Saudi Pharmaceutical Journal 29 (2021) 361–368

Contents lists available at ScienceDirect

Saudi Pharmaceutical Journal

journal homepage: www.sciencedirect.com

Original article

Commiphora myrrha (Nees) Engl. resin extracts induce phase-I

cytochrome P450 2C8, 2C9, 2C19, and 3A4 isoenzyme expressions in
human hepatocellular carcinoma (HepG2) cells
Zeyad Alehaideb a,d, Ghada Alatar a, Atef Nehdi b,d, Abeer Albaz a, Hamad Al-Eidi a, Mansour Almutairi c,
Esraa Hawsa a, Nora Alshuail a, Sabine Matou-Nasri a,d,⇑
a
Cell and Gene Therapy Group, Medical Genomics Research Department, King Abdullah International Medical Research Center (KAIMRC), Riyadh, Saudi Arabia
b
Department of Medical Research Core Facility and Platform, KAIMRC, Riyadh, Saudi Arabia
c
Developmental Medicine Department, KAIMRC, Riyadh, Saudi Arabia
d
King Saud Bin Abdulaziz University for Health Sciences, Riyadh, Saudi Arabia

a r t i c l e i n f o a b s t r a c t

Article history: Commiphora myrrha (Nees) Engl. (C. myrrha) resin is the most Middle Eastern herbal medicine used
Received 27 December 2020 against numerous diseases. After being decocted or macerated, this resin is widely consumed among
Accepted 6 March 2021 Saudi Arabian patients who are already under prescribed medication. Despite its popularity, no studies
Available online 1 April 2021
have been reported on potential modulation effects of these resin extracts on drug metabolism.
Therefore, we studied C. myrrha resin extracts on the expression of cytochrome P450 (CYP) drug-
Keywords: metabolizing isoenzyme in human hepatocellular carcinoma cell line HepG2. The C. myrrha extracts were
Commiphora myrrha
prepared by sonication and boiling, resembling the most popular traditional preparations of maceration
Cytochrome P450
Drug-metabolizing enzyme
and decoction, respectively. Both boiled and sonicated aqueous extracts were fingerprinted using high-
Inducer performance liquid chromatography equipped with ultra-violet detector (HPLC-UVD). The viability of
Natural health product HepG2 cells treated with these aqueous extracts was determined using CellTiter-GloÒ assay in order to
select the efficient and non-toxic resin extract concentrations for phase-I metabolic CYP isoenzyme
expression analysis. The isoenzyme gene and protein expression levels of CYP 2C8, 2C9, 2C19, and 3A4
were assessed using reverse transcription-quantitative polymerase chain reaction and Western blot tech-
nologies. The HPLC-UVD fingerprinting revealed different chromatograms for C. myrrha boiled and soni-
cated aqueous extracts. Both aqueous extracts were toxic to HepG2 cells when tested at concentrations
exceeding 150 mg/ml of the dry crude extract. The CYP 2C8, 2C9, and 2C19 mRNA expression levels
increased up to 4.0-fold in HepG2 cells treated with either boiled or sonicated C. myrrha aqueous extracts
tested between 1 and 30 mg/ml, as compared with the untreated cells. However, CYP3A4 mRNA expres-
sion level exceeded the 2.0-fold cutoff when the cells were exposed to 30 mg/ml of C. myrrha extracts. The
up-regulation of CYP mRNA expression levels induced by both boiled and sonicated C. myrrha aqueous
extracts was confirmed at the CYP protein expression levels. In conclusion, both sonicated and boiled
C. myrrha aqueous extracts modulate CYP 2C8, 2C9, 2C19, and 3A4 gene expression at clinically-
relevant concentrations regardless of preparation methods. Further in vitro and in vivo experiments are

Abbreviations: cDNA, complementary DNA; CO2, carbon dioxide; CYP, cytochrome P450; DMEM, Dulbecco’s Modified Eagle Medium; EU, endotoxin unit; FBS, fetal bovine
serum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HPLC-UVD, high-performance liquid chromatography and ultra-violet detector; mRNA, messenger ribonucleic
acid; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; PBS, phosphate-buffered saline.
⇑ Corresponding author at: Cell and Gene Therapy Group, Medical Genomics Research Department, King Abdullah International Medical Research Center, King Saud Bin
Abdulaziz University for Health Sciences, P.O. Box 3660, Riyadh 11481, MC 1515, Saudi Arabia.
E-mail address: [email protected] (S. Matou-Nasri).
Peer review under responsibility of King Saud University.

Production and hosting by Elsevier

https://doi.org/10.1016/j.jsps.2021.03.002
1319-0164/Ó 2021 King Abdullah International Medical Research Center. Published by Elsevier B.V. on behalf of King Saud University.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

required for CYP isoenzyme activity assessment and the establishment of herb-drug interaction profile
for these traditional medicinal resin extracts.
Ó 2021 King Abdullah International Medical Research Center. Published by Elsevier B.V. on behalf of King
Saud University. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/
licenses/by-nc-nd/4.0/).

1. Introduction If consumed concomitantly, certain traditional medicines can

modulate by up-regulating or down-regulating in vivo CYP gene
The Middle Eastern medicine of ‘‘Myrrah” is a botanical resin expression levels resulting in less efficient drug therapy or over-
obtained from scratching the tree bark of Commiphora myrrha dose drug toxicity (Meijerman et al., 2006). This can be predicted
(Nees) Engl. (C. myrrha) (Synonym, Commiphora molmol (Engl.) in vitro by exposing the hepatoma cells to different concentrations
Engl. ex Tschirch) and is worldwide known as ‘‘Mir’rah” (in Arabic, of the traditional medicine crude extract. The effect can be mea-
‫)ﺍﻟ ُﻤ ّﺮﻩ‬, ‘‘Hira’bol” (in Hindi, हिराबोल) in the Indian subcontinent, and sured at the transcriptional level using quantitative PCR (q-PCR)
‘‘Mò’yào” (in simplified Chinese, 沒藥) in China. This ancient natu- technique, and at the translational level using Western blot or
ral medicine from the Burseraceae family is considered as an mass spectrometry technologies. The rapid advances in molecular
important traditional medicine in Ayurveda, Chinese, and Greco- techniques have allowed the accurate and sensitive measurements
Arab (Unani) traditional medicine systems and is commonly of mRNA and protein levels in hepatoma cells. Generally, the hep-
known nowadays as the ‘‘True Myrrha” or ‘‘Molmol Myrrha”. The atoma cells are known to have lower basal CYP mRNA and protein
resin of C. myrrha is used for the treatment of arthritis, hyperlipi- levels in comparison to the gold in vitro model option of freshly-
demia, obesity, pain, fractures, cancer, wounds, and bacterial/para- harvested primary human hepatocytes (Guo et al., 2011).
sitic infections (Shen et al., 2012). Traditionally, C. myrrha herbal In this present study, we determined the comparative modula-
medicine is prepared using different extraction methods depend- tory effects of boiled and sonicated aqueous extracts of C. myrrha
ing on desired clinical treatment. The resin is either boiled, macer- resins on CYP 2C8, 2C9, 2C19, and 3A4 isoenzyme expression at
ated, prepared as an ointment, or used directly in raw resin form both mRNA and protein levels.
(Bhutya, 2011). The highly desired therapeutic properties of C. myr-
rha resin might be due to its rich composition of tannins, flavo-
noids, alkaloids, glycosides, steroids, saponins, and terpenoids 2. Materials and methods
(Chandrasekharnath et al., 2013).
Numerous survey studies confirm that resin of C. myrrha is one 2.1. Source of C. myrrha resin
of the most popular traditional medicines used by individuals in
Saudi Arabia. In 2003, a survey reported that approximately 35 The resin was purchased from Boswellness (Colchester, VT)
percent of 1408 healthy volunteers were consuming C. myrrha with product number 10,018 and lot number CM000105. The herb
resins within the year (Al-Faris et al., 2008). Another study of was certified to be organic and free of pesticides, preservatives, and
100 healthy volunteers has found that 59 percent at least used C. alterations as the resin was wildcrafted by experts in the Federal
myrrha resins mainly as an antiseptic treatment (Alanzi et al., Republic of Somalia. The resins were stored in a dark and cool cab-
2016). Among Saudi Arabian patients, a study published that 45 inet until processed. The remaining resin sample is kept in our
percent among 51 diabetic patients use C. myrrha resins department for future reference.
(Al-Rowais, 2002). In another survey, approximately 7 percent of
asthmatic out-patients used C. myrrha resins (Al Moamarym,
2.2. Source of HepG2 cells
2008). Furthermore, Jazieh et al. (2012) reported that 90 percent
of hospitalized cancer patients used complementary medicines
Human Hepatocellular Carcinoma (HepG2) cells were kindly
including 10 percent consuming C. myrrha resins. Despite its pop-
gifted by Dr. Ahmed Al-Qahtani from King Faisal Specialist Hospital
ular use among patients, no clinical studies assessed the safety of
and Research Center (Riyadh, Saudi Arabia) and originally pur-
consuming C. myrrha along with drugs primarily metabolized by
chased from the American Type Culture Collection (ATCC, Manas-
hepatic cytochrome P450 (CYP) enzymes.
sas, VA). The HepG2 cell line was derived from a fifteen-year-old
Cytochrome P450 enzymes are a group of phase-I metabolic
Caucasian adolescent male patient diagnosed with hepatocellular
detoxifying enzymes located mainly in the liver and enterocytes.
carcinoma.
More than 50 percent of overall elimination of pharmaceutical
drugs are mediated by CYP enzymes (Wilkinson, 2005). The con-
sumption of phytochemicals can interfere with the drug- 2.3. Chemicals and reagents
metabolizing activity of such hepatic enzymes. Such interferences
are referred to as food-drug and herb-drug interactions which can Rifampicin (USP grade, 97 percent) was obtained from UFC
pose serious health consequences. In vitro cell models are used to Biotechnology Fine Chemicals (Amherst, NY). Dulbecco’s Modified
predict such interactions using primary enterocytes or hepatocytes Eagle Medium (DMEM) plus GlutaMax-I (4.5 g/l D-Glucose,
(Wong et al., 2018). However, HepG2 cells are preferred from pri- 25 mM HEPES, Pyruvate), fetal bovine serum (FBS), TrypLETM
mary hepatocytes as the later has many disadvantages including Express, and Dulbecco’s phosphate-buffered saline (PBS) were pro-
special cell culture requirements and limited life-span (Gerets vided from GibcoÒ (Waltham, MA). NP40 cell lysis buffer was pur-
et al., 2012). Common cells used for CYP-related studies include chased from Thermo Fisher Invitrogen (Carlsbad, CA). Methanol
liver cancer cell lines such as HepG2, Hep3B, SK-Heb-1, Huh-7, (chromatography grade, 99 percent) was obtained from Honey-
and HepaRG (Marion et al., 2010; Guo et al., 2011). Non-hepatic well Riedel-de Haen (Seelze, Germany). Purified carbon dioxide
cancerous cells, including intestinal Caco-2 cells, have been used (CO2) gas was provided by Saudi Industrial Gas (Dammam, Saudi
but is known to have much lower basal CYP expression levels Arabia). Ultrapure water was produced using a Millipore (Billerica,
(Sergent et al., 2009). MA) system with a resistivity reading of 18.2 MX
cm at 25 °C.

362
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

2.4. Preparation of C. myrrha aqueous extracts bated for 48 h under experimental conditions previously described.
After incubation, the plate was left at room temperature for 30 min
The extracts were prepared as 100 percent water by sonication and 100 ml of Cell Titer-GloÒ reagent were added for each well and
and 100 percent water by boiling. Prior extraction, resin of C. myr- mixed on a shaker for 2 min. The plate was left at room tempera-
rha was fine powered using an electric grinder. For the sonicated ture for 10 min to settle and the luminescence of each well was
extraction, approximately 500 mg of the fine powder were mixed read by the Perkin Elmer (Waltham, MA) EnVision Multilabel
with 10 ml of ultra-pure water and sonicated for 30 min at high- Reader.
power mode using a Sonics (Newton, CT) Vibra-Cell Ultrasonic Liq-
uid Processor Model GEX-130 probe-sonicator. For the boiling
2.9. Extraction of mRNA from HepG2 cells
water, approximately 500 mg of resin were mixed with 10 ml of
ultra-pure water and boiled until half of the volume was evapo-
The untreated and treated HepG2 cells were washed with PBS
rated. The extracts were filtered using a Sartorius stedim biotech
and harvested using TrypLETM Express solution. The cells were
(Göttingen, Germany) quantitive ashless paper filter and dried in
transferred to a 1.5 ml tube and centrifuged at 15,000 rpm for
an incubator set at 50C for 3 to 4 days. The remaining dried pellets
5 min. The cell pellet was stored at 80 °C. The whole RNA was
were weighted and reconstituted with 1 ml of ultra-pure water by
extracted from the treated and untreated cell pellets using the Qia-
vortex until completely dissolved. The reconstituted extracts were
gen (Hilden, Germany) RNeasy Plus Mini kit (catalog number,
stored at cool temperature in dark until used.
74106) as per the manufacturer’s instructions.
2.5. Fingerprinting of C. myrrha aqueous extracts by HPLC-UVD
2.10. Extraction of proteins from HepG2 cells
The chromatograms of C. myrrha aqueous extracts were per-
formed using an Agilent (Santa Clara, CA) 1260 infinity high- The HepG2 cells were washed with PBS and 80 ml of NP40 lysis
performance liquid chromatography (HPLC) equipped with an buffer were added to the cell pellet and incubated on ice for 30 min
ultra-violet detector (UVD). The major components of C. myrrha with repeated vortexing at 10 min intervals. The cell lysate was
were separated using a Phenomenex (Torrance, CA) C18 Kinetex transferred to 1.5 ml tube and centrifuged at 13,000 rpm for
column (250  4.6 mm, 5 mm). The multi-wave UVD was set at 10 min at 4 °C. The supernatant containing the whole cell lysate
wavelengths ranging from 225 to 375 nm at 25 nm segments with- rich in proteins was transferred to fresh 1.5 ml tube and kept at
out reference. The gradient programming of methanol and ultra- 20 °C. The amount of protein was measured using the Molecular
pure water was as follows: separation-phase (5 to 100 percent ProbesÒ Life Technologies (Eugene, OR) QubitÒ Protein Assay kit
methanol, 0 to 35 min), washing-phase (100 percent methanol, (catalog number, Q33211) as per the manufacturer’s instructions.
35 to 40 min), and equilibrium-phase (100 to 5 percent methanol,
40 to 45 min). The injection volume was 10.0 ml at ambient tem-
2.11. RT-qPCR for CYP gene expression assessment
perature and the total run time was 45 min.
The method was performed as previously described in El Gendy
2.6. Determination of endotoxin level in C. myrrha aqueous extracts
and El-Kadi (2009) with modifications. Briefly, Complementary
DNAs (cDNAs) at 50.0 ng per well were first produced from the
The levels of endotoxins in the C. myrrha aqueous extracts were
whole RNA extracts via reverse transcription using Thermo Fisher
determined using the Thermo ScientificTM PierceTM Chromogenic
Scientific Applied BiosystemsTM High-Capacity cDNA Reverse Tran-
Endotoxin Quant kit (catalog number, A39553) as per the manufac-
scription kit. The quantitative real-time PCR was performed using a
turer’s instructions.
Thermo Fisher Scientific SYBR Green PCR Master Mix kit and per-
formed on Applied Biosystems 7900 real-time PCR system. For
2.7. Culture and treatment of HepG2 cells
each analysis, a negative control was prepared using all reagents
except the cDNA template. The housekeeping gene (b-actin) was
The HepG2 cells were cultured in complete DMEM Glutamax-I
used as an internal control and cytochrome enzyme primer
medium containing 10 percent (v/v) heat-inactivated FBS, and 1
sequences (Table 1) were used at 10.0 pmol/ml concentration.
percent (v/v) of penicillin G (100 IU/ml) and of streptomycin
(100 lg/ml). The cells were incubated at 37C in 5 percent CO2
and 95 percent relative humidity. The media was changed 2 to 2.12. Western blot for CYP protein expression analysis
3 days and the cells were sub-cultured when the cell population
density reached 70 to 80 percent confluency. Cells were seeded The method was applied as previously described in Alehaideb
at an appropriate density according to each experimental design. et al. (2020) with modifications. Briefly, protein samples (120 mg
For the cell viability experiment, concentrations ranging from per well) were separated on 11 percent SDS–polyacrylamide gels
0.05 to 2000 mg dry extract weight per ml were used for each and electro-blotted onto a Thermo Fisher polyvinylidene difluoride
boiled and sonicated extract. For gene expression assessment, the (PVDF) transfer membrane 0.45 lm (catalog number, #88518). Pri-
HepG2 cells were treated with three different concentrations of mary antibodies (Invitrogen) against mouse monoclonal anti-
1, 15, and 30 mg/ml for each boiled and sonicated aqueous C. myr- CYP3A4 antibody (#MA5-17064), rabbit polyclonal anti-CYP2C19
rha extracts. Different rifampicin concentrations ranging between antibody (#PA5-13669), mouse monoclonal anti-CYP2C9 antibody
0.001 and 50 mM inducing CYP isoenzyme gene expression were (#MA5-25748) were used as probes to stain the PVDF membranes.
used as positive controls. Secondary LI-COR (Lincolin, NE) IRDyeÒ goat anti mouse
(# 926-32210) and goat anti- rabbit antibodies (# 926-32211)
2.8. Cytotoxicity of C. myrrha extracts on HepG2 cells were used for detection and measurement of targeted CYP expres-
sion. In all gels, a LI-COR Chameleon Due Pre-Stained Protein Lad-
The percentage of cell viability was determined using Promega der (#928-60000) was included. The housekeeping protein
CellTiter-GloÒ assay (Madison, WI) according to the manufacturer’s glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used
instructions. Briefly, the HepG2 cells were seeded at a density of as the loading control and was detected by Abcam (Cambridge,
4  103 cells per well. The untreated and treated cells were incu- UK) mouse monoclonal anti-GAPDH antibody (#ab9485).
363
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

Table 1 concentration 30 mg/ml to 2.3-fold. On the other hand, the soni-

Primer sequences used for CYP gene expression monitoring using RT-qPCR. cated extracts had similar mean values of 2.5-fold and spiked to
Gene Forward Reverse 3.5-fold at 30 mg/ml. The positive inducer, rifampicin, increased
2C8 CCCTTTGGAAGTGGACCCAG ACGGTGCCATCCCTTGACTC the gene expression of CYP 2C8 up to 4.0-fold change. Fig. 3b dis-
2C9 CACCCAGAGGTCACAGCTAAAGT CATGTGGCTCCTATCCTGCAT plays the most representative Western blot results, which show
2C19 TGCTCTCCTTCTCCTGCTGAAG TGCCAACGACACGTTCAATC increased CYP 2C8 protein expression in HepG2 cells treated with
3A4 CAGGAGGAAATTGATGCAGTTTT GTCAAGATACTCCATCTGTAGCACAGT 1 and 15 mg/ml of boiled aqueous extracts and in HepG2 cells trea-
b- actin CTGGCACCCAGCACAATG
GCCGATCCACACGGAGTACT
ted with 30 mg/ml of sonicated aqueous extracts.
Fig. 4a displays the effect of C. myrrha aqueous extracts on CYP
2C9 gene expression levels in HepG2 cells. Both selected boiled and
sonicated aqueous extracts stimulated the expression of CYP 2C9
2.13. Data analysis gene at levels exceeding 2.0-fold in comparison to the basal
expression level monitored in untreated cells. At the lowest con-
The cytotoxicity values were estimated based on the plotting of centration of boiled aqueous extract (1 lg/ml), CYP 2C9 gene
common log (log10) values of dry extract weight of C. myrrha versus expression level trended to increase by 3.0-fold followed by a
percentage inhibition of untreated control using the log-inhibition descending decrease at higher concentrations. Concerning
variable-slop (four-parameter) model in Prism GraphPad (San sonicated aqueous extracts, only one concentration at 30 mg/ml
Diego, CA) software version 5.04. For data generated using RT- stimulated CYP 2C9 gene expression with more than 2.0-fold
qPCR, the gene expression values were normalized to b-actin and increase. Fig. 4b shows that extracts upregulated CYP 2C9 protein
considered to be positive for induction or suppression if exceeding expression, which confirmed their stimulatory effect at the gene
the two-fold relative to untreated control (i.e., 0.5 or 2.0-fold cut- expression level observed in Fig. 4a. In comparison with the basal
off) (USFDA, 2020). The results are expressed as mean ± standard expression level detected in the untreated cells, an induction of
deviation from a minimum of three independent cell culture CYP 2C9 protein expression level was observed in all treatments
experiments. For Western blot analysis, the protein expression and especially in cells treated with boiled aqueous extracts tested
level detected in treated cells was related to the basal protein at 1 and 15 lg/ml and sonicated extract tested at 30 lg/ml.
expression level detected in untreated cells using ImageJ software Fig. 5a displays the effect of C. myrrha aqueous extracts on CYP
(http://rsbweb.nih.gov/ij/index.html). 2C19 gene expression levels in HepG2 cells. Both boiled and soni-
cated extracts induced CYP 2C19 gene expression at levels exceed-
ing 2.0-fold in comparison to untreated cells. The CYP 2C19 gene
3. Results
expression level was concomitantly increased by 4.4-fold after cell
exposure to 15 mg/ml of boiled extracts. Fig. 5b displays the effects
3.1. Chemical fingerprint analysis of boiled and sonicated aqueous
of C. myrrha aqueous extracts on CYP 2C19 protein expression,
extracts of C. myrrha resins and their cytotoxic effects on HepG2 cells
which aligned with the observed effects on gene expression level
presented in Fig. 5a. In comparison with the basal protein expres-
In this study, we investigated whether the boiled and sonicated
sion level detected in untreated cells, the CYP 2C19 protein expres-
aqueous C. myrrha resin extracts could modulate the gene expres-
sion was induced in all cell treatments, especially in HepG2 cells
sion of CYP isoenzymes in HepG2 cells. We firstly performed the
exposed to boiling extracts tested at 15 and 30 mg/ml and sonicated
fingerprinting of the two extracts and noticed different chro-
extract, tested at 30 mg/ml concentrations.
matograms, indicating possible differences in their potential mod-
Fig. 6a displays the effect of C. myrrha aqueous extracts on the
ulation effects on CYP isoenzyme gene expression (Fig. 1). Prior cell
CYP 3A4 expression levels monitored in HepG2 cells. Unlike the
treatment, we determined the bacterial endotoxin levels in both C.
previous isoenzymes, only the gene expression level of CYP 3A4
myrrha aqueous extracts. Low endotoxin levels were detected in
isoenzyme exceeded the two-fold cutoff when the cells were
both boiled and sonicated extracts and corresponding to 1.47 and
exposed to 30 lg/ml of C. myrrha aqueous sonicated extracts, in
2.09 Endotoxin Unit (EU)/ml, respectively. To determine the C.
comparison to untreated cells. The CYP 3A4 gene expression level
myrrha aqueous extracts concentrations resulting in HepG2 cyto-
monitored in HepG2 cells exposed to the boiled aqueous extracts
toxicity, we assessed the viability of HepG2 cells at different con-
tested at 1 and 15 mg/ml were slightly below the cutoff value set
centrations of C. myrrha aqueous extracts. Compared with the
at two-fold. Fig. 6b displays the effects of both extracts on CYP
high viability of untreated cells, cell viability decreased by 20 per-
3A4 protein expression levels, which aligned with the variations
cent (IC20) after HepG2 cell exposure to concentrations determined
of gene expression levels shown in Fig. 6a. In comparison with
at 183.8 and 632.0 mg/ml for sonicated and boiled aqueous
the basal expression level detected in untreated cells, the CYP
extracts, respectively (Fig. 2). Half-maximum inhibitory concentra-
3A4 protein expression level was induced in all cell treatments
tions (IC50) on HepG2 cell viability were determined at 467.9 and
used, and especially in HepG2 cells exposed to either sonicated
1066.0 lg/ml of sonicated and boiled extracts, respectively
or boiled extracts tested at 30 lg/ml.
(Fig. 2). Based on cytotoxic concentrations of both C. myrrha aque-
ous extracts, further biological investigation was performed by
treating HepG2 cells with non-toxic concentrations of each extract,
4. Discussion
tested at 1, 15, and 30 mg/ml.
We demonstrated in this current study the induction of the
3.2. Modulatory effects of boiled and sonicated aqueous extracts of C. expression of the main phase-I drug-metabolizing CYP isoenzymes
myrrha resins on CYP gene and protein expression in human hepatocellular carcinoma HepG2 cell line exposed to C.
myrrha resins, which may affect the drug metabolism of conven-
Fig. 3a displays the effects of C. myrrha resin aqueous extracts tional prescribed regimens. We chose these CYP isoenzymes as
on CYP 2C8 gene expression in HepG2 cells. Both sonicated and they present the key isoenzymes that are involved in the metabo-
boiled extracts increased mean gene expression ranging from 2.3 lism of more than 60 percent of CYP-mediated clinical pharmaceu-
to 3.5-fold change. The boiled concentrations at 1 and 15 mg/ml tical drugs including those with narrow therapeutic indices such as
shows mean values just below 3.0-fold and lowered at S-warfarin, S-mephenytoin, cyclosporine, sirolimus, and tacroli-
364
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

Fig. 1. Comparative fingerprinting chromatograms for boiled and sonicated aqueous extracts of C. myrrha resins using HPLC with UVD detector set at 275 nm without
reference.

interfere with CYP expression levels (Shedlofsky et al., 1994). How-

ever, the acceptable level of endotoxins in mammalian cell culture
is not firmly established and varies among cell types and laborato-
ries. In one study, Epstein et al. (1990) exposed several common
cell lines with several endotoxin concentrations up to 100 EU/ml
and found minimal effects on cell proliferation, thus establishing < 5
EU/ml as a conservative acceptable level for endotoxin contamina-
tion in cell culture. Based on this conservative level, the C. myrrha
extracts in this study are considered acceptable for cell culture
considering that these extracts were further diluted twice, in
preparation of extract concentration serial dilutions and final cell
treatment dilution reaching an estimated maximum endotoxin
contamination at 0.003 EU/ml at final cell treatment concentration
for both C. myrrh aqueous extracts. Based on this final maximum
endotoxin concentration, we found it unnecessary to include an
Fig. 2. Variation of the viability of HepG2 cells at different treatment concentra- endotoxin removal step prior HepG2 cell culture for the two aque-
tions of C. myrrha resins boiled and sonicated aqueous extracts. Each data point ous extracts.
represents the mean and standard deviation based on minimum three individual
The cytotoxicity of C. myrrha extracts on HepG2 cells was per-
cell treatment. The above bar indicates the range of C. myrrha concentrations used
in HepG2 cell treatments. formed to determine the range of concentrations to be used for
drug-metabolizing CYP isoenzyme expression analysis. The con-
centrations of C. myrrha selected for HepG2 cell treatment are
mus (Rendic and Di Carlo, 1997). We performed the extractions much below the measured IC20 by approximately 2.0 or 4.0-fold
using sonicated and boiled water methods resembling the local for sonicated and boiled C. myrrha aqueous extracts, respectively.
traditional preparation methods of maceration and decoction, The difference in their cytotoxicity reflects the HPLC-UVD-based
respectively. Prior to cell treatment, we determined the levels of fingerprinting, suggesting that the heat-sensitive chemicals could
endotoxin contamination and the cytotoxicity of C. myrrha on increase the cytotoxic potency of C. myrrha sonicated aqueous
HepG2 cells to select the concentrations for cell treatment and sub- extract on HepG2 cells by approximately a factor of 2.0-fold in
sequent CYP gene and protein expression studies. It should be comparison to the boiled extract. Based on the relatively low cyto-
noted that we chose a 2-day treatment with replenishment of toxic effects of C. myrrha resin extracts on HepG2 cell viability, we
treatment after 24 h to mimic the real-life therapy situation as this chose the range of treatment concentrations from 1 to 50 mg/ml,
traditional medicine is typically consumed for several days (Duke, which is considered clinically relevant taken note that the typical
2002). dosage is 3–5 g per day for several days (Duke, 2002). It is worth
The levels of endotoxins in aqueous extracts were measured mentioning that we have also determined the IC50 value for a
prior use in experiments as endotoxins (20 EU/kg body weight) methanolic extract of C. myrrha resin on HepG2 cells at 29.9 ± 5.
are shown to inhibit CYP isoenzymes levels in volunteers; thus, 7 mg/ml which is much potent than the sonicated C. myrrha aque-

365
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

Fig. 3. (a) Modulation effects of boiled and sonicated aqueous extracts of C. myrrha
resins on gene expression of CYP 2C8 isoenzyme. Minimum of three independent
cell treatments were performed for each C. myrrha resin extract concentration.
Rifampicin tested at three different concentrations (0.1, 1, and 10 mM) was used as a
positive control. Dotted-line represents the upregulation cutoff level of 2.0-fold. (b)
Representative Western blots showing the effects of different C. myrrha boiled and
sonicated extract concentrations (1, 15, and 30 mg/ml) on the protein expression of
CYP 2C8 isoenzyme in HepG2 cells. GAPDH was used as a loading control.

ous extract despite showing similar fingerprinting chromatograms

at 275 nm absorbance (unpublished data). This finding supports Fig. 4. (a) Modulation effects of boiled and sonicated aqueous extracts of C. myrrha
resins on gene expression of CYP 2C9 isoenzyme. Minimum of three independent
the approach that research on safety use of natural health products
cell treatments were performed for each C. myrrha resin extract concentration.
should be performed using extraction methods resembling com- Dotted-line represents the up-regulation cutoff level of 2.0-fold. (b) Representative
mon traditional preparations prepared by consumers. Western blots showing the effects of different C. myrrha boiled and sonicated
Based on the United States Food and Drug Administration extract concentrations (1, 15, and 30 mg/ml) on the protein expression of CYP 2C9
isoenzyme in HepG2 cells. Rifampicin tested at four different concentrations (0.001,
Industry Guidelines for Drug Interaction Studies, rifampicin tested
0.01, 1, and 10 mM) was used as a positive control. GAPDH was used as a loading
at 10 mM should be performed in CYP 2C and 3A-related induction control.
studies and used as a positive control for CYP expression stimula-
tion (USFDA, 2012). In this study, we have tested increasing con-
centrations of rifampicin to demonstrate dose-dependency and to Previous studies involving C. myrrha resins and 2C/3A isoen-
compare its induction effects with established CYP expression zyme expression and activity have been reported although very
induction values reported in the industry guidelines. The induction limited. For CYP 2C9, Al Faraj (2005) reported a clinical case for a
of CYP gene expression in HepG2 cells by rifampicin in this study is patient that consumed C. myrrha resin along with warfarin and
comparable to those previously published in the guidelines. The noticed significant decrease in anti-coagulant coagulantactivity
typical induction of CYP gene expression for CYP 2C8, 2C9, 2C19, which suggest induced CYP 2C9 expression as one possible reason.
and 3A4 isoenzymes at 10 mM treatment concentration are approx- This study agrees with the aforementioned clinical report as the
imately 2.0–4.0, 4.0, 20.0, and 4.0-fold, respectively (USFDA, 2012). lowest concentration of C. myrrha resin extract (i.e., 1.0 mg/ml) is
We used lower rifampicin concentrations and observed a similar shown to strongly induce CYP 2C9 expression at both transcrip-
trend with CYP 2C19 showing the highest induction expression tional and protein levels (Fig. 4) in this study. For CYP 3A,
reaching 13.6-fold in one experiment. Despite the low induction Al-Jenoobi et al. (2015) measured the bioavailability of cyclosporin
of CYP 2C9 expression observed at the transcriptional level, rifam- A, a substrate for CYP 3A4, before and after an eight-day-treatment
picin clearly upregulated CYP 2C9 protein expression in HepG2 with C. myrrha resin (60 mg/kg) in rats. They found the bioavail-
cells, when tested at all concentrations and especially at 0.001 ability has significantly decreased by 45 percent which suggest
and 0.01 mM concentrations, suggesting a positive regulatory sys- induction of in vivo CYP 3A isoenzyme activity which agrees with
tem prompting CYP 2C9 expression at the translational level. our results despite the known differences between rat and human
equivalent CYP isoenzymes (Graham and Lake, 2008; Martignoni

366
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

Fig. 5. (a) Modulation effects of boiled and sonicated aqueous extracts of C. myrrha
resins on gene expression of CYP 2C19 isoenzyme. Minimum of three independent Fig. 6. (a) Modulation effects of boiled and sonicated aqueous extracts of C. myrrha
cell treatments were performed for each C. myrrha resin extract concentration. resins on gene expression of CYP 3A4 isoenzyme. Minimum of three independent
Rifampicin tested at three different concentrations (0.1, 1, and 10 mM) was used as a cell treatments were performed for each C. myrrha resin extract concentration.
positive control. Dotted-line represents the up-regulation cutoff level of 2.0-fold. (b) Rifampicin tested at three different concentrations (1, 10, and 50 mM) was used as a
Representative Western blots showing the effects of different C. myrrha boiled and positive control. Dotted-line represents the up-regulation cutoff level of 2.0-fold. (b)
sonicated resin extract concentrations (1, 15, and 30 mg/ml) on the protein Representative Western blots showing the effects of different C. myrrha boiled and
expression of CYP 2C19 isoenzyme in HepG2 cells. GAPDH was used as a loading sonicated resin extract concentrations (1, 15, and 30 mg/ml) on the protein
control. expression of CYP 3A4 isoenzyme in HepG2 cells. GAPDH was used as a loading
control.

et al., 2006). Interestingly, Zhou et al. (2011) administrated mice 5. Conclusion

with a single high dose of C. myrrha plus olibanum oil (~3 g/kg)
and found the in vivo activity for CYP 3A4 isoenzyme was not sig- This is the first study to report the modulation effects of C. myr-
nificantly affected, which indicated that C. myrrha resin con- rha resin extracts on major phase-I metabolic isoenzyme (i.e., CYP
stituents are not potent inactivators to CYP 3A isoenzyme. Thus, 2C8, 2C9, 2C19, and 3A4) expressions at transcriptional and trans-
suggesting the induction might be a result of C. myrrha con- lational levels using a human liver carcinoma cell line. The results
stituent(s) binding to the pregnane X receptor and not to CYP suggest highly-possible herb-drug interaction occurrences regard-
3A4 replenishment due to CYP 3A4 destruction. So far, no previous less of preparation method and could be used to predict clinical
studies involving the remaining CYP isoenzymes (i.e., CYP 2C8 and drug adverse-effects especially for CYP 2C isoenzyme drug sub-
2C19) and C. myrrha resins have been found. strates. Further in vitro and human studies are needed to investi-
Despite the evidence of induction at both transcriptional and gate the effects of C. myrrha resin on phase-I and II isoenzymes
translational levels, the in vivo situation can be completely differ- to complete the safety profile for this popular traditional medicine.
ent. Several pharmacokinetic factors including gastric digestion
of extract, gut absorption of phytochemicals, and first-pass effect
in humans are not accounted in this present study. The role of Funding
in vivo chemical interactions among C. myrrha phytochemicals
should also be investigated. Worth mentioning is the natural vari- This work was fully funded by King Abdullah International
ation of phytochemicals in C. myrrha resin which might be differ- Medical Research Center under grant number RC17/093/R.
ent based on harvest location, processing method, and storage
condition. Thus, the modulation effect might be stronger from
the lot used in this study. Nevertheless, this study cautions Authors contributions
patients and health care providers for concomitant consumption
of C. myrrha resin and drugs mainly metabolized by CYP 2C8, ZA conceived and conducted the study. GA, AN, AA, HA, MA, EH,
2C9, 2C19, and 3A4 isoenzymes. and NA carried out the experiments, collected the data, analyzed
367
Z. Alehaideb, G. Alatar, A. Nehdi et al. Saudi Pharmaceutical Journal 29 (2021) 361–368

the data and reviewed the manuscript. ZA and SMN interpreted the Epstein, J., Lee, M.M., Kelly, C.E., Donahoe, P.K., 1990. Effect of E. coli endotoxin on
mammalian cell growth and recombinant protein production. Vitro Cell. Dev.
data and wrote the manuscript.
Biol. 26, 1121–1122.
Gerets, H.H.J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B.O., Dhalluin, S.,
Declaration of Competing Interest Atienzar, F.A., 2012. Characterization of primary human hepatocytes, HepG2
cells, and HepaRG cells at the mRNA level and CYP activity in response to
inducers and their predictivity for the detection of human hepatotoxins. Cell
The authors declare that they have no known competing finan- Biol. Toxicol. 28, 69–87.
cial interests or personal relationships that could have appeared Graham, M.J., Lake, B.G., 2008. Induction of drug metabolism: species differences
to influence the work reported in this paper. and toxicological relevance. Toxicology 254, 184–191.
Guo, L., Dial, S., Shi, L., Branham, W., Liu, J., Fang, J.L., Green, B., Deng, H., Kaput, J.,
Ning, B., 2011. Similarities and differences in the expression of drug-
Acknowledgements metabolizing enzymes between human hepatic cell lines and primary human
hepatocytes. Drug Metab. Dispos. 39, 528–538.
Jazieh, A.R., Al Sudairy, R., Abulkhair, O., Alaskar, A., Al Safi, F., Sheblaq, N., Young, S.,
The authors wish to express greatest gratitude to Dr. Ahmed Al- Issa, M., Tamim, H., 2012. Use of complementary and alternative medicine by
Qahtani, from King Faisal Specialist Hospital and Research Center, patients with cancer in Saudi Arabia. J. Altern. Complement. Med. 18, 1045–
for donating hepatoma HepG2 cells. 1049.
Marion, M.J., Hantz, O., Durantel, D., 2010. The HepaRG cell line: biological
properties and relevance as a tool for cell biology, drug metabolism, and
virology studies. Methods Mol. Biol. 640, 261–272.
References Martignoni, M., Groothuis, G.M.M., de Kanter, R., 2006. Species differences between
mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition
and induction. Expert Opin. Drug Metab. Toxicol. 2, 875–894.
Alanzi, A., Assiri, A., Aldayel, F., Allam, A., Bin-Bakheet, O., Alanzi, F., Alhaydhal, A., Meijerman, I., Beijnen, J.H., Schellens, J.H.M., 2006. Herb-drug interactions in
Alrasheed, L., 2016. Herbal medicine among Saudis: awareness, uses, reasons
oncology: focus on mechanisms of induction. Oncologist 11, 742–752.
and common herbs. Int. J. Res. Med. Sci. 1, 13–19. Rendic, S., Di Carlo, F.J., 1997. Human cytochrome P450 enzymes: a status report
Alehaideb, Z., AlGhamdi, S., Yahya, W.B., Al-Eidi, H., Alharbi, M., Alaujan, M., Albaz, summarizing their reactions, substrates, inducers, and inhibitors. Drug Metab.
A., Tukruni, M., Nehdi, A., Abdulla, M.H., Matou-Nasri, S., 2020. Anti-
Rev. 29, 413–580.
proliferative and pro-apoptotic effects of calligonum comosum (L’Her.) Sergent, T., Dupont, I., Van der Heiden, E., Scippo, M.L., Pussemier, L., Larondelle, Y.,
methanolic extract in human triple-negative MDA-MB-231 breast cancer
Schneider, Y.J., 2009. CYP1A1 and CYP3A4 modulation by dietary flavonoids in
cells. J. Evid. Integr. Med. 25. https://doi.org/10.1177/2515690X20978391. human intestinal Caco-2 cells. Toxicol. Lett. 191, 216–222.
PMID: 33302699. Shedlofsky, S.I., Israel, B.C., McClain, C.J., Hill, D.B., Blouin, R.A., 1994. Endotoxin
Al Faraj, S., 2005. Antagonism of the anticoagulant effect of warfarin caused by the administration to humans inhibits hepatic cytochrome P450-mediated drug
use of Commiphora molmol as an herbal medication: a case report. Ann. Trop. metabolism. J. Clin. Invest. 94, 2209–2214.
Med. Parasitol. 99, 219–220.
Shen, T., Li, G.H., Wang, X.N., Lou, H.X., 2012. The genus Commiphora: a review of its
Al-Faris, E.A., Al-Rowais, N., Mohamed, A.G., Al-Rukban, M.O., Al-Kurdi, A., Balla Al- traditional uses, phytochemistry and pharmacology. J. Ethnopharmacol. 142,
Noor, M.A., Al-Harby, S., Sheikh, A., 2008. Prevalence and pattern of alternative 319–330.
medicine use: the results of a household survey. Ann. Saudi Med. 28, 4–10. US Food and Drug Administration, 2012. Guidance for Industry: Drug Interaction
Al-Jenoobi, F.I., Alam, M.A., Al-Mohizea, A.M., Ahad, A., Raish, M., 2015. Orally co- Studies—Study Design, Data Analysis, Implications for Dosing, and Labeling
administrated oleo-gum resin of Commiphora myrrha decreases the
Recommendations. Center for Drug Evaluation and Research (CDER), pp. 1–75.
bioavailability of cyclosporine A in rats. Pharmazie 70, 549–552. US Food and Drug Administration, 2020. In vitro drug interaction studies-
Al Moamarym, M.S., 2008. Unconventional therapy use among asthma patients in a
cytochrome P450 enzyme-and transporter-mediated drug interactions:
tertiary care center in Riyadh, Saudi Arabia. Ann Thorac. Med. 3, 48–51. guidance for industry.
Al-Rowais, N.A., 2002. Herbal medicine in the treatment of diabetes mellitus. Saudi Wilkinson, G.R., 2005. Drug metabolism and variability among patients in drug
Med. J. 23, 1327–1331. response. N. Engl. J. Med. 352, 2211–2221.
Bhutya, R.K., 2011. Ayurvedic Medicinal Plants of India, vol. 1. Scientific Publishers. Wong, S., Doshi, U., Vuong, P., Liu, N., Tay, S., Le, H., Kosaka, M., Kenny, J.R., Li, A.P.,
Chandrasekharnath, N., Mahlakshmi, Y.V., Jayalakshmi, L., Venkanna, B., Uma, A.,
Yan, Z., 2018. Utility of pooled cryopreserved human enterocytes as an in vitro
2013. Screening and isolation of bioactive factors from Commiphora myrrha model for assessing intestinal clearance and drug-drug interactions. Drug
and evaluation of their antimicrobial activity. IJERA 3, 1291–1294 http://www. Metab. Lett. 12, 3–13.
ijera.com/papers/Vol3_issue2/HE3212911294.pdf. Zhou, K., Zhu, T.T., Ma, Z.H., Wang, A.H., 2011. Influence of olibanum and myrrha on
Duke, J.A., 2002. Handbook of Medicinal Herbs. CRC Press. activity of cytochrome P450. Chinese J. Exp. Tradit. Med. Formulae 22 (2011),
El Gendy, M.A.M., El-Kadi, A.O.S., 2009. Peganum harmala L. differentially
43.
modulates cytochrome P450 gene expression in human hepatoma HepG2
cells. Drug. Metab. Lett. 3, 212–216.

368