Scribd
Upload
41 views

Haa Nipa Question Bank (Proposed) - Final

This document contains a proposed question bank for the course BIO 3105 covering topics in biotechnology, ecosystem dynamics, food and nutrition, and immunity. It includes 14 questions on biotechnology focusing on topics like DNA electrophoresis, restriction enzymes, and recombinant DNA techniques. 9 questions cover ecosystem dynamics addressing topics such as chemosynthesis, food webs, and the impacts of factors like deforestation. 7 questions relate to food and nutrition including diet for conditions like gestational diabetes and lifestyle changes to prevent noncommunicable diseases. 9 questions address immunity, touching on vaccines for COVID-19, autoimmune diseases, homeostasis, and adaptive vs innate immunity.

Uploaded by

Zahidul Hassan
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
41 views

Haa Nipa Question Bank (Proposed) - Final

This document contains a proposed question bank for the course BIO 3105 covering topics in biotechnology, ecosystem dynamics, food and nutrition, and immunity. It includes 14 questions on biotechnology focusing on topics like DNA electrophoresis, restriction enzymes, and recombinant DNA techniques. 9 questions cover ecosystem dynamics addressing topics such as chemosynthesis, food webs, and the impacts of factors like deforestation. 7 questions relate to food and nutrition including diet for conditions like gestational diabetes and lifestyle changes to prevent noncommunicable diseases. 9 questions address immunity, touching on vaccines for COVID-19, autoimmune diseases, homeostasis, and adaptive vs innate immunity.

Uploaded by

Zahidul Hassan
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 3

BIO 3105

Proposed Question Bank


Summer 2022
Biotechnology
1. Show pictorial view of the pH balance in a bioreactor. Also show how you will
maintain necessary air supply. Slide 20
2. Mention the enzymes needed to prepare a DNA sample before pushing it through gel
electrophoresis. Slide 14
3. Name the goods you would like to protect against biopiracy that is native to
Bangladesh (Naming 5 would be sufficient). Slide (search from google)
4. Do you think you have scope to give your input as a computer engineer in
personalized drug design? Give details. Slide 39
5. Show the pictorial view of PCR chain including polarities for DNA. Slide 4, 6
6. Mention the name of the characteristics of a competent host. How you would apply a
complete rDNA to a plant (mention only the names of the means you are going to
use). Slide 33
7. Suppose you have a restriction enzyme that has a recognition sequence GCCG. How
you would complete the rDNA for a given sequence of one strand as below show in a
pictorial view (You need to complete the DNA with a complementary strand before
starting the process).
hnology: Principles ATAACGATAGCCGTATTATGCAATGCATTACGAGCCGTATAAT
and Processes
DNA fragments are
der normal light.
8. Find the total number of base pairs of sample “A” and “C” from below. Slide 11
y are visualized
the bands with a
thidium bromide
them to UV
e they are stained
o UV light, you can
ated DNA bands and
ir sizes using a DNA

e can cut out the


DNA fragment,
further ligate it with
s. The techniques of
ectrophoresis are
ield of forensics, for
printing and
me suspects.

9. Show pictorial view of the nutrients supply and temperature control in a bioreactor.
Ref: https://www.toppr.com/guides/biology/biotechnology-principles-and-processes/

Slide 20
10. Do you think we need a protocol to monitor transgenic animal issue? Propose some
basic points that you think we should include in the protocol (it should be very brief).
Slide (See such protocol from other countries)
11. Do you think you have scope to give your input as a computer engineer in gene therapy for a
project? Give details. Slide 37
12. Name the specific fields where you can give your input as a computer engineer. Slide
35-50
13. Suppose you have a primer sequence GCATTA. In PCR you have a fragment of DNA
with 25 spaces for bases which will repeat itself after every six sequences. If the
above mentioned primer fits on the right hand side of your desired DNA strand, show
the whole DNA strand before and show the whole picture after elongation process.
14. Why do you put DNA sample in the negative terminal of the device for gel
electrophoresis? Slide 9-11
Ecosystem Dynamics
1. Give the equations for chemosynthesis and photosynthesis. Which one of these two
do you think vital for ecosystems on earth? Give reasons in brief. Slide (see video linked
with Slide 15+all Slides)
2. Do you think pandemic can potentially spread out from the ecosystem? Give reasons
from the concept of ecosystem dynamics. Slide 25-27
3. Sketch the flow diagram(s) to show the resistance and resilience of a land based
ecosystem after deforestation. Slide 24
4. What should be the change in energy flow for a typical ecosystem where there are 3
levels of consumers? Show with the help of energy-time graph. Slide 11, 16
5. Mention the basic differences between food web and food chain. Slide 8-10
6. Mention the names of substances we give up in the environment which can be
harmful for us. Slide 20
7. Name the natural external factors of a land based ecosystem with a brief focus on one
example. Slide 23
8. For a drought happening in several years back in the north part of the country explain
the resistance and resilience of the ecosystem in a diagram. Slide 24 (not direct ans)
9. Explain the results of the simulation with produces and consumers. Slide 14 (simulation)

Food and Nutrition


1. Show in pictorial view that how food can help us to fight with noncommunicable
diseases (block diagram of key points would be sufficient).
2. Do you think we need a change in diet for a 95 kg 130 cm pregnant woman? Give
reasons and possible changes you want to recommend in diet. This person has
gestational diabetes (diabetes in pregnancy period).
3. Name the specific ways to control your sugar, salt and fat intake.
4. Suppose you have a child in the family. If from three months the child needs food
from outside, how would you plan the diet from three months to one year (only name
the foods for specific months).
5. Explain why the increased rate of NCD in our country with examples. Name some of
the noncommunicable diseases. Design a lifestyle to prevent those diseases focusing
on the ingredients of food that should be taken into account for.
6. Explain the relationship between food and mental stress. Please comment on the steps
we should take regarding this matter.
7. Clarify your height and weight complies with BMI. If not then analyse the procedure
to maintain.
Immunity
1. Write down two of the US based vaccines for COVID-19 with doses.
2. Name the types of the vaccines used against COVID-19.
3. Name some of the autoimmune diseases. Mention their impact on health.
4. Give a pictorial view of similarities and differences of spleen and thymus.
5. With the help of a diagram show the role of insulin to restore homeostatic control in
the blood sugar.
6. Discuss the significances of having both positive and negative feedback in our
homeostasis control. Give proper reasons behind your answers.
7. Explain each category of Immunity with example. Is Covid 19 vaccine adaptive or
innate clarify
8. For example any pathogen is invaded in our body. Justify how your defence
mechanisms work in this case.
9. Explain the relationship of vaccination with primary an d secondary response.

You might also like