EARTH AND LIFE SCIENCE

Hand Out # 3 (2nd Quarter)

EVOLUTION OF LIVING THINGS

THE TREE OF LIFE

• All living things share a common ancestor.
• We can draw a Tree of Life to show how every species is related.
• Evolution is the process by which one species gives rise to another and the Tree of Life grows
EVOLUTION
 Evolution refers to a change over time. Organic Evolution is the process by which modern organisms
have descended from ancient organisms.
 A scientific theory is a well-supported testable explanation of phenomena that have occurred in the
natural world.
Evolution as Theory and Fact
o Confusion sometimes arises as to whether Evolution is a theory or a fact. Actually it is both!
o The theory of Evolution deals with how Evolution happens. Our understanding of this process is always
changing.
o Evolution is also a fact as there is a huge amount of indisputable evidence for its occurrence.
THEORIES OF EVOLUTION

 FIXED SPECIES
o From Classical times until long after the Renaissance, species were considered to be special
creations, fixed for all time
 CAROLOUS LINNAEUS
o Father of taxonomy (differentiate classical taxonomy and modern taxonomy)
 THOMAS MALTHUS
o Believed that populations grow geometrically while resources slowly increase or not at all,
leading to competition
 JEAN BAPTISTE DE LAMARCK
o First to propose about the theory of evolution: Theory of inheritance of acquired traits and
Theory of use and disuse
o Physiological needs drive Lamarckian evolution
o Defined evolution as process of increasing complexity
o No extinction of species. Species disappeared because they just evolved into different species.
o Organisms adapt to evolve
 TRANSMUTATION
o Around 1800, scientists began to wonder whether species could change or transmute.
o Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it
onto its offspring.
o Hence giraffes got their long necks through generations of straining to reach high branches.
 GEORGES CUVIER
o Established extinction through fossils
o Believed that the earth was immensely old
o Catastrophes caused that each one wiped out a number of species
o Didn’t believe organic evolution because of the mummified cats.
 JAMES HUTTON
o Proposed theory of gradualism (Slow subtle processes could cause substantial change over time)
o Great age of the earth
 CHARLES DARWIN
o Explained evolution through: Natural Selection, Idea of Common Descent, Idea of Gradualism,
Idea of Multiplication of species
o Organisms evolve to adapt.
 DARWIN’S VOYAGE
o From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle.
o He was dazzled by the amazing diversity of life and started to wonder how it might have
originated
o SURVIVAL OF THE FITTEST
 In his Origin of Species, published in 1859, Darwin proposed how one species might give
rise to another.
  Where food was limited, competition meant that only the fittest would survive.
 This would lead to the natural selection of the best adapted individuals and eventually
the evolution of a new species.
 GREGOR MENDELL
o Studied garden peas
o Responsible for the: Law of segregation (two alleles for each gene separate during gamete
formation) and Law of Independent Assortment (alleles of genes on non homologous
chromosomes assort independently during gamete formation)
 GENETICS
o From 1856-63, a monk called Gregor Mendel cultivated 29,000 pea plants to investigate how
evolutionworked i.e., how characteristics were passed down the generations.
o He figured out the basic principles of genetics. He showed that offspring received characteristics
from both parents, but only the dominant characteristic trait was expressed. Mendel’s work only
came to light in1900, long after his death
 CHARLES LYELL
o .Proposed the theory of uniformitarianism (natural agents now at work on and within the Earth
have operated with general uniformity through immensely long periods of time)
 ALFRED RUSSEL WALLACE
o Had a correspondence with Darwin regarding the theory of evolution by mean of Natural
selection
o Realized that species evolved because fittest individuals survived and reproduced passing their
advantageous characters.
 HUGO DE VRIES
o Rediscovered Mendel’s work
o Thought of theory of mutation but his idea of mutation before has nothing to do with the real
mutations
 CARL CORRENS
o Rediscovered Mendel’s work
o Worked on the Behavior of the Progeny of Racial Hybrids
 ERICH VON TSCHEMAK
o Rediscovered Mendel’s work
o Applied Mendial laws to artificial selection to improve crop yield
 ROSALIND FRANKLIN
o One of the few women during their time to be recognized for her contribution in the scientific
community.
o Worked on the x-ray diffraction image of the DNA. X-ray crystallography picture of the DNA
that time were not pictures of molecules.
o The spots were produced by diffracted x-rays from the fibers of a purified DNA.
 DNA ( Watson and Crick)
o The double-helix structure of DNA was discovered in 1953. This showed how genetic
information is transferred from one cell to another almost without error.
 MUTATION
o However, occasional mutations or copying errors can and do occur when DNA is replicated.
o Mutations may be caused by radiation, viruses, or carcinogens.
o Mutations are rare and often have damaging effects. Consequently organisms have special
enzymes whose job it is to repair faulty DNA.
 VARIATION
o Nevertheless, some mutations will persist and increase genetic variation within a population.
o Variants of a particular gene are known as alleles.
o For example, the one of the genes for hair color comprises brown/blond alleles.
 Artificial Selection vs. Natural Selection
o Artificial selection- process of selecting and breeding of animals and plants over many
generations to achieve the modifications desired by human beings..
o Caused the production of individuals used for crops, livestock, pets that resemble wild ancestors
o Instead of nature serving as the selecting factor, its humans that select which organisms will be
used for breeding depending on to the traits they want to improve.
o Can take effect faster than natural selection, though follows the same principle as natural
selection where favorable traits will be more frequent in a population while less favorable traits
will diminish
 NATURAL SELECTION
o Differential in rates of survival is dependent on individual’s heritable traits suited in the
environment
o An organisms compatibility with its surrounding is increased by natural selection over time.
o A change in environment (or movement of individuals to new environment) may cause a species
to give rise to a new species depending on the traits that will be favored by the new environment
o The traits that help an organism survive in a particular environment are “selected” in natural
selection
 The Struggle for Existence-members of each species have to compete for food, shelter, other life
necessities
 Survival of the Fittest-Some individuals better suited for the environment
 ARTIFICIAL SELECTION
o Nature provides variation; humans select variations that are useful.
o Example - a farmer breeds only his best livestock
 MICROEVOLUTION
o The dog is another example of how selection can change the frequency of alleles in a population.
o Dogs have been artificially selected for certain characteristics for many years, and different
breeds have different alleles.
o All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of
Microevolution as no new species has resulted.
 MACROEVOLUTION
o However, if two populations of a species become isolated from one another for tens of thousands
of years, genetic difference may become marked.
o If the two populations can no-longer interbreed, new species are born.
o This is called Macroevolution.
o Darwin’s Galapagos finches are an example of this process in action.
EVIDENCES
 EVIDENCE 1: Biochemistry
o The basic similarity of all living things suggests that they evolved from a single common
ancestor.
o As we have already seen, all living things pass on information from generation to generation
using the DNA molecule.
o All living things also use a molecule called ATP to carry energy around the organism.
 EVIDENCE 2: Similar genes
o HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
o CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
o GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

• If evolution is true then we might also expect that closely related organisms will be more similar to one
another than more distantly related organisms.
• Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly
genetically identical (differ by less than 1.2%) whereas the mouse differs by ≈15%.

 EVIDENCE 3: Comparative Anatomy

o Similar comparisons can be made based on anatomical evidence.
o The skeleton of humans and gorillas are very similar suggesting they shared a recent common
ancestor
 EVIDENCE 4: Homology
o The penta dactyl limb is ancestral to all vertebrates…but modified for different uses
 EVIDENCE 5: Vestigial Structures
o As evolution progresses, some structures get side-lined as they are not longer of use. These are
known as vestigial structures.
o The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid
balance and climbing. Another vestigial structure in humans is the appendix.
 EVIDENCE 6: Fossil Record
o The fossil record shows a sequence from simple bacteria to more complicated organisms through
time and provides the most compelling evidence for evolution.
o Evolution of Man
  Australopithecus Afarensis
 Homo habilis = handy human 1.5 to 2 mya
 Homo Erectus 1.6 m.y.a

 Neanderthals35,000 to 100,000 ya
 Cro-Magnon35,000 to 40,000 ya
Differences among Organisms
o Adaptation: a characteristic that helps an organism survive and reproduce in its environment
o Adaptations can be physical, such as a long neck on a giraffe or striped fur
o Adaptations may be behaviors that help an organism find food (like hunting at night), protect itself (skunk
spraying noxious smell), or reproduce
 Species: group of organisms that can mate with one another to produce fertile offspring
Do Species Change Over Time?
o The species that live on Earth today range from single-celled bacteria to multicellular fungi, plants, and
animals
o Scientists think that Earth has changed a great deal during its history, and that living things have changed,
too
o Earth is estimated to be 4.6 billion years old
o Many species have existed over time, and many have died out
Evidence of Ancestry
o The fossil record provides evidence about the order in which species have existed
o Scientists observe that all living organisms have characteristics in common and inherit characteristics in
similar ways
o Scientists believe that all living species descended from common ancestors
o -evidence of this is found in fossils and in living organisms
o Scientists examine the fossil record to figure out the relationship between extinct and living organisms
o Models may be drawn to show how several species were once related
Examining Organisms
o This ancestor was probably a mammal that lived on land between 50-70 million years ago
o Examining an organism carefully can give scientists clues about its ancestors
o Example: Whales seem very similar to fish, but whales have live young and breathe air, which makes
o them a mammal. These traits show scientists that whales evolved from ancient mammals.
 These structures do not look alike and are not used in the same way
 Under the surface there are similarities
 These similarities suggest that cats, dolphins, bats, and humans had a common ancestor