur pipette.
Note 9: The motility of gametes decreases with time. Gametes of U. muta-
bilis are no longer motile for more than 7 h after discharge from the
gametangia.
Note 10: Alternative purification step: Spoerner et al. (2012) suggested,
as a prepurification step, “that the gametes assembling at the bright-
est spot of the sporulation dish should be aspirated with a pipette
in a small volume and diluted with twofold concentrated UCM
to a 1.6-fold concentration, to increase the density of the medium.
A volume of 1–2 mL of this suspension was placed at the bottom of
a sterile 160/15 mm standard glass test tube using a sterile pipette,
thoroughly avoiding any contact with the upper sterile inner tube
surface. The gamete suspension of higher density was then cau-
tiously over-layered with less dense sterile standard UCM and
filled up to the top. After placement for at least 15  min in a dark
room, 25 cm below a fluorescent lamp, the bulk of the positive pho-
totactic gametes had moved vertically to the meniscus. Residual
algal debris, bacteria, and other undesired contaminants, and zoids
and zygotes, remained within the dense liquid pad at the bottom of
the test tube.”
Note 11: As gametes move toward the light source, homogenization of
the gamete suspension is hard to achieve. Four technical replicates are
recommended to estimate the density of the gametes in suspension.
Note 12: The culture-dependent technique used here is an inexpensive
way to check for common heterotrophic bacteria. By contrast, a culture-
independent 16S rRNA gene-based method can detect uncultivable
bacteria by example, denaturing gradient gel electrophoresis (Wichard
2015, 2016).
Note 13: Alternatively, a direct PCR of the intact bacteria in the superna-
tant can be performed, according to Woodman (2008).

Acknowledgments
This work was funded by the Deutsche Forschungsgemeinschaft (DFG)
through the Collaborative Research Centre 1127 Chemical Mediators in
complex Biosystems and by the European Union’s Horizon 2020 research
and innovation program under the Marie Sklodowska−Curie grant
agreement No.642575—The ALgal Microbiome: Friends and Foes (ALFF)
(G.C. and T.W.).
Chapter nine: Preparation of axenic cultures in Ulva (Chlorophyta) 171

References
Alsufyani, T., A. Weiss, and T. Wichard. 2017. Time course exo−metabolomic pro-
filing in the green marine macroalga Ulva (Chlorophyta) for identification
of growth phase−dependent biomarkers. Mar. Drugs 15: 14. doi: 10.3390/
md15010014.
Andersen, A.R. 2005. Algal Culturing Techniques: A Book for All Phycologists. London,
UK: Elsevier Academic Press.
Kessler, R.W., T. Alsufyani, and T. Wichard. 2018. Purification of sporulation and
swarming inhibitors from Ulva: Application in algal life cycle controlling. In
Protocols for Macroalgae Research, Charrier, B., Wichard, T., and Reddy, C.R.K.
(Eds.), Chapter 8. Boca Raton, FL: CRC Press.
Løvlie, A. 1964. Genetic control of division rate and morphogenesis in Ulva muta-
bilis Føyn. C. R. Trav. Lab. Carlsberg 34: 77–168.
Spoerner, M., T. Wichard, T. Bachhuber, J. Stratmann, and W. Oertel. 2012. Growth
and thallus morphogenesis of Ulva mutabilis (Chlorophyta) depends on a
combination of two bacterial species excreting regulatory factors. J. Phycol.
48: 1433–1447. doi: 10.1111/j.1529−8817.2012.01231.x.
Stratmann, J., G. Paputsoglu, and W. Oertel. 1996. Differentiation of Ulva mutabilis
(Chlorophyta) gametangia and gamete release are controlled by extracellu-
lar inhibitors. J. Phycol. 32(6): 1009–1021. doi: 10.1111/j.0022−3646.1996.01009.x.
Tatewaky, M. and L. Provasoli. 1964. Vitamin requirements of three species of
antithamnion. Bot. Mar. 6: 193–203. doi: 10.1515/botm.1964.6.3−4.193.
Vesty, E.F., R. Kessler, T. Wichard, and J. Coates. 2015. Regulation of gametogen-
esis and zoosporogenesis in Ulva linza (Chlorophyta): Comparison with
Ulva mutabilis and potential for laboratory culture. Front. Plant Sci. 6: 15. doi:
10.3389/fpls.2015.00015.
Wichard, T. 2015. Exploring bacteria−induced growth and morphogenesis in the
green macroalga order Ulvales (Chlorophyta). Front. Plant Sci. 6: 86. doi:
10.3389/fpls.2015.00086.
Wichard, T. 2016. Identification of metallophores and organic ligands in the che-
mosphere of the marine macroalga Ulva (Chlorophyta) and at land-sea inter-
faces. Front. Mar. Sci. 3: 131. doi: 10.3389/fmars.2016.00131.
Wichard, T. and W. Oertel. 2010. Gametogenesis and gamete release of Ulva
mutabilis and Ulva lactuca (Chlorophyta): Regulatory effects and chemical
characterization of the “Swarming Inhibitor”. J. Phycol. 46(2): 248–259. doi:
10.1111/j.1529−8817.2010.00816.x.
Weiss, A., R. Costa, and T. Wichard. 2017. Morphogenesis of Ulva muta-
bilis (Chlorophyta) induced by Maribacter species (Bacteroidetes,
Flavobacteriaceae). Bot. Mar. 60(2): 197–206. doi: 10.1515/bot-2016-0083.
Woodman, M.E. 2008. Direct PCR of intact bacteria (colony PCR). Curr. Prot.
Microbiol. 9: A.3D.1–A.3D.6.
section two

Chemical composition
chapter ten

Biochar production from seaweeds

Loretto Contreras-Porcia, Matías Araya,*
Elizabeth Garrido-Ramírez, Cristian Bulboa,
Jean Pierre Remonsellez, Javier Zapata,
Camila Espinoza, and Jorge Rivas

Contents
10.1 Introduction ......................................................................................... 175
10.2 State of the art ...................................................................................... 177
10.3 Materials ............................................................................................... 177
10.3.1 Extraction and pre-drying of seaweed biomass ................ 177
10.3.2 Sample preparation by pyrolysis ......................................... 177
10.3.3 Biochar generation by pyrolysis........................................... 180
10.3.4 Storage of biochar samples ................................................... 180
10.4 Experimental procedures .................................................................. 180
10.4.1 Extraction and pre-drying of seaweed biomass
(the case of Macrocystis pyrifera) ........................................... 180
10.4.2 Sample preparation for pyrolysis ........................................ 180
10.4.3 Biochar generation by pyrolysis........................................... 181
10.4.4 Storage of biochar samples ................................................... 181
10.5 Notes ..................................................................................................... 182
Acknowledgments ......................................................................................... 183
References........................................................................................................ 183

10.1 Introduction
Biochar is a carbon-rich solid derived from thermally stabilized organic
material, meaning that this product can be stored and applied to soils for
improving its quality. Biochar differs from other solid products derived
from thermochemical conversion, such as charcoal or active carbon, in
that long-term carbon storage is an objective, than the generation of raw
material for processing industries or fuels (Mašek et al. 2013). In technical
terms, biochar is produced through the thermal decomposition of organic

* Loretto Contreras-Porcia and Matías Araya: Both the authors have contributed equally.

175
176 Protocols for Macroalgae Research

material under oxygen (O2)-limited conditions and at relatively low tem-

peratures (<900°C) (Lehmann and Joseph 2009; Cha et al. 2016). Through a
process termed pyrolysis, biochar production results in subproducts such
as gases (e.g., synthesis gas) and liquids (e.g., tars and oils) (Bridgwater
and Peacocke 2000; Cha et al. 2016). At lower temperatures (<550°C),
pyrolysis tends to produce more biochar, whereas at higher temperatures,
more synthesis gas is generated.
In recent years, biochar has been a subject of important scientific
and commercial interest because of its role in carbon sequestration,
ability to improve nutrient uptake efficiency in soils, and capacity to
adsorb pollutants from diverse matrices. In relation to improving soils,
several studies demonstrate that biochar incorporation can improve
(1) nutrient retention; (2) cationic interchange capacity; (3) chemical,
physical, and biological soil properties; and (4) plant health and growth,
in addition to reducing nitrogen loss in fertilized soils through vola-
tilization and lixiviation (Jassal et al. 2015; Mandal et al. 2016). Adding
biochar to soils also reduces the emission of greenhouse gases such as
CH4 and N2O (Qian et al. 2015). For example, Case et al. (2015) reported
that biochar suppresses the accumulated production of N2O by 91% in
near-saturated fertilized soils. Furthermore, denitrification is reduced
by 37%, which represents between 85% and 95% of N2O emissions in
soil.
The use of low-cost raw materials is of vital importance for future
biochar applications. Consequently, biochar production using seaweeds
has garnered widespread attention as a promising alternative. The low
cost of this raw material is because of macroalgae abundance and easy
collection from natural fields or detachments, and from seaweed farms.
Research associated with the use of biochar originating from mac-
roalgae primarily focuses on the use of this raw material as a low-cost
adsorbent of pollutants, mainly in the removal of metals (Cho et  al.
2013; Park et al. 2016) and phosphate (Jung et al. 2015a, b: 2016a, b) from
aquatic systems.
Scientific studies assessing the use of seaweed-derived biochar in
soils are fewer and more recent. For example, Bird et  al. (2011) studied
the potential of different types of seaweeds on biochar generation and,
subsequently, applications in carbon sequestration, as a soil amender, and
as a fertilizer. Roberts et al. (2015a, b) used biochar generated from fresh-
water macroalgae (Oedogonium) cultivated in a wastewater of a coal-fired
power station to enhance the rehabilitation of soils close to a coal mine.
Cole et al. (2017) used the same species to recover nitrogen (N) and phos-
phorus (P) from municipal wastewater and then used the cultivated algae
to produce biochar as a soil amendment. As such, algal biomass use is
now considered as a new biotechnological alternative (Lee and Woo 2014)
from an environmental point of view.
Chapter ten: Biochar production from seaweeds 177

10.2 State of the art

Biochar can be obtained from different biomass feedstock, including
wood residue, crop residue, grass, manure, sludge and municipal organic
waste, and seaweeds, among others. Successful biochar use depends on
the properties of the originating biomass and operational conditions,
including residency time, temperature, heating rate, reactor type, and so
on, among others (Rajapaksha et al. 2016). As such, biochar produced from
seaweeds has a low carbon content compared with biochar from lingocel-
lulosic materials and, conversely, higher concentrations of macronutrients
(i.e., N and P) and interchangeable trace elements (i.e., Ca, Mg, K, and Mo),
which are essential for plant growth (Bird et al. 2011; Roberts et al. 2015a, b).
Nevertheless, the final composition of biochar, and the physicochemical
properties varies depending on the seaweed used for production (Table 10.1).
Bird et al. (2012) compared biochar derived from freshwater (FW) and salt-
water (SW) macroalgae with lignocellulosic biochar (commercial charcoal).
Lignocellulosic biochar was similar to the algal biochar in terms of pH,
CEC, and surface area characteristic, but has considerable higher carbon
content (72%) compared with FW biochar (11.6%) and SW biochar (17.4%).
In turn, algal biochar presents higher ash content and considerable highest
nutrient (N, P, and K) contents than lignocellulosic biochar. This final trait
permits using algal biochar as a soil amender (Bird et al. 2011, 2012).

10.3 Materials
10.3.1 Extraction and pre-drying of seaweed biomass
• Plastic bags.
• Raschel mesh.
• Tap water.
• Distilled water.
• Hemp or cotton rope, 10–20 mm in diameter.
• Ice pack.
• Knife.
• Bag sealer.

10.3.2 Sample preparation by pyrolysis

• Drying oven.
• Plastic or stainless-steel baskets.
• Sealable bags.
• Stainless-steel mill.
• No. 18 (1.0 mm) and N° 3.5 (5.7 mm) sieve.
• Bag sealer.
• Semi-analytical balance.
 178

Table 10.1 Main physicochemical characteristics of biochar generated from different biomass sources
and different pyrolysis conditions
CECc SAd
Feedstock PTa (°C) C (%) H (%) O (%) N (%) S (%) pH b (cmol kg–1) Ash (%) (m 2 g–1) References
Algae
Cladophora vagabunda 450 21.80 1.20 – 2.00 – 9.87 23 54.20 – Bird et al. (2011)
Caulerpa taxifolia 450 24.80 1.20 – 2.40 – 9.65 17 20.90 – –
Cladophoropsis sp. 450 23.60 1.50 – 2.80 – 10.07 27 46.50 – –
Chaetomorpha linum 450 23.60 1.30 – 2.40 – 9.61 36 16.00 – –
Chaetomorpha indica 450 10.20 0.80 – 1.10 – 7.83 16 73.50 – –
Cladophora patentiramea 450 20.30 1.20 – 1.70 – 9.12 21 47.00 – –
Cladophora coelothrix 450 34.60 1.50 – 3.3 – 8.72 19 32.10 – –
Ulva flexuosa 450 22.60 1.20 – 2.70 – 10.00 41 42.6 – –
414 25.70 1.90 – 3.90 – 9.80 39 29.2 – –
305 28.90 2.80 – 5.00 – 8.00 29 26.5 – –
Undaria pinnatifida 500 56.60 2.70 33.00 4.80 3.00 – – 47.70 – Cho et al. (2013)
Gracilaria edulis 450 30.90 2.20 16.5 2.80 4.40 7.60 – – 2.02 Roberts et al. (2015c)
Eucheuma spinosum 450 25.60 1.8 24.90 0.80 9.30 8.20 – – 30.30 –
Kappaphycus alvarezii 450 31.30 2.10 23.80 0.70 7.00 8.80 – – 2.24 –
Sargassum sp. 450 28.90 2.10 18.20 1.10 2.80 10.80 – – 7.46 –
Unadaria pinnatifida 450 34.80 2.80 15.60 2.40 0.80 9.90 – – 1.33 –
Saccharina japonica 450 28.00 1.90 16.40 2.20 1.00 11.00 – – 1.29 –
(Continued)
Protocols for Macroalgae Research
 Table 10.1 (Continued) Main physicochemical characteristics of biochar generated from different biomass sources
and different pyrolysis conditions
CECc SAd
Feedstock PTa (°C) C (%) H (%) O (%) N (%) S (%) pH b (cmol kg–1) Ash (%) (m 2 g–1) References
Undaria pinnatifida 200 30.58 3.820 34.70 3.40 – 7.37 – 32.83 1.909 Jung et al. (2016b)
400 31.92 1.74 13.56 2.35 – 8.38 – 41.85 70.29 –
600 36.64 0.99 11.76 2.31 – 10.36 – 48.71 61.80 –
800 40.51 0.70 10.02 2.00 – 11.09 – 50.41 44.49 –
Ulva compressa 500 57.60 2.60 22.40 5.60 11.80 – 157 43.30 – Kim et al. (2016)
Porphyra tenera 500 74.70 3.00 9.00 9.10 4.20 – – 21.30 – Park et al. (2016)
Oedogonium 450 49.80 – – 5.50 1.00 10.60 21.30 – – Cole et al. (2017)

Others
Poultry litter 400 – 3.08 15.62 4.48 – 9.49 48 – – Jassal et al. (2015)
Chapter ten: Biochar production from seaweeds

500 – 2.04 8.60 3.99 – 9.33 36 – – –

600 – 1.49 5.20 3.27 – 9.91 47 – – –
Spruce–pine–fir wood waste 400 – 3.60 17.70 0.28 – 5.47 1 – – –
500 – 2.99 9.42 0.40 – 7.13 0.9 – – –
600 – 2.42 4.75 0.54 – 7.53 1.3 – – –
Poultry litter 550 77.50 – – 2.74 0.39 8.66 – – 12.80 Mandal et al. (2016)
460 72.90 – – 4.95 0.13 10.84 – – 202.50 –
a PT, Final pyrolysis temperature.
b May differ due to the method for pH measurement, see references.
c Cation exchange capacity.
d Surface area.
179
180 Protocols for Macroalgae Research

10.3.3 Biochar generation by pyrolysis

• Pyrolysis reactor with speed/temperature controls, supplemented
with thermocouples and gas inlet/outlet with condenser.
• Pure gaseous nitrogen (N2).

10.3.4 Storage of biochar samples

• No. 35 (0.5 mm) and 18 (1.0 mm) sieve.
• Sealable bags.
• Bag sealer.
• Stainless-steel mill.
• Porcelain mortar.

10.4 Experimental procedures

10.4.1 Extraction and pre-drying of seaweed biomass
(the case of Macrocystis pyrifera)
1. Store extracted biomass samples in large or small plastic bags with
an ice pack, depending on the amount (Note 1).
2. Remove biomass from the plastic bags, manually remove any large
debris, and immediately wash three times with tap water. Repeat
this process three times with distilled water (Note 2).
3. The algae biomass can be open-air dried either by (1) evenly distrib-
uting the algae mass on a clean mesh (Figure 10.1a) to allow water
drainage during the day with algae covered by the mesh at night
to maintain drying, or (2) take the seaweed from the holdfast and
hanging these evenly along a rope (Figure 10.1b). The drying process
should be monitored (Note 3).
4. Remove the holdfast and store the rest of the tissue in sealed plastic
bags (Note 4).

10.4.2 Sample preparation for pyrolysis

1. Remove the remaining moisture by oven drying at 40°C for 24  h
(Jung et al. 2016b). For this, take 1 kg of biomass and place it in plastic
or aluminum containers (Note 5).
2. The dry product must be milled manually or in a stainless-steel mill
and sieved to retain particles 1.0–5.7  mm (Cho et  al. 2013; Roberts
et al. 2015c; Jung et al. 2016b; Kim et al. 2016) (Note 6).
3. Store the ground biomass in sealed plastic bags at room temperature
until pyrolysis.
Chapter ten: Biochar production from seaweeds 181

200 m

100 m

200 m 200 m 200 m

(a)

200 m

200 m 200 m
(b)

Figure 10.1 Open-air biomass dryer systems on a clean mesh (a) or hanging along
a rope (b).

10.4.3 Biochar generation by pyrolysis

1. Put the samples in the pyrolyzer and open the N2 gas passage at
a  flow of 3–4  L min−1 for until achieving an inert atmosphere
(Bird et al. 2011; Roberts et al. 2015c).
2. Begin increasing the temperature at a rate of 3°C –5°C min−1, starting
at room temperature until reaching 450°C–500°C (Bird et  al. 2011,
2012; Cho et al. 2013; Jung et al. 2015a; Kim et al. 2016; Lee et al. 2016).
Maintain the N2 flow and the final temperature and other pyrolysis
conditions (see Note 1) for 1 h. Finally, cool to room temperature while
maintaining the N2 flow constant (Johansson et al. 2016) (Note 7).
3. Remove the biochar sample from the pyrolyzer and store at room
temperature in sealed plastic bags.

10.4.4 Storage of biochar samples

1. Grind the samples until small enough to standardize the sample size
according to the study purposes (Figure 10.2) (Note 8).
182 Protocols for Macroalgae Research

300°C 450°C

600°C

Figure 10.2 Biochar obtained from Macrocystis pyrifera at 300°C, 450°C, and 600°C.

2. Wash the samples three times with deionized water (1:20 sample:water
ratio). The samples must then be filtered to obtain the solid product,
which must be subsequently dried in an oven at 60–80°C for 24 h
(Jung et al. 2015a; 2016b).
3. The obtained biochar must be cooled in a desiccator for 1 h and then
stored in sealed plastic bags at room temperature.

10.5 Notes
Note 1: To prevent the decomposition of algae biomass, refrigerated
storage and/or transportation should not exceed 48 h, whereas non-
refrigerated storage and/or transportation should not exceed 24 h.
Note 2: Initial washing is performed primarily to remove sand and
any other organisms. Maintaining the holdfast will facilitate algae
handling.
Note 3: Monitor and periodically move the algae biomass to ensure uni-
form drying (for ground or hanging drying methods). Algae bio-
mass must be covered with mesh for ground drying under windy
conditions. If a moisture content > 15% persists after two days, and if
environmental conditions will not improve, directly proceed to Step 4,
which will remove any moisture excess.
Note 4: If the next step will be carried out in less than 12 h, it is advisable
to store the biomass in a dry place so that they do not get wet again.
Note 5: Use perforated boxes or baskets to ensure that heat reaches all
algal tissue surfaces. If posterior experiments measure heavy metal
Chapter ten: Biochar production from seaweeds 183

contents, plastic boxes are advisable for the drying process. If pos-
terior experiments are related to the organic matter, stainless-steel
baskets are advisable for the drying process.
Note 6: If following analyses focus on heavy metals adsorption, grind-
ing the samples manually or with a mortar are recommended.
Note 7: An end pyrolysis temperature of 450°C is more efficient and
results in less solid biomass loss in the pyrolysis process (Bird et al.
2011). This temperature may vary depending on the purpose of the
study and pyrolysis conditions.
Note 8: To perform adsorption tests, it is advisable to grind up to pass
through a 0.5–1.0 mm sieve (Zhang et al. 2013). If the biochar will be
used to assess heavy metals adsorption, avoid crushing the samples
with metallic instruments. In the case of applying the biochar to the
soil, it a particle size of 0.5–2.0 mm is recommended (Bird et al. 2012;
Roberts et al. 2015c; Jung et al. 2016b).

Acknowledgments
This work was supported by FIC 30397482-0  Gobierno Regional de
Valparaíso and Project CONICYT FB-0002-2014 to LC-P. We acknowledge
the language support provided by Ashley VanCott, BioPub Ltd. We also
thank Ignacio Perez-Massad for providing Figure 10.1.

References
Bird, M.I., Wurster, C.M., de Paula, S.P.H., Bass, A.M., and de Nys, R. 2011. Algal
biochar production and properties. Bioresource Technol. 102:1886–1891.
Bird, M.I., Wurster, C.M., de Paula Silva, P.H., Paul, N.A., and de Nys, R. 2012.
Algal biochar: Effects and applications. GCB Bioenergy 4:61–69.
Bridgwater, A. and Peacocke, G. 2002. Fast pyrolysis processes for biomass.
Renew. Sust. Energy Rev. 4:1–73.
Case, S., McNamara, N.P., Reay, D., Stott, A., Grant, H., and Whitaker, J. 2015.
Biochar suppresses N2O emissions while maintaining N availability in a
sandy loam soil. Soil Biol. Biochem. 81:178–185.
Cha, A.B., Sung, H.P.C., Sang-Chul, J.C., Changkook, R.D., Jong-Ki, J.E. Min-Chul,
S.B., and Young-Kwon, P.A. 2016. Production and utilization of biochar: A
review. J. Ind. E. Chem. 40:1–15.
Cho, H.J., Baek, K., Jeon, J.-K., Park, S.H., Suh, D.J., and Park, Y.-K. 2013. Removal
characteristics of copper by marine macro-algae-derived chars. Chem. Eng. J.
217:205–211.
Cole, A.J., Paul, N.A., de Nys, R., and Roberts, D. 2017. Good for sewage treat-
ment and good for agriculture: Algal based compost and biochar. J. Environ.
Manag. 200:105–113.
Jassal, R., Johnson, M., Molodovskaya, M., Black, T.A., Jollymore, A., and Sveinson, K.
2015. Nitrogen enrichment potential of biochar in relation to pyrolysis tem-
perature and feedstock quality. J. Environ. Manag. 152:140–144.
184 Protocols for Macroalgae Research

Johansson, C.H., Paul, N.A., Nys, R., and Roberts, D.A. 2016. Simultaneous bio-
sorption of selenium, arsenic and molybdenum with modified algal-based
biochars. J. Environ. Manag. 165:117–123.
Jung, K.-W., Hwang, M.-H., Jeong, T.-U., and Ahn, K.-H. 2015a. A novel approach
for preparation of modified-biochar derived from marine macroalgae: Dual
purpose electro-modification for improvement of surface area and metal
impregnation. Bioresource Technol. 191:342–345.
Jung, K.-W., Jeong, T.-U., Hwang, M.-H. Kim, K., and Ahn, K.-H. 2015b. Phosphate
adsorption ability of biochar/Mg–Al assembled nanocomposites prepared
by aluminum-electrode based electro-assisted modification method with
MgCl2 as electrolyte. Bioresource Technol. 198:603–610.
Jung, K.W., and Kyu-Hong, A.K.-H. 2016a. Fabrication of porosity-enhanced MgO/
biochar for removal of phosphate from aqueous solution: Application of a
novel combined electrochemical modification method. Bioresource Technol.
200:1029–1032.
Jung, K.-W, Kim, K., Jeong, T.-U., and Ahn, K.-H. 2016b. Influence of pyrolysis
temperature on characteristics and phosphate adsorption capability of
biochar derived from waste-marine macroalgae (Undaria pinnatifida roots).
Bioresource Technol. 200:1024–1028.
Kim, B.-S., Lee, H.W., Park, S.H., Baek, K., Jeon, J.-K., Cho, H.J., Jung, S.-C., Kim,
S.C., and Park, Y.-K. 2016. Removal of Cu2+ by biochars derived from green
macroalgae. Environ. Sci. Pollut. Res. 23:985–994.
Lee, H., Park, R.-S., Lee, H.W., Hong, Y., Lee, Y., Park, S.H., Jung, S.C., Yoo, K.-S.,
Jeon, J.-K., and Park, Y.-K. 2016. Adsorptive removal of atmospheric pollut-
ants over Pyropia tenera chars. Carbon Lett. 19:79–88.
Lee, M.N. and Woo, S.H. 2014. Application of biochar produced from wood and
seaweed for the removal of dye in wastewater. 2nd FORBIOM Workshop
Potentials and Biochar to Mitigate Climate Change, Hanbat National University,
Korea.
Lehmann, J. and Joseph, S. 2009. Biochar for environmental management: An
Introduction. In Biochar for Environmental Management: Science and Technology,
Lehmann, J. and Joseph, S. (Eds.), pp. 1–9, Earthscan, London, UK.
Mandal, S., Thangarajan, R., Bolan, N.S., Sarkar, B., Khan, N., Ok, Y.S., and Naidu, R.
2016. Biochar-induced concomitant decrease in ammonia volatilization and
increase in nitrogen use efficiency by wheat. Chemosphere. 142:120–127.
Mašek, O., Brownsort, P., Cross, A., and Sohi, S. 2013. Influence of production con-
ditions on the yield and environmental stability of biochar. Fuel. 103:151–155.
Park, S.H., Cho, H.J., Ryu, C., and Park, Y.-K. 2016. Removal of copper (II) in aque-
ous solution using pyrolytic biochars derived from red macroalga Porphyra
tenera. J. Ind. Eng. Chem. 25:314–319.
Qian, K., Kumar, A., Zhang, H., Bellmer, D., and Huhnke, R. 2015. Recent advances
in utilization of biochar. Renew. Sustain. Energy Rev. 42:1055–1064.
Rajapaksha, A.U., Chen, S.S., Tsang, D.C.W., Ming, Z.M., Vithanage, M., Mandal, S.,
Gao, B., Bolanm N.S., and Ok, S.Y. 2016. Engineered/designer biochar for
contaminant removal/immobilization from soil and water: Potential and
implication of biochar modification. Chemosphere. 148:276–291.
Roberts, D.A., Paul, N.A., Bird, M.I., and de Nys, R. 2015a. Bioremediation for coal-
fired power stations using macroalgae. J. Environ. Manag. 153:25–32.
Chapter ten: Biochar production from seaweeds 185

Roberts, D.A., Paul, N.A., Cole, A.J., and de Nys, R. 2015b. From waste water treat-
ment to land management: Conversion of aquatic biomass to biochar for
soil amelioration and the fortification of crops with essential trace elements.
J. Environ. Manage. 157:60–68.
Roberts, D.A., Paul, N.A., Dworjanyn, S.A., Bird, M.I., and de Nys, R. 2015c. Biochar
from commercially cultivated seaweed for soil amelioration. Sci. Rep. 5:1–6.
Zhang, M., Gao, G., Varnoosfaderani, S., Hebard, A., Yao, Y., and Inyang, M. 2013.
Preparation and characterization of a novel magnetic biochar for arsenic
removal. Bioresource Technol. 130:457–462.
chapter eleven

Identification and quantification

of laminarins in brown algae
Angelika Graiff, Wolfgang Ruth, and Ulf Karsten

Contents
11.1 Introduction......................................................................................... 187
11.2 State of the art ..................................................................................... 189
11.3 Materials .............................................................................................. 191
11.3.1 Extraction of laminarin from macroalgal material .......... 191
11.3.2 Precipitation of alginate ....................................................... 191
11.3.3 Liquid chromatography–mass spectrometrical
method measurement .......................................................... 192
11.4 Experimental procedures .................................................................. 192
11.4.1 Laminarin extraction............................................................ 192
11.4.2 LC–MS measurements ......................................................... 193
11.4.3 Laminarin reference and quantification............................ 194
11.5 Notes..................................................................................................... 195
Acknowledgment ........................................................................................... 196
References........................................................................................................ 197

11.1 Introduction
Brown algae exhibit a unique central storage carbon metabolism (Michel
et al. 2010). The photoassimilated d-fructose 6-phosphate is not used by
these algae to produce sucrose as in higher plants but is rather converted
into the polyol d-mannitol (Stenhouse 1844, Yamaguchi et al. 1966). Brown
algae lack or contain only very low concentrations of free sugars such as
glucose, fructose, or sucrose (Yamaguchi et  al. 1966). These free sugars
most likely undergo immediate biochemical conversion into d-mannitol
and polysaccharides.
The long-term carbon storage polysaccharide in brown algae is lami-
narin, a vacuolar β-1,3-glucan, which chemically differs from storage prod-
ucts of most other living organisms that typically use glycogen or starch

187
188 Protocols for Macroalgae Research

(α-1,4-glucans). Laminarin, also known as laminaran or leucosin, was first

isolated from Laminariaceae by Schmiedeberg (1885). Unlike other algal
polysaccharides (e.g., agar, alginate, and carrageenan), laminarin does not
have thickening and gelling properties (Rupérez et al. 2002). Laminarins
are a class of low-molecular mass storage β-glucans, which are com-
posed of (1,3)-β-D-glucan (Rioux et al. 2007) and consisting of chains of
β-1,3′-linked glucose units with occasional β-1,6′-linkages (Percival and
Ross 1951, Beattie et  al. 1961). These β-1,6′-linkages are present in a lin-
ear chain of β-1,3′-linked glucose residues and mainly as interchain link-
ages, which lead to a ramification of the molecule (Peat et al. 1958, Annan
et al. 1965). The molecular weight of laminarin is approximately 5000 Da
and is dependent on the degree of polymerization, which is in the range
of 20–25 glucose units (Nelson and Lewis 1974, Alderkamp et  al. 2007).
Furthermore, this polysaccharide is polydisperse, consisting of a minor
G-series with polymers containing only glucose residues, and a more
abundant M-series with glucans terminated with a 1-linked d-mannitol
residue (Read et al. 1996, Figure 11.1).
Consequently, the chemical variation in this storage molecule is based
on the number of β-1,6′-linkages, the degree of branching, and the pres-
ence or absence of terminal mannitol residues (Craigie 1974). The structure
and ratio of the different types of laminarin vary according to algal spe-
cies, tissue type, reproductive conditions, and seasonal growth and envi-
ronmental factors (Read et al. 1996, Chizhov et al. 1998, Rioux et al. 2010).

CH2OH CH2OH
CH2OH
O O OH
O O
OH O
OH OH
OH OH OH
OH n
(a) G-chain laminarin

CH2OH
CH2OH O
O
O
OH O CH2(CHOH)4CH2OH
OH
Mannitol
OH OH
OH n
(b) M-chain laminarin

Figure 11.1 Chemical structures of one unit of G- and M-chain of laminarin.

Chapter eleven: Identification and quantification of laminarins 189

Laminarin shows not only chemical variations but also quantitative

changes. Over the course of a year, some brown algae shift their major
storage compounds from mannitol in spring to laminarin in autumn
(Dethier and Williams 2009). Mannitol is remobilized and translocated in
perennial species of brown algae from mature storage tissues to supply
the rapidly growing meristematic parts with carbon for biomass forma-
tion (e.g., reviewed by Gómez and Huovinen 2012). Stored polysaccharides
are of particular ecological relevance for perennial brown algae because
they often allow the uncoupling of growth from photosynthesis. This is
a crucial adaptation to ecosystems with a strong seasonal variation such
as the polar regions, which are characterized by continuous darkness in
winter and continuous daylight in summer.
Laminarins are also of increasing economic interest because some of
their derivatives are used for high-end products such as in cosmetics and
pharmacology (Yvin et al. 1999).

11.2 State of the art

Different studies quantifying laminarin from the algal material used
specific kinds of extraction methods, hydrolysis conditions, and tests
for glucose as equivalent units for laminarin (see, e.g., Gagné et al. 1982,
Gómez and Wiencke 1998, Dethier and Williams 2009). Laminarin was
extracted from the dried algal material using ethanol (20%) at 75°C for
2–3  h and subsequent hot acidic hydrolysis (HCl or H2SO4) of ethanol
extracts (Chapman and Craigie 1977, Gómez and Wiencke 1998) or enzy-
matic hydrolysis (Johnston et al. 1977, Devillé et al. 2004). Another used
method is the direct extraction of laminarin from dried algal biomass
with sulfuric or hydrochloric acid and the use of the supernatant after
neutralization for quantification of laminarin as total sugar equivalents
(e.g., Devillé et al. 2004, Schiener et al. 2015). However, the hydrolysis of
the complete algal material will most probably result in a strong overes-
timation of laminarin, because acidic hydrolysis will cleave all sugars or
sugar residues present in the biomass such as, for example, glycolipids,
glycoproteins, and celluloses. Furthermore, the acidic hydrolysis of pure
commercial laminarin is incomplete, and hence not quantitative, because
a larger amount of oligomer carbohydrate units than single glucose units
is received under widely applied hydrolysis conditions (for details see
Graiff et al. 2016). In addition, the hydrolysis of polysaccharides is leading
to uncontrolled cleavage of sugar units (Templeton et al. 2012). Thus, the
received concentration of glucose from laminarin varied depending on
the hydrolysis duration (Graiff et al. 2016).
Laminarin quantification was performed, either indirectly after
hydrolysis by measuring the cleaved glucose units with enzymatic
assays (Gómez and Wiencke 1998) or with the anthrone reagent method
190 Protocols for Macroalgae Research

(Yemm and Willis 1954), both calibrated against glucose standards. So far,

neither intercalibration nor any test for reproducibility or sensitivity of the
different protocols have been conducted to ensure that these analytical
approaches are comparable.
The commercial laminarin, which is used as a reference substance
for identification and quantification is available from a company as a
lyophilized powder and was extracted from Laminaria digitata. However,
the company is not able to provide any information about the extraction
procedure and purity of the laminarin product. Hence, it is not certified
as a standard. It might be reasonable to assume that this commercially
available laminarin is a product being obtained from algal material by
chemical or enzymatic extraction procedures according to the U.S. pat-
ent for the use of laminarin in cosmetics and pharmacology (Yvin et al.
1999). Thus, the use of a liquid chromatography–mass spectrometry
method (LC–MS) is essential for identification and characterization of
laminarins, as the high-performance liquid chromatography separates
the mixture of laminarin species and the mass spectrometry analyzes
their molar masses (Figure 11.2). The LC–MS measurements based on
the method of Graiff et al. (2016) demonstrated clearly that the commer-
cial laminarin consists of a mixture of four different chemical species of
laminarin showing the typical molar mass distribution of 2000–7000 Da.
Quantification depending on the commercially available laminarin from
L. digitata is problematic, because of the species-specific variability and
number of the chemical structures of laminarin, which can vary depend-
ing on environmental and individual conditions of the harvested algae.

Mobile phase Samples: Multiple

component mixtures

Detection
A B

Mass spectrometer:
Linear ion trap

LC–MS
Interface +
MS ion source

High-performance liquid HPLC Chromatogram and

chromatography (HPLC) device column mass spectrum analysis

Figure 11.2 Scheme of a liquid chromatography–mass spectrometry (LC–MS)

system. (Courtesy of Daniel Norena-Caro, Creative Commons, CC0 1.0 Universal
Public Domain Dedication.)
Chapter eleven: Identification and quantification of laminarins 191

These points also represent a great challenge working with natural sub-

stances as a reference compound for calibration because the chemical
structure and quantity depend on the biological source and environ-
mental factors. The resulting aspect of laminarin variability has to be
considered in all applied analytical approaches. A second commercially
available laminarin substance from another company showed no detect-
able chemical laminarin species by LC–MS; however, the signals indi-
cated that the substance consisted of  disaccharides. Thus, according to
our experiences, LC–MS measurements provide the most precise and reli-
able data as they detect (1) the presence, (2) the different chemical struc-
tures of laminarin, and (3) their quantities.
The described LC–MS method is an analytical tool to identify and
characterize carefully and finally, quantify laminarin in extracts from
different brown algal species to overcome the methodological problems
described. The cold extraction of this storage polysaccharide from brown
algae is a very simple method and is suitable for further exact quantitative
determination of these complex compounds. The obtained extract from
the dried algal material can be analyzed directly by LC–MS. The direct
characterization and quantification of laminarin by LC–MS is a helpful
approach to modern biochemical analytics to verify the importance of
laminarin for brown algae.

11.3 Materials
11.3.1 Extraction of laminarin from macroalgal material
• Freeze drier
• Laboratory mill
• Spatula
• Laboratory balance
• Pipettes
• 1 ml reaction vessels
• Ultrapure water
• Laboratory shaker
• Centrifuge (14,000 rpm) (Note 1)

11.3.2 Precipitation of alginate

• Formic acid (98%, MS-grade)
• Ethanol (>99.7%)
• Vortex mixer
• Refrigerator (Note 2)
192 Protocols for Macroalgae Research

11.3.3 Liquid chromatography–mass

spectrometrical method measurement
• Commercial laminarin from Laminaria digitata (Sigma L9634, Sigma-
Aldrich Chimie S.a.r.l., France).
• 1.5 ml microvials (MS certified).
• LTQ Velos Pro mass spectrometer with Accela HPLC (Thermo
Scientific, USA).
• Kinetex column (C18, 150 × 2.1 mm, 2.6 µm core shell, Phenomenex,
USA).
• Eluents:
• Ultrapure water
• Acetonitrile (MS-grade)
• Modifier: Formic acid (MS-grade)
• The linear ion trap mass spectrometer has to work in the ESI nega-
tive ion mode in a mass range of 100–4000 atomic mass units (amu).
The use of an ion trap equipped mass spectrometer has the advan-
tage to accomplish several experiments simultaneously. For analyz-
ing laminarin, the simultaneous use of the full scan and zoom scan
mode are recommended.
• Instrument control and evaluation software (Xcalibur 2.2, Thermo
Scientific, USA).

11.4 Experimental procedures

11.4.1 Laminarin extraction
Two extraction steps are used to guarantee a complete extraction of the
different laminarin species from the algal samples. The first extraction
with ultrapure water supplies mainly unbranched short polysaccharide
chains (90%), the second mainly branched long polysaccharide chains
(10%), and the third no laminarin at all.

1. For extraction, grind the samples (<1 mm grain size) with an analyti-
cal mill (Ika MF 10 Basic, Germany).
2. Extract the algal material (0.2 g DW) with ultrapure water (1.5 ml) on
a shaker (250 rpm) at 25°C for 2 h.
3. Centrifuge 1  ml of the water extract at 14,000  rpm for 5  min
(HettichMikro 22 R, Germany).
4. Transfer the supernatant into a 4 ml vial and add 1.5 ml of ultrapure
water. Then the procedure is repeated, and both supernatants are mixed
and converted into a microvial (300 µl) for direct LC–MS analysis.
5. If the algal sample contains a large amount of alginate, see Note 2.
Chapter eleven: Identification and quantification of laminarins 193

11.4.2 LC–MS measurements

Laminarin is analyzed using LC–MS, Figure 11.2 to separate and iden-
tify the different laminarin species contained in extracted algal samples
(Note 3).

1. For separation of the different laminarin species use a Kinetex col-

umn (2.6 µm C18, 150 × 3 mm) (Note 4).
2. Use ultrapure water and acetonitrile (90% water with 0.1% formic
acid (v:v) and 10% acetonitrile with 0.1% formic acid) as mobile phase
and run isocratically at a flow rate of 0.2 ml min−1.
3. For determination of molar masses of different laminarin species
run the MS in ESI negative ion mode (Cone energy of the electro-
spray: 3.5 kV) in a mass range of 100–4000 amu.
4. Accomplish simultaneous full scan and special zoom scan measure-
ments on representative laminarin masses to receive qualitative data
of the laminarin species and quantitative data of the total laminarin
content.
5. Apply the zoom scan measurements to achieve exact information
about the charge state of the measured representative molar masses
as the x-axis of the MS measurements is the mass to charge signal
(m/z). These measurements concerning the charge state are based on
the abundance ratio of the carbon isotopes: 12C and 13C. Thus, the
actual molecular mass of, for example, 3256  Da is calculated with
the detected mass of 1628 amu on the x-axis and a charge state of 2
(Figure 11.3). Then calculate the mean chain length and branched
chains of individual laminarin species in the reference substance
and in the algal samples.
6. Achieve quantitative information of the total laminarin content in
the algal samples on the comparison of full scan measurements of
the commercial reference laminarin to full scan measurements
of the extracted algal samples.
7. Perform a smoothing of the full scan peaks using the evaluation
software. Most likely, the quantitative information will be afflicted
with an error because an absolute quantification is only possible
with a licensed laminarin standard substance, which accurately cor-
responds to the different laminarin species in the respective algal
samples. However, natural substances are characterized by the pres-
ence of various chemical species of laminarin. Nevertheless, com-
parative measurements because of the trends are possible and offer
good evidence for quantification of total laminarin contents from
algal samples.
194 Protocols for Macroalgae Research

RT:0.00 − 9.99
2.54
100 2.74
80 Cystoseira tamariscifolia
60
40 3.10
20
Relative abundance

0.28 0.68 0.93 1.33 1.76 2.08 2.27 3.39 3.67 4.11 4.61 4.77 5.27 5.72 5.90 6.30 6.64 7.10 7.28 7.44 7.92 8.29 8.64 8.90 9.12 9.76 9.94
0
2.74
100
80 2.63 Saccharina latissima
60
40 3.70

20 3.28
0.26 0.39 1.04 1.29 1.45 1.67 2.18 4.06 4.30 4.53 4.90 5.27 5.72 5.91 6.34 6.82 7.09 7.38 7.76 8.25 8.59 9.13 9.48 9.69
0
3.70
100
80
Laminarin
60
40
20 2.87 2.97 3.57
0.15 0.39 0.90 1.06 1.47 1.98 2.33 2.68 4.15 4.34 4.61 5.09 5.58 6.01 6.33 6.49 6.76 6.89 7.32 7.80 7.94 8.48 8.80 9.31 9.87
0
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5

(a) Time (min)

RT:3.7 AV:1 NL: 8.56E3
T:ITMS - c ESI Full ms [500.00-4000.00]
1628.50
100
95
90 Laminarin
85
80
1574.49
75 1736.34
70
Relative abundance

65
60
55
50
45 1790.31
1521.25
40
35
30
25
20
15 1469.02
2117.50
10 1844.47
2198.25
1414.52
5 2279.05
1360.58 2441.38 3418.90
0
600 800 1000 1200 1400 1600 1800 2000 2200 2400 2600 2800 3000 3200 3400 3600 3800 4000
m/z
(b)

Figure 11.3 Chromatograms of algal extracts and commercial laminarin from

Laminaria digitata (a). The commercial laminarin shows a distinctive single lami-
narin peak at a retention time of 3.70 min. The chromatogram of Cystoseira tama-
riscifolia reveals no laminarin in contrast to Saccharina latissima showing a clear
laminarin peak at 3.70 min. LC–MS mass spectrum of commercial laminarin as a
reference and for calculation of its molar masses (b).

11.4.3 Laminarin reference and quantification

For the calibration of the LC–MS and for a reliable determination and
analysis of laminarin from natural algal samples, the identification and
characterization of laminarin of commercially available substances are
necessary (Note 5).
Chapter eleven: Identification and quantification of laminarins 195

1. Dissolve commercial laminarin from L. digitata in ultrapure water,

which will provide clear LC–MS signals (Figure 11.3). Ultrapure
water suits best for dissolving laminarin compared to solvents such
as methanol, ethanol, ethanol/water (1:1, v/v), ethyl acetate, and tet-
rahydrofuran (THF) (for details see Graiff et al. 2016).
2. Prepare standard solutions of the commercial laminarin in different
concentrations (0.7, 0.375, 0.14, 0.07, and 0.014 mg ml−1) and analyze
them with the LC–MS to receive a calibration curve.
3. In addition to the full-scan measurements of the LC–MS, apply the
special simultaneous zoom scan measurement to identify charge
states of laminarin and to calculate the molar mass distribution.
Molar mass is determined at the maximum of the statistical molar
mass distribution.
4. Identify commercial laminarin in different concentrations by its
retention time of 3.70 min and its distinctive mass spectra of differ-
ent chain lengths (Figure 11.3).
5. Apply the special simultaneous zoom scan measurement, to iden-
tify laminarin as doubly charged. On the basis of this evidence, the
typical molar mass distribution of 2000–7000 Da can be confirmed
for the commercial laminarin by LC–MS analysis. Then use the com-
mercial laminarin as a reference for comparison with natural algal
samples.
6. This method will allow quantifying laminarin in very low concen-
trations (<0.014 mg ml−1).
7. Quantify laminarin from the algal samples by comparison of the
retention time and peak area with standard solutions (calibration
range 0.375–0.07, 0.7–0.07, and 0.14–0.014 mg ml−1) using the evalua-
tion software.

11.5 Notes
Note 1: A hot standard extraction method completely extracts alginate
in addition to the laminarins, which results in very viscous extracts.
These extracts are completely unsuitable for LC–MS analysis. The
hot extraction follows a standardized microwave extraction method
for plant components in ultrapure water as a solvent. The conditions
for microwave extraction are 20% of 400 W (MarsXpress 5 CEM) at a
rate of 5°C min−1 to 60°C for 5 min. This microwave-based method is
very effective and can be used for fresh and freeze dried raw material
with water as the solvent. It takes only 20 min for a complete extrac-
tion. However, this standard extraction method is proved to be com-
pletely unsuitable for extraction of laminarin from brown macroalgal
samples.
196 Protocols for Macroalgae Research

Note 2: Certain brown macroalgal species (e.g., Fucales) contain very high
amounts of alginates. Thus, even the application of the described cold
water method extracts substantial amounts of  alginate. The  extrac-
tion of alginates can be recognized by a higher viscosity and a
visible turbidity of the extract. To avoid disturbance of the LC–MS
measurements, a method was developed to precipitate alginates.
From the aqueous extract, 500 µL is transferred into a reaction vessel,
and the alginates are precipitated with 450 µL ethanol (>99.7%), and
50 µL formic acid (98%). This mixture is mixed for 10 s (Vortex mixer),
then stored for 12 h in a refrigerator and finally centrifuged for 5 min
at 14,000  rpm (Hettich micro 22  R, Germany). The clear and liquid
supernatant is transferred into a microvial (300 µl) for later LC–MS
analysis. To achieve comparable analysis conditions, the commercial
laminarin substance used for the reference measurements is treated
in the same way.
Note 3: The received extracts have to be measured either immediately or
after 4 h. Longer storage of the extracts, even in the refrigerator, leads
to noticeable decomposition of the polysaccharides, and thus lower
laminarin content will be detected.
Note 4: LC–MS analytics have some particular characteristics, which have
to be considered. If chemically different laminarin species, number
of different chain lengths, and presence of branched chains have to
be studied and investigated with the HPLC-measuring system, we
recommend the use of a column for size-exclusion chromatography.
Therefore, we use for the chromatographic separation of individual
laminarin chains a Zenix SEC 150 column (Sepax Technologies, Inc.,
250 mm length, 4.6 mm ID, 3 µm particle size, 150 An intermediate vol-
ume) with ultrapure water and 0.1% formic acid as eluents. However,
for the quantitative determination of the total laminarin content, this
column is not suitable because an integration of split or shoulder peaks
is not possible even after smoothing. For quantification purposes, the
use of the column described in Methods is better suitable.
Note 5: During an analysis sequence with the LC–MS system, a lami-
narin reference sample has to be inserted as a quality control-run
(QC-run) after at least six algal sample runs. Despite careful sam-
ple preparation, both the spray shield and the transfer capillary of
the mass spectrometer get blocked relatively fast, which leads to a
smaller ion transfer into the mass spectrometer. A QC-run permits
clear measurements because of an unhindered ion transfer.

Acknowledgment
This research was funded by the Project BIOACID Phase II of the German
Federal Ministry of Education and Research (BMBF; FKZ 03F0655L).
Chapter eleven: Identification and quantification of laminarins 197

References
Alderkamp, A.-C., M. van Rijssel, and H. Bolhuis. 2007. Characterization of marine
bacteria and the activity of their enzyme systems involved in degradation of
the algal storage glucan laminarin. FEMS Microbiol. Ecol. 59:108–117.
Annan, W. D., E. Hirst, and D. J. Manners. 1965. 162. The constitution of lami-
narin. Part V. The location of 1,6-glucosidic linkages. J. Chem. Soc. 885–891.
doi:10.1039/JR9650000885.
Beattie, A., E. L. Hirst, and E. Percival. 1961. Studies on the metabolism of the
Chrysophyceae. Comparative structural investigations on leucosin
(Chrysolaminarin) separated from diatoms and laminarin from the brown
algae. Biochem. J. 79:531–537.
Chapman, A. R. O., and J. S. Craigie. 1977. Seasonal growth in Laminaria longi-
cruris: Relations with dissolved inorganic nutrients and internal reserves of
nitrogen. Mar. Biol. 40:197–205.
Chizhov, A. O., A. Dell, H. R. Morris et al. 1998. Structural analysis of laminarans
by MALDI and FAB mass spectrometry. Carbohydr. Res. 310:203–210.
Craigie, J. S. 1974. Storage products. In Algal Physiology and Biochemistry, W. P. D.
Stewart (Ed.), pp. 206–235. Berkley, CA: University of California Press.
Dethier, M. N., and S. L. Williams. 2009. Seasonal stresses shift optimal intertidal
algal habitats. Mar. Biol. 156:555–567.
Devillé, C., J. Damas, P. Forget, G. Dandrifosse, and O. Peulen. 2004. Laminarin in
the dietary fibre concept. J. Sci. Food Agricult. 84:1030–1038.
Gagné, J. A., K. H. Mann, and A. R. O. Chapman. 1982. Seasonal patterns of growth
and storage in Laminaria longicruris in relation to differing patterns of avail-
ability of nitrogen in the water. Mar. Biol. 69:91–101.
Gómez, I., and P. Huovinen. 2012. Morpho-functionality of carbon metabolism in
seaweeds. In Seaweed Biology: Novel Insights into Ecophysiology, Ecology and
Utilization, C. Wiencke, and K. Bischof (Eds.), pp. 25–46. Berlin, Germany:
Springer Verlag.
Gómez, I., and C. Wiencke. 1998. Seasonal changes in C, N and major organic
compounds and their significance to morpho-functional processes in the
endemic Antarctic brown alga Ascoseira mirabilis. Polar Biol. 19:115–124.
Graiff, A., W. Ruth, U. Kragl, and U. Karsten. 2016. Chemical characterization and
quantification of the brown algal storage compound laminarin—A new
methodological approach. J. Appl. Phycol. 28:533–543.
Johnston, C. S., R. G. Jones, and R. D. Hunt. 1977. A seasonal carbon budget for a
Laminarian population in a scottish sea-loch. Helgoländer Wissenschaftliche
Meeresuntersuchungen 30:527–545.
Michel, G., T. Tonon, D. Scornet, J. M. Cock, and B. Kloareg. 2010. Central and storage
carbon metabolism of the brown alga Ectocarpus siliculosus: Insights into the ori-
gin and evolution of storage carbohydrates in eukaryotes. New Phytol. 188:67–81.
Nelson, T. E., and B. A. Lewis. 1974. Separation and characterization of the soluble
and insoluble components of insoluble laminaran. Carbohydr. Res. 33:63–74.
Peat, S., W. J. Whelan, and H. G. Lawley. 1958. 141. The structure of laminarin.
Part I. The main polymeric linkage. J. Chem. Soc. 724–728. doi:10.1039/
JR9580000724.
Percival, E. G. V., and A. G. Ross. 1951. 156. The constitution of laminarin. Part II.
The soluble laminarin of Laminaria digitata. J. Chem. Soc. 720–726. doi:10.1039/
JR9510000720.
198 Protocols for Macroalgae Research

Read, S. M., G. Currie, and A. Bacic. 1996. Analysis of the structural heterogeneity
of laminarin by electrospray-ionisation-mass spectrometry. Carbohydr. Res.
281:187–201.
Rioux, L.-E., S. L. Turgeon, and M. Beaulieu. 2007. Characterization of polysaccha-
rides extracted from brown seaweeds. Carbohydr. Polm. 69:530–537.
Rioux, L.-E., S. L. Turgeon, and M. Beaulieu. 2010. Structural characterization of
laminaran and galactofucan extracted from the brown seaweed Saccharina
longicruris. Phytochem. 71:1586–1595.
Rupérez, P., O. Ahrazem, and J. A. Leal. 2002. Potential antioxidant capacity of sul-
fated polysaccharides from the edible marine brown seaweed Fucus vesiculo-
sus. J. Agr. Food Chem. 50:840–845.
Schiener, P., K. D. Black, M. S. Stanley, and D. H. Green. 2015. The seasonal varia-
tion in the chemical composition of the kelp species Laminaria digitata,
Laminaria hyperborea, Saccharina latissima and Alaria esculenta. J. Appl. Phycol.
27:363–373.
Schmiedeberg, W. 1885. Über die Bestandteile der Laminaria. Gesellschaft deutscher
Naturforscher und Ärzte, Leipzig, Tageblatt der 58. Versammlung, p. 427.
Stenhouse, J. 1844. Über das Vorkommen von Mannit in Laminaria saccharina und
einigen anderen Seegräsern. Justus Liebigs Annalen Der Chemie 51:349–354.
Templeton, D. W., M. Quinn, S. van Wychen, D. Hyman, and L. M. L. Laurens. 2012.
Separation and quantification of microalgal carbohydrates. J. Chromatogr. A.
1270:225–234.
Yamaguchi, T., T. Ikawa, and K. Nisizawa. 1966. Incorporation of radioactive car-
bon from H14CO3− into sugar constituents by a brown alga, Eisenia bicyclis,
during photosynthesis and its fate in the dark. Plant Cell Physiol. 7:217–229.
Yemm, E. W., and A. J. Willis. 1954. The estimation of carbohydrates in plant
extracts by anthrone. Biochem. J. 57:508–514.
Yvin, J.-C., F. LeVasseur, and F. Hud`Homme. 1999. Use of laminarin and oligosac-
charides derived there from in cosmetics and for preparing a skin treatment
drug. US Patent 5980916A.
chapter twelve

Determination of carbohydrate
composition of macroalgae
Wouter J.J. Huijgen, E.M. Cobussen-Pool,
B.F. van Egmond, and J.W. van Hal

Contents
12.1 Introduction ......................................................................................... 200
12.2 State of the art ...................................................................................... 201
12.3 Materials ............................................................................................... 202
12.3.1 Seaweed .................................................................................. 202
12.3.2 Reagents.................................................................................. 202
12.3.3 Equipment .............................................................................. 203
12.4 Experimental procedures................................................................... 203
12.4.1 Preparation seaweed sample ............................................... 204
12.4.2 Hydrolysis .............................................................................. 204
12.4.2.1 Prehydrolysis ........................................................ 204
12.4.2.2 Hydrolysis ............................................................. 205
12.4.3 Analysis monomeric carbohydrates ................................... 205
12.4.3.1 Sample preparation .............................................. 205
12.4.3.2 Gradient ................................................................. 206
12.4.4 Calculations ........................................................................... 208
12.5 Notes ..................................................................................................... 208
12.5.1 General remarks .................................................................... 208
12.5.2 Seaweed hydrolysis............................................................... 209
12.5.3 High-performance anion-exchange chromatography
with pulsed amperometric detector ................................... 209
Acknowledgments ......................................................................................... 210
References........................................................................................................ 210

199
200 Protocols for Macroalgae Research

12.1 Introduction
Carbohydrates are a major constituent of macroalgae (in addition to min-
erals and proteins) (Van Hal et al. 2014). In addition, carbohydrates are key
target components in the application of macroalgae for production of, for
example, biobased chemicals and biofuels (Van Hal et al. 2014). However,
a generally accepted protocol for adequate determination of the content
of individual carbohydrates is lacking. The EU-H2020 MacroFuels project
aims to develop such a protocol.
The carbohydrates that occur in seaweeds vary between the major
classes of seaweeds: that is, the brown seaweeds (Phaeophycaea includ-
ing Kelps), the red seaweeds (Rhodophyta), and the green seaweeds
(Chlorophyta). Within the group of red seaweeds, at least three different
main structural carbohydrates occur: that is, (1) xylan (e.g., Palmaria pal-
mata), (2) agar (e.g., Gracilaria sp.), and (3) carrageenan (e.g., Chondrus
crispus). Table 12.1 gives an overview of carbohydrates reported in the lit-
erature for the seaweeds used in our study.
Here, we present a method for determination of the carbohydrate com-
position of macroalgae based on hydrolysis and subsequent determina-
tion of resulting monosaccharides by high-performance anion-exchange
chromatography with pulsed amperometric detector (HPAEC–PAD). The
presented approach is intended to be uniform for all seaweeds, with opti-
mum hydrolysis conditions that have to be determined for each (class of)
seaweed. As an example, the optimum hydrolysis times for three differ-
ent seaweeds have been identified. This optimization procedure can also
be extended to other seaweeds. In addition, a gradient and elution order
for the HPAEC–PAD is described that allows determination of the major

Table 12.1 Overview of (structural) carbohydrates present in

seaweeds used (Van Hal et al. 2016) (see also Note 12)
Palmaria
Seaweed Laminaria digitata palmata Ulva lactuca
Seaweed class Brown Red Green
Carbohydrates in Mannitol Floridoside Ulvan (rhamnose,
seaweed Alginate (mannuronic (galactose xylose,
(corresponding and guluronic acid) and glycerol) glucuronic acid,
monosaccharides Laminarin (glucose) Xylan (xylose) and iduronic
on hydrolysis) Cellulose (glucose) Cellulose acid)
Fucoidan (fucose) (glucose) Cellulose
(glucose)
Chapter twelve: Determination of carbohydrate composition of macroalgae 201

sugar alcohols, reducing sugars, deoxy sugars, and uronic acids occurring
in tested seaweeds in a single run.

12.2 State of the art

A generally accepted protocol for determination of carbohydrate compo-
sition of seaweeds is lacking. However, for other types of biomass, such
protocols exist, such as the method for lignocellulosic biomass devel-
oped by the U.S. National Renewable Energy Laboratory (NREL). This
method is based on two-stage hydrolysis of structural carbohydrate poly-
mers using H2SO4 and subsequent determination of resulting monosac-
charides (Sluiter et al. 2010). In a comparison of different chemical and
enzymatic hydrolysis methods, the NREL method has been selected in
literature for compositional analysis of brown seaweeds (Manns et al.
2014). In addition to the standard NREL protocol, in which second-stage
hydrolysis is performed at 121°C, an alternative protocol with hydrolysis
at 100°C has been reported in the literature for summative composition
analysis of lignocellulosic biomass (TAPPI 2009, Wildschut et al. 2013).
This modified approach has been applied in literature to, for example,
Ulva lactuca (Van der Wal et al. 2013). Anticipating that more labile car-
bohydrates such as uronic acids would give a higher recovery at a lower
temperature, the starting point for this study was based on this approach,
that is, as follows:

• Prehydrolysis: 12  M H2SO4, 30°C, 1  h (to hydrolyze the polymeric

structural carbohydrates into soluble [oligomeric] carbohydrates).
• Hydrolysis: 1.2 M H2SO4, 100°C, 3 h (to convert oligomeric carbohy-
drates into monosaccharides).
• Analysis of resulting monomeric carbohydrates by HPAEC–PAD.

The reaction times of both steps have been varied to determine opti-
mum conditions. It was found that prehydrolysis is required to have ade-
quate hydrolysis of structural components such as cellulose and ulvan.
Optimum prehydrolysis time determined for all the three seaweeds was
60 min (identical to lignocellulosic biomass).
The optimum hydrolysis time was found to depend on both the sea-
weed type and specific monosaccharides of interest. For each monosac-
charide, a balance between formation and degradation (e.g., to furans),
which are both acid catalyzed, needs to be found. Recommended optimum
hydrolysis times based on the maximum total carbohydrate response are
given in Table 12.2.
202 Protocols for Macroalgae Research

Table 12.2 Optimum hydrolysis times recommended

Laminaria Palmaria
Seaweed digitata palmata Ulva lactuca
a
Optimum hydrolysis time (h) 3 2 3
Too short, that is, Mannuronic acid Glucuronic acid
underestimation of: Glucose Rhamnose
(Chemically
bound) mannitol
Too long, that is, degradation of: Guluronic acid Xylose
a Iduronic acid is very sensitive to degradation by hydrolysis. The optimum response of all
monosaccharides, including iduronic acid, could not be obtained with a single hydrolysis time.

12.3 Materials
12.3.1 Seaweed
• In the case of nondried seaweed, immediately dry it to prevent com-
positional changes.
• Optionally, remove large contaminants such as stones and snails.
• Cut seaweed, if needed.
• Dry at mild conditions, preferably by freeze-drying (alterna-
tively, in a [vacuum] oven at ≤50°C).
• Check moisture content. Ambient-dry conditions (about 5%–15%
moisture content, depending on seaweed species) are sufficient.
• Crush or cut dried seaweed to <1 cm and homogenize.
• Store the dried seaweed in closed containers at ambient temperature
until compositional analysis.

12.3.2 Reagents
• 72% w/w (12 M) sulfuric acid (stored at 4°C)
• BaCO3
• Bromophenol blue indicator (20 mg L –1)
• Standards analysis monomeric carbohydrates:
• Sugar alcohols:
– Mannitol
– Glycerol
• Reducing sugars:
– Glucose
– Xylose
– Arabinose (might be left out as not detected in seaweeds)
– Galactose
– Fructose (internal standard)
Chapter twelve: Determination of carbohydrate composition of macroalgae 203

• Deoxy sugars:
– Rhamnose (as L-rhamnose monohydrate)
– Fucose
• Uronic acids:
– Guluronic acid as the sodium salt (CarboSynth Limited, UK)
– Mannuronic acid as the sodium salt (CarboSynth Limited, UK)
– Iduronic acid (CarboSynth Limited, UK)
– Galacturonic acid
– Glucuronic acid

12.3.3 Equipment
• Halogen moisture analyzer.
• 50 mL centrifuge plastic tubes with a screw cap.
• Use centrifuge tubes that are heat resistant to maximum operat-
ing temperature (i.e. 100°C).
• Use centrifuge tubes with a cap that are liquid tight at elevated
temperature, to prevent leaking while shaking. Centrifuge tubes
with a flat screw cap tend to work fine.
• 10 mL plastic centrifuge tubes.
• Water bath set at 30°C.
• Water bath set at 100°C.
• Centrifuge applicable for 50 mL centrifuge tubes.
• Centrifuge applicable for 10 mL centrifuge tubes.
• HPAEC setup (Dionex, Sunnyvale, CA, USA) consisting of
• ICS3000 Ion Chromatography System
• CarboPac PA1 column (2 × 250 mm)
• CarboPac guard column (2 × 50 mm)
• Pulsed amperometric detector (PAD)
• Pump 1 (used for gradient over column, 0.25 mL/min)
– Eluent A: Ultrapure water
– Eluent B: 0.1 M NaOH in ultrapure water
– Eluent C: 0.1 M NaOH and 1 M NaAc in ultrapure water
• Pump 2 (used for postcolumn addition of NaOH, 0.15 mL min–1)
– 0.25 M NaOH in ultrapure water.

12.4 Experimental procedures

Determination of the carbohydrate composition of macroalgae consists of
the following steps (see also the general Notes 1–5):

1. Preparation of seaweed sample.

2. Two-stage hydrolysis (to hydrolyze the polymeric structural carbo-
hydrates into monosaccharides).
204 Protocols for Macroalgae Research

3. Analysis of resulting monosaccharides by HPAEC–PAD using a gra-

dient that allows determination of the major sugar alcohols, reducing
sugars, deoxy sugars, and uronic acids occurring in tested seaweeds
in a single run.

12.4.1 Preparation seaweed sample

1. Take a representative sample of ambient-dry seaweed from the
closed container (see also 3.1.). Use at least about 2 g, but in the case
of inhomogeneous sample use a larger amount.
2. Optionally, let seaweed sample equilibrate with ambient humidity
overnight. Normally, equilibration takes place during subsequent
milling, and this step can be skipped.
3. Mill seaweed sample to <250 µm:
a. Use, for example, a laboratory cutting mill, knife mill, or a vibra-
tory disc mill.
b. Avoid heating of the sample while milling (i.e., mill in steps
using short milling times).
c. After each milling step, sieve sample over <250 µm and mill part
that does not pass again.
4. Transfer seaweed sample quantitatively to a plastic container:
a. Use a brush to get the finer part of the sample off the inside of the
mill.
b. Avoid separation of inorganics particles that might be present.
5. Homogenize seaweed sample well by mixing.
6. Take representative subsample and determine moisture content
using a moisture analyzer or by drying till constant weight (xmoisture).
7. Weigh empty 50 mL centrifuge plastic tube (mempty).
8. Weigh in 300 ± 5 mg of representative subsample in the centrifuge
tube (mseaweed).
9. Make sure all the sample is at the bottom of the tube.

12.4.2 Hydrolysis
12.4.2.1 Prehydrolysis
1. Place tube with the sample in ice water and let it cool down (proper
cooling is crucial!).
2. Open the tube and carefully add 3 mL of prechilled 72% w/w sulfu-
ric acid.
3. Carefully mix the sample with the sulfuric acid using a sealed glass
Pasteur pipette. Leave the pipette in the tube.
4. Transfer the open tube to a preheated water bath and incubate for
60 min at 30°C (Note 6).
Chapter twelve: Determination of carbohydrate composition of macroalgae 205

5. Mix sample every 10–15 min using the sealed glass Pasteur pipette.
6. After incubation, transfer the tube to ice water to stop the prehy-
drolysis reaction.

12.4.2.2 Hydrolysis
1. Add demineralized H2O to the tube to a final volume of 30  mL.
While adding the water, clean the sealed glass Pasteur pipette and
take it out.
2. Close the tube with the screw cap and mix well by shaking.
3. Transfer tube, placed in a rack, to a preheated water bath, and incu-
bate at 100°C for 180  min (Laminaria digitata and Ulva lactuca) or
120 min (Palmaria palmata) (Notes 7 and 8).
4. Mix every 45–60 min by shaking. Be cautious and shake gently as
centrifuge tube is hot and tube and/or screw cap might have become
softer at elevated temperature (Note!)
5. After incubation, transfer the tube to ice water to cool down and stop
the hydrolysis.
6. Take tube out of ice water, dry the outside, and weigh the tube (mfinal).
7. Centrifuge tube for 5 min at 2500–3000 g at 20°C.
8. Alternatively, the tube can be placed overnight in a refrigerator after
initial cooling in ice water to cool down further and allow the resid-
ual solids to settle. In general, thus a clear supernatant is obtained,
and centrifugation is not needed.
9. Take a sample from the supernatant (Note 9).
10. Store sample in the freezer at −20°C until analysis. The sample
should preferably be analyzed within a few weeks but might be kept
for substantially longer times.

12.4.3 Analysis monomeric carbohydrates

Analysis of monomeric carbohydrates resulting from seaweed hydroly-
sis as described above can be performed with any adequate technique.
However, GC and HPLC techniques are generally not able to adequately
distinguish all individual seaweed constituents and require the use of
multiple columns and/or derivatization steps. Here, we describe HPAEC,
given its ability to separate sugar alcohols, reducing sugars, deoxy sugars,
and uronic acids in a single run.

12.4.3.1 Sample preparation

1. Thaw hydrolysate sample.
2. Add 0.2 mL seaweed hydrolysate to a 10 mL plastic centrifuge tube.
3. Add 4.8 mL 20 mg L –1 bromophenol blue indicator to the tube.
206 Protocols for Macroalgae Research

4. Neutralize by adding small amounts of BaCO3 (total about 75 mg)

until the solution turns blue while vortexing (final pH >4.6, max 8.2).
5. Centrifuge tube for 30 min at 2500–3000 g at 20°C.
6. Take 1.0 mL of the clear supernatant and add to a vial.
7. Add 0.5  mL 150  ppm fructose as an internal standard to the vial
(Note 13).
8. Homogenize the solution and place vial in the autosampler of the
HPAEC–PAD.

12.4.3.2 Gradient
After sample injection, while using 15 mM NaOH as mobile phase, pure
water is used first as eluent for successively sugar alcohols, deoxy sug-
ars, and reducing sugars and, subsequently, a gradient of NaOH and Na
acetate is used as eluent for uronic acids (Notes 10 and 11).

1. Condition column with 0.1 M NaOH and 1 M NaAc (100% eluent C)

(Note 10).
2. Condition column with 15 mM NaOH (85% eluent A [H2O] and 15%
eluent B [100 mM NaOH]) (Note 10).
3. Inject sample (injection volume 10 µL).
4. Run gradient as given in Table 12.3.

Table 12.3 HPAEC–PAD multigradient optimized for determination

of the major sugar alcohols, deoxy sugars, reducing sugars, and
uronic acids occurring in tested seaweeds in a single run
(including conditioning for next injection)
Eluent A Eluent B (0.1 M Eluent C (0.1 M NaOH
t (min) (H 2O) (%) NaOH) (%) and 1 M NaAc) (%)
0 85 15 0
0 85 15 0
2 85 15 0
2 100 0 0
12.5 100 0 0
17 85 15 0
17.5 73 16 11
29.5 45 40 15
30 0 0 100
35 0 0 100
35.5 85 15 0
48 85 15 0
Chapter twelve: Determination of carbohydrate composition of macroalgae 207

Glycerol
Mannitol
Fucose

Galactose
Rhamnose
Arabinose

Glucose

Xylose

Galacturonic acid

Mannuronic acid
Glucuronic acid
Guluronic acid
IS (Fructose)
1 2 3 4 5 6 7 8 9 10 11 12 13
0.1 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 18.0 20.0 22.0 24.0 26.0 28.0 30.0 32.0
t (min)

Figure 12.1  HPAEC-PAD chromatograph of a mixture of standards (excluding

iduronic acid).

Figure 12.1 shows the HPAEC chromatograph of a mixture of stan-

dards and the gradient applied. Table 12.4 gives the elution order of com-
ponents and the indicative retention times.
For component labeling, see Table 12.4.

Table 12.4 Elution order and indicative retention

times of the components (Note 14)
# Component t (min)
1 Glycerol 1.7
2 Mannitol 2.3
3 Fucose 3.5
4 Rhamnose 5.7
5 Arabinose 6.4
6 Galactose 8.4
7 Glucose 9.6
8 Xylose 11.8
9 Fructose (IS) 15.7
10 Galacturonic acid 26.1
11 Guluronic acid 26.7
12 Glucuronic acid 27.7
13 Mannuronic acid 28.5
14 Iduronic acid 31.0
208 Protocols for Macroalgae Research

12.4.4 Calculations
The content of individual carbohydrates is calculated by

ccarb =
[carb] ⋅ ( mfinal − mempty ) ⋅ 100% (12.1)
mseaweed ⋅ ( 1 − xmoisture )

where:
ccarb is the content of carbohydrate in seaweed (% w/w on dry basis).
[carb] is the concentration carbohydrate in hydrolysate as determined
by HPAEC–PAD (g/g).
mfinal is the weight of the centrifuge tube and hydrolysate after two-
stage hydrolysis (g).
mempty is the weight of the empty centrifuge tube (g).
mseaweed is the weight of the seaweed sample used for hydrolysis (g).
xmoisture is the moisture content of the seaweed sample (−).

The carbohydrate content is based on corresponding monosaccharides.

Optionally, a molar mass correction to anhydrous monomeric equivalents
can be made in case the carbohydrate is known to be part of a polymer.

12.5 Notes
12.5.1 General remarks
Note 1: Perform compositional analysis at least in duplicate.
Note 2: The summative composition of seaweeds might be further com-
pleted by determination of, among others, proteins (e.g., based on
total nitrogen) (Safi et al. 2017), phenolic components (Hou et al.
2017), and ash (by calcination of seaweed at 550°C).
Note 3: In a compositional analysis of lignocellulosic biomass, recovery
factors are sometimes used to correct for acid degradation of formed
monosaccharides (Sluiter et al. 2010). A similar approach might be
followed for seaweeds, although it should be realized that (1) the
use of recovery factors tends to lead to an overestimation of the con-
tent of individual carbohydrates (Whitfield et al. 2016) and (2) uronic
acids are more sensitive to acid degradation than reducing sugars.
(Moreover, the sensitivity of each uronic acid toward acid degrada-
tion differs.)
Note 4: No distinction between different glucans in, for example, Kelps,
that is, laminarin and cellulose, can be made with this method. If
required, see Chapter 11 by Graiff et al. (2017).
Note 5: The presented protocol has not been verified for agarophytes,
such as Gracilaria sp., carrageenan-containing Rhodophyta such as
Chapter twelve: Determination of carbohydrate composition of macroalgae 209

Chondrus crispus and fucoidan-rich brown seaweeds, such as Fucus

sp. One can use the optimization procedure described to adapt the
protocol for the desired seaweed.

12.5.2 Seaweed hydrolysis

Note 6: For Palmaria palmata, the prehydrolysis time might be shortened
to 30 min.
Note 7: To prevent excessive boiling during the hydrolysis step, which
tends to disturb the centrifuge tubes in the rack, the water bath can
best be set at 99.5°C–99.8°C.
Note 8: To prevent pressure built-up during the hydrolysis step, the
screw cap of the centrifuge tube might be slightly loosened before
the tube is placed in the water bath.
Note 9: Optionally, the dry weight of the solid residue remaining after
two-stage hydrolysis might be determined, after washing, to verify
the completeness of the liquefaction.

12.5.3 High-performance anion-exchange chromatography

with pulsed amperometric detector
Note 10: Adequate conditioning of the column is crucial for proper anal-
ysis and stable retention times.
Note 11: Calibration standards are perishable.
Open solutions of calibration standards as least as possible to reduce
the risk of microbiological contamination.
Store calibration standards adequately.
Check calibration curves using an independent standard.
Note 12: In case other sugar alcohols than only mannitol and glycerol
are present in the hydrolysate, separation of individual sugar alcohols
over the CarboPac PA1 column might be insufficient. In that case,
additional analysis of the hydrolysate with another analytical method
is recommended such as HPAEC–PAD using a CarboPac MA1 column.
Note 13: In (tested) seaweeds, as far as known, no fructose is present.
However, the absence of fructose should always be verified for each
type of seaweed by HPAEC–PAD analysis of its hydrolysate without
the addition of an internal standard. As an alternative to fructose, for
example, ribose might be used as internal standard. The retention
time of ribose is slightly longer than that of fructose.
Note 14: Mannose cannot be separated adequately from xylose with the
presented HPAEC–PAD protocol. Please be aware when applying
this protocol to other types of biomass such as nonmarine aquatic
plants such as Azolla and water hyacinth. In seaweeds, as far as
known, no mannose is present.
210 Protocols for Macroalgae Research

Acknowledgments
The authors thank Mark Smit for his contribution to the experimental
work and Arjan Smit for his ideas and input. The current chapter is part
of the MacroFuels project. This project has received funding from the
European Union’s Horizon 2020 research and innovation program under
grant agreement No 654010.

References
Graiff, A., W. Ruth, and U. Karsten. 2017. Identification and quantification of
laminarin in brown algae. In Protocols for Macroalgae Research, B. Charrier,
T.  Wichard, and C. R. K. Reddy, (Eds.), Chapter 11. Boca Raton, FL: CRC
Press, Taylor & Francis Group.
Hou, X., R. Neerup, and A. B. Bjerre. 2017. Total phenol content and antioxidant
capacity analysis of seaweed biomass. In Biotechnology Protocols for Macroalgae
Research, B. Charrier, T. Wichard, and C. R. K. Reddy (Eds.), Chapter 15. Boca
Raton, FL: CRC Press, Taylor & Francis Group.
Manns, D., A. L. Deutschle, B. Saake, and A. S. Meyer. 2014. Methodology for
quantitative determination of the carbohydrate composition of brown sea-
weeds (Laminariaceae). RSC Advances 4:25736–25746.
Safi, C., J. van Leeuwen, Y. Telleman, N. Engelen-Smit, L. van den Broek, and
P. Harmsen. 2017. Quantification of proteins in seaweeds. In Biotechnology
Protocols for Macroalgae Research, B. Charrier, T. Wichard, and C. R. K. Reddy
(Eds.), Chapter 13. Boca Raton, FL: CRC Press, Taylor & Francis Group.
Sluiter, J. B., R. O. Ruiz, C. J. Scarlata, A. D. Sluiter, and D. W. Templeton. 2010.
Compositional analysis of lignocellulosic feedstocks. 1. Review and descrip-
tion of methods. J. Agric. Food Chem. 58:9043–9053.
TAPPI (Technical Association of the Pulp and Paper Industry) 2009. Standard test
methods. http://www.tappi.org. Norcross, GA.
Van der Wal, H., B. L. H. M. Sperber, B. Houweling-Tan, R. R. C. Bakker,
W. Brandenburg, and A. M. López-Contreras. 2013. Production of acetone,
butanol, and ethanol from biomass of the green seaweed Ulva lactuca.
Bioresour. Technol. 128:431–437.
Van Hal, J. W., A. B. Bjerre, A. M. López-Contreras, M. Stanley, G. O. Hreggvidsson,
and W. J. J. Huijgen. 2016. Carbohydrate analysis of seaweed in the biorefin-
ery to chemicals and fuel context. Paper Presented at the International Seaweed
Symposium, Copenhagen, Denmark.
Van Hal, J. W., W. J. J. Huijgen, and A.M. López-Contreras. 2014. Opportunities
and challenges for seaweed in the biobased economy. Trends Biotechnol.
32:231–233.
Whitfield, M. B., M. S. Chinn, and M. W. Veal. 2016. Improvement of acid hydro-
lysis procedures for the composition analysis of herbaceous biomass. Ener.
Fuels 30:8260–8269.
Wildschut, J., A. T. Smit, J. H. Reith, and W. J. J. Huijgen. 2013. Ethanol-based
organosolv fractionation of wheat straw for the production of lignin and
enzymatically digestible cellulose. Bioresour. Technol. 135:58–66.
chapter thirteen

Quantification of
proteins in seaweeds
Carl Safi, Jelle van Leeuwen, Yvette Telleman,
Nicole Engelen-Smit, Lambertus van den Broek,
and Paulien Harmsen

Contents
13.1 Introduction ......................................................................................... 212
13.2 State of the art ...................................................................................... 212
13.3 Materials ............................................................................................... 213
13.3.1 Kjeldahl method: Total protein determination ................. 213
13.3.2 Dumas method: Total protein determination ................... 213
13.3.3 Amino acid determination ...................................................216
13.3.4 Nitrogen-to-protein-conversion factor determination......216
13.3.5 Lowry method: Soluble protein determination .................216
13.3.6 Bradford method: Soluble protein assay ........................... 217
13.4 Experimental procedures................................................................... 217
13.4.1 Kjeldahl method: Total protein determination ................. 217
13.4.1.1 Digestion ............................................................... 217
13.4.1.2 Distillation ............................................................ 217
13.4.1.3 Titration ................................................................. 218
13.4.1.4 Calculation ............................................................ 218
13.4.2 Dumas method: Total protein determination ................... 218
13.4.2.1 Procedure .............................................................. 218
13.4.3 Amino acid determination .................................................. 219
13.4.3.1 Preparation of reagents ....................................... 219
13.4.3.2 Preparation of eluents ......................................... 219
13.4.3.3 Preparation of standards .................................... 219
13.4.3.4 Acid hydrolysis..................................................... 220
13.4.3.5 Analysis ................................................................. 220
13.4.4 Nitrogen-to-protein-conversion factor determination..... 220
13.4.4.1 Procedure .............................................................. 220
13.4.5 Lowry method: Soluble protein determination ................ 221
13.4.5.1 Preparation of the standard solution ................ 221

211
212 Protocols for Macroalgae Research

13.4.5.2 Preparation of Folin–Ciocalteau reagent .......... 221

13.4.5.3 Test tube protocol ................................................. 222
13.4.6 Bradford method: Soluble protein assay ........................... 222
13.4.6.1 Procedure .............................................................. 222
13.5 Notes ..................................................................................................... 222
Acknowledgment ........................................................................................... 223
References........................................................................................................ 223

13.1 Introduction
Seaweeds have been long exploited as a marine vegetable and food
additive owing to their rich composition of unique functional polysac-
charides, minerals, and proteins (Fujiwara-Arasaki et al. 1984; Fleurence
1999). Though proteins are an important component of seaweed compo-
sition, additional value can be created by extracting proteins together
with high-value compounds, such as health-improving components
and hydrocolloids (Jung et al. 2013). Aside from the economic benefits of
protein extraction, seaweed-based proteins can also alleviate the grow-
ing global demand for protein that is expected in the coming years.
As seaweeds only need water, CO2, and the fertilizers present in the
sea, they can also contribute to reducing the environmental hazards
associated with the current production of animal proteins (Steinfeld
et al. 2006; Gerber et al. 2013). The protein content of seaweeds varies
through species, cultivation location, and season (Black 1950, Patarra
et al. 2011). Studies have shown that the protein content in green spe-
cies can fluctuate from 5% to 32% (w/dw), brown species from 3% to 16%
(w/dw), and red seaweeds can contain from 2% to 29% (w/dw) protein
at 90% confidence level (Angell et al. 2016). Combining the interest in
seaweed protein with these observed fluctuations stresses, the need for
reliable methods to determine the protein content in seaweed samples
and fractions.

13.2 State of the art

Proteins are polypeptides formed from amino acids (AAs) through amide
linkages. These so-called peptide bonds are synthesized by the carboxyl
group of the AA at the end of the growing polypeptide chain, which reacts
with the amino group of an incoming free AA and thereby releasing a
water molecule. For extraction, seaweed proteins can be found in soluble
or insoluble form, with a ratio that is dependent on the species selected
and the extraction method applied (Barbarino and Lourenco 2005; Angell
et al. 2017; Vilg and Undeland 2017). Many methods are available for the
determination of total soluble proteins. These can be based on colorimetric
Chapter thirteen: Quantification of proteins in seaweeds 213

assays such as Lowry and Bradford (Barbarino and Lourenco 2005). Here,
the presence of the peptide bonds or the presence of certain AAs plays a
role. Another approach is the determination of the total amount of nitrogen
present in your sample. Kjeldahl and Dumas can be used to estimate the
total nitrogen content, which can be converted into total protein content.
This is because each peptide bond contains a nitrogen atom, although
some AAs have an additional nitrogen atom in their structure (e.g.,
arginine and histidine). A nitrogen-to-protein (NTP)-conversion factor
is required, and this is calculated from the total amount of AAs present
in the sample (Shuuluka et al. 2013; Akgul et al. 2015; Angell et al. 2016;
Biancarosa et al. 2017). If insoluble proteins are present, it is not possible to
use the colorimetric assays to determine the total protein content because
the peptide bonds and/or AAs are hardly accessible and are more or less
contained in the matrix. In these cases, Kjeldahl or Dumas method is the
most suitable one. Be aware that you should be careful to compare the
outcome of the different protein assays with each other as the methods
are based on different principles and as such can result in different values
(Barbarino and Lourenco 2005). For total proteins, especially Kjeldahl is
most often used, whereas for soluble protein Lowry is the preferred protein
method. On the other hand, Dumas (total protein) and Bradford (soluble
protein) are also suitable, and their advantage is the short assay time. All
methods described in this chapter are applicable to all seaweed species
regardless of its color (red, green, or brown) or structural characteristics.
Furthermore, despite the satisfying efficiency these methods exhibit, they
also feature weaknesses that should also be taken into consideration
(Table 13.1).

13.3 Materials
13.3.1 Kjeldahl method: Total protein determination
• Sulfuric acid: 95%–97% sulfuric acid.
• Kjeltab: Kjeltabs Type CK, each tablet contains: 3.5  g K2SO4  +  0.4  g
CuSO4·5H2O.
• Boric acid: Boric acid is dissolved in a solution of 1%. To prepare the
solution, 50 g boric acid is dissolved in 5 L distilled water.
• Sodium hydroxide: 33% NaOH with 16.5 g L–1 sodium thiosulfate.
• Hydrochloric acid: 0.1 M (0.1 N) HCl.

13.3.2 Dumas method: Total protein determination

• Oxygen gas for combustion (free of nitrogen).
• Column material for removal of nonnitrogen-containing substances.
 214

Table 13.1 Screening of the main advantages and disadvantages of the methods described in this chapter
Methods Advantages Disadvantages
Kjeldahl Suitable for both dry and liquid samples Time-consuming
Measures small amount samples, if needed Measures total nitrogen including nonprotein nitrogen
Measures total proteins (soluble and insoluble) Generates a lot of waste
Dumas Suitable for both dry and liquid samples Measures total nitrogen, including nonprotein nitrogen
Measures total proteins (soluble and insoluble) A drying step must be performed before the analysis step of
the method
Amino acids Accurate measurement Time-consuming
determination The acid hydrolysis denatures tryptophan and renders very
difficult for the determination of cysteine
NTP Gives more accurate protein measurements It is dependent on the quality of the amino acid analysis
calculation It only targets protein nitrogen previously performed
The NTP is highly dependent on the nitrogen-containing
components present in the sample
Its value can vary between seaweed species, growth conditions,
and growth phase at which the seaweed has been harvested
(Continued)
Protocols for Macroalgae Research
 Table 13.1 (Continued) Screening of the main advantages and disadvantages of the methods described in this chapter
Methods Advantages Disadvantages
Lowry Selective measurement given that it only Risk of no color formation because of the interference of other
determines soluble proteins substances such as chelating agents
Measures/detects very small amount of The formation of purple color instead of blue is due to the
protein present in the sample presence of reducing agents or thiol in the sample
The formation of precipitate is because of the presence of
surfactant in the sample
Bradford Fast and simple assay Detergents such as SDS and/or basic conditions affect the color
Measures very small amount of protein present in The proteins should contain arginine and/or aromatic residues
the sample as the dye binds to these amino acids to form the color
The color is not affected by the presence of reducing The calculation of the amount of proteins is dependent on the
Chapter thirteen: Quantification of proteins in seaweeds

agents such as DTT and β-mercaptoethanol type of standard protein used in the assay
215
216 Protocols for Macroalgae Research

• Carrier gas, often helium (free of nitrogen).

• Stock chemical containing a known amount of nitrogen, for instance
methionine.
• The stock chemical is lacking nitrogen, for example, cellulose.
• Aluminum or tin cups.
• (Freeze-) drying equipment.
• Grinding equipment (e.g., mortar and pestle).
• Analytical balance, preferably accurate to 0.1 mg.
• Combustion oven >900°C.
• Polishing column.
• Thermal conductivity detector.

13.3.3 Amino acid determination

• Analytical grade o-phthalaldehyde (OPA) and ethanethiol for
derivatization of AA.
• Analytical grade 9-fluorenylmethyl chloroformate (FMOC) for
derivatization of Proline.
• Boric acid, potassium chloride, sodium hydroxide (50%) for buffer A.
• Phosphoric acid for the injection diluent.
• Hydrogen chloride and phenol for the acid hydrolysis.
• Disodium phosphate, tetraborate, and sodium azide for eluents.
• Norleucine (internal standard) and AAS18 for the preparation of
standards and any additional AA not included in AAS18.
• Column: Acuity UPLC BEH C18 1.7 µm, 2.1 × 150 mm.

13.3.4 Nitrogen-to-protein-conversion factor determination

• No specific materials are needed to conduct the calculation of the
NTP conversion factor.

13.3.5 Lowry method: Soluble protein determination

• Two bovine serum albumin (BSA) ampules (2 mg mL–1 each).
• Spectrophotometer cuvettes.
• MilliQ water.
• Folin–Ciocalteau reagent.
• Preprepared modified Lowry reagent containing sodium tartrate
(Na2C4H4O6) in an alkaline sodium carbonate buffer (Na2CO3),
cupric sulfate (CuSO4), and potassium iodide (KI).
• All reagents and BSA ampules can be found in the modified Lowry
assay kit (Thermo Fisher Scientific).
• Automatic Pipettors.
Chapter thirteen: Quantification of proteins in seaweeds 217

13.3.6 Bradford method: Soluble protein assay

• 0.01% (w/v) Coomassie Brilliant Blue G-250 in 4.7% (w/v) ethanol
and 8.5% (w/v) phosphoric acid. The reagents can also be obtained
already prepared (e.g., Sigma-Aldrich or Thermo Scientific Pierce).
• 0–1.4 mg mL–1 BSA.
• Automatic pipettors

13.4 Experimental procedures

13.4.1 Kjeldahl method: Total protein determination
It was first developed in 1883 by the Danish scientist Johan Kjeldahl. The
method measures the total amount of organic nitrogen present in the bio-
mass or the extracts. The amount of nitrogen determined will be then
converted into the amount of protein using the NTP-conversion factor.
Please note that the protocol described applies to a semiautomated system
(Gerhardt Analytical Systems, Königswinter, Germany).

13.4.1.1 Digestion
1. Switch on the heater and set the temperature at 420°C.
2. Weigh the sample in the tubes and add a Kjeltabs tablet and 9 mL
H2SO4 (Notes 1–3).
3. Once the heater is at the desired temperature, insert the tubes and
put the exhaust system on the top.
4. Switch on the scrubber and water the scrubber.
5. Leave the tubes for 50 min in the heater.
6. Switch off the scrubber and lift the rack with the tubes.
7. Leave the exhaust system on top until no further fumes come out.
8. Add 75 mL distilled water in each tube (maximum cooling time is
10 min).
9. The samples are ready for the next step: distillation.

13.4.1.2 Distillation
1. Switch on the VAPODEST 45 and the water.
2. Double check if the vessels are full with distilled water, boric acid,
and sodium hydroxide.
3. Put a tube with 75 mL water in the machine and an empty Erlenmeyer.
This tube is only to warm up the machine.
4. Select the distillation program on the screen and press enter to start
measuring.
5. Wait for 5 min, and the sample is ready.
6. Put a new tube with water and an empty Erlenmeyer to determine
the blank value.
218 Protocols for Macroalgae Research

7. Repeat this step until the value will be 0.12–0.15 M HCl (titration).
8. Now tubes with the protein samples can be measured.
9. After all samples are tested, activate the cleaning system.

13.4.1.3 Titration
1. Always start with calibrating the electrode by selecting the calibra-
tion mode.
2. Set the temperature at 25°C.
3. First, calibrate with the pH 7 buffer, then calibrate with the pH 4
buffer.
4. After the calibration step is over, select Kjeldahl method and start
with titration.
5. Record the amount of HCl (mL) titrated.

13.4.1.4 Calculation
Use the following equation:

Protein (mg ) = (mL − blank ) × 0.1 × 14 × KF

0.1 is the concentration of HCl used during titration. 14 is the molec-

ular weight of nitrogen; KF is a Kjeldahl factor or the so-called NTP-
conversion factor; according to Akgul et al. (2015), the universal NTP for
seaweeds is 5.

13.4.2 Dumas method: Total protein determination

The method was first proposed by the French chemist Jean-Baptiste
Dumas in 1826. It is based on the analysis of total nitrogen in a sample,
just like in Kjeldahl’s method. Similarly, Dumas’ method needs a NTP-
conversion factor. The determination of this factor is explained in more
detail in Sections 13.4.3 and 13.4.4.

13.4.2.1 Procedure
1. Dry the samples completely before analysis, to guarantee complete
combustion (Note 4). However, applying very high temperatures is
discouraged to prevent evaporation of ammonium or nitrous gas.
Usually, lyophilization is used, and if this is not possible, low-tem-
perature drying (60°C–80°C) is to be allowed.
2. Make a calibration curve with the stock chemical containing nitro-
gen from 1 to 20 mg and should cover the detection range.
3. Weigh the samples in aluminum or tin cups folded shut to prevent
sample loss or adsorption of water from the air. For optimal accuracy,
Chapter thirteen: Quantification of proteins in seaweeds 219

weigh the dried samples in an amount so that the expected nitrogen

content falls in the same detection range as the calibration curve.
4. Add a negative or positive control every 20 samples to guarantee
data quality. This is done with a chemical containing a known
amount of nitrogen (like the calibration chemical) and one without
any nitrogen.
5. Individually, add the samples to the combustion oven. The samples
are burnt at 900°C in the presence of oxygen to achieve total com-
bustion, after which the detector reports an increase in conductivity
over time.
6. Quantify the conductivity peak surface, and calculate the amount of
nitrogen with the calibration curve.
7. Convert total nitrogen to protein by using a conversion factor, as
explained in Sections 13.4.3 and 13.4.4.

13.4.3 Amino acid determination

This method describes the determination of proteinogenic AAs by acid
hydrolysis and automated precolumn derivatization (Meussen et al. 2014).
Free AAs can be determined without the performance of acid hydrolysis.
The AA composition will be determined by UPLC; after that, the protein-
conversion factor can be calculated by using the NTP-conversion factor,
which is further explained in Section 13.4.4.

13.4.3.1 Preparation of reagents

1. FMOC reagents: Place 5 mg FMOC in a 2 ml vial.
2. Add 2 mL acetonitrile.
3. OPA reagents: Place 40 mg OPA in a 10 mL vial and add 2.0 mL of
buffer A, 8.0 mL methanol, and 50 µl ethanethiol (Note 5).
4. Buffer A: Place 1.29 g boric acid and 1.49 g potassium chloride into
50 mL MilliQ water, adjust pH to 10.5 with sodium hydroxide (50%).
5. 5 mL HCl/phenol reagents (1%).
6. Injection diluent: Place 48.5  mL of eluent A and 1.5  mL phosphoric
acid (85%) into a 50 mL flask.

13.4.3.2 Preparation of eluents

1. Eluent A consists of 10  mM disodium phosphate, 10  mM sodium
tetraborate, and 2 mM sodium azide, pH 7.8.
2. Eluent B consists of Methanol–Acetonitrile–MilliQ water (20:60:20).

13.4.3.3 Preparation of standards

1. Standard 4A (additional AAs): In a 50 mL flask, weigh in the additional
AAs not included in AAS18. Ensure that the concentration is 2.5 mM
for each AA.
220 Protocols for Macroalgae Research

2. AA all stock: Mix 300 µl of standard AAS18, 300 µl of standard 4A,

and 900 µl MilliQ water in an Eppendorf safe-lock tube. Final con-
centration is 0.5 mM; make a dilution series from 0.5 to 0.01 mM.
3. Internal standard: Weigh 14 mg of norleucine into a 50 mL flask, and
fill it up with MilliQ water. Final concentration is 0.4 mM.

13.4.3.4 Acid hydrolysis

1. Weigh in 0.2 mg of (freeze-)dried sample in analysis vials and into
a reaction vial, add 500 µL of HCl/phenol solution into the reaction
vial (N.B.: not in the analysis vials!). Remove air by flushing with
nitrogen.
2. Place the reaction vial into the preheated oven at 110°C for 24 h (Notes
6–8).
3. After the hydrolysis, remove the reaction vials and let them cool
down to room temperature.
4. Remove any excess HCl/phenol solution under vacuum for 2 h.
5. Place the content of the analysis vial into a 50 mL tube with 1 mL
internal standard, 4 mL of methanol, and 5 mL of MilliQ water.
6. Before analysis, filter the solution over a 0.2 µm filter into an analysis
vial.
7. Dilute samples if necessary, the concentration of each AA must be
between 0.01 and 2 mM, and the total AA amount may not exceed
10 mM.

13.4.3.5 Analysis
1. Set the column temperature at 50°C.
2. UV_1 set at wavelength 338 nm.
3. UV_2 set at wavelength 263 nm.
4. Flow gradient (Table 13.2).

13.4.4 Nitrogen-to-protein-conversion factor determination

13.4.4.1 Procedure
1. The NTP-conversion factor is the ratio of proteinogenic protein mea-
sured by the total nitrogen content.
2. To obtain the total proteinogenic protein content, this is measured
by quantifying and summing up the AAs obtained by the AA deter-
mination (see Section 13.4.3) of your sample.
3. Often cysteine and tryptophan are excluded, and the remaining 18
AAs are used (Angell et al. 2016).
4. The amount of protein is expressed as % (w/w) dry matter content.
5. Total nitrogen content can be measured by Kjeldahl (Section 13.4.1)
or Dumas method (Section 13.4.2). Here, the amount of total nitrogen
Chapter thirteen: Quantification of proteins in seaweeds 221

Table 13.2 Flow gradient

Time (min) Flow (mL min−1) Eluent A (%) Eluent B (%)
0.00 0.40 80.00 20.00
6.98 0.40 36.00 64.00
10.00 0.40 23.40 76.60
10.20 0.40 0.00 100.00
12.49 0.40 0.00 100.00
12.72 0.40 97.70 2.30
15.00 End – –

is expressed as % (w/w) dry matter. The NTP conversion factor is

calculated by equation A.

% (w/w) total protein

Nitrogen-to-protein conversion factor =
% (w/w) total nitrogen (A)

6. If the NTP conversion factor is known (Note 9), then you can calcu-
late the amount of proteinogenic protein in your sample by multi-
plying the nitrogen content of your sample (obtained by Kjeldahl or
Dumas) with the NTP conversion factor.

13.4.5 Lowry method: Soluble protein determination

The method was first published in 1951 by the American biochemist
Oliver  H. Lowry. It is a standard method mainly used to determine
the amount of soluble proteins. Due to its reliability, Lowry method is
considered as the most cited method of all time.

13.4.5.1 Preparation of the standard solution

1. While preparing the calibration curve, dissolve the BSA well in
glassware. As dissolving needs some time, only shake gently after-
ward. Stirring will result in foaming.
2. Prepare 10 samples with a concentration range from 0 to 1500 µg mL –1
by using MilliQ water as the diluent.

13.4.5.2 Preparation of Folin–Ciocalteau reagent

1. Prepare 1 N Folin–Ciocalteau by diluting the reagent (2 N) 1:1 with
MilliQ water.
2. Use the prepared Folin–Ciocalteau on the same day, because it is
unstable on time.
222 Protocols for Macroalgae Research

13.4.5.3 Test tube protocol

1. Pipette 0.2 mL of each standard previously prepared.
2. Wait exactly 15 s for each sample, and then add 1 mL modified Lowry
reagent to each test tube (Note 10).
3. Vortex for 5 s, then cover all tubes and incubate for 10 min (Notes 11
and 12).
4. Exactly after 10 min incubation (for each sample) add 100 µL of the
prepared (1 N) Folin–Ciocalteau reagent (Notes 13 and 14).
5. Set the spectrophotometer at 750 nm.
6. Zero the spectrophotometer with the blank sample that contains
only MilliQ water (0 µg mL−1 (Protein)).
7. Plot the calibration curve for each concentration prepared and try to
get R2 = 0.99.
8. Use the calibration curve to determine the protein concentration of
the unknown samples.

13.4.6 Bradford method: Soluble protein assay

The Bradford method was first developed by the American scientist,
Marion Mckinley Bradford. It is a fast and sensitive method to determine
the level of soluble proteins. When the Bradford reagent (Coomassie
Brilliant Blue G-250) binds to the protein, the color changes from red to
purple, and the absorption maximum changes from 495 to 595 nm. The
increase in absorption at 595 nm is monitored (Bradford 1976).

13.4.6.1 Procedure
1. Pipette 30 µL sample or standard into a 1 mL plastic cuvette (Note 15).
2. Add 1.0 mL Bradford reagents and mix well (Note 16).
3. Measure the absorbance at 595 nm.
4. Plot the calibration curve (at least five different BSA concentrations
in duplicate) to determine the protein concentration of the unknown
samples (Note 17).

13.5 Notes
Note 1: To keep the measurement within the appropriate range, there
must be between 10 and 100 mg seaweed protein in the sample.
Note 2: It is possible to use liquid samples in this method. Therefore,
the digestion part of the protocol has to be changed by following the
next three steps:
a. Incubate the sample for 1 h at 180°C.
b. Then incubate the same sample for 1 h at 280°C.
c. Finally, incubate the same sample for 50 min at 420°C.
Chapter thirteen: Quantification of proteins in seaweeds 223

Note 3: Another alternative is that the liquid sample can be put in the
tube and dried at 105°C overnight. Afterward, it can be treated as a
solid sample.
Note 4: For seaweeds, inhomogeneity can be an issue, which could
partially be solved by (freeze-) drying a larger batch of material and
grinding the dried material.
Note 5: Make sure to add ethanethiol inside the fume hood.
Note 6: Not all the AAs present in the seaweed will survive the hydro-
lysis process.
Note 7: Asparagine is converted into aspartic acid and glutamine into
glutamic acid.
Note 8: Tryptophan is completely destroyed, and it is impossible to
accurately determine cysteine concentrations in acid hydrolyzed
samples.
Note 9: Be aware that the NTP conversion factor for Kjeldahl and Dumas
slightly differ as both have another principle to determine the total
nitrogen content.
Note 10: Use a new pipette for each reagent and sample, do not use the
same pipette for all the samples and reagents.
Note 11: While adding the reagents, it is essential to respect the waiting
time between each sample.
Note 12: Respecting the incubation time is important.
Note 13: If the solution is not turning blue, it means that there is
interference from undesired components in the sample such as che-
lating agents.
Note 14: If precipitate forms while adding the reagents, this implies that
the samples contain a surfactant or potassium ions.
Note 15: Dissolve the BSA well in glassware. Dissolving needs some
time, so only shake gently afterward. Stirring will result in foaming.
Note 16: Coomassie Brilliant Blue G-250 stains glass or quartz cuvettes;
the use of disposable polystyrene cuvettes is therefore recommended.
Note 17: Basic conditions and detergents influence the outcome negatively.

Acknowledgment
The authors would acknowledge MacroFuels project. This project has
received funding from the European Union’s Horizon 2020 research and
innovation program under grant agreement No 654010.

References
Akgul, R., Kizilkaya, B., Akgul, F. et al. 2015. Crude protein values and amino acid
profiles of some red algae collected from Canakkale. Indian J. Geo. Mar. Sci.
44: 527–530.
224 Protocols for Macroalgae Research

Angell, A.R., Mata, L., de Nys, R. et al. 2016. The protein content of seaweeds:
A universal nitrogen-to-protein conversion factor of five. J. Appl. Phycol. 28:
511–524.
Angell, A.R., Paul, N.A., and de Nys, R. 2017. A comparison of protocols for isolat-
ing and concentrating protein from the green seaweed Ulva ohnoi. J. Appl.
Phycol. 29: 1011–1026.
Barbarino, E. and Lourenco, S.O. 2005. An evaluation of methods for extraction
and quantification of protein from marine macro- and microalgae. J. Appl.
Phycol. 17: 447–460.
Biancarosa, I., Espe, M., Bruckner, C.G. et al. 2017. Amino acid composition, pro-
tein content, and nitrogen-to-protein conversion factors of 21 seaweed spe-
cies from Norwegian waters. J. Appl. Phycol. 29: 1001–1009.
Black, W.A.P. 1950. The seasonal variation in weight and chemical composition of
the common British Laminariaceae. J. Mar. Biol. Assoc. UK 29: 45–72.
Bradford, M.M. 1976. Rapid and sensitive method for quantitation of microgram
quantities of utilizing principle of protein-dye binding. Anal. Biochem. 72:
248–254.
Fleurence, J. 1999. Seaweed proteins: Biochemical, nutritional aspects and
potential uses. Trends. Food. Sci. Tech. 10: 25–28.
Fujiwara-Arasaki, T., Mino, N., and Kuroda, M. 1984. The protein value in human
nutrition of edible marine algae in Japan. Hydrobiologia 116: 513–516.
Gerber, P.J., Steinfeld, H., Henderson, B. et al. 2013. Tackling Climate Change Through
Livestock: A global Assessment of Emissions and Mitigation Opportunities. Food
and Agriculture Organization of the United Nations (FAO), Rome, Italy.
Jung, K.A., Lim, S.R., Kim, Y. et al. 2013. Potentials of macroalgae as feedstocks for
biorefinery. Bioresour. Technol. 135: 182–190.
Meussen, B.J., Zeeland, A.N.T., Bruins, M.E. et al. 2014. A fast and accurate UPLC
method for analysis of proteinogenic amino acids. Food Anal. Method 7:
1047–1055.
Patarra, R., Paiva, L., Net, A.I. et al. 2011. Nutritional value of selected macroalgae.
J. Appl. Phycol. 23: 205–208.
Shuuluka, D., Bolton, J.J., and Anderson, R.J. 2013. Protein content, amino acid
composition and nitrogen-to-protein conversion factors of Ulva rigida and
Ulva capensis from natural populations and Ulva lactuca from an aquaculture
system, in South Africa. J. Appl. Phycol. 25: 677–685.
Steinfeld, H., Gerber, P., Wassenaar, T. et al. 2006. Livestock’s long shadow:
Environmental issues and options. Food and Agriculture Organization of the
United Nations (FAO), Roman, Italy.
Vilg, J.V. and Undeland, I. 2017. pH-driven solubilization and isoelectric precipi-
tation of proteins from the brown seaweed Saccharina latissima-effects of
osmotic shock, water volume and temperature. J. Appl. Phycol. 29: 585–593.
chapter fourteen

Comprehensive phytohormone
quantification in the red
alga Pyropia yezoensis by
liquid chromatography–mass
spectrometry
Takakazu Matsuura, Izumi C. Mori, Yoko Ikeda,
Takashi Hirayama, and Koji Mikami

Contents
14.1 Introduction ......................................................................................... 226
14.2 State of the art ...................................................................................... 226
14.3 Materials ............................................................................................... 227
14.3.1 Extraction and purification of phytohormones ................ 227
14.3.2 Liquid chromatography–mass spectrometry ................... 228
14.4 Experimental procedures................................................................... 228
14.4.1 Extraction ............................................................................... 229
14.4.2 Partial purification of phytohormones with
solid- phase extraction .......................................................... 229
14.4.3 Liquid chromatography–mass spectrometry analysis .... 231
14.4.4 Data analysis .......................................................................... 234
14.5 Notes ..................................................................................................... 234
References........................................................................................................ 236

225
226 Protocols for Macroalgae Research

14.1 Introduction
Phytohormones are structurally unrelated compounds, including auxin,
abscisic acid (ABA), gibberellins, cytokinins, ethylene, jasmonates, sali-
cylic acid (SA), brassinosteroids, and strigolactones (Kende and Zeevaart
1997; Kamiya 2010). Emerging studies suggest the critical involvement
of these phytohormones in the regulation of growth, development, and
environmental stress response in plants (Weyers and Paterson 2001;
Vanstraelen and Benková 2012). To date, phytohormones are known to
exist in seaweeds as in terrestrial plants (Basu et al. 2002; Le Bail et al.
2010; Wang et al. 2014; Mikami et al. 2016), although functions of phyto-
hormones are not entirely understood.
Analysis of phytohormones in algae has a long history, and small
molecules identical to phytohormones of terrestrial plants have been
detected in a variety of algae (reviewed in Bradley 1991; Evans and
Trewavas 1991; Tarakhovskaya et al. 2007; Lu and Xu 2015). As the pre-
vious analyses generally focused on individual phytohormones, the
overall composition of phytohormones within a given algal species
has not been elucidated well. However, efforts have made to develop
methods employing gas chromatography–tandem mass spectrogram
and liquid chromatography–tandem mass spectrometry (LC–MS/MS)
for comprehensive phytohormone analysis in algae, and phytohor-
mone compositions have been characterized in a few algae (Yokoya
et al. 2010; Gupta et al. 2011; Wang et al. 2014). In addition, we recently
improved comprehensive analysis methods for phytohormones by liquid
chromatography– electrospray ionization–tandem mass spectroscopy
(LC–ESI–MS/MS) using the red seaweeds Pyropia yezoensis and Bangia
fuscopurpurea (Mikami et al. 2016; Mori et al. 2017). On the basis of our
current findings, we describe an updated procedure for comprehensive
analysis of phytohormones in P. yezoenssis as a model.

14.2 State of the art

For red seaweed samples, we have found that special attention must
be paid to two aspects of the experimental procedures. The first is the
extraction of phytohormones as the physical characteristics of red alga
tissue extracts are peculiar. The second is the choice of deuterium-labeled
internal standard for indole-3-acetic acid (IAA), because of contamination
of the red algal extracts with an unknown factor possessing a mass-to-
charge ratio and retention time in octadecyl silica columns that interferes
with the detection of stable isotope-labeled IAAs such as D2-IAA and
D5-IAA. We have already found that D7-IAA is compatible for use with
Chapter fourteen: Comprehensive phytohormone quantification 227

crude phytohormone extracts, and thus our latest method utilizes it as

the preferred internal standard to quantify IAA in red seaweeds (Mikami
et  al. 2016). Our findings point to a need for reexamination of compre-
hensive phytohormone analysis using D7-IAA in other algae, for which
D2-IAA and D5-IAA were sometimes employed for IAA quantification
(see Mikami et al. 2016).

14.3 Materials
14.3.1 Extraction and purification of phytohormones
• Extraction solvent: Mixture of acetonitrile (MeCN)/water (80:20) con-
taining 1% (v/v) acetic acid (AcOH). Prepare daily.
• Internal standard stock solution: Prepare a stock solution of the extrac-
tion solvent containing all four internal standards in amounts
shown in Table 14.1. The sources of the internal standards are shown
in Table 14.1. Store the internal standard stock solution in a light-
proof bottle and replace after approximately six months.
• Solid-phase extraction cartridges:
• Oasis® HLB solid-phase extraction cartridge (1  cm3, Waters,
Milford, MA, USA)
• Oasis® MCX solid-phase extraction cartridge (1  cm3, Waters,
Milford, MA, USA)
• Oasis® WAX solid-phase extraction cartridge (1  cm3, Waters,
Milford, MA, USA).
• Solvents for solid-phase extraction:
• MeCN (HPLC grade or higher)
• Methanol (HPLC grade or higher, MeOH)
• 0.1 N HCl
• 0.1 N KOH

Table 14.1 Concentrations of stable isotope-labeled phytohormones in the

internal standard stock solution
Compound Concentration Source company, Country
D7-indoleacetic acida 20 ng mL−1 CDN Isotopes, Canada
D6-isopentenyladenine 1 ng mL−1 OlChemim, Czech Republic
D4-salicylic acid 200 ng mL−1 OlChemim, Czech Republic
D6-abscisic acid 20 ng mL−1 OlChemim, Czech Republic
a Alternatively, 13C6-indoleacetic acid (Cambridge Isotope Laboratories Inc., MA, USA) can
be used. D indicates replacement of hydrogen by deuterium.
228 Protocols for Macroalgae Research

• Aqueous solution containing 1% (v/v) AcOH

• MeCN/water (80:20) containing 1% (v/v) AcOH (extraction
solvent)
• MeCN/water (50:50) containing 5% ammonia
• MeCN/water (80:20).
• Reconstitution solution: aqueous solution containing 0.01% (v/v) AcOH
(alternatively, 1% AcOH can be used).
• Liquid nitrogen.
• Pasteur pipettes (146 mm and 229 mm).
• Glass test tubes (13 × 100 mm and 12 × 75 mm).
• Mortars and pestles.
• Disposable round-bottom polypropylene test tubes (14  mL, e.g.,
Greiner Z617954). Note: must not be made of polystyrene.
• Microcentrifuge tubes (1.5 mL).
• Micropipettes.
• Chemical hood.
• Refrigerated centrifuges to spin 1.5  mL microcentrifuge tubes
(e.g., Eppendorf 5418R) and 14  mL polypropylene test tubes (e.g.,
Eppendorf 5702R).
• Vacuum concentrator (e.g., Mivac quattro concentrator, Genevac).
• Vortex mixer.

14.3.2 Liquid chromatography–mass spectrometry

• Water containing 0.01% (v/v) AcOH.
• MeCN (HPLC grade or higher) containing 0.05% (v/v) AcOH.
• MeOH (HPLC grade or higher) containing 0.2% (v/v) AcOH.
• Aqueous solution containing 0.1% (v/v) formic acid (FA).
• MeCN (HPLC grade or higher) containing 0.1% (v/v) FA.
• Triple quadrupole LC–MS system (Agilent 6410 or equivalent) and
associated software (e.g., MassHunter, Agilent).
• A volume of 0.5 mL vials with 250 µL glass inserts (or 96-well poly-
propylene plates [0.5 mL] with compatible cover caps).

14.4 Experimental procedures

Phytohormones are extracted from fronds into an acidified polar solvent,
purified to eliminate interferents by solid-phase extraction, and quantified
by LC–MS. The concentration of analytes (endogenous phytohormones) is
determined by the internal standard method.
Chapter fourteen: Comprehensive phytohormone quantification 229

14.4.1 Extraction
All procedures should be carried out in a chemical hood:

1. Dilute internal standard stock solution 20 times with the extraction

solvent (Note 1).
2. Grind lyophilized algal samples (approximately 0.1  g of thalli or
protonemata) in liquid nitrogen with mortar and pestle into a fine
powder (Note 2).
3. Add 4 mL of the extraction solvent containing internal standards to
the mortar and incubate at 4°C for 60 min. Briefly, stir the ground
tissue in the solvent every 20 min to disperse any aggregates (Note 3).
4. Transfer the extract to a polypropylene test tube and centrifuge at
3000 g for 10 min at 4°C.
5. Transfer the supernatant to glass test tube (13  ×  100  mm) with a
Pasteur pipette (229 mm).
6. Add 4 mL extraction solvent (without the internal standard) to the
tube containing the pellet, mix with a vortex mixer, and centrifuge
at 3000 g for 10 min at 4°C.
7. Collect the supernatant with a Pasteur pipette (229 mm) and add to
the previous one in the same glass test tube (Note 4).

14.4.2 Partial purification of phytohormones with

solid-phase extraction
All procedures should be carried out in a chemical hood. Phytohormones
are fractionated into three parts: (1) IAA/ABA, (2) iP, and (3) SA by the fol-
lowing solid-phase extraction steps:

1. Evaporate MeCN in the supernatant with a vacuum concentrator

until only the acidic aqueous solution remains.
2. Transfer the acidic aqueous solution to a microcentrifuge tube and
centrifuge at 16,000 g for 10 min at 4°C to remove any precipitate that
appeared after concentration.
3. Condition Oasis® HLB cartridge with 1 mL of MeCN, 1 mL of MeOH,
and 1 mL of 1% AcOH, successively.
4. Load the clear supernatant of the acidic aqueous solution contain-
ing extracted phytohormones onto the HLB cartridge with a Pasteur
pipette (146 mm, Note 5).
5. Wash the cartridge with 1 mL of 1% AcOH aqueous solution.
230 Protocols for Macroalgae Research

6. Elute crude phytohormone fraction with 2  mL of MeCN/water

(80:20) containing 1% %(v/v) AcOH and collect it in a glass test tube
(12 × 75 mm).
7. Add 0.6 mL of 1% AcOH to the eluate and evaporate the MeCN off
the eluate with a vacuum concentrator to yield approximately 1 mL
of acidic aqueous solution (Note 6).
8. Condition Oasis® MCX cartridge with 1 mL of MeCN and 1 mL of
MeOH, successively.
9. Activate Oasis® MCX cartridge with 1 mL of 0.1 N HCl and equili-
brate with >1 mL of 1% AcOH aqueous solution (Note 7).
10. Load the acidic aqueous solution onto the Oasis® MCX cartridge
using a 146 mm Pasteur pipette and wash with 1 mL of 1% AcOH
aqueous solution.
11. Elute acidic and neutral compounds with 2 mL of MeCN/water (80:20)
containing 1% (v/v) AcOH and collect in a glass test tube (12 × 75 mm).
12. After vortex mixing, evaporate a 0.2  mL aliquot to dryness with a
vacuum concentrator and prepare for SA quantification by reconsti-
tution in 50 µL of reconstitution solution (Figure 14.1) (Note 8). Retain
the remaining 1.8 mL of this acidic/neutral eluate for further purifi-
cation by Oasis® WAX cartridge (as described starting in Step 15).
13. Wash the Oasis® MCX cartridge further with 2 mL of aqueous solu-
tion containing 5% ammonia.
14. Elute alkaline compounds from Oasis® MCX cartridge with 2 mL of
MeCN/water (50:50) containing 5% ammonia and collect in a glass
test tube (12 × 75 mm). Evaporate this alkaline fraction containing iP
to dryness with a vacuum concentrator followed by reconstitution in
50 µL of reconstitution solution (Figure 14.1).
15. Add 0.6  mL of 1% AcOH to the acidic/neutral eluate fraction
(see  Step 12) and evaporate MeCN with a vacuum concentrator to
yield approximately 1 mL of aqueous solution.
16. Wet Oasis® WAX cartridge with 1 mL of MeCN and 1 mL of MeOH,
successively.
17. Activate Oasis® WAX cartridge with 0.3 mL of 0.1 N KOH and equil-
ibrate with >1 mL of 1% AcOH aqueous solution (Note 7).
18. Load the acidic/neutral eluate onto the Oasis® WAX cartridge using
a 146 mm Pasteur pipette and wash with 1 mL of 1% AcOH aqueous
solution and 2 mL of MeCN/water (80:20), successively.
19. Elute acidic compound fraction containing IAA and ABA with 2 mL
of MeCN/water (80:20) containing 1% (v/v) AcOH and collect in a
glass test tube (12 × 75 mm).
20. Evaporate the fraction containing IAA and ABA to dryness with a
vacuum concentrator followed by reconstitution in 50 µL of reconsti-
tution solution (Figure 14.1).
Chapter fourteen: Comprehensive phytohormone quantification 231

Acidic extract

Oasis® WAX
Oasis® MCX
Oasis® HLB

Discard Collect Collect Collect Collect

hydrophilic crude alkaline acidic/neutral acidic
compounds phytohormones compounds compounds compounds

Isopentenyladenine Indoleacetic acid

(trans-Zeatin) Abscisic acid
Salicylic acid (Jasmonic acid)
(12-oxo-Phyrodienoic acid)
(Gibberellin A1)
(Gibberellin A4)

Figure 14.1   Solid-phase extraction procedure. Phytohormones extracted in

acidified polar solvent are sequentially processed by Oasis ® HLB, Oasis® MCX,
and Oasis® WAX cartridges yielding three fractions—alkaline compound
fraction, including cytokinins; acidic/neutral compound fraction, including
highly acidic salicylic acid; and acidic compound fraction, including indole-
acetic acid, abscisic acid, jasmonic acid, 12-oxo-phtodienoic acid, gibberellin A1,
and gibberellin A4.

14.4.3 Liquid chromatography–mass spectrometry analysis

Phytohormone analysis is conducted on an Agilent 1260–6410 Triple quad-
rupole LC–MS, using a Zorbax Eclipse XDB-C18 column and an XDB-C8
guard column.

1. Set the running parameters. Parameters for LC are shown in

Figure 14.2. Parameters for MS are listed in Table 14.2 (Note 9).
2. Transfer the reconstituted sample to a vial with 250 µL glass insert
or a 96-well plate.
3. Set the vial in the autosampler and run the program.
232 Protocols for Macroalgae Research

LC method 1
100

Solvent A: Water containing 0.01% (v/v) AcOH

Solvent B: MeCN containing 0.05% (v/v) AcOH
% of solvent B
0.4 ml min−1
50

0
0 10 20 30

LC method 2
100

Solvent A: Water containing 0.01% (v/v) AcOH

Solvent B: MeOH containing 0.2% (v/v) AcOH
% of solvent B

0.25 ml min−1
50

0
0 10 20 30

LC method 3
100

Solvent A: Water containing 0.1% (v/v) FA

% of solvent B

Solvent B: MeCN containing 0.1% (v/v) FA

0.4 ml min−1
50

0
0 10 20
Time (min)

Figure 14.2  Parameters for liquid chromatography. LC method 1 is used for the
analysis of indoleacetic acid and abscisic acid. LC methods 2 and 3 are used for
analyses of isopentenyladenine and salicylic acid, respectively. The proportion of
solvent B increases from 3% to 55% in 22 min in LC method 1. It increases from
3% to 97% in 16 min in LC method 2, and from 3% to 98% in 10 min in LC method
3. After a wash of the column with a high concentration of solvent B for approxi-
mately 5 min, the column is washed with 3% solvent B to condition the column.
LC, liquid chromatography. AcOH, acetic acid. MeCN, acetonitrile. MeOH, meth-
anol. FA, formic acid. The flow rate of LC methods 1 and 3 is 0.4 mL min−1, and that
of LC method 2 is 0.25 mL min−1.
 Table 14.2 Parameters for mass spectrometry for quantification of IAA, ABA, iP, and SA
Retention time Time segment Multiple reaction Fragmentor Collision
Compound LC method (min) (min) ESI mode monitoring transition (m/z) voltage (V) energy (V)
IAA 1 9.7 9.3–11.8 Positive 176/130 90 15
D7-IAA 183/135, 136, 137
ABA 1 12.6 11.8–13.5 Negative 263/153 130 4
D6-ABA 269/159
iP 2 12.5 11–16 Positive 204/136 110 11
D6-iP 210/137
SA 3 5.6 2–10 Negative 137/93 90 12
D4-SA 141/97
See Figure 14.2 for LC methods.
Chapter fourteen: Comprehensive phytohormone quantification
233
234 Protocols for Macroalgae Research

14.4.4 Data analysis

1. Measure the areas of the peaks in the corresponding multiple
reaction monitoring for endogenous plant hormones and internal
standards.
2. Calculate the amount of plant hormone in the sample and normalize
it to the weight of the algal sample.

14.5 Notes
Note 1: The dilution factor can be modified according to the actual con-
centrations of plant hormones detected in the algal sample.
Note 2: Grinding the tissue with stainless steel beads or tungsten beads
can reduce or abolish the detection of some hormones. This may be
because of tight binding of hormones to the beads and/or scraping
the plastic tube, which increases the surface area of plastic.
Note 3: The extracts may become very viscous and aggregate during the
suspension of powdered tissue in the extraction solvent. The extracts
will become more fluid as incubation progresses. Stir the extracts in
the mortar intermittently to disperse the aggregates.
Note 4: Samples can be stored at −20°C for a week or 4°C for overnight
at this step.
Note 5: The volume of the aqueous solution should be adjusted to
1 mL with 1% AcOH, if the volume of the solution is less than that.
Hormones may be lost during loading.
Note 6: The addition of 0.6 mL of 1% AcOH aqueous solution prevents
the sample from overdrying.
Note 7: Fill the cartridge up to the mouth with 1% AcOH aqueous solu-
tion to remove any remaining drops of HCl or KOH on the wall of
the cartridge that could affect binding of chemicals to the cartridge.
Note 8: As SA binds to Oasis® WAX cartridge very strongly, the recov-
ery rate is very low. Therefore, it is analyzed by using the eluate from
Oasis® MCX cartridge by LC–MS. SA can be eluted by 2% FA/98%
MeCN.
Note 9: Parameters for phytohormones that are not detected in P. yezoen-
sis but were examined in a previous paper (Mikami et al. 2016) are
listed in Table 14.3.
 Table 14.3 Parameters for mass spectrometer for quantification of phytohormones measured in Mikami et al. (2016) and
12-oxo-phytodienoic acid (OPDA), which were not detected in gametophytes and sporophytes of Pyropia yezoensis
Retention Time segment Multiple reaction Fragmentor Collision
Compound LC method time (min) (min) ESI mode monitoring transition (m/z) voltage (V) energy (V)
GA1 1 8.9 8–9.3 Negative 347/273 160 18
D2-GA1 349/275
JA 1 14.4 13.5–15.7 Negative 209/59 135 11
D2-JA 211/59
GA4 1 17 16–17.3 Negative 331/257 160 20
D2-GA4 333/259
JA-Ile 1 16.2 17.5–20 Negative 322/130 140 14
13C -JA-Ile 328/136
6
OPDA 1 22.4 20–25 Negative 291/165 150 11
D5-OPDA 296/170
tZ 2 8.3 5–11 Positive 220/136 100 12
D5-tZ 225/136, 137
Chapter fourteen: Comprehensive phytohormone quantification

See Figure 14.2 for LC methods.

235
236 Protocols for Macroalgae Research

References
Basu, S., Sun, H., Brian, L., Quatrano, R.L. and Muday, G.K. 2002. Early embryo
development in Fucus distichus is auxin sensitive. Plant Physiol. 130:292–302.
Bradley, P.M. 1991. Plant hormones do have a role in controlling growth and devel-
opment of algae. J. Phycol. 27:317–321.
Evans, L.V. and Trewavas, A.J. 1991. Is algal development controlled by plant
growth substances? J. Phycol. 27:322–326.
Gupta, V., Kumar, M., Brahmbhatt, H., Reddy, C.R., Seth, A. and Jha, B. 2011.
Simultaneous determination of different endogenetic plant growth regula-
tors in common green seaweeds using dispersive liquid–liquid microextrac-
tion method. Plant Physiol. Biochem. 49:1259–1263.
Kamiya, Y. 2010. Plant hormones: Versatile regulators of plant growth and devel-
opment. Annu. Rev. Plant Biol. 61:Special Online Compilation.
Kende, H. and J.A.D. Zeevaart. 1997. The five “classical” plant hormones. Plant Cell
9:1197–1210.
Le Bail, A., Billoud, B., Kowalczyk, N., Kowalczyk, M., Gicquel, M., Le Panse, S.,
Stewart, S. et al. 2010. Auxin metabolism and function in the multicellular
brown alga Ectocarpus siliculosus. Plant Physiol. 153:128–144.
Lu, T. and Xu, J. 2015. Phytohormones in microalgae: A new opportunity for
microalgal biotechnology? Trends Plant Sci. 20:275–282.
Mikami, K., Mori, I.C., Matsuura, T., Ikeda, Y., Kojima, M., Sakakibara, H. and
Hirayama, T. 2016. Comprehensive quantification and genome survey reveal
the presence of novel phytohormone action modes in red seaweeds. J. Appl.
Phycol. 28:2539–2548.
Mori, I.C., Ikeda, Y., Matsuura, T., Hirayama, T. and Mikami, K. 2017. Phytohormones
in red seaweeds: A technical review of methods for analysis and a consider-
ation of genomic data. Bot. Mar. 60:153–170.
Tarakhovskaya, E.R., Maslov, Y.I. and Shishova, M.F. 2007. Phytohormones in
algae. Russ. J. Plant Physiol. 54:163–170.
Vanstraelen, M. and Benková, E. 2012. Hormonal interactions in the regulation of
plant development. Annu. Rev. Cell Dev. Biol. 28:463–487.
Wang, X., Zhao, P., Liu, X., Chen, J., Xu, J., Chen, H. and Yan, X. 2014. Quantitative
profiling method for phytohormones and betaines in algae by liquid chro-
matography electrospray ionization tandem mass spectrometry. Biomed.
Chromatogr. 28:275–280.
Weyers, J.D.B. and Paterson, N.W. 2001. Plant hormones and the control of physi-
ological processes. New Phytol. 152:375–407.
Yokoya, N.S., Stirk, W.A., van Staden, J., Novák, O., Turečková, V., Pěnčík, A. and
Strnad, M. 2010. Endogenous cytokinins, auxins, and abscisic acid in red
algae from Brazil. J. Phycol. 46:1198–1205.
chapter fifteen

Total phenolic content and

antioxidant capacity analysis
of seaweed biomass
Xiaoru Hou, Randi Neerup, and Anne-Belinda Bjerre

Contents
15.1 Introduction ......................................................................................... 237
15.2 State of the art ...................................................................................... 238
15.3 Materials ............................................................................................... 239
15.3.1 Seaweed biomass .................................................................. 239
15.3.2 Equipment .............................................................................. 240
15.3.3 Chemicals ............................................................................... 240
15.3.3.1 Total phenolic content analysis of seaweed
biomass .................................................................. 240
15.3.3.2 Antioxidant capacity analysis of seaweed
biomass: 2,2-Diphenyl-1-picrylhydrazyl
assay ....................................................................... 241
15.4 Experimental procedures................................................................... 241
15.4.1 Total phenolic content analysis of seaweed biomass ....... 241
15.4.1.1 Folin–Ciocalteu assay .......................................... 241
15.4.1.2 Prussian blue assay .............................................. 243
15.4.2 Antioxidant capacity analysis of seaweed biomass:
2,2-Diphenyl-1-picrylhydrazyl assay .................................. 245
15.5 Tips and tricks ..................................................................................... 247
Acknowledgment ........................................................................................... 247
References........................................................................................................ 247

15.1 Introduction
Seaweed is a known source of value-added components such as dietary
fibers, proteins, minerals, vitamins, and phenolic compounds. These phe-
nolic compounds are considered as one of the most important classes
of natural antioxidants (Machu et al. 2015). A worldwide trend to apply

237
238 Protocols for Macroalgae Research

natural antioxidants, instead of synthetic compounds, has gained increas-

ing interest. Main reasons are the possible cause of neurotoxicity, gastri-
tis, and cancer stemming from the degradation of synthetic antioxidants
(Nieva-Echevarría et al. 2015). As a result, phenolic compounds extracted
from, for example, seaweed are more and more applied to date in, for
instance, cosmetics, pharmaceutics, and food/feed ingredients, primarily
for their radical scavenging potential and antiaging properties (Zern et al.
2005; Tomas and Kim 2013).
Phenolic compounds are chemical compounds that contain a hydroxyl
group (–OH) attached to an aromatic hydrocarbon group (ring of carbons).
They are found as simple phenols and polyphenols that contain multiple
phenol structural units. Polyphenols are secondary metabolites present in
various organisms, including seaweed and higher plants (La Barre et al.
2010). Polyphenols, in general, include phenolic acids, flavonoids, stilbenes,
lignans, pigments, and phlorotannins (Chater et al. 2015). Phlorotannins
are a major group of phenolic compounds found in brown seaweed and in
few species of red seaweed. Phlorotannins are oligo- or polymers of phlo-
roglucinols (PGs) (1,3,5-trihydroxy benzene). More than 150 structures of
phlorotannins have been isolated and characterized (Spurr 2014), and the
molecular weight varies between 126 and 650 kDa (Koivikko 2008). These
compounds can represent up to 20% (Amsler and Fairhead 2006; Koivikko
2008) of the dry weight of brown seaweed.

15.2 State of the art

The content of phenolic compounds in seaweed depends on many factors,
for example, seaweed species, plant age, position in the plant body, and
growing locations and seasons (Marinho-Soriano et al. 2006). The qual-
ity and intensity of light, salinity, and nutrient concentration also play an
important role for phenolic content in seaweed (Connan et al. 2006). To
monitor and optimize the process/strategy of cultivation and harvesting
of suitable seaweed feedstocks for extracting phenolic compounds, a quick
determination of the phenolic content and the bioactivities (e.g., antioxidant
capacity) is of practical importance. Therefore, the current chapter describes
suitable methods, which have been modified and adapted specifically to
seaweed, for quick determination of the total phenolic content (TPC) (by the
Folin–Ciocalteu [FC] assay and Prussian blue [PB] assay) and of the antioxi-
dant capacity (by the DPPH (2,2-diphenyl-1-picrylhydrazyl) assay).
FC assay is the most widely used assay to estimate the TPC in plant
extracts. It is a colorimetric method based on electron transfer in an
alkaline medium from the phenolic compounds to phosphomolybdic/
phosphotungstic acid complexes, resulting in a blue solution, which is
then determined spectroscopically at 700–765  nm (Singleton and Rossi
1965). However, the disadvantage is that FC reagent not only reacts with
Chapter fifteen: Total phenolic content and antioxidant capacity analysis 239

polyphenols but could also react with some other reducing compounds
that possibly exist in the crude extracts, and thus skew the results of TPC
determination. To increase the specificity for TPC determination, increasing
the purification of phenolic compounds extract is one of the possibilities.
Another colorimetric method commonly used for determining the TPC is
the PB assay (Price and Butler 1977). This method is based on the color-
formation reaction between the phenolic compounds and ferricyanide ion
(Fe(CN)6)3−. Phenols are oxidized, whereas Fe(CN)63− is reduced to the fer-
rocyanide ion Fe(CN)64−. Fe(CN)64− then reacts with the ferric ion (Fe3+) to
form PB metallic complex, Fe4[Fe(CN)6]3. Compared with the FC assay,
it has the advantages of lower time consumption and higher selectivity
(Margraf et al. 2015). The main drawbacks of the original PB assay (Price
and Butler 1977) are the formation of precipitates after incubation and an
increase in color intensity with time. Graham (1992) developed a stabilized
reagent in combination of phosphoric acid (or tetrasodium ethylenediami-
netetraacetate) and gum arabic: Phosphoric acid (or tetrasodium ethyl-
enediaminetetraacetate) is used for stopping the reaction by complexing
the excess of Fe3+ in the mixture, and gum arabic is used for preventing
the precipitation by impeding the coalescence of the colloidal particles.
However, running a preanalysis to ensure a proper phenolic concentration
range is recommended for preventing the potential precipitation of the PB
metallic complex, especially when the phenolic content of sample is high.
Although the selectivity of phenolic compound is higher in PB assay than
in FC assay (Margraf et al. 2015), the purity of the extract still affects the
measured result of TPC from PB assay.
The antioxidant capacity of extracted phenolic compounds from sea-
weed can be determined by, for example, DPPH assay (first developed
by Blois 1958). This assay is one of the most widely used assays and has
been modified and adapted in many different natural antioxidant stud-
ies, because of its simplicity, speed, and sensitivity (Kedare and Singh
2011). DPPH• (free radical) is a stable and commercially available organic
nitrogen radical that shows a strong absorption maximum at 517  nm
(purple). The color turns from purple to yellow followed by the formation
of DPPH by trapping hydrogen from a hydrogen donor (i.e., antioxidant).
The antioxidant effect is proportional to the disappearance of DPPH• in
test samples and can be spectrophotometrically monitored at 517 nm.

15.3 Materials
15.3.1 Seaweed biomass
Fresh or defrosted seaweed biomass is dried in a 50°C drying oven for
two nights (until the biomass dry matter content reaches ~90%) and is then
ground and passed through a Ø = 1.0 mm screen.
240 Protocols for Macroalgae Research

15.3.2 Equipment
• A UV–vis spectrophotometer with a 96-well flat-bottom microtiter
plate reader.
• Moisture content analyzer.
• Thermostatically controlled drying oven (50°C).
• Incubator/water bath.
• Benchtop centrifuge.
• Vortex mixer.
• Magnetic stirrer with temperature controller.
• Analytical balance.
• Single- and multichannel pipette and tips.
• Magnetic stirrer bars.
• Stopwatch.
• Measuring cylinders.
• Volumetric flasks.
• Filter funnels.
• 1.5 and 2 mL plastic microtubes with caps.
• 15/50 mL plastic tubes with screw caps.
• 100 mL autoclavable glass bottles with caps.
• Racks for 1.5–2 mL microtubes and 15/50 mL tubes.
• Disposable 96-well flat-bottom microplate.
• Aluminum foil.

15.3.3 Chemicals
15.3.3.1 Total phenolic content analysis of seaweed biomass
15.3.3.1.1 Folin–Ciocalteu assay
• FC reagent: 0.2 N in ultrapure water.
• Sodium bicarbonate (NaHCO3) solution: 6% w/v in ultrapure water.
• Absolute ethanol: 99% (w/w).
• PG stock solution: 2 mg mL−1 in absolute ethanol.

15.3.3.1.2 Prussian blue (PB) assay

• HCl solution: 0.1 M in ultrapure water.
• K3Fe(CN)6: 0.016 M in ultrapure water.
• FeCl3: 0.02 M in 0.1 M HCl.
• H3PO4: 6.03 M in ultrapure water.
• Gum arabic solution (1%): Dilute 1.00  g of gum arabic in a 100  mL
volumetric flask with 100 mL ultrapure water. Dissolve by heating
it at max 60°C for 30 min. Cool down the solution and adjust with
ultrapure water to the 100  mL mark. Filter the solution through a
filter paper (20–25 µm).
Chapter fifteen: Total phenolic content and antioxidant capacity analysis 241

• Absolute ethanol: 99% (w/w).

• Catechol (1,2-dihydroxybenzene) stock solution: 150  mg  L−1 in absolute
ethanol.

15.3.3.2 Antioxidant capacity analysis of seaweed biomass:

2,2-Diphenyl-1-picrylhydrazyl assay
• Absolute ethanol: 99% (w/w).
• Ascorbic acid (AA) stock solution: 100 mg L−1 in absolute ethanol.
• DPPH• (free radical) solution: 0.1  mM in absolute ethanol. Cover the
flask of the prepared solution with aluminum foil.

15.4 Experimental procedures

The procedures for the determination of the TPC (Section 15.4.1) and anti-
oxidant capacity (Section 15.4.2) are described as follows.

15.4.1 Total phenolic content analysis of seaweed biomass

Two quick assays for determination of TPC are described (Sections 15.4.1.1
and 15.4.1.2). FC assay is the most widely used assay for estimating the
TPC, whereas PB assay showed the advantages of, for example, lower time
consumption (15 min reaction time in PB VS 2 h reaction time in FC, see
the procedures in the following sections). Moreover, as being introduced,
although the results of TPC from both assays can be skewed by other
existing reducing compounds, the selectivities of the assays are different.
The two assays can be used as an alternative to each other and to compare
the results (Margraf et al. 2015).

15.4.1.1 Folin–Ciocalteu assay

This assay is modified and adapted to seaweed biomass from the previ-
ously published methods (Singleton et al. 1998; Velioglu et al. 1998).

1. Measure the dry matter content of the dried, ground, and screened
seaweed (preparation described in Section 15.3.1) by using the
moisture content analyzer (following the instruction manual of the
analyzer you use). Record the moisture content of the sample p (%).
Calculate and record the dry matter content of the sample q (%):

q = 100% – p (15.1)

2. Mix the dried seaweed with 99% ethanol at a ratio of 1:20 (seaweed
biomass [g, dry weight]:ethanol [mL]) in, for example, a 100 mL glass
bottle with cap, under continuous stirring at 400 rpm at 22°C ± 1.0°C
242 Protocols for Macroalgae Research

for 24 h. Record the weight of the seaweed biomass m (mg) and total
volume V (L). Calculate and record the dry weight of seaweed bio-
mass M (mg):

M=m×q (15.2)

where q is the recorded dry matter content from step 1.

3. Collect the liquid fraction (i.e., seaweed extract sample) after cen-
trifugation in a benchtop centrifuge at 2200 (×g) for 10 min.
4. Prepare other regents and stock solutions as listed in Section
15.3.3.1.1.
5. Prepare PG standard series with the range of 20–100 mg L−1: Dilute the
prepared PG stock solution with absolute ethanol, for example, add
0.5, 1.0, 1.5, 2.0, and 2.5 mL of stock solution and then add absolute
ethanol to the 50 mL mark of the volumetric flask.
6. If necessary, dilute the seaweed extract sample by ethanol to keep
the phenolic content in the extract within the linear range of the
concentrations in the standard solution series, that is, 20–100 mg L−1.
Record the dilution factor d.
7. Pipette 100 µL each of the below samples to one 2 mL microtube (and
make triplicate tubes per sample, as indicated):
• (Diluted) seaweed extract (×3)
• Blank (99% ethanol) (×3)
• PG standard solution series: 20 mg L−1 (×3), 40 mg L−1 (×3), 60 mg L−1
(×3), 80 mg L−1 (×3), and 100 mg L−1 (×3) microtube.
Label the microtubes by, for example, seaweed extract, blank, PG
standard 20 mg L−1, PG standard 40 mg L−1, PG standard 60 mg L−1,
PG standard 80 mg L−1, and PG standard 100 mg L−1.
8. Pipette 750 µL of FC reagent to each of the above microtube and mix
well by vortex mixing.
9. Allow the mixture to stand at room temperature (22°C ± 1°C) for 8 min.
10. Pipette 750 µL of 6% NaHCO3 solution to each microtube and mix
well by vortex mixing. pH should be approximately 10.
11. Incubate at room temperature (22°C ± 1°C) for 2 h.
12. After incubation, pipette 200  µL of the reacted solution from the
marked microtubes, respectively, to a well in the 96-well microtiter
plate. Put the plate to a UV–vis spectrophotometer.
13. Record the absorbance at 725 nm (A725 nm). Mean of A725 nm from the
triplicate of each sample (i.e., seaweed extract, blank, and PG stan-
dard series) is calculated and used for the following calculations.
14. Plot a PG standard curve (X-axis: TPC [mg  L−1], Y-axis: A725  nm). A
linear correlation formula is then generated from the curve, that is,

Y = kX + b (15.3)
Chapter fifteen: Total phenolic content and antioxidant capacity analysis 243

15. The concentration of the TPC in the seaweed extract sample, that is,
TPCSE (mg L−1) is calculated from the generated formula, based on its
measurement of A725 nm:
AE − A0
TPC SE = (15.4)
k
where:
TPCSE is the TPC in the extracted sample for measurement
AE is the absorbance of the seaweed extract sample
A0 is the absorbance of the blank

16. The TPC in seaweed biomass, that is, TPCSW (%, w/w) is
TPCSE × d × V
TPC SW(%) = (15.5)
M ×100
where:
d is the (possible) dilution factor recorded in step 6
V (L) and M (mg) are the extraction volume and seaweed bio-
mass dry weight recorded in step 2

15.4.1.2 Prussian blue assay

This assay is modified and adapted to seaweed biomass according to the
previously published methods (Price and Butler 1977; Graham 1992).

1. Measure the dry matter content of the dried, ground, and screened
seaweed (preparation described in Section 15.3.1) by using the
moisture content analyzer (following the instruction manual of the
analyzer you use). Record the moisture content of the sample p (%).
Calculate and record the dry matter content of the sample q (%) fol-
lowing Equation 15.1.
2. Mix the dried seaweed with 99% ethanol at a ratio of 1:20 (seaweed
biomass [g, dry weight]:ethanol [mL]) in, for example, a 100 mL blue-
cap bottle, under continuous stirring at 400 rpm at 22°C ± 1.0°C for
24 h. Record the weight of the seaweed biomass m (mg) and total vol-
ume V (L). Calculate and record the dry weight of seaweed biomass
M (mg) following Equation 15.2.
3. Collect the liquid fraction (i.e., seaweed extract sample) after cen-
trifugation in a benchtop centrifuge at 2200 (×g) for 10 min.
4. Prepare other reagents and stock solutions as listed in Section
15.3.3.1.2.
5. Dilute the catechol stock solution with ethanol to prepare the stan-
dard solutions within the range of 0.6–15 mg L−1, for example, add
0.2, 0.5, 1.0, 2.0, and 5.0 mL of stock solution, and then add absolute
ethanol to the 50 mL mark of the volumetric flask.
244 Protocols for Macroalgae Research

6. If necessary, dilute the extracted sample with ethanol with the appro-
priate dilution factor to keep phenolic content in the diluted extract
sample within the linear range of concentrations of the standard
solution series, that is, 0.6–15 mg L−1. Record this dilution factor d.
7. Pipette 300 µL each of the below samples to one 2 mL microtube (and
make triplicate tubes per sample, as indicated):
• Diluted seaweed extract (×3)
• Blank (ethanol) (×3)
• Standard solution series: 0.6 mg L−1 (×3), 1.5 mg L−1 (×3), 3 mg L−1
(×3), 6 mg L−1 (×3), and 15 mg L−1 (×3).
Label the microtubes by, for example, seaweed extract, blank,
Catechol standard 0.6  mg  L−1, Catechol standard 1.5  mg  L−1, Catechol
standard 3 mg L−1, Catechol standard 6 mg L−1, and Catechol standard
15 mg L−1.
8. Pipette into each of the above microtubes 100 µL of 0.016 M K3Fe(CN)6
followed by 100 µL of 0.02 M FeCl3 in 0.1 M HCl.
9. Mix the microtubes properly by vortex mixing and incubate the
tubes in a water bath at 25°C for 15 min.
10. Pipette 300 µL 6.03 M H3PO4 into each of the above-mentioned tubes.
Vortex the tubes and incubate the tubes in a water bath at 25°C for
2 min.
11. Pipette 200 µL 1% gum arabic solutions to each of the microtubes and
mix it well by vortex mixing.
12. After that, pipette 200  µL of the reacted solution from each of the
labeled microtube to a well in the 96-well microtiter plate. Put the
plate to a UV–vis spectrophotometer.
13. Record the absorbance at 700 nm (A700 nm). Mean of A700 nm from the
triplicate of each sample (i.e., seaweed extract, blank, and catechol
standard series) is calculated and used for the following calculations.
14. Plot a catechol standard curve (X-axis: TPC [mg L−1], Y-axis: A700 nm).
A linear correlation formula is then generated from the curve, that is,

Y = aX + c (15.6)

15. The concentration of the TPC in the seaweed extract sample, that is,
TPCSE (mg L−1) is calculated from the generated formula, based on its
measurement of

TPC SE =
( AE − A0 ) (15.7)
a

where:
AE is the absorbance of the seaweed extract sample
A0 is the absorbance of the blank
Chapter fifteen: Total phenolic content and antioxidant capacity analysis 245

The TPC in seaweed biomass, that is, TPCSW (%, w/w) is then calcu-
lated as
TPCSE × d × V
TPC SW(%) = (15.8)
M ×100
where:
d is the dilution factor recorded in step 6
V (L) and M (mg) are the extraction volume and seaweed bio-
mass dry weight recorded in step 2

15.4.2 Antioxidant capacity analysis of seaweed biomass:

2,2-Diphenyl-1-picrylhydrazyl assay
This assay is adapted to seaweed biomass from the previously published
methods (Yang et al. 2008; Sanja et al. 2009; Farvin and Jacobsen 2013).

1. Measure the dry matter content of the dried, ground, and screened
seaweed biomass (preparation described in Section 15.3.1) by using
the moisture content analyzer (following the instruction manual of
the analyzer you use). Record the moisture content of the sample
p (%). Calculate and record the dry matter content of the sample q (%)
following Equation 15.1.
2. Mix the dried seaweed with 99% ethanol at a ratio of 1:20 (seaweed
biomass [g, dry weight]:ethanol [mL]) in, for example, a 100 mL glass
bottle with cap, under continuous stirring at 400 rpm at 22°C ± 1.0°C
for 24  h. Record the weight of the seaweed biomass m (mg) and
total volume V (L). Calculate and record the dry weight of seaweed
biomass M (mg) following Equation 15.2.
3. Collect the liquid fraction (i.e., seaweed extract sample) after cen-
trifugation in a benchtop centrifuge at 2200 (×g) for 10 min.
4. Prepare other regents and stock solutions as listed in Section 15.3.3.2.
5. Prepare AA standard: Mix the prepared AA standard with ethanol to
achieve the final concentration of AA standard series in concentra-
tion of 1 ~ 10 mg L−1: for example, add 1.0, 2.0, 5.0, 7.5, and 10 mL of
stock solution, and then add absolute ethanol to the 100 mL mark of
the volumetric flask.
6. Pipette 100  µL each of the below samples to a well in a 96-well
microtiter plate (and make triplicate tubes per sample, as indicated):
• Seaweed extract (×3)
• Sample control (ethanol) (×3)
• Standard solution series: 1 mg L−1 (×3), 2 mg L−1 (×3), 5 mg L−1 (×3),
7.5 mg L−1 (×3), and 10 mg L−1 (×3)
7. Pipette 100 µL of the prepared DPPH solution to the above-mentioned
wells.
246 Protocols for Macroalgae Research

8. Pipette 100 µL seaweed extract + 100 µL ethanol, in triplicate, into

extra wells of the microtiter plate, as blank for the seaweed sample.
9. Pipette 100 µL (each of the) standard solution series + 100 µL ethanol,
in triplicate, into extra wells of the microtiter plate, as blank for the
standard sample.
10. Incubate the microtiter plate for 30  min at room temperature
(22°C ± 1.0°C) in darkness.
11. After that, measure the absorbance of each well at 517 nm using a
UV–vis microplate spectrophotometer. Mean of the triplicate of each
sample (i.e., seaweed extract, sample control, standard series, blank
for the seaweed sample, and blank for the standard series) is calcu-
lated and used for the following calculations.
12. Antioxidant capacity of the seaweed samples is calculated as
a. The percentage inhibition (I [%]) of the DPPH radical at 517 nm:

 ( A − A0 ) 
I (%) = 1 − S × 100 (15.9)
 AC 

where:
AS is the absorbance in the seaweed extract sample
A0 is the absorbance in the blank for seaweed sample
AC is the absorbance in the sample control

OR
b. The AA equivalent antioxidant capacity (AEAC) by the following
way:
– Calculate the percentage inhibition (I%) in each of the AA
standard sample:

 ( A − A0 ST ) 
I ST (%) = 1 − ST  × 100 (15.10)
 AC 

where:
AST is the absorbance of the standard sample
A0ST is the absorbance in the blank for the corresponding
standard sample
AC is the absorbance in the sample control

– Plot an AA standard curve (X-axis: AA concentration [mg L−1],

Y-axis: I [%]). A linear correlation formula is then generated
from the curve, that is,

Y = gX + f (15.11)
Chapter fifteen: Total phenolic content and antioxidant capacity analysis 247

– AEAC (mg-ascorbic-acid/L) of the seaweed extract sample

(AEACSE) is calculated from the above-generated formula,
based on its calculated inhibition (%):
( IS − f )
AEACSE = (15.12)
g

where IS is the calculated I (%) of the seaweed extract sample.

– AEAC (g-ascorbic-acid/g-biomass) of the seaweed biomass
(AEACSW) is
( AEACSE × V )
AEACSE = (15.13)
M
where V (L) and M (mg) is the extraction volume and sea-
weed biomass dry weight recorded in step 2.

15.5 Tips and tricks

To avoid any possible experiment deviations, for example, small deviation
of incubation time or reaction time, always run the blank, sample con-
trol (in DPPH assay) and standard series together with the samples to be
measured. To avoid precipitation while performing the PB assay, read the
absorbance as quickly as possible and strictly follow the addition order
of the reagents in the PB assay (Section 15.4.1.2) from step 7 to step  11.
Run a pretest to find a proper dilution rate to keep the total phenolic con-
centration in the seaweed extract sample within the linear range of the
standard curve.

Acknowledgment
The current chapter is part of the MacroFuels project. The project has
received funding from the European Union’s Horizon 2020 research and
innovation program under grant agreement No 654010.

References
Amsler, C.D., and V.A. Fairhead. 2006. Defensive and sensory chemical ecology of
brown algae. Adv. Bot. Res. 43: 1–91.
Blois, M.S. 1958. Antioxidant determinations by the use of a stable free radical.
Nature 181: 1199–1200.
Chater, P.I., Wilcox, M.D., Houghton, D., and J.P. Pearson. 2015. The role of seaweed
bioactives in the control of digestion: Implications for obesity treatments.
Food Funct. 6: 3420–3427.
Connan, S., Delisle, F., Deslandes, E., and E.A. Gall. 2006. Intra-thallus phlorotan-
nin content and antioxidant activity in Phaeophyceae of temperate waters.
Bot. Mar. 49: 39–46.
248 Protocols for Macroalgae Research

Farvin, K.H.S., and C. Jacobsen. 2013. Phenolic compounds and antioxidant

activities of selected species of seaweeds from Danish coast. Food Chem. 138:
1670–1681.
Graham, H.D. 1992. Stabilization of the Prussian blue color in the determination
of polyphenols. J. Agric. Food Chem. 40: 801–805.
Kedare, S.B., and R.P. Singh. 2011. Genesis and development of DPPH method of
antioxidant assay. J. Food Sci. Technol. 48: 412–422.
Koivikko, R. 2008. Brown algal phlorotannins: Improving and applying chemi-
cal methods. PhD thesis. University of Turku. Accessed May 8, 2017: http://
www.doria.fi/handle/10024/36054
La Barre, S., Potin, P., Leblanc, C., and L. Delage. 2010. The halogenated metabo-
lism of brown algae (Phaeophyta), its biological importance and its environ-
mental significance. Mar. Drugs 8: 988–1010.
Machu, L., Misurcova, L., Ambrozova, J.V., Orsavova, J., Mlcek, J., Sochor, J., and
T. Jurikova. 2015. Phenolic content and antioxidant capacity in algal food
products. Molecules 20: 1118–1133.
Margraf, T., Karnopp, A.R., Rosso, N.D., and D. Granato. 2015. Comparison between
Folin–Ciocalteu and Prussian blue assays to estimate the total phenolic con-
tent of juices and teas using 96-Well microplates. J. Food Sci. 80: 2397–2403.
Marinho-Soriano, E., Fonseca, P.C., Carneiro, M.A.A., and W.S.C. Moreira. 2006.
Seasonal variation in the chemical composition of two tropical seaweeds.
Bioresour. Technol. 97: 2402–2406.
Nieva-Echevarría, B., Manzanos, J.M., Goicoechea, E., and M.D. Guillén. 2015.
2,6-Di-Tert-Butyl-Hydroxytoluene and its metabolites in foods. Compr. Rev.
Food Sci. Food Saf. 14: 67–80.
Price, M.L., and L.G. Butler. 1977. Rapid visual estimation and spectrophotometric
determination of tannin content of Sorghum grain. J. Agric. Food Chem. 26:
1268–1273.
Sanja, S.D., Sheth, N.R., Patel, N.K., Patel, D., and B. Patel. 2009. Characterization
and evaluation of antioxidant activity of Portulaca oleracea. Int. J. Pharm.
Pharmac. Sci. 1: 74–84.
Singleton, V.L., and J.A. Rossi. 1965. Colorimetry of total phenolics with
phosphomolybdic—Phosphotungstic acid reagents. Am. J. Enol. Vitic. 16:
144–158.
Singleton, V.L., Rudolf, O., and R.M. Lamuela-Raventós. 1998. Analysis of total
phenols and other oxidation substrates and antioxidants by means of Folin–
Ciocalteu reagent. Meth. Enzymol. 299: 152–178.
Spurr, H.I. 2014. Extraction, separation, and purification of polyphenols, polysac-
charides and pigments from British seaweed for high-value applications.
PhD thesis. University of Leeds. Accessed May 8, 2017: http://etheses.
whiterose.ac.uk/id/eprint/8636
Tomas, N.V., and S.K. Kim. 2013. Beneficial effects of Marine algal compounds in
cosmeceuticals. Mar. Drugs 11: 146–164.
Velioglu, Y.S., Mazza, G., Gao, L., and B.D. Oomah. 1998. Antioxidant activity and
total phenolics in selected fruits, vegetables, and grain products. J. Agric.
Food Chem. 46: 4113–4117.
Yang, J., Guo, J., and J. Yuan. 2008. In vitro antioxidant properties of rutin. LWT-
Food Sci. Technol. 41: 1060–1066.
Zern, T.L., and M.L. Fernandez. 2005. Cardioprotective effects of dietary polyphe-
nols. J. Nutr. 135: 2291–2294.
chapter sixteen

Extraction of phycocyanin
and phycoerythrin pigments
Stewart William Beattie, Michèle Morançais,
Paul Déléris, Joël Fleurence, and Justine Dumay

Contents
16.1 Introduction ......................................................................................... 250
16.2 State of the art ...................................................................................... 251
16.3 Materials ............................................................................................... 252
16.3.1 Algal harvesting .................................................................... 252
16.3.2 Algal conditioning ................................................................ 253
16.3.3 Buffer preparation................................................................. 254
16.4 Experimental procedures................................................................... 254
16.4.1 Phycobiliproteins extraction................................................ 254
16.4.1.1 Algal treatment ..................................................... 254
16.4.1.2 Maceration ............................................................. 254
16.4.1.3 Acid extraction ...................................................... 255
16.4.1.4 Ultrasonic treatment ............................................ 255
16.4.1.5 Enzymatic hydrolysis .......................................... 255
16.4.2 Phycobiliprotein purification .............................................. 256
16.4.2.1 Adsorption bed chromatography ...................... 256
16.4.2.2 Ammonium sulphate precipitation ................... 257
16.4.2.3 Ion-exchange column........................................... 257
16.4.2.4 Hydroxyapatite chromatography....................... 257
16.4.2.5 Aqueous two-phase extraction........................... 258
16.4.3 Analytical method ................................................................ 258
16.5 Concluding remarks ........................................................................... 259
16.6 Notes ..................................................................................................... 260
References........................................................................................................ 262

249
250 Protocols for Macroalgae Research

16.1 Introduction
Phycobiliproteins (PBP) are an oligomeric water-soluble algal protein fam-
ily constituting the main light-harvesting chromoproteins of photosys-
tem II in Rhodophyta and Cyanobacteria. PBPs function as light-capture
and transfer systems, comprising up to 50% of water-soluble proteins in
Rhodophyta (Dumay et al. 2014) and 60% in Cyanobacteria (Cohen-Bazire
and Bryant 1982). These exist on the outer thylakoid membrane in the
stroma and are largely responsible for the reflected colors in Rhodophyta
(red algae), Cyanophycaea (blue–green algae), Cryptomonads and some
Pyrrophyceae, as aggregates of phycobilisomes (Cohen-Bazire and Bryant
1982, Isailovic et al. 2006). These PBPs function predominantly to absorb
sunlight in the wavelength range of 470–660 nm, allowing for the species
exploiting them to survive at very low light intensities, mainly at depths
in the water where chlorophyll-a becomes inefficient in light absorption.
PBPs are generally split into four groups according to their absorbance
maxima, existing as a complex of cores and rods (Figure 16.1). The quan-
tum efficiency with regards to energy transfer between PBPs has been
quoted as being close to 100%, with Phycoerythrin (PE) being located at
the tip of the rod, Phycocyanin (PC) in the center, and Allophycocyanin
(APC) comprising the core that then transfers energy to photosystem II
(Figure 16.2) (Galland-Irmouli et al. 2000).

Light (photons)
480–570 nm 550–650 nm
Light energy
transfer
6 nm

Stroma 12 nm

Thylakoid
membrane
Reaction center
chlorophyll
(chlorophyll a)

Lumen

Phycoerythrin, Phycoerythrocyanin, or Phycocyanin

Rod Phycoerythrin or Phycocyanin Allophycocyanin
Phycocyanin

Figure 16.1 Structure of a single phycobilisome situated on the thylakoid mem-

brane. (From Dumay, J. et al., Chapter 11. Phycoerythrins: Valuable proteinic pig-
ments in red seaweeds, in Jacquot, J.P., Gadal, P., Bourgougnon, N. (Eds.), Advances
in Botanical Research Vol. 71, pp. 321–343, 2014.)
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 251

Phycoerythrin/
Phycocyanin Allophycocyanin Chlorophyll a
Phycoerythrocyanin

Figure 16.2 Schematic of quantum energy transfer from the tip of a phycobilis.

Certain species of Cyanobacteria, such as those in the genus Spirulina,

have been found to contain a rich and inexpensive source of C-PC
(Bennett and Bogorad 1973, Bhaskar et al. 2005), and it has been posited
that the accessory water-soluble PBPs in seaweeds have originated from
an endosymbiotic relationship with Cyanobacteria before their evolution
into plastids (Dawes 2016).
PBPs are categorized depending on their source, for example,
Rhodophyta contain R-Phycocyanin (R-PC) whereas C-Phycocyanin (C-PC)
originates from Cyanobacteria and Cryptophyta and B-Phycocyanin
(B-PC) from Bangiophycaea, a class of Rhodophyta (Dumay and Morançais
2016). R-PC is classed as a surviving intermediate species from the past
that contributes to the transfer of energy from PE to PC and is utilized
in modern applications in a similar fashion to R-phycoerythrin (R-PE) as
fluorescent markers, natural nontoxic dyes, and as an immunoregulator
(Glazer and Hixson 1975, Zhu et al. 2015).

16.2 State of the art

The discovery of phycobilisomes role as the main light-harvesting chro-
moproteins in the aforementioned phyla can be attributed to Theodor
Wilhelm Engelmann in 1883, who concluded that the projection of light
on an Oscillatoria filament caused an accumulation of aerotactic bacteria in
spectral regions where oxygen was involved, which corresponded to the
previously stated absorbance regions. This accumulation occurs in photo-
system II that is the first protein complex involved in the photosynthesis
of oxygen in plants and is the last step in the quantum energy transfer
chain situated on the surface of the thylakoid membrane (Figure 16.3).
These PBPs are composed of α and β subunits; however, R-PE
(Phycoerythrin of Rhodophyceae) and B-PE (Phycoerythrin of Bangiales)
are unique in the sense that they are the only PBPs containing an extra γ
subunit (Isailovic et al. 2004, Niu et al. 2006, Sun et al. 2009), which ulti-
mately boosts the pigment structures stability as the extra subunit acts
like a rivet to the two central, face-to-face αβ3-trimers (Glazer and Hixson
1977, Hilditch et al. 1991, Dumay et al. 2014).
The extraction of PBPs is influenced by numerous external factors,
with significance given to the biomass-solvent ratio, cellular disruption
method, nature of solvent, and extraction time (Abalde et al. 1998, Reise
et al. 1998). Furthermore, the efficacy of each method will vary according
to species, regardless of PBP intended for extraction (Moraes et al. 2011).
252 Protocols for Macroalgae Research

CF1

Intrathylakoidal space Lumenal

surface

Lipid bilayer

PSII + phycobilisome attachment sites

PSI, cytochromes, subunits CF0

Allophycocyanin
Phycobilisome
Phycocyanin, phycoerythrin

Figure 16.3 Phycobilisomes and their associated photosystems as situated on the

thylakoid membrane. (From Dumay, J. et al., Chapter 11. Phycoerythrins: Valuable
proteinic pigments in red seaweeds, in Jacquot, J.P., Gadal, P., Bourgougnon, N.
(Eds.), Advances in Botanical Research Vol. 71, pp. 321–343, 2014.)

This efficacy also depends on the number of steps taken to complete the
extraction as it is well known that a greater number of steps will result in
a lower final product yield (Kula et al. 1982).
The purity of the extracted PE and PC will ultimately determine which
use it is best suited for. Low purity (0.7) will be used as a food colorant as
it is nontoxic and noncarcinogenic (Doke 2005). High purity (3.9) can be
considered reactive grade, and purity (>3.2) will be implemented into pro-
cesses involving analyzing fluorescent energy transfer as PBPs have a nota-
bly large stokes shift, making then easily detectable through spectroscopy
(Rito-Palomares et al. 2001, Patil and Raghavaroa 2007, Dumay et al. 2015).

16.3 Materials
16.3.1 Algal harvesting
PBPs could be recovered from both seaweeds and microalgae.
For seaweeds (Note 1)

1. Collect the samples in the shore or from seaweed farms (Note 2).
2. Remove epiphytes when required.
3. Rinse thoroughly with tap water and spin dry the sample.
4. Store until use.
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 253

16.3.2 Algal conditioning

Studies analyzed in the course of writing this chapter have found several
phycobiliprotein removal experiments conducted on wet and dry algal
biomass. Several studies are reporting different techniques associated
with the drying process (Table 16.1) that ultimately affected the purity
and yield of PBPs from macroalgae (Sarada et al. 1999, Doke 2005, Oliveira
et al. 2009, Chaiklahan et al. 2011, Moraes et al. 2011, Prabakaran and
Ravindran 2013).
Studies utilizing these techniques with Spirulina sp. have reported
differing values of loss for PC yield, with a 5% loss from sun-dried bio-
mass (Chaiklahan et al. 2011), a 5%–7% loss when dried with air circulation
(Doke 2005) and a 21% loss with cross-flow drying (Oliveira et al. 2009).
One conclusion from Sarada et al. (1999) also detailed that although the
temperature differed between drying techniques, it was not a major influ-
encer on PC yield. Regardless of the drying technique in this study (spray,
cross-flow, and sun drying), the PC yield remained at a loss of 45% ± 1%
when PC recovery from wet biomass is classed as 100%; therefore, it is
recommended to perform experiments on fresh wet biomass, either cul-
tivated, harvested or purchased, to optimize yield and purity of PBPs.
Purity was also affected in this study as PC recovered from dry samples
demonstrated an absorbance peak at 652  nm, indicating that APC was
also present within the sample. This could be because of the fact that phy-
cobilisomes are constituted of an APC core surrounded by PC rods tipped
with PE, which suggests that heat from drying methods could cause a

Table 16.1 Biomass drying techniques and methodologies

Drying technique Method
Sun-drying Wet biomass in a beaker can be placed directly in the
sun assuming exterior ambient temperatures exceed
35°C (ancestral method).
Air-drying Wet biomass can be placed in an air circulation system
at 25°C for 1 h in the shade. This can also be
performed using a cross-flow system by
implementing perpendicular airflows (Oliveira et al.
2009).
Spray-drying Wet biomass solution is sprayed into a chamber
containing a hot gas to eliminate moisture content
and leave a powdered form of the initial solution
behind (Sarada et al. 1999).
Freeze-drying Wet biomass can be rapidly frozen before being
subjected to a vacuum to remove the water content to
preserve it (Nguyen et al. 2016).
254 Protocols for Macroalgae Research

decrease in purity and yield because of the peripheral position of the PC

and excessive penetration of the phycobilisome by high temperatures
(Glazer 1984, Sarada et al. 1999).
Therefore, prefer to carry PBP extraction on dry algae material by the
use of one of the techniques.

16.3.3 Buffer preparation

Acetate buffer 50 mM pH 5 (1 L) (Notes 3 and 4)

• Homogenize 4.32 g of sodium acetate trihydrate (97%) and 1.05 mL of

99% acetic acid in 250 mL of distilled water.
• Set pH at 5 using pH meter.
• Adjust pH if required with the addition of 97% sodium hydroxide
(NaOH).
• Complete to 1 L with ultrapure water and store at 4°C for up to one
month.

Phosphate buffer 20 mM pH 7.1 (1 L)

• Dissolve 1.58 g of Na2HPO4 ∙ 2H2O and 1.54 g of NaH2PO4 ∙ H2O in

1 L of distilled water.
• Set pH at 7.1 and adjust if necessary before storing at 4°C for up to
one month.

16.4 Experimental procedures

16.4.1 Phycobiliproteins extraction
16.4.1.1 Algal treatment
1. Homogenization of cells must also occur before experimenta-
tion either manually by grinding, cryo-grinding or mechanically
assisted, for example, with pressure 200–400  kg  cm−2 (Patil and
Raghavaroa 2007) (Note 5).
2. Biomass can also be frozen or ground with liquid nitrogen and
homogenized in the presence of acid-washed neutral sand/
diatomaceous earth (at a ratio of 5:1 respectively) and a weakly
acidic buffer at a ratio of 1 g biomass: 20 mL 20 mM sodium phos-
phate (pH 6.8–7) buffer (Galland-Irmouli et al. 2000, Fleurence 2003,
Moraes et al. 2011, Su et al. 2014, Nguyen et al. 2016).

16.4.1.2 Maceration
This technique is arguably the most widely employed phycobiliprotein
extraction protocol, attributable to low economic impact, short extraction
time, and easiness of setup.
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 255

1. Homogenize and suspend triplicate masses of samples under agita-

tion (150 rpm) at a ratio of 100 mL water/buffer to 1 g dry weight/7.5 g
wet weight biomass (Dumay et al. 2013).
2. Conduct in darkness and allow cell lyses to occur over a 20  min
period at 4°C for Cyanobacteria and Rhodophyta.
3. Centrifuge samples at 25,000 g at 4°C for 20 min before filtering and
measuring rigorously the supernatant obtained (weight and volume)
before spectrophotometric analysis.

16.4.1.3 Acid extraction

Acid extraction must be performed on wet biomass and using different
concentrations of acid—both organic and inorganic (Note 6).

1. Inorganic acid extraction: Treat biomass with HCl (2.0–10 M) at a ratio

of 5 g wet biomass:1 mL acid under agitation (150 rpm).
2. Maintain at room temperature in darkness for 24  h (Moraes et al.
2011).
3. Organic extraction has a parallel methodology except HCl is replaced
by an organic acid such as acetic acid (2.0–10 M).
4. Clarify by centrifuging at 25,000 g at 4°C for 20 min before filtration,
measuring the supernatant obtained (weight and volume) and ana-
lyzing spectrophotometrically.

16.4.1.4 Ultrasonic treatment

1. Homogenize and suspend biomass in distilled water/buffer (Note 7).
2. With/without the presence of glass pearls (ratio of 1 g biomass:1 g
glass pearls), place biomass in an ultrasonic bath at 50 kHz for 40 min
to break up cells (Medeiros et al. 2008).
3. Alternatively, sonicate for 6 h at 35 kHz following the procedure of
Le Guillard et al. (2015).
4. Centrifuge samples at 25,000 g at 4°C for 20 min, weigh, determine
volume, and analyze supernatant by spectrophotometry.

16.4.1.5 Enzymatic hydrolysis

The use of such treatment is well documented (Fleurence 2003, Denis
et  al. 2009, Dumay et al. 2013, Harnedy and Fitzgerald 2013, Dumay
et al. 2015, Le Guillard et al. 2015, Le Guillard et al. 2016, Nguyen et al.
2016) and requires a background knowledge of the cell-wall composi-
tion of the subject species to select the appropriate enzymes for cell-wall
degradation (Table 16.2) (Note 8). The cell walls of Rhodophyta are
rich in xylans, making this phylum generally best suited to enzymatic
hydrolysis by xylanolytic enzymes obtainable from fungal sources
256 Protocols for Macroalgae Research

Table 16.2 Species, study, appropriate enzyme, and optimum conditions

for enzymatic hydrolysis (Note 11)
Appropriate
Species Study enzyme pH + Temp (°C)
Gracilaria verrucosa Fleurence et al. 1995 • k carrageenase pH 6.5–6.8 at 45
• Cellulase pH 3.8 at 50
• Xylanase pH 5 at 55
• β-agarase pH 6–6.5 at 55
Grateloupia turuturu Denis et al. 2009 • Cellulase pH 3.8 at 50
• Agarase pH 6–6.5 at 55
• i carrageenase pH 6.5–6.8 at 45
• k carrageenase pH 6.5–6.8 at 45
Palmaria palmata Dumay et al. 2013 • Xylanase pH 5 at 40
Mastocarpus stellatus Nguyen et al. 2016 • Xylanase pH 5 at 55

(Kloareg  and  Quatrano 1988, Fleurence et al. 1995, Fleurence 2003,

Harnedy and Fitzgerald 2013) (Note 9).

1. Homogenize biomass before weighing out equal masses of a desired

number or replicates for experimentation.
2. Introduce equivalent biomass and buffer values at a ratio of 100 mL
water/buffer (e.g., acetate buffer 50 mM, pH 5) to 1 g dry weight/7.5 g
wet weight biomass (Dumay et al. 2013).
3. Maintain in darkness under agitation (700 rpm) at specific enzyme
optimum temperature and allow 6 h extraction before centrifugation
at 25,000 g for 20 min at 4°C (Dumay et al. 2013).
4. Filtrate supernatant to remove large fragments before analyzing by
spectrophotometry (Note 10).

16.4.2 Phycobiliprotein purification

16.4.2.1 Adsorption bed chromatography
1. Expanded-bed adsorption column is loaded with STREAMLINE™
phenyl-Sepharose and equilibrated with ammonium sulphate
(0.05 M) solution along with an expanded absorbent (Note 12).
2. Solution is then pumped into the column in an upward direction at
15 mL min−1 at room temperature (Wang 2002, Bermejo et al. 2003,
Niu et al. 2006).
3. Ammonium sulphate (0.1  M) solution or sodium acetate solution
(0.05 M) can then be used to wash and elute PBPs in a downward
direction. PBPs are then collected as a solution as the STREAMLINE™
phenyl-Sepharose has acted as a vector for PBP capture, whereas cell
debris and particulate matter has been separated and transported
upward (Wang 2002, Niu et al. 2006).
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 257

16.4.2.2 Ammonium sulphate precipitation

1. Collected eluates can be fractionated with ammonium sulphate (e.g.,
30, 50, and 60% weight/volume) to form precipitates.
2. Precipitates can then be dissolved in a neutral buffer such as sodium
phosphate (0.05 M) before dialysis against the same buffer diluted
1000 times over the course of 4  h at 4°C (Zhang and Chen 1999,
Bhaskar et al. 2005).
3. Centrifuge at 10,000 g for 30 min at 4°C.
4. Resuspend precipitate in an acetate buffer (0.05 M, pH 5) and centri-
fuge again using the same settings (Patel et al. 2005, Leema et al. 2010).
Repetitive steps and allowing for overnight dialysis can both improve
purity, but they will reduce yield due to an increased number of steps.

16.4.2.3 Ion-exchange column

1. Eluates from absorption bed chromatography are eluted with
ammonium sulphate solution (e.g., 0.05, 0.1, and 0.2 M) and distilled
water before being applied to the ion-exchange column.
2. Pump or pour through the ion-exchange column in a downward
direction in the presence of a negatively charged ion exchanger (e.g.,
STREAMLINE™ Q-Sepharose).
3. Wash with a neutral buffer such as sodium phosphate (0.05  M) to
remove loosely bound particles and excess debris, while eluting the
PBP from the ion exchanger until the effluent is clear (Wang 2002,
Niu et al. 2006, Munier et al. 2015).
4. Elute PBPs by creating a gradient using sodium chloride (0.15  M)
and phosphate buffer (0.05 M) before collecting PBPs.

16.4.2.4 Hydroxyapatite chromatography

Hydroxyapatite is a form of naturally occurring calcium that can be cre-
ated in the form of a neutral solution by combining certain chemicals.

1. Equilibrate hydroxyapatite column with 10  mM phosphate buffer

containing 20  mM of sodium chloride in the downward direction
before adding eluates (Niu et al. 2006).
2. Eluates from absorption bed chromatography are eluted with
ammonium sulphate solution (e.g., 0.05, 0.1, and 0.2 M) and distilled
water before being applied to the hydroxyapatite column.
3. Calcium chloride (CaCl2) (2 M) and potassium phosphate (KH2PO4)
(2  M) can be mixed at a rate of 5  mL  min−1 using a magnetic stir-
rer at a ratio of 1:1.1 mL, respectively, to trigger the hydroxyapatite
precipitation.
4. As previously mentioned, PBPs are sensitive to pH, therefore, the pH
of the hydroxyapatite solution must be maintained at a value of 9 by
adding potassium hydroxide (KOH) (2 M) solution.
258 Protocols for Macroalgae Research

5. Sodium phosphate (1 mM) buffer containing sodium chloride (NaCl)

(20 mM) can be used to wash and remove fine particles from the pre-
cipitate before collecting the eluate (Niu et al. 2006, Niu et al. 2007).

16.4.2.5 Aqueous two-phase extraction

1. Predetermined quantities of a hydrophilic polymer such as polyeth-
ylene glycol (PEG) and salt (e.g., phosphate) are added to a known
quantity of crude extract of PBP (Note 13).
2. This is termed a polymer-salt extraction, and this results in the PBPs
being concentrated in a phase predominantly comprising water
(80%–95%) and an increased concentration of a phase-forming com-
ponent such as PEG (Johansson et al. 1998, Rito-Palomares 2004,
Mensi et al. 2014).
3. Vortex mixing or magnetic stirring at room temperature for an hour
will then allow for phase separation to occur (Patil and Raghavaroa
2007). This method presents several advantages over polymer–
polymer systems as it is cost-efficient, widely used, and applied cur-
rently with a stable range of pH 6–9 (Rito-Palomares 2004).

16.4.3 Analytical method

As PBPs are segregated on the basis of their absorbance properties, there-
fore spectrophotometry is the preferred method to analyze supernatant
and to identify different absorbance maxima (Table 16.3).
Bennett and Bogorad 1973: PC, APC, and PE concentration (expressed
as mg mL−1) can also be calculated using equations that correct for spectral
overlaps of the pigments with previous studies detailing their implementa-
tion (Bennett and Bogorad 1973, Beer and Eshel 1985, Sarada et al. 1999, Patel
et al. 2005, Moraes et al. 2011, Prabakaran and Ravindran 2013).
Equations are required to convert absorbance data into phycobilipro-
tein concentrations.

A615 − 0.474( A652 )

C − PC (mg ml −1 ) = (16.1)
5.34

Table 16.3 PBP spectrometry values

PBP Absorbance maxima (nm)
PE 540–570
PEC 560–600
PC 610–620
APC 650–655
Source: Glazer, A. N. et al., Proc. Nat. Acad. Sci., 73,
428–431, 1976.
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 259

A652 − 0.208( A620 )

C − APC (mg ml −1 ) = (16.2)
5.09

[A652 − 2.41( PC ) − 0.849( APC )]

C − PE (mg ml −1 ) = (16.3)
9.6

R − PE (mg ml −1 ) = [( A565 − A592 ) − ( A455 − A592 ) × 0.2] × 0.12 (16.4)

R − PC (mg ml −1 ) = [( A618 − A645 ) − ( A592 − A645 ) × 0.15] × 0.15 (16.5)

Silveira et al. (2007): The following equation can be used to calculate the
extraction yield of PBP:

(PBP concentration) ∗ solvent volume (mL)

Yield = (16.6)
Dry biomass (g)

Purity: Spectrophotometrically measuring the ratio of A615/A280 will give

a purity index for PC (Silveira et al. 2007) whereas the ratio A565/A280 will
give a purity index for PE (Beer and Eshel 1985).
Purification factor: As stated by Antelo et al. (2010).

EPP
Purification factor = (16.7)
EPC

where:
EPP is the Extract purity
EPC is the Extract purity of crude extract

Further information and more detailed protocols can be found using the
references cited for each process.

16.5 Concluding remarks

Several methods of PBP extraction and purification have been reported
with many research projects on this topic having found disparate results
with regards to PBP extraction optimization because of the distinct verac-
ity differences between protocols when it comes to PBP extraction. This
alone would suggest that to industrialize the aforementioned protocols,
the requirement for an efficient, universally acceptable PBP extraction pro-
cedure capable of processing large amounts of selected biomass at mini-
mal cost and with environmental concern is necessary. Indeed, all studies
cited in this chapter have produced low yield and purity of PBPs if con-
sidered from a commercial perspective. The extraction and purification
260 Protocols for Macroalgae Research

steps combined with the requirement for highly specialized equipment

and the meticulous preparation of biomass to obtain such a small amount
of final product has severely limited the applications available to PBP
and the resulting commercialization of extraction procedures. Centrifugal
recovery is a step required in most protocols because of the requirement
of the separation of cell debris and product. This step is efficient as no
biomass is lost through the process. Nonetheless, from a commercial per-
spective, it is expensive and energy inefficient when the large volumes of
biomass required for industrial production are considered. However, use
of less-efficient equipment could hinder the purity of the final product.
Therefore, it is imperative that fundamental research be carried out on
larger scales to optimize and improve the production and downstream
processes of PBP extraction and purification that will ultimately be the
solution to achieving supernatant with high content and purity of PBPs.
Research will soon be revolving around protocol optimization that will
allow for these industrial parameters to become more realistic, permit-
ting the commercialization of an industry dedicated to the extraction and
purification of these highly specialized and favorable pigments in the near
future that will perhaps expand their applicability and accessibility due to
continuous development of modern technology and medicine.

16.6 Notes
Note 1: PBPs content could significantly vary according to environmen-
tal factors. Be aware that samples collected during hot and sunny
season (it depends of the hemisphere) will not provide as high PBPs
yields as those collected during the cold season.
Note 2: Seaweed life cycle could also interfere with the extraction yield.
For more accurate results, separate thalli.
Note 3: Depending on the extraction method chosen (especially for
enzymatic assisted ones), you can use different buffers according to
pH required. Be sure that the buffer chosen fit with the extraction
method (enzyme accuracy as example).
Note 4: When PBPs extraction is compared, ensure that the buffer cho-
sen for all the methods is the same (same pH, same ionic strength,
and same composition). If not, discuss about the interferences led by
the buffer differences.
Note 5: Anionic polysaccharides present within the cell walls of sea-
weeds make extraction of metabolites challenging and rather inef-
ficient (Denis et al. 2009). The discharge of these highly valuable
and useful PBPs from cells can be directly related to cell rupture,
but small algae such as Spirulina sp. (300–500  µm diameter) are
resistant to this in the sense that they have multilayered cell walls,
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 261

making extraction difficult (Moraes et al. 2011). Regardless of the

extraction method, the pH of the system must remain between pH 3
and 10 as this is the range in which PBPs remain stable (Patil and
Raghavarao 2007).
Note 6: It should be noted that the method of inorganic extraction
by using hydrochloric acid (HCl) can cause release PBPs to pre-
cipitate immediately after extraction (Moraes et al. 2011) and, fur-
thermore, negatively impact purity as chlorophyll-a will also be
extracted by HCl that can be identified by an absorption peak at
663 nm (Doke 2005).
Note 7: This method has been found to be one of the most efficient
extraction procedures, especially with the presence of glass beads
that were found to increase the yield by 76× when compared with
ultrasonic treatment without glass pearls (Moraes et al. 2011), proba-
bly due to the fact that as thallus disintegration promotes the release
of PBPs from cells, the presence of glass beads most likely catalyzed
this process with extra friction.
Note 8: The biochemical composition of Rhodophyta varies greatly
according to species, although, as a general assumption, it can be
said that red seaweed cell walls comprise a matrix of polysaccha-
rides with a small proportion of proteins and cellulose (Fleurence
2003). Results from previous studies have shown that pH and tem-
perature also have an impact on the enzymatic extraction of proteins
and pigments (Fleurence 2003).
Note 9: Enzymes also have nonlinear specific activity values that change
with respect to temperature and incubation time; therefore, hydro-
lysis should be carried out in glass bioreactors under controlled
temperature, agitation, and light obscurity to assert the maximum
conditional controls.
Note 10: The use of ultrasound to assist in enzymatic hydrolysis has
also been tested and can be applied by using Ultrasonic treatment or
by using a Sonitube® (Le Guillard et al. 2016).
Note 11: Other techniques to extract PBPs exist (e.g., freezing & thaw-
ing) but are not applied as much as those stated in this chapter due
to increased labor/economic costs or decreased purity and yield
efficiency.
Note 12: This method is usually performed in a specialized piece of
equipment such as a STREAMLINE™ column that is also resis-
tant to blockage caused by the excess amount of sticky polysac-
charides released after cell homogenization (Wang 2002, Niu
et  al. 2006). This ultimately causes an equilibrium between par-
ticle sedimentation and upward flow and a particle size gradient
increasing from top to bottom (Hjorth 1999, Wang 2002, Bermejo
et al. 2006, UMSC).
262 Protocols for Macroalgae Research

Note 13: Commonly implemented as an alternative in purification

systems in chemical industries (Hatti-Kaul 2001, Antelo et al. 2010,
Ratanapongleka 2010, Goja et al. 2013, Duarte et al. 2015), this pro-
cess is attractive because of its low processing time and high yield
with an efficiency based on the choice of which system is used, for
example, polymer–polymer, polymer–salt (Manirafasha et al. 2016).

References
Abalde, J., Betancourt, L., Torres, E., Cid, A., Barwell, C. 1998. Purification and char-
acterisation of phycocyanin from the marine cyanobacterium Synechococcus
sp. IO9201. Plant Science 136: 109–120.
Antelo, F. S., Anschau, A., Costa, J. A. V., Kalil, S. J. 2010. Extraction and puri-
fication of C-phycocyanin from Spirulina platensis in conventional and
integrated aqueous two-phase systems. Journal of the Brazilian Chemical
Society 21: 5.
Beer, S. and Eshel, A. 1985. Determining phycoerythrin and phycocyanin concen-
trations in aqueous crude extracts of red algae. Australian Journal of Marine
and Freshwater Research 36: 785–792.
Bennett, A. and Bogorad, L. 1973. Complimentary chromatic adaption in a fila-
mentous blue-green alga. The Journal of Cell Biology 58(2): 419.
Bermejo, R., Acién, F. G., Ibanez, M. J., Fernandez, J. M., Molina, E., Alvarez-Pez,
J. M. 2003. Preparative purification of B-phycoerythrin from the micro-
alga Porphyridium cruentum by expanded-bed adsorption chromatography.
Journal of Chromatography B 790(1–2): 317–325.
Bermejo, R., Felipe, M. A., Talavera, E. M., Alvarez-Pez, J. M. 2006. Expanded bed
adsorption chromatography for recovery of phycocyanins from the micro-
alga Spirulina platensis. Chromatographia 63(1–2): 59.
Bhaskar, S. U., Gopalaswamy, G., Raghu, R. 2005. A simple method for efficient
extraction and purification of C-phycocyanin from Spirulina platensis Geitler.
Indian Journal of Experimental Biology 43: 277–279.
Chaiklahan, R., Chirasuwan, N., Loha, V., Tia, S., Bunnag, B. 2011. Separation and
purification of phycocyanin from Spirulina sp. using a membrane process.
Bioresource Technology 102(14): 7159–7164.
Cohen-Bazire, G. and Bryant, D. A. 1982. Chapter 7. Phycobilisomes: Composition
and Structure. In: Carr, N. G. and Whitton, B. A. (Eds.). The Biology of
Cyanobacteria, pp. 143–190. Oxford, UK: Blackwell.
Dawes, C. 2016. Chapter 4. Macroalgae systematics. In: Levine, I. and Fleurence,
J. (Eds.). Seaweed in Health and Disease Prevention, pp. 107–138. London, UK:
E-Book, Elsevier.
Denis, C., Morançais, M., Gaudin, P., Fleurence, J. 2009. Effect of enzymatic diges-
tion on thallus degradation and extraction of hydro soluble compounds
from Grateloupia turuturu. Botanica Marina 52: 262–267.
Doke, J. M. Jr. 2005. An improved and efficient method for the extraction of phy-
cocyanin from Spirulina sp. International Journal of Food Engineering 1(5): 2.
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 263

Duarte, A. W. F., Lopes, A. M., Molino, J. V. D., Pessoa, A., Sette, L. D. 2015. Liquid-
liquid extraction of lipase produced by psychrotrophic yeast Leucosporidium
scottii L117 using aqueous two-phase systems. Separation and Purification
Technology 156(2): 215–225.
Dumay, J., Clément, N., Morançais, M., Fleurence, J. 2013. Optimisation of hydro-
lysis conditions of Palmaria palmata to enhance R-phycoerythrin extraction.
Biosource Technology 131: 21–27.
Dumay, J. and Morançais, M. 2016. Chapter 9. Proteins and pigments. In: Levine, I.
and Fleurence, J. (Eds.). Seaweed in Health and Disease Prevention, pp. 275–308.
London, UK: E-book, Elsevier.
Dumay, J., Morançais, M., Munier, M., Le Guillard, C. L., Fleurence, J. 2014.
Chapter 11. Phycoerythrins: Valuable proteinic pigments in red seaweeds.
In: Jacquot, J. P., Gadal, P., and Bourgougnon, N. (Eds.). Advances in Botanical
Research, Vol. 71, pp. 321–343.
Dumay, J., Morançais, M., Nguyen, H. P. T., Fleurence, J. 2015. Chapter 5. Extraction
and purification of R-phycoerythrin from marine red algae. In: Stengel, D. B.
and Connan, S. (Eds.). Natural Products from Marine Algae (NPMA). Methods
in Molecular Biology, p. 1308.
Engelmann, T. W. 1883. Bacterium photometricum. Archive for the Whole Physiology
of Humans and Animals 30(1): 95–124.
Fisheries and Aquaculture Statistics (FAO). 2014. FAO yearbook. Rome, Italy: Food
and Agriculture Organisation of the United Nations.
Fleurence, J. 2003. R-phycoerythrin from red macroalgae: Strategies for extrac-
tion and potential application in biotechnology. Applied Biotechnology, Food
Science and Policy 1(1): 1–6.
Fleurence, J., Massiani, L., Guyader, O., Mabeau, S. 1995. Use of enzymatic cell wall
degradation for improvement of protein extraction from Chondrus crispus,
Gracilaria verrucosa, and Palmaria palmata. Journal of Applied Phycology 7: 393.
Galland-Irmouli, A. V., Pons, L., Luçon, M. et al. 2000. One-step purification of
R-phycoerythrin from the red macroalga Palmaria palmata using pre-
parative polyacrylamide gel electrophoresis. Journal of Chromatography B:
Biomedical Sciences and Applications 739(1): 117–123.
Glazer, A. N. 1984. A Macromolecular complex optimised for light energy trans-
fer. Biochimica et Biophysica Acta 768: 29–51.
Glazer, A. N., Apell, G. S., Hixson, C. S., Bryant, D. A., Rimon, S., Brown, D. M.
1976. Biliproteins of cyanobacteria and rhodophyta: Homologous family of
photosynthetic accessory pigments. Proceedings of the National Academy of
Science 73: 428–431.
Glazer, A. N. and Hixson, C. S. 1975. Characterisation of R-phycocyanin.
Chromophore content of R-phycocyanin and C-phycoerythrin. Journal of
Biological Chemistry 250: 5487–5495.
Glazer, A. N. and Hixson, C. S. 1977. Subunit structure and chromophore composi-
tion of rhodophytan phycoerythrins. Porphyridium cruentum B-phycoerythrin
and b-phycoerythrin. Journal of Biological Chemistry 252(1): 32–42.
Goja, A. M., Tang, H., Cui, M., Li, C. 2013. Aqueous two-phase extraction advances
for bioseparation. Journal of Bioprocessing and Biotechnology 4: 1–8.
264 Protocols for Macroalgae Research

Gupta, A. and Sainis, J. K. 2010. Isolation of C-phycocyanin from Synechococcus sp.

Journal of Applied Phycology 22: 231–233.
Harnedy, P. A. and Fitzgerald, R. J. 2013. Extraction of protein from the macroalga
Palmaria palmata. LWT-Food Science and Technology 51(1): 375–382.
Hatti-Kaul, R. 2001. Aqueous two-phase systems. Molecular Biotechnology 19: 269–277.
Hilditch, C. M., Balding, P., Jenkins, R., Smith, A. J., Rogers, L. J. 1991.
R-phycoerythrin from the macroalga Corallina officinais (Rhodophyceae) and
application of a phycofluor probe for detecting sugar-binding sites on cell
membranes. Journal of Phycology 3(4): 345–354.
Hjorth, R. 1999. Expanded bed adsorption: Elution in expanded bed mode.
Bioseparation 8: 1–9.
Isailovic, D., Li, H. W., Yeung, E. S. 2004. Isolation and characterisation of
R-phycoerythrin subunits and enzymatic digests. Journal of Chromatography
1051: 119–130.
Isailovic, D., Sultana, I., Phillips, G. J., Yeung, E. S. 2006. Formation of fluorescent
proteins by the attachment of phycoerythrobilin to R-phycoerythrin alpha
and beta apo-subunits. Analytical Biochemistry 358: 38–50.
Johansson, H. O., Karlstrom, G., Tjerneld, F., Haynes, C. A. 1998. Driving forces for
phase separation and partitioning in aqueous two-phase systems. Journal of
Chromatography B 711: 3–17.
Kloareg, B. and Quatrano, R. S. 1988. Structure of the cell walls of marine algae
and ecophysical functions of the matric polysaccharides. Oceanography and
Marine Biology—An Annual Review 26: 259–315.
Kula, M. R., Kroner, K. H., Hustedt, H. 1982. Purification of enzymes by liquid-
liquid extraction. Advances in Biochemical Engineering 24: 73–118.
Le Guillard, C., Berge, J. P., Donnay-Moreno, C. et al. 2016. Soft liquefaction of the
red seaweed Grateloupia turuturu Yamada by ultrasound-assisted enzymatic
hydrolysis process. Journal of Applied Phycology 28(4): 2575–2585.
Le Guillard, C., Dumay, J., Donnay-Moreno, C. et al. 2015. Ultrasound-assisted
extraction of R-phycoerythrin from Grateloupia turuturu with and without
enzyme addition. Algal Research 12: 522–528.
Leema, J. T. M., Kirubagaran, R., Vinithkumar, N. V., Dheenan, P. S., Karthikayulu, S.
2010. High value pigment production from Arthrospira (Spirulina) platensis
cultured in seawater. Bioresource Technology 101(23): 9221–9227.
Manirafasha, E., Ndikubwimana, T., Zeng, X., Lu, Y., Jing, K. 2016. Phycobiliprotein:
Potential microalgae derived pharmaceutical and biological reagent.
Biochemical Engineering Journal 109: 282–296.
Medeiros, F. O., Alves, F. G., Lisboa, C. R., Martins, D. S., Burkert, C. A. V. K., Kalil,
S. J. 2008. Ondas ultrasonicas e perolas de vidro: Um novo metodo de extracao
de B-galactosidase para uso em laboratorio. Quimica Nova, Brazil 31(2): 336.
Mensi, F., Ksouri, J., Seale, E., Romdhane, M. S. 2014. Optimising R-phycoerythrin
purification from the red algae Gracilaria verrucosa in polymer-salt aque-
ous two-phase system response surface methodology. Bulletin de l’institut
National des Sciences et Technologies de la Mer 41: 63–74.
Moraes, C. C., Sala, L., Cerveira, G. P., Kalil, S. J. 2011. C-phycocyanin extrac-
tion from Spirulina platensis wet biomass. Brazilian Journal of Chemical
Engineering 28: 1.
Chapter sixteen: Extraction of phycocyanin and phycoerythrin pigments 265

Munier, M., Morançais, M., Dumay, J., Jaouen, P. 2015. One-step purification of
R-phycoerythrin from the red edible seaweed Grateloupia turuturu. Journal of
Chromatography 992: 23–29.
Nguyen, H. P. T., Morançais, M., Fleurence, J., Dumay, J. 2016. Mastocarpus stella-
tus as a source of R-phycoerythrin: Optimisation of enzyme assisted extrac-
tion using response surface methodology. Journal of Applied Phycology 29(3):
1563–1570.
Niu, J. F., Wang, G. C., Lin, X. Z., Zhou, B. C. 2007. Large-scale recovery of
C-phycocyanin from Spirulina platensis using expanded bed adsorption
chromatography. Journal of Chromatography B 850: 267–276.
Niu, J. F., Wang, G. C., Tseng, C. K. 2006. Method for large-scale isolation and
purification of R-phycoerythrin from red alga Polysiphonia urceolata. Protein
Expression and Purification 49: 23–31.
Oliveira, E. G., Rosa, G. S., Moraes, M. A., Pinto, L. A. A. 2009. Characterisation
of thin layer drying of Spirulina platensis utilising perpendicular air flow.
Bioresource Technology 100: 1297–1303.
Patel, A., Mishra, S., Pawar, R., Ghosh, P. K. 2005. Purification and characterisation
of C-phycocyanin from cyanobacterial species of marine and freshwater
habitat. Protein Expression and Purification 40(2): 248–255.
Patil, G. and Raghavaroa, K. S. M. S. 2007. Aqueous two phase extraction for puri-
fication of C-phycocyanin. Biochemical Engineering Journal 34(2): 156–164.
Prabakaran, P. and Ravindran, A. D. 2013. Efficacy of different extraction methods
of phycocyanin from Spirulina platensis. International Journal of Research in
Pharmacy and Life Science 1(1): 15–20.
Ratanapongleka, R. 2010. Recovery of biological products in aqueous two phase
systems. International Journal of Chemical Engineering and Applications 1:
191–198.
Reise, A., Mendes, A., Lobo-Fernandes, L., Empis, J. A., Novais, J. M. 1998.
Production, extraction and purification of phycobiliproteins from Nostoc sp.
Bioresource Technology 66: 181–187.
Rito-Palomares, M. 2004. Practical application of aqueous two-phase partition
to process development for the recovery of biological products. Journal of
Chromatography B 807(1): 3–11.
Rito-Palomares, M., Nunez, L., Amador, D. 2001. Practical application of aque-
ous two-phase systems for the development of a prototype process for
C-phycocyanin recovery from Spirulina maxima. Journal of Chemical Technology
and Biotechnology 76: 1273–1280.
Sarada, R., Pillai, M. G., Ravishankar, G. A. 1999. Phycocyanin from Spirulina sp.
Influence of processing of biomass on phycocyanin yield, analysis of effi-
cacy of extraction methods and stability studies on phycocyanin. Process
Biochemistry 34: 795–801.
Silveira, S. T., Burkert, J. F. M., Costa, J. A. V., Burkert, C. A. V., Kalil, S. J. 2007.
Optimisation of phycocyanin extraction from Spirulina platensis using facto-
rial design. Bioresource Technology 98(8): 1629.
Su, C. H., Liu, C. S., Yang, P. C., Syu, K. S., Chiuh, C. C. 2014. Solid-liquid extraction
of phycocyanin from Spriulina platensis: Kinetic modelling of influential fac-
tors. Separation and Purification Technology 123: 64–68.
266 Protocols for Macroalgae Research

Sun, L., Wang, S., Gong, X., Zhao, M., Fu, X., Wang, L. 2009. Isolation, purifica-
tion and characteristics of R-phycoerythrin from a marine macroalga
Heterosiphonia japonica. Protein Expression and Purification 64: 146–154.
Wang, G. 2002. Isolation and purification of phycoerythrin from red alga Gracilaria
verrucosa by expanded-bed-adsorption and ion-exchange chromatography.
Chromatographia 56(7–8): 1–5.
Zhang, Y. M. and Chen, F. 1999. A simple method for efficient separation and
purification of C-phycocyanin and allophycocyanin from Spirulina platensis.
Biotechnology Techniques 13: 601–603.
Zhu, L. P., Gan, S. G., Lv, A. J. 2015. Chapter 51. Efficient purification and active
configuration investigation of R-phycocyanin from Polysiphonia urceolata.
In: Zhang, T. C. and Nakajima, M. (Eds.). Advances in Applied Biotechnology,
Vol. 332, pp. 489–496.
chapter seventeen

Quantification and localization

of reactive oxygen species
in marine macrophytes
Manoj Kumar, Loretto Contreras-Porcia,
Nirali M. Kumar, and Peter J. Ralph

Contents
17.1 Introduction ......................................................................................... 268
17.2 State of the art ...................................................................................... 269
17.2.1 ROS detection reaction mechanism using
dihydroethidium and dichlorodihydrofluorescein
diacetate.................................................................................. 269
17.2.2 Histochemical localization mechanism using nitro
blue tetrazolium and DAB staining ................................... 271
17.3 Material ................................................................................................ 273
17.3.1 Reactive oxygen species visualization by microscopy .... 273
17.3.2 Reactive oxygen species quantification using
dihydroethidium and dichlorodihydrofluorescein
diacetate.................................................................................. 273
17.3.3 ROS histochemical localization .......................................... 273
17.4 Experimental procedures ...................................................................274
17.4.1 Reactive oxygen species visualization by microscopy .... 274
17.4.2 ROS quantification using DHE and DCFH–DA............... 274
17.4.3 Histochemical localization for reactive oxygen
species detection ....................................................................274
17.5 Tips and tricks ..................................................................................... 275
17.5.1 Reactive oxygen species visualization ............................... 275
17.5.2 Reactive oxygen species quantification ............................. 275
17.5.3 Reactive oxygen species histochemical localization ........ 276
Acknowledgment ........................................................................................... 276
References........................................................................................................ 276

267
268 Protocols for Macroalgae Research

17.1 Introduction
Marine macrophytes (including seaweeds and seagrasses) are the assem-
blage of diverse groups of phototrophic marine plants and are considered
marine ecological engineers. Both provide a range of ecologically and
economically valuable biological services; however, they are under con-
stant threat from a wide range of anthropogenic stressors, climate varia-
tion, invasive species, and pathogens and are often exposed to low- and
high-tidal cycle on daily bases (Contreras-Porcia et al. 2011; Kumar et al.
2011a, b). The relative abundance, survivability, and distribution of marine
macrophytes in such environments are principally determined by their
tolerance abilities to diverse stresses. Any adverse effect on marine mac-
rophytes because of fluctuating and stressful environmental conditions
can directly or indirectly lead to perturbations at higher trophic levels and
can eventually affect the integrity and sustainability of marine ecosys-
tems. The climatic variations and anthropogenic stressors in their ecologi-
cal niche trigger a series of physiological processes and accumulation of
reactive oxygen species (ROS), including singlet oxygen (1O2), superoxide
radicals (O2·−), hydrogen peroxide (H2O2), or hydroxyl radicals (OH·).
The cell organelles such as chloroplast, mitochondria, and peroxisomes
are vital organelles involved in highly oxidizing metabolic activities with
intense electron flow rate and are the major source of ROS production.
Furthermore, microsomes (e.g., cytochrome P450 and diamine oxidase),
peroxisomes (e.g., enzymes involved in fatty acid oxidation), and some
enzymes in the plasma membrane (e.g., NADPH oxidase and lipooxygenase)
have been identified as a potential source of ROS generator (Kumar et al.
2011b, 2014; Wojtala et al. 2014). ROS are produced directly by excitation
of O2 and subsequent formation of singlet oxygen, or by the transfer of
one, two, or three electrons to O2 or by protonation, which results in the
formation of O2·−, H2O2, or OH· radicals (Bischof and Rautenberger 2012).
Furthermore, O2·−, if protonated, can form the perhydroxyl radical (HO2·)
and can also react with reactive nitrogen species (RNS), that is, nitric
oxide radical (NO·, signaling free radical) to form more toxic peroxynitrite
(OON−) radical. Under physiological conditions, both ROS and RNS can
act as signal molecules to regulate cellular metabolism. They also affect
the transmission of signals across cells and can be considered second mes-
sengers during growth, differentiation, and cell death (Wojtala et al. 2014).
Although many ROS and RNS, while acting as a signal molecule, modify
gene expression and modulate the activity of specific defense proteins
(Kumar et al. 2014), high concentrations of ROS and/or RNS can disrupt
the cellular redox homeostasis, and can lead to oxidative burst exacer-
bating cellular damages. In this context, marine macrophytes express a
battery of antioxidant enzymes and nonenzymatic antioxidants such as
ascorbate, glutathione, tocopherol, carotenoids, phenolics, and flavonoids,
Chapter seventeen: Quantification and localization of reactive oxygen species 269

which are of immense importance and play a crucial role in controlling

cellular ROS levels, redox status, and cellular repair, thereby minimiz-
ing the risk of detrimental effects resulting from ROS-mediated oxidative
stress.
To attribute a cell-signaling event in response to stress, ROS estima-
tion is essential to detect and characterize these species accurately as an
indicator of oxidative stress. ROS are highly reactive and exhibit very
short lifetimes that vary from nanoseconds to seconds. For example, OH·
reacts with most of the organic compounds and has a lifetime of about
10  ns. O2·− exhibits a low steady-state concentration of around 10−10  M
in different cells or organelle types (Gardner 2002). The half-life of O2·−
depends on its concentration. At a concentration of 10 µM, O2·− exhibits a
half-life time of 0.2 ms in water, whereas at a lower concentration of 1 µM,
half-life rises to 20 ms. 1O2 exhibits a lifetime of 2.7 µs (Steffen-Heins and
Steffens 2015).

17.2 State of the art

Several analytical approaches, including electron paramagnetic reso-
nance (EPR, including spin trap and spin probe), chemiluminescence,
fluorescence, and spectrophotometry have been used to detect ROS in
land and marine plants (Contreras-Porcia et al. 2009, 2011; Kalyanaraman
et  al. 2012; Kumar et  al. 2011a, b, 2012; Dikalov and Harrison 2014;
Steffen-Heins and Steffens 2015; Strittmatter et al. 2016, and references
therein). Nevertheless, it is very challenging to monitor ROS success-
fully in biological systems because of their significantly low concentra-
tion, the enzymatic defense systems, and the different compartments
of the living cell. ROS detection methods are based on a unique bio-
chemical reaction mechanism with merits and demerits—describing
them is out of the scope of this article; however, interested readers can
refer to other articles (Kalyanaraman et al. 2012; Dikalov and Harrison
2014; Winterbourn 2014; Steffen-Heins and Steffens 2015, and refer-
ences therein). Here we describe the most common methods used in
marine macrophytes to quantify ROS using fluorescence probes such
as dihydroethidium (DHE) and dichloro-dihydrofluorescein diacetate
(DCFH–DA), and their localization using stains such as nitro blue tetra-
zolium (NBT, for O2·−) and 3,3′-diaminobenzidine (DAB, for H2O2).

17.2.1 ROS detection reaction mechanism using dihydroethidium

and dichlorodihydrofluorescein diacetate
Dihydroethidium (DHE) and its mitochondrion-targeted form mito-
SOX (a triphenyl-phosphonium cation conjugated to DHE) is a widely
270 Protocols for Macroalgae Research

NH2 NH2 NH2

HO
+
O2 O2
N CH2CH3 N CH2CH3 N CHCH3

NH2 NH2 NH2

Dihydroethidium (DHE) DHE radical 2-Hydroxyethidium (2−OH−E+)
Non-fluorescent Fluorescent

Figure 17.1 Formation of DHE superoxide-specific product 2-hydroxyethidium

(2–OH–E+).

used fluorescence probe for detecting cellular and mitochondrial O2·−

(Dikalov and Harrison 2014). The red fluorescence formed from the
two-electron oxidation product 2–OH–E+ is equated to intracellular
O2·− (Figure 17.1). However, this approach is limited, because DHE can
also form ethidium (E+) and other dimers of HE (HE–HE, HE−E+, E+−E+)
by nonspecific redox reactions. The fluorescent spectra of ethidium and
2–OH–E+ overlap that make it difficult to distinguish such products
by using confocal microscopy or other fluorescence-based microscopic
assays to measure only 2–OH–E+ accurately. Therefore, careful use of
specific wavelengths of excitation might allow separation of these sig-
nals, so that confocal imaging or other fluorescence-based approaches
could be used. One should take extra efforts to accurately measure
the 2–OH–E+ using HPLC-fluorescence or LC–MS-based analytical
methods.
DCFH–DA is commonly used for detecting intracellular H2O2 and
oxidative stress. This probe is cell permeable, which first gets intracel-
lularly hydrolyzed by esterase into the DCFH carboxylate anions, and
subsequently its oxidation results in the formation of a fluorescent
product dichlorofluorescein (Figures 17.2 and 17.3). This product can

AcO Cl HO Cl O Cl O Cl

COOH COOH COOH COOH

Intracellular Fe3+, Heme O2

O O O O
Esterase H H2O2
H
O2

AcO Cl HO Cl HO Cl HO Cl
DCFH–DA DCFH DCFH DCF

Figure 17.2 DCFH–DA oxidative reaction mechanism for H2O2 detection.

Chapter seventeen: Quantification and localization of reactive oxygen species 271

DHE DCFH–DA

Figure 17.3 ROS burst visualized in Lessonia spicata under copper stress (100 µg L−1)
by fluorescence microscopy using DHE and DCFH–DA probes. (Adapted from
Contreras-Porcia, L. et al., Aquat. Toxicol., 94, 94–102, 2009.)

be  monitored by either fluorescent-based analytical methods, micros-

copy, or by flow cytometry. Despite the immense popularity of these
methodologies, it cannot be reliably used to solely measure the intracel-
lular H2O2 in a cell. It is highly essential to keep in mind the following
limitations when using DCFH–DA probe for accurate interpretation of
data: (1) DCFH does not directly react with H2O2; (2) several one- electron
oxidizing species (including OH·, HOCl, and several ROS) oxidize
DCFH to DCF; (3) DCF can actually produce H 2O2 through the reaction
of DCF radical with the oxygen, leading to artifactual amplification of
fluorescence signal intensity; (4) redox active metals, cytochrome c, and
heme peroxidases can also catalyze DCFH oxidation (Kalyanaraman
et al. 2012).

17.2.2 Histochemical localization mechanism using

nitro blue tetrazolium and DAB staining
Cell type-specific ROS have been detected using histochemical approaches.
Localization and quantification of H2O2 using DAB in different cell com-
partments are possible, wherein DAB reacts with H2O2 in a peroxidase-
catalyzed reaction resulting in an oxidized insoluble brown precipitate.
For localization of O2·− in a plant tissue, the nitrosubstituted aromatic
compound NBT is useful, wherein NBT specifically reacts with super-
oxide ions, and oxidized NBT forms a purple/blue formazan precipitate
(Figure 17.4). Such techniques have recently been implemented in ROS
localization in seaweeds and seagrasses (Figure 17.5) (Kumar et al. 2011a, b,
2012; Strittmatter et al. 2016).
272 Protocols for Macroalgae Research

NO2 O2N NO2 O2N

− −
N +Cl Cl N
N 4O2 + 2H+ NH HN
N N + N N N
N N
N N 4O2 N N
O O O O
NBT Formazan
(Soluble) (Insoluble–purple precipitate)
(a)

+ +
H2N NH2 HRP + H O NH NH HN NH
2 2

H2N NH2 HN NH2 -le− H2N NH2

HRP-O + H2O -le− 2 n
DAB Quinone iminium radical Polymeric complex
brown precipitate
(b)

Figure 17.4 (a) NBT and (b) DAB oxidative reaction mechanism for ROS detection.

Control Ionic liquid Control Copper

a b a b
H2O2

DAB

150 μm 150 μm 100 μm 100 μm

a b a b
NBT
O2 −

200 μm 200 μm 100 μm 100 μm

Seaweed Seagrass
(Ulva lactuca) (Zostera muelleri)

Figure 17.5 Histochemical localization of ROS in seaweeds and seagrasses exposed

to toxic ionic liquid [C12mim]Br (0.14  mM for four days) and copper (250  mM;
seven days). (From Kumar, M. et al., Chem. Res. Toxicol., 24, 1882–1890, 2011b.)
Chapter seventeen: Quantification and localization of reactive oxygen species 273

17.3 Material
17.3.1 Reactive oxygen species visualization by microscopy
• 0.2 µm-filtered natural seawater (NSW)
• 10 µM DCFH–DA (Calbiochem, UK) prepared in filtered seawater
• 100 µM DHE (Molecular Probes, Invitrogen, Australia) prepared in
filtered seawater
• Fluorescence microscopy coupled with camera
• Razor blade
• Glass slide
• Cover slips

17.3.2 Reactive oxygen species quantification using

dihydroethidium and dichlorodihydrofluorescein diacetate
• 10 µM DCFH–DA (Calbiochem, UK) prepared in filtered seawater
• DCF standard curve prepared in filtered seawater
• 100 µM DHE (Molecular Probes, Invitrogen, Australia) prepared in
filtered seawater
• 40 mM Tris–HCl buffer pH 7.0 (for DCF determination) and 7.5 (for
2–OH–E+ determination)
• Liquid nitrogen
• Amber glasses or bottles (50–100 mL)
• Porcelain mortar and pestle
• Spectrofluorometer
• Room-temperature centrifuge
• Agitator plate

17.3.3 ROS histochemical localization

• 0.2 µm-filtered NSW
• Vacuum infiltration unit (desiccator connected to vacuum pump)
• Glass Petri dishes (90 × 30 mm)
• Nitroblue tetrazolium chloride (Sigma-Aldrich)
• Prepare 0.1% (w/v) NBT solution in NSW (filtered and auto-
claved) in an amber bottle
• Diaminobenzidine tetrahydrochloride (Sigma-Aldrich)
• Prepare 0.1% (w/v) DAB solution (pH 3.8) in NSW in an amber
bottle
• Water bath
• Absolute ethanol
274 Protocols for Macroalgae Research

• 50% glycerol
• Razor blade
• Glass slide
• Coverslips
• Stereomicroscope coupled with camera

17.4 Experimental procedures

17.4.1 Reactive oxygen species visualization by microscopy
1. Cut by hand the seaweed thalli or seagrass leaves from control and
treatments samples.
2. Incubate the samples at room temperature (20°C–25°C) with DCFH–
DA or DHE solution for 30 min or 1 h under gentle shaking.
3. Rinse the tissue in filtered sea waters four times.
4. Blot-dry the tissue gently.
5. Put the samples quickly on glass slip.
6. Select an excitation wavelength of 480–488  nm and an emission
wavelength of 525–590 nm.

17.4.2 ROS quantification using DHE and DCFH–DA

1. Incubate 1–2  g fresh weight of the samples at room temperature
(20°C–25°C) in DCFH–DA or DHE solution for 30 min or 1 h under
gentle shake.
2. Rinse the tissue at room temperature in filtered seawaters four times,
and blot-dry the tissue gently.
3. Freeze the tissue in liquid nitrogen until reaching a fine powder
using porcelain mortar and pestle.
4. Homogenize the tissue in 5–10 mL of Tris–HCL.
5. Centrifugate at 20,000 g for 10–15 min, recover the supernatant, and
put immediately on ice.
6. The fluorescence determination of the extract must be carried out
immediately, using an excitation wavelength of 480–488 nm and an
emission wavelength of 525–590 nm.
7. The ROS values will be expressed as nmol DCF per gram of fresh
tissue and nmol 2–OH–E+ per gram of fresh tissue.

17.4.3 Histochemical localization for reactive

oxygen species detection
1. Excise the seaweed thalli or seagrass leaves from control and treat-
ments samples. For example, thalli of seaweed (Ulva lactuca) exposed
to ionic liquid ([C12mim]Br; 0.14  mM) for four days and leaves of
Chapter seventeen: Quantification and localization of reactive oxygen species 275

seagrass Zostera muelleri exposed to copper (250 mM) for seven days

were used for ROS histochemical localization.
2. Cut the thalli/leaves using a razor blade in 1 × 1 cm size and immerse
in 25  mL of 0.1% NBT or 0.1% DAB solution. For negative control,
supplement the NBT solution with 10 mM sodium azide.
3. Vacuum infiltrates the leaves by building a vacuum (∼50–60 kPa for
2 min). Release the vacuum gently and repeat the procedure two to
three times until the thalli/leaves are completely infiltrated.
4. Incubate the infiltrated samples at room temperature for 1–2 h under
room light.
5. After incubation, drain off the staining solution and transfer the
thalli/leaves samples in a Falcon tube (50 mL) containing 30 mL of
absolute ethanol for chlorophyll removal.
6. Remove the chlorophyll for proper visualization of the stain by series
of ethanol washes while heating the samples in a boiling water bath
for 10–15 min (or more if necessary, with intermittent shaking, add
fresh ethanol in every wash).
7. Cool and transfer the samples in 50% glycerol to capture the images
using a stereomicroscope by keeping the samples on a slide.
8. Hand-cut sections can also be prepared from stained samples after
removal of chlorophyll and can be fixed subsequently in 50% glyc-
erol for imaging.
9. Superoxide ions react with NBT and appear as blue formazan.
Hydrogen peroxide reacts with DAB and appears as a brown pre-
cipitate (Figure 17.5).

17.5 Tips and tricks

17.5.1 Reactive oxygen species visualization
• The incubation time depends on the tissue thickness. It is recom-
mended to use thin cuts.
• The rinsing depends on the tissue.
• Both DCFH–DA and DHE solutions must be prepared freshly before
use.
• The excitation and emission wavelengths must be adjusted accord-
ing to the samples.

17.5.2 Reactive oxygen species quantification

• Both DCFH–DA or DHE solutions must be prepared freshly before
use.
• The supernatant for quantification must be clear without rests of
tissue.
276 Protocols for Macroalgae Research

• The DHE standard curve should be recorded along with the samples.
• Will be using the extinction coefficient of 2–OH–E+ for quantifica-
tion depending on the excitation wavelength.
• The excitation and emission wavelengths must be adjusted accord-
ing to the samples. Use additional controls as the tissue without
probes.

17.5.3 Reactive oxygen species histochemical localization

• For the negative control, the NBT solution will be supplemented
with 10 mM sodium azide before the infiltration.
• NBT solution can also be prepared in 50 mM potassium phosphate
buffer (pH 6.5–7.5). However, it is preferred to use NSW for marine
samples.
• A low pH of 3.8 is necessary for proper solubilization of DAB. Set the
pH by using 0.1 N HCl.
• Both NBT and DAB staining solutions must be prepared freshly
before use.
• It is important to release the vacuum gently during vacuum infiltra-
tion to enable better infiltration of leaves.
• Perform the step of chlorophyll removal by boiling the mixture in a
fume hood to prevent the spread of bad odor.

Acknowledgment
Author MK is grateful to the Australian Research Council for award-
ing him Discovery Early Career Research Award (DECRA Fellowship,
DE150100461-2015). Author LC-P is grateful to FONDECYT 1170881 and
DI-1245-16/R (Universidad Andrés Bello).

References
Bischof, K. and Rautenberger, R. 2012. Seaweed responses to environmental
stress: Reactive oxygen and antioxidative strategies. In C. Wiencke, and
K.  Bischof (Eds.), Seaweed Biology. Novel Insights into Ecophysiology, Ecology
and Utilization Ecological Studies (Vol. 219, pp. 109–132). Heidelberg, Germany:
Springer.
Contreras-Porcia, L., Mella, D., Moenne, A., and Correa, J.A. 2009. Differential
responses to copper-induced oxidative stress in the marine macroalga
Lessonia nigrescens and Scytosiphon lomentaria (Phaeophyceae). Aquat. Toxicol.
94: 94–102.
Contreras-Porcia, L., Thomas, D., Flores, V., and Correa, J.A. 2011. Tolerance to
oxidative stress induced by desiccation in Porphyra columbina (Bangiales,
Rhodophyta). J. Exp. Bot. 62: 1815–1829.
Dikalov, S.I. and Harrison, D.G. 2014. Methods for detection of mitochondrial and
cellular reactive oxygen species. Antioxid. Redox Signal. 20: 372–382.
Chapter seventeen: Quantification and localization of reactive oxygen species 277

Gardner, P.R. 2002. Aconitase: Sensitive target and measure of superoxide. Meth.
Enzymol. 349: 9–23.
Kalyanaraman, B., Darley-Usmar, V., Davies, K.J., Dennery, P.A., Forman,
H.J., Grisham, M.B., Mann, G.E., Moore, K., Roberts, L.J., and Ischiropoulos,
H. 2012. Measuring reactive oxygen and nitrogen species with fluorescent
probes: challenges and limitations. Free Radic. Biol. Med. 52(1): 1–6.
Kumar, M., Bijo, A.J., Baghel, R.S., Reddy, C.R.K., and Jha, B. 2012. Selenium and
spermine alleviate cadmium induced toxicity in the red seaweed Gracilaria
dura by regulating antioxidants and DNA methylation. Plant Physiol.
Biochem. 51: 129–138.
Kumar, M., Gupta, V., Trivedi, N., Kumari, P., Bijo, A.J., Reddy, C.R.K., and Jha, B.
2011a. Desiccation induced oxidative stress and its biochemical responses in
intertidal red alga Gracilaria corticata (Gracilariales, Rhodophyta). Environ.
Exp. Bot. 72:194–201.
Kumar, M., Kumari, P., Reddy, C.R.K., and Jha, B. 2014. Salinity and desiccation
induced oxidative stress acclimation in seaweeds. In N. Bourgougnon (Ed.),
Sea Plants (Vol. 71, pp. 91–123). San Diego, CA: Academic Press Publisher,
Elsevier.
Kumar, M., Trivedi, N., Reddy, C.R.K., and Jha, B. 2011b. Toxic effects of imidazo-
lium ionic liquids on the green seaweed Ulva lactuca: Oxidative stress and
DNA damage. Chem. Res. Toxicol. 24(11): 1882–1890.
Steffen-Heins, A. and Steffens, B. 2015. EPR spectroscopy and its use in planta—
a promising technique to disentangle the origin of specific ROS. Front.
Environ. Sci. 3: 15.
Strittmatter, M., Grenville-Briggs, L.J., Breithut, L., Van-West, P., Gachon, C.M.M.,
and Küpper, F.C. 2016. Infection of the brown alga Ectocarpus siliculosus by
the oomycete Eurychasma dicksonii induces oxidative stress and halogen
metabolism. Plant Cell Environ. 39(2): 259–271.
Winterbourn, C.C. 2014. The challenges of using fluorescent probes to detect and
quantify specific reactive oxygen species in living cells. Biochim. Biophys.
Acta: General Subjects 1840(2): 730–738.
Wojtala, A., Bonora, M., Malinska, D., Pinton P., Duszynski, J., and Wieckowski, M.R.
2014. Methods to monitor ROS production by fluorescence microscopy and
fluorometry. Meth. Enzymol. 542: 243–262.
chapter eighteen

Metabolomics of intra- and

extracellular metabolites from
micro- and macroalgae using
GC–MS and LC–MS
Constanze Kuhlisch, Gianmaria Califano,
Thomas Wichard, and Georg Pohnert

Contents
18.1 Introduction ......................................................................................... 280
18.2 State of the art ...................................................................................... 281
18.3 Materials............................................................................................... 283
18.3.1 Solvents................................................................................... 283
18.3.2 Equipment .............................................................................. 283
18.3.3 Consumables ......................................................................... 285
18.3.4 Solution recipes ..................................................................... 285
18.3.5 Instrumental setup ............................................................... 286
18.4 Experimental procedures .................................................................. 287
18.4.1 Sampling and metabolic quenching .................................. 288
18.4.1.1 Filtration of planktonic single-celled algae ...... 288
18.4.1.2 Collection of algal gametes (of Ulva spp.) ........ 288
18.4.1.3 Collection of algal thalli...................................... 289
18.4.2 Solid-phase extraction of extracellular metabolites ......... 289
18.4.3 Extraction of intracellular metabolites............................... 290
18.4.3.1 Cell disruption by ultrasound treatment ......... 290
18.4.3.2 Cell disruption with a bead mill ....................... 290
18.4.4 Two-step-derivatization for GC–MS analysis ................... 291
18.4.5 GC–MS analysis .................................................................... 292
18.4.6 Data analysis for GC–MS data ............................................ 292
18.5 Notes ..................................................................................................... 295
Acknowledgments ......................................................................................... 297
References........................................................................................................ 297

279
280 Protocols for Macroalgae Research

18.1 Introduction
Metabolomics techniques aim to comprehensively extract, quantify, and
evaluate metabolites from a given organism or community and have
developed into an indispensable tool in life sciences (Allwood et  al.
2011; Aldridge and Rhee 2014) (for more information, refer to a recent
special issue in Current Opinion in Chemical Biology) (Schroeder and
Pohnert 2017). Different approaches have been brought forward that
allow us to answer a multitude of questions about the physiology of an
organism and to generate new hypotheses about its response to stress
(Goulitquer et al. 2012; Krug and Müller 2014). Among others, metabo-
lomics allows us to map changes in primary metabolism that reflect
the regulation of biochemical pathways to categorize samples by using
metabolic fingerprinting techniques or to identify metabolites that are
regulated in stress or interaction situations by comparative metabolic
profiling. Especially, comparative metabolomics is suitable for the
generation of hypotheses about the role of primary and secondary
metabolites (Lee and Fiehn 2008; Kuhlisch and Pohnert 2015). Most
commonly, mass spectrometric techniques are used for the recording
of metabolomics data. With complex samples, mass spectrometry
(MS) can be coupled to efficient separation techniques such as ultra
performance liquid chromatography (UPLC) and gas chromatography
(GC). By using such hyphenated analytical techniques, the profiling of
hundreds of metabolites within minutes is feasible. Fundamental pre-
requirements for successful metabolomics investigations are the exper-
iment planning, sample preparation, extraction, data recording, and
the statistical evaluation of the results. In this contribution, we describe
a very robust and validated protocol for the generation of metabolic
data from marine organisms. Initially developed for the investiga-
tion of the diatom Skeletonema marinoi, the protocol was successfully
adapted to the investigation of different algal taxa (Nylund et al. 2011;
Vidoudez and Pohnert 2012; Mausz and Pohnert 2015), including flag-
ellated gametes and thalli of the green macroalga Ulva mutabilis and
water samples for exometabolomic profiling (Alsufyani et al. 2017).
Even profiling of entire plankton communities is feasible without the
need for further alterations (Kuhlisch et al. submitted), and it can be
predicted that only minor adaptations to the protocol are required
to make it suitable for a broad range of other (marine) organisms. By
introducing a few additional experimental steps, the method that was
initially developed for the investigation of the endometabolome (i.e.,
the intracellular metabolites) can also be used to monitor the exome-
tabolome (i.e., the metabolites released into the surrounding seawater;
see Barofsky et  al. 2009 and Alsufyani et al. 2017). For high-quality
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 281

metabolomics, the sample preparation and handling are decisive, and

we thus place here attention to fully document and describe the work-
flow. We also introduce one selected workflow for data analysis of com-
parative metabolomics datasets.

18.2 State of the art

In the past, qualitative and quantitative metabolite investigations
were conducted by targeted chemical analyses of certain metabolites
or metabolite classes (Gravot et al. 2010; Dittami et al. 2011). However,
along with the improvement of hyphenated analytical techniques, the
simultaneous and untargeted metabolic profiling of a broader range
of substance classes including amino acids, organic acids, sugars, and
fatty acids became feasible as reviewed in Dunn (2008). Complex bio-
logical extracts are thereby separated by, for example, GC, LC, or capil-
lary electrophoresis, followed by their subsequent analysis using MS.
Various available mass analyzers such as quadrupole, time of flight
(TOF), and the Orbitrap provide a range of instruments with variable
sensitivity, mass resolution, and mass accuracy. Besides LC–MS, one of
the most common analytical platforms for metabolic profiling is GC–
MS because of its high chromatographic resolution, sensitivity, and
availability of reference libraries (Dunn 2008). Many experimental steps
for GC–MS metabolic profiling were established in terrestrial plants
and transferred to mammals and microbes (Fiehn 2008). Thus, the first
protocols in plant sciences included plant-specific protocols for enzyme
quenching by liquid nitrogen, cell homogenization, and metabolite
extraction in hot methanol before the separation of polar metabolites,
evaporation for derivatization, GC–MS analysis, data processing, and
statistical analysis. A two-step derivatization with optimized methox-
ylation conditions and N-methyl-N-trimethylsilyl-trifluoroacetamide
(MSTFA) as silylation reagent was introduced, and DB-5ms columns
were recommended for separation (Fiehn et al. 2000a, b; Roessner et al.
2000). Isotopically labeled primary metabolites (Fiehn et al. 2000a)
and the polyol ribitol (Roessner et al. 2000) were introduced as inter-
nal standards (ISs) for semiquantitative metabolite analysis. In the
following, several steps of the initial protocols were improved (Lisec
et  al. 2006) or adjusted  to the needs of other study systems (Winder
et  al. 2008), especially for particularly error-prone steps such as met-
abolic quenching (Álvarez-Sánchez et al. 2010), or cell extraction, for
which a one-phase-solvent mixture was proposed by Gullberg et al.
(2004), who also sorted out the effect of oximation time and tempera-
ture during derivatization. Later, GC–TOF–MS systems came in focus,
282 Protocols for Macroalgae Research

which offer faster scan times compared with quadrupole-MS (Wagner

et al. 2003). Furthermore, data processing and analysis strategies were
evaluated, for example, handling of multiple derivatization products
(Kanani and Klapa 2007), appropriate data-scaling methods (van den
Berg et al. 2006), or the choice of uni- and multivariate statistical analy-
ses (Saccenti et al. 2014).
Within the field of marine sciences, metabolomics approaches are still
at their advent (Goulitquer et al. 2012). Metabolic profiling of microalgae
was first established for the freshwater microalga Chlamydomonas
reinhardtii (Bölling and Fiehn 2005), followed by the introduction of
protocols for the investigation of the marine diatoms Phaeodactylum tri-
cornutum (Allen et al. 2008), Skeletonema marinoi (Vidoudez and Pohnert
2012), and Thalassiosira pseudonana (Bromke et al. 2013). With Gracilaria
vermiculophylla and Gracilaria chilensis (Nylund et al. 2011; Weinberger
et al. 2011), the first marine macroalgae were profiled followed by the
brown algae Ectocarpus siliculosus, Laminaria digitata, and Lessonia spicata
(Ritter et al. 2014; Ritter et al. 2017). Some efforts have already been
made to adjust experimental procedures to the needs of macroalgae.
Thus, the robust cell wall structures were extracted after flash freez-
ing in liquid nitrogen and thorough grinding with mortar and pestle.
Prior to this, epibionts were removed gently if thalli were collected in
the field. A challenge that has not been addressed thus far is the high
morphological and chemical diversity of the diverse macroalgal taxa
and life-cycle stages.
In contrast to the profiling of endometabolites of marine algae, rather
few investigations exist, which cover exometabolites (Barofsky et al. 2009;
Gillard et al. 2013; Becker et al. 2014; Longnecker et al. 2015). The meth-
odology in this field is currently developing as reviewed in Minor et al.
(2014). Main challenges are the separation of cells and surrounding
medium without cell leakage and the extraction of dissolved metabolites.
Thus, cells should be removed, for example, by gentle filtration over sand
or GF/C filters (Barofsky et al. 2009; Alsufyani et al. 2017). The most com-
mon extraction method for dissolved metabolites in seawater is solid-
phase extraction (SPE) as it is fast, simple, and removes the salt load of
marine samples that would otherwise interfere with subsequent analyti-
cal processes. Metabolite coverage depends both on the choice of the SPE
cartridge adsorbent and eluting solvents. Styrene divinylbenzene phases
showed highest recoveries thus far, and we propose CHROMABOND®
Easy cartridges due to their high recovery of m/z-retention time pairs
(Barofsky et al. 2009).
In the following protocol, we focus on sample generation for GC–MS
analysis in addition to LC–MS and give a brief overview of processes
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 283

in data treatment. Different sampling and extraction strategies for the

diverse macroalgal life stages are presented. We also introduce a protocol
for profiling the exometabolome of micro- and macroalgae.

18.3 Materials
18.3.1 Solvents
• Acetone (certified ACS, Fisher Chemical)
• Chloroform (for HPLC, HiPerSolv CHROMANORM® [≥99.8%, fil-
tered through 0.2 µm, packed under N2, stabilized with 0.6% etha-
nol], VWR)
• Ethanol (gradient grade for LC, LiChrosolv®; ≥99.9%, filtered through
0.2 µm, Merck)
• Hexane (for GC, SupraSolv® [≥98%], Merck; stored over 4 Å molecu-
lar sieve)
• Methanol (for HPLC, Chromasolv®Plus [≥99.9%], Sigma-Aldrich)
• Pyridine (for HPLC, Chromasolv®Plus [≥99.9%], Sigma-Aldrich; stored
over 4 Å molecular sieve under argon)
• Tetrahydrofuran (THF; for HPLC, HiPerSolv CHROMANORM®
[≥99.7%, filtered through 0.2  µm, packed under N2, not stabilized],
VWR; stored under argon)
• Water (for HPLC, Chromasolv®Plus [filtered through 0.2  µm],
Sigma-Aldrich)
• Extraction solution (see Table 18.1 in Section 18.3.4)
• Column elution solution (see Table 18.2 in Section 18.3.4)
• Internal standard (IS) solution (see Table 18.3 in Section 18.3.4)
• Methoxyamine hydrochloride (98%, Sigma-Aldrich; hygroscopic
and  thus stored in a desiccator under argon and vacuum-dried
before use)
• Retention time index (RI) solution (see Table 18.4 in Section 18.3.4)
• MSTFA (1 mL vials, Macherey–Nagel)

18.3.2 Equipment
• Fume hood
• Lab coat
• Safety goggles
• Chemical-resistant gloves (nitril or latex, dependent on solvent)
• Eppendorf® pipettes (1000, 100, and 10  µL, recently checked and
calibrated)
284 Protocols for Macroalgae Research

• Filtration pump system with vacuum control and Nalgene® tubing

• DURAN® filtering flasks (1 L, KECK™ assembly, Erlenmeyer shape)
with rubber seals (Figure 18.1)
• DURAN® dismountable filter holders (ø 50 mm, 250 mL top mani-
fold, sintered filter discs [Porosity 4], FKM seals, PP outlet funnel)
(Figure 18.1a)
• Tweezers
• 25 mL glass beaker
• TissueLyser II (QIAGEN, max. speed: 30 frequencies s−1)
• Lyophilizer
• Polytetrafluoroethylene (PTFE) tubing (ø 0.8  mm, each ~30  cm)
(Figure 18.1b)
• Vortex mixer
• Ultrasonic bath
• Centrifuge (with temperature control, up to 30,000 × g)
• Vacuum evaporation facility (desiccator) and vacuum diaphragm
pump (down to 7 mbar, with vacuum control, connected to argon)
• Precision balance (±0.1 mg)

Top manifold

Outlet funnel, SPE column

filter disc, Nalgene® tubing
seals
Rubber seals
PTFE tubing
KECKTM assembly

Nalgene® tubing

Filtering flask Filtering flask

(a) (b)

Figure 18.1 Setup of filtration system (a) and filtrate extraction system (b).
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 285

• Hamilton® glass syringes (100 µL)

• Heating block (for 1.5 mL vials)

18.3.3 Consumables
• Eppendorf® pipette tips (blue, yellow, and white)
• Eppendorf® centrifuge tubes (1.5 mL, 2 mL)
• Whatman® glass microfiber filters (ø 47 mm, grade GF/C)
• SPE columns CHROMABOND® Easy (3 mL, 200 mg, Macherey–Nagel)
• Metal beads (ø 3 mm, stainless steel)
• Centrifuge tubes (15 mL)
• Glass screw neck vials both 1.5 and 4 mL, the 1.5 mL vials have to fit
GC–MS or LC–MS autosamplers
• Glass inserts for 1.5 mL vials (200 µL) with metal springs compatible
with autosamplers
• Screw caps for 1.5 and 4 mL vials with septa (PTFE coated)
• Liquid nitrogen

18.3.4 Solution recipes

The following solutions have to be prepared in advance (Tables 18.1
through 18.4):

Table 18.1 Extraction solution

Quantity to add
Composition Final ratio (ν:ν:ν) (for 10 mL final solution)
Methanol 1 2 mL
Ethanol 3 6 mL
Chloroform 1 2 mL
Note: Prepare daily and precool at −20°C before use. During cell sampling, store on ice to
ensure an ice-cold solution for extraction. The composition is optimized for diatom
cells (Skeletonema marinoi) and was suitable for the extraction of other marine organ-
isms but can be adjusted to ensure optimal metabolite extraction if using organisms
with specific mechanical or chemical properties.

Table 18.2 Column elution solution

Quantity to add
Composition Final ratio (ν:ν:ν) (for 20 mL final solution)
Methanol 1 10 mL
THF 1 10 mL
Note: Store in inert containers (ideally glass sealed with PTFE caps). The composition can be
adjusted to ensure optimal elution of the SPE column.
286 Protocols for Macroalgae Research

Table 18.3 Internal standard (IS) solution

Final Quantity to add (for 1 mL final
Composition concentration solution)
Ribitol or 13C6-sorbitol 4 mM 100 µL of stock solution at 40 mM
Water – 900 µL
Note: Prepare a 40 mM stock solution by dissolving 24.9 mg ribitol (>99%, Sigma-Aldrich) in
water. Store stock and working solution at −20°C in inert containers (ideally glass
sealed with PTFE caps). Thaw before use. The polyol ribitol serves as IS in this protocol
as it has not been reported from marine algae thus far. However, it has been shown in
bacteria, fungi, plants, and green microalgae (Bieleski 1982). Here, isotopically labeled
ISs are recommended such as 13C6-sorbitol (Bölling and Fiehn 2005). Both the final con-
centration and composition of the IS can be adjusted with regard to the experiment.

Table 18.4 Retention time index (RI) solution

Final Quantity to add (for 1 mL
Composition concentration final solution)
Decane, C10H22 1 mM 10 µL of stock solution at 100 mM
Pentadecane, C15H32 1 mM 10 µL of stock solution at 100 mM
Nonadecane, C19H40 1 mM 10 µL of stock solution at 100 mM
Docosane, C22H46 1 mM 10 µL of stock solution at 100 mM
Octacosane, C28H58 1 mM 100 µL of stock solution at 10 mM
Dotriacontane, C32H66 1 mM 100 µL of stock solution at 10 mM
Hexatriacontane, C36H74 0.5 mM 100 µL of stock solution at 5 mM
Hexane – 660 µL
Note: Prepare stock solutions for n-alkanes from C10 to C36 (all >99%, Sigma-Aldrich) in
hexane. Stock and working solutions are stored at −20°C and thawed before use. The
RI solution is used to calculate system-independent retention times, which is, for
example, necessary for comparison with externally measured reference compounds
and thus metabolite identification. Final concentration and composition can be
adjusted with regard to the experiment.

18.3.5 Instrumental setup

Common GC–MS (and LC–MS) instruments can be used. The described
procedure can be easily adjusted to the available instrumentation.

GC–MS instrument: Agilent 6890N gas chromatograph, equipped

with Agilent 7683B autosampler, coupled to Waters® Micromass
GCT Premier™ mass spectrometer (orthogonal acceleration
time-of-flight MS).
Injection parameters: 1 µL injection volume, split/splitless injector at
300°C, splitless to split 10 mode (can be adapted to sample and instru-
ment properties), deactivated Agilent split liner (4 × 6.3 × 78.5 mm
inner ø × outer ø × length) with glass wool.
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 287

GC parameters: Constant helium (5.0) flow at 1 mL min−1, Agilent J&W

DB-5ms column (30  m, 0.25  mm internal diameter, 0.25  µm film
thickness, 10 m Duraguard precolumn), oven temperature program:
60°C for 1 min, ramp to 310°C at 15°C min−1, 310°C for 10 min.
MS parameters: Electron impact source (70  eV) at 300°C, scan rate of
5 scans s−1, dynamic range extension mode, resolution of >6000 at
m/z 501.97.

18.4 Experimental procedures

In the following section, all steps from sampling to statistical analysis are
described in detail (Figure 18.2). Preceding steps such as the design of
the experimental setup are not in focus of this protocol. It is, however,

1) Research question
Control group, Treatment group(s), n = 5 for each
2) Experimental design Blank samples, n = 3

3) Sample processing Section 18.4.1–18.4.5

1.3.2–3 Vacuum

3.2.1
100 mg 3.2.2–3
Freeze in
liquid N2, Add 5 μL IS sol.,
Lyophilize, Add 1 mL 3.2.4–5 3.2.6 3.2.7
Homogenize extraction sol. 10 min ultrasonic bath Transfer Dry with
15 min at 30,000 g/4°C supernatant to desiccator
1.1.4–6 3.1.1 1.5 mL glass vial
Transfer aliquot
Add 1 mL to centrifuge tube
extraction sol.,
Add 5 μL IS sol. Vacuum

Vacuum
Vacuum

2.5 2.6–7 2.8–9 2.12 2.13

1.1.3 Load SPE Wash with Elute with
Transfer Dry with
Filtrate through aliquot to desiccator
GF/C filter column 4 mL water, 2 mL methanol 1.5 mL
at 1 L h−1 Air-dry 2 mL elution sol. glass vial

4.3–5 4.8–9 4.12 4.13

Add 50 μL Add 50 μL Transfer to 5 min at 4500 g GC–MS
methoxyamine sol., MSTFA (+ RI sol.), insert-equipped (Transfer supernatant)
1 h at 60°C, 9 h at RT 1 h at 40°C glass vial

4) Data analysis Section 18.4.6

Spectral processing Data processing and statistics Structure elucidation

- Baseline correction - Blank subtraction - NIST data base
- Deconvolution - Normalization - External standards
- Peak alignment - Uni-/multivariate
- Peak integration statistical analyses

5) Biological interpretation/Hypothesis formulation/Bioassays

Figure 18.2   Metabolomics workflow for the analysis of intra- and extracellu-
lar metabolites of micro- and macroalgae by GC–MS. All numbers refer to steps
within the protocol.
288 Protocols for Macroalgae Research

recommended to set up at least five biological replicates. Further, the sam-

pling of blanks that should undergo identical treatment as the biological
samples is essential for the later identification of contaminants.

18.4.1 Sampling and metabolic quenching

The presented protocol was originally developed for metabolite profil-
ing of phytoplankton samples. Therefore, this section describes several
strategies for collecting algal biomass depending on its origin, including a
sampling of single-celled microalgae (Section 18.4.1.1), of single-cell stages
of macroalgae (Section 18.4.1.2), and of the whole thalli (Section 18.4.1.3).
As metabolites underlie diurnal fluctuations, the sampling time should be
identical for all replicates. Until metabolic quenching (arresting the meta-
bolic activity), all steps have to be conducted as rapidly as possible to pre-
vent metabolic alterations.

18.4.1.1 Filtration of planktonic single-celled algae

1. Gently shake the culture to homogeneously distribute the cells.
2. Collect aliquots for cell counting (Note 1), bioassays, or collection of
other metadata if needed.
3. Filter a determined culture volume (Note 2) under reduced pressure
(~600  mbar) through a GF/C filter. The filter should not run dry.
Keep the filtrate at 4°C until SPE (see Section 18.4.2.).
4. Immediately transfer the wet filter to a 25 mL glass beaker.
5. Immediately quench the metabolism by quickly resuspending the
cells in 1 mL cold (−10°C) extraction solution. Therefore, rinse cells
as far as possible off the filter by repeatedly pipetting the extraction
solution over the filter. Transfer the suspension into a 1.5  mL
centrifuge tube.
6. Add 5 µL IS solution and vortex 10 s.
7. Store the sample on ice.
8. Repeat steps 3–7 for all replicates. Continue with step 4 in Section
18.4.1.3.

18.4.1.2 Collection of algal gametes (of Ulva spp.)

1. Once gametes swarm out of the gametangium, they gather toward
the light. Collect, count, and transfer a volume equivalent to 5 × 106
gametes into 2  mL centrifuge tubes as described in Chapter 9 by
Califano and Wichard (2018).
2. Optional: Free swimming gametes can be sampled by centrifugation
(Note 3).
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 289

3. Once the gametes are attached to the 2  mL centrifuge tube wall

or are pelleted after centrifugation, remove the growth medium
with a pipette, and immediately freeze the sample in liquid nitro-
gen. Because of the low recovery rate of entire cells from surfaces,
the tube in which the gametes were grown should also be used for
extraction. Continue with step 4 in Section 18.4.1.3.

18.4.1.3 Collection of algal thalli

1. Gently clean the thalli. First, scrape off epiphytes with a scalpel and
then wash three times with autoclaved (filtered) seawater.
2. Collect about 100  mg fresh weight of a specific tissue (e.g., blade
tissue or rhizoid, cut with a scalpel) in a 2 mL centrifuge tube and
immediately freeze in liquid nitrogen.
3. Remove remaining water by lyophilization at 0.001 mbar at −50°C
until completely dry.
4. Optional: Samples can be stored at −20°C for a few days and −80°C
for several weeks.
5. Samples are ready for extraction (see Section 18.4.3).

18.4.2 Solid-phase extraction of extracellular metabolites

The extraction of extracellular metabolites from the filtrates can be done
in parallel for all replicates. Therefore, randomize the samples.

1. Condition a CHROMABOND® Easy column directly before use.

Therefore, pipette 4 mL methanol onto the column and let it flow by
gravity into a waste vial.
2. Wash the column with 4 mL water. Let it flow by gravity into a waste
vial.
3. Take out all filtrates from the fridge (step 3 in Section 18.4.1.1) and
place them on ice.
4. Connect the PTFE tube in line with the column. Place the PTFE tube
into the filtration flask containing the filtrate and connect the col-
umn with the vacuum system.
5. Pass the sample slowly through the column at a flow rate of ~1 L h−1.
6. Disconnect the column from the PTFE tube and wash the column
with 4 mL water.
7. Air-dry the column with the vacuum system. Dry column adsorbent
is bright red again.
8. Elute the column by gravity with 2 mL methanol into a 4 mL glass vial.
9. Elute in the second step with 2 mL column elution solution into the
same vial.
290 Protocols for Macroalgae Research

10. Add 5 µL IS solution, close the vial, and vortex for 10 s.
11. Optional: Samples can be stored at −20°C for a few days and at −80°C
for several weeks.
12. Transfer for each sample an aliquot of 1.5 mL into a 1.5 mL glass vial.
For LC–MS see Note 4.
13. Evaporate to dryness under vacuum using a desiccator (Note 5).
Reduce the pressure from ambient pressure to 0 mbar considering
solvent boiling points (Note 6).
14. Vent the desiccator slowly with dry air or argon (Note 7) and imme-
diately close all vials.
15. Samples are ready for derivatization (see Section 18.4.4).

18.4.3 Extraction of intracellular metabolites

The extraction of intracellular metabolites can be carried out in par-
allel for all replicates. Therefore, randomize the samples. Depending
on the cell-wall morphology of the studied organism, different cell
disruption methods might be suitable of which two are described in
this section.

Optional: Thaw samples from step 4 in Section 18.4.1.3 (or directly

use samples from step 5 in Section 18.4.1.3).

18.4.3.1 Cell disruption by ultrasound treatment

1. Vortex the samples for 30 s. Transfer an aliquot equivalent to ~5 × 107
cells into a new 1.5 mL centrifuge tube (Note 2).
2. Add extraction solution to reach an adequate cell-to-solvent ratio
that is ideally equivalent to a cell density of ~5 × 105 cells µL−1 sol-
vent. Continue with step 4 in Section 18.4.3.2.

18.4.3.2 Cell disruption with a bead mill

1. Place the centrifuge tubes in a precooled (−80°C) TissueLyser II tube
support. Add two metal beads per tube, close again, and disrupt the
cells using the TissueLyser II for 30 s at a frequency of 30 s−1 (Note 8).
During this procedure, the sample will remain frozen.
2. Add 5 µL IS solution.
3. Add 1 mL extraction solution to each sample and vortex vigorously
to homogenize the sample and allow a more uniform extraction.
4. Place the samples for 10 min into an ultrasonic bath.
5. Centrifuge the samples at 30,000 × g for 15 min at 4°C.
6. Transfer the debris-free supernatants into 1.5  mL glass vials.
For LC–MS analysis see Note 4.
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 291

7. Evaporate to dryness under vacuum using a desiccator (Note 5).

Reduce the pressure from ambient pressure to a 0 mbar setting con-
sidering solvent boiling points (Note 6).
8. Optional: Traces of salt from the medium will precipitate as crystals
that restrain water molecules. Thus, keep the pressure setting at
0 mbar for an additional hour to ensure an entirely dry sample.
9. Vent the desiccator slowly with dry air or argon (Note 7) and imme-
diately close all vials.
10. Samples are ready for derivatization (see Section 18.4.4).

18.4.4 Two-step-derivatization for GC–MS analysis

To analyze a broad range of metabolites by GC–MS, the volatility and ther-
mostability of some substance classes need to be enhanced by derivatiza-
tion. In a first step, ketones and aldehydes are derivatized to oximes, and
then functional groups such as −OH, −NH2, −SH, or −COOH as present
in, for example, sugars, fatty acids, or amino acids are chemically deriva-
tized by silylation. Directly use the dried samples from step 15 in Section
18.4.2 or step 10 in Section 18.4.3.2.

11. Prepare the methoxyamine solution immediately before derivatiza-

tion. Weigh 20 mg dried methoxyamine hydrochloride in a 1.5 mL
glass vial.
12. Add 1 mL pyridine, close the vial, and ensure complete dissolution
by sonication in an ultrasonic bath for at least 5 min.
13. Pipette 50 µL methoxyamine solution to each sample (a maximum of
20 samples is recommended, Note 9, and immediately close the vials.
Vortex 60 s to redissolve the extract.
14. Incubate at 60°C for 1 h.
15. Subsequently incubate at room temperature for 9  h (up to 16  h,
Note 10).
16. Prepare the silylation solution. Therefore, remove a new vial of
MSTFA from the fridge, and let it warm up to room temperature.
Thaw and vortex the RI solution.
17. Add with a glass syringe 40 µL RI solution to 1 mL MSTFA and vor-
tex the vial. Rinse the syringe with hexane after use.
18. Add with a glass syringe 50  µL silylation solution to each sample.
Prevent any cross-contamination between samples. Rinse the
syringe with acetone after use.
19. Incubate at 40°C for 1 h (Note 11).
20. Let the samples cool down to room temperature.
21. Optional: In the case of condensation along the glass, briefly centri-
fuge the vials (~5 s).
22. Transfer each sample into a glass insert and close the vial.
292 Protocols for Macroalgae Research

23. Centrifuge all samples at 8000 × g for 5 min using 15 mL centrifuge
tubes padded with a cloth as vial mounting. In the case of precipitate
formation, transfer the supernatant into a new glass insert.
24. Analyze the batch of samples immediately (Note 9) by GC–MS
(see Section 18.4.5.).

18.4.5 GC–MS analysis

1. Directly use the derivatized samples from step 24 in Section 18.4.4.
2. Analyze each batch of samples in a random order to diminish,
for example, a potential systematic effect of increasing time delay
between silylation and injection. For analysis details, see the
Instrumental setup.
3. Run air injections before, in between, and after each batch to check
for contaminations.
4. Use a new glass liner every 21 injections or if air injections indicate
contamination.
5. For data analysis see Section 18.4.6.

18.4.6 Data analysis for GC–MS data

In the following protocol, a canonical analysis of principal coordinates
(CAP, Anderson and Willis 2003) is used to investigate metabolic altera-
tions. In comparison with other common multivariate statistical analy-
ses, CAP is less sensitive to hidden correlations within the dataset
(McCune et al. 2002), which are a direct result from metabolites generat-
ing multiple peaks, for example, due to different levels of derivatization.
Alternatively,  a  range of online platforms is available offering different
data processing and analysis strategies. These include MetaboAnalyst
(Xia et al. 2009; see Figure 18.3e), XCMS Online (Tautenhahn et al. 2012;
see Figure 18.3d), and Workflow4Metabolomics (Giacomoni et al. 2015).
The following workflow is also applicable to LC–MS data after adaptation
of the peak detection procedure (Alsufyani et al. 2017).

1. Conduct a background-noise correction for each chromatogram

using, for example, the CODA tool of MassLynx  4.1 (Waters,
MCQ = 0.8, Smoothing window = 5).
2. Convert the raw data files into NetCDF (.cdf), for example, by using
the Databridge tool of MassLynx 4.1.
3. Deconvolute all chromatograms with AMDIS 2.71 (nist, http://
chemdata.nist.gov/, 2012) with the following parameters: minimum
match factor = 30, type of analysis = simple, low/high m/z = auto,
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 293

CAP—Sigma Plot XCMS Online—MetaboAnalyst

(a) PCo—score plot (d) Cloud plot

20
1000
750
500
PC 2 (15.8%)

10
250
0

m/z
−250
0 −500
−750
−1000
−10 0 5 10 15 20 25 30
Retention time (min)

−20 −10 0 10 20 30
PC 1 (50.7%)
(b) CAP DA—score plot (e) Heatmap plot

20 78 1
0.5
0
−0.5
10
−1
Component 2

599
0

−10

−20

−10 −5 0 5 10 15
Component 1

(c) CAP DA—vector plot (f) Box—Whiskers plot

1.0

0.8
Correlation with component 2

0.6
78 599
0.4 1.0 1.0
Peak intensity

0.5 0.5
0.2 0 0
−0.5
0 −0.5
−1.0
−1.0
−0.2
A B A B
−0.4

−0.6
−1.5 −1.0 −0.5 0 0.5 1.0 1.5
Correlation with component 1

Figure 18.3 Statistical data analysis approaches for untargeted metabolomics

datasets. A combination of unsupervised (a) and supervised (b, c) multivariate
analyses with univariate analyses (d) is recommended. Selected metabolites of
interest can be further described with heat maps (e) or box plots (f). (Continued)
294 Protocols for Macroalgae Research

Figure 18.3 (Continued) All plots were generated from a dataset that was
obtained by GC–MS analysis of the macroalga Ulva mutabilis with either three
(a–c) or two (d–f) treatment groups (n = 4). Score plots of (a) principal coordinate
analysis and (b) CAP show the separation of sample groups. The vector plot of
the CAP (c) and the t-test-based cloud plot (d, from XCMS Online) indicate char-
acteristic metabolites. These selected metabolites can be visualized semiquan-
titatively with a heat map (e, from MetaboAnalyst) or box plots (f, from XCMS
Online).

instrument type  =  quadrupole, component width  =  32, omitted

m/z = 147, 176, 193, 207, adjacent peak subtraction = 2, resolution = low,
sensitivity = medium, shape requirement = low, column bleed = 207.
Run one batch job each for extra- and intracellular samples.
4. Integrate the deconvoluted peaks with MET-IDEA  2.08 (http://
bioinfo.noble.org, 2012). Select the chromatogram with the highest
number of deconvoluted components as ion file and the following
parameters for peak integration: chromatography  =  GC, average
peak width  =  0.08, minimum peak width  =  0.5, maximum peak
width = 2, peak start/stop slope = 1.5, adjusted retention time accu-
racy = 0.25, peak overload factor = 0.9, MS = TOF, mass accuracy = 0.1,
mass range  =  0.3, lower mass limit  =  100, ion per component  =  1,
exclude ion list = 73, 147, 281, 341, 415. In the output file, the peak area
of each variable as described by model ion (m/z) and retention time
(min) is listed for each sample.
5. Import the peak area file in Excel (Microsoft® Office, 2010). For each
variable, subtract the median area of all blanks from each sample.
Remove variables with a resulting negative peak area.
6. Normalize the data. Divide each peak area by the peak area of the
IS of the same sample. For intracellular metabolites, normalize to
extracted biomass (e.g., fresh weight) as well. For extracellular metab-
olites, normalize to the sum of all peak areas within one sample.
7. Export the dataset as a text file for further statistical analysis. Sample
and variable descriptors have to be omitted.
8. Perform a CAP with CAP12 (Anderson and Willis 2003, http://www.
esapubs.org/archive/ecol/E084/011/suppl-1.htm) by using the fol-
lowing parameters: transformation = none, standardization = none,
distance measure = Bray–Curtis dissimilarity, discriminant analysis
mode, number of principal coordinates axes chosen by the program,
999 random permutations test.
9. Display the resulting sample coordinates as score plot and the
metabolites as loading plot, for example, with SigmaPlot 13.0 (Systat
Softwares). Evaluate the principal coordinate analysis score plot
(Figure 18.3a) to detect sample outliers. Evaluate the CAP score plot
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 295

(Figure 18.3b) for correct sample groups. Use the correlation values
of the original variables with the CAP axes to generate a vector plot
(Figure 18.3c) and select highly correlated variables. Describe these
variables by their m/z and tR values (see Section 18.4.6, step 4).
10. Compare the mass spectra of all highly correlated variables as
extracted by AMDIS (see Section 18.4.6, step 4) with spectral libraries
using MS Search 2.0 (nist, http://chemdata.nist.gov/, 2005). A com-
mon commercial database is the NIST library. Other, noncommercial
alternatives are available which often focus on specific metabolites,
for example, the Golm-library for plant metabolites. Document the
quality of spectral comparison with the R-match value.
11. Compare the retention times of all highly correlated variables with
externally measured reference compounds by calculating nonlinear
retention indices (van den Dool and Kratz 1963). Follow Fiehn et al.
(2008) for metabolomics standards initiative-compliant identification.

18.5 Notes
For a successful untargeted metabolomic approach, the personal secu-
rity and sample protection against contaminants and chemical reactions
with H2O and O2 are essential. It is thus recommended to wear personal
protective equipment and work under fume hoods whenever necessary.
Moreover, read the material safety data sheets (MSDS) of all reagents and
follow the recommendations for correct disposal. As biological samples
are rather complex, avoid any contamination by humans or lab equipment
(e.g., fatty acids, plasticizers). It is thus advisable to wear gloves, use glass
or PTFE whenever possible, and rinse lab equipment with solvents before
use. For the same reason, blanks should be carried through the whole pro-
cedure. As the derivatization is moisture sensitive, all involved chemicals
and samples have to be dry, which is especially challenging for salt water
samples. Samples should be exposed to air as rarely as possible. Several
metabolites are labile. Therefore, work should be carried out without lon-
ger interruptions.

Note 1: For subsequent data normalization, it is important to determine

the amount of extracted biomass, for example, as cell count or fresh
weight. For a quantitative comparison or differential screening, it is
best to collect the same biomass among samples wherever possible.
Note 2: The sample volume should provide ~5 × 107 algal cells of a cell
volume of ~100 µm3 as tested for the diatom Skeletonema marinoi. With
~12 pg C cell−1 (Menden-Deuer and Lessard 2000), this cell number
equals ~0.6  mg  C. For other organisms, the required cell numbers
have to be determined in test runs or indirectly estimated on the
basis of the amount of carbon per cell.
296 Protocols for Macroalgae Research

Note 3: Alternatively, algal cells can be sampled by centrifugation. Cold

solvent quenching before centrifugation is necessary to prevent met-
abolic alterations during centrifugation (Bölling and Fiehn, 2005).
Note 4: At this stage, the samples can be directly used for LC–MS analy-
sis as described in Barofsky et al. (2009) and Alsufyani et al. (2017)
for extracellular extracts and in Barofsky et al. (2010) for cell extracts.
Therefore, transfer an aliquot of 100  µL into insert-equipped glass
vials and measure in one batch in randomized order.
Note 5: All solvents and water residues have to be evaporated before the
derivatization. This can be achieved with a desiccator but also under
a flow of nitrogen. Any sample contamination should, however, be
prevented.
Note 6: Pressure reduction results similarly to heating in solvent boil-
ing. In a desiccator, however, a boiling delay can occur. To avoid any
loss of extract because of this uncontrolled boiling, reduce the pres-
sure stepwise. Select the pressure steps at the boiling points of the
different solvents as listed elsewhere.
Note 7: To vent the desiccator with dry air, mount a CaCO3-filled col-
umn at the air inflow. Alternatively, argon can be used as shielding
gas as it is denser than air and inert.
Note 8: The speed (or the frequency) of the grinding has to guarantee
cell-wall disruption in a short period of time (before thawing) and
has to be optimized for the respective tissue in test runs.
Note 9: The batch size is limited to maximum 20 samples because of the
instability of the silylated samples. If, for example, standing in the
autosampler of a GC–MS instrument at room temperature, decom-
position would be substantial if more than 20 samples in a row
would be measured (Kanani et al. 2008). As one GC–MS run lasts
about 30 min, 20 samples can be analyzed within ~10 h. Biological
replicates should be randomized within one batch.
Note 10: The oximation depends both on reaction temperature and time.
To reduce the decomposition of, for example, sucrose and increase
derivatization efficiency, an oximation for 1  h at 60°C and 16  h at
room temperature was proposed by Gullberg et al. (2004). However,
to be able to work up two batches per day, the latter time is reduced
to 9  h without significant losses. With the addition of MSTFA, the
oximation reaction is quenched because of silylation of the reactive
amine group of methoxyamine.
Note 11: MSTFA is a strong trimethylsilyl group (TMS; Si[CH3]3) donor,
and thus a common silylation reagent. During the silylation reaction,
the active hydrogen of functional groups such as −OH, −NH, −NH2
−SH, and −COOH are replaced by a TMS group. As each functional
group has different reaction kinetics, a heating time of 1 h compro-
mises silylation efficiency and required reaction times.
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 297

Acknowledgments
We gratefully thank Alina Hera for her help in the Ulva mutabilis analysis.
Furthermore, we acknowledge Franziska Speck for testing protocol com-
prehensibility in the lab and Kathleen Thume for proofreading the manu-
script. The current work was supported by the Jena School of Microbial
Communication (CK, TW), by the Collaborative Research Center 1127
“Chemical Mediators in complex Biosystems” and CRC 1067 “AquaDiva”
(TW, GP) and by the European Union’s Horizon 2020 research and inno-
vation program under the Marie Sklodowska-Curie grant agreement No.
642575 (GC, TW, and GP).

References
Aldridge, B. B., and K. Y. Rhee. 2014. Microbial metabolomics: Innovation, applica-
tion, insight. Curr. Opin. Microbiol. 19:90–96.
Allen, A. E., J. Laroche, U. Maheswari et al. 2008. Whole-cell response of the pen-
nate diatom Phaeodactylum tricornutum to iron starvation. Proc. Nat. Acad. Sci.
105 (30):10438–10443.
Allwood, J. W., R. C. De Vos, A. Moing et al. 2011. Plant metabolomics and its
potential for systems biology research background concepts, technology,
and methodology. Methods Enzymol. 500:299–336.
Alsufyani, T., A. Weiss, and T. Wichard. 2017. Time course exo-metabolomic profiling
in the green marine macroalga Ulva (Chlorophyta) for identification of growth
phase-dependent biomarkers. Mar. Drugs 15 (1):14. doi: 10.3390/md15010014.
Álvarez-Sánchez, B., F. Priego-Capote, and M. D. Luque de Castro. 2010. Meta-
bolomics analysis II. Preparation of biological samples prior to detection.
TrAC, Trends Anal. Chem. 29 (2):120–127.
Anderson, M. J., and T. J. Willis. 2003. Canonical analysis of principal coordi-
nates: A useful method of constrained ordination for ecology. Ecology 84 (2):
511–525.
Barofsky, A., P. Simonelli, C. Vidoudez et al. 2010. Growth phase of the diatom
Skeletonema marinoi influences the metabolic profile of the cells and the selec-
tive feeding of the copepod Calanus spp. J. Plankton Res. 32 (3):263–272.
Barofsky, A., C. Vidoudez, and G. Pohnert. 2009. Metabolic profiling reveals
growth stage variability in diatom exudates. Limnol. Oceanogr.: Methods
7:382–390.
Becker, J., P. Berube, C. Follett et al. 2014. Closely related phytoplankton species
produce similar suites of dissolved organic matter. Front. Microbiol. 5 (111).
doi: 10.3389/fmicb.2014.00111.
Bieleski, R. L. 1982. Sugar alcohols. In Plant Carbohydrates I: Intracellular
Carbohydrates, (Eds.) F. A. Loewus and W. Tanner, pp. 158–192. Berlin,
Germany: Springer.
Bölling, C., and O. Fiehn. 2005. Metabolite profiling of Chlamydomonas reinhardtii
under nutrient deprivation. Plant Physiol. 139 (4):1995–2005.
Bromke, M. A., P. Giavalisco, L. Willmitzer, and H. Hesse. 2013. Metabolic analy-
sis of adaptation to short-term changes in culture conditions of the marine
diatom Thalassiosira pseudonana. PLoS One 8 (6):e67340.
298 Protocols for Macroalgae Research

Califano, G., and T. Wichard. 2018. Preparation of axenic cultures in Ulva

(Chlorophyta). In Protocols for Macroalgae Research, (Eds.) B. Charrier,
T.  Wichard, and C.R.K. Reddy, Chapter 9. Boca Raton, FL: CRC Press, Taylor &
Francis Group.
Dittami, S. M., A. Gravot, D. Renault et al. 2011. Integrative analysis of metabolite
and transcript abundance during the short-term response to saline and oxi-
dative stress in the brown alga Ectocarpus siliculosus. Plant Cell Environ. 34
(4):629–642.
Dunn, W. B. 2008. Current trends and future requirements for the mass spec-
trometric investigation of microbial, mammalian and plant metabolomes.
Phys. Biol. 5 (011001).
Fiehn, O. 2008. Extending the breadth of metabolite profiling by gas chromatog-
raphy coupled to mass spectrometry. TrAC-Trend. Anal. Chem. 27 (3):261–269.
Fiehn, O., J. Kopka, P. Dormann, T. Altmann, R. N. Trethewey, and L. Willmitzer.
2000a. Metabolite profiling for plant functional genomics. Nat. Biotechnol.
18 (11):1157–1161.
Fiehn, O., J. Kopka, R. N. Trethewey, and L. Willmitzer. 2000b. Identification of
uncommon plant metabolites based on a calculation of elemental composi-
tions using gas chromatography and quadrupole mass spectrometry. Anal.
Chem. 72 (15):3573–3580.
Fiehn, O., G. Wohlgemuth, M. Scholz et al. 2008. Quality control for plant metabo-
lomics: Reporting MSI-compliant studies. Plant J. 53 (4):691–704.
Giacomoni, F., G. Le Corguille, M. Monsoor et al. 2015. Workflow4Metabolomics:
A collaborative research infrastructure for computational metabolomics.
Bioinformatics 31 (9):1493–1495.
Gillard, J., J. Frenkel, V. Devos et al. 2013. Metabolomics enables the structure elu-
cidation of a diatom sex pheromone. Angew. Chem. Int. Edit. 52 (3):854–857.
Goulitquer, S., P. Potin, and T. Tonon. 2012. Mass spectrometry-based metabo-
lomics to elucidate functions in marine organisms and ecosystems. Mar.
Drugs 10 (4):849–880.
Gravot, A., S. M. Dittami, S. Rousvoal et al. 2010. Diurnal oscillations of metabolite
abundances and gene analysis provide new insights into central metabolic
processes of the brown alga Ectocarpus siliculosus. New Phytol. 188 (1):98–110.
Gullberg, J., P. Jonsson, A. Nordström, M. Sjöström, and T. Moritz. 2004. Design of
experiments: An efficient strategy to identify factors influencing extraction
and derivatization of Arabidopsis thaliana samples in metabolomic studies
with gas chromatography-mass spectrometry. Anal. Biochem. 331 (2):283–295.
Kanani, H., P. K. Chrysanthopoulos, and M. I. Klapa. 2008. Standardizing GC-MS
metabolomics. J. Chromatogr. B: Anal. Technol. Biomed. Life Sci. 871 (2):191–201.
Kanani, H. H., and M. I. Klapa. 2007. Data correction strategy for metabolomics
analysis using gas chromatography-mass spectrometry. Metab. Eng. 9 (1):
39–51.
Krug, D., and R. Müller. 2014. Secondary metabolomics: The impact of mass
spectrometry-based approaches on the discovery and characterization of
microbial natural products. Nat. Prod. Rep. 31 (6):768–783.
Kuhlisch, C., J. Althammer, A. F. Sazhin, H. H. Jakobsen, J. C. Nejstgaard, and
G. Pohnert. Metabolomics-derived marker metabolites to characterize
Phaeocystis pouchetii in natural plankton communities. submitted.
Kuhlisch, C., and G. Pohnert. 2015. Metabolomics in chemical ecology. Nat. Prod.
Rep. 32 (7):937–955.
Chapter eighteen: Metabolomics of intra- and extracellular metabolites 299

Lee, D. Y., and O. Fiehn. 2008. High quality metabolomic data for Chlamydomonas
reinhardtii. Plant Methods 4. doi: 10.1186/1746-4811-4-7.
Lisec, J., N. Schauer, J. Kopka, L. Willmitzer, and A. R. Fernie. 2006. Gas chro-
matography mass spectrometry-based metabolite profiling in plants. Nat.
Protocols 1 (1):387–396.
Longnecker, K., M. C. K. Soule, and E. B. Kujawinski. 2015. Dissolved organic mat-
ter produced by Thalassiosira pseudonana. Mar. Chem. 168:114–123.
Mausz, M. A., and G. Pohnert. 2015. Phenotypic diversity of diploid and haploid
Emiliania huxleyi cells and of cells in different growth phases revealed by
comparative metabolomics. J. Plant Physiol. 172:137–148.
McCune, B., J. B. Grace, and D. L. Urban. 2002. Analysis of Ecological Communities.
2 ed., Vol. 28. Gleneden Beach, Oregon: MjM software design.
Menden-Deuer, S., and E. J. Lessard. 2000. Carbon to volume relationships for
dinoflagellates, diatoms, and other protist plankton. Limnol. Oceanogr.
45 (3):569–579.
Minor, E. C., M. M. Swenson, B. M. Mattson, and A. R. Oyler. 2014. Structural char-
acterization of dissolved organic matter: A review of current techniques for
isolation and analysis. Environ. Sci. Process Impacts 16 (9):2064–2079.
Nylund, G. M., F. Weinberger, M. Rempt, and G. Pohnert. 2011. Metabolomic
assessment of induced and activated chemical defence in the invasive red
alga Gracilaria vermiculophylla. PLoS One 6 (12):e29359.
Ritter, A., L. Cabioch, L. Brillet-Guéguen et al. 2017. Herbivore-induced chemical
and molecular responses of the kelps Laminaria digitata and Lessonia spicata.
PLoS One 12 (3):e0173315.
Ritter, A., S. M. Dittami, S. Goulitquer et al. 2014. Transcriptomic and metabolomic
analysis of copper stress acclimation in Ectocarpus siliculosus highlights sig-
naling and tolerance mechanisms in brown algae. BMC Plant Biol. 14 (1):116.
Roessner, U., C. Wagner, J. Kopka, R. N. Trethewey, and L. Willmitzer. 2000.
Technical advance: Simultaneous analysis of metabolites in potato tuber by
gas chromatography-mass spectrometry. Plant J. 23 (1):131–142.
Saccenti, E., H. C. J. Hoefsloot, A. K. Smilde, J. A. Westerhuis, and M. M. W. B.
Hendriks. 2014. Reflections on univariate and multivariate analysis of
metabolomics data. Metabolomics 10 (3):361–374.
Schroeder, F., and G. Pohnert. 2017. Editorial overview: Omics techniques to map
the chemistry of life. Curr. Opin. Chem. Biol. 36:v–vi.
Tautenhahn, R., G. J. Patti, D. Rinehart, and G. Siuzdak. 2012. XCMS Online:
A web-based platform to process untargeted metabolomic data. Anal. Chem.
84 (11):5035–5039.
van den Berg, R. A., H. C. Hoefsloot, J. A. Westerhuis, A. K. Smilde, and
M. J. van der Werf. 2006. Centering, scaling, and transformations: Improving
the biological information content of metabolomics data. BMC Genomics
7:142. doi: 10.1186/1471-2164-7-142.
van den Dool, H., and P. D. Kratz. 1963. A generalization of retention index system
including linear temperature programmed gas-liquid partition chromatog-
raphy. J. Chromatogr. 11 (4):463–471.
Vidoudez, C., and G. Pohnert. 2012. Comparative metabolomics of the diatom
Skeletonema marinoi in different growth phases. Metabolomics 8 (4):654–669.
Wagner, C., M. Sefkow, and J. Kopka. 2003. Construction and application of a
mass spectral and retention time index database generated from plant
GC-EI-TOF-MS metabolite profiles. Phytochemistry 62 (6):887–900.
300 Protocols for Macroalgae Research

Weinberger, F., U. Lion, L. Delage et al. 2011. Up-regulation of lipoxygenase, phos-

pholipase, and oxylipin-production in the induced chemical defense of the
red alga Gracilaria chilensis against epiphytes. J. Chem. Ecol. 37 (7):677–686.
Winder, C. L., W. B. Dunn, S. Schuler et al. 2008. Global metabolic profiling of
Escherichia coli cultures: An evaluation of methods for quenching and
extraction of intracellular metabolites. Anal. Chem. 80 (8):2939–2948.
Xia, J. G., N. Psychogios, N. Young, and D. S. Wishart. 2009. MetaboAnalyst: A web
server for metabolomic data analysis and interpretation. Nucleic Acids Res.
37:W652–W660.
chapter nineteen

Preparative extraction
of exometabolites from
seaweed surfaces
Florian Weinberger

Contents
19.1 Introduction ......................................................................................... 301
19.2 State of the art ...................................................................................... 302
19.3 Materials ............................................................................................... 304
19.4 Experimental procedures ................................................................... 304
19.4.1 Development of extraction protocol ................................... 304
19.4.2 Determination of algal surface/mass ratio........................ 305
19.4.3 Extraction ............................................................................... 306
19.5 Notes ..................................................................................................... 307
References........................................................................................................ 307

19.1 Introduction
The surface chemistry of seaweeds and other marine organisms is of
increasing interest in biotechnology and ecology. The molecular compo-
nents that are released, taken up, or perceived by an alga reflect all its
interactions with the biotic and abiotic environment. For this reason, these
compounds are often carriers of ecologically or physiologically important
functions. In particular, the relationships between algal hosts and com-
patible and noncompatible epibionts are often (if not always) driven by
molecular communication, and they typically involve chemical deterrents
or cues. Marine biotechnology increasingly targets such compounds for
antifouling applications. At the same time, ecologists studying seaweed–
epibiont interactions also aim to identify compounds that are bioactive
when they are present on macroalgal surfaces at physiological concentra-
tion. In particular, the second goal requires extraction methods that yield
surface metabolites and exclude tissue metabolites. Solid-phase extrac-
tion (SPE) is available to prepare relatively small samples for sensitive

301
302 Protocols for Macroalgae Research

analytical approaches, such as LC–MS or GC–MS (Chapter 20 by Cirri and

Pohnert 2017). However, surface metabolites are often required in larger
quantities or even in bulk amounts, for example, when they are to be
tested for bioactivities or when they need to be purified for less-sensitive
analytical approaches, such as NMR spectroscopy. Under such condi-
tions, SPE is usually not affordable, and approaches based on the solvent
extraction are required: The seaweed to be extracted is dipped alive into
an organic solvent (de Nys et al. 1998). Organic solvents generally have a
stronger capacity to dissolve lipids than water. However, a destruction
of the outer membranes of epidermal cells—which are primarily com-
posed of lipids—has to be prevented if only surface and not intracellular
metabolites are to be extracted. At the same time, the sensitivity of marine
macrophytes to organic solvents differs, and specific techniques need to
be developed for each target organism. The current chapter provides a
general protocol for the development of large-scale preparative surface
extraction methods.

19.2 State of the art

Solvent surface-extraction protocols have already been published for
brown and red, but not for green macroalgae (Table 19.1). The resistance
of any seaweed to an organic solvent depends on (a) the nature of the
solvent; (b) the exposure time; and (c) certain traits of the alga, such as the
structure of the outer cell wall. Main constituents of the outer cell wall
are usually polysaccharides. On account of their polar character, polysac-
charides exclude nonpolar solvents more than those that are polar. As a
consequence, nonpolar solvents such as hexane are generally tolerated for
longer exposure times than dichloromethane or even more polar solvents
(Table 19.1). However, the nonpolar character of hexane also implicates
that it can only extract nonpolar surface compounds, which may exclude
many relevant metabolites (Saha et al. 2012). In most cases, it will be neces-
sary to overcome this limitation, which can often be achieved if hexane is
mixed with a more polar solvent and the exposure time is reduced. Thus,
the resistance of the target seaweed to various solvents during various
exposure times has to be compared to identify an optimal combination of
nondetrimental extraction even of less unpolar compounds. The follow-
ing protocol for the development of an extraction method has so far been
successfully employed for brown (Saha et al. 2011) and red (Wang et al.
2016) seaweeds, and for the seagrass Zostera marina (Guan, unpublished).
Different approaches have already been used to evaluate the intactness
of epidermal cells after solvent treatment (see references in Table 19.1). The
following protocol uses Evans Blue to stain damaged cells. Evans Blue can-
not cross intact plasma membranes and has a high affinity to proteins, which
are much more abundant within cells than in the extraplasmatic  space.
Chapter nineteen: Preparative extraction of exometabolites from seaweed 303

Table 19.1 Exposure times to different organic solvents that are tolerated
before epidermal cells of seaweeds are disrupted
Species Solvent Time (s) Reference
(A) Rhodophyta
Laurencia obtusa Hexane 60 or less de Nys et al. (1998)
DCM, DE, EA, and <10 de Nys et al. (1998)
MeOH
Laurencia rigida 1% or less DCM in 30 Nylund et al. (2007)
hexane
1% DCM in hexane 30 or less Nylund et al. (2007)
Delisea pulchra Hexane 40 or less Nylund et al. (2007)
DCM, DE, EA, and <10 de Nys et al. (1998)
MeOH
Pterocladia capillacea Hexane 40 or less Nylund et al. (2007)
Solieria robusta Hexane 40 or less Nylund et al. (2007)
Gracilaria 25% DCM in hexane 5 or less Wang et al. (2016)
vermiculophylla

(B) Phaeophyta
Dictyopteris 4% or less DCM in 30 Nylund et al. (2007)
acrostichoides hexane
4% DCM 40 or less Nylund et al. (2007)
Dilophus marginatus 6% or less DCM in 30 Nylund et al. (2007)
hexane
6% DCM in hexane 40 or less Nylund et al. (2007)
Taonia atomaria MeOH 15 or less Othmani et al. (2016)
50% MeOH in DCM 20 or less Othmani et al. (2016)
Fucus vesiculosus 4% DCM in hexane 40 or less Brock et al. (2007)
50% MeOH in hexane 5 or less Lachnit et al. (2010)
50% MeOH in hexane 10 or less Saha et al. (2011)
Fucus serratus 50% MeOH in hexane 5 or less Rickert et al. (2016)
Note: DCM = Dichloromethane, DE = Diethyl ether, EA = Ethyl acetate, MeOH = Methanol.

As a consequence, damaged and intact cells can be easily distinguished

by microscopic observation after application of Evans Blue (Weinberger
et al. 2005; Saha et al. 2011; Wang et al. 2016).
Once a reliable extraction protocol is available, concentrations of
obtained extracts need to be related to the extracted surfaces. The size of
these surfaces is strongly dependent on algal morphology. Surface areas
(SA) can be determined through analysis of thallus projections (TP), which
may be generated with a standard flatbed scanner. Scanning each sample
before extraction is usually impossible because the scanning procedure
304 Protocols for Macroalgae Research

comes along with air exposure, temperature increase, and exposure to

intense light, which may affect the extraction result. However, algal SA
are—within species and life-cycle stage—to some degree correlated with
mass. As a consequence, mean surface/mass ratios can be determined and
used to calculate approximate SA from fresh weights.

19.3 Materials
• Algal samples to be extracted should be generally collected and
maintained under low-stress conditions. Desiccation, temperature
shock, or salinity shock have to be prevented for obvious reasons.
If different age cohorts, sexes, or populations are to be studied with
the final protocol (see 19.4.3), make sure that they are all investigated
during the preparatory steps (19.4.1 and 19.4.2), as they could differ
in their sensitivities.
• Sufficient amounts of cooled natural seawater to allow for repeated
rinsing and interim maintenance of sample seaweeds (Note 1).
• Salad spinner.
• Balance.
• Vent hood.
• Magnetic stirrer.
• Glass beakers (size adapted to the size of seaweeds to be extracted).
• Organic solvent.
• Natural seawater containing 0.05 % w/v of Evans Blue (20  mL per
sample).
• Rack with test tubes for incubation during staining (20 mL).
• Large- and medium-sized forceps.
• Stopwatch.
• Microscope with glass slides.
• Flatbed scanner.
• Imaging software (e.g., Fiji, a free software package available for
Windows, MacOS, Linux, and other systems [Schindelin et al. 2012]).
• Ruler.
• Filtration devise with glass microfiber filters.
• Evaporator.
• Lyophilizer.

19.4 Experimental procedures

19.4.1 Development of extraction protocol
All extractions should be carried out in a vented hood with clean equip-
ment. Apart from the solvent treatment itself examined, algae need to be
maintained at low-stress conditions (Note 1).
Chapter nineteen: Preparative extraction of exometabolites from seaweed 305

1. Water removal: To remove adhering water, spin an algal individual

for 60 s in a salad spinner at full speed. Do not blot with paper or a
towel, as this might remove surface compounds.
2. Extraction: Dip algae individually for a defined time (stop seconds)
into a beaker containing stirred solvent. Tissue cuts should not get into
contact with the solvent, as this would result in extraction of tissue
metabolites.
3. Coarse rinsing: Immediately after performing step 2, throw the alga
into a large beaker containing seawater to remove the solvent. Move
it vigorously with a large forceps for some seconds.
4. Fine rinsing: Immediately after performing step 3, sample a thallus
section (approximately 5 cm), and rinse it further in a second beaker
containing seawater.
5. Staining: Immediately after performing step 4, introduce the thallus
section into a vial containing 20 mL of seawater with the addition
of Evans Blue (0.05 % w/v). Incubate 30 min at low-stress conditions
(darkness, suitable temperature).
6. Removal of excess dye: Rinse stained thallus section in fresh seawater.
7. Microscopic observation: Take photos and compare the staining result
to negative controls (=unextracted algae) and positive controls
(=algae placed for 5 min into pure methanol).
8. Repeat step 1 to step 6 with various solvents (Note 2) and for different
extraction times, always with naïve algal individuals. Treatments
are always resulting in the same staining result as negative controls
are treatments that do not damage epidermal cells and that may be
used in the following steps.

19.4.2 Determination of algal surface/mass ratio

Once a reliable extraction protocol is available, concentrations of obtained
extracts usually need to be related to the extracted surfaces. These are
strongly dependent on the algal morphology but can be determined from
TP as follows:

1. Selection of algae: At least 10 individuals should be examined. If groups

are to be compared that may potentially differ in their surface/mass
ratios (e.g., populations, age cohorts, or sexes), each of these groups
should be examined separately.
2. Water removal: Remove adhering water by using the same technique
as in 19.4.3.1 below (spinning individuals for 60 s in a salad spinner
at full speed).
3. Weighing: Determine the fresh weight of each alga on balance.
4. Interim maintenance: To prevent shrinking or other deformations due to
drought, place the algae into individual beakers containing seawater.
306 Protocols for Macroalgae Research

5. Scanning: Dry the algae with paper, and spread them on a flatbed
scanner. Individuals that are too large or exhibit nonflat morphol-
ogies can be cut into pieces, which need to be distributed on the
scanner without overlap. A scale is placed on the scanner as well.
To obtain a good background contrast, cover the scanner with spot-
lessly clean and bright white material (e.g., an isopor panel). Scan at
high resolution and save the obtained image in a standard graphics
format.
6. Image analysis: Use imaging software to determine the total projec-
tion area of each alga.
7. Determine SA by using either Equation 19.1 or 19.4. Most seaweeds
exhibit either flat or filamentous morphologies. For thalli with flat
morphology, SA can be calculated from TP as

SA = 2 × TP (19.1)

In contrast, filaments can be regarded as cylinders, therefore

SA = π × thallus diameter × thallus length (19.2)

and, because

TP = thallus diameter × thallus length (19.3)

SA = π × TP (19.4)

8. Calculate mean surface/mass-ratios: For each scanned algal individual,

divide SA by the fresh weight obtained in 19.4.2.3, and then, calcu-
late the mean surface/mass ratio.

19.4.3 Extraction
All extractions should be carried out in a vented hood with clean equip-
ment. Prior to the extraction, examined algae need to be maintained at
low-stress conditions.

1. Water removal: To remove adhering water, spin algal individuals for

60  s in a salad spinner at full speed. Do not blot with paper or a
towel, as this might remove surface compounds.
2. Weighing: Determine the fresh weight of algal material on balance.
3. Extraction: Dip algae individually for a suitable time into a beaker
containing stirred suitable solvent (solvent and exposure time were
identified following 19.4.1). Tissue cuts should not get into contact
with the solvent. Surface extracted algae may be either discarded or
conserved for other purposes.
Chapter nineteen: Preparative extraction of exometabolites from seaweed 307

4. Filtration: Remove particles from the solvent by immediate filtration

through a glass microfiber filter.
5. Evaporation: Evaporate the organic solvent in vacuo at a temperature
<40°C. In nearly all cases, the sample will also contain a small volume
of water that originally adhered to the alga. Samples that are free of
organic solvent should be lyophilized prior to storage at −20°C.
6. Determine extracted SA: For each sample, multiply the fresh weight
obtained in step 19.4.3.2 with the mean surface/mass ratio obtained
in step 19.4.2.8.

19.5 Notes
Note 1: To prevent stress, use seawater with a similar salinity and tem-
perature as in the collection site of the algal material.
Note 2: In most cases, nonpolar solvents such as hexane are tolerated
best (Table 19.1) and should be tested first. The solvent polarity may
then be increased stepwise until exposure times of less than 5  s
result in cell damage.

References
Brock, E., G. M. Nylund, and H. Pavia. 2007. Chemical inhibition of barnacle
larval settlement by the brown alga Fucus vesiculosus. Mar. Ecol. Progr. Ser.
337:165–174.
Cirri, E. and G. Pohnert. 2017. Disruption-free solid phase extraction of surface
metabolites from macroalgae. In Protocols for Macroalgae Research, B. Charrier,
T. Wichard, and C.R.K. Reddy, (Eds.) Chapter 20, 311–321. Boca Raton, FL:
CRC Press, Taylor & Francis Group.
de Nys, R., S. A. Dworjanyn, and P. D. Steinberg. 1998. A new method for deter-
mining surface concentrations of marine natural products on seaweeds.
Mar. Ecol. Progr. Ser. 162:79–87.
Lachnit, T., M. Wahl, and T. Harder. 2010. Isolated thallus-associated compounds
from the macroalga Fucus vesiculosus mediate bacterial surface colonization
in the field similar to that on the natural alga. Biofouling 26 (3):247–255.
Nylund, G. M., P. E. Gribben, R. de Nys, P. D. Steinberg, and H. Pavia. 2007. Surface
chemistry versus whole-cell extracts: antifouling tests with seaweed metab-
olites. Mar. Ecol. Progr. Ser. 329:73–84.
Othmani, A., J. F. Briand, M. Aye, M. Molmeret, and G. Culioli. 2016. Surface
metabolites of the brown alga Taonia atomaria have the ability to regulate
epibiosis. Biofouling 32 (7):801–813.
Rickert, E., M. Lenz, F. R. Barboza, S. N. Gorb, and M. Wahl. 2016. Seasonally fluc-
tuating chemical microfouling control in Fucus vesiculosus and Fucus serratus
from the Baltic Sea. Mar. Biol. 163 (10):203.
Saha, M., M. Rempt, B. Gebser, J. Grueneberg, G. Pohnert, and F. Weinberger.
2012. Dimethylsulphopropionate (DMSP) and proline from the surface of
the brown alga Fucus vesiculosus inhibit bacterial attachment. Biofouling
28 (6):593–604.
308 Protocols for Macroalgae Research

Saha, M., M. Rempt, K. Grosser, G. Pohnert, and F. Weinberger. 2011. Surface-

associated fucoxanthin mediates settlement of bacterial epiphytes on the
rockweed Fucus vesiculosus. Biofouling 27 (4):423–433.
Schindelin, J., I. Arganda-Carreras, E. Frise et al. 2012. Fiji: An open-source plat-
form for biological-image analysis. Nat. Meth. 9 (7):676–682.
Wang, S., G. Wang, F. Weinberger, D. Bian, M. Nakaoka, and M. Lenz. 2016. Anti-
epiphyte defences in the red seaweed Gracilaria vermiculophylla: Non-native
algae are better defended than their native conspecifics. J. Ecol. 105 (2):
445–457.
Weinberger, F., G. Pohnert, M. L. Berndt, K. Bouarab, B. Kloareg, and P. Potin.
2005. Apoplastic oxidation of L-asparagine is involved in the control of the
green algal endophyte Acrochaete operculata Correa & Nielsen by the red sea-
weed Chondrus crispus Stackhouse. J. Exp. Bot. 56 (415):1317–1326.
chapter twenty

Disruption-free solid-phase
extraction of surface
metabolites from macroalgae
Emilio Cirri and Georg Pohnert

Contents
20.1 Introduction ......................................................................................... 309
20.2 State of the art .......................................................................................310
20.3 Materials................................................................................................311
20.3.1 Fucus vesiculosus .....................................................................311
20.3.2 Solid-phase surface extraction method ............................. 312
20.4 Experimental procedures .................................................................. 312
20.4.1 Extraction procedure ............................................................ 313
20.4.2 Data evaluation ..................................................................... 315
20.5 Notes ..................................................................................................... 315
Acknowledgments ......................................................................................... 317
References........................................................................................................ 317

20.1 Introduction
Surface metabolites play a fundamental role in the mediation of interac-
tions on biotic surfaces of, for example, macroalgae, corals, or sponges.
Such compounds control settling processes, regulate predator–prey rela-
tionships, and mediate infection processes (Wahl 2009, Dobretsov et al.
2013, da Gama et al. 2014). A hallmark of such interactions is the locally
much focused action of the compounds in question (Dworjanyn et al.
1999, 2006). The surface concentration of such metabolites often exceeds
the concentration in the medium, but it can even exceed concentrations
within the tissue as exuded compounds can accumulate in a diffusion-
limited laminar boundary layer. Despite their ecological importance,

309
310 Protocols for Macroalgae Research

until now, only a few methods allow the estimation of local concentra-
tions of surface metabolites. As a consequence, many investigations on
the effect of surface metabolites were based on bioassays with extracts of
whole organisms (Hellio et al. 2000, Nylund et al. 2011). Such experiments
do not reflect the real ecological relevance of surface-active substances
because only metabolites at the surface or near a producer should be con-
sidered (Nylund et al. 2007). The determination of metabolites within the
laminar boundary layer around an aquatic organism, a thin film of about
100–200  µm that determines the transition between the surface and the
surrounding water is thus crucial for experiment planning and evalua-
tion. Thus far, the laminar boundary layer has been studied to determine
uptake rates of nutrients (Wheeler 1980) or to model them (Hadley 2014),
or it has been investigated in correlation with climate changes and oceans’
acidification (Cornwall 2014), but the study of metabolites identity and
concentration at macroalgal surface is crucial both from an ecological and
an industrial point of view, especially in the framework of antifouling
substances research (Bhadury and Wright 2004, Rajan 2016).

20.2 State of the art

Several methods to study the laminar boundary layer have been estab-
lished during the last 20  years: These include Raman microspectros-
copy (Grosser et al. 2012), mass-spectrometry imaging, such as MALDI
and DESi (Slaveykova 2009, Andras 2012) and the widely used dipping
methods (de Nys et al. 1998, Lachnit et al. 2010). For extraction, algae are
immersed in a solvent for a short period, during which the metabolites are
partially extracted from the surface. Care has to be taken that the solvent
does not damage the cells of the extracted organism. After concentration
in vacuum, the extracts can be submitted to analytical methods, such as
GC–MS and LC–MS. Dipping methods are really easy to handle and can
be used with a lot of different species of macroalgae. By optimizing the
solvent (or mixtures of solvents) for extractions, as well as the solvent’s
volume, these techniques allow extracting a very different kind of metab-
olites, proving to be flexible and adaptable to specific questions (Chapter 19
by Weinberger 2018). Although useful, dipping methods are problematic
as solvent exposure can cause cell lysis, and thereby contamination of the
surface extract with intracellular metabolites; these problems depend both
on the algal species and on the physiological conditions, as well as on the
part of the alga that needs to be extracted. Some algae only tolerate expo-
sure to rather nonpolar solvents such as hexane for few seconds. However,
these solvents only cover a very limited range of nonpolar metabolites and
do not penetrate surface-associated water. If solvent mixtures containing
methanol are employed, massive damage of the algae could be observed,
thereby questioning the validity of results. To overcome these limitations,
Chapter twenty: Extraction of surface metabolites from macroalgae 311

5s 60 s 600 s
1.3
Control

1.2

Red/Green ratio
C18

Treatment
1.1 Control
C18
Hexan
Hexan/Methanol

1.0

0 200 400 600

(a) (b) Time (s)

Figure 20.1 Evaluation of surface damage by different extraction methods.

(a) Photographs of F. vesiculosus surfaces (scale bars 100 µm). Top row: Control
after removal from water for 5, 60, and 600  s. Middle row: algae after C18
extraction. Bottom row: after hexane/methanol dipping for the same time
spans. (b) Evaluation of cell damage after Evans blue staining by red/green ratio
analysis at 5, 30, 60, 120, 300, 600 s exposure to C18 material (gray), hexane/methanol
dipping (white) and control (black), (n = 5 ± SD). (Reprinted with permission from
Cirri et al. 2016.)

we developed a new, nondestructive solvent-free and universal method

for extracting secondary metabolites from marine macroorganisms (Cirri
2014, Cirri et al. 2016). The method is based on the adsorption of organic
metabolites onto C18 extraction sorbent and is not harmful to algal surface
cells (Figure 20.1).
The technique has been optimized regarding recovery, reproducibil-
ity, and ease of use with the brown macro alga Fucus vesiculosus as a model
organism. F. vesiculosus is a common, well-studied brown alga that can
be found on the coasts of the North Sea, the western Baltic Sea, and the
Atlantic and Pacific Oceans. However, also the green alga Caulerpa taxifolia
and the red alga Gracilaria vermiculophylla were extracted for proof of con-
cept, demonstrating the universality of the method that can be potentially
used for all aquatic macroscopic organisms. Here, a detailed commented
protocol is given, based on our publication (Cirri et al. 2016).

20.3 Materials
20.3.1 Fucus vesiculosus
• Fucus vesiculosus samples can be collected independently of the sea-
son. The alga can be extracted directly after collection in the field or
can be kept in aquaria as described below.
312 Protocols for Macroalgae Research

• Artificial seawater (ASW): An amount of 33  g Instant Ocean™

(Aquarium Systems, France) per liter of deionized water is stirred
at least for 12 h to accomplish a complete dissolution. In our experi-
ment, ASW was diluted with deionized water to half of the initial
concentration to reproduce the salinity of the Baltic Sea.
• Nutrient solutions: A volume of 0.22  mL K2HPO4 solution (1.79  g
K2HPO4/200  mL water) and 0.59  mL of a NaNO3 solution (17.99  g
NaNO3/200 mL water) were added to 1 L of ASW.
• Glass Aquaria (7 L or more).
• Controlled climate chamber (15°C) under 12 h light/12 h darkness
regime (light intensity of 65 µmol m2 s–1).
• Air pump for constant ventilation of aquaria.

20.3.2 Solid-phase surface extraction method

• Fully end-capped SPE material C18-reversed phase silica gel mate-
rial (pore size 90 Å, particle dimensions 40–63 µm, Sigma-Aldrich,
Deisenhofen, Germany)
• Forceps
• Empty 6  mL polypropylene columns with PE (polyethylene) frits
(Macherey-Nagel, Düren, Germany)
• ASW (Artificial seawater as described in 20.3.1 point 2)
• 500 mL spray bottle
• Deionized water
• Methanol (HPLC Grade, Sigma-Aldrich, Germany)
• Plastic Petri dishes (92 × 10 mm)
• Glass or plastic funnels (100 mm diameter)
• Silicone adaptors for Büchner flask
• Büchner flask (500 mL)
• A vacuum pump (ca. 550 mbar) (not essential, Note 10)
• 4 mL glass vials with a black cap
• 1.5 mL glass vials with a blue cap
• 200 µL glass inserts and metal springs
• Analytical balance
• Digital camera
• ImageJ (Rasband 1997) or another image-processing software

20.4 Experimental procedures

The following operations in Figure 20.2 are suitable for different species
of macroalgae when they are in healthy condition (not wounded or dam-
aged). The method can easily be adapted to other aquatic organisms by
changing handling parameters.
Chapter twenty: Extraction of surface metabolites from macroalgae 313

1. 2.
3.

C18 - Material

4.

5.

Extract

Figure 20.2 Schematic workflow of the C18 method. (1) Algal fronds are removed
from the water and left for 2 min to remove excess water by dripping; (2) fronds
are transferred to Petri dishes and covered with absorption material; (3) the C18
material is washed off with excess seawater and collected in an empty solid-phase
extraction cartridge equipped with a frit; (4) the material is washed with deionized
water to remove salts; (5) elution with organic solvents finalizes sample preparation.
(Reprinted with permission from Cirri et al. 2016.)

20.4.1 Extraction procedure

1. Spread C18 SPE material (Notes 1 and 2) on the small thecae of the
Petri dish and weigh it. For a Petri dish with a diameter of 9.2 cm
(92 × 10 mm), an amount of 0.5 g of SPE material is sufficient to reach
uniform covering of the plate (Note 3).
2. Weight the empty polypropylene cartridge (Note 2).
3. Take the piece of alga that you desire to extract out of the aquarium
(in this case, the fronds of F. vesiculosus). Pieces of around 40 cm2 of
this alga were small enough to fit in a 9.2 cm diameter Petri dish and
sufficient for generating surface extracts that can be investigated in
GC–MS and LC–MS.
4. Hold the alga for 2 min so that excess of water can drop off (Note 4).
5. Place the alga inside the dish, close it, and shake it manually for
about 10 s, taking care to obtain a homogenous cover of the surface
with SPE material.
314 Protocols for Macroalgae Research

Figure 20.3 Vacuum setup for solid-phase extraction.

6. Leave the alga in the Petri dish for 60 s (Note 5).
7. Take the alga out of the Petri dish using forceps, shaking it gently to
remove excess SPE material.
8. Hold the alga with forceps over the funnel connected with the empty
polypropylene column and with the Büchner flask (Figure 20.3).
9. Wash the algal surface with ASW from a spray bottle to remove the
most of SPE material. The SPE material is collected in an empty 6 mL
polypropylene column (Note 6).
10. Wash the funnel and the cartridge with the SPE material with excess
(ca. 20 mL) MilliQ water to remove salt from the seawater/medium,
by taking care that all SPE material is going into the cartridge. While
washing, you can apply a gentle vacuum (≈550 mbar) to make the
powder settle in the cartridge (0.5–1 mL bed volume) (Note 7).
11. Add an appropriate internal standard for recovery calculations.
12. Elute the compounds with methanol (three times 0.5 mL) into a 4 mL
glass vial under ambient pressure. Optimal flow rate should be
maximum one drop per second (Note 8).
13. Remove the solvent under a stream of nitrogen and redissolve the
sample in 100 µL of methanol (Notes 9 and 10). Transfer the sample
into a 250 µL glass insert placed in a 1.5 mL glass vial (or other vials
suitable for the autosampler of your own GC or HPLC).
Chapter twenty: Extraction of surface metabolites from macroalgae 315

14. Store the sample at −20°C or proceed to measure it with the desired
technique (GC–MS or LC–MS, as in, e.g., Cirri et al. 2016, Vidoudez
and Pohnert 2011) (Chapter 18 by Kuhlisch et al. 2018).
15. Place the extracted alga on a white, plane surface equipped with
a scale bar and take a picture. Calculate the surface of the alga as
shown in Chapter 19 by Weinberger (2017) with an image-processing
software (in our case, we used the open source software ImageJ,
http://imagejnihgov/ij/.) (Note 11). For thalli with flat morphology,
surface areas (SA) can be calculated as

SA = 2 × TP

where TP is the thallus projection.

In contrast, filaments can be regarded as cylinders, therefore

SA = π × thallus diameter × thallus length;

and, because TP = thallus diameter × thallus length,

SA = π × TP.

After the C18 material is completely dry, weight the cartridge to cal-
culate the amount of extraction powder used for the experiment.

20.4.2 Data evaluation

1. After LC–MS or GC–MS measurements, integrate both the chro-
matographic peak area of the internal standard and the substance(s)
of interest with the appropriate software associated with your ana-
lytical instrument (e.g., Waters® Masslynx or Thermo® Xcalibur).
2. Calculate the ratio between the chromatographic peak area of the
internal standard and the substance(s) of interest for a relative quan-
tification. For absolute quantification, the ratio should be compared
with an external calibration curve.
3. Normalize the quantity (relative or absolute) to the SA previously
calculated with ImageJ.
4. For recovery calculation, normalize the chromatographic peak area
of the internal standard (in our experiment, canthaxanthin) to the
weight of the C18 material effectively extracted.

20.5 Notes
Security advice: Care should be taken that the dust of the SPE material is
not inhaled as aerosols are problematic under prolonged exposure. MeOH
is flammable and toxic, thus handling under a fume hood or a good ven-
tilated area is advised.
316 Protocols for Macroalgae Research

Note 1: Take care of where you are cutting your alga: During the
following step of the method, you have to avoid washing and
removing the SPE material that is in contact with damaged tis-
sue in cutting sites. Otherwise, you would risk extracting internal
metabolites.
Note 2: Our method development was limited to test a different type of
C18 SPE material, but the flexibility of this approach allows extend-
ing the range of absorbing material that can be used. For example,
material contained in prepackaged SPE cartridges (HLB, StrataX,
and Ionic Exchanger) can be used as well. The choice depends on the
polarity of the metabolites under consideration. It is not necessary
to purchase new empty cartridges: You can use old used cartridges;
empty them and clean them before reusing them.
Note 3: The Petri dish dimensions can be changed as desired, and
smaller or bigger samples can be used, depending on the availability
of biological material and the concentration of surface metabolites.
The Petri dish method was preferred to other methods because it is
faster and assures a uniform and simultaneous covering of the algal
surface. A drawback of the method is the loss of a huge percentage
of SPE material as only about one-fifth of the powder spread in the
Petri dish attached to the algal surface. However, this powder can
be reused as it does not get contaminated by exometabolites of the
alga. An alternative to the Petri dish method could be to use a small
mesh sieve to spread the SPE material over the algal surface. Either
plastic or glass funnels can be used. Glass guarantees less chemi-
cal contaminations. However, the plastic material allows for stirring
and collecting the C18-powder easily, as the silica material tends to
stick to the glass surfaces.
Note 4: It is essential that the surface is not getting completely dry: The
thin layer of water that remains on the surface (laminar bound-
ary layer) is the environment from which metabolites shall be
determined.
Note 5: Different extraction times were tested, and 60 s was chosen as the
best compromise between a good interaction and absorption of metabo-
lites with C18 material and an easy recovery of the powder from the alga.
Note 6: The amount of water used for the washing steps is not a crucial
parameter, but for more precise absolute quantification of metabo-
lites, this step can also be easily standardized, always by using the
same amount of water.
Note 7: Different vacuum setups could be used, as a vacuum manifold
(Visiprep™, Supelco, USA) for multiple, simultaneous extractions.
However, the use of a vacuum pump is not necessary. In case the
vacuum is not applicable, the settlement of the SPE material will
Chapter twenty: Extraction of surface metabolites from macroalgae 317

require longer time and a larger amount of water to make sure that
the absorbing material is properly packed.
Note 8: Our method was optimized for 1.5 mL of methanol as an extrac-
tion solvent, but as in all SPE methods, the amount and the polarity
of the solvent (or mixture solvents) can be adapted. Other solvents
can be applied depending on the used solid phase and the nature
of the metabolites which should be extracted. C18 material does not
need to be dry before elution; however, each material has its specific
treatment to be fully effective. For all these information, also check
the recommendations of the manufacturer.
Note 9: If needed or desired, the sample can be stored at this point
at −20°C, and the drying step could be performed afterward.
Note 10: The volume of redissolution should be adapted to some surface
metabolites present and the sensitivity of the analytical instrument
to obtain a response in the linear range. For GC–MS analysis of polar
compounds, a derivatization protocol can be used starting from this
step. For more information about derivatization, see chapter 18 by
Kuhlisch et al. (2017) and Vidoudez and Pohnert (2011).
Note 11: The measurement of the surface is an essential step of this
method, but sometimes difficult to achieve, because of the texture
and morphology of the alga. Try to get your sample as flat as pos-
sible, by using, for example, a glass slide to cover your alga and some
weights to keep the alga plane.

Acknowledgments
The authors acknowledge funding the Jena School for Microbial
Communication and the International Max Planck Research School on
the Exploration of Ecological Interactions with Molecular and Chemical
Techniques and the EU Marie Sklodowska-Curie Initial Training Network
(ITN) program Algal Microbiome: Friends or Foes (ALFF) for funding.

References
Andras, T.D., Alexander, T.S., Gahlena, A., Parry, R.M., Fernandez, F.M., Kubanek, J.,
Wang, M.D., and Hay, M.E. 2012. Seaweed allelopathy against coral: Surface
distribution of a seaweed secondary metabolite by imaging mass spectrom-
etry. J. Chem. Ecol. 38:1203–1214.
Bhadury, P. and Wright, P.C. 2004. Exploitation of marine algae: Biogenic com-
pounds for potential antifouling applications. Planta 219 (4):561–578.
Cirri, E. 2014. Development and optimization of an extraction method for the
analysis of algal, surface metabolites, Master Thesis, University of Florence.
Cirri, E., Grosser, K., and Pohnert, G. 2016. A solid phase extraction based non-
disruptive sampling technique to investigate the surface chemistry of mac-
roalgae. Biofuling 32(2):145–153.
318 Protocols for Macroalgae Research

Cornwall, E.C., Boyd, P., McGraw, C.M., Hepburn, C.D., Pilditch, C.A., Morris, J.N.,
Smith, A.M., and Hurd, C.L. 2014. Diffusion boundary layers ameliorate the
negative effects of ocean acidification on the temperate coralline macroalga
Arthrocardia corymbosa. PLoS One 9 (9):e109468.
da Gama, B.A.P., Plouguerne, E., and Pereira, R.C. 2014. The antifouling defence
mechanisms of marine macroalgae. In: Advances in Botanical Research—Sea
Plants. Bourgounon, N., Jacquoud, J.P., and Gadal, P. (Eds.), pp. 413–440.
Amsterdam, the Netherlands: Elsevier.
de Nys, R., Dworjanyn, S.A., and Steinberg, P.D. 1998. A new method for deter-
mining surface concentrations of marine natural products on seaweeds.
Mar. Ecol. Prog. Ser. 162:79–87.
Dobretsov, S., Abed, R.M.M., and Teplitski, M. 2013. Mini-review: Inhibition of
biofouling by marine microorganisms. Biofouling 29:423–441.
Dworjanyn, S.A., de Nys, R., and Steinberg, P.D. 1999. Localisation and surface
quantification of secondary metabolites in the red alga Delisea pulchra. Mar.
Biol. 133:727–736.
Dworjanyn, S.A., Wright, J.T., Paul, N.A., de Nys, R., and Steinberg, P.D. 2006. Cost
of chemical defence in the red alga Delisea pulchra. Oikos 113:13–22.
Grosser, K., Zedler, L., Schmitt, M., Dietzek, B., Popp, J., and Pohnert, G. 2012.
Disruption-free imaging by Raman spectroscopy reveals a chemical sphere
with antifouling metabolites around macroalgae. Biofouling 28:687–696.
Hadley, S., Wild-Allen, K., Johnson, C., and Macleod, C. 2014. Modeling macroal-
gae growth and nutrient dynamics for integrated multi-trophic aquaculture.
J. Appl. Phycol., 27 (2):901–916.
Hall, S., Wild-Allen, K., Johnson, C., and Macleod, C. 2015. Modeling macroalgae
growth and nutrient dynamics for integrated multi-trophic aquaculture.
J. Appl. Phycol. 27 (2):901–916.
Hellio, C., Bremer, G., Pons, A.M., Le Gal, Y., and Bourgougnon, N. 2000. Inhibition
of the development of microorganisms (bacteria and fungi) by extracts of
marine algae from Brittany, France. Appl. Microbiol. Biotechnol. 54:543–549.
Kuhlisch, C., Califano, G., Wichard, T., and Pohnert, G. 2018. Metabolomics of intra-
and extracellular metabolites from micro- and macroalgae using GC-MS
and LC-MS. In Biotechnology Protocols for Macroalgae Research, Charrier, B.,
Wichard, T., Reddy, C.R.K. (Eds.), Chapter 18, 281–302. Boca Raton, FL: CRC
Press, Taylor & Francis Group.
Lachnit, T., Fischer, M., Kuenzel, S., Baines, J.F., and Harder, T. 2013. Compounds
associated with algal surfaces mediate epiphytic colonization of the marine
macroalga Fucus vesiculosus. FEMS Microbiol. Ecol. 84:411–420.
Lachnit, T., Wahl, M., and Harder, T. 2010. Isolated thallus-associated compounds
from the macroalga Fucus vesiculosus mediate bacterial surface colonization
in the field similar to that on the natural alga. Biofouling 26:247–255.
Nylund, G.M., Gribben, P.E., de Nys, R., Steinberg, P.D., and Pavia, H. 2007. Surface
chemistry versus whole-cell extracts: Antifouling tests with seaweed metab-
olites. Mar. Ecol. Prog. Ser. 329:73–84.
Nylund, G.M., Weinberger, F., Rempt, M., and Pohnert, G. 2011. Metabolomic
assessment of induced and activated chemical defence in the invasive red
alga Gracilaria vermiculophylla. PLoS One 6:e29359.
Chapter twenty: Extraction of surface metabolites from macroalgae 319

Rajan, R., Selvaraj, M., Palraj, S., and Subramanian, G. 2016. Studies on the anticor-
rosive & antifouling properties of the Gracilaria edulis extract incorporated
epoxy paint in the Gulf of Mannar Coast, Mandapam, India. Prog. Org. Coat,
90:448-454.
Rasband, W. 1994–2014. ImageJ, US National Institutes of Health, Bethesda, MD.
Available from: Accessed December 22, 2017, https://imagej.nih.gov/ij/
Saha, M., Rempt, M., Gebser, B., Grueneberg, J., Pohnert, G., and Weinberger, F.
2012. Dimethylsulphopropionate (DMSP) and proline from the surface of
the brown alga Fucus vesiculosus inhibit bacterial attachment. Biofouling
28:593–604.
Saha, M., Rempt, M., Grosser, K., Pohnert, G., and Weinberger, F. 2011. Surface-
associated fucoxanthin mediates settlement of bacterial epiphytes on the
rockweed Fucus vesiculosus. Biofouling 27:423–433.
Slaveykova, V.I., Guignard, C., Eybe, T., Migeon, H.-N., and Hoffmann, L. 2009.
Dynamic NanoSIMS ion imaging of unicellular freshwater algae exposed to
copper. Anal. Bioanal. Chem. 393:583–589.
Vidoudez, C. and Pohnert, G. 2011. Comparative metabolomics of the diatom
Skeletonema marinoi in different growth phases. Metabolomics 8(4):654–669.
Wahl, M., Molis, M., Ringelhan, F., Rohnstock, L., and Lenz, M. 2009. Effects of
grazing pressure on the induction of anti-herbivory defences in bladder-
wrack (Fucus vesiculosus) in different seasons. 8th International Temperate
Reefs Symposium. Accessed January 12, 2016. Adelaide, Australia.
Weinberger, F. 2018. Preparative extraction of exometabolites from seaweed
surfaces. In Biotechnology Protocols for Macroalgae Research, Charrier, B.,
Wichard, T., Reddy, C.R.K. (Eds.), Chapter 19, 303–310. Boca Raton, FL: CRC
Press, Taylor & Francis Group.
Wheeler, W.N. 1980. Effect of boundary layer transport on the fixation of carbon
by the giant kelp Macrocystis pyrifera. Mar. Bio. 56(2):103–110.
section three

Cellular and molecular

characterization
chapter twenty one

The immunodetection and

in situ imaging of cell-wall
polysaccharides in brown algae
Amandine Siméon, Delphine Duffieux, Cécile Hervé,
Sophie Le Panse, Paul Knox, and Thomas Torode

Contents
21.1 Introduction ......................................................................................... 323
21.2 State of the art: Imaging cell walls in brown algae ........................ 324
21.3 Materials ............................................................................................... 325
21.4 Experimental procedures................................................................... 327
21.4.1 Preparation of algal material and fixation procedures .......327
21.4.2 Embedding protocol for London resins White resin ....... 328
21.4.3 Embedding protocol for Lowicryl resin ............................ 329
21.4.4 Sectioning of resin-embedded samples ............................. 330
21.4.5 Imaging algal cell walls using general stains ................... 330
21.4.6 Immunolabeling for fluorescence microscopy ................. 330
21.4.7 Immunolabeling for electron microscopy ......................... 331
21.4.8 Pretreatments before immunolabeling .............................. 331
21.5 Notes ..................................................................................................... 332
Acknowledgments ......................................................................................... 333
References........................................................................................................ 333

21.1 Introduction
Cell walls in brown algae are major cell compartments involved in impor-
tant biological roles such as algal growth and development, osmotic regu-
lation of cell surfaces, and defense responses. Such a variety of functional
properties is supported by dynamic and complex cell-wall architectures.
Brown algal cell walls are composed predominantly of polysaccharides
together with lower amounts of phenols, proteins, and halide compounds
(Deniaud-Bouët et al. 2014). The fucose-containing sulfated polysaccharides
and the alginates are the major sets of matrix polysaccharides, which are by

323
324 Protocols for Macroalgae Research

far prevalent over crystalline polymers, including cellulose. Structural vari-

ants in cell-wall polysaccharides of brown algae are known and these are
indicative of diverse functions. So far, most attempts to study cell-wall poly-
mers in brown algae used labor-intensive chemical extractions, with the
consequent loss of most spatial and developmental information. The chal-
lenge now is to discern features of specific polysaccharide structures, their
modulation, and dynamics in cell-wall regions and tissues. One of the best
ways to detect and assess the presence of polysaccharides in algal materi-
als is by immunohistochemical techniques, based on the use of tagged pro-
teins with specific recognition capacities (Lee et al. 2011). Currently, most
of the molecular probes used to bind specific polysaccharide epitopes in
context are monoclonal antibodies. The development of such tools is still
in its infancy in brown algae but recent advancements have extended our
capabilities to study cell-wall biology in these systems. The current chapter
focuses on chemical staining of cell walls and the use of monoclonal anti-
bodies for the specific detection of polysaccharide epitopes in brown algae.

21.2 State of the art: Imaging cell walls

in brown algae
Brown algae have a unique cell-wall biochemistry not present in other
taxa that is organized in a three-dimensional complex architecture and
composed predominantly of polysaccharides. The anionic and matrix
polysaccharides alginates and fucose-containing sulfated polysaccharides
(FCSPs) are by far prevalent over crystalline β-glucans, which include
cellulose. Proteins, arabinogalactan proteins (Hervé et al. 2016), phenolic
compounds known as phlorotannins, and halide compounds as iodide,
are additional compounds found in brown algal cell walls. It is believed
that FCSPs interlock the β-glucan scaffold, whereas alginate–phenol link-
ages are key players in regulating the rigidity of the wall (Deniaud-Bouët
et al. 2014). Each of these groups of polysaccharides displays distinct ele-
ments of chemical complexity. The arrangement of alginates in three block
types has been described in some detail, although it is obvious that a vast
continuum of intermediate structures can be found in planta (Campa et al.
2004; Hervé et  al. 2016). The FCSPs are highly diverse in terms of their
degree of sulfation, esterification, methylation, molecular weight, and
conformation of sugar residues (Deniaud-Bouët et al. 2014); less hetero-
geneous FCSPs include the sulfated fucans, which are polymers featuring
a backbone based on α-l-fucopyranosyl residues only. All these variants
exhibit discrete biological and mechanical properties that still need to be
explored in the context of the wall at both the cell and tissue levels.
To date, limited attention has been paid in brown algae to the particular
arrangements of the various polymers forming the cell wall and how they
Chapter twenty one: In situ imaging of cell-wall polysaccharides 325

are interlinked. Equally important is the fact that the variations are not
just between lineages and species, but might also occur between organs,
tissues, and microdomains of the wall. Most of the chemical knowledge
gained on brown algal cell walls used analyses that require homogeniza-
tion of large amounts of material, generally including a diversity of cell
types. The information of each cell type is lost on analysis. In land plants,
the development of immunolocalization techniques has made significant
contributions to the exploration of many aspects of the biology of cell-wall
polysaccharides (Lee et al. 2011). These methods generally use well-defined
monoclonal antibodies that have been developed from immunization
procedures with cell-wall–derived materials. This technology has been
used for decades in plant biology and is now extending to brown algal cell
walls. Recently, specific monoclonal antibodies toward cell-wall polysac-
charides of brown algae were generated and characterized. They include
the brown algal monoclonal (BAM) antibodies that bind structural vari-
ants of FCSPs (BAM1–4) and alginates (BAM6–11) (Torode et al. 2015, 2016).
Although the structural features recognized by these antibodies have not
always been fully defined, they allow detailed cytological analysis to be
performed. They are likely to significantly increase our understanding of
the organization and developmental dynamics of the polysaccharides in
brown algal cell walls. In optical microscopy, these antibodies can be used
in combination to general stains, which are useful for the detection of all
cell walls in tissues.
Studies on plant cell-wall polysaccharides indicate that some epitopes
might not be readily accessible in all cell walls, because of other polymers
masking them (Marcus et al. 2008; Hervé et al. 2009; Xue et al. 2013). The
use of dedicated enzymes to remove populations of cell-wall polysac-
charides was instrumental in these study processes to reveal epitopes.
The situation is likely to be similar in brown algae and the use of specific
enzymatic treatments can be a valuable addition to the immunolabeling
techniques.
The current chapter discusses the use of specific antibodies in combi-
nation with histochemical techniques for the detection of cell-wall poly-
saccharides in tissues or at cell surfaces in brown algae. A set of protocols
is provided for both optical and electron microscopy. Additional guidance
is given for the general staining of all cell walls and the enzymatic pre-
treatment with alginate lyases to remove alginates.

21.3 Materials
• Seawater and fresh brown algae.
• Razor blades or Leitz 1320 freezing microtome (Ernst LeitzWetzlar
GmbH, Wetzlar, Germany) coupled with Tissue Freezing Medium®
326 Protocols for Macroalgae Research

(Leica Biosystems Nussloch GmbH, Germany) to cut algal material

for light microscopy.
• Microtome ultracut Leica UCT, diamond knife (Diatome), and Jeol
1400 transmission electron microscope to cut and observe algal
material for electron microscopy.
• Fixative solution: A good fixative to start with is a 4% (w/v) solution
of formaldehyde in 50% (v/v) seawater diluted with distilled water.
Alternatively, 2% (w/v) formaldehyde with 0.25% (w/v) of glutaralde-
hyde (Sigma-Aldrich), 0.001% (w/v) of Tween 80, and 342 mM NaCl
in 25 mM PIPES (pH 7.2) can be used.
• Polysine-coated microscopy slides (VWR, France).
• Poly-l-lysine solution 0.1% in water (Sigma-Aldrich).
• Microscope slide cover slips (VWR, France).
• Microscope slide mailers (VWR, France).
• Super PAP hydrophobic pen (Agar Scientific).
• Milk powder (Régilait, France) or bovine serum albumin (Sigma-
Aldrich) to be used as blocking agents.
• Molecular probes that recognize algal cell-wall polysaccharides.
A range of monoclonal antibodies that specifically bind to sul-
fated fucans (BAM1 to BAM4) and alginates (BAM6 to BAM11) are
available through PlantProbes (www.plantprobes.net). The LM7
monoclonal antibody is classically used to detect pectic homoga-
lacturonan in plants, but it also binds alginates (www.plantprobes.
net) as shown in Figure 21.1. These antibodies are derived using rat
hybridoma systems, and thus require anti-rat secondary reagents, as
outlined below.

Sulfated fucans M-rich alginates

TBO
(BAM4) (BAM6)

100 μm

Figure 21.1 Micrographs showing toluidine blue O (TBO) staining of cell walls
and indirect immunofluorescence labeling of sulfated fucan and alginate epit-
opes in equivalent sections of Fucus serratus male conceptacles.
Chapter twenty one: In situ imaging of cell-wall polysaccharides 327

• Calcofluor White (fluorescent brightener, Sigma-Aldrich).

• Toluidine Blue O (Sigma-Aldrich): Use 1.3  mM in 0.1  M phosphate
buffer (pH 6.8).
• Ruthenium Red (Sigma-Aldrich): Use 0.5  mM in 0.1  M ammonium
acetate (pH 6.85).
• Phosphate-buffered saline (PBS) containing 137 mM NaCl, 2.7 mM
KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4.
• Alginate lyases: We use in-house alginate lyases but commercial algi-
nate lyases (Megazyme, Sigma-Aldrich) should give equivalent results.
• Anti-fade reagents: Citifluor PBS AF3 (Agar scientific).
• Secondary antibodies for fluorescence microscopy: Anti-rat immunoglob-
ulin coupled to a fluorochrome, generally FITC (Sigma-Aldrich) or
Alexafluor (Invitrogen).
• Secondary antibodies for electron microscopy: We use goat anti-rat
IgG ultrasmall with the Silver Enhancement Reagent (both from
Aurion). The nano-gold antibody has a low particle diameter, which
decreases the steric hindrance as compared to classical conjugates.
The postlabeling silver enhancement allows enlarging the average
gold particle size by coating the gold particle, greatly enhancing vis-
ibility in electron microscopy.
• Absolute ethanol to prepare aqueous solutions (30%–100%) for dehy-
dration procedures.
• LR White resin hard grade, containing 0.5% of the catalyst benzoin
methyl ether (Delta microscopies).
• Nonpolar Lowicryl resin HM20 embedding kit.
• Gelatin capsules size 4 for resin embedding (Electron Microscopy
Sciences).
• Formvar film on 200 square mesh nickel grids (Delta microscopies)
to collect thin sections.
• Uranyl acetate.
• Lead citrate.
• Fish gelatin.
• 0.5 M ammonium chloride in 0.1 M phosphate buffer pH 7.4.

21.4 Experimental procedures

21.4.1 Preparation of algal material and fixation procedures
1. Small filamentous algae such as Ectocarpus can be plunged directly
into fixative solutions (Note 1). To ease the subsequent immunola-
beling procedure, the fixed material can be attached to pretreated
slides. To do so, soak a Q-tip with 0.1% poly-l-lysine, spread the solu-
tion on the slide, and let it dry. Apply the fixed and washed sample
on the slide and allow it to dry.
328 Protocols for Macroalgae Research

2. Early developmental stages of brown algae such as zygotes and

embryos can be directly cultivated on polylysine-coated slides or
cover slips before the fixation stage. The slides are maintained in Petri
dishes and covered with a drop of seawater and/or immersed after
natural adhesion of the algae to the substratum. At selected times the
seawater is washed out and replaced by the fixative solution.
3. Samples of reasonable quality for light microscopy can be obtained
by sectioning from large samples or stiff materials such as blades
from Laminariale species. They are obtained by hand sectioning
with a razor blade and directly put in the fixative solution.
4. The use of a microtome allows generating thinner sections of equiv-
alent size. We provide instructions for the use of a Leitz 1320 freez-
ing microtome, but other systems can be used. Fill the sample holder
with a Tissue Freezing Medium and place the sample. Coat the entire
material with the Tissue Freezing Medium and wait until total freez-
ing before sectioning. Sections of 60 µm are a good starting point for
Laminariale stipes. Place sections in the fixative solution.
5. For resin-embedding procedures, pieces of such materials (generally
no thicker than 5 mm) are sectioned and placed in fixative solution.
Specific recommendations for the embedding and sectioning are
explained in Sections 21.4.2. through 21.4.4.
6. Maintain in fixative at 4°C for at least 1 h and for no more than over-
night. Fixation duration is increasing with the size and thickness of
the sample and must be determined. Fixed and slide-mounted sam-
ples can be stored for a reasonable time period (up to one month)
before being used for optical microscopy. To do this, we maintain
the slides in a fourfold dilution of fixative solution in microscope
slide mailers.
7. Fixed samples should be washed twice in buffer without fixative
before labeling.

21.4.2 Embedding protocol for London resins White resin

The London resins (LR) are hydrophilic acrylic resins that tolerate the
water remaining in samples. The LR White resin can be used at room
temperature (RT), 4°C, or at low temperature (−20°C). A dehydration per-
formed at a low temperature protects most antigenic sites from denatur-
ation. We carry out our protocol at 4°C until the end of the dehydration
step and at RT during infiltration.

1. Fix samples.
2. Rinse the samples three times for 10  min with 0.5  M ammonium
chloride in 0.1 M phosphate buffer pH 7.4 to quench the free alde-
hyde groups.
Chapter twenty one: In situ imaging of cell-wall polysaccharides 329

3. Dehydrate for 10  min with 30% ethanol followed by 10  min with
50%  ethanol, then 3  ×  15  min with 70% ethanol, 3  ×  15  min with
90% ethanol, and finally 3 × 15 min with absolute ethanol.
4. Infiltrate the specimens with a 3:1 mixture of ethanol and LR White
resin for 1 h.
5. Infiltrate the specimens with a 1:1 mixture of ethanol and LR White
resin for 1 h.
6. Infiltrate the specimens with a 1:3 mixture of ethanol and LR White
resin overnight.
7. Infiltrate the specimens with pure LR White resin. Repeat three
times every 3 h and incubate overnight.
9. Transfer the samples to gelatin capsules. Fill the capsules with 100%
LR White resin and place the caps. Make sure to exclude any oxygen
as this will inhibit polymerization.
10. Allow polymerization either at 37°C for five days (to minimize the
heat effect on a reduction of the antigenicity) or at 60°C for two days.

21.4.3 Embedding protocol for Lowicryl resin

Lowicryls are acrylate–methacrylate mixtures that polymerize to form
cross-linked saturated carbon chain structures (Kellenberg et  al. 1980;
Carlemalm et al. 1982; Acétarin et al. 1986). These resins can be used at
low temperatures to improve the preservation of molecular structures
and antigenicity. A low viscosity facilitates the rapid penetration of the
resin into the sample at low temperature. Two groups of Lowicryl resins
are available: (1) the polar (K4M and K11M) and (2) the nonpolar (HM20
and HM23) Lowicryl resins. After dehydration at low temperature the sol-
vent is replaced by the resin and the polymerization is achieved using UV
light.

1. Fix and rinse samples at 4°C as explained earlier.

2. Transfer to 30% ethanol on ice for 30 min.
3. Continue dehydration as follows in precooled solvent solutions:
• 50% ethanol from 0°C to −20°C, 2 × 30 min.
• 70% ethanol from −20°C to −35°C, 2 × 45 min.
• 90% ethanol from −35°C to −35°C, 2 × 45 min.
• Absolute ethanol from −35°C to −35°C, 2 × 1 h.
4. Replace the solvent by the resin with a 1:2 mixture of ethanol and
Lowicryl resin for 2 h, followed by a 2:1 mixture overnight.
5. Infiltrate with the resin as follows:
• Pure Lowicryl HM20 resin at −35°C for 1 h, repeat 2 times.
• Pure Lowicryl HM20 resin at −35°C overnight.
• Pure Lowicryl HM20 resin at −35°C for one day and overnight.
6. Induce polymerization under long waves UV at −35°C for 48 h.
330 Protocols for Macroalgae Research

7. Store the samples at room temperature. Lowicryl blocks can be

stored for several years but should be protected against the humidity
uptake.

21.4.4 Sectioning of resin-embedded samples

1. These instructions relate to the use of Leica Ultracut UCT.
2. Prepare glass knives.
3. Trim the block using the razor blade and then more precisely using
the glass knife of the microtome.
4. For electron microscopy Lowicryl HM20 or LRWhite sections of
a ~70 nm thickness can be cut at room temperature with a diamond
knife.
5. Rinse the nickel grids with ethanol and allow them to dry onto filter
paper within glass Petri dishes. Collect sections on grids.

21.4.5 Imaging algal cell walls using general stains

General stains are not specific enough to ascertain the exact nature of the
targeted polymer but they offer a quick and easy alternative to indicate
all cell walls in sections. Calcofluor White (CW) binds to a variety of
β-glucans that include cellulose and fluoresces under UV excitation.
CW poorly binds cell walls in brown algae, and other stains are prefer-
entially used such as ruthenium red (RR) or toluidine blue O (TBO), as
shown in Figure 21.1. RR reveals carboxylated polysaccharides (alginates).
TBO binds to polysaccharides containing carboxyl or sulfated groups
(alginates, fucans) and putative sulfated polyphenols (Note 2).

1. For CW staining: Incubate the sample with 0.015% CW solution diluted

in distilled water for no more than 5  min in darkness. Wash abun-
dantly with PBS. Mount slide and examine in fluorescence microscopy.
2. For RR staining: Incubate the sample with RR dye solution during
10 min at room temperature. Wash five times with 0.1 M ammonium
acetate (pH 6.85). Mount slide and examine in light microscopy.
3. For TBO staining: Incubate the sample with TBO dye solution during
5–10  min, at room temperature. Wash five times with 0.1  M phos-
phate buffer (pH 6.8). Mount slide and examine in light microscopy.

21.4.6 Immunolabeling for fluorescence microscopy

1. Use the hydrophobic pen to draw a circle around the slide-mounted
sample
2. Block nonspecific binding sites by incubation with PBS/MP for at
least 45 min at room temperature (RT) or overnight at 4°C
Chapter twenty one: In situ imaging of cell-wall polysaccharides 331

3. Wash three times with PBS during 5 min

4. Incubate with primary antibody at an appropriate dilution in PBS/
MP (generally 1:10 for hybridoma cell culture supernatant and 1:1000
for purified antibodies) for at least 1 h at RT (Note 3)
5. Wash three times with PBS during 5 min
6. Incubate with secondary antibody conjugated to a fluorochrome
(generally FITC or AlexaFluor) diluted at 1:100 in PBS/MP for at least
1 h at RT in darkness (Note 4)
7. Wash three times with PBS during 5 min
8. Incubate with either CW or TBO as above-mentioned
9. Wash abundantly with PBS and mount slides with an antifading
solution

21.4.7 Immunolabeling for electron microscopy

1. Grids with sections facing down are incubated 15  min at RT on a
droplet (at least 20 µL) of phosphate buffer pH 7.4 containing glycine
to block free aldehyde groups (Note 5).
2. Block nonspecific binding with 0.5% bovine serum albumin (BSA)
and 0.2% fish gelatin (optional) in 0.1 M phosphate buffer.
3. Incubate with primary antibody at an appropriate dilution (gen-
erally between 1  µg mL−1  to 10  µg mL−1, which is equivalent to a
10–100-fold dilution of a hybridoma cell culture supernatant) in
0.1 M phosphate buffer containing 0.5% of BSA in a moist chamber
overnight.
4. Wash seven times with phosphate buffer containing 0.5% of BSA.
5. Incubate with secondary antibody (goat anti-rat IgG ultrasmall cou-
pled to 1.6 nm gold particle) diluted at 1:200 in phosphate buffer con-
taining 0.5% of BSA.
6. Wash seven times with phosphate buffer containing 0.5% of BSA.
7. Incubate with the silver enhancement reagents during 40 min.
8. Wash as before with phosphate buffer and then extensively in dis-
tilled water.
9. The sections are contrasted using heavy metal. Float grids on a drop
of saturated uranyl acetate for 5–10 min. Wash on drops of distilled
water and air dry. Incubate on drops of lead citrate for 3 min in the
presence of NaOH pellets to reduce carbon dioxide. Examine under
an electron microscope. This facilitates the detection of epitopes
with high resolution as shown in Figure 21.2.

21.4.8 Pretreatments before immunolabeling

To date, most demonstrated cases of cell-wall polysaccharide epitope
masking are in plants. Similar cases of epitope masking can be explored
332 Protocols for Macroalgae Research

Alginates (LM7)

Detail

2 μm 1 μm

Figure 21.2 Micrographs showing immunogold electron microscopy labeling

of alginate in a section of Saccharina latissima tissue. The black dots in cell walls
feature the labeling.

in brown algae by degradation of alginates through the use of commer-

cially available alginate lyases.

1. Block nonspecific binding sites by incubation of the slide-mounted

sample with PBS/MP for at least 45 min.
2. Wash three times with PBS during 5 min.
3. Incubate with alginate lyase (10 µg/mL) in Tris–NaCl buffer for 1 h at
RT. Alternatively, most alginates can be solubilized using a 2.8 mM
sodium carbonate solution for 1 h at RT (Note 6).
4. Wash with three changes of PBS.
5. The material is now ready for immunolabeling as detailed in Sections
21.4.5 through 21.4.7.

21.5 Notes
Note 1: Compared to plant or animal cells, cells from marine species are
hyperosmotic and particular care should therefore be taken to main-
tain the fixative in iso-osmolarity with those cells, that is, 1100 mOsm.
Note 2: The TBO staining method can be used as a postlabeling
procedure during which it can be very useful in quenching the auto-
fluorescence emitted by the algal cells.
Note 3: Controls are essential to validate the results—omitting the pri-
mary antibody is a good control to determine any nonspecific binding.
Note 4: Specific care should be taken to avoid photobleaching of the
fluorochromes. The labeling procedure is performed in darkness
and the light exposure under the microscope should be kept to a
minimum.
Chapter twenty one: In situ imaging of cell-wall polysaccharides 333

Note 5: The upper side of the grids (i.e., without sections) must be kept
clean and dry during all steps.
Note 6: Application of polysaccharide-degrading enzymes to materials
not fixed to a glass slide is likely to result in separation of cells and
may cause degradation of samples.

Acknowledgments
We acknowledge funding from the French National Research Agency
with regard to the IDEALG program with reference ANR-10-BTBR-04.

References
Acétarin, J.D., Carlemalm, E., and Villiger, W., 1986. Developments of new
Lowicryl resins for embedding biological specimen of even lower tempera-
tures. J. Micros. 143, 81.
Campa, C., Holtan, S., Nilsen, N., Bjerkan, T.M., Stokke, B.T., and Skjak-Braek, G.,
2004. Biochemical analysis of the processive mechanism for epimeriza-
tion of alginate by mannuronan C-5 epimerase AlgE4. Biochem. J. 381 (1),
155–164.
Carlemalm, E., Garavito, R.M., and Villiger, W., 1982. Resin development for elec-
tron microscopy and an analysis of embedding at low temperature. J. Micros.
126, 123.
Deniaud-Bouët, E., Kervarec, N., Michel, G., Tonon, T., Kloareg, B., and Hervé, C.,
2014. Chemical and enzymatic fractionation of cell walls from fucales:
Insights into the structure of the extracellular matrix of brown algae. Ann.
Bot. 114 (6), 1203–1216.
Hervé, C., Rogowski, A., Gilbert, H.J., and Knox, J.P., 2009. Enzymatic treatments
reveal differential capacities for xylan recognition and degradation in pri-
mary and secondary plant cell walls. Plant J. 58 (3), 413–422.
Hervé, C., Siméon, A., Jam, M., Cassin, A., Johnson, K.L., Salmeán, A.A., Willats,
W.G.T., Doblin, M.S., Bacic, A., and Kloareg, B., 2016. Arabinogalactan pro-
teins have deep roots in eukaryotes: Identification of genes and epitopes
in brown algae and their role in fucus serratus embryo development. New
Phytologist 209 (4), 1428–1441.
Kellenberg, E., Carlemalm, E., Villiger, W., Roth, J., and Garavito, R.M., 1980. Low
Denaturation Embedding for Electron Microscopy of Thin Sections. Chemische
Werke Lowi GmbH, Waldkraiburg, Germany, F.R.G, pp. 1–59.
Lee, K.J.D., Marcus, S.E., and Knox, J.P., 2011. Cell wall biology: Perspectives from
cell wall imaging. Mole. Plant 4 (2), 212–219.
Marcus, S.E., Verhertbruggen, Y., Hervé, C., Ordaz-Ortiz, J.J., Farkas, V., Pedersen,
H.L., Willats, W.G.T., and Knox, J.P., 2008. Pectichomogalacturonan
masks abundant sets of xyloglucan epitopes in plant cell walls. BMC Plant
Biol. 8, 60.
Torode, T.A., Marcus, S.E., Jam, M., Tonon, T., Blackburn, R.S., Hervé, C., and Knox,
J.P., 2015. Monoclonal antibodies directed to fucoidan preparations from
brown algae. PLoS One 10 (2), e0118366.
334 Protocols for Macroalgae Research

Torode, T.A., Siméon, A., Marcus, S.E., Jam, M., LeMoigne, A.M., Duffieux, D.,
Knox J.P., and Hervé, C., 2016. Dissection of cell wall assembly dynamics
during early embryogenesis in the brown alga Fucus using monoclonal
antibodies. J. Exp. Bot. 67 (21), 6089–6100.
Xue, J., Bosch, M., and Knox, J.P., 2013. Heterogeneity and glycan masking of cell
wall microstructures in the stems of Miscanthus × giganteus, and its parents
M. sinensis and M. sacchariflorus. PLoS One 8 (11), e82114.
chapter twenty two

Atomic force microscopy

based analysis of cell-wall
elasticity in macroalgae
Thomas Torode, Marina Linardic, J. Louis Kaplan,
and Siobhan A. Braybrook

Contents
22.1 Introduction ......................................................................................... 335
22.1.1 Biomechanical characterization of macroalgal
cell walls ............................................................................. 335
22.2 State of the art ...................................................................................... 336
22.2.1 Mechanical characterization of macroalgal cell walls ......336
22.3 Materials ............................................................................................... 338
22.4 Experimental procedures................................................................... 338
22.4.1 Preparation of algal material for atomic force
microscopy analysis.............................................................. 338
22.4.2 Choosing a force for indentation ........................................ 339
22.4.3 Influence of osmoticum upon macroalgal mechanics ..... 341
22.4.4 Selection of tip size ............................................................... 342
22.4.5 Performing atomic force microscopy based
elasticity measurements ....................................................... 343
22.5 Notes ..................................................................................................... 345
Acknowledgments ......................................................................................... 346
References........................................................................................................ 346

22.1 Introduction
22.1.1 Biomechanical characterization of macroalgal cell walls
The three independent multicellular macroalgae lineages (red, green, and
brown) show conserved adaptations to reducing drag, improving buoyancy,
and displaying remarkable developmental plasticity in their body forms.
As walled organisms, the structure, shape, and mechanical properties of

335
336 Protocols for Macroalgae Research

macroalgae are dependent on the cell wall—a complex hydrated compos-

ite composed predominantly of polysaccharides. The emergent cell-wall
mechanical properties are reliant on the composition, abundance, and
architecture of the components of the cell wall, which can be modulated
by the alga. The challenge now is to discern how microscale mechanical
properties of cell walls contribute to the formation of functionalized body
forms and macroscale physical properties, which allow macroalgae to grow
in a range of aquatic environments. Macroalgae grow in a variety of diverse
and demanding ecological niches: lentic (lakes), lotic (rivers), eulittoral
(intertidal), sublittoral (submerged), and epipelagic (free-floating). Atomic
force microscopy (AFM) has recently been used to study cell-wall mechan-
ics in plants but remains in its infancy for macroalgae research. The current
chapter focuses upon the application of AFM techniques to macroalgal cell
walls, with specific reference to unique challenges faced by algal researchers.

22.2 State of the art

22.2.1 Mechanical characterization of macroalgal cell walls
In comparison with terrestrial plants, macroalgae do not need to resist
gravity to grow. The body forms of most macroalgae have therefore evolved
to be flexible and pliable to survive forces in an aqueous environment.
This has resulted in a body unique tissue organization: a tightly packed
outer meristoderm surrounding a more loosely organized medulla. The
medulla cells, which are not in close association with neighboring cells,
feature large extracellular spaces between cell walls (Torode et al. 2015).
The general cell-wall composition of macroalgae features a reduction in
the abundance of load-bearing cellulose microfibrils, and a larger portion
of hydrogel matrix polysaccharides. Furthermore, the cell walls of algae
are generally thicker than those of terrestrial plants.
In plants, the use of AFM-based techniques has been used to deter-
mine tissue and cell mechanics (Milani et al. 2011; Peaucelle et al. 2011;
Fernandes et al. 2012; Sampathkumar et al. 2014) and localized changes
in cell walls because of exogenous application and endogenous expres-
sion of cell-wall modifying agents (Braybrook and Peaucelle 2013). To
date, there has been limited application of AFM-based techniques toward
macroalgae, focusing on the early life stages of embryos of Fucus serratus
(Torode,  Linardic, Braybrook, unpublished), and early sporophytes of
Ectocarpus siliculosus (Tesson and Charrier 2014). Both these samples are
ideal for AFM analysis because of their relatively small size and the self-
adhesive properties of their cells to the underlying substratum. However,
they represent a small fraction of the immense variety of morphology
within the macroalgae. Within this chapter, we will provide examples of
excised thalli and cultured zygotes.
Chapter twenty two: AFM analysis of macroalgae 337

The current chapter builds upon the expanding field of AFM-based

techniques used to study plant cell walls (Braybrook 2015) and will pro-
vide technical directions to optimize experiments for macroalgae. The
relatively recent advent of AFM techniques in plant sciences, and the com-
parative ease of transferable AFM-based skills, equipment, and software,
allows a rapid and successful application of AFM techniques to macroal-
gae research.
AFM-based indentation, as presented here, allows one to analyze
the elasticity of a biological sample. The AFM tip is used to indent into
the material, up to a maximum force, and is then withdrawn. Data are
collected throughout the process in the form of force and piezo-height
(Figure  22.1a; indentation and retraction portions of curve). The elastic-
ity of the material can be evaluated in two ways: by fitting a tangent to
− Force +

(a) (b)

(c) + Position −

Figure 22.1 An illustration of AFM-based indentation data and analysis.

AFM-based indentation experiments can measure elastic responses within the
algal cell-wall material. (a) A single indentation event consists of an approach
(darker curve) in which the tip moves toward the sample until it reaches contact
(dashed line) with the sample surface. The indentation then commences, and force
can be seen to increase. The retraction of the tip from the sample (gray curve)
can also be tracked. The indentation portion of the curve may be fit by using two
methods, both of which yield measures of elasticity. (b) A tangent (dashed orange
line) fit to the upper portion of the indentation curve (light-gray box) yields a
measure of stiffness (N  m–1). (c) The whole indentation curve (dotted gray box)
may be used to fit a Hertzian contact model (dark-black dashed line), yielding an
elastic/indentation modulus (Pa or N m–2). The cases for use of each method are
discussed at the end of the current chapter.
338 Protocols for Macroalgae Research

the indentation curve at the upper range of indentation (Figure 22.1b),

or by fitting a Hertzian-contact model to the whole indentation curve
(Figure 22.1c). In the method below, we will outline how one acquires such
data and chooses to analyze it.

22.3 Materials
• Seawater (artificial or natural)
• Fresh algae
• Razor blades/scalpel
• Forceps
• Petri dishes
• Microscope slides
• Gene Frame Seals (Thermo Scientific, 11570294)
• 1% (w/v) low-melt agarose in seawater
• AFM Cantilevers: 0.5 and 3 N m–1 stiffness; 10 nm, 1 and 10 µm tips
(Windsor Scientific, UK)
• Two-component epoxy resin
• Silica beads of various diameters (e.g., 5, 10, 50  µm; www.
microspheres-nanospheres.com)
• Atomic force microscope with top-view optics (JPK NanoWizard3,
JPK AG, Berlin)

22.4 Experimental procedures

22.4.1 Preparation of algal material for atomic
force microscopy analysis
Samples for AFM analysis must first be mounted such that the sample
does not move, is accessible to the cantilever, remains hydrated, and is not
physically restricted in a way that would alter the mechanical properties
of the sample region. We have found that macroalgal samples, other than
those which self-adhere to glass, are best mounted in low-melt agarose
upon slides.

1. Small pieces (~0.5 cm2) of macroalgal material can be excised from

the alga and maintained in seawater prior to their mounting for
AFM analysis.
2. Prepare the slide. Attach a Gene Frame to the slide by peeling off the
backing and squaring with the top/bottom slide edges. This creates
a reservoir for the seawater, keeping the sample hydrated and con-
taining the liquid.
Chapter twenty two: AFM analysis of macroalgae 339

3. Melt the agarose (1.5% [w/v] with seawater) and place ~250 µL (adjust
volume depending on sample number and size) onto the center of
the slide (within the Gene Frame), allow to partially set, and then
settle the excised algal piece on top of the agar (Note 1). Partial set-
ting allows the gel to have structure enough to hold the sample but
still enough pliability to form a good connection and fit the sample
in place.
4. Place the algae sample near to top of the agarose mound to ensure
relative flatness of the sample and minimize the chance of agarose
covering the sample.
5. Flood the reservoir with seawater.
6. Early stages of embryogenesis and sporophyte germination can be
studied without additional mounting support due to the natural
adhesive properties of the developing alga. To do this, settle fer-
tilized eggs/spores upon desired substratum (microscope slides)
that can be loaded into the AFM. When ready to start the AFM-
indentations, place a Gene Frame around the samples which forms a
reservoir of seawater to maintain hydration.

22.4.2 Choosing a force for indentation

The indentation depth is important for the experiment, but dependent
on the biological question being asked, and some prior knowledge of
the cell wall and mucilage thickness can help the experimenter choose
a good indentation depth. For example, the outer meristoderm cell wall
of Ulva flexuosa is ~25 µm with a ~5 µm mucilage layer (Messyasz et al.
2013); in Saccharina latissima, the wall thickness is ~2 µm with a mucilage
layer ~6 µm (Chapter 21 by Siméon et al.). In these examples, the experi-
menter should choose their depth on the basis of their target (mucilage or
wall and mucilage). To determine the force of indentation that yields the
desired indentation depth, a range of forces should be tested. Lower forces
result in smaller indentation depths, which can lead to error and overes-
timation of elastic properties, whereas larger forces can generate indenta-
tion depths far greater than the wall—thereby measuring internal tissue
properties, instead of the desired target mechanical properties alone.

1. Mount a macroalgal sample onto agar (as mentioned above).

2. Run a series of force spectroscopy experiments, using a range of
indentation forces. In our hands, by using a 3 N m–1 cantilever, a force
range of 100–1500  nN is suitable (Figure 22.2). Force-spectroscopy
experiments are simply a handful of point-AFM-indentations, as
opposed to the grid-based force maps used later. Upper and lower
bounds for this range of forces can be found from evaluation of
340 Protocols for Macroalgae Research

Fucus Ulva Chondrus

1X ASW
4X ASW

0.7

0.6

0.5
Depth (μm)

0.4

0.3

0.2

(a) 0.1
45

35
IM (MPa)

25

15

5
100 300 500 700 900 1100 1300 1500
(b) Force (nN)

Figure 22.2 Influence of indentation force and media upon indentation depth and
modulus in three macroalgal species. Fucus, Ulva, and Chondrus samples were
subjected to a set of force spectroscopy experiments at a range of forces in 1X
(solid) and 4X (dashed) artificial seawater (ASW). Resulting indentation depths
(a) allow the experimenter to determine an appropriate force for further experi-
ments and to examine the linearity of the material response. Resulting indenta-
tion (b) moduli (IM) allow the experimenter to assess the linearity of the material
response as well, which should be considered alongside knowledge of cell-wall
geometry. Examining sensitivity of both results to increased ASW concentration
allows for the consideration of sample sensitivity to evaporation of indentation
media during the experiment; Fucus is relatively insensitive, whereas Ulva is very
sensitive.

force/depth plots, shown by AFM testing software, of initial tests at

several reasonable forces (e.g., somewhere in range above) and allow-
ing a generous margin of error for potential sample heterogeneity.
3. Analyze the data to extract the indentation depths and moduli.
This can be achieved using the AFM manufacturer’s software
Chapter twenty two: AFM analysis of macroalgae 341

(here JPK Data Processing, JPK AG, DE) or by custom-built code. In

general, a Hertz fit to the indentation phase of the force indentation
curve will yield an indentation modulus (IM; an approximation of
the Young’s modulus; MPa). In cases of extreme adhesion, a tan-
gential fit yielding a stiffness value (N m–1) may be more appropri-
ate (Braybrook 2015).
4. Plot force by indentation depth and force by IM. Use the first plot to
determine which forces yielded an indentation depth appropriate
for the question and sample being tested: as an example, a depth that
is <5% of the meristoderm cell depth. Use the second plot to assess
whether your chosen force(s) are within a linear range, in which the
IM change is relatively flat as force increases. This is ideal but may
not always be achievable (Figure 22.2, Fucus vs. Ulva or Chondrus).
You should choose a force for your experiments, which yields the
desired indentation depth, based on these data.

22.4.3 Influence of osmoticum upon macroalgal mechanics

For the AFM-based mapping of elasticity in any given sample, we rec-
ommend using a grid of AFM-indentations, or force maps. Large, high-
resolution force-mapping can take several hours to finish. In this time, water
loss through evaporation may be detrimental to the sample, altering its
mechanical properties. This is particularly important when using seawa-
ter in which evaporation of water can lead to rapid accumulation of salts
and an altered osmoticum. Therefore, we recommend determining the
influence of hypersaline conditions upon samples before initiating force
scan experiments. This is variable between the species of macroalgae we
have tested in 1X and 4X artificial seawater: Fucus shows no difference;
Chondrus shows a similar trend, but variation in absolute values; and Ulva
shows a large variation in mechanical properties (Figure 22.2). We recom-
mend testing the sensitivity of your sample, so appropriate adjustments
can be made if needed.

1. Mount a macroalgal sample onto agar, flood with 1X sea water.

2. Find a location on the sample that is easily identifiable in the future
(take a screen shot of the location if the AFM is mounted with a
camera).
3. Run a series of force-spectroscopy experiments, using the range of
indentation forces used previously (see above).
4. Remove the microscope slide from the AFM machine, and swap the
media for a stronger concentration (Note 2), leaving 1 h to allow dif-
fusion of salts.
5. Repeat the series of force-spectroscopy experiments, using the range
of indentation forces.
342 Protocols for Macroalgae Research

6. Compare the resultant indentation depths and IMs for the two con-
centrations of media.
7. Assess whether your sample is sensitive to changes in salinity. If it
is, we recommend that the solution be exchanged often during the
experiment. This may be achieved by making an initial waterline
mark, and topping up to this during the experiment with distilled
water. The changes seen here may be due to complex phenomenon:
turgor pressure may be affected (as in plants) resulting in a lower
measured IM. In the case of Ulva, in which the cell wall is over 20 µm
thick (Messyasz et al. 2013) and a maximum indentation of 0.5 µm is
applied, it is unlikely that turgor was influencing the measurements
in 1X seawater; the material properties of the wall, and its hydrogel
matrix, may change due to both changes in salt concentration and
dehydration. It is likely that this is the dominant phenomenon seen
in Figure 22.2 for Ulva and Chondrus.

22.4.4 Selection of tip size

Due to the large variety in shape and form within the macroalgae, it is
important to determine a suitable tip size for use in experiments. Tip size
influences the possible resolution of force mapping experiments, and it
can also affect both the values of IM obtained and the tissue depth from
which those data originate (larger beads deform larger areas of tissue)
(Note 3).

1. Mount a macroalgal sample onto agar, flood with 1X seawater.

2. Find a location on the sample that is easily identifiable, this will aid
in relocation of the position for analysis (take a screen shot of the
location if the AFM has a camera).
3. Run a force-mapping experiment at the determined force. Force-
mapping experiments allow for a positional map of both sample
topography and IM/stiffness to be produced. This is helpful in
determining where you are in a sample and what features you may
be observing.
4. Change cantilever tip to another size and repeat your scan as above,
ensuring that the indentation force remains constant. It is often diffi-
cult to return to the exact position after switching tips, use the image
from step 2 to help you relocate.
5. Analyze the data, and plot the resultant IM/stiffness as a force map.
6. An ideal tip size will give good spatial resolution of tissue features.
We recommend using a 10 nm tip as a starting point due to afford-
ability and excellent resolution. Figure 22.3 demonstrates how tip
size affects both the IM and resolution of the force map.
Chapter twenty two: AFM analysis of macroalgae 343

40 20 40 20

IM (MPa)
(a) 0 0 0 0
100
90 Mean
80 Median
70
60
IM (MPa)

50
40
30
20
10
0
S. muticum; S. muticum; S. muticum; F. serratus; F. serratus; F. serratus;
10 nm 1 μm 10 μm 10 nm 1 μm 10 μm
(b) Species; tip diameter

Figure 22.3 The influence of AFM tip size on spatial resolution and indentation
modulus. Two species of brown alga, F. serratus and S. muticum, were tested using
three tip diameters but constant indentation force (10 nm, 1 µm, 10 µm; 500 nN).
Maps of indentation modulus (IM; 10 × 10 µm grids) are shown in (a). Smaller tip
sizes yield better XY resolution of surface structures and larger tip sizes give spa-
tially averaged values. (b) IM values vary with tip size and this may alter compa-
rability of datasets between experiments. The experimenter should be consistent
and clear on the tip size chosen.

22.4.5 Performing atomic force microscopy

based elasticity measurements
As mentioned earlier, elasticity data in complex samples are best acquired
in a force map or grid. This provides positional and topographical infor-
mation about the sample that can help the experimenter to gather data
from the appropriate structures or features of interest. A detailed protocol
for plant AFM-based elasticity measurements is available as a reference
for details of tip-calibration and data analysis (Braybrook 2015). In this
final section, we will outline a basic elasticity experiment and highlight
challenges unique to macroalgal samples.

1. Mount a macroalgal sample onto agar, flood with 1X seawater.

2. Place the sample-containing dish under the AFM head (with an
appropriate, calibrated tip).
3. Navigate to the sample and area you wish to test. Note that several
bio-AFMs allow the operator to choose the grid size and resolution
of a force map. Depending on your biological question and resolu-
tion need, you may range from a 10 × 10 µm grid to a 100 × 100 µm
344 Protocols for Macroalgae Research

grid with 8  ×  8–128  ×  128  points along that grid. The larger and
denser your grid, the longer the experiment but the better the reso-
lution. This decision requires some optimization by the user.
4. After utilizing the force you have experimentally determined, start
acquiring data in your force-map grid. Pay attention to the force–
position curves produced by the AFM during the run (most bio-
AFMs allow real-time observation of each curve as it is produced);
macroalgal samples can suffer from adhesion due to their coatings
of extracellular mucilage. When strong adhesion is present, as visu-
alized by a negative force at the start of the indentation curve and
end of the retraction curve (Figure 22.4), it is best to use a stiffness fit
for elasticity determination. When adhesion is only present on the
retraction curve, one can safely fit a Hertz-type model to the inden-
tation curve to obtain an IM. Figure 22.5 shows the topography of a
Fucus zygote rhizoid alongside the IM and stiffness maps obtained
through analysis.
5. Occasionally, some samples will appear very soft, indenting much
more than expected. In our experience, this results from one of two

Adhesion
Force

No adhesion
retract only

(a) (b)

Adhesion
indent and
retract

(c) Position

Figure 22.4 (a) The effect of sample adhesion on AFM-based indentation experi-
ments. In an ideal situation, there is no adhesion between the sample and the
tip. Neither the approach (dark gray) nor retraction (gray) curves result in values
that dip below the baseline noncontact force (dashed line). (b) Biological samples
often do show adhesion that may result in the tip being stuck on the sample dur-
ing retraction or (c) additionally being pulled down onto the surface early. When
adhesion is present, stiffness analysis is more appropriate.
Chapter twenty two: AFM analysis of macroalgae 345

30 2

Height (μm)

IM (MPa)
0 0

(a) (b)

Stiffness (N m−1)

(c)

Figure 22.5 An example of data obtained from AFM-based indentation tests.

Force maps of a rhizoid of F. serratus, showing (a) sample height; (b) indentation
modulus (IM, MPa); and (c) stiffness (N m–1). Indentation modulus and stiffness
show similar qualitative trends. The sample height map may be used to filter out
nonsample data (e.g., the glass surface here, low height and high IM, and stiffness).

scenarios: (1) either the sample has become unmounted in the aga-
rose or is covered in agarose, or (2) there is an inordinate amount of
mucilage on the sample. The latter can be helped by thoroughly rins-
ing your samples before mounting, the former requires remounting
of the sample.
6. When extracting data from AFM maps (i.e., for comparison of
regions), we recommend plotting values on the basis of height of
the sample and extracting the IM values as a secondary value. This
removes unconscious bias from selection of data. In Figure 22.5a, the
lowest part of the topographic map is the glass slide (also the high-
est IM and stiffness values), and this could be used as a height filter
threshold.

22.5 Notes
Note 1: When orientating samples for AFM analysis, consider the topo-
graphical structure of the algae in relation to angle and approach
of the cantilever. The cantilever requires access to the sample—
disrupting this access through ridges/obstacles will limit the capac-
ity to perform the experiment. Obtaining an unobstructed sampling
will require familiarization with the AFM you are using.
346 Protocols for Macroalgae Research

Note 2: When swapping solutions, we recommend placing the entire

microscope slide (and therefore sample) inside a Petri dish and gen-
tly flooding with desired media.
Note 3: Manufactured tips can be purchased at a 10 nm diameter, and
these are the most common types of probes. Specially made 1 µm
tips can be ordered from most companies but will be more expen-
sive. Tipless cantilevers are considerably cheaper than buying canti-
levers premounted with larger (>1 µm) beads. Beads of a variety of
sizes can be bought and mounted directly onto tipless cantilevers
through two-component epoxy resin glue.

Acknowledgments
Funding for the work presented here was provided by the Gatsby
Charitable Foundation (GAT3396/PR4; T.A.T. and S.A.B). M.L. was sup-
ported by the R. Lewin and F.E. Fritsch Prize Studentship in Phycology.
J.L.K. was supported by the George and Lillian Schiff Studentship in
Engineering. We thank our colleagues in the Phycomorph Network for
their support and collaboration (COST Action FA1406; http://www.
phycomorph.org/).

References
Braybrook, S.A. 2015. Chapter 13—Measuring the elasticity of plant cells with
atomic force microscopy. Methods in Cell Biology 125: 237–254.
Braybrook, S.A., and Peaucelle, A. 2013. Mechano-chemical aspects of organ for-
mation in arabidopsis thaliana: The relationship between auxin and pectin.
PLoS One 8(3): e57813.
Fernandes, A.N., Chen, X.Y., Scotchford, C.A., Walker, J., Wells, D.M., Roberts, C.J.,
Everitt, N.M. 2012. Mechanical properties of epidermal cells of whole liv-
ing roots of Arabidopsis thaliana: An atomic force microscopy study. Physical
Review E 85: 1–8.
Messyasz, B., Czerwik-marcinkowska, J., Massalski, A., Uher, B., Rybak, A.,
Szendzina, L., Pikosz, M. 2013. Morphological and ultrastructural studies
on Ulva flexuosa subsp. Pilifera (Chlorophyta) from Poland. Acta Societatis
Botanicorum Poloniae 82: 157–163.
Milani, P., Gholamirad, M., Trass, J., Arnéodo, A., Boudaoud, A., Argoul, F.,
Hamant, O. 2011. In vivo analysis of local wall stiffness at the shoot apical
meristem in Arabidopsis using atomic force microscopy. The Plant Journal
67: 1116–1123.
Peaucelle, A., Braybrook, S.A., Le Guillou, L., Bron, E., Kuhlemeier, C., Höfte, H.
2011. Pectin-induced changes in cell wall mechanics underlie organ initia-
tion in Arabidopsis. Current Biology 21: 1720–1726.
Sampathkumar, A., Krupinski, P., Wightman, R., Milani, P., Berquand, A.,
Boudaoud, A., Hamant, O., Jönsson, H., Meyerowitz, E.M. 2014. Subcellular
and supracellular mechanical stress prescribes cytoskeleton behavior in
Arabidopsis cotyledon pavement cells. eLife 3: e01967.
Chapter twenty two: AFM analysis of macroalgae 347

Tesson, B., and Charrier, B. 2014. Brown algal morphogenesis: Atomic force micros-
copy as a tool to study the role of mechanical forces. Frontier in Plant Science
5: 1563.
Torode, T.A., Marcus, S.E., Jam, M., Tonon, T., Blackburn, R.S., Hervé, C., Knox, J.P.
2015. Monoclonal antibodies directed to fucoidan preparations from brown
algae. PLoS One 10(2): e0118366.
chapter twenty three

Dynamic and microscale

mapping of cell growth
Case of Ectocarpus filament cells
Hervé Rabillé, Bernard Billoud, Elodie Rolland,
and Bénédicte Charrier

Contents
23.1 Introduction ......................................................................................... 350
23.2 State of the art ...................................................................................... 351
23.3 Materials ............................................................................................... 353
23.3.1 Reagents.................................................................................. 353
23.3.2 Ectocarpus culture .................................................................. 353
23.3.3 Equipment and software...................................................... 353
23.4 Experimental procedures................................................................... 354
23.4.1 Preparation of living algal material for time-lapse
microscopy ............................................................................. 354
23.4.1.1 Gametes release on glass-bottom Petri dish,
multiwell plate or free coverslips ...................... 354
23.4.1.2 Preparation of “homemade” glass bottom
Petri dishes............................................................ 354
23.4.2 Cell-surface deformation monitoring using
time-lapse microscopy ......................................................... 355
23.4.2.1 Prior preparation of the equipment .................. 356
23.4.2.2 Cell-surface labeling with fluorescent
microspheres ........................................................ 356
23.4.2.3 Measuring irreversible deformations
during growth (plastic strain) ............................ 356
23.4.2.4 Measuring deformations induced by
hypo- or hypertonic shock (mainly elastic
deformations) ....................................................... 357
23.4.3 Picture analysis: Quantification of cell-surface
marker displacement ............................................................ 359
23.5 Notes ..................................................................................................... 360
References........................................................................................................ 362

349
350 Protocols for Macroalgae Research

23.1 Introduction
Macroalgal cells are surrounded by a stiff cell wall that prevents any
relative cell displacement inside the multicellular thallus (Mirabet et al.
2011; Charrier et  al. 2012). As a consequence, their development and
morphogenesis rely mainly on the pattern of cell division and cell elon-
gation, which impacts the proper final shape (Kuchen et al. 2012; Bassel
et al. 2014). Cell growth and morphogenesis imply mechanical deforma-
tions, which depends on molecular signaling pathways impacting the
mechanical properties of the cellular components and/or act through
force generation (Boudaoud 2010; Uyttewaal et al. 2010; Robinson et  al.
2013). Before getting an integrated understanding of morphogenetic
mechanisms, geometrical deformations of cells and tissues must be char-
acterized and quantified (Mirabet et al. 2011). Moreover, characterization of
cell or tissue mechanical properties (i.e., deformability) is needed to assess
the physical and structural basis of deformations and to understand how
such deformations are regulated (Geitmann 2006; Routier-Kierzkowska
and Smith 2013). Deformations can be measured in response to external or
internal force variations (i.e., turgor) and allow one to get insight into the
possible biological mechanisms regulating the mechanical deformations
(Peters and Bernstein 1997). Deformation can be linked to the localization
of cellular factors such as cell-wall components, delivered vesicles, or ele-
ments of the cytoskeleton.
Many studies monitored the displacement of natural or artificial
surface markers regularly or randomly scattered at the cell surface dur-
ing growth and morphogenesis. Such studies were mainly conducted in
green land plants (Richards and Kavanagh 1943; Erickson and Sax 1956;
Hejnowicz and Brodzki 1960; Schnyder et al. 1987; Kutschera and Briggs
1988; Shaw et al. 2000; Menand et al. 2007; Armour et al. 2015; Yanagisawa
et  al. 2015), green algae (Green 1965b; Chen 1973; Métraux et  al. 1980;
Hejnowicz et al. 1977; Serikawa and Mandoli 1998; Von Dassow et al. 2001),
and fungi (Castle 1958; Soll and Herman 1983; Soll et  al. 1985; Staebell
and Soll 1985; Bartnicki-Garcia et  al. 2000; Abenza et  al. 2015) but were
much less attempted on other groups of macroalgae (Waaland et al. 1972;
Kataoka 1982).
To our knowledge, no kinetic studies of cell or tissue growth pattern
were conducted in brown algae (Phaeophyceae), whereas this class of mac-
roalgae displays interesting specific features, among which are its great
morphological diversity and its phylogenetic position (Charrier et  al.
2012; Bogaert et  al. 2013). In the current chapter, we describe a protocol
to observe the fine pattern of cell-surface deformations during growth or
in response to turgor variations (osmotic shocks) in the sporophytic fila-
ments of Ectocarpus siliculosus, a model species for the brown algae. Cell
surface was marked with commercial fluorescent microspheres that get
Chapter twenty three: Dynamic and microscale mapping of cell growth 351

stuck on the cell wall, and deformations were observed by epifluorescence

or confocal laser-scanning microscopy. Instructions for the image anal-
ysis and calculation of cell-wall deformations are also provided. In the
future, such protocol could be adapted on morphologically more complex,
multicellular brown algal thalli to provide a more accurate description of
the volume changes potentially experienced during the lifetime of these
organisms.

23.2 State of the art

During the twentieth century, surface-marking experiments have been
extensively used to follow the deformations of tissue and cell surface dur-
ing the development of animal (Cox and Peacock 1978), plant, and fungal
organisms (see references in the introduction). The principle was to fol-
low, in the course of time, the displacement rate of markers regularly or
randomly scattered at the surface of an organ. Doing so allowed one to
localize the growing region, its local growth rate, and potential growth
anisotropy. In land plants, most kinematic studies were focused on roots
(Erickson and Sax 1956; Hejnowicz and Brodzki 1960), leaves (Richards
and Kavanagh 1943; Kemp 1980; Schnyder et  al. 1987, 1990), and stem
growth (Kutschera and Briggs 1988). Determining the rate of distance
increase between markers or between markers and a reference point pro-
vided segmental growth rates (Peters and Bernstein 1997). More complex
calculation allowed one to calculate the growth field or field of displacement
vectors that can provide many different kinematic, mechanical, and physi-
ological information regarding the growing organ (Silk and Erickson
1979; Silk 1984). These numerical approaches are beyond the scope of the
present protocol, which focuses on the analysis of cellular growth and
morphogenesis.
Many studies were focused on individual cell morphogenesis. The
aim was to observe the local growth dynamics, and in some cases, to
assess the mechanical properties of the extracellular matrix (i.e., the plant
and algal cell walls). Reaching these objectives required that (1) the sur-
face of the cell be labeled with fine markers, to allow a resolution at the
subcellular level; and (2) the relative displacement of markers be followed
by time-lapse microscopy and their trajectory be recorded, traced, and
analyzed.
To fulfill these requirements, different kinds of surface markers
were used. In rare cases, items such as dust or cell fragments naturally
occurring at the cell surface were considered (Suzaki and Williamson
1985), but in most studies artificial markers deposited on the cell sur-
face were required. Their nature depends on the chemical composition
of the cell wall and the growth medium. Small grains were released
close to the cells (by pipetting), to which they bound randomly through
352 Protocols for Macroalgae Research

ionic, weak chemical interactions with the cell wall. First studies using
giant-celled characean algae such as Nitella or Acetabularia used anionic
resin particles (Green 1965a, b; Chen 1973; Hejnowicz et  al. 1977;
Métraux et al. 1980; Kataoka 1982) or carbon particles (Waaland et al.
1972; Serikawa and Mandoli 1998; Von Dassow et  al. 2001), whereas
Castle (1958) used starch grain on the tip-growing sporangiophore of
Phycomyces. In other eumycetes, polystyrenes beads (Soll et  al. 1985;
Staebell and Soll 1985) or carbon particles (Bartnicki-Garcia et al. 2000)
were used. In all these studies, the displacements of surface mark-
ers were followed by time-lapse optical microscopy, sometimes with
special devices using horizontal objectives to observe cells growing
vertically (Castle 1958; Green 1965b; Chen 1973; Métraux et al. 1980).
Most recent studies on fungal or land plant tip-growing cells used fluo-
rescent surface markers such as commercial fluorescent microspheres
(Shaw et al. 2000; Dumais et al. 2004; Menand et al. 2007; Abenza et al.
2015; Yanagisawa et al. 2015) or droplets of fluorescent paint (Armour
et al. 2015), and deformation was monitored using epifluorescence or
confocal scanning microscopy.
After the time-lapse acquisition, images must be extracted, and
individual particle trajectories are mapped to quantify cell-surface
deformations. In the first studies, pictures were imprinted, and mor-
phometric measurements were done manually on imprinted images
(Castle 1958; Green 1965b; Kataoka 1982). Use of image analysis soft-
ware allowed more rapid image normalization (for size and growth
axis orientation) and analysis (Soll et  al. 1985; Staebell and Soll 1985;
Bartnicki-Garcia et  al. 2000; Shaw et  al. 2000; Mine and Okuda 2003;
Menand et al. 2007; Abenza et al. 2015; Armour et al. 2015; Yanagisawa
et al. 2015).
Several methods for the calculation of the deformation were employed.
The simplest studies used surface-marking experiments only to locate
and measure the extent of the growth site in individual cells (Soll et al.
1985; Serikawa and Mandoli 1998; Menand et al. 2007). Bartnicki-Garcia
et al. (2000) finely traced the trajectory of markers on the growing tip and
compared them with theoretical trajectories predicted by various growth
models. However, most studies, especially those dedicated to tip-growing
cells, calculated the relative elemental growth rate as described in Peters
and Bernstein (1997). This approaches the irreversible and ideal extension
rate of an infinitely small elemental piece of cell wall in two perpendicu-
lar directions (and thus the growth anisotropy) as a function of its posi-
tion along the cells (generally relatively to a point of reference) (Castle
1958; Green 1965b; Chen 1973; Hejnowicz et al. 1977; Shaw et al. 2000; Von
Dassow et  al. 2001; Dumais et  al. 2004; Abenza et  al. 2015). Some more
complex, computational approaches also exist (see, e.g., Armour et  al.
2015) but are out of the scope of this chapter.
Chapter twenty three: Dynamic and microscale mapping of cell growth 353

23.3 Materials
23.3.1 Reagents
• Seawater.
• Ethanol 70% (v:v).

A stock solution of fluorescent microspheres. We used FluoSpheresTM

amine, 0.2 µm, red (F8763, Molecular Probes). In the rest of the chapter,
these surface markers will be referred to as fluospheres. Concentration
of stock solution is 2% (w:v) in distilled water. Working solution of fluo-
spheres is prepared by diluting the stock solution to 0.1%–0.01% (w:v) in
seawater (Natural Sea Water [NSW] or artificial seawater [ASW]). The two
solutions must be kept at 4°C in the dark. Fluospheres tend to agglomer-
ate and to accumulate at the bottom of the tube, so the solution must be
vigorously vortexed or sonicated before use. Keep the solution sterile if
possible.

23.3.2 Ectocarpus culture

The material necessary for the standard cultivation of Ectocarpus was
described previously (Le Bail and Charrier 2013). To carry out the proto-
col, additional material is required.
Sterile glass-bottom Petri dishes or sterile glass bottom multiwell
plates (×6 or  ×24  wells) for tissue culture. If cultivating Ectocarpus on
these materials is unsuccessful, culture it on 22 × 22 mm sterile coverslips
(that must be autoclaved in an oven at 180°C for 2 h) loaded in conven-
tional Petri dishes (55 or 90  mm in diameter). Then prepare homemade
glass bottom Petri dishes from this material according to the protocol
described in Section 23.4.1.2.

23.3.3 Equipment and software

• Blu-tack®.
• Double-faced adhesive tape.
• Parafilm® strips.
• Waterproof silicone glue.
• Fine forceps, needle, and scalpel (or box cutter).
• Empty Petri dishes, which bottom is lined with Parafilm®.
• 1000 and 100 µL pipettors.
• Inverted epifluorescence or confocal laser-scanning microscope,
equipped with a camera and a motorized stage. The whole system
must be piloted by software that allows recording multiple posi-
tions on the stage and in time-lapse mode. We used a DMI6000-
inverted epifluorescence videomicroscope (Leica) or TCS SP5
354 Protocols for Macroalgae Research

Acousto-Optical Beam Splitter (AOBS)–inverted confocal micro-

scope (Leica) equipped with the LAS AF (v2.2.1, Leica) software.
• White LED lamp programmed on a 14:10 h day/light cycle.
• Confined, air-conditioned culture cabinet enclosing the microscope
to maintain a temperature compatible with Ectocarpus cultivation.
• Hot air pistol, which temperature should be around 600°C–700°C.
• Metal perforator used to make holes in the bottom of the 55 mm
polystyrene Petri dishes. This perforator is held at the extremity of a
wood stick and heated up to about 600°C–700°C.

23.4 Experimental procedures

23.4.1 Preparation of living algal material
for time-lapse microscopy
23.4.1.1 Gametes release on glass-bottom Petri dish,
multiwell plate or free coverslips
A detailed protocol for the production of Ectocarpus filaments and gametes
is described in Le Bail and Charrier (2013). Specifically for this chapter, the
instructions are as follows:

1. Prepare Ectocarpus sporophytic filaments by loading gametes in ster-

ile glass-bottom Petri dishes or coverslips as described in Le Bail and
Charrier (2013).
2. Once the young filaments initiate branching (usually after 2 weeks),
they are ready to be used for the time-lapse experiment.

23.4.1.2 Preparation of “homemade” glass bottom Petri dishes

Cultivation of Ectocarpus in Petri dishes equipped with a glass bottom is
necessary for accurately monitoring the cell-surface markers under the
microscope. Difficulties were met when trying to grow Ectocarpus fila-
ments in glass-bottom Petri dishes or multiwell plates bought from com-
mercial suppliers (Note 1). Alternatives consist in preparing homemade
glass bottom Petri dishes. The protocol involves sticking glass coverslips
with Ectocarpus filaments germinated on it below conventional Petri
dishes (typically 55  mm in diameter) previously drilled with a hole in
their center.

1. Two weeks before, make filaments grow on glass coverslips accord-

ing to the procedure described in Section 23.4.1.1.
2. By using a metal perforator heated with a hot air gun (adequate tem-
perature: 600°C–700°C), make a hole at the center of the bottom of
empty 55  mm wide Petri dishes (Note 2). Ideally, the hole must be
between 10 and 12 mm in diameter (Note 3).
Chapter twenty three: Dynamic and microscale mapping of cell growth 355

3. Under a sterile laminar flow hood, spray the Petri dishes (and their
lid) copiously with 70% ethanol and let them dry overnight under
the UV light of the hood.
4. The next day, keep the dishes under the laminar flow hood. Once
they are completely dry, cut 22  ×  22 mm square pieces of double-
faced adhesive tape (i.e., of the size of a coverslip). Stick each piece
below the bottom of a drilled dish (Note 4), centering it on the hole of
the dish.
5. By using a fine sterilized scalpel or cutter, cut the central part of each
piece of the adhesive tape facing the hole of the dish.
6. Open the culture dishes bearing the inoculated coverslips. Remove
most of the filaments on the surface of the coverslip with fine for-
ceps, except a few at the very center.
7. Remove the coverslip from its Petri dish using forceps and a fine
needle. Gently dry the coverslips with a paper towel, except at the
center of the top face, where a few number of filaments must be kept
(Note 5). Be sure to let a small drop of seawater at this place to protect
those filaments from desiccation. This drop must have a diameter
lower than that of the central hole of the drilled dish.
8. Put the coverslip on the lid of a 50 mL Falcon tube. Then stick it
right below a drilled dish with a piece of double-faced adhesive tape.
Make sure that the square-shaped piece of double-faced adhesive
tape is right on the coverslip, and that the central filaments within
their drop of seawater end up in the hole of the dish. Press gently for
about 10 s on the internal face of the dish, around the central hole
(Note 6).
9. Immediately fill the dish with seawater and seal it with Parafilm®.
10. Paste the border of the coverslip (i.e., at the junction with the bottom
of the dish) with silicone glue using the tip of a pipettor cone (Note 7).
11. Place the dish under standard culture conditions for one night. Make
the dish straddle two inverted empty dishes or Falcon tube lids to
have the bottom face (with silicone glue) not in contact with the shelf
of the culture cabinet.
12. One day later, when the silicone glue is dry, the homemade glass-
bottom Petri dishes are ready to be used for time-lapse experiments.

23.4.2 Cell-surface deformation monitoring

using time-lapse microscopy
High magnification (×1000 or ×2000) is required to finely observe the
position and displacement of fluospheres at the surface of Ectocarpus cells.
Moreover, the focus plane must be thin enough to distinguish fluospheres
in the different planes of the cell. For these reasons, we recommend con-
focal microscopy (Note 8). We used a TCS SP5 AOBS–inverted confocal
356 Protocols for Macroalgae Research

microscope (Leica) or a DMI6000-inverted video microscope, which are

both controlled by a LAS AF (v2.2.1, Leica) software.

23.4.2.1 Prior preparation of the equipment

The microscope devices must be switched on and ready to use before
filaments labeling with fluospheres.

1. Select the appropriate lasers. As we used red fluospheres (F8763,

excitation-emission maximums: 580/605), we used a DPSS 561 nm
laser.
2. Select the appropriate excitation wavelength and appropriate detec-
tion range (Photomultiplier Tubes [PMT] module) according to the
characteristic of the fluospheres used. Activate the bright-field PMT
that will reconstruct a virtual bright-field image of the cell. Both flu-
orescent and bright-field pictures must be acquired at every acquisi-
tion (Note 9).

23.4.2.2 Cell-surface labeling with fluorescent microspheres

1. Open a glass bottom Petri dish (commercial or homemade, cf
Section 23.4.1.2) or multiwell plate, with filaments germinated inside.
Remove most of the culture medium and let the filaments immersed
into some drops of the medium.
2. Just above the filaments, add a small volume (20–50 µL) of fluosphere
solution (Note 10). Pipette the fluosphere solution up and down
repeatedly and rapidly on the filaments for 1 min (Note 11). Take care
not to tear off the filaments from the glass surface.
3. Add some milliliters of seawaters completed with 10 µL/mL of
Provasoli’s enrichment medium (ASWp or NSWp) and shake the
dish gently and manually to wash out the exceeding fluospheres not
bound to the filament surface.
4. Remove the washing medium and fill the dish/well with fresh
seawater. Seal with Parafilm® stripes. Mount it immediately under
the microscope previously prepared for time-lapse experiments
(Section 23.4.2.1).

23.4.2.3 Measuring irreversible deformations

during growth (plastic strain)
In this section, we describe how to monitor cell-surface deformation
during growth or morphogenesis. The example here is the tip-growth
of Ectocarpus sporophyte vegetative filaments. The seawater volume in
which filaments are incubated (~15 mL in a 55 mm Petri dish, or 2–5 mL
in a well of a multiwell plate) is enough to allow normal growth without
renewal of the medium during a few days.
Chapter twenty three: Dynamic and microscale mapping of cell growth 357

1. As soon as the filaments have been labeled with fluorescent mark-

ers (see Section 23.4.2.2), mount the dish on the appropriate object
holder. If there is any slack between the dish and the object holder,
stuck it by inserting small pieces of Blu-tack® or modeling clay.
2. Mount the object-holder on the motorized stage of the inverted
microscope and locate an interesting individual at the surface of the
glass bottom (×100 immersion objective is recommended).
3. Select the cells of interest: Adequate cells must be located just above
the glass surface and with their growth axis parallel to it (i.e., focus
plane) (Note 12). Mark the position of each cell (x/y/z coordinates)
(Note 13). From this moment, the dish must not be moved from its
location on the motorized stage. If the imaging software allows it,
optimize the experiment by monitoring several cells in different
wells of a multiwell plate, thus testing different growth conditions
in the same experiment (Note 14). Save the set of positions for the
next time point.
4. Once all the cells with valuable labeling have been selected and
marked, initiate the time-lapse and acquire the first time point (t0).
5. Before acquiring pictures at the next steps (t n), check that the posi-
tions were conserved (Note 15). Acquire a new series of pictures and
repeat the procedure as many times as necessary.
6. When the time-lapse is completed, export the pictures. Figure 23.1
shows an example of time-lapse series of pictures produced by a
growing apical cell, showing displacement of fluospheres restricted
to the dome.

23.4.2.4 Measuring deformations induced by hypo- or

hypertonic shock (mainly elastic deformations)
To acquire data about the in-plane elasticity of the cell wall, deformation
of the cell surface in response to osmotic shocks can be monitored. That
will also provide information about the mechanical anisotropy of the cell
wall, that is, the different stretching potentials in one direction compared
with the perpendicular one.

1. Prepare the microscope and all the necessary devices as described in

Section 23.4.2.1. As the deformations take place on very short term,
culture cabinet and LED lamp are not required (Note 16).
2. After filament labeling with fluospheres (Section 23.4.2.2), add a
small amount of seawater (osmolarity ~1100 mOsm L−1) in the dish.
Do not seal it with Parafilm®.
3. Mount the dish under the microscope without its lid. Record the
position (x/y/z) of a set of interesting cells. To ensure reliable acqui-
sitions of very fast cell response to osmotic shocks, we recommend
358 Protocols for Macroalgae Research

c b a

d
e f g

c b a

d
(a) e f g

b c
a

e f
d

b c
a

e f
d
(b)

Figure 23.1 Example of surface deformation pattern of Ectocarpus cells observed

by surface labeling with fluospheres, and using time-lapse fluorescent microscopy.
Some individual markers (or marker aggregates) are labeled with letters to display
their respective displacement. (a) Cell-wall strain observed during growth of one
Ectocarpus apical cell. Time elapsed between the first (top) and the second (bottom)
acquisitions was 4  h. Note the displacement of marker d compared with markers
c and e; (b) example of cell-wall deformation in an Ectocarpus (subapical) cell in
response to a hypotonic shock (transfer from NSW ~1100 mOsm L−1, to half-strength
NSW ~550 mOsm L−1, resulting in cell inflation). Images show the cell just before
(top) and ~1 min after transfer into the diluted medium (bottom). Note the significant
circumferential displacement of markers a, b, and c compared with the position of
markers d, e, and f, whereas the meridional displacement is negligible. (left) bright-
field image; (right) corresponding fluorescent picture. Bar = 5 µm for all pictures.
Chapter twenty three: Dynamic and microscale mapping of cell growth 359

not selecting more than 4–5 positions, and no more than 1–2 focus
planes per position (Note 17).
4. Acquire the first series of pictures corresponding to the initial state
of the cells (t0 = normal osmolarity) (Note 18).
5. By using a pipette, take off most of the seawater from the dish.
6. Immediately after, fill the dish with a large volume (from 2 to 15 mL,
according to the volume available) of hypotonic or hypertonic sea-
water (Note 19). Then, correct each position that will probably be
modified in the z-axis because of the change of medium (Note 20).
7. After a short time (elastic stretching of Ectocarpus cell wall takes
about 1 min), acquire a second series of pictures at the same posi-
tions. This second series will correspond to the stable, inflated (after
hypotonic shocks), or shrunk (after hypertonic shocks) state of the
cells.
8. Export the pictures. Figure 23.1 shows a cell from an Ectocarpus fila-
ment, surface deformation of which was monitored after a hypotonic
shock in half-strength seawater.

23.4.3 Picture analysis: Quantification of cell-surface

marker displacement
This final section provides some instructions for image analysis, measure-
ment, and quantification of surface-marker displacement and for corre-
sponding calculation of significant geometric or mechanical parameters.

1. For each time point and each position, export one bright-field pic-
ture of the median plane of the cell and one or several fluorescent
pictures of one or several planes of the cell showing fluospheres.
2. Process images using dedicated software such as GIMP (Smith and
Joost 2012; available at https://www.gimp.org). First, if time-lapse
facilities do not allow one to faithfully superpose successive images,
this should be done manually by using translations and/or rota-
tions, taking static markers outside the cell as landmarks. On each
image, draw a 1-pixel large line onto the cell wall, making the cell
contour. For convenience, this line should be drawn in color if the
microscope picture is black-and-white, and/or drawn on a separate
layer. Similarly, denote each marker by a pixel in another color.
3. From each cell contour, compute a cubic spline, thus creating one spline
per image. Smoothing should be carefully adjusted to avoid effects at
pixel-size scale, yet keeping local contour curvature. Similarly, build
a trajectory for each marker, by joining all marker pixels of the same
color in the time series, leading to one spline per marker. The degree
of each spline should be three, but if less than four-time steps are
available, then the degree should be n − 1 for n images.
360 Protocols for Macroalgae Research

4. Consider each intersection between a cell contour and a marker

trajectory (each represented by its spline). From these, it is possible
to compute the mean velocities of each point during one interim-
age duration, and the angle between the two curves (deduced from
the first derivatives at the intersection point). These raw data can be
processed by using standard statistical analysis software, such as R
Core Team (2016).

Software designed to perform steps 3 and 4 can be obtained upon request

to the authors.

23.5 Notes
Note 1: In most cases, we observed a bloom of bacteria invading the
whole glass bottom, rapidly killing and consuming all the early
Ectocarpus filaments.
Note 2: This step is dangerous and must be carried out in adequate
safety conditions. The metal perforator must be held at the extrem-
ity of a handle made of an isolating material (e.g., wood) to prevent
any burning injury.
Note 3: The hole must be much lower in size compared with the size of
the coverslip (22 × 22 mm).
Note 4: To efficiently stick the double-faced adhesive tape on the exte-
rior face of the dish bottom, turn the dish upside-down without its
lid, on the lid of a 50 mL Falcon tube (the top face of the Falcon lid
must be in contact with the internal face of the bottom of the dish).
Then press the adhesive tape on the exterior face of the dish bottom.
Note 5: Clean and dry the peripheral border of the coverslip to ensure a
good sticking of the coverslip under the double-faced adhesive tape
(cf the next step). Indeed, Ectocarpus and bacteria growing on the
surface of the coverslip seem to deposit some substances that make
the surface more hydrophilic. Cleaning the surface with a paper
towel will thus prevent the central drop of seawater from spreading
on the coverslip.
Note 6: You can press on the internal face of the Petri dish around the
central hole using a 50 mL Falcon tube without its lid and turned
upside-down.
Note 7: Be careful to keep the center of the coverslip clean of any trace
of glue, especially the area facing the central hole. This area must be
perfectly clean when high-magnification observations are planned.
Make sure that the silicone glue forms a thin bulge all around the
periphery of the coverslip, which does not diffuse to the center of
the coverslip. It would otherwise impede the movement of the thin
high-magnification objective.
Chapter twenty three: Dynamic and microscale mapping of cell growth 361

Note 8: It is also possible to use epifluorescence video micro-

scope. Note that, on both types of microscope, the exposition of
Ectocarpus filament to strong white or fluorescent light has del-
eterious effects on the cell physiology. In our experiment, we
observed that less than half of the apical cells continue to grow
after time-lapse initiation.
Note 9: Bright-field pictures are necessary for drawing the contour of
the cell required for picture analyses.
Note 10: The fluospheres tend to aggregate and sink at the bottom of
the tube. Vortex or sonicate the solution just before using it. The
concentration of the working fluospheres solution must be adjusted
according to the algal material used and to the required density of
fluospheres on the cell surface. Make some tests before starting a
time-lapse. We used a 0.1% (w:v) working concentration.
Note 11: The rapid flow of fluospheres solution around the filament will
enhance the sticking of fluospheres on the surface of the cell.
Note 12: Observing the cell in a plane passing through the symmetry axis
will facilitate the geometrical analysis of fluosphere displacement.
Note 13: Each position is given a number. When needed, depending on
the software used, clicking on the appropriate number on the drop-
down list allows one to reach any position on the coverslips rapidly.
Each position can be easily reassigned, suppressed, or renamed.
Note 14: If working on a multiwell plate with oil objective, it may be
necessary to put back the objective when switching from one well
to another. In this situation, the number of well usable for one time-
lapse would be limited, and the time-lapse would have to be con-
ducted manually.
Note 15: If the time interval between each acquisition is large (i.e., 12 h
or more), it might be preferable to switch off all the devices except the
air-conditioned cabinet and the LED lamps between each acquisition
to avoid any extra heat produced by the equipment. Make sure that
the positions were maintained before any subsequent acquisition.
Note 16: However, if the environment around the microscope is too hot
(due to the activity of the camera or another device), the use of an
air-conditioned cabinet would be required.
Note 17: At every chosen position, all the cells to be analyzed should
be more or less in the same meridional plane. For this purpose, you
should select filaments lying on the glass surface. Nonetheless, note
that the physical adherence of cells to the glass surface could impact
the deformability of cells.
Note 18: When positions are unstable, acquire each position one by one.
Note 19: The large volume of hypo/hypertonic medium will exceed by
far that of the remaining initial medium. Therefore, the impact of the
latter on the final osmolarity is negligible.
362 Protocols for Macroalgae Research

Note 20: The addition of several milliliters of medium in the dish will
increase the total weight on the object-holder and the stage. This can
lower all the positions by several µm and thereby require correction
of the z-position before the acquisition.

References
Abenza, J. F., E. Couturier, J. Dodgson, J. Dickmann, A. Chessel, J. Dumais,
and R.  E. C. Salas. 2015. Wall mechanics and exocytosis define the shape
of growth domains in fission yeast. Nature Commun 6. Nature Publishing
Group: 8400. doi:10.1038/ncomms9400.
Armour, W. J., D. A. Barton, A. M. Law, and R. L. Overall. 2015. Differential
growth in periclinal and anticlinal walls during lobe formation in arabi-
dopsis cotyledon pavement cells. Plant Cell 27 (9): 2484–2500. doi:10.1105/
tpc.114.126664.
Bartnicki-Garcia, S., C. E. Bracker, G. Gierz, R. López-Franco, and H. Lu. 2000.
Mapping the growth of fungal hyphae: Orthogonal cell wall expansion dur-
ing tip growth and the role of turgor. Biophys J 79 (5): 2382–2390. doi:10.1016/
S0006-3495(00)76483-6.
Bassel, G. W., P. Stamm, G. Mosca, P. Barbier de Reuille, D. J. Gibbs, R. Winter,
A. Janka, M. J. Holdsworth, and R. S. Smith. 2014. Mechanical constraints
imposed by 3D cellular geometry and arrangement modulate growth pat-
terns in the arabidopsis embryo. Proc Natl Acad Sci USA 111 (23): 8685–8690.
doi:10.1073/pnas.1404616111.
Bogaert, K. A., A. Arun, S. M. Coelho, and O. De Clerck. 2013. Brown algae as a
model for plant organogenesis. In Plant Organogenesis: Methods and Protocols,
I. De Smet (Ed.), Vol. 959, pp. 97–125. New York: Springer Science+Business
Media. doi:10.1007/978-1-62703-221-6.
Boudaoud, A. 2010. An introduction to the mechanics of morphogenesis for plant
biologists. Trends Plant Sci 15 (6): 353–360. doi:10.1016/j.tplants.2010.04.002.
Castle, E. S. 1958. The topography of tip growth in a plant cell. J Gen Physiol 41:
377–383.
Charrier, B., A. Le Bail, B. de Reviers, A. L. Bail, and B. D. Reviers. 2012. Plant pro-
teus: Brown algal morphological plasticity and underlying developmental
mechanisms. Trends Plant Sci 17 (8): 468–477. doi:10.1016/j.tplants.2012.03.003.
Chen, J. C. W. 1973. The kinetics of tip growth in the nitella rhizoid. Plant Cell
Physiol 14 (4): 631–640.
Cox, R. W., and M. A. Peacock. 1978. The velocity field of growing ear cartilage.
J Anat 126 (Pt 3): 555.
Dumais, J., S. R. Long, and S. L. Shaw. 2004. The mechanics of surface expansion
anisotropy in Medicago Truncatula root hairs. Plant Physiol 136 (2): 3266–3275.
doi:10.1104/pp.104.043752.
Erickson, R. O., and K. B. Sax. 1956. Elemental growth rate of the primary root of
zea mays. Proc Natl Acad Sci USA 100 (5): 487–498.
Geitmann, A. 2006. Experimental approaches used to quantify physical parame-
ters at cellular and subcellular levels. Am J Bot 93 (10): 1380–1390. doi:10.3732/
ajb.93.10.1380.
Green, P. B. 1965a. Anion-exchange resin spheres as marking material for wet cell
surfaces. Exp Cell Res 40: 195–196.
Chapter twenty three: Dynamic and microscale mapping of cell growth 363

Green, P. B. 1965b. Pathways of cellular morphogenesis. A diversity in nitella.

J Cell Biol 27 (2): 343–363. doi:10.1083/jcb.27.2.343.
Hejnowicz, Z., and P. Brodzki. 1960. The growth of root cells as the function of time
and their position in the root. Acta Soc Bot Pol 29 (4): 625–644. doi:10.5586/
asbp.1960.032.
Hejnowicz, Z., B. Heinemann, and A. Sievers. 1977. Tip growth: Patterns of growth
rate and stress in the chara rhizoid. Zeitschrift für Pflanzenphysiologie 81 (5):
409–424. doi:10.1016/S0044-328X(77)80176-1.
Kataoka, H. 1982. Colchicine-induced expansion of vaucheria cell apex. Alteration
from isotropic to transversally anisotropic growth. Bot Mag Tokyo 95 (3):
317–330. doi:10.1007/BF02488543.
Kemp, D. R. 1980. The location and size of the extension zone of emerging wheat
leaves. New Phytol 84: 729–737.
Kuchen, E. E., S. Fox, P. Barbier de Reuille, R. Kennaway, S. Bensmihen, J. Avondo,
G. M. Calder et  al. 2012. Generation of leaf shape through early patterns
of growth and tissue polarity. Science 335 (111): 1092–1095. doi:10.1126/
science.1245938.
Kutschera, U., and W. R. Briggs. 1988. Growth, in vivo extensibility, and tissue ten-
sion in developing pea internodes. Plant Physiol 86 (1): 306–311.
Le Bail, A., and B. Charrier. 2013. Culture methods and mutant generation in
the filamentous brown algae Ectocarpus Siliculosus. In Plant Organogenesis:
Methods and Protocols, I. De Smet (Ed.), Vol. 959, pp. 235–245. New York:
Springer Science+Business Media New York.
Menand, B., G. Calder, and L. Dolan. 2007. Both chloronemal and caulonemal cells
expand by tip growth in the moss Physcomitrella Patens. J Exp Bot 58 (7): 1843–
1849. doi:10.1093/jxb/erm047.
Métraux, J.-P., P. A. Richmond, and L. Taiz. 1980. Control of cell elongation in
Nitella by endogenous cell wall pH gradients. Plant Physiol 65 (2): 204–210.
Mine, I., and K. Okuda. 2003. Extensibility of isolated cell walls in the giant tip-
growing cells of the Xanthophycean alga Vaucheria Terrestris. Planta 217 (3):
425–435. doi:10.1007/s00425-003-0993-8.
Mirabet, V., P. Das, A. Boudaoud, and O. Hamant. 2011. The role of mechanical
forces in plant morphogenesis. Ann Rev Plant Biol 62: 365–385. doi:10.1146/
annurev-arplant-042110-103852.
Peters, W. S., and N. Bernstein. 1997. The determination of relative elemental
growth rate profiles from segmental growth rates. Plant Physiol 113: 1395–1404.
R Core Team. 2016. R: A Language and Environment for Statistical Computing. Vienna,
Austria: R Foundation for Statistical Computing. (https://www.R-project.
org/)
Richards, O. W., and A. J. Kavanagh. 1943. The analysis of the relative growth gra-
dients and changing form of growing organisms: Illustrated by the tobacco
leaf. Am Nat 77 (772): 385–399. doi:10.1086/281140.
Robinson, S., A. Burian, E. Couturier, B. Landrein, M. Louveaux, E. D. Neumann,
A. Peaucelle, A. Weber, and N. Nakayama. 2013. Mechanical control of mor-
phogenesis at the shoot apex. J Exp Bot 64 (15): 4729–4744. doi:10.1093/jxb/ert199.
Routier-Kierzkowska, A. L., and R. S. Smith. 2013. Measuring the mechanics of
morphogenesis. Curr Opin Plant Biol 16 (1): 25–32. doi:10.1016/j.pbi.2012.11.002.
Schnyder, H., C. J. Nelson, and J. H Coutts. 1987. Assessment of spatial distribu-
tion of growth in the elongation zone of grass leaf blades. Plant Physiol 85 (1):
290–293. doi:10.1104/pp.85.1.290.
364 Protocols for Macroalgae Research

Schnyder, H., S. Seo, I. F. Rademacher, and W. Kühbauch. 1990. Spatial distribution

of growth rates and of epidermal cell lengths in the elongation zone during
leaf development in Lolium Perenne L. Planta 181 (3): 423–431. doi:10.1007/
BF00195897.
Serikawa, K. A., and D. F. Mandoli. 1998. An analysis of morphogenesis of the
reproductive whorl of Acetabularia Acetabulum. Planta 207 (1): 96–104.
doi:10.1007/s004250050460.
Shaw, S. L., J. Dumais, and S. R. Long. 2000. Cell surface expansion in polarly
growing root hairs of Medicago Truncatula. Plant Physiol 124 (3): 959–970.
doi:10.1104/pp.124.3.959.
Silk, W. K. 1984. Quantitative descriptions of development. Ann Rev Plant Physio
35 (1): 479–518. doi:10.1146/annurev.arplant.35.1.479.
Silk, W. K., and R. O. Erickson. 1979. Kinematics of plant growth. J Theor Biol 76 (4):
481–501. doi:10.1016/0022-5193(79)90014-6.
Smith, J., and R. Joost. 2012. GIMP for Absolute Beginners. Berkeley, CA: Apress.
Soll, D. R., and M. A. Herman. 1983. Growth and the inducibility of mycelium for-
mation in Candida Albicans: A single-cell analysis using a perfusion cham-
ber. J Gen Microbiol 129 (9): 2809–2824.
Soll, D. R., M. A. Herman, and M. A. Staebell. 1985. The involvement of cell wall
expansion in the two modes of mycelium formation of Candida Albicans.
J Gen Microbiol 131 (9): 2367–2375.
Staebell, M., and D. R. Soll. 1985. Temporal and spatial differences in cell wall
expansion during bud and mycelium formation in Candida Albicans. J Gen
Microbiol 131 (6): 1467–1480. doi:10.1099/00221287-131-6-1467.
Suzaki, T., and R. E. Williamson. 1985. Euglenoid movement in Euglena Fusca:
Evidence for sliding between Pellicular Strips. Protoplasma 124 (1–2): 137–146.
doi:10.1007/BF01279733.
Uyttewaal, M., J. Traas, and O. Hamant. 2010. Integrating physical stress,
growth, and development. Curr Opin Plant Biol 13 (1): 46–52. doi:10.1016/
j.pbi.2009.10.004.
Von Dassow, M., G. M. Odell, and D. F. Mandoli. 2001. Relationships between
growth, morphology and wall stress in the stalk of Acetabularia Acetabulum.
Planta 213 (4): 659–666. doi:10.1007/s004250100538.
Waaland, S. D., J. R. Waaland, and R. Cleland. 1972. A new pattern of plant cell
elongation: Bipolar band growth. J Cell Biol 54: 184–190.
Yanagisawa, M., A. S. Desyatova, S. A. Belteton, E. L. Mallery, J. A. Turner, and
D. B. Szymanski. 2015. Patterning mechanisms of cytoskeletal and cell
wall systems during leaf trichome morphogenesis. Nat Plants 1 (3): 15014.
doi:10.1038/nplants.2015.14.
chapter twenty four

Actin fluorescent staining in

the filamentous brown alga
Ectocarpus siliculosus
Hervé Rabillé, Maria Koutalianou, Bénédicte Charrier,
and Christos Katsaros

Contents
24.1 Introduction ......................................................................................... 365
24.2 State of the art ...................................................................................... 367
24.3 Materials ............................................................................................... 369
24.3.1 Chemicals ............................................................................... 369
24.3.2 Solutions and recipes ............................................................ 369
24.3.2.1 Preparation of Rhodamine–Phalloidin
(R415) or AlexaFluor568–Phalloidin
(A12380, life technology) ..................................... 369
24.3.2.2 Preparation of buffers .......................................... 370
24.3.2.3 Other solutions ..................................................... 372
24.3.3 Equipment .............................................................................. 373
24.4 Experimental procedures................................................................... 373
24.4.1 Preparation of poly-l-lysine-coated coverslips ................. 373
24.4.2 Preparation of Ectocarpus samples ...................................... 373
24.4.2.1 Filaments grown on coverslips .......................... 373
24.4.2.2 Free-floating filaments .........................................374
24.4.3 Actin staining procedure ......................................................374
24.5 Notes ..................................................................................................... 375
Acknowledgments ......................................................................................... 376
References........................................................................................................ 376

24.1 Introduction
Brown algae (Phaeophyceae) are a very interesting group of macroalgae
that acquired a complex multicellularity independently of land plants or
animals (Bogaert et al. 2013). In the past 10 years, genetic and molecular

365
366 Protocols for Macroalgae Research

studies of fundamental processes governing brown algal development

have benefited from the selection of Ectocarpus siliculosus as a new model
species for this group, because of its very simple filamentous body plan
and of the easiness of its cultivation (Peters et al. 2004; Charrier et al. 2008;
Le Bail and Charrier 2013).
A major component involved in brown algal morphogenesis is the
cytoskeleton, consisting of microtubules (MTs) and actin filaments
(AFs). The role of the cytoskeleton in the brown algal morphogenesis
has repeatedly been underlined in several studies, particularly after the
development of immunofluorescence techniques (Katsaros et al. 2006,
for literature).
Contrary to higher plants, brown algae bear a unique and complex
cell wall, which caused problems in the localization of cytoskeleton, when
protocols described for plant cells were followed. Therefore, it became
necessary to develop modified protocols suitable for brown algae (Coelho
et al. 2012a).
As in land plants (Viridiplantae), fungi and animals (Opistokonts),
AFs are thought to play a very important role in cell and tissue devel-
opment in brown algae. Previous works showed their importance in the
polarization processes in fucoid zygotes (Hable et al. 2003; Bisgrove and
Kropf 2004; Hable and Kropf 2005; Bogaert et al. 2013), branching in fila-
mentous gametophytes (Varvarigos et al. 2004), cytokinesis (Karyophyllis
et al. 2000a; Bisgrove and Kropf 2004; Nagasato et al. 2010), and growth
and morphogenesis of tip-growing apical cell of Sphacelaria rigidula
(Karyophyllis et al. 2000b; Katsaros et al. 2002, 2003, 2006).
In some of these studies, the fine structure of AF networks was
determined by immunolabeling. AF networks can display various orga-
nizations, and to understand their role in cellular processes such as
polarization, intracellular trafficking or growth, knowledge of its 3D orga-
nization within the cell is required (Chebli et al. 2013).
When the transformation is possible, an actin-binding protein probe
labeled with GFP can be used to reveal the actin organization in living cells
(Wilsen et al. 2006; Meijer et al. 2014), but this technique is not available in
brown algae yet. Immunolocalization on fixed material represents a good
alternative to GFP tagging, with the additional advantage of revealing the
majority of the AF structures present in a cell in a single experiment, con-
trary to in vivo GFP-tagged probe that can only recognize some specific AF
configurations (Wilsen et al. 2006).
As AFs are very delicate structures, moreover sensitive to the fixa-
tion procedure (Katsaros et al. 2006), a modified protocol has been devel-
oped for brown algal cells. The detailed steps of this alternative protocol
using Rhodamine–Phalloidin labeling are described in this chapter. It
has proven to be successful in Sphacelaria and Dictyota, but the version
given has been adapted for Ectocarpus siliculosus, the model brown algal
Chapter twenty four: Actin staining in Ectocarpus 367

species for which protocols for immunolabeling of cytoplasmic proteins

has already been established (Coelho et al. 2012a, b).

24.2 State of the art

Actin fluorescent staining has been tried in all the major plant lin-
eages, including land plants (Traas et al. 1987; Kakimoto and Shibaoka
1987a; Sonobe and Shibaoka 1989; Doris and Steer 1996; Lovy-Wheeler
et al. 2005), fungi (Heath et al. 2000), microalgae (Harper et al. 1992;
Pflügl-Haill et al. 2000; Hawkins et al. 2003), and macroalgae (Garbary
et al. 1992; Katsaros et al. 2006). A fluorescent probe conjugated to phal-
loidin, a toxic bicyclic peptide first extracted from the fungus Amanita
phalloides (Barden et al. 1987), is used to label AFs, although several
anti-actin antibodies are also used.
Most of AF staining techniques on plant cells were first estab-
lished for terrestrial plants (Perdue and Parthasarathy 1985; Kakimoto
and Shibaoka 1987a, b; Parthasarathy 1987; Traas et al. 1987; Sonobe and
Shibaoka 1989; Heslop-Harrison and Heslop-Harrison 1991; Doris and
Steer 1996; Wasteneys et al. 1997; Vitha et al. 2000; Lovy-Wheeler et al.
2005; Dyachok et al. 2010). One of the major inputs from these works on
land plant immunocytochemistry was the use of m-maleimidobenzoyl
N-hydroxysuccinimide ester (commonly abbreviated as MBS) as an actin-
stabilizing reagent added before the fixation steps (Sonobe and Shibaoka
1989; Doris and Steer 1996). Another finding was the necessity to partially
digest the cell wall (CW) to allow the fluorescent probe to get access to the
cytoplasm. In this case, the enzymes used were cellulases and pectolyases
(Lloyd et al. 1979; Kakimoto and Shibaoka 1987b; Sonobe and Shibaoka
1989; Vitha et al. 2000; Szechyn′ ska-Hebda et al. 2006; Dyachok et al. 2010).
In green macroalgae, very few studies of AF organization were con-
ducted, except in the Characean algae (Chara, Nitella) and some coenocytic
algae such as Acetabularia and Caulerpa. As in land plants, the fixation pro-
cedure was commonly carried out with classical aldehyde compounds,
but sometimes it could be omitted, and AFs were labeled directly in vivo
(Tewinkel et al. 1989; Sampson and Pickett-Heaps 2001). Curiously, the
CW digestion step was omitted in most studies. In some cases, simple
cell permeabilization appeared sufficient (Tewinkel et al. 1989; Braun and
Wasteneys 1998; Sampson and Pickett-Heaps 2001), whereas in others,
methods to get through the CW barrier were used (e.g., freeze-chattering
of rhizoid and protonemata of characean algae; Braun and Wasteneys
1998). Moreover, in the giant coenocytic green alga Acetabularia, the CW
showed to be insensitive to enzymatic treatments (Sawitzky et al. 1996),
and for this species and other giant coenocytic algae, AF staining was
conducted on microdissected cells (Menzel 1987) or cytoplasm extruded
from its cell wall (La Claire II 1989; Mine et al. 2001).
368 Protocols for Macroalgae Research

AF staining procedure was also developed for red macroalgae in

the 1990s (McDonald et al. 1993). Red macroalgae possess a complex CW
(Garbary et al. 1992; Popper et al. 2011) and so several enzyme cocktails
have been used, including cellulase alone (Reis et al. 2013), a mix of cel-
lulase and snail gut extract (McDonald et al. 1993), or β-glucuronidase
(Garbary et al. 1992; Garbary and McDonald 1996). However, the CW
digestion step had to be adapted to each species (McDonald et al. 1993),
sometimes leading to damaged cell ultrastructures, which raises some
doubts about the observed AF organization. As in green macroalgae,
some studies reported successful AF labeling in red macroalgae with-
out CW digestion steps (Kim and Kim 1999; Kim et al. 2001; Wilson
et al. 2003).
On brown macroalgae (Phaeophyceae), few AF staining studies have
been conducted until now, and most of them were only focused on fucoid
zygotes during polarization and germination (Brawley and Robinson
1985; Kropf et al. 1989; Alessa and Kropf 1999; Hable et al. 2003). In the
earliest studies, protocols did not include any CW digestion step, but only
cell permeabilization using compounds such as saponin or Triton X-100
after fixation (Brawley and Robinson 1985; Kropf et al. 1989; Alessa and
Kropf 1999). However, fucoid zygotes are free naked cells, directly in con-
tact with the external medium, in which the cell wall is just beginning to
form (Bisgrove and Kropf 2001). Therefore, this simple procedure would
not be as effective for other cell types, especially for cells encased in a
tissue. Moreover, Phaeophyceae have a very complex cell wall, the composi-
tion of which strongly differs from that of land plants or other macroal-
gae. As mentioned in the introduction, land plants and brown algae differ
strongly in their CW composition and structure, cellulose, hemicellulose,
arabinogalactan, and callose being the only polymers that the two groups
have in common (Popper et al. 2011; Deniaud-Bouët et al. 2014; Hervé
et al. 2016). The two major components of the brown algal cell wall are
alginates and sulfated fucans that are specific to this class of macroalgae
(Mabeau and Kloareg 1987; Popper et al. 2011). Brown algal cell wall also
contains proteins, halogenated and sulfated phenolic molecules (named
phlorotannins), and halides (Deniaud-Bouët et al. 2014). As a consequence,
the digestion steps necessary to permeabilize the cell must be adapted to
these particular molecules.
In 2000, Karyophyllis and colleagues adapted several protocols from
previous studies on pollen tubes (Sonobe and Shibaoka 1989) and red
algae (Garbary et al. 1992) to improve AF staining on the apical cells of
Sphacelaria rigidula (Karyophyllis et al. 2000a, b). This protocol improved
AF staining by introducing MBS as an AF-stabilizing agent before chemi-
cal fixation. In addition, CW is digested by a complex mixture of enzymes,
including cellulase, β-glucuronidase, and sulfatase (both from aba-
lone acetone powder), pectinase, hemicellulase (both from macerozyme
Chapter twenty four: Actin staining in Ectocarpus 369

product, Onozuka R-10, Yakult), laminarase, and xylanase (both from

driselase product, Sigma) (Karyophyllis et al. 2000a). Using Rhodamine–
Phalloidin or anti-actin antibody to tag AFs and with some modifications,
this new protocol allowed the visualization of the fine AF organization
in several species and cell types of Phaeophyceae, including apical and
other vegetative cells of Sphacelaria rigidula (Karyophyllis et al. 2000b), and
Dictyota dichotoma (Katsaros et al. 2002), polarizing cells of Macrocystis
pyrifera gametophytes (Varvarigos et al. 2004, 2007) and again in fucoid
zygotes (Hable et al. 2003; Bisgrove and Kropf 2004). Recently, it has been
successfully applied to Ectocarpus sporophyte cells, and the different steps
are described in this chapter.

24.3 Materials
24.3.1 Chemicals
• DMSO 100%.
• Glycerol 100%.
• Cell-wall digesting enzymes:
• Cellulase (Onozuka R-10, Yakult).
• Hemicellulase (H2125, Sigma).
• Driselase (D8037-1G, Sigma).
• Macerozyme (Onozuka R-10, Yakult).
• Pectinase (P2401, Sigma).
• Alginate lyase (A1603, Sigma).
• m-maleimido benzoic acid N-hydroxy succinimide ester (MBS,
M2786, Sigma).
• Natural or artificial seawater (ASW) (to wash free-floating filaments
before prefixation. Must be autoclaved and kept sterile, if possible).
• Paraformaldehyde (PFA, powder).
• p-phenylenediamine (PDA).
• Poly-l-lysine (1 mg mL−1).
• Rhodamine–Phalloidin (Sigma or Biotium) or AlexaFluor568–
Phalloidin (in general, AlexaFluor568 is more suited for plant mate-
rial than Rhodamine–Phalloidin).
• Triton X-100.

24.3.2 Solutions and recipes

24.3.2.1 Preparation of Rhodamine–Phalloidin (R415) or
AlexaFluor568–Phalloidin (A12380, life technology)
Dilute the content of a whole tube (300 U) into 1.5 mL of methanol, fol-
lowing the manufacturer’s directions. The final concentration is about
6.6 µM (=200 U mL−1). Store at −20°C in the dark.
370 Protocols for Macroalgae Research

The instructions for the preparation of buffers and other solutions are
indicated in Tables 24.1 through 24.10.

24.3.2.2 Preparation of buffers

Table 24.1 Microtubule stabilizing buffer (MTB) modified for actin
Final Quantity to add
Composition concentration (for 1 L final)
Pipes 50 mM 15.12 g
EGTA 5 mM 1.318 g
MgSO4 5 mM 1.902 g
KCl 25 mM 1.86 g
NaCl 4% (w/v) 40 g
PVP 2.5% (w/v) 25 g
(Polyvinylpyrrolidone 25)
DTT 1 mM 0.154 g
((−)-1,4-dithio-l-threitol)
Pure water – qsp 1 L
Note: Adjust pH to 7.4. Store at 4°C.

Table 24.2 Phosphate-buffered saline (PBS)

Final Quantity to
Composition concentration add (for 1 L final)
NaCl 137 mM 8.01 g
KCl 0.7 mM 0.052 g
Na2HPO4 5.1 mM 0.72 g
KH2PO4 1.7 mM 0.22 g
Distilled water – qsp 1 L
Note: Adjust pH to 7.4. Store at 4°C.

Table 24.3 Stock solution of MBS (m-maleimido benzoic acid

N-hydroxy succinimide ester)
Quantity to add
Composition Final concentration (for 1 mL final)
MT-buffer – 980 µL
DMSO 2% 20 µL
MBS 100 mM 0.0943 g
Note: Store in the dark at −20°C. As the product is better preserved as a
powder (at −20°C), prepare preferably a small volume of stock
solution just before a series of experiments.
Chapter twenty four: Actin staining in Ectocarpus 371

Table 24.4 Actin-stabilization solution

Quantity to add
Composition Final concentration (for 1 mL final)
MTB – 975 µL
Triton X-100 0.2% 2 µL
DMSO 2% 20 µL
MBS 300 µM 3 µL of a stock
solution at
100 mM
Note: Prepare fresh solution just before use.

Table 24.5 Fixation solution

Final Quantity to add
Composition concentration (for 10 mL final)
MT buffer – 10 mL
PFA 4% 0.4 g
(Paraformaldehyde)
Note: Distribute in 1 mL aliquots and store at −20°C.

Table 24.6 Cell wall lysis buffer

Final Quantity to add
Composition concentration (for 2 mL final)
PBS:MTB 1:1 – 1946 µL
Triton X-100 (pure) 0.2% (v:v) 4 µL
Rhodamine – (or 0.17 µM 50 µL of stock
AlexaFluor568) – Phalloidin solution at
6.6 µM
Cellulase 2% (w:v) 40 mg
Hemicellulase 2% (w:v) 40 mg
Driselase 1% (w:v) 20 mg
Macerozyme 1% (w:v) 20 mg
Pectinase 0.5% 10 mg
(w:v)
Note: Just before use, prepare the lysis buffer (with PBS, MTB, Triton X-100, and
Rh-Ph). Stir and dissolve the enzymes in it, and centrifuge for 5 min to elim-
inate the precipitate. Adjust the pH to 5.5 (this is important for the activity
of enzymes). The given composition of the cell wall digestion solution is
only indicative and must be adjusted for each type of material. We also rec-
ommend trying using alginate–lyases (concentration 1%–2% w:v), because
alginate is a common cell wall compound in brown algae.
372 Protocols for Macroalgae Research

24.3.2.3 Other solutions

Table 24.7 Extraction solution
Composition Final concentration Quantity to add (for 1 mL final)
DMSO 5% 50 µL
Triton X-100 3% 30 µL
PBS – 920 µL
Note: Prepare fresh solution just before use.

Table 24.8 Actin-staining solution

Quantity to add
Composition Final concentration (for 300 µL final)
Rhodamine–Phalloidin 0.33 µM 15 µL of stock solution
at 6.6 µM
PBS:MTB – 285 µL
Note: Rhodamine–Phalloidin can be replaced by AlexaFluor568–Phalloidin (A12380, Life
Technology), that is thought to give better results on plant cells. In both cases, prepare
the staining solution just before use. Store on the ice and protect from light.

Table 24.9 DNA staining solution

Quantity to add
Composition Concentration (for 10 mL final)
PBS – 9.9 mL
Hoechst 33258 10 µg mL−1 100 µL of a 1 mg mL−1
(94403, Sigma) stock solution
Note: Store at 4°C.

Table 24.10 Mounting solution

Quantity to add
Composition Concentration (for 1 mL final)
Glycerol 33.3% 800 µL
PBS 66.6% 400 µL
PDA 0.2% (w:v) 0.02 g
(p-phenylenediamine,
P6001, Sigma)
Note: Store at 4°C, in the dark. The solution gets darker with time.
Chapter twenty four: Actin staining in Ectocarpus 373

24.3.3 Equipment
1.54 mL Eppendorf® tubes.
15- and 50 mL plastic tubes.
Fine forceps.
Glass coverslips (sterilized, if possible).
Microscope slides (sterilized, if possible).
Parafilm®.
Pipettes and tips (10/100/1000 µL range).
Plastic or glass Petri dishes.
Plastic Pasteur pipette.

24.4 Experimental procedures

24.4.1 Preparation of poly-l-lysine-coated coverslips
This is for free-floating filaments. They must be prepared at least one day
before the staining experiment (Note 1).

1. Soak coverslips in nitric acid for at least several hours.

2. Wash the coverslips with distilled water, then with acetone, and
again with water. Dispose them one-by-one on a paper towel, and let
them dry until all drops of water have disappeared.
3. Using a cotton bud spread a solution of 1 mg mL−1 poly-l-lysine on
the whole surface of coverslips.
4. Let the coverslips dry at room temperature (RT). The poly-l-lysine
solution is thick and dries very slowly, so it is better to prepare the
coverslips at least one day in advance. Drying step can be speeded
up by putting the coverslips under a chemical hood.

24.4.2 Preparation of Ectocarpus samples

24.4.2.1 Filaments grown on coverslips
The preparation of Ectocarpus algal material is described in Chapter 23 by
Rabillé et al.

1. On the bottom of the lid of an empty Petri dish, place a round

piece of Whatman paper (that must cover all the Petri dish’s bottom
surface). Press a small piece of cotton wool on the rim of the lid.
Add a small volume of water on the Whatman paper and the piece
of cotton wool to have enough humidity. Remove any exceeding
water. Finally, dispose a large piece of Parafilm® on the Whatman
paper (Note 2).
374 Protocols for Macroalgae Research

2. Using forceps, takeoff the coverslips with the filaments grown on

them from the bottom of the culture dish. Wipe the coverslips’ bot-
tom and edge with a paper towel.
3. Put the coverslips on the surface of the Parafilm® with the filaments
upside. For all the subsequent steps, dispose a small volume of each
solution on the surface of the coverslips and close the moist chamber
for incubation.

24.4.2.2 Free-floating filaments

1. Gently crap or takeoff the filaments from the medium with forceps,
and stack them in a pile. Quickly wash the pile of filaments by gently
shaking it in clean sea water.
2. Put a dense pile of filaments into an Eppendorf tube. The following
steps up to the enzyme digestion will take place in the tube. When
changing the liquids by a pipette, be careful of not losing or damag-
ing the filaments (Note 3).
3. After the cell wall lysis step, spread the filaments on the surface
of poly-l-lysine-coated coverslips (or slides) with forceps. Separate
every tuft of filaments from one another (Note 4).
4. Let some medium evaporate, keeping the coverslips damp. The rest
of the protocol is then proceeded as for filaments that are directly
grown on coverslips. Alternatively, the procedure can be continued
in Eppendorf tube.

24.4.3 Actin staining procedure

1. Incubate the filaments with the actin-stabilization solution (300 µM
MBS, 2% DMSO, 0.1% Triton X-100 in MTB, pH 7,4) for 30 min in dark
at room temperature (RT) (Note 5).
2. Wash 3 × 10 min with MTB, at RT (this step might be omitted, Note 6).
3. Fix the filament with 4% PFA in MTB for 40 min at RT (Note 5).
4. Wash 3 × 10 min in PBS:MTB 1:1 (v:v), at RT.
5. Incubate the filaments with the cell wall lysis solution (2% cellulase,
2% hemicellulase, 1% driselase, 1% macerozyme, 0.5% pectinase, 0.2%
Triton X-100, 0.17 µM Rhodamine–Phalloidin, pH 5.5) for 15–20 min
in dark, at RT.
6. Wash 3 × 10 min in PBS:MTB 1:1, in the dark at RT (Note 7).
7. Optional: Incubate the filaments in the extraction solution (2% DMSO
in MT buffer) for 10 min, in the dark, RT (Note 5).
8. Wash 3 × 10 min in PBS:MTB 1:1, in the dark at RT.
9. Incubate the filaments in actin-staining solution (0.66 µM Rh–Ph in
PBS:MT 1:1) in the dark for at least 1 h or overnight at 4°C or at RT
(Note 5).
10. Wash 3 × 10 min in PBS, in the dark at RT.
Chapter twenty four: Actin staining in Ectocarpus 375

(a) (b)

Figure 24.1 Organization of actin cytoskeleton in vegetative cells of Ectocarpus

filaments labeled with Rhodamine–Phalloidin, as seen under epifluorescence
microscopy. Long bundles of actin filaments are observed in intermediate
(elongated) cell during interphase (a) and during cytokinesis (b), in which actin
filaments are densely packed at the cytokinetic diaphragm plane. Scale bars
represent 10 µm on each picture.

11. Stain the nucleus in 10 µg mL−1 Hoechst 33258 in PBS for 10 min, in
the dark at RT.
12. Wash 3 × 10 min in PBS, in the dark at RT.
13. Mount in 0.2% phenylenediamine in glycerol:PBS 2:1. The slides are
now ready to be observed under the fluorescent microscope. Two
examples of actin-staining pattern observed in Ectocarpus sporo-
phyte vegetative cells are shown in Figure 24.1.

24.5 Notes
Note 1: Alternatively, slides can be used instead of coverslips.
Note 2: By turning over the Petri dish on its lid, you create a moist cham-
ber in which the coverslips will be incubated. The moisture avoids
the evaporation of the medium deposited on the surface of the cov-
erslips, which is important especially for long incubation times. The
Parafilm® is hydrophobic and prevents the medium to flow over the
surface of the coverslips.
Note 3: Avoid sucking filaments into the pipette tip when removing the
medium from the tube while manipulating as gently as possible. If
needed, slowly centrifuge the tube to take the filaments at the bottom
of the tube. Avoid centrifuging filaments until they have been fixed.
376 Protocols for Macroalgae Research

Note 4: Do not pressure the filaments with the forceps, just spread them
around very gently, because Ectocarpus filaments are easily dam-
ageable. Do not leave large piles of entangled filaments, which pre-
vent proper staining of the filament, subsequently interfering with
the observation. If needed, spread the filaments under a dissecting
microscope using a fine needle.
Note 5: Incubation duration might require adjustments, depending on
the amount and nature of the treated material.
Note 6: The first washing step can be omitted. Alternatively, remove
half quantity of the first solution above and complete with the solu-
tion of PFA (8%) without washing step.
Note 7: Spread free-floating filaments on poly-l-lysine-coated coverslips
(or slides) as described in Section 24.4.1. The rest of the protocol is
identical for both types of sample.

Acknowledgments
This research was cofinanced by the National and Kapodistrian University
of Athens (program “Kapodistrias”), the Roscoff Biology Station (Centre
National de la Recherche Scientifique et Université Pierre et Marie Curie)
and the COST Action Phycomorph FA 1406.

References
Alessa, L., and D. L. Kropf. 1999. F-Actin marks the rhizoid pole in living Pelvetia
compressa zygotes. Development 126 (1): 201–209.
Barden, J. A., M. Miki, B. D. Hambly, and C. G. dos Remedios. 1987. Localization
of the phalloidin and nucleotide-binding sites on actin. Eur J Biochem 162 (3):
583–588.
Bisgrove, S. R., and D. L. Kropf. 2001. Cell wall deposition during morphogenesis
in fucoid algae. Planta 212 (5–6): 648–658.
Bisgrove, S. R., and D. L. Kropf. 2004. Cytokinesis in brown algae: Studies of asym-
metric division in fucoid zygotes. Protoplasma 223 (2–4): 163–173.
Bogaert, K. A., A. Arun, S. M. Coelho, and O. De Clerck. 2013. Brown algae as a
model for plant organogenesis. In Plant Organogenesis: Methods and Protocols,
I. De Smet (Ed.), 959: 97–125. New York: Springer Science+Business Media.
Braun, M., and G. O. Wasteneys. 1998. Distribution and dynamics of the cyto-
skeleton in graviresponding protonemata and rhizoids of characean algae:
Exclusion of microtubules and a convergence of actin filaments in the apex
suggest an actin-mediated gravitropism. Planta 205 (1): 39–50.
Brawley, S. H., and K. R. Robinson. 1985. Cytochalasin treatment disrupts the
endogenous currents associated with cell polarization in fucoid zygotes:
Studies of the role of F-actin in embryogenesis. J Cell Biol 100 (4): 1173–1184.
Charrier, B., S. M. Coelho, A. Le Bail, T. Tonon, G. Michel, P. Potin, B. Kloareg,
C. Boyen, A. F. Peters, and J. M. Cock. 2008. Development and physiology of
the brown alga Ectocarpus siliculosus: Two centuries of research. New Phytol
177 (2): 319–332.
Chapter twenty four: Actin staining in Ectocarpus 377

Chebli, Y., J. Kroeger, and A. Geitmann. 2013. Transport logistics in pollen tubes.
Molecular Plant 6 (4): 1037–1052.
Coelho, S. M., D. Scornet, S. Rousvoal, N. Peters, L. Dartevelle, A. F. Peters, and
J.  M. Cock. 2012a. Immunostaining of Ectocarpus cells. Cold Spring Harb
Protoc 2012 (3): 369–372.
Coelho, S. M., D. Scornet, S. Rousvoal, N. Peters, L. Dartevelle, A. F. Peters, and
J. M. Cock. 2012b. Isolation and regeneration of protoplasts from Ectocarpus.
Cold Spring Harb Protoc 2012 (3): 361–364.
Deniaud-Bouët, E., N. Kervarec, G. Michel, T. Tonon, B. Kloareg, and C. Hervé.
2014. Chemical and enzymatic fractionation of cell walls from fucales:
Insights into the structure of the extracellular matrix of brown algae. Ann
Bot 114 (6): 1203–1216.
Doris, F. P., and M. W. Steer. 1996. Effects of fixatives and permeabilisation buffers
on pollen tubes: Implications for localisation of actin microfilaments using
phalloidin staining. Protoplasma 195: 25–36.
Dyachok, J., C.-M. Yoo, K. Palanichelvam, and E. B. Blancaflor. 2010. Sample prepa-
ration for fluorescence imaging of the cytoskeleton in fixed and living plants
roots. In Cytoskeleton - Methods and Protocols, R.H. Gavin (Ed.), 54: 157–169.
New York: Springer Science+Business Media New York.
Garbary, D. J., A. R. McDonald, and J. G. Duckett. 1992. Visualization of the cyto-
skeleton in red algae using fluorescent labelling. New Phytol 120: 435–444.
Garbary, D. J., and A. R. McDonald. 1996. Fluorescent labelling of the cytoskeleton
in Ceramium strictum (Rhodophyta). J Phycol 32 (1): 85–93.
Hable, W. E., and D. L. Kropf. 2005. The Arp2/3 complex nucleates actin arrays dur-
ing zygote polarity establishment and growth. Cell Motil Cytoskel 61 (1): 9–20.
Hable, W. E., N. R. Miller, and D. L. Kropf. 2003. Polarity establishment requires
dynamic actin in fucoid zygotes. Protoplasma 221 (3–4): 193–204.
Harper, J., D. McCurdy, M. Sanders, and J. Salisbury. 1992. Actin dynamics during
the cell cycle in Chlamydomonas reinhardtii. Cell Motil Cytoskel 126: 117–126.
Hawkins, E. K., J. J. Lee, and M. Correia. 2003. Polar localization of filamentous actin
in cells of the scale-forming alga Pleurochrysis sp. Protoplasma 220 (3–4): 233–236.
Heath, I. B., G. Gupta, and S. Bai. 2000. Plasma membrane-adjacent actin fila-
ments, but not microtubules, are essential for both polarization and hyphal
tip morphogenesis in Saprolegnia ferax and Neurospora crassa. Fungal Genet
Biol 30 (1): 45–62.
Hervé, C., A. Siméon, M. Jam, A. Cassin, K. L. Johnson, A. A. Salmeán, W. G. T.
Willats et al. 2016. Arabinogalactan proteins have deep roots in eukaryotes:
Identification of genes and epitopes in brown algae and their role in Fucus
serratus embryo development. New Phytol 209 (4): 1428–1441.
Heslop-Harrison, J., and Y. Heslop-Harrison. 1991. The actin cytoskeleton
in unfixed  pollen tubes following microwave-accelerated DMSO-
permeabilisation and TRITC-phalloidin staining. Sex Plant Reprod 4: 6–11.
Kakimoto, T., and H. Shibaoka. 1987a. A new method for preservation of actin fila-
ments in higher plant cells. Plant Cell Physiol 28 (8): 1581–1585.
Kakimoto, T., and H. Shibaoka. 1987b. Actin filaments and microtubules in the pre-
prophase band and phragmoplast of tobacco cells. Protoplasma 140 (2–3): 151–156.
Karyophyllis, D., C. Katsaros, and B. Galatis. 2000. F-Actin Involvement in api-
cal cell morphogenesis of Sphacelaria rigidula (Phaeophyceae): Mutual align-
ment between cortical actin filaments and cellulose microfibrils. Eur J Phycol
35 (2): 195–203.
378 Protocols for Macroalgae Research

Karyophyllis, D., C. Katsaros, I. Dimitriadis, and B. Galatis. 2000. F-actin orga-

nization during the cell cycle of Sphacelaria rigidula (Phaeophyceae). Eur J
Phycol 35 (1): 25–33.
Katsaros, C., D. A. Karyophyllis, and B. D. Galatis. 2002. Cortical F-actin under-
lies cellulose microfibril patterning in brown algal cells. Phycologia 41 (2):
178–183.
Katsaros, C., D. Karyophyllis, and B. Galatis. 2003. F-actin cytoskeleton and cell
wall morphogenesis in brown algae. Cell Biol Int 27 (3): 209–210.
Katsaros, C., D. Karyophyllis, and B. Galatis. 2006. Cytoskeleton and morphogen-
esis in brown algae. Ann Bot 97 (5): 679–693.
Kim, G. H., T. A. Klotchkova, B. C. Lee, and S. H. Kim. 2001. FITC-phalloidin
staining of F-actin in Aglaothamnion oosumiense and Griffithsia japonica
(Rhodophyta). Bot Mar 44 (5): 501–508.
Kim, S., and G. H. Kim. 1999. Cell-cell recognition during fertilization in the red alga,
Aglaothamnion oosumiense (Ceramiaceae, Rhodophyta). In Sixteenth International
Seaweed Symposium, pp. 81–89. Dordrecht, the Netherlands: Springer.
Kropf, D. L., S. K. Berge, and R. S. Quatrano. 1989. Actin localization during Fucus
embryogenesis. Plant Cell 1 (2): 191–200.
La Claire II, J. W. 1989. Actin cytoskeleton in intact and wounded coenocytic green
algae. Planta 177: 47–57.
Le Bail, A., and B. Charrier. 2013. Culture methods and mutant generation in
the filamentous brown algae Ectocarpus siliculosus. In Plant Organogenesis:
Methods and Protocols, I. De Smet (Ed.), 959: 235–245. New York: Springer
Science+Business Media.
Lloyd, C. W., A. R. Slabas, A. J. Powell, G. MacDonald, and R. A. Badley. 1979.
Cytoplasmic microtubules of higher plant cells visualised with anti-tubulin
antibodies. Nature 279: 239–241.
Lovy-Wheeler, A., K. L. Wilsen, T. I. Baskin, and P. K. Hepler. 2005. Enhanced
fixation reveals the apical cortical fringe of actin filaments as a consistent
feature of the pollen tube. Planta 221 (1): 95–104.
Mabeau, S., and B. Kloareg. 1987. Isolation and analysis of the cell walls of brown
algae: Fucus spiralis, F. ceranoides, F. vesiculosus, F. serratus, Bifurcaria bifurcata
and Laminaria digitata. J Exp Bot 38 (9): 1573–1580.
McDonald, A. R., D. J. Garbary, and J. G. Duckett. 1993. Rhodamine-phalloidin
staining of F-actin in rhodophyta. Biotech Histochem 68 (2): 91–98.
Meijer, H. J. G., C. Hua, K. Kots, T. Ketelaar, and F. Govers. 2014. Actin dynamics in
Phytophthora infestans; rapidly reorganizing cables and immobile, long-lived
plaques. Cell Microbiol 16 (6): 948–961.
Menzel, D. 1987. The cytoskeleton of the giant coenocytic green alga Caulerpa
visualized by immunocytochemistry. Protoplasma 139 (2–3): 71–76.
Mine, I., K. Okuda, and D. Menzel. 2001. Poly(A)+ RNA during vegetative devel-
opment of Acetabularia peniculus. Protoplasma 216 (1–2): 56–65.
Nagasato, C., A. Inoue, M. Mizuno, K. Kanazawa, T. Ojima, K. Okuda, and
T. Motomura. 2010. Membrane fusion process and assembly of cell wall dur-
ing cytokinesis in the brown alga Silvetia babingtonii (Fucales, Phaeophyceae).
Planta 232 (2): 287–298.
Parthasarathy, M. V. 1987. In situ localization of actin filaments in higher plant
cells using fluorescent probes. Plant Mol Biol Rep 5 (1): 251–259.
Perdue, T. D., and M. V. Parthasarathy. 1985. In situ localization of F-actin in pollen
tubes. Eur J Cell Biol 39 (1): 13–20.
Chapter twenty four: Actin staining in Ectocarpus 379

Peters, A. F., D. Marie, D. Scornet, B. Kloareg, and J. M. Cock. 2004. Proposal of

Ectocarpus siliculosus (Ectocarpales, Phaeophyceae) as a model organism for
brown algal genetics and genomics. J Phycol 40 (6): 1079–1088.
Pflügl-Haill, M., L. Vidali, J. W. Vos, P. K. Hepler, and U. Lütz-Meindl. 2000.
Changes of the actin filament system in the green alga Micrasterias denticulata
induced by different cytoskeleton inhibitors. Protoplasma 212: 206–216.
Popper, Z. A., G. Michel, C. Hervé, D. S. Domozych, W. G. T. Willats, M. G. Tuohy,
B. Kloareg, and D. B. Stengel. 2011. Evolution and diversity of plant cell
walls: From algae to flowering plants. Ann Rev Plant Biol 62: 567–590.
Reis, V. M., L. S. Oliveira, R. M. F. Passos, N. B. Viana, C. Mermelstein, C. Sant’Anna,
R. C. Pereira et al. 2013. Traffic of secondary metabolites to cell surface in the
red alga Laurencia dendroidea depends on a two-step transport by the cyto-
skeleton. PLoS One 8 (5): e63929.
Sampson, K., and J. D. Pickett-Heaps. 2001. Phallacidin stains the kinetochore
region in the mitotic spindle of the green algae Oedogonium spp. Protoplasma
217 (4): 166–176.
Sawitzky, H., J. Willingale-Theune, and D. Menzel. 1996. Improved visualization
of F-actin in the green alga Acetabularia by microwave-accelerated fixation
and simultaneous FITC-phalloidin staining. Histochem J 28 (5): 353–360.
Sonobe, S., and H. Shibaoka. 1989. Cortical fine actin filaments in higher
plant cells visualized by rhodamine-phalloidin after pretreatment with
m-maleimidobenzoyl N-hydroxysuccinimide ester. Protoplasma 148: 80–86.
Szechyńska-Hebda, M., M. Wędzony, E. Dubas, H. Kieft, and A. Van Lammeren.
2006. Visualisation of microtubules and actin filaments in fixed BY-2 sus-
pension cells using an optimized whole mount immunolabelling protocol.
Plant Cell Rep 25 (8): 758–766.
Tewinkel, M., S. Kruse, H. Quader, D. Volkmann, and A. Sievers. 1989. Visualization
of actin filament pattern in plant cells without pre-fixation. A comparison of
differently modified phallotoxins. Protoplasma 149: 178–182.
Traas, J. A., J. H. Doonan, D. J. Rawlins, P. J. Shaw, J. Watts, and C. W. Lloyd. 1987.
An actin network is present in the cytoplasm throughout the cell cycle of car-
rot cells and associates with the dividing nucleus. J Cell Biol 105 (1): 387–395.
Varvarigos, V., B. Galatis, and C. Katsaros. 2007. Radial endoplasmic reticulum
arrays co-localize with radial F-actin in polarizing cells of brown algae. Eur
J Phycol 42 (3): 253–262.
Varvarigos, V., C. Katsaros, and B. Galatis. 2004. Radial F-actin configurations are
involved in polarization during protoplast germination and thallus branching
of Macrocystis pyrifera (Phaeophyceae, Laminariales). Phycologia 43 (6): 693–702.
Vitha, S., F. Baluska, M. Braun, J. Samaj, D. Volkmann, and P. W. Barlow. 2000.
Comparison of cryofixation and aldehyde fixation for plant actin immuno-
cytochemistry: Aldehydes do not destroy F-actin. Histochem J 32 (8): 457–466.
Wasteneys, G. O., J. Willingale-Theune, and D. Menzel. 1997. Freeze shattering:
A simple and effective method for permeabilizing higher plant cell walls.
J Microsc 188 (1): 51–61.
Wilsen, K. L., A. Lovy-Wheeler, B. Voigt, D. Menzel, J. G. Kunkel, and P. K. Hepler.
2006. Imaging the actin cytoskeleton in growing pollen tubes. Sex Plant
Reprod 19 (2): 51–62.
Wilson, S. M., J. A. West, and J. D. Pickett-Heaps. 2003. Time-lapse videomicros-
copy of fertilization and the actin cytoskeleton in Murrayella periclados
(Rhodomelaceae, Rhodophyta). Phycologia 42 (6): 638–645.
chapter twenty five

Cryofixation of brown algae for

transmission electron microscopy
Chikako Nagasato, Christos Katsaros,
and Taizo Motomura

Contents
25.1 Introduction ......................................................................................... 381
25.2 State of the art ...................................................................................... 383
25.3 Materials ............................................................................................... 384
25.3.1 Reagents.................................................................................. 384
25.3.2 Equipment .............................................................................. 384
25.4 Experimental procedures................................................................... 384
25.4.1 Preparation of material......................................................... 384
25.4.2 Cryogen and substitution fixative ...................................... 385
25.4.3 Cryofixation ........................................................................... 386
25.4.4 Freeze substitution ................................................................ 386
25.4.5 Infiltration and embedding of samples into resin............ 386
25.5 Notes ..................................................................................................... 387
25.6 Concluding remarks ........................................................................... 387
References........................................................................................................ 388

25.1 Introduction
Chemical fixation involves the immersion of samples in a solution that
inactivates and stabilizes cellular contents. Although the general protocol
is the same, modifications are required to give optimal results (Huang
and Yeung 2015). The chemical fixation procedure is complicated, but
it has been a well-accepted method, giving good-quality images. The
main steps in chemical fixation are as follows: (a) fixation using aldehyde
fixatives (glutaraldehyde, paraformaldehyde) to cross-link proteins and
osmium tetroxide (OsO4) to preserve lipids in membranes and lipopro-
teins; (b) dehydration using an organic solvent (ethanol, acetone); and
(c)  embedding samples in resins (Epon, Spurr, LR White, Lowcryl, etc.).

381
382 Protocols for Macroalgae Research

In most cases, the chemical fixation protocols used for land plants and ani-
mals are inadequate to apply to brown algae. Therefore, special modifica-
tions should be developed for this group (Clayton and Beaks 1983, Hallam
and Luff 1988). One of the characteristics of brown algae that should be
considered during preparation of transmission electron microscopy
(TEM) samples is that the cell wall contains alginates and fucoidans in
addition to cellulose (Kloareg and Quatrano 1988). These polysaccharides
flow out into the sample preparation buffers in conventional chemical
fixation methods. For example, alginate becomes soluble under low con-
centrations of calcium in the buffer. Swollen cell walls caused by low cal-
cium buffer induce detachment of the plasma membrane from the cell
wall. Therefore, phosphate buffer is inadequate for preparation of brown
algal cells, because calcium binds to phosphate. Thus, many researchers
use cacodylate buffer with 0.1%–1% calcium or seawater for the fixation
buffer. On the other hand, mucilaginous polysaccharides in the cell wall
of brown algae disturb penetration of fixatives and resins into the tissue,
and as a result, it is difficult to make ultrathin sections with satisfactory
preservation of the cell structures. Phenolic compounds in physodes,
which are membrane-bounded structures with osmiophilic or electron-
dense material, also cause a problem for chemical fixation in brown algae.
Leakage of the phenolics into the cytoplasm affects fixation of samples for
TEM, usually resulting in negative contrast images of the cell structure.
To trap the phenolics from physodes, caffeine is usually added to the alde-
hyde fixative and washing buffer (Clayton and Beaks 1983). Components
of the fixative and selection of the buffer become crucial factors affecting
TEM images of brown algae.
Physical fixation is achieved by cryofixation, composed of rapid
freezing (104 –105  K  s−1) to the temperature of liquid nitrogen (−196°C)
or below and subsequent freeze substitution. All metabolic activities
in the cell are instantly stopped by cryofixation, which preserves the
native status of cells. However, cryofixation is not always successful in
all samples. In cryofixation, the most important thing is to prevent for-
mation of ice crystal in cells. One problem with cryofixation is that there
is a limitation in the area or depth of sample preserved, as it is difficult
to achieve high cooling to produce amorphous ice instead of ice crystals.
This depth-limit is usually a few micrometers. After cryofixation, fro-
zen cellular water should be substituted with an organic solvent under
low temperature (−180°C) (Gilkey and Staehelin 1986). There are three
methods in cryofixation: immersion, metal contact, and high-pressure
freezing. In immersion freezing, specimens are plunged into liquid
propane. This method is simple and handy, but freezing depth is less
than 10–20 µm. In the metal contact and high-pressure freezing meth-
ods, rapid freezing is performed by liquid helium or liquid nitrogen
using expensive instrumentation. The metal contact method permits a
Chapter twenty five: Cryofixation of brown algae for TEM 383

well-preserved area with a depth up to 20 µm. High-pressure freezing

guarantees high-quality images of 600 µm thickness from the surface
(McDonald et al. 2007). In the current chapter, the immersion-freezing
method is described, as applied to brown algae.

25.2 State of the art

The first application of cryofixation and freeze substitution for TEM
samples in brown algae was in fucoid zygotes of Phyllospora comosa
and Hormosira banksii (Schoenwaelder and Clayton 2000). Subsequently,
observations of ultrastructure using this method expanded to several spe-
cies of brown algae, that is, zygotes of Scytosiphon lomentaria (Nagasato
and Motomura 2002) and Silvetia babingtonii (Nagasato et al. 2010); api-
cal cells of Halopteris congesta (Katsaros et al. 2009), Sphacelaria rigidula
(Katsaros et  al. 2009), and Dictyota dichotoma (Terauchi et al. 2012); and
plurilocular sporangia of Ectocarpus siliculosus (Fu et al. 2013). The images
in these reports indicate that detachment of the plasma membrane from
the cell wall does not occur and membranous structures are well pre-
served, showing minimal appearance of artifacts and reflecting their
original structure (Figure 25.1). In the case of brown algae, the immersion-
freezing method preserves cell structure to a depth of more than 20 µm
from the cell surface, but the success rate is less than 10%. In land plants,

M
Ch

P P M
Ch
G
N
Ch
N N
Ch G
Es
C
P
M

(a) (b)

Figure 25.1 Comparison of ultrastructural images between chemical and cryo-

fixation methods. (a) Chemical fixation; (b) cryofixation. Centriole (C), chloroplast
(Ch), eye spot (Es), Golgi body (G), mitochondrion (M), nucleus (N), pyrenoid (P).
Scale bars, 1 µm.
384 Protocols for Macroalgae Research

cryoprotectants, such as sucrose, are used to suppress the formation of

extracellular ice crystals (Seguí-Simarro 2015). In brown algae, cryoprotec-
tants have not been used thus far.

25.3 Materials
25.3.1 Reagents
Liquid nitrogen
Liquid propane
Acetone
Dry ice
2% Osmium tetraoxide (OsO4) in acetone
Spurr Low Viscosity Embedding Kit (Polysicences, Inc., Warrington,
PA, USA)

25.3.2 Equipment
Filter paper
Thin, acetone-resistant support film
Gold wire loop (5–10 mm diam.) with formvar film
Metal caps (appropriate for liquid propane and liquid nitrogen, for
example, small metal milk jug around 10 mL)
Polypropylene tube (50 mL)
Cryogenic tubes (2 mL)
Glass vial (2 or 4 mL)
Small styrene containers (appropriate for holding metal caps, polypro-
pylene tubes, and cryogenic vials)

25.4 Experimental procedures

25.4.1 Preparation of material
A thin, acetone-resistant support film, similar to that used for acrylamide
gel electrophoresis, or a formvar film on gold wire loops (5–10 mm diameter)
are used as sample carriers into the cryogen (Figure 25.2a). Motile cells
bearing flagella, such as gametes and zoospores, are collected by centrifu-
gation. Floating thalli are chopped with a razor blade into pieces less than
5 mm wide. Cell pellets and chopped thalli are put on the formvar-coated
gold wire loop. To induce germination after germlings of reproductive
cells are fixed, motile reproductive cells are inoculated on the thin film
attached to a Petri dish with adhesive tape. Just before cryofixation, the
film with attached germlings is cut into a right triangle to easily distin-
guish the front and back.
Chapter twenty five: Cryofixation of brown algae for TEM 385

(a) (b)

(c) (d)

Figure 25.2 Preparation for immersion freezing. (a) Sample carriers. A formvar
film on gold wire loops and a thin support film with acetone tolerance; (b) mak-
ing liquid propane in the fume hood. Place a hose connected to a propane gas
cylinder (right) into a precooled 50 mL polypropylene tube; (c) liquid propane and
liquid nitrogen poured into separate metal caps on the liquid nitrogen bath; and
(d) dry-ice acetone to keep cryogenic vials under –80°C.

25.4.2 Cryogen and substitution fixative

To make liquid propane, a hose connected to a propane gas cylinder is
placed in a 50 mL polypropylene tube, which is cooled in a liquid nitrogen
bath (Figure 25.2b) (Note 1). About 5 mL of liquid propane is poured into
the small metal cap (Figure 25.2c), which has been precooled in a liquid
nitrogen bath. Liquid nitrogen is then decanted into another metal cap.
Instead of propane, ethane or a mixture of propane and ethane has also
386 Protocols for Macroalgae Research

been used as cryogens (Ryan 1992). However, ethane has not been used as
a cryogen for brown algae.
The substitution fixative is adjusted by adding OsO4 to acetone to a
final concentration of 2%. It is then transferred into a 2 mL cryogenic vial
and cooled in a liquid nitrogen bath.

25.4.3 Cryofixation
Excess culture medium is quickly drained with filter paper before immer-
sion into liquid propane, taking care to avoid plasmolysis. The specimen’s
carrier is held with forceps and rapidly plunged into the metal cap filled
with liquid propane. Quick immersion of the sample into liquid propane
is a key step for obtaining quality images in cryofixation, as it prevents
the growth of ice crystals. After 10 s, the sample is transferred into liquid
nitrogen and then preserved into precooled (<−80°C) 2% osmium–acetone
substitution fixative.

25.4.4 Freeze substitution

Cryogenic vials (2–3  mL volume) containing samples in OsO4 are kept
in dry-ice acetone (−80°C) or a deep freezer for two days (Figure 25.2d)
(Note 2). At this low temperature, frozen water in the cells is gradually
substituted with acetone. After two days, the cryogenic vials are moved
to −20°C for 2 h, then at 4°C for 2 h, and finally, at room temperature for
1 h. Osmium tetroxide fixes phospholipids and proteins as the tempera-
ture rises. The specimen carriers are taken out of the cryogenic vials and
washed with acetone several times at room temperature. Samples are then
removed from these carriers with forceps. If samples adhere to the thin
film, the film is kept intact until the last step. After washing with acetone,
samples are transferred into glass vials (2 or 4 mL).

25.4.5 Infiltration and embedding of samples into resin

For conventional ultrastructural observations of biological specimens,
Epon 812 and Spurr’s resins are frequently used. Spurr’s shows much
lower viscosity and has a faster infiltration into cells than Epon 812. In
brown algae, Spurr’s is preferably used as the embedding resin. Spurr’s
Low Viscosity Embedding Kit includes 3,4-epoxycyclohexylmethyl
3,4-epoxycyclohexanecarboxylate (ERL 4221), diglycidyl ether of poly-
propylene glycol (DER 736), nonenyl succinic anhydride, and dimethyl-
aminoethanol (DMAE) as an accelerator. According to the manufacture’s
protocol, these resin media are compounded. It is possible to preserve the
resin mixture without DMAE at −20°C for several months, but it should
return to room temperature before using it. To perform the procedure,
Chapter twenty five: Cryofixation of brown algae for TEM 387

the resin is first diluted to 10% with acetone. The resin concentration is
then increased 10% every half day until it reaches 100%. A rotary shaker is
used to facilitate the infiltration of resin into cells. Samples in the vials are
exchanged with fresh 100% resin two times, and they are then infiltrated
with 100% resin overnight. New resin containing DMAE is added to the
samples and is kept for half a day. Finally, samples are embedded in the
resin on dishes of aluminum foil, and polymerization is carried out in an
oven at 60°C overnight.
In the case of film with adhering germlings, the resin pedestal must
be prepared beforehand with the same resin using aluminum-foil dishes.
The film is placed upside down with a little resin on the polymerized
resin pedestal. After polymerization, excess resin surrounding the film is
trimmed, the film removed with forceps, and the samples remain on the
flat resin disc (Note 3).

25.5 Notes
Note 1: Liquid propane is explosive when mixed with oxygen for a long
time, and, therefore, each of the above steps should be carried out in
a fume hood. After finishing these steps, liquid propane is immedi-
ately discarded outdoors. The filter paper is torn off by hand before
use to allow the promotion of absorption of water from the small
sample. Cool the cryogenic vials containing substitution medium
before use. Leave the cryogenic vials on liquid nitrogen until half of
the liquid freezes.
Note 2: Osmium tetroxide is highly hazardous. When handling osmium
tetroxide, wear gloves and carry out all steps in the fume hood. To
avoid contamination of freezers and refrigerators with OsO4, put the
cryogenic vials in a metallic can with a cover and seal it with plastic
tape.
Note 3: Vials containing samples immersed in more than 90% resin
should be put in a plastic container with silica gel to control humidity.

25.6 Concluding remarks

Cryofixation is beneficial in obtaining high-quality ultrastructural
images compared with conventional chemical fixation, although there
are limitations. In the current chapter, a procedure of immersion freez-
ing was described in detail. This method can preserve the cell structure
at 10–20 µm depth from the cell surface. An additional advantage of this
method is that special equipment is not necessary. To obtain high-quality
images across a wide range of objectives, high-pressure freezing is applied.
In this case, specimens are subjected to a pressure of 2100  bars, which
388 Protocols for Macroalgae Research

depresses the melting point of water and limits the formation of destruc-
tive ice crystals. This method preserves cell structures up to 600  µm in
depth. In brown algae, tissue from Fucus distichus and huge apical cells
from Halopteris congesta have been studied using this method (Nagasato
et al. 2015, Nagasato et al. 2017). High-quality ultrastructural images were
impossible to obtain using immersion-freezing methods. The disadvan-
tages of high-pressure freezing methods are that the instrument is expen-
sive, and a lot of liquid nitrogen is used. However, almost all samples were
well preserved and gave informative images using this technique.
Cryofixation is also more suitable for immunofluorescence and
immunoelectron microscopy than chemical fixation, because antigen-
recognition regions against the target molecules are preserved in cryofix-
ation but are not with chemical fixation (Guo and Huang 2015). In brown
algae, cryofixation has been applied using both procedures (Fu et al. 2014,
Fu et al. 2016). To obtain structures close to the native state of the cells,
cryofixation should be employed in cytological procedures.

References
Clayton, M. N., and Beakes, G. W. 1983. Effects of fixatives on the ultrastructure
of physodes in vegetative cells of Scytosiphon lomentaria (Scytosiphonaceae,
Phaeophyta). Journal of Phycology 19: 4–16.
Fu, G., Nagasato, C., Ito, T., Müller, D. G., and Motomura, T. 2013. Ultrastructural
analysis of flagellar development in plurilocular sporangia of Ectocarpus
siliculosus (Phaeophyceae). Protoplasma 250: 261–272.
Fu, G., Nagasato, C., Oka, S., Cock, J. M., and Motomura, T. 2014. Proteomics
analysis of heterogeneous flagella in brown algae (stramenopiles). Protist 165:
662–675.
Fu, G., Nagasato, C., Yamagishi, T., Kawai, H., Okuda, K., Takao, Y., Horiguchi, T.,
and Motomura, T. 2016. Ubiquitous distribution of helmchrome in phototac-
tic swarmers of the stramenopiles. Protoplasma 253: 929–941.
Gilkey, J. C., and Staehelin, L. A. 1986. Advances in ultrarapid freezing for the
preservation of cellular ultrastructure. Journal of Electron Microscopy Technique
3: 177–210.
Guo, F., and Huang, B. Q. 2015. Immunogold labeling for electron microscopy:
Strategy and problem solving. In Plant Microtechniques and Protocols,
E. C. T. Yeung, C. Stasolla, C. Sumner, and B. Q. Huang (Eds.), pp. 225–249.
Springer International Publishing, Switzerland.
Hallam, N. D., and Luff, S. E. 1988. The fixation and infiltration of larger brown
algae (Phaeophyta) for electron microscopy. British Phycological Journal 23:
337–346.
Huang, B. Q., and Yeung, E. C. 2015. Chemical and physical fixation of cells and
tissues: An overview. In Plant Microtechniques and Protocols, E. C. T.  Yeung,
C. Stasolla, C. Sumner, and B. Q. Huang (Eds.), pp. 23–43. Springer International
Publishing, Switzerland.
Katsaros, C., Motomura, T., Nagasato, C., and Galatis, B. 2009. Diaphragm develop-
ment in cytokinetic vegetative cells of brown algae. Botanica Marina 52: 150–161.
Chapter twenty five: Cryofixation of brown algae for TEM 389

Kloareg, B., and Quatrano, R. S. 1988. Structure of the cell walls of marine algae
and ecophysiological functions of the matrix polysaccharides. Oceanogry
and Marine Biology, An Annual Review 26: 259–315.
McDonald, K. L., Morphew, M., Verkade, P., and Müller-Reichert, T. 2007. Recent
advances in high-pressure freezing: Equipment and specimen loading meth-
ods. In Methods in Molecular Biolology, Vol. 369, Electron Microscopy: Methods
and Protocols, 2nd Ed., J. Kuo (Ed.), pp. 143–173. Humana Press, Totowa, NJ.
Nagasato, C., Inoue, A., Mizuno, M., Kanazawa, K., Ojima, T., Okuda, K., and
Motomura, T. 2010. Membrane fusion process and assembly of cell wall dur-
ing cytokinesis in the brown alga, Silvetia babingtonii (Fucales, Phaeophyceae).
Planta 23: 287–298.
Nagasato, C., and Motomura, T. 2002. Ultrastructural study on mitosis and cytoki-
nesis in Scytosiphon lomentaria zygotes (Scytosiphonales, Phaeophyceae) by
freeze-substitution. Protoplasma 219: 140–149.
Nagasato, C., Tanaka, A., Ito, T., Katsaros, C., and Motomura, T. 2017. Intercellular
translocation of molecules via plasmodesmata in the multiseriate filamen-
tous brown alga, Halopteris congesta (Sphacelariales, Phaeophyceae). Journal
of Phycology 53: 333–341.
Nagasato, C., Terauchi, M., Tanaka, A., and Motomura, T. 2015. Development and
function of plasmodesmata in zygotes of Fucus distichus. Botanica Marina 58:
229–238.
Ryan, K. P. 1992. Cryofixation of tissues for electron microscopy: A review of
plunge cooling methods. Scanning Microscopy International 6: 715–743.
Schoenwaelder, M. E., and Clayton, M. N. 2000. Physode formation in embryos of
Phyllospora comosa and Hormosira banksii (Phaeophyceae). Phycologia 39: 1–9.
Seguí-Simarro, J. M. 2015. High-pressure freezing and freeze substitution of in vivo
and in vitro cultured plant samples. In Plant Microtechniques and Protocols,
E. C. T. Yeung, C. Stasolla, C. Sumner, and B. Q. Huang (Eds.), pp. 117–134.
Springer International Publishing, Switzerland.
Terauchi, M., Nagasato, C., Kajimura, N., Mineyuki, Y., Okuda, K., Katsaros, C., and
Motomura, T. 2012. Ultrastructural study of plasmodesmata in the brown
alga Dictyota dichotoma (Dictyotales, Phaeophyceae). Planta 236: 1013–1026.
chapter twenty six

Probing the subcellular

topography of seaweeds
Transmission electron microscopy,
immunocytochemistry, and
correlative light microscopy
Sandra C. Raimundo and David S. Domozych

Contents
26.1 Introduction ......................................................................................... 392
26.2 State of the art ...................................................................................... 393
26.2.1 General considerations ......................................................... 393
26.2.2 Protocol considerations ........................................................ 394
26.3 Materials ............................................................................................... 395
26.3.1 Fixation, dehydration, and embedding ............................. 395
26.3.2 Polymerization....................................................................... 397
26.3.3 Sectioning ............................................................................... 397
26.3.4 Uranyl acetate/Lead citrate staining .................................. 397
26.3.5 Immunogold labeling ........................................................... 398
26.4 Experimental procedures................................................................... 399
26.4.1 Fixation ................................................................................... 399
26.4.2 Dehydration ........................................................................... 399
26.4.3 Infiltration .............................................................................. 400
26.4.4 Polymerization....................................................................... 400
26.4.5 Sectioning ............................................................................... 401
26.4.6 Uranyl acetate/Lead citrate staining .................................. 403
26.4.7 Immunogold labeling ........................................................... 404
26.4.8 Considerations for light microscopy and correlative
studies ..................................................................................... 405
26.5 Notes ..................................................................................................... 407
References........................................................................................................ 409

391
392 Protocols for Macroalgae Research

26.1 Introduction
Macroscopic marine algae or seaweeds comprise a diverse range of mul-
ticellular photosynthetic eukaryotes that are classified as brown-, red-,
and green algae. Taxonomically, green seaweeds (Chlorophyta) belong
to the green lineage in the eukaryotic tree of life (Viridiplantae), and
are evolutionarily closer to land plants than other seaweed taxa (Becker
and Marin 2009, Leliaert et  al. 2012); red seaweeds (Rhodophyta) are a
distinct and ancient eukaryotic algal lineage (Yoon et al. 2004), whereas
brown seaweeds (Phaeophyceae) form an independent lineage, which
is neither related to the other algal groups nor to land plants (Patterson
1999). Marine algae exhibit a wide array of morphological forms ranging
from giant kelps with distinctive thallus parts, such as holdfast, stipe, and
blade, to small filamentous or sheet-like phenotypes. Marine seaweeds are
important primary producers and some are keystone species in particular
habitats where they constitute the base of nutrient cycles and ultimately
define biotic diversity. Many seaweeds form extensive beds in intertidal
and subtidal zones of rocky shores, providing the physical infrastructure
for distinct ecosystems (Bold and Wynne 1978, Lobban and Harrison 1994,
Graham and Wilcox 2000). Although humans have historically used many
of these algae for food, fertilizers, and gelling agents, seaweeds are now
taking on even greater economic significance in the biofuel, pharmaceu-
tical, and bioremediation industries (Cardozo et al. 2007, Wargacki et al.
2012, Enquist-Newman et al. 2014, Cunha and Grenha 2016). Yet, the basic
biology of most seaweeds, including fundamental physiological processes
related to growth, development, and reproduction is poorly resolved and
lags significantly behind what is known about land plants. At the cell
biology level, though some seaweed species have been studied as model
organisms for specific biological phenomena, for example, adhesion in
Ulva sp. (Callow and Callow 2006) and polarity establishment in fertilized
eggs in Fucus sp. (Hervé et al. 2016, Torode et al. 2016), little is known about
the vast majority of taxa. Recently, new and valuable molecular studies
have emerged and are providing keen insight into the evolution, phyloge-
netic relationships, and physiological events of various marine algae (Cock
et al. 2010, Collén et al. 2013). Similar endeavors focused at the cellular level
will be required to help translate this wealth of new molecular data. The
technological foundation of many cell biology studies is microscopy. This
includes light microscopy (LM)-based imaging such as those employing
immunofluorescence labeling and fluorescent protein transformants, and
transmission electron microscopy (TEM)-based analyses. LM and TEM
imaging may also be coupled in correlative microscopy studies to provide
complementary data and different topological perspectives. For exam-
ple, in immunocytochemical investigations, immunofluorescence-based
imaging yields overview maps of specific epitope distribution in various
Chapter twenty six: Probing the subcellular topography of seaweeds 393

tissues and organs, whereas complementary TEM-based immunogold

labeling provides high-resolution epitope location within the constituent
cells therein. One of the most critical aspects of microscopy based imag-
ing involves the proper preparation of the sample whereby experimental
probing takes place with least alteration/destruction of the specimen.
Preparation of seaweeds for microscopy based analyses is a major
challenge (Hallam and Luff 1988). Large seaweeds containing cell walls
with gel-forming polysaccharides pose significant problems for the
researcher attempting to prepare samples without unwanted extractions,
incomplete preservation of cell–tissues, and/or generation of misleading
artifacts. Although no method has been shown to be the perfect solution
for preparing these algae for microscopy, there are fundamental strate-
gies that provide practical starting points. This chapter describes a set of
techniques that can be used for fixing and embedding seaweeds in plastic
for subsequent sectioning and observation for TEM and LM microscopy.

26.2 State of the art

26.2.1 General considerations
For the majority of cellular studies, specimens need to be fixed, dehy-
drated, embedded in plastic, and ultimately sectioned. One fixation
strategy entails cryofixation whereby cells/tissues are rapidly frozen in
a cryogen (e.g., liquid propane) at temperatures below −180°C. This is
usually followed by a freeze substitution of the tissue at −80°C or lower
with various chemical fixatives (e.g., formaldehyde, glutaraldehyde, and
osmium tetroxide) dissolved in ethanol, methanol, or acetone, depending
on the embedding medium of choice. After substitution, the cells/tissues
are infiltrated with a plastic embedding medium and precisely positioned
in a capsule or mold. UV-based or heat polymerization follows to yield a
solid plastic block containing the specimen. The initial freezing of cells
and tissues must be rapid to avoid the production of damaging ice crys-
tals. However, the depth of a good cryofixation is often limited because
of the inadequate means of rapid freezing (e.g., freeze plunging of tissue
segments or spray freezing of cells into a cryogen) and/or the size of the
tissue to be frozen. Seaweeds with thick walls and high amount of muci-
laginous intercellular polysaccharides are especially difficult specimens
for cryofixation, and therefore studies have been limited to small struc-
tures such as single-celled zygotes or embryos (Nagasato and Motomura
2002, Nagasato et  al. 2010, 2014). An improvement of the freezing qual-
ity using high-pressure units and/or coupled with cryomicrotomy and
cryo-microscopy is possible but is often prohibitively expensive, therefore
limited to a few laboratories. Most laboratories employ chemical-fixation
protocols followed by dehydration and embedding in a wide assortment
394 Protocols for Macroalgae Research

of embedding agents, especially plastics. Often, this strategy provides

very good results for both structural and specific labeling studies (e.g.,
immunolabeling). Likewise, the judicious choice of the right fixatives and
embedding chemicals can yield materials suitable for both TEM and LM
imaging, that is, correlative microscopy. In this chapter, a basic protocol
for chemical fixation followed by plastic embedding that can be used both
for TEM or LM is provided. Experimental adjustments of specific stages
described here especially when dealing with difficult specific specimens
are encouraged to maximize results.

26.2.2 Protocol considerations

To obtain optimal results when chemically fixing seaweeds, three spe-
cific features need to be carefully considered. First, particular conditions
must be maintained during fixation to prevent shrinkage, extraction of
cellular material, and/or production of artifacts. Specifically, the fixation
buffer should be adjusted to pH 7.8 or matching the pH of the habitat from
which the seaweed was collected. Osmotic conditions that match those of
the seaweed’s habitat must also be carefully considered. An osmometer
is very helpful to discern osmotic conditions, although the use of natural
seawater as the fixation buffer is often satisfactory. Second, choosing the
fixative must take into account the goals of the microscopy-based experi-
ment. Formaldehyde is a fixative that rapidly penetrates tissues and most
often provides good quality for LM imaging. However, for TEM, either
it is not used or is combined in a cocktail with other fixatives such as glu-
taraldehyde. Known for its superb cross-linking activity during fixation,
glutaraldehyde is the preferred fixative for TEM studies and typically
yields superior subcellular ultrastructural preservation. Glutaraldehyde,
though, may interfere with the immunolabeling especially when using
antibodies that recognize protein epitopes. To address this problem and
remove any excess of glutaraldehyde, sections fixed with this chemical can
be treated with ammonium chloride before labeling. Nonetheless, glutar-
aldehyde causes little or no problem when using antibodies that recognize
epitopes present in polysaccharides (which constitutes most of the com-
mercially available monoclonal antibodies [mAbs] used in plant and algal
cell wall research). Another fixation concern may occur if one wishes to
use osmium tetroxide, a chemical that binds to membrane lipids and sig-
nificantly enhances contrast for TEM imaging. However, osmium tetrox-
ide should not be used in immunogold labeling or with common plastics;
for example, London Resin (LR) White resin, and should be removed
from the tissues by preincubating the sections in 3%–5% (v/v) H2O2 before
immunolabeling. It is also important to note that many of the newer
TEMs have energy filter lenses that allow a superb contrast of nonosmi-
cated specimens and thereby eliminate the need to use osmium tetroxide in
Chapter twenty six: Probing the subcellular topography of seaweeds 395

the fixation process. Third, the choice of the embedding chemical (e.g.,
plastic) is also critical, depending on the ultimate goal of the microscopy
study. Some plastics are polymerized with heat (e.g., epoxy plastics such
as Spurr’s Low-Viscosity Embedding Mixture) that may potentially cause
alterations to the antigens recognized by mAbs. Other agents may be
polymerized with UV at a wide range of temperatures. Many laboratories
employ LR White as it can be either UV-polymerized (room temperature
[RT], 4°C or −20°C) or heat polymerized (60°C). Other plastics can be UV
polymerized at very low temperature (e.g., −40°C or lower in the case of
Lowicryl® embedding media) but require special equipment and are often
a source of noxious vapors.

26.3 Materials
The following materials represent some of the resources required for pro-
cessing seaweeds for microscopic studies.

26.3.1 Fixation, dehydration, and embedding

All chemicals described in the list below are available from diverse com-
mercial sources (e.g., Electron Microscopy Sciences [EMS], USA; Agar
Scientific, UK; Sigma-Aldrich®, USA). Vacuum-sealed glass ampules with
specific concentrations of fixatives (Figure 26.1a) are recommended as
they are relatively inexpensive, easy to use, and safer to dispose. Both
natural and artificial seawater are appropriate to prepare the fixation buf-
fer. If a different buffer (e.g., sodium cacodylate) is chosen, high purity
deionized water (e.g., 18  MΩ resistivity) should be used. All fixations
should be performed under a fume hood, and all personnel should wear
gloves and protective eye gear. Institutional and government-based safety
regulations for hazardous waste disposal should be followed (Note 1). The
materials needed include the following:

• Seawater (natural or artificial).

• Styrofoam™ container with ice.
• 9 cm diameter plastic Petri dish.
• Tweezers.
• Glass scintillation vials.
• Disposable pipettes.
• Bell-jar connected to a vacuum pump or vacuum filtration unit.
• Single-edge blades of carbon steel.
• Laboratory shaker.
• Paraformaldehyde 16% (w/v), EM grade.
• Glutaraldehyde 25% EM grade distillation purified.
• Osmium tetroxide 4% (w/v) aqueous solution.
396 Protocols for Macroalgae Research

(a) (b) (c)

Aclar film

Mold

(d) (e) (f )

(g) (h)

Figure 26.1 (a) Vacuum-sealed glass ampule of glutaraldehyde. (b) On collection

of the seaweeds from the field, pieces are cut arrow and placed in a Petri dish con-
taining the fixative solution. (c) After cutting smaller pieces, these are placed in
glass scintillation vials containing the fixative solution. (d) Filtration unit attached
to a sink aspirator can be used to remove air trapped in the samples. (e) A vari-
ety of BEEM® and gelatin capsules can be used for polymerization. (f) Molds can
also be chosen to polymerize samples, although if using LR White embedding
medium, Aclar® film must be applied to seal the molds. (g) Samples prepared
for TEM have a black appearance, whereas samples prepared for LM often look
transparent, or retain some of the original color of the sample.
Chapter twenty six: Probing the subcellular topography of seaweeds 397

• Acetone or ethanol (depending on the embedding medium of choice).

• Fixative solution: 2% (v/v) paraformaldehyde with 1% (v/v) glutaral-
dehyde in seawater or buffer of choice. Prepare fresh and keep the
solution in a box with ice.
• Postfixative: 1% (v/v) osmium tetroxide in ice cold seawater or buffer
of choice. Prepare freshly before use.
• LR White embedding medium-grade acrylic resin.
• Low-viscosity Embedding Media Spurr’s kit.
• Plastic cup with paper lid (for Spurr’s preparation).
• Dehydrating series solutions: If using LR White, prepare solutions
of 10% (v/v), 30% (v/v), 50% (v/v), 70% (v/v), 90% (v/v), and 100% (v/v)
of ethanol in seawater. If using Spurr’s, prepare the same concentra-
tions, but use acetone in seawater.

26.3.2 Polymerization
• BEEM® embedding capsules, gelatin capsules, or molds for flat
embedding
• Aclar® 33c embedding film (if using LR White)
• Tweezers
• Laboratory UV lamp (for LR White medium)
• Laboratory oven (for Spurr’s medium)

26.3.3 Sectioning
• Ultramicrotome such as the Leica EM UC6 ultramicrotome
• Histo-diamond knife (e.g., DiATOME, Hatfield, PA, USA)
• Single-edge blades of carbon steel
• High precision and ultrafine tweezers
• Microscope slides
• Formvar-coated copper, nickel, or gold grids
• Chloroform
• Squeeze lab bottle with dH2O
• Glass pipette with a plug of cotton inside
• Filter paper ripped in pieces
• Eyelash tool: Use glue or nail polish to attach an eyelash or a fine hair
of an artist’s fine brush to a toothpick handle
• Grid storage box

26.3.4 Uranyl acetate/Lead citrate staining

• Sodium hydroxide pellets.
• Water without dissolved CO2: Boil dH2O in a glass bottle for 4–6 min
in a microwave. Cap and let it cool down overnight before use.
• Squeeze lab bottle with dH2O.
398 Protocols for Macroalgae Research

• Disposable pipettes.
• Uranyl acetate 1% (w/v) solution.
• Lead citrate 1% (w/v) solution.
• High precision and ultrafine tweezers.
• 100 mL glass beakers.
• Glass Petri dish (100 mm diameter).
• Filter paper ripped in pieces.
• Silicone staining plates.
• Grid storage box.

26.3.5 Immunogold labeling

• PBST: Add 10 mL of a 10x stock phosphate-buffered saline (PBS) to
90 mL dH2O. Mix and adjust pH to 7.0–7.2. Add 100 µL of TWEEN®
20 and shake into solution.
• Blocking solution: Place 10  mL of PBST in a 15  mL Falcon™ tube.
Add 0.1 g of Carnation Instant Milk and vortex for 20 s to dissolve.
• Ammonium chloride (to remove glutaraldehyde): Place 50  mL of
dH2O in a 50 mL Falcon™ tube, add 0.13 g of ammonium chloride
and dissolve.
• Hydrogen peroxide (to remove osmium tetroxide): Add 1 mL of 30%
(v/v) of H2O2 (stored at 4°C) to 5 mL of dH2O. Wear gloves and use
with care.
• Primary antibodies: mAbs for many cellular components may be
obtained from Agrisera Inc, or Sigma-Aldrich®. Cell wall epitope rec-
ognizing mAbs may be purchased from Plant Probes (Leeds, UK),
the Complex Carbohydrate Research Center (Athens, GA, USA), or
Biosupplies (Bundoora, Australia); mAbs may be diluted in PBST to
the desired concentration.
• Secondary antibody: gold conjugated goat anti-rat IgG (10–15  nm
range is best for TEM) may be obtained from Nanoprobes (Yaphank,
NY, USA), Sigma-Aldrich®, Agar Scientific, or EMS and is diluted in
PBST to the desired concentration.
• Microcentrifuge (Fisher Scientific accuSpin Micro 17).
• Vortex (Vortex Genie2).
• Filter paper ripped in pieces.
• Sheets of Parafilm M®.
• High precision and ultrafine tweezers.
• Disposable pipettes.
• 50 mL beaker.
• Squeeze lab bottle with dH2O.
• Moisture chamber: Use a plastic box with lid, such as a Tupperware®
box, place some sheets of paper, moisture with water, and place a
flat bottom glass base (such as a glass Petri dish lid) that fits the box.
Chapter twenty six: Probing the subcellular topography of seaweeds 399

• Porcelain multiwell plates.

• Microscope slides.
• Oven with a temperature set at 33°C.

26.4 Experimental procedures

26.4.1 Fixation
1. Prepare the fixative solution and keep on ice. If the specimen is also
to be used for LM sections, glutaraldehyde may be eliminated from
the fixative; a low percentage of 0.25% (v/v) has also shown to be suc-
cessful in the case of brown seaweeds (Note 2).
2. Pour 5 mL of the fixative into a 9 cm plastic Petri dish also on ice. Cut
portions of the seaweed thallus from the collected specimen and place
it immediately in the fixative. Using a razor blade, cut 0.5–2.0  cm
of seaweed segments in the fixative (Figure 26.1b). Excision of sea-
weed parts directly in the fixative allows a faster infiltration of the
chemical.
3. Gently collect the seaweed pieces with forceps, place in a screw cap
glass scintillation vial containing the fixative (Figure 26.1c), and keep
on ice for 30–60 min. For some dense seaweed parts, fixations at 4°C
for up to 48 h may be required.
4. If the samples float in the fixative and do not sink, place the vial with
a loose cap in a small ice bath in a bell jar connected to a vacuum
pump or to the top chamber of a medium filtration unit attached to a
sink aspirator (if a vacuum pump is unavailable). (Figure 26.1d, Note 3).
Once the vacuum is applied, the seaweed pieces typically sink after
2–5 min. Remove the vial and put it back on ice.
5. Remove and discard the fixative with a pipette, wash the samples
with ice cold seawater or another buffer for 5 min. Repeat the wash-
ing step twice.
6. Postfixation: If using a postfixative such as osmium tetroxide, place
the samples in a vial and cover them with the postfixative solution
(Note 4). Incubate on ice for 2 h, or overnight. Samples can be gently
shaken on a laboratory shaker, vacuum infiltrated, or processed in a
microwave oven (Note 5).
7. Repeat the washing step 5.

26.4.2 Dehydration
Most embedding agents are hydrophobic. Therefore, water must be
removed from the specimen. Therefore, samples are slowly dehydrated
in a series of ethanol or acetone before adding the embedding medium.
Using a pipette to add or remove the solutions, samples are dehy-
drated in the graded ethanol or acetone series (10% [v/v], 30% [v/v], 50%
400 Protocols for Macroalgae Research

[v/v], 70% [v/v], 90% [v/v], and 100% [v/v]) during 30–60  min for each
grade, with gentle shaking, either at RT, at 4°C (ice bath or refrigerator) or
at −20°C (commercial freezer). For embedding media that may be polym-
erized with UV light (e.g., LR White), the ethanol dehydration should be
carried on at 4°C or −20°C; for epoxy plastics especially of osmicated spec-
imens, RT dehydration is satisfactory. The 70% (v/v) dehydrating stage is
an appropriate timing for an overnight incubation (Note 6).

26.4.3 Infiltration
After dehydration, the tissue segments are slowly infiltrated in a series of
embedding medium dissolved in the dehydrating agent (Note 7).
For LR White: Incubate the samples in a series of LR White:ethanol of
1:2, 1:1, 2:1, and 1:0. The first three infiltration steps should be 2–4 h long
each, at RT, 4°C or −20°C. The seaweed parts should be lightly shaken
during infiltration, placed in pure LR White at the desired temperature,
and lightly shaken for a period of up to two days.
For Spurr’s medium, prepare the resin beforehand in a plastic cup
according to the manufacturer’s instructions. Use a similar infiltration
series using acetone as the solvent. The final incubation with 100% Spurr’s
medium is performed overnight, or for one day, at RT.

26.4.4 Polymerization
A variety of specimen molds used for polymerization is commercially
available, such as plastic BEEM® capsules, gelatin capsules (Figure 26.1e),
and molds for flat embedding made of rubber, Teflon, or flexible plastic
(Figure 26.1f).

1. Seaweed parts may be trimmed with a razor blade to fit in the appro-
priate mold.
2. Add a small amount of the resin of choice (if using LR White and has
to be UV polymerized, an accelerator should be added in advance
following the manufacturer’s instructions). Using forceps, carefully
place a piece at the bottom of a BEEM® capsule or at the end of a
flat embedding mold in the desired orientation/position, and fill the
mold with resin. A dissecting light microscope is often helpful to
properly position the seaweed part in the mold.
3. For LR White polymerization, the BEEM® capsule is capped care-
fully. For flat embedding molds, a piece of Aclar® embedding film
should be cut and carefully placed over the molds, making sure that
there are no air bubbles between the resin and the film (Figure 26.1f)
(Note 8). Position a laboratory UV lamp 10–20 cm above the mold and
polymerize the sample for 24 h at the desired temperature (Note 9).
Chapter twenty six: Probing the subcellular topography of seaweeds 401

LR White polymerization has also been proven to work well for

brown seaweeds at 60°C for two days (Raimundo et al. 2016, 2017).
4. For Spurr’s polymerization, the BEEM® capsules should not be
capped or covered. Polymerize the samples at 70°C for 8 h (or at the
temperature specified by the manufacturer).
5. After polymerization, the plastic of the BEEM® capsule is cut with
a razor blade, releasing the polymerized sample (Figure 26.1g),
whereas for gelatin capsules there is no need to remove the gelatin
from the sample (Figure 26.1h). For flat embedding molds, the Aclar®
film is removed, the mold is gently bent, and the blocks pop out.
Blocks can be stored in labeled paper or glassine envelopes at RT for
years.

26.4.5 Sectioning
An ultramicrotome is the most convenient instrument to obtain sections
ranging in thickness from 500 nm for LM to 50–70 nm for TEM purposes.
Depending on the embedding medium chosen, the same block can be
conveniently used for correlative studies at the LM and TEM levels. Thick
sections may be immunolabeled and imaged with a fluorescence LM, and
labeled zones identified and documented. Thin sections are obtained
from selected zones and processed for immunogold labeling studies to
elucidate a more precise epitope location through electron microscopy.
Specific protocols include the following:

1. Knife manufacture: For sectioning, a knife that accurately cuts embed-

ded specimens with a specific thickness is a critical tool. Glass or
diamond knives can be used to section. Glass knives are relatively
cheap and highly effective for all thickness sections, but their dura-
bility and shelf life are limited. Water-cooled glass strips and troughs
must be assembled and individual knife is quality assessed before
each sectioning session. Likewise, the knife maker used for scoring
and fracturing the glass to make the knife must be regularly main-
tained and cleaned. On the other hand, diamond knives are more
expensive, but if cared properly, may provide outstanding sections
for years. Their cutting edge is extremely durable, whereas glass
knives must constantly be replaced, and it is possible to obtain ultra-
thin sections (50 nm). Information on the various knives, including
maintenance and troubleshooting are provided by manufactures,
for example, DiATOME (Hatfield, PA, USA).
2. Preparation of imaging platforms for TEM grids and special tools: Before
sectioning for TEM, grids, that is, the platforms for holding sections
(Figure 26.2a) must be prepared. Typically, a 0.25%–1.0% (v/v) layer of
Formvar or another transparent plastic is coated on the grid. Grids
402 Protocols for Macroalgae Research

Chloroform pipette

(a) (b) “Eye lash”

(c)

Grid box

UA LC
NaOH

(d)
(e)

1 2 3 4 5

10 9 8 7 6
(f ) (g)

Figure 26.2 (a) Gold, nickel, or copper (first to third column, respectively) grids
are used to hold sections for TEM observations. (b) Useful tools for sectioning:
chloroform pipette, and eyelash attached to a toothpick. (c) Trimming the block
with a razor blade is the first and essential step for a successful sectioning.
(d) During the sectioning procedure, sections can be observed floating on the
water (arrow). (e) Apparatus used for uranyl acetate/lead citrate staining proce-
dure. A CO2-free chamber is essential to avoid the formation of lead carbonate
deposits. UA, Uranyl acetate drops; LC, Lead citrate chamber; NaOH, Sodium
hydroxide pellets. (f) 10 Multiwelled immunoslide is useful when performing
immunolabeling with different antibodies. (g) Microbiology loop used to pick
sections.
Chapter twenty six: Probing the subcellular topography of seaweeds 403

are dried and stored at RT until needed. For routine ultrastructural

studies, copper grids are typically used. For immunogold labeling,
nickel or gold grids should be used. To help collect the sections onto
grids, two valuable tools to have are the eyelash and a chloroform
vapor-dispensing pipette (Figure 26.2b). The former is easily assem-
bled by affixing an eyelash to a toothpick handle with glue or nail
polish. The latter consists of a glass pipette filled with a plug of cot-
ton that is wetted with chloroform. A rubber bulb is placed on the
open end of the pipette and through gentle squeezing, puffs of chlo-
roform vapor are released from the tip.
3. Trimming specimen blocks: To facilitate sectioning of plastic-embedded
specimens with a small knife edge (diamond knives cutting edge
size range from 0.5–4.0  mm), the block face must be properly
trimmed. Using the trimming vice of an ultramicrotome and razor
blades (Figure 26.2c), a trapezoid is cut around the specimen with
1.0  mm or less. It is important to trim the sides of the block at a
slight angle, as steeper angles result in vibrations and chatter dur-
ing sectioning.
4. Sectioning for TEM: After placing the trimmed block on the micro-
tome and carefully positioning it with respect to the knife edge,
50–70 nm sections are cut and floated onto to the surface of the water
that fills the trough behind the knife (Figure 26.2d). The chloroform
dispensing pipette is then used to gently release chloroform vapors
over the sections (Note 10). The sections can be trapped into one area
of the trough using the eyelash, collected, and placed on the coated
grids. Excess of water should be removed from the grid surface by
carefully touching the grid edge with a piece of ripped filter paper
without touching the sections. Grids can be stored in a grid storage
box indefinitely.

26.4.6 Uranyl acetate/Lead citrate staining

For routine ultrastructural work, the sections are stained with conven-
tional uranyl acetate and lead citrate (Venable and Coggeshall 1965, Hayat
1981). Grid staining may not be necessary if using a TEM with energy
filtration lenses.

1. Keep the solutions in 15 mL Falcon™ tubes at 4°C for regular use,
and before using them make sure to centrifuge for 1 min at 1000 rpm
to precipitate unwanted particles.
2. Prepare a CO2-free chamber: Put a silicone plate in a glass Petri dish,
place sodium hydroxide pellets around it, put the number of drops
404 Protocols for Macroalgae Research

of lead citrate needed on the wells (one per grid), and close the cham-
ber with the lid (Figure 26.2e, Note 11).
3. Put a drop of uranyl acetate on a silicone plate, one drop for each
grid, and incubate for 5–10 min (section facing the stain).
4. Wash the grids with a gentle continuous stream of dH2O, dry with a
ripped filter paper piece.
5. Place each grid on a drop of lead citrate, close the chamber, and let it
incubate for 1–2 min.
6. Dip the grids in a beaker with the CO2-free dH2O, gently, for a few
seconds, wash again with a gentle continuous stream of dH2O, dry
with ripped filter paper, and store indefinitely in the grid box until
observation.

26.4.7 Immunogold labeling

For all the procedures except those requiring the porcelain plates,
perform the incubations placing drops of the solutions on Parafilm M®
sheets previously placed on the lab bench, one drop for each grid,
and incubating the grids on the solutions with the section facing the
solution.

1. Spread Parafilm M® sheets on the bench and place drops of H2O2

solution to match the number of grids. Float each grid in each drop
with section-side (or Formvar-side or dark-side) down onto the
solution for 5 min (Note 12).
2. Wash the grids with a gentle stream of dH2O. Blot dry with a ripped
filter paper.
3. Float the grids for 20 min on drops of ammonium chloride solution.
4. Repeat washing step 2.
5. Pipette 1  mL aliquots of the blocking solution in Eppendorf tubes
and centrifuge at 12,000 rpm for 1 min. Use the supernatant of the
blocking solution to incubate the grids for 20–30 min.
6. Repeat washing step 2.
7. Float grids on 20–30  µL of diluted primary mAb in the wells of
porcelain plate (Note 13).
8. Cover the wells with microscope slides, place the porcelain dish
carefully in the moisture chamber, close the lid, and place it care-
fully in the oven at 33°C for 90 min (this step can also be performed
at 4°C overnight).
9. Remove the moisture chamber from the oven; remove the porcelain
dish with the grids at RT.
10. Repeat washing step 2.
11. Float the grids on blocking solution for 20–30 min. At this time, also
prepare the secondary antibody solutions.
Chapter twenty six: Probing the subcellular topography of seaweeds 405

12. Repeat washing step 2.

13. Float the grids on drops of secondary antibody solution in the wells
of a new porcelain dish. Cover the wells with microscope slides,
place the porcelain dish carefully in the moisture chamber, close the
lid, and place it carefully in the oven at 33°C for 90 min.
14. Remove the moisture chamber from the oven, remove the porcelain
dish with the grids at RT.
15. Repeat washing step 2.
16. Stain the grids with uranyl acetate/lead citrate (Figure 26.2e). After
drying, samples are ready for TEM observation.

26.4.8 Considerations for light microscopy and correlative studies

For examining thick sections (e.g., 500 nm) with LM using the same block
of seaweed samples, the following protocol is recommended.

1. Before sectioning, 10- or 12-welled immunoslides should be coated

(Figure 26.2f, Note 14): Add 25 µL of a 1 mg/mL poly-l-lysine solution
to each well of, let it stand for 5 min, and remove the excess with a
micropipette. Let it dry at RT. Slides may be kept for several weeks
in a refrigerator until needed.
2. Trimming and microtome setup are the same as for TEM section-
ing. However, 250–500 nm sections are more common for LM. The
eyelash tool is used to corral the sections together. The sections
are collected by placing a clean microbiology loop (Figure 26.2g)
around the section floating on the water and lifting it up. The sec-
tion is caught in a film of water in the loop. The loop is gently tapped
into a well of the slide where the drop of water with the section is
deposited. Clean the microbiology loop regularly by heating it over
an alcohol lamp. The other wells of the slide can be filled with as
many sections as needed. Using a dissecting microscope, carefully
remove the excess of water. Dry the slides at RT or in a 37°C incu-
bator for 1 h. The slides can be stored in a refrigerator for months
until use. Alternatively, sections can be dried at 50°C straight after
collection.
3. Stain some sections with a reference stain such as toluidine blue
(1% [w/v] toluidine blue in 1% [w/v] sodium borate) for 30 s, wash
with dH2O, and dry at 50°C (Figure 26.3a–b, Note 15).
4. For immunolabeling procedures, a similar protocol is used as for
immunogold labeling, but the secondary antibody used is a goat
anti-mouse IgG or goat anti-rat IgG conjugated with a fluorochrome,
such as TRITC or FITC (Figure 26.3c–d). In the final washing steps,
place 10 µL of PBS in each well, cover with a cover slip 20 × 75 mm,
remove the excess of liquid, and seal with nail polish. Slides can be
406 Protocols for Macroalgae Research

(a) (b)

(c) (d)

(e) Pd (f)

IS IS

CW
IS

CW

Figure 26.3 (a) Natural habitat of the brown seaweed Laminaria digitata. (b) Cross
section of L. digitata blade stained with toluidine blue. (c) Negative control where
no primary mAb is used. (d) Cross section of L. digitata blade immunolabeled
with LM7 mAb. LM7 is an excellent probe for alginate-containing extracellular
matrix in brown seaweed tissues. (e) Transmission electron micrograph of L. digitata
blade cross section immunogold labeled with LM7. (f) Detail of the gold particles
showing the labeling of the cell wall. CW, cell wall; IS, intracellular space;
Pd, plasmodesmata. Scale bar: (b–d) = 20 µm, (e) = 1 µm, (f) = 200 nm.
Chapter twenty six: Probing the subcellular topography of seaweeds 407

kept in a refrigerator for up to six months. The same tissue areas

can them be correlated together with TEM immunogold labeling
(Figure 26.3e–f).

26.5 Notes
Variations and refinements in reagents, equipment, and protocols are
often necessary for the accommodation of the aforementioned protocols
in particular laboratories. The following list includes some common areas
where changes may be performed, and comments on details that should
be kept in mind while performing the experiments.

Note 1: In some situations, it may be preferable or necessary to perform

a fixation in the collection site. A Styrofoam™ box containing the
fixative solution, glass scintillation vials, razor blades, plastic Petri
dishes, forceps, ice, waste container, and gloves are taken out to the
field and fixation is performed in situ. The vials with the fixed speci-
mens are kept on the ice, taken to the laboratory as soon as possible,
and vacuum infiltrated if needed. Particular care must be taken to
avoid spilling fixative into the collection habitat.
Note 2: Glutaraldehyde is known for being an excellent fixative, and it
has shown to work well in the preservation of brown seaweed tis-
sues for LM fluorescence observations (Raimundo et al. 2016, 2017),
but a low concentration should be used, such as 0.25% (v/v), as glu-
taraldehyde induces an increase in autofluorescence, commonly
observed in many brown seaweed tissues, which will interfere with
immunofluorescence observations.
Note 3: During the fixation process, the seaweed pieces should sink to
the bottom of the vial. If they keep floating, vacuum infiltration is
necessary to remove air trapped in the tissues. The presence of air in
the sample will lower the success of the penetration efficacy of the
fixative and further embedding procedure.
Note 4: The use of osmium tetroxide as a secondary or postfixative
is commonly used to enhance contrast in TEM studies but is not
needed for LM.
Note 5: Recently, the use of special microwave ovens (e.g., EMS-9000
precision-pulsed laboratory microwave oven) modified for speci-
men processing have been used in the processing of specimens for
microscopy. The function of these devices is to make the fixation–
infiltration–embedding processes faster, with the same results as
regular methods (Login and Dvorak 1988, Webster 2007). Currently,
there is limited published information regarding their application in
the processing of seaweeds.
408 Protocols for Macroalgae Research

Note 6: The chemical composition and/or organization of the thallus

parts of some seaweeds (especially brown seaweeds) might limit the
permeability to the embedding chemicals, therefore longer dehy-
drating stages may be needed (e.g., 1–4 h each grade). This may be
confirmed after sectioning; the seaweed part separating from the
embedding agent or the presence of empty holes within the tissue
after sectioning and microscopy imaging is an indicator of an incom-
plete penetration of the embedding medium.
Note 7: It is up to the researcher to use LR White or Spurr’s as the
embedding medium of choice, as both provide satisfactory results
with seaweeds. However, if using LR White, ethanol must be used
for the dehydration process and as a solvent for the embedding
series, whereas the same steps are performed with acetone if Spurr’s
medium is the resin of choice.
Note 8: Although Spurr’s medium polymerizes in contact with air, oxy-
gen alters the polymerization ability of LR White, therefore the pres-
ence of any air bubbles must be avoided by capping the BEEM® or
gelatin capsules tightly, and if using flat molds, Aclar® film should
cover the resin. If oxygen infiltration becomes a problem, LR White
polymerization can be performed in a vacuum desiccator or a cham-
ber where nitrogen gas is pumped.
Note 9: Styrofoam™ blocks are a practical and inexpensive solution to
hold the UV lamps under and above the embedding molds.
Note 10: One major problem that occurs when sectioning is that the
hydrophobic embedding material wrinkles when floating on water.
Wrinkles may be removed by gently releasing vapors of chloroform
over the sections using the chloroform-dispensing pipette. The
vapor results in the immediate section dewrinkling.
Note 11: During the staining with lead citrate, it is highly recommended
that CO2-free water is used when washing the grids to avoid the for-
mation of lead carbonate deposits on the specimen that will appear as
black dots and smudges on the specimen during TEM observations.
Note 12: Incubation with H2O2 is only required if the samples were
osmicated.
Note 13: Immunogold labeling can only be performed on nickel or gold
grids; do not use copper grids for this procedure.
Note 14: Multiwelled immunoslides are very useful because immuno-
labeling with different mAbs can be performed per slide. Some sea-
weed species have shown to be difficult to use, as sections detach
from the slides during staining/immunolabeling. To avoid such
situations, multiwell immunoslides can be coated with poly-l-lysine
before used. An alternative that has also proven to be successful
with brown seaweeds is the use of noncoated Superfrost™ Plus
slides (Fisher Scientific, Pittsburg, PA, USA).
Chapter twenty six: Probing the subcellular topography of seaweeds 409

Note 15: When performing immunolabeling procedures, it is important

to keep in mind that the labeling will appear on a black background.
Therefore, it is useful to have some sections from the same block
stained with, for example, toluidine blue, which is an excellent dye
for seaweeds to have a reference regarding the localization of the
labeling within the tissue/cells.

References
Becker, B., and B. Marin. 2009. Streptophyte algae and the origin of embryophytes.
Annals of Botany 103 (7):999–1004.
Bold, H. C., and M. J. Wynne. 1978. Introduction to the Algae: Structure and
Reproduction. Englewood, NJ: Prentice Hall.
Callow, J. A., and M. E. Callow. 2006. The Ulva spore adhesive system. In Biological
Adhesives, A. M. Smith and J. A. Callow (Eds.), pp. 63–78. Berlin, Germany:
Springer.
Cardozo, K. H. M., T. Guaratini, M. P. Barros, V. R. Falcão, A. P. Tonon, N. P. Lopes,
S. Campos et  al. 2007. Metabolites from algae with economical impact.
Comparative Biochemistry and Physiology, Part C: Toxicology & Pharmacology
146 (1–2):60–78.
Cock, J. M., L. Sterck, P. Rouzé, D. Scornet, A. E. Allen, G. Amoutzias, V. Anthouard
et al. 2010. The Ectocarpus genome and the independent evolution of multi-
cellularity in brown algae. Nature 465 (7298):617–621.
Collén, J., B. Porcel, W. Carré, S. G. Ball, C. Chaparro, T. Tonon, T. Barbeyron
et  al. 2013. Genome structure and metabolic features in the red sea-
weed Chondrus crispus shed light on evolution of the Archaeplastida.
Proceedings of the National Academy of Sciences of the United States of America
110 (13):1–6.
Cunha, L., and A. Grenha. 2016. Sulfated seaweed polysaccharides as multifunc-
tional materials in drug delivery applications. Marine Drugs 14 (3):42.
Enquist-Newman, M., A. M. Faust, D. D. Bravo, C. N. Santos, R. M. Raisner, A. Hanel,
P. Sarvabhowman et al. 2014. Efficient ethanol production from brown mac-
roalgae sugars by a specific yeast platform. Nature 505 (7482):239–243.
Graham, L. E., and L. W. Wilcox. 2000. Algae. New York: Prentice Hall.
Hallam, N. D., and S. E. Luff. 1988. The fixation and infiltration of larger brown
algae (Phaeophyta) for electron microscopy. British Phycological Journal
23 (4):337–346.
Hayat, M. A. 1981. Principles and Techniques of Electron Microscopy—Biological
Applications. 2nd ed. Vol. 1. Baltimore, MD: University Park Press.
Hervé, C., A. Siméon, M. Jam, A. Cassin, K. L. Johnson, A. A. Salmeán, W. G. T.
Willats, M. S. Doblin, A. Bacic, and B. Kloareg. 2016. Arabinogalactan pro-
teins have deep roots in eukaryotes: Identification of genes and epitopes
in brown algae and their role in Fucus serratus embryo development. New
Phytologist 209 (4):1428–1441.
Leliaert, F., D. R. Smith, H. Moreau, M. D. Herron, H. Verbruggen, C. F. Delwiche,
and O. De Clerck. 2012. Phylogeny and molecular evolution of the green
algae. Critical Reviews in Plant Sciences 31:1–46.
Lobban, C. S., and P. J. Harrison. 1994. Seaweed Ecology and Physiology. Cambridge,
UK: Cambridge University Press.
410 Protocols for Macroalgae Research

Login, G. R., and A. M. Dvorak. 1988. Microwave fixation provides excellent pres-
ervation of tissue, cells and antigens for light and electron microscopy. The
Histochemical Journal 20 (6):373–387.
Nagasato, C., A. Inoue, M. Mizuno, K. Kanazawa, T. Ojima, K. Okuda, and
T. Motomura. 2010. Membrane fusion process and assembly of cell wall dur-
ing cytokinesis in the brown alga, Silvetia babingtonii (Fucales, Phaeophyceae).
Planta 232 (2):287–298.
Nagasato, C., and T. Motomura. 2002. Ultrastructural study on mitosis and cytoki-
nesis in Scytosiphon lomentaria zygotes (Scytosiphonales, Phaeophyceae) by
freeze-substitution. Protoplasma 219 (3):140–149.
Nagasato, C., N. Kajimura, M. Terauchi, Y. Mineyuki, and T. Motomura. 2014.
Electron tomographic analysis of cytokinesis in the brown alga Silvetia
babingtonii (Fucales, Phaeophyceae). Protoplasma 251 (6):1347–1357.
Patterson, D. J. 1999. The diversity of eukaryotes. The American Naturalist 154
(S4):S96–S124.
Raimundo, S. C., U. Avci, C. Hopper, S. Pattathil, M. G. Hahn, and Z. A. Popper.
2016. Immunolocalization of cell wall carbohydrate epitopes in seaweeds:
Presence of land plant epitopes in Fucus vesiculosus L. (Phaeophyceae). Planta
243 (2):337–354.
Raimundo, S. C., S. Pattathil, S. Eberhard, M. G. Hahn, and Z. A. Popper. 2017.
β-1,3-Glucans are components of brown seaweed (Phaeophyceae) cell walls.
Protoplasma 254 (2):997–1016.
Torode, T. A., A. Siméon, S. E. Marcus, M. Jam, M.-A. Le Moigne, D. Duffieux,
J. P. Knox, and C. Hervé. 2016. Dynamics of cell wall assembly during early
embryogenesis in the brown alga Fucus. Journal of Experimental Botany
67:6089–6100.
Venable, J. H., and R. Coggeshall. 1965. A simplified lead citrate stain for use in
electron microscopy. The Journal of Cell Biology 25 (2):407–408.
Wargacki, A. J., E. Leonard, M. N. Win, D. D. Regitsky, C. N. S. Santos, P. B. Kim,
S. R. Cooper et al. 2012. An engineered microbial platform for direct biofuel
production from brown macroalgae. Science 335 (6066):308–313.
Webster, P. 2007. Microwave-assisted processing and embedding for transmission
electron microscopy. In Electron Microscopy: Methods and Protocols, J. Kuo
(Ed.), pp. 47–65. Totowa, NJ: Humana Press.
Yoon, H. S., J. D. Hackett, C. Ciniglia, G. Pinto, and D. Bhattacharya. 2004.
A molecular timeline for the origin of photosynthetic eukaryotes. Molecular
Biology and Evolution 21 (5):809–818.
chapter twenty seven

Coralline algae preparation for

scanning electron microscopy
and optical microscopy
S. Kaleb, G. Alongi, and A. Falace

Contents
27.1 Introduction ..........................................................................................411
27.2 State of the art ...................................................................................... 412
27.3 Materials ............................................................................................... 412
27.3.1 Materials for optical microscopy ........................................ 412
27.3.2 Materials for scanning electron microscopy ..................... 413
27.4 Experimental procedures....................................................................414
27.4.1 Choice of the portion to cut and orientation of the
sample ......................................................................................414
27.4.2 Optical microscopy ............................................................... 420
27.4.3 Scanning electron microscopy ............................................ 423
27.5 Notes ..................................................................................................... 425
Acknowledgments ......................................................................................... 427
References........................................................................................................ 427

27.1 Introduction
Coralline algae (CA) are distributed from tropical regions to the poles,
thriving from the intertidal to the lower boundaries of the euphotic zone.
Because of the calcium carbonate present in their cell walls, they fill a
paramount role as bioconstructors of coral reefs, coralligenous, rhodolith
beds, providing three-dimensional habitats and contributing to carbon-
ate deposition in marine ecosystems. CA are object of studies related to
global change and are also used in paleoenvironmental reconstruction
as biological datalogger (McCoy and Kamenos 2015; Kamenos et al. 2016).
The Marine Strategy Framework Directive (MSFD; European Parliament
and Council of the European Union 2008; European Commission 2010)
has included the assessment of CA distribution and biodiversity within

411
412 Protocols for Macroalgae Research

the protocol to evaluate the Good Environmental Status of Coralligenous

and Rhodolith beds Habitats (Basso et al. 2016; Piazzi et al. 2015). In par-
ticular, the protocol proposed for the monitoring of deep Mediterranean
rhodolith beds (Basso et al. 2016) requires time-consuming and expensive
laboratory analysis for species identification. In fact, as most coralline spe-
cies belong to a few genera only, the use of taxonomic ranks higher than
species is not useful. Finally, because CA are calcified, the preparation
of the material for the microscopy (both optical microscopy and scan-
ning electronic microscopy) can be more demanding than for most other
macroalgae.
In the current chapter, we describe how to obtain samples of CA
for the observation at scanning electron microscopy (SEM) and optical
microscopy (OM) of the anatomical features relevant for taxonomical
identification. The protocol applies to herbarium specimens or freshly col-
lected samples. The same procedures can be used to prepare samples for
energy dispersive spectrometry (SEM–EDS) in calcium carbonate biomin-
eralization studies.

27.2 State of the art

SEM analyses have been first used in CA biomineralization and morphoa-
natomical studies starting from the early 1970s (i.e., Bailey and Bisalputra
1970; Alexandersson 1974; Borowitzka et al. 1974; Littler 1976; Woelkerling
1978; Chamberlain 1983). SEM micrographs have been used to reveal the
presence of microborers (i.e., Cyanobacteria and endolithic Chlorophyta)
in algal tissues (Tribollet and Payri 2001; Ghirardelli 2002).
Some indications on how to prepare samples for CA taxonomical
studies are reported in Woelkerling (1988), Irvine and Chamberlain (1994),
Bressan and Babbini (2003), and Harvey et al. (2005), but without detailing
procedures and protocols. Because of their morphological plasticity, the
identification of CA displays some challenges, in particular for the non-
specialists. Moreover, if compared to other macroalgae, the preparation of
CA samples for microscopy observation can be more arduous because of
the calcium carbonate cell walls. For this reason, it is necessary to employ
a straightforward protocol to obtain sections with proper orientation,
thus allowing the observation of the more relevant features needed for
the identification.

27.3 Materials
27.3.1 Materials for optical microscopy
For the decalcification and stain of CA, different solutions can be used
(Woelkerling 1988; Bressan and Babbini 2003).
Chapter twenty seven: Coralline algae preparation for SEM and OM 413

• Decalcification solutions: (a) 6 M HNO3 or (b) Perenyi solution (4:3:3

of 10% aqueous NHO3, 90% aqueous ethanol, 5% aqueous chromic
acid, respectively)
• Staining mixtures: (a) 2%–5% aqueous solution of KMnO4 or (b) 5%
aqueous solution of aniline blue with a drop of 1% aqueous solution
of HCl as fixative
• Ethanol (according to the increasing concentration series: 30%, 60%,
90%, and 100%)
• Medium grade LR White resin® (resin + accelerator)
• Clearing agent Eukitt (O. Kindler GmbH & Co, Germany)
• Hand razor blade
• Sledge microtome
• Infrared lamp
• Stoppered small plastic box

27.3.2 Materials for scanning electron microscopy

• Hammer (Figure 27.1)
• Chisel (Figure 27.1)
• Single-edged razor blades (Figure 27.1)
• Fine forceps
• Air Hardening Modeling Clay (DAS)
• Permanent marker
• Aluminum stubs (diameter 1 cm)
• Instant adhesive (cyanoacrylate adhesive), acrylic adhesive, or liquid
graphite
• Sonicator
• Sputter coater
• Oven

(a)

(b)

(c)

(d)

Figure 27.1 Material required for the cut of samples (a–d): Single-edged razor
blade, chisels with fine tip, and hammer.
414 Protocols for Macroalgae Research

27.4 Experimental procedures

27.4.1 Choice of the portion to cut and orientation
of the sample
The anatomical features of CA vary depending on the planes of view.
The longitudinal sections/fractures permit to identify the majority of
CA genera and allow observing some characteristic such as trichocytes
(Figure 27.2), primary and secondary pit connections, cell fusions, calcite
crystals disposition in the cell wall (Figure 27.3), or reproductive features
(Figure 27.4). The identification of the genus Sporolithon requires trans-
verse sections allowing observing the presence of both cell fusions and
secondary pit connections (Figure 27.5).

1. Longitudinal view (Figure 27.6a, c):

a. In crustose and lamellate thalli, the longitudinal/radial section
is directed toward the centre of the thallus, perpendicularly to
the growth margin (Figure 27.7a and b);
b. In rhodoliths/maerl or in protuberances, the longitudinal section
is directed from the apex to the base (Figure 27.8).

T T T T
T T
T

Figure 27.2 Section of the thallus showing solitary and paired trichocytes (T).
Note the neck (arrowheads) of trichocyte megacells and the normal vegetative
cells (arrows) between the solitary and paired trichocytes.
Chapter twenty seven: Coralline algae preparation for SEM and OM 415

Vegetative features

P
CC
EF

NC
(a) (b) (c)

S
S

(d) (e) S (f )

(g) (h) (i)

Figure 27.3 SEM micrographs of CA vegetative features. (a) Dimerous thallus:

single-layered basal filament (arrows); erect filaments (EF) up to 7 cells long. Scale
bar = 50 µm. (b) Monomerous thallus with noncoaxial core region (NC); peripheral
region with filaments curving outward (P). Scale bar = 50 µm. (c) Monomerous
thallus with a coaxial core region (CC); peripheral region (P). Scale bar = 50 µm.
(d) Fusion cells (arrows) with starch grains (S). Scale bar  =  20  µm. (e) Cells of
adjacent filaments joined by secondary pit connections (arrows). Primary pit con-
nections (arrowheads). Starch grains (S). Scale bar = 10 µm. (f) Calcite crystals of
the cell walls. Scale bar = 5 µm. (g) Epithelial cells (arrows). Scale bar = 10 µm.
(h) Subepithelial initial cells (arrows). Scale bar = 10 µm. (i) Trichocytes (arrows).
Scale bar = 20 µm.
416 Protocols for Macroalgae Research

Reproductive features

PP

(a) (b) (c)

RC

(d) (e) (f )

Figure 27.4 SEM micrographs of CA reproductive features. (a) Conceptacle

morphology. Note the sunken pore plate (PP) and a conspicuous rim (arrowhead).
Scale bar = 100 µm. (b) Vertical section of uniporate conceptacle. Note the conceptacle
chamber immersed in the thallus. Scale bar = 20 µm. (c) Vertical section of buried
conceptacles. Note the presence of a columella (arrow). Scale  bar  =  100  µm.
(d) Surface view of pores (arrows) in multiporate conceptacles. Scale bar = 100 µm.
(e) Vertical section of roof of the multiporate conceptacle. Cells  of the roof (RC);
cells bordering the pore canal (arrows); pore canal (arrowhead). Scale bar = 10 µm.
(f) Surface view of rosette cells (arrows) bordering the pores of multiporate
conceptacles. Scale bar = 20 µm.

F
F

Figure 27.5 Transverse section of Sporolithon sp. Cells with both fusions (F) and
secondary pit connection (arrowhead). Primary pit connections (arrow) join cells
of the same filament. Scale bar = 10 µm.
 L
L

(a) (c)

T T

(b) (d)

Figure 27.6 (a) Section of crustose thallus in a longitudinal plane of view. (b) Section of crustose thallus in transverse plane of view.
Scale bar = 50 µm (a), 30 µm (b). (c) Section of protuberance in longitudinal plane of view. (d) Section of protuberance in the trans-
Chapter twenty seven: Coralline algae preparation for SEM and OM

verse plane of view. Scale bar = 200 µm (c), 50 µm (d).

417
418 Protocols for Macroalgae Research

(a) (b)

Figure 27.7 (a) Longitudinally cut perpendicular to margin (arrow) in crustose

thallus. (b) Longitudinally cut perpendicular to margin (arrow) in lamellate thallus.

Figure 27.8 Longitudinal section (black line) of protuberance directed from its
apex (arrow) to the base.

2. Transverse view (Figure 27.6b, d):

a. In crustose and lamellate thalli, the transverse section is paral-
lel to the growth margin and perpendicular to the longitudinal/
radial section (Figure 27.9a and b);
b. In rhodoliths/maerl or in protuberances, the transverse section is
perpendicular to the growth axis (Figure 27.10).
Chapter twenty seven: Coralline algae preparation for SEM and OM 419

(a) (b)

Figure 27.9 (a) Crustose thallus: transverse section parallel to the growth margin
(arrow) and perpendicular to the radial section. (b) Lamellate thallus: Transverse sec-
tion parallel to the growth margin (arrow) and perpendicular to the radial section.

Figure 27.10 Transverse section of protuberance (black line) perpendicular to the

growth axis in a rhodolith sample.

3. To observe reproductive structures (conceptacles), the section/fracture

must be directed from their surface toward the base. The section must
pass through the pore in uniporate conceptacles (Figure 27.4b and c;
Figure 27.11a) and through the center of the roof in multiporate concep-
tacles (Figure 27.11b). Some relevant features can be observed directly
from the surface view, without sections (Figure 27.4a, d, and f).
420 Protocols for Macroalgae Research

(a) (b)

Figure 27.11 For sections of reproductive structures, fractures must be directed

from  their surface toward the base and pass through the pore in uniporate
conceptacles (a) and through the center of the roof in multiporate conceptacles (b).

27.4.2 Optical microscopy

OM is used to observe some of the above-described features and to iden-
tify trichocyte position and pattern of spore germination in very thin and
small epiphytic thalli of, for example, Fosliella, Hydrolithon, Melobesia, and
Pneophyllum (Figure 27.12).

1. Place the sample on a glass slide

2. Put some drops of 0.6 M HNO3 with a pipette to decalcify it
3. Stain with aniline blue and a drop of HCl (usually for 3–5 min), then
remove the excess stain with drops of water

Figure 27.12 Surface view of a thin crust. Note the four-celled element on the
original germination disc. Scale bar = 100 µm.
Chapter twenty seven: Coralline algae preparation for SEM and OM 421

4. Mount either a temporary slide (for a rapid observation) or a perma-

nent one using some drops of Eukitt

For larger specimens:

5. Select the portion to be decalcified under stereomicroscope, follow-

ing one of these ways:
a. Break off a small piece of thallus and immerse it in a decalcifying
solution (Figure 27.13a and b)
b. Around the area to be studied, build a silicone rim to form a
small bowl in which to pour the decalcifying solution
The time required for the complete decalcification, recogniz-
able by the end of bubbles production, vary from few minutes
to many hours, according to both the size and thickness of the
thallus
6. Transfer the decalcified fragments in a small plastic box
7. Stain in 2%–5% aqueous KMnO4 for 30–60  minutes (Figure 27.14);
then rinse off the excess of stain with water
8. In the same box, dehydrate through a series of 30%, 60%, 90%, and
100% ethanol (Figure 27.15) at 20/30  min intervals; during these
steps, the box should be covered or sealed with parafilm
9. Embed in a medium-grade LR White resin according to the following
steps:
a. LR White Resin: Overnight.
b. Fresh LR White Resin: 2–3 h.
c. Fresh LR White resin with the accelerator; the embedding solu-
tion is made by adding 20 µL of accelerator to 10 mL of LR White
resin just before use and mixing well (Note 1). The resin sets in
20 min at 20°C.

(a) (b)

Figure 27.13 (a) Sample of CA (arrowhead) in the decalcifying solution and

(b) Bubbles of CO2 produced by CA during decalcification process.
422 Protocols for Macroalgae Research

Figure 27.14 CA sample (arrowhead) in 2%–5% aqueous KMnO4 staining mixture.

30% 60% 90% 100%

Figure 27.15 CA sample placed in a sealed box for dehydration in a series of 30%,
60%, 90%, and 100% ethanol.

10. Soften the resin blocks under an infrared lamp and trim them with
a razor blade to remove surplus resin.
11. Place the resin block on the sledge microtome. Make sections
5–15 µm thick, and place them serially placed on glass slides. Flatten
the sections with a drop of histoclear (clearing agent) and mount
them on permanent slides using some drops of Eukitt.

For coarse microscopic observations, a hand section with razor blade

should be made, after the decalcification; the sections should be stained
with aniline blue and a drop of HCl, and rinsed with water to remove the
excess of stain.
Chapter twenty seven: Coralline algae preparation for SEM and OM 423

27.4.3 Scanning electron microscopy

1. Thalli should be air dried for at least 48 h or dried in oven at 50°C
for 24 h.
2. Select and detach the portions of thallus to investigate under a ste-
reomicroscope (Note 2).
3. Embed the portion of thallus in a small block of air hardening mod-
eling clay (ca. 2 × 2 cm, 3 to 5 mm thick) (Note 3). Gently press the
fragment until the algal piece is in line with the surface of the clay or
slightly below (<1 mm).
4. To trace the fracture line press with a razor blade on the clay in
the desired direction (Figure 27.16a–d). The incision line should be
1–2 mm deep.
5. Dry the clay block in the oven at 50°C for 24 h or in air for 48 h.
6. To make the section, place the cutting edge of the razor into the
trace line previously prepared and give a sharp hit with the hammer
(Note 4).
7. After the cut, verify the sectioned portions under a stereomicroscope.
8. Using fine forceps place the cut fragments on aluminum stubs and
attach them with a thin and uniform layer of glue (Note 5).
9. More than one fragment can be placed on a single stub paying atten-
tion that they are distant at least 2–3 mm (Figure 27.17).
10. To remove sediments, diatoms or any residual material formed during
cutting, briefly sonicate (ca. 5–10 min) the stubs using distilled water.
11. Dry stubs in oven at 50°C for 24 h.
12. Coat stubs with a mixture of gold and palladium (80% and 20%,
respectively) or with carbon, and place them with their support into
the chamber of the sputter coater (Figure 27.18). Time for coating
(ca. 2–10 min) depends on the model of SEM used.

(a) (b) (c) (d)

Figure 27.16 Fragments of samples oriented and embedded in the clay. (a) Line of
fracture directed from the apex (arrowhead) to the base of protuberance to obtain
longitudinal section. (b) Line of fracture perpendicular to the growth axis of pro-
tuberance to get a transverse plane of view. (c) Longitudinal section of encrust-
ing thallus. The line of fracture is perpendicular to the margin (arrowhead).
(d)  Transverse section of lamella. The line of fracture is parallel to the growth
margin (arrowhead).
424 Protocols for Macroalgae Research

(a) (b)

Figure 27.17 Samples mounted on stubs. (a) Protuberance. (b) Lamella. Longitu-
dinal sections are indicated with arrows; note that in the lamellate fragment the
longitudinal section is perpendicular to the margin (M). Transverse sections
are shown with arrowheads.

Figure 27.18 Stubs with samples collocated in the sputter coater for coating with
gold/palladium mixture.
Chapter twenty seven: Coralline algae preparation for SEM and OM 425

Figure 27.19 SEM (Leica Stereoscan 430i).

13. Samples are thus ready for SEM observations (Figure 27.19). If dif-
ferent planes of a sample need to be examined, the stub should be
placed individually into the SEM chamber to allow the tilting of it.
Otherwise, if only the upper planes of the samples require observa-
tion, several stubs can be placed together in the chamber and viewed
consecutively.

27.5 Notes
Note 1: Use the mixture immediately after having added accelerator to
the resin. It is very important to seal the box, to exclude any contacts
with oxygen and to prevent surface ripples in hardened resin blocks.
Note 2: Usually, the selected portions of CA should include one or more
of the following: margins, lamellae, protuberance, and areas with
reproductive structures, as shown in Figure 27.20a–d. For taxa with
protuberances, the sections must be done on both protuberances
and crustose parts. In case of thin crusts, better is to cut them along
with the substratum (Figure 27.20a) to avoid breaking of the sample.
Note 3: Orient sample in the clay to obtain the desired section
(Figure  27.16). Prepare the clay blocks just before embedding the
samples into it. The thickness of the clay should not exceed 5 mm
otherwise it could be too hard to be cut.
426 Protocols for Macroalgae Research

(a) (b)

(c) (d)

Figure 27.20 (a) Margin of the encrusting thallus (arrow). (b) Thallus with lamel-
lae (arrows). (c) Unattached thallus (rhodolith) with protuberances (arrows).
(d) Multiporate conceptacles of Mesophyllum sp. (arrows).

Note 4: The razor can be used several times, paying attention that it is
not damaged. If damaged razor is used the fracture can be compro-
mised and not useful for observation.
Note 5: As the glue rapidly hardens, determine prior how to orient frag-
ments on the stub. Place the samples with the plane to observe facing
up, as shown in Figure 27.17a. If the sample is oriented with the plane
to observe is placed lateral (Figure 27.17b), during SEM observations
the stub can be tilted also allowing these planes to be viewed. It is
a good practice to put several fragments of the same sample on a
single stub to have sufficient material to examine. The labeling of
the stubs must be done on its bottom side to prevent labels being
covered during coating phase.
Chapter twenty seven: Coralline algae preparation for SEM and OM 427

Acknowledgments
Figure 27.2 has been previously published in Wolf et al., 2015 (Phytotaxa
224(1): 59–71).

References
Alexandersson T. 1974. Carbonate cementation in coralline algal nodules in the
Skagerrak, North Sea; biochemical precipitation in undersaturated waters.
J. Sediment. Petrol. 44: 7–26.
Bailey A., Bisalputra T. 1970. A preliminary account of the application of thin-
sectioning, freeze-etching, and scanning electron microscopy to the study
of coralline algae. Phycologia 9: 83–101.
Basso D., Babbini L., Kaleb S., Bracchi V.A., Falace A. 2016. Monitoring deep
Mediterranean rhodolith beds. Aquatic Conserv: Mar. Freshw. Ecosyst. 26:
549–561.
Borowitzka M.A., Larkum A.W.D., Nockolds C.E. 1974. A scanning elctron micro-
scope study of the structure and organization of the calcium carbonate
deposits of algae. Phycologia 13: 195–203.
Bressan G., Babbini L. 2003. Biodiversità marina delle coste Italiane: Corallinales
del Mar Mediterraneo: Guida all deteminazione. Biologia Marina Mediterranea
10(Suppl. 2): 1–237.
Chamberlain Y.M. 1983. Studies in the Corallinaceae with special reference to
Fosliella and Pneophyllum in the British Isles. Bulletin of the British Museum
(Natural History) Botany 11: 291–463.
European Commission. 2010. Commission decision of 1 September 2010 on crite-
ria and methodological standards on good environmental status of marine
waters. Official Journal of the European Union L 232/14 .
European Parliament and Council of the European Union. 2008. Directive
2008/56/EC of the European Parliament and of the Council of 17 June 2008
establishing a framework for Community action in the field of marine envi-
ronmental policy (Marine Strategy Framework Directive). Official Journal of
the European Union L 164/19.
Ghirardelli L.A. 2002. Endolithic microorganisms in live and dead thalli of coral-
line red algae (Corallinales, Rhodophyta) in the Northern Adriatic Sea. Acta
Geologica Hispanica 37(1): 53–60.
Harvey A., Woelkerling W., Farr T., Neill K., Nelson W. 2005. Coralline Algae
of  Central New Zealand: An Identification Guide to Common ‘‘Crustose’’ Species.
National Institute of Water & Atmospheric Research Information Series
No. 57, Wellington, 145 p.
Irvine L.M., Chamberlain Y.M. 1994. Seaweeds of the British Isles, Vol. 1, Rhodophyta
Part 2B Corallinales, Hildenbrandiales. HMSO, London. p. 276.
Kamenos N.A., Burdett H.L., Darrenogue N. 2016. Coralline algae as palaeo-
climatic proxies. In Riosmena-Rodríguez R., Nelson W., Aguire J. (Eds.),
Rhodolith/Maerl Beds: A Global Perspective. Switzerland: Springer.
Littler M.M. 1976. Calcification and its role among macroalgae. Micronesica 12:
27–41.
428 Protocols for Macroalgae Research

McCoy S.J., Kamenos N.A. 2015. Coralline algae (Rhodophyta) in a changing

world: Integrating ecological, physiological, and geochemical responses to
global change. J. Phycol. 51: 6–24.
Piazzi L., Gennaro P., Cecchi E. et al. 2015. Improvement of the ESCA index for the
evaluation of ecological quality of coralligenous habitat under the European
Framework Directives. Medit. Mar. Sci. 16: 419–426. https://doi.org/10.12681/
mms.1029
Tribollet A., Payri C. 2001. Bioerosion of the crustose coralline alga Hydrolithon
onkodes by microborers in the coral reefs of Moorea, French Polynesia.
Oceanolog Acta 24: 329–342.
Woelkerling W.J. 1978. Mastophoropsis canaliculata (Harvey in Hooker) gen. et
comb. nov. (Corallinaceae, Rhodophyta) in southern Australia. Brit. Phycol. J.
13: 209–225.
Woelkerling W.J. 1988. The Coralline Red Algae: An Analysis of the Genera and
Subfamilies of Nongeniculate Corallinaceae. Oxford University Press, New York.
p. 268.
Wolf M.A., Maneveldt G.W., Kaleb S., Moro I., Falace A. 2015. Morphological
and molecular characterization of Hydrolithon rupestre (Corallinaceae,
Corallinales, Rhodophyta): First report from the Mediterranean Sea.
Phytotaxa 224(1): 59–71.
chapter twenty eight

Extraction of high quality

RNA from brown algae for
transcriptomic analysis
Sandra Heinrich

Contents
28.1 Introduction ......................................................................................... 429
28.2 State of the art ...................................................................................... 430
28.3 Materials ............................................................................................... 432
28.3.1 Algal material ........................................................................ 432
28.3.2 Sample homogenization ....................................................... 432
28.3.3 RNA extraction ...................................................................... 432
28.3.3.1 Reagents ................................................................ 432
28.3.3.2 Equipment............................................................. 432
28.3.4 RNA quality control ............................................................. 433
28.4 Experimental procedures................................................................... 433
28.4.1 Sample homogenization ....................................................... 433
28.4.2 RNA extraction ...................................................................... 433
28.4.3 RNA quality control ............................................................. 435
28.4.3.1 Measuring RNA concentration and purity ...... 435
28.4.3.2 RNA integrity control ......................................... 436
28.5 Notes ..................................................................................................... 436
Acknowledgments ......................................................................................... 437
References........................................................................................................ 437

28.1 Introduction
Environmental genomics and transcriptomics are powerful approaches
to gain novel insights into evolutionary ecology, organism–environment
interactions, and ecosystem processes (Vandenkoornhuyse et  al. 2010).
Main aims of transcriptomics are to catalog all expressed RNA species,
to determine the transcriptional structure of genes, and to quantify

429
430 Protocols for Macroalgae Research

the changing expression levels of transcripts, for example, during the

development or under stressful environmental conditions (Wang et al.
2009). Recent technological advances gave rise to the rapid generation of
large-scale sequencing data from nonmodel organisms at a reasonable
cost (Ekblom and Galindo 2011). One of the most common applications
is transcriptome characterization by high-throughput RNA sequencing,
especially for nonmodel species, as it is not limited to detect transcripts
that correspond to known genomic sequences (Wang et al. 2009, Deng
et al. 2012). However, in nonmodel species, RNA extraction often proves
to be difficult, but high-quality RNA is crucial, for example, preparing
cDNA libraries or investigating gene expression profiles by RT-PCR
(Falcão et al. 2008). The loss in RNA quality, that is, RNA degradation,
can be caused by prolonged storage, suboptimal storage conditions, and
through cleavage by RNases during handling of RNA samples (Fleige
and Pfaffl 2006, Vermeulen et  al. 2011). Various studies showed that
the quality of data from gene expression analysis using RT-qPCR or
microarrays is strongly influenced by the quality of the extracted RNA
(Copois et al. 2007, Becker et al. 2010). Johnson et al. (2012) investigated
the effects of RNA quality on Illumina sequencing; their results imply
that impure RNA hampers cDNA synthesis, RNA of low integrity, in
contrast, prevents the assembly of large scaffolds during data analysis.
Therefore, assessment of RNA quality before using samples for down-
stream applications is highly critical to obtain reliable gene expression
data (Vermeulen et al. 2011). RNA purity can be determined photometri-
cally using sensitive spectrophotometers, for example, the NanoDrop
(peqLab Biotechnologie GmbH, Erlangen, Germany); for standardized
RNA, integrity control automated capillary electrophoresis is recom-
mended (Becker et al. 2010).

28.2 State of the art

Within recent years, several transcriptomic studies on macroalgae have
been published (Wang et al. 2013, Liang et al. 2014, Heinrich et al. 2015,
2016). Nevertheless, compared to other species groups, that is, green
plants, multicellular heterokonts remain highly underrepresented in
sequence databases (Pearson et al. 2010). Up to now, only two brown algal
genomes were fully sequenced: (1) the genome of Ectocarpus siliculosus
(Cock et al. 2010) and (2) Saccharina latissima (Ye et al. 2015). One reason
might be that brown macroalgae exhibit high amounts of polysaccha-
rides (Wang et  al. 2005, Varela-Alvarez et  al. 2006) and phenolic com-
pounds (Lane et  al. 2006, Pearson et  al. 2006), which make isolation of
high-quality RNA and DNA difficult. Tissues with high levels of polysac-
charides yield poor quality RNA as polysaccharides coprecipitate with
Chapter twenty eight: Extraction of high quality RNA from brown algae 431

RNA in low ionic strength buffers (Falcão et al. 2008). Furthermore, RNA
extracted from macroalgae is often contaminated with acidic polysaccha-
rides because of almost identical densities between those molecules (Kim
et  al. 1997). Commercially available kits using guanidinium salts (e.g.,
the RNeasy Mini Kit; Qiagen, and Hildesheim) usually fail for brown
algae. A more promising approach consists of the utilization of a cet-
yltrimethylammonium bromide (CTAB)-based buffer and subsequent
phenol–chloroform purification followed by selective precipitation with
LiCl (Pearson et al. 2006, Dittami et al. 2009). One disadvantage of this
method is that lithium salts, even in minute amounts, often interfere with
downstream enzymatic applications (e.g., reverse transcription) (Bilgin
et  al. 2009). Here, a fast and effective approach to extract high-quality
RNA from brown algae for transcriptomic analysis is presented. The
developed protocol consists of a CTAB extraction followed by the usage
of the RNeasy Plant Mini Kit (Qiagen, Hildesheim, Germany), applying
a modified protocol based on the company’s user manual (Heinrich et al.
2012a). The extraction protocol was tested successfully in several brown
algae (e.g., S. latissima, Desmarestia anceps, and Fucus serratus) and in the
green alga Ulva sp.; thus it might also be effective in the red algae. The
isolated RNA was successfully used for downstream applications such as
RT-PCR, Microarray hybridizations, 454 sequencing, and Illumina high-
throughput RNA sequencing (Heinrich et al. 2012a, b, Heinrich et al. 2016,
Iñiguez et al. 2017). A comparison of different RNA extraction methods
for brown algae regarding RNA yield, purity, and integrity can be found
in Table 28.1.

Table 28.1 Comparison of CTAB-based method, Qiagen RNeasy Plant Mini

Kit, and a combined approach of regarding RNA yield, integrity,
purity, and working time
CTAB + Qiagen
Qiagen RNeasy CTAB-based RNeasy Plant
Plant Mini Kit method Mini Kit
Number of samples 3/6 6/6 6/6
yielding RNA
RNA yield µg/100 mg 0.4 ± 0.2 1.2 ± 0.7 11.8 ± 1.7
sample
RNA integrity High High High
Average OD (260/230) 0.98 ± 0.2 1.41 ± 0.13 2.19 ± 0.04
Average OD (260/280) 1.64 ± 0.14 1.56 ± 0.17 2.2 ± 0.03
Average time to process 1 h 20 h 2.5 h
DNA contamination No Yes No
432 Protocols for Macroalgae Research

28.3 Materials
28.3.1 Algal material
Laboratory cultures, and field materials, can be used for RNA extrac-
tion. RNA isolation from culture material proves to be easier as it typi-
cally shows a low degree of contamination with endo- and epiphytes
and often contains lower amounts of polysaccharides and polyphenolic
compounds. When using materials collected in the field, collection sites
should be well considered. For example, material collected from sites
with strong grazing pressure exhibits higher contents of polyphenolic
compounds; sporophytes from strong wave-exposed sampling sides usu-
ally contain higher amounts of polysaccharides. Both substances might
hamper the RNA-extraction process. Furthermore, field material should
be carefully cleaned before extracting RNA to minimize contamination.
To prevent RNA degradation, samples should be stored at −80°C and pro-
cessed within four weeks.

28.3.2 Sample homogenization

• Liquid nitrogen
• Liquid nitrogen dewar
• Mortar and pestle (autoclaved)
• Gloves
• Small chemical spoon (autoclaved)
• 2 mL microcentrifuge tubes (PCR-clean)
• RNase Zap (Thermo Fisher Scientific, Waltham, USA)

28.3.3 RNA extraction

28.3.3.1 Reagents
• CTAB buffer (2% cetyltrimethylammonium bromide, 1  M NaCl,
100  mM Tris pH 8, and 50  mM EDTA, pH 8), β-mercaptoethanol,
chloroform:isoamyl alcohol (24:1; v/v), ethanol (96%–100%), RNeasy
Plant Mini Kit (Qiagen, Hildesheim, Germany), RNase-free DNase
Kit (Qiagen, Hildesheim, Germany), and RNase Zap (Thermo Fisher
Scientific, Waltham, USA).

28.3.3.2 Equipment
• 2 mL microcentrifuge tubes (PCR-clean)
• Microcentrifuge, for example, Eppendorf 5418R (Eppendorf GmbH,
Hamburg, Germany)
• Thermoblock
• Vortexer with a microcentrifuge adapter
• Pipettes 1000, 100, and 10 µL and corresponding tips.
Chapter twenty eight: Extraction of high quality RNA from brown algae 433

28.3.4 RNA quality control

• Low-volume spectrophotometer: Agilent Bioanalyzer & Agilent
RNA 6000 Nano Kit (Agilent, Santa Clara, CA, Model 2100).

28.4 Experimental procedures

28.4.1 Sample homogenization
All experiments are performed under clean conditions; workplaces
should be cleaned and thoroughly wiped with RNase Zap (Thermo
Fisher Scientific, Waltham, USA) before starting. The sample homog-
enization is one of the most crucial steps of the RNA-extraction pro-
cess as insufficiently homogenized samples lead to low RNA extraction
yields. For cell disruption, two tissue homogenizers: (1) the Mikro-
Dismembrator (U Braun Biotech International, Melsungen, Germany)
and (2) the Precellys 24 (Bertin, Montigny-le-Bretonneux, France) have
been tested, and manual grinding in liquid nitrogen. The latter method
produced the best results.

1. Precool the mortar by pouring liquid nitrogen into it, precool the
pestle, and microcentrifuge tubes and chemical spoon by placing
them into a liquid nitrogen dewar.
2. Add the sample (at least 500 mg) into the mortar still containing liq-
uid nitrogen and grind with the pestle until a fine powder is pro-
duced (Note 1).
3. Transfer the homogenized sample into a precooled 2 mL microcen-
trifuge tube using the precooled chemical spoon. At most 1/4 of the
cup should be filled with the homogenized sample. Store the sample
at −80°C until further use to avoid RNA degradation.

28.4.2 RNA extraction

RNA extraction should be performed under clean conditions in a fume
hood. The workbench should be cleaned and thoroughly wiped with
RNase Zap (Thermo Fisher Scientific, Waltham, USA) before starting
the RNA extraction. Advice for troubleshooting can be retrieved from
Table 28.2.

1. Add 1 mL of CTAB extraction buffer and 20 µL β-mercaptoethanol

to the homogenized sample and immediately mix vigorously by vor-
texing (Note 2).
2. Incubate the mixture for 10 min at 45°C in a thermoblock. Mix the
samples by inversion 2–3 times during the incubation time (Note 3).
434 Protocols for Macroalgae Research

Table 28.2 Troubleshooting advice

Problem Possible reason Suggestion
Low RNA yield Too small amounts of Increase the starting material
biomass
Insufficient homogenization Increase homogenization
time
Increase incubation time
Low A260/A280 Too high amounts of Decrease starting material
biomass
Low A260/230 Disruption of the organic Do not touch organic phase
phase after the chloroform with the pipet
extraction
Ethanol carry over during Carefully remove the column
the steps RNeasy from the collection tube after
extraction step 17–20 centrifugation so that the
column does not touch the
flow through
Ethanol carry over during Make sure to pipet the water
the RNeasy extraction into the center of the
elution step 21 membrane; do not touch
walls of the column
RNA degraded Frozen material too old In general, the material can
only be stored for four
weeks at −80°C without
RNA degradation
Sample thawed during Keep sure to refill liquid
homogenization nitrogen regularly during
homogenization

3. Add 1  mL of chloroform: Isoamyl alcohol (24:1; v/v), vortex vigor-

ously for 10 min, and centrifuge the sample at 12,000 × g for 20 min
at 20°C.
4. Collect the aqueous phase (maximal 750 µl) into a clean 2 mL micro-
centrifuge tube and discard the rest (Note 4).
5. Add 0.3 volume of ethanol (96%–100%) and mix gently by inversion.
6. Add 1  mL of chloroform:isoamyl alcohol (24:1; v/v), vortex vigor-
ously for 10 min, and centrifuge the sample at 12,000 × g for 20 min
at 20°C.
7. Collect the supernatant (maximal 500 µl) into a clean 2 mL micro-
centrifuge tube and extract total RNA by using the RNeasy Plant
Mini Kit (Qiagen, Hildesheim, Germany) according to this modi-
fied form of the manufacturer’s protocol for RNA extraction
Chapter twenty eight: Extraction of high quality RNA from brown algae 435

(https://www.qiagen.com), including on-column DNA digestion.

For the following buffers, the terminology of the kit provider is used.
8. Add 500 µL Buffer RLT to the supernatant and vortex vigorously.
9. Transfer 500 µL lysate to a QIAshredder spin column (lilac) placed
in a collection tube, and centrifuge for 2 min at full speed. Carefully
transfer the flow through to a new microcentrifuge tube and avoid
disturbing the pellet.
10. Repeat step 9 with the remaining 500 µL of the supernatant.
11. Add 0.5 volume of ethanol (96%–100%) to the lysate and mix immedi-
ately by pipetting.
12. Transfer the sample to a RNeasy spin column (pink) placed in a 2 mL
collection tube and centrifuge for 1 min at ≥9000 × g at 20°C. Discard
the flow through.
13. Repeat step 12 with the remaining supernatant.
14. Add 350 µL Buffer RW1 to the RNeasy spin column and centrifuge
for 1 min at ≥9000 × g at 20°C. Discard the flow through.
15. Add 10 µL DNase I stock solution (RNase-free DNAse Kit) to 70 µL
Buffer RDD. Mix by gently inverting the tube.
16. Add the 80  µL DNase I mix directly to the RNeasy spin column
membrane and place on the benchtop (20°C–30°C) for 15 min.
17. Add 350 µL Buffer RW1 to the RNeasy spin column and centrifuge
for 1 min at ≥9000 × g at 20°C. Discard the flow through.
18. Add 500 µL Buffer RPE to the RNeasy spin column, centrifuge for
1 min at 20°C, and ≥9000 × g and discard the flow through.
19. Add 500 µL Buffer RPE to the RNeasy spin column and centrifuge
for 1 min at ≥9000 × g and 20°C.
20. Place the RNeasy spin column into a new 2 mL collection tube and
centrifuge at full speed at 20°C for 1 min.
21. Place the RNeasy spin column in a new 1.5  mL collection tube
and add 50  µL RNase-free water to the spin column membrane.
Centrifuge for 1 min at 9000 × g at 20°C to elute the RNA (Note 5).
22. Repeat step 21 using the eluate from step 21.

28.4.3 RNA quality control

28.4.3.1 Measuring RNA concentration and purity
Determine RNA quantity and purity spectrophotometrically by measur-
ing the absorbance at 230, 260, and 280 nm. The purity of the RNA can
be estimated by calculating the A260/A280 ratio, which gives a measure
for protein contamination. Calculate the A260/A230 ratio to determine
whether impurities, for example, polysaccharides and polyphenols, are
present. Pure RNA exhibits A260/A280 and A260/A230 ratios ≥1.8.
436 Protocols for Macroalgae Research

65
60
55
50
45
Time (s)

40
35
30
25
20
15
L 1 2 3 4 5 6 7 8 9 10 11 12

Figure 28.1 Results of a 2100 Bioanalyzer microfluidic electrophoresis chip. The

first lane of the gel electrophoresis contains the RNA ladder (L), sample lanes 1–11
contain nondegraded RNA, and sample lane 12 degraded RNA from Desmarestia
anceps.

28.4.3.2 RNA integrity control

Checking the RNA integrity can be performed using automated capillary
electrophoresis or an agarose RNA gel. For downstream applications such
as RT-qPCR and RNA sequencing, it is highly recommended to use auto-
mated capillary electrophoresis (e.g., the Bioanalyzer microfluidic electro-
phoresis) because it gives more detailed results on RNA integrity. For total
RNA, the RNA 6000 Nano chip can be used. Prepare the RNA 6000 Nano
chips according to the manufacturer’s protocol (http://rai.unam.mx/
manuales/lbg_ARNGuideAgileny.pdf). Figures 28.1 and 28.2 show the
results of a Bioanalyzer microfluidic electrophoresis with RNA isolated
from the brown algae Desmarestia anceps.

28.5 Notes
Note 1: Do not allow the sample to thaw during grinding. Add extra
liquid nitrogen to the mortar during the homogenization to avoid
thawing. This should be done very slowly to avoid splashing of the
material.
Note 2: Do not allow the homogenized material to thaw.
Note 3: Incubation time can be raised up to 30 min if only small amounts
of biomass are available or if the RNA extraction yields from previ-
ous extractions have been insufficient.
Chapter twenty eight: Extraction of high quality RNA from brown algae 437

28S 28S
18S 18S
1 2
(FU) (FU)
500
500

0 0
15 20 25 30 35 40 45 50 55 (s) 15 20 25 30 35 40 45 50 55 (s)

3 4
(FU) (FU)
40 20
20 10
0 0
15 20 25 30 35 40 45 50 55 (s) 20 25 30 35 40 45 50 55 60 65 (s)

Figure 28.2 Electropherogram of RNA samples of different integrity from

Desmarestia anceps. Sample 1 and 2: nondegraded RNA, sample 3 and 4 degraded
RNA.

Note 4: Be very careful not to disturb the organic phase. Otherwise,

contaminations are transferred into the aqueous phase.
Note 5: Pipette the water directly on the membrane. Do not touch the
walls of the column to avoid carryover of ethanol.

Acknowledgments
This work was partly funded by the Deutsche Forschungsgemeinschaft
(DFG) in the framework of the priority program “Antarctic Research with
comparative investigations in Arctic ice areas” by a grant (HE 6734/1-1).
Andreas Wagner and Claudia Daniel are acknowledged for technical
assistance.

References
Becker, C., A. Hammerle-Fickinger, I. Riedmaier, and M.W. Pfaffl. 2010.
mRNA and microRNA quality control for RT-qPCR analysis. Methods
50 (4):237–243.
Bilgin, D.D., E.H. DeLucia, and S.J. Clough. 2009. A robust plant RNA isolation
method is suitable for Affymetrix GeneChip analysis and quantitative real-
time RT-PCR. Nat. Protoc. 4 (3):333–340.
Cock, J.M., L. Sterck, P. Rouze et al. 2010. The Ectocarpus genome and the indepen-
dent evolution of multicellularity in brown algae. Nature 465 (7298):617–621.
Copois, V., F. Bibeau, C. Bascoul-Mollevi et al. 2007. Impact of RNA degradation on
gene expression profiles: Assessment of different methods to reliably deter-
mine RNA quality. J. Biotechnol. 127 (4):549–559.
438 Protocols for Macroalgae Research

Deng, Y., J. Yao, X. Wang, H. Guo, and D. Duan. 2012. Transcriptome sequencing
and comparative analysis of Saccharina japonica (Laminariales, Phaeophyceae)
under blue light induction. PLoS One 7 (6):e39704.
Dittami, S.M., D. Scornet, J.L. Petit et al. 2009. Global expression analysis of the
brown alga Ectocarpus siliculosus (Phaeophyceae) reveals large-scale repro-
gramming of the transcriptome in response to abiotic stress. Genome Biol.
10 (6):51.
Ekblom, R. and J. Galindo. 2011. Applications of next generation sequencing in
molecular ecology of non-model organisms. Heredity 107 (1):1–15.
Falcão, V.D.R., A.P. Tonon, M.C. Oliveira, and P. Colepicolo. 2008. RNA Isolation
method for polysaccharide rich algae: Agar producing Gracilaria tenuistipi-
tata (Rhodophyta). J. Appl. Phycol. 20 (1):9–12.
Fleige, S. and M.W. Pfaffl. 2006. RNA integrity and the effect on the real-time qRT-
PCR performance. Mol. Asp. Med. 27 (2):126–139.
Heinrich, S., S. Frickenhaus, G. Glöckner, and K. Valentin. 2012a. A comprehensive
cDNA library of temperature stressed Saccharina latissima (Phaeophyceae).
Eur. J. Phycol. 47 (2):83–94.
Heinrich, S., K. Valentin, S. Frickenhaus, U. John, and C. Wiencke. 2012b.
Transcriptomic analysis of acclimation to temperature and light stress in
Saccharina latissima (Phaeophyceae). PLoS One 7 (8):e44342.
Heinrich, S., K. Valentin, S. Frickenhaus, and C. Wiencke. 2015. Temperature
and light interactively modulate gene expression in Saccharina latissima
(Phaeophyceae). J. Phycol. 51:93–108.
Heinrich, S., K. Valentin, S. Frickenhaus, and C. Wiencke. 2016. Origin matters—
Comparative transcriptomics in Saccharina latissima (Phaeophyceae). J. Exp.
Mar. Biol. Ecol. 476:22–30.
Iñiguez, C., S. Heinrich, L. Harms, and F.J.L. Gordillo. 2017. Increased temperature
and CO2 alleviate photoinhibition in Desmarestia anceps: From transcrip-
tomics to carbon utilization. J. Exp. Bot. 68:3971–3984.
Johnson, M.T.J., E.J. Carpenter, Z. Tian et al. 2012. Evaluating methods for isolat-
ing total RNA and predicting the success of sequencing phylogenetically
diverse plant transcriptomes. PLoS One 7 (11):e50226.
Kim, S.H., Y.K. Lee, C.B. Hong, and I.K. Lee. 1997. A simple method for RNA
extraction from marine macroalgae. Algae 12:53–56.
Lane, C.E., C. Mayes, L.D. Druehl, and G.W. Saunders. 2006. A multi-gene molec-
ular investigation of the kelp (Laminariales, Phaeophyceae) supports sub-
stantial taxonomic re-organization. J. Phycol. 42 (2):493–512.
Liang, X., X. Wang, S. Chi et al. 2014. Analysis of Saccharina japonica transcriptome
using the high-throughput DNA sequencing technique and its vanadium-
dependent haloperoxidase gene. Acta Oceanol. Sin. 33 (2):27–36.
Pearson, G., G. Hoarau, A. Lago-Leston et  al. 2010. An expressed sequence tag
analysis of the intertidal brown seaweeds Fucus serratus (L.) and F. vesiculo-
sus (L.) (Heterokontophyta, Phaeophyceae) in response to abiotic stressors.
Mar. Biotechnol. 12 (2):195–213.
Pearson, G., A. Lago-Leston, M. Valente, and E. Serrao. 2006. Simple and rapid
RNA extraction from freeze-dried tissue of brown algae and seagrasses.
Europ. J. Phycol. 41 (1):97–104.
Vandenkoornhuyse, P., A. Dufresne, A. Quaiser et al. 2010. Integration of molecu-
lar functions at the ecosystemic level: Breakthroughs and future goals of
environmental genomics and post‐genomics. Ecol. Lett. 13 (6):776–791.
Chapter twenty eight: Extraction of high quality RNA from brown algae 439

Varela-Alvarez, E., N. Andreakis, A. Lago-Leston et al. 2006. Genomic DNA isola-

tion from green and brown algae (Caulerpales and Fucales) for microsatel-
lite library construction. J. Phycol. 42 (3):741–745.
Vermeulen, J., K. De Preter, S. Lefever et al. 2011. Measurable impact of RNA qual-
ity on gene expression results from quantitative PCR. Nucleic Acids Res.
39 (9):e63.
Wang, G.G., Y.H. Li, P. Xia, and D.L. Duan. 2005. A simple method for DNA extrac-
tion from sporophyte in the brown alga Laminaria japonica. J. Appl. Phycol. 17
(1):75–79.
Wang, W.-J., F.-J. Wang, X.-T. Sun, F.-L. Liu, and Z.-R. Liang. 2013. Comparison
of transcriptome under red and blue light culture of Saccharina japonica
(Phaeophyceae). Planta 237 (4):1123–1133.
Wang, Z., M. Gerstein, and M. Snyder. 2009. RNA-Seq: A revolutionary tool for
transcriptomics. Nat. Rev. Gen. 10 (1):57–63.
Ye, N., X. Zhang, M. Miao et al. 2015. Saccharina genomes provide novel insight
into kelp biology. Nat. Commun. 6:6986.
chapter twenty nine

Induction of sexual reproduction

in Spirogyra cultures for
laser capture microdissection
of gametes and zygotes
Denis Saint-Marcoux and Jane A. Langdale

Contents
29.1 Introduction ......................................................................................... 441
29.2 State of the art ...................................................................................... 443
29.3 Materials ............................................................................................... 444
29.3.1 Equipment .............................................................................. 444
29.3.1.1 Algae cultivation .................................................. 444
29.3.1.2 Laser microdissection ......................................... 444
29.3.2 Reagents.................................................................................. 445
29.4 Experimental procedures................................................................... 445
29.4.1 Cultivation of Spirogyra and induction of sexual
reproduction .......................................................................... 445
29.4.1.1 Media preparation ............................................... 445
29.4.1.2 Vegetative growth ................................................ 446
29.4.1.3 Sexual reproduction induction .......................... 446
29.4.2 Fixation of thallus before laser capture microdissection..... 447
29.4.3 Laser capture microdissection ............................................ 449
29.5 Notes ..................................................................................................... 449
Acknowledgment ........................................................................................... 451
References........................................................................................................ 451

29.1 Introduction
Zygnematophyceae belong to the paraphyletic Charophyte group, which
is composed entirely of unicellular and multicellular algae. Together
with the land plants, Charophytes form a monophyletic group called
Streptophyta. Charophytes are of particular interest for evodevo studies

441
442 Protocols for Macroalgae Research

because many developmental mechanisms and gene toolkits that allowed

land plants to conquer the terrestrial environment must have first evolved
in ancient Charophytes. Studying extant Charophytes can thus provide
clues about these ancestral developmental toolkits, at least about those
that are retained in modern lineages, and can help to understand the evo-
lutionary transition from water to land.
Phylogenetic studies places Zygnematophyceae as the sister group to
land plants (Wickett et al. 2014). As a consequence, representatives of
Zygnematophyceae, such as Spirogyra, are ideal candidates for evodevo stud-
ies. The Spirogyra genus is composed of fresh water species that develop an
unbranched filamentous body plan. As with all Zygnematophyceae, Spirogyra
has an unusual mode of sexual reproduction in that gametes are not released
into the environment. Instead, vegetative cells differentiate cellular protru-
sions called conjugation tubes that bridge two adjacent cells, either from
the same (lateral conjugation) or from two (scalariform conjugation) algal
bodies. Gametes differentiate from the vegetative protoplast that initiated
the conjugation tube into an amoeboid cell form. In the case of Spirogyra pra-
tensis, one of the gametes moves from its gametangium into the other gam-
etangium. After gametic fusion, the resulting zygote stays inside the female
gametangium until it is finally released into the surrounding environment
on degradation of the gametangium cell wall. One of the most iconic inno-
vations that accompanied the transition of Streptophyta to the land was the
invention of a multicellular embryo. Growth of the embryo gives rise to a
sporophyte that produces spores at maturity, augmenting the dispersal of
the products of sexual reproduction. The transition from unicellular zygote
to multicellular embryo was a major innovation that contributed to the suc-
cess of plants during the colonization of land.
To date, very few methods have been developed for working with
Zygnematophyceae in laboratory conditions, and molecular data are scarce.
Vegetative culture can be achieved in fresh-water medium but completing
the life cycle in a controlled manner is a challenge, and transformation has
only been reported for a single unicellular species, Penium margaritaceum
(Sørensen et al. 2014). Molecular data are available for a handful of species
through the oneKP project and the transcriptome of the vegetative thal-
lus of S. pratensis has also been released (Timme and Delwiche 2010; Poel
et al. 2016). With a view to understanding the evolution of multicellular
embryos, we set up a large transcriptomic survey to compare zygotes from
Charophytes (including Spirogyra) with embryos from early land plants.
Because reproduction occurs through conjugation, Spirogyra gametes and
zygotes cannot be separated easily from vegetative filaments. As a con-
sequence, we developed a method to microdissect gametes and zygotes
from filaments using laser capture microdissection (LCM). In the current
chapter, we describe a method for the induction of sexual competence
in Spirogyra, and also report a protocol for the isolation of gametes and
Chapter twenty nine: Induction of sexual reproduction in Spirogyra 443

zygotes that are suitable material for RNA extraction. These protocols have
been used to obtain gamete- and zygote-specific transcriptomes after RNA
amplification and sequencing on an Illumina platform (unpublished data).

29.2 State of the art

Vegetative growth of Spirogyra is easily established in controlled condi-
tions. Filaments can be cultivated in a variety of fresh-water growth media,
either based on soil solutions or on synthetic components, for example,
Woods Hole medium (Nichols 1973; Drummond et al. 2005), Closteridium
medium, Reichart’s medium, artificial pond water (Ichimura 1971; Nagata
1973; Ikegaya et al. 2012), Guillard’s medium (Andersen et al. 2005; Poel
et al. 2016), or Pringsheim’s soil–water medium (Starr 1964; Simons et al.
1984). Growth medium is often supplemented with vitamins, notably thia-
mine, cyanocobalamin, and biotin.
Gametogenesis and sexual competency have previously proven diffi-
cult to induce in laboratory cultures of Spirogyra. Over the past 60  years,
growth stage (Czurda 1933), light intensity (Allen 1958), nitrogen deple-
tion (Grote 1977; Simons et al. 1984; Drummond et al. 2005), temperature
and light, CO2, sucrose availability, growth media dilution (Simons et al.
1984), and growth on solid medium (Hoshaw et al. 1985; Ikegaya et al. 2012)
have all been tested for the ability to induce sexual reproduction in lab cul-
tures. Of these factors, nitrogen depletion seemed to have the most reliable
effect, and indeed nitrogen depletion is a potent trigger for the induction of
gametogenesis in the unicellular alga Chlamydomonas reinhardtii (Sager and
Granick 1954). A recent study confirmed the importance of nutrient ratio,
and notably nitrogen quantity, for gametogenesis induction in Spirogyra but
no single determinant could be clearly identified (Zwirn et al. 2013).
Since the mid-1990s, LCM has been used for microdissecting cell
types out of tissues (Emmert-Buck et al. 1996). Generally, LCM involves
capturing cells from tissue sections that are visualized using an optical
microscope. Modern iterations of the technology use glass slides covered
with a plastic membrane onto which sections are attached. A laser cuts out
the desired portion of the section, which is then collected in vessels (tubes
or tube caps) for further treatments. LCM can be used on fresh frozen
sections, fixed and embedded sections, or whole structures that are either
fixed or alive, providing the organism or tissue is not too thick. Often, tis-
sues are fixed and dehydrated to ease the processing of the samples before
and during laser capture. For a comprehensive description of the use and
applications of this technology, see Espina et al. 2006. A minute amount
of material is typically collected during LCM. As a consequence, down-
stream analysis methods must be adapted, and in the case of molecular
biology and sequencing, an amplification step is often required before fur-
ther processing. LCM has been successfully applied to the study of gene
444 Protocols for Macroalgae Research

expression in animal cells (Emmert-Buck et al. 1996), plant cells (Nakazono

et al. 2003), and fungi (Gomez and Harrison 2009).
Recently, LCM has been used with macroalgae to capture specific cell
types of Ectocarpus siliculosus sporophytic thallus (Saint-Marcoux et al. 2015).
In this case, algal filaments were grown directly on the LCM slide immersed
in cultivation medium. Growing Spirogyra filaments attached to a LCM slide
was not an option, however, because although fine cut pieces of Spirogyra
thallus initially attached themselves to the LCM slide they quickly became
detached. As a consequence, filaments had to be grown freely in cultivation
medium and then attached to a slide before processing for LCM. Ectocarpus
filaments were fixed in a 100% acetone solution before LCM (Saint-Marcoux
et al. 2015). Acetone is a precipitative fixative that coagulates the cell content
by essentially denaturing the proteins. This type of fixative is favored in LCM
experiments because cross-linking fixatives create chemical bonds between
cellular components and tend to render downstream molecular extraction
difficult. However, acetone fixation is harsh and Spirogyra cells were damaged
to the point that filaments could not be used for laser capture (not shown). As
a consequence, a gentler fixative composed of ethanol and acetic acid was
developed and successfully used with sexually induced Spirogyra filaments.

29.3 Materials
29.3.1 Equipment
29.3.1.1 Algae cultivation
• Temperature and light-controlled growth chamber
• Laminar flowhood
• 500 µL sterile cell culture plastic flask with vented cap
• Glass Pasteur pipettes
• 1 L glass bottles
• 50 mL sterile plastic tubes
• Horizontal microscope slide holder
• Plastic sandwich boxes to contain 200–500 mL
• 0.2 µm Millipore filter and large plastic syringe
• Standard lab equipment (gloves, etc.)

29.3.1.2 Laser microdissection

• LCM unit equipped with a 40x magnification objective; here a Carl
Zeiss PALM MicroBeam with an AxioVert 200 microscope and a
CryLas UV laser, assisted by the PalmRobo 4.5 software were used
• UV cross-linker or a flowhood with UV light
• 37°C oven or chamber
• Nuclease-free 1.0 polyethylene naphthalate (PEN) membrane slides
(Carl Zeiss Microscopy, #415190-9081-000)
Chapter twenty nine: Induction of sexual reproduction in Spirogyra 445

• 500 µL plastic tubes with adhesive tube caps (Carl Zeiss Microscopy,
#415190-9201-000)
• Soft paint brush

29.3.2 Reagents
• Bold modified basal freshwater solution 50X (SIGMA #B5282); on
arrival, aliquot stock in 50 mL plastic tubes and freeze at −20°C
• Vitamins:
• Kao and Michayluk vitamin solution 100X (SIGMA #K3129)
Or
• Biotin powder (SIGMA #B4639)
• Cyanocobalamin (SIGMA #C3607)
• Thiamine (SIGMA #T1270)
• Pure water
• Ethanol 100%
• Acetic acid 100%
• ProtectRNA™ RNase Inhibitor 500X concentrate (SIGMA #R7397)
• RNaseZap™ RNase Decontamination solution (Invitrogen #AM9780)
• Poly-l-lysine solution 0.1% (w/v) in H2O (SIGMA #P8920)
• RNase-free water
• Silica gel

29.4 Experimental procedures

29.4.1 Cultivation of Spirogyra and induction
of sexual reproduction
Cultures are grown in Bold’s basal medium (BSM) supplemented with
vitamins. Vitamins can be obtained as a combined solution or prepared
individually in the lab. Induction of sexual reproduction is carried out in
1/10th dilution BSM. Vitamin concentration is kept undiluted.

29.4.1.1 Media preparation

1. Prepare BSM by adding 784  mL pure H2O and 16  mL of Bold-
modified basal freshwater stock solution 50X in a 1 L glass bottle
2. Adjust the pH solution to 7.0 with 0.1 or 1 M KOH
3. Autoclave and keep at room temperature until further use
4. Prepare BSM 1/10th by adding 798.4  mL pure H2O and 1.6  mL of
Bold-modified basal freshwater stock solution 50X in a 1 L glass bottle
If not using the commercial combined solution of vitamins
5. Prepare a vitamin stock solution (Table 29.1), filter through a 0.2 µm fil-
ter, aliquot and freeze at −20°C for storage, or keep at 4°C for routine use
446 Protocols for Macroalgae Research

Table 29.1 Vitamin solution recipe

MW (g mol−1) For 500 mL In stock Final
Biotin 244.1 2.5 mg 20 µM 2 nM
Cyanocobalamin 1355.37 2.75 mg 4 µM 0.4 nM
Thiamine 337.27 500 mg 3 mM 0.3 µM

29.4.1.2 Vegetative growth

1. Using a flame, close the tip of a glass Pasteur pipette by melting the
glass and then carefully curve the tip to form a hook.
2. Sterilize the curved pipette using ethanol.
3. Pour 50  mL of BSM per culture flask and add 0.5  mL of Kao and
Michayluk vitamin solution or add 5  µL of lab-made vitamin
solution.
4. Using the curved Pasteur pipette, grab a few filaments of Spirogyra
from the old culture and plunge them in the new medium. If the
culture is old and filaments are fragmented, bits of thalli can be col-
lected using a sterile pipette.
5. Place the flasks in the cultivation chamber at 22°C, a light radiance
of 150 µE m−2 s−1, and a photoperiod of 14:10 h of a light:dark cycle.
No agitation is required. When starting from a few filaments, a satu-
rated culture is obtained within 2–3 weeks. Cultures can survive for
several months in these conditions. Figure 29.1a and c shows fila-
ments in vegetative culture.

29.4.1.3 Sexual reproduction induction

1. Before attempting to induce sexual reproduction, it is important
to stimulate vegetative growth by changing the vegetative growth
medium every 4–5 days for a minimum of three times (Note 1).
2. Then transfer a full pipette hook of filaments in a culture flask con-
taining 50 mL of BSM 1/10th supplemented with 0.5 mL of Kao and
Michayluk or 5 µL of lab-made vitamin solution.
3. Place the flask back in the culture chamber. From the sixth day in
culture, start to look for the first signs of gametogenesis using a
dissecting microscope: cells within the filaments should start to
enlarge and protoplasts start to condense soon after (Figure 29.1d).
In our conditions, the maximum peak of fertilization and zygote
formation was attained after 8–9  days in these culture conditions
(Figure 29.1b, e).
Chapter twenty nine: Induction of sexual reproduction in Spirogyra 447

(c)

Sexual reproduction progression

(a)

f
f
m
(d)

f
m

(b) (e)

Figure 29.1 Induction of sexual reproduction in S. pratensis. S. pratensis (UTEX LB

928 strain) vegetative thallus (a) and after sexual reproduction (b). (c–e) close-up
and progression of sexual reproduction: vegetative stage (c); intermediate stage
where male and female gametes can be distinguished and conjugation tubes
are forming (d); sexually mature filaments containing both gametes and zygotes
(e) m: male; f: female; z: zygote; filled and hollow arrowheads point respectively
to a lateral conjugation tube and a scalariform conjugation tube. Scale bars a and
b: 500 µm; c–e: 100 µm.

29.4.2 Fixation of thallus before laser capture microdissection

Fixation is carried out using a more aqueous version of the traditional
acetic acid:ethanol fixative, that is supplemented with RNase inhibitor.
Together with its fixative properties, this solution allows fixed material to
448 Protocols for Macroalgae Research

be stained, which helps to visualize cell structures during LCM. Fixation

is carried out on the LCM slides because the algal filaments are too fragile
to be manipulated afterward. Slides are covered with a solution of poly-
l-lysine to help filaments stick to the surface.
NEVER touch the PEN membrane directly with anything but a brush
(Note 2). The plastic membrane is extremely fragile.
FROM this step onward, all manipulations must be carried out in an
RNase-free environment. Ensure that you have mastered good experi-
mental practice for working with RNA before attempting this protocol.
Wear gloves at all times. Clean all surfaces and materials with RNAseZap
solution. Use only RNase-free water.

1. Place the PEN membrane slides under UV rays for 30 min. This helps
to make the plastic surface more hydrophilic.
2. Pour ~1  mL of poly-l-lysine solution onto the surface of the PEN
membrane slides and let it dry completely.
3. Place a slide in a clean horizontal slide holder. The slide holder can
be custom made (e.g., from a PEN membrane slide plastic box). It is
important that the slide can be moved while keeping it horizontal.
4. Prepare the following three solutions:
• BSM 1/10th cultivation medium
• 25% ethanol, 10% acetic acid, and 1X SIGMA RNase inhibitor
mixed with RNase-free H2O
• 25% ethanol, 1X SIGMA RNase inhibitor mixed with RNase-free
H2O
5. Clean three plastic sandwich boxes that are larger than the slide holder.
6. Place the slide holder in a plastic box then pour the BSM 1/10th
medium up to the limit of the surface of the slide. The solution must
barely cover the slide.
7. Using a dissecting microscope, select fragments of thalli where
reproduction and gametogenesis took place. Transfer pieces of frag-
ments to the surface of the membrane slide using a clean brush and
then spread the filaments equally over the slide (Note 2).
8. Very gently transfer the slide holder into a second plastic box
(keeping the slide as horizontal as possible) and then pour the 25%
ethanol, 10% acetic acid, and 1X SIGMA RNase inhibitor solution
up to the limit of the slide. Again, make sure that the solution
barely covers the slide. Note at this step that you will lose some
pieces of thallus as they will be washed off of the slide. Incubate
for 10 min.
9. Transfer the slide holder and the slide into a third plastic box and
pour the 25% ethanol, 1X SIGMA RNase inhibitor solution as above-
mentioned. Incubate for 10 s.
Chapter twenty nine: Induction of sexual reproduction in Spirogyra 449

10. Remove and transfer the slide holder and the slide to 37°C to dry
(~30 min).
11. Once dried, the slides can be kept at room temperature in a box con-
taining silica gel for a few days before LCM.

29.4.3 Laser capture microdissection

LCM procedures can vary significantly from one unit to another. You
should be trained before attempting LCM. In our case, cells were collected
in adhesive tube caps and we applied the following settings:

• Cutting energy: 45%–60%

• Cutting speed: 5%
• Cutting focus: 35%
• LPC delta: 25
• LPC focus delta: 0

A rule of thumb is to lower the laser energy as much as possible, while

maintaining a good cutting performance. Cut as many gametes or zygotes
as necessary depending on the downstream application. We found that
approximately 200 captures were enough to ensure appropriate RNA
amplification with our protocol. Male and female gametes differ in size
and can be identified as such: female gametangia are enlarged compared to
male gametangia. Zygotes that are contained in the female gametangium
are linked through a conjugation tube to an empty male gametangium.
Figure 29.2a shows filaments fixed on a LCM slide and Figure 29.2b is a
close-up to a zygote. Figure 29.2c to k shows capturing of both gametes
and zygotes.

29.5 Notes
Note 1: Gametogenesis induction is at best unreliable. We found that
having very healthy cultures was crucial, and thus it is important to
subculture the algae every 4–5 days (several times) before attempting
induction. Counterintuitively, we also found that gametogenesis works
best when only a moderate number of filaments are transferred to BSM
1/10th; do not try to saturate the culture from the onset. Spirogyra can
be easily cultured on agar plates. In this case, we found that gameto-
genesis occurred more easily, even on a full BSM. Induction can thus
be attempted on 1% agar plates containing BSM 1/10th.
Note 2: Transferring Spirogyra filaments to LCM slides is a tedious task
and it is very important not to touch the membrane with a hard
450 Protocols for Macroalgae Research

(a) (b)

(c) (d) (e)

(f) (g) (h)

(i) (j) (k)

Figure 29.2 Laser capture microdissection of S. pratensis gametes and zygotes.

(a, b) S. pratensis thallus fragments attached to an LCM slide before microdissec-
tion. Zygotes are visible. (c–k) Capture of male gametes (c–e), female gametes
(f–h), and zygotes (i–k) showing the LCM slide (c, d, f, g, i, j) and the adhesive cap
containing the captured cells (e, h, k). Scale bars a, e, h, k: 300 µm; b: 25 µm; c, d,
f, g, i, j: 50 µm.

object to avoid tearing. A soft paint brush is ideal to manipulate

the thallus fragments over the slide surface and it can be used to
disentangle clumps, thus ensuring that the cellular structure of the
filaments is visible for capture. Only a thin film of liquid BSM is
needed over the surface of the slide when spreading the filaments.
If there is too much liquid, filaments will float free from the slide.
Chapter twenty nine: Induction of sexual reproduction in Spirogyra 451

Acknowledgment
This work was funded by an ERC Advanced Investigator Grant (EDIP) to
JAL. We are grateful to Julie Bull for technical support.

References
Allen, M. A. 1958. The Biology of a Species Complex in Spirogyra. Bloomington, IA:
Indiana University.
Andersen, R. A., J. A. Berges, P. J. Harrison, and M. M. Watanabe. 2005. Recipes
for freshwater and saltwater media. In Algal Culturing Techniques, edited by
R. A. Andersen, pp. 429–538. London, UK: Elsevier Academic Press.
Czurda, V. 1933. Experimentelle analyse der kopulationsauslösenden Bedingungen
bei Mikroorganismen—1. Untersuchungen an Algen (Spirogyra, Zygnema
Und Hyalotheca). Beihefte zum Botanischen Centralblatt 51: 711–761.
Drummond, C. S., J. Hall, K. G. Karol, C. F. Delwiche, and R. M. McCourt.
2005. Phylogeny of Spirogyra and Sirogonium (Zygnematophyceae)
based on rbcL sequence data. Journal of Phycology 41 (5): 1055–1064.
doi:10.1111/j.1529-8817.2005.00130.x.
Emmert-Buck, M. R., R. F. Bonner, P. D. Smith, R. F. Chuaqui, Z. Zhuang,
S.  R.  Goldstein, R. A. Weiss, and L. A. Liotta. 1996. Laser capture micro-
dissection. Science 274 (5289): 998–1001. doi:10.1126/science.274.5289.998.
Espina, V., J. D. Wulfkuhle, V. S. Calvert, A. VanMeter, W. Zhou, G. Coukos, D. H.
Geho, E. F. Petricoin, and L. A. Liotta. 2006. Laser-capture microdissection.
Nature Protocols 1 (2): 586–603. doi:10.1038/nprot.2006.85.
Gomez, S. K., and M. J. Harrison. 2009. Laser microdissection and its applica-
tion to analyze gene expression in Arbuscular Mycorrhizal symbiosis. Pest
Management Science 65 (5): 504–511. doi:10.1002/ps.1715.
Grote, M. 1977. Über die auslösung der generativen fortpflanzung unter kontrol-
lierten bedingungen bei der grünalge Spirogyra Majuscula. Zeitschrift Für
Pflanzenphysiologie 83 (2): 95–107. doi:10.1016/S0044-328X(77)80064-0.
Hoshaw, R. W., J.-C. Wang, R. McCourt, and H. M. Hull. 1985. Ploidal changes in
clonal cultures of Spirogyra Communis and implications for species defini-
tion. ResearchGate 72 (7): 1005–1011.
Ichimura, T. 1971. Sexual cell division and conjugation-papilla formation in sexual
reproduction of Closterium Strigosum. In Proceedings of the 7th International
Seaweed Symposium, edited by K. Nishizawa, pp. 208–214, Tokyo, Japan:
University of Tokyo Press.
Ikegaya, H., T. Nakase, K. Iwata, H. Tsuchida, S. Sonobe, and T. Shimmen. 2012.
Studies on conjugation of Spirogyra using monoclonal culture. Journal of
Plant Research 125 (3): 457. doi:10.1007/s10265-011-0457-3.
Nagata, Y. 1973. Rhizoid differentiation in Spirogyra I. Basic features of rhizoid
formation. Plant and Cell Physiology 14 (3): 531–541.
Nakazono, M., F. Qiu, L. A. Borsuk, and P. S. Schnable. 2003. Laser-capture micro-
dissection, a tool for the global analysis of gene expression in specific plant
cell types: Identification of genes expressed differentially in epidermal cells
or vascular tissues of maize. The Plant Cell Online 15 (3): 583–596. doi:10.1105/
tpc.008102.
452 Protocols for Macroalgae Research

Nichols, H. W. 1973. Growth media—Freshwater. In Handbook of Phycological

Methods: Culture Methods and Growth Measurements, edited by J. R. Stein,
pp. 7–24, Cambridge, UK: Cambridge University Press.
Poel, B. V., E. D. Cooper, D. Van Der Straeten, C. Chang, and C. F. Delwiche. 2016.
Transcriptome profiling of the green alga Spirogyra pratensis (Charophyta)
suggests an ancestral role for ethylene in cell wall metabolism, photosynthe-
sis, and abiotic stress responses. Plant Physiology 172 (1): 533–545. doi:10.1104/
pp.16.00299.
Sager, R., and S. Granick. 1954. Nutritional control of sexuality in Chlamydomonas
reinhardi. The Journal of General Physiology 37 (6): 729–742.
Saint-Marcoux, D., B. Billoud, J. A. Langdale, and B. Charrier. 2015. Laser cap-
ture microdissection in Ectocarpus Siliculosus: The pathway to cell-specific
transcriptomics in brown algae. Frontiers in Plant Science 6: 54. doi:10.3389/
fpls.2015.00054.
Simons, J., A. P. Van Beem, and P. J. R. De Vries. 1984. Induction of conjugation and
spore formation in species of Spirogyra (Chlorophyceae, Zygnematales). Acta
Botanica Neerlandica 33 (3): 323–334. doi:10.1111/j.1438-8677.1984.tb01823.x.
Sørensen, I., Z. Fei, A. Andreas, W. G. T. Willats, D. S. Domozych, and J. K. C. Rose. 2014.
Stable transformation and reverse genetic analysis of Penium Margaritaceum:
A platform for studies of Charophyte Green Algae, the immediate ancestors of
land plants. The Plant Journal 77 (3): 339–351. doi:10.1111/tpj.12375.
Starr, R. J. 1964. The culture collection of algae at Indiana University. American
Journal of Botany 51: 1013–1044.
Timme, R. E., and C. F. Delwiche. 2010. Uncovering the evolutionary origin of
plant molecular processes: Comparison of Coleochaete (Coleochaetales)
and Spirogyra (Zygnematales) transcriptomes. BMC Plant Biology 10 (1): 96.
doi:10.1186/1471-2229-10-96.
Wickett, N. J., S. Mirarab, N. Nguyen, T. Warnow, E. Carpenter, N. Matasci,
S.  Ayyampalayam et al. 2014. Phylotranscriptomic analysis of the origin
and early diversification of land plants. Proceedings of the National Academy of
Sciences 111 (45): E4859–E4868. doi:10.1073/pnas.1323926111.
Zwirn, M., C. Chen, B. Uher, and M. Schagerl. 2013. Induction of sexual reproduc-
tion in Spirogyra clones—Does an universal trigger exist? Fottea 13 (1): 77–85.
doi:10.5507/fot.2013.007.
chapter thirty

Cloning and expression

strategies for the postgenomic
analysis of brown algae
Agnès Groisillier

Contents
30.1 Introduction ......................................................................................... 454
30.2 State of the art ...................................................................................... 455
30.3 Materials ............................................................................................... 456
30.3.1 Strains and vector.................................................................. 457
30.3.1.1 E. coli ....................................................................... 457
30.3.1.2 Vector ..................................................................... 457
30.3.2 General stock solutions ........................................................ 457
30.3.3 PCR, cloning and transformation procedures .................. 457
30.3.4 Protein expression and purification ................................... 458
30.3.5 Equipment .............................................................................. 458
30.3.6 Software .................................................................................. 459
30.4 Experimental procedures .................................................................. 459
30.4.1 Bioinformatics analysis ........................................................ 459
30.4.2 Cloning ................................................................................... 459
30.4.2.1 Amplification of gene of interest........................ 459
30.4.2.2 PCR fragment purification .................................. 460
30.4.2.3 PCR fragment digestion ...................................... 460
30.4.2.4 pFO4 vector preparation ..................................... 460
30.4.2.5 Ligation step .......................................................... 461
30.4.2.6 Transformation in E. coli DH5α .......................... 461
30.4.2.7 PCR screening....................................................... 461
30.4.2.8 Plasmid extraction and glycerol stock............... 462
30.4.2.9 Transformation of expression strain, PCR
screening, and glycerol stock ............................. 462
30.4.3 Small-scale test expression .................................................. 462
30.4.3.1 Cultivation was performed in two phases ....... 462
30.4.3.2 Lysis of cells and detection of proteins ............. 462

453
454 Protocols for Macroalgae Research

30.4.4 Large-scale expression and purification ............................ 463

30.4.4.1 Expression culture ............................................... 463
30.4.4.2 Affinity chromatography .................................... 463
30.4.4.3 Size-exclusion chromatography ......................... 463
30.4.4.4 Analysis of the chromatography........................ 463
30.5 Notes ..................................................................................................... 464
References........................................................................................................ 466

30.1 Introduction
The marine environment is highly complex and contains the vast major-
ity of known and unknown biodiversity. It is also the last frontier to
understand the control of the global climate and hides a wealth of bio-
logical resources still to be tapped for food, health, and energy. Marine
macroalgae are thus photosynthetic eukaryotes that provide relevant
and significant biological models to gain insight into the deep evolution
of fundamental biological processes, which are at the same time comple-
mentary to those obtained by the study of other models such as plants
or animals. Seaweeds that grow in the intertidal zone live in a constant
stressful environment. They undergo the disadvantages of terrestrial
habitats combined with disadvantages of aquatic environments (desicca-
tion, freezing, osmotic stress, UV radiation, and variable temperatures), to
which the mechanical stresses imposed by waves are added. In this inter-
tidal zone, macroalgae, particularly brown algae, have a remarkable abil-
ity to adapt and acclimate to many different adverse conditions. Hence,
these organisms should possess key processes that have evolved to cope
with these frequent changes in environmental conditions.
Brown algae are a large group of marine seaweeds including almost
1800 species with a characteristic olive-green to dark-brown color
derived from fucoxanthin (Wei et  al. 2013). They are multicellular and
have evolved independently from animals and land plants. They belong
to the Stramenopiles (Heterokonta), a phylum that diverged from the
Archaeplastida and Opisthokonta 1  billion years ago (Yoon et  al. 2004).
Within the Stramenopiles, brown algae are a relatively recent lineage
that emerged about 200  million years ago (Brown and Sorhannus 2010;
Silberfeld et  al. 2010). Little is known about their biology, as they were
mostly studied for their taxonomic and ecological diversity. So, knowl-
edge about primary metabolic processes is essential for the understand-
ing of the physiology and ecology of seaweeds.
Global genome sequencing efforts have generated large numbers of new
genes, the biological or biochemical functions of which remain unknown.
The complete sequences of more than 24,000 genomes are currently avail-
able in the public databases (https://www.ncbi.nlm.nih.gov/genome/).
Chapter thirty: Cloning and expression strategies 455

However, up to now, only three draft genomes of brown algae have been
decoded: Ectocarpus siliculosus (E. siliculosus), order Ectocarpales (Cock
et  al. 2010); Saccharina japonica, order Laminariales (Ye et  al. 2015); and
Cladosiphon okamuranus S-strain, order Chordariales (Nishitsuji et  al.
2016). In newly sequenced genomes, genes are annotated on the basis of
sequence similarity to other proteins that have already been characterized
(Altschul et al. 1997). One major challenge is to assign biological function
and to elucidate the mechanism of action of such genes. This challenge
involves techniques to elucidate the structure and function of the gene
products, interactions between proteins, and/or global protein changes.
Overexpression of recombinant proteins is one of the possible solutions to
answer these biological questions.

30.2 State of the art

Overexpression of a recombinant protein is essential for its structural
and biochemical characterization, and the aim is to obtain as much cor-
rectly folded protein as possible. Most recombinant protein expression
is achieved in heterologous hosts, in which low yields can be the direct
result of protein toxicity to the host cell, or incorrect folding and sub-
sequent insolubility of the protein. Escherichia coli (E. coli) is often used
as a heterologous expression host as expression tests can be carried out
relatively quickly and economically, allowing various constructs and
conditions to be efficiently screened. Heterologous expression of algal
genes is notoriously difficult and has presented a bottleneck in proj-
ects aiming at characterizing enzymes of macroalgal origins (Kurland
and Gallant 1996; Groisillier et al. 2010). Thus far, there are only a few
examples of successful expression of brown algal proteins in heterolo-
gous systems.
The publication of the first genome sequence of a brown alga (Cock
et al. 2010) paved the way for experimental analyses of some of the unique
metabolic pathways featured by these organisms. Among those that play
pivotal roles in the physiology of these seaweeds, mannitol metabolism
is of great importance due to its implication in carbon storage and in
stress response. Several metabolic pathways for biosynthesis and degra-
dation have been suggested, and a mannitol cycle (reviewed by Iwamoto
and Shiraiwa 2005) has been proposed in a number of organisms, includ-
ing micro- and macroalgae. This cycle, branching off from glycolysis
at the level of fructose-6-phosphate, comprises a mannitol-1-phosphate
dehydrogenase (M1PDH, EC1.1.1.17), a mannitol-1-phosphatase (M1Pase,
EC3.1.3.22), a mannitol-2-dehydrogenase (M2DH), and a hexokinase.
In 2011, for the first time, the activity of a recombinant M1PDH of
E. siliculosus in E. coli cell–free extracts was shown (Rousvoal et al. 2011).
456 Protocols for Macroalgae Research

The purification and characterization of the recombinant catalytic domain

of EsM1PDH1 provides the first insights on the biochemical behavior of
such enzymes (Bonin et  al. 2015). These latter results complement the
characterization of a new type of phosphatase in Ectocarpus, which is spe-
cific for M1P (Groisillier et al. 2014). Such observations pave the way for
future analysis to gain a better understanding about the physiological
role, functioning, and regulation of mannitol synthesis in brown algae,
notably by assessing the relationships between the structure and func-
tion of relevant enzymes and by altering mannitol synthesis in vivo when
protocol(s) for targeted genetic modification of Ectocarpus will be avail-
able. In addition, a gene encoding a M2DH was recently characterized
from the kelp S. japonica, but the purified recombinant protein was not
active (Shao et  al. 2014). Other original metabolic processes have been
studied because of recombinant protein expression in E. siliculosus. In
brown algae, Mannuronan C5-epimerases (ManC5-Es) catalyze the
remodeling of alginate, a major cell-wall component that is involved
in many biological functions. In 2016, the heterologous production and
activity characterization of two ManC5-Es were successfully performed.
The ManC5-E from the brown alga S. japonica was expressed because of
Sf9 insect cells system (Inoue et al. 2016), and ManC5-E from E. siliculosus
was purified in an active form after refolding on affinity columns (Fischl
et al. 2016). Functional characterization of glutathione transferases (GSTs,
EC 2.5.1.18) has been established by measuring the enzymatic activity
of recombinant microsomal EsGSTs in Saccharomyces cerevisiae cell-free
extracts (de Franco et  al. 2009). In the same way, the first recombinant
CYP74-related enzyme of oxylipin biosynthesis (Toporkova et  al. 2017)
and the first recombinant Guanosine DiPhosphate (GDP)-mannose dehy-
drogenase providing the precursor for the alginate polymer (Tenhaken
et al. 2011) of E. siliculosus were purified and characterized. The only X-ray
crystallographic structure of an E. siliculosus protein concerns a type III
polyketide synthase (Meslet-Cladière et al. 2013). The current study has
provided phylogenetic, biochemical, and structural evidence that sup-
port a primary role of PolyKetide Synthase 1 (PKS1) in the condensation
of malonyl-CoA to produce phloroglucinol, the direct precursor of phlo-
rotannins unique to brown algae. In 2011, the activity of a type III PKS
Sargassum binderi PolyKetide Synthase (SbPKS) from a brown seaweed,
Sargassum binderi, has been characterized but only in E.  coli cell–free
extracts (Baharum et al. 2011).

30.3 Materials
The protocol described below is based on techniques used for the purifi-
cation of recombinant M1Pase and M1PDH from E. siliculosus (Groisillier
et al. 2014; Bonin et al. 2015).
Chapter thirty: Cloning and expression strategies 457

30.3.1 Strains and vector

30.3.1.1 E. coli
• DH5α: F-Φ80dlacZ∆M15∆(lacZYA-argF) U169 recA1 endA1 hsdR17
(rk–, mk+) phoA supE44 λ-thi-1 gyrA96 relA1.
• BL21 (DE3): fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS λ DE3 = λ
sBamHIo ∆EcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 ∆nin5.

30.3.1.2 Vector
• pFO4 vector: AmpR, T7lac promoter hexa-histidine tail at the
N-terminal of recombinant (a vector modified from pET15b, Novagen)
(Groisillier et al. 2010) (Note 1).

30.3.2 General stock solutions

• Ultrapure (purified) water (such as MilliQ water, Millipore).
• 5 M NaCl, filter on 0.2 µm and store at room temperature.
• 1 M Tris–HCl, pH 7.5, filter on 0.2 µm and store at room temperature.
• 5 M Imidazole, filter on 0.2 µm and store at room temperature.
• 6 M Urea, filter on 0.2 µm and store at room temperature.
• 1 M Isopropyl β-D-1-thiogalactopyranoside (IPTG) in water, filter-
sterilize and store in 1 mL aliquots at −20°C.
• 100  mg  mL–1  ampicillin in water, filter-sterilize and store in 1  mL
aliquots at −20°C.
• 0% (v/v) glycerol, autoclave, and store at room temperature.
• Super Optimal broth with Catabolite repression (SOC) buffer (Merck).
• LB medium: 1% Tryptone, 0.5% yeast extract, 200 mM NaCl, sterilize
by autoclaving.
• LB2x: LB medium prepared in 0.5 volume.
• LB-agar plates: LB medium + 1.5% agar, add antibiotic after autoclave;
pour 60-mm Petri dishes.
• ZYP5052 medium, prepared according to Studier (2005) and supple-
mented with 200 µg mL−1 of ampicillin (final concentration).

30.3.3 PCR, cloning and transformation procedures

• Primers were ordered from Eurogentec.
• Gene of interest was synthetized by GeneArtR Gene Synthesis (Life
Technologies).
• BamHI HF, EcoRI HF, and 10× Cutsmart Buffer (New England
Biolabs).
• Calf intestinal alkaline phosphatase (CIP) (New England Biolabs).
• T4 DNA Ligase and 10× ligase buffer (New England Biolabs).
• DNA ladder.
458 Protocols for Macroalgae Research

• Pfu polymerase and 10× Pfu buffer (Promega).

• dNTP (10 mM).
• PCR master mix (Promega).
• Plasmid prep kit.
• PCR clean-up kit.
• Buffers for nucleotide electrophoresis: Commonly available formulations.

30.3.4 Protein expression and purification

• Lysis buffer: Tris–HCl 50  mM, pH 7.5; 250  mM NaCl; 1  mM
Ethylenediaminetetraacetic acid (EDTA); 1  mg  mL−1 lysozyme;
0.1 mg mL−1 DNAse (final concentrations)
• His Microspin columns (GE Healthcare, USA) or equivalent
• Complete, EDTA-free (Roche): One tablet for 20  mL expression cells
suspended in loading buffer
• Loading (wash) buffer: 20 mM Tris–HCl, pH 7.5, 200 mM NaCl, 10 mM
imidazole (final concentrations)
• Elution buffer: 20 mM Tris–HCl, pH 7.5, 200 mM NaCl, 500 mM imid-
azole (final concentrations)
• Gel filtration buffer: 20 mM Tris–HCl, pH 7.5, 200 mM NaCl (final
concentrations)
• 12% Criterion precast Bis-Tris gels (Biorad) or equivalent
• Buffers for protein gel electrophoresis Sodium Dodecyl Sulfate
PolyAcrylamide Gel Electrophoresis (SDS–PAGE): commonly avail-
able formulations
• Anti-His antibody Horseradish Peroxidase (HRP)-conjugated
• TransBlot Turbo transfer pack 0.2 µ, nitrocellulose membrane mini
(Biorad) or equivalent
• Enhanced ChemiLuminescent (ECL) Western Blotting Substrate
• TBS-tween buffer: 20 mM Tris–HCl pH 7.6, 0.8% NaCl, 0.1% Tween-20
(final concentrations)

30.3.5 Equipment
• Water bath set at 42°C
• Incubator set at 37°C
• Shaking incubator at 20°C or 37°C
• Autoclave
• 96-well thermocycler with heated lid
• OD600 absorbance reader
• Nanodrop spectrophotometer
• Sonicator
• French press
• ÄKTA Avant system (GE Healthcare, USA) or equivalent
Chapter thirty: Cloning and expression strategies 459

• HisPrep™ FF 16/10 column (GE Healthcare, USA) or equivalent

• HiLoad™ Superdex 200 column (GE Healthcare, USA) or equivalent
• DNA and protein gel electrophoresis systems
• TransBlot Turbo system (Biorad) or equivalent

30.3.6 Software
• Hyper 32 (Informer Technologies, model: hyper32)
• Microsoft Excel or similar spreadsheet
• UNICORN software associated with ÄKTA Avant

30.4 Experimental procedures

The current chapter does not include description of standard techniques
and gel electrophoresis, the use of equipment, and commercial kits. The
reader should refer to texts, manuals, and protocols provided by suppliers
for instructions.

30.4.1 Bioinformatics analysis

• Basic Local Alignment Search Tool (BLAST) analyses in National
Center for Biotechnology Information (NCBI) to predicted related
proteins (https://blast.ncbi.nlm.nih.gov/).
• SignalP 3.0 server to predict signal peptides (Bendtsen et al. 2004).
• TransMembrane Helices based on a hidden Markov Model (TMHMM)
servers to predict transmembrane domains (Krogh et al. 2001).
• The crucial choices of the N- and C-terminal boundaries of each
module were refined using hydrophobic cluster analysis (Callebaut
et al. 1997).

30.4.2 Cloning
Gene of interest was synthetized and codon-optimized for expression
in E. coli by GeneArtR Gene Synthesis, Life Technologies (USA) (Bonin
et al. 2015) or searched in the genome sequence or the GenBank Expressed
Sequence Tag (EST) library of E. siliculosus (Groisillier et al. 2014) (Note 2).

30.4.2.1 Amplification of gene of interest

Primers are designed to contain restriction sites contained in multicloning
site of pFO4 vector:

• Forward primer: 5′-GGGGGGGGATCCXn-3′ (BamHI restriction site in

italic).
• Reverse primer: 5′-CCCCCCGAATTCXn-3′ (EcoRI restriction site in
italic).
460 Protocols for Macroalgae Research

• Xn corresponds to gene primers chosen to have a Tm of 70°C–72°C

(Note 3).
• Prepare the PCR mix, on ice:
Pfu polymerase 0.5 µL (3 u µL−1)
10× buffer 5 µL
dNTP 2 µL (10 mM)
Primer forward 0.5 µL (10 µmol µL−1)
Primer reverse 0.5 µL (10 µmol µL−1)
Gene DNA 1 µL (10 ng µL−1)
Sterile water qsp 50 µL

• Program the thermocycler as follows: 5  min at 94°C, followed by 30

cycles of 30 s at 94°C, 60 s at 50°C, 90 s at 72°C, then 10 min at 72°C.
The duration of the extension step depended on the length (nucleo-
tides) gene fragment, approximately 60 s kb–1.
• Put 5 µL of PCR result on 1% agarose gel for analysis (size and amount).

30.4.2.2 PCR fragment purification

When proper amplification of the desired fragment has occurred, purify
the PCR product using PCR clean-up kit. Finally, add 30 µL of sterile water
to suspend PCR fragment.
30.4.2.3 PCR fragment digestion
• Digest the PCR fragment with reaction mix as follows:
PCR fragment 25 µL
EcoRI HF (20 u µL−1) 0.5 µL
BamHI HF (20 u µL−1) 0.5 µL
10× Cutsmart Buffer 3 µL
Sterile water qsp 30 µL

• Incubate 2 h at 37°C.

• Purify the linearized vector using PCR clean-up kit, elute in 30 µL
sterile water.
30.4.2.4 pFO4 vector preparation
• Digest the vector with reaction mix as follows:
Vector DNA 1 µg
EcoRI HF (20 u µL−1) 1 µL
BamHI HF (20 u µL−1) 1 µL
10× Cutsmart Buffer 2 µL
Sterile water qsp 20 µL
Chapter thirty: Cloning and expression strategies 461

• Incubate 2 h at 37°C.

• Add 1 µL of CIP and then incubate 1 h at 37°C.
• Purify the linearized vector using PCR clean-up kit. Finally, add
100 µL sterile water to get a vector concentration of 10 ng µL−1.

30.4.2.5 Ligation step

• Prepare the ligation mix:

Linearized vector (2.5 ng µL−1) 2 µL

Digested PCR fragment 5 µL
10× ligation buffer 0.5 µL
T4 DNA ligase 0.5 µL
Sterile MilliQ water qsp 10 µL

• To optimize ligation, incubate at room temperature for 1 h and then

at 4°C O/N.

30.4.2.6 Transformation in E. coli DH5α

• Prepare LB-agar with antibiotic plates at room temperature.
• Thaw competent cells on ice.
• Mix 50 µL DH5α competent cells with ligation mix in 10 mL sterile
culture tube.
• Incubate 30 min on ice.
• Heat shock exactly 45 s at 42°C in water bath.
• Put back on ice 5 min.
• Add 100 µL of SOC medium.
• Incubate 45 min at 37°C with agitation.
• Plate 2 × 80 µL on selective plates then incubate at 37°C O/N.

30.4.2.7 PCR screening

PCR screening was performed directly on the DH5α bacterial colonies to
verify the clones with inserts of the expected size, by using PCR prim-
ers that annealed upstream (5′-GCAGCAGCCACCATCACCATCACC-3′)
and downstream (5′-CCTTTCGGGCTTTGTTAGCAGCCGG-3′) from the
insertion site of pFO4 vector.

• PCR screening Mix:

10 µL Master mix
0.2 µL primer pFO4 forward
0.2 µL primer pFO4 reverse
With a sterile plastic tip, pick up a single well-isolated colony and
inoculate it in a PCR reaction tube. Repeat this step for each colony
to be screened.
462 Protocols for Macroalgae Research

• PCR program: (cf. Section 30.4.2.1).

• Put 10 µL on 1% agarose gel for size analysis.

30.4.2.8 Plasmid extraction and glycerol stock

• Positive DH5α clones were cultivated in 2  mL of LB medium  +
ampicillin (100 µg mL −1) at 37°C O/N. One milliliter was used to
stock clones in glycerol at −80°C, and plasmids were purified from
the other mL.
• Glycerol stocks:
500 µL glycerol 100%
500 µL LB 2×
1 µL ampicillin (100 mg mL−1)
1 mL culture
• Plasmid extraction was carried out using Plasmid Prep kit. Plasmids
were eluted with 50 µL H2O sterile. The integrity of sequences was
verified by sequencing.

30.4.2.9 Transformation of expression strain,

PCR screening, and glycerol stock
Steps in Section 30.4.2.6 and 30.4.2.7, and glycerol stock were repeated with
E. coli BL21 (DE3) cells and recombinant pFO4 vector obtained at step in
Section 30.4.2.8 (Note 1).

30.4.3 Small-scale test expression

BL21 (DE3) positive clones (between 4 and 8) were tested for the expres-
sion of the desired protein (Note 4).

30.4.3.1 Cultivation was performed in two phases

First, transformed colonies were grown at 37°C overnight in 1  mL LB
medium containing 100  µg  mL−1 ampicillin; then, cultures were diluted
1:100 in 2  mL autoinductible ZYP5052 medium containing 200  µg  mL−1
ampicillin and subjected to further incubation at 20°C, 200 rpm, during 72 h.

30.4.3.2 Lysis of cells and detection of proteins

• For solubility assay, cell pellets from small-scale expression cultures
were resuspended in 500 µL of lysis buffer and incubated at 18°C for
1 h with light agitation and the soluble and insoluble fractions sepa-
rated by centrifugation (14,000 g, 20 min, 4°C).
• Insoluble pellets were resuspended in 200 µL of lysis buffer supple-
mented with urea 6 M, incubated at 4°C for 1 h with light agitation
and the insoluble protein fraction and the pellet separated by cen-
trifugation (14,000 g, 20 min, 4°C).
• Samples from soluble and insoluble fractions were separated by 12%
SDS–PAGE.
Chapter thirty: Cloning and expression strategies 463

Presence of the protein of interest is not always easy to observe in SDS–

PAGE, due to the presence of E. coli proteins. Two methods can be used to
confirm the presence of the recombinant protein:

• First, soluble fractions could be purified using His Microspin col-

umns according to the protocol recommended by the supplier. The
results were also analyzed by 12% SDS–PAGE.
• Second, a Western blot can be carried out. For this, transfer from
gel onto ready-to-use 0.2 µm nitrocellulose membrane was done by
using a TransBlot Turbo system under the condition specified by the
manufacturer. Monoclonal antipolyhistidine peroxidase conjugate
antibody that specifically recognizes his-tagged fusion proteins was
used at a final concentration of 1/10,000.

30.4.4 Large-scale expression and purification

30.4.4.1 Expression culture
• Expression tests were performed as described in Section 30.4.3.1 but
adjusted to a 1 L culture (Note 5).

30.4.4.2 Affinity chromatography

• To purify the recombinant proteins, bacteria cells were harvested by
centrifugation at 4000 rpm for 20 min and then resuspended in 5 to
20 mL of loading buffer (depending of the pellet volume) before lysis
with a French press. The lysate was centrifuged for 1 h at 14,000 rpm,
and the cell-free supernatant was filtered through 0.2 µm filter before
loading onto a HisPrep column.
• Proteins were eluted with a linear increasing gradient (0%–100%) of
elution buffer within minimum 10 column volumes, and fractions of
1 mL were collected (Figure 30.1a).
• Presence of the recombinant protein was verified by 12% SDS–PAGE
(Figure 30.1a).

30.4.4.3 Size-exclusion chromatography

• To improve the purification of the recombinant protein, fractions
containing the recombinant tagged protein were injected onto a
HiLoad™ Superdex 200 column previously equilibrated with gel fil-
tration buffer. Fractions were then eluted with the same buffer at a
flow rate of 1 mL min−1 (Figure 30.1b).

30.4.4.4 Analysis of the chromatography

After each step of purification, protein fractions were analyzed by SDS–
PAGE and by Western blot if necessary (Figure 30.1b).
464 Protocols for Macroalgae Research

2000
Fraction number
4 5 6
1600
Absorbance at 280 nm

1200

800

600

0
0 1 2 3 4 5 6 7 8 9 10 11 12
(a) Fraction number
6

5
Ln molecular mass

250
Fraction number
Absorbance at 280 nm

4 200 EsM1PDH1cat
150

100
3
50
Fraction number
0
20 25 30 35 40 45 50 55 60 65 70
2
1 1.2 1.4 1.6 1.8 2 2.2
(b) Ve/V0

Figure 30.1 Purification (a) and estimation of molecular mass (b) of the recombi-
nant His-tagged EsM1PDH1cat domain. (a) Proteins were purified by Ni2+ affin-
ity chromatography, and eluted fractions were analyzed by SDS–PAGE (inset);
(b) proteins were resolved by gel filtration onto a Superdex 200 HiLoad™ column
(inset), and the following proteins were used as standards for column calibration:
carbonic anhydrase (29 kDa), albumin (66 kDa), alcohol dehydrogenase (150 kDa),
b-amylase (200 kDa); Ve, elution volume; V0, void volume. (From Bonin, P. et al.,
Phytochemistry, 117, 509–520, 2015.)

30.5 Notes
Note 1: The E. coli system is the first-choice host for the initial screen-
ing of the recombinant protein expression, because these cells can
be readily manipulated, are cultured inexpensively, and grow rap-
idly. In recent years, numerous new strains, vectors, and tags have
been developed to overcome the limitations of this system, which
Chapter thirty: Cloning and expression strategies 465

include codon bias, inclusion body formation, toxicity, protein inac-

tivity, mRNA instability, and lack of posttranslational modification
(Khow and Suntrarachun 2012; Gopal and Kumar 2013; Rosano and
Ceccarelli 2014).
Note 2: The few example of expression of proteins in brown algae does
not make it possible to know whether gene synthesis and optimi-
zation in E. coli is the best solution to obtain a soluble protein, but
now, relatively cheap commercial gene synthesis is often a preferred
option, providing an outsourced service that affords the benefit of
codon-optimized cDNAs that can be custom cloned into the required
expression vectors by the supplier (Quax et al. 2015).
Note 3: This protocol uses restriction sites dependent on the multiple
site cloning present on the expression vectors, but other cloning
techniques may be commonly used as Gateway Technology, Flexi R
Vector Systems, and Creator™ DNA Cloning System (Festa et  al.
2013). The primers are always chosen with the same Tm (70°C–72°C)
to simplify the amplification steps in the case of multiple clonings
performed in parallel (Groisillier et al. 2010).
Note 4: Figure 30.2 shows the importance of examining several clones
for the same expression strain transformed by a recombinant
plasmid.

M1Short NC M1Short N M1full NC M

u t s l k j f′ e′ d′
150

75

50

37

Figure 30.2 Western blot analysis of insoluble and soluble fractions of three
clones of E. coli cell-free extracts containing catalytic domain of M1PDH (M1Short
NC, without induction), M1PDH (M1Short N), and full M1PDH (M1full NC)
of E. siliculosus. M: molecular weight marker in kDa. (From Bonin, P., Étude du
métabolisme du mannitol chez l’algue brune modèle Ectocarpus siliculosus: carac-
térisation de l’enzyme clé mannitol-1-phosphate déshydrogénase. Thèse de doctorat
de Biologie. Université Pierre et Marie Curie, Paris, France, 2014.)
466 Protocols for Macroalgae Research

Note 5: Culture condition of recombinant E. coli may also increase gene

expression levels and the solubility of expressed proteins. The solu-
bility of recombinant proteins is increased by prolonged induction
at low temperatures with decreased amounts of IPTG. Sometimes
addition of some chemicals in the culture medium also increases the
expression of the gene-of-interest because these chemicals induce
chaperone expression (Gopal and Kumar 2013).

References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.,
Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: A new generation of pro-
tein database search programs. Nucleic Acids Res 25: 3389–3402.
Baharum, H., Morita, H., Tomitsuka, A., Lee, F.-C., Ng, K.-Y., Rahim, R.A., Abe, I.,
Ho, C.-L. 2011. Molecular cloning, modeling, and site-directed mutagenesis
of Type III polyketide synthase from Sargassum binderi (Phaeophyta). Mar
Biotechnol 13: 845–856.
Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S. 2004. Improved prediction of
signal peptides: SignalP 3.0. J Mol Biol 340: 783–795.
Bonin, P. 2014. Étude du métabolisme du mannitol chez l’algue brune modèle
Ectocarpus siliculosus: Caractérisation de l’enzyme clé mannitol-1-phosphate
déshydrogénase. Thèse de doctorat de Biologie. Université Pierre et Marie
Curie, Paris, France.
Bonin, P., Groisillier, A., Raimbault, A., Guibert, A., Boyen, C., Tonon, T. 2015.
Molecular and biochemical characterization of mannitol-1-phosphate
dehydrogenase from the model brown alga Ectocarpus sp. Phytochem 117:
509–520.
Brown, J.W., Sorhannus, U. 2010. A molecular genetic timescale for the diversifica-
tion of autotrophic stramenopiles (Ochrophyta): Substantive underestima-
tion of putative fossil ages. PLoS One 5: e12759.
Callebaut, I., Labesse, G., Durand, P., Poupon, A., Canard, L., Chomilier, J.,
Henrissat, B., Mornon, J.P. 1997. Deciphering protein sequence information
through hydrophobic cluster analysis (HCA): Current status and perspec-
tives. Cell Mol Life Sci 53: 621–645.
Cock, J.M., Sterck, L., Rouzé, P. et al. 2010. The Ectocarpus genome and the indepen-
dent evolution of multicellularity in brown algae. Nature 465: 617–621.
de Franco, P.O., Rousvoal, S., Tonon, T., Boyen, C. 2009. Whole genome survey of
the glutathione transferase family in the brown algal model. Mar Genomics
1: 135–148.
Festa, F., Steel, J., Bian, X., Labaer, J. 2013. High-throughput cloning and expression
library creation for functional proteomics. Proteomics 13: 1381–1399.
Fischl, R., Bertelsen, K., Gaillard, F., Coelho, S., Michel, G., Klinger, M., Boyen, C.,
Czjzek, M., Hervé, C. 2016. The cell-wall active mannuronan C5-epimerases
in the model brown alga Ectocarpus: From gene context to recombinant pro-
tein. Glycobiology 26: 973–983.
Gopal, J., Kumar, A. 2013. Strategies for the production of recombinant protein in
Escherichia coli. Protein J 32: 419–425.
Chapter thirty: Cloning and expression strategies 467

Groisillier, A., Hervé, C., Jeudy, A., Rebuffet, E., Pluchon, P.F., Chevolot, Y.,
Flament,  D. et  al. 2010. MARINE-EXPRESS: Taking advantage of high
throughput cloning and expression strategies for the post-genomic analysis
of marine organisms. Microb Cell Fact 9: 45.
Groisillier, A., Shao, Z., Michel, G., Goulitquer, S., Bonin, P., Krahulec, S.,
Nidetzky, B., Duan, D., Boyen, C., Tonon, T. 2014. Mannitol metabolism in
brown algae involves a new phosphatase family. J Exp Bot 65: 559–570.
Inoue, A., Satoh, A., Morishita, M., Tokunaga, Y., Miyakawa, T., Tanokura, M.,
Ojima, T. 2016. Functional heterologous expression and characterization of
mannuronan C5-epimerase from the brown alga Saccharina japonica. Algal
Res 16: 282–291.
Iwamoto, K., Shiraiwa, Y. 2005. Salt-regulated mannitol metabolism in algae. Mar
Biotechnol 7: 407–415.
Khow, O., Suntrarachun, S. 2012. Strategies for production of active eukaryotic
proteins in bacterial expression system. Asian Pac J Trop Biomed 2: 159–162.
Krogh, A., Larsson, B., von Heijne, G., Sonnhammer, E.L. 2001. Predicting trans-
membrane protein topology with a hidden Markov model: application to
complete genomes. J Mol Biol 305: 567–580.
Kurland, C., Gallant, J. 1996. Errors of heterologous protein expression. Curr Opin
Biotechnol 7: 489–493.
Meslet-Cladière, L., Delage, L., Leroux, C.J.-J., Goulitquer, S., Leblanc, C., Creis, E.,
Ar Gall, E., Stiger-Pouvreau, V., Czjzek, M., Potin, P. 2013. Structure/function
analysis of a Type III polyketide synthase in the brown alga Ectocarpus silicu-
losus reveals a biochemical pathway in phlorotannin monomer biosynthesis.
The Plant Cell 25: 3089–3103.
Nishitsuji, K., Arimoto, A., Iwai, K., Sudo, Y., Hisata, K., Fujie, M., Arakaki, N. et al.
2016. A draft genome of the brown alga, Cladosiphon okamuranus, S-strain:
A platform for future studies of “mozuku” biology. DNA Res 23: 561–570.
Quax, T.E., Claassens, N.J., Söll, D., van der Oost, J. 2015. Codon bias as a means to
fine-tune gene expression. Mol Cell 59: 149–161.
Rosano, G.L., Ceccarelli, E.A. 2014. Recombinant protein expression in Escherichia
coli: Advances and challenges. Front Microbiol 5: 172.
Rousvoal, S., Groisillier, A., Dittami, S.M., Michel, G., Boyen, C., Tonon, T. 2011.
Mannitol-1-phosphate dehydrogenase activity in Ectocarpus siliculosus, a key
role for mannitol synthesis in brown algae. Planta 233: 261–273.
Shao, Z., Zhang, P., Li, Q., Wang, X., Duan, D. 2014. Characterization of mannitol-
2-dehydrogenase in Saccharina japonica: Evidence for a new polyol-specific
longchain dehydrogenases/reductase. PLoS One 9: e97935.
Silberfeld, T., Leigh, J.W., Verbruggen, H., Cruaud, C., de Reviers, B., Rousseau, F. 2010.
A multi-locus time-calibrated phylogeny of the brown algae (Heterokonta,
Ochrophyta, Phaeophyceae): Investigating the evolutionary nature of the
“brown algal crown radiation”. Mol Phylogenetics Evol 56: 659–674.
Studier, F.W. 2005. Protein production by auto-induction in highdensity shaking
cultures. Protein Expr Purif 41: 207–234.
Tenhaken, R., Voglas, E., Cock, J.M., Neu, V., Huber, C.G. 2011. Characterization
of GDP-mannose dehydrogenase from the brown alga Ectocarpus silicu-
losus providing the precursor for the alginate polymer. J Biol Chem 286:
16707–16715.
468 Protocols for Macroalgae Research

Toporkova, Y.Y., Fatykhova, V.S., Gogolev, Y.V., Khairutdinov, B.I., Mukhtarova,

L.S., Grechkin, A.N. 2017. Epoxyalcohol synthase of Ectocarpus siliculo-
sus. First CYP74-related enzyme of oxylipin biosynthesis in brown algae.
Biochimica et Biophysica Acta 1862: 167–175.
Wei, N., Quarterman, J., Jin, Y. 2013. Marine macroalgae: An untapped resource
for producing fuels and chemicals. Trends Biotechnol 31: 70–77.
Ye, N., Zhang, X., Miao, M., Fan, X., Zheng, Y., Xu, D., Wang, J. et al. 2015. Saccharina
genomes provide novel insight into kelp biology. Nat Commun 6: 6986.
Yoon, H.S., Hackett, J.D., Ciniglia, C., Pinto, G., Bhattacharya, D. 2004. A mole-
cular timeline for the origin of photosynthetic eukaryotes. Mol Biol Evol
21: 809–818.
chapter thirty one

Polyethylene glycol-mediated
transformation in the green
macroalga Ulva mutabilis
(Chlorophyta)
A forward genetics approach
Jens Boesger, Michiel Kwantes, and Thomas Wichard

Contents
31.1 Introduction ......................................................................................... 470
31.2 State of the art ...................................................................................... 471
31.3 Materials ................................................................................................474
31.3.1 Equipment, consumables, and reagents .............................474
31.3.1.1 Equipment and consumables ..............................474
31.3.1.2 Reagents .................................................................474
31.3.2 Ulva culture medium ............................................................ 475
31.4 Experimental procedures................................................................... 475
31.4.1 Appropriate vector preparation for transformation
of U. mutabilis ......................................................................... 475
31.4.2 Preparation of gametes of U. mutabilis for
transformation ....................................................................... 475
31.4.3 Transformation of U. mutabilis gametes ............................. 476
31.4.4 Cultivation of transgenic Ulva lines and selection by
phleomycin treatment .......................................................... 477
31.4.5 Determination of the transformation efficiency and
further single-strain cultivation.......................................... 478
31.4.6 Confirmation of stable transformation .............................. 478
31.5 Notes ..................................................................................................... 481
Acknowledgments ......................................................................................... 482
References........................................................................................................ 482

469
470 Protocols for Macroalgae Research

31.1 Introduction
The number of research groups looking for opportunities to transform
algae has increased steadily with the increasing interest in algae as novel
plant model organisms and potential next-generation fuel producers
(Walker et al. 2005, Hallmann 2007, Mikami 2013). Genetic engineering
programs aim to manipulate algal metabolism, but a stable transforma-
tion is still a prerequisite and often the limiting factor to achieving the
next level of skills in macroalgal research.
Vector transformation is the process by which exogenous DNA is
transferred into a host organism. Methods based on polyethylene gly-
col (PEG)-mediated DNA transfer, particle bombardment, electropora-
tion, and gene transfer using Agrobacterium are common approaches to
create transgenic cell lines, which were also all applied to green algae
(Kathiresan et al. 2009, Oertel et al. 2015). Transformation can be divided
into genetic (stable) and transient transformations, which has recently
been more frequently reported for macroalgae (Mikami 2013). On trans-
formation, genes introduced by genetic recombination are maintained in
the genome through generations of cells, whereas in transient transforma-
tion, rapid loss of introduced foreign genes is usually observed. At this
moment, the critical step for genetic transformation is to generate a plas-
mid vector containing all the genetic elements for expression, including
promoter, enhancer, and transcription termination sequences. The vector
involves the manipulation of selection marker expression cassettes (usu-
ally a gene conferring resistance to an antibiotic) for either selection of
the plasmid in bacteria during the cloning steps or gene transfer in the
host organism. Recent genome data of several macroalgae now support
the application of recombinant techniques for these species (Cock et al.
2010, Collén et al. 2013), because they provide a rich resource of DNA ele-
ments, such as, for example, promoters that can be chosen for transgenic
expression.
Macroalgae very often reveal a strong resistance to antibiotics, so that
an appropriate selection of antibiotic markers is hard to find. At the same
time, morphogenesis of macroalgae (i.e., Ulva) depends on its associated
bacteria (Wichard 2015). Therefore, those essential growth-promoting
and/or morphogenesis-inducing bacteria must be equally resistant to the
chosen antibiotics such as the transgenic Ulva (Oertel et al. 2015).
Establishing the genetic-transformation system requires five main
parameters (Mikami 2013): (1) easily accessible target cells (e.g., Ulva
gametes); (2) an efficient gene transfer system; (3) an efficient expression
system for foreign genes, considering the codon usage of the host; (4) an
integration (and targeting) system to integrate the foreign gene into the
genome; and (5) a selection system for transformed lines that does not
interfere with the growth of the bacteria associated to Ulva. In fact, a
Chapter thirty one: Transformation of Ulva 471

stable transformation system will be accomplished by the proof of stable

DNA integration into the algal genome by PCR techniques or Southern
blots. A stable transformation system in hand allows us to apply sev-
eral important techniques in forward and reverse genetics; for example,
insertional mutagenesis, promoter trapping, gene silencing, or gene edit-
ing. In the current chapter, the PEG-mediated DNA transfer into Ulva’s
gametes is described for stable transformation facilitating a forward
genetic approach (Figure 31.1).

31.2 State of the art

Hallmann (2007), in his review Algal Transgenics and Biotechnology, high-
lighted several critical questions that have to be addressed when trans-
genic algae of new model systems are to be produced: (1) Are there any close
relatives that have been transformed before? (2) Which DNA constructs might be
the most suitable for selection of my transgenic algae? (3) Which promoters should
work and result in a high level of expression? (4) How should the DNA be trans-
ferred into the cells? [and] (5) How can expression of a given gene be monitored?
(Hallmann 2007). Answers to these questions could be given for Ulva, but
not for other macroalgae, such as Ectocarpus siliculosus or Porphyra species,
which are still under investigation. In any case, considerable technical
improvements have been made, for example, regarding transient trans-
formation in red seaweeds (Mikami 2014) and stable transformation in
Ulva (Oertel et al. 2015). Oertel et al. (2015) adopted a protocol for intro-
ducing DNA into U. mutabilis cells that was originally developed for the
high-frequency transformation of yeast protoplasts (Hinnen et al. 1978).
In contrast to yeast, Ulva gametes or zoids can be used directly as receiver
cells, because they are devoid of a rigid cell wall. After settling and adhe-
sion, germ cells resorb their flagella and form a protoplast.
Indeed, the first successful stable transformation of macroalgae was
achieved by PEG-mediated direct DNA transfer into germ cells of U. mutabilis
in Oertel’s laboratory (University of Regensburg, Regensburg, Germany) to
target green fluorescent protein expression in the cell nucleus during early
cell divisions of the germling and to generate developmental mutants show-
ing an atypical morphogenesis (Oertel et al. 2015). Transformation vectors
possess (Figure 31.2) the chromosomal RBCS gene from U. mutabilis with
the bleomycin resistance gene (ble) as a dominant selection marker gene.
Transformation frequencies are in average 104 in 107 cells (Oertel et al. 2015).
A similar approach revealed the expression of mitochondrial targeting
green fluorescent protein upon PEG transformation in U. partita (Suzuki
et  al. 2016). The insertional mutagenesis approach is currently evolving
to a reliable genetic tool kit along with the genome project of U. mutabilis
(Wichard et al. 2015).
 472

Complementation of mutants for example

Ulva develops by using cosmid libraries and
mature thalli (8–12 weeks) rescue of the phenotype

Cloning of the gene

Induction of gametogenesis and Expression patterns
Functional characterization of
transformation of gametes (6 days) genes involved in the bacteria-
Localization studies
mediated morphogenesis
Interaction partners
Knock down approach

TCCATCACACTCAACAC

Selection of respective phenotypes

(3–5 weeks) PCR-based identification of
disrupted genes

Isolation of genomic DNA and

Large scale cultivation of PCR/Southern blot analysis
descendants (up to 6 month)

Figure 31.1  Workflow of the forward genetic approach. The selection criteria and screenings for the phenotype of interest are the
bottleneck before the (multiple) insertion sites of the phleomycin-resistant cassette can be determined.
Protocols for Macroalgae Research
 NcoI 4466 NcoI 4506 NcoI 5168
EcoRI 4460 NotI 73 NotI 73 EcoRI 5162 NotI 73
Chapter thirty one:

PvuI 4063
U. mutabilis U. mutabilis U. mutabilis XcmI 711
RbcS promoter XcmI 711 XcmI 711 RbcS promoter
bla RbcS promoter

pPIBT7 ble pPIBT3 ble pPIBGT8

4471 bps 4511 bps 5173 bps
GFP/ble fusion Kpn I 1412
bla
U. mutabilis U. mutabilis
bla Pvu I 3546
RbcS terminator RbcS terminator U. mutabilis
2447
Pvu I 2844 NcoI 1651 RbcS terminator
Eco RI 1808 Eco RI Nco I 1651
Transformation of Ulva

Hind III 1825 Kpn I

Bam HI Ssp I 3111 Bam HI 2131
PvuI 1948 Xba I Sfo I 2232 Nco I 2371
Ssp I 2409 SfoI 1989 Sfo I 2691
Sal I Pvu I 2273
Sph I Pvu I 2650
Hind III
(a) (b) 2396 (c)

Figure 31.2  Vector plasmids for the transformation of Ulva mutabilis (Oertel et al. 2015). (a–c) Codon adapted phleomycin-resistant
cassettes: RBCS. Ribulose-1.5-bisphosphate carboxylase/oxygenase small subunit; ble. phleomycin resistant gene; bla. ß-lactamase.
Suitable restriction site marked with the frame.
473
474 Protocols for Macroalgae Research

31.3 Materials
31.3.1 Equipment, consumables, and reagents
31.3.1.1 Equipment and consumables
• Bead mill, for example, Tissuelyser (Qiagen, Hilden, Germany)
• 2–3 mm diameter steel beads
• Erlenmeyer flasks (2 L)
• Nylon sieve (mesh size 30 µm)
• Micro centrifuge tubes (1.5 mL, 2 mL, and for PCR)
• Centrifuge tubes (15 and 50 mL)
• Membrane filters (0.2 µm)
• Disposable syringes (sterile; 10/20/50 mL range)
• Pipettes and tips (2/10/100/1000 µL range)
• Petri dishes (diameter 145  mm) or culture flasks (surface area
182 cm2, capacity 550 mL)
• Pasteur pipettes with long, thin opening
• Light source (e.g., a mobile fluorescent lamp)
• Common PCR thermal cycler
• Aluminum foil and paper tissues

31.3.1.2 Reagents
• Ulva culture medium (UCM, Stratmann et al. 1996)
• Ulva transformation buffer 1 (UTB1, Table 31.1)
• Ulva transformation buffer 2 (UTB2, Table 31.2)
• Phleomycin (InvivoGen, San Diego CA, USA; stock solution:
10 mg mL−1)
• Bacterial growth factors of Ulva or stationary cultures of Maribacter
sp. MS6 and Roseovarius sp. MS2 (Spoerner et al. 2012, Grueneberg
et al. 2016)
• Vector plasmids for the transformation of U. mutabilis, for example,
pPIBT7 (EU176859.1), pPIBT3 (EU176858.1), pPIBGT8 (EU196041.1)
(Figure 31.2; Oertel et al. 2015)
• Oligonucleotides: Ph-2–5′-TTAGTCCTGCTCCTCGTCCACGAAGTG-3′;
RbcS_F1—GGCTTTCCAGGAGGGCAGTC; Ubi1-F1–5′-TACGGAGGC
TGTTGCACACG-3′; Ubi1_R2—AGCAGCATGACAGACCATCTTGTG
• PrimeSTAR GXL DNA Polymerase (Takara Bio Inc, USA); alternative
Pfu-Turbo DNA Polymerase (Agilent, USA)
• Dimethyl sulfoxide
• Silica-based DNA purification kit, for example, QIAquick (Qiagen,
Hilden, Germany)
• Genomic DNA purification kit, for example, GenElute Plant Genomic
DNA Miniprep Kit (Sigma, St. Louis, MO, USA)
• Suitable restriction endonucleases
Chapter thirty one: Transformation of Ulva 475

Table 31.1 Composition of Ulva transformation buffer 1 (UTB1) (Note 1)

Composition Final concentration Quantity to add (for 50 mL final)
Sorbitol 1 M 9.1085 g
Tris–HCl pH 7.5 10 mM 500 µL of a stock solution at 1 M
CaCl2 10 mM 55.49 mg
UCM 10% (v/v) 5 mL

Table 31.2 Composition of Ulva transformation buffer 2 (UTB2) (Note 1)

Composition Final concentration Quantity to add (for 50 mL final)
PEG 4000 40% (w/v) 20 g
Tris–HCl pH 7.5 10 mM 500 µL of a stock solution at 1 M
CaCl2 10 mM 55.49 mg

31.3.2 Ulva culture medium

A specific UCM was developed that allows Ulva and its associated bacte-
ria to develop sufficiently (see Chapter 9 by Califano and Wichard 2018,
Stratmann et al. 1996).

31.4 Experimental procedures

31.4.1 Appropriate vector preparation for transformation
of U. mutabilis
1. Linearize 20 µg of a transformation vector with a suitable single cut-
ting restriction endonuclease.
2. Perform a final purification of the linearized transformation vector
by using a silica-based DNA purification kit, for example, QIAquick
(Qiagen, Hilden, Germany), and elute in the smallest volume.
3. Determine the DNA concentration of the linearized and purified
transformation vector.

31.4.2 Preparation of gametes of U. mutabilis

for transformation
As Ulva gametogenesis is regulated by a light-triggered and endogenous
circadian clock, releasing of gametes from mature gametangia should
take place in the morning of the third day after the induction of game-
togenesis according to Kessler et al. (2018) (please see Chapters 8 and 9).
476 Protocols for Macroalgae Research

Gametes must be used directly as they are depleted of a cell wall for
a few hours only. Therefore, the transformation procedure must be per-
formed not later than 4 h after the hatching of gametes. Moreover, zoids
from parthenosporophytes lack also a rigid cell wall, making them suit-
able for this method as well (see Note 2).

1. Induce the gametogenesis as described by Stratmann et al. (1996)

and in Chapter 8.
2. In the morning of the third day after induction, decant the tissue
material through a nylon sieve and transfer all thalli-fragments into
fresh UCM to wash out the swarming inhibitor via exchanging the
media (see also Chapter 9).
3. Place a light source at one site of the cultivation vessel. After
10–40 min, released gametes accumulate at the brightest spot facing
the light source.
4. Collect the motile gametes in centrifuge tubes (15  mL) and place
these again with the tip orientated to the light source for additional
accumulation and concentration. The movement of gametes to the
light can be enhanced by covering the centrifuge tubes with alumi-
num foil up to the end of the tip of the tube. After accumulation, the
gametes can be carefully collected by using Pasteur pipettes with
a long thin tip. Transfer the accumulated gametes carefully into a
micro centrifuge tube (1.5 mL).
5. Optional: Due to the overall research interest, it might be necessary
to work with axenic cultures, which can be prepared from gametes
as described in Chapter 9 (Note 3).
6. Wash the gametes after centrifugation (2 min, 13,500 × g, 20°C) by
resuspending in 1 mL UTB1.
7. Determine the cell density of the gametes or zoids (Chapter 9) and
dilute cells with UTB1 to 106 –108 cells/100 µL with UTB1 (Table 31.1).

31.4.3 Transformation of U. mutabilis gametes

1. Add 2–5 µg of linearized and purified plasmid DNA to the 100 µL
cell suspension and incubate for 10 min at room temperature.
2. Proceed with 100 µL cell suspension without purified plasmid DNA
analogous to the next steps for control (Note 4).
3. Dilute the sample with 1 mL UTB2 (Table 31.2, Note 5) and incubate
for an additional 30 min.
4. Centrifuge the transformed gametes for 10 min at 13,500 × g at 20°C
and discard the supernatant immediately.
5. Resuspend the transformed gametes carefully in 500 µL UCM (Note 6).
Chapter thirty one: Transformation of Ulva 477

31.4.4 Cultivation of transgenic Ulva lines and selection

by phleomycin treatment
1. Inoculate 20 mL of fresh UCM in a Petri dish (145 mm diameter) with
either 250 µL of resuspended transformed gametes or nontransformed
gametes as a negative control, respectively (Figure 31.3).
2. Incubate the cells in darkness at 18°C until the next morning to allow
the expression of the phleomycin resistance gene and attachment of
gametes to the surface of the Petri dish (or culture flask).
3. Add phleomycin from the stock solution to a final concentration of
5 µg mL−1 (Note 7).
4. A prerequisite when working with already purified (axenic) gam-
etes: Add 0.5 µL from each stationary culture of Maribacter sp. MS6
and Roseovarius sp. MS2 (Note 8).
5. Cultivate the transgenic lines and the control for two to three  weeks
in a 7 h light/17 h dark cycle at 18°C without changing the media,
including phleomycin.

12345678

−5000 bp
−1000 bp

−5000 bp
−1000 bp

(a) Control (b) Transformants (c)

Figure 31.3  Transformants of the Ulva mutabilis mutant (slender) derived from
gametes. (a) The negative control (=transformation experiment without DNA) did
not show any surviving germling or contaminant. (b) U. mutabilis gametes were
transformed with the linearized vector plasmid pPIBT7. The picture was taken
by inverted microscopy in the third week after transformation. The transforma-
tion was conducted under the conditions described. (c) Agarose gel photograph
showing PCR genotyping results. The upper part of the gel was loaded with 5 µL
PCR product from the reaction, using primers Ph-2 and RbcS_F1 (amplicon length
1376 bp), and the lower part product from the control reaction with primers UBQ1_F1
and Ubi_R2 (amplicon length 1601 bp). PCR products, lanes 1–4: gDNA from inde-
pendently selected transformed Ulva lines; lane 5: gDNA from untransformed
Ulva; lane 6: 0.5 pg SspI-linearized pPIBT7; lane 7: water. Lane 8 contains 5 µL of
molecular marker.
478 Protocols for Macroalgae Research

31.4.5 Determination of the transformation efficiency

and further single-strain cultivation
Regarding plasticity in morphogenesis of U. mutabilis, random insertion
of transformation vectors very often reveals a variety of different morpho-
types in transgenic lines with different developmental paces and states.
Different growth rates are also furthered by differences in the sensitivity
of the individual insertional mutants against phleomycin, caused by mul-
tiple insertions of the resistance gene.
The first green transgenic lines usually become visible within the third
week after transformation. It also includes thalli that are free-floating in
the media. Early separation of larger seedlings in single culture flasks or
multiwell plates induces faster growth of the remaining smaller seedling.
Further cultivation of the transgenic strains does not require a continu-
ance of the antibiotic treatment due to the stable insertion of the resistance
gene. Moreover, persistent treatment of phleomycin can cause additional
random mutations in the individual transgenic lines. Due to various inser-
tion events into the genome and the disrupted genes, different growth
rates of the transformants should be expected. Novel morphotypes of
the thallus can be regularly observed five weeks after the transformation
(Figure 31.4).

1. Exchange the media containing phleomycin for fresh UCM without

phleomycin.
2. Preferably use a nylon sieve (mesh size 30  µm) to avoid a loss of
free-floating or very tiny transgenic seedlings when exchanging the
media supplemented with phleomycin to UCM.
3. Count the number of seedlings that have survived in a defined area
by using a calibrated inverted microscope or with binoculars. No
seedling should develop on the control plates (Figure 31.3).
4. Depending on the size and developmental status of the transgenic
seedlings, transfer each seedling to single culture flasks or multi-
well plates for further cultivation. Frequent changes of media (every
week) expedite sporulation of the transgenic strains, which is neces-
sary to produce larger populations of the transformants.

31.4.6 Confirmation of stable transformation

The most straightforward methods to verify whether the Ulva germlings
that survived the phleomycin selection also carry the inserted vector
are Southern blots and PCR analyses. To optimize these techniques for
Ulva, information about genome size and GC-content would be benefi-
cial because these parameters influence the efficiency of both approaches.
Chapter thirty one: Transformation of Ulva 479

Sl fl ab

3 cm 0.5 cm 500 μm
ro wr br

1 cm 1.6 cm 150 μm
tw bu sk

1 cm 1 cm 500 μm

Figure 31.4   Mutants with atypical thallus formation on polyethylene glycol

(PEG)-mediated transformation of gametes of Ulva mutabilis. Cultures of Ulva
are three to five weeks old. Sl, slender (control strain); fl, filamentous branched;
ab, additional blade branch; ro, rosette-shaped; wr, wrinkled; br, branched;
tw, twisted; bu, bubble; sk, skinny.

However, currently, there is no clear consensus on the exact genome size

or the GC-content of the Ulva genome (Freshwater et al. 1990, Kapraun
2007). In addition, high methylation of the genome (Pakhomov et al. 1968)
and the presence of secondary metabolites, such as sulfated polysac-
charides (Haug 1976), further affect the amenability of Ulva to standard
molecular techniques. Therefore, protocols and kits that work effectively
for other organisms often need considerable testing before they can be
applied successfully to Ulva. Here, we used PCR analysis to verify trans-
gene insertion in Ulva primary transformants (Figure 31.3). We were most
successful in the purification of genomic DNA using the GenElute Plant
480 Protocols for Macroalgae Research

Genomic DNA Miniprep Kit (Sigma, St. Louis, USA). Regarding PCR,
the best results were obtained using PrimeSTAR GXL DNA polymerase
(Takara Bio Inc, USA) (alternative: Pfu-Turbo DNA polymerase).

1. Harvest algal material and squeeze it thoroughly between tissue

paper to remove excess culture medium.
2. Grind the tissue, under liquid nitrogen, to a fine powder using a
pestle and mortar. Alternatively, collect up to 100 mg tissue together
with two steel beads (approximate diameter 2–3 mm) in a centrifuge
tube (2 mL), freeze it using liquid nitrogen, and disrupt the sample
in a bead mill. Keep the samples frozen.
3. Purify genomic DNA from the disrupted tissue using the GenElute
Plant Genomic DNA Miniprep Kit (Sigma, St. Louis, MO, USA), accord-
ing to the manufacturer’s instructions. It is recommended to include
the optional RNaseA digestion and perform only a single final elution
step in 50 µL of 5 mM Tris/HCl (pH 8.5) solution heated to 65°C.
4. Determine the quality and quantity of purified DNA by gel electro-
phoresis on a 0.8% agarose gel.
5. Perform PCR using PrimeSTAR GXL DNA Polymerase (Takara Bio
Inc, USA). The PCR reactions, using primer pair Ph-2 and RbcS_F1,
will amplify a 1376 bp region of the bleomycin resistance cassette.
It is also recommended to include a positive control PCR reaction
for each sample by using primers pair Ubi1-F1 and Ubi1-R2, which
should result in the amplification of a 1601 bp region of an Ulva UBQ
gene. Cycling protocol: 10 s denaturation at 98°C followed by 30
polymerization cycles (10 s at 98°C, 10 s at 62°C, 105 s at 68°C) and a
final 1 min elongation step at 68°C (Table 31.3).
6. Analyze the PCR products length on a 1.0% (w/v) agarose gel.

Table 31.3 PCR reaction mixture composition for optimized conditions

Amount for a 50 µL
Component reaction volume Final concentration
5× PrimeSTAR GXL Buffer 10 µL 1×
dNTP Mixture (2.5 mM each) 4 µL 0.2 mM each
Primer FW (10 µM) 1 µL 200 nM
Primer RV (10 µM) 1 µL 200 nM
DNA template 1–100 ng –
PrimeSTAR GXL DNA 0.75 µL 0.94 U/50 µL
Polymerase (1.25 U/µL)
Dimethyl sulfoxide 2.5 µL 5%
Water To 50 µL –
Chapter thirty one: Transformation of Ulva 481

31.5 Notes
Note 1: Before the use of any transformation buffer, sterilize the buffer
by passing through a membrane filter (0.2 µm) using a sterile dispos-
able syringe.
Note 2: Ulva zoids from parthenosporophytes were transformed by the
same procedure as gametes. However, a partial purification of these
cells by their movement to the light could not be applied, because
zoids are not phototactic. Therefore, zoids were used directly after
hatching from mature sporangia. For further applications, cells must
be processed within 30 min after the sporangia have discharged the
zoids and before they start settling or aggregating.
Note 3: Development and morphogenesis in a variety of green macroal-
gae are strongly dependent on the appropriate microbiome in the
environment. Therefore, it is necessary for certain scientific issues
to work further with axenic algal cultures or in the presence of a
defined microbiome. A smart way to separate gametes from their
accompanying bacteria can be performed by the horizontal move-
ment of phototactic gametes through glass capillary pipettes (for a
detailed protocol, see Chapter 9 by Califano and Wichard 2018). The
generation of axenic insertional mutants also requires highly puri-
fied DNA, and, therefore, additional purification steps by isopropa-
nol or ethanol precipitation might be necessary.
Note 4: Increasing concentrations of the transformation vector not
only result in better transformation efficiencies but also may cause
multiple insertion events accompanied by problems in further
characterization, including the identification of the insertional
mutants.
Note 5: Because of the high viscosity of PEG 4000 and the UTB2, careful
mixing is recommended through repeated aspiration with a micro-
liter pipette with a wide-open tip.
Note 6: Based on experience, gametes do not precipitate in the highly
concentrated UTB2 solution at the tip of the 1.5 mL micro centrifuge
tubes after centrifugation. Gametes usually stick around the wall of
the microcentrifuge tubes and are only visible as a light-green halo.
Therefore, resuspend the transformed gametes carefully by repeated
aspiration with a microliter pipette with a wide-open tip or gently
shaking the tube in 500 µL UCM after discarding the supernatant.
Note 7: The concentration of phleomycin can be increased up to
50 µg mL−1.
Note 8: A cross-kingdom cross-talk between macroalgae and bacte-
ria controls a variety of algal morphogenic processes, such devel-
opment, settlement, and growth. For that reason, it is essential
to inoculate each medium with the appropriate marine bacteria.
482 Protocols for Macroalgae Research

At least two bacterial strains are necessary for complete morpho-

genesis of Ulva. Roseovarius sp. MS2 induces cell division, whereas
the Maribacter sp. MS6 promotes a viable basal stem cell and pri-
mary rhizoid cells in addition to the induction of the proper cell
wall formation. Moreover, the MS2 species exhibits a specific che-
motactic affinity to the rhizoid cells of U. mutabilis (Kessler et al.
2018b) and seems to cooperate with MS6 and alga by chemical com-
munication. Both bacterial strains need to be resistant to phleomy-
cin. Alternatively, it is also possible to supplement 20 mL UCM with
100  µL of the sterile-filtered supernatant of stationary cultures of
both MS6 and MS2 (Spoerner et al. 2012). The supernatants contain
sufficient amounts of the essential bacterial growth factors for Ulva.
Alternatively, the partly purified bacterial factors could be used
(Spoerner et al. 2012). The morphogenetic substances are added
repetitively to the growth medium of axenic cultures of Ulva.

Acknowledgments
This work is supported by the Deutsche Forschungsgemeinschaft (DFG)
through the Collaborative Research Centre 1127 “Chemical Mediators in
complex Biosystems” (T.B., M.K., and T.W.).

References
Califano, G., and T. Wichard. 2018. Preparation of axenic cultures in Ulva
(Chlorophyta). In Protocols for Macroalgae Research, B. Charrier, T. Wichard,
C.R.K. Reddy (Eds.), Chapter 9. Boca Raton, FL: CRC Press, Taylor & Francis
Group.
Cock, J.M., L. Sterck, P. Rouze et al. 2010. The Ectocarpus genome and the indepen-
dent evolution of multicellularity in brown algae. Nature 465: 617–621.
Collén, J., B. Porcel, W. Carré et al. 2013. Genome structure and metabolic features
in the red seaweed Chondrus crispus shed light on evolution of the archae-
plastida. Proc. Natl. Acad. Sci. 110: 5247–5252.
Freshwater, D.W., J.A. Dutcher, D.F. Kapraun, and R.K. Sizemore. 1990. Variation
in nuclear DNA base composition (mol % G + C) in three orders of marine
green algae. Hydrobiologia 204: 167–172.
Grueneberg, J., A. Engelen, R. Costa, and T. Wichard. 2016. Macroalgal morpho-
genesis induced by waterborne compounds and bacteria in coastal seawater.
PLoS One 11: e0146307–e07.
Hallmann, A. 2007. Algal transgenics and biotechnology. Transgenetic Plant J.
1: 81–98.
Haug, A. 1976. Influence of borate and calcium on gel formation of a sulfated poly-
saccharide from Ulva lactuca. Acta Chem. Scandinaviaca B 30: 562–566.
Hinnen, A., J.B. Hicks, and G.R. Fink. 1978. Transformation of yeast. Proc. Natl.
Acad. Sci. 75: 1929–1933.
Chapter thirty one: Transformation of Ulva 483

Kapraun, D.F. 2007. Nuclear DNA content estimates in green algal lineages:
Chlorophyta and Streptophyta. Ann. Bot. 99: 677–701.
Kathiresan, S., A. Chandrashekar, G.A. Ravishankar, and R. Sarada. 2009.
Agrobacterium-mediated transformation in the green alga Haematococcus plu-
vialis (chlorophyceae, volvocales). J. Phycol. 45: 642–649.
Kessler, R.W., T. Alsufyani, and T. Wichard. 2018. Purification of sporulation and
swarming inhibitors from Ulva: Application in algal life cycle controlling.
In Protocols for Macroalgae Research, B. Charrier, T. Wichard, C.R.K. Reddy
(Eds.), Chapter 8. Boca Raton, FL: CRC Press, Taylor & Francis Group.
Mikami, K. 2014. A technical breakthrough close at hand: Feasible approaches
toward establishing a gene-targeting genetic transformation system in sea-
weeds. Front. Plant Sci. 5: 498.
Mikami, K. 2013. Current advances in seaweed transformation. In Biochemistry,
Genetics and Molecular Biology an Integrated View of the Molecular Recognition
and Toxinology—From Analytical Procedures to Biomedical Applications, G.R.
Baptista (Ed.), Chapter 13. Rijeka, Croatia, InTech.
Oertel, W., T. Wichard, and A. Weissgerber. 2015. Transformation of Ulva mutabilis
(chlorophyta) by vector plasmids integrating into the genome. J. Phycol.
51: 963–979.
Pakhomov, M.V., G.N. Zaitseva, and A.N. Belozerskii. 1968. Presence of
5-methylcytosine and 6-methylaminopyrine in composition of DNA of cer-
tain algae. Dok. Akad. Nauk SSSR 182: 712–714.
Spoerner, M., T. Wichard, T. Bachhuber, J. Stratmann, and W. Oertel. 2012. Growth
and thallus morphogenesis of Ulva mutabilis (Chlorophyta) depends on a
combination of two bacterial species excreting regulatory factors. J. Phycol.
48: 1433–1447.
Stratmann, J., G. Paputsoglu, and W. Oertel. 1996. Differentiation of Ulva mutabilis
(chlorophyta) gametangia and gamete release are controlled by extracellular
inhibitors. J. Phycol. 32: 1009–1021.
Suzuki, R., S. Ota, T. Yamazaki et al. 2016. Morphological changes of giant mito-
chondria in the unicellular to multicellular phase during parthenogenesis of
Ulva partita (Ulvophyceae) revealed by expression of mitochondrial target-
ing GFP and PEG transformation. Phycol. Res. 64: 176–184.
Walker, T.L., C. Collet, and S. Purton. 2005. Algal transgenics in the genomic era.
J. Phycol. 41: 1077–1093.
Wichard, T. 2015. Exploring bacteria-induced growth and morphogenesis in the
green macroalga order ulvales (chlorophyta). Front. Plant Sci. 6: 86.
Wichard, T., B. Charrier, F. Mineur et al. 2015. The green seaweed Ulva: A model
system to study morphogenesis. Front. Plant Sci. 6: 72.
Index
Note: Page numbers followed by f and t refer to figures and tables respectively.

2,2-Diphenyl-1-picrylhydrazyl (DPPH) Algal surface/mass ratio determination,

assay, 238–239, 241, 245–247 305–306
3,3ʹ-Diaminobenzidine (DAB), 269, 271, 272f Alginate, 382
16S rRNA encapsulation, 82, 87
amplicon sequencing data analysis, lyases, 327
103–105, 104f precipitation of, 191
amplification, 102–103 Amino acids (AAs), 212–213, 219
gene sequencing, 105–107 determination method, 216, 219
454 pyrosequencing technology, 103 acid hydrolysis, 220
advantages and disadvantages, 214t
eluents preparation, 219
A
flow gradient, 220, 221t
AAs. See Amino acids (AAs) reagents/standards preparation,
Acetate buffer, 254 219–220
Acousto-Optical Beam Splitter (AOBS), 354 Ammonium sulphate precipitation,
Actin filaments (AFs), 366, 375f 256–257
Adsorption bed chromatography, 256 Antibiotics, 161, 470
Adult macroalgal specimen, 124 AOBS (Acousto-Optical Beam Splitter),
AFM. See Atomic force microscopy (AFM) 354
AFs (actin filaments), 366, 375f Apogamic sporophytes, 72
A.I.G. (artificially inducible gametogenesis), Artificially inducible gametogenesis
143–144, 143t (A.I.G.), 143–144, 143t
Alaria esculenta, sporophylls of, 67f, 119f Artificial seawater (ASW), 340, 369
AlexaFluor568–Phalloidin (A12380) Atomic force microscopy (AFM), 336
preparation, 369–370 CW elasticity analysis in macroalgae,
Algal conditioning, 253–254 336–345
Algal gametes, 288–289 indentation depth, 339
Algal harvesting, 252 materials, 338
Algal material, 432 overview, 335–336
for AFM analysis, 338–339 indentation data/analysis, 337, 337f
experimental procedure, 119–125 on spatial resolution/indentation
and fixation procedure, 327–328 modulus, 343f
hydrolysis, 189 Axenic cultures in Ulva (chlorophyta),
for spore release and toxicity test, 118–119 159–169
for time-lapse microscopy, 354–355 UCM, 164, 164t

485
486 Index

B Cell-surface labeling with fluorescent

microspheres, 356
BAM (brown algal monoclonal), 325 Cell-surface marker displacement
BEEM® capsules, 396f, 400–401 quantification, 359–360
Biochar from seaweeds, 175–182 Cell wall (CW), 367
characteristics of, 178t–179t in brown algae, immunodetection/
pyrolysis, biochar generation, 181 imaging, 323–333
storage of, 181–182 immunolabeling, 330–331
Biomass drying techniques and calcite crystals of, 415f
methodologies, 253, 253t of Rhodophyta, 255
Bradford method, 217, 222 TBO staining, 326f
advantages and disadvantages, 215t Charophytes, 441–442
Bradford, M. M., 222 Chemical fixation, 381–382, 383f
Brown algae, 187, 365, 454 Chlamydomonas reinhardtii, 282
actin fluorescent staining, 365–376 Clonal cultures, propagation of, 71–72, 71f
cloning/expression for postgenomic Clonal gametophyte cultures
analysis, 454–464 advantages and disadvantages, 75
cryofixation. See Cryofixation of brown hybridization, 72–75, 73t, 75f
algae for TEM isolation of, 70
genomes, 455 Coralline algae (CA), 411–412
high-quality RNA extraction from, reproductive features, 416f
429–436 vegetative features, 415f
immunodetection/imaging of CW in, Cryopreservation of macroalgae, 79–82,
323–333 83t–85t
immunolabeling, 330–331 conventional colligative, 86–88
Lowicryl resin, protocol for, vitrification-based approach,
329–330 87–90
LR White resin, protocol for, 328–329 Culture Collection of Algae and Protozoa
labor-intensive chemical extractions, 324 (CCAP), 87, 89
laminarin in. See Laminarin, in brown CW. See Cell wall (CW)
algae CW (Calcofluor White), 330
RNA extraction methods for, 431t Cytoskeleton, 366
Brown algal monoclonal (BAM), 325
Brown macroalgae, 368
Brown seaweeds, 200, 392, 406f D
DAB (3,3ʹ-diaminobenzidine), 269,
C 271, 272f
Denaturing gradient gel electrophoresis
CA. See Coralline algae (CA) (DGGE), 98
Calcofluor White (CW), 330 Dichloro-dihydrofluorescein diacetate
Canonical analysis of principal coordinates (DCFH–DA), 269–270, 270f, 274
(CAP), 292, 293f–294f, 294–295 Dihydroethidium (DHE), 269, 270f, 274
Carbohydrates composition of macroalgae, Dimerous thallus, 415f
200–208 Dimethylaminoethanol (DMAE), 386–387
analysis monomeric, 205–208, 206t, 207t Diploid macroscopic algae, 62
CCAP (Culture Collection of Algae and Dipping methods, 310
Protozoa), 87, 89 DMAE (dimethylaminoethanol), 386–387
Cell DNA extraction, 101–102
disruption, 433 DPPH (2,2-diphenyl-1-picrylhydrazyl)
with bead mill, 290–291 assay, 238–239, 241, 245–247
by ultrasound treatment, 290 Dumas, J., 218
organelles, 268 Dumas method, 213, 214t, 218–219
Index 487

E Germanium dioxide (GeO2), 49

Glutaraldehyde, 394, 396f, 407
Ecotoxicity tests, 116–117 Green marine alga, 159
Ectocarpus siliculosus Green seaweeds, 392
actin cytoskeleton in vegetative cells Gum arabic, 239–240
of, 375f
actin fluorescent staining in,
365–376 H
dynamic/microscale mapping of cell
growth, 354–360 Hatchery systems, seedlings production
surface deformation pattern, 358f by, 50–51, 51f
EEZ (exclusive economic zone), 4 Heterosis effect, 64
Enzymatic hydrolysis, 255–256, 256t High-performance anion-exchange
Evans Blue, 302 chromatography with pulsed
Exclusive economic zone (EEZ), 4 amperometric detector
(HPAEC–PAD), 200, 209
chromatograph, 207, 207f
F multigradient optimized, 206t
High-pressure freezing in cryofixation,
Filtration system, 284, 284f 382–383
Fluospheres, 353 High-quality RNA extraction from brown
Folin–Ciocalteu (FC) assay, 238–240 algae, 429–436
Fucose-containing sulfated Holobiont, 95
polysaccharides (FCSPs), 324 Homogenization of RNA extraction, 433
Fucus vesiculosus, 311–312 Homogenizer tissues, 433
HPAEC–PAD. See High-performance
anion-exchange chromatography
G with pulsed amperometric
detector (HPAEC–PAD)
Gametangia, 140, 148f Hydrolysis, 201, 204–205
Gametes, 141–142 acid, 220
algal, 288–289 algal material, 189
axenicity test proof, 162f, 167–169 enzymatic, 255–256, 256t
from bacteria, 166–167 optimum, 201, 202t
density seaweed, 209
enrichment, 165–166 Hydroxyapatite chromatography,
measuring, 167 257–258
Ulva mutabilis, 475–476
Gametogenesis, 141, 161, 449
induction of, 143, 147–149, 165 I
in Laminaria, 39–40
Gametophytes, 159 Illumina MiSeq technology, 103
cultures, 42–43, 46–50 Immersion freezing in cryofixation,
growth rate, 122, 123f 382–383, 385f
Gas chromatography (GC), 280 Inorganic acid extraction, 255
GC–MS analysis, 292 Ion-exchange column, 257
data, 292–295
instrument, 286
K
parameters, 287
two-step-derivatization for, 291–292 Kelps, 62–75, 208
GenElute Plant Genomic DNA Miniprep gametophytes, 123f
Kit, 480 Kjeldahl, J., 217
Genetic-transformation system, 470 Kjeldahl method, 213, 214t, 217–218
488 Index

L Microalgae cells, 124

Microtubules (MTs), 366
Laminaran, 188 m-maleimidobenzoyl
Laminaria digitata, 190, 194f, 406f N-hydroxysuccinimide (MBS)
Laminariales life cycle, 39–41, 40f ester, 367
Laminarian seaweed, 5 MO BIO’s PowerSoil™ DNA Isolation Kit
Laminarian species, 7–8, 24 protocol, 101–102
Laminarin, 188 Monomerous thallus, 415f
in brown algae, 188–195 Mooring device, 20
G- and M-chain, 188f offshore farm, deployment, 23
Laser capture microdissection (LCM), system design, offshore seaweed
443–444, 449, 450f cultivation, 18
Leucosin, 188 MS (mass spectrometry) techniques, 280
Liquid chromatography–mass MTs (microtubules), 366
spectrometry (LC–MS) method, Mucilaginous polysaccharides, 382
190, 190f, 192–193, 228, 231, 232f,
233t, 235t
phytohormone in Pyropia yezoensis, 226 N
Liquid propane, 385
London Resin (LR) White resin, 328–329, Nitro blue tetrazolium (NBT), 271, 272f
394, 400–401 Nitrogen-to-protein (NTP)-conversion
Longline (backbone) system, 13, 13f factor, 213, 214t, 216, 220–221
Lowicryl resin, embedding protocol for, Noninducible gametogenesis (N.I.G.),
329–330 143t, 144
Lowry method, 215t, 216, 221–222 NREL (U.S. National Renewable Energy
Lowry, O. H., 221 Laboratory), 201
LR White resin. See London Resin (LR)
White resin
O
M Offshore aquaculture, 4, 27
Offshore farm deployment, 20
Maceration technique, 254–255 diving at farm site, 23–24
Macroalgae, 116, 470 under harsh conditions, 21f
brown, 368 mooring, 23
carbohydrates composition, 200–208 ropes, connections, and buoyancy,
cryopreservation, 79–90 22, 23f
marine, 454 of seaweed farm, 22f
mechanical/biomechanical vessel, 21
characterization, CW, 335–338 Offshore installations, multi-use, 29–31,
metal ecotoxicity on, 116–124 29f–30f
surface metabolites from, 309–315 Offshore-ring device, 14f, 15f
Macrocystis pyrifera, biochar, 180, 182f OM. See Optical microscopy (OM)
Mannuronan C5-epimerases O&M. See Operation and maintenance
(ManC5-Es), 456 (O&M)
Marine ecotoxicology, 115–116 Omics technique, 98
Marine macroalgae, 282, 454 Operational taxonomic unit (OTU),
Mass spectrometry (MS) techniques, 280 104–105
MBS (m-maleimidobenzoyl Optical microscopy (OM), 412–413,
N-hydroxysuccinimide) 420–422
ester, 367 Optimum hydrolysis times, 201, 202t
Metabolomics techniques, 280 Osmium tetroxide (OsO4), 381, 394
Metal contact in cryofixation, 382 OTU (operational taxonomic unit),
Meticulous site assessment parameters, 9 104–105
Index 489

P Prussian blue (PB) assay, 240, 243–245

PVS2 (plant vitrification solution 2), 82
Parthenosporophytes, 72, 73f, 74
PB (Prussian blue) assay, 240, 243–245
PBP. See Phycobiliproteins (PBP) Q
PBS (phosphate-buffered saline), 327
PCR. See Polymerase chain reaction (PCR) QIIME program, 103–104
PEG-mediated transformation in Ulva
mutabilis, 470–480
R
Peptide bonds, 212–213
Phaeophyceae, 368 Reactive nitrogen species (RNS), 268
Phenolic compounds, 238–239, 324, 382 Reactive oxygen species (ROS), 268
Phlorotannins, 238, 324 Red seaweeds (Rhodophyta), 200, 392
Phosphate buffer, 254, 382 Rhizoid cells, 161
Phosphate-buffered saline (PBS), 327 Rhodamine–phalloidin (R415) preparation,
Phosphoric acid, 239 369–370
Photosynthetic organisms, 31 RNA degradation, 430
Phycobiliproteins (PBP), 250, 254–258 RNA extraction methods, brown algae, 431t
Phycobilisome structure, 250–251, RNS (reactive nitrogen species), 268
250f, 252f ROS (reactive oxygen species), 268
Phycocyanin and phycoerythrin pigments ROS in marine macrophytes, 269–271,
extraction, 250–259 273–276
Phylogenetic Investigation of Communities DHE and DCFH–DA
by Reconstruction of Unobserved detection reaction mechanism
States (PICRUSt), 105–107, 107f using, 269–271
Phytohormones, 226–234, 235t quantification using, 273–274
with SPE, 229–230 histochemical localization,
stable isotope-labeled concentrations, 272f, 273–276
227, 227t NBT and DAB staining, 271
PICRUSt (Phylogenetic Investigation of Ruthenium red (RR), 330
Communities by Reconstruction
of Unobserved States),
S
105–107, 107f
Planktonic single-celled algae Saccharina japonica, 64
filtration, 288 Saccharina latissima, 7–8, 24, 25f, 38–39,
Plant cells, actin fluorescent 41–56
staining on, 367 fertile sorus of, 68f
Plant vitrification solution 2 (PVS2), 82 laminariales life cycle, 39–41, 40f
Polyethylene glycol (PEG), 258, 470 seedling production, 41
Poly-l-lysine-coated coverslips sporophyte, 39
preparation, 373 and parthenosporophytes, 73f
Polymerase chain reaction (PCR), 163 thallus of, 44f
amplification, 98, 102 Scanning electron microscopy (SEM),
cloning and transformation procedures, 412, 425f
457–458 CA for
fragment purification/digestion, 460 experimental procedures, 423–425
reaction mixture composition, 480t materials, 413
reagents, 164 micrographs, 412, 415f, 416f
and volumes, 168t Sea lettuce, 140
screening, 461–462 Seaweed-associated bacterial community,
test of axenicity, 168–169, 169f 96–98, 100
Polyphenols, 238 QIIME and PRIMER-E+PERMANOVA,
Prehydrolysis, 201, 204–205 106f
490 Index

Seaweed biomass, 175–182 SPE. See Solid-phase extraction (SPE)

extraction and pre-drying, 177, 180 Spirogyra pratensis, 442
TPC and antioxidant capacity analysis, Spontaneously inducible gametogenesis
237–247 (S.I.G.), 143t, 144
Seaweed cultivation Spore release methods, 66–69, 69f, 76
in high-energy environments Sporophytes, 43
conditions, 27f apogamic, 72
equipment and system design, collection of, 41, 43–45
13–18, 16f fertility, 75–76
land-based preparation, 8–9 collection and preparation, 66
problems and failures, 26–28, 28f key parameters, 44t
seeding procedure, 18–20, 19f Saccharina latissima, 39
site selection, 9–12 spores development, 54f
offshore-ring device, 14f Streptophyta, 441
Seaweed Energy Solutions (SES), 7 Styrofoam™, 407–408
Seaweed hydrolysis, 209 Swarming inhibitor (SWI), 141, 153–155
Seaweeds, subcellular topography of, 392–407 bioassay-guided cleanup, 145, 153
cryofixation, 393 extraction, 153
SEC (size-exclusion chromatography), sporulation and. See Sporulation and
150, 151f SWI purification from Ulva
Seeding procedure, 18–20, 19f SWEEDTECH project, 6
Seedling cultivation systems, 51f SWI. See Swarming inhibitor (SWI)
key parameters, 52t
under optimal conditions, 52–53
Seed supply and sporulation, 43–46 T
SEM. See Scanning electron
TEM (transmission electron microscopy), 382
microscopy (SEM)
Terminal restriction fragment length
SES (Seaweed Energy Solutions), 7
polymorphism (T-RFLP), 98
S.I.G. (spontaneously inducible
Time-lapse microscopy
gametogenesis), 143t, 144
cell-surface deformation monitoring,
Site selection, seaweed farm for,
355–359
9–10, 10f
living algal material preparation,
economic/technical/expansion
354–355
feasibility, 12
Toluidine blue O (TBO), 326, 326f, 330
information of local area, 10–11
Total phenolic content (TPC), 237–247
issues, 9
Toxicity test, 120–121
site-specific/oceanographic/water
algal material for spore release and,
quality parameter, 11–12
118–119
Size-exclusion chromatography (SEC),
on microalgae/adult macroalgal, 124
150, 151f
Trace metal cleaning techniques, 118–125
Solid-phase extraction (SPE),
Traditional controlled cooling-rate
227, 229–230, 231f, 282,
freezing, 79–80
289–290, 301–302, 314f
Transcriptomics, 429–430
Solid-phase surface extraction method,
Transgenic algae, 471
312, 313f
Transmission electron microscopy
Sori (sorus), 118, 119f
(TEM), 382
contamination from, 49
disinfection, dehydration, spore
release/counting, 42, 45 U
induction/collection of sporophytes,
41, 43–45 UCM (Ulva culture medium), 161
patches, 45 Ultramicrotome, 401
spore density, 46 Ultrasonic treatment, 255
Index 491

Ulva (chlorophyta), 140–155, 159, 160f V

culture, 142
axenic, 159–169 Vaucheria sessilis, cryophotomicrograph, 81f
Ulva culture medium (UCM), 161 Vector transformation, 470
Ulva mutabilis, 140, 146f Vitrification approach, 79, 79f, 81–82
gametes, 475–476
PEG-mediated transformation in, W
470–482
sporulation in, 143t Western blot analysis, 463, 465f
UNCLOS (United Nations Convention on Whitish fragments, 149
the Law of the Sea), 4
Undaria pinnatifida, 63–64 Z
United Nations Convention on the Law of
the Sea (UNCLOS), 4 Zoids, 476, 481
U.S. National Renewable Energy Zoosporogenesis, 159
Laboratory (NREL), 201 Zygnematophyceae, 441–442