Scribd
Upload
301 views

Activity 1.3.1: Student Response Sheet: PART A-Restriction Enzymes

PLTW 1.3.1

Uploaded by

Riley McCafferty
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
301 views

Activity 1.3.1: Student Response Sheet: PART A-Restriction Enzymes

PLTW 1.3.1

Uploaded by

Riley McCafferty
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 3

Activity 1.3.

1: Student Response Sheet


PART A- Restriction Enzymes
Restriction enzymes are a tool that allows us to pinpoint human identity down to single
differences in our DNA. Work through the following simulation so you can see these
molecular scissors in action.

Find out more about restriction enzymes by viewing the animation listed below.

o Dolan DNA Learning Center: Restriction Enzymes


http://www.dnalc.org/ddnalc/resources/restriction.html

1. Each enzyme recognizes a very specific sequence in DNA.

For example, the enzyme PstI recognizes the sequence:

CTGCAG
GACGTC

The enzyme scans DNA for this sequence and makes a cut as indicated by the arrows.

Visit the list of restriction enzymes found at the bottom of the page on
http://en.wikipedia.org/wiki/Restriction_enzymes. Find the unique sequence
(restriction site) that is recognized by EcoRI and by HindIII. Write the double-stranded
sequence below and draw an arrow between the base pairs to indicate where the
enzyme would make its cut.

EcoRI: HindIII:

GAATTC AAGCTT
CTTAAG TTCGAA

2. What do you notice about each restriction site? What does the word palindrome
mean?

I noticed that the restriction sites read the same forward as they do backwards. The
word palindrome means that DNA or RNA reads the same in both directions.

© 2019 Project Lead The Way, Inc.


Human Body Systems Activity 1.3.1 Student Response Sheet – Page 1
3. Using the information above, digest the DNA samples for Person 1 and Person 2
using EcoRI. Scan the strand for the restriction site and draw an arrow any place this
enzyme would make a cut. Beneath each strand indicate the number of fragments that
would be created and also the size of each fragment. The size of a fragment is
determined by counting the number of bases on the top strand of each fragment and is
recorded in bases. Some of the pieces will have bases overhanging the edge (sticky
ends). For example, for a piece that looks like

ATTCAACCC
GTTGGGAA

the size of the fragment would be listed as 9 base pairs (9 bp).

Person 1:

GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT


CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA

Number of restriction fragments (pieces of DNA after digestion): _____4____

Size of restriction fragments (count the number of bases on the top strand of each
fragment) - listed from largest to smallest

21, 15, 11, 9________________________________________________________

Person 2:

CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG


GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC

Number of restriction fragments (pieces of DNA after digestion): ____4_____

Size of restriction fragments (count the number of bases on the top strand of each
fragment) - listed from largest to smallest

17, 16, 14, 8

PART B: Gel Electrophoresis of Restriction Fragments

© 2019 Project Lead The Way, Inc.


Human Body Systems Activity 1.3.1 Student Response Sheet – Page 2
After you have reviewed the principles of electrophoresis, use what you know to
complete the following:

1. “Run” your restriction fragments from both Person 1 and Person 2 on the gel drawn
below. Use the DNA marker lane to help you draw in the bands you would see in each
lane of the gel.

2. Place a large “+” on the end of the gel diagram where the positive electrode would
go. Place a large “-“ on the end of the gel diagram where the negative electrode would
go. Using what you know about the structure of DNA, explain why this placement is
crucial to separating the fragments.
The placement is important to dividing the fragments because the smaller
fragments reach the bottom quicker than the fatter the fragments.

3. Use an asterisk (*) to indicate the smallest fragment shown on the gel.

4. Compare the DNA fingerprint of Person 1 and Person 2. Explain how this fingerprint
would have looked different if you had digested the DNA of each person with HindIII
instead of EcoRI.
It has a negative charge so if you were to put it (the gel) on the positive end, it wouldn’t
have to move so much or little so the gel would get the positive charge.

© 2019 Project Lead The Way, Inc.


Human Body Systems Activity 1.3.1 Student Response Sheet – Page 3

You might also like