BioMG 2800 Lectures in Genetics and Genomics

Practice Prelim 2
Fall 2022

As the name implies, this Practice Prelim is an optional exercise for your own preparation. This
Practice Prelim is derived from a Prelim given in a previous semester.

We encourage you to complete this practice prelim as if it was you own exam. Simply looking
at the answer key loses the practice aspect.

©Department of Molecular Biology and Genetics Cornell University 1

Q1. Part of the double stranded DNA below encodes a small polypeptide, whose
sequence is listed below. A codon table is included on page 11 of this exam.
Met Tyr Trp Phe Arg Gln

5’ TTGAATGACGTATTATTGACGAAACCTGTACATTATTTATAAGTTAGG 3’
3’ AACTTACTGCATAATAACTGCTTTGGTCATGTAATAAATATTCAATCC 5’

1a. Indicate which strand is the coding / mRNA-like strand, top or bottom

1b. Design two primers, 6 bp long each, that can be used to PCR amplify only the
region highlighted in gray. Be sure to label the 5’ and 3’ ends of your primers.

5’ TTGAATGACGTATAATTGACGAAACCTGTACATTATTTATAAGTTAGG 3’
3’ AACTTACTGCATATTAACTGCTTTGGTCATGTAATAAATATTCAATCC 5’

©Department of Molecular Biology and Genetics Cornell University 2

Q2. A geneticist examined the amino acid (AA) sequence of a particular protein. The
following list shows 5 different AA substitutions the geneticist found at position 12, which
is a Threonine (Thr) in the wildtype protein. Each of these 5 mutants is a single base-
pair substitution mutation. A codon table is included on page 11 of this exam.

mutant 1 at position 12 Serine (Ser)

mutant 2 at position 12 Methionine (Met)
mutant 3 at position 12 Proline (Pro)
mutant 4 at position 12 Lysine (Lys)
mutant 5 at position 12 Alanine (Ala)

2a. Using a genetic code table and the above information, what is the
WT sequence for Threonine (Thr) at position 12? Include polarity in
your answer. If more than one possibility exists, list all possibilities.

2b. Which of these mutant(s) (1-5) would be capable of recombination with mutant 1 to
form a wild-type gene? List all possible mutants.

The sequence of the wildtype polypeptide at the C-terminal end is shown below.
Arginine (Arg) 141 is the last amino acid in the wildtype protein. A deletion in the third
base in the codon for amino acid 138 causes the below mutant protein to be made.
position: 137 138 139 140 141
WT protein: thr ser lys tyr arg
position: 137 138 139 140 141 142 143 144 145 146
mut protein: thr ser asn thr val lys leu glu pro arg

2c. Explain, in 1 concise sentence, how the deletion of a base pair can result in the
synthesis of a longer polypeptide.

2d. Describe, in 1 concise sentence, one way the deletion mutation could be
suppressed by another mutation.

©Department of Molecular Biology and Genetics Cornell University 3

Q3. Plasmid Vector 1 is cleaved completely by the restriction enzyme BamHI, which
recognizes only one site in the vector.
Plasmid Vector 2 is cleaved
completely by the restriction
enzyme UghI, which recognizes
only one site in the vector.
Human DNA is cleaved
completely by the restriction
enzyme MboI, which recognizes
many sites in the human genome.

“^”indicates the cut sites.

3a. The probability that a restriction site in the human genome for MboI can also be
cleaved by BamHI is: (Give your answer as a fraction or whole number).

3b. The probability that a restriction site in the human genome for MboI can also be
cleaved by UghI is: (Give your answer as a fraction or whole number).

3c. You wish to clone a MboI cut fragment of the human DNA into a plasmid vector.
Indicate which plasmid vector will work for this cloning. Choose 1 answer from the list
below by placing an X in the box to the left of your answer choice.

Vector 1 only
Vector 2 only
Either Vector 1 or Vector 2
Neither will work

©Department of Molecular Biology and Genetics Cornell University 4

Q4. Bacteriophage P22 is a generalized transducing phage that grows on Salmonella.
Recall that transduction is the horizontal transfer of bacterial genes between bacteria
that is mediated by bacteriophage. Transduction can be used to map the bacterial
chromosome.
You grow P22 on wild-type bacteria (pro+ lac+ and his+). You then use the
resulting phage to infect a recipient strain that has pro-, lac- and his- mutations.
pro abbreviates the amino acid proline, his abbreviates the amino acid histidine, lac
abbreviates the sugar lactose.

You first select for pro+ transductants. You have selected and found 1000 pro+
transductants. You then test these pro+ cells on several selective media by replica
plating and identify the following genotypes.

Genotype Number of transductions

pro+ lac- his- 585
pro+ lac- his+ 300
pro+ lac+ his+ 114
pro+ lac+ his- 1

4a. What is the order of the three markers?

pro lac his

pro his lac

lac pro his

cannot be determined from the above information.

4b. How many crossovers occurred to produce the 1 pro+ lac+ his- transductant seen?

©Department of Molecular Biology and Genetics Cornell University 5

Q5. The figure below shows a pedigree for a rare, fully penetrant autosomal dominant
disease, where the individuals were genotyped for a SNP marker using allele-specific
oligonucleotides (ASOs). The ASO arrays for each generation are shown below the
pedigree. Except for individual II-9, whom you forgot to genotype.

5a. Although you forgot to genotype individual II-9, you can use the pedigree to infer
some genotypic information. Based on the pedigree, what are all possible genotypes at
the SNP marker for II-9?

5b. Based on the pedigree presented do the data suggest the existence of genetics
linkage between the SNP and disease locus for this pedigree? If so, what is the
estimated genetic distance between the two loci in map units? Assume that no data are
available for II-9 genotype, regardless of your answer above. Do not worry about LOD
scores for this question.

©Department of Molecular Biology and Genetics Cornell University 6

Q6. In a species of beetle, the eye phenotype "star" is caused by recessive mutation(s)
mapping to one location on the second chromosome.
Six independently induced star mutations are each made homozygous and the six
are intercrossed to study complementation at the star region. The results follow, where
+ indicates wildtype eye phenotype and s indicates the star eye phenotype.

1 2 3 4 5 6
1 s + s s + +
2 s s + s +
3 s s s +
4 s + +
5 s +
6 s

6a. In the following box, indicate how many different complementation groups are at the
star region. Group allelic mutations using parentheses. For example: (x, y, z) (r, s)
where the letters indicate different mutations within each complementation group; in
your answers the mutations will be numbers. Note that mutations belonging to more
than one complementation group should be included in your answer for each
complementation group.

Gametes from each of beetles in the above complementation table were genotyped.
The data below indicate whether wildtype star+ recombinant gametes are identified.
Here, + indicates a wildtype star+ gamete and s indicates a star mutant gamete.

1 2 3 4 5 6
1 s + + s + +
2 s + + + +
3 s s s +
4 s + +
5 s +
6 s

Using the information from both data tables, create a map of the star region on the next
page.

©Department of Molecular Biology and Genetics Cornell University 7

6b. Based on these data, draw a possible map showing the positions of the mutations
relative to each other and to the boundaries of the complementation groups you
identified above. Use the following conventions: show deletions as open rectangles,
point mutations as vertical tick marks, and the boundaries of the complementation
groups by larger rounded brackets. For ambiguities in mutation order, using { } brackets.
See the following example picture as a guide:

Map of star region:

©Department of Molecular Biology and Genetics Cornell University 8

Q7. A series of five independent mutations (1-5) were isolated in an organism. Each
mutation was supplemented with a variety of compounds (A-E), with the results seen
below. “+” indicates the mutant can grow, “-“ indicates the mutant cannot.

Compound
Mut A B C D E B&E
1 - + - - - +
2 - - - + - +
3 - - - - + +
4 - - + + - +
5 + - + + - +

7a.Show the best possible biosynthetic pathway for these compounds in this organism.
Remember to include the positions of the mutations.

7b. Which compound(s) (A-E) will be accumulated in the following mutants. Note that
“Mutants 1 & 3” and “Mutants 2 & 4” indicate double mutant strains.

Mutant 1

Mutants 1 & 3

Mutants 2 & 4

©Department of Molecular Biology and Genetics Cornell University 9

©Department of Molecular Biology and Genetics Cornell University 10