Scribd
Upload
95 views54 pages

Review: 1. What Is The Difference Between Needham and Spallanzani's Experiment?

The document provides an overview of the key characteristics of living things: 1) All organisms are made of cells that reproduce through cell division. Organisms can be unicellular or multicellular. 2) Reproduction through sexual or asexual means allows for the continuation of species. Heredity through DNA ensures traits are passed down. 3) Living things grow, develop, metabolize energy through catabolism and anabolism, and adapt to their environments over time through the process of evolution.

Uploaded by

bae joohyun
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
95 views54 pages

Review: 1. What Is The Difference Between Needham and Spallanzani's Experiment?

The document provides an overview of the key characteristics of living things: 1) All organisms are made of cells that reproduce through cell division. Organisms can be unicellular or multicellular. 2) Reproduction through sexual or asexual means allows for the continuation of species. Heredity through DNA ensures traits are passed down. 3) Living things grow, develop, metabolize energy through catabolism and anabolism, and adapt to their environments over time through the process of evolution.

Uploaded by

bae joohyun
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 54

Review

1. What is the
difference between
Needham and
Spallanzani’s
experiment?
2. What made
Pasteur’s experiment
successful?
3. Who conducted the
following experiment?

A. Redi
B. Needham
C. Spallanzani
D. Pasteur
4. Who conducted the
following experiment?

A. Redi
B. Needham
C. Spallanzani
D. Pasteur
5. What is being simulated in the
portion of Millers experiment that is
marked II?

A. lightening bolts
B. the atmosphere
C. the water cycle
D. standing water
Objectives:
• Identify the characteristics of living
things
• Distinguish between homeostasis &
metabolism and between growth,
development & reproduction
IT’S ALL ABOUT YOU
(Characteristics of Life)

UST Senior High School


Earth and Life Science
Guide Question:
•What distinguishes living
from non living things?
WHAT IS
LIFE???
Group work (5 mins)

List down what you think are the


characteristics of life. What makes
a living organism living?
What are the
characteristics of a
LIVING ORGANISM?
All Organisms are made of Cells

 Cells are the smallest/basic


living unit of an organism
 Cells are complex & highly
organized
Cells have parts called
organelles that do different
jobs
e.g. Chloroplasts in plants
make sugars
All Organisms are made of Cells

 The simplest cells are


called Prokaryotes
 These cells DO NOT have
a nucleus or membrane-
bound organelles
 Bacteria
All Organisms are made of Cells

 More complex cells are


called Eukaryotes
 These cells DO have a
nucleus and membrane-
bound organelles
 Plants, animals, protists, &
fungi
All Organisms are made of Cells

Unicellular Organisms
 Living Organism Made Up Of One Cell

Multicellular Organisms
 Living Organism Made Up Of Many, Specialized
Cells
Organization of Life: It’s All a Hierarchy
atom  biosphere
 living organisms are now
classified into six kingdoms
(Bacteria, Archaea, Protista,
Plantae, Fungi and Animalia) that
are divided into three domains
(Bacteria, Archaea and Eukarya)
Reproduction: Continuation of Life

 production of new cells


from cell division
 production of new
individuals, either sexually or
asexually which is necessary
for the perpetuation of the
existence of species
Reproduction: Continuation of Life
 SEXUAL
- use of two individuals
contributing their sex cells to
produce a unique individual of
their kind

 ASEXUAL
- an organism makes copies of
itself
- common in lower life forms
Heredity: Unity Amidst Diversity

➢ DNA
(deoxyribose nucleic
acid) carries the
genetic code for all
organisms
➢ All organisms
contain DNA
Heredity: Unity Amidst Diversity

➢ DNA
- molecule of life that
carries the instruction
for assembling
protein that is
responsible for
variations (eye, hair
or skin color)
Growth & Development: It’s Inevitable
 GROWTH
- increase in all parts of
the body brought about
by increase in tissues,
coupled with cell division
or cell enlargement
 DEVELOPMENT
- defined stages in an
organism’s life cycle
which are accompanied
by changes
Metabolism: Gathering and Using Energy

 chemical and physical reactions


within the body that allows organisms
to grow and maintain its structures
 enables organisms to acquire energy
and nutrients in order to sustain
themselves
 nutrient uptake, processing and waste
elimination
Metabolism: Gathering and Using Energy
 Catabolism
- breaking down of organic matter to
harvest energy and molecules
Ex. digestion

 Anabolism
- use of energy to build up
molecules
Ex. photosynthesis
Irritability: Hello, stimuli!

 capability of an organism
to respond to stimuli or
external factors like light,
temperature, pressure, sound,
presence of chemical
substances, food sources,
etc.
Irritability: Hello, stimuli!

 Once a stimulus has been


received by the organism, that
triggers a response.
 Lower organisms (lacking
complex sensory organs)
undergo types of taxis.
 Phototaxis, Hydrotaxis,
Chemotaxis, Geotaxis etc.
Irritability: Hello, stimuli!

 Higher organisms (with complex


sensory organs) undergo
behaviors often using chemical
messengers (called hormones)

 Conditioning, Imprinting, Insight


learning, etc.
Adaptation: Survival of the Fittest

- capability of an organism
to make adjustments to
changes in the
environment

- fundamental process in
evolution which led to
diversity of life
Adaptation: Survival of the Fittest

- Adapted to extremes
- Animal intelligence
- Behavioral pattern
Adaptation: Survival of the Fittest

- Communication and
senses
Motility: Keep it movin’

 possible with the use of


locomotory organs
examples: microorganisms (cilia,
flagella, pseudopods); plants
(tendrils, shoots, flowers):
animals/humans (limbs, wings,
fins/flippers)

 organisms tend to move in search


for food, reproduction and response
to the changing environment
Homeostasis: Keeping it Balance

- ability of an organism to
maintain a constant internal
environment despite the
changes in the external
environment

- examples: sweating, goose


pimples / goosebumps, ear-
popping, shivering
Homeostasis: Keeping it Balance
- Positive Feedback loop: accelerates or enhances
the output created by a stimulus that has already
been activated.
- Blood clotting, Oxytocin release during birth
Homeostasis: Keeping it Balance

- Negative Feedback
loop: reducing the
output or activity of
any organ or system
back to its normal
range of functioning
- Shivering/Sweating,
Blood Pressure
Evolution: Change is Permanent

 EVOLUTION
- Changes in characteristics of a group of organisms over time
 EVOLUTIONARY ADAPTATION
- gradual or rapid change in body structure or behavior to be suited and to survive a
new environment
Evolution: Biochemistry
• The basic similarity of all living things
suggests that they evolved from a single
common ancestor.

• As we have already seen, all living


things pass on information from
generation to generation using the DNA
molecule.
DNA for
Information
Transfer
Evolution: Similar Genes

• Comparison of the human genetic code with that of other


organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans


Evolution: Comparative Anatomy

• Similar comparisons can be


made based on anatomical
evidence.

• The skeleton of humans and


gorillas are very similar
suggesting they shared a recent
common ancestor.

Human and Gorilla


Evolution: Homology

• The pentadactyl
limb is ancestral to
all vertebrates… but
modified for
different uses.
Evolution: Vestigial Structures

• As evolution progresses,
some structures get side-
lined as they are not longer
of use. These are known as
vestigial structures.

The coccyx is a vestigial tail


Evolution: Fossil Record

origins bacteria complex cells dinosaurs humans

• The fossil record shows a sequence from simple


bacteria to more complicated organisms through time
and provides the most compelling evidence for
evolution.
Evolution: Transitional fossils

• Many fossils show a clear


transition from one species, or
group, to another.

• Archaeopteryx was found in


Germany in 1861. It share
many characteristics with
Archaeopteryx
both dinosaurs and birds.
Evolution: Geography

Marsupials

• Geographic spread
of organisms also
tells of their past
evolution.
That’s all!

You might also like