Molecular basis of inheritance HW3

1. What is not True for DNA in prokaryotes

a) present in the form of a compact structure called nucleoid

b) the coils are maintained by non-histone basic proteins

c) found in cytoplasm in a supercoiled condition

d) packaged as nucleosomes along with histones

2. Pick the right difference between a DNA and RNA

a) Sugar and phosphate

b) sugar and purines

c) purines and phosphate

d) sugar and pyrimidines

3. A bacterial colony containing DNA made up of 100% N15 nitrogen bases is allowed to replicate in a
medium containing N14 bases. After one round of replication the result would be

a) All individuals will be identical to parents

b) All individuals will be hybrids

c) Only 50% individuals would be hybrids

d) All individuals would have DNA made up of 100% N14

4. Cistron is

a) The coding sequence of DNA

b) The functional unit of DNA molecule that codes for a particular gene product

c) Intervening non coding sequence of DNA

d) The sequences which are removed during RNA splicing.

5. Read the statements given below and identify the incorrect statement.

a) The human genome contains 3164.7 million nucleotide bases.

b) The average gene consists of 30,000 bp

c) The total number of genes is estimated at 30,000.

d) Chromosome Y has 231 genes

e) Less than 2% of the genome codes for proteins.

6. The coding sequences found in split genes are called

b) introns

c) exons

d) cistrons

7. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes

a) RNA polymerase II

b) RNA primase

c) RNA polymerase III

d) RNA polymerase I

8. Sickle cell anemia is caused

a) When valine is replaced by glutamic acid in beta polypeptide chain

b) When glutamic acid is replaced by valine in beta polypeptide chain

c) When glutamic acid is replaced by valine in alpha polypeptide chain

d) When valine is replaced by glutamic acid in alpha polypeptide chain

9. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?

a) AUGUUAAUAGACGAGUAGCGACGAUGU

b) AUGAGACGGACUGCAUUCCCAACCUGA

c) AUGCCCAACCGUUAUUCAUGCUAG

d) AUGUCGACAGUCUAAAACAGCGGG

10. Arrange the following events in the order of synthesis of a protein

i) A peptide bond forms

ii) A tRNA matches its anticodon to the codon in the A- site

iii) The movement of second tRNA complex from A-site to P-site

iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the P-site

v) A small subunit binds to the mRNA

vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA

a) iv, v, iii, ii, i, vi

b) iv, vi, v, ii, I, iii

c) v, iv, iii, ii, vi, I

11. Select the incorrect statement out of the five given below about lac operon when Lactose is present
in the medium.

a) Gene – A gets transcribed into mRNA which produces β-galactoside permease

b) Inducer-Repressor complex is formed

c) Lactose inactivates repressor protein

d) RNA polymerase transcribe Z-gene, Y-gene and A-gene

e) Allolactose is the inducer of lac operon

12. The percentage of human genome which encodes proteins is approximately

a) Less than 2% b) 5% c) 25% d) 99%

13. Match the entries in column I with those of column II and choose the correct answer.

Column I Column II

A) Alkali treatment M) separation of DNA fragments on gel slab

B) Southern blotting N) split DNA fragments into single strands

C) Electrophoresis O) DNA transferred to nitrocellulose sheet

D) PCR P) X-ray photography E) Autoradiography Q) produce fragments of different sizes

F) DNA treated with REN R) DNA amplification

(1) A - N, B- Q, C- P, D- R, E- M, F - O

(2) A - P, B - R, C - M, D -O, E - N, F – Q

(3) A - Q, B - O, C - M, D - R, E - P, F – N

(4) A - N, B - O, C - M, D - R, E - P, F - Q

14. Enzyme which can cut the DNA strand

a) Topoisomease II (b) Helicase (c) Primase (d) Restriction endonuclease

15. Match the names of scientists in column I with their achievements in column II and choose the
correct answer given below

Column I Column II

A) Watson and Crick P) DNA fingerprinting

B) R.W. Holley Q) Decipher genetic code

C) Marshal Nirenberg R) Double helix of DNA

E) Alec Jeffrey T) Lac operon concept

a) R S P T Q

b) R S Q T P

c) R Q P T S

d) R T S P Q

16. Which of the statements give below is correct with respect to frameshift mutation

a) a single nucleotide base change, insertion, or deletion of the genetic material

b) Glutamine is replaced by valine

c) Sickle cell anemia is an example

d) insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three.

17. The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is
(a) β (b) ω (c) σ (d) α

18. The structural genes of lac operon transcribe mRNA which is

a) polycistronic b) replicative c) monokaryotic d) monocistronic

19. If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will
be

a) ATGGCTGGT b) ATCCGAACU c) AUGGCUGGU d) AUGGACUAA

20. Match the following

Column I Column II

(A) Helicase (M) activation of amino acid

(B) Peptidyl transferase (N) joins DNA fragments

(C) DNA polymerase (O) unwinds DNA helix

(D) DNA ligase (P) peptide bonds between amino acids

(E) Aminoacyl synthetase enzyme (Q) DNA synthesis

(F) RNA primase (R) synthesis of RNA primer

a) A-O, B-P, C-Q, D-N, E-M, F-R

b) A-R, B-M, C-N, D-Q, E-P, F-O

c) A-M, B-R, C-P, D-Q, E-N, F-O