Forensic DNA Testing

Maj Gen (R) Suhaib Ahmed, HI (M)

DNA from no two individuals except identical twins is alike. The person to person
differences in DNA can be discovered by PCR amplification and genomic sequencing.
The main advantages of DNA typing are the universality of application, an almost
unlimited power to discriminate, extreme sensitivity, and reasonable resistance to
degradation by environmental factors. The typing of DNA can be used in:

• Linking a suspect to a crime

• Excluding a falsely accused person
• Recognizing serial crimes
• Resolving parentage disputes
• Identification of the remains of victims

The differences in DNA are either in the form of variable number of tandem repeats
(VNTR) or single nucleotide polymorphisms (SNP). Approximately 20% of the human
genome comprises tandem repeat sequences. These are called micro-satellites or short
tandem repeats (STR) when the repeats are 2-6bp in length. When the repeat sequences
are 7-80bp in length these are called mini-satellite or variable number of tandem repeats
(VNTR). The number of STR repeat units tends to vary between individuals. This
variation (polymorphism) makes them extremely useful in applications like human
identification and linkage analysis for diagnosis of genetic disorders.

STR analysis:
There are over a million sites (loci) in the human genome that have STRs of which over
20,000 have been characterized. Considering the highly polymorphic nature and the ease
with witch the STRs can be analyzed these provide an extremely powerful tool for human
identification. The discrimination power of STRs increases with increase in the number
of loci tested. Therefore it is usual to use a battery of STRs. The repeat sequence of STRs
range from 2-6bp. Due to technical reasons four base pair (tetra-nucleotide) repeats are
best suited for forensic case work.

STR loci
The STRs are mostly located in the non-coding DNA between the genes (inter-genic
DNA). Some STRs are also present in the intervening sequences (introns) of known
genes. The STRs found in the inter-genic DNA are named according to the chromosome
number and the site. For example in the name “D5S818” “D” stands for DNA, “5” is the
chromosome number, “S” stands for single copy sequence and “818” is the locus number.
The STRs in the introns of the known genes are identified by their location e.g. TH01 is
present in the intron-1 of human tyrosine hydroxylase gene and TPOX is located in the
thyroid peroxidase gene.
1

Forensic DNA Testing

In a typical tetra-nucleotide STR the repeat units comprise four base pairs. For example
an STR with “GATA” repeat would look like:

GTATCCTTATGTAATATTTTGAAGATAGATAGATAGATAGATAGATAGATA
GATAGATAGATAGATAGGTAGATAGAGGTATAAATAAGGATACAGATATAG

Autosomal STRs
In most forensic DNA applications STRs located on autosomes are used. A list of 15 core
STR loci and their chromosomal locations are shown in Table 16.1
(Short Tandem Repeat DNA Internet DataBase).

Table. 16.1. Core STR loci used in forensic DNA testing.

Name Chromosome Location Type GenBank

TPOX 2p23-2pter Intron 10 of human thyroid Simple M68651
peroxidase gene
D3S1358 3p21 - Complex 11449919
FGA 4q28 Intron 3 of alpha fibrinogen Complex M64982
gene
D5S818 5q21-q31 - Simple G08446
AC008512
CSF1PO 5q33.3-34 c-fms proto-oncogene for CSF- Simple X14720
1 receptor gene
D7S820 7q - Simple G08616
AC004848
D8S1179 8q24.1-24.2 - Simple GO8710
AF216671
Th01 11p15-15.5 Intron 1 of human tyrosine Complex D00269
hydroxylase gene
vWA 12p12-pter Gene for von Willebrand Complex M25858
antigen.
D13S317 13q22-q31 - Simple G09017
AL353628.2
D16S539 16q22-24 - Simple G07925
AC024591.3
D18S51 18q21.3 - Simple X91254
AP001534
D21S11 21q21.1 - Complex M84567
AP000433
D2S1338 2q35 - Complex AC010136
G08202
D19S433 19q12 - Complex G08036
AC008507.6

Forensic DNA Testing

Y-Chromosome STRs
Several STRs have also been identified on Y-chromosome. These are useful in tracing
male DNA in investigations like sexual assault. These may also be used in investigation
of paternal lineage inheritance. A list of 15 Y-STR markers available as a commercial kit
(Applied Biosystems) is shown in Table 16.2 (Short Tandem Repeat DNA Internet
DataBase).

Table. 16.2. Fifteen Y-STRs available as a commercial kit (Applied Biosystems, USA)

Locus Repeat Repeat Motif GenBank Reference

Numbers Accession Allele
DYS19 10-19 TAGA AC017019 15
DYS385 a/b 7-28 GAAA AC022486 11
DYS389 I DYS389I: 9-17 (TCTG) (TCTA) AC004617 12, 29
DYS389 II DYS389II:24-34 (TCTG) (TCTA)
DYS390 17-28 (TCTA) (TCTG) AC011289 24
DYS391 6-14 TCTA AC011302 11
DYS392 6-17 TAT AC011745 13
DYS393 9-17 AGAT AC006152 12
DYS437 13-17 TCTA AC002992 16
DYS438 6-14 TTTTC AC002531 10
DYS439 9-14 AGAT AC002992 13
DYS448 20-26 AGAGAT AC025227 22
DYS456 13-18 AGAT AC010106 15
DYS458 13-20 GAAA AC010902 16
DYS635 17-27 TSTA compound AC004772 23

STR allele nomenclature

The STR alleles are named according to the number of repeat units it contains e.g. 7, 8, 9,
10, 11 etc. Some STRs are more complex than simple repeats. The complexity may be
present both in the sequence as well as the number of bases in the repeat unit. The
variation in sequence of the repeats can be found only by genomic sequencing. However,
the variation in number of bases in a repeat results in different sizes that can be picked on
gel electrophoresis. For example at the TH01 locus allele 9 has nine simple repeats i.e.
[AATG]9. Another allele at the same locus has an additional triplet i.e.
[AATG]6ATG[AATG]3. The resulting allele is 3bp longer and is written as 9.3. The
D21S11 locus contains numerous complex alleles like 32.1, 32.2 etc. The complex loci
being more polymorphic are more informative.
The STRs are inherited in a simple Mendelian fashion. An individual inherits an allele
each from its father and the mother. A person may be homozygous (the same allele on the
maternal and the paternal chromosomes) or compound heterozygous (different alleles on
the two chromosomes). A typical STR profile comprising genotypes at several loci is
shown in Table 16.3.

Forensic DNA Testing

Table 16.3. The STR profile at various loci in individuals A, B, and C.

Individuals D3S1358 D5S818 D7S820 D8S117 D21S11 TH01 TPOX

A. 15,18 12,12 9,10 12,16 28,29 7,9 9,11
B. 14,14 10,12 8,10 11,15 30,32.2 7,9.3 8,11
C. 15,17 10,10 9,11 13,15 29,32.2 8,10 8,11

Allele frequencies
In a given population the STR allele frequencies are calculated by simple counting. Each
individual has two alleles at each locus. Genotyping of 100 individuals from a population
would mean examination of 200 chromosomes (alleles). Each allele of a compound
heterozygote is counted as one and homozygotes are counted as two. For example if
20/100 people have allele 8, including 2 homozygotes (8,8), the frequency of allele 8
would be 18+2+2 = 22/200 i.e. 11% or 0.11.

Minimum allele threshold

In a population survey the uncommon or the rare alleles are expected to have an under-
representation. In order to overcome this problem it has been recommended to inflate the
frequency of rare alleles (<5 counts) to 5. The 5/2N formula is used for this purpose
where N is the number of individuals examined. The N is doubled because each
individual has two chromosomes (alleles). For example if allele 12 is observed in 2/100
people its frequency by the conventional method would be 2/200 = 1% (0.01). However,
by the 5/2N formula its frequency would be 2.5% (0.025).

Genotype frequencies
The allele combination in an individual at a locus is called its genotype e.g. “7,10” or
“7,7” etc. The number of possible genotypes increases with an increase in the number of
alleles. The possible genotypes can be calculated by the formula [n(n+1)/2] where n is the
number of different alleles found in the population. The observed genotype frequencies
are calculated by simple counting. The expected genotype frequencies can be calculated
from the observed allele frequencies by using Hardy Weinberg equation (p2 + q2 + 2pq =
1). The homozygotes of two alleles with frequencies of p and q would be equal to p2 and
q2 respectively while the heterozygotes (compound heterozygotes) would be equal to 2pq.

Example
Table 16.4 describes an example of calculation of expected genotype frequencies of
alleles 10 and 11 with observed frequencies of p and q respectively.

Table 16.4. The expected genotypes of two alleles at D5S818 locus.

D5S818 Frequency p2 q2 2pq

Allele 10 p = 0.108 0.0117 - 0.0687
Allele 11 q = 0.318 - 0.101 0.0687

Forensic DNA Testing

Profile frequencies
The STR profile of an individual is the combination of genotypes at several loci. Larger the
number of loci tested rarer would be the combination in the population. The frequency of a
profile is calculated by the multiplication rule. The individual genotype frequencies are
multiplied to get the combined frequency (see example). The combined frequency of 15
core STR loci in the US Caucasian population is 1 in 2.46 quadrillion (1015).
Example
Table 16.5 gives an example of how a profile frequency can be calculated from various
allele and genotype frequencies.

Table 16.5. Example of calculation of profile frequency from the genotype frequencies in a
given population.

Loci Alleles Allele frequency p2 q2 2pq

D3S1358 15 p = 0.299 0.0894 - 0.0466
18 q = 0.078 - 0.0061 0.0466
D5S818 10 p = 0.108 0.0117 - 0.0687
11 q = 0.318 - 0.1011 0.0687
D8S1179 12 p = 0.103 0.0107 - 0.0132
16 q = 0.064 - 0.0041 0.0132
D21S11 30.2 p = 0.059 0.0035 - -
30.2 - - - -
Profile Profile frequency
D3 & D5 0.0466 X 0.0687 = 0.0032 (1 in 312)
D3, D5 & D8 0.0466 X 0.0687 X 0.0132 = 0.000042 (1 in 23,809)
D3, D5, D8 & D21* 0.0466 X 0.0687 X 0.0132 X 0.0035 = 0.00000015 (1 in 6666,666)
*additional loci can also be added to this calculation

Forensic calculations and consanguineous marriage

Hardy-Weinberg equation for the calculation of expected genotype frequencies is for
populations where mating is random. In a population where consanguineous marriage and
marriage between tribe members is very common, the population has several substructures
(smaller groups). Therefore Hardy-Weinberg equation would not be applicable as such.
The main genetic effect of consanguineous marriage is an increase in the proportion of
homozygotes and a corresponding reduction in the hetrozygotes. The increase in
homozygotes as compared to Hardy-Weinberg proportions is by an amount Fpq, while
heterozygotes are reduced by 2Fpq where F is the inbreeding coefficient, and p and q are
the frequencies of the alleles under consideration.
Homozygotes = p2 + Fpq or q2 + Fpq
5

Forensic DNA Testing

Heterozygotes = 2pq (1 - F)
The coefficient of inbreeding is the probability that an individual receives at a given locus
two genes that are identical by descent (copies of a single gene carried by a common
ancestor). The value of F for a first cousin marriage is 0.0625 i.e. 6.25% of the genes are
identical by descent. In 1½ cousin and 2nd cousin marriage F is 0.0313 and 0.0156
respectively. The average coefficient of inbreeding in the Pakistani population is 0.0280
that may be as high as 0.0350 in selected populations/tribes.
Example
The correction for consanguineous marriage applied to the genotype and profile
frequency on the example shown in table 16.5 is presented in table 16.6.

Table 16.6. Example of correction for consanguineous marriage applied to the genotype
and profile frequency of the example presented in Table 16.5.

Loci Alleles Allele frequency p2 + Fpq q2 + Fpq 2pq (1 - F)

D3S1358 15 p = 0.299 0.0900 - 0.0453
18 q = 0.078 - 0.0068 0.0453
D5S818 10 p = 0.108 0.0127 - 0.0668
11 q = 0.318 - 0.1021 0.0668
D8S1179 12 p = 0.103 0.0109 - 0.0128
16 q = 0.064 - 0.0059 0.0128
D21S11 30.2 p = 0.059 0.0036* - -
30.2 - - - -
Profile Profile frequency
D3 & D5 0.0453 X 0.0668 = 0.00303 (1 in 330)
D3, D5 & D8 0.0453 X 0.0668 X 0.0128 = 0.000039 (1 in 25,641)
D3, D5, D8 & D21 0.0453 X 0.0668 X 0.0128 X 0.0036 = 0.0000014 (1 in 7142,857)
* p2 + Fp(1-p)

Mutations in STRs
Genomic DNA is liable to develop spontaneous mutations with the passage of time. In
fact the existence of highly polymorphic STRs in the genome is thought to be due to
spontaneous mutations that is a fairly regular event. The STR mutations become
significant if these are encountered in solving a case of inheritance.
The rate of spontaneous mutations at the STR loci ranges from 1 in 500 to 1 in 1000. The
rates of mutations at the core STR loci used in forensic DNA testing are given in Table
16.7. A mutation may be suspected if a disagreement is found between alleles of the
parents and the offspring at one odd locus out of the several tested. The mutation can be
confirmed by genomic sequencing. It may be pointed out that matching between DNA
samples from a crime scene and a suspect would not be affected by mutations in the STR
loci.

Forensic DNA Testing

Table 16.7 Mutation rates at the STR loci commonly used in forensic DNA testing.

STR Loci Mutation Rate STR Loci Mutation Rate STR Loci Mutation Rate
CSF1PO 0.16% D3S1358 0.12% D16S539 0.11%
FGA 0.28% D5S818 0.11% D18S51 0.22%
TH01 0.01% D7S820 0.10% D21S11 0.19%
TPOX 0.01% D8S1179 0.14% D2S1338 0.12%
VWA 0.17% D13S317 0.14% D19S433 0.11%

Core STR loci used in human identification

The core STR loci are sets of DNA markers that are globally accepted for human
identification (Table 16.8). The uniformity is adopted to share and compare genetic
information between different labs and the legal systems. The loci have been carefully
selected to avoid their linkage with any physical character or genetic disease. In addition
to the STRs a marker for sex determination, usually Amelogenin, is also included in the
profile.

Table 16.9 Core STR loci required by various countries and the legal systems.

Countries Core STR Loci

US CSF1PO, FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820,
D8S1179, D13S317, D16S539, D18S51, D21S11, Amelogenin
UK/European FGA, TH01, vWA, D2S1338, D3S1358, D8S1179, D16S539,
D18S51, D19S433, D21S11, Amelogenin
Recommended Loci: D1S1656, D2S441, D10S1248, D12S391,
D22S1045, TPOX
Interpol FGA, TH01, vWA, D3S1358, D8S1179, D18S51, D21S11,
Amelogenin

COmbined DNA Index System (CODIS)

United States Federal Bureau of Investigation has created a database, called CODIS, that
stores the DNA profiles of convicted offenders and the biological material found at crime
scenes. The database contains DNA profiles comprising 15 STR loci including CSF1PO,
D2S1338, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51,
D19S433, D21S11, FGA, THO1, TPOX, vWA and Amelogenin to determine sex.
Inclusion of profiles in the CODIS database is authorized by the DNA Identification Act
of 1994. At present over 5 million entries exist in the database making it the largest in the
world. It has helped in over 93,000 criminal investigations.

Forensic DNA Testing

Single Nucleotide Polymorphisms (SNP)
SNPs are DNA sequence variations that are distributed throughout the genome and are
found after every 300 to 500 base pairs. Almost all SNPs have two alleles. By convention
the base change is called polymorphism when the frequency of its alleles in a population
is more than 1%. SNPs are present in the non-coding as well as the coding sequences of
DNA.
The SNPs are identified by restriction enzyme analysis and gel electrophoresis (Chapter
8). More recently real time PCR is being used to analyze multiple SNPs in a single tube
by multiplex allele specific probes. The automated SNP genotyping by micro arrays also
allow analysis of very large number of SNPs on a single gene chip. The later has
potential for human identification applications like investigation of mass disasters.
Mitochondrial DNA
Each mitochondrion contains 2-10 copies of a circular piece of DNA, 16,569 base pairs
in length. It is inherited from the mother. Mitochondrial DNA contains two hyper
variable regions (HV1 and HV2) that contain many SNPs. The regions can be amplified
and sequenced. Since mitochondrial DNA is inherited from the mother it can be useful in
tracing maternal inheritance. Mitochondrial DNA can be extracted from structures like
hair shafts, old bones and teeth etc.
PCR for sex determination
Determination of sex is an essential part of human identification by DNA test. Most
commonly it is done by amplifying a sequence from the amelogenin gene whose length
varies between male and the female.
Degraded DNA and “Mini STRs”
The DNA is a very large molecule that can be easily broken to smaller fragments by
shearing force or bacterial enzymes (Chapter 2). Such degraded DNA samples are poorly
amplified. The problem is most marked in highly degraded DNA samples. In precious
and trace forensic samples degradation can completely jeopardize the analysis.
The problem of degraded DNA can be overcome to some extent by using “Mini STRs”.
In a mini STR analysis the forward and the reverse amplification primers flanking the
repeat units are brought to the nearest possible distance from the repeat units. The
resultant amplified fragments are of smallest possible size. Many degraded DNA samples
can be analyzed to provide sufficient information.
Limitations of DNA test for human identification
Some of the limitations of forensic DNA test are:
1. It can not tell the age of the person.
2. In some situations it may provide information about predisposition to disease,
color of eyes, height or hair color.

Forensic DNA Testing

Applications
Matching suspect with evidence
The profiles of the two or more DNA samples are aligned to see if there is any difference
or not. There could be three possible outcomes:
1. Match: When the two or more samples have the same genotypes. The statistical
significance of the match is calculated as described in a subsequent section.
2. Exclusion: When the two samples originate from two different sources. This does
not require prior knowledge of the allele frequencies in the population.
3. Inconclusive: Neither of the above two outcomes.
Example
The STR profiles of four DNA samples are shown in Table 16.10. Sample 1 was picked
from crime scene whereas samples 2-4 are of the suspects. The samples 1 and 2 are
completely matching whereas the samples 3 and 4 do not match and are therefore
excluded.

Table 16.10 Comparison of the STR profile of a DNA sample collected from a crime
scene (serial 1) and three suspects (serial 2-4). The profile of sample at serial 2
completely matches with that of the crime scene DNA whereas the samples at serial 2 &
3 are excluded from the match.

Sample D2S1338 D3S1358 D5S818 D7S820 D8S1179 D13S317 D16S539 D18S51

1 22,25 17,17 11,11 8,11 10,16 9,11 12,13 13,13
2 22,25 17,17 11,11 8,11 10,16 9,11 12,13 13,13
3 24,24 18,18 12,14 9,11 8,13 11,11 11,13 14,14
4 20,23 15,15 9,11 8,12 13,16 11,12 10,10 14,17
Sample D19S433 D21S11 FGA TH01 TPOX vWA CSF1PO Amel
1 13,15 29,30 21,25 6,9 8,9 16,16 11,11 XY
2 13,15 29,30 21,25 6,9 8,9 16,16 11,11 XY
3 13,14 28,31.2 21,23 7,9 8,9 21,21 11,12 XY
4 12,14 28,32.2 24,24 6,8 8,11 16,16 8,11 XY

Probability of match
The example shown in Table 16.10 shows a complete match between the samples at
serials 1 & 2. However, there is a remote probability that the match could be by chance.
The probability of match by chances is inversely proportional to the number of loci
tested. Its calculation in a given population requires comprehensive knowledge of the
allele frequencies of all the loci tested. A worked example of the profile frequency
(probability of match by chance) was discussed in Table 16.5.

Forensic DNA Testing

Sexual assault
In a sexual assault the DNA testing is done to demonstrate male DNA from the
perpetrator in a sample collected from the victim. In a vaginal swab the victim’s own
DNA is seen mixed with the DNA of the perpetrator. In addition the DNA from the
husband may also be present. Less often there may be more than one perpetrator and in
that case complex mixtures might be found. If the perpetrator has used condom his DNA
would not be found in the vaginal secretions/swab. In that case the evidence material may
have to be collected from other places like seminal stains on the victim’s clothing or the
other objects.

Example
The STR profiles of DNA extracted from high vaginal swab of a victim of sexual assault
(sample 1) and the suspects (sample 2 & 3) are shown in Table 16.11. The vaginal swab
shows mixture of two DNAs. The minor component has a male genotype and matches
exactly with that of the suspect 2 whereas the suspect 3 is excluded.

Table 16.11 DNA profiles of victim (sample 1) and two suspects (samples 2 &3) in a
case of sexual assault. The vaginal swab shows mixture of two DNAs. The minor
component has a male genotype and matches exactly with that of the suspect 2 whereas
the suspect 3 is excluded.

Sample D3S1358 D5S818 D7S820 D8S1179 D13S317 D18S51

1 16,17(16,18) 11,13(10,11) 11,11(10,12) 11,14(13,15) 11,11(11,11) 12,18(13,15)
2 16,18 10,11 10,12 13,15 11,11 13,15
3 15,16 10,13 11,13 13,15 10,13 12,15
Sample D21S11 TPOX FGA Th01 Amgl XY -
1 29,30(29,32.2) 8,8(8,8) 23,24(22,23) 9.3,9.3(6,9) XX(XY) -
2 29,32.2 8,8 22,23 6,9 XY -
3 28,31.2 8,8 21,22 6,9.3 XY -

Resolving mixtures of DNA

Mixture of DNA from more than one source is typically encountered in investigation of
sexual assault.
1. Simple mixtures may be resolved on gel electrophoresis.
2. Complex mixtures are best resolved on genetic analyzer.
3. In a mixture the major component is usually of the victim itself.
10

Forensic DNA Testing

 4. The minor component may be from one or more individuals.
5. Identify all possible alleles.
6. A difficult issue is to differentiate between stutter products and the minor
component of the mixture.
a. The stutter products are usually of smaller size than the main PCR product
and therefore would be seen moving ahead of the main product.
b. The height of the stutter peak is usually less than 10% of the main peak.
c. The mixture allele peak when present in the stutter peak area is considered
significant when its height is more than 15% of the main peak.
d. An allele peak or band seen in the larger size area is unlikely to be a stutter
peak/band.
e. A peak height less than 10% present in an area where stutter peaks are not
expected are considered significant.
7. The alleles once identified are sorted out.
8. The victim’s alleles are identified by aligning/comparing them with her own DNA
extracted from blood.
9. The DNA samples of the suspect(s) are run and the results are aligned/compared
to find any match.
10. In a sexual assault male DNA can also be demonstrated by Y-STR profiling.
Paternity testing
At any autosomal locus an individual inherits one allele each from the biological parents
(mother and father). The child inherits mitochondrial DNA only from the mother while
Y-chromosome is transmitted from the father to the son. The exceptions to the rules are
development of spontaneous mutations or chromosomal aneuploidies (trisomy or
monosomy). Most parentage disputes are of paternal in origin. However, occasionally
maternity may also be questioned e.g. exchanged babies in a labour room.
In solving a paternity dispute a battery of STR markers are used. The step wise procedure
includes:
1. Profiling of the alleged father and the child or the products of conception is done.
The mother’s profile is usually not required.
2. Of the two paternal alleles at each locus the allele transmitted to the child, called
the “obligate allele”, is selected.
3. If none of the alleles of the alleged father are present in the child at any of the loci
tested the paternity is excluded. For example if the child has genotype 14,18 and
the father has 13,15 the paternity is excluded. However, keeping the possibility of
spontaneous mutations in mind it is advisable to consider more than one loci
before excluding paternity.

11

Forensic DNA Testing

 4. Frequencies of the obligate paternal alleles are noted from the table of allele
frequencies in the reference population.
5. The Paternity Index (PI) is calculated by dividing the prior probability with the
frequency of the allele in question. The prior probability is the chance of
transmitting the obligate allele by the alleged father to the child. If the alleged
father is homozygous for the allele the prior probability is 1.0 and it is 0.5 if he is
heterozygous.
6. Combined Paternity Index (CPI) is calculated by multiplying the PI values
calculated at each locus.
7. The Probability of Paternity (POP) is calculated by the formula:
CPI /CPI + (1-prior probability) x 100
Example
An example of calculation of paternity index and the combined paternity index is shown
in Table 16.12.

Table 16.12 Calculation of Paternity Index and Probability of Paternity.

Locus Genotype Obligate Frequency Paternity Index (PI) =

Mother Child Al/Father Allele Prior probability*/frequency
D3S1358 14,15 14,18 15,18 18 0.078 0.5/0.078 = 6.41
D5S818 9,12 9,9 9,9 9 0.049 1.0/0.049 = 20.41
D7S820 8,11 8,9 9,11 9 0.108 0.5/0.108 = 4.63
D8S1179 10,12 10,15 11,15 15 0.211 0.5/0.211 = 2.37
D21S11 29,32.2 29,31.2 28,31.2 31.2 0.123 0.5/0.123 = 4.06
TPOX 9,11 9,11 8,11 11 0.333 0.5/0.333 = 1.50
TH01 8,9.3 9,9.3 6,9 9 0.250 0.5/0.250 = 2.00
FGA 21,21 20,21 20,24 20 0.093 0.5/0.093 = 5.38
Combined Paternity Index (CPI) 6.41 X 20.41 X 4.63 X 2.37 X 4.06 X 1.50 X 2.00 X 5.38 = 94,072
or 1 in 94,072
Probability of Paternity CPI/CPI + (1-prior probability) X 100
94072/(94072 + 0.5) X 100 = 99.999 %

*
If the father is heterozygous for the allele Prior Probability = 0.5
*
If the father is homozygous for the allele Prior Probability = 1.0

Identification in mass disasters

In mass disasters the DNA testing is primarily done to identify bodies that are beyond
recognition. It may also be required to put the pieces of bodies together.
The process is done as follows:
1. The DNA profiles of the dead bodies or their remains are entered in a computer
database.
12

Forensic DNA Testing

 2. The DNA profiles of the bodies is matched with those of the parents or the
offsprings. If these are not available then DNA may be matched with that
recovered from the personal effects of the victims.
3. The matched profiles are put together after sorting.

Table. 16.13. Comparison of the DNA profiles of three dead bodies from a mass disaster
and a father. The DNA profile of the “father” shares at least one allele at all fifteen loci
with the DNA profile of the body number 7 and is therefore a proof of identity.

Sample D2S1338 D3S1358 D5S818 D7S820 D8S1179 D13S317 D16S539 D18S51

3 20,25 14,15 8,10 8,12 14,16 10,11 10,10 13,16
7 20,23 15,15 9,11 8,12 13,16 11,12 10,10 14,17
16 22,23 14,14 10,11 8,11 13,16 10,12 10,12 15,17
Father 21,23 15,16 9,11 7,12 13,14 12,14 10,11 13,17

Sample D19S433 D21S11 FGA TH01 TPOX vWA CSF1PO Amel

3 11,14 29,32.2 23,23 6,9.3 8,11 15,16 8,12 XY
7 12,14 28,32.2 24,24 6,8 8,11 16,16 8,11 XY
16 13,14 30,32.2 22,24 6,9 8,10 14,14 8,11 XY
Father 13,14 32.2,32.2 21,24 7,8 8,10 15,16 8,11 XY

Determining the ethnic origin of a person

Can DNA testing provide information on the ethnic origin of a person? The question is
asked more than often especially when no clue is available to identify the perpetrator.
There are some STR loci that have more significant differences in allele frequencies
between major world populations like Caucasians, Blacks, Hispanics, Asians and East
Asians etc. The differences are more marked in the frequency of less common alleles
than the more common ones. An important requirement would be to have representative
samples of the target ethnic groups with ethnically pure individuals and not the ones with
self declared ethnicity. In this context analysis of SNP is considered more informative
than the STR markers.
In tribal populations with high frequency of consanguinity and marriage within the same
tribe founder effect and genetic drift might cause an unexpectedly higher or lower
frequency of alleles than in the rest of the population.
OmniPop 200.1 software is available on the internet free of cost. It is basically a database
of the STR allele frequencies published in over 200 studies in the major world
populations. By entering the CODIS STR profile of an individual it provides statistical
information on finding a similar profile in various world populations. Similar software
can be developed for one’s own requirements if comprehensive knowledge of the allele
frequencies in the smaller target groups and populations is available.

13

Forensic DNA Testing

Collection storage and dispatch of samples for forensic DNA testing
1. Collection and storage of samples
a. DNA can be extracted from any biological material that contains sufficient
number of nucleated cells. Since DNA is susceptible to degradation by
mal handling and nucleases derived from cells and bacterial contamination
the sample should remain as clean and free of bacterial contamination as is
possible.
b. DNA may be extracted from a wide variety of samples. The usual samples
are whole or dried blood (stains), buccal smear, wet or dried semen and
other body secretions, hair with roots, soft tissues, fresh and dried bones
etc.
c. The samples of stains like blood or body secretions should be air dried and
kept in a paper envelop rather than plastic bag.
d. Fresh blood: 2-3 ml of venous blood should be collected in EDTA. The
sample can be stored before dispatch at 4oC for 48 hours.
e. Blood stains on clothes or other objects should be dried at room
temperature before dispatch in a paper bag.
f. Buccal smear obtained on a clean throat swab contains mucosal cells to
yield sufficient quantity of good quality DNA. The swab can also be used
to obtain DNA from a dead body. The swab should be rubbed several
times over clean part of buccal mucosa. It may be air dried before storage
or dispatch.
g. Semen and other body fluids containing nucleated cells are a good source
of DNA. The stained clothes or objects should be air dried and treated as
blood stains.
h. Hair shafts do not contain nuclear DNA. Hairs that are plucked from the
body and come out with roots can be used to extract DNA. Sufficient
DNA can be extracted from 2-3 hairs with roots.
i. Soft tissues are a very rich source of DNA. Skin is an easily accessible
tissue that can be used to collect DNA from a dead body. A full thickness
piece of skin measuring 2x2 cm from a clean part of the body or its
remains can be taken. If skin is not available then any other available soft
tissue should be collected. The soft tissue samples provide an excellent
medium for bacterial growth. In a putrefied or heavily contaminated soft
tissue sample the yield as well as the quality of DNA can be very poor.
The soft tissue samples can be stored as such at -20oC in a suitable
container for several days. The sample may be transported in normal
saline. Do not put the samples for DNA testing in formalin at any stage.
j. Bones can also be used as a source of DNA. But the extraction of DNA
from a bone is difficult therefore the yield and quality of DNA is also
14

Forensic DNA Testing

 variable. DNA is best collected from compact bones like humerus or
femur. The spongy bones with thin cortex are usually heavily
contaminated with mud etc. that may inhibit PCR.
2. Dispatch of samples
a. The samples should be properly labeled and sealed.
b. The request form should contain all available details of the individual(s) to
be tested along with a brief summary of the incident and what exactly is
required to be solved by the DNA test.
c. Unnecessary delay in transport can adversely affect the quality of the
sample. There is no special requirement of transporting the samples in ice
etc. However, avoid exposing the sample to extreme heat or direct
sunlight.
3. Chain of custody
a. Forensic DNA testing is done for medico-legal purpose therefore it is
essential to maintain the chain of custody.
b. A record of the individuals receiving and handing over the samples must
be maintained at all steps as they may be called by the court as a witness.

Bibliography
1. Kaiser L and Sever G (1983) Paternity testing: I. Calculation of paternity indexes.
Am J Med Genet 15: 323-329.
2. Elston RC (1986) Probability and paternity testing. Am J Hum Genet 39: 112-
122.
3. Smith RN (1995) Accurate size comparison of short tandem repeat alleles amplified
by PCR. Biotechniques 18: 122-128.
4. Brinkmann, B., Klintschar, M., Neuhuber, F., Huhne, J., and Rolf, B. (1998).
Mutation rate in human microsatellites: Influence of the structure and length of
the tandem repeat. Am J Hum Genet 62: 1408-1415.
5. Short Tandem Repeat DNA Internet DataBase, http://www.cstl.nist.gov/strbase/

15

Forensic DNA Testing