Cell and Molecular Biology

BIOL 30095 - Lecture

Overview

This course is a 3-hour lecture, 6-hour laboratory once-a-week meeting that will discuss
understanding of cellular structures and function in molecular level. This course is concerned with
the chemistry of the living cell and its progression from molecules to multicellular organisms;
evolution of the cell; principles of major experimental methods for investigating cells; transmission
of genetic information and the internal organization of the cell.

On completion of this course, the student is expected to present the following learning outcomes:

• Explain the concept, scope and importance of cell biology

• Compare the cell’s morphology in both prokaryotic and eukaryotic organisms
• Trace the genetic lineage or phylogenetic history of the organisms
• Describe briefly the different cellular components (structure, function, molecular diversity)
• Determine the factors that can affect cellular components, metabolic activities, and
molecular behavior
• Familiarize some common methods and techniques in molecular biology

In this module, topics are organized in a weekly time frame that includes overviews, readings,
lectures, discussions, and other relevant activities. At the end of each module, the student will
answer the assessment to check the understanding of the student.

PREPARED BY:
Jordan M. Abellar
Kiara Nicole Rodriguez
Kenneth Jay Solis
Jhunel G. Vinarao
Course Title: Cell And Molecular Biology

Course Code: BIOL 30095

Course Credit: 5 units (3 units lec/ 2 units lab) ( 3 hrs Lect/ 6 hrs lab)

Pre-Requisite: BIOL 30015; BIOL 30025; BIOL 30035; CHEM 20175

Course Description: This course is concerned with the chemistry of the living cell and its
progression from molecules to multicellular organisms; evolution of
the cell; principles of major experimental methods for investigating
cells; transmission of genetic information and the internal
organization of the cell.

Institutional Learning Programs Outcomes Course Outcomes

Outcomes
Develop a critical and
1. Creative and Critical analytical mind in dealing
Thinking with different biological • Explain the concept,
theories and their scope and
application. importance of cell
Articulate scientific biology
2. Effective knowledge and innovation in • Compare the cell’s
Communication the field of practice by morphology in both
exhibiting technical writing prokaryotic and
and oral communication eukaryotic
skills. organisms
• Trace the genetic
Build a strong culture of lineage or
3. Strong Service passion for continuous phylogenetic history
Orientation learning and servant hood by of the organisms
incorporating such values in • Describe briefly the
4. Passion to Life-Long every course of the program. different cellular
Learning components
Advocate a strong sense of (structure, function,
5. Sense of Nationalism nationalism and global molecular diversity)
and Global responsiveness in various • Determine the
Responsiveness areas and activities in factors that can
biology. affect cellular
components,
metabolic activities,
6. Community Create and regularly conduct and molecular
Engagement extension programs and behavior
services benefiting identified • Familiarize some
marginalized sectors and common methods
industry partners. and techniques in
molecular biology
Demonstrate knowledge and
laboratory skills using state of

Cell and Molecular Biology | BIOL 30095 3

 7. Adeptness in the the art equipment and
Responsible Use of breakthrough researches that
Technology benefits humanity.

Practice strong ethical

8. High Level of considerations, leadership,
Leadership and and efficiency in every area of
Organizational Skills research and academics.

9. Sense of Personal and

Professional Ethics

Course Plan

Week Topic Learning Outcomes Methodology

Introduction to the course Show interest and Orientation

Week 1 contents, activities, and appreciation of the Review of the syllabus,
requirements. importance of knowing the learning activities and
course and know the basic assessment
The basics of cell classroom policies. Getting to know activity

Microscopy Emphasize the Laboratory Activity on

endosymbiotic theory of life Microscopy
Laboratory Activity on Cell
Introduce the modern Culture
microscopic methods of
studying cells and cell
culture

Biochemistry of the Cell Explain and understand the Lecture and Discussion
Week 2 Types of Bonding biochemical components of Video presentation
Role of Water in Living the cell Laboratory: Biochemical
System Components of the Cell
Biomolecules Discuss the role of water in Protein Structure Prediction
a. Carbohydrates the cell
b. Lipids Identify the different
c. Nucleic Acids biomolecules in the cell
d. Proteins and Enzymes based on molecular
structure
Eukaryotic, Prokaryotic Cell
and Virus Structure Predict the structure of
biomolecules and correlate
its function/interaction in the
cell

Predict enzyme activity in

the cell in a given condition

Cell and Molecular Biology | BIOL 30095 4

 Differentiate prokaryotic,
eukaryotic and virus in terms
of structure
Week 3 Central Dogma of Differentiate prokaryotic and Lecture
Molecular Biology eukaryotic genome, Module
Replication chromosome and enzymes Practice Exercise
Transcription involved in replication, Journal Crituqe
Post Transcriptional transcription and translation Laboratory Activity
Processing
Translation Compare Replication,
Post Translational Transcrition and Translation
Modification in prokaryotic and eukaryotic
organism.

Critique journal associated

to central dogma of
molecular biology

Cell surface and Discuss the composition of Lecture and Discussion

Week 3 extramembrane plasma membrane Drills
components Determine the interference Think, Pair, Share Activity
Nature and composition of of other factors affecting Giving of Assignments
plasma membrane membrane permeability
Illustrate the mechanism of Laboratory: Permeability of
Functions and activities of extracellular activities in the Plasma Membrane
the cell membrane cell

Extramembrane
components (including
extracellular matrix)
Cell Nucleus
Chromosome structure and Discuss the structure and Lecture and Discussion
genes composition of chromosome Video Presentation
Group Presentation
Cell cycle Illustrate thoroughly the Laboratory:
Week 4 processes and events Observation of
Organization and evolution happen during cell cycle Models/specimens and
of the nuclear genome illustrations of onion root
Focus on prokaryotic and tips,
Molecular biology of the eukaryotic gene expression RNA/DNA Extraction,
gene RNA/DNA Quantification
gene expression

Endomembrane System Discuss the concept of Lecture Discussion

Week 5 cellular modification,
ER and its derivatives packaging and transport Video presentation
Illustrate the pathway during
Golgi complex cellular transport Group Learning Activity
Sheets

Cell and Molecular Biology | BIOL 30095 5

 Lysosomes and Determine the primary
peroxisomes function of each intracellular
organelle
Vacuoles
Membrane flow and sorting
(trafficking)

Cytoskeleton and Cell

Week 6 Motility Discuss the basic structure, Lecture Discussion
composition, variations and
Microtubules molecular mechanism of Video presentation
action of cytoskeletal
Microfilaments component of the cell Laboratory: Cell
Fractionation (2)
Intermediate filaments Identify the advantages and
disadvantages of having
Cell motility variation of cytoskeleton in
relation to motility

Bioenergetics
Week 7
Lecture Discussion
Mitochondria and cell Understand the structure of
respiration organelles for energy
supplier Laboratory: Hill Reaction
Chloroplast and and Respiration
photosynthesis Discuss the molecular
mechanism of
photosynthesis and
respiration

Identify the primary genes

responsible for this primary
metabolic activity
Methods in Molecular Familiarize the basic Lecture Discussion
Week 8 Biology concept and principle in
using modern methods of Video presentation
DNA and RNA studying DNA, RNA and
proteins Laboratory: Introduction to
Proteins some Molecular Biology
Recognize the principle tools and equipment
Molecular Markers behind blotting techniques,
ELISA, Flow Cytometry and
Protein Purification

Week 9 Bioinformatics Familiarize on DNA Lecture Discussion

databases and
biocomputing Group Learning Activity

Cell and Molecular Biology | BIOL 30095 6

 Name: ID Number:
Section: Instructor:

Table of Contents
The Basics of Cell .................................................................................................................. 11
The Cell Theory: Brief History ......................................................................................................... 11
Microscopy: Parts, Functions, and Types ........................................................................................ 14
Types and Properties of Cells: Differences and its Evolution ........................................................... 17
Endosymbiotic Theory ................................................................................................................... 20
Viruses ........................................................................................................................................... 22
Module Assessment: ...................................................................................................................... 25
Cell Chemical Components .................................................................................................... 26
The Importance of Carbon ............................................................................................................. 26
Covalent and Non-covalent Bonding .............................................................................................. 27
The Importance of Water ............................................................................................................... 30
Nature of Biological Molecules....................................................................................................... 31
Four Types of Biological Molecules ................................................................................................ 35
Module Assessment: ...................................................................................................................... 43
Central Dogma of Molecular Biology .................................................................................... 44
THE CHROMOSOME ....................................................................................................................... 44
DNA STRUCTURE AND REPLICATION .............................................................................................. 45
DNA Polymerase ............................................................................................................................ 46
DNA REPLICATION ......................................................................................................................... 47
TRANSCRIPTION: DNA to RNA ........................................................................................................ 48
PROMOTERS .................................................................................................................................. 50
RNA SPLICING ................................................................................................................................ 51
Reverse Transcription .................................................................................................................... 53
TRANSLATION: RNA to Protein ....................................................................................................... 54
Translating Genetic Information .................................................................................................... 57
Module Assessment: ...................................................................................................................... 58

Cell and Molecular Biology | BIOL 30095 7

Cell Membrane ..................................................................................................................... 59
Molecular Structure ....................................................................................................................... 60
Phospholipid Biosynthesis ............................................................................................................. 61
Membrane Proteins ....................................................................................................................... 63
Hydropathy Plot to Predict Transmembrane Protein ...................................................................... 66
Structure of the Plasma Membrane ............................................................................................... 67
Lipid Raft ....................................................................................................................................... 68
Function of the Cell Membrane ...................................................................................................... 69
Membrane Fluidity ........................................................................................................................ 70
Membrane Permeability ................................................................................................................ 71
Movement Across Membrane ........................................................................................................ 72
Membrane Potentials and Nerve Impulses..................................................................................... 72
Voltage-gated ion channels ............................................................................................................ 74
Cell Signaling ........................................................................................................................ 77
Basic Elements: Cell Signaling System ............................................................................................ 77
Signal Transduction........................................................................................................................ 78
Extracellular Messengers and Their Receptors ............................................................................... 79
G Protein-Coupled Receptors and Their Second Messengers .......................................................... 79
Arrestin.......................................................................................................................................... 80
cAMP ............................................................................................................................................. 81
Phosphoinositides.......................................................................................................................... 82
Phosphatidylinositol-inositol triphosphate (IP3) and diacylglycerol (DAG) ..................................... 82
Phosphatidylinositol-inositol triphosphate (IP3) ............................................................................ 83
Glucose Levels ............................................................................................................................... 84
Senses............................................................................................................................................ 85
Protein-Tyrosine Phosphorylation .................................................................................................. 85
Insulin ............................................................................................................................................ 86
In Plants ......................................................................................................................................... 88
Calcium as an Intracellular Messenger ........................................................................................... 88
In Plant cells .................................................................................................................................. 88
Convergence, Divergence and Crosstalk ......................................................................................... 89
Apoptosis (Programmed Cell Death) .............................................................................................. 91
Extrinsic pathway........................................................................................................................... 92

Cell and Molecular Biology | BIOL 30095 8

 Intrinsic Pathway ........................................................................................................................... 93
Clearance ....................................................................................................................................... 93
Module Assessment ....................................................................................................................... 95
The Nucleus of the Cell.......................................................................................................... 96
Anatomy of the Cell Nucleus .......................................................................................................... 96
MOLECULAR STRUCTURE OF GENES AND CHROMOSOMES ............................................................ 97
THE CELL CYCLE .............................................................................................................................. 99
Interphase ................................................................................................................................... 100
M Phase ....................................................................................................................................... 100
Regulation of the Cell Cycle .......................................................................................................... 103
NUCLEAR GENOME EVOLUTION ................................................................................................... 106
Module Assessment ..................................................................................................................... 108
The Endomembrane System ................................................................................................109
The Endoplasmic Reticulum (ER) .................................................................................................. 110
The Golgi Complex ....................................................................................................................... 111
Protein and Lipid Trafficking as facilitated by the ER and Golgi Apparatus .................................... 112
Lysosomes ................................................................................................................................... 113
Peroxisomes ................................................................................................................................ 114
Vacuoles ...................................................................................................................................... 115
Module Assessment: .................................................................................................................... 116
Cytoskeleton and Cell Motility .............................................................................................117
Microtubules ............................................................................................................................... 118
Microfilaments ............................................................................................................................ 119
Intermediate Filaments ................................................................................................................ 121
Cell Motility ................................................................................................................................. 123
Microtubule-based motility ......................................................................................................... 123
Microfilament-based motility ...................................................................................................... 123
Module Assessment ..................................................................................................................... 124
Bioenergetics: Energy Flowing, Harvesting and Yielding Processes ......................................125
The Mitochondrion ...................................................................................................................... 126
Carbohydrate Metabolism ........................................................................................................... 127
Oxidative Metabolism in the Mitochondrion................................................................................ 127
NADH Shuttle............................................................................................................................... 129

Cell and Molecular Biology | BIOL 30095 9

 Oxidative Phosphorylation ........................................................................................................... 129
The Role of Mitochondria in the Formation of ATP....................................................................... 130
The Machinery for ATP Formation ............................................................................................... 132
Chloroplast and Photosynthesis ................................................................................................... 136
Photosynthetic Metabolism ......................................................................................................... 137
Absorption of Light ...................................................................................................................... 138
Photosynthetic Units & Reaction Centers ..................................................................................... 139
Photophosphorylation ................................................................................................................. 142
Carbon Dioxide Fixation and the Synthesis of Carbohydrate ........................................................ 143
Module Assessment: .................................................................................................................... 146
Bioinformatics .....................................................................................................................150
Sister Fields of Bioinformatics ...................................................................................................... 150
Biological Databases .................................................................................................................... 151
Tools and Methods in Bioinformatics ........................................................................................... 151
Module Assessment ..................................................................................................................... 155
Laboratory Activity Sheet ....................................................................................................158
Laboratory Activity 1: Microscopy and the Cell ....................................................................159
Laboratory Activity 2: Biological Shapes ..............................................................................164
Laboratory Activity 3: Biological Molecules and its Properties .............................................167
Laboratory Activity 4: Cellular Membrane and Its Components ............................................170
Laboratory Activity 5: Bioenergetics ....................................................................................174
Laboratory Activity 6: DNA Extraction .................................................................................177
Laboratory Activity 7: DNA Profiling and Quantification ......................................................182
Laboratory Activity 8: Polymerase Chain Reaction (PCR) ......................................................187
Laboratory Activity 9: Protein Synthesis and Words .............................................................191
Laboratory Activity 10: Bioinformatics .................................................................................197
References: ..........................................................................................................................199

Cell and Molecular Biology | BIOL 30095 10

 Module 1

The Basics of Cell

I. OBJECTIVES: At the end of this module, you should be able to:

• Compare and contrast structures common to and that distinguish prokaryotes, eukaryotes
and archaea, and groups within these domain
• Articulate the function of different cellular substructures and compare how prokaryotes
and eukaryotes accomplish the same functions, i.e. display the same essential properties
of life, despite the fact that prokaryotes lack most of the structures
• Outline a procedure to study a specific cell organelle or other substructure
• describe how the different structures (particularly in eukaryotic cells) relate/interact with
each other to accomplish specific functions

II. COURSE MATERIAL

The Cell Theory: Brief History

Think of your family at home, a family that communicates, build friendship, and fun all the time.
Remember that a family is the basic unit of the society where you live with peace and harmony
that build relationship from one another. Everyone is working with each other to grow and develop
well.

Now, imagine a cell, where they work together to function properly and effectively. Every part of
a cell has an equivalent part of the family which has specific function in order to help you as you
grow. As each part of the cell work together, they create balance with one another. Like a family
which is a basic unit of the society, cell is also the basic unit of life.

The smallest unit of a living matter is the cell. All organisms are made up of at least one cell that
work together that has specific functions and parts. Every cell has its own characteristics such as
sizes, shapes, parts, and its specific functions. The story of cell biology started to unfold more
than 300 years ago, as European scientists began to focus their crude microscopes on a variety
of biological material ranging from tree bark to bacteria to human sperm. One such scientist was
Robert Hooke, Curator of Instruments for the Royal Society of London. In 1665, Hooke built a
microscope and examined thin slices of cork. He saw a network of tiny boxlike compartments that
reminded him of a honeycomb and called these little compartments cells, from the Latin word
cellula, meaning “little room.”

What Hooke observed were not cells at all. Those empty boxlike compartments were formed by
the cell walls of dead plant tissue, which is what cork is. However, Hooke would not have thought
of these cells as dead because he did not understand that they could be alive! Although he noticed
that cells in other plant tissues were filled with what he called “juices,” he concentrated instead on
the more prominent cell walls of the dead cork cells that he had first encountered.

Cell and Molecular Biology | BIOL 30095 11

The Cell Theory Applies to All Organisms

Aided by such improved lenses, the Scottish botanist Robert Brown found that every plant cell he
looked at contained a rounded structure, which he called a nucleus, a term derived from the Latin
word for “kernel.” In 1838, his German colleague Matthias Schleiden came to the important
conclusion that all plant tissues are composed of cells and that an embryonic plant always arises
from a single cell. A year later, German cytologist Theodor Schwann reported similar conclusions
concerning animal tissue, thereby discrediting earlier speculations that plants and animals do not
resemble each other structurally. These speculations arose because plant cell walls form
conspicuous boundaries between cells that are readily visible even with a crude microscope,
whereas individual animal cells, which lack cell walls, are much harder to distinguish in a tissue
sample. However, when Schwann examined animal cartilage cells, he saw that they were unlike
most other animal cells because they have boundaries that are well defined by thick deposits of
collagen fibers. Thus, he became convinced of the fundamental similarity between plant and
animal tissue. Based on his astute observations, Schwann developed a single unified theory of
cellular organization. This theory has stood the test of time and continues to be the basis for our
own understanding of the importance of cells and cell biology.

As originally postulated by Schwann in 1839, the cell theory had two basic principles:
1. All organisms consist of one or more cells.
2. The cell is the basic unit of structure for all organisms.

Less than 20 years later, a third principle was added. This grew out of Brown’s original description
of nuclei, which Swiss botanist Karl Nägeli extended to include observations on the nature of cell
division. By 1855 Rudolf Virchow, a German physiologist, concluded that cells arose only by the
division of other, preexisting cells. Virchow encapsulated this conclusion in the now-famous Latin
phrase omnis cellula e cellula, which in translation becomes the third principle of the modern cell
theory:

3. All cells arise only from preexisting cells.

Thus, the cell is not only the basic unit of structure for all organisms but also the basic unit of
reproduction. No wonder, then, that we must understand cells and their properties to appreciate
all other aspects of biology. Because many of you have seen examples of “typical” cells in
textbooks that may give the false impression that there are relatively few different types of cells,
let’s take a look at a few examples of the diversity of cells that exist in our world

Cells exist in a wide variety of shapes and sizes, ranging from filamentous fungal cells to spiral-
shaped Treponema bacteria to the differently shaped cells of the human blood system. Other
cells have much more exotic shapes, such as the diatom and the protozoan. The egg and the
sperm, differ greatly in size and shape. As in leaves, the green chlorophyll in a Chlamydomonas
cell shows that these algae carry out photosynthesis. Often, an appreciation of a cell’s shape and
structure gives clues about its function. For example, the spiral thickenings in the cell walls of

Cell and Molecular Biology | BIOL 30095 12

plant xylem tissue give strength to these water-conducting vessels in wood, and the highly
branched cells of a human neuron allow it to interact with numerous other neurons.

If evolution requires genetic variation, can populations of asexually reproducing organisms

evolve? Explain.

Advances in Microscopy Allowed

Detailed Studies of Cells

Hooke’s observations were limited by the

magnification power of his microscope,
which enlarged objects to only 30 times
(30X) their normal size. This made it
difficult to learn much about the internal
organization of cells. A few years later,
Antonie van Leeuwenhoek, a Dutch textile
merchant, produced small lenses that
could magnify objects to almost 300 times
(300X) their size. Using these superior
lenses, van Leeuwenhoek became the
first to observe living cells, including blood
cells, sperm cells, bacteria, and single-
celled organisms (algae and protozoa)
found in pond water. He reported his
observations to the Royal Society of
London in a series of letters during the late
1600s. His detailed reports attest to both the high quality of his lenses and his keen powers of
observation.

Two main factors restricted further understanding of the nature of cells. First, the microscopes of
the day had limited resolution (resolving power)—the ability to see fine details of structure. Even
van Leeuwenhoek’s superior instruments could push this limit only so far. The second factor was
the descriptive nature of seventeenth-century biology. It was an age of observation, with little
thought given to explaining the intriguing architectural details being discovered in biological
materials.
More than a century passed before the combination of improved microscopes and more
experimentally minded microscopists resulted in a series of developments that led to an
understanding of the importance of cells in biological organization. By the 1830s, important optical

Cell and Molecular Biology | BIOL 30095 13

improvements were made in lens quality and in the compound microscope, an instrument in which
one lens (the eyepiece) magnifies the image created by a second lens (the objective). This
allowed both higher magnification and better resolution. At that point, structures only 1 micrometer
(mm) in size could be seen clearly.

Microscopy: Parts, Functions, and Types

The development of microscopes from a simple magnifying lens to a compound light microscope
and then to the electron microscope is important to biologists/scientists that help to enlarge
images which are microscopic in nature so as they can be studied. The compound light
microscope is an instrument containing two (2) lenses to increase the magnification of objects
and variety of knobs to resolve (focus) of the pictures. The objects must be thin, so light passes
through them, and mounted on a surface, such as glass. The lens system is formed by the ocular
lenses (eyepieces) and the objective lenses. It uses more than one lenses (binocular), meaning
they have two ocular lenses that you look through. Binocular microscopes are parfocal meaning
when magnification of one objective lens is in focus, then the other objectives will also be in focus
at the new setting. The following in the table are the different parts and functions of a microscope:

Parts Functions
Allows the specimen to be seen enlarged, normally the eyepiece
Eyepiece/Ocular
usually contains 10x magnification.
Draw tube Connects the eyepiece to the different objectives
Arm Connects the draw tube to the base of the microscope
Coarse adjustment
Focuses the specimen if the objective is under low-power
knob
Fine adjustment knob Focuses the specimen if the objective is under high-power
holds the objective lenses that will be rotated that has different
Revolving nose piece
magnification.
a. Scanning – allows you to view the specimen with 4x magnification
b. Low Power Objective (LPO) – allows you to view the specimen with
10x magnification
Objectives c. High Power Objective (HPO) – allows you to view the specimen with
40x magnification
d. Oil Immersion Objective (OIO) – allows you to view the specimen
with 100x magnification
Stage and Stage clip A platform that holds the specimen that has clips on both sides
Diaphragm Controls the light that passes through the stage
Reflects the light from the light source to the specimen for better
Mirror
viewing
Base Supports the whole microscope

Cell and Molecular Biology | BIOL 30095 14

Types of Microscopes

There are different types of microscope that needs to be improved based on the needs of the
society and of different researches. These types of devices were improved by different scientists,
researchers, and students. These different microscopes depend on the resources and needs of
the stakeholders, that provides different resolution, magnification, and sizes. The following are
the different types of microscope:

Scanning Transmission
Microscope Compound Dissection Electron Electron
Microscope Microscope

Compound A dissection SEM use electron TEM is electron

microscopes are microscope is illumination. The illuminated. This
light illuminated. light illuminated. image is seen in gives a 2-D view.
The image seen The image that 3-D. It has high Thin slices of
with this type of appears is three magnification and specimen are
microscope is dimensional. It is high resolution. obtained. The
two dimensional. used for The specimen is electron beams
This microscope dissection to get coated in gold pass through this.
Description is the most a better look at and the electrons It has high
commonly used. the larger bounce off to give magnification and
You can view specimen. You you an exterior high resolution.
individual cells, cannot see view of the
even living ones. individual cells specimen. The
It has high because it has a pictures are in
magnification. low black and white.
However, it has a magnification.
low resolution.
Visible light Visible light Electrons Electrons
Source of
Radiation for
Image
Formation

Focusing Mechanical Mechanical Electrical Electrical

Light absorption Light scattering Electron Electron
Major Means of or light reflection scattering Scattering
Providing
specimen
contrast

Cell and Molecular Biology | BIOL 30095 15

Why is there a need to have different types of microscopes?

Activity Task 1: Identify the correct parts of the microscope.

Cell and Molecular Biology | BIOL 30095 16

Types and Properties of Cells: Differences and its Evolution

The idea that all organisms are composed of cells and that cells come only from preexisting cells
are the two central tenets of the cell theory. We can identify some characteristics that are common
to all cells:

• A plasma membrane made of phospholipids that regulates the movement of materials into
and out of the cell
• A semifluid interior, called the cytoplasm, where chemical reactions occur
• Genetic material (DNA) that provides the information needed for cellular activities,
including growth and reproduction

Cells are divided into two main types, according to the way their genetic material is organized.
The prokaryotic cells lack a membrane-bound nucleus. Their DNA is located in a region of the
cytoplasm called the nucleoid. The other type of cells, eukaryotic cells, have a nucleus that houses
their DNA.

Fundamental Properties

Cells Are Highly Complex and Organized Complexity is a property that is evident when
encountered, but difficult to describe. For the
present, we can think of complexity in terms of
order and consistency. The more complex a
structure, the greater the number of parts that
must be in their proper place, the less
tolerance of errors in the nature and
interactions of the parts, and the more
regulation or control that must be exerted to
maintain the system. Cellular activities can be
remarkably precise. DNA duplication, for
example, occurs with an error rate of less than
one mistake every ten million nucleotides
incorporated—and most of these are quickly
corrected by an elaborate repair mechanism
that recognizes the defect.
Cells Possess a Genetic Program and the Organisms are built according to information
Means to Use It encoded in a collection of genes, which are
constructed of DNA. The hu- man genetic
program contains enough information, if
converted to words, to fill millions of pages of
text. Remarkably, this vast amount of
information is packaged into a set of

Cell and Molecular Biology | BIOL 30095 17

 chromosomes that occupies the space of a
cell nucleus—hundreds of times smaller than
the dot on this i.
Cells Are Capable of Producing More of Cells reproduce by division, a process in which
Themselves the contents of a “mother” cell are distributed
into two “daughter” cells. Prior to division, the
genetic material is faith- fully duplicated, and
each daughter cell receives a complete and
equal share of genetic information.
Cells Acquire and Utilize Energy Cells expend an enormous amount of energy
simply breaking down and rebuilding the
macromolecules and organelles of which they
are made. This continual “turnover,” as it is
called, maintains the integrity of cell
components in the face of inevitable wear and
tear and enables the cell to respond rapidly to
changing conditions.
Cells Engage in Mechanical Activities Cells are sites of bustling activity. Materials
are transported from place to place, structures
are assembled and then rapidly
disassembled, and, in many cases, the entire
cell moves itself from one site to another.
Cells Are Able to Respond to Stimuli Cells possess receptors to hormones, growth
factors, and extracellular materials, as well as
to substances on the surfaces of other cells. A
cell’s receptors provide pathways through
which external stimuli can evoke specific
responses in target cells. Cells may respond
to specific stimuli by altering their metabolic
activities, moving from one place to another,
or even committing suicide.
Cells Evolve It is presumed that cells evolved from some
type of precellular life form, which in turn
evolved from nonliving organic materials that
were present in the primordial seas. According
to one of the tenets of modern biology, all
living organisms have evolved from a single,
common ancestral cell that lived more than
three billion years ago. Because it gave rise to
all the living organisms that we know of, this
ancient cell is often referred to as the last
universal common ancestor.

Cell and Molecular Biology | BIOL 30095 18

Differences between prokaryotes and eukaryotes

Characteristics Prokaryotes Eukaryotes

Cell Size Usually 1-5 um in diameter 1usually 10-100 um in diameter
Nucleus None Present
Organelles No membrane-bound Membrane-bounded
Cell Wall Yes, contains peptidoglycan Present in some cells; specifically in
plant cells
Size of ribosomes 70s; 30s and 50s subunits 80s; 40s and 60s subunits
Internal Absent Present
membrane
system made up
of fluid mosaic
structure
Presence of Mostly absent but some have Present
Sterol in the hopanoids
Membrane
DNA Structure circular Helical
Chromosomes – One but double stranded One or more
DNA with
associated
proteins
DNA Geometry Covalently closed circular with Linear in nucleus
phosphoester bonds Covalently closed circular in
mitochondria and chloroplast
Histones Absent but some have histone-like Present in nucleus
proteins
Mode of Binary Fission (asexual); Mitosis (body cells); Meiosis (sex
Reproduction conjugation (sexual) cells)

Why do distinct characteristics is needed in cells?

Cell and Molecular Biology | BIOL 30095 19

What are the criteria you might use to distinguish prokaryotes from plant and animal cells?

Endosymbiotic Theory

Fossil remains of ancient life, suggests that the first cells were prokaryotes. Therefore, scientists
believe that eukaryotic cells evolved from prokaryotic cells. Biochemical analysis indicates that
eukaryotes are more closely related to the archaea than the bacteria—the evolution of eukaryotic
cells, probably from a prokaryotic cell in stages. The distinct characteristics of the eukaryotic cell,
the nucleus, is believed to have changed due to the invagination of the plasma membrane. The
origin of the endoplasmic reticulum and Golgi apparatus explains the same process.

There is strong evidence that the origin of the energy organelles occurred when a larger
eukaryotic cell engulfed smaller prokaryotic cells. Based on observation, infected amoeba with
bacteria can become dependent upon them. Therefore, they believe that mitochondria and
chloroplasts came from prokaryotes that were taken up by a giant cell. Also, mitochondria were
initially aerobic heterotrophic bacteria, and chloroplasts have initially been cyanobacteria.
Prokaryotes' ability to utilize their oxygen and create their food causes them to be taken up and
not destroyed; this premise also benefited the eukaryotic host cell. Therefore, these
circumstances become a relationship in living in close association. This proposition is known as
the endosymbiotic theory (endo-, “in,”; symbiosis, “living together”). Some of the evidence
supporting this hypothesis is as follows:

• Mitochondria and chloroplasts are similar to bacteria size and in structure

Cell and Molecular Biology | BIOL 30095 20

 • A double membrane surrounds both organelles where the outer layer may come from the
submerged vesicle, and the inner membrane may derive from the invagination of the
plasma membrane from the original prokaryote.
• Mitochondria and chloroplasts also contain genetic material and undergo cell division.
Their DNA (deoxyribonucleic acid) is similar to prokaryotes, a circular loop.
• Mitochondria and chloroplasts produce their protein from their ribosomes, although the
eukaryotic host produces some. Their ribosomes resemble those of prokaryotes.
• The RNA (ribonucleic acid) base sequence of the ribosomes in chloroplasts and
mitochondria also suggests a prokaryotic origin of these organelles.

Explain Endosymbiotic Theory in relation to compartmentalization found in cells.

It was noted that cells possess receptors on their surface that allow them to respond to specific
stimuli. Many cells in the human body possess receptors that allow them to bind specific
hormones that circulate in the blood. Why do you think these hormone receptors are important?
What would be the effect on the physiological activities of the body if cells lacked these receptors,
or if all cells had the same receptors?

Cell and Molecular Biology | BIOL 30095 21

 Viruses

Viruses are responsible for dozens of

human diseases, including AIDS,
polio, influenza, cold sores, measles,
Capsid
and a few types of cancer. Viruses Coat Protein
occur in a wide variety of very different
shapes, sizes, and constructions, but Lipid Bilayer
all of them share certain common
RNA
properties. All viruses are obligatory
intracellular parasites; that is, they
cannot reproduce unless present
within a host cell. Depending on the
specific virus, the host may be a plant,
animal, or bacterial cell. Outside of a living cell, the virus exists as a particle, or virion, which is
little more than a macromolecular package. The virion contains a small amount of genetic material
that, depending on the virus, can be single-stranded or double-stranded, RNA or DNA.
Remarkably, some viruses have as few as three or four different genes, but others may have as
many as several hundred. The genetic material of the virion is surrounded by a protein capsule,
or capsid. Virions are macromolecular aggregates, inanimate particles that by themselves are
unable to reproduce, metabolize, or carry on any of the other activities associated with life. For
this reason, viruses are not considered to be organisms and are not described as being alive.
Viral capsids are generally made up of a
specific number of subunits. There are
DNA numerous advantages to construction by
Capsid subunit, one of the most apparent being an
economy of genetic information. If a viral coat
is made of many copies of a single protein, as
Neck
is that of TMV, or a few proteins, as are the
coats of many other viruses, the virus needs
Tail Sheath only one or a few genes to code for its protein
container. Many viruses have a capsid whose
subunits are organized into a polyhedron, that
Tail Fiber is, a structure having planar faces. A
particularly common polyhedral shape of
viruses is the 20-sided icosahedron. In many
Base plate animal viruses, including the human
immunodeficiency virus (HIV) responsible for
Pins AIDS, the protein capsid is surrounded by a
lipid-containing outer envelope that is derived
from the modified plasma membrane of the
T-even bacteriophage
host cell as the virus buds from the host-cell
surface. Bacterial viruses, or bacteriophages, are among the most complex viruses. They are also

Cell and Molecular Biology | BIOL 30095 22

the most abundant biological entities on Earth. The T bacteriophages (which were used in key
experiments that revealed the structure and properties of the genetic material) consist of a
polyhedral head containing DNA, a cylindrical stalk through which the DNA is injected into the
bacterial cell, and tail fibers, which together cause the particle to resemble a landing module for
the moon.

Each virus has on its surface a protein that is able to bind to a particular surface component of its
host cell. For example, the protein that projects from the surface of the HIV particle interacts with
a specific protein (called CD4) on the surface of certain white blood cells, facilitating entry of the
virus into its host cell. The interaction between viral and host proteins determines the specificity
of the virus, that is, the types of host cells that the virus can enter and infect. Some viruses have
a wide host range, being able to infect cells from a variety of different organs or host species.

There are two basic types of viral infection. (1) In most cases, the virus arrests the normal
synthetic activities of the host and redirects the cell to use its available materials to manufacture
viral nucleic acids and proteins, which assemble into new virions. Viruses, in other words, do not
grow like cells; they are assembled from components directly into the mature-sized virions.
Ultimately, the infected cell ruptures (lyses) and releases a new generation of viral particles
capable of infecting neighboring cells. (2) In other cases, the infecting virus does not lead to the
death of the host cell, but instead inserts (integrates) its DNA into the DNA of the host cell’s
chromosomes. The integrated viral DNA is called a provirus. An integrated provirus can have
different effects depending on the type of virus and host cell. For example,

• Bacterial cells containing a provirus behave normally until exposed to a stimulus, such as
ultraviolet radiation, that activates the dormant viral DNA, leading to the lysis of the cell
and release of viral progeny.
• Some animal cells containing a provirus produce new viral progeny that bud at the cell
surface without lysing the infected cell. Human immunodeficiency virus (HIV) acts in this
way; an infected cell may remain alive for a period, acting as a factory for the production
of new virion
• Some animal cells containing a provirus lose control over their own growth and division
and become malignant. This phenomenon is readily studied in the laboratory by infecting
cultured cells with the appropriate tumor virus.

Viruses are not without their virtues. Because the activities of viral genes mimic those of host
genes, investigators have used viruses for decades as a research tool to study the mechanism of
DNA replication and gene expression in their much more com- plex hosts. In addition, viruses are
now being used as a means to introduce foreign genes into human cells, a technique that will
likely serve as the basis for the treatment of human diseases by gene therapy. Lastly, insect- and
bacteria-killing viruses may play an increasing role in the war against insect pests and bacterial
pathogens. Bacteriophages have been used for decades to treat bacterial infections in eastern
Europe and Russia, while physicians in the West have relied on antibiotics. Given the rise in
antibiotic-resistant bacteria, bacteriophages may be making a comeback on the heels of
promising studies on infected mice. Several biotechnology companies are now producing

Cell and Molecular Biology | BIOL 30095 23

bacterio- phages intended to combat bacterial infections and to protect certain foods from
bacterial contamination.

Viroid

An infectious agent consisting of a small circular RNA molecule that totally lacks a protein coat
named viroid. The RNAs of viroid range in size from about 240 to 600 nucleotides, one- tenth the
size of the smaller viruses. No evidence has been found that the naked viroid RNA encodes any
proteins. Rather, any biochemical activities in which viroid engage take place using host-cell
proteins. For example, duplication of the viroid RNA within an infected cell utilizes the host’s RNA
polymerase II, an enzyme that normally transcribes the host’s DNA into messenger RNAs. Viroid
are thought to cause disease by interfering with the cell’s normal path of gene expression.

Prions

A number of fatal brain diseases, known as transmissible spongiform encephalopathies, or TSEs,

have been attributed to prions, a term coined for proteinaceous infectious particles. Prions are
proteins that normally exist in an animal but have a different conformation, or structure. Like
viruses, prions cannot replicate on their own but cause infection by interacting with a normal
protein and altering its structure. The process that changes the structure from the normal protein
conformation to the prion conformation can be as simple as changing a chemical bond. Once a
prion infects tissue, a chain reaction begins that converts normal proteins to prions at an
exponential rate. TSEs are neurodegenerative diseases, or those that destroy nerve tissue in the
brain. In the brain, prion proteins form clusters that break down normal brain tissue, creating small
holes that give the brain a spongy appearance. All TSEs are untreatable and fatal. Mad cow
disease, or bovine spongiform encephalopathy (BSE), is a neurodegenerative disease of cattle
that is transmissible to humans by eating cattle brains or meat contaminated with prion-infected
brain tissue. The disease occurred after the individual had participated in the cannibalistic practice
of eating a deceased person’s brain, the brain was evidently infected with prions

Explain the unique characteristics of viruses compared to living cells.

Cell and Molecular Biology | BIOL 30095 24

“Virus is not a cell”, explain.

Module Assessment:

1. The cells of plant seeds store oils in the form of droplets enclosed by membranes. Unlike
typical biological membranes, this oil droplet membrane consists of a single layer of
phospholipids rather than a bilayer. Draw a model for a membrane around such an oil
droplet. Explain why this arrangement is more stable than a bilayer of phospholipids.
2. You are studying a disease of crops that causes stunted growth of the plants and spots in
their leaves. You find out that the sap from the infected plant has the capability to transmit
the disease to healthy plant. When you examine the juice under the microscope, there is
no bacterial evidences. You also filter the sap whose pores are small that no known
bacteria will be filtered, but then the sap still transmit the disease. What kinds of
experiments might you perform today to test this hypothesis?
3. The number of mitochondria varies in each cell, for example, erythrocytes (red blood cells)
do not contain mitochondria compared to muscle cells. What would be the effect on the
cells if they lacked mitochondria? How does the mitochondria affect erythrocytes activity
in the human body?
4. Antibiotic medications work by targeting specific structures and functions in bacterial cells.
Side effects on the patient are usually minimal, because their eukaryotic cells do not
possess the same structures and characteristics as the prokaryotic pathogens. What
structures or functions of the prokaryotic cell would serve as good targets for new
antibiotics?
5. Explain the propagation of protists diversity in connection with endosymbiosis.

Cell and Molecular Biology | BIOL 30095 25

 Module 2

Cell Chemical Components

I. OBJECTIVES: At the end of this module, you should be able to:

• Differentiate cellular function in relation to its structure.

• Explain the structure and function in cells are closely related to the structure of molecules
and atoms.
• Discuss then importance of water

II. COURSE MATERIAL

The Importance of Carbon

Life’s molecular diversity is based on the properties

of carbon.
1. Carbon-based molecules are called
organic compounds, make up the cell dry
weight.
2. The number of electrons in the outermost
shell of its atoms determines an element’s
chemical properties.
3. A carbon atom has 4 electrons in a valence
shell that holds 8.
4. Carbon completes its outer shell by sharing
electrons with other atoms in four covalent
bonds.
5. Thus, each carbon atom is a connecting
point from which a molecule can branch in
up to four directions.
6. Compounds composed of only carbon and hydrogen are called hydrocarbons
7. Compounds with the same formula but different structural arrangements are called
isomers. Isomers can also result from different spatial arrangements of the four partners
bonded to a carbon atom.
8. Carbon is central to the chemistry of life.

Cell and Molecular Biology | BIOL 30095 26

 –Carbon-containing molecules produced by living organisms are called
biochemicals.
9. Hydrocarbons
– Contain only carbon and hydrogen.
– Vary in the number of carbons, and the
number of double and triple bonds
between carbons (unsaturated)
– Max number of H atoms (saturated)

Almost all the molecules a cell makes are composed

of carbon atoms bonded to one another and to atoms of other elements. Carbon is unparalleled
in its ability to form large and complex molecules, which build the structures and carry out the
functions required for life. Carbon’s ability to bond with four other atoms is the basis for building
large and diverse organic compounds. Therefore, carbon atoms lead the player in the chemistry
of life.

The organic chemistry of living cells is said to be special for two reasons: it occurs in an aqueous
environment and it accomplishes some very complex reactions. But do you suppose it is really all
that much different from the organic chemistry carried out in the top laboratories in the world?
Why or why not?

Plant leaves are covered with hydrocarbon constituents wax coating, what purpose of this
hydrocarbon coating serve?

Covalent and Non-covalent Bonding

Covalent

• Bonds between atoms with shared pairs of electrons are called covalent bonds.
– Molecules are stable combinations of atoms held together by covalent bonds.
– Compounds are molecules with more than one type of atom
• Electrons are present around an atom’s nucleus in “clouds” or orbitals that are roughly
defined by their boundaries, which may have a spherical or dumbbell shape. Each orbital

Cell and Molecular Biology | BIOL 30095 27

 contains a maximum of two electrons, which is why the electrons are grouped in pairs.
The innermost shell contains a single orbital (thus two electrons), the second shell
contains four orbitals (thus eight electrons), the third shell also contains four orbitals, and
so forth. The number of outer-shell electrons is a primary determinant of the chemical
properties of an element. Atoms with a similar number of outer-shell electrons have similar
properties. Lithium (Li) and sodium (Na), for example, have one outer-shell electron, and
both are highly reactive metals. Carbon (C) and silicon (Si) atoms can each bond with four
different atoms. Because of its size, however, a carbon atom can bond to other carbon
atoms, forming long-chained organic molecules, whereas silicon is unable to form
comparable molecules. Neon (Ne) and argon (Ar) have filled outer shells, making these
atoms highly nonreactive; they are referred to as inert gases.
• Shared electrons tend to be located more closely to the atom with the greater attractive
force, that is, the more electronegative atom. Among the atoms most commonly present
in biological molecules, nitrogen and oxygen are strongly electronegative.
• The sharing of one pair of electrons between atoms results in a single bond. Sometimes
two or even three pairs of electrons can be shared by two atoms, giving rise to double
bonds or triple bonds

Polar and Nonpolar Molecules

Molecules, such as water, that have an asymmetric distribution of charge (or dipole) are referred
to as polar molecules. Polar molecules of biological importance contain one or more
electronegative atoms, usually O, N, and/or S. Molecules that lack electronegative atoms and
strongly polarized bonds, such as molecules that consist entirely of carbon and hydrogen atoms,
are said to be nonpolar. The presence of strongly polarized bonds is of utmost importance in
determining the reactivity of molecules. Large nonpolar molecules, such as waxes and fats, are
relatively inert. Some of the more interesting biological molecules, including proteins and
phospholipids, contain both polar and nonpolar regions, which behave very differently.

Noncovalent

Covalent bonds are strong bonds between the atoms that make up a molecule. Interactions
between molecules (or between different parts of a large biological molecule) are governed by a
variety of weaker linkages called noncovalent bonds. Noncovalent bonds do not depend on
shared electrons but rather on attractive forces between atoms having an opposite charge. Even
though individual noncovalent bonds are weak, when large numbers of them act in concert, as
between the two strands of a DNA molecule or between different parts of a large protein, their
attractive forces are additive. Taken as a whole, they provide the structure with considerable
stability.

Cell and Molecular Biology | BIOL 30095 28

Types of Noncovalent bonds

1. Ionic bonds – attractions between charged atoms.

- Are weakened in the cell due to the presence of water by forming shells of
hydration
- They may be significant within large biological molecules as in the core of protein
where water is excluded.
- Noncovalent ionic bonds play an important role in holding the protein molecule
on the right (yellow atoms) to the DNA molecule on the left. Ionic bonds form
between positively charged nitrogen atoms in the protein and negatively charged
oxygen atoms in the DNA. The DNA molecule itself consists of two separate
strands held together by noncovalent hydrogen bonds. Although a single
noncovalent bond is relatively weak and easily broken, large numbers of these
bonds between two molecules, as between two strands of DNA, make the overall
complex quite stable.
- Example: The dissolution of a salt crystal. When placed in water, the Na+ and
Cl- ions of a salt crystal become surrounded by water molecules, breaking the ionic
bonds between the two ions. As the salt dissolves, the negatively charged oxygen
atoms of the water molecules associate with the positively charged sodium ions,
and the positively charged hydrogen atoms of the water molecules associate with
the negatively charged chloride ions

2. Hydrogen bonds - enhance solubility in

and interactions with water
- A hydrogen bond occurs when
covalently bound hydrogen has a
partial positive charge and attracts
electrons of a second atom.
- H-bonds determine the structure
and properties of water.
- H-bonds occur between polar
groups in biological molecules, such
as between the strands of DNA.
- Hydrogen bonds form between a
bonded electronegative atom, such
as nitrogen or oxygen, which bears
a partial negative charge, and a
bonded hydrogen atom, which bears a partial positive charge. Hydrogen bonds
(about 0.18 nm) are typically about twice as long as the much stronger covalent
bonds.

3. Hydrophobic Interactions
- These occur when nonpolar molecules associate and minimize their exposure to
polar molecules by forming aggregates or micelles

Cell and Molecular Biology | BIOL 30095 29

 - Lack charged region that can interact with poles of water molecules & are thus
insoluble in water
- Hydrophobic, nonpolar R groups congregate in soluble protein interior away from
HO
2
- In a hydrophobic interaction, the nonpolar (hydrophobic) molecules are forced
into aggregates, which minimizes their exposure to the surrounding water
molecules.

4. Van de Waals Forces

- attractions between nonpolar molecules or hydrophobic groups are due to
transient dipole formation (change in electron distribution)
- Biological molecules must be close
together & interacting portions have
complementary shapes that allow
close approach; many atoms of both
interactants can approach each
other closely
- For example, interactions between
antibodies and viral antigens
- Van der Waals forces operate at
optimum distances and are maximized by complementary surfaces.

Why salt stop water from freezing?

The Importance of Water

Properties of Water for Sustaining Life

1. The structure of water is suitable for sustaining

life.
- It is asymmetric – both H atoms are on
one side.
- Both covalent O–H bonds are highly
polarized.
- All three atoms readily form H-bonds.

Cell and Molecular Biology | BIOL 30095 30

 2. The properties of water result from its structure.
- It is asymmetric—both H atoms are on one
side.
- High heat capacity - heat energy disrupts H
bonds instead of causing molecular motion
that is measured as increased
temperature, so temperature does not rise
too fast
- High heat of vaporization - a lot of heat to
break the H bonds in order to evaporate
- It is an excellent solvent for many
substances.
- It determines the interactions between
many biological solutes
- It is a reactant or product in many cellular reactions
5. It is a universal solvent.
6. It has a high surface tension due to H bond.
7. Frozen water is less dense than liquid water.
8. It exhibits cohesion and adhesion

Explain the mechanism behind (a) dissolving of sugar in water, (b) fat droplets in aqueous
solution, (c) cooling temperature in the body, and (d) water interaction in the plasma membrane

Nature of Biological Molecules

The unique properties of an organic compound depend not only on the size and shape of its
carbon skeleton but also on the groups of atoms that are attached to that skeleton.

Functional groups—groups of atoms giving organic molecules different characteristics and

properties.
- Usually contain one or more electronegative atoms (N, P, O and/or S) & thus make
organic molecules more polar, more water soluble & more reactive
- Many are capable of ionization & may become positively or negatively charged

Cell and Molecular Biology | BIOL 30095 31

 Functional Groups
Hydroxyl Group
- consists of a hydrogen atom
bonded to an oxygen atom,
which in turn is bonded to the
carbon skeleton
- other organic compounds
containing hydroxyl groups are
called alcohols
Carbonyl Group
- carbon atom is linked by a
double bond to an oxygen atom
- if the carbonyl group is at the
end of a carbon skeleton, the
compound is called an
aldehyde;
- if it is within the chain, the
compound is called a ketone
Carboxyl Group
- carbon double-bonded to an
oxygen atom and also bonded
to a hydroxyl group
- Compounds with carboxyl
groups are called carboxylic
acids
Amino Group
- nitrogen bonded to two
hydrogens and the carbon
skeleton. It acts as a base by
picking up an H+ from a
solution
- organic compounds with an
amino group are called amines
- the building blocks of proteins
are called amino acids
because they contain an amino
and a carboxyl group

Cell and Molecular Biology | BIOL 30095 32

 Phosphate Group
- consists of a phosphorus atom
bonded to four oxygen atoms.
It is usually ionized and
attached to the car- bon
skeleton by one of its oxygen
atoms.
- Compounds with phosphate
groups are called organic
phosphates and are often
involved in energy transfers, as
is the energy-rich compound
ATP
Methyl Group
- consists of a carbon bonded to
three hydrogens
- compounds with methyl groups
are called methylated
compounds.
- Addition of methyl group in
DNA affects gene expression

The given compound is a hormonal medication

used in contraception and hormone therapy.
(a) identify the compound.

(b) identify the functional groups.

(c) explain the mechanism when the compound interferes with ovulation.

Cell and Molecular Biology | BIOL 30095 33

Functional Classification of Biological Molecules

Macromolecules: large structural and functional molecules in cells. Include four major
categories: proteins, nucleic acids, polysaccharides and lipids.
• Building blocks (precursors) of macromolecules include amino acids, nucleotides, sugars,
and fatty acids.
• Metabolic intermediates (metabolites): compounds formed in metabolic pathways.
• Molecules of miscellaneous function: include vitamins, hormones, ATP, creatine
phosphate and metabolic waste products (urea)

Monomers and Polymers

Making Polymers

Polysaccharides, proteins, and nucleic acids consist

of monomers (subunits) linked together by covalent
bonds formed during polymerization or
dehydration synthesis. Free monomers do not
simply react with each other to become
macromolecules. Rather, each monomer is first
activated by attachment to a carrier molecule that
subsequently transfers the monomer to the end of the
growing macromolecule.

Breaking Polymers

A macromolecule is disassembled by hydrolysis of the

bonds that join the monomers together. Hydrolysis is the
splitting of a bond by water. All of these reactions are
catalyzed by specific enzymes. the bond between
monomers is broken by the addition of a water molecule,
with the hydroxyl group from the water attaching to one
monomer and a hydrogen attaching to the adjacent
monomer.

Cell and Molecular Biology | BIOL 30095 34

Four Types of Biological Molecules

• Carbohydrates include simple sugars and sugar polymers

- They serve as energy storage molecules.
- Structure:
• Chemical formula is (CH2O)n
• Ketose sugars (ketones) have a carbonyl
(C=O) on an internal carbon; forms
ketone group (ex. Fructose)
• Aldose sugars (aldehydes) have a
carbonyl on a terminal carbon; forms
aldehyde group ( glucose)
• Sugars can be linear but sometimes form
ring structures.
– Stereoisomerism:
• Asymmetric carbons bond to four different groups (tetrahedron); C at the
center.
• Molecules with asymmetric carbons can exist in two mirror-image
configurations called enantiomers or stereoisomers.
• Enantiomers can be as either D- (OH grp to the right) or L-isomers (OH group
to the left) .
• Sugars can have many asymmetric carbons, but are designated D- or L-
according to the arrangement around the carbon farthest from the carbonyl
group or aldehyde (carbon associated with aldehyde is designated as C1)
– Linking Sugars Together:
• Covalent Glycosidic bonds are –C—O—C– links between sugars forms by
reaction between C1 of one sugar & OH of another
– Disaccharides are used as a source of readily available energy.
a. Sucrose and lactose are two of the most common disaccharides. Sucrose is
composed of glucose and fructose joined by an alpha (1 to 2) linkage,
whereas lactose is composed of glucose and galactose joined by a beta (1 to
4) linkage.
b. Sucrose (table sugar) - major component of plant sap; carries chemical
energy from one part of plant to another
c. Lactose (milk sugar) - fuel for early growth & development of newborns
i. lactase that hydrolyzes it is found in membranes of cells lining intestines
ii. If lose this enzyme after childhood, eating dairy products causes
digestive discomfort
– Oligosaccharides
a. small chains of sugars found bound to plasma membrane proteins
(glycoproteins) and lipids (glycolipids)
b. may be used for cell recognition

Cell and Molecular Biology | BIOL 30095 35

 c. help mediate specific interactions of a cell with its surroundings

Polysaccharides are polymers of sugars joined by glycosidic bonds.

1. Glycogen is an animal product made of branched glucose polymers.
– Human skeletal muscles have enough glycogen to fuel about 30 min of moderate
activity
– Stored in cells as highly concentrated, dark-staining, irregular granules
2. Starch is a plant product made of both branched (amylopectin) and unbranched, helical
( amylose) glucose polymers.
– Stored as amyloplasts in plant cells
– Amylase in animals hydrolyzes it
3. Cellulose is plant product made of unbranched polymers of glucose monomers
- tough, highly insoluble, plant cell wall component
- Cellulase synthesized by bacteria and protozoans in the gut of termites and
herbivores
4. Chitin is unbranched polymer of N-acetylglucosamine (acetyl amino group instead of OH
on glucose C2
- tough, resilient yet flexible
- Forms the exoskeleton of insects, spiders, crustaceans
5. Glycosaminoglycans (GAGs) is composed of two different sugars repeating
disaccharides (2 different sugars; —A—B—A—B—); found in extracellular space and in
connective tissues
6. Peptidoglycans is a polymer of NAG-NAM (N-acetyl glucosamine & N-acetyl-muramic
acid); structural component of bacterial
cell wall

**Three polysaccharides with identical sugar

monomers but dramatically different
properties. Glycogen (A), starch (B), and
A
cellulose (C) are each composed entirely of
glucose subunits, yet their chemical and physical
properties are very different due to the distinct
ways that the monomers are linked together (three
different types of linkages). Glycogen molecules B
are the most highly branched, starch molecules
assume a helical arrangement, and cellulose
molecules are unbranched and highly extended.
Whereas glycogen and starch are energy stores,
cellulose molecules are bundled together into
tough fibers that are suited for their structural role. C
Amyloplasts in a plant seed, and cellulose fibers
in a plant cell wall.

Cell and Molecular Biology | BIOL 30095 36

Starch is composed of two polysaccharides, amylose and amylopectin. Both polysaccharides are
polymers, which consist of repeating units of a-D-glucose.
(a) What is the difference between the structures of amylose and amylopectin?
(b) How do the structures of amylose and amylopectin alter their properties?

• Lipids are a diverse group of nonpolar molecules.

– Fats are made of glycerol
linked by three ester bonds to
three fatty acids (FAs);
triacylglycerol or
triglycerides; neutral lipids;
serves as lipid storage form
for fuel (stored in adipocytes)
– Fatty acids - long, unbranched hydrocarbon chains (hydrophobic) with single
carboxyl group (hydrophilic) at one end
• FAs are unbranched hydrocarbons with one carboxyl group; they are
amphipathic.
• Saturated FAs lack C=C double bonds and are solid at room temperature;
chains packed tightly together; animal sources
• Unsaturated FAs have one or more C=C double bonds and are liquid at
room temperature; bends or kinks that prevent close packing
a. In oils, double bonds lower the temperature at which a fatty acid containing lipid
melts
b. Multiple double bonds leads to oils being called polyunsaturated
c. Example: linseed oil – highly volatile lipid extracted from flax seeds, remains liquid
at much lower temperatures than tristearate

Cell and Molecular Biology | BIOL 30095 37

 **Soap - in past, soap was made
by heating animal fat in strong
alkali (NaOH, KOH) to break
fatty acid - glycerol bonds; most
are now made synthetically;
can dissolve grease
o Hydrophobic end of fatty
acids embeds in grease;
hydrophilic end interacts
with water
o Greasy materials form
complexes that can be
dispersed by water
(micelles)
• Margarine - formed from unsaturated vegetable oils by chemically reducing double
bonds with H atoms (hydrogenation)
• Steroids are four C fused rings animal lipids that have been implicated in
atherosclerosis; component of cholesterol, steroid hormones, vit D and bile acids
• Phospholipids are amphipathic lipids that are a major component of cell
membranes.

Which would you expect to resemble a sphingomyelin molecule more closely: a molecule of
phosphatidylcholine containing two molecules of palmitic acid as its fatty acid side chains or a
phosphatidylcholine molecule with one molecule of palmitate and one molecule of oleate as its
fatty acid side chains? Explain your reasoning.

Cell and Molecular Biology | BIOL 30095 38

 • Proteins are polymers of amino acids
and form a diverse group of
macromolecules.
– They exhibit a high degree of
specificity.
– They have a variety of cellular
functions.
– The Building Blocks of Proteins
• Amino acids have an α carbon, an amine group, a carboxyl group, and a variable
R group; 20 types of amino acids
• Amino acids in nature occurs as the L stereoisomer.
• Amino acids are linked together by peptide bonds into a polypeptide chain to
make a protein.
• Peptide bonds form between the α-carbonyl and the α-amino of participating
amino acids

**Amino acid structure. Ball-and-stick model (A) and chemical formula (B) of a
generalized amino acid in which R can be any of a number of chemical groups. (C)
The formation of a peptide bond occurs by the condensation of two amino acids,
drawn here in the uncharged state. In the cell, this reaction occurs on a ribosome
as an amino acid is transferred from a carrier (a tRNA molecule) onto the end of
the growing polypeptide chain.

– Amino acids differ in the R group attached to one of the bonds of the α-carbon.
• R groups may be polar charged; polar uncharged; nonpolar.

– The chemical structure of amino acids. These 20 amino acids represent those
most commonly found in proteins and, more specifically, those encoded by DNA.
Other amino acids occur as the result of a modification to one of those shown here.
The amino acids are arranged into four groups based on the character of their side
chains. All molecules are depicted as free amino acids in their ionized state as they
would exist in solution at neutral pH.
• Polar charged - contain R groups that act as stronger organic acids, bases;
can form ionic bonds
o Almost always fully charged (lysine, arginine, aspartic acid, glutamic acid)
at pH 7; side chains are relatively strong organic acids & bases

Cell and Molecular Biology | BIOL 30095 39

 o Can form ionic bonds due to charges; histones with arginine (+-charge)
bind to negatively charged phosphate groups of DNA
o Histidine - usually only partially charged at pH 7; often important in
enzyme active sites due to its ability gain or lose a proton in physiologic
pH ranges
• Polar uncharged - R groups weakly acidic or basic; not fully charged at pH 7;
can form H bonds with other molecules like water since they have atoms with
a partial negative or positive charge
o Asparagine & glutamine [amides of aspartic & glutamic acid], threonine,
serine, tyrosine
• Nonpolar - R groups hydrophobic; generally lack O & N; cannot interact with
water or form electrostatic bonds; vary primarily in size & shape; allows them
to pack tightly into protein core
o Alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine
o Associate with one another via hydrophobic & van der Waals interactions
in protein core
• The other three – glycine, proline, cysteine
• Glycine (R = H) - small R group makes backbone flexible & able to move
so it is useful in protein hinges; small R group allows 2 backbones (of same
or different protein) to approach closely
• Proline – R group forms ring with amino group (imino acid); hydrophobic
amino acid that does not readily fit into orderly secondary structure (a-helix)
• Cysteine – R group has reactive —SH; forms disulfide (—S—S—) bridge
with other cysteines often at some distance away in
polypeptide backbone

Protein Structures
• Protein Functions
o Enzymes
o Cytoskeletal elements
o Hormones, growth factors, gene activators
o Membrane receptors & transporters
o Contractile elements & molecular motors
o Antibodies and toxins
o Form blood clots
o Absorb or refract light
o Transport substances from one part of body to another

• Primary structure, the linear sequence of amino acids in the polymer, is critical to
the protein function; peptide bond; changes in sequence resulting from mutation
may not be readily tolerated

Cell and Molecular Biology | BIOL 30095 40

 • Secondary structure refers to the
conformation ( spatial organization;3-D
arrangement of atoms of a molecule) or
interactions between adjacent amino acids
into α-helix, β-sheet, hinges, turns, loops,
or finger-like extensions; H bonds
• Tertiary structure is the conformation of the
entire polymer. Protein Secondary Structure
o It is stabilized by intramolecular
noncovalent bonds between R groups in same chain or R groups at a distance
o It is studied by X-ray crystallography.
o Proteins can be fibrous ( structural
materials outside the cell; elongated or
flattened sheets) or globular ( within
the cells; compact shape).
o All of the noncovalent bonds thought to
occur between R groups within proteins
(H bonds, ionic bonds, hydrophobic
Protein Tertiary Structure - Globular
interactions, Van der Waals forces) have
been found
o Most proteins have both a-helix & b-pleated sheet
o Proteins are flexible and can change shape
o Protein Domains
o Domains occur when proteins are composed of two or more distinct
regions.
o Each domain is a functional region
o Dynamic Changes within Proteins
o May occur with protein activity.
o Conformational changes are non-random (predictable) movements
triggered by the binding of a specific molecule.
• Quaternary structure refers to proteins
composed of subunits.
o the linking of polypeptide chains
(subunits) to form multisubunit
functional protein via
intermolecular R group
interactions
o May be linked by disulfide bonds,
but more often noncovalent bonds
(hydrophobic, H bonds, ionic bonds,
Van der Waals) like hydrophobic
Protein Quaternary Structure
patches on complementary
surfaces of neighboring polypeptides
o Chains may be identical or nonidentical

Cell and Molecular Biology | BIOL 30095 41

 1. Protein composed of 2 identical subunits - homodimer
2. Protein composed of 2 nonidentical subunits – heterodimer

• Protein-Protein Interactions
o Different proteins can become physically associated to form a multiprotein
complex.

• Nucleic acids are polymers of nucleotides that

store and transmit genetic information.
– Deoxyribonucleic acid (DNA) holds the
genetic information in all cellular organisms
and some viruses for protein synthesis.
– Ribonucleic acid (RNA) is the genetic
material in some viruses.
– Nucleotides are connected by 3’-5’
phosphodiester bonds between the OH
group attached to the 3’ carbon of one
nucleotide to the phosphate group attached
to the 5’ carbon of the next nucleotide.
– Each nucleotide consists of three
parts:
• A five-carbon sugar
• A phosphate group
• A nitrogenous base
– Bases are either purines or
pyrimidines.
– The purines are adenine and
guanine in both DNA and RNA.
– The pyrimidines are cytosine and
uracil in RNA; uracil is replaced by
thymine in DNA.
– Nucleoside consists of sugar and
nitrogenous base
– nucleotides of RNA strand are known
as ri bunucleoside monophosphates
– RNA is usually single stranded and DNA is usually double stranded.
– RNA may fold back on itself to form complex three dimensional structures, as in
ribosomes.
– Types of RNA - ribosomal RNA (rRNA), transfer RNA (tRNA), messenger RNA
(mRNA)
– RNA may have catalytic activity; such RNA enzymes are called ribozymes.
– Adenosine triphosphate (ATP) is an RNA nucleotide that plays a key role in
cellular metabolism, whereas guanosine triphosphate (GTP) binds to variety of
proteins which serves as a switch to turn on some proteins.

Cell and Molecular Biology | BIOL 30095 42

Draw the structure of the following:
(a) a purine base
(b) a pyrimidine base
(c) a triphosphate of guanosine
(d) a diphosphate of uridine

Module Assessment:

1. For each of the following pairs of molecules, specify a property that would distinguish
between them, and indicate two different tests that could be used to make that distinction:
(a) The protein insulin and the DNA in the gene that encodes insulin
(b) The DNA that encodes insulin and the messenger RNA for insulin
(c) Starch and cellulose
(d) Amylose and amylopectin
(e) The monomeric protein myoglobin and the tetrameric protein hemoglobin
(f) A triacylglycerol and a phospholipid with a very similar fatty acid content
(g) A glycolipid and a sphingolipid
(h) A bacterial cell wall polysaccharide and chitin
2. How would you define a lipid? In what sense is the operational definition different from
that of proteins, nucleic acids, or carbohydrates?
3. Describe in detail the DNA double helix with reference to each of the following features:
(a) the sugar-phosphate backbone; (b) the functional groups at the end of each strand; (c)
the hydrogen bonding between bonds
4. Hydrogen bonding stabilizes both the secondary and tertiary structures of a protein. (a)
What functional groups hydrogen bond to stabilize secondary structure? (b) What
functional groups hydrogen bond to stabilize tertiary structure?

Cell and Molecular Biology | BIOL 30095 43

 MODULE 3

Central Dogma of Molecular Biology

I. OBJECTIVES: At the end of this module, you should be able to:

• differentiate prokaryotic and eukaryotic genome, chromosome and enzymes involved in

replication, transcription, and translation.
• compare replication, transcription, and translation in prokaryotic and eukaryotic organism
•

II. COURSE MATERIAL

THE CHROMOSOME

Evolutionary selection for ideal

genome preservation, replication,
and expression should produce
parallel chromosome organizations
in any type of cells. And yet, the
chromosome organization is
remarkably different between
eukaryotes and prokaryotes. The
nuclear versus cytoplasmic
accommodation of genetic material
accounts for the distinct eukaryotic
and prokaryotic modes of genome
evolution.

Prokaryotes are monoploid=they

have only one set of genes (one copy of the genome). In most viruses and prokaryotes, the single
set of genes is stored in a single chromosome. Prokaryotic genomes are exemplified by E. coli
chromosome. Experiments in which DNA from E. coli is carefully isolated free of most of the
attached proteins and observed under the microscope reveal one level organization of the
nucleoid. Their DNA consist of 50-100 domains or loops. The loops are about 50-100 Kb
(kilobases). Eukaryotic organisms have a nucleus in their cells and true organelles covered with
membranes. The genome of these organisms is located inside the nucleus.

The below figure shows the organization of nucleosome that will become a chromosome at certain
distance. The DNA segment is wrapped around the protein known as histones. The tight
association of DNA to histones is one way of controlling gene expression. Modification of this
interaction leads to turning on the genes, hence transcription would occur.

Cell and Molecular Biology | BIOL 30095 44

The figure on the right shows the level of
organization of chromosome down to DNA.
The hierarchy of structure is being labeled
Images adapted from www.nature.com
from 1 to 8.

During DNA packaging, DNA form

complexes with positively charged proteins
and exist as stable structures called
chromatin fibers. Chromatin fibers
collectively make the chromosomes.
Chromatin fiber can be defined as a fiber
composed of DNA and histone protein
complexes.

A chromosome can be defined as a thread

like structure composed of chromatin fibers.
This is the key difference between
chromatin and chromosomes.
Chromosomes are the carriers of genetic
information. A number of early observations
led biologists to consider the genetic role of
chromosomes.

If genes are packaged together on Images

chromosomes that are passed from parents to offspring, then adapted from www.nature.com
genes on the same chromosome should be linked to one another to form a linkage group.

DNA STRUCTURE AND REPLICATION

• The two complementary

strands of the DNA double
helix run in antiparallel
directions
• The phosphodiester
connection between individual
deoxynucleotides is
directional.
• It connects the 5’-hydroxyl
group of one nucleotide with
the 3’-hydroxyl group of the
next nucleotide.
• The strand backbones are
closer together on one side of
the helix than on the other. The
major groove occurs where
the backbones are far apart,
the minor groove occurs
where they are close together.
The grooves twist around the molecule on opposite sides.

Cell and Molecular Biology | BIOL 30095 45

 • The spaces between adjacent turns of the helix form two grooves of different width—a
wider major groove and a more narrow minor groove—that spiral around the outer surface
of the double helix. Proteins that bind to DNA often contain domains that fit into these
grooves.

Draw and label a structure of one strand of DNA with 10 nucleotides: 5’ AATCGATCGG 3’ Use
this picture as a guide.

Explain the following: (a) DNA strand has polarity (b)two strands are antiparallel (c) the molecule
has a major groove and a minor groove (d) the strands are complementary to one another

DNA Polymerase

For DNA replication to proceed, the major enzyme involved, DNA Polymerase should play a big
part of the process. This DNA polymerase would vary from prokaryotic to eukaryotic organisms.
E. coli bacteria contains 5 different DNA polymerases : DNA Pol I, DNA Pol II, DNA Pol III, DNA
Pol IV, and DNA Pol V. Eukaryotic cells contain 5 different DNA polymerases: α, β, γ, δ, and ε.

Cell and Molecular Biology | BIOL 30095 46

Eukaryotic DNA polymerase β is most similar to E. coli DNA Pol I because its main function is
associated with DNA repair, rather than replication.

Complete the table by providing information inside each box

DNA Source: 3’-5’ Exonuclease 5’-3’ Role
Polymerase Prokaryotic or (Proofreading) Exonuclease
Eukaryotic? Yes/No? (Excision)
Yes or No?
I
II
III
IV
V
α
β
ε
γ
δ

DNA REPLICATION

This begins at a defined origin, bidirectional, and is

semiconservative (one new chain, one old chain in
daughter DNA), and chain growth occurs in the 5’ to
3’ direction. Chromosomal DNA is normally packaged
around histones. At unique DNA sites called origins of
replication, unwinding proteins (helicases) unwind the
helix in an ATP-dependent manner. Single-strand
binding proteins then bind to and stabilize the single-
stranded and DNA regions to keep them single
stranded. At each replication fork there are two DNA
polymerase complexes. As the double-stranded DNA
is unwound, two template strands are exposed. One
of the templates can be replicated in a continuous
fashion by DNA polymerase since a continuous
synthesis of new strands can occur in the 5’ to 3’
direction as the template strand is exposed.

Cell and Molecular Biology | BIOL 30095 47

Since all growing chains must be synthesized
in the 5’ to 3’ direction, the lagging chain must
be continuously reinitiated as new template is
exposed. The lagging strand is then
synthesized discontinuously, in pieces that
must be joined together later. After synthesis,
the RNA primers must be removed, gaps filled
in, and the strands joined to give a linear,
duplex DNA. New histones are added to the
lagging strand (which is now a duplex) while the
old histones remain with the leading strand.

Differentiate Prokaryotic and Eukaryotic after

reading this section in terms of DNA replication and chromosome structure

How do eukaryotes overcome telomere replication challenges?

TRANSCRIPTION: DNA to RNA

During initiation of transcription, RNA polymerase forms a transcription bubble and begins
polymerization of ribonucleotides (rNTPs) at the start site, which is located within the promoter
region. Once a DNA region has been transcribed, the separated strands reassociate into a double
helix, displacing the nascent RNA except at its 3’ end. The 5’ end of the RNA strand exits the
RNA polymerase through a channel in the enzyme. Termination occurs when the polymerase
encounters a specific termination sequence (stop site).

Cell and Molecular Biology | BIOL 30095 48

The figure to the right shows how
transcription factors sequentially associate
and interact themselves in the specific
segment of a DNA before the recruitment of
RNA polymerase.
Transcription is the process by which DNA is
being converted into RNA using the enzyme
RNA polymerase. But before this RNA
polymerase binds to the specific sequence of
DNA, many regulatory proteins interact on the
regulatory region of the DNA creating a
landmark for RNA polymerase to initiate
synthesis of transcripts. RNA polymerase
temporarily unwinds DNA and bids to
promoter with the aid of GTF of general
transcription factors. This enzyme catalyzes
phosphodiester bonds between
ribonucleotides using exposed DNA template
which moves down template in 3’ to 5’
direction. It adds ribonucleotide triphosphate
in a 5’ to 3’ direction. RNA does not remain H
bound to DNA, when DNA helix reforms, RNA
is being displaced.

How does RNA polymerase ensure that the reaction is irreversible?

Cell and Molecular Biology | BIOL 30095 49

Of all the transcription factors mentioned in the figure above, which GTF has the enzymatic
activity?

What are the roles of repressor and activators in the gene?

Draw the anatomy of the gene and give a brief description.

What is the difference in bacteria and in plant in terms of mRNA processing?

PROMOTERS

In genetics, a promoter is a sequence of DNA to which proteins bind that initiate transcription of
a single RNA from the DNA downstream of it. This RNA may encode a protein, or can have a
function in and of itself, such as tRNA, mRNA, or rRNA. Promoters are located near the
transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand).
• In bacteria: The promoter is recognized by RNA polymerase and an associated sigma
factor, which in turn are often brought to the promoter DNA by an activator protein's
binding to its own DNA binding site nearby.
• In eukaryotes: The process is more complicated, and at least seven different factors are
necessary for the binding of an RNA polymerase II to the promoter

Relative location. Positions in the promoter are designated relative to the transcriptional start
site, where transcription of DNA begins for a particular gene (i.e., positions upstream are negative
numbers counting back from -1, for example -100 is a position 100 base pairs upstream).

Eukaryotic Promoter

Cell and Molecular Biology | BIOL 30095 50

1. Core promoter – the minimal portion of the promoter required to properly initiate transcription
Includes the transcription start site (TSS) and elements directly upstream
A binding site for RNA polymerase
• RNA polymerase I: transcribes genes encoding 18S, 5.8S and 28S ribosomal RNAs
• RNA polymerase II: transcribes genes encoding messenger RNA and certain small
nuclear RNAs and microRNA
• RNA polymerase III: transcribes genes encoding transfer RNA, 5s ribosomal RNAs and
other small RNAs
General transcription factor binding sites, e.g. TATA box, B recognition element.
Many other elements/motifs may be present. There is no such thing as a set of "universal
elements" found in every core promoter.
2. Proximal promoter – the proximal sequence upstream of the gene that tends to contain primary
regulatory elements
• Approximately 250 base pairs upstream of the start site
• Specific transcription factor binding sites
3. Distal promoter – the distal sequence upstream of the gene that may contain additional
regulatory elements, often with a weaker influence than the proximal promoter
• Anything further upstream (but not an enhancer or other regulatory region whose influence
is positional/orientation independent)
• Specific transcription factor binding sites
Prokaryotic Promoter
In bacteria, the promoter contains two short sequence elements approximately 10 (Pribnow
Box) and 35 nucleotides upstream from the transcription start site.

• The sequence at -10 (the -10 element) has the consensus sequence TATAAT.
• The sequence at -35 (the -35 element) has the consensus sequence TTGACA.

Example position of the promoter.

RNA SPLICING
RNA splicing is a form of RNA processing in which a newly made precursor messenger RNA (pre-
mRNA) transcript is transformed into a mature messenger RNA (mRNA). During splicing, introns
(Non-coding regions) are removed and exons (Coding Regions) are joined together. For nuclear
encoded genes, splicing takes place within the nucleus either during or immediately after
transcription.

For those eukaryotic genes that contain introns, splicing is usually required in order to create an
mRNA molecule that can be translated into protein. For many eukaryotic introns, splicing is carried
out in a series of reactions which are catalyzed by the spliceosome, a complex of small nuclear
ribonucleoproteins (snRNPs). Self-splicing introns, or ribozymes capable of catalyzing their own
excision from their parent RNA molecule, also exist.
Eukaryotes are more much complex than prokaryotes in terms of gene expression such as
alternative splicing which is more common in eukaryotes.

Cell and Molecular Biology | BIOL 30095 51

Alternative splicing or alternative use of
multiple poly(a) sites can be used to
generate an RNA (and protein) that is
missing a portion of the information present
in the gene. These mechanisms are useful
in generating two proteins from the same
gene.

A soluble and a membrane-bound form of

the same protein can be made from the
same RNA by simply splicing out or
skipping the membrane-anchor sequences
during RNA processing. After synthesis,
the primary transcript (hnRNA—for
heterogeneous nuclear) is capped on the
5end with an inverted G residue.

The G is not actually backward or inverted;

the inverted refers to the fact that the 5end
is capped by forming a phosphate ester
between the 5end of the DNA and the 5-
triphosphate of 7-methyl-GTP rather than
the normal
5—3bond.

This stabilizes the message against

degradation from exonucleases and
provides a feature that is recognized by the
ribosome. Next the message is tailed on
the 3end with a stretch of A’s of variable
length (100 to 200 nucleotides).

There is not a corresponding set of T’s in

the DNA template. Poly(A) addition
requires a sequence (AAUAAA) in the RNA
that helps direct the cleavage of the
transcript and the addition of the poly(A) tail
by poly(A) polymerase, an RNA
polymerase that does not use a
template.Transcription is the first of several
steps of DNA based gene expression in
which a particular segment of DNA is
copied into RNA (especially mRNA) by the
enzyme RNA polymerase.

Both DNA and RNA are nucleic acids,

which use base pairs of nucleotides as a
complementary language. During
transcription, a DNA sequence is read by
an RNA polymerase, which produces a

Cell and Molecular Biology | BIOL 30095 52

complementary, antiparallel RNA strand called a primary transcript.

To review, transcription proceeds in the following general steps:

1. RNA polymerase, together with one or more general transcription factors, binds to
promoter DNA.
2. RNA polymerase generates a transcription bubble, which separates the two strands of the
DNA helix. This is done by breaking the hydrogen bonds between complementary DNA
nucleotides.
3. RNA polymerase adds RNA nucleotides (which are complementary to the nucleotides of
one DNA strand).
4. RNA sugar-phosphate backbone forms with assistance from RNA polymerase to form an
RNA strand.
5. Hydrogen bonds of the RNA–DNA helix break, freeing the newly synthesized RNA strand.
6. If the cell has a nucleus, the RNA may be further processed. This may include
polyadenylation, capping, and splicing.
7. The RNA may remain in the nucleus or exit to the cytoplasm through the nuclear pore
complex.

Reverse Transcription

A retrovirus has a membrane containing glycoproteins, which are able to bind to a receptor protein
on a host cell. There are two strands of RNA within the cell that have three enzymes: protease,
reverse transcriptase, and integrase. The first step of replication is the binding of the glycoprotein
to the receptor protein. Once these have been bound, the cell membrane degrades, becoming
part of the host cell, and the RNA strands and enzymes enter the cell.

What is the importance of discovering reverse transcription in development diagnostic kits?

Provide an example.

Briefly describe the process of RT-PCR.

Cell and Molecular Biology | BIOL 30095 53

Within the cell, reverse transcriptase creates a
complementary strand of DNA from the
retrovirus RNA and the RNA is degraded; this
strand of DNA is known as cDNA. The cDNA is
then replicated, and the two strands form a weak
bond and enter the nucleus. Once in the
nucleus, the DNA is integrated into the host
cell's DNA with the help of integrase. This cell
can either stay dormant, or RNA may be
synthesized from the DNA and used to create
the proteins for a new retrovirus. Ribosome units
are used to translate the mRNA of the virus into
the amino acid sequences which can be made
into proteins in the rough endoplasmic
reticulum. This step will also make viral
enzymes and capsid proteins. Viral RNA will be
made in the nucleus. These pieces are then
gathered together and are pinched off of the cell
membrane as a new retrovirus.

TRANSLATION: RNA to Protein

Components

Translation takes place inside structures

called ribosomes, which are made of
RNA and protein. Ribosomes organize
translation and catalyze the reaction that
joins amino acids to make a protein
chain.
tRNA is an adaptor molecule composed
of RNA, typically 76 to 90 nucleotides in
length, that serves as the physical link
between the mRNA and the amino acid
sequence of proteins.

Translation of the mRNA template converts Image credit: "Translation: Figure 1," by OpenStax
nucleotide-based genetic information into the College, Concepts of Biology, CC BY 4.0.
“language” of amino acids to create a protein
product. A protein sequence consists of 20
commonly occurring amino acids. Each amino acid is defined within the mRNA by a triplet of
nucleotides called a codon. The relationship between an mRNA codon and its corresponding
amino acid is called the genetic code.

Cell and Molecular Biology | BIOL 30095 54

 There are 61 codons for amino acids, and each
of them is "read" to specify a certain amino acid
out of the 20 commonly found in proteins. One
codon, AUG, specifies the amino acid methionine
and also acts as a start codon to signal the start
of protein construction. There are three more
codons that do not specify amino acids. These
stop codons, UAA, UAG, and UGA, tell the cell
when a polypeptide is complete. All together, this
collection of codon-amino acid relationships is
called the genetic code, because it lets cells
“decode” an mRNA into a chain of amino acids.
Image modified from "Translation: Figure 3," by OpenStax
College, Biology (CC BY 4.0). Each mRNA contains a series of codons
(nucleotide triplets) that each specifies an amino
acid. The correspondence between mRNA
codons and amino acids is called the genetic code.

Prokaryotic translation is the process by which

messenger RNA is translated into proteins in
prokaryotes. Initiation of translation in prokaryotes
involves the assembly of the components of the
translation system, which are: the two ribosomal
subunits (50S and 30S subunits); the mature mRNA
to be translated; the tRNA charged with N-
formylmethionine (the first amino acid in the nascent
peptide); guanosine triphosphate (GTP) as a source
of energy, and the three prokaryotic initiation factors
IF1, IF2, and IF3, which help the assembly of the
initiation complex. Variations in the mechanism can
be anticipated.

Elongation of the polypeptide chain involves addition of amino acids to the carboxyl end of the
growing chain.

Termination occurs when one of the three termination codons moves into the A site. These codons
are not recognized by any tRNAs. Instead, they are recognized by proteins called release factors,
namely RF1 (recognizing the UAA and UAG stop codons) or RF2 (recognizing the UAA and UGA
stop codons). These factors trigger the hydrolysis of the ester bond in peptidyl-tRNA and the
release of the newly synthesized protein from the ribosome. A third release factor RF-3 catalyzes
the release of RF-1 and RF-2 at the end of the termination process.

Cell and Molecular Biology | BIOL 30095 55

The above reaction is catalyzed by aminoacyl
tRNA synthetases. An aminoacyl-tRNA
synthetase (aaRS or ARS), also called tRNA-
ligase, is an enzyme that attaches the
appropriate amino acid onto its tRNA. It does
so by catalyzing the esterification of a specific
cognate amino acid or its precursor to one of
all its compatible cognate tRNAs to form an
aminoacyl-tRNA. In humans, the 20 different
types of aa-tRNA are made by the 20 different
aminoacyl-tRNA synthetases, one for each
amino acid of the genetic code.

This is sometimes called "charging" or

"loading" the tRNA with the amino acid. Once
the tRNA is charged, a ribosome can transfer the amino acid from the tRNA onto a growing
peptide, according to the genetic code. Aminoacyl tRNA therefore plays an important role in RNA
translation, the expression of genes to create proteins.

The mechanism can be summarized in the following reaction series:

Amino Acid + ATP → Aminoacyl-AMP + PPi

Aminoacyl-AMP + tRNA → Aminoacyl-tRNA + AMP
Summing the reactions, the highly exergonic overall reaction is as follows:

Amino Acid + tRNA + ATP → Aminoacyl-tRNA + AMP + PPi

In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm
or ER synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus.
The entire process is called gene expression.
.
In translation, messenger RNA (mRNA) is
decoded in the ribosome decoding center to
produce a specific amino acid chain, or
polypeptide. The polypeptide later folds into
an active protein and performs its functions in
the cell. The ribosome facilitates decoding by
inducing the binding of complementary tRNA
anticodon sequences to mRNA codons. The
tRNAs carry specific amino acids that are
chained together into a polypeptide as the
mRNA passes through and is read by the
ribosome. The basic process of translation is
the addition of one amino acid at a time to the
end of the polypeptide being formed. This
process takes place inside the ribosome. A ribosome is made up of a subunit, a small 40S subunit
or a large 60S subunit. These subunits come together before translation of mRNA into a protein
to provide a location for translation to be carried out and a polypeptide to be produced.
The choice of amino acid type to be added is determined by the genetic code on the mRNA
molecule. Each amino acid added is matched to three nucleotide subsequences of the mRNA.

Cell and Molecular Biology | BIOL 30095 56

For each such triplet possible, the corresponding amino acid is accepted. The successive amino
acids added to the chain are matched to successive nucleotide triplets in the mRNA.

Translating Genetic Information

Initiation of Protein Synthesis in Eukaryotes

• Eukaryotic cells require at least 12 initiation factors comprising a total of more than
25 polypeptide chains.
• Once the 43S preinitiation complex is formed, it is ready to find the 5’ mRNA.
• Protein-protein interactions between eIF3 and eIF4G drive the interaction.
• Once the 43S complex scans to the appropriate AUG codon, eIF2-GTP is
hydrolyzed, eIF2-GDP (and other associated eIFs) are released, and the large
(60S) subunit joins the complex to complete the initiation phase.

The role of Ribosome

– Ribosomes have three sites for tRNAs: the A (aminoacyl) site , the P (peptidyl)
site, and the E (exit ) site.
– Ribosomes receive each tRNA in successive steps of the elongation cycle.
– The interface between the small and large subun its forms a relatively spacious
cavity that is lined almost exclusively by RNA.
– The active site, where amino acids are covalently linked to one another, also
consists of RNA.
– The mRNA is situated in a narrow groove that winds around the neck of the small
subunit, passing through the A, P, and E sites.
– A tunnel runs completely through the core of the large subunit beginning at the
active site.

Elongation
– The elongation cycle is the process of adding each subsequent amino acid to the
growing polypeptide chain.
• With the charged amino acid in the P site, the next aminoacyl-tRNA binds
to the vacant P site.
• Several elongation factors are required.
– Peptidyl transferase catalyzes the peptide bond formation between amino acids.
– With the charged amino acid in the P site, the next aminoacyl-tRNA binds to the
vacant A site
– Peptidyl transferase forms bond
– The ribosome translocates (5’-3’) three nucleotides driven by conformational
changes in EF-G or eEF2
– Mutations that add or delete nucleotides: frameshift mutations produce an
abnormal sequence of amino acids

Termination
– Termination occurs at one of the three stop codons: UAA, UAG, or UGA; requires
release factors, which recognize stop codons.
– Eukaryotic cells have two release factors, eRF1 and eRF3, which work together
and recognize all the stop codons.
– The ester bond linking the nascent polypeptide to the tRNA is hydrolyzed.
– The final step is the dissociation of the mRNA from the ribosome and the
disassembly of the ribosome.

Cell and Molecular Biology | BIOL 30095 57

Module Assessment:
1. During DNA replication, which enzyme can be disposed of in an organism with a mutant
DNA polymerase that does not require a free 3′-OH?
2. Summarize and compare the properties of DNA polymerase I, II, and III.
3. List and describe the function of the ten subunits constituting DNA polymerase III.
Distinguish between the holoenzyme and the core enzyme
4. Distinguish between (a) unidirectional and bidirectional synthesis, and (b) continuous and
discontinuous synthesis of DNA. 15. List the proteins that unwind DNA during in vivo DNA
synthesis. How do they function?
5. Define and indicate the significance of (a) Okazaki fragments, (b) DNA ligase, and (c)
primer RNA during DNA replication. 17. What would be the impact of the loss of
processivity on DNA Pol III?
6. What are the replication origins in bacteria, yeast, and mammalian cells?
7. Suppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and
takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the
entire E. coli chromosome? (b) What is the physical length of the chromo- some in its
helical configuration—that is, what is the circumference of the chromosome if it were
opened into a circle?

Cell and Molecular Biology | BIOL 30095 58

 Module 4

Cell Membrane

I. OBJECTIVES: At the end of this module, you should be able to:

• Explain the biosynthesis of phospholipid

• Describe the structure of cell membrane
• Discuss the function of cell membrane
• Predict the structure of membrane protein

II. COURSE MATERIAL

OVERVIEW

Membranes divide one part of the cell from

the other. Proteins and other molecules
can be localized in the membrane.
Membrane localization concentrates the
molecules and makes it easier for them to
find each other (two-dimensional diffusion)
than it is for two molecules in solution
(three-dimensional diffusion).

Because most molecules can’t pass

through the membrane by themselves, the
cell machinery can create concentration
gradients across membranes by pumping
Adapted from karp’s Cell and Molecular Biology
specific molecules out of the cell and/or by
allowing specific molecules into the cell.
As we’ll see later, these gradients are a source of energy for the cell and can be used for signaling.

Biological membranes are the basis for many important properties of the cell, not the least of
which is to physically define the cell boundary, and in eukaryotes, the boundaries of each
intracellular organelle. However, they are not completely impermeable boundaries, and through
embedded proteins, the membrane serves as the gatekeeper for the passage of specific
molecules into (e.g. nutrients) and out of (e.g. waste) the cell. Other embedded proteins can
identify the cell to other cells, and participate in numerous interactions with the environment or
other cells.

Cell and Molecular Biology | BIOL 30095 59

Molecular Structure

Phospholipids are detergents; they have a

hydrophobic part (the fatty acid tail) and a
hydrophilic part (the head). The hydrophobic
tail is provided by long-chain fatty acids
attached to a glycerol backbone. The head
group contains oxygen and may be positively
charged or neutral. The name of the
phospholipid is dictated by the head group. The
head and tail are attached through a phosphate
diester. As Gorter and Grendel
first proposed, the core of a membrane
contains a bimolecular layer of phospholipids
oriented with their water-soluble head groups
facing the outer surfaces and their hydrophobic
fatty acid tails facing the interior. The structures
of the head groups are given in the corner right.
Simulation of a fully hydrated lipid bilayer
composed of the phospholipid
phosphatidylcholine can be seen in the figure.
Phospholipid head groups are orange, water
molecules are blue and white, fatty acid chains
are green.)

(C: FROM S.-W. CHIU, TRENDS IN BIOCHEM. SCI. 22:341, © 1997,

FROM ELSEVIER)

Common Phospholipids

Membranes contain a wide diversity of

lipids, all of which are amphipathic; that
is, they contain both hydrophilic and
hydrophobic regions. There are three
main types of membrane lipids:
phosphoglycerides, sphingolipids,
and cholesterol

Cell and Molecular Biology | BIOL 30095 60

The other phospholipids that you may encounter are based on sphingosine. They are derived
from serine instead of glycerol but the concept is the same. They have two long, fatty acid chains,
a phosphate diester, and a choline-like charged group. Glycolipids are derived from sphingosine,
but have a sugar unit, such as glucose or galactose attached instead of the choline unit.

The carbohydrate can be extended to form more

complex structures, including branches. The
sugars point out from the cell surface and are
involved in cell-cell recognition.
More than 90 percent of the membrane’s
carbohydrate is covalently linked to proteins to form
glycoproteins; the remaining carbohydrate is
covalently linked to lipids to form glycolipids. such
as glycogen, starch, or cellulose), which are
polymers of a single sugar, the oligosaccharides
attached to membrane proteins and lipids can
display extensive variability in composition and
structure.
Two types of linkages that join sugars to a
polypeptide chain.
The N-glycosidic linkage between asparagine and
N acetylglucosamine is more common than the O-
glycosidic linkage between serine or threonine and
N-acetylgalactosamine.

What is the role of carbohydrates associated in the

plasma membrane during blood transfusion?

Another essential component of animal cell membrane is Cholesterol. It is obtained from the diet
or can be synthesized from acetyl-CoA. Particular animal cells may constitute up to 50 percent of
lipid molecules in their plasma membrane. Plant cells contain cholesterol-like sterols, but
biologists disagree as to whether or not they completely lack cholesterol. Cholesterol molecules
are oriented with their small hydrophilic hydroxyl group toward the membrane surface and the
remainder of the molecule embedded in the lipid bilayer.

Phospholipid Biosynthesis

Lipids are biological molecules that are soluble in certain organic solvents. Lipids include a variety
of molecules such as triglycerides, phospholipids, and cholesterol. The major type of lipid in
membranes is the phospholipid. Fats and phospholipids both contain fatty acids linked by ester
bonds to a glycerol backbone , and are described as glycerolipids. Phospholipids are major
components of membrane bilayers, so are structural components of the cell, whereas

Cell and Molecular Biology | BIOL 30095 61

triacylglycerols are stored as the
bodies main energy reserve.
Phosphatidic acid itself tends to
disrupt bilayer structure, and must
be modified by adding a polar
headgroup. The head group is a
hydroxyl or alcohol compound that
forms an ester bond with the
phosphate of phospahtidic acid. The
makes the product a
phosphodiester, phosphate with two
ester groups.

Phospholipid biosynthetic pathways

in animal cells is shown in the
previous image. The abbreviations
are: DHAP, dihydroxyacetone
phosphate; G-3-E glycerol-3-
phosphate: PA, phosphatidic acid;
DG, diacylglycerol; CDP-DG, cytidine diphosphodiacylglycerol; PI, phosphatidylinositol; PG,
phosphatidylglycerol; PGp, phosphatidylglycerol phosphate; DPG, diphosphatidylglycerol; PP,
phosphatidic acid phosphatase; PE, phosphatidylethanolamine; PC, phosphatidylcholine; PEMT,
phosphatidylethanolamine N-methyltransferase; CT, CTP : phosphocholine cytidylyltransferase;
PS, phosphatidylserine; CK/EK, choline/ethanolamine kinase; CPT, CDP choline : 1,2-
diacylglycerol cholinephosphotransferase; EPT, CDP-ethanolamine: 1,2-diacylglycerol
ethanolaminephosphotransferase; ET, CTP:phosphoethanolamine cytidylyltransferase; PSD,
phosphatidylserine decarboxylase; PSS, phosphatidylserine synthase.

Phospholipids are involved in stabilizing proteins within the membrane, facilitating the active
conformational structure of proteins, and as cofactors in enzymatic reactions. Phospholipids are
essential for the absorption, transport and storage of lipids. Phospholipids are secreted into the
bile to aid in the digestion and absorption of dietary fat. They form the monolayer on the surface
of lipoproteins which function to transport neutral lipids throughout the body. Finally, phospholipids
serve as a reservoir for signalling molecules, such as arachidonic acid, phosphatidate,
diacylglycerol and inositol trisphosphate.

Phosphatidic acid synthesis begins with the addition of a fatty acyl-CoA, usually saturated, to
glycerol 3-phosphate at the sn-1 position to produce lysophosphatidic acid. This reaction is
catalyzed by glycerol 3-phosphate acyltransferase and is rate limiting for phosphatidic acid
synthesis. There are two forms of this enzyme; one is found in the outer mitochondrial membrane,
while the other is found in the endoplasmic reticulum. A second fatty acyl-CoA, often unsaturated,
is added to lysophosphatidic acid at the sn-2 position by acylglycerol-3-acyltransferase to form
phosphatidic acid. This occurs primarily in the endoplasmic reticulum.

Cell and Molecular Biology | BIOL 30095 62

Biosynthesis of PA

Abbreviations: GPAT, glycerol 3-phosphate acyltransferase; AGPAT, acylglycerol-3-

acyltransferase; PAP, phosphatidic acid phosphatase; CDS, CDP-diacylglycerol synthase; PA,
phosphatidic acid; DAG, diacylglycerol; PC, phosphatidylcholine; PE, phosphatidylethanolamine;
TAG, triacylglycerol; PI, phosphatidylinositol; PG, phosphatidylglycerol.

Phosphatidylcholine accounts for approximately 50% of total cellular phospholipids and is the
most abundant phospholipid in mammalian membranes. Most of the PC in the plasma membrane
is found within the outer leaflet. PC is cylindrical in shape; as such, it is an important structural
component that contributes to the integrity and function of membranes. PC is essential for the
formation and secretion of very-low-density lipoproteins by the liver, which is responsible for the
delivery of hydrophobic cargo (cholesterol and energy in the form of fat) to other organs. This
phospholipid also plays a role in bile salt-mediated micelle formation in the intestinal lumen, which
facilitates the absorption of lipid-soluble nutrients from the diet.

Membrane Proteins

The Structure and Functions

Cell membranes contain a variety of biological molecules, notably lipids and proteins.
Composition is not set, but constantly changing for fluidity and changes in the environment, even
fluctuating during different stages of cell development. Specifically, the amount of cholesterol in
human primary neuron cell membrane changes, and this change in composition affects fluidity
throughout development stages.

Fusion of intracellular vesicles with the membrane (exocytosis) not only excretes the contents of
the vesicle but also incorporates the vesicle membrane's components into the cell membrane.
The membrane may form blebs around extracellular material that pinch off to become vesicles
(endocytosis). If a membrane is continuous with a tubular structure made of membrane material,
then material from the tube can be drawn into the membrane continuously. Although the
concentration of membrane components in the aqueous phase is low (stable membrane
components have low solubility in water), there is an exchange of molecules between the lipid
and aqueous phases.

Each membrane protein has a defined orientation relative to the cytoplasm, so that the properties
of one surface of a membrane are very different from those of the other surface. Membrane
proteins can be grouped into three distinct classes distinguished by the intimacy of their
relationship to the lipid bilayer. These are

Cell and Molecular Biology | BIOL 30095 63

 • Integral proteins that penetrate the lipid bilayer. Integral proteins are transmembrane
proteins; that is, they pass entirely through the lipid bilayer and thus have domains that
protrude from both the extracellular and cytoplasmic sides of the membrane. Some
integral proteins have only one membrane-spanning segment, whereas others are
multispanning.

Like the phospholipids of the bilayer, integral membrane proteins are also amphipathic,
having both hydrophilic and hydrophobic portions. Integral membrane proteins may
penetrate the membrane partially or may exist as transmembrane proteins interfacing with
both the cytosol and external environment.

They interact strongly with the membrane lipids through hydrophobic side chains of amino
acids and can only be removed by destroying membrane structure with detergent or
solvent. They are usually composed of multiple α-helices with hydrophobic side chains;
cylindrical arrays form pores for transport of polar molecules.

• Peripheral proteins that are located entirely outside of the lipid bilayer, on either the
cytoplasmic or extracellular side, yet are associated with the surface of the membrane by
noncovalent bonds. Peripheral membrane proteins are loosely associated with the surface
of either side of the membrane; they interact with the membrane through hydrogen
bonding or salt-bridging with membrane proteins or lipids and can be removed without
disrupting the structure of the membrane.

• Lipid-anchored proteins that are located outside the lipid bilayer, on either the
extracellular or cytoplasmic surface, but are covalently linked to a lipid molecule that is
situated within the bilayer.

How do scientists identify if a protein is a transmembrane domain?

Cell and Molecular Biology | BIOL 30095 64

Color fill (yellow) the probable amino acids that are found in the membrane spanning domain of
a transmembrane protein? Explain.

Cell and Molecular Biology | BIOL 30095 65

Label the below figure. What is the level of structure of each protein possessed?

Hydropathy Plot to Predict Transmembrane Protein

• Kyte and Doolittle : hydropathy plots to predict transmembrane helices: Transmembrane helices
are buried in the non-polar phase of the lipid membrane whilst other part (loops) exist in more
polar solution
• Heijne: positive inside rule positively charged residues (Arg, Lys) tend to be much more frequent
in non-translocated regions as compared to translocated regions.
• Most methods for predicting transmembrane helices start by computing hydropathy plot.
• There are many hydrophobicity scales. Some computed from experimental solution study
of free energy transfer from aqueous solution to that that mimics membrane, some use
crystallographic data.

Prediction Protocol
• Construct hydropathy plot
• Identify “certain” helices (peeks
above “ upper ” cut-off)
• Identify “putative” helices (peeks
above “lower”cut-off but below upper
cut-off)
• Construct all possible topologies
that include all “sure” helices and
include or exclude putative segments
(we are not concern with the helix
position in the membrane but
only in finding the helices)
• For each possible topology compute Δ+ = the difference between the number of Arg+Lys
between the two sides of the structure (exclude long loops)

Cell and Molecular Biology | BIOL 30095 66

Discuss the figure provided below for hydropathy plot.

Draw a hypothetical structure of a membrane protein

based on the hydropathy index profile.

Structure of the Plasma Membrane

Lipid bilayers assemble spontaneously in aqueous
solutions as in liposomes. Hence, they use these
liposomes in drug delivery.

Liposomes have been used to improve the therapeutic

index of new or established drugs by modifying drug
absorption, reducing metabolism, prolonging
biological half-life or reducing toxicity.

Cell and Molecular Biology | BIOL 30095 67

Drug distribution is then controlled primarily by properties of the carrier and no longer by physico-
chemical characteristics of the drug substance only.
Supposed you are a scientist on drug delivery, design with complete label a liposome (through
illustration) with your drugs on it such as surface conjugated drug, crystalline drug, hydrophobic
drug and hydrophilic drug, siRNA.

Lipid bilayers form through the process of self-assembly. The cell membrane consists primarily of
a thin layer of amphipathic phospholipids that spontaneously arrange so that the hydrophobic
"tail" regions are isolated from the surrounding water while the hydrophilic "head" regions interact
with the intracellular (cytosolic) and extracellular faces of the resulting bilayer. This forms a
continuous, spherical lipid bilayer. Hydrophobic interactions (also known as the hydrophobic
effect) are the major driving forces in the formation of lipid bilayers. An increase in interactions
between hydrophobic molecules (causing clustering of hydrophobic regions) allows water
molecules to bond more freely with each other, increasing the entropy of the system. This complex
interaction can include noncovalent interactions such as van der Waals, electrostatic and
hydrogen bonds.

Lipid Raft

The cell membrane contains mixtures of glycosphingolipids, cholesterol and protein receptors
arranged in glycolipoprotein lipid microdomains termed lipid rafts. It has been proposed that they
are specialized membrane microdomains which compartmentalize cellular processes by serving
as organising centers for the assembly of signaling molecules, allowing a closer interaction of
protein receptors and their effectors to promote kinetically favorable interactions necessary for
the signal transduction.

1. Non-raft membrane
2. Lipid raft
3. Lipid raft associated transmembrane
protein
4. Non-raft membrane protein
5. Glycosylation modifications (on
glycoproteins and glycolipids)
6. GPI-anchored protein
7. Cholesterol

Cell and Molecular Biology | BIOL 30095 68

Although more common in the cell membrane, lipid rafts have also been reported in other parts
of the cell, such as the Golgi apparatus and lysosomes

Function of the Cell Membrane

The cell membrane thus works as a selective filter that allows only certain things to come inside
or go outside the cell. The cell employs a number of transport mechanisms that involve biological
membranes:

1. Passive osmosis and diffusion:

Discuss the below figure:

Differentiate osmosis from diffusion.

2. Transmembrane protein channels and transporters:

Discuss the below figure:

Cell and Molecular Biology | BIOL 30095 69

3. Endocytosis: Draw a detailed representation of endocytosis

4. Exocytosis: Draw a detailed representation of exocytosis.

Membrane Fluidity

The internal temperature of most organisms (other than birds and mammals) fluctuates with the
temperature of the external environment. Since it is essential for many activities that the
membranes of a cell remain in a fluid state, cells respond to changing conditions by altering the
types of phospholipids of which they are made. Maintenance of membrane fluidity is an example
of homeostasis at the cellular level and can be demonstrated in various ways. The presence of
cholesterol tends to abolish sharp transition temperatures and creates a condition of intermediate
fluidity. In physiologic terms, cholesterol tends to increase the durability while decreasing the
permeability of a membrane.

Cell and Molecular Biology | BIOL 30095 70

Given the picture above, which is more likely to be solid? Why? What makes it more solid/liquid?

What enzymes are responsible for modification of this phospholipid tail? What are their action?

Membrane Permeability

A pure phospholipid bilayer,

whatever the lipid composition, is a
semi-permeable membrane that is
generally repellent to large
molecules and to ions. Small polar
molecules can sometimes pass
easily (e.g. ethanol), but more often
pass at low rates if at all (e.g.
water). However, small nonpolar
molecules are able to pass through
the membrane with relative ease.
The reasons should be self-evident: larger molecules simply cannot fit between the lipid
molecules to make their way through. Higher concentrations of cholesterol, by filling in gaps

Cell and Molecular Biology | BIOL 30095 71

between phospholipid tails, decreases permeability even for small molecules that can normally
pass through the membrane easily.

Movement Across Membrane

Because the cell membrane is not permeable to ions and most molecules, the cell can regulate
the concentrations of things on either side of the membrane.

There are two factors that influence the movement of ions and molecules through a membrane.
• Concentration gradient across the membrane (also called the “chemical potential”)
• Electrical potential of the membrane.

A concentration gradient (chemical potential) exists if the concentration of a given molecule or ion
is different on the two sides of the membrane. If you punch a hole in the membrane, the
concentration of the molecule will try to equalize itself on the two sides of the membrane (if it is
an uncharged molecule). Normally, cells maintain a slight excess of negative ions inside the cell.
This costs energy, but you’ll see it’s worth it. This uneven distribution of charge across the
membrane results in a membrane potential (or electrical potential). The membrane potential is
negative, indicating that the inside of the cell is negatively charged as opposed to the outside
which is positive. It has a normal value of about 0.06 V (60 mV). As long as the membrane
potential is maintained, it will affect how ions move (the movement of molecules with no charge
is not sensitive to the membrane potential). Moving an ion toward the opposite charge (moving
a positive ion from outside to inside the cell) will be easier than moving the ion toward the same
charge. The membrane potential and the concentration gradient can reinforce each other or they
can be in opposition to each other. The total force tending to move a molecule or ion through a
membrane is called the electrochemical potential. When the concentration gradient and the
electrical potential work to oppose each other, the stronger effect wins.

Membrane Potentials and Nerve Impulses

Potential differences exist when charges are

separated.
– Membrane potentials have been measured in all
types
of cells.
– Neurons are specialized cells for information
transmission using changes in membrane
potentials.
• Dendrites receive incoming information.
• Cell body contains the nucleus and metabolic
center
of the cell.
• The axon is a long extension for conducting
outgoing impulses.
• Most neurons are wrapped by myelin-sheath.

The Action Potential (AP)

– When cells are stimulated, Na+ channels open,
causing membrane depolarization.

Cell and Molecular Biology | BIOL 30095 72

– When cells are stimulated, voltage-gated Na+ channels open, triggering the AP.
– Na+ channels are inactivated immediately following an AP, producing a short refractory period
when the membrane cannot be stimulated.
– Excitable membranes exhibit all-or-none behavior

Generally, the signal start with excitatory chemical signal, or neurotransmitter, that binds to a
receptor on the neuron. This receptor may be linked to an ion channel or it may itself be a ligand-
gated ion channel. In either case, the channel opens and Na+ comes into the cell.

The sudden influx of positive charges transiently and locally depolarizes the membrane (more +
charges along the inside of the membrane than outside). The depolarization of the membrane
near the channel causes all nearby voltage-gated Na+ channels to transiently open, thus allowing
a new rush of Na+ ions into the cell that can then depolarize another small section of membrane.
Although technically, channels open up on either side of the receptor, normally, the receptor is
located on the main cell body, or soma, while most of the ion channels are lined up along the
axon. Therefore, there is a de facto directionality to the propagation of the depolarization.

More voltage gated Na+ channels are opened up quickly after their neighboring channels have
opened and depolarized their section of the membrane, leading to a long chain reaction of voltage-
gated depolarizations all the way down the axon

Cell and Molecular Biology | BIOL 30095 73

Propagation of Action Potentials as an
Impulse
– APs produce local membrane currents
depolarizing adjacent membrane regions of
the membrane that propagate as a nerve
impulse.
– Speed Is of the Essence: Speed of neural
impulse depends on axon diameter and
whether axon is myelinated.
• Resistance to current flow decreases as
diameter increases.
• Myelin sheaths cause saltatory
conduction.
• Depolarization of pre-synaptic cell causes
Ca2+ channels in membrane to open,
Ca2+ stimulates fusion of vesicles with membrane
• Neurotransmitter binding to ion channel receptors can either stimulate or inhibit action potential

Voltage-gated ion channels

Voltage-gated ion channels have two gates: one that opens in response to an increase in
membrane potential, and one that closes the channel after a short period of time. This means that
there are three potential states for most voltage-gated ion channels: closed, open, and
inactivated. The inactivated state occurs when the second gate (more like a plug, really) closes,
because this is voltage-insensitive. The plug eventually comes out of the pore and the voltage-
sensitive gate is set back in place to the closed state. Voltage-sensitive K+ channels are
tetramers, as shown here, and each subunit carries a potential inactivating domain. The choice
of which domain appears to be random. Voltage-sensitive Na+ channels, on the other hand, also
have four transmembrane regions, but they are all part of a single protein, and the channel only
has one inactivation gate/domain. However, the three-state gating mechanism is still the same.

Cell and Molecular Biology | BIOL 30095 74

Discuss the sequence of event in the figure be

Cell and Molecular Biology | BIOL 30095 75

Module Assessment
1. How are lipids organized into a bilayer?
2. How is the bilayer important for membrane activities?
3. Why are detergents necessary to solubilize membrane proteins?
4. How might one determine the diversity of integral proteins that reside in a purified
membrane
5. fraction? What is meant by the statement that the proteins of a membrane are distributed
asymmetrically? Is this also true of the membrane’s carbohydrate?
6. Describe the properties of the three classes of membrane proteins (integral, peripheral,
and lipid-anchored), how they differ from one another, and how they vary among
themselves.
7. What is the importance of fatty acid unsaturation for membrane fluidity?
8. What is meant by a membrane’s transition temperature, and how is it affected by the
degree of saturation or length of fatty acyl chains? How are these properties important in
the formation of lipid rafts?
9. In propagating signals in neurons down to axon, how are all these opened channels
reset and the membrane re-polarized for the next action potential? Why wouldn’t the
depolarization wave become bidirectional since each little depolarization area spreads
out in both directions from the opened Na+ gate?

Cell and Molecular Biology | BIOL 30095 76

 MODULE 5

Cell Signaling

I. OBJECTIVES

At the end of this module, you should be able to

• Explain the process of cell to cell communication

• Discuss the pathways of cell signaling

OVERVIEW

The various cell types of an organism do not exist as arbitrary arrangements. Rather, they form
organized structures such as limbs and hearts. Moreover, the types of cells that represent our
fingers—bone, cartilage, neurons, blood cells, and others—are the same cell types that make up
our pelvis and legs. This process of organization is mediated by signaling agents action.

Signaling agents could be physical agents like mechanical pressure, voltage, temperature, light
etc. or chemical agents like peptides, steroids, terpenoids, etc. Better to say, every molecule has
some or some signaling consequences. it may be food material or pathogen-associated patterns,
or it may be oxygen-level or carbon di oxide or it may be specially biosynthesised signaling
molecules like hormones and ferromones (ektohormones). Signaling molecules greatly vary in
their physico chemical properties such as solubilities (hydrophobic or hydrophillic) Some of the
signaling molecules are gaseous, such as nitric oxide.

Basic Elements: Cell Signaling System

• Extracellular messenger molecules transmit messages between cells.

– In autocrine signaling, the cell has receptors on its surface that respond to the
messenger.
– During paracrine signaling, messenger molecules travel short distances through
extracellular space.
– During endocrine signaling, messenger molecules reach their target cells through
the bloodstream.

Types of intercellular signaling:

autocrine (left), paracrine (middle), and
endocrine (right)

Cell and Molecular Biology | BIOL 30095 77

 • Receptors on or in target cells receive the
message.
– Some cell surface receptors generate
an intracellular second messenger
through an enzyme called an effector.
– Second messengers are small
substances that activate (or inactivate)
specific proteins.
– Other surface receptors recruit
proteins to their intracellular domains
at the plasma membrane.
– An overview of the major signaling
pathways by which extracellular
messenger molecules can elicit
intracellular responses. Two
different types of signal transduction
pathways are depicted, one in which a
signaling pathway is activated by a
diffusible second messenger and
another in which a signaling pathway is
activated by recruitment of proteins to
the plasma membrane. Most signal
transduction pathways involve a
combination of these mechanisms. It
should also be noted that signaling
pathways are not typically linear tracks as depicted here, but are branched and
interconnected to form a complex web. The steps are described in the text.

Signal Transduction

• Signaling pathways consist of a series of

proteins.
– Each protein in a pathway alters the
conformation of the next protein.
– Protein conformation is usually altered by
phosphorylation.
– Kinases add phosphate groups while
phosphatases remove them.
– Target proteins ultimately receive a
message to alter cell activity.
– This overall process is called signal
transduction.
**Signal transduction pathway consisting of protein
kinases and protein phosphatases whose catalytic
actions change the conformations, and thus the
activities, of the proteins they modify. In the example
depicted here, protein kinase 2 is activated by protein kinase 1. Once activated, protein kinase 2
phosphorylates protein kinase 3, activating the enzyme. Protein kinase 3 then phosphorylates a
transcription factor, increasing its affinity for a site on the DNA. Binding of a transcription factor to

Cell and Molecular Biology | BIOL 30095 78

the DNA affects the transcription of the gene in question. Each of these activation steps in the
pathway is reversed by a phosphatase.

• Protein phosphorylation can change protein behavior in different ways.

– It can activate or inactivate an enzyme.
– It can increase or decrease protein-protein interactions.
– It can change the subcellular location of the protein .
– It can trigger protein degradation.
– Phosphorylation patterns differ between cell types (e.g. two different types of
breast cancer cells).

Extracellular Messengers and Their Receptors

• Extracellular messengers include:

– Small molecules such as amino acids and their derivatives (e.g. acetylcholine,
epinephrine, dopamine).
– Gases such as NO and CO
– Steroids (regulate sexual differentiation, pregnancy, carbohydrate metabolism)
– Eicosanoids, which are lipids derived from fatty acids.
– Various peptides and proteins
• Receptor types include:
– G-protein coupled receptors (GPCRs)
– Receptor protein-tyrosine kinases (RTKs)
– Ligand gated channels
– Steroid hormone receptors
– Specific receptors such as B-and T-cell receptors

G Protein-Coupled Receptors and Their

Second Messengers

• G protein-coupled receptors (GPCRs)

constitute the single largest superfamily
of proteins encoded by animal genomes.
• GPCRs have seven a-helical
transmembrane domains and interact
with G proteins.
• Natural ligands: hormones (both plant
and animal), neurotransmitters, opium
derivatives, chemoattractants (odorants,
tastants, and photons.
** The membrane-bound machinery for
transducing signals by means of a seven
transmembrane receptor and a heterotrimeric G protein. Receptors of this type, including
those that bind epinephrine and glucagon, contain seven membrane-spanning helices. When
bound to their ligand, the receptor interacts with a trimeric G protein, which activates an effector,
such as adenylyl cyclase. As indicated in the figure, the α and γ subunits of the G protein are
linked to the membrane by lipid groups that are embedded in the lipid bilayer. (Note: Many GPCRs
may be active as complexes of two or more receptor molecules.)

• Signal Transduction by G Protein-Coupled Receptors

Cell and Molecular Biology | BIOL 30095 79

 – Ligand binding on the extracellular domain changes the intracellular domain.
– Affinity for G proteins increases, and
the receptor binds a G protein
intracellularly.
– GDP is exchanged for GTP on the G
protein, activating the G protein.
– One ligand-bound receptor can
activate many G proteins.
** The mechanism of receptor-mediated
activation (or inhibition) of effectors by means
of heterotrimeric G proteins. In step 1, the ligand
binds to the receptor, altering its conformation and
increasing its affinity for the G protein to which it
binds. In step 2, the Gα subunit releases its GDP,
which is replaced by GTP. In step 3, the Gα subunit
dissociates from the Gβγ complex and binds to an
effector (in this case adenylyl cyclase), activating
the effector. The G dimer may also bind to an
effector (not shown), such as an ion channel or an
enzyme. In step 4, activated adenylyl cyclase
produces cAMP. In step 5, the GTPase activity of
Gα hydrolyzes the bound GTP, deactivating Gα. In
step 6, Gα reassociates with Gβγ, reforming the
trimeric G protein, and the effector ceases its
activity. In step 7, the receptor has been
phosphorylated by a GRK and in step 8 the
phosphorylated receptor has been bound by an
arrestin molecule, which inhibits the ligand-bound
receptor from activating additional G proteins. The
receptor bound to arrestin is likely to be taken up by
endocytosis.

• Termination of the Response

– Desensitization – by blocking active receptors from turning on additional G
proteins.
– G protein-coupled receptor kinase (GRK) activates a GPCR via phosphorylation.
– Proteins called arrestins compete with G proteins to bind GPCRs.
– Termination of the response is accelerated by regulators of G protein signaling
(RGSs).

Arrestin

Phosphorylation of the GPCRs sets the stage for the binding of arrestins, which complete for
binding with the G proteins. Upon binding, the GPCRs become desensitized, even though ligands
are bound extracellularly. If receptors are recycled and returned to the cell surface, the cells
remain sensitive to the ligand and are said to be resensitized. Bacterial Toxins, such as cholera
toxin and pertussis virulence factors, target GPCRs and G proteins. Adrenergic Receptors
stimulate Gas to activate adenylate cyclase. Gas is a target of cholera toxin. Pathway is locked in
stimulatory state causing diarrhea. Adrenergic Receptors stimulate Gai to inhibit adenylate
cyclase. Gai is a target of pertussis toxin. Locks in inhibitory state causing excessive coughing.

Cell and Molecular Biology | BIOL 30095 80

** Arrestin-mediated internalization of GPCRs.
Arrestin-bound GPCRs (step 1) are internalized when
they are trapped in clatherin-coated pits which bud into
the cytoplasm (step 2). Clatherin-coated buds are
transformed into clatherin-coated vesicles which
deliver their contents, including the GPCRs, to
endosomes. When present in endosomes, arrestins
can serve as scaffolds for the assembly of signaling
complexes, including those that activate the MAPK
cascade and the transcription factor ERK (step 3).
Alternatively, the GPCRs can be delivered to
lysosomes, where they are degraded (step 4), or they
can be returned to the plasma membrane in a recycling
endosome (step 5), where they can then interact with
new extracellular ligands (step 6).

cAMP

• Second Messengers
– The Discovery of Cyclic AMP
• It is a second messenger, which is released into the cytoplasm after
binding of a ligand.
• Second messengers amplify the response to a single extracellular ligand.

** The localized formation of cAMP in a live cell in response to the addition of an

extracellular messenger molecule (photo above). This series of photographs shows a sensory
nerve cell from the sea hare Aplysia. The concentration of free cAMP is indicated by the color:
blue represents a low cAMP concentration, yellow an intermediate concentration, and red a high
concentration. The left image shows the intracellular cAMP level in the unstimulated neuron, and
the next three images show the effects of stimulation by the neurotransmitter serotonin (5-
hydroxytryptamine) at the times indicated. Notice that the cAMP levels drop by 109s despite the
continued presence of the neurotransmitter. (The cAMP level was determined indirectly in this
experiment by microinjection of a fluorescently labeled cAMP-dependent protein kinase labeled
with both fluorescein and rhodamine on different subunits. Energy transfer between the subunits
(provides a measure of cAMP concentration.)

Cell and Molecular Biology | BIOL 30095 81

Phosphoinositides

• Phosphatidylinositol-Derived Second Messengers

– Some phospholipids of cell membranes are converted into second messengers by
activated phospholipases.
• Phosphatidylinositol Phosphorylation
– Phosphoinositides (PI) are derivatives of phosphatidylinositol.

** Phospholipid-based second messengers. (A) The structure of a generalized phospholipid.

Phospholipids are subject to attack by four types of phospholipases that cleave the molecule at
the indicated sites. Of these enzymes, we will focus on PLC, which splits the phosphorylated head
group from the diacylglycerol. (B) A model showing the interaction between a portion of a PLC
enzyme molecule containing a PH domain that binds to the phosphorylated inositol ring of a
phosphoinositide. This interaction holds the enzyme to the inner surface of the plasma membrane
and may alter its enzymatic activity. (C) Fluorescence micrograph of a cell that has been
stimulated to move toward a chemoattractant (i.e., a chemical to which the cell is attracted). This
cell has been stained with an antibody that binds specifically to PI 3,4,5-trisphosphate (PIP3),
which is seen to be localized at the leading edge of the migrating cell (arrows). Bar equals 15 μm.

Phosphatidylinositol-inositol triphosphate (IP3) and diacylglycerol (DAG)

• Phosphatidylinositol-specific phospholipase C-b produces second messengers derived

from phosphatidylinositol-inositol triphosphate (IP3) and diacylglycerol (DAG).
• DAG activates protein kinase C, which phosphorylates serine and threonine residues on
target proteins.
• The phosphorylated phosphoinositides form lipid-binding domains called PH domains.

Cell and Molecular Biology | BIOL 30095 82

 **The generation of second
messengers as a result of ligand-
induced breakdown of
phosphoinositides (PI) in the lipid
bilayer. In steps 1 and 2, phosphate
groups are added by lipid kinases to
phosphatidylinositol (PI) to form PIP2.
When a stimulus is received by a
receptor, the ligand-bound receptor
activates a heterotrimeric G protein
containing a Gαγ subunit (step 3),
which activates the enzyme PI-
specific phospholipase C-β (step 4),
which catalyzes the reaction in which PI(4, 5)P2 is split into diacylglycerol (DAG) and inositol 1,4,5-
trisphosphate (IP3) (step 5). DAG recruits the protein kinase PKC to the membrane and activates
the enzyme (step 6). IP3 diffuses into the cytosol (step 7), where it binds to an IP3 receptor and
Ca+2 channel in the membrane of the SER (step 8). Binding of IP3 to its receptor causes release
of calcium ions into the cytosol (step 9).

Phosphatidylinositol-inositol triphosphate (IP3)

• One IP3 receptor is a calcium channel located at the surface of the smooth ER.
• Binding of IP3 opens the channel and allows Ca2+ ions to diffuse out.
• Protein kinase C and IP3 elicit a variety of cellular responses.

Discuss the given image.

Cell and Molecular Biology | BIOL 30095 83

Glucose Levels

• Regulation of Blood Glucose Levels

– Different stimuli acting on the same target cell
may induce the same response.
• Glucagon and epinephrine bind to
different receptors on the same cell.
• Both hormones stimulate glucoses
breakdown and inhibit its synthesis.
• cAMP is activated by the G protein of
both hormone receptors
– Responses are amplified by signal cascades.

**The reactions that lead to glucose storage or

mobilization. The activities of two of the key enzymes in
these reactions, glycogen phosphorylase and glycogen
synthase, are controlled by hormones that act through signal
transduction pathways. Glycogen phosphorylase is activated
in response to glucagon and epinephrine, whereas glycogen
synthase is activated in response to insulin.

• Glucose Metabolism
– cAMP is synthesized by adenylyl
cyclase.
– cAMP evokes a reaction cascade
that leads to glucose mobilization.
– Once formed, cAMP molecules
diffuse into the cytoplasm where
they bind a cAMP-dependent
protein kinase (protein kinase A,
PKA).

**The response by a liver cell to

glucagon or epinephrine. The steps in the
response to hormonal stimulation that lead
to glucose mobilization are described in the
text. Many of the steps in the reaction
cascade are accompanied by a dramatic
amplification of the signal. Steps leading to
amplification are indicated by clusters of
blue arrows. Activation of transcription by
CREB occurs in conjunction with the usual
array of coactivators (e.g. p300 and CBP)
and chromatin-modifying complexes (not
shown).

Enumerate the different processes that can be affected by changes in cAMP concentration

Cell and Molecular Biology | BIOL 30095 84

Senses

• The Role of GPCRs in Sensory Perception

– Rhodopsin is a photosensitive protein for black-and-white vision that is also a
GPCR.
– Several color receptors in the cones of the retina are GPCRs.
– The distal tips of neurons located in the nasal epithelium contain odorant receptors,
GPCRs that bind various chemicals. There are more than 400 types of these
receptors in the human nose.
– Each taste receptor cell in the tongue transmits a sense of one of only five basic
taste qualities, namely: salty, sour, sweet, bitter, or savory.
– Perception that a food is bitter, sweet, or savory depends on a compound
interacting with a GPCR at the surface of the receptor cell.
Protein-Tyrosine Phosphorylation

Protein-Tyrosine Phosphorylation as a Mechanism for Signal Transduction

• Protein-tyrosine kinases phosphorylate tyrosine residues on target proteins.

• Over 90 different protein-tyrosine kinases are encoded by the human genome.
• Protein-tyrosine kinases regulate cell growth, division, differentiation, survival, and
migration.
• Receptor protein-tyrosine kinases (RTKs) are cell surface receptors of the protein-
tyrosine kinase family encoded by more than 60 RTK genes in the human genome.
• Receptor Dimerization
• Results from ligand binding.
• Protein kinase activity is activated.
• Tyrosine kinase phosphorylates another subunit of the receptor
(autophosphorylation).
• RTKs phosphorylate tyrosines within phosphotyrosine motifs.

Cell and Molecular Biology | BIOL 30095 85

** Steps in the activation of a receptor protein-
tyrosine kinase (RTK). (A) Ligand-mediated
dimerization. In the nonactivated state, the receptors
are present in the membrane as monomers. Binding
of a bivalent ligand leads directly to dimerization of
the receptor and activation of its kinase activity,
causing it to add phosphate groups to the
cytoplasmic domain of the other receptor subunit.
The newly formed phosphotyrosine residues of the
receptor serve as binding sites for target proteins
containing either SH2 or PTB domains. The target
proteins become activated as a result of their
interaction with the receptor. (B) Receptor-mediated
dimerization. The sequence of events are similar to
those in part A, except that the ligand is monovalent
and, consequently, a separate ligand molecule binds
to each of the inactive monomers. Binding of each
ligand induces a conformational change in the
receptor that creates a dimerization interface (red
arrows). The ligand-bound monomers interact
through this interface to become an active dimer.

Insulin

• Signaling by the Insulin Receptor

– Insulin regulates blood glucose levels by increasing cell glucose uptake.
– The insulin receptor is a protein-tyrosine kinase
• Autophosphorylated receptor associates with insulin receptor substrate
proteins (IRSs).
• IRSs bind proteins with SH2 domains to activate downstream signal
molecules.
• SH2 domain-containing proteins are kinases that phosphorylate a lipid, PI
3-kinase (PI3K).
• Activated IRS proteins activate major signaling pathways such as PI3K
and Ras.
• Active PI3K produces phosphorylated lipids that trigger activation of
downstream proteins (Akt, PDK1)
• Terminal effects of PI3K activation include increased protein synthesis,
glucose uptake, and glycogen synthesis.

Cell and Molecular Biology | BIOL 30095 86

** The response of the insulin receptor to ligand binding. (A) The insulin receptor, shown
here in schematic form in the inactive state, is a tetramer consisting of two α and two β subunits.
(B) Binding of a single insulin molecule to the β subunits causes a conformational change in the
β subunits, which activates the tyrosine kinase activity of the β subunits. (C) The activated β
subunits phosphorylate tyrosine residues located on the cytoplasmic domain of the receptor as
well as tyrosine residues on several insulin receptor substrates (IRSs) that are discussed below.

What are the roles of tyrosine-phosphorylated IRS in activating a variety of signaling pathways?

• Glucose Transport
– PKB regulates glucose uptake by GLUT4 transporters.
• GLUT4 transporters reside in intracellular membrane vesicles.
• Vesicles fuse with the membrane in response to ligand binding to the IR.
– Diabetes mellitus is caused by defects in insulin signaling and Type 2 diabetes is
caused by gradual insensitivity to insulin.

**Regulation of glucose uptake in muscle

and fat cells by insulin. Glucose transporters
are stored in the walls of cytoplasmic vesicles
that form by budding from the plasma membrane
(endocytosis). When the insulin level increases,
a signal is transmitted through the IRS-PI3K-
PKB pathway, which triggers the translocation of
cytoplasmic vesicles to the cell periphery. The
vesicles fuse with the plasma membrane
(exocytosis), delivering the transporters to the
cell surface where they can mediate glucose

Cell and Molecular Biology | BIOL 30095 87

uptake. A second pathway leading from the insulin receptor to GLUT4 translocation is not shown.

In Plants

• Signaling Pathways in Plants

– Plants do use Ca+2 and phosphoinositide messengers.
– Plants lack cyclic nucleotides and RTKs.
– Plants have protein kinases that phosphorylate histidine residues.
• The downstream cascade is similar to MAP kinase cascade.
• The target of the cascade is usually transcription factors.
• The product of the Etr1 gene encodes a receptor for the gas ethylene
(C2H4), a plant hormone that regulates a diverse array of developmental
processes, including seed germination, flowering, and fruit ripening.

Calcium as an Intracellular Messenger

• Cytoplasmic calcium levels are determined by events within a membrane.

– Calcium levels are low in the cytosol because it is pumped out into the extracellular
space and the membrane is highly impermeable to the ion.
– Calcium channels can be transiently opened by action potential or calcium itself.
– Calcium binds to calcium-binding proteins (such as calmodulin), which affects
other proteins.

**Calcium-induced calcium release, as it occurs in a

cardiac muscle cell. A depolarization in membrane voltage
causes the opening of voltage-gated calcium channels in the
plasma membrane, allowing entry of a small amount of Ca+2
into the cytosol (step 1). The calcium ions bind to ryanodine
receptors in the SER membrane (step 2), leading to release
of stored Ca+2 into the cytosol (step 3), which triggers the
cell’s contraction. The calcium ions are subsequently
removed from the cytosol by the action of Ca+2 pumps
located in the membrane of the SER (step 4) and a Na+/Ca+2
secondary transport system in the plasma membrane (step
5), which leads to relaxation. This cycle is repeated after
each heart beat.

In Plant cells

• Regulating Calcium Concentrations in Plant Cells

– Cytosolic calcium changes in response to several stimuli, including light,
pressure, gravity, and hormones.
– Calcium signaling aids in decreasing turgor pressure in guard cells.

Cell and Molecular Biology | BIOL 30095 88

 Discuss the role of Ca2+ in guard cell
closure

Convergence, Divergence and Crosstalk

• Signaling pathways can converge , diverge, and crosstalk as follows:

– Signals form unrelated receptors can converge to activate a common effector.
– Identical signals can diverge to activate a variety of effectors.
– Signals can be passed back and forth between pathways from crosstalk.

• Convergence – GPCRs, receptor tyrosine kinases, and integrins bind to different ligands
but they all can lead to a docking site for Gbr2.
• Divergence – all of the examples of signal transduction so far are evidence of divergence
of how a single stimulus sends signals along a variety of different pathways.
• Crosstalk – more and more crosstalk is found between signaling pathways:
• cAMP can block signals transmitted through the MAP kinase cascade.
• Ca2+ and cAMP can influence each other’s pathways.

Cell and Molecular Biology | BIOL 30095 89

** Examples of convergence, divergence, and
cross-talk among various signal transduction
pathways. This drawing shows the outlines of
signal-transduction pathways initiated by receptors
that act by means of both heterotrimeric G proteins
and receptor protein tyrosine kinases. The two are
seen to converge by the activation of different
phospholipase C isoforms, both of which lead to the
production of the same second messengers (IP3 and
DAG).Activation of the RTK by either PDGF or EGF
leads to the transmission of signals along three
different pathways, an example of divergence.
Cross-talk between the two types of pathways is
illustrated by calcium ions, which are released from
the SER by action of IP3 and can then act on various
proteins, including protein kinase C (PKC), whose
activity is also stimulated by DAG.

Discuss the pathway given.

Cell and Molecular Biology | BIOL 30095 90

**An example of cross-talk between two
major signaling pathways. Cyclic AMP acts in
some cells, by means of the cAMP-dependent
kinase PKA, to block the transmission of signals
from Ras to Raf, which inhibits the activation of
the MAP kinase cascade. In addition, both PKA
and the kinases of the MAP kinase cascade
phosphorylate the transcription factor CREB on
the same serine residue, activating the
transcription factor and allowing it to bind to
specific sites on the DNA.
Apoptosis (Programmed Cell Death)

• Apoptosis is an ordered process involving cell shrinkage, loss of adhesion to other

cells, dissection of chromatin, and engulfment by phagocytosis.
• Apoptotic changes are activated by proteolytic enzymes, caspases, which target:
– Protein kinases, some of which cause detachment of cells.
– Lamins, which line the nuclear envelope.
– Proteins of the cytoskeleton
– Caspase activated DNase (CAD)

**A comparison of normal and apoptotic cells. (A, B) Scanning electron micrographs of a
normal (A) and apoptotic (B) T-cell hybridoma. The apoptotic cell exhibits many surface blebs
that are budded off in the cell. Bar equals 4 mm. (C) Transmission electron micrograph of an
apoptotic cell treated with an inhibitor that arrests apoptosis at the membrane blebbing stage.

• Apoptosis is needed during embryonic development to form structure, organs and

tissues (e.g. spaces between the digits, pruning unneeded nerve cells).
• Apoptosis is also active in the adult, where about 1010-1011 cells die every day.
• Reduced or elevated apoptosis is linked to several human diseases:
– Cancer
– Parkinson’s, Alzheimer’s, and Huntington’s diseases
– Diabetes type I

Cell and Molecular Biology | BIOL 30095 91

**Apoptosis carves out the
structure of the mammalian digits.
Three stages in this process in a
mouse embryo. In this particular
mouse, which is called a MacBlue
mouse, all of the embryonic
macrophages express the cyan
fluorescent protein. Fluorescent
macrophages have infiltrated the
regions of the footpad where
apoptosis has occurred and are
clearing the space between the digits.

Discuss the mechanism of Cancer Cells

Extrinsic pathway

• The Extrinsic Pathway of Apoptosis

– It is initiated by external stimuli:
• Tumor necrosis factor (TNF) is detected by a TNF cell surface receptor.
• Bound TNF receptors recruit “procaspases” to the intracellular domain of
the receptor.
• Procaspases convert other procaspases to caspases.
• Caspases activate executioner caspases, leading to apoptosis.

**The extrinsic (receptor-mediated) pathway of

apoptosis. When TNF binds to a TNF receptor (TNFR1),
the activated receptor binds two different cytoplasmic
adaptor proteins (TRADD and FADD) and procaspase-8
to form a multiprotein complex at the inner surface of the
plasma membrane. The cytoplasmic domains of the TNF
receptor, FADD, and TRADD interact with one another by
homologous regions called death domains that are
present in each protein (indicated as green boxes).
Procaspase-8 and FADD interact by means of
homologous regions called death effector domains
(indicated as brown boxes). Once assembled in the
complex, the two procaspase molecules cleave one
another to generate an active caspase-8 molecule

Cell and Molecular Biology | BIOL 30095 92

containing four polypeptide segments. Caspase-8 is an initiator complex that activates
downstream (executioner) caspases that carry out the death sentence. It can be noted that the
interaction between TNF and TNFR1 also activates other signaling pathways, one of which leads
to cell survival rather than self-destruction.

Intrinsic Pathway

• The Intrinsic Pathway of Apoptosis

– It is initiated by intracellular stimuli.
• Proapoptotic proteins stimulate mitochondria to leak proteins, mostly
cytochrome c.
• Once in the cytosol, cytochrome c forms part of a multiprotein complex
called the apoptosome, that also includes several molecules of
procaspase-9.
• Release of apoptotic mitochondrial proteins irreversibly commits the cell
to apoptosis.

**The intrinsic (mitochondria-mediated) pathway of

apoptosis. Various types of cellular stress cause
proapoptotic members of the Bcl-2 family of proteins-
either Bax or Bak- to oligomerize within the outer
mitochondrial membrane, forming channels that facilitate
the release of cytochrome c molecules from the
intermembrane space. Once in the cytosol, the
cytochrome c molecules form a multisubunit complex with
a cytosolic protein called Apaf-1 and procaspase-9
molecules. Procaspase-9 molecules are apparently
activated to their full proteolytic capacity as the result of a
conformational change induced by association with Apaf-
1. Caspase-9 molecules cleave and activate executioner
caspases, which carry out the apoptotic response. The
intrinsic pathway can be triggered in some cells (e.g.
hepatocytes) by extracellular signals. This occurs as the
initiator caspase of the extrinsic pathway, caspase 8,
cleaves a BH3-only protein called Bid, generating a
protein fragment (tBid) that binds to Bax, inducing
insertion of Bax into the OMM and release of cytochrome
C from mitochondria.

Clearance

• Antiapoptotic proteins promote survival.

• Cell fate depends on the balance between pro- and anti-apoptotic signals.
• Apoptotic cell death occurs without spilling cellular contents to prevent inflammation,
compared to necrosis.

Cell and Molecular Biology | BIOL 30095 93

 • During apoptosis, a phospholipid “scramblase” moves phosphatidylserine molecules to
the outer leaflet of the plasma membrane where they are recognized as an “eat me”
signal by specialized macrophages.
• Apoptotic cells are cleared by phagocytosis.

Differentiate Extrinsic and Intrinsic Pathway

Cell and Molecular Biology | BIOL 30095 94

Module Assessment

1. Consider a signaling pathway

that proceeds through three protein
kinases that are sequentially
activated by phosphorylation. In one
case, the kinases are held in a
signaling complex by a scaffolding
protein; in the other, the kinases are
freely diffusible (based on the
figure). Discuss the properties of
these two types of organization in
terms of signal amplification, speed,
and potential for cross-talk between
signaling pathways.

2. Cells communicate in ways that resemble human communication. Decide which of the following
forms of human communication are analogous to autocrine, paracrine, endocrine, and synaptic
signaling by cells: (a) A telephone conversation (b) Talking to people at a cocktail party (c) A
radio announcement (d) Talking to yourself

3. Why do signaling responses that involve changes in proteins already present in the cell occur
in milliseconds to seconds, whereas responses that require changes in gene expression require
minutes to hours?

4. How is it that different cells can respond in different ways to exactly the same signaling molecule
even when they have identical receptors?

Cell and Molecular Biology | BIOL 30095 95

 MODULE 6

The Nucleus of the Cell

I. OBJECTIVES

At the end of this module, you should be able

• To demonstrate a clear understanding of the structure, functions and processes inside a

cell’s nucleus
• To identify and describe the parts of a cell nucleus;
• To describe the molecular structure of genes and their organization to chromosomes;
• To explain thoroughly the events and processes that happen in cell cycle;
• To identify mechanisms that drive nuclear genome evolution; and
• To discuss the basic concepts of prokaryotic and eukaryotic gene expression

II. COURSE MATERIAL

Anatomy of the Cell Nucleus

The nucleus is an organelle found in eukaryotic cells that serves as information processing and
administrative center of the cell. The nucleus has two main functions: (1) to store the genetic
material and (2) to coordinate cellular activities such as growth, metabolism, protein synthesis
and reproduction. The nucleus has the following parts:

TASK: Given the following description of the parts of the nucleus, identify the
structures in the figure. Put the letter in the box provided.
a) Nuclear envelope - a double membrane
that encloses the content of the nucleus The nucleus
and separate it from the contents of the
cytoplasm.
b) Nuclear lamina – composed of lamins that
lines the inner surface of the nuclear
envelope. It provides structural support to
the nuclear membrane.
c) Nuclear pore – regulates the transport of
specific molecules inside and outside the
nucleus. It is also connected to the
endoplasmic reticulum where protein
synthesis occurs.
d) Nucleoplasm – the semifluid matrix found
inside the nucleus where nucleotides and
enzymes are found.
e) Chromatin – dense string-like structures
composed of nucleic acids associated with
proteins (also referred to as chromosome
territories)

Cell and Molecular Biology | BIOL 30095 96

f) Nucleolus – dark staining region within the nucleus responsible for the synthesis of ribosomal
RNA

MOLECULAR STRUCTURE OF GENES AND CHROMOSOMES

Structure of Gene

By the beginning of the twenty first century, molecular biologists had completed sequencing the
entire genomes of hundreds of viruses, bacteria, unicellular eukaryotes, plants and even humans.
These efforts led to the extensive elucidation of the structure of the fundamental units of
inheritance – the gene.

In molecular biology the term gene refers to the entire DNA sequence that is needed for the
synthesis of a functional protein. However, there’s more to gene structure than just the coding
region (exons). In order for a gene to be complete, such that the coding sequence will be
expressed, several sequences must be present:

• Promoter - It acts as a 'genetic dimmer switch' in that it turns the gene on and off and specifies
how many copies of the protein will be produced. The promoter allows the binding of
transcription factors and recruit RNA polymerase;
• Enhancer – These are regulatory sequences that enhance the transcription of gene;
• Termination Sequence – This is the last region and signals the end of the gene and its
transcription.

In prokaryotes and some viruses, genes coding for functionally related proteins are group in a
single cluster called operons, while eukaryotic genes are divided by long intergenic non coding
sequences called introns.

Figure 2. The basic structure of a gene comprises of the promoter, the coding region, the
termination sequence and the enhancer.
Chromosome Organization

Inside the a eukayotic cell’s nucleus, the DNA molecule is packed into thread like structures called
chromosomes. For instance, the DNA from all the 46 human chromosomes measures
approximately 2 meters when laid out. Considering the size of human cell of about 10 um, the
DNA must be tightly packaged to fit inside the cells’ nucleus. At the same time, it must be readily
accessible for the genes to be expressed.

There are a number of ways by which the chromosomes are compacted. During interphase (the
stage where cells are not dividing), the genetic material exists as a nucleoprotein complex called

Cell and Molecular Biology | BIOL 30095 97

chromatin. The most common proteins
associated with DNA are the histones.
Short stretches of DNA double helix wraps
around around the core of eight histone
proteins forming a “beads on a string”
structure. Histone proteins provide
structural support to DNA, giving the
chromosome a more compact shape. This
histone-DNA complex is called a
nucleosome. In a nucleosome unit, a 147
base pair DNA is wrapped around a histone
core octamer composed of H32 - H42
tetramer associated with two H2A – H2B
dimer. Approximately, a DNA molecule in
this form is seven times shorter than the
double helix without the histones. As the
nucleosomes and the linker DNA between
them are coiled into a 30 nm fiber by the
action of H1 histone, the chromosomes are
50 times shorter than its extended form. In
this condensed state, nucleosomes are
thought to be packed into irregular spiral or
solenoid arrangment.

Further condensation and coiling of the

chromatin structure is facilated by a variety
of fibrous proteins or scaffold proteins.
Scaffold proteins are non-histone proteins
that produce highly condensed structure
for the chromosomes. These fibrous proteins also ensure that chromosomes occupies specific
areas in the nucleus of a non- dividing cell such that chromosomes does not over lap with each
other. This series of condensation and compaction results to a DNA molecule packed to a
chromosome that is 10,000 fold shorter that its extended form. The process of chromosome
organization is illustrated in the figure.

Often, a chromosome is depicted as an X structure with

a constriction along its length that divides the
chromosome into two sections, the long arm and the
short arm. The constriction is called the centromere. It
is the site where spindle fibers attach. During cell
division, the centromere is genetically active while the
rest of the chromosome parts are inactive.

Associated with the centromere is the kinetochore,

which is a complex of proteins where the microtubules
of the soindle attache dutring cell division. Normally,
each diploid homologous chromosome exhibits
additional constirctions called secondary constrictions.
These constrictions are mainly responsible for the
formation of the nucleolus. The tips or the terminal ends

Cell and Molecular Biology | BIOL 30095 98

of the chromosome are called telomeres. The telomeres has a property that protects the
chromosome from detoriation and fusion with other chromosomes

Genome Packaging in Prokaryotes.

Prokaryotes do not contain nuclei or any membrane bound organelles. The nucleoid is simply
the area where the double stranded circular chromosomal DNA is located. Prokaryotic genome
is usually larger than the cell itself. The huge chromosome of prokaryotes is packed inside the
cell through supercoiling. Supercoiling is analogous in twisting a rubber band to make tiny coils
and twisting it again to make even smaller coils. Prokaryotic genomes can either be negatively
supercoiled, when the DNA is twisted in a direction opposite to that of the double helix, or
positively supercoiled when the DNA is twisted in the same direction as the double helix.

Whereas in eukaryotes, DNA wraps around histone proteins, prokaryotes do not have histones.
Instead multiple non-histone proteins act together to fold and condense the prokaryotic DNA. For
instance, HU proteins are very abundant in the nucleoid and work with DNA topoisomerase I to
introduce sharp bends in the chromosome necessary to generate negative supercoils. Moreover,
IHFs (integration host factors) bind within the genome to produce additional bends. Once
condensed, enzymes like DNA topoisomerase I and DNA Gyrase maintain the supercoil.

Although at compacted state, the prokaryotic genome is still accessible for transcription factors.
Because there is nuclear membrane that separates the DNA from the ribosomes in the cytoplasm,
transcription and translation happen simultaneously in these organisms.

Exercise. Compare and contrast eukaryotic and prokaryotic genomes. Focus on their size,
localization, and organization.
Prokaryotic Eukaryotic

THE CELL CYCLE

Overview of the Cell Cycle

The only way to make a new cell is to duplicate a cell that already exist. All living organisms, from
unicellular bacterium to the multicellular mammals are products of repeated cell growth and
division. A cell reproduces by performing an orderly sequence of events in which it duplicates its
contents and divides in two. This series of duplication and division is known as cell cycle. Cell
cycle is an essential mechanism by which all living organisms reproduce. The cell, through the
cell cycle, accomplishes its most fundamental task : the passing on of its genetic information to
the next generation of cells.

The details of cell cycle vary from species to species at different times in an organism’s life.
However, certain features are universal. The cell cycle is a 4-stage process composed of the non-
dividing phase (intephase) and the dividing phase (mitotic phase).

Cell and Molecular Biology | BIOL 30095 99

Interphase

Most of the cells require much more time to grow and

double their mass of proteins and organelles than they
require in replicating their chromosomes and divide. Partly,
to provide time for growth, cell cycles have gap phases.
The first gap called G1 phase occurs after cell division and
before DNA replication phase. This is often referred to as
the growth phase because during this stage the cell
continues to grow accompanied by the synthesis of
enzymes and proteins for DNA replication and cell division.
The cell is fully functional and the centromere and the
components of centrosome are made during this phase.
Lastly, the G1 phase ensures that the cell is biologically
ready before it undergoes DNA replication.

The G1 phase is followed by the S-phase (S for DNA

synthesis). As discussed, the most basic function of cell cycle is to duplicate the vast amount of
DNA in the chromosomes and to segragate the copies to the two daughter cells. Chromosome
duplication occurs at S-phase and requires 10-12 hours, thus occupying the half of the cycle in a
typical mammalian cell. At the end of the S phase, the DNA molecules in each duplicated
chromosomes are intertwined and held tightly by specialized protein linkages.

The S-phase is followed by another intermediary phase called G2 phase. This gap phase acts as
a safety gap where the cell ensures that the entirety of its DNA and other cellular components are
duplicated before it proceeds to division. At this stage, the centrioles are fully formed and other
microtubules necessary to mobilize the chromosomes during cell division are assembled. This
gap phase is the last chance for the cell to grow before it splits ino two independent cells during
cell division.

The G1 phase, S phase and G2 phase comprise the non-dividing stage of the cell cycle called the
interphase.

M Phase

Following the completion of S phase and transition through G2, the cell undergoes the M phase.
This begins with mitosis, in which the sister chromatids are separated and segragated to a pair of
identical daughter nuclei, each having its own copy of the genome. Mitosis is divided into our
stages – prophase, metaphase, anaphase and telophase – each defined baased on the behavior
of the chromsomes as observed under the microscope.

As mitosis is completed, the second major event of cell division proceeds – cytokinesis in which
the cell is divide into two halves eah with identical nucleus. Panel 1 describes the events that
occur during mitosis.

Cell and Molecular Biology | BIOL 30095 100

 Exercise. The lung epithelial cells of newt undergoing the M phase were shown. Order
these micrographs and identify the stages of M phase shown.

ANSWERS:

Stages of Cell Division

Cell and Molecular Biology | BIOL 30095 101

Cell and Molecular Biology | BIOL 30095 102
Regulation of the Cell Cycle

Cell move through the cell cycle in a regulated manner. They use internal cues and environmental
signals to decide whether to proceed to cell division or not. This regulation ensures that cells will
divide only under favorable conditions. For instance, DNA damage and lack of space in the tisseu
or organ may cease the progression of the cell to divide. Cell cycle is mainly regulated through
cell cycle checkpoints. A checkpoint is a surveillance mechanism that monitor the integrity,
fidelity and order of the major events in the cell cycle. Chekcpoints play critical roles in preventing
the cells from progressing to the next phase of the cell when the prior phase has not been
completed. Premature entry to phases of the cell cycle can lead to catastrophic consequences
for the cells such as cell death. There are a lot of checkpoints in eukaryotic cell cycle. The three
major ones are the following:

Cell and Molecular Biology | BIOL 30095 103

1. G1 Checkpoint (G1 / S transition)

It is the first chekcpoint located at the end og G1 phase and just before the start of the S phase.
It is where the cell deicdes whether to divide, to delay division or to enter a resting stage. At this
checkpoint a cell must ensure that its size, the availability of nutrients, the presence of signals
and DNA damage are assessed. If the cell does not get the “go cues” from G1 checkpoint, it may
leave the cycle and enter a resting stage called G0 . Some cells stay at the G0 for their entire
lifetime while other resume the cycle once theenvironmental conditions become favorable for
them to divide. Once the cell passes the G1 checkpoint and enters the S phase, it will make an
irreversible commitment to divide, barring problems such as errors in replication and DNA
damage.

2. G2 Checkpoint (G2 / M transition)

This is the check point before the cell enters the division phase. The G2 checkpoint prevents
initiation of mitosis when DNA is damaged. If the chekpoint detects DNA damage, the cell cycle
is halted and the cell either completes the replication or repair DNA damage. When the the
damage is irreparable, the cell will proceed to programmed cell death or apoptosis to ensure that
damaged DNA is not passed on to the daughter cells. The G2 checkpoint is also an imprtant focus
in understanding the molecular biology of cancer.

3. Spindle Assembly Checkpoint (SAC, metaphase/anaphase transition)

This checkpoint ensures that each of the sister chromatid iscorrectly attached to the spindle
microtubule via the kinetochore. The SAC acts to maintain genome stability by delaying cell
division until accurate chromosome segragation is guaranteed.

The cell cycle checkpoints work through the cascades of internal and external cues that trigger
signalling pathways involve in the activation and inactivation of core proteins that moves the cell
cycle forward. These sets of proteins are called cell cycle regulators.

• Cyclins

These are regulatory proteins that control progression of the cell cycle. Each cyclin is
associated with the phase, transition or set of phases. Cyclins help drive the major events
of eachphase of the cell cycle. For instance, M –cyclins promotes events in M phase such
as nuclear membrane digestion and chromosome condensation.

• Cyclin dependent kinases (CdKs)

Cyclins activate and deactivate many proteins inside the cel such as the cyclin dependent
kinases (CdKs). CdKs are kinases that phosphorylates specific target proteins. The
attached phopshate makes activates or deactvates the target protein. For instance, G1/S
cyclins sends CdKs to S phase protein promoting cell division. A lone CdK is inactive, but
the binding of cyclin activates it to modify specific traget proteins. Cyclin/CdK complex
phosphorylates target proteins need for the progression of the cell cyle.

Cell and Molecular Biology | BIOL 30095 104

 • Maturation Promotion Factor (MPF)

MPFs add phosphate tags to several proteins in the nuclear envelop and signals its
breakdown. MPF also induces chromosome condensation, a key event that initiates M
phase.

• Anaphase-promoting complex / cyclosome (APC/C)

APC/C is a protein complex that breaks down M cyclins at the beginning of anaphase.
Aside from this, APC/C mobilizes the sister chromatids during anaphase by breaking down
the proteins that hold the sister chromatids together. The degradation of these proteins
pushes the cells out of mitosis and allows the daughter cells to enter the G1 phase. APC/C
performs this task by adding small protein tags called ubiquitin (Ub) to its target proteins.
Proteins tagged with ubiquitin are send to proteosome and are degraded.

Cell cycle checkpoints and regulators work together to ensure the successful completion of the
cell cycle. So, how do checkpoints and regulators perform their task? As an example, let us look
at how DNA damage halts cell cycle in G1 phase.

DNA damage is brought about by exposure to

UV rays, ingestion of mutagens and many other
instances. Cells deal with this damage by
utilizing the key response protein called p53, a
known tumor suppresor.

The p53 protein arrests the cell cycle in G2 by

trigerring the production of CdK inhibitors (CKI)
CdK inhibitors bind to CdK-cyclin complexes and
block their activities. Then, p53 activates a DNA
repair mechanisms. Lastly, if the damage is
reparable, the p53 protein triggers programmed
cell death. This ensures that the damage genetic
material will not be passed on to the daughter The interaction of cell cycle checkpoint and
regulators ensures the completion of the cell
cells. cycle.

Cell and Molecular Biology | BIOL 30095 105

 Exercise. Checkpoint ensures successful progression of the cell cycle. Fill out the
table with necessary key points for each cell cycle checkpoint. Identify at least two for
each.
Checkpoint Checks for?

G1 Checkpoint

G2 Checkpoint

M checkpoint

NUCLEAR GENOME EVOLUTION

Genome evolution is the process wherein the genome changes in structure and size over time.
Genome evolution has several mechanisms that allow the genes and genomes to evolve and
produce the vast diversity of modern life form on earth.

The following are the common mechanisms of nuclear genome evolution:

1. Mutation results addition or deletion of one or more nucleotide bases causing changes in the
reading frame, hence the entire code will be read in a different order from the original resulting
to non-functional proteins.

2. In gene duplication, the coding region of a gene is duplicated. This process can either be
due to errors in recombination or through retrotransposition. Duplicated genes are thought to
be immune in selection pressure, hence may accumulate large amounts of mutations.

3. Similar to gene duplication, whole genome duplication is the process in which the organism’s
entire genome is copied. This event is the result of non-disjuction during meiosis. Non
disjuction refers to the failure of chromosomes to segregate during cell division resulting to
imbalance in chromosome numbers. Often, whole genome duplication leads to polyploidy.

4. Transposons are genetic elements called jumping genes as they can insert themselves in a
different location along the genome. Transoposons works in two mechanisms. The first one
is where a certain portion of the genome is excised and transferrred to another region of the
genome (cut and paste). The second mechanisms beigns with making multiple copies of a
certain part if genome and transfer those copies to another location in the genome (copy and
paste).

5. Exon shuffling refers to the process by which two or more exons from different genes were
brought together, or the same exon is dupicated resulting to a new exon-intron structure. This
is a mechanism for creating new genes.

Cell and Molecular Biology | BIOL 30095 106

6. Horizontal Transfer happens when a piece of DNA is transferred from the genome of one cell
to the that of the other. It is incontrat to the vertical gene transfer which happens from parents
to progenies.

Exercise. Identify the mechanism of genome evolution depicted in the following figures. Put your
answer in the box provided.

Cell and Molecular Biology | BIOL 30095 107

Module Assessment

1. What is the role of nucleus in a eukaryotic cell?

2. Kinetochores are proteins associated with centromeres. How many kinetochores are present
in a human cell as it enters mitosis?
3. Cancer is a disease primarily characterized by development of abnormal cells that divide
uncontrollably. Which phase(s) of the cell cycle is affected by cancer?
4. Among the mechanisms of genome evolution, which do you think generates the most diversity
among life forms? Discuss your answer.

Cell and Molecular Biology | BIOL 30095 108

 Module 7

The Endomembrane System

I. Objectives:
• Discuss the concept of cellular modification, packaging and transport;
• Illustrate the pathway during cellular transport;
• Determine the primary function of each intracellular organelle.

Overview
The endomembrane system is consists of the endoplasmic reticulum, Golgi complex, endosomes,
lysosomes, and vacuoles. Together, these organelles make up a single dynamic system that
functions to facilitate the movement of proteins, lipids, and other particles inside the cell. This
process is termed as endomembrane trafficking and is tightly regulated in order to ensure that
each organelle has the correct components for its proper structure and function.
Transport vesicles shuttle membrane lipids and membrane-bound proteins to their proper
destinations in the cell. They also carry soluble materials destined for secretion.

Figure 5.1 The Endomembrane System

Cell and Molecular Biology | BIOL 30095 109

The Endoplasmic Reticulum (ER)
The ER is a network of flattened sacs, tubules, and associated vesicles that stretches throughout
the cytoplasm of the eukaryotic cell. The membrane-bound sacs of the ER are called ER
cisternae (singular: ER cisterna) while the space enclosed by these is called the ER lumen.

Figure 5.2 The Smooth and Rough Endoplasmic Reticulum

There are two kinds of ER – the smooth and the rough ER. The rough ER has ribosomes attached
to the cytosolic side of the membrane where translation occurs. The newly synthesized proteins
will then enter the ER lumen shortly. The smooth ER appears smooth because of the absence
of ribosomes attached to it. Both types of ER are present in eukaryotic cells, however there is
variation on the relative amounts of each type, depending on the activity of the cell. The rough
ER is primarily involved in synthesizing both membrane-bound and soluble proteins for the
endomembrane system. Newly-synthesized proteins enter the endomembrane system co-
translationally. This means that the proteins are inserted via a pore complex in the ER
membrane into the rough ER lumen as the polypeptide is still being synthesized by the ER- bound
ribosome. After synthesis, membrane-spanning proteins are still anchored to the ER membrane
either by covalent attachment to membrane lipids or by hydrophobic regions of the polypeptide.
Meanwhile, secretory proteins are released into the ER lumen. Additionally, the rough ER is also
involved in the cotranslational and posttranslational protein modifications. This includes
glycosylation, polypeptide folding, and assembly of multimeric proteins. Also, the rough ER also
functions to recognize and remove misfolded and improperly modified proteins via the ER-
associated degradation (ERAD). During this process, the defective polypeptides are exported
from the ER for degradation by the cytosolic proteasomes.
The smooth ER plays a role in the processes of drug detoxification, carbohydrate metabolism,
calcium storage, and steroid biosynthesis. The cytochrome P-450 family of proteins, which are
involved in the detoxification of organic compounds (ethanol, barbiturates, etc.) via hydroxylation,

Cell and Molecular Biology | BIOL 30095 110

is prevalent in the smooth ER of hepatocytes. Moreover, the enzyme glucose-6-phosphatase,
which is uniquely found in the smooth ER of hepatocytes, is involved in the breakdown of stored
glycogen. The smooth ER is also the site for the biosynthesis of cholesterol and steroid hormones
such as testosterone, estrogen, and cortisol. Thus, the smooth ER is abundant in the Leydig cells
of the testes, cortisol-producing cells of the adrenal glands, and the follicular cells of the ovaries.
Lastly, the sarcoplasmic reticulum of muscle cells is an example of smooth ER that specializes in
calcium storage. ATP-dependent calcium ATPases pump calcium ions inside the ER.

The Golgi Complex

The Golgi complex is composed of flattened
membrane-bound cisternae, which are disk-
shaped stacks that are stacked together. A
series of cisternae is termed as the Golgi
stack. The number and size of the Golgi
stacks depends upon the metabolic activity of
that particular cell type. The Golgi apparatus
lumen is known as the intracisternal space.
There are actually two sides or faces of the
Golgi stack -- the cis face and the trans face.
The cis face is oriented towards the ER. The
closest Golgi compartment to the ER is
referred to as the cis-Golgi network (CGN).
Transport vesicles that shuttles newly-
synthesized proteins and lipids from the ER
arrive at the CGN, where they fuse with the
CGN membranes.
On the other hand, the opposite side of the Figure 5.2 Golgi Complex
Golgi apparatus is called the trans face. The
Golgi compartment at this side is referred to as the trans-Golgi network (TGN). The TGN is the
site where proteins and lipids ferried by transport vesicles exit the Golgi apparatus by budding
from the tips of the TGN cisternae. The destination of the transport vesicles that carry proteins
and lipids are the endosomes, secretory granules, lysosomes, and plasma membrane. The
central sacs that are located between the CGN and the TGN is called the medial cisternae.
Majority of the processing of proteins occur at the medial cisternae.
The CGN, TGN, and medial cisternae differ in the enzymes and receptor proteins that they
contain. Thus, it could be said that these three are biochemically and functionally distinct from
one another. For instance, staining of the cell to detect the presence of N-acetylglucosamine
transferase I, an enzyme that catalyzes the modification of the carbohydrate side chains of
glycoproteins, localizes it to the medial cisternae of the Golgi complex.
There are two proposed models that explain the movement of proteins and lipids from the CGN
to the TGN through the medial cisternae of the Golgi complex. The stationary cisternae model
posits that every compartment of the Golgi stack is a stable structure. With that being said,

Cell and Molecular Biology | BIOL 30095 111

trafficking is facilitated by shuttle vesicles that bud from one cisterna then fuse with the next
cisterna in the cis-trans sequence. Thus, proteins that are needed to be in the TGN are carried
by shuttle vesicles to its destination.
The second model is known as the cisternal maturation model. According to this model, the
Golgi cisternae are transient structures that changes from CGN cisternae through medial
cisternae to TGN cisternae. First, the CGN is formed from the transition vesicles from the ER that
converge and accumulated specific enzymes for the initial steps in protein processing. As it
acquires additional enzymes, the cis cisternae transform into a medial cisternae and then
eventually into a trans cisternae. In both models, the TGN forms secretory granules or transport
vesicles containing sorted cargo that are targeted to be transported beyond the Golgi complex.
The movement of materials from the ER to the Golgi apparatus towards the plasma membrane is
termed as the anterograde transport. On the other hand, the flow of vesicles from the Golgi
cisternae back to the ER is called the retrograde transport. The retrograde transport allows for
the recycling of the lipids and proteins that are no longer needed during the latter stages of the
anterograde transport. This ensures continuous supply of components for the formation of new
vesicles.

Protein and Lipid Trafficking as facilitated by the ER and Golgi Apparatus

Proteins and lipids have a “tag” for it to be recognized by the specific transport vesicle that will
carry it from one cellular location to the next. For proteins, these “tags” could be composed of a
short-chain amino acid sequence, an oligosaccharide side chain, a hydrophobic domain, or some
other structural moieties. For lipids, the “tags” can be one or more phosphate groups attached to
positions 3,4, and / or 5 of a membrane phosphatidylinositol through a specific kinase.
A brief overview of the trafficking that involves the ER and the Golgi Complex is presented below:
Anterograde transport
1. The ribosomes attached to the rough ER synthesizes proteins. At the same time, the
proteins enter the ER lumen where they undergo the initial steps of glycosylation.
2. The glycosylated proteins and newly-synthesized lipids are then carried by transition
vesicles to the CGN.
3. The proteins and lipids move through the cisternae of Golgi stack.
4. Some vesicles at the TGN forms secretory vesicles in order to release their contents at
the plasma membrane via the process of exocytosis. Meanwhile, other vesicles bud from
the TGN to form endosomes that will eventually become lysosomes.
Retrograde Transport
1. At the same time, the process of endocytosis is also occurring, wherein proteins and other
materials outside are taken inside the cell, forming vesicles that fuse with early
endosomes.
2. Maturation of early endosomes that contain material for digestion to form late endosomes
and then eventually, lysosomes.
3. Compartment-specific proteins are return to earlier compartments via the retrograde
traffic.

Cell and Molecular Biology | BIOL 30095 112

Lysosomes
The lysosomes contain several hydrolytic
enzymes, which includes β-glucuronidase, A B
deoxyribonuclease, ribonuclease, and protease,
hence this organelle is involved in cellular lysis.
The lysosome is bound by a single membrane
which serves as a protection for the rest of the
cell from the hydrolytic enzymes contained in the
lysosome. Additionally, membrane-bound ATP- C
dependent proton pumps maintain an acidic
environment inside the lysosome. This is
essential for activating acid hydrolases and for
the initial denaturation of macromolecules that
are targeted for degradation. Products left after
degradation are then transported to the cytosol
where they will either enter several synthetic Figure 5.3 (A) Phagocytosis; (B) Autophagy (C)
Receptor-mediated endocytosis
pathways or will be extruded from the cell.
Lysosomal enzymes are synthesized by the
ribosomes in the rough ER and undergoes modification in both the ER and the Golgi complex.
From the TGN, the lysosomal enzymes are packaged in clathrin-coated vesicles and travel to the
endosomes. Endosomes mature while it accumulates acid hydrolases over time. The late
endosomes thereby contain digestive enzymes as well as materials that are destined to be
degraded.
Transformation of the late endosome into lysosomes takes place when the acid hydrolases are
activated. Activation of the acid hydrolases occur when the pH of the endosomal lumen becomes
more acidic (pH 4.0 to 5.0) through the ATP-dependent proton pumps.
Mature lysosomes can be distinguished based from the origin of the substances that they contain.
Heterophagic lysosomes are those that contain materials that originate extracellularly. On the
other hand, those with materials of intracellular origin are known as autophagic lysosomes.
Lysosomes are involved in a variety of processes. This includes phagocytosis, receptor-mediated
endocytosis, autophagy, and cellular digestion.
Phagocytosis and receptor-mediated endocytosis is the process of degradation of foreign
materials brought inside a eukaryotic cell. Phagocytosis is the ingestion of large particles which
is approximately about >0.5 µm in diameter. This includes aggregates of macromolecules, whole
cells, or microorganisms. In contrast, receptor-mediated endocytosis makes use of specific
receptors found in the plasma membrane of the cell. Viruses and bacterial toxins can be ingested
by the cells once they are recognized by these receptors. Once inside the cell, these foreign
particles will be degraded.
On the other hand, autophagy is the process of digestion or unwanted or old organelles or other
cell structures. Autophagy can be classified into two types – macrophagy and microphagy.
Macrophagy occurs when the organelle or structure that is to be destroyed is enclosed in a
double membrane derived from the ER. The resulting vesicle is then called autophagic vacuole

Cell and Molecular Biology | BIOL 30095 113

or autophagosome. In contrast, microphagy involves the formation of a much autophagosome
that is surrounded by a single phospholipid bilayer that encloses small bits of cytoplasm rather
than the whole organelle. Extracellular digestion occurs when the lysosomes release their
digestive enzymes to the outside of the cell by exocytosis. An example of extracellular digestion
is when sperm cells extrude lysosomal enzymes that degrade the barriers of the egg cell in order
for fertilization to occur.
Peroxisomes
Peroxisome is an organelle
that is surrounded by a single
membrane and its function is mainly on
degrading hydrogen peroxide with the
use of the enzyme catalase. Hydrogen
peroxide is a toxic compound to the cell
and is mainly a by-product of oxidative
reactions catalyzed by oxidases. Both
catalase and oxidase are contained in
the peroxisomes, thus generation and
detoxification of hydrogen peroxide is
confined in the said organelle. This
protects other parts of the cell from the
harmful compound. Peroxisomes are
found in all eukaryotic cells but it is
more abundant in mammalian liver and
kidney cells, photosynthetic cells in
plants, in algae, and in germinating Figure 5.4 Peroxisomes (green) associate with lipid
bodies (red) during fatty acid oxidation
plant seedlings that store fats.
In addition, peroxisomes are also
involved in the β- oxidation of fatty acids. In animal cells, peroxisomes degrade long chain (16-22
carbons), very long (24-26), and branched fatty acids. The main product of the β- oxidation of
fatty acids is acetyl-CoA which can then enter biosynthetic pathways or the tricarboxylic acid cycle
(TCA). Meanwhile, peroxisomes are involved in the complete catabolism of fatty acids to acetyl-
CoA in plants and fungi.
In plants, a functionally-distinct type of plant peroxisomes occurs temporarily in seedlings that
store carbon and energy reserves. This is called glyoxysomes. Glyoxysomes contain enzymes
that are essential for metabolic pathways that breaks down the stored carbon and energy sources
in the seedling. These catabolic pathways include β- oxidation of fatty acids and the glyoxylate
cycle.

Cell and Molecular Biology | BIOL 30095 114

Vacuoles
In plants, vacuoles are acidic membrane-
enclosed compartments that resembles the
lysosomes in animal cells. Just like
lysosomes, the vacuoles also contain
hydrolytic enzymes. One of the major roles of
the plant vacuoles is to accumulate solutes
which causes water to enter the cells by
osmosis. As a result, the cell maintains
turgor pressure, thereby preventing the
plant from collapsing and wilting. Moreover,
turgor pressure enables the remodeling of
plant cells. For instance, softening of the cell
wall (higher turgor pressure) allows plant to
expand.
Additionally, vacuoles act as storage for a variety of compounds. This includes the anthocyanins
that impart colors to flowers, malate in CAM plants, both organic and inorganic nutrients,
compounds that protect the plants against ultraviolet light, and residual indigestible wastes.
Another important function of the vacuole is regulation of the cytosolic pH. Vacuoles have ATP-
dependent proton pumps that can transfer protons from the cytosol to the lumen of the vacuole.
This compensates for a decline in the cytosolic pH that could happen when sudden changes in
the extracellular environment occurs.

Cell and Molecular Biology | BIOL 30095 115

Module Assessment:

1. Each of the following processes is associated with one or more specific eukaryotic organelles.
In each case, identify the organelle or organelles, and suggest one advantage of confining the
process to the organelle or organelles.
a. β- oxidation of long-chain fatty acids
b. Regulation of calcium ion concentration in muscle cells
c. Degradation of damaged organelles
e. Hydroxylation of barbiturate drugs

2. For each of the following statements, indicate if the statement is true of the rough ER only (R),
of the smooth ER only (S), or of both rough and smooth ER (RS).
(a) Contains less cholesterol than does the plasma membrane
(b) Does not contain free ribosomes
(c) Is involved in steroid biosynthesis
(d) Is involved in the breakdown of polycyclic aryl hydrocarbons
(e) Is the site for biosynthesis of secretory proteins
(f) Is the site for the folding of membrane-bound proteins
(g) Tends to form tubular structures
(h) Usually consists of flattened sacs

3. Why is it important for the biochemical reactions occurring in peroxisomes to be isolated from
the cytoplasm in a separate organelle?

4. Although the plant vacuole resembles the lysosome of animal cells, it has additional functions
other than housing hydrolytic enzymes. Describe these functions. How do they reflect a plant’s
immobile lifestyle?

5. What problems would a cell have if it could not produce lysosomes?

Cell and Molecular Biology | BIOL 30095 116

 Module 8

Cytoskeleton and Cell Motility

I. Objectives
• Discuss the basic structure, composition, variations and molecular mechanism of action
of cytoskeletal component of the cell;
• Identify the advantages and disadvantages of having variation of cytoskeleton in relation
to motility.

Overview
The cytoskeleton in a eukaryotic cell is a complex network of interconnected filaments
and tubules that extends throughout the cytosol, from the nucleus, to the inner surface of the cell
membrane. The cytoskeleton provides an architectural framework for the cell and its functions.
The cytoskeleton is highly important during cell division, cell movement, cell signaling, and cell
adhesion.
There are three structural elements of the cytoskeleton in eukaryotic cells. These are the
microfilaments, microtubules, and the intermediate filaments. These three structural elements are
distinct in size, structure, and intracellular distribution. A brief summary of the differences between
these three are presented in Table 6.1.
Table 6.1 Properties of Microtubules, Microfilaments, and Intermediate

Polymer Subunit Microtubules Microfilaments Intermediate filaments

Structure Hollow tube with a Two intertwined Eight protofilaments

wall consisting of chains of F-actin joined end to end with
typically 13 staggered overlaps
protofilaments
Diameter 25 nm 7 nm 8-12 nm
Monomers α-tubulin, β-tubulin G-actin Six classes of proteins
Cytosolic MTs: - Muscle contraction - Structural support
- Organization and - Cell locomotion - Maintenance of
maintenance of animal cell shape
- Cytoplasmic
animal cell shape and
streaming - Formation of nuclear
polarity
lamina and scaffolding
- Cytokinesis
Functions - Chromosome
- Strengthening of
movements - Maintenance of
nerve cell axons
animal cell shape
- Intracellular (neurofilament
transport/trafficking, - Intracellular protein)
and movement of transport/ trafficking
- Keeping myofibrils in
organelles
register (desmin)
Axonemal MTs:
- Cell motility

Cell and Molecular Biology | BIOL 30095 117

Microtubules
Microtubules are the
largest of the three
structural elements.
They are involved in a
diverse array of cellular
processes whose
common denominator
is movement.
Microtubules are made
up of the protein
tubulin and their
diameter is approximately 25 nm.
There are two general groups of microtubules which could be differentiated in their structural
stability and degree of organization. Cytosolic microtubules are more loosely organized; thus,
they are more dynamic. This group of microtubules is involved in various functions, including
maintenance of axons in animal cells and proper orientation of cellulose microfibrils during cell
growth in plant cells. Similarly, mitotic and meiotic spindles that facilitate movement of
chromosomes during cell division is formed by cytosolic microtubules. They are also responsible
in guiding the movement and spatial disposition of organelles and vesicles.
The other group of microtubules is the axonemal microtubules. This type of microtubules is
more stable and highly organized. They are found usually in subcellular structures that are
responsible for cell movement. This includes flagella, cilia, and the basal bodies that serve as
point of attachments for these appendages. The axoneme, or the central shaft, of flagella and
cilia is comprised by a highly organized bundle of axonemal microtubules and other associated
proteins.
In general, microtubules are hollow and straight cylinders which have an outside diameter of 25
nm and an inner diameter of 15 nm. The lengths of microtubules are also varied. Protofilaments,
which are longitudinal arrays of linear polymers, make up the walls of microtubules. Usually, 13
protofilaments that are arranged side by side surround the hollow center of a microtubule. The
basic unit of the protofilament is a heterodimer of the protein tubulin. This heterodimer is
composed of one molecule of α-tubulin and another molecule of β-tubulin which bind
noncovalently to each other. The αβ-heterodimer is stable; thus, it does not dissociate under
normal conditions.
Each α-tubulin and β-tubulin molecules have an estimated diameter of about 4-5 nm and has a
molecular weight of 55 kDa. Also, these two have almost identical 3D protein structure. Both α-
tubulin and β-tubulin each has the following: (1) a GTP-binding domain at the N-terminus; (2) a
domain located at the middle where microtubule inhibitor can bind; (3) a C-terminus domain that
interacts with MAPs (microtubule associated proteins). The microtubule is a polarized structure,
meaning it has a plus (+) end and a minus (-) end.

Cell and Molecular Biology | BIOL 30095 118

There are a number of drugs that could adversely affect the assembly of microtubules. One
example is the drug colchicine, which is a naturally-occurring compound from Colchicum
autumnale. Colchicine binds to the β-tubulin, thereby preventing the heterodimers to be
incorporated into the microtubules. It results to the destabilization of the microtubules, which then
lead to disassembly. Other drugs that could inhibit microtubule formation is presented in Table
6.2.
Microtubules can be in the form of singlets, doublets, or triplets. Cytosolic microtubules are form
singlets, which is built from 13 protofilaments. On the other hand, axonemal microtubules can
contain either doublet or triplet microtubules, thus they are more complex. Both doublets and
triplets are composed of one complete 13-protofilament microtubule (A tubule) and an additional
one or two incomplete microtubules (B and C microtubule). Doublets are observed in locomotory
structures, such as the cilia and flagella. Meanwhile, triplets are found in centrioles and basal
bodies.

Microfilaments
The smallest structural element of cytoskeleton
is the microfilament. The microfilaments have
approximately a diameter of 7 nm. Their function
is primarily on interacting with myosin filaments
in order to cause the contractions characteristics
of muscles. Be that as it may, the microfilaments
are not exclusively found in muscle cells, they
are also present in almost all types of eukaryotic
cells. Microfilaments also play a role in various
structural and locomotory functions.
In terms of cell locomotion, the microfilaments
are responsible for cell migration through the
filopodia and lamellipodia, cytoplasmic streaming, and amoeboid movement. The cleavage

Cell and Molecular Biology | BIOL 30095 119

furrow in animal cells during cytokinesis are also produced by microfilaments. Additionally,
microfilaments are also present at the sites of attachment of cells to one another and to the
extracellular matrix.
Similarly, microfilaments aid in maintaining the shape and structure of cells. For instance,
animal cells have a network of microfilaments within the cell cortex just under the plasma
membrane. Likewise, the microvilli are also made up of parallel bundles of microfilaments.
The building block of microfilaments is the protein actin. Actin molecules are referred to
as the G-actin (globular actin). When G-actin polymerizes to form a microfilament, it is now
referred to as F-actin (filamentous actin). There are a variety of types of actins that are found in
the cell. Actins are classified into two groups – the α-actins (muscle-specific actins) and the β-
and γ- actins (non-muscle actins).
Just like microtubules, there are a variety of drugs that could affect the polymerization of

Table 6.2 Chemical Agents Used to Perturb the Cytoskeleton

Agent Source Effect
Agents Affecting Microtubules
Colchicine, colcemid Autumn crocus, Colchicum Binds β-tubulin, inhibiting
autumnale assembly
Nocadazole Synthetic compound Binds β-tubulin, inhibiting
polymerization
Vinblastine, vincristine Periwinkle plant, Vinca rosea Aggregates tubulin
heterodimers
Paclitaxel (taxol) Symbiotic fungi in bark of the Stabilizes microtubules
Pacific yew tree, Taxus
brevifolia
Agents Affecting Microfilaments
Cytochalasin D Fungal metabolite Prevents addition of new
monomers to plus ends
Latrunculin A Red sea sponge, Latrunculia Sequesters actin monomers
magnifica
Phalloidin Death cap fungus, Amanita Binds and stabilizes
phalloides assembled microfilaments
Agents Affecting Intermediate Filaments
Acrylamide Synthetic compound Causes loss of intermediate
filament networks
microfilaments. An example is the latrunculin A, which is a marine toxin from the Red Sea
Sponge Latrunculia magnifica. This drug prevents addition of actin to the growing microfilament

Cell and Molecular Biology | BIOL 30095 120

by sequestering actin monomers. Other drugs that inhibits microfilaments are also show in the
table.
Intermediate Filaments
Intermediate filaments have an average diameter of about 8-12 nm. They are absent in the cytosol
of plant cells; however, they are abundant in animal cells. Intermediate filaments can occur in
bundles or singly and they play an important role in maintaining the structure and tension of animal
cells. An example of an intermediate filament is keratin. Keratin is a component of skin in animals,
including their claws, fingernails, hair, horn and beaks, feathers, turtle shells, and scales.

Table 6.3 Classes of Intermediate Filaments

Class IF Protein Tissue Function

I Acidic keratins Epithelial cells Mechanical strength

II Basic or neutral keratins Epithelial cells Mechanical strength

III Vimentin Fibroblasts; cells of Maintenance of cell shape

mesenchymal
origin; lens of eye

III Desmin Muscle cells, especially Structural support for

smooth contractile
muscle machinery

III GFA protein Glial cells and astrocytes Maintenance of cell shape

IV Neurofilament proteins Central and peripheral Axon strength; determines

nerves axon size

V Nuclear lamins All cell types Form a nuclear scaffold to

give shape to nucleus
VI Nestin Neuronal stem cells Unknown

Of the three structural elements of the cytoskeleton, the intermediate filaments are the most stable
and the least soluble constituent. They can resist treatment of cells with detergents; thus, they
serve as a scaffold that support the entire cytoskeleton framework.
The amino acid composition of intermediate filaments varies between tissue types. A summary of
the classes of the intermediate filaments is presented in Table 6.3. Class I and II are composed
of keratins. Keratins are found in epithelial cells that cover body structure, examples of which are
mentioned in the previous paragraphs. Class I keratins are the acidic keratins, while Class II are
the neutral or basic keratins. As can be seen from the table, class III includes vimentin, desmin,
and GFA (glial fibrillary acidic) protein. Vimentin is seen in connective tissues and cells that are
derived from nonepithelial cells. Vimentin is also a prominent feature in cultured fibroblast cells.
Meanwhile, desmins are present in muscle cells. GFA proteins are observed in glial cells that

Cell and Molecular Biology | BIOL 30095 121

insulates nerve cells. Neurofilament proteins
found in neurofilaments of nerve cells comprise
the Class IV of intermediate. Class V is
composed of nuclear lamins A, B, and C. These
proteins serve as filamentous scaffold of the
nuclear membranes in animal cells. Nestin
comprise the Class VI of intermediate filaments.
Nestins are found in the neurofilaments of cells in
the embryonic nervous system.
Since intermediate filaments are tissue-specific,
the technique intermediate filament typing is a
useful tool in medicine, particularly in diagnosing
tumor cells. Tumor cells retain their intermediate
filament characteristics of their origin tissue.
The basic subunits of intermediate filaments are
dimers. However, these dimers are fibrous, in
contrast to actin and tubulin which are globular
proteins. Each subunit of the intermediate
filament dimer has a homologous central rod-like
domain that is composed of 310-318 amino
acids. The central domain is consists of 4 α-
helical segments interspersed with 3 short linker
segments. N- and C-terminal domains that vary
greatly in size, sequence, and function flank the Figure 6.4 Basic Structure of α-
central domain. keratin

The fundamental structural unit of intermediate filaments is comprised of a dimer of 2 polypeptides

that are intertwined with one another via the central domains. These 2 polypeptides are aligned
in a parallel way and the N- and C- terminal regions protrude as globular structures at each end.
To form a tetramer, two dimers align laterally in an offset way. Then, protofilaments are formed
when tetramers overlap with one another, thereby building a filamentous structure. Finally,
intermediate filament is formed when protofilaments assembly in a higher order. A fully-
assembled intermediate filament is estimated to be 8 protofilaments thick

Cell and Molecular Biology | BIOL 30095 122

Cell Motility
Motility can be defined as the
movement of a cell, its
components, or the whole
organism itself on its
environment. It can be observed
at the subcellular, cellular, and
tissue levels. The process of cell
motility utilizes the conversion of
chemical energy (ATP) into
mechanical energy through the
motor proteins. The
microtubules and microfilaments Figure 6.3 (a) Cilia in Paramecium; (b) Pseudopods in
Amoeba; (c) Flagellum in Euglena
serve as a scaffold for these
motor proteins.

There are two types of motility systems in eukaryotes – one that is microtubule-based and another
that is microfilament-based. Microtubule-based motility of components inside the cell involves
the motor proteins kinesins and dyneins while the movement of the whole organism is facilitated
by the motor appendages, cilia and flagella. On the other hand, microfilament-based motility
is mediated by the myosin family of motor proteins.

Microtubule-based motility
Transport of vesicles through the endomembrane system is mediated by the kinesins and
dyneins. Kinesins are involved in the movement of vesicles away the Golgi complex until it
reaches the cell periphery. Meanwhile, the dyneins move in the opposite direction, carrying
vesicles that form via endocytosis and transporting them further inside the cell.
Cilia is being used by unicellular organisms like Paramecium and protozoans for collection of
food and for locomotion. In multicellular organisms like humans, cilia can be found at the cells
that line the air passages of the respiratory tract. Flagella enables a cell to move along a fluid
medium. They are larger in size than cilia. A notable example of a cell that moves by means of
flagella is the human sperm cell.
Microfilament-based motility
Contraction of mammalian muscles is
mediated by microfilaments.
Additionally, cell crawling of growing
neurons, fibroblasts, and embryonic
cells through the use of lamellipodia
and/or filopodia is based also on
microfilaments. Lamellipodia and
filopodia are cell protrusions Figure 6.4 Comparison between Filipodia and Lamellipodium

produced by the cell to initiate their

crawling movement. The type of protrusion depends on the assembly of the actin filaments and

Cell and Molecular Biology | BIOL 30095 123

the nature of the movement of the cell itself. The former is a protrusion of a thin sheet of the
cytosol while the latter are characterized by fingerlike projections. Moreover, microfilaments are
also involved in the amoeboid movement displayed by white blood cells and amoebas. Amoeboid
movement is accompanied by a different kind of cell protrusion which is the pseudopodia. Cells
that exhibit the amoeboid movement typically have an exterior layer of gelatinous, actin-rich
cytosol while it has a more fluid inner cytoplasm that is called the endoplasm.

Module Assessment

1. True or False. Identify each of the following statements as true (T) or false (F). Provide a
brief justification for your answer.
a. Colchicine is an agent that can stop the polymerization of microtubules, intermediate
filaments, and microfilaments.
b. Treating a mitotic cell with Latrunculin A will result in the movement of chromosomes to
one side of the cell.
c. Acidic keratins, vimentin, desmin, and nestins are proteins present in intermediate
filaments
d. An algal cell contains neither tubulin nor actin.
e. All of the protein subunits of intermediate filaments are encoded by genes in the same
gene family.

2. Described below are the results of two recent studies on the proteins of the cytoskeleton. In
each case, state the conclusion(s) that can be drawn from the findings. (5 points each)
a. When an animal cell is treated with colchicine, its microtubules depolymerize and
virtually disappear. If the colchicine is then washed away, the MTs appear again,
beginning at the centrosome and elongating outward at about the rate (1µ/min) at
which tubulin polymerizes in vitro.
b. Small vesicles containing pigment inside of pigmented fish epidermal cells aggregate
or disperse in response to treatment with certain chemicals. When nocodazole is
added to cells in which the pigment granules have been induced to aggregate, the
granules cannot disperse again.

3. Human sperm swim using a flagellum. They also have mitochondria at the base of the
flagellum. What advantage do you think this structure provides, based on what you know about
flagella?

Cell and Molecular Biology | BIOL 30095 124

 Module 8

Bioenergetics: Energy Flowing, Harvesting and Yielding Processes

I. OBJECTIVES: At the end of this module, you should be able to:

• Discuss the different processes that are involved in cellular respiration to produce
energy
• Explain the steps and features of photosynthesis
• Explain the different carbon fixation synthesis in different plants

II. COURSE MATERIAL

A living cell bustles with activity.

Macromolecules of all types are
assembled from raw materials, waste
products are produced, and excreted,
genetic instructions flow from the
nucleus to the cytoplasm, vesicles
are moved along the secretory
pathway, ions are pumped across cell
membranes, and so forth. To
maintain such a high level of activity,
a cell must acquire and expend
energy. The study of the various
types of energy transformations that
occur in living organisms is referred to
as bioenergetics.

Cells are in a constant need of ATP to regulate different cellular processes produced by energy-
converting organelles. These organelles are mitochondria that occur in all cells, burning food
molecules to produce ATP by oxidative phosphorylation, and chloroplasts, which can be found in
photosynthetic organisms such as plants and algae, gathering solar energy as a source in
producing ATP.

Energy conversion happens when high energy electrons, derived from oxidized food molecules,
energized pigment by the sunlight, and other sources, are being processed and transferred along
with the series of electron-transport protein complexes that create chain that is embedded in the
membrane. The transferred electron releases energy that is used to pump H+ that will eventually
generate large electrochemical gradient across the membrane. Then, electrochemical gradient
will store the created energy and it can be harnessed to do useful work when ions flow back
across the membrane.

Protons flow down in the electrochemical gradient through the ATP synthase that phosphorylates
ADP and inorganic phosphate (Pi) and yields ATP. Therefore, energy harnessed from food and
sunlight is being converted into chemical energy in the form of ATP.

Cell and Molecular Biology | BIOL 30095 125

The Mitochondrion

In a eukaryotic cell, almost 20% of the cytoplasmic volume is occupied by the mitochondria, like
a bacterium size, about 0.5-01μm. One of its characteristics is being dynamic and flexible, its
mobility inside the cell, always changing shape, dividing, and fusing. Sometimes, mitochondria
are compared to the microtubular cytoskeleton that determines cell type based on their orientation
and distribution. The amount or number of mitochondria depends on the cell type and cell function.
For example, cardiac muscle cells require a high amount of ATP for continuous pumping of the
heart, with this large number of mitochondria is needed to produce high amount of energy in the
form of ATP.

Structure and Function

• Inner and outer mitochondrial membranes enclose two spaces: the matrix and
intermembrane space.
– The outer mitochondrial membrane serves as its outer boundary.
– The inner mitochondrial membrane is subdivided into two interconnected domains:
• Inner boundary membrane
• Cristae: where the machinery for ATP is located

• Mitochondrial Membranes
– The outer membrane is about 50% lipid; the inner membrane is more than 75%
protein.
– The inner membrane contains cardiolipin (diphosphatidylglycerol) but not
cholesterol. Outer membrane contains many enzymes involved in diverse
activities: epinephrine oxidation, tryptophan degradation, fatty acid elongation,
mitochondrial lipid synthesis,etc.
– The outer membrane contains a large pore-forming protein called porin, integral
protein permeable to ATP, NAD, CoA
– The inner membrane is impermeable to even small molecules, contain
Ca2+ATPase, Ca2+-H+ symport, electron transport chain, ATP machinery,
pyruvate-H+ symport

• The mitochondrial matrix

– Contains a circular DNA molecule, ribosomes, and enzymes for oxidation of fatty
acids, pyruvate, citric acid cycle
– RNA and proteins can be synthesized in the matrix.

Cell and Molecular Biology | BIOL 30095 126

 – In humans, this nonchromosomal DNA encodes 13 mitochondrial polypeptides &
2 rRNAs & 22 tRNAs that are used in protein synthesis within the organelle
– genes to encode some of the most hydrophobic proteins of the inner mitochondrial
membrane
– contains filaments & dense granules (some are calcium phosphate storage sites)

Carbohydrate Metabolism

The reactions of glycolysis generate

pyruvate and NADH in the cytosol. In the
absence of O2, the pyruvate is reduced by
NADH to lactate (or another product of
fermentation, such as ethanol in yeast).
The NAD+ formed in the reaction is
reutilized in the continuation of glycolysis.
In the presence of O2, the pyruvate
moves into the matrix (facilitated by a
membrane transporter), where it is
decarboxylated and linked to coenzyme
A (CoA), a reaction that generates
NADH. The NADH produced during
glycolysis donates its high-energy
electrons to a compound that crosses the
inner mitochondrial membrane. The
acetyl CoA passes through the TCA
cycle, which generates NADH and
FADH2. The electrons in these various NADH and FADH2 molecules are passed along the
electron-transport chain, which is made up of carriers that are embedded in the inner
mitochondrial membrane, to molecular oxygen (O2). The energy released during electron
transport is used in the formation of ATP. If all of the energy from electron transport were to be
utilized in ATP formation, approximately 36 ATPs could be generated from a single molecule of
glucose.

Oxidative Metabolism in the Mitochondrion

• The first steps in oxidative metabolism are carried out in glycolysis.

– Glycolysis produces pyruvate, NADH, and two molecules of ATP.
– Aerobic organisms use O2 to extract more than 30 additional ATPs from pyruvate
and NADH.
– Pyruvate is transported across the inner membrane and decarboxylated to form
acetyl CoA, which enters the next stage.
• The next step is the Krebs Cycle.
– The tricarboxylic acid (TCA) cycle, also called the Krebs cycle after the person
who formulated it, or the citric acid cycle after the first compound formed in it.
– It is a stepwise cycle where substrate is oxidized and its energy conserved.
– The cycle begins with the condensation of oxaloacetate (OAA) and acetyl CoA.
– The two-carbon acetyl group from acetyl CoA is condensed with the four-carbon
oxaloacetate to form a six-carbon citrate.

Cell and Molecular Biology | BIOL 30095 127

 – During the cycle, two carbons are oxidized to CO2, regenerating the four-carbon
oxaloacetate needed to continue the cycle.
– Four reactions in the cycle transfer a pair of electrons to NAD+ to form NADH, or
to FAD+ to form FADH2.
– Reaction intermediates in the TCA cycle are common compounds generated in
other catabolic reactions making the TCA cycle the central metabolic pathway of
the cell.

Glycolysis - During glycolysis, one molecule of

glucose is split in half, partially oxidized, and
converted to two molecules of pyruvate. Energy is
conserved as a net gain of two molecules of ATP
and two molecules of NADH. Here are the two Main
Energy-
Steps: Investment
Step

1. Energy-Investment Step: As glycolysis begins,

two ATP are used to activate glucose by adding
phosphate. Glucose eventually splits into two C3
molecules known as G3P, the same molecule
produced during photosynthesis. Each G3P has a
phosphate group, each of which is acquired from an
ATP molecule. From this point on, each C3 molecule
undergoes the same series of reactions.

2. Energy-Harvesting Step: Oxidation of G3P now

occurs by the removal of electrons accompanied by Energy-
harvesting
hydrogen ions. In duplicate reactions, electrons are Step
+
picked up by coenzyme NAD . When O2 is available,
each NADH molecule carries two high-energy
electrons to the electron transport chain and
becomes NAD+ again. In this way, NAD+ is recycled
and used again. The addition of inorganic phosphate
results in a high-energy phosphate group on each
C3 molecule. These phosphate groups are used to directly synthesize two ATP in the later steps
of glycolysis. This is called substrate-level ATP synthesis, also called substrate- level
phosphorylation, because an enzyme passes a high-energy phosphate to ADP, and ATP results.
**this is an example of a coupled reaction: An energy-releasing reaction is driving forward an
energy-requiring reaction on the surface of the enzyme**. Oxidation occurs again, substrate- level
ATP synthesis occurs again per each C3, and two molecules of pyruvate result. Subtracting the
two ATP that were used to get started, and the four ATP produced overall, there is a net gain of
two ATP from glycolysis.

Net Reaction:
Glucose + 2NAD+ + 2ADP + 2Pi à 2 Pyruvate + 2 ATP + 2NADH + 2H+ + 2H20

Cell and Molecular Biology | BIOL 30095 128

The tricarboxylic acid (TCA) cycle - also called
the Krebs cycle after the person who formulated it,
or the citric acid cycle after the first compound
formed in it. The cycle begins with the
condensation of oxaloacetate (OAA) and acetyl
CoA. The two carbons lost during passage through
the cycle are derived from oxaloacetate. The
standard free energies (in kcal/mol) and names of
enzymes are also provided. Five pairs of electrons
are removed from substrate molecules by
pyruvate dehydrogenase and the enzymes of the
TCA cycle. These high-energy electrons are
transferred to NAD+ or FAD and then passed down
the electron-transport chain for use in ATP
production.

At the start of the cycle, the (C2) acetyl group

carried by CoA joins with a C4 molecule, and a C6 citrate molecule results. During the cycle,
oxidation occurs when electrons are accepted by NAD+ in three instances and by FAD in one
instance. Therefore, three NADH and one FADH2 are formed as a result of one turn of the citric
acid cycle. Also, the acetyl group received from the prep reaction is oxidized to two CO2
molecules. citric acid cycle turns twice for each original glucose molecule.

NADH Shuttle

Malate-aspartate Shuttle - Malate crosses to the mitochondrial matrix and reduces NAD+ to
form NADH which forms 3ATPs per molecule of NADH
Glycerol phosphate Shuttle - Cytosolic NADH reduces dihydroxyacetone phosphate to glycerol
phosphate crosses to the mitochondrial matrix which reduces FAD to FADH2 forms 2 ATPs per
molecule of FADH2

Malate-aspartate Shuttle Glycerol phosphate Shuttle

Oxidative Phosphorylation

Importance of Reduced Coenzymes

– As electrons move through the electron-transport chain, H+ are pumped out across the
inner membrane.
– ATP is formed by the controlled movement of H+ back across the membrane through the
ATP-synthesizing enzyme.

Cell and Molecular Biology | BIOL 30095 129

 – Coupling of H+ translocation to ATP synthesis is called chemiosmosis.
– Three molecules of ATP are formed from each pair of electrons donated by NADH; two
molecules of ATP are formed from each pair of electrons donated by FADH2.
– Process: Substrates such as isocitrate and succinate are oxidized and the electrons are
transferred to the coenzymes NAD+ or FAD to form NADH or FADH2. These high-energy
electrons are then transferred through a series of electron carriers of the electron transport
chain. The energy released is used to translocate protons from the matrix to the
intermembrane space, establishing a proton electrochemical gradient across the inner
mitochondrial membrane. Then, the protons move down the electrochemical gradient,
through an ATP-synthesizing complex. The energy stored in the gradient is used to
synthesize ATP.

The Role of Mitochondria in the Formation of ATP

Cyt C
Q
CI CIV
CII CIII

Electron-Transport Complexes
– Complex I (NADH dehydrogenase) catalyzes transfer of electrons from NADH to
ubiquinone and transports four H+ per pair.
– Complex II (succinate dehydrogenase) catalyzes transfer of electrons from
succinate to FAD to ubiquinone without transport of H+.
– Complex III (cytochrome bc1) catalyzes the transfer of electrons from ubiquinone
to cytochrome c and transports four H+ per pair.
– Complex IV (cytochrome c oxidase) catalyzes transfer of electrons to O2 and
transports H+ across the inner membrane.
– Cytochrome oxidase is a large complex that adds four electrons to O2 to form two
molecules of H2O.
– The metabolic poisons CO, N3–, and CN– bind catalytic sites in Complex IV.

Cell and Molecular Biology | BIOL 30095 130

The electron-transport chain of the inner mitochondrial membrane

The respiratory chain consists of four complexes of electron carriers and two other carriers
(ubiquinone and cytochrome c) that are independently disposed. Electrons enter the chain from
either NADH (via complex I) or FADH2 (a part of complex II). Electrons are passed from either
complex I or II to ubiquinone (UQ, which exists as a pool within the lipid bilayer. Electrons are
subsequently passed from reduced ubiquinone (ubiquinol) to complex III and then to the
peripheral protein cytochrome c, which is thought to be mobile. Electrons are transferred from
cytochrome c to complex IV (cytochrome oxidase) and then to O2 to form H2O. The sites of proton
translocation from the matrix to the cytosol are indicated. The precise number of protons
translocated at each site remains controversial; the number indicated is a general consensus.
Keep in mind that the proton numbers shown are those generated by each pair of electrons
transported, which is sufficient to reduce only one-half of an O2 molecule. (The translocation of
protons by complex III occurs by way of a Q cycle. The Q cycle can be divided into two steps,
each of which leads to the release of two protons into the cytosol.) The tertiary structure of
Complex I has yet to be determined, but its overall shape is indicated.

Translocation of Protons and the Establishment of a Proton-Motive Force

• Two components of the proton gradient:

– Concentration gradient between matrix and intermembrane space creates a pH
gradient (ΔpH).
– Separation of charge across the membrane creates an electric potential (Ψ).
– Energy present in both components of the gradients is proton-motive force (Δp).
– Proton-motive force maintenance requires inner mitochondrial membrane to be
highly impermeable to H+ ions.
– If not, electrochemical gradient is quickly dissipated by H+ ion diffusion into matrix,
leading to energy released as heat.
– Uncoupling proteins (UCPs) present in the inner mitochondrial membrane for
transporting H ions to the matrix
– UCP1 abundant in brown adipose tissues of mammals as source of heat
production during exposure to cold temperature.
– Human infants also rely on brown fat deposits to maintain body temperature
– These brown fat cells are largely lost as we grow up, which makes us dependent
upon muscle contraction (shivering) to generate body heat

Cell and Molecular Biology | BIOL 30095 131

The Machinery for ATP Formation

The structure of the ATP synthase

– The F1 particle is the catalytic
subunit, and contains three catalytic
sites for ATP synthesis found in the 3
β subunits
– The F0 particle attaches to the F1 and
is embedded in the inner membrane.
– The F0 base contains a channel
through which protons are conducted
from the intermembrane space to the
matrix–demonstrated in experiments
with sub-mitochondrial particles.
– The number of subunits in the c ring
is 10–14 because structural studies Bacterial ATP synthase from E. coli
have revealed that this number can vary depending on the source of the enzyme.
– Yeast mitochondrial and E. coli ATP synthase have 10 c subunits.
– The chloroplast ATP synthase has 14 c subunits.
– The enzyme consists of two major portions, called F1 and F0. The F1 head consists
of five different subunits in the ratio 3alpha: 3beta: 1delta: 1epsilon: 1gamma. The
alpha and beta subunits are organized in a circular array to form the spherical head
of the particle; the gamma subunit runs through the core of the ATP synthase from
the tip of F1 down to F0 to form a central stalk; the epsilon subunit helps attach the
gamma subunit to the F0 base. The F0 base, which is embedded in the plasma
membrane, consists of three different subunits in the apparent ratio 1a: 2b: 10–
14c. The c subunits form a rotating ring within the membrane; the paired b subunits
of the F0 base and the delta subunit of the F1 head form a peripheral stalk that
holds the alpha/beta subunits in a fixed position; and the a subunit contains the
proton channel that allows protons to traverse the membrane. The mammalian
enzyme contains seven to nine small additional subunits whose functions are not
well established.

Binding Change Mechanism

Cell and Molecular Biology | BIOL 30095 132

 - The Basis of ATP Formation According to the Binding Change Mechanism
- The binding change mechanism states the following:
• Movement of protons through ATP synthase alters the binding affinity of
the active site.
• Each active site goes through distinct conformations that have different
affinities for substrates and product.
• There is a structural basis of catalytic site conformation.

**(a) At the beginning of the cycle, the site is in the open (O) conformation, and substrates ADP
and Pi are entering the site. In step 1, the movement of protons through the membrane induces
a shift to the loose (L) conformation in which the substrates are loosely bound. In step 2, the
movement of additional protons induces a shift to the tight (T) conformation, in which the affinity
for substrates increases, causing them to be tightly bound to the catalytic site. In step 3, the tightly
bound ADP and Pi spontaneously condense to form a tightly bound ATP; no change in
conformation is required for this step. In step 4, the movement of additional protons induces a
shift to the open (O) conformation, in which the affinity for ATP is greatly decreased, allowing the
product to be released from the site. Once the ATP has dissociated, the catalytic site is available
for substrate binding, and the cycle is repeated. (b) Schematic drawing showing changes at all
three catalytic sites of the enzyme simultaneously. The movement of protons through the F0 part
of the enzyme causes the rotation of the asymmetric γ subunit, which displays three different
faces to the catalytic sub- units. As the γ subunit rotates, it induces changes in the conformation
of the catalytic site of the β subunits, causing each catalytic site to pass successively through the
T, O, and L conformations.

The Machinery for ATP Formation

• Catalytic Machinery: The Role of the F0

Portion of ATP Synthase
– The c subunits of the F0 base form a
ring.
– The c ring is bound to g subunit of the
stalk.
– Protons moving through membrane
rotate the ring.
– Rotation of the ring provides twisting
force that drives ATP synthesis.

1. Each a subunit has 2 half-channels that are

physically separated (offset) from one another
2. One half-channel leads from intermembrane (cytosolic) space into the middle of the a
subunit; the other leads from the middle of the a subunit into the matrix
3. It is proposed that each proton moves from the intermembrane space through the half-
channel & binds to a negatively charged aspartic acid residue situated at the surface of
the adjoining c subunit
4. Binding of the proton to aspartic acid carboxyl group generates a major conformational
change in the c subunit that causes the subunit to rotate ~30° in a counterclockwise
direction

Cell and Molecular Biology | BIOL 30095 133

 5. This movement of the recently protonated c subunit brings the adjoining ring subunit
(protonated at an earlier step) into alignment with the second a subunit half-channel
6. Once there, the aspartic acid releases its associated proton, which diffuses into the matrix
7. After proton dissociation, the c subunit then returns to its original conformation & is ready
to accept another proton from the intermembrane space & repeat the cycle
• Translocation of 12 protons would lead to the full 360° rotation of c ring & g subunit &
the synthesis & release of 3 ATPs
+
• If the c ring consists of more or less than 12 subunits, the H /ATP ratio would change

**A model in which proton diffusion is coupled to the rotation of the c ring of the F0
complex. the number of subunits in the c ring is variable. For the sake of simplicity, this c ring
consists of 12 subunits. It is proposed in this model that each proton from the intermembrane
space enters a half-channel within the a subunit and then binds to an acidic residue (Asp 61 in E.
coli) that is accessible on one of the c subunits. Proton binding induces a conformational change
that causes the ring to move by approximately 30. The bound proton is carried in a full circle by
the rotation of the c ring and is then released into a second half-channel that opens into the matrix.
A succession of protons that engage in this activity causes the c ring to rotate in a
counterclockwise direction.

**Other Roles for the Proton-Motive Force in Addition to ATP Synthesis

– The H+ gradient drives transport of ADP into and ATP out of the mitochondrion;
Ca-H+ symport into the mitochondrion
– ADP is the most important factor controlling the respiration rate.
– In aerobic bacteria, used to drive transport proteins of nutrients like lactose-H+
symport, amino acid-H+ symport
– It is the driving force for the movement of the flagellar motor rings for bacteria to
swim

You are working with acetyl CoA molecules that contain only radioactive carbon. They are
incubated with all the components of the citric acid cycle long enough for one turn of the cycle.
Explain why the carbon dioxide given off is radioactive.

Cyanide is known to be an inhibitor of the electron transport chain. It functions by inhibiting one
of the cytochrome enzymes. How, then, would this cause death to the individual?

Cell and Molecular Biology | BIOL 30095 134

Label each pathway and products

Some coupled reactions in cells, including many involved in protein synthesis, use the nucleotide
GTP as an energy source instead of ATP. What would be the advantage of using GTP instead of
ATP as an energy source for these cellular reactions?

Cell and Molecular Biology | BIOL 30095 135

 Label the ATP Synthase. Describe the mechanism and formation
of ATP.

Differentiate ATP Synthase vs. ATPase.

Chloroplast and Photosynthesis

All animals and most microorganisms rely on the continual uptake of large amounts of organic
compounds from their environment. These compounds pro- vide both the carbon-rich building
blocks for biosynthesis and the metabolic energy for life. It is likely that the first organisms on the
primitive Earth had access to an abundance of organic compounds produced by geochemical
processes, but it is clear that these were used up billions of years ago. Since that time, virtually
all of the organic materials required by living cells have been produced by photosynthetic
organisms, including plants and photosynthetic bacteria. The core machinery that drives all
photosynthesis appears to have evolved more than 3 billion years ago in the ancestors of present-
day bacteria; today it provides the only major solar energy storage mechanism on Earth. The
most advanced photosynthetic bacteria are the cyanobacteria, which have minimal nutrient
requirements. They use electrons from water and the energy of sunlight to convert atmospheric
CO2 into organic compounds—a process called carbon fixation. In the course of the overall
reaction nH2O + nCO2 → (light) (CH2O)n + nO2, they also liberate into the atmosphere the
molecular oxygen that then powers oxidative phosphorylation. In this way, it is thought that the
evolution of cyanobacteria from more primitive photosynthetic bacteria eventually made possible
the development of the many different aerobic life-forms that populate the Earth today.

Cell and Molecular Biology | BIOL 30095 136

 • They include higher
plants, eukaryotic
algae, diatoms, some Chloroplasts

flagellated protists & Vacuole

members of 5 groups s

of prokaryotes Nucleu
(heliobacteria, s

cyanobacteria, purple Enlarged view of palisade mesophyll

sulfur, green cell with chloroplasts

nonsulfur & green

sulfur bacteria) O2
CO
• Chloroplasts have a 2

double membrane.
– The outer membrane contains porins and is permeable to large molecules.
– The inner membrane contains light-absorbing pigment, electron carriers, and ATP-
synthesizing enzymes

Chloroplast: Structure and Functions

• Thylakoid Membranes
o The inner membrane of a
chloroplast is folded into
flattened sacs (thylakoids),
arranged in stacks called
grana.
o Thylakoid membranes contain
little phospholipid & a large
percentage of glycolipids.
o Both fatty acids of these lipids contain several double bonds; this makes thylakoid
membrane lipid bilayers highly fluid.
o The fluidity of the lipid bilayer facilitates lateral diffusion of protein complexes
through the membrane during photosynthesis
• Stroma
o Chloroplasts are self-replicating organelles containing their own DNA.
o Stroma stores small, double stranded circular DNAs encoding tRNAs, rRNAs
o Encoded proteins include many of protein subunits that mediate thylakoid
membrane light reactions & large subunit of CO2-fixing enzyme

Photosynthetic Metabolism

• Photosynthesis is a redox reaction transferring an electron from water to carbon dioxide:

6 CO2 + 12 H2O à C6H12O6 + 6 H2O + 6 O2
• Experiments showed that O2 molecules released from photosynthesis came from two
molecules of H2O, not from CO2.
• Photosynthesis oxidizes water to oxygen; respiration reduces oxygen to form water.
• Respiration removes high energy electrons from reduced organic substrates to form ATP
and NADH.
• Photosynthesis uses low energy electrons to form ATP and NADPH, which are then used
to reduce CO2 to carbohydrate.

Cell and Molecular Biology | BIOL 30095 137

Energetics of Photosynthesis & Aerobic Respiration

• Photosynthesis occurs in two stages:

– Light-dependent reactions (light reactions) in which sunlight is absorbed,
converting it into ATP and NADPH.
– Light-independent reactions (dark reactions) use the energy stored in ATP and
NADPH to produce carbohydrate.

Absorption of Light

• Absorption of photons (light “particles”) by a molecule makes them go from ground state
to excited state.
– Energy in the photon depends on the wavelength of light.
– Energy required to shift electrons varies for different molecules.
– Molecules absorb specific wavelengths of light.
• Photosynthetic Pigments – molecules that absorb light of particular wavelengths.
– Chlorophyll contains a porphyrin ring that absorbs light and a hydrophobic tail
embedding it to the photosynthetic membrane

Classes of chlorophyll among photosynthetic organisms differ in side groups attached to

porphyrin rings; the primary light-absorbing photosynthetic pigments:
A. Chlorophyll a - in all O2-producing photosynthetic organisms; missing from
sulfur bacteria;
B. Chlorophyll b - in all higher plants & green algae
C. Chlorophyll c - in brown algae, diatoms & certain protozoa
D. Bacteriochlorophyll - only in green & purple bacteria that do PS without O2
formation

Absorption spectrum: three Action spectrum: efficiency of light

photosynthetic pigments of higher plants wavelengths to promote photosynthesis

**Absorption spectrum for several photosynthetic pigments of higher plants. The

background shows the colors that we perceive for the wavelengths of the visible spectrum.
Chlorophylls absorb most strongly in the violet, blue, and red regions of the spectrum, while
carotenoids (e.g., -carotene) also absorb into the green region. Red algae and cyanobacteria
contain additional pigments (phycobilins) that absorb in the middle bands of the spectrum.

**Action spectrum for photosynthesis. The action spectrum (represented by the red-colored
line) indicates the relative efficiency with which light of various wavelengths is able to promote
photosynthesis in the leaves of a plant. An action spectrum can be generated by measuring the
O2 produced by the leaves following exposure to various wavelengths. The black lines indicate

Cell and Molecular Biology | BIOL 30095 138

the absorption spectra of each of the major photosynthetic pigments. The green line shows the
combined absorption spectrum of all pigments.

** The structure of chlorophyll a. The molecule consists

of a porphyrin ring (which in turn is constructed of four
smaller pyrrole rings) with a magnesium ion at its center and
a long hydrocarbon tail. The porphyrin indicates the
delocalization of electrons that form a cloud. The structure
of the magnesium-containing porphyrin of chlorophyll can be
compared to the iron-containing porphyrin of a heme.
Chlorophyll b and bacteriochlorophyll a contain specific
substitutions. For example, the —CH3 group on ring II is
replaced by a —CHO group in chlorophyll b. Chlorophyll a
is present in all oxygen-producing photosynthetic
organisms, but it is absent in the various sulfur bacteria. In
addition to chlorophyll a, chlorophyll b is present in all higher
plants and green algae. Others not shown are chlorophyll c,
present in brown algae, diatoms, and certain protozoa, and
chlorophyll d, found in red algae. Bacteriochlorophyll is
found only in green and purple bacteria, organisms that do
not produce O2 during photosynthesis.

Photosynthetic Metabolism

• Photosynthesis is a redox reaction transferring an electron from water to carbon dioxide:

6 CO2 + 12 H2O à C6H12O6 + 6 H2O + 6 O2
• Experiments showed that O2 molecules released from photosynthesis came from two
molecules of H2O, not from CO2.
• Photosynthesis oxidizes water to oxygen; respiration reduces oxygen to form water.
• Respiration removes high energy electrons from reduced organic substrates to form ATP
and NADH.
• Photosynthesis uses low energy electrons to form ATP and NADPH, which are then used
to reduce CO2 to carbohydrate.

Photosynthetic Units & Reaction Centers

• Photosystem Photons
– A multiprotein complex that
catalyzes conversion of light
energy to chemical energy
compounds
– Components: Antenna pigment
complex or Light-harvesting
complex (LHC; accessory Reaction
Center

pigments and chlorophyll

molecules), photochemical
reaction center (pair of
chlorophyll molecules)
Antenna Complexes
• Excited chlorophyll molecule transfers
the energy to neighboring chlorophyll by resonance energy transfer until it reaches the
chloro in the reaction center

Cell and Molecular Biology | BIOL 30095 139

 • Reaction-center chlorophyll transfers electrons to an electron acceptor.

Photosystems

• Photosystem II (PSII)
– Reaction center is P680
(pigment)
– a pair of chlorophyll a that
absorbs strongly at 680nm
– Electron is transferred to the
primary electron acceptor
– Oxidation of water
• Photosystem I (PSI)
– Reaction center is P700
– a pair of chlorophyll a that
absorbs strongly at 700nm
– Photosystem I (PSI) boosts
electrons to a level above
NADP+
• The flow of electrons from H2O to
NADP+ is referred to as the Z scheme.

Ground State Photon Absorption Excited State

Series: Flow of Electrons from PSII to PSI

• The Flow of Electrons from PSII to Plastoquinone

– Harvested energy is passed from LHCII to inner-antenna molecules within PSII.

Cell and Molecular Biology | BIOL 30095 140

 – Excited P680 (P680*) transfers energy to an electron acceptor Pheo (Pheophytin)
generating P680+ and Pheo-.
– P680+ and Pheo- are transferred to opposite sides of the thylakoid membrane
where Pheo- passes an electron to plastiquinone (PQ).
– PQ passes the electron to another PQ forming PQ.-
– The electron is then moved to the stromal side of the membrane.
– 2 protons combine to PQ.- to form PQH2 ( reduced form Plastoquinol)

• The Flow of Electrons from Water to PSII

– The redox potential of P680+ pulls electrons from water (photolysis).
– Formation of O2 requires four electrons from H2O:
2 H2O à 4 H+ + O2 + 4 e–
– Four electrons required to form O2 are transferred in cycles through P680+ to four
Mn ions and one Ca ion that form the oxygen-evolving complex.
– Protons produced in photolysis are retained in the thylakoid lumen.
– Oxygen produced is a released as a waste product into the environment.

• From PSII to PSI

– Production of O2 leads to formation of two molecules of PQH2.
– Reduced PQH2 then diffuses through thylakoid membrane and binds cytochrome
b6f, and releases protons the lumen of thylakoid.
– Electrons from cytochrome b6f are passed to another carrier, plastocyanin.
– Plastocyanin transfers electrons to P700+.

Two electrons are

delivered
2e-

Reaction
Center

Energy from two

photons Antenna Complex

From
PSII Photosystem I
P700

PSI Operations: The Production of NADPH

– The PSI consists of a reaction core center of 12–14 different polypeptides and a
complex of protein-bound pigments called LHCI.
– Photons harvested by antenna pigments in PSI (LHCI) oxidizes chlorophyll a,
forming excited reaction center chloro a (P700*).
– Absorption of light leads to production of P700+ and Ao–.
– Electrons are passed to A1 to Fe-S centers , then to Ferredoxin
– The reduction of NADP+ to NADPH is catalyzed by ferredoxin-NADP+ reductase.
– The electron-deficient reaction center pigment (P700+) is reduced by plastocyanin

Cell and Molecular Biology | BIOL 30095 141

Photophosphorylation

• The machinery for ATP synthesis in

a chloroplast is similar to that of
mitochondrial enzymes.
• The ATP synthase consists of a
head (CF1), and a base (CF0).
• The CF1 heads project outward into
the stroma, keeping with the
orientation of the proton gradient.
• Protons move in the lumen through
the CF0 base of the synthase and
into the stroma thereby driving
phosphorylation of ADP.
• The movement of protons into the
lumen is neutralized by movement
of other ions so no significant
membrane potential build up.
• The proton-motive force is largely
due to a gradient pH

**Summary of the light-dependent

reactions. Three-dimensional structures
of the proteins of the thylakoid membrane
that carry out the light-dependent
reactions of photosynthesis. Of the four
major protein complexes, PSII and
cytochrome b6f are present in the
membrane as dimers, whereas PSI and
the ATP synthase are present as
monomers. The flow of electrons from
H2O to NADPH through the three
transmembrane complexes. This figure
shows the estimated number of protons
translocated through the membrane as
the result of the oxidation of two
molecules of water, yielding two pairs of
electrons. The ATP synthase of the
thylakoid membranes is also shown.
Approximately four protons are required
for the synthesis of each molecule of
ATP. FNR, Ferredoxin NADP+ reductase.

Cell and Molecular Biology | BIOL 30095 142

Cyclic and Noncyclic photophosphorylation

• The movement of electrons during the formation of oxygen is called noncyclic

photophosphorylation because ions move in a linear path.
• Cyclic vs. noncyclic photophosphorylation:
– Cyclic photophosphorylation is carried out by PSI independently of PSII.
– Cyclic photophosphorylation is thought to provide additional ATP required for
carbohydrate synthesis.
• Cyclic photophosphorylation. Absorption of
light by PSI excites an electron, which is
transferred to ferredoxin (step 1) and on to
cytochrome b6f (step 2), plastocyanin (step 3),
and back to P700 (step 4). In the process,
protons are translocated by cytochrome b6f to
form a gradient utilized for ATP synthesis (step
5). Another cyclic pathway for electron
transport that involves movement of electrons
from PSI through NADPH to cytochrome b6f.

Carbon Dioxide Fixation and the Synthesis of Carbohydrate

Converting CO2 into carbohydrate. (A) The

reaction catalyzed by ribulose bisphosphate
carboxylase (Rubisco) in which CO2 is fixed by
linkage to RuBP. The product rapidly splits into two
molecules of 3-phosphoglycerate (PGA). (B) An
abbreviated version of the Calvin cycle showing the
fate of 6 molecules of CO2 that are fixed by
combination with 6 molecules of RuBP. (Numerous
reactions have been deleted). The fixation of CO2
is indicated in step 1. In step 2, the 12 PGA
molecules are phosphorylated via ATP hydrolysis
to form 12 1,3- bisphosphoglycerate (BPG)
molecules, which are reduced in step 3 by
electrons provided by NADPH to form 12 molecules
of glyceraldehyde 3-phosphate (GAP). Here, 2 of
the GAPs are drained away (step 4) to be used in
the synthesis of sucrose in the cytosol, which can be considered the product of the light-
independent reactions. The other 10 molecules are converted into 6 molecules of RuBP (step 5),
which can act as the acceptor for 6 more molecules of CO2. The regeneration of 6 RuBPs requires
the hydrolysis of 6 molecules of ATP. The NADPH and ATP used in the Calvin cycle represent
the two high-energy products of the light-dependent reactions.

Photorespiration – uptake of O2 and release of CO2.

– Rubisco also catalyzes the attachment of O2 to RuBP to produce 2-
phosphoglycolate.
– Glycolate is then transferred to the peroxisome and leads to release of CO2.
– It accounts for the loss of up to 50% of fixed CO2.
– Rate of photorespiration depends on the CO2/O2 ratio.

Cell and Molecular Biology | BIOL 30095 143

 – The reactions of photorespiration. Rubisco can catalyze two different reactions
with RuBP as a substrate. If the RuBP reacts with O2, the reaction produces an
oxygenase intermediate that breaks down into 3-PGA and 2-phosphoglycolate.
The eventual outcome of these reactions is the release of CO2, a molecule that the
cell had previously expended energy to fix. In contrast, if the RuBP molecule reacts
with CO2, the reaction produces a carboxylase intermediate hat breaks down into
two molecules of PGA, which continue through the Calvin cycle.

• Peroxisomes and Photorespiration

– Glycolate produced during photorespiration is shuttled to the peroxisome.
– Peroxisomal enzymes convert glycolate to glyoxylate and then glycine, resulting in
the loss of CO2.

Carbohydrate Synthesis in C3 Plants

– C3 plants are those that produce a three-carbon intermediate (3-
phosphoglycerate, PGA) as the first compound to be identified during carbon
dioxide fixation.
– CO2 is condensed with a five-carbon compound, ribulose 1,5-bisphosphate
(RuBP), to form a six-carbon molecule which then splits into two molecules of PGA.
– The GAP molecules can be exported into the cytosol in exchange for phosphate
ions and used to synthesize sucrose.
– GAP can also remain in the chloroplast where it is converted to starch.
– It is an expensive process.
– Conversion of 6 molecules of CO2 to 1 six-carbon sugar molecules requires 12
molecules of NADPH and 18 molecules of ATP.

Carbohydrate Synthesis in C4 Plants

– The C4 pathway involves the production of phosphoenolpyruvate (PEP), which
then combines with CO2 to produce 4-carbon compounds oxaloacetate or malate.
– Plants utilizing this pathway are C4 plants, usually tropical grasses.
– In a hot, dry environment C4 plants get enough CO2 for photosynthesis while
keeping their stomata partially closed to prevent water loss.
– C4 plants have anatomical adaptations to transport C4 products into the bundle
sheath cells, where fixed CO2 can be split from the 4-carbon carrier producing a
high CO2 level suitable for fixation by Rubisco.

Carbohydrate Synthesis in CAM Plants

– CAM plants carry out light reactions and CO2 fixation at different times of the day
using the enzyme PEP carboxylase.
– CAM (crassulacean acid metabolism) plants keep their stomata closed during the
day to reduce water loss.

Cell and Molecular Biology | BIOL 30095 144

Where in a chloroplast are the following substances or processes localized? Be as specific as
possible.
(a) A high concentration of protons
(b) NADPH+
(c) Starch
(d) Light-harvesting complex II
(e) Rubisco enzyme
(f) Phycobilins
(g) ATP
(h) ATP synthase complex
(i) Phosphoribulokinaseenzyme
(j) Reduction of nitrite (NO –) to ammonia (NH )

For each of the following metabolites, indicate whether you would expect it to be in steady-state
flux across one or more membranes in a photosynthetically active chloroplast, and, if so,
indicate which membrane(s) the metabolite must cross.

(a) CO2
(b) Pi
(c) Electrons
(d) Starch
(e) Glyceraldehyde-3-phosphate
(f) NADPH
(g) ATP
(h) O2
(i) Protons
(j) Pyruvate

Label the process and describe the mechanism

Cell and Molecular Biology | BIOL 30095 145

Module Assessment:
Direction: Choose the BEST answer by encircling the letter

1. Which of the following statements describes the differences of glycolysis and aerobic
respiration?
A. Glycolysis occurs on the cell membrane, while aerobic respiration occurs in
mitochondria.
B. Glycolysis occurs only in photosynthesis, while aerobic respiration is part of cellular
respiration.
C. Glycolysis occurs in the absence of oxygen, while aerobic respiration requires oxygen.
D. There is no difference; these terms are different names for the same process.

2. What will be the end process of Electron Transport Chain?

A. The electrons will go outside the cell
B. The electrons are used in the formation of ethyl alcohol.
C. The electrons combine with oxygen and protons to form water.
D. The electrons build up inside the mitochondria and diffuse back to a thylakoid.

3. Which of the following statements describes BEST about NAD+ Redox reaction of
metabolites?
A. NAD+ can oxidize a metabolite by accepting electrons and can reduce a metabolite by
giving up electrons
B. NAD+ can oxidize a metabolite by giving up electrons and can reduce a metabolite by
accepting electrons
C. NAD+ can oxidize a metabolite by accepting oxygen and can reduce a metabolite by
releasing carbon dioxide
D. NAD+ can oxidize a metabolite by accepting carbon dioxide and can reduce a metabolite
by releasing oxygen

4. Which of these is NOT true of the electron transport chain?

A. The electron transport chain contains cytochrome molecules.
B. The electron transport chain ends when oxygen accepts electrons.
C. The electron transport chain is located on the cristae of the mitochondria.
D. The electron transport chain produces more NADH than any metabolic pathway.

5. Which of the following fermentation methods can occur in animal skeletal muscles?
A. Lactic Acid Fermentation
B. Alcohol Fermentation
C. Mixed Acid Fermentation
D. Propionic Fermentation

6. Which of the following BEST describes wavelength?

A. The photosynthetic pigment in plants
B. The discrete packets of kinetic energy
C. The range of frequencies of radiation
D. The distance between consecutive points of wave

7. How is photosynthesis being similar in C4 and CAM plants?

A. In both cases, only PI is used.
B. In both cases, rubisco is not used to fix carbon initially

Cell and Molecular Biology | BIOL 30095 146

 C. In both cases, thylakoids are not involved in photosynthesis
D. In both cases, both types of plants make sugar without Calvin cycle.

8. If plant gene alterations cause the plants to be deficient in photorespiration, what would
most probably occur?
A. Less ATP would be generated
B. More sugars would be produced
C. Cells would carry on more photosynthesis
D. There would be more light-induced damage to the cells

9. Cyclic electron flow may be photoreactive (protective to light-induced damage). Which of the
following experiments could provide information on this phenomenon?
A. using plants with only photosystem I operative and measure how much damage occurs
at different wavelengths.
B. using bacteria with only cyclic flow and measuring the number and types of
photosynthetic pigments they have in their membranes
C. using plants that can carry out both linear and cyclic electron flow, or only one or another
of three processes, and measuring their light absorbance
D. Using mutated organisms that can grow but that cannot carry out cyclic flow of electrons
and compare their abilities to photosynthesizes in different light intensities

10. Assume a thylakoid is somehow punctured so that the interior of the thylakoid is no longer
separated from the stroma. This damage will have the most direct effect on which of the
following processes?
A. the splitting of water
B. the synthesis of ATP
C. the absorption of light energy by chlorophyll
D. the flow of electrons from photosystem II to photosystem I

11. Which of the following statements best represents the relationships between the light
reactions and the Calvin cycle?
A. The light reactions provide ATP and NADPH to the Calvin cycle, and the cycle returns
+
ADP, P i, and NADP to the light reactions.
B. The light reactions supply the Calvin cycle with CO2 to produce sugars, and the Calvin
cycle supplies the light reactions with sugars to produce ATP.
C. The light reactions provide ATP and NADPH to the carbon fixation step of the Calvin
cycle, and the cycle provides water and electrons to the light reactions.
D. The light reactions provide the Calvin cycle with oxygen for electron flow, and the Calvin
cycle provides the light reactions with water to split.

12. In a protein complex for the light reaction (a reaction center), energy is transferred from
pigment molecule to pigment molecule, to a special chlorophyll-a molecule, and eventually
to the primary electron acceptor. Why does this occur?
A. Each pigment molecule has to be able to act independently to excite electrons.
B. These chlorophyll-a molecules are associated with higher concentrations of ATP.
C. The action spectrum of that molecule is such that it is different from other molecules of
chlorophyll.
D. The molecular environment lets it boost an electron to a higher energy level and also to
transfer the electron to another molecule.

Cell and Molecular Biology | BIOL 30095 147

13. Which of the following statements is the main function of light-dependent reaction?
A. Splitting of water molecule
B. Production of water molecule
C. Conversion of captured energy to chemical energy.
D. Adding of carbon molecule from an inorganic source to organic molecule.

14. Which of the following is the correct sequence of events in cellular respiration?
A. Glycolysis-Fermentation-Krebs cycle
B. Krebs cycle-Electron Transport-Glycolysis
C. Glycolysis-Krebs cycle-Electron Transport
D. Krebs cycle-Glycolysis-Electron Transport

15. Which of the following statements BEST describe wavelength?

A. The photosynthetic pigment in plants

B. The discrete packets of kinetic energy
C. The range of possible frequencies of radiation
D. The distance between consecutive points of wave

Label and Describe the process involved in the image

Cell and Molecular Biology | BIOL 30095 148

JOURNAL CRITQUE: Read the journal paper, “ Effects of Salt Stress on the amount of
Chlorophyll (a and b) and Carotenoid in Leaves of Theobroma cacao L.” then answer the following
questions.

1. Are the study design and methods appropriate for the purposes of the study?
2. Have the procedures been presented in enough detail to enable a reader to duplicate them?
3. Discuss the mechanism of salt in the process of light absorption.
4. Discuss the effects of salt i.e. growth, chlorophyll production, and photosynthesis in plants.

Effects of Salt Stress on the amount of Chlorophyll (a and b) and Carotenoid in Leaves of
Theobroma cacao L.
Raymond Vincent Castillo, Racquel Concepcion, John Paul Domingo, Hilarie Orario, Paolo
Ramon Pacheco, Kenneth Jay Solis
Department of Biology, College of Science, De La Salle University 2401 Taft Ave., Manila,
Philippines

ABSTRACT

Background: Theobroma cacao (Malvacea), an evergreen plant, that is widely distributed across
the tropical regions of West Africa, Southeast Asia, Central, and West America. Moreover, the
cacao's drupe is primarily used to produce chocolate, thus it is regarded as one of the most valued
crops in the world. For this reason, the cacao industry in the Philippines is aiming to increase its
production capability since the climate and location are well-suited for cacao production and trade.
However, there are possible challenges that may arise in cacao farms and affect its production
such as overcrowding, that may lead to rapid spread of diseases and competition of nutrients,
and other environmental challenges. One of the major environmental factors that can affect plant
negatively is salt stress, which can interfere in the absorption of essential nutrients needed for
growth.
Objective: It is the aim of this study to determine the physiological and morphological effects of
salt stress in Theobroma cacao seedlings, by quantifying the chlorophyll (a & b) and carotenoids,
as well as documenting leaf discoloration during the salt stress period. Methods: The seedlings
were exposed to different salt concentrations (0 as control, 70 mM, 140 mM, and 280mM) for 15
days, and then the leaves of the seedling was subjected to DMSO based extraction, following the
protocol of Hiscox & Israelstam (1979). Afterwards, the extracts were immediately quantified using
a UV-Vis Spectrophotometer at specific wavelengths.
Results: Leaves of the seedlings exposed to 70mM, 140 mM, and 280 mM salt concentrations
started to turn yellow at day 13, day 10, and day 8, respectively. Leaf discoloration became more
evident as salt concentration increases. Meanwhile, chlorophyll (a & b) and carotenoid content
were found to decrease per level of exposure with results of statistical analysis showed significant
difference for all pigments per salt concentration. Regression analysis on the other hand revealed
significant association between mean chlorophyll (a & b) content with salt concentration.
However, significant relationship was observed between salt treatment and carotenoid content.
Conclusion: This study in general revealed high sensitivity of T. cacao to salt stress indicated by
leaf discoloration and significant decrease in chlorophyll (a & b). The reduction in carotenoid
content also show inability of the plant to protect itself against salinity stress

Cell and Molecular Biology | BIOL 30095 149

 Module 9

Bioinformatics

I. Objectives

• Familiarize on DNA databases and biocomputing

Overview

Bioinformatics is a recently developed field that

makes use of computational resources to solve
biological problems. It is an interdisciplinary field
that encompasses both computer science,
mathematics, statistics, and molecular biology. Its
main goal is to allow the discovery of new biological
insights -- which were inhibited by the low-
throughput methods by previous biological
research paradigms -- as well as to unify the
disparate biological domains that were previously
separated mainly by methodology and expertise.

Sister Fields of Bioinformatics

Bioinformatics is associated with several fields.

These fields will be discussed in the succeeding
paragraphs.

Computational Evolutionary Biology makes use

of computational algorithms in order to derive
evolutionary inferences from both gene and protein Figure 9.1 Bioinformatics Workflow for High-
sequences, as well as other molecular markers. throughput Experiments
This allows researchers to trace the lineage of a
particular organism in a more robust and quantitative manner compared to older phylogenetic
techniques, and in turn is known to supplant these methods.

Computational Biology is a field that makes use of computational algorithms in order to solve
biological problems. This sister field is primarily focused the computer science aspect of
Bioinformatics, such as creating more efficient algorithms -- I.e. those used in sequence
alignment, and with sequence comparison (I.e. BLAST, Hidden Markov Modelling in HMMER,
among others).

Cell and Molecular Biology | BIOL 30095 150

Systems Biology is a field that tackles Biological problems in a holistic, big-picture approach. It
tries to study organisms as if it were comprised of interacting and interconnected networks of
genes, proteins, and biochemical pathways. As such, it makes use of large amounts of Biological
data in order to map a larger picture, and in turn requires scaled-up computational resources in
order to integrate and form inferences from it.

Biological Databases
Biological databases are repository raw sequence data that were generated from researches.
These sequences include both nucleic acid and protein sequences and data that were generated
from them. Biological databases can be classified as primary and secondary.
Primary databases are also known as archival databases. The hold data derived from
experiments, which includes nucleotide sequences, protein sequences and/or their
macromolecular structure. Examples of primary databases are GenBank, DNA Data Bank of
Japan (DDBJ), European Nucleotide Archive (ENA) which stores nucleotide sequences from all
organisms. For functional genomics data, Array Express Archive and Gene Expression Omnibus
(GEO) are two of the most used databases. Additionally, the Protein Data Bank holds data on
three-dimensional molecular structures of proteins.
On the other hand, secondary databases contain information that were generated from the
analysis of primary data. One example is InterPro which is a database of protein families,
domains, and motifs. Another is UniProt Knowledgebase which stores sequence and functional
information on proteins. Ensembl is a secondary database for function, variation, and regulation
of proteins. 1000 Genomes Project is also secondary database which contains genomes of more
than a thousand anonymous participants from different ethnic groups B.
Databases for signal transduction pathways include Netpath, Reactome, and WikiPathways.
Similarly, there are databases that are dedicated for metabolic pathways and protein function.
This includes BioCyc Database Collection, BRENDA, SABIO-RK, KEGG Pathway, MANET
database, and HMDB. Antimicrobial resistance databases include Antmicrobial Drug Database
(AMDD), ARDB, ARGMiner, BacMet, Beta-Lactamase database (BLAD), The Comprehensive
Antibotic Resistance, etc.
There are also databases that are specialized to a particular research interest. Examples are the
HIV Sequence Database, Flybase (database for Drosophila melanogaster),

Tools and Methods in Bioinformatics

Some commonly used methods in bioinformatics are discussed in the following paragraphs:

Parsing Sequence Data

Before sequence data can be analyzed, it must first be parsed. Sequence data can be encoded
in multiple formats, usually depending on the type of software used. However, the most common
format for both nucleotide and Amino acid sequences is .fasta or .fa. Other formats such as .fastq
include metadata such as sequence quality -- a quantity that shows the level of certainty of the
sequence being described. Other formats also include .vcf, or variant call file, and .gbk -- a format

Cell and Molecular Biology | BIOL 30095 151

used by NCBI that also includes accessory data such as sample source, description, and
information regarding the author.
Gene Prediction

Gene prediction, also known as gene finding, is the

process of identifying regions of gDNA (genomic
DNA) that codes for genes. RNA genes, protein-
coding genes, and other functional elements, such as
regulatory regions, are those that can be determined
via gene prediction. There are a variety of gene
prediction programs that are available for
researchers. Examples of which are GENEID,
AUGUSTUS, and EuGene. GENEID is used to
identify genes, splice sites, exons and other signals
in a DNA sequence. AUGUSTUS is utilized for Figure 9.2 Gene Prediction using ORFs
predicting genes in eukaryotic species. Lastly,
EuGene is an integrative tool for gene finding for both prokaryote and eukaryote genomes.

As can be seen in Figure 9.2, gene prediction can use open reading frames (ORFs). We know
that functional proteins must always begin with a start codon and end with a stop codon. Locating
the start and stop codons will provide us information where in the whole genome these functional
proteins are located. In the figure above, the functional protein is at ORF3. This is because the
ORF3 begins with a start codon, has several amino acids, and ends with a stop codon.

Annotation
Genome annotation is the process of identifying the coding regions and gene locations in a
particular DNA sequence produced by the genome-sequencing projects. The first software for
annotation was developed in the year 1995 at the Institute for Genomic Research for the analysis
of the gene of the bacteria Haemophilus influenza.
Structural annotation of genes involve identification by general morphology, chemical
composition, molecular weight variation, and physical appearance. The information that can be
derived include gene structures, coding regions, open-reading frames (ORFs) and their locations,
and regulatory motifs. Meanwhile, functional annotation provides the physiological and
biochemical functions of the genes that were identified during the process of structural annotation.

Alignment
The goal of sequence alignment is to derive homology from the protein or nucleic acid sequences
that were being compared. Multiple-sequence alignment (MSA) compares three or more
biological sequences with the same lengths. Through the MSA, homology between these
sequences can be inferred and, thus the evolutionary relationships can be studied. Phylogenetic
trees are the main output of MSA. On the other hand, the process of identifying regions of

Cell and Molecular Biology | BIOL 30095 152

similarities (ex. structural, functional, or evolutionary relationship) between two biological
sequences is known as the pairwise alignment. A number of software and online tools are
available that could perform sequence alignments. Among those that are used are Clustal
Omega, MUSCLE, EMBOSS Cons, Kalign, MAFFT, MView, T-Coffee, etc.
One of the most popular tools for alignment
that is being used by scientists is BLAST
(Basic Local Alignment Search Tool.
BLAST is a computer program that was
developed by David Lipman and Stephen
Altschul in the year 1990. Its main function is
to search for homologous sequences using
the GenBank database. BLAST enables
end-users to search web-based portals,
such as the U.S. National Center for
Biotechnology Information (NCBI;
http://blast.ncbi.nlm.nih.gov/Blast.cgi).
There are different types of BLAST searches
that could be performed by the researchers.
These are the following:

1. nucleotide blast (blastn)- used

when the goal is to compare
nucleotide sequences.
2. protein blast – a specific amino
acid sequence is compared to the
protein sequences in the
database.
3. tblastn – comparison of a protein
sequence with nucleotide
sequences by translating the
nucleotides into all 6 possible reading frames.
4. tblastx – a nucleotide query sequence that is translated to all 6 possible reading
Wframes is compared with the nucleotide sequences in the database that are also
translated to all 6 possible reading frames.

Genome - Phenotype Correlation Analysis

Another important method in the field of bioinformatics is the correlation of genetic
variations in the phenotype of an organism. One of the well utilized approach is the Genome-Wide
Association Studies (GWAS). GWAS is significant especially in researches that tackles diseases
in humans. It primarily aims to determine if any genetic variants are associated with a trait and
locate them at a specific loci/locus in the chromosomes. Most of the time, these genetic variants
involve single-nucleotide polymorphisms (SNPs). SNPs are locations within the genome wherein

Cell and Molecular Biology | BIOL 30095 153

the nucleotide present differs between individuals. Similarly, this method can be accomplished
with the use of online tools. This includes easyGWAS, LDassoc, GWASpro, PAST, PheGWAS,
etc.

Rat Genome Database (genomic and

phenotypic data for Rattus norvegicus),
SoyBase (USDA soybean genomics
database) and the Ribosomal Database
Project. Other specialized databases are
The Cancer Genome Atlas, MethBase
DiProDB, Dryad, TRANSFAC, RIKEN
integrated database of mammals,
JASPAR, etc.
Metagenomics of Microorganisms in
Environmental Samples
Bioinformatics has allowed
researchers to directly extract the nucleic
acids present in a particular sampling site
in order to identify the organisms present
within it. In order to do so, researchers
either make use of total genomic DNA
within the sample, or would make use of
PCR to amplify a specific region that is
generally common to all the organisms
present. In the case of the latter, this
usually involves amplifying the 16S rRNA
region for identification and cataloguing of
prokaryotes within the sample. In addition,
certain metabolic enzymes may also be
identified or amplified in order to map the
metabolic pathways present within the
sample.
Total genomic DNA (gDNA) is usually
sequenced via Next Generation
Sequencing. This results with a large
amount of raw nucleotide sequence data
that must be parsed, assembled into long
chains of “scaffolds” and “contigs”, and
afterwards annotated to identify gene
sequences, as well as to classify which
organism it came from. Figure 9.3 Metagenomic analysis flowchart

Cell and Molecular Biology | BIOL 30095 154

With other supplementary data, such as the sample’s nutrient and mineral content and others, an
accurate picture of the sample’s micro-ecosystem can be deduced.
Module Assessment
1.Briefly explain the importance of bioinformatics in understanding genes and their respective
functions.

2.In a family of homologous proteins, how would you best determine the most highly conserved
amino acids?

3.TRUE or FALSE
When creating a phylogenetic tree,
______ A multiple sequence alignment is required.
______ Either nucleotide or protein sequence can be used.

4. How is multiple sequence alignment performed?;

What information can be obtained from these alignments

5. What is the advantage of conducting metagenomic analyses in determining the microorganisms

present in a particular environment in contrast with the traditional method of culturing
microorganisms isolated from such environment?

6. The above figure presents a multiple

sequence alignment of Histone 1 of
human, mouse, rat, cow, and chimps.
Answer the following questions below:
a.) What is meant by
conservative and non-
conservative amino acids
and discuss their
significance in studying
relationships between species
b.) Interpret the information given by the figure above with respect to the relatedness of
the organisms based on their Histone H1 sequences (residues 120-180)

Cell and Molecular Biology | BIOL 30095 155

Cell and Molecular Biology Laboratory Manual
 Cell and Molecular Biology
BIOL 30095
Laboratory Manual

Overview

This course is a 3-hour lecture, 6-hour laboratory once-a-week meeting that will discuss
understanding of cellular structures and function in molecular level. This course is concerned with
the chemistry of the living cell and its progression from molecules to multicellular organisms;
evolution of the cell; principles of major experimental methods for investigating cells; transmission
of genetic information and the internal organization of the cell.

On completion of this course, the student is expected to present the following learning outcomes:

• Explain the concept, scope and importance of cell biology

• Compare the cell’s morphology in both prokaryotic and eukaryotic organisms
• Trace the genetic lineage or phylogenetic history of the organisms
• Describe briefly the different cellular components (structure, function, molecular diversity)
• Determine the factors that can affect cellular components, metabolic activities, and
molecular behavior
• Familiarize some common methods and techniques in molecular biology

In this module, topics are organized in a weekly time frame that includes overviews, readings,
lectures, discussions, and other relevant activities. At the end of each module, the student will
answer the assessment to check the understanding of the student.

PREPARED BY:
Jordan M. Abellar
Kiara Nicole D. Rodriguez
Kenneth Jay Solis
Jhunel G. Vinarao

Cell and Molecular Biology Laboratory Manual

 Laboratory Activity Sheet
Name:
Student:
Section:
Instructor:

Laboratory Activity Scores

I. Microscopy and the Cell

II. Biological Shapes

III. Biological Molecules and Propeties

IV. Cellular Membrane and its Components

V. Bioenergetics

VI. DNA Extraction

VII. DNA Profiling and Quantification

VIII. Polymerase Chain Reaction

IX. Protein Synthesis and Words

X. Bioinformatics

Total Score

Cell and Molecular Biology Laboratory Manual

158
 Laboratory Activity 1: Microscopy and the Cell

The development of microscopes from a simple magnifying lens to a compound light

microscope and then to the sophisticated electron microscope is important for
biologists/scientists. Microscopes aid in magnifying cells and its components, as well as
organisms which are minute in nature, so they can be studied carefully (Buckley, 2015).

The compound light microscope is an instrument containing two (2) lenses to increase the
magnification of objects and variety of knobs to resolve (focus) of the pictures. The objects must
be thin, to enable passing of light through them, and mounted on a surface, such as glass. The
lens system is formed by the ocular lenses (eyepieces) and the objective lenses. It uses more
than one lenses (binocular), meaning they have two ocular lenses that you look through. Binocular
microscopes are parfocal, meaning when magnification of one objective lens is in focus, then the
other objectives will also be in focus at the new setting (Cajigal, P. and Valenton C, 2012).

OBJECTIVES
At the end of the activity, you should be able to:

• Identify the parts and functions, correctly of the compound light microscope.
• Demonstrate the proper procedure of handling and focusing under different objectives
using the compound light microscope.
• Determine the total magnification of the microscope

Parts of the Microscope

• Power switch - turns the lamp on and off

• Illumination control
A. controls the brightness of the lamp
B. on most microscopes, it is a continuously variable rheostat controlled by a sliding
switch
• Illuminator
A. consists of a lamp bulb and one or more lenses to produce a cylindrical beam of light
directed towards the base of the condenser
B. may have a ground glass - a frosted sheet of glass that scatters the light from the lamp
bulb to provide more diffuse light
C. may have an iris diaphragm, called the field diaphragm
a. controls the diameter of the illuminating beam of light
b. used as a guide to focus the light from the condenser onto the specimen
• Condenser - contains a set of lenses that focus the light on the specimen. The condenser
has the following components:
A. focusing knob - moves the condenser up and down to adjust the focus of the light on
the specimen
B. front lens - the glass surface closest to the specimen. Be careful not to touch this
surface as it is easily scratched
C. iris diaphragm - controls the aperture of the illuminating light and used to adjust
contrast
• Revolving nosepiece - holds several objective lenses that can be rotated into position to
change the lens
• Objective lenses - create a magnified image of the specimen

Cell and Molecular Biology Laboratory Manual

159
 A. Scanning lens - used to get an overview of the structures present in a section and to
find areas for more detailed observation
B. LPO 10x lens - the most useful magnification to identify tissues
C. HPO 40x lens - used to see the details of a cell and tissue organization
D. OIO 100x lens - requires the use of immersion oil. It is used primarily to view
subcellular details and microorganisms such as bacteria.

• Eyepiece - forms an image that can be visualized by the eye or a camera. In a binocular
microscope, the distance between the two tubes can be adjusted to fit the distance
between the observers’ eyes.
• Focusing controls - used to raise and lower the specimen stage to focus the
image of the specimen
A. coarse focus - used to focus the specimen at 4x and 10x
B. fine focus - used to focus the specimen at 40x and 100x, but only after initially
focusing at lower magnification
• Specimen stage - holds the microscope slide
A. slide holder - spring-loaded device to hold the microscope slide in place on the stage
B. slide holder travel controls - allow the slide to be moved along two axes: longitudinal
and lateral

Magnification is the process of enlarging a particular specimen (what you see

looking through the eyepiece). The total magnification for the microscope is obtained by
multiplying the magnification of the eyepiece and the magnification of the objective lens
that is being used. The eyepiece on the microscope is 10x and the three objective lenses
are 4x, 10x and 20x.

What is the total magnification using each of the objective lenses?

4x=________ 10x=_________ 20x=_________

Identify each of the parts of the microscope and describe their functions.

Cell and Molecular Biology Laboratory Manual

160
 Parts Functions

10

11

12

13

Observation: Compare the onion cells from the cheek cells. Fill in the table below with the
information indicated

Cell and Molecular Biology Laboratory Manual

161
Differences Cheek Cells Onion Cell

Write the differences you

observed between the cheek
cells and the onion cell in the
designated box provided

Similarities Cheek Cells Onion Cell

Write the similarities you

observed between the cheek
cells and the onion cell in the
designated box provided

Sketch of Cells Cheek Cells Onion Cell

Do your sketches of the two

types of cells in the designated
box provided

Identify the parts and functions in your onion cell and cheek cell.

Cell and Molecular Biology Laboratory Manual

162
Write your answer on the space provided for the following questions.

How does the shape of the onion cells differ from that of the cheek cells?
____________

A cell’s shape often correlates with its function. How do you explain the shape of the onion cells
versus your cheek cells?

__________________________
___________________
_____________

What structures were you able to see in both types of cells?

_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

Both plants cells and animal cells contain mitochondrion and yet they were not visible in the cells
viewed in this activity. Does this mean that these organelles are not found in cheek and onion
cells? Why or why not? Explain.
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Why did you add iodine to the onion cells before looking at them through the microscope? Why
did you add methylene blue to the cheek cells before looking at them through the microscope?
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

Describe the appearance and the function of a cell’s cytoplasm.

_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

Cell and Molecular Biology Laboratory Manual

163
 Laboratory Activity 2: Biological Shapes

Almost all living organisms contain four macromolecular organic compounds. Two of
which are lipids and proteins. Lipids are made up of one molecule of glycerol and three molecules
of fatty acids, resulting in a triglyceride. Fatty acids are what make lipids non-polar and unable to
dissolve in water. Proteins are inherently important to any living organism. They control cell
process, provide support, and transport substances within a cell. Enzymes and hormones are two
examples of proteins. Proteins are made up of polymers of amino acids whose functional groups
are a carboxyl group and a free amino group. Both lipids and proteins are crucial for various
cellular functions.

OBJECTIVES
At the end of the activity, you should be able to:

• Construct three-dimensional models of molecules.

• Identify simple chemical compounds such as water, ethyl alcohol, and oil.

You probably have seen images of molecules printed on a 2- dimensional page. In such
cases, molecules appear to be 2-dimensional structures when in fact they actually have 3-
dimensional shapes that are quite complex. Each atom that makes up a molecule has a
characteristic size and can form only a limited number of bonds. For a given atom, bonds are
formed in a precise geometry.

Carbon, oxygen, and hydrogen are three atoms that are commonly found in biological
molecules. Carbon forms four bonds to other atoms in the following arrangement (note that the
dark lines represent the bonds while the dashed triangle is to help you in visualizing the bond
angles)

Hydrogen only forms a bond with a single atom.

Oxygen can form two bonds at the angle shown below:

Cell and Molecular Biology Laboratory Manual

164
MATERIALS:

• Gumdrops (or any circular candies/soft candy) (12 gumdrops of one single color, 4 of a
different color, and 3 of yet another different color)
• Scissors
• toothpicks
• Colored Pencils

PROCEDURE:

• Start by cutting about a dozen toothpicks in half. Sort your gumdrops by color. To
complete this activity, you will need 4 of one color (O, oxygen), 12 of a different color (H,
hydrogen), and 3 of another color (C, carbon). Record the colors that you have chosen to
use in the table that follows:

Atom Color

O
H
C

• Using the structural formulas that follow and the accurate bond angles illustrated in the
introduction, construct a model for water, methyl alcohol, and ethyl alcohol using
toothpicks and gumdrops. Remember you need to think in 3 dimensions!

Using colored pencils, sketch the structure of each of your gumdrop models in the space below.
Be sure to indicate which color corresponds to which atom.

Water Methyl Alcohol Ethyl Alcohol

Cell and Molecular Biology Laboratory Manual

165
Now write the structural formula for each of these three compounds in the table below.

Water Methyl Alcohol Ethyl Alcohol

How many dimensions are visible in the structural formula? __________________

How many dimensions are visible in your gumdrop models?__________________

Using gumdrops, make a model of oil shown

below. Take a photo of your model and paste it
in the given space.

Cell and Molecular Biology Laboratory Manual

166
 Laboratory Activity 3: Biological Molecules and its Properties

Biomolecules comprise all living things. These biomolecules are made up of four classes
which includes carbohydrates, proteins, lipids, and nucleic acids which perform a wide array of
functions in the cell.

Carbohydrates are represented by the formula (CH2O)n, wherein n is the number of carbon
atoms in the molecule. Therefore, the ratio of carbon to hydrogen to oxygen is 1:2:1.
Carbohydrates are classified into 3 types: monosaccharides, disaccharides, and polysaccharides.
The simplest sugars are the monosaccharides, wherein the number of carbon atoms ranges from
3 to 6. The names of monosaccharides end with the suffix -ose. Monosaccharides can be trioses
(3 carbon atoms), pentoses (5 carbon atoms), and hexoses (6 carbon atoms). Glucose, fructose,
and galactose are example of monosaccharides and they are all hexoses. Meanwhile,
disaccharides are formed when 2 monosaccharides undergo a dehydration reaction, resulting to
the formation of a covalent bond between atoms in the 2 sugar molecules. Examples of
disaccharides include maltose, lactose, and sucrose. The monomers of lactose are glucose and
galactose while maltose is made up of 2 glucose molecules. Sucrose is composed of molecules
of fructose and glucose. Lastly, polysaccharides are long chain of monosaccharides that are
linked together by covalent bonds. They can be either branched or unbranched. Examples of
polysaccharides include starch, cellulose, chitin, and glycogen.

Lipids are made up of one molecule of glycerol and three molecules of fatty acids. Because
of this, lipids are nonpolar molecules and therefore they are hydrophobic (“water-fearing”) in
nature. Lipids are vital for a variety of cellular functions. Cells primarily store energy in the form of
lipids known as fats. Oils, fats, phospholipids, waxes, and steroids are all examples of lipids.

Proteins are one of the most abundant molecules that make up living organisms. Thus,
they have the most diverse cellular functions. Depending on the type of protein, they can be
structural, contractile, regulatory, or protective. In addition, they may be also be involve in storage,
transport. Proteins are polymers of amino acids linked by peptide bonds.

Nucleic acids are regarded as the genetic blueprint of the cell as they carry the instructions
for the functioning of the cell. There are 2 main types of nucleic acids – the deoxyribonucleic acid
(DNA) and the ribonucleic acid (RNA). DNA is the genetic material of all living organisms while
RNA is involved in the process of protein synthesis. Both DNA and RNA are made up of
nucleotides. Each nucleotide is consists of a nitrogenous base, a pentose sugar, and a phosphate
group.

OBJECTIVES: At the end of the activity, you should be able to:

• Demonstrate mastery of the scientific method by asking a question, making observations,

developing a hypothesis, testing the hypothesis, and drawing conclusions.
• Identify “water-loving” and “water-fearing” molecules based on structural formulas.

MATERIALS:
• Cups/glass (anything where you can put your liquids) ~ similar sizes
• Labeling pen
• Alcohol (ethyl – 70%)
• Cooking Oil
• Water

Cell and Molecular Biology Laboratory Manual

167
 • Vinegar
• Dishwashing detergent
• Fabric Conditioner

PROCEDURES:

• Filled a cup about one quarter full with alcohol and then added 10 drops of oil. After gently
swirling, observe. In the space below, describe the initial appearance of the oil droplets
(include observations on the number of drops and the sizes of the individual drops).

• From your first cup, add only five drops of liquid dishwashing. In the space below, describe
the initial appearance of the oil droplets (include observations on the number of drops and
the sizes of the individual drops).

Cell and Molecular Biology Laboratory Manual

168
 • Prepare 6 cups, label each cups from A-F. Pour the appropriate solution into the cups until
it is about 1/4 full (shown in the table). Pour the second solution until the cup is about half
full. Determine whether the solutions mix giving one uniform solution or separate into
layers. Record your observation(s) in column 3 of the table below. Use “+” (plus) to
represent mixable and “-“ (minus) to represent nonmixable.

Cup Solutions Tested Mixable(+ / -)

A – Alcohol + Vinegar
B – Cooking Oil +water
C – Water +Alcohol
D – Vinegar +Dishwashing Detergent
E – Dishwashing Detergent + Fabric Conditioner
F – Fabric Conditioner +Oil

Write your answer on the space provided for the following questions.

How does a detergent affect the solubility of oil in alcohol (or water)?
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
In which case is more oil surface area in contact with alcohol? In which case is the
interaction between alcohol molecules more disrupted?
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Explain why two layers are formed when a “water-fearing” solution is added to a “water-loving”
solution.
_____________________________________________________________________________________
_____________________________________________________________________________________
____________________________________________________________________________________
Dry cleaners use “water-fearing” solvents rather than water to clean soiled
clothes. The structure of trichloromethane, a typical dry cleaning solvent, is
shown. Explain why dry cleaning is an effective way to remove greasy stains.

Cell and Molecular Biology Laboratory Manual

169
 Laboratory Activity 4: Cellular Membrane and Its Components

Concentration gradient is a regular concentration change over a distance in a particular

direction. Diffusion is the net movement down the concentration gradient. Diffusion is caused by
the following natural occurrences: thermal motion (movement caused by the loss of heat), random
molecular movement, and an increase in entropy of the system. In a solution of many different
substances, each will diffuse down its own concentration gradient independently. Diffusion is a
passive type of transport; it requires no additional energy to make it work. Osmosis is movement
of water molecules from down the concentration gradient across a biological membrane. A
solution is a mixture of a solute (substance being dissolved) and a solvent (substance used to
dissolve a solute). Water is regarded as the universal solvent.

Types of Aqueous Solutions:

1. Hypertonic: solution with the greater concentration of solute than inside the cell.
2. Hypotonic: solution with a lesser concentration of solute than inside the cell.
3. Isotonic: solution with equal solute concentration with that of inside the cell.

Water balance in a living cell:

1. Cells placed in a hypertonic environment (salt water) animal cells crenate (shrink). Plant
cells plasmolyze (shrink).
2. Cells placed in hypotonic environment (fresh water) animal cells lyse (burst) and plant cell
become turgid (firm).
3. Cells placed in isotonic solution animal cells are normal, plant cells are flaccid (limp).

OBJECTIVES
At the end of the activity, you should be able to:

• To explain the vital functions of the cell membrane;

• To know and explain different membrane transports;
• And to distinguish between different types of solutions.

MATERIALS

• 10% Sugar Solution (10g Sugar over 100mL ~ dissolve)

• 10% NaCl Solution (10g Salt over 100mL ~ dissolve)
• Tap water/ Distilled Water (100 mL)
• Vinegar
• Eggs (6, raw)
• Glass cups (similar sizes ~ 6)

Cell and Molecular Biology Laboratory Manual

170
PROCEDURE

• Prepare 2 glasses, add 50 mL of sugar solution in each glass, then put the egg with and
without the shell. Observe for 24 hours.
• Prepare 2 glasses, add 50 mL of salt solution in each glass, then put the egg with and
without the shell. Observe for 24 hours.
• Prepare a glass, Add 50 mL of vinegar, then put the egg with the shell. Observe for 24
hours.
• Prepare a glass, add 50 mL of water, then put the egg without the shell. Observe for 24
hours.

OBSERVATION:

Took a photo of your set-up, the paste in the given space.

Cell and Molecular Biology Laboratory Manual

171
Draw the egg after observation for 24 hours.

Cell and Molecular Biology Laboratory Manual

172
Write your answer on the space provided for the following questions.

What is the significant role of the shell to the egg?

_____________

What will happen in the solvent molecule in the cells if it is suspended in sugar solution? Explain.

What will happen in the solvent molecule in the cell is suspended in salt solution? Explain.

In what direction will water move through the cell membrane when the cell is immersed in distilled
water? Explain.

What will happen to the egg if its suspended in a vinegar solution? What about its shell?

Bacteria cause food to spoil and meat to rot. Explain why salted pork, strawberry preserves, and
sweet pickles do not spoil even though they are exposed to bacteria.

Cell and Molecular Biology Laboratory Manual

173
 Laboratory Activity 5: Bioenergetics

Cellular respiration is the process by which the chemical energy of "food" molecules is
released and partially captured in the form of ATP. Carbohydrates, fats, and proteins can all be
used as fuels in cellular respiration, but glucose is most commonly used as an example to
examine the reactions and pathways involved.

In glycolysis, the 6-carbon sugar, glucose, is broken down into two molecules of a 3-
carbon molecule called pyruvate. This change is accompanied by a net gain of 2 ATP molecules
and 2 NADH molecules.

The Krebs, also known as the Citric Acid cycle occurs in the mitochondria matrix of
eukaryotes and generates a pool of chemical energy (ATP, NADH, and FADH2 ) from the oxidation
of pyruvate, the end product of glycolysis. Pyruvate is transported into the mitochondria and loses
carbon dioxide to form acetyl-CoA, a 2-carbon molecule. When acetyl-CoA is oxidized to carbon
dioxide in the Krebs cycle, chemical energy is released and captured in the form of NADH, FADH2,
and ATP.

The electron transport chain allows the release of the large amount of chemical energy
stored in reduced NAD + (NADH) and reduced FAD (FADH2). The energy released is captured in
the form of ATP (3 ATP per NADH and 2 ATP per FADH2). The electron transport chain (ETC)
consists of a series of molecules, mostly proteins, embedded in the inner mitochondrial
membrane.

The glucose required for cellular respiration is produced by plants. Plants go through a
process known as photosynthesis. Photosynthesis can be thought of as the opposite process of
cellular respiration. Through two processes known as the light reactions and the dark reactions,
plants have the ability to absorb and utilize the energy in sunlight. This energy is then converted
along with water and carbon dioxide from the atmosphere into glucose and oxygen. Since this is
the opposite process of cellular respiration, plants and animals are said to have a symbiotic
relationship. This means that plants and animals live together and benefit from each other. When
humans and animals breath, they take in oxygen and give off carbon dioxide. This carbon dioxide
is taken up by plants and oxygen is given off through photosynthesis. There is an equilibrium of
oxygen and carbon dioxide created between animals and plants. Without one, the other would
not survive for long.

OBJECTIVES

At the end of the activity, you should be able to:

• Explain the process of cellular respiration

• Discuss the importance of glucose in cellular respiration
• Differentiate the effects of glucose level in cell

MATERIALS

• Sugar Solution (1%, 5%, 10%, 25%, 50%)

• Yeast solution (Make a yeast solution using 1/2 cup warm water, 1 teaspoon sugar and
1/4 ounce package of Active Dry Yeast)

Cell and Molecular Biology Laboratory Manual

174
 • Glass (similar sizes ~ 5)
• Glass Tube (similar sizes ~ 5)
• Dropper

PROCEDURE

• Prepare the sugar solution, dissolve sugar (1g, 5g, 10g, 25g, and 50g) to water (100mL).
• Prepare a yeast solution using 1/2 cup warm water, 1 teaspoon sugar and 1/4 ounce
package of Active Dry Yeast)
• Add one mL of yeast solution to each glucose solution in a tube. (~20 drops)
• Flip the solution (glucose +yeast) tube into the glass with remainder glucose solution.
• Observe for 24 hours.

OBSERVATION:

Took a photo of your set-up, the paste in the given space.

Describe your observation:

Cell and Molecular Biology Laboratory Manual

175
Write your answer on the space provided for the following questions.

What is the role of sugar solution in the experiment? Is there a difference if the amount of sugar
solution put varies?

What may account for the difference between the heights of the liquids in the tubes?

What is the requirement for cellular respiration?

What is the role of glucose in cellular respiration?

Is there a correlation or relationship between the amount of sugar available and the amount of
carbon dioxide produced?

Can any type of sugar be used as a fuel for cellular respiration?

Cell and Molecular Biology Laboratory Manual

176
 Laboratory Activity 6: DNA Extraction

DNA Extraction is a routine procedure in genetics and molecular biology. The

development of the methods for DNA extraction involves a thorough understanding of the
biochemical nature of the cell to achieve successful homogenization of tissue, lysis of the cell,
and intact acquisition of the DNA. In animals, the histological nature of the sample to be used
limits the types of extraction method to be used but all extraction types follow the same principle.

Tissue homogenization may be done mechanically or chemically. Mechanical

homogenization uses physical force to destroy cellular structure, and may be done in tandem with
freezing to optimize results. Chemical homogenization, on the other hand, makes use of enzymes
that degrade protein. For both techniques, the tissue is placed in an artificial environment that
would ensure the stability of the nucleotide structures, even when it is released from the nuclear
membrane. Further cellular lysis is encouraged through the emulsification of the cell membrane.
Detergents are the typical components of lysis buffers to ensure that lipid-based membranes are
completely dissolved to release their contents for extraction.

Once the DNA has been freed from the cellular structure, it must be isolated in a relatively
pure form. This requires the separation of other biomolecular contaminants, such as proteins and
lipids, from the nucleotide components. Most methods take advantage of the nucleotide’s ability
to stay soluble in an aqueous environment. Proteins are separated by mixing tissue slurries with
solutions containing a mixture of organic and aqueous solvents. With proper mixing, proteins and
contaminants will mix with the organic solvent, while nucleotides will be isolated in the aqueous
solvent. Separation is done through centrifugation. Precipitation of the DNA is finally done through
the addition of ethanol.

Pure DNA is a prerequisite to a lot of molecular biology studies – from amplification of

molecular markers, to genomic sequencing, to genetic transformation. This requires a certain
amount of effort and time, but alternative methods are available with differing strengths and
weaknesses.

OBJECTIVES

At the end of the activity, you should be able to:

• Isolate DNA from cheek cells and a fruit

• Determine the significance of the reagents used in the DNA isolation procedure
• Understand the importance of each of the steps in DNA isolation

MATERIALS

• 90% Isopropyl Alcohol (cold)

• Dishwashing Liquid
• Food Coloring (optional)
• Smash Banana (or salt solution)
• 3 clear plastic cups/glass

Cell and Molecular Biology Laboratory Manual

177
Procedure:

Extraction Process

Cheek Cell Extraction

1. Create a salt solution (10g of salt over 100mL). Vigorously gargle salt water for a minute. Spit
salt water back into the same cup
2. Add 1ml of clear dishwashing soap to the salt water you just spit out
3. In a separate cup, pour 100 ml (cold) isopropyl alcohol. Then, add 3 drops of food coloring,
mix them well
4. Tilt the salt water cup and carefully pour alcohol such a way that it makes a layer on top of the
salt water. Observe.

For Fruit Extraction:

1. For 100 mL of the extraction solution, mix 1 ml of detergent (you can also use shampoo or
soap) and 1.5 g of table salt (iodized or non-iodized both will work). Add water to make a final
volume of 100 ml. Dissolve the salt by stirring slowly to avoid foaming. Measure 20 ml of
solution for each extraction
2. Smash some pieces of fruit and put them in a plastic bag (be careful not to break the bag).
Make the fruit look like a liquid.
3. Place 20mL of extraction solution in the plastic bag. (1 mL ~ 20 drops)
4. Filter the mixture using filter paper or cloth
5. Pour 2-3 mL of mixture in the glass/cup. Then, pour 5 mL of cold alcohol in the glass. Observe.

OBSERVATION:

Took a photo of your set-up, the paste in the given space.

Cell and Molecular Biology Laboratory Manual

178
Took a photo of your extraction, then paste in the given space.

Cell and Molecular Biology Laboratory Manual

179
Give the following role/significance of each materials/procedure in DNA Extraction.

Material/Procedure Role/Significance in Extraction

Salt solution

Cold Isopropyl Alcohol

Food Coloring

Smash Fruit/s

Write your answer on the space provided for the following questions.

What is the purpose of (a) cold ethyl alcohol (b) detergent (c) salt solution

What are the characteristics of a high quality DNA Extract?

How do you do determine the quality of your DNA Extracts?

Cell and Molecular Biology Laboratory Manual

180
Hereditary information is contained in genes. Genes are composed of DNA that makes up the
chromosomes of cells. Put the following words in order from largest to smallest: Genes,
Chromosomes, DNA, Cell __________________________________________________

If a DNA molecule were composed of 10% guanine, what percent of the molecule would be made
up of cytosine?

If a DNA molecule were composed of 30% adenine, what percentage of the molecule would be
thymine, cytosine, and guanine?

Cell and Molecular Biology Laboratory Manual

181
 Laboratory Activity 7: DNA Profiling and Quantification

Deoxyribonucleic acid (DNA) is the master molecule that programs all living processes. DNA
molecules are composed nucleotides. Both DNA and RNA are made up of nucleotides. Each
nucleotide is consist of a nitrogenous base, a pentose sugar, and a phosphate group.

OBJECTIVES
At the end of the activity, you should be able to:
• Explain DNA profiling
• Discuss the Mechanism of Gel Electrophoresis
• Importance of Electrophoresis

In living cells, DNA molecules are surrounded by proteins and organized into chromosomes.
Each chromosome contains one very long and thin molecule of DNA. It is possible to isolate
chromosomal DNA from most organisms. This long molecule can be “cut” (digested) into small
pieces by incubating it in the presence of restriction enzymes. Restriction enzymes are used in
the laboratory to cut DNA molecules at specific sequences and generate fragments of various
sizes. Agarose gel electrophoresis is used to determine the size of these DNA fragments. An
agarose gel is like a complex maze with very tiny channels. DNA has a negative charge and will
move toward the positive pole in an electrical field. Short pieces of DNA navigate more easily
through the maze and therefore move a greater distance. An indicator dye is added to the DNA
digest prior to injecting it into the gel so that the researcher can tell when the small fragments
have run the length of the gel. Otherwise, the
DNA would either be run off the positive end of
the gel or would not move far enough into the gel.
The DNA itself will not be visible until a stain is
added. Some stains are visible under normal
light, while others fluoresce under UV light.

If you determined the nucleotide sequence of

each of your chromosomes (an enormous task)
and compared it to one of your classmates, much
of it would be the same. There are, however,
regions that are highly variable (e.g., variable
number tandem repeats, VNTRs). Because the
DNA in these regions can vary from one
individual to another, it can be used as a form of
identification similar to a fingerprint. This type of
evidence has become commonplace in
courtrooms in cases involving paternity, rape,
murder, etc.

VNTRs are formed through an error in DNA

replication (see figure). DNA is copied by an

Cell and Molecular Biology Laboratory Manual

182
enzyme called DNA polymerase. DNA polymerase reads one strand of DNA and fills in the
corresponding nucleotide sequence to make a second strand (2 & 3). In a small number of cases,
the newly synthesized DNA strand can slip (4). When this happens with a non-repetitive DNA
sequence, there is only one way that the two strands can “zip” back together. In the case of
VNTRs, though, there are many ways that the repeated sequence can come together. One of
the strands of DNA can loop out, which will result in chromosomes with two differently sized
VNTRs after the next round of DNA replication (5 & 6).

One of the tools that molecular biologists rely on is the use of restriction enzymes. Restriction
enzymes are proteins isolated from bacteria. They protect the bacteria from attacks from bacterial
viruses by cutting the viral DNA. Molecular biologists use restriction enzymes because they
recognize unique DNA nucleotide sequences and cut the DNA at that site. The sequences
recognized by restriction enzymes are known as restriction sites.
Restriction sites usually range from four to eight basepairs in length and are usually palindromic
sequences. Palindromic sequences are sequences that are the same on both strands of the
DNA, though in the opposite order.

Most DNA molecules found in nature are

much too large to be analyzed without breaking
them down into smaller pieces. Restriction
enzymes are used to cut DNA into manageable
pieces. Since restriction enzymes cut DNA at
specific sequences, they will cut DNA
molecules with the same sequence at the same
sites, which will result in DNA fragments of the
same size. On the other hand, if there is a
different amount of DNA sequence between the
restriction sites, the resulting DNA pieces will
be of different length. For example, look at the
figure on the next page. If restriction enzymes
were used to cut at the sites marked by “X”,
they would cut out a smaller piece of DNA from
the top DNA strand than they would from the
lower DNA strand. Sites where cutting with
restriction enzymes would result in different
lengths of DNA between different members of
a population, such as at VNTRs, are called
restriction fragment length polymorphisms
(RFLPs).

DNA quantification is done to determine average concentrations of extracts or mixtures. It

also helps determine purity. This is a typical prerequisite to procedures or reactions that require
specific amounts of nucleic acids to work, and those that need a certain level of purity to achieve
optimal performance. There are several methods to determine concentrations of solutions
containing nucleic acids. These methods include spectrophotometry and UV fluorescence.
In spectrophotometric techniques, it takes advantage of the natural absorbance of nucleotides of
light with a wavelength of 260 nm. Determination of concentration is derived through the Beer-
Lambert Law that states that a higher concentration of a substance will result in higher
absorbance. Purity through spectrophotometric techniques, on the other hand, requires

Cell and Molecular Biology Laboratory Manual

183
contrasting the absorbance of nucleotides to that of proteins. This means measuring the
absorbance of the solution with light at a wavelength of 280 nm, to check for protein contaminants.
Nucleotides can be made to fluoresce by exposing them to fluorescent substances that
intercalate with nucleotides. Examples of these substances are ethidium bromide, Gel Red©, and
SYBR© dyes. The amount of fluorescence can indicate quantity, but other applications can also
be done to use such a visualization technique to also determine size.

Theoretical Procedure:

Determining nucleotide concentration and purity

Nucleotides optimally absorb light at a wavelength of 260 nm, so to determine the

concentration of a nucleotide solution, it must be run at a spectrophotometer under these
conditions. Of course, for procedures like this, the whole sample cannot be processed in the
machine. It’s either the volume of the extract is not enough, or it will be too wasteful to use your
extract. So to proceed with spectrophotometry, dilution must be done. This means that the
absorbance you will get from the experiment is not the actual absorbance of your extract. So to
st
determine the concentration of your extract, you must 1 compute for the dilution factor.

• Preparing dilutions and computing for the dilution factor

Transfer 50 uL of your DNA extract to a fresh tube. Add ddH2O to make final volume 500 uL.
Compute for dilution factor using the formula: Dilution factor (DF) = Total final volume/ Aliquot
volume. Record dilution factor in worksheet and notebook.

• Determining nucleotide concentration

Transfer the prepared dilution into the cuvettes. WARNING: Do not touch the smooth side of
the cuvette. Record the absorbance at 260 nm. Compute for the concentration of the dilution
using the ratio: 1 OD260: 50 ug/mL DNA. Compute for the concentration of your extract using the
formula:

Concentration of extract (C ) = Concentration of dilution (C ) * DF E D

• Determining the purity of your extracts

Using the same dilution in the same cuvettes, record the absorbance at 280 nm. Account for the
dilution of your samples by using the formula:

• OD of extract = OD of dilution * DF

Compute for the purity coefficient using formula: Purity = OD260/ OD280 . A value of 1.8-2.0 is
high purity, while a value of less than 1.73 is highly contaminated.

Cell and Molecular Biology Laboratory Manual

184
Agarose Gel Electrophoresis

Agarose Gel Electrophoresis is a standard procedure done after DNA extraction. It is a

quantitative method to determine if you have nucleotide products and can also be used to
determine the sizes of your DNA fragments. This is done by allowing the migration of nucleotides
across a matrix (the agarose gel) by running an electric current through it. DNA, being negatively
charged, will migrate towards the positive end of the current. The matrix will retard the movement
of the DNA fragments, causing the smaller fragments to move faster, and the bigger fragments to
move slower. The sizes of the resultant nucleotides bands are approximated by loading a DNA
ladder. This is a solution containing DNA fragments with known sizes.

• Preparation of the gel

Weigh out the needed agarose for a 0.7% w/v agarose gel. Total volume: 50 mL. In an Erlenmeyer
flask, add 50 mL of 0.5X TBE Buffer. Swirl to mix. Add 0.5 uL Gel Red Dye to the solution. Swirl
to mix. Heat in microwave until the solution boils. Pour into casting tray, then put in the comb. Let
the gel polymerize at room temperature.

• Loading and running of samples

In a strip of parafilm, place 3 uL of loading dye. Then, add 7 uL of the DNA extract. Pipette in and
out to mix. Load the solution into the well. Make sure to load the DNA ladder in the 1st well
(preferably) and the negative control in the last well (preferably). Set the electrophoresis machine
at 100 V for a run time of 30 minutes. Turn the machine on and wait. View the gel under UV light
after run time.

• Viewing the Gel

Wearing gloves, gently transfer the gel to the dark reader for viewing. Place the orange filter
screen over the gel. Turn on the dark reader.*Scientific results need to be documented in

Cell and Molecular Biology Laboratory Manual

185
permanent form. A photograph of the gel could be used as evidence in the courtroom (the gel
itself would break down over time). We recommend using a digital camera to take a photograph
of the gel. We have found that digital cameras work best with a dark room and with the camera
flash turned off. We also recommend using a ring stand and a clamp or a tripod to steady the
camera.* Once the pictures are taken, you can add labels to each of the lanes using programs
such as Photoshop™ or PowerPoint™, or by hand on the paper printout.

• Results

To interpret the size of each of your HindIII l bands compare the spacing between the stained
bands visible on your gel to the figure given below. The figure gives the expected banding pattern
for the size standard and the size of each fragment (the smallest band may not be visible on your
gel). From your gel photo (or from the gel itself) measure the distance from the well to each of the
bands. For each of the 6 (or 7) bands, plot the distance migrated from the well on the X-axis and
the size of the DNA fragment on the log scale (Y-axis). You can plot this using a piece of semi-
log paper or using a computer graphing program (Note: If using a computer graphing program,
make sure that the Y axis is set to a log scale). Connect the points with a smooth curve. This is
a standard curve and can be used to determine the size of the linear fragments in samples treated
with restriction enzymes for that particular gel.

Write your answer on the space provided for the following questions.

Compute for the following DNA Concentration and Purity: (a) Dilution Factor (b) Concentration of
Dilution (c) Concentration of Extract (d) Purity. Show your solution

ddH2O – 90uL
DNA Extract Aliquot – 10uL
OD260 – 0.22A
OD280 – 0.41
Concentration: 50 ug/mL

Why and how do nucleotides absorb light at 280 nm?

Cell and Molecular Biology Laboratory Manual

186
Why and how do amino acids absorb light at 260 nm?

What force causes samples to move in electrophoresis? In the case of agarose gel
electrophoresis of DNA fragments, why do the DNA molecules move? Look at the structure of
DNA in your biology textbook. What charge does DNA have? In which direction will it move?
Label the proper orientation of the (+) and (-) electrodes on the diagram below. Why do pieces
of different sizes move at different rates?

What will happen to the indicator dye while the gel is running? Will you be able to see the DNA
fragments as the gel is being run? Why or why not?

How can the size of a DNA fragment be determined on the basis of the distance that it has moved?

Laboratory Activity 8: Polymerase Chain Reaction (PCR)

The process of replicating the DNA in vitro was made possible by the discovery of the

Cell and Molecular Biology Laboratory Manual

187
structure of DNA by James Watson and Francis Crick. Since then, scientists actively pursued the
process of synthesizing and manipulating the “blueprint of life”. The process of PCR is a perfect
example of biomimicry wherein scientists amplify the amount of nucleotides they have by
simulating the process of replication that originally happens within the nucleus as a precursor to
mitosis.

PCR, as a process, can be divided into two major phases: the preparation of the reaction
cocktail, and the amplification procedure. Reaction cocktails are often specific to the target gene
being amplified, and can be adjusted to various conditions by changing the concentrations of the
components. The same is true for the temperatures and durations of the amplification parameters.
The fine adjustment of these components is a process known as optimization, and is a vital task
in molecular biology.

In this activity, a target gene will be amplified to serve as a molecular marker for species
identification in plant and animals. It is expected that the process of making a PCR cocktail, or
master mix, will be learned by students, together with the setting of the conditions in the machine.
(Abeledo, 2017)

OBJECTIVES

At the end of the activity, you should be able to:

• Understand DNA Amplification

• Understand the basic principles of PCR

Theoretical Procedure

Preparation of the Master Mix

Compute for the needed volumes for your Master Mix, given the following:
Total reactions: 10 samples, 1 negative control
Reaction volume: 20 uL
Amount of template DNA to be added: 1 uL
Solvent: ddH2O

• Collect 5 PCR Ready tubes. Each of these already contains a preformulated, pellet of
“Master Mix”. This material contains Taq polymerase, MgCl2, Buffer, and dNTPs. Label
each tube (number and initials) according to which DNA sample they will contain.
• Volume per reaction: C1V1=C2V2
• Prepare the master Mix: After computing for the needed volumes, prepare and label.
Place the template DNA in the corresponding PCR tubes. Prepare the Master Mix in a
microfuge tube. Mix all components together. NOTE: Put the Taq polymerase last. Vortex
the Master Mix for 5s. Dispense the needed volume of the Master Mix to each PCR tube.
Vortex the PCR tubes for 5s. Spin down the PCR tubes for 5s

Amplification Procedure

Cell and Molecular Biology Laboratory Manual

188
 • Turn on the machine. In the Programming Set-up, set the following conditions:

Write your answer on the space provided for the following questions.

Preparation of Master Mix

Sample computations: Volume: (25uL) Samples: 8

(a) Volume per reaction (b) PCR Buffer (c) dNTPs (d) Volume for master mix

Component Stock Working Volume Per Volume for

Concentration Concentration Reaction Master Mix
PCR Buffer 10X 1X
MgCl2 25 mM 2.0 mM
dNTPs 10 mM 0.3 mM
Forward primer 10 uM 0.3 mM
Reverse primer 10 uM 0.3 mM
Taq polymerase 5 U/ul 0.5 U
ddH2O N/A N/A
Template N/A N/A 1 uL N/A

Cell and Molecular Biology Laboratory Manual

189
Agarose gel electrophoresis results of 16S rDNA amplification (Kenneth Jay Solis)

Explain the AGE given, is it a good electrophoresis? Why or why not? What does this AGE means
for PCR?

Given the process of replication, what are the counterparts of each enzyme in PCR?

If PCR is unsuccessful, how do you adjust the following parameters and why would you adjust
them that way: (a) MgCl2 (b) dNTPs (c) Primers (d) Taq (e) Annealing Temperature (f) Annealing
duration (g) Extension duration

Cell and Molecular Biology Laboratory Manual

190
 Laboratory Activity 9: Protein Synthesis and Words
A string of nucleotides
represents the genetic information
that makes us unique and the
blueprint of who and what we are,
and how we operate. Part of this
genetic information is devoted to the
synthesis of proteins, which are
essential to our body and used in a
variety of ways. Proteins are created
from templates of information in our
DNA.

The X marked nucleotides

are an example of a DNA sequence
that would be used to code for a
particular protein, with the sequence
of these nucleotides determining
which protein it is. The sequence of
these nucleotides are used to create
amino acids, where chains of amino
acids form to make a protein.

MRNA
This genetic information is found in the nucleus, though protein synthesis actually occurs in
ribosome found in cytoplasm and on rough endoplasmic reticulum. If protein is to be synthesised,
then the genetic information in the nucleus must be transferred to these ribosomes. This is done
by mRNA (messenger ribonucleic acid). It is very similar to DNA, but fundamentally differs in two
ways:
• A base called uracil replaces all thymine bases in mRNA.
• The deoxyribose sugar in DNA in is replaced by ribose sugar in mRNA.
At the beginning of protein synthesis, just like DNA replication, the double helix structure of
DNA uncoils in order for mRNA to replicate the genetic sequence responsible for the coding of a
particular protein.In the beginning, the DNA has uncoiled, allowing the mRNA to move in and
transcribe (copy) the genetic information.
If the code of DNA looks like this: G-G-C-A-T-T, then the mRNA would look like this:
C-C-G-U-A-A (remembering that uracil replaces thymine)
With the genetic information responsible for creating substances now available on the mRNA
strand, the mRNA moves out of the nucleus and away from the DNA towards the ribosomes.

mRNA and tRNA

mRNA leaves the nucleus and enters the cytoplasm where ribosomes can be found, the
site of protein synthesis. The mRNA strand is met in the ribosome by complimentary tRNA
anticodons, which have opposing bases to that of the mRNA strand (the codons).

Cell and Molecular Biology Laboratory Manual

191
For example,

if the mRNA sequence is A-A-U-C-A-U, (codon)

then the tRNA sequence is U-U-A-G-U-A (anticodon)

Each tRNA molecule consists of 3 bases, deemed an anticodon which compliments the
opposing bases on the mRNA strand. These in turn have the amino acid sequence to successfully
code for a particular amino acid. Each amino acid has a certain sequence of bases to make it
unique. Therefore, as a summary:
-The initial DNA contained a certain sequence of nucleotides
-The mRNA has a pre-determined sequence (because it is transcribed from the DNA)

Again, as a consequence the anticodons possess a pre-determined sequence due to the

mRNA
As each amino acid corresponds to a particular anticodon, a unique amino acid sequence is
created forming a protein These amino acids (peptides) can combine to form a polypeptide chain
(proteins), which are used in a variety of structures such as enzymes and hormones.

OBJECTIVES At the end of the activity, you should be able to:

• Understand the process of protein synthesis.
• to further understand the ability of DNA to code for proteins and therefore preserve
the continuity of life within an organism/species.

MATERIALS:
• 20 DNA Template Cards
• 64 Anti-Codon Cards or Anti-codon posters
• Lab Paper
• Pen/Pencil

PROCEDURE

1. Make sure you look at what the

DNA Template cards look like.
2. Check the anti-codon translation.
Pick up a DNA template card, write
down the DNA template card
number, and transcribe it into
mRNA.
3. With the mRNA sequence, go back
to your desk and the ribosomal
student will write out the tRNA anti-
codon sequence.
4. The tRNA student will search out
the correct anti-codon card write
down the corresponding word.

Cell and Molecular Biology Laboratory Manual

192
 Triplet Code Translation
UAG = Stop (period) CCG = is CGC = water
AUG = Initiator (Start) CCU = subject CGG = every
AAA = Your CGA = drink CGU = day
AAC = mother AAG = wears AAU = dresses
ACG = funny ACC = have ACU = dog
ACA = breath AGA = the AGG = are
AGU = Beatles AGC = best AUA = rock
AUC = band AUU = an CAA = old
CAC = rubber CAG = breaks CAU = pulled
CCA = when CCC = Biology CUA = I
CUC = love CUG = roll CUU = music
GAA = all GAC = demented GAG = puppies
GAU = and GCA = so GCC = much
GCG = fun GCU = education GGA = door
GGC = to GGG = future GGU = father
GUA = a GUC = dress GUG = brother
GUU = nothing UAA = we UAC = in
UAU = this UCA = together UCC = must
UCG = be UCU = informed UGA = around
UGC = you UGG = read UGU = little
UUA = DNA UUC = code UUG = for
UUU = life

Key to DNA Fragments

1. ATGAAAAACAAGGTACACATCTAG
2. ATGAAAAACAATTGCACGTAG
3. ATGTAAACCACTACATAG
4. ATGAGAAGTAGGAGAAGCATAATCTAG
5. ATGATTCAACACATCCAGCCACATTAG
6. ATGCCCCCGAGAAGCCCTTAG
7. ATGCGACGCCGGCGTTAG
8. ATGCTACTCATAGATCTGCTTTAG
9. ATGTAAAGGGAAGACGAGTAG
10. ATGCCCCCGGCAGCCGCGTAG
11. ATGGCTCCGAGAGGAGGCAGAGGGTAG
12. ATGAAAGGTAAGGTAGTCTAG
13. ATGAAAGTGAAGGTTTAG
14. ATGTAAAGGGAATACTATTCATAG
15. ATGTAATCCTCGTCTCGGCGTTAG
16. ATGATAGATCTGCTTCCGAGAAGCTAG
17. ATGCCCCCGGAATGATGCTAG
18. ATGTGGGTATGTCGGCGTTAG
19. ATGTTACCGAGATTCTTGTTTTAG
20. ATGTTATCCTCGTGGTTGTTTTAG

Cell and Molecular Biology Laboratory Manual

193
 Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA

Cell and Molecular Biology Laboratory Manual

 tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA

Cell and Molecular Biology Laboratory Manual

195
 tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence
Sequence #
DNA
mRNA
tRNA
Sentence

Cell and Molecular Biology Laboratory Manual

196
 Laboratory Activity 10: Bioinformatics

Once you have successfully amplified and sequenced your molecular markers, there are many
tools that aid in making sense out of them. These sequences can help you determine the identity
of your samples by comparing them to other nucleotide sequences. This process has been greatly
simplified and accelerated by the existence of the National Center for Biotechnology Information
(NCBI) database, known as GenBank. Apart from species identification, nucleotide sequences
can also be used to estimate relationships across individuals, and to check for common ancestor
ship. This is done by screening across the sequences being compared to look at the diversity of
mutations found across the molecular markers. The output of such a process is in the form of a
phylogenetic tree. The sequences of molecular markers can also be used to detect population
genetic structure. There is a variety of studies done on the population structure of marine species
that are found in the Philippines. The studies make use of different markers for detecting structure
and connectivity, and also cover different geographic scales (Abeledo, 2017)

OBJECTIVE

At the end of the activity, you should be able to:

• Introduce you to the number and diversity of nucleotide sequences in the NCBI database.

Theoretical Procedure

Begin by linking to the NCBI homepage (www.ncbi.nlm.nih.gov). If you ever get lost, always
return to this page as a starting point. Select ‘TaxBrowser’ at the top right. The NCBI Taxonomy
database contains the names of those organisms whose sequences have been deposited. Only
a small fraction of the millions of species estimated to exist on earth is represented! Select the
option ‘Taxonomy Statistics’ in the middle of the left-side navigation bar

• Select the ‘Taxonomy’ option in the right of the top menu bar
• Select ‘Taxonomy home’ in the left-hand navigation menu
• Select ‘Extinct organisms’ in the bottom of the left-hand navigation menu to see the
organism list
• Scroll down to Insects on the main page and select ‘Libanorhinus succinus (a beetle from
Lebanese amber 120-135 Mya)’.
• This page gives you very specific information about the ancestry of this organism. Select
the option ‘Arthropoda’.

Scroll through the complete reference report on this sequence. A lot of information may seem
confusing, but it is all there to provide scientists with as much information as possible about this
sequence. At the bottom of the screen, you will find the nucleotide sequence (all of the A,T,G,C
base pairs) of this gene. Click on the PUBMED ‘8505978’ to directly link to the title, authors, and
abstract of the published paper! Amazing, now you can read the research article that describes
the discovery of this nucleotide sequence. Select the ‘NCBI’ link in the top left corner of the screen
(next to the DNA symbol) to return to the NCBI home page.

Cell and Molecular Biology Laboratory Manual

197
Write your answer on the space provided for the following questions.

What is the meaning of each of the following Blast criteria: (a) Max Score (b) Total Score (c)
Query Cover (d) E-value (e) Max ident

There are instances when you do a blast search and two possible options appear that have the
same Max Score, Total Score, Query Cover, E-value and Ident value, but different species
identification. What could be possible reasons for such instances?

Cell and Molecular Biology Laboratory Manual

198
 References:

Alberts, Bruce, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts, and Peter
Walter. Molecular Biology of the Cell, 6th ed.. New York: Garland Science, 2015.

Brown, Amy. (2012). Lab: The Use of Glucose in Cellular Respiration. Retrieved from
https://www.amybrownscience.com/2012/03/lab-use-of-glucose-in-cellular.html

Cajigal, P.B., Valenton, C.R. (2012). A Workbook in College General Biology. Muntinlupa: San
Beda College.

Cresencia, J.C., Lagunzad, CG.G. (2007). Laboratory Manual and Workbook in Biology. Vibal
Publishing House Inc.

Cornell University. (2014). Cornell Institute for Biology Teachers, Labs and Activities. Retrieved
from https://blogs.cornell.edu/cibt/labs/molecular-biology

Gunthoti, Kranthi. (2020). How to extract your own DNA at home. Retrieved from
https://www.instructables.com/id/How-to-extract-your-own-DNA-at-home/

Home Science Tools. (2017).How to extract DNA at home.Retrieved from https://learning-

center.homesciencetools.com/article/how-to-extract-dna-at-home/

Hardin, J., Bertoni, G. P., & Kleinsmith, L. J. Becker's World of the Cell. Pearson Higher
Ed. 2017

Iwasa, J. and Marshall, W.Karp’s Molecular and Cell Biology Concepts and Experiments. 8th ed.
USA, 2016.

Karp, G. Cell and molecular biology: concepts and experiments. John Wiley & Sons. 2009

Lodish, H., et al. Molecular Biology, 4th ed. New York: W.H. Freeman & Co., 2000.

Mader, S. S., & Windelspecht, M. Essentials of Biology 5th Edition By Sylvia S. Mader Dr.: By
Sylvia S. Mader Dr. My Ebooks Planet. 2017

National Center for Biotechnology Information. (2009). BLAST Program Selection. Retrieved from
Guidehttps://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=Blast

Wartski, Lynn Marie. (2014). Protein Synthesis and Words. Retrieved from
https://blogs.cornell.edu/cibt/labs/molecular-biology

Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., & Jackson, R.
B. Campbell biology(No. s 1309). Boston: Pearson 2014

Cell and Molecular Biology Laboratory Manual

199