Advanced Technologies

for Meat Processing

Advanced Technologies
for Meat Processing
Second Edition

Edited by
Fidel Toldrá and Leo M. L. Nollet
CRC Press
Taylor & Francis Group
6000 Broken Sound Parkway NW, Suite 300
Boca Raton, FL 33487-2742

© 2018 by Taylor & Francis Group, LLC

CRC Press is an imprint of Taylor & Francis Group, an Informa business

No claim to original U.S. Government works

Printed on acid-free paper

International Standard Book Number-13: 978-1-4987-5459-0 (Hardback)

This book contains information obtained from authentic and highly regarded sources. Reasonable efforts
have been made to publish reliable data and information, but the author and publisher cannot assume
responsibility for the validity of all materials or the consequences of their use. The authors and publishers
have attempted to trace the copyright holders of all material reproduced in this publication and apologize to
copyright holders if permission to publish in this form has not been obtained. If any copyright material has
not been acknowledged please write and let us know so we may rectify in any future reprint.

Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced,
transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter
invented, including photocopying, microfilming, and recording, or in any information storage or retrieval
system, without written permission from the publishers.

For permission to photocopy or use material electronically from this work, please access www.copyright.
com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood
Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and
registration for a variety of users. For organizations that have been granted a photocopy license by the CCC,
a separate system of payment has been arranged.

Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used
only for identification and explanation without intent to infringe.

Visit the Taylor & Francis Web site at

http://www.taylorandfrancis.com

and the CRC Press Web site at

http://www.crcpress.com
Contents

Preface .................................................................................................................... vii

About the Editors ...................................................................................................ix
Contributors ......................................................................................................... xiii

1. Genetically Modified Farm Animals: Control and Traceability...........1

Antoon Lievens and Mauro Petrillo

2. Hyperspectral Imaging Technique for Online Monitoring of

Meat Quality and Safety ............................................................................. 17
Jun-Li Xu and Da-Wen Sun

3. Raman Spectroscopy for Predicting Meat Quality Traits ....................83

Stephanie M. Fowler, Heinar Schmidt, Rico Scheier, and David L. Hopkins

4. Real-Time PCR for the Detection of Pathogens in Meat and

Meat Products .............................................................................................. 113
Alicia Rodríguez, María J. Andrade, Mar Rodríguez, and Juan J. Córdoba

5. Sensors and Biosensors for Meat Safety: Recent Advances in

Nanotechnology Integration .................................................................... 153
Rosa Pilolli, Nicoletta Ditaranto, and Linda Monaci

6. Meat Decontamination by Irradiation ................................................... 197

Dong U. Ahn, Eun Joo Lee, and Aubrey Mendonca

7. Advances in High Hydrostatic Pressure for Meat and Meat

Processing .................................................................................................. 227
Sencer Buzrul

8. Hydrodynamic Pressure Processing to Improve Meat Quality

and Safety..................................................................................................... 259
Tomás Bolumar and Stefan Toepfl

9. Emerging Technologies for the Meat Processing Industry ................ 297

Kumari Shikha Ojha, Joseph P. Kerry, and Brijesh K. Tiwari

10. Reduction of Contaminant’ Content in Processed Meats .................. 319

Peter Šimko

v
vi Contents

11. Nutrigenomics in Food-Producing Animals......................................... 355

Werner G. Bergen

12. Bioactive Properties of Peptides Generated from Meat Proteins ..... 371
Keizo Arihara and Yusuke Komiya

13. New Approaches for the Development of Functional Meat

Products ........................................................................................................ 403
Francisco Jiménez-Colmenero, Milagro Reig, and Fidel Toldrá

14. Salt Reduction in Processed Meats .........................................................443

Fidel Toldrá and José M. Barat

15. Fat Reduction in Processed Meats ........................................................... 461

Marise A. Rodrigues Pollonio

16. Processing of Nitrite-Free Cured Meats ................................................ 513

Fereidoon Shahidi and Ronald B. Pegg

17. Proteomic Tools for Improved Processing of Dry-Cured Meats ...... 535
Leticia Mora and Fidel Toldrá

18. The Use of Bacteriocins against Meat-borne Pathogens .................... 559

Carmen A. Campos, Marcela P. Castro, María E. Cayre, and Franco P. Rivas

19. Functionalities of Meat Bacterial Starters ............................................. 597

Régine Talon and Sabine Leroy

20. Modified Atmosphere Packaging ............................................................ 615

Joseph G. Sebranek and Terry A. Houser

21. Nanotechnology-Based Packaging Materials for Fresh and

Processed Meats .......................................................................................... 647
Brandon Guild, Hans Bernard Tee, and Loong-Tak Lim

Index ..................................................................................................................... 689

Preface

Meat and meat products constitute some of the most important foods in
Western societies and their presence is also increasing very rapidly in the
Asian countries. The processing technology has been developing very fast
over the last decade, as can be observed in the number of publications, which
is growing exponentially year by year. The meat industry is progressively
incorporating such technological advances and it is evident that an updated
compilation of these recent developments is really needed by meat scientists
and technologists.
The first edition of this book dates back to 2006 and the contents were
spread throughout 18 chapters. The second edition brings 21 chapters with
new approaches to a dynamic field, combining updated and revised versions
of several chapters with new chapters dealing with new online monitoring
techniques such as hyperspectral imaging and Raman spectroscopy, the use
of nanotechnology for sensor devices or new packaging materials, and the
application of omics technologies such as nutrigenomics and proteomics for
meat quality and nutrition.
The main goal of this book is to provide the reader with recent develop-
ments in new advanced technologies for the full meat processing chain. The
book starts with the control and traceability of genetically modified farm
animals, followed by four chapters reporting the use of online nondestruc-
tive monitoring techniques such as hyperspectral imaging and Raman spec-
troscopy, real-time polymerase chain reaction for pathogen detection, and
nanotechnology-based sensors. Then, the following five chapters describe
different advanced technologies for meat decontamination, such as irradia-
tion, hydrostatic and hydrodynamic pressure processing, other nonthermal
technologies, and reduction in contaminant generation. One chapter covers
nutrigenomics in animal nutrition and production, and this is followed by
six chapters dealing with nutrition-related issues such as bioactive peptides,
functional meats, fat and salt reduction, processing of nitrite-free products,
and the use of proteomics for the improved processing of dry-cured meats.
The last four chapters report the latest developments in bacteriocins against
meat-borne pathogens, the functionality of bacterial starters, modified atmo-
sphere packaging, and the use of new nanotechnology-based materials for
intelligent and edible packaging.
This book is written by distinguished international contributors with
recognized expertise and strong reputations, and brings together all the
advances in varied and different technologies such as biotechnology, hyper-
spectral imaging and Raman spectroscopy, nanotechnology, decontami-
nation technologies, omics technologies, and packaging for application in
different stages of meat processing.

vii
viii Preface

We would like to thank very cordially all the authors of this book for all
their efforts and for sharing their knowledge on these different topics, as
well as the production team at CRC Press for their dedication to the publica-
tion of this new edition.
About the Editors

Fidel Toldrá obtained his BSc in chemistry (1980) and PhD in chemistry (1984)
from the University of Valencia. Since 2001, he has been a research professor
and head of the Laboratory of Biochemistry, Innovation, and Technology of
Meat and Meat Products at the Instituto de Agroquímica y Tecnología de
Alimentos, in Paterna, Valencia, Spain.
He has filed 11 patents and directed 24 PhD theses and is currently direct-
ing one PhD theses. He has published over 270 manuscripts in worldwide
recognized scientific journals and 120 book chapters. His work is quite cited
(>700 citations in 2016) and he holds an h-index of 47.
Prof. Toldrá has received numerous awards such as the 1992 Iber Award
on food and cardiovascular diseases; the 2001 Danone Institute Award to
the best scientific trajectory within the last 10 years in food, nutrition, and
health; the 2002 International Prize for meat science and technology from the
International Meat Secretariat, Paris, France; the 2002 GEA Award on R&D
activity in agro-food in the Valencia community; the 2010 Distinguished
Research Award and the 2014 Meat Processing Award, both from the
American Meat Science Association; and the 2015 Dupont Science Award. In
2008, he was elected as a fellow of the International Academy of Food Science
and Technology in Shanghai, China; in 2009, he was elected as a fellow of the
Institute of Food Technologists.
Prof. Toldrá is the European editor of Trends in Food Science and Technology
(Elsevier, since 2005) and an associate editor of Meat Science (Elsevier, since
2014); he was editor-in-chief of Current Nutrition and Food Science (Bentham,
2005–2012) and section editor of the Journal of Muscle Foods (Wiley-Blackwell,
2009–2010). He is a member of the Editorial Boards of Food Chemistry
(Elsevier, since 1999), Journal of Food Engineering (Elsevier, since 2011),
Journal of Muscle Foods (Wiley-Blackwell, 2001–2010), Food Analytical Methods
(Springer, since 2008), Journal of Food and Nutrition Research (VUP, since 2008),
The Open Nutrition Journal (Bentham, since 2008), The Open Enzyme Inhibition
Journal (Bentham, since 2008), Recent Patents in Agriculture, Food and Nutrition
(Bentham, since 2009), Food Science and Nutrition (Wiley, since 2012), and
Current Opinion in Food Science (Elsevier, since 2014).
In 2002, he authored a book entitled Dry-Cured Meat Products (Wiley-
Blackwell) and has worked as an editor or associate editor of numerous
books for major publishers, such as Springer, CRC Press, Wiley-Blackwell,
and Elsevier. He was an associate editor of the Handbook of Food and Beverage
Fermentation Technology and the Handbook of Food Science, Technology and
Engineering, both published by CRC Press (2004 and 2006, respectively),
Handbook of Food Product Manufacturing (John Wiley & Sons, 2007), and the
third edition of Food Biochemistry and Food Processing (Wiley-Blackwell, 2012).

ix
x About the Editors

In 2006, he coedited two books with Dr. Nollet: Advanced Technologies for Meat
Processing (CRC Press) and Advances in Food Diagnostics (Blackwell Publishing).
He was the editor of Meat Biotechnology (Springer, 2008) and Safety of Meat and
Processed Meat (2009, Springer), the editor-in-chief of first and second edi-
tions of the Handbook of Fermented Meat and Poultry (Wiley-Blackwell, 2007
and 2015), and editor of the Handbook of Meat Processing (Wiley-Blackwell,
2010). With Leo M. L. Nollet, he has published several books on food analysis
published by CRC Press: Handbook of Muscle Foods Analysis (2009), Handbook
of Processed Meats and Poultry Analysis (2009), Handbook of Seafood and Seafood
Products Analysis (2010), Handbook of Dairy Foods Analysis (2010), Handbook of
Analysis of Edible Animal By-Products (2011), Safety Analysis of Foods of Animal
Origin (2011), Sensory Analysis of Foods of Animal Origin (2011), Handbook of
Analysis of Active Ingredients in Functional Foods (2012), Food Analysis by HPLC
(2013), and the third edition of the Handbook of Food Analysis (2015). He also
coedited Proteomics in Foods: Principles and Applications for Springer (2013).
He is one of the three editors-in-chief of the Encyclopedia of Food and Health
with five volumes published by Academic Press/Elsevier (2016). He is the
editor of the eighth edition of the famous book Lawrie´s Meat Science pub-
lished by Woodhead/Elsevier (2017). Since 2016, he has been the editor of the
prestigious series of books entitled Advances in Food and Nutrition Research
(Academic Press/Elsevier).
Prof. Toldrá has been a member, by strict selection within the European
Union, for two mandates on the scientific panel on food additives (2003–2008)
and three mandates on the panel on flavorings, enzymes, processing aids,
and materials in contact with foods (2008–2015) of the European Food Safety
Authority where he was chairman of the Working Groups on Irradiation
(2009–2010), Processing Aids (2011–2014), and Enzymes (2010–2015). In 2008–
2009, he joined a group of Food and Agriculture Organization/World Health
Organization experts to evaluate chlorine-based disinfectants in the pro-
cessing of foods.

Leo M. L. Nollet obtained his MS (1973) and PhD (1978) in biology from the
Katholieke Universiteit Leuven, Belgium. He is an editor and associate edi-
tor of numerous books. He edited for M. Dekker, New York—now CRC Press
of Taylor & Francis—the first, second, and third editions of the books Food
Analysis by HPLC and Handbook of Food Analysis. The last edition is a two-
volume book. He also edited the Handbook of Water Analysis (first, second, and
third editions) and Chromatographic Analysis of the Environment, third edition
(CRC Press).
With Fidel Toldrá, he coedited two books published in 2006 and 2007:
Advanced Technologies for Meat Processing (CRC Press) and Advances in Food
Diagnostics (Blackwell Publishing—now Wiley). With M. Poschl, he coed-
ited the book Radionuclide Concentrations in Foods and the Environment, also
published in 2006 (CRC Press). Dr. Nollet has also coedited several books
with Y. H. Hui and other colleagues: Handbook of Food Product Manufacturing
About the Editors xi

(Wiley, 2007), Handbook of Food Science, Technology and Engineering (CRC

Press, 2005), Food Biochemistry and Food Processing (first and second editions;
Blackwell Publishing—now Wiley—2006 and 2012), and the Handbook of
Fruits and Vegetable Flavors (Wiley, 2010). In addition, he edited the Handbook
of Meat, Poultry and Seafood Quality, first and second editions (Blackwell
Publishing—now Wiley—2007 and 2012).
From 2008 to 2011, he published five volumes on animal product–related
books with Toldrá, namely, the Handbook of Muscle Foods Analysis, Handbook of
Processed Meats and Poultry Analysis, Handbook of Seafood and Seafood Products
Analysis, Handbook of Dairy Foods Analysis, and Handbook of Analysis of Edible
Animal By-Products. In 2011, also with Toldrá, he coedited two volumes for
CRC Press: Safety Analysis of Foods of Animal Origin and Sensory Analysis of
Foods of Animal Origin. In 2012, they both published the Handbook of Analysis
of Active Compounds in Functional Foods.
Dr. Nollet coedited, with Hamir Rathore, the books Handbook of Pesticides:
Methods of Pesticides Residues Analysis in 2009, Pesticides: Evaluation of
Environmental Pollution in 2012, and Biopesticides Handbook in 2015. Other
finished book projects include Food Allergens: Analysis, Instrumentation, and
Methods (with A. van Hengel, CRC Press, 2011) and Analysis of Endocrine
Compounds in Food (Wiley-Blackwell, 2011).
Dr. Nollet’s recent projects include Proteomics in Foods with Toldrá (Springer,
2013) and Transformation Products of Emerging Contaminants in the Environment:
Analysis, Processes, Occurrence, Effects and Risks with D. Lambropoulou
(Wiley, 2014). In the series Food Analysis and Properties, he edited Flow Injection
Analysis of Food Additives with C. Ruiz-Capillas (CRC Press, 2015) and Marine
Microorganisms: Extraction and Analysis of Bioactive Compounds (CRC Press, 2016).
Contributors

Dong U. Ahn Carmen A. Campos

Department of Animal Science Universidad de Buenos Aires
Iowa State University Facultad de Ciencias Exactas y
Ames, Iowa Naturales
Departamento de Industrias
María J. Andrade Buenos Aires, Argentina
Department of Veterinary Science,
and
Food Hygiene and Safety, Meat
and Meat Products Research CONICET
Institute Buenos Aires, Argentina
University of Extremadura
Cáceres, Spain Marcela P. Castro
Departamento de Ciencias Básicas y
Keizo Arihara Aplicadas
Laboratory of Food Science Laboratorio de Microbiología de
Kitasato University Alimentos
Towada-shi, Japan Universidad Nacional del Chaco
Austral
José M. Barat Presidencia Roque Sáenz Peña,
Departamento de Tecnología de Chaco, Argentina
Alimentos Consejo Nacional de Investigaciones
Universitat Politècnica de València Científicas y Técnicas (CONICET)
Valencia, Spain Buenos Aires, Argentina

Werner G. Bergen
Department of Animal Sciences María E. Cayre
Auburn University Departamento de Ciencias Básicas y
Auburn, Alabama Aplicadas
Laboratorio de Microbiología de
Tomás Bolumar Alimentos
Group of Food Structure, Meat Universidad Nacional del Chaco
Science Team Austral
CSIRO Agriculture and Food Presidencia Roque Sáenz Peña,
Queensland, Australia Argentina

Sencer Buzrul Juan J. Córdoba

Tütün ve Alkol Piyasası Düzenleme Food Hygiene and Safety, Meat and
Kurumu (TAPDK) Auditing Meat Products Research Institute
Department University of Extremadura
Ankara, Turkey Cáceres, Spain

xiii
xiv Contributors

Nicoletta Ditaranto Yusuke Komiya

Dipartimento di Chimica Laboratory of Food Science
Università degli Studi di Bari Aldo Kitasato University
Moro Towada-shi, Japan
Bari, Italy
Eun Joo Lee
Stephanie M. Fowler Department of Food and
NSW Department of Primary Nutrition
Industries University of Wisconsin-Stout
Centre for Sheep and Red Meat Menomonie, Wisconsin
Development
Cowra, Australia Sabine Leroy
INRA
Brandon Guild UR454 Microbiologie
Department of Food Science Centre de Recherche
University of Guelph Auvergne-Rhône-Alpes, France
Guelph, Ontario, Canada
Antoon Lievens
David L. Hopkins
European Commission
NSW Department of Primary
Joint Research Centre
Industries
Directorate F – Health, Consumers
Centre for Sheep and Red Meat
and Reference Materials
Development
Unit F4 – Fraud Detection and
Cowra, Australia
Prevention
Geel, Belgium
Terry A. Houser
Animal Sciences and Industry
Kansas State University Loong-Tak Lim
Manhattan, Kansas Department of Food Science
University of Guelph
Francisco Jiménez-Colmenero Guelph, Ontario, Canada
Products Department
Instituto de Ciencia y Tecnología Aubrey Mendonca
de Alimentos y Nutrición Department of Food Science and
(ICTAN-CSIC) Human Nutrition
Madrid, Spain Iowa State University
Ames, Iowa
Joseph P. Kerry
Food Packaging Group Linda Monaci
School of Food and Nutritional Istituto di Scienze delle Produzioni
Sciences Alimentari
University College Cork Consiglio Nazionale delle Ricerche
Cork, Ireland Bari, Italy
Contributors xv

Leticia Mora Franco P. Rivas

Department of Food Science Departamento de Ciencias Básicas y
Instituto de Agroquímica y Aplicadas
Tecnología de Alimentos (CSIC) Universidad Nacional del Chaco
Valencia, Spain Austral
Presidencia Roque Sáenz Peña,
Kumari Shikha Ojha Argentina and
Food Chemistry and Technology Consejo Nacional de Investigaciones
Department Científicas y Técnicas
Teagasc Food Research Centre Presidencia Roque Sáenz Peña,
Dublin, Ireland Argentina
Ronald B. Pegg
Alicia Rodríguez
Department of Food Science and
Food Hygiene and Safety, Meat
Technology
and Meat Products Research
University of Georgia
Institute
Athens, Georgia
University of Extremadura
Mauro Petrillo Cáceres, Spain
European Commission
Joint Research Centre Mar Rodríguez
Directorate F – Health, Consumers Food Hygiene and Safety, Meat and
and Reference Materials Meat Products Research Institute
Unit F7 – Knowledge for Health & University of Extremadura
Consumer Safety Cáceres, Spain
Ispra, Italy
Rico Scheier
Rosa Pilolli Department of Bioanalytical Science
Istituto di Scienze delle Produzioni and Food Analysis
Alimentari University of Bayreuth
Consiglio Nazionale delle Ricerche Kulmbach, Germany
Bari, Italy
Heinar Schmidt
Marise A. Rodrigues Pollonio
Department of Bioanalytical Science
Department of Food Technology
and Food Analysis
School of Food Engineering
University of Bayreuth
University of Campinas
Kulmbach, Germany
Campinas, Brazil

Milagro Reig Joseph G. Sebranek

Instituto de Ingeniería de Alimentos Animal Science and Food Science
para el Desarrollo and Human Nutrition
Universidad Politécnica de Valencia Iowa State University
Valencia, Spain Ames, Iowa
xvi Contributors

Fereidoon Shahidi Hans Bernard Tee

Department of Biochemistry Department of Food Science
Memorial University of University of Guelph
Newfoundland Guelph, Ontario, Canada
St. John’s, Newfoundland, Canada
Brijesh K. Tiwari
Peter Šimko Food Chemistry and Technology
Institute of Food Science and Department
Nutrition Teagasc Food Research Centre
Slovak University of Technology Dublin, Ireland
Bratislava, Slovakia

Da-Wen Sun Stefan Toepfl

Food Refrigeration and Process Technologies
Computerised Food Technology German Institute of Food
(FRCFT) Technologies
School of Biosystems and Food Quakenbrueck, Germany
Engineering
University College Dublin Jun-Li Xu
National University of Ireland Food Refrigeration and
Agriculture and Food Science Computerised Food Technology
Centre (FRCFT)
Dublin, Ireland School of Biosystems and Food
Engineering
Régine Talon University College Dublin
INRA National University of Ireland
UR454 Microbiologie Agriculture and Food Science
Centre de Recherche Centre
Auvergne Rhône Alpes, France Dublin, Ireland
1
Genetically Modified Farm Animals:
Control and Traceability

Antoon Lievens and Mauro Petrillo

CONTENTS
1.1 Introduction ....................................................................................................1
1.1.1 Authorization Process .......................................................................2
1.1.2 Field Use of GM Animals .................................................................3
1.1.3 Modification Strategies .....................................................................4
1.1.4 Detection Options ..............................................................................7
1.1.4.1 Visual Inspection ................................................................7
1.1.4.2 Protein Detection ................................................................7
1.1.4.3 DNA Detection ....................................................................7
1.1.5 Protein-Based Detection Strategies .................................................7
1.1.5.1 Flow Strip .............................................................................8
1.1.5.2 Enzyme-Linked Immunosorbent Assay ......................... 9
1.1.5.3 Mass Spectrometry ........................................................... 10
1.1.6 DNA Bases Detection Strategies .................................................... 10
1.1.6.1 Polymerase Chain Reaction-Based Methods ................ 10
1.1.6.2 Sequencing ......................................................................... 11
1.1.7 Quantification Strategies ................................................................ 13
1.1.7.1 Quantitative Protein Methods......................................... 13
1.1.7.2 Quantitative PCR Methods .............................................. 13
1.1.8 Outlook .............................................................................................. 14
References ..................................................................................................... 14

1.1 Introduction
Traceability is one of the current key aspects of the European food safety
policy. It has rapidly gained importance in the wake of the bovine spongi-
form encephalopathy (BSE) crisis, and currently, there is a widespread adop-
tion of control and traceability systems in the entire agri-food industry.
Transparent and trustworthy regulatory and traceability processes are a
cornerstone in addressing consumer concerns and providing a wider accep-
tance of animal biotechnology. In addition, proper traceability increases

1
2 Advanced Technologies for Meat Processing, Second Edition

safety and quality control and allows faster identification and resolving
of problems, and it also allows correct labeling, which provides consum-
ers with information that is important for health and lifestyle choices.
Traceability also forms an essential aspect of risk management and will be
a major requirement for postmarketing surveillance when genetically mod-
ified (GM) animals enter the consumer market. However, before any GM
product may enter the European market, it needs to be officially authorized
(Frewer et al., 2013).
The main traceability legislation is stipulated in European Commission
(EC) regulation 1830/2003 concerning the traceability and labeling of geneti-
cally modified organisms (GMOs) and the traceability of food and feed prod-
ucts produced from GMOs.* It requires member states to take measures to
ensure traceability and labeling of authorized GMOs at all stages of their
placing on the market. The European Union (EU) law further requires that
foods and ingredients that contain, or are directly produced from, (autho-
rized) GMOs must be clearly labeled as such. These requirements do not
apply to foods containing GM material at <0.9%, provided that this presence
is adventitious or technically unavoidable.
Although member states are free to choose how to implement these regu-
lations, most have chosen a strategy of sampling and analysis throughout the
food chain to check the labeling claims (note that, depending on the member
state, it may or may not be allowed to label as “GMO-free”). This is carried
out by member-state-run laboratories (Reference labs) that together with the
European Reference Laboratory for GM Food and Feed (EURL GMFF) make
up the European Network of GMO Laboratories (ENGL), a platform that
develops, validates, and shares methods and information to harmonize the
identification and quantification of GM samples. It is expected that the man-
date of this current network will be expanded to also encompass samples
derived from animal products.
In the following sections, we take a closer at the procedure for GMOs to
enter the European market and discuss what methods will allow for control
and verification of labeling claims at various stages of the food chain. Ideally,
such methods should allow us to accurately distinguish GM from non-GM,
and should preferably be fast and not require extensive sample preparation.
In addition, the ideal detection method should be mobile and allow on-site
control (be it on the farm, in the supermarket, or in the restaurant) (Loftus,
2005). However, as we see, depending on the case, only certain of these boxes
may be checked.

* Regulation (EC) 1830/2003 of the European Parliament and of the Council of 22 September
2003 concerning the traceability and labelling of genetically modified organisms and the
traceability of food and feed products produced from genetically modified organisms and
amending directive 2001/18/EC.
Genetically Modified Farm Animals: Control and Traceability 3

1.1.1 Authorization Process

Before a GMO is allowed to enter the European food or feed market, an
authorization application it must be submitted to a national authority. The
requirements for authorization are stipulated in regulation (EC) 1829/2003,*
(EC) 641/2004,† and (EU) 503/2013.‡ Among other requirements, an application
must include a monitoring plan, labeling proposal, and detection method.
The national authority will send the application to the European Food
Safety Agency (EFSA) for a risk assessment. EFSA then makes the applica-
tion summary available to the public.
In the risk assessment procedure, the safety of the gene product is assessed
on a case-by-case basis. In the case of well-characterized proteins, a limited
evaluation, such as amino acid sequence and expression rates in different tis-
sues, may suffice. In the case of less well-documented proteins, there may be
extensive toxicity testing, since, theoretically, GM animals may contain new
proteins for which there is no history of safe use in the human diet.
Once EFSA has published its risk assessment, the public has 30 days to
comment on the EC’s website for applications, after which the commission
will produce its final decision (within 3 months). The authorizations are
valid for a maximum of 10 years and are renewable.

1.1.2 Field Use of GM Animals

Currently, the main European legislation consists of directive 2001/18/EC§ on
the deliberate release of GMOs into the environment and directive 2015/412¶
amending the former, which allows member states to restrict or prohibit the
cultivation of GMOs in their territory.
These directives explicitly incorporate the precautionary principle, and
state that the introduction of GMOs into the environment should be car-
ried out according to a “step-by-step” principle. Thus, the containment

* Regulation (EC) No 1829/2003 of the European Parliament and Council of 22 September 2003
on genetically modified food and feed.
† Regulation (EC) No 641/2004 of 6 April 2004 on detailed rules for the implementation of

Regulation (EC) No 1829/2003 of the European Parliament and of the Council as regards the
application for the authorization of new genetically modified food and feed, the notifica-
tion of existing products and adventitious or technically unavoidable presence of genetically
modified material which has benefited from a favourable risk evaluation.
‡ Commission implementing regulation on applications for authorisation of genetically

modified food and feed in accordance with regulation (EC) No 1829/2003 of the European
Parliament and of the council amending commission regulations (EC) No 641/2004 and (EC)
No 1981/2006.
§ Directive 2001/18/EC of the European Parliament and of the concould of 12 March 2001 on

the deliberate release of genetically modified organisms and repealing council directive
90/220/EEC.
¶ Directive (EU) 2015/412 of the European Parliament and of the Council of 11 March 2015

amending Directive 2001/18/EC as regards the possibility for the member states to restrict or
prohibit the cultivation of genetically modified organisms in their territory.
4 Advanced Technologies for Meat Processing, Second Edition

of a GMO should be gradually reduced and the scale of its release

increased, step by step, but only after a positive evaluation of the previous
step (in terms of the protection of human health and the environment)
(Garcia, 2006).
A person or company applying for an authorization for “deliberate release”
of a GMO must submit its application to the competent national authority of
the member state where the release is to take place, and the eventual authori-
zation will only be valid in this member state. Among other requirements, an
application for deliberate release should contain a technical dossier includ-
ing a full environmental risk assessment, a monitoring plan, and appropriate
safety measures.
In practice, such safety measures will probably boil down to treating the
GM animals as a completely different species than their non-GM counter-
parts. This may include separate housing and transport facilities and manda-
tory animal identification systems (Kok and Jones, 2003). However, member
states may impose additional restrictions on the use and cultivation of GM
animals.

1.1.3 Modification Strategies

To fully understand the complications that may arise in detecting GMOs,
one has to have a basic understanding of the origin of their modifications
and their effects on the microbiological level.
Historically, the most common methods for generating GM animals
are probably microinjection (injecting DNA into the nucleus of fertilized
egg cell) and retrovirus-mediated gene transfer. The success rate is rather
low and the results are variable: the insertions are highly random in
terms of location and number of copies inserted, making the disrup-
tion of essential genetic information a possibility (Houdebine et al., 2009;
Robl et al., 2007; Kues and Niemann, 2011). Even in plants, where the
existence of Agrobacterium tumefaciens makes for a more straightforward
transformation, the random nature of the insertions complicates GMO
production.
These technical limitations favored the insertion of larger sequence con-
structs that could operate independently from the region of insertion and
carry selection markers to distinguish successfully modified cells. As a con-
sequence, such inserts tend to come with easy targets for detection, either on
the protein level or on the DNA level.
The advent of clustered regularly interspaced short palindromic repeat
(CRISPR) technology (see Figure 1.1) is changing all this by allowing tar-
geted insertion, thus taking part of the randomness out of the equation. In
addition, CRISPR may allow for site-specific mutagenesis that can create
variants of one specific protein (Go and Stottmann, 2016). As we see, such
small changes may be problematic for detection.
Genetically Modified Farm Animals: Control and Traceability 5

Cas9 Host Cas9 Host

All-in-one vector Target sequence genome genome
RNA expre
ide ssi or Repair break
Gu o ?

n
Downstream cut
ACGCCAATATGGAAAATCGTCACCATAAAA
AACGGGAGAAGGTCCATCCCCACCGGACA DNA
TCGTTACTCTAGCGGTTAAGCTAATCTAA
GAGCAACAAGGCTCTTATACCCCAATATG
template
on

GAAAATCGTCACCATAAAAAACGGGAGAA
Cut in other
ssi

GGTCCATCCCCACCGGACATCGTTACTCTAG
re

C as
9
9e
xp CGGTTAAGCTAATCTAAGAGCAACAAGGCT
DNA chromosome
Cas CTTATACCACACCGGACATCGTTACGGCTAC
insert
Transfection Targeted double-stranded DNA cleavege

Nucleus Cas9 protein

RNA Guide
Host DNA scaffold RNA

Target sequence

PAM (NGG)
Cell

FIGURE 1.1
The clustered regularly interspaced short palindromic repeat (CRISPR) system consists ini-
tially of a single (circular) piece of DNA into which the target sequence is coned. Upon trans-
fection into the cell, it is the cell’s own which builds and assembles the protein complex. The
CRISPR/Cas9 system recognizes specific DNA sequences using a guide RNA/protein com-
plex based around a protospacer adjacent motif (PAM). The complex creates a double-stranded
break in the DNA at the target site. The latter is subsequently repaired by the cell’s DNA repair
system, which will incorporate a template provide (homology-directed repair) or just close the
break(s) (nonhomologous end joining).

Independent of the desired final effect (e.g., faster growth, virus resistance),
we can divide the current types of modification into classes relevant to their
detection as follows:
At the DNA level the following can occur:

• Insertion of a sequence into the host genome inevitably generates two

unique junctions in addition to the (usually foreign) inserted gene,
making this the most straightforward type of modification to detect.
Even if the donor organism is the same species, the junctions at the
insertion sites are unique to the GM and specific detection is possible.
• Deletion of a sequence yields, similar to insertions, a new, unique, junc-
tion that may be targeted for detection. Theoretically, exceptions are
possible if the deletion took place in a high-repeat region; this might
create an undetectable (nonunique) junction region.
• Mutation of a sequence consists of changing very few bases in the
DNA, resulting in a highly similar variant of gene. Depending on
6 Advanced Technologies for Meat Processing, Second Edition

the kind of change and its sequence context, the design of a rou-
tine detection method can be anything from straightforward to near
impossible.

At the protein level there the following possible options:

• A new protein is produced, which has no equivalent in the wild-type

organism. This is the most straightforward type of modification to
detect. Independent of the technology used, a novel protein is an
excellent detection marker.
• A protein is no longer produced. Essentially, the same situation as in
the above, but with the GM and non-GM roles reversed. A nega-
tive test will now indicate a GMO. However, such a strategy will not
work in mixed samples.
• A modified version of an existing protein is produced. Depending on
if the modification results in unique protein-surface features, this
protein may be detected using immunological methods, otherwise
more complicated methods will be required.
• Changes in protein timing or dosage. GM animals may produce more
or less of an endogenous protein, or may produce the protein in a
different tissue or at a different stage of their life. Protein quantifica-
tion approaches may yield a workable strategy in some stages of the
food chain, but may not be a universal solution.
• No change at all. Not all DNA modifications yield proteomic changes
and in these cases, protein testing will not be able to distinguish
between GM and non-GM.

The classes of DNA modification are not causally linked to the classes of
proteomic change: the insertion of DNA may not lead to the production of
a protein, or may even prevent the production of a protein, and the deletion
of part of the DNA may modify rather than suppress the protein produc-
tion. And even more complicated constructs exist, for example, recombi-
nase-mediated deletions where, depending on the construct, the resulting
organism may or may not be mosaic for the deletion.
Theoretically, all modifications can be detected at the DNA level, but it is
more difficult to develop detection methods for small changes than for large
insertions. Likewise, some protein changes are more readily detected than
others (e.g., a change in protein level vs. a new protein).
Overall, small changes are harder to detect than large changes. Because
of the limitations of the techniques involved in producing GMOs, small
changes were never much of an option . . . until recently. The advent of
CRISPR has the potential to greatly accelerate the production of more subtle
GMOs and threatens to throw the proverbial wrench in the current detec-
tion strategies.
Genetically Modified Farm Animals: Control and Traceability 7

1.1.4 Detection Options

Depending on the place in the food chain, there may be different needs for
detection. In the early part of the chain where animals are whole or their
meat is unprocessed, qualitative detection (positive/negative) may suffice.
Near the end of the chain, in processed materials or mixed samples, quanti-
tative analysis may be required (How much of the sample is GM?) (Bonfini
et al., 2002; Corbisier et al., 2007).

1.1.4.1 Visual Inspection

In live animals, visual identification of GM animals may be possible: fluores-
cent light can be used to recognize GloFish™ and featherless chickens are easily
identified as such. However, other traits (disease resistance, meat composition)
are not so straightforward to confirm, and one has to resort to other means.

1.1.4.2 Protein Detection

Changes in the proteome form an attractive target for detection. “New” or mod-
ified proteins are often suitable for immunological detection (see Figure 1.3).
Such methods are highly specific, fast, and can be made in portable formats.
However, not all proteins resits processing well and by the end of the food
chain they may no longer be detectable.

1.1.4.3 DNA Detection

As changes to the DNA are the very definition of GMOs, the detection of
these changes is a reliable way to detect and identify GMs (Holst-Jensen,
2009). As a consequence, DNA forms the current gold standard in detection
and quantification of GMOs. In addition, its resistance to processing and its
amplifiable nature (see Figure 1.2) makes for a low limit of detection through-
out the entire production chain. As a drawback, DNA detection methods
often require extensive sample preparation and highly specified equipment.

1.1.5 Protein-Based Detection Strategies

Proteins are manufactured in the cell according to the information coded
by DNA. This DNA can be completely transgenic (GMO) and the protein
produced can be foreign to the species (e.g., a bacterial toxin, CryIAb, in
insect-resistant maize) (Magg et al., 2001) or it could be a modified version
of a natural protein (e.g., a glyphosate-tolerant version of a plant enzyme,
CP4-epsps, in herbicide-resistant soy) (Funke et al., 2006). The changes to the
proteome can also be temporal (e.g., growth hormone at lower temperature
in aquadvantage™ salmon) (Du et al., 1992) or in the amount of protein pro-
duced (e.g., sheep overexpressing insulin-like growth factor 1 in their skin to
improve wool growth) (Damak et al., 1996).
8 Advanced Technologies for Meat Processing, Second Edition

Cycle 1 Cycle 2 Cycle 3

Target 3′ 5′ 3′ 5′ 3′ 5′
sequence
Primers Polymerase

5′ 3′ 5′ 3′ 5′ 3′

Step 1: Step 2: Step 3:

Denaturation Annealing Elongation

Total DNA
n molecules 2n molecules 22n molecules 23n molecules

FIGURE 1.2
Enzymatic amplification of DNA (polymerase chain reaction [PCR]). An amplification cycle
typically consists of three steps that allow duplication of the target DNA. The denaturation
step consists of heating the reaction to a temperature of 95°, which disrupts the hydrogen
bonds between complementary bases, yielding single-stranded DNA molecules. During the
annealing step, the temperature is lowered to 60°, allowing binding of the primers to the
single-stranded DNA template. For the elongation step, the temperature is raised to the opti-
mum activity temperature of the polymerase enzyme (72° for Taq polymerase). At this step, the
DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand
by adding nucleotides present in the reaction mix.

Proteins that have surface characteristics that are unique to GM animals

are usually detectable by immunological methods (using antibodies that
bind specifically to that protein) whereas other changes may only be detect-
able by more elaborate methods such as 2D gel electrophoresis and mass
spectrometry (MS).

1.1.5.1 Flow Strip

The most commonly used immuno- or antibody-based test for GMO detec-
tion is the strip test (also known as a lateral flow device). The “devices” are
thin strips of a nitrocellulose membrane covered by a sample pad on one end
and a wicking pad on the other end (see Figure 1.3).
The business end of the strip is submersed in a solution of homogenized
test sample (usually an aqueous solution). The solution wicks up the strip,
passing the fluid over an area containing an excess of gold-labeled antibody
specific to the GM protein being tested. If this protein is present then it will
bind to the gold-labeled antibodies, and the antibody–protein complex will
continue moving up the strip with the flow of fluid.
Genetically Modified Farm Animals: Control and Traceability 9

Enzyme Colloidal gold

Detector antibody Detector antibody
Target protein Target protein
Capture antibodies Capture antibodies
1. Incubate sample
2. Incubate detector antibody
3. Substrate solution
and read-out Wicking pad

Control line
Test line
Gold-labeled
antibodies
96-well plate Sample f low
Sample

FIGURE 1.3
Immunological protein detection methods: Enzyme-linked immunosorbent assay (ELISA)
(left) and flow strips (right) employ a common mechanism of capturing the protein of interest
using an immobilized capture antibody and visualizing the protein using a second enzyme/
gold-linked antibody.

The sample fluid then passes over two additional areas on the strip:
(1) the test line, containing a second (immobilized) antibody specific for the
GM protein that captures the antibody–protein complex, which results in
formation of a visible line on the strip indicating the presence of the GM pro-
tein in the sample, and (2) the control line, containing a third (immobilized)
antibody that will bind any other antibody (free or carrying protein) and
which indicates that the strip has functioned correctly.

1.1.5.2 Enzyme-Linked Immunosorbent Assay

Enzyme-linked immunosorbent assay (ELISA) is a more sensitive antibody-
based protein detection method. Here, the sample solution is added to a
multiwell plate on which GM-protein-specific antibody has been immobi-
lized (capture antibodies). If the GM protein is present in the sample, it will
bind to the capture antibody. After washing, the detector antibody, also spe-
cific for the GM protein and tagged with an enzyme, is added to the well.
The enzyme-linked detection antibody will bind any GM protein already
immobilized to the well by the capture antibody, forming an antibody–
protein–antibody sandwich. After another round of washing to remove any
unbound antibody, a substrate is added, which is converted by the enzyme
inducing a color change in the solution. Not only does the enzymatic reac-
tion amplify the signal, but it also lowers the detection limit; the intensity of
the color change is proportional to the amount of protein present, allowing
quantification.
10 Advanced Technologies for Meat Processing, Second Edition

1.1.5.3 Mass Spectrometry

Although antibody-based approaches are powerful and versatile, their main
bottleneck is the availability of antibodies with high specificity. The develop-
ment of high-quality antibody-based assays can be costly, time consuming
and resource intensive. Another disadvantage of antibody-based assays is
that they may not be able to discriminate between closely related proteins.
MS provides a powerful alternative and complementary approach.
Essentially, a mass spectrometer measures the masses of the molecules
within a sample. The technique relies on magnetic and electric fields
which exert forces on charged particles (ions) in vacuum in order to deter-
mine their mass–charge ratio. Therefore, the sample must be ionized prior
to be analysis. In addition, the ions must be introduced into the system as
a gas so that the molecules are individualized, allowing the determination
of their single masses. However, proteins are nonvolatile and thermally
unstable, and require special “soft” ionization methods that do not cause
extensive degradation. Beside the ionization source, a mass spectrome-
ter also consist of a mass analyzer, a detector, and the data processing
electronics.
The workflow usually consists of breaking down the protein in smaller
parts (peptides), which yields a spectrum of masses (a peptide mass finger-
print) which is used as input for a search in a database that holds the pre-
dicted masses for each protein. Complex samples can hold an overwhelming
number of components that yield spectrums that are very difficult to inter-
pret. Therefore, it is usually necessary to enrich, purify, or separate the
proteins prior to MS analysis (e.g., via 2D gel or high-performance liquid
chromatography [HPLC]).
As MS is a much more versatile tool for protein analysis, it is able to see
very small differences between proteins and is not limited to any specific
protein. Unfortunately, a mass spectrometer is an expensive, very much non-
portable piece of equipment that may require extended sample preparation,
and relies on the availability of databases for the identification of proteins.

1.1.6 DNA Bases Detection Strategies

As mentioned above, DNA analysis forms the current gold standard in
detection and quantification of GMOs within the EU. The technology has
been optimized to produce a high-throughput screening and quantification
system that has been harmonized between member states and has been stan-
dardized in terms of performance.

1.1.6.1 Polymerase Chain Reaction-Based Methods

At present, (real time) polymerase chain reaction (PCR)-based analysis is
the method of choice for the routine analysis of food and feed samples for
Genetically Modified Farm Animals: Control and Traceability 11

their GMO content and authenticity (Loftus, 2005; Mafra et al., 2008). They
work by targeting specific DNA sequences (between 60 and 200 bp long) for
enzymatic amplification (also see Figure 1.2), revealing the presence (ampli-
fication) or absence (no amplification) of the target sequence. By following
the amplification process fluorometrically (in real time,) quantification of the
initial amount of target sequence becomes possible.
Traditionally, three levels of specificity are distinguished within GMO-
detection methods (Figure 1.4):

Screening methods target DNA sequences that are frequently inserted

into GMOs, for example, promoters, terminators, sequences of genes
conferring certain tolerances, or resistances. These methods allow
the detection of a broad range of GMOs, but they do not allow
identification with absolute certainty of which GM event(s) is (are)
present in the sample.
Construct-specific methods target two or more adjacent genetic elements
in a transgene construct by amplifying their junction. These meth-
ods are more informative in terms of presence or absence of specific
events, but cannot distinguish between different events containing
the same (or similar) constructs.
Event-specific methods target the host-transgene DNA junction. As a
consequence, these methods are highly specific and amplify only a
single event. They are usually applied in downstream confirmation
of GM-positive samples.

The current workflow surrounding GM sample processing includes the fol-

lowing steps: (1) analysis of the meta information surrounding a sample in
order to decide which screening methods to used (e.g., only markers related to
a single crop or a full screening), (2) running of these screening methods and if
all are negative, stopping the testing, (3) in case of positive results, identifying
possible events and running the event-specific tests, possibly quantifying any
positive result in the same run, and (4) if no event-specific tests show a positive
result, declaring the sample contaminated with a nonauthorized GMO.
The downside of PCR-based detection is that, much like immunological
methods, you can only find what you are looking for: each reaction tests the
absence/presence of a specific sequence. Any GM sequence that is present
but not tested for cannot be detected. In addition, PCR-based tests are dif-
ficult to design and optimize for small sequence changes.

1.1.6.2 Sequencing
Where PCR cannot distinguish between GM and non-GM, or when a com-
plete characterization of a sample is required, direct DNA sequencing may
offer a solution (Lievens et al., 2015). Sequencing has come a long way in
12 Advanced Technologies for Meat Processing, Second Edition

Host wild-type
DNA

Insertion Point mutation

Deletion

FIGURE 1.4
Schematic overview of detection targets. DNA is represented in different ways for
explanatory purpose. Insertions are represented as outlined stretches of DNA, dele-
tions as the omission of dashed stretches of DNA, grey is used to help indicate the new
junction after modification. Depending on the type of modification (insertion, deletion,
and point mutation), there are different options for event-specific identification (circular
crosshairs) or construct-specific detection (square crosshairs).

recent decades, and the current state of the art allows the massive paral-
lel sequencing of entire genomes (so-called “next generation sequencing”
[NGS]).
Several approaches exist (semiconductor sequencing, pyro-sequencing,
nanopore sequencing, etc.), but the common strategy entails “reading” many
short sequences (usually 100–400 bp depending on the technology). From the
overlap between the millions of “reads” generated the original sequence is
rebuilt. The technology allows either concentrating on a specific sequence
(captured or preamplified) or addressing the entire sequence diversity of the
sample.
Much like MS, the equipment is expensive compared to standard PCR
(although prices are steadily declining) and may require extended sample
preparation. In addition, there is a bioinformatics bottleneck in the process-
ing of the “reads,” which may be challenging without dedicated software
and computing cluster. On the plus side, most sequencing platforms have the
Genetically Modified Farm Animals: Control and Traceability 13

ability to “tag” DNA with specific short sequences (barcoding), which allows
pooling of samples since the software can use the barcode to distinguish
which sequence came from which sample.

1.1.7 Quantification Strategies

The current European labeling requirement applies to food and feed when
their GM content is higher than 0.9% (weight/weight) on a per ingredient
base. Other thresholds exist (e.g., 5% in Japan and 1% in Brazil) but irrespec-
tive of their exact value, there is a need for accurate quantification (Zel et al.,
2012; Trapmann et al., 2010).
Most quantification strategies are relative in nature and require standards
or reference materials to which a sample is compared and, generally speak-
ing, a quantification result is often only as good as the standard that has been
used. Materials of high purity and well-defined GM content are key in the
process of efficiently controlling for a threshold.

1.1.7.1 Quantitative Protein Methods

The current GM quantification strategies are almost exclusively nuclear
DNA based, which has the advantage that each (somatic) cell carries the
exact same amount of target copies. Although not straightforward, the
relation between the number of DNA targets and sample weight is more
direct than for proteins. Protein levels can change over time and may differ
between tissues. Compared to DNA, a lot less work has been done in the
establishment of a protein-based GM quantification approach. Nevertheless,
ELISA, MS, and even strip tests can be made to function quantitatively and
combined with the right sampling strategies may provide a useful tool in
quality assurance.

1.1.7.2 Quantitative PCR Methods

Real time PCR-based GM quantification involves the parallel detection
of two targets: a wild-type endogene and an event-specific transgene.
Calibration curves for both genes are constructed using reference materials.
The complete result then allows accurate quantification of the GM content
of the sample over a wide dynamic range. Digital PCR, on the other hand,
allows the direct absolute quantification of the target and could function
without the need for reference materials.
The current quantification approach is based on the assumption of equiva-
lence of the percentage of GM target in DNA and the weight/weight percent-
age of GM in the ingredient of the original sample. Even though there are
many factors that may complicate this assumption (cell size varies between
plant tissues, fruits and seeds may be (partially) haploid, etc.) a large body of
14 Advanced Technologies for Meat Processing, Second Edition

practical experience currently justifies its use and its existence as an official
recommendation from the EC (i.e., EC 2004/787).*
In animals, there are again several biological facts that complicate the
assumption of equivalence between DNA ratio and mass percentage. The
most straightforward relating to the nature of muscle tissue is that muscle
consists of multinucleated myofibers and their growth mainly happens by
increases in length and width of the muscle fibers rather than by an increase
of the number of fibers (and therefore, in the number of cell nuclei). However,
there is significant postnatal DNA accumulation in muscle tissue insofar
that there is a quite linear relation between the number of nuclei and the
muscle. Transferability of the equivalence of DNA and weight percentages to
animals thus seems likely but will have to be confirmed and validated before
it can be put to practice at the regulatory level.

1.1.8 Outlook
Traceability is currently well established as a key risk management tool
and component of the agri-food quality system. Animal identification sys-
tems are already mandatory in several regions worldwide and GMO test-
ing is commonplace where labeling requirements have been installed. These
developments have largely paved the way for the advent of biotech-derived
animals, as most of the building blocks are already in place. The further
adoption of molecular-based systems in the food production process has the
potential to answer most traceability challenges GM animals will pose. It is
likely that the biggest bottleneck in the introduction of biotech animals will
not be of a technical nature, but rather regulatory.

References
Bonfini, L., Kay, S., Heinze, P. and Van den Eede, G. (2002). Report on GMO detection
identification and quantification methods submitted to collaborative studies.
European Communities, EUR 20383 EN, 1–29.
Corbisier, P., Broothaerts, W., Gioria, S. et al. (2007). Toward metrological traceabil-
ity for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction
methods on the quantitative determination of Bt176 corn by real-time PCR.
Journal of Agricultural and Food Chemistry, 55, 3249–3257.
Damak, S., Sul, H.-Y., Jay, N. P. and Bullock, D. W. (1996). Improved wool production
in transgenic sheep expressing insulin-like growth factor 1. Biotechnology, 14(2),
185–188.

* Commission recommendation 2004/787/EC of 4 October 2004 on technical guidance for sam-

pling and detection of genetically modified organisms and material produced from geneti-
cally modified organisms as or in products in the context of Regulation (EC) No 1830/2003.
Genetically Modified Farm Animals: Control and Traceability 15

Du, S. J., Gong, Z., Fletcher, G. L., Shears, M. A., King, M. J., Idler, D. R. and Hew,
C. L. (1992). Growth enhancement in transgenic Atlantic salmon by the use of an
“all fish” chimeric growth hormone gene construct. Nature Biotechnology, 10(2),
176–181.
Frewer, L., Kleter, G., Brennan, M. et al. (2013). Genetically modified animals from
life-science, socio-economic and ethical perspectives: Examining issues in an
EU policy context. New Biotechnology, 30, 447–460.
Funke, T., Han, H., Healy-Fried, M. L., Fischer, M. and Schönbrunn, E. (2006).
Molecular basis for the herbicide resistance of roundup ready crops. Proceedings
of the National Academy of Sciences, 103(35), 13010–13015.
Garcia, P. R. (2006). Directive 2201/18/EC on the deliberate release into the environ-
ment of GMOs: An overview and the main provisions for placing on the market.
Journal for European Environmental and Planning Law, 3, 3–12.
Go, D. E. and Stottmann, R.W. (2016). The impact of CRISPR/Cas9-based genomic
engineering on biomedical research and medicine. Current Molecular Medicine,
16(4), 343–352.
Holst-Jensen, A. (2009). Testing for genetically modified organisms (GMOs): Past,
present and future perspectives Biotechnology Advances, 27, 1071–1082.
Houdebine, L.-M. (2009). Methods to generate transgenic animals. In: Engelhard, M.,
Hagen, K. and Boysen, M. (eds.) Genetic Engineering in Livestock (Vol. 34). Berlin:
Springer-Verlag, 31–48.
Kok, E. J. and Jones, W. (2003). The food safety risk assessment of GM animals. Topic
Paper 4. FAO/WHO Expert Consultation on Safety Assessments of Foods
Derived From Genetically Modified Animals, Including Fish. FAO, Rome.
Kues, W. and Niemann, H. (2011). Advances in farm animal transgenesis. Preventive
Veterinary Medicine, 102, 146–156.
Lievens, A., Petrillo, M., Querci, M. and Patak, A. (2015). Genetically modified ani-
mals: Options and issues for traceability and enforcement. Trends in Food Science
and Technology, 44, 159–176.
Loftus, R. (2005). Traceability of biotech-derived animals: Application of DNA tech-
nology. Revue Scientifique et Technique, Office International des Epizooties, 24,
231–242.
Mafra, I., Ferreira, I. and Oliveira, M. (2008). Food authentication by PCR-based
methods. European Food Research and Technology, 227, 649–665.
Magg, T., Melchinger, A. E., Klein, D. and Bohn, M. (2001). Comparison of Bt maize
hybrids with their non-transgenic counterparts and commercial varieties for
resistance to European corn borer and for agronomic traits. Plant Breeding, 120,
397–403.
Robl, J., Wang, Z., Kasinathan, P. and Kuroiwa, Y. (2007). Transgenic animal produc-
tion and animal biotechnology. Theriogenology, 67, 127–133.
Trapmann, S., Corbisier, P., Schimmel, H. and Emons, H. (2010). Towards future
reference systems for GM analysis. Analytical and Bioanalytical Chemistry, 396,
1969–1975.
Zel, J., Milavec, M., Morisset, D., Plan, D., Van den Eede, G. and Gruden, K. (2012).
How to Reliably Test for GMOs. New York, NY: Springer.
2
Hyperspectral Imaging Technique for Online
Monitoring of Meat Quality and Safety

Jun-Li Xu and Da-Wen Sun

CONTENTS
2.1 Introduction .................................................................................................. 18
2.2 Fundamentals of Hyperspectral Imaging ................................................ 20
2.2.1 Basic Principles................................................................................. 20
2.2.2 Data Structure ..................................................................................22
2.2.3 Image Sensing Modes ..................................................................... 23
2.2.4 Acquisition of Hyperspectral Images ........................................... 24
2.3 Hyperspectral Imaging Instruments ........................................................ 26
2.3.1 Illumination Unit ............................................................................. 27
2.3.2 Wavelength Dispersion Devices .................................................... 28
2.3.2.1 Imaging Spectrographs .................................................... 28
2.3.2.2 Filter Wheels ...................................................................... 29
2.3.2.3 Tunable Filters ................................................................... 29
2.3.3 Area Detectors ..................................................................................30
2.3.4 Hyperspectral Imaging System Calibration ................................ 30
2.3.4.1 Spatial Calibration ............................................................ 31
2.3.4.2 Spectral Calibration .......................................................... 31
2.3.4.3 Flat-Field Correction ......................................................... 32
2.4 Hyperspectral Imaging Data Processing and Multivariate Analysis .. 33
2.4.1 Image Segmentation ........................................................................ 33
2.4.1.1 Thresholding and Morphological Processing...............34
2.4.1.2 Spectral Image Segmentation .......................................... 36
2.4.2 Spectral Preprocessing .................................................................... 37
2.4.3 Multivariate Analysis ...................................................................... 39
2.4.3.1 Multivariate Classification ............................................... 39
2.4.3.2 Multivariate Regression ................................................... 41
2.4.3.3 Model Evaluation ..............................................................43
2.4.4 Selection of Important Wavelengths .............................................44
2.5 Online Applications for Meat Quality and Safety Assessment ............ 45
2.5.1 Poultry Carcass ................................................................................ 48

17
18 Advanced Technologies for Meat Processing, Second Edition

2.5.1.1 Contamination Detection................................................. 49

2.5.1.2 Tumor and Bone Detection .............................................. 52
2.5.1.3 Microbiological Spoilage Detection................................ 55
2.5.2 Fish ..................................................................................................... 56
2.5.2.1 Freshness ............................................................................ 57
2.5.2.2 Chemical Compositions ................................................... 58
2.5.2.3 Parasites and Defects ........................................................ 60
2.5.2.4 Microbial Spoilage ............................................................ 61
2.5.2.5 Differentiation and Classification/Sorting.................... 62
2.5.3 Red Meats .......................................................................................... 62
2.5.3.1 Sensory Attributes ............................................................64
2.5.3.2 Chemical Compositions ................................................... 67
2.5.3.3 Microbiological Properties............................................... 69
2.5.3.4 Technological Attributes .................................................. 70
2.6 Conclusions................................................................................................... 72
References............................................................................................................... 73

2.1 Introduction
Accurate and rapid assessment of meat quality parameters has always been
a big concern because consumers are always demanding and expecting safe
meat and meat products with superior quality. To meat consumers’ needs, it
is significant for the meat industry to ensure the safe production of meat dur-
ing processing operations and the correct labeling of products with regard
to safety, quality, authenticity, and compliance. Quality and safety of meat
are normally defined by physical attributes (e.g., color, texture, tenderness,
and marbling), chemical attributes (e.g., moisture, protein, and fat content),
and microbiological attributes (e.g., total viable count [TVC]). Traditionally,
assessment of meat quality and safety involves human visual inspection
which, however, is subjective, laborious, and inconsistent. Currently, differ-
ent techniques such as sensory analysis, chemical procedures, instrumental
methods, and screening methods, such as mass spectrometry (MS) and high-
performance liquid chromatography (HPLC), are commonly used to provide
information about meat quality. These methods play a pivotal role in cur-
rent industrial meat quality and safety inspection, and some of them have
been applied as old standards and regulation methods in scientific research
because of their relative accuracy and validity. However, they have some
unavoidable limitations, such as being destructive, tedious, time consuming,
sometimes environmentally unfriendly, and unable to handle a large num-
ber of samples. These obvious disadvantages of conventional methodologies
necessitate the need for rapid, accurate, fast, noninvasive, and real-time detec-
tion techniques, so as to optimize quality and assure safety of meat.
In order to surmount the aforementioned disadvantages, the meat indus-
try has experienced dramatic changes by adopting the most advanced
Hyperspectral Imaging Technique 19

technological innovations. A great number of methods, which are based on

different principles, procedures, and/or instruments, are available now to
measure meat traits. One of these methods is a spectroscopic technique that
depends on the interaction between incident light and molecules in matters.
Recently, near-infrared spectroscopy (NIRS) has received considerable atten-
tion as a fast and noncontact analytical tool in food quality assessment. NIRS
is a useful and reliable technique and is relatively easy to implement for both
offline and online applications. Meanwhile, NIRS has the potential for the
measurement of multiple attributes at the same time. In other words, NIRS
is capable of simultaneously collecting the physical, chemical, and microbio-
logical information within the tested products by scrutinizing the changes of
spectra. However, this spectroscopic technique is not able to provide impor-
tant spatial information because it analyzes the sample in bulk and evaluates
an average composition across the whole sample. In order to obtain spatial
information, a smart technology, that is, computer vision (Sun, 2007) has been
developed for automated visual inspection to replace the traditional inspec-
tion by human inspectors. Computer vision imitates the principle of human
vision, using three bands (red, green, and blue) to acquire the characteristics
of the tested object, such as color, shape, size, and texture. Unfortunately, com-
puter vision has some limitations that make certain industrial applications
unavailable. External attributes such as shape, size, texture, color, and exter-
nal defects can be easily detected by ordinary computer vision, yet internal
attributes are difficult to evaluate with the traditional imaging means. Work-
ing in visible range, it is generally not efficient to predict chemical and biolog-
ical parameters and detect invisible defects. Both spectroscopy and computer
vision techniques have found a wide range of applications in the food indus-
try even though they have their own inherent drawbacks (Brosnan and Sun,
2004). As an integrated alternative, hyperspectral imaging was developed to
obtain both spectral and spatial information from the target.
In recent years, the hyperspectral imaging technique, also known as imag-
ing spectroscopy or imaging spectrometry, has been considered a promising
and versatile analytical tool for the food research and industry. Hyperspec-
tral imaging was originally developed in the early 1970s for mainly remote
sensing applications (Adam et al., 2010). The invention of the first charge-
coupled device (CCD) detector by George Smith and Willard Boyle played a
crucial role in moving hyperspectral imaging technology forward. It started
blooming in many other different fields, such as pharmaceutical research,
food science, forensic science, and agriculture (ElMasry and Sun, 2010).
Indeed, the feasibility of measuring a whole spectrum over the ultraviolet
(UV), visible, and near-infrared (NIR) spectral regions (300–2600 nm) for
every single pixel within the sample has made it very attractive for many
different applications.
Hyperspectral imaging goes beyond conventional imaging and spectros-
copy through obtaining a spatial map of spectral variation (Gowen et al.,
2015). Therefore, the merits in spectroscopy and computer vision are both
20 Advanced Technologies for Meat Processing, Second Edition

reflected in hyperspectral imaging. In addition, more benefits are obtained

besides these aggregated advantages from both methods. For example,
hyperspectral imaging can generate distribution maps to visualize differ-
ent biochemical constituents presented in a tested sample based on their
special spectral signatures. The huge spectral information stored in the
hyperspectral images allows different objects to be identified and distin-
guished even if they have similar morphological features, colors, and over-
lapping spectra. Compared to conventional methods for evaluation of meat
quality parameters, hyperspectral imaging is a fast, sensitive, noninvasive,
and chemical-free analytical technique with minimal sample preparation,
providing both qualitative and quantitative measurements for numerous
meat properties simultaneously. For example, it can be used as an automatic
inspection protocol to identify contaminants with the capability of causing
illness in humans in meat and meat products. The pioneering research of
applying hyperspectral and multispectral imaging techniques to determine
various contaminants on poultry carcasses was carried out by the United
States Department of Agriculture’s (USDA) Agricultural Research Service,
and some of them have already been set up in an online monitoring line
(ElMasry and Sun, 2010). Additionally, research on meat safety inspection
using hyperspectral imaging has been extended to reach the area of micro-
bial spoilage detection. Some other fundamental applications, such as bone
fragments detection, overall quality inspection, grade classification, and
fraud authentication have also been investigated in many published works
and good results were collected (Wu and Sun, 2013b). Therefore, hyperspec-
tral imaging is a powerful analytical technique in the meat industry with
great potential for inspection, monitoring, control, quantification, classifica-
tion, and identification purposes. In this chapter, a comprehensive overview
of the recent developments in using hyperspectral imaging systems for the
online applications of monitoring meat quality and safety parameters is pre-
sented. Basics and theoretical aspects of this technique, the main features of
the instrumentation, and the commonly used chemometrics algorithms to
handle the hyperspectral data are also provided and briefly discussed. In
particular, the latest research and online applications using hyperspectral
imaging on white meat (poultry and fish) and red meat (pork, lamb, and
beef) are described and highlighted in detail.

2.2 Fundamentals of Hyperspectral Imaging

2.2.1 Basic Principles
At the molecular level, all sample materials continuously absorb and emit
energy by reducing or raising their molecular energy levels. Thus, spectro-
scopic tools provide detailed fingerprints by using physical characteristics
Hyperspectral Imaging Technique 21

of the interaction between electromagnetic radiation and physicochemical

materials of foods, such as absorbance, reflectance, transmittance, phos-
phorescence, fluorescence, and radioactive decay. Electromagnetic waves
usually consist of UV radiation, visible light (VIS), NIR, mid-infrared, and
far-infrared (FIR) (Huang et al., 2014). NIRS is one of the most popular strat-
egies among these spectroscopic techniques within the food industry. As
with any biological material, food tissues are the combination of many vari-
ous pure compounds with different molecular bonds and forces. Water, fats,
and carbohydrates are rich in C–H or O–H bonds, while organic compounds
and petroleum derivatives contain many C–H or N–H bonds. The absorp-
tion bands in the NIR range arise from overtones and combination bands
of C–H, O–H, N–H, and S–H stretching and bending vibrations, enabling
NIRS to provide characteristic and detailed fingerprints of food samples by
using these observed changes in molecular energy levels. Since all the bio-
logical substances consist of thousands of molecular bonds, the exposure
of a sample to electromagnetic waves accounts for a complex spectrum that
provides the detailed qualitative and quantitative information about the
physical and chemical changes of that sample. At the macro level, the elec-
tromagnetic wave is observed as light, and the change of the incident elec-
tromagnetic wave is presented as the scattering, reflection, and transmission
of light. After the light penetrates into the tissue of samples, the emerging
light obtained is converted to a spectrum, which could indicate the chemical
constituents and physical properties of the food samples.
On the other hand, measurement of the external features, such as color,
texture, shape, and size parameters, of food products can be achieved by a
conventional imaging system or more specifically computer vision. Computer
vision involves the capturing, processing, and analyzing of images, accounting
for the rapid, objective, and nondestructive assessment of visual quality char-
acteristics (Timmermans, 1995). Images are first acquired with a sensor and
dedicated computing hardware and software are implemented to analyze the
images with the aim of performing a predefined visual task. This technology
attempts to duplicate the effect of human vision by electronically perceiving
and understanding an image (Brosnan and Sun, 2004). It has been tested suc-
cessfully for objective measurement of various agricultural and food products
(Wang and Sun, 2001). Nevertheless, a computer vision system is incapable of
inspecting targets with similar color, predicting chemical components, classi-
fying complex objectives, and detecting invisible defects because it operates at
visible wavelengths in the forms of monochromatic or color images.
Hyperspectral imaging is defined as a system that is able to simultane-
ously acquire spatial images in a very large number of spectrally discrete or
contiguous bands measured from a remotely operated platform (Schaepman,
2007). By integration of the main advantages of spectroscopy and imaging,
hyperspectral imaging enables us to simultaneously provide external physi-
cal and geometrical features as well as the inside chemical properties of the
product. In other words, if conventional spectroscopy answers the question
22 Advanced Technologies for Meat Processing, Second Edition

of what and conventional imaging answers the question of where, hyper-

spectral imaging can provide the answer to the question of where is what.

2.2.2 Data Structure

A hyperspectral image is a three-dimensional (3D) hyperspectral cube (also
called a hypercube, spectral cube, data cube, or spectral volume), which com-
prises two spatial dimensions (of x rows and y columns) and one spectral
dimension (of λ wavelengths). A hypercube provides rich information about
the objective food product, including physical and geometric observations of
size, shape, color, and texture, together with chemical/molecular informa-
tion such as fat, water, protein and other hydrogen-bond constituents (Sun,
2010). The 3D dataset contains a stack of images of the same object, where
each one of them is measured at a different wavelength. Since pixels are
digitalized intensities or gray values at a certain wavelength, they are inter-
preted as integers. The intensity value of each pixel might have 8-bit gray
values meaning that 0 is the black and 255 is the white.
Figure 2.1 displays one example of the hypercube acquired from a piece of
salmon fillet. The raw hyperspectral image comprises a series of continuous
subimages and each of them presents the intensity and spatial distribution
of the tested sample at a certain waveband. It should be noted that the collec-
tive images for all wavelengths are intrinsically the same as a conventional
digital image: they both provide optical perception in a spatial domain. The
only difference exists in the number of wavelengths involved and thereby the
amount of characteristic information captured. Particularly, for a hypercube,
the object of interest in a certain subimage may either be apparent or merged
in the background and noise, based on the wavelength concerned. There-
fore, effective image analysis approaches should be carefully established and
employed to sift through useful bands, which will be discussed later.
As shown in Figure 2.1, the hyperspectral image described as I(x, y, λ) can
be viewed either as a separate spatial image I(x, y) at each individual wave-
length λ, or as a spectrum I(λ) at each individual pixel (x, y). Full spatial fea-
tures of the tested object could be viewed at a different single waveband
(pseudocolor image) as depicted in Figure 2.1 to show how the sample gives
different reflectance values at different wavelengths based on its chemical
composition. Meanwhile, spectral features can be viewed in the form of a
spectrum, which acts like a fingerprint to characterize the composition of
that particular pixel. For a given tested object, when the reflectance value
(also absorbance or transmittance) is plotted against wavelengths, the result-
ing curve is considered the spectral signature or spectral fingerprint for
that object. In essence, the spectral signature can be utilized to uniquely
identify, characterize, and discriminate between classes/types of any given
material(s) in each pixel of the image (Elmasry et al., 2012b). For instance,
salmon is a fat-rich fish with a large proportion of lipids congregated in
white stripes of connective tissue, segmenting the red-colored muscle tissue
Hyperspectral Imaging Technique 23

Image at 1050 nm
Hypercube (x, y, λ)
1.0 viewed as spatial image
0.8 at each wavelength λ
Image at 1155 nm
0.6

0.4 y
0.2 Image at 1355 nm
x
0

W
av (λ)
ele
Hypercube (x, y, λ) viewed

ng
ths y-direction
as a spectrum at every pixel

No. of pixels in
White stripe
0.4

0.3
Ref lectance

Red muscle
0.2
No. of pixels in x-direction
0.1

1000 1100 1200 1300 1400 1500 nm

Wavelengths
Spectral signatures of two different pixels.

FIGURE 2.1
The conceptual view of a hypercube for a salmon fillet.

in vertical blocks and presenting a zebra-like appearance. Figure 2.1 shows

the difference in spectral signatures between white stripe pixel and red mus-
cle pixel of the tested salmon fillet. According to Xu et al. (2016), though these
two spectra shared a similar spectral pattern, the white stripe demonstrated
higher reflectance (lower absorbance) values over the whole wavelength
range owing to different concentrations of major chemical compositions.
Therefore, it is possible to identify either white stripes or red muscles from
captured spectral signatures.

2.2.3 Image Sensing Modes

There are three common sensing modes for hyperspectral imaging, namely
reflectance, transmittance and interactance, based on the relative arrange-
ment between the light source and the optical detector (spectrograph, cam-
era, and lens). In reflectance mode, the detector collects the reflected light
from the illuminated sample in a specific conformation to avoid specular
24 Advanced Technologies for Meat Processing, Second Edition

reflection. External quality features such as shape, size, surface texture,

color, and external defects are typically detected using reflectance mode. In
transmittance mode, the detector is located in the opposite side of the light
source and captures the transmitted light penetrated through the substance.
The amount of light through the sample is normally very small but carries
more valuable information. Transmittance mode is mostly used to determine
internal ingredient concentration and detect internal defects of relatively
transparent materials such as vegetables, fruit, and fish (Wu and Sun, 2013a).
However, transmittance mode has a low signal level from light attenuation
and is affected by the thickness of the sample. Therefore, a more powerful
light source and a sensitive detector are required in this mode. Interactance
mode is a combination of transmittance and reflectance where both the light
source and the detector are located on the same side and parallel to each
other (ElMasry and Wold, 2008). Compared to reflectance mode, the inter-
actance method can detect information deeper into the sample and has less
surface effects. In addition, the interactance mode can reduce the influence
of thickness, which is a practical advantage when compared to transmis-
sion mode. However, a special setup with a light seal is required in interac-
tance mode to avoid interference from the environment, which may affect
the received light.

2.2.4 Acquisition of Hyperspectral Images

Technically, there are four approaches to acquire hyperspectral images,
which are point scanning, line scanning, area scanning, and the single-shot
method, as illustrated in Figure 2.2. The point scanning method, known as
the whiskbroom approach, is completed by acquiring a complete spectrum
of a single point (pixel) at a time and then moving either the detector or
the sample along two spatial dimensions (x and y), after which and another
spectrum is taken. The great advantage of point scanning is that the light for
every spatial element passes through the same path of the optical system.
However, it is very time consuming for positioning the sample and needs
advanced repositioning hardware to ensure repeatability. The hypercube
obtained from this configuration is stored in the band-interleaved-by-pixel
(BIP) format. This format is optimal for accessing the spectral information of
each pixel and is commonly used for microscopic imaging where the acquisi-
tion time is usually not a problem.
The line scanning method (also known as the pushbroom method) can
be regarded as an extension of the whiskbroom method. It simultaneously
records a whole line of an image rather than a single pixel, together with
spectral information corresponding to each pixel in the line at a time. A slit
of the object is imaged onto a row of pixels on one dimension of the sensor
chip and the spectrograph yields a spectrum for each point on the second
dimension of the chip. As illustrated in Figure 2.2, a special image (y, λ) with
one spatial dimension (y) and one spectral dimension (λ) is acquired at a
Hyperspectral Imaging Technique 25

y y

x x
Point scanning Line scanning

λ λ

y
y

x
x
Area scanning
Single shot

FIGURE 2.2
Four approaches to acquire hypercube I(x, y, λ).

time and the complete hypercube I(x, y, λ) is obtained as the line is scanned
along the direction of x dimension. This configuration stores a hypercube
in the format of band-interleaved-by-line (BIL). Because of its characteristics
of continuous scanning in one direction, line scanning is particularly well
suited for conveyor belt systems that are commonly used in food process
lines. Therefore, line scanning is the most popular method of acquiring
hyperspectral images for food industry applications.
Both point scanning and line scanning are spatial scanning methods,
while area scanning (also known as plane scanning) is a spectral scanning
method. This method keeps the image field of view fixed and there is no
movement at all either for the imaging unit or for the tested object itself.
This configuration acquires a 2D grayscale image (x, y) with full spatial
information at a single spectral band at a time and it repeats over the whole
wavelength range, accounting for a stack of single-band images stored in
the band sequential (BSQ) format. As the detector is exposed to only a
single wavelength each time, a suitable exposure time can be set for each
spectral band. Particularly, area scanning is suitable for applications where
the object should be stationary for a while, such as excitation-emission in
florescence imaging. However, the disadvantage is that it is not suitable for
a moving sample or the inspection of real-time delivery. Finally, the single
26 Advanced Technologies for Meat Processing, Second Edition

shot method was developed to record both spatial and spectral informa-
tion using an area detector with one exposure, making it attractive when
fast hyperspectral imaging is anticipated. Nevertheless, this method is not
fully developed and has limited resolutions for the spatial dimension and
narrow ranges for the spectral dimension. To conclude, each approach has
its own advantages, and the choice among these methods depends on the
specific application. Point scanning is useful if a small surface has to be
analyzed to find out minor compounds (i.e., impurity detection), while
area scanning is more appropriate in situations where an overview of the
sample is required and a lot of samples must be analyzed. As for the line
scanning approach, it is a typical choice for online applications where the
sample is moving.

2.3 Hyperspectral Imaging Instruments

The instrumentation of hyperspectral imaging is basic and it is very desir-
able to acquire reliable hyperspectral images with high quality in the food
industry. Therefore, the main components of a hyperspectral imaging system
will be outlined in this section and more efforts will be focused on the sys-
tem employing the line scanning method due to the fact that line scanning
is more consistent and useful for food online applications. The schematic
representation of the main configuration of a line-scan hyperspectral imag-
ing system used for nondestructive meat quality assessment at University
College Dublin (UCD), Ireland is illustrated in Figure 2.3. A typical pushb-
room hyperspectral imaging system consists of an illumination unit, a spec-
trograph coupled with C-mount lens, CCD, or complementary metal oxide
semiconductor (CMOS) cameras, and a computer equipped with image
acquisition software.

Camera
Spectrograph

Illumination unit

Sample Computer
Translation stage

FIGURE 2.3
Schematic diagram of the main components of a pushbroom hyperspectral imaging system.
Hyperspectral Imaging Technique 27

2.3.1 Illumination Unit

Light serves as an information carrier to excite or illuminate the target sam-
ple. The illumination unit is an essential part of optical inspection systems
to generate light. Choice of light sources and development of the lighting
setup are paramount to guarantee the excellent performance and reliability
of any imaging system. Typical light sources used in hyperspectral imag-
ing systems include halogen lamps, light-emitting diodes (LEDs), lasers, and
tunable sources.
Halogen lamps are usually used for illumination in the visible and NIR
spectral regions. These broadband sources cover a wide spectral range,
from 400 to 2500 nm, and are low cost (Gowen et al., 2015). Typically, a lamp
filament made of tungsten wire is housed in a quartz glass bulb filled with
halogen gas (Sun, 2010). The output light of quartz–tungsten–halogen (QTH)
lamps is generated from incandescent emission when the filament has a
high temperature. The QTH lamps are bright and work with low voltage,
and thereby they are considered all-purpose illumination sources. However,
the heat generated by a tungsten–halogen bulb is significant and may alter or
even burn the sample. In order to overcome this issue, fiber optic line lights
are usually applied to provide distance between the tungsten–halogen bulb
and sample (Gaston et al., 2010).
LED technology has developed rapidly owning to its advantages of small
size, low cost, long lifetime, fast response, low heat generation, low frequency
of bulb replacement, low energy consumption, robustness, power, coolness to
the touch without burning concerns, and insensitivity to vibration (Wu and
Sun, 2013a). Instead of having a filament for incandescent emission, LEDs are
solid-state sources that emit light when a semiconductor is electrified. LEDs
can be assembled in different arrangements (e.g., spot, line, and ring lights)
to meet different illumination requirements. With the different benefits men-
tioned above, LED lights have found application in hyperspectral imaging
systems in food inspection (Park et al., 2011). The growth of LED technology
is still ongoing with the development of new materials and electronics, and
it has great potential to become a mainstream light source.
Unlike broadband illumination sources, lasers are directional monochro-
matic light sources. Lasers have three unique properties, namely monochro-
maticity, directionality, and coherence. Lasers are widely used as excitation
sources in the application of fluorescence and Raman measurements. When
some biological materials are excited by a monochromatic beam of light with a
high energy, they will emit light of a lower energy in a broad wavelength range,
accounting for fluorescence emission or Raman scattering. In recent years,
lasers have been used as excitation sources in hyperspectral Raman imaging
(Qin et al., 2011) and fluorescence imaging (Cho et al., 2009) applications.
Tunable light sources are mostly used for area scanning hyperspectral
imaging systems. Tunable light sources put the wavelength dispersion
device in the illumination light path instead of the imaging light path, allow-
28 Advanced Technologies for Meat Processing, Second Edition

ing the detector directly performing area scanning to obtain both spatial and
spectral information from the sample. Tunable light sources are still in the
early stage of development and different wavelengths dispersion methods
are explored. Currently, hyperspectral imaging with tunable light sources
have been used for identification of fraudulent documents (Klein et al., 2008).

2.3.2 Wavelength Dispersion Devices

Wavelength dispersion devices are recognized as the core component for any
hyperspectral imaging system using broadband illuminating light sources.
Different optical and electro-optical instruments can be used to disperse
broadband light into different wavelengths so that detectors can record light
changes in specific wavelengths with associated spatial information after
light-matter interaction. Typical devices include imaging spectrographs,
bandpass filter wheels, and tunable filters.

2.3.2.1 Imaging Spectrographs

The imaging spectrograph normally operates in a hyperspectral imaging
system with line scanning mode. This optical device is capable of dispers-
ing incident broadband light into different wavelengths while preserving its
spatial information and generating a spectrum for each point on the scanned
line. The dispersed light is mapped onto the detector array and then a two-
dimensional (2D) image is constructed with one dimension representing the
spectral axis and the other containing spatial information for the scanning
line. A complete 3D hyperspectral image cube is generated after scanning
the entire surface of the sample. Most contemporary imaging spectrographs
are established based on diffraction grating, which is a collection of equally
spaced reflecting or transmitting elements separated by a distance that is on
the order of the wavelength of the light under investigation. The physical
characteristic of the diffraction grating is based on the spatial modulation of
the refractive index, by which the incident electromagnetic wave on a grat-
ing will have its electric field amplitude, or phase, or both, modified in a
predictable manner (Palmer et al., 2005).
There are two main methods for building imaging spectrographs, namely
reflection gratings (i.e., a grating laid on a reflective surface) and transmis-
sion gratings (i.e., a grating laid on a transparent surface). The imaging
spectrograph utilizing a transmission grating is based on the prism-grating-
prism (PGP) principle and no moving mechanical components are included.
Specifically, the light source, such as a halogen lamp, illuminates the object
and entrance optics, for example, a lens, captures the radiation coming from
the tested object. After passing through the entrance slit of the spectrograph,
the incoming beam is then collimated and dispersed at the PGP component
into different directions according to wavelength. At last, the dispersed light
is projected onto an area detector resulting in a 2D image; one dimension
Hyperspectral Imaging Technique 29

represents the spectral axis (λ), and the other contains one spatial dimension
(y) of the scanned line. The second spatial dimension (x) is generated by mov-
ing the sample perpendicularly to the scanning direction. As a result, hyper-
cube I(x, y, λ) is created after the surface of the sample is completely scanned.
As another main form of imaging spectrographs, a typical reflection grating
generally consists of an entrance slit, a pair of concentric spherical mirrors
coupled with an aberration-corrected convex reflection grating, and a detec-
tor. After passing through the entrance slit, the incoming light is reflected
by the lower mirror to the reflection grating, where the incident beam is dis-
persed into different wavelengths in a reflection manner. The upper mirror
then reflects the dispersed light to the detector, resulting in a continuous
spectrum at different pixels. Reflection grating is believed to have several
advantages, such as lack of higher order aberrations, high image quality, low
distortion, low f-number, and large field size (Bannon and Thomas, 2005).
Additionally, the efficiency of the reflective optical components (e.g., mir-
ror) is usually higher than that of the transmission components (e.g., prism).
Hence, reflection grating-based imaging spectrographs can provide high sig-
nal-to-noise ratio (SNR) and are more suitable for low-light measuring con-
ditions, such as fluorescence imaging and Raman imaging, which make the
reflection grating approach increasingly accepted in line-scan hyperspectral
imaging systems.

2.3.2.2 Filter Wheels

A rotatable disk called a filter wheel is the most basic implementation of
spectral imaging for wavelength dispersion. A filter wheel carries a set of
discrete bandpass filters that transmit the light at a particular wavelength
while rejecting light at other wavelengths out of the passband. Filter wheels
are relatively cheap and easy to use. Nevertheless, they have some disadvan-
tages for applications in hyperspectral imaging, such as mechanical vibra-
tion from moving parts, slow wavelength switching, low resolution, and
image misregistration owing to the filter movement. There is a broad range
of filters from UV and visible to NIR wavelength with different specifications
commercially available to satisfy different requirements.

2.3.2.3 Tunable Filters

An acousto-optic tunable filter (AOTF) is a solid-state device that works
based on acousto-optic interactions in a crystal. An AOTF can isolate a sin-
gle wavelength from a broadband source through an applied acoustic field.
The wavelength of the dispersed light is a function of the frequency of the
acoustic waves that are applied to the crystal (Sun, 2010). The AOTF only
diffracts one particular spectral band at a time, which is quite similar to
a bandpass filter with a narrow bandwidth. A liquid crystal tunable filter
(LCTF) is another commonly used tunable filter and it is established from a
30 Advanced Technologies for Meat Processing, Second Edition

series of optical stacks. A LCTF has electronically controlled liquid crystal

cells inserted between two parallel polarizers to transmit light at a specific
wavelength while eliminating light at other wavelengths. Each optical stack
comprises a combination of a birefringent retarder and a liquid crystal layer
inserted between two parallel polarizers. Both AOTFs and LCTFs are elec-
tronically tunable bandpass filters. Tunable filters have moderate spectral
resolution (approximately 5–20 nm) and a broad wavelength range covering
400 to 2500 nm. In addition, electronically tunable filters like AOTFs and
LCTFs can be flexibly controlled for various wavelengths by differentiating
the frequency of the radio frequencies using a computer, which is a major dif-
ference from fixed interference filters. Compared to the rotating filter wheels,
tunable filters have no problem of speed limitation, mechanical vibration,
and image misregistration because they have no moving parts.

2.3.3 Area Detectors

Area detectors are used to quantify the intensity of the acquired light by con-
verting radiation energy to electrical signals. The quality of hyperspectral
images are directly based on the performance of the detector. Hyperspectral
imaging systems operating in the spectral range of 400–1000 nm typically
utilize two major types of solid-state area detectors, namely, CCD and CMOS
cameras. Both types of detectors are sensitive in the wavelength region of
300–1000 nm, but typically subject to a sharp decrease in quantum efficiency
below 400 nm and above 900 nm (Gowen et al., 2015). Longer wavelength
systems require more expensive detectors, for example, InGaAs, which is
made of an alloy of indium arsenide (InAs) and gallium arsenide (GaAs).
A standard InGaAs (53% InAs and 47% GaAs) sensor is generally used for
detecting the spectra at 900–1700 nm (ElMasry et al., 2012c) and it has fairly
flat and high quantum efficiency in the NIR region. Photodiodes made of
light-sensitive materials are the basic unit of both CCD and CMOS sensors to
convert incident photons into electrons.

2.3.4 Hyperspectral Imaging System Calibration

Proper calibrations for a hyperspectral imaging system are necessary to
ensure the consistent performance of the instrument and reliability of the
acquired data. Inconsistent spectral profiles of reference spectra may be
recorded by some systems even if the environment of data measurement
is under carefully controlled conditions. The variability suggests that it is
essential to apply a standardized and objective calibration protocol. The
aims of calibration process are to (1) standardize the spectral and spatial
axes of the hyperspectral image, (2) evaluate the accuracy of the extracted
spectral and spatial data and validate the acceptability and reliability, (3)
determine whether the hyperspectral imaging system is in a stable running
condition, and (4) diagnose instrumental errors if necessary. The commonly
Hyperspectral Imaging Technique 31

used calibration methods include spatial calibration, spectral calibration,

and flat-field correction.

2.3.4.1 Spatial Calibration

Spatial calibration for hyperspectral imaging systems is intended to adjust
the field of view and estimate the spatial detection limit. There are dif-
ferent spatial calibration methods that can be used according to different
image acquisition modes for imaging systems. In area scanning mode, as
mentioned before, each single-band image at different wavelengths is a
regular 2D grayscale image with full spatial information. Therefore, spatial
calibration is carried out on a selected image with high SNR using resolu-
tion test charts, for example, the NBS 1952 Resolution Test Chart, ISO 12233
Test Chart, and 1951 USAF resolution test chart. When the same binning is
employed for the horizontal and vertical axis of the camera, the area scan-
ning systems generally provide the same resolution for both spatial dimen-
sions. However, the resolution for two spatial dimensions might be different
in line scanning systems. The y direction is parallel to the slit of the imaging
spectrograph (see Figure 2.2), and the resolution has a relationship with the
working distance, lens, imaging spectrograph, and camera. The pixels along
the x direction are acquired by the stepwise movement of the sample, and
the resolution is determined by the step size of the movement.

2.3.4.2 Spectral Calibration

The goal of spectral calibration (also called wavelength calibration) is to
identify each pixel along the spectral dimension with a specific wavelength.
Wavelength calibration will convert the form of hyperspectral data from
pixel intensity versus pixel index to intensity versus wavelength. The cali-
bration results are useful to determine the range and resolution of spectra.
Wavelength calibration is not necessary for area scanning systems because
single-band images at a series of known wavelengths are generated in area
scanning mode. However, imaging spectrograph-based line scanning sys-
tems disperse indecent light into different spectral bands, which are then
charged at different locations on the detector. Thus, the wavelength of each
pixel is usually unknown. Technically, standard emission lamps are used as
light sources to determine the correlations between distance (in pixels) on
the spectral axis and wavelength. These calibration lamps generate constant,
narrow, intense, stable, and specific lines from the excitation of different rare
gases and metal vapors. Different spectral calibration lamps are available
for different wavelength ranges from UV to infrared for different systems.
The most acceptable wavelength calibration lamps include battery-powered
lamps, pencil style lamps, and high power lamps utilizing Argon (Ar), Mer-
cury (Hg), Krypton (Kr), Neon (Ne), Mercury/Argon (Hg/Ar), Xenon (Xe),
and so forth. Once the calibration lamp is scanned by the hyperspectral
32 Advanced Technologies for Meat Processing, Second Edition

imaging system, the spectral peaks with known wavelengths as well as their
corresponding pixel indices along the spectral dimension can be identified.
Then, the relationship between wavelength and the pixel indices can be
established by a quantitative regression equation. The resulting regression
equation can be used to identify the wavelengths of all pixels along the spec-
tral dimension.

2.3.4.3 Flat-Field Correction

Due to the imperfections of each component (e.g., source, lens, spectrograph,
and camera) and different measurement environments, the acquired raw
hyperspectral images generally contain noises and artifacts. Many factors,
such as nonuniform illumination, pixel-to-pixel sensitivity variations of the
detector, and dust on the lens, will contribute to different image artifacts,
leading to the raw images not suitable for quantitative analysis. Flat-field
correction (also known as reflectance calibration) can be performed to cali-
brate the raw intensity image into a relative (or percent) reflectance or absor-
bance image and remove the effects of the noise and artifacts. White diffuse
reflectance panels, which have high, uniform, stable, and flat reflectance over
a broad spectral range (about 99.9% reflectance), are generally employed as
standards for the reflectance calibration. The dark current image (about 0%
reflectance) is obtained with the light source completely off and the camera
lens completely covered. These two reference images are then used to correct
the original hyperspectral images using the following equation:

I S − ID
R= (2.1)
I W − ID

where R is the relative reflectance image, I S the raw hyperspectral image, ID

the dark image, and I W the white reference image. The original image can
also be corrected into absorbance (A) by taking logarithms of Equation 2.1 as

⎛ I −I ⎞
R = − log 10 ⎜ S D ⎟ (2.2)
⎝ I W − ID ⎠

Figure 2.4 shows an example of flat-field correction for a hyperspectral

image of a salmon sample. The plot displayed in Figure 2.4a consists of origi-
nal spectra extracted from three hyperspectral images (i.e., salmon sample,
white calibration tile made of Teflon [Gilden Photonics Ltd., Glasgow, UK],
and dark current). The white panel is observed to have the highest inten-
sity values and the dark current is relatively low and flat over the whole
wavelengths. A relative reflectance spectrum of the sample (Figure 2.4b) is
achieved by performing Equation 2.1 and this spectrum is suitable for the
subsequent spectral data analysis.
Hyperspectral Imaging Technique 33

Intensity (CCD count) 3000

2500
White panel
2000
1500
1000 Salmon sample
500
Dark current
0
1000 1100 1200 1300 1400 1500
Wavelength (nm)
(a)
0.4

0.3
Ref lectance

Salmon sample
0.2

0.1

0
1000 1100 1200 1300 1400 1500
Wavelength (nm)
(b)

FIGURE 2.4
Flat-field correction for hyperspectral image. (a) Raw reflectance spectra. (b) Relative reflec-
tance spectrum after flat-field correction.

2.4 Hyperspectral Imaging Data Processing

and Multivariate Analysis
2.4.1 Image Segmentation
Segmentation is the process that divides an image into disjoint objects or
regions and locates the regions of interest (ROIs) in a form of mask for fur-
ther spectral and textural feature extraction. Technically, image segmenta-
tion can be obtained by attempting to detect either the discontinuity of object
boundaries or the similarity of regions in an image. Discontinuity is defined
as the abrupt changes of intensity, and the places where discontinuity occurs
are named edges. On the other hand, the approach based on similarity is to
identify the relatively homogeneous regions which are believed to be similar
according to the predefined criteria. There are some classic techniques for
image segmentation, such as thresholding, morphological processing (such
as erosion, dilation, open, close, and watershed algorithms), and edge-based
segmentation.
With a hyperspectral image, each pixel contains a vector of intensity values
and this vector is well recognized as the spectral signature. Therefore, image
34 Advanced Technologies for Meat Processing, Second Edition

segmentation can be achieved by classifying pixels into background and the

tested object based on the spectral difference. Spectral image segmentation,
which is regarded as a higher level analysis compared to traditional seg-
mentations, actually integrates segmentation and classification into a single
process.

2.4.1.1 Thresholding and Morphological Processing

Thresholding is popularly used to separate samples from the background
because it is easy to use and it can provide relatively good results. Better
performance can be obtained for the image containing the object against a
contrasting background. When ROIs present a high gray level on a low gray
level background, the thresholding image J ( x , y ) can be defined as

⎧⎪ 1, if I ( x , y ) ≥ T
J ( x, y ) = ⎨ (2.3)
0, otherwise
⎩⎪

where I ( x , y ) represents the original image, and T is the threshold value.

Therefore, all pixels at or above the threshold are assigned value 1 corre-
sponding to the ROI, whereas pixels corresponding to the background are
assigned value 0. Global thresholding, which is known as the simplest thresh-
olding technique, is accomplished by partitioning the image histogram with
a single global threshold and it is widely acceptable in hyperspectral image
processing. This approach is competent when the gray level histogram is
bimodal and the threshold T is appropriately selected. Morphological pro-
cessing is flexible and powerful for image segmentation and it can be uti-
lized if the initial segmentation by thresholding is not satisfactory. Binary
morphological processing consists of typical neighborhood operations by
sliding a structure element containing any complement of 0s and 1s with
any size over the image. Erosion and dilation are two primitive operations
of morphological processing techniques. Specifically, erosion is the process
to eliminate all the pixels on object boundaries in an image, while dilation is
the process of incorporating pixels to the boundaries of objects.
Figure 2.5 demonstrates examples of hyperspectral image segmentation
by using the thresholding technique. The spectra of three pixels belong to
the salmon sample and three pixels of background were randomly selected
and presented in the form of a plot (Figure 2.5a). A grayscale image at a
waveband of 1400 nm (B2) was obtained due to the high contrast between
the sample and the background (Figure 2.5b). Simple histogram threshold-
ing (value of 0.3) was determined and it subsequently produced a segmented
image for the whole sample. Then, morphological operations were imple-
mented to boost the segmentation performance. This method is simple and
useful; however, as we can see from the final mask (Figure 2.5b), some pix-
els of the sample were wrongly classified into the background. Figure 2.5c
Hyperspectral Imaging Technique 35

0.5

0.4
Background
Ref lectance

0.3

0.2
Salmon sample
0.1

0
B1 B2
1000 1100 1200 1300 1400 1500
Wavelength (nm)
(a)
Raw image at B2 Mask 1

Thresholding

Histogram Morphological
processing
400 Thresholding
300 value = 0.3
200
100
0 Final mask
0 0.2 0.4 0.6 0.8 1.0
(b)
Image obtained after B1-B2 Mask 1

Thresholding

Histogram Morphological
processing
1600
Thresholding
value = 0.01
800

0
–0.05 0 0.1 0.2 0.3 Final mask
(c)

FIGURE 2.5
Hyperspectral image segmentation by thresholding.

shows another thresholding method that is widely used in hyperspectral

imaging processing (Barbin et al., 2013c; Kamruzzaman et al., 2011). Two
images were selected, one with high (B1 of 1077 nm) and the other with low
reflectance values (B2 of 1400 nm), and subtracted from each other to obtain
36 Advanced Technologies for Meat Processing, Second Edition

a grayscale image. This grayscale image has uniform gray level within the
entire sample region and no extreme pixel can be observed. All the pixels in
the background were set to approximately 0 because each spectrum of back-
ground remains constant along the whole wavelength region. As a result, a
thresholding value of 0.01 was obtained and a final mask was generated. As
shown, the segmentation result was greatly improved.

2.4.1.2 Spectral Image Segmentation

Classification-based techniques intend to partition pixels into several classes
based on various classification methods. Generally, they can be categorized
into two groups, supervised and unsupervised, where output target values
of learning samples are involved in the former and missing in the latter.
There are a great number of supervised techniques, such as support vector
machines (SVMs), artificial neural networks (ANNs), and Bayesian classifi-
cation, among which Bayesian classification is considered as the most com-
monly used method (Kleynen et al., 2005). Unsupervised classification does
not offer guidance in the learning process because of lack of target values
and the widely used methods include K-means and principal component
analysis (PCA). K-means is a classical dynamic clustering algorithm and is
simple in theory and fast in computation. It intends to partition the image
into K clusters so that intercluster similarity is low and intracluster simi-
larity is high. K-means has been successfully implemented in hyperspectral
image segmentation (Piqueras et al., 2011).
Meanwhile, PCA is a mathematical approach used to segment a hyper-
spectral image by seeking the maximum variances from the original
image. It decomposes the raw hyperspectral image into several score
images described by a small amount of uncorrelated data (principal com-
ponents [PC]) and loadings (eigenvectors). The first and the second PC
score images usually interpret the highest variance. Figure 2.6 shows an
example of using PCA for identification of the loin eye, fat part, and mar-
bling pixels in a piece of pork meat (Barbin et al., 2012a). The first two PCs
were used to compose the score plot for identifying the pixels with similar
spectral signatures. This plot represents the most useful information of the
original image due to the highest variance and the lowest correlation to
avoid the colinearity of the spectral data. Since each material has a unique
spectral signature based on different physicochemical properties, the loin
eye reveals a distinctive spectral signature compared with fat portions and
any other muscles adjoining the loin eye. Pixels with similar spectral sig-
natures were projected together as one cluster in the 2D scatter plot, which
facilitates its identification in the PC score image and consequently in the
original image. The correspondent pixels recognized in the score plot were
highlighted in the PC score image simultaneously, which allowed for the
identification of the corresponding clusters, namely loin eye, fat, and mus-
cles adjacent to the loin eye.
Hyperspectral Imaging Technique 37

PCA

PC1 image PC2 image

PC score image
Hyperspectral image
with no background Scatter plot

Segmentation
PC2 (3.5%)

PC2 (3.5%)

PC1 (95.1%)
PC1 (95.1%) Segmented image
Score plot

FIGURE 2.6
Principal component analysis (PCA) classification-based segmentation method for hyperspectral
images. (Adapted from Barbin, D. et al., Meat Science, 90, 259–268, 2012a.)

2.4.2 Spectral Preprocessing

After image segmentation, spectral data can be extracted from different ROIs,
which present different quality features in the calibrated image. Spectral pre-
processing algorithms are mathematically used to improve the spectral data.
They aim to correct undesired effects such as random noise, length variation
of light path, and light scattering resulting from variable physical sample
properties or instrumental effects, to produce a robust model with the best
predicting ability. This step is generally performed prior to multivariate
modeling so as to reduce, eliminate, or standardize the impact on the spec-
tra and to greatly enhance the robustness of the calibration model (Reich,
2005). The most widely used preprocessing algorithms include smoothing,
derivatives, standard normal variate (SNV), multiplicative scatter correction
(MSC), Fourier transform (FT), and some new methods including orthogonal
signal correction (OSC) and wavelet transforms (WTs) (Luypaert et al., 2004).
Smoothing, which includes moving smoothing and Savitzkye–Golay
smoothing (Savitzky and Golay, 1964), can be applied to eliminate noises in
the raw spectra without reducing the number of spectral variables. Generally,
smoothing is combined with other preprocessing techniques to accomplish
the denoising function. Derivatives (mainly first and second derivatives) are
38 Advanced Technologies for Meat Processing, Second Edition

performed to correct baseline effects in spectra, remove background, and

increase spectral resolution. The second derivative also has the function of
resolving nearby peaks and sharpening spectral features. Figure 2.7a and b
shows original and processed spectra by the Savizkye–Golay second deriva-
tive with a window width of 15. It can be observed that the peaks and valleys
not very obvious in raw spectra became clear after preprocessing.
SNV and MSC intend to remove the multiplicative interferences of scatter,
particle size, and the change of light distance (Blanco et al., 1997). In order to
remove slope variations on individual spectrum basis, each object is trans-
formed independently using the following calculation:

∑
m
( X i − X )2
i=1
X i ,SNV = (X i − X )/ (2.4)
(m − 1)

where X i ,SNV is the ith variable in the transformed spectrum after SNV pre-
processing, X i is the ith variable, and X is the average of all variables in the
raw spectrum, respectively, i = 1, 2, 3, … , m, where m is the number of wave-
length variables in the spectrum. Figure 2.7c shows spectra processed by the
SNV algorithm, and it is observed that the baseline shift was successfully

×10–3
0.9 4
0.7
Ref lectance

2
0.5 0
0.3 –2
0.1 –4
1000 1100 1200 1300 1400 1500 1000 1100 1200 1300 1400 1500
Wavelengths (nm) Wavelengths (nm)
(a) (b)
2
0.5
1 0.4
0.3
0 0.2
0.1
–1
0
1000 1100 1200 1300 1400 1500 1000 1100 1200 1300 1400 1500
Wavelengths (nm) Wavelengths (nm)
(c) (d)

FIGURE 2.7
Near-infrared (NIR) spectra of salmon samples obtained from (a) raw data, (b) Savizkye–
Golay second derivative, (c) standard normal variate, and (d) extended multiplicative signal
correction.
Hyperspectral Imaging Technique 39

removed. Extended multiplicative signal correction (EMSC) is considered an

extension of MSC that can be used to eliminate additional unwanted inter-
ferences in the signal (Martens and Stark, 1991). This method cannot only
correct the spectra for multiplicative effects but can also correct the baseline
of the spectra and suppress the effect of known interfering compounds. This
method outperforms MSC in many cases (Esquerre et al., 2012). The perfor-
mance of EMSC with the default setting in MATLAB® 8.6 R2015b software
(The Mathworks Inc., MA, USA) is displayed in Figure 2.7d.

2.4.3 Multivariate Analysis

As mentioned previously, hyperspectral imaging contains huge amount of
spectral and spatial data; therefore, a combination of multivariate chemo-
metrics and visualization tools to appropriately extract desired information
in an efficient way is undoubtedly required. Chemometric techniques are
mathematical and statistical methods which decompose a massive quantity
of features into simple and easier interpretable structures, which enable the
establishment of easier to understand relationship between hyperspectral
data and the desired attributes of tested samples (Bro et al., 2002). Multi-
variate techniques commonly applied in spectral data can be classified into
multivariate classification for qualitative analysis and multivariate regres-
sion for quantitative analysis.

2.4.3.1 Multivariate Classification

Qualitative classification, also called pattern recognition, can be further
divided into unsupervised and supervised classification. Unsupervised
classification is accomplished based on the natural characteristics, which
can be correlation, distance, or some combination of both, requiring no prior
knowledge about the class information of the data. Generally, it is quite useful
for preliminary evaluation of the information contents in the spectral dataset.
Typical unsupervised classification algorithms for the analysis of hyperspec-
tral data include hierarchical clustering, K-means clustering, and PCA.
PCA is a dimension-reduction tool, which can reduce a large set of vari-
ables to a small set but retain most of the information in the original data-
set. It is a mathematical procedure that transforms a number of (possibly)
correlated variables into a (smaller) number of uncorrelated variables called
PCs. The first PC interprets as much of the variability in the data as possible,
and each succeeding component accounts for as much of the remaining vari-
ability as possible. PCA decomposes the data matrix X (m samples and n
variables) as the sum of the outer product of vectors ti and pi plus a residual
variance (Penha and Hines, 2001):

X = t1 p1T + t2 p2 T + t3 p3 T + … + tk pk T + E = Tk Pk T + E (2.5)
40 Advanced Technologies for Meat Processing, Second Edition

where ti vectors refer to principle component scores and provide informa-

tion on how the samples are correlated with each other, and pi vectors are
the eigenvectors of the covariance of data matrix X. These eigenvectors are
known as the PC loadings, which reveal how variables are related to each
other. In other words, the PCA model aims to split the matrix X in two parts:
one accounts for the system variation (the process model Tk Pk T ) and the other
captures the noise or unmodeled information (residual variance E). This
division is able to reduce the dimensionality and eliminate the redundant
information existent in highly correlated variables of the original dataset.
Figure 2.8 demonstrates an example of PCA model used to evaluate spec-
tral variations in chicken meat, lamb, and salmon. Each data point in the
score plot represents a spectrum of the sample. This plot was established
for exploration and identification of any special features (clusters or group-
ings) within the data set. As shown, all sample points were generally clus-
tered into three groups based on their first three PCs, which account for
91.26% of the total variance. Loading plots in Figure 2.8 can be used to
identify important variables that are responsible for the specific features
appearing in the corresponding scores. Generally, several wavelengths
with high (local maxima) and low (local minimum) values from the PC
loadings should be selected as the dominant wavelengths which contribute
most to the classification performance. As the most frequently used unsu-
pervised technique for qualitative classification, PCA has proved useful in
initial investigation of many meat species to visualize the spectral data and

0.04
0.02 Chicken
Scores on PC3 Lamb
0
(0.68%) –0.02 Salmon
–0.04

Sc 0.04 0.4
or
e 0 0.2 PC1
(2 s on –0 0 on )
.17 P .0
%) C2 4 –0.2 res
Sco 88.41%
(

0.15 0.2
0.15

0 0 0

–0.15 –0.2 –0.15

1000 1200 1400 1600 1000 1200 1400 1600 1000 1200 1400 1600
Wavelengths (nm) Wavelengths (nm) Wavelengths (nm)
Loadings for PC1 Loadings for PC2 Loadings for PC3

FIGURE 2.8
Example of PCA model performance to analyze chicken meat, lamb, and salmon using NIR
hyperspectral imaging.
Hyperspectral Imaging Technique 41

to examine any possible grouping of samples according to spectral features

(Kamruzzaman et al., 2012a; Wu et al., 2012).
Supervised pattern recognition intends to establish a classification model
to group new unknown samples into predefined known classes on the basis
of their measured features. Linear discrimination analysis (LDA) and par-
tial least squares-discriminant analysis (PLS-DA) are typical chemometric
techniques for supervised classification of the spectra and they are increas-
ingly used in hyperspectral data analysis for classification and discrimina-
tion problems (Chevallier et al., 2006). LDA aims to find optimum boundaries
among classes by maximizing the ratio of between-groups variance and min-
imizing the ratio of within-groups variance. PLS-DA is based on the partial
least squares regression (PLSR) approach and seeks the optimum separation
of classes by encoding each dependent variable of PLSR with dummy vari-
ables interpreting the classes. When performed using the PLS2 algorithm, the
dependent Y matrix in the PLS-DA model has as many columns as classes,
and as many rows as samples used for the calibration. This is known as the
dummy matrix and it contains only 1’s and 0’s, indicating that the spectrum
belongs or not belongs to a specific class, respectively. Technically, a thresh-
old must be set in the predictions because the results will not be either a
1 or a 0 perfectly.
Machine learning methods, including SVM, artificial neural networks
(ANN), and random forests (RF), have also been applied in the supervised
multivariate analysis. Among them, RF is a powerful statistical classifier,
which is well established in many disciplines but is relatively unknown in
the food research area. It has been shown effective when applied for classi-
fication of hyperspectral data (Lawrence et al., 2006). As the name suggests,
the RF classifier first generates many classification trees and then combines
the predictions to provide a more accurate classification result (Cutler et al.,
2007). The trees are fully grown and each can be used to predict the out-of-
bag (OOB) observations. The predicted class is calculated by majority vote
of the OOB predictions, with ties split randomly. Accuracies and error rates
are calculated for each observation, and then averaged over all observations.
Meanwhile, SVM has also been successfully used for NIR classification tasks,
such as material identification (Langeron et al., 2007) and food discrimina-
tion (Chen et al., 2007). This method aims at finding the optimal separation
surface between classes on the basis of the identification of support vectors
which are the most representative training samples of the side of the class
(Mercier and Lennon, 2003). If the training data are not linearly separable, a
kernel method is applied to simulate a nonlinear projection of the data in a
higher dimension space, where the classes are linearly separable.

2.4.3.2 Multivariate Regression

The goal of multivariate regression is to establish a quantitative rela-
tionship between the desired physical, chemical, or biological attributes
42 Advanced Technologies for Meat Processing, Second Edition

of the tested sample and its spectrum response. The most widely used
multivariate linear regression methods are multiple linear regression
(MLR), principle component regression (PCR), and PLSR. MLR establishes
a relationship between the spectrum and its target features with explana-
tory or predictive purposes in the form of a linear equation. It is simple
and easy to interpret. The regression coefficients (RCs) of the equation are
estimated by the process of minimizing the error between reference and
predicted values in a least squares sense. MLR typically does not perform
well when the number of variables is more than that of samples and is
easily affected by high collinearity between the variables. PCR is a two-
step multivariate method that consists of PCA and MLR. The PCs are first
computed by the PCA model and then used as independent variables in
MLR to replace the original variables. Compared to MLR, the PC calcula-
tion in PCR makes the independent variables uncorrelated and less noisy.
However, PC calculation does not take the reference values of depen-
dent variables into consideration; therefore, the achieved PCs may be not
informative with respect to the response variables. On the other hand,
PLSR decomposes both the spectra (independent variables) and proper-
ties of objects (dependent variables) simultaneously. During the decom-
position process, dependent variables are actively considered to extract
a set of orthogonal factors called latent variables (LVs) to ensure that the
first several LVs are the most related for predicting dependent variables.
The number of LVs to be extracted relies on the prediction error, typically
determined by cross-validation.
When the spectra of the tested sample and its quality are not linearly
related, nonlinear methods, such as ANN and support vector regression
(SVR), are very suitable for analysis. ANN is inspired by the behavior of
biological neural networks and is used for learning and prediction purposes.
The most widely used ANN technique is the multilayer feed forward neural
network where the artificial neurons are arranged into three layers of input,
hidden, and output layer. The intensity or reflectance value at each spectral
wavelength is fed to the input layer, while the output layer exports the predic-
tion of the target attribute. A feed forward neural network usually involves
more than one hidden layer, which makes the network capable of processing
nonlinear and complex correlation. SVR employs a nonlinear map function
and the input is first mapped to a high-dimensional feature space, then a lin-
ear regression is established in this space. There are two methods to build an
SVR model, epsilon-SVR and nu-SVR, and the difference lies in the fact that
nu-SVR introduces and uses parameter nu to control the number of support
vectors while epsilon-SVR uses parameter epsilon. The radial basis function
(RBF) kernel is normally used as the kernel function of epsilon-SVR to deal
with the linear and nonlinear relationships between the spectral informa-
tion and target attributes. Both ANN and SVM are able to deliver promising
solutions in different classification and regression tasks.
Hyperspectral Imaging Technique 43

2.4.3.3 Model Evaluation

To perform either qualitative classification or quantitative regression using
hyperspectral imaging, data must be trained or calibrated to develop a
model to relate spectral data with the real properties of these samples. This
is generally carried out by first selecting representative calibration samples
(which span the values of attributes under investigation) and then building
a multivariate model. The established model is subsequently validated by
cross-validation or/and the prediction process with a new set of samples.
Cross-validation is a method to measure generalization error by using hold-
out data. Leave-one-out cross-validation and venetian blinds cross-validation
methods are widely used to validate hyperspectral data.
Within the processes of quantitative regression, the performance of a cali-
bration model is usually evaluated by the following criteria: standard error
of calibration (SEC) and standard error of prediction (SEP), root mean square
error of calibration (RMSEC), root mean square error of cross-validation
(RMSECV) and root mean square error of prediction (RMSEP), coefficients
of determination of calibration (r 2 C ), coefficients of determination of cross-
validation (r 2 CV ) and coefficients of determination of prediction (r 2 P ), and
residual predictive deviation (RPD). Generally, a good model would present
higher values of r 2 C , r 2 CV, r 2 P, and RPD, lower values of SEC, SEP, RMSEC,
RMSECV, and RMSEP, with a small difference between SEC and SEP (Wu
and Sun, 2013a).
When it comes to qualitative classification, the performance of each estab-
lished model can be evaluated by calculating the correct classification rate
(CCR) in calibration, validation, and cross-validation, which is expressed
according to the following equation:

N1
CCR = × 100% (2.6)
N2

where N 1 is the number of correctly classified samples and N 2 is the total

number of samples. Meanwhile, model performance can also be statistically
evaluated by using the sensitivity, specificity, and class error:

TP
Sensitivity = (2.7)
TP + FN

TN
Specificity = (2.8)
FP + TN

Sensitivity + Specificity
Class error = 1 − (2.9)
2
44 Advanced Technologies for Meat Processing, Second Edition

In Equations 2.7 through 2.9, TP and TN refer to true positive and true nega-
tive, respectively, resulting in the samples that have been correctly assigned
as belonging (TP), or not belonging (TN), to a specific class. FP and FN
denote false positive and false negative, respectively, accounting for the
samples that have been wrongly assigned as belonging (FP), or not belong-
ing (FN), to a specific class (Amigo et al., 2015). Another important statistic
evaluation often used in classification is the receiver operator characteris-
tics (ROC) curves, which are graphical plots that present the performance of
the classification as its discrimination threshold (relationship between the
specificity and sensitivity) is varied. The closest point in the ROC curve to
the top left corner of the chart usually results from an optimal threshold.
The best prediction model would generate a point in the upper left corner
or coordinate (0, 1) of the ROC space, representing 100% sensitivity (no false
negatives) and 100% specificity (no false positives). The area under the ROC
curve (AUC) can also be applied to compare general classification perfor-
mances due to its statistical property: the AUC of a classifier is equivalent
to the probability that the classifier will rank a randomly chosen positive
instance higher than a randomly chosen negative instance.

2.4.4 Selection of Important Wavelengths

It is very critical to select the most important wavelengths in hyperspec-
tral imaging in order to optimize data analysis and save computation time.
Irrelevant wavelength elimination and spectral dimension reduction are
necessary in spectral data analysis. According to Wold et al. (1996), effec-
tive wavelengths may be equally or more efficient than full wavelengths in
many situations. The elimination of irrelevant wavelengths can predigest
calibration modeling and enhance the results in terms of accuracy and
robustness. Besides, contiguous wavelengths are likely to have a problem
of multicollinearity, which refers to strong correlations among the indepen-
dent variables (wavelengths). The selection of spectral variables can mini-
mize the collinearity among contiguous wavelengths. Once a few optimal
wavelengths with characteristic information are collected, a multispectral
imaging system with the advantages of simple structure and low cost can be
developed and it will be incomparable for process monitoring and real-time
inspection.
There are numerous mathematical selection algorithms developed for
choosing optimum wavelengths. Some classical methods include correlation
coefficients, analysis of spectral differences (ASD), spectrum derivatives,
and stepwise regression. Simulated annealing (SA) and genetic algorithms
(GAs) are two elaborate search-based strategies. Interval-based algorithms
usually include interval partial least squares (iPLS), windows PLS, and back-
ward interval partial least squares (biPLS). The choice of a particular method
should be determined by the nature of the problem, ease of implementation,
the size of the data set, and economic feasibility (ElMasry and Wold, 2008).
Hyperspectral Imaging Technique 45

2.5 Online Applications for Meat

Quality and Safety Assessment
From its manifestation as a means of remote sensing exploration, to its current
success in several distinct applications, hyperspectral imaging has established
itself as a key analytical tool for nondestructive quality and safety evaluation
of meat and meat products. When implemented in processing lines, hyper-
spectral imaging systems enable further increasing throughput by providing
precise inspection control over key steps in the production and packaging pro-
cess. Stimulated by rapid advances in instrumentation, software, and algorith-
mic developments as well as chemometrics, hyperspectral imaging has found
use in many important applications in the meat industry such as classification
or sorting of meat into different groups based on quality traits, such as color,
fat, protein, and moisture, either to screen or eliminate lower quality products
before processing or packaging or to sort a single meat source into a quality
stack. Meanwhile, it is applied for uniformity control and inspection purposes
to identify meat adulteration and exclude contaminated or substandard meat
sources from the food chain with minimal additional cost. There are a number
of areas for which hyperspectral imaging holds great potential in online quality
and safety evaluation of meat and meat products, as summarized in Table 2.1.

TABLE 2.1
Applications of Hyperspectral Imaging for Quality and Safety Evaluation of Meat
Imaging Spectral Data
Products Mode Range (nm) Applications Analysis References
Poultry Reflectance 385–735 Differentiation of Fuzzy Chao et al.
carcass wholesome and algorithm (2007)
unwholesome
chicken
Reflectance 400–1000 Fecal detection Image Park et al.
and wholesome- processing (2010)
ness inspection algorithm
Fluorescence 425–711 Skin tumor SVM, PCA Du et al.
detection (2007)
Reflectance 447–733 Skin tumor FS-MBB, Nakariyakul
detection KNN and Casasent
(2007)
Reflectance/ 400–1000 Bone fragment PCA Yoon et al.
transmittance detection (2008)
Reflectance 900–1700 TVC prediction PLSR Feng and Sun
(2013a)
Reflectance 900–1700 Pseudomonas PLSR Feng and Sun
loads (2013b)
Reflectance 900–1700 Enterobacteria- PLSR Feng and Sun
ceae loads (2013)
(Continued)
46 Advanced Technologies for Meat Processing, Second Edition

TABLE 2.1 (Continued)

Applications of Hyperspectral Imaging for Quality and Safety Evaluation of Meat
Imaging Spectral Data
Products Mode Range (nm) Applications Analysis References
Reflectance 400–1000 Hydroxyproline PLSR Xiong et al.
content in (2015b)
chicken meat
Reflectance 400–1000 Springiness of fresh PLSR, Xiong et al.
chicken meat ANN (2015a)
Fish Interactance 400–1000 Freshness PCA, Sivertsen
assessment of PLSR, et al. (2011)
cod KNN
Reflectance 400–1000 Sensory QIS in LS-SVM Cheng and
grass carp fillet Sun (2015a)
Interactance 760–1040 Distribution of fat PLSR Segtnan et al.
and salt contents (2009)
Reflectance 899–1694 Fat content in PLSR Zhu et al.
Atlantic salmon (2014)
fillets
Interactance 448–752 Nematodes GML Sivertsen
detection in cod classifier et al. (2012)
fillets
Reflectance 400–1700 TVC of salmon PLSR, Wu and Sun
fillets LS-SVM (2013d)
Reflectance 400–1000 Enterobacteria- PLSR Cheng and
ceae loads in Sun (2015b)
grass carp
Reflectance 380–1030 Discrimination of LS-SVM Zhu et al.
fresh and (2013)
frozen-thawed
halibut fillets
Reflectance 400–1000 Categorization of PCA, Sone et al.
salmon fillets KNN (2012)
stored under
different
atmospheres
Reflectance 400–1000 Distinguish PLS-DA Ivorra et al.
expired and (2013)
nonexpired
vacuum-packed
salmon
Red meat Reflectance 900–1700 Color, pH, and PLSR ElMasry et al.
tenderness of (2012c)
fresh beef
Reflectance 900–1700 Color, pH, and PLSR Barbin et al.
drip loss of pork (2012b)
(Continued)
Hyperspectral Imaging Technique 47

TABLE 2.1 (Continued)

Applications of Hyperspectral Imaging for Quality and Safety Evaluation of Meat
Imaging Spectral Data
Products Mode Range (nm) Applications Analysis References
Reflectance 400–1000 Beef marbling MLR Li et al. (2011)
grade
Reflectance 400–1000 Pork tenderness MLR Tao et al.
(2012)
Reflectance 900–1700 Lamb tenderness PLSR Kamruzza-
man et al.
(2013)
Reflectance 400–1000 Beef tenderness FLD, SVM, Konda
DT Naganathan
et al. (2016)
Reflectance 380–1700 Moisture content MLR Wu et al.
in beef (2013)
Reflectance 900–1700 Water, fat, and PLSR ElMasry et al.
protein contents (2013)
of beef
Reflectance 400–1000 Fat content in SAM, Lohumi et al.
beef EDM (2016)
Reflectance 1000–2500 Moisture content PLSR Liu et al.
of porcine meat (2014b)
Reflectance 400–1000 Moisture content PLSR Ma et al.
in pork (2016)
Reflectance 900–1700 Moisture, protein, PLSR Barbin et al.
and fat of intact (2013a)
and minced
pork
Reflectance 900–1700 Moisture, protein, PLSR Kamruzza-
and fat content man et al.
in lamb (2012b)
Reflectance 400–1000 Moisture content MLR Kamruzza-
in beef, lamb, man et al.
and pork (2016b)
Reflectance 900–1700 TVC and PPC in PLSR Barbin et al.
pork (2013b)
Reflectance 472–1000 TVC in pork SMLR Tao and Peng
(2015)
Reflectance 400–1000 pH of salted pork PLSR Liu et al.
meat (2014a)
Reflectance 400–1000, Drip loss of PLSR Xie et al.
900–2500 frozen pork (2015)
Reflectance 900–1700 Drip loss of lamb PLSR Kamruzza-
man et al.
(2012c)
(Continued)
48 Advanced Technologies for Meat Processing, Second Edition

TABLE 2.1 (Continued)

Applications of Hyperspectral Imaging for Quality and Safety Evaluation of Meat
Imaging Spectral Data
Products Mode Range (nm) Applications Analysis References
Reflectance 900–1700 WHC in fresh PCA ElMasry et al.
beef ,PLSR (2011)
Reflectance 400–1000 WHC in beef, PLSR, Kamruzza-
lamb, and pork LS-SVM man et al.
(2016a)
ANN, artificial neural network; DT, decision tree; EDM, Euclidian distance measure; FLD,
Fisher’s linear discriminant; FS-MBB, forward selection-modified branch and bound;
GML, Gaussian maximum likelihood; KNN, K-nearest neighbor; LS-SVM, least
squares-support vector machine; MLR, multiple linear regression; PCA, principal
component analysis; PLS-DA, partial least squares-discriminant analysis; PPC,
psychrotrophic plate count; PLSR, partial least squares regression; QIS, quality index
scores; SAM, spectral angle measure; SVM, support vector machines; TVC, total viable
counts; WHC, water holding capability.

2.5.1 Poultry Carcass

The Poultry Products Inspection Act of 1957 requires the United States Depart-
ment of Agriculture’s Food Safety and Inspection Service (FSIS) to inspect all
domesticated birds when slaughtered and processed into products by a com-
mercial facility. Since then, on-site organoleptic inspection is carried out on
each chicken carcass processed at U.S. poultry plants for indications of dis-
eases or defects and it is usually accomplished by sight and by touch for the
body, the inner body cavity surfaces, and the internal organs during process-
ing operations. Each inspector employed in FSIS is limited to a maximum of 35
birds per minute and an inspector working more than eight hours per day in
these conditions tends to develop repetitive motion injuries and fatigue prob-
lems. As a result, fast and automatic methods for precise inspection are nec-
essary in the poultry industry for efficient management. In recent years, the
hyperspectral imaging technique has been extensively implemented for safety
and quality evaluation and monitoring of chicken and poultry carcasses in
offline and online applications through many research endeavors (Feng and
Sun, 2014; Park et al., 2007). The widely conducted research of hyperspectral
imaging systems in poultry quality and safety evaluation is mostly focused on
the differentiation between unwholesome and wholesome freshly slaughtered
chickens or identification of different contaminants or tumors on the surface
of the poultry carcasses. In fact, some online hyperspectral imaging detection
systems for inspection of poultry carcasses have been successfully installed
and implemented (Chao et al., 2008). Generally, the spectral image is first cap-
tured for each poultry carcass along the processing line, and then the image
is processed by computer software and the result to determine whether or not
the chicken has a contaminant, disease, or systemic defects will be obtained in
seconds (Chao et al., 2014).
Hyperspectral Imaging Technique 49

2.5.1.1 Contamination Detection

Undoubtedly, consumers require some assurance that the poultry product
available for purchase is wholesome and without any food safety hazards.
Contamination of poultry carcasses with bacterial food-borne pathogens
potentially results from exposure of the animal carcass to fecal materials
during or after slaughter. Microbial pathogens are likely to be transmitted
to humans after consumption of contaminated undercooked or mishandled
poultry meat. In the United States, about 9000 deaths and 6.5–33 million
illnesses each year are food related (Park et al., 2002). As a result, fecal and
ingesta contaminants on poultry carcasses are prohibited in order to reduce
the risk of an adverse health effect. For safety purposes, the successful
identification of poultry carcasses contaminated by feces and/or ingesta is
critical to protect the public health from a potential source of food-borne ill-
nesses. Generally, the color of fecal material ranges from different shades of
yellow to green, brown, and white and the consistency of feces is normally
semisolid to paste. These guidelines are used by inspectors to prevent visibly
fecal-contaminated carcasses from entering the chilling tanks. In addition to
being very tedious, this manual inspection method is not only labor-intensive
but also prone to both human error and inspector-to-inspector variation.
Hyperspectral imaging systems with different designs have been developed
for the identification of fecal matter and ingesta on the surfaces of poultry
carcasses. Intensive research has been conducted by the USDA Agricultural
Research Service (ARS) for calibrating hyperspectral imaging systems, iden-
tifying spectral signatures of different contaminants, building models for
fecal detection, and exploiting the system in online multispectral applica-
tions (Chao et al., 2008; Park et al., 2007). Park et al. (2006) attempted to find
out the optimal supervised classification algorithms for the identification of
fecal and ingesta contaminants on the surfaces of poultry carcasses. In this
research, a pushbroom hyperspectral imaging system was used to acquire
hyperspectral images, with 512 narrow bands ranging from 400–900 nm.
Three different feces from digestive tracts (duodenum, ceca, and colon) and
ingesta were regarded as contaminants. Figure 2.9 shows typical hyper-
spectral images of an uncontaminated carcass, surface contaminants with
regions of interest (ROIs), and the corresponding spectra from each ROI. As
shown, 25 pixels were recognized as duodenum, 27 pixels as ceca, 78 pixels
as colon, 93 pixels as ingesta, and 195 pixels as skin of different locations of
thigh, breast, and wing. The reflectance spectra of skin were observed to be
much higher than those of the contaminants. After spectra were extracted
from different ROIs, six different supervised classification methods were
investigated and the performances were compared. Those supervised classi-
fication algorithms were parallelepiped, minimum distance, maximum like-
lihood, Mahalanobis distance, spectral angle mapper, and binary encoding
classifier. The classification accuracies varied with the algorithms as well as
with the type of feed used to grow the broilers. The highest classification
50 Advanced Technologies for Meat Processing, Second Edition

Duodenum
(25 pixels)
Ceca (27 pixels)

Colon (78 pixels)

Ingesta (93 pixels)

(a) (b) Skin (195 pixels)

0.8

Duodenum
0.6 Ceca
Colon
Reflectance

Ingesta
0.4
Skin (thigh)
Skin (breast)
0.2 Skin (wing)

0
400 500 600 700 800 900
Wavelengths (nm)
(c)

FIGURE 2.9
Regions of interests (ROIs) of a corn-fed poultry carcass and the corresponding mean spectra.
(a) Uncontaminated carcass. (b) Fecal contaminant ROIs. (c) Mean spectra of ROIs. (Repro-
duced from Park, B. et al., Transactions of the ASABE, 49, 2017–2024, 2006.)

accuracy for identifying contaminants from corn-fed carcasses was observed

to be 92.3% with a spectral angle mapper classifier.
A multispectral imaging system to detect fecal and ingesta contaminants on
the surface of poultry carcasses was developed for a real-time, online poultry
inspection application (Park et al., 2004). Three optimum wavelengths of 515.4,
566.4, and 631 nm was selected according to the results of previous research
(Park et al., 2002; Windham et al., 2003) and these three-band spectral images
were collected using a common aperture camera with three selected optical
filters that were preinstalled into the camera assembly. The detailed process
for the real-time image processing is described in Figure 2.10. It was found
that the ratio of 566.4-nm image/515.4-nm image could identify feces (duo-
denum, ceca, and colon) and ingesta contaminants. Meanwhile, a masking
process was implemented to remove the noisy background by using a 631-nm
image. After a threshold process, three white spots of each row from the top
Hyperspectral Imaging Technique 51

515.4 nm Band ratio Masked image Thresholding

566.4 nm

Find coordinate Centroid

631 nm Masking

Calculate location and

area of contamination

(a)

Calculate image ratio

Collect three-band
(566.4-nm image/515.4-nm image)
spectral images using
to identify fecal and ingesta
common aperture camera
contaminants

Mask spectral image to

Threshold to segregate eliminate noisy background
contaminants using 631-nm image

Find centroid of each Determine coordinates of

contaminant spot and contaminated spots
calculate size of contaminant

(b)

FIGURE 2.10
(a) The process of a real-time multispectral imaging method for automated fecal and ingesta
detection on poultry carcasses (b) and the corresponding flowchart. (Reproduced from Park,
B. et al., Journal of Food Process Engineering, 27, 311–327, 2004.)
52 Advanced Technologies for Meat Processing, Second Edition

to the bottom were obtained to represent contaminants from duodenum,

ceca, colon, and ingesta from the crop or gizzard, respectively. The crossline-
markers denoted the centroid of each contaminant spot. Finally, blob analysis
was used to determine the location of each contaminant spot. The total pro-
cessing time to analyze one bird was 251 ms or 3.99 frames per second, which
means processing capability would exceed 239 birds per minute. The overall
accuracy to detect fecal and ingesta contaminants was 96.8% and the predic-
tion accuracy of identifying each contaminant was 92.4% for duodenum and
98% for ceca, colon, and ingesta with moderate false positives. The algorithm
developed in this research confirmed that a multispectral imaging system
with batch image-processing algorithm can be effectively used for the real-
time, online poultry processing speed of at least 140 birds per minute.
In addition, Chao et al. (2007) have developed a multispectral imaging
platform using a line-scan hyperspectral camera with a spectrograph for
differentiation of wholesome and systemically diseased poultry carcasses
at a commercial line speed. Using a threshold of 0.4 for fuzzy output deci-
sion values, multispectral classification was able to obtain 97.6% accuracy for
wholesome birds and 96.0% accuracy for systemically diseased birds in the
testing dataset. More recently, Park et al. (2010) attempted to merge the fecal
detection and systemic disease detection systems onto a common platform
using a line-scan hyperspectral imaging system in real-time mode during
poultry processing. Figure 2.11 presents a line-scan hyperspectral imaging
system setup developed in this research to collect image data for contami-
nate detection on poultry carcasses at a commercial line speed at the Belts-
ville imaging laboratory. The results testified to the feasibility of a line-scan
hyperspectral imaging system in terms of processing speed and detection
accuracy for real-time, online fecal detection and wholesomeness inspection
in a commercial poultry plant.

2.5.1.2 Tumor and Bone Detection

The presence of tumors and bones in chicken carcasses poses serious
problems to the producers because they are not acceptable for consumers.
Chicken skin tumors refer to round ulcerous lesions that are surrounded by
a rim of thickened skin and dermis. Skin cancer makes skin cells unable to
divide and grow normally, and induces abnormal cells to grow out of control
to form tumors. Tumors are not as visually obvious as other pathological dis-
eases because their spatial signature appears as shape distortion rather than
a discoloration. Moreover, tumors vary in size and shape and sometimes
they can be found in both sides of the chicken. Therefore, identification is a
big challenge because some blemishes are rather difficult to discern by using
traditional manual inspection and conventional vision-based inspection sys-
tems operating in the visual spectrum may also suffer limitations (Du et al.,
2007). Additionally, different tumors present different spectral responses
and some parts of normal chicken skin even have similar spectral response
Hyperspectral Imaging Technique 53

FIGURE 2.11
Line scanning real-time hyperspectral imaging system setup. (Reproduced from Park, B. et al.,
Line-scan hyperspectral imaging for real-time poultry fecal detection. SPIE Defense, Security,
and Sensing. International Society for Optics and Photonics, Orlando, Florida, 76760I, 2010.)

as that of tumors, which makes detection a more difficult task. In this aspect,
hyperspectral imaging shows potential for identification and classification
of biomedical abnormalities due to its ability of simultaneously providing
spatial and spectral features of the objects of interest in the image.
Currently, two methods, namely hyperspectral fluorescence imaging and
hyperspectral reflectance imaging, are widely used to detect tumors on
poultry carcasses. Prior work on detection of chicken skin tumors used PCA
on hyperspectral reflectance images to select three effective wavelengths
(465, 575, and 705 nm) and developed a multispectral imaging system
(Chao et al., 2002). In this study, they achieved classification accuracy of 91%
and 86% for normal and tumorous skin tissue regions, respectively. Kim
et al. (2004) investigated the use of a hyperspectral fluorescence imaging
system for identification of chicken skin tumors. A spectral classifier gener-
ated a spectral map that locates candidate regions for skin tumors. Then,
a spatial classifier was employed to select the real tumor spots from the
potential tumorous regions, which yielded final results showing the loca-
tion of tumors. This method was believed to be useful to detect chicken
carcasses with tumors, but it failed to detect some tumors smaller than
3 mm in diameter. The detection rate, false positive rate, and miss rate of
this proposed method were 76%, 28%, and 24%, respectively. Nakariyakul
54 Advanced Technologies for Meat Processing, Second Edition

and Casasent (2007) developed a novel feature selection method to detect

skin tumors on chicken carcasses using hyperspectral reflectance data.
Figure 2.12 demonstrates the whole process to obtain the final classifica-
tion image (Figure 2.12d) by using a fusion system. As mentioned earlier,
a chicken skin tumor consists of an ulcerous lesion region, which is sur-
rounded by a region of thickened skin; the spectral responses of the lesion
and the thickened-skin regions of tumors are remarkably different. In this
research, the feature selection algorithm was applied to choose different
sets of spectral bands to separately detect the lesion and thickened-skin
regions of the tumors. A pair of binary images were produced to locate a
candidate lesion and thickened-skin pixels and then morphologically pro-
cessed and finally fused to reduce false alarms. As shown in Figure 2.12d,
the initial test results were promising with 11 of 14 skin tumors detected
without any false alarms. Two of the three missed tumors were very small
and were expected to be missed. Meanwhile, the feature selection algorithm
only included five bands, therefore making a fast and inexpensive multi-
spectral sensor system possible.
Fragments of bone in boneless poultry meat also pose significant hazards
to consumers. Bone fragments may result from bones that are already bro-
ken before or during slaughter or a misaligned cutting blades shaving pieces
from the skeleton. Bone fragments, including the clavicle (wishbone), which
is a long, sharp, and completely calcified bone, have the potential to cause
injury. Yoon et al. (2008) evaluated how reflectance spectra can be exploited
for detection of bone fragments in chicken fillets. Specifically, a fusion of
hyperspectral transmittance and reflectance imaging, which is a nonionized
and nondestructive imaging modality, was developed in this study as an

Hyperspectral
raw image

Spatial
preprocessing

1
Spectral feature Spectral feature
selection selection
14
Lesion pixel Thickened (b) 3
2
classification skin-pixel classification 45
6
78 111213
Spatial Spatial 9
10
postprocessing postprocessing
(d) (e)

Fusion
algorithm

Final fused (c)

classification image
(a)

FIGURE 2.12
Chicken skin tumor detection by using hyperspectral imaging aided with a fusion algorithm.
Hyperspectral Imaging Technique 55

alternative method to the conventional transmittance x-ray imaging tech-

nique. An enhancement method using an illumination-transmittance model
was proposed to correct nonuniform illumination effects so that embedded
bones were more easily identified by a simple segmentation method with a
single threshold value. Predicted bones were classified by the nearest neigh-
bor classifier which was trained by the library of mean spectral reflectance of
chicken tissues such as fat, meat, and embedded bones. Their study observed
that bones embedded in compressed 1 cm thick samples can be successfully
detected when both sides of the sample were examined. Their results were
promising, indicating that a hyperspectral imaging system was effective for
detecting bones on poultry carcasses when appropriate image processing
algorithms were applied.

2.5.1.3 Microbiological Spoilage Detection

All chicken meat provided to the markets must undergo quality control in
order to guarantee consumer safety. Without proper storage conditions,
undesirable microorganisms may grow to cause sensory changes, dis-
coloration, and changes in taste. Therefore, fast and automatic methods
for precise prediction of bacterial loads in chicken meat are required in
the poultry industry for efficient management. A laboratory-based push-
broom hyperspectral imaging system in the NIR range was investigated
to evaluate TVCs in raw chicken fillets (Feng and Sun, 2013a). To simplify
the models, important wavelengths were selected by stepwise regres-
sion. Meanwhile, the resulting reflectance images were transformed
into hypercubes in absorbance and Kubelka–Munck (K–M) units. Three
PLSR models were built based on reflectance spectra, absorbance data,
and K–M parameters, named RS-PLSR, AS-PLSR, and KMS-PLSR, respec-
tively. More robustness was found in the resulting simplified KMS-PLSR
model with high correlation coefficients (R) of 0.96 and 0.94 as well as low
root mean squared errors (RMSEs) of 0.40 and 0.50 log 10 CFU/g , for cali-
bration and cross-validation, respectively. With respect to detecting spe-
cific bacteria, the hyperspectral imaging technique as a nondestructive
tool has also been employed for quantitative and direct determination of
Pseudomonas loads (Feng and Sun, 2013b) and Enterobacteriaceae loads
(Feng et al., 2013) on chicken fillet. The best model for Pseudomonas loads
prediction produced R and RMSEs of 0.91 and 0.55 log 10 CFU/g , 0.87 and
0.65 log 10 CFU/g as well as 0.88 and 0.64 log 10 CFU/g for calibration, cross-
validation, and prediction, respectively. Three optimal wavelengths (930,
1121, and 1345 nm) were selected and competent for predicting Entero-
bacteriaceae loads with R 2 of 0.89, 0.86, and 0.87 and RMSEs of 0.33, 0.40,
and 0.45 log 10 CFU/g for calibration, cross-validation, and prediction,
respectively. All the mentioned studies had the advantage of building a
prediction map to visualize the distribution of bacteria on chicken fillet,
which is not available by conventional methods.
56 Advanced Technologies for Meat Processing, Second Edition

In addition to the abovementioned applications, there have been an

increasing amount of research about predicting quality parameters of
poultry meat using hyperspectral imaging systems. For instance, Xiong
et al. (2015b) used a hyperspectral imaging system (400–1000 nm) to predict
hydroxyproline content in chicken meat and good results were achieved
from the simplified regression model with Rp of 0.854 and low RMSEP of
0.049. Springiness, as one of the most important quality characteristics of
chicken meat, was also measured by a hyperspectral imaging technique
with satisfying results presented (Xiong et al., 2015a). However, future
work should be carried out to investigate the feasibility of multispectral
imaging systems for online and at-site inspections in terms of predicting
these parameters in chicken meat.

2.5.2 Fish
Fish and fish products play a significant part in our daily diet; in addi-
tion to an appetizing taste, they are regarded as the best sources of fats,
proteins, and essential micronutrients to promote human health. Globally,
fish and fish products are consumed by nearly two-thirds of the world’s
population, providing roughly 40% of the protein intake (Cheng et al.,
2013). Nevertheless, there are some concerns and challenges related with
the evaluation of fish quality and safety at an industrial level. Fish quality
and safety is a scientific discipline referring to handling, preparation, pro-
cessing, transportation, and storage in ways that prevent food-borne ill-
ness and supply the consumer with premium quality products. However,
fish is one of the most perishable and heterogeneous aquatic products,
and it serves as a growth medium for microorganisms that may cause
fish spoilage or even cause disease in the consumer. In addition, chemical
composition and sensory attributes of fish are highly affected by prehar-
vest (species, sex, age, feeding, and environmental habits) and postharvest
factors (storage methods, time, and temperature). Subtle changes in color,
juiciness, texture, and biochemical properties of fish are likely to affect
consumers’ sensory evaluation of fish quality as well as their decisions in
making a second purchase. Therefore, appropriate tools for inspection are
required to maintain good quality and safety in production and trade of
fish and fish products.
During the past few decades, a great number of different techniques have
been explored as possible instrumental methods for quality and safety evalu-
ation of fish, including sensory evaluation based on the quality index method
(QIM) (Larsen et al., 1992), biochemical methods with HPLC (Mendes et al.,
2009), and microbial inspection based on TVCs (Song et al., 2012). These tech-
niques play a critical role in the current fish industry; some of them have
always been used as gold standards and regulation methods serving scientific
research because of their relative validity and accuracy. However, these meth-
ods are normally expensive, time consuming, laborious, and require highly
Hyperspectral Imaging Technique 57

skilled operators, and are not suitable for online and real-time monitoring.
Applications of hyperspectral imaging for quality and safety assessment of
fish are mainly concentrated on overall fish freshness, chemical composi-
tion determination, and microbial inspection. Compared with NIR spectros-
copy, applications of hyperspectral imaging in freshness grading and quality
evaluation of fish in both research and industry have a limited number of
publications, although there is a prevailing tendency of promising success.
The reason probably lies in the fact that hyperspectral imaging is still a rela-
tively new technique, and its full potential has yet to be exploited so far. The
hyperspectral imaging technique is able to optimize processing of the raw
fish, determing the correct pricing, labeling, and documentation, and identify
quality authentication when appropriately applied in production and packag-
ing plants.

2.5.2.1 Freshness
Fresh fish normally refers to the fish being caught/harvested and then
chilled and stored for a short period before use. Freshness is an ambiguous
term summing up many factors, mostly associated with a sensory impres-
sion or understanding. The freshness is reduced during storage time until
spoilage occurs due to physical, chemical, biochemical, and microbiological
processes, which are mainly affected by time and temperature. Traditionally,
fish freshness has been measured by sensory inspection (Anastasio et al.,
1999), which is carried out through the sense of smell, sight, taste, and touch.
Descriptive analysis like QIM for sensory analysis of marine products is cur-
rently increasingly used. These methods are relatively simple, but inefficient,
time consuming, costly, and very subjective because the assessment is based
on individual preferences, although the bias could be reduced if proper sen-
sory training is implemented. Instrumental methods are also developed,
such as an electric nose that simulates the human sense of smell for ana-
lyzing the odor profile of fish samples. These methods enable objective and
reliable results to a certain degree, but they are still not efficient when a large
number of samples need to be measured.
In recent years, hyperspectral imaging has been employed as an advanced
method for automatic freshness assessment of different kinds of fish dur-
ing production. Chau et al. (2009) employed the hyperspectral imaging
system in the region of 892–2495 nm to determine overall freshness of fish.
Their research revealed that hyperspectral imaging was able to evaluate the
freshness in all spots (pixels) of the fish surface instead of evaluating the
fish freshness at specific regions on the fish surface. It also showed that
there were differences observed among the mean spectra of a whole fish, the
fillet flesh, and belly flap regions of a fillet. These dissimilarities between
the spectra are basically due to the significant differences between chemical
compositions of these parts. Meanwhile, hyperspectral interactance imaging
in the region 400–1000 nm was investigated for differentiating between fresh
58 Advanced Technologies for Meat Processing, Second Edition

and frozen-thawed cod fillets and for measuring the freshness at industrial
speed (40 cm/s or 1 fillet/s) (Sivertsen et al., 2011). In this study, PCA,
K-nearest neighbor (KNN) classifier, and PLSR were applied as the multi-
variate analysis. Their results showed that the freshness, defined as storage
days on ice, can be well predicted for each of the unfrozen samples with a
RMSECV of 1.64 days for the simplified PLSR model calculated from only
four wavelengths. This result was comparable, or better, than that obtained
from sensory evaluation by the QIM with a group of trained panelists.
More recently, Cheng and Sun (2015a) explored the feasibility of using
hyperspectral imaging (400–1000 nm) in tandem with a data fusion tech-
nique for rapid and nondestructive determination of sensory quality index
scores (QIS) of grass carp fish fillet during cold storage. In the QIM scheme,
QIS is assigned for each quality parameter in a numeric scale using a demerit
score system, ranging from 0 to 3. Score 0 normally refers to the very fresh
fish, with scores increasing with storage time. In their study (Cheng and Sun,
2015a), a total of 135 fresh fish subsamples were involved and the reflectance
hyperspectral images were acquired in a line scanning mode. Five important
wavelengths (441, 560, 598, 639, and 684 nm) were collected by the successive
projections algorithm (SPA) and 13 textural feature variables were extracted
by the gray-level gradient co-occurrence matrix (GLGCM) method. In order
to boost the robustness of models, these selected spectral variables and
textural feature variables were fused by applying the feature level fusion
method. Figure 2.13 shows the flowchart of data fusion for measurement of
fish fillet QIS using hyperspectral imaging. The least squares-support vector
machine (LS-SVM) model developed by data fusion of effective spectra and
texture data presented the most excellent performance with RPD of 4.23, R 2 P
of 0.944, and RMSEP of 0.703. These results verified that hyperspectral imag-
ing is an admirable alternative to the conventional evaluation by trained
panelists for assessment of fish freshness and it also indicated the potential
and promise for making more efforts to facilitate this emerging technique
for online applications in the fish industry.

2.5.2.2 Chemical Compositions

Another aspect related to fish quality and safety properties is intrinsic
chemical attributes such as water, protein, fat, and salt. These key quality
parameters vary greatly from one species or one individual fish to another
and these variations can cause a severe deterioration of sensory quality, and
loss of nutritional and commercial values. Water is the largest component of
fish composition and is closely associated with other attributes such as fat
and lipid. Furthermore, moisture plays an essential part in affecting micro-
bial growth, leading to influencing the shelf life of fish and fish products.
The first application of hyperspectral imaging for moisture content predic-
tion was conducted by Wold et al. (2006) using a multispectral imaging NIR
transflectance system in the region of 760–1040 nm for online evaluation
Hyperspectral Imaging Technique 59

Hyperspectral image

Spectra extraction Image texture extraction

ROI
PCA
0.60
0.50 0d
0.40 2d
0.30
4d
R

0.20
0.10 6d
0.00
400 500 600 700 800 9001000 PC1 PC2 PC3
Wavelength nm
GLGCM
Full spectra data
SPA Image texture variables

Optimal spectra data

Data fusion

LS-SVM analysis

FIGURE 2.13
Flowchart of data fusion for prediction of quality index scores in grass carp fish fillet by reflec-
tance hyperspectral imaging. GLGCM, gray-level gradient co-occurrence matrix; LS-SVM,
least squares-support vector machine; PCA, principal component analysis; ROI, regions of
interest; SPA, successive projections algorithm. (Reproduced from Cheng, J.-H. and Sun, D.-W.,
LWT—Food Science and Technology, 63, 892–898, 2015a.)

of dried salted coalfish (Bacalao). Fish was placed on the conveyor belt and
moved at a speed of approximately 0.1 ms−1. It was scanned line by line to
collect the entire spectral image, which was acquired with a spectral resolu-
tion of approximately 20 nm at the speed of 10,000 spectra per second. Their
research achieved the best prediction model with R 2 and RMSECV equal
to 0.92 and 0.70%, respectively. In addition, hyperspectral imaging was also
explored to determine the spatial distribution of moisture content in farmed
Atlantic salmon fillets (He et al., 2013). Three spectral regions of 400–1000 nm
(Spectral Range I), 900–1700 nm (Spectral Range II), and 400–1700 nm (Spec-
tral Range III) were considered, and optimized PLSR models were built using
only the important wavelengths selected from each spectral range, resulting
in R 2 P of 0.893, 0.888 and 0.884, and RMSEP of 1.517%, 1.553%, and 1.578% for
the three spectral regions, respectively.
Fat content is also one of the most significant quality criteria of fish, not only
from a nutritional point of view, but also because of its sensory and functional
properties. Nevertheless, conventional chemical analytical methods for fat con-
tent assessments are destructive and time consuming and require the use of
hazardous chemicals that may be harmful to analysts and the environment (Xu
et al., 2015). Therefore, online NIR hyperspectral interactance imaging (760–1040
nm) was used as an advanced and noncontact technique to determine the fat
distribution in raw and salted salmon (Salmo salar) fillets (Segtnan et al., 2009).
60 Advanced Technologies for Meat Processing, Second Edition

Satisfactory results were obtained with correlation R and prediction error

(RMSECV) for raw fillets of 0.947 and 1.96% and for salted fillets of 0.966 and
1.95%, respectively. Likewise, Zhu et al. (2014) used a pushbroom NIR (899–1694
nm) hyperspectral imaging system to determine the spatial distribution of fat
in Atlantic salmon fillets. The quantitative relationship between spectral data
and the reference fat contents was successfully established based on PLSR with
RP of 0.93 and RMSEP of 1.24.
In another interesting endeavor for the application of compositional analy-
sis in fish, an NIR hyperspectral imaging technique was employed for non-
invasive distributional analysis of salt (NaCl) and fat in salmon fillets during
salting, salt equilibration, and smoking, which are recognized as very criti-
cal for modern fish processing plants (Segtnan et al., 2009). In spite of the
fact that NaCl molecules are not infrared active, several studies have been
implemented on the use of NIR spectroscopy for prediction of NaCl con-
tents in foods. Segtnan et al. (2009) acquired hyperspectral images of salted
and smoked salmon fillets and built models with the use of PLSR. It was
found that NIR interactance imaging alone can predict NaCl contents locally
in salted salmon fillets with RMSECV of 0.56% and R of 0.86. In addition, a
large number of other studies have also stressed the potential of hyperspec-
tral imaging for automatic inspection and evaluation of physical properties
in fish, such as the measurement of color distribution in salmon fillet (Wu
et al., 2012), determination of water holding capacity (Wu and Sun, 2013c),
and analysis of texture (Wu et al., 2014).

2.5.2.3 Parasites and Defects

As with other foods, safety is a key issue in the fish industry. Therefore,
producers must deliver fish and fish products free from parasites and nema-
todes because these incidents about parasites in fish muscle to a great extent
lead to an instant negative response from consumers toward the product.
So far, the only reasonable solution is the manual inspection and trimming
of each fillet on a candling table to avoid the occurrence of parasites in fish
products and detect them online (Elmasry et al., 2012a). This is a very labor-
intensive and time-consuming method because the operator has to inspect
the fillet first and then manually remove the defects from the fillet. As a
consequence, the hyperspectral imaging technique has been used to detect
parasite contamination in fish. In an early study, Wold et al. (2001) applied
a multispectral imaging technique in the visible and NIR spectral region to
detect parasites in cod (Gadus morhua) fillets. It was observed that parasites
in fish flesh presented distinctive spectral fingerprints compared to the nor-
mal fish muscles. They further confirmed that this methodology was capable
of detecting parasites at a depth of 6 mm below the fillet surface, which is
2–3 mm deeper than what can be found by manual inspection of fish fillets.
Recently, interactance hyperspectral imaging was conducted under indus-
trial conditions to automatically detect nematodes in cod fillets (Sivertsen et al.,
Hyperspectral Imaging Technique 61

2012). The test was performed at a fish processing plant in northern Norway
and this system operated at a conveyor belt speed of 400 mm/s, which meets
the industrial speed requirements. A detailed sketch of the main system com-
ponents are illustrated in Figure 2.14a, and a photograph of the inspection
machine, with the front cover removed, is presented in Figure 2.14b. A Gauss-
ian maximum likelihood (GML) classifier was utilized to classify pixels as
nematodes or not according to their corresponding spectra. Results indicated
that the detection rate was 61.5% for all nematodes, and 70.8% and 60.3% for
the dark and pale nematodes, respectively. To some degree, these studies
reveal that the hyperspectral imaging technique has the potential to replace
manual inspection in the fish processing industry.

2.5.2.4 Microbial Spoilage

A hyperspectral imaging system in the region of 400–1700 nm was devel-
oped to rapidly and noninvasively determine TVC of salmon fillets during
the spoilage process (Wu and Sun, 2013d). The reference TVC values were
measured using a standard plate count method and calibration models were
established using PLSR and LS-SVM. The competitive adaptive reweighted
sampling (CARS) algorithm was used to identify the effective wavelengths,
which largely reflected the changes of microbial spoilage. A CARS-PLSR

20
VNIR-640

Screen
Fiber-optic
light line

Cylindrical lens

1030

Conveyer direction 100

50

20 20
(a) (b)

FIGURE 2.14
(a) A sketch illustrating the dimensions and position of the spectrometer and fiber lines and
(b) a photo of the hyperspectral imaging machine with the front cover removed.
62 Advanced Technologies for Meat Processing, Second Edition

model built with only eight spectral variables demonstrated the best per-
formance with R 2 P of 0.985 and RPD of 5.127. More recently, Cheng and Sun
(2015b) used hyperspectral imaging in the spectral range of 400–1000 nm to
measure the Escherichia coli loads in grass carp fish for evaluation and visu-
alization of microbial spoilage. A PLSR model built with full wavelengths
showed good performance with RPD of 5.47 and R 2 P = 0.880. A simplified
PLSR with six characteristic wavelengths also demonstrated good prediction
capability (RPD = 5.22 and R 2 P = 0.870). The results presented in these stud-
ies confirmed that hyperspectral imaging systems are suitable for microbial
spoilage control in view of the online requirements of fish industry.

2.5.2.5 Differentiation and Classification/Sorting

Fish product differentiation and classification is an emerging area of con-
cern in the fish processing industry. The feasibility of Vis/NIR hyperspectral
imaging (380–1030 nm) in alliance with LS-SVM classifiers was investigated
to discriminate the fresh and frozen-thawed halibut fillets (Zhu et al., 2013). In
this work, a classification model was established based on the textural feature
variables extracted by gray-level co-occurrence matrix analysis. Satisfactory
results with a classification rate of 97.22% were obtained. In another work,
categorization of fresh Atlantic salmon fillets stored under different atmo-
spheres using hyperspectral imaging was conducted by Sone et al. (2012).
PCA was used to study changes occurring in the spectral characteristics of
samples under different storage atmospheres and a KNN classifier was used
for the classification of fillets by packaging type. Successful classification of
over 88% was obtained, which was mainly associated with spectral char-
acteristics at the wavelengths of 606 and 636 nm. Meanwhile, Ivorra et al.
(2013) also applied Vis/NIR hyperspectral imaging to distinguish expired
and nonexpired vacuum-packed salmon based on PLS-DA method for
classification purposes. The result obtained has a classification success rate
of 82.7% in cross-validation from real commercial samples, which makes this
technique promising for the nondestructive detection of expired packaged
smoked salmon. On the basis of the results obtained from the earlier studies,
it is necessary to develop suitable classification algorithms and enhance the
hardware of the hyperspectral imaging system to boost and accelerate the
industrial application of a hyperspectral imaging technique with a higher
correct classification rate near 100%.

2.5.3 Red Meats

Red meats, such as pork, beef, and lamb, play a significant part in people’s
daily diet as they are good sources of animal protein, vitamins, and miner-
als. For meat and meat products, it is very critical to keep them at a high qual-
ity for the modern meat industry because superior quality of these products
is always demanded by consumers. Red meat is a nutritious, expensive,
Hyperspectral Imaging Technique 63

and perishable food commodity, and its quality is always associated with
individual experience and preference. Generally, meat quality is defined
as a measurement of attributes or properties which determine the suitabil-
ity of meat as fresh or stored for a reasonable period without deterioration
(Elmasry et al., 2012b). Particularly, quality attributes of red meats usually
comprise sensory, chemical, microbiological, and technological attributes
(Xiong et al., 2014), as demonstrated in Figure 2.15. Regrettably, there is a
great variability in these attributes of raw meat, accounting for highly vari-
able meat products being marketed without a controlled level of quality. This
issue will be aggravated when the industry cannot satisfactorily characterize
this level of quality and thus is unable to market products with a certified
quality level (Damez and Clerjon, 2008).
Traditionally, sensory attributes (color, juiciness, firmness, marbling,
tenderness, etc.) of many foods, including red meats, are evaluated by
well-trained assessors. For meat color and marbling, the inspection
methods are similar and usually conducted by comparing the color of
the rib eye muscle (Musculus longissimus dorsi) or the proportion of intra-
muscular fat within the Musculus longissimus dorsi and scoring against
the reference standards specific for each of the meat species (Xiong et al.,
2014). Today, other methods like chemical methods and instrumental
techniques have also been used in evaluation of quality attributes, which
are more convenient and effective than manual inspection. For chemical
methods, the universal standard for crude protein analysis in food is the
Kjeldahl method (Kirk, 1950) while for moisture content the oven-drying
method is the standard (Willits, 1951). However, most of the chemical
and instrumental techniques are destructive and require lengthy sample
preparation. Hence, these methods are not feasible for rapid analysis of
quality attributes in industrial and commercial processing. In addition,
from the viewpoint of quality assurance, it is desirable to inspect all meat
and meat products and thereby an ideal sensing technique for the meat
industry should be online and nondestructive.
In recent years, many studies have been reported on developing nonde-
structive techniques for detecting internal and/or external red meat quality
attributes (Kamruzzaman et al., 2012b). Different methodologies based on

Quality attributes of red meats

Sensory Chemical Technological

Microbiological
(color, marbling, (moisture, protein, (pH, water holding
(freshness, spoilage)
tenderness) fat) capacity, drip loss)

FIGURE 2.15
Common quality attributes of red meats analyzed in the meat industry.
64 Advanced Technologies for Meat Processing, Second Edition

different principles, procedures, and instruments, such as ultrasound tech-

nology and computed tomography (CT) scanning, are currently available for
measuring different meat quality attributes. Among them,the hyperspectral
imaging technique is widely accepted as a new inspiring and versatile tech-
nique for rapid, reagentless, and noninvasive quantitative applications in the
red meat industry. As a matter of fact, a large amount of research has been
done in the application of hyperspectral imaging in red meats analysis, high-
lighting its capability of measuring many different quality attributes such as
pH, color, tenderness, and fat content in beef, pork, and lamb (Barbin et al.,
2013a; Kamruzzaman et al., 2012c).

2.5.3.1 Sensory Attributes

Today, the application of hyperspectral imaging systems to measure sensory
attributes of red meats are largely focused on prediction of color, marbling,
and tenderness. Sensory attributes are the main quality attributes that have a
huge influence on consumers’ overall evaluation of red meats. As consumers
usually use color as an indicator of freshness and wholesomeness of meat,
an attractive and stable color in the meat has a major influence on the buy-
ing decision made by the consumer. Marbling refers to the white flecks of
fat present within the lean in the muscle, and the marbling score normally
evaluates the distribution density of fat in the carcass rib eye region. As mar-
bling enhances juiciness, retail cuts with little marbling tend to account for
cooked products that lack flavor and juiciness. Ideally, it should be uniformly
and finely distributed throughout the lean, as this is preferred by consumers
to enhance eating satisfaction. With respect to tenderness, it is an expression
of meat texture, which is regarded as the most important sensory quality
attribute related to consumer satisfaction. Meat tenderness is also positively
associated with juiciness and flavor, and therefore consumers accept pay-
ing more for tender meat. Sources of tenderness variation in meat may be
ascribed to the animal’s sex, age, breed, and antemortem stress, as well as
postmortem treatments. Indeed, meat tenderness is a complex phenomenon
that encompasses many characteristics such as chewiness, springiness, cohe-
siveness, hardness, and even juiciness (Elmasry et al., 2012a).
Color is an important feature that is used in conjunction with other char-
acteristics to determine the grade or suitability of red meat for a particular
market. Beef and lamb meat in bright red and pork in pink are desirable
to consumers. Retailers have to cut prices for meat with undesired surface
color, which leads to revenue losses. ElMasry et al. (2012c) developed a hyper-
spectral imaging system in the NIR region for noncontact measurements of
surface color, pH, and tenderness of fresh beef. Hyperspectral images were
acquired in a pushbroom mode and reference color values were measured in
a L* a * b * color system with a chromometer (CR-400, Konica Minolta Corp.,
Japan). It was found that PLSR models for prediction of color components L*
and b * were reasonably good; yet prediction of color component a * was not
Hyperspectral Imaging Technique 65

satisfactory. The resulting PLSR models generated R 2 CV of 0.88 and 0.81 and
RMSECV of 1.21 and 0.57 for lightness (L*) and yellowness (b *), respectively.
In addition, an image processing algorithm was developed to transfer the
simplified model to every pixel in the image for visualizing color distribution
in all portions of the beef sample. ElMasry et al. (2012c) thereby concluded
that a hyperspectral imaging technique could be effectively implemented
in commercial meat processing plants for rapid and nondestructive qual-
ity analysis when more improvements in terms of speed and processing are
achieved. In addition to beef, the objective determination of the pork color
attribute has also been investigated using a hyperspectral imaging technique
(Barbin et al., 2012b). In this research, hyperspectral images in the NIR region
were acquired for pork samples from the longissimus dorsi muscle by a push-
broom hyperspectral imaging system. Reference color (L, a, and b values)
was measured using a Minolta Chromameter (CR-400, Konica Minolta Corp.,
Japan) calibrated against white ceramic tile. Meanwhile, chroma (( a 2 + b 2 )1/2 )
and hue angle (arctan b/a) were also calculated, as it is believed that these
parameters can change due to differences in meat quality. The optimized
PLSR models were developed to predict color features (L, a, b, chroma, and
hue angle) and good performance was achieved in the prediction of light-
ness (L) with R 2 CV of 0.93, R 2 P of 0.90, RMSECV of 1.36 < and RMSEP of 1.63.
Distribution maps for lightness (L) prediction in pork meats were generated
by applying this reduced PLS-R model (Figure 2.16b).
As for marbling, some researchers have used hyperspectral imaging tech-
nique in marbling evaluation of red meat and obtained good results. For
instance, Li et al. (2011) investigated assessment of beef-marbling grade using
a hyperspectral imaging system in the spectral region of 400–1100 nm. A
charactersitic band was collected at the point where the maximal ratio of gray
value of fat and lean occurs and therefore the images at 530 nm were used
to differentiate beef-marbling. In addition, three characteristic parameters of
samples, namely the density of large-particle fat, that of medium-particle fat,
and that of small-particle fat, were applied to establish a prediction model by
the MLR method and the beef samples were successfully graded with R 2 of
0.92 for full cross-validation.
With respect to meat tenderness, the most common method is to mea-
sure the mechanical properties of a meat sample using the Warner–Bratzler
shear force (WBSF) or slice shear force (SSF), yet both of them are not suit-
able for the commercial and fast-paced production environment. Recently,
interest in exploiting hyperspectral imaging for the assessment of red meat
tenderness is growing (ElMasry et al., 2012c). In an early study, Nagana-
than et al. (2008) developed and tested a Vis/NIR hyperspectral imaging
system to predict meat tenderness of 14-day aged beef. On the basis of the
extracted features, discriminant models were established to predict three
beef tenderness categories, namely tender (SSF ≤ 205.80 N), intermediate
(205.80 N < SSF < 254.80 N), and tough (SSF ≥ 254.80 N). The prediction
66 Advanced Technologies for Meat Processing, Second Edition

(a)

(b) 60 60
55 55
50 50
45 45
40 40
35 35
30 30
25 25
Average l = 49.12 Average l = 41.3
20 20

6.5 6.5
(c)

6 6

5.5 5.5

5 5

Average pH = 5.41 Average pH = 5.85

4.5 4.5

15 15
(d)

10 10

5 5

0 0

Average drip loss = 6.35% Average drip loss = 2.73%

–5 –5

FIGURE 2.16
Distribution maps for some quality attributes in pork samples.

model achieved an overall accuracy of 96.4% in leave-one-out cross-vali-

dation and all of the tough samples were correctly classified. Apart from
that, Tao et al. (2012) implemented hyperspectral imaging in 400–1000 nm
to nondestructively determine pork tenderness. The overall results showed
that the spatially resolved hyperspectral imaging technique coupled with
MLR was capable of predicting tenderness in pork. More recently, a hyper-
Hyperspectral Imaging Technique 67

spectral imaging system (900–1700 nm) was utilized to predict instrumental

and sensory tenderness of lamb meat (Kamruzzaman et al., 2013). WBSF val-
ues and sensory scores by trained panelists were recorded as the indicators
of instrumental and sensory tenderness, respectively. Reasonable accuracy
was obtained from PLSR models with RCV of 0.84 for WBSF values and 0.69
for sensory tenderness scores. Further results demonstrated that hyper-
spectral imaging can quickly categorize lamb steaks into good (i.e., tender)
and bad (i.e., tough) based on WBSF values and sensory scores with overall
accuracy of 94.51% and 91%, respectively. More recently, a prototype online
hyperspectral imaging system (400–1000 nm) was built to acquire images of
exposed rib eye muscle on hanging beef carcasses at two-day postmortem
in a commercial beef packing plant (Konda Naganathan et al., 2016). In this
research, 3D chemometric analyses coupled with discriminant models were
applied to forecast beef tenderness by predicting WBSF values. Four differ-
ent dimensionality reduction approaches including sample principal com-
ponent analysis (SPCA), chemometric principal component analysis (CPCA),
mosaic principal component analysis (MPCA), and partial least squares
analysis (PLSA), as well as three different discriminant analysis algorithms,
Fisher’s linear discriminant (FLD), SVM, and the decision tree (DT) model,
were involved. The best prediction model was achieved by the CPCA and
FLD combination with a tender certification accuracy of 86.7% and accuracy
index value of 66.8%, in a true validation set (101 samples).

2.5.3.2 Chemical Compositions

Chemical constituents are intrinsic factors that affect red meat quality. It
is believed that color, flavor, as well as tenderness of red meats might be
changed by a series of reactions among different chemical constituents. For
instance, moisture, as the major chemical constituent in red meats, plays a
key part in affecting microbial growth, leading to influencing the shelf life of
meat products. In addition to moisture, protein and fat are also main compo-
nents in red meats. There are abundant different kinds of proteins contained
in red meats and these proteins can be easily digested and absorbed by the
human body for essential good health. As another major component of red
meats, fat contributes greatly to the flavor when they are cooked and has a
positive effect on eating satisfaction.
Attempts on using hyperspectral imaging as a nondestructive method
for assessing beef chemical constituents have been fully investigated by
many researchers (Elmasry et al., 2012a). The feasibility of determination
of water distribution within beef during dehydration was investigated
by using a time series hyperspectral imaging system (380–1700 nm) (Wu
et al., 2013). Hyperspectral images of beef slices were first acquired at
different periods of the dehydration process and the reference value of
water content was determined based on the oven-drying method. Then,
68 Advanced Technologies for Meat Processing, Second Edition

the selection of effective wavelengths was carried out using SPA to reduce
the computational and predigest calibration modeling. Good results
were achieved from the SPA-MLR model with R 2 CV equal to 0.953 and an
RMSECV of 1.280%. Finally, the visualization of water distribution within
beef slice along with dehydration was also created. Moreover, a labora-
tory-based pushbroom hyperspectral imaging system (900–1700 nm) in
reflectance mode was tested to simultaneously predict water, fat, and pro-
tein contents of beef (ElMasry et al., 2013). PLSR models for predicting
water, fat, and protein contents yielded a reasonable accuracy with R 2 P of
0.89, 0.84, and 0.86 concomitant with standard error of prediction (SEP) of
0.46%, 0.65%, and 0.29%, respectively. More recently, Lohumi et al. (2016)
used a hyperspectral imaging system (400–1000 nm) for determination
and visualization of intramuscular fat concentration in beef samples. An
analysis of variance (ANOVA) test revealed that the ratio image based
on wavelengths of 650.4 and 736.4 nm was found to be effective for the
visualization of the intramuscular fat distribution, since a notable differ-
ence in the contrast between the intramuscular fat and the lean area was
observed. Furthermore, spectral similarity analysis methods, which are
based on the quantification of spectral similarities using a predetermined
end-member spectrum vector, yielded comparable results for character-
ization of intramuscular fat in beef.
Besides beef, intensive research using hyperspectral imaging for predic-
tion of chemical compositions has also been reported on pork. The suitabil-
ity of using a hyperspectral imaging system (1000–2500 nm) for predicting
moisture content during the salting process of porcine meat was assessed
(Liu et al., 2014b). In this research, three different spectral profiles including
reflectance spectra (RS), absorbance spectra (AS), and Kubelka–Munk spec-
tra (KMS) were applied to build PLSR models and their results were com-
pared. It was shown that the best full-wavelength PLSR model was obtained
based on reflectance spectra ( R 2 P = 0.941, RMSEP = 1.23%). Based on the
important wavelengths selected using the RC, the optimal RS-MLR model
also demonstrated good performance to predict moisture content of salted
pork with R 2 P of 0.917 and RMSEP of 1.48%. More recently, Ma et al. (2016)
proved that the spectral absorption index (SAI) was promising in spectral
analysis to predict moisture content in pork samples using a hyperspectral
imaging technique. Based on SAI features, PLSR models presented satisfac-
tory performance with R 2 P of 0.952 and RMSEP of 1.396. An extended experi-
ment was conducted by predicting moisture, protein, and fat of intact and
minced pork (Barbin et al., 2013a). The results obtained by cross-validated
PLSR models indicated that the NIR spectral range (900–1700 nm) had an
extraordinary ability to determine the content of moisture ( R 2 CV = 0.87), pro-
tein ( R 2 CV = 0.88), and fat ( R 2 CV = 0.95) in pork samples.
When it comes to lamb, relatively few studies have been carried out
using hyperspectral imaging for chemical composition prediction.
Hyperspectral Imaging Technique 69

Kamruzzaman et al. (2012b) were the first to use hyperspectral imaging

(900–1700 nm) for simultaneous prediction of the moisture, protein, and
fat content in lamb meat. Multivariate calibration models were constructed
by using PLSR in full spectral range and reasonable prediction abilities
for these chemical constituents were presented with R 2 P of 0.88, 0.88, and
0.63 and SEP of 0.51%, 0.40%, and 0.34% for moisture, protein, and fat
content, respectively. Six spectral variables were selected as the most rel-
evant wavelengths in the spectrum for water and fat prediction and six
wavelengths were identified as the effective wavelengths for protein pre-
diction. The new PLSR models based on feature wavelengths generated
R 2 P of 0.84, 0.87 and 0.82 and SEP of 0.57%, 0.35% and 0.47% for water, fat,
and protein contents, respectively. Meanwhile, the resulting distribution
maps have provided detailed information on the compositional gradient
in the tested lamb samples. Interestingly, a hyperspectral imaging sys-
tem (400–1000 nm) was investigated to develop a multispectral real-time
imaging system allowing the meat industry to predict moisture content
in red meat including beef, lamb, and pork (Kamruzzaman et al., 2016b).
In their study, instead of respectively selecting different sets of effective
wavelengths for beef, lamb, and pork, a set of 10 optimal wavelengths was
selected for convenient industrial application for the prediction of mois-
ture content in red meat. The best optimized MLR model yielded R 2 P of
0.97 and RMSEP of 2.19%, which confirmed that a fast, reliable, and accu-
rate multispectral system for real-time monitoring of moisture content in
red meat is available.

2.5.3.3 Microbiological Properties

Spoilage in red meats usually results from the growth and enzymatic activ-
ity of microorganisms; this will lead to the decomposition of nutrition com-
positions and the formation of metabolites. Red meats are described as
spoiled if organoleptic changes make them unacceptable to the consumer.
These organoleptic characteristics normally include changes in appear-
ance (discoloration), changes in taste, the development of off odors, or any
other characteristic that makes the food undesirable for consumption (Doyle
and Buchanan, 2012). Excessive bacterial spoilage in red meats would cause
harm to human health, thus it is crucial to guarantee the safety of red meats
supplied to the markets. However, present methods of detecting bacterial
spoilage in meats, such as enumeration methods based on microscopy, the
plate count method, ATP bioluminescene, and the measurement of electrical
phenomena, are not able to rapidly and nondestructively detect bacterially
contaminated meat.
The hyperspectral imaging technique has unique advantages over the
aforementioned methods and its potential for predicting microbiological
properties of red meats has been intensively exploited through many research
70 Advanced Technologies for Meat Processing, Second Edition

endeavors (Tao et al., 2012; Wang et al., 2011). For example, a NIR pushbroom
hyperspectral imaging system (900–1700 nm) was explored to determine
the TVC and psychrotrophic plate count (PPC) in chilled pork during storage
(Barbin et al., 2013b). First, hyperspectral images were utilized to classify the
tested samples into fresh or spoiled pork and good results were obtained with
over 95% accuracy for spoilage detection. In the second stage, TVC and PPC
were predicted simultaneously by correlating classical microbiological plat-
ing methods with the spectral information extracted from the pork samples.
PLSR was applied and the best models demonstrated promising performance
with an R 2 of 0.86 and 0.89 for log (TVC) and log (PPC), respectively. Finally,
effective wavelengths were selected for regression and spatial visualization of
microbial contamination. Similarly, Tao and Peng (2015) also applied hyper-
spectral scattering imaging in the spectral range of 472–1000 nm to predict
TVC in pork meat. A stepwise multiple linear regression (SMLR) method was
applied to build prediction models and models constructed by the Lorentzian
parameter b and the Gompertz parameter β performed best for determining
TVC of pork meat, with RP of 0.94 and 0.93, respectively.
As for beef, Peng et al. (2011) investigated the feasibility of hyperspectral
imaging technique for prediction of the beef spoilage. In this research, PLSR
was carried out between the log 10 (TVC) value and three combinations of
scattering parameters. The best predictions were obtained with r 2 = 0.95 and
SEP = 0.30. Likewise, the application of a multispectral imaging system has
been evaluated to monitor aerobically packaged beef filet spoilage at differ-
ent storage temperatures (Panagou et al., 2014). Spectral data in the spectral
range of 405–970 nm were extracted and correlated with microbiological data
(log counts), for TVC, Pseudomonas spp., and Brochothrix thermosphacta, respec-
tively. Qualitative analysis (PLS-DA) was first applied for the classification of
meat samples in three microbiological quality classes based on the values of
TVC, namely Class 1 (TVC < 5.5 log 10 CFU / g ), Class 2 (5.5 log 10 CFU / g <
TVC < 7.0 log 10 CFU / g ), and Class 3 (TVC > 7.0 log 10 CFU / g). Meanwhile,
PLSR models were also built to provide quantitative estimations of micro-
bial counts during storage. Encouraging results were obtained in discrimi-
nation of meat samples with the overall CCR for cross-validation amounting
to 85.9% and respective sensitivities of 73.1%, 75.0%, and 95.7% for classes
1, 2, and 3, respectively. The developed PLSR models yielded rCV of 0.918,
0.898, and 0.903 for TVC, Pseudomonas spp., and Brochothrix thermosphacta,
respectively. The overall results confirmed that multispectral imaging has
significant potential as a rapid and nondestructive technique in assessing
the microbiological quality of beef fillets.

2.5.3.4 Technological Attributes

Besides sensory attributes, chemical constituents attributes, and microbial
spoilage determination, in recent years, research on red meat quality and safety
Hyperspectral Imaging Technique 71

inspection using hyperspectral imaging has been extended to predict impor-

tant technological attributes such as pH, drip loss, and water holding capability
(WHC), generally with satisfactory results. pH is defined as the concentration
of the hydrogen ion in aqueous solution. It has significant influence on the stor-
age and quality of red meat by affecting its WHC and color. Traditionally, pH is
determined by inserting a pH meter into the muscle, but nowadays, there is the
potential to predict pH using a hyperspectral imaging technique (Xiong et al.,
2014). In more detail, Liu et al. (2014a) carried out the an experiment to investi-
gate the utility of hyperspectral imaging (400–1000 nm) for predicting the pH
of salted pork meat. The results from the PLSR model with a reduced number
of wavelengths yielded R 2 CV of 0.86 and RMSECV of 0.073. Additionally, NIR
hyperspectral imaging was employed to predict pH values of pork samples
from the longissimus dorsi muscle and promising results were achieved with
R 2 CV of 0.87 (Barbin et al., 2012b). The distribution maps of pH values were
generated by applying the PLSR model to each pixel in the spectral image as
shown in Figure 2.16c. The distribution maps illustrated how pH values varied
drastically between different parts of the same sample.
Drip loss is of great importance in red meat production due to its financial
implications. Generally speaking, meat with a high drip loss has an unat-
tractive appearance and thus has low consumer preference, accounting for
loss of sales. In addition to pH, Barbin et al. (2012b) used the same hyper-
spectral imaging system to predict drip loss of pork meat. The results from
the PLSR model revealed that drip loss of pork meat could be well predicted
with R 2 CV of 0.83 and the corresponding distribution maps are shown in
Figure 2.16d. More recently, a hyperspectral imaging system was utilized to
test frozen pork quality with drip loss as one of the quality indicators (Xie
et al., 2015). In this study, hyperspectral images were acquired at the frozen
state and PLSR was used to establish calibration models. The performance
for drip loss prediction was acceptable with R 2 P of 0.762. Additionally, NIR
hyperspectral imaging was explored for the prediction of some quality
attributes of lamb meat including drip loss (Kamruzzaman et al., 2012c). As
usual, PLSR models were developed and good performance was obtained
for drip loss prediction with R 2 of 0.77 and RDP of 2.11.
Like drip loss, WHC also has a huge influence on the appearance of fresh
red meat during retail and might affect the sensory attributes of cooked
meat. From an economic point of view, high WHC is extremely desirable
as red meat is normally sold by weight and any water loss accounts for
a reduction in yield due to loss in the total weight of the meat (Hoving-
Bolink et al., 2005). Past years have seen the potential of a hyperspectral
imaging system for nondestructive and rapid evaluation of WHC of red
meats (ElMasry et al., 2011; Kamruzzaman et al., 2012b). For instance,
ElMasry et al. (2011) conducted an experiment for postmortem prediction
of WHC in fresh beef using NIR hyperspectral imaging. Both PCA and
PLSR models were developed to correlate spectral data with the reference
72 Advanced Technologies for Meat Processing, Second Edition

WHC estimated by the drip loss method. The PLSR model resulted in an
R 2 CV of 0.89 and standard error estimated by cross-validation (SECV) of
0.26%. Six spectral variables (940, 997, 1144, 1214, 1342, and 1443 nm) were
selected as optimal wavelengths to establish a new PLSR prediction model
with R 2 CV of 0.87 and SECV of 0.28%. More recently, a hyperspectral imag-
ing system was tested for determination of effective wavelengths to be
used in the design of a multispectral system for online monitoring of WHC
in red meats including beef, lamb, and pork samples (Kamruzzaman et al.,
2016a). Hyperspectral images of different red meat samples were acquired
in the spectral range of 400–1000 nm and subsequently PLSR and LS-SVM
models were constructed. Optimal wavelengths were collected using RC
and CARS methods. Instead of selecting different sets of important wave-
lengths for different red meats, only eight spectral variables (545, 610, 705,
765, 805, 900, 940, and 970 nm) were selected to design a multispectral sys-
tem for convenient industrial application of red meats. The RC-LS-SVM
model demonstrated the best performance with an R 2 P of 0.93 and RPD of
4.09, confirming that this model is adequate for analytical purposes.

2.6 Conclusions
Hyperspectral imaging is a powerful and versatile technique and it is now
under dynamic evaluation by researchers in many different fields. Among
dozens of techniques that have been proposed for meat quality evaluation on
the fresh intact form, the hyperspectral imaging technique has great potential
advantages, including elimination of human error during subjective judg-
ment, reduced labor costs, and the generation of product data in visualized
forms in real time for documentation, labeling, and traceability. With the pri-
mary advantage of providing both spatial and spectral details, hyperspec-
tral imaging not only provides a means of accurate quantification but also
describes constituent variation within the tested meat sample, which con-
sequently enables better characterization of the meat sample and improved
description of meat quality and safety status. Additionally, hyperspectral
imaging is able to measure multiple quality and/or safety attributes simulta-
neously without monotonous sample preparation. Therefore, the hyperspec-
tral imaging technique has many applications in the meat industry, such as
simple product inspection, full sample quantification, or the segregation of a
subset of the measured batch for further manual inspection (Elmasry et al.,
2012a). The results of the previous research works presented in this chapter
confirm that hyperspectral imaging is a promising technology for rapid and
noncontact evaluation of essential meat quality and safety attributes.
Hyperspectral Imaging Technique 73

However, there are two major challenges that may hamper widespread
adoption in the meat industry. The first is the high purchase cost of hyper-
spectral imaging systems. There are few commercial suppliers as this
technology is an emerging tool for meat quality evaluation. Future tech-
nological developments in hyperspectral imaging equipment manufacture
are expected to promote the manufacture of low-cost systems. The second
limitation arises from the relatively lengthy times necessary for hyperspec-
tral image acquisition, processing, and modeling. Based on target size and
image resolution, acquisition time can range from two to four minutes.
Although a multispectral imaging system with a limited number of wave-
bands can largely reduce the prolonged time, it is normally very tricky
to judge which subsets of selected wavelengths will provide the best per-
formance, because applying different variable selection methods always
leads to different optimal wavelengths combinations. It is of great impor-
tance for researchers to overcome technological challenges for performing
hyperspectral imaging technology in the food industry for meat quality
and safety assessment, so that the meat industry can realistically benefit
from implementing this rapid and nondestructive technique at an early
stage of processing without additional time-consuming, tedious, and labo-
rious chemical analyses, enabling early sorting and grading of produce
and thereby enhanced quality management.
Although it suffers from several disadvantages, considering the continu-
ing improvements in hardware and software design, it is anticipated that
hyperspectral imaging may progressively become a substantial and routine
method for real-time meat safety and quality control.

References
Adam, E., Mutanga, O. and Rugege, D. (2010). Multispectral and hyperspectral
remote sensing for identification and mapping of wetland vegetation: A review.
Wetlands Ecology and Management, 18(3), 281–296.
Amigo, J. M., Babamoradi, H. and Elcoroaristizabal, S. (2015). Hyperspectral image
analysis. A tutorial. Analytica Chimica Acta, 896, 34–51.
Anastasio, A., Vollano, L., Visciano, P., Miranda, E. and Cortesi, M. (1999). Corre-
lations between pH, total volatile basic nitrogen, trimethylamine and sensory
evaluation in fresh fish slices. Archiv für Lebensmittelhygiene, 50(3), 63–66.
Bannon, D. and Thomas, R. (2005). Harsh environments dictate design of imaging
spectrometer. Laser Focus World, 41(8), 93–97.
Barbin, D., Elmasry, G., Sun, D.-W. and Allen, P. (2012a). Near-infrared hyperspectral
imaging for grading and classification of pork. Meat Science, 90(1), 259–268.
Barbin, D. F., ElMasry, G., Sun, D.-W. and Allen, P. (2012b). Predicting quality and
sensory attributes of pork using near-infrared hyperspectral imaging. Analytica
Chimica Acta, 719, 30–42.
74 Advanced Technologies for Meat Processing, Second Edition

Barbin, D. F., ElMasry, G., Sun, D.-W. and Allen, P. (2013a). Non-destructive determi-
nation of chemical composition in intact and minced pork using near-infrared
hyperspectral imaging. Food Chemistry, 138(2), 1162–1171.
Barbin, D. F., ElMasry, G., Sun, D.-W., Allen, P. and Morsy, N. (2013b). Non-destructive
assessment of microbial contamination in porcine meat using NIR hyperspec-
tral imaging. Innovative Food Science and Emerging Technologies, 17, 180–191.
Barbin, D. F., Sun, D.-W. and Su, C. (2013c). NIR hyperspectral imaging as non-
destructive evaluation tool for the recognition of fresh and frozen-thawed
porcine longissimus dorsi muscles. Innovative Food Science and Emerging Tech-
nologies, 18, 226–236.
Blanco, M., Coello, J., Iturriaga, H., Maspoch, S. and Pezuela, C. (1997). Effect of data
preprocessing methods in near-infrared diffuse reflectance spectroscopy for the
determination of the active compound in a pharmaceutical preparation. Applied
Spectroscopy, 51(2), 240–246.
Bro, R., Van den Berg, F., Thybo, A., Andersen, C. M., Jorgensen, B. M. and Andersen,
H. (2002). Multivariate data analysis as a tool in advanced quality monitoring in
the food production chain. Trends in Food Science and Technology, 13(6), 235–244.
Brosnan, T. and Sun, D.-W. (2004). Improving quality inspection of food products by
computer vision––A review. Journal of Food Engineering, 61(1), 3–16.
Chao, K., Kim, M. S. and Chan, D. E. (2014). Control interface and tracking control
system for automated poultry inspection. Computer Standards and Interfaces,
36(2), 271–277.
Chao, K., Mehl, P. and Chen, Y. (2002). Use of hyper-and multi-spectral imaging for
detection of chicken skin tumors. Applied Engineering in Agriculture, 18(1), 113–120.
Chao, K., Yang, C., Chen, Y., Kim, M. and Chan, D. (2007). Hyperspectral-multispectral
line-scan imaging system for automated poultry carcass inspection applications
for food safety. Poultry Science, 86(11), 2450–2460.
Chao, K., Yang, C., Kim, M. and Chan, D. (2008). High throughput spectral imaging
system for wholesomeness inspection of chicken. Applied Engineering in Agricul-
ture, 24(4), 475–485.
Chau, A., Whitworth, M., Leadley, C. and Millar, S. (2009). Innovative sensors to rap-
idly and non-destructively determine fish freshness. Seafish Industrial Authority.
Report No. CMS/REP/110284/1. References 233.
Chen, Q., Zhao, J., Fang, C. and Wang, D. (2007). Feasibility study on identification
of green, black and Oolong teas using near-infrared reflectance spectroscopy
based on support vector machine (SVM). Spectrochimica Acta Part A: Molecular
and Biomolecular Spectroscopy, 66(3), 568–574.
Cheng, J.-H., Dai, Q., Sun, D.-W. et al. (2013). Applications of non-destructive spectro-
scopic techniques for fish quality and safety evaluation and inspection. Trends in
Food Science and Technology, 34(1), 18–31.
Cheng, J.-H. and Sun, D.-W. (2015a). Data fusion and hyperspectral imaging in tan-
dem with least squares-support vector machine for prediction of sensory qual-
ity index scores of fish fillet. LWT—Food Science and Technology, 63(2), 892–898.
Cheng, J.-H. and Sun, D.-W. (2015b). Rapid quantification analysis and visualiza-
tion of Escherichia coli loads in grass carp fish flesh by hyperspectral imaging
method. Food and Bioprocess Technology, 8(5), 951–959.
Chevallier, S., Bertrand, D., Kohler, A. and Courcoux, P. (2006). Application of PLS-
DA in multivariate image analysis. Journal of Chemometrics, 20(5), 221.
Hyperspectral Imaging Technique 75

Cho, B., Kim, M. S., Chao, K., Lawrence, K., Park, B. and Kim K. (2009). Detection of
fecal residue on poultry carcasses by laser-induced fluorescence imaging. Jour-
nal of Food Science, 74(3), E154–E159.
Cutler, D. R., Edwards, T. C., Beard, K. H. et al. (2007). Random forests for classifica-
tion in ecology. Ecology, 88(11), 2783–2792.
Damez, J.-L. and Clerjon, S. (2008). Meat quality assessment using biophysical meth-
ods related to meat structure. Meat Science, 80(1), 132–149.
Doyle, M. P. and Buchanan, R. L. (2012). Food Microbiology: Fundamentals and Frontiers.
Washington, D.C: American Society for Microbiology Press.
Du, Z., Jeong, M. K. and Kong, S. G. (2007). Band selection of hyperspectral images
for automatic detection of poultry skin tumors. IEEE Transactions on Automation
Science and Engineering, 4(3), 332–339.
Elmasry, G., Barbin, D. F., Sun, D.-W. and Allen, P. (2012a). Meat quality evaluation by
hyperspectral imaging technique: An overview. Critical Reviews in Food Science
and Nutrition, 52(8), 689–711.
Elmasry, G., Kamruzzaman, M., Sun, D.-W. and Allen, P. (2012b). Principles and
applications of hyperspectral imaging in quality evaluation of agro-food prod-
ucts: A review. Critical Reviews in Food Science and Nutrition, 52(11), 999–1023.
ElMasry, G. and Sun, D.-W. (2010). Meat quality assessment using a hyperspectral
imaging system. In: Hyperspectral Imaging for Food Quality Analysis and Control,
Da-Wen Sun (Ed.), Amsterdam : Academic Press, 273–294.
ElMasry, G., Sun, D.-W. and Allen, P. (2011). Non-destructive determination of
water-holding capacity in fresh beef by using NIR hyperspectral imaging. Food
Research International, 44(9), 2624–2633.
ElMasry, G., Sun, D.-W. and Allen, P. (2012c). Near-infrared hyperspectral imaging for
predicting colour, pH and tenderness of fresh beef. Journal of Food Engineering,
110(1), 127–140.
ElMasry, G., Sun, D.-W. and Allen, P. (2013). Chemical-free assessment and mapping
of major constituents in beef using hyperspectral imaging. Journal of Food Engi-
neering, 117(2), 235–246.
ElMasry, G. and Wold, J. P. (2008). High-speed assessment of fat and water content
distribution in fish fillets using online imaging spectroscopy. Journal of Agricul-
tural and Food Chemistry, 56(17), 7672–7677.
Esquerre, C., Gowen, A. A., Burger, J., Downey, G. and O’Donnell, C. P. (2012). Sup-
pressing sample morphology effects in near infrared spectral imaging using
chemometric data pre-treatments. Chemometrics and Intelligent Laboratory Sys-
tems, 117, 129–137.
Feng, Y.-Z., Elmasry, G., Sun, D.-W., Scannell, A. G., Walsh, D. and Morcy, N. (2013).
Near-infrared hyperspectral imaging and partial least squares regression for
rapid and reagentless determination of Enterobacteriaceae on chicken fillets.
Food Chemistry, 138(2), 1829–1836.
Feng, Y.-Z. and Sun, D.-W. (2013a). Determination of total viable count (TVC) in
chicken breast fillets by near-infrared hyperspectral imaging and spectroscopic
transforms. Talanta, 105, 244–249.
Feng, Y.-Z. and Sun, D.-W. (2013b). Near-infrared hyperspectral imaging in tandem
with partial least squares regression and genetic algorithm for non-destruc-
tive determination and visualization of Pseudomonas loads in chicken fillets.
Talanta, 109, 74–83.
76 Advanced Technologies for Meat Processing, Second Edition

Feng, Y.-Z. and Sun, D.-W. (2014). Seeing the bacteria: Hyperspectral imaging for bac-
terial prediction and visualisation on chicken meat. NIR news, 25(7), 4–6.
Gaston, E., Fras, J., Cullen, P., O’Donnell, C. and Gowen, A. (2010). Visible-near infra-
red hyperspectral imaging for the identification and discrimination of brown
blotch disease on mushroom (Agaricus bisporus) caps. Journal of Near Infrared
Spectroscopy, 18(5), 341.
Gowen, A. A., Feng, Y., Gaston, E. and Valdramidis, V. (2015). Recent applications of
hyperspectral imaging in microbiology. Talanta, 137, 43–54.
He, H.-J., Wu, D. and Sun, D.-W. (2013). Non-destructive and rapid analysis of mois-
ture distribution in farmed Atlantic salmon (Salmo salar) fillets using visible
and near-infrared hyperspectral imaging. Innovative Food Science and Emerging
Technologies, 18, 237–245.
Hoving-Bolink, A., Vedder, H. W., Merks, J. W. et al. (2005). Perspective of NIRS mea-
surements early post mortem for prediction of pork quality. Meat Science, 69(3),
417–423.
Huang, H., Liu, L. and Ngadi, M. O. (2014). Recent developments in hyperspectral
imaging for assessment of food quality and safety. Sensors, 14(4), 7248–7276.
Ivorra, E., Girón, J., Sánchez, A. J. et al. (2013). Detection of expired vacuum-packed
smoked salmon based on PLS-DA method using hyperspectral images. Journal
of Food Engineering, 117(3), 342–349.
Kamruzzaman, M., Barbin, D., ElMasry, G., Sun, D.-W. and Allen, P. (2012a). Poten-
tial of hyperspectral imaging and pattern recognition for categorization and
authentication of red meat. Innovative Food Science and Emerging Technologies, 16,
316–325.
Kamruzzaman, M., ElMasry, G., Sun, D.-W. and Allen, P. (2011). Application of NIR
hyperspectral imaging for discrimination of lamb muscles. Journal of Food Engi-
neering, 104(3), 332–340.
Kamruzzaman, M., ElMasry, G., Sun, D.-W. and Allen, P. (2012b). Non-destructive
prediction and visualization of chemical composition in lamb meat using NIR
hyperspectral imaging and multivariate regression. Innovative Food Science and
Emerging Technologies, 16, 218–226.
Kamruzzaman, M., ElMasry, G., Sun, D.-W. and Allen, P. (2012c). Prediction of some
quality attributes of lamb meat using near-infrared hyperspectral imaging and
multivariate analysis. Analytica Chimica Acta, 714, 57–67.
Kamruzzaman, M., ElMasry, G., Sun, D.-W. and Allen, P. (2013). Non-destructive
assessment of instrumental and sensory tenderness of lamb meat using NIR
hyperspectral imaging. Food Chemistry, 141(1), 389–396.
Kamruzzaman, M., Makino, Y. and Oshita, S., (2016a). Hyperspectral imaging for
real-time monitoring of water holding capacity in red meat. LWT—Food Science
and Technology, 66, 685–691.
Kamruzzaman, M., Makino, Y. and Oshita, S. (2016b). Parsimonious model devel-
opment for real-time monitoring of moisture in red meat using hyperspectral
imaging. Food Chemistry, 196, 1084–1091.
Kim, I., Kim, M., Chen, Y. and Kong, S. (2004). Detection of skin tumors on chicken
carcasses using hyperspectral fluorescence imaging. Transactions-American Soci-
ety of Agricultural Engineers, 47(5), 1785–1792.
Kirk, P. L. (1950). Kjeldahl method for total nitrogen. Analytical Chemistry, 22(2),
354–358.
Hyperspectral Imaging Technique 77

Klein, M. E., Aalderink, B. J., Padoan, R., De Bruin, G. and Steemers, T. A. (2008).
Quantitative hyperspectral reflectance imaging. Sensors, 8(9), 5576–5618.
Kleynen, O., Leemans, V. and Destain, M.-F. (2005). Development of a multi-spectral
vision system for the detection of defects on apples. Journal of Food Engineering,
69(1), 41–49.
Konda Naganathan, G., Cluff, K., Samal, A. et al. (2016). Three dimensional chemo-
metric analyses of hyperspectral images for beef tenderness forecasting. Journal
of Food Engineering, 169, 309–320.
Langeron, Y., Doussot, M., Hewson, D. J. and Duchêne, J. (2007). Classifying NIR
spectra of textile products with kernel methods. Engineering Applications of Arti-
ficial Intelligence, 20(3), 415–427.
Larsen, E., Heldbo, J., Jespersen, C., and Nielsen, J. (1992). Development of a method
for quality assessment of fish for human consumption based on sensory evalu-
ation. In: Huss, H H., Jakobsen, M., Liston, J., (eds.) Quality Assurance in the Fish
Industry. Amsterdam: Elsevier Science Publishing, 351--358.
Lawrence, R. L., Wood, S. D. and Sheley, R. L. (2006). Mapping invasive plants using
hyperspectral imagery and Breiman Cutler classifications (RandomForest).
Remote Sensing of Environment, 100(3), 356–362.
Li, Y., Shan, J., Peng, Y. and Gao, X. (2011). Nondestructive assessment of beef-
marbling grade using hyperspectral imaging technology. In Procs 2011 Inter-
national Conference on New Technology of Agricultural Engineering (ICAE), Zibo,
China. IEEE, 779–783.
Liu, D. Ma, J., Sun, D.-W. et al. (2014a). Prediction of color and pH of salted porcine
meats using visible and near-infrared hyperspectral imaging. Food and Biopro-
cess Technology, 7(11), 3100–3108.
Liu, D., Sun, D.-W., Qu, J., Zeng, X. A., Pu, H. and Ma, J. (2014b). Feasibility of using
hyperspectral imaging to predict moisture content of porcine meat during salt-
ing process. Food Chemistry, 152, 197–204.
Lohumi, S., Lee, S., Lee, H., Kim, M. S., Lee, W. H. and Cho, B.-K. (2016). Application
of hyperspectral imaging for characterization of intramuscular fat distribution
in beef. Infrared Physics and Technology, 74, 1–10.
Luypaert, J., Heuerding, S., Vander Heyden, Y. and Massart, D. (2004). The effect of
preprocessing methods in reducing interfering variability from near-infrared
measurements of creams. Journal of Pharmaceutical and Biomedical Analysis, 36(3),
495–503.
Ma, J., Sun, D.-W. and Pu, H. (2016). Spectral absorption index in hyperspectral image
analysis for predicting moisture contents in pork longissimus dorsi muscles.
Food Chemistry, 197, Part A, 848–854.
Martens, H. and Stark, E. (1991). Extended multiplicative signal correction and
spectral interference subtraction: New preprocessing methods for near
infrared spectroscopy. Journal of Pharmaceutical and Biomedical Analysis, 9(8),
625–635.
Mendes, R., Cardoso, C. and Pestana, C. (2009). Measurement of malondialdehyde in
fish: A comparison study between HPLC methods and the traditional spectro-
photometric test. Food Chemistry, 112(4), 1038–1045.
Mercier, G. and Lennon, M. (2003). Support vector machines for hyperspectral image
classification with spectral-based kernels. In Proc Geoscience and Remote Sensing
Symposium, 2003 (IGARSS’03), Toulouse, France. IEEE International, 288–290.
78 Advanced Technologies for Meat Processing, Second Edition

Naganathan, G. K., Grimes, L. M., Subbiah, J., Calkins, C. R., Samal, A. and Meyer
G. E. (2008). Visible/near-infrared hyperspectral imaging for beef tenderness
prediction. Computers and Electronics in Agriculture, 64(2), 225–233.
Nakariyakul, S. and Casasent, D. (2007). Fusion algorithm for poultry skin tumor
detection using hyperspectral data. Applied Optics, 46(3), 357–364.
Palmer, C.A., Loewen, E. G. and Thermo, R. (2005). Diffraction Grating Handbook.
Springfield, OH: Newport Corporation.
Panagou, E. Z., Papadopoulou, O., Carstensen, J. M. and Nychas, G.-J. E. (2014).
Potential of multispectral imaging technology for rapid and non-destructive
determination of the microbiological quality of beef filets during aerobic stor-
age. International Journal of Food Microbiology, 174, 1–11.
Park, B., Lawrence, K., Windham, W. and Buhr, R. J. (2002). Hyperspectral imaging
for detecting fecal and ingesta contaminants on poultry carcasses. Transactions
of the ASAE, 45(6), 2017–2026.
Park, B., Lawrence, K., Windham, W. and Smith, D. (2006). Performance of super-
vised classification algorithms of hyperspectral imagery for identifying fecal
and ingesta contaminants. Transactions of the ASABE, 49(6), 2017–2024.
Park, B., Lawrence, K. C., Windham, W. R. and Smith, D. P. (2004). Multispectral
imaging system for fecal and ingesta detection on poultry carcasses. Journal of
Food Process Engineering, 27(5), 311–327.
Park, B., Lee, S., Yoon, S.-C. et al. (2011). AOTF hyperspectral microscopic imaging for
foodborne pathogenic bacteria detection. In SPIE Defense, Security, and Sensing,
April 2011, Orlando, Florida. International Society for Optics and Photonics,
802707-802707-11.
Park, B., Yoon, S.-C., Lawrence, K. and Windham, W. (2007). Fisher linear discrimi-
nant analysis for improving fecal detection accuracy with hyperspectral images.
Transactions of the ASABE, 50(6), 2275–2283.
Park, B., Yoon, S.-C., Windham, W. R. et al. (2010). Line-scan hyperspectral imag-
ing for real-time poultry fecal detection. In SPIE Defense, Security, and Sensing,
April 2010, Orlando, Florida. International Society for Optics and Photonics,
76760I-76760I-10.
Peng, Y., Zhang, J., Wang, W. et al. (2011). Potential prediction of the microbial spoil-
age of beef using spatially resolved hyperspectral scattering profiles. Journal of
Food Engineering, 102(2), 163–169.
Penha, R. and Hines, J. W. (2001). Using principal component analysis modeling to
monitor temperature sensors in a nuclear research reactor. In Proc 2001 Mainte-
nance and Reliability Conference (MARCON 2001), Knoxville, Tennessee. Citeseer.
Piqueras, S., Duponchel, L., Tauler, R. and de Juan, A. (2011). Resolution and segmen-
tation of hyperspectral biomedical images by Multivariate Curve Resolution-
Alternating Least Squares. Analytica Chimica Acta, 705(1–2), 182–192.
Qin, J., Chao, K. and Kim, M.S. (2011). Investigation of Raman chemical imaging for
detection of lycopene changes in tomatoes during postharvest ripening. Journal
of Food Engineering, 107(3), 277–288.
Reich, G. (2005). Near-infrared spectroscopy and imaging: Basic principles and phar-
maceutical applications. Advanced Drug Delivery Reviews, 57(8), 1109–1143.
Savitzky, A. and Golay, M. J. (1964). Smoothing and differentiation of data by simpli-
fied least squares procedures. Analytical Chemistry, 36(8), 1627–1639.
Hyperspectral Imaging Technique 79

Schaepman, M. E. (2007). Spectrodirectional remote sensing: From pixels to pro-

cesses. International Journal of Applied Earth Observation and Geoinformation, 9(2),
204–223.
Segtnan, V. H., Høy, M., Sørheim, O. et al. (2009). Noncontact salt and fat distributional
analysis in salted and smoked salmon fillets using X-ray computed tomography
and NIR interactance imaging. Journal of Agricultural and Food Chemistry, 57(5),
1705–1710.
Sivertsen, A. H., Heia, K., Hindberg, K. and Godtliebsen, F. (2012). Automatic nema-
tode detection in cod fillets (Gadus morhua L.) by hyperspectral imaging. Journal
of Food Engineering, 111(4), 675–681.
Sivertsen, A. H., Kimiya, T. and Heia, K. (2011). Automatic freshness assessment of
cod (Gadus morhua) fillets by Vis/Nir spectroscopy. Journal of Food Engineering,
103(3), 317–323.
Sone, I., Olsen, R. L., Sivertsen, A. H., Eilertsen, G. and Heia, K. (2012). Classifica-
tion of fresh Atlantic salmon (Salmo salar L.) fillets stored under different atmo-
spheres by hyperspectral imaging. Journal of Food Engineering, 109(3), 482–489.
Song, Y., Luo, Y., You, J., Shen, H. and Hu, S. (2012). Biochemical, sensory and
microbiological attributes of bream (Megalobrama amblycephala) during partial
freezing and chilled storage. Journal of the Science of Food and Agriculture, 92(1),
197–202.
Sun, D.-W. (2010). Hyperspectral Imaging for Food Quality Analysis and Control. Elsevier.
Sun, D. -W. (2007). Computer Vision Technology for Food Quality Evaluation. San Diego,
CA: Academic Press, Amsterdam: Academic Press.
Tao, F. and Peng, Y. (2015). A nondestructive method for prediction of total viable
count in pork meat by hyperspectral scattering imaging. Food and Bioprocess
Technology, 8(1), 17–30.
Tao, F., Peng, Y., Li, Y., Chao, K. and Dhakal, S. (2012). Simultaneous determination of
tenderness and Escherichia coli contamination of pork using hyperspectral scat-
tering technique. Meat Science, 90(3), 851–857.
Timmermans, A. (1995). Computer vision system for on-line sorting of pot plants
based on learning techniques. In: van Meurs, W. T. H. M., Gieling, T. H. and
Bennedsen, B. S. (eds.) II International Symposium on Sensors in Horticulture 421,
March 1998, Tune Landboskole, Greve, Denmark, 91–98.
Wang, H.-H. and Sun, D.-W. (2001). Evaluation of the functional properties of ched-
dar cheese using a computer vision method. Journal of Food Engineering, 49(1),
49–53.
Wang, W., Peng, Y., Huang, H. and Wu, J. (2011). Application of hyper-spectral imag-
ing technique for the detection of total viable bacteria count in pork. Sensor Let-
ters, 9(3), 1024–1030.
Willits, C. (1951). Methods for determination of moisture-oven drying. Analytical
Chemistry, 23(8), 1058–1062.
Windham, W., Lawrence, K., Park, B. and Buhr, R. (2003). Visible/NIR spectroscopy
for characterizing fecal contamination of chicken carcasses. Transactions-Ameri-
can Society of Agricultural Engineers, 46(3), 747–754.
Wold, J. P., Jakobsen, T. and Krane, L. (1996). Atlantic salmon average fat content
estimated by near-infrared transmittance spectroscopy. Journal of Food Science,
61(1), 74–77.
80 Advanced Technologies for Meat Processing, Second Edition

Wold, J. P., Johansen, I.-R., Haugholt, K. H. et al. (2006). Non-contact transflectance

near infrared imaging for representative on-line sampling of dried salted coal-
fish (bacalao). Journal of Near Infrared Spectroscopy, 14(1), 59.
Wold, J. P., Westad, F. and Heia, K. (2001). Detection of parasites in cod fillets by using
SIMCA classification in multispectral images in the visible and NIR region.
Applied Spectroscopy, 55(8), 1025–1034.
Wu, D. and Sun, D.-W. (2013a). Advanced applications of hyperspectral imaging tech-
nology for food quality and safety analysis and assessment: A review—Part I:
Fundamentals. Innovative Food Science and Emerging Technologies, 19, 1–14.
Wu, D. and Sun, D.-W. (2013b). Advanced applications of hyperspectral imaging
technology for food quality and safety analysis and assessment: A review—Part
II: Applications. Innovative Food Science and Emerging Technologies, 19, 15–28.
Wu, D. and Sun, D.-W. (2013c). Application of visible and near infrared hyperspectral
imaging for non-invasively measuring distribution of water-holding capacity in
salmon flesh. Talanta, 116, 266–276.
Wu, D. and Sun, D.-W. (2013d). Potential of time series-hyperspectral imaging (TS-
HSI) for non-invasive determination of microbial spoilage of salmon flesh.
Talanta, 111, 39–46.
Wu, D., Sun, D.-W. and He, Y. (2012). Application of long-wave near infrared hyper-
spectral imaging for measurement of color distribution in salmon fillet. Innova-
tive Food Science and Emerging Technologies, 16, 361–372.
Wu, D., Sun, D.-W. and He, Y. (2014). Novel non-invasive distribution measurement
of texture profile analysis (TPA) in salmon fillet by using visible and near infra-
red hyperspectral imaging. Food Chemistry, 145, 417–426.
Wu, D., Wang S., Wang, N. et al. (2013). Application of time series hyperspectral imag-
ing (TS-HSI) for determining water distribution within beef and spectral kinetic
analysis during dehydration. Food and Bioprocess Technology, 6(11), 2943–2958.
Xie, A., Sun, D.-W., Xu, Z. and Zhu, Z. (2015). Rapid detection of frozen pork qual-
ity without thawing by Vis–NIR hyperspectral imaging technique. Talanta, 139,
208–215.
Xiong, Z., Sun, D.-W., Dai, Q. et al. (2015a). Application of visible hyperspectral imag-
ing for prediction of springiness of fresh chicken meat. Food Analytical Methods,
8(2), 380–391.
Xiong, Z., Sun, D.-W., Xie, A., Han, Z. and Wang, L. (2015b). Potential of hyperspectral
imaging for rapid prediction of hydroxyproline content in chicken meat. Food
Chemistry, 175, 417–422.
Xiong, Z., Sun, D.-W., Zeng, X.-A. and Xie, A. (2014). Recent developments of hyper-
spectral imaging systems and their applications in detecting quality attributes
of red meats: A review. Journal of Food Engineering, 132, 1–13.
Xu, J. L., Riccioli, C. and Sun, D.-W. (2015). An overview on nondestructive spectro-
scopic techniques for lipid and lipid oxidation analysis in fish and fish products.
Comprehensive Reviews in Food Science and Food Safety, 14(4), 466–477.
Xu, J.-L., Riccioli, C. and Sun, D.-W. (2016). Efficient integration of particle analysis in
hyperspectral imaging for rapid assessment of oxidative degradation in salmon
fillet. Journal of Food Engineering, 169, 259–271.
Yoon, S., Lawrence, K., Smith, D., Park, B. and Windham, W. (2008). Embedded bone
fragment detection in chicken fillets using transmittance image enhancement
and hyperspectral reflectance imaging. Sensing and Instrumentation for Food
Quality and Safety, 2(3), 197–207.
Hyperspectral Imaging Technique 81

Zhu, F., Zhang, D., He, Y., Liu, F. and Sun, D.-W. (2013). Application of visible and
near infrared hyperspectral imaging to differentiate between fresh and frozen–
thawed fish fillets. Food and Bioprocess Technology, 6(10), 2931–2937.
Zhu, F., Zhang, H., Shao, Y., He, Y. and Ngadi, M. (2014). Mapping of fat and moisture
distribution in Atlantic salmon using near-infrared hyperspectral imaging. Food
and Bioprocess Technology, 7(4), 1208–1214.
3
Raman Spectroscopy for Predicting
Meat Quality Traits

Stephanie M. Fowler, Heinar Schmidt, Rico Scheier,

and David L. Hopkins

CONTENTS
3.1 Introduction ..................................................................................................83
3.2 Theory of Raman Spectroscopy.................................................................84
3.3 Raman Spectroscopic Devices ................................................................... 86
3.4 Applications in Meat Science ..................................................................... 87
3.4.1 Pork .................................................................................................... 88
3.4.1.1 Prerigor Pork ...................................................................... 88
3.4.1.2 Postrigor Pork .................................................................... 92
3.4.1.3 Heat-Treated Pork .............................................................. 93
3.4.1.4 Fatty Acid Composition of Pork Adipose Tissue.......... 94
3.4.2 Lamb .................................................................................................. 96
3.4.3 Beef ................................................................................................... 100
3.4.4 Spoilage ........................................................................................... 102
3.4.5 Differentiation of Animal Species and Detection of
Adulteration in Muscle Foods ...................................................... 103
3.5 Limitations .................................................................................................. 104
3.6 Conclusion .................................................................................................. 106
References............................................................................................................. 107

3.1 Introduction
Raman spectroscopy is a method of vibrational spectroscopy that was first dis-
covered by Indian physicist Sir C. V. Raman in 1928. Initially used to provide the
first catalog of molecular vibrational frequencies, the low sensitivity of the tech-
nique hindered its use as extensive methods were needed to measure relatively
large volumes of highly concentrated samples in order to obtain quality Raman
spectra. Consequently, the use of Raman spectroscopy for chemical analysis
declined as infrared (IR) spectrophotometers became available. Since these
early days, the advent of lasers in the 1960s facilitated the development of more

83
84 Advanced Technologies for Meat Processing, Second Edition

simplified Raman spectroscopy equipment and increased the sensitivity of the

technique. Further development of technologies in recent decades has continued
to increase the efficiency of the equipment, which has enabled the construction
of smaller and more robust devices (McCreery, 2000). As a result, Raman spec-
troscopy is now a widely used method of chemical analysis used in a number
of applications including archaeology, forensics, biomedical, and food sciences.

3.2 Theory of Raman Spectroscopy

Raman spectroscopy is based on the principle that when light is directed
at matter, there is an interaction and an exchange of energy occurs, which
is referred to as inelastic scattering (Das and Agrawal, 2011). If the photons
interact with the molecules and the net exchange of energy causes the pho-
ton to gain vibrational energy from the molecules and the backscattered
frequency is greater than the incident frequency, this is called anti-Stokes
Raman scattering. However, the reverse is more likely, where matter gains
energy from the photons resulting in a backscattered frequency which is
lower than the incident beam, which is referred to as Stokes Raman scatter-
ing (Ozaki, 1999). These interactions with the excitation photons are graphed
for relative wave number (Raman shift) and intensity of the frequencies mea-
sured as a spectrum where the peaks indicate Raman scattering and the cen-
tral peak indicates the Rayleigh scattered light (Figure 3.1).
Vibrations for different chemical bonds are distinct due to energy that
excites them and the movement of atoms which are generated by the

Anti-Stokes Raman Stokes Raman

Laser

×10–6
Intensity

×50

–1800 –1400 –1000 –600 –200 200 600 1000 1400 1800
Relative wave number (cm–1)

FIGURE 3.1
Representation of anti-Stokes and Stokes Raman spectra of polystyrene. Raman shifts are
given in wave numbers relative to the laser line, which has been supressed by a notch filter.
Raman Spectroscopy for Predicting Meat Quality Traits 85

Stretches

Deformations

Scissor Rock

Twist Wag

+ – + +
Symmetric Asymmetric

FIGURE 3.2
Examples of the chemical bond vibrations of the methylene group as characterized by Raman
spectroscopy.

exchange as well as the frequency at which the atoms oscillate, which cor-
responds to the wave number. Consequently, vibrations are characterized
by their type of motion including the stretch of bonds (symmetric and
asymmetric) and deformation of bond angles including in-plane deforma-
tions (scissor and rock deformations) and out-of-plane deformations (twist
and wagging), as illustrated in Figure 3.2 for the three-atom methylene
group.
Although the structure of large molecules cannot be directly obtained
from the spectrum, approximations have been determined using the atomic
vibrations of small molecules (Krimm and Bandekar, 1986). Early Raman
studies ascertained the character of the vibrations (intensity, wave number,
and symmetry) and the determination of their relation to the structure of the
molecule using various pure and denatured samples, isotopic substitution
and excitation at various wavelengths (Frushour and Koenig, 1975; Carey,
1982; Hudson and Mayne, 1986; Krimm and Bandekar, 1986; Krimm, 1987).
Historically, Raman spectroscopy has many applications including chemi-
cal identification of materials in artworks (Breitman et al., 2007), quantitative
analysis of fungicides, three-dimensional imaging of chemical composition,
rapid identification of biological samples, pharmacology, dermatology, cos-
metic development, and characterizing pigments as well as atomic and ele-
ment composition (Hudson and Mayne, 1986; Das and Agrawal, 2011). With
recent advances in charge-coupled devices (CCDs) and laser technologies,
the use of Raman spectroscopy is expanding and its uses within commercial
food systems are being explored.
Raman spectroscopy is suitable for use in food systems as it can provide infor-
mation about the structure, function, and kinetics of biomolecules including
proteins and lipids by identification of the vibrational bands (Das and Agrawal,
86 Advanced Technologies for Meat Processing, Second Edition

2011). The advantages of using Raman spectroscopy, in lieu of other technolo-

gies, include no sample preparation so measurements can be taken in any phys-
ical state including gases, liquids, gels, amorphous solids, or crystals. Raman is
less affected by varying water content compared to IR or near infrared (NIR);
it is nondestructive, noninvasive, and can detect substances even if only small
amounts are present. Furthermore, it is sensitive to structural changes that are
induced by freezing, heating, mixing, aeration, fiber formation, denaturation,
and gelatination (Li-Chan et al., 1994; Li-Chan, 1996; Ozaki, 1999; Beattie et al.,
2004b; Afseth et al., 2006; Chen and Han, 2011). Consequently, Raman spectros-
copy is ideal for application in the research and assessment of muscle foods.

3.3 Raman Spectroscopic Devices

Benchtop Raman devices are the most common Raman spectroscopic equip-
ment currently in use. A schematic diagram (Figure 3.3) illustrates the
arrangement, where a laser passes through the sample, and the scattered
light is collected through a CCD detector, after it has passed through a notch
filter, and focused onto the CCD detector. While the benchtop devices can be
useful in suppressing fluorescence, which can be a limitation when measur-
ing biological samples (Hudson and Mayne, 1986), they are limited for in situ
measurement by the sampling required as well as the size and weight of the
devices, and the power consumption of the lasers (Schmidt et al., 2009).

Laser Sample

Collection optics

Rayleigh filter

Launch optics

Single-stage
spectrometer CCD

Grating

FIGURE 3.3
Schematic diagram of a benchtop single grating Raman spectrometer with a multichannel
charge-coupled device (CCD) detector.
Raman Spectroscopy for Predicting Meat Quality Traits 87

Lens Filters
Fiber-optic cable
Sample

Window Mirrors

Laser To spectrometer

FIGURE 3.4
Schematic diagram of a Raman handheld probe head. (Adapted from Schmidt et al., Proceedings
of the Advanced Environment, Chemical and Biological Sensing Technology VI, International Society
for Optics and Photonics, Orlando, Florida, 2009.)

Miniaturization of the laser and implementation of fiber optics into Raman

devices has enabled the development of ball probes which can be connected
to Raman spectroscopy instruments via a fiber-optic cable (Olsen et al.,
2007). The CCD and spectrograph technologies used with this probe are
bulky and collected light needs to be filtered before it can be focused and
collected with the CCD, while others have developed a handheld Raman
sensor head for in situ characterization of meat quality (Schmidt et al., 2009).
This technology uses the principles of backscattering geometry, lens optics,
integration of laser, and Raman filter stage in one optical bench device. Min-
iaturization of the benchtop device required the laser, band pass, and the
Raman edge filters to be combined into a single module (or optical bench),
along with mirrors and lens optics as illustrated in Figure 3.4 (Schmidt et al.,
2009). The Rayleigh scattered radiation is removed by the Raman filters and
the Stokes-shifted signals is launched into an optical fiber within the same
device (Schmidt et al., 2009).
Laboratory assessment of this technology suggested that a wavelength
of 671 nm is optimal for pork meat, as it is a trade-off between the shorter
wavelengths which allow for faster measuring times due to higher scatter-
ing intensities and the long wavelengths required to reduce fluorescence of
the biological molecules (Schmidt et al., 2010). However, other Raman spec-
troscopic measurement parameters including laser power, integration time
(the length of time used to collect photons on the detector), and the number
of integrations (accumulations) acquired can be altered between samples to
improve spectra, dependent on factors such as the rigor status of the meat.

3.4 Applications in Meat Science

The advantages of using Raman spectroscopy in food systems has not been
overlooked in recent meat science research. Consequently, numerous studies
88 Advanced Technologies for Meat Processing, Second Edition

have been conducted using both benchtop and handheld devices to deter-
mine whether Raman spectroscopy has the ability to predict a number of
meat quality traits of beef, lamb, and pork.

3.4.1 Pork
Among the Raman publications in meat science, pork has the largest share
(>40% between 2000 and 2015), reflecting that pork is a highly consumed
meat in the world and especially preferred in Europe, large parts of Asia, and
North America (Food and Agriculture Organization of the United Nations
[FAO], 2014). Apart from the pioneering work in the 1970s (Carew et al., 1975;
Pezolet et al., 1978), Raman spectroscopy was rarely used in the meat science
field before 2000.
The first Raman papers on pork addressed sensory and technological
parameters associated with warmed-over flavor due to preslaughter stress
(Brøndum et al., 2000a) indicating high expectations for the fingerprint-
ing capabilities of Raman spectroscopy, while the second tackled the pre-
diction of the water holding capacity (WHC) of pork in the abattoir before
rigor (Pedersen et al., 2003). However, this early work was carried out with
benchtop laboratory instruments which were not suited to the measure-
ment of meat or for fieldwork. Furthermore, these results were reported to be
inferior due to lack of practicability and lack of sensitivity when compared
to low-field nuclear magnetic resonance (NMR) (Brøndum et al., 2000a) or
Fourier transform infrared (FTIR) predictions (Pedersen et al., 2003), which
were conducted in parallel. It took nearly 10 years until the development of
compact and sensitive Raman instrumentation allowed for a more practical
and general use of Raman spectroscopy in meat science. Since then, pre-
dominantly technological and sensory quality parameters of pork have been
investigated with Raman spectroscopy while the investigation of processed
products is still an emerging field.

3.4.1.1 Prerigor Pork

The initial work of Pedersen et al. (2003) conducted Raman spectra of meat
samples which were excised from freshly slaughtered pigs (n = 14) in an abat-
toir between 10 and 30 minutes postmortem (PM). While the authors found a
correlation (R2 = 0.95) between the spectra and the measured drip loss (DL),
the number of samples was low and no understanding of the Raman spectra
in the prerigor phase was reported, limiting further applications of the find-
ings. However, Pedersen et al. (2003) did collect reference spectra of metab-
olites relevant to the development of meat quality traits during anaerobic
glycolysis.
Although these early studies were limited, they highlighted the potential
for Raman spectroscopy to monitor PM metabolism, particularly for pork
Raman Spectroscopy for Predicting Meat Quality Traits 89

which is susceptible to metabolic-related meat quality defects, such as dry

firm and dark (DFD) and pale soft and exudative (PSE) meat (England et al.,
2013). Indeed, further research conducted by Scheier and Schmidt (2013) used
a prototype handheld Raman device over a period of 0.5–10 h PM to measure
the musculus semimembranosus (SM) from 10 animals, while measuring pH
and lactate concentration as reference. In this research, pH was shown to
correlate with two phosphate signals which act as pH indicators (Scheier and
Schmidt, 2013). The pH values were calculated from the net signal intensities
at 980 [A − ] and 1080 cm–1 [HA] with a standard error of 0.3 pH units using
the Henderson–Hasselbalch equation (Equation 3.1):

⎛ [A − ] ⎞
pH = pKa + log 10 ⎜ ⎟ (3.1)
⎝ [HA] ⎠

The observed pH values in this study gave a mean value of 5.8 and a stan-
dard deviation (SD) of 0.32, while the root-mean-squared error of calibra-
tion (RMSEC) was 0.14 pH units calculated with a multiple linear regression
model based on the net intensities of 11 selected peaks. However, this error
was reduced to 0.07 pH units with a partial least squares regression (PLSR)
model (Scheier and Schmidt, 2013) demonstrating that different analyses can
reduce the predictive error.
Using advanced spectral preprocessing and multivariate calibration tech-
niques, such as multiplicative scattering correction and locally weighted
regression, further studies have shown that the lactate concentration and
pH values can be determined from the Raman spectra with an error of root
mean square error of cross-validation (RMSECV) = 4.5 mmol/kg (mean
62.2 mmol/kg and SD 22.2 mmol/kg) and RMSECV = 0.06, respectively,
highlighting the lactate concentration and pH predictions can be further
improved (Nache et al., 2015).
The other observed changes in the spectra associated with pH decline
in pork, however, were too complex for a direct assignment of the signals
to metabolites (Scheier and Schmidt, 2013). The key to an understanding
of the spectra was the calculation of difference spectra which reduced the
complexity of the spectral changes in two defined phases: prerigor (spectra
collected at <1 h PM minus the spectra collected at 2 h PM) and when the
muscle enters into the rigor (spectra collected at 8.5 h PM minus spectra
collected at 2 h PM). The subsequent measured difference spectra from
both phases could then be well explained by calculating difference spectra
using the scaled reference spectra of the involved metabolites (Figure 3.5)
(Scheier et al., 2014b). To this end, the reference spectra were measured
in aqueous solution under the same pH conditions which were observed
in the meat samples and these spectra were scaled according to the mea-
sured or expected concentrations in normal meat (reddish, firm, nonexu-
dative—RFN) (Scheier et al., 2014b).
90 Advanced Technologies for Meat Processing, Second Edition

(a) (c)
H+ + CrP ADP ADP

Cr AMP IMP
ATP
NH3
Lactate

Glycogen ADP Pi + H+
(b) (d)

FIGURE 3.5
Scheme of postmortem energy metabolism in muscle cells showing (a) degradation of creatine
phosphate (CrP) to creatine (Cr), (b) glycolysis and formation of lactate, (c) consumption of
adenosine diphosphate (ADP) and subsequent deamination of adenosine monophosphate
(AMP) to inosine monophosphate (IMP), and (d) hydrolysis of adenosine triphosphate (ATP)
with formation of inorganic phosphate (Pi) and H+ ions. Metabolites identified in the Raman
spectra are framed: dashed and solid lines denote decreasing and increasing concentrations,
respectively. (Modified from Scheier et al., Vibrational Spectroscopy, 70, 12–17, 2014b.)

The key metabolites of anaerobic glycolysis are summarized in Figure 3.6,

where metabolites which were observed in the Raman spectra with decreas-
ing concentration are marked with dashed lines, and compounds with
increasing concentrations are marked with solid lines. Central to this pro-
cess is the regeneration of adenosine triphosphate (ATP) by depleting
stored creatine phosphate (CrP), reaction (a), or glycolysis and formation of
lactate, reaction (b). Preslaughter stress can accelerate or inhibit these reac-
tions causing deviations from normal meat quality (Scheffler and Gerrard,
2007; Adzitey and Nurul, 2011). If the muscle glycogen reserves were already
exhausted before the death of the animal, glycolysis and formation of lactate
are inhibited. If the metabolism is upregulated perimortem, regeneration
from adenosine diphosphate (ADP) and subsequent deamination to ino-
sine monophosphate (IMP), reaction (c), is significant and was shown to be
an indicator of PSE and DFD (Honikel and Fischer, 1977). This information
can be extracted from prerigor Raman spectra of pork. Finally, when ATP
is hydrolyzed, reaction (d), protons are released which causes a fall in the
muscle’s pH. It is interesting to note that the proton is not released during
glycolysis or upon reduction of pyruvate to lactate (this step is consuming
a proton), but that the proton is virtually stored in polyphosphates (as acid
anhydrides) until the hydrolysis of ATP (Robergs et al., 2004). These key
metabolites and components with their most significant Raman peaks are
summarized in Table 3.1.
Raman Spectroscopy for Predicting Meat Quality Traits 91

935
1645 1448 1309 901
(f)
6.0
1081 827
976
(e)

5.0
875
1075
Raman difference intensity (counts/mWs)

(d)
4.0 855
1417

537
1380
1338

1040
1115 937
(c)
3.0
1551
1466
1303
1576

1335

1119 732
(b)
2.0

(a)

1.0

(S)

0.0
1700 1500 1300 1100 900 700 500
Wave number (cm–1)

FIGURE 3.6
Raman difference spectra of (a) porcine m. semimembranosus from seven pigs measured 8.5 h
and 2 h postmortem and (S) simulated sum spectrum comprising Raman spectra of (b) inosine
monophosphate at pH 5.6 minus adenosine triphosphate (ATP) at pH 6.0, (c) lactate minus
glycogen, (d) phosphate at pH 5.6 minus phosphate at pH 6.0, (e) glucose 6-phosphate (G6P) at
pH 5.6 minus G6P at pH 6.0, and (f) α -helical proteins. (Modified from Scheier et al., Vibrational
Spectroscopy, 70, 12–17, 2014b.)
92 Advanced Technologies for Meat Processing, Second Edition

TABLE 3.1
Assignment of Most Significant Peaks to Metabolites Found in
Different Raman Spectra of Early Postmortem Porcine Muscle
Peak Position/cm –1 Assignment

732, 1119, 1303, 1335, 1576 Adenosine triphosphate

901, 935, 1309, 1448, 1645 α -helical proteins
826, 1045 Creatine
849, 978 Creatine phosphate
937, 1115 Glycogen
1466, 1551 Inosine monophosphate
537, 855, 1040, 1417 Lactate
875, 1075 (980) Phosphate, monobasic (dibasic)
827, 1081 (976) Sugar phosphates, monobasic (dibasic)
Source: Scheier, R. et al., Vibrational Spectroscopy, 70, 12–17, 2014b.

To transfer this approach from the laboratory to field tests, two experi-
ments were performed using the portable Raman device to demonstrate the
feasibility of using Raman spectra for the prerigor assessment of meat quality
in a production environment (Scheier et al., 2014a, 2015b). In the first study,
the Raman spectra of the SM from 96 pigs were recorded where the car-
casses had been split, in the chilling room of an abattoir 1–2 h after slaugh-
ter. Ten Raman spectra with only 2.5 s integration times were averaged and
correlated with pH45, pH24, DL, L*, a*, b*, and shear force (SF) measured after
24 (SF24) and 72 h (SF72) using PLSR. The animals were selected to cover all
typical slaughter weights and grades and the sample contained PSE and
DFD type animals. Coefficients of correlation of between 0.64 and 0.73 were
obtained for pH45, pH24, DL, L*, b*, and SF72 (Scheier et al., 2014a). While the
measurement in the chiller allowed for a good differentiation of the meta-
bolic state of the carcasses, this point in time did not meet the requirements
of the regular operation of the abattoir. Therefore, in the second study, the
Raman spectra of the SM from 151 pigs were recorded at 25–40 min after
slaughter before weighing and classification of the carcasses. The averaged
Raman spectra with 2.5 s integration time, six accumulations and seven rep-
licates were correlated with pH45, pH24, L*, and DL yielding good results for
pH5 (R2 = 0.75), pH24 (R2 = 0.58), and DL (R2 = 0.83) (Scheier et al., 2015b).
In summary, the field studies demonstrated that Raman spectra recorded
from porcine muscles before rigor (0.5–2 h PM) can be utilized to measure
and predict technological quality traits such pH1 (pH value at 1 h PM), ulti-
mate pH (pHu), and DL (which will occur three days later) with one mea-
surement. This is possible because the predictions are based on (known)
differences of the early PM energy metabolism which is captured by the
Raman spectra and which is related to deviating qualities such as dry (DFD)
or exudative (PSE).
Raman Spectroscopy for Predicting Meat Quality Traits 93

3.4.1.2 Postrigor Pork

While anaerobic glycolysis is ending and the muscle is passing into rigor
mortis, a large part of this information is lost, e.g., normal pork cannot be
discriminated from PSE meat based on the pHu. Similarly, postrigor Raman
spectra contain less spectral information which can be used for the predic-
tion of DFD and PSE affected pork. For example, the Raman spectra of exu-
dative (PSE) pork exhibits significantly lower signals of α -helical proteins
(Table 3.1) in the rigor phase, but these pH-related signals cannot be distin-
guished from normal pork (Scheier and Schmidt, 2013).
Subsequently, a very weak relationship between Raman spectra and the
meat quality defect warmed-over flavor was reported when the impact of pre-
slaughter stress on the development of warmed-over flavor was studied by
Brøndum et al. (2000b). However, we cannot exclude that this poor relation-
ship could also be due to the instrumentation used in this study, as a 1064 nm
laser was used which is less suited to applications in meat science. Alterna-
tively, postrigor spectra from 95 pigs recorded with the 671 nm Raman device
yielded correlations with pH and DL of R2 = 0.85 and 0.7, respectively, showing
that the spectra allowed for the identification of DFD meat, but not for a clear
differentiation of PSE meat (Schmidt et al., 2012). Subsequent work with 137
m. longissimus thoracis yielded improved prediction errors for pH24 (RMSECV
= 0.03 pH units), but not for DL (0.9%). In addition, L* (RMSECV = 1.2) and, to
some extent, cooking loss (1.6%) could be correlated with the postrigor Raman
spectra (Scheier et al., 2015a). However, the samples in this study were homog-
enous and contained neither PSE nor DFD animals so no conclusions can be
drawn with respect to the postrigor detection of these qualities.
The ability to predict other meat quality traits of pork using Raman spectros-
copy has also been investigated as further studies have measured pork to deter-
mine SF values (Beattie et al., 2008) and sensory attributes (Wang et al., 2012).
In a study conducted by Beattie et al. (2008), aged and cooked pork was tested
with a 785 nm Raman benchtop device to determine whether SF values could
be predicted. Prediction models for this study yielded a prediction error of
RMSEP = 4.4 N for animals with an average SF of 36.9 N. However, the number
of samples measured in this study was low, as meat from only three pigs was
measured. Therefore, the application of this study is limited. Further work to
predict sensory attributes of pork using a Raman microscope equipped with a
780 nm excitation laser yielded poor accuracies in PLSR predictions of 23.2%,
9.6%, and 17.3% (with 5% error tolerance) for tenderness, chewiness, and juici-
ness which were assessed by a sensory panel, but showed >83% correct pre-
dictions with tenderness and chewiness when employing PLS discriminant
analysis (PLSDA) (Wang et al., 2012) suggesting that Raman spectral data may
be better suited to differentiating and classifying meat on tenderness.
Overall, these studies conducted on pork highlight the potential of postrigor
Raman spectra to determine technological relevant pork quality traits SF,
pH24, and L* as well as sensory attributes.
94 Advanced Technologies for Meat Processing, Second Edition

3.4.1.3 Heat-Treated Pork

Cooking meat leads to changes in protein structures including denaturation
of myosin at 53°C, sarcoplasmic proteins and connective tissue at 62°C, as well
as actin at 76°C (Xiong et al., 1987; Tornberg, 2005). Subsequently, the changes
associated with cooking can be monitored using Raman spectroscopy as they
alter the spectra of cooked meat (Beattie et al., 2008; Berhe et al., 2014, 2015).
The signals indicating denaturation of the proteins predominantly originate
from the protein backbone signals at 1640–1660 (amide I, α -helix), 1660–1670
(amide I, random coil and β-pleated sheet), 1330–1350 (CH-bending), 1230–1260
(amide III, random coil and β -pleated sheet), 1000 (C-C stretching β -pleated
sheet) (Beattie et al., 2008), and 920–960 cm–1 (C-C stretching α -helix) (Berhe
et al., 2014, 2015). Although broad signals in the regions 510–550 cm–1 have
been assigned to disulfide bonds (Berhe et al., 2014), the observed intensities
are too high in this study to account for the low cysteine content of the meat.
Furthermore, loss of fat, which also occurs during cooking, has been identi-
fied by peaks at 1060, 1080, and 1128 cm–1 (Beattie et al., 2008).
It has been long established that protein conformation and denaturation are
reflected by the Raman spectra (Frushour and Koenig, 1975). Consequently,
several studies were completed to determine if Raman spectroscopy could
predict end point temperature by using principal component analysis (PCA)
to cluster spectra according to the end point cooking temperature (Berhe et al.,
2014, 2015). These studies found that the temperature could be calculated
using PLSR with a prediction error of RMSECV = 1.3°C (Berhe et al., 2014)
and 1.3–1.6°C for freshly cooked meat (Berhe et al., 2015), and with 1.6–2.0°C
for cooked meat stored for four or eight days (Berhe et al., 2014). Furthermore,
classification of samples cooked below and above 65°C was achieved with
<5% misclassification (Berhe et al., 2015) indicating that Raman spectroscopy
could be useful to check the core temperature of cooked meat in a final prod-
uct. However, the application of these studies is limited given that noninva-
sive methods of temperature determination are already available.
The spectral changes associated with cooking have also been studied to
determine the potential for Raman spectra to predict the amount of intracel-
lular fluid lost during cooking (cooking loss) and postcooking SF values of
pork. Indeed, several studies have agreed that cooking loss of pork could be
determined from Raman spectra with an RMSECV of 2.5% (Beattie et al.,
2008) and 2.8% (Berhe et al., 2014). Interestingly, these studies were also able
to predict cooking time with an RMSECV = 4.1 min (Beattie et al., 2008) and
1.4 h (Berhe et al., 2014). The correlation of SF with spectra of cooked pork
samples was also promising, as models yielded a root-mean-squared error of
prediction of RMSEP = 4.4 N using 54 samples for calibration and for valida-
tion with an averaged SF for all samples of 36.9 N (Beattie, 2015, pers. comm.).
Overall, these studies have shown that Raman spectra of cooked pork were
able to provide information about conformational changes in the secondary
structure of meat proteins and the hydrophobic environment at the molecu-
lar level. This spectral information can be used to predict the end point tem-
Raman Spectroscopy for Predicting Meat Quality Traits 95

perature, cooking loss, and cooking time with high accuracy. In addition,
there is potential to assess tenderness with Raman spectra of cooked pork.

3.4.1.4 Fatty Acid Composition of Pork Adipose Tissue

Raman work on pork adipose tissue has focused on the fatty acid (FA) com-
position (Olsen et al., 2007, 2008, 2010) and the prediction of FA bulk param-
eters for adipose tissue to differentiate it from the fat of other meat species
(Beattie et al., 2006). These studies demonstrated consistently good correla-
tions between the Raman spectra and bulk unsaturation parameters of pork
subcutaneous fat, including total unsaturated cis FAs (R2 = 0.97) and poly-
unsaturated fatty acids (PUFAs) (R2 = 0.97) (Beattie et al., 2006), iodine value
(IV) (R2 = 0.89 and 0.97), monounsaturated fatty acids (MUFAs) (R2 = 0.96),
and PUFAs (R2 = 0.98) (Olsen et al., 2007, 2010).
The predictions of trans-FAs were not as promising (R2 = 0.52), which was
ascribed to the inherently low content of trans-FAs present in pork meat (Beat-
tie et al., 2006). Similarly, the prediction of individual FAs with Raman spec-
troscopy was shown to be feasible for subcutaneous fat in general, but with
different levels of accuracy for individual FAs (Beattie et al., 2006). As this is
of considerable interest due to the importance of determining the nutritional
value of meats, further work has addressed the determination of omega-3 und
omega-6 FAs in adipose tissue from the neck of 73 pork carcasses (Olsen et al.,
2008). This study found a high correlation between omega-6 and Raman spec-
tra (R2 = 0.93) yet the correlation was slightly lower between omega-3 FAs and
Raman spectra (R2 = 0.91). Further work on the prediction of individual FAs has
revealed that prediction of individual FAs is likely to be indirectly but strongly
correlated to other FAs, such as PUFA and IV, when predicted using Raman
spectra (Berhe et al., 2016). The authors describe this as a “cage of covariance,”
which is also affected by the animal’s diet and potentially breed. Consequently,
the authors suggested that further analysis is required when assessing models
to predict individual FAs to prevent model instability due to this covariance.
Further Raman spectroscopy research has also been conducted to dis-
criminate between the inner and the outer layers of porcine subcutaneous
adipose tissue, which is important due to the impact of chemical composi-
tion of fat on the cohesiveness and firmness of fat, visual appearance, oxida-
tive stability, and nutritive value of value-added pork products (Lyndgaard
et al., 2012). Discrimination between the layers is possible as there is a higher
degree of unsaturation (higher IV) of the outer layer compared to the inner
layer (Lyndgaard et al., 2012).
The ability of Raman spectra to reflect the bulk FA profile was also
exploited when discriminating animal fats from different species (Beattie
et al., 2007; Sowoidnich and Kronfeldt, 2012; Boyaci et al., 2014b) or animal fats
from plant oils (Abbas et al., 2009). The differentiation of animal fats from dif-
ferent origins is possible using polymorphic features in the Raman spectra.
Polymorphism is the ability of a compound to solidify in different crystalline
structures. As an example, the polymorphs of tristearin can be discriminated
96 Advanced Technologies for Meat Processing, Second Edition

by their Raman spectra (Da Silva et al., 2009). Thus, the 1417 cm–1 methylene
scissoring vibration which is an indicator for the β ′ polymorph can be used to
discriminate porcine adipose tissue from bovine adipose tissue (Motoyama
et al., 2010). Furthermore, Raman spectroscopy has been used to monitor
physical changes of adipose tissue during the refrigeration process of a car-
cass. The degree of crystallinity and the fraction of β′ polymorph of porcine
adipose tissue were shown to increase with refrigeration time and with low-
ering temperature (Motoyama et al., 2013). In this study, the degree of crys-
tallinity was calculated from the methylene twisting vibrations attributed to
crystalline and melted fat at 1297 cm−1 and 1305 cm–1, respectively. Raman
imaging was then applied to visualize and characterize the spatial distribu-
tion of the crystalline states of fats (Motoyama et al., 2016).
The ban on surgical castration of piglets in Europe has resulted in research into
the detection of boar taint (EU, 2010). Boar taint is characterized as an off-flavor
that is perceivable when fat of entire males is heated and is mainly ascribed
to the compounds skatole (3-methyl-indole) and androstenone (5α-androst-
16-en-3-one), which are enriched in adipose tissue. Three approaches have
been reported to investigate the feasibility of using Raman spectroscopy for
boar taint detection (Wang, 2013; Sorensen et al., 2015; Liu et al., 2016). The first
method used a methanolic extract from subcutaneous fat and direct measure-
ment of the extract (Wang, 2013). However, both skatole and androstenone occur
at concentrations that are so low that they are not directly assessed with sponta-
neous Raman scattering. Therefore, this approach is not practical for a produc-
tion environment due to the extraction process. The second approach also used
a methanolic extract, but assessed the malodorous compounds directly with
surface-enhanced Raman spectroscopy (SERS) (Sorensen et al., 2015). SERS is
the amplification of Raman scattering by orders of magnitude when the com-
pounds are adsorbed to gold or silver nanoparticles (Lee and Meisel, 1982). With
SERS, quantification of skatole and androstenone was shown to be feasible with
prediction errors (RMSECV) of 0.17 μg/g for skatole and 1.5 μg/g for androste-
none in the fat (Sorensen et al., 2015). The third approach tested the indirect
detection of boar taint based on variations in the FA profile of boars. The ratio-
nale behind this approach was that such a measurement can be recorded dur-
ing the production process. Liu et al. (2016) showed that detection of extreme
boar taint based on differences in the FA composition of subcutaneous fat was
feasible with Raman spectroscopy and that the highest classification accuracy
was achieved using only spectra from the inner layer (81% samples correctly
classified). However, this approach had limitations as only extremely divergent
fat samples were detectable and the classification may be affected by the diet of
the animals as it influences the FA composition.

3.4.2 Lamb
The initial Raman spectroscopic research on lamb carcass quality conducted
by Schmidt et al. (2013) used a Raman spectroscopic handheld device to pre-
Raman Spectroscopy for Predicting Meat Quality Traits 97

dict SF values, due to the importance of tenderness to the consumer acceptance

of meat products (Thompson, 2002). Consequently, the m. longissimus thoracis
et lumborum (LTL) was sampled from 140 mixed sex lambs that were bred and
reared at two different research sites, and this muscle was measured using a
Raman handheld device equipped with a 671 nm laser (Schmidt et al., 2009).
Prediction models developed using PLSR yielded promising correlations of
R2 = 0.79 and 0.86, respectively, for the samples measured from the two sites.
However, the methodology of this study limits the application of the findings
to commercial meat processors, as the measurements were conducted on 3
cm sections of LTL that were aged, frozen at −20°C, and thawed. Further-
more, this study did not conduct the Raman spectroscopic measurements and
determine the SF values from the same piece of meat. Subsequently, further
research was conducted to investigate whether the same Raman handheld
device could be used to predict SF values of fresh intact lamb measured on
the same piece of meat (Fowler et al., 2014a,b).
The complementary studies conducted by Fowler et al. (Fowler et al.,
2014a,b) reported for the first time the potential of Raman spectroscopy to
predict the SF of fresh intact lamb, while also comparing the prediction
using Raman spectroscopy against commonly used indicators of SF includ-
ing particle size, sarcomere length, pH measured at 24 h PM (pH24), and pHu.
Given the promising correlations of the initial research predicting SF using
a Raman handheld device (Schmidt et al., 2013), these studies moved toward
developing Raman spectroscopy as a predictor of SF which could be used in
industrial applications.
For the first time, these studies measured unrelated carcasses, collecting
cuts from 80 carcasses selected from the same abattoir from different con-
signments over a four-day period to represent the animals typically pro-
cessed in order to obtain a spread in SF values which would be expected
by commercial processors. Furthermore, the Raman spectroscopy measure-
ments were conducted on each intact sample at 24 h and five days PM in 12
positions parallel to the muscle fibers of the cuts after they were removed
from the carcass using an integration time of 3.75 (topside) and 3 s (loin).
Therefore, the area sampled and the measurement times of each muscle were
shorter and more feasible for measurement in industrial applications com-
pared to previous Raman spectroscopic research in lamb where the 3 cm
thick samples were cut into quarters and the freshly cut surfaces of three
of the quarters were measured in five different positions using integration
times of 5 and 4 s for the two sample groups (Schmidt et al., 2013).
Despite the initial research suggesting there was an excellent correlation
between SF of lamb and the Raman spectra, these subsequent studies (Fowler
et al., 2014a,b) indicated otherwise, as the most fruitful model yielded a cross-
validated coefficient of determination between the predicted and observed
2
values ( Rcv ) equal to 0.22 (Fowler et al., 2014a). This model was obtained for
the prediction of SF values measured on the SM at five days PM using Raman
spectra collected at one-day PM. Although these studies yielded lower accu-
98 Advanced Technologies for Meat Processing, Second Edition

racies for the prediction of SF values using Raman spectra, Fowler et al.
(2014a) did demonstrate that compared to the laboratory- based indicators
of SF, Raman spectroscopy had greater potential to predict SF values as the
predictions using Raman spectra yielded lower prediction errors compared
to using the indicators alone.
Comparing these Raman spectroscopic studies focused on predicting
SF values highlights that there are numerous experimental design factors
which vary between studies, including the spectral acquisition parameters,
muscle and face measured, sample handling, number of independent sam-
ples, positioning of the sample under the laser, and the Raman spectroscopic
device and wavelengths used for measurement as well as the methods of
chemometric analysis. For example, multiple studies have been conducted
all aimed to predict the SF values of meat determined by a Warner–Bratzler
SF texture analyzer using Raman spectra (Beattie et al., 2008; Schmidt et al.,
2013; Fowler et al., 2014a,b). Yet models from these studies have yielded a
range of results from no correlation ( Rcv2
= 0.00) (Fowler et al., 2014b) to strong
correlations (R = 0.86) (Schmidt et al., 2013) between predicted and observed
2

values. However, as the experimental design varies between the cited stud-
ies, it is difficult to determine the reasons for the variation. Consequently, as
the experimental design of studies have been altered to move toward devel-
opment of Raman spectroscopy as a tool for processors to predict SF values,
the impact of changes to the design of the experiments on the quality of spec-
tral information and the robustness of the prediction is currently unknown.
As sample handling has varied greatly between earlier studies, Fowler
et al. (2014a) hypothesized that freezing the meat may have improved the
prediction of SF values found by Schmidt et al. (2013) as Raman spectros-
copy is sensitive to the effects of freezing and thawing (Li-Chan et al., 1994).
Subsequently, further research was conducted to test this hypothesis and
determine the effects of freezing and thawing on the prediction of SF of
intact lamb (Fowler et al., 2015b). However, this research also aimed to test
whether Raman spectroscopy could predict several other meat quality traits
given that other research in pork has demonstrated the ability to predict pHu
(R2 = 0.85) (Scheier et al., 2014a) and WHC (r = 0.98) (Pedersen et al., 2003) yet
studies conducted on lamb had focused solely on the prediction of SF values.
The two complementary studies conducted by Fowler et al. (2015b) used
similar experimental designs to previous research on fresh intact lamb
(Fowler et al., 2014a); however, in these studies carcasses were subjected to
electrical stimulation, Raman spectra were collected at 25-min PM and the
80 SM collected over two consecutive days for experiment two were frozen
after the five-day PM measurements, held frozen for 24 h, and thawed prior
to measurement. Furthermore, the data analysis for both of these studies also
included models to determine the potential to predict other meat quality
traits of lamb including sarcomere length, particle size, color (L*, a*, b* values),
collagen content, purge loss, and pH values at 24 h PM (pH24) as well as pHu.
Raman Spectroscopy for Predicting Meat Quality Traits 99

The results of these experiments indicated that there was no ability to pre-
dict SF values using spectra collected at 24 h, five days PM, or after freezing
and thawing (Fowler et al., 2015b). Given the inconsistent results from experi-
ments over multiple years (Schmidt et al., 2013; Fowler et al., 2014a,b, 2015b), it
is likely that the measurement of intact lamb using the Raman spectroscopic
handheld device is unable to provide a repeatable prediction of SF values as
currently tested. Yet, the findings of Fowler et al. (2015b) indicated that there
is a potential to predict pH24 and pHu using Raman spectra measured at
24 h (Rcv2
= 0.59 and Rcv
2
= 0.48, respectively) as well as purge ( Rcv
2
= 0.42) and
L* values measured at both 24 h PM ( Rcv = 0.32) and five days PM ( Rcv
2 2
= 0.33).
Given that relationships between pH and purge were found and it has been
well established that pH, purge, and color are interrelated (Hughes et al., 2014),
it is plausible that the predictions of these meat quality traits using Raman
spectroscopy are related to the biochemical changes which occur during the
conversion of muscle to meat during the early PM period. Although there is
a scarcity in literature which has reported on the prediction of lamb meat
quality characteristics, spectral assignments to determine the biochemical
characteristics that underlie the predictions for pH, purge, and color based
on a comparison with existing literature on the determination of meat qual-
ity traits in pork (Scheier and Schmidt, 2013; Scheier et al., 2014b) agrees with
this hypothesis. Although it was acknowledged that there are limitations
in the transference of findings between the measurement of pH early PM
in pork and the measurement of pHu at 24 h in lamb, some of the spectral
changes were identified as metabolites involved in anaerobic glycolysis. These
included spectral changes associated with inorganic phosphate (875, 970, and
1080 cm–1), adenosine (1334 cm–1), α-helical proteins (937 cm–1), and the amino

1750

1500
Intensity (counts/second)

1250

1000

750

500

250

0
500 650 800 950 1100 1250 1400 1550 1700 1850
Wave number (cm–1)

FIGURE 3.7
The averaged background corrected Raman spectra collected 24 h postmortem (PM) from the
ovine m. semimembranosus with the five highest and five lowest pH values, highlighting the
spectral changes associated with pH value.
100 Advanced Technologies for Meat Processing, Second Edition

acid side chains (563–720 cm–1) (Figure 3.7). Overall, it was concluded that
the spectral changes noted suggested that lamb with lower pHu values may
have undergone a more accelerated pH decline PM which could have been
driven by glycogen concentrations at slaughter (Ferguson et al., 2008). How-
ever, the exact biochemical pathways which resulted in the spectral differ-
ences remained unclear due to the complexity of the spectra collected and a
lack of reference spectra for comparison (Fowler et al., 2015b). Furthermore, it
is yet to be determined whether these findings are repeatable over time and
for independent data sets and subsequent research will need to address this.
As Raman spectroscopy has been used to classify adipose tissue by species
(Beattie et al., 2007), and predict the FA composition of pork subcutaneous adi-
pose tissue (Olsen et al., 2007, 2010; Lyndgaard et al., 2011) and intact salmon
(Afseth et al., 2006), further research conducted by Fowler et al. (2015a) has also
investigated its potential as a tool to predict the fat content and FA group com-
position of lamb loin including PUFA, MUFA, and saturated fatty acids (SFA).
Despite finding strong correlations between the observed and predicted values
for the prediction of PUFA (R2 = 0.93) and MUFA (R2 = 0.54), this study found
that the models became less accurate when cross-validation procedures were
used as the cross-validated correlations between the predicted and observed
values dropped to Rcv 2
= 0.21 and Rcv
2
= 0.16 for PUFA and MUFA, respectively.
Being the first study to focus on the prediction of major FA group compo-
sition of intact meat, several challenges were identified with the approach
undertaken to measure FA composition in intact meat which could be con-
tributing to the reduction in the predictions when the models were cross
validated. Fowler et al. (2015a) hypothesized that the discrimination between
spectra containing lipid and protein signals and overlapping spectral signals
from contributions of the phospholipid head groups present in intact muscle
may be causing the models to under- or overestimate the major FA group
concentrations when the models are cross validated. The optimal thresholds
for discriminating between spectra containing mixed lipid and protein sig-
nals and the impact of contributions of phospholipid signals in spectra for
meat with varying intramuscular fat content on the prediction models is cur-
rently unknown. Therefore, the current models do not have general applica-
bility; however, the value of measuring FA group composition due to human
health targets warrants further investigation.

3.4.3 Beef
To date, there has been very little research conducted on the potential of
Raman spectroscopy to predict meat quality traits of beef, although a prelim-
inary investigation on the application of Raman spectroscopy to predict sen-
sory quality traits (Beattie et al., 2004a) and tenderness (Bauer et al., 2016) of
beef have been completed. The study by Beattie et al. (2004a) was an explor-
atory study to determine if Raman spectroscopy could predict meat quality
given that other technology-based methods including elastograms, fluores-
Raman Spectroscopy for Predicting Meat Quality Traits 101

cence emission spectroscopy, or NIR spectroscopy had not been adopted

by industry for widespread use and high-performance push-button Raman
spectroscopy equipment was becoming available at a reasonable cost. To this
end, 52 samples of beef silverside were collected, cooked, and subsampled
for Raman spectroscopic measurement on a rotating stage using a benchtop
Raman device equipped with a 785 nm excitation laser, for determination
of SF and sensory analysis. Despite achieving good correlation coefficients
using Raman spectra to measure SF (R2 = 0.75) and sensory traits including
texture (R2 = 0.71), juiciness (R2 = 0.62), as well as overall liking (R2 = 0.67), the
application of these results to industry is limited as the samples were cooked
prior to measurement and a benchtop Raman device was used which still
requires a biopsy of the sample to be taken for measurement. Nonetheless,
this experiment does highlight the potential for Raman spectroscopy to be
applied to predict a broader range of eating quality traits.
A longer term study to determine the potential for Raman spectroscopy
to predict the tenderness of beef m. gluteus medius (Bauer et al., 2016) demon-
strated that there was an ability to predict beef tenderness with good accu-
2
racy ( Rcal = 0.94) with the initial modeling. However, when this model was
further validated on independent samples, this accuracy is reduced ( Rval 2
=
0.23) suggesting the initial model was overfitted or the biological variance
of the samples included in the calibration model did not represent the sam-
ples collected in the validation model. Yet, the correlation between Raman
spectra and tenderness was improved when a model was created using the
validation data to create a new model ( Rcv 2
= 0.65). Further analysis for this
data showed that reducing the number of spectral channels included and
limiting the latent variables in the analysis resulted in more robust models
but reduced the precision of the predictions ( Rcv 2
= 0.33) (Bauer et al., 2016)
highlighting the need to determine the optimal processing and analysis
techniques to obtain repeatable predictions of meat quality parameters to
determine whether there is a potential for industry to apply this research.
Bauer et al. (2016) also suggested an alternative approach to predicting SF
values as they demonstrated that Raman spectroscopy has potential to dis-
criminate between tough and tender samples based on a given threshold,
thereby eliminating the need for an exact prediction of the SF values. Thresh-
olds of 30, 34, 40, 43, and 49 N were trialled as consumer studies in the United
States have demonstrated SF values below these values met the 100%, 99%,
94%, 86%, and 25% consumer satisfaction scores for tenderness. Using partial
least squares discriminate analysis (PLS-DA), Bauer et al. (2016) concluded that
it was possible to classify samples with accuracies of between 59% and 80%.
However, the precision increased with the threshold suggesting that Raman
spectroscopy can be used as a screening tool to accurately identify tough beef.
While this study overcomes some of the limitations of earlier meat science
research using Raman spectroscopy by using a handheld Raman device
and measuring SF on the same areas of muscle which were scanned using
102 Advanced Technologies for Meat Processing, Second Edition

the Raman device, more work is required to determine whether the accu-
racy and precision of predictive models are achievable using measurement
protocols which more closely reflect commercial operations. Consequently,
research is needed to determine whether an early PM Raman measurement
in a commercial situation is able to predict the tenderness of the product
when it reaches the consumer after aging and transport.
Tentative band assignment of the spectra collected from tough and ten-
der beef indicates that while there are clear signals associated with α -helical
proteins (1650, 1447, 1312, 935, and 906 cm–1), amino acid side chains such as
tryptophan (1550, 1353, 1336, 1009, and 759 cm–1), and connective tissue (1665,
1453, 1270, 1248, and 855 cm–1), overall intensity of the spectra were the main
difference between tough and tender samples (Bauer et al., 2016; Figure 3.8).
This disagrees with the research conducted in lamb, which found that spec-
tra from tender samples had a higher overall intensity (Fowler et al., 2014a);
however, reasons for these differences have not been well defined.

3.4.4 Spoilage
Meat is a very perishable food whose shelf life is dependent on the microbial
flora, the packaging, and the storage conditions (Borch et al., 1996; Saucier,
2016). Food safety regulations require routine control of microbial status,
but as the traditional microbiological methods are time-consuming and
expensive, rapid methods are sought for more efficient monitoring (Ellis
16 6
Difference intensity (counts/mWs)
Raman intensity (counts/mWs)

12 2

8 –2

4 –6

0 –10
1700 1500 1300 1100 900 700 500
Wave number (cm–1)

FIGURE 3.8
Averaged and preprocessed Raman spectra of the 10 most tender (black line) and the 10 tough-
est (gray line) bovine gluteus medius samples with shear force values <29 N and >48 N, respec-
tively. The upper curve (thin line) represents the difference spectrum “tough minus tender.”
Selected signals of α -helical proteins (star), myoglobin (circle), tryptophan (diamond), tyrosine
doublet (gray triangle), and connective tissue (triangle) are highlighted. (From Bauer et al.,
Meat Science, 115, 27–33, 2016.)
Raman Spectroscopy for Predicting Meat Quality Traits 103

and Goodacre, 2001). Spectroscopic methods are among those being trialled
as they are rapid, noninvasive, and nondestructive (Damez and Clerjon,
2008). The first detection of spoilage of pork using Raman spectroscopy was
reported with a 785 nm laboratory set up (Schmidt et al., 2008). In this work,
principal components analysis (PCA) was applied for a qualitative discrimi-
nation between samples at a threshold of 106 colony forming units (cfu)/cm2
total viable mesophilic aerobic plate counts. This discrimination of spoiled
pork was confirmed with a handheld Raman sensor head operating at 671 nm
which was developed for the characterization of meat quality (Schmidt et al.,
2009). Subsequent research revealed that this detection was largely based
on a laser-induced fluorescence which started beyond the threshold of
106 cfu/cm2 (Sowoidnich et al., 2010) and that this detection could be per-
formed through packaging (Schmidt et al., 2009). In these studies, however,
the growth of the spoilage flora was intrinsically tied to the storage time. To
separate both effects, the storage experiment was repeated by comparing the
Raman spectra of pork chops (LTL) which were sterilized and which did not
spoil over a period of 14 days and untreated pork chops (SM and LTL), which
perished over a period of 21 days (Sowoidnich et al., 2012). In this instance,
the PCA revealed that spoilage was detected by means of the first princi-
pal component as observed before and that the aging of the sterilized meat
was monitored by the second principal component. Raman signals indicat-
ing storage, time, and aging were observed at 1650 cm–1 (amide I), 1446 and
1340 cm–1 (C–H deformation), and 902 and 935 cm–1 (C–C stretching α -helix),
respectively (Sowoidnich, 2012; Sowoidnich et al., 2012).
Raman measurements using the polarization dependency of the spectra
during a storage experiment with sterilized and untreated meat revealed
that Raman spectra are anisotropic (with the muscle fiber direction). Dur-
ing storage changes in signals attributed to α -helical proteins indicated a
loss of anisotropy as the surface spoiled; however, this did not occur with
the sterilized samples. Hence, it was concluded that the bacteria on the sur-
face obscure to some extent the spectra of the underlying meat (Al Ebrahim
et al., 2013b). Quantification of the microbial surface contamination of pork
has also been successfully completed using a portable Raman device, which
resulted in a model with a reported prediction error of RMSEV = 1.6 log
total viable counts (TVC)/cm2 (Grimmler and Schmidt, 2015). Overall, this
research demonstrates that Raman spectroscopy can be used below the criti-
cal threshold of 5 log TVC/cm2 (Grimmler and Schmidt, 2015).

3.4.5 Differentiation of Animal Species and Detection of

Adulteration in Muscle Foods
Given the species differences evident in Raman spectra, it is unsurprising
that Raman spectroscopy has been used to distinguish between different
species such as pork, chicken, turkey, mutton, goat, beef, and horse (Ellis
et al., 2005; Sowoidnich, 2012; Sowoidnich and Kronfeldt, 2012; Boyaci et al.,
104 Advanced Technologies for Meat Processing, Second Edition

2014a,b). This is achieved as the Raman spectra reflect differences in the

protein and lipid composition, although heme signals from myoglobin can
also be used as a marker for distinguishing between red and white muscles
(Sowoidnich and Kronfeldt, 2012). Differences in muscle structure and minor
components will also contribute to the classification of species using Raman
spectroscopy, but current knowledge about the spectra and the identification
of marker substances is inconsistent and incomplete.
Increasing attention is being paid to the detection of fraudulent addition
of undesired meat, especially to minced meat products. Consequently, the
addition of pork to minced lamb products has been investigated using a
Raman microscope (Hassing et al., 2012; Hassing and Jernshøj, 2014). This
work demonstrated classification of fat and meat from minced pork and
lamb was possible, although it was stated that for a practical implemen-
tation, the 785 nm system which was used will require improvements in
order to automatically detect areas of fat, to focus the laser, and to measure
Raman spectra.
After the large-scale adulteration of beef mince by the addition of minced
horse meat in Europe during 2013, the discrimination of horse meat and beef
was investigated with Raman spectroscopy. Principal components analysis
was shown to successfully discriminate Raman spectra of beef and horse
which were measured with 671 nm excitation (Al Ebrahim et al., 2013a).
FT-Raman measurements using 1064 nm excitation with ground beef mix-
tures with 0%, 25%, 50%, 75%, and 100% admixture of horse meat indicated
a correlation with selected signals (937, 879, 856, and 829 cm–1) which were
normalized to the phenylalanine signal at 1003 cm–1 with the percentage of
added horse meat (Zając et al., 2014). Similarly, the detection of horse meat in
beef was also reported based on the 785 nm Raman spectra of the extracted
fat using PCA (Boyaci et al., 2014b).
Dispersive Raman spectroscopy was used to detect beef offal adulterations
(kidney, liver, heart, and lung) in beef burgers (Zhao et al., 2015). PLS-DA
classifications with >89% correctly classified samples were reported and the
authors stated a prediction accuracy acceptable for screening purposes when
assessing total offal and added fat in the samples (Zhao et al., 2015).

3.5 Limitations
From the literature it is clear that Raman spectroscopy has the potential to
be an online tool to predict meat quality traits of intact muscle in a nonde-
structive and rapid way. However, gaps in the understanding of existing lit-
erature including the reasons for inconsistencies between results of current
studies predicting meat quality traits, the biochemical characteristics of the
meat which underlie predictions, and the optimal muscle and measurement
Raman Spectroscopy for Predicting Meat Quality Traits 105

parameters for each species will need to be addressed before Raman spectro-
scopic technologies can be widely adopted within industry.
Lack of understanding of the causes of variation in predictability between
studies is an ongoing challenge for adoption of Raman spectroscopy in
industry as it is sensitive to variation in measurement parameters (Beattie
et al., 2004a) yet there is little consistency in existing literature. For example,
the research by Fowler et al. (2014a) was conducted by collecting 10 Raman
spectra measured perpendicular to the muscle fiber over the largest face
of the SM, where the m. adductor was removed, from 80 randomly selected
lambs. However, Schmidt et al. (2013) measured 3 cm blocks of loin from 140
lambs that had been quartered before five different positions were measured
on the freshly cut surfaces with integration times of 5 and 4 s for the two
sample groups. Thus, Schmidt et al. (2013) collected 15 spectra per sample
over a much smaller portion of muscle. Furthermore, other Raman spectro-
scopic studies predicting meat quality traits of pork (Beattie et al., 2008) and
beef (Beattie et al., 2004a) have measured different faces of other muscles
using integration times of six and three minutes which produced relatively
2
high Rcv values of 0.75 and 0.77 (Beattie et al., 2004a, 2008). Consequently, the
most appropriate measurement parameters, muscle, and face of the muscle
for measurement for pork, beef, and lamb are yet to be determined.
The number of positions and locations measured on each independent
sample needed to develop robust calibration models is also required as it
determines the way in which the scattered light can be detected and the che-
mometric data can be analyzed. Despite the widespread use of PCA as a tool
for spectral data analysis, when PCA is used in the analysis of data from a
small number of samples the average spectra representing each sample may
underrepresent subtle differences between spectral regions of the samples
(Bonnier and Byrne, 2012). This occurs because PCA clusters data based on
spectral similarity and variance. Consequently, it is expected that Raman
spectra obtained from numerous subsections removed from a small number
of independent samples would substantially impact the variance and load-
ings that differentiate groups in further data analysis. This is because the
strength of this analysis technique is in the loadings, given that they repre-
sent the spectral origin of the variations (Bonnier and Byrne, 2012). As such,
data sets with few truly independent samples, for example, Beattie et al.
(2004a), who measured 168 pork m. longissimus lumborum (LL) sections from
only 18 pigs, are at risk of artificially biasing the results from chemomet-
ric analysis and consequently underrepresenting subtle differences within
more complex data sets. Consequently, the models generated from data sets
with small numbers of independent samples or from more positions mea-
sured on fewer samples may then have a better accuracy of prediction than
if the true spectral differences were represented.
Despite the strong advantages in using Raman within food systems, the
presence of fluorescence is also a continuing challenge when measuring bio-
logical samples, particularly meat. Fluorescence occurs when light absorbed
106 Advanced Technologies for Meat Processing, Second Edition

and emitted at a longer wavelength and therefore at lower energy (Austin

et al., 1993). As the level of light scattered by the Raman process is gener-
ally weak in comparison to other optical processes, the vibrational spectrum
can be completely obscured by other contributions including broad feature-
less fluorescence emission (Hudson and Mayne, 1986). Although the use of
highly effective filters and measuring at a wavelength >800 nm can, to some
extent, overcome these challenges (Hudson and Mayne, 1986), current Raman
spectroscopic research on meat quality has focused on using shorter wave-
lengths (785 and 671 nm) to facilitate shorter measurement times (Schmidt
et al., 2013). Although 785 nm excitation is considerably less impaired by fluo-
rescence, measurements are slower compared to 671 nm excitation and vice
versa. Consequently, losses of Raman spectral information due to fluores-
cence continues to be an ongoing challenge for the prediction of meat quality
traits using Raman spectroscopy in red meat where higher levels of iron and
heme are likely to generate higher amounts of fluorescence when meat is
excited with a 671 nm laser.
Like fluorescence, the presence of non-Raman background signals can com-
pletely obscure the Raman vibration modes (Beattie, 2011). Any photons that
aren’t generated by the sample at the frequency of interest are considered back-
ground noise (McCreery, 2005). Background noise may arise from a range of
optical phenomena (Beattie, 2011) including optic equipment, stray light from
Rayleigh scattering, and reflections from optics or dust (McCreery, 2005). How-
ever, it also may arise from the samples due to differences in the myofibrils
associated with background and age. After completing the chemometric analy-
sis jointly and separately for the samples reared at two sites, Schmidt et al. (2013)
noted that coefficients of determination for prediction models were increased
when two models were created based on site of origin due to the differences
in background noise and fluorescence in the spectra. Therefore, the impact of
differences in background noise and fluorescence generated from samples ran-
domly collected to generate calibration models needs to be determined.

3.6 Conclusion
Although there has been relatively limited research into the use of Raman
spectroscopy for meat quality and eating quality assessment, the studies
which have been completed demonstrate that there is potential to develop
Raman spectroscopy into a carcass assessment tool which can be used in
commercial situations. Predictions of meat quality traits including pHu,
purge, SF, cooking loss, FA composition, and sensory traits including tender-
ness, juiciness, and flavor have been successfully completed in a number of
species including pork, beef, and lamb. Furthermore, additional research has
been able to determine microbiological loads and differentiate between spe-
cies to identify muscle food adulteration.
Raman Spectroscopy for Predicting Meat Quality Traits 107

Before Raman spectroscopy can be adopted for widespread industry use,

further research is required to determine the optimal measurement and
analysis parameters methods, the factors which are contributing to differ-
ences between predictive models of species and traits and further identify
the biochemical and biophysical characteristics of meat which are contribut-
ing to these predictions. However, as technological advancements continue,
Raman spectroscopy equipment will continue to become more robust, pro-
viding repeatable measurements, and limitations associated with high fluo-
rescence will be overcome making Raman spectroscopy as an ideal tool for
carcass quality assessment.

References
Abbas, O., Fernández Pierna, J. A., Codony, R., Von Holst, C. and Baeten, V. (2009).
Assessment of the discrimination of animal fat by FT-Raman spectroscopy. Jour-
nal of Molecular Structure, 924–962, 294–300.
Adzitey, F. and Nurul, H. (2011). Pale soft exudative (PSE) and dark firm dry (DFD)
meats: Causes and measures to reduce these incidences—A mini review. Inter-
national Food Research, 18, 11–20.
Afseth, N. K., Wold, J. P. and Segtnan, V. (2006). The potential of Raman spectroscopy
for characterisation of the fatty acid unsaturation of salmon. Analytica Chimica
Acta, 572, 85–92.
Al Ebrahim, H., Sowoidnich, K. and Kronfeldt., H.-D. (2013a). Raman spectroscopic
differentiation of beef and horse meat using a 671 nm microsystem diode laser.
Applied Physics B, 113, 159–163.
Al Ebrahim, H., Sowoidnich, K., Schmidt, H. and Kronfeldt, H.-D. (2013b). Polar-
ization dependence of the Raman scattering of oriented porcine muscle fibers
affected by storage time and spoilage. Focusing on Modern Food Industry, 2, 1–9.
Austin, J. C., Jordan, T. and Spiro, T. G. (1993). Ultra violet reasonance Raman stud-
ies of proteins and related molecules. In: Clark, R. J. H. and Hester, R. E. (eds.)
Biomolecular Spectroscopy-Part A. West Sussex: John Wiley and Sons.
Bauer, A., Scheier, R., Eberle, T. and Schmidt, H. (2016). Assessment of tenderness of
aged bovine gluteus medius muscles using Raman spectroscopy. Meat Science,
115, 27–33.
Beattie, J. R. (2011). Optimising reproducibility in low quality signals without smooth-
ing: An alternative paradigm for signal processing. Journal of Raman Spectros-
copy, 42, 1419–1427.
Beattie, J. R., Bell, S. E. J., Borgaard, C., Fearon, A. M. and Moss, B. W. (2006). Predic-
tion of adipose tissue composition using Raman spectroscopy: Average proper-
ties and individual fatty acids. Lipids, 41, 287–294.
Beattie, J. R., Bell, S. E. J., Borggaard, C., Fearon, A. M. and Moss, B. W. (2007). Classi-
fication of adipose tissue species using Raman spectroscopy. Lipids, 42, 679–685.
Beattie, J. R., Bell, S. E. J., Borggaard, C. and Moss, B. W. (2008). Preliminary investi-
gations on the effects of ageing and cooking on the Raman spectra of porcine
longissimus dorsi. Meat Science, 80, 1205–1211.
108 Advanced Technologies for Meat Processing, Second Edition

Beattie, J. R., Bell, S. E. J., Farmer, L. J., Moss, B. W. and Patterson, D. (2004a). Prelimi-
nary investigation of the application of Raman spectroscopy to the prediction of
the sensory quality of beef silverside. Meat Science, 66, 903–913.
Beattie, J. R., Bell, S. E. J. and Moss, B. W. (2004b). A critical evaluation of Raman spec-
troscopy for the analysis of lipids: Fatty acid methyl esters. Lipids, 39, 407–419.
Berhe, D. T., Engelsen, S. B., Hviid, M. S. and Lametsch, R. (2014). Raman spectro-
scopic study of effect of the cooking temperature and time on meat proteins.
Food Research International, 66, 123–131.
Berhe, D. T., Eskildsen, C. E., Lametsch, R., Hviid, M. S., Van Den Berg, F. and Engelsen,
S. B. (2016). Prediction of total fatty acid parameters and individual fatty acids
in pork backfat using Raman spectroscopy and chemometrics: Understanding
the cage of covariance between highly correlated fat parameters. Meat Science,
111, 18–26.
Berhe, D. T., Lawaetz, A. J., Engelsen, S. B., Hviid, M. S. and Lametsch, R. (2015).
Accurate determination of endpoint temperature of cooked meat after storage
by Raman spectroscopy and chemometrics. Food Control, 52, 119–125.
Bonnier, F. and Byrne, H. J. (2012). Understanding the molecular information con-
tained in principal component analysis of vibrational spectra of biological sys-
tems. Analyst, 137, 322–332.
Borch, E., Kant-Muermans, M. and Blixt, Y. (1996). Specific spoilage organisms bac-
terial spoilage of meat and cured meat products. International Journal of Food
Microbiology, 33, 103–120.
Boyaci, I. H., Temiz, H. T., Uysal, R. S., Velioglu, H. M., Yadegari, R. J. and Rishkan,
M. M. (2014a). A novel method for discrimination of beef and horsemeat using
Raman spectroscopy. Food Chemistry, 148, 37–41.
Boyaci, İ. H., Uysal, R. S., Temiz, T. et al. (2014b). A rapid method for determination
of the origin of meat and meat products based on the extracted fat spectra by
using of Raman spectroscopy and chemometric method. European Food Research
and Technology, 238, 845–852.
Breitman, M., Ruiz-Moreno, S. and Gil, A. L. (2007). Experimental problems in Raman
spectroscopy applied to pigment identification in mixtures. Spectrochimica Acta
Part A: Molecular and Biomolecular Spectroscopy, 68, 1114–1119.
Brøndum, J., Byrne, D. V., Bak, L. S., Bertelsen, G. and Engelsen, S. B. (2000a). Warmed-
over flavour in porcine meat—A combined spectroscopic, sensory and chemo-
metric study. Meat Science, 54, 83–95.
Brøndum, J., Munck, L., Henckel, P., Karlsson, A., Tornberg, E. and Engelsen, S. B.
(2000b). Prediction of water-holding capacity and composition of porcine meat
by comparative spectroscopy. Meat Science, 55, 177–185.
Carew, E. B., Asher, I. M. and Stanley, H. E. (1975). Laser raman spectroscopy—New
probe of myosin substructure. Science, 188, 933–936.
Carey, P. R. (1982). Biochemical Applications of Raman and Reasonance Raman Spectrosco-
pies. New York, NY: Academic Press.
Chen, H. and Han, M. (2011). Raman spectroscopic study of the effects of microbial
transglutaminase on heat-induced gelation of pork myofibrillar proteins and its
relationship with textural characteristics. Food Research International, 44, 1514–1520.
Da Silva, E., Bresson, S. and Rousseau, D. (2009). Characterization of the three major
polymorphic forms and liquid state of tristearin by Raman spectroscopy. Chem-
istry and Physics of Lipids, 157, 113–119.
Raman Spectroscopy for Predicting Meat Quality Traits 109

Damez, J.-L. and Clerjon, S. (2008). Meat quality assessment using biophysical meth-
ods related to meat structure. Meat Science, 80, 132–149.
Das, R. S. and Agrawal, Y. K. (2011). Raman spectroscopy: Recent advancements,
techniques and applications. Vibrational Spectroscopy, 57, 163–176.
Ellis, D. I., Broadhurst, D., Clarke, S. J. and Goodacre, R. (2005). Rapid identification of
closely related muscle foods by vibrational spectroscopy and machine learning.
Analyst, 130, 1648–1654.
Ellis, D. I. and Goodacre, R. (2001). Rapid and quantitative detection of the microbial
spoilage of muscle foods: Current status and future trends. Trends in Food Sci-
ence and Technology, 12, 414–424.EU. (2010). European Declaration on alternatives
to surgical castration of pigs. Available at: https://ec.europa.eu/food/animals/
welfare/practice/farm/pigs/castration_alternatives_en
England, E. M., Scheffler, T. L., Kasten, S. C., Matarneh, S. K. and Gerrard, D. E. (2013).
Exploring the unknowns involved in the transformation of muscle to meat.
Meat Science, 95, 837–843.
Food and Agriculture Organization of the United Nations (FAO). (2014). Sources
of meat. Available at http://www.fao.org/ag/againfo/themes/en/meat/
backgr_sources.html (accessed 8 June 2016).
Ferguson, D. M., Daly, B. L., Gardner, G. E. and Tume, R. K. (2008). Effect of glyco-
gen concentration and form on the response to electrical stimulation and rate of
post-mortem glycolysis in ovine muscle. Meat Science, 78, 202–210.
Fowler, S. M., Ponnampalam, E. N., Schmidt, H., Wynn, P. and Hopkins, D. L.
(2015a). Prediction of intramuscular fat content and major fatty acid groups
of lamb M. longissimus lumborum using Raman spectroscopy. Meat Science,
110, 70–75.
Fowler, S. M., Schmidt, H., Van De Ven, R., Wynn, P. and Hopkins, D. L. (2014a). Pre-
dicting tenderness of fresh ovine semimembranosus using Raman spectroscopy.
Meat Science, 97, 597–601.
Fowler, S. M., Schmidt, H., Van De Ven, R., Wynn, P. and Hopkins, D. L. (2014b).
Raman spectroscopy compared against traditional predictors of shear force in
lamb m. longissimus lumborum. Meat Science, 98, 652–656.
Fowler, S. M., Schmidt, H., Van De Ven, R., Wynn, P. and Hopkins, D. L. (2015b).
Predicting meat quality traits of ovine m. semimembranosus, both fresh and
following freezing and thawing, using a hand held Raman spectroscopic device.
Meat Science, 108, 138–144.
Frushour, B. G. and Koenig, J. L. (1975). Raman spectroscopy of proteins. In: Clark,
R. J. H. and Hester, R. E. (eds.) Advances in Infrared and Raman Spectroscopy. Lon-
don: Wiley & Sons.
Grimmler, C. and Schmidt, H. (2015). Quantifying bacteria on pork using a portable
Raman scanner. 61st International Congress of Meat Science and Technology
(ICoMST). Clermont-Ferrand, France.
Hassing, S. and Jernshøj, K. D. (2014). Benefits and challenges in applying Raman
spectroscopy as a non-destructive tool in the analysis of food quality. Agro Food
Industry Hi Tech, 25, 63–69.
Hassing, S., Jernshøj, K. D. and Christensen, L. S. (2012). Raman spectroscopy: A non-
destructive and on-site tool for control of food quality? InTech.
Honikel, K. O. and Fischer, C. (1977). A rapid method for the dectection of PSE and
DFD porcine muscles. Journal of Food Science, 42, 1633–1636.
110 Advanced Technologies for Meat Processing, Second Edition

Hudson, B. and Mayne, L. (1986). Ultraviolet resonance Raman spectroscopy of bio-

polymers. In: Hirs, C. H. W. (ed.) Methods in Enzymology. New York, NY: Aca-
demic Press.
Hughes, J. M., Oiseth, S. K., Purslow, P. P. and Warner, R. D. (2014). A structural
approach to understanding the interactions between colour, water-holding
capacity and tenderness. Meat Science, 98, 520–532.
Krimm, S. (1987). Peptides and proteins. In: Spiro, T. G. (ed.) Biological Applications
Raman Spectroscopy. New York, NY: John Wiley and Sons.
Krimm, S. and Bandekar, J. (1986). Vibrational spectroscopy and conformation of pep-
tides, polypeptides, and proteins. In: Anfinsen, C. B., Edsall, J. T. and Richards,
F. M. (eds.) Advances in Protein Chemistry. New York, NY: Academic Press.
Lee, P. C. and Meisel, D. (1982). Adsorption and surface-enhanced Raman of dyes on
silver and gold sols. Journal of Physical Chemistry, 86, 3391–3395.
Li-Chan, E. C. Y. (1996). The applications of Raman spectroscopy in food science.
Trends in Food Science and Technology, 7, 361–370.
Li-Chan, E. C. Y., Nakai, S. and Hirotsuka, M. (1994). Raman spectroscopy as a probe of
protein structure in food systems. In: Yada, R. Y., Jackman, R. L. and Smith, J. L.
(eds.) Protein Structure-Function Relationships in Food. Glasgow: Blackie Aca-
demic and Professional.
Liu, X., Schmidt, H. and Mörlein, D. (2016). Feasibility of boar taint classification
using a portable Raman device. Meat Science, 116, 133–139.
Lyndgaard, L. B., Sorensen, K. M., Van Den Berg, F. and Engelsen, S. B. (2011). Depth
profiling of porcine adipose tissue by Raman spectroscopy. Journal of Raman
Spectroscopy, 43, 482–489.
Lyndgaard, L. B., Sorensen, K. M., Van Den Berg, F. and Engelsen, S. B. (2012). Depth
profiling of porcine adipose tissue by Raman spectroscopy. Journal of Raman
Spectroscopy, 43, 482–489.
McCreery, R. L. (2000). Raman spectroscopy for chemical analysis. In: Winefordner,
J. D. (ed.) A Series of Monographs of Analytical Chemistry and It’s Applications. New
York, NY: Wiley-Interscience John Wiley & Sons.
McCreery, R. L. (2005). Raman Spectroscopy for Chemical Analysis. 1st ed. Hoboken, NJ:
Wiley-Interscience.
Motoyama, M., Ando, M., Sasaki, K. and Hamaguchi, H.-O. (2010). Differentiation
of animal fats from different origins: Use of polymorphic features detected by
Raman spectroscopy. Applied Spectroscopy, 64, 1244–1250.
Motoyama, M., Ando, M., Sasaki, K. et al. (2016). Simultaneous imaging of fat crystal-
linity and crystal polymorphic types by Raman microspectroscopy. Food Chem-
istry, 196, 411–417.
Motoyama, M., Chikuni, K., Narita, T., Aikawa, K. and Sasaki, K. (2013). In situ
Raman spectrometric analysis of crystallinity and crystal polymorphism of fat
in porcine adipose tissue. Journal of Agriculture and Food Chemistry, 61, 69–75.
Nache, M., Scheier, R., Schmidt, H. and Hitzmann, B. (2015). Non-invasive lactate-
and pH-monitoring in porcine meat using Raman spectroscopy and chemomet-
rics. Chemometrics and Intelligent Laboratory Systems, 142, 197–205.
Olsen, E. F., Baustad, C., Egelandsdal, B., Rukke, E.-O. and Isaksson, T. (2010). Long-
term stability of a Raman instrument determining iodine value in pork adipose
tissue. Meat Science, 85, 1–6.
Raman Spectroscopy for Predicting Meat Quality Traits 111

Olsen, E. F., Rukke, E.-O., Egelandsdal, B. and Isaksson, T. (2008). Determination of

omega-6 and omega-3 fatty acids in pork adipose tissue with nondestructive
Raman and fourier transform infrared spectroscopy. Applied Spectroscopy, 62,
968–974.
Olsen, E. F., Rukke, E.-O., Flåtten, A. and Isaksson, T. (2007). Quantitative determina-
tion of saturated-, monounsaturated- and polyunsaturated fatty acids in pork
adipose tissue with non-destructive Raman spectroscopy. Meat Science, 76, 628–
634.
Ozaki, Y. (1999). Raman spectroscopy. In: Mossoba, M. M. (ed.) Spectral Methods in
Food Analysis—Instrumentation and Applications. New York, NY: Marcel Dekker.
Pedersen, D. K., Morel, S., Andersen, H. J. and Balling Engelsen, S. (2003). Early pre-
diction of water-holding capacity in meat by multivariate vibrational spectros-
copy. Meat Science, 65, 581–592.
Pezolet, M., Pigeon-Gosselin, M. and Caille, J.-P. (1978). Laser Raman investigation of
intact single muscle fibers: Protein conformations. Biochimica et Biophysica Acta
(BBA)—Protein Structure, 533, 263–269.
Robergs, R. A., Ghiasvand, F. and Parker, D. (2004). Biochemistry of exercise-induced
metabolic acidosis. American Journal of Physiology-Regulatory, Integrative and
Comparative Physiology, 287, R502–R516.
Saucier, L. (2016). Microbial spoilage, quality and safety within the context of meat
sustainability. Meat Science, 120, 78–84.
Scheffler, T. L. and Gerrard, D. E. (2007). Mechanisms controlling pork quality devel-
opment: The biochemistry controlling postmortem energy metabolism. Meat
Science, 77, 7–16.
Scheier, R., Bauer, A. and Schmidt, H. (2014a). Early postmortem prediction of meat
quality traits of porcine semimembranosus muscles using a portable Raman
system. Food and Bioprocess Technology, 7, 2732–2741.
Scheier, R., Köhler, J. and Schmidt, H. (2014b). Identification of the early post mortem
metabolic state of porcine m. semimembranosus using Raman spectroscopy.
Vibrational Spectroscopy, 70, 12–17.
Scheier, R., Scheeder, M. and Schmidt, H. (2015a). Post-rigor assessment of porcine
meat quality applying a portable Raman system. In 61st International Congress
of Meat Science and Technology (ICoMST). Clermont-Ferrand, France.
Scheier, R., Scheeder, M. and Schmidt, H. (2015b). Prediction of pork quality at the
slaughter line using a portable Raman device. Meat Science, 103, 96–103.
Scheier, R. and Schmidt, H. (2013). Measurement of the pH value in pork meat early
postmortem by Raman spectroscopy. Applied Physics B, 111, 289–297.
Schmidt, H., Blum, J., Sowoidnich, K. and Kronfeldt, H. D. (2008). Raman spectro-
scopic examinations of meat ripening: An approach to product-flanking meat
monitoring using non-invasive optical measuring methods. Fleischwirtschaft, 88,
111–113.
Schmidt, H., Scheier, R. and Hopkins, D. L. (2013). Preliminary investigation on the
relationship of Raman spectra of sheep meat with shear force and cooking loss.
Meat Science, 93, 138–143.
Schmidt, H., Scheier, R., Octoviani, A., Agarkov, N. and Petzet, A. (2012). Recent
results of measuring quality traits of pork meat using Raman spectroscopy. Mit-
teilungsblatt der Fleischforschung Kulmbach, 51, 219–225.
112 Advanced Technologies for Meat Processing, Second Edition

Schmidt, H., Sowoidnich, K. and Kronfeldt, H. D. (2010). A prototype hand-held

Raman sensor for the in situ characterization of meat quality. Applied Spectros-
copy, 64, 888–894.
Schmidt, H., Sowoidnich, K., Maiwald, M., Sumpf, B. and Kronfeldt, H. D. (2009).
Hand-held Raman sensor head for in-situ characterization of meat quality
applying a mircosystem 671 nm diode laser. In: Vo-dinh, T., Lieberman, R. A.
and Gauglitz, G. (eds.) Proceedings of the Advanved Environment, Chemical and
Biological Sensing Technology VI. Orlando, FL: International Society for Optics
and Photonics, 1–8.
Sorensen, K. M., Westley, C., Goodacre, R. and Engelsen, S. B. (2015). Simultaneous
quantification of the boar-taint compounds skatole and androstenone by sur-
face-enhanced Raman scattering (SERS) and multivariate data analysis. Analyti-
cal and Bioanalytical Chemistry, 407, 7787–7795.
Sowoidnich, K. (2012). Multispektrale, Diodenlaser-basierte Raman-Untersuchungen
zur In-situ-Analytik ausgewählter Fleischsorten. PhD dissertation, Technische
Universität, Berlin.
Sowoidnich, K. and Kronfeldt, H.-D. (2012). Shifted excitation Raman difference
spectroscopy at multiple wavelengths for in-situ meat species differentiation.
Applied Physics B, 108, 975–982.
Sowoidnich, K., Schmidt, H., Kronfeldt, H.-D. and Schwägele, F. (2012). A portable
671 nm Raman sensor system for rapid meat spoilage identification. Vibrational
Spectroscopy, 62, 70–76.
Sowoidnich, K., Schmidt, H., Maiwald, M., Sumpf, B. and Kronfeldt, H.-D. (2010).
Application of diode-laser Raman spectroscopy for in situ investigation of meat
spoilage. Food and Bioprocess Technology, 3, 878–882.
Thompson, J. M. (2002). Managing meat tenderness. Meat Science, 62, 295–308.
Tornberg, E. (2005). Effects of heat on meat proteins—Implications on structure and
quality of meat products. Meat Science, 70, 493–508.
Wang, Q. 2013. Raman spectroscopic characterization and analysis of agricultural and
biological systems. PhD dissertation, Iowa State University, Ames, Iowa.
Wang, Q., Lonergan, S. M. and Yu, C. (2012). Rapid determination of pork sensory
quality using Raman spectroscopy. Meat Science, 5, 4069–4085.
Xiong, Y. L., Brekke, C. J. and Leung, H. K. (1987). Thermal denaturation of muscle
proteins from different species and muscle types as studied by differential scan-
ning calorimetry. Canadian Institute of Food Science and Technology Journal, 20,
357–362.
Zając, A., Hanuza, J. and Dymińska, L. (2014). Raman spectroscopy in determina-
tion of horse meat content in the mixture with other meats. Food Chemistry, 156,
333–338.
Zhao, M., Downey, G. and O’Donnell, C. P. (2015). Dispersive Raman spectroscopy
and multivariate data analysis to detect offal adulteration of thawed beefburg-
ers. Journal of Agricultural and Food Chemistry, 63, 1433–1441.
4
Real-Time PCR for the Detection of
Pathogens in Meat and Meat Products

Alicia Rodríguez, María J. Andrade, Mar Rodríguez, and Juan J. Córdoba

CONTENTS
4.1 Principles and Characteristics of Real-Time Polymerase Chain
Reaction for Detecting and Quantifying Pathogens in Meat and
Meat Products ............................................................................................. 114
4.1.1 Sample Preparation ....................................................................... 114
4.1.2 Main Considerations for qPCR .................................................... 116
4.1.3 Targets ............................................................................................. 117
4.1.4 Controls of the qPCR ..................................................................... 118
4.1.5 Validation ........................................................................................ 118
4.2 qPCR for Detecting Bacterial Pathogens in Meat and Meat Products .... 119
4.2.1 qPCR for Detecting Bacteria Foodborne Infection ................... 119
4.2.1.1 Salmonella .......................................................................... 119
4.2.1.2 Listeria monocytogenes ...................................................... 122
4.2.1.3 Verotoxigenic E. coli ........................................................124
4.2.1.4 Campylobacter ...................................................................127
4.2.1.5 Yersinia .............................................................................. 127
4.2.2 qPCR for Detecting Bacteria Foodborne Intoxications............. 129
4.2.2.1 Staphylococcus aureus .......................................................129
4.2.2.2 Clostridium botulinum ...................................................... 131
4.3 qPCR for Detecting Toxigenic Molds ...................................................... 132
4.4 Reverse Transcription Quantitative PCR as a Tool for Evaluating Gene
Expression of Foodborne Pathogens in Meat and Meat Products........... 134
4.4.1 Salmonella.........................................................................................135
4.4.2 Listeria monocytogenes.....................................................................139
4.4.3 Shiga Toxin-Producing E. coli .......................................................140
4.4.4 Campylobacter jejuni ........................................................................140
4.4.5 Staphylococcus aureus ......................................................................141
4.4.6 Viruses ............................................................................................. 141
4.4.7 Ochratoxin A-Producing Penicillia ............................................. 142
4.5 Conclusions................................................................................................. 142
Acknowledgments .............................................................................................. 143
References............................................................................................................. 143

113
114 Advanced Technologies for Meat Processing, Second Edition

4.1 Principles and Characteristics of Real-Time

Polymerase Chain Reaction for Detecting and
Quantifying Pathogens in Meat and Meat Products
In the meat industry, there is a necessity of having available rapid microbio-
logical methods to ensure the safety of products. For such purposes, a wide
range of protocols for detecting and/or quantifying pathogenic microorgan-
isms has been developed. Despite the fact that the results yielded by classical
microbiological techniques based on the enrichment, isolation, and/or enu-
meration using selective culture media and the subsequent confirmation by
biochemical and/or serological tests are generally adequate, they are laborious
and time consuming. In recent years, many molecular techniques have been
optimized for the detection of pathogens in meat and meat products. The most
valuable molecular methods rely on the polymerase chain reaction (PCR).
They have demonstrated to be faster than the traditional techniques and allow
a more specific and sensitive detection of pathogenic microorganisms. Within
such methods, the real-time PCR (quantitative PCR [qPCR]) ones are the most
valuable since they allow quantifying the level of pathogens apart from being
more sensitive and less prone to cross-contamination risks than conventional
PCR and have potential for automation (Hernández et al., 2009). Besides, qPCR
procedures developed for detecting and quantifying pathogenic microor-
ganisms in meat and meat products requires less time for the analyses, less
than 24 h in some cases, while this time is much higher (to seven days or even
more depending on the pathogen) when using traditional methods. In addi-
tion, qPCR methods are able to detect and quantify different pathogens in the
same reaction. Thus, the current trend is to develop multiplex qPCR methods
to detect several pathogenic microorganisms. They are also very useful for
detecting closely related species that display genetic variations requiring the
use of different sets of primers for reliable detection (Postollec et al., 2011).
This chapter focuses on current qPCR methods that are available for detect-
ing and quantifying microbial pathogens of interest in meat and meat products.

4.1.1 Sample Preparation

DNA isolation is the first critical step of qPCR procedures to detect and/or quan-
tify pathogenic microorganisms in meat and meat products. Due to the fact that
the DNA to be amplified is directly isolated from the meat matrix, its components
can inhibit the subsequent amplification, which can cause false negative results
or an underestimation of pathogen levels. Consequently, the elimination of such
inhibitory substances from DNA is a paramount prerequisite for the success of
the qPCR procedure. Thus, qPCR protocols have to be adapted for each meat or
meat product type since each one has a different nature mainly based on their
composition. Different methods of sample preparation to eliminate PCR inhibi-
tors from meat matrices have been reported included filtration, centrifugation,
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 115

the use of detergents and organic solvents, enzyme treatment, dilution of the
sample, the use of PCR components, flotation, and immunomagnetic separation
(IMS) (Botteldoorn et al., 2008; Gordillo et al., 2014; Melero et al., 2011; Rodríguez
et al., 2012b; Wolffs et al., 2005). Several commercial DNA extraction kits as well
as in-house developed protocols are currently available to obtain DNA with
high purity and quantitative yields. For instance, Gattuso et al. (2014) used a
DNA extraction protocol based on a washing step with phosphate saline buffer
(PBS) combined with a Chelex resin for detecting Listeria monocytogenes in pork
meat. For the same pathogenic bacterium, Rodríguez-Lázaro et al. (2014) com-
pared simple boiling of the culture after washing the bacterial pellet with PBS,
the use of a Chelex resin, and the QIAamp DNA Mini kit (QIAGEN), which con-
tains a silica column, obtaining the best results with the commercial kit. In gen-
eral, many commercial kits have proved to be adequate for a pathogen’s DNA
extraction in meat and meat products.
After isolating the DNA, its quantity and quality should be checked.
Measurement of absorbance is the most commonly used method for such
purposes. For determining DNA purity, the OD260/OD280 ratio should be
calculated. When this ratio is around 1.8, it indicates a good purity of the
obtained DNA. The concentration of DNA can also be quickly estimated by
agarose gel electrophoresis (Thermo Scientific. 2016).
Due to the fact that one of the limitations of qPCR methods consists of their
high limit of quantification considering the microbiological criteria required by
international legislations, nowadays their application for quantifying patho-
gens in meat and meat products generally requires a sample enrichment of a
few hours prior to further preparation and thus yields appropriate sensitivity.
Besides it has to be kept in mind that in most cases low levels of pathogenic
bacteria are able to cause disease. Apart from allowing the concentration of
the target microorganism, such an enrichment step diminishes the probabil-
ity of detecting dead microorganisms and dilutes the inhibitory food matrix
components. However, it should be considered that the disadvantage of using
an initial enrichment step is the impossibility to quantify the initial loads of
pathogenic microorganisms (Postollec et al., 2011). Regarding the enrichment
medium, both nonselective and selective media have been proposed. For
example Gattuso et al. (2014) and Rodríguez-Lázaro et al. (2014) successfully
used the selective Half Fraser Broth for enrichment of pork and poultry meat
for L. monocytogenes. For Campylobacter spp., Bolton broth with selective sup-
plements has been normally used. However, the presence of blood in this
medium could be problematic because of its PCR inhibitors. The omission of
such a component in Bolton enrichment broth has not been reported to have
a negative influence in Campylobacter recovery by qPCR in poultry samples
(Melero et al., 2011). Rodríguez et al. (2016) used Mannitol Salt broth (MSB)
for selective enrichment of Staphylococcus aureus from different kinds of meat
products. On the contrary, the nonselective tryptone soy broth (TSB) modified
by the addition of yeast extract has been used for detecting pathogenic Yersinia
enterocolitica and Yersinia pseudotuberculosis (Thisted Lambertz et al., 2008a,b)
116 Advanced Technologies for Meat Processing, Second Edition

Another important limitation of qPCR consists of the lack of differentiation

between viable and dead cells. To circumvent this disadvantage, propidium
monoazide (PMA) coupled with qPCR has been used in meat and meat prod-
ucts (Josefsen et al., 2010). Such DNA intercalating dye can only penetrate
membranes of damaged cells, thus preventing the following PCR reaction
(Barbau-Piednoir et al., 2014). However, this PMA treatment should not replace
the initial enrichment for a rapid and reliable foodborne bacteria detection
(Barbau-Piednoir et al., 2014). Controversial results have been obtained when
performing treatment of samples with PMA. Therefore, Josefsen et al. (2010)
obtained a good correlation between Campylobacter counts obtained by qPCR
with PMA sample treatment and counts from culture-based enumeration in
chicken carcass rinse and Pacholewicz et al. (2013) did not obtain concordant
results when testing the same protocol in broiler chicken carcass rinse sam-
ples. On the other hand, Wolffs et al. (2005) developed a flotation method to be
used prior to qPCR capable of selecting viable and viable nonculturable Cam-
pylobacter and Y. enterocolitica cells for being subsequently quantified by qPCR.

4.1.2 Main Considerations for qPCR

In qPCR methods, the accumulation of amplification products is continu-
ously monitored through the reaction by using fluorescent reporters without
the necessity of post-PCR handling of the obtained products. The change in
fluorescence during the reaction is measured by an instrument that combines
thermal cycling with fluorescent dye scanning capability. The fluorescence
intensity during qPCR is proportional to the amount of amplification products
(Law et al., 2015). By plotting fluorescence against the number of cycles, the
qPCR instrument generates an amplification curve that represents the accu-
mulation of PCR product over the duration of the entire reaction (Invitrogen,
2008). The quantification cycle (Cq), also known as threshold cycle (Ct), is deter-
mined from the amplification plot and used to calculate the initial concentra-
tion of the target DNA because this value is inversely related to the amount
of starting template (Invitrogen, 2008). Cq is the cycle number at which the
fluorescent signal of the reaction crosses the threshold (Invitrogen, 2008).
Many fluorescence chemistries are available including nonspecific dyes,
such as SYBR® Green, and sequence-specific primers or probes coupled to
fluorescent dyes, including hydrolysis probes, fluorescence resonance energy
transfer (FRET) probes, molecular beacons, and scorpions primers. SYBR
Green chemistry and TaqMan® hydrolysis probes are the most commonly
used technologies for detecting and quantifying pathogenic microorganism
in meat and meat products by qPCR. As SYBR Green binding is not specific
for a target DNA sequence this system can be readily used for different gene
assays, it is inexpensive and flexible (Postollec et al., 2011). Regarding the Taq-
Man chemistry, this is more expensive than DNA-binding dye assays, but
the presence of the hydrolysis probe ensures that only specific amplification
products are measured (Postollec et al., 2011). Furthermore, the last technology
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 117

allows the development of multiplex PCR reactions, although an important

optimization procedure is needed (Postollec et al., 2011). When using SYBR
Green dyes melting curve analysis should be performed to determine the
specificity of qPCR procedure and assure accurate results. This is normally
generated by the qPCR instrument and allows the calculation of the Tm value
of the amplification products.
To estimate the initial DNA concentration and consequently the unknown
target pathogen load in the analyzed meat or meat product, a linear standard
curve based on tenfold serial dilutions (know concentrations) of the DNA
should be set up. At least four but preferably six or more points should be
included in the curve (Kavanagh et al., 2011). It has to be kept in mind that
the concentrations of DNA chosen for the standard curve should cover the
expected concentration range of the target DNA (Invitrogen, 2008). For con-
structing the standard curve, the Cq values of diluted reference material
are plotted against the logarithm of the samples’ concentrations, number of
template copies, or dilution factor (Raymaekers et al., 2009). When the Cq
values of the analyzed meat or meat product samples are determined, they
are correlated to a certain concentration by placement on the standard curve.
It is recommended to use the same matrix as the one containing samples to
be tested and the same target DNA sequence for constructing the standard
curve as well as to include it on each experiment (Postollec et al., 2011).
Standard curves also allow for calculating the efficiency of the amplification
reaction by using their slope (S) in the formula E = [10(−1/S)]−1 (Bustin et al., 2009).
The acceptable range is generally between 90% and 110% (Raymaekers et al.,
2009). Furthermore, the coefficient of correlation (R2) derived from the stan-
dard curve must be between 0.99 and 0.999 (Raymaekers et al., 2009). Despite
the fact that it is possible to automatically elaborate standard curves and
calculate the efficiency using the software of the qPCR instruments, it
can be manually determined.

4.1.3 Targets
The basis of the qPCR methods is the detection of a characteristic and spe-
cific DNA sequence in the DNA of the pathogen. Thus the design or selec-
tion of the primers and probes is a key factor for the correct detection of a
pathogenic microorganism (Chapela et al., 2015). Although a wide variety
of DNA targets have been selected for developing qPCR methods to detect
microbial pathogens in meat and meat products, multicopy ribosomal RNA
(rRNA) genes and those encoding virulence microbial factors have been the
most commonly employed. rRNA genes have been commonly used because
they span both variable and highly conserved sequences, are easily available
from public databases for many species, and often result in sensitive detec-
tion due to their multicopy nature (Chapela et al., 2015; Postollec et al., 2011).
Housekeeping genes involved in essential cellular processes have also been
considered adequate for detecting pathogens (Bonjoch et al., 2010).
118 Advanced Technologies for Meat Processing, Second Edition

4.1.4 Controls of the qPCR

Owing to the fact that the qPCR is an instrumental technique, false negative
and false positive results can be produced (Rodríguez-Lázaro and Hernández,
2013). Consequently, proper controls must be carried out for monitoring the
critical steps and assuring the validity of the results. Controls necessary for
assessing the analytical performance of PCR methods have been summarized
(Hernández et al., 2009). Process or amplification controls can be used to
check the entire method or only the PCR, respectively. Positive and nega-
tive PCR controls and internal amplification control (IAC) are highly recom-
mended. Positive PCR control consists of a negative sample spiked with target
DNA (Hernández et al., 2009; Postollec et al., 2011). Negative or nontemplate
PCR control does not contain the target DNA and water is used instead of
it (Hernández et al., 2009; Postollec et al., 2011). IAC consists of a nontarget
DNA sequence present in the same sample reaction tube which is coamplified
simultaneously with the target sequence, but with an amplicon size visually
distinguishable from the target sequence (Hoorfar et al., 2004a,b). In a qPCR
with an IAC, a control signal will be always produced when there is no target
sequence present. When neither IAC nor target signal is produced, it indicates
that the amplification reaction has been inhibited due to malfunction of the
thermal cycler, incorrect PCR mixture, poor polymerase activity, and/or the
presence of inhibitors in the sample matrix (Hoorfar et al., 2004a,b). Postollec
et al. (2011) have proposed a Cq shift ≥1 between qPCR performed with the
IAC alone and with the IAC and the sample as cut-off inhibition value.
The use of the abovementioned analytical controls also assures the accu-
rate quantification of the target pathogen. Additionally, to avoid false posi-
tive results due to sample contamination, precautionary measurements are
required in the laboratory (Rodríguez-Lázaro and Hernández, 2013).
The most used controls for detecting pathogens in meat and meat products
are IAC (Bonjoch et al., 2010; Josefsen et al., 2010; Thisted Lambertz et al.,
2008a,b). The controls are processed throughout the whole protocol in paral-
lel with samples to be analyzed (Postollec et al., 2011).

4.1.5 Validation
Despite the fact that many qPCR protocols have been reported for detecting
and quantifying different pathogenic microorganisms in meat and meat prod-
ucts, they have not normally been implemented in the meat industry for routine
analysis. This could be due to the lack of validation and/or standardization.
Validation of qPCR methods is necessary to ensure that their performance
is equal or better when comparing with the conventional culture-based refer-
ence methods (Ceuppens et al., 2014). Validation of qPCR methods assures that
the target pathogens are detected without false negative or positive results.
During the validation process, the performance characteristics and limita-
tions of a method are established. Validation also allow identification of the
influences that may change these characteristics (Jones and Marengo, 2016).
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 119

Raymaekers et al. (2009) proposed practical guidelines for the validation of

qPCR procedures. Apart from studying the amplification efficiency and using
appropriate controls as previously mentioned, checking of several parameters
such as precision, linearity, trueness, limit of detection, and specificity, among
others, was recommended when validating qPCR methods before their appli-
cation for routine analysis (Raymaekers et al., 2009). Additionally, the use of
the specific meat matrix to be checked is vital for detecting potential inhibitors
and determining the competition of the target pathogen in the presence of the
natural microbial population (Gorski and Csordas, 2010).
There are some commercial qPCR methods that have been validated
by official independent organizations, such as the Association of Official
Analytical Chemists (AOAC), for the detection of foodborne bacterial patho-
gens including shiga toxin-producing Escherichia coli, S. aureus, L. monocyto-
genes, Salmonella, and Campylobacter.
On the other hand, the International Standardization Organization (ISO)
has provided guidelines to detect foodborne pathogens by qPCR. Concretely,
ISO 22119:2011 (Anonymous, 2011) is focused on the general requirements for
food testing by means of qPCR.

4.2 qPCR for Detecting Bacterial Pathogens

in Meat and Meat Products
Microorganisms that are involved in foodborne illness include Salmonella
spp., L. monocytogenes, Campylobacter spp., and E. coli O157:H7 are known to be
responsible for the majority of foodborne infections outbreaks (Velusamy et al.,
2010). A TaqMan qPCR procedure to simultaneously detect 20 foodborne patho-
gens, including all of the abovementioned pathogenic bacteria, in complex food
matrices such as meat has been reported (Cremonesi et al., 2014). Although no
meat matrix interferences were observed, the sensitivity of this method in artifi-
cially contaminated meat matrices ranged between 108 and 104 cfu/g. Thus, this
qPCR has the potential to be a powerful tool for a high-throughput screening
for multiple pathogens, enabling simultaneous processing of several samples
and reducing the total time required for analysis. However, for a more sensitive
quantification specific qPCR should be conducted to analyze each of the most
common and important pathogenic bacteria. In this section, qPCR methods to
detect bacteria involved in foodborne infections and foodborne intoxications in
meat and meat products will be separately analyzed.

4.2.1 qPCR for Detecting Bacteria Foodborne Infection

4.2.1.1 Salmonella
The European Commission through regulation No. 2073/2005 (European
Commission. 2005) established EN/ISO 6579 (Anonymous, 2002) as the
120 Advanced Technologies for Meat Processing, Second Edition

official analytical reference method for detection of Salmonella in foods.

This procedure is a culture-based method that includes pre-enrichment
and selective enrichment steps and subsequent plating in selective media
and final confirmatory tests. This takes four to five days of analysis. The
scientific community, in response to the demands of the European Com-
mission and the industrial sector, aimed to identify novel molecular-based
methods of high accuracy, specificity, sensitivity, and reduced time of
analysis for Salmonella detection (Pasquali et al., 2014). Thus, several qPCR
methods based on the target sequences the virulence hilA, invA, Sal, and
ttrRSBCA genes have been developed for rapid and sensitive detection
of Salmonella in meat carcasses (Krämer et al., 2011; Löfström et al., 2009;
McCabe et al., 2011; Zheng et al., 2014) and pork and meat products (Deli-
bato et al., 2013; Pasquali et al., 2014).
Most of the developed PCR methods include an enrichment step of 7–24 h at
37°C (Figure 4.1) to increase the number of the target Salmonella at detectable
levels (Martin et al., 2012; Zheng et al., 2014). Although most of the reported

Detection of Salmonella by qPCR Detection of Salmonella

by ISO 6579, 2004
(traditional culture-based
Meat/meat products techniques)

Enrichment (7–24 h at 37°C)

Buffered peptone water ONE Broth Salmonella medium

Immunomagnetic
separation

DNA extraction
(DNeasy tissue kit,
Martín et al. 2012)

qPCR with IAC

(Targets for design primers and probes)

ttrRSBCA gene hilA gene invA gene Sal gene

(Alves et al., 2016; Delibato et al., 2013; Löfström et al., 2009;
McCabe et al., 2011; Pasquali et al., 2014; Zheng et al., 2014)

Total time of Total time of

Limit of detection 1–100 cfu/g
analysis 2 days analysis 7 days

FIGURE 4.1
Flow diagram of the detection of Salmonella in meat and meat products by quantitative
polymerase chain reaction (qPCR) protocols validated with ISO 6579–2004. IAC, internal
amplification control; ONE, oxoid noel enrichment. (From Rodríguez, A. et al, Food Control, 60,
302–308, 2016.)
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 121

qPCR methods include buffered peptone water as culture medium for enrich-
ment, it has been demonstrated that oxoid noel enrichment (ONE) Broth Salmo-
nella medium increases the growth of Salmonella in the presence of competitive
microbial population in meat products compared with buffered peptone water
(Delibato et al., 2013). Thus, ONE Broth could be used in enrichment protocol
in order to minimize the effect of the competitive microflora naturally present
in meat samples. In addition, in meat and meat products, a pre-PCR treatment
consisting of a treatment with the DNeasy Tissue kit could be recommended to
reduce the risk of false negative results and increase the probability of Salmonella
detection, since PCR inhibitors present in these complex food matrices or in the
enrichment media would be eliminated (Martin et al., 2012). Some of the devel-
oped qPCR methods have been validated against the reference culture-based
method, ISO 6579 (Anonymous, 2002), providing an alternative testing protocol
to this reference microbiological method. Thus, Löfström et al. (2009) reported a
qPCR method that included an IAC, making it useful for detecting Salmonella in
meat. This method was validated in comparative and collaborative trials, based
on the recommendations from the Nordic organization for validation of alterna-
tive microbiological methods (NordVal) of a same-day, noncommercial qPCR
method for detection of Salmonella in meat and carcass swabs. This method
includes a short pre-enrichment of 18 h in buffered peptone water followed by
automated DNA purification and targets a part of the ttrRSBCA locus specific
for Salmonella. This locus, located in the Salmonella pathogenicity island 2, is
essential for tetrathionate-based anaerobic respiration and significant for Salmo-
nella survival and outgrowth in anaerobic competitive environments (Hensel
et al., 1999; Pasquali et al., 2014). The detection level of this method was between
1 and 100 cfu/25 g of sample. The ttrRSBCA locus has been used to design new
primers and a hydrolysis fluorescent probe for accurate and validated detection
of Salmonella spp. by qPCR using IAC (Delibato et al., 2013).
Furthermore, McCabe et al. (2011) developed a DNA and a RNA qPCR
validated assays amplifying a 270 bp region of the hilA gene of Salmonella
enterica serovars which includes an IAC that coamplified with the hilA gene
to monitor potential PCR inhibitors and ensure successful amplification. The
hilA target gene is located in the Salmonella pathogenicity island 1 (SPI1) and
regulates the expression of Salmonella invasion genes (Pasquali et al., 2014).
Both DNA and RNA PCR methods include an adapted two-step enrichment
protocol before DNA or RNA extraction that is able to detect between 1 and
10 cfu per carcass swab.
Different validated qPCR methods for accurate detection of Salmonella
using as the target the invA, ttrRSBCA, and Sal genes (Figure 4.1) have been
also reported (Zheng et al., 2014). The former authors reported qPCR proto-
cols combined with IMS for detecting healthy and heat-injured Salmonella
typhimurium on raw duck wings increasing sensitivity of the methods. From
the developed qPCR-IMS protocols that used primers targeting Sal genes
showed lower limit of detection and higher amplification efficiency than
those obtained with the invA and ttrRSBCA-based primers (Zheng et al., 2014).
122 Advanced Technologies for Meat Processing, Second Edition

Apart from simplex qPCR methods to detect Salmonella, a multiplex pro-

tocol that detect this pathogen and other worrying pathogenic microorgan-
ism in chicken meat such as Campylobacter spp. has been recently developed
(Alves et al., 2016). For the Salmonella gene, the invA was targeted. This
method showed a sensitivity of 1 cfu of each of these pathogens per milliliter
of rinse after 24 h of the selective enrichment of Campylobacter spp. and the
nonselective enrichment of Salmonella spp.
When the sensitivity and specificity of validated qPCR methods for Sal-
monella detection are tested possible differences between artificially and
naturally contaminated meat and meat products should be considered, since
during their shelf life, the number of Salmonella-stressed cells and the related
positive deviation might be increased (Pasquali et al., 2014). To avoid dif-
ferences on sensitivity of the new qPCR validated method due to stressed
cells, Pasquali et al. (2014) evaluated the relative accuracy, sensitivity, and
specificity of a qPCR targeting the ttrRSBCA locus, for detection of poten-
tially stressed Salmonella in naturally contaminated pork cuts from packag-
ing, during storage at retail and at the consumer’s house, in comparison with
ISO 6579:2004. The same authors reported that the qPCR assay targeting the
ttrRSBCA locus is an accurate, sensitive, and specific method for the rapid
and routine detection of Salmonella spp. also in naturally contaminated pork
cuts subject to physical stresses. Thus, the reference ISO method might be
applied only on positive samples for confirmatory and isolation purposes,
which are mandatory in epidemiological investigations.
Finally, the investigation of Salmonella serotypes in meat and meat prod-
ucts could be needed, especially when the traditional culture-based method
according to ISO 6579 (Anonymous, 2002) is followed. Recently, Mauris-
chat et al. (2015) developed a validated multiplex qPCR assay targeting the
partial sequences of the safA, fliAIS200, fljB-hin, and hin-iroB genes and the
pUC18/19 plasmid as IAC. This protocol detects Salmonella enteritidis and
Salmonella typhimurium and differentiates Salmonella serovars in 24 h after
sampling with a detection probability of 100% between 3 and 5 cfu in 25 g of
sample, showing a direct correlation with serovars determined by the tradi-
tional method using slide agglutination according to the White–Kauffman–
Le Minor scheme (Grimont and Weill, 2007). Thus, this qPCR assay could be
used to serotype Salmonella isolates from meat and meat products.

4.2.1.2 Listeria monocytogenes

The current ISO 11290-1 standard method (Anonymous, 2004) for the detec-
tion of L. monocytogenes that includes two consecutive enrichment steps in
the selective medium Half Fraser Broth and full concentrations, followed by
plating out on two selective solid media (PALCAM and ALOA) and sub-
sequent presumptive colonies confirmation through hemolysis and bio-
chemical tests (Anonymous, 2004), usually takes more than seven days. The
availability of rapid methods such as qPCR is one of the most important
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 123

advancements to managing L. monocytogenes along the meat chain, allow-

ing faster hazard analysis critical control points (HACCP) verification and
positive release of finished food products (Gattuso et al., 2014). Several qPCR
methods have been developed for rapid and sensitive detection of L. mono-
cytogenes in meat and meat products targeting different virulence hlyA, inlA,
prfA genes (Figure 4.2; Bolocan et al., 2016; Dalmasso et al., 2014; De Cesare
et al., 2014; Heo et al., 2014). From these target sequences, the hlyA gene encod-
ing for the virulence factor listeriolisin O has been the most frequently used
to design primers and probes for developing qPCR protocols (Rodríguez-
Lázaro et al., 2004; De Cesare et al., 2014). Until now, the developed methods
do not have sufficient sensitivity for direct detection of such pathogens in
meat samples without the use of an enrichment procedure (Bolocan et al.,
2016; Dalmasso et al., 2014).
Thus, qPCR methods for accurate and sensitive detection of L. monocyto-
genes in meat and meat products should include an enrichment step around
24–48 h at 37°C to increase the number of the target L. monocytogenes to

Detection of Listeria monocytogenes by qPCR Detection of Listeria monocytogenes

by ISO 11290-1
Meat/meat products (traditional culture-based
techniques)

1. Enrichment in Half Frasser

Broth (24 h at 37ºC)

2. Enrichment in Frasser Broth

(24 h at 37ºC)

Immunomagnetic
separation

DNA extraction
(DNeasy tissue kit,
Martín et al., 2012)

qPCR with IAC

(Targets for design primers and probes)

hilA gene inlA gene prfA gene

(Bolocan et al., 2016; Dalmasso et al., 2014; De Cesare et al., 2014;
Gattuso et al., 2014; Heo et al., 2014; Rodríguez-Lázaro et al., 2004)

Limit of detection 1–10 cfu/g Total time of Total time of

analysis 2–3 days analysis 7 days

FIGURE 4.2
Flow diagram of the detection of Listeria monocytogenes in meat and meat products by qPCR
validated with International Standardization Organization (ISO) 11290-1. IAC, internal ampli-
fication control; ONE, oxoid noel enrichment. (From Rodríguez, A. et al, Food Control, 60,
302–308, 2016.)
124 Advanced Technologies for Meat Processing, Second Edition

detectable levels (Figure 4.2). Dalmasso et al. (2014) demonstrated that the
use of the second enrichment broth in the qPCR reduces time for a confirmed
result from seven days needed for the ISO standard procedure performance
to three days. Besides, Gattuso et al. (2014) reported that a combination of
an incubation step in 100 mL of Half Fraser Broth for 24 h coupled to a DNA
extraction and a qPCR assay could detect about 8 cfu of L. monocytogenes
per sample in less than 27 h. This approach is fully compatible with the
ISO standard for detection of L. monocytogenes if 1:10 and 1:5 dilutions are
used, providing results more rapidly (27 h vs. 7 days) and cost-effectively
(five times cheaper, Gattuso et al., 2014). Recently, Bolocan et al. (2016) dem-
onstrated that the analysis of the second enrichment of the ISO method by
qPCR was more sensitive for the detection of L. monocytogenes than when the
ISO method was used alone.

4.2.1.3 Verotoxigenic E. coli

Verotoxin-producing E. coli (VTEC) are a group of foodborne pathogenic
E. coli strains that produce two cytotoxins called shiga-like toxins or vero-
toxins (Stx1 and Stx2). VTEC can cause diarrhea and hemorrhagic colitis and
may lead to hemolytic uremic syndrome. Although E. coli O157:H7 is the
serotype that has been linked to most of the outbreaks of foodborne dis-
eases, other VTEC serotypes such as O26, O103, O145, O91, O146, and O111
are related to sporadic cases (EFSA, 2015). This diversity of microorganisms is
a difficulty when designing primers for qPCR. Despite the fact that it would
be easier to screen for the presence of the shiga-like toxins gene sequences,
its value remains controversial, since not all VTEC have been proven to be
clinically significant in humans. Furthermore, each shiga-like toxin contains
several subtypes which differ in their sequence gene, biological activity, and
association with disease which complicates the design of appropriate targets
(Gyles, 2007). The Stx1 type is divided into three subtypes: Stx1a, Stx1c, and
Stx1d, and the Stx2 have been classified into seven subtypes: Stx2a, Stx2b,
Stx2c, Stx2d, Stx2e, Stx2f, and Stx2g (Scheutz et al., 2012). Therefore, for a cor-
rect Stx screening, the greatest amount of Stx subtypes should be considered.
For all these reasons, there are many methods of qPCR for the detection of
VTEC in meat products based on different targets. Different virulence genes
such as stx1, stx2, and eae, which encode the bacterial outer-membrane pro-
tein intimin, have been targeted to assess the presence of VTEC in minced
beef (Verhaegen et al., 2016), processed meat product (Bardasi et al., 2015),
and lamb (Osés et al., 2010). Other authors have developed multiplex qPCR
procedures to detect all known stx gene variants in ground and minced beef
(Brusa et al., 2015; Derzelle et al., 2011).
A commercial method known as the “BAX® System real-time PCR Assay”
was approved by the United States Department of Agriculture-Food Safety
and Inspection Service (USDA-FSIS) and AOAC for VTEC detection in raw
ground beef and beef trim (DuPont, 2014). The system amplifies and detects
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 125

the virulence genes stx and eae in less than an hour, and allows the screening
of samples containing any of the top six non-O157 serogroups. Furthermore,
there is a specific kit for detecting E. coli O157:H7 certified by AENOR and
another kit, the “BAX System Real-Time PCR STEC Suite” for detecting O26,
O45, O103, O111, O121, and O145 serogroups recommended by USDA-FSIS.
The ISO/TS 13136:2012 (Anonymous, 2012) describes a multiplex qPCR tar-
geting the virulence genes eae, stx1 and stx2, and after the samples result
positive for the presence of stx2 gene are tested for E. coli O104 serogroup-
associated gene. Positive samples for the presence of the stx1 and/or stx2 in
association with the eae gene were tested for the detection of E. coli O103,
O111, O145, O157, O26, serogroup-associated genes. When such genes are
detected, the isolation of the strain is needed to confirm the presence of the
stx genes in addition to relevant virulence factor in the same live cell while
excluding the presence of free DNA or free stx phages in the enrichment cul-
ture (EFSA, 2013). A sensitive multiplex qPCR using a melting curve analysis
for simultaneously detecting eight serogroups of VTEC has been developed
to sensitive detection of specific VTEC serotypes during preliminary screen-
ings (Singh and Mustapha, 2015).
In this sense, methods in which the combination of virulence genes with
serogroup-specific genes such as the wzx (O antigen flippase) and wzy
(O antigen polymerase) genes in minced meat and ground beef have been
developed (Kagkli et al., 2011; Perelle et al., 2007; Hara-Kudo et al., 2016). Nev-
ertheless, other authors have published a duplex-specific mRNA-based qPCR
tests for detection and quantification of viable E. coli O157:H7 in ready-to-eat
(RTE) meat products. This assay includes a combination of serotype-specific
markers of E. coli O157:H7 such as the rfbE and fliCh7 genes, encoding the
O157 antigen and the H7 flagellar antigen, respectively, to ensure specific-
ity in the detection of this pathogenic microorganism (Gordillo et al., 2014).
Recently, these two targets have been used in the commercial validated
“Thermo Scientific SureTect Escherichia coli O157:H7” procedure through the
AOAC as well (Cloke et al., 2015).
Finally, another E. coli O157:H7-specific qPCR assay targeting the highly
conserved mutation at position +93 of the uidA (β-glucuronidase) gene in
such pathogen has been used in raw ground meat for its accurate detection
(Miszczycha et al., 2012).
Detection limits of the listed methods are variable (Table 4.1), ranging
between 0.25 and 104 cfu/g, but most of them are below 100 cfu/g, the advis-
able limit of this microbial group in most foods. All assays include a previ-
ous enrichment ranging between 6 and 24 h (Table 4.1). From those methods
the one developed by Gordillo et al. (2014) may be the most suitable for the
detection of E. coli O157:H7 in meat and meat products. Regarding the assay
proposed by Singh and Mustapha (2015), it seems to be the most appropriate
qPCR for simultaneously detecting eight serogroups of VTEC in different
meat products. Finally, the multiplex qPCR developed by Brusa et al. (2015) is
the most appropriate to detect all known stx gene variants in meat.
TABLE 4.1
126

Target Sequence, Meat Matrix, Sample Preparation, Technology, and Limit of Detection for qPCR Detection of E. Coli VTEC in Meat
and Meat Products
Sample qPCR Limit of Detection/
Target Sequence Matrix Preparation Technology Quantification References

stx1 and stx2 genes Minced beef and cattle Enrichment 20 h TaqMan 0.25 cfu/g Verhaegen et al. (2016).
carcass
stx1, stx2, and eae genes Meat product Enrichment 18–24 h TaqMan 1–5 copies per ISO/TS 13136:2012
Lamb Enrichment 18 h TaqMan reaction Osés et al. (2010)
Ground beef, beef trim Enrichment 9–12 h Scorpion/ 3–4 log cfu/g 0BAX System (DuPont,
TaqMan 4 log cfu/mL 2014)
stx1a–stx1d genes Ground beef Enrichment 20 h SYBR Green 2 log cfu/mL Brusa et al. (2015)
stx2a–stx2g genes Minced beef Enrichment 18 h TaqMan 2 log cfu/g Derzelle et al. (2011)
wzxO26, wzxO45, wzxO103, wzxO111, wzxO121 Ground beef, ground Enrichment 6 h SYTO 9, HRM 10 cfu/25 g Singh and Mustapha
genes, glycosyl transferase gene chicken, ground turkey dye (2015)
(O104), uidA gene (O157)
stx, wzxO26, wzxO103, wzxO141, wzxO145, Ground beef Enrichment 20–24 h TaqMan 10 cfu/25 g Hara-Kudo et al. (2016)
wbdIO111, rfbEO157 genes Minced meat Enrichment 18–24 TaqMan 2–10 cfu/g Kagkli et al. (2011)
stx1a, stx2a–stx2d, eae, wzxO26,
wzxO103, ihp1O145, wbdIO111, rfbEO157
genes
rfbEO157 and fliCh7 genes Raw beef Enrichment 9–24 h TaqMan – Thermo Sci. Sure Test
Dry-cured ham, dry-cured Enrichment 6 h SYBR Green 1 cfu/g (Cloke et al., 2015)
pork loin, dry-fermented Gordillo et al. (2014)
sausages (“chorizo,”
“salchichón” and “salami”),
cooked ham, cooked turkey
breast, chopped, mortadella
uidA gene (O157) Raw ground meat Enrichment 24 h TaqMan 2 log cfu/mL Miszczycha et al. (2012)
HRM, high-resolution melting; ISO, International Standardization Organization; VTEC, verotoxin-producing E. coli.
Advanced Technologies for Meat Processing, Second Edition
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 127

4.2.1.4 Campylobacter
Since Campylobacter detection by traditional culture-based methods is prob-
lematic owing to its presence in low concentration and its sensitivity to cul-
ture conditions (Botteldoorn et al., 2008), qPCR methods seem to be more
adequate for its detection.
As illustrated in Table 4.2, most qPCR methods were developed for chicken
due to the fact that poultry is often implicated as a main source of human
infections with Campylobacter spp.
For the detection of Campylobacter spp., two different alternatives have
been proposed depending on the whole genus or the most important species
(Campylobacter jejuni, Campylobacter Coli, and Campylobacter lari). The detec-
tion of Campylobacter genus without differentiating the species may be an
ideal approach from a risk assessment point of view, and it is particularly
based on the thermotolerant C. jejuni, C. coli, and C. lari (Chapela et al., 2015).
rRNA gene sequences, mainly 16S, have been applied for specific detection
of Campylobacter genus and/or the three species (Table 4.2).
In the case of the differentiation of the thermotolerant species, the design
of appropriate primers and probes is a challenge since such species are
remarkably similar to each other in their genome sequences (He et al., 2010).
Different genes have been targeted for each species (Table 4.2).
Botteldoorn et al. (2008) evaluated the ability of three qPCR methods, two
of them already described, to quantify Campylobacter genus, thermotolerant
Campylobacter (Josefsen et al., 2004), and C. jejuni in chicken carcass rinses.
The most sensitive and specific method was the first one, based on the Taq-
Man technology (Table 4.2). The other two methods used SYBR Green but
they were not appropriate because of cross-reactions with other species
closely related with Campylobacter. Consistently, most of the published qPCR
for detecting and quantifying Campylobacter in meat and meat products have
used the TaqMan technology (Table 4.2).
On the other hand, Botteldoorn et al. (2008) compared the qPCR results
with those from traditional culture-based methods, obtaining lower detec-
tion sensitivity than from the latter. They suggested the presence of viable but
non-culturable or dead Campylobacter spp. and the sensitivity and difficulty of
enumerating them as the reason for such underestimation. This feature has
also been established by other authors working with Campylobacter detection.
The described qPCR methods for detecting Campylobacter in meat and
meat products are generally characterized for not having low detection lim-
its, although a few of them are able to detect as low as 1 cfu/g (Table 4.2).

4.2.1.5 Yersinia
Several qPCR protocols mainly using TaqMan technology have been reported
for detecting and quantifying pathogenic Yersinia in meat and meat products
(Table 4.2). Most of them have been developed for Y. enterocolitica and employ
TABLE 4.2
128

Target Sequence, Meat Matrix, Sample Preparation, Technology, and Limit of Detection for qPCR Detection of Pathogenic Campylo-
bacter and Yersinia Species in Meat and Meat Products
Sample qPCR Limit of Detection/
Microorganisms Target Genes Matrix Preparation Technology Quantification References

Campylobacter jejuni, hipO, cdtA, pepT Chicken (skin) 24 h selective TaqMan IAC 1 cfu/g He et al. (2010)
Campylobacter coli, enrichment
Campylobacter lari
C. jejuni, C. coli, C. lari 16S rRNA Chicken rinse Flotation Hybridiza- 8.6 × 102 cfu/mL Wolffs et al. (2005)
(skin) tion probes
C. jejuni, C. coli, C. lari, bipA, cje0832 Meat and meat Selective enrichment TaqMan 1–5 cfu/g Bonjoch et al. (2010)
Campylobacter upsaliensis products IAC
Campylobacter spp. 16S rRNA Chicken carcass TaqMan 2 × 103 cfu/carcass Botteldoorn et al.
rinse (2008)
C. jejuni, C. coli, C. lari 16S rRNA Chicken carcass PMA TaqMan 102 cfu/mL Josefsen et al. (2010)
rinse IAC
C. jejuni rpoB Chicken, turkey 18–48 h selective SYBR® Green 1–10 cfu/g or mL Rantsiou et al. (2010);
enrichment Melero et al. (2011)
Yersinia enterocolitica ail Ground beef, 18–20 h nonselective TaqMan 5.5–55 cfu/10g Thisted Lambertz
cold-smoked enrichment IAC et al. (2008)
sausage, raw pork
Yersinia enterocolitica ail Ground pork 24 h selective TaqMan ≤1 cfu/g Jourdan et al. (2000)
enrichment
Y. enterocolitica ail Pork 16–18 h nonselective TaqMan 1–10 cfu/g Fredriksson-Ahomaa
enrichment et al. (2007)
Yersinia pseudotuberculosis ail Ground beef 18–24 h nonselective TaqMan 28 cfu/10g Thisted Lambertz
enrichment IAC et al. (2008)
Yersinia pestis Virulence plasmids Ground beef TaqMan 102 cfu/g Amoako et al. (2010)
(pPCP1, pMT1), cnp60
Advanced Technologies for Meat Processing, Second Edition

IAC, internal amplification control; PMA, propidium monoazide; qPCR, quantitative polymerase chain reaction.
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 129

the chromosomally located virulence-associated gene ail (Table 4.2). Such

protocols are of great interest since some difficulties are associated with the
isolation of pathogenic Y. enterocolitica consisting of its low number in the
samples and the presence of competing microbial population (Fredriksson-
Ahomaa and Korkeala, 2003). The ability of the ail gene to detect Y. pseudotu-
berculosis has been also proven (Table 4.2). Thisted Lambertz et al. (2008a,b)
reported a multiplex qPCR assay for the simultaneous detection and differ-
entiation of Y. enterocolitica and Y. pseudotuberculosis based on the ail gene.
However, the utility of this gene seems to be limited due to the fact that it
is also found in some nonpathogenic strains of Y. enterocolitica (Fredriksson-
Ahomaa and Korkeala, 2003).
For the detection of Y. enterocolitica, its specific region of the 16SrRNA gene
and the plasmid-borne virulence gene yadA have also been described in pork
and chicken samples (Wolffs et al., 2005).
qPCR methods for detecting pathogenic Yersinia spp. other than Y. enteroco-
litica and Y. pseudotuberculosis in meat and meat products are scarce (Table 4.2).
Concretely, Amoako et al. (2010) described qPCR assays involving four primer
sets and their corresponding probes based on two virulence plasmids able to
distinguish Yersinia pestis from the various Yersinia and other bacterial spe-
cies tested. They designed an additional primer and probe set based on the
cnp60 chromosomal gene for distinguishing Y. pestis and Y. pseudotuberculosis
from the various Yersinia and other bacterial species tested.

4.2.2 qPCR for Detecting Bacteria Foodborne Intoxications

4.2.2.1 Staphylococcus aureus
Staphylococcal foodborne poisoning is an intoxication produced by con-
sumption of foods containing high enough amounts of preformed staph-
ylococcal enterotoxins (Argudín et al., 2010). Staphylococcus aureus is a
recognized causative agent of this poisoning and has been considered
the main representative of the genus Staphylococcus capable of produc-
ing enterotoxins (SEs) (Podkowik et al., 2013). However, some coagulase
negative Staphylococci strains showing enterotoxigenic capacity have been
found in Spanish dry-cured hams (Rodríguez et al., 1996) and even in
starter cultures (Zell et al., 2008).
The correct choice of the target sequence to design primers is essential for
a good power of discrimination and sensitivity of a qPCR method. Several
qPCR procedures to detect S. aureus on meat and meat products are based
on different staphylococcal genes, coding genes for thermonuclease (nuc),
chromosomal DNA fragment (Sa442), methicillin resistance (mecA), and heat
shock protein (htra) (Chiang et al., 2007; Cremonesi et al., 2014; Martinon and
Wilkinson, 2011; Table 4.3). Nevertheless, these target genes are not related to
the production of SEs, and not all S. aureus are enterotoxin-producers. In this
sense, other simplex or multiplex qPCR procedures based on genes involved
TABLE 4.3
130

Target Sequence, Meat Matrix, Sample Preparation, Technology, and Limit of Detection for qPCR Detection of Toxin-Producing
Staphylococcus aureus and Clostridium botulinum in Meat and Meat Products
Limit of
Sample qPCR Detection/
Microorganisms Target Sequence Matrix Preparation Technology Quantification References

Staphylococcus aureus nuc gene Ham, chicken, raw Enrichment 18 h SYBR Green 2 cfu/g Martinon and
minced meat Wilkinson (2011)
16S rRNA, nuc, Meat (beef, pork, Primary enrichment TaqMan – Velasco et al. (2014)
mecA, PVL genes poultry) and deli meat 18–20 h
(chicken, ham. turkey) Second enrichment
18–20 h
htrA gene Pork sausage Direct qPCR TaqMan 1pg genomic DNA Cremonesi et al. (2014)
Sa422 gene Pork Inmunomagnetic SYBR Green 9.6 cfu/g Ma et al. (2014)
separation 30 min
conserved regions Dry-cured ham, Enrichment 8 h SYBR Green 2–40 cfu/g Rodríguez et al. (2016)
of enterotoxin dry-cured pork loin,
genes dry-fermented
sausages, cooked ham,
mortadella
Clostridium botulinum BoNT/A, sausage – TaqMan 100 spores/mL Yoon et al. (2005)
BoNT/A, BoNT/B, “foie gras” salami, meat Enrichment 48 h TaqMan 103–104 cfu/mL Fach et al. (2009,
BoNT/E, and juice and homogenized Enrichment 4 days TaqMan 103–104 cfu/mL 2011)
BoNT/F gene meat Fenicia et al. (2011)
Sausages, canned meat,
salami, meat juice and
homogenized meat,
blood sausage
NTNH gene “foie gras” Enrichment 48 h TaqMan 103–104 cfu/mL Fach et al. (2009)
qPCR, quantitative polymerase chain reaction.
Advanced Technologies for Meat Processing, Second Edition
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 131

in the production of several SEs have been developed (Letertre et al., 2003;
Rodríguez et al., 2016; Table 4.3).
The qPCR methods designed for screening single genes encoding each SE
require several sets of specific primers targeting each SE gene. Therefore, a
rapid and specific method is still necessary able to detect the potential pro-
duction of all the described SEs using universal primers. Sharma et al. (2000)
reported a single-reaction multiplex PCR assay using a universal toxin gene
forward primer (SA-U) in combination with various toxin-specific reverse
primers for detecting SE genes between A and E from pure cultures of
S. aureus. Letertre et al. (2003) designed a qPCR using such a forward primer
and another universal reverse primer suitable to check for SE genes from A
to J but not for the remaining SE genes. Rodríguez et al. (2016) developed
a SYBR Green-based qPCR procedure for detecting most of the described
staphylococcal SE (A to V) in meat products.
Detection limits of the listed methods are variable (Table 4.3) but all are
below 100 cfu/g, the advisable limit of this microbial group in most foods.
Considering all the abovementioned methods, it seems that the method
developed by Rodríguez et al. (2016) may be the most suitable for the detec-
tion of enterotoxigenic Staphylococci in meat and meat products. In this pro-
cedure, the detection limits were about 2–40 cfu/g after an 8 h enrichment
period at 30°C, and the total time for assay completion was approximately
12 h. This qPCR method offers a useful, rapid, and efficient tool for screening
SEs-producing Staphylococci in meat products.

4.2.2.2 Clostridium botulinum

Foodborne botulism is caused by the ingestion of foods containing botuli-
num neurotoxin (BoNT). BoNT is produced by some species of the genus
Clostridium, particularly Clostridium botulinum, but some strains of Clos-
tridium baratii and Clostridium bytiricum can also produce it. BoNTs can also
be separated into one of seven distinct serotypes (A–G) on the basis of the
immunological characteristics of its botulinum toxin. Moreover, five immu-
nologically or genetically distinct BoNT/A subtypes, five BoNT/B subtypes,
six BoNT/E subtypes, and three BoNT/F subtypes have been identified
(Satterfield et al., 2010).
Several qPCR procedures to detect C. botulinum on meat and meat product
rely on different BoNT genes. Yoon et al. (2005) have designed primers for
detecting only the BoNT/A gene, while other authors have proposed qPCR
methods for identifying and typing BoNT-producing C. botulinum types A,
B, E, and F using a specific target based on the BoNT/A, BoNT/B, BoNT/E,
and BoNT/F genes on meat and meat products (Fach et al., 2009, 2011; Fenicia
et al., 2011).
Another strategy consists of using universal primers that recognize all
BoNT genes, but the nucleotide diversity among the BoNT genes may present
a potential problem (Hauser et al., 1995). Nonetheless, BoNTs are generated
132 Advanced Technologies for Meat Processing, Second Edition

as part of a progenitor toxin complex and a conserved component among

serotypes is nontoxic nonhemagglutinin (NTNH) (East and Collins, 1994).
These authors demonstrated that the gene encoding NTNH reveals a high
level of similarity and is present in all strains that produce BoNTs while it
is missing in nontoxic strains. Nucleotide sequence analysis of the cluster of
genes associated with the BoNT gene demonstrates that the presence of the
NTNH gene is directly upstream of the BoNT gene in all tested toxin types
(Raphael and Andreadis, 2007). A qPCR assay based on the detection of the
NTNH gene has been developed; its specificity in naturally contaminated
samples of “foie gras” has been also shown (Fach et al., 2009).
Detection limits of the listed methods are higher than methods for detect-
ing C. botulinum (Table 4.3), ranging between 102 and 104 cfu/g. All assays
include a previous enrichment ranging between 48 h and four days, except-
ing the protocol of Yoon et al. (2005). This assay was the most sensitive
and fast, but only detected the BoNT/A gene (Table 4.3). Fenicia et al. (2011)
included an external amplification control that gives more robustness to the
technique, but the disadvantage was that the enrichment period is too long.

4.3 qPCR for Detecting Toxigenic Molds

Only a few qPCR methods have been developed for detecting and quan-
tifying foodborne molds in meat and meat products. Generally, molds do
not grow on meats, which do not have a ripening step within their process-
ing. However, the processing of cured meat products such as dry-cured
ham and dry-cured fermented sausages have a ripening step which favors
mold colonization on their surface. Normally, this mycobiota only has
positive effects on these cured meats, nevertheless some mold species may
contaminate such products with mycotoxins (Núñez et al., 1996), which
are secondary metabolites produced by molds which have toxic effects in
both animals and humans. Among them, ochratoxin A (OTA) is the most
important mycotoxin found in dry-cured meat products (Bertuzzi et al.,
2013; Comi and Iacumin, 2013; Markov et al., 2013; Perši et al., 2014; Pleadin
et al., 2013; Rodríguez et al., 2011). Rodríguez et al. (2011) developed two
new qPCR methods to detect and quantify ochratoxigenic molds in dry-
cured meat products by using both TaqMan and SYBR Green methodol-
ogies (Table 4.4). For these qPCR protocols primers and probe target the
otanps gene involved in OTA biosynthesis were developed. The specificity
of the methods has been tested on 75 mold strains distinguishing between
producing and nonproducing strains. The efficiencies and R 2 values of the
standard curves were within the recommended range (Rodríguez et al.,
2015b) so they can be used for quantification purposes in dry-cured meat
products. Therefore, such methods have been widely used in further stud-
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 133

TABLE 4.4
Target Sequence, Meat Matrix, Sample Preparation, Technology, and Limit of
Detection for qPCR Detection of Toxigenic Molds in Dry-Cured Meat Products
Limit of
Sample qPCR Detection/
Toxigenic Target Prepara- Technol- Quantifi-
Mold Genes Matrix tion ogy cation References
Ochratoxin otanps Dry-cured ham, Direct SYBR® 10 cfu/g Rodríguez
A-producing dry-fermented qPCR Green/ et al. (2011)
mold sausage TaqMan®
Aflatoxin- aflP Dry fermented Direct SYBR 10 cfu/g Rodríguez al.
producing sausages qPCR Green/ (2012c)
mold “salchichón” TaqMan
and “chorizo,”
dry-cured ham,
dry-cured pork
loin
Cyclopiazonic dmaT Dry-cured ham Direct TaqMan/ 10–100 Rodríguez
acid-produc- qPCR Competi- cfu/g et al. (2012e)
ing mold tive IAC
IAC, internal amplification control; qPCR, quantitative polymerase chain reaction.

ies to quantify OTA-producing molds in the dry-cured ham industry

(Rodríguez et al., 2012d), to test different DNA extraction methods from
inoculated meat matrices (Rodríguez et al., 2012b) and to evaluate the
efficacy of different antagonist microorganisms to control ochratoxigenic
mold growth on dry-cured ham and dry-fermented sausages (Andrade
et al., 2014; Bernáldez et al., 2013; Rodríguez et al., 2015a). Besides, other
types of toxigenic molds can be quantified in cured meat products using
qPCR. Thus, Rodríguez et al. (2012c) optimized two qPCR methods, which
use both SYBR Green and TaqMan methodologies for detection and quan-
tification of aflatoxigenic molds in such products (Table 4.4). Specific prim-
ers and probe based on the aflP gene involved in aflatoxin biosynthesis
have been designed. The specificity of the two methods has been tested on
53 producing and nonproducing strains and their efficiencies of around
90% allows using both methods to quantify the load of aflatoxigenic molds
contaminating cured meat products. These methods can be carried out in
any laboratory/equipment and performed by different operators since they
also show good repeatability and reproducibility. On the other side, two
TaqMan-based qPCR methods have been reported for detection and quan-
tification of cyclopiazonic acid (CPA)- and verrucosidin-producing molds
in dry-cured meat products (Rodríguez et al., 2012a,e; Table 4.4). Both
methods utilize IAC to assess the validity of qPCR and avoid false negative
results as has been explained in Section 4.1. However, the IAC methodol-
ogy used for both methods is different. The qPCR for detecting produc-
ers of CPA includes a competitive IAC, while the method for producers of
134 Advanced Technologies for Meat Processing, Second Edition

verrucosidin uses a noncompetitive IAC. For the qPCR for CPA-producing

mold detection, the design of primers and probe is based on the dmaT gene
that encodes the enzyme dimethylallyl tryptophan synthase involved in
the biosynthesis of CPA. The competitive IAC consists of a 105 bp chimeric
DNA fragment containing a region of the hly gene of L. monocytogenes. The
qPCR method for quantifying verrucosidin-producing molds was devel-
oped with primers and probes designed from the SVr1 probe sequence of a
verrucosidin-producing Penicillium polonicum (Aranda et al., 2002). The con-
served regions of the β-tubulin gene have been used to design primers and
probe of the noncompetitive IAC included in such qPCR. Both methods
are specific, able to quantify only CPA- or verrucosidin-producing molds
between other toxigenic molds, which normally contaminate dry-cured
ham and dry-fermented sausages. The functionality of both methods is
demonstrated by high linear relationships of the standard curves relating
to log10 cfu/g and the Cq values obtained from the different producers of
CPA and verrucosidin tested, respectively. The described qPCR for detect-
ing toxigenic molds in cured meat products are characterized as having
detection limits between 1 and 2 cfu/g (Table 4.4).

4.4 Reverse Transcription Quantitative PCR as a

Tool for Evaluating Gene Expression of Food-
borne Pathogens in Meat and Meat Products
Reverse transcription quantitative PCR (RT-qPCR) could also be a useful
technique for evaluation of meat and meat products safety. RT-qPCR has
been proven to be a powerful method to study population dynamics and
activities through quantification of gene expression (Gadkar and Filion,
2013), which is increasingly important in a variety of food research fields
(Ishii et al., 2007). qPCR when combined with reverse transcription (RT) can
also estimate transcript amounts, providing data on microbial activity (Post-
ollec et al., 2011). The main difference between the qPCR and RT-qPCR meth-
ods is that in the latter mRNA is used as a template. Altered levels of specific
mRNAs may indicate a change in the level of the proteins encoded by the
mRNA required in response to specific environmental conditions. Such a
technique can also be used in foodborne pathogen viability studies. How-
ever, the major drawback is that mRNA itself cannot be stable for a quite long
time after cell death (Birch et al., 2001; Rijpens and Herman, 2004). Design of
RT-qPCR methods should be based on the targeting sequences of virulence
genes and/or stress-related genes instead of housekeeping genes.
Target detection chemistries for RT-qPCR are the same as those used for
qPCR and they are detailed in depth in Section 4.1. RT-qPCR can be conducted
in one step within a single reaction, or in two steps with cDNA synthesis done
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 135

independently of qPCR (Nolan et al., 2006). Despite the fact that both RT-qPCR
procedures are acceptable, it is preferable to choose the two-step protocol
when several qPCR analyses will be carried out from the same RNA sample.
Analysis of data derived from RT-qPCR can be performed either at absolute
levels to determine the absolute transcript copy number or at relative levels
to measure differences in the expression level of a specific target between dif-
ferent samples (VanGuilder et al., 2008). For absolute quantification, a RNA
standard curve of the gene of interest is required in order to calculate the
number of copies. However, for the relative one, an endogenous control (e.g.,
housekeeping gene) and a calibrator (control or reference sample) are needed.
Although several mathematical models have been set up for relative quanti-
fication, the most common one is the 2−ΔΔCT method (Livak and Schmittgen,
2001), which relies on two assumptions. The first one is that the amplification
efficiencies of the target and the reference must be approximately equal. The
second assumption of the 2−ΔΔCT method is that the endogenous gene should
be expressed at a constant level between the samples. This endogenous con-
trol will be used to correct any difference in sample loading. Depending on
the chosen quantification method, different results can be observed. Com-
pared to absolute quantification, relative quantification is simpler. However,
it can only be applied to the samples run within the same PCR.
Generally, gene expression studies in foodborne bacteria and molds nor-
mally growing in meat and meat products have been conducted in culture
media and not in such complex matrices. This makes it difficult to analyze the
real gene expression of pathogens in food environments due to several reasons:
(a) differences between growth medium and meat matrices, (b) the isolation of
stable mRNA from complex matrices such as meat and meat products that
contains nucleases and PCR inhibitors, and (c) the substantial technique chal-
lenges associated with accurately measuring bacteria and mold-related gene
expression in complex matrices. Due to the fact that gene expression measure-
ments can vary depending on the substrate that the pathogen grows on, only
studies which have investigated quantitative gene expression of foodborne
pathogens on complex meat matrices are discussed in Sections 4.4.1 to 4.4.7.
This section provides brief descriptions of the currently available RT-qPCR-
based methods for gene expression studies of the most relevant foodborne
pathogens in meat and meat products: Salmonella, Campylobacter, shiga toxin-
producing E. coli, S. aureus, L. monocytogenes, viruses, and OTA-producing
Penicillia. RT-qPCR methods to analyze gene expression responses by Yersinia
and C. botulinum in meats have not been developed yet. A review of RT-qPCR
methods developed to quantify gene expression of the most relevant
foodborne pathogens in meat and meat products is summarized in Table 4.5.

4.4.1 Salmonella
Several RT-qPCR methods have been developed to analyze gene expression
of Salmonella spp. contaminating meat and meat products. Most of them
TABLE 4.5
136

Target Sequence and Sample Preparation for Gene Expression by RT-qPCR of Pathogenic Microorganisms in Meat and Meat Products
Gene Expres-
Foodborne Target Sequence Sample Detection sion Quantifi-
Pathogen (Reference Gene) Matrix Preparation Chemistry cation Method Factor Analyzed References
Salmonella rpoE, rpoH, rpoS, htrA, Poultry Enrichment NA Relative Temperature/time Yadav et al.
uspA, uspB (rpoD) Minced beef Direct qPCR SYBR Green Relative Heat/salt stress (2016)
dnaK, otsB (rpoD) Meat extract Enrichment SYBR Green Relative Tolerance to acid Kjeldgaard
rpoS, nlpD, clpD (gmk) broth Enrichment SYBR Green Relative (lactic acid and et al. (2011)
adrA, bapA, csgB, csgD, Meat-based acetic acid) Burin et al.
csrA, rpoS, invA, sipB-C, growth Biofilm formation (2014)
sdiA, luxS (16S rRNA) medium Wang et al.
(2016)
Escherichia coli dnaK, ostB (gapA) Minced beef Direct qPCR SYBR Green Relative Heat/salt stress Kjeldgaard
asnB, rbsB, rplD, uhpT, Beef Enrichment SYBR Green Relative Beef composition et al. (2011)
asr, melA, osmY, melB, Dry-cured meat Enrichment SYBR Green/ Absolute Viability Fratamico
melR, grxB (16S rRNA) products, TaqMan et al. (2011)
fliCh7, rfbE dry-fermented Gordillo
sausages and et al. (2014)
cooked meat
products
Campylobacter rplA, cheA, Cj0006, hslV, Chicken In vivo inoculation SYBR Green Relative Interaction between Hu et al.
jejuni glyA (Cj0402) Chicks and direct qPCR SYBR Green Relative chicken-C. jejuni (2014)
dps (Cj0402) Chicken In vivo inoculation SYBR Green Relative Biofilm formation Theoret et al.
dnaJ, dnaK, groEL (rpoA) and direct qPCR Heat shock response, (2012)
In vivo inoculation motility, and Apel et al.
and direct qPCR maintenance of cell (2012)
length homogeneity
(Continued)
Advanced Technologies for Meat Processing, Second Edition
TABLE 4.5 (Continued)
Target Sequence and Sample Preparation for Gene Expression by RT-qPCR of Pathogenic Microorganisms in Meat and Meat Products
Gene Expres-
Foodborne Target Sequence Sample Prepara- Detection sion Quantifi-
Pathogen (Reference Gene) Matrix tion Chemistry cation Method Factor Analyzed References

Staphylococcus sec (rpoB and hu) Pepper beef Direct qPCR EvaGreen Relative Gene expression Alibayov
aureus sea (16S rRNA) salami, turkey Direct qPCR TaqMan Relative through various et al. (2015)
ham, chicken meat products Zeaki et al.
ham, pork ham processing (2014)
Frankfurter Gene expression
type sausage through sausage
storage and lactic
acid effect
Listeria sigB, lmo0669, lmo2434, Salami Direct qPCR SYBR Green Relative Potential stress Mataragas
monocyto- gbuA, gbuB, lmo1421, Liver pâtés Enrichment TaqMan Relative resistance et al. (2015)
genes betL, opuCA, lmo1038, Fermented Direct qPCR TaqMan Relative NaCl content Olesen et al.
lmo0442, lmo0115, sausage, Direct qPCR SYBR Green Absolute Common (4°C) and (2010)
lmo0938, prfA (rpoB, minced meat abuse (12°C) Rantsiou
rplD, gap, bglA and tuf) Chilled pork refrigeration et al. (2012)
prfA, inlA, sigB, clpC (gap conditions Ye et al.
and rpoB) Viability (2012)
hly, sigB, iap, plcA (IGS)
hly
(Continued)
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products
137
TABLE 4.5 (Continued)
138

Target Sequence and Sample Preparation for Gene Expression by RT-qPCR of Pathogenic Microorganisms in Meat and Meat Products
Gene Expres-
Foodborne Target Sequence Sample Detection sion Quantifi-
Pathogen (Reference Gene) Matrix Preparation Chemistry cation Method Factor Analyzed References
Viruses HEV (MNV-1) Pork liver Direct qPCR TaqMan Absolute Viability of hepatitis Di Bartolo
HEV (MS2 phage) sausages/Raw Direct qPCR TaqMan Detection E virus et al. (2015);
Murine norovirus and pig liver Direct qPCR TaqMan Absolute Viability of hepatitis Martin-
F-RNA coliphage MS2 products E virus Latil et al.
Liver raw Viability of hepatitis (2014)
sausages E virus Szabo et al.
Pork chop Survival of viruses (2015)
during meat Brandsma
processing et al. (2012)
Ochratoxi- otapks, otanps Dry-cured Direct qPCR SYBR Green Relative NaCl content on Rodríguez
genic molds otapks ham-based Direct qPCR SYBR Green Absolute temporal gene et al. (2014)
medium expression Ferrara et al.
Salami Seasoning process of (2016)
salami on temporal
gene expression
MNV, murine norovirus; RT-qPCR, reverse transcription quantitative polymerase chain reaction.
Advanced Technologies for Meat Processing, Second Edition
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 139

use the nonspecific dye SYBR Green to monitor the fluorescence through
the qPCR reactions and the relative quantification method is the method of
choice to analyze gene expression data. Only a few studies have investigated
quantitative gene expression of Salmonella in meat matrices (Table 4.5). The
majority of them have examined the behavior of such foodborne pathogens
in culture media (González-Gil et al., 2012).
Depending on the objective of the study, different genes have been used
as targets of the RT-qPCR designed to analyze gene expression of Salmo-
nella in meat and meat products. For studying the cue of genes involved in
imparting thermotolerance or thermal stress response of S. typhimurium
and S. enteritidis on dressed poultry skin surface, relative expression of heat
stress-related genes has been analyzed (Yadav et al., 2016). The target genes
of such RT-qPCR are the heat stress-related sigma factor (rpoH), alternative
sigma factor (rpoE), universal stress protein (uspA and uspB), and the serine
protease htrA. However, for in-depth analysis on heat and salt stress changes
of S. enterica in minced beef, a RT-qPCR method has been devised based on
the targeting sequences of the dnaK related to many cellular processes (e.g.,
DNA replication of the bacterial chromosome, RNA synthesis, and auto-
regulation of the heat shock response) and ostB genes involved in trehalose
biosynthesis connected to osmotic stress (Kjeldgaard et al., 2011). Both inves-
tigations use the gene encoding the RNA polymerase sigma factor (rpoD) as
the reference gene to normalize quantification of the mRNA targets.
Other authors use model systems such as meat extract broth and agar to
simulate meat matrix composition to study the influence of lactic acid and ace-
tic acid and biofilm formation on expression of related genes by Salmonella,
respectively (Burin et al., 2014; Wang et al., 2016). Burin et al. (2014) have devel-
oped a RT-qPCR method targeting three genes involved in a complex tolerance
mechanism of survival under acid stress: rpoS and nlpD, which are responsible
for protein expression, and clpP, which is associated with the regulation of
these proteins inside the cell (Foster, 2001). The essential gmk gene encoding
guanylate kinase is used as endogenous control in such RT-qPCR. Wang et al.
(2016) have investigated the expression of the attachment (adrA, bapA, csgB,
csgD, and csrA), virulence (invA and sipB-C), and quorum sensing (sidA and
luxS) genes in Salmonella biofilm formed on meat-based medium. They have
also identified the relationships between each tested gene involved in biofilm
formation. In this case, 16s rRNA has been used as endogenous control.

4.4.2 Listeria monocytogenes

Different meat products including fermented sausage “salami,” liver pâtés,
minced meats, and chilled pork have been used as meat matrices to study
expression of different stress- and virulence-related genes of L. monocyto-
genes. Mataragas et al. (2015) examined the gene expression profiling of the
pathogen in response to the conditions encountered during the fermenta-
tion and ripening of sausages (salami). For this, SYBR Green-based RT-qPCR
140 Advanced Technologies for Meat Processing, Second Edition

methods based on one gene related to general stress (sigB) and eleven genes
relative to various stresses commonly found during fermented sausage pro-
duction, such as acid (lmo0669 and lmo2434 or gadD), osmotic (gbuA, gbuB,
lmo1421, betL, and opuCA) and competition for nutrients (lmo1038, lmo0442,
lmo0115, and lmo0938), are used as targets. Five housekeeping genes (rpoB,
rplD, gap, bglA, and tuf) are included as reference genes for performing rela-
tive quantification. Ye et al. (2012) have also used the nonspecific SYBR Green
dye to detect rapidly viable L. monocytogenes in chilled pork by RT-qPCR.
This method is able to quantify the absolute expression of the L. monocyto-
genes-specific hly gene encoding listeriolysin.
Other researchers have used the sequence-specific double-labeled probes
for their gene expression studies of such pathogens in meat products. Ole-
sen et al. (2010) analyzed the effect of NaCl content on relative transcription
of several L. monocytogenes virulence genes such as prfA, inlA, sigB, and clpC
in liver pâtés. However, Rantsiou et al. (2012) studied the influence of com-
mon (4°C) and abuse (12°C) refrigeration conditions on the relative expres-
sion profile of a stress response gene (sigB) and three virulence genes (hly,
iap, and plcA) of this foodborne pathogen in fermented sausages and minced
meat.

4.4.3 Shiga Toxin-Producing E. coli

A limited number of RT-qPCR methods have been devised to analyze gene
expression of verocytotoxic E. coli contaminating meat and meat products.
Two of them have analyzed the relative expression of virulence-related genes
of E.coli in beef using the SYBR Green chemistry as the detection system
(Kjeldgaard et al., 2011; Fratamico et al., 2011). One of them analyses the effect
of heat and salt stress on the dnaK and ostB genes using the gapA gene as the
reference gene. The other one evaluates the influence of 10 genes (asnB, rbsB,
rplD, uhpT, asr, melA, osmY, melB, melR, and grxB) with the nonribosomal 16s
rRNA region as the housekeeping gene. On the other hand, Gordillo et al.
(2014) quantifies the viability of E. coli 0157:H7 in meat products by means
of duplex qPCR assays based on two serotype-specific markers such as the
fliCh7 and rfbE genes in RTE meat products. Both detection qPCR methodolo-
gies, SYBR Green and TaqMan, are proposed to be used to quantify expres-
sion of verocytotoxic E. coli in meat products.

4.4.4 Campylobacter jejuni

Chicken is the only meat matrix used for C. jejuni gene expression studies
by RT-qPCR. In such studies, chickens were in vivo inoculated by C. jejuni
through oral or intramuscular administration (Hu et al., 2014; Theoret et al.,
2012; Apel et al., 2012). In addition, regarding RT-qPCR performance, SYBR
Green chemistry is utilized and Cq data from qPCR are analyzed using
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 141

the 2−ΔΔCT method (Table 4.5). Although earlier studies have several similari-
ties, they set different research goals. Hu et al. (2014) have studied the genes
expressed in vivo during interaction between chicken and the host infection
by the pathogen. For this, the virulence-associated genes plA, cheA, Cj0006,
hslV, and glyA have been used as target genes. However, Theoret et al. (2012)
have analyzed the expression of the dps gene for a role in biofilm formation
and cecal colonization in poultry. The housekeeping gene Cj0402 was used
as endogenous control in both abovementioned RT-qPCR methods. On the
other hand, the RT-qPCR method, reported by Apel et al. (2012), targets three
genes (dnaJ, dnaK, and groEL) to analyze their role in the heat shock response
of C. jejuni when it colonizes the cecum of birds. The rpoA gene is used to
normalize cDNA quantities in the qPCR reactions.

4.4.5 Staphylococcus aureus

Scarce RT-qPCR methods have been developed to examine gene expression
of S. aureus in meat products. In all studies, expression of genes encoding
enterotoxin A (SEA) and C (SEC) has been analyzed throughout process-
ing of different meat products. In addition, Zeaki et al. (2014) investigated
the effect of lactic acid on the sea gene expression through sausage storage.
A detection method using hydrolysis probes and relative gene expression
measurements are used by Zeaki et al. (2014). The sea gene, which has pre-
viously shown that regulates the expression and production of SEA, and
16s rRNA are utilized as target and endogenous genes, respectively. The
main difference between the abovementioned two methods were the dif-
ferent types of meat matrix used. The first one evaluates gene expression
on several pork meat products (boiled ham, hot-smoked ham, Serrano ham,
and black pepper salami), and the second one checked expression of the sea
gene on frankfurter type sausage. Recently, Alibayov et al. (2015) studied
differences in transcription and expression of the sec gene associated with
SEC formation in processed meat products such as pepper beef salami and
turkey, chicken, and pork ham. This method used two genes (rpoB and hu)
as endogenous control to calculate relative expression of the target gene.
Fluorescence changes occurring during qPCR are measured by the DNA-
binding EvaGreen® dye.

4.4.6 Viruses
Human foodborne viruses are not usually found in meat and meat prod-
ucts. However, the meat industry and laboratories should be prepared
to detect viruses in meat matrices due to the increase in recent years of
foodborne outbreaks involving viruses. Detection of worrying foodborne
viruses requires preferably RT-qPCR instead of qPCR. All the RT-qPCR
methods developed to check gene expression of viruses in meat products
use the TaqMan chemistry. Most of these methods target hepatitis E virus
142 Advanced Technologies for Meat Processing, Second Edition

and their purpose was to study the viability of the pathogen in different
meats and meat products such as pigs, pork liver sausages, and raw pig liver
products (Di Bartolo et al., 2015; Martin-Latil et al., 2014; Szabo et al., 2015).
On the other hand, Brandsma et al. (2012) have devised a method to evaluate
the survival of murine norovirus and F-RNA coliphage MS2 on pork chop
during storage and retail display.

4.4.7 Ochratoxin A-Producing Penicillia

Only two RT-qPCR methods have been developed to study expression of
genes involved in mycotoxin of unwanted molds in cured meat products.
Both protocols have used the nonspecific SYBR Green dye to monitor fluo-
rescence during qPCR reactions. Rodríguez et al. (2014) have evaluated the
effect of NaCl content on relative temporal expression of the otapks and otanps
genes associated with OTA biosynthesis of Penicillium nordicum on dry-cured
ham-based medium. However, Ferrara et al. (2016) have analyzed the influ-
ence of the seasoning process of a dry-fermented sausage (salami) on the
absolute expression of the otapks gene.

4.5 Conclusions
Recently, several qPCR protocols have been reported as accurate, specific,
and sensitive methods to detect pathogenic microorganisms of concern in
meat and meat products. Some of these methods such as those reported for
detecting Salmonella and L. monocytogenes are validated against the corre-
sponding ISO methods and thus they could be used in the meat industry for
routine analysis. Although in most of the qPCR protocols an enrichment step
of 7–48 h could be included, time of analysis is greatly reduced in compari-
son to traditional culture-based techniques proposed by ISO methods. The
limit of detection of these methods is around 1–100 cfu/g. The high sensitiv-
ity and reasonably low time of analysis of the reported qPCR protocols make
them very useful tools to evaluate raw material and preprocessed and fin-
ished products; they allow for the use of rapid and efficient corrective actions
during processing in the meat industry. In addition, RT-qPCR could be also
a valuable technique for evaluation of meat and meat products safety. RT-
qPCR has proved to be a powerful method to evaluate population dynamics
and activities through quantification of gene expression. Several RT-qPCR
protocols have been reported for accurate and sensitive evaluation of gene
expression of the most important foodborne pathogenic bacteria and mold
in meat products. These protocols could be used to detect live pathogenic
microorganisms in meat and meat products, which could allow for the use of
corrective actions during processing in the meat industry. Although further
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 143

studies should be developed to reduce the time of analysis and protocols

validation, the current qPCR and RT-qPCR methods allow a rapid and sensi-
tive detection and gene expression analysis respectively of concern microor-
ganisms in the meat industry.

Acknowledgments
This work has been funded by the Instituto Nacional de Investigación
y Tecnología Agraria y Alimentaria (INIA), the Spanish Ministry of Economy
and Competitiveness, the Government of Extremadura, and FEDER (INIA-
RTA-2013-00070-C03-03, AGL2013-45729-P, GR15108). Dr. Alicia Rodríguez is
a recipient of a Juan de la Cierva senior fellowship from the Spanish Ministry
of Economy and Competitiveness (IJCI-2014-20666).

References
Alibayov, B., Karamonova, L., Hollerova, R., Zdenkova, K. and Demnerova, K. (2015).
Differences in transcription and expression of staphylococcal enterotoxin C in
processed meat products. LWT–Food Science and Technology, 64, 578–585.
Alves, J., Hirooka, E. Y. and Oliveira, T. C. R. M. D. (2016). Development of a multi-
plex real-time PCR assay with an internal amplification control for the detection
of Campylobacter spp. and Salmonella spp. in chicken meat. LWT—Food Science
and Technology, 72, 175–181.
Amoako, K. K., Goji, N., Macmillan, T. et al. (2010). Development of multitarget real-
time PCR for the rapid, specific, and sensitive detection of Yersinia pestis in milk
and ground beef. Journal of Food Protection, 73, 18–25.
Andrade, M. J., Thorsen, L., Rodríguez, A., Córdoba, J. J. and Jespersen. L. (2014).
Inhibition of ochratoxigenic moulds by Debaryomyces hansenii strains for bio-
preservation of dry-cured meat products. International Journal of Food Microbiol-
ogy, 170, 70–77.
Anonymous. (2002). International Standard Organisation 6579. Microbiology of food
and animal feeding stuffs: horizontal method for the detection of Salmonella. Avail-
able at: https://www.iso.org/standard/29315.html (Accessed on 19 June 17).
Anonymous. (2004). International Standard Organisation 11290-1. Microbiology
of food and animal feeding stuffs—Horizontal method for the detection and
enumeration of Listeria monocytogenes—Part 1: Detection method. Available at:
https://www.iso.org/standard/19268.html (Accessed on 19 June 17).
Anonymous. (2011). International Standard Organisation 22119:2011. Microbiology
of food and animal feeding stuffs—Real-time polymerase chain reaction (PCR)
for the detection of food-borne pathogens—General requirements and defini-
tions. Available at:https://www.iso.org/standard/45035.html (Accessed on
19 June 17).
144 Advanced Technologies for Meat Processing, Second Edition

Anonymous. (2012). International Standard Organisation 13136. Microbiology of food

and animal feed—Real-time polymerase chain reaction (PCR)-based method
for the detection of food-borne pathogens—Horizontal method for the detec-
tion of shiga toxin-producing Escherichia coli (STEC) and the determination of
O157, O111, O26, O103 and O145 serogroups (ISO/TS 13136:2012). Available at:
https://www.iso.org/standard/53328.html (Accessed on 19 June 17).
Apel, D., Ellermeier, J., Pryjma, M., DiRita, V. J. and Gaynor, E. C. (2012). Character-
ization of Campylobacter jejuni RacRs reveals roles in the heat shock response,
motility, and maintenance of cell length homogeneity. Journal of Bacteriology, 194,
2342–2354.
Aranda, E., Rodríguez, M., Benito, M. J., Asensio, M. A. and Córdoba, J. J. (2002).
Molecular cloning of verrucosidin-producing Penicillium polonicum genes by dif-
ferential screening to obtain a DNA probe. International Journal of Food Microbiol-
ogy, 76, 55–61. Available at http://www.ncbi.nlm.nih.gov/pubmed/12038578
Argudín, M. Á., Mendoza, M. C. and Rodicio, M. R. (2010). Food poisoning and Staph-
ylococcus aureus enterotoxins. Toxins, 2, 1751–1773.
Barbau-Piednoir, E., Mahillon, J., Pillyser, J., Coucke, W., Roosens, N. H. and Bottel-
doorn, N. (2014). Evaluation of viability-QPCR detection system on viable and
dead Salmonella serovar enteritidis. Journal of Microbiological Methods, 103, 131–137.
Bardasi, L., Taddei, R., Nocera, L., Ricchi, M. and Merialdi, G. (2015). Shiga toxin-
producing Escherichia coli in meat and vegetable products in Emilia Romagna
region, years 2012–2013. Italian Journal of Food Safety, 4, 33–35.
Bernáldez, V., Córdoba, J. J., Rodríguez, M., Cordero, M., Polo, L. and Rodríguez, A.
(2013). Effect of Penicillium nalgiovense as protective culture in processing of dry-
fermented sausage “salchichón.” Food Control, 32, 69–76.
Bertuzzi, T., Gualla, A., Morlacchini, M. and Pietri, A. (2013). Direct and indirect con-
tamination with ochratoxin A of ripened pork products. Food Control, 34, 79–83.
Birch, L., Dawson, C. E., Cornett, J. H. and Keer, J. T. (2001). A comparison of nucleic
acid amplification techniques for the assessment of bacterial viability. Letters in
Applied Microbiology, 33, 296–301.
Bolocan, A. Nicolau, S. A. I., Alvarez-Ordóñez, A. et al. (2016). Dynamics of Listeria
monocytogenes colonisation in a newly-opened meat processing facility. Meat Sci-
ence, 113, 26–34.
Bonjoch, X., Calvó, L., Soler, M., Ruiz-Rueda, O. and Garcia-Gil, L. J. (2010). A new
multiplexed real-time PCR assay to detect Campylobacter jejuni, C. coli, C. lari,
and C. upsaliensis. Food Analytical Methods, 3, 40–46.
Botteldoorn, N., Van Coillie, E., Piessens, V. et al. (2008). Quantification of Campylo-
bacter spp. in chicken carcass rinse by real-time PCR. Journal of Applied Microbiol-
ogy, 105, 1909–1918.
Brandsma, S. R., Muehlhauser, V. and Jones, T. H. (2012). Survival of murine norovi-
rus and F-RNA coliphage MS2 on pork during storage and retail display. Inter-
national Journal of Food Microbiology, 159, 193–197.
Brusa, V., Galli, L., Linares, L. H., Ortega, E. E., Lirón, J. P. and Leotta, G. A. (2015).
Development and validation of two SYBR Green PCR assays and a multiplex
real-time PCR for the detection of shiga toxin-producing Escherichia coli in meat.
Journal of Microbiological Methods, 119, 10–17.
Burin, R., Konrad, C., Silva, A. and Nero, L. A. (2014). Influence of lactic acid and
acetic acid on Salmonella spp. growth and expression of acid tolerance-related
genes. Food Research International, 64, 726–732.
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 145

Bustin, S. A., Benes, V., Garson, J. A. et al. (2009). The MIQE guidelines: Minimum
information for publication of quantitative real-time PCR experiments. Clinical
Chemistry, 55, 611–622.
Ceuppens, S., Li, D., Uyttendaele, M. et al. (2014). Molecular methods in food safety
microbiology: Interpretation and implications of nucleic acid detection. Compre-
hensive Reviews in Food Science and Food Safety, 13, 551–577.
Chapela, M. J., Garrido-Maestu, A. and Cabado, A. G. (2015). Detection of foodborne
pathogens by qPCR: A practical approach for food industry applications. Cogent
Food and Agriculture, 1, 1013771.
Chiang, Y.-C., Fan, C.-M., Liao, W.-W., Lin, C.-K. and Tsen, H.-Y. (2007). Real-time
PCR detection of Staphylococcus aureus in milk and meat using new primers
designed from the heat shock protein gene htrA sequence. Journal of Food Pro-
tectection, 70, 2855–2859.
Cloke, J., Crowley, E., Bird, P. et al. (2015). Validation of the Thermo Scientific SureTect
Escherichia coli O157: H7 real-time PCR assay for raw beef and produce matrixes.
Journal of AOAC International, 98, 1301–1314.
Comi, G. and Iacumin, L. (2013). Ecology of moulds during the pre-ripening and rip-
ening of San Daniele dry cured ham. Food Research International, 54, 1113–1119.
Cremonesi, P., Pisani, L. F., Lecchi, C. et al. (2014). Development of 23 individual
TaqMan® real-time PCR assays for identifying common foodborne pathogens
using a single set of amplification conditions. Food Microbiology, 43, 35–40.
Dalmasso, M., Bolocan, A. S., Hernandez, M. et al. (2014). Comparison of polymerase
chain reaction methods and plating for analysis of enriched cultures of Liste-
ria monocytogenes when using the ISO11290-1 method. Journal of Microbiological
Methods, 98, 8–14.
De Cesare, A., Pasquali, F., Lucchi, A. and Manfreda, G. (2014). Relative accuracy,
specificity and sensitivity of a 5’nuclease real-time PCR assay for Listeria mono-
cytogenes detection in naturally contaminated pork cuts. Food Analytical Methods,
7, 1359–1365.
Delibato, E., Anniballi, F., Sinibaldi Vallebona, P. et al. (2013). Validation of a 1-day
analytical diagnostic real-time PCR for the detection of Salmonella in different
food meat categories. Food Analytical Methods, 6, 996–1003.
Derzelle, S., Grine, A., Madic, J. et al. (2011). A quantitative PCR assay for the detection
and quantification of shiga toxin-producing Escherichia coli (STEC) in minced
beef and dairy products. International Journal of Food Microbiology, 151, 44–51.
Di Bartolo, I., Angeloni, G., Ponterio, E., Ostanello, F. and Ruggeri, F. M. (2015). Detec-
tion of hepatitis E virus in pork liver sausages. International Journal of Food Micro-
biology, 193, 29–33.
DuPont (2014). Dupont™ BAX® system real-time PCR assays e STEC suite. Available
at: http://www2.dupont.com/Qualicon/en_US/assets/downloads/BAX%20
product%20descrip-RealTimeSTEC.pdf (Accessed on 15 June 17).
East, A. K. and Collins, M. D. (1994). Conserved structure of genes encoding compo-
nents of botulinum neurotoxin complex-m and the sequence of the gene coding
for the nontoxic component in nonproteolytic Clostridium botulinum type-F. Cur-
rent Microbiology, 29(2), 69–77.
EFSA. (2013). Scientific opinion on VTEC-Seropathotype and scientific criteria regard-
ing pathogenicity assessment. EFSA Journal, 11(4), 3138.
EFSA. (2015). The European Union summary report on trends and sources of zoono-
ses, zoonotic agents and food-borne outbreaks in 2011 has been published. Euro
146 Advanced Technologies for Meat Processing, Second Edition

Surveillance: Bulletin Europe en Sur Les Maladies Transmissibles European Commu-

nicable Disease Bulletin, 18(15), 20449.
European Commission. (2005). Commission regulation (EC) No. 2073/2005 of 15
November 2005 on microbiological criteria for foodstuffs. Official Journal of the
European Union, 338, 1–26.
Fenicia, L., Fach, P., van Rotterdam, B. J. et al. (2011). Towards an international stan-
dard for detection and typing botulinum neurotoxin-producing clostridia types
A, B, E and F in food, feed and environmental samples: A European ring trial
study to evaluate a real-time PCR assay. International Journal of Food Microbiology,
145(Suppl. 1), S152–S157.
Fach, P., Fenicia, L., Knutsson, R. et al. (2011). An innovative molecular detection tool
for tracking and tracing Clostridium botulinum types A, B, E, F and other botu-
linum neurotoxin producing Clostridia based on the GeneDisc cycler. Interna-
tional Journal of Food Microbiology, 145(Suppl. 1), S145–S151.
Fach, P., Micheau, P., Mazuet, C., Perelle, S. and Popoff, M. (2009). Development of
real-time PCR tests for detecting botulinum neurotoxins A, B, E, F producing
Clostridium botulinum, Clostridium baratii and Clostridium butyricum. Journal of
Applied Microbiology, 107, 465–473.
Ferrara, M., Magistà, D., Epifani, F. et al. (2016). Study of gene expression and OTA
production by Penicillium nordicum during a small-scale seasoning process of
salami. International Journal of Food Microbiology, 227, 51–55.
Foster, J. W. (2001). Acid stress responses of Salmonella and E. coli: Survival mecha-
nisms, regulation, and implications for pathogenesis. Journal of Microbiology, 39,
89–94.
Fratamico, P. M., Wang, S., Yan, X., Zhang, W. and Li. Y. (2011). Differential gene
expression of E. coli O157:H7 in ground beef extract compared to tryptic soy
broth. Journal of Food Science, 76, 79–87.
Fredriksson-Ahomaa, M., Hartmann, B., Scheu, P. and Stolle. A. (2007). Detection of
pathogenic Yersinia enterocolitica in meat using real-time PCR. Journal Für Verbr-
aucherschutz Und Lebensmittelsicherheit, 2, 202–208.
Fredriksson-Ahomaa, M. and Korkeala, H. (2003). Low occurrence of pathogenic Yer-
sinia enterocolitica in clinical, food, and environmental samples: A methodologi-
cal problem. Society, 16, 220–229.
Gadkar, V. J. and Filion, M. (2013). New developments in quantitative real-time poly-
merase chain reaction technology. Current Issues in Molecular Biology, 16, 1–6.
Gattuso, A., Gianfranceschi, M. V. and Sonnessa, M. (2014). Optimization of a real
time PCR based method for the detection of Listeria monocytogenes in pork meat.
International Journal of Food Microbiology, 184, 106–108.
González-Gil, F., Le Bolloch, A., Pendleton, S., Zhang, N., Wallis, A. and Hanning. I.
(2012). Expression of hila in response to mild acid stress in Salmonella enterica is
serovar and strain dependent. Journal of Food Science, 77, 292–297.
Gordillo, R., Rodríguez, A., Werning, M. L., Bermúdez, E. and Rodríguez, M. (2014).
Quantification of viable Escherichia coli O157: H7 in meat products by duplex
real-time PCR assays. Meat Science, 96, 964–970.
Gorski, L. and Csordas, A. (2010). Molecular detection: Principles and methods. In:
Liu, D. (ed.) Molecular Detection of Foodborne Pathogens. Boca Raton, FL: CRC
Press (Taylor and Francis), pp. 1–20.
Grimont, P. and Weill, F. X. (2007). Antigenic formulae of the Salmonella serovars.
WHO collaborating centre for reference and research on Salmonella, 1–167. Available
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 147

at: http://www.serotest-thailand.com/upload/news/download/9-8310-0.pdf
(Accessed on 15 June 17).
Gyles, C. L. (2007). Shiga toxin-producing Escherichia coli: An overview. Journal of Ani-
mal Science, 85(Suppl. E), E45–E62.
Hara-Kudo, Y., Konishi, N., Ohtsuka, K. et al. (2016). An interlaboratory study on effi-
cient detection of shiga toxin-producing Escherichia coli O26, O103, O111, O121,
O145, and O157 in food using real-time PCR assay and chromogenic agar. Inter-
national Journal of Food Microbiology, 230, 81–88.
Hauser, D., Gibert, M., Marvaud, J. C., Eklund, M. W. and Popoff, M. R. (1995). Botuli-
nal neurotoxin C1 complex genes, clostridial neurotoxin homology and genetic
transfer in Clostridium botulinum. Toxicon, 33, 515–526.
He, Y., Yao, X. and Gunther, N. W. et al. (2010). Simultaneous detection and differen-
tiation of Campylobacter jejuni, C. coli, and C. lari in chickens using a multiplex
real-time PCR assay. Food Analytical Methods, 3, 321–329.
Hensel, M., Nikolaus, T. and Egelseer, C. (1999). Molecular and functional analysis
indicates a mosaic structure of Salmonella pathogenicity island 2. Molecular
Microbiology, 31, 489–498.
Heo, E. J., Song, B. R., Park, H. J. et al. (2014). Rapid detection of Listeria monocytogenes
by real-time PCR in processed meat and dairy products. Journal of Food Protec-
tion, 77, 453–458.
Hernández, M., Hansen, F., Cook, N. and Rodríguez-Lázaro, D. (2009). Real-time
PCR methods for detection of foodborne bacterial pathogens in meat and meat
products. In: Toldrá, F. (ed.) Safety of Meat and Processed Meat. New York, NY:
Springer, pp. 427–446.
Hoorfar, J., Cook, N., Malorny, B. et al. (2004a). Diagnostic PCR: Making internal
amplification control mandatory. Letters in Applied Microbiology, 38, 79–80.
Hoorfar, J., Malorny, B., Abdulmawjood, A., Cook, N., Wagner, M. and Fach, P.
(2004b). Practical considerations in design of internal amplification controls for
diagnostic PCR assays. Journal of Clinical Microbiology, 42, 1863–1868.
Hu, Y., Huang, J. and Jiao, X. A. (2014). Screening of genes expressed in vivo during
interaction between chicken and Campylobacter jejuni. Journal of Microbiology and
Biotechnology, 24, 217–224.
Invitrogen. (2008). Real-time PCR. Real-Time PCR: From Theory to Practice. Available at:
www.invitrogen.com (Accessed on 15 June 17).
Ishii, T., Sootome, H., Shan, L. and Yamashita, K. (2007). Validation of universal con-
ditions for duplex quantitative reverse transcription polymerase chain reaction
assays. Analytical Biochemistry, 362, 201–212.
Jones, M. and Marengo, S. (2016). Laboratory validation, verification and accredita-
tion of molecular methods. In: Cook, N., D’Agostino, M. and Thompson, K. C.
(eds.) Molecular Microbial Diagnostic Methods: Pathways to Implementation for the
Food and Water Industries. London: Academic Press, pp. 107–133.
Josefsen, M. H., Jacobsen, N. R. and Hoorfar, J. (2004). Enrichment followed by quan-
titative PCR both for rapid detection and as a tool for quantitative risk assess-
ment of food-borne thermotolerant Campylobacters. Applied and Enviromental
Microbiology, 70, 3588–3592.
Josefsen, M. H., Löfström, C., Hansen, T. B., Christensen, L. S., Olsen, J. E. and Hoorfar, J.
(2010). Rapid quantification of viable Campylobacter bacteria on chicken carcasses,
using real-time PCR and propidium monoazide treatment, as a tool for quantita-
tive risk assessment. Applied and Environmental Microbiology, 76, 5097–5104.
148 Advanced Technologies for Meat Processing, Second Edition

Jourdan, A. D., Johnson, S. C. and Wesley, I. V. (2000). Development of a fluorogenic

5’nuclease PCR assay for detection of the ail gene of pathogenic Yersinia entero-
colitica. Applied and Environmental Microbiology, 66, 3750–3755.
Kagkli, D. M., Weber, T. P., Van den Bulcke, M. et al. (2011). Application of the modu-
lar approach to an in-house validation study of real-time PCR methods for the
detection and serogroup determination of verocytotoxigenic Escherichia coli.
Applied and Environmental Microbiology, 77, 6954–6963.
Kavanagh, I., Jones, G. and Nayab, S. N. (2011). Significance of controls and stan-
dard curves in PCR. In: Kennedy, S. and Oswald, N. (eds.) PCR Troubleshooting
and Optimization: The Essential Guide. Norfolk, VA: Caister Academic Press, pp.
67–78.
Kjeldgaard, J., Henriksen, S., Cohn, M. T. Aabo, S. and Ingmer, H. (2011). Method
enabling gene expression studies of pathogens in a complex food matrix. Applied
and Environmental Microbiology, 77, 8456–8458.
Krämer, N., Vigre, C. L. H., Hoorfar, J., Bunge, C. and Malorny, B. (2011). A novel
strategy to obtain quantitative data for modelling: Combined enrichment and
real-time PCR for enumeration of Salmonellae from pig carcasses. International
Journal of Food Microbiology, 145, S86–S95.
Law, J. W. F., Ab Mutalib, N. S., Chan, K. G. and Lee, L. H. (2015). Rapid methods for
the detection of foodborne bacterial pathogens: Principles, applications, advan-
tages and limitations. Frontiers in Microbiology, 5, 1–19.
Letertre, C., Perelle, S., Dilasser, F. and Fach, P. (2003). Detection and genotyping by
real-time PCR of the staphylococcal enterotoxin genes sea to sej. Molecular and
Cellular Probes, 17, 139–147.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods,
25, 402–408.
Löfström, C., Krause, M., Josefsen, M. H., Hansen, F. and Hoorfar, J. (2009). Validation
of a same-day real-time PCR method for screening of meat and carcass swabs
for Salmonella. BMC Microbiology, 9, 85.
Ma, K., Deng, Y., Bai, Y. et al. (2014). Rapid and simultaneous detection of Salmonella,
Shigella, and Staphylococcus aureus in fresh pork using a multiplex real-time PCR
assay based on immunomagnetic separation. Food Control, 42, 87–93.
Markov, K., Pleadin, J., Bevardi, M. et al. (2013). Natural occurrence of aflatoxin B1,
ochratoxin A and citrinin in Croatian fermented meat products. Food Control,
34, 312–317.
Martin, B., Garriga, M. and Aymerich. T. (2012). Pre-PCR treatments as a key factor on
the probability of detection of Listeria monocytogenes and Salmonella in ready-to-
eat meat products by real-time PCR. Food Control, 27, 163–169.
Martin-Latil, S., Hennechart-Collette, C., Guillier, L. and Perelle, S. (2014). Method for
HEV detection in raw pig liver products and its implementation for naturally
contaminated food. International Journal of Food Microbiology, 176, 1–8.
Martinon, A. and Wilkinson, M. G. (2011). Selection of optimal primer sets for use in a
duplex SYBR green-based, real-time polymerase chain reaction protocol for the
detection of Listeria monocytogenes and Staphylococcus aureus in foods. Journal of
Food Safety, 31, 297–312.
Mataragas, M., Rovetto, F., Bellio, A. et al. (2015). Differential gene expression profil-
ing of Listeria monocytogenes in cacciatore and felino salami to reveal potential
stress resistance biomarkers. Food Microbiology, 46, 408–417.
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 149

Maurischat, S., Baumann, B., Martin, A. and Malorny, B. (2015). Rapid detection
and specific differentiation of Salmonella enterica subsp. enterica Enteritidis,
Typhimurium and its monophasic variant 4,[5],12:i: By real-time multiplex PCR.
International Journal of Food Microbiology, 193, 8–14.
McCabe, E. M., Burgess, C. M., Walsh, D. et al. (2011). Validation of DNA and RNA
real-time assays for food analysis using the hila gene of Salmonella enterica
serovars. Journal of Microbiological Methods, 84, 19–26.
Melero, B., Cocolin, L., Rantsiou, K., Jaime, I. and Rovira, J. (2011). Comparison
between conventional and qPCR methods for enumerating Campylobacter jejuni
in a poultry processing plant. Food Microbiology, 28, 1353–1358.
Miszczycha, S. D., Ganet, S., Duniere, L., Rozand, C., Loukiadis, E. and Thevenot-
Sergentet, D. (2012). Novel real-time PCR method to detect Escherichia coli
O157: H7 in raw milk cheese and raw ground meat. Journal of Food Protection,
75, 1373–1381.
Nolan, T., Hands, R. E. and Bustin, S. (2006). Quantification of mRNA using real-time
RT-PCR. Nature Protocols, 1, 1559–1582.
Núñez, F., Rodríguez, M., Bermúdez, M. E., Córdoba, J. J. and Asensio, M. A. (1996).
Composition and toxigenic potential of the mould population on dry-cured Ibe-
rian ham. International Journal of Food Microbiology, 32, 185–197.
Olesen, I., Thorsen, L. and Jespersen, L. (2010). Relative transcription of Listeria mono-
cytogenes virulence genes in liver pates with varying NaCl content. International
Journal of Food Microbiology, 141, S60–S68.
Osés, S. M., Rantsiou, K., Cocolin, L., Jaime, I. and Rovira, J. (2010). Prevalence and
quantification of shiga-toxin producing Escherichia coli along the lamb food chain
by quantitative PCR. International Journal of Food Microbiology, 141, S163–S169.
Pacholewicz, E., Swart, A., Lipman, L. J., Wagenaar, J. A., Havelaar, A. H. and Duim,
B. (2013). Propidium monoazide does not fully inhibit the detection of dead
Campylobacter on broiler chicken carcasses by qPCR. Journal of Microbiological
Methods, 95, 32–38.
Pasquali, F., De Cesare, A., Bovo, F., Serraino, A. and Manfreda, G. (2014). Relative
accuracy, specificity and sensitivity of a 5’nuclease real-time PCR assay for Sal-
monella detection in naturally contaminated pork cuts. Molecular and Cellular
Probes, 28, 133–137.
Perelle, S., F. Dilasser, J. Grout, and P. Fach. 2007. Screening food raw materials for
the presence of the world’s most frequent clinical cases of shiga toxin-encoding
Escherichia coli O26, O103, O111, O145 and O157. International Journal of Food
Microbiology 113, 284–88.
Perši, N., Pleadin, J., Kovačević, D., Scortichini, G. and Milone, S. (2014). Ochratoxin A
in raw materials and cooked meat products made from OTA-treated pigs. Meat
Science, 96, 203–210.
Pleadin, J., Perši, N., Kovačević, D., Vahčić, N., Scortichini, G. and Milone, S. (2013).
Ochratoxin A in traditional dry-cured meat products produced from subchronic-
exposed pigs. Food Additives and Contaminants: Part A, 30, 1827–1836.
Podkowik, M, Park, J. Y, Seo, K. S., Bystroń, J. and Bania, J. (2013). Enterotoxigenic
potential of coagulase-negative Staphylococci. International Journal of Food Micro-
biology, 163, 34–40.
Postollec, F., Falentin, H., Pavan, S., Combrisson, J. and Sohier, D. (2011). Recent
advances in quantitative PCR (qPCR) applications in food microbiology. Food
Microbiology, 28, 848–861.
150 Advanced Technologies for Meat Processing, Second Edition

Rantsiou, K., Lamberti, C. and Cocolin, L. (2010). Survey of Campylobacter jejuni in

retail chicken meat products by application of a quantitative PCR protocol.
International Journal of Food Microbiology, 141, S75–S79.
Rantsiou, K., Mataragas, M., Alessandria, V. and Cocolin, L. (2012). Expression of
virulence genes of Listeria monocytogenes in food. Journal of Food Safety, 32,
161–168.
Raphael, B. H. and Andreadis, J. D. (2007). Real-time PCR detection of the nontoxic
nonhemagglutinin gene as a rapid screening method for bacterial isolates har-
boring the botulinum neurotoxin (A-G) gene complex. Journal of Microbiological
Methods, 71, 343–346.
Raymaekers, M., Smets, R., Maes, B. and Cartuyvels, R. (2009). Checklist for opti-
mization and validation of real-time PCR assays. Journal of Clinical Laboratory
Analysis, 23, 145–151.
Rijpens, N. and Herman, L. (2004). Comparison of selective and nonselective primary
enrichments for the detection of Listeria monocytogenes in cheese. International
Journal of Food Microbiology, 94, 15–22.
Rodríguez, A., Bernáldez, V., Rodríguez, M., Andrade, M. J., Núñez, F. and Córdoba,
J. J. (2015a). Effect of selected protective cultures on ochratoxin A accumulation
in dry-cured Iberian ham during its ripening process. LWT—Food Science and
Technology, 60, 923–928.
Rodríguez, A., Córdoba, J. J., Werning, M. L., Andrade, M. J. and Rodríguez, M.
(2012a). Duplex real-time PCR method with internal amplification control for
quantification of verrucosidin producing molds in dry-ripened foods. Interna-
tional Journal of Food Microbiology, 153, 85–91.
Rodríguez, A., Gordillo, R., Andrade, M. J., Córdoba, J. J. and Rodríguez, M. (2016).
Development of an efficient real-time PCR assay to quantify enterotoxin-
producing staphylococci in meat products. Food Control, 60, 302–308.
Rodríguez, A., Medina, Á., Córdoba, J. J. and Magan, N. (2014). The influence of salt
(NaCl) on ochratoxin A biosynthetic genes, growth and ochratoxin A produc-
tion by three strains of Penicillium nordicum on a dry-cured ham-based medium.
International Journal of Food Microbiology, 178, 113–119.
Rodríguez, M., Núñez, F., Córdoba, J. J., Bermúdez, E. and Asensio, M. A. (1996).
Gram-positive, catalase-positive cocci from dry cured Iberian ham and their
enterotoxigenic potential. Applied and Environmental Microbiology, 62, 1897–1902.
Rodríguez, A., Rodríguez, M., Córdoba, J. J. and Andrade, M. J. (2015b). Design of
primers and probes for quantitative real-time PCR methods. In PCR Primer
Design (Series: Methods in Molecular Biology), Chhandak Basu (ed). New York,
NY: Springer.pp. 189–191.
Rodríguez, A., Rodríguez, M., Luque, M. I., Justesen, A. F. and Córdoba, J. J. (2011).
Quantification of ochratoxin A-producing molds in food products by SYBR
Green and TaqMan real-time PCR methods. International Journal of Food Micro-
biology, 149, 226–235.
Rodríguez, A., Rodríguez, M., Luque, M. I., Justesen, A. F. and Córdoba, J. J. (2012b).
A comparative study of DNA extraction methods to be used in real-time PCR
based quantification of ochratoxin A-producing molds in food products. Food
Control, 25, 666–672.
Rodríguez, A., Rodríguez, M., Luque, M. I., Martín, A. and Córdoba, J. J. (2012c). Real-
time PCR assays for detection and quantification of aflatoxin-producing molds
in foods. Food Microbiology, 31, 89–99.
Real-Time PCR for the Detection of Pathogens in Meat and Meat Products 151

Rodríguez, A., Rodríguez, M., Martín, A., Delgado, J. and Córdoba, J. J. (2012d). Pres-
ence of ochratoxin A on the surface of dry-cured Iberian ham after initial fungal
growth in the drying stage. Meat Science, 92, 728–734.
Rodríguez, A., Werning, M. L., Rodríguez, M., Bermúdez, E. and Córdoba, J. J. (2012e).
Quantitative real-time PCR method with internal amplification control to quan-
tify cyclopiazonic acid producing molds in foods. Food Microbiology, 32, 397–405.
Rodríguez-Lázaro, D., Gonzalez-García, P., Gattuso, A., Gianfranceschi, M. V. and Her-
nandez, M. (2014). Reducing time in the analysis of Listeria monocytogenes in meat,
dairy and vegetable products. International Journal of Food Microbiology, 184, 98–105.
Rodríguez-Lázaro, D. and Hernández, M. (2013). Real time PCR in food science:
Introduction. Current Issues in Molecular Biology, 15, 25–38.
Rodríguez-Lázaro, D., Jofre, A., Aymerich, T., Hugas, M. and Pla, M. (2004). Rapid
quantitative detection of Listeria monocytogenes in meat products by real-time
PCR. Society, 70, 6299–6301.
Satterfield, B. A., Stewart, A. F., Lew, C. S. et al. (2010). A quadruplex real-time PCR
assay for rapid detection and differentiation of the Clostridium botulinum toxin
genes A, B, E and F. Journal of Medical Microbiology, 59, 55–64.
Scheutz, F., Teel, L. D., Beutin, L. et al. (2012). Multicenter evaluation of a sequence-
based protocol for subtyping shiga toxins and standardizing stx nomenclature.
Journal of Clinical Microbiology, 50, 2951–2963.
Sharma, N. K, Rees, C. E. D., Christine, E. R. and Dodd, C. E. R. (2000). Development
of a single-reaction multiplex PCR toxin typing assay for Staphylococcus aureus
strains. Applied and Environmental Microbiology, 66, 1347–1353.
Singh, P. and Mustapha, A. (2015). Multiplex real-time PCR assays for detection of
eight shiga toxin-producing Escherichia coli in food samples by melting curve
analysis. International Journal of Food Microbiology, 215, 101–108.
Szabo, K., Trojnar, E., Anheyer-Behmenburg, H. et al. (2015). Detection of hepatitis E
virus RNA in raw sausages and liver sausages from retail in Germany using an
optimized method. International Journal of Food Microbiology, 215, 149–156.
Theoret, J. R., Cooper, K. K., Zekarias, B. et al. (2012). The Campylobacter jejuni Dps
homologue is important for in vitro biofilm formation and cecal colonization of
poultry and may serve as a protective antigen for vaccination. Clinical and Vac-
cine Immunology, 19, 1426–1431.
Thermo Scientific. (2016). T042-TECHNICAL BULLETIN NanoDrop Spectro-
photometers, Assessment of Nucleic Acid Purity. Available at http://www
.nanodrop.com/Library/T042-NanoDrop-Spectrophotometers-Nucleic-Acid-
Purity-Ratios.pdf (accessed 23 May 2016).
Thisted Lambertz, S., Nilsson, C. and Hallanvuo, S. (2008a). TaqMan-based real-time
PCR method for detection of Yersinia pseudotuberculosis in food. Applied and Envi-
ronmental Microbiology, 74, 6465–6469.
Thisted Lambertz, S., Nilsson, C., Hallanvuo, S. and Lindblad, M. (2008b). Real-time
PCR method for detection of pathogenic Yersinia enterocolitica in food. Applied
and Environmental Microbiology, 74, 6060–6067.
VanGuilder, H. D., Vrana, K. E. and Freeman, W. M. (2008). Twenty-five years of quan-
titative PCR for gene expression analysis. BioTechniques, 44, 619–626.
Velasco, V., Sherwood J.S., Rojas-García P.P., Logue, C.M. Multiplex Real-Time PCR
for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin
(PVL) Genes from Selective Enrichments from Animals and Retail Meat. PLOS
ONE 9, e97617.
152 Advanced Technologies for Meat Processing, Second Edition

Velusamy, V., Arshak, K., Korostynska, O., Oliwa, K. and Adley, C. (2010). An over-
view of foodborne pathogen detection: In the perspective of biosensors. Biotech-
nology Advances, 28, 232–254.
Verhaegen, B., Van Damme, I., Heyndrickx, M. et al. (2016). Evaluation of detection
methods for non-O157 shiga toxin-producing Escherichia coli from food. Interna-
tional Journal of Food Microbiology, 219, 64–70.
Wang, H., Dong, Y., Wang, G., Xu, X. and Zhou, G. (2016). Effect of growth media on
gene expression levels in Salmonella typhimurium biofilm formed on stainless
steel surface. Food Control, 59, 546–552.
Wolffs, P., Norling, B., Hoorfar, J., Griffiths, M. and Radström, P. (2005). Quantification
of Campylobacter spp. in chicken rinse samples by using flotation prior to real-
time PCR. Applied and Environmental Microbiology, 71, 5759–5764.
Yadav, A. S., Saxena, G. K., Saxena, V. K. and Kataria, J. M. (2016). Study on heat stress
response in Salmonella typhimurium and Salmonella enteritidis and its impact on
their attachment to dressed broiler skin surface. Asian Journal of Animal and Vet-
erinary Advances, 11, 114–121.
Ye, K., Zhang, Q., Jiang, Y., Xu, X., Cao, J. and Zhou, G. (2012). Rapid detection of
viable Listeria monocytogenes in chilled pork by real-time reverse-transcriptase
PCR. Food Control, 25, 117–124.
Yoon, S. Y., Chung, G. T., Kang, D. H., Ryu, C., Yoo, C. K. and Seong, W. K. (2005).
Application of real-time PCR for quantitative detection of Clostridium botulinum
type A toxin gene in food. Microbiology and Immunology, 49, 505–511.
Zeaki, N., Cao, R., Skandamis, P. N., Rådström, P. and Schelin, J. (2014). Assessment
of high and low enterotoxin a producing Staphylococcus aureus strains on pork
sausage. International Journal of Food Microbiology, 182, 44–50.
Zell, C., Resch, M., Rosenstein, R., Albrecht, T., Hertel, C. and Götz, F. (2008). Charac-
terization of toxin production of coagulase-negative staphylococci isolated from
food and starter cultures. International Journal of Food Microbiology, 127, 246–251.
Zheng, Q., Mikš-Krajnik, M., Yang, Y., Xu, W. and Gyun Yuk, H. (2014). Real-time PCR
method combined with immunomagnetic separation for detecting healthy and
heat-injured Salmonella typhimurium on raw duck wings. International Journal of
Food Microbiology, 186, 6–13.
5
Sensors and Biosensors for Meat
Safety: Recent Advances in Nano-
technology Integration

Rosa Pilolli, Nicoletta Ditaranto, and Linda Monaci

CONTENTS
5.1 Introduction ................................................................................................ 154
5.1.1 Nanomaterial Implementation for Enhanced Sensing
Performance .................................................................................... 156
5.2 Advances in Screening Methods for Meat Contamination
Monitoring .................................................................................................. 157
5.2.1 Microbial Contamination ............................................................. 157
5.2.1.1 Optical Fibers and Microarrays .................................... 159
5.2.1.2 FTIR Spectroscopy .......................................................... 164
5.2.1.3 Light-Scattering Sensors ................................................ 166
5.2.1.4 Hyperspectral Imaging .................................................. 166
5.2.1.5 Latest Trends in Optical Sensors .................................. 166
5.2.1.6 Electrochemical and Electromechanical
Sensors .............................................................................. 167
5.2.1.7 Electronic Nose-Based Sensors ..................................... 169
5.2.1.8 Advances in Nanotechnology Integration for
Microbial Contamination............................................... 171
5.2.2 Chemical Contamination .............................................................. 172
5.2.2.1 Veterinary Drug Residues: Overview and
Legislative Frame ............................................................ 173
5.2.2.2 Optical Sensors ................................................................ 177
5.2.2.3 Electromechanical Sensors ............................................ 183
5.2.2.4 Advances in Nanotechnology Integration for
Chemical Contamination ............................................... 184
5.3 Concluding Remarks ................................................................................. 187
References............................................................................................................. 187

153
154 Advanced Technologies for Meat Processing, Second Edition

5.1 Introduction
Meat is an important constituent of the human diet and is consumed world-
wide mainly because of its valuable nutrients such as protein, fat, iron, zinc,
niacin, and vitamins B6 and B12, all of which are essential for balanced and
healthy nutrition. However, both meat and poultry can also become a vehicle
of human foodborne diseases, mainly due to the potential contamination of
food from chemical and biological hazards. In spite of extensive food safety
regulations and excellent monitoring systems in the food industry, one of
the greatest challenges for authorities is the control of foodborne diseases.
The number of foodborne outbreaks associated with eating meat and poul-
try products is still raising intense consumer concern about meat safety. The
continuous developments in livestock practices have posed newer threats
in terms of physical, chemical, and biological hazards for the final product
quality and related consumer health. New risks, in addition to the most com-
mon pathogens, toxins, drugs, pesticides, and heavy metals, have emerged
in recent years due to indiscriminate agriculture and animal husbandry
practices causing serious health implications in terms of causing illness.
The more quality and safety are challenged, the more stringent tools are
needed to monitor effectively the contamination and to provide marketable
products according to prescribed standard parameters. Traditional analyti-
cal methods, such as culture and colony counting for pathogen monitoring or
liquid chromatography (LC)–tandem mass spectrometry, for the detection of
chemical contaminants are still widely used in the meat industry to preserve
food safety and quality. However, most of them are time consuming (up to
several days), and they are sometimes expensive and require strict adherence
to protocol, complicated procedures, and trained personnel. Increase in meat
production and threat of contamination have led the industry to pursue rapid
and innovative methods of analysis to safeguard the health and safety of con-
sumers. In this context, sensor technology is nowadays gaining more interest,
as it is perceived to comprise several advantages over conventional methods
such as cost-effectiveness and the possibility for real-time and on-site analysis.
Physical and biological sensors (biosensors) are the two most promising
technologies that might fit this purpose. According to the International Union
of Pure and Applied Chemistry, a chemical sensor is “a device that transforms
chemical information, ranging from the concentration of a specific sample
component to total composition analysis, into an analytically useful signal.
The chemical information, mentioned above, may originate from a chemi-
cal reaction of the analyte or from a physical property of the system investi-
gated” (Hulanicki et al., 1991). Biosensors are “chemical sensors in which the
recognition system utilizes a biochemical mechanism” (Thevenot et al., 1999).
The recognition mechanism is crucial in biosensing performance. For a long
time, recognition elements, such as enzymes or antibodies, isolated from
living organisms were preferred for their unquestionable selectivity and
Sensors and Biosensors for Meat Safety 155

specificity, but new artificial and/or engineered recognition elements, such

as aptamers, molecularly imprinted polymers (MIPs), phages, and affibodies,
were recently tested and improved for their implementation in chemical sen-
sors and biosensors (Table 5.1). Most of these alternative recognition elements

TABLE 5.1
Advantages and Limitations of Recognition Elements in Chemical Sensors and
Biosensors
Recognition Elements Sensor Designation Advantages Limitations
Classical Enzymes Enzymatic biosensor Specificity Purification is costly
and time consuming
– Simple apparatus Poor stability
and procedures
– – Efficient only at
optimum pH and
temperature
Antibodies Immunosensor High affinity Limited target (protein)
– Specificity Laborious production
– – Production requires
use of animals
– – Lack of stability
Nucleic acid Genosensor Stability Limited target
(complimentary
nucleic acid)
Whole cells Whole cell biosensor Low-cost –
preparation
Reduced purifica- –
tion requirements
Recent Phages Phage biosensor Specificity and Laborious selection
sensitivity
Stability Skilled personnel
required for selection
Aptamers Aptasensor Easy to modify Laborious selection
– Possibility to Affinity constant not
design structure always comparable to
the relevant antibody
– Possibility to –
denaturalize and
to rehybridize
– Possibility to –
distinguish
targets with
different
functional groups
– Thermally stable –
– In vitro synthesis –

(Continued)
156 Advanced Technologies for Meat Processing, Second Edition

TABLE 5.1 (Continued )

Advantages and Limitations of Recognition Elements in Chemical Sensors and
Biosensors
Recognition Elements Sensor Designation Advantages Limitations
MIPs MIP sensor High thermal, Complex fabrication
chemical, and methodology
mechanical
tolerance
– Reusability Time-consuming
process
– Low cost Incompatibility with
aqueous media
– – Leakage of template
molecules
Affibodies Affibody sensor Lack of disulfide –
bonds that
enables
intracellular
applications
– Long shelf life –
MIPs, molecularly imprinted polymers.

were initially devised to reduce the cost of production but a few of them were
proved comparable in term of selectivity with traditional solutions.
Together with the discovery of new recognition elements, the integration of
nanotechnology has contributed to progress in sensor performance (Inbaraj
and Chen, 2016; Cho et al., 2014; Warriner et al., 2014). In the following sec-
tions, an overview of the most recent and relevant achievements in the devel-
opment of analytical methods for chemical and biological contamination
monitoring in meat samples is provided. The contribution will start from the
critical discussion of consolidated sensing platforms, and then widen to the
new trends and advances achieved by nanotechnology integration.

5.1.1 Nanomaterial Implementation for Enhanced Sensing Performance

The development of novel sensors and biosensors targeted to the food
industry has gained a growing interest over the years and represents one
of the key fields that has pushed the development of nanobiotechnology
and nanomaterial science. The sensing capacity of the detection systems
is being improved by employing nanomaterials due to their unique physi-
cal and chemical properties. When used in electrical biosensors, they pos-
sess a very high capacity for charge transfer, which makes them suitable to
reach lower detection limits and higher sensitivity values. Nanomaterials
can also contribute as labels or transducers modifiers so as to improve the
performance of the biosensor. Some of the reported nanomaterials are quan-
tum dots: they are crystalline clusters in the nanometer range that can be
Sensors and Biosensors for Meat Safety 157

synthesized from semiconductor materials. If so, their exceptional optical

properties (such as high quantum yield, high molar extinction coefficients,
high resistance to photobleaching, and exceptional resistance to photo and
chemical degradation) make them one of the most interesting materials for
bioimaging, labeling, and sensing. Similarly, carbon nanotubes (CNTs) and
metal nanoparticles (NPs) (AuNPs, AgNPs, etc.) have attracted considerable
attention for the assembling of novel electrochemical biosensing systems
due to their excellent conductivity and electrocatalytic activity, high surface/
volume ratio, and their ability to be functionalized. Thanks to these incom-
parable properties, nanobiosensors can achieve very low detection limits
(even single molecule or cell), can be easily implemented in portable devices,
and may ensure higher stability compared to the usual enzymes or dyes
employed in the classical methods/devices. In recent years, novel nanoma-
terials have been greatly used in modifying electrode surfaces to achieve
a faster electron transfer of biomolecules. The introduction of nanomate-
rials into electrochemical sensors also brings further advantages such as
decreased overpotentials, ensuring the reversibility of some redox reactions,
which are irreversible at unmodified electrodes, and novel labeling opportu-
nities including multidetection capabilities (Pérez-Lόpez and Merkoçi, 2011).

5.2 Advances in Screening Methods for

Meat Contamination Monitoring
5.2.1 Microbial Contamination
Foodborne diseases can often be caused by the consumption of food contami-
nated by pathogenic microorganisms such as bacteria, viruses, parasites, and
related toxins. Conventional methods for detecting pathogens include micros-
copy-, nucleic acid-, and immunoassay-based techniques. The gold standard for
food pathogen detection is colony counting (CFU) on an agar plate, which takes
two to three days for initial results, and up to one week for confirming pathogen
specificity. In addition, with the progress made in DNA management and poly-
merase chain reaction (PCR) researcher attention was moved from targeting
the microorganism itself to targeting specific genes. Although the PCR-based
techniques and several other molecular diagnostics are highly sensitive and
selective, they require undamaged DNA, experienced personnel, and expen-
sive equipment as well as reagents, thus making the overall cost of detection
high enough to prevent wide-scale application. As an alternative, immunoas-
says can be preferred, such as enzyme-linked immunosorbent assays (ELISAs)
and Western blot analyses, targeting specific proteins or carbohydrate moieties
related to pathogens (Gopinath et al., 2014), providing high sensitivity and
molecular fingerprinting of the pathogen. Still, the major enduring limitation
of such traditional detection methods is time to results. In Figure 5.1, a scheme
of conventional and innovative methods for pathogen detection is presented as
 158
Pathogen detection schemes

Whole organism Peptides/proteins Nucleic acids Lipopolysaccharides Metabolites

Conventional Conventional Conventional Conventional Conventional

methods: methods: methods: methods: methods:
• Cell culture using agar • PCR followed by • Radio labeled CO2
• Immunofluorescence • Limulus amebocyte
or broth medium - Gel electrophoresis release by culture
• Enzyme immunoassay assay
• Immunofluorescence • Detect O2 tension
- Restriction endonu- • Cell-based assays
• Enzyme immunoassay (ESP® culture)
clease digestion
• Latex agglutination • EndoLISA • Acidified pH check
- Dot blots
- High-pressure liquid • Pyrogene rFC assay • GC–MS
Current technologies: chomatography
Current technologies: • Microfluidic ELISA
- Electrochemilumines-
• Elastic light scattering • Optofluidic biosensors cence Current technologies: Current
• Phage-based methods • SPR biosensor - Direct sequencing technologies:
• Limulus amebocyte
• SPR biosensor • Photonic crystal assay • Impedance biosensors
biosensors
• Micro/nano devices • Nanoparticle methods • Cell-based assays • Gas microsensors
• Aptamer-based method Current technologies: • Microcalorimetry
• FT-IR
• EndoLISA
• Nanoparticlemethods • Raman spectroscopy • Microfluidic PCR • Microfluidic pH
• Ramanspectroscopy • Microelectrode arrays • Pyrogene rFC assay sensors
• Phage-based methods
• Lateral flow assay • Nanoparticle methods
• Micro/nano devices
• Nanopore sequencing
• Aptamer-based method
• FTIR
• Mass spectrometry
• Phage-based methods
• Micro/nano devices

FIGURE 5.1
Overview of pathogen detection techniques. ELISA, enzyme-linked immunosorbent assay; FTIR, Fourier transform infrared spectroscopy; GC–MS,
Advanced Technologies for Meat Processing, Second Edition

gas chromatography–mass spectrometry; PCR, polymerase chain reaction; rFC, recombinant factor C; SPR, surface plasmon resonance.
Sensors and Biosensors for Meat Safety 159

a general overview. Rapid detection of food pathogens is challenging because

microorganisms need to be recovered from food matrices, differentiated from
nonpathogenic microorganisms, and then detected and quantified. This is a big
issue for both industry and regulatory agencies because products with short
shelf life may spoil before test results are available and because time is critical
when identifying and controlling foodborne disease outbreaks.
Food contamination can be spoted by direct targeting of the pathogen itself
or by indirect detection of specific metabolites produced by the biochemi-
cal processes occurring into the microorganism. In the following sections,
some of the most recent and representative investigations on the develop-
ment of sensing platforms for microbial contamination in meat samples are
presented; particular attention is devoted to sensors already tested on real
samples and on enhancement. The works have been classified based on the
transduction mechanism employed for the detection, and the main features
of each investigation are itemized in Table 5.2.

5.2.1.1 Optical Fibers and Microarrays

Among the various phenomena exploited for optical detection, fluorescence,
chemiluminescence and absorbance measurements by optical fibers or
microarray configurations, and Fourier transform infrared (FTIR) spectros-
copy represent the most well-established approaches for meat contamination
monitoring. More recently, light scattering and hyperspectral imaging (HI)
have been proposed as alternative optical transductions in sensing platforms
for their potential to combine spectral and spatial information of the food
sample under investigation.
Biosensors based on optical fiber exploit a tapered fiber in total internal reflec-
tion operating mode, to send excitation laser light signals to the detection sur-
face and receive emitted light. Light propagation through a fiber or waveguide
can be a very sensitive phenomenon, which makes the optical fibers excellent
detectors for a variety of applications in the industry, especially the detection
of pathogenic organisms. A portable evanescent-wave fiber-optic biosensor
to detect Escherichia coli O157:H7 in seeded ground beef samples was demon-
strated by DeMarco and Lim (2002), reporting 100% correct identification of
positive samples obtained at 9.0 × 103 CFU/g for 25 g and at 5.2 × 102 CFU/g
for 10 g ground beef samples with silica and polystyrene waveguides, respec-
tively. Similarly, Liu et al. (2003) developed a biosensor, consisting of a chemi-
luminescence reaction cell, a fiber-optic light guide, and a luminometer linked
to a personal computer, in conjunction with immunomagnetic separation for
rapid detection of E. coli O157:H7. The chemiluminescence biosensor was selec-
tive toward E. coli O157:H7 even in the presence of other bacteria in the sample,
including Salmonella typhimurium, Campylobacter jejuni, and Listeria monocyto-
genes. The authors could detect E. coli O157:H7 in ground beef and chicken car-
cass, with detection limits of 3.2 × 102 and 4.4 × 102 CFU/g, respectively, and
time to results of 1.5 hours without any enrichment. Another fiber-optic portable
TABLE 5.2
160

Summary of Sensors for Microbial/Fungal Contamination Detection

Transduction Nanomaterial Recognition
Target Analyte System Integration Food Matrix Element Reference
Salmonella typhimurium Optical fiber None Ground pork samples Antibody Ko and Grant (2006)
(fluorescence)
S. typhimurium e-nose None Fresh beef None Balasubramanian et al. (2008)
S. typhimurium SPR biosensor None Chicken carcass Antibody Lan et al. (2008)
Salmonella enterica Optical fiber None Shell egg and chicken Antibody Valadez et al. (2009)
(fluorescence) breast
Listeria monocytogenes Optical fiber None Ready-to-eat beef, Antibody– Ohk et al. (2010)
(fluorescence) chicken, and turkey aptamer
L. monocytogenes, Escherichia coli O157:H7 Optical fiber None Ready-to-eat beef, Antibody Ohk and Bhunia (2013)
and S. enterica (fluorescence) chicken, and turkey
meats
E. coli O157:H7 FTIR None Ground beef None Davis et al. (2010a)
S. typhimurium QCM None Chicken Antibody Su and Li (2005)
S. typhimurium e-nose None Beef strip loins None Balasubramanian et al. (2005)
S. typhimurium e-nose None Beef strip loins None Balasubramanian et al. (2008)
E. coli O157:H7 FTIR None Ground beef None Davis et al. (2010b)
S. typhimurium FTIR None Beef None Amamcharla et al. (2010)
S. typhimurium, Salmonella dublin, Optical microar- None Pork ss-DNA Bai et al. (2010)
Salmonella thompson, Staphylococcus ray
aureus, Yersinia enterocolitica, L. monocyto-
genes, Shigella flexneri, Shigella bogdii,
Campylobacter jejuni, E. coli O157:H7,
Vibrio parahaemolyticus, Vibrio cholerae,
Enterobacter sakazakii, Pseudomonas
aeruginosa
Advanced Technologies for Meat Processing, Second Edition

(Continued)
TABLE 5.2 (Continued)
Summary of Sensors for Microbial/Fungal Contamination Detection
Transduction Nanomaterial Recognition
Target Analyte System Integration Food Matrix Element Reference

Toxigenic Penicillum nordicum e-nose None Ham None Leggieri et al. (2011)
L. monocytogenes BARDOT None Hotdog Protein 60 Koo et al. (2011)
light-scattering
sensor
Salmonella QCM None Beef Odorant- Sankaran et al. (2011)
binding
protein
S. typhimurium e-nose None Beef strip loin None Balasubramanian et al. (2012)
Salmonella e-nose None Beef Peptide Panigrahi et al. (2012)
S. typhimurium Electrochemical None Pork Antibody Kim et al. (2013)
Sensors and Biosensors for Meat Safety

impedence
spectroscopy
E. coli K12 Mie scattering None Ground beef None Liang et al. (2014)
(smartphone)
Salmonella and Campylobacter DVD microarray None Chicken ss-DNA Tortajada-Genaro et al. (2015)
Campylobacter Square wave None Chicken ss-DNA Morant-Miñana and Elizalde
voltammetry (2015)
C. jejuni and Campylobacter coli BARDOT None Chicken None He et al. (2015)
light-scattering
sensor
P. nordicum e-nose Nose Dry-cured meats None Lippolis et al. (2016)
Y. enterocolitica Differential pulse Chitosan/ Pork ss-DNA Sun et al. (2010)
voltammetry nano-V2O5/
MWCNTs

(Continued)
161
TABLE 5.2 (Continued)
162

Summary of Sensors for Microbial/Fungal Contamination Detection

Transduction Nanomaterial Recognition
Target Analyte System Integration Food Matrix Element Reference

Salmonella Electrochemical GO and gold Pork Aptamer Ma et al. (2014)

impedence NPs
spectroscopy
S. aureus Differential PbS NPs Beef ss-DNA Abdalhai et al. (2014)
pulse MWCNTs
voltammetry
E. coli O157:H7 Differential CdS NPs Beef ss-DNA Abdalhai et al. (2015)
pulse MWCNTs
voltammetry
Shiga toxin-producing E. coli Microarray Gold NPs Ground beef ss-DNA Quintela et al. (2015)
(absorbance)
E. coli O157:H7 Portable None Beef Antibody De Marco and Lim (2002)
evanescent-
wave fiber-
optic
E. coli O157:H7 Chemilumines- None Ground beef, Antibody Liu et al. (2003)
cence chicken carcass,
fiber-optic and lettuce samples
biosensor
S. typhimurium FRET-based None Pork Antibody Ko and Grant (2006)
optical fiber
Salmonella Electrochemical Gold NPs Pork Antibody Yang et al. (2009)
impedance
spectroscopy
BARDOT, bacterial rapid detection using optical scattering technology; CNT, carbon nanotubes; FRET, fluorescence resonance energy transfer; FTIR,
Fourier transform infrared spectroscopy; GO, graphene oxide; MWCNTs, multiwalled carbon nanotubes; NP, nanoparticle; SPR, surface plasmon
Advanced Technologies for Meat Processing, Second Edition

resonance; QCMs, quartz-crystal microbalances.

Sensors and Biosensors for Meat Safety 163

biosensor working on the principle of fluorescence resonance energy transfer

(FRET) for rapid detection of S. typhimurium in pork samples was reported in
2006 by Ko and Grant. Valadez et al. (2009) also achieved a limit of detection
(LOD) of 102 CFU/mL for Salmonella enterica in egg and chicken after six hours
enrichment by a fiber-optic biosensor integrating a fluorescently labeled second-
ary antibody. Ohk et al. (2010) described an alternative, optical (fluorescence)
based, fiber-optic approach in which they used a capture antibody and a flu-
orescently labeled aptamer to sandwich L. monocytogenes with an LOD of 102
CFU/25 g in ready-to-eat meat samples. The investigation was recently updated
with the same authors achieving multiplexing: L. monocytogenes, E. coli O157:H7,
and S. enterica were simultaneously detected in a single assay (Ohk and Bhunia,
2013). Optical waveguides were functionalized with polyclonal antibodies and
exposed to bacterial suspensions or enriched food samples (ready-to-eat beef,
chicken, and turkey meats) for two hours. Pathogens were detected after react-
ing with Alexa-Fluor 647-labeled monoclonal antibodies (McAbs). The biosensor
was able to detect each pathogen, individually or in a mixture with very little
cross-reactivity. The LOD for the sensor was 103 CFU/mL for all three patho-
gens. Furthermore, the biosensor successfully detected each pathogen, grown
in a mixture from enriched meat samples in under 24 hours.
Optical microarrays have been quite popular sensing solutions in recent
decades for several application fields mainly due to the high multiplexing
capabilities and easy read-out not requiring expensive equipment. A few
investigations dealt with the detection of microbiological contamination in
meat samples, mainly based on the detection of specific DNA target genes
preliminarily amplified by PCR.
Bai et al. (2010) described the development of a silicon-based optical thin-
film biosensor for the detection of 11 foodborne pathogens, in pork meat, using
a microarray approach with biospecific DNA probes immobilized on a sensor
surface. Specific probes with aldehyde moieties were arrayed and covalently
attached to a hydrazine-derivatized chip surface, and then the biotinylated
PCR products were hybridized with their relevant probes. To complete the
sandwich assay format, anti-biotin IgG conjugated to horseradish peroxidase
(HRP) was then passed over the surface, followed by substrate, which allowed
the detection of the target DNA sequence as a concentration-dependent color
change on the surface of the optical biosensor. Interestingly, the detection of
PCR fragment targets took only 30 minutes. Very recently, a novel microar-
ray biosensor was presented for identification and genotyping of Salmonella
and Campylobacter in meat products (Tortajada-Genaro et al., 2015). Also, this
method was based on a DNA microarray developed on a standard DVD as
support for the hybridization assay and a DVD driver as scanner; a scheme of
the set up was presented in Figure 5.2. This approach was found to be highly
sensitive, reproducible, and, interestingly, high working capacity (20 samples
per disc). One hundred isolates from meat samples, collected in a poultry fac-
tory, were analyzed by the DVD microarraying and fluorescent real-time PCR.
An excellent correlation was observed for both generic and specific.
164 Advanced Technologies for Meat Processing, Second Edition

DVD method Reference method

DVD disc hns Sdf STM 16S hipO CeuE hns Sdf STM 16S hipO CeuE
Laser C– C+ 1 + + – – – –
λ = 650 nm 2 + + + – – –
ceuE 3 + – – – – –
hipO 4 – – – + – –
16S 5 – – – + + –
STM4497 – + + –
6 – –
Rotatory Optical pick-up sdf
7 – – – + + –
motor assembly hns
8 – – – + + –
(a) (b) 9 + + + + + –
10 – – – + + –
S. Enteridis C. Typhimurium 11 – – – + + –
C+ C+ 12 – – – + + +
ceuE ceuE 13 – – – + + +
hipO hipO 14 – – – + + –
16S 16S
STM4497 STM4497 15 – – – + + –
sdf sdf 16 – – – + + –
hns hns 17 – – – + – –
C. jeujuni C. coli 18 – – – + – +
C+ C+
19 – – – + – +
20 – – – + + –
ceuE ceuE
hipO hipO 21 – – – + + –
16S 16S 22 – – – + + –
STM4497 STM4497 23 – – – + + –
sdf sdf 24 + – + – – –
hns hns 25 + + – – – –
(c) (d) (e)

FIGURE 5.2
(a) Scheme of reading principle by a DVD drive: the reflections of the laser beam following
the spiral track are converted into electrical pulses and collected by a data acquisition card.
(b) Microarray layout: inter-spot distance 1.5 mm, spot diameter 0.55 mm. C−: negative con-
trol, noncomplementary probe; C+: positive control, digoxigenin-labeled probe. (c) Microar-
ray images obtained for pure cultures (pathogen concentration 16 × 103 CFU/μL). (d) Results
for 25 poultry samples with positive presence of pathogens (color scheme based on optical
densities registered by DVD drive: mid-grey-positive, light-grey positive with a low signal
(concentration <102), grey-positive with an intermediate signal (concentration 102–104), dark
grey-positive with a high signal (concentration >104). (e) Results of reference methods (quan-
titative polymerase chain reaction [qPCR] and microbiological/biochemical analysis) are
expressed as positive presence (+) or negative presence. (With kind permission from Springer
Science+Business Media: Analytical and Bioanalytical Chemistry, Microarray on digital versatile
disc for identification and genotyping of Salmonella and Campylobacter in meat products, 407,
2015, 7285–7294, Tortajada-Genaro, L. A. et al.)

5.2.1.2 FTIR Spectroscopy

Fourier transform infrared (FTIR) spectroscopy is another technique with
considerable potential for application in foodborne pathogen optical detec-
tion. Among the first applications, in 2002 Ellis et al. reported on an FTIR-
based method used directly on the food surface to produce biochemically
interpretable fingerprints of meat substrate. The strength of this approach
relies on the potential to enhance and accelerate the detection of microbial
spoilage. Quantitative interpretation of FTIR spectra was possible using par-
tial least squares (PLSs) regression, which provided accurate estimates of
bacterial loads calculated directly from the meat surface in 60 s (Ellis et al.,
2002).
Since then, the use of FTIR techniques coupled with different chemometric
analyses has been expanded and successfully applied to detect, discriminate,
identify, and classify bacteria belonging to different species, including food-
borne pathogens such as Listeria (Davis et al., 2011), E. coli (Kim et al., 2006a;
Sensors and Biosensors for Meat Safety 165

Mura et al., 2012; Davis et al., 2012), and Salmonella (Kim et al., 2006b). Detecting
pathogenic bacteria in food using FTIR has been done using direct and indi-
rect methods, although the indirect approach is most common. In the direct
method, infrared (IR) spectra of the contaminated food are collected directly
from the sample and compared with the spectra of a blank (uncontaminated)
sample. If successful, direct analyses could enable near real-time food analysis
because spectral acquisition requires at most five minutes. The presence of a
new absorbance peak and/or a change in peak intensity compared to baseline
spectra of uncontaminated sample may indicate the presence of a pathogen.
However, in many cases, the spectra collected in a direct method contain a
complex spectral background owing to the presence of food matrix, which
challenges the spectral interpretation. Indirect detection reduces or eliminates
this spectral background from food by using a bacterial separation step such
as filtration or immunomagnetic separation prior to spectral acquisition.
Concerning microbial contamination monitoring, beside the total bacterial
amount, specific information about their viability is also of major concern in
the food industry because injured bacteria pose a significant health threat if
they propagate during food distribution and storage. Since FTIR methods rely
on the analysis of the biochemical composition of cells, they may be used to
differentiate live and dead microorganisms. As an example, Davis et al. (2010b)
used an FTIR method coupled with filtration and immunomagnetic separa-
tion to discriminate heat-killed E. coli O157:H7 in ground beef. Differences in
the spectra were very small and occurred mainly in the amide and nucleic
acid regions, likely generated by heat-induced denaturation of these biomol-
ecules in the killing step. For discrimination studies, second derivative spectra
were generated to increase the number of distinctive spectral features, and
principal component analysis was used to successfully classify live and dead
E. coli O157:H7. A similar approach was also successfully employed by the
same authors for the detection and differentiation of live and heat-treated S.
enterica serovars inoculated onto chicken breast (Davis et al., 2010a).
In general, microbial contamination can be spotted not only by detection
of the offending microorganism itself but also via detection of volatile com-
pounds produced by its metabolism. As an example of such an approach,
Amamcharla et al. (2010) proposed an interesting investigation based on the
FTIR fingerprinting of headspace volatile compounds in packaged meat to
discriminate Salmonella-contaminated packed commodities. A suitable head-
space sampling setup was designed to collect the headspace volatiles from
the packed meat to the FTIR gas cell (Amamcharla et al., 2010). The whole
FTIR spectrum was divided into several regions, based on the absorbance
properties of various volatiles components in the headspace of meat package.
Principal component analysis was performed on the entire spectrum (4000–
500 cm−1) as well as on the selected subregions of entire spectrum. Two sta-
tistical classification techniques (linear and quadratic discriminate analysis)
were used to develop classification models for nondestructive discrimination
of Salmonella-contaminated packed beef samples from uncontaminated ones.
166 Advanced Technologies for Meat Processing, Second Edition

5.2.1.3 Light-Scattering Sensors

Light-scattering sensors measure the spatial distribution of the scattered
light from an object, captured by a photodetector, photomultiplier tube
(PMT), or charge-coupled device (CCD): the PMT provides high signal
gain through signal amplification and is typically used as a point detector,
whereas a CCD collects the two-dimensional (2D) spatial distribution of scat-
tered light, allowing the sample imaging. A light-scattering device called
BARDOT (bacterial rapid detection using optical scattering technology) that
utilizes a 635 nm laser and a CCD detector was firstly developed by Purdue
University to capture 2D scattering patterns from bacterial colonies grown
on agar medium (Bae et al., 2007; Banada et al., 2007). It directly applies the
laser beam to the center of a colony and creates a circular symmetric scatter
pattern without destroying the cells; the resulting forward light-scattered
image is automatically captured by a CCD sensor. Depending on the colony’s
physical characteristics (size, shape, and refractive index), cell surface chemi-
cal compositions, and the interactions with different agar media, scatter
patterns distinctive among bacterial species can be produced. These light-
scattering images are automatically processed via software for image fea-
tures extraction and analysis associated with the BARDOT instrument and
bacterial classification can be accomplished at the genus, species, and serovar
level based on their similarity to known scatter patterns in a library. Very
recently, a novel BARDOT-based sensor was proposed for high-throughput
screening of Campylobacter colonies in spiked ground chicken and naturally
contaminated fresh chicken cuts. Combined with real-time PCR verification,
BARDOT was able to identify Campylobacter isolates from retail chicken.
Moreover, applying passive filtration to food samples facilitated the isolation
of pure Campylobacter colonies and therefore overcame the interference from
the food matrix (He et al., 2015).

5.2.1.4 Hyperspectral Imaging

HI represents an emerging technology based on light scattering, raising
interest for its ability of performing real-time assessment and spectral 2D
mapping. This technique integrates digital imaging and traditional spectros-
copy into a single system to achieve simultaneously both spatial and spectral
characterization from an object; such an approach is not detailed in this sec-
tion, because it is already the subject of Chapter 2 of this book.

5.2.1.5 Latest Trends in Optical Sensors

Among the latest trends in optical sensors, great attention has been paid to
smartphone integration in the sensing platform, due to its portability and
ubiquitous availability. The ubiquitous availability guarantees a convenient
and cost-effective acquisition of smartphones and a large number of poten-
tial subscribers for smartphone-based sensor systems. Smartphones can be
Sensors and Biosensors for Meat Safety 167

integrated in biosensing approaches as optical detectors for imaging and

optical intensity measurements thanks to their integrated cameras. Sev-
eral studies suggested that Mie scattering from a biomodified microparticle
scan be digitally imaged to report concentrations of proteins and bacteria
(San Park et al., 2013). Starting from this idea, Liang et al. (2014) developed
a reagentless approach using a smartphone to detect microbial spoilage on
ground beef (Figure 5.3). In their work, scanning electron microscopy (SEM)
and fluorescence microscopy experiments revealed that E. coli could change
the size and morphology of fat particles in beef, which modulated Mie scat-
tering in color. The smartphone was also used to record the color at differ-
ent angles for microbial spoilage detection without antibodies, microbeads,
or any other reagents. This study provided a promising approach to apply
smartphone-based color quantification in practical monitoring of microbial
contamination on food products.

5.2.1.6 Electrochemical and Electromechanical Sensors

By definition, an electrochemical biosensor is a self-contained integrated
device, which is capable of providing specific quantitative or semiquantitative

(a) (b) (c)

iPhone 4S
and holder

Angle of
Ground beef scatter detection
sample

NIR LED (d) (e)

and holder

FIGURE 5.3
(a) The benchtop system consists of an iPhone 4S and its holder, a near-infrared light-emitting
diode (NIR LED) and its holder, and a ground beef sample and its holder. The angle of scatter
detection refers to the angle between the iPhone camera and the NIR LED light source. Pho-
tographs showing the operation of the smartphone application at the four specific angles of
scatter detection: (b) 15°, (c) 30°, (d) 45°, and (e) 60°. (Reprinted by permission from Macmillan
Publishers Ltd., Scientific Reports, Liang et al., 2014, copyright 2014.)
168 Advanced Technologies for Meat Processing, Second Edition

analytical information using a biological-recognition element, which is

retained in direct spatial contact with an electrochemical transduction ele-
ment (Pilolli et al., 2013). Due to the low cost and ease of miniaturization,
electrochemical biosensors hold great promise for particular applications
where minimizing size and cost is crucial, such as online contamination
monitoring and point-of-care (POC) diagnosis.
Electrochemical biosensors can be classified into potentiometric, ampero-
metric, voltammetric, and impedance types. Potentiometric sensors have
been traditionally defined as zero-current devices that measure the poten-
tial across an interface, often a membrane. By contrast, both amperometry
and voltammetry are based on the measurement of current as a function
of applied electrode-solution voltage. During amperometric measurement,
the working electrode (i.e., the sensing electrode) is held at constant poten-
tial, while the current is monitored as a function of time and related to the
concentration of the analyte. During voltammetric measurement, the current
of the working electrode is recorded as a function of the potential. Several
types of experiment may be performed to gather information from voltam-
metry (e.g., cyclic, linear sweep, square wave, stripping, and pulse). Recently,
Morant-Miñana and Elizalde (2015) reported on the first electrochemical
genosensor based on thin-film gold electrodes deposited onto cyclo-olefin
polymer (COP) substrates for the detection of Campylobacter spp. in poultry
meat. This was presented as the last step for the fabrication of a Lab on a Chip,
integrating DNA sensor technology into a microfluidic system, believed to
perform an automated and complete assay, including sample preparation,
PCR amplification, and electrochemical detection of Campylobacter spp. in
real samples. The sensing element was characterized by several surface tech-
niques and provided a good linear relationship for the concentrations of PCR
amplicon of Campylobacter spp. between 1 and 25 nM with an LOD of 90 pM.
Impedance biosensors measure the electrical impedance of an interface by
imposing a small sinusoidal voltage at a particular frequency and measuring
the resulting alternating current. The current–voltage ratio gives the imped-
ance. The impedance of the interface may be measured at a single frequency
or at different frequencies, the latter approach known as electrochemical
impedance spectroscopy (EIS). An example of an impedimetric biosensor
to quantify S. typhimurium in meat was developed by Kim et al. in 2013. To
allow impedimetric biosensing, an interdigitated microelectrode was fabri-
cated by using a semiconductor fabrication process and a functionalization
with anti-Salmonella antibodies. A multivariate data analysis was performed
on the impedimetric responses. It was assessed that the PLS regression
model based on the whole frequency range produced better results than the
PLS model based on part of the frequency range or the univariate regression
model for the quantitative determination of S. typhimurium in PBS and pork
samples. The PLS model built with impedance data improved R2 to 0.85 and
0.89, and reduced the root mean square of error in prediction to 1.13 and 1.02
log CFU/mL for PBS and pork samples, respectively.
Sensors and Biosensors for Meat Safety 169

As electromechanical platforms, quartz crystal microbalances (QCMs)

demonstrated remarkable performance in biosensing such as high sensitiv-
ity and label-free detection. However, only a few examples of the application
of such approaches to meat contamination management can be found. In
QCM biosensors, the biological-recognition event generates a mass change
of the sensing layer, giving rise to a change in the resonant frequency of the
microbalance. Su and Li in 2005 demonstrated a QCM immunosensor for the
detection of S. typhimurium with simultaneous measurements of significant
changes in the resonance frequency and motional resistance. In the direct
detection of S. typhimurium in chicken meat sample, resonance frequency
and motional resistance were proportional to the cell concentration in the
range of 105–108 and 106 –108 cells/mL, respectively. Using anti-Salmonella
magnetic beads as a separator/concentrator for sample pretreatment as
well as a marker for signal amplification, the detection limit was lowered to
102 cells/mL based on the resistance measurement.

5.2.1.7 Electronic Nose-Based Sensors

Electronic noses (e-noses) have been applied to microbial contamination
detection as artificial olfactory systems to sense the volatile metabolites pro-
file that arise from various food products during bacteria growth. Four major
sensor technologies are currently used in commercially available e-noses—
metal–oxide–semiconductors (MOSs), metal–oxide–semiconductor field-
effect transistors (MOSFETs), conducting organic polymers (CPs), and
piezoelectric crystals (Loutfi et al., 2015). In food applications, MOS and CP
sensors are most commonly used. The output of MOS and CP sensors to a
target compound is represented by a resistance or voltage change caused by
two phenomena—one related to chemical interaction of the volatile compo-
nent with the sensor surface and the other related to electron transport. The
rate of change occurring due to these two phenomena defines the magnitude
of the sensor responses. Typically, the sensing element in MOS e-noses is
usually sensitive to a specific volatile organic compound (VOC) while those
of CP sensors are mostly nonspecific. The success and reliability of e-nose
systems for safety of food products through their headspace monitoring
depend to a large extent on appropriate statistical data analysis and pattern
recognition. These pattern recognition techniques help to construct a reliable
algorithm for discerning the “smell patterns” acquired from food products
for classification or prediction purposes. Smell patterns obtained from the
e-nose sensors can be analyzed using various statistical-based pattern rec-
ognition tools such as principal component regression, PLSs, factorial dis-
criminant analysis, cluster analysis, and linear and quadratic discriminant
analysis (Loutfi et al., 2015).
MOS- and CP-based sensors have been used individually with moderate
success in identifying spoilage and contamination in stored beef. Balasub-
ramanian et al. (2005) used a commercially available Cyranose-320™ e-nose
170 Advanced Technologies for Meat Processing, Second Edition

system to identify S. typhimurium in inoculated beef samples. An e-nose

containing an array of 32 conducting polymer sensors was used to obtain
the odor patterns of meat headspace emanated from vacuum-packaged
beef strip. The system was able to identify meat samples contaminated with
S. typhimurium at a population concentration level ≥0.7 log CFU/g. Starting
from these achievements, the same research group deepened the focus on
engineering intelligent olfactory sensors using various sensor techniques to
detect Salmonella contamination in packaged beef (Panigrahi et al., 2006a,b;
Balasubramanian et al., 2008, 2009). More recently, they also investigated the
potential of integrating the information from different sensing elements to
enhance the discriminatory power of the detection system. As a fact, the reli-
ability and efficiency in olfactory pattern recognition depend on the quality
of information obtained by the sensing system and the ability to discard
unnecessary information; thus combining information from different sens-
ing systems can increase the prediction capabilities (Steinmetz et al., 1996).
In 2012, they proposed the combination of sensor responses from two dif-
ferent e-nose systems, MOS and CP based, as a screening tool in order to
identify the presence of S. typhimurium in fresh beef strip loins (stored at
two temperatures) (Balasubramanian et al., 2012). The data from the two sys-
tems were ranked based on their Fisher criteria to evaluate their importance
in discriminant analysis. The most informative sensors were then used to
develop linear discriminant analysis and quadratic discriminant analysis-
based classification models.
In the last two decades, e-noses have been also successfully applied to early
detection of fungal growth and potential discrimination between toxigenic
and nontoxigenic strains in food samples. Focusing on meat contamination,
some examples can be found concerning fungal detection on the surface
of dry-cured meat products. Although the fungal colonization contributes
to the improvement of the final product quality, some uncontrolled fungal
development may also occur on these products causing undesirable altera-
tion and/or synthesis of mycotoxins, such as ochratoxin A (OTA). OTA is
a strong nephrotoxic agent and it has been shown to be teratogenic, muta-
genic, hepatotoxic, and immunosuppressive to animal species (EFSA, 2006).
Clearly, it becomes crucial to prevent and monitor possible contamination
of meat by OTA-producing species to avoid undesirable negative economic
impact and a potential health hazard to consumers. Penicillium nordicum is
the most important OTA-producing species frequently isolated from dry-
cured meats. Leggieri et al. (2011) demonstrated the potential use of e-nose
analysis to analyze qualitatively volatile patterns produced by P. nordicum
and discriminate between OTA-producing and nonproducing strains on a
ham-based medium. Very recently, Lippolis et al. (2016) presented another
investigation, which aimed at developing and validating an e-nose-based
method for early detection of OTA-producing and nonproducing strains
of Penicillium during the seasoning process of dry-cured meat. In particu-
lar, a MOS e-nose was initially trained by using yeast extract sucrose and
Sensors and Biosensors for Meat Safety 171

meat-based agar media inoculated with OTA-producing and nonproducing

strains of Penicillium. Afterwards multivariate statistical analysis was used to
discriminate the inoculated samples based on the pattern of VOCs. Finally,
the approach was validated in dry-cured meat samples produced both at the
laboratory (240 e-nose analyses carried out on inoculated sausages, seasoned
and sampled at 5, 7, 10, and 14 days) and at an industrial scale (60 dry-cured
meat samples produced by an industrial-scale seasoning process) showing a
total recognition percentage of 73%.

5.2.1.8 Advances in Nanotechnology Integration

for Microbial Contamination
The development of nanoscale materials such as nanowires (NWs), nanofi-
bers, NPs, nanobelts or nanorods (NRs), and nanotubes (NTs) has dramati-
cally changed clinical and molecular biology thanks to their significant use
as bioanalyzers. When nanomaterials are being used for the analysis of
pathogens, the recognition element in the (bio) sensing platform is typically
bound to the surface of the nanomaterial, and the interaction of this hybrid
with a pathogen is monitored through a signal transduction mechanism,
which explicitly detects the interaction between the pathogen and the recog-
nition element, improving the sensitivity of the analysis. Among the others,
Salmonella, E. coli, and Staphylococcus aureus are the most detected pathogens
with such an approach in food matrices. Yang et al. (2009) immobilized Sal-
monella spp. McAbs on AuNPs fabricating a capacitive immunosensor. They
detected the interaction using the EIS for the recognition of Salmonella spp. in
pork samples. The linear relationship between the relative change in capaci-
tance and logarithm of Salmonella concentration was obtained in the range of
1.0 × 102 to 1.0 × 105 CFU/mL. The lowest detection limit of Salmonella antigen
concentration was 1.0 × 102 CFU/mL. This capacitive immunosensor proved
to have the advantage of high nonspecific interactions and short analysis
time (40 minutes) in comparison with the PCR method. More recently, an
electrochemical biosensor was developed for Salmonella detection using a
Salmonella-specific recognition aptamer. The biosensor was based on a glassy
carbon electrode modified with graphene oxide (GO) and gold NPs. Then,
the aptamer ssDNA sequence was linked to the electrode. After incubation
of the modified electrode with Salmonella, the electrochemical impedance
spectrum was measured to quantify the Salmonella. The results revealed
an inverse correlation between Salmonella added to the reaction system and
the current between the electrode and electrolyte, with a detection limit as
low as 3 CFU/mL. In particular, the introduction of GO and AuNPs con-
ferred biocompatibility and high electron transfer to the sensor; moreover,
the aptamer sensor proved to have a very good selectivity and specificity
in the presence of L. monocytogenes, Bacillus subtilis, S. aureus, Streptococcus
pyogenes, E. coli, and Enterobacter sakazakii (Ma et al., 2014). Abdalhai et al.
(2014, 2015) developed electrochemical genosensors to detect S. aureus by
172 Advanced Technologies for Meat Processing, Second Edition

using lead sulfide NPs and E. coli O157:H7 using cadmium sulfide NPs. The
genosensors were prepared by immobilization of complementary DNA on
the gold electrode surface, which hybridizes with a specific fragment gene
from pathogenic to make a sandwich structure. The conductivity and sensi-
tivity of the sensor were increased by using multiwalled carbon nanotubes
(MWCNTs). The peak currents of microorganisms correlated in a linear fash-
ion with the concentration of tDNA. The detection limit was 1.97 × 10−14 M
and 3.17 × 10−14 M for E. coli and S. aureus, respectively. Both the DNA sensors
were successfully applied to the pathogens detection in beef samples, after
enrichment, extraction, and DNA amplification.
A direct detection of STEC was obtained by Quintela at al. (2015) by an
optical biosensing method using oligonucleotide-functionalized AuNPs.
This approach allowed a simultaneous visual discrimination and identifica-
tion of STEC DNA samples following DNA hybridization with highly spe-
cific thiol-modified probes immobilized on the surface of AuNPs. Stability
and reproducibility of this optical method were demonstrated using artifi-
cially inoculated pooled and individual ground beef and blueberry samples.
The detection limit was <1 log CFU/g requiring less than 1 hour to complete
and achieved 100% specificity.
The biocompatibility of some nanostructures and the excellent electron
transfer of carbon NTs have been properly exploited by Sun et al. (2010) in
the fabrication of an electrochemical DNA biosensor by using V2O5 nano-
belts (nano-V2O5), MWCNTs, and chitosan (CTS) nanocomposite materials
modified carbon ionic liquid electrode to detect Yersinia enterocolitica gene
sequence in pork meat. Differential pulse voltammetry (DPV) was used to
record the electrochemical response of the specific ssDNA sequence with a
detection limit as low as 1.76 × 10−12 mol/L.
Overall, the effective detection of pathogens in food samples can be facili-
tated by nanomaterial-based sensors. Although several classical and modified
methods have considerably reduced the incubation time, the nanomaterial-
based sensors can detect pathogens and toxins at very low concentrations as
they can react and produce a strong signal in a very short incubation time.
However, there is still a need for critical evaluation of nanomaterials toxicity as
pointed out in several papers (Inbaraj and Chen, 2016, and references therein).

5.2.2 Chemical Contamination

Chemical contamination of meat products can be caused by a large variety
of potential health hazards like veterinary drug residues, pesticide residues,
toxins, heavy metals, and anions. In this chapter, we focused the discussion
only on the first category given the wider existing literature devoted to sens-
ing platforms for detection of such contaminants. In fact, a lot of effort has
been spent in developing screening methods for drug residue detection in
real meat samples, achieving successful integration of nanotechnology for
enhancement of the performance.
Sensors and Biosensors for Meat Safety 173

5.2.2.1 Veterinary Drug Residues: Overview and Legislative Frame

Veterinary drugs are used in livestock to treat disease, promote growth,
and improve meat quality in terms of reducing fat and increasing lean meat
yield. Very small amounts of veterinary medicines or any related degrada-
tion product could accumulate in animal products and enter the food chain,
posing a risk factor for public health. The chemical structures of veterinary
drugs available are as diverse as their applications, but two main categories
can be identified for classification purposes basing on their function, anti-
biotics, and hormones. The extensive use of antibiotics in food-producing
animals has triggered the development of bacterial resistance (Novais et al.,
2010), which in recent years has become an international concern as a poten-
tial source of antibiotic-resistant bacteria in humans. In addition, the misuse
of hormone and growth promoters can cause drastic side effects in humans,
such as cramps or tremors in muscles.
Government regulatory authorities control the use of veterinary drugs by
approving or registering safe uses and monitoring food for unsafe or prohib-
ited residues, with a quite complex legislative frame. Within the European
Union (EU), legislation regarding the control of such drugs is given in Council
Directive 96/23/EC (European Commission, 1996), which establishes measures
to monitor certain substances and residues thereof, mainly veterinary medici-
nal products, in live animals and animal products, integrated by Commis-
sion Decision 97/747/EC which lays down levels and frequencies of sampling
for certain animal products (European Commission, 1997). In order to protect
public health, concerns have been raised about the need for a clear definition
of the maximum concentration of residues resulting from the use of a veteri-
nary medicinal product that may be accepted by the Community as “legally
permitted.” With this aim, regulation no. 470/2009 defined procedures for the
establishment of maximum residue limits (MRLs) of veterinary medicinal
products in food-producing animals and animal products (European Com-
mission, 2009), and regulation no. 37/2010 reported a list of pharmacologically
active substances and their classification regarding MRLs (European Com-
mission, 2010). Efforts toward harmonization of regulatory systems across the
world led to the agreement among members of Codex Alimentarius Commis-
sion concerning the MRLs and Risk Management Recommendations (RMRs)
for residues of veterinary drugs in foods (CAC, 2015), but significant differ-
ences remain on how risk assessment principles should be placed into practice.
In addition, for those veterinary drugs that have no permitted limit by law
(zero-tolerance), minimum required performance limits (MRPLs, defined as
the minimum content of an analyte in a sample which has to be detected and
confirmed) have been identified according to Commission Decision 2002/657/
EC in order to harmonize the analytical performance of specific methods under
development and validation (European Commission, 2002). MRPLs for chloram-
phenicol (CAP), nitrofurans metabolites, and medroxyprogesterone acetate were
established by Commission Decision 2003/181/EC (European Commission, 2003).
174 Advanced Technologies for Meat Processing, Second Edition

Effective drug residue control requires cost-effective routine screening

with the capability of high sample throughput, eventually followed by more
expensive chemical confirmation. False negative results are not acceptable
in screening assays, although a limited number of false positives may be
tolerated. Sensors and particular biosensors that can meet these require-
ments are probably the most promising solutions for this need; in fact in the
last 15 years, a large variety of screening methods were developed (Cháfer-
Pericás et al., 2010; Samsonova et al., 2012). Note that only a few of them
achieved detection on real samples.
In the following section, an overview of the most interesting and recent
achievements in the development of sensing and biosensing platforms for
detection of veterinary drugs residues in meat samples is provided; only
analytical approaches whose applicability was already assessed on real food
matrix are discussed.

5.2.2.1.1 Antibiotics
The antibiotic category includes substances or compounds that either kill
bacteria, and are therefore defined as bactericidal, or inhibit their growth,
and are therefore defined as bacteriostatic. Antibiotics that target the bacte-
rial cell wall, cell membrane, or interfere with essential bacterial enzymes
are usually bactericidal in nature; among these are β-lactams (penicillins and
cephalosporins), nitrofurans, polymixins, quinolones, and sulfonamides.
Those that target protein synthesis such as the aminoglycosides, macrolides,
tetracyclines, and amphenicols are usually bacteriostatic. Some antibiotics
occur naturally and can be isolated by fungi, though nowadays most of them
are produced industrially, either synthetically or semisynthetically. Among
the aforementioned veterinary drugs, the most frequently investigated anti-
biotic compounds can be identified due to their widespread use, toxicity, and
resulting concerns about consumers safety (Baynes et al., 2016).
β-lactam antibiotics have a long history in the treatment of infectious
diseases; for nearly six decades, penicillins have been widely used to treat
bacterial infections. However, the development of multidrug resistance has
reduced their effectiveness. This type of antibiotic can be classified into sev-
eral groups according to their structural characteristics, but their unique
structural feature is the presence of the four-membered β-lactam (2-azetidi-
none) ring (Figure 5.4). They include penicillins, cephalosporins, and more
recently, carbapenems. Many of these feed additives have therapeutic indica-
tions such as use for the treatment of erysipelas in turkeys (e.g., penicillin G
potassium) or they may have indications for increased rate of weight gain
and improved feed efficiency in poultry or swine (e.g., penicillin G).
Quinolones are a family of synthetic broad-spectrum antibiotic drugs, which
share the basic structure and a number of common functional groups reported
in Figure 5.4. Various modifications of the end moieties have produced com-
pounds with different physical, chemical, pharmacokinetic, and antimicrobial
Sensors and Biosensors for Meat Safety 175

β-Lactams (Fluoro)quinolons Amphenicols

R R Chloramphenicol Thiamphenicol
R H H
N OH OH OH H CI
S N R
CI N
CI
O O
O N+ HN CI O
N HO S HO
ŏF) O– O O
O Florfenicol
OH O O R O O
S FO
O H3C
CI
N
OH H CI
Sulfonamides
Aminoglycosides
O O
S OH Gentamycin
1 R3 CH3 NH2
R N O Neomycin
H3C H2N
2 HN O HO O
R HO
H3C HO NH2 HO
O O H2N
H2N NH2 NH2
OO
HO NH2
OH Streptomycin O OH
H2N
HO O OH
NH2
HO HO N O OH Neomycin
O R1 NH2 R1 R2
HN OH
O HO B CH2NH2 H
H3C ON
OHC NH2 HO C
R2 H CH2NH2
OH CH3
NH2

FIGURE 5.4
Chemical structures of the main drugs or drug categories occurring as chemical contaminants
in food-producing animals.

properties. For example, substitution at position 6 with a fluorine moiety (fluo-

roquinolones) markedly enhances activity against gram-negative pathogens
and broadens the spectrum of activity against gram-positive pathogens. Cip-
rofloxacin is a powerful antibiotic belonging to the fluoroquinolone class and is
used to treat severe and life-threatening bacterial infections. It interferes with
bacterial cell division by inhibition of the enzyme DNA gyrase (necessary for
the separation of replicated DNA). However, ciprofloxacin also affects mam-
malian cell replication and can result in adverse side effects. In most cases, cip-
rofloxacin causes tendinitis and tendon rupture; other side effects may include
central nervous system toxicity, cardiovascular toxicity, renal failure, seizures,
etc. Ciprofloxacin is the active metabolite of enrofloxacin, a veterinary anti-
biotic used in poultry, cattle, pigs, and aquaculture. This wide distribution
has raised concern over the possible emergence of fluoroquinolones-resistant
strains and resistance transfer between animal and human pathogens, such as
E. coli, Salmonella, and Campylobacter in humans.
CAP, thiamphenicol (TAP), and florfenicol (FF) are members of the amphen-
icol family of broad-spectrum antibacterial agents. They are effective against
a wide variety of gram-positive and gram-negative bacteria, including most
anaerobic organisms. CAP was first isolated from Streptomyces venezuelae
in 1947 but it is relatively cheap to produce by industrial processes. CAP is
highly effective as a bacteriostatic, and may also be bactericidal at high con-
centrations. It diffuses readily into all body tissues and it is rather rapidly
176 Advanced Technologies for Meat Processing, Second Edition

metabolized by conjugation with glucuronic acid. These properties under-

line the reasons why CAP was widely used for many years in veterinary
practice both therapeutically and prophylactically. However, CAP is hema-
totoxic for humans and may cause life-threatening side effects such as bone
marrow aplasia (loss of ability to produce blood cells) and therefore aplastic
anemia or fetotoxicity. Since the size of the CAP dose that may lead to these
pathologies is still not defined, the use of this antibiotic for the treatment of
animals and livestock meant for food production in many countries has been
prohibited (EU, United States, Canada, and others). Currently, TAP and FF
are used as alternatives to CAP for animal treatment. However, because of its
high efficiency, broad spectrum of action, relatively low cost, and availability,
CAP is still in use, often illegally.
The sulfonamides have been used in food animal production for over 60
years and they are still utilized in cattle, swine, and poultry; however, their
use has somewhat declined, this drug class being the third most commonly
used antimicrobial used in food animals (Baynes et al., 2016). A recent study
across 25 European countries found that sulfonamides were the third most
popular class of antimicrobials used in veterinary medicine (behind tetra-
cyclines and penicillins) and that sulfonamides represented 11% of the total
sales of veterinary antimicrobial drugs across Europe in 2011 (Grave et al.,
2014). Oral sulfonamides are commonly given to calves with diarrhea, to pigs
as a treatment for septicemia and bacterial pneumonia, and to turkeys for
the treatment of E. coli and Pasteurella multocida (fowl cholera). Occasionally,
potentiated sulfonamides are used in the poultry industry to control coc-
cidiosis.
Gentamicin, neomycin, and streptomycin make up the majority of amino-
glycosides used in livestock production. The immunogenicity of these antimi-
crobials has not been deeply investigated, but the amino sugars appear to be
important epitopes for aminoglycosides. They are employed for treatment of
infectious keratoconjunctivitis caused by Moraxella bovis in cattle, and for treat-
ment or control of bacterial enteritis in piglets or young chickens and turkeys.

5.2.2.1.2 Hormones Acting as Growth Promoters

A hormone is a chemical messenger produced by all multicellular organ-
isms. They are released by localized cells in the organism and can affect cells
in different parts of the organism. Hormones are used for animal breeding to
enhance body protein accumulation, metabolize fat stores, and increase lean
growth rate. Growth promotion using anabolic hormone treatment rises up
to 20% compared to nontreated animals. The β-agonists group (salbutamol
[SAL], clenbuterol [CLB], and ractopamine [RAC]) are proven repartitioning
agents in meat-producing animals, causing a reduction in fat content and
improved production of lean meat. Another group of hormones is cortico-
steroids (Dexamethasone, Triamcinolone), which help control metabolism,
inflammation, immune functions, salt and water balance, development of
sexual characteristics, and the ability to withstand illness and injury.
Sensors and Biosensors for Meat Safety 177

β-agonists such as β2-adrenergic receptor agonists are sympathomimetic

drugs that mimic the action of epinephrine and norepinephrine. They act
on the target cell via membrane-bound G protein-coupled receptors, and are
used therapeutically in humans, as well as in veterinary medicine for the
treatment of asthmatic respiratory diseases, for tocolysis, and for the treat-
ment of peripheral disturbed blood flow. In higher doses, β2-adrenergic ago-
nists (BAAs) show effects as partitioning agents in food animals, whereby
they cause a modification of growth by increasing accretion of skeletal
muscle and decreasing fat stores (Mersmann, 1998). Use of BAAs late in the
feeding period results in consistent increases in the rate of weight gain with-
out an increase in feed consumption, thereby increasing feed efficiency and
cost-effectiveness (Loneragan et al., 2014). The most prominent example is
CLB; other β-agonists are RAC, salbumatol, terbutaline, fenoterol, zilpaterol,
brombuterol, cimaterol, and mabuterol. The misuse of these agents can cause
drastic side effects in humans, such as cramps or tremors in muscles. The
more common symptoms shown are aggression, agitation, increased blood
pressure, dizziness, and nausea. Typical side effects also include tachycardia,
arrhythmia, tremor, hyperglycemia, and hypocalcemia.
CLB is a sympathomimetic amine and β2 agonist with some structural and
pharmacological similarities with epinephrine and SAL. It works mostly
through increasing the production and secretion of catabolic hormones
and leads to increased aerobic capacity. When the central nervous system
is stimulated, blood pressure and oxygen transportation increase and this
in turn raises the rate of body fat metabolism. It is most commonly avail-
able as hydrochloride salt, but is currently prohibited from use as a growth-
promoting agent worldwide. RAC is another very common BAA used as a
feed additive to promote growth and leanness in pigs. Food safety concerns
about RAC divide the global community. Although RAC is not as toxic to
humans compared to other β-agonists such as SAL and CLB, long-term mis-
use of RAC may still result in potentially harmful side effects. In toxicol-
ogy studies, the primary side effects of RAC are those classically related to
BAA, such as dose-dependent increases in heart rate and decreases in dia-
stolic blood pressure, and it is unlikely to be carcinogenic. It should be noted
that there have been no reported cases of adverse health effects in humans
exposed to livestock products containing RAC residues.

5.2.2.2 Optical Sensors

The most common optical biosensors tailored to antibiotics detection are
based on surface plasmon resonance (SPR) transduction (see Table 5.3). SPR
biosensors utilize the principle of label-free interaction analysis, with inter-
actions between molecules such as antigen and antibody being monitored
in real time. Various assay formats are available (Pilolli et al., 2013); however,
as for antibiotics detection, usually indirect assays (mainly inhibition) are
preferred given the low molecular weight of the target analyte.
TABLE 5.3
178

Summary of Sensors for Chemical Contamination Detection

Nanomaterial Recognition
Target Analyte Transduction System Integration Food Matrix Element Reference
Clenbuterol Differential pulse None Bovine liver MIP Pizzariello et al. (2001)
voltammetry
Streptomycin, dihydro- SPR None Milk, honey, and meat Antibody Ferguson et al. (2002)
streptomycin
Sulfonamides (sulfa- SPR None Chicken serum Antibody Haasnoot et al. (2003)
methazine and
N4-acetyl-sulfametha-
zine)
Multisulfonamides SPR None Chicken serum and plasma Antibody Haasnoot et al. (2005)
(sulfamethoxazole and
sulfadiazine)
Multisulfonamides SPR None Chicken serum Antibody and Bienenmann-Ploum et al.
(sulfamethazine, binding protein (2005)
sulfadiazine, sulfa-
methoxazole, sulfaqui-
noxaline,
sulfachloropyridazine)
CAP, CAP glucuronide SPR None Poultry muscle, honey, Antibody Ferguson et al. (2005)
Prawn, and milk
CAP, CAP glucuronide SPR None Honey, prawns, and porcine Antibody Ashwin et al. (2005)
kidney
Multisulfonamides SPR None Porcine muscles Binding protein McGrath et al. (2005)

(Continued)
Advanced Technologies for Meat Processing, Second Edition
TABLE 5.3 (Continued)
Summary of Sensors for Chemical Contamination Detection
Nanomaterial Recognition
Target Analyte Transduction System Integration Food Matrix Element Reference

CAP Chemiluminescence None Pork, beef, chicken, shrimp, Antibody Park and Kim (2006)
and milk
Multi-(fluoro)quinolones SPR None Egg, fish, and poultry meat Antibody Huet et al. (2008)
Multi-(fluoro)quinolones SPR None Egg, fish, and poultry meat Antibody Huet et al. (2009)
Tetracyclines Luminescence None Poultry muscle Cell (bacteria) Pikkemaat et al. (2010)
Florfenicol Fluorescence None Liver, pork, chicken, and fish MIP Ge et al. (2010)
CAP QCM None Chicken muscles Hapten–protein Karaseva and Ermolaeva
conjugate and (2012)
antibody
Sensors and Biosensors for Meat Safety

Ractopamine SPR None Pork Antibody Lu et al. (2012)

Ractopamine Differential pulse None Pork None Yang et al. (2014a)
voltammetry
PenicillinG, ampicillin QCM None Milk, pork, beef, liver Hapten–protein, Karaseva and Ermolaeva
antibody (2014)
CLB hydrochloride SPR None Pork Antibody Li et al. (2014)
Neomycin Amperometry Gold NP-deco- Beef, pork, chicken Antibody Zhu et al. (2010)
rated CNTs
CAP Amperometry Cadmium sulfide Beef, chicken, pork Antibody Kim et al. (2010)
NPs modified-
dendrimer
CLB, SAL, terbutaline, Linear sweep voltamme- GO Pork (spiked only with CLB) None Lin et al. (2013)
ractopamine, dopamine, try
dobutamine, adrenaline,
isoprenaline

(Continued)
179
TABLE 5.3 (Continued)
180

Summary of Sensors for Chemical Contamination Detection

Nanomaterial Recognition
Target Analyte Transduction System Integration Food Matrix Element Reference

Ractopamine, SAL, CLB Cyclic voltammetry Reduced GO and Pork Antibody Wang et al. (2013)
silver–palladium
alloy NPs
Enrofloxacin Fluorescence Ru(phen)32+– Chicken Antibody Huang et al. (2013)
doped silica FN
Streptomycin Differential pulse Gold–silica Honey, milk, and porcine Antibody Liu et al. (2011)
voltammetry nanostructures kidney and muscle
Quinoxaline-2-carboxylic Square wave voltamme- GO Pork and chicken muscles MIP Yang et al. (2014b)
acid (metabolites of try
carbadox)
CLB Linear sweep voltamme- Poly(sodium Pork None Wang et al. (2014)
try 4-styrenesulfo-
nate) functional-
ized graphene
Tetracycline Differential pulse Iron/zinc Fish, chicken, shrimp None Gan et al. (2014)
voltammetry cation–
exchanged
montmorillonite
Penicillin G, ampicillin QCM Nanoparticulate Chicken meat MIPs Karaseva et al. (2016)
MIPs
Florfenicol Fluorescence Mn-doped ZnS Chicken and fish MIPs Sadeghi et al. (2016)
quantum dots
Ractopamine and CLB Differential pulse GO and reduced Pork None Wu et al. (2012)
voltammetry GO
Ractopamine Differential pulse MWCNT Pork and liver None Liu et al. (2012)
voltammetry
Advanced Technologies for Meat Processing, Second Edition

(Continued)
TABLE 5.3 (Continued)
Summary of Sensors for Chemical Contamination Detection
Nanomaterial Recognition
Target Analyte Transduction System Integration Food Matrix Element Reference

Ractopamine and SAL Linear sweep voltamme- Poly taurine/ Pig meat (and human urine) None Rajkumar et al. (2013)
try zirconian NPs
Ractopamine and SAL Differential pulse Hybrid CNTs Pork None Lin et al. (2013)
voltammetry (single- and mul-
tiwalled) and
Nafion compos-
ites
Ractopamine Fluorescence CdSe quantum Pork MIP Liu et al. (2014)
dots
Ractopamine Electromotive force Ractopamine–tet- Pork None Zhang et al. (2014)
Sensors and Biosensors for Meat Safety

raphenylborate
complexed NPs
Multisulfonamides SPR None Milk and porcine muscle Antibody Gaudin et al. (2007)
Flumequine SPR None Chicken serum and muscles Antibody Haasnoot et al. (2007)
CAP, chloramphenicol; CLB, clenbuterol; CNT, carbon nanotubes; FN, fluorescent nanoparticles; GO, graphene oxide; MIPs, molecularly imprinted
polymers; MWCNT, multiwalled carbon nanotube; NP, nanoparticles; SAL, salbutamol; SPR, surface plasmon resonance; QCMs, quartz-crystal
microbalances.
181
182 Advanced Technologies for Meat Processing, Second Edition

One of the first examples of SPR-based detection of antibiotics dates back

2002 and reported on the development of an immunosensor inhibition assay
for detection of aminoglycoside antibiotics residues (streptomycin and dihy-
drostreptomycin) in different food matrices (whole bovine milk, honey, por-
cine kidney, and porcine muscle) (Ferguson et al., 2002). After a few years,
the same authors used and validated a commercially available Qflex® kit for
Biacore® Q biosensor for the highly accurate and reliable detection of CAP
and CAP glucuronide in poultry muscle, honey, prawns, and milk in concen-
trations below the MRPL (Ferguson et al., 2005). Analogously, another SPR-
based screening method for the same analytes was developed and validated
according to the EU legislation (European Commission, 2002). This included
the determination of decision limits (CCα) and detection capabilities (CCβ)
and associated data such as stability of the analyte in matrix. Incurred tis-
sues were used in this study to evaluate the long-term performance and
agreement between the screening and a confirmatory LC–mass spectrom-
etry (LC–MS)-based procedure (Ashwin et al., 2005).
As for the screening methods tailored to the specific detection of sul-
fonamides in food-producing animals, several investigations were car-
ried for single and multiple detection of such drugs in chicken serum (as
a predictor of contamination levels in edible tissues) (Haasnoot et al., 2003,
2005; Bienenmann-Ploum et al., 2005) or porcine muscles (McGrath et al.,
2005; Gaudin et al., 2007). However, among these, only the latter authored
by Gaudin et al. (2007) was subjected to a full validation. In their work, a
multisulfonamide antibody was used for the development of two differ-
ent Biacore protocols, one for the screening of milk samples, the other for
muscle samples. The Biacore 3000 system, which is completely automated,
was used for high-throughput screening in muscle protocol, widening the
applicability assessment to porcine, bovine, and poultry muscle. The differ-
ent performance characteristics, according to European Decision 2002/657/
EC (detection capability CC, specificity/selectivity, precision, stability, and
applicability) were determined in relation to the European Union MRL of
100 g/kg for sulfonamides.
Focusing on quinolones monitoring, after the first investigation by Haasnoot
et al. (2007), achieving the specific quantitative detection of flumequine in
broiler serum and muscle, the research trend pushed toward the development
of high-throughput platforms for multiple detection of chemicals belonging to
the quinolones category.
With this aim, Huet et al. (2008) developed an optical biosensor inhibition
immunoassay, based on the SPR principle, for the screening of 13 quinolones
(norfloxacin, sarafloxacin, difloxacin, ciprofloxacin, enrofloxacin, flume-
quine, danofloxacin, marbofloxacin, pefloxacin, enoxacin, lomefloxacin,
ofloxacin, and oxolinic acid). An innovative feature of this investigation was
the recourse to bi-active antibody, specifically produced by a dual immuno-
gen prepared after combining features of two complexes (i.e., norfloxacin-
BSA and flumequine-BSA). The assay was optimized for detection in three
Sensors and Biosensors for Meat Safety 183

matrices (poultry muscle, fish, and egg), and tested on incurred samples
prepared by liquid extraction followed by two washing steps. The biosen-
sor was validated afterward according to criteria specified by European
legislation, through assessment of the performance characteristics, that is,
detection capability, specificity/selectivity, decision limit, repeatability, rug-
gedness, and stability (Huet et al., 2009).
Researchers have also described a membrane-based immunosensor for
the detection of CAP by chemiluminescence phenomenon in samples of
pork, beef, chicken, and shrimp (Park and Kim, 2006). A flow-through cell
was devised, connected to an injector and a peristaltic pump inside a dark
box, and facing a PMT as light detector in front of it; it exploits competi-
tion between CAP and a CAP–HRP conjugate for binding to an anti-CAP
antibody immobilized on the membrane. Addition of the peroxidase sub-
strate luminol catalyzed a light-emitting reaction which was measured for
the quantification.
Ge et al. (2010) proposed an online coupling of molecular imprinted solid-
phase extraction with flow-injection fluorescence sensing for the detection
of FF. The method described an FF-imprinted polymer as the recognition
part followed by a solid-phase extraction to remove potential interferences
from the matrix component. Fluorescence intensity in fluorescence energy
transfer (FET) based sensing was inhibited by FF. The proposed sensor was
applied successfully to the determination of FF in liver and meat samples.
Focusing on the most recent investigations tailored to the detection of
hormone and growth promoters, two different works were reported on the
development of SPR-based biosensors for the label-free detection of CLB
hydrochloride and RAC, respectively (Li et al., 2014; Lu et al., 2012). In partic-
ular, in the latter the authors achieved good results in pork matrix by using
a low cost SPR-2004 biosensor and chip created by the Chinese Academy of
Sciences, proposed as an alternative to the most common but expensive com-
mercial instruments.

5.2.2.3 Electromechanical Sensors

The application of electromechanical gravimetrical sensors allows for the
detection of drug residues in composite matrixes at quite a low level, usu-
ally carried out in a competitive format with the preliminary introduction of
fixed antibody quantities into the samples. The sensing performance (detec-
tion limit, range of detection, accuracy, and reproducibility) of the assay
would be mainly influenced by the quality of the sensor electrode coating,
which includes the formation of the substrate and the immobilization of
the receptor. The use of direct electropolymerization on the gold electrode
provides a promising solution for the immobilization of biomolecules since
it is possible to control the mass and thickness of the coating in real time
by tuning the potential and the scan rate (Cosnier, 2005). Electrogenera-
tion of polyelectrolyte films provides strong binding with the surface of a
184 Advanced Technologies for Meat Processing, Second Edition

gold electrode, and hence the immunoaffinity layer resistance to detection/

regeneration cycles increases improving the sensor lifetime.
Recently, Karaseva and Ermolaeva (2012, 2014) proposed, in two different
investigations, the development and application of a piezoelectric immuno-
sensor prepared by electrogenerated polymer for single and multiresidual
contamination monitoring in several food matrixes. In 2012, they developed
a competitive assay for CAP detection in meat, milk, eggs, and honey. In
2014, the same authors proposed a QCM-based immunosensor for detecting
penicillin G, ampicillin, and the total content of penicillin antibiotics by inte-
gration of homologous and group-specific antibodies. The receptor coating
of the sensor was obtained by the immobilization of penicillin G or ampicil-
lin hapten–protein conjugates on the polypyrrole film obtained by electropo-
lymerization and activated by glutaraldehyde. The sensors were tested in
detecting penicillins in milk, pork, beef, and liver.

5.2.2.4 Advances in Nanotechnology Integration

for Chemical Contamination
One of the main concerns in the real samples analysis is the drug extraction
procedure, especially when the matrix is a complex one, like food in general
and meat in particular. Therefore, sensors able to achieve good performances
upon simple treatment procedures are highly desirable. Among them, elec-
trochemical approaches using properly modified electrodes are able to com-
bine the high sensitivity, low cost, and simplicity of the methods with the
selectivity induced from the specific nanomaterials employed. This strategy
has also the great advantage of eliminating the use of enzymes and media-
tors, and all the possible negative effects coming from them.
The use of the “rising star” graphene has been described by Wang et al. to
successfully determine CLB in pork meat (Wang et al., 2014). They propose
poly (sodium 4-styrenesulfonate) (PSS) functionalized graphene nanocom-
posite as the electrode modifier material for the fabrication of an electro-
chemical sensor. It was found not only to enhance the enrichment of CLB
on the electrode surface by strong π–π interaction, but also had an extraordi-
narily fast electron transfer rate. Moreover, the PSS functionalized graphene
is water-soluble, which facilitates its application in many fields. Applying
linear sweep voltammetry, a good linear relationship of the oxidation peak
current with respect to concentrations of CLB was achieved with a detection
limit of 2.2 × 10 –8 mol/L.
A further approach based on the use of graphene is the development
of a multiplexed electrochemical sensor for the simultaneous detection of
RAC, SAL, and CLB, three β-agonists with similar structure (Wang et al.,
2013). Graphene with high conductivity was used as an electrode material to
immobilize artificial antigens and amplify electrochemical signal. AgPdNPs
are used to label antibodies and generate a strong electrochemical signal in
phosphate-buffered saline without any other substrates. Artificial antigens
Sensors and Biosensors for Meat Safety 185

of RAC, SAL, and CLB are, respectively, immobilized onto three working
electrodes. RAC, SAL and CLB are separately pre-reacted with the corre-
sponding antibody functionalized AgPd NPs (Ab/AgPdNPs). The free Ab/
AgPdNPs are then captured by the corresponding antigens in the competi-
tive electrochemical biosensors. A simple pork extract solution was therefore
used, with good recovery percentages and detection limits of 1.52, 1.44, and
1.38 pg/mL for RAC, SAL, and CLB, respectively.
Since RAC contains phenolic hydroxyl group, it could be oxidized at the
electrode surface. However, sensors based on direct electrochemical detection
of RAC are still limited, maybe due to the poor response activity on ordinary
electrode surface. Recently, ordered mesoporous carbon (OMC) has attracted
great attention as a novel advanced carbon material, due to its uniform and
tailored pore structure, high specific surface area, large pore volume, chemical
inertness, and good conductivity; such properties suggest its implementation
in electrochemical sensors for the enhancement of sensitivity. In particular,
Yang et al. (2014) proposed an electrochemical sensor based on OMC modified
glass carbon electrode (OMC/GCE) to detect toxic RAC, demonstrating that
the mesoporous film increases the oxidation signal of RAC, given the remark-
ably enhanced electrocatalytic activity compared with bare GCE surface (Yang
et al., 2014). The signal for the determination of RAC was recorded using DPV
and after optimization of the experimental conditions, the analytical perfor-
mances of the electrochemical sensor were evaluated by the determination of
RAC in pork samples, obtaining a good linear correlation over drug concentra-
tion, with a detection limit of 0.06 μM (Yang et al., 2014a).
In their work, Wu et al. also gave a rationale for the electrochemical
behavior of RAC and CLB on the surface of different carbon materials elec-
trode. The presence of graphene resulted in a strong enhancement effect
and an increased oxidation signal due to the presence of a large number of
oxygen-containing groups responsible for high electrochemical activities
(Wu et al., 2012).
Recently, an interesting study has been published reporting the electro-
catalytic activity of eight different β-agonists at the surface of a glassy carbon
electrode modified with GO and a sodium salt (acid chrome blue K [ACBK])
possessing good electrocatalytic activity toward metal ions and proteins.
Electrochemical oxidation of CLB, SAL, adrenaline, RAC, terbutaline, dopa-
mine, dobutamine, and isoprenaline was investigated by cyclic voltammetry
at differently modified electrodes (Lin et al., 2014). Briefly, no redox peaks
were observed on the simple GCE; the current somewhat increased when
measuring at GO/GCE or at ACBK/GCE, while it significantly increased at
the ACBK/GO/GCE modified electrode. The detection limits for the eight
drugs were in the range 0.58–1.46 ng/mL; the method proved to be reproduc-
ible and stable and successfully applicable for quantitative analysis of CLB
in pork samples.
Along with the excellent electrochemical properties of graphene, other
carbon-based materials like CNTs have gained attention as novel electrode
186 Advanced Technologies for Meat Processing, Second Edition

materials due to their fascinating structural, mechanical, physical prop-

erties, and effective catalytic activity for the promotion of charge transfer
processes. Liu et al. (2012) reported the use of MWCNT water dispersion
as a GCE modifier to detect RAC at an LOD of 20 μg/L, with high recovery
percentages in pork samples. Hybrid single-walled and MWCNT compos-
ites have been also investigated, where the synergistic effect allowed for a
more compact structure between single-walled carbon nanotube (SWCNT)
and MWCNT, resulting in higher electroactive CNTs concentration on the
electrode surface. Amperometric sensors using these electrodes were able
to simultaneously detect RAC and SAL in pork samples with LOD as low as
0.05 and 0.1 μM, respectively (Lin et al., 2013).
Following a diverse approach, the NPs can also be intercalated into the
electrode modifier film, achieving the same enhancement effect of the drug
catalytic activity: the determination of tetracycline in chicken meat samples
with a detection limit of 0.10 μM (Gan et al., 2014) and the detection of RAC
in pork samples in the range 1–114 μM (Rajkumar et al., 2013) are valuable
examples.
As an alternative solution to reduce the effect of the matrices and improve
sensitivity, molecularly imprinted technology has attracted increasing atten-
tion due to a possible predetermined recognition ability. In particular, MIPs
may be used as a synthetic alternative for biomolecular recognition elements
(Wei et al., 2006; Dickert et al., 2000; Piletsky and Turner, 2006; Wackerlig and
Lieberzeit, 2015). The synthesis of MIPs is carried out in the presence of the
molecules that selectivity should be entailed for, ideally establishing selec-
tive binding sites within a polymer matrix. Hence, MIPs constitute porous
materials providing complementary functional groups capable of specifi-
cally recognizing the “template” molecules and subsequently binding them
with similar affinities as natural antibodies. Very recently, the introduction
of nanomaterials either as the support matrix (Zhang et al., 2011) or as the
nanostructured polymer itself (Karasevaa et al., 2016; Liu et al., 2014) further
increased selectivity toward determination of antibiotics like erythromycin
and penicillins in meat and chicken muscle, respectively.
In the design of a biosensor, NPs can also play the role of the antibody-
bearing constituent that is the immunosensor probe. The main advantage is
the significant amplification of the response, allowing for the fabrication of
ultrasensitive sensors. Usually, metal NPs are employed, such as gold, thanks
to the enhancement of catalytic properties at nanometer size. Zhu et al. (2010)
reported AuNP-decorated CNTs for the determination of neomycin in real
meat samples at an LOD of 6.76 ng/mL; melamine functionalized AuNPs
were successfully employed for the simultaneous detection of RAC and SAL
in swine meat at an LOD of 10−11 mol/L (Zhou et al., 2013). Moreover an ultra-
sensitive electrochemical immunoassay for streptomycin was accomplished
by gold–silica nanostructures (LOD = 5 pg/mL, in kidney and muscle) (Liu
et al., 2011). Examples of different nanostructures have been reported as well,
such as cadmium sulfide NPs modified-dendrimer for CAP detection were
Sensors and Biosensors for Meat Safety 187

investigated by Kim et al. for real meat samples analysis (LOD = 45 pg/mL)
(Kim et al., 2010).
The real goal in the field of food control would be a total portable device
sensor, able to perform a fast and selective screening analysis. In this respect,
there are very few published papers presenting real tests already performed
on food matrices (Chen et al., 2012; Zhao et al., 2008). The Huang research
group reported a aRu(phen)32+-doped silica fluorescent nanoparticle (FN)-
based immunochromatographic test strip sensor (ICTS) for rapid, high sensi-
tivity, easy to use, and low-cost quantitative detection of enrofloxacin residues
in chicken meat. The fluorescence signal intensity of the FNs at the test line
(FIT) and control line (FIC) was determined with a prototype of a portable
fluorescent strip reader. The signal was based on FIT/FIC ratio to effectively
eliminate strip-to-strip variation and matrix effects (Huang et al., 2013).

5.3 Concluding Remarks

In this chapter, an overview of the most recent and relevant achievements
in the development of screening methods for chemical and biological con-
tamination monitoring in meat samples was provided, including critical
discussion of consolidated sensing platforms and new trends and advances
achieved by nanotechnology integration. A variety of platforms has been
reported, and many have shown good promise for high sensitivity and low
detection limits, eventually enhanced by the inclusion of NPs and nanostruc-
tures. A massive recourse to nanomaterials in the development of routine
sensor platforms for the marketplace would require a preventive evaluation
of the potential toxicity and proper disposal strategies. Effective success of
this technology in the food safety and regulatory field requires rigorous vali-
dation with conventional methodologies, testing of real samples with sta-
tistically relevant sample numbers, careful evaluation of interferences, and
interlaboratory studies; this represents the most important enduring chal-
lenge which prevents the achievement of full industry acceptance and regu-
latory approvals.

References
Abdalhai, M. H., Fernandes, A. M., Bashari, M., Ji, J., He, Q. and Sun, X. (2014). Rapid
and sensitive detection of foodborne pathogenic bacteria (Staphylococcus aureus)
using an electrochemical DNA genomic biosensor and its application in fresh
beef. Journal of Agricultural and Food Chemistry, 62, 12659−12667.
188 Advanced Technologies for Meat Processing, Second Edition

Abdalhai, M. H., Fernandes, A. M., Xia, X., Musa, A., Ji, J. and Sun, X. (2015). Elec-
trochemical genosensor to detect pathogenic bacteria (Escherichia coli O157:H7)
as applied in real food samples (fresh beef) to improve food safety and quality
control. Journal of Agricultural and Food Chemistry, 63, 5017−5025.
Amamcharla, J. K., Panigrahi, S., Logue, C. M., Marchello, M. and Sherwood, J. S.
(2010). Fourier transform infrared spectroscopy (FTIR) as a tool for discriminat-
ing Salmonella typhimurium contaminated beef. Sensing and Instrumentation Food
Quality and Safety, 4, 1–12.
Ashwin, H. M., Stead, S. L., Taylor, J. C. et al. (2005). Development and validation
of screening and confirmatory methods for the detection of chloramphenicol
and chloramphenicol glucuronide using SPR biosensor and liquid chromatog-
raphy–tandem mass spectrometry. Analytica Chimica Acta, 529, 103–108.
Bae, E., Banada, P. P., Huff, K., Bhunia, A. K., Robinson, J. P. and Hirleman, E. D.
(2007). Biophysical modeling of forward scattering from bacterial colonies using
scalar diffraction theory. Applied Optics, 46, 3639–3648.
Bai, S., Zhao, J., Zhang, Y. et al. (2010). Rapid and reliable detection of 11 food-
borne pathogens using thin-film biosensor chips. Applied Microbiology and
Biotechnology, 86, 983–990.
Balasubramanian, S., Amamcharla, J., Panigrahi, S., Logue, C. M., Marchello, M. and
Sherwood, J. S. (2012). Investigation of different gas sensor-based artificial olfac-
tory systems for screening Salmonella typhimurium contamination in beef. Food
and Bioprocess Technology, 5, 1206–1219.
Balasubramanian, S., Panigrahi, S., Logue, C. M., Doetkott, C., Marchello, M. and
Sherwood, J. S. (2008). Independent component analysis-processed electronic
nose data for predicting Salmonella typhimurium populations in contaminated
beef. Food Control, 19, 236–246.
Balasubramanian, S., Panigrahi, S., Logue, C. M., Gu, H. and Marchello, M. (2009).
Neural networks-integrated metal oxide-based artificial olfactory system for
meat spoilage identification. Journal of Food Energy, 91, 91–98.
Balasubramanian, S., Panigrahi, S., Logue, C. M., Marchello, M. and Sherwood,
J. S. (2005). Identification of Salmonella-inoculated beef using a portable elec-
tronic nose system. Journal of. Rapid Methods and Automation in Microbiology,
13, 71–95.
Baynes, R. E., Dedonder, K., Kissell, L. et al. (2016). Health concerns and management
of select veterinary drug residues. Food and Chemical Toxicology, 88, 112–122.
Banada, P. P., Guo, S., Bayraktar, B. et al. (2007). Optical forward-scattering for detec-
tion of Listeria monocytogenes and other Listeria species. Biosensors and Bioelectron-
ics, 22, 1664–1671.
Bienenmann-Ploum, M., Korpimäki, T., Haasnoot, W. and Kohen, F. (2005). Compari-
son of multi-sulfonamide biosensor immunoassays. Analytica Chimica Acta, 529,
115–122.
Codex Alimentarius Commission. (2015). Joint FAO/WHO Food Standard Program
Codex Alimentarius Commission Thirty-Eighth Session. Maximum Residue
Limits (MRLs) and Risk Management Recommendations (RMRs) for Residues
of Veterinary Drugs in Foods. Geneva. Available at: http://www.fao.org/fao-
who-codexalimentarius/standards/vetdrugs/en/ (accessed 21 June 2016).
Cháfer-Pericás, C., Maquieira, A. and Puchades, R. (2010). Fast screening methods
to detect antibiotic residues in food samples. Trends in Analytical Chemistry, 29,
1038–1049.
Sensors and Biosensors for Meat Safety 189

Chen, X., Xu, H., Lai, W., Chen, Y., Yang, X. and Xiong, Y. (2012). A sensitive chromato-
graphic strip test for the rapid detection of enrofloxacin in chicken muscle. Food
Additives and Contaminants: Part A, 29, 383−391.
Cho, I.-H., Radadia, A. D., Farrokhzad, K. et al. (2014). Nano/micro and spectroscopic
approaches to food pathogen detection. Annual Review of Analytical Chemistry,
7, 65–88.
Cosnier, S. (2005). Affinity biosensors based on electropolymerized films. Electroanaly-
sis, 17, 1701–1712.
Davis, R., Burgula, Y., Deering, A., Irudayaraj, J., Reuhs, B. L. and Mauer, L. J. (2010a).
Detection and differentiation of live and heat-treated Salmonella enterica serovars
inoculated onto chicken breast using Fourier transform infrared (FT-IR) spec-
troscopy. Journal of Applied Microbiology, 109, 2019–2031.
Davis, R., Irudayaraj, J., Reuhs, B. L. and Mauer, L. J. (2010b). Detection of E. coil
O157:H7 from ground beef using Fourier transform infrared (FT-IR) spectros-
copy and chemometrics. Journal of Food Science, 75, M340–M346.
Davis, R. and Mauer, L. J. (2011). Subtyping of Listeria monocytogenes at the haplotype
level by Fourier transform infrared (FT-IR) spectroscopy and multivariate statis-
tical analysis. International Journal of Food Microbiology, 150, 140–149.
Davis, R., Paoli, G. and Mauer, L. J. (2012). Evaluation of Fourier transform infra-
red (FT-IR) spectroscopy and chemometrics as a rapid approach for sub-typing
Escherichia coli O157:H7 isolates. Food Microbiology, 31, 181–190.
De Marco, D. R. and Lim, D. V. (2002). Detection of Escherichia coli O157:H7 in 10- and
25-gram ground beef samples with an evanescent-wave biosensor with silica
and polystyrene waveguides. Journal of Food Protection, 65, 596–602.
Dickert, F. L., Lieberzeit, P. and Tortschanoff, M. (2000). Molecular imprints as artifi-
cial antibodies—A new generation of chemical sensors. Sensors and Actuators B,
65, 186–189.
Ellis, D. I., Broadhurst, D., Kell, D. B., Rowland, J. J. and Goodacre, R. (2002). Rapid
and quantitative detection of the microbial spoilage of meat by Fourier trans-
form infrared spectroscopy and machine learning. Applied and Environmental
Microbiology, 68, 2822–2828.
European Commission. (1996). Council Directive 96/23/EC of 29 April 1996 on mea-
sures to monitor certain substances and residues thereof in live animals and animal
products and repealing Directives 85/358/EEC and 86/469/EEC and Decision
89/187/EEC and 91/664/EEC. Official Journal of the European Union, L125, 10–32.
European Commission. (1997). Commission Decision of 27 October 1997 fixing the
levels and frequencies of sampling provided for by Council Directive 96/23/EC
for the monitoring of certain substances and residues thereof in certain animal
products. Official Journal of the European Union, L303, 12–15.
European Commission. (2002). Commission Decision 2002/657/EC of 12 August
2002 implementing Council Directive 96/23/EC concerning the performance of
analytical methods and the interpretation of results. Official Journal of the Euro-
pean Union, L221, 8–36.
European Commission. (2003). Commission Decision 2003/181/EC of 13 March 2003
amending Decision 2002/657/EC as regards the setting of minimum required
performance limits (MRPLs) for certain residues in food of animal origin. Offi-
cial Journal of the European Union, L71, 17–18.
190 Advanced Technologies for Meat Processing, Second Edition

European Commission. (2009). Regulation (EC) No 470/2009 of the European Parlia-

ment and of the Council of 6 May 2009 laying down Community procedures
for the establishment of residue limits of pharmacologically active substances
in foodstuffs of animal origin, repealing Council Regulation (EEC) No 2377/90
and amending Directive 2001/82/EC of the European Parliament and of the
Council and Regulation (EC) No 726/2004 of the European Parliament and of
the Council. Official Journal of the European Union, L152, 11–22.
European Commission. (2010). Commission Regulation (EU) No 37/2010 on pharma-
cologically active substances and their classification regarding maximum resi-
due limits in foodstuffs of animal origin. Official Journal of the European Union,
L15, 1–72.
European Food Safety Authority. (2006). Opinion of the scientific panel on contami-
nants in the food chain of the EFSA on a request from the Commission related
to ochratoxinA in food. EFSA Journal, 365, 1–56.
Ferguson, J. P., Baxter, G. A., McEvoy, J. D. G., Stead, S., Rawlings E. and Sharman, M.
(2002). Detection of streptomycin and dihydrostreptomycin residues in milk,
honey and meat samples using an optical biosensor. Analyst, 127, 951–956.
Ferguson, J., Baxtera, A., Young, P. et al. (2005). Detection of chloramphenicol and
chloramphenicol glucuronide residues in poultry muscle, honey, prawn and
milk using a surface plasmon resonance biosensor and Qflex® kit chloram-
phenicol. Analytica Chimica Acta, 529, 109–113.
Gan, T., Shi, Z., Sun, J. and Liu, Y. (2014). Simple and novel electrochemical sensor for
the determination of tetracycline based on iron/zinc cations-exchanged mont-
morillonite catalyst. Talanta, 121, 187–193.
Gaudin, V., Hdou, C. and Sanders, P. (2007). Validation of a Biacore method for
screening eight sulfonamides in milk and porcine muscle tissues according to
European decision 2002/657/EC. Journal of AOAC International, 90, 1706–1715.
Ge, S., Yan, M., Cheng, X. et al. (2010). On-line molecular imprinted solid-phase
extraction flow-injection fluorescence sensor for determination of florfenicol in
animal tissues. Journal of Pharmaceutical and Biomedical Analysis, 52, 615–619.
Gopinath, S. C. B., Tang, T.-H., Chen, Y., Citartan, M. and Lakshmipriya, T. (2014).
Bacterial detection: From microscope to smartphone Biosensors and Bioelectron-
ics, 60, 332–342.
Grave, K., Torren-Edo, J., Muller, A., Greko, C., Moulin, G. and Mackay, D. (2014).
Variations in the sales and sales patterns of veterinary antimicrobial agents in 24
European countries. Journal of Antimicrobial Chemotherapy, 69, 2284–2291.
Haasnoot, W., Bienenmann-Ploum, M. and Kohen, F. (2003). Biosensor immunoassay
for the detection of eight sulfonamides in chicken serum. Analytica Chimica Acta,
483, 171–180.
Haasnoot, W., Bienenmann-Ploum, M., Lamminmäki, U., Swanenburg, M. and van
Rhijn, H. (2005). Application of a multi-sulfonamide biosensor immunoassay
for the detection of sulfadiazine and sulfamethoxazole residues in broiler serum
and its use as a predictor of the levels in edible tissue. Analytica Chimica Acta,
552, 87–95.
Haasnoot, W., Gerçek, H., Cazemier, G. and Nielen, M. W. (2007). Biosensor immuno-
assay for flumequine in broiler serum and muscle. Analytica Chimica Acta, 586,
312–318.
Sensors and Biosensors for Meat Safety 191

He, Y., Reed, S., Bhunia, A. K., Gehring, A., Nguyen, L. H. and Irwin, P. L. (2015).
Rapid identification and classification of Campylobacter spp. Using laser optical
scattering technology. Food Microbiology, 47, 28–35.
Huang, X., Aguilar, Z. P., Li, H. et al. (2013). Fluorescent Ru (phen)32+-doped silica
nanoparticles-based ICTS sensor for quantitative detection of enrofloxacin resi-
dues in chicken meat. Analytical Chemistry, 85, 5120–5128.
Huet, A. C., Charlier, C., Singh, G. S. et al. (2008). Development of an optical sur-
face plasmon resonance biosensor assay for (fluoro) quinolones in egg, fish, and
poultry meat. Analytica Chimica Acta, 623, 195–203.
Huet, A. C., Charlier, C., Weigel, S., Godefroy, S. B. and Delahaut, P. (2009). Validation
of an optical surface plasmon resonance biosensor assay for screening (fluoro)
quinolones in egg, fish and poultry. Food Additives & Contaminants. Part A, Chem-
istry, Analysis, Control, Exposure & Risk Assessment, 26, 1341–1347.
Hulanicki, A., Glab, S. and Ingman, F. (1991). Chemical sensors. Definitions and clas-
sification. Pure and Applied Chemistry, 63, 1247–1250.
Inbaraj, B. S. and Chen, B. H. (2016). Nanomaterial-based sensors for detection of
foodborne bacterial pathogens and toxins as well as pork adulteration in meat
products. Journal of Food and Drug Analysis, 24, 15–28.
Karaseva, N. A. and Ermolaeva, T. N. (2012). A piezoelectric immunosensor for chlor-
amphenicol detection in food. Talanta, 93, 44–48.
Karaseva, N. A. and Ermolaeva, T. N. (2014). Piezoelectric immunosensors for the
detection of individual antibiotics and the total content of penicillin antibiotics
in foodstuffs. Talanta, 120, 312–317.
Karasevaa, N., Ermolaevaa, T. and Mizaikoff, B. (2016). Piezoelectric sensors using
molecularly imprinted nanospheres for the detection of antibiotics. Sensors and
Actuators B: Chemical, 225, 199–208.
Kim, S., Burgula, Y., Ojanen-Reuhs, T., Cousin, M. A., Reuhs, B. L. and Mauer, U. J.
(2006a). Differentiation of crude lipopolysaccharides from Escherichia coli strains
using Fourier transform infrared spectroscopy and chemometrics. Journal of
Food Science, 71, M57–M61.
Kim, S., Kim, H., Reuhs, B. L. and Mauer, L. J. (2006b). Differentiation of outer
membrane proteins from Salmonella enterica serotypes using Fourier transform
infrared spectroscopy and chemometrics. Letters in Applied Microbiology, 42,
229–234.
Kim, G., Moon J. H. and Morgan, M. (2013). Multivariate data analysis of impedi-
metric biosensor responses from Salmonella typhimurium. Analytical Methods,
5, 4074–4080.
Kim, D. M., Rahman, M. A., Do, H., Ban, C. and Shim, Y. B. (2010). An amperomet-
ric chloramphenicol immunosensor based on cadmium sulfide nanoparticles
modified-dendrimer bonded conducting polymer. Biosensors and Bioelectronics,
25, 1781–1788.
Ko, S. H. and Grant, S. A. (2006). A novel FRET-based optical fiber biosensor for rapid
detection of Salmonella typhimurium. Biosensors and Bioelectronics, 21, 1283–1290.
Koo, O.K., Aroonnual, A., Bhunia, A.K. (2011). Human heat-shock protein 60 recep-
tor-coated paramagnetic beads show improved capture of Listeria monocyto-
genes in the presence of the other Listeria in food. Journal of Applied Microbiology,
111, 93-104.
192 Advanced Technologies for Meat Processing, Second Edition

Lan, Y.B., Wang, S.-Z., Yin, Y.-G., Hoffmann W.C., Zheng X. (2008) Using a surface
plasmon resonance biosensor for rapid detection of Salmonella Typhimurium in
Chicken Carcass. Journal of Bionic Engineering, 5, 239–246.
Leggieri, M. C., Pont, N. P., Battilani, P. and Magan, N. (2011). Detection and dis-
crimination between ochratoxin producer and non-producer strains of Penicil-
lium nordicum on a ham-based medium using an electronic nose. Mycological
Research, 27, 29–35.
Li, Y., Qi, P., Ma, X. and Zhong, J. (2014). Quick detection technique for clenbuterol
hydrochloride by using surface plasmon resonance biosensor. European Food
Research and Technology, 239, 195–201.
Liang, P. S., San Park, T. and Yoon, J.-Y. (2014). Rapid and reagentless detection of
microbial contamination within meat utilizing a smartphone-based biosensor.
Scientific Reports, 4, 5953.
Lin, K. C., Hong, C. P. and Chen, S. M. (2013). Simultaneous determination for toxic
ractopamine and salbutamol in pork sample using hybrid carbon nanotubes.
Sensors and Actuators B: Chemical, 177, 428–436.
Lin, X., Ni, Y. and Kokot, S. (2014). A novel electrochemical sensor for the analysis of
β-agonists: The poly (acid chrome blue K)/graphene oxide-nafion/glassy car-
bon electrode. Journal of Hazardous Materials, 260, 508–517.
Lippolis, V., Ferrara, M., Cervellieri, S. et al. (2016). Rapid prediction of ochratoxin
A-producing strains of Penicillium on dry-cured meat by MOS-based electronic
nose. International Journal of Food Microbiology, 218, 71–77.
Liu, H., Fang, G. and Wang, S. (2014). Molecularly imprinted optosensing material
based on hydrophobic CdSe quantum dots via a reverse microemulsion for spe-
cific recognition of ractopamine. Biosensors and Bioelectronics, 55, 127–132.
Liu, Y., Ye J. and Li, Y. (2003). Rapid detection of Escherichia coli O157:H7 inoculated
in ground beef, chicken carcass, and lettuce samples with an immunomagnetic
chemiluminescence fiber-optic biosensor. Journal of Food Protection, 66, 512–517.
Liu, B., Zhang, B., Cui, Y., Chen, H., Gao, Z. and Tang, D. (2011). Multifunctional gold
silica nanostructures for ultrasensitive electrochemical immunoassay of strepto-
mycin residues. ACS Applied Materials and Interfaces, 3, 4668–4676.
Liu, Z., Zhou, Y., Wang, Y., Cheng, Q. and Wu, K. (2012). Enhanced oxidation and
detection of toxic ractopamine using carbon nanotube film-modified electrode.
Electrochimica Acta, 74, 139–144.
Loneragan, G. H., Thomson, D. U. and Scott, H. M. (2014). Increased mortality in
groups of cattle administered the beta-adrenergic agonists ractopamine hydro-
chloride and zilpaterol hydrochloride. PLOS ONE, 9, e91177, 1–13.
Loutfi, A., Coradeschi, S., Mani, G. K., Shankar, P., Bosco J. and Rayappan, B. (2015).
Electronic noses for food quality: A review. Journal of Food Engineering, 144,
103–111.
Lu, X., Zheng, H., Li, X. Q. et al. (2012). Detection of ractopamine residues in pork
by surface plasmon resonance-based biosensor inhibition immunoassay. Food
Chemistry, 130, 1061–1065.
Ma, X., Jiang, Y., Jia, F., Yu, Y., Chen, J. and Wang, Z. (2014). An aptamer-based elec-
trochemical biosensor for the detection of Salmonella. Journal of Microbiological
Methods, 98, 94–98.
McGrath, T., Baxter, A., Ferguson, J., Haughey, S. and Bjurling, P. (2005). Multi sulfon-
amide screening in porcine muscle using a surface plasmon resonance biosen-
sor. Analytica Chimica Acta, 529, 123–127.
Sensors and Biosensors for Meat Safety 193

Mersmann, H. J. (1998). Overview of the effects of beta-adrenergic receptor agonists

on animal growth including mechanisms of action. Journal of Animal Science, 76,
160–172.
Morant-Miñana, M. C. and Elizalde, J. (2015). Microscale electrodes integrated on
COP for real sample Campylobacter spp. detection. Biosensors and Bioelectronics,
70, 491–497.
Mura, S., Greppi, G., Marongiu, M. L. et al. (2012). FT-IR nanobiosensors for Esch-
erichia coli detection. Beilstein Journal of Nanotechnology, 3, 485–492.
Novais, A., Comas, I., Baquero, F. et al. (2010). Evolutionary trajectories of beta-lac-
tamase CTX-M-1 cluster enzymes: Predicting antibiotic resistance. PLOS Patho-
gens, 6, e1000735, 1–16.
Ohk, S. H. and Bhunia, A. K. (2013). Multiplex fiber optic biosensor for detection
of Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella enterica from
ready-to-eat meat samples. Food Microbiology, 33, 166–171.
Ohk, S. H., Koo, O. K., Sen T., Yamamoto, C. M. and Bhunia, A. K. (2010). Antibody
aptamer functionalized fibre-optic biosensor for specific detection of Listeria
monocytogenes from food. Journal of Applied Microbiology, 109, 808–817.
Panigrahi, S., Balasubramanian, S., Gu, H., Logue, C. M. and Marchello, M. (2006a).
Neural network-integrated electronic nose system for identification of spoiled
beef. LWT Food Science and Technology, 39, 135–145.
Panigrahi, S., Balasubramanian, S., Gu, H., Logue, C. M. and Marchello, M. (2006b).
Design and development of a metal oxide based electronic nose for spoilage
classification of beef. Sensors and Actuators B: Chemical, 119, 2–14.
Panigrahi, S., Sankaran, S., Mallik, S., Gaddam, B. and Hanson, A. A. (2012). Olfactory
receptor-based polypeptide sensor for acetic acid VOC detection. Materials Sci-
ence and Engineering: C, 32, 1307–1313.
Park, I. S. and Kim, N. (2006). Development of a chemiluminescent immunosensor for
chloramphenicol. Analytica Chimica Acta, 578, 19–24.
Pérez-Lόpez, B. and Merkoçi, A. (2011). Nanomaterials based biosensors for food
analysis applications. Trends in Food Science & Technology, 22, 625–639.
Pikkemat, M.G., Rapallini, M.L.B.A., Karp M.T., Elferink, J.W.A. (2010). Application
of a luminescent bacterial biosensor for the detection of tetracyclines in rou-
tine analysis of poultry muscle samples, Food Additives & Contaminants: Part A:
Chemistry, Analysis, Control, Exposure & Risk Assessment, 27, 1112–1117.
Piletsky, S. and Turner, A. (2006). New generation of chemical sensors based on MIPs.
In: Molecular Imprinting of Polymers, Piletsky, S. and Turner, A.P.F. (Eds.), United
States: 1–16.
Pilolli, R., Monaci, L. and Visconti, A. (2013). Advances in biosensor development
based on integrating nanotechnology and applied to food-allergen manage-
ment. Trends in Analytical Chemistry, 47, 12–26.
Pizzariello, A., Stred’ansky, M., Stred’anska, S., Stanislav, M. (2001). A solid binding
matrix/molecularly imprinted polymer-based sensor system for the determina-
tion of clenbuterol in bovine liver using differential-pulse voltammetry. Sensors
and Actuators B, 76, 286–294.
Quintela, I. A., de los Reyes, B. G., Lin, C. S. and Wu, V. C. H. (2015). Simultane-
ous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains
by optical biosensing with oligonucleotide-functionalized gold nanoparticles.
Nanoscale, 7, 2417–2426.
194 Advanced Technologies for Meat Processing, Second Edition

Rajkumar, M., Li, Y. S. and Chen, S. M. (2013). Electrochemical detection of toxic rac-
topamine and salbutamol in pig meat and human urine samples by using poly
taurine/zirconia nanoparticles modified electrodes. Colloids and Surfaces. B, Bio-
interfaces, 110, 242–247.
Sadeghi, S., Jahani, M. and Belador, F. (2016). The development of a new optical sen-
sor based on the Mn doped ZnS quantum dots modified with the molecularly
imprinted polymers for sensitive recognition of florfenicol. Spectrochimica Acta.
Part A, Molecular and Biomolecular Spectroscopy, 159, 83–89.
Samsonova, J. V., Cannavan A. and Elliott, C. T. (2012). A critical review of screening
methods for the detection of chloramphenicol, thiamphenicol, and florfenicol
residues in foodstuffs. Critical Reviews in Analytical Chemistry, 42, 50–78.
San Park, T., Li, W., McCracken, K. E. and Yoon, J. Y. (2013). Smartphone quantifies
Salmonella from paper microfluidics. Lab on a Chip, 13, 4832–4840.
Sankaran, S., Suranjan, P., Mallik, S. (2011). Odorant binding protein based biomi-
metic sensors for detection of alcohols associated with Salmonella contamina-
tion in packaged beef. Biosensors and Bioelectronics, 26, 3103–3109.
Su, X. L. and Li, Y. B. (2005). A QCM immunosensor for Salmonella detection with
simultaneous measurements of resonant frequency and motional resistance.
Biosensors and Bioelectronics, 21, 840–848.
Steinmetz, V., Crochon, M., BellonMaurel, V., Garcia Fernandez, J. L., Barreiro Elorza,
P. and Verstreken, L. (1996). Sensors for fruit firmness assessment: Comparison
and fusion. Journal of Agricultural Engineering Research, 64, 15–28.
Sun, W., Qin, P., Gao, H., Li, G. and Jiao, K. (2010). Electrochemical DNA biosen-
sor based on chitosan/nano-V2O5/MWCNTs composite film modified carbon
ionic liquid electrode and its application to the LAMP product of Yersinia entero-
colitica gene sequence. Biosensors and Bioelectronics, 25, 1264–1270.
Thevenot, D. R., Toth, K., Durst, R. A. and Wilson, G. S. (1999). Electrochemical bio-
sensors: recommended definitions and classification. Pure and Applied Chemistry,
71, 2333–2348.
Tortajada-Genaro, L. A., Rodrigo, A., Hevia, E., Mena, S., Niñoles, R. and Maquieira,
Á. (2015). Microarray on digital versatile disc for identification and genotyping
of Salmonella and Campylobacter in meat products. Analytical and Bioanalytical
Chemistry, 407, 7285–7294.
Valadez, A. M., Lana, C. A., Tu, S.-I., Morgan, M. T. and Bhunia, A. K. (2009). Eva-
nescent wave fiber optic biosensor for Salmonella detection in food. Sensors,
9, 5810–5824.
Wackerlig, J. and Lieberzeit, P. A. (2015). Molecularly imprinted polymer nanopar-
ticles in chemical sensing—synthesis, characterisation and application. Sensors
and Actuators B Chemical, 207, 144–157.
Wang, L., Yang, R., Chen, J., Li, J., Qu, L. and Harrington, P. B. (2014). Sensitive voltam-
metric sensor based on isopropanol–Nafion–PSS–GR nanocomposite modified
glassy carbon electrode for determination of clenbuterol in pork. Food Chemistry,
164, 113–118.
Wang, H., Zhang, Y., Li, H. et al. (2013). A silver–palladium alloy nanoparticle-based
electrochemical biosensor for simultaneous detection of ractopamine, clen-
buterol and salbutamol. Biosensors and Bioelectronics, 49, 14–19.
Warriner, K., Reddy, S. M., Namvar A. and Neethirajan, S. (2014). Developments in
nanoparticles for use in biosensors to assess food safety and quality. Trends in
Food Science & Technology, 40, 183–199.
Sensors and Biosensors for Meat Safety 195

Wei, S., Jakusch, M. and Mizaikoff, B. (2006). Capturing molecules with templated
materials—Analysis and rational design of molecularly imprinted polymers.
Analytica Chimica Acta, 578, 50–58.
Wu, C., Sun, D., Li, Q. and Wu, K. (2012). Electrochemical sensor for toxic ractopamine
and clenbuterol based on the enhancement effect of graphene oxide. Sensors and
Actuators B Chemical, 168, 178–184.
Yang, Y., Fang, G., Wang, X. et al. (2014b). Sensitive and selective electrochemical
determination ofquinoxaline-2-carboxylic acid based on bilayer of novel poly
(pyrrole) functional composite using one-step electro-polymerization and
molecularly imprinted poly (o-phenylenediamine). Analytica Chimica Acta, 806,
136–143.
Yang, X., Feng, B., Yang, P., Ding, Y., Chen, Y. and Fei, J. (2014a). Electrochemical
determination of toxic ractopamine at an ordered mesoporous carbon modified
electrode. Food Chemistry, 145, 619–624.
Yang, G. J., Huang, J. L., Meng, W. J., Shen, M. and Jiao, X. A. (2009). A reusable capaci-
tive immunosensor for detection of Salmonella spp. based on grafted ethylene
diamine and self-assembled gold nanoparticle monolayers. Analytica Chimica
Acta, 647, 159–166.
Zhang, J., Shao, X., Yue, J., Li, D. and Chen, Z. (2014). Preparation of ractopamine-
tetraphenylborate complexed nanoparticles used as sensors to rapidly deter-
mine ractopamine residues in pork. Nanoscale Research Letters, 9, 639(1–7).
Zhang, Z., Yang, X., Zhang, H. et al. (2011). Novel molecularly imprinted polymers
based on multi-walled carbon nanotubes with binary functional monomer
for the solid-phase extraction of erythromycin from chicken muscle. Journal of
Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences, 879,
1617–1624.
Zhao, Y., Zhang, G., Liu, Q., Teng, M., Yang, J. and Wang, J. (2008). Development
of an immunochromatography strip for the rapid detection of 12 fluoroquino-
lones in chicken muscle and liver. Journal of Agricultural and Food Chemistry, 56,
12138−12142.
Zhou, Y., Wang, P., Su, X., Zhao, H. and He, Y. 2013. Colorimetric detection of racto-
pamine and salbutamol using gold nanoparticles functionalized with melamine
as a probe. Talanta, 112, 20–25.
Zhu, Y., Son, J. I. and Shim, Y. B. (2010). Amplification strategy based on gold nanopar-
ticle-decorated carbon nanotubes for neomycin immunosensors. Biosensors and
Bioelectronics, 26, 1002–1008.
6
Meat Decontamination by Irradiation

Dong U. Ahn, Eun Joo Lee, and Aubrey Mendonca

CONTENTS
6.1 Introduction ................................................................................................ 198
6.2 Food Irradiation ......................................................................................... 199
6.2.1 History of Food Irradiation .......................................................... 199
6.2.2 Irradiation Process ......................................................................... 201
6.3 Microbial Decontamination of Meat by Irradiation ............................. 204
6.3.1 Factors Affecting Radiation Destruction of
Microorganisms in Meat............................................................... 205
6.3.1.1 Irradiation Dose .............................................................. 205
6.3.1.2 Meat Composition ........................................................... 205
6.3.1.3 Temperature ..................................................................... 205
6.3.1.4 Microbial Factors ............................................................. 206
6.3.2 Combinations of Irradiation and Other Antimicrobial
Interventions................................................................................... 207
6.4 Quality Changes in Meat by Irradiation ................................................ 209
6.4.1 Lipid Oxidation .............................................................................. 209
6.4.2 Off-Odor Production ..................................................................... 210
6.4.2.1 Sources of Off-Odor Production in
Irradiated Meat ................................................................ 210
6.4.2.2 Mechanism of Off-Odor Production in
Irradiated Meat ................................................................ 211
6.4.3 Color Change .................................................................................. 212
6.4.3.1 Color Changes in Irradiated Raw and
Cooked Meat ................................................................. 212
6.4.3.2 Mechanism of Color Changes in
Irradiated Meat ................................................................ 213
6.4.4 Texture Change .............................................................................. 215
6.4.5 Consumer Acceptance of Irradiated Meat ................................. 215
6.5 Control of Quality Changes in Meat by Irradiation ............................. 216
6.5.1 Additives ......................................................................................... 216
6.5.2 Packaging ........................................................................................ 217
6.5.3 Packaging and Additive Combinations...................................... 217
6.6 Future Research Needed .......................................................................... 218
References............................................................................................................. 219

197
198 Advanced Technologies for Meat Processing, Second Edition

6.1 Introduction
Meat is one of the major sources of pathogens that cause foodborne illness
in humans. The intervention strategies for pathogens in meat can be divided
into preharvest reduction of microorganisms in livestock and postharvest
decontamination on carcass and meat. The reduction of bacteria in animal
is achieved by priming their immune system via the use of dietary supple-
mentation with known immune stimulants. Postharvest interventions are
traditional meat decontamination methods that use various physical and
chemical methods during slaughtering and processing steps (Farkas, 2006).
Irradiation is among the most effective physical decontamination technolo-
gies for inactivating foodborne pathogens and improving the safety of meats
(Roberts, 2014). Irradiation of meat for the purpose of killing indigenous
microflora, and thereby extending shelf life, has been known as a preser-
vation technique for several decades. The major advantages of irradiating
meat are it is a nonthermal processing, maintains the integrity of products,
and leaves no chemical residues. Also, the products can be treated after final
packaging, which prevents further cross-contamination during postprocess-
ing handling.
The bacteriocidal action of ionizing irradiation is through the damage
of bacterial DNA by the free radicals produced during the irradiation
process. The effect of irradiation in inhibiting foodborne pathogens and
spoilage bacteria in meat products is dose dependent. The survival of
microbial cells upon irradiation treatments is influenced by the nature
and extent of direct damage produced inside the cell; the number, nature,
and longevity of irradiation-induced chemical species; and the inherent
ability of cells to withstand the assaults and undergo repair. Extracellu-
lar conditions such as pH, temperature, and chemical composition of the
food, in which the microorganisms are also suspended, have significant
effects on the microcidal efficiency of irradiation. Although very effective
for controlling pathogens, irradiation can deplete antioxidants in muscle,
induce color change, increase production of off-odor volatiles, and neg-
atively alter the sensory characteristics of meat products. Formation of
2-alkylcyclobutanones, benzene, and methyl benzene (toluene) in irradi-
ated foods is also another important issue that consumers are concerned
about.
This chapter discusses the history, principles, and microcidal effects of
irradiation as well as how irradiation influences quality, sensory characteris-
tics, and consumer acceptance of meat products. The combinations of physi-
cal and/or chemical treatments that can improve the efficacy of irradiation
and the quality and consumer acceptance of irradiated meat products are
also discussed.
Meat Decontamination by Irradiation 199

6.2 Food Irradiation

6.2.1 History of Food Irradiation
Food irradiation has been studied for over 70 years. Most of the food products
approved for irradiation have been investigated for more than 40 years before
approval in the United States. To date, no other food technology has as long a
history of scientific research and testing before gaining approval. Food irradi-
ation research has been comprehensive, and included toxicological, microbio-
logical evaluation, and wholesomeness (WHO, 1994). Although two patents
were filed in 1905 and x-ray treatment was applied to kill Trichina in pork in
1921, food irradiation was economically unfeasible in the United States until
World War II because of the high cost of ionizing radiation sources. In the
1940s, machines that can produce high-energy electron beams of up to 24
million electron volts (eV) became available. This energy was strong enough
to penetrate six inches deep into food when electron beams were “fired”
from both sides of the product. Also, man-made radionuclides such as Co-60
and Cs-137, which emit gamma rays during their radioactive decay, became
available through the development of atomic energy. The availability of these
sources stimulated research in food irradiation aimed at the development
of commercial processes. In the mid-1940s, the use of irradiation to preserve
foods was suggested. From 1940 to 1953, exploratory research on food irra-
diation in the United States was sponsored by the Department of the Army,
the Atomic Energy Commission, and private industry. In the late 1940s and
early 1950s, researchers investigated the potential of ultraviolet light, x-rays,
electrons, neutrons, and alpha particles for food preservation and concluded
that only electrons had the necessary characteristics of efficiency, safety, and
practicality. They considered x-rays to be impractical because of very low con-
version efficiency from electron to x-ray at that time (Hayashi, 1991). Ultravio-
let light and alpha particles were also considered to be impractical because
of their limited ability to penetrate matter. Neutrons exhibited an excellent
penetration capability and were very effective in the inactivation of bacteria,
but were considered inappropriate for use because of the potential for induc-
ing radioactivity in food. Proctor and Goldblith (1951) found that the physi-
cal characteristics of food products were important factors in determining
the correct dose of radiation for bacterial inactivation. Enzymes were more
resistant to ionizing radiation than bacteria, and irradiation in frozen state
minimized the development of off-flavor.
Most in-depth studies in food irradiation since 1952 have been govern-
ment-sponsored because of military interest in this type of food processing.
Much of the early research to sterilize foods was done by the Quartermas-
ter Corps of the U.S. Army at the Food and Container Institute in Chicago
200 Advanced Technologies for Meat Processing, Second Edition

because of its need to provide high-quality, shelf-stable field rations for

troops. The Army Quartermaster Corps concluded that wholesome, eco-
nomical, shelf-stable field rations could be provided through irradiation.
Department began to assess the safety of irradiated foods in 1955, petitions
to the Food and Drug Administration (FDA) for the approval of irradiation
of specific foods followed, and commercial radiation equipment and sources
were developed. In the meantime, the International Atomic Energy Agency
(IAEA) that promoted nuclear technologies was working on the global
acceptance of food irradiation. In 1959, IAEA signed an agreement with the
World Health Organization (WHO) giving IAEA “the primary responsibility
for encouraging, assisting and coordinating research on, and development
and practical application of atomic energy for peaceful uses throughout the
world.” As a result, IAEA has had authority over nuclear energy programs,
has played a major role in encouraging people to accept irradiated food, and
has organized scientific committees that promote the wholesomeness of irra-
diated food (IAEA, 1991).
In 1962, the U.S. Army built a food irradiation facility at the Army’s
research laboratories and conducted research in sterilizing meat products
using high-dose irradiations; it developed shelf-stable bacon, ham, pork,
beef, hamburger, corned beef, pork sausage, codfish cakes, and shrimp,
but the first products approved for irradiation by the FDA were wheat and
wheat powder in 1963. In the early 1970s, the National Aeronautics and Space
Administration (NASA) adopted an irradiation process to sterilize meats for
astronauts in space, and added them to the flight menu of Apollo 17 in 1972.
In 1975, irradiated ham, turkey, beef steak, and corned beef were used on the
Apollo–Soyuz Test Project (ASTP) where irradiated foods were shared with
the Russian cosmonauts.
In 1980, the Food and Agriculture Organization (FAO) of the United
Nations, the IAEA, and the WHO stated that “irradiation of any food com-
modity up to an overall average dose of 1 Mrad (10 kGy) presents no toxi-
cological hazard and introduces no special nutritional or microbiological
changes; hence, toxicological testing of foods so treated is no longer required”
(WHO, 1981). During the 1980s, the FDA approved petitions for irradiation of
spices and seasonings, pork, fresh fruits, and dry or dehydrated substances.
The U.S. Department of Agriculture (USDA) approved irradiation of pork to
destroy Trichinella spirallis (USDA-FSIS, 1986), and pathogen control for poul-
try and red meats (USDA-FSIS, 1999). More recently, WHO convened a Study
Group to review all data on products irradiated above the 10-kGy ceiling
and concluded the products to be safe and wholesome. As a result, WHO
has recommended removing the dose limit so that irradiation can be used to
sterilize foods commercially as in canning (WHO, 1999). During the past six
decades, the commercial development of food irradiation has been delayed
because of consumers’ notion that food irradiation is linked to the atomic
bomb and nuclear radiation. More than 60 countries have permitted irradia-
tion of food, and more than 600,000 tons of food is irradiated annually in the
Meat Decontamination by Irradiation 201

world (Kume et al., 2009). The United States also has more than 40 licensed
irradiation facilities, most of which are used to sterilize medical and phar-
maceutical supplies. The approval date, dose, and purpose of food irradia-
tion in the United States are listed in Table 6.1.

6.2.2 Irradiation Process

Atoms are made up of three types of particles: protons, neutrons, and elec-
trons. These particles are held together by energy, and atomic nuclei contain
protons (+ charge) and neutrons (uncharged) in about 1:1–1:1.5 ratio (Thakur
and Singh, 1994). If any changes of number and arrangements in the forces
of the nuclear particles occur, they lose balance and consequently become

TABLE 6.1
Approval of Food Irradiation in the United States
Date Products Dose (kGy) Purpose
1963 Wheat and wheat powder 0.2–0.5 Disinfect insects
1964, 1965 Potatoes 0.05–0.15 Inhibit sprouting
1983 Spices and dry seasonings <30 Disinfestation and
decontamination
1985 Pork 0.3–1.0 Control of Trichinella spiralis
1985, 1986 Dehydrated enzymes <10 Control insects and microbes
1986 Fruits and vegetables <1 Delay maturation and
disinfection
1986 Herb, spices, and <30 Control of microorganisms
seasonings
1990 Poultry, fresh and frozen <3.0 Control of microorganisms
1995 Meat, frozen and >44 Sterilization only for NASA
packaged
1997, 1999 Red meat, chilled <4.5 Control of microorganisms
Red meat, frozen <7.5
2000 Shell eggs <3.0 Control of Salmonella
enteriditis
2000 Sprouts <8.0 Control of pathogens in seeds
2005 Fresh or frozen molluscan <5.5 Control of Vibrio species and
and other shellfish foodborne pathogens
2008 Iceberg lettuce and <4.0 Control of foodborne
spinach pathogens and extension of
shelf life
2012 Uncooked meat, meat <4.5 Control of foodborne
by-products, and certain pathogens and extension of
meat food products shelf life
2014 Chilled or frozen raw, <6.0 Control of foodborne
cooked, or partially pathogens and extension of
cooked crustaceans shelf life
NASA, National Aeronautics and Space Administration.
202 Advanced Technologies for Meat Processing, Second Edition

an unstable or “radioactive” atom. This unstable atom can be restabilized

by emitting energy to rebalance the nucleus. To emit energy, electrons are
removed from the outer shell of atoms and the energy levels of electrons
are changed as the electrons return to their original energy levels. This
energy is electromagnetic and its emission, as particles or waves, is termed
“radiation” (Halliwell and Gutteridge, 1989).
The amounts of emission energy depend on the level of energy being
released. Low-energy electromagnetic radiations occur in TV, radio, and
microwave as long waves; intermediate radiations occur in visible light,
heat, and solar energy; high-energy radiations occur in x-ray and gamma
ray; very high-energy radiations occur in the radioactive decay of radionu-
clides like uranium (Lagunas-Solar, 1995). If radiation has sufficient energy
to move atoms in another material without chemical changes it is called a
“nonionizing radiation,” and if it also has sufficient energy to break chemi-
cal bonds it is called “ionizing radiation.” The amount of energy to break a
carbon–carbon bond is about ~33 eV and a dose of 1 kGy has been estimated
to break <1 chemical bond in 1 million bonds present (CAST, 1986).
Radionuclides, such as 60Co, 137Cs, and uranium, are defined as the atoms
that contain excess energy in the nucleus due to an excess of either proton or
neutron. They emit energy as alpha particles, beta particles, and photons, and
emitting the energy in these atoms is called “decay.” Alpha particles are emit-
ted from very large atoms such as radium, uranium, and plutonium when the
neutron:proton ratio is too low. Alpha particles travel slowly and lose energy
rapidly due to their charge and mass, expanding it in a few centimeters. Beta
particles are emitted when the neutron:proton ratio is too high, and 60Co, 137Cs,
and 14C release beta particles. They have ~1/2000 mass of a neutron or pro-
ton. So, they can travel several feet from their source but are stopped by solid
materials. The movement of a neutron does not reduce the nuclear energy level
enough, and the extra energy is released as a gamma photon (Efiok, 1996).
Photons such as gamma rays and x-rays are emitted when the energy of
atoms (60Co and 137Cs) is exhausted: gamma rays are emitted from nucleus
and x-rays are from electron fields. Gamma rays have such high energy and
are so small that they pass through living tissues without interacting with
them (Jarrett, 1982). These gamma rays do not ionize atoms directly. They
transfer energy to secondary electrons, which then interact with other mate-
rials to form ions. When a photon or an accelerated electron enters material,
the energy can be transferred or absorbed by an electron of an atom in the
material. The electron of an atom in the material increases in energy level
and leaves its orbit. The ejected electron, called a “Compton electron,” trans-
fers its energy to a secondary electron and reduces the total energy of the
Compton electron (Diehl, 1995). By the same token, Compton electrons cause
further excitation and ionization in the material and this primary effect is
called the “Compton effect.” Because of this effect, energy is passed through
a cascade of electrons until not enough energy to cause electrons to escape
their orbitals is left (Venugopal et al., 1999).
Meat Decontamination by Irradiation 203

As the basic principle of the radiation process, irradiation energy applied

to biological materials ejects electrons from the atoms/molecules of the
material and produces ions and free radicals (Woods and Pikaev, 1994). The
first target of highly energized electrons is water molecules in biological sub-
stances. The dispersion of ions and free radicals is greater when water is
present in free form than in bound form (dried products) or in crystalline
form (frozen products) (Thakur and Singh, 1994). The hydroxyl radical (HO·),
the primary radiolytic product of water, is a powerful oxidizing agent, and
this free radical tends to recombine to form stable products (Taub et al., 1979).
Because the dispersion and capture of electrons are purely random, large
molecules and compounds have a greater probability of being affected than
smaller molecules. The cellular components such as DNA, pigments, fatty
acids, and membrane lipids can be damaged by ionizing radiation. When the
DNA of living cells is exposed to OH· by radiation, both single and double
strands in the molecule are broken.
Radionuclides such as 137Cs and 60Co are used as the major sources of
gamma rays, and a linear accelerator is used to generate high-energy elec-
trons and x-rays. 137Cs is produced when uranium and plutonium absorb
neutrons and a undergo fission in nuclear reactors. 137Cs produces 0.66 MeV
gamma radiations, and it decays to nonradioactive barium (56Ba137) by emit-
ting beta particles and strong gamma rays (Lagunas-Solar, 1995). 60Co, the
most common energy source for irradiation, produces 1.33 MeV gamma
radiations as it decays to nonradioactive nickel by emitting beta particles
and powerful gamma rays. 60Co is a man-made radionuclide produced in
linear accelerators and as a nuclear reactor by-product by bombarding 59Co
with neutrons. Gamma rays are highly penetrable and can be used to treat
food contained inside a package. From a practical point of view, 60Co is pre-
ferred to 137Cs because the latter, apart from having weaker gamma rays,
is also water soluble and thus poses environmental hazards (Venugopal
et al., 1999).
An electon beam is a stream of high-energy electrons that are generated
electrically then accelerated through an electron gun. The electrons can be
accelerated to different energy levels including particles of high-energy elec-
trons and x-rays that are produced when high-energy electrons strike a thin
metal film (Josephson and Peterson, 2000). Electron beam accelerators accel-
erate electrons to a beam (up to 10 MeV) with minimal penetrating power into
thin foods (5–10 cm). Electron beams are with single-sided treatment, and 10
MeV electrons can give adequate treatment for thicknesses up to about 35
mm of unit density material. Using a conveyor belt with double-sided treat-
ment can give a bit more than double the single-sided depth because of the
way the two depth-dose curves superimpose; hence, a product thickness of
8 cm can be used (Satin, 2002). Although electrons are less penetrable than
gamma rays, they can be useful for irradiating large volumes of free flow-
ing food items such as grains or packages of fish fillets with no more than
8–10 cm thickness with a density of 1 g/cm3.
204 Advanced Technologies for Meat Processing, Second Edition

TABLE 6.2
The Characteristics of Ionizing Radiation Sources
Gamma Ray Electron Beam X-Ray
Energy type Electromagnetic Charged particle Electromagnetic
Energy volt (MeV) 1.17 + 1.33 ~10 ~5
Energy efficiency Low (~30%) High (~85%) Low (~10%)
Penetration capability Deep (60–80 cm) Low (8–10 cm) Deep
Source control Continuous Switch (on/off) Switch (on/off)
Source: Kwon, 2010, Korea Food Safety Research Institute.

Each of these sources has specific advantages and disadvantages (Jarrett,

1982). The advantages of 60Co include high penetration and dose uniformity,
allowing treatment of products of variable sizes, shapes, and densities, a long
history of satisfactory use in similar applications, ready availability, and low
environmental risk. The disadvantages include 12% of the source must be
replaced annually because of its short half-life (5.3 years) and a rather slow
processing rate compared with electron beam irradiation. The advantages of
a linear accelerator compared with the gamma irradiators are the following:
can simply be turned off when not in use, does not need to be replenished,
established history of use, and a high throughput rate. The disadvantages are
the complexity of the machine and the consequent need for regular mainte-
nance and the large requirements for power and cooling. Currently, e-beam
and gamma rays are used as radiation sources for commercial food irradia-
tion. Although x-rays have relatively high penetrating power, x-rays are not
used in food irradiation due to poor conversion of accelerated electrons to
x-rays (Hayashi, 1991). The comparative characteristics of ionizing radiation
sources used for food irradiation are shown in Table 6.2.
The quantity of energy absorbed by something (food) as it passes through a
radiation field is called “radiation absorbed dose.” The unit (SI) for irradiation
dose is Gray (Gy), which is equal to the absorption of energy equivalent to one
Joule per kilogram of absorbing material (1 Gy = 1 J·kg–1 = 6200 billion MeV
absorbed/kg of food = 0.01 calorie/lb of food = 100 rad, 1 rad = 100 erg/g).

6.3 Microbial Decontamination of Meat by Irradiation

Food irradiation is an effective technology for microbial decontamination of
foods including meats. The antimicrobial efficacy of food irradiation against
pathogenic microorganisms has been recognized for decades. The use of this
technology with the aim of destroying meat-borne pathogenic microorgan-
isms will also bring a reduction in the number of spoilage microorganisms
to increase shelf life of meats (Olson, 1998).
Meat Decontamination by Irradiation 205

6.3.1 Factors Affecting Radiation Destruction of Microorganisms in Meat

6.3.1.1 Irradiation Dose
Significant reductions in microbial populations in meats can be achieved
by using high radiation doses; however, such an approach can have adverse
effects on the desirable sensory attributes of meats. Therefore, emerging
trends in the application of irradiation include the use of this technology
and other interventions (e.g., antimicrobial food preservatives, heat, and
high hydrostatic pressure) as part of a hurdle technology approach to control
meat-borne pathogens. This approach allows the use of relatively low doses
of irradiation to improve microbial safety of meats while maintaining the
desirable sensory attributes of these nutritious food products.

6.3.1.2 Meat Composition

Meat composition affects the destruction of microorganisms by irradiation.
The proteins in the meat may protect microorganisms against the damaging
effects of irradiation by neutralizing free radicals (Diehl, 1995). This neutral-
izing effect of proteins may explain the relatively high radiation resistance
of microorganisms in meats and dairy products compared to nonprotein
foods of similar moisture content (Soladoye et al., 2015). Proteins and other
meat constituents, including natural antioxidants such as carnosine and
vitamin E, compete for free radicals formed by the radiolysis of water (Galan
et al., 2011). This competition for free radicals decreases the antimicrobial
efficacy of ionizing radiation. Carnosine has been reported to increase the
radiation resistance of Aeromonas hydrophila in minced turkey meat (Stec-
cheni et al., 1998). Irradiation produces peroxides from dextrose, and free
fatty acids, carbonyl compounds, hydrogen peroxide, and hydroperoxides
from fat. However, dextrose added in processed meat and fat content of meat
had no effect on microbial inactivation by irradiation (Sommers and Fan,
2002), probably because other meat constituents such as proteins may have
protected bacteria and other microorganisms from the antimicrobial prod-
ucts of fats and dextrose (Diehl, 1995).

6.3.1.3 Temperature
The temperature of meat during irradiation is an important factor that affects
the extent of irradiation destruction of microorganisms. Microbial resistance
to irradiation increases with decreases in temperature below the freezing
point of water. The impact of meat temperature on the survival of patho-
genic bacteria following irradiation has been reported for Campylobacter
jejuni (Clavero et al., 1994), Salmonella (Thayer and Boyd, 1991), Escherichia
coli O157:H7 (Arthur et al., 2005), Staphylococcus aureus (Thayer and Boyd,
1992), Listeria monocytogenes (Thayer and Boyd, 1995), and Clostridium botuli-
num spores (El-Bisi et al., 1966). Microorganisms exhibit a greater sensitivity
206 Advanced Technologies for Meat Processing, Second Edition

to irradiation at ambient temperatures than at subfreezing temperatures:

D10-values (dose required to destroy 90% of the bacterial population) for
E. coli O157:H7 in mechanically deboned chicken meat were 0.28 and 0.44
kGy at 5°C and at –5°C, respectively (Thayer and Boyd, 1993). Significantly
higher D10-values have been reported for E. coli O157:H7 in ground beef pat-
ties irradiated at –15°C than at 5°C. Freezing meat reduces water activity by
converting the water to ice, drastically reduce the generation of free radi-
cals from the radiolysis of water (Diehl, 1995). Additionally, the frozen state
impedes the migration of free radicals to other parts of the frozen product
beyond those areas of limited free radical production (Taub et al., 1979).

6.3.1.4 Microbial Factors

Microbial factors including numbers and types of microorganisms in meats
as well as the physiological state of the microorganisms can affect the extent
of microbial destruction by irradiation. As observed with other food pres-
ervation processes, the presence of large populations of microorganisms
reduces the effectiveness of a given irradiation dose. Therefore, decontami-
nation of meat using irradiation would be more efficient if the meat to be
treated is of good microbial quality. With regard to types of microorgan-
isms, microbial sensitivity to irradiation in meats, as in other foods, can vary
among microbial types. For example, viruses have much higher radiation
resistance than bacterial spores, which in turn show a higher radiation resis-
tance than vegetative bacterial cells. Bacterial vegetative cells are more radia-
tion resistant than fungi (yeast and molds). More complex life forms have a
higher sensitivity to irradiation than simpler life forms. This phenomenon is
supported by the observation that a dose as high as 40 kGy is necessary for
destroying viruses; however, a dose as low as 0.01 kGy could cause death in
humans (Satin, 1993). Gram-negative bacteria are more sensitive to ionizing
radiation than gram-positive bacteria. In fact irradiation doses of at least 1.0
kGy, which could virtually destroy gram-negative bacteria in food, exhibit a
much less destructive effect on gram-positive bacteria such as the lactic acid
producing bacteria (Lambert et al., 1992). Nonspore-forming bacteria exhibit
a greater sensitivity to irradiation than spore formers.
With regard to the physiological state of bacteria, exponential phase cells
are more sensitive to irradiation than lag phase cells or stationary phase
cells. More importantly, meat-borne bacteria that have adapted to certain
environmental stress demonstrate even greater radiation resistance than
stationary-phase bacteria. More recently, significant increases in the radia-
tion resistance (D10-value) of starved L. monocytogenes cells in ground pork at
4°C have been reported (Mendonca et al., 2004). Irradiation of ground pork at
2.5 kGy decreased initial populations of nonstarved cells (control) by about
6.0 log, whereas starved cells were decreased by only 3.8 log. D10-values for
exponential, stationary, and starved L. monocytogenes cells in ground pork
were reported to be 0.35, 0.42, and 0.66 kGy, respectively. Kundu et al. (2014)
Meat Decontamination by Irradiation 207

reported that 1 kGy irradiation treatment of beef reduced ≤1.9 log of Salmo-
nella and ≤4.0 log of E. coli O157:H7. Xavier et al. (2014) applied 2.5 kGy irra-
diation doses to beef and found 2 log cfu/g for L. monocytogenes and 5 log
cfu/g for E. coli O157: H7. The D10-values of foodborne pathogens, parasite,
and spoilage bacteria are listed in Table 6.3.

6.3.2 Combinations of Irradiation and Other

Antimicrobial Interventions
Doses of irradiation used alone for microbial decontamination of meat may
result in adverse sensory changes in these food products. Combinations
of relatively mild antimicrobial treatments and preservative hurdles can
enhance each other’s antimicrobial activity. In this regard, combinations of
marginally effective antimicrobials may result in enhanced microbial safety
and improved quality of foods. Food preservation methods applied to meats
including acidification, heating, and the addition of chemical food preserva-
tives can improve the decontamination efficacy of irradiation by increasing
the radiation sensitivity of meat-borne microorganisms and by inhibiting
the proliferation of microbial survivors following irradiation.
Various acidifying agents have been widely used in combination with
irradiation for controlling pathogens and extending the microbial shelf life
of meat products. Farkas and Andrassy (1993) examined the antimicrobial
effects of gamma irradiation (2 kGy) and acidulants (0.1% ascorbic acid or
0.5% glucono-delta-lactone) in vacuum-packaged minced meat and found

TABLE 6.3
D10-Values of Foodborne Pathogens, Parasite, and Spoilage Bacteria
Pathogen D10 (kGy) Medium Pathogen D10 (kGy) Medium
Trichinella 0.3–0.6 Pork Yersinia 0.11 Beef
spiralis enterocolitica
Bacillus cereus 0.14–0.19 Beef Clostridium 3.56 Chicken
(vegetative) botulinum
(spore)
Campylobacter 0.18 Beef Clostridium 0.58 Meat
jejuni perfringens
Escherichia coli 0.25 Beef Clostridium 6.3 Beef fat
O157:H7 sporogenes
(spore)
Listeria 0.51–059 Beef Moraxella 0.63–0.88 Chicken
monocytogenes phenylpyruvica
Salmonella spp. 0.48–0.70 Meat Pseudomonas 0.08–0.11 Chicken
putida
Staphylococcus 0.42 Chicken Streptococcus 0.65–0.7 Chicken
aureus faecalis
208 Advanced Technologies for Meat Processing, Second Edition

that acidulants delayed the growth of Enterobacteriaceae in nonirradiated

meat for two weeks at 0°C–2°C. However, a combination of acidulant with
irradiation completely prevented the growth of this microbial group during
refrigerated storage and temperature abuse (10°C). Bhide et al. (2001) sprayed
sheep carcasses with 1% propionic acid, 2% lactic acid, or 2% acetic acid at
a pressure of 3 kg/cm2 for two to four minutes. The meat harvested from
the carcasses was packaged and exposed to gamma irradiation at 1, 2, or
3 kGy. All organic acids used increased the sensitivity of Bacillus cereus to
irradiation. Acetic acid (2%) plus irradiation at 3 kGy was the most effec-
tive in reducing total viable count and B. cereus count during refrigerated
storage (5°C–7°C) of the meat samples. Citric acid, used as a surface treat-
ment for frankfurters, has been shown to decrease the irradiation resistance
of L. monocytogenes in this ready-to-eat (RTE) meat product. The D10-values
for L. monocytogenes on frankfurters dipped in 0, 1, 5, or 10% (w/v) citric acid
were 0.61, 0.60, 0.54, and 0.53 kGy, respectively (Sommers et al., 2003). Alaha-
koon et al. (2015) reported that 2% citrus peel extract treatment was effective
to extend the shelf life of 2 kGy irradiated chicken breast meat. Combinations
of organic acid and irradiation were more effective than each intervention
used alone for controlling the growth of total microbial counts and coliforms
in pork during storage at 4°C for 14 days.
Various other antimicrobial treatments have shown potential in enhanc-
ing destruction of microorganisms by irradiation. Kim and Thayer (1996)
reported that irradiation and heating combination significantly decreased
survival of Salmonella typhimurium irrespective of the order of application
of each treatment. Interestingly, application of irradiation before rather
than after heating was consistently more lethal to the pathogen. Huq et al.
(2015) indicated that microencapsulation of oregano and cinnamon essen-
tial oils combined with nisin showed an antimicrobial effect to reduce L.
monocytogenes in RTE ham. By using a combination of hurdles (low aw,
vacuum packaging, and irradiation), Kanatt et al. (2002) developed a few
RTE shelf-stable intermediate moisture (IM) spiced mutton and spiced
chicken products. Those researchers reduced the aw of the meat products
to 0.80 by grilling or hot-air drying. The IM meat products were then
vacuum sealed, treated with gamma irradiation at 0 (control), 2.5, 5.0, and
10.0 kGy, then stored at 30°C for six months (spiced chicken cubes) or
nine months (mutton kababs). No viable microorganisms were detected
in meat products treated with 10 kGy and those products retained accept-
able sensory quality for up to nine months. More recently, Chen et al.
(2004) demonstrated a synergistic effect between the bacteriocin pediocin
(in ALTA 2341) and electron beam irradiation for inhibiting L. monocy-
togenes in frankfurters. Storage of the frankfurters at 4°C enhanced the
antilisterial effects of the combined treatments; little or no growth of the
pathogen occurred in packages of frankfurters during 12 weeks of stor-
age. The combined treatments did not alter the sensory characteristics of
the frankfurters negatively.
Meat Decontamination by Irradiation 209

6.4 Quality Changes in Meat by Irradiation

The main goal of irradiating meat is eliminating pathogens and improving
the safety and storage stability of meat. However, the application of irradia-
tion technology by the meat industry is limited because of quality concerns
about irradiated meat products. Irradiation produces a characteristic odor as
well as alters meat flavor and color, which significantly influences consumer
acceptance. Consumers associate the brown/gray color in irradiated raw
beef with old or low-quality meat, and off-odor and off-flavor with undesir-
able chemical reactions. Thus, developing methods that can prevent these
quality changes in meat by irradiation is essential for implementing irradia-
tion technology in the meat industry.

6.4.1 Lipid Oxidation

Lipid is one of the main meat components, and polyunsaturated fatty acids
are the most susceptible to oxidation by irradiation. Hydroxyl radicals are
the most reactive oxygen species that can initiate lipid oxidation in meat.
Thakur and Singh (1994) reported that ionizing radiation generates hydroxyl
radicals in aqueous systems. Because meat contains near 75% water, irradia-
tion is expected to accelerate oxidative changes in meat. Irradiation-induced
lipid oxidation in meat is dose dependent (Ahn et al., 1997). The presence
of oxygen also has a significant effect on the development of oxidation and
odor production (Merritt et al., 1975; Badr, 2004). Without oxygen, lipid oxida-
tion in raw and cooked meat did not progress and thiobarbituric acid reac-
tive substances (TBARS) and volatiles of vacuum-packaged irradiated raw
and cooked meat did not correlate well. Under aerobic conditions, however,
TBARS had very high correlations with the amounts of aldehydes, total vola-
tiles, and ketones in aerobically packaged irradiated meat. Therefore, exclud-
ing oxygen from meat and meat products, whether they are irradiated or
not, is critical to stop oxidative chain reactions (Ahn et al., 2000b). Ahn et al.
(1998b) reported that preventing oxygen, especially for cooked meat, was
more important than irradiation dose and storage time (Ahn et al., 2000a).
Aerobically packaged sausages irradiated at a higher dose produced greater
amounts of TBARS than those irradiated at lower doses (Kanatt et al., 2015b).
The TBARS of sausages with higher polyunsaturated fatty acids was greater
than those with lower polyunsaturated fatty acids.
Diehl (1995) reported that irradiation of aqueous systems produced hydro-
gen peroxide, particularly in the presence of oxygen. During postirradiation
storage, hydrogen peroxide gradually disappears while other constituents
of the system are oxidized. A series of dienes, trienes, and tetraenes were
formed from unsaturated fatty acids by irradiation at high dose (60 kGy)
under vacuum conditions (Nawar, 1986). Shahidi and Pegg (1994) reported
that aldehydes contributed the most to oxidation flavor and rancidity in
210 Advanced Technologies for Meat Processing, Second Edition

cooked meat, and hexanal was the major volatile aldehyde. Lee and Ahn
(2003) reported that the TBARS values of oil emulsion immediately after
irradiation were lower than those of the nonirradiated ones, but rapidly
increased during storage. Especially, arachidonic acid, linolenic acid, and
fish oil, which had a large proportion of polyunsaturated fatty acids, had
accelerated lipid oxidation after irradiation.
Under frozen conditions, irradiation increased the TBARS of pork pat-
ties and turkey breast but storage time had no effect on lipid oxidation even
under aerobic packaging conditions (Nam and Ahn, 2002b). Taub et al. (1979)
reported that with less mobility in the frozen state, free radicals tend to
recombine to form the original substances rather than diffuse through the
food and react with other food components. Thus, the minimal lipid oxida-
tion detected in frozen turkey after irradiation should be due to the lim-
ited mobility of free radicals in frozen states. During the warming process,
however, they tend to react with each other rather than with the substrates
(Javanmard et al., 2006).

6.4.2 Off-Odor Production

6.4.2.1 Sources of Off-Odor Production in Irradiated Meat
All irradiated meat produces a characteristic, readily detectable, irradia-
tion odor regardless of the degree of lipid oxidation (Ahn et al., 1997).
Meat sterilized through irradiation develops a characteristic odor, which
has been described as “metallic,” “sulfide,” “wet dog,” “wet grain,” or
“burnt.” These investigators assumed that the off-odor was the result
of free-radical oxidation, which was initiated by the irradiation pro-
cess. Others described the irradiated meat odor as “bloody and sweet”
(Hashim et al., 1995) and “barbecued corn-like” (Ahn et al., 2000a). Batzer
and Doty (1955) found that methyl mercaptan and hydrogen sulfide were
important to irradiation odor, and the precursors of the undesirable odor
compounds in irradiated meat were sulfur-containing compounds that
were water soluble. Others postulated that hydrocarbons and carbonyl
from fats were the major source of irradiation off-odor. Sensory results,
however, clearly indicated that the major source of irradiation off-odor
was sulfur compounds. More recent studies showed that irradiation
greatly increased or newly produced many volatile compounds such
as 2-methyl butanal, 3-methyl butanal, 1-hexene, 1-heptene, 1-octene,
1-nonene, cis-3- and trans-6-nonenals, oct-1-en-3-one, hydrogen sulfide,
sulfur dioxide, mercaptomethane, bis(methylthio-)methane, methyl thio-
acetate, dimethyl disulfide, and trimethyl sulfide from meat (Patterson
and Stevenson, 1995; Fan et al., 2002). Among those volatile compounds,
sulfur volatiles showed much stronger and stringent odor intensity than
other compounds because sulfur compounds had very low odor thresh-
olds (Angelini et al., 1975). Volatiles from lipids played only a small part
Meat Decontamination by Irradiation 211

of the irradiation off-odor (Lee and Ahn, 2003). This indicated that sulfur
compounds would be the major volatile components responsible for the
characteristic off-odor in irradiated meat, and supported the concept that
the changes that occur following irradiation were different from those of
warmed-over flavor in the oxidized meat.

6.4.2.2 Mechanism of Off-Odor Production in Irradiated Meat

Ahn (2002) found that side chains of amino acids were susceptible to radio-
lytic degradation. More than one site of amino acid side chains was suscepti-
ble to free radical attack and many volatiles were produced by the secondary
chemical reactions after the primary radiolytic degradation of side chains.
The majority of volatiles produced by irradiation were sulfur compounds,
indicating that sulfur-containing amino acids are among the most suscep-
tible to irradiation (Ahn and Lee, 2002).
The perception of odor from samples containing sulfur volatiles changed
greatly depending upon their composition and amounts present in the
sample. The sulfur compounds were not only produced by the radiolytic
degradation of amino acid side chains (primary reaction), but also by the sec-
ondary reactions of the primary sulfur compounds with other compounds
around them. The amounts and types of sulfur compounds produced from
irradiated sulfur amino acids indicated that methionine is the major amino
acid responsible for the production of sulfur volatiles. Sensory panelists con-
firmed that all irradiated liposomes containing “sulfur amino acids” pro-
duced similar odor characteristics to irradiated meat, indicating that sulfur
amino acids are mainly responsible for irradiation odor (Ahn, 2002). The
volatile profiles and sensory characteristics of amino acids clearly explained
why irradiation odor was different from lipid oxidation odor, and why lipid
oxidation was responsible for only a small part of the off-odor in irradiated
meat (Ahn and Lee, 2002).
The mechanisms of volatile production from meat indicated that the
majority of the volatiles were from the radiolytic degradation of amino acid
side chains, but deamination and decarboxylation from α-carbon were also
involved in the production of volatile compounds (Dogbevi et al., 1999). The
Strecker degradation, ketonic decarboxylation, and oxidation–reduction were
involved in the production of aldehydes. Each amino acid monomers produced
different odor characteristics, but the intensities of odor from all nonsulfur
amino acid groups were weak. Cysteine and methionine produced similar
odor characteristics to that of the irradiated meat, but the amounts of sulfur
volatiles from methionine were far greater than that of the cysteine. This indi-
cated that the contribution of volatiles produced from nonsulfur amino acids
was minor, although interactions among volatiles, especially aldehydes with
other volatile compounds, can contribute to the off-odor of irradiated meat
products significantly. Although this study is done using a model system,
the results can be extrapolated to a meat system because about 70% of meat is
212 Advanced Technologies for Meat Processing, Second Edition

water, and protein (amino acid) is the major component involved in volatile
production in meat by irradiation (Ahn et al., 2002, 2016a,b).
Mottram et al. (2002) reported that the degradation of amino acids by oxi-
dative deamination–decarboxylation via Strecker degradation produced
branched-chain aldehydes. 2-methyl butanal, 3-methyl butanal, and 2-methyl
propanal are the main Strecker degradation products from isoleucine, leu-
cine, and valine, respectively, by irradiation (Ahn et al., 2016a). Davies (1996)
reported that irradiation of N-acetyl amino acids and peptides in the pres-
ence of oxygen give high yields of side-chain hydroperoxides, which can be
formed on both the backbone (at α-carbon positions) and the side chain. In
addition to amino acids, fatty acids are also degraded by irradiation. When
triglycerides or fatty acids are irradiated, hydrocarbons are formed from
fatty acids through various free-radical reactions. Radiolytic degradation of
fatty acid methyl ethers were affected by irradiation dose, irradiation tem-
perature, oxygen pressure, and fatty acid composition (Miyahara et al., 2002).
The release of nonpolar hydrocarbons was not influenced, but polar com-
pounds such as aldehydes, ketones, and alcohols were greatly influenced
by water. The volatility of aroma compounds depends on the vapor–liquid
partitioning of volatile compounds, which determines the affinity of volatile
molecules for each phase (Buttery et al., 1973). The interactions among food
components such as carbohydrates, lipids, and proteins (Godshall, 1997), and
the physicochemical conditions of foods, which influence conformation of
proteins, also affect the release of volatile compounds in foods (Lubbers et al.,
1998). Jo and Ahn (1999) reported that the amount of volatiles released from
oil emulsion correlated negatively with fat content. This indicated that the
relative amounts of volatile compounds released from meat systems could be
significantly different from those in the aqueous system (Jo and Ahn, 2000).

6.4.3 Color Change

6.4.3.1 Color Changes in Irradiated Raw and Cooked Meat
The color of meat depends on the concentration and chemical status of heme pig-
ments. Oxygen (O2), CO, S, or NO can be the sixth ligand of heme pigments and
is formed only when the heme iron is in reduced form. Although three common
forms of myoglobin exist in different proportions, fresh meat color is imparted
mainly by oxymyoglobin and deoxymyoglobin. The color of fresh meat is deter-
mined by oxygen partial pressure, oxygen diffusion rate, and oxygen consump-
tion rate at meat surface. Under normal conditions, enzymes use up all oxygen
available and generate reducing conditions inside meat block. Thus, the pig-
ments in the middle of a meat block are usually in the reduced form (deoxymyo-
globin, purple color) and weakly bind with water molecules or are stabilized by
distal histidine of globin. Discoloration in fresh meat is mainly caused by oxida-
tion of myoglobin to metmyoglobin when oxygen partial pressure is low, result-
ing in an unattractive brown color. The oxidized brown color can be turned into
Meat Decontamination by Irradiation 213

a bright red color under air (blooming or oxygenation) if the meat has strong
enough reducing power or purple-red under full-vacuum conditions.
The color changes in irradiated meat vary significantly depending on
various factors such as irradiation dose, animal species, muscle type, and
packaging type (Luchsinger et al., 1996; Ahn et al., 1998a; Nanke et al., 1999).
Millar et al. (1995) found that irradiated chicken breasts had a definite color
change from the usual brown or purple to a more vivid pink or red as a
result of ionizing irradiation in the oxygen-permeable film. Nam and Ahn
(2002c) also reported that irradiation increased redness of both aerobically
and vacuum-packaged raw turkey breast. However, the vacuum-packaged
meat was redder than the aerobically packaged meat and was stable during
storage (Luchsinger et al., 1997; Nanke et al., 1998, 1999). Jo et al. (2000) found
a significant increase in redness of cooked pork sausages after irradiation.
Irradiation and subsequent storage of pork improved the red color even in
pale soft and exudative (PSE) pork, indicating that irradiation can be used
to increase the acceptability of low-quality pork (Nam et al., 2002b). During
the frozen storage, irradiation increased pink color in both aerobically and
vacuum-packaged turkey breast, and the pink color was stable (Nam et al.,
2002c). Sensory evaluations of irradiated raw turkey breast meat indicated
that sensory panelists preferred the red color of irradiated meats to nonir-
radiated ones because irradiated meat looked fresh (Lefebvre et al., 1994).
However, increased redness is a problem in irradiated light meats such as
poultry breast and pork loin if the red color of irradiated meats persists in
meat after cooking.
In cooked turkey meat, the increased redness was greater inside than on the
surface, and the pink color intensity of the inside was stronger in irradiated
meat than the nonirradiated (Nam and Ahn, 2003c). Tappel (1957) noted that
when precooked meat was irradiated, the gray-brown hematin pigments were
converted to uncharacteristic red pigments, especially when the cooked meat
was irradiated in the absence of oxygen. Irradiation of red meat changes the red
color to brown or gray under aerobic conditions. Immediately after irradiation,
the color of ground beef changed from a bright red to a greenish brown, which
would be an unattractive beef color for consumers (Nam and Ahn, 2003a).

6.4.3.2 Mechanism of Color Changes in Irradiated Meat

Irradiation produces ligand-forming compounds that can act as the sixth
ligand of myoglobin. Tappel (1956) postulated a bright red color of irradiated
fresh meat in an inert atmosphere was oxymyoglobin formed by the reaction
between metmyoglobin and hydroxyl radicals. However, it is not logical that
the pigment is an oxymyoglobin because the red color formed by irradiation
has been produced mainly in anoxic conditions. Millar et al. (1995) postu-
lated that the red/pink color in irradiated meat was due to a ferrous myo-
globin derivative such as carboxymyoglobin or nitric oxide myoglobin other
than oxymyoglobin. Nam and Ahn (2002a,b) characterized the pink pigment
214 Advanced Technologies for Meat Processing, Second Edition

formed in irradiated raw and cooked turkey breast as carbon monoxide-

myoglobin (CO-Mb). In cooked meat, both undenatured and denatured
heme pigments were involved in heme-complex formations with ligands
available under the conditions. In aerobically and vacuum-packaged tur-
key breast, the a*-values were positively correlated with the irradiation dose
and the amount of CO gas produced (Nam and Ahn, 2003d). Considerable
amounts of CO were produced by radiolysis of organic components and meat
(Furuta et al., 1992; Woods and Pikaev, 1994; Nam and Ahn, 2002a,b). Lee and
Ahn (2004) reported that glycine, asparagine, glutamine, pyruvate, glyceral-
dehyde, α-ketoglutarate, and phospholipids were the primary sources of CO
production among meat components by irradiation. They indicated that the
production of CO was via the radiolytic degradation of meat components
and was closely related to the structure of component molecules. They sug-
gested three essential factors for the pink color formation of light meats by
irradiation: production of CO, generation of reducing conditions, and CO-Mb
ligand formation that intensified the red color greatly.
Watts et al. (1978) found that fresh meat exposed to low levels of CO
gas turned red with the formation of CO-Mb. The decrease of oxidation–
reduction potential (ORP) in meat played a significant role in CO-Mb forma-
tion because the CO-Mb complex can only be formed when heme pigment
is in reduced form. Nam and Ahn (2002a,b) showed that irradiation low-
ered ORP of both aerobically and vacuum-packaged raw and cooked turkey
breast meat because irradiation produces hydrated electrons (aqueous e–), a
powerful reducing agent, from water (Swallow, 1984). However, the ORP in
irradiated meat increased rapidly during storage under aerobic conditions
while stayed stable under vacuum-packaging conditions. The irradiation-
induced red pigments were relatively stable against the increased oxidative
environment stress during the storage time (Nam and Ahn, 2003d). The
increase in ORP facilitated the conversion of myoglobin from ferrous to ferric
form, which reduced the affinity of CO to heme pigments, and thus, reduced
pink color intensity in such meat. Also, during the storage of irradiated meat
under aerobic conditions, CO-Mb receives continuous challenge by oxygen
to form Mb-O2, and eventually oxidizes to metmyoglobin.
The mechanisms of color change in irradiated red meat are different
from those of light meats, and the proposed color changing mechanisms in
irradiated beef is as follows: irradiation produces aqueous electrons (eaq–)
and hydrogen radicals that have reducing power from water molecules
(Thakur and Singh, 1994). Thus, in the absence of O2, a reducing environ-
ment is established, and all the heme pigments in beef are in ferrous form
and color is red (Satterlee et al., 1971). In the presence of oxygen, however,
strong oxidizing agents (superoxide and hydroperoxyl radicals) are formed
from the reactions of O2 and eaq– and O2 and ·H, respectively (Giddings and
Markakis, 1972). Therefore, irradiation under aerobic conditions favors ferric
Mb (brown color) but produces ferrous Mb (red color) under vacuum condi-
tions. The amount of heme pigments in beef is about >10 times of the light
Meat Decontamination by Irradiation 215

meats, and the proportion of CO-Mb, the compound responsible for color
changes in irradiated light meats, to total heme pigments in irradiated red
meat is small. Thus, overall beef color is mainly determined by the status of
heme pigments, which is determined by the reducing potential of the meat.
Irradiation of meat under vacuum conditions or addition of ascorbic acid to
aerobically packaged meat creates reducing environments (Wheeler et al.,
1996) and can prevent brown color development in ground beef.

6.4.4 Texture Change

The texture change of meat by irradiation is related to protein denaturation
and the reduction of water holding capacity (Kanatt et al., 2015a). Zhu et al.
(2004) found that irradiation significantly increased centrifugation loss of
water from pork loins, but it was partly reversed during refrigerated stor-
age, which could be due to the hydrolysis of muscle proteins. Yoon (2003)
reported that irradiated chicken breasts had more cooking loss and higher
shear force than the nonirradiated ones. The mechanism for irradiation-
induced water loss could be caused by: (1) the damage to the integrity of
membrane structure of muscle fibers and (2) denaturation of muscle pro-
teins, which reduced water holding capacity by irradiation. Significant dif-
ferences in size of sarcomeres between irradiated and nonirradiated breast
muscle fibers were observed. However, the texture attributes of chicken
breasts were not influenced by low-dose irradiation (1.0 and 1.8 kGy) (Lewis
et al., 2002).

6.4.5 Consumer Acceptance of Irradiated Meat

Consumers easily distinguish odor differences between nonirradiated and
irradiated meat. Lynch et al. (1991) reported that a set of the unpleasant odor
was produced from irradiated turkey breast fillet and the odor was differ-
ent from nonirradiated samples. Aerobic packaging reduced irradiation off-
aroma of raw meat, and consumers could not detect the aroma difference
between nonirradiated and irradiated raw and cooked meat after three days
of storage. This happened because S-compounds responsible for irradiation
off-odor volatilized during storage under aerobic packaging conditions. Lee
and Ahn (2003) reported that antioxidants had no significant effect on the
off-odor intensity of irradiated turkey meat in the consumer acceptance test
but prevented lipid oxidation. Therefore, the combined use of aerobic pack-
aging and antioxidants is recommended to improve consumer acceptance of
irradiated poultry meat.
Surveys (AMIF, 1993) showed that most supermarket shoppers believed
that irradiated foods pose a health risk. The acceptance of irradiated food
was affected by consumers’ knowledge about food irradiation. Market simu-
lation studies showed that the consumer acceptance of irradiated meat and
poultry increased when the participants received additional information
216 Advanced Technologies for Meat Processing, Second Edition

about food irradiation (Hashim et al., 1995). The less knowledgeable the par-
ticipants were about food irradiation, the higher was their level of concern
about the process (Bruhn, 1995). However, the effects of positive and nega-
tive information about irradiation on consumer response were different: a
favorable description of irradiation increased the willingness to pay, and an
unfavorable description decreased willingness to pay (Farkas and Mohacsi-
Farkas, 2011). When both positive and negative descriptions about irradiation
were provided, however, the negative description dominated. The willing-
ness to pay decreased even though the source of negative information was
from a consumer advocacy group and was written in a nonscientific manner
(Fox et al., 2002).

6.5 Control of Quality Changes in Meat by Irradiation

6.5.1 Additives
Efforts have been made to minimize the negative quality effect of irradia-
tion using various food additives (O’bryan et al., 2008). Antioxidants added
to nonirradiated fresh and further processed meat prevented oxidative ran-
cidity, slowed the development of off-flavors, and improved color stability
(Morrissey et al., 1997). Phenolic antioxidants interrupt autoxidation of lipids
in irradiated meat either by donating hydrogen atom or quenching free radi-
cals (Hsieh and Kinsella, 1989; Nam and Ahn, 2003b). Dietary antioxidant
treatments stabilized lipids in membranes, and reduced the extent of lipid
oxidation in meat during storage (Morrissey et al., 1997). However, the anti-
oxidant effects of dietary tocopherol in chicken meat differ among muscles
types (Ahn et al., 1997).
Lactic acid improved cooked meat appearance and increased myoglobin
denaturation during cooking, but produced a tangy off-flavor. However, acid
(citric or ascorbic acid) did not affect the redness of irradiated turkey breast
(Nam and Ahn, 2002c). Ascorbic acid incorporated to ground beef at the level
of 0.1% (w/w) was very efficient in maintaining redness of irradiated ground
beef and the color stabilizing effects of ascorbic acid were more distinct in
“long-term-aged” than in “pre-aged” irradiated ground beef (Nam and Ahn,
2003a). Ascorbic acid significantly lowered the ORP values, which helped
the heme pigments in ferrous status, and stabilized the color of irradiated
ground beef (Nam et al., 2003; Nam and Ahn, 2003a).
The addition of antimicrobial agents had synergistic effects with irradia-
tion in killing microorganisms in meat (Jensen et al., 2003). However, the
effect of antimicrobial agents on the texture, color, and sensory properties
of meat products was not consistent (Sommers and Fan, 2003; Choi and
Chin, 2003). The addition of benzoate increased the content of benzene in the
volatiles of irradiated RTE turkey ham and breast rolls, and thus caution is
needed to use benzoate salt in products for irradiation (Zhu et al., 2004, 2005).
Meat Decontamination by Irradiation 217

6.5.2 Packaging
Packaging is a major factor influencing color and the amounts and types of vol-
atiles detected in irradiated meat. The greenish brown color was problematic
when ground beef was irradiated under aerobic conditions, but anaerobic condi-
tions protected the beef from discoloration (Nam et al., 2004). Vacuum packag-
ing prevented oxidative changes and color fading and retained sulfur volatiles
inside the packaging bag during storage, which reduced the odor acceptance of
irradiated meat (Nam et al., 2002a). Vacuum packaging is an excellent strategy
to inhibit lipid oxidation in meat during storage because oxygen is essential for
the progress of lipid oxidation (Ahn et al., 2001). Vacuum-packaged meats have
mainly purple deoxymyoglobin if the oxygen partial pressure reaches zero.
Failure to remove oxygen completely, however, can result in oxidizing condi-
tions associated with low partial oxygen pressure. The impacts of irradiation
on meat color are related to oxygen availability and the amount of free radicals
formed during irradiation. Nanke et al. (1999) reported that irradiated meat in
aerobic packaging discolored more rapidly than nonirradiated samples during
display. In irradiated meat, vacuum packaging was better than aerobic pack-
aging in preventing lipid oxidation and oxidation-dependent volatile produc-
tion, but increased pink color intensity. Aerobic packaging was more desirable
for the irradiated meat color than vacuum packaging if lipid oxidation could
be controlled (Ahn et al., 2000b, 2001). An appropriate combination of aerobic
and anaerobic packaging conditions was effective in minimizing both off-odor
volatiles and lipid oxidation in irradiated raw turkey breast during storage, and
it also was effective in reducing the generation of pink color in irradiated meat
compared to vacuum packaging alone (Nam and Ahn, 2003c,d). Sulfur com-
pounds, the most critical volatiles for off-odor development in irradiated meat,
could easily be eliminated under aerobic conditions (Ahn et al., 2001). Nam and
Ahn (2003c,d) found that irradiation and aerobic packaging promoted aldehydes
production, especially propanal and hexanal, highly correlated with lipid oxida-
tion in turkey breast and thigh meats. The term “double-packaging” describes a
packaging method in which meat pieces are individually packaged in oxygen-
permeable bags at first, and then a few of them are vacuum packaged in a larger
vacuum bag. After a certain period of storage time, the outer vacuum bag is
removed and stored until the last day of storage. Double-packaging was very
effective in controlling both lipid oxidation-dependent (aldehydes) and radio-
lytic off-odor (S-compounds) volatiles. However, double-packaging alone was
not enough to reduce the pink color of irradiated raw turkey meat (Nam and
Ahn, 2003c,d).

6.5.3 Packaging and Additive Combinations

The addition of antioxidants to irradiated meat was an effective method in
complementing problems of double-packaging. The addition of sesamol +
tocopherol (S + E) or gallate + tocopherol (G + E) combinations lowered the
218 Advanced Technologies for Meat Processing, Second Edition

amount of propanal and total volatiles in double-packaged and irradiated

raw turkey meat (Nam and Ahn, 2003c). After 10 days of refrigerated stor-
age, however, volatile profiles of irradiated turkey breast were highly depen-
dent upon antioxidant and packaging conditions: sulfur volatiles were not
detected in irradiated aerobically packaged or double-packaged meat. How-
ever, aerobically packaged irradiated meat without antioxidants produced
large amounts of aldehydes (propanal, hexanal) and 2-butanone during stor-
age. The double-packaged meat had lower lipid oxidation products than aer-
obically packaged meat, but antioxidant combinations significantly reduced
the amounts. Therefore, the double-packaging in combination with antioxi-
dants was effective in reducing sulfur volatiles responsible for the irradia-
tion off-odor without any problem in lipid oxidation (Nam and Ahn, 2003c).
The beneficial effects of double-packaging and antioxidant combinations
on volatiles were more clearly shown in irradiated cooked meat (Nam and
Ahn, 2003c). Double-packaging in combination with gallate + α-tocopherol
(G + E) or S + E significantly reduced the redness of irradiated cooked
turkey breast meat, but G + E was more effective than S + E. Double-
packaging itself was more effective than vacuum-packaging in reducing
sulfur volatiles and lipid oxidation-dependent volatiles compared with
aerobic packaging in cooked meat. The total amounts of sulfur volatiles
in double-packaged irradiated turkey meat with antioxidants were only
about 5%–7% of the irradiated vacuum-packaged cooked meat without
antioxidants. Production of most aldehydes in irradiated cooked turkey
breast was prevented by using antioxidants and double-packaging com-
binations. The combined use of double-packaging and ascorbic acid was
also very effective in reducing off-odor volatiles and maintaining the
bright red color of irradiated ground beef (Nam et al., 2004). Both irra-
diating under vacuum condition and the added ascorbate was helpful in
maintaining low ORP of irradiated beef and caused myoglobin to remain
in a reduced form.

6.6 Future Research Needed

Most of the irradiation studies are done with raw meat because irradiation
is not permitted for meats treated with additives, further processed, or RTE
meat products. Therefore, future studies on irradiation should be focused
on flavor, color, and taste changes in further processed and precooked RTE
meat products. Although odor and color are important factors for consumer
acceptance of irradiated raw meat, the most important quality parameter for
cooked meat is taste because if irradiated meat has undesirable taste, con-
sumers will never choose irradiated meat again. Currently, no information
on the mechanisms and causes of taste/flavor changes in irradiated cooked
Meat Decontamination by Irradiation 219

meat is available. Therefore, research to elucidate the causes and mecha-

nisms of taste changes in irradiated cooked meat to determine the roles
of spices and additives on taste/flavor of irradiated processed meat and to
develop methods that can control taste/flavor changes in irradiated further
processed meat are needed. The effect of those additives on the microcidal
efficiency of irradiation should also be determined.

References
Ahn, D. U. (2002). Production of volatiles from amino acid homopolymers by irradia-
tion. Journal of Food Science, 67(7), 2565–2570.
Ahn, D. U. and Lee, E. J. (2002). Production of off-odor volatiles from liposome-
containing amino acid homopolymers by irradiation. Journal of Food Science,
67(7), 2659–2665.
Ahn, D. U., Jo, C. and Olson, D. G. (2000a). Analysis of volatile components and the
sensory characteristics of irradiated raw pork. Meat Science, 54, 209–215.
Ahn, D. U., Jo, C., Olson, D. G. and Nam, K. C. (2000b). Quality characteristics of pork
patties irradiated and stored in different packaging and storage conditions.
Meat Science, 56, 203–209.
Ahn, D. U., Lee, E. J., Feng, X. et al. (2016a). Mechanisms of volatile production from
non-sulfur amino acids by irradiation. Radiation Physics and Chemistry, 119, 64–73.
Ahn, D. U., Lee, E. J., Feng, X. et al. (2016b). Mechanisms of volatile production from
sulfur-containing amino acids by irradiation. Radiation Physics and Chemistry,
119, 80–84.
Ahn, D. U., Nam, K. C., Du, M. and Jo, C. (2001). Effect of irradiation and packag-
ing conditions after cooking on the formation of cholesterol and lipid oxidation
products in meats during storage. Meat Science, 57, 413–418.
Ahn, D. U., Olson, D. G., Jo, C., Chen, X., Wu, C. and Lee, J. I. (1998a). Effect of muscle
type, packaging, and irradiation on lipid oxidation, volatile production and
color in raw pork patties. Meat Science, 49, 27–39.
Ahn, D. U., Olson, D. G., Lee, J. I., Jo, C., Wu, C. and Chen, X. (1998b). Packaging and
irradiation effects on lipid oxidation and volatiles in pork patties. Journal of Food
Science, 63(1), 15–19.
Ahn, D. U., Sell, J. L., Jeffery, M. et al. (1997). Dietary vitamin E affects lipid oxida-
tion and total volatiles of irradiated raw turkey meat. Journal of Food Science, 62,
954–959.
Alahakoon, A. U., Jayasena, D. D., Jung, S., Kim, S. H., Kim, H. J. and Jo, C. (2015).
Effect of electron beam irradiation and high-pressure treatment combined with
citrus peel extract on seasoned chicken breast meat. Journal of Food Processing and
Preservation, 39, 2332–2339.
American Meat Institute Foundation (AMIF). (1993). Consumer Awareness, Knowledge,
and Acceptance of Food Irradiation. Washington, DC: American Meat Institute
Foundation.
Angelini, P., Merritt, C., Jr., Mendelshon, J. M. and King, F. J. (1975). Effect of irradiation
on volatile constituents of stored haddock flesh. Journal of Food Science, 40, 197–199.
220 Advanced Technologies for Meat Processing, Second Edition

Arthur, T. M., Wheeler, T. L., Shackelford, S. D., Bosilevac, J. M., Nou, X. W. and
Koohmaraie, M. (2005). Effects of low-dose, low-penetration electron beam irra-
diation of chilled beef carcass surface cuts on Escherichia coli O157: H7 and meat
quality. Journal of Food Protection, 68(4), 666–672.
Badr, H. M. (2004). Use of irradiation to control foodborne pathogens and extend the
refrigerated market life of rabbit meat. Meat Science, 67(4), 541–548.
Batzer, O. F. and Doty, D. M. (1955). Radiation sterilization, nature of undesirable
odors formed by gamma irradiation of beef. Journal of Agricultural and Food
Chemistry, 3(1), 64–67.
Bhide, M. R., Paturkar, A. M., Sherikar, A. T. and Waskar, V. S. (2001). Pre-sensitization
of microorganisms by acid treatments to low dose gamma irradiation with spe-
cial reference to Bacillus cereus. Meat Science, 58(3), 253–258.
Bruhn, C. M. (1995). Strategies for communicating the fact on food irradiation to con-
sumers. Journal of Food Protection, 58, 213–216.
Buttery, R. G., Guadagni, D. G. and Ling, L. C. (1973). Flavor compounds: Volatilities
in vegetable oil and oil-water mixtures: Estimation of odor thresholds. Journal of
Agricultural and Food Chemistry, 21, 198–201.
Council for Agricultural Science and Technology (CAST). (1986). Ionizing Energy in
Food Processing and Pest Control: I. Wholesomeness of food treated with ion-
izing energy. In Task Force Report No.109:50, Ames, IA.
Chen, C. M., Sebranek, J. G., Dickson, J. S. and Mendonca, A. F. (2004). Combining
pediocin with postpackaging irradiation for control of Listeria monocytogenes on
frankfurters. Journal of Food Protection, 67, 1866–1875.
Choi, S. H. and Chin, K. B. (2003). Evaluation of sodium lactate as a replacement for
conventional chemical preservatives in comminuted sausages inoculated with
Listeria monocytogenes. Meat Science, 65, 531–537.
Clavero, M. R., Monk, J. D., Beuchat, L. R., Doyle, M. P. and Brackett, R. E. (1994). Inactiva-
tion of Escherichia coli O157:H7, salmonellae, and Campylobacter jejuni in raw ground
beef by gamma irradiation. Applied Environmental Microbiology, 60, 2069–2075.
Davies, M. J. (1996). Protein and peptide alkoxyl radicals can give rise to C-terminal
decarboxylation and backbone cleavage. Archives of Biochemistry and Biophysics,
336, 163–172.
Diehl, J. F. (1995). Safety of Irradiated Foods. 2nd ed. New York, NY: Marcel Dekker,
283–289.
Dogbevi, M. K., Vachon, C. and Lacroix, M. (1999). Physicochemical and microbio-
logical changes in irradiated fresh pork loins. Meat Science, 51, 349–354.
Efiok, B. S. (1996). Basic Calculations for Biomedical and Biological Analyses. Gaithers-
burg, MD: AOAC International, 84–86.
El-Bisi, H. M., Snyder, O. P. and Levin, R. E. (1966). Radiation death kinetics of C.
botulinum spores at cryogenic temperatures. In: Ingram, I. M. and Roberts, T. A.
(eds.) Botulism. London: Chapman and Hall, 89–107.
Fan, X., Sommers, C. H., Thayer, D. W. and Lehotay, S. J. (2002). Volatile sulfur com-
pounds in irradiated precooked turkey breast analyzed with pulsed flame pho-
tometric detection. Journal of Agricultural and Food Chemistry, 50(15), 4257–4261.
Farkas, J. (2006). Irradiation for better foods. Trends in Food Science & Technology, 17,
148–152.
Farkas, J. and Andrassy, E. (1993). Interaction of ionizing radiation and acidulants on
the growth of the microflora of a vacuum-packaged chilled meat. International
Journal of Food Microbiology, 19, 145–152.
Meat Decontamination by Irradiation 221

Farkas, F. and Mohacsi-Farkas, C. (2011). History and future of food irradiation.

Trends in Food Science and Technology, 22, 121–126.
Fox, J. A., Hayes, D. J. and Shogren, J. F. (2002). Consumer preferences for food irra-
diation: How favorable and unfavorable descriptions affect preferences for irra-
diated pork in experimental auctions. Journal of Risk Uncertainty, 24(1), 75–95.
Furuta, M., Dohmaru, T., Katayama, T., Toratoni, H. and Takeda, A. (1992). Detection
of irradiated frozen meat and poultry using carbon monoxide gas as a probe.
Journal of Agricultural and Food Chemistry, 40(7), 1099–1100.
Galan, I., García, M. L. and Selgas, M. D. (2011). Irradiation is useful for manufactur-
ing ready-to-eat cooked meat products enriched with folic acid. Meat Science,
87, 330–335.
Giddings, G. G. and Markakis, P. (1972). Characterization of the red pigments pro-
duced from ferrimyoglobin by ionizing radiation. Journal of Food Science, 37,
361–364.
Godshall, M. A. (1997). How carbohydrate influence flavor. Food Technology, 51, 63–67.
Halliwell, B. J. M. and Gutteridge, C. (1989). A consideration of atomic structure and
bonding. In: Halliwell, B. J. M. and Gutteridge, C. (eds.) Free Radicals in Biology
and Medicine. 2nd ed. London: Clarendon Press, 508–524.
Hashim, I. B., Resurreccion, A.V.A. and MaWatters, K. H. (1995). Disruptive sensory anal-
ysis of irradiated frozen or refrigerated chicken. Journal of Food Science, 60, 664–666.
Hayashi, T. (1991). Comparative effectiveness of gamma rays and electron beams in
food irradiation. In: Thorne, S. (ed.) Food Irradiation. London: Elsevier Applied
Science, 169–206.
Hsieh, R. J. and Kinsella, J. E. (1989). Oxidation of polyunsaturated fatty acids: Mech-
anisms, products, and inhibition with emphasis on fish. Advances in Food Nutri-
tion Research, 33, 233–237.
Huq, T., Vu, K. D., Riedl, B., Bouchard, J. and Lacroix, M. (2015). Synergistic effect
of gamma (g)-irradiation and microencapsulated antimicrobials against Listeria
monocytogenes on ready-to-eat (RTE) meat. Food Microbiology, 46, 507–514.
International Atomic Energy Agency (IAEA). (1991). Facts about food irradiation.
International Consultative Group on Food Irradiation. Vienna: International Atomic
Energy Agency. (accessed 23 December 2015).
Jarrett, R. D. Sr. (1982). Isotope (gamma) radiation sources. In: Josephson, E. S. and
Peterson, M. S. (eds.) Preservation of Food by Ionizing Radiation (Vol. 1). Boca
Raton, FL: CRC Press, 137–163.
Javanmard, M., Rokni, N., Bokaie, S. and Shahhosseini, G. (2006). Effects of gamma
irradiation and frozen storage on microbial, chemical and sensory quality of
chicken meat in Iran. Food Control, 17, 469–473.
Jensen, J. M., Robbins, K. L., Ryan, K. J., Homco-Ryan, C., McKeith, F. K. and Brewer,
M. S. (2003). Effects of lactic and acetic acid salts on quality characteristics of
enhanced pork during retail display. Meat Science, 63, 501–508.
Jo, C. and Ahn, D. U. (1999). Fat reduces volatiles production in oil emulsion system
analyzed by purge-and-trap dynamic headspace/gas chromatography. Journal
of Food Science, 64(4), 641–643.
Jo, C. and Ahn, D. U. (2000). Production of volatiles from irradiated oil emulsion
systems prepared with amino acids and lipids. Journal of Food Science, 65(4),
612–616.
Jo, C., Jin, S. K. and Ahn, D. U. (2000). Color changes in irradiated cooked pork sausage
with different fat sources and packaging during storage. Meat Science, 55, 107–113.
222 Advanced Technologies for Meat Processing, Second Edition

Josephson, E. S. and Peterson, M. S. (2000). Preservation of Food by Ionizing Radiation

(II). Boca Raton, FL: CRC Press, 102–103.
Kanatt, S. R., Chander, R. and Sharma, A. (2015a). Effect of radiation processing on the
quality of chilled meat products. Meat Science, 69, 269–275.
Kanatt, S. R., Chander, R. and Sharma, A. (2015b). Effect of radiation processing on
meat tenderization. Radiation Physics and Chemistry, 111, 1–8.
Kanatt, S. R., Chawla, S. P., Chander, R. and Bongirwar, D. R. (2002). Shelf-stable and
safe intermediate-moisture meat products using hurdle technology. Journal of
Food Protection, 65, 1628–1631.
Kim, A. Y. and Thayer, D. W. (1996). Mechanism by which irradiation increases the
sensitivity of Salmonella typhimurium ATCC 14028 to heat. Applied Environmental
Microbiology, 62, 1759–1763.
Kume, T., Furuta, M., Todoriki, S., Uenoyama, N. and Kobayashi, Y. (2009). Status of
food irradiation in the world. Radiation Physics and Chemistry, 78, 222–226.
Kundu, D., Gill, A., Lui, C., Goswami, N. and Holley, R. (2014). Use of low dose
e-beam irradiation to reduce E. coli O157:H7, non-O157 (VTEC) E. coli and Sal-
monella viability on meat surfaces. Meat Science, 96, 413–418.
Kwon, J.H. (2010). Research and application of irradiated foods (Chapter 2). In
Safety and Understanding of Irradiated Food. Korea Food Safety Research Institute,
pp. 1–37.
Lagunas-Solar, M. C. (1995). Radiation processing of food: An overview of scientific
principles and current status. Journal of Food Protection, 58, 186–192.
Lambert, A. D., Smith, J. P. and Dodds, K. L. (1992). Physical, chemical, and sensory
changes in irradiated fresh pork packaged in modified atmosphere. Journal of
Food Science, 57, 1294–1299.
Lee, E. J. and Ahn, D. U. (2003). Production of off-odor volatiles from fatty acids and
oils by irradiation. Journal of Food Science, 68(1), 70–75.
Lee, E. J. and Ahn, D. U. (2004). Sources and mechanisms of carbon monoxide pro-
duction by irradiation. Journal of Food Science, 69(6), c485–c490.
Lefebvre, N., Thibault, C., Charbonneau, R. and Piette, J. P. G. (1994). Improvement of
shelf-life and wholesomeness of ground beef by irradiation 2: Chemical analysis
and sensory evaluation. Meat Science, 36, 371–380.
Lewis, S. J., Velasquez, A., Cuppett, S. L. and McKee, S. R. (2002). Effect of electron
beam irradiation on poultry meat safety and quality. Poultry Science, 81, 896–903.
Lubbers, S., Landy, P. and Voilley, A. (1998). Retention and release of aroma com-
pounds in foods containing proteins. Food Technology, 52, 68–74, 208–214.
Luchsinger, S. E., Kropf, D. H., Garcia-Zepeda, C. et al. (1997). Color and oxidative
properties of irradiated ground beef patties. Journal of Muscle Foods, 8(4), 445–
464.
Luchsinger, S. E., Kropf, D. H., Garcia-Zepeda, C. M. et al. (1996). Color and oxidative
rancidity of gamma and electron beam irradiated boneless pork chops. Journal
of Food Science, 61(5), 1000–1005, 1093.
Lynch, J. A., Macfie, H. J. H. and Mead, G. C. (1991). Effect of irradiation and pack-
aging type on sensory quality of chill-stored turkey breast fillets. International
Journal of Food Science and Technology, 26, 653–668.
Mendonca, A. F., Romero, M. G., Lihono, M. A., Nannapaneni, R. and Johnson, M. G.
(2004). Radiation resistance and virulence of Listeria monocytogenes following
starvation in physiological saline. Journal of Food Protection, 67, 470–474.
Meat Decontamination by Irradiation 223

Merritt, C., Jr., Angelini, P., Wierbicki, E. and Shuts, G. W. (1975). Chemical changes
associated with flavor in irradiated meat. Journal of Agricultural and Food Chem-
istry, 23, 1037–1043.
Millar, S. J., Moss, B. W., MacDougall, D. B. and Stevenson, M. H. (1995). The effect
of ionizing radiation on the CIELAB color co-ordinates of chicken breast meat
as measured by different instruments. International Journal of Food Science and
Technology, 30, 663–674.
Miyahara, M., Saito, A., Kamimura, T., Nagasawa, T., Ito, H. and Toyoda, M. (2002).
Hydrocarbon productions in hexane solutions of fatty acid methyl esters irradi-
ated with gamma rays. Journal of Health Science, 48, 418–426.
Morrissey, P. A., Brandon, S., Buckley, D. J., Sheehy, P. J. A. and Frigg, J. (1997). Tissue
content of alpha-tocopherol and oxidative stability of broilers receiving dietary
alpha-tocopheryl acetate supplementation for various periods pre-slaughter.
British Poultry Science, 38, 84–88.
Mottram, D. S., Wedzicha, B. L. and Dodson, A. T. (2002). Acrylamide is formed in the
Maillard reaction. Nature, 419, 448–449.
Nam, K. C. and Ahn, D. U. (2002a). Mechanisms of pink color formation in irradiated
precooked turkey breast. Journal of Food Science, 67(2), 600–607.
Nam, K. C., and Ahn, D. U. (2002b). Carbon monoxide-heme pigment complexes are
responsible for the pink color in irradiated raw turkey breast meat. Meat Science,
60(1), 25–33.
Nam, K. C. and Ahn, D. U. (2002c). Effect of double-packaging and acid combination on
the quality of irradiated raw turkey patties. Journal of Food Science, 67(9), 3252–3257.
Nam, K. C. and Ahn, D. U. (2003a). Effects of ascorbic acid and antioxidants on the
color of irradiated beef patties. Journal of Food Science, 68(5), 1686–1690.
Nam, K. C. and Ahn, D. U. (2003b). Use of antioxidants to reduce lipid oxidation and
off-odor volatiles of irradiated pork homogenates and patties. Meat Science, 63, 1–8.
Nam, K. C. and Ahn, D. U. (2003c). Use of double-packaging and antioxidant com-
binations to improve color, lipid oxidation, and volatiles of irradiated raw and
cooked turkey breast patties. Poultry Science, 82(5), 850–857.
Nam, K. C. and Ahn, D. U. (2003d). Combination of aerobic and vacuum packaging
to control color, lipid oxidation and off-odor volatiles of irradiated raw turkey
breast. Meat Science, 63(3), 389–395.
Nam, K. C., Du, M., Jo, C. and Ahn, D. U. (2002a). Quality characteristics of vacuum-
packaged, irradiated normal, PSE, and DFD Pork. Innovative Food Science and
Emerging Technology, 3(1), 73–79.
Nam, K. C., Hur, S. J., Ismail, H. and Ahn, D. U. (2002b). Lipid oxidation, volatiles,
and color changes in irradiated raw turkey breast during frozen storage. Journal
of Food Science, 67(6), 2061–2066.
Nam, K. C., Kim, Y. H., Du, M. and Ahn, D. U. (2002c). Off-odor and pink color devel-
opment in precooked, ionizing-radiated turkey breast during frozen storage.
Poultry Science, 81, 269–275.
Nam, K. C., Min, B. R., Lee, S. C., Cordray, J. and Ahn, D. U. (2004). Prevention of
pinking, off-odor, and lipid oxidation in irradiated pork loin using double pack-
aging. Journal of Food Science, 69(3), FTC214–219.
Nam, K. C., Min, B. R., Park, K. S., Lee, S. C. and Ahn, D. U. (2003). Effects of ascorbic
acid and antioxidants on the lipid oxidation and volatiles of irradiated beef pat-
ties. Journal of Food Science, 68(5), 1680–1685.
224 Advanced Technologies for Meat Processing, Second Edition

Nanke, K. E., Sebranek, J. G. and Olson, D. G. (1998). Color characteristics of irra-

diated vacuum-packaged pork, beef, and turkey. Journal of Food Science, 63(6),
1001–1006.
Nanke, K. E., Sebranek, J. G. and Olson, D. G. (1999). Color characteristics of irra-
diated aerobically packaged pork, beef, and turkey. Journal of Food Science, 64,
272–276.
Nawar, W. W. (1986). Volatiles from food irradiation. Food Review International, 2(1),
45–78.
O’bryan, C. A., Crandall, P. G., Ricke S. C. and Olson, D. G. (2008). Impact of irradia-
tion on the safety and quality of poultry and meat products: A review. Critical
Reviews in Food Science and Nutrition, 48, 442–457.
Olson, D. G. (1998). Irradiation of food. Food Technology, 52, 56–62.
Patterson, R. L. and Stevenson, M. H. (1995). Irradiation-induced off-odor in chicken
and its possible control. British Poultry Science, 36, 425–441.
Proctor, B. E. and Goldblith, S. A. (1951). Food processing with ionizing radiations.
Food Technology, 5(9), 376–380.
Roberts, F. B. (2014). Food irradiation is safe: Half a century of studies. Radiation Phys-
ics and Chemistry, 105(12), 78–82.
Satin, M. (1993). Food Irradiation: A Guidebook. Lancaster, England. Technomic Publishing.
Satin, M. (2002). Use of irradiation for microbial decontamination of meat: Situation
and perspectives. Meat Science, 62, 277–283.
Satterlee, L. D., Wilhelm, M. S. and Barnhart, H. M. (1971). Low dose gamma irradia-
tion of bovine metmyoglobin. Journal of Food Science, 36(3), 549–551.
Shahidi, F. and Pegg, R. B. (1994). Lipids in Food Flavors. ACS Symposium Series (Vol.
558). Washington, DC: American Chemical Society, 256–279.
Soladoye, O. P., Jua’rez, M. L., Aalhus, J. L., Shand, P. and Este’vez, M. (2015). Protein
oxidation in processed meat: Mechanisms and potential implications on human
health. Comprehensive Reviews in Food Science and Food Safety, 14, 106–122.
Sommers, C. H. and Fan, X. (2002). Antioxidant power, lipid oxidation, color, and
viability of Listeria monocytogenes in beef bologna treated with gamma radiation
and containing various levels of glucose. Journal of Food Protection, 65, 1750–1755.
Sommers, C. H. and Fan, X. (2003). Gamma irradiation of fine-emulsion sausage con-
taining sodium diacetate. Journal of Food Protection, 66, 819–824.
Sommers, C. H., Fan, X., Handel, P. A. and Sokorai, K. B. (2003). Effect of citric acid on
the radiation resistance of Listeria monocytogenes and frankfurter quality factors.
Meat Science, 63, 407–415.
Steccheni, M. I., Del Torre, M., Sarais, P. G., Fuochi, F., Tubaro, F. and Ursini, F. (1998).
Carnosine increases the radiation resistance of Aeromonas hydrophila in minced
turkey meat. Journal of Food Science, 61, 979–987.
Swallow, A. J. (1984). Fundamental radiation chemistry of food components. In: Bai-
ley, A. J. (ed.) Recent Advances in the Chemistry of Meat. London: The Royal Soci-
ety of Chemistry, Burlington House, 165–177.
Tappel, A. L. (1956). Regeneration and stability of oxymyoglobin in some gamma
irradiated meats. Food Research, 21, 650–654.
Tappel, A. L. (1957). The red pigment of precooked irradiated meats. Food Research,
22, 408–412.
Taub, I. A., Karielian, R. A., Halliday, J. W., Walker, J. E., Angeline, P. and Merritt, C.
(1979). Factors affecting radiolytic effects of food. Radiation Physics and Chemis-
try, 14, 639–653.
Meat Decontamination by Irradiation 225

Thakur, B. R. and Singh, R. K. (1994). Food irradiation: Chemistry and applications.

Food Review International, 10, 437–473.
Thayer, D. W. and Boyd, G. (1991). Effect of ionizing radiation dose, temperature, and
atmosphere on the survival of Salmonella typhimurium in sterile mechanically
deboned chicken meat. Poultry Science, 70, 381–388.
Thayer, D. W. and Boyd, G. (1992). Gamma ray processing to destroy Staphylococcus
aureus in mechanically deboned chicken meat. Journal of Food Science, 57, 848–851.
Thayer, D. W. and Boyd, G. (1993). Elimination of Escherichia coli O157 in meats by
gamma irradiation. Applied Environmental Microbiology, 59, 1030–1034.
Thayer, D. W. and Boyd, G. (1995). Radiation sensitivity of Listeria monocytogenes on
beef as affected by temperature. Journal of Food Science, 60, 237–240.
United States Department of Agriculture-Food Safety and Inspection Service (USDA-
FSIS). (1986). Irradiation of pork for control of Trichinella spiralis. Federal Register,
51, 1769–1771.
United States Department of Agriculture-Food Safety and Inspection Service (USDA-
FSIS). (1999). Meat and poultry irradiation proposal. USDA Food Safety and
Inspection Service. Available at http://www.fsis.usda.gov/Oa/background/
irradprop.htm?redirecthttp=true (accessed 23 December 2015).
Venugopal, V., Doke, S. N. and Thomas, P. (1999). Radiation processing to improve
the quality of fishery products. Critical Review in Food Science and Nutrition,
39(5), 391–440.
Watts, D. A., Wolfe, S. K. and Brown, W. D. (1978). Fate of [14C] carbon monoxide in
cooked or stored ground beef samples. Journal of Agricultural and Food Chemistry,
26(1), 210–214.
Wheeler, T. L., Koohmaraie, M. and Shackelford, S. D. (1996). Effect of vitamin C con-
centration and co-injection with calcium chloride on beef retail display color.
Journal of Animal Science, 74(8), 1846–1853.
World Health Organization (WHO). (1981). Wholesomeness of irradiated foods. In
Technical Report Series 659. World Health Organization, Geneva, Switzerland.
World Health Organization (WHO). (1994). Food irradiation. In Safety and Nutritional
Adequacy of Irradiated Food, 5–13. World Health Organization, Geneva, Switzerland.
World Health Organization (WHO). (1999). High-dose irradiation: Wholesomeness
of food irradiated with doses above 10 kGy: Report of a Join FAO/IAEA/WHO
Study Group. World Health Organization, Geneva, Switzerland.
Woods, R. J. and Pikaev, A. K. (1994). Interaction of radiation with matter. Selected
topics in radiation chemistry. In: Woods, R. J. and Pikaev, A. K. (eds.) Applied
Radiation Chemistry: Radiation Processing. New York, NY: John Wiley and Sons,
59–89 and 165–210.
Xavier, M. P., Dauber, C., Mussio, P. et al. (2014). Use of mild irradiation doses to
control pathogenic bacteria on meat trimmings for production of patties aiming
at provoking minimal changes in quality attributes. Meat Science, 98, 383–391.
Yoon, K. S. (2003). Effect of gamma irradiation on the texture and microstructure of
chicken breast meat. Meat Science, 63, 273–277.
Zhu, M. J., Mendonca, A., Min, B. et al. (2004). Effects of electron beam irradiation and
antimicrobials on the volatiles, color and texture of ready-to-eat turkey breast
roll. Journal of Food Science, 69(5), C382–C387.
Zhu, M. J., Mendonca, A., Ismail, H. A., Du, M., Lee, E. J. and Ahn, D. U. (2005). Impact
of antimicrobial ingredients and irradiation on the survival of Listeria monocyto-
genes and quality of ready-to-eat turkey ham. Poultry Science, 84, 613–620.
7
Advances in High Hydrostatic Pressure
for Meat and Meat Processing

Sencer Buzrul

CONTENTS
7.1 Introduction ................................................................................................ 228
7.2 Effect of HHP on the Inactivation of Microorganisms in Meat
and Meat Products ..................................................................................... 230
7.2.1 Inactivation of Listeria monocytogenes in Meat and Meat
Products under HHP ..................................................................... 230
7.2.1.1 Different Types of Survival Curves of L. monocyto-
genes in Meat and Meat Products under HHP ............ 232
7.2.2 Methods Used to Improve Microbial Inactivation during
HHP Treatment of Meat and Meat Products ............................. 232
7.2.2.1 Temperature ..................................................................... 232
7.2.2.2 Additives/Antimicrobials .............................................. 238
7.2.2.3 Multipulsed HHP Treatment of Meat Products ......... 238
7.2.2.4 Hurdle Concept ............................................................... 239
7.2.2.5 Limitations of the Abovementioned Methods ............ 240
7.3 Effects of HHP on Quality Attributes of Meat and
Meat Products ............................................................................................. 241
7.3.1 Effect of HHP on Texture of Meat and Meat Products ............. 241
7.3.2 Effect of HHP on Lipid Oxidation of Meat and
Meat Products ................................................................................. 241
7.3.3 Effect of HHP on Color of Meat and Meat Products ................ 242
7.3.4 Other Effects of HHP on Meat and Meat Products................... 243
7.4 Consumer Acceptance of HHP-Treated Meat and
Meat Products ............................................................................................. 244
7.5 Some Important Results from Recent Studies of HHP on Meat
Products....................................................................................................... 245
7.6 Opportunities for HHP Application to Meat and
Meat Products ............................................................................................. 246
7.7 Limitations of HHP on Meat and Meat Products ................................. 247
7.7.1 On the Application of HHP on Fresh Meat ................................ 247
References............................................................................................................. 248

227
228 Advanced Technologies for Meat Processing, Second Edition

7.1 Introduction
The modern consumer requires foods that are safe and nutritious, free from
additives, taste good, and, for certain products, have a longer shelf life.
There are a number of possible scientific solutions to meet these demands,
such as genetic modification and gamma irradiation, but these have met
with consumer resistance. High hydrostatic pressure (HHP) processing is
one technology that has the potential to fulfill both consumer and scien-
tific requirements. In HHP treatment, pressures up to 900 MPa are used to
kill many of the microorganisms found in foods, even at room tempera-
ture, without degrading vitamins, flavor, and color molecules in the process
(Patterson et al., 2007; Polydera et al., 2005).
Macfarlane and coworkers in Australia, who pioneered the use of pres-
sure on meat, carried out some well-designed studies in the 1970s–1980s.
However, the main problem associated with these studies was that the
pressure vessel used was only capable of reaching pressures of 150 MPa
(Bouton et al., 1977; Macfarlane, 1973, 1985; Macfarlane and Morton, 1978;
Macfarlane et al., 1981, 1982, 1986). Nevertheless, these studies were a useful
starting point of later studies and also clearly demonstrated that treatment
of prerigor meat at these pressures led to marked increases in tenderness
(Ma and Ledward, 2013). After these pioneering studies, the effects of pres-
sure on meat and meat products were investigated extensively by many
researchers and the use of HHP for meat and meat products has been
described in different journal papers (Bajovic et al., 2012; Buckow et al.,
2013; Campus, 2010; Cheftel and Culioli, 1997; Hugas et al., 2002; Simonin
et al., 2012; Sun and Holley, 2010; Teixeira et al., 2014) as well as in different
book chapters (Atsushi et al., 2006; Garriga and Aymerich, 2009; Ikeuchi,
2011; Tokuşoğlu and Vural, 2014).
The Spanish company Espuña pioneered the use of HHP for the pasteuri-
zation of meat products. Sliced cooked ham with the label “high pressure
pasteurized product remains fresh until eaten” was launched in Spain in
1998 (Grèbol, 2002). Even now, it is being sold and distributed in several
supermarket chains in Spain. The product’s ham slices are vacuum skin-
packed with plastic film interleaves to facilitate the separation of slices by
the consumer. It has a refrigerated shelf life of 60 days and it is processed
for 10 minutes at 400 MPa (Tonello, 2011). Since then, HHP has become an
industrial reality for the meat industry, and HHP-treated meat products are
available in different parts of the world—see Table 7.1.
A market research study reported that as of 2013, the global HHP prod-
ucts market has achieved $3 billion. Fruit and vegetable products (35% of all
industrial applications) are the largest product market for HHP, followed by
meat products (31%), seafood and fish products (14%), and then other prod-
ucts (8%) (Koutchma, 2014).
Advances in High Hydrostatic Pressure for Meat and Meat Processing 229

TABLE 7.1
Products, Country, and Year of Introduction of the Technology
Country Year Product
Spain 1998 Cooked sliced ham and tapas (pork and poultry cuts)
United States 2001 Cooked sliced ham, pork meat products, and Parma ham
United States 2001 Poultry ready-to-eat (RTE) products
United States 2002 Spicy sliced precooked chicken and beef for fajitas
Spain 2002 Sliced ham, chicken and turkey products, cooked and Serrano
ham, and chorizo
Spain 2003 Gross slices of ham, turkey, and chicken
Italy 2003 Parma ham, salami, and mortadella
Japan 2004 Raw ham-like pork ham
Japan 2005 Cooked pork meat products, nitrite free ham, sausages, and
bacon
Germany 2005 Smoked German ham: whole, sliced, and diced products
Spain 2006 Cooked ham
Canada 2006 Cured meat products
Canada 2006 RTE meat and vegetable meals
Japan 2007 Ham without nitrite
Greece 2010 Deli meats infused with extra virgin olive oil
Greece 2010 Sliced processed meat: mortadella, ham, and salami
Netherlands 2010 Filet American
Romania 2011 Fermented sausages
United States 2011 Hamburger
United States 2011 Deli meat and fermented meats
United Kingdom 2011 Meat and cheese snack products
United States N.I. Poultry strips
United States N.I. Oven-roasted chicken
Canada N.I. Sliced dry-cured meat and cooked meats
Source: Adapted from Bajovic, B. et al., Meat Science, 92, 280–289, 2012; Buzrul, S. and Alpas,
H., In: Bhat, R., Alias, A. K. and Paliyath G. [eds.], Progress in Food Preservation.
Wiley-Blackwell, West Sussex, 2012; Campus, M., Food Engineering Reviews, 2, 256–273,
2010; Ikeuchi, Y., In: Kerry, J. P. and Kerry, J. F. [eds.], Processed Meats—Improving
Safety, Nutrition and Quality, Woodhead Publishing, Cambridge, 2011; and reprinted
from Adapting High Hydrostatic Pressure (HPP) for Food Processing Operations,
Koutchma, T., Copyright (2014), Elsevier.
Some examples of high hydrostatic pressure-treated meat products are available on the market.
Note: N.I., No information was found about the year..

In this chapter, an overview about current and fundamental knowledge of

HHP and its impact on meat and meat products is presented and some of the
research findings are summarized. Opportunities and limitations of HHP
on meat and meat products are discussed, and important results of some
recent studies are also given.
230 Advanced Technologies for Meat Processing, Second Edition

7.2 Effect of HHP on the Inactivation of

Microorganisms in Meat and Meat Products
The main purpose of using HHP to treat meat and meat products is to
improve microbial safety. The effectiveness of HHP to inactivate bacterial
cells is well documented in various studies. Conditions such as the pressure
level, process temperature, and holding time of the HHP treatment of food
products depend on the type of microorganisms, the various ingredients,
and the dispersion medium in foods (Ikeuchi, 2011). In the meat industry,
HHP treatment is also an attractive method that can be used to inactivate
various microorganisms without affecting the character and features of at
least some of the meat products (Garriga and Aymerich, 2009; Garriga et al.,
2004; Jofré et al., 2009b; Shigehisa et al., 1991; Tassou et al., 2007). A summary
of some research findings associated with HHP inactivation of microorgan-
isms are listed in Table 7.2.

7.2.1 Inactivation of Listeria monocytogenes in

Meat and Meat Products under HHP
As a severe foodborne pathogen, Listeria monocytogenes requires particular
attention during food processing and storage because it is moderately heat-
resistant and can grow anaerobically under refrigeration (Teixeira et al., 2014).
L. monocytogenes is also considered a target microorganism of public health
concern in dairy and meat products (Koutchma, 2014).
There are many studies on inactivation of L. monocytogenes in meat and
meat products. Treatment of sliced Iberian and Serrano hams at 450 MPa
for 10 minutes significantly reduced the population of L. monocytogenes Scott
A, spiked at 6 log10CFU/g. After 60 days at 4°C or 8°C, the counts were 3.24
and 4.70 log10CFU/g in HHP-treated and control samples, respectively, for
Iberian and 2.73 and 5.07 log CFU/g for Serrano ham (Morales et al., 2006).
The effectiveness of HHP (600 MPa, 31°C, 6 minutes) to reduce the risks
associated with L. monocytogenes in sliced cooked ham was also reported
by Garriga et al. (2004). Aymerich et al. (2005) also reported the effect of a
treatment at 400 MPa for 10 minutes at 17°C on L. monocytogenes artificially
spiked in vacuum-packaged sliced cooked ham. The growth of L. monocyto-
genes was inhibited until 40 days of refrigerated storage at 1°C or 6°C. After
that period, and at 6°C, L. monocytogenes was able to grow until reaching
counts similar to that of nonpressurized samples (about 8 log10CFU/g), while
at 1°C, they kept to the low levels achieved after pressurization. The effec-
tiveness of HHP treatments at 600 MPa was evaluated in sliced cooked ham
spiked with 4 log10CFU/g of L. monocytogenes after three months of storage
at 1°C and 6°C (Jofré et al., 2008b). The HHP application reduced the levels of
L. monocytogenes to below 10 CFU/g. These levels continued until the end of
storage at both 1°C and 6°C.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 231

TABLE 7.2
Summary of HHP Inactivation of Microorganisms in Meat and Meat Products
Process Reduction
Microorganism Product Conditionsa (log10) Reference
Campylobacter Pork slurry 300 MPa, 6.0 Shigehisa et al. (1991)
jejuni 25°C, 10 min
Poultry 375 MPa, 6.0 Solomon and Hoover
25°C, 10 min (2004)
Chicken meat 200 MPa, 2.0 Martinez-Rodrigez
25°C, 10 min and Mackey (2005)
Chicken slurry 450 MPa, 7.0b Lori et al. (2007)
15°C, 1 min
Cooked ham, 600 MPa, 3.5b Jofré et al. (2009b)
dry-cured ham, 31°C, 6 min
marinated beef loin
Escherichia coli Poultry 600 MPa, 3.0 Patterson et al. (1995)
O157:H7 20°C, 15 min
Raw minced meat 700 MPa, 5.0 Gola et al. (2000)
15°C, 1 min
Ground beef patties 400 MPa, 2.5 Morales et al. (2008)
12°C, 20 min
Dry fermented 483 MPa, 5.0b Porto-Fett et al. (2010)
salami 19°C, 5 min
Salmonella Minced meat 400 MPa, 4.4 Escriu and Mor-Mur
Typhimurium 20°C, 2 min (2009)
Salmonella Poultry sausages 500 MPa, 7.2 Yuste et al. (2000b)
Enteritidis 50°C, 10 min
Salmonella Chicken breast fillets 400 MPa, 4.8 Morales et al. (2009)
Enteritidis 12°C, 15 min
Salmonella Fermented sausages 400 MPa, 2.0 Jofré et al. (2009a)
Enterica 17°C, 10 min
Staphylococcus Poultry 600 MPa, 3.0 Patterson et al. (1995)
aureus 20°C, 15 min
Marinated beef loin 600 MPa, 2.5 Jofré et al. (2009b)
31°C, 6 min
Dry-cured ham 600 MPa, 0.5 Jofré et al. (2009b)
31°C, 6 min
Cooked ham 600 MPa, 1.1 Jofré et al. (2009b)
31°C, 6 min
Staphylococcus Cooked ham 500 MPa, 1.3 Hugas et al. (2002)
carnosus 40°C, 10 min
Lactobacillus sakei Cooked ham 500 MPa, 4.0 Hugas et al. (2002)
40°C, 10 min
Pseudomonas Minced beef 200 MPa, 5.0 Carlez et al. (1993)
flourescens 20°C, 20 min
Yersinia Pork slurry 300 MPa, 6.0 Shigehisa et al. (1991)
enterocolitica 25°C, 10 min
Source: From Bajovic, B. et al., Meat Science, 92, 280–289, 2012 and Simonin, H. et al., Compre-
hensive Reviews in Food Science and Food Safety, 11, 285–306, 2012.
a Temperature given is either initial or process temperature.

b Total inactivation.
232 Advanced Technologies for Meat Processing, Second Edition

HHP has already satisfied the demands of regulatory agencies such as the
US Department of Agriculture/Food Safety Inspection Service as an accept-
able method of elimination of L. monocytogenes in processed meat prod-
ucts (Campus, 2010; Teixeira et al., 2014; USDA, 2006). A summary of some
research findings associated with HHP inactivation of L. monocytogenes in
meat and meat products are listed in Table 7.3.

7.2.1.1 Different Types of Survival Curves of L. monocytogenes

in Meat and Meat Products under HHP
There is now enough evidence that a log-linear isothermal survival curve
of bacterial cells is an exception rather than a rule and the same can be
said about semi-logarithmic survival curves of organisms exposed to
HHP. A number of nonlinear models for describing the HHP inactiva-
tion of microbial cells such as the (modified) Gompertz equation (Chen
and Hoover, 2003; Patterson and Kilpatrick, 1998; Yamamoto et al., 2005),
Fermi equation (Donsì et al., 2003), log-logistic equation (Buzrul and
Alpas, 2004; Chen and Hoover, 2003; Yamamoto et al., 2005), modified
Baranyi model (Koseki and Yamamoto, 2007), and Weibull model (Avsa-
roglu et al., 2006; Buzrul and Alpas, 2004; Chen and Hoover, 2003; Yama-
moto et al., 2005) have been proposed in literature—see Figure 7.1 and
Table 7.4. While all these models—in their original and modified forms—
could be used to fit survival curves of microbial cells inactivated by HHP,
none of them can be considered unique.
It can be observed in such figures that L. monocytogenes in foods of animal
origin under HHP could have different survival curves (Buzrul, 2014a). Some
examples in meat and meat products are shown in Figures 7.2 through 7.5.
It should be noted that it is still common to report D and z values of micro-
organisms; however, these values have no or little meaning if the survival
curve of an organism is nonlinear.

7.2.2 Methods Used to Improve Microbial Inactivation

during HHP Treatment of Meat and Meat Products
7.2.2.1 Temperature
It is known that increase of the treatment temperature during HHP can be
used to improve microbial inactivation. Temperatures between 45°C and
60°C allow the use of lower pressure levels and shorter holding times for
pathogen inactivation in meat and meat products compared to applica-
tion at ambient temperature (Moerman, 2005; Simpson and Gilmour, 1997;
Tassou et al., 2008; Yuste et al., 2000a). For example, a 5 log10 reduction of
Staphylococcus aureus can be achieved in chicken treated at 500 MPa, 50°C,
TABLE 7.3
Summary of HHP Inactivation of Listeria monocytogenes in Meat and Meat Products
Product Strain Initial Count Process Conditions a Reduction (log10) Reference
Cooked beef mince NCTC 11994 8.70 375 MPa, 45°C, 5 min 4.30 Simpson and Gilmour
(1997)
Cooked chicken mince – – 375 MPa, 18°C, 30 min ~ 3.40 –
Raw chicken mince – – 375 MPa, 18°C, 25 min ~ 4.60 –
– – – – –
Turkey breast meat Cocktail of five strains 7.00 400 MPa, 1°C, 1 min 0.50 Chen (2007)
(PSU1), PSU2, PSU9, 400 MPa, 20°C, 1 min 0.10
PSU21, ATCC 19115) 400 MPa, 50°C, 1 min 4.10
500 MPa, 1°C, 1 min 1.40
500 MPa, 20°C, 1 min 0.90
500 MPa, 40°C, 1 min 3.80
– – – – – –
Cooked ham Cocktail of three strains 4.00 600 MPa, 10°C, 5 min ~ 3.50 Jofré et al. (2007)
(CTC1010, CTC1011,
CTC1034)
– – – – – –
Mortadella CTC1034 ~ 7.00 450 MPa, 15°C, 15 min >4.00 Hereu et al. (2012)
Cooked ham – – 450 MPa, 15°C, 15 min >5.00
– – – – – –
RTE-sliced ham Cocktail of five strains 5.00 400 MPa, 17°C, 3 min 0.95 Myers et al. (2013)
(ATCC 7644, NCTC – – – –
Advances in High Hydrostatic Pressure for Meat and Meat Processing

10890, ATCC 19112,

ATCC 19114, ATCC
19115)
– – – 600 MPa, 17°C, 3 min 4.25 –
a
233

Temperature given is either initial or process temperature.

234 Advanced Technologies for Meat Processing, Second Edition

I VI
log10 S(t)

log10 S(t)
II
III

IV VIII VII

Time Time
(a) (b)

FIGURE 7.1
Commonly observed types of survival curves. (a) Linear (I), biphasic (II), strong (extreme)
tailing (III), convex (IV). (b) Shoulder (V), sigmoidal type 1—starting with a convex and
ending up with concave (VI), sigmoidal type 2—starting with a concave and ending up
with convex (VII), concave (VIII). (Adapted from Xiong, R. et al., International Journal of
Food Microbiology, 46, 45–55, 1999; Peleg, M., Critical Reviews in Food Science and Nutrition,
43, 645-658, 2003; and Geeraerd, A. H. et al., International Journal of Food Microbiology, 102,
95–105, 2005.)

15 minutes, whereas a pressure level of approximately 700 MPa would be

necessary to obtain the same reduction at 20°C (Patterson and Kilpatrick,
1998). Yuste et al. (2000b) concluded that HHP treatment (500 MPa, 65°C,
5 minutes) could be an effective preservation method to replace heat pas-
teurization (80°C, 40 minutes) in cooked sausages, achieving the same
preserving effect in terms of microbial inactivation and growth inhibi-
tion during chilled storage. However, heat-transfer limitations in par-
ticulate food products can still prevent their successful pasteurization by
HHP treatments at elevated temperatures (Moerman, 2005).
The use of low temperatures (<15°C) during HHP treatment could also
be an effective strategy to improve microbial inactivation. A pork-isolated
strain of Pseudomonas fluorescens was reduced by 5 log10 when treated at
200 MPa, 5°C, 10 minutes, and the bactericidal effect decreased as the
temperature increased to 35°C (López-Caballero et al., 2002). Chen
(2007) found that L. monocytogenes was more resistant to pressure
(500 MPa, 1 minute) at temperatures between 10°C and 30°C. When tem-
peratures decreased below 10°C or increased above 30°C, L. monocytogenes’
susceptibility to pressure increased. This enhanced inactivation effect
was more pronounced when meat samples were treated at higher tem-
peratures. In the study by Yuste et al. (2002), HHP treatment at subzero
temperatures (450 MPa, −20°C, 15 minutes) was not effective at decreas-
ing the microbial count in poultry meat, probably because samples were
treated while frozen and thus presented a lack of plasticity (Simonin
et al., 2012).
TABLE 7.4
Models Used to Describe Survival Curves of Microorganisms
Model Equation Number Equation Reference

t
Linear (1) log 10 S (t ) = −kt or log 10 S (t ) = − Chick (1908)
D

Biphasic (2) log 10 S(t) = log 10 fe − k1t + (1 − f ) e − k2t

( ) Cerf (1977)

Biphasic (3) If t ≤ ti log 10 S (t ) = −k1t Corradini et al. (2007)

If t > ti log 10 S (t ) = −k1ti − k2 (t − ti )

Shoulder (4) log 10 S (t ) = − log 10 1 + exp ⎡⎣k (t − tmin )⎤⎦

{ } Peleg (1996)

Shoulder (5) If t ≤ tlag log10 S(t) = 0 Peleg (2000)

If t > tlag log10 S(t) = –k(t – tlag)
Concave (6) log 10 S (t ) = −bt n n < 1 Peleg and Cole (1998)
n
Convex (7) log 10 S (t ) = −bt n < 1 Peleg and Cole (1998)
at
Strong tailing (8) log 10 S(t) = − Peleg (2006)
b+t
at
Sigmoid (start with (9) log 10 S(t) = − Peleg (2003)
concave end up (1 + bt) (c − t)
with convex)
Sigmoid (start with (10) log 10 S(t) = A exp ⎡⎣− exp ( kti )⎤⎦ − A exp ⎡⎣− exp (−k (t − ti ))⎤⎦ Linton et al. (1995)
convex end up
Advances in High Hydrostatic Pressure for Meat and Meat Processing

with concave)
235
236 Advanced Technologies for Meat Processing, Second Edition

–1
log10 S(t)

–2

–3

0 5 10 15 20 25 30
Time (min)

FIGURE 7.2
Survival data (black circles) of Listeria monocytogenes NCTC 11994 in cooked chicken mince at
375 MPa, about 18°C fitted with Equations 4 (dashed gray line) and 5 (dashed black line)—see
Table 7.4. (From Simpson, R. K. and Gilmour, A., Food Microbiology, 14, 567–573, 1997.)

–1

–2
log10 S(t)

–3

–4

–5

–6
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Time (min)

FIGURE 7.3
Survival data (black circles) of five-strain cocktail of L. monocytogenes (PSU1, PSU2, PSU9,
PSU21, and ATCC 19115) in turkey breast meat at 400 MPa, 50°C fitted with Equation 6 (dashed
black line)—see Table 7.4. (From Chen, H., International Journal of Food Microbiology, 117, 55–60,
2007.)
Advances in High Hydrostatic Pressure for Meat and Meat Processing 237

–1

–2
log10 S(t)

–3

–4

–5

–6
0 5 10 15 20 25 30
Time (min)

FIGURE 7.4
Survival data (black circles) of L. monocytogenes NCTC 11994 in raw chicken mince at 375 MPa,
about 18°C fitted with Equation 7 (dashed black line)—see Table 7.4. (From Simpson, R. K. and
Gilmour, A., Food Microbiology, 14, 567–573, 1997.)

–1

–2
log10 S(t)

–3

–4

–5

0 5 10 15 20 25 30
Time (min)

FIGURE 7.5
Survival data (black circles) of L. monocytogenes NCTC 11994 in cooked beef mince at 375
MPa, 45°C fitted with Equation 8 (dashed black line)—see Table 7.4. (From Simpson, R. K. and
Gilmour, A., Food Microbiology, 14, 567–573, 1997.)
238 Advanced Technologies for Meat Processing, Second Edition

7.2.2.2 Additives/Antimicrobials
The synergism between bacteriostatic additives and HHP has been reported
(Aymerich et al., 2005; Krockel and Muller 2002; Marcos et al., 2008b; Ogihara
et al., 2009). Organic acids can be used in meat products to delay the growth
of bacteria during storage without negative effects on the sensory quality
of the products (Diez et al., 2008). In sliced cooked ham prepared with 1.8%
potassium lactate, the growth of L. monocytogenes during chilled storage at
6°C was delayed, and the combination of this treatment with HHP treatment
(400 MPa, 17°C, 10 minutes) totally inhibited the recovery of L. monocytogenes
during chilled storage at 6°C (Aymerich et al., 2005). Lactate (1.4%) was also
efficient for preventing L. monocytogenes growth after a cold-chain break in
HHP-treated (400 MPa, 17°C, 10 minutes) cooked ham (Marcos et al., 2008b).
In fact, HHP alone decreased the initial count of L. monocytogenes from 5 to 2
log10 CFU/g, but it failed to prevent the bacteria from recovering after a cold-
chain break arising during the storage.
Among antimicrobials, bacteriocins have also been used in combination
with HHP to increase microbial inactivation in meat and meat products
(Garriga et al., 2002; Marcos et al., 2008b; Yuste et al., 1998, 2002). Bacteriocins
can be either incorporated into the product formulation or applied directly
to meat before the HHP treatment. The use of active packaging containing
antimicrobials is an additional solution that has been shown to be effective
(Jofré et al., 2008a; Marcos et al., 2008a).
Nisin is currently the only bacteriocin to be widely used as a food pre-
servative. Its effectiveness in reducing the Listeria risk is low, and the use
of potassium lactate has been shown to be more effective for inhibiting cell
recovery during chilled storage (Aymerich et al., 2005). Garriga et al. (2002)
investigated the behavior of several foodborne bacteria inoculated in a HHP-
treated (400 MPa, 17°C, 10 minutes) meat model system with added bacte-
riocins, enterocins A and B, sakacin K, pediocin AcH, and nisin. Nisin was
very efficient for inhibiting the recovery of Escherichia coli, S. aureus, and
Leuconostoc carnosum during subsequent chilled storage; however, it failed to
inhibit the recovery of L. monocytogenes. The other bacteriocins were effective
with L. monocytogenes, but not with the other tested bacteria. In HHP-treated
(400 MPa, 17°C, 6 minutes) cooked ham, the introduction between slices of
alginate films containing enterocin reduced the count of L. monocytogenes
below the level of detection, whereas either HHP treatment or active packag-
ing alone had no effect on the bacteria count (Marcos et al., 2008a).

7.2.2.3 Multipulsed HHP Treatment of Meat Products

HHP treatment can consist of a single exposure period, that is, compression
to target pressure, holding time at the target pressure, and decompression
to atmospheric pressure (single-pulsed HHP or spHHP), or the applica-
tion of multiple exposure periods in which more than one exposure period
Advances in High Hydrostatic Pressure for Meat and Meat Processing 239

exists, that is, compression, holding time, and decompression followed by

another compression, holding time, and decompression (multipulsed HHP
or mpHHP) (Buzrul et al., 2009). MpHHP could be used to lower the peak
pressure necessary to inactivate the microorganisms in foods (Pilavtepe-
Çelik et al., 2011).
Several authors have studied the potential of using mpHHP processing of
meat to improve process lethality. MpHHP (350 or 450 MPa, 2°C, 3 pulses ×
5 minutes) applied to mechanically recovered poultry meat showed that the
mpHHP treatment was slightly better than the spHHP treatment (350 or 450
MPa, 2°C, 15 minutes) for psychrotrophs, but the mpHHP treatment did not
offer better results than the spHHP treatment for mesophiles (Yuste et al.,
1998). Similar results were also obtained by Yuste et al. (2001), but in this
case, mpHHP was applied as a 60 MPa treatment (moderate pressure) fol-
lowed by a 450 MPa treatment (high pressure). These authors did not obtain
any increase in efficiency in comparison with spHHP at 450 MPa. On the
other hand, the use of the mpHHP treatment instead of the spHHP treat-
ment was observed to be more advantageous for the inactivation of E. coli
O157:H7 in ground beef (Morales et al., 2008) and Salmonella Enteritidis in
chicken breast fillets especially at higher pressures (Morales et al., 2009).
Morales et al. (2008) and Del Olmo et al. (2010) studied the effect of the
spHHP and mpHHP treatments on color and texture of beef patties and
chicken breast fillets, respectively. Changes in the color and texture of
ground beef caused by spHHP and mpHHP treatments of the same lethality
for E. coli O157:H7 (20 minutes for spHHP at 400 MPa and 4 pulses × 1 minute
for mpHHP at 400 MPa) were similar (Morales et al., 2008). Color parameters
(L*, a*, and b*) were significantly higher for both treatments than for vacuum-
packaged control fillets. Similarly, the texture of chicken breast fillets was
also significantly affected by both treatments (Del Olmo et al., 2010).

7.2.2.4 Hurdle Concept

The hurdle concept is the combination of different strategies, preservation
factors, or techniques to produce safe, stable, and high-quality food prod-
ucts. This concept consists of adding several barriers (hurdles) to bacterial
life and growth (Simonin et al., 2012). For example, in the study of Yuste
et al. (1998), mpHHP treatment (450 MPa, 2°C, 3 pulses × 5 minutes), nisin
(200 ppm), and weak acidity (pH 5.42 provided by the addition of glucono
delta-lactone) reduced the psychrotrophic and mesophilic bacterial counts
to levels below 2 log10 CFU/g in mechanically recovered poultry meat dur-
ing 1 month of chilled storage. Nisin proved to be more efficient in reducing
the indigenous flora of HHP-treated poultry meat when used at a weakly
acidic pH (Yuste et al., 1998, 2002). In fermented sausages, the inherent hur-
dles (low aw and acidity) combined with HHP (Porto-Fett et al., 2010) were
used to reduce Listeria and Salmonella risks. In this study, fermentation and
drying of inoculated salami at 7 log10 CFU/g induced reductions of 1.1–1.3
240 Advanced Technologies for Meat Processing, Second Edition

log10 CFU/g for L. monocytogenes and 4.2–4.8 log10 CFU/g for Salmonella sp. In
addition, following pressurization (600 MPa, 1–5 minutes or 483 MPa, 5–12
minutes) L. monocytogenes and Salmonella were reduced by an additional
1.6 to ≥ 5.0 log10 CFU/g and 1.9–2.4 log10 CFU/g, respectively, compared to
their levels after fermentation and drying (Porto-Fett et al., 2010). The use
of lactate, HHP, and 1°C refrigeration is a successful combination that could
reduce the Listeria risk in cooked ham (Aymerich et al., 2005; Marcos et al.,
2008b). In fact, in HHP-treated (400 MPa, 17°C, 10 minutes) cooked ham
inoculated with L. monocytogenes, a recovery of the bacteria was observed
during storage at 6°C, but no recovery was observed when the ham was
formulated with 1.4% of lactate or when it was stored at 1°C (Aymerich et
al., 2005). Storage conditions are thus of great importance for cell recovery
after HHP treatment. Generally, the lower the storage temperature, the bet-
ter is the resulting microbial quality, except for certain specific products,
such as fermented sausages, that benefit from storage at ambient tempera-
ture (Jofré et al., 2009a).

7.2.2.5 Limitations of the Abovementioned Methods

The use of elevated temperatures could be advantageous to reduce the target
pressure for some meat products; however, temperature would have nega-
tive impacts on the organoleptic properties of fresh meat. On the other hand,
low temperature could be used for fresh meat but this will require accu-
rate control of the temperature in large-scale devices used in the industry
(Urrutia et al., 2007).
The use of antimicrobials such as nisin has been shown to have a syner-
gistic effect on bacterial inactivation; however, antimicrobial spectrum of
most natural preservative systems is restricted to a narrow group of micro-
organisms. For instance, nisin and other bacteriocins are effective against
only some gram-positive bacteria, but not against gram-negative bacteria.
Further, sensitive bacterial strains may develop resistance when exposed to
sublethal doses of an antimicrobial. A well-studied example of this is nisin
resistance (Mazzotta and Montville, 1999; Mendoza et al., 1999). Finally,
protein, fat, or other components in complex foods such as meat may pro-
tect target microorganisms, for instance, by adsorbing antimicrobial com-
ponents. One way to overcome these limitations is to use combinations
of two or more biopreservatives with different targets (Zapico et al., 1998)
or to combine antimicrobials with other preservation techniques (García-
Graells et al., 2000).
Although there is now enough evidence that the mpHHP treatment is an
effective way of inactivating microorganisms, there is no commercial appli-
cation of the mpHHP treatment to date. The most important reason for this is
that the mpHHP treatment is a longer application and thus more expensive
than the spHHP treatment (Alemán et al., 1998; Buzrul et al., 2009; Buzrul,
2014b; Kingsley et al., 2006; Rivalain et al., 2012). In addition, more compli-
Advances in High Hydrostatic Pressure for Meat and Meat Processing 241

cated HHP equipment which can withstand fast compression and decom-
pression rates (to reduce the total duration of the treatment) are likely needed
for commercial applications (Buzrul, 2015).

7.3 Effects of HHP on Quality Attributes

of Meat and Meat Products
7.3.1 Effect of HHP on Texture of Meat and Meat Products
The effect of HHP on the texture of muscle foods has been investigated since
1973, when Macfarlane (1973) reported the potential use of HHP for pressure-
induced tenderization of meat (Campus, 2010). There is agreement among
consumers that tenderness is the most important factor of all attributes that
characterize the eating quality of meat (Denoyella and Lebihan, 2003; Jung
et al., 2000; Sun and Holley, 2010). Many authors reported that HHP treat-
ment (100–200 MPa) for a few minutes can improve meat tenderness when
applied to prerigor meat (Bouton et al., 1977; Elgasim and Kennick, 1980;
Ohmori et al., 1991).
In postrigor meat, HHP (150–200 MPa) causes tenderization of meat after
long exposure times (20–30 minutes) at high temperature values (40°C–80°C)
(Bouton et al., 1977; Locker and Wild; 1984; Ma and Ledward, 2004; Macfar-
lane, 1973; Sikes et al., 2010)
In summary, meat tenderness is dependent on rigor stage, pressure, tem-
perature, and their combination. Pressure values lower than 200 MPa can
tenderize prerigor meat, whereas tenderization of postrigor meat with HHP
treatment can only be achieved at higher temperatures (Sun and Holley,
2010).
HHP also induces meat protein modifications (gelation, solubilization, and
aggregation) differently than heat-induced changes. HHP results in vary-
ing effects on meat product texture and water retention, depending mainly
on the product’s form and composition, the pressure level, and the pressure/
temperature combination. Combining HHP and heat can sometimes improve
the water retention in meat batters, depending on the batter’s composition and
the process parameters. HHP can also be used to improve meat binding in
restructured meat. Nevertheless, each specific product should be tested indi-
vidually for the resulting effects of HHP on its quality (Simonin et al., 2012).

7.3.2 Effect of HHP on Lipid Oxidation of Meat and Meat Products

There is enough evidence that HHP treatment of meat and meat products
can trigger lipid oxidation, and such oxidation affects eating quality through
flavor deterioration (rancidity), color changes, loss of nutritive value, and
alterations of textural and functional properties through concomitant pro-
242 Advanced Technologies for Meat Processing, Second Edition

tein denaturation (Buckow et al., 2013; Fuentes et al., 2010; Refsgaard et al.,
2000; Viljanen et al., 2004).
The effect of HHP on lipid oxidation on pork (Cheah and Ledward, 1995,
1996, 1997), beef (Ma et al., 2007; McArdle et al., 2010), and poultry (Beltran
et al., 2004; Bragagnolo et al., 2007; Dissing et al., 1997; Kruk et al., 2011; Orlien
et al., 2000; Tuboly et al., 2003) has established that pressure levels between
300 and 600 MPa are critical for inducing lipid oxidation in fresh meat (Bajo-
vic et al., 2012).
In cured meat products, it was reported that presliced dry-cured ham was
more susceptible to oxidative reactions and lipid oxidation compared to the
control (Fuentes et al., 2010) whereas the oxidative stability of dry-cured ham
pressurized at 600 MPa was not affected (Clariana et al., 2011b). As for the
color, the effect on lipid oxidation by HHP is more pronounced for fresh meat
than for cured meat products (Clariana et al., 2011a).
Addition of natural antioxidants such as rosemary extract to meat and
meat products can help to minimize the effect of HHP on lipid oxidation.
Addition of a rosemary extract to beef patties completely prevented forma-
tion of lipid oxidation products after nine days of chilled storage in both
control and samples pressure-treated up to 600 MPa (Robbins et al., 2006).
Bragagnolo et al. (2007) demonstrated that addition of rosemary to minced
chicken meat samples before HHP treatment (600 MPa, 10°C, 10 minutes)
protected against lipid oxidation resulting from HPP when the product was
subsequently cooked. Similar findings were observed by Ma et al. (2007)
using additions of vitamin E to ground beef.
Lipid oxidation can also be controlled by using metal chelators such as
citrate or EDTA (Ikeuchi, 2011). Further possibilities proposed to inhibit lipid
oxidation is to limit oxygen availability in the packaging, use of antioxi-
dant active packaging (Bolumar et al., 2011), or use of different antioxidants
derived from natural by-products like tomato (Alves et al., 2012).
In conclusion, HHP treatment of fresh and processed meats induces lipid
oxidation. Depending on the pressure level, and to a lesser extent, on holding
time, lipid oxidation most often occurs during subsequent storage. Moreover,
HHP can be as damaging as heat treatment in terms of the oxidation level in
cold-stored meat products. Generally, HHP has little effect on lipid oxidation
below 300 MPa; however, it can have a significant effect at higher pressure
values (Simonin et al., 2012). The possible effects of enhanced lipid oxidation
on the eating quality of HHP-treated meats during storage need to be con-
sidered and controlled either through appropriate HHP treatments (pressure
levels and holding times), packaging, or use of natural antioxidants (Buckow
et al., 2013; Tume et al., 2010).

7.3.3 Effect of HHP on Color of Meat and Meat Products

It is well known that HHP influences fresh meat’s color. It has often been
reported that application of pressure above 200 MPa drastically changes
Advances in High Hydrostatic Pressure for Meat and Meat Processing 243

the appearance of red meat within a few minutes of treatment even at low
temperatures (Carlez et al., 1993; Jung et al., 2003; Korzeniowski et al., 1999;
Ledward, 2000; Tintchev et al., 2010). As pressure is increased, major struc-
tural proteins of the muscle became denatured (Cheah and Ledward, 1996)
resulting in an opaque appearance of the flesh, which further reduces the
visualization of other meat pigments. Typically, the lightness (L* values) of
red meat increases significantly after pressure treatments above 250 MPa,
whereas the redness (a* values) decreased at 400–500 MPa resulting in a gray-
brown meat with a cooked aspect (Carlez et al., 1995; Jung et al., 2003; Tintchev
et al., 2010). Studies of beef and minced beef meat showed a decrease of the
total myoglobin content at pressures in the range 250–500 MPa, whereas the
proportion of the gray metmyoglobin increased at the expense of cherry-red
oxymyoglobin at 400–500 MPa (Carlez et al., 1995).
Overall, HHP caused drastic changes in the color of fresh meat and thus
made the commercialization of HHP-treated fresh meat difficult (Cheftel and
Culioli, 1997), since color is one of the most important attributes of fresh meat
that consumers use as a purchasing criterion (Faustman and Cassens, 1990).
The color of cured products is less affected by pressure than is fresh meat’s
color (Karlowski et al., 2002; Rubio et al., 2007), although significant changes
have also been reported. For example, a decrease in redness in dry-cured
ham was observed above 200 MPa (Andrés et al., 2004, 2006; Cava et al., 2009).
Cava et al. (2009) observed that color differences between HHP-treated (300
MPa, 14°C, 30 minutes) and untreated dry-cured ham and loin disappeared
during subsequent storage at 4°C for 90 days. Changes induced by pressure
were noticeable after the treatment; however, after 60 and 90 days of storage,
differences were no longer found between treated and untreated products.
To avoid color changes in cured meat products, cooking before HHP treat-
ment has been recommended (Goutefongea et al., 1995).
In general, the negative impact of HHP on fresh meat and meat products is
dependent on different parameters, and not all of them are well-understood
as of yet. In general, HHP-induced color changes vary according to the myo-
globin content and are more dramatic for fresh red meat than for white meat
and cured meat products. Undesired changes can be limited by optimiz-
ing the process parameters of HHP treatment such as pressure, time, tem-
perature, curing, oxygen removal, and increased pH. When looking for a
reduction of the color changes induced by HHP, one should keep in mind
that measures to protect the color quality and stability can result in changed
microbial inactivation and thus affect the safety and shelf‐life of the final
product (Bajovic et al., 2012).

7.3.4 Other Effects of HHP on Meat and Meat Products

It is evident that HHP is capable of inducing various structural changes on
muscle proteins of meat and these resulting changes are dependent on the
magnitude of the pressures/temperatures and the duration of the treatment
244 Advanced Technologies for Meat Processing, Second Edition

(Buckow et al., 2013). The application of HHP on proteins leads to different

degrees of protein structure modification. As a general mechanism, the appli-
cation of HHP induces unfolding of the protein structure and subsequent fold-
ing after pressure release. This can lead, depending on the specific protein and
conditions applied, to partial or total denaturation and tuning of electrostatic
interactions. Based on the principle of Le Chatelier and Braun, reactions with a
decrease in volume are favored by pressure (Bajovic et al., 2012).
One of the remarkable effects of HHP on meat is the modification of the
actin–myosin complex. Pressure induces structural changes in the main
constituent of muscle filaments, which are possibly caused by increased
ATPase activity at 30 MPa as well as with an increase of soluble materials
from the myofibrils enhanced by pressurization above 150 MPa (Nishiwaki
et al., 1996).
Sensory acceptance of HHP-treated meat products depends on color,
texture, aroma, and taste modifications induced by the process. Problems
of sensory acceptance occur with raw products, mainly because of visible
color changes. Cooked and cured products are less modified by pressure,
and good sensory acceptance is generally reported despite some changes in
aroma and taste profiles (Simonin et al., 2012).

7.4 Consumer Acceptance of HHP-Treated

Meat and Meat Products
Although HHP is now a reality in the food industry, there are still many
consumers who are not aware of this technology. One way to understand the
consumer’s awareness/acceptance/interest on HHP technology is to admin-
ister surveys.
Personal interviews revealed that HHP was acceptable to the majority of con-
sumers in France and Germany (Butz et al., 2003). An online consumer survey in
the United States was implemented by Hicks et al. (2009) to assess the awareness
of alternative food-processing technologies, consumer food safety attitudes and
knowledge, and the willingness to pay for HHP-treated products. The survey
was completed by 1204 adults. Results revealed that while traditional meth-
ods—that is, canning, freezing, and microwaving—were all well recognized by
over 80% of respondents, only 8% recognized HHP. Trends indicated that an
increase in age, education, and income reflected greater food safety knowledge.
Given an explanation of HHP and its benefits, 39% of respondents indicated they
would be willing to pay an additional cost for such foods, with higher income
and education having the most impact (Hicks et al., 2009).
Surveys were conducted by Cardello et al. (2007) to 225 potential consum-
ers of foods processed by innovative and emerging food technologies (HHP,
pulsed electric fields, irradiation, ionizing energy, genetic modification)
Advances in High Hydrostatic Pressure for Meat and Meat Processing 245

to assess the factors contributing to their interest in using such products.

Respondents rated their interest in 49 different food-product concepts that
varied in food type, processing or production technology, costs, benefits,
risks, endorsing agencies, and product information. HHP has a strong posi-
tive influence on consumer interest, compared to irradiation and genetic
modification (Cardello et al., 2007).
In summary, consumers are ready to pay extra for new HHP-treated meat
products if they have higher quality. It is essential that the quality and safety
of the new product are assessed prior to launch in the market (Ikeuchi, 2011).
Further study is required for marketing of pressurized food products to pro-
vide consumers with clear information about the treatments, its purposes,
and gained benefits (Teixeira et al., 2014). Consumer’s willingness to pay
once they are informed could encourage industry to look more favorably on
this technology (Hicks et al., 2009).

7.5 Some Important Results from Recent

Studies of HHP on Meat Products
In this section, some results from recent studies are given. A recent work
by de Oliveira et al. (2015) showed that the addition of carvacrol (200 ppm)
to sliced low-sodium, vacuum-packed turkey breast ham notably improved
the preservation effects of HHP (600 MPa, 25°C, 3 minutes) processing. This
combined treatment was able to reduce the growth rates of lactic acid and
psychrotrophic bacteria, and extend the lag-phase of L. innocua. In addition,
the triggered lipid oxidation events by HHP may be delayed by the addition
of carvacrol. The preservative effects during the shelf life can be potentiated
by the presence of natural barriers, and the use of carvacrol represents a
promising technology against sublethal injury and cell recovery phenomena
(de Oliveira et al., 2015).
Montiel et al. (2015) studied the effects of reuterin, lactoperoxidase, lactoferrin,
and HHP (450 MPa, 6°C, 5 minutes) on the inactivation of foodborne pathogens
in cooked ham. Individual treatments of reuterin, lactoperoxidase, and HHP
diminished the growth of L. monocytogenes in cooked ham, but a recovery of
growth was observed during storage at 4°C after 35 days. Combined treatments
of HHP with reuterin or lactoperoxidase increased synergistically the antimi-
crobial effect against L. monocytogenes and avoided the recovery. Reuterin and
lactoperoxidase added individually to cooked ham diminished S. Enteritidis
and E. coli O157:H7 levels during the 35 days of challenge at 4°C and 10°C. Pres-
sure treatments, individually and in combination with antimicrobials, inhib-
ited the growth of these Gram-negative microorganisms during the 35 days of
storage. The result showed that lactoperoxidase combined with HHP was the
most effective treatment at reducing the growth of pathogens tested. Also, the
246 Advanced Technologies for Meat Processing, Second Edition

application of reuterin combined with HHP would be a useful hurdle technol-

ogy to improve the safety of cooked ham (Montiel et al., 2015).
The results of a recent study by Ros-Polski et al. (2015) indicated that,
in general, the use of HHP treatment (0–300 MPa, ambient temperature,
1–3 minutes) in salted (0–2.5 g/100 g) white chicken meat improved the
texture of the cooked meat and color of raw meat. Overall, NaCl at lower con-
centrations along with HHP treatment improved white chicken meat color
and texture. This information can be used when developing HHP treatments
as a processing alternative to reduce NaCl content while maintaining the
physical attributes and ensuring meat functionality and quality (Ros-Polski
et al., 2015).
A more recent study by Teixeira et al. (2016) investigated the effect of
growth temperature, process temperature, and sodium chloride concentra-
tion on the lethality of HHP to a five-strain cocktail of L. monocytogenes in
cooked ham. Results reveal that cultures grown at 8°C were more resistant
than cultures grown at 20°C and 32°C in broth; however, cultures grown at
8°C and 32°C were equally resistant to pressurizations at 5°C and 32°C on
ham; whereas cultures grown at 8°C tended to be more sensitive to treat-
ments at -5°C when compared to cultures grown at 32°C. L. monocytogenes
was more pressure resistant in ham with 3% (w/v) NaCl when compared to
ham with 1% (w/v) NaCl.
It is thus remarkable that the modest decrease of the NaCl content of ham
from 3% to 1% had a measurable impact on pressure resistance of L. monocy-
togenes. The meat industry currently aims to reduce the salt content of ready-
to-eat meat products. The study by Teixeira et al. (2016) indicates that even a
modest reduction of the NaCl content can improve food safety by decreasing
the pressure resistance of L. monocytogenes (Teixeira et al., 2016).

7.6 Opportunities for HHP Application

to Meat and Meat Products
HHP is a well-known technology to inactivate pathogenic and spoilage micro-
organisms in meat products. Commercially applied pressure levels are between
400 and 600 MPa with processing times of three to seven minutes at ambient
temperatures which in most cases lead to an inactivation of about four log units
of the majority of vegetative pathogenic and spoilage microorganisms < result-
ing in increased shelf life and improved safety (Bajovic et al., 2012).
The thermo-labile nature of protein meat systems and the described effects
of pressure on meat and meat proteins allow the development of novel meat-
based products and the usage of HHP as a time- and energy-saving process-
ing step for the meat industry. Functional and rheological properties of meat
can be improved and novel meat-based products with decreased salt content
Advances in High Hydrostatic Pressure for Meat and Meat Processing 247

or higher nutritional level can be developed (Bajovic et al., 2012). Since HHP
has value in the formation of gels from myofibrillar protein at low (0.2 M)
salt concentration, HHP may have potential for the development of low-
sodium-containing processed meat products. Current technological limita-
tions of 1.7%–2.1% (w/v) NaCl may be overcome by the use of HHP and will
enable manufacture of these products with more healthful levels of NaCl
(Sun and Holley, 2010).

7.7 Limitations of HHP on Meat and Meat Products

HHP treatment can be used to increase the safety and storage life especially
of ready-to-eat meat products but cannot be used to establish the safety of
these products. Further studies should be carried out to ensure microbio-
logical safety of ready-to-eat meat products. The hurdle concept could be an
effective way to achieve this goal.
Moreover, capital equipment cost can be a problem for some companies.
Nevertheless, as the technology improves, it may be possible to reduce the
cost of both the equipment and the treatment. An additional problem is that
current batch sizes are a restriction for operations with high line speeds (Sun
and Holley, 2010).

7.7.1 On the Application of HHP on Fresh Meat

HHP at ambient temperatures increases the shelf life of fresh meat; however,
HHP causes several transformations such as color loss and texture changes.
The meat becomes more gel-structured and paler, losing the typical appear-
ance of fresh meat (Bajovic et al., 2012). The color changes are similar to those in
cooked meat as the actomyosin denatures at about 200 MPa and the myoglobin
denatures and/or coprecipitates with other proteins at about 400 MPa. In addi-
tion, at pressures ≥400 MPa the unsaturated lipids in the meat become more
susceptible to oxidation, probably due to the release of iron from complexes
present in meat and/or changes in the lipid membrane (Ma and Ledward, 2013).
Depending on the process parameter applied, HHP-treated meat would
possibly not be recognized as fresh meat by consumers (Bajovic et al., 2012).
Under European Union (EU) regulation, “fresh meat” has not undergone any
preserving process other than chilling, freezing, or quick-freezing, includ-
ing meat that is vacuum-wrapped or wrapped in a controlled atmosphere
(The European Parliament and the Council of the European Union, 2004).
Overall, the color change induced by HHP in the meat as well as the current
legal definition of fresh meat has drastically limited the use of HHP for fresh
meat in the markets (Bajovic et al., 2012). Even if legislation would allow it,
it is unlikely that many consumers would be prepared to buy such meat.
248 Advanced Technologies for Meat Processing, Second Edition

However, if prerigor meat is subjected to pressures of about 100–150 MPa,

below those necessary to cause color changes, it becomes significantly more
tender than its untreated counterpart, and this may now be a commercially
viable process given the decreasing cost of HHP equipment. When treated
at 100–200 MPa, while the temperature is raised from ambient to around
60°C postrigor meat also yields a tender product and this may also be a com-
mercially attractive process to parts of the food industry, for example, those
involved in catering (Ma and Ledward, 2013).
Undesired color changes, especially for fresh red meat, can be limited by
changing the process parameters such as pressure, time, and temperature as
well as by curing, oxygen removal, and the increase of product pH by ingre-
dients (Bajovic et al., 2012).

References
Alemán, G. D., Ting, E. Y., Farkas, D. F., Mordre, S. C., Hawes, A. C. O. and Torres, J. A.
(1998). Comparison of static and step-pulsed ultra-high pressure on the micro-
bial stability of fresh cut pineapple. Journal of the Science of Food and Agriculture,
76, 383–388.
Alves, A. B., Bragagnolo, N., da Silva, M. G., Skibsted, L. H. and Orlien, V. (2012).
Antioxidant protection of high-pressure processed minced chicken meat by
industrial tomato products. Food and Bioproducts Processing, 90, 499–505.
Andrés, A., Adamsen, C., Møller, J., Ruiz, J. and Skibsted, L. (2006). High-pressure
treatment of dry-cured Iberian ham. Effect on colour and oxidative stability
during chill storage packed in modified atmosphere. European Food Research and
Technology, 222, 486–491.
Andrés, A. I., Møller, J. K. S., Adamsen, C. E. and Skibsted, L. H. (2004). High pressure
treatment of dry-cured Iberian ham. Effect on radical formation, lipid oxidation
and colour. European Food Research and Technology, 219, 205–210.
Atsushi, S., Ken, K., Hiroyuki, T., Tadayuki, N. and Yoshihide, I. (2006). Application
of high hydrostatic pressure to meat and meat processing. In: Nollet, L. M. L.
and Toldrá, F. (eds.) Advanced Technologies for Meat Processing. Boca Raton, FL:
CRC Press, 193–271.
Avsaroglu, M. D., Buzrul, S., Alpas, H., Akcelik, M. and Bozoglu, F. (2006). Use of the
Weibull model for lactococcal bacteriophage inactivation by high hydrostatic
pressure. International Journal of Food Microbiology, 108, 78–83.
Aymerich, M. T., Jofré, A., Garriga, M. and Hugas, M. (2005). Inhibition of Listeria
monocytogenes and Salmonella by natural antimicrobials and high hydrostatic
pressure in sliced cooked ham. Journal of Food Protection, 68, 173–177.
Bajovic, B., Bolumar, T. and Heinz, V. (2012). Quality considerations with high pres-
sure processing of fresh and value added meat products. Meat Science, 92,
280–289.
Beltran, E., Pla, R., Yuste, J. and Mor-Mur, M. (2004). Use of antioxidants to minimize
rancidity in pressurized and cooked chicken slurries. Meat Science, 66, 719–725.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 249

Bolumar, T., Andersen, M. L. and Orlien, V. (2011). Antioxidant active packaging for
chicken meat processed by high pressure treatment. Food Chemistry, 129, 1406–
1412.
Bouton, P. E., Harris, P. V., Macfarlane, J. J. and O’Shea, J. M. (1977). Effect of pressure
treatments on the mechanical properties of pre- and post-rigor meat. Meat Sci-
ence, 1, 307–318.
Bragagnolo, N., Danielsen, B. and Skibsted, L. H. (2007). Rosemary as antioxidant in
pressure processed chicken during subsequent cooking as evaluated by electron
spin resonance spectroscopy. Innovative Food Science and Emerging Technologies,
8, 24–29.
Buckow, R., Sikes, A. and Tume, R. (2013). Effect of high pressure on physicochemi-
cal properties of meat. Critical Reviews in Food Science and Nutrition, 53, 770–786.
Butz, P., Needs, E. C., Baron, A. et al. (2003). Consumer attitudes to high pressure food
processing. Food Agriculture and Environment, 1, 30–34.
Buzrul, S. (2014a). A review on describing the survival curves of Listeria monocytogenes
in foods of animal origin under high hydrostatic pressure. Kafkas Üniversitesi
Veteriner Fakültesi Dergisi, 20, 321–327.
Buzrul, S. (2014b). Multi-pulsed high hydrostatic pressure treatment of microorgan-
isms: A review. Innovative Food Science and Emerging Technologies, 26, 1–11.
Buzrul, S. (2015). Multi-pulsed high hydrostatic pressure treatment of foods. Foods,
4, 173–183.
Buzrul, S. and Alpas, H. (2004). Modeling the synergistic effect of high pressure and
heat on the inactivation kinetics of Listeria innocua: A preliminary study. FEMS
Microbiology Letters, 238, 29–36.
Buzrul, S. and Alpas, H. (2012). Treatment of foods using high hydrostatic pressure.
In: Bhat, R., Alias, A. K. and Paliyath, G. (eds.) Progress in Food Preservartion.
West Sussex: Wiley-Blackwell, 375–388.
Buzrul, S., Alpas, H., Largeteau, A. and Demazeau, G. (2009). Efficiency of pulse pres-
sure treatment for inactivation of Escherichia coli and Listeria innocua in whole
milk. European Food Research and Technology, 229, 127–131.
Campus, M. (2010). High pressure processing of meat, meat products and seafood.
Food Engineering Reviews, 2, 256–273.
Cardello, A. V., Schutz, H. G. and Lesher, L. L. (2007). Consumer perceptions of foods
processed by innovative and emerging technologies: A conjoint analytic study.
Innovative Food Science and Emerging Technologies, 8, 73–83.
Carlez, A., Rosec, J.-P., Richard, N. and Cheftel, J. C. (1993). High pressure inactivation
of Citrobacter freundii, Pseudomonas fluorescens, and Listeria innocua in inoculated
minced beef muscle. Lebensmittel-Wissenschaft und -Technologie, 26, 357–363.
Carlez, A., Veciana-Nogues, T. and Cheftel, J. C. (1995). Changes in colour and
myoglobin of minced beef meat due to high pressure processing. Lebensmittel-
Wissenschaft und -Technologie, 28, 528–538.
Cava, R., Ladero, L., González, S., Carrasco, A. and Ramírez, M. R. (2009). Effect of
pressure and holding time on colour, protein and lipid oxidation of sliced dry-
cured Iberian ham and loin during refrigerated storage. Innovative Food Science
and Emerging Technologies, 10, 76–81.
Cerf, O. (1997). A review. Tailing of survival curves of bacterial spores. Journal of
Applied Bacteriology, 42, 1–19.
Cheah, P. B. and Ledward, D. A. (1995). High-pressure effects on lipid oxidation. Jour-
nal of the American Oil Chemists’ Society, 72, 1059–1063.
250 Advanced Technologies for Meat Processing, Second Edition

Cheah, P. B. and Ledward, D. A. (1996). High pressure effects on lipid oxidation in

minced pork. Meat Science, 43, 123–134.
Cheah, P. B. and Ledward, D. A. (1997). Inhibition of metmyoglobin formation in
fresh beef by pressure treatment. Meat Science, 45, 411–418.
Cheftel, J. C. and Culioli, J. (1997). Effects of high pressure on meat: A review. Meat
Science, 46, 211–236.
Chen, H. (2007). Temperature-assisted pressure inactivation of Listeria monocyto-
genes in Turkey breast meat. International Journal of Food Microbiology, 117, 55–60.
Chen, H. and Hoover, D. G. (2003). Pressure inactivation kinetics of Yersinia enteroco-
litica ATCC 35669. International Journal of Food Microbiology, 87, 161–171.
Chick, H. (1908). An investigation of the laws of disinfection. Journal of Hygiene Cam-
bridge, 8, 92–158.
Clariana, M., Guerrero, L., Sárraga, C., Díaz, I., Valero, Á. and García-Regueiro, J. A.
(2011a). Influence of high pressure application on the nutritional, sensory and
microbiological characteristics of sliced skin vacuumpacked dry-cured ham.
Effects along the storage period. Innovative Food Science and Emerging Technolo-
gies, 12, 456–465.
Clariana, M., Guerrero, L., Sárraga, C. and Garcia-Regueiro, J. A. (2011b). Effects
of high pressure application (400 and 900 MPa) and refrigerated storage time
on the oxidative stability of sliced skin vacuum packed dry-cured ham. Meat
Science, 90, 323–329.
Corradini, M. G., Normand, M. D. and Peleg, M. (2007). Modeling non-isothermal
heat inactivation of microorganisms having biphasic isothermal survival
curves. International Journal of Food Microbiology, 116, 391–399.
de Oliveira, T. L. C., Leite, B. R. D., Ramos, A. L. S., Ramos, E. M., Piccoli, R. H. and
Cristianini, M. (2015). Phenolic carvacrol as a natural additive to improve the
preservative effects of high pressure processing of low-sodium sliced vacuum-
packed turkey breast ham. LWT–Food Science and Technology, 64, 1297–1308.
Del Olmo, A., Morales, P., Ávila, M., Calzada, J. and Nuñez, M. (2010). Effect of single-
cycle and multiple-cycle high-pressure treatments on the colour and texture of
chicken breast fillets. Innovative Food Science and Emerging Technologies, 11, 441–444.
Denoyella, C. and Lebihan, E. (2003). Intramuscular variation in beef tenderness.
Meat Science, 66, 241–247.
Diez, A. M., Santos, E. M., Jaime, I. and Rovira, J. (2008). Application of organic acid
salts and high-pressure treatments to improve the preservation of blood sau-
sage. Food Microbiology, 25, 154–161.
Dissing, J., Bruun-Jensen, L. and Skibsted, L. H. (1997). Effect of high-pressure treat-
ment on lipid oxidation in turkey thigh muscle during chill storage. Zeitschrift
für Lebensmitteluntersuchung und Forschung, 205, 11–13.
Donsì, G., Ferrari, G. and Maresca, P. (2003). On the modeling of the inactivation
kinetics of Saccharomyces cerevisiae by means of combined temperature and high
pressure treatments. Innovative Food Science and Emerging Technologies, 4, 35–44.
Elgasim, E.A. and Kennick, W.H. (1980). Effect of pressurization of pre-rigor beef
muscles on protein quality. Journal of Food Science, 45, 1122–1124.
Escriu, R. and Mor-Mur, M. (2009). Role of quantity and quality of fat in meat mod-
els inoculated with Listeria innocua or Salmonella Typhimurium treated by high
pressure and refrigerated stored. Food Microbiology, 26, 834–840.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 251

The European Parliament and the Council of the European Union. (2004). Regulation
(EC) No 853/2004 of the European Parliament and of the Council of 29 April
2004 laying down specific hygiene rules for on the hygiene of foodstuffs. Official
Journal of the European Union, 139, 1–155.
Faustman, C. and Cassens, R. G. (1990). The biochemical basis for discoloration in
fresh meat: A review. Journal of Muscle Foods, 1, 217–243.
Fuentes, V., Ventanas, J., Morcuende, D., Estévez, M. and Ventanas, S. (2010). Lipid
and protein oxidation and sensory properties of vacuum packaged dry-cured
ham subjected to high hydrostatic pressure. Meat Science, 85, 506–514.
García-Graells, C., Valckx, C. and Michiels, C. W. (2000). Inactivation of Escherchia coli
and Listeria innocua in milk by combined treatment with high hydrostatic pres-
sure and the lactoperoxidase system. Applied and Environmental Microbiology, 66,
4173–4179.
Garriga, M. and Aymerich, T. (2009). Advanced decontamination technologies: High
hydrostatic pressure on meat products. In: Toldrá, F. (ed.) Safety of Meat and Pro-
cessed Meat. New York, NY: Springer, 183–208.
Garriga, M., Aymerich, M. T., Costa, S., Monfort, J. M. and Hugas, M. (2002). Bacteri-
cidal synergism through bacteriocins and high pressure in a meat model system
during storage. Food Microbiology, 19, 509–518.
Garriga, M., Grèbol, N., Aymerich, M. T., Monfort, J. M. and Hugas, M. (2004). Micro-
bial inactivation after high-pressure processing at 600 MPa in commercial meat
products over its shelf life. Innovative Food Science and Emerging Technologies, 5,
451–457.
Geeraerd, A. H., Valdramidis, V. P. and Van Impe, J. F. (2005). GInaFiT, a freeware tool
to assess non-log-linear microbial survivor curves. International Journal of Food
Microbiology, 102, 95–105.
Gola, S., Mutti, P., Manganelli, E., Squarcina, N. and Rovere, P. (2000). Behaviour of
E. coli 0157: H7 strains in model system and in raw meat by HPP: Microbial and
technological aspects. High Pressure Research, 19, 91–97.
Goutefongea, R., Rampon, V., Nicolas, J. and Dumont, J. P. (1995). Meat color changes
under high pressure treatment. In Proceeding of the 41st International Congress of
Meat Science and Technology, San Antonio, Texas, 384–385.
Grèbol, N. (2002). Commercial use of high hydrostatic pressure in sliced cooked ham
in Spain. In: Hayashi, R. (ed.) Trends in High Pressure Bioscience and Biotechnology,
Progress in Biotechnology, vol. 19. Amsterdam: Elsevier Science, pp. 385–388.
Hereu, A., Dalgaard, P., Garriga, M., Aymerich, T. and Bover-Cid, S. (2012). Modelling
the high pressure inactivation kinetics of Listeria monocytogenes on RTE cooked
meat products. Innovative Food Science and Emerging Technologies, 16, 305–315.
Hicks, D. T., Pivarnik, L. F., McDermott, R., Richard, N., Hoover, D. G. and Kniel, K. E.
(2009). Consumer awareness and willingness to pay for high-pressure process-
ing of ready-to-eat food. Food Science Education Research, 8, 32–38.
Hugas, M., Garriga, M. and Monfort, J. M. (2002). New mild technologies in meat
processing: High pressure as a model technology. Meat Science, 62, 359–371.
Ikeuchi, Y. (2011). Recent advances in the application of high pressure technology
to processed meat products. In: Kerry, J. P. and Kerry, J. F. (eds.) Processed
Meats—Improving Safety, Nutrition and Quality. Cambridge: Woodhead Pub-
lishing, 590–609.
252 Advanced Technologies for Meat Processing, Second Edition

Jofré, A., Aymerich, T. and Garriga, M. (2008a). Assessment of the effectiveness of

antimicrobial packaging combined with high pressure to control Salmonella spp.
in cooked ham. Food Control, 19, 634–638.
Jofré, A., Aymerich, T. and Garriga, M. (2009a). Improvement of the food safety of
low-acid fermented sausages by enterocins A and B and high pressure. Food
Control, 20, 179–184.
Jofré, A., Aymerich, T., Grebol, N. and Garriga, M. (2009b). Efficiency of high hydro-
static pressure at 600 MPa against food-borne microorganisms by challenge tests
on convenience meat products. LWT-Food Science and Technology, 42, 924–928.
Jofré, A., Garriga, M. and Aymerich, T. (2007). Inhibition of Listeria monocytogenes in
cooked ham through active packaging with natural antimicrobials and high-
pressure processing. Journal of Food Protection, 70, 2498–2502.
Jofré, A., Garriga, M. and Aymerich, T. (2008b). Inhibition of Salmonella sp. Lis-
teria monocytogenes and Staphylococcus aureus in cooked ham by combining
antimicrobials, high hydrostatic pressure and refrigeration. Meat Science,
78, 53–59.
Jung, S., de Lamballerie-Anton, M. and Ghoul, M. (2000). Textural changes in bovine
meat treated with high pressure. High Pressure Research, 19, 69–74.
Jung, S., Ghoul, M. and de Lamballerie-Anton, M. (2003). Influence of high pressure
on the color and microbial quality of beef meat. Food Science and Technology, 36,
625–631.
Karlowski, K., Windyga, B., Fonberg-Broczek, M. et al. (2002). Effects of high pressure
treatment on the microbiological quality, texture and colour of vacuum-packed
pork meat products. High Pressure Research, 22, 725–732.
Kingsley, D. H., Guan, D., Hoover, D. G. and Chen, H. (2006). Inactivation of hepatitis
A virus by high-pressure processing: The role of temperature and pressure oscil-
lation. Journal of Food Protection, 69, 2454–2459.
Korzeniowski, W., Jankowska, B., Kwiatkowska, A. (1999). The effect of high pressure
on some technological properties of pork. Electronic Journal of Polish Agricultural
Universities, 2, 1–7, #04. Available at http://www.ejpau.media.pl/volume2/
issue2/food/art-04.html
Koseki, S. and Yamamoto, K. (2007). A novel approach to predicting microbial inac-
tivation kinetics during high pressure processing. International Journal of Food
Microbiology, 116, 275–281.
Koutchma, T. (2014). Adapting High Hydrostatic Pressure (HPP) for Food Processing
Operations. Burlington, NY: Elsevier.
Krockel, L. and Muller, W. D. (2002). Inactivation of bacteria on vacuum-packaged sliced
Bologna-type sausage by high hydrostatic pressures. Fleischwirtschaft, 82, 121–124.
Kruk, Z. A., Yun, H., Rutley, D. L., Lee, E. J., Kim, Y. J. and Jo, C. (2011). The effect of
high pressure on microbial population, meat quality and sensory characteristics
of chicken breast fillet. Food Control, 22, 6–12.
Ledward, D. A. (2000). Effects of pressure on protein structure. High Pressure Research,
19, 1–10.
Linton, R. H., Carter, W. H., Pierson, M. D. and Hackney, C. R. (1995). Use of modified
Gompertz equation to model non-linear survival curves for Listeria monocyto-
genes Scott A. Journal of Food Protection, 9, 946–954.
Locker, R. H. and Wild, D. J. C. (1984). Tenderisation of meat by pressure-heat involves
weakening of the gap filaments in the myofibril. Meat Science, 10, 207–233.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 253

López-Caballero, M., Carballo, J. and Jiménez-Colmenero, R. (2002). Microbial inac-

tivation in meat products by pressure/temperature processing. Journal of Food
Science, 67, 797–801.
Lori, S., Buckow, R., Knorr, D., Heinz, V. and Lehmacheri, A. (2007). Predictive model
for inactivation of Campylobacter spp. by heat and high hydrostatic pressure.
Journal of Food Protection, 70, 2023–2029.
Ma, H. J. and Ledward, D. A. (2004). High pressure/thermal treatment effects on the
texture of beef muscle. Meat Science, 68, 347–355.
Ma, H. and Ledward, D. A. (2013). High pressure processing of fresh meat—Is it
worth it? Meat Science, 95, 897–903.
Ma, H. J., Ledward, D. A., Zamri, A. I., Frazier, R. A. and Zhou, G. H. (2007). Effects of
high pressure/thermal treatment on lipid oxidation in beef and chicken muscle.
Food Chemistry, 104, 1575–1579.
Macfarlane, J. J. (1973). Pre-rigor pressurization of muscle: Effects on pH, shear value
and taste panel assessment. Journal of Food Science, 38, 294–298.
Macfarlane, J. J. (1985). High pressure technology and meat quality. In: Lawrie, R. A.
(ed.) Developments in Meat Science-3, London: Elsevier Applied Science, 155–184.
Macfarlane, J. J., McKenzie, I. J. and Turner, R. H. (1986). Pressure-heat treatment of meat:
Changes in myofibrillar proteins and ultrastructure. Meat Science, 17, 161–176.
Macfarlane, J. J., McKenzie, I. J. and Turner, R. H. (1982). Pressure-induced pH and
length changes in muscle. Meat Science, 7, 169–181.
Macfarlane, J. J., McKenzie, I. J., Turner, R. H. and Jones, P. N. (1981). Pressure treatment
of meat: Effects on thermal transitions and shear values. Meat Science, 5, 307–317.
Macfarlane, J. J. and Morton, D. J. (1978). Effects of pressure treatment on the ultra-
structure of striated muscle. Meat Science, 2, 282–288.
Marcos, B., Aymerich, T., Monfort, J. M. and Garriga, M. (2008a). High-pressure pro-
cessing and antimicrobial biodegradable packaging to control Listeria monocyto-
genes during storage of cooked ham. Food Microbiology, 25, 177–182.
Marcos, B., Jofré, A., Aymerich, T., Monfort, J. M. and Garriga, M. (2008b). Combined
effect of natural antimicrobials and high pressure processing to prevent Listeria
monocytogenes growth after a cold-chain break during storage of cooked ham.
Food Control, 19, 76–81.
Martinez-Rodriguez, A. and Mackey, B. M. (2005). Factors affecting the pressure resis-
tance of some Campylobacter species. Letters in Applied Microbiology, 41, 321–326.
Mazzotta, A. S. and Montville, T. J. (1999). Characterization of fatty acid composition,
spore germination, and thermal resistance in a nisin-resistant mutant of Clos-
tridium botulinum 169B and in the wild-type strain. Applied and Environmental
Microbiology, 65, 659–664.
Mendoza, F., Maqueda, M., Galvez, A., Martinez-Bueno, M. and Valdivia. E. (1999).
Antilisterial activity of peptide AS-48 and study of changes induced in the cell
envelope properties of an AS-48-adapted strain of Listeria monocytogenes. Applied
and Environmental Microbiology, 65, 618–625.
McArdle, R., Marcos, B., Kerry, J. P. and Mullen, A. (2010). Monitoring the effects of
high pressure processing and temperature on selected beef quality attributes.
Meat Science, 86, 629–634.
Moerman, F. (2005). High hydrostatic pressure inactivation of vegetative microorgan-
isms, aerobic and anaerobic spores in pork Marengo, a low-acidic particulate
food product. Meat Science, 69, 225–232.
254 Advanced Technologies for Meat Processing, Second Edition

Montiel, R., Martín-Cabrejas, I. and Medina, M. (2015). Reuterin, lactoperoxidase, lac-

toferrin and high hydrostatic pressure on the inactivation of food-borne patho-
gens in cooked ham. Food Control, 51, 122–128.
Morales, P., Calzada, J., Ávila, M. and Nuñez, M. (2008). Inactivation of Escherichia coli
O157: H7 in ground beef by single-cycle and multiple-cycle high-pressure treat-
ments. Journal of Food Protection, 71, 811–815.
Morales, P., Calzada, J. and Nuñez, M. (2006). Effect of high-pressure treatment on
the survival of Listeria monocytogenes Scott A in sliced vacuum-packaged Iberian
and Serrano cured hams. Journal of Food Protection, 69, 2539–2543.
Morales, P., Calzada, J., Rodríguez, B., de Paz, M. and Nuñez, M. (2009). Inactivation
of Salmonella Enteritidis in chicken breast fillets by single-cycle and multiple-
cycle high pressure treatments. Foodborne Pathogens and Diseases, 6, 577–581.
Myers, K., Cannon, J., Montoya, D., Dickson, J., Lonergan, S. and Sebranek, J. (2013).
Effects of high hydrostatic pressure and varying concentrations of sodium
nitrite from traditional and vegetable-based sources on the growth of Listeria
monocytogenes on ready-to-eat (RTE) sliced ham. Meat Science, 94, 69–76.
Nishiwaki, T., Ikeuchi, Y. and Suzuki, A. (1996). Effects of high pressure treatment
on Mg-enhanced ATPase activity of rabbit myofibrils. Meat Science, 43, 145–155.
Ogihara, H., Yatuzuka, M., Horie, N., Furukawa, S. and Yamasaki, M. (2009). Syner-
gistic effect of high-hydrostatic-pressure treatment and food additives on the
inactivation of Salmonella enteritidis. Food Control, 20, 963–966.
Ohmori, T., Shigehisa, T., Taji, S. and Hayashi, R. (1991). Effect of high pressure on
the protease activities in meat. Agricultural and Biological Chemistry, 55, 357–361.
Orlien, V., Hansen, E. and Skibsted, L. H. (2000). Lipid oxidation in high-pressure pro-
cessed chicken breast muscle during chill storage: Critical working pressure in rela-
tion to oxidation mechanism. European Food Research and Technology, 211, 99–104.
Patterson, M. F. and Kilpatrick, D. J. (1998). The combined effect of high hydrostatic
pressure and mild heat on inactivation of pathogens in milk and poultry. Journal
of Food Protection, 61, 432–436.
Patterson, M. F., Linton, M. and Doona, C. J. (2007). Introduction to high pressure
processing of foods. In: Doona, C. J. and Feeherry, F. E. (eds.) High Pressure Pro-
cessing of Foods. Ames, IA: IFT Press/Blackwell Publishing, pp. 1–14.
Patterson, M. F., Quinn, M., Simpson, R. and Gilmour, A. (1995). Sensitivity of vegeta-
tive pathogens to high hydrostatic pressure treatment in phosphate-buffered
saline and foods. Journal of Food Protection, 58, 524–529.
Peleg, M. (1996). Evaluation of the Fermi equation as a model of dose-response
curves. Applied Microbiology and Biotechnology, 46, 303–306.
Peleg, M. (2000). Microbial survival curves—The reality of flat shoulders and absolute
thermal death times. Food Research International, 33, 531–538.
Peleg, M. (2003). Calculation of the nonisothermal inactivation patterns of microbes
having sigmoidal isothermal semilogarithmic survival curves. Critical Reviews
in Food Science and Nutrition, 43, 645–658.
Peleg, M. (2006). Advanced Quantitative Microbiology for Food and Biosystems: Models for
Predicting Growth and Inactivation. Boca Raton, FL: CRC Press.
Peleg, M. and Cole, M. B. (1998). Reinterpretation of microbial survival curves. Criti-
cal Reviews in Food Science and Nutrition, 38, 353–380.
Pilavtepe-Çelik, M., Buzrul, S., Alpas, H., Largeteau, A. and Demazeau, G. (2011).
Multi-pulsed high hydrostatic pressure treatment for inactivation and injury of
Escherichia coli. Journal für Verbraucherschutz und Lebensmittelsicherheit, 6, 343–348.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 255

Polydera, A. C., Stoforos, N. G. and Taoukis, P. S. (2005). Effect of high hydrostatic

pressure treatment on post processing antioxidant activity of fresh navel orange
juice. Food Chemistry, 91, 495–503.
Porto-Fett, A. C. S., Call, J. E., Shoyer, B. E. et al. (2010). Evaluation of fermenta-
tion, drying, and/or high pressure processing on viability of Listeria mono-
cytogenes, Escherichia coli O157: H7, Salmonella spp., and Trichinella spiralis in
raw pork and Genoa salami. International Journal of Food Microbiology, 140,
61–75.
Refsgaard, H. H. F., Brockhoff, P. M. B. and Jensen, B. (2000). Free polyunsaturated
fatty acids cause taste deterioration of salmon during frozen storage. Journal of
Agricultural and Food Chemistry, 48, 3280–3285.
Rivalain, N., Roquain, J., Boiron, J. M. et al. (2012). High hydrostatic pressure treat-
ment for the inactivation of Staphylococcus aureus in human blood plasma. New
Biotechnology, 29, 409–414.
Robbins, K. L., Lakshmanan, R., Sebranek, J. G. and Jung, S. (2006). Efficiency of rose-
mary and BHA/BHT antioxidant to delay lipid and color deterioration of pres-
surized meat products. In Proceedings of Annual Meeting and Food Exposition of the
Institute of Food Technologists, Orlando, Florida.
Rubio, B., Martínez, B., García-Cachán, M. D., Rovira, J. and Jaime, I. (2007). Effect of
high-pressure preservation on the quality of dry cured beef “Cecina de Leon.”
Innovative Food Science and Emerging Technologies, 8, 102–110.
Ros-Polski, V., Koutchma, T., Xue, J., Defelice, C. and Balamurugan, S. (2015). Effects
of high hydrostatic pressure processing parameters and NaCl concentration on
the physical properties, texture and quality of white chicken meat. Innovative
Food Science and Emerging Technologies, 30, 31–42.
Shigehisa, T., Ohmori, T., Saito, A., Taji, S. and Hayashi, R. (1991). Effects of high
hydrostatic pressure on characteristics of pork slurries and inactivation of
microorganisms associated with meat and meat products. International Journal
of Food Microbiology, 12, 207–215.
Sikes, A., Tornberg, E. and Tume, R. (2010). A proposed mechanism of tenderising
post-rigor beef using high pressure-heat treatment. Meat Science, 84, 390–399.
Simonin, H., Duranton, F. and de Lamballerie, M. (2012). New insights into the high-
pressure processing of meat and meat products. Comprehensive Reviews in Food
Science and Food Safety, 11, 285–306.
Simpson, R. K. and Gilmour, A. (1997). The resistance of Listeria monocytogenes to high
hydrostatic pressure in foods. Food Microbiology, 14, 567–573.
Solomon, E. B. and Hoover, D. G. (2004). Inactivation of Campylobacter jejuni by high
hydrostatic pressure. Letters in Applied Microbiology, 38, 505–509.
Sun, X. D. and Holley, R. A. (2010). High hydrostatic pressure effects on the texture of
meat and meat products. Journal of Food Science, 75, R17–R21.
Tassou, C. C., Galiatsatou, P., Samaras, F. J. and Mallidis, C. G. (2007). Inactivation kinet-
ics of a piezotolerant Staphylococcus aureus isolated from high-pressure-treated
sliced ham by high pressure in buffer and in a ham model system: Evaluation in
selective and non-selective medium. Innovative Food Science and Emerging Tech-
nologies, 8, 478–484.
Tassou, C. C., Panagou, E. Z., Samaras, F. J., Galiatsatou, P. and Mallidis, C. G. (2008).
Temperature-assisted high-hydrostatic-pressure inactivation of Staphylococ-
cus aureus in a ham model system: Evaluation in selective and nonselective
medium. Jounal of Applied Microbiology, 104, 1764–1773.
256 Advanced Technologies for Meat Processing, Second Edition

Teixeira, P., Kolomeytseva, M., Silva, J., Castro, S. M. A. and Saraiva, J. A. (2014). High
hydrostatic pressure applied to ready-to-eat meat products. Frontiers in Food Sci-
ence and Technology, 1, 14–23.
Teixeira, J. S., Maier, M. B., Miller, P., Gänzle, M. G. and McMullen, L. M. (2016).
The effect of growth temperature, process temperature, and sodium chloride on
the high pressure inactivation of Listeria monocytogenes on ham. European Food
Research and Technology, 242, 2021–2029.
Tintchev, F., Wackerbarth, H., Kuhlmann, U. et al. (2010). Molecular effects of high-
pressure processing on food studied by resonance Raman. Annals of New York
Academy of Science, 1189, 34–42.
Tonello, C. (2011). Case studies on high-pressure processing of foods. In: Zhang,
H. Q., Barbosa-Cánovas, G. V., Balasubramaniam, V. M., Dunne, C. P., Farkas, D.
F. and Yuan, J. T. C. (eds.) Nonthermal Processing Technologies for Food. Chichester:
Wiley-Blackwell, pp. 36–50.
Tokuşoğlu, Ö. and Vural, H. (2014). High-pressure processing for freshness, shelf-life
quality of meat products and value-added meat products. In: Tokuşoğlu, Ö. and
Swanson, B. G (eds.) Improving Food Quality with Novel Food Processing Technolo-
gies. Boca Raton, FL: CRC Taylor & Francis, pp. 85–110.
Tuboly, E., Lebovics, V. K., Gaál, Ö., Mészáros, L. and Farkas, J. (2003). Microbiologi-
cal and lipid oxidation studies on mechanically deboned turkey meat treated by
high hydrostatic pressure. Journal of Food Engineering, 56, 241–244.
Tume, R. K., Sikes, A. L. and Smith, S. B. (2010). Enriching M. Sternomandibularis with
alpha-tocopherol by dietary means does not protect against the lipid oxidation
caused by high-pressure processing. Meat Science, 84, 66–70.
Urrutia, G., Arabas, J., Autio, K. et al. (2007). SAFE ICE: Low-temperature pressure
processing of foods: Safety and quality aspects, process parameters and con-
sumer acceptance. Journal of Food Engineering, 83, 293–315.
USDA, Food Safety and Inspection Service. (2006). Compliance guidelines to control
Listeria monocytogenes in post-lethality exposed RTE Meat and Poultry Prod-
ucts. Available at http://www.fsis.usda.gov/OPPDE/rdad/FRPubs/97-013F/
LM_Rule_Compliance_Guidelines_May_2006.pdf (Accessed 28 February 2016).
Viljanen, K., Kylli, P., Kivikari, R. and Heinonen, M. 2004. Inhibition of protein and
lipid oxidation in liposomes by berry phenolics. Journal of Agricultural and Food
Chemistry, 52, 7419–7424.
Xiong, R., Xie, G., Edmondson, A. E. and Sheard, M. A. (1999). A mathematical model
for bacterial inactivation. International Journal of Food Microbiology, 46, 45–55.
Yamamoto, K., Matsubara, M., Kawasaki, S., Bari, M. L. and Kawamoto, S. (2005).
Modeling the pressure inactivation dynamics of Escherichia coli. Brazilian Journal
of Medical and Biological Research, 38, 1253–1257.
Yuste, J., Mor-Mur, M., Capellas, M., Guamis, B. and Pla, R. (1998). Microbiological
quality of mechanically recovered poultry meat treated with high hydrostatic
pressure and nisin. Food Microbiology, 15, 407–414.
Yuste, J., Pla, R., Capellas, M. and Mor-Mur, M. (2002). Application of high-pressure
processing and nisin to mechanically recovered poultry meat for microbial
decontamination. Food Control, 13, 451–455.
Yuste, J., Pla, R., Capellas, M., Ponce, E. and Mor-Mur, M. (2000b). High-pressure pro-
cessing applied to cooked sausages: Bacterial populations during chilled stor-
age. Journal of Food Protection, 63, 1093–1099.
Advances in High Hydrostatic Pressure for Meat and Meat Processing 257

Yuste, J., Pla, R., Capellas, M., Sendra, E., Beltran, E. and Mor-Mur, M. (2001).
Oscillatory high pressure processing applied to mechanically recovered poultry
meat for bacterial inactivation. Journal of Food Science, 66, 482–484.
Yuste, J., Pla, R. and Mor-Mur, M. (2000a). Salmonella enteritidis and aerobic meso-
philes in inoculated poultry sausages manufactured with high-pressure pro-
cessing. Letters in Applied Microbiology, 31, 374–377.
Zapico, P., Medina, M., Gaya, P. and Nuñez M. (1998). Synergistic effect of nisin and
the lactoperoxidase system on Listeria monocytogenes in skim milk. International
Journal of Food Microbiology, 40, 35–42.
8
Hydrodynamic Pressure Processing to
Improve Meat Quality and Safety

Tomás Bolumar and Stefan Toepfl

CONTENTS
8.1 Introduction ................................................................................................ 259
8.2 HDP or Shock Wave Technology ............................................................. 260
8.2.1 Fundamentals ................................................................................. 261
8.2.2 Development of Equipment.......................................................... 263
8.3 HDP for Improving Meat Quality ........................................................... 267
8.3.1 HDP for Meat Tenderization ........................................................ 267
8.3.2 HDP for Modification of Meat Functionality............................. 274
8.3.3 Molecular and Structural Effects of HDP in Meat .................... 276
8.4 HDP for Improving Meat Safety.............................................................. 281
8.5 Cost Analysis of HDP Technology .......................................................... 286
8.5.1 Packaging ........................................................................................ 286
8.5.2 Equipment ....................................................................................... 287
8.5.3 Quantifying Meat Benefits ........................................................... 289
8.5.4 Overall Cost Analysis of HDP or Shock Wave Technology
for the Meat Industry .................................................................... 289
8.6 Future Considerations ............................................................................... 291
8.7 Conclusion .................................................................................................. 291
Acknowledgments .............................................................................................. 292
References............................................................................................................. 292

8.1 Introduction
Meat quality and safety are essential for the meat industry. For fresh meat,
tenderness is the most important eating quality trait (Mennecke et al., 2007),
and thus, it has great impact on its value and repeated purchase by consumers
(Grunert et al., 2004). Consequently, during the years, many interventions have
been developed to improve the tenderness of low-value muscles and to ensure
the consistency of high-value muscles. Tenderness, however, is a very complex
trait and has proved to be very difficult to guarantee in commercial scenarios.

259
260 Advanced Technologies for Meat Processing, Second Edition

Therefore, the development of novel interventions to improve tenderness would

greatly contribute to boost the profitability of the meat industry (Bolumar et al.,
2013). In addition, meat safety assurance is on top of the list of industry pri-
orities. Food safety is assured in the industry by the application of strict risk
management systems that exclude from the food production chain the presence
of chemical, physical, or biological materials that are harmful to human health
upon consumption. The development of alternative processing methods for
microbial inactivation provides the industry with tools to guarantee food safety
and can contribute to process optimization and cost reductions.
In recent years, the use of novel food processing technologies, beyond the use
of heat treatments, such as high-pressure processing (HPP), pulsed electric fields,
and high-power ultrasounds, has emerged due in part to the considerable effort
undertaken by the scientific community in the last 20 years. This has led to the
development and scale up of different technologies which are nowadays available
for testing in different fields and for specific applications regarding food qual-
ity and safety (Barbosa-Canovas et al., 2004; Doona et al., 2010). Hydrodynamic
pressure processing (HDP) is one of these novel processing technologies that
emerged on scientific ground and is now developing for transfer to the industry.
Meat tenderization and microbial decontamination using HDP are promising
areas to deliver alternative methods to comply with the demands of the future
meat industry for high-quality and safe meat (Bolumar et al., 2013).
This chapter begins by describing the fundamental principles to generate
a shock wave and presents this together with the engineering development
of shock wave equipment. Then, the effects of HDP on meat quality traits
such as tenderness and meat functional properties are presented. Following
on, the effects of HDP on muscle micro- and ultrastructure are described to
shed light on the molecular mechanisms responsible for the observed effects.
Later, the potential use of HDP for microbial inactivation is also described
and discussed. Throughout the chapter, the HDP method for meat tenderiza-
tion and microbial inactivation is compared with current and novel practices
and methods applied with the same purpose in order to provide the reader
and the industry with alternatives and set out the specific context for its use.
Finally, a cost–benefit analysis of the technology including processing and
packaging costs in relation to benefits on meat quality is outlined as well as
directions on how to improve the technology.

8.2 HDP or Shock Wave Technology

HDP differs from HPP. HPP is a processing method in which a product is
placed within a vessel filled with a fluid, normally water, and the pressure is
transmitted to the product by compressing the surrounding liquid with pumps.
In HPP, pressure is applied to the product in a static way as such pressure is
transmitted instantaneously and uniformly across the entire product, while in
HDP, the pressure is applied in a dynamic way as pressure pulses. The fact is that
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 261

the application of high pressure to food systems offers possibilities that cannot
be achieved by common processing techniques, and thus, it has a high potential
for the development of novel and future food applications. Indeed, HPP is the
most successful nonthermal technology applied in the food industry so far with
more than 200 units operating worldwide (Bolumar et al., 2015). Commercial
HPP equipment operates in the pressure range up to 600 MPa. Today, the ben-
efits of HPP on microbial inactivation are well established and HPP-treated food
products such as juices, dairy products, sauces, or meat products can be found
in the market (Hendrickx and Knorr, 2002). Furthermore, HPP can also be used
as a method to modify food structures with positive effects if applied under the
right conditions. More information on the use of HPP for structure modifica-
tion is reviewed in the book chapter by Bolumar et al. (2016). In this chapter,
HDP is presented and described. Overall, HDP, like HPP, can be used for struc-
ture modification and microbial inactivation although the way that pressure is
applied to the system is substantially different as described above.

8.2.1 Fundamentals
HDP or shock wave is the application of high-pressure waves up to 1 GPa in
fractions of milliseconds. A shock wave is instantaneously generated and is
characterized by the intensity achieved (pressure level) and its propagation
along the time course (rise time). The shock wave propagates across the sur-
rounding medium with high energy–momentum at speeds higher than the
speed of sound. It travels rapidly through the fluids (water) and any objects
which are an acoustical match with water (Mayer et al., 2009; Yang, 2011).
Since meat is composed of 75% water the pressure wave crosses the meat and
at points where acoustic impedances differ, an energy–momentum transfer
occurs, which, in turn, creates mechanical stress that tears the muscle struc-
ture. This produces what could be termed a “rupture effect,” and as a result,
the meat instantaneously softens; an accelerated aging of the meat has also
been observed over time (Bolumar et al., 2013).
Shock waves are mechanical pressure pulses in fluids. The generation of
a shock wave by electrical discharge occurs by converting electrical energy
into mechanical energy under water. A shock wave can be generated by
piezoelectric, electromagnetic, electrothermal, or electrodetonative methods
(Mayer et al., 2009; Yang, 2011). The highest energy conversion rate can be
accomplished by electrothermal and electro-detonative procedures and these
methods have been the most applied in food processing research so far due to
the higher energy of these shock waves. When the electro-detonative process
takes place in a tensioned wired electrode, chemical energy is released by the
evaporation and explosion. The explosive expansion generates a shock wave.
The range of penetration depth of a shock wave is affected by the propaga-
tion loss and the absorption, reflection, and refraction in and on the different
materials of the treatment area and surroundings. Due to the propagation loss
as a consequence of the increase of the shock wave front, the power density at
262 Advanced Technologies for Meat Processing, Second Edition

a point from the origin of the shock wave decreases with the square of the dis-
tance. Therefore to increase the energy density in medical devices, focusing
of the shock wave is applied which leads to a locally limited workspace. To
increase the range of energy release, particularly when used for the treatment
of foods, it is essential to obtain sufficient processing volumes with homog-
enous distribution of treatment intensity. Simultaneously, the focusing of the
shock wave energy to the material to be treated permits the reduction of the
mechanical load applied to the treatment area.
As previously mentioned, the shock waves commonly used in food process-
ing so far can be generated by a detonation of an explosive or by an electrical
discharge of a high voltage between two electrodes under water. The detona-
tion of an explosive and the subsequent generation of a dynamic pressure wave
is obvious. But in the case of an electrical discharge, it is noteworthy to briefly
describe the underliying mechanism. The application of high energy by use of a
capacitor discharge underwater between two electrodes leads to the formation
of a plasma channel wherein the medium is ionized. The electric breakdown of
liquids is initiated by the application of the high electric field on the electrode
followed by rapid propagation and branching of plasma channels (Locke et al.,
2006). The operational principle of shock wave equipment based on electrical
discharge is outlined in Figure 8.1. A basic shock wave system consists of a high-
voltage power supply, a capacitor bank, and a high-voltage/current switch to dis-
charge the stored electric energy across the electrodes. By variations of charging
voltage and capacity, the energy per pulse can be varied. The treatment intensity
can be further adjusted with the number of pulses applied to the sample.
So far, HDP has mainly been applied for meat tenderization (Solomon et al.,
1997, 2006; Claus et al., 2001b; Claus, 2002; Bolumar et al., 2013). HDP can be
also applied to foodstuffs for different purposes like the opening of oysters

Power supply

Switch

Capacitor
bank
Underwater Exploding
discharge wire

FIGURE 8.1
Operation principle of electrohydraulic shock wave equipment. (Reprinted from Meat Science,
92, Bajovic et al., Quality considerations with high pressure processing of fresh and value
added meat products, 280–289. Copyright 2012, with permission from Elsevier.)
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 263

(Paparella and Allen, 1970), the improvement of the extraction of saponin

from tomato (Manabe et al., 2011), and the production of functional rice flour
(Miyafuji et al., 2011; Shimojima et al., 2011). In general, shock wave tech-
nology as a method for structure modification can assist in extraction pro-
cesses and waste treatment as well as cleaning and fragmentation processes
of plant materials. Some work has also been done in the area of microbial
inactivation as later is examined for the case of meat (Section 8.3).

8.2.2 Development of Equipment

A historical perspective of the evolution of HDP or shock wave technology
is presented in Figure 8.2 that highlights chronologically the major events on
the evolution of the engineering development of HDP technology from the
1970s until now. The development of commercial shock wave equipment for
meat tenderization is described in the following paragraphs.
The very first rudimentary systems of the use of shock waves or HDP as a
method for food structure modification or “food tenderizer” were conceived
early in the 1950s (Simjian, 1957) (Figure 8.2). The use of HDP as an alterna-
tive method for “food tenderization” has been investigated since the 1970s
(Godfrey, 1970), although the first semi-industrial shock wave units were not
developed until the 1990s in the United States and those were based on the
detonation of explosives (Long, 1993, 1994; Solomon et al., 1997; Figure 8.2). It
was not until then that the development of the so-called “Hydrodyne Process”
and related equipment allowed an extensive and thorough investigation,
mostly conducted by Professor Morse Solomon from the Food Technology
and Safety Laboratory (Beltsville, MD) and partners (Figure 8.2). Those works
provided clear evidence of muscle tenderization under different conditions
and shed valuable information for future experiments and equipment design
(Solomon et al., 2006). However, the use of explosives in the food industry
raised different safety concerns for operators and the potential contamination
of the meat itself with chemical residues from the explosion, and therefore, its
transfer to the industry was never accomplished.

1950–1970 1993–1994 2000 2008–2011 2012–2014

Vibrations and Hydrodyne Underwater Underwater electrical Underwater

rudimentary process. electrical discharge with wire electrical discharge.
detonation of Use of explosives. discharge. mediated explosion. Continuous pilot
explosives systems. Tender Class System. Batch-pilot equipment. equipment.

HE

FIGURE 8.2
Historical perspective of shock wave technology for meat tenderization.
264 Advanced Technologies for Meat Processing, Second Edition

During the last decade, the second generation of HDP equipment based
on electrical discharges underwater rather than the detonation of explo-
sives was conceived (Long, 2000) (Figures 8.1 and 8.2). The use of electri-
cal discharges underwater avoids the problems associated with the use of
explosives and allows a continuous treatment process as there is no longer
the need for loading/unloading of explosives between shock waves. These
systems are favorable as they make the application more feasible in terms of
automation and reduction in processing time, and they facilitate the modula-
tion of the shock wave intensity by delivery of gradual electrical intensities
and number of pulses per treatment. This shock wave technology generated
by electrical discharges underwater led to an attempt at a commercial HDP
system intended for meat tenderization, the Tender Class System (TCS), by
the American company Hydrodyne Incorporated. The TenderClass (TDC) is
shown in Figure 8.3. The TDC system has not been fully applied in the meat
industry to the best of our knowledge.

FIGURE 8.3
Photo of the Tender Class System (TCS) unit from Hydrodyne Inc. (Courtesy of Bill McKenna,
Hydrodyne Inc. CEO and Professor Jim Claus, University of Wisconsin-Madison).
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 265

Finally, the construction firstly of a pilot-batch prototype, and then a con-

tinuous semi-industrial-scale shock wave prototype for the continuous treat-
ment of meat was undertaken at the German Institute of Food Technologies
(DIL) (Figures 8.2, 8.4, and 8.5). During the period from 2008 to 2011 and
within a German-funded research project, a pilot-batch prototype for the
generation of shock waves intended for meat tenderization by electro-deto-
native and electrohydraulic underwater discharges was designed and built
at the DIL (Heinz et al., 2011). The pilot-batch prototype relied on underwa-
ter discharges of electric energy between two electrodes mediated by metal
wires (aluminum and copper). A prototype was developed with an average
power output of 2 kV and a peak power of 40 kV with a vessel volume of 50 L
(Figure 8.4). An effective energy conversion from electrical to mechanical
energy was achieved and demonstrated to be effective to tenderize meat.
This pilot-batch unit was successfully used to decrease the maturation time
of beef cuts from 14 to 7 days (Toepfl and Heinz, 2009).
At a later stage, the development of an upgraded industrial prototype for
a continuous shock wave treatment of meat was accomplished within the
European-funded project, Shockmeat (http://www.shockmeat.eu/) (Toepfl
et al., 2013). A drawing scheme of the main parts of the prototype is shown
in Figures 8.5 and 8.6. The shock wave prototype has a conveyor belt for the
transport of the meat to the treatment area where an electrically generated

FIGURE 8.4
Shock wave prototype intended for meat tenderization developed within a German-funded
research project, AiF-15884 N (2008–2011).
266 Advanced Technologies for Meat Processing, Second Edition

Meat input

Pulse generator

High voltage switch

Capacitors

Meat output

Conveyor belt
Treatment area
Safety door
y
x Water basin
z

FIGURE 8.5
Main parts of the shock wave prototype intended for meat tenderization developed within
the European-funded research project, ShockMeat (2012–2013). (Reprinted from Meat
Science, 95, Bolumar et al., New developments in shockwave technology intended for meat
tenderization: Opportunities and challenges, 931–939. Copyright 2013, with permission
from Elsevier.)

FIGURE 8.6
Photo of the shock wave prototype intended for meat tenderization developed within the
European-funded research project, ShockMeat (2012–2013).
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 267

shock wave is applied to the meat. Energy storage by the capacitors, cur-
rent, and voltage applied determine the shock wave intensity and this is
controlled by an automatic programmable interface. The number of pulses
applied in the treatment can be set up taking into account the belt speed and
the number of pulses applied per traveled distance. These parameters allow
for an adjustable and targeted treatment of shock wave intensity and num-
ber of pulses. This shock wave prototype showed promising effects on meat
tenderization (10%–25% reduction of Warner–Bratzler shear force [WBSF] in
different muscles of beef and pork). However, during the project execution,
it was also pointed out that in order to benefit from the application of the
HPD technology in an industrial environment some improvements were
required. These included the development of a stronger and highly resis-
tant packaging material, better interaction between the dynamic forces of
the shock wave and the packaging, and a further characterization of the pro-
cessing settings required for a particular meat (i.e., specific meat primal cut
and type of animal) (Bolumar et al., 2013).
Recently, the use of high-efficiency compact sparkers, based on the
sparker source system by Schaefer (1998), was demonstrated on a labora-
tory scale, with favorable changes in tenderness (10%–57% reduction of the
shear force) of steaks (2.5 cm thick) and intact beef loins (Bowker et al., 2011)
being achieved. Sparkers are electrically driven acoustic sources that pro-
duce high-pressure shock waves, similar to explosives. This system is essen-
tially equivalent to the electrohydraulic system described (Figure 8.5) but on
a miniaturized scale. While this technique did not damage the packaging
during HDP (major drawback of the larger unit, Figure 8.5), the scale-up to
industrial standard for this miniaturized HDP unit would be very difficult
given the small treatment area and the long processing times required, and
as such, it is a laboratory-scale technology at this time.

8.3 HDP for Improving Meat Quality

8.3.1 HDP for Meat Tenderization
Meat tenderness (toughness or resistance to cut) has long been recognized
as the most important eating quality trait of fresh meats (Mennecke et al.,
2007; Grunert et al., 2004). Basically, meat tenderness depends on three
main components: (1) degree of contraction of the muscle sarcomere (sar-
comere length), (2) extent of integrity/degradation of structural myofibril-
lar proteins (proteolysis), and (3) connective tissue content/composition
(“background toughness”) (Koohmaraie et al., 2002; Sentandreu et al., 2002).
Accordingly, different intrinsic tenderness can be listed. These include the
extent to which muscle is contracted when it sets into rigor mortis, the extent
268 Advanced Technologies for Meat Processing, Second Edition

to which certain proteins are broken down postmortem through the action
of proteolytic enzymes such as calpains and cathepsins, the ultimate pH, the
amount of connective tissue and the extent of cross-linking between peptide
chains within collagen molecules, and concentration of intramuscular fat
(marbling) in muscle (Purchas, 2004). These determinants are dependent on
particular phenotypes and environmental effects (Koohmaraie et al., 2002;
Anderson et al., 2012). The relative contribution of each determinant to the
ultimate tenderness varies with genetic-related factors such as muscle type
and breed, production factors such as grain/pasture feeding and age, pre-
slaughter factors such as glycolytic potential, handling, temperament, and
stress, and early postmortem events such as pH and temperature of the car-
cass’ muscles, as well as the duration and temperature at which the product
is stored postmortem. Being such a complex quality trait, it is not surprising
that tenderness is one of the most difficult meat quality traits to assure for
the industry. But consumers are willing to pay more for guaranteed tender
meat (Miller et al., 2001).
To improve meat tenderness, different interventions aiming to minimize
muscle fiber shortening at the rigor onset and to increase the degree of prote-
olysis (aging) can be employed. Unfortunately, it is not an easy task to imple-
ment them in practice due to the high differences in cattle phenotype which
impact on metabolic rates and muscle structure together with unpredictable
environmental circumstances, such as weather conditions and animal stress,
all impacting meat quality and the further ability for the meat to mature. In
addition, aging meat involves processing costs in terms of time, room, and
energy (14–21 days in cold storage) and certain cuts do not tenderize well.
Alternatively, the “background toughness” associated with collagen could
be reduced to improve tenderness. However, there are currently very few
treatments that enable the contribution of connective tissue to tenderness to
be manipulated (Purslow, 2005, 2014). Cooking method and consumer expec-
tations also influence meat tenderness and its perception and therefore must
be considered.
Within the industrial practices of meat processing, tenderization interven-
tions can be classified as biological, chemical, and mechanical.
Biological interventions for meat tenderization are those that rely on muscle
biochemistry, and thus, attempt to modulate the molecular events governing
the conversion of muscle to meat. Such interventions impose certain condi-
tions that affect the temperature and pH of the carcass muscles, the condi-
tions at the onset of rigor mortis, and further reactions such as proteolysis by
endogenous enzymes. The temperature at which the carcass reaches rigor
and the actuation of endogenous proteolytic enzymes (ratio enzyme activity
and their inhibitors) are key determinants for the level of sarcomere short-
ening and the progression of meat aging, respectively, both having a major
impact on meat tenderness. Biological interventions include methods such
as optimization of carcass chilling, use of electrical stimulation, prerigor
muscle stretching, and traditional aging. Further, detailed information on
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 269

this area can be obtained by consulting the following references: Troy (1999),
Thompson (2002), Thompson et al. (2006), Bowker et al. (2010a), and Bolumar
et al. (2013).
Chemical interventions for meat tenderization include the addition of chemi-
cal compounds that have different effects on muscle structure as well as of
exogenous enzymes that contribute to the proteolysis of muscle proteins.
Chemical compounds such as salts, organic acids, and phosphates exert
positive effects on meat tenderness when incorporated into meats. Hence,
the incorporation of brines with these compounds through immersion, injec-
tion, and marination is a well-established method to tenderize meat (Berge
et al., 2001). However, there is usually a significant price reduction in com-
parison to its counterpart, “fresh steaks.” The addition of enzymes is another
possibility to increase tenderness but the inactivation of the enzyme is prob-
lematic as it can render an over-tenderized meat with the development of
off-flavors (Sullivan and Calkins, 2010).
Mechanical interventions for meat tenderization disrupt muscle structure with
mechanical forces. The simplest mechanical tenderization method is chop-
ping or mincing of meat. However, this is accompanied with a significant
reduction in price. Another possibility is to use blade or needle tenderiza-
tion of cuts. This tenderization method is used for improving tenderness
of low-value tough meat cuts. This affects the appearance of the steaks, and
can result in potential microbial cross-contamination and color changes
in the penetration area. “High pressure processing” has also been investi-
gated as a method for tenderness improvement. The effect of HPP is due to
the disruptive nature induced by pressure that causes a dissociation of the
myofibrillar proteins (Sun and Holley, 2010). Depending on the pressure, the
application of HPP to prerigor meat inhibits the metabolism and the conver-
sion of muscle to meat resulting in higher pH and higher tenderness score
(Souza et al., 2011). With postrigor meat, the tenderizing effect of HPP is only
observed if pressure is combined with heat (~60°C) (Sikes et al., 2010; Sikes
and Tume, 2014), thought to result from the release of cathepsins from dis-
rupted lysosomes.
HDP is another postmortem mechanical intervention for meat tender-
ization. In general, tenderness improvement ranging from 10% to 70% in
different species such as beef, pork, lamb, turkey, and chicken has been doc-
umented after application of HDP treatment. Table 8.1 provides an extensive
summary of the effects of HDP or shock wave treatment on meat tenderness
using different prototypes, treatment intensities, animal species, and muscles
during the last 20 years. Red meats, especially beef, have the biggest prob-
lems with tenderness. The HDP treatment can be used to reduce tenderness
variation within the same muscle as observed along the length of beef strip
loins (Spanier et al., 2000), and therefore, HDP can be used to ensure consis-
tency in tenderness. The variation in tenderness improvements with regard
to HDP treatment is due to a myriad of factors such as the initial tenderness
of the meat, treatment of fresh or frozen/thawed meat, postmortem time of
TABLE 8.1
270

Effect of Hydrodynamic Pressure Processing (HDP) on Meat Tenderness

Tenderness
Species Primal Cut Process Conditions Improvement (%)a Reference
Beef Longissimus Explosives (50, 75, and 100 g), container (208 L), diameter (51 68 Solomon et al. (1997)
Semimembranous cm), steel plate (2 cm thick), distance (30.5 cm), 60–70 MPa 59
Biceps femoris 52
Semitendinosus 55
Longissimus Explosives (100 g), same conditions as experiment above 37 Zuckerman and Solomon (1998)
(Solomon et al., 1997)
Strip loin Explosives (100 g), same conditions as experiment above 21–40 Spanier et al. (2000)
(Solomon et al., 1997)
Strip loin Explosives (100 g), same conditions as experiment above 47 Spanier and Romanowski (2000)
(Solomon et al., 1997)
Top rounds Electrical discharge. Energy setting (3–2), pulses (1–2) 20–28 Claus (2002)
Biceps femoris Explosives (105, 200, and 305 g), distance (26.7 cm), pressure 10–24 Schilling et al. (2002)
(83, 104, and 124 MPa)
Rib eye Explosives (100 g), distance (31 cm) 29 Solomon et al. (2008)
Strip loin Explosives (100 g), distance (31 cm) 23 Bowker et al. (2008b)
Loin Electrical discharge. Use of a high-efficiency sparker. Distance 20–30 Bowker et al. (2011)
(3.75–7.5 cm), pulses (5, 10, 40, 80), pressure (6–7 MPa)
Silverside Electrical discharge. Semi-industrial batch prototype 25 Bolumar et al. (2013)
Loin (Longissimus manufactured at the German Institute of Food Technologies. 18
lumborum) Cylindrical steel vessel (1 m of diameter), distance (20 cm),
pulses (5, for the silverside, and 1, for the loin)
Loin (L. lumborum) Electrical discharge. Semi-industrial batch prototype 18 Bolumar et al. (2014)
manufactured at the German Institute of Food Technologies.
Cylindrical steel vessel (1 m of diameter), distance (20 cm),
pulses (5, for the silverside, and 1, for the loin)
Advanced Technologies for Meat Processing, Second Edition

(Continued)
TABLE 8.1 (Continued)
Effect of Hydrodynamic Pressure Processing (HDP) on Meat Tenderness
Tenderness
Species Primal Cut Process Conditions Improvement (%)a Reference
Pork Loin Explosives (150 g), distance (36.0 cm), pressure (68.9 MPa) 17 Moeller et al. (1999)
Loin Electrical discharge. Tender Class System. Energy setting (2) 29 Claus (2002)
and pulses (2)
Topside Electrical discharge. Cylindrical steel vessel (1 m of diameter), -1 Bolumar et al. (2013)
distance (20 cm), pulses (2, for the topside, and 2, for the
silverside)
Silverside 5
Lamb Longissimus Explosives (100 g), same conditions as experiment above 33–67 Solomon et al. (1998)
Semitendinosus (Solomon et al., 1997) no response
Turkey Breast Explosives (100 g), container (98 L), diameter (40 cm), steel 13 Bowker et al. (2010a)
plate (1.3 cm thick), distance (31.0 cm)
Breast Electrical discharge. Hydrodyne pilot plant. Energy setting 12 Claus et al. (2001a)
(72%), pulses (2)
Chicken Breast Explosives (200 g at 20 cm, 350 g at 23 cm, 275 g at 20 cm, and 19–28 Meek et al. (2000)
350 at 20 cm)
Breast Explosives (40 g), Hydrodyne research prototype, stainless steel 42 Claus et al. (2001b)
cylinder (20.3 × 48 cm)
Breast Electrical discharge. Hydrodyne pilot plant. Energy setting 22 Claus et al. (2001a)
(45%), pulses (2)
aReduction of Warner–Bratzler shear force (WBSF) by HDP or shock wave treatment compared to control untreated.
HDP, hydrodynamic pressure processing.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety
271
272 Advanced Technologies for Meat Processing, Second Edition

application (pre- or postrigor), storage duration, and specific conditions of

HDP treatment (e.g., configuration of the shock wave container, quantity,
placement and shape of the explosives, and position and distance from the
point of explosion/sparking) (Claus et al., 2001a,b; Solomon et al., 2004, 2006,
2008, 2011). Generally, the tougher the meat the easier to gain a reduction
in cutting force. Also, there are different effects if the meat is treated fresh
or frozen. Treatment of fresh meat with HDP treatment gave better results
than did frozen meat (Solomon et al., 1997). Furthermore, it was reported
that if fresh and frozen meats were treated by HDP, freezing accounted
for a 14% reduction of WBSF whereas treatment of fresh meat followed by
freezing resulted in a 30% reduction of WBSF (Solomon et al., 2008). Most of
the data regarding tenderness improvements in meat have been conducted
using different systems/units based on explosives though some experiments
have also been conducted using electrical discharges underwater. HDP sys-
tems based on electrical discharges, such as the TDC, have been reported
to improve tenderness in beef loin and turkey and chicken breasts (Table
8.1). More recently, HDP treatment using a batch-pilot prototype based on
electrical discharge underwater manufactured at the DIL was tested on beef
silverside. The silverside was treated as an intact primal cut whereas, for the
loin, the HDP treatment was applied on steaks 26 mm thick. The WBSF was
measured at seven days of storage (simulating commercial life span of the
meat from the processor to the supermarket and consumer); an 18% and 25%
WBSF reduction was reported, respectively (Bolumar et al., 2013). The same
semi-industrial batch prototype was used on steaks of beef loin (Longissimus
lumbarum) of 26 mm thickness. The WBSF was reduced by 18% in this case
(Bolumar et al., 2014).
As well as beef, other species have been subjected to HDP treatments. In
pork, despite the effect of HDP treatment on WBSF (17% WBSF reduction),
no effect was detected by sensory analysis. Color, drip loss, and microbial
counts were not affected in this study (Moeller et al., 1999). Claus (2002) and
Bolumar et al. (2013) reported either improved tenderness or minor or no
effect, respectively, after HDP treatment of pork meat (Table 8.1). Generally,
pork is usually tender per se and as such it is more difficult to make it more
tender. Lamb has also been the object of study (Table 8.1). Especially the
Callipyge lamb, which has tougher meat than normal lambs, has been sub-
jected to HDP treatment. A 33%–67% reduction in WBSF for the loin and no
response for the eye of round was reported for callipyge lamb meat (Solomon
et al., 1998). Turkey breast has been reported to show improved tenderness
following HDP treatment (13% and 12% reduction of WBSF) (Bowker et al.,
2010a; Claus et al., 2001a). However, cooking loss was higher in HDP-treated
turkey breast though HDP facilitated early deboning and provided tender-
ness-enhanced fillets (Claus et al., 2001a). Chicken breast has also been eval-
uated. HDP treatment reduced WBSF by 20%–40% in different studies (Meek
et al., 2000; Claus et al., 2001a,b). Regarding the time of postmortem applica-
tion, a greater effect was observed if HDP treatment was applied postrigor
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 273

rather than prerigor. In this sense, HDP treatment of chicken breasts, when
applied at 77 minutes postmortem, did not tenderize the meat as did when
treatment was applied at 24 hours postmortem (Claus et al., 2001b). In these
studies, cooking loss and color were not affected (Claus et al., 2001a,b). The
postrigor application is consistent with the disruption of the meat structure
as prerigor meat is more flexible and somehow malleable.
During the European-funded project “ShockMeat,” a comparison of
HDP, or shock wave technology, with other tenderization methods such as
low-temperature long-time treatment (LTLT) and brine injection was car-
ried out. The meat treated with the different tenderization methods was
instrumentally and sensory analyzed. The tenderness scores assessed
by sensory analysis are shown in Figure 8.7. The HDP effect was evalu-
ated in relation to eating quality and improved tenderness. The overall
variation between the four treatments could be ascribed to differences
in textural properties that clearly differentiated LTLT treatment (63°C for
15 hours) from the other tenderizing technologies (p < .001) (tenderness
score of 8.3, Figure 8.7). The blade injection with brine to 10% (w/w) and
to a final concentration of salt in the product of 0.6% also resulted in a
significant improvement in the sensorial tenderness (tenderness score of
7.0, Figure 8.7). The shock wave treatment resulted in a tenderness score
of 5.6, 0.6 units higher than the control untreated. Even though this dif-
ference obtained using the HDP method seems minimal there is room
for more improvements by the efficient interaction between the HDP and
the meat and the power of the shock wave in different ways. The use of
LTLT treatment is an effective method to produce tender and juicy meat,

15
14
13
Sensory tenderness score (1–15)

12
11
10
9 8.3
8 7.0
7
6 5.6
5.0
5
4
3
2
1
0
LTLT Multistik SW REF
Tenderization treatment

FIGURE 8.7
Sensory tenderness score of beef eye of round after application of different tenderization
interventions. LTLT, low-temperature long-time treatment (63°C for 15 hours); Multistik, blade
injection of brine (10% w/w, 0.6% salt); SW, shock wave (1 shot, 40 kV); and REF, reference
or control (no treatment). Work performed during the European-funded research project,
ShockMeat (2012–2013).
274 Advanced Technologies for Meat Processing, Second Edition

but in this treatment the meat is cooked, and so the meat cannot be con-
sidered “fresh meat” and there would be an associated price reduction.
LTLT could be a good technology for ready-to-eat dishes containing meat.
In addition, LTLT processing takes 15–20 hours whereas the shock wave
treatment is done in seconds. The brine injection is a good method for ten-
derizing meats and is being widely used in some countries, for instance,
for the tenderization of chicken breast with a concomitant enhancement
in juiciness. The main problem with the blade injection of whole muscles
is the possibility of microbial cross-contamination of the center of the cut,
and consequently, the possibility of growth of spoilage and pathogenic
bacteria impairing shelf life and in the worst scenario leading to food poi-
soning. Again the injected meat product could not be considered “fresh
meat” and this always brings a significant price reduction of the meat cut.
In contrast, HDP does not affect the visual appearance of the meat, and
therefore, can be commercialized as “fresh meat” allowing meat proces-
sors to obtain the highest prices of the market.

8.3.2 HDP for Modification of Meat Functionality

HDP can change meat structure thereby impacting the functionality of the
system. HDP, applied as pressure pulses, can result in pressure-induced struc-
tural modifications. These structural modifications are based on the effect of
high pressure on cell membranes and the biopolymers present in the system
such as proteins. In meat, muscle proteins could be modified whereby the
functionality of the proteins is impacted. These modifications could lead to
diverse food applications such as the creation of novel textures and improve-
ment of water binding. The modification of food structure using HPP has
been recently reviewed (Bolumar et al., 2016). As explained in Section 8.2,
HDP is a dynamic application of pressure in comparison to a static applica-
tion in HPP. Nevertheless, similar effects could be expected though the effect
of HDP in the modification of the functionality has been scarcely investi-
gated. The structural changes in foods caused by HPP have been investi-
gated mostly during the last decade (Bolumar et al., 2016). Several examples
are described using HPP for structural modification, for instance, an HPP
treatment of meat batters that allows a salt reduction in meat products since
HP-induced changes can result in meat batters requiring less salt to create a
stable physical structure. HP treatment affects the disruption of noncovalent
interactions (hydrophobic and electrostatic) followed by a rearrangement of
intra- and intermolecular interactions at the interfaces of proteins leading to
different degrees of denaturation, disassociation, aggregation, and gelation.
HP induces unfolding of proteins and can modify the quaternary and ter-
tiary structure of proteins, whereby protein functionality could be affected.
In the literature, few papers deal with the mechanisms involved in the func-
tionality changes occurring in meat and the majority of them use high pres-
sure (HPP). Regarding water-binding capacity, both improvements and no
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 275

changes have been reported. This suggests that there is much more work
to be done to document how HDP or shock wave might be used to improve
the yield of processed meats. There seem to be some unraveled interactions
between meat, the formulation, and processing that still needs to be sorted.
Chan et al. (2011) showed that pressures of 50–100 MPa increased the water-
binding capacity of low pH meat (pale, soft, and exudative [PSE] like) and
the pressure treatment gave a better gel network formation. Furthermore,
they showed that protein solubility was increased in both low and normal
pH meat. The authors suggested that HPP (50–100 MPa) could be used as an
alternative technology to reduce salt and improve water retention in meat
products. Flynn et al. (2014) found that HPP (150 MPa) increased emulsion
stability and reduced cooking loss when salt was reduced in breakfast sau-
sages. At 1.5% NaCl, the cooking loss was reduced from 17.6% (0 MPa) to
16.2% (150 MPa). HP-induced benefits on the structure of meat products are
due to additional swelling and solubilization of muscle myofibrillar proteins.
The modification of protein structure, and so functionality, using HDP has
been very scarcely investigated. Increased water retention using HDP treat-
ment has been described in some cases. The U.S. patent 7,485,331 states that
the Hydrodyne System improved water binding of sirloin during marination
(Long, 2009). The uptake of water during marinating of Hydrodyne-treated
sirloin increased from 10% to 14%. In another study, HDP treatment enhanced
brine absorption, increased processing yield, and improved texture of mari-
nated turkey breasts without impacting color (L*, a*, and b*) and expressible
moisture (Bowker et al., 2010a). Therefore, HDP treatment could be used as
a pretreatment prior to marination or injection to increase yield. Marinated
samples (15% and 30% brine levels) had lower (p < .001) WBSF values and
lower (p < .05) hardness, cohesiveness, and chewiness values compared with
nonmarinated samples (Bowker et al., 2010a). In another study, Bowker et al.
(2010b) reported on the influence of HDP and aging on the processing charac-
teristics and final meat quality of moisture-enhanced pork loins. WBSF and
expressible moisture decreased (p < .0001) with aging from 1 to 8 days, but
were not significantly affected by HDP treatment. Again, HDP-treated loins
had greater (p < .05) brine retention after overnight equilibration and thus
a higher (p < .05) processing yield than controls. In addition, HDP samples
had lower drip loss values than controls. HDP treatment demonstrated the
potential to improve the texture and WHC of moisture-enhanced pork loins
with minimal impact on the visual appearance of the final product (Bowker
et al., 2010b). In contrast, Schillinger et al. (2002) treated beef biceps femoris
with hydrodynamic shock waves before producing frankfurters (cooked
to internal temperature of 71°C). They found that the HDP treatment did
not affect the myofibrillar or sarcoplasmic protein solubility, cooking yield,
color, textural properties, or gel strength. In this study, it was concluded that
beef trims obtained from HDP-treated meat could be used interchangeably
with normal beef trims in the production of frankfurters. Therefore, the use
of HDP treatment did not provide any advantage in comparison with no
276 Advanced Technologies for Meat Processing, Second Edition

pretreatment of the raw meat. It is noteworthy to consider that frankfurters

are made out of minced meat of very small particle size, in contrast to mari-
nation of whole muscles, which favors protein accessibility, interactions, and
functionality. However, only a few studies have been done in this area so far,
and thus, more research is needed to better understand the potential of HDP
treatment for modification of protein functionality. HDP could be a techno-
logical processing aid in the production of meat products, whole muscles,
or meat emulsions with reduced salt and phosphate content and enhanced
yields and texture.

8.3.3 Molecular and Structural Effects of HDP in Meat

The tenderization effect of HDP has been ascribed to two main mechanisms:
(1) physical disruption of muscle structures and (2) enhanced proteolysis
of structural muscle proteins. Both effects have been reported by the use
of HDP or shock wave (Bolumar et al., 2013). A shock wave travels rapidly
through the water and any object which is an acoustical match with water.
At points where acoustic impedances differ stress is created, which in turn
tears muscle structure. This produces what could be called a “rupture effect”
and as a consequence, meat tenderization is favored. Furthermore, the high
pressure–momentum reached during HDP treatment could increase cathep-
sin activity due to their release from lysosomes analogously as has been
described after HPP (Ohmori et al., 1992; Homma et al., 1994; Grossi et al.,
2012). Muscle cathepsin and peptidase (amino- and dipeptidyl-) activities
from control and shock wave-treated beef were not different (Bolumar et al.,
2014). This fact can confirm that enzyme activity per se is not enhanced but it
cannot dismiss the possibility that shock wave facilitates the contact between
the structural muscle proteins and the endogenous proteolytic enzymes,
which could potentially lead to an accelerated maturation. In the same study,
Bolumar et al. (2014) analyzed the protein pattern of sarcoplasmic and myo-
fibrillar proteins at one and seven days of chilling storage by using sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). No differ-
ences in the protein bands between control and HDP-treated meat for sar-
coplasmic and myofibrillar proteins at day 1 or at day 7 could be observed
(Figure 8.8). In agreement with our results, other authors did not observe
major changes in sarcoplasmic and myofibrillar protein patterns visualized
by SDS-PAGE analysis (Bowker et al., 2008a,b). Bowker et al. (2008b) reported
some minor changes in sarcoplasmic proteins bands corresponding to 143,
65, 44, 36, and 19 kDa. In this study, changes in sarcoplasmic protein compo-
sition were significantly correlated to WBSF (r = −0.58 to 0.45). Sarcoplasmic
protein solubility decreased with both HDP (p < .05) and aging (p < .0001).
Changes in solubility were significantly correlated to SDS-PAGE band inten-
sities (r = −0.53 to 0.60). Data suggested that HDP and aging cause changes to
sarcoplasmic proteins, which may be an indicator of proteolysis and tender-
ization. In another study, Bowker et al. (2008a) reported that HDP treatment
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 277

C SW St St C SW St C SW St C SW
200.0
116.3
97.4
66.2

45.0

31.0

21.5

14.4

6.5

(a) (b) (c) (d)

FIGURE 8.8
SDS-PAGE analysis of sarcoplasmic and myofibrillar proteins from control and shock wave-
treated beef Longissimus thoracis steaks at day 1 and 7 of storage under refrigerated condi-
tions. (a) Sarcoplasmic proteins at day 1, (b) sarcoplasmic proteins at day 7, (c) myofibrillar
proteins at day 1, and (d) myofibrillar proteins at day 7. Lane C, control sample; lane SW, shock
wave-treated sample; lane St, standard proteins (kDa); SDS-PAGE, sodium dodecyl sulfate-
polyacrylamide gel electrophoresis. (Reprinted from Meat Science, 98, Bolumar et al., Effect of
electrohydraulic shockwave treatment on tenderness, muscle cathepsin and peptidase activi-
ties and microstructure of beef loin steaks from Holstein young bulls, 759–765. Copyright 2014,
with permission from Elsevier.)

influenced troponin T (TnT) degradation as confirmed by using a more sen-

sitive technique than the SDS-PAGE such as Western Blot. They reported that
shock wave in combination with aging decreased the intensity of the TnT
band and enhanced the accumulation of the 30-kD fragment which arose
from the TnT degradation, suggesting that HDP tenderization was caused by
both physical disruption of the myofibril apparatus and enhanced postmor-
tem proteolysis (Bowker et al., 2008a). Shock wave and aging decreased the
intensity of the TnT band and enhanced the accumulation of the 30-kD TnT
degradation product (Bowker et al., 2008b). An accelerated maturation after
HDP treatment, enabling a shorter maturation time for the industry, has been
described in the literature (Heinz et al., 2011). During aging, the percentage
of proteins in the soluble fraction was increased with HDP treatment while
the insoluble myofibrillar proteins were reduced. Similar results were seen
when the myofibrillar fragmentation index was correlated to tenderness dur-
ing aging (Spanier and Romanowski, 2000). More recently, changes in the
sarcoplasmic protein fraction of beef muscle with aging (0, 5, and 8 days)
and HDP treatment were evaluated using capillary electrophoresis (CE)
278 Advanced Technologies for Meat Processing, Second Edition

and reversed-phase high-performance liquid chromatography (RP-HPLC).

Aging and HDP interactions were not detected using either separation tech-
nique. With CE analysis, no HDP effects were observed; however, the rela-
tive peak area of eight protein peaks ranging in size from 17 to >200 kDa
were influenced by postmortem aging. Separation of proteins with RP-HPLC
demonstrated that HDP influenced the relative size of two protein peaks
while postmortem aging effects were observed in six peaks. Alterations in
the sarcoplasmic protein fractions detected by both CE and RP-HPLC were
correlated to WBSF measurements. Overall, the data demonstrate that HDP
has minimal effects on sarcoplasmic proteins and that aging-related changes
in the water-soluble protein fractions of muscle may be useful as indirect
indicators of beef tenderness (Bowker et al., 2012).
Microscopic examinations using transmission electron microscopy (TEM)
of HDP meat displayed myofibrillar fragmentations in the region adjacent to
the z-lines as well as z-line fragments attached to the A-band on both sides
of the fractures (Zuckerman and Solomon, 1998; Figure 8.9). Also, increased
intra-myofibrillar spaces with longitudinal gaps or splits in the myofibril
lattice were observed (Zuckerman and Solomon, 1998). Jagged edges at the
z-line and the thin filaments in HDP-treated meat have also been described
by Claus (2002) (Figure 8.9). These scientists suggested that physical tearing
rather than proteolysis was behind the tenderization.
Recently, Bolumar et al. (2014) conducted microscopic analysis on HDP-
treated meat by using confocal laser scanning microscopy (CLSM), and
showed very clearly that HDP causes considerable disruptions of muscle fibers
and tissue (Figure 8.10a through c, control vs. d through f, shock wave treated).
By using scanning electron microscopy (SEM), a larger endomysium
space, the space between muscle fibers, could also clearly be observed in
the HDP meat, especially at day 7 (Figure 8.11, white arrow). Furthermore,
the appearance of additional “white networks” (Figure 8.11, within a circle)

Jagged
edges

Myofibril
seperation
Physical
from z-lines
tearing

(a) (b)

FIGURE 8.9
TEM of shock wave-treated (a) beef and (b) chicken. (a) Early deboned Holstein beef after shock
wave processing with TCS (separations at z-line) and (b) early deboned chicken after shock
wave processing with explosives (physical tearing). TEM, transmission electron microscopy.
(Photo courtesy of Professor Jim Claus, University of Wisconsin-Madison.)
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 279

(a) (b) (c)

(d) (e) (f)

FIGURE 8.10
CLSM images from control and shock wave-treated beef longissimus thoracis steaks at days 1
and 7 of storage under refrigerated conditions. (a) Control at day 1, (b) control at day 7, (c) con-
trol at day 7, (d) shock wave-treated at day 1, (e) shock wave-treated at day 7, and (f) shock wave-
treated at day 7. CLSM, confocal laser scanning microscopy. (Reprinted from Meat Science, 98,
Bolumar et al., Effect of electrohydraulic shockwave treatment on tenderness, muscle cathep-
sin and peptidase activities and microstructure of beef loin steaks from Holstein young bulls,
759–765. Copyright 2014, with permission from Elsevier.)

was observed in HDP or shock wave-treated samples (Figure 8.11, compar-

ing images a through c [control] to images d through f [shock wave treated]).
This observation may be related to the release of intracellular contents or
most likely an alteration of the endomysium collagen fibril network. A wider
endomysium space might be presumably due to a displacement within the
muscle fibers at the collagen level. This is in agreement with Zuckerman et al.
(2013) who, using SEM, reported that HDP treatment disrupted the integrity
of the collagen fibril network of the endomysium in both nonaged and aged
samples and that WBSF and connective tissue changes were greater in HDP
samples in comparison to the control.
Zuckerman et al. (2013) examined the effect of HDP treatment on intra-
muscular connective tissue. In general, HDP did not cause extensive tear-
ing or perforation of the endomysial connective tissue sheaths surrounding
individual muscle fibers. Deformations to the honeycomb structure of the
endomysium, however, were observed in the shock wave-treated samples
(Figure 8.12). A higher incidence of aggregated fragments of collagen fibrils
280 Advanced Technologies for Meat Processing, Second Edition

×500 50 μm DIL ×250 100 μm DIL ×500 50 μm DIL

(a) (b) (c)

×500 50 μm DIL ×250 100 μm DIL ×500 50 μm DIL

(d) (e) (f )

FIGURE 8.11
SEM images from control and shock wave-treated beef Longissimus thoracis steaks at day 1 and
7 of storage under refrigerated conditions. (a) Control at day 1, (b) control at day 7, (c) control
at day 7, (d) shock wave-treated at day 1, (e) shock wave-treated at day 7, and (f) shock wave-
treated at day 7. Arrows point out the separation between muscle fibers (endomysium space),
circles point out additional “white networks.” SEM, scanning electron microscopy. (Reprinted
from Meat Science, 98, Bolumar et al., Effect of electrohydraulic shockwave treatment on ten-
derness, muscle cathepsin and peptidase activities and microstructure of beef loin steaks from
Holstein young bulls, 759–765. Copyright 2014, with permission from Elsevier.)

on the surface of the endomysial sheaths was observed in the shock wave-
treated samples (Figure 8.12). They suggested that these aggregates on the
endomysium are likely parts of collagen fibrils separated from the connec-
tive tissue matrix, due to physical weakening of the collagen network. Based
on the underlying assumption that physical disruptions to the microstruc-
ture of intramuscular connective tissue improve meat tenderness, these data
suggested that shock wave or HDP meat tenderization is caused at least par-
tially by alterations to connective tissue in addition to their known impact on
the myofibrillar component of muscle (Zuckerman et al., 2013).
Overall, HDP or shock wave treatment has been shown to induce disrup-
tive effects on the z-line, the muscle microstructure, and the connective tis-
sue (Zuckerman and Solomon, 1998; Bolumar et al., 2014; Zuckerman et al.,
2013). In addition, an enhanced maturation (i.e., a further reduction of WBSF
at the same time of maturation) has been observed (Heinz et al., 2011) and
evidenced by a faster degradation of the TnT protein and accumulation of
the 30-kD protein band (Bowker et al., 2008a). Furthermore, the release of
cathepsins from lysosomes by HDP or shock wave treatment has not been
demonstrated so far, but if this were so, it could be a good target for the ben-
efit of the technology in order to enhance proteolysis driven by endogenous
muscle endo-proteases during meat storage.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 281

(a) (b)

(c) (d)

FIGURE 8.12
SEM of intramuscular connective tissue prepared from beef musculus semimembranosus follow-
ing 14 days of aging posttreatment: (a and b) nontreated controls, (c and d) shock wave-treated
samples. Scale bars indicate 50 μm (a, c) and 10 μm (b, d). SEM, scanning electron micrographs.
(Reprinted from Meat Science, 95, Zuckerman et al., Microstructure alterations in beef intra-
muscular connective tissue caused by hydrodynamic pressure processing, 603–607. Copyright
2013, with permission from Elsevier.)

8.4 HDP for Improving Meat Safety

Food safety is a must for meat processors. The meat industry has to deal with
microbial contamination and growth of both spoilage and pathogenic bacte-
ria, which can jeopardize shelf life and cause foodborne illnesses. Thus, the
industry needs to manage the biological risks and demands tools to control
these microbial hazards. Traditionally, the meat industry has used and still
uses chemical substances such as disinfectants and preservatives and heat
treatments to control microbial growth. Yet interventions, such as hot water
(80°C–96°C) carcass treatment to raise carcass surface temperatures, organic
acid (lactic, acetic, and citric) carcass washes of surfaces to reduce the surface
pH, steam pasteurization of carcass in a closed chamber, and steam vacuum,
can be used as interventions to decontaminate fresh meat (Acuff, 2014). But
nowadays, consumers demand nonchemical and mild processing treatments
for superior nutritional preservation. These mild preservation technolo-
gies ideally should aim at energy saving and be environmentally friendly.
Several examples of these mild preservation techniques with good potential
in the meat industry are HPP, controlled instantaneous decompression (DIC),
282 Advanced Technologies for Meat Processing, Second Edition

oscillating magnetic fields (ohmic heating, dielectric heating, and micro-

waves), high-intensity pulsed light, x-rays, and electron beams (Hugas et al.,
2002). Some of these novel mild technologies have found application as a
decontamination and pasteurization method but high costs, legal restrictions,
consumer perceptions, and insufficient adaptation to the industrial environ-
ment have limited a wider use. HDP treatment can also result in biological
inactivation, and as such, can be used as an additional hurdle to microbial
growth. The exact mechanisms for the microbial inactivation of HDP are not
well understood. Two physical effects must be behind the inactivation: (1) cav-
itation and (2) exposure to high-pressure conditions. Cavitation is the rapid
and violent expansion and collision of microscopic cavities that generates
high-energy density particles and microregions of very high temperatures (T)
and pressures (P) which may be responsible for inactivation of bacteria (Patel
et al., 2012). Also exposure to high pressure can lead to microbial inactivation.
Protein denaturation is one of the key mechanisms for microbial inactivation
in HPP and irreversible changes in proteins start at a comparative level to that
required for inactivation of microorganisms (400–600 MPa) (Bolumar et al.,
2015). HDP pressure levels are around 100 MPa though localized higher pres-
sures may occur (Solomon et al., 2006, 2011). Pressures in the range of 100 MPa
might cause sublethal injuries which can lead to death and delay of growth
more than direct lethal damage/inactivation.
Zuckerman et al. (2002) claimed an efficient microbial inactivation (in log
cfu/g) (5–7.5 log reduction) of different microorganisms suspended in a
0.9% NaCl solution by a system based on pulsed high-current underwater
discharges. A US patent also claims a microbial inactivation of 90% of sur-
face bacteria populations in meat (Long, 2001). This level of inactivation will
greatly increase the shelf life of meat, which is of large economical impor-
tance. However, Williams-Campell and Solomon (2002) described a 1.5–2 log
reduction in ground beef after HDP treatment, which increased to 4.5 log
after 14 days of storage. And no differences were found in coliform bacte-
ria and aerobic plate counts of pork loins (Moeller et al., 1999). Overall, HDP
treatment has been investigated as a microbial decontamination technique
although contradictory reports coexist, especially when the application is
used in real meat systems (Solomon et al., 2006). Table 8.2 summarizes the lit-
erature data found in relation to microbial decontamination of meat matrices.
HDP-treated meat products showed a significant reduction in the naturally
occurring spoilage microbiota on stew-sized pieces of beef and pork, ground
beef, and intact beef muscle (Schilling et al., 2003; Williams-Campbell and
Solomon, 2002) though these reductions (in log cfu/g) were low (0.3 and 1–2
log), respectively (Table 8.2). Williams-Campbell and Solomon (2002) inves-
tigated the use of HDP as a technology to reduce spoilage microorganisms
found in fresh beef. HDP reduced bacteria (1–2 log cfu/g) in retail ground
beef and beef roasts (stew-sized pieces of 30–40 g) on day 0 after HDP appli-
cation. In a shelf-life storage experiment, there was an immediate reduction
(1.5 log) following HDP (day 0) and a 4.5-log difference between control
TABLE 8.2
Effect of HDP on Bacteria Inactivation in Meat Matrixes
Inactivation
Bacteria Matrix Treatment Level (log cfu/g) Comments Reference
Aerobic plate Ground beef and beef HDP (100 g binary 1–2 There was an immediate reduction Williams-Campbell
counts roasts (pieces of 30–40 g) explosive), steel shock in the cfu (~1.5 log) and a difference and Solomon
wave container after 14 days of storage (4.5 log) (2002)
Standard plate L. lumborum Explosives (100 g), 0.3 HDP improved tenderness of intact Schilling et al.
count at 35°C container (98 L), steel loins (2003)
plate (1.3 cm thick),
distance (30.5 cm)
Salmonella Minced chicken (100g) Explosives (50 g), 0.1–0.25 Minimal reduction Patel et al. (2006)
Typhimurium container (98 L), steel
plate (1.3 cm thick),
distance (30.5 cm)
Escherichia coli Ground beef (samples of Explosives (100 g), <1 Podolak et al.
O157:H7 60 g) container (54 L), steel (2006)
plate (1.3 cm thick),
distance (30.5 cm)
Listeria Frankfurters Explosives (100 g), 1–2 A synergetic effect combining nisin Patel et al. (2007)
monocytogenes and container (54 L), steel and HDP treatment allowed a 2
aerobic cells plate (1.3 cm thick), log cfu/g reduction in L.
distance (30.5 cm) monocytogenes after 28 days of
storage
L. monocytogenes Beef frankfurters Explosives (100 g), 1–2 HDP was combined with Patel et al. (2009)
and aerobic cells container (54 L), steel antimicrobials such as sodium
plate (1.3 cm thick), diacetate and pediocin
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety

distance (30.5 cm)

E. coli O157:H7 S. Beef cubes (2.54 cm) Explosives (100 g), 0.5–1 Patel et al. (2012)
Typhimurium, and container (54 L),
L. monocytogenes distance (30.5 cm)
283
284 Advanced Technologies for Meat Processing, Second Edition

samples (9 log) and HDP-treated samples (4.5 log) after 14 days of storage.
In this study, the authors concluded that it was possible to reduce spoilage
microorganisms found in ground and stew meat pieces, which could extend
the shelf life of meat products (Williams-Campbell and Solomon, 2002).
The effect of HDP on the survival of Escherichia coli O157:H7 in ground beef
was investigated by Podolak et al. (2006) (Table 8.2). The ground beef was
inoculated with a six strain cocktail of E. coli O157:H7 at three different con-
centrations (103, l04, and l06 cfu/g). The initial concentrations of E. coli were
1.29 × 103, 2.88 × 104, and 2.19 × l06 cfu/g. After HDP treatment, the popula-
tions were reduced (p < .05) to 9.12 × 102, 2.40 × 104, and 1.91 × 106 cfu/g,
respectively. Although the reduction in E. coli populations due to HDP treat-
ment was statistically significant, the practicability of the reduction was
marginal (1 log or even less reduction). Therefore, other hurdle parameters
should be included along with the HDP treatment for more practical inac-
tivation of E. coli in ground beef (Podolak et al., 2006). In this regard, HDP
has also been assayed in combination with antimicrobials. Populations of
Listeria monocytogenes in beef frankfurters were significantly reduced by
HPD when used in conjunction with nisin after 28 days of refrigerated stor-
age (Patel et al., 2007). Patel et al. (2006) reported that HDP treatment was
unable to kill significant amounts of Salmonella in minced chicken (Table 8.2).
In another work, HDP treatment significantly reduced (1 log cfu/g) L. mono-
cytogenes (Patel et al., 2009). The combination of pediocin and HDP process-
ing showed a synergistic effect with a 2-log reduction for L. monocytogenes
in frankfurters compared to control samples (Patel et al., 2009). The penetra-
tion of surface-inoculated bacteria into the meat due to HDP treatment was
reported to be around 200–300 μ in chicken breast and beef steaks (Lorca et
al., 2002, 2003). This penetration into the meat does not carry a safety hazard
to consumers provided it is cooked properly. A heat treatment when cook-
ing the meat will easily destruct the bacteria at this depth below the sur-
face. The effect of HDP on the inactivation of E. coli O157:H7, Salmonella
Typhimurium, and L. monocytogenes attached to beef surface was recently
evaluated by Patel et al. (2012) (Table 8.2). The HDP treatment significantly
reduced E. coli O157:H7 (0.75 log cfu/g), S. Typhimurium (1.09 log cfu/g),
and L. monocytogenes (0.55 log cfu/g) from beef surfaces (Figure 8.13). HDP-
induced injury, as determined by plating on nonselective media, revealed
that ca. 0.5 log cfu/g of E. coli O157:H7 and S. Typhimurium cells were
injured. Most cell injury occurred at the cell membrane level as observed
by TEM (Figure 8.14; Patel et al., 2012).
HDP treatment has also been investigated to inactivate parasites in meat.
Gamble et al. (1998) reported that the numbers of Trichinella spiralis recov-
ered from infested pork were significantly reduced by treatment with the
“Hydrodyne Process” as compared with untreated. However, the infectivity
of this parasite when the larvae from Hydrodyne-treated meat were inocu-
lated into mice was not eliminated. HDP treatment has also been assayed
in relation to the inactivation of viruses. Sharma et al. (2008) compared the
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 285

0
E. coil O157:H7 S. Typhimurium L. monocytogenes

Control HDP

FIGURE 8.13
Effect of HDP on survival of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella
Typhimurium on beef cubes (log cfu/g). HDP, hydrodynamic pressure processing. (Reprinted
from Innovative Food Science and Emerging Technologies, 14, Patel et al., Inactivation and injury
of pathogens on intact beef treated with hydrodynamic pressure, 38–45. Copyright 2012, with
permission from Elsevier.)

inactivation of foodborne viruses by HDP or HPP and found that both tech-
nologies significantly reduced foodborne viruses on pork sausages (1–3 log
reduction), but complete inactivation was not possible to achieve using these
pressure treatments.
Overall, HDP treatment could have some decontamination effect under
the right settings. However, notable inactivation levels have not been clearly
demonstrated in meat products so far with maximum inactivation level
being 1–2 log reduction (Bolumar et al., 2013; Patel et al., 2012). Nevertheless,
HDP treatment for microbial decontamination has been scarcely investi-
gated given the few groups with the available equipment to carry out experi-
mental work worldwide, and definitely deserves further scientific attention.
Additional hurdles such as addition of bacteriocins (e.g., nisin) and/or
organic acids (e.g., lactic acid) could be employed to achieve further reduc-
tion of pathogens present in meat surfaces. High pressure-induced injured
cells can grow under favorable conditions and may regain their pathogenic
potential, and therefore, the population of injured cells should be considered
in devising terminal treatment for reducing pathogens on foods. New engi-
neering developments in shock wave equipment could deliver the required
technical pressure conditions to achieve significant biological inactivation in
the near future so providing an effective microbial decontamination method
to the meat industry.
286 Advanced Technologies for Meat Processing, Second Edition

(a) (b)

500 nm 500 nm

(c) (d)

500 nm 500 nm

FIGURE 8.14
Transmission electron microscopy (TEM) images of hydrodynamic pressure processing
(HDP)-treated S. Typhimurium. All cells show pressure-induced injuries in the form of polar
(a through c) or peripheral invagination of the cellular membrane. (a) Salmonella strongly
attached to meat surfaces. Arrow indicates the actual site of physical binding of bacteria to
muscular tissue. (Reprinted from Innovative Food Science and Emerging Technologies, 14, Patel
et al., Inactivation and injury of pathogens on intact beef treated with hydrodynamic pressure,
38–45. Copyright 2012, with permission from Elsevier.)

8.5 Cost Analysis of HDP Technology

A cost analysis considering cost of HDP technology and cost of the extra
packaging required for the most recent continuous shock wave prototype
developed at the DIL (Figures 8.5 and 8.6) is presented in Table 8.3.

8.5.1 Packaging
Currently, there is no packaging able to withstand the intensity of the shock
waves generated during HDP treatment intended for meat tenderization.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 287

TABLE 8.3
Cost Analysis of HDP or Shock Wave Technology for Meat Tenderization
Cost

Shock Wave Technologya

Spare Operative Extra
Case Throughput Amortization Parts Costs Subtotal Packaging Total
Study (kg/h) (€/kg) (€/kg) (€/kg) (€/kg) (€/kg) (€/kg)

1 500 0.160 0.024 0.041 0.225 0.172 0.397

2 1800 0.050 0.007 0.012 0.069 0.172 0.241
Average 1150 0.105 0.015 0.026 0.147 0.172 0.319
a The amortization costs for the shock wave technology are estimated assuming a one shift
working scheme (8 h/d), 50% occupancy of the equipment time, and a 5-year period for pay-
back of investment.

Some of the typical damages that occurred in the packaging as a conse-

quence of the power and harshness of the HDP treatment can be observed in
Figure 8.15. Figure 8.15a shows a broken bag caused by the fact that the meat
did not have enough expansion space within the bag, which led to enormous
mechanical pressure on the sealing bonds. Furthermore, the commercial
bags showed higher incidence of opened seals (Figure 8.15b). Other dam-
age included small pinholes (primarily started from the inside of the bags)
(Figure 8.15c and e) and large holes caused by burning (Figure 8.15d and f).
Also, large cracks were seen that damaged the entire bag. Research and
development of an HDP-resistant packaging material is one of the key devel-
opments required to underpin the HDP technology to the industry. Efforts
addressing the development of this type of packaging will require the
involvement of packaging materials scientists and most likely commercial
packaging companies that can provide up-to-date expertise adapted to the
needs of the meat industry in terms of cost and compatibility with an indus-
trial food environment.

8.5.2 Equipment
The cost of the shock wave technology can be estimated by durable costs
(i.e., machine depreciation) and operative costs (i.e., spare parts, energy and
water consumption, and personnel cost). The prototype throughput can be
estimated taking into account the speed of the belt, the number of shots that
a meat cut receives, and the size and weight of the meat cut. Depending on
the specific treatment (mainly number of pulses applied) and size of meat
cut, the throughput (kg/h) will vary (see the following calculation example).
The minimum distance that a shock wave can be applied with the shock
wave unit built at DIL (Figures 8.5 and 8.6) is 30 mm. This would be the worst
case scenario for the productivity of the shock wave unit and corresponds to
288 Advanced Technologies for Meat Processing, Second Edition

(a) (b)

(c) (d)

(e) (f)

FIGURE 8.15
Typical damages in the packaging material after HDP or shock wave treatment. (a) Breaking
of the sealing due to the expansion of the meat, (b) details of an opened sealing, (c) pinholes
(leak points) in the packaging (located immersing the bag under water-containing colorants),
(d) pinholes as a consequence of burned plastic, and (e and f) microscopy images of a hole
generated during HDP treatment. HDP, hydrodynamic pressure processing. Work performed
during the European-funded research project, ShockMeat (2012–2013).

the conditions employed in the testing of the prototype. If fewer shots are
applied (e.g., every 60 or 90 mm) the productivity will become higher. The
time required between shots is 2.5 seconds.
Throughput calculation example:
For a meat cut of 240 mm length and applying a shock wave every 30 mm
(240 mm/30 mm = 8) a total of 8 pulses will be applied per meat cut.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 289

• For a small meat cut (e.g., beef eye of round) the result is ca. 3 kg × 180
(meat cuts/h) = 540 kg.
• For a big meat cut (e.g., beef top side) the result is ca. 10 kg × 180
(meat cuts/h) = 1800 kg.

Main spare parts to consider are insulators, electrodes, an insulator jacket,

reflector, conductive sheet metals, and a high-voltage switch.

8.5.3 Quantifying Meat Benefits

Benefits on meat can be estimated based on improvements in tenderness and
so price.
Miller et al. (2001) made a national consumer evaluation on strip loin steaks
of known WBSF values, ranging from tough (>5.7 kg) to tender (<3.0 kg). In
that study, they assessed the monetary value that consumers place on ten-
derness by determining the average price that a consumer would pay for
a steak in four tenderness categories (toughest, tough, intermediate tender-
ness, and tender). The prices for these categories would be 12.30, 12.45, 12.94,
and 13.53 (US $/kg) (Miller et al., 2001).

8.5.4 Overall Cost Analysis of HDP or Shock Wave

Technology for the Meat Industry
The cost of the application of shock wave technology comprises equip-
ment costs (i.e., amortization of investment) and operating costs (i.e., spare
parts, energy and water consumption, and personnel cost). The following
throughputs of 540–1800 kg/h and a life span of five years have been taken
as assumptions for the calculation of operative costs and payback of invest-
ment. The amortization cost is based on a one shift working scheme (8 h/d)
and 50% occupancy of equipment time. With these assumptions, a total
processing cost of 0.069–0.225 €/kg of meat processed is estimated for the
respective throughputs and an average cost of 0.147 €/kg of meat is calcu-
lated (Table 8.3).
The cost in extra packaging is based on a consumption of 50,000 bags of
the optimal material, a highly resistant packaging material, at the standard
commercial cost in the market. An extra cost of around 0.172 €/kg of meat
was estimated (Table 8.3). However, it must be noted that there is no pack-
aging material that is fully resistant to HDP or shock wave at the moment.
Consequently, a reprocessing will have to be considered, which makes
implementation more difficult in industrial practices.
The benefit for the meat can be estimated based on the assumption that an
improvement in the tenderness perception of the meat with one point within
a sensory scale (1–15) may increase the extra value of the meat. This increase
of one point in tenderness appreciation in sensorial panel is realistic by using
the continuous shock wave prototype developed at the DIL. The translation
290 Advanced Technologies for Meat Processing, Second Edition

of the improved tenderness corresponding to one point in a sensory scale

(1–15) can be estimated in (€/kg) for different beef meat cuts assuming that
this will increase the value of the meat to a certain percentage depending on
specific markets (1%–5% added value to price).
Overall, it can be concluded that with the current technological develop-
ment status of the shock wave technology, only applications in which qual-
ity/tenderness improvement will lead to higher benefits than 0.3 €/kg of
meat would make the technology profitable. The shock wave technology
could be easily integrated in the meat processing industry at the abattoirs
after the onset of rigor mortis (i.e., boning room) or at the reception of meat
processing plants (Figure 8.16). Toll processing is another possible option,
where companies offer this service to the meat industry, similarly to what

Livestock production

Slaughter

Chilling
Slaughterhouse

Rigor mortis onset

Deboning

Vacuum packaging

Shockwave
Shock wave treatment

Transport,
storage, and
maturation
Meat processor

Processing

Packaging

Distribution

Consumer

FIGURE 8.16
Meat processing layout with integrated shock wave unit intended for meat tenderization.
(Reprinted from Meat Science, 95, Bolumar et al., New developments in shockwave technology
intended for meat tenderization: Opportunities and challenges, 931–939. Copyright 2013, with
permission from Elsevier.)
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 291

happens with other novel food processing technologies such as HPP, which
also has a high initial investment cost, thereby facilitating the use of the tech-
nology by the industry.

8.6 Future Considerations

HDP or shock wave technology could be profitable for meat cuts of high
commercial value (e.g., loin) or for revalorization of low-value cuts (e.g.,
brisket) and market niches of premium meats which could absorb the costs
of the technology (~0.3 €/kg of meat). Other benefits of the use of HDP
would be the attainment of consistent meat quality and improved con-
sumer satisfaction, both resulting in consumer confidence and branding.
But these factors are marginal compared to the effect on the net cost €/
kg and a prerequisite before the meat industry truly decides to invest in
shock wave technology. Other factors of importance to ensure success of
the technology are the noise and vibration during operation, which can
be avoided by placing the process in a different and isolated room. This is
a common practice for some operations in the meat industry where noisy
processes such as mechanical deboning of meat and rendering require
physical separation to ensure a physical barrier/separation that prevents
cross-contamination. Shock wave technology could be further developed
to improve throughput and particularly, to create a better interaction
between the equipment and the packaged product to minimize the amount
of damaged packages, which is a requirement at the moment. Engineering
developments seem to be the keystone for the transfer of the technology
to the industry. As with many technologies, compliance with the indus-
try requirements in terms of cost and operability will be essential prior to
investment and uptake.

8.7 Conclusion
HDP or shock wave technology represents a low-cost and noninvasive inter-
vention for meat tenderization with no negative impact on microbiological
and chemical stability (drip loss, color, and flavor). However, commercial
application is not yet available because of limitations of suitable packaging
materials as well as the need for an efficient shock wave delivery process in
a commercial environment. Should these be achieved, HDP would make it
possible to obtain remarkable improvements in meat tenderness with a very
short treatment time and low processing costs.
292 Advanced Technologies for Meat Processing, Second Edition

Acknowledgments
Grant agreement number 2870340 (Development of Shock Wave Technology
for Packed Meat) from the European Union’s Seventh Framework Program
managed by REA (Research Executive Agency, http://ec.europa.eu/research
/rea) (FP7/2007–2013) is acknowledged. Critical review of this manuscript by
Bo-Anne Rohlik and Ron Tume is acknowledged.

References
Anderson, M. J., Lonergan, S. M., Fedler, C. A., Prusa, K. J., Binning, J. M. and Huff-
Lonergan, E. (2012). Profile of biochemical traits influencing tenderness of mus-
cles from the beef round. Meat Science, 91(3), 247–254.
Acuff, G. R. (2014). Microbial contamination, Decontamination of Fresh Meat. In C.
Devine and M. Dikeman (Ed.), Encyclopedia of Meat Sciences, Volume 2 (Vol. 2, pp.
276-279). London, UK: Elsevier Ltd.
Bajovic, B., Bolumar, T. and Heinz, V. (2012). Quality considerations with high pressure
processing of fresh and value added meat products. Meat Science, 92(3), 280–289.
Barbosa-Canovas, G. V., Tapia, M. S. and Cano, P. (2004). Novel Food Processing
Technologies. Boca Raton, FL: CRC Press, Taylor & Francis.
Berge, P., Ertbjerg, P., Larsen, L. M., Astruc, T., Vignon, X. and Møller, A. J. (2001).
Tenderization of beef by lactic acid injected at different times post mortem. Meat
Science, 57, 347–357.
Bolumar, T., Bindrich, U., Toepfl, S., Toldrá, F. and Heinz, V. (2014). Effect of electro-
hydraulic shockwave treatment on tenderness, muscle cathepsin and peptidase
activities and microstructure of beef loin steaks from Holstein young bulls. Meat
Science, 98, 759–765.
Bolumar, T., Enneking, M., Toepfl, S. and Heinz, V. (2013). New developments in
shockwave technology intended for meat tenderization: Opportunities and
challenges. A review. Meat Science, 95(4), 931–939.
Bolumar, T., Georget, E. and Mathys, A. (2015). High pressure processing (HPP)
of foods and its combination with electron beam processing. In: Pillai, S.
and Shayanfar, S. (eds.) Electron Beam Pasteurization and Complementary Food
Processing Technologies. Cambridge: Woodhead Publishing, pp. 127–155.
Bolumar, T., Middendorf, D., Toepfl, S. and Heinz, V. (2016). Structural changes in
foods caused by high-pressure processing. In: Balasubramaniam, V. M., Barbosa-
Canovas, G. and Lelieveld, H. (eds.) High Pressure Processing of Food—Principles,
Technology and Applications. New York, Springer-Verlag, pp. 509–537.
Bowker, B. C., Callahan, J. A. and Solomon, M. B. (2010a). Effects of hydrodynamic
pressure processing on the marination and meat quality of turkey breasts.
Poultry Science, 89(8), 1744–1749.
Bowker, B. C., Eastridge, J. S., Paroczay, E. W., Callahan, J. A. and Solomon, M. B.
(2010b). Aging/tenderization mechanisms. In: Toldrá, F. (ed.) Handbook of Meat
Processing. Iowa, IA: Wiley-Blackwell, pp. 87–104.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 293

Bowker, B. C., Fahrenholz, T. M., Paroczay, E. W., Eastridge, J. S. and Solomon, M. B.

(2008a). Effect of hydrodynamic pressure processing and aging on the tenderness
and myofibrillar proteins of beef strip loins. Journal of Muscle Foods, 19(1), 74–97.
Bowker, B. C., Fahrenholz, T. M., Paroczay, E. W. and Solomon, M. B. (2008b). Effect of
hydrodynamic pressure processing and aging on sarcoplasmic proteins of beef
strip loins. Journal of Muscle Foods, 19, 175–193.
Bowker, B. C., Fahrenholz, T. M., Sarnoski, P. J. and Solomon, M. B. (2012). Alterations
in the sarcoplasmic protein fraction of beef muscle with postmortem aging and
hydrodynamic pressure processing. Journal of Food Science, 77(6), C594–C602.
Bowker, B., Liu, M., Callahan, J. and Solomon, M. (2010b). Effect of hydrodynamic
pressure processing on the processing and quality characteristics of moisture-
enhanced pork loins. Journal of Food Science, 75(4), S237–S244.
Bowker, B. C., Schaefer, R. B., Grapperhaus, M. J. and Solomon, M. B. (2011).
Tenderization of beef loins using a high efficiency sparker. Innovative Food
Science and Emerging Technologies, 12(2), 135–141.
Chan, J. T. Y., Omana, D. A. and Betti, M. (2011). Application of high pressure process-
ing to improve the functional properties of pale, soft, and exudative (PSE)-like
turkey meat. Innovative Food Science and Emerging Technologies, 12, 216–225.
Claus, J. R. (2002). Shock treatment—Shock waves are an effective tool for tenderizing
meat. Meat and Poultry, 48(12), 61–63.
Claus, J. R., Schilling, J. K., Marriott, N. G., Duncan, S. E., Solomon, M. B. and Wang,
H. (2001a). Hydrodynamic shockwave tenderization effects using a cylinder
processor on early deboned broiler breasts. Meat Science, 58, 287–292.
Claus, J. R., Schilling, J. K., Marriott, N. G., Duncan, S. E., Solomon, M. B. and Wang,
H. (2001b). Tenderization of chicken and turkey breasts with electrically pro-
duced hydrodynamic shockwaves. Meat Science, 58, 283–286.
Doona, C. J., Kustin, K. and Feeherry, F. E. (eds.) (2010). Case Studies in Novel Food Processing
Technologies. Innovations in Processing, Packaging, and Predictive Modelling. Cambridge:
Woodhead Publishing Series in Food Science, Technology and Nutrition.
Flynn, C., Cruz-Romero, M. C., Troy, D., Mullen, A. M. and Kerry, J. P. (2014). The
application of high-pressure treatment in the reduction of salt levels in reduced-
phosphate breakfast sausage. Meat Science, 96, 1266–1274.
Gamble, H., Solomon, M. B. and Long, J. (1998). Effects of hydrodynamic pressure on
the viability of Trichinella spiralis in pork. Journal of Food Protection, 61, 637–639.
Godfrey, C. S. (1970). Apparatus for tenderizing food. US Patent 3, 492, 688.
Grossi, A., Gkarane, V., Otte, J. A., Ertbjerg, P. and Orlien, V. (2012). High pressure
treatment of brine enhanced pork affects endopeptidase activity, protein solu-
bility, and peptide formation. Food Chemistry, 134(3), 1556–1563.
Grunert, K. G., Bredahl, L. and Brunsø, K. (2004). Consumer perception of meat qual-
ity and implications for product development in the meat sector—A review.
Meat Science, 66, 259–272.
Heinz, V., Töpfl, S., Schwägele, F. and Münch, S. (2011). AiF-15884 N: Anwendung
elektrohydraulischer Stoßwellen zur Desintegration biologischer Gewebe
am Beispiel der Zartmachung von Rindfleisch. In: Forschungskreis der
Ernährungsindustrie e. V. (FEI), Bonn, Germany.
Hendrickx, M. E. G. and Knorr, D. (2002). Ultra High Pressure Treatments of Foods. Food
Engineering Series. New York, NY, London: Kluwer Academic Publishers.
Homma, N., Ikeuchi, Y. and Suzuki, A. (1994). Effects of high pressure treatment on
the proteolytic enzymes in meat. Meat Science, 38, 219–228.
294 Advanced Technologies for Meat Processing, Second Edition

Hugas, M., Garriga, M. and Monfort, J. M. (2002). New mild technologies in meat
processing: High pressure as a model technology. Meat Science, 62, 359–371.
Koohmaraie, M., Kent, M. P., Shackelford, S. D., Veiseth, E. and Wheeler, T. L. (2002). Meat
tenderness and muscle growth: Is there any relationship? Meat Science, 62, 345–352.
Locke, B. R., Sato, M., Sunka, P., Hoffmann, M. R. and Chang, J.-S. (2006).
Electrohydraulic discharge and non-thermal plasma for water treatment.
Industrial and Engineering Chemistry Research, 45(3), 882–905.
Long, J. B. (1993). Tenderizing meat. US Patent 5,273,766.
Long, J. B. (1994). Apparatus for tenderizing meat. US Patent 5,328,403.
Long, J. B. (2000). Treatment of meat by capacitor discharge. US Patent 6,120,818.
Long, J. B. (2001). Method for killing bacteria in meat. US Patent 6,200,615.
Long, J. B. (2009). Tenderizing of meat. US Patent 7,485,331.
Lorca, T. A., Claus, J. R., Eifert, J. D., Marcy, J. E. and Sumner, S. S. (2003). Penetration
of surface-inoculated bacteria as a result hydrodynamic shock wave treatment
of beef steaks. Journal of Food Protection, 65, 616–620.
Lorca, T. A., Pierson, M. D., Claus, J. R., Eifert, J. D., Marcy, J. E. and Sumner, S. S.
(2002). Penetration of surface-inoculated bacteria as a result of electrically-
generated hydrodynamic shock wave treatment of boneless skinless chicken
breasts. Journal of Poultry Science, 82, 1205–1210.
Manabe, H., Takemoto, A., Maehara, H. et al. (2011). Efficient improved extraction of tomato
saponin using shock waves. Chemical and Pharmaceutical Bulletin, 59(11), 1406–1408.
Mayer, D., Dorfmüller, C. and Lachat, M. (2009). Die extrakorporale Stoßwellentherapie
als neue Methode zur Stimulation der Heilung komplexer Wunden: Eine
Übersicht. Zeitschrift Fur Wundheilung, 14(1), 14–19.
Meek, K. I., Claus, J. R., Duncan, S. E. et al. (2000). Quality and sensory characteris-
tics of selected post-rigor, early deboned broiler breast meat tenderized using
hydrodynamic shock waves. Poultry Science, 79, 126–136.
Mennecke, B. E., Townsend, A. M., Hayes, D. J. and Lonergan, S. M. (2007). A study
of the factors that influence consumer attitudes toward beef products using the
conjoint market analysis tool. Journal of Animal Science, 85, 2639–2659.
Miller, M. F, Carr, M., Ramsey, C. B., Crockett, K. L. and Hoover, L. C. (2001). Consumer
thresholds for establishing the value of beef tenderness. Animal Science, 79, 3062–3068.
Miyafuji, Y., Shimojima, K., Tanaka, S. et al. (2011). Development of the pressure ves-
sel for manufacturing the rice-powder using the underwater shock wave. In
ASME Conference Proceedings, Washington, DC, USA (44540), 53–56.
Moeller, S., Wulf, D., Meeker, D., Ndife, M., Sundararajan, N. and Solomon, M. B. (1999).
Impact of the hydrodyne process on tenderness, microbial load, and sensory char-
acteristics of pork longissimus muscle. Journal of Animal Science, 77, 2119–2123.
Ohmori, T., Shigehisa, T., Taji, S. and Hayashi, R. (1992). Biochemical effects of high
hydrostatic-pressure on the lysosome and proteases involved in it. Bioscience
Biotechnology and Biochemistry, 58, 1285–1288.
Paparella, M. W. and Allen, M. (1970). Gaping oysters by shockwave energy. Chesapeake
Science, 11(2), 116–119.
Patel, J. R., Bhagwat, A. A., Sanglay, G. C. and Solomon, M. B. (2006). Rapid detec-
tion of Salmonella from hydrodynamic pressure-treated poultry using molecular
beacon real-time PCR. Food Microbiology, 23, 39–46.
Patel, J., MacArisin, D., Sanglay, G. and Murphy, C. (2012). Inactivation and injury of
pathogens on intact beef treated with hydrodynamic pressure. Innovative Food
Science and Emerging Technologies, 14, 38–45.
Hydrodynamic Pressure Processing to Improve Meat Quality and Safety 295

Patel, J. R., Sanglay, G. C., Sharma, M. and Solomon, M. B. (2007). Combining anti-
microbials and hydrodynamic pressure processing for control of Listeria
Monocytogenes in frankfurters. Journal of Muscle Foods, 18, 1–18.
Patel, J. R., Sanglay, G. C. and Solomon, M. B. (2009). Control of Listeria monocytogenes
on frankfurters with antimicrobials and hydrodynamic pressure processing.
Journal of Muscle Foods, 20, 227–241.
Podolak, R., Solomon, M. B., Patel, J. R. and Liu, M. N. (2006). Effect of hydrodynamic
pressure processing on the survival of Escherichia coli O157:H7 in ground beef.
Innovative Food Science and Emerging Technologies, 7, 28–31.
Purchas, R. W. (2004). Tenderness measurement. In: Encyclopedia of Meat Sciences, vol.
3. Amsterdam: Elsevier, pp. 452–459.
Purslow, P. P. (2005). Intramuscular connective tissue and its role in meat quality. Meat
Science, 70, 435–447.
Purslow, P. (2014). New developments on the role of intramuscular connective tissue
in meat toughness. Annual Review of Food Science and Technology, 5, 133–153.
Schaefer, R. B. (1998). Sparker source systems. US Patent 5,841,737.
Schilling, M. W., Claus, J. R., Marriot, N. G., Solomon, M. B., Eigel, W. N. and Wang,
H. (2002). No effect of hydrodynamic shock wave on protein functionality of
beef muscle. Journal of Food Science, 67, 335–340.
Schilling, M. W., Marriott, N. G., Wang, H. and Solomon, M. B. (2003). Characteristics
of USDA utility cow beef subjected to blade tenderization and hydrodynamic
shock-waves. Journal of Muscle Foods, 14, 131–142.
Sentandreu, M. A., Coulis, G. and Ouali, A. (2002). Role of muscle endopeptidases and
their inhibitors in meat tenderness. Trends in Food Science and Technology, 13, 398–419.
Sharma, M., Shearer, A. E. H., Hoover, D. G., Liu, M. N., Solomon, M. B. and Kniel, K.
E. (2008). Comparison of hydrostatic and hydrodynamic pressure to inactivate
foodborne viruses. Innovative Food Science and Emerging Technologies, 9, 418–422.
Shimojima, K., Miyafuji, Y., Tanaka, S. et al. (2011). Study of the suitable pressure
vessel for the rice-powder manufacturing using the underwater shock wave. In
ASME Conference Proceedings, Washington, DC, USA (44540), 49–52.
Sikes, A., Tornberg, E. and Tume, R. (2010). A proposed mechanism of tenderising
post-rigor beef using high pressure-heat treatment. Meat Science, 84(3), 390–399.
Sikes, A. L. and Tume, R. K. (2014). Effect of processing temperature on tenderness,
colour and yield of beef steaks subjected to high-hydrostatic pressure. Meat
Science, 97(2), 244–248.
Simjian, L. G. (1957). Food tenderizer. US Patent 2,806,246.
Solomon, M. B., Carpenter, C. E., Snowder, G. D. and Cockett, N. E. (1998). Tenderizing
callipyge lamb with the hydrodyne process and electrical stimulation. Journal of
Muscle Foods, 9, 305–311.
Solomon, M. B., Liu, M. N., Patel, J. R., Bowker, B. C. and Sharma, M. (2006).
Hydrodynamic pressure processing to improve meat quality and safety. In:
Nollet, L. M. L. and Toldrá, F. (eds.) Advanced Technologies for Meat Processing.
Boca Raton, FL: CRC Press/Taylor & Francis, pp. 219–244.
Solomon, M. B., Liu, M., Patel, J., Paroczay, E. and Eastridge, J. (2004). Tenderness
improvement in fresh and frozen/thawed beef strip loins treated with hydrody-
namic pressure processing. Journal of Animal Science, 82, 18–22.
Solomon, M. B., Liu, M. N., Patel, J., Paroczay, E., Eastridge, J. and Coleman, S. W.
(2008). Tenderness improvement in fresh or frozen/thawed beef steaks treated
with hydrodynamic pressure processing. Journal of Muscle Foods, 19(1), 98–109.
296 Advanced Technologies for Meat Processing, Second Edition

Solomon, M. B., Long, J. B. and Eastridge, J. S. (1997). The hydrodyne: A new process
to improve beef tenderness. Journal of Animal Science, 75, 1534–1537.
Solomon, M. B., Sharma, M., and Patel, J. R. (2011). Hydrodynamic pressure processing
of meat products. In: Zhang, H. Q., Barbosa-Canovas, G. V., Balasubramaniam,
V.M., Dunne, C. P., Farkas, D. and Yuan, J. T.C. (eds.) Non-Thermal Processing
Technologies for Food. Brisbane, Milton QLD 4064 Australia, Wiley Blackwell, IFT
Press, pp. 98–108.
Souza, C. M., Boler, D. D., Clark, D. L. et al. (2011). The effects of high pressure pro-
cessing on pork quality, palatability, and further processed products. Meat
Science, 87, 419–427.
Spanier, A. M., Berry, B. W. and Solomon, M. B. (2000). Variation in the tenderness of
beef strip loins and improvement in tenderness by use of hydrodynamic pres-
sure processing (HDP). Journal of Muscle Foods, 11(3), 183–196.
Spanier, A. M. and Romanowski, R. (2000). A potential index for assessing the tenderness
of hydrodynamic pressure (HDP)-treated beef strip loins. Meat Science, 56, 193–202.
Sullivan, G. and Calkins, C. R. (2010). Application of exogenous enzymes to beef mus-
cle of high and low-connective tissue. Meat Science, 85(4), 730–734.
Sun, X. D. and Holley, R. A. (2010). High hydrostatic pressure effects on the texture of
meat and meat products. Journal of Food Science, 75(1), R17–R22.
Thompson, J. (2002). Managing meat tenderness. Meat Science, 62, 295–308.
Thompson, J. M., Perry, D., Daly, B., Gardner, G. E., Johnston, D. J. and Pethick, D. W.
(2006). Genetic and environmental effects on the muscle structure response
post-mortem. Meat Science, 74, 59–65.
Toepfl, S., Bolumar, T. and Heinz. V. (2013). Development of shockwave technol-
ogy for packed meat. European Funded Project, FP7 (2007–2013) Under Grant
Agreement Number 287034.
Toepfl, S. and Heinz, V. (2009). New options for targeted product modification.
Fleischwirtschaft International, 3, 11–13.
Troy, D. J. (1999). Enhancing the tenderness of beef. Final report. Project Armis No.
3916. The National Food Centre. Research and training for the food industry.
Research Report no 11.
Williams-Campbell, A. M. and Solomon, M. B. (2000). New non-thermal postharvest
technology to improve food safety: Hydrodynamic pressure processing. In
Proceedings of the International Society for Optical Engineering, 4206. Boston, MA,
167–173.
Williams-Campbell, A. M. and Solomon, M. B. (2002). Reduction of spoilage microor-
ganisms in fresh beef using hydrodynamic pressure processing. Journal of Food
Protection, 65(3), 571–574.
Yang, Y. (2011). Plasma discharge in water and its application for industrial cooling water
treatment. PhD dissertation, Drexel University, Philadelphia, PA.
Zuckerman, H., Bowker, B. C., Eastridge, J. S. and Solomon, M. B. (2013). Microstructure
alterations in beef intramuscular connective tissue caused by hydrodynamic
pressure processing. Meat Science, 95(3), 603–607.
Zuckerman, H., Krasik, Y. E. and Felsteiner, J. (2002). Inactivation of microorganisms
using pulsed high-current underwater discharges. Innovative Food Science and
Emerging Technologies, 3, 329–336.
Zuckerman, H. and Solomon, M. B. (1998). Ultrastructural changes in bovine lon-
gissimus muscle caused by Hydrodyne process. Journal of Muscle Foods, 9(4),
419–426.
9
Emerging Technologies for the
Meat Processing Industry

Kumari Shikha Ojha, Joseph P. Kerry, and Brijesh K. Tiwari

CONTENTS
9.1 Introduction ................................................................................................ 297
9.2 Emerging Technologies............................................................................. 298
9.2.1 Ultrasound Technology ................................................................ 298
9.2.1.1 Decontamination of Meat ..............................................300
9.2.1.2 Meat Tenderization ......................................................... 301
9.2.1.3 Brining .............................................................................. 302
9.2.3 Pulsed Electric Field ...................................................................... 303
9.2.4 Cold Plasma Technology ..............................................................304
9.2.5 Light-Based Technologies .............................................................308
9.3 Conclusions................................................................................................. 312
References............................................................................................................. 313

9.1 Introduction
Novel technologies, including high-pressure processing, pulsed electric field
(PEF), oscillating magnetic fields (OMFs), light-based technologies, high-pres-
sure carbon oxide, ultrasound processing, and microwaves, are currently being
developed, optimized, and tested on a variety of food products including meat
and meat products. These technologies have shown commercial potential and
some of these technologies (e.g., high-pressure processing, see also Chapter 7)
have been employed at commercial scale for meat products. Emerging tech-
nologies have shown potential to overcome several challenges faced by the
meat industry such as improving the process efficiency, new product develop-
ment, and extension of shelf life while improving the safety profile of meat
products. One of the key challenges is related to decontamination of meat sur-
faces by using heat or chemical-based treatments, which can exert negative
effects on meat quality. Low temperature treatment, which includes the appli-
cation of chemicals, for example, organic acids and chlorine, in a concentra-
tion between 1.5% and 2.5% have been reported to lower meat pH and reduce

297
298 Advanced Technologies for Meat Processing, Second Edition

both pathogens and spoilage microorganisms by up to 1–3.5 log units. These

chemicals are recommended to be applied either by spraying or dipping meat
in water containing chemical disinfectants. These chemicals have been used
outside the European Union (EU) for years and have a profound antimicro-
bial effect. Since these chemicals are not likely to be accepted in the EU, it is
highly relevant to search for alternative techniques for meat decontamination.
Further, decontamination of meat surfaces using chemicals often relies heav-
ily on potable water usage. The additional impetus of reducing water usage as
well as chemical emissions has led to a focus on non-water-based or reduced
water-usage-based decontamination technologies. Driven by the need to find
more effective decontamination methods, and in light of increasing market and
legislative pressures, in the face of highly publicized incidences of foodborne
illness, the meat sector is increasingly interested in the development and imple-
mentation of new processing technologies. Some of the novel food processing
technologies including high-pressure processing have paved a path toward
commercialization whereas some novel processing techniques including light-
based technologies, ultrasound processing, PEF, and cold plasma are currently
being evaluated for meat processing applications. The objective of this chapter
is to demonstrate the application of these technologies for meat applications.

9.2 Emerging Technologies

9.2.1 Ultrasound Technology
Ultrasonic waves are sound waves having frequencies above the threshold
of hearing for humans and typically divided into three regions of frequency,
power ultrasound (20–100 kHz), high-frequency ultrasound (100 kHz–2
MHz), and diagnostic ultrasound (>1 MHz). Ultrasound is an innovative and
versatile technology that has its wide range of applications. High-frequency
and diagnostic ultrasound is in use for meat carcass evaluation for several
decades (Pathak et al., 2011). Ultrasound scanning technology is a noninva-
sive method to predict carcass characteristics that utilizes ultrasonic waves
to generate ultrasonic images, which are employed for visualization of vari-
ous body parts, with real-time tomographic imaging feasible. Although com-
mercial applications of power ultrasound have been demonstrated in some
industries (e.g., chemical, cosmetic, textile, polymer, and petrochemical), it
has recently gained interest in the food industry including meat processing.
Power ultrasound has been known to influence technological properties and
quality of fresh and processed meat. However, limited research studies are
available demonstrating the application of ultrasound for various unit opera-
tions in meat value chain. The application of ultrasound in meat processing
to date includes surface decontamination, tenderization, brining, freezing,
thawing, cooking, and cutting of meat (Alarcon-Rojo et al., 2015). Table 9.1
demonstrates the applications of ultrasound for various meat processes.
Emerging Technologies for the Meat Processing Industry 299

TABLE 9.1
Applications of Ultrasound for Meat Processing
Meat Condition Effect of Ultrasound Reference
Decontamination of meat
Chicken wing 2.5 W/cm−2, 40 Microorganism Kordowska-Wiater
surface kHz, 3 or 6 min reduction and Stasiak (2011)
Higher reduction
with higher time
Escherichia coli has
been found to be
more sensitive to
ultrasound
Fresh pork jowl SonoSteam Less skin and surface Morild et al. (2011)
treatment, steam bacteria
(130°C, 3.5–5
atm) and
ultrasound 30–40
kHz for 0.5–2 s
Chicken carcasses SonoSteam Campylobacter and Musavian et al. (2014)
treatment, a total count viable
combination of reduction
steam at
90°C–94°C and
ultrasound at
30–40 kHz
through specially
designed nozzles
Bovine semitendino- Ultrasonic Reduced growth of Caraveo et al. (2015)
sus muscle frequency of mesophilic,
40 kHz and an psychrophilic
intensity of bacteria and total
11 W/cm−2 coliforms in beef
stored at 4°C
Tenderization of meat
Beef (semimembra- 2 W/cm−2, 45 kHz, No effect on pH or Stadnik and
nosus) 24 h 2 min color. Reduced Dolatowski (2011)
postmortem and hardness
matured for 24, 48,
72, or 96 h at 2°C
Hen breast meat 24 kHz, Reduced shear force Xiong et al. (2012)
0, 1, 3, or 7 days 12 W/cm−2, No change in cooking
at 4°C 15 s period loss
Chicken breast and 20 kHz, 450 W for More viscoelastic gel, Zhao et al. (2014)
soybean gels 0, 3, 6, 9, and 12 improved Water-and
min (4 or 2 s fat-binding
pulses) capacities and
textural properties.
Homogeneous fine
network microstruc-
tures

(Continued)
300 Advanced Technologies for Meat Processing, Second Edition

TABLE 9.1 (Continued)

Applications of Ultrasound for Meat Processing
Meat Condition Effect of Ultrasound Reference
Beef longissimus Ultrasonic probe Simultaneous Barekat and
lumborum muscles (20 kHz) at application of both Soltanizadeh (2017)
power of 100 and ultrasound and
300 W papain enzyme
improved the
tenderness of beef
Brining
Pork longissimus 40 kHz; 37.5 W/ Higher salt and water Cárcel et al. (2007)
dorsi dm−3 diffusion
Pork longissimus 2–4 W/cm−2, 20 Higher salt diffusion. Siró et al. (2009)
dorsi kHz Diffusion coefficient
increases with
ultrasound intensity
Pork longissimus 0, 40, 56, Reduction of salting McDonnell et al.
thoracis and 72 W/cm−2, time without (2014)
lumborum 34–40 kHz, 2, changes in sensory
4, 6 h attributes
Bovine longissimus 20 kHz ultrasonic Ultrasound intensity Kang et al. (2016)
dorsi muscles probe at different could significantly
power levels improve the D values
(150, 200, 250, of NaCl and water
and 300 W) Space between
myofibrils increased
with increased
ultrasound intensity

9.2.1.1 Decontamination of Meat

Power ultrasound has the ability to generate physical (micromechanical) and
chemical effects resulting in the disruption of cellular structures. The bacteri-
cidal effect of ultrasound is largely attributed to intracellular cavitation, which
can cause thinning of cell membranes, temperature increase, and production of
free radicals (Butz and Tauscher, 2002; Chemat and Khan, 2011). It is proposed
that in the compression and rarefaction cycles of ultrasound energy, fluctuat-
ing pressures induce formation and collapse of microscopic cavitation bubbles
resulting in micromechanical shock waves. These shock waves can disrupt cel-
lular structural and functional components leading to cell lysis (Hoover, 2000).
Free radicals, mainly hydroxyl radicals, are produced during the collapse of
cavitation bubbles as a result of sonolysis of water. These radicals (e.g., OH−,
H+<) through a series of reactions, produce hydrogen peroxide (H2O2) and
other reactive species. Cavitation, production of radicals, and microstreaming
can cause thinning of the cell membrane and DNA damage leading to micro-
bial inactivation (Alarcon-Rojo et al., 2015; Earnshaw et al., 1995; Turantaş et
al., 2015). The inactivation of various pathogenic and spoilage microorganisms
Emerging Technologies for the Meat Processing Industry 301

including Escherichia coli, Listeria monocytogenes, Salmonella sp., and Bacillus sp.
pertinent to meat products is extensively reported in the literature (Piyasena
et al., 2003). However, most studies indicate lower antimicrobial efficacy of
ultrasound depending upon the conditions employed. Thus, a combination
of ultrasound with pressure (manosonication), ultrasound and heat (thermo-
sonication), ultrasound, heat, and pressure (manothermosonication), or the
combination of ultrasound with other nonthermal approaches has often been
recommended for improving efficacy (Pagán et al., 1999a,b). Kordowska-Wiater
and Stasiak (2011) investigated the removal of gram-negative bacteria (Salmo-
nella anatum, E. coli, Proteus sp. and Pseudomonas fluorescens) from the surface of
chicken skin after treatment with ultrasound (40 kHz and 2.5 W/cm−2 for 3 or
6 min) in water and in aqueous 1% lactic acid. Sonication in water alone or in
lactic acid for 3 min resulted in a 1.0 cfu/cm−2 reduction on the skin surface,
but longer treatment (6 min) resulted in a reduction of over 1.0 cfu/cm−2 in the
water samples and 1.5 log cfu/cm−2 in the lactic acid-treated samples. Ultra-
sound treatment in combination with lactic acid may be a suitable method for
decontamination of the poultry skin. Herceg et al. (2013) studied the effect of
high-intensity ultrasound on the inactivation of suspensions containing E. coli,
Staphylococcus aureus, Salmonella sp., L. monocytogenes, and Bacillus cereus treated
with an ultrasound probe operating at 20 kHz and amplitudes of 60, 90, and
120 μm for 3, 6, and 9 min at 20°C, 40°C, and 60°C. Increasing any of these
three parameters improved the inactivation rates of bacteria in suspension.
The results also showed increased inactivation after prolonged treatment
time, especially in combination with high temperature and amplitude level.
Ultrasound in combination with steam has shown potential for inactivation of
pathogenic and spoilage microorganism. For instance, a study investigated the
decontaminating effect of SonoSteam treatment (ultrasound + steam) on broiler
carcasses under commercial processing conditions with a rate of 8500 carcasses
per hour (Musavian et al., 2014). SonoSteam treatment achieved reductions of
approximately 1.0 log for Campylobacter and 0.7 log for total viable counts with
no significant changes in sensorial properties of chicken carcasses.

9.2.1.2 Meat Tenderization

As tenderness is one of the most important attributes of meat quality, research-
ers and meat processors have always been looking for efficient tenderization
processes. One method of increasing meat tenderness and sensory attributes
is by employing ultrasound. Although the application of ultrasonic techniques
for meat tenderization was reported as early as the 1970s by Zayas and Orlova,
the actual mechanism is still unclear and results are inconsistent in some cases.
The tenderization effect of ultrasound is attributed to various mechanisms
including physical disruption of muscle tissues through cavitation-induced
effects such as high shear, pressure, and temperature; high proteolysis through
the release of either cathepsins from lysosomes and/or Ca2+ from intracellular
302 Advanced Technologies for Meat Processing, Second Edition

stores; and the activation of calpains by Ca2+ (Jayasooriya et al., 2004, 2007;
Turantaş et al., 2015).
Several studies have focused on the effect of ultrasound on meat tenderiza-
tion showing positive and no significant effects on meat tenderization (Table
9.1). For example, Dickens et al. (1991) determined the effect of ultrasound (40
kHz, 15 min) on the texture and cooking loss of cooked broiler breast meat
and observed that the ultrasound treatment did not affect cooking loss, but
improved texture significantly. Dolatowski and Twarda (2004) reported that
ultrasound treatment (45 kHz, 2 W/cm−2 or 25 kHz, 2 W/cm−2) during the
rigor mortis period (up to 24 h postmortem) resulted in improved tender-
ness and higher water-holding capacity in the semimembranosus muscles. On
contrary, Got et al. (1999) employed high-frequency (2.4 MHz) ultrasound to
treat prerigor meat and observed an initial increase in firmness (compres-
sion force) of raw meat compared to untreated or postrigor sonicated meat.
After 14 days of aging, this group observed no difference between untreated
and prerigor or postrigor ultrasound-treated meat. Ultrasound in combi-
nation with other methods is also reported to be effective for improving
marination, tenderness, and modifying the functional properties of meat
and poultry products (Turantaş et al., 2015). For example, Xiong et al. (2012)
reported that contribution of mechanical disruption by ultrasound (24 kHz
for 4 min) and endogenous proteolytic enzymes can be a suitable method
for improving tenderness and decreasing the cooking loss of chicken meat.
Barekat and Soltanizadeh (2017) evaluated the effects of ultrasonic treatment
alone, enzyme treatment, and simultaneous application of both ultrasound
and papain on the tenderness and certain other physicochemical properties
of Longissimus lumborum muscles. Results showed that the most proteolytic
activity and the highest tenderness value were obtained when the combined
treatment was applied at ultrasonic power of 100 W for 20 min. They also
concluded that the combination of ultrasound radiation and papain treat-
ment could be employed for the production of tender beef pieces.

9.2.1.3 Brining
Low-frequency ultrasound in the range of 20–100 kHz is known to enhance
several mass transfer processes, including brining and curing of meat. It is
well recognized that ultrasound allows faster and uniform diffusion of brine
solution into the meat tissues. Various physical and chemical phenomena
including agitation, vibration, pressure, shock waves, shear forces, microjets,
compression and rarefaction, acoustic streaming, cavitation, and radical for-
mation are responsible for the ultrasonic effect. The main driving force for
enhancing salt diffusion is acoustic cavitation. It has been proved that power
ultrasound treatment can directly increase the diffusion coefficient, which
can shorten the curing time. Cárcel et al. (2003) immersed sliced pork in satu-
rated brine solution at 2°C for 45 min with different agitation. It was reported
that the sodium chloride and water content in the pork samples were higher
Emerging Technologies for the Meat Processing Industry 303

with than without ultrasound treatment. Siró et al. (2009) also revealed that
ultrasonic brining significantly improved salt diffusion in meat, in compari-
son with static brining. McDonnell et al. (2014) reported that it took only 2 h
to finish curing of pork ham, achieving 2.25% NaCl content, using ultrasound
treatment while it needed about 4 h for the control treatment. Some authors
pointed out that the mass transfer was not affected until intensity thresholds
were reached. Cárcel et al. (2007) reported the thresholds as 39 and 51 W/
cm−2. But Siró et al. (2009) exhibited the mass transfer enhancement effect of
ultrasound (20 kHz) at ultrasound intensity as low as 2–4 W/cm−2. They also
reported an exponential increase of the diffusion coefficient with the ultra-
sound intensity. Recently, Kang et al. (2016) evaluated the effects of ultrasound
intensity and salt concentration of brining for accelerating brine transfer into
beef. The results of the diffusion coefficient study showed that ultrasound
intensity could significantly improve the diffusion coefficient values of NaCl
and water with best results at an ultrasound intensity of 20.96 W/cm−2.

9.2.3 Pulsed Electric Field

High-intensity PEF treatment is a nonthermal technology, which has dem-
onstrated the ability to inactivate microorganisms, decrease the activity of
enzymes, and extend the shelf life of food products without significantly
affecting the sensorial and nutritional attributes (Barba et al., 2015; Toepfl
et al., 2014). This technology involves the application of short pulses (often
<1 s) of high-intensity electric field (typically 20–80 kV/cm−1) at frequencies
of up to 1000 Hz to foods placed between two electrodes in batch or con-
tinuous system (Mosqueda-Melgar et al., 2008). PEF technology has dem-
onstrated several promising applications and commercial interest for liquid
foods; however, significant challenges have been encountered for solid foods
including meat, hence it has no current commercial application in the meat
industry to date. Although there are limited studies on the effect of PEF on
meat, there are several possible concepts for the application of PEF in meat
and meat products that focus on the permeabilization of cell membranes
leading to microbial inactivation and disruption of the cell structure, which
can be exploited for accelerating mass transfer (e.g., extraction, curing, and
drying). Apart from these, PEF can induce changes in the structure and tex-
ture of meat, potentially improving its functional properties such as tender-
ness, color, and water-holding capacity hence aiding in the development of
new products (Arroyo and Lyng, 2017; Faridnia et al., 2015).
Studies in recent years have shown that PEF treatment can enhance meat
tenderness and quality attributes of beef muscles (Faridnia et al., 2015;
Suwandy et al., 2015a,b). For example, Faridnia et al. (2014) reported that
tenderness and color stability of beef longissimus thoracis muscles are not
affected by PEF (0.2–0.6 kV/cm−1, 1–50 Hz, 20 μs) treatments and a subsequent
vacuum aging. Faridnia et al. (2015) evaluated the effect of freezing as a pre-
treatment prior to PEF treatment (1.4 kV/cm−1, pulse width 20 μs, frequency
304 Advanced Technologies for Meat Processing, Second Edition

50 Hz, and total specific energy 250 kJ/kg) on the quality traits of semitendi-
nosus beef muscle. They observed that the combined freezing–thawing and
PEF resulted in improved tenderness indicated by reduced shear force, while
no differences were found for the fresh PEF-treated samples. Ma et al. (2016)
studied the effects of chilling and freezing prior to PEF treatment on the
volatile profile and sensory attributes of different cooked lamb muscles (i.e.,
shoulder, rib, and loin). Lamb samples were treated at electric field strength
of 1–1.4 kV/cm−1, specific energy of 88–109 kJ/kg−1, frequency of 90 Hz, pulse
width of 20 μs and pulse number of 964. The results showed that prolonged
storage time and frozen-thawed pretreatment led to significant increases in
volatile compounds due to lipid and protein oxidation. PEF also resulted in
significant changes of volatile compounds in different meat cuts. Tempo-
ral dominance of sensations showed that both storage and PEF treatment
affected the temporal flavor of meaty and oxidized flavor attributes. Particu-
larly, a longer storage period was associated with oxidized flavor, while PEF-
treated samples were associated with browned, juicy, livery, and meaty flavor
attributes. Effects of PEF and OMF combination technology on the extension
of supercooled state within chicken breasts were investigated by Mok et al.
(2017). They observed that the PEF + OMF supercooling was highly effective
in the maintenance of original meat qualities without significant physical
damages or chemical changes, which opens up the possibility of advanced
designing of innovative food freezers for long-term preservation of “fresh-
like” foods at subzero temperature.

9.2.4 Cold Plasma Technology

Cold plasma technology (CPT) has shown promise as a decontamination
tool on inert food-contact surfaces, foods, and abiotic surfaces (Klockow and
Keener, 2009; Misra et al., 2011; Niemira, 2012). CPT has numerous potential
applications for the food industry including the disinfection of food surfaces
including meat, poultry, and fresh produce and dry ingredients (Fernandez
et al., 2013; Noriega et al., 2011; Ziuzina et al., 2014). This technology has also
been successfully applied for surface decontamination of packaging material
and for improving functional properties of polymeric materials (Güleç et al.,
2006; Lee et al., 2015; Ozdemir et al., 1999; Pankaj et al., 2014). The antimicro-
bial efficacy of CPT is related to the plasma source, the power level, the gas
mixture used in plasma generation, and duration of exposure. The inactiva-
tion effect of CPT on pathogenic and spoilage microbes pertinent to a range
of foods has been demonstrated extensively. Cold plasma provides inacti-
vation effects through the generation of various reactive species which are
lethal to microbial cells. Reactive oxygen and nitrogen species are the main
species responsible for antimicrobial effects with strong oxidative damages
to cellular components. One of the major mechanisms of action for CPT is
the chemical effects observed through the formation of reactive gas species
(ROS). Gas plasma offers a very effective route to surface disinfection and
Emerging Technologies for the Meat Processing Industry 305

decontamination, benefiting from many of the highly reactive ROS such as

OH radicals, singlet and triplet oxygen, and superoxide. Most of these reac-
tive species interact with water leading to the formation of OH– which are
deleterious to the microbial cells by causing up to 90% of DNA damage and
oxidation of cellular membranes and other cell components (Liao et al., 2017;
Thirumdas et al., 2015). Most of these reactive (gas) species revert back to
original (gas) form within minutes after treatment due to their short half-
life. There are two mechanisms responsible for microbial inactivation: (1)
electrostatic disruption and (2) oxidation or damage of membrane or cellular
components. In most of the cases, plasma treatment causes disintegration of
microbial cells and induces pitting on microbial cells as shown in Figures 9.1
and 9.2.
Plasma technologies offer a range of generation methods (e.g., dielectric
barrier discharge, microwave plasma, pen-type plasma or plasma-treated

Cytosol H2O Exogenous

sources
H2O+
O2 Cytoplasm
H2O Protein
H2O– H• HO2• membrane
H3O– DNA Cell wall
e– e– e–
O2 O2•– H2O2
Reactive and
2H+ H+ H2O
NO• harmful
Endogenous •OH
decomposes
sources ONOO• NO2 + Charged particles
Membrane lipid
Nucleus
and protein

FIGURE 9.1
Dissociation of water molecule into reactive species and microbial inactivation mechanisms of
cold plasma technology in biological and physical aspects.

6 μm 6 μm 6 μm

1 μm 1 μm 1 μm

(a) (b) (c)

FIGURE 9.2
Scanning electron microscopic pictures of Staphylococcus aureus ATCC 12600 on the beef jerky.
(a) Before plasma treatment. (b) After plasma treatment for 5 min. (c) After heat treatment to
70°C for 5 min. (From Kim, J.-S. et al., Innovative Food Science and Emerging Technologies, 22,
124–130, 2014.)
306 Advanced Technologies for Meat Processing, Second Edition

water) and method of product exposure (e.g., in-package, surface treatment),

which can be applied to a range of meat products. Decontamination of fresh
pork using microwave plasma (2.45 GHz, 1.2 kW) has shown to maintain
microbial load in the range of 2–3 log cfu/g during storage at 5ºC for 20 days
with some changes in color (Fröhling et al., 2012). Similar microbial load
reductions for E. coli and L. monocytogenes have been reported for dielectric
barrier plasma treatment of pork loin with input gases of He alone and He +
O2 (Kim et al., 2013). Cold plasma driven by radio frequency using argon as
a feed gas has shown a significant reduction of 3–4 log cfu/g in S. aureus on
the surface of beef jerky after 10 min of treatment time whereas similar log
reductions were observed after 2 min on the surface of polystyrene with no
significant change observed in the fatty acid composition, color, and shear
force of the beef jerky samples (Kim et al., 2014). Table 9.2 shows some recent
examples of plasma-treated meat products demonstrating application of CPT
for the meat industry.
One of the key advantages of the cold plasma technique compared to oth-
ers is the fact that it can cause microbial inactivation within a package. The
effect of in-pack plasma in conjunction with modified atmospheric packag-
ing (MAP) used for common meat products on the inactivation of E. coli,
L. monocytogenes, and S. aureus associated with meat products was investi-
gated by Han et al. (2016). They observed a maximum reduction of 1.5 log
using a high-oxygen atmosphere, while using air and high nitrogen atmo-
spheres yielded lower antimicrobial efficacy. In-package decontamination of
ready-to-eat meat products sealed in linear-low-density polyethylene bags
with 30% O2 was reported to reduce microbial load in the range of 0.8 ±
0.4 to 1.6 ± 0.5 log cfu/g depending on power and treatment time with sig-
nificant increase in thiobarbituric acid reactive substances (TBARS) and loss
of redness value by 70% after a 14-day storage period (Rød et al., 2012). A
study carried out by Wang et al. (2016) showed that no significant differences
were observed in mesophiles, psychrophiles, and pseudomonas counts for
plasma-treated (80 kV for 180 s) chicken fillets packed in food trays contain-
ing air and control, whereas a significant reduction in spoilage microbes
were observed for plasma-treated chicken fillets packed in modified atmo-
sphere (MA) gas (O2:CO2:N2 = 65:30:5).
Studies have shown that the cold plasma technique can be employed for
decontamination of meat surfaces, which poses significant food safety chal-
lenges. Numerous reactive chemical species formed during plasma depend-
ing on the gas composition. These short-lived reactive species not only
have antimicrobial effects but may also cause oxidation of macromolecules
leading to alteration of sensory and nutritional properties. CPT has shown
to cause lipid oxidation in plasma-treated bresaola (Rød et al., 2012), raw
pork, and beef (Jayasena et al., 2015). Generally, high plasma power, treat-
ment time, storage conditions posttreatments, and lipid content of meat are
some key factors which govern the rate of lipid oxidation in meat products.
Oxidation of lipids is mainly attributed to the formation of highly reactive
Emerging Technologies for the Meat Processing Industry 307

TABLE 9.2
Application of Cold Plasma Technology for Meat Processing
Application Processing Conditions Salient Findings References

Microbial Dielectric barrier 2–3 log cfu/g Yong et al. (2017)

inactivation discharge using a reduction; no
of beef jerky bipolar square significant changes in
waveform voltage at the metmyoglobin
15 kHz; ambient air; content, shear force,
treatment and myofibrillar
time: 0–10 min fragmentation index;
some changes in
sensorial properties of
plasma-treated beef
jerky samples
Shelf life of Plasma treatment (80 kV Improved microbiologi- Wang et al. (2016)
chicken fillets for 3 min) in air or cal shelf life of
modified atmosphere plasma-treated
gas samples in modified
(O2:CO2:N2 = 65:30:5) atmosphere
and stored at 4°C after No significant
treatment differences in the
surface L* value
regardless of the
treatment
Nitrate Plasma-treated water No significant Jung et al. (2015)
reduction in differences in total
emulsion- aerobic count, color,
type sausages peroxide value, and
sensory qualities
between control
(sodium nitrate) and
plasma-treated water
for the manufacture of
emulsion-type
sausage
Pork loins Dielectric barrier He + O2 showing Kim et al. (2013)
discharge plasma higher efficiency of
(3 kV, 30 kHz bipolar microbial reduction
square wave) with when compared to He
input gases He and alone
He + O2 Higher inactivation
Treatment time up to with longer treatment
10 min time for Listeria
monocytogenes and
Escherichia coli; higher
TBARS values for
He + O2; significant
differences in sensory
quality
TBARS, thiobarbituric acid reactive substances.
308 Advanced Technologies for Meat Processing, Second Edition

oxidative species formed during plasma treatment. CPT has shown that the
use of nitrates can be avoided by the application of plasma-treated water
in the manufacture of emulsion-type sausages cured with plasma-treated
water. Sausages prepared using plasma-treated water as a nitrite source in
curing process or synthetic sodium nitrite at a concentration of nitrite ion
70 mg/kg did not show any noticeable effects on the total aerobic bacterial
counts, color, and peroxide values of sausages compared with those with
sodium nitrite throughout 28 days of storage at 4°C. Further, sausage with
added plasma-treated water had lower concentrations of residual nitrite
compared to sodium nitrite during the storage period (Jung et al., 2015).
Mutagenicity using the Ames test and immune toxicity studies with 8-week-
old female mice of emulsion-type sausage cured with plasma-treated water
showed negative results thus demonstrating that the plasma-treated water
can be a suitable replacement for sodium nitrite for meat products (Kim et
al., 2016).
Studies have shown that plasma technologies can improve microbial
safety profile of meat and can extend microbiological shelf life of meat
products. However, higher power and treatment times required to enhance
microbial load reduction in meat products may cause undesirable changes
in nutritional and eating quality of meat. These undesirable changes are
mainly associated with lipid oxidation, changes in color, and development of
odor. Limited studies have demonstrated the effect of plasma on nutritional
and sensorial quality of plasma-treated meat products. Further studies are
required to establish the commercial viability of CPT for surface decontami-
nation or meat product applications.

9.2.5 Light-Based Technologies

Light-based technologies are reported and described with several synonyms
including pulsed light (PL), high-intensity pulsed light (HIPL), intense light
pulse (ILP), pulsed white light (PWL), and pulsed ultraviolet light (P-UV). In
some cases, these are also described and reported based on the wavelength
employed within the electromagnetic spectrum. Apart from physicochemi-
cal properties of the food, the efficacy of light-based technologies strongly
depends on various factors including wavelength, pulsing, treatment dura-
tion, and energy (fluence, J/cm−2) as shown in Figure 9.3 (Heinrich et al., 2016).
Within the food industry, ultraviolet (UV) light wavelengths in the range of
10–400 nm have been shown effective against various pathogenic and spoilage
microorganisms pertinent to food. UV light can be classified in three differ-
ent regions depending on the wavelength or penetration power: UV-A, UV-B,
and UV-C range from 315–400 nm, 280–315 nm, and 200–280 nm, respectively.
Among these classifications, UV-C is very effective for inactivation of various
pathogenic and spoilage microorganisms. PL (combined visible and UV pho-
tons at energies up to 50 J/cm−2) has a broad spectrum of wavelength in the
range of 170–1000 nm. Compared to UV light, PL has higher intensity. Infrared
Emerging Technologies for the Meat Processing Industry 309

Treatment
Food matrix Microbial load conditions

Opacity or Type of
transparency microorganisms Wavelength and dose

Surface characteristics Extrinsic control

Intrinsic conditions
and topography parameters

Composition Growth parameters Geometry and setup

FIGURE 9.3
Various factors affecting efficacy of light-based technologies. Light-based technolo-
gies have been reported for surface decontamination of fresh-cut meat surfaces as well as
ready-to-eatmeat products (see Table 9.3).

radiations have wavelengths in range of 750 nm to 1 mm, which can be classi-

fied in three spectral regions based on wavelength, namely near infrared (NIR,
0.75–1.4 μm), mid-infrared (MIR, 1.4–3.0 μm), and far-infrared (FIR, 3–1000 μm),
respectively.
Light-based technologies including UV light, PL, and infrared irradiations
are nonthermal with mild thermal character. These techniques find applica-
tions in meat processing for improving the safety profile of meat and ready-
to-eat meat products. Light-based technologies are of particular interest for
decontamination of meat products and surfaces as they do not require potable
water to achieve desired microbial safety. One of the key advantages of light-
based technologies is that they can be easily applied to the processing line
after thermal treatment, for example, after slicing of cooked ham where post-
cooking contamination can be eliminated prior to packaging. Compared to
other novel technologies, the application of light-based technologies seems to
be legally placed in better position at least in the United States because of its
approval in the production, processing, and handling of food and food-contact
surfaces for the control of surface microorganisms, provided that the treat-
ment uses a xenon lamp with emission wavelengths between 200 and 1000
nm, with a pulse width not exceeding 2 ms, and the cumulative level of treat-
ment does not exceed 12 J/cm−2 (21 CFR 179.41, issued by the Food and Drug
Administration, US FDA, 2005) (Rajkovic et al., 2010a). Whereas, in the EU,
310 Advanced Technologies for Meat Processing, Second Edition

according to EC 258/97, novel technologies require evidence to prove that new

technologies do not alter nutritional composition of treated foods. Research
carried out to date shows minimal or no changes in nutritional composition of
food treated with light-based technologies.
UV light in the range of 200–280 nm (UV-C) has been used primarily for
decontamination of food surfaces and causes microbial inactivation that
is mainly due to photochemical, photothermal, or photophysical effects,
which include chemical modification of proteins and DNA. The formation
of 6,4-photoproducts and cyclobutane pyrimidine dimers in their DNA,
alteration of cellular components, and preventing cells from replicating are
key mechanisms associated with microbial inactivation (Anderson et al.,
2000; Krisko and Radman, 2010; Sommers et al., 2017). UV-C light has been
tested to improve the microbial safety and quality of chicken meat (Sommers
et al., 2017), frog meat (Silva et al., 2015), sliced fermented salami (Rajkovic
et al., 2017), and ready-to-eat cured meat products (Ganan et al., 2013)
against pathogenic microorganisms including L. monocytogenes, Salmonella
Typhimurium, and S. aureus. Significant reductions of up to 1.5 and 1.8 log cfu/
cm−2 for L. monocytogenes and S. Typhimurium with a fluence of 11.9 J/cm−2 can
be obtained for ready-to-eat meat products (Ganan et al., 2013). A systematic
review was carried out on the sensory quality of various types of meat and
meat products treated by light-based technologies, including PL, PWL, and
pulsed UV light (Rajkovic et al., 2010b). They concluded that sensory quality
strongly depends on animal species, type of meat product, and dose applied.
Odor followed color is one of the most significant sensory parameters that
are affected by light-based technologies. Light-based technologies have less
impact on sensory quality of dry-cured meat compared to cooked meat
products while fermented meat products are the least influenced.

TABLE 9.3
Application of Light-Based Technologies for Meat Processing
Light-Based
Technologies Application Conditions Salient Findings Reference
PL Fermented Fluence of Listeria monocytogenes, Rajkovic et al.
salami 3–15 J/cm−2 Escherichia coli (2017)
slices Treatment 0157:H7, Salmonella
followed by Typhimurium, and
MAP 80% Staphylococcus aureus
CO2/20% N2 for 2.24, 2.29, 2.25, and
2.12 log cfu/g on the
surface of dry
fermented salami
No significant increase
in lipid oxidation
except for samples
treated at 15 J/cm−2
(Continued)
Emerging Technologies for the Meat Processing Industry 311

TABLE 9.3 (Continued)

Application of Light-Based Technologies for Meat Processing
Light-Based
Technologies Application Conditions Salient Findings Reference

PL treatment Ready-to- Fluence rate of Maximum log Ganan et al.

(30% UV eat 0.7, 2.1, 4.2, reductions between (2013)
light [12% dry-cured 8.4, and 11.9 1.5 and 1.8 cfu/cm−2
UV-C, 10% meat J/cm−2 obtained for both
UV-B, and products microorganisms at
8% UV-A], (salchichón fluence rate of 11.9 J/
30% and loin cm−2
infrared No significant changes
radiation, in sensorial properties
and 40%
visible
light)
UV-C Bullfrog Packed A reduction of 3 log Silva et al.
intensities back meat bullfrog’s back cfu/g for all treat- (2015)
(0.65, 1.04, meat was then ments compared to
and exposed to control
1.68 mW/s/ low
cm−2) (0.65 mW/s/
cm−2),
medium (1.04
mW/s/cm−2),
and high
(1.68 mW/s/
cm−2) UV-C
intensities
over different
time intervals
(60, 100, and
140 s)
Pilot-scale Whole 0.25 J/cm−2 per 0.87–1.43 log (E. coli) Keklik et al.
pulsed UV chicken pulse; 30, 45, Temperature increase (2011)
light system 60, 90, 120, up to 44.1°C;
with two and 180 s; discolorations at high
pairs of distance: 5 energy doses
pulsed UV cm; 3 Hz
lamps
PL (200–1100 Pork 3, 10, or 30 J/ 0.96 log (raw pork) and Nicorescu et al.
nm) cm−2; distance 0.99 log (roast pork) (2014)
3 cm; 1 Temperature increase
Hz/4°C; 15 by 11°C–12°C,
days dose-dependent color
changes of pork;
dose-dependent lipid
peroxidation of
salmon and pork at
high fluencies
(Continued)
312 Advanced Technologies for Meat Processing, Second Edition

TABLE 9.3 (Continued)

Application of Light-Based Technologies for Meat Processing
Light-Based
Technologies Application Conditions Salient Findings Reference
ILPs in range Beef/pork, 1 and 5 pulses; Dose and type of Tomašević
of UV to IR chicken/ 3.4 J/cm−2 per meat-dependent (2015)
turkey and pulse; 0.5 Hz; sensory changes;
deer/ distance: 6 impact on odor of all
rabbit/ and 10 cm; meat; significant
kangaroo discharge sensory deviation of
voltage: 3 kV turkey; color
unaffected in chicken
and rabbit; dose-
dependent discolor-
ation of pork and
turkey meat
PL treatment Cooked 0.7, 2.1, 4.2, 8.4 L. monocytogenes Hierro et al.
(30% UV ham J/cm−2; 0.75–1.78 log (cooked (2011)
light [12% Bologna through PA/ ham) 0.41–1.11 log
UV-C, 10% PE/VA (bologna)
UV-B, and plastic bags/ Low levels of lipid
8% UV-A], aerobic and oxidation and slight
30% vacuum discoloration directly
infrared conditions, after PL exposure; no
radiation, 4°C, up to 54 impact on sensory
and 40% days attributes of cooked
visible ham, negative impact
light) on sensory properties
of bologna at high
fluencies, shelf-life
extension of cooked
ham by 30 days under
vacuum packaging
MAP, modified atmospheric packaging; PL, pulsed light; UV, ultraviolet.

9.3 Conclusions
Various new technologies have been advocated for potential application
across the meat production chain for food safety intervention and meat
product development. Various emerging technologies discussed in this
chapter demonstrates the potential to replace, at least partly, the traditional
embraced techniques for meat processing and preservation, as the industry
seeks to become more environmentally and economically sustainable. Apart
from decontamination, novel technologies can also play an important role in
various operations including drying, cooking, curing, freezing, and packag-
ing with an aim to improve the process efficiency, quality, and nutritional
profile of meat products.
Emerging Technologies for the Meat Processing Industry 313

This chapter identifies a group of selected technologies that have shown sig-
nificant potential for improving shelf life and technological properties of meat
that has emerged during the past few years. These technologies represent a
rapid, efficient, and reliable alternative to improve the quality of meat, but it also
has the potential to develop new products with a unique functionality. Finally,
it is worth noting that while many innovative food processing techniques have
shown good potential for improving the nutritive quality of processed meat, a
significant proportion has not been scaled up for new food applications.
The exact mechanisms of emerging technologies discussed in this chapter
for meat give only a limited amount of information. There are numerous,
complex, and perplexing mechanisms that are proposed. A better under-
standing of the complex physicochemical mechanisms of action and their
effects on the technological and functional properties of meat products
would also contribute to reinforce the commercial viability of these tech-
nologies for the meat industry.

References
Alarcon-Rojo, A., Janacua, H., Rodriguez, J., Paniwnyk, L. and Mason, T. (2015).
Power ultrasound in meat processing. Meat Science, 107, 86–93.
Anderson, J. G., Rowan, N. J., MacGregor, S. J., Fouracre, R. A. and Farish, O. (2000).
Inactivation of food-borne enteropathogenic bacteria and spoilage fungi using
pulsed-light. IEEE Transactions on Plasma Science, 28(1), 83–88.
Arroyo, C. and Lyng, J. G. (2017). Electroprocessing of meat and meat products. In:
Cummins, E. J. and Lyng, J. G. (eds.) Emerging Technologies in Meat Processing:
Production, Processing and Technology. Wiley Blackwell, pp. 103–130.
Barba, F. J., Parniakov, O., Pereira, S. A. et al. (2015). Current applications and new
opportunities for the use of pulsed electric fields in food science and industry.
Food Research International, 77, 773–798.
Barekat, S. and Soltanizadeh, N. (2017). Improvement of meat tenderness by simulta-
neous application of high-intensity ultrasonic radiation and papain treatment.
Innovative Food Science and Emerging Technologies, 39, 223–229.
Butz, P. and Tauscher, B. (2002). Emerging technologies: Chemical aspects. Food
Research International, 35(2), 279–284.
Caraveo, O., Alarcon-Rojo, A. D., Renteria, A., Santellano, E. and Paniwnyk, L. (2015).
Physicochemical and microbiological characteristics of beef treated with high-
intensity ultrasound and stored at 4°C. Journal of the Science of Food and Agricul-
ture, 95(12), 2487–2493.
Cárcel, J., Benedito, J., Bon, J. and Mulet, A. (2007). High intensity ultrasound effects
on meat brining. Meat Science, 76(4), 611–619.
Cárcel, J., Benedito, J., Mulet, A. and Riera, E. (2003). Mass transfer effects during
meat ultrasonic brining. In Proceedings of World Congress on Ultrasonics WCU.
Paris, France, 431–434.
Chemat, F. and Khan, M. K. (2011). Applications of ultrasound in food technology: Pro-
cessing, preservation and extraction. Ultrasonics Sonochemistry, 18(4), 813–835.
314 Advanced Technologies for Meat Processing, Second Edition

Dickens, J., Lyon, C. and Wilson, R. (1991). Effect of ultrasonic radiation on some
physical characteristics of broiler breast muscle and cooked meat. Poultry Sci-
ence, 70(2), 389–396.
Dolatowski, Z. J. and Twarda, J. (2004). Einfluss von Ultraschall auf das Wasserbind-
ungsvermögen von Rindfleisch. Fleischwirtschaft, 84(12), 95–99.
Earnshaw, R., Appleyard, J. and Hurst, R. (1995). Understanding physical inactiva-
tion processes: Combined preservation opportunities using heat, ultrasound
and pressure. International Journal of Food Microbiology, 28(2), 197–219.
Faridnia, F., Bekhit, A. E. D. A., Niven, B. and Oey, I. (2014). Impact of pulsed electric
fields and post-mortem vacuum ageing on beef longissimus thoracis muscles.
International Journal of Food Science and Technology, 49(11), 2339–2347.
Faridnia, F., Ma, Q. L., Bremer, P. J., Burritt, D. J., Hamid, N. and Oey, I. (2015). Effect
of freezing as pre-treatment prior to pulsed electric field processing on quality
traits of beef muscles. Innovative Food Science and Emerging Technologies, 29, 31–40.
Fernandez, A., Noriega, E. and Thompson, A. (2013). Inactivation of Salmonella
enterica serovar Typhimurium on fresh produce by cold atmospheric gas plasma
technology. Food Microbiology, 33(1), 24–29.
Fröhling, A., Durek, J., Schnabel, U., Ehlbeck, J., Bolling, J. and Schlüter, O. (2012). Indi-
rect plasma treatment of fresh pork: Decontamination efficiency and effects on
quality attributes. Innovative Food Science and Emerging Technologies, 16, 381–390.
Ganan, M., Hierro, E., Hospital, X. F., Barroso, E. and Fernández, M. (2013). Use of
pulsed light to increase the safety of ready-to-eat cured meat products. Food
Control, 32(2), 512–517.
Got, F., Culioli, J., Berge, P. et al. (1999). Effects of high-intensity high-frequency ultra-
sound on ageing rate, ultrastructure and some physico-chemical properties of
beef. Meat Science, 51(1), 35–42.
Güleç, H. A., SarIoglu, K. and Mutlu, M. (2006). Modification of food contacting sur-
faces by plasma polymerisation technique. Part I: Determination of hydrophilic-
ity, hydrophobicity and surface free energy by contact angle method. Journal of
Food Engineering, 75(2), 187–195.
Han, L., Ziuzina, D., Heslin, C. et al. (2016). Controlling microbial safety challenges of
meat using high voltage atmospheric cold plasma. Frontiers in Microbiology, 7, 977.
Heinrich, V., Zunabovic, M., Varzakas, T., Bergmair, J. and Kneifel, W. (2016). Pulsed
light treatment of different food types with a special focus on meat: A critical
review. Critical Reviews in Food Science and Nutrition, 56(4), 591–613.
Herceg, Z., Markov, K., Sobota Šalamon, B., Režek Jambrak, A., Vukušić, T. and
Kaliterna, J. (2013). Effect of high intensity ultrasound treatment on the growth
of food spoilage bacteria. Food Technology and Biotechnology, 51(3), 352–359.
Hierro, E., Barroso, E., De la Hoz, L., Ordóñez, J. A., Manzano, S. and Fernández, M.
(2011). Efficacy of pulsed light for shelf-life extension and inactivation of Listeria
monocytogenes on ready-to-eat cooked meat products. Innovative Food Science and
Emerging Technologies, 12(3), 275–281.
Hoover, D. G. (2000). Ultrasound. Journal of Food Science, 65(s8), 93–95.
Jayasena, D. D., Kim, H. J., Yong, H. I. et al. (2015). Flexible thin-layer dielectric bar-
rier discharge plasma treatment of pork butt and beef loin: Effects on pathogen
inactivation and meat-quality attributes. Food Microbiology, 46, 51–57.
Jayasooriya, S., Bhandari, B., Torley, P. and D’arcy, B. (2004). Effect of high power
ultrasound waves on properties of meat: A review. International Journal of Food
Properties, 7(2), 301–319.
Emerging Technologies for the Meat Processing Industry 315

Jayasooriya, S. D., Torley, P., D’arcy, B. R. and Bhandari, B. R. (2007). Effect of high
power ultrasound and ageing on the physical properties of bovine Semitendi-
nosus and Longissimus muscles. Meat Science, 75(4), 628–639.
Jung, S., Kim, H. J., Park, S. et al. (2015). The use of atmospheric pressure plasma-treated
water as a source of nitrite for emulsion-type sausage. Meat Science, 108, 132–137.
Kang, D.-C., Wang, A.-R., Zhou, G.-H., Zhang, W.-G., Xu, S.-M. and Guo, G.-P. (2016).
Power ultrasonic on mass transport of beef: Effects of ultrasound intensity and
NaCl concentration. Innovative Food Science and Emerging Technologies, 35, 36–44.
Keklik, N., Demirci, A. and Bock, R. (2011). Surface decontamination of whole chicken
carcasses using a pilot-scale pulsed UV light system. Transact ASABE, 54, 993–
1000.
Kim, J.-S., Lee, E.-J., Choi, E. H. and Kim, Y.-J. (2014). Inactivation of Staphylococcus
aureus on the beef jerky by radio-frequency atmospheric pressure plasma dis-
charge treatment. Innovative Food Science and Emerging Technologies, 22, 124–130.
Kim, H. J., Sung, N. Y., Yong, H. I. et al. (2016). Mutagenicity and immune toxicity of
emulsion-type sausage cured with plasma-treated water. Korean Journal for Food
Science of Animal Resources, 36(4), 494–498.
Kim, H.-J., Yong, H. I., Park, S., Choe, W. and Jo, C. (2013). Effects of dielectric bar-
rier discharge plasma on pathogen inactivation and the physicochemical and
sensory characteristics of pork loin. Current Applied Physics, 13(7), 1420–1425.
Klockow, P. A. and Keener, K. M. (2009). Safety and quality assessment of packaged
spinach treated with a novel ozone-generation system. LWT-Food Science and
Technology, 42(6), 1047–1053.
Kordowska-Wiater, M. and Stasiak, D. M. (2011). Effect of ultrasound on survival of
gram-negative bacteria on chicken skin surface. Bull Vet Inst Pulawy, 55, 207–210.
Krisko, A. and Radman, M. (2010). Protein damage and death by radiation in Esch-
erichia coli and Deinococcus radiodurans. Proceedings of the National Academy of Sci-
ences, 107(32), 14373–14377.
Lee, T., Puligundla, P. and Mok, C. (2015). Inactivation of foodborne pathogens on the
surfaces of different packaging materials using low-pressure air plasma. Food
Control, 51, 149–155.
Liao, X., Liu, D., Xiang, Q. et al. (2017). Inactivation mechanisms of non-thermal
plasma on microbes: A review. Food Control, 75, 83–91.
Ma, Q., Hamid, N., Oey, I. et al. (2016). Effect of chilled and freezing pre-treatments
prior to pulsed electric field processing on volatile profile and sensory attributes
of cooked lamb meats. Innovative Food Science and Emerging Technologies, 37(Part
C), 359–374.
McDonnell, C. K., Lyng, J. G., Arimi, J. M. and Allen, P. (2014). The acceleration of
pork curing by power ultrasound: A pilot-scale production. Innovative Food Sci-
ence and Emerging Technologies, 26, 191–198.
Misra, N., Tiwari, B., Raghavarao, K. and Cullen, P. J. (2011). Nonthermal plasma
inactivation of food-borne pathogens. Food Engineering Reviews, 3(3–4), 159–170.
Mok, J. H., Her, J. -Y., Kang, T., Hoptowit, R. and Jun, S. (2017). Effects of pulsed elec-
tric field (PEF) and oscillating magnetic field (OMF) combination technology
on the extension of supercooling for chicken breasts. Journal of Food Engineering,
196, 27–35.
Morild, R. K., Christiansen, P., Sørensen, A. H., Nonboe, U. and Aabo, S. (2011). Inac-
tivation of pathogens on pork by steam-ultrasound treatment. Journal of Food
Protection, 74(5), 769–775.
316 Advanced Technologies for Meat Processing, Second Edition

Mosqueda-Melgar, J., Elez-Martinez, P., Raybaudi-Massilia, R. M., and Martin-Belloso,

O. (2008). Effects of pulsed electric fields on pathogenic microorganisms of
major concern in fluid foods: A review. Critical Reviews in Food Science and Nutri-
tion, 48(8), 747–759.
Musavian, H. S., Krebs, N. H., Nonboe, U., Corry, J. E. and Purnell, G. (2014). Com-
bined steam and ultrasound treatment of broilers at slaughter: A promising
intervention to significantly reduce numbers of naturally occurring campylo-
bacters on carcasses. International Journal of Food Microbiology, 176, 23–28.
Nicorescu, I., Nguyen, B., Chevalier, S. and Orange, N. (2014). Effects of pulsed light
on the organoleptic properties and shelf-life extension of pork and salmon. Food
Control, 44, 138–145.
Niemira, B. A. (2012). Cold plasma decontamination of foods. Annual Review of Food
Science and Technology, 3, 125–142.
Noriega, E., Shama, G., Laca, A., Díaz, M. and Kong, M. G. (2011). Cold atmospheric
gas plasma disinfection of chicken meat and chicken skin contaminated with
Listeria innocua. Food Microbiology, 28(7), 1293–1300.
Ozdemir, M., Yurteri, C. U. and Sadikoglu, H. (1999). Physical polymer surface modi-
fication methods and applications in food packaging polymers. Critical Reviews
in Food Science and Nutrition, 39(5), 457–477.
Pagán, R., Manas, P., Alvarez, I. and Condón, S. (1999a). Resistance of Listeria mono-
cytogenes to ultrasonic waves under pressure at sublethal (manosonication) and
lethal (manothermosonication) temperatures. Food Microbiology, 16(2), 139–148.
Pagán, R., Manas, P., Raso, J. and Condón, S. (1999b). Bacterial resistance to ultrasonic
waves under pressure at nonlethal (manosonication) and lethal (manothermo-
sonication) temperatures. Applied and Environmental Microbiology, 65(1), 297–300.
Pankaj, S. K., Bueno-Ferrer, C., Misra, N. et al. (2014). Applications of cold plasma
technology in food packaging. Trends in Food Science and Technology, 35(1), 5–17.
Pathak, V., Singh, V. and Sanjay, Y. (2011). Ultrasound as a modern tool for carcass
evaluation and meat processing: A review. International Journal of Meat Science,
1(2), 83–92.
Piyasena, P., Mohareb, E. and McKellar, R. (2003). Inactivation of microbes using
ultrasound: A review. International Journal of Food Microbiology, 87(3), 207–216.
Rajkovic, A., Smigic, N. and Devlieghere, F. (2010a). Contemporary strategies in com-
bating microbial contamination in food chain. International Journal of Food Micro-
biology, 141(Supplement 1), S29–S42.
Rajkovic, A., Tomasevic, I., De Meulenaer, B. and Devlieghere, F. (2017). The effect of
pulsed UV light on Escherichia coli O157:H7, Listeria monocytogenes, Salmonella
Typhimurium, Staphylococcus aureus, and staphylococcal enterotoxin A on sliced
fermented salami and its chemical quality. Food Control, 73(Part B), 829–837.
Rajkovic, A., Tomasevic, I., Smigic, N., Uyttendaele, M., Radovanovic, R. and Dev-
lieghere, F. (2010b). Pulsed UV light as an intervention strategy against Listeria
monocytogenes and Escherichia coli O157:H7 on the surface of a meat slicing knife.
Journal of Food Engineering, 100(3), 446–451.
Rød, S. K., Hansen, F., Leipold, F. and Knøchel, S. (2012). Cold atmospheric pres-
sure plasma treatment of ready-to-eat meat: Inactivation of Listeria innocua and
changes in product quality. Food Microbiology, 30(1), 233–238.
Silva, H., Costa, M., Frasao, B. et al. (2015). Efficacy of ultraviolet-C light to eliminate
Staphylococcus aureus on precooked shredded bullfrog back meat. Journal of Food
Safety, 35(3), 318–323.
Emerging Technologies for the Meat Processing Industry 317

Siró, I., Vén, C., Balla, C., Jónás, G., Zeke, I. and Friedrich, L. (2009). Application of
an ultrasonic assisted curing technique for improving the diffusion of sodium
chloride in porcine meat. Journal of Food Engineering, 91(2), 353–362.
Sommers, C., Sheen, S., Scullen, O. J. and Mackay, W. (2017). Inactivation of Staphylo-
coccus saprophyticus in chicken meat and purge using thermal processing, high
pressure processing, gamma radiation, and ultraviolet light (254 nm). Food Con-
trol, 75, 78–82.
Stadnik, J. and Dolatowski, Z. J. (2011). Influence of sonication on Warner-Bratzler
shear force, colour and myoglobin of beef (m. semimembranosus). European
Food Research and Technology, 233(4), 553.
Suwandy, V., Carne, A., van de Ven, R., Bekhit, A. E.-D. A. and Hopkins, D. L. (2015a).
Effect of pulsed electric field on the proteolysis of cold boned beef M. Longis-
simus lumborum and M. Semimembranosus. Meat Science, 100, 222–226.
Suwandy, V., Carne, A., van de Ven, R., Bekhit, A. E.-D. A. and Hopkins, D. L. (2015b).
Effect of pulsed electric field treatment on hot-boned muscles of different poten-
tial tenderness. Meat Science, 105, 25–31.
Thirumdas, R., Sarangapani, C. and Annapure, U. S. (2015). Cold plasma: A novel
non-thermal technology for food processing. Food Biophysics, 10(1), 1–11.
Toepfl, S., Siemer, C., Saldaña-Navarro, G. and Heinz, V. (2014). Overview of pulsed
electric fields processing for food. In: Sun, D.-W. (ed.) Emerging Technologies for
Food Processing (2nd Ed). San Diego, CA: Academic Press, pp. 93–114.
Tomašević, I. (2015). The effect of intense light pulses on the sensory quality and
instrumental color of meat from different animal breeds. Biotechnology in Animal
Husbandry, 31(2), 273–281.
Turantaş, F., Kılıç, G. B. and Kılıç, B. (2015). Ultrasound in the meat industry: General
applications and decontamination efficiency. International Journal of Food Micro-
biology, 198, 59–69.
Wang, J. M., Zhuang, H., Hinton, A. and Zhang, J. H. (2016). Influence of in-package
cold plasma treatment on microbiological shelf life and appearance of fresh
chicken breast fillets. Food Microbiology, 60, 142–146.
Xiong, G., Zhang, L., Zhang, W. and Wu, J. (2012). Influence of ultrasound and proteo-
lytic enzyme inhibitors on muscle degradation, tenderness, and cooking loss of
hens during aging. Czech Journal of Food Sciences, 30(3), 195–205.
Yong, H. I., Lee, H., Park, S. et al. (2017). Flexible thin-layer plasma inactivation of
bacteria and mold survival in beef jerky packaging and its effects on the meat’s
physicochemical properties. Meat Science, 123, 151–156.
Zayas, J. and Orlova, T. (1970). The application of ultrasonic vibrations for tenderisa-
tion of meat. Izvestia vysshykh unhebnykh zavedeniy, 4, 54–56.
Zhao, Y.-Y., Wang, P., Zou, Y.-F. et al. (2014). Effect of pre-emulsification of plant lipid
treated by pulsed ultrasound on the functional properties of chicken breast
myofibrillar protein composite gel. Food Research International, 58, 98–104.
Ziuzina, D., Patil, S., Cullen, P. J., Keener, K. and Bourke, P. (2014). Atmospheric cold
plasma inactivation of Escherichia coli, Salmonella enterica serovar Typhimurium
and Listeria monocytogenes inoculated on fresh produce. Food Microbiology, 42,
109–116.
10
Reduction of Contaminant Content
in Processed Meats

Peter Šimko

CONTENTS
10.1 Introduction ................................................................................................ 320
10.2 Polycyclic Aromatic Hydrocarbons ......................................................... 320
10.2.1 Characterization of Polycyclic Aromatic Hydrocarbons.......... 320
10.2.2 Formation of PAHs during Meat Processing ............................. 321
10.2.2.1 Smoking ............................................................................ 321
10.2.2.2 Grilling ............................................................................. 324
10.2.3 Effect of PAHs on Living Organisms.......................................... 325
10.2.4 Legislative Aspects and International Normalization
of PAHs in Smoked Meat and Liquid Smoke
Flavors ............................................................................................. 326
10.2.5 Occurrence of PAHs in Smoked Meats ....................................... 328
10.2.6 Reduction of PAH Concentrations in LSFs ................................ 329
10.2.6.1 Characterization of Physicochemical Processes
Taking Place between Liquid Media and LDPE ......... 335
10.2.7 Reduction of PAH Content in Processed Meats ........................ 339
10.2.7.1 Reduction of PAH Content during Smoking .............. 339
10.2.7.2 Reduction of PAH Content by Their
Photodecomposition .......................................................340
10.2.7.3 Reduction of PAH Content by Cooking of Smoked
Sausages............................................................................342
10.2.7.4 Reduction of PAH Content in Roasted Duck by
Packaging into LDPE ......................................................344
10.2.7.5 Reduction of PAH Content in Smoked Sausages
by Packaging into LDPE.................................................344
10.3 General Conclusions..................................................................................348
Acknowledgment ................................................................................................349
References............................................................................................................. 349

319
320 Advanced Technologies for Meat Processing, Second Edition

10.1 Introduction
Meat is an important source for protein including essential amino acids,
fat, minerals, vitamins, and other functional nutrients (Biesalski, 2005), and
therefore it has been consumed by man to ensure his fundamental nutri-
tional needs, which—finally—has led to the development of modern man-
kind. There is no doubt that the occasional surplus of meat obtained from
hunted animals had become in the past a base for development of simple
preservation procedures (such as drying, smoking, salting, fermentation,
etc.), which made it possible for mankind to survive unfavorable times.
Although up-to-date meat processing procedures are based on current
scientific and professional knowledge, the contamination of processed meat
products is still a serious problem due to the fact that some compounds, espe-
cially those highly harmful to human health, are being formed permanently
in the meat matrix during its processing. Therefore, there is a strong interest
to find prevention procedures which could lead to minimization of contami-
nant formation during meat processing and storage, or look for and apply
procedures to eliminate formed contaminants from final products, respec-
tively. Thus, this chapter deals with modern procedures which decrease con-
taminant content in processed meats to ensure that human exposure to these
compounds is as low as possible.

10.2 Polycyclic Aromatic Hydrocarbons

10.2.1 Characterization of Polycyclic Aromatic Hydrocarbons
Polycyclic aromatic hydrocarbons (PAHs) are organic compounds contain-
ing only hydrogen and carbon elements in a molecule, consisting of two or
more condensed aromatic rings linked together, either cataannellated (lin-
early or angularly) or pericondensed. Catacondensed PAHs are alternant
systems containing only six-membered rings and closed shell systems, with
all bonding orbitals occupied by two electrons. The entire group of cata-
condensed PAHs can be further divided into branched and nonbranched
systems. Branched systems are thermodynamically more stable and chemi-
cally less reactive than nonbranched systems of the same size. Conversely,
pericondensed PAHs are either closed shell systems or neutral free orbitals,
in which at least one electron is in a nonbonding orbital. Free radicals of this
type are stable only if the systems have an odd number of carbon atoms.
In addition, pericondensed PAHs can be further divided into alternant and
nonalternant, depending on the presence of five- or six-membered rings in
the molecule (Guillén, 1994). PAHs have a strong lipophilic character and
therefore they have a tendency to migrate into adipose tissue or nonpolar
Reduction of Contaminant Content in Processed Meats 321

parts of meat products (Šimko et al., 1993). In general, the stability of PAHs
depends on environmental conditions and they are, in general, relatively
stable in the dark. However, light catalyzes their decomposition by oxida-
tion reactions, which happens especially in ultraviolet (UV) light condi-
tions; therefore photodecomposition is a main route of PAH degradation
in the environment (Skláršová et al., 2012), when numerous intermediate
oxy- and hydroxy compounds are being formed (Bednáriková et al., 2011).

10.2.2 Formation of PAHs during Meat Processing

10.2.2.1 Smoking
In general, smoke is a polydisperse mixture of liquid and solid components
with a diameter of 0.08–0.15 μm in gaseous phase of air, carbon oxide, carbon
dioxide, water vapor, methane, and other gases. Smoke has a variable com-
position that depends on various conditions such as procedure and tempera-
ture of smoke generation, origin and composition of wood, water content in
wood, etc. (Sikorski, 2004). So far, up to 1100 various chemical compounds
have been identified and published in literature (Wilms, 2000). The smok-
ing treatment itself is based on successive deposition of compounds such as
phenol derivatives, carbonyls, organic acids, and their esters, lactones, pyr-
azines, pyrols, and furan derivatives on the food surface with their subse-
quent migration into the food bulk (Maga, 1987). Smoke is generated during
thermal combustion of wood, consisting roughly of 50% cellulose, 25% hemi-
cellulose, and 25% lignin, with limited access to oxygen. The thermal com-
bustion of these wood components proceeds at 180°C–300°C, 260°C–350°C,
and 300°C–500°C, respectively. However, the decomposition of the wood (as
a whole) proceeds also at temperatures reaching up to 900°C and in large
excess of oxygen even at 1200°C. The smoke produced at 650°C–700°C is
richest in components able to impart desirable organoleptic properties to the
treated products. The temperature of generation of smoke can be decreased
by increasing the humidity of woods (Tóth, and Potthast, 1984; Šimko, 2005).
Apart from the compounds mentioned above, many other compounds are
also formed during smoke generation. One of the most important groups
which is harmful to human health is PAHs. These are being formed during
the thermal decomposition of wood, especially with limited access of oxygen
in the range of 500°C–900°C (Bartle, 1991).
A mechanism of PAH formation based on reactions with stable and radi-
cal species, including single-ring aromatics, other PAHs, and acetylene, fol-
lowed by the nucleation or inception of small soot particles with subsequent
soot growth by coagulation and mass addition from gas phase species, and
carbonization of the particulate materials, is generally accepted (Richter and
Howard, 2000). A rough scheme of PAH formation during thermal combus-
tion of organic matter is shown in Figure 10.1. During the formation of sin-
gle aromatic rings, propargyl (C3H3) and cyclopentadienyl (C5H5) radicals
322 Advanced Technologies for Meat Processing, Second Edition

50 nm
Coagulation

Surface growth and

coagulation

Particle inception
Particle zone
Reaction time

0.5 nm

Molecular zone
CO2 H2O
CO H2

O2
Fuel and oxidizer (premixed)

FIGURE 10.1
Simplified scheme of PAH formation during thermal combustion of organic matter. (Reprinted
from Prog. Energy Combust. Sci., 26, Richter, H. and Howard, J. B., Formation of polycyclic
aromatic hydrocarbons and their growth to soot—A review of chemical reaction pathways,
565–608. Copyright 2000 with permission from Elsevier.)

play a significant role, as follows from Figures 10.2 and 10.3 (McEnally et al.,
2006). The temperature of smoke generation plays a decisive role because
the amount of PAHs contained in smoke increases linearly with the tem-
perature of smoke generation in the range of 400°C–1000°C (Tóth, and Blaas,
1972). Apart from the formation itself, the temperature also affects struc-
ture and number of PAH homologues. For example, the number of PAHs
presented in smoked fish can reach the value of 100 various compounds
(Grimmer and Böhnke, 1975).
To achieve a rich deep-brown coloring on the surface and very strong
aroma profile formation of smoked meat products, the time of smoking is
considerably prolonged (Šimko, 2011). Such products are frequently termed
as “black-smoked” or “farmhouse smoked,” respectively. However, these
products also have higher contents of PAHs (Šimko et al., 1991; Roda et al.,
1999; Wilms, 2000). “Wild” or direct smoking under uncontrolled techno-
logical conditions, or at nonexisting legislative measures, which is typical,
Reduction of Contaminant Content in Processed Meats 323

H H H H H
C C C C + C C *
*
(n-C4H3) (Acetylene) (Phenyl)

H H H H H H
C C C C + C C + H
H *
(n-C4H5) (Acetylene) (Benzene)

H H H H
C C C + C C C
H * * H
(Propargyl) (Propargyl) (Benzene)

FIGURE 10.2
Schematic diagrams of three important reactions that form single-ring aromatic hydrocarbons
from aliphatic hydrocarbons. (Reprinted from Progress in Energy and Combustion Science, 32,
McEnally, C. S. et al., Studies of aromatic hydrocarbon formation mechanisms in flames: Prog-
ress towards closing the fuel gap, 247–294. Copyright 2006 with permission from Elsevier.)

H *
C C H H
+ C C
*
(2-Ethynylphenyl) (Acetylene) (Naphthyl)

H H H
C * + C C C + 2H
H * H
(Benzyl) (Propargyl) (Naphthalene)

* *
+ + 2H

(Cyclopentadienyl) (Cyclopentadienyl) (Naphthalene)

FIGURE 10.3
Schematic diagrams of three important reactions that form two-ring aromatic hydrocarbons
from single-ring aromatic and aliphatic hydrocarbons. (Reprinted from Progress in Energy
and Combustion Science, 32, McEnally, C. S. et al., Studies of aromatic hydrocarbon formation
mechanisms in flames: Progress towards closing the fuel gap, 247–294. Copyright 2006 with
permission from Elsevier.)

especially, for households and developing countries, leads to enormous PAH

contents in smoked foods (Afolabi et al., 1983; Alonge, 1987, 1988; Wretling
et al., 2010; Fasano et al., 2016).
324 Advanced Technologies for Meat Processing, Second Edition

A relatively new alternative to traditional smoking is aromatization

of foods by liquid smoke flavorings (LSFs). It was in the late 1800s when
Kansas pharmacist Ernest H. Wright developed and patented a liquid
smoke flavor prepared from smoke condensate. More recently, the devel-
opment of aqueous smoke condensates, also known as “liquid smoke,” has
resulted in the widespread use of LSFs in many food products to reach the
same smoke organoleptic profiles. Today, LSFs are being added to a great
variety of products including all forms of meat products (Emmerson, 2011).
A main advantage of LSF application lies in the fact that LSFs contaminate
meat products far less in comparison to meat products aromatized by tra-
ditional procedures because PAHs are removed effectively from smoke
condensates during LSF production and therefore real contamination is
frequently bellow detection limits (Šimko et al., 1992).

10.2.2.2 Grilling
A formation of PAHs during charcoal broiling of beef steaks was
observed for the first time by Lijinsky and Shubik (1964) when average
benzo[a]pyrene (BaP) content was found at the level of 8 μg/kg. Later,
Lijinsky and Ross (1967) revealed that PAHs could be formed during
the pyrolysis of the fat that drips down on the hot coals. Larsson et al.
(1983) grilled frankfurters over various heat sources such as log fire, log
fire embers, cone fire, charcoal fire, electric oven, and frying pan. They
found that grilling over log fire resulted in extremely high PAH levels,
up to 212 μg/kg BaP. When the grilling was carried out over the embers,
the average level of BaP was only 7.7 μg/kg. Relatively high PAHs levels
(an average of 17.6 μg of BaP μg/kg) were found in frankfurters grilled
over smoldering spruce or pine cones. The BaP levels in charcoal-grilled
frankfurters did not exceed 1 μg/kg, whereas charcoal-grilled whole
meat samples contained 2.3–6.1 μg/kg probably due to the fact that the
fat in frankfurters is not “free, but locked” in an oil/water type of emul-
sion system, and therefore release of fat in comparison to muscle meat is
less possible (Šimko and Knežo, 1992). The lowest formation of PAH was
observed during application of electric oven and frying pan. Application
of indirect sources of heat as an effective tool for minimization of PAH
content has also been confirmed by Farhadian et al. (2011) using two dif-
ferent types of treatments, preheating (steam and microwave) and wrap-
ping (aluminum and banana leaf) of the meat samples prior to charcoal
grilling. Apart from fat, there are also other precursors of PAHs such as
ergosterol (Cai et al., 2008) and steroid hormones (androsterone, choles-
terol, estrone, and estradiol) which are prone to decompose in the thermal
range 300°C–900°C and provide substantial amounts of PAHs (Christy et
al., 2011). A possible method of PAH formation from cholesterol is shown
in Figure 10.4.
Reduction of Contaminant Content in Processed Meats 325

HO
H
Cholesterol Cholesta-3,5-diene 4-Methyl fluorence

C
C
H

Phenanthrene 2-Methyl phenanthrene

FIGURE 10.4
The pathways of formation from cholesterol to phenanthrene, methylphenanthrene, fluorine,
and methylfluorene. (Reprinted from Food Chemistry, 124, Christy, A. A. et al., Pyrolytic forma-
tion of polyaromatic hydrocarbons from steroid hormones, 1466–1472. Copyright 2011 with
permission from Elsevier.)

10.2.3 Effect of PAHs on Living Organisms

The fact that chemicals could cause cancer arose from the observations
of Percival Pott of St. Bartholomew’s Hospital in London in 1775 when he
had noted high incidence of cancer of the scrotum among chimney sweep-
ers who often had to climb up inside chimneys to sweep the soot down.
Although he deduced correctly that the soot was responsible for the can-
cer, in this time, it was not possible to find out the compounds responsible
for such serious tissue damage. In 1920, Japanese workers discovered that
painting extracts of soot onto the skin of mice caused tumors of the skin. In
1929, the first pure chemical carcinogenic compound—dibenzo[a,h]pyrene
(DBa,hP)—was isolated from soot extracts at Chester Beatty Research
Institute by Kennaway. In 1953, Doll, on the basis of wide epidemiological
and statistical analysis, proved that cigarette smoking was a prime cause
of lung cancer. Careful analysis of the smoke and tar obtained from ciga-
rettes showed that it contained many carcinogenic PAHs from which BaP
was assessed as the most dangerous compound (Šimko, 2002). According
to current knowledge, some PAHs are able to interact in organisms with
enzymes (such as aryl hydrocarbon hydroxylases) to form PAH dihydro-
diol derivates. These reactive products (so-called “bay region” dihydro-
diol epoxides) are believed to be the ultimate carcinogens that are able
to form covalently bounded adducts with proteins and nucleic acids. In
general, DNA adducts are thought to initiate cell mutation which results
326 Advanced Technologies for Meat Processing, Second Edition

in malignancy (Bartle, 1991). The direct mutagenic potential of 14 PAHs

and PAH-containing fractions isolated from smoked and charcoal broiled
samples was studied toward strains TA 98 and TA 100 using the Ames
test. The most potential mutagenicity was observed on PAH fractions iso-
lated from smoked fish, treated before smoking with nitrites in an acid
solution (Kangsadalampai et al., 1997). While various compounds have dif-
ferent carcinogenic effects to living organisms, there have been attempts
to express objectively the real risk of PAH exposition using so called toxic
equivalency factors (Nisbet and La Goy, 1992). On the basis of data from
more than 800 epidemiological studies that investigated the association of
cancer with consumption of red meat or processed meat (processed means
cured, fermented, and smoked), in many countries from several continents,
with diverse ethnicities and diets, it was stated that consumption of 50 g
processed meat per day can increase risk of colorectal cancer incidence by
18%. Therefore, the Working Group of International Agency for Research
on Cancer (IARC) classified processed meat as “carcinogenic to humans”
and added it to group 1, which includes dangerous compounds such as
aflatoxins, benzene, asbestos, vinyl chloride, etc. (Bouvard et al., 2015).

10.2.4 Legislative Aspects and International Normalization of

PAHs in Smoked Meat and Liquid Smoke Flavors
With regard to the information regarding the harmful effects of PAHs on
living organisms, some European countries (e.g., Germany, Slovak Repub-
lic, Czech Republic) have enacted maximum limits of these compounds
in smoked meat products at different levels in the past. To simplify such
problems associated with the variability of PAH occurrence, BaP had been
accepted, in general, as the indicator of total PAH presence in smoked foods,
even in spite of the fact that BaP constitutes only between 1% and 20% of
the total carcinogenic PAHs (Andelman and Suess, 1970). To unify approach
to assessment of PAHs in food products in the European Union (EC,2002),
the European Commission (EC) adopted the limitation of BaP content at
a level of 5 μg/kg in smoked meats, smoked meat products, muscle meat
of smoked fish, and smoked fishery products (Commission Regulation,
1881/2006/EC). Apart from this, the EC has also adopted either Directive
2005/10/EC laying down the sampling methods and the methods of analy-
sis for the official control of BaP levels in foodstuffs (Commission Directive,
2005/10/EC), or Recommendation 2005/108/EC on the further investigation
into the levels of PAHs in certain foods such as benzo[a]anthracene (BaA),
benzo[b]fluoranthene (BbF), benzo[j]fluoranthene (BjF), benzo[k]fluoranthene
(BkF), benzo[g,h,i]perylene (Bg,h,iP), chrysene (Chr), BaP, cyclopenta[c,d]
pyrene (Cc,dP), DahA, dibenzo[a,e]pyrene (DBa,eP), DBa,hP, dibenzo[a,i]
pyrene (DBa,iP), dibenzo[a,l]pyrene (DBa,lP), indeno[1,2,3-cd]pyrene (IcdP),
and 5-methylchrysene (Commission Recommendation, 2005/108/EC). More-
over, the Joint FAO/WHO Expert Committee on Food Additives (JECFA) has
Reduction of Contaminant Content in Processed Meats 327

defined another compound benzo[c]fluorene (BcF), which should also be

monitored with regard to its effects to living organisms (Report of the Joint
FAO/WHO Expert Commission on Food Additives, 2005). Structural formu-
las of these compounds are shown in Table 10.1. Later, Commission Direc-
tive 2005/10/EC was replaced by Commission Regulation (EC) No 333/2007
and this document has been amended by Commission Regulation (EC) No
836/2011 (Suranová et al., 2015).
On the basis of a comprehensive survey of PAH presence in foods, the
European Food Safety Authority (2008) proposed—apart from BaP—also
to include other reference compounds, such as BaA, Chr, and BbF. Conse-
quently, either maximum content of BaP or a sum of all four compounds
called “PAH4” were established by the European Commission’s Regulation
No. 835/2011a, b for smoked, heat-treated meat and meat products. Limits
relating to processed meat are shown in Table 10.2.
Concerning LSFs, the EC has adopted Regulation 2065/2003 relating to
the production of smoke flavorings intended to be used for food flavoring
(Commission Regulation, 2065/2003/EC). This regulation has limited the
maximum acceptable concentrations of BaP at 10 μg/kg and BaA at 20 μg/kg
in LSFs. Following in this course, the EC recently established the EU list of

TABLE 10.1
Structural Formulas of PAHs Listed in the Recommendation of EC No. 2005/108/
EC and Benzo[c]Fluorene set by JECFA

Benzo[a]pyrene Benzo[a]anthracene Chrysene Benzo[b]fluoranthene

Benzo[k]fluoran- Cyklopenta[c,d]
Dibenzo[a,l]pyrene thene Benzo[g,h,i]peryléne pyréne

Dibenzo[a,h] Dibenzo[a,h]pyrene
Dibenzo[a,e]pyrene Dibenzo[a,i]pyrene
antracéne

CH3
Indeno[1,2,3-cd]
Benzo[j]fluoranthene 5-methylchrysene Benzo[c]fluorene
fluoranthene
328 Advanced Technologies for Meat Processing, Second Edition

TABLE 10.2
Maximum Allowed Levels of PAHs, Set by Commission Regulation (EU) No. 835/2011
for Meat Products
Maximum Levels (μg/kg)

Sum of benzo[a]pyrene,
benzo[a]anthracene, benzo[b]
fluoranthene, and chrysenea
Foodstuffs Benzo[a]pyrene (ΣPAH4)
Smoked meat and meat products 2.0 12.0
Muscle meat of smoked fish and smoked 2.0 12.0
fishery products. The maximum level for
smoked crustaceans applies to muscle
meat from appendages and abdomen. In
case of smoked crabs and crab-like
crustaceans (Brachyura and Anomura), it
applies to muscle meat from appendages.
Smoked sprats and canned smoked spratsb 5.0 30.0
(Sprattus sprattus); bivalve molluscs
(fresh, chilled, or frozen); and heat-
treated meat and meat productsc sold to
the final consumer
Bivalve molluscs (smoked) 6.0 35.0
a Lower bound concentrations are calculated on the assumption that all the values of the four
substances below the limit of quantification are zero.
b For the canned product the analysis shall be carried out on the whole content of the can.
c Meat and meat products that have undergone a heat treatment potentially resulting in forma-
tion of PAH, that is, only grilling and barbecuing.

authorized smoke flavoring primary products for use as such in or on foods

and/or for the production of derived smoke flavorings (Commission Imple-
menting Regulation, 1321/2013). Finally, directive 88/388/EEC has limited
the maximum residual levels of BaP at 0.03 μg/kg in foodstuffs flavored by
LSF (Commission Directive, 88/388/EC).
For international trade purposes, the Joint Expert Committee for Food
Additives and Contaminants of the FAO and WHO has adopted a specifica-
tion that tolerates the concentration in liquid smoke flavors at the levels of 10
μg/kg for BaP and 20 μg/kg for BaA, respectively (Report of the Joint FAO/
WHO Expert Commission, 1987).

10.2.5 Occurrence of PAHs in Smoked Meats

In general, smoked meat products are believed to be the food products
with the highest content of PAHs, especially in cases of production via tra-
ditional procedures, when a food is put near the fireplace for several days
and directly exposed (Djinovic et al., 2008; Lorenzo et al., 2010; Škaljac
Reduction of Contaminant Content in Processed Meats 329

et al., 2014; Zelinkova and Wenzl, 2015). This fact documents data sum-
marized in Table 10.3 showing some findings of PAH4 content in meat
products smoked under “intensive” conditions (Purcaro et al., 2013). As
follows from Table 10.3, some data are really alarming and confirm clearly
the relationship between the direct way of hot smoking and PAH4 content
in smoked products as well as an urgent need to find new effective proce-
dures for lowering of PAH content in these food products.

10.2.6 Reduction of PAH Concentrations in LSFs

As mentioned above, LSFs have far lower PAH concentrations and therefore
contamination of aromatized meat products could be negligible due to
the fact that real PAH contents are well under legislative limits. However,
any presence of hazardous/carcinogenic compounds in foods and food
additives should never be acceptable while there are available procedures
which are able even to remove traces of PAHs. From this point of view,
production of LSFs “free of PAHs” is really an attractive challenge for chemi-
cal and food scientists to protect humans entirely against exposure to these
compounds.
The first study dealing with the possibility of elimination of PAHs from
LSFs was carried out by Šimko and Bruncková (1993). In their experiments,
liquid smoke flavor was spiked with six PAH compounds, pyrene (Py), BaA,
dibenzo[a,c]anthracene (DBa,cA), benzo[e]pyrene (BeP), BaP, and dibenzo[a,h]
anthracene DBa,hA at a level of total concentration 45.6 μg/kg and filled
into receptacles made of low-density polyethylene (LDPE). As follows from
high-performance liquid chromatography (HPLC) records of LDPE and LSF
immediately after spiking (Figure 10.5), LDPE was free of PAHs. However,
after 14 days of the experiment, PAHs in LSF were “lost” and, on the con-
trary, they were found in LDPE (Figure 10.6). This process was very effec-
tive, because during the experiment total concentrations of PAHs in LSFs
dropped by two orders (Figure 10.7) and reached values of 0.73 μg/kg, which
was practically under limits of detection. Authors concluded that the elimi-
nation was brought about by sorption of PAHs on the LDPE surface due to
their similar, nonpolar character. Later, Šimko et al. (1994) tried to reveal the
mechanism of this process, and therefore they allowed interaction of PAHs
contained in LSFs with LDPE receptacles of cylindrical shapes. Because they
observed the same courses of PAH elimination, they made an assumption
that this process could be dominantly directed by diffusion.
As the LSFs were not mixed during the experiment, it was a given assump-
tion that the factor limiting the rate of PAH removal from LSFs is the diffu-
sion in the liquid media. Therefore, the authors applied Fick’s laws dealing
with transportation of mass in a media using the relationship derived for
diffusion in a cylinder by Cranck (1976):
TABLE 10.3 330
Some Findings of PAH Occurrence in Smoked Meat Products
Content (μg/kg) Source
BaA Chr BbF BaP ΣPAH4
Sample/Number of Samples Min. Max. Min. Max. Min. Max. Min. Max. Min. Max. Min.
Smoked ham/16 <0.3 76.5 <0.3 71.4a <0.3 23.9 <0.3 36.9 <0.3 208.7 Wretling et al.
smoked directly (2010)
Smoked bacon/5 1.9 28.9 1.5 33.4a 0.3 10.2 0.4 15.9 <0.3 88.4
smoked directly
Smoked elk and reindeer meat/1 11.7 13.0a 4.5 6.6 35.8
smoked directly
Smoked meat/3 1.51 2.37 1.56 1.64 0.07 0.15 0.36 0.63 3.5 4.79 Roseiro et al.
Smoked blood sausages/3 0.88 3.28 0.61 4.94 0.03 0.23 0.32 0.39 1.84 8.84 (2012)
Smoked frankfurter-type sausages/10 0.82 1.69 0.74 1.57a 0.27 0.61 0.32 0.80 2.06 4.67 Hitzel et al. (2013)
Smoked mini-salamis/9 0.91 2.06 0.93 1.79a 0.27 0.62 0.23 0.60 2.34 5.07
Smoked pork breast/18 0.06 9.60 0.10 11.24 <0.05 4.28 <0.05 2.99 0.16 28.10 Rozentale et al.
Smoked pork/14 0.05 10.60 0.10 11.07 <0.05 4.60 <0.05 6.03 0.15 27.25 (2015)
Smoked pork speck/10 0.13 12.23 0.25 14.50 0.11 4.29 <0.05 3.62 0.48 34.65
Smoked sausages/21 0.08 14.21 0.13 11.19 <0.05 4.09 <0.05 4.17 0.22 33.66
Crackers or small sausages/10 0.19 13.13 0.26 12.79 0.13 4.03 0.05 4.63 0.63 34.58
Spanish smoked meat product ND ND ND 0.9 3.21 0.9 3.21 Ledesma et al.
“chorizo”/12 (2015)
Smoked garlic pork sausages 11 522 21 649 3.2 178 3.1 98 38.3 1387.3 Fasano et al. (2016)
“chorizo”/8 smoked directly
Source: Reprinted from Food Chemistry, 201, Semanová, J. et al., Elimination of polycyclic aromatic hydrocarbons from smoked sausages by migration
into polyethylene packaging, 1–6. Copyright 2016 with permission from Elsevier.
a The sum of Chr and triphenylene.

ND, not determined.

Advanced Technologies for Meat Processing, Second Edition
Reduction of Contaminant Content in Processed Meats 331

1
4

6
5

3
Fluorescence

S S

0 10 20 0 10 20
Time (min)
(a) (b)

FIGURE 10.5
Chromatograms of PAH analysis in LDPE (a) and LSFs (b) before storage experiment. 1,
Pyrene; 2, benzo[a]anthracene (BaA); 3, dibenzo[a,c]anthracene (DB(a,c)A); 4, benzo[e]pyrene
(BeP); 5, benzo[a]pyrene (BaP); 6, dibenzo[a,h]pyrene (DB(a,h)A). (Reprinted from Šimko, P.
and Bruncková, B. Lowering of concentration of polycyclic aromatic hydrocarbons in a liquid
smoke flavour by sorption into polyethylene packaging. Food Additives and Contaminants, 10,
(1993):257–263. With permission. Copyright Taylor and Francis © 1993.)

∞
nt = 1 −
n∞
∑ a 4α2 2
n
exp[−Dα n2 t], (10.1)
n=1

where nt is the amount of diffused substance, which left the LSF as a con-
sequence of the diffusion into the LDPE at time t, and n∞ is the amount of
substance, which corresponds to infinite time. D is the diffusion coefficient,
a is the radius of the cylinder, and α n are the roots of the equation:

J 0( a . α n) = 0 (10.2)

where J0 is the zero-order first-class Bessel function.

However, in the experiment, the amount of substance sorbed into the
LDPE was not measured, but rather the amount left in the cylindrical liquid
332 Advanced Technologies for Meat Processing, Second Edition

1 6
2
Fluorescence

S S

0 10 20 0 10 20
Time (min)
(a) (b)

FIGURE 10.6
Chromatograms of PAH analysis in LDPE (a) and LSFs (b) after storage experiment. 1, Py; 2,
BaA; 3, DB(a,c)A; 4,BeP; 5, BaP; 6, DB(a,h)A. The chromatogram in (b) was obtained at two times
more detector sensitivity that that in (a). (Reprinted from Šimko, P. and Bruncková, B. Lower-
ing of concentration of polycyclic aromatic hydrocarbons in a liquid smoke flavour by sorption
into polyethylene packaging. Food Additives and Contaminants, 10, (1993): 257–263. With permis-
sion. Copyright Taylor and Francis © 1993.)

bulk—LSF. Therefore, after recalculation of the amount of substance, the

concentration, Equation 10.1, could be modified to

c t = c0 ∑ a 4α exp[−Dα t],
2 2
n
2
n (10.3)
n=1

where c0 and ct are concentrations at time t = 0 and t.

Diffusion coefficients of PAHs (Table 10.4) were obtained by the nonlin-
ear least squares method by minimizing the sum of squares of differences
between the concentrations of PAHs measured experimentally (A rows of
Table 10.5) and those calculated by Equation 10.3 (B rows of Table 10.5). The
Reduction of Contaminant Content in Processed Meats 333

Concentration of PAHs (μg/kg) 50

40

30

20

10

0
0 2 4 6 8 10 12 14 16
–10
Time (days)

FIGURE 10.7
Reduction of PAH concentration in LSFs stored in LDPE receptacles during 14 days of storage.
(Reprinted from Šimko, P. and Bruncková, B. Lowering of concentration of polycyclic aromatic
hydrocarbons in a liquid smoke flavour by sorption into polyethylene packaging. Food Additives
and Contaminants, 10, (1993): 257–263. With permission. Copyright Taylor and Francis © 1993).

TABLE 10.4
Values of Diffusion Coefficients Calculated by
Equation 10.3 for Individual and Sum of PAHs in LSFs
Values of Diffusion Coefficients
Compound D × 102 (m 2 /h)

Py 8.7
BaA 4.6
DB(a,c)A 7.4
BeP 5.8
BaP 7.2
DB(a,h)A 7.6
Total 6.3
Source: Reprinted with permission from Food Chemistry, 50,
Šimko, P. et al., Kinetics of polycyclic aromatic hydro-
carbons sorption from liquid smoke flavor into low
density polyethylene packaging, 65–68. Copyright
1994 with permission from Elsevier.

minimization was carried out by the simplex method (Nelder and Mead,
1965). Minimized parameters were c0 and D. The parameter c0 was mini-
mized because the error of determination of this concentration in trace
analysis is usually relatively high, and might affect all values of concen-
trations calculated. In calculations, the first 20 terms of Equation 10.3 were
taken into account. The values α n were taken from tables (Abramowitz and
Stegun, 1964). The agreement between experimental and calculated values
of PAH concentrations was very good as can be seen from Table 10.5 when
334 Advanced Technologies for Meat Processing, Second Edition

TABLE 10.5
Changes in Concentrations of PAHs (μg/kg) in LSFs Followed during the Experi-
ment
Time of Storage (h)
Com-
pound 0 27 68 92 98 116 121.5 141 145.5 164 σ

Py A 14.8 2.45 0.65 0.58 0.50 0.50 0.29 0.29 0.25 ND 0.33
B 14.7 2.70 0.36 0.11 0.08 0.03 0.03 0.01 0.01 0.00
BaA A 26.8 8.23 3.40 1.54 1.79 1.43 1.03 0.99 0.75 ND 0.47
B 26.5 9.12 3.09 1.64 1.41 0.88 0.74 0.46 0.41 0.24
DB(a,c)A A 17.8 3.55 0.78 0.67 0.47 0.43 0.25 0.16 0.13 ND 0.25
B 17.8 3.80 0.64 0.23 0.17 0.08 0.06 0.03 0.02 0.01
BeP A 11.0 3.25 0.63 0.42 0.30 0.30 0.13 0.08 0.07 ND 0.09
B 11.0 3.16 0.82 0.38 0.31 0.17 0.14 0.08 0.07 0.04
BaP A 10.2 2.25 0.44 0.32 0.26 0.21 0.16 0.08 0.07 ND 0.10
B 10.1 2.34 0.44 0.17 0.13 0.06 0.05 0.02 0.02 0.01
DB(a,h)A A 10.7 2.20 0.43 0.31 0.24 0.23 0.10 0.06 0.06 ND 0.10
B 10.6 2.29 0.39 0.14 0.11 0.05 0.04 0.02 0.01 0.01
Total A 91.1 21.9 6.33 3.83 3.54 3.11 1.96 1.67 1.32 ND 1.43
B 90.7 24.0 5.56 2.37 1.91 1.03 0.80 0.41 0.35 0.18
Source: Reprinted with permission from Food Chemistry, 50, Šimko, P. et al., Kinetics of poly-
cyclic aromatic hydrocarbons sorption from liquid smoke flavor into low density
polyethylene packaging, 65–68. Copyright 1994 with permission from Elsevier.
ND, not detectable.
A Rows, experimentally obtained data; B Rows, values obtained by Equation 10.3.

TABLE 10.6
Values of Diffusion Coefficients Calculated by Equation 10.3 for Individual and
Sum of PAHs in LSFs
Total Amount of PAHs (ng) in
Time of Experiment (h) LSF LDPE

0 1274.7 ND
27 295.3 884.1
68 88.6 1067.4
92 53.6 1055.7
98 49.6 1114.8
116 43.5 1095.7
121.5 27.4 1122.6
141 23.3 1138.8
145.5 18.5 1163.8
164 ND 1187.3
Source: Reprinted from Šimko P. et al. Kinetics of polycyclic aromatic hydrocarbons sorption
from liquid smoke flavour into low density polyethylene packaging. Food Chemistry, 50,
(1994):65–68. With permission. Copyright Elsevier © 1994.
ND, not detectable.
Reduction of Contaminant Content in Processed Meats 335

comparing rows A and B for the same compound, and it was also demon-
strated by the low values of standard deviations (σ) in the right-hand column
of Table 10.5. By numerical solution of Equation 10.3 for known values of the
diffusion coefficients D and given initial concentration c0, it is possible to cal-
culate the time at which PAH concentration decreases to a required value ct.
This means that, by Equation 10.3, it is possible to predict the time necessary
for lowering PAH concentrations to an acceptable level. For example, if initial
concentration c0 is equal to 10.2 μg of BaP/kg of LSF, it can be calculated that
the acceptable concentration, ct = 9.90 μg/kg, accepted by JECFA (Report of
the Joint FAO/WHO Expert Commission on Food Additives, 1987) would be
reached within 51 minutes of the experiment. The evidence about sorption
processes of PAHs onto LDPE is shown in Table 10.6, where the total amount
of PAHs in both LSF and LDPE is compared. As follows from this table, the
amount of PAHs “lost” in LSF during the experiment was possible to recover
later from the LDPE.

10.2.6.1 Characterization of Physicochemical Processes

Taking Place between Liquid Media and LDPE
By the theory of physical chemistry, the sorption of nonelectrolytes at the
solid–solution interface may be viewed in terms of two somewhat differ-
ent physical pictures. The first is that adsorption is essentially confined to a
monolayer next to the solid surface, with the implication that succeeding lay-
ers are virtually normal bulk solution. The second picture is that of an inter-
facial layer or region, multimolecular in depth, over which a more slowly
decaying interaction potential with the solid is present. From this point of
view, adsorption from solution corresponds to a partition between a bulk
and an interfacial phase (Adamson, 1990). To find definitively the mecha-
nism of PAH removal from liquid media, water was spiked with three dif-
ferent PAHs and filled into a diffusion cell made of stainless steel. One of
the walls was replaced by an LDPE sheet made up of five layers of LDPE
films. The depth of PAH migration into this sheet was followed for 143 hours,
using high-performance liquid chromatography with selective fluorimetric
detection after extraction of PAHs from individual peeled-off films. As can
be seen from Table 10.7, the PAH concentrations in water started to decrease
immediately after beginning the experiment.
As follows from Table 10.8, the presence of PAHs in the first layer of the
PE sheet was possible to determine already after 0.75 hours. With extension
of the experiment time, the presence of PAHs was determined also in fur-
ther layers, and after 69 hours, PAHs were determined in all layers of the PE
sheet. The total view of the dependence of PAH migration into bulk polymer
upon time is shown in Figure 10.8.
The solution of the second Fick’s law for the diffusion of PAHs in poly-
mer placed in the diffusion cell (Cranck, 1976; Moisan, 1985) gives the next
equation:
336 Advanced Technologies for Meat Processing, Second Edition

TABLE 10.7
Decrease in PAH Concentration (μg/kg) in Water at Various Time Intervals
Time (h) Fl Py BaP

0.00 1350 537 191

0.75 1348 536 190
1.50 1344 534 190
2.50 1337 531 189
3.00 1324 525 188
69.0 1153 455 169
143.0 1054 417 165
Source: Reprinted from Food Chemistry, 64, Šimko, P. et al., Removal of polycyclic aromatic
hydrocarbons from water by migration into polyethylene, 157–161. Copyright 1999
with permission from Elsevier.

TABLE 10.8
Concentration of PAHs (μg/kg) in Individual Layers of PE Sheet at Various Time
Intervals
Time (hr) Compound Layer No. 1 Layer No. 2 Layer No. 3 Layer No. 4 Layer No. 5

0.00 Fl ND ND ND ND ND
Py ND ND ND ND ND
BaP ND ND ND ND ND
0.75 Fl 523 ND ND ND ND
Py 244 ND ND ND ND
BaP 86 ND ND ND ND
Fl 647 43 ND ND ND
1.50 Py 268 25 ND ND ND
BaP 98 11 ND ND ND
Fl 894 57 39 ND ND
2.50 Py 395 26 15 ND ND
BaP 146 6 3 ND ND
3.00 Fl 1087 101 77 62 ND
Py 458 42 22 14 ND
BaP 193 16 10 7 ND
69.00 Fl 6614 1861 319 86 57
Py 2275 632 122 31 22
BaP 1242 129 27 17 5
143.00 Fl 7709 2154 1493 459 182
Py 4009 1060 626 142 79
BaP 2083 376 109 42 27
Source: Reprinted from Food Chemistry, 64, Šimko, P. et al., Removal of polycyclic aromatic
hydrocarbons from water by migration into polyethylene, 157–161. Copyright 1999
with permission from Elsevier.
ND, not detectable.
Reduction of Contaminant Content in Processed Meats 337

450

400

350
Amount of PAH (μg)

300

250

200

150

100

50

0
0.00
0.75
1.50
2.50
3.00
Time of experiment (h) 69.00
143.00

FIGURE 10.8
Amounts of PAHs in liquid media before the experiment— , amounts of PAHs in liquid
media during the experiment— , and amounts of PAHs in LDPE during the experiment— .
(Reprinted from Food Chemistry, 64, P. et al., Removal of polycyclic aromatic hydrocarbons from
water by migration into polyethylene, 157–161. Copyright 1999 with permission from Elsevier.)

⎛ x ⎞
c = S.erfc ⎜ (10.4)
⎝ 2 Dt ⎟⎠

where c is the concentration of PAHs in the polymer at time t and at the distance
x, D is the diffusion coefficient, and S is the solubility of PAHs in the polymer.
The amount of diffusant in the region x–h to x is given by Equation 10.5:
x

Q=A
∫ c(x, t)dx
x− h
(10.5)

where A is the area and h is the thickness of the polymer layer. It can be
derived from Equations 10.4 and 10.5 that the amount of PAHs in the nth
polymer layer expressed as a weight of PAHs per weight of polymer, w, is
n
⎛ hn ⎞
w=S
∫ erfc ⎜⎝ 2
n− 1
Dt ⎟⎠
dn (10.6)

where n is the number of the layer.

338 Advanced Technologies for Meat Processing, Second Edition

Therefore, the experimental data have been treated using Equation 10.6. The
solubilities of individual PAHs in LDPE and the related diffusion coefficients
have been obtained from the comparison of the theoretical values given by
Equation 10.6 and the experimental values listed in Table 10.9 using the non-
linear least-squares method. The minimization of the sum of squares between
theoretical and experimental values has been done by the simplex method.
Integration in Equation 10.6 has been performed using the Simpson formula.
For example, the courses of experimentally obtained and calculated values are
shown in Figures 10.9 and 10.10 for 69 or 143 hours of experiment, respectively.
The relationships between measured and calculated values are fairly good.
As can be seen from the values of standard deviations in Table 10.9, the agree-
ment between experimental and calculated values is fairly good. The solubili-
ties and diffusion coefficients decrease in the order Fluoranthene (Fl)>Py>BaP,

TABLE 10.9
Solubilities and Diffusion Coefficients of Individual PAHs in LDPE and the
Standard Deviation of Calculated Values
Compound S (μg/kg) D × 1010 (cm 2 /s) σ (μg/kg)

Fl 10,430 7.05 310

Py 5030 5.47 190
BaP 3360 2.53 80
Source: Reprinted from Food Chemistry, 64, Šimko, P. et al., Removal of polycyclic aromatic
hydrocarbons from water by migration into polyethylene, 157–161. Copyright 1999
with permission from Elsevier.

7000

6000
Concentration of PAHs (μg/kg)

5000 Fl

4000

3000 Py

2000

1000
BaP
0
1 2 3 4 5
Layers

FIGURE 10.9
Dependence of PAHs concentration on the depth of migration in 69 hours of the experiment.
- - - measured values, — calculated values. (Reprinted with permission from Food Chemistry,
64, Šimko, P. et al., Removal of polycyclic aromatic hydrocarbons from water by migration into
polyethylene, 157–161. Copyright 1999 with permission from Elsevier.)
Reduction of Contaminant Content in Processed Meats 339

9000
8000
Concentration of PAHs (μg/kg)

7000
6000
5000 Fl

4000 Py
3000
2000
1000
BaP
0
1 2 3 4 5
Layers

FIGURE 10.10
Dependence of PAH concentration on the depth of migration in 143 hours of the experiment.
- - - measured values, — calculated values. (Reprinted from Food Chemistry, 64, Šimko, P. et al.,
Removal of polycyclic aromatic hydrocarbons from water by migration into polyethylene,
157–161. Copyright 1999 with permission from Elsevier.)

which is due to the increasing molar mass of the compounds. These calculated
values of diffusion coefficients are more precise as the same values were only
estimated for the same material in the previous work (Šimko et al., 1995).
On the basis of the results obtained, it can be concluded that PAHs after
leaving the liquid media are primarily adsorbed on the polyethylene surface,
with following migration into the bulk polymer, while the transportation of
PAHs through the LDPE bulk can be described satisfactorily by Fickian laws
of diffusion. This finding has also explained why this process is so effec-
tive—it is due to the existence of a permanently unbalanced state between
PAH concentrations in the liquid and solid phase, where PAHs migrate con-
tinuously into the LDPE bulk; therefore the unbalanced state on the interfa-
cial phase is permanently renewing. It is clear that this process will stop after
a balance state between both phases are reached. Later, these findings were
confirmed also by Guillén et al. (2000), when they observed reduction of PAH
concentration in LSFs stored in LDPE flasks.

10.2.7 Reduction of PAH Content in Processed Meats

In principal, reduction of PAH content in smoked meat products can be real-
ized at any production stage of these products. To keep formal categorization of
reduction procedures, they could be applied during smoking, immediately after
smoking, and by additional treatment or packaging into LDPE, respectively.

10.2.7.1 Reduction of PAH Content during Smoking

In general, PAH content in smoked meat products is directly proportional
to smoking time (Djinovic et al., 2008; Ledesma et al., 2014) and the selec-
340 Advanced Technologies for Meat Processing, Second Edition

tion of the mode also has considerable influence on the contents of PAHs,
especially in hot smoked meat products. Therefore, the highest PAH con-
tents were detected in sausages smoked with smoldering (intensive) smoke
(Wretling et al., 2010; Pöhlmann et al., 2013a). So, shortening of smoking time
and lowering of temperature of smoke generation have considerable effects
on the final PAH content. Also, the use of synthetic casings instead of natu-
ral ones prevents the penetration of PAHs inside meat products smoked by
any method due to the diameters of casing pores and molecules of PAHs
(Ledesma et al., 2015, 2016). For example, the selection of a cellulose-peelable
casing is an effective tool for reducing the PAH content in hot smoked sau-
sages as a high percentage of the PAHs (BaP—77%; PAH4—61%) remains
in the peelable casing and does not migrate to the inside of meat products
(Pöhlmann et al., 2013b).

10.2.7.2 Reduction of PAH Content by Their Photodecomposition

To obtain data regarding possible effects of light on BaP content in hot
smoked meat products, an Atlantic herring (Clupea harengus) was treated
with hot smoke at a temperature of 82°C in a plant smoke house for
50 minutes (Šimko, 1991). After finishing the smoking, BaP content was
determined immediately. Next, the samples were hung in the laboratory at
unlimited access to oxygen and daylight at 18°C, and the BaP content was
determined after 1, 2, 3, 4, 6, and 7 days of exposition. During this time, the
BaP content was lowered from 0.58 to 0.12 μg/kg, as follows from Figure
10.11. Simultaneously, BaP methanolic solution was transferred into far UV
silica cells and, after evaporation of the solvent, BaP at an amount of 1 μg

0.6
Concentration of BaP (μg/kg)

0.5

0.4

0.3

0.2

0.1

0 1 2 3 4 5 6 7
Time (days)

FIGURE 10.11
Dependence of BaP content upon time in smoked fish. (Reprinted from Food Chemistry, 40,
Šimko, P. Changes of benzo(a)pyrene contents in smoked fish during storage, 293–300. Copy-
right 1991 with permission from Elsevier.)
Reduction of Contaminant Content in Processed Meats 341

was exposed to the same conditions as used for the smoked fish. The con-
tents of the cells were analyzed for amount of BaP at the same time intervals.
As found, BaP content was affected by light, especially at the initial time of
exposition, when all BaP molecules were localized just on the fish surface.
But, the process of BaP light decomposition was not the only physicochemi-
cal process to take place in the fish. On analyzing surface (skin) and inter-
nal layers (meat) at the beginning and at the end of the experiment, it was
found that a part of BaP molecules diffused into the fish bulk. So, while
BaP content in fish skin decreased from 10.6 to 1.3 μg/kg, BaP in the bulk
increased from 0 to 0.1 μg/kg. It was found that BaP degradation in silica
cells could be described, in general, by a reaction of zero order, which is
typical for photolytic degradations; this means that the amount of decom-
posed BaP was proportionally equal to the time of light exposition. On the
other hand, the diffusion inside of fish bulk brought about the protection
of BaP against environmental (decomposition) factors and the stabilization
of its residual content in the fish. This course is typical for a reaction of first
order, and it is clear that two different physicochemical processes took place
there—light decomposition and diffusion—independently of each other. It
is clear that extent of BaP content decrease can be affected by the intensity
of light, and finally, also by antioxidant activity of phenol derivatives and
other antioxidants present in the food matrix. Evidence about decompo-
sition effects on PAHs was given by Skláršová et al. (2012), who studied
decomposition of BaP at two different light wavelengths, 254 and 365 nm,
in a nonpolar medium at concentrations of 50, 100, and 150 μg/L. At chosen
time intervals, BaP concentration was measured by HPLC using fluores-
cence detection. Comparing rate constants k and half-lives τ 1/2, it was found
that decomposition at 365 nm was 15.3 times faster in comparison with
the decomposition at 254 nm. The decompositions obeyed the first-order
kinetics. Addition of food antioxidants, 2,6-di-tert-butyl-4-methylphenol
(BHT) and o-methoxyphenol (guaiacol), had considerable effect as both
accelerated the rate of BaP decomposition—BHT by 1.17 times and guaia-
col almost 1.45 times, which is really surprising. While these compounds
are currently present in smoke, this observation could explain accelerated
photodecomposition of PAHs localized on the surface of processed meats.
These findings may represent a basis for a new approach to decrease PAH
content in foods, where their presence is inevitable due to the applied pro-
duction technology (Ledesma et al., 2016). To derive the kinetic equation
and eliminate errors associated with nonisothermal heating procedures,
BaP dissolved in glyceryl trioctanoate was heated in a glass reaction vessel
within the temperature range 297.95–361.85 K with a heating rate of 1 K/
min and simultaneously exposed to UV light at wavelength λ = 365 nm at
radiation power 20 mW/cm 2. During the experiment, the BaP concentration
decreased from 62.2 to 19.8 μg/L. From experimental results, the param-
eters characterizing the nonisothermal kinetics of the BaP photooxidation
equation have been obtained (Equation 10.7):
342 Advanced Technologies for Meat Processing, Second Edition

⎡ aT ϑ m+1 ⎤
c = co exp ⎢− r ⎥ (10.7)
⎣ β(m + 1) ⎦

where Tr is a reference temperature, co and c are the concentrations of BaP in

the vessel at the temperatures To and T, ϑ is reduced temperature, and a and
m are adjustable parameters. The parameters were tested at two isothermal
conditions (290.16 and 323.26 K) to verify the suitability of the derived param-
eters. Comparing calculated and measured data of half-lives of BaP decrease
at mentioned temperatures, it was found that calculated half-lives are in
good accordance with those experimentally obtained values, where relative
standard deviations at 290.16 K were 17.0% and 5.4% at 323.26 K, respectively.
The kinetic parameters enable the calculation of the rate constant for any
temperature in the isothermal regime and make possible modeling, in gen-
eral, the kinetics of PAH photooxidation without a deeper insight into their
mechanisms.

10.2.7.3 Reduction of PAH Content by Cooking

of Smoked Sausages
Sausages belong to a group of typical meat products consumed in consid-
erable quantities over the world. They are commonly made from pork—
boneless hams, shoulders, and slab bacon. The proper amounts of each
are cut and ground through a 7 mm plate of a meat grinder. The mixture
is then combined with seasoning ingredients (NaCl, black and red pep-
per, garlic, etc.), and stuffed into natural casings. The linked sausages are
smoked using hot smoke for seven hours. The sausages are consumed
directly, or after cooking in boiling water. To follow the effect of cooking
on BaP in sausages, a sausage was analyzed for BaP content, fat content,
and dry weight prior to cooking (Šimko et al., 1993). The BaP content was
determined not only in whole sausages, but also in sausages in casing and
peel-off film, separately; also BaP content in the cooked-out fat remain-
ing in water after cooking was determined. The sausage was cooked in
water at the boiling point, taken off at set time intervals, and analyzed.
As follows from the experiment, cooking of sausage could be an effective
tool for lowering BaP content, because the BaP content was lowered from
4.8 μg/kg to a final value of 1.9 μg/kg. The maximum drop in BaP con-
tent was observed during the first 20 minutes of cooking, after which it
remained at a constant level. The decrease of BaP content during cooking
was directly proportional to the amount of cooked-out fat released from
sausages during cooking. Global changes of BaP and fat on time of cooking
are shown in Figure 10.12. Although the BaP content found in the sausage
casing corresponded to a level of 86 μg/kg, in real terms this represented
only 21% of the total BaP content in the sausage; this means that 78% of the
Reduction of Contaminant Content in Processed Meats 343

100.0 Time (min)

80.0

60.0

40.0

20.0

24.0 28.0
1.2 32.0 36.0 40.0
2.8 Fat (x)
3.6
4.3
5.0
BaP (μg/kg)

FIGURE 10.12
Three-dimensional diagram of the dependence of BaP content on the fat content and the time
of cooking. (Reprinted from Meat Science, 34, Šimko, P. Influence of cooking on benzo[a]pyrene
content in smoked sausages, 301–309. Copyright 1993 with permission from Elsevier.)

total amount of BaP had diffused into the sausage bulk before cooking.
Evidence about diffusion of BaP and its high affinity to nonpolar parts,
that is, its nonhomogenous distribution in the sausage, was also proven by
determination of BaP content in cooked-out fat, when BaP content at the
level of 7.7 μg/kg was determined. To the contrary, with regard to the find-
ing that BaP content can be influenced by cooking, frankfurters were also
treated by cooking and BaP and fat content was monitored. In comparison
to the sausages, it was found that BaP in frankfurters was not affected by
cooking at all. Comparing data and production technologies, it was found
that although sausages and frankfurters are visually quite similar, they
are very different due to their methods of production. While production of
sausages was finished immediately after smoking, the frankfurters were
still cooked in water steam. For this reason, the BaP content did not change
in the frankfurters during additional cooking, because the “free” fat had
already been removed from them during their technological production.
So, while sausages represented a “crude” mixture of ground pork meat and
bacon, frankfurters represented the typical fine cut homogeneous emulsi-
fied system, where the “residual” fat was “locked” in three-dimensional
structures of denaturated proteins and therefore immobilized. Because the
fat content had been stabilized already in the frankfurters during produc-
tion, it was not further changed considerably during cooking. Then, with
regard to the high affinity of BaP to nonpolar parts, its content was also not
344 Advanced Technologies for Meat Processing, Second Edition

influenced by additional cooking and it remained at a constant level (Šimko

and Knežo, 1992).

10.2.7.4 Reduction of PAH Content in Roasted

Duck by Packaging into LDPE
Chen and Chen (2005) roasted whole duck samples at 225°C for 60 minutes,
and skin samples were peeled off, analyzed for BaA, BbF, and BaP contents,
and then packed in LDPE pouches under vacuum to ensure as much as pos-
sible contact of the skin with LDPE. After 24 hours storage at ambient temper-
ature, BaA, BbF, and BaP contents were determined again and compared with
the original content. As the authors found, all three contents were changed,
and the most effective reduction was observed for BaP, as original content
was reduced by 73% (from 3.5 to 0.9 μg/kg), while BbF was reduced by 54%
(from 3.69 to 1.69 μg/kg), and BaA by 8% (from 143 to 130 μg/kg), respectively.
As the authors concluded, this reduction was brought about by migration of
PAHs from meat into the LDPE package and this process of elimination is
believed to be a very promising method for elevation of food safety.

10.2.7.5 Reduction of PAH Content in Smoked

Sausages by Packaging into LDPE
Smoked sausages were divided into two groups—the first group was packed
immediately after smoking into the LDPE using vacuum packaging technol-
ogy, while the second one was packed 12 hours after finishing the smoking.
Also, unpacked sausages were left at the same conditions for comparison
purposes. All samples were protected against daylight to prevent light
decomposition of PAHs and stored at 15°C. Sausages were sampled at 0, 15,
30, 45, 60, 90, 120, 150, and 180 minutes. As follows from the experimental
data in Table 10.10 (A columns, in time = 0), sausages contained relatively
high PAH4. However, this content is in close accordance with the findings of
other studies (shown in Table 10.3) and it is clear that it is brought about by
the mode of smoking, because values of PAH4 content in nonsmoked sau-
sages were under the limit of detection. As follows from the A columns in
Table 10.10, PAH4 content started to decrease immediately after packaging
into the LDPE. Because this decrease reached an equilibrium state in which
PAH4 content in infinite time (c∞ ) was not equal to zero, this decrease can
be described by kinetic Equation 10.8 derived for cylindrical shape of a food
product by Šimko et al. (2004):
∞

∑ a 4α exp[−Dα t]
c t = c ∞ + (c 0 − c ∞)
n= 1
2 2
n
2
n (10.8)

where c0, ct , and c∞ are the initial concentration, concentration at time t, and
equilibrium concentration, a is the radius of the cylinder, α n were taken from
Reduction of Contaminant Content in Processed Meats 345

TABLE 10.10
Changes in PAH4 Content in Smoked Sausage during Storage in LDPE Packaging
BaA Chr BbF BaP
A B A B A B A B
(μg/ EMU (μg/ (μg/ EMU (μg/ (μg/ EMU (μg/ (μg/ EMU (μg/
Time kg) (%) kg) kg) (%) kg) kg) (%) kg) kg) (%) kg)

0 11.5 8.1 11.4 9.4 6.9 9.1 5.3 4.9 5.3 3.9 7.9 3.9
15 4.3 7.5 5.3 4.7 9.8 5.9 1.7 6.9 1.7 1.4 7.6 1.5
30 4.2 13.1 3.91 5.4 7.2 4.9 2.4 5.2 1.7 1.4 9.2 1.3
45 4.2 8.2 3.4 4.8 12.1 4.2 1.9 8.8 1.7 1.7 8.8 1.3
60 5.2 8.2 3.2 3.4 12.2 3.7 1.8 8.9 1.7 1.5 6.6 1.3
90 3.3 10.9 3.1 3.1 9.9 2.9 2.5 12.9 1.7 1.4 9.9 1.3
120 2.1 8.9 3.1 2.9 11.5 2.5 1.4 10.0 1.7 0.9 11.2 1.3
150 2.8 7.5 3.1 2.2 11.5 2.3 1.4 11.0 1.7 1.0 12.1 1.3
180 2.1 12.9 3.1 1.9 15.7 2.1 0.6 14.0 1.7 1.1 12.8 1.3
Source: Reprinted from Food Chemistry, 201, Semanová, J. et al., Elimination of polycyclic aro-
matic hydrocarbons from smoked sausages by migration into polyethylene packaging,
1–6. Copyright 2016 with permission from Elsevier.
A columns, measured values; EMU, expanded measurement uncertainty (k = 2) of measured
values listed in A columns; B columns, values calculated using Equation 10.8.

tables (Abramowitz and Stegun, 1964), D is the diffusion coefficient, and t is

the time of LDPE–sausage interaction.
Values of diffusion coefficients were calculated by the nonlinear least
squares method by minimizing the sum of squares in differences between
the PAH4 content measured experimentally and those calculated by Equa-
tion 10.8. The minimization was carried out by the simplex method (Nelder
and Mead, 1965). Minimized parameters were c∞ , c0 - c∞ , and D, and these
values are shown in Table 10.11. In calculations, the first 20 terms of Equation
10.8 were taken into account. Experimental data were used for calculation
of D and successively D values were used for calculation for PAH4 content.
For comparison purposes, ct was calculated at the same time as the experi-
mental data. The agreement between experimental and calculated values is
fairly good as follows from Table 10.9—columns A and B—which confirms
diffusion of PAH4 from smoked sausages into LDPE bulk as a dominant
physicochemical migration process of mass transfer between these media. A
measure of the distribution of PAH4 between LDPE and smoked sausages is
the distribution coefficient β calculated for a time of experiment equal to 180
minutes, given by the ratio (Equation 10.9)
c0 − c∞
β= (10.9)
c∞
In general, the higher is the value of β, the greater is the part of PAH4 elimi-
nated from smoked sausages and adsorbed onto LDPE. The values of β are
346 Advanced Technologies for Meat Processing, Second Edition

TABLE 10.11
Values of Minimized Parameters and Diffusion and Distribution Coefficients
Diffusion
Coefficients Distribution
D Coefficients
Compound c∞ c0 – c∞ (cm 2 /h) β 180

BaA 3.1 8.2 2.5 × 10−2 2.6

Chr 1.9 7.1 6.8 × 10−3 3.7
BbF 1.7 3.6 6.4 × 10−1 2.1
BaP 1.3 2.6 6.1 × 10−2 2.0
Source: Reprinted from Food Chemistry, 201, Semanová, J. et al., Elimination of polycyclic aro-
matic hydrocarbons from smoked sausages by migration into polyethylene packag-
ing, 1–6. Copyright 2016 with permission from Elsevier.

also listed in Table 10.11. As follows from these values, PAH4 was extensively
adsorbed onto LDPE and these values are, for example, higher by one order
in comparison to β values for polyethylene terephtalate (PET) packaging
(Šimko et al., 2004) which proves better suitability of LDPE for PAH elimina-
tion purposes in comparison to PET. Experimental data listed in Table 10.10
show that this procedure is a very effective tool for PAH4 elimination, when
the total PAH4 content was lowered by 81%, while reduction of individual
compound content varied between 72% and 89%. A measure of diffusion is
given—apart from other factors—also by D values for given media. As fol-
lows from Table 10.12, there is a great difference in D values for BaP between
liquid media (LSFs) and solid media (LDPE). As follows from the table, dif-
fusion of PAH4 in smoked sausages has migration properties closer to liquid
than to solid media, and therefore the process of PAH4 elimination will be
very effective. Moreover, this phenomenon could be expected also in other
similar food matrices such as bacon, salami, etc. Another important finding
is that the values of D are transferable to other geometry of smoked products,
and therefore they could be used for variously shaped smoked meat prod-
ucts. The advantage of application of the kinetic equation (Equation 10.8) is
based on the fact that by numerical solution of the equation for known values
of D and given co , it is possible to calculate the time at which PAH4 and/or
individual compound content decreases to a required value ct set by legisla-
tion. For example, in this experiment, the legislative limit (set by Commis-
sion Regulation No. 835/2011) of 12 μg/kg for PAH4 was reached in 28.57
minutes, and acceptable content of 11.9 μg/kg in 29.32 minutes, as also fol-
lows from Figure 10.13. Similarly, the legislative limit of 2 μg/kg for BaP was
reached in 10.41 minutes, and acceptable content of 1.9 μg/kg in 11.20 min-
utes. All these changes are in sharp contrast to nonpacked smoked sausages,
since the PAH4 content in them remained at a constant level during the
whole experiment, as shown in Figure 10.13 by (▲) points (Semanová et al.,
2016). A time gap also has a substantial effect on the measure of PAH content
Reduction of Contaminant Content in Processed Meats 347

TABLE 10.12
Values of Diffusion Coefficients for BaP in Various Media
D
Medium (cm 2 /h)

Liquid smoke flavor (Simko et al. 1994) 7.2 × 102

Low-density polyethylene (Simko et al. 1999) 6.9 × 10−14
Smoked sausage 6.1 × 10−2
Sources: Reprinted from Food Chemistry, 201, Semanová, J. et al., Elimination of
polycyclic aromatic hydrocarbons from smoked sausages by migration
into polyethylene packaging, 1–6. Copyright 2016 with permission
from Elsevier. Reprinted from Food Chemistry, 50, Šimko, P. et al., Kinet-
ics of polycyclic aromatic hydrocarbons sorption from liquid smoke
flavor into low density polyethylene packaging, 65–68. Copyright 1994
with permission from Elsevier. Reprinted from Food Chemistry, 64,
Šimko, P. et al., Removal of polycyclic aromatic hydrocarbons from
water by migration into polyethylene, 157–161. Copyright 1999 with
permission from Elsevier.

40

35

30
PAH4 content (μg/kg)

25

20

15

10

0
0 50 100 150 200
Time (min)

FIGURE 10.13
Total changes in PAH4 content in nonpacked smoked sausages (▲) and smoked sausages
packed into polyethylene (■). Legislative limit PAH4 content equal to 12 μg/kg is marked
by dashed line, dependence of PAH4 content upon time calculated by kinetic Equation 10.8 is
marked by the black curve. Variability of experimental data is marked by error bars. (Reprinted
from Food Chemistry, 201, Semanová, J. et al., Elimination of polycyclic aromatic hydrocarbons
from smoked sausages by migration into polyethylene packaging, 1–6. Copyright 2016 with
permission from Elsevier.)

reduction between finishing the smoking and the package operation itself.
As follows from Table 10.13, there is a great difference between distribution
coefficients measured in sausages packed immediately after smoking, and
after a 12-hour delay. This fact could be brought about by migration of PAHs
into meat product bulk and therefore extension of the method of migration,
348 Advanced Technologies for Meat Processing, Second Edition

TABLE 10.13
Values of Distribution Coefficients Measured in 120 Minutes of
Storage Experiment in Sausages Packed into LDPE Immediately (β 0)
and after 12-Hour Delay before Packaging (β 12)
Distribution Coefficients Distribution Coefficients
Compound β0 β 12

BaA 2.65 2.62

Chr 2.30 0.56
BbF 2.82 2.68
BaP 3.24 2.89
Average 2.75 1.85
Source: Data ß0 are reprinted from Food Chemistry, 201, Semanova, L. et al.,
Elimination of polycyclic aromatic hydrocarbons from smoked sau-
sages by migration into polyethylene packaging, 1 – 6, Copyright
(2016) with permission from Elsevier.
Data ß12 are so far unpublished data..

which affects, of course, the time of PAH content reduction. Also, incorpora-
tion of PAHs into liphophilic structures under the surface of meat products
could bring about their immobilization, which would affect global measure
of PAH removal from these foods.

10.3 General Conclusions

On the basis of the data and information mentioned above, the following
partial conclusions could be postulated:

1. PAHs are permanent contaminants formed during thermal decom-

position of organic matter such as wood, cholesterol, or other food
components.
2. PAHs have substantial carcinogenic effects on living organisms, and
therefore their content is limited by EU legislation.
3. PAH content may be limited by technological procedures such as
duration of thermal or smoke treatment, temperature of smoke gen-
eration, application of packaging materials protecting migration
of PAHs from surface into meat bulk, and photodecomposition of
PAHs deposited on the surface of meat products.
4. Apart from the mentioned procedures, PAHs can be also eliminated
by migration into a suitable plastic package.
5. Migration of PAHs into a plastic package—dominantly LDPE—is
driven by nonequal chemical potentials in package/meat systems,
expressed by PAH contents, or concentrations, respectively.
Reduction of Contaminant Content in Processed Meats 349

6. From the point of view of physical chemistry, the elimination is a

combined process composed of adsorption (as the prime process)
followed by diffusion (as the second process).
7. The process of PAH migration into LDPE is most effective when
smoking has just finished. A time delay before packaging would
bring about a decrease of the process due to migration of PAHs into
meat products’ bulk and their eventual incorporation and immobili-
zation in liphophilic structures.
8. Combination of both these processes offers the unique possibility to
eliminate these compounds from the food matrix and elevate food
safety in foods, where another process of elimination is impossible,
or banned by legislation.

Acknowledgment
This contribution is the result of a project funded by the Slovak Scientific
Grant Agency VEGA No. 1/0487/16.

References
Abramowitz, M. and Stegun, I. A. (1964). Handbook of Mathematical Functions.
Washington, DC: National Bureau of Standards.
Adamson, A. W. (1990). Physical Chemistry of Surfaces. New York, NY: John Wiley &
Sons.
Afolabi, A. O., Adesulu, E. A. and Oke, O. L. (1983). Polynuclear aromatic hydrocar-
bons in some Nigerian preserved freshwater fish species. Journal of Agricultural
and Food Chemistry, 31, 1083–1090.
Alonge, D. O. (1988). Carcinogenic polycyclic aromatic hydrocarbons (PAH) deter-
mined in Nigerian kundi (smoke-dried meat). Journal of the Science of Food and
Agriculture, 43, 167–172.
Alonge, D. O. (1987). Factors affecting the quality of smoke-dried meats in Nigeria.
Acta Aliment, 16, 263–270.
Andelman, J. B. and Suess, M. J. (1970). PAH in the water environment. Bulletin WHO,
43, 479–508.
Bartle, K. D. (1991). Analysis and occurrence of polycyclic aromatic hydrocarbons in
food. In: Creaser, C. and Purchase, R. (eds.) Food Contaminants, Sources and Sur-
veillance. Cambridge: The Royal Society of Chemistry, 41–60.
Bednáriková, A., Skláršová, B., Kolek, E. and Šimko, P. (2011). New rapid HPLC
method for separation and determination of benzo[a]pyrene hydroxyderiva-
tives. Polycyclic Aromatic Compounds, 31, 350–369.
Biesalski, H. K. (2005). Meat as a component of a healthy diet—Are there any risks or
benefits if meat is avoided in the diet? Meat Science, 70, 509–524.
Bouvard, V., Loomis, D., Guyton, K. Z. et al. (2015). Carcinogenicity of consumption of
red and processed meat. The Lancet Oncology. doi:10.1016/S1470-2045(15)00444-1.
350 Advanced Technologies for Meat Processing, Second Edition

Cai, J., Wang, S. and Su, Q. (2008). Analysis of polycyclic aromatic hydrocarbons
formed during off-line pyrolysis of ergosterol by GC–MS–SIM. Chromatographia,
68, 357–363.
Cranck, J. (1976). The Mathematics of Diffusion. Oxford: Clarendon Press, pp. 69–81.
Emmerson, E. P. (2011). Improving the sensory and nutritional quality of smoked
meat products. In: Kerry, J. P. and Kerry, J. F. (eds.) Processed meats: Improving
Safety, Nutrition and Quality. Cambridge: Woodhead Publishing, pp. 527–545.
Cai, J., Wang, S. and Su, Q. (2008). Analysis of polycyclic aromatic hydrocarbons
formed during off-line pyrolysis of ergosterol by GC–MS–SIM. Chromatographia,
68, 357–363.
Chen, J. and Chen, S. (2005). Removal of polycyclic aromatic hydrocarbons by low
density polyethylene from liquid model and roasted meat. Food Chemistry, 90,
461–469.
Christy, A. A., Lian, M. I. and Francis, G. W. (2011). Pyrolytic formation of polyaro-
matic hydrocarbons from steroid hormones. Food Chemistry, 124, 1466–1472.
Commission Directive 88/388/EEC on the approximation of the laws of the Member
States relating to flavorings for use in foodstuffs and to source materials for their
production. Official Journal of the European Union, L0388, 1991:1–10. Available
at http://ec.europa.eu/food/fs/sfp/addit_flavor/flav09_en.pdf (accessed
5 February 2016).
Commission Directive 2005/10/EC laying down the sampling methods and the meth-
ods of analysis for the official control of the levels of benzo(a)pyrene in foodstuffs.
Official Journal of the European Union, L34, 2 February 2005:15–20. Available at
http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=celex%3A32005R0208
(accessed 5 February 2016).
Commission Recommendation 2005/108/EC of February 4, 2005 on the further inves-
tigation into the levels of polycyclic aromatic hydrocarbons in certain foods.
Official Journal of the European Union, L34, 8 February 2003:43–45. Available at
http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2005:034:0043:
0045:EN:PDF (accessed 5 February 2016).
Commission Regulation (EC) 1881/2006/EC setting maximum levels for certain con-
taminants in foodstuffs. Official Journal of the European Union, L364, 20 December
2006:5–24. Available at http://eur-lex.europa.eu/LexUriServ/ LexUriServ.do?
uri=OJ:L:2006:364:0005:0024:EN:PDF (accessed 5 February 2016).
Commission Regulation (EC) No 333/2007 laying down the methods of sampling
and analysis for the official control of the levels of lead, cadmium, mercury,
inorganic tin, 3-MCPD and benzo(a)pyrene in foodstuffs. Official Journal of the
European Union, L88, 29 March 2007:29–38. Available at http://eur-lex.europa.
eu/LexUriServ/LexUriServ.do?uri=OJ:L:2007:088:0029:0038:EN:PDF (accessed
5 February 2016).
Commission Regulation (EC) 835/2011a amending Regulation (EC) No 1881/2006
as regards maximum levels for polycyclic aromatic hydrocarbons in foodstuffs.
Official Journal of the European Union, L215, 19 August 2011:4–8. Available at
http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:215:0004:
0008:EN:PDF (accessed 5 February 2016).
Commission Regulation EC No 836/2011b amending Regulation (EC) No 333/2007
laying down the methods of sampling and analysis for the official control of the
levels of lead, cadmium, mercury, inorganic tin, 3-MCPD and benzo(a)pyrene in
Reduction of Contaminant Content in Processed Meats 351

foodstuffs. Official Journal of the European Union, L215, 20 August 2011:9–16. Avail-
able at http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:
215:0009:0016:EN:PDF (accessed 5 February 2016).
Commission Implementing Regulation (EU) No 1321/2013 of 10 December 2013
establishing the Union list of authorised smoke flavouring primary prod-
ucts for use as such in or on foods and/or for the production of derived
smoke flavourings. Available at http://eur-lex.europa.eu/legal-content/EN/
TXT/?uriĽOJ:L:2013:333:TOC. (accessed 5 February 2016).
Djinovic, J., Popovic, A. and Jira, W. (2008). Polycyclic aromatic hydrocarbons (PAHs)
in different types of smoked meat products from Serbia. Meat Science, 80, 449–456.
European Commission, Health and Consumer Protection Directorate—General, Sci-
entific Committee on Food. (2002). Opinion of the Scientific Committee on Food
on the risk to human health of polycyclic aromatic hydrocarbons in food. SCF/
CS/CNTM/PAH/29 Final.
European Food Safety Authority. (2008). Scientific opinion of the panel on contami-
nants in the food chain on a request from the European Commission on polycy-
clic aromatic hydrocarbons in food. EFSA Journal, 724, 1–114.
Farhadian, A., Jinap, S. Hanifah, H. N. and Zaidul, I. S. (2011). Effects of meat pre-
heating and wrapping on the levels of polycyclic aromatic hydrocarbons in
charcoal-grilled meat. Food Chemistry, 124, 141–146.
Fasano, E., Yebra-Pimentel, I., Martínez-Carballo, E. and Simal-Gandara, J. (2016).
Profiling, distribution and levels of carcinogenic polycyclic aromatic hydrocar-
bons in traditional smoked plant and animal foods. Food Control, 59, 581–90.
Grimmer, G. and Böhnke, H. (1975). Polycyclic aromatic hydrocarbon profile analysis
of high protein foods, oils and fats by gas chromatography. Journal Association of
Official Analytical Chemists, 58, 725–733.
Hitzel, A., Pöhlmann, M., Schwägele, F., Speer, K. and Jira, W. (2013). Polycyclic aro-
matic hydrocarbons (PAH) and phenolic substances in meat products smoked
with different types of wood and smoking spices. Food Chemistry, 139, 955–62.
Guillén, M. D. (1994). Polycyclic aromatic compounds: Extraction and determination
in food. Food Additives and Contaminants, 11, 669–684.
Guillén, M. D., Sopelana, P. and Partearroyo, M. A. (2000). Polycyclic aromatic hydro-
carbons in liquid smoke flavorings obtained from different types of wood. Effect
of storage in polyethylene flasks on their concentrations. Journal of Agricultural
and Food Chemistry, 48, 5083–5087.
Kangsadalampai, K., Butryee, C. and Manoonphol, K. (1997). Direct mutagenicity of
the polycyclic aromatic hydrocarbon-containing fraction of smoked and char-
coal-broiled foods treated with nitrite in acid solution. Food Chemical Toxicology,
35, 213–218.
Larsson, B. K., Sahlberg, G. P., Eriksson, A. T. and Busk, L. A. (1983). Polycyclic aromatic
hydrocarbons in grilled food. Journal of Agricultural and Food Chemistry, 31,
867–873.
Ledesma, E., Rendueles, M. and Díaz, M. (2014). Benzo(a)pyrene penetration on a
smoked meat product during smoking time. Food Additives and Contaminants,
Part A, 1, 1688–1698.
Ledesma, E., Rendueles, M. and Díaz, M. (2015). Spanish smoked meat products:
Benzo(a)pyrene (BaP) contamination and moisture. Journal of Food Composition
and Analysis, 37, 87–94.
352 Advanced Technologies for Meat Processing, Second Edition

Ledesma, E., Rendueles, M. and Díaz, M. (2016). Contamination of meat products

during smoking by polycyclic aromatic hydrocarbons: Processes and preven-
tion. Food Control, 60, 64–87.
Lijinsky, W. and Shubik, P. (1964). Benzo[a]pyrene and other polynuclear hydrocar-
bons in charcoal-broiled meat. Science, 88, 145–153.
Lijinsky, W. and Ross, A. E. (1967). Production of carcinogenic polynuclear hydrocar-
bons in the cooking of food. Food and Cosmetics Toxicology, 5, 343–347.
Lorenzo, J. M., Purriños, L., Fontán, M. C. G. and Franco, D. (2010). Polycyclic aro-
matic hydrocarbons (PAHs) in two Spanish traditional smoked sausage variet-
ies: “Androlla” and “Botillo”. Meat Science, 86, 660–664.
Maga, J. A. (1987). The flavor chemistry of wood smoke. Food Reviews International, 3,
139–183.
McEnally, C. S., Pfefferle, L. D., Atakan, B. and Kohse-Höinghaus, K. (2006). Studies
of aromatic hydrocarbon formation mechanisms in flames: Progress towards
closing the fuel gap. Progress in Energy and Combustion Science, 32, 247–294.
Moisan, J. Y. (1985). Effects of oxygen permeation and stabiliser migration on polymer
degradation. In: Comyn J. (ed.) Polymer Permeability. Oxford: Elsevier.
Nelder, J. A. and Mead, R. A. (1965). A simplex method for function minimization. The
Computer Journal, 7, 308–313.
Nisbet, I. C. T. and La Goy, P. K. (1992). Toxic equivalency factors (TEFS) for polycyclic
aromatic hydrocarbons. Regulatory Toxicology and Pharmacology, 16, 290–300.
Pöhlmann, M., Hitzel, A., Schwägele, F., Speer, K. and Jira, W. (2013a). Polycyclic aro-
matic hydrocarbons (PAH) and phenolic substances in smoked Frankfurter-type
sausages depending on type of casing and fat content. Food Control, 31, 136–144.
Pöhlmann, M., Hitzel, A., Schwägele, F., Speer, K. and Jira, W. (2013b). Influence of
different smoke generation methods on the contents of polycyclic aromatic
hydrocarbons (PAH) and phenolic substances in Frankfurter-type sausages.
Food Control, 34, 347–355.
Purcaro, G., Moret, S. and Conte, L. S. (2013). Overview on polycyclic aromatic hydro-
carbons: Occurrence, legislation and innovative determination in foods. Talanta,
105, 292–305.
Regulation (EC) 2065/2003 of the European Parliament and of the Council on smoke
flavourings used or intended for use in or on foods. Official Journal of the Euro-
pean Union, L309, 26 November 2003:1–8. Available at http://eur-lex.europa.
eu/LexUriServ/LexUriServ.do?uri=OJ:L:2003:309:0001:0008:EN:PDF (accessed
on 5 February 2016).
Report of the Joint FAO/WHO Expert Commission on Food Additives. 1987. 31:20–
22. [Online]. Available at http://whqlibdoc.who.int/trs/WHO_TRS_759.pdf
(accessed 2 February 2016).
Report of the Joint FAO/WHO Expert Commission on Food Additives. 2005.
JECFA/64/SC: 32–38. [Online]. Available at ftp://ftp.fao.org/es/esn/jecfa/
jecfa64_summary.pdf (accessed 2 February 2016).
Richter, H. and Howard, J. B. (2000). Formation of polycyclic aromatic hydrocarbons
and their growth to soot—A review of chemical reaction pathways. Progress in
Energy and Combustion Science, 26, 565–608.
Roseiro, L. C., Gomes, A., Patarata, L. and Santos, C. (2012). Comparative survey of
PAHs incidence in Portuguese traditional meat and blood sausages. Food and
Chemical Toxicology, 50, 1891–96.
Reduction of Contaminant Content in Processed Meats 353

Roda, A., Simoni, P., Ferri, E., et al. (1999). Determination of PAHs in various smoked
meat products and different samples by enzyme immunoassay. Journal of the
Science of Food and Agriculture, 79, 58–62.
Rozentale, I., Stumpe-Viksna, I., Začs, D., Siksna, I., Melngaile, A. and Bartkevičs,
V. (2015). Assessment of dietary exposure to polycyclic aromatic hydrocarbons
from smoked meat products produced in Latvia. Food Control, 54, 16–22.
Semanová, J., Skláršová, B., Šimon, P. and Šimko, P. (2016). Elimination of polycyclic
aromatic hydrocarbons from smoked sausages by migration into polyethylene
packaging. Food Chemistry, 201, 1–6.
Sikorski, Z. E. (2004). Traditional smoking. In: Jensen, W. K, Devine, C. and Dikeman
M. (eds.) Encyclopedia of Meat Sciences, London, Elsevier, pp. 1265–1272.
Skláršová, B., Šimon, P., Kolek, E., Šimko, P. and Bednáriková, A. (2012). Non-
isothermal kinetics of benzo[a]pyrene photooxidation in glyceryl trioctanoate.
Polycyclic Aromatic Compounds, 32, 580–588.
Suranová, M., Semanová, J., Skláršová, B. and Šimko, P. (2015). Application of accel-
erated solvent extraction for simultaneous isolation and pre-cleaning up pro-
cedure during determination of polycyclic aromatic hydrocarbons in smoked
meat products. Food Analytical Methods, 8, 1014–1020.
Šimko, P. (1991). Changes of benzo(a)pyrene contents in smoked fish during storage.
Food Chemistry, 40, 293–300.
Šimko, P., Petrík, J. and Karovičová, J. (1992). Determination of benzo(a)pyrene in liq-
uid smoke preparations by high pressure liquid chromatography and confirma-
tion by gas chromatography-mass spectrometry. Acta Alimentaria, 21, 107–114.
Šimko, P. and Knežo, J. (1992). Influence of cooking on benzo(a)pyrene content in
frankfurters. Nahrung, 36, 208–209.
Šimko, P., Gergely, Š., Karovičová, J., Drdák, M. and Knežo, J. (1993). Influence
of cooking on benzo[a]pyrene content in smoked sausages. Meat Science, 34,
301–309.
Šimko, P. (2011). Heat and processing generated contaminants in processed meats. In:
Kerry, J. P. and Kerry, J. F. (eds.) Processed Meats: Improving Safety, Nutrition and
Quality. Cambridge: Woodhead Publishing, pp. 478–507.
Šimko, P., Gombita, M. and Karovičová, J. (1991). Determination and occurrence of
benzo[a]pyrene in smoked meat products. Nahrung, 35, 103–104.
Šimko, P. and Bruncková, B. (1993). Lowering of concentration of polycyclic aromatic
hydrocarbons in a liquid smoke flavour by sorption into polyethylene packag-
ing. Food Additives and Contaminants, 10, 257–263.
Šimko, P., Šimon, P., Khunová, V., Karovičová, J. and Drdák, M. (1994). Kinetics of
polycyclic aromatic hydrocarbons sorption from liquid smoke flavour into low
density polyethylene packaging. Food Chemistry, 50, 65–68.
Šimko, P., Khunová, V., Šimon, P. and Hrubá, M. (1995). Kinetics of sunflower oil con-
tamination with polycyclic aromatic hydrocarbons from contaminated recycled
low density polyethylene film. International Journal of Food Science and Technol-
ogy, 30, 807–812.
Šimko, P., Šimon, P. and Khunová, V. (1999). Removal of polycyclic aromatic hydro-
carbons from water by migration into polyethylene. Food Chemistry, 64, 157–61.
Šimko, P. (2002). Determination of polycyclic aromatic hydrocarbons in smoked meat
products and smoke flavouring food additives. Journal of Chromatography B, 77,
3–18.
354 Advanced Technologies for Meat Processing, Second Edition

Šimko, P., Šimon, P. and Belajová, E. (2004). Lowering of concentration of polycy-

clic aromatic hydrocarbons in liquid media by sorption into polyethylene tere-
phthalate—A model study. European Food Research and Technology, 219, 273–276.
Šimko, P. (2005). Factors affecting elimination of polycyclic aromatic hydrocarbons in
smoked meat foods and liquid smoke flavorings. Molecular Nutrition and Food
Research, 49, 637–647.
Škaljac, S., Petrović, L., Tasić, T. et al. (2014). Influence of smoking in traditional and
industrial conditions on polycyclic aromatic hydrocarbons content in dry fer-
mented sausages (Petrovská klobása) from Serbia. Food Control, 40, 12–18.
Tóth, L. and Blaas, W. (1972). Einfluss der Räeuchertechnologie auf den Gehalt von
geraeucherten Fleischwaren an cancerogenen Kohlenwasserstoffen. II. Einfluss
der Glimmtemperatur des Holzes sowie der Kuehlung, Waesche und Filtration
des Räeucherrauches. Fleischwirtschaft, 52, 1419–1422.
Tóth, L. and Potthast, K. (1984). Chemical aspects of the smoking of meat and meat
products, In: Chichester, C. O., Mrak, E. M. K. and Schweigert, B. S. (eds.)
Advances in Food Research. New York, NY: Academic Press, pp. 87–158.
Wilms, M. (2000). The developing of modern smokehouses—Ecological and economi-
cal aspects. Fleischwirtsch Int, 80, 4–5.
Wretling, A., Eriksson, A., Eskhult, G. A. and Larsson, B. (2010). Polycyclic aromatic
hydrocarbons (PAHs) in Swedish smoked meat and fish. Journal of Food Composi-
tion and Analysis, 23, 264–72.
Zelinkova, Z. and Wenzl, T. (2015). The occurrence of 16 EPA PAHs in food—A review.
Polycyclic Aromatic Compounds, 35, 248–84.
11
Nutrigenomics in Food-Producing Animals

Werner G. Bergen

CONTENTS
11.1 Introduction .............................................................................................. 355
11.2 Application of Genomics to Current Issues in Animal Agriculture... 356
11.3 Reductionism to Global Gene Expression—Overview ...................... 357
11.4 Global and Targeting Differential Gene Expression Studies in
Farm Animals............................................................................................................... 358
11.5 Experimental Approaches to Nutrigenomics Research ..................... 360
11.6 Long-Chain Fatty Acids as Nutrigenomic Effectors........................... 360
11.7 Conjugated Linoleic Acids as Regulators of Fatty Acid Synthesis ... 361
11.8 The Role of High-Energy Diets in Promoting IMF Deposition in
Finishing Cattle ........................................................................................................... .. 364
11.9 Glucose versus Acetate as Precursors for IMF .....................................364
11.10 Conclusions and Future Trends ............................................................. 366
References............................................................................................................. 366

11.1 Introduction
It has been well established that foodstuffs contain three classes of macromole-
cules (carbohydrates, lipids, and proteins) which supply energy (carbohydrates
and lipids) and protein building blocks for animals to function and maintain
themselves. As our knowledge of the effect of many individual compounds/
nutrients in foodstuffs increased (this statement does not include vitamins),
it was recognized that there were other possible contributions of such com-
pounds on specific aspects of regulation of metabolism. Thus, beyond func-
tion in cellular components (as plasma membranes, enzymes, glycogen, etc.),
some of these compounds appeared to have “bioactive/pathway controlling
properties” which may be used in a nutraceutical sense to combat health
issues as well as promote animal production and the quality and character-
istics of muscle foods. Many of these bioactive nutrients interact/bind with
transcription factors (TFs) to regulate major metabolic pathways to regulate
metabolism at the transcriptomic/functional genomics level; this is referred
to as nutrigenomics. These potential, other putative functions of food compo-

355
356 Advanced Technologies for Meat Processing, Second Edition

nents have created great excitement particularly in the realm of human nutri-
tion and health. There may also be opportunities for regulatory manipulations
by dietary components during animal production. In this chapter, issues of
nutrigenomics in animal nutrition and production will be explored. Two dif-
ferent/divided concepts have been formulated when relating dietary nutrients
content to animal metabolism. These two aspects of nutrient/gene function
relationships have been coined nutrigenetics, the concept that a given nutri-
tion regime has been formulated to satisfy all nutrients requirement based
on genetic potential, and nutrigenomics, the concept that a feed component
may affect physiological function by altering gene expression either directly or
indirectly in animals (Joffe and Houghton, 2016).

11.2 Application of Genomics to Current

Issues in Animal Agriculture
Improving the efficiency of animal production and optimizing the quality
of the animal products have been a long-term goal of the livestock industry.
To varying degrees, the definitions of quality of muscle foods have differed
over the years. In the past, animal fat was considered a positive attribute of
meat products, but today a lean product with just enough fat to optimize fla-
vor and the eating experience is preferred. Such goals have been actualized
with various production and animal selection practices. What stands out is that
contemporary meat animals (at least in North America) can be characterized
as lean and heavier muscled while carrying much less fat than their predeces-
sors. In the last 50 plus years, serious efforts have been made to select for lean
animals by traditional means, which resulted in today’s animals. These genetic
selections based on body composition changes have implications in nutrition,
management, and harvesting techniques for these animals, and the further
handling of the animal products. While there has been considerable success
in increasing lean (protein) gains with much lower whole-body depot fat gains
(subcutaneous and visceral fat) in animal production, such emphasis on lean-
ness also has a negative effect on the small adipose depots within skeletal mus-
cle (intramuscular fat [IMF]). These fat depots are associated with organoleptic
properties of the muscle foods. In addition, tenderness is a highly valued prop-
erty of meat (especially beef). Thus, currently animal production procedures
are geared toward maximizing lean (protein) gains, counterbalanced by nutri-
tional regimes that will also encourage more depot fat and IMF deposition.
There is interest by some producers (consumers) to make available
increased amounts of so-called “healthy” meat products, in particular grass-
fed beef (Ruminants). Grass is a relatively low source of dietary energy and
animals will not develop IMF except when animals are fed for a long time
period. Such a long time span greatly lowers production efficiency (high
Nutrigenomics in Food-Producing Animals 357

maintenance energy input) and greatly increases the carbon footprint of

such practices. Animals selected for high efficiency of production often do
not get adequate dietary energy in such a feeding system and their genetic
potential (nutrigenetics) for lean growth is not met. In many cases, tenderness
and organoleptic properties are undesirable in muscle foods arising from
such production regimes. Clearly, the so-called health benefits are difficult
to discern other than that grass-fed beef is a low-fat food product. To date,
no one has identified any major change in carcass components that may be
construed to provide “additional” health benefits. To date, gene expression
works with pasture finished beef have not uncovered putative enzymatic
pathways, TFs, or compositional factors that would increase the health value
of such products (Burnett, 2014).
Questions about molecular regulation of IMF deposition (marbling), fat
deposition in general, lean growth, overall energetic efficiency, and beneficial
factors in animal products are all amenable to targeted or genome-wide gene
expression/association studies (Williams et al., 2016). Such data, however, are
descriptive; further application-type research based on such nutrigenomics
data must be done to actualize any benefits. A number of excellent reviews
about the role of nutrigenomics in animal production and animal products
development have recently been published (Bionaz et al., 2015; Loor et al.,
2015; Picard et al., 2015). In addition, some selected publications emphasizing
other functional genomics techniques related to food animals are Graung-
nard et al. (2009), Graungnard et al. (2010), Komolka et al. (2014), Loor et al.
(2013), Guo et al. (2014), Lancaster et al. (2014), Roberts et al. (2015), and Loor
et al. (2015). This literature has been steadily growing over the last decade.

11.3 Reductionism to Global Gene Expression—Overview

The hallmark of much of biochemistry and physiology research has been
and still is reductionism. Here, a biological process has been observed and
then a causative delineation is accomplished by isolating organs, then tissue
slices, perfusions, cells, and then cell fractionation into nuclei, mitochondria,
endoplasmic reticulum, and cytosol. Activities of relevant enzymes are mea-
sured in the various fractions and these data were interpreted by relating to
whole cells, organs, and whole body function. To attempt a more metabolic
interactive holistic approach, reductionist data are utilized in so-called mod-
eling systems concerning animal nutrition and metabolism for interpreta-
tion and application (Baldwin et al., 1987; France et al., 1987; Johnson et al.,
2012; Tedeschi et al., 2013).
Contemporary experimental approaches utilize high-throughput tech-
nologies in studying genomes (DNA sequences, single-nucleotide poly-
morphism [SNP]), genome function or transcriptomics (messenger RNA
358 Advanced Technologies for Meat Processing, Second Edition

[mRNA]), protein synthesis, folding, and function or proteomics along with

assessments of metabolic profiles in body and tissue fluids or metabolomics.
When focusing strictly on lipid metabolites, this is often referred to as lipi-
domics. All these procedures can lead to a tremendous accumulation of raw
data which have to be calculated, sorted, and adjusted for inherent method-
ological errors, statistical evaluation, and finally pathway-network analyses.
The results can then be matched to biological processes and interpreted in
line with the experimental design and hypotheses. Traditional reductionist-
based life science researchers have had little difficulty engaging in modern
analytical procedures and equipment. What is often lacking is the ability to
boil down the plethora of data into useful terms; this requires the application
of bioinformatics. Hence, omics research teams typically include biofor-
maticists. While totally comprehensive analysis of the genome, functional
genome, proteome, and metabolome for a given situation in animal produc-
tion is very useful, nevertheless the work is also very expensive.
All too often people have confidence in equipment, but the proper initial
isolation of biological substances (particularly nucleic acids) and purity are an
overwhelmingly important starting point for many “omic” studies. The most
elaborate downstream equipment and capacity cannot obtain useful data
with poor-quality samples. Unfortunately, some researchers unwittingly fail
to recognize this pitfall.

11.4 Global and Targeting Differential Gene

Expression Studies in Farm Animals
The scope of functional genomic assessments has included organs such as
liver, skeletal muscle, adipose tissue, mammary tissue, connective tissue and
blood, heart, cancer tissue, and gut epithelium along with the whole tract
microbiome. In the food animal production area (but not disease related),
principal tissues have been muscle, adipose of various depots, liver, gastro-
intestinal tract epithelium, and the gut microbiome. Much of the work with
the gut microbiome has centered on metagenomics of organism diversity
ranging from archaea, bacteroides, and firmicutes to prevotella (Kim et al.,
2014; McCann et al., 2014) but this will not be considered in this chapter.
Early work in differential gene expression (DE) utilized complemen-
tary DNA (cDNA) probes and Northern analysis of mRNA. In the bio-
medical field, where the focus was rodent biology, an huge inventory of
such probes were developed as the GenBank sequence data for individ-
ual genes started to grow; however, many of these rodent-based probes
could not be used without further development as probes for homologous
genes in cattle or pigs. This development process was aided immensely as
GenBank submissions increased for cattle, pigs, and other farm animals.
Nutrigenomics in Food-Producing Animals 359

In contemporary times, animal species involved with food production have

been sequenced to various degrees of completeness; however, sequence
data on many promoters and structural genes are generally available. In
early, gene expression work only a limited number of genes were sub-
jected to DE analysis (Reiter et al., 2007; Halsey et al., 2011), but as real-time
(quantitative) reverse transcriptase-polymerase chain reaction (RT-PCR)
evolved as a main tool for DE, the number of target genes studied in single
experiments has greatly expanded (Graugnard et al., 2010; Key et al., 2013;
Perkins et al., 2014a,b).
When assessing DE for a set of target genes representing different metabolic
pathways (such as peroxisome proliferator-activated receptor alpha [PPARα]
for fatty acid catabolism and peroxisome proliferator-activated receptor
gamma [PPARγ] for adipogenesis) (Reiter et al., 2007) was done using North-
erns or PCR, biological interpretation of results could be readily based on
basic understanding of biochemical pathways and accumulated DE data for
such genes. The application of microarrays and more recently RNA deep
sequencing has enabled researchers to simultaneously assess DE for thou-
sands of genes within a given sample. Except for noting how many genes
were up- or downregulated and checking on DE of specific individual genes,
a full assessment of such results can only be completed using bioinformatics
computer programs and tools (e.g., Ayuso et al., 2015) including Ingenuity
Pathway Analysis (IPA), enriched gene ontology (GO)-terms analysis, struc-
tural variant analysis, and regulatory TFs analysis. Before any statistical and
system biology analyses can be made, however, genes must be evaluated
according to a minimum mean group expression threshold, a set level of
fold-change DE (such as 1.5, 2, or greater), and an application of appropriate
false discovery rates values. The application of these statistical concepts and
pathway analysis of data will not be further discussed here. These interpre-
tive workups of the massive data can then be assessed as networks from
IPA and enriched biological function related to an overall criterion, such
as structural genes, within pathway genes (glycolysis, fat lipolysis), and so
forth. In addition, a new wrinkle has emerged in that gene expression can be
attenuated at the posttranscriptional level by gene silencing. This is achieved
by mRNA degradation or interference at the translation level by microRNA.
Present in the genome are DNA sequences for specific microRNA which
regulate expression of a given gene (Roberts 2015b; Svoboda et al., 2016).
Thus, differential microRNA analysis adds an additional dimension to the
interpretation of deep RNA sequencing analyses. Unfortunately, pathway
analysis may predict differential expression of genes for a given pathway
based on up- or downregulation of a given gene. Ultimately, the function of
a pathway is dependent, however, on the pathway’s rate-limiting enzyme,
thermodynamic considerations, and substrate concentration. Thus, a down-
stream gene may demonstrate wide DE fluctuations with various treatments
but it may be unlikely that this will have any effect on the biochemical func-
tion of a pathway.
360 Advanced Technologies for Meat Processing, Second Edition

11.5 Experimental Approaches to Nutrigenomics Research

Experimental approaches in vivo can vary depending on the hypotheses
to be assessed. The most frequent experimental treatments would be a
DE response study to some food source, specific nutrients/molecules, and
varying intakes of a given diet. Such experiments can be completed in a fairly
short term and samples taken for appropriate “omics” analyses. While often
not complicated from the actual execution standpoint, time course studies
(e.g., neonatal, nursing, and growth finishing phases) with agricultural ani-
mals that require slaughter need extensive animal resources for the overall
validly and analysis, and such studies are therefore expensive. Other studies
will track genetic progress at the genome level for some trait over genera-
tions as, for example, selection for residual feed intake, marbling propen-
sity, rate of growth, protein deposition, and fattening. These types of studies
require the maintenance of large herds or flocks through many generations.
Finally, cell culture studies may also be useful for DE work with a whole host
of potential treatments and incubation protocols.
Functional genomics and transcriptomic research laboratory protocols
require optimal sampling procedures and the isolation of high-quality RNA.
When conducting genome-wide association studies, genotyping and SNP
analysis of good quality DNA is also required. Unfortunately, RNA is much
less robust than DNA and always subject to possible degradation during
isolation from tissues and cell cultures.

11.6 Long-Chain Fatty Acids as Nutrigenomic Effectors

Long-chain fatty acids are highly hydrophobic molecules involved in numer-
ous structural and dynamic cell functions, including serving as a highly
concentrated form of metabolic energy, cell membrane composition and
fluidity, functioning as regulatory ligands, and controlling gene expression
(Jump et al., 2013, 2015). It is the latter area where dietary long-chain fatty
acids may display nutrigenomic properties. In particular, highly unsatu-
rated omega-3 fatty acids (HUFAs) have been shown to attenuate hepatic
gene transcription and lipogenesis. A number of TFs are involved in this
role of transcriptional regulation by polyunsaturated fatty acids (PUFAs) in
the liver including SREBP-1c, PPARγ, and PPARα. HUFAs/PUFAs may affect
transcription directly by binding to TFs or indirectly via binding to other
TFs and coactivators (e.g., Ou et al., 2001; DeBose-Boyd et al., 2001; Jump
et al., 2013; Teran-Garcia et al., 2002). In humans, development of nonalco-
holic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH)
parallels with the development of obesity and type 2 diabetes. Hence, ώ-3
Nutrigenomics in Food-Producing Animals 361

HUFAs (eicosapentaenoic acid [EPA] 20:5 ώ 3; docosahexaenoic acid [DHA]

22:6 ώ-3) have been tested to specifically ameliorate pathologic lipid accu-
mulation in mouse fatty liver models. Dietary DHA showed a much stron-
ger response in attenuating liver lipid accumulation than EPA (Jump et al.,
2013). Other similar studies have had similar results and emerging transla-
tion issues into human medicine include how much HUFA must be admin-
istered to be effective in combatting NAFLD. A proposed mechanism of
phytochemical (botanicals; ώ-3 PUFA) related nutrigenomics effects in ani-
mals can be found elsewhere (Luo et al., 2016).
In pigs and cattle, the primary sites of lipogenesis are the adipose tis-
sues (Bergen and Mersmann, 2005). To evaluate nutrigenomics effects on de
novo fatty acid synthesis by PUFA/HUFA in pigs, studies were conducted
to monitor effects of long-chain PUFA on de novo fatty acid synthesis in
porcine adipose tissues. Preliminary studies in my laboratory showed that
in porcine adipose, as in rodent liver, ώ-3 HUFA (from fish oil) and to some
extent ώ-6 PUFA will lower expression of some genes involved in de novo
fatty acid synthesis. Once again, the issue of optimal dosage is an important
factor in translational application of this work. Flaxseed (linseed oil) and
canola oil are sources of 18-carbon ώ-3 fatty acids (linolenic acid). Over the
years, some work has been done with these ώ-3 PUFA sources to evaluate
their influence on fat deposition and marbling characteristics in pigs. The
hypothesis was that ώ-3 PUFAs will depress overall body fat accretion, but
these PUFAs as dietary fatty acids will also be channeled to IMF. This would
presumably result in leaner pork with increased ώ-3 fatty acid content. On
balance, to date such experiments have not yet demonstrated that feeding of
ώ-3 fatty acids attenuate fat synthesis and change the fatty acid profile in IMF
of pigs. Application of this possible nutrigenomic effect of plant ώ-3 fatty acid
sources to attenuate fat deposition and possibly enhance marbling in com-
mercial pork production is minimal.

11.7 Conjugated Linoleic Acids as Regulators

of Fatty Acid Synthesis
As far back as the 1800s, a relationship between high-grain diets and butter
fat production in lactating was observed. In the last third of the twentieth
century, it was noted that there may be a molecule(s) of lipid nature in rumi-
nant animal products (meat, milk, and cheese) that would have antiobesity
and cardioprotective effects in animals (Wang and Jones, 2004; Shen and
McIntosh, 2016). A team of workers led by Professor M. W. Pariza (University
of Wisconsin-Madison, WI) identified these lipid molecules as conjugated
linoleic acids (CLAs) (Ha et al., 1987; Pariza et al., 2001). CLAs are a group
of unsaturated positional and geometric isomers of linoleic acids (cis, cis
362 Advanced Technologies for Meat Processing, Second Edition

nonconjugated 18:2) that initially were touted to be a novel nutrigenomic

molecule useful for the treatment of obesity and associated maladies. Since
beef and dairy products were a source of CLA, strategies were implemented
to advance consumption of these food products based on the presence of
bioactive components. Further research was initiated to somehow increase
CLA concentrations in ruminant animal products and it was speculated that
bison provided muscle foods with higher CLA content than beef. After a
number of clinical intervention trials, it was soon noted that potential daily
consumption of endogenous CLA from beef or milk products (100–200 mg)
was too low to have desired antiobesity effects. About 3 g daily of CLA as a
50–50 mixture of c9, t11 and t10, c12 CLA (active isomer) is usually needed
for notable antiobesity effects in humans. Highly concentrated CLA supple-
ments are now available for human use but their overall effectiveness is
still not fully clear. From a mechanistic perspective, the t10, c12 CLA isomer
reduces adiposity by enhancing lipolysis, fat oxidation, and depressing de
novo fatty acid synthesis (Shen and McIntosh, 2016).
Milk fat depression (MFD) was a generally recognized issue when lactating
cows are fed diets high in readily fermentable carbohydrates. While initially
workers tried to relate MFD to shifts in the acetate/propionate molar ratio
in rumen fermentation, the role of biohydrogenation of PUFA (linoleic acid)
from high-energy feeds was later related to MFD. Then it was observed that
18:2 hydrogenation resulted in incomplete saturation of all 18:2. Thus, rumen
trans-linoleic acid conjugated intermediates of c9, t11 and t10, c12 arose which
could be further reduced to trans 11 C 18:1 and trans 10 C 18:1, both of which
can be reduced to stearic acid. All these intermediates were found in milk
and adipose fat of ruminants. The 18:1 trans-fatty acids could also be recon-
verted to c9 t11 and t10 18:1 CLA by tissue stearoyl-CoA desaturase. In any
case, it has now been well established that t10 c12 is the active CLA in MFD
(inhibition of mammary de novo fatty acid synthesis), decreasing adipose
de novo fatty acid synthesis in nonruminants and nonlactating cows, but
increasing de novo fatty acid synthesis in adipose of lactating cows fed an
MFD diet (Bauman and Griinari, 2003; Bauman et al., 2011).
The potential of CLA in enhancing the quality and composition of nonru-
minant food animals has been studied over the last 25 years. It was shown
when fed to pigs, CLA reduced back fat, increased marbling scores, and
increased IMF by increasing IMF adipocyte size rather than number (Barnes
et al., 2012). Administration of CLA to steers or bovine adipocytes in culture
lowered adipose lipid deposition (Smith et al., 2009). Interestingly in lactating
dairy cows, t10, c12 CLA inhibits mammary de novo lipogenesis but adipose
tissue lipogenesis is actually increased (Thomas and Moore, 1953; Harvatine
et al., 2009; Bauman et al., 2011; Bergen, 2009).
As indicated above, many bioactive molecules bind to TFs, which can then
turn on/off given metabolic pathways through activating transcription of
the TF target genes. Workers have strategically explored the nutrigenomics
potential of molecules in animal production by targeting functionally
Nutrigenomics in Food-Producing Animals 363

related TF as related to animal production. The current ongoing discovery

research in gene expression responses to multiple variables in animal pro-
duction systems (related to nutrient intake, environmental constraints, man-
agement, and husbandry procedures) has identified some key TFs that could
affect efficiency of animal foods production and quality. Research indicated
that nutrigenomics-based DE findings in this regard tend to revolve around
fat synthesis and oxidation with TF such as PPARα, PPARγ, SREBP-1c, and
PPCoactivator 1 α (PGC1α) mostly implicated in adipose and muscle tissues
(Wahli and Michalik, 2012). The involvement of TF regulating protein syn-
thesis has been much more difficult to identify as this metabolic process is to
a large extent under translational or posttranscriptional control. Thus, prog-
ress in finding other nutrigenomic molecules that will affect muscle protein
synthesis and degradation has been slow. The issue is that such molecules
(often amino acids, cAMP-stimulating agents, or beta-adrenergic agonists)
either involve substrate level of amino acids effects or interactions with
receptors which could affect both transcription and translation, respectively.
These molecules in this context could at best be called “quasi-nutrigenomic”;
however, they may affect gene expression. The beta-adrenergic agonists
attenuate lipogenesis primarily via transcriptomic regulation while enhanc-
ing lipolysis and fatty acid oxidation via regulation of both gene expression
and posttranscriptional processes. Other work has also shown that beta-
agonists enhance myofibrillar synthesis (increase in alpha actin and myosin
mRNA) and attenuate muscle protein degradation in beef cattle and pigs
(Skjaerlund et al., 1993) by pre- and posttranslational regulation. Unfortu-
nately, more often than not the extent of marbling is also lowered by beta
agonists thereby affecting the organoleptic properties of beef and pork. The
amino acid leucine has a nutrigenomics-like effect on translation processes
(Columbus et al., 2013). Leucine stimulates the target of rapamycin (mTOR)
system whereby initiation factors and their binding proteins (eIF2 and eIf4
family) are activated to support enhanced protein synthesis; however, these
actions are not mediated via DE. Numerous studies have shown that leucine
administration will increase myofibrillar protein synthesis under conditions
where increased translation can occur (Columbus et al., 2013). Extra leucine
appears to have a beneficial effect in neonates, but broad application of this
concept to increasing animal protein production has been limited.
A relatively new paradigm in digestive physiology is that the digested
nutrients (amino acids, sugars, and fatty acids) may have direct effects on the
overall integrity of the mucosal epithelial cells. Work first with the rumen
microbiome and then the lower gut microbiome showed that the anaerobic
fermentations of feed and undigested foods, respectively, may produce bio-
active molecules that may be critical for the well-being of gut epithelial cells.
For example, the short-chain fatty acid (SCFA) butyrate arising from colonic
fermentation has been implicated in the attenuation of colonic cell cancer.
Colon cancer is characterized by rapid proliferation of colonocytes; this
proliferation may be modified by butyric acid. Since the extent of butyrate
364 Advanced Technologies for Meat Processing, Second Edition

production can be influenced by undigested food/prebiotics there has been

great interest in understanding a putative role of butyric acid on colon cancer
and health. Similarly, the pregastric fermentation in the rumen produces
butyric acid (and other molecules) and the butyrate may possess beneficial
effects on the rumen epithelium (Minuti et al., 2015). Ruminal biohydroge-
nation of PUFAs and CLAs has already been described previously in this
chapter. To what degree nutrigenomic-like actions of gastrointestinal micro-
biome fermentations will effect animal production is not clear, but this area
is receiving increased research attention.

11.8 The Role of High-Energy Diets in Promoting

IMF Deposition in Finishing Cattle
Beef cattle consuming relatively low-net-energy feeds such as most grasses
and forages during the finishing phase show a slow expression of finish
and marbling; animals must be fed for extended periods to achieve fin-
ish and adequate marbling on such dietary regimes. To this end, after the
growing and often backgrounding phase, feeder cattle are placed on high-
energy, readily fermentable carbohydrate diets (such as starch in corn) and
a desirable finish and acceptable marbling in beef is achieved after a few
months of consuming the finishing diet. It has been shown that fat depo-
sition becomes the principal anabolic process once animals have reached
their lean carcass peak. This switch in priority of energy nutrient utili-
zation (or nutrient partitioning) to continue fat deposition as lean tissue
deposition slows significantly (Bergen, 1974; Prior and Scott, 1980; Smith
and Crouse, 1984; Smith et al., 2009; Smith and Johnson, 2016) has also
been related to an increased rate of marbling at that point.
The population of IMF adipocytes is very dynamic, ranging from preadi-
pocytes to fully mature adipocytes. This is also accompanied in shifts in
DE of adipogenic (differentiation) and lipogenic genes (fat synthesis) as IMF
adipocytes accumulate. Pethick et al. (2004) noted that the fractional rate of
IMF fat accretion is similar to that of the major depot fat sites.

11.9 Glucose versus Acetate as Precursors for IMF

The primary precursor for fatty acid synthesis is acetic acid in rumi-
nants (cattle) and glucose in nonruminants (pigs, rodents). The rumen
fermentation of all but high-starch-containing feeds produces princi-
pally acetic acid, but production of the two other SCFA is also prevalent
Nutrigenomics in Food-Producing Animals 365

(propionic acid and butyric acid). Consuming diets high in readily ferment-
able carbohydrates (starch from zea maize), as typical in finishing diets for
cattle in the United States, produces a higher molar percent of propionic acid
of the total SCFA production. Propionic acid can be channeled directly into
hepatic gluconeogenesis since it can enter the anapleoretic portion of the
citric acid cycle via succinate. While the present consensus is that in major
adipose depots (subcutaneous, visceral, pelvic, kidney, and IMF), acetate is
the principal substrate for de novo fatty acid synthesis in ruminants (Bergen
and Mersmann, 2005), there is some evidence that in the IMF adipocytes of
high-energy diet fed steers, glucose (from propionic acid) may be the pri-
mary carbon source for de novo fatty acid synthesis possibly accounting
for a rapid rise in intensity of marbling in the finishing phase. These con-
clusions were based on in vitro incubations of various lipogenic substrates
with ruminant liver and adipose slices and with in vivo infusions of radio-
labeled acetate and glucose (Prior and Scott, 1980; Smith and Crouse, 1984).
It should be noted here that in ruminants as compared to rodents, de novo
fatty acid synthesis is minimal in liver (Bergen and Mersman, 2005). Acetic
acid as acetyl-CoA is a precursor of de novo fatty acid synthesis in the cyto-
sol and available directly from the rumen fermentation; however, glucose
by itself is not a direct substrate for lipogenesis, and there appears to little
real biochemical advantage to glucose as a lipogenic substrate in ruminants.
Glucose must proceed through glycolysis and then early reactions in the
mitochondrial tricarboxylic acid (TCA) cycle to obtain citrate from which
then AcCoA arises in the cytosol upon citrate cleavage. A benefit of glucose
may be related to stimulation of glucose transporters and the possibility
of enhanced nicotinamide adenine dinucleotide phosphate (NADPH+H)
production for reducing fatty acid carbon skeletons in IMF adipocytes. Fur-
ther, acetic acid can never be converted to glucose and since glycerol (aris-
ing from glyceroneogenesis) is essential for the synthesis of triglycerides
(triacylglycerols), the potential role of glucose in IMF lipogenesis may be
significant. In this sense, propionic acid can be similar to a nutrigenomic
molecule in that when present in adequate concentrations, this SCFA is not
only an energy substrate for ruminant tissues, but also redirects regulation
of lipogenesis in ruminant adipose tissues.
Questions about lipogenic precursors in ruminant for de novo fatty
acid synthesis have, however, not been fully answered. Recently, workers
(Nayananjalie et al., 2015) established a precocious fat deposition model by
feeding weaned steer calves high-energy diets, followed by growing and fin-
ishing regimes. This experimental model was then utilized to assess differ-
ential incorporation of glucose and acetate into subcutaneous, intramuscular,
and visceral palmitic acid. To determine differential utilization of lipogenic
substrates, these finished cattle were infused with either (2H3) acetic acid or
(U-13C6) glucose. Results showed that irrespective of location of the fat depot,
fractional synthesis rates of palmitic acid from acetate were about 13-fold
higher than rates observed for glucose. This recent study clearly indicates
366 Advanced Technologies for Meat Processing, Second Edition

that acetate is the highly preferred precursor for de novo fatty acid synthesis
for all fat depots in ruminants.

11.10 Conclusions and Future Trends

Our understanding of the impacts of nutrigenomics on production, health,
and disease of food animals is just emerging. This research field is emerg-
ing as an ongoing culmination of application of all the genomics, tran-
scriptomics, and bioinformatics to animal systems. Potential downstream
benefits of nutrigenomics research have largely not yet impacted animal
agriculture and discovery of many hitherto unknown nutrient–genome
interactions are anticipated in the future. In this chapter, a number of top-
ics in nutrigenomics that currently represent this rapidly advancing field of
knowledge are described. Potential nutrigenomic effects of amino acids have
not been discussed in detail as we cannot readily separate amino acids’ role
as protein building blocks, impacts on hormonal status and gene expres-
sion. From an era of technological innovations and new tools in agriculture
(global positioning system [GPS], use of computer technology, minimum till-
age, more efficient planting, and harvesting equipment and animal housing)
we are now engaged in the discovery and application of biological innova-
tions beyond traditional selection and propagation techniques to secure an
adequate, wholesome food supply for an ever-expanding human population.

References
Ayuso, M., Fernández, A., Núñez, Y. et al. (2015). Comparative analysis of muscle tran-
scriptome between pig genotypes identifies genes and regulatory mechanisms
associated to growth, fatness and metabolism. PLOS ONE, 22, 10:e0145162.
doi:10.1371/journal.pone.0145162.
Baldwin, R. L., France, J., Beever, D. E. et al. (1987). Metabolism of the lactating dairy
cow. III. Properties of mechanistic models suitable for evaluation of energetic
relationships and factors involved in the partition of nutrients. Journal of Dairy
Research, 54, 133–145.
Barnes, K. M., Winslow, N. R., Shelton, A. G. et al. (2012). Effect of dietary conju-
gated linoleic acid on marbling and intramuscular adipocytes in pork. Journal of
Animal Science, 90, 1142–1149.
Bauman, D. E. and Griinari, J. M. (2003). Nutritional regulation of milk fat synthesis.
Annual Review of Nutrition, 23, 203–227.
Bauman, D. E., Harvatine, K. J. and Lock, A. L. (2011). Nutrigenomics, rumen-derived
bioactive fatty acids, and the regulation of milk fat synthesis. Annual Review of
Nutrition, 31, 299–319.
Nutrigenomics in Food-Producing Animals 367

Bergen, W. G. (1974). Protein synthesis in animal models. Journal of Animal Science, 38,
1079–1091.
Bergen, W. G. (2009). Milk-fat depression and lipid repartitioning in lactating dairy
cows. Journal of Nutrition, 139, 826–827.
Bergen, W. G. and Mersmann, H. J. (2005). Comparative aspects of lipid metabolism:
Impact on contemporary research and use of animal models. Journal of Nutrition,
135, 2499–2502.
Bionaz, M., Osorio, J. and Loor, J. J. (2015). Nutrigenomics in dairy cows: Nutrients,
transcription factors, and techniques. Journal of Animal Science, 93:5531–5553.
Burnett, D. D. (2014). Targeted gene expression profiling in beef cattle under finishing
conditions in the south eastern United States: Identification of regulatory fac-
tors involved in metabolic efficiency, energy partitioning, and intramuscular fat
deposition. PhD dissertation, Auburn University, Alabama.
Columbus, D. A., Fiorotto, M. L. and Davis, T. A. (2013). Leucine is a major regulator
of muscle protein synthesis in neonatal pigs. Amino Acids, 47, 259–270.
DeBose-Boyd, R. A., Ou, J., Goldstein, J. L. et al. (2001). Expression of sterol regulatory
element-binding protein 1c (SREBP-1c) mRNA in rat hepatoma cells requires
endogenous LXR ligands. Proceedings of the National Academy of Sciences USA,
98, 1477–1482.
France, J., Gill, M., Thornly, J. H. et al. (1987). A model of nutrient utilization and body
composition in beef cattle. Animal Production, 44, 371–385.
Graugnard, D. E., Berger, L. L., Faulkner, D. B. et al. (2010). High-starch diets induce
precocious adipogenic gene network up-regulation in longissimus lumborum
of early-weaned Angus cattle. British Journal of Nutrition, 103, 953–963.
Guo, B., Kongsuwan, K., Greenwood, P. L. et al. (2014). A gene expression estimator of
intramuscular fat percentage for use in both cattle and sheep. Journal of Animal
Science and Biotechnology, 5, 35.
Ha, Y. L., Grimm, N. K. and Pariza, M. W. (1987). Anticarcinogens from fried ground
beef: Heat-altered derivatives of linoleic acid. Carcinogenesis, 12, 1881–1887.
Halsey, C. H. C., Weber, P. S., Reiter, S. S. et al. (2011). The effect of ractopamine
hydrochloride on gene expression in adipose tissues of finishing pigs. Journal of
Animal Science, 89, 1011–1019.
Harvatine, K. J., Perfield, J. W. and Bauman, D. E. (2009). Expression of enzymes and
key regulators of lipid synthesis is upregulated in adipose tissue during CLA-
induced milk fat depression in dairy cows. Journal of Nutrition, 139, 849–854.
Joffe, Y. T. and Houghton, C. A. (2016). A novel approach to the nutrigenetics and
nutrigenomics of obesity and weight management. Current Oncology Reports,
18, 43–50.
Johnson, I. R., France, J., Thornley, J. H. et al. (2012). A generic model of growth,
energy metabolism, and body composition for cattle and sheep. Journal of
Animal Science, 90, 4741–4751.
Jump, D. B., Depner, C. M., Tripathy, S. et al. (2015). Potential for dietary ω-3 fatty
acids to prevent nonalcoholic fatty liver disease and reduce the risk of primary
liver cancer. Advances in Nutrition, 6, 694–702.
Jump, D. B., Tripathy, S. and Depner, C. M. (2013). Fatty acid-regulated transcription
factors in the liver. Annual Review of Nutrition, 33, 249–269.
Key, C. N., Perkins, S. D., Bratcher, C. L. et al. (2013). Grain feeding coordinately alters
expression patterns of transcription factor and metabolic genes in subcutaneous
adipose tissue of crossbred heifers. Journal of Animal Science, 91, 2616–2627.
368 Advanced Technologies for Meat Processing, Second Edition

Kim, M., Wang, L. and Morrison, M. (2014). Development of a phylogenetic micro-

array for comprehensive analysis of ruminal bacterial communities. Journal of
Applied Microbiology, 117, 949–960.
Komolka, K., Albrecht, E., Wimmers, K. et al. (2014). Molecular heterogeneities of
adipose depots—Potential effects on adipose-muscle cross-talk in humans, mice
and farm animals. Journal of Genomics, 2, 31–44.
Lancaster, P. A., Sharman, E. D., Horn, G. V. et al. (2014). Effect of rate of weight gain
of steers during the stocker phase. III. Gene expression of adipose tissues and
skeletal muscle in growing-finishing beef cattle. Journal of Animal Science, 92,
1462–1472.
Loor, J. J., Bionaz, M. and Drackley, J. K. (2013). Systems physiology in dairy cattle:
Nutritional genomics and beyond. Annual Review of Animal Biosciences, 1,
365–392.
Loor, J. J., Vailati-Riboni, M., McCann, J. C. et al. (2015). Lactation symposium: Nutrig-
enomics in livestock: Systems biology meets nutrition. Journal of Animal Science,
93, 5554–5574.
Luo, T., Miranda-Garcia, O., Adamson, A. et al. (2016). Consumption of walnuts in
combination with other whole foods produces physiologic, metabolic, and
gene expression changes in obese C57BL/6J high-fat-fed male mice. Journal of
Nutrition, 146, 1641–1650.
McCann, J. C., Wickersham, T. A., Loor, J. J. et al. (2014). High-throughput methods
redefine the rumen microbiome and its relationship with nutrition and metabo-
lism. Bioinformatics and Biology Insights, 8, 109–125.
Minuti, A., Palladino, A., Khan, M. J. et al. (2015). Abundance of ruminal bacteria,
epithelial gene expression, and systemic biomarkers of metabolism and inflam-
mation are altered during the peripartal period in dairy cows. Journal of Dairy
Science, 98, 8940–8951.
Nayananjalie, W. A., Wiles, T. R., Gerrard, D. E., McCann, M. A., Hanigan, M. D. (2015).
Acetate and glucose incorporation into subcutaneous, intramuscular, and vis-
ceral fat of finishing steers. Journal of Animal Science, 93, 2451–2459.
Ou, J., Tu, H., Shan, B. et al. (2001). Unsaturated fatty acids inhibit transcription of the
sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing
ligand-dependent activation of the LXR. Proceedings of the National Academy of
Sciences USA, 98, 6027–6032.
Pariza, M. W., Park, Y. and Cook, M. E. (2001). The biologically active isomers of
conjugated linoleic acid. Progress in Lipid Research, 40, 283–298.
Perkins, S. D., Key, C. N., Garrett, C. F. et al. (2014a). Residual feed intake studies in
Angus-sired cattle reveal a potential role for hypothalamic gene expression in
regulating feed efficiency. Journal of Animal Science, 92, 549–560.
Perkins, S. D., Key, C. N., Marvin, M. N. et al. (2014b). Effect of residual feed intake
on hypothalamic gene expression and meat quality in Angus-sired cattle grown
during the hot season. Journal of Animal Science, 92, 1451–1461.
Pethick, D. W., Harper, G. S. and Oddy, V. H. (2004). Growth, development and
nutritional manipulation of marbling in cattle: A review. Australian Journal of
Experimental Agriculture, 44, 705–715.
Picard, B., Lebret, B., Cassar-Malek, I. et al. (2015). Recent advances in omic technolo-
gies for meat quality management. Meat Science, 109, 18–26.
Nutrigenomics in Food-Producing Animals 369

Prior, R. L. and Scott, R. A. (1980). Effects of intravenous infusions of glucose, lactate,

propionate or acetate on the induction of lipogenesis in bovine adipose tissue.
Journal of Nutrition, 110, 2011–2019.
Reiter, S. S., Halsey, C. H. C., Stronach, B. N., Bartosh, J. L., Owsley, W. F., Bergen, W. G.
(2007). Lipid metabolism related gene-expression profiling in liver, skeletal
muscle a adipose tissue in crossbred Duroc and Pietrain pigs. Comparative Bio-
chemistry and Physiology Part D, 2, 200–2007.
Roberts, S. L., Lancaster, P. A., DeSilva, U., Horn, G. W., Krehbiel, C. R. (2015a).
Coordinated gene expression between skeletal muscle and intramuscular adi-
pose tissue in growing beef cattle. Journal of Animal Science, 93, 4302–4311.
Roberts, T. C. (2015b). The micro-RNA machinery. Advances in Experimental Medicine
and Biology, 887, 15–30.
Shen, W. and McIntosh, M. K. (2016). Nutrient regulation: Conjugated linoleic acid’s
inflammatory and browning properties in adipose tissue. Annual Review of
Nutrition, 36, 183–210.
Skjaerlund, D. M., Grant, A. L. and Helferich, W. G. (1993). Determination of the
relative abundance of skeletal muscle alpha actin mRNA in muscle of livestock
species. Journal of Animal Science, 71, 393–399.
Smith, S. B. and Crouse, J. D. (1984). Relative contributions of acetate, lactate and glu-
cose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue.
Journal of Nutrition, 114, 792–800.
Smith, S. B. and Johnson, B. J. (2016). Marbling of cattle to maximize the deposition of
intramuscular adipose. Journal of Animal Science, 94(eE-Suppl 5), 374.
Smith, S. B., Kawachi, H. and Choi, C. B. (2009). Cellular regulation of bovine intra-
muscular adipose development and composition. Journal of Animal Science,
87(14 Suppl), E72–E82.
Svobodova, E., Kubikova, J. and Svoboda, P. (2016). Production of small RNAs by
mammalian Dicer. Pflugers Arch Review, 468: 1089–1101.
Tedeschi, L. O., Fox, D. G. and Kononoff, P. J. (2013). A dynamic model to predict fat
and protein fluxes and dry matter intake associated with body reserve changes
in cattle. Journal of Dairy Science, 96, 2448–2463.
Teran-Garcia, M., Rufo, C., Nakamura, M. T., Osborne, T. F., Clarke, S. D. (2002).
NF-Y involvement in the polyunsaturated fat inhibition of fatty acid synthase
gene transcription. Biochemical and Biophysical Research Communications, 290,
1295–1299.
Thomas, J.W. and Moore, R.A. (1953). Thyroprotein feeding to dairy cows during suc-
cessive lactations. Journal of Dairy Science, 36, 657–672.
Wahli, W. and Michalik, L. (2012). PPARs at the crossroads of lipid signaling and
inflammation. Trends Endocrinology Metabolism, 32, 351–363.
Wang, Y. W. and Jones, P. J. (2004). Conjugated linoleic acid and obesity control:
Efficacy and mechanisms. International Journal of Obesity and Related Metabolic
Disorders, 28, 941–955.
Williams, E. G, Wu, Y. J., Pooja, J. et al. (2016). Systems proteomics of liver mitochon-
dria function. Science, 352, 1292.
12
Bioactive Properties of Peptides
Generated from Meat Proteins

Keizo Arihara and Yusuke Komiya

CONTENTS
12.1 Introduction ................................................................................................ 371
12.2 Generation of Peptides from Meat Proteins ........................................... 372
12.2.1 Gastrointestinal Proteolysis .......................................................373
12.2.2 Aging of Meats .............................................................................373
12.2.3 Fermentation of Meats ................................................................374
12.2.4 Enzymatic Treatment .................................................................. 374
12.3 Bioactivities of Meat Protein-Derived Peptides ..................................... 375
12.3.1 ACE Inhibitory/Antihypertensive Peptides ............................ 375
12.3.2 Antioxidative Peptides................................................................ 378
12.3.3 Opioid Peptides ........................................................................... 379
12.3.4 Immunomodulatory Peptides ................................................... 380
12.3.5 Hypocholesterolemic Peptides .................................................. 381
12.3.6 Antithrombotic Peptides ............................................................ 381
12.3.7 Antimicrobial Peptides ............................................................... 382
12.3.8 Prebiotic Peptides ........................................................................ 382
12.3.9 Bioactive Peptides from By-Products........................................ 383
12.3.10 Peptides with Sensory Properties ............................................. 385
12.4 Peptides and the Maillard Reaction ........................................................ 385
12.4.1 The Maillard Reaction................................................................. 385
12.4.2 Maillard Reaction and Meat....................................................... 386
12.4.3 Bioactivities of MRPs from Peptides......................................... 387
12.4.4 Bioactivities of Volatile MRPs from Peptides .......................... 388
12.5 Conclusions................................................................................................. 389
References............................................................................................................. 391

12.1 Introduction
Functional foods are foods with additional functions related to health pro-
motion or disease prevention by functional ingredients (Arihara, 2006a,
2014; Bagchi and Nair, 2017). Peptides generated from food proteins are

371
372 Advanced Technologies for Meat Processing, Second Edition

representative functional food ingredients (Aleixandre and Miguel, 2012;

Bowman, 2015). Although the activities of these peptides are latent in par-
ent food proteins, they are released by enzymatic treatments. Mellander
(1950) first reported that bioactive peptides were generated from food pro-
teins. He suggested that casein-derived phosphorylated peptides enhanced
vitamin D-independent bone calcification in rachitic infants. Since then,
information on bioactivities of peptides generated from food proteins has
steadily accumulated, and numerous peptides exhibiting various activities
have been discovered (Bowman, 2015; Hettiarachchy, 2012; Owusu-Apenten,
2010). Such peptides include antihypertensive, opioid, immunostimulating,
antimicrobial, antithrombotic, hypocholesterolemic, and antioxidative pep-
tides. It goes without saying that these peptides can be generated from meat
proteins. There is a great possibility of utilizing such components for devel-
oping novel functional meat products and food ingredients (Arihara, 2006b,
2014; Pathera et al., 2017). In this chapter, generation of peptides from meat
proteins and potential benefits of such peptides are discussed. Maillard reac-
tion products (MRPs) generated from meat protein-derived peptides are also
focused.

12.2 Generation of Peptides from Meat Proteins

Although most proteins contain bioactive sequences, those sequences are
inactive or incomplete within the parent proteins. Only via proteolytic diges-
tion are active peptide fragments released from native proteins. Once such
peptides are liberated, they can act as regulatory compounds. Along with
gastrointestinal digestion, there are several ways in which peptides are gen-
erated from meat proteins (Figure 12.1).

Gastrointestinal digestion

Meat proteins e.g., pepsin, trypsin, chymotrypsin Oligopeptides

e.g., myosin, actin bioactive peptides
Aging/storage of meats
e.g., endopeptidases, exopeptidases

Fermentation of meats
Microbial and muscle enzymes

Protease treatment
Commercial exogenous proteases

FIGURE 12.1
Generation of peptides from meat proteins.
Bioactive Properties of Peptides Generated from Meat Proteins 373

12.2.1 Gastrointestinal Proteolysis

During gastrointestinal proteolysis, bioactive peptides are liberated from
food proteins by various digestive enzymes (Pihlanto and Korhonen, 2003).
Ingested proteins are attacked first by pepsin in the stomach. They are fur-
ther hydrolyzed by trypsin, chymotrypsin, elastase, and carboxypeptidase
in the small intestine. Katayama et al. (2003b) reported that angiotensin
I-converting enzyme (ACE) inhibitory activity was generated from meat
proteins (i.e., myosin, actin, tropomyosin, and troponin) by pancreatic pro-
tease treatment. ACE inhibitory (antihypertensive) peptides generated from
pork meat were found during in vitro gastrointestinal digestion (Escudero
et al., 2010, 2012). Terashima et al. (2010) identified ACE inhibitory peptides
from the hydrolysate of boneless chicken leg meat digested with artificial
gastric juice. Recently, Simonetti et al. (2016) reported that in vitro gastrointes-
tinal digestion enhanced the biological activity of pig meat. Sayd et al. (2016)
identified and quantified peptides released from cooked meat during in vitro
gastric and intestinal digestion.

12.2.2 Aging of Meats

The content of peptides in meat increases during postmortem aging.
Nishimura et al. (1988) reported changes in oligopeptide levels occurring
during the storage of beef, pork, and chicken. Oligopeptides increased in all
meats during storage. For example, the content of peptide in pork increased
from 2.40 mg at day 1 to 3.05 mg/g meat at day 6 (53% increment). Mikami
et al. (1995) reported that peptide contents of beef varied widely, ranging
from 0.69 to 1.44 mg and from 2.64 to 4.65 mg/g meat 2 and 21 days after
slaughter, respectively.
During aging or storage, meat proteins are hydrolyzed by muscle endog-
enous proteases (Etherington, 1984; Koohmaraie, 1994). Initially, endo-
peptidases (e.g., calpains and cathepsins) hydrolyze muscle proteins and
generate polypeptides. Then such polypeptides are further hydrolyzed by
exopeptidases and dipeptyl peptidases. Such enzymatic hydrolysis con-
tributes to improvement of sensory properties of meat (texture, taste, and
flavor). In addition, peptides with bioactivities can be generated in meat
during postmortem aging. Bauchart et al. (2006) examined the peptide gen-
eration in fresh beef after 14 days of ripening and after cooking. In their
study, the content of several presumable bioactive peptides was greatly
increased. Arihara and Ohata (2015) identified ACE inhibitory (antihy-
pertensive) peptides (i.e., Gly-Pro-Leu-Lys, Ile-Pro-Ile-Lys, Ile-Pro) in aged
pork. Also, they showed an increase in ACE inhibitory activity of beef dur-
ing cold storage (Arihara and Ohata, 2017). Recently, Fu et al. (2017) inves-
tigated endogenous release of bioactive (e.g., ACE inhibitory) peptides in
beef during aging. Findings provided insights on development of healthy
beef through postmortem aging.
374 Advanced Technologies for Meat Processing, Second Edition

12.2.3 Fermentation of Meats

Bioactive compounds including peptides are produced during fermentation
processes of foods. In most fermented foods, proteolytic changes occur and
various peptides are generated from food proteins (Hernändez-Ledesma
et al., 2004; Hayes and García-Vaquero, 2016). It has been reported that fer-
mented dairy products (e.g., cheese and yoghurt) contain bioactive peptides,
such as ACE inhibitory and antioxidative peptides (Bütikofer et al., 2008;
Gagnaire et al., 2001; Gobbetti et al., 2007; Gomez-Ruiz et al., 2002; Saito et al.,
2000). These peptides are generated by proteolytic activities of starter micro-
organisms (i.e., lactic acid bacteria and mold).
Proteolytic degradations that occur during fermentation of raw sausages
and dry-cured ham have been studied extensively, since components gener-
ated from meat proteins are critical for the development of sensory proper-
ties of fermented meat products (Toldrá and Flores, 1998; Ordonez et al., 1998;
Toldrá, 2014). Although both muscle endogenous and microbial proteolytic
enzymes are involved in fermentation of meat products, the former enzymes
contribute greatly to meat protein degradation. During fermentation of meat
products, primarily, proteins are degraded into peptides by endogenous
enzymes (cathepsins B, D, H, and L). Although calpains play a central role
in the conditioning of meat, they do not exhibit activity at the end of the
salting step (Sarraga et al., 1989). Since most bacteria (e.g., lactobacilli) found
in fermented meat products have only weak proteolytic activity, the deg-
radation of proteins (e.g., myosin and actin) is not greatly affected by the
bacteria (Hierro et al., 1999). However, lactic acid bacteria influence protein
degradation by causing reduction in pH, which results in increased activity
of muscle proteases (Kato et al., 1994).
During fermentation of sausages, the content of peptides and amino acids
reaches about 1% dry matter of products (Dainty and Blom, 1995). Sentan-
dreu et al. (2003) and Mora et al. (2009) identified small peptides in Spanish
dry-cured ham. As described later in this chapter, they identified many bio-
active peptides generated in dry-cured ham. López et al. (2015) characterized
proteolysis and low-molecular-weight peptides of commercial Argentinean
fermented sausages by applying a peptidomic approach. This study repre-
sents a first peptidomic approach for fermented sausages, thereby providing
a baseline to define key peptides acting as potential biomarkers.

12.2.4 Enzymatic Treatment

The last, but most efficient, method of peptide preparation from food pro-
teins is by utilizing commercial exogenous proteases. Proteases from ani-
mal, plant, and microbial sources have been applied to food protein solution
for the industrial scale production of bioactive peptides (Agyei and Dan-
quah, 2011; Young and Mine, 2009). Utilization of various commercial pro-
teases is one approach for producing bioactive peptides from food proteins.
Bioactive Properties of Peptides Generated from Meat Proteins 375

Many bioactive peptides have been experimentally generated in this way

(Korhonen and Pihlanto, 2003; Pihlanto-Leppala, 2001; Pihlanto and Korho-
nen, 2003). Single proteinases from animal, plant, and microbial sources
and combinations of them have been used for the digestion of food proteins
(Yoshikawa, 1996). As described later, several proteases have been utilized
for the generation of bioactive peptides from meat proteins.
In the meat industry, proteolytic enzymes have been used for meat ten-
derization. The most commonly used enzymes for meat tenderization are
the plant enzymes papain, bromelain, and ficin (Dransfield and Etherington,
1981). In meat treated with enzymatic tenderization, peptides having bioac-
tivities could be generated. On the other hand, effects of commercial pro-
teases on protein breakdown and sensory characteristics of dry fermented
sausages have been investigated (Diaz et al., 1997; Bruna et al., 2000). Such
treatment would also generate bioactive peptides in meat products. Mird-
hayati et al. (2015) prepared hydrolysates of goat meat proteins by using
sequential digestion of commercial endoproteinase and protease complex.
Since they successfully obtained hydrolysates with ACE inhibitory and anti-
hypertensive activities, they are trying to develop a functional ingredient
utilizing a meat protein hydrolysate. More recently, Ryder et al. (2016) evalu-
ated commercially available food-grade microbial protease preparations for
their ability to produce bioactive peptides by hydrolyzing meat myofibrillar
and connective tissue protein extracts.

12.3 Bioactivities of Meat Protein-Derived Peptides

Since the first discovery of bioactive peptides generated from food proteins
(Mellander, 1950), information about such peptides has accumulated (Bow-
man, 2015; Wu et al., 2015). Various bioactive peptides have been found in
hydrolysates of food proteins (Figure 12.2). Such peptides have been also
identified in hydrolysates of meat proteins and in meat products (Arihara,
2006b; Arihara and Ohata, 2017; Lafarga and Hayes, 2014; Mora and Toldrá,
2014; Ryan et al., 2011; Udenigwe and Howard, 2013; Wu et al., 2015).

12.3.1 ACE Inhibitory/Antihypertensive Peptides

The most extensively studied bioactive peptide generated from food pro-
teins is the ACE inhibitory peptide (Aleixandre and Miguel, 2012; He et al.,
2013; Meisel et al., 2005; Norris and FitzGerald, 2015). ACE inhibitory pep-
tides lower blood pressure through inhibition of ACE in the body. ACE is
a dipeptidyl carboxypeptidase, which is widely distributed in mammalian
bodies, predominantly as a membrane-bound ectoenzyme in vascular endo-
thelial cells. ACE plays a critical role in the regulation of blood pressure in
376 Advanced Technologies for Meat Processing, Second Edition

the renin angiotensin system (Figure 12.3). ACE converts the inactive deca-
peptide angiotensin I into the potent vasoconstricting octapeptide angio-
tensin II, resulting in an increase in blood pressure. ACE also inactivates
the antihypertensive vasodilator bradykinin. Therefore, by inhibiting the
catalytic action of ACE, the elevation of blood pressure can be suppressed
(Li et al., 2004). Oshima et al. (1979) first found ACE inhibitory peptides
derived from food proteins in the hydrolysate of gelatin. Thereafter, these
peptides have been identified in the hydrolysates of various proteins (Aleix-
andre and Miguel, 2012; He et al., 2013; Norris and FitzGerald, 2015). To date,
many ACE-I inhibitory peptides have been isolated from hydrolysates of
muscle (meat) proteins and have been reviewed (Ahhmed and Muguruma,
2010; Di Bernardini et al., 2012; Vercruysse et al., 2005; Wu et al., 2015). Meat
proteins seem to be good sources of ACE inhibitory peptides (Gu et al., 2011).
Fujita et al. (2000) isolated ACE inhibitory peptides (Leu-Lys-Ala, Leu-Lys-
Pro, Leu-Ala-Pro, Phe-Gln-Lys-Pro-Lys-Arg, Ile-Val-Gly-Arg-Arg-Arg-His-

Circulatory system Nervous system

Antihypertensive peptides Opioid peptides

Antioxidative peptides – Opioid agonist
Antithrombotic peptides – Opioid antagonist

Alimentary system Immune system

Mineral-binding peptides Immunomodulating peptides

Antimicrobial peptides Antimicrobial peptides
Prebiotic peptides Cytomodulatory peptides

FIGURE 12.2
Representative bioactive peptides generated from food proteins.

Hydrolysis
ACE inhibitory peptides Meat proteins

Angiotensin I Bradykinin

ACE

Angiotensin II Inactive fragments

Increase of blood pressure Decrease of blood pressure

FIGURE 12.3
Blood pressure regulation by angiotensin I-converting enzyme (ACE) and ACE inhibitory pep-
tides generated from meat proteins.
Bioactive Properties of Peptides Generated from Meat Proteins 377

Gln-Gly, Phe-Lys-Gly-Arg-Tyr-Tyr-Pro, Ile-Lys-Trp) generated from chicken

muscle proteins by thermolysin treatment. Arihara et al. (2001) reported ACE
inhibitory peptides in enzymatic hydrolysates of porcine skeletal muscle
proteins. Among the digests of porcine muscle proteins, thermolysin digest
showed the most potent inhibitory activity. Two ACE inhibitory peptides
(Met-Asn-Pro-Pro-Lys and Ile-Thr-Thr-Asn-Pro), which are found in the
sequence of myosin heavy chain, were purified from thermolysin digest
of myosin. These peptides showed antihypertensive activity when admin-
istered orally to spontaneously hypertensive rats (Nakashima et al., 2002).
Katayama et al. (2003a,b, 2004) utilized porcine skeletal muscle and respec-
tive muscle proteins for proteolytic digestion in a series of studies. All enzy-
matic hydrolysates of water-soluble protein extracted from pork loin, myosin
B, myosin, actin, and tropomyosin, which were prepared by eight kinds of
proteases, showed ACE inhibitory activities, and the pepsin-treated hydro-
lysate showed the highest activity (Katayama et al., 2003a). They isolated a
corresponding peptide (Arg-Met-Leu-Gly-Gln-Thr-Pro-Thr-Lys) from hydro-
lyzed porcine troponin C with pepsin (Katayama et al., 2003b). They also
investigated the inhibitory profile of this noncompetitive peptide (Katayama
et al., 2004). ACE inhibitory activity and antihypertensive effect were also
generated from pork muscle by fermentation with lactic acid bacteria (Ari-
hara et al., 2004). Octapeptide (Val-Phe-Pro-Met-Asn-Pro-Pro-Lys) with ACE
inhibitory activity was identified from the fermented pork meat.
Saiga et al. (2003a) reported antihypertensive activity of Aspergillus prote-
ase-treated chicken muscle extract in spontaneously hypertensive rats. Fur-
thermore, they isolated four ACE inhibitory peptides from the hydrolysate.
Among the four peptides, three peptides possessed a common sequence,
Gly-X-X-Gly-X-X-Gly-X-X, which is homologous with that of collagen. The
peptide Gly-Phe-Hyp-Gly-Thr-Hyp-Gly-Leu-Hyp-Gly-Phe showed the
strongest inhibitory activity. Jang and Lee (2005) assayed ACE inhibitory
activities of several enzymatic hydrolysates of sarcoplasmic protein extracts
from beef rump. An ACE inhibitory peptide (Val-Leu-Ala-Gln-Tyr-Lys)
purified from the hydrolysate with the highest ACE inhibitory activity was
prepared by using the combination of thermolysin and proteinase A. Sentan-
dreu and Toldrá (2007) identified seven ACE inhibitory peptides from por-
cine skeletal muscle treated with dipeptidyl peptidase. These included the
peptides Arg-Pro, Lys-Ala, Ala-Ala, Gly-Pro, Ala-Arg, Gly-Arg, and Arg-Arg.
Di Bernardini et al. (2012) studied ACE inhibitory and antioxidant activities
of hydrolysates of bovine brisket sarcoplasmic proteins produced by papain.
Similarities between the amino acid sequences of the peptides identified in
their study and previously identified antioxidant and ACE inhibitory pep-
tides detailed in the BIOPEP database were outlined.
During fermentation, bioactive peptides are also generated from muscle
proteins in meat products. As a source of bioactive peptides including ACE
inhibitory (antihypertensive) peptides, Spanish dry-cured ham has been
extensively studied by a group of Spanish researchers (Escudero et al., 2013a,
378 Advanced Technologies for Meat Processing, Second Edition

2014; Gallego et al., 2014, 2015, 2016; Mora et al., 2014, 2015, 2016). Their great
efforts will make traditional cured ham reborn as novel functional meat
products. Dellafiora et al. (2015) utilized a hybrid in silico/in vitro approach
for the identification of ACE inhibitory peptides from Parma dry-cured ham.
Castellano et al. (2013) investigated ACE inhibitory peptides derived
from the hydrolysates of sarcoplasmic and myofibrillar porcine proteins
by the action of Lactobacillus sakei and Lactobacillus curvatus. Their results
suggested that meat-borne Lactobacillus were able to generate peptides
with ACE inhibitory activity, highlighting their potential to be used in the
development of functional fermented products. Ferranti et al. (2014) identi-
fied many ACE inhibitory and antioxidative peptides from cured ham and
fermented sausages.
ACE inhibitory peptides from various sources, including meat proteins, have
been shown to have antihypertensive effects by oral administration in animal
experiments using spontaneously hypertensive rats (Fujita and Yoshikawa,
1999; Fujita et al., 2000; Nakashima et al., 2002). However, the inhibitory poten-
cies of peptides do not always correlate with their antihypertensive effects.
Some peptides with potent ACE inhibitory activities in vitro are inactive by
oral administration. Regarding the ACE inhibitory peptides derived from
food proteins, Li et al. (2004) reviewed the phenomenon between inhibitory
activity and antihypertensive effect and the structure–activity relationships.
Although many ACE inhibitory peptides with diverse sequence proper-
ties have been isolated from food proteins, their structure–activity relation-
ships have not been fully clarified (Li et al., 2004). However, binding of ACE
inhibitory peptides to an ACE seemed to be influenced by the C-terminal
tripeptide sequence of peptides (Ondetti and Cushman, 1982). Also, stud-
ies have demonstrated that the C-terminal amino acid residue of peptides
is critical for their potential. It has been reported that many ACE inhibitory
peptides with potent activity have Trp, Phe, Tyr, or Pro at their C-terminus
(Maruyama et al., 1987; Miyoshi et al., 1991; Cheung et al., 1980).

12.3.2 Antioxidative Peptides

Neutralization and reduced release of free radicals occur through the inges-
tion of diet. This beneficial action of food is attributed to the antioxidant
potency of various compounds, such as vitamin C and E, and polyphenols.
Meat contains endogenous peptides with antioxidative activities such as
carnosine (β-alanyl-l-histidine) and anserine (β-alanyl-1-methyl-l-histidine)
(Arihara, 2014). In addition to these endogenous peptides, antioxidative pep-
tides can be generated from meat proteins by enzymatic hydrolysis (Liu
et al., 2016; Stadnik and Kęska, 2015).
Antioxidative peptides have been identified from various food proteins,
such as soybean, milk, eggs, and meat (Bernardini et al., 2011; Kim et al., 2012;
Liu et al., 2016). Saiga et al. (2003b) identified five antioxidative peptides in the
enzymatic hydrolysate of porcine muscle proteins. These peptides contain
Bioactive Properties of Peptides Generated from Meat Proteins 379

acidic amino acids, Asp or Glu, in their sequences. Although basic amino
acids, such as His and Lys, showed strong antioxidative activity (Chen et al.,
1996), acidic peptides as well as basic peptides possess antioxidative activity.
Arihara et al. (2011) investigated antioxidative activities of enzymatic
hydrolysates of porcine muscle actomyosin. Three antioxidative peptides
were isolated from a papain-treated hydrolysate of actomyosin and were
sequenced as Asp-Leu-Tyr-Ala, Ser-Leu-Tyr-Ala, and Val-Trp. Each of these
peptides had an antifatigue effect when orally administered to mice in an
experiment using a treadmill. 2,2-diphenyl-1-picrylhydrazyl (DPPH) activi-
ties and superoxide ion extinguishing ability were identified for peptide
extracts isolated from Spanish dry-cured ham (Escudero et al., 2012, 2013b).
Recently, Xing et al. (2016) identified antioxidative peptides from dry-cured
Xuanwei ham. Asp-Leu-Glu-Glu seemed to be one of the main peptides that
plays a key role in the antioxidant activity. Ohata et al. (2016) paid attention
to antioxidant activities of fermented meat sauce, which was prepared by
mixing ground pork, Koji mold, and salt, and fermenting for 24 weeks. The
tripeptide Gln-Tyr-Pro with an extremely high antioxidant activity against
the OH-radical was identified.

12.3.3 Opioid Peptides

Opioid peptides are defined as peptides that have an affinity for an opioid
receptor as well as opiate-like effects (Pihlanto and Korhonen, 2003). These
peptides influence the nerve system and gastrointestinal functions. Typical
opioid peptides are endorphins, enkephalin, and prodynorphin. These opi-
oid peptides have the same N-terminal sequence, Tyr-Gly-Gly-Phe. Opioid
peptides exert their activity by binding to intestinal-specific receptors of the
target cell. The individual receptors are responsible for specific physiological
effects (i.e., emotional behavior, suppression of intestinal motility, sedation,
and food intake).
Several opioid peptides derived from food proteins have been reported.
The N-terminal sequence of most of these peptides is Tyr-X-Phe or Tyr-X1-X2-
Phe. The N-terminal tyrosine residue and the presence of an aromatic amino
acid at the third or fourth position form a critical structure that fits with
the binding site of opioid receptors (Pihlanto-Leppälä, 2001). Casomorphins,
the first identified group of opioid peptides derived from food proteins, are
generated from milk casein by enzymatic hydrolysis (Brantl et al., 1979). Gen-
eration of casomorphins from casein during gastrointestinal digestion has
been demonstrated (Meisel, 1986). Also, proteolysis of milk whey proteins
(α-lactalbumin and β-lactoglobulin) with digestive enzymes produced opi-
oid peptides with sequences Tyr-Gly-Leu-Phe and Tyr-Leu-Leu-Phe, which
were named α-lactorphin and β-lactorphin (Chiba and Yoshikawa, 1986).
Subcutaneous administration of α-lactorphin dose-dependently lowered
systolic and diastolic blood pressures in spontaneously hypertensive rats as
well as in normotensive rats (Nurminen et al., 2000). The antihypertensive
380 Advanced Technologies for Meat Processing, Second Edition

mechanism of α-lactorphin is not by ACE inhibition but rather appears to be

due to interaction with opioid receptors. This provides further evidence for
the multifunctional role of bioactive peptides. Thus, mechanisms other than
ACE inhibition may be involved in the antihypertensive actions of various
peptides. Opioid peptides were also found in hydrolysates of wheat gluten
(exorphins) (Fukudome and Yoshikawa, 1992, 1993) and blood hemoglobin
(hemorphons) (Nyberg et al., 1997; Zhao et al., 1997).
There has been no report on the generation of opioid peptides from meat
proteins. However, possible opioid sequences, such as Tyr-X-Phe or Tyr-X1-
X2-Phe, are found in the sequences of muscle proteins (e.g., myosin heavy
chain). Therefore, it should be possible to find opioid peptides in meat pro-
teins by proteolytic treatment. Bovine blood hemoglobin is regarded as a
minor component in meat and meat products. In some meat products, such
as blood sausage, hemoglobin is a major component of the product. Investiga-
tion of hemoglobin peptic hydrolysate revealed the presence of biologically
active peptides with affinity for opioid receptors (Nyberg et al., 1997; Zhao
et al., 1997). These peptides were named hemorphins (VV-hemorphin 7, Val-
Val-Tyr-Pro-Trp-Thr-Gln-Arg-Phe; LVV-hemorphin-7, Leu-Val-Val-Tyr-Pro-
Trp-Thr-Gln-Arg-Phe). Hemorphins were first isolated from enzymatically
treated bovine blood. Later, these peptides were found in the brain, plasma,
and cerebrospinal fluid. When proteolytically degraded, hemoglobin gives
rise to active peptides that are probably involved in regulatory functions in
vivo during pain, physical effort, inflammation, and blood pressure varia-
tion. Also, a study on quantification of hemorphins in Alzheimer’s disease
brains suggests that these peptides could be candidates for pharmacological
prevention of this disease (Poljak et al., 2004). Another study has demon-
strated that valorphin (Val-Val-Tyr-Pro-Trp-Thr-Gln), a fragment of hemor-
phins, suppressed the proliferation of tumor cells (Blishchenko et al., 2002).

12.3.4 Immunomodulatory Peptides

Immunomodulatory peptides affect both the immune system and cell pro-
liferation responses. It has been reported that several hydrolysates of milk
caseins stimulate the immune system. Many studies have shown that immu-
nomodulatory sequences exist within food proteins, especially milk pro-
teins. Although several hydrolysates of milk caseins stimulate the immune
system, their modulatory effects are dependent on the proteolytic systems
employed. Peptides generated from milk caseins by pancreatin or trypsin
inhibited the proliferative responses of murine splenic lymphocytes and
Peyer’s patch cells (Otani and Hata, 1995). However, digests generated by
pepsin or chymotrypsin did not show such activity. Peptides derived from
pepsin-trypsin hydrolysis of caseins strongly suppressed mitogen-induced
proliferation of peripheral blood mononuclear cells (Kayser and Meisel,
1996). Casein-derived peptides sequenced as Val-Glu-Pro-Ile-Pro-Asn and
Gly-Leu-Tyr enhanced phagocytosis of human and murine macrophages
Bioactive Properties of Peptides Generated from Meat Proteins 381

and prevented Klebsiella pneumoniae infection in mice (Migliore-Samour

et al., 1989; Fiat et al., 1993).
Immunomodulating peptides have also been discovered in enzymatic
hydrolysates of proteins from various foods, such as eggs (Watanabe et al.,
1998), soybean (Yoshikawa et al., 1993), and rice (Matsubayashi and Saka-
gami, 1999). Although meat protein-derived immunomodulating peptides
have not been reported, Kęska and Stadnik (2016) suggested that pork myo-
fibrillar proteins are a promising source of various bioactive peptides based
on in silico analysis.

12.3.5 Hypocholesterolemic Peptides

Dietary proteins (e.g., milk and soy proteins) have been shown to lower
serum cholesterol level (Nagaoka et al., 1992). However, until recently, the
mechanism of the hypocholesterolemic activity induced by food proteins
was unclear. Based on the hypothesis that hypocholesterolemic peptides
derived from food protein exist and influence serum cholesterol level (Sug-
ano et al., 1990), Nagaoka et al. (2001) attempted to clarify the mechanism of
the hypocholesterolemic action of milk β-lactoglobulin. A hypocholesterol-
emic peptide (Ile-Ile-Ala-Glu-Lys) was found in the enzymatic hydrolyzates
of bovine milk β-lactoglobulin (Nagaoka, 2012). This peptide has a strong
effect on serum cholesterol level, and the hypocholesterolemic activity of
the peptide was greater than that of the drug β-sitosterol in rats. Nagaoka
et al. (2001) speculated that the peptide reduces the micellar solubility of
cholesterol and inhibits cholesterol absorption. However, the mechanisms
of interaction between hypocholesterolemic peptides and cholesterol micelle
of cholesterol are still unknown. The peptide is speculated to reduce the
micellar solubility of cholesterol and inhibit cholesterol absorption.
Morimatsu et al. (1996) examined the effects of a papain-hydrolyzed pork
muscle diet on the plasma and liver cholesterol levels in rats. Plasma and
liver cholesterol concentrations were significantly lower in rats fed with the
hydrolyzed pork. However, the amino acid sequence of pork peptide was not
determined.

12.3.6 Antithrombotic Peptides

Venous thromboembolism is related either to trauma, long immobilization,
or abnormalities in blood coagulation. Based on the knowledge that the
mechanism of blood clotting is similar to that of milk clotting, milk protein–
derived antithrombotic peptides have been studied (Fiat et al., 1993; Jollès
and Henschen, 1982). Milk clotting occurs by the interaction of casein with
a coagulating enzyme. Similarly, blood clotting occurs by the interaction of
fibrinogen with thrombin. The dodecapeptide of human fibrinogen and the
undecapeptide (Met-Ala-Ile-Pro-Pro-Lys-Lys-Asn-Gln-Asp-Lys) of bovine
κ-casein are both structurally and functionally similar. This κ-casein-derived
382 Advanced Technologies for Meat Processing, Second Edition

undecapeptide (casoplatelin) inhibited adenosine diphosphate (ADP)-

induced platelet aggregation and combined with the fibrinogen receptor of
blood platelets (Jollès et al., 1986). Also, tryptic fragments of casoplatelin-
inhibited platelet aggregation (Bouhallab et al., 1992).
Shimizu et al. (2009) isolated an antithrombotic peptide fraction from pork
muscle hydrolyzed with papain. The peptide fraction with mean molecular
weight of 2500 showed antithrombotic activity in vivo after oral adminis-
tration to mice. The fraction with mean molecular weight of 2517 further
purified showed antithrombotic activity after oral administration. Further
studies are required to identify the active peptide and to reveal the mecha-
nism of the antithrombotic effect.

12.3.7 Antimicrobial Peptides

Antimicrobial peptides have been isolated from milk and egg proteins. Case-
cidin, generated from milk casein by chymosin digestion, exhibits activity
against Staphylococcus aureus, Sarcina, Bacillus subtilis, Diplococcus pneumoniae,
and Streptococcus pyogenes (Lahov and Regelson, 1996). Isracidin is another
casein-derived antimicrobial peptide. It protected mice against infection
with S. aureus and Candida albicans (Lahov and Regelson, 1996). Antimicro-
bial peptides generated by proteolytic digestion of milk lactoferrin have been
studied most extensively (Tomita et al., 1994). The hydrolysate exhibits broad
antibacterial activity against both gram-positive and gram-negative bacteria.
Several lactoferrin-derived antimicrobial peptides named lactoferricins (e.g.,
lactoferricin B) have been isolated (Shin et al., 1998). A hen egg ovotransfer-
rin-derived antimicrobial peptide (OTAP-92) that is active against S. aureus
and Escherichia coli has been isolated (Ibrahim et al., 2000).
Spanish dry-cured ham has a particular sensory quality that makes it a dis-
tinctive food. Its high salt content and reduced water activity contribute to its
shelf stability. However, postprocessing actions carried out for the commercial-
ization of these products such as slicing may increase the risk of development of
pathogenic microorganisms such as Listeria monocytogenes. A peptidomic strat-
egy with mass spectrometry techniques was directed to naturally generated
peptides showing antilisterial activity in Spanish dry-cured ham (Castellano
et al., 2016). Ten identified peptides inhibited the growth of L. monocytogenes. Of
these peptides, Arg-His-Gly-Tyr-Met was the most effective, showing a mini-
mum inhibitory concentration (MIC) value of 6.25 mM. This is the first report
of the generation of an antimicrobial peptide from meat proteins.

12.3.8 Prebiotic Peptides

Several substances are known to enhance the activity of probiotic bacteria,
such as intestinal Lactobacillus and Bifidobacterium. Such substances are called
prebiotics (Gibson, 2004). Oligosaccharides are representative prebiotic sub-
stances. In addition to oligosaccharides, the presence of prebiotic peptides
Bioactive Properties of Peptides Generated from Meat Proteins 383

has been suggested. Many studies have shown that hydrolysates of milk pro-
teins exhibited stimulation of the growth of lactic acid bacteria and bifidobac-
teria (Brody, 2000). However, the main growth factors have been estimated to
be the sugar moieties (e.g., N-acetylglucosamine and glucosamine) of glyco-
sylated peptides (Idota et al., 1994). Nonglycosylated peptides derived from
proteins have recently been identified. Liepke et al. (2002) first reported non-
glycosylated peptides that selectively stimulate the growth of bifidobacteria.
These peptides (5584 and 5801 Da) were isolated from pepsin-treated human
milk and identified as lactoferrin fragments. Based on structural characteris-
tics, a small peptide named prebiotic lactoferrin-derived peptide-I (PRELP-I;
Cys-Ala-Val-Gly-Gly-Cys-Ile-Ala-Leu) was designed and characterized.
Arihara et al. found that the hydrolysate of porcine skeletal muscle acto-
myosin digested by papain enhanced the growth of Bifidobacterium strains in
media (Arihara et al., 2011; Arihara and Ohata, 2011a). One of the correspond-
ing prebiotic peptides was purified from the hydrolysate and identified as a
tripeptide (Glu-Leu-Met). Although Glu-Leu-Met showed growth-promoting
activity of Bifidobacterium bifidum, neither the dipeptides (Glu-Leu, Leu-Met)
nor amino acids (Glu, Leu, Met), which are parts of the tripeptides, showed
growth-promoting activity. Therefore, the sequence of the tripeptide is criti-
cal for its growth-promoting activity. Glu-Leu-Met promoted the growth of
11 strains of 26 Bifidobacterium strains in skim milk.

12.3.9 Bioactive Peptides from By-Products

Animal by-products include entire bodies or parts of animals, or products
of animal origin, and other products obtained from animals (Lafarga and
Hayes, 2014; Toldrá et al., 2012). They are generally recognized as carcasses,
skins, bones, meat trimmings, blood, fatty tissues, horns, feet, hoofs, or
internal organs. Most parts of animal by-products are discarded as waste
or used for low-value products. Since meat by-products (e.g., trimmings and
mechanically recovered meat, collagen, and blood) are rich in proteins, bio-
active peptides can be generated from them by enzymatic treatments (Ari-
hara and Ohata, 2017; Bernardini et al., 2011; Mora and Toldrá, 2014; Toldrá
et al., 2012; Lafarga and Hayes, 2014).
Blood is the most common and first by-product of the meat industry (Parés
et al., 2011). Large volumes of blood from domestic animals (e.g., cattle and pigs)
are obtained in industrial slaughterhouses. Since blood contains proteins in rich
amounts, it seems to be a good source of bioactive peptides (Bah et al., 2013). Anti-
hypertensive, antioxidative, antimicrobial, and opioid peptides have been found
in hydrolysates of blood proteins, such as hemoglobin and plasma (Chang et al.,
2007). As such peptides, ACE-inhibitory peptides Gly-Phe-Pro-Thr-Thr-Lys-Thr-
Tyr-Phe-Pro-His-Phe and Val-Val-Tyr-Pro-Trp-Thr, which are corresponding to
the sequences of porcine hemoglobin, are identified (Yu et al., 2006). As described
earlier, biologically active peptides with affinity for the opioid receptor were
found in the hemoglobin peptic hydrolysate (Nyberg et al., 1997; Zhao et al., 1997).
384 Advanced Technologies for Meat Processing, Second Edition

Several antimicrobial peptides have been found in the hydrolysates of

hemoglobin. Fogaca et al. (1999) identified the first antimicrobial peptide
from bovine hemoglobin. This peptide (FLSFPTTKTYFPHFDLSHGSAA-
QVKGHGAK) was active against Micrococcus luteus. Froidevaux et al. (2001)
found the peptide from the hydrolysate of bovine α-hemoglobin. The peptide
(VLSAADKGNVKAAWGKVGGHAAE) was also active against M. luteus.
Furthermore, the peptide (VTLASHLPSDFTPAVHASLDKFLANVSTVL)
obtained from bovine hemoglobin showed activity against M. luteus, Liste-
ria innocua, E. coli, and Salmonella enteritidis (Daoud et al., 2005). Also, Ned-
jar-Arroume et al. (2006) identified four peptides from bovine hemoglobin.
These peptides were active against M. luteus, L. innocua, E. coli, and S. enter-
itidis. VNFKLLSHSLLVTLASHL was purified from the hydrolysate of bovine
α-hemoglobin and showed antimicrobial activity against E. coli, S. aureus,
and C. albicans (Hu et al., 2011). Recently, Przybylski et al. (2016) identified a
small antimicrobial peptide (Thr-Ser-Tyr-Arg, fragment of hemoglobin) from
pepsin-treated bovine cruor.
Collagen is the most abundant protein in mammals (Mora and Toldrá,
2014). The most common motifs in the amino acid sequence of collagen
are Gly-Pro-X and Gly-X-Hyp, where X can be any amino acid other than
Gly, Pro, or Hyp. Since collagen lacks certain essential amino acids, it has
less nutritional value than most other food proteins (Gomez-Guillen et al.,
2011). Saiga et al. (2003a) reported antihypertensive activity of Aspergillus
protease-treated chicken muscle extract in spontaneously hypertensive
rats. Furthermore, they isolated four ACE inhibitory peptides from the
hydrolysate. Three of those four peptides possessed a common sequence,
Gly-X-X-Gly-X-X-Gly-X-X, which is homologous with that of collagen.
Banerjee and Shanthi (2012) identified ACE inhibitory peptides generated
from bovine Achilles tendon collagen hydrolyzed with bacterial colla-
genase. The identified peptides were AKGANGAPGIAGAPGFPGARG-
PSGPQGPSGPP and PAGNPGADGQPGAKGANGAP. Kim et al. (2001)
hydrolyzed bovine skin, rich in collagen, with pronase E. Three antioxi-
dative peptides were purified from pronase E hydrolysate. The peptide
Gly-Pro-Hyp-Gly-Pro-Hyp-Gly-Pro-Hyp-Gly showed the highest activ-
ity with the thiobarbituric acid reactive substances (TBARSs) method.
Li et al. (2007) hydrolyzed porcine skin collagen with different protease
treatments and found four antioxidative peptides. Their sequences were
identified as Gln-Gly-Ala-Arg, Leu-Gln-Gly-Met, Leu-Gln-Gly-Met-Hyp,
and Hyp-Cys.
Fermentation of by-product from meat processing has been used to gener-
ate bioactive compounds (Hayes and García-Vaquero, 2016). Goat placenta
has long been used in Chinese medicine and is recognized as rich in bioac-
tive components (Chakraborty and Bhattacharyya, 2005). Hou et al. (2014)
assayed peptides generated in goat placenta by fermentation. They identified
that the DPPH scavenging activity of goat placenta peptides reached 85.43%
at a concentration of 1.4 μg/mL.
Bioactive Properties of Peptides Generated from Meat Proteins 385

12.3.10 Peptides with Sensory Properties

Apart from bioactivities, food protein–derived peptides contribute signifi-
cantly to sensory properties of foods (Pihlanto and Korhonen, 2003; Gonzalez
de Llano and Polo Sanchez, 2003; Nishimura and Kato, 1988; Temussi, 2012).
In foods with protein-hydrolysis processes, such as fermentation and aging,
generation of flavor peptides is an important event. Peptides that have a
savory flavor are known to be generated from food proteins. Some savory
peptides (Glu-Asp-Glu, Asp-Glu-Ser, Ser-Glu-Glu) were generated in fish
muscle protein hydrolysates (Noguchi et al., 1975). An octapeptide with
delicious taste (Lys-Gly-Asp-Glu-Glu-Ser-Leu-Ala) was isolated from beef
treated with papain (Yamazaki and Maekawa, 1980). Later, this peptide was
called “beef meaty peptide” or “savory taste-enhancing peptide” (Hau et al.,
1997). Henriksen and Stahnke (1997) fractionated low-molecular-weight
water-soluble compounds extracted from dried sausages. Fractions contain-
ing smaller peptides enhanced savory taste impressions.
Umami taste-enhancing peptides (Glu-Glu, Glu-Val, Ala-Asp-Glu, Ala-
Glu-Asp, Asp-Glu-Glu, and Ser-Pro-Glu) were found in chicken protein
hydrolysate (Maehashi et al., 1999). Okumura et al. (2004) investigated sour-
ness-suppressing peptides generated in cooked pork loins. They obtained a
fraction that exhibited sourness-suppressing and umami-enhancing effects
from an extract prepared from vacuum-cooked pork loins. Three peptides
purified from this fraction had a common sequence (Ala-Pro-Pro-Pro-Pro-
Ala-Glu-Val-His-Glu-Val). A synthetic peptide having this common sequence
exhibited suppression of sour taste. Also, peptides containing this sequence
were generated during postmortem aging (Kitamura et al., 2005).

12.4 Peptides and the Maillard Reaction

12.4.1 The Maillard Reaction
Numerous chemical reactions occur in foods during manufacture, storage,
and cooking and they change the color, aroma, taste, and nutritional value of
foods. The Maillard reaction is a critical chemical reaction in such changes
(Losso, 2016; Shahidi et al., 2014). This reaction occurs between amines (e.g.,
amino acids, peptides, and proteins) and carbonyl compounds, especially
reducing sugars. Since food protein–derived peptides are widely utilized in
many processed foods, the changes of peptides by the Maillard reaction in
foods deserve concern and research (Arihara et al., 2017).
The Maillard reaction occurs in several stages (Figure 12.4). The initial stage
of the reaction involves a Schiff base formation between the free amino and
carbonyl group (amino-carbonyl reaction). This is followed by the rearrange-
ment of the Schiff base to an Amadori compound. The intermediate stage
386 Advanced Technologies for Meat Processing, Second Edition

Early stage

Amino compounds Reducing sugars

+
e.g., peptides e.g., glucose

Amadori rearrangement

Intermediate stage

Final stage

Fission Dehydration Strecker reaction

Dicarbonyls Dicarbonyls Aldehydes

Melanoidin formation (brown in color)

FIGURE 12.4
Outline of the Maillard reaction of amino compounds and reducing sugars.

starts from the Amadori compounds. They react further by several pathways,
such as enolization, dehydration, aldol condensations, and Strecker degra-
dation, to generate numerous compounds. Melanoidins, which are the final
products of the reaction, are nitrogen-containing polymeric substances that
decompose with difficulty (Hayase, 1996). Melanoidins demonstrate physio-
logically positive effects because of unique partial structures in the molecules.
Melanoidins have a strong scavenging activity against active oxygen species,
such as hydroxyl radicals, hydrogen peroxides, and superoxides. Also, they
show antimicrobial activity and the ability to chelate different minerals and
to promote the growth of beneficial bacteria (Morales et al., 2012).

12.4.2 Maillard Reaction and Meat

Meat and meat products are closely related with the Maillard reaction. Meat
and meat products are very complex systems with numerous compounds
and generally cooked before eating. Although raw meat has little or no aroma
and only a blood-like taste, each type of cooked meat has a characteristic
flavor (Shahidi et al., 2014). More than 1000 compounds have been identi-
fied in the aroma profiles of cooked meat products and the Maillard reaction
has a critical role in generating such compounds (Pegg and Shahidi, 2014).
Free amino groups of amino acids or peptides in meat can react with reduc-
ing sugars in the presence of heat. MRPs generated in cooked meat include
many important classes of meat flavor compounds such as pyrazines, oxa-
zoles, thiophenes, thiazoles, and other heterocyclic compounds. Sulfur com-
pounds are especially important for the characteristic aroma of meat.
Bioactive Properties of Peptides Generated from Meat Proteins 387

Cheng et al. (2011) explored the MRPs of enzymatic hydrolysates

(peptides) prepared from beef proteins for the relationship between flavor
products and reactants in model system. The majority of peptides partici-
pating in the Maillard reaction were reported to have a molecular weight
from 1000 to 2000 Da. Furans and furanones were the major products
from the degradation of carbohydrates. Pyrazines were produced from
the reaction of peptides and xylose. Thiazole, thiophene, and thiols were
generated from the degradation of thiamin. The Maillard reaction of pep-
tides is also a critical phenomenon in meat products without heat treat-
ment (Jayasena et al., 2013; Ventanas et al., 1992; Weerawatanakorn et al.,
2015). Hams from the Iberian breed are processed by the traditional dry-
curing procedure and proteolysis and autooxidation occur during ripen-
ing/drying. As a result, peptides, nitrogen, and carbonyl compounds are
accumulated. In the next step, a rapid increase of amino acid nitrogen is
observed, and aldehydes decrease notably. This change seems to be due to
condensations between carbonyls and free amino acids. While hams are
kept in the cellar, the overall increase of amino acid nitrogen is in contrast
to the slow rate of accumulation of some individual amino acids. This is
presumably due to degradation to volatile derivatives, where Maillard
reactions could be involved.

12.4.3 Bioactivities of MRPs from Peptides

MRPs show some biological activities, such as antioxidative activity, antibac-
terial activity, and ACE inhibitory activity (Somoza, 2005; Van Lancker et al.,
2011). Several studies have focused on the heating effect on the functional
properties of MRPs generated from vegetable protein hydrolysate (Lertitti-
kula et al., 2007; Li et al., 2009). However, the published information about
animal proteins (e.g., meat proteins) involved in the generation about flavor
compounds in the Maillard reaction is still limited.
Arihara et al. have been trying to develop peptide-based functional food
ingredients by the Maillard reaction (Arihara et al., 2017). Since collagen is an
abundant protein in animal by-products, attention has been given to devel-
oping functional materials from collagen (Arihara et al., 2013, 2017). Col-
lagen contains approximately 33% glycine, which is a nonessential amino
acid, thus it has been considered of low nutritional value. However, glycine
is a good source for the Maillard reaction with reducing sugars. Also, col-
lagen does not contain asparagine, which is a major amino acid in potatoes
and cereals. Acrylamide, which is found in a range of fried and oven-cooked
foods, is a known human neurotoxin and has been classified as probably car-
cinogenic in humans. The main formation pathway of acrylamide in foods is
linked to the Maillard reaction and, in particular, the amino acid asparagine
(Mottram et al., 2002; Stadler et al., 2002; Blank, 2005). Therefore, proteins
without asparagine such as collagen are appropriate candidates for the pro-
cess of the Maillard reaction.
388 Advanced Technologies for Meat Processing, Second Edition

Collagen was heated to transfer to gelatin and digested by commercial

proteases (Arihara et al., 2017). Such collagen-derived peptides were added
with reducing sugars (e.g., xylose) and a pH adjuster (e.g., sodium carbonate).
Since the Maillard reaction prefers the alkaline condition, a pH adjuster was
added in the reaction solution. The solution was further heated at 90°C for
the Maillard reaction. The activities by using superoxide ion and DPPH radi-
cal were increased significantly by heat treatment (the Maillard reaction).
Oral administration of the MRPs to mice suppressed the stress marker (e.g.,
hydroperoxide value of serum). Also, continuous oral administration of the
MRPs to the spontaneously hypertensive rats decreased the blood pressure
compared to collagen peptides without the heat treatment. Since this colla-
gen peptide-based product prepared by the Maillard reaction showed good
sensory properties, it will be a possible functional food ingredient.
Ējiāo (Asini Corii Collas) is a Chinese crude drug made of dry skin, bone, ten-
dons, and ligaments of donkeys (Equus asinus) by decoction, degreasing, and
concentration (Kumeta et al., 2014). The main component of Ējiāo is collagen.
It has been mainly used for promoting hematopoiesis and arresting bleed-
ing. Although it is specified as being made of dry skin derived from donkeys
in the Chinese Pharmacopoeia, adulteration with skins or bones from other
animals such as horses, cattle, and pigs has been found. Since it is brown in
color, the Maillard reaction seems to have occurred during its processing.
The advanced glycation end products (AGE), such as Nϵ-(carboxymethyl)
lysine was detected in Ējiāo. Oral administration of Ējiāo to spontaneously
hypertensive rats decreased blood pressure. At least a part of this activity
would proceed from MRPs of Ējiāo.

12.4.4 Bioactivities of Volatile MRPs from Peptides

As described earlier, MRPs include a wide variety of odor components,
which can contribute to the perceived quality of foods. However, very few
studies have been conducted on the bioactivities of the odor components
generated by the Maillard reaction (Zhou et al., 2016). Initially, Ohata et al.
investigated the effects of the odor produced by the Maillard reaction on
blood pressure (Ohata et al., 2014). Chicken meat protein digests (peptides)
prepared by papain treatment were mixed with xylose in buffer. They
were heated at 90°C for 240 minutes at pH 5 or pH 10. Wistar rats were
exposed to the vapor of these solutions for 5 min, and systolic blood pres-
sure (SBP) was measured. The pH 10 sample significantly decreased SBP
after 10–15 minutes exposure. Volatile compounds generated in the pH
10 sample would have the effect of decreasing SBP of rats. Further experi-
ments indicated that the pH 10 sample odor caused parasympathetic ner-
vous system dominance and induced a relaxed and sedated state (Ohata
et al., 2014). 2,3-dimethyl-pyrazine, acetic acid, 2-furancarboxyaldehyde,
2-hydroxy-3-methyl-2-cyclopenten-1-one (cyclotene), 2,5-dimethyl-4-hy-
droxy-3(2H)-furanone (DMHF), and 5-methylpyrazine-2-methanol were
Bioactive Properties of Peptides Generated from Meat Proteins 389

identified as odor components contributing to the odor of the pH 10 sample.

Since 2-furanoncarboxyaldehyde, cyclotene, DMHF, and 5-methylpyrazine-
2-methanol were absent in the sample before heat treatment, these com-
pounds were generated by the Maillard reaction. Some of these compounds
seem to be implicated in the effects on the autonomic system in rats.

12.5 Conclusions
Bioactive peptides generated from meat proteins are promising food ingre-
dients for developing functional foods (Arihara, 2014; Arihara and Ohata,
2011b; Olmedilla-Alonso et al., 2013; Young et al., 2013). Also, since tradi-
tional meat products, such as fermented sausages and dry-cured ham,
have been revealed to contain various bioactive peptides, they have a great
possibility to be reborn as functional foods. Apart from bioactivities, meat
protein–derived peptides also contribute to the sensory properties of meat
and meat products. Since peptides have a wide range of taste from sweet to
umami (Temussi, 2012), generation of peptides from meat proteins would
lead to development of novel functional meat products with favorable sen-
sory characteristics.
In addition to conventional research techniques (Martínez-Maqueda
et al., 2013), the modern nutrigenomics approach have been rapidly
applied to the field of nutrition and health (Figure 12.5) (Arihara, 2013;
Cevallos-Cevallos and Reyes-De-Corcuera, 2012; Ortea et al., 2016; Pavli-
dis et al., 2015). Nutrigenomics seeks to find out the interaction between
dietary factors and host genes and how genes and their products metabo-

DNA mRNA Protein Metabolite

Genomics Transcriptomics Proteomics Metabolomics

DNA microarrays 2D-gel electrophoresis GC/MS, LC/MS
MALDI-TOF and MS/MS

Nutrigenomics
Bioactive peptides
system biology

Conventional Bioinformatics
Peptidomics
approach in silico study

FIGURE 12.5
Strategy for approaching bioactivity of meat protein-derived peptides.
390 Advanced Technologies for Meat Processing, Second Edition

lize these constituents into health-promoting nutrients or disease-causing

antinutrients, and bioactive compounds. Omics technologies including
transcriptomics, proteomics, and metabolomics offer exciting opportuni-
ties to address complex issues related to human health. Although applica-
tion of this strategy for studying meat protein–derived bioactive peptides is
still limited, it has great potential to help us understand and utilize bioac-
tive peptides (Carrasco-Castilla et al., 2012). The identification of peptides
using mass spectrometry and searching for their sequences in the database
is one representative approach. Mora and Toldrá (2013) described the appli-
cation of proteomic tools to dry-cured ham in order to better understand
the intense proteolysis phenomena that occur during its processing. They
pointed out that modern mass spectrometry techniques with the analyz-
ers in tandem allows a faster and more reliable identification of the pep-
tide sequences because the obtained MS/MS spectra are matched with the
theoretical sequences contained in the databases.
Along with analytical methods, computer-aided techniques are uti-
lized to evaluate food components including bioactive peptides (Dziuba
et al., 2012). Bioinformatics combines computers, software tools, statis-
tics, and databases and has been used for in silico analyses of biological
queries in the omics, including genomics, proteomics, transcriptomics,
metabolomics, and peptidomics. Furthermore, system biology involves
the integration of genomics, proteomics, and bioinformatics information
to create a whole-system view of a biological entity. Bioinformatics and
proteomics are useful tools toward the identification of peptides with
potent biological activities (Carrasco-Castilla et al., 2012; Khaldi, 2012;
Udenigwe, 2014). The hydrolysis of the selected protein can be simulated
to generate in silico peptides using an open-access database, such as BIO-
PEP, PEPBANK, or ERP-Moscow. The BIOPEP database provides a useful
resource when looking for peptides with different bioactivities. Lafarga
et al. (2015) identified meat-derived prolyl endopeptidase inhibitory pep-
tides using in silico methods. They evaluated five proteins commonly
found in meat by-products (e.g., serum albumin, collagen, and myosin)
as a substrate for use in the generation of peptides. These proteins were
cleaved in silico using the BIOPEP and ExPASy PeptideCutter and gen-
erated peptides were compared to known peptides in the BIOPEP. This
study demonstrated the usefulness of in silico analysis for predicting the
release of bioactive peptides from meat proteins.
By combining various techniques and information, it will be possible to
understand all aspects and implications of bioactive peptides generated
from meat proteins. Also, with the advent of new techniques, the mecha-
nisms underlying numerous biological properties of meat protein–derived
peptides will be revealed. Such efforts will contribute to the demonstration
of the scientific benefits of meat and meat products and the development of
novel functional meat products with bioactive peptides.
Bioactive Properties of Peptides Generated from Meat Proteins 391

References
Agyei, D. and Danquah, M. K. (2011). Industrial-scale manufacturing of pharmaceuti-
cal-grade bioactive peptides. Biotechnology Advances, 29, 272–277.
Ahhmed, A. M. and Muguruma, M. (2010). A review of meat protein hydrolysates
and hypertension. Meat Science, 86, 110–118.
Aleixandre, A. and Miguel, M. (2012). Food proteins and peptide as bioactive agents.
In: Hettiarachchy, N. S., Sato, K., Marshall, M. R. and Kannan A. (eds.) Bioactive
Food Proteins and Peptides: Applications in Human Health. Boca Raton, FL: CRC
Press, pp. 131–180.
Arihara, K. (2006a). Strategies for designing novel functional meat products. Meat
Science, 74, 219–229.
Arihara, K. (2006b). Functional properties of bioactive peptides derived from meat
proteins. In: Nollet, L. M. L. and Toldrá, F. (eds.) Advanced Technologies for Meat
Processing. Boca Raton, FL: CRC Press, pp. 245–274.
Arihara, K. (2013). Relevance of peptides bioactivity in foods. In: Toldrá, F. and Nollet,
L. M. L. (eds.) Proteomics in Foods. New York, NY: Springer, pp. 447–463.
Arihara, K. (2014). Functional foods. In: Dikeman, M. and Devine, C. (eds.) Encyclope-
dia of Meat Sciences (2nd Ed., vol. 2). Oxford: Elsevier/Academic Press, pp. 32–36.
Arihara, K., Arai, T., Ohata, M., Ishikawa, S. and Itoh, M. (2013). Food/pet food mate-
rial having health functionality and linking-improving effect with collagen as
raw material. Japan Patent No. 2013-5326489.
Arihara, K., Ishikawa, S. and Itoh, M. (2011). Bifidobacterium growth promoting pep-
tides derived from meat proteins. Japan Patent No. 2011-4726129.
Arihara, K., Nakashima, Y., Ishikawa, S. and Itoh, M. (2004). Antihypertensive activi-
ties generated from porcine skeletal muscle proteins by lactic acid bacteria. In
Abstracts of 50th International Congress of Meat Science and Technology, Helsinki,
Finland, p. 236.
Arihara, K., Nakashima, Y., Mukai, T., Ishikawa, S. and Itoh, M. (2001). Peptide inhibi-
tors for angiotensin I-converting enzyme from enzymatic hydrolysates of por-
cine skeletal muscle proteins. Meat Science, 57, 319–324.
Arihara, K. and Ohata, M. (2011a). Use of probiotics and prebiotics in meat products.
In: Kerry, J. P. and Kerry. J. F. (eds.) Processed Meats: Improving Safety, Nutrition
and Quality. Cambridge: Woodhead Publishing, pp. 403–417.
Arihara, K. and Ohata, M. (2011b). Functional meat products. In: Saarela, M. (ed.)
Functional Foods: Concept to Products (2nd Ed.). Cambridge: Woodhead Publish-
ing, pp. 512–533.
Arihara, K. and Ohata, M. (2015). Antihypertensive peptides generated in aged pork.
Japan Patent No. 2015-154703.
Arihara, K. and Ohata, M. (2017). Production of bioactives from meat and animal
by-products. In: Bekhit, A. E.-D. A. (ed.) Advances in Meat Processing Technology.
Boca Raton, FL: CRC Press.
Arihara, K., Tomita, K., Ishikawa, S., Itoh, M., Akimoto, M. and Sameshima, T. (2011).
Anti-fatigue peptides derived from meat proteins. Japan Patent No. 2011-4828890.
Arihara, K., Zhou, L. and Ohata, M. (2017). Bioactive properties of Maillard reaction
products generated from food protein-derived peptides. Advances in Food and
Nutrition Research, 81, 161–185.
392 Advanced Technologies for Meat Processing, Second Edition

Bagchi, D. and Nair, S. (2017). Developing New Functional Food and Nutraceutical Prod-
ucts. London: Academic Press.
Bah, C. S. F., Bekhit, E.-D. A., Carne, A. and McConnell, M. A. (2013). Slaughterhouse
blood: An emerging source of bioactive compounds. Comprehensive Reviews in
Food Science and Food Safety, 12, 314–331.
Banerjee, P. and Shanthi, C. (2012). Isolation of novel bioactive regions from bovine
Achilles tendon collagen having angiotensin I-converting enzyme-inhibitory
properties. Process Biochemistry, 47, 2335–2346.
Bauchart, C., Remond, D., Chambon, C. et al. (2006). Small peptides (<5 kDa) found
in ready-to-eat beef meat. Meat Science, 74, 658–666.
Bernardini, R. D., Harnedy, P., Bolton, D., Kerry, J. and O’Neil, E. (2011). Antioxidant
and antimicrobial peptidic hydrolysates from muscle protein sources and by-
products. Food Chemistry, 124, 1296–1307.
Blank, I. (2005). Current status of acrylamide research in food: Measurement, safety
assessment, and formation. Annals of the New York Academy of Sciences, 1043,
30–40.
Blishchenko, E., Sazonova, O., Surovoy, A. et al. (2002). Antiproliferative action of
valorphin in cell cultures. Journal of Peptide Science, 8, 438–452.
Bouhallab, S., Molle, D. and Leonil, J. (1992). Tryptic hydrolysis of caseinomacropep-
tide in membrane reactor: Preparation of bioactive peptides. Biotechnology Let-
ters, 14, 805–810.
Bowman, L. (2015). Bioactive Food Peptides: Production and Health Benefits. Forest Hills,
NJ: Foster Academics.
Brantl, V., Teschemacher, H., Henschen, A. and Lottspeich, F. (1979). Novel opioid
peptides derived from casein (β-Casomorphins) I. Isolation from bovine casein
peptone. Hoppe-Seyler’s Zeitschrift fur physiologische Chemie, 360, 1211–1216.
Brody, E. P. (2000). Biological activities of bovine glycomacropeptide. British Journal of
Nutrition, 84, S39–S46.
Bruna, J. M., Fernandez, M., Hierro, E. M., Ordonez, J. A. and de la Hoz, L. (2000).
Combined use of pronase E and a fungal extract (Penicillium aurantiogriseum) to
potentiate the sensory characteristics of dry fermented sausages. Meat Science,
54, 135–145.
Bütikofer, U., Meyer, J., Sieber, R., Walther, B. and Wechsler, D. (2008). Occurrence of
the angiotensin-converting enzyme-inhibiting tripeptides Val-Pro-Pro and Ile-
Pro-Pro in different cheese varieties of Swiss origin. Journal of Dairy Science, 91,
29–38.
Carrasco-Castilla, J., Hernández-Álvarez, A. J., Jiménez-Martínez, C., Gutierrez-
López, G. F. and Dávila-Ortiz, G. (2012). Use of proteomics and peptidomics
methods in food bioactive peptide science and engineering. Food Engineering
Reviews, 4, 224–243.
Castellano, P., Aristoy, M. C., Sentandreu, M. Á., Vignolo, G. and Toldrá, F. (2013).
Peptides with angiotensin I converting enzyme (ACE) inhibitory activity gener-
ated from porcine skeletal muscle proteins by the action of meat-borne Lactoba-
cillus. Journal of Proteomics, 89, 183–190.
Castellano, P., Mora, L., Escudero, E., Vignolo, G., Aznar, R. and Toldrá, F. (2016).
Antilisterial peptides from Spanish dry-cured hams: Purification and identifica-
tion. Food Microbiology, 59, 133–141.
Cevallos-Cevallos, J. M. and Reyes-De-Corcuera, J. I. (2012). Metabolomics in food
science. Advances in Food and Nutrition Research, 67, 1–24.
Bioactive Properties of Peptides Generated from Meat Proteins 393

Chakraborty, P. D. and Bhattacharyya, D. (2005). Isolation of fibronectin type III like

peptide from human placental extract used as wound healer. Journal of Chroma-
tography B, 818, 67–73.
Chang, C.-Y., Wu, K.-C. and Chiang, S.-H. (2007). Antioxidant properties and pro-
tein compositions of porcine haemoglobin hydrolysates. Food Chemistry, 100,
1537–1543.
Chen, H.-M., Muramoto, K. and Yamauchi, F. (1996). Antioxidative activity of
designed peptides based on the antioxidative peptide isolated from digests of a
soybean protein. Journal of Agricultural and Food Chemistry, 44, 2619–2623.
Cheng, L.-K., Song, H.-L. and Wang, P.-X. C. (2011). Degradation of peptides derived
from enzymatic hydrolysis of beef during Maillard reaction. Food Science, 32,
46–50.
Cheung, H. S., Wang, F. L., Ondetti, M. A., Sabe, E. F. and Cushman, D. W. (1980).
Binding of peptide substrate and inhibition of angiotensin-converting enzyme:
Importance of the COOH-terminal dipeptides sequence. Journal of Biological
Chemistry, 255, 401–407.
Chiba, H. and Yoshikawa, M. (1986). Biologically functional peptides from food pro-
teins: New opioid peptides from milk proteins. In: Feeney, R. E. and Whitaker,
J. R. (eds.) Protein Tailoring for Food and Medical Users. New York, NY: Marcel
Dekker, pp. 123–153.
Dainty, R. and Blom, H. (1995). Flavor chemistry of fermented sausages. In: Campbell
Platt, G. and Cook, P. E. (eds.) Fermented Meats. Glasgow: Blackie Academic &
Professional, pp. 176–193.
Daoud, R., Dubois, V., Bors-Dodita, L. et al. (2005). New antibacterial peptide derived
from bovine hemoglobin. Peptides, 26, 713–719.
Dellafiora, L., Paolella, S., Dall’Asta, C., Dossena, A., Cozzini, P. and Galaverna,
G. (2015). Hybrid in silico/in vitro approach for the identification of angiotensin
I converting enzyme inhibitory peptides from Parma dry-cured ham. Journal of
Agricultural and Food Chemistry, 63, 6366–6375.
Diaz, O., Fernandez, M., Garcia De Fernando, G. D., de la Hoz, L. and Ordonez, J. A.
(1997). Proteolysis in dry fermented sausages: The effect of selected exogenous
proteases. Meat Science, 46, 115–128.
Di Bernardini, R., Mullen, A. M., Bolton, D., Kerry, J., O’Neill, E. and Hayes, M. (2012).
Assessment of the angiotensin-I-converting enzyme (ACE-I) inhibitory and
antioxidant activities of hydrolysates of bovine brisket sarcoplasmic proteins
produced by papain and characterisation of associated bioactive peptidic frac-
tions. Meat Science, 90, 226–235.
Dransfield, E. and Etherington, D. (1981). Enzymes in the tenderization of meat. In:
Birch, G. G., Blakebrough, N. and Parker, K. J. (eds.) Enzymes and Food Process-
ing. London: Applied Science Publishers, pp. 177–194.
Dziuba, B., Minkiewicz, P. and Darewicz, M. (2012). Database of biologically active
proteins and peptides. In: Hettiarachchy, N. S. (ed.) Bioactive Food Proteins and
Peptides. Boca Raton, FL: CRC Press, pp. 331–373.
Escudero, E., Aristoy, M.-C., Nishimura, H., Arihara, K. and Toldrá, F. (2012). Anti-
hypertensive effect and antioxidant activity of peptide fractions extracted from
Spanish dry-cured ham. Meat Science, 91, 306–311.
Escudero, E., Mora, L., Fraser, P. D., Aristoy, M. C., Arihara, K. and Toldrá, F. (2013a).
Purification and identification of antihypertensive peptides in Spanish dry-
cured ham. Journal of Proteomics, 78, 499–507.
394 Advanced Technologies for Meat Processing, Second Edition

Escudero, E., Mora, L., Fraser, P. D., Aristoy, M. C., Arihara, K. and Toldrá, F. (2013b).
Identification of novel antioxidant peptides generated in Spanish dry-cured
ham. Food Chemistry, 138, 1282–1288.
Escudero, E., Mora, L. and Toldrá, F. (2014). Stability of ACE inhibitory ham peptides
against heat treatment and in vitro digestion. Food Chemistry, 161, 305–311.
Escudero, E., Sentandreu, M., Arihara, K. and Toldrá, F. (2010). Angiotensin I-convert-
ing enzyme inhibitory peptides generated from in vitro gastrointestinal diges-
tion of pork meat. Journal of Agricultural and Food Chemistry, 58, 2895–2901.
Etherington, D. J. (1984). The contribution of proteolytic enzymes to postmortem
changes in muscle. Journal of Animal Science, 59, 1644–1650.
Ferranti, P., Nitride, C., Nicolai, M. A. et al. (2014). In vitro digestion of Bresaola proteins
and release of potential bioactive peptides. Food Research International, 63, 157–169.
Fiat, A.-M., Migliore-Samour, D., Jollès, P., Drout, L., Collier, C. and Caen, J. (1993).
Biologically active peptides from milk proteins with emphasis on two examples
concerning antithrombotic and immunomodulating activities. Journal of Dairy
Science, 76, 301–310.
Fogaca, A. C., da Silva, P. I., Miranda, M. T. M. et al. (1999). Antimicrobial activity of a
bovine hemoglobin fragment in the tick Boophilus microplus. Journal of Biological
Chemistry, 274, 25330–25334.
Froidevaux, R., Krier, F., Nedjar-Arroume, N. et al. (2001). Antimicrobial activity of a
pepsin-derived bovine hemoglobin fragment. FEBS Letters, 491, 159–163.
Fu, Y., Young, J. F. and Therkildsen, M. (2017). Bioactive peptides in beef: Endogenous
generation through postmortem aging. Meat Science, 123, 134–142.
Fujita, H. and Yoshikawa, M. (1999). LKPNM: A prodrug-type ACE-inhibitory pep-
tide derived from fish protein. Immunopharmacology, 44, 123–127.
Fujita, H., Yokoyama, K. and Yoshikawa, M. (2000). Classification and antihyperten-
sive activity of angiotensin I-converting enzyme inhibitory peptides derived
from food proteins. Journal of Food Science, 65, 564–569.
Fukudome, S. and Yoshikawa, M. (1992). Opioid peptides derived from wheat gluten,
their isolation and characterization. FEBS Letters, 296, 107–111.
Fukudome, S. and Yoshikawa, M. (1993). A novel opioid peptide derived from wheat
gluten. FEBS Letters, 316, 17–19.
Gagnaire, V., Molle, D., Herrouin, M. and Leonil, J. (2001). Peptides identified during
Emmental cheese ripening: Origin and proteolytic systems involved. Journal of
Agricultural and Food Chemistry, 49, 4402–4413.
Gallego, M., Mora, L., Fraser, P. D., Aristoy, M. C. and Toldrá, F. (2014). Degradation of
LIM domain-binding protein 3 during Spanish dry-cured ham processing. Food
Chemistry, 149, 121–128.
Gallego, M., Grootaert, C., Mora, L., Aristoy, M. C., Van Camp, J. and Toldrá, F. (2016).
Transepithelial transport of dry-cured ham peptides with ACE inhibitory activ-
ity through a Caco-2 cell monolayer. Journal of Functional Foods, 21, 388–395.
Gallego, M., Mora, L., Aristoy, M. C. and Toldrá, F. (2015). Titin-derived peptides as
processing time markers in dry-cured ham. Food Chemistry, 167, 326–339.
Gibson, G. R. (2004). From probiotics to prebiotics. Journal of Food Science, 69,
M141–M143.
Gobbetti, M., Minervini, F. and Rizzello, C. G. (2007). Bioactive peptides in dairy
products. In: Hui, Y. H. (ed.) Handbook of Food Products Manufacturing: Health,
Meat, Milk, Poultry, Seafood, and Vegetables. Hoboken, NJ: John Wiley & Sons, pp.
489–517.
Bioactive Properties of Peptides Generated from Meat Proteins 395

Gomez-Guillen, C. M., Gimenez, B., Lopez-Caballero, M. E. and Montero, M. P.

(2011). Functional and bioactive properties of collagen and gelatin from alterna-
tive sources: A review. Food Hydrocolloids, 25, 1813–1827.
Gomez-Ruiz, J. A., Ramos, M. and Recio, I. (2002). Angiotensin-converting enzyme-
inhibitory peptides in Manchego cheeses manufactured with different starter
cultures. International Dairy Journal, 12, 697–706.
Gonzalez de Llano, D. and Polo Sanchez, C. (2003). Peptides. In: Caballero, B., Trugo,
L. C. and Finglas, P. M. (eds.) Encyclopedia of Food Science and Nutrition (2nd Ed.).
London: Academic Press, pp. 4468–4473.
Gu, Y., Majumder, K. and Wu, J. (2011). QSAR-aided in silico approach in evaluation
of food proteins as precursors of ACE inhibitory peptides. Food Research Interna-
tional, 44, 2465–2474.
Hau, J., Cazes, D. and Fay, L. B. (1997). Comprehensive study of the “beefy meaty
peptide”. Journal of Agricultural and Food Chemistry, 45, 1351–1355.
Hayase, F. (1996). Scavenging of active oxygen by melanoidins. In: Ikan, R. (ed.) The
Maillard Reaction, Consequences for the Chemical and Life Sciences. Hoboken, NJ:
John Wiley & Sons, pp. 89–104.
Hayes, M. and García-Vaquero, M. (2016). Bioactive compounds from fermented food
products. In: Ojha, K. S. and Tiwari, B. K. (eds.) Novel Food Fermentation Technolo-
gies. Cham, Switzerland: Springer International Publishing, pp. 293–310.
He, H. L., Liu, D. and Ma, C. B. (2013). Review on the angiotensin-I-converting
enzyme (ACE) inhibitor peptides from marine proteins. Applied Biochemistry and
Biotechnology, 169, 738–749.
Henriksen, A. H. and Stahnke, L. H. (1997). Sensory and chromatographic evalua-
tions of water soluble fractions from dried sausages. Journal of Agricultural and
Food Chemistry, 45, 2679–2684.
Hernändez-Ledesma, B., Amigo, L., Ramos, M. and Recio, I. (2004). Angiotensin con-
verting enzyme inhibitory activity in commercial fermented products. Journal of
Agricultural and Food Chemistry, 52, 1504–1510.
Hettiarachchy, N. S. (2012). Bioactive Food Proteins and Peptides. Boca Raton, FL: CRC
Press.
Hierro, E., de la Hoz, L. and Ordonez, J. A. (1999). Contribution of the microbial
and meat endogenous enzymes to the free amino acid and amine contents
of dry fermented sausages. Journal of Agricultural and Food Chemistry, 47,
1156–1161.
Hou, Y., Liu, W., Cheng, Y., Zhou, J., Wu, L. and Yang, G. (2014). Production, opti-
mization and characterization of immunomodulatory peptides obtained from
fermented goal placenta. Food Science and Technology (Campinas), 34, 723–729.
Hu J., Xu, M., Hang, B. et al. (2011). Isolation and characterization of an antimicrobial
peptide from bovine hemoglobin α-subunit. World Journal of Microbiology and
Biotechnology, 27, 767–771.
Ibrahim, H. R., Sugimoto, Y. and Aoki, T. (2000). Ovotransferrin antimicrobial peptide
(OTAP-92) kills bacteria through a membrane damage mechanism. Biochimica
et Biophysica Acta, 1523, 196–205.
Idota, T., Kawakami, H. and Nakajima, I. (1994). Growth-promoting effects of
N-acetylneuraminic acid containing substances on bifidobacteria. Bioscience,
Biotechnology, and Biochemistry, 58, 1720–1722.
Jang, A. and Lee, M. (2005). Purification and identification of angiotensin converting
enzyme inhibitory peptides from beef hydrolysates. Meat Science, 69, 653–661.
396 Advanced Technologies for Meat Processing, Second Edition

Jayasena, D. D., Ahn, D. U., Nam, K. C. and Jo, C. (2013). Flavour chemistry of chicken
meat: A review. Asian-Australasian Journal of Animal Sciences, 26, 732–742.
Jollès, P. and Henschen, A. (1982). Comparison between the clotting of blood and
milk. Trends in Biochemical Sciences, 7, 325–328.
Jollès, P., Levy-Toledano, S., Fiat, A. M. et al. (1986). Analogy between fibrinogen and
casein. Effect of an undecapeptide isolated from κ-casein on platelet function.
European Journal of Biochemistry, 158, 379–384.
Katayama, K., Fuchu, H., Sakata, A. et al. (2003a). Angiotensin I-converting enzyme
inhibitory activities of porcine skeletal muscle proteins following enzyme diges-
tion. Asian-Australasian Journal of Animal Sciences, 16, 417–424.
Katayama, K., Tomatsu, M., Fuchu, H. et al. (2003b). Purification and characterization
of an angiotensin I-converting enzyme inhibitory peptide derived from porcine
troponin C. Animal Science Journal, 74, 53–58.
Katayama, K., Tomatsu, M., Kawahara, S. et al. (2004). Inhibitory profile of nonapep-
tide derived from porcine troponin C against angiotensin I-converting enzyme.
Journal of Agricultural and Food Chemistry, 52, 771–775.
Kato, T., Matsuda, T., Tahara, T., Sugimoto, M., Sato, Y. and Nakamura, R. (1994).
Effects of meat conditioning and lactic fermentation on pork muscle protein
degradation. Bioscience, Biotechnology, and Biochemistry, 58, 408–410.
Kayser, H. and Meisel, H. (1996). Stimulation of human peripheral blood lymphocytes
by bioactive peptides derived from bovine milk proteins. FEBS Letters, 383, 18–20.
Kęska, P. and Stadnik, J. (2016). Porcine myofibrillar proteins as potential precursors
of bioactive peptides—An in silico study. Food Function, 7, 2878–2885.
Khaldi, N. (2012). Bioinformatics approaches for identifying new therapeutic bioac-
tive peptides in food. Functional Foods in Health and Disease, 2, 325–338.
Kim, S.-K., Kim, Y.-T., Byun, H.-G., Park, P.-J. and Ito, H. (2001). Purification and char-
acterization of antioxidative peptides from bovine skin. Biochemistry and Molec-
ular Biology, 34, 219–224.
Kim, S.-K., Wijesekara, I., Park, E. Y., Matsumura, Y., Nakamura, Y. and Sato, K. (2012).
Proteins and peptide as antioxidants. In: Hettiarachchy, N. S., Sato, K., Marshall,
M. R. and Kannan, A. (eds.) Bioactive Food Proteins and Peptides, Applications in
Human Health. Boca Raton, FL: CRC Press, pp. 97–115.
Kitamura, S., Muroya, S., Tanabe, S., Okumura, T., Chikuni, K. and Nishimura,
T. (2005). Mechanism of production of troponin T fragments during postmortem
aging of porcine muscle. Journal of Agricultural and Food Chemistry, 53, 4178–4181.
Koohmaraie, M. (1994). Muscle proteinases and meat aging. Meat Science, 36, 93–104.
Korhonen, H. and Pihlanto, A. (2003). Food-derived bioactive peptides: Opportuni-
ties for designing future foods. Current Pharmaceutical Design, 9, 1297–1308.
Kumeta, Y., Maruyama, T., Asama, H., Yamamoto, Y., Hakamatsuka, T. and Goda,
Y. (2014). Species identification of Asini Corii Collas (donkey glue) by PCR ampli-
fication of cytochrome b gene. Journal of Natural Medicines, 68, 181–185.
Lafarga, T. and Hayes, M. (2014). Bioactive peptides from meat muscle and by-
products: Generation, functionality and application as functional ingredients.
Meat Science, 98, 227–239.
Lafarga, T., O’Connor, P. and Hayes, M. (2015). In silico methods to identify meat-
derived prolyl endopeptidase inhibitors. Food Chemistry, 175, 337–343.
Lahov, E. and Regelson, W. (1996). Antibacterial and immunostimulating casein-
derived substances from milk: Casecidin, istacidin peptides. Food and Chemical
Toxicology, 34, 131–145.
Bioactive Properties of Peptides Generated from Meat Proteins 397

Lertittikula, W., Benjakula, S. and Tanaka, M. (2007). Characteristics and antioxidative

activity of Maillard reaction products from a porcine plasma protein–glucose
model system as influenced by pH. Food Chemistry, 100, 669–677.
Li, B., Chen, F., Xang, X., Ji, B. and Wu, Y. (2007). Isolation and identification of anti-
oxidative peptides from porcine collagen hydrolysate by consecutive chroma-
tography. Food Chemistry, 102, 1135–1143.
Li, G. H., Le, G. W., Shi, Y. H. and Shrestha, S. (2004). Angiotensin I-converting
enzyme inhibitory peptides derived from food proteins and their physiological
and pharmacological effects. Nutrition Research, 24, 469–486.
Li, Y., Lu, F., Luo, C., Chen, Z., Mao, J. and Shoemaker, C. (2009). Functional proper-
ties of the Maillard reaction products of rice protein with sugar. Food Chemistry,
117, 69–74.
Liepke, C., Adermann, K., Raida, M., Magert, H.-J., Forssman, W.-G. and Zucht, H.-D.
(2002). Human milk provides peptides highly stimulating the growth of bifido-
bacteria. European Journal of Biochemistry, 269, 712–718.
Liu, R., Xing, L., Fu, Q., Zhou, G.-H. and Zhang, W.-G. (2016). A review of antioxidant
peptides derived from meat muscle and by-products. Antioxidants, 5, 32–46.
López, C. M., Bru, E., Vignolo, G. and Fedda, S. G. (2015). Identification of small pep-
tides arising from hydrolysis of meat proteins in dry fermented sausages. Meat
Science, 104, 20–29.
Losso, J. N. (2016). The Maillard Reaction Reconsidered. Boca Raton, FL: CRC Press.
Maehashi, K., Matsuzaki, M., Yamamoto, Y. and Udaka, S. (1999). Isolation of
peptides from an enzymatic hydrolysate of food proteins and characteriza-
tion of their taste properties. Bioscience, Biotechnology, and Biochemistry, 63,
555–559.
Martínez-Maqueda, D., Hernández-Ledesma, B., Amigo, L., Miralles, B. and Gómez-
Ruiz, J. Á. (2013). Extraction/fractionation techniques for proteins and peptides
and protein digestion. In: Toldrá, F. and Nollet, L. M. L. (eds.) Proteomics in
Foods. New York, NY: Springer, pp. 21–50.
Maruyama, S., Mitachi, H., Awaya, J., Kurono, M., Tomizuka, N. and Suzuki, H.
(1987). Angiotensin I converting enzyme inhibitory activity of the C-terminal
hexapeptide of αs1-casein. Agricultural and Biological Chemistry, 51, 2557–2561.
Matsubayashi, Y. and Sakagami, Y. (1999). Characterization of specific binding sites
for a mitogenic sulfated peptide, phytosulfokine-α, in the plasma-membrane
fraction derived from Oryza sativa L. European Journal of Biochemistry, 262,
666–671.
Meisel, H. (1986). Chemical characterization and opioid activity of an exorphin iso-
lated from in vivo digests of casein. FEBS Letters, 196, 223–227.
Meisel, H., Walsh, D. J., Murry, B. and FitzGerald, R. J. (2005). ACE inhibitory pep-
tides. In: Mine, Y. and Shahidi, F. (eds.) Nutraceutical Proteins and Peptides in
Health and Disease. Boca Raton, FL: CRC Press, pp. 269–315.
Mellander, O. (1950). The physiological importance of the casein phosphopeptide cal-
cium salts II: Peroral calcium dosage in infants. Acta Societatis Medicorum Upsa-
liensis, 55, 247–255.
Mikami, M., Nagao, M., Sekikawa, M. and Miura, H. (1995). Changes in peptide and
free amino acid contents of different bovine muscle homogenate during storage.
Animal Science and Technology (Japan), 66, 630–638.
Migliore-Samour, D., Floc’h, F. and Jollès, P. (1989). Biologically active casein peptides
implicated in immunomodulation. Journal of Dairy Research, 56, 357–362.
398 Advanced Technologies for Meat Processing, Second Edition

Mirdhayati, I., Hermanianto, J., Wijaya, C. H., Sajuthi, D. and Arihara, K. (2015).
Angiotensin converting enzyme (ACE) inhibitory and antihypertensive activi-
ties of protein hydrolysate from meat of Kacang goat (Capra aegagrus hircus).
Journal of the Science of Food and Agriculture, 96, 3536–3542.
Miyoshi, S., Ishikawa, H., Kaneko, T., Fukui, F., Tanaka, H. and Maruyama, S. (1991).
Structures and activity of angiotensin-converting enzyme inhibitors α-zein
hydrolysate. Agricultural and Biological Chemistry, 55, 1313–1318.
Mora, L., Escudero, E., Arihara, K. and Toldrá, F. (2015). Antihypertensive effect of
peptides naturally generated during Iberian dry-cured ham processing. Food
Research International, 78, 71–78.
Mora, L., Escudero, E., Fraser, P. D., Aristoy, M. C. and Toldrá, F. (2014). Proteomic
identification of antioxidant peptides from 400 to 2500 Da generated in Span-
ish dry-cured ham contained in a size-exclusion chromatography. Food Research
International, 56, 68–76.
Mora, L., Escudero, E. and Toldrá, F. (2016). Characterization of the peptide profile
in Spanish Teruel, Italian Parma and Belgian dry-cured hams and its potential
bioactivity. Food Research International, 89, 638–646.
Mora, L., Sentandreu, M. A., Fraser, P. D., Toldrá, F. and Bramley, P. M. (2009). Oligo-
peptides arising the degradation of creatine kinase in Spanish dry-cured ham.
Journal of Agricultural and Food Chemistry, 57, 8982–8988.
Mora, L. and Toldrá, F. (2013). Dry-cured ham. In: Toldrá, F. and Nollet, L. M. L. (eds.)
Proteomics in Foods. New York, NY: Springer, pp. 147–160.
Mora, L. and Toldrá, F. (2014). Bioactive peptides generated from meat industry by-
products. Food Research International, 65, 344–349.
Morales, F., Somoza, V. and Fogliano, V. (2012). Physiological relevance of dietary
melanoidins. Amino Acids, 42, 1097–1109.
Morimatsu, F., Ito, M., Budijanto, S., Watanabe, I., Furukawa, Y. and Kimura, S. (1996).
Plasma cholesterol-suppressing effect of papain-hydrolyzed pork meat in rats
fed hypercholesterolemic diet. Journal of Nutritional Science and Vitaminology, 42,
145–153.
Mottram, D. S., Wedzicha, B. L. and Dodson, A. T. (2002). Food chemistry: Acrylamide
is formed in the Maillard reaction. Nature, 419, 448–449.
Nagaoka, S. (2012). Peptide-lipid interactions and functionalities. In: Hettiarachchy,
N. S., Sato, K., Marshall, M. R. and Kannan, A. (eds.) Food Proteins and Peptides:
Chemistry, Functionality, Interactions and Commercialization. Boca Raton, FL: CRC
Press, pp. 263–276.
Nagaoka, S., Futamura, Y., Miwa, K. et al. (2001). Identification of novel hypocholes-
terolemic peptides derived from bovine milk β-lactoglobulin. Biochemical and
Biophysical Research Communications, 281, 11–17.
Nagaoka, S., Kanamaru, Y. and Kuzuya, Y. (1992). Comparative studies on the serum
cholesterol lowering action of whey protein and soyprotein in rats. Bioscience,
Biotechnology, and Biochemistry, 56, 1484–1485.
Nakashima, Y., Arihara, K., Sasaki, A., Ishikawa, S. and Itoh, M. (2002). Antihyper-
tensive activities of peptides derived from porcine skeletal muscle myosin in
spontaneously hypertensive rats. Journal of Food Science, 67, 434–437.
Nedjar-Arroume, N., Dubois-Delval, V., Miloudi, K. et al. (2006). Isolation and char-
acterization of four antibacterial peptides from bovine hemoglobin. Peptides, 27,
2082–2089.
Bioactive Properties of Peptides Generated from Meat Proteins 399

Nishimura, T. and Kato, H. (1988). Mechanisms involved in the improvement of meat

taste during postmortem aging. Food Science and Technology International (Tokyo),
4, 241–249.
Nishimura, T., Rhue, M. R., Okitani, A. and Kato, H. (1988). Components contribut-
ing to the improvement of meat taste during storage. Agricultural and Biological
Chemistry, 52, 2323–2330.
Noguchi, M., Arai, S., Yamashita, M., Kato, H. and Fujimaki, M. (1975). Isolation and
identification of acidic oligopeptides occurring in a flavor potentiating fraction
from a fish protein hydrolysate. Journal of Agricultural and Food Chemistry, 23,
49–53.
Norris, R. and FitzGerald, J. R. (2015). Antihypertensive peptides from food proteins.
In: Bowman, L. (ed.) Bioactive Food Peptides: Production and Health Benefits. Forest
Hills, NJ: Foster Academics, pp. 3–30.
Nurminen, M.-L., Sipola, M., Kaarto, H. et al. (2000). α-Lactophin lowers blood pres-
sure via radiotelemetry in normotensive and spontaneously hypertensive rats.
Life Sciences, 66, 1535–1543.
Nyberg, F., Sanderson, K. and Glamsta, E.-L. (1997). The hemorphins: A new class of
opioid peptides derived from the blood protein hemoglobin. Biopolymers, 43,
147–156.
Ohata, M., Uchida, S., Zhou, L. and Arihara, K. (2016). Antioxidant activity of fer-
mented meat sauce and isolation of an associated antioxidant peptide. Food
Chemistry, 194, 1034–1039.
Ohata, M., Zhou, L., Owashi, C. and Arihara, K. (2014). The effect of odor generated
from protein digests and reducing sugars by the Maillard reaction on blood
pressure. IMARS News Letter, 9, 21–25.
Okumura, T., Yamada, R. and Nishimura, T. (2004). Sourness-suppressing peptides
in cooked pork loins. Bioscience, Biotechnology, and Biochemistry, 68, 1657–1662.
Olmedilla-Alonso, B., Jiménez-Colmenero, F. and Sánchez-Muniz, F. J. (2013). Devel-
opment and assessment of healthy properties of meat and meat products
designed as functional foods. Meat Science, 95, 919–930.
Ondetti, M. A. and Cushman, D. W. (1982). Enzymes of the renin-angiotensin system
and their inhibitors. Annual Review of Biochemistry, 51, 283–308.
Ordonez, J. A., Hierro, E. M., Bruna, J. M. and de la Hoz, L. (1998). Changes in the
components of dry fermented sausages during ripening. Critical Reviews in Food
Science and Nutrition, 39, 329–367.
Ortea, I., O’Connor, G. and Maquet, A. (2016). Review on proteomics for food authen-
tication. Journal of Proteomics, 147, 212–225.
Oshima, G., Shimabukuro, H. and Nagasawa, K. (1979). Peptide inhibitors of angio-
tensin I-converting enzyme in digests of gelatin by bacterial collagenase. Biochi-
mica et Biophysica Acta, 566, 128–137.
Otani, H. and Hata, I. (1995). Inhibition of proliferative responses of mouse spleen
lymphocytes and rabbit Peyer’s patch cells by bovine milk caseins and their
digests. Journal of Dairy Research, 62, 339–348.
Owusu-Apenten, R. (2010). Bioactive Peptides Applications for Improving Nutrition and
Health. Baca Raton, FL: CRC Press.
Parés, D., Saguer, E. and Carretero, C. (2011). Blood by-products as ingredients in
processed meat. In: Kerry, J. P. and Kerry, J. F. (eds.) Processed Meats: Improving
Safety, Nutrition and Quality. Oxford: Woodhead Publishing, pp. 219–242.
400 Advanced Technologies for Meat Processing, Second Edition

Pathera, A. K., Jairath, G., Singh, P. K. and Yadav, S. (2017). Health promoting func-
tional properties of meat and meat products. In: Mudgil, D. and Barak, S. (eds.)
Functional Foods: Sources and Health Benefits. Jodhpur, India: Scientific Publishers,
pp. 333–362.
Pavlidis, C., Patrinos, G. P. and Katsila, T. (2015). Nutrigenomics: A controversy.
Applied & Translational Genomics, 4, 50–53.
Pegg, R. B. and Shahidi, F. (2014). Flavor development. In: Encyclopedia of Meat Sciences
(2nd Ed., vol. 1), Dikeman, M. and Devine, C (eds.). Oxford: Elsevier/Academic
Press, pp. 377–384.
Pihlanto-Leppälä, A. (2001). Bioactive peptides derived from bovine whey proteins:
Opioid and ACE inhibitory peptides. Trends in Food Science & Technology, 11,
347–356.
Pihlanto, A. and Korhonen, H. (2003). Bioactive peptides and proteins. Advances in
Food and Nutrition Research, 47, 175–276.
Poljak, A., McLean, C. A., Sachdev, P., Brodaty, H. and Smythe, G. A. (2004). Quan-
tification of hemorphins in Alzheimer’s disease brains. Journal of Neuroscience
Research, 75, 704–714.
Przybylski, R., Firdaous, L., Châtaigné, G., Dhulster, P. and Nedjar, N. (2016). Produc-
tion of an antimicrobial peptide derived from slaughterhouse by-product and
its potential application on meat as preservative. Food Chemistry, 211, 306–313.
Ryan, J. T., Ross, R. P., Bolton, D., Fitzgerald, G. F. and Stanton, C. (2011). Bioactive
peptides from muscle sources: Meat and fish (review). Nutrients, 3, 765–791.
Ryder, K., Bekhit, A. E.-D., McConnell, M. and Carne, A. (2016). Towards generation
of bioactive peptides from meat industry waste proteins: Generation of peptides
using commercial microbial proteases. Food Chemistry, 208, 42–50.
Saiga, A., Okumura, T., Makihara, T. et al. (2003a). Angiotensin I-converting enzyme
inhibitory peptides in a hydrolyzed chicken breast muscle extract. Journal of
Agricultural and Food Chemistry, 51, 1741–1745.
Saiga, A., Tanabe, S. and Nishimura, T. (2003b). Antioxidant activity of peptides
obtained from porcine myofibrillar proteins by protease treatment. Journal of
Agricultural and Food Chemistry, 51, 3661–3667.
Saito, T., Nakamura, T., Kitazawa, H., Kawai, Y. and Itoh, T. (2000). Isolation and
structural analysis of antihypertensive peptides that exist naturally in Gouda
cheese. Journal of Dairy Science, 83, 1434–1440.
Sarraga, C., Gil, M., Arnau, J., Monfort, J. M. and Cusso, R. (1989). Effect of curing
salt and phosphate on the activity of porcine muscle proteases. Meat Science, 25,
241–249.
Sayd, T., Chambon, C. and Santé-Lhoutellier, V. (2016). Quantification of peptides
released during in vitro digestion of cooked meat. Food Chemistry, 197, 1311–1323.
Sentandreu, M. A., Stoeva, S., Aristoy, M. C., Laib, K., Voelter, W. and Toldrá, F. (2003).
Identification of small peptides generated in Spanish dry-cured ham. Journal of
Food Science, 68, 64–69.
Sentandreu, M. A. and Toldrá, F. (2007). Evaluation of ACE inhibitory activity of
dipeptides generated by the action of porcine muscle dipeptidyl peptidases.
Food Chemistry, 102, 511–515.
Shahidi, F., Samaranayaka, A. G. P. and Pegg, R. B. (2014). Flavor development. In:
Dikeman, M. and Devine, C. (eds.) Encyclopedia of Meat Sciences (2nd Ed., vol. 1).
London: Elsevier/Academic Press, pp. 391–403.
Bioactive Properties of Peptides Generated from Meat Proteins 401

Shimizu, M., Sawashita, N., Morimatsu, F. et al. (2009). Antithrombotic papain-

hydrolyzed peptides isolated from pork meat. Thrombosis Research, 123, 753–757.
Shin, K., Yamauchi, K., Teraguchi, S. et al. (1998). Antibacterial activity of bovine lac-
toferrin and its peptides against enterohaemorrhagic Escherichia coli O157:H7.
Letters in Applied Microbiology, 6, 407–411.
Simonetti, A., Gambacorta, E. and Perna, A. (2016). Antioxidative and antihyperten-
sive activities of pig meat before and after cooking and in vitro gastrointestinal
digestion: Comparison between Italian autochthonous pig Suino Nero Lucano
and a modern crossbred pig. Food Chemistry, 212, 590–595.
Somoza, V. (2005). Five years of research on health risks and benefits of Maillard reac-
tion products: An update. Molecular Nutrition & Food Research, 49, 663–672.
Stadler, R. H., Blank, I., Varga, N. et al. (2002). Food chemistry: Acrylamide from Mail-
lard reaction products. Nature, 419, 449–450.
Stadnik, J. and Kęska, P. (2015). Meat and fermented meat products as a source of bio-
active peptides. Acta Scientiarum Polonorum Technologia Alimentaria, 14, 181–190.
Sugano, M., Goto, S., Yamada, Y. et al. (1990). Cholesterol-lowering activity of various
undigested fraction of soybean protein in rats. Journal of Nutrition, 120, 977–985.
Temussi, P. A. (2012). The good taste of peptides. Journal of Peptide Science, 18, 73–82.
Terashima, M., Baba, T., Ikemoto, N., Katayama, M., Morimoto, T. and Matsumura,
S. (2010). Novel angiotensin-converting enzyme (ACE) inhibitory peptides
derived from boneless chicken leg meat. Journal of Agricultural and Food Chemis-
try, 58, 7432–7436.
Toldrá, F. (2014). Dry. In: Dikeman, M. and Devine, C. (eds.) Encyclopedia of Meat Sci-
ences (2nd Ed., vol. 1). Oxford: Elsevier/Academic Press, pp. 425–429.
Toldrá, F., Aristoy, M.-C., Mora, L. and Reig, M. (2012). Innovations in value-addition
of edible meat by-products. Meat Science, 92, 290–296.
Toldrá, F. and Flores, M. (1988). The role of muscle proteases and lipases in flavor
development during the processing of dry-cured ham. Critical Reviews in Food
Science and Nutrition, 38, 331–352.
Tomita, M., Takase, M., Bellamy, W. R. and Shimamura, S. (1994). A review, the active
peptide of lactoferrin. Acta Paediatrica Japonica, 36, 585–591.
Udenigwe, C. C. (2014). Bioinformatics approaches, prospects and challenges
of food bioactive peptide research. Trends in Food Science & Technology, 36,
137–143.
Udenigwe, C. C. and Howard, A. (2013). Meat proteome as source of functional bio-
peptides. Food Research International, 54, 1021–1032.
Van Lancker, F., Adams, A. and De Kimpe, N. (2011). Chemical modifications of pep-
tides and their impact on food properties. Chemical Reviews, 111, 7876–7903.
Ventanas, J., Cordoba, J. J., Antequera, T., Garcia, C., López-bote, C. and Asensio,
M. A. (1992). Hydrolysis and Maillard reactions during ripening of Iberian ham.
Journal of Food Science, 57, 813–815.
Vercruysse, L., Van Camp, J. and Smagghe, G. (2005). ACE inhibitory peptides derived
from enzymatic hydrolysates of animal muscles protein: A review. Journal of
Agricultural and Food Chemistry, 53, 8106–8115.
Watanabe, K., Tsuji, Y., Shimoyamada, M., Ogama, N. and Ebina, T. (1998). Antitumor
effects of pronase-treated fragments, glycopeptides, from ovomucin in hen egg
white in a double grafted tumor system. Journal of Agricultural and Food Chemis-
try, 46, 3033–3038.
402 Advanced Technologies for Meat Processing, Second Edition

Weerawatanakorn, M., Wu, J.-C., Pan, M.-H. and Ho, C.-T. (2015). Reactivity and
stability of selected flavor compounds. Journal of Food and Drug Analysis, 23,
176–190.
Wu, J., Jahandideh, F., Yu, W. and Majumder, K. (2015). Bioactive peptides from meat
proteins as functional food components. In: Girillo, G., Gianfranco Spizzirri, U.
and Iemma, F. (eds.) Functional Polymers in Food Science. Beverly, MA: Scrivener
Publishing, pp. 181–208.
Xing, L.-J., Hu, Y. Y., Hu, H.-Y., Ge, Q.-F., Zhou, G.-H. and Zhang, W.-G. (2016). Puri-
fication and identification of antioxidative peptides from dry-cured Xuanwei
ham. Food Chemistry, 194, 951–958.
Yamazaki, Y. and Maekawa, K. (1980). Synthesis of a peptide with delicious taste.
Agricultural and Biological Chemistry, 44, 93–97.
Yoshikawa, M. (1996). Selection of proteases for production of biologically active pep-
tides from food proteins. Japanese Journal of Dairy and Food Science, 45, A51–A60.
Yoshikawa, M., Kishi, K., Takahashi, M. et al. (1993). Immunostimulating peptide
derived from soybean protein. Annals of the New York Academy of Sciences, 685,
375–376.
Young, D. and Mine, Y. (2009). Functional bioactive proteins and peptides in nutrig-
enomics. In: Mine, Y., Miyashita, K. and Shahidi, F. (eds.) Nutrigenomics and Pro-
teomics in Health and Disease. Ames, IA: Wiley-Blackwell, pp. 129–144.
Young, J. F., Therkildsen, M., Ekstrand, B. et al. (2013). Novel aspects of health pro-
moting compounds in meat. Meat Science, 95, 904–911.
Yu, Y., Hu, J. N., Miyaguchi, Y., Bai, X. F., Du, Y. G. and Lin, B. C. (2006). Isolation
and characterization of angiotensin I-converting enzyme inhibitory peptides
derived from porcine hemoglobin. Peptides, 27, 2950–2956.
Zhao, Q., Garreau, I., Sannier, F. and Piot, J. M. (1997). Opioid peptides derived from
hemoglobin: Hemorphins. Biopolymers, 43, 75–98.
Zhou, L., Ohata, M. and Arihara, K. (2016). Effects of odor generated from the glycine/
glucose Maillard reaction on human mood and brainwaves. Food Function, 7,
2574–2581.
13
New Approaches for the Development
of Functional Meat Products

Francisco Jiménez-Colmenero, Milagro Reig, and Fidel Toldrá

CONTENTS
13.1 Introduction: A Global Perspective on Functional Foods....................404
13.2 Options to Design Functional Meat and Meat Products......................405
13.3 Animal Production Strategies for Improving the Nutritional
Profiles of Raw Meat .................................................................................. 407
13.3.1 Genetics for the Reduction of Animal Fats ................................ 407
13.3.2 Dietary Feed Formulation for the Modification of Animal Fats... 408
13.3.2.1 Manipulation of Fatty Acids in Pigs ............................ 409
13.3.2.2 Manipulation of Fatty Acids in Ruminants ................ 412
13.3.3 Dietary Enrichment in Compounds of Specific Nutritional
Interest ............................................................................................. 413
13.3.3.1 Vitamins and Antioxidants ........................................... 413
13.3.3.2 Minerals ............................................................................ 415
13.4 Processing Strategies for Developing Functional Meat Products ....... 415
13.4.1 Reduction of Specific Unhealthy Compounds .......................... 417
13.4.1.1 Fat and Cholesterol ......................................................... 417
13.4.1.2 Sodium and Phosphate .................................................. 419
13.4.1.3 Nitrite ................................................................................ 419
13.4.1.4 Allergens .......................................................................... 419
13.4.2 Promoting the Presence of Specific Healthy Compounds ....... 420
13.4.2.1 Fat and Fatty Acid Profile .............................................. 420
13.4.2.2 Proteins, Peptides, and Amino Acids ..........................422
13.4.2.3 Prebiotics and Probiotics ................................................423
13.4.2.4 Antioxidants and Vitamins ...........................................425
13.4.2.5 Minerals ............................................................................ 427
13.4.2.6 Plant Sterols and Stanols ................................................ 427
13.4.2.7 Other Compounds .......................................................... 428
13.5 Safety and Scientific Criteria for Nutrition and Health Claims:
Legislative Implications ............................................................................ 428
13.6 Final Considerations.................................................................................. 429
Acknowledgments ..............................................................................................430
References.............................................................................................................430

403
404 Advanced Technologies for Meat Processing, Second Edition

13.1 Introduction: A Global Perspective on Functional Foods

The last few decades have seen rapid expansion of knowledge about the influ-
ence of diet on health and well-being. The concept of food in the developed
world is changing drastically from the classical idea whereby the purpose of
food was to supply the nutrients required for proper metabolism by consum-
ers and to satisfy their expectations; now, the emphasis is increasingly on the
beneficial and psychological effects of the diet. In this sense, an adequate diet
can not only help to achieve optimal health and development, but it can also
play an important role in reducing the risk of disease (Diplock et al., 1999).
The influence of certain foods on human health has long been known, but
the scientific basis for the role of certain physiologically active food com-
pounds in the modulation of specific bodily functions was only established
recently. Such knowledge has contributed to a concept of optimal nutrition
in developed countries and the development of functional foods within that
context. This new concept focuses on optimizing the quality of the daily diet.
This is achieved by controlling nutrient and nonnutrient contents, and also
other food properties that favor health maintenance (Ashwell, 2002).
There is no clear universally accepted definition of functional foods. How-
ever, several organizations have attempted to define this emerging food cat-
egory. Japan was the first country to introduce specific regulatory approval,
in 1991. Foods for specified health use (FOSHU) were defined as “foods
which, based on knowledge concerning the relationship between foods or
food components and health, are expected to have certain health benefits
and have been licensed to bear labeling claiming that a person using them
may expect to obtain that health through the consumption of these foods”
(Arihara, 2004). The American Dietetic Association considers functional
foods, including whole foods and fortified, enriched, or enhanced foods, as
those having a potential benefit for health when consumed as part of a var-
ied diet on a regular basis, at effective levels (Hasler et al., 2004). A European
Commission Concerted Action coordinated by the International Life Science
Institute (ILSI Europe) produced a consensus document concerning Scien-
tific Concepts of Functional Foods in Europe and proposed the following
definition: “A food can be regarded as a functional food if it is satisfacto-
rily demonstrated to affect beneficially one or more target functions in the
body, beyond adequate nutritional effects, in a way that is relevant to an
improved health status and well-being and/or reduction of risk of disease.
Functional foods must remain as foods and must demonstrate their effects
in amounts that can normally be expected to be consumed in the diet: they
are not pills or capsules, but part of a normal food pattern” (Diplock et al.,
1999). A functional food may be a natural food or one that can be made func-
tional by means of different technological approaches. This refers to new
foods specifically designed for health enhancement, but it also includes tra-
ditional, family foods where recent research has highlighted health benefits,
New Approaches for the Development of Functional Meat Products 405

previously unknown, or dispelled old dogma about potential adverse health

effects (Hasler, 2000).
Functional food effects are based on the way in which specific nutrients
and food components positively affect target functions in the organism.
The substantiation of these effects should be based on the knowledge of the
mechanisms by which functional foods can modulate the target function and
their relevance to the state of well-being and health and/or reduction of a dis-
ease. Although the substantiation should be based on a systematic review of
all available relevant evidences, in general, experimental human trial is the
most useful experimental study (Diplock et al., 1999; Ashwell, 2002).

13.2 Options to Design Functional Meat and Meat Products

A food can be made functional by using appropriate technologies to optimize
beneficial properties. Depending on the origin and targeted modification,
within the field of meat these include the following approaches (Roberfroid,
2000; Ashwell, 2002; Holm, 2003): (1) to raise the concentration of the benefi-
cial natural compound (either nutrient or nonnutrient) in the food up to the
desired effective level, where such enhancement can be naturally induced
(e.g., by increasing specific compounds like n-3 fatty acids or conjugated lin-
oleic acid [CLA] in raw meat by animal production practices) or produced by
reformulation (e.g., calcium-fortified meat products); (2) to add a compound
that is not normally present in the food but has proven benefits (e.g., a pre-
biotic in meat products); (3) to replace a compound, usually a macronutrient
(e.g., a fat) whose intake is usually excessive and hence harmful to health, by
a compound with demonstrated health benefits; (4) to remove specific com-
pounds so as to reduce adverse health effects, where these compounds may
be naturally present or produced by processing (e.g., the reduction of satu-
rated fatty acids [SFAs], trans-fatty acids (TFAs), a toxic compound, or a food
allergen); (5) to improve the bioavailability (e.g., improved iron absorption)
or stability of a compound that is known to produce a functional effect or to
reduce the potential disease risk of the food; and (6) any combination of the
preceding possibilities.
These different approaches to the production of meat-based functional
foods entail the use of a wide range of common bioactive components, both
phytochemicals and zoochemicals (see Table 13.1). The more promising target
functions for these foods concern: (1) growth, development, and differentia-
tion; (2) substrate metabolism; (3) defense against reactive oxidative species;
(4) cardiovascular system; (5) intestinal physiology; and (6) behavioral and
psychological functions (Diplock et al., 1999).
Meat and meat products are generally recognized as being contributors
to nutrition because they constitute an important source of high biological
406 Advanced Technologies for Meat Processing, Second Edition

TABLE 13.1
Examples of Major Classes of Bioactive Food Components
Bioactive Component Examples

Lipids and fatty acids n-3 polyunsaturated fatty acids (eicosapentaenoic and
docosahexaenoic acids), monounsaturated fatty acids,
conjugated linoleic acid
Proteins and peptides Soy protein, bioactive peptides (inhibitors of the angiotensin
I-converting enzyme, antioxidants, carnitine, carnosine,
anserine, etc.)
Prebiotic Dietary fibers (oats, soy, citrus, etc.), oligosaccharides
Probiotic Lactic acid bacteria (Lactobacillus casei, Lactobacillus acidophilus,
etc.), Bifidobacteria
Vitamins Tocopherols, folic acid, ascorbic acid
Minerals Calcium, magnesium, selenium, zinc, iron
Phytochemicals Phytosterols (sterol and stanol esters), carotenoids (β-carotene,
lycopene, zeaxanthin, lutein, etc.), flavonoids (flavones,
flavonones, catechins, etc.), phytoestrogens (isoflavones), etc.

value proteins, group B vitamins, minerals, trace elements, and other bio-
active compounds including strategies to get them enriched in such com-
pounds in order to get enhanced bioactivity (Toldrá and Reig, 2011). On the
other hand, they also contribute to the intake of fat, SFAs, cholesterol, salt,
and other substances that in inappropriate amounts may result in nega-
tive physiological effects. For many years now, the image of meat and meat
products has tended to deteriorate because they are viewed as a serious risk
factor (through various of their different constituents) involved in some of
the most prevalent diseases of western society, such as cardiovascular dis-
ease (CVD), hypertension, obesity/diabetes, and certain types of cancer.
The meat industry must adapt to the new concepts in nutrition. There is
now a potential market for functional foods, based on the principle of added
value linked to health benefits (Diplock et al., 1999), which is one of the main
trends in the development of food (meat) products (Sloan, 2000). The scien-
tific research process must be clearly integrated with insights into consumer
needs and demands (Weststrate et al., 2002). Functional meats constitute an
excellent opportunity to improve their “image” and help facilitate the imple-
mentation of strategies (in different areas such as family, health, education,
etc.) for updating the recommendations relating to nutrient and dietary goals
(WHO, 2003). It is an essential task for the meat sector to promote the pro-
duction of foods for a healthy and balanced diet. At the same time, leaving
aside their current relative importance, this type of food could also furnish
a means to achieve more diversification in the sector and to take up a solid
position in emerging markets with considerable promise for the future. As a
result, more and more work is being done on food processing and technol-
ogy for the production of functional foods (Jimenez-Colmenero, 2007a).
New Approaches for the Development of Functional Meat Products 407

From farm to table, different strategies can be effectively used to increase

or reduce bioactive compounds in meat and meat products and thus pro-
duce functional meat products. These strategies basically address such lev-
els as animal production practices, meat processing, and cooking systems
(Jimenez-Colmenero, 2007a). This chapter provides an overview of these
strategies, focusing on certain aspects of interest for the development of
functional meat products. It also discusses the potential benefits of meat
components for human health, modifications in bioactive compounds, and
their health implications.

13.3 Animal Production Strategies for Improving

the Nutritional Profiles of Raw Meat
13.3.1 Genetics for the Reduction of Animal Fats
The genetic type plays an important role in nutritional quality. Many
breeding strategies in recent years have focused mainly on increasing lean
meat content and reducing intramuscular fat content and back fat thick-
ness. Sometimes, the meat is poorer in quality even though grading traits
are better (Hovenier et al., 1992). Some studies with cattle breeds have been
directed toward more tender meat (Johnson et al., 1990; Wheeler et al.,
1990). There are several strategies for increasing the ratio of lean to fat in
farm animals. Some are based on the repartitioning effects of somatotro-
pin, specific β-adrenergic agonists, some growth promoting agents, and
gene manipulation techniques (Solomon et al., 2002). Other strategies for
increasing the lean to fat ratio are based on different breeding schemes, but
most entail a backcross or a three- or four-way cross. A three-way cross is
quite usual for pigs in the European Union (EU), using a Landrace × Large
White (LR × LW) crossbreed as sow. The terminal sire is chosen from a
wide range of possibilities like Duroc, Pietrain, Belgian Landrace, Land-
race, etc. The choice is very important as it affects not only production and
quality but also the nutritional profile, given that the intramuscular fat
content may reach anywhere between 1.2 and 2.9/100 g of meat (Leclerq,
1990). Thus, when Duroc is used, the result is an excess of fat and hence
an excess of calories. Belgian Landrace and Pietrain, on the other hand,
are heavily muscled and consequently have a lower fat content (Toldrá et
al., 1996a; Toldrá, 2002). We would note that leaner carcasses are gener-
ally associated with a more glycolytic muscle fiber type and hence more
rapid postmortem metabolism, paler meat color, and lower water holding
capacity (De Smet et al., 2002). Moreover, some changes in lipids have been
reported depending on the sire genetic type (Armero et al., 2002). Enzyme
fingerprinting, in the form of reports on the activity of endo- and exopro-
teases, lipases, and esterases, constitutes a useful tool for understanding
408 Advanced Technologies for Meat Processing, Second Edition

the biochemical activity of a given meat and for predicting its sensory and
nutritional quality and behavior (expected proteolysis and lipolysis) dur-
ing processing (Armero et al., 1999a).
The age of the animal correlates directly with increased intramuscular
fat content (higher calorie intake) and connective tissue (tougher meat and
poorer biological value), even though the meat may have stronger flavor
and color due to greater generation of volatile compounds and myoglobin,
respectively (Armero et al., 1999b). This is a consequence of the action of
muscle proteolytic and lipolytic enzymes, which are affected by age. Thus,
muscles from heavy pigs have been reported to exhibit a higher peptidase to
proteinase ratio and higher lipase activity than muscles from younger pigs
(Toldrá et al., 1996b; Rosell and Toldrá, 1998).
Sex mainly affects the fat content. Thus, meat from barrows has more fat,
more marbling, and a thicker subcutaneous fat layer than meat from gilts
(Armero et al., 1999a). For example, a fat thickness of 15.4 mm has been
reported for barrows and 9.0 mm for boars at 90 kg live weight (Wood et al.,
1985). The elimination of castration would help reduce fat content in boars to
close to that of gilts (Bass et al., 1990).

13.3.2 Dietary Feed Formulation for the Modification of Animal Fats

There has been a good deal of research since the 1980s on altering the fatty
acid composition of meat to attain the levels recommended by nutritionists.
Initially, the target was to increase the ratio between polyunsaturated and
SFAs (PUFA:SFA ratio) to above 0.4. A few years later, nutritionists also rec-
ommended manipulating PUFA composition in the direction of a lower
n-6:n-3 ratio so as to reduce the adverse effect of arachidonic acid and its
eicosanoid products (Simopoulos et al., 2000). This n-6:n-3 ratio constitutes a
risk factor in coronary heart diseases and cancers (Enser et al., 2000), so that
a n-6:n-3 ratio below 4 is highly recommended (Wood et al., 2003). Meats
evidently far exceed these target values, but there are ways to improve them
based on the type of feed, as described below. It should be mentioned that
manipulation of fats to attain a higher PUFA content may cause indirect
problems during processing, such as softer fats (due to its lower melting
point). Other major problems such as oxidation and generation of off-fla-
vors (rancid aromas) and color deterioration (trend toward yellowness in
the fat) are also likely to arise unless antioxidants are added (Toldrá and
Flores, 2004).
The amount of feed also influences the fat content in meat. Thus, an excess
of feed may increase the amount of intramuscular fat, but if animals are
deprived of feed, lipolysis may be induced and the amount of fat reduced,
especially in glycolytic muscles (Fernández et al., 1995). The amount of cho-
lesterol accretion in tissues of growing pigs is not generally influenced by
their serum cholesterol content or by the fat and cholesterol content in the
diet (Harris et al., 1993).
New Approaches for the Development of Functional Meat Products 409

13.3.2.1 Manipulation of Fatty Acids in Pigs

Pigs are monogastric animals that incorporate part of their dietary fatty acid
intake practically unchanged into the adipose tissue and cellular membranes,
where desaturation and chain elongation processes may take place (Toldrá
et al., 1996a; Jakobsen, 1999). The extent of incorporation may vary depend-
ing on the specific fatty acid, the time of feeding, and the type of feed.
Maximal effect with essential fatty acids has been reported within 40 days,
while only half of the effect was achieved in 14 days (Warnants et al., 1999;
Wood et al., 2003).
A large variety of dietary oils and their respective effects on the propor-
tions of fatty acid composition have been studied. When feeds are rich in
saturated fats like tallow, the levels of palmitic, palmitoleic, stearic, and
oleic acids in pork meat are substantially higher and the PUFA:SFA ratio
is lower (Morgan et al., 1992). However, the primordial objective of most
of the assayed oils was to raise the PUFA content and hence the PUFA:SFA
ratio. Thus, dietary oils rich in linoleic acid (C 18:2), a n-6 fatty acid typi-
cally present in soy, maize, sunflower, and barley, significantly increase
the concentration of this fatty acid in meat (see Table 13.2). When these
oils are used in feeds, the oleic acid content is partly replaced by linoleic
acid (Hernández et al., 1998). There is a serious potential problem derived
from rapid oxidation during heating, caused by the generation of volatile
compounds, like some aldehydes, which produce rancid aromas (Larick
et al., 1992). Even more serious is an increase in the n-6:n-3 ratio, commonly
observed when feeds contain oils of this type, to well above the nutritional
recommendations.
Some strategies have focused on n-3 fatty acids in the dietary supply,
as these compounds have been shown to protect against some cancers,
reduce CVDs, improve rheumatoid arthritis, and reduce inflammatory
bowel diseases (Hoz et al., 2003). Dietary oils rich in linolenic acid (C 18:3),
a n-3 fatty acid typically present in canola and linseed oils, have been
tested recently. These feeds increase the linolenic acid content, and slightly
increase the eicosapentaenoic (EPA, C 22:5) and docosahexaenoic (DHA, C
22:6) acid contents, in pork meat, also decreasing the linoleic acid content.
In this way, they raise the PUFA:SFA ratio to 0.4, close to the minimum
recommended value for the human diet, and reduce the n-6:n-3 ratio to 5,
close to the recommended maximum of 4 (Enser et al., 2000). On the other
hand, no significant effects on oxidative stability or sensory characteris-
tics have been reported (Sheard et al., 2000). Other authors, feeding either
linseed oil alone or a mixture of linseed and olive oils (see Table 13.3),
have reported even higher PUFA:SFA ratios, around 0.6–0.7, and lower
n-6:n-3 ratios, close to 2.0 (Hoz et al., 2003), although stability against oxi-
dation was lower. Large differences in linoleic and linolenic acid contents
between the leanest and fattest animals are common (Enser et al., 1998).
A recent work studied the performance and meat quality of grower-finisher
410 Advanced Technologies for Meat Processing, Second Edition

TABLE 13.2
Examples of the Effect of Type of Feed on Fatty Acid Composition (Expressed as %
of Total Fatty Acids) of Pork Meat Lipids
Feed Enriched in:

Barley + Barley + 6%
Soya Bean Safflower Wheat + Canola Fish
Fatty Acid Meala Oilb Tallow Diet c Maized Oile Oilf
C 14:0 – – 1.37 1.55 1.6 1.93
C 16:0 23.86 27.82 24.15 25.10 20.6 26.89
C 18:0 10.16 12.53 11.73 12.62 9.8 16.30
C 16:1 3.0 3.56 3.63 2.79 3.6 2.56
C 18:1 39.06 37.81 46.22 36.47 45.9 37.31
C 20:1 – 0.01 0.29 0.47 – –
C 18:2 17.15 14.60 8.95 16.49 12.3 7.78
C 20:2 – 0.01 0.44 0.49 0.4 0.59
C 18:3 0.91 0.01 0.26 1.14 3.0 2.08
C 20:3 0.21 0.01 0.25 0.30 0.1 0.08
C 20:4 4.26 2.14 2.13 0.25 0.74 0.46
C 22:5 0.64 0.01 – – – 0.91
C 22:6 0.75 0.01 – – – 1.13
Total SFA 34.02 40.35 37.83 39.42 33.6 45.12
Total MUFA 42.06 42.38 50.26 39.74 49.5 39.87
Total PUFA 23.92 16.79 11.91 20.84 16.6 13.03
PUFA:SFA ratio 0.70 0.42 0.32 0.53 0.49 0.29
n-6:n-3 ratio 9.4 559 45.3 16.6 4.5 2.2
a Morgan et al. (1992).
b Larick et al. (1992).
c Leszczynski et al. (1992).

d Toldrá et al. (2004).

e Miller et al. (1990).

f Irie and Sakimoto (1992).

SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid.

pigs when received a feed containing 0.4% of the basal diet as a herb com-
bination (pomegranate, Ginkgo biloba, licorice) either in a natural or fer-
mented form (Ahmed et al., 2016). The feed intake was reduced in both
cases as well as the back fat thickness of pigs. The lean production and the
content of n-3 fatty acids in the longissimus muscle were increased with
a reduced ratio of n-6/n-3 while the cholesterol was lower in the natural
herb combination group (Ahmed et al., 2016). Other strategies are based
on the use of feeds enriched with n-3 fatty acids like EPA and DHA, by
the addition of fish oils or algae (Jakobsen, 1999). Feeding 4%–6% fish
oil to pigs for two to four weeks before slaughter produced a substantial
increase in EPA and DHA (see Table 13.3) and reduced the n-6:n-3 ratio
to 2.2 (Irie and Sakimoto, 1992). However, feeding with 6% unrefined fish
New Approaches for the Development of Functional Meat Products 411

TABLE 13.3
Examples of the Effect of Type of Feed on Fatty Acid Composition (Expressed as %
of Total Fatty Acids) of Beef Meat Lipids
Feed Enriched in Beef
Maize- Soybean Meal
Based + Corn + 33% Soybean Canola
Fatty Acid Concentratea Pastureb Pasturec Peanut Caked Oila Meale

C 14:0 2.9 2.9 1.6 2.9 3.3 2.8

C 15:0 1.3 – – 0.3 1.5 0.5
C 16:0 26.7 23.9 21.6 25.4 26.0 24.8
C 17:0 1.6 – – 0.8 1.6 1.0
C 18:0 9.7 19.4 17.7 18.2 11.0 11.4
C 14:1 – 0.4 0.2 0.1 – –
C 16:1 4.9 2.4 2.5 1.8 3.9 4.8
C 18:1 40.0 35.4 31.5 38.9 33.4 44.8
C 18:2 6.0 1.8 3.3 3.7 7.4 5.7
C 18:3 0.5 0.6 1.3 0.4 0.6 0.5
C 20:3 2.4 – – 0.9 2.1 –
CLA 0.23 1.3 0.53 3.8 0.3 –
C 20:4 – – – – – 1.5
Total SFA 42.2 48.1 49.1 50.3 42.4 40.5
Total MUFA 44.9 38.2 41.0 43.9 37.3 50.5
Total PUFA 9.1 4.3 10.0 5.9 10.4 7.7
PUFA:SFA 0.22 0.09 0.20 0.12 0.24 0.19
ratio
n-6:n-3 ratio 16.8 3.0 1.4 1.7 15.8 11.4
a Dhiman et al. (2005).
b Realini et al. (2004a).
c Realini et al. (2004b).
d Correia et al. (2016).
e Rule et al. (1994).

oil up to 60 kg live weight caused off-flavor (Lauridsen et al., 1999). These

fatty acids with large numbers of double bonds are evidently prone to oxi-
dation, so that feeds of this type require addition of antioxidants like vita-
min E to prevent any oxidation and rancidity development. The amount
depends, for instance, enrichment with 250 g per pig for 22–42 days was
reported to have no adverse effects on sensory attributes (Marriott et al.,
2002). Dietary CLA has been reported to enrich the CLA isomer content to
around 0.35/100 g total fatty acids, and to reduce the intramuscular cho-
lesterol (Lauridsen et al., 2005).
Poultry meat has an n-6:n-3 ratio similar to pork, and for similar reasons:
basically, the use of feeds rich in linoleic acid (grain, maize, plant seeds,
oils). Higher concentrations of n-3 fatty acids may be attained by feeding
412 Advanced Technologies for Meat Processing, Second Edition

canola oil, flax seed, fish oil, or algae. For instance, a feed with 20% white
fish meal may enrich the n-3 fatty acid content from 3% (on a basal diet)
up to 10.4% and reduce the n-6:n-3 ratio from 8.4 to 1.7 (Jakobsen, 1999).

13.3.2.2 Manipulation of Fatty Acids in Ruminants

Fatty acid profiles are more saturated in ruminants than in pigs and the fat is
firmer (Wood et al., 2003). The manipulation of fatty acids through the type
of feed is more difficult because the rumen is biohydrogenated, producing
mainly stearic acid as the final product. It is therefore difficult to increase the
PUFA:SFA ratio since more than 90% of the PUFAs are hydrogenated unless
they are protected against hydrogenation in the forestomach. Dietary lin-
oleic and linolenic acids may be partially hydrogenated, forming oleic acid
and trans-, odd chain, branched-chain, and conjugated fatty acids (Jakobsen,
1999). Meats from ruminants are rich in CLA, mainly cis-9, trans-11 octadeca-
dienoic acid, which has been reported to exert important health-promoting
biological activity (Belury, 2002). CLA has exhibited anticarcinogenic, anti-
oxidative, and antidiabetic effects in animal models. In any case, feeding
strategies were recommended to be adapted to the priority target of each
farm. This means that goals may be quite different: achieve good carcass
performance, or reduce fat in the carcass or even get rumen health (Bello
et al., 2016).
Some researchers have attempted to manipulate fatty acids in ruminants
and, especially in recent years, to enrich beef with CLA. Some examples of
final composition in fatty acids in intramuscular lipids of beef and lamb are
shown in Tables 13.3 and 13.4, respectively. Dietary full canola altered the
fatty acid composition in beef meat, especially by decreasing palmitic acid
and increasing stearic and oleic acids (Rule et al., 1994). Comparison of a
maize-based concentrated feed with soybean oil revealed that even though
the linolenic content twice as high in soybean oil as in the other feed, the
final content in the beef was almost identical (Dhiman et al., 2005). Feeding
with high-starch (25%) diets improved the nutritional value of beef because
the SFAs were decreased and the unsaturated fatty acids increased (Rossi
et al., 2016). The inclusion of 25% soybean in the diets increased the amount
of PUFA in the meat (Rossi et al., 2016). Feeding with soybean oil increased
the trans-10, cis-12 CLAs in the adipose tissue but did not increase the cis-9,
trans-11 CLA isomer that was the target (Dhiman et al., 2005). An increase in
this last CLA isomer was achieved by feeding with sunflower oil, although
this also raised the n-6:n-3 ratio (Noci et al., 2005).
Lambs on pasture usually present more n-3 fatty acids than when they
are fed concentrates (Jakobsen, 1999). When lambs are fed with linseed, the
amount of n-3 fatty acids increases; similar findings with EPA and DHA
have been reported in lambs fed a mixture of fish oil and marine algae
(Elmore et al., 2005). However, the results are better when lambs are fed with
protected lipid supplements. Then, the amount of n-6 and n-3 fatty acids
New Approaches for the Development of Functional Meat Products 413

TABLE 13.4
Examples of the Effect of Type of Feed on Fatty Acid Composition (Expressed as %
of Total Fatty Acids) of Lamb Meat Lipids
Feed Enriched in Lamb
Barley, Maize,
Wheat and Soybean Concentrate + Concentrate +
Fatty Acid Meala Forageb Corn + Soybeanc

C 14:0 2.2 3.7 1.5

C 15:0 – – –
C 16:0 21.1 23.2 2.3
C 17:0 1.3 – 0.9
C 18:0 11.6 16.3 17.4
C 14:1 – – –
C 16:1 2.1 2.3 1.5
C 18:1 38.7 40.4 40.9
C 18:2 10.2 7.5 3.3
C 18:3 0.56 1.0 0.5
C 20:3 – – –
CLA – – 0.4
C 20:4 – 2.1 2.4
Total SFA 42.7 43.2 46.1
Total MUFA 46.0 42.7 46.8
Total PUFA 4.8 10.6 7.1
PUFA:SFA ratio 0.11 3.31 0.15
n-6:n-3 ratio 18.1 9.32 12.2
a Castro et al. (2005).
b Salvatori et al. (2005).
c Pereira et al. (2016).

increases substantially (see Table 13.2) due to the effectiveness of the pro-
tection system (Elmore et al., 2005). On the other hand, feeding with palm
oil supplements enriches the meat lipids with SFAs, especially palmitic acid
(Castro et al., 2005). It has been reported that the fatty acid composition is
somehow affected by genotype (Salvatori et al., 2004).

13.3.3 Dietary Enrichment in Compounds of

Specific Nutritional Interest
13.3.3.1 Vitamins and Antioxidants
Meat contains considerable amounts of water-soluble vitamins like B vita-
mins. However, its content in vitamins A, D, C, and E is rather poor (Reig
and Toldrá, 1998a). The deposition of vitamin E in pig and poultry muscles
414 Advanced Technologies for Meat Processing, Second Edition

is dependent on its concentration and time of supplementation (Mercier

et al., 1998). Usual levels are around 100–200 mg/kg in the feed for several
weeks prior to slaughter. For instance, vitamin E content of 12.9 mg/kg dry
matter may be reached after feeding 200 mg of α-tocopheryl acetate per kg
diet in pigs between 60 and 93 kg live weight (Isabel et al., 2003). The distri-
bution of vitamin E in the organism is variable; it is higher in the muscles
of the thoracic limb, neck, and thorax and lower in the muscles of the pelvic
limb and back (O’Sullivan et al., 1997). Dietary supplementation with this
lipid-soluble antioxidant improves the oxidative stability of the meat (Buck-
ley et al., 1995), which is important because phospholipids are located in
subcellular membranes such as mitochondria, microsomes, etc. Their PUFA
content is relatively high and this makes them susceptible to peroxidation
due to the proximity of prooxidants like myoglobin, cytochromes, nonheme
iron, and trace elements (Buckley et al., 1995). Although meat contains sev-
eral natural antioxidant enzymes like the superoxide dismutase and gluta-
thione peroxidase, their activity is weakened during postmortem storage.
Several antioxidants have therefore been assayed as an effective alternative
for protection against oxidation. Vitamin E (α-tocopheryl acetate), which
was studied in depth in the 1990s, is a very effective antioxidant because it
is accumulated in tissues and subcellular structures, including membranes.
It is commonly added to the feed today. There are other endogenous antioxi-
dants like the histidine-containing dipeptides carnosine and anserine, but
contents vary according to anatomical location and species. These dipep-
tides are therefore more abundant in light muscles than in dark muscles
(Aristoy and Toldrá, 1998). Carnosine content is higher in beef and pork and
anserine content is higher in poultry (Reig and Toldrá, 1998b; Toldrá and
Reig, 2004).
The use of essential oils as feed additives for livestock production has
been reported to increase feed efficiency and animal productivity due to
their antimicrobial, antiinflammatory, and antioxidant effects (Bakkali
et al., 2008, Benchaar et al., 2006, 2008; Jayasena and Jo, 2013). The antimi-
crobial activity of essential oils added to livestock feed can contribute to a
decreased ruminal biohydrogenation that consequently results in a higher
deposition of PUFA in meat (Martineau et al., 2008). Antioxidant activity
is widely observed in spices and herbs, for example, oregano, rosemary,
thyme, cinnamon, pepper, nutmeg, licorice, aniseed, cassia bark, fennel,
prickly ash, round cardamom, basil, garlic, coriander, and ginger. Such
antioxidant activity is attributed to various phenolic compounds, structur-
ally related but different in quantity and type, depending on the respective
source (Morán et al., 2012, 2013; Jiang and Xiong, 2016). The addition of 3.5
g/animal/day of an essential oil blend (oregano, garlic, lemon, rosemary,
thyme, eucalyptus, and sweet orange) was reported to reduce lipid oxida-
tion in bulls even though higher doses had a prooxidant effect (Rivaroli
et al., 2016). Such an essential oil blend did not influence the chemical com-
position nor the fatty acid profile.
New Approaches for the Development of Functional Meat Products 415

13.3.3.2 Minerals
Meat constitutes a rich source of iron, and also of trace elements like sele-
nium, magnesium, and zinc. Red meats, i.e., beef and lamb, contain higher
levels of iron than pork and poultry. The iron present is part of the heme mol-
ecule, an essential component of myoglobin in the muscle, which is highly
bioavailable for humans. Iron content is higher in oxidative than in glycolytic
muscles. Iron, phosphorus, copper, and zinc contents are little affected by
dietary levels; however, the levels of selenium in meat are highly dependent
on dietary intakes (Lynch and Kerry, 2000).
Different magnesium salts, such as magnesium aspartate, magnesium
aspartate hydrochloride, and magnesium fumarate, have been used as dietary
supplements to improve pork meat quality, but cheaper sources like magne-
sium sulfate and magnesium chloride can also be effective. Magnesium acts
as a cofactor for several metabolic and enzymatic pathways; for instance, it
reduces skeletal muscle activity by antagonizing calcium (D’Souza et al., 1999).
Selenium is needed in certain metabolic processes like the defense against
free radicals and their detoxification (Lener et al., 2012) and contributes to
better health status (Fairweather-Tait et al., 2011). Selenium can also regulate
adipogenesis and lipolysis in the organism (Wang et al., 2016). Supplementa-
tion with sodium selenite or selenium-rich yeast makes for a high selenium
content in meat. In fact, dietary selenium supplementation has been reported
to delay postmortem oxidation reactions, especially due to its antioxidant are
more effective when supplied in the organic form (Mahan et al., 2014) as the
selenium reaches tissues more efficiently (Jang et al., 2010). Organic selenium,
in the form of selenium-enriched yeast, is taken up via methionine transporter
mechanisms and located either into selenoenzymes or in place of methionine
in muscle proteins (Suzuki and Ogra, 2002). The water holding capacity was
improved with organic selenium because the lowest water losses in pork meat
were observed when feeding with selenium-rich yeast in comparison to other
inorganic sources of selenium like sodium selenite or selenium and vitamin
E (Calvo et al., 2016a,b). Further, the inclusion of 0.4 ppm of organic selenium
in pig diets improved the lipid stability against oxidation (Calvo et al., 2017).
It was also reported that supplementation with selenium-enriched yeast
in sheep is more efficient compared to inorganic selenium supplementation
(Stewart et al., 2012).

13.4 Processing Strategies for Developing

Functional Meat Products
Meat technology plays a number of major roles in the development of func-
tional meat products. As well as animal production strategies, processing
strategies can be used to alter the composition of meat products. For the
416 Advanced Technologies for Meat Processing, Second Edition

production of functional meat products (as with others functional foods),

there are a number of different technological approaches that can be adopted
to remove, reduce, increase, add, and/or replace different components with
physiological activity (functional or bioactive components), any of which
may help achieve an improved state of health and well-being and/or reduce
the risk of disease (Roberfroid, 2000; Ashwell, 2002; Jimenez-Colmenero,
2007a). The presence, absence, or reduced content of substances known to
have physiological effects are cited in the EU proposal for the purposes of
health claims (EU Commission, 2003).
The beneficial effects of functional foods derive from bioactive compo-
nents (phytochemicals and zoochemicals) which may have specific posi-
tive and negative implications for health. In some cases, these substances
may occur naturally in the product (in meat raw materials, or ingredients
or additives used in their preparation), while in others they may be formed
or their presence may be modified in the course of processing, storage, or
cooking.
It is essential to know the role and source of healthy and unhealthy com-
pounds in order to be able to identify, design, and more effectively imple-
ment procedures for the development of functional meat products. There are
basically two kinds of procedure with regard to the composition of func-
tional meat products (Jimenez-Colmenero et al., 2001) aimed at:

• Reducing the concentration or limiting the formation of unhealthy

compounds
• Promoting the presence of healthy compounds

Several basic approaches can be adopted to successfully induce such

effects (Jimenez-Colmenero, 2007a). These focus on aspects relating to: selec-
tion and preparation (postslaughter) of meat ingredients in order to secure
raw materials with suitable composition (mainly in terms of lipidic compo-
nents: fat proportion, fatty acid profile, and cholesterol content); reformula-
tion of products to induce certain changes in composition; and adaptation of
preparation, storage, and cooking technologies so as to limit the concentra-
tion and/or formation of unhealthy components.
The development of functional meat products poses some technological
challenges, chiefly as regards optimizing the formulation, processing, and
subsequent storage so as to promote the presence and activity of healthy
components and reduce or eliminate unhealthy substances (optimization of
functional food components) without this affecting the quality of meat prod-
ucts. The technological feasibility of achieving the desired composition with
optimum palatability depends very much on the product type, i.e., whether
it is composed of identifiable pieces of meat, coarsely or finely ground, emul-
sions, cooked, cured, etc. To help optimize the desired beneficial properties
there are a number of technologies (conventional and emerging) that prom-
ise friendly processing conditions.
New Approaches for the Development of Functional Meat Products 417

13.4.1 Reduction of Specific Unhealthy Compounds

Meat and meat derivatives, like any other food, may contain a number of
components (of highly diverse origins) which can have unhealthy implica-
tions if more than a given amount is ingested. Some of these compounds
may be naturally present in the meat or its derivatives as part of the various
raw materials used in their preparation. Examples include fat, SFAs, choles-
terol, salt, and others.
There are a number of steps in the processing and storage of meat prod-
ucts, and also in their preparation and consumption, which can modify the
concentration and bioavailability of some of their components. These may
equally cause the density of some nutrients to increase (e.g., due to cooking-
induced drying, etc.) or that of others to decrease (due to cooking). At the
same time, like other complex foods, during processing, storage, and cook-
ing, meat and meat products undergo major chemical changes which cause
the formation of a number of nonintrinsic components. Although some
are health-promoting components such as antioxidant and antimicrobial
agents or are probiotic during fermentation (Knorr, 1998), others may have
potentially harmful biological properties. This is true of substances such as
nitrosamines, polycyclic aromatic hydrocarbons, heterocyclic amines (HA),
biogenic amines, lipid oxidation products, or advanced glycoxidation end
products (Hotchkiss and Parker, 1990; Cassens, 1999; Goldberg et al., 2004;
Ruiz-Capillas and Jiménez Colmenero, 2004; Vitaglione and Fogliano, 2004).
Some of them present mutagenic, carcinogenic, and cytotoxic properties
related to the etiology of various forms of human cancer, CVD, arterioscle-
rosis, renal complications, Alzheimer’s disease, etc. The presence of these
nonintrinsic substances in meat products has prompted several mechanistic
hypotheses in which meat intake is associated with some health problem. It
has been suggested that these compounds may have more to do with the risk
of disease than the meat itself (Ulrich and Potter, 2004), although the rela-
tionship has yet to be demonstrated (Carbajal, 2004; Ulrich and Potter, 2004).
Meat products could potentially be made healthier by applying technology
strategies that do not lead to the formation (at least in excess of established
limits) of such unhealthy nonintrinsic substances. From a practical point of
view, any approach to promoting potential functional meat products must
involve reducing the concentration and/or formation of those compounds to
within acceptable limits. Following are a number of examples.

13.4.1.1 Fat and Cholesterol

Recent years have seen the development of numerous meat products with
lower fat content, which consumers perceive as healthier. As a result of recom-
mendations regarding quantitative and qualitative aspects of fat included in
population nutrient intake goals for preventing diet-related chronic diseases
(WHO, 2003), many consumers are currently limiting the amount of fat and
418 Advanced Technologies for Meat Processing, Second Edition

calories in their diet. These recommendations must therefore be a key consid-

eration when a new composition is designed for any product; this is particu-
larly true of meat products given their importance as a source of fat in the diet.
The proportion of calories in the diet contributed by the intake of fat is
around 36%–40%, almost a quarter of which derives from the consumption
of meat and meat products (Sheard et al., 1998; Chizzolini et al., 1999; Jiménez-
Colmenero et al., 2012).
While meat cannot be considered a high-energy food given the current
trends in meat production toward leaner animals (retail cuts frequently con-
tain less than 5%), there are various meat products to which the same does
not apply, containing fat levels over 30%. Where it is most desirable to reduce
fat is in frequently consumed products with higher fat levels, whose poor
image in terms of health benefits would really be improved thereby. Fat is
a major determinant of the sensory characteristics of a product, and hence
acceptable low-fat meat products cannot be effectively achieved simply by
reducing the fat in the formulation. There are generally two basic criteria
governing fat reduction technology: the use of leaner meat raw materials,
and the reduction of fat and energy density (dilution) through the addition
of water and other ingredients. However, as fat content falls and water con-
tent rises, increasing attention must be paid to water holding ability. In this
context, different protein-, carbohydrate-, or fat-based are used, classified as
“fat replacers,” “fat substitutes,” “fat analogs,” “fat mimetics,” “fat extend-
ers,” or “fat barrier compounds,” generally depending on their composition,
properties, and the functions that they perform in the meat matrix (Jiménez-
Colmenero et al., 2012). The feasibility to reduce fat in meat products depends
on a number of factors such as the desired fat level, the nature of the product
to be reformulated, and the kind of processing required (emulsifying, heat-
ing, curing, and others).
Cholesterol content can vary considerably in meat products. Under the
heading of processing strategies, there are two main approaches to choles-
terol reduction, one entailing alteration of the composition of meat prod-
ucts and another entailing direct removal of cholesterol by supercritical
carbon dioxide extraction (Clarke, 1997). A number of different meat prod-
ucts (ground beef, frankfurters, pork patties, restructured pork, structured
beef rolls, etc.) have been reformulated; their original composition has been
altered by reducing animal fat and/or partially replacing it with vegetable
oils (olive, maize, sunflower, soybean, etc.) and adding various plant-based
proteins (soy, maize, oat, wild rice, wheat gluten, etc.) or other fat replac-
ers (free cholesterol). This dilution method has made significant cholesterol
reduction (20%–50% less than conventional products) possible in meat prod-
ucts such as low-fat ground beef, pork sausages, frankfurters, and others
(Sandrou and Arvanitoyannis, 2000; Jiménez Colmenero, 2007a). Some meat
products are currently being marketed with claims relating to fat and cho-
lesterol contents. Further information on fat reduction in processed meats is
reported in Chapter 15.
New Approaches for the Development of Functional Meat Products 419

13.4.1.2 Sodium and Phosphate

Sodium intake generally exceeds nutritional recommendations in industrial-
ized countries (Antonios and MacGregor, 1997; WHO, 2003). Excessive intake
of sodium has been associated with high blood pressure, one of the major
risk factors for CVD (Antonios and MacGregor, 1997). Since approximately
20%–30% of common salt intake comes from meat products (Wirth, 1991),
there is increasing interest among consumers and processors in reducing the
use of salt (minimizing sodium) in meat processing.
Sodium reduction requires partial substitution of the sodium chloride
added to meat derivatives by other compounds that have similar effects on
sensory, technological, and microbiological properties. Different strategies
based on selection of meat raw material, modification of processing tech-
niques, use of salt substitutes and flavor enhancers and masking agents, and
optimization of the physical form of salt have been used in order to reduce
the salt addition in meat products (Desmond, 2006). A number of compounds
have been used to overcome property problems in low-salt products, includ-
ing problems associated with water- and fat-binding properties and texture.
These include chlorides, phosphates, lactates, alginate, transglutaminase,
and others (Collins, 1997; Monahan and Troy, 1997; Jimenez-Colmenero et al.,
2005). More extensive information on sodium reduction in meats and pro-
cessed meats can be found in Chapter 14. Since excessive dietary inorganic
phosphate may increase the risk of lung cancer (Jin et al., 2009) and bone
disease (Shahidi and Synowiecki, 1997), different meat products have been
reformulated without added phosphates.

13.4.1.3 Nitrite
It is suggested that dietary nitrites (from processed meats among other
foods) considered as human carcinogens because they may be converted in
the body to N-nitroso compounds that are known carcinogens (Demeyer
et al., 2008). In order to limit this unhealthy effect, various ingredients have
been used to reduce or even eliminate the added nitrites to ensure that these
additives perform their functions (color, antioxidant, antimicrobial, etc.) in
the end product while maintaining quality. In this regard, the utilization
of nonmeat ingredients that, by nature, have high nitrate content has been
proposed to avoid the direct addition of nitrite to meat products (Weiss et al.,
2010). On the other hand, different strategies have been suggested to inhibit
damage due to nitros(yl)ation reactions, including the use of dietary com-
ponents such as pre- and probiotics, resistant starch, vitamin C and E, etc.
(Demeyer et al., 2008). More extensive information on nitrite reduction in
meats can be found in Chapter 16.

13.4.1.4 Allergens
Some of the ingredients used in the preparation of meat products, like veg-
etable (i.e., soy), egg, or milk proteins, contain substances that cause allergic
420 Advanced Technologies for Meat Processing, Second Edition

reactions in some consumers. Such nonmeat ingredients must be excluded

to produce “allergen-free” meat products such as pork sausages, hamburger
steak, or meatballs, recently approved (FOSHU) in Japan (Arihara, 2004). Dif-
ferent meat products (turkey breast, sausages, ham, etc.) are marketed as glu-
ten free and lactose free.

13.4.2 Promoting the Presence of Specific Healthy Compounds

Some food components possess potential health-beneficial properties, and
efforts are therefore being made to promote increased dietary intake. A good
way to increase the dietary intake of a functional ingredient is to incorpo-
rate it in common foods, such as meat products, and meat processing offers
an excellent opportunity to do this. Although some biologically active com-
pounds occur naturally in meat, most are produced by plants. In meat pro-
cessing, it is possible to promote the presence of functional ingredients by
substituting, adding, or enhancing food components. Whereas replacing
basically targets lipidic material, adding or increasing embraces a large group
of bioactive substances, and this opens up major prospects. Such substances
have been used in the form of specific preparations and as constituents of
some nonmeat ingredients (extracts, meals, concentrates, homogenates, etc.)
used for various different purposes (technological, sensory, nutritional,
microbiological, and economical) in the meat industry. The fact is that many
of these ingredients (both common and otherwise) are of vegetable origin
(oats, soy, wheat, sunflower, rosemary, apple, mushroom, walnut, etc.) and
are composed of a variety of biologically active phytochemicals.

13.4.2.1 Fat and Fatty Acid Profile

The basic requirement for any major advance in the direction of diet opti-
mization and human health is that food fat (and meat products are some of
the most important sources of dietary fat) be brought down closer to rec-
ommended population nutrient dietary goals (WHO, 2003). By means of a
formulation approach, changes in lipid content and fatty acid profile can be
tailored to help prevent many human diseases. These changes involve reduc-
ing SFA levels, raising mono- and PUFA levels (n-3, CLA), improving n-6:n-3
PUFA balances, and limiting cholesterol contents. In meat products, such
modifications can be achieved by means of formulation and technological
processing, including raw material selection.
Healthier meat products can be made using meat raw materials with
improved composition (higher monounsaturated fatty acid [MUFA] or n-3
PUFA contents and lower n-6:n-3 PUFA ratio) achieved by animal production
practices (see Section 13.3). Frankfurters, low-fat sausages, dry fermented
sausages, and cooked ham or pork liver pate have been manufactured using
materials (back fat and meat) obtained from pigs fed diets enriched with saf-
flower, sunflower and canola, linseed or fish oils (St. John et al., 1986; Shack-
New Approaches for the Development of Functional Meat Products 421

elford et al., 1990; Hoz et al., 2004; Jeun-Horng et al., 2002; Santos et al., 2004;
D’Arrigo et al., 2004).
In order to achieve healthier meat products, part of the animal fat normally
present in the product can be replaced with another component more suited
to human needs (Jiménez Colmenero, 2005). Lipids from nonmeat sources,
for example, vegetable and fish oils, have been used for that purpose. Veg-
etable oils are of particular interest for meat product development because
they are free of cholesterol and high in unsaturated fatty acids. Various dif-
ferent vegetable oils (maize, cottonseed, palm, peanut, soybean, high-oleic
acid sunflower, olive, linseed) have been used to replace animal fats (pork
back fat or beef fat) in normal and low-fat meat products such as frankfurt-
ers (Marquez et al., 1989; Paneras et al., 1998; Lurueña-Martinez et al., 2004),
cooked sausages (Yilmaz et al., 2002), ground beef patties (Liu et al., 1991),
fermented sausages (Bloukas et al., 1997; Muguerza et al., 2002; Ansorena
and Astiasaran, 2004), and others. Other nonmeat ingredients such as wal-
nut have been used to achieve healthier fatty acid profiles in frankfurters
and restructured beef steaks (Jimenez-Colmenero et al., 2003; Serrano et al.,
2005). A mixture of crushed linseed and linseed oil has been used to produce
a range of basic Finnish meat products: sausage, meatballs, liver paste, etc.
(Ahola, 2001). Fish oils (n-3 polyunsaturated oil) have been used in low-fat
frankfurters (Park et al., 1989). Generally, the procedures used to incorporate
natural or processed plant and marine lipids into meat products range from
direct addition in the form of liquid oils and interesterified oils, to incorpora-
tion in encapsulated or emulsified forms (simple and multiple emulsions) or
as part of plant ingredients (Jimenez-Colmenero, 2007b). Novel approaches
of stabilizing and structuring liquid oils to create a plastic fat which retains
solid-like properties while possessing a healthier fatty acid profile has been
suggested recently as an animal fat alternative in order to improve the fat
content of meat products. These strategies include those based on the appli-
cation of interesterification and organogelation processes, the creation of
structured emulsions, and the formation of oil bulking agents (Jiménez-
Colmenero et al., 2015). A recent example is the use of structured canola oil
consisting of an organogel produced with ethylcellulose and sorbitan mono-
stearate to replace beef fat in frankfurters. The replacement of beef fat with
such organogel containing 8% ethylcellulose and 1.5% sorbitan monoestea-
rate was reported to give a hardness value similar to that of beef fat, by both
sensory and texture profile analysis (Barbut et al., 2016).
There is evidence of a positive association between levels of TFA intake
and the risk of CVD. Population nutrient intake goals recommend less than
1% of the total energy as TFA (WHO, 2003). Dietary surveys indicate that
intakes of TFA have decreased in a number of EU countries, mainly thanks
to reformulation of food products (EFSA, 2004). Although natural TFAs
found in ruminant meat fat appear to have a less unhealthy effect than other
processed food fats (Higgs, 2000), in any case TFAs of meat products have
been reduced by reformulation (adding oat bran or rye bran) (Yilmaz, 2004).
422 Advanced Technologies for Meat Processing, Second Edition

Fatty acid profiles of meat products have been improved by direct addition
of CLA to pork patties (Joo et al., 2000), beef patties (Chae et al., 2004; Hur
et al., 2004), or liver pâté (Martin et al., 2008). Although feeding rather than
processing conditions determine the CLA content in foods (Williams, 2000),
endogen or exogen CLA content in meat is not negatively altered by cook-
ing or storage; to the contrary, it is increased by heating (Mulvihill, 2001;
Arihara, 2004).
The varying effect of fats (depending in part on fatty acid composition)
on satiety signaling could be used to develop fat-containing foods (meat
products) that modulate satiety. Specific manipulations of fats (and also of
proteins and carbohydrates) have the potential to act as functional foods for
appetite control (Dye and Blundell, 2002). Modified-fatty-acid-profile and
trans-fat-free meat products are currently being marketed.

13.4.2.2 Proteins, Peptides, and Amino Acids

Meat products contain high levels of both meat protein and nonmeat pro-
tein from the numerous ingredients used in their manufacture. Essential
nutrients can be considered functional components if in addition to the req-
uisite nutritional effect they provide benefit to the human body (Arihara,
2004). Meat protein is an important factor in permitting antibody synthe-
sis, thus allowing for acquired immunity to disease (Romans et al., 1994).
A number of amino acids from meat have beneficial effects on the nervous
and immune systems. Peptides like carnosine and anserine, which are
found in muscle, are the most abundant antioxidants in meats. They have
been reported to play roles in wound healing, recovery from fatigue, and
prevention of stress-related diseases (Arihara, 2004). Recent research has
been disclosing the role of meat proteins as precursors of bioactive peptides.
These are fragments that are inactive within the precursor protein, but once
released during food processing or during digestion, they can carry out
various different health physiological functions in the organism (Toldrá
and Reig, 2011). More detailed information on bioactive peptides is given
in Chapter 13. l-Carnitine, which is naturally abundant in skeletal muscle,
especially in beef, helps the body to reduce cholesterol levels and absorb cal-
cium (Arihara, 2004). The l-carnitine content in processed meat is normally
rather low, but levels similar to those found in muscle have been achieved
by adding l-carnitine to such products. The first l-carnitine-enriched meat
products (wiener sausage and salami) were introduced in 2002 in Germany
(Anonymous, 2002).
Protein-based ingredients are among the principal nonmeat ingredients
used in the manufacture of meat products. Nonmeat proteins have been used
in meat products for technological purposes and to reduce costs. They have
also been used to provide nutritional benefits by lowering the caloric and
cholesterol contents (when used as fat replacers) and by increasing the pro-
tein level and balancing the amino acid profile (Jiménez Colmenero, 2004).
New Approaches for the Development of Functional Meat Products 423

Some also contain health-enhancing components which make for healthier

processed meats. The range of applicable nonmeat proteins from animal and
plant sources is very large.
Plant proteins from soy, sunflower, wheat, and maize derivatives, and
flours from cottonseed and oats have been utilized in the meat industry
as fat replacers among other purposes (Keeton, 1994). Soy proteins are a
good example of such proteins with health-enhancing activity; they are
thought to exert a preventive and therapeutic effect in CVDs, cancer, and
osteoporosis, and in the relief of menopausal symptoms (Hasler, 1998). In
the United States, the Food and Drug Administration (FDA) has approved
health claims on soy protein (containing isoflavons) in connection with a
reduced risk of coronary heart disease (Holm, 2003). Low-fat sausage prod-
ucts containing soy proteins (as functional ingredients) have recently been
approved in Japan, with the claim that an acceptable blood cholesterol level
can be maintained by consumption of this product (Arihara, 2004). Some
proteins from vegetal sources (sunflower, walnut, etc.) contain high pro-
portions of arginine and have low lysine/arginine ratios, both characteris-
tics that have beneficial effects for heart failure, blood pressure, and stroke
(Feldman, 2002). Lysine/arginine ratios of restructured beef steak proteins
have been reported to decrease with the addition of 20% walnut (Serrano
et al., 2005).
Nonmeat proteins from animal sources have also been used in meat
products. Whey protein products are used in a variety of processed meats
(ground meats, emulsion products, coarse ground products, whole muscle
products) to improve flavor, texture, emulsification, water binding, and cook
yield. Whey protein contains bioactive components that help the release of
two appetite-suppressing hormones and may have positive effects on cardio-
vascular health (Ohr, 2004).

13.4.2.3 Prebiotics and Probiotics

One of the most promising areas for the development of functional foods
lies in the use of prebiotics and probiotics. A prebiotic is a “nondigestible
food ingredient that beneficially affects the host by selectively stimulating
the growth and/or activity of one or a limited number of bacteria in the
colon and thus improves the health of the host” (Arihara, 2004). Prebiotics
utilized in a number of meat products include dietary fibers and oligosac-
charides.
Dietary fibers have frequently been claimed to influence a number of ben-
eficial health characteristics, for instance by increasing fecal volume, limit-
ing caloric intake, to favor regulation of blood glucose levels, and to prevent
CVDs , colon cancer, and constipation by regulating intestinal transit (Holm,
2003). Consumption of either insoluble or soluble fiber results in distinct
physiological effects. Aside from its potential physiological effects, addition
of fiber to meat products has been widely practiced because of its role as a
424 Advanced Technologies for Meat Processing, Second Edition

technological coadjuvant: its presence can improve water binding properties,

texture, or emulsion stability of meat products and can help overcome the
effects produced by changes of composition (e.g., due to fat reduction) on
meat product characteristics. Dietary fiber from oats, sugar beet, soy, rice,
apples, peas, citrus (lemons, oranges), etc. have been incorporated in the
formulations of several meat products including ground meat and sausages
(Keeton, 1994; Kim et al., 2000; Jimenez Colmenero et al., 2001; Fernández-
López et al., 2004). Antioxidant dietary fiber opens up interesting possibili-
ties for meat products.
Oligosaccharides such as inulin, which is composed of a blend of fructose
polymers extracted from chicory, has been used in the preparation of vari-
ous meat products (Pszczola, 1998; Sloan, 2000; Archer et al., 2004). Intake
of oligosaccharides improves beneficial intestinal microflora, reduces blood
glucose levels, and reduces the production of carcinogens in the intestine
(Anandh et al., 2003). Inulin has been used as a fat replacer in sausage, where
it presented interesting satiating properties (Archer et al., 2004). The use of
dietary fiber in the development of fiber-enriched meat products has been
recently reviewed (Jiménez-Colmenero and Delgado-Pando, 2013; Verma
and Banerjee, 2010).
Probiotics are live microbial food ingredients that, when ingested in suf-
ficient quantities, exert health benefits on the consumer (Ashwell, 2002).
Health benefits relating to gastrointestinal disorders, food allergies, inflam-
matory bowel diseases, or immune functions have been attributed to pro-
biotics. These health benefits depend on many factors associated to the
microorganism (genus, species, strain, etc.) and the product (processing,
temperature, pH, aw, etc.). The level of probiotics required in food products to
warrant health claims is not clear, although the minimum daily ingestion of
probiotic bacteria needed to show a health effect is estimated at 106–10 viable
microbes (Anandh et al., 2003; Työppönen et al., 2003). A variety of probiotic
meat products have been prepared with most of the focus on fermented meat
products as these provide a more appropriate environment (no heat treat-
ment) for the viability of microorganisms. A number of meat products (dry
sausage, meat spreads) have been prepared with lactic acid bacteria (Lactoba-
cillus acidophilus, Lactobacillus casei, Lactobacillus paracassei, Lactobacillus rham-
nosus) or bifidobacteria (Bifidobacterium spp.) (Arihara, 2004; Työppönen et al.,
2003). Studies using probiotic microorganisms in other types of meat prod-
ucts such as cooked meat sausages and fresh ground or raw meat are still
scarce mainly because of the processing required for these products such
as heating, the use of additives (sodium chloride, sodium nitrite, etc.), and
consume conditions (Cavalheiro et al., 2015). Probiotic delivery strategies,
based on encapsulation and/or entrapping in gelled dispersions, designed
to enhance probiotic viability during manufacture, storage, cooking, and
gastrointestinal stages in meat matrices, have been recently reviewed (Cav-
alheiro et al., 2015). Meat products with added prebiotics and probiotics have
been marketed in different countries.
New Approaches for the Development of Functional Meat Products 425

13.4.2.4 Antioxidants and Vitamins

The best way to achieve a balance between oxidative damage and anti-
oxidant defense in the human body would be to enhance antioxidant
capacity by optimizing the dietary intake of antioxidants through increased
consumption of antioxidant-rich foods, among them animal-derived foods
(Suray, 2003). The biological hypothesis suggests that dietary antioxidants
have the capacity to prevent oxidative damage in the body, so that increased
levels will also reduce the risk of several diseases, in particular CVD, some
cancers, Alzheimer’s disease, and impairment of vision (Holm, 2003).
The presence of antioxidants also limits the susceptibility of foods to oxida-
tion by reducing the formation (and hence ingestion) of by-products with neg-
ative implications for health. Attempting to produce functional meat products
entails changes in food composition; depending on the nature of the products,
these may in turn entail alterations in the ratio of oxidizable substrate/prooxi-
dants/antioxidants, and consequently also changes in the rate and extent of
the oxidative processes, with undesirable effects as regards oxidative damage.
Meat and meat products enriched with PUFAs are generally characterized by
increased susceptibility to lipid peroxidation. In fact, although PUFAs elicit a
greater cholesterol-lowering response than MUFAs, there has been caution in
recommending high-PUFA diets because of potentially adverse health effects
of their lipoperoxidation products (Williams, 2000). Since antioxidants are
known to be effective in decreasing lipid peroxidation in such products, it
seems logical that an increase in the degree of unsaturation should be accom-
panied by enhancement of antioxidant capacity.
The most prominent dietary antioxidants are tocopherols, vitamin C,
carotenoids, flavonoids, and phenolic compounds. Animal feeding strategies
(see Section 13.3.3) have been used to promote their presence in intact mus-
cle. Reformed and restructured cured turkey products (Walsh et al., 1998),
cooked ham (Santos et al., 2004), and dry fermented sausage (Hoz et al., 2004)
have all been made with improved meat raw materials of this kind.
The antioxidant profile of meat products has also been improved by add-
ing antioxidants during the manufacturing process, either as a specific prep-
aration or as a component of nonmeat ingredients. One example of this is
the incorporation of a wide variety of synthetic or natural exogenous anti-
oxidants (nitrite, phenolic compounds, tocopherols, chelants, plant extracts,
etc.), which in some cases are added in the form of complex mixtures of bio-
active compounds with multiple functions. Technological processing strate-
gies can also be used to minimize oxidation in muscle foods (Decker and
Xu, 1998).
Vitamin E has been added to several meat products (sausages, ham) (Jimé-
nez Colmenero, 2005; Jensen et al., 1998). Various plant-derived ingredients
containing tocopherols (and tocotrienols) have been used in the preparation
of meat products, including wheat germ in frankfurters (Gnanasambandam
and Zayas, 1992), walnut in restructured steak (Serrano et al., 2005), and rice
426 Advanced Technologies for Meat Processing, Second Edition

bran oil in roast beef (Kim et al., 2000). Honey, which possesses important
antioxidant properties attributed to the presence of α-tocopherol (along with
other substances such as ascorbic acid, catalase, flavonoids, etc.), has been
used as an agent against lipid oxidation in muscle food (Pszczola, 1998).
Ascorbic acid supplementation presents health-beneficial effects in
connection with improvement of the immune function and the prevention
of heart diseases and certain types of cancers (Johnston, 2003). Ascorbic acid
has been incorporated as an isolate or as a component of nonmeat ingre-
dients (citrus by-products, honey, etc.) in meat products such as beef pat-
ties (Sánchez-Escalante et al., 2001), dry-cured sausages (Fernández-López
et al., 2004), roasted chicken (Pszczola, 1998), and cooked pork (O’Connell
et al., 2002). Additionally, meat products (cooked sausages, hamburgers) have
been enriched with folic acid (Cáceres et al., 2008). Folic acid presents dif-
ferent health benefits, for example a reduction in the risk of the incidence of
neural tube defects.
Carotenoids (β-carotene, lycopene, lutein, zeaxanthin, etc.) are naturally
present in different vegetables (Pennington, 2002), some of which are used as
nonmeat ingredients in processed meats. Potential health-promoting effects
of dietary carotenoids include antioxidant activity and a contribution to the
prevention of common chronic diseases, including reduction of the risk of
cancer, CVD, age-related macular degeneration, and cataracts (Suray, 2003).
Several carotenoids have been tested as exogenous antioxidant additives in
meat products. Lycopene has been used in the production of beef patties
(Desmond and Troy, 2004). Beef patties, restructured beef steak, frankfurters,
and meat/liver loaves have been prepared with plant-derived ingredients
such as tomato pulp or juice (lycopene rich) (Yilmaz et al., 2002; Sánchez-
Escalante et al., 2003), carrot and sweet potato (rich in provitamin A) (Saleh
and Ahmed, 1998; Devatkal et al., 2004), or spinach (rich in lutein and zea-
xanthin) (Pizzocaro et al., 1998). Lutein has been directly incorporated in
meat products (Granado-Lorencio et al., 2010). The ready availability of carot-
enoids (e.g., lycopene and lutein) as food ingredients means that industrial
use is likely to grow fast (Sloan, 2000).
There has been growing interest in the meat industry in the use of some
plant-derived materials (from herbs, spices or fruit), as sources of natural
phenolic antioxidants. For example, antioxidant activity has been reported
for extract of cherry in lean ground beef; green tea in poultry meat; grape, lic-
orine root, and horsetail in pork meat; or coffee, rosemary, and grape skin in
precooked pork patties or beef patties (Sánchez-Escalante et al., 2001; Turu-
batovic and Milatovic-Stevanovic, 2001; Nissen et al., 2004). The antioxidant
activity of hydroxytyrosol has been demonstrated in frankfurters enriched
with n-3 PUFA (Cofrades et al., 2011). Other compounds like taurine or car-
nosine have been added to meat products during processing to limit lipid
oxidation (Morrissey et al., 1998; Sánchez-Escalante et al., 2001).
Some of the compounds cited above have also been used in meat products
for purposes other than enhancing lipid stability. For instance, antioxidants
New Approaches for the Development of Functional Meat Products 427

(synthetic and natural, pure compounds or food extracts, and whole foods)
are thought to be a promising means of reducing HA exposure because of
their ability to inhibit HA formation or to block/suppress HA biotransforma-
tion/metabolism (Vitaglione and Fogliano, 2004). Addition of vitamin E in
certain cured products has been shown to reduce the production of nitrosa-
mines (Jensen et al., 1998).

13.4.2.5 Minerals
Technological strategies have been employed to increase the concentration
of various minerals in meat products. In this regard, different meat prod-
ucts have been enriched with minerals such as calcium (Arihara, 2004;
Cáceres et al., 2006), selenium (García-Iñiguez et al., 2010), or iron (Navas-
Carretero et al., 2009). At the same time, some nonmeat ingredients (walnut,
seaweed, etc.) can promote the presence in processed meat of a number of
minerals (Cu, Mg, Mn, K, etc.) (Serrano et al., 2005; Olmedilla-Alonso et al.,
2013). Iodine has been incorporated into dry fermented sausage (García-Iñi-
guez et al., 2010).

13.4.2.6 Plant Sterols and Stanols

Plant sterols are natural constituents of plants (Pennington, 2002). How-
ever, they are generally present in the diet in relatively low concentrations
(Ashwell, 2002). Structurally, plant sterols and stanols (the saturated deri-
vates) resemble cholesterol. A number of studies have demonstrated the
ability of plant sterols/stanols to reduce total and low-density lipoprotein
(LDL) cholesterol in humans, inhibit the absorption of dietary cholesterol,
and reabsorb endogenous cholesterol from the digestive tract (Holm, 2003).
In the United States, the FDA has approved the use of a health claim for
plant sterol and plant stanol esters based on evidence that they may help
to reduce the risk of CVD when the content of saturated fats and dietary
cholesterol is low. Meat products such as frankfurters and broiler meat-
balls have been developed with stanols (Benecol) for marketing in Finland
(Leino, 2001).
Some plant ingredients (e.g., vegetable oils) used in meat processing con-
tain phytosterols such as β-sitosterol, camposterol, and stingmasterol, which
pass into meat products. They may be incorporated either as isolated phytos-
terols or through the use of vegetable oils containing them in the course of
meat processing. A mixture of plant sterols and/or their esterified forms and
mineral salts has been used to prepare plant sterol-enriched frankfurters,
sausage, and cold cuts (SCF, 2003).
Vegetable oils (and other plant products) used as animal fat replacers or
in frying processes (either industrially or in domestic food preparation) pro-
mote the presence of sterols in meat derivatives.
428 Advanced Technologies for Meat Processing, Second Edition

13.4.2.7 Other Compounds

The roles of some phytochemicals have so far been noted individually
(chiefly as antioxidants); however, many plant products (spices, condiments,
and herbs) used in meat products are sources of phytochemicals (flavonols,
lignans, allicin, etc.) with potential health-promoting properties (Gibis et al.,
1999; Anandh et al., 2003; Fista et al., 2004; Sadler, 2004), including anticar-
cinogenic, antihypertensive, antihypercholesterolaemic, antibacterial, and
antioxidant properties.

13.5 Safety and Scientific Criteria for Nutrition and

Health Claims: Legislative Implications
Food safety is an important and essential aspect for food consumers, espe-
cially in the meat sector, which is highly sensitive to such considerations.
Safety is therefore an essential factor that must be taken into account in the
development of new functional meat products. Functional foods (and func-
tional meat products) are consumed as part of a normal food pattern. How-
ever, there are several considerations that must be addressed when assessing
food risk: (1) altered consumption behavior; (2) the negative effect of this on
particular highly sensitive groups of the population; (3) interactions between
components and medicaments; (4) effects of low micronutrient intakes;
(5) effects of excessive micronutrient intakes; and (6) long-term consequences
of their consumption (Diplock et al., 1999).
Most studies on functional meats have focused chiefly on the improve-
ment of their composition by means of one or more functional compo-
nents. As mentioned in the introduction, the beneficial effect of a functional
food must be demonstrated by scientific methods. Such a demonstration
will furnish scientific support for health claims, which normally address
(1) improvement of physiological functions or (2) reduced risk of certain dis-
eases. The ultimate purpose of the foods obtained using any of the strategies
mentioned above is to obtain a given benefit, to be functional, for the target
user, the consumer. In the case of certain claims of health-promoting prop-
erties, based on generally accepted scientific proof, it is possible to admit
a cause–effect relationship between a food category, a food, or one of its
constituents, and the claimed effect (Olmedilla-Alonso et al., 2013). This has
enabled the EU to establish a list of authorized claims of health-promoting
properties of foods other than those relative to the reduction of disease risk
and the development and health of children (European Commission, 2012).
When this cause–effect relationship is yet to be convincingly established,
or substantiation of it is sought in a specific food matrix, it is necessary to
evaluate the functional effect, which can be carried out using in vitro and in
vivo models that provide information on mechanisms of action, the effect
New Approaches for the Development of Functional Meat Products 429

on function–response in vivo, the dose–response relationship, and acute and

chronic effects (Ashwell et al., 2002; Howlett, 2008).
Although no simple matter in practice, regulation of nutrition and health
claims with respect to foods would help to achieve a high level of protection of
human health and to promote the protection of consumer interests by ensur-
ing that foods bearing nutrition and health claims are labeled and advertised
in an appropriate and clear manner that enables consumers to make ratio-
nal choices (EU Commission, 2003). Obviously, such regulations will have a
strong influence on the development and marketing of functional foods. The
increasing public interest in dietary health benefits have led to the develop-
ment of different legislative texts (with important global variations) on nutri-
tion and health claims worldwide. Recently, Boer and Bast (2015) reviewed
the current international pieces of legislation on nutrition and health claims
in an attempt to show the diverse approaches and to envision ways to opti-
mize procedures from a scientific perspective. As indicated by these authors
the international harmonization of claims should globally lead to improved
pieces of legislation, stimulate industrial efforts in functional foods, and
enhance consumers’ opportunity to use health-enhancing products.
In the context of EU legislation, meat and meat products, as other foods, have
different possibilities related health claims. Commission Regulation (EU) No
432/2012 established a list of permitted health claims made on foods, other
than those referring to the reduction of disease risk and to children’s develop-
ment and health. In this document, meat is directly included in relation to the
claim: meat contributes to the improvement of iron absorption when eaten
with other foods containing iron. In order to bear the claim, information shall
be given to the consumer that the beneficial effect is obtained by consuming
50 g of meat together with food(s) containing nonheme iron. However, taking
in account the permitted claims, there are many other possibilities to provide
meat products with claims (including those related to the reduction of disease
risk and to children’s development and health), as the conditions of use of the
claim are referred to the nutrient, substance, food, or food category, in general
according with the conditions of use for the nutrition claims. In this regard,
numerous products has been designed and developed in order to improve
the presence/absence of compounds with health implications as described
in this chapter. On the other hand, novel perspectives can be considered in
meat production and processing strategies, as well in the use of new candi-
date bioactive components. All this opens up a wide range of possibilities of
establishing definite designs to provide specific health claim.

13.6 Final Considerations

Meat and meat products are essential foods in our diet. The main role of diet
consists in providing enough nutrients to meet all metabolic requirements
and maintain well-being. In addition, diet can help to modulate some specific
430 Advanced Technologies for Meat Processing, Second Edition

physiological functions and to reduce the risk of certain diseases. Functional

foods have progressed very fast in the last few years and are contributing to
the development of new foods, including meats. In this context, functional
meats and meat products will most probably gain increased market share in
the short term, thus helping to project a better image of meat.
The meat industry possesses the technology with which to produce a good
number of potential functional meat and meat products, some of which have
actually been on the market for several years. Moreover, emerging technologies
may also offer interesting possibilities for new functional meat products in the
near future. However, for the meat industry, communication with its consum-
ers could present a major challenge given that meat functional foods are uncon-
ventional and consumers by no means always perceive meats as healthy foods.

Acknowledgments
To projects AGL2014-53207-C2-1-R and AGL2014-57367-R of the Plan Nacio-
nal de Investigación Cientifica, Desarrollo e Innovación Tecnológica (I+D+I),
Ministerio de Economía y Competitividad, FEDER funds, and Intramural
CSIC: 201470E056.

References
Ahmed, S. T., Mun, H. S., Islam, M. M., Ko, S.-Y. and Yang, C.-J. (2016). Effects of
dietary natural and fermented herb combination on growth performance, car-
cass traits and meat quality in grower-finisher pigs. Meat Science, 122, 7–15.
Ahola, M. (2001). Innovation in Foods: Health, Quality and Well Being Links. Scandinavia:
Finnish Food Industry and Research. February/March, pp. 56–57.
Anandh, M. A., Lakshmanan, V. and Anjaneluyu, A. S. R. (2003). Designer meat foods.
Indian Food Industry, 22(4), 40–45.
Anonymous. (2002). L-carnitine: Bringing health to functional foods. Innovative Food
Science and Emerging Technologies, 17, 14–15.
Ansorena, D. and Astiasarán, I. (2004). The use of linseed oil improves nutritional
quality of the lipid fraction of dry-fermented sausages. Food Chemistry, 87, 69–74.
Antonios, T. F. T. and MacGregor, G. A. (1997). Scientific basis for reducing the salt
(sodium) content in food products. In: Pearson, A. M. and Dutson, T. R. (eds.)
Production and Processing of Healthy Meat, Poultry and Fish Products. London:
Blackie Academic & Professional, pp. 84–100.
Archer, B. J., Johnson, S. K., Devereux, H. M. and Baxter, A. (2004). Effect of fat
replacement by inulin or lupin-kernel fibre on sausage patty acceptability, post-
meal perceptions of satiety and food intake in men. British Journal of Nutrition,
91, 591–599.
Arihara, K. (2004). Functional foods. In: Jensen, W., Devine, C. and Dikemann, M.
(eds.) Encyclopedia of Meat Sciences, vol. 1. London: Elsevier Science, pp. 492–499.
New Approaches for the Development of Functional Meat Products 431

Aristoy, M. C. and Toldrá, F. (1998). Concentration of free amino acids and dipeptides
in porcine skeletal muscles with different oxidative patterns. Meat Science, 50,
327–332.
Armero, E., Barbosa, J. A., Toldrá, F., Baselga, M., and Pla, M. (1999a). Effect of the ter-
minal sire and sex on pork muscle cathepsin (B, B+L and H), cysteine proteinase
inhibitors and lipolytic enzyme activities. Meat Science, 51, 185–189.
Armero, E., Flores, M., Toldrá, F. et al. (1999b). Effects of pig sire types and sex on
carcass traits, meat quality and sensory quality of dry-cured ham. Journal of the
Science of Food and Agriculture, 79, 1147–1154.
Armero, E., Navarro, J. L., Nadal, M. I., Baselga, M. and Toldrá, F. (2002). Lipid com-
position of pork muscle as affected by sire genetic type. Journal of Food Biochem-
istry, 26, 91–102.
Ashwell, M. 2002. Concepts of Functional Foods. ILSI Europe Concise Monograph Series.
Brussels: International Life Science Institute.
Bakkali, F., Averbeck, S., Averbeck, D. and Idaomar, M. (2008). Biological effects of
essential oils—A review. Food and Chemical Toxicology, 46, 446–475.
Barbut, S., Wood, J. and Marangoni, A. (2016). Potential use of organogels to replace
animal fat in comminuted meat products. Meat Science, 122, 155–162.
Bass, J. J., Butler-Hogg, B. W. and Kirton, A. H. (1990). Practical methods of control-
ling fatness in farm animals. In: Wood, J. D. and Fischer, A. V. (eds.) Reducing Fat
in Meat Animals. London: Elsevier Applied Science, pp. 398–436.
Bello, J. M., Mantecón, A. R., Rodríguez, M., Cuestas, R., Beltrán, J. M. and González,
J. M. (2016). Fattening lamb nutrition. Approaches and strategies in feedlot.
Small Ruminant Research, 142, 78–82.
Belury, M. A. (2002). Dietary conjugated linoleic acid in health: Physiological effects
and mechanisms of action. Annual Review of Nutrition, 22, 505–531.
Benchaar, C., Calsamiglia, S., Chaves, A. V. et al. (2008). A review of plant-derived
essential oils in ruminant nutrition and production. Animal Feed Science and Tech-
nology, 145, 209–228.
Benchaar, C., Duynisveld, J. L. and Charmley, E. (2006). Effects of monensin and
increasing dose levels of a mixture of essential oil compound on intake, diges-
tion and growth performance of beef cattle. Canadian Journal of Animal Science,
86, 91–96.
Bloukas, J. G., Paneras, E. D. and Fournitzis, G. C. (1997). Effect of replacing pork
backfat with olive oil on processing and quality characteristics of fermented
sausages. Meat Science, 45, 133–144.
Boer, A. and Bast, A. (2015). International legislation on nutrition and health claims.
Food Policy, 55, 61–70.
Buckley, D. J., Morrisey, P. A. and Gray, J. I. (1995). Influence of dietary vitamin E
on the oxidative stability and quality of pig meat. Journal of Animal Science, 73,
3122–3130.
Cáceres, E., García, M. L. and Selgas, M. D. (2006). Design of a new cooked meat sau-
sage enriched with calcium. Meat Science, 73, 368–377.
Cáceres, E., García, M. L. and Selgas, M. D. (2008). Conventional and reduced-fat
cooked meat sausages enriched with folic acid. Fleischwirtschaft, 23, 58–60.
Carbajal, A. (2004). Consumo de carne y tendencias. Calidad de vida y epidemiología
de enfermedades asociadas. In: Jiménez Colmenero, F., Sánchez-Muniz, F. J. and
Olmedilla, B. (eds.) La Carne y Productos Cárnicos Como Alimentos Funcionales.
Madrid, Spain: editec@red, pp. 13–38.
432 Advanced Technologies for Meat Processing, Second Edition

Calvo, L., Segura, J., Toldrá, F. et al. (2017). Dietary organic selenium increases post-
mortem free fatty acid concentration in pigs. Food Science and Technology Interna-
tional (accepted for publication).
Calvo, L., Toldrá, F., Aristoy, M. C., López-Bote, C. J. and Rey, A. I. (2016a). Effect
of dietary organic selenium on muscle proteolytic activity and water-holding
capacity in pork. Meat Science, 121, 1–11.
Calvo, L., Toldrá, F., Rodríguez, A. I., López-Bote, C. and Rey, A. I. (2016b). Effect of
dietary selenium source (organic vs. mineral) and muscle pH on meat quality
characteristics of pigs. Food Science & Nutrition, 5(1), 94–102. doi:10.1002/fsn3.368.
Cassens, R. G. 1999. Contribution of meat to human health. Proceedings of the 45th
International Congress of Meat Science and Technology. Yokohama, Japan, vol. 2,
642–648.
Castro, T., Manso, T., Mantecón, A. R., Guirao, J. and Jimeno, V. (2005). Fatty acid
composition and carcass characteristics of growing lamb fed diets containing
palm oil supplements. Meat Science, 69, 757–764.
Cavalheiro, C. P., Ruiz-Capillas, C., Herrero, A. M., Jimenez-Colmenero, F., Ragagnin
de Menezes, C. and Martins Fries, L. L. (2015). Application of probiotic delivery
systems in meat products. Trends in Food Science & Technology, 46, 120–131.
Chae, S. H., Keeton, J. T. and Smith, S. B. (2004). Conjugated linoleic acid reduces
lipid oxidation in aerobically stored, cooked ground beef patties. Journal of Food
Science, 69, 306–309.
Chizzolini, R., Zanardi, E., Dorigoni, V. and Ghidini, S. (1999). Calorific value and
cholesterol content of normal and low-fat meat and meat products. Trends in
Food Science & Technology, 10, 119–128.
Clarke, A. D. (1997). Reducing cholesterol levels in meat, poultry and fish products.
In: Pearson, A. M., Dutson, T. R. (eds.) Production and Processing of Healthy Meat,
Poultry and Fish Products. London: Blackie Academic & Professional, pp. 101–117.
Cofrades, S., Salcedo Sandoval, L., Delgado-Pando, G., López-López, I., Ruiz-Capil-
las, C. and Jiménez-Colmenero, F. (2011). Antioxidant activity of hydroxytyrosol
in frankfurters enriched with n-3 polyunsaturated fatty acids. Food Chemistry,
129, 429–436.
Collins, J. E. (1997). Reducing salt (sodium) levels in processed meat, poultry and fish
products. In: Pearson, A. M. and Dutson, T. R. (eds.) Production and Processing
of Healthy Meat, Poultry and Fish Products. London: Blackie Academic & Profes-
sional, pp. 282–297.
Correia, B. R., Carvalho, G. G. P., Oliveira, R. L. et al. (2016). Production and quality of
beef from young bulls fed diets supplemented with peanut cake. Meat Science,
118, 157–163.
D’Arrigo, M., Hoz, L., Cambero, I., Lopez-Bote, C. J., Pin, C. and Ordoñez, J. A.
(2004). Production of n-3 enriched pork liver paté. Lebensmittel-Wissenschaft und-
Technologie, 37, 585–591.
Decker, E. A. and Xu, Z. (1998). Minimizing rancidity in muscle foods. Food Technology,
52, 54–59.
De Smet, S., Claeys, E. and Demeyer, D. (2002). Muscle enzymes in relation to meat
quality and muscularity. In: Toldrá, F. (ed.) Research Advances in the Quality of
Meat and Meat Products. Trivandrum, India: Research Signpost, pp. 123–142.
Demeyer, D., Honikel, K. and De Smet, S. (2008). The World Cancer Research Fund
report 2007: A challenge for the meat processing industry. Meat Science, 80,
953–959.
New Approaches for the Development of Functional Meat Products 433

Desmond, E. (2006). Reducing salt: A challenge for the meat industry. Meat Science,
74, 188–196.
Desmond, E. and Troy, D. (2004). Nutrient claims on packaging. In: Jensen, W. K,
Devine, C. and Dikeman, M. (eds.) Encyclopaedia of Meat Science, vol. 2. Oxford:
Elsevier Academic Press, pp. 903–910.
Devatkal, S., Mendiratta, S. K. and Kondaiah, N. (2004). Quality characteristics of
loaves from buffalo meat, liver and vegetables. Meat Science, 67, 377–383.
Dhiman, T. R., Zaman, S., Olson, K. C., Bingham, H. R., Ure, A. L. and Pariza, M. W.
(2005). Influence of feeding soybean oil on conjugated linoleic acid content in
beef. Journal of Agricultural and Food Chemistry, 53, 684–689.
Diplock, A. T., Aggett, P. J., Ashwell, M., Bornet, F., Fern, E. B. and Roberfroid, M. B.
(1999). Scientific concept of functional foods in Europe. Consensus document.
British Journal of Nutrition, 81, S1–S27.
D’Souza, D. N., Warner, R. D., Dunshea, F. R. and Leury, B. J. (1999). Comparison
of different dietary magnesium supplements on pork quality. Meat Science, 51,
221–225.
Dye, L. and Blundell, J. (2002). Functional foods: Psychological and behavioural func-
tions. British Journal of Nutrition, 88(Suppl 2), S187–S211.
EFSA. (2004). Opinion of the Scientific Panel on Dietetic Products, Nutrition and
Allergies on a request from the Commission related to the presence of trans fatty
acids in foods and the effect on human health of the consumption of trans fatty
acids. (Request N EFSA-Q-2003-022). EFSA Journal, 81, 1–49
Elmore, J. S., Cooper, S. L., Enser, M. et al. (2005). Dietary manipulation of fatty acid
composition in lamb meat and its effect on the volatile aroma compounds of
grilled lamb. Meat Science, 69, 233–242.
Enser, M., Hallet, K. G., Hewett, B., Fursey, G. A., Wood, J. D. and Harrington, G.
(1998). Fatty acid content and composition of UK beef and lamb muscle in rela-
tion to production system and implications for human nutrition. Meat Science,
49, 329–341.
Enser, M., Richardson, R. I., Wood, J. D., Gill, B. P. and Sheard, P. R. (2000). Feeding
linseed to increase the n-3 PUFA of pork: Fatty acid composition of muscle, adi-
pose tissue, liver and sausages. Meat Science, 55, 201–212.
European Commission (EU). (2012). Regulation (EU) No 432/2012 of 16 May 2012
establishing a list of permitted health claims made on foods, other than those
referring to the reduction of disease risk and to children’s development and
health. Official Journal of the European Union, L136, 1–40.
European Commission (EU). (2003). Proposal for a Regulation of the European Parlia-
ment and of the Council on nutrition and health claims made on food. COM 424,
Commission of the European Communities 2003/0165, Brussels.
Fairweather-Tait, S. J., Bao, Y., Broadley, M. R. et al. (2011). Selenium in human health
and disease. Antioxidants & Redox Signaling, 14, 1337–1383.
Feldman, L. B. (2002). The scientific evidence for a beneficial health relationship
between walnuts and coronary disease. Journal of Nutrition, 132, 1062S–1101S.
Fernández, X., Mourot, J., Mounier, A. and Ecolan, P. (1995). Effect of muscle type and
food deprivation for 24 hours on the composition of the lipid fraction in muscles
of Large White pigs. Meat Science, 41, 335–343.
Fernández-López, J., Fernández-Ginés, J. M., Aleson-Carbonell, L., Sendra, E., Sayas-
Barberá, E. and Pérez-Alvarez, J. A. (2004). Application of functional citrus by-
products to meat products. Trends in Food Science & Technology, 15, 176–185.
434 Advanced Technologies for Meat Processing, Second Edition

Fista, G. A., Bloukas, J. G. and Siomos, A. S. (2004). Effect of leek and onion on processing
and quality characteristics of Greek traditional sausages. Meat Science, 68, 163–172.
García-Iñiguez, C., Larequi, E., Rehecho, S. et al. (2010). Selenium, iodine, ω-3
PUFA and natural antioxidant form Melissa officinalis L: A combination of
components for healthier dry fermented sausage formulation. Meat Science,
85, 274–279.
Gibis, M., Schoch, A. and Fisher, A. (1999). The effect of spices on the reduction of the
formation of mutagenic/carcinogenic heterocyclic amines in beef patties. Pro-
ceedings of 45th International Congress of Meat Science and Technology, 2, (716–717)
Yokohama, Japan.
Gnanasambandam, R. and Zayas, J. F. (1992). Functionality of wheat germ protein
in comminuted meat products as compared with corn germ and soy proteins.
Journal of Food Science, 57, 829–833.
Goldberg, T., Cai, W., Peppa, M. et al. (2004). Advanced glycoxidation end products
in commonly consumed foods. Journal of the American Dietetic Association, 104(8),
1287–1291.
Granado-Lorencio, F., López-López, I., Herrero-Barbudo, C. et al. (2010). Lutein-
enriched frankfurter-type products: Physicochemical characteristics and lutein
in vitro bioaccessibility. Food Chemistry, 120, 741–748.
Harris K. B., Cross, H. R., Pond, W. G. and Mersmann, H. J. (1993). Effect of dietary
fat and cholesterol level on tissue cholesterol concentrations of growing pigs
selected for high or low serum cholesterol. Journal of Animal Science, 71, 807–810.
Hasler, C. M. (1998). Functional foods: Their role in disease prevention and health
promotion. Food Technology, 52, 63–70.
Hasler, C. M. (2000). The changing face of functional foods. Journal of the American
College of Nutrition, 19, 499S–506S.
Hasler, C. M., Bloch, A. S., Thomson, C. A., Enrione, E. and Manning, C. (2004). Posi-
tion of the American Dietetic Association: Functional foods. Journal of the Ameri-
can Dietetic Association, 104, 814–826.
Hernández, P., Navarro, J. L. and Toldrá, F. (1998). Lipid composition and lipolytic
enzyme activities in porcine skeletal muscles with different oxidative pattern.
Meat Science, 49, 1–10.
Higgs, J. D. (2000). The changing nature of red meat: 20 years of improving nutritional
quality. Trends in Food Science & Technology, 11, 85–95.
Holm, F. (2003). New Functional Foods Ingredients Cardiovascular Health. Project no.
QLK1-CT-2000-00040. SMEs no.5. Available at www.nutrition.org.uk (accessed
October 2004).
Hotchkiss, J. H. and Parker, R. S. (1990). Toxic compounds produced during cooking
and meat processing. In: Pearson, A. M. and Dutson, T. R. (eds.) Advances in
Meat Research, vol. 6. London: Elsevier Applied Science, pp. 105–134.
Hovenier, R., Kanis, E., Asseldonk, T. H. and Westerink, N. G. (1992). Genetic param-
eters of pig meat quality traits in a halothane negative population. Meat Science,
32, 309–321.
Howlett, J. (2008). Functional Foods: From Science to Health and Claims. ILSI Europe Con-
cise Monographs Series. Belgium, Brussels: ILSI Europe.
Hoz, L., D’Arrigo, M. D., Camberro, I. and Ordoñez, J. A. (2004). Development of an
n-3 fatty acid and α-tocopherol enriched dry fermented sausage. Meat Science,
67, 485–495.
New Approaches for the Development of Functional Meat Products 435

Hoz, L., López-Bote, C. J., Cambero, M. I. et al. (2003). Effect of dietary linseed oil and
α-tocopherol on pork tenderloin (Psoas major) muscle. Meat Science, 65, 1039–1044.
Hur, S. J., Ye, B. W., Lee, J. L., Ha, Y. L., Park, G. B. and Joo, S. T. (2004). Effects of
conjugated linoleic acid on color and lipid oxidation of beef patties during cold
storage. Meat Science, 66, 771–775.
Irie, M. and Sakimoto, M. (1992). Fat characteristics of pigs fed fish oil contain-
ing eicosapentaenoic and docosahexanoic acids. Journal of Animal Science, 70,
470–477.
Isabel, B., López-Bote, C. J., Hoz, L., Timón, M., García, C. and Ruiz, J. (2003). Effects
of feeding elevated concentrations of monounsaturated fatty acids and vitamin
E to swine on characteristics of dry-cured hams. Meat Science, 64, 475–482.
Jakobsen, K. (1999). Dietary modifications of animal fats: Status and future perspec-
tives. Fett/Lipid, 101, 475–483.
Jang, Y. D., Choi, H. B., Durosoy, S., Schlegel, P., Choie, B. R. and Kim, Y. Y. (2010).
Comparison of bioavailability of organic selenium sources in finishing pigs.
Asian Australasian Journal of Animal Sciences, 23, 931–936.
Jayasena, D. D. and Jo, C. (2013). Essential oils as potential antimicrobial agents
in meat and meat products: A review. Trends in Food Science & Technology, 34,
96–108.
Jensen, C., Lauridsen, C. and Bertelsen, G. (1998). Dietary vitamin E: Quality and stor-
age stability of pork and poultry. Trends in Food Science & Technology, 9, 62–72.
Jeun-Horng, L., Yuan-Hui, L. and Chun-Chin, K. (2002). Effect of dietary fish oil on
fatty acid composition, lipid oxidation and sensory property of chicken frank-
furters during storage. Meat Science, 60, 161–167.
Jiang, J. and Xiong, Y. L. (2016). Natural antioxidants as food and feed additives to
promote health benefits and quality of meat products: A review. Meat Science,
120, 107–117.
Jiménez-Colmenero, F. (2004). Chemistry and physics of comminuted meat products.
Non-meat proteins. In: Jensen, W. K., Devine, C. and Dikeman, M. (eds.) Ency-
clopaedia of Meat Science, vol. 1. Oxford: Elsevier Academic Press, pp. 271–278.
Jimenez-Colmenero, F. (2007a). Meat based functional foods. In: Hui, Y. H., Chandan,
R. C., Clark, S. et al. (eds.) Handbook of Food Products Manufacturing. Hoboken,
NJ: John Wiley & Son, pp. 989–1015.
Jimenez-Colmenero, F. (2007b). Healthier lipid formulation approaches in meat based
functional foods. Technological options for replacement of meat fats by non-
meat fats. Trends in Food Science & Technology, 18, 567–578.
Jimenez-Colmenero, F., Ayo, M. J. and Carballo, J. (2005). Physicochemical proper-
ties of low sodium frankfurter with added walnut: Effect of transglutaminase
combined with caseinate, KCl and dietary fibre as salt replacers. Meat Science,
69, 781–788.
Jimenez-Colmenero, F., Carballo, J. and Cofrades S. (2001). Healthier meat and meat
products: Their role as functional foods. Meat Science, 59, 5–13.
Jiménez-Colmenero, F. and Delgado-Pando, G. (2013). Fibre-enriched meat products.
In: Delcour, J. A. and Poutanen, K. (eds.) Fibre-Rich and Wholegrain Foods. Oxford:
Woodhead Publishing, pp. 329–347.
Jiménez-Colmenero, F., Herrero, A., Cofrades, S. and Ruiz-Capillas, C. (2012). Meat
and functional foods. In: Hui, Y. H. (ed.) Handbook of Meat and Meat Processing
(2nd Ed.). Boca Raton, FL: Taylor & Francis Group, CRC Press, pp. 225–248.
436 Advanced Technologies for Meat Processing, Second Edition

Jiménez-Colmenero, F., Salcedo-Sandoval, L., Bou, R., Cofrades, S., Herrero, A. M.

and Ruiz-Capillas, C. (2015). Novel applications of oil-structuring methods as
a strategy to improve the fat content of meat products. Trends in Food Science &
Technology, 44, 177–188.
Jimenez-Colmenero, F., Serrano, A., Ayo, J., Solas, M. T., Cofrades, S. and Carballo, J.
(2003). Physicochemical and sensory characteristics of restructured beef steak
with added walnuts. Meat Science, 65, 1391–1397.
Jin, H., Xu, C. X., Lim, H. T. et al. (2009). High dietary inorganic phosphate increases
lung tumorigenesis and alters akt signaling. American Journal of Respiratory and
Critical Care Medicine, 179, 59–68.
Johnson, M. H., Calkins, C. R., Huffman, R. D., Johnson, D. D. and Hargrove, D. D.
(1990). Differences in cathepsin B+L and calcium-dependent protease activities
among breed type and their relationship to beef tenderness. Journal of Animal
Science, 68, 2371–2379.
Johnston, C. S. (2003). Vitamin C In: Bowman, B. A. and Russell, R. M. (eds.) Cono-
cimientos Actuales sobre Nutrición. Washington, DC: Organización Panamericana
de la Salud, ILSI Press, pp. 191–200.
Joo, S. T., Lee, J. I., Hah, K. H., Ha, Y. L. and Park, G. B. (2000). Effect of conjugated
linoleic acid additives on quality characteristics of pork patties. Korean Journal of
Food Science and Technology, 32, 62–68.
Keeton, J. T. (1994). Low-fat meat products. Technological problems with processing.
Meat Science, 36, 261–276.
Kim, J.S., Godber, J.S. and Prinaywiwatkul, W. (2000) Restructured beef roasts con-
taining rice bran oil and fiber influences cholesterol oxidation and nutritional
profile. Journal of Muscle Foods, 11, 111–127.
Knorr, D. (1998). Technology aspects related to microorganisms in functional foods.
Trends in Food Science & Technology, 9, 295–306.
Larick, D. K., Turner, B. E., Schoenherr, W. D., Coffey, M. T. and Pilkington, D. H.
(1992). Volatile compound contents and fatty acid composition of pork as influ-
enced by linoleic acid content of the diet. Journal of Animal Science, 70, 1397–1403.
Lauridsen, C., Andersen, G., Andersson, M., Danielsen, V., Engberg, R. and Jakobsen,
K. (1999). Effect of dietary fish oil supplied to pigs from weaning to 60 kg live-
weight on performance, tissue fatty acid composition and palatability of pork
when slaughtered at 100 kg liveweight. Journal of Animal and Feed Sciences, 8,
441–456.
Lauridsen, C., Mu, H. and Henckel, P. (2005). Influence of dietary conjugated linoleic
acid (CLA) and age at slaughtering on performance, slaughter- and meat quality,
lipoproteins, and tissue deposition of CLA in barrows. Meat Science, 69, 393–399.
Leclerq, B. (1990). Facteurs influençant la teneur en lipids des viands de porc et de
volailles. Viandes Produits Carnées, 11, 250–254.
Leino, M. 2001. Health trends in meat production. IFAJ 45th Annual Congress, Savon-
linna, Finland. Available at http://www.maataloustoimittajat.fi/ifaj-2001/
speeches/monday/leino_en.htm (accessed 5 October 2004).
Lener, M., Jaworska, K., Muszy ska, M. et al. (2012). Selenium as marker for cancer
risk and prevention. Polish Journal of Surgery, 84, 470–475.
Leszczynski, D. E., Pikul, J., Easter, R. A. et al. (1992). Characterization of lipid in loin
and bacon from finishing pigs fed full-fat soybeans or tallow. Journal of Animal
Science, 70, 2175–2181.
New Approaches for the Development of Functional Meat Products 437

Liu, M. N., Huffman, D. L. and Egbert, W. R. (1991). Replacement of beef fat with
partially hydrogenated plant oil in lean ground beef patties. Journal of Food Sci-
ence, 56, 861–862.
Lurueña-Martinez, M. A., Vivar-Quintana, A. M. and Revilla, I. (2004). Effect of locust
bean/xanthan gum addition and replacement of pork fat with olive oil on the
quality characteristics of low-fat frankfurters. Meat Science, 68, 383–389.
Lynch, P. B. and Kerry, J. P. (2000). Utilizing diet to incorporate bioactive compounds
and improve the nutritional quality of muscle foods. In: Decker, E., Faustman,
C. and López-Bote, C. J. (eds.) Antioxidants in Muscle Foods. New York, NY: Wiley
Interscience, pp. 455–480.
Mahan, D. C., Azain, M., Crenshaw, T. D. et al. (2014). Supplementation of organic
and inorganic selenium to diets using grains grown in various regions of the
United States with differing natural Se concentrations and fed to grower-fin-
isher swine. Journal of Animal Science, 92, 4991–4997.
Marquez, E. J., Ahmed, E. M., West, R. L. and Johnson, D. D. (1989). Emulsion stability
and sensory quality of beef frankfurters produced at different fat and peanut oil
levels. Journal of Food Science, 54, 867–870, 873.
Marriott, N. G., Garrett, J. E., Sims, M. D., Wang, H. and Abril, J. R. (2002). Charac-
teristics of pork with docosahexanoic acid supplemented in the diet. Journal of
Muscle Foods, 13, 253–263.
Martin, D., Ruiz, J., Kivikari, R. and Puolanne E. (2008). Partial replacement of pork
fat by conjugated linoleic acid and/or olive oil in liver pâtés: Effect on physico-
chemical characteristics and oxidative stability. Meat Science, 80, 496–504.
Martineau, R., Petit, H. V., Benchaar, C. et al. (2008). Effects of lasalocid or monensin
on in situ biohydrogenation of flaxseed and sunflower seed unsaturated fatty
acids. Canadian Journal of Animal Science, 88, 335–339.
Mercier, Y., Gatellier, P., Viau, M., Remignon, H. and Renerre, M. (1998). Effect of
dietary fat and vitamin E on colour stability and on lipid and protein oxidation
in turkey meat during storage. Meat Science, 48, 301–318.
Miller, M. F., Shackelford, S. D., Hayden, K. D. and Reagan, J. O. (1990). Determina-
tion of the alteration in fatty acid profiles, sensory characteristics and carcass
traits of swine fed elevated levels of monounsaturated fats in the diet. Journal of
Animal Science, 68, 1624–1631.
Monahan, F. J. and Troy, D. J. (1997). Over coming sensory problems in low fat and
low salt products. In: Pearson, A. M. and Dutson, T. R. (eds.) Production and
Processing of Healthy Meat, Poultry and Fish Products. London: Blackie Academic
& Professional, pp. 257–281.
Morán, L., Andrés, S., Bodas, R., Prieto, N. and Giráldez, F. J. (2012). Meat texture and
antioxidant status are improved when carnosic acid is included in the diet of
fattening lambs. Meat Science, 91, 430–434.
Morán, L., Giráldez, F. J., Panseri, S. et al. (2013). Effect of dietary carnosic acid on
the fatty acid profile and flavour stability of meat from fattening lambs. Food
Chemistry, 138, 2407–2414.
Morgan, C. A., Noble, R. C., Cocchi, M. and McCartney, R. (1992). Manipulation of the
fatty acid composition of pig meat lipids by dietary means. Journal of the Science
of Food and Agriculture, 58, 357–368.
Morrissey, P. A., Sheehy, P. J. A., Galvin, K., Kerry, J. P. and Buckley, D. J. (1998). Lipid
stability in meat and meat products. Meat Science, 49(Suppl 1), S73–S86.
438 Advanced Technologies for Meat Processing, Second Edition

Muguerza, E., Ansorena, D., Gimeno, O., and Astiasarán, I. (2002). Nutritional advan-
tages of dry fermented sausages elaborated with vegetable oils. In Proceedings
of 48th International Congress of Meat Science and Technology, Rome, Italy, 2, pp.
1012–1013.
Mulvihill, B. (2001). Rumiant meat as a source of conjugated linoleic acid (CLA).
Nutrition Bulletin, 26, 295–299.
Navas-Carretero, S., Pérez-Granados, A. M., Sarriá, B. and Vaquero, M. P. (2009). Iron
absorption from meat pâté fortified with ferric pyrophosphate in iron-deficient
women. Nutrition, 25, 20–24.
Nissen, L. R., Byrne, D. V., Bertelsen, G. and Skibsted, L. H. (2004). The antioxidative
activity of plant extracts in cooked pork patties as evaluated by descriptive sen-
sory profiling and chemical analysis. Meat Science, 68, 485–495.
Noci, F., O’Kiely, P., Monahan, F. J., Stanton, C. and Moloney, A. P. (2005). Con-
jugated linoleic acid concentration in M. Longissimus dorsi from the heifers
offered sunflower oil-based concentrates and conserved forages. Meat Science,
69, 509–518.
O’Connell, M., Kerry, J. P., Fannin, S., and Gilroy, D. (2002). Assessment of honey as a
functional ingredient in cooked meat pork. In Proceeding 48th International Con-
gress of Meat Science and Technology, Rome, Italy, 2, pp. 1016–1017.
Ohr, L. M. (2004). Nutraceutical & functional foods. Food Technology, 58, 71–76.
Olmedilla-Alonso, B., Jiménez-Colmenero, F. and Sánchez-Muniz, F. (2013). Develop-
ment and assessment of healthy properties of meat and meat products designed
as functional foods. Meat Science, 95, 919–930.
O’Sullivan, M. G., Kerry, J. P., Buckley, D. J., Lynch, P. B. and Morrisey, P. A. (1997).
The distribution of dietary vitamin E in the muscles of the porcine carcass. Meat
Science, 45, 297–305.
Paneras, E. D., Bloukas, J. G. and Filis, D. G. (1998). Production of low-fat frankfurt-
ers with vegetable oils following the dietary guidelines for fatty acids. Journal of
Muscle Foods, 9, 111–126.
Park, J., Rhee, K. S., Keeton, J. T. and Rhee, K. C. (1989). Properties of low-fat frank-
furters containing monounsaturated and omega-3 polyunsaturated oils. Journal
of Food Science, 54, 500–504.
Pennington, J. A. T. (2002). Food composition databases for bioactive food compo-
nents. Journal of Food Composition and Analysis, 15, 419–434.
Pereira, E. S., Mizubuti, I. Y., Oliveira, R. L. et al. (2016). Supplementation with cashew
nut and cottonseed meal to modify fatty acid content in lamb meat. Journal of
Food Science, 81, c2143–c2148.
Pizzocaro, F., Senesi, E., Veronese, P. and Gasparoli, A. (1998). Mechanically
deboned poultry meat hamburgers. II. Protective and antioxidant effect of
the carrot and spinach tissues during frozen storage. Industrie Alimentari, 37,
710–720.
Pszczola, D. E. (1998). Addressing functional problems in fortified foods. Food Tech-
nology, 52, 38–46.
Realini, C. E., Duckett, S. K., Brito, G. W., Dalla Rizza, M. and De Mattos, D. (2004b).
Effect of pasture vs. concentrate feeding with or without antioxidants on carcass
characteristics, fatty acid composition, and quality of Uruguayan beef. Meat Sci-
ence, 66, 567–577.
New Approaches for the Development of Functional Meat Products 439

Realini, C. E., Duckett, S. K. and Windham, W. R. (2004a). Effect of vitamin C addition

to ground beef from grass fed or grain-fed sources on color and lipid stability,
and prediction of fatty acid composition by near-infrared reflectance analysis.
Meat Science, 68, 35–43.
Reig, M. and Toldrá, F. (1998a). Pork meat as a source of vitamins. Recent Research
Developments in Nutrition, 2, 29–34.
Reig, M. and Toldrá, F. (1998b). Protein nutritional quality of muscle foods. Recent
Research Developments in Agricultural & Food Chemistry, 2, 71–78.
Rivaroli, D. C., Guerrero, A., Valero, M. V. et al. (2016). Effect of essential oils on meat
and fat qualities of crossbred young bulls finished in feedlots. Meat Science, 121,
278–284.
Roberfroid, M. B. (2000). Concept and strategies of functional food science: The Euro-
pean perspective. American Journal of Clinical Nutrition, 71(Suppl 6), 1660S–1664S.
Romans, J. R., Costello, W. J., Carlson, C. W., Greaser, M. L. and Jones, K. W. 1994. The
Meat We Eat. Danville, IL: Interstate Publisher, p. 1193.
Rosell, C. M. and Toldrá, F. (1998). Comparison of muscle proteolytic and lipolytic
enzyme levels in raw hams from Iberian and White pigs. Journal of the Science of
Food and Agriculture, 76, 117–122.
Rossi, L. G., Fiorentini, G., Netoa, A. J. et al. (2016). Impact of ground soybean and
starch levels on the quality of meat from feedlot young Nellore bulls. Meat Sci-
ence, 122, 1–6.
Ruiz-Capillas, C. and Jiménez Colmenero, F. (2004). Biogenic amines in meat and
meat products. Critical Reviews in Food Science and Nutrition, 44, 489–499.
Rule, D. C., Busboom, J. R. and Kercher, C. J. (1994). Effect of dietary canola on fatty
acid composition of bovine adipose tissue, muscle, kidney, and liver. Journal of
Animal Science, 72, 2735–2744.
Sadler, M. J. (2004). Meat alternatives-market developments and health benefits.
Trends in Food Science & Technology, 15, 250–260.
Saleh, N. T. and Ahmed, Z. S. (1998). Impact of natural sources rich in provitamin A
on cooking characteristics, color, texture and sensory attributes of beef patties.
Meat Science, 50, 285–293.
Salvatori, G., Pantaleo, L., Di Cesare, C., Maiorano, G., Filetti, F. and Oriani, G.
(2004). Fatty acid composition and cholesterol content of muscles as related
to genotype and vitamin E treatment in crossbred lambs. Meat Science, 67,
45–55.
Sánchez-Escalante, A., Djenane, D., Torrescano, G., Beltrán, J. A. and Roncalés P.
(2001). The effects of ascorbic acid, taurine, carnosine and rosemary powder on
colour and lipid stability of beef patties packaged in modified atmosphere. Meat
Science, 58, 421–429.
Sánchez-Escalante, A., Torrescano, G., Djenane, D., Beltran, J. A. and Roncales, P.
(2003). Combined effect of modified atmosphere packaging and addition of
lycopene rich tomato pulp, oregano and ascorbic acid and their mixtures on the
stability of beef patties. Food Science and Technology International, 9, 77–84.
Santos, C., Ordoñez, J. A., Camberro, I., D’Arrigo, M. and Hoz, L. (2004). Physico-
chemical characteristics of an α-linolenic acid and α-tocopherol-enriched
cooked ham. Food Chemistry, 88, 123–128.
Sandrou, D. K. and Arvanitoyannis, I. S. (2000). Low-fat/calorie foods: Current state
and perspectives. Critical Reviews in Food Science and Nutrition Technology, 40,
427–447.
440 Advanced Technologies for Meat Processing, Second Edition

SCF (2003). Opinion of the Scientific Committee on Food on an application from

MultiBene for approval of plant-sterol enriched foods (Scientific Committee
on Food, SFC/CS/NF/DOS/24ADD2 Final). Health and Consumer Protection
Directorate-General, European Commission, Brussels, Belgium.
Serrano, A., Cofrades, S., Ruiz-Capillas, C., Olmedilla-Alonso, B., Herrero-Barbudo,
C. and Jiménez-Colmenero, F. (2005). Nutritional profile of restructured beef
steak with added walnuts. Meat Science, 70, 647–654.
Shackelford, S. D., Miller, M. F., Haydon, K. D. and Reagan, J. O. (1990). Effects of
feeding elevated levels of monounsaturated fats to growing-finishing swine on
acceptability of low-fat sausage. Journal of Food Science, 55, 1497–1500.
Shahidi, F. and Synowiecki, J. (1997). Protein hydrolyzates from seal meat as phos-
phate alternatives in food processing applications. Food Chemistry, 60, 29–32.
Sheard, P. R., Enser, M., Wood, D. J., Nute, G. R., Gill, B. P. and Richardson, R. I. (2000).
Shelf life and quality of pork and pork products with raised n-3 PUFA. Meat
Science, 55, 213–221.
Sheard, P. R., Wood, J. D., Nute, G. R. and Ball, R. C. (1998). Effects of grilling to 80°C
on the chemical composition of pork loin chops and some observations on the
UK National Food Survey estimate of fat consumption. Meat Science, 49, 193–204.
Simopoulos, A. P., Leaf, A. and Salem, N. (2000). Workshop on the essentiality of
and recommended dietary intakes for omega-6 and omega-3 fatty acids. Food
Reviews International, 16, 113–117.
Sloan, A. E. (2000). The top ten functional food trends. Food Technology, 54, 33–62.
Solomon, M. B., Pursel, V. G. and Mitchell, A. D. (2002). Biotechnology for meat qual-
ity enhancement. In: Toldrá, F. (ed.) Research Advances in the Quality of Meat and
Meat Products. Trivandrum, India: Research Signpost, pp. 17–31.
Stewart, W.C., Bobe, G., Pirelli, G.J., Mosher, W.D. and Hall, J.A. (2012) Organic and
inorganic selenium: III. Ewe and progeny performance. Journal of Animal Sci-
ence, 90, 4536-4543.
St. John, L. C., Buyck, M. J., Keeton, J. T., Leu, R. and Smith, S. B. (1986). Sensory and
physical attributes of frankfurters with reduced fat and elevated monounsatu-
rated fats. Journal of Food Science, 51, 1144–1146, 1179.
Suray, P. F. (2003). Natural antioxidants: From the animal feed industry to human
health. In: Suray, P. F. (ed.) Natural Antioxidants in Avian Nutrition and Reproduc-
tion. Nottingham: Nottingham University Press, pp. 565–604.
Suzuki, K. T. and Ogra, Y. (2002). Metabolic pathway for selenium in the body: Speciation
by HPLC-ICP MS with enriched Se. Food Additives & Contaminants, 19, 974–983.
Toldrá, F. (2002). Dry-Cured Meat Products. Trumbull, CT: Food & Nutrition Press, pp.
1–238.
Toldrá, F. and Flores, M. (2004). Meat quality factors. In: Nollet, L. M. L. (ed.) Handbook
of Food Analysis. New York, NY: Marcel Dekker, pp. 1961–1977.
Toldrá, F., Flores, M., Aristoy, M. C., Virgili, R. and Parolari, G. (1996b). Pattern of
muscle proteolytic and lipolytic enzymes from light and heavy pigs. Journal of
the Science of Food and Agriculture, 71, 124–128.
Toldrá, F. and Reig, M. (2004). Analysis of meat in food. In: Nollet, L. M. L. (ed.) Hand-
book of Food Analysis. New York, NY: Marcel Dekker, pp. 1941–1959.
Toldrá, F. and Reig, M. (2011). Innovations for healthier processed meats. Trends in
Food Science & Technology, 22, 517–522.
Toldrá, F., Reig, M., Hernández, P. and Navarro, J. L. (1996a). Lipids from pork meat
as related to a healthy diet. Recent Research Development in Nutrition, 1, 79–86.
New Approaches for the Development of Functional Meat Products 441

Toldrá, F., Rubio, M. A., Navarro, J. L. and Cabrerizo, L. (2004). Quality aspects of
pork and its nutritional impact. In: Shahidi, F., Spanier, A. M., Ho, C.-T. and
Braggins, T. (eds.) Quality of Fresh and Processed Foods. Advances in Experimental
Medicine and Biology, vol. 542. New York, NY: Kluwer Academic/Plenum, 25–32.
Työppönen, S., Petäjä, E. and Mattila-Sandlhom, T. (2003). Bioprotective and probiot-
ics for dry sausages. International Journal of Food Microbiology, 83, 233–244.
Turubatovic, L. and Milatovic-Stevanovic, M. (2001). Bioactive components—New
aspects of applying supplements in the meat industry. Tehnologija Mesa, 42(5–6),
377–397.
Ulrich, C. M. and Potter, J. D. (2004). Diet, genes and cancer risk. In: Senate Commis-
sion on Food Safety (ed.) Functional Foods: Safety Aspects. Weinheim: Wiley-Vch.
KgaA, pp. 37–49.
Verma, A. K. and Banerjee, R. (2010). Dietary fibre as functional ingredient in meat
products: A novel approach for healthy living—A review. Journal of Food Science
and Technology–Mysore, 47, 247–257.
Vitaglione, P. and Fogliano, V. (2004). Use of antioxidants to minimize the human
health risk associated to mutagenic/carcinogenic heterocyclic amines in food.
Journal of Chromatography B, 8002, 189–199.
Walsh, M. M., Kerry, J. F., Buckley, D. J., Arendt, E. K. and Morrissey, P. A. (1998). Effect
of dietary supplementation with α-tocopheryl acetate on stability of reformed
and restructured low nitrite cured turkey products. Meat Science, 50, 191–201.
Wang, X., Wu, H., Long, Z. et al. (2016). Differential effect of Se on insulin resistance,
regulation of adipogenesis and lipolysis. Molecular and Cellular Biochemistry, 415,
89–102.
Warnants, N., Van Oeckel, M. J. and Boucqué, C. V. (1999). Incorporation of dietary
polyunsaturated fatty acids into pork fatty tissues. Journal of Animal Science, 77,
2478–2490.
Weiss, J., Gibis, M., Schuh, V. and Salminen, H. (2010). Advances in ingredient and
processing systems for meat and meat products. Meat Science, 86, 196–213.
Weststrate, J. A., van Poppel, G. and Verschuren, P. M. (2002). Functional foods, trends
and future. British Journal of Nutrition, 88, s233–s235.
Wheeler, T. L., Savell, J. W., Cross, H. R., Lunt, D. K. and Smith, S. B. (1990). Mecha-
nisms associated with the variation in tenderness of meat from Brahman and
Hereford cattle. Journal of Animal Science, 68, 4206–4220.
WHO (2003). Diet, nutrition and the prevention of chronic diseases. WHO Library Cata-
loguing-in-Publication Data, Geneva, WHO Technical Report Series 916.
Williams, C. M. (2000). Dietary fatty acids and human health. Annales de Zootechnie,
49, 165–180.
Wirth, F. (1991). Reducing the fat and sodium content of meat products. What pos-
sibilities are there? Fleischwirtschaft, 7, 294–297.
Wood, J. D., Jones, R. C. D., Bayntun, J. A. and Dransfield, E. (1985). Backfat quality in
boars and barrows at 90 kg live weight. Animal Production, 40, 481–487.
Wood, J. D., Richardson, R. I., Nute, G. R. et al. (2003). Effects of fatty acids on meat
quality: A review. Meat Science, 66, 21–32.
Yılmaz, I. (2004). Effects of rye bran addition on fatty acid composition and quality
characteristics of low-fat meatballs. Meat Science, 67, 245–249.
Yılmaz, I., Simsek, O. and Isıkli, M. (2002). Fatty acid composition and quality char-
acteristics of low-fat cooked sausages made with beef and chicken meat, tomato
juice and sunflower oil. Meat Science, 62, 253–258.
14
Salt Reduction in Processed Meats

Fidel Toldrá and José M. Barat

CONTENTS
14.1 Introduction ................................................................................................443
14.2 Manufacturing Strategies for Low-Salt Foods.......................................445
14.2.1 Sodium Reduction .........................................................................445
14.2.2 Sodium Replacement .....................................................................445
14.2.3 Change of Size and Shape of Salt Crystals.................................446
14.2.4 Other Strategies: Masking Agents ...............................................446
14.3 Effects of Salt on the Quality and Safety of Meat Products................. 447
14.3.1 Physical Properties ........................................................................ 447
14.3.2 Chemical Properties: Enzyme Inhibition ...................................448
14.3.3 Chemical Properties: Sensory Effects ......................................... 449
14.3.4 Preservation Properties................................................................. 452
14.4 Current Regulations on Salt Reduction and Labeling.......................... 453
14.5 Conclusions.................................................................................................454
References.............................................................................................................454

14.1 Introduction
Western societies are concerned with the increased dietary consumption of
sodium and, in fact, it is well recognized that sodium intake exceeds the nutri-
tional recommendations in most industrialized countries. The main reasons
for such concern is the evidence related to consumers’ health. So, an excess of
sodium in the diet may result in a significant rise of blood pressure in signifi-
cant sectors of population having hypertension or prehypertension. This may
contribute to an increased risk of coronary heart disease and both forms of
stroke (WHO/FAO, 2003; WHO, 2007). High salt intake has been also related as
a possible cause contributing to colorectal cancer (Demeyer et al., 2008), stom-
ach cancer, and osteoporosis due to increases in urinary calcium levels excreted
even though solid evidence has yet to be demonstrated (Gilbert and Heiser, 2005;
Glass and Doyle, 2010).
The major risk factor for cardiovascular disease and one of the three leading
risk factors for global disease burden in 2010 is high blood pressure (Lim et al.,

443
444 Advanced Technologies for Meat Processing, Second Edition

2012). Dietary risk factors, diets low in fruits and high in sodium being the
most relevant, and physical inactivity collectively accounted for 100% of the
disability-adjusted life years in 2010 (Lim et al., 2012). Excessive sodium intake
has been confirmed as an important cause for high blood pressure (Aburto et
al., 2013; He and MacGregor, 2003). The amount of dietary salt consumed is an
important determinant of blood pressure levels and a major risk factor for cor-
onary heart disease and ischemic as well as hemorrhagic stroke (WHO/FSA,
2010). In fact, raised blood pressure is estimated to cause 7.5 million deaths,
about 12.8% of all deaths (WHO, 2011). So, sodium consumption of more than
2 g/day is estimated to cause 1.65 million cardiovascular-related deaths each
year, representing around 1 of every 10 deaths from cardiovascular causes
(Mozaffarian et al., 2014). Raised blood pressure is positively and progressively
related to the risk for stroke and coronary heart disease (Whitworth, 2003).
The efficacy of reduced sodium intake in lowering blood pressure is well
established. A reduction in salt intake to less than 5 g/day (2 g/day of sodium)
was recommended by WHO (2014) in order to reduce blood pressure and the
risk of coronary heart disease and stroke. Seventy-five percent of our sodium
dietary intake comes from processed foods (Appel and Anderson, 2010). The
main source of sodium in the diet is sodium chloride and the use is estimated
to be around 9–12 g of salt per day. Dietary salt intake is recommended to
decrease to 5 g/day, since this reduction would also decrease the impact of
blood pressure and cardiovascular disease. For instance, a study carried out
in the United Kingdom demonstrated that blood pressure was reduced to
3.6–5.6/1.9–3.2 mmHg (systolic/diastolic) in hypertensive volunteers when salt
intake was reduced by 3 g/day (He and Macgregor, 2003). It was also estimated
that with such salt reduction, strokes could be reduced by 13% and ischemic
heart disease by 10% (Gilbert and Heiser, 2005). Member states have been sup-
ported by the WHO for the development, implementation, and monitoring of
salt reduction strategies (WHO, 2010). In 2014, there were 75 countries with
national salt reduction strategies, more than double that in 2010 (WHO, 2014).
The consumption of meat products may represent up to 30% of the total
dietary sodium intake. Cooked, fermented, and dry-cured meat products
contain high concentrations of sodium that may range from 800 to 1900 mg
Na+/100 g product and an example of typical content in a variety of meat
products is shown in Table 14.1 (USDA, 2017). The reduction of salt in meat
products is not an easy task due to the multiple technological benefits of
salt to the final product quality, especially from sensory and safety point
of views (Ruusunen and Puolanne, 2005; Desmond, 2006; Toldrá and Reig,
2011). There is a relevant influence of salt content on flavor, water activity,
microbial stability, enzyme activity, water holding capacity (WHC), protein
solubility, and texture (Toldrá, 2006a; Weiss et al., 2010; Toldrá and Barat,
2012). The content of salt in the meat products can be reduced through differ-
ent strategies like reducing the amount of added sodium chloride (Andrés et
al., 2004), partially replacing the sodium chloride with other salts (i.e., potas-
sium chloride) having similar technological properties (Sofos, 1989; Aliño
Salt Reduction in Processed Meats 445

TABLE 14.1
Typical Reported Content of Sodium Chloride in Selected Meat Products
Sodium Content Sodium Chloride Content
Meat Product (mg Na+/100 g) (g NaCl/100 g)
Pork cured ham 977 2.49
Bacon 1420 3.62
Bologna 920 2.34
Frankfurter 816 2.08
Cooked ham 900 2.29
Cooked sausage 809 2.06
Salami 1889 4.80
Source: Adapted from USDA. (2017). Food National Database. Nutritional composition of
foods. Available at http://www.ndb.nal.usda.gov/ndb/nutrients.

et al., 2010b; Toldrá and Barat, 2012), replacing salt with other substances that
may mask salt characteristics (Inguglia et al., 2017), or reducing the salt crys-
tal size or changing its shape while maintaining the salty taste (Angus et al.,
2006; Hanley, 2005).
There are some recent reviews on the different strategies for salt reduction
in processed meats (Barat and Toldrá, 2012; Toldrá and Barat, 2009, 2012, 2015,
2016; Inguglia et al., 2017). This chapter deals with and summarizes the avail-
able strategies for salt reduction in the processing of meat products.

14.2 Manufacturing Strategies for Low-Salt Foods

14.2.1 Sodium Reduction
The first and basic strategy to reduce salt content in food is the direct reduc-
tion of the added salt (Samapundo et al., 2010). In the case of meat products
obtained by mixing all the ingredients, the total amount of salt to be added
should be reduced (Aaslyng et al., 2014). In the case of salted products, when
placing the meat product in contact with the salting media, a reduction of
the salting time or salt concentration would be needed (Aliño et al., 2009a).
Nevertheless, the direct reduction of salt content in food is limited by one
or more aspects, depending on the type of meat product: WHC, texture, pro-
tein extraction, or solution, enzyme activity, sensory, or preservation aspects.
The problems related to the direct reduction of salt in food could be
avoided by using total or partial replacement of NaCl by other types of salts.

14.2.2 Sodium Replacement

NaCl can be partially or totally replaced by a nonsodium ingredient to reduce
the sodium content of the meat product. The main replacer is KCl, although
446 Advanced Technologies for Meat Processing, Second Edition

TABLE 14.2
Studies about NaCl Replacement by Other Salts in Meat Products
Replacement Approach References
Replacement of NaCl by a mixture of KCl, MgCl2, and CaCl2 in Aliño et al. (2009b, 2010a)
dry-cured pork loin showed that reductions up to 40%–50% in and Armenteros et al.
NaCl could be achieved without significantly affecting sensory (2009d, 2009c)
and/or safety characteristics of the final product.
The replacement of NaCl by KCl and/or K-lactate in sausages Guàrdia et al. (2008)
showed that increased K-lactate replacement gave increased
pH, sweetness, crumbliness, and pastiness while piquantness,
hardness, cohesiveness, ripened flavor, acid taste, and saltiness
decreased.
Sensory effects were observed at larger replacements than 40% Armenteros et al. (2011)
Na+, especially some bitter and metallic aftertastes, especially and Barat et al. (2013)
when magnesium or calcium chlorides were added.
The replacement of NaCl has also been assayed in Spanish Costa-Corredor et al.
dry-cured ham by replacement with either K-Lactate, or a (2009), Fulladosa et al.
mixture of KCl alone or mixed with MgCl2 and CaCl2, (2009), Aliño et al. (2010c),
obtaining satisfactory results with an approximate 40% Na+ Armenteros et al. (2011),
reduction. and Ripollés et al. (2011)

MgCl2, CaCl2, K-lactate, glycine, or a mixture of them have also been used.
Table 14.2 shows some studies about NaCl replacement in meat products.

14.2.3 Change of Size and Shape of Salt Crystals

Salt is hydrated and dissolved by saliva and then it is distributed through-
out the mouth. So, the salt crystal size and shape may affect both the rate of
hydration and dissolution phenomena (Rama et al., 2013). The reduction of
size of the salt crystal results in an increase of the surface area. In fact, the
particle size of salt crystals when applied to fried potato crisps was reported
to have a strong effect on the delivery rate and concentration of sodium into
the saliva and on the perceived saltiness (Rama et al., 2013). The use of differ-
ent particulate sizes was patented for an instant soup with low salt content.
Different sodium levels and distribution between the particulate phase and
the soluble phase was reported (Busch et al., 2008).

14.2.4 Other Strategies: Masking Agents

Unpleasant tastes (bitter or metallic aftertaste) can appear as a consequence
of NaCl replacement by other salts. The use of masking agents to reduce
those unpleasant tastes is an option. Some masking agents are natural condi-
ments which act in masking the bitter or metallic aftertaste: pepper, onion,
garlic, curry, and so on (Toldrá and Barat, 2012). Table 14.3 shows masking
agents that can be used as reported in the literature.
Salt Reduction in Processed Meats 447

TABLE 14.3
Studies about NaCl Replacement in Meat Products Based on Masking Mixture
Masking Mixture References
Magnesium glutamate and naringin, alone or in combination Imada et al. (2010) and
Yamada (2009)
Combination of carboxymethyl cellulose and carrageenan with Ruusunen et al. (2003)
sodium citrate
Combination of one edible nucleotide monophosphate salt and Zolotov et al. (1997)
another substance (low organic acid, low organic acid salt,
phosphoric acid, phosphate salt, a magnesium salt, sugar, and
burnt sugar)
A cereal flour such as rice flour and a food grade acidulant like Chigurupati (2007)
citric acid
An organic acid with potassium, calcium, and magnesium salts, or Burckel et al. (2003)
potassium bicarbonate containing magnesium, potassium or
calcium carbonate, lactate, citrate, tartrate, succinate, glutamate,
or orthophosphate
Minor amounts of magnesium sulfate and calcium carbonate, with Ryberg (2008)
trace amounts of folic acid and zinc oxide

14.3 Effects of Salt on the Quality and Safety of Meat Products

14.3.1 Physical Properties
The interaction of salt with the protein matrix of processed meats has big
consequences on its physical properties. The influence of salt on the WHC of
proteins is probably the most important technological parameter related to
the presence of salt in foods. Differences in WHC may be obtained, depend-
ing on the type of salt used (Puolanne and Halonen, 2010).
The penetration of NaCl into the meat during the salting process induces
protein–ion interactions and entropic repulsions between the myofibrils
contained in the muscle fibers (Offer and Knight, 1983). At low salt concen-
tration (around 5%), muscle fibers or myofibrils swell laterally and myosin
is extracted. As a consequence of that an increase in the WHC of meat is
observed, and an increase of weight of the salted product occurs (Aliño
et al., 2010a). This is due to the existence of a swelling pressure that affects
the mass transfer processes (Barat et al., 2009). At high salt concentrations,
the phenomenon is the contrary: the competition of Na+ and Cl– ions with
proteins for water molecules lead to the denaturation and precipitation of
proteins, with a maximum effect at saturation concentration (26% w/w).
The mentioned behavior contributes to define the most recommendable
brine concentration to obtain a certain product. For instance, in the case of
marinated meat, low NaCl concentrations are used, so the obtained product
is juicy and a high process yield is achieved. Nevertheless, if a salt-dried
448 Advanced Technologies for Meat Processing, Second Edition

product is desired, dry salt or saturated brine is used, because of the high
water loss of the salted product.
A similar effect on WHC to that observed when using NaCl can be partially
obtained by changing the pH of meat products. Since the minimum WHC
is achieved at a pH value equal to the isoelectric point of proteins (Warriss,
1982), the change in the pH of the meat product (e.g., by using acid like lactic
acid or citric acid [Sawyer et al., 2008; Ke et al., 2009]) allows for an increase in
WHC. This increase is bigger when the difference with the isoelectric point
increases (Hultin et al., 2010). Apart from changing the pH, other substances
can be added to meat products to increase its water binding properties, such
as other salts, modified food starches, phosphates, low-dextrose equivalent
corn syrup solids, maltodextrins, gums, wheat, concentrates, flours, edible
seaweeds (for gel/emulsion meat systems), and whey or soy protein isolates
or protein isolates made from low quality muscle foods (Imer, 2007; Ruu-
sunen et al., 2005; Wang et al., 2009; Schilling et al., 2004; Cofrades et al., 2008).
Physical treatments like high-pressure technology can also contribute to
increase WHC as tested in frankfurters (Crehan et al., 2000) and in beef sau-
sage batters (Sikes et al., 2009).
The presence of salt in meat products also affects protein extraction and
solubility. For instance, an increase in viscosity of meat batter has been
observed due to the presence of salt (Desmond, 2006). Low salt contents also
affect the texture in dry-cured hams (Morales et al., 2007) resulting in soft
hams due to extensive protein breakdown by increased muscle cathepsins
activity (Toldrá, 2007).
The replacement of sodium by other salts, like potassium, calcium, or mag-
nesium chloride, can enhance emulsion stability and/or protein extraction
and solubility (Nayak et al., 1998a,b; Piggot et al., 2000). but can also con-
tribute to an increased lipid oxidation (Zanardi et al., 2010). Meat product
texture can also be improved by using high-pressure treatments (Carballo et
al., 2001; Campus et al., 2008; Totosaus and Pérez-Chabela, 2009).

14.3.2 Chemical Properties: Enzyme Inhibition

Sodium chloride has been reported as an effective inhibitor of the majority
of muscle proteolytic enzymes, especially cathepsins, dipeptidylpeptidases,
and aminopeptidases (Rico et al., 1991; Toldrá and Flores, 1998). Through this
inhibitory effect, the proteolysis phenomena is not so extensive during the
processing of dry-cured ham (Toldrá, 2002, 2006b,c).
The effect of chloride salts used as NaCl replacers like KCl, MgCl2, and
CaCl2 was tested on muscle peptidases (Armenteros et al., 2009b) and a sum-
mary of their effects is shown in Table 14.4. As can be observed in Table 14.4,
KCl exerts, in general, an effect similar to NaCl, but the inhibitory effect of
divalent salts (CaCl2 and MgCl2) is more pronounced in most of the cases.
Cathepsins are quite affected by 0.2 M of NaCl, as reported elsewhere
(Rico et al., 1991), but also by all other types of assayed salts. In the case of
Salt Reduction in Processed Meats 449

TABLE 14.4
Relative Activity of Muscle Enzymes (Expressed as Approximate % Range) in the
Presence of 0.2 M Salt Concentration
Enzyme/Salt NaCl KCl MgCl2 CaCl2
Cathepsin B 40 40 0–10 10–20
Cathepsin B + L 60–70 60–70 40 40
Cathepsin H 40–50 40–50 0–10 30–40
DPP I <100 <100 <100 40–50
DPP II 80 80 60 nd
DPP III 50 50 10 0
DPP IV 100 100 40–50 20–30
Alanyl aminopeptidase 70 70 20–30 0–10
Arginyl aminopeptidase <100 <100 100 0
Leucyl aminopeptidase 80–90 90–100 70 70
Methionyl aminopeptidase 100 100 50 Nd
Source: Adapted from European Food Research and Technology, 229, Armenteros, M. et al., Effect
of sodium, potassium, calcium and magnesium chloride salts on pork muscle prote-
ases, 93–98. Copyright 2009 with permission from Elsevier.
nd, no available data.

exopeptidases, dipeptidylpeptidase III (DPP III) is the most affected by all

types of salts while DPP I, II, and IV remain quite unaffected by 0.2 M of
NaCl or KCl. Alanyl aminopeptidase is quite affected by 0.2 M of NaCl or KCl,
although leucyl and methionyl aminopeptidases remain nearly unaffected at
such concentration. It must be mentioned that arginyl aminopeptidase, also
named aminopeptidase B, has a different behavior because it is a chloride
activated enzyme (activated at low amounts of NaCl), and thus is also acti-
vated at low amounts of NaCl and KCl and at very low amounts of MgCl2.
However, CaCl2 shows a strong inhibitory effect (Armenteros et al., 2009b).
The effect of different salt formulations on the proteolysis and lipolysis phe-
nomena during the processing of dry-cured meats was reported. Most proteo-
lytic enzyme activities from dry-cured loins salted with 50% KCl or with 25%
KCL, 15% CaCl2, and 5% MgCl2 replacement were higher than those salted
traditionally with only NaCl and a larger release of free amino acids was
also observed due to the higher aminopeptidase activity (Armenteros et al.,
2009a,c,d). In the case of dry-cured ham, nonsignificant statistical differences
were reported for proteolysis after different salting treatments (Armenteros
et al., 2012b). On the other hand, there was a slight trend toward a major lipol-
ysis in hams salted with MgCl2 and CaCl2 replacement (Ripollés et al., 2011).

14.3.3 Chemical Properties: Sensory Effects

Salt has a salty taste mainly due to its Na+ cation, so sodium is perceived in
the pores on the tongue via receptor cells that allow the sodium ion to enter
through specific ion channels. Such channels are quite specific and this is
450 Advanced Technologies for Meat Processing, Second Edition

one of the reasons why alternative salts are less perceived (Rama et al., 2013).
It must be taken into account that the complexity of the food matrix such as
in the case of meat products also exerts an influence on the saltiness per-
ception (Drake et al., 2011). Saltiness was reported to be related to fat and
water concentrations based on a cheese matrix. The water content influenced
the sodium release and the fat content influenced saltiness during the chew-
ing process, so that in this way, salt concentration could be reduced without
saltiness alteration through an increase of water and a decrease of fat content
(Phan et al., 2008).
Another relevant effect of salt is that it contributes to a flavor-enhancing
effect in meat products. The most noticeable effect of salt addition to meat
products is the perception of saltiness (Ruusunen and Puolanne, 2005) and
this effect is more perceived in those products having higher fat content
(Matulis et al., 1995) and less perceived in products with more protein con-
tent. In fact, a reduction of 17%–20% of salt in slow dry-fermented sausages
resulted in sausages perceived as less tasty and less aromatic by panelists
even though the inoculation of the yeast Debaryomices hansenii improved
significantly the aroma and taste quality (Corral et al., 2013). In the case of
17%–20% salt reduction and 10%–16% fat reduction, the sausage quality was
affected with an increase in aw and hardness and chewiness values, and a
decrease of staphylococci growth (Corral et al., 2014).
The reduction of salt in meat products affects the sensory quality. For
instance, salt levels below 1.5% were reported to have a negative effect on
consumer acceptability; however, 2.5% salt content was the most accepted
by consumers (Tobin et al., 2012a). Beef patties were also assayed for salt and
fat reduction, and the beef patty containing 40% fat and 1% salt (a 50% salt
reduction in comparison to standard patties) was reported to be the most
acceptable for consumers (Tobin et al., 2012b). Similarly, pork breakfast sau-
sages containing 1.4% and 1.0% salt were reported to be more acceptable to
consumers than other salt levels (Tobin et al., 2013).
The aroma perception of meat products depends on the concentration and
odor threshold of the available volatile compounds as well as how they inter-
act with the food matrix (Guichard, 2002). Fermented and/or long ripened
meat products like dry-fermented sausages and dry-cured hams have a wide
variety of aroma volatile compounds generated as a consequence of their
long processing and the action of muscle and microbial enzymes and further
chemical reactions (Toldrá and Aristoy, 2010; Flores and Hernández, 2007).
The effect of salt replacers was assayed and the salting-out effects of KCl
were compared to those of NaCl by analyzing the headspace concentration of
volatile compounds in water solutions, resulting in similar effects. However,
no salting-out effects were reported for MgCl2 and CaCl2 (Pérez-Juan et al.,
2007). Dry-cured hams produced with formulations containing NaCl alone
or in combination 50/50 with KCl were reported to have significantly higher
amounts of lipid-derived volatiles such as hexanal than hams produced with
formulations including MgCl2 and CaCl2 (Armenteros et al., 2012a).
Salt Reduction in Processed Meats 451

Salt reduction in dry-fermented sausages was reported to increase

lipolysis and also to exert a higher oxidation rate and rancid aroma
generation. The inoculation of D. hansenii yeast in the low-salt dry-fer-
mented sausages resulted in an increased aroma derived from amino
acid degradation (3-methylbutanoic acid and benzothiazole) and ester
activities increasing the perception of fruity and cured aroma notes
from 2-methylpropanoate, 2-methylbutanoate, and 3-methylbutanoate
(Corral et al., 2015). Yeasts were isolated from traditional fermented
sausages and were genetically typed. Those with the ability to pro-
duce aroma compounds were selected and tested in different systems
(culture media, model systems, and dry-fermented sausages) and the
results revealed that such yeast strains with aroma potential could be
used to improve the sensory characteristics of low-salt fermented sau-
sages (Flores et al., 2015).
An example of the effect on sensory properties of dry-cured ham when
sodium chloride is replaced by other chloride salts is shown in Table 14.5. As
can be observed, the sensory attributes remained unaffected by replacement
of 50% of NaCl by KCl. However, dry-cured hams prepared with magnesium
and calcium salts, which are characterized by bitter tastes producing metal-
lic, astringent, and irritative sensations, scored low for all sensory attributes
(Armenteros et al., 2012b).

TABLE 14.5
Sensory Analysis (Paired Comparison Test): Results of the 9 Month Dry-Cured
Hams Samples with Different Salting Formulations at the End of the Ripening Stage
Sensory Traits I II III P-valuea
Aroma 24 24 n.s
33 15 *
34 14 **
Taste 31 17 **
37 11 ***
36 12 ***
Hardness 28 20 n.s
35 13 **
34 14 **
Juiciness 27 21 n.s
32 16 *
30 18 n.s
Source: Reprinted from Meat Science, 90, Armenteros, M. et al., Biochemical and sensory
changes in dry-cured ham salted with partial replacements of NaCl by other chloride
salts, 361–367. Copyright 2012b with permission from Elsevier.
Formulation I, Control, 100% NaCl; Formulation II, 50% NaCl, 50% KCl; Formulation III, 55%
NaCl, 25% KCl, 15% CaCl2, and 5% MgCl2. Results based on the number of assessors
that preferred each batch (total number equal to 48).
*p < .05; **p < .01; and ***p < .001.
452 Advanced Technologies for Meat Processing, Second Edition

The interaction of volatile compounds with the food matrix is also very
relevant for the aroma perception as discussed earlier. In this way, it was
reported that the binding ability of sarcoplasmic proteins to some key vola-
tile compounds (branched aldehydes, hexanal, and methional) was signifi-
cantly reduced by both NaCl and KCl. No effect was observed for other key
volatile compounds like octanal and 2-pentanone (Pérez-Juan et al., 2006).
The effects were almost negligible for MgCl2 and CaCl2. Only the branched
aldehydes were released in the presence of MgCl2 at 1.0 ionic strength (Pérez-
Juan et al., 2006). Similar effects were reported for for the interaction of key
volatile compounds with some isolated peptides (Martínez-Arellano et al.,
2016). In such a work, peptide extracts from dry-cured ham were defatted
and deodorized and then used to study the binding effect of each peptide
extract to key volatile compounds. Approximately 20% and 30% interaction
was observed for 2-methylpropanal, hexanal, and ethyl acetate and the high-
est interaction was reported for trimethylpyrazine; there was no binding
effect on 2-methylbutanal (Martínez-Arellano et al., 2016).
In any case, the reduction in NaCl by 16% resulted in a lower acceptance
of aroma, taste, juiciness, and overall quality. The use of KCl as an NaCl
replacer resulted in a similar acceptance but the aroma perception was not
improved (Corral et al., 2013).

14.3.4 Preservation Properties

The first use of salt in food was probably because of its preservation action
(Sofos, 1984). The reduction of microbial spoilage of foods is mainly due to
the reduction of the water activity because of the interactions of ions with
water present in food (Desmond, 2006). Usually a drying process follows the
salting step, implying a further reduction of water activity.
Nevertheless, the aw values of processed meats are lower than that needed
to achieve a complete inhibition. It is important to note that under those cir-
cumstances, a combination of preservation factors contribute to extend the
shelf life of meat products, such as pH, storage temperature, vacuum or con-
trolled atmosphere packaging, and so on (Leistner, 2000).
The reduction of salt content in processed meats has a direct consequence
on its stability, and as a consequence on safety aspects, due to the increase
in aw values (for the same moisture of the meat products). In those cases, if
a lower aw value needs to be achieved, further drying is needed. Neverthe-
less, a higher decrease of moisture content implies an increase in the NaCl
concentration, which would be contrary to the final objective of reducing the
salt content.
Although some authors mention a slight effect of NaCl partial replacement
on the growth certain microorganisms (Raccach and Hennigen, 1997), most
studies indicate that no significant differences are observed, when compared
with products having the same water activity (Blesa et al., 2008).
Salt Reduction in Processed Meats 453

14.4 Current Regulations on Salt Reduction and Labeling

Terms like salt reduction or low salt content in foods and drinks have been
the object of regulation in many countries in order to clarify the market and
avoid confusion to the consumers. The European Union issued Regulation
EC 1924/2006 on nutrition and health claims made on foods (EC, 2006). This
regulation describes the terms that may be used in the claims of foods, meats
in our case, with low sodium/salt content and the requirements needed for
each claim. The following claims can be used depending on the sodium/salt
content:

Low in Sodium/Salt: Content of sodium, or the equivalent value for

salt, less than 0.12 g/100 g.
Very Low in Sodium/Salt: Content of sodium, or the equivalent value
for salt, less than 0.04 g/100 g.
Sodium/Salt-Free: Content of sodium, or the equivalent value for salt,
less than 0.005 g/100 g.
Reduced Sodium/Salt: At least 25% of sodium, or the equivalent value
for salt, less than in the original meat product.

The Nutrition Facts Label (FDA, 2013) in the United States lists the Percent
Daily Value (% DV) of sodium in one serving of a food, which is based on
100% of the recommended amount of sodium, which is less than 2400 mg/
day.
The FDA Food Labeling Guide (FDA, 2016) describes the terms that may be
used in the claims that can be labeled in the package. The following claims
can be used depending on the sodium/salt content:

Salt/Sodium Free: For less than 5 mg of sodium per serving.

Very Low Sodium: For 35 mg of sodium or less per serving.
Low Sodium: For 140 mg of sodium or less per serving.
Reduced Sodium: For at least 25% less sodium than in the original
product.
Light in Sodium or Lightly Salted: For at least 50% less sodium than
the regular product.
No Salt Added or Unsalted: When no salt is added during processing,
but this does not guarantee that the product is sodium free. It would
be necessary to check the Nutrition Facts Label to be sure about its
sodium content.

If the meat product exceeds 480 mg of sodium per serving but other health
claims are made (e.g., low in fat), then a disclosure statement is required.
454 Advanced Technologies for Meat Processing, Second Edition

14.5 Conclusions
The consumption of meat products may represent up to 30% of the total
dietary sodium intake, and there is a clear trend toward its reduction.
Several approaches for salt reduction have been reported in this chapter.
The main challenges are related to the technological properties of salt like
taste, water retention, protein solubilization, and antimicrobial activity
that are difficult to replace. However, the unpleasant taste derived from
salt replacers is perhaps the most relevant challenge. New ingredients,
processes, and technologies are expected to be developed in the near
future.

References
Aaslyng, M. D., Vestergaard, C. and Koch, A. G. (2014). The effect of salt reduction
on sensory quality and microbial growth in hotdog sausages, bacon, ham and
salami. Meat Science, 96, 47–55.
Aburto, N. J., Ziolkovska, A., Hooper, L., Elliott, P., Cappuccio, F. P. and Meerpohl,
J. J. (2013). Effect of lower sodium intake on health: Systematic review and meta-
analyses. British Medical Journal, 346, f1326.
Aliño, M., Grau, R., Baigts, D. and Barat, J. M. (2009a). Influence of sodium replace-
ment on the salting kinetics of pork loin. Journal of Food Engineering, 95, 551–557.
Aliño, M., Grau, R., Toldrá, F. and Barat, J. M. (2010a). Physicochemical changes in
dry-cured hams salted with potassium, calcium and magnesium chloride as a
partial replacement for sodium chloride. Meat Science, 86, 331–336.
Aliño, M., Grau, R., Toldrá, F., Blesa, E., Pagán, M. J. and Barat, J. M. (2009b). Influence
of sodium replacement on physicochemical properties of dry-cured loin. Meat
Science, 83, 423–430.
Aliño, M., Grau, R., Toldrá, F., Blesa, E., Pagán, M. J. and Barat, J. M. (2010b). Physi-
cochemical properties and microbiology of dry-cured loins obtained by partial
sodium replacement with potassium, calcium and magnesium. Meat Science, 85,
580–588.
Aliño, M., Grau, R., Toldrá, F., Blesa, E., Pagán, M. J. and Barat, J. M. (2010c). Physi-
cochemical properties and microbiology of dry-cured loins obtained by partial
sodium replacement with potassium, calcium and magnesium. Meat Science, 85,
580–588.
Andrés, A. I., Cava, R., Ventanas, J., Thovar, V. and Ruiz, J. (2004). Sensory character-
istics of Iberian ham: Influence of salt content and processing conditions. Meat
Science, 68, 45–51.
Angus, F., Phelps, T., Clegg, S., Narain, C., Den Ridder, C. and Kilcast, D. (2006). Salt
in Processed Foods: Collaborative Research Project. Leatherhead: Leatherhead Food
International.
Appel, L. J. and Anderson, C. A. M. (2010). Compelling evidence for public health
action to reduce salt intake. New England Journal of Medicine, 362, 650–652.
Salt Reduction in Processed Meats 455

Armenteros, M., Aristoy, M. C., Barat, J. M. and Toldrá, F. (2009a). Biochemical and
sensory properties of dry-cured loins as affected by partial replacement of
sodium by potassium, calcium and magnesium. Journal of Agricultural and Food
Chemistry, 57, 9699–9705.
Armenteros, M., Aristoy, M. C. and Toldrá, F. (2009b). Effect of sodium, potassium,
calcium and magnesium chloride salts on pork muscle proteases. European Food
Research and Technology, 229, 93–98.
Armenteros, M., Aristoy, M. C., Barat, J. M. and Toldrá, F. (2009c). Biochemical and
sensory properties of dry-cured loins as affected by partial replacement of
sodium by potassium, calcium and magnesium. Journal of Agricultural and Food
Chemistry, 57, 9699–9705.
Armenteros, M., Aristoy, M. C., Barat, J. M. and Toldrá, F. (2011). Biochemical and
sensory changes in dry-cured ham salted with partial replacement of sodium
by a mixture of potassium, calcium and magnesium. Meat Science, 90, 361–367.
Armenteros, M., Aristoy, M. C., Barat, J. M. and Toldrá, F. (2009d). Biochemical
changes in dry-cured loins salted with partial replacements of NaCl by KCl.
Food Chemistry, 117, 627–633.
Armenteros, M., Toldrá, F., Aristoy, M. C., Ventanas, J. and Estevez, M. (2012a). Effect
of the partial replacement of sodium chloride by other salts on the formation of
volatile compounds during ripening of dry-cured ham. Journal of Agricultural
and Food Chemistry, 60, 7607–7615.
Armenteros, M., Aristoy, M. C., Barat, J. M. and Toldrá, F. (2012b). Biochemical and
sensory changes in dry-cured ham salted with partial replacements of NaCl by
other chloride salts. Meat Science, 90, 361–367.
Barat, J. M., Aliño, M., Fuentes, A., Grau, R. and Romero, J. B. (2009). Measurement of
swelling pressure in pork meat brining. Journal of Food Engineering, 93, 455–459.
Barat, J. M., Pérez-Esteve, E., Aristoy, M. C. and Toldrá, F. (2013). Partial replacement
of sodium in meat and fish products by using magnesium salts. Plant and Soil,
368, 179–188.
Blesa, E., Aliño, M., Barat, J. M., Grau, R., Toldrá, F. and Pagán, M. J. (2008). Microbiology
and physico-chemical changes of dry-cured ham during the post-salting stage as
affected by partial replacement of NaCl by other salts. Meat Science, 78, 135–142.
Burckel, A., Martin, F. and Leclerc, C. (2003). Food supplement composition and use
thereof. Patent WO03053163.
Busch, J. L., Keulemans, J., Van Den, O. G. J. and Reckweg, F. (2008). Food composi-
tion. Patent WO2008074606.
Campus, M., Flores, M., Martinez, A. and Toldrá, F. (2008). Effect of high pressure
treatment on colour, microbial and chemical characteristics of dry cured loin.
Meat Science, 80, 1174–1181.
Carballo, J., Cofrades, S., Fernández-Martín, F. and Jiménez-Colmenero, F. (2001).
Pressure-assisted gelation of chemically modified poultry meat batters. Food
Chemistry, 75, 203–209.
Chigurupati, S. R. (2007). Low-sodium salt composition. Patent WO2007032941.
Cofrades, S., López-López, I., Solas, M. T., Bravo, L. and Jiménez-Colmenero, F. (2008).
Influence of different types and proportions of added edible seaweeds on char-
acteristics of low-saltgel/emulsion meat systems. Meat Science, 79, 767–776.
Corral, S., Salvador, A. and Flores, M. (2013). Salt reduction in slow fermented sau-
sages affects the generation of aroma active compounds. Meat Science, 93,
776–785.
456 Advanced Technologies for Meat Processing, Second Edition

Corral, S., Salvador, A., Belloch, C. and Flores, M. (2014). Effect of fat and salt reduc-
tion on the sensory quality of slow fermented sausages inoculated with Debaryo-
myces hansenii yeast. Food Control, 45, 1–7.
Corral, S., Salvador, A., Belloch, C. and Flores, M. (2015). Improvement the aroma of
reduced fat and salt fermented sausages by Debaryomyces hansenii inoculation.
Food Control, 47, 526–535.
Costa-Corredor, A., Serra, X., Arnau, J. and Gou, P. (2009). Reduction of NaCl con-
tent in restructured dry-cured hams: Post-resting temperature and drying level
effects on physicochemical and sensory parameters. Meat Science, 83, 390–397.
Crehan, M., Troy, D. J. and Buckley, D. J. (2000). Effects of salt level and high hydro-
static pressure processing on frankfurters formulated with 1.5 and 2.5% salt.
Meat Science, 55(1), 123–130.
Demeyer, D., Honikel, K. and De Smet, S. (2008). The World Cancer Research Fund report
2007: A challenge for the meat processing industry. Meat Science, 80, 953–959.
Desmond, E. (2006). Reducing salt: A challenge for the meat industry. Meat Science,
74, 188–196.
Doyle, M. E. and Glass, K. A. (2010). Sodium reduction and its effect on food safety,
food quality, and human health. Comprehensive Reviews in Food Science and Food
Safety, 9, 44–56.
Drake, S. L., Lopetcharat, K. and Drake, M. A. (2011). Salty taste in dairy foods: Can
we reduce the salt? Journal of Dairy Science, 94, 636–645.
EC (2006). Regulation (EC) No 1924/2006 of the European Parliament and of the
Council of 20 December 2006 on nutrition and health claims made on foods.
Official Journal of the European Union, 30th December 2006, L404, 9–25.
FDA (2013). Guidance for industries: A food labelling guide. 1–129. Available at
http://www.fda.gov/FoodLabelingGuide
FDA (2016). Changes to the nutrition facts label. Available at http://www.fda.
gov/Food/GuidanceRegulation/GuidanceDocumentsRegulatoryInforma-
tion/LabelingNutrition
Flores, M. and Hernández, D. (2007). Optimization of multiple headspace dolid-phase
microextraction for the quantification of volatile compounds in dry fermented
sausages. Journal of Agricultural and Food Chemistry, 55, 8688–8695.
Flores, M., Corral, S., Cano-García, L., Salvador, A. and Belloch, C. (2015). Yeast strains
as potential aroma enhancers in dry fermented sausages. International Journal of
Food Microbiology, 212, 16–24.
Fulladosa, E., Serra, X., Gou, P. and Arnau, J. (2009). Effects of potassium lactate and
high pressure on transglutaminase restructured dry-cured hams with reduced
salt content. Meat Science, 82, 213–218.
Gilbert, P. A. and Heiser, G. (2005). Salt and health: The CASH and BPR perspective.
British Foundation Nutrition Bulletin, 30, 62–69.
Guàrdia, M. D., Guerrero, L., Gelabert, J., Gou, P. and Arnau, J. (2008). Sensory charac-
terisation and consumer acceptability of small calibre fermented sausages with
50% substitution of NaCl by mixtures of KCl and potassium lactate. Meat Sci-
ence, 80, 1225–1230.
Guichard, E. (2002) Interactions between flavor compounds and food ingredients and
their influence on flavor perception. Food Research International, 18, 49-70.
Hanley, B. (2005). Salt, sugar and fat reduction in foods—Technological challenges.
Presentation Given at Fat, Sugar and Salt: A Question of Balance Event. Dublin:
Leatherhead Food International.
Salt Reduction in Processed Meats 457

He, F. J. and Macgregor, G. A. (2003). How far should salt intake be reduced? Hyper-
tension, 42, 1093–1099.
Hultin, H. O., Ke, S., Huang, Y., Imer, S. and Vareltzis, P. (2010). Process for improv-
ing water holding capacity and tenderness in cooked protein food products.
USPTO Applicaton No: #20100009048—Class: 426281 (USPTO).
Imada, T., Ishida, M., Kono, R., Arai, H., So, R. and Kimura, E. (2010). Salty taste
enhancer containing magnesium glutamate. Patent JP 2010011807A.
Imer, S. (2007). Increasing water holding capacity of muscle foods: Protein isolate
effect. Electronic doctoral dissertations for UMass Amherst. Paper AAI3254954.
http://scholarworks.umass.edu/dissertations/AAI3254954
Inguglia, E. S., Zhang, Z., Tiwari, B. K., Kerry, J. P. and Burgess, C. M. (2017). Salt
reduction strategies in processed meat products—A review. Trends in Food Sci-
ence and Technology, 59, 70–78.
Ke, S., Huang, Y., Decker, E. A. and Hultin, H. O. (2009). Impact of citric acid on the
tenderness, microstructure and oxidative stability of beef muscle. Meat Science,
82(1), 113–118.
Leistner, L. (2000). Basic aspects of food preservation by hurdle technology. Interna-
tional Journal of Food Microbiology, 55(1–3), 181–186.
Lim, S. S., Vos, T., Flaxman, A. D. et al. (2012). A comparative risk assessment of bur-
den of disease and injury attributable to 67 risk factors and risk factor clusters
in 21 regions, 1990–2010: A systematic analysis for the global burden of disease
study2010. Lancet, 380, 2224–2260.
Martínez-Arellano, I., Flores, M. and Toldrá, F. (2016). Ability of peptide extracts
obtained at different dry cured ham ripening stages to bind aroma compounds.
Food Chemistry, 196, 9–16.
Matulis, R. J., McKeith, F. K., Sutherland, J. W. and Brewer, M. S. (1995). Sensory char-
acteristics of frankfurters as affected by fat, salt and pH. Journal of Food Science,
60, 42–47.
Morales, R., Serra, X., Guerrero, L. and Gou, P. (2007). Softness in dry-cured porcine
biceps femoris muscles in relation to meat quality characteristics and processing
conditions. Meat Science, 77, 662–669.
Mozaffarian, D., Fahimi, S., Singh, G. M. et al. (2014). Global sodium consumption
and death from cardiovascular causes. New England Journal of Medicine, 371,
624–34.
Nayak, R., Kenney, P. B., Slider, S., Head, M. K. and Killefer, J. (1998a). Cook yield,
texture and gel ultrastructure of model beef batters as affected by low levels of
calcium, magnesium and zinc chloride. Journal of Food Science, 63, 945–950.
Nayak, R., Kenney, P. B., Slider, S., Head, M. K. and Killefer, J. (1998b). Myofibrillar
protein solubility affected by low levels of calcium, magnesium and zinc chlo-
ride. Journal of Food Science, 63, 951–954.
Offer, G. and Trinick, J. (1983). On the mechanism of water holding in meat: The
swelling and shrinking of myofibrils. Meat Science, 8, 245–281.
Pérez-Juan, M., Flores, M. and Toldrá, F. (2006). Model studies on the efficacy of
protein homogenates from raw pork muscle and dry-cured ham in bind-
ing selected flavor compounds. Journal of Agricultural and Food Chemistry,
54, 4802–4808.
Pérez-Juan, M., Flores, M. and Toldrá, F. (2007). Effect of ionic strength of different
salts on the binding of volatile compounds to sarcoplasmic protein homoge-
nates in model systems. Food Research International, 40, 687–693.
458 Advanced Technologies for Meat Processing, Second Edition

Phan, V. A., Yvena, C., Lawrence, G., Chabanet, C., Reparet, J. M. and Salles, C. (2008).
In vivo sodium release related to salty perception during eating model cheeses
of different textures. International Dairy Journal, 18, 956–963.
Piggot, R. S., Kenney, P. B., Slider, S. and Head, M. K. (2000). Formulation protocol
and dicationic salts affect protein functionality on model systems beef batters.
Journal of Food Science, 65, 1151–1154.
Puolanne, E. and Halonen, M. (2010). Theoretical aspects of water-holding in meat.
Meat Science, 86, 151–165.
Raccach, M. and Henningen, E. C. (1997). The effect of chloride salts on Yersinia entero-
colitica in meat. Food Microbiology, 14, 431–438.
Rama, R., Chiu, N., Da Silva, M. C., Hewson, L., Hort, J. and Fisk, I. D. (2013). Impact
of salt crystal size on in-mouth delivery of sodium and saltiness perception
from snack foods. Journal of Texture Studies, 44, 338–345.
Rico, E., Flores, J. and Toldrá, F. (1991). Effect of dry-curing process parameters
on pork muscle cathepsin B, H and L activity. Z Lebensm Unters Forsch, 193,
541–544.
Ripollés, S., Campagnol, P. C. B., Armenteros, M., Aristoy, M. C. and Toldrá, F. (2011).
Influence of partial replacement of NaCl for KCl, CaCl2 and MgCl2 in lipolysis
and lipid oxidation on dry-cured ham. Meat Science, 89, 58–64.
Ruusunen, M. and Puolanne, E. (2005). Reducing sodium intake from meat products.
Meat Science, 70, 531–541.
Ruusunen, M., Vainionpää, J., Lyly, M. et al. (2005). Reducing the sodium content in
meat products: The effect of the formulation in low-sodium ground meat pat-
ties. Meat Science, 69(1), 53–60.
Ruusunen, M., Vainionpää, J., Puolanne, E., Lyly, M., Lahteenmaki, L. and Niemisto,
M. (2003). Effect of sodium citrate, carboxymethyl cellulose and carrageenan
levels on quality characteristics of low-salt and low-fat bologna type sausages.
Meat Science, 64, 371–381.
Ryberg, P. (2008). A salt mixture with low sodium content for human consumption.
Patent WO08024050.
Samapundo, S., Ampofo-Asiama, J., Anthierens, T. et al. (2010). Influence of NaCl
reduction and replacement on the growth of Lactobacillus sakei in broth,
cooked ham and white sauce. International Journal of Food Microbiology, 143(1–
2), 9–16.
Sawyer, J. T., Apple, J. K. and Johnson, Z. B. (2008). The impact of lactic acid concen-
tration and sodium chloride on pH, water-holding capacity, and cooked color of
injection-enhanced dark-cutting beef. Meat Science, 79, 317–325.
Schilling, M. W., Marriott, N. G., Acton, J. C., Anderson-Cook, C., Alvarado, C.Z. and
Wang, H. (2004). Utilization of response surface modeling to evaluate the effects
of non-meat adjuncts and combinations of PSE and RFN pork on water holding
capacity and cooked color in the production of boneless cured pork. Meat Sci-
ence, 66, 371–381.
Sikes, A. L., Tobin, A. B. and Tume, R. K. (2009). Use of high pressure to reduce cook
loss and improve texture of low-salt beef sausage batters. Innovative Food Science
and Emerging Technologies, 10, 405–412.
Sofos, J. N. (1984). Antimicrobial effects of sodium and other ions in foods: A review.
Journal of Food Safety, 6, 45–78.
Sofos, J. N. (1989). Phosphates in meat products. In: Thorne, S., (ed.) Developments in
Food Preservation—5. New York, NY: Elsevier Applied Science, pp. 207–252.
Salt Reduction in Processed Meats 459

Tobin, B. D., O’Sullivan, M. G., Hamill, R. M. and Kerry, J. P. (2012a). Effect of varying
salt and fat levels on the sensory and physiochemical quality of frankfurters.
Meat Science, 92, 659–666.
Tobin, B. D., O’Sullivan, M. G., Hamill, R. M. and Kerry, J. P. (2012b). Effect of vary-
ing salt and fat levels on the sensory quality of beef patties. Meat Science, 91,
460–465.
Tobin, B. D., O’Sullivan, M. G., Hamill, R. M. and Kerry, J. P. (2013). The impact of salt
and fat level variation on the physiochemical properties and sensory quality of
pork breakfast sausages. Meat Science, 93, 145–152.
Toldrá, F. (2002). Dry-Cured Meat Products. Ames, IA: Wiley-Blackwell.
Toldrá, F. (2006a). Dry-cured ham. In: Hui, Y. H., Castell-Perez, E., Cunha, L. M. et al.
(eds.) Handbook of Food Science, Technology and Engineering, vol. 4. Boca Raton, FL:
CRC Press, pp. 164-1–164-11.
Toldrá, F. (2006b). Meat: Chemistry and biochemistry. In: Hui, Y. H, Culbertson, J. D.,
Duncan, S. et al. (eds.) Handbook of Food Science, Technology and Engineering, vol.
1. Boca Raton, FL: CRC Press, pp. 28-1–28-18. ISBN 1-57444-551–0.
Toldrá, F. (2006c). Biochemical proteolysis basis for improved processing of dry-cured
meats. In: Nollet, L. M. L. and Toldrá, Y. F. (eds.) Advanced Technologies for Meat
Processing. Boca Raton, FL: CRC Press, pp. 329–351.
Toldrá, F. (2007). Biochemistry of muscle and fat. In: Toldrá, F., Hui, Y. H., Astiasarán,
I. et al. (eds.) Handbook of Fermented Meat and Poultry. Ames, IA: Blackwell Pub-
lishing, pp. 51–58.
Toldrá, F. and Aristoy, M. C. (2010). Dry-cured ham. In: Toldrá, F. (ed.) Handbook of
Meat Processing. Ames, IA: Wiley-Blackwell, pp. 351–362.
Toldrá, F. and Barat, J. M. (2009). Recent patents for sodium reduction in foods. Recent
Patens on Food, Nutrition and Agriculture, 1, 80–86.
Toldrá, F. and Barat, J. M. (2012). Strategies for salt reduction in foods. Recent Patents
in Food, Nutrition and Agriculture, 4, 19–25.
Toldrá, F. and Barat, J. M. (2015). Low-sodium products. In: Toldrá, F., Hui, Y. H.,
Astiasarán, I., Sebranek, J. G. and Talon, R. (eds.) Handbook of Fermented Meat and
Poultry (2nd Ed.). Chichester, West Sussex: Wiley-Blackwell, pp. 251–257.
Toldrá, F. and Barat, J. M. (2016). Low-salt foods: Types and manufacture. In: Cabal-
lero, B., Finglas, P. M. and Toldrá, F. (eds.) Encyclopedia of Food and Health, vol. 3.
London: Academic Press/Elsevier Science Ltd, pp. 756–758.
Toldrá, F. and Flores, M. (1998). The role of muscle proteases and lipases in flavor
development during the processing of dry-cured ham. Critical Reviews in Food
Science and Nutrition, 38, 331–352.
Toldrá, F. and Reig, M. (2011). Innovations for healthier processed meats. Trends in
Food Science and Technology, 22, 517–522.
Totosaus, A. and Pérez-Chabela, M. L. (2009). Textural properties and microstructure
of low-fat and sodium-reduced meatbatters formulated with gellan gum and
dicationic salts. LWT—Food Science and Technology, 42, 563–569.
USDA. (2017). Food National Database. Nutritional composition of foods. Available
at http://www.ndb.nal.usda.gov/ndb/nutrients
Wang, P., Xu, X.-L. and Zhou, G. H. (2009). Effects of meat and phosphate level on
water-holding capacity and texture of emulsion-type sausage during storage.
Agricultural Sciences in China, 8, 1475–1481.
Warriss, P. D. (1982). The relationship between pH and drip in pig muscle. Journal of
Food Technology, 17, 573–578.
460 Advanced Technologies for Meat Processing, Second Edition

Weiss, J., Gibis, M., Schuh, V. and Salminen, H. (2010). Advances in ingredient and
processing systems for meat and meat products. Meat Science, 86, 196–213.
Whitworth, J. A. (2003). World Health Organization/International Society of Hyper-
tension statement on management of hypertension. Journal of Hypertension, 21,
1983–1992.
WHO/FAO. (2003). Diet, Nutrition and the Prevention of Chronic Diseases. WHO
Technical Report Series 916. Geneva: World Health Organization/Food and
Agriculture Organisation. Available at http://www.who.int/dietphysicalactiv-
ity/publications/trs916/en/
WHO. (2007). Prevention of Cardiovascular Disease: Pocket Guidelines for Assessment and
Management of Cardiovascular Risk. Geneva: World Health Organization. Avail-
able at http://www.who.int/cardiovascular_diseases/guidelines/Full%20
text.pdf
WHO. (2010). Creating an Enabling Environment for Population-Based Salt Reduction
Strategies. Geneva: World Health Organization. Available at http://whqlibdoc.
who.int/publications/2010/9789241500777_eng.pdf
WHO/FSA. (2010). Creating an Enabling Environment for Population-Based Salt Reduc-
tion Strategies: Report of a Joint Technical Meeting Held by WHO and the Food Stan-
dards Agency, United Kingdom. Geneva: World Health Organization. Available at
http://whqlibdoc.who.int/publications/2010/9789241500777_eng.pdf
WHO. (2011). Global Status Report on Noncommunicable Diseases 2010. Available at
http://www.who.int/nmh/publications/ncd_report_full_en.pdf
WHO (2014). Global Status Report on Noncommunicable Diseases 2014. Available at
http://www.who.int/nmh/publications/ncd-status-report-2014/en/
Yamada, T. (2009). Drink, and method for reducing bitter taste. Patent JP 2009279013A.
Zanardi, E., Ghidini, S., Conter, M. and Ianieri, A. (2010). Mineral composition of Ital-
ian salami and effect of NaCl partial replacement on compositional, physico-
chemical and sensory parameters. Meat Science, 86, 742–747.
Zolotov, S., Braverman, O., Genis, M. and Biale, D. (1997). Low sodium edible salt
mixture. Patent EP809942.
15
Fat Reduction in Processed Meats

Marise A. Rodrigues Pollonio

CONTENTS
15.1 Introduction ................................................................................................ 462
15.2 Implications of Fat Consumption on Health.......................................... 462
15.2.1 Saturated Fatty Acids .................................................................... 463
15.2.2 Mono and Polyunsaturated Fatty Acids.....................................464
15.2.3 Meat Products as a Fat Source...................................................... 465
15.3 The Role of Fat in Processed Meats ......................................................... 466
15.3.1 Texture ............................................................................................. 466
15.3.2 Flavor and Taste ............................................................................. 467
15.3.3 Physicochemical Properties.......................................................... 467
15.3.4 Perception of Satiety ...................................................................... 469
15.4 Strategies for Reducing Fat in Meat Products........................................ 469
15.4.1 Simple Fat Reduction and Selection of Lean Meat Cuts ........... 470
15.4.2 Use of Fat Replacers ....................................................................... 471
15.4.2.1 Gums ................................................................................. 471
15.4.2.2 Starch Derivatives ........................................................... 472
15.4.2.3 Protein-Based Fat Replacers .......................................... 473
15.4.3 Use of Fibers as Functional Ingredients and Fat Replacers ..... 474
15.4.3.1 Insoluble Fibers ............................................................... 474
15.4.3.2 Soluble Fibers ................................................................... 478
15.4.4 Lipid Reformulation Using Vegetable Oils ................................484
15.4.5 Use of Structured Lipids ............................................................... 488
15.5 Challenges of Fat Reduction in Different Meat Products .................... 492
15.5.1 Emulsified Meat Products ............................................................ 492
15.5.2 Fermented Meat Products............................................................. 493
15.5.3 Restructured Injected and Marinated Meat Products.............. 494
15.5.4 Restructured and Breaded Meat Products ................................. 495
15.6 Final Considerations.................................................................................. 496
References............................................................................................................. 496

461
462 Advanced Technologies for Meat Processing, Second Edition

15.1 Introduction
Fat is a macronutrient in foods responsible for various functions in the
human body including energy supply (9 kcal/g); it also serves as a source
of fat-soluble vitamins (A, D, E, and K) and essential fatty acids (linoleic and
linolenic), and is a precursor of important hormones that participate in differ-
ent biochemical and metabolic pathways (Pearson and Gillett, 1996; Varnam
and Sutherland, 1995). However, the association between high-fat intake and
increase in the incidence of chronic diseases such as obesity, hypertension,
certain types of cancer, hypercholesterolemia, and cardiovascular and cere-
bral accidents, among others (Rothstein, 2006; Zhang et al., 2010) requires a
strict control of dietary fat intake.
Meat and processed meat products are generally recognized as good
sources of proteins with high biological value, B vitamins, minerals and trace
elements, and bioactive compounds (Biesalski, 2005; Olmedilla-Alonso et al.,
2013). However, these products are poor sources of fiber and contain high-
sodium levels, various additives, and fat, particularly cholesterol and satu-
rated fat, which make their regular consumption quite criticized (Whitney
and Rolfes, 2002).
In this scenario, the reformulation of processed meat products aims at
reducing, suppressing, and/or incorporating ingredients that promote
healthier appeals to consumers, without losing the identity and quality
standards (Arihara, 2006). In the search for healthier meat products, the
reduction of total fat and saturated fat and the reformulation of the lipid
profile have been widely studied, as well as fat substitutes with adequate
technological and sensory performance and nutritional benefits that are
safe and allowed by regulatory agencies.
This chapter addresses the principles for reducing fat in different pro-
cessed meat products, describing the difficulties and possible strategies con-
sidering the sensory acceptance, overall stability, and safe consumption of
the reformulated products.

15.2 Implications of Fat Consumption on Health

Although the pathogenesis of diseases associated with excess fat intakes,
such as obesity, hypertension, and cardiovascular diseases, has not yet
been fully elucidated, several studies have shown that dietary fat may be
an important modulator of morbidity and mortality (Vessby, 2003; Rubio-
Rodríguez et al., 2010).
However, the simple reduction of total fat is not enough to reduce the risk
of these pathologies, since this complex class of macromolecules, including
saturated, mono, polyunsaturated fatty acids (PUFAs), and cholesterol, is
Fat Reduction in Processed Meats 463

subdivided into several groups of compounds with specific and diversified

physiological properties. Several authors have reported that the balanced
intake of these components is more relevant than the simple suppression
of total fat (Lamarche and Couture, 2014. This reference is listed in the
References Recent studies have strongly criticized fat replacement by high
levels of carbohydrates, responsible for the occurrence of other pathologies,
thus various scientific authorities have established nutritional recommenda-
tions to guide the intake of this class of compounds. According to many
studies, only 15%–35% of total calories should come from dietary fat; the
intake of saturated fatty acids (SFAs) should not exceed 10%, with 6%–11%
coming from PUFAs, 10%–15% from monounsaturated fatty acids (MUFAs),
and less than 1% from trans-fatty acids. It is also recommended that choles-
terol intake be less than 300 mg per day (Jiménez-Colmenero, 1996; Cengiz
and Gokoglu, 2005; WHO, 2003). In this context, the reduction and/or refor-
mulation of processed products with high fat content that are rich in SFAs
becomes the target of many studies.

15.2.1 Saturated Fatty Acids

There is no absolute consensus on the role of total fat and saturated fat in
increasing the risk of chronic diseases, especially cardiovascular diseases;
however, all guidelines from different countries and health agencies are
unanimous in recommending a control in the dietary SFAs intake. The U.S.
Department of Agriculture (USDA) has suggested a dietary SFA intake of
less than 7% of daily calories (Eckel et al., 2014), while European Committees
have proposed that the recommended SFAs and trans-fatty acids intake
should be as low as possible (EFSA Panel and Dietetic Products, 2010), and
as previously described, the WHO indicates that fatty acids intake should be
less than 10% of daily calories.
This lipid fraction, which mainly comprises triacylglycerols of animal
origin, is known to increase levels of total cholesterol and low-density lipo-
protein (LDL) cholesterol (Valsta et al., 2005). Palmitic (C16:0) and myristic
(C14:0) fatty acids are among the main SFAs that contribute to the increase
in cholesterol levels (Spady and Dietschy, 1985). Studies have suggested that
palmitic acid increases the plasma total cholesterol levels to a greater extent
when compared to other unsaturated fatty acids and carbohydrates (Mattson
and Grundy, 1985; Grundy and Vega, 1988). Some authors have also reported
that palmitic acid is also capable of raising the risk of obesity and insulin
resistance (Kien et al., 2005).
According to Schaefer (2002), although myristic acid is more hypercholes-
terolemic than palmitic acid, it is less relevant once it is present in most diets
at lower concentrations when compared to palmitic acid (Grundy, 1994). With
regard to the hypercholesterolemic role of lauric acid (C12:0), contradictory
data are found in the literature (Pronczuk et al., 1995; Denke and Grundy,
1992) and in vivo studies have shown that stearic acid (C:18:0) is partially
464 Advanced Technologies for Meat Processing, Second Edition

converted to oleic acid and has not been shown to raise plasma cholesterol
levels (Bonanome et al., 1992; Bonanome and Grundy, 1988).
Whereas most of the fat from meat products comes from fatty cuts or back
fat rich in SFAs, the reduction of saturated fat in processed meat products is
an urgent challenge for the meat processing industry.

15.2.2 Mono and Polyunsaturated Fatty Acids

Along with the reduction of saturated fat intake, the reformulation of the
lipid profile of processed foods has stood out as one of the main strategies
to produce healthier products, once the MUFAs and PUFAs have specific
functions in the human diet and the balanced intake results in physiological
benefits.
Oleic acid (C18:1 ω -9) is the main fatty acid present in the diet, corre-
sponding to approximately 45% of total fatty acids that make up most of the
processed meat products. According to Keys et al. (1965) and Mattson and
Grundy (1985), total plasma cholesterol levels decrease around 2.7 mg/dL for
each 1% calories from diet when oleic acid (C18:1) is ingested in place of SFA,
exclusively due to a reduction in the LDL fraction, with no changes in high-
density lipoprotein (HDL).
Although most of the fatty acids can be synthesized by the organism, the
precursors of the ω -6 and ω -3 PUFAs are considered essential, since they
cannot be endogenously produced in humans and some animals due to
deficiency of certain enzymes known as desaturases, which are capable of
inserting double bonds at the Δ12 and Δ15 positions (Moreira et al., 2002).
The intake recommendations for these essential fatty acids are due to the
main benefits associated with eicosapentaenoic acid (EPA) and docosahexae-
noic acid (DHA), resulting from the conversion of linoleic acid (w6) and
α -linolenic acid (w3), including anti-inflammatory action (Vedin et al., 2008;
Furuhjelm et al., 2009), cardiovascular protective effect (Kris-Elherton et al.,
2002), reduced risk of depression (Appleton et al., 2010), delay in the onset of
degenerative diseases caused by aging (Dangour et al., 2012), reduced risk for
certain types of cancer, and promotion of adequate fetal development and
improvement of baby’s cognition (Dunstan et al., 2008).
With regard to the cholesterolemic effect, the replacement of SFAs by
PUFAs has been reported in several studies as a very effective way to lower
plasma cholesterol levels in humans, although this effect is still unclear
(Lamarche and Coture, 2014) and varies according to the ω -6 and ω -3 fami-
lies. For many years, linoleic acid (C18:2) was recommended for a healthy
diet due to its effectiveness in reducing cholesterol levels. However, in
humans, a high linoleic acid (C18:2) intake can reduce HDL levels (Mattson
and Grundy, 1985) and increase the risk of gallstone cholesterol (Sturdevant
et al., 1973). On the other hand, high concentrations of ω -3 fatty acids may
reduce plasma triacylglycerides, which may be responsible for reduction of
the risk of cardiovascular diseases. Omega-3 PUFAs blood levels have been
Fat Reduction in Processed Meats 465

associated with reduced risk of cardiovascular disease in epidemiological

studies due to their protective antiarrhythmic, anti-inflammatory, hypo-
tensive, and hypocholesterolemic effects (Balk et al., 2006; Harris and Von
Schacky, 2004). Although the benefits of ω -3 fatty acids on cardiovascular
diseases are unclear or referring exclusively to the metabolic transforma-
tions of EPA (C20:5) and DHA (C22:6) (Barceló-Coblijn and Murphy, 2009),
the ω -6/ω -3 ratio has become increasingly important in human nutrition,
with a recommended ratio of 5:1 or less (Simopoulos, 1999; Schaefer, 2002;
Chardigny et al., 2001; Kris-Etherton et al., 2000). However, the ω -6/ω -3 ratio
has reached alarming proportions, being higher than 20:1 (Simopoulos, 2004)
probably due to the low concentration of ω -3 in foods, suggesting strategic
reformulations with enrichment with this nutrient.

15.2.3 Meat Products as a Fat Source

The fat content in lean meats is generally less than 5%. However, as a rule,
besides the fatty cuts, pork back fat is a key ingredient for the development
of texture and flavor in meat product formulations. Meat fats contain less
than 50% SFAs and above 50% unsaturated fatty acids (50%–52% bovine,
55%–57% swine, 70% chicken, and 62% rabbit). Although meat contains cho-
lesterol levels less than 75 mg/100 g, except kidney, brain, and heart (Jiménez-
Colmenero et al., 2001), these levels are higher in processed meat products.
In meat products, the lipid content depends on both the proportion of fat in
meat raw materials and mainly the amount of fatty cuts and back fat added
to the formulations during processing. Although traditionally meat products
contain between 20% and 35% total fat, fermented meat products such as dry
fermented sausages can contain up to 45%–50% (Pearson and Gillett, 1996;
Jiménez-Colmenero, 1996).
Emulsified meat products vary widely in their fat content, with mean percent-
ages of 20%–35%. More popular products that contain less noble raw materials
such as mechanically separated chicken, organ meats, and skin permitted
by law are characterized by higher fat contents. The meat matrix stabilized
by myofibrillar proteins as gelling agents and emulsifiers, as well as addi-
tives such as phosphates and extenders (starch and protein derivatives), can
provide high fat levels in the network. These products are the target of studies
to develop new strategies for fat reduction and reformulation of lipid profile.
In fermented meat products, after the fermentation, the drying stage
allows important proteolytic and lipolytic reactions, with weight losses that
can reach up to 45%–50%, which increases the fat content, making these
products the most caloric within this category. However, this characteristic
is expected and determines the identity and quality standards for the dif-
ferent categories produced worldwide. On the other hand, for using whole
cuts in its manufacture, raw ham requires an adequate meat toilet in the
food processing to completely remove the fat covering from the shank, will
have its fat content defined by the intermuscular fat (marbling). High-quality
466 Advanced Technologies for Meat Processing, Second Edition

standards have established adequate fat contents to control the lipolytic and
proteolytic reactions.
Restructured meat products have physical characteristics that allow the
use of fat cuts, leading to great variations of fat content, in addition to losses
of functional quality. These characteristics highlight the complexity of reduc-
ing fat in different meat products from a technological and sensory point of
view to minimize the changes that can lead to a product’s rejection.

15.3 The Role of Fat in Processed Meats

Fat is one of the main constituents of meat and processed meat products,
mainly affecting the sensory (flavor, juiciness, texture), physicochemical and
technological characteristics (batter stability and shelf life, viscosity, yield), and
microbiological safety, since it contributes to the reduction of water activity
in certain processed products (Jiménez-Colmenero, 2000; Pearson and Gillett,
1996). Some of the most important functions are briefly discussed below.

15.3.1 Texture
One of the most important attributes of fat in processed meat products is its
recognized role in texture properties, as it strongly affects the homogeneity,
chewing, hardness, cohesiveness, crispness, and creaminess of the processed
product (Drewnowski, 1997). In reduced-fat products, the texture character-
istics are defined according to the technological strategy used, including the
type of processing (emulsion formation, fermentation/dehydration, raw mate-
rial injection/restructuring systems, baking systems), cooking, type of pack-
aging, expected shelf life, raw materials, and fat substitutes, among others.
Several studies have shown a modification of the texture profile when using
different types of fat substitutes in meat products (Mendoza et al., 2001; García
et al., 2002; Cáceres et al., 2004; Nowak et al., 2007; Fernández-López et al.,
2008; Salazar et al., 2009). In addition, when water is used to compensate for
the reduced fat, the products tend to become stiffer and firmer, showing yield
loss and changes in physicochemical, microbiological, and sensory stability.
In fermented meat products, the decrease in fat levels provides a rubber-like
texture (Keeton, 1994) and the external appearance of the fermented sausage,
for example, is impaired by a wrinkled and hardened surface (Muguerza et
al., 2002). Many studies have pointed out that the reduction of lipid content
above 20% may result in an unacceptable product to the consumer due to tex-
ture defects, mainly accompanied by changes in flavor and appearance, short
shelf life, and palatability defects (Yang et al., 2001).
In emulsified meat products, the reduction of saturated fat and/or refor-
mulation of lipid profile by the addition of vegetable oils reduces emulsion
Fat Reduction in Processed Meats 467

stability, leading to loss of juiciness and liquid release during the shelf life
of the products, with serious consequences on microbiological safety. In
restructured products such as hamburgers, the cooking losses increase sig-
nificantly, and texture is the most affected parameter (Yang et al., 2001), lead-
ing to rejection by consumers.

15.3.2 Flavor and Taste

In addition to texture, flavor and taste can also be altered by the fat reduction
in meat products. The fat is responsible for the development of a charac-
teristic flavor, which depends on several factors, including the composition
of the animal raw material, processing steps, heat treatment, fermentation
and drying stages, storage conditions, and packaging. The components that
make up the lipid fraction can interact with amino acids, sugars, and miner-
als in desirable or undesirable reactions involving or not heat treatments. In
fermented and/or ripened meat products, fat has a highly relevant role in the
lipolysis reactions that define, along with proteolysis, the characteristics of
a particular product, which are also used to differentiate items of the same
category around the world.
Fat in the meat products acts as a carrier of the compounds responsible for
the aroma, stimulating some senses during the food ingestion. The quan-
tity, composition, and physical state are determining factors for a dynamic
release of flavor components during consumption (Hort and Cook, 2007;
Cierach et al., 2009).
The fat content is also related to the alteration of the perception of salinity,
spicing, and smoking, which can drastically reduce the acceptance of these
products when compared to traditional ones (Hughes et al., 1997; Chevance
et al., 2000).
Reformulated meat products with replacement of animal fat (back fat) by
vegetable oils require additional procedures, such as the use of herbs and
spices to improve the final flavor (Tan et al., 2006; Pelser et al., 2007) and
reduce the effects of a possible lipid oxidation. These reactions are particu-
larly relevant when fat is a precursor in the generation of volatile compounds
(Jiménez-Colmenero, 1996).

15.3.3 Physicochemical Properties

Fat provides various physical characteristics in the meat products, with the
development of specific functional properties. Thus, several factors includ-
ing crystallization capacity, changes in the melting point, and the hydropho-
bic interactions between meat components and water should be carefully
evaluated in reduced-fat meat products.
In cooked meat emulsions, fat is associated with the formation and sta-
bility of the emulsion, improvement in the process yield, and increased
water retention capacity, which directly interfere with the texture, color,
468 Advanced Technologies for Meat Processing, Second Edition

and sensory acceptance of the processed products (Keeton, 1994; Jiménez-

Colmenero, 2000). These effects result from the interaction of the saturated
lipid fraction with the myofibrillar proteins extracted during the comminu-
tion step, under an adequate ionic strength. After cooking and cooling, a
stable network containing water, protein, and fat is formed (Pietrasik and
Duda, 2000; Yoo et al., 2007; Hughes et al., 1997). This set of reactions affects
both the sensory and physicochemical properties of the processed meat
products.
The color attributes and the overall appearance are commonly altered
in reduced-fat meat products. Many studies have reported the develop-
ment of darker coloring, probably due to the greater yield loss caused
by the fluid exudation accompanying this cycle of events, as previously
described in the texture changes, which make the products drier, harder,
and more elastic (Cierach et al., 2009). The physicochemical changes may
also affect the microbiological stability, since the liquid released from
improperly conducted reformulations may accelerate the development of
spoilage microorganisms in emulsified and restructured injected meats
(Pearson and Gillet, 1996; Keeton, 1994), leading to short shelf life and neg-
ative effects on appearance. Some authors have suggested that reducing
the fat content in meat products by more than 10%, especially in emulsi-
fied products such as sausages, leads to a reduction of palatability, besides
increasing hardness and depreciating taste and aroma (Claus, 1991; Rust
and Olson, 1988).
In fermented sausages, fat regulates the continuous water release from
the inner layers of the product during the manufacturing process, which is
very important for effective fermentation and drying. Thus, the fat reduction
in fermented products provides greater weight loss since lean meat has a
higher moisture content when compared to pork back fat, which is the most
common fat source used in traditional formulations (Muguerza et al., 2002;
Papadima and Bloukas, 1999).
The fat composition in meat formulations is a determining factor in the
physicochemical properties of the processed products. Due to the higher
melting point of certain animal fats, especially pork back fat, which is
widely used in a variety of meat products, the reduction of total fat contents
or their partial substitution by more unsaturated fats can lead to techno-
logical problems, probably due to a reduction in viscosity of the reformu-
lated batters.
Heat treatment is another common operation in the manufacturing of
emulsified products, and its extent can be affected by the reduced fat in the
formulations. When fat is partially replaced by water, processing changes are
required, including a longer cooking time for these products to reach the same
internal temperature as conventional formulations. However, the increase
in the cooking time or temperature to guarantee microbiological safety can
change the palatability of the processed product (Jiménez-Colmenero, 2000),
thus significantly affecting the product’s acceptance (Giese, 1996).
Fat Reduction in Processed Meats 469

15.3.4 Perception of Satiety

From the physiological point of view, fat is responsible for several sensory
impressions that include pleasure, overall palatability and, among the most
recently studied, the feeling of satiety. Meat products are characterized by
a high satiety index, largely due to their high fat content. The development
of reformulated products with fat reduction with equivalent satiety index,
that is, those products with greater capacity to inhibit appetite for a longer
period after consumption, would attract the interest of industry and con-
sumers (Halford and Harrold, 2012), constituting an additional technological
challenge.
Satiety is the feeling of fullness that persists after eating, suppressing
further consumption of food. Factors affecting satiety can be character-
ized according to cognitive, postingestion, and postabsorption sensory
impressions. Initially, sensory and cognitive factors influence expectations
about the food to be consumed, including aspects such as flavor, texture,
and aroma or associations with previous experiences. As the food or drink
reaches the stomach, postingestion effects begin. First, the distension of the
stomach sends signals to the brain, initiating the sensation of satiety. As the
digestion process continues in the intestines, hormones that promote satiety
are released at this location. In the postabsorption stage, the nutrients are
detected by specialized receptors in various parts of the body, including the
brain, providing information on nutritional status that can also affect satiety
(Blundell, 2006).
In this context, fat reduction should be accompanied by a product refor-
mulation that produces physiological effects on satiety, constituting an
additional challenge. Fibers are considered as suitable vehicles to fulfill this
objective since they increase volume and weight due to their great water
absorption capacity, and trigger gastric and postgastric mechanisms that
send signals from the stomach to the brain, leading to the perception of sati-
ety (Slavin, 2005).
Therefore, studies on soluble and plant-derived fibers such as mucilages
should gain a foothold among advanced research in reducing fat in meat
products. Reducing fat levels and preserving the perception of satiety of
meat products is among the key challenges that must be achieved in obtain-
ing healthier products.

15.4 Strategies for Reducing Fat in Meat Products

Despite the technological and sensory challenges, the development of meat
products with reduced fat content is an irreversible trend in the indus-
try worldwide. The use of substitute ingredients and the development of
new processing technologies may be effective alternatives to maintain the
470 Advanced Technologies for Meat Processing, Second Edition

identity of the reduced-fat meat product (Mendoza et al., 2001; García et al.,
2002, Weiss et al., 2010).
The strategies for fat reduction vary for each category of products,
according to their specific characteristics (raw materials, ingredients, pro-
cessing aids, packaging, etc.). In addition, the sensory characteristics of the
reformulated product should be accepted by the consumer, who can reject
products with altered identity and quality standards. For a successful fat
reduction in meat products, each category of processed product requires a
substitute and/or manufacturing method that results in appropriate tech-
nological properties with low impact on overall quality. Nutritional factors,
technological properties (lower water retention capacity), cost, acceptance,
convenience, legislation, and marketing should also be considered. Some
strategies to improve the lipid profile of processed meat products are
described below.

15.4.1 Simple Fat Reduction and Selection of Lean Meat Cuts

One of the most common strategies to reduce fat in processed meat products,
in a simple way, consists in the selection of leaner meat cuts, adipose tissue
removal, and use of raw materials from animals fed diets aiming at the mod-
ification of fatty acids composition (Decker and Park, 2010; de Oliveira Faria
et al., 2015). Although this reformulation is one of the pioneers in the devel-
opment of low-fat meat products, some critical points should be investigated.
The selection of lean cuts and the reduction of the energy value cannot
guarantee a better nutritional profile of the final products. According to
Novakofski et al. (1989), the composition of the lean pork portion was not
affected by a good meat toilet before grilling, due to the presence of the mar-
bled fat in the cuts studied. In general, meat contains an approximate PUFA/
MUFA ratio of 0.1, indicating an unbalanced fatty acids intake (Webb and
O’Neill, 2008). On the other hand, the pork back fat, which is the main com-
ponent to be reduced, has a PUFA/MUFA ratio of 0.4 more favorable when
compared to the use of meat as a fat substitute in the formulation (Bernardi
et al., 2016). In addition, the w6/w3 ratio, which is important to ensure many
health benefits, is quite inadequate in meat and meat products, thus the con-
sumption of foods that can improve this ratio has been widely recommended
(Valencia et al., 2007).
Another limitation to reduce fat in meat products is the use of cuts without
marbling, which implies the selection of a few parts of the carcass, mainly
pork, which may not be economically feasible due to the high cost.
In addition to nutritional and cost constraints, simple fat reduction and
the increase in meat content to compensate for fat in emulsified meat prod-
ucts gives rise to negative changes in appearance, flavor, and texture, such as
increased red color intensity and hardness (Weiss et al., 2010). The safety of
the product should also be considered when some of the fat is replaced with
water and lean meat since the product’s stability can be compromised.
Fat Reduction in Processed Meats 471

15.4.2 Use of Fat Replacers

Many ingredients of different chemical classes can be used as fat replacers in
processed meat products. Its ranking varies greatly since some compounds
have more than one specific property to define it. In essence, for an ingredi-
ent to be considered a fat replacer, it should contribute a minimum of calories
without drastically altering the sensory and functional characteristics of the
product, in addition to being in compliance with the current legislation and
having a low cost (Hachmeister and Herald, 1998).
According to Akoh (1998), fat replacers can be classified into two groups.
The first are fat substitutes, defined as macromolecules that resemble triac-
ylglycerols in the physicochemical aspect, that can theoretically replace fat
in foods, by weight. They are chemically synthesized or derived from con-
ventional fat or oils by enzymatic modification and must be stable on cook-
ing and freezing. Second are fat mimetics, defined as substances that mimic
the sensory or physical properties of triacylglycerols, but cannot replace by
weight. They are made from proteins or carbohydrates present in common
food components, which undergo physicochemical modifications to provide
the fat characteristics. In general, these ingredients have no stability to freez-
ing and heating at high temperatures, due to their high water-binding ability.
The wide variety of fat replacers available in the market can be commer-
cially classified into protein extenders (high protein) and nonprotein extend-
ers (high carbohydrate). Protein extenders contribute to increased water
retention, gelling, and emulsification of fats, whereas the nonprotein extend-
ers contribute significantly to a higher water retention capacity and are less
involved in fat emulsification (Lucca and Tepper, 1994; Brewer, 2012). The fol-
lowing sections discuss fat replacers according to their importance as com-
monly used ingredients, as well as those that represent nutritional trends
with respect to healthier calories and calorie reduction.

15.4.2.1 Gums
Gums are high-molecular-weight carbohydrates classified as hydrocolloids,
used as thickeners and/or gelling agents in various meat products, generally
in low concentrations. The gums most commonly used in low-fat meat prod-
ucts include carrageenan, agar, alginate, gum arabic, galactomannan (guar
gum and locust bean), and xanthan gum, because of their water retention
properties (Candogan and Kolsarici, 2003). Although some authors classify
these compounds as soluble fibers, this chapter assesses them as a differenti-
ated item, considering their technological relevance and citation in works in
the literature.
Carrageenan gum has been widely used as a fat substitute and consists of
a group of sulfated polysaccharides extracted from various red algae formed
by three major kappa, iota, and lambda fractions. The kappa and iota frac-
tions form thermoreversible gels, while the lambda fraction does not form a
472 Advanced Technologies for Meat Processing, Second Edition

gel. Because of its ionic nature, the formation of kappa and iota carrageenan
gel is strongly influenced by the presence of electrolytes, showing synergy
with other gums. The kappa carrageenan and calcium ions form a rigid, ther-
moreversible, and highly resistant gel; in contrast, an elastic gel is formed
with potassium ions. The iota carrageenan produces a flexible gel, stable to
freezing, and forms an elastic gel in the presence of calcium ions (Shand et
al., 1990). The functional properties of carrageenan include the water reten-
tion capacity and better slice ability, constituting an excellent fat substitute
(Bater et al., 1992; Brewer, 2012; Egbert et al., 1991; Trius et al., 1994; Cierach et
al., 2009); thus, it has been applied in a broad category of meat products such
as hamburgers, sausages, and hams.
Galactomannans (guar gum and locust) can be used as fat substitutes for
their ability to control viscosity through water retention, which is relevant
in low-fat products that do not form gels (Setser and Racette, 1992). Guar
gum produces solutions with high viscosity, with good stabilizing effect and
water retention capacity. It confers greater juiciness and creaminess to meat
products as it is able to interact synergistically with xanthan gum. Locust
gum is soluble in cold water with a maximum viscosity at 95°C, which limits
its use in meat products, other than when used in combination with other
gums, for example, xanthan gum, when it forms very elastic gels after heat-
ing and cooling (Symes, 1980). Lurueña-Martínez et al. (2004) showed that
a blend containing xanthan gum and locust gum was effective in reducing
fat of Frankfurt sausages, reducing cooking losses, and improving emul-
sion yield and stability, due to its ability to form hydrogen bonds with water,
without affecting the sensory properties of the product.
Several other hydrocolloids derived from algae can be used to stabilize
meat batters. Jiménez-Colmenero et al. (2010) used edible algae, and Konjac
used algae derivatives as fat substitutes in sausages and found that the emul-
sion stability was dependent on the replacement ratio. That study demon-
strated that a fat substitution up to 15% showed no visible changes in the
sensory quality of sausages.

15.4.2.2 Starch Derivatives

Starch is one of the most widely used ingredients in meat processing due
to its extensor properties, low cost, and high availability in the production
chain. Its properties include increased water retention capacity, reduction of
cooking losses, emulsion stabilization, positive effect on the texture of some
meat products, and cost reduction, among others (Carballo et al., 1995; Claus
and Hunt, 1991; Khalil, 2000; Lyons et al., 1999).
This ingredient is composed of two main fractions, amylose and amylo-
pectin, but its main gelatinization property depends mainly on the content
of the amylose component, responsible for forming hydrogen bonds for
the construction of the three-dimensional network and the water retention
capacity. After gel formation and cooling, the retrogradation of the starch
Fat Reduction in Processed Meats 473

gels is a phenomenon commonly characterized by the reassociation of the

gelatinized molecules, causing water release known as syneresis and forma-
tion of precipitates that can reduce the quality and safety of vacuum-packed
and sliced products. The intensity of the retrogradation depends on the amy-
lose content in each type of starch, increasing in the following order: cassava
> rice > potato > maize > wheat (Murphy, 2000).
Starches may undergo chemical or physical modifications such as acid
or enzymatic hydrolysis, oxidation, dextrinization, cross-linking, or mono-
substitution to alter their functional properties, becoming ingredients widely
used in different segments of food processing (Shand et al., 1990).
Native potato and cassava starches have limited dispersibility in cold water
and are applied in emulsified products to reduce cooking losses, and increase
yield and shelf life, whereas the modified potato starches produce a firm
texture gel with potential application in injected, tumbled, and marinated
meats, with a strong synergistic effect with soybean proteins. Regarding cas-
sava starch, Hart and Price (1993) also observed an increase in the juiciness
of low-fat cooked meat products, probably due to the greater water retention
capacity. Rice starch is characterized by its more neutral flavor.
Maltodextrin, resulting from the partial hydrolysis of corn or potato
starch, is also considered Generally Recognized As Safe (GRAS) and pres-
ents a great application in meat systems requiring increased viscosity, partic-
ularly in emulsified products, since it does not gel, favoring filling operations
(Akoh, 1998).

15.4.2.3 Protein-Based Fat Replacers

Protein-based fat replacers can be from milk, egg, whey, or plant proteins
(Giese, 1996). Some of these proteins are microparticulate (denatured by heat-
ing) and form microscopic coagulated round particles that mimic the mouth
feel and texture of fat, providing lubricity and better palatability (Roller and
Jones, 1996). Low-molecular-weight proteins can develop fat-like physical
properties and favorably modify the texture of a lipid-lowering product.
The most commonly used fat substitutes in the meat industry are soy pro-
tein isolates, concentrates, and texturized soy protein; defatted milk pow-
der, caseinates, and whey proteins; and wheat flour and gluten. Flours (50%
protein) and concentrates (70% protein) are used at levels of 3%–5% (on dry
basis), while the isolates (90% protein) are limited to 2% of the total formula-
tion. Each country has regulatory standards to control these percentages and
to curb fraud by reducing the content of meat raw materials while maintain-
ing the protein content in a particular meat product.
The use of by-products of the meat production chain such as porcine and
bovine skin gels has been explored as potential fat substitutes to add value to
the meat and meat production chain since they constitute rich sources of col-
lagen (Alves et al., 2016). Pintado et al. (2016) evaluated different strategies for
the incorporation of chia flour (10%) and olive oil in frankfurters and found
474 Advanced Technologies for Meat Processing, Second Edition

an increase in fiber and linolenic acid levels, reduction of purge losses, and a
26% reduction of fat in all samples.

15.4.3 Use of Fibers as Functional Ingredients and Fat Replacers

Functional ingredients have been recognized for their beneficial physiologi-
cal effects on human diet, and are widely used to modify nutritional prop-
erties and aggregate healthier consistent appeals in many processed food
products (Jiménez-Colmenero et al., 2001). Studies have shown changes in
the nutritional profile of meat products as delivery vehicles for bioactive
compounds (Zhuang et al., 2016; Alves et al., 2016; Turp, 2016), such as pheno-
lic compounds, flavonoids, PUFAs, prebiotics, and probiotics.
In addition to the high fat content of meat and meat products, one of the
main complaints is the absence of fibers in their composition. The World
Health Organization has recommended that more than 55% of the energy
consumed by humans come from carbohydrates, suggesting fibers as a part
of food intake (Talukder, 2015). The American Dietetic Association recom-
mends the intake of 25–30 g of fiber/adult/day, or 10–13 g/1000 kcal, and the
insoluble to soluble fiber ratio should be 3:1. In Europe, the recommendation
is 20 g fiber/day/person (Borderías et al., 2005). The USDA and US Food and
drug administration (USFDA) have established the consumption of 38 g fiber
for men and 26 g for women (Mehta et al., 2015).
Thus, the use of plant fibers of different botanical origins to reformulate
meat products may be a promising alternative, since they can make the prod-
uct healthier as a fat substitute and add value due to thier physicochemical
properties (Weiss et al., 2010). In this context, dietary fibers can be very use-
ful for their technological properties in meat products, which briefly include
(1) increasing water holding capacity, (2) fat binding capacity, (3) increasing
viscosity, (4) gelling properties, (5) chelating effects, (6) fermentative capacity,
(7) positive effects on texture and slicing, (8) stabilization in frozen products,
and (9) prevention of deformation and shrinkage of restructured products
during cooking (Fernández-López et al., 2008; Sendra et al., 2008; Campagnol
et al., 2013; Choi et al., 2009).

15.4.3.1 Insoluble Fibers

The water solubility of dietary fibers is one of the criteria most used for its
classification. Soluble fibers consist of pectins, gums, mucilages, alginates,
beta-glucans, and some hemicelluloses, whereas insoluble fibers are repre-
sented by lignin, cellulose, and most hemicelluloses (Chawla and Patil, 2010;
Brennan, 2005).
Insoluble fibers increase the volume of the fecal bulk, decreasing the
time of intestinal transit, facilitating fecal elimination, and also contribut-
ing to glucose absorption and retarding the starch hydrolysis. This effect on
intestinal regulation makes them relevant to well-being and contributes to
Fat Reduction in Processed Meats 475

the reduction of the risk of various pathologies (Maffei, 2004; Brennan and
Cleary, 2005; Mira et al., 2009).
Despite their wide availability, insoluble fibers require very careful stud-
ies for their application in meat products, since they may interact negatively
with ingredients of the meat matrix, depending on the type of process used.
Grittiness, loss of texture, and development of off-flavors are the most common
defects, especially in emulsified and fermented meat products (Catalani et al.,
2003). On the other hand, the technological advantages are related to the high
water and fat holding capacity, as well as cost reduction. Grains and their deriv-
atives, such as whole flours and bran, along with fruits and vegetables, are the
main sources of dietary fiber and are among the most studied for application
in meat products. Table 15.1 shows some of the major studies on the addition of
insoluble fibers in meat products and the critical points of this reformulation.

TABLE 15.1
Insoluble Fibers from Cereals, Legumes, and Fruits as Fat Substitutes in Processed
Meats
Insoluble Fiber
Source (%) Meat Product Effects Resulted from Fiber Addition Reference
Oat bran Meatballs Lower total fat and trans-fatty acid Yilmaz and
(5%–20%) contents, higher protein, salt and ash Dağlıoğ lu
contents, lightness, yellowness, and (2003)
lower moisture and redness. High
acceptability.
Oat fiber (13%, Beef patties Higher cooking yield and fat and moisture Piñero et al.
45%) retention due to the water binding (2008)
capacity of β-glucan. No changes in
appearance, tenderness, and color.
Soy flour (5%), rice Nuggets Both soy flour and rice flour provided Dogan et al.
flour (5%) reduced oil absorption. Soy flour had the (2005)
highest apparent viscosity and was
found to be an effective ingredient in
improving batters in crispness and color.
Oat bran (0%, 2%, Beef patties No changes were observed for protein and Serdaroglu
4%, 6%) fat. Reduction of moisture content in raw (2006)
patties but increase in cooked patties with
improvement of sensory quality.
Carrot fiber (3%, Sobrassada Over 3%, the fermentation process in Eim et al.
6%, 9%, 12%) these samples was not successful and the (2008)
textural parameters were critically
affected. Only over 6% was the lipolytic
process was influenced.
Orange fiber 1% Spanish No changes during fermentation and Fernández-
and 2% salami dehydration stages, reducing residual López et al.
nitrite. (2008)
(Continued)
476 Advanced Technologies for Meat Processing, Second Edition

TABLE 15.1 (Continued)

Insoluble Fibers from Cereals, Legumes, and Fruits as Fat Substitutes in Processed
Meats
Insoluble Fiber
Source (%) Meat Product Effects Resulted from Fiber Addition Reference
Cereal grain Fermented Reduction of 35% energy value. Sensory García et al.
(wheat and oat) sausage and texture properties of sausages with 3% (2002)
and fruit (peach, dietary fiber were not good, due to high
apple, and hardness and cohesiveness value. The best
orange) results for organoleptic characteristics
(1.5%–3.0%) were obtained for 1.5% fruit fiber.
Soy fiber 1% and Brazilian No changes in global and technological Campagnol
2% salamis properties up to 1% addition. et al. (2013)
Wheat fiber Hamburger No changes in sensory properties Mansour
2.5%–5.5% and Kalil
(1999)
Rye bran Sausages and Rye bran was more suitable in meatballs Petersson
2.1%–2.95%, oat meatballs due to its particulate nature; oat bran et al.
bran 4.3%–6.0%, was the best alternative in low-fat (2014)
and barley fiber sausages due to its gelling ability upon
1.3%–1.7% heating. The barley fiber (highest
amount of soluble β -glucan) resulted in
higher losses and the lowest firmness.
Apple pulp 8%, Reduced Increasing pH and dietary fiber content, Verma et al.
10%, 12% sodium redness, yellowness, and chroma index. (2010)
chicken Sensory evaluation showed significant
nuggets reduction in texture, but overall
acceptability of the treated samples, with
scores in the range of very good.
Wheat, rye, oat, Meatballs Decreasing in weight loss; overall Yasarlar
and corn bran acceptability decreased as bran content et al.
5%–20% increased specially due to higher firmness; (2007)
redness of meatballs gradually decreased
and lightness increased as the level of oat
bran increased from 5% to 20%.
Lemon albedo Bologna Good sensory acceptance of the fat- Fernández-
2.5%–10% sausage reduction treatments. Sausages Ginés
containing containing 2.5%, 5.0%, or 7.5% et al.
cooked albedo had similar sensory (2004)
properties when compared to the control.
Barley flour (4%, v Increase in cooking yield and moisture Kumar and
7%, 10%) retention. The incorporation of 4% barley Sharma
flour had higher flavor and texture (2004)
scores when compared to 7% and 10%
levels.
Wheat bran (5%, Meatballs Lower total trans-fatty acids and higher Yilmaz
10%, 15%, 20%) total unsaturated fatty acids to total (2005)
saturated fatty acids ratio. Samples with
wheat bran added were lighter and
yellower than the control.
(Continued)
Fat Reduction in Processed Meats 477

TABLE 15.1 (Continued)

Insoluble Fibers from Cereals, Legumes, and Fruits as Fat Substitutes in Processed
Meats
Insoluble Fiber
Source (%) Meat Product Effects Resulted from Fiber Addition Reference
Pea flour Chicken Higher emulsion stability up to 10% Singh et al.
nuggets levels; decrease in moisture, protein, and (2008)
fat contents and shear force value at 10%
pea flour level. No significant changes in
the sensory properties.
Peach dietary fiber Frankfurter No changes in protein and collagen Grigelmo-
suspensions (17% contents; increase of viscosity of the Miguel
and 29%) meat batters at two levels. Dietary fiber et al.
was effective in retaining water in the (1999)
final product.
Tomato, beet root, Chopped Increase of water-holding capacity and Cava et al.
and inulin (1%, chicken reducing in cook loss for tomato fiber; (2012)
2%, 3%) products significant changes in color and texture
parameters (higher hardness); tomato
fiber reduced the extent of lipid
oxidation.
Chia (Salvia Frankfurter Increase of total dietary fiber and Pintado
hispanica L.) minerals; reduction in fat and energy et al.
(10%) content (>265); lower purge; good (2016)
sensorial acceptance and suitable for
health claims.
Pea flour, Low fat Adding fibers improved the poor texture Pietrasik
starch-rich and bologna of low fat bologna sausage and and Janz
fiber-rich increased water holding capacity. (2010)
fractions Consumer acceptance was not
influenced, but pea fiber had lowest
texture and flavor.
Brown rice fiber Pork meat Lower emulsion stability and higher Choi et al.
(1%, 2%, 3%, 6%) emulsion cooking yield and hardness of meat (2015)
systems emulsion systems were observed in all
with canola treatments. Partially replacing pork
oil back fat with a mix of 10% back fat, 10%
canola oil, and 2% brown rice fiber was
most similar to the control with 30%
pork back fat.

Bran is among the most studied fibers. Rice bran is mainly composed of
arabinoxylans and cellulose (Andersson et al., 2003), while oat and barley
bran, in addition to their insoluble fractions, are rich in β -glucans, soluble
fibers related to the reduction of plasma cholesterol when consumed regu-
larly (Beer et al., 1997).
Fibers from beets, soybeans, carrots, pears, apples, oranges, and peas,
among others, have been studied as ingredients for the reformulation of
meat products, especially in hamburgers and sausages (Table 15.1). In most
478 Advanced Technologies for Meat Processing, Second Edition

applications, despite the good performance in the functional properties

(Jiménez-Colmenero et al., 2001), some attributes such as flavor and texture
can be negatively affected.
Various types of cellulose can be obtained industrially by different pro-
cesses and used as fat replacers. Microcrystalline cellulose is considered
GRAS and noncaloric, contributes to a product’s consistency, and acts as
emulsion stabilizers, besides controlling baking losses, and conferring vis-
cosity in emulsified products. Various commercial celluloses are available
in the market, for example, Z-trim® and Oatrim®, obtained from oat, soy,
corn, or wheat by-products, which have been widely used in meat products
(Warner and Inglett 1997; Akoh, 1998, Campagnol et al., 2012).
One of the major challenges in the use of insoluble fibers is the sensory
acceptance and the regulatory aspects that vary between countries since they
can be considered fraud promoters due to their wide water holding capac-
ity. Insoluble fibers can be incorporated into restructured products such as
hamburgers and nuggets, as they are compatible with the typical texture of
such products.

15.4.3.2 Soluble Fibers

In general, soluble fibers have similar effects to the insoluble fibers in small
intestinal transit, and consequently, reduce the rate of digestion and absorp-
tion of macronutrients, resulting in higher glucose tolerance and higher
starch content available for colonic fermentation. They also indirectly affect
the absorption of lipids by the organism, due to their capacity to sequester
the bile salts (Roberfroid, 1993). Many studies have suggested that the great-
est physiological benefit of soluble fibers results from the action of short-
chain fatty acids, which, when in the bloodstream, reach the liver and/or
peripheral tissues, causing a decrease in postprandial glycemia, thus reduc-
ing the free fatty acid levels (Trowell et al., 1976; Prosky and Hoebregs, 1999;
AACC, 2001).
In addition to the solubility criterion, the fibers can be classified based
on their physiological properties as digestible oligosaccharides (DOs) and
nondigestible oligosaccharides (NDOs), according to the anomeric carbon
in the monosaccharide, which makes them available or not for the hydro-
lytic activity of the digestive enzymes (Roberfroid and Slavin, 2000). Great
prominence has been given to NDOs for their important physicochemical
properties and health benefits, including the prebiotic effect due to their
ability to stimulate the growth of Bifidobacteria (Saad, 2006; Mussatto and
Mancilha, 2007; Finocchiaro et al., 2009; Monsivais et al., 2011). Some of the
most important NDOs for use in meat products are inulin (IN), fructooligo-
saccharides (FOSs), resistant starch (AR), and polydextrose (PD), which are
briefly described below; select applications in processed meats are given in
Table 15.2.
Fat Reduction in Processed Meats 479

TABLE 15.2
Using FOS, IN, RS, and PD as Fat Replacers in Meat Products

Prebiotic Fiber Product Effects on Meat Products Reference

FOS (3%, 6%, 9%) Pepperoni Reduction of 50% pork back fat Dos Santos
without altering texture due to the et al. 2012
ability of FOS to form a gel at the
interface of meat and fat particles.
Good sensorial acceptance and
microbial stability.
FOS (2%–12%) Sausages Reduction of 40% fat and 35% energy Cáceres et al.
value; good acceptance scores for (2004)
12% FOS; no changes in texture, pH,
aw, and weight losses.
FOS (2%, 4%, 6%) Dry fermented 50% and 80% fat reduction with good Salazar et al.
sausage sensorial properties, but with few (2009)
changes on texture and color as
reduction of hardness and increase
in lightness.
FOS (2.5% and Meatballs No changes in the texture properties Ergönül et al.
5.0%) (2.5% and 5.0%); higher scores were (2009)
observed for 2.5% regarding sensory
properties when compared to the
control without addition of FOS.
IN Mortadella Reduction of up to 47.5% in energy Nowak et al.
value with use of 12% IN; increase (2007)
in hardness and adhesiveness, dark
color as negative effect.
IN (powder/gel) Mortadella Powdered IN increased the hardness García et al.
(2.5%–7.5%) of reduced fat in sausages even at (2006)
2.5% level while the gel form
affected texture of product only at
7.5% level. Although the sensory
properties remained similar for all
products, IN in the form of gel was
preferred.
IN (5%, 10%, Veal meatball At 20% IN, significant changes in Yilmaz and
15%, 20%) physicochemical properties. Lower Geçgel (2009)
sensory scores observed with 10%,
15%, and 20% IN were due to
hardness, low juiciness, and low
flavor intensity. 5% level was found
to be optimum.
IN Dry fermented No changes in the physicochemical Menegas et al.
chicken and microbiological parameters and (2013)
sausage + the product’s acceptability, but
corn oil resulted in an altered texture profile.
The products were stable during
storage at 4°C for 45 days for
physicochemical and microbial
parameters. (Continued)
480 Advanced Technologies for Meat Processing, Second Edition

TABLE 15.2 (Continued)

Using FOS, IN, RS, and PD as Fat Replacers in Meat Products
Prebiotic Fiber Product Effects on Meat Products Reference
IN Cooked meat Better stability of emulsion with Álvarez and
batters addition of water to replace fat, Barbut (2013)
reduction of cooking losses when
using the IN powder and greater
creaminess and softness when using
the gel form.

IN Comminuted Better softness and overall texture, Keenan et al.

meat emulsion stability, with no changes (2014)
products in sensory quality, improvement of
lipid profile by substitution of pork
back fat for vegetable oil.

IN Low salt The reformulated chorizo with olive Beriain et al.

Pamplona- alginate emulsion and 6% IN (2011)
style chorizo resulted in a product with 20% less
fat than the control, 10% richer in
MUFAs, and sensory properties
similar to the traditional chorizo
used as a control, achieving a good
acceptability rating.
IN (7.5%–12.5%) Dry fermented The IN led to a softer texture and Mendoza et al.
sausage tenderness, springiness, and (2001)
adhesiveness very similar to that of
conventional sausages. A low-
calorie product (30% of the original)
was obtained with approximately
10% IN without significant changes
in sensory properties.
PD + FOS + IN + Mortadella Prebiotic fibers reduced the emulsion Felisberto
RS (3% and 6% stability of mortadellas when et al. (2015)
for each one) cassava starch was suppressed from
the formulations. There was a
significant increase in softness. The
gelation process of myofibrillar
proteins occurred at lower
temperatures when compared with
control.
PD Nuggets Increased juiciness and moisture with Stowell (2009)
preservation of crispness after
cooking.
PD (5% and 10%) Hamburger Lower cooking losses and reduced Troutt et al.
firmness. Cohesiveness was similar (1992)
to the control formulation (20% fat),
even with the addition of PD in
combination with potato starch, beet
sugar, oat fiber, or pea fiber.
(Continued)
Fat Reduction in Processed Meats 481

TABLE 15.2 (Continued)

Using FOS, IN, RS, and PD as Fat Replacers in Meat Products
Prebiotic Fiber Product Effects on Meat Products Reference
PD Cod surimi Cryoprotectant effect of myofibrillar Sych et al.
proteins on cod surimi, due to the (1990)
high availability of hydroxyl groups,
which act on the hydrogen bonds
with the protein chains, leading to a
greater hydration of the protein
chains and reducing aggregation.
RS Sausage Addition of resistant starch led to an Sarteshnizi
undesirable effect on the sensory et al. (2015)
properties and cooking yield, with
increased hardness. However, an
appropriate technological
performance was observed when RS
was combined with beta-glucan,
contributing to the prebiotic appeal
of the meat product.
FOS, fructooligossacharide; IN, inulin; MUFAs, monounsaturated fatty acids; RS, resistant;
PD, polydextrose.

15.4.3.2.1 FOS and IN

IN is a soluble fiber, formed by fructose units joined by linear bonds with
a terminal glucose unit, and can be found in several plants as an energy
reserve, especially in chicory (Meyer et al., 2011). FOSs are oligosaccharides
known as unconventional sugars that originate from plants, and their natu-
ral biosynthesis occurs in asparagus, beet, garlic, chicory, onion, wheat, bar-
ley, and rye (Spiegel et al., 1994; Wang, 2009). FOS can be produced either by
enzymatic hydrolysis of IN or by transfructosylation of sucrose, consisting
basically of linear units of fructose, with or without the final glucose unit
(Passos and Park, 2003).
From the chemical point of view, there is no difference between IN and
FOS: both are fructose oligomers whose monomers are joined by β -(2,1) gly-
cosidic bonds. However, while IN chains contain 2 ± 60 units, the length
of FOS chains ranges from 2 to 10 units with an average degree of polym-
erization of four. The molecular weight and size of the chains of these two
compounds are responsible for their different functional physicochemical
properties. The long IN chain forms microcrystals when mixed with water.
On the other hand, the FOS present short chains, which are hygroscopic,
soluble, and have good water retention capacity (Niness, 1999).
Both IN and FOS travel through the upper intestinal tract and can be fer-
mented in the colon and selectively used by certain types of beneficial bacteria,
such as Bifidobacterium and Lactobacillus, reducing the number of undesirable
bacteria, such as Clostridium and Escherichia. For these reasons, both fibers are
considered prebiotic ingredients (Gibson et al., 1995; Tungland and Meyer, 2002).
482 Advanced Technologies for Meat Processing, Second Edition

Many studies have reported the use of IN and FOS as fat replacers in var-
ious categories of meat products, as shown in Table 15.2. They are highly
stable, supporting pH above 3 and temperatures above 140°C (Bornet, 1994).
FOS, in particular, can be used at higher levels because of its greater solubil-
ity when compared to IN (Dos Santos et al., 2013). In fermented products,
FOSs do not undergo hydrolysis, preventing the development of foreign
microorganisms during the fermentation process.
IN can be incorporated at high levels into emulsified meat products with-
out considerable sensory changes, acting as an excellent fat replacer. Because
of its ability to form viscous gels, some technological problems can occur
when IN is mixed with fat in the cutter, which can be minimized with a
correct formulation and the order of addition of the ingredients. Flavor and
objective texture measured by texture profile analysis (TPA) are the attri-
butes most affected in emulsified and fermented meat products. Although
there are few studies in the literature, both FOS and IN can be components of
brines in injected products aimed at the elaboration of healthier restructured
meat products with fat reduction.

15.4.3.2.2 Polydextrose
PD is a compound formed by the polycondensation of approximately 89%
D-glucose, 10% sorbitol, and 1% citric or phosphoric acid. Due to its gly-
cosidic bonds, the molecule has a complex and compact structure which
resists enzymatic digestion in the body; it has a prebiotic effect and ensures
a healthy and balanced intestinal microbiota, thus positively affecting the
physiological functions (Stowell, 2009). Its mechanism of action is similar to
that of the other soluble fibers such as pectins, β -glucans, and IN since they
contribute to lower cholesterol levels and blood glucose (Montenegro et al.,
2008). PD also has a low energy value (1 kcal/g), low glycemic index, and
evidence of reduced risk of colon cancer (Saad, 2006).
In some countries, it has achieved additive status due to its texturizing, stabi-
lizing, thickening, and humectant properties (Burdock and Flamm, 1999), which
gives it favorable technological properties as a functional filler. In comminuted
and restructured meat products, such as hamburgers, it can be used to replace
fat without compromising flavor and aroma; this allows for the creation of low-
fat products with reduced energy value (Stowell, 2009) and increased juiciness
that maintain the crispness of the product even after cooking.

15.4.3.2.3 Resistant Starch

Resistant starches are defined as compounds capable of resisting digestion
by the small intestine, passing into the large intestine, where they act as a
dietary fiber (Annison and Topping, 1994; Champ, 2004; Finocchiaro et al.,
2009) presenting a different behavior when compared to the conventional
highly digestible starches. According to their resistance ratio, they can be
classified into five types. Resistant starch type I (RS I) is physically inacces-
sible, since it is trapped in plant tissues, and is not susceptible to enzymatic
Fat Reduction in Processed Meats 483

hydrolysis, such as starches from whole grains; the resistant starch type
II (RS II) is defined as native granular, occurring in raw grain and having
type B polymorphism, such as potato, peas, and high amylose starches, also
resistant to enzymatic hydrolysis; type III (RS III) is retrograded starch, that
is, it has been cooked and cooled. All these types of starches can be found
naturally or produced during processing, whereas resistant starch type IV
(RS IV) is produced only by chemical modifications, providing linkages
nondigestible by the digestive enzymes (Li et al., 2008; Adam-Perrot et al.,
2009). On the other hand, resistant starch type V (RS V), developed more
recently, is formed by an amylose-lipid complex, for example, through the
complexation of maize starch with high amylose and lipid contents (Hasjim
et al., 2010).
This resistant portion of the starch passes through the colon and is used
by microflora as energy for growth and fermentation, producing short-chain
fatty acids (Champ, 2004; Hasjim et al., 2010), accompanied by a reduction of
pH, increasing the blood flow of the colon, and reducing the development of
abnormal cells, with effects on the reduction or in the treatment of colon dis-
eases, such as colon cancer and inflammatory diseases (Raigond et al., 2015).
Studies have shown its effectiveness on the reduction of blood glucose lev-
els and absorption of nutrients, such as calcium and magnesium, due to the
higher solubility of these minerals in the cecum and large intestine, which is
promoted by the acidification induced by fermentation.
Some resistant starches are commercially available, for example, resistant
starches type II (RS II), which include products with higher resistant starch
levels and smaller particles. Hi-Maize® 260 is a high-amylose-resistant corn
starch produced without chemical or enzymatic treatment, containing at
least 60% dietary fiber. When subjected to moderate processes, its granules
remain resistant and its organoleptic characteristics intact (Finocchiaro et
al., 2009).
The performance of resistant starches as fat substitutes is due to the exten-
sor properties and low energy value. In addition, RS does not change the
flavor, texture, and appearance of foods (Yue and Waring, 1998).
Carraro et al. (2012) have reported the technological benefits of using RS by
replacing swine fat with RS II, which exhibited the best performance among
all resistant starches tested. Felisberto et al. (2015) evaluated the rheological
properties of RS II as a substitute for fat and cassava starch and reported a
loss of texture in bologna sausages with 50% reduction of pork back fat and
the addition of 6% RS II. Although the emulsion stability of the meat bat-
ters was also affected, with higher liquid release after the cooking step, the
products were considered quite stable. The authors suggested the use of an
extender associated with the RS into less robust reformulations.
The use of resistant starches as fat substitutes in meat products should
be investigated due to their prebiotic (Sajilata et al., 2006) and technological
properties, including their swelling, gel-forming and water-binding capaci-
ties, and increased viscosity. In breaded products, resistant starches can act
484 Advanced Technologies for Meat Processing, Second Edition

as a coating ingredient as predust and breader due to their crispness prop-

erty, providing an excellent opportunity to promote healthy approaches

15.4.4 Lipid Reformulation Using Vegetable Oils

The improvement of the fatty acid profile of processed meat products as well
as the reduction of total fat and, mainly, saturated fat, has been the subject of
much research and is a great challenge for the meat industry (Hur et al., 2008;
Jiménez-Colmenero, 2007; Hoz et al., 2004; Ansorena and Astiasaran, 2004).
The addition of vegetable or marine oils to meat products is a relevant
strategy to introduce a new source of PUFAs into the diet with a potential
health benefit, since the body needs a balance between the consumption of
saturated, monounsaturated, and PUFAs (López-López et al., 2009).
Vegetable oils reported in the numerous studies in the literature were
selected for their sources of MUFA and PUFA (Pelser et al., 2007; Serrano
et al., 2005). Although some of these oils have been used to increase MUFA
levels, others have been used essentially to increase PUFAs, or more specifi-
cally ω -3, as observed for flaxseed oil (Ansorena and Astiasaran, 2004; Rubio
et al., 2008). Table 15.3 shows some relevant studies on the improvement of
the fatty acid profile in meat products. Olive oil, rich in oleic acid (C18:1),
is one of the most studied vegetable oils, and is used in meat products to

TABLE 15.3
Reformulating Lipid Profile of Meat Products by Adding Vegetable Oils

Vegetable
Processed Oil/l/% Reduced
Meat or Replaced
Authors Product Animal Fat Most Important Results
Muguerza Dry fermented Olive oil/10%, 20%, Changes in lightness and yellowness but
et al. sausages and 30% pork the products had a high sensorial score
(2002) back fat for odor and taste for 20% olive oil.
However, the appearance was just
acceptable because the surface was
wrinkled and case hardening had
developed.

Kayaardı Soudjouk Pre-emulsified fat Moisture, cholesterol, and pH decreased.

and Gök (sucuk) (soy protein No significant difference in appearance,
(2004) isolate)/20%, 40%, texture, color, and general acceptability
and 60% of beef upto 40% olive oil. The highest TBA
fat value was found with the 60% olive oil
replacement. Oleic and linoleic acid
contents were high while other fatty acid
contents were low for the 40% and 60%
olive oil samples compared with
controls.
(Continued)
Fat Reduction in Processed Meats 485

TABLE 15.3 (Continued)

Reformulating Lipid Profile of Meat Products by Adding Vegetable Oils
Vegetable
Processed Oil/l/% Reduced
Meat or Replaced
Authors Product Animal Fat Most Important Results
Lurueña- Frankfurters Olive oil added to The reformulation did not affect emulsion
Martínez locust bean/ stability, jelly and fat separation,
(2004) xanthan gum processing yield, cook loss, texture, and
(0.5% and sensory characteristics.
0.6%)/25% and
40% pork back fat

Muguerza Dry fermented Pre-emulsified soy Significant increase in polyunsaturated

et al. sausages oil/15%, 20%, and fatty acids (25%) and reduction in
(2003) 25% of pork back saturated fatty acids. No increase in lipid
fat oxidation. There were no considerable
effects on hardness and springiness,
color, and sensory attributes.

Severini Salami Extra-virgin olive Significant effects on water activity and

et al. oil/33.5%, 50%, texture. No changes in the shelf life
(2003) and 66.5% of pork regarding both oxidation and loss of
back fat organoleptic quality. The formulation
with 5% olive oil (33%, 3% substitution
of pork back fat) was judged best.

Ansorena Dry- Linseed/25% pork Increased P/S ratio from 0.4 (control) to
and fermented back fat 0.6–0.7 (with linseed oil). The n−6/ n−3
Astiasaran sausages ratio decreased from 14.1 (control) to
(2004) 1.7–2.1 in modified products as a
consequence of the α -linolenic acid
increment. No oxidation changes were
detected during the ripening process.
Rodríguez- Porcine Avocado, Lowered percentage of SFA (from 36.96%
Carpena burger sunflower, and to ~25.30%) and reduction of the
(2012) patties olive oils/100% atherogenic index (from 0.41 to ~0.24)
pork back fat and significantly lower amounts of lipid
and protein oxidation products than
control patties. Avocado oil contributed
with specific aroma-active terpenes to
patties and had a significant impact on
particular color and texture parameters.
Tan et al. Chicken Palm oil and palm Good emulsion stability and strong gels
(2006) frankfurters stearin/chicken after heating; the increment of palm oil
fat raised hardness, chewiness, and shear
hardness; the reduction of CF in the
formulation resulted in lower scores in
chicken flavor, juiciness, oiliness, and
overall acceptance of the frankfurters.
(Continued)
486 Advanced Technologies for Meat Processing, Second Edition

TABLE 15.3 (Continued)

Reformulating Lipid Profile of Meat Products by Adding Vegetable Oils
Vegetable
Processed Oil/l/% Reduced
Meat or Replaced
Authors Product Animal Fat Most Important Results

Choi et al. Meat Olive, corn, Higher values for moisture, protein, ash
(2009) emulsion soybean, canola, content, uncooked and cooked pH
systems or grape seed, and values, b*-value, hardness, cohesiveness,
rice bran gumminess, chewiness, and viscosity
fiber/66.6% pork compared with control containing 30%
back fat pork back fat. Decrease of cooking loss
and better emulsion stability.

Youssef and Comminuted Canola oil or Canola oil or pre-emulsified treatments

Barbut meat pre-emulsified showed a positive effect on improving
(2009) products canola oil (soy yield and textural parameters, but
protein, caseinate, resulted in a significant reduction in
or whey protein redness and meat batters became darker.
isolate)/25.0%, The pre-emulsification oil helps to
17.5%, and 10.0% produce more stable meat matrix.
beef fat

Hur et al. Pork patty Virgin olive oil Reduction in water-holding capacity in
(2008) (isolated soy treatments control and in those
protein and containing isolated soy protein and
carrageenan)/50% carrageenan, and increase in hardness in
pork back fat samples with virgin oil. Sensory
evaluation scores were higher in control
compared to virgin olive oil-substituted
pork patty samples.

Paneras Frankfurter Olive, corn, Reformulated frankfurters (10% fat +

and sunflower, or different oils) had 67% lower total fat,
Bloukas soybean oils/100% 40%–45% lower saturated fatty acids,
(1994) pork back fat 50%–53% lower calories, reduced
cholesterol, and 20% higher meat
protein. They had a darker red color, and
were 6%–7.2% lower in processing yield,
but they were firmer and less juicy. The
type of oil had no effect on these
characteristics. Frankfurters with olive
oil had 41.8% higher monounsaturated
fatty acids and those with seed oils had
5–7 times higher polyunsaturated fatty
acids. Soybean oil negatively affected
overall acceptability and shelf life due to
the increased linolenic acid content.

(Continued)
Fat Reduction in Processed Meats 487

TABLE 15.3 (Continued)

Reformulating Lipid Profile of Meat Products by Adding Vegetable Oils
Vegetable
Processed Oil/l/% Reduced
Meat or Replaced
Authors Product Animal Fat Most Important Results
Valencia Fresh pork Linseed oil or fish Increase in α -linolenic, EPA, and DHA
et al. sausages oil added to and no changes in lightness, but redness
(2008) natural was lower after 7 days of storage.
antioxidants/15% Reformulated cooked pork sausages had
pork back fat no effects in sensory properties,
indicating a potential application to
enhance nutritional properties.
Backes et Italian-type Emulsified canola No changes in all treatments for pH, color,
al. (2013) salami oil/15% and 30% and Aw during manufacture process and
pork back fat storage period. The modified salamis
had lower weight loss and in
substituting 30% pork back fat, an
elevation of lipid oxidation was
observed. At 15% pork back fat
substitution no effect was reported
regarding the sensorial acceptance of the
product for aroma, flavor, color, texture,
and visual appearance.

Mora- Nonacid Sunflower oil + Fat reduction higher than 70% compared
Gallego fermented diacylglycerols/ with the standard fermented sausages;
et al. sausages pork back fat higher sensory ratings and improved
(2016) texture for sunflower oil. Fermented
sausages containing less than 12.5% of
fat added of sunflower oil had a good
overall sensory quality.
Delgado- Pork liver Olive, linseed, and The increase of unsaturated fatty acid
Pando pâtés fish oils added to levels resulted in a higher level of lipid
et al. konjac gels/pork oxidation, despite the low values
(2012) back fat reported at the end of shelf life. The
products were considered safe regarding
biogenic amine contents of products
during shelf life. No changes in
microbial stability were observed in
chilling storage.

partially replace pork back fat. Some authors recommend between 1 and 10 g
of olive oil per 100 g of meatballs (Hsu and Yu, 2002), frankfurters (Lurueña-
Martínez et al., 2004), and dry fermented sausages (Muguerza et al., 2001;
Severini et al., 2003). It was found that olive oil increases the MUFAs in meat
products without significantly altering the ω -6/ω -3 ratio (Muguerza et al.,
2002; Ansorena and Astiasaran, 2004).
488 Advanced Technologies for Meat Processing, Second Edition

Other oils used to reformulate the lipid profile of meat products include
sunflower, cotton, corn, soybean, peanut, linseed, and palm oils, which stand
out by raising the MUFA and PUFA levels, reducing cholesterol, and improv-
ing PUFA/SFA and ω-6/ω-3 ratios (Paneras and Bloukas, 1994; Ambrosiadis
et al., 1996; Hsu and Yu, 2002). Cotton and corn oils are very rich in PUFAs
and contain high linoleic acid (C18:2 ω -6) levels (>56% total fatty acids). Their
addition to meat products improves the PUFA/SFA ratio, with a negative
effect on increasing the ω -6/ω -3 ratio (Paneras and Bloukas, 1994; Paneras
et al., 1998). In most studies, these vegetable oils partially replaced pork back
fat at levels up to 50%–100%.
Due to the technological and functional limitations of vegetable oils in
liquid form, many studies recommend the incorporation of these compo-
nents in the form of pre-emulsions (Berasategi et al., 2011; Beriain et al.,
2011; García-Íñiguez de Ciriano et al., 2010; Rodríguez-Carpena et al., 2012;
Jiménez-Colmenero, 2007). In emulsified products, the application of oil in
liquid form may result in loss of functionality of the batter, with exudation
losses, due to the low melting point, thus requiring a higher content of myofi-
brillar proteins to encompass all lipid content widely dispersed. In addition,
oil in liquid form can negatively affect the emulsion forming and gelling
properties. This phenomenon is also observed in fermented products, with
an extensive oxidative deterioration when vegetable oils in liquid form are
used in the formulations. In products subjected to high temperatures such
as hamburgers and nuggets, the lipid fraction will be easily separated, with
a loss of texture and sensory attributes.
The pre-emulsions used to overcome these technological problems are oil-
in-water type containing an emulsifying agent, generally a nonmeat protein,
which results in increased stability during the shelf life of the product sub-
jected to processing and storage under adequate conditions (Djordjevic et al.,
2004).
Generally, sodium caseinate and soy protein isolate are the protein extend-
ers most commonly used in this type of reformulation, as listed in Table 15.3.
Regardless of the strategy of the addition of these components rich in
MUFAs and PUFAs in the reformulation, many preliminary studies are
required, since they can accelerate the lipid oxidation process, resulting in
the development of off-flavor and toxic compounds due to the degradation
of fatty acids (Jacobsen, 1999).

15.4.5 Use of Structured Lipids

Several strategies to reduce saturated fat and improve the fatty acid profile
may result in defects and technological limitations associated with loss of
flavor, aroma, juiciness, and texture, heat transfer problems, and other pro-
cessing operations as a function of the solid fats in these products. These
challenges have focused on developing liquid oils restructured by different
processes to form functional plastic fats with better technological performance
Fat Reduction in Processed Meats 489

TABLE 15.4
Ingredients Used in Emulsified Lipid Gels and Their Respective Effects
Concentration
Ingredient Effects (%) (References)
Soy protein It forms a gel when subjected to heating and cooling, 5.0%–10.0% (Pires
isolate with protein participating in three distinct phases: Vilela et al., 2011;
denaturation, aggregation, and gelation. A preheating Lee et al., 2006;
stage induces the molecular changes (unfolding of the Delgado-Pando
protein structure and exposure of reactive groups), et al., 2010)
necessary to form the soluble aggregates. The initial
pH of the solution should be sufficiently different from
the isoelectric point of the proteins, and the ionic
strength should be sufficiently low to avoid an
immediate aggregation of the protein molecules
during preheating. T required to form gel: >70°C.
Isoelectric point: 4.5.

Inulin It has different applications in the food industry, 2.0%–10.0%

including gelling properties, increase in viscosity, (Herrero et al.,
improvement of organoleptic properties, and as a 2014; Felisberto
nondigestible fiber in meat products. It is water et al., 2015)
soluble, but dependent on the temperature and degree
of polymerization. It is practically insoluble in cold
water at T < 10°C. It is stable at high temperatures.
Sodium It is widely used due to its functional properties such as 0.5%–5.0% (Lee
caseinate emulsification and water and fat holding capacity, as et al., 2006;
well as the thickening and gelling properties. It gives Jourdain et al.,
good stability to emulsions at neutral pH by 2008; Jiménez-
combination of electrostatic and steric stabilization Colmenero et al.,
mechanisms. β -casein and α 1-casein, which together 2010; Perrechil
account for more than 75% of the total casein, are and Cunha, 2013)
particularly disordered and substantially hydrophobic,
and contribute to its rapid absorption during
emulsification, leading to the rapid establishment of a
thick and sterically stable layer that protects the newly
formed droplets against flocculation and coalescence.
Isoelectric point: 4.5. Stable at very high temperatures.
Carrageenan It is part of a group of water-soluble anionic sulfated 0.5%–1.5%
polysaccharides that interact with proteins at pH (Jourdain et al.,
above and below their isoelectric point. It can affect 2008, Perrechil
the characteristics of the formed gels, depending on its and Cunha, 2013;
composition and type (number/position of sulfate Poyato et al.,
groups and number of 3,6-anhydrogalactose rings per 2014)
disaccharide). In emulsion gels, its stabilizing and/or
emulsifying capacity is mainly due to the greater
electrostatic repulsion from the interaction between
the carrageenan (anionic polysaccharide) and the fat
droplets coated by proteins. This interaction depends
mainly on polymer concentration, pH, and ionic
strength. It is subjected to gelation at temperatures
> 65°C.
(Continued)
490 Advanced Technologies for Meat Processing, Second Edition

TABLE 15.4 (Continued)

Ingredients Used in Emulsified Lipid Gels and Their Respective Effects
Concentration
Ingredient Effects (%) (References)
Pectin Anionic polysaccharide composed of polygalacturonic 0.07%–0.67%
acid and its methyl esters which can generate highly (Simo et al., 2012)
viscous or gel-like materials by heteroaggregation in
systems with electrically charged colloidal particles
(protein-coated fat droplets).
Soy lecithin Emulsifying agent with amphoteric character found in 0.5% (Lupi et al.,
different natural sources, such as soybean and egg, 2012)
composed by a mixture of phospholipids. It
contributes as a stabilizing/gelling agent in systems
with polar solvents (usually water); it is well accepted
by the consumer and considered safe for consumption
by the FDA.
FDA, Food and Drug Administration.

and healthier characteristics when compared to the pre-emulsions previously

discussed. Among the strategies to improve lipid profile emulsion gels have
been used as fat substitutes in emulsified meat products. (Jiménez-Colmenero
et al., 2015; Delgado-Pando et al., 2010).
An emulsified lipid gel is defined as an emulsion containing a gel-like
network structure with mechanical properties similar to that of a solid
compound (Dickinson, 2012, 2013). Its development occurs briefly in two
stages:

1. Formation of an oil + water emulsion containing a protein source

as a surfactant by homogenization under high pressure or high
speed (potent mixers, ultra-turrax, cutters), whose stability can be
improved by the addition of other extender ingredients to the newly
formed emulsion.
2. Formation of a gel from the emulsion obtained in the first step, obtained by
the aggregation of emulsion droplets or gelation of the continuous
phase through an appropriate heat treatment. The transformation
of the liquid state to the soft solid state of protein-based emulsions
occurs during the processing steps, such as heating, acidification, or
enzymatic treatment (Dickinson, 2013).

In meat products, the use of emulsified lipid gels is a very promising strat-
egy for fat reduction. Proteins, different hydrocolloids and functional ingre-
dients, with emphasis on sodium caseinate, whey proteins, soy proteins,
gelatin, lecithin, carrageenan, and IN, among others (Jiménez-Colmenero
et al., 2010; Delgado-Pando et al., 2010) have been evaluated as structuring
agents in the development of lipid gels. Because many of these compounds
have been used either as extenders in meat product formulations or as fat
Fat Reduction in Processed Meats 491

substitutes in single formulations, the potential use of these new ingredients

becomes highly promising.
The proteins can be used as emulsifiers, gelling agents, and thickeners in
the formation of lipid gels due to their ability to facilitate the formation and
improve the stability of O/W emulsions. Several factors influence protein
functionality throughout the lipid gel formation process, which is related to
the solution conditions (pH, ionic strength, surfactants, biopolymers), inter-
actions of the ingredients, and process steps (heat treatment, cooling, freez-
ing, drying, homogenization, and mechanical agitation) (McClements, 2004).
In inadequate conditions, proteins may suffer electrostatic repulsion, which
can destabilize the meat system (Picone et al., 2011). Whey protein isolates,
soy protein isolates, and gluten proteins have been extensively studied for
this purpose.
In addition to proteins, other ingredients can be added to emulsion gels,
especially hydrocolloids (polysaccharides), for their effects on texture and
stability properties (Lal et al., 2006). The protein–polysaccharide interactions
are mainly electrostatic and thus their intensity and strength are dependent
on pH and ionic strength (Dickinson, 1994), which affects the emulsifica-
tion and gelling properties (Dickinson, 2012). The use of structured lipids in
meat products containing substitute salts may affect the technological per-
formance of these compounds as fat substitutes and has been the subject of
many studies.
In meat products, examples of polysaccharides to stabilize emulsion gels
include alginate, IN, and carrageenan (Paradiso et al., 2015). Several factors
can induce gelling of a hydrocolloid, including the addition of calcium ions
(pectin, alginate), temperature reduction (agar, carrageenan, gellan), or
increase in temperature (methylcellulose, hydroxypropylmethylcellulose).
In starches, gelatinization occurs by heating, forming an opaque thermore-
versible gel during cooling. The control of syneresis is one of the points that
deserves great attention. IN gels are formed by a network of small crystals
of approximately 100 nm in diameter that aggregate to form clusters larger
than 1–5 μm, which retain a large amount of water in the network. The
properties of this network resemble a fat-in-oil crystal network. Due to this
similarity, IN has been identified as an alternative ingredient for structur-
ing low-fat and fat-free products (Bot et al., 2004). Table 15.4 presents some
of the gelling agents for gel formation and their potential application in
meat products considering improvement in the nutritional properties in
addition to fat reduction.
The emulsion gels may be a better alternative to mimic the hardness and
water retention capacity conferred by pork back fat in meat products when
compared to the O/W emulsions (Poyato et al., 2014). Various studies have
reported the elaboration of emulsion gels based on olive oil, chia oil, and cold
gelling agents (microblial transglutaminase, alginate, or gelatin) to replace
saturated fat in emulsified products. As positive points, the authors stated an
improvement in the fatty acid profile and reduction of saturated fat content
492 Advanced Technologies for Meat Processing, Second Edition

by up to 50%. Very positive results on the oxidative stability, sensory perfor-

mance, and physicochemical properties have also been reported.

15.5 Challenges of Fat Reduction in Different Meat Products

Pork back fat is the fat source most widely used in different categories of meat
products, representing one of the most suitable raw materials of meat prod-
ucts. It has a high melting point, differentiated texture, and distinct flavor
characteristics due to its high SFA composition (Ospina-E et al., 2012), present-
ing excellent stability. On the other hand, “soft fats” or liquid oils have a high
content of MUFAs and PUFAs, which can cause technological and sensory
problems in meat products, affecting the appearance and slice ability, with a
tendency toward lipid oxidation (Maw et al., 2003). Likewise, some sensory
problems can take place when fatty cuts are replaced by lean cuts, affecting the
texture, softness, and juiciness of meat products. Each product category has
its specific challenges, making it necessary to know them for a senspory suc-
cessful lipid reformulations with stability and safety throughout the shelf life.

15.5.1 Emulsified Meat Products

Meat emulsions are obtained from a mixture of raw meat, fat/fat tissue, water
in the form of ice, and various additives and ingredients (such as nitrite, salt,
phosphates, and condiments), subjected to a reduction in particle size (cut-
ter comminution or high-pressure homogenization), processed in a single
phase, stuffed into natural or artificial casings, and subjected to adequate
heat treatment and cooling. Myofibrillar proteins are extracted by increasing
the ionic strength in the presence of sodium chloride, which includes fat and
water particles, forming a network stabilized by the gel formation during
cooking and cooling. A wide variety of products consumed throughout the
world belongs to this category, including bologna sausage, sausage, meatloaf,
among others (Shimokomaki et al., 2006).
Fat reduction strongly affects emulsion stability, water-binding capacity,
and gel formation, with negative effects on the quality of the final products.
It is associated with various factors, such as fat particle size, emulsion pH,
nonmeat ingredients, meat species (bovine, pork, or poultry), processing
time and temperature, cooking method, etc. (Sorapukdee et al., 2013). The
higher the fat reduction with partial replacement by water or vegetable oils,
the greater the cooking losses, providing a very soft and sandy texture to the
product (Sorapukdee et al., 2013). In formulations containing high levels of
vegetable oil, higher protein concentrations are needed to recover the lipid
content, keeping it in the net of the batter.
Carbohydrate-based extenders or proteins can be used in systems with
partial replacement of fat by water, which contributes to stabilize the bound
Fat Reduction in Processed Meats 493

water, avoiding water release during cooking or storage. Such extensors, as

previously discussed, may be hydrocolloids, fibers, or nonmeat proteins,
but an inadequate selection can result in an increased size of the emulsion
particles, darker color of the product, reduction of the meat flavor attri-
butes, and decrease in the shelf life, with loss of microbiological stability
(Cengiz and Gokoglu, 2005). The major challenges are the maintenance of
the identity of the traditional product, especially firmness and cohesive-
ness, as well as avoiding water release in the package during storage (Claus
et al., 1990).
These technological challenges stand out in low-cost formulations contain-
ing high levels of mechanically separated chicken meat, which is a techno-
logical resource widely used in many countries and permitted by law. In
this case, the lower supply of myofibrillar proteins and the higher fat content
of the low-cost raw materials together with the prooxidant compounds that
normally occur during the mechanical deboning impair the fat reduction in
popular products.

15.5.2 Fermented Meat Products

A set of barriers is used to maintain the safety of fermented meat sausages,
including water activity at around 0.90, a decrease in pH, and the addition of
nitrite and salt (Leistner, 1992).
Whereas the drying stage leads to high water loss and concentration of
other components, the fat reduction in fermented sausages, as is the case of
dry fermented sausages, represents a greater challenge when compared to
other meat products, concerning the physicochemical stability and sensory
properties (Mendoza et al., 2001).
The major technological challenge of fat reduction in fermented sau-
sages is the maintenance of the characteristic texture, due to the addi-
tion of pork back fat. The fat content of the fermented sausages can reach
up to 50% of the formulation after the drying stage (Wirth, 1988), which
markedly affects the speed and water evaporation during the process.
This is one of the reasons for the low sensory acceptance of fat-reduced
sausages (Muguerza et al., 2002), due to the harder and more elastic tex-
ture with undesirable appearance caused by a greater weight loss and fat
reduction (Muguerza et al., 2002). In addition, fat is responsible for the
generation of volatile flavor and aroma compounds. Lipolysis has an
important role in the generation of free fatty acids from the enzymatic
hydrolysis, which are substrates for oxidation reactions, leading to the
formation of compounds responsible for the aroma of the product (Lücke,
1985; Verplaetse, 1994).
However, these defects can be minimized through adequate processing
and correct control of moisture and temperature of the maturation chamber
(Jiménez-Colmenero, 1996). Different types of packaging were also studied
by Liaros et al. (2009) and Koutsopoulos et al. (2008) to improve the external
494 Advanced Technologies for Meat Processing, Second Edition

appearance and to control the lipid oxidation improved by the addition of

vegetable oils to dry fermented sausages with reduced fat content.
As regards the reformulation of lipid profile, some strategies suggest the
use of vegetable oils in the form of pre-emulsions (Muguerza et al., 2002),
which may be an additional challenge, once the pre-emulsions require the
use of stabilizing ingredients, such as caseinates, soy protein isolates, car-
rageenan, etc., which can also interfere with the texture profile and sensory
properties (Dickinson, 2013; Zóia, 2011).

15.5.3 Restructured Injected and Marinated Meat Products

Restructured injected meat products include hams, loins, perennis, canopy,
turkey breast, and a series of ready-to-eat seasoned cuts. Generally, the fat
reduction in such products occurs preferentially by the use of lean cuts, for
example, cuts from the rear back portion of the animals. However, the search
for healthier claims and lower costs (Brashear et al., 2002) suggests the use of
functional ingredients as fat substitutes.
Fibers and a number of soluble hydrocolloids capable of interacting with
the myofibrillar proteins, water, and fat portion are the preferred ingredi-
ents for reduction and/or partial replacement of fat in restructured prod-
ucts. Such compounds are introduced into the process through the steps of
marinating, tumbling, and massaging, or simply in the injection step. The
resulting effects are increased water retention capacity and higher protein–
protein interaction, with the advantage of shortening the processing time,
and increasing the color uniformity, texture, fat distribution, and binding,
especially when the injection stage is not conducted (Sheard, 2002).
In general, soluble fibers and hydrocolloids, maltodextrins, and cer-
tain additives such as phosphates are added to the brine in brine-mixing
tanks, and then incorporated into meat cuts through marinate injectors.
The retention of the functional compounds will depend on the compatibil-
ity between meat cuts and these ingredients and additives. The ingredients
may be selected according to their solubility, dispersibility, and the viscosity
at low temperatures. In most cases, brine should be kept at relatively low
temperatures to increase muscle retention and process yield (Varnam and
Sutherland, 1995) and to ensure microbiological safety. The main problem
that can arise in the manufacturing of restructured products is the need to
couple a blender to disperse the ingredients, particularly the starch deriva-
tives and soy protein, due to their longer dispersion, which may cause dif-
ficulties in cleaning the circuit the brine passes through. During cooking,
the product should be kept stable, and the fat reduction should not promote
the separation of the restructured cuts after cooling. When subjected to high
temperatures, the gelation phenomenon occurs and the exudate liquid forms
a film, which retains moisture, improving texture and juiciness (Varnam
and Sutherland, 1995). However, a large release caused by functional ingre-
dients that don’t have suitable binding properties and reduction of saturated
Fat Reduction in Processed Meats 495

fat with a high melting point can seriously compromise the physicochemical,
sensory, and microbiological stability of the products.

15.5.4 Restructured and Breaded Meat Products

Breaded meat products subjected to the frying process are among the most
accepted by consumers since the oil introduced into the product confers
special crispness, flavor, succulence, and aroma when replacing part of the
water. However, excessive fat in the final product with an increase of up to
one-third of the energy value leads to many nutritional restrictions.
According to Ordóñez (2005), the process of elaborating the breaded meat
products consists basically of the following operations: (1) preparation of the
meat matrix with particle size reduction (grinding of raw material) in the
case of nuggets, blends of ingredients and spices, molding or marination for
small cuts, and tumbling; (2) coating through a specific coating system; and
(3) partial prefrying or total frying, freezing, and packaging.
The traditional breading system consists of predust, liquid mixtures (bat-
ter), and coating flours. The order of addition and use of these components
may vary; there is no correct order and not all of these components are used
(Bortoluzzi, 2006; GL, 2002; Uemura and Luz, 2003).
Strategies have been proposed to reduce the absorbed oil in the coating
systems and meat batters (Huebner-Keese et al., 2016). According to Brannan
et al. (2014), the phenomenon of oil absorption is explained by a series of
events that include (1) replacement of water by oil (mass transfer) at tempera-
tures around 180ºC, (2) a cooling effect, when the fried product is removed
from the hot oil with sudden drop in pore pressure, creating a vacuum effect
that sucks the oil that adhered to the surface into the pores, and (3) triacyl-
glycerol degradation in the oil to more polar compounds (diacylglycerols,
monoglycerides, free fatty acids, and glycerol) that act as surfactants, reduc-
ing the tension between oil and water, collaborating to increase oil absorp-
tion, particularly in aged oils.
Based on these events, many compounds have been added to the predust,
batter, or breader to reduce oil absorption and to act as barriers, facilitat-
ing water release and reducing oil absorption, often as a consequence of
reduced vapor escape during frying. Some compounds can favor the forma-
tion of thermally induced gels and alteration of the surface hydrophobicity,
contributing to the reduction of fat absorbed during the frying process. In
meat products, these compounds include sodium caseinate, whey protein
concentrate, starch, methyl cellulose, xanthan gum (Altunakar et al., 2006),
modified cellulose derivatives, PD, hydroxymethyl cellulose (Jamshidi and
Shabanpour, 2014), pregelatinized rice flour, phosphorylated rice starch,
pregelatinized acetylated rice starch, pectates, gelatin, and alginate esters
(Sahin et al., 2005).
Functional ingredients such as soluble or insoluble fibers have also
been used as excellent carriers in the batters of restructured breaded and
496 Advanced Technologies for Meat Processing, Second Edition

nonbreaded products, such as hamburgers, in general as a model system to

evaluate new fat substitutes.

15.6 Final Considerations

Fat reduction in processed meat products is one of the most important refor-
mulations aimed at promoting healthier consumption appeals, contribut-
ing to improve their nutritional value. Although these products are sources
of proteins, liposoluble vitamins, essential fatty acids, and many minerals
important for maintenance of a healthy diet, their high fat content, especially
saturated fat, stimulate a negative perception of product quality by consumers.
However, the manufacture of reduced-fat meat products presents many
technological, sensory, and safety challenges, since fat plays functions that
cannot be easily replaced. The simple reduction of back fat, the main source
of fat used in formulations, greatly affects the texture attributes, flavor, per-
ception of satiety, microbiological safety, and physicochemical stability, com-
promising the product’s quality.
Strategies, such as the use of fat replacers based on ingredients compatible
with meat matrixes of processed products, restructured lipids, such as emul-
sion gels, and partial replacement with vegetable oils, are among the most
studied alternatives to overcome the technological and sensory challenges
in low-fat meat products.
The specific characteristics of each category of processed meat product,
including the raw materials used, processing methods, packaging, and esti-
mated shelf life should be evaluated to obtain safe, stable, and well-accepted
food products. Finally, simultaneous reformulations, such as sodium or
phosphate reduction, can present additional challenges that can be overcome
after careful selection of the manufacturing practices, the use of ingredients
with functional properties compatible with the new meat matrix, and the
competence to choose physicochemical and sensory methodologies to accu-
rately interpret the effects of lipid reformulation on consumers’ perception.

References
AACC. (2001). The definition of dietary fiber. Cereal Foods World, 46(3), 112.
Adam-Perrot, A., Gutton, L., Sanders, L., et al. (2009). Resistant starch and starch-
derived oligosaccharides as prebiotics. In: Charalampopoulos, D. and Rastall,
R. A. (Eds.). Prebiotics and Probiotics Science and Technology. New York: Springer,
volume 1, pp. 259–291.
Akoh, C. C. (1998). Structured lipids. In: Akoh, C. C. and Min, D. B. (eds.) Food Lipids
Chemistry, Nutrition, and Biotechnology. New York, NY: Marcel Dekker, pp. 699–727.
Fat Reduction in Processed Meats 497

Altunakar, B., Sahin, S. and Sumnu, G. (2006). Effects of hydrocolloids on appar-

ent viscosity of batters and quality of chicken nuggets. Chemical Engineering
Communications, 193(6), 675–682. doi:10.1080/00986440500194069.
Álvarez, D. and Barbut, S. (2013). Effect of inulin, β -glucan and their mixtures on
emulsion stability, color and textural parameters of cooked meat batters. Meat
Science, 94(3), 320–327. doi:10.1016/j.meatsci.2013.02.011.
Alves, L. A. A., dos, S., Lorenzo, J. M., Gonçalves, C. A. A. et al. (2016). Production of
healthier bologna type sausages using pork skin and green banana flour as fat
replacers. Meat Science, 121, 73–78. doi:10.1016/j.meatsci.2016.06.001.
Ambrosiadis, J., Vareltzis, K. P. and Georgakis, S. A. (1996). Physical, chemical
and sensory characteristics of cooked meat emulsion style products contain-
ing vegetable oils. International Journal of Food Science and Technology, 31(2),
189–194.
Andersson, R., Eliasson, C., Selenare, M., Kamal-Eldin, A. and Åman, P. (2003). Effect
of endo-xylanase-containing enzyme preparations and laccase on the solubil-
ity of rye bran arabinoxylan. Journal of the Science of Food and Agriculture, 83(7),
617–623. doi:10.1002/jsfa.1321.
Annison, G. and Topping, D. L. (1994). Nutritional role of resistant starch: Chemical
structure vs physiological function. Annual Review of Nutrition, 14(1), 297–320.
doi:10.1146/annurev.nu.14.070194.001501.
Ansorena, D. and Astiasaran, I. (2004). Effect of storage and packaging on fatty
acid composition and oxidation in dry fermented sausages made with
added olive oil and antioxidants. Meat Science, 67, 237–244. doi:10.1016/
j.meatsci.2003.10.011.
Appleton, K. M, Rogers, P. J. and Ness, A. R. (2010). Updated systematic review
and meta-analysis of the effects of n-3 long-chain polyunsaturated fatty acids
on depressed mood. American Journal of Clinical Nutrition, 91(3), 757–770.
doi:10.3945/ajcn.2009.28313.
Arihara, K. (2006). Strategies for designing novel functional meat products. Meat
Science, 74(1), 219–229. doi:10.1016/j.meatsci.2006.04.028.
Backes, A. M., Nascimento Terra, N., Inês, L., Milani, G., De, A. P., Rezer, S. et al.
(2013). Physico-chemical characteristics and sensory acceptance of Italian-type
salami with canola oil addition. Semina: Ciências Agrárias, 34(2), 3709–3720.
doi:10.5433/1679-0359.2013v34n6Supl2p3709.
Balk, E. M., Lichtenstein, A. H., Chung, M., Kupelnick, B., Chew, P. and Lau, J. (2006).
Effects of omega-3 fatty acids on serum markers of cardiovascular disease risk:
A systematic review. Atherosclerosis, 189(1), 19–30. doi:10.1016/ j.atherosclero-
sis.2006.02.012.
Barceló-Coblijn, G. and Murphy, E. J. (2009). Alpha-linolenic acid and its conversion
to longer chain n−3 fatty acids: Benefits for human health and a role in main-
taining tissue n−3 fatty acid levels. Progress in Lipid Research, 48(6), 355–374.
doi:10.1016/j.plipres.2009.07.002.
Bater, B., Descamps, O. and Maurer, A. J. (1992). Quality characteristics roasted of
hydrocolloid-added turkey breasts. Journal of Food Science, 57(5), 1068–1070.
Beer, M. U., Wood, P. J. and Weisz, J. (1997). Molecular weight distribution and (1→3)
(1→4)-β -D-glucan content of consecutive extracts of various oat and barley cul-
tivars. Cereal Chemistry. American Association of Cereal Chemists, 74(4), 476–480.
doi:10.1094/CCHEM.1997.74.4.476.
498 Advanced Technologies for Meat Processing, Second Edition

Berasategi, I., Legarra, S., de Ciriano, M. G. et al. (2011). “High in omega-3 fatty acids”
bologna-type sausages stabilized with an aqueous-ethanol extract of Melissa offi-
cinalis. Meat Science, 88(4), 705–711. doi:10.1016/j.meatsci.2011.02.035.
Beriain, M. J., Gómez, I., Petri, E., Insausti, K. and Sarriés, M. V. (2011). The effects of
olive oil emulsified alginate on the physico-chemical, sensory, microbial, and
fatty acid profiles of low-salt, inulin-enriched sausages. Meat Science, 88(1) 189–
197. doi:10.1016/j.meatsci.2010.12.024.
Bernardi, D. M., Bertol, T. M., Pflanzer, S. B., Sgarbieri, V. C. and Pollonio, M. A.
R. (2016). ω -3 in meat products: Benefits and effects on lipid oxidative stabil-
ity. Journal of the Science of Food and Agriculture, 96(8), 2620–2634. doi:10.1002/
jsfa.7559.
Biesalski, H. -K. (2005). Meat as a component of a healthy diet – are there any risks or
benefits if meat is avoided in the diet? Meat Science, 70(3), 509–524. doi:10.1016/j.
meatsci.2004.07.017.
Blundell, J. E. (2006). Perspective on the central control of appetite. Obesity (Silver
Spring, Md.) 14(Suppl 4) (July), 160S–163S. doi:10.1038/oby.2006.298.
Bonanome, A., Pagnan, A., Biffanti, S. et al. (1992). Effect of dietary monounsatu-
rated and polyunsaturated fatty acids on the susceptibility of plasma low
density lipoproteins to oxidative modification. Arteriosclerosis and Thrombosis:
A Journal of Vascular Biology, 12(4), 529–533. http://www.ncbi.nlm.nih.gov/
pubmed/1558840.
Bonanome, A. and Grundy, S. M. (1988). Effect of dietary stearic acid on plasma cho-
lesterol and lipoprotein levels. New England Journal of Medicine, 318(19), 1244–
1248. doi:10.1056/NEJM198805123181905.
Borderías, A. J., Sánchez-Alonso, I. and Pérez-Mateos, M. (2005). New applications
of fibres in foods: Addition to fishery products. Trends in Food Science and
Technology, 16(10), 458–465. doi:10.1016/j.tifs.2005.03.011.
Bornet, F. R. (1994). Undigestible sugars in food products. American Journal of
Clinical Nutrition, 59(3 Suppl), 763S–769S. http://www.ncbi.nlm.nih.gov/
pubmed/8116563.
Bortoluzzi, R. C. (2006). Empanados. In: Olivo, R. (ed.) O mundo do frango: Cadeia
produtiva da carne de frango. Criciúma: Ed. do Autor, pp. 481–494.
Bot, A., Erle, U., Vreeker, R. and Agterof, W. G. M. (2004). Influence of crystallisation
conditions on the large deformation rheology of inulin gels. Food Hydrocolloids,
18(4), 547–556. doi:10.1016/j.foodhyd.2003.09.003.
Brannan, R. G., Mah, E. M. S., Yuan, S., Casher, K. L., Myers, A. and Herrick, C. (2014).
Influence of ingredients that reduce oil absorption during immersion frying
of battered and breaded foods. European Journal of Lipid Science and Technology,
116(3), 240–254. doi:10.1002/ejlt.201200308.
Brashear, G., Brewer, M. S., Meisinger, D. and McKeith, F. K. (2002). Raw mate-
rial pH, pump level and pump composition on quality characteristics of
pork. Journal of Muscle Foods, 13(3), 189–204. doi:10.1111/j.1745-4573.2002.
tb00330.x.
Brennan, C. S. (2005). Dietary fibre, glycaemic response, and diabetes. Molecular
Nutrition & Food Research, 49(6), 560–570. doi:10.1002/mnfr.200500025.
Brennan, C. S. and Cleary, L. J. (2005). The potential use of cereal (1→3,1→4)-β -D-glucans
as functional food ingredients. Journal of Cereal Science, 42(1), 1–13. doi:10.1016/
j.jcs.2005.01.002.
Fat Reduction in Processed Meats 499

Brewer, M. S. (2012). Reducing the fat content in ground beef without sacrificing qual-
ity: A review. Meat Science, 91(4), 385–395. doi:10.1016/j.meatsci.2012.02.024.
Burdock, G. A. and Flamm, W. G. (1999). A review of the studies of the safety of
polydextrose in food. Food and Chemical Toxicology, 37(2), 233–264. doi:10.1016/
S0278-6915(98)00113-6.
Cáceres, E., García, M. L., Toro, J. and Selgas, M. D. (2004). The effect of fructooli-
gosaccharides on the sensory characteristics of cooked sausages. Meat Science,
68(1), 87–96. doi:10.1016/j.meatsci.2004.02.008.
Campagnol, P. C. B., dos Santos, B. A., Wagner, R., Terra, N. N. and Pollonio, M.
A. R. (2013). The effect of soy fiber addition on the quality of fermented
sausages at low-fat content. Journal of Food Quality, 36(1), 41–50. doi:10.1111/
jfq.12013.
Campagnol, P. C. B., Dos Santos, B. A., Wagner, R., Terra, N. N. and Pollonio, M. A. R.
(2012). Amorphous cellulose gel as a fat substitute in fermented sausages. Meat
Science, 90(1), 36–42. doi:10.1016/j.meatsci.2011.05.026.
Candogan, K. and Kolsarici, N. (2003). The effects of carrageenan and pectin on some
quality characteristics of low-fat beef frankfurters. Meat Science, 64(2), 199–206.
doi:10.1016/S0309-1740(02)00181-X.
Carballo, J., Barreto, G. and Jiménez-Colmenero, F. (1995). Starch and egg white influ-
ence on properties of bologna sausage as related to fat content. Journal of Food
Science, 60(4), 673–677.
Carraro, C. I. (2012). The use of resistant starch as fat replacers extenders ingredients
in emulsified meat products. Unpublished Master’s dissertation, Universidade
Estadual de Campinas, Brazil.
Catalani, L. A. et al. 2003. Fibras alimentares. Revista Brasileira de Nutrição Clínica,
18(4): 178–182.
Cava, R., Ladero, L., Cantero, V. and Rosario Ramírez, M. (2012). Assessment of differ-
ent dietary fibers (tomato fiber, beet root fiber, and inulin) for the manufacture
of chopped cooked chicken products. Journal of Food Science, 77(4), C346–C352.
doi:10.1111/j.1750-3841.2011.02597.x.
Cengiz, E. and Gokoglu, N. (2005). Changes in energy and cholesterol contents of
frankfurter-type sausages with fat reduction and fat replacer addition. Food
Chemistry, 91(3), 443–447. doi:10.1016/j.foochem.2004.06.025.
Champ, M. M. (2004). Physiological aspects of resistant starch and in vivo measure-
ments. Journal of AOAC International, 87, 749–755.
Chardigny, J. M., Arnal, M. A., Juanéda, P., Genty, M., Grégoire, S. and Sebédio, J. L.
(2001). Effect of cis-9, trans-11 and 10-trans, 12cis-CLA isomers in two strains of
mice. Annals of Nutrition and Metabolism, 45(Suppl 1), 559.
Chawla, R. and Patil, G. R. (2010). Soluble dietary fiber. Comprehensive Reviews in Food
Science and Food Safety, 9(2), 178–196. doi:10.1111/j.1541-4337.2009.00099.x.
Chevance, F. F., Farmer, L. J., Desmond, E. M., Novelli, E., Troy, D. J. and
Chizzolini, R. (2000). Effect of some fat replacers on the release of vola-
tile aroma compounds from low-fat meat products. Journal of Agricultural
and Food Chemistry, 48(8), 3476–3484. http://www.ncbi.nlm.nih.gov/
pubmed/10956136.
Choi, Y. S., Choi, J. H., Han, D. J. et al. (2009). Characteristics of low-fat meat emul-
sion systems with pork fat replaced by vegetable oils and rice bran fiber. Meat
Science, 82(2), 266–271. doi:10.1016/j.meatsci.2009.01.019.
500 Advanced Technologies for Meat Processing, Second Edition

Choi, Y. S., Kim, Y. B., Kim, H. W. et al. (2015). Emulsion mapping in pork meat
emulsion systems with various lipid types and brown rice fiber. Korean
Journal for Food Science of Animal Resources, 35(2), 258–264. doi:10.5851/
kosfa.2015.35.2.258.
Cierach, M., Modzelewska-Kapituła, M. and Szaciło, K. (2009). The influence of car-
rageenan on the properties of low-fat frankfurters. Meat Science, 82(3), 295–299.
doi:10.1016/j.meatsci.2009.01.025.
Claus, J. R. (1991). Fat reduction in comminuted meat systems. Reciprocal Meat
Conference Proceedings, 44, 93–99.
Claus, J. R. and Hunt, M. C. (1991). Low-fat, high added-water bologna formulated
with texture-modifying ingredients. Journal of Food Science, 56(3), 643–647.
doi:10.1111/j.1365-2621.1991.tb05347.x.
Claus, J. R., Hunt, M. C. and Kastner, C. L. (1990). Effects of substituting added water
for fat on the textural, sensory, and processing characteristics of bologna. Journal
of Muscle Foods, 1(1), 1–21. doi:10.1111/j.1745-4573.1990.tb00349.x.
Dangour, A. D., Andreeva, V. A., Sydenham, E. and Uauy, R. (2012). Omega 3 fatty
acids and cognitive health in older people. British Journal of Nutrition, 107(S2),
S152–S158. doi:10.1017/S0007114512001547.
Decker, E. A. and Park, Y. (2010). Healthier meat products as functional foods. Meat
Science, 86(1), 49–55. doi:10.1016/j.meatsci.2010.04.021.
Delgado-Pando, G.; Cofrades, S.; Ruiz-Capillas, C.; et al. (2012). Enriched n-3 PUFA/
konjac gel low-fat pork liver pate: Lipid oxidation, microbiological properties
and biogenic amine formation during chilling storage. Meat Science 92(4): 762--
767. doi.org/10.1016/j.meatsci.2012.06.035
Denke, M. A. and Grundy, S. M. (1992). Comparison of effects of lauric acid and
palmitic acid on plasma lipids and lipoproteins. American Journal of Clinical
Nutrition, 56(5), 895–898. http://www.ncbi.nlm.nih.gov/pubmed/1415008.
Dickinson, E. (1994). Protein-stabilized emulsions. Journal of Food Engineering, 22, 59–
74. doi:10.1016/j.cocis.2004.09.003.
Dickinson, E. (2012). Emulsion gels: The structuring of soft solids with protein-
stabilized oil droplets. Food Hydrocolloids, 28(1), 224–241. doi:10.1016/
j.foodhyd.2011.12.017.
Dickinson, E. (2013). Stabilising emulsion-based colloidal structures with mixed
food ingredients. Journal of the Science of Food and Agriculture, 93(4), 710–721.
doi:10.1002/jsfa.6013.
Djordjevic, D., Kim, H. -J., McClements, D. J. and Decker, E. A. (2004). Physical sta-
bility of whey protein-stabilized oil-in-water emulsions at pH 3: Potential ω -3
fatty acid delivery systems (part A). Journal of Food Science, 69(5), C351–C355.
doi:10.1111/j.1365-2621.2004.tb10696.x.
Dogan, S. F., Sahin, S. and Sumnu, G. (2005). Effects of soy and rice flour addition on
batter rheology and quality of deep-fat fried chicken nuggets. Journal of Food
Engineering, 71(1), 127–132.
Dos Santos, B. A., Pollonio, M. A. R. and Cruz, A. G. (2013). Ultra-flash profile and
projective mapping for describing sensory attributes of prebiotic mortadellas.
Food Research International, 54, 1705–1711. doi:10.1016/j.foodres.2013.09.022.
De Oliveira Faria, M., Cipriano, T. M., da Cruz, A. G, Santos, B. A., Pollonio, M. A.,
Campagnol, P. C. (2015). Properties of bologna-type sausages with pork back-fat
replaced with pork skin and amorphous cellulose. Meat Science 104: 44--51. doi.
org/10.1016/j.meatsci.2015.02.002
Fat Reduction in Processed Meats 501

Dos Santos, B. A., Bastianello Campagnol, P. C., Bertoldo Pacheco, M. T. et al.

(2012) Fructooligosaccharides as a fat replacer in fermented cooked sau-
sages. International Journal of Food Science and Technology, 47(6): 1183–1192. doi:
10.1111/j.1365-2621.2012.02958.x
Drewnowski, A. (1997). Taste preferences and food intake. Annual Review of Nutrition,
17(1), 237–253. doi:10.1146/annurev.nutr.17.1.237.
Dunstan, J. A., Simmer, K., Dixon, G. and Prescott, S. L. (2008). Cognitive assessment
of children at age 21/2 years after maternal fish oil supplementation in preg-
nancy: A randomised controlled trial. Archives of Disease in Childhood—Fetal and
Neonatal Edition, 93(1), F45–F50. doi:10.1136/adc.2006.099085.
Eckel, R. H., Jakicic, J. M., Ard, J. D. et al. (2014). 2013 AHA/ACC Guideline on
lifestyle management to reduce cardiovascular risk: A report of the American
College of Cardiology/American Heart Association task force on practice
guidelines. Journal of the American College of Cardiology, 63(25 PART B), 2960–
2984. doi:10.1016/ j.jacc.2013.11.003.
EFSA Panel and Dietetic Products. (2010). Scientific opinion on establishing
food-based dietary guidelines. EFSA Journal, 8(3), 1460–1502. doi:10.2903/j.
efsa.2010.1460.
Egbert, W., Huffman, R. D. L., Chen, C. M. and Dylewski, D. P. (1991). Development
of low-fat ground beef. Food Technology, 45, 64.
Eim, V. S., Simal, S., Rosselló, C. and Femenia, A. (2008). Effects of addition of carrot
dietary fibre on the ripening process of a dry fermented sausage (sobrassada).
Meat Science, 80(2), 173–182. doi:10.1016/j.meatsci.2007.11.017.
Ergönül, B., Ergönül, P. G. and Obuz, E. (2009). Functional traits of prebiotic ingredi-
ents of meat products—chemical, textural and sensory traits of meatballs con-
taining inulin and oligofructose as prebiotic additives. Fleischwirtschaft, 89(2),
140–154.
Felisberto, M. H. F., Galvão, M. T. E. L., Picone, C. S.F. , Cunha, R. L. and Pollonio,
M. A. R. (2015). Effect of prebiotic ingredients on the rheological properties and
microstructure of reduced-sodium and low-fat meat emulsions. LWT—Food
Science and Technology, 60(1), 148–155. doi:10.1016/j.lwt.2014.08.004.
Fernández-Ginés, J. M., Fernández-López, J., Sayas-Barberá, E., Sendra, E. and
Pérez-Álvarez, J. A. (2004). Lemon albedo as a new source of dietary fiber:
Application to bologna sausages. Meat Science, 67(1), 7–13. doi:10.1016/j.
meatsci.2003.08.017.
Fernández-López, J., Sendra, E., Sayas-Barberá, E., Navarro, C. and Pérez-Alvarez,
J. A. (2008). Physico-chemical and microbiological profiles of “salchichón”
(Spanish dry-fermented sausage) enriched with orange fiber. Meat Science, 80(2),
410–417. doi:10.1016/j.meatsci.2008.01.010.
Finocchiaro, E. T., Birkett, A. and Okoniewska, M. (2009). Resistant starch. In: Cho,
S. S. and Samuel, P. (eds.) Fiber Ingredients: Food Applications and Health Benefits.
Boca Raton, FL: CRC Press.
Furuhjelm, C., Warstedt, K., Larsson, J. et al. (2009). Fish oil supplementation in preg-
nancy and lactation may decrease the risk of infant allergy. Acta Paediatrica,
98(9), 1461–1467. doi:10.1111/j.1651-2227.2009.01355.x.
García, M. L., Cáceres, E. and Selgas, M. D. (2006). Effect of inulin on the tex-
tural and sensory properties of mortadella, a Spanish cooked meat prod-
uct. International Journal of Food Science and Technology, 41(10), 1207–1215.
doi:10.1111/j.1365-2621.2006.01186.x.
502 Advanced Technologies for Meat Processing, Second Edition

García, M. L., Dominguez, R., Galvez, M. D., Casas, C. and Selgas, M. D. (2002).
Utilization of cereal and fruit fibres in low fat dry fermented sausages. Meat
Science, 60(3), 227–236. doi:10.1016/S0309-1740(01)00125-5.
García-Íñiguez de Ciriano, M., Larequi, E., Rehecho, S. et al. (2010). Selenium, iodine,
w-3 PUFA and natural antioxidant from Melissa officinalis L.: A combination of
components from healthier dry fermented sausages formulation. Meat Science,
85(2), 274–279. doi:10.1016/j.meatsci.2010.01.012.
Gibson, G. R., Beatty, E. R. Wang, X. and Cummings, J. H. (1995). Selective stimulation
of Bifidobacteria in the human colon by oligofructose and inulin. Gastroenterology,
108(4), 975–982. http://www.ncbi.nlm.nih.gov/pubmed/7698613.
Giese, J. (1996). Fats, oils, and fat replacers. Food Technology, 61(4), 78–83.
GL-Laboratories Worldwide. (2002). Guia Completo Para Sistemas De Cobertura.
Guarulhos: GLLW, 41.
Grigelmo-Miguel, N., Abadías-Serós, M. I. and Martín-Belloso, O. (1999).
Characterisation of low-fat high-dietary fibre frankfurters. Meat Science, 52(3),
247–256. doi:10.1016/S0309-1740(98)00173-9.
Grundy, S. M. (1994). Influence of stearic acid on cholesterol metabolism relative to
other long-chain fatty acids. American Journal of Clinical Nutrition, 60(6 Suppl),
986S–990S. http://www.ncbi.nlm.nih.gov/pubmed/7977157.
Grundy, S. M. and Vega, G. L. (1988). Plasma cholesterol responsiveness to saturated
fatty acids. American Journal of Clinical Nutrition, 47(5), 822–824. http://www.
ncbi.nlm.nih.gov/pubmed/3364396.
Hachmeister, K. A. and Herald, T. J. (1998). Thermal and rheological properties and
textural attributes of reduced-fat turkey batters. Poultry Science, 77(4), 632–638.
Halford, J. C. G. and Harrold, J. A. (2012). Satiety-enhancing products for appe-
tite control: Science and regulation of functional foods for weight man-
agement. Proceedings of the Nutrition Society, 71(2), 350–362. doi:10.1017/
S0029665112000134.
Harris, W. S. and Von Schacky, C. (2004). The omega-3 index: A new risk factor
for death from coronary heart disease? Preventive Medicine, 39(1), 212–220.
doi:10.1016/j.ypmed.2004.02.030.
Hart, B. and Price, K. (1993). New potential for low fat beef burgers. Food Manufacture,
68, 42–43.
Hasjim, J., Lee, S. O., Hendrich, S., Setiawan, S., Ai, Y. and Jane, J. L. (2010).
Characterization of a novel resistant-starch and its effects on postpran-
dial plasma-glucose and insulin responses. Cereal Chemistry, 87(4), 257–262.
doi:10.1094/CCHEM-87-4-0257.
Herrero, A. M., Carmona, P., Jiménez-Colmenero, F. and Ruiz-Capillas, C. (2014).
Polysaccharide gels as oil bulking agents: Technological and structural proper-
ties. Food Hydrocolloids, 36, 374–381. doi:10.1016/j.foodhyd.2013.08.008.
Hort, J. and Cook, D. (2007). Formulating low-fat food: The challenge of retain-
ing flavour quality. In: Taylor, A. and Hort, J. (eds.) Modifying Flavour in Food.
Cambridge: Woodhead Publishing in Food Science, Technology and Nutrition,
131–143.
Hoz, L., D’Arrigo, M., Cambero, I. and Ordóñez, J. A. (2004). Development of an n-3
fatty acid and a-tocopherol enriched dry fermented sausage. Meat Science, 67(3),
485–495. doi:10.1016/j.meatsci.2003.12.001.
Hsu, S. Y. and Yu, S. H. (2002). Comparisons on 11 plant oil fat substitutes for low-fat
kung-wans. Journal of Food Engineering, 51(3), 9–14.
Fat Reduction in Processed Meats 503

Huebner-Keese, B., Guo, J., Adden, R. et al. (2016). Enable fat reduced deep fried
food and meat products by cellulose ethers. In: Williams, P. A. and Phillips, G.
(eds.) Gums and Stabilisers for the Food Industry 18: Hydrocolloid Functionality for
Affordable and Sustainable Global Food Solutions, UK: Royal Society of Chemistry,
pp. 313–320. doi:10.1039/9781782623830-00313.
Hughes, E., Cofrades, S. and Troy, D. J. (1997). Effects of fat level, oat fibre and car-
rageenan on frankfurters formulated with 5, 12 and 30% fat. Meat Science, 45(3),
273–281. doi:10.1016/S0309-1740(96)00109-X.
Hur, S. J., Jin, S. K. and Kim, I. S. (2008). Effect of extra virgin olive oil substitution
for fat on quality of pork patty. Journal of the Science of Food and Agriculture, 88,
1231–1237. doi:10.1002/jsfa.
Jacobsen, C. (1999). Sensory impact of lipid oxidation in complex food systems.
European Journal of Lipid Science and Technology, 101(12), 484–492. doi:10.1002/
(SICI)1521-4133(199912)101:12<484::AID-LIPI484>3.0.CO;2-H.
Jamshidi, A. and Shabanpour, B. (2014). The effect of hydroxypropyl methylcellulose
(HPMC) added pre-dust and batter of talang queenfish (Scomberoides commer-
sonnianus) nuggets on the quality and reduction of oil uptake. Minerva Biotec,
26(1), 57–64.
Jiménez-Colmenero, F. (1996). Technologies for developing low-fat meat products.
Trends in Food Science & Technology, 7(2), 41–48. doi:10.1016/0924-2244(96)81327-6.
Jiménez-Colmenero, F. (2000). Relevant factors in strategies for fat reduction in
meat products. Trends in Food Science & Technology, 11(2), 56–66. doi:10.1016/
S0924-2244(00)00042-X.
Jiménez-Colmenero, F. (2007). Healthier lipid formulation approaches in meat-
based functional foods. Technological options for replacement of meat fats by
non-meat fats. Trends in Food Science & Technology, 18, 567–578. doi:10.1016/
j.tifs.2007.05.006.
Jiménez-Colmenero, F., Herrero, A., Pintado, T., Solas, M. T. and Ruiz-Capillas, C.
(2010). Influence of emulsified olive oil stabilizing system used for pork back-
fat replacement in frankfurters. Food Research International, 43(8), 2068–2076.
doi:10.1016/j.foodres.2010.06.010.
Jiménez-Colmenero, F., Carballo, J. and Cofrades, S. (2001). Healthier meat and meat
products: Their role as functional foods. Meat Science, 59(1), 5–13. doi:10.1016/
S0309-1740(01)00053-5.
Jiménez-Colmenero, F., Salcedo-Sandoval, L., Bou, R., Cofrades, S., Herrero, A. M.
and Ruiz-Capillas, C. (2015). Novel applications of oil-structuring methods as
a strategy to improve the fat content of meat products. Trends in Food Science &
Technology, 44(2), 177–188, Elsevier. doi:10.1016/j.tifs.2015.04.011.
Jourdain, L., Leser, M. E., Schmitt, C., Michel, M. and Dickinson, E. (2008). Stability
of emulsions containing sodium caseinate and dextran sulfate: Relationship
to complexation in solution. Food Hydrocolloids, 22, 647–659. doi:10.1016/j.
foodhyd.2007.01.007.
Kayaardı, S. and Gök, V. (2004). Effect of replacing beef fat with olive oil on qual-
ity characteristics of turkish soudjouk (Sucuk). Meat Science, 66(1), 249–257.
doi:10.1016/S0309-1740(03)00098-6.
Keenan, D. F., Resconi, V. C., Kerry, J. P. and Hamill, R. M. (2014). Modelling the influ-
ence of inulin as a fat substitute in comminuted meat products on their physico-
chemical characteristics and eating quality using a mixture design approach.
Meat Science, 96(3), 1384–1394. doi:10.1016/j.meatsci.2013.11.025.
504 Advanced Technologies for Meat Processing, Second Edition

Keeton, J. T. (1994). Low-fat meat products technological problems with processing.

Meat Science, 36, 261–276. doi:10.1016/0309-1740(94)90045-0.
Keys, A., Anderson, J. T. and Grande, F. (1965). Serum cholesterol response to changes
in the diet: II. The effect of cholesterol in the diet. Metabolism: Clinical and
Experimental, 14(7), 759–765. http://www.ncbi.nlm.nih.gov/pubmed/25286460.
Khalil, A. H. (2000). Quality characteristics of low-fat beef patties formulated with
modified corn starch and water. Food Chemistry, 68(1), 61–68. doi:10.1016/
S0308-8146(99)00156-9.
Kien, C. L., Bunn, J. Y. and Ugrasbul, F. (2005). Increasing dietary palmitic acid
decreases fat oxidation and daily energy expenditure. American Journal of Clinical
Nutrition, 82(2), 320–326. http://www.ncbi.nlm.nih.gov/pubmed/16087974.
Koutsopoulos, D. A., Koutsimanis, G. E. and Bloukas, J. G. (2008). Effect of carra-
geenan level and packaging during ripening on processing and quality char-
acteristics of low-fat fermented sausages produced with olive oil. Meat Science,
79(1), 188–197. doi:10.1016/j.meatsci.2007.08.016.
Kris-Etherton, P. M., Taylor, D. S. Yu-Poth, S. et al. (2000). Polyunsaturated fatty acids
in the food chain in the United States. American Journal of Clinical Nutrition, 71(1
Suppl): 179S–188S.
Kris-Etherton, P.M., Harris, W.S., Appel, L.J. (2002). Fish consumption, fish oil,
Omega-3 fatty acids, and cardiovascular disease. Circulation, 106(21): 2747–2757.
Kumar, M. and Sharma, B. D. (2004). Quality and storage stability of low-fat pork
patties containing barley flour as fat substitute. Journal of Food Science and
Technology, 41(5), 496–502.
Lal, S. N. D., O’Connor, C. J. and Eyres, L. (2006). Application of emulsifiers/stabiliz-
ers in dairy products of high rheology. Advances in Colloid and Interface Science,
123–126(SPEC. ISS.), 433–437. doi:10.1016/j.cis.2006.05.009.
Lamarche, B. and Couture, P. (2014). It is time to revisit current dietary recommen-
dations for saturated fat. Applied Physiology Nutrition and Metabolism, 39, 1409–
1411. doi:10.1139/apnm-2014-0141.
Lee, H. A., Choi, S. J. and Moon, T. W. (2006). Characteristics of sodium caseinate- and soy
protein isolate-stabilized emulsion-gels formed by microbial transglutaminase.
Journal of Food Science, 71(6), C352–C357. doi:10.1111/j.1750-3841.2006.00110.x.
Leistner, L. (1992). Food preservation by combined processes. Food Research
International, 25, 151–158.
Li, L., Jiang, H., Campbell, M., Blanco, M. and Jane, J. (2008). Characterization of
maize amylose-extender (AE) mutant starches. Part I: Relationship between
resistant starch contents and molecular structures. Carbohydrate Polymers, 74(3),
396–404. doi:10.1016/j.carbpol.2008.03.012.
Liaros, N. G., Katsanidis, E. and Bloukas, J. G. (2009). Effect of the ripening time under
vacuum and packaging film permeability on processing and quality character-
istics of low-fat fermented sausages. Meat Science, 83(4), 589–598. doi:10.1016/j.
meatsci.2009.07.006.
López-López, I., Bastida, S., Ruiz-Capillas, C. et al. (2009). Composition and antioxi-
dant capacity of low-salt meat emulsion model systems containing edible sea-
weeds. Meat Science, 83(3), 492–498. doi:10.1016/j.meatsci.2009.06.031.
Lucca, P. A. and Tepper, B. J. (1994). Fat replacers and the functionality of fat in foods.
Trends in Food Science and Technology, 5(1), 12–19. doi:10.1016/0924-2244(94)90043-4.
Lücke, F.-K. (1985). Fermented sausages. In: Wood, B. J. B. (ed.) Microbiology of
Fermented Foods, vol. 2. Essex: Elsevier Applied Science Publishers, pp. 41–83.
Fat Reduction in Processed Meats 505

Lupi, F. R., Gabriele, D., Facciolo, D., Baldino, N., Seta, L. and de Cindio, B. (2012).
Effect of organogelator and fat source on rheological properties of olive oil-
based organogels. Food Research International, 46(1), 177–184. doi:10.1016/j.
foodres.2011.11.029.
Lurueña-Martínez, M. A., Vivar-Quintana, A. M. and Revilla, I. (2004). Effect of locust
bean/xanthan gum addition and replacement of pork fat with olive oil on
the quality characteristics of low-fat frankfurters. Meat Science, 68(3), 383–389.
doi:10.1016/j.meatsci.2004.04.005.
Lyons, P. H., Kerry, J. F., Morrissey, P. A. and Buckley, D. J. (1999). The influence
of added whey protein/carrageenan gels and tapioca starch on the textural
properties of low fat pork sausages. Meat Science, 51(1), 43–52. doi:10.1016/
S0309-1740(98)00095-3.
Maffei, H. V. L. (2004). Chronic functional constipation. Which supplementary fiber to
choose? Jornal de Pediatria, 80(3), 167–168.
Mansour, E. H. and Khalil,A. H. (1999). Characteristics of low-fat beef burgers as influenced
by various types of wheat fibres. Journal of the Science of Food and Agriculture, 79(4),
493–498. doi:10.1002/(SICI)1097-0010(19990315)79:4<493::AID-JSFA4>3.0.CO;2-5.
Mattson, F. H. and Grundy, S. M. (1985). Comparison of effects of dietary saturated,
monounsaturated, and polyunsaturated fatty acids on plasma lipids and lipo-
proteins in man. Journal of Lipid Research, 26(2), 194–202. http://www.ncbi.nlm.
nih.gov/pubmed/3989378.
Maw, S. J., Fowler, V. R., Hamilton, M. and Petchey, A. M. (2003). Physical character-
istics of pig fat and their relation to fatty acid composition. Meat Science, 63(2),
185–190. doi:10.1016/S0309-1740(02)00069-4.
McClements, D. J. (2004). Protein-stabilized emulsions. Current Opinion in Colloid and
Interface Science, 9, 305–313.
Mehta, N., Ahlawat, S. S., Sharma, D. P. and Dabur, R. S. (2015). Novel trends in devel-
opment of dietary fiber rich meat products—A critical review. Journal of Food
Science and Technology, 52(2), 633–647. doi:10.1007/s13197-013-1010-2.
Mendoza, E., García, M. L., Casas, C. and Selgas, M. D. (2001). Inulin as fat substitute
in low fat, dry fermented sausages. Meat Science, 57(4), 387–393. doi:10.1016/
S0309-1740(00)00116-9.
Menegas, L. Z., Pimentel, T. C., Garcia, S. and Prudencio, S. H. (2013). Dry-fermented
chicken sausage produced with inulin and corn oil: Physicochemical, micro-
biological, and textural characteristics and acceptability during storage. Meat
Science, 93(3), 501–506. doi:10.1016/j.meatsci.2012.11.003.
Meyer, D., Bayarri, S., Tárrega, A. and Costell, E. (2011). Inulin as texture modi-
fier in dairy products. Food Hydrocolloids, 25(8), 1881–1890. doi:10.1016/
j.foodhyd.2011.04.012.
Mira, G. S., Graf, H. and Cândido, L. M. B. (2009). Visão retrospectiva em
fibras alimentares com ênfase em beta-glucanas no tratamento do diabe-
tes. Brazilian Journal of Pharmaceutical Sciences, 45(1), 11–20. doi:10.1590/
S1984-82502009000100003.
Monsivais, P., Carter, B. E., Christiansen, M., Perrigue, M. M. and Drewnowski, A.
(2011). Soluble fiber dextrin enhances the satiating power of beverages. Appetite,
56(1), 9–14. doi:10.1016/j.appet.2010.10.010.
Montenegro, F. M., Gomes-Ruffi, C. R., Vicente, C. A., Collares-Queiroz, F. P. and
Steel, C. J. (2008). Fermented cassava starch biscuits enriched with soluble and
insoluble fibers. Ciência E Tecnologia de Alimentos, 2863(9), 184–191.
506 Advanced Technologies for Meat Processing, Second Edition

Mora-Gallego, H., Guàrdia, M. D., Serra, X., Gou, P. and Arnau, J. (2016). Sensory
characterisation and consumer acceptability of potassium chloride and sun-
flower oil addition in small-caliber non-acid fermented sausages with a reduced
content of sodium chloride and fat. Meat Science, 112, 9–15. doi:10.1016/j.
meatsci.2015.10.008.
Moreira, N. X., Curi, R. and Mancini-Filho, J. (2002). Fatty acids : A review. Journal
Brazilian Social Food Nutrition, 24, 105–123.
Muguerza, E., Fista, G., Ansorena, D., Astiasaran, I. and Bloukas, J. G. (2002). Effect
of fat level and partial replacement of pork backfat with olive oil on processing
and quality characteristics of fermented sausages. Meat Science, 61(4), 397–404.
doi:10.1016/S0309-1740(01)00210-8.
Muguerza, E., Gimeno, O., Ansorena, D., Bloukas, J. G. and Astiasarán, I. (2001).
Effect of replacing pork backfat with pre-emulsified olive oil on lipid fraction
and sensory quality of chorizo de Pamplona—A traditional Spanish fermented
sausage. Meat Science, 59(3), 251–258. doi:10.1016/S0309-1740(01)00075-4.
Muguerza, E., Ansorena, D., Astiasaran, I. (2003). Improvement of nutritional proper-
ties of Chorizo de Pamplona by replacement of pork backfat with soy oil. Meat
Science, 65(4), 1361–1367. doi.org/10.1016/S0309-1740(03)00058-5
Murphy, P. (2000). Starch. In G. O. Phillips & P. A. Williams (Eds.), Handbook of food
hydrocolloids (pp. 41–65), Cambridge: Woodhead Publishing.
Mussatto, S. I. and Mancilha, I. M. (2007). Non-digestible oligosaccharides: A review.
Carbohydrate Polymers, 68(3), 587–597. doi:10.1016/j.carbpol.2006.12.011.
Niness, K. R. (1999). Inulin and oligofructose: What are they? Journal of
Nutrition, 129(7 Suppl), 1402S–1406S. http://www.ncbi.nlm.nih.gov/
pubmed/10395607.
Novakofski, J., Park, S., Bechtel, P. J. and McKeith, F. K. (1989). Composition of cooked
pork chops: Effect of removing subcutaneous fat before cooking. Journal of Food
Science, 54(1), 15–17. doi:10.1111/j.1365-2621.1989.tb08556.x.
Nowak, B., von Mueffling, T., Grotheer, J., Klein, G. and Watkinson, B.-M.
(2007). Energy content, sensory properties, and microbiological shelf life
of German bologna-type sausages produced with citrate or phosphate
and with inulin as fat replacer. Journal of Food Science, 72(9), S629–S638.
doi:10.1111/j.1750-3841.2007.00566.x.
Olmedilla-Alonso, B., Jiménez-Colmenero, F. and Sánchez-Muniz, F. J. (2013).
Development and assessment of healthy properties of meat and meat prod-
ucts designed as functional foods. Meat Science, 95(4), 919–930. doi:10.1016/
j.meatsci.2013.03.030.
Ordóñez, J. A. (2005). Tecnologia de Alimentos: Componentes dos Alimentos e Processos (1st
Ed.). Porto Alegre: Editora Artmed.
Ospina-E, J. C., Sierra-C, A., Ochoa, O., Pérez-Álvarez, J. A. and Fernández-López,
J. (2012). Substitution of saturated fat in processed meat products: A review.
Critical Reviews in Food Science and Nutrition, 52(2), 113–122. doi:10.1080/104083
98.2010.493978.
Paneras, E. D. and Bloukas, J. G. (1994). Vegetable oils replace pork backfat for low-fat
frankfurters. Journal of Food Science, 59(4), 725–728. doi:10.1111/j.1365-2621.1994.
tb08113.x.
Paneras, E. D., Bloukas, J. G. and Filis, D. G. (1998). Production of low-fat frankfurt-
ers with vegetable oils following the dietary guidelines for fatty acids. Journal of
Muscle Foods, 9(2), 111–126. doi:10.1111/j.1745-4573.1998.tb00648.x.
Fat Reduction in Processed Meats 507

Papadima, S. N. and Bloukas, J. G. (1999). Effect of fat level and storage conditions
on quality characteristics of traditional Greek sausages. Meat Science, 51(2), 103–
113. doi:10.1016/S0309-1740(98)00103-X.
Paradiso, V. M., Giarnetti, M., Summo, C., Pasqualone, A., Minervini, F. and
Caponio, F. (2015). Production and characterization of emulsion filled gels
based on inulin and extra virgin olive oil. Food Hydrocolloids, 45, 30–40.
doi:10.1016/j.foodhyd.2014.10.027.
Passos, L. and Park, Y. K. (2003). Fructooligosaccharides: Implications in human
health being and use in foods. Ciência Rural, 3333(22), 385–390.
Pearson, A. M. and Gillett, T. A. (1996). Processed Meats. US: Springer, pp. 355–371.
Pelser, W. M, Linssen, J. P. H., Legger, A. and Houben, J. H. (2007). Lipid oxidation in
n-3 fatty acid enriched Dutch style fermented sausages. Meat Science, 75(1), 1–11.
doi:10.1016/j.meatsci.2006.06.007.
Perrechil, F. A. and Cunha, R. L. (2013). Stabilization of multilayered emulsions
by sodium caseinate and κ-carrageenan. Food Hydrocolloids, 30(2), 606–613.
doi:10.1016/j.foodhyd.2012.08.006.
Petersson, K., Godard, O., Eliasson, A. and Tornberg, E. (2014). The effects of cereal
additives in low-fat sausages and meatballs. Part 2: Rye bran, oat bran and bar-
ley fibre. Meat Science, 96(1), 503–508. doi:10.1016/j.meatsci.2013.08.019.
Picone, C. S. F., Takeuchi, K. P. and Cunha, R. L. (2011). Heat-induced whey protein
gels: Effects of pH and the addition of sodium caseinate. Food Biophysics, 6(1),
77–83. doi:10.1007/s11483-010-9177-9.
Pietrasik, Z. and Duda, Z. (2000). Effect of fat content and soy protein/carrageenan
mix on the quality characteristics of comminuted, scalded sausages. Meat
Science, 98(2), 181–188. doi.org/10.1016/S0309-1740(00)00038-3
Pietrasik, Z. and Janz, J. A. M. (2010). Utilization of pea flour, starch-rich and fiber-
rich fractions in low fat bologna. Food Research International, 43(2), 602–608.
doi:10.1016/j.foodres.2009.07.017.
Piñero, M. P., Parra, K., Huerta-Leidenz, N. et al. (2008). Effect of oat’s soluble fibre
(B-glucan) as a fat replacer on physical, chemical, microbiological and sensory
properties of low-fat beef patties. Meat Science, 80(3), 675–680. doi:10.1016/
j.meatsci.2008.03.006.
Pintado, T., Herrero, A. M., Jiménez-Colmenero, F. and Ruiz-Capillas, C. (2016).
Strategies for incorporation of chia (Salvia Hispanica L.) in frankfurters as a health-
promoting ingredient. Meat Science, 114, 75–84. doi:10.1016/j.meatsci.2015.12.009.
Pires Vilela, J. A., Cavallieri, A. L. F. and Lopes da Cunha, R. (2011). The influ-
ence of gelation rate on the physical properties/structure of salt-induced
gels of soy protein isolate–gellan gum. Food Hydrocolloids, 25(7), 1710–1718.
doi:10.1016/j.foodhyd.2011.03.012.
Poyato, C., Ansorena, D., Berasategi, I., Navarro-Blasco, Í. and Astiasarán, I. (2014).
Optimization of a gelled emulsion intended to supply ω -3 fatty acids into meat
products by means of response surface methodology. Meat Science, 98(4), 615–
621. doi:10.1016/j.meatsci.2014.06.016.
Pronczuk, A., Khosla, P., Hajri, T. and Hayes, K. C. (1995). Plasma lipids are affected
similarly by dietary lauric or palmitic acid in gerbils and monkeys. Lipids,
30(12), 1157–1161. doi:10.1007/BF02536618.
Prosky, L. and Hoebregs, H. (1999). Methods to determine food inulin and oligofruc-
tose. Journal of Nutrition, 129(7 Suppl), 1418S–1423S. http://www.ncbi.nlm.nih.
gov/pubmed/10395610.
508 Advanced Technologies for Meat Processing, Second Edition

Raigond, P., Ezekiel, R. and Raigond, B. (2015). Resistant starch in food: A review. Journal
of the Science of Food and Agriculture, 95(10), 1968–1978. doi:10.1002/jsfa.6966.
Roberfroid, M. (1993). Dietary fiber, inulin, and oligofructose: A review comparing
their physiological effects. Critical Reviews in Food Science and Nutrition, 33(2),
103–148. doi:10.1080/10408399309527616.
Roberfroid, M. and Slavin, J. L. (2000). Nondigestible oligosaccharides. Critical Reviews
in Food Science and Nutrition, 40(6), 461–480. doi:10.1080/10408690091189239.
Rodríguez-Carpena, J. G., Morcuende, D. and Estévez, M. (2012). Avocado, sunflower
and olive oils as replacers of pork back-fat in burger patties: Effect on lipid
composition, oxidative stability and quality traits. Meat Science, 90(1), 106–115.
doi:10.1016/j.meatsci.2011.06.007.
Roller, S. and Jones, S. A. (1996). Handbook of Fat Replacers. Boca Raton: CRC Press.
Rothstein, W. G. (2006). Dietary fat, coronary heart disease, and cancer: A historical
review. Preventive Medicine, 43(5), 356–360. doi:10.1016/j.ypmed.2006.07.013.
Rubio, B., Martínez, B., García-Cachán, M. D., Rovira, J. and Jaime, I. (2008). Effect
of the packaging method and the storage time on lipid oxidation and colour
stability on dry fermented sausage salchichón manufactured with raw material
with a high level of mono and polyunsaturated fatty acids. Meat Science, 80,
1182–1187. doi:10.1016/j.meatsci.2008.05.012.
Rust, R. and Olson, D. (1988). Making good “lite” sausage. Meat and Poultry, 34, 1012.
Saad, S. M. I. (2006). Probiotics and prebiotics: The state of the art. Revista Brasileira de
Ciências Farmacêuticas, 42(1), 1–16. doi:10.1590/S1516-93322006000100002.
Sahin, S., Sumnu, G. and Altunakar, B. (2005). Effects of batters containing different
gum types on the quality of deep-fat fried chicken nuggets. Journal of the Science
of Food and Agriculture, 85(14), 2375–2379. doi:10.1002/jsfa.2258.
Sajilata, M. G., Singhal, R. S. and Kulkarni, P. R. (2006). Resistant starch—A
review. Comprehensive Reviews in Food Science and Food Safety, 5(1), 1–17.
doi:10.1111/j.1541-4337.2006.tb00076.x.
Salazar, P., García, M. L. and Selgas, M. D. (2009). Short-chain fructooligosaccharides
as potential functional ingredient in dry fermented sausages with different
fat levels. International Journal of Food Science and Technology, 44(6), 1100–1107.
doi:10.1111/j.1365-2621.2009.01923.x.
Sarteshnizi, A. R., Hosseini, H., Bondarianzadeh, D., Jiménez-Colmenero, F. and
Khaksar, R. (2015). Optimization of prebiotic sausage formulation: Effect of
using β -glucan and resistant starch by D-optimal mixture design approach.
LWT—Food Science and Technology, 62(1), 704–710. doi:10.1016/j.lwt.2014.05.014.
Schaefer, E. J. (2002). Lipoproteins, nutrition, and heart disease. American
Journal of Clinical Nutrition, 75(2), 191–212. http://www.ncbi.nlm.nih.gov/
pubmed/11815309.
Sendra, E., Fayos, P., Lario, Y., Fernández-López, J., Sayas-Barberá, E. and Pérez-
Alvarez, J. A. (2008). Incorporation of citrus fibers in fermented milk containing
probiotic bacteria. Food Microbiology, 25(1), 13–21. doi:10.1016/j.fm.2007.09.003.
Serdaroglu, M. (2006). The characteristics of beef patties containing different levels
of fat and oat flour. International Journal of Food Science and Technology, 41(2),
147–153. doi:10.1111/j.1365-2621.2005.01041.x.
Serrano, A., Cofrades, S., Ruiz-Capillas, C., Olmedilla-Alonso, B., Herrero-
Barbudo, C. and Jiménez-Colmenero, F. (2005). Nutritional profile of
restructured beef steak with added walnuts. Meat Science, 70(4), 647–654.
doi:10.1016/j.meatsci.2005.02.014.
Fat Reduction in Processed Meats 509

Setser, C. S. and Racette, E. L. (1992). Macromolecule replacers in food products.

Critical Reviews in Food Science and Nutrition, 32(3), 275–297.
Severini, C., De Pilli, T. and Baiano, A. (2003). Partial substitution of pork back-
fat with extra-virgin olive oil in ‘salami’ products: Effects on chemical,
physical and sensorial quality. Meat Science, 64(3), 323–331. doi:10.1016/
S0309-1740(02)00204-8.
Shand, J. P., Schmidt, G. R., Mandigo, R. W. and Claus, J. R. (1990). New technology
for low-fat meat products. Reciprocal Meat Conference Proceedings, 43, 37–46.
Sheard, P. (2002). Processing and quality control of restructured meat. Meat Processing,
332–358. doi:10.1533/9781855736665.3.332.
Shimokomaki, M.; Olivo, P., Terra, N. N. Fermentação cárnea: Princípios e Inovações.
In Atualidades em Ciência e Tecnologia de Carnes. São Paulo: Editora Varela, 29-36.
Simo, O. K., Mao, Y., Tokle, T., Decker, E. A. and McClements, D. J. (2012). Novel
strategies for fabricating reduced fat foods: Heteroaggregation of lipid
droplets with polysaccharides. Food Research International, 48(2), 337–345.
doi:10.1016/j.foodres.2012.04.018.
Simopoulos, A. P. (1999). Essential fatty acids in health and chronic disease. American
Journal of Clinical Nutrition, 70(3 Suppl), 560S–569S. http://www.ncbi.nlm.nih.
gov/pubmed/10479232.
Simopoulos, A. P. (2004). Omega-6/omega-3 essential fatty acid ratio and chronic dis-
eases. Food Reviews International, 20(1), 77–90. doi:10.1081/FRI-120028831.
Singh, O. P., Singh, J. N., Barthi, M. K. and Soni, K. (2008). Refrigerated storage stabil-
ity of chicken nuggets containing pea flour. Journal of Food Science and Technology,
45(5), 460–462.
Slavin, J. L. (2005). Dietary fiber and body weight. Nutrition, 21(3), 411–418.
doi:10.1016/j.nut.2004.08.018.
Sorapukdee, S., Kongtasorn, C., Benjakul, S. and Visessanguan, W. (2013). Influences
of muscle composition and structure of pork from different breeds on stabil-
ity and textural properties of cooked meat emulsion. Food Chemistry, 138(2–3),
1892–1901. doi:10.1016/j.foodchem.2012.10.121.
Spady, D. K. and Dietschy, J. M. (1985). Rates of cholesterol synthesis and low-density
lipoprotein uptake in the adrenal glands of the rat, hamster and rabbit in vivo.
Biochimica et Biophysica Acta (BBA)—Lipids and Lipid Metabolism, 836(2), 167–175.
doi:10.1016/0005-2760(85)90063-3.
Spiegel, J. E., Rose, R., Karabell, P., Francos, V. H. and Schmitt, D. F. (1994). Safety and
benefits of frutooligosaccharides as food ingredients. Food Technology, 48, 85–89.
Stowell, J. D. (2009). Polydextrose. In: Cho, S. S. and Samuel, P. (eds.) Fiber Ingredients:
Food Applications and Health Benefits. Boca Raton, FL: CRC Press.
Sturdevant, R. A. L., Pearce, M. L. and Dayton, S. (1973). Increased prevalence of
cholelithiasis in men ingesting a serum-cholesterol-lowering diet. New England
Journal of Medicine, 288(1), 24–27, Massachusetts Medical Society. doi:10.1056/
NEJM197301042880106.
Sych, J., Lacroix, C., Adambounou, L. T. and Castaigne, F. (1990). Cryoprotective
effects of lactitol, palatinit and Polydextrose® on cod surimi proteins during fro-
zen storage. Journal of Food Science, 55(2), 356–360. doi:10.1111/j.1365-2621.1990.
tb06762.x.
Symes, K. C. (1980). The relationship between the covalent structure of the Xanthomonas
polysaccharide (xanthan) and its function as a thickening, suspending and gell-
ing agent. Food Chemistry, 6(1), 63–76.
510 Advanced Technologies for Meat Processing, Second Edition

Talukder, S. (2015). Effect of dietary fiber on properties and acceptance of meat prod-
ucts: A review. Critical Reviews in Food Science and Nutrition, 55(7), 1005–1011. doi
:10.1080/10408398.2012.682230.
Tan, S. S., Aminah, A., Zhang, X. G. and Abdul, S. B. (2006). Optimizing palm oil and
palm stearin utilization for sensory and textural properties of chicken frankfurt-
ers. Meat Science, 72(3), 387–397. doi:10.1016/j.meatsci.2005.07.012.
Trius, A., Sebranek, J. G., Rust, R. E. and Carr, J. M. (1994). Low-fat bologna and bea-
ker sausage: Effects of carrageenans and chloride salts. Journal of Food Science,
59(5), 941–945. doi:10.1111/j.1365-2621.1994.tb08163.x.
Troutt, E. S., Hunt, M. C., Johnson, D. E., Claus, J. R., Kastner, C. L. and Kropf, D.
H. (1992). Characteristics of low-fat ground beef containing texture-modifying
ingredients. Journal of Food Science, 57(1), 19–24. doi:10.1111/j.1365-2621.1992.
tb05415.x.
Trowell, H., Southgate, D. A., Wolever, T. M., Leeds, A. R., Gassull, M. A. and Jenkins,
D. J. (1976). Dietary fibre redefined. Lancet (London, England), 1(7966), 967.
http://www.ncbi.nlm.nih.gov/pubmed/57372.
Tungland, B. C. and Meyer, D. (2002). Nondigestible oligo- and polysaccharides (dietary
fiber): Their physiology and role in human health and food. Comprehensive
Reviews in Food Science and Food Safety, 1(3), 90–109. doi:10.1111/j.1541-4337.2002.
tb00009.x.
Turp, G. Y. (2016). Effects of four different cooking methods on some quality charac-
teristics of low fat Inegol meatball enriched with flaxseed flour. Meat Science,
121, 40–46. doi:10.1016/j.meatsci.2016.05.016.
Uemura, C. H. and Luz, M. B. (2003). Sistemas de cobertura. Aditivos & Ingredientes,
28, 81–82.
Valencia, I., Ansorena, D. and Astiasaran, I. (2007). Development of dry fer-
mented sausages rich in docosahexaenoic acid with oil from the Microalgae
schizochytrium sp.: Influence on nutritional properties, sensorial quality
and oxidation stability. Food Chemistry, 104(3), 1087–1096. doi:10.1016/j.
foodchem.2007.01.021.
Valencia, I., O’Grady, M. N., Ansorena, D., Astiasarán, I. and Kerry, J. P. (2008).
Enhancement of the nutritional status and quality of fresh pork sausages fol-
lowing the addition of linseed oil, fish oil and natural antioxidants. Meat Science,
80(4), 1046–1054. doi:10.1016/j.meatsci.2008.04.024.
Valsta, L. M., Tapanainen, H. and Männistö, S. (2005). Meat fats in nutrition. Meat
Science, 70(3), 525–530. doi:10.1016/j.meatsci.2004.12.016.
Varnam, A. H. and Sutherland, J. P. (1995). Meat and Meat Products: Technology,
Chemistry, and Microbiology. New York, NY: Chapman & Hall.
Vedin, I., Cederholm, T., Levi, Y. F. et al. (2008). Effects of docosahexaenoic acid-rich
n-3 fatty acid supplementation on cytokine release from blood mononuclear
leukocytes: The OmegAD study. American Journal of Clinical Nutrition, 87(6),
1616–1622. http://www.ncbi.nlm.nih.gov/pubmed/18541548.
Verma, A. K., Sharma, B. D. and Banerjee, R. (2010). Effect of sodium chloride replace-
ment and apple pulp inclusion on the physico-chemical, textural and sensory
properties of low fat chicken nuggets. LWT—Food Science and Technology, 43(4),
715–719. doi:10.1016/j.lwt.2009.12.006.
Verplaetse, A. (1994). Influence of raw meat properties and processing technol-
ogy on aroma quality of raw fermented meat products. Proceedings of the 40th
International Congress on Meat Science and Technology, 45–65, Den Haag.
Fat Reduction in Processed Meats 511

Vessby, B. (2003). Dietary fat, fatty acid composition in plasma and the meta-
bolic syndrome. Current Opinion in Lipidology, 14(1), 15–19. doi:10.1097/01.
mol.0000052859.26236.5f.
Wang, Y. (2009). Prebiotics: Present and future in food science and technology. Food
Research International, 42, 8–12.
Warner, K. and Inglett, G. E. (1997). Flavor and texture characteristics of foods con-
taining Z-trim corn and oat fibers as fat and flour replacers. Cereal Foods World,
42(10), 821–825.
Webb, E. C. and O’Neill, H. A. (2008). The animal fat paradox and meat quality. Meat
Science, 80(1), 28–36. doi:10.1016/j.meatsci.2008.05.029.
Weiss, J., Gibis, M., Schuh, V. and Salminen, H. (2010). Advances in ingredient and
processing systems for meat and meat products. Meat Science, 86(1), 196–213.
doi:10.1016/j.meatsci.2010.05.008.
Whitney, E. N. and Rolfes, S. R. (2002). Understanding Nutrition. Belmont, CA: Wadsworth.
World Health Organization (WHO). (2003). Diet, nutrition and the prevention of chronic
diseases. World Health Organization Technical Report Series. Geneva, 916: i–viii-1-149.
Wirth, F. (1988). Technologies for making fat-reduce meat products, what possibilities
are there? Fleischwirtschaf, 68, 1153–1156.
Yang, A., Keeton, J. T., Beilken, S. L. and Trout, G. R. (2001). Evaluation of some bind-
ers and fat substitutes in low-fat frankfurters. Journal of Food Science, 66(7), 1039–
1046. doi:10.1111/j.1365-2621.2001.tb08232.x.
Yasarlar, E. E., Daglioglu, O. and Yilmaz, I. (2007). Effects of cereal bran addition on
chemical composition, cooking characteristics and sensory properties of Turkish
meatballs. Asian Journal of Chemistry, 19(3), 2353–2361.
Yilmaz, I. (2005). Physicochemical and sensory characteristics of low fat meat-
balls with added wheat bran. Journal of Food Engineering, 69, 369–373.
doi:10.1016/j.jfoodeng.2004.08.028.
Yilmaz, I. and Dağ lıoğ lu, O. (2003). The effect of replacing fat with oat bran on fatty
acid composition and physicochemical properties of meatballs. Meat Science,
65(2), 819–823. doi:10.1016/S0309-1740(02)00286-3.
Yilmaz, I. and Geçgel, U. (2009). Effect of inulin addition on physico-chemical and
sensory characteristics of meatballs. Journal of Food Science and Technology, 46(5),
473–476, Association of Food Scientists and Technologists (India).
Yoo, S. S., Kook, S. H., Park, S. Y., Shim, J. H. and Chin, K. B. (2007). Physicochemical
characteristics, textural properties and volatile compounds in comminuted sau-
sages as affected by various fat levels and fat replacers. International Journal of Food
Science and Technology, 42(9), 1114–1122. doi:10.1111/j.1365-2621.2006.01402.x.
Youssef, M. K. and Barbut, S. (2009). Effects of protein level and fat/oil on emulsion
stability, texture, microstructure and color of meat batters. Meat Science, 82(2),
228–233, Elsevier. doi:10.1016/j.meatsci.2009.01.015.
Yue, P. and Waring, S. (1998). Resistant starch in food applications. Cereal Foods World,
43(9), 690–695.
Zhang, W., Xiao, S., Samaraweera, H., Lee, E. J. and Ahn, D. U. (2010). Improving functional
value of meat products. Meat Science, 86(1), 15–31. doi:10.1016/j.meatsci.2010.04.018.
Zhuang, X., Han, M., Kang, Z. L. et al. (2016). Effects of the sugarcane dietary fiber
and pre-emulsified sesame oil on low-fat meat batter physicochemical prop-
erty, texture, and microstructure. Meat Science, 113, 107–115, Elsevier B.V.
doi:10.1016/j.meatsci.2015.11.007.
Zóia, D. (2011). As gomas exudadas de plantas. Food Ingredients Brasil, 17, 26.
16
Processing of Nitrite-Free Cured Meats

Fereidoon Shahidi and Ronald B. Pegg

CONTENTS
16.1 Origins of Nitrite Curing of Meats .......................................................... 513
16.2 N-Nitrosamines .......................................................................................... 515
16.3 Processing Options When Curing Meats ............................................... 515
16.3.1 Formulating .................................................................................... 515
16.3.2 Curing Methods ............................................................................. 516
16.3.2.1 Dry Curing ....................................................................... 516
16.3.2.2 Brine Curing .................................................................... 517
16.3.2.3 Multiple-Needle Pumping ............................................. 518
16.3.2.4 Tumbling or Massaging ................................................. 518
16.3.2.5 Chopping or Blending .................................................... 519
16.4 Benefits and Drawbacks of Nitrite Curing ............................................. 519
16.4.1 Color Characteristics ..................................................................... 519
16.4.2 Antioxidant Properties.................................................................. 523
16.4.3 Flavor Characteristics .................................................................... 525
16.4.4 Antimicrobial Properties .............................................................. 526
16.5 Tailor Designing Nitrite-Free Meat Products ........................................ 528
16.6 Other Developments ................................................................................. 529
References............................................................................................................. 529

16.1 Origins of Nitrite Curing of Meats

The origin of salting meats is lost in antiquity, but it is believed that it was first
practiced and flourished in Sumeria during the third and fourth millenniums
BC. From a historical perspective, meat curing can be defined as the addition
of salt to meats for the sole purpose of preservation, that is, to inhibit or deter
microbial spoilage. The preservation of meat resulted from necessity, so that the
products could be held for extended periods for later consumption in times of
scarcity. It was recognized that fresh cuts of meat could be preserved by treat-
ing them with a salt solution or packing them in dry salt (Aberle et al., 2001).
Salting prevented bacterial growth on account of salt’s direct inhibitory effect
or because of the drying action it had on meat (note that most bacteria require

513
514 Advanced Technologies for Meat Processing, Second Edition

substantial amounts of moisture to survive and proliferate). Thus, rock salt was
an important commodity that was routinely employed for muscle food preser-
vation in ancient China, Babylonia, and Sumeria (Jensen, 1953). However, high
concentrations of salt promoted the formation of an unattractive brownish-
gray color within lean muscle tissue. At some point in the development of this
art, more likely by accident than design, it was discovered that certain salts (i.e.,
those containing saltpeter) could impart or “fix” a unique pink or red color and
flavor in meats (Binkerd and Kolari, 1975). A preference developed for the use
of this special salt. Granulated or grain salt was formerly called “corn,” which
comes from the Old Norse, korn, meaning grain; thus when beef was sprinkled
with these salts, corned beef was the resultant product.
By medieval times, treating meat with salt, saltpeter, and smoke was com-
monplace, and saltpeter’s effect to “fix” the red color was well recognized.
Gradually, sweet pickle and sugar cures evolved as sucrose became avail-
able as a commodity of trade. Sugar added flavor to the meat and helped to
counteract some of the harshness and hardening effects of salt. As the art
progressed, the term meat curing eventually was understood as the addition
of salt, sugar, spices, saltpeter (nitrate), or nitrite to meat for its preservation
and flavor enhancement (Townsend and Olson, 1987). Spices and other fla-
vorings were added to achieve distinctive brand flavors.
Scientific principles of meat curing were not applied until the latter half
of the nineteenth and the early twentieth century when the growing meat-
packing trade began to search for ways to improve quality and to extend the
shelf life of products. It was discovered that nitrite, not nitrate as originally
thought, plays a multifunctional role in the meat matrix (Haldane, 1901;
Polenske, 1891). Nitrite is responsible for developing or “fixing” the charac-
teristic color associated with cured meats; for creating a special flavor so that
one can distinguish the flavor of corned beef from roast beef; for imparting
antioxidant activity to the cooked product, thereby extending its shelf life;
and for suppressing the outgrowth and production of toxin from the anaer-
obic bacterium, Clostridium botulinum. Since nitrite has been added to cure
meats, U.S. Centers for Disease Control statistics indicate that botulism is no
longer associated with cured meats. The industry has evolved to the point
that quite a diverse list of cured meat products offering great taste, conve-
nience, and versatility is available to the consumer. On account of household
refrigeration, the original need to cure meats no longer exists; nevertheless,
consumers have become accustomed to certain products in their diet and
still demand their availability in the market.
Until the late 1960s and early 1970s, the primary technological emphasis
of nitrite usage had been to reduce the time required for curing as much as
possible to increase production capacity. Modern technology and scientific
understanding had made it possible to utilize smaller quantities of nitrite
while exercising vastly improved control over the curing of meat and meat
products. Suddenly, the technological emphasis shifted to problem solving
with particular regard to N-nitrosamine production (Sebranek, 1979, 2010).
Processing of Nitrite-Free Cured Meats 515

16.2 N-Nitrosamines
Despite all of its desirable effects in processed meat products, nitrite under
certain conditions such as pan frying forms N-nitrosamines at trace quan-
tities (i.e., parts-per-billion levels). Typical volatile N-nitrosamines detected
in heat processed cured products include N-nitrosodimethylamine (NDMA)
and N-nitrosopyrrolidine (NPYR). Among cured products, fried bacon has
consistently shown the presence of NDMA and NPYR at mean levels of up to
3 and 25 μg/kg, respectively (Glória et al., 1997). These N-nitrosamines are car-
cinogenic, mutagenic, and teratogenic in experimental animals (Preussmann
and Stewart, 1984; Tricker and Preussmann, 1991). Although the carcinogenic-
ity of N-nitrosamines in humans cannot be tested, epidemiological studies
have suggested a possible link to the incidence of various cancers in humans.
N-nitrosamines are formed from the reaction of nitrite with free amino
acids and amines in meat products under certain heat processing conditions
(e.g., high temperatures associated with frying of bacon), or in the stomach
after consumption. As it is difficult to control the level of endogenous factors,
such as amino acids and amines, a reduction in the level of nitrite added
to products or specifics of reaction and process conditions might be neces-
sary. Thus, the allowable level of nitrite addition in cured meats has been
reduced to a maximum of 150–200 mg/kg in most products, with lower max-
imum addition levels for bacon (about 120 mg/kg). The meat industry has
responded adequately and responsibly to concerns expressed about nitrite
and the control of N-nitrosamine formation in processed meats. Nonetheless,
two controversial studies published in the mid- to late 1990s recommended
that excessive consumption of hot dogs and cured products be avoided to
prevent the occurrence of leukemia in children (Blot et al., 1999; Peters et al.,
1994). To keep things in perspective, it should be noted that humans excrete
noncarcinogenic N-nitrosoproline in their urine, thereby demonstrating that
such compounds are also formed within the body (Loeppky, 1994).

16.3 Processing Options When Curing Meats

Before a discussion of processing meats using nitrite-free curing systems can
be given, a review of formulation and processing options presently employed
for curing meats is required.

16.3.1 Formulating
Formulating any food product is much more than simply recipe devel-
opment. In fact some even call it an art. It involves detailing the required
processing steps and in what particular order they must be carried out to
516 Advanced Technologies for Meat Processing, Second Edition

produce a high-quality finished product. Decisions when formulating meat

products can entail the selection of meats and their levels of addition; choice
of nonmeat ingredients such as salt, sweeteners, binders, and seasonings;
method and length of curing; grind or chop size of meat and fat; oven or
smokehouse schedules; type and diameter of casings; and type and method
of packaging. Formulating meat products also requires preparing a product
that meets recognized characteristics set out by the country’s standards of
identity for that product. For meat companies, innovation is one of the single
most important factors in building and maintaining a successful product or
brand. A brand can be well recognized, but if over time that brand does not
continue to offer value to consumers it will soon be eclipsed in the market.
When designing meat products it is practical to formulate by ingredient
weight, which is based on the amount of the meat block. When formulating
the seasonings, the processor must work in the weight of seasoning per 100
lb. or kg of meat. Quantities can then be easily converted to percentages and
the seasoning formula determined. For meat blocks not in 100 lb. or kg incre-
ments, the percentage usage of spice, oleoresin, or seasoning is calculated
per pound or kilogram and then multiplied by the weight desired to deter-
mine the quantity required. Many processors weigh out the dry ingredients
in a controlled-access room where the temperature and humidity are care-
fully monitored. Often after weighing, the critical components are packaged
and then assembled for batch production. A checklist must be prepared and
verified to ensure that all of the materials are accounted for. Meat processors
keep very detailed records of all formulas, and most are proprietary. The
formulas are designed so that costs can be easily calculated and updated as
needed (especially in the case of least cost formulation products). Standard
blending or formulation documentation includes a list of ingredients, the
weight of the individual ingredients in one seasoning unit, the percentage of
each ingredient in a batch, and the laboratory and plant code numbers.

16.3.2 Curing Methods

There are a few means by which meats can be cured. The basic methods
include the following.

16.3.2.1 Dry Curing

Dry curing is the oldest technique, traditionally employed in bacon and ham
manufacturing. It involves the application of uniform and quantified mix-
tures of salt, sugar, spices, and saltpeter or sodium nitrite to solid meat cuts.
Industrial applications of dry curing are still carried out in Europe, but are
generally restricted to the preparation of specialty ham products. The curing
agents are rubbed in dry form over the surface of meat cuts, which are then
placed in a cool room and allowed to cure. No water is added, so the curing
agents are solubilized in the endogenous moisture of the muscle tissue. With
Processing of Nitrite-Free Cured Meats 517

time, slow penetration of the cure into the meat via diffusion (about 2.5 cm/
week) and micrococcal reduction of nitrate to nitrite affords the character-
istic cured meat color and flavor of the product (Fox, 1974). More than one
application of the salt mixture is necessary to affect a cure; the cuts must
be “overhauled,” or turned over and restacked. This labor-intensive process
requires a considerably longer period than curing comminuted meats; this is
the main disadvantage of this approach. Another problem is that in thicker
pieces of meat, spoilage organisms can begin growing before the preserva-
tives reach all parts of the product. The manufacture of dry-cured hams,
nevertheless, provides a class of products with flavor and taste that cannot
be re-created by any other nitrite-containing or nitrite-free curing method.
After curing is complete, the excess cure is washed off and the meat is
placed under refrigeration (2°C–4°C) for 20–40 days to allow for salt equal-
ization throughout. In the case of hams, the meat is held in natural or air-
conditioned drying chambers and ripened for a minimum of 6 months and
often 12 months or more, depending on each country’s traditional practices.
The temperature is usually varied between 14°C and 20°C at relative humid-
ities ranging from 90% to 70%. Complex biochemical reactions that are
mainly proteolytic and lipolytic in nature occur and a characteristic flavor
is developed (Flores and Toldrá, 1993). Dry curing is used only for specialty
items such as country-cured hams and bacon, as well as European-type dry-
cured hams such as Spanish Serrano and Iberian hams, Italian Parma, and
San Daniele prosciuttos, or French Bayonne hams. These European hams are
usually consumed raw, unlike country-style hams in the United States and
Westphalia hams in Germany, which are smoked and then thermally pro-
cessed before consumption (Toldrá and Flores, 1998). Worldwide production
of dry-cured products represents an important segment of the processed
meat industry because these products possess unique flavor and texture
attributes that apparently cannot be developed by any other means (Aberle
et al., 2001).

16.3.2.2 Brine Curing

Brine is prepared by combining the salt, cure (i.e., sodium nitrite), and water-
soluble seasoning mixtures in water, which serves as a carrier. The strength
of a brine solution or “pickle” is determined by the amount of salt present.
A salometer is a specially graduated hydrometer that measures the strength
of brines at a particular temperature (usually 40°F/4.4°C) and is calibrated
to indicate the degree of salinity (this is essentially a measure of the brine’s
density). A 100° salometer reading is equivalent to a 100% saturated salt solu-
tion. Most large processors prepare stock solutions of brine at a 100° salom-
eter reading and then formulate working pickles with additional additives
at lower strengths. The presence of sweeteners, phosphates, nitrite, and ery-
thorbate in a brine will affect salometer readings to an extent. Typical pickles
have strengths of 60°–70°, with 70° brine being the most common. For brine
518 Advanced Technologies for Meat Processing, Second Edition

immersion or cover pickling, the meat pieces are simply immersed in the brine
for a specified period. For example, hams and shoulders are normally cured
for 2–2.5 days per pound in 70° brine. Due to high water activity, microbial
growth and spoilage can arise during pickling even though the product is
refrigerated and salt is present at an appreciable concentration. Although the
penetration of ingredients into the muscle tissue is faster than in dry curing,
this technique also suffers from slowness and is not widely employed by the
industry. Presently, only specialty products such as neck bones, tails, pigs’ feet,
and salt pork are cured in North America in this way (Aberle et al., 2001).

16.3.2.3 Multiple-Needle Pumping

The practice of pumping or injecting meat with a perforated needle origi-
nated in the late nineteenth century and greatly shortened the length of time
required to cure meat. The process of multiple-needle injection has become
popular and such designed machines have ensured rapid, continuous process-
ing of meat cuts. A brine or pickle is prepared and then injected mechanically
under pressure through needles, which are perforated along the stem near the
point, into primal cuts of meat. In this multiple-needle injection technique, a
conveyor belt carries meat under a bank of offset needles through which brine
is pumped until a desired target weight is achieved. The spacing of the nee-
dles, their size, and the dwell time between strokes are important variables to
ensure good distribution and retention of the pickle. By way of the many chan-
nels running throughout the muscle tissue, the cure is rapidly distributed. The
brine injected into commercial mild-cured products is typically a 70° pickle.
The main advantages of multiple-needle pumping include increased product
yield, greatly reduced labor costs, and time required for production. After
pumping, some products are cooked immediately, whereas others are fur-
ther processed by immersing them in a brine cure for a period (e.g., Canadian
bacon) or subjecting them to a mechanical operation such as tumbling.

16.3.2.4 Tumbling or Massaging

Tumbling or massaging of pickle-injected meat cuts is generally employed to
speed up the curing process, to facilitate extraction of salt-soluble proteins, and
to improve the texture, bind, water-holding capacity, and yield of the finished
product. Tumblers are large stainless steel units that rotate in a circular fash-
ion for a period of time and may also have vacuum capabilities. Inside, baffles
continuously lift up pieces of meat to the upper part of the machine. From
here they fall, striking the meat mass below, producing an intense mechani-
cal action suitable for high-yield products. Muscle fibers are disrupted by this
mechanical action, which makes cellular membranes more permeable and
facilitates the distribution and absorption of brine. Some degree of massaging
also occurs as the chunks slide over each other as the tumbler turns. Tumblers
typically provide somewhat more of a destructive effect than massagers on
Processing of Nitrite-Free Cured Meats 519

account of the impact force generated from the mechanical action. Thus, not
all cured meat products can be tumbled. A fitting example for the benefits of
tumbling comes from ham production: hams processed in this fashion are
more uniform, as brine uptake is more tightly controlled and pickle pockets
are reduced. The tighter control of pickle uptake results from the ability to
pump the hams at, or somewhat below, the target pump and then adjusting
the product’s uptake to the exact percentage pump by adding pickle directly
to the tumbler. Tumblers and massagers in meat processing operations have
resulted in the higher processing yields and lower production costs for a num-
ber of value-added meat products.

16.3.2.5 Chopping or Blending

Dry-curing ingredients are distributed directly into ground meat products
during the grinding, chopping, and emulsification steps involved in bat-
ter preparation. The employment of nitrite-free curing systems using the
preformed cooked cured meat pigment (CCMP), as described later, is best
achieved for products using this curing method.

16.4 Benefits and Drawbacks of Nitrite Curing

Two ingredients, salt and nitrite, are essential components in meat curing.
Nitrite is the active agent in curing; all reactions taking place have some rela-
tionship to nitrite chemistry. For the production of dry-cured or fermented
meat products, however, nitrate is still required in this long ripening process
for slow nitrite generation by bacterial reduction. Nitrite can therefore be
considered unique. This one food additive can afford to meet a characteristic
cured color by means of a heat-stable nitrosylprotoheme pigment, a typical
cured flavor, an extended period of refrigerated storage of cooked products
without the worry of warmed-over flavor development, and bacteriostatic
action against C. botulinum spores. It seems clear that the possibility of finding
a single compound to mimic all functions of nitrite is remote at best. Although
the N-nitrosamine scare has died down, nitrite-free curing of meat might still
be attractive in view of the fact that many of the effects of nitrite can be easily
duplicated by the presence of adjuncts, together with refrigeration. The answer
lies in the development of composite nonnitrite curing mixtures.

16.4.1 Color Characteristics

Although the bacteriostatic action of nitrite is most important from a health
standpoint, the color of the meat product will influence the customer’s
decision to purchase the product. Numerous studies have supported the
520 Advanced Technologies for Meat Processing, Second Edition

view that certain colors do, in fact, influence food acceptance (Kostyla and
Clydesdale, 1978). For meat, it is the quantity of hemoproteins, particularly
that of myoglobin and its relationship with the environment surrounding
it that determines the meat’s color (Ledward, 1992; Livingston and Brown,
1981). The addition of nitrite to meat followed by thermal processing pro-
duces a relatively stable pink-colored pigment. If nitrite were eliminated
from cured meats, the result would be products with beige or tan color,
unless an acceptable colorant is employed.
A number of colorants to replace nitrite such as nicotinic acid, 3- and
4-acylpyridine, N,N-diethylnicotinamide, erythrosine, protoporphyrin-IX,
cochineal, dried radish chip extracts, betalain pigments from beet root
extract, and angkak from Monascus purpureus have been tested in meat sys-
tems. Unfortunately, color fixation, toxicological, oxidation, or thermal sta-
bility issues have prevented their use. In 1975, a U.S. patent was issued to
Sweet (1975), who first proposed the use of composite nonnitrite curing mix-
tures for duplicating the cumulative action of nitrite. His multicomponent
system consisted of a red colorant—erythrosine—an antioxidant/chelator,
an antimicrobial agent, and all other curing adjuncts except for nitrite.
Efforts in the laboratory of Shahidi toward the development of a compos-
ite nitrite-free curing system, which bestows the characteristic and desirable
attributes of cooked cured meat products without N-nitrosamine formation
and which may be employed at an industrial level, have been successful.
Sweet’s approach was employed for preparing nitrite-free products, but the
colorant of choice was the natural CCMP. This nitrosylated heme pigment
was preformed outside the meat matrix and then applied to meat. Palmin
and coworkers first suggested using such a pigment for improving the color
of sausages (Palmin et al., 1973, 1975; Palmin and Prizenko, 1974).
The pigment is manufactured from the red blood cells of animals, which
are an industrial by-product of abattoirs, and a nitrosating agent in the pres-
ence of a reductant. The pigment can be prepared in a direct, one-step process
or by an indirect method through a hemin intermediate (Shahidi and Pegg,
1991c,d; Shahidi et al., 1984, 1985, 1994); the preparation of the latter process is
depicted in Figure 16.1. The coloring efficacy of CCMP, as part of a composite
nitrite-free curing package, has been tested in the meat from a number of
species, but mostly for pork. Addition of CCMP to comminuted pork at 3–30
mg/kg levels produced a pink color after thermal processing in all cases,
albeit of different intensities that was visually similar to nitrite-treated pork
systems. Although various levels of CCMP were employed (Table 16.1), colo-
rimetric data (i.e., Hunter color values) demonstrated that pigment-treated
pork samples at a 12–18 mg/kg addition level were not significantly (p > .05)
different from their nitrite-cured counterpart (Pegg and Shahidi, 2000).
Studies have shown that the color intensity of nitrite or CCMP-treated meat
products depends on the endogenous myoglobin content of meat (Pegg, 1993;
Shahidi and Pegg, 1991a; Stevanović et al., 1997). Whether there is an interac-
tion between myoglobin and the added CCMP is uncertain. Nevertheless,
Processing of Nitrite-Free Cured Meats 521

TABLE 16.1
Concentration Effect of the Preformed CCMP on Hunter Color Values of Cooked
Ground Porka
Hunter Values
Treatment (mg/kg) L a b Hue Angle (arctan b/a)
No additive 58.2 ± 0.5 4.8 ± 0.1 11.9 ± 0.1 68.0 ± 0.4
NaNO2, 156 57.8 ± 0.2 13.4 ± 0.2 9.2 ± 0.1 34.5 ± 0.5
CCMP, 3 58.4 ± 0.5 12.6 ± 0.2 9.1 ± 0.1 35.8 ± 0.5
CCMP, 6 57.9 ± 0.2 12.8 ± 0.1 9.1 ± 0.1 35.4 ± 0.4
CCMP, 9 57.3 ± 0.3 13.0 ± 0.2 9.1 ± 0.1 35.2 ± 0.5
CCMP, 12 57.1 ± 0.2 13.2 ± 0.1 9.1 ± 0.1 34.6 ± 0.3
CCMP, 18 56.4 ± 0.2 13.5 ± 0.1 9.2 ± 0.1 34.3 ± 0.3
CCMP, 24 56.1 ± 0.4 13.8 ± 0.2 9.1 ± 0.1 33.6 ± 0.4
CCMP, 30 55.8 ± 0.3 14.1 ± 0.2 9.1 ± 0.1 32.8 ± 0.4
Source: Reprinted from Pegg, R. B. Development of nitrite-free meat curing systems. PhD
thesis, Memorial University, St. John’s, Newfoundland and Labrador, Canada, 1993.
With permission.
CCMP, cooked cured meat pigment.
a All pork systems were prepared with 20% (w/w) distilled water and 550 mg/kg sodium

ascorbate.

meats richer in myoglobin require greater addition levels of CCMP to attain

an attractive cured color in the final product (Pegg and Shahidi, 1990).
In a pilot-scale study, nitrite-free cured frankfurter and salami products
were prepared. Industry panel members were unable to distinguish the
nitrite-cured control (i.e., 200 mg/kg sodium nitrite addition based on for-
mulation) from the nitrite-free test samples (i.e., 21–27 mg/kg CCMP) based
on visual observation (Pegg, 1993). Frankfurter and salami products used
beef, pork, some organ tissues, and mechanically deboned chicken meat in
their formulations. It was only when the two sets of samples were examined
under bright daylight that the nitrite-free cured sample was discovered to be
slightly redder and darker in appearance (Shahidi et al., 1993).
The preformed CCMP undergoes decomposition in the presence of light
and air, as does the pigment present in nitrite-cured meats. Unlike the
CCMP in processed products, there is no protein matrix protecting the nitro-
sylated heme pigment from oxidation. Therefore, its stabilization is crucial.
The preformed CCMP was protected by microencapsulation using modified
starch, cyclodextrins, and gums followed by spray drying. In this manner,
the pigment remains “locked” in a powder format until it is released by the
moisture when mixed into ground meat or by its dissolution in water or a
pickle. The resultant powdered cooked cured meat pigment (PCCMP) acts as
a potent agent for color development in nitrite-free curing mixtures. PCCMP
was applied to various meat systems and found to successfully duplicate
the color characteristics of nitrite-cured analogues (Shahidi and Pegg, 1991b).
522 Advanced Technologies for Meat Processing, Second Edition

H
N Protein

N
H2C CH CH3

H3C C CH2
H
N N

Fe(II)
N N
H3C CH3

HOOC COOH
H2O
(One of the four heme moieties from bovine red blood cells, red, Fe2+)
Hemin isolation by
Schalfejew method
using acetic acid/salt
H2C CH CH3

H3C C CH2
H
N N
–
Fe(III) Cl
N N
H3C CH3

HOOC COOH
Hemin chloride
(Green/black color in basic solution, Fe3+)
Dissolution in an acetate
(NO) addition buffer containing a reductant
and polyphosphate
NO
H2C CH CH3

H3C C CH2
H
N N

Fe(II)
N N
H3C CH3

HOOC COOH
Mononitrosyl protoheme
(Cooked cured meat pigment, pink, Fe2+)

FIGURE 16.1
Preparation and chemical structure of the preformed cooked cured meat pigment from hemin
chloride after its isolation from bovine red blood cells.
Processing of Nitrite-Free Cured Meats 523

The optimal addition level of PCCMP to meat depends primarily on its

endogenous myoglobin content (Shahidi and Pegg, 1991a). Best performance
of the pigment, however, was observed for meat systems containing a low or
intermediate concentration of myoglobin.

16.4.2 Antioxidant Properties

Nitrite functions as a strong antioxidant in cured meats and thus prevents
lipid oxidation. However, nitrite is not unique in its role as a food-grade anti-
oxidant. Shahidi (1989) proposed that any agent or combination of agents
that prevents lipid oxidation, with the exception of nitrite precursors, would
in principal duplicate the antioxidant role of nitrite in the curing process.
To reproduce the antioxidative efficacy of nitrite, a number of antioxidants
(Shahidi et al., 1987a), sequestrants (Shahidi et al., 1986), and their combina-
tions (Shahidi et al., 1987b, 1988) were examined. Addition of antioxidants
to meat and meat products resulted in the preservation of meat quality by
retarding autoxidation and rancidity development, as well as discoloration
and loss of nutrients. The inhibitory effect of the antioxidants was attributed
to their ability to donate a hydrogen atom or an electron to a lipid-free radical
as well as possibly to form a complex between the antioxidants themselves
and the lipid molecule (Dziezak, 1986). The concentration of carbonyl com-
pounds produced in these systems from autoxidation was markedly reduced
when combinations containing polyphosphates, ascorbates, and low levels
of an antioxidant were used. The spectrum of notable carbonyl compounds
was, however, similar to the nitrite-cured system.
Among synthetic antioxidants, butylated hydroxyanisole (BHA) and
tert-butylhydroquinone (TBHQ) were most effective, even at 30 mg/kg, in
retarding oxidation during a five-week storage period at 4°C. This was con-
firmed by monitoring the production of 2-thiobarbituric reactive substances
(TBARSs) over this period and comparing to those for the nitrite-cured control
(Table 16.2). Among the food-grade sequestrants, sodium acid pyrophosphate,
tetrasodium pyrophosphate, sodium tripolyphosphate (STPP), and ethylene-
diaminetetraacetic acid were the most efficacious. Sodium ascorbate and STPP
alone retarded lipid oxidation, but together, a strong synergistic action was
noted (Shahidi and Pegg, 1992). In fact, the mixture containing sodium ascor-
bate (550 mg/kg) and STPP (3000 mg/kg) with or without a phenolic antioxi-
dant (30 mg/kg) was as effective as sodium nitrite (150 mg/kg) in the presence
of sodium ascorbate (550 mg/kg). Addition of sodium nitrite to meat contain-
ing sodium ascorbate and STPP at the abovementioned levels did not have any
further effect in controlling lipid oxidation (Shahidi et al., 1987b).
In the food industry, there has been a move to clean label products and
hence the use of natural ingredients due to greater sensitivity of con-
sumers to synthetic additives, and especially since BHA and butylated
hydroxytoluene (BHT) are suspected to have carcinogenic activity (Valentão
et al., 2002). Research has shown that constituents of aromatic plants can
524 Advanced Technologies for Meat Processing, Second Edition

TABLE 16.2
TBARS Values of Cooked Ground Pork Pretreated with Different Additives after a
5-Week Storage Period at 4°C
Exp. No. Additives (mg/kg)a TBARS Valueb
1 Control, no additives 15.46
2 Sodium nitrite, 150 0.63
3 Butylated hydroxyanisole, 30 0.44
4 tert-Butylhydroquinone, 30 0.35
5 Sodium tripolyphosphate, 3000 1.86
6 Tetrasodium pyrophosphate, 3000 1.66
7 Sodium hexametaphosphate, 3000 7.21
8 (5) + Sodium ascorbate, 550 0.27
9 (6) + Sodium ascorbate, 550 0.23
10 (7) + Sodium ascorbate, 550 0.29
11 (8) + (3) 0.20
12 (8) + (4) 0.18
13 Preformed cooked cured meat pigment, 12 9.89
14 (11) + (13) 0.34
15 (12) + (13) 0.24
16 (14) + Sodium hypophosphite, 3000 0.28
17 (15) + Sodium hypophosphate, 3000 0.21
Source: Reprinted from Food Chemistry, 43, Shahidi, F. and Pegg, R. B., Nitrite-free meat curing
systems: Update and review, 185–191, Copyright 1992, with permission from Elsevier.
a All pork systems were prepared with 20% (w/w) distilled water and listed additive(s).

b TBARS (2-thiobarbituric acid reactive substances) values were determined by the classical

distillation method and are reported as mg malonaldehyde equivalents/kg meat.

function as natural antioxidants and thereby prevent or retard rancidity of

food lipids, improve sensory scores, and offer greater consumer acceptance
of food products (Nakatani, 1997). Crude extracts of spices, herbs, and other
plant materials rich in polyphenolics are increasingly of interest because
they have the capacity to retard oxidative degradation of lipids and thereby
improve the quality and nutritional value of food (Amarowicz et al., 2004).
Although certain spices and herbs, or their fractions, may possess marked
antioxidant activity, their practical application to meat and meat products
may be restricted due to a pungent or characteristic flavor imparted by the
spice and to their thermal stability in the product.
The antioxidant activity of selected spices and their oleoresins in pork sys-
tems has been investigated. The TBARS values for spice-containing samples
were lower than those of the control, thus indicating protection to meat by
these spices against lipid oxidation. The protection, however, was concentra-
tion dependent and a saturated point was reached after a certain amount of
spice had been added. For example, the addition of clove at a 500 mg/kg level
achieved 96% inhibition of TBARS, but this protection remained unchanged
even when higher concentrations were employed (Shahidi et al., 1995). In the
Processing of Nitrite-Free Cured Meats 525

pork systems, clove, sage, rosemary, and oregano appeared quite effective in
retarding lipid oxidation as TBARS values remained at less than 1 μg/g sample
over the entire three-week storage period at 4°C. Because future research into
novel sources of natural antioxidants as a component in functional food for-
mulations is expected to continue, there will be new preparations available
to curb lipid oxidation with the potential of being part of a nitrite-free cur-
ing system. The use of rosemary extract and green tea in meat product has
been a common practice in the more recent formulations (Senanayake, 2013).
Furthermore, protein extenders such as meals from mustard, canola, and other
grains belonging to the cereal, legume, and oilseeds groups may be used as all
of these include considerable amount of antioxidant phenolics (Shahidi, 2016).

16.4.3 Flavor Characteristics

According to the National Academy of Sciences (NAS, 1982), the generation
of cured meat flavor is most likely a composite sensation derived from the
contribution of many odoriferous compounds. No research has been able to
specify a positive contribution by nitrite to flavor in chemical terms, but the
NAS suggested that nitrite probably influences the flavor of cured meat by
virtue of its antioxidative effects. Because the mechanism involved in the
production of the characteristic cured meat flavor is uncertain, there is no
known nitrite substitute that can duplicate this flavor.
There were contradicting studies throughout the 1970s and 1980s as to the
impact of salt and nitrite on cured meat flavor. What is clear, however, is
that the amount of salt used in curing processes plays a vital role in deter-
mining the overall flavor of the product. Yun (1984) and Yun et al. (1987)
evaluated combinations of ingredients that would effectively prevent lipid
oxidation in cooked ground pork systems to be used in the nitrite-free cur-
ing of meat products such as frankfurters. The authors reported that sensory
evaluation scores of pork systems treated with 3000 mg/kg STPP, 500 mg/kg
sodium ascorbate, and 30 mg/kg BHA or TBHQ were not significantly dif-
ferent (p > .05) from their nitrite-cured (156 mg/kg) counterparts. Yun (1984)
also observed that the concentration of volatiles identified in the distillate
of cooked pork samples, notably hexanal, was significantly reduced (p < .05)
when samples had been pretreated with the preceding antioxidant/chelating
agent combinations. The concentration of volatiles in these systems was
depressed almost to the level of the nitrite-cured control (Table 16.3).
These two studies suggest, for the most part, that it is possible to prepare
nitrite-free cured meat products without seriously compromising their
flavor. If one accepts the views of Cross and Ziegler (1965) that cured ham
flavor represents the basic or true-to-nature flavor of meat derived from pre-
cursors other than triacylglycerols or phospholipids and that the different
aromas of the various types of cooked meat depend on the spectrum of car-
bonyl compounds derived by lipid oxidation, then any agent or combination
that suppresses lipid oxidation, would, in principle, duplicate the flavor of
526 Advanced Technologies for Meat Processing, Second Edition

TABLE 16.3
Effect on the Concentration of Dominant Carbonyl Compounds from Cooked
Ground Pork When Treated with Either Sodium Nitrite or a Nitrite-Free Preparation
Relative Concentration
Carbonyl Compounds Uncured Meat a Nitrite Curedb Nitrite-Free Treatedc
Hexanal 100 7.0 6.5
Pentanal 31.3 0.5 0.5
Heptanal 3.8 < 0.5 0.5
Octanal 3.6 < 0.5 0.5
Nonanal 8.8 0.5 0.7
trans-2-Octenal 2.0 – –
trans-2-Nonenal 1.0 – –
trans-2-Decenal 1.1 – <0.1
trans-2-Undecenal 1.4 0.5 0.5
trans,trans-2,4-Decadienal 1.1 — <0.1
Source: Reprinted from Food Chemistry, 43, Shahidi, F. and Pegg, R. B., Nitrite-free meat curing
systems: Update and review, 185–191, Copyright 1992, with permission from Elsevier.
a Pork system contained 20% (w/w) distilled water.

b Pork system contained 20% (w/w) distilled water; sodium nitrite, 150 mg/kg; and sodium

ascorbate, 550 mg/kg.

c Pork system contained 20% (w/w) distilled water; preformed cooked cured meat pigment,

12 mg/kg; sodium tripolyphosphate, 3000 mg/kg; sodium ascorbate, 550 mg/kg; and tert-
butylhydroquinone, 30 mg/kg.

nitrite-cured meat. In other words, the antioxidative role of nitrite simply

retards the breakdown of unsaturated fatty acids and the formation of sec-
ondary lipid oxidation products; this may be the main process involved in
modifying the volatile profile of cooked cured meats by suppressing the for-
mation of oxidation products, thereby allowing the unique flavor associated
with cured products to be revealed.

16.4.4 Antimicrobial Properties

Nitrite exerts a concentration-dependent antimicrobial effect in cured meat
products in the inhibition of the outgrowth of spores of putrefactive and
pathogenic bacteria such as C. botulinum (NAS, 1982). Irrespective of the
fate of nitrite, its removal from or reduction in meat products must be coun-
terbalanced by alternatives that will assure safety from botulinal hazards
in abused products (Shahidi and Pegg, 1991d). At the same time, the tra-
ditional identity of the cured meat product in question must be retained.
According to Sofos and Busta (1980), any substance to be considered as an
alternative to nitrite should be suitable for use in all cured meat products
and should control other microorganisms of public health significance,
delay product spoilage, and not interfere with beneficial microorganisms,
such as lactic acid-producing cultures, required in the manufacturing of
Processing of Nitrite-Free Cured Meats 527

fermented meat products. The compound of choice must also be at least as

effective as nitrite, safe, heat stable, flavorless, and preferably effective at
low concentrations.
Alternatives to nitrite that have been tested include propylparabens, sorbic
acid and its potassium salts, esters of fumaric acid, lactic acid and its salts,
nisin and other bacteriocins. Sodium hypophosphite has been proposed
for use as an antimicrobial agent in foods (Rhodehamel and Pierson, 1990).
Microbiological studies have indicated that a total or partial replacement of
nitrite with this compound effectively inhibits production of C. botulinum
toxins (Banner, 1981). At 3000 mg/kg alone or at 1000 mg/kg in combina-
tion with 40 mg/kg of nitrite, sodium hypophosphite imparted anticlostrid-
ial protection to meat products equivalent to that provided by 120 mg/kg
of nitrite. Wood et al. (1986) evaluated the antibotulinal activity of sodium
hypophosphite, potassium sorbate, and monomethyl fumarate in nitrite-
free curing systems. The treatment containing 3000 mg/kg sodium hypo-
phosphite, together with CCMP, sodium ascorbate, STPP, and TBHQ, most
closely resembled that of nitrite at 150 mg/kg in its ability to prevent spore

TABLE 16.4
Effect of Treatment Composition on Gas and Toxin Production by Clostridium
botulinum in Cooked Ground Porka
Incubation at 27°C (Days)
Exp
No. Treatment b 1 2 3 4 5 6 7 8 27
1 No additives 34/34
+
2 NaNO2, 150 0/36 – 11/36 + 5/18 + 8/13 + 3/5 * 2/2 +
3 (2) + ASC 0/36 – 0/32 – 15/30 – 5/14 + 3/9 + 4/6 + 1/2 + 0/1 – 0/1 –
4 CCMP, 12 17/17
+
5 (4) + ASC + 12/37 25/25 +
STPP + TBHQ +
6 (4) + SHP 1/18 – 1/16 + 2/14 + 4/12 + 3/5 + 1/2 + 0/1 – 0/1 – 0/1 –
7 (4) + ASC + 5/17 – 0/11 – 3/11 * 6/8 + 0/2 – 0/2 – 0/2 – 0/2 – 0/2 –
SHP
8 (5) + SHP 6/35 – 3/27 * 1/24 – 6/22 + 3/16 * 5/13 + 6/8 + 1/2 + 0/1 –
9 (5) + PS 0/39 – 32/35 + 3/3 +
10 (5) + MMF 0/37 – 1/33 – 17/31 + 9/18 + 3/7 + 3/4 + 0/1 + 0/1 + 0/1 –
Source: Reprinted from Wood, D. S. et al., Journal of Food Protection, 49, 691–695, 1986.
Copyright held by the International Association for Food Protection, Des Moines,
Iowa, IA. With permission.
a Number of packs showing gas production/total number of packs. + = toxin present; – =

toxin absent; * = presence of toxin was not tested.

b Additives were as follows: sodium ascorbate (ASC), preformed cooked cured meat pigment

(CCMP), sodium tripolyphosphate (STPP), tert-butylhydroquinone (TBHQ), sodium hypo-

phosphite (SHP), potassium sorbate (PS), and monomethyl fumarate (MMF).
528 Advanced Technologies for Meat Processing, Second Edition

outgrowth and toxin production (Table 16.4). Monomethyl fumarate at 1250

mg/kg was slightly less effective than sodium hypophosphite and these
additives had no adverse effect on the oxidative stability or the color of for-
mulated pork products. Moreover, sodium hypophosphite is bland in taste;
nitrite-free bacon containing 3000 mg/kg of it had a flavor as desirable as
that of its conventionally cured counterpart.

16.5 Tailor Designing Nitrite-Free Meat Products

The use of the nitrite-free meat curing system is highly dependent on the
product in question. First, this system cannot be used to dry-cure meat prod-
ucts. Nitrite is a very small anion, whose relative rate of diffusion through
muscle tissue utilizing the meat’s natural moisture is markedly faster than
that of CCMP or PCCMP. The molecular size of CCMP/PCCMP is several
orders of magnitude larger than that of nitrite; this affects the pigment’s rate
of diffusion through the meat. Second, when formulating meat products,
nitrite-free curing systems work best in ground or emulsified meat products,
as opposed to whole muscle cuts; CCMP or PCCMP is more uniformly dis-
tributed throughout the meat matrix. CCMP or PCCMP can also be added
to a solution and used in a pickle formulation for treating solid cuts of meat.
Unlike nitrite-containing pickles, nitrite-free ones with CCMP or PCCMP
are more sensitive to oxidation and therefore need to be prepared in a special
manner (i.e., dissolution of the pigment in a polyphosphate and ascorbate
solution before mixing it with brine) just before injecting it into pieces of
meat. Care must be exercised in the application of nitrite-free curing sys-
tems in whole muscle cuts to ensure that the pigment is evenly distributed
throughout and that red blotches are avoided. After pumping meats, tum-
bling or massaging of the product facilitates an even distribution of the
CCMP throughout the muscle tissue.
All nitrite-free cured meat products must contain CCMP or PCCMP for proper
color fixation and an antioxidant or sequestrant system (i.e., either synthetic or
natural antioxidants) for protection of meat lipids against oxidation, but not
necessarily an antimicrobial agent. If the meat product being formulated is to
be canned, such as a Vienna-type sausage or a meat loaf, the product will be
heat sterilized and an antimicrobial agent is not required. If the product is to
be stored in a retail display case under a modified atmosphere at refrigerated
temperatures, again an antimicrobial agent may not be needed. On the other
hand, for a traditional product such as a vacuum-packaged frankfurter, inclu-
sion of an antimicrobial agent, such as sodium hypophosphite, is mandatory in
the product for protection against the outgrowth of spores from C. botulinum.
To summarize, several nitrite-free combinations consisting of the preformed
CCMP or its encapsulated product, PCCMP, a sequestrant, and an antioxidant,
as well as an antimicrobial agent for the curing of meat products have been
Processing of Nitrite-Free Cured Meats 529

described. These mixtures successfully reproduced the color, oxidative stability,

and flavor as well as the antimicrobial effects of nitrite in meat products. Further
details on the process are available in three U.S. patents (Shahidi and Pegg, 1993,
1995a,b). The question now put forward is this: is there any commercial value
to these nitrite-free meat curing systems? Limits imposed by regulatory agen-
cies on the level of nitrite permitted in various meat products, coupled with the
responsible reductions in nitrite addition implemented by the meat processing
industry have reduced the possibility of overcuring and N-nitrosamine forma-
tion. Today, product innovations and food safety (e.g., hazard analysis critical
control points [HACCPs]) drive the meat industry. Benefits from the controlled
and responsible use of nitrite overwhelm the possible risks from the outbreak
of botulinal food poisoning. Because of nitrite’s connection with cancer-causing
N-nitrosamines, its use, nonetheless, is a potential trouble area. Hence, employ-
ment of a nonnitrite cure for a niche market is deemed desirable and also offers
a practical solution to address the needs of the industry and consumers.

16.6 Other Developments

Other developments in the field include making use of celery extract as a
source of nitrate that is carefully reduced to nitrite, which is then used in the
curing of meat. While this process has also been referenced as nitrite-free cur-
ing by the user industry, this may be considered as misuse of the term as the
process is not nitrite-free and the residual nitrite in the products is not less than
those that use nitrite directly. In fact, our own routine testings have shown the
reverse trend of increased nitrite residues in such products. Although we have
not checked the N-nitrosamine content of these products, one may assume
that their content could indeed be higher than directly cured products with
nitrite. Thus, responsible measures should be considered when developing
alternatives to the currently used nitrite curing processing. In this connection,
Sebranek et al. (2012) have summarized advances in natural and organic cur-
ing processes. Related publications on this topic are also worthy of consider-
ation (Jackson et al., 2011; Sebranek and Bacus, 2007; Sindelar et al., 2007a,b,c).
Thus, the solutions put forward in this chapter fill the existing knowledge gap,
but their adoption by the industry may need new initiatives.

References
Aberle, E., Forrest, J. C., Gerrard, D. E. and Mills, E. W. (2001). Principles of Meat Science
(4th Ed.). Dubuque, IA: Kendall/Hunt.
Amarowicz, R., Pegg, R. B., Rahimi-Moghaddam, P., Barl, B. and Weil, J. A. (2004).
Free-radical scavenging capacity and antioxidant activity of selected plant spe-
cies from the Canadian prairies. Food Chemistry, 84, 551–562.
530 Advanced Technologies for Meat Processing, Second Edition

Banner, R. J. (1981). Sodium hypophosphite: New nitrite replacer? Food Engineering,

53(10), 130.
Binkerd, E. F. and Kolari, O. E. (1975). The history and use of nitrate and nitrite in the
curing of meat. Food and Cosmetics Toxicology, 13, 655–661.
Blot, W. J., Henderson, B. E. and Boice, J. D., Jr. (1999). Childhood cancer in relation
to cured meat intake: Review of the epidemiological evidence. Nutrition and
Cancer, 34, 111–118.
Cross, C. K. and Ziegler, P. (1965). A comparison of the volatile fractions from cured
and uncured meat. Journal of Food Science, 30, 610–614.
Dziezak, J. D. (1986). Preservatives: Antioxidants. Food Technology, 40(9), 94–97,
100–102.
Flores, J. and Toldrá, F. (1993). Curing. In: Macrae, R., Robinson, R. K. and Sadlor, M. J.
(eds.) Encyclopedia of Food Science, Food Technology and Nutrition. London, UK:
Academic Press, pp. 1277–1282.
Fox, J. B., Jr. (1974). Role of cure accelerators. In: Proceedings of the Meat Industry
Research Conference. Arlington, VA, American Meat Institute Foundation, 17–21.
Glória, M. B. A., Barbour, J. F. and Scanlan, R. A. (1997). Volatile nitrosamines in fried
bacon. Journal of Agricultural and Food Chemistry, 45, 1816–1818.
Haldane, J. (1901). The red colour of salted meat. Journal of Hygiene, 1, 115–122.
Jackson, A. L., Sullivan, G. A., Charlwit K., Sebranek, J. G. and Dickson, J. S. (2011).
Survival and growth of Clostridium perfringens in commercial no-nitrate-or-
nitrite-added (natural and organic) frankfurters, hams, and bacon. Journal of
Food Protection, 74, 410–416.
Jensen, L. B. (1953). Man’s Foods: Nutrition and Environments in Food Gathering Times
and Food Producing Times. Champaign, IL: Garrard Press.
Kostyla, A. S. and Clydesdale, F. M. (1978). The psychophysical relationships
between color and flavor. CRC Critical Reviews in Food Science and Nutrition,
10, 303–321.
Ledward, D. A. (1992). Colour of raw and cooked meat. In: Johnston, D. W., Knight,
M. K. and Ledward, D. A. (eds.) The Chemistry of Muscle-Based Foods. Cambridge,
UK: The Royal Society of Chemistry, pp. 128–144.
Livingston, D. J. and Brown, W. D. (1981). The chemistry of myoglobin and its reac-
tions. Food Technology, 35, 244–252.
Loeppky, R. N. (1994). Nitrosamine and N-nitroso compound chemistry and bio-
chemistry. In: Loeppky, R. N. and Michejda, C. J. (eds.) Nitrosamines and Related
N-Nitroso Compounds: Chemistry and Biochemistry. Washington, DC: American
Chemical Society, pp. 1–18.
Nakatani, N. (1997). Antioxidants from spices and herbs. In: Shahidi, F. (ed.) Natural
Antioxidants: Chemistry, Health Effects, and Applications. Champaign, IL: AOCS
Press, pp. 64–75.
National Academy of Sciences (NAS). (1982). Alternatives to the Current Use of Nitrite
in Foods. Washington, DC: National Academy Press.
Palmin, V., Fedorova, T., Prizenko, V. and Loginova, O. (1975). The manufacture of
nitrosohaemochromogen and its application as meat product colorant. Myasnaya
Industriya SSSR, 2, 40–41.
Palmin, V. V. and Prizenko, V. K. (1974). Stabilization of colour of cured meat using
nitric oxide. Izvestia Vysshikh Uchebnykh Zavedenii. Pishchevaya Teknologiya,
3, 51–53.
Processing of Nitrite-Free Cured Meats 531

Palmin, V. V., Prizenko, V. K., Fedorova, T. A. and Loginova, O. A. (1973). Some

aspects of colour formation in meat products. In Proceedings of the 19th European
Meeting of Meat Research Workers, Part IV. Paris, France, 1457–1472.
Pegg, R. B. (1993). Development of nitrite-free meat curing systems. PhD thesis,
Memorial University, St. John’s, Newfoundland and Labrador, Canada.
Pegg, R. B. and Shahidi, F. (1990). Effects of myoglobin and nitrite or preformed
cooked cured-meat pigment concentrations on the colour of cooked meats.
In Paper presented at the 33rd Annual Conference of the Canadian Institute of Food
Science and Technology, Saskatoon, Saskatchewan, Canada.
Pegg, R. B. and Shahidi, F. (2000). Nitrite Curing of Meat: The N-Nitrosamine Problem and
Nitrite Alternatives. Trumbull, CT: Food & Nutrition Press.
Peters, J. M., Preston-Martin, S., London, S. J., Bowman, J. D., Buckley, J. D. and
Thomas, D. C. (1994). Processed meats and risk of childhood leukaemia
(California, USA). Cancer Causes and Control, 5, 195–202.
Polenske, E. (1891). Über den Verlust, welchen das Rindfleisch an Nährwerth
durch das Pökeln erleidet, sowie über die Veränderungen Salpeter-haltiger
Pökellaken. Mitteilungen aus dem chemischen Laboratorium des Kaiserlichen
Gesundheitsamtes. Arbeitslosigkeit Gesundh Amt, 7, 471–474.
Preussmann, R. and Stewart, B. W. (1984). N-nitroso carcinogens. In: Searle, C. E. (ed.)
Chemical Carcinogens (2nd Ed., vol. 2). Washington, DC: American Chemical
Society, pp. 643–838.
Rhodehamel, E. J. and Pierson, M. D. (1990). Sodium hypophosphite inhibition of the
growth of selected Gram negative foodborne pathogenic and spoilage bacteria.
Journal of Food Protection, 53, 56–63.
Sebranek, J. G. (1979). Advances in the technology of nitrite use and consideration of
alternatives. Food Technology, 33(7), 58–62, 93.
Sebranek, J. G. (2010). Basic curing ingredients. In: Tarté, R. (ed.) Ingredients in Meat
Products. New York, NY: Springer Science, pp. 274–289.
Sebranek, J. G. and Bacus, J. N. (2007). Cured meat products without direct addition
of nitrate and nitrite: What are the issues. Meat Science, 77, 136–147.
Sebranek, J. G., Jackson-Davis, A. L., Myers, K. L. and Lavieri, N. A. (2012). Beyond
celery and starter culture: Advances in natural/organic curing processes in the
United States. Meat Science, 92(3), 267–273.
Senanayake, N. (2013). Green tea extract: Chemistry, antioxidant properties and food
applications—A review. Journal of Functional Foods, 5, 1529–1541.
Shahidi, F. (1989). Flavor of cooked meats. In: Teranishi, R., Buttery, R. G. and Shahidi,
F. (eds.) Flavor Chemistry: Trends and Developments. Washington, DC: American
Chemical Society, pp. 188–201.
Shahidi, F. (2016). Oxidative stability and shelf-life of meat and meat products. In:
Hu, M. and Jacobsen, C. (eds.) Evaluation of Oxidative Stability and Shelf-life of
Oils/Fats and Oil/Fat-Containing Foods. Champaign, IL: AOCS Press, pp. 373–389.
Shahidi, F. and Pegg, R. B. (1991a). Effect of the preformed cooked cured-meat pig-
ment (CCMP) on color parameters of muscle foods. Journal of Muscle Foods, 2,
297–304.
Shahidi, F. and Pegg, R. B. (1991b). Encapsulation of the pre-formed cooked cured-
meat pigment. Journal of Food Science, 56, 1500–1504, 1518.
Shahidi, F. and Pegg, R. B. (1991c). Novel synthesis of cooked cured-meat pigment.
Journal of Food Science, 56, 1205–1208.
532 Advanced Technologies for Meat Processing, Second Edition

Shahidi, F. and Pegg, R. B. (1991d). Safety and sensory aspects of nitrite alternatives
in meat curing. Canadian Chemical News, 43(2), 12–15.
Shahidi, F. and Pegg, R. B. (1992). Nitrite-free meat curing systems: Update and
review. Food Chemistry, 43, 185–191.
Shahidi, F. and Pegg, R. B. (1993). Powdered cooked cured-meat pigment which is a
non-nitrite meat preservative. US Patent 5,230,915.
Shahidi, F. and Pegg, R. B. (1995a). Proteinaceous food product containing stabilized
cooked cured-meat pigment. US Patent 5,443,852.
Shahidi, F. and Pegg, R. B. (1995b). Stabilized cooked cured-meat pigment. US Patent
5,425,956.
Shahidi, F., Pegg, R. B. and Saleemi, Z. O. (1995). Stabilization of meat lipids with
ground spices. Journal of Food Lipids, 2, 145–153.
Shahidi, F., Pegg, R. B. and Sen, N. P. (1993). Novel nitrite-free processed meats. In:
Ali, R. and Barlow, P. J. (eds.) Impact of Food Research on New Product Development.
Karachi, Pakistan: University of Karachi, pp. 221–245.
Shahidi, F., Pegg, R. B. and Sen, N. P. (1994). Absence of volatile N-nitrosamines in
cooked nitrite-free cured muscle foods. Meat Science, 37, 327–336.
Shahidi, F., Rubin, L. J., Diosady, L. L., Chew, V. and Wood, D. F. (1984). Preparation of
dinitrosyl ferrohemochrome from hemin and sodium nitrite. Canadian Institute
of Food Science and Technology Journal, 17, 33–37.
Shahidi, F., Rubin, L. J., Diosady, L. L., Kassam, N. and Li Sui Fong, J. C. (1986). Effect
of sequestering agents on lipid oxidation in cooked meats. Food Chemistry, 21,
145–152.
Shahidi, F., Rubin, L. J., Diosady, L. L. and Wood, D. F. (1985). Preparation of the
cooked cured-meat pigment, dinitrosyl ferrohemochrome, from hemin and
nitric oxide. Journal of Food Science, 52, 564–567.
Shahidi, F., Rubin, L. J. and Wood, D. F. (1987a). Control of lipid oxidation in cooked
ground pork with antioxidants and dinitrosyl ferrohemochrome. Journal of Food
Science, 52, 564–567.
Shahidi, F., Rubin, L. J. and Wood, D. F. (1987b). Control of lipid oxidation in cooked
meats by combinations of antioxidants and chelators. Food Chemistry, 23, 151–157.
Shahidi, F., Rubin, L. J. and Wood, D. F. (1988). Stabilization of meat lipids with nitrite-
free curing mixtures. Meat Science, 22, 73–80.
Sindelar, J. J., Cordray, J. C., Sebranek, J. G. Love, J.A. and Ahn, D.U. (2007a). Effects of
varying levels of vegetable juice powder and incubation time on colour, residual
nitrate and nitrite, pigment, pH, and trained sensory attributes of ready-to-eat
uncured ham. Journal of Food Science, 72(6), 388–395.
Sindelar, J. J., Cordray, J. C., Sebranek, J. G., Love, J. A. and Ahn, D. U. (2007b). Effects
of vegetable juice powder concentration and storage time on some chemical
and sensory quality attributes of uncured, emulsified cooked sausages. Journal
of Food Science, 72(5), 324–332.
Sindelar, J. J., Cordray, J. C., Sebranek, J. G., Love, J. A. and Ahn, D. U. (2007c).
Investigating quality attributes and consumer acceptance of uncured, no nitrate/
nitrite-added commercial hams, bacons, and frankfurters. Journal of Food Science,
72(8), 551–559.
Sofos, J. N. and Busta, F. F. (1980). Alternatives to the use of nitrite as an antibotulinal
agent. Food Technology, 34, 244–251.
Processing of Nitrite-Free Cured Meats 533

Stevanović, M., Zlender, B., Abram, V. and Kumperger, U. (1997). The influence of pork
muscle’s type and addition of pigment CCMP on the colour of meat emulsion
coagulates. In: Bass, J. (ed.), Proceedings of the 43rd International Congress of Meat
Science and Technology. Auckland, New Zealand, July 27–August 1. Hamilton, NZ:
Rice Printers, pp. 462–463.
Sweet, C. W. (1975). Additive composition for reduced particle size meats in the cur-
ing thereof. US Patent 3,899,600.
Toldrá, F. and Flores, M. (1998). The role of muscle proteases and lipases in flavor
development during the processing of dry-cured ham. CRC Critical Reviews in
Food Science and Nutrition, 38, 331–352.
Townsend, W. E. and Olson, D. G. (1987). Cured meats and cured meat products pro-
cessing. In: Price, J. F. and Schweigert, B. S. (eds.) The Science of Meat and Meat
Products (3rd Ed.). Trumbull, CT: Food & Nutrition Press, pp. 431–456.
Tricker, A. R. and Preussmann, R. (1991). Carcinogenic N-nitrosamines in the diet:
Occurrence, formation, mechanisms and carcinogenic potential. Mutation Research,
259, 277–289.
Valentão, P., Fernandes, E., Carvalho, F., Andrade, P. B., Seabra, R. M. and Bastos,
M. L. (2002). Antioxidative properties of cardoon (Cynara cardunculus L.) infu-
sion against superoxide radical, hydroxyl radical, and hypochlorous acid.
Journal of Agricultural and Food Chemistry, 50, 4989–4993.
Wood, D. S., Collins-Thompson, D. L., Usborne, W. R. and Picard, B. (1986). An evalu-
ation of antibotulinal activity in nitrite-free curing systems containing dinitrosyl
ferrohemochrome. Journal of Food Protection, 49, 691–695.
Yun, J. J. (1984). Alternative Meat Curing System: Flavour and Oxidative Stability. MASc.
thesis, University of Toronto, Toronto, Canada.
Yun, J., Shahidi, F., Rubin, L. J. and Diosady, L. L. (1987). Oxidative stability and fla-
vour acceptability of nitrite-free meat-curing systems. Canadian Institute of Food
Science and Technology Journal, 20, 246–251.
17
Proteomic Tools for Improved
Processing of Dry-Cured Meats

Leticia Mora and Fidel Toldrá

CONTENTS
17.1 Introduction ................................................................................................ 535
17.2 Muscle Proteolytic System ........................................................................ 536
17.2.1 Endopeptidases .............................................................................. 537
17.2.2 Exopeptidases................................................................................. 537
17.3 Microbial Proteolytical System ................................................................ 538
17.3.1 Endopeptidases ..............................................................................540
17.3.2 Exopeptidases ................................................................................. 541
17.4 Traditional Techniques for the Follow-Up of Proteolysis in
Dry-Cured Meats .......................................................................................542
17.5 Proteomics in Dry-Cured Ham Approaches .........................................543
17.5.1 From Traditional Proteomics to Peptidomics ............................545
17.5.2 Applications of Peptidomics in Dry-Cured Ham .....................545
17.5.2.1 Identification of Bioactive Peptides ..............................548
17.5.2.2 Label-Free Relative Quantitation to Determine
Differences between Dry-Cured Hams ....................... 549
17.5.3 Data Analysis ................................................................................. 550
References............................................................................................................. 552

17.1 Introduction
Dry-cured meats are characterized by a typical flavor, color, and texture that
make them a high-quality product that has been consumed for centuries in
many countries. The processing of such types of dry-cured meats is very
long, lasting a few months for dry-fermented sausages or several months
or even years in the case of dry-cured ham (Toldrá, 2012a). There are sev-
eral biochemical mechanisms taking place, proteolysis through the action
of endogenous muscle peptidases the most relevant. The enzymes involved
are endopeptidases, mainly cathepsins and calpains, which are able to
degrade sarcoplasmic and myofibrillar proteins and generate polypeptides

535
536 Advanced Technologies for Meat Processing, Second Edition

that are further hydrolyzed into smaller peptides and free amino acids by
exopeptidases (Toldrá, 2002; Toldrá and Flores, 1998).
A good control of proteolysis is of primary importance in order to produce a
product that is consistent, regular, and high quality. Muscle and/or microbial
proteases are mainly responsible for the proteolytical changes and thus, a good
knowledge of their properties and mode of action is essential for a controlled pro-
teolysis (Toldrá, 2012b). The proteolysis phenomena involving muscle and micro-
bial proteases and their resulting products, and the latest proteomic tools available
for the study of proteolysis in dry-cured meats, are presented in this chapter.

17.2 Muscle Proteolytic System

Skeletal muscle contains a good number of enzymes involved in multiple meta-
bolic pathways. Some of the most important enzymes are related to protein
changes. Endopeptidases (calpains and cathepsins) are responsible for protein
breakdown, tri- and dipeptidylpeptidases (DPP) are involved in the generation
of small tri- and dipeptides, and finally, aminopeptidases and carboxypepti-
dases release free amino acids (Toldrá, 2012b). A general scheme of the pro-
teolytical chain is shown in Figure 17.1. Most of these enzymes remain very
active in postmortem muscle, playing important roles in proteolysis, and thus,

Myofibrillar and sarcoplasmic proteins

Calpains, cathepsins, microbial proteinases

Protein fragments

Tripeptidylpeptidases

Tripeptides

Dipeptidylpeptidases
Dipeptides

Aminopeptidases

Free amino acids

Chemical reactions

Volatile compounds

FIGURE 17.1
General scheme of the proteolytical chain in dry-cured meats.
Proteomic Tools for Improved Processing of Dry-Cured Meats 537

they have an important relevance for the development of meat quality. Some of
these peptidases, with optimal acid pH, are located in organules like lysosomes
while others are bound to membranes or free in the cytosol (Haard, 1990).

17.2.1 Endopeptidases
There are three important groups of endopeptidases, or proteinases: cathepsins,
calpains, and proteasome. Cathepsins B, D, H, and L are located in lysosomes.
They are very small in size, with molecular masses within the range 20–40
kDa, that allow them to penetrate into the myofibrillar structure and hydro-
lyze important proteins like myosin and troponins that experience important
changes during dry curing (Toldrá, 1998). Optimal pH for cathepsins B and L
is around 6.0, for cathepsin H near 6.8, and for cathepsin D in the range 3.0–5.0
(Toldrá and Flores, 1998). Cathepsins are very active and have high stability
in long processed meat products (Toldrá and Etherington, 1988). The second
group of proteinases are two calpains, also known as calcium-activated neutral
proteinases, calcium-dependent proteases, or calcium-activated factor. Both cal-
pains are located in the cytosol but mainly in the z-line area and differ in their
Ca2+ requirement for activation, 50–70 μM of Ca2+ for calpain I or μ-calpain and
1–5 mM for calpain II or m-calpain. They have an optimal neutral pH, around
7.5, but their activity decreases rapidly at acid pH values such as those found in
dry-fermented sausages. The stability is very poor for calpain I and rather poor
for calpain II, which may exhibit some activity after a few weeks (Koohmaraie
et al., 1987). Calpains have been considered the major contributors to meat ten-
derization (Lawrie and Ledward, 2006) even though in recent years it has been
also attributed to the action of other muscle proteolytic enzymes (Ouali et al.,
2006; Kemp et al., 2010). The third group is the proteasome complex, a large pro-
tease with multiple catalytic sites, is the third group of proteases. This enzyme
is able to exhibit different activities like chymotrypsin-like activity, trypsin-like
activity, and peptidyl-glutamyl hydrolyzing activity (Coux et al., 1995). The 20S
proteasome may have a role in tenderness because of its ability to degrade myo-
fibrils, specially M and z lines, but this activity is only exhibited at high pH
values, far from those found in dry-cured meats (Ouali and Sentandreu, 2002).
The mode of action for these enzymes is shown in Figure 17.2.

17.2.2 Exopeptidases
Two important groups of muscle exopeptidases are tripeptidylpeptidases
(TPP) and dipeptidylpeptidases (DPP). TPP I and II, with optimal activity at
acid and neutral pH, respectively, are able to hydrolyze different tripeptides
from the amino termini of peptides and proteins. DPP I and II have optimal
acid pH while DPP III and IV have optimal pH around 7.8–8.0 (Sentandreu
and Toldrá, 1998, 2000, 2001a,b). Dipeptidases are enzymes able to hydrolyze
dipeptides and their names can vary depending on the preference for certain
amino acids. Aminopeptidases, which have large molecular masses, are able
to release a free amino acid from the amino terminus of peptides and proteins.
538 Advanced Technologies for Meat Processing, Second Edition

Endopeptidases Lys-Ala-Arg-Leu-Gly-His-Gly-Phe-.....

Tripeptidylpeptidases Ala-Ala-Phe-Leu-Tyr-Phe-Gly-Leu-….

Dipeptidylpeptidases Ala-Ala-Lys-Phe-Arg-Ala-Trp-Tyr-….

X-Pro-dipeptidylpeptidases Gly-Pro-Lys-Arg-Tyr-Ala-Arg-Lys-….

Tripeptidases Ala-Ala-Phe

Dipeptidases Ala-Arg

General aminopeptidases Ala-Arg-Ala-Tyr-Leu-Gly-His-Phe-….

Arginyl aminopeptidases Lys-Ala-Arg-Tyr-Leu-Gly-His-Phe-….

Carboxypeptidases …..-Phe-Leu-Tyr-Ala-Arg-Phe-Arg-Leu

FIGURE 17.2
Example of peptide bond hydrolysis by different types of peptidases.

Arginyl, alanyl, pyroglutamyl, leucyl, and methionyl aminopeptidases are the

most important aminopeptidases in skeletal muscle. All of them are active
at neutral or basic pH. Alanyl and methionyl aminopeptidases have a wide
spectrum of activity while arginyl aminopeptidase, or aminopeptidase B, is
only able to hydrolyze arginine and lysine. A minor role is expected for leucyl
and pyroglutamyl aminopeptidases due to their optimal basic pH (Toldrá
et al., 2000).
There are two carboxypeptidases, both located in the lysosomes, with opti-
mal activity at acid pH. They generate free amino acids from the carboxyl
termini of peptides and proteins. Carboxypeptidase B has a wide spectrum
of activity against any terminal amino acid but carboxypeptidase A is more
specific for hydrophobic amino acids (Barrett et al., 2004). The mode of action
of these proteases against different substrates is shown in Figure 17.2 and the
substrate preferences are given in Table 17.1.

17.3 Microbial Proteolytical System

The proteolytic system is essential for a number of cellular processes involved
in major physiological processes like use of proteins to supply free amino
acids as nutrients and gene regulation (Pritchard and Coolbear, 1993). The
mechanisms for proteolytic breakdown of proteins by microbial enzymes are
similar to those previously described for muscle enzymes (see Figures 17.1 and
17.2). These enzymes are also endopeptidases or proteinases and peptidases.
Proteomic Tools for Improved Processing of Dry-Cured Meats 539

TABLE 17.1
Main Muscle Exopeptidases: Location and Substrate Preferences
Optimal
Enzyme EC Number Location Substrates pH Range References
DPP I EC 3.4.14.1 Lysosome Ala-Arg-peptide, 5.0–6.0 Sentandreu
Gly-Arg-peptide & Toldrá
(2000)
DPP II EC 3.4.14.2. Lysosome Gly-Pro-peptide 5.0–6.0 Sentandreu
& Toldrá
(2001a)
DPP III EC 3.4.14.4. Cytosol Arg-Arg-peptide, 7.5–8.0 Sentandreu
Ala-Arg-peptide & Toldrá,
(1998)
DPP IV EC 3.4.14.5. Membrane Gly-Pro-peptide 7.5–8.0 Sentandreu
& Toldrá
(2001b)
TPP I EC 3.4.14.9. Lysosome Gly-Pro-Phe-peptide 3.0–5.0 Toldrá (2002)
Ala-Ala-Phe-peptide
TPP II EC 3.4.14.10. Cytosol Gly-Pro-Phe-peptide 6.5–7.5 Toldrá (2002)
Ala-Ala-Phe-peptide
Alanyl EC 3.4.11.14. Cytosol Ala-peptide, amino 6.0–7.0 Flores et al.
aminopeptidase acids-peptide (1996)
Arginyl EC 3.4.11.6. Cytosol Arg-peptide, 6.0–7.0 Flores et al.
aminopeptidase Lys-peptide (1993)
Methionyl EC 3.4.11.18. Cytosol Met-peptide, Ala- 7.0–7.5 Flores et al.
aminopeptidase peptide, Lys-peptide, (2000)
Leu-peptide
Leucyl EC 3.4.11.1. Cytosol Leu-peptide 9.0 Toldrá et al.
aminopeptidase (2012b)
Pyroglutamyl EC 3.4.19.3. Cytosol Pyroglu-peptide 8.0–8.5 Toldrá et al.
aminopeptidase (2012b)
Carboxypeptidase A EC 3.4.16.1. Lysosome Peptide-hydrophobic 5.0–5.5 Barrett et al.
amino acids (2004)
Carboxypeptidase B EC 3.4.18.1. Lysosome Peptide-amino acid 5.0–5.5 Barrett et al.
(2004)
DPP, dipeptidylpeptidases; TPP, tripeptidylpeptidases.

Endopeptidases or proteinases are predominantly extracellular and peptidases

are located inside the cell. Extracellular proteinases may be bound either to the
cell wall or to the cell membrane (Visser, 1993). In this way, the mode of action
may substantially differ if using whole cells or only cell-free extracts. In the
case of whole cells, the amino acid and peptide transport system is necessary
to supply the cells with the amino acids required for growth (Tan et al., 1993).
The cell wall-associated proteolytic activity is the first enzyme to degrade pro-
teins. The generated peptides are then transported into the cell where they are
further degraded by different peptidases like tri- and dipeptidases, DPP, and
aminopeptidases, to small peptides and free amino acids (Bockelmann, 1995).
Many microorganisms have been used as starters for fermented meats. Some
540 Advanced Technologies for Meat Processing, Second Edition

of the most important are Lactobacillus sakei, Lactobacillus curvatus, Lactobacillus

carnosus, Lactobacillus plantarum, Kocuria varians, Staphylococcus xylosus, and the
yeast Debaryomices hansenii (Toldrá, 2004, 2012a). Lactic acid bacteria constitute
a group of microorganisms widely used in food fermentation. Even though
the proteolytic system from dairy lactic acid bacteria has been well character-
ized, limited information is available on meat Lactobacilli.

17.3.1 Endopeptidases
Lactic acid bacteria have some endopeptidases or proteinases associated to the
cell envelope. These proteinases are responsible for initial breakdown of pro-
teins into oligopeptides. Several in vitro assays have been performed to elucidate
the hydrolysis of sarcoplasmic and myofibrillar meat proteins when incubated
with whole cells and cell-free extracts from different Lactobacilli like L. sakei,
L. curvatus, L. plantarum, and L. carnosus. The hydrolysis of myofibrillar proteins
is rather poor for all the assayed strains (Fadda et al., 1999a,b; Sanz et al., 1999a,b).
These in vitro observations agree with other reports that bacterial proteinases
are less effective than muscle proteinases in hydrolyzing myofibrillar proteins
(Molly et al., 1997). However, these Lactobacilli strains are able to hydrolyze sar-
coplasmic proteins, especially L. plantarum and L. casei, which show the stron-
gest degradation (Sanz et al., 1999b). The substrate specificity is broad and the
proteinase activity appears to be extracellularly located, which is in agreement
to the existence of a single cell wall-associated proteinase in dairy lactic acid
bacteria, which is responsible for initial caseins hydrolysis (Kunji et al., 1996).
The peptide profiles of the sarcoplasmic and myofibrillar extracts after
incubation with these strains show the generation of a large number of
hydrophylic peptides. This generation increased under the combined action
of whole cells and cell-free extracts. The generation of hydrophilic peptides
is important because they are correlated to desirable cured-meat flavors
whereas hydrophobic peptides are correlated to bitterness (Aristoy and
TABLE 17.2
Main Purified Exopeptidases in Lactobacillus sakei: Biochemical Similarity and
Substrate Preferences
Biochemical Optimal Optimal
Enzyme Similarity Activation Substrates T (°C) pH Reference
Major aminopeptidase Pep L Ca2+, Sn2+, Leu-peptide, 37 7.5 Sanz and
Mg2+, Ba2+, Ala-peptide Toldrá (1997)
Mn2+
Arginine Pep N like Reducing Arg-peptide, 37 5.0 Sanz and
aminopeptidase agents, salt Lys-peptide Toldrá (2002)
X-prolyl- Pep X X-Pro-peptides, 55 7.5 Sanz and
dipeptidylpeptidase Ala-Pro- Toldrá (2001)
peptide
Dipeptidase Pep V Met-Ala 45 7.8 Montel et al.
(1995)
Tripeptidase Pep T Ala-Ala-Ala 40 7.0 Sanz et al. (1998)
Proteomic Tools for Improved Processing of Dry-Cured Meats 541

Toldrá, 1995; Henriksen and Stahnke, 1997). Some hydrophobic peptides are
generated although in minor amounts.
An endopeptidase, known as protease B, has been purified from D. hansenii,
a yeast typically found in meat. This protease is active at neutral–basic pH
(see Table 17.2) and has homology with proteinase B (PrB) from Saccharomyces
cerevisiae (Bolumar et al., 2005). It is able to hydrolyze sarcoplasmic proteins
when using in vitro assays confirming previous reports incubating sarco-
plasmic proteins with whole D. hansenii cells and cell-free extracts (Santos
et al., 2001). However, this enzyme is inactivated at acid pH, reducing the
expectatives for an important role in meat fermentation where pH may easily
reach pH 5.0 or even lower.

17.3.2 Exopeptidases
There are important exopeptidases in L. sakei, the most prevalent species
in European sausages (see Table 17.3). (1) The major or general aminopepti-
dase, which has an optimal neutral pH (around 7.5) and is similar to PepL
from Lactobacillus delbrueckii. This aminopeptidase has a broad range of
activity against amino acids, especially alanine and leucine, but is unable
to hydrolyze basic residues (Sanz and Toldrá, 1997). (2) The arginine ami-
nopeptidase, which has optimal acid pH, is activated by salt, and has a
preference for basic residues like arginine and lysine (Sanz and Toldrá,
2002). No similar enzymes have been purified from dairy lactic acid bac-
teria. (3) A dipeptidase with an optimal basic pH, a broad specificity
against dipeptides except those containing Pro or Gly at the N-terminus,
and similarity to PepV characterized in other lactic acid bacteria (Montel
et al., 1995). (4) A tripeptidase with optimal neutral pH, able to hydro-
lyze a wide spectrum of tripeptides except those with Pro in the second
position; it is similar to PepT from lactococci (Sanz et al., 1998). (5) An
X-prolyl-dipeptidylpeptidase, which has optimal neutral pH, the ability
to hydrolyze X-Pro dipeptides from the amino terminus from different
peptides, and similarity to PepX from dairy lactic acid bacteria (Sanz and
Toldrá, 2001). The addition of cell-free extracts from L. sakei, L. curvatus,

TABLE 17.3
Main Purified Peptidases in Debaryomices Hansenii: Homology to Saccharomyces
cerevisiae Peptidases and Substrate Preferences
Molecular Homology to
Mass S. cerevisiae Optimal T Optimal
Enzyme (kDa) Peptidases Activation Substrates (°C) pH Reference
Protease B 430 PrB – Sarcoplasmic 37 8.0 Bolumar et al.
proteins (2005)
Prolyl 370 – – Pro-peptide 45 7.5 Bolumar et al.
aminopeptidase (2003a)
Arginyl 101 ApY Ca2+, Mg2+, Arg-peptide, 37 7.0 Bolumar et al.
aminopeptidase Co2+ Lys-peptide (2003b)
542 Advanced Technologies for Meat Processing, Second Edition

and L. casei to myofibrillar and sarcoplasmic proteins gave a net increase

in free amino acids. The increases were especially significant for glu-
tamic acid, alanine and leucine for L. sakei, glutamic acid and alanine for
L. curvatus, and arginine and glutamic acid for L. casei (Fadda et al., 1999b;
Sanz et al., 1999a,b). However, this increase was negative when using
L. plantarum probably due a lower exopeptidase activity or a higher intra-
cellular metabolic activity for amino acid degradation (Fadda et al., 1999a).
In the case of yeasts, like D. hansenii, there are also several exopeptidases
(see Table 17.3): (1) prolyl aminopeptidase, which has an optimal neutral
pH, restricted to the hydrolysis of Pro at the amino terminus of peptides
(Bolumar et al., 2003a) and (2) an arginyl aminopeptidase, with an opti-
mal neutral pH, maximum specificity for basic residues like arginine and
lysinee, and homology to ApY from S. cerevisiae (Bolumar et al., 2003b).
Experiences in vitro with whole cells and cell-free extracts of D. hansenii
have shown that they are able to hydrolyze sarcoplasmic proteins under
similar conditions to those found during fermented sausage processing,
generating several hydrophilic and hydrophobic peptides and free amino
acids. The highest generation rates were observed when using whole cells
(Santos et al., 2001).

17.4 Traditional Techniques for the Follow-Up

of Proteolysis in Dry-Cured Meats
For many decades, proteolysis has been followed up through the use of
several techniques like sodium dodecyl sulfate polyacrylamide gel elec-
trophoresis (SDS-PAGE), two-dimensional gel electrophoresis (2-DGE),
free solution conjugate electrophoresis (FSCE), size-exclusion chroma-
tography (SEC), ion exchange chromatography (IEC), reversed-phase
high-performance liquid chromatography (RP-HPLC), and more recently,
hydrophilic interaction liquid chromatography (HILIC). These techniques
have been used to study proteolysis and to separate and identify the pro-
teins and major generated fragments from complex mixtures like those
found in dry-cured meats as well as the analysis of free amino acids after
their derivatization (Lawrie and Ledward, 2006). This has allowed the
interpretation of major findings related to peptides generation and the
accumulation of released free amino acids (Toldrá, 2012a). An example
of the key role of small peptides and free amino acids released and the
enzymes involved during the processing of dry-cured meats and its con-
tribution to flavor are shown in Table 17.4. However, there were problems
in the identification of the type of peptides generated and their sequences
Proteomic Tools for Improved Processing of Dry-Cured Meats 543

TABLE 17.4
Main Enzymatic Routes for the Generation of Small Peptides and Free Amino
Acids during the Processing of Dry-Cured Meats and their Contributions to Flavor
Compounds Enzymes Involved Contribution to Flavor
Tripeptides Muscle tripeptidyl peptidases Taste will depend on the
specific amino acid
composition
Dipeptides Muscle and microbial Taste will depend on the
dipeptidylpeptidases specific amino acid
composition
Phenylalanine, tyrosine, Muscle methionine and alanyl Bitter taste will increase as
tryptophane, methionine, aminopeptidases the concentration of these
leucine, valine, and Major aminopeptidase from amino acids arise
isoleucine Lactobacillus sakei Generation of volatile
branched-chain aldehydes
(from Leu, Val, and Ile) that
contribute to aroma
Alanine, serine, proline, Muscle methionine and alanyl Sweet taste will depend on
glycine, and hydroxyproline aminopeptidases the final concentration
Major aminopeptidase from
L. sakei
Proline Prolyl aminopeptidase from Slight bitterness reduction
Debaryomices hansenii
Glutamic and aspartic acids Muscle methionine and alanyl Taste enhancement, slight
aminopeptidases acid taste
Major aminopeptidase from
L. sakei
Lysine and arginine Muscle aminopeptidase B Aged cured taste
Arginine aminopeptidase from
L. sakei and arginyl
aminopetidase from D. hansenii
Source: Adapted from Toldrá, F., Dry-Cured Meat Products, Food and Nutrition Press, Trumbull,
CT, 2002; Toldrá, F., Food Processing: Principles and Applications, Blackwell Publishing,
Ames, IA, 2004; Toldrá, F., Food Biochemistry and Food Processing, Blackwell Publishing,
Ames, IA, 2012a.

that has been solved with the availability of powerful proteomics tools, as
will be described in next sections.

17.5 Proteomics in Dry-Cured Ham Approaches

Traditionally, proteomics has been used to identify proteins from a mix or
an extract, obtaining the characterization of the protein profile of the sample.
The most frequently used strategy has been the separation of the proteins
544 Advanced Technologies for Meat Processing, Second Edition

using SDS-PAGE and the subsequent digestion of the isolated protein with
specific proteases like trypsin that specifically cleaves the protein on the
C-terminal side of the basic amino acids arginine and lysine. The peptides
obtained after the digestion of the protein are analyzed by mass spectrom-
etry, achieving a list of peak masses. This experimental mass profile is
matched against the theoretical masses obtained from the in silico digestion
of the protein and included in the databases. This strategy is named protein
mass fingerprint (PMF) and the results are given as a report where identified
proteins are ranked according to the number of peptide masses matching
their sequence within a given mass error tolerance. To identify a protein it is
necessary that the masses of a certain number of fragments match with the
theoretical peptide masses contained in the protein databases. This result is
accepted if the data passes a statistical probability threshold of being a cor-
rect match (Figure 17.3).
The PMF approach has been used different times in dry-cured ham stud-
ies. Regarding the use of this approach in meat-derived matrices, 2D SDS-
PAGE and matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-ToF MS) analysis were used to study the myofibrillar
and water-soluble fraction of raw ham muscles and dry-cured hams with
different ripening times (Di Luccia et al., 2005). The two-dimensional maps
showed the progressive disappearance of actin, tropomyosin, and myosin
light chains during ripening. Some of the sarcoplasmic proteins in water
extracts from pork meat markedly decreased in amount or disappeared
totally during ripening. The most interesting bands were digested using
trypsin enzyme and subsequently analyzed by MALDI-ToF MS. Two frag-
ments of myosin heavy chain and a new form of actin were identified in
the myofibrilar fraction whereas α- and β-tropomyosin were detected in the
water-soluble protein fraction.
Sarcoplasmic proteins undergoing proteolysis during the ripening of prod-
ucts were also identified by MALDI-ToF MS using the PMF approach after
2D AUT-PAGE/SDS electrophoresis (acetic acid-urea-triton polyacrylamide
gel in the first dimension and sodium dodecyl sulfate polyacrylamide gel in
the second dimension). This resulted in the identification of thirteen sarco-
plasmic proteins and the technique showed higher resolution in comparison

2D SDS-PAGE
pI
MS Peptide mass fingerprint
MW
MS2 MS/MS ion search
Protein

FIGURE 17.3
Scheme of a typical proteomics approach with a previous SDS-PAGE separation of the protein
of interest. SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis.
Proteomic Tools for Improved Processing of Dry-Cured Meats 545

to standard 2D IPG/SGS-PAGE as well as an easier interpretation of the

2D maps (Picariello et al., 2006).
Despite the advantage of using these approaches for a better understand-
ing of the disappearance of proteins, the sequences corresponding to the
hydrolysis products were not analyzed in any of these studies. The major
difficulty in the study of naturally generated peptides resides is the small
size of these fragments that cannot be trypsin digested. This fact gives dou-
ble difficulty, the small size of the generated peptides that are sometimes at
the limit of some standard mass spectrometry techniques, and the impos-
sibility of controlling the hydrolysis, with the consequence being a complex
mixture of peptides from different proteins with unspecific cleavage sites. In
this sense, it is essential to use advanced proteomic techniques such as mass
spectrometry in tandem to elucidate the sequence of these small peptides
(see Figure 17.3), as it allows for faster and more reliable identification of the
sequences.

17.5.1 From Traditional Proteomics to Peptidomics

Peptidomics is the area of science focused on the comprehensive character-
ization of peptides present in a biological sample by studying their struc-
ture, composition, interactions, and properties. It uses similar methods as
proteomics, although the analysis of peptides requires an analytical and
experimental adaptation of the strategy to follow in comparison to proteins.
Peptidomics has become an essential tool in food science in order to study
the biological activity, functional properties, product authenticity and ori-
gin, allergenicity, and sensory properties of the peptides (Minkiewicz et al.,
2008). Thus, peptidomic approaches constitute the methodologies of choice to
identify the specific sequences generated from myofibrillar and sarcoplasmic
proteins in dry-cured ham. Thus, peptides from the myofibrillar proteins
titin (Gallego et al., 2015), myosin light chain (Mora et al., 2011), troponin T
(Mora et al., 2010), LIM domain-binding protein 3 (Gallego et al., 2014), and
actin (Sentandreu et al., 2007), as well as sarcoplasmic proteins creatine
kinase (Mora et al., 2009), glycolytic enzymes (Mora et al., 2011a), myoglobin
(Mora and Toldrá, 2012), and ubiquitin (Mora et al., 2015a) were described
using MS/MS analysis with electrospray ionization quadrupole (ESI-Q)/ToF
and MALDI-ToF/ToF mass spectrometers. In this sense, Table 17.5 shows the
number of peptides that have been sequenced in dry-cured ham including
their respective protein of origin.

17.5.2 Applications of Peptidomics in Dry-Cured Ham

Dry-cured ham is a high-quality product with a very long ripening time,
reaching in certain cases up to 24 months of processing. The time of curing
together with genetics and feed of the animal are main factors determining
its final economical value.
TABLE 17.5
546

Naturally Generated Peptides (in Number) by Respective Protein of Origin during the Processing of Dry-Cured Ham Identified Using
Mass Spectrometry in Tandem
Accession Number of
Protein Name Number Peptides Analysis Search Engine Database Reference
Small peptides (2, 3, – – Edman degradation – – Sentandreu and Toldrá
and 4 amino acids) (2007)
Actin NP_001161267 4 MALDI-ToF Mascot UniProt Sentandreu et al. (2007)
Qtrap
Myosin light chain 1 ABK55642 9 MALDI-ToFn Mascot NCBInr Mora et al. (2009,
(MLC 1) 137 ESI-LC-Q/ToF Mascot NCBInr 2011a)
Titin AAD00528 5 MALDI-ToFn Mascot NCBInr Mora et al. (2009)
O97771 320 ESI-LC-Q/ToFn Mascot Uniprot Gallego et al. (2015)
ESI-LC-Q/ToF
Creatine kinase (CK) NP_001123421 58 MALDI-ToFn Mascot NCBInr Mora et al. (2009)
ESI-LC-Q/ToF
Slow troponin T (TnT) Q75ZZ6 2 MALDI-ToF/ToF Mascot NCBInr Mora et al. (2010)
Fast troponin T (TnT) BAD15381 25 MALDI-ToF/ToF Mascot NCBInr Mora et al. (2010)
Myosin light chain 2 NP_001006592 88 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011a)
(MLC 2)
Glycogen ABF81977 2 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
phosphorylase Paragon UniProt
(PYGM)
Glyceraldehyde ABI29187 8 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
3-phosphate Paragon UniProt
dehydrogenase
(GAPDH)
Phosphoglycerate NP_001093402 4 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
kinase 1 (PGK) Paragon UniProt
Advanced Technologies for Meat Processing, Second Edition

(Continued)
TABLE 17.5 (Continued)
Naturally Generated Peptides (in Number) by Respective Protein of Origin during the Processing of Dry-Cured Ham Identified Using
Mass Spectrometry in Tandem
Accession Number of
Protein Name Number Peptides Analysis Search Engine Database Reference
Phosphoglycerate CAD89670 7 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
mutase 2 (PGAM) Paragon UniProt
Enolase (ENO) NP_001037992 18 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
Paragon UniProt
Piruvate kinase 3 XP_001929120 2 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
isoform 2 (PK) 1 Edmandegradation Paragon UniProt
– –
Lactate dehydrogenase P0039 4 nESI-LC-Q/ToF Mascot NCBInr Mora et al. (2011b)
(LDH) Paragon UniProt
LIM domain-binding F1SEN8 107 nESI-LC-Q/ToF Mascot UniProt Gallego et al. (2013)
(LIM)
Myoglobin (MYO) NP_999401 11 nESI-LC-Q/ToF Mascot NCBInr Mora and Toldrá (2012)
Ubiquitin-60S (UBI) P63053 68 nESI-LC-Q/ToF Mascot UniProt Mora et al. (2015b)
ESI, electrospray ionization quadrupole (ESI-Q); MALDI/ToF, matrix-assisted laser desorption/ionization time-of-flight; nESI-LC-Q, nano-electrospray
ionization/liquid chromatography quadrupole.
Proteomic Tools for Improved Processing of Dry-Cured Meats
547
548 Advanced Technologies for Meat Processing, Second Edition

Peptidomics have also been used to characterize proteolysis related to food

processes such as curing or fermentation (Sforza et al., 2012), to determine
peptide biomarkers of time of processing or food quality (Gallego et al., 2016),
and to establish differences between genotypes in high-value meat-derived
products (Mora et al., 2016). Different empirical and in silico approaches have
also been used to identify naturally generated bioactive peptides in dry-
cured ham. In this sense, peptides showing antihypertensive, antioxidant,
and antimicrobial activities were reported (Escudero et al., 2012, 2013a,b).
Figure 17.4 shows a scheme of main applications of peptidomics in dry-cured
ham samples.
The use of these approaches in dry-cured ham offers many advantages
allowing the advance of meat science by both adding extra value to the prod-
uct with the presence of natural bioactive peptides and controlling the time
of curing and thus the final quality of dry-cured hams to prevent fraudulent
activities or accidental mislabeling.

17.5.2.1 Identification of Bioactive Peptides

Several bioactive peptides exerting antihypertensive, antioxidant, and anti-
microbial activities have been identified in Spanish dry-cured ham. The
identification was done after several isolation steps using different chro-
matographic separations such as SEC or RP-HPLC. From the list of iden-
tified peptides in the most active fraction, some of them were selected as
potentially bioactive according to their length, amino acid composition, and
amino acid location in the sequence (Pihlanto-Leppälä, 2001), and their activ-
ity was confirmed in vitro.
Regarding the antihypertensive activity, the most active fractions and
peptides assayed in vitro were also tested in vivo for their antihypertensive
activity using spontaneous hypertensive rats (SHR). In this respect, fractions
obtained from SEC corresponding to molecular masses lower than 1700 Da
showed the most intense antihypertensive activity with a decrease in systolic

Valorization Authentication

Proteolysis Biomarkers of
characterization time of curing

Peptidomics
in dry-cured ham

Bioactive Genotype
peptides differentiation

FIGURE 17.4
Main applications of peptidomics in dry-cured ham.
Proteomic Tools for Improved Processing of Dry-Cured Meats 549

blood pressure (SBP) of 38.38 mmHg in such SHR rats after eight hours of
ingestion (Escudero et al., 2012), whereas peptide AAATP with an in vitro IC50
value of 100 μM showed a decrease in SBP of 25.62 mmHg after eight-hour
administration in SHR (Escudero et al., 2013a). In Parma dry-cured ham, the
gastrointestinal digestion of 18 and 24 months of curing samples resulted in
the identification of peptides LGL and SFVTT with IC50 values of 145 and 395
μM, respectively (Dellafiora et al., 2015). More recently, a peptide extract from
Iberian dry-cured ham showed a significant decrease in SBP of 12 mmHg after
eight hours of ingestion in spontaneously hypertensive rats (SHR). The analy-
sis resulted in the identification of 2632 sequences of peptides containing the
previously described angiotensin-converting enzyme (ACE)-inhibitory frag-
ments PPK (Pro-Pro-Lys), PAP (Pro-Ala-Pro), and AAP (Ala-Ala-Pro) repeated
a total of 322, 302, and 119 times, respectively (Mora et al., 2015a).
Regarding antioxidant activity, Jinhua ham and Xuanwei ham from China
have been described to show antioxidant activity. The sequence GKFNV
was presented as the main peptide playing a key role as a scavenger of free
radicals in a Jinhua ham extract (Zhu et al., 2013), whereas the tetrapeptide
DLEE was identified in Xuanwei ham as one of the key peptides responsible
for the observed antioxidant activity, showing a 2,2-diphenyl-1-picrylhydra-
zyl (DPPH) radical scavenging activity of 74.45% at a concentration of 0.5
mg/mL (Xing, et al., 2016). In a recent study, different antioxidant peptides
from Jinhua ham were isolated and identified such as the sequences DLEE,
GKFNV, and LPGGGHGDL, which were tested using DPPH radical scaveng-
ing and hydroxyl radical scavenging assays (Zhu et al., 2016). In this sense,
Escudero et al. (2013b) reported that the water-soluble extract of Spanish dry-
cured ham contained a large amount of potentially antioxidant peptides.
This fact was confirmed with the identification of the peptide SNAAC with
an IC50 value of 75.2 μM in a DPPH radical scavenging assay and 205 μM in
ferric-reducing antioxidant power assays (Mora et al., 2014).
Regarding the antimicrobial activity, Listeria monocytogenes is an important
concern in dry-cured ham products after slicing due to its high resistance.
Recently, a novel antilisterial peptide with sequence RHGYM was identified
in Spanish dry-cured ham after 10 months of curing showing an MIC value
of 6.25 mM (Castellano et al., 2016).

17.5.2.2 Label-Free Relative Quantitation to Determine

Differences between Dry-Cured Hams
In peptidomics, the study of peptides often includes their relative quantita-
tion with labeled or label-free methods. In this sense, labeling methodolo-
gies provide the most accurate quantitative values, but their use involves
costly labeling reagents and multistep experimental protocols. In contrast,
label-free methods are a simple, versatile, reliable, and cost-effective alterna-
tive. Thus, the use of peak intensity in peptide quantitation is based on the
correlation existing between peak areas of peptides with the concentration
550 Advanced Technologies for Meat Processing, Second Edition

of the protein where peptides come from, allowing an accurate and pre-
cise evaluation of changes in protein abundance from sample to sample
(Zhu et al., 2010).
Peptide quantitation using a label-free approach based on peptidomics
results is very useful to detect significant differences between dry-cured
ham samples through the generated peptides during hydrolysis as well as
to evaluate the main peptides and proteins responsible for these differences.
Different approaches based on the relative quantitation of peptides using a
label-free methodology have been developed to determine biomarkers of the
time of curing (Gallego et al., 2016), to differentiate genetics in high-value
meat-derived products (Mora et al., 2016), as well as to establish the degree of
posttranslational modifications as oxidation occurred during the processing.

17.5.2.2.1 Biomarkers of the Time of Curing

Time of curing in dry-cured ham is one of the factors determining its final
quality as longer processing times are associated with a more intense pro-
teolysis and higher generation of aroma and flavor. Differences obtained
in the relative quantification of generated peptides during the processing
of dry-cured ham determine that peptides obtained from the degradation
of myosin light chain 1 protein were mainly responsible for the observed
differences during the last stages of curing. In this sense, two peptides in
particular were identified as potential biomarkers of nine months of curing
dry-cured ham (Gallego et al., 2016). These results were obtained using prin-
cipal component analysis (PCA) statistics as indicated in Figure 17.5.

17.5.2.2.2 Differences between Genotypes

The genotype of the pig used in the preparation of dry-cured ham gives
extra value to the final product. In this respect, Iberian ham is a product of
excellence well valuated for its intramuscular fat and final characteristics
of flavor. The use of a peptidomic approach permitted study of the differ-
ences between three different genotypes in the final peptide profile of dry-
cured ham (Mora et al., 2016). In this case, the most influential peptides were
derived from myosin light chain I, creatine kinase, myoglobin, troponin T,
and myosin heavy chain 7. This study proved the differences in the action
of endogenous enzymes depending on genetics that resulted in a different
peptide profile at the end of the processing period.

17.5.3 Data Analysis

In proteomics, the identification of peptides is mostly carried out using data-
base search approaches. This type of data analysis can also be used for the
direct analysis of peptides naturally generated from endogenous enzymes
(Fricker et al., 2006; Geho et al., 2006; Hardt et al., 2005a,b; Villanueva et al.,
2006) although the appropriate choice of the search parameters and sequence
database is very important for the successful application of this methodology.
Proteomic Tools for Improved Processing of Dry-Cured Meats 551

15

10 5m
2m 3.5 m
5
6.5 m
t [2]

–5 9m
0m

–10

–15

–20
–30 –20 –10 0 10 20
t [1]

(a)

Density
PAPAPAPAPAPAPPKE APAPAPAPAPAPPKEE
0.3
PAPAPAPAPAPAPPKEEKID AAPAPAPAPAPAPAPAPPKEEKID
AAAPAPAPAPAPAPAPAPPKEE APAPAPAPAPPKEEIDLS PAPAPAPAPAPAPPKEE 0.8
0.2
PAPAPAPAPAPAPAPPKEEKID
PAPAPAPAPAPPKE
APAPAPAPAPPKEE
0.1
0.6
VKKPAAAAAPAPAPAPAPAPAPAPP APAPAPAPAPAPAPAPPKEEKID
p [2]

APAPAPAPAPAPAPAPPKEE
PAPAPAPAPAPAPAPAPPKEE
PAPAPAPAPAPAPPKEEK
0 APAPAPAPAPPKE APAPAPAPAPAPAPAPP
PAPAPAPAPAPAPAPPKEEKI
APAPAPAPPKEEKI 0.4
VKKPAAAAAPAPAPAPAPAPAPAPPKE APAPAPAPAPAPPKEEKID
–0.1 PAPAPAPAPAPAPAPPKE
PAPAPAPAPAPAPAPPKEEK
PAPAPAPAPPKEEKID
PAPAPAPAPAPAPAPPKEEKIDLS
APAPAPAPPKE PAPAPAPAPAPAKPKEEKID
–0.2 0.2
APAPAPAPAPAPPKEEK PAPAPAPAPAPAPPKEEKI
APAPAPAPAPAPAPAPPKEEKI
AAPAPAPAPAPAPAPAPPKE
–0.3
–0.05 0 0.05 0.1 0.15 0.2 0.25
p [1] 0

(b)

FIGURE 17.5
(a) Principal component analysis (PCA) score plot to assess the variance among the naturally
generated peptides at different times of dry-cured ham processing. (b) PCA loading plot show-
ing peptides identified at nine months of curing from myosin light chain 1 protein. Reprinted
from Journal of Proteomics, 147, Gallego et al., Peptidomics as a tool for quality control in dry-
cured ham processing, 98–107, Copyright 2016, with permission from Elsevier.
552 Advanced Technologies for Meat Processing, Second Edition

In fact, database searching of nontryptic peptides is less effective due to the

lack of charge localization at the N and C termini of the naturally gener-
ated peptides. The uses of nonspecific enzymes as well as the error tolerant
option to search the unmatched spectra considering possible modifications
are some of the parameters to take into account in the Mascot MS/MS Ions
Search when naturally generated peptides are studied.
The most widely used search engines are Mascot (http://www.matrixscience.
com/search_form_select.html), SEQUEST (http://fields.scripps.edu/sequest/),
Phenyx (http://www.ionsource.com/functional_reviews/Phenyx/phenyx
-web.htm), MassWiz (Yadav et al., 2011), Hydra (Lewis et al., 2012), and the
free software OMSSA (https://www.ncbi.nlm.nih.gov/Web/Newsltr/V14N2/)
and X!Tandem (http://www.thegpm.org/tandem/), but there are more soft-
ware packages designed to identify the most likely peptide sequence to match
a MS/MS spectrum. Mascot from matrixscience (http://www.matrixscience
.com/) is the most widely used software but the choice of its search parameters
requires some user expertise. There are many available databases, but UniProt
and NCBInr are the most commonly used in the identification of meat-derived
peptides. Currently, UniProtKB/TrEMBL contains 77,483,538 sequence entries,
comprising 25,974,169,949 amino acids, and it is considered the best annotated
database although it is important to consider that it is nonredundant so it is
ideal for PMF searches, where the loss of one or two peptides is not very impor-
tant. For MS/MS searches, the NCBInr database is a better choice. This database
is large (94 million entries approximately), comprehensive, and nonidentical.
The use of peptidomic approaches in the field of processed meat prod-
ucts such as dry-cured ham has permitted a better understanding of the
proteolytic phenomena during its processing through the study of the gen-
erated peptides. This also results in an improved value through the identifi-
cation of bioactive peptides and better control of quality parameters such as
time of curing or genotypes. What is more, future aims using peptidomics
could apply the obtained information to drive the proteolysis process toward
improvements of the final value and quality of the product as well as the
development of a new generation of improved processed meat products.

References
Aristoy, M. C. and Toldrá, F. (1995). Isolation of flavor peptides from raw pork meat
and dry-cured ham. In: Charalambous, G. (ed.) Food Flavors: Generation, Analysis
and Process Influence. Amsterdam, the Netherlands: Elsevier Science Publishers
BV, pp. 1323–1344.
Barrett, A. J., Rawlings, N. D. and Woessner, J.F. (eds.) (2004). Handbook of Proteolytic
Enzymes (2nd Ed.). Amsterdam, the Netherlands: Elsevier/Academic Press,
pp. 831–833, 1923–1929.
Proteomic Tools for Improved Processing of Dry-Cured Meats 553

Bockelmann, W. (1995). The proteolytic system of starter and non-starter bacteria:

Components and their importance for cheese ripening. International Dairy
Journal, 5, 977–994.
Bolumar, T., Sanz, Y., Aristoy, M. C. and Toldrá, F. (2003a). Purification and charac-
terization of a prolyl aminopeptidase from Debaryomyces hansenii. Applied and
Environmental Microbiology, 69, 227–232.
Bolumar, T., Sanz, Y., Aristoy, M. C. and Toldrá, F. (2003b). Purification and properties
of an arginyl aminopeptidase from Debaryomyces hansenii. International Journal
of Food Microbiology, 86, 141–151.
Bolumar, T., Sanz, Y., Aristoy, M. C. and Toldrá, F. (2005). Protease B from Debaryomyces
hansenii. Purification and biochemical properties. International Journal of Food
Microbiology, 98, 167–177.
Castellano, P., Mora, L., Escudero, E., Vignolo, G., Aznar, R. and Toldrá, F. (2016).
Antilisterial peptides from Spanish dry-cured hams: Purification and identifica-
tion. Food Microbiology, 59, 133–141.
Coux, O., Tanaka, T. and Goldberg, A. (1995). Structure and function of the 20S and
26S proteasomes. Annual Review of Biochemistry, 65, 801–847.
Dellafiora, L., Paolella, S., Dall’Asta, C., Dossena, A., Cozzini, P. and Galaverna, G.
(2015). Hybrid in silico/in vitro approach for the identification of angiotensin
I converting enzyme inhibitory peptides from parma dry-cured ham. Journal of
Agricultural and Food Chemistry, 63(28), 6366–6375.
Di Luccia, A., Picariello, G., Cacace, G. et al. (2005). Proteomic analysis of water solu-
ble and myofibrillar protein changes occurring in dry-cured hams. Meat Science,
69(3), 479–491.
Escudero, E., Aristoy, M. C., Nishimura, H., Arihara, K. and Toldrá, F. (2012).
Antihypertensive effect and antioxidant activity of peptide fractions extracted
from Spanish dry-cured ham. Meat Science, 91(3), 306–311.
Escudero, E., Mora, L., Fraser, P. D., Aristoy, M. C., Arihara, K. and Toldrá, F. (2013a).
Purification and identification of antihypertensive peptides in Spanish dry-
cured ham. Journal of Proteomics, 78, 499–507.
Escudero, E., Mora, L., Fraser, P. D., Aristoy, M. C. and Toldrá, F. (2013b). Identification
of novel antioxidant peptides generated in Spanish dry-cured ham. Food
Chemistry, 138, 1282–1288.
Fadda, S., Sanz, Y., Vignolo, G., Aristoy, M. C., Oliver, G. and Toldrá, F. (1999a).
Hydrolysis of pork muscle sarcoplasmic proteins by Lactobacillus curvatus and
Lactobacillus sake. Applied and Environmental Microbiology, 65, 578–584.
Fadda, S., Sanz, Y., Vignolo, G., Aristoy, M. C., Oliver, G. and Toldrá, F. (1999b).
Characterization of muscle sarcoplasmic and myofibrillar protein hydrolysis
caused by Lactobacillus plantarum. Applied and Environmental Microbiology, 65,
3540–3546.
Flores, M., Aristoy, M. C. and Toldrá, F. (1993). HPLC purification and characteriza-
tion of porcine muscle aminopeptidase B. Biochimie, 75, 861–867.
Flores, M., Aristoy, M. C. and Toldrá, F. (1996). HPLC purification and characteriza-
tion of soluble alanyl aminopeptidase from porcine skeletal muscle. Journal of
Agricultural and Food Chemistry, 44, 2578–2583.
Flores, M., Marina, M. and Toldrá, F. (2000). Purification and characterization of a
soluble methionyl aminopeptidase from porcine skeletal muscle. Meat Science,
56, 247–254.
554 Advanced Technologies for Meat Processing, Second Edition

Fricker, L. D., Lim, J., Pan, H. and Che, F. Y. (2006). Peptidomics: Identification
and quantification of endogenous peptides in neuroendocrine tissues. Mass
Spectrometry Reviews, 25(2), 327–344.
Gallego, M., Mora, L., Fraser, P. D., Aristoy, M. C. and Toldrá, F. (2014). Degradation of
LIM domain-binding protein 3 during Spanish dry-cured ham processing. Food
Chemistry, 149, 121–128.
Gallego, M., Mora, L., Aristoy, M. C. and Toldrá, F. (2015). Titin-derived peptides as
processing time markers in dry-cured ham. Food Chemistry, 167, 326–339.
Gallego, M., Mora, L. and Toldrá, F. (2016). Peptidomics as a tool for quality control in
dry-cured ham processing. Journal of Proteomics, 147, 98–107.
Geho, D. H., Liotta, L. A., Petricoin, E. F., Zhao, W. and Araujo, R. P. (2006). The
amplified peptidome: The new treasure chest of candidate biomarkers. Current
Opinion in Chemical Biology, 10(1), 50–55.
Haard, N. F. (1990). Enzymes from food myosystems. Journal of Muscle Foods, 1,
293–338.
Hardt, M., Thomas, L. R., Dixon, S. E. et al. (2005a). Toward defining the human
parotid gland salivary proteome and peptidome: Identification and charac-
terization using 2D SDS-PAGE, ultrafiltration, HPLC, and mass spectrometry.
Biochemistry, 44(8), 2885–2899.
Hardt, M., Witkowska, H. E., Webb, S. et al. (2005b). Assessing the effects of diurnal
variation on the composition of human parotid saliva: Quantitative analysis of
native peptides using iTRAQ reagents. Analytical Chemistry, 77(15), 4947–4954.
Henriksen, A. P. and Stahnke, L. H. (1997). Sensory and chromatographic evaluations
of water soluble fraction from dried sausages. Journal of Agricultural and Food
Chemistry, 45, 2679–2684.
Kemp, C. M., Sensky, P. L., Bardsley, R. G., Buttery, P. J. and Parr, T. (2010). Tenderness:
An enzymatic view. Meat Science, 84, 248–256.
Koohmaraie, M., Seideman, S. C., Schollmeyer, J. E., Dutson, T. R. and Grouse, J. D.
(1987). Effect of postmortem storage on Ca2+ dependent proteases, their inhibi-
tor and myofibril fragmentation. Meat Science, 19, 187–196.
Kunji, E. R. S., Fang, G., Jeronimus-Stratingh, C. M., Bruins, A. P., Poolman, B. and
Konings, W. N. (1996). The proteolytic systems of lactic acid bacteria. Antonie
van Leeuwenhoek, 70, 187–221.
Lawrie, R. A. and Ledward, D. A. (2006). Lawrie’s Meat Science (7th Ed). Cambridge,
UK: Woodhead Publishing.
Lewis, S., Csordas, A., Killcoyne, S. et al. (2012). Hydra: A scalable proteomic search
engine which utilizes the Hadoop distributed computing framework. BMC
Bioinformatics, 13, 324.
Minkiewicz, P., Dziuba, J., Darewicz, M., Iwaniak, A., Dziuba, M. and Nałęcz, D.
(2008). Food peptidomics. Food Technology and Biotechnology, 46(1), 1–10.
Molly, K., Demeyer, D. I., Johansson, G., Raemaekers, M., Ghistelinck, M. and Geenen, I.
(1997). The importance of meat enzymes in ripening and flavor generation in dry
fermented sausages. First results of a European project. Food Chemistry, 54, 539–545.
Montel, M. C., Seronine, M. P., Talon, R. and Hebraud, M. (1995). Purification and char-
acterization of a dipeptidase from Lactobacillus sake. Applied and Environmental
Microbiology, 61, 837–839.
Mora, L., Calvo, L., Escudero, E. and Toldrá, F. (2016). Differences in pig genotypes
influence the generation of peptides in dry-cured ham processing. Food Research
International, 86, 74–82.
Proteomic Tools for Improved Processing of Dry-Cured Meats 555

Mora, L., Escudero, E., Arihara, K. and Toldrá, F. (2015a). Antihypertensive effect of
peptides naturally generated during Iberian dry-cured ham processing. Food
Research International, 78, 71–78.
Mora, L., Escudero, E., Fraser, P. D., Aristoy, M. C. and Toldrá, F. (2014). Proteomic
identification of antioxidant peptides from 400 to 2500 Da generated in Spanish
dry-cured ham contained in a size-exclusion chromatography fraction. Food
Research International, 56, 68–76.
Mora, L., Gallego, M., Aristoy, M. C., Fraser, P. D. and Toldrá, F. (2015b). Peptides
naturally generated from ubiquitin-60S ribosomal protein as potential biomark-
ers of dry-cured ham processing time. Food Control, 48, 102–107.
Mora, L., Sentandreu, M. A., Fraser, P. D., Toldrá, F. and Bramley, P. M. (2009).
Oligopeptides arising the degradation of creatine kinase in Spanish dry-cured
ham. Journal of Agricultural and Food Chemistry, 57, 8982–8988.
Mora, L., Sentandreu, M. A. and Toldrá, F. (2010). Identification of small troponin T
peptides generated in dry-cured ham. Food Chemistry, 123, 691–697.
Mora, L., Sentandreu, M. A. and Toldrá, F. (2011a). Intense degradation of myosin
light chain isoforms in Spanish dry-cured ham. Journal of Agricultural and Food
Chemistry, 59, 3884–3892.
Mora, L. and Toldrá, F. (2012). Proteomic identification of small (<2000 Da) myoglobin
peptides generated in dry-cured ham. Food Technology and Biotechnology, 50(3),
343–349.
Mora, L., Valero, M. L., Del Pino, M. M. S., Sentandreu, M. A. and Toldrá, F. (2011b).
Small peptides released from muscle glycolytic enzymes during dry-cured ham
processing. Journal of Proteomics, 74, 442–450.
Ouali, A., Herrera-Méndez, C. H., Coulis, G. et al. (2006). Revisiting the conversion
of muscle into meat and the underlying mechanisms. Meat Science, 74, 44–58.
Ouali, A. and Sentandreu, M. A. (2002). Overview of muscle peptidases and their
potential role in meat texture development. In: Toldrá, F. (ed.) Research Advances
in the Quality of Meat and Meat Products. Trivandrum, India: Research Signpost,
pp. 33–63.
Picariello, G., De Martino, A., Mamone, G. et al. (2006). Proteomic study of muscle
sarcoplasmic proteins using AUT-PAGE/SDS-PAGE as two-dimensional gel
electrophoresis. Journal of Chromatography B: Analytical Technology Biomedical Life
Sciences, 833(1), 101–108.
Pihlanto-Leppälä, A. (2001). Bioactive peptides derived from bovine whey proteins:
Opioid and ACE-inhibitory peptides. Trends in Food Science and Technology, 1,
347–356.
Pritchard, G. G. and Coolbear, T. (1993). The physiology and biochemistry of the pro-
teolytic system of lactic acid bacteria. FEMS Microbiology Reviews, 12, 179–206.
Santos, N. N., Santos, R. C., Sanz, Y., Bolumar, T., Aristoy, M.-C. and Toldrá, F.
(2001). Hydrolysis of muscle sarcoplasmic proteins by Debaryomyces hansenii.
International Journal of Food Microbiology, 68, 199–206
Sanz, Y., Fadda, S., Vignolo, G., Aristoy, M. C., Oliver, G. and Toldrá, F. (1999a).
Hydrolytic action of Lactobacillus casei CRL 705 on pork muscle sarcoplas-
mic and myofibrillar proteins. Journal of Agricultural and Food Chemistry, 47,
3441–3448.
Sanz, Y., Fadda, S., Vignolo, G., Aristoy, M. C., Oliver, G. and Toldrá, F. (1999b).
Hydrolysis of muscle myofibrillar proteins by Lactobacillus curvatus and
Lactobacillus sake. International Journal of Food Microbiology, 53, 115–125.
556 Advanced Technologies for Meat Processing, Second Edition

Sanz, Y., Mulholland, F. and Toldrá, F. (1998). Purification and characterization of a

tripeptidase from Lactobacillus sake. Journal of Agricultural and Food Chemistry, 46,
349–353.
Sanz, Y. and Toldrá, F. (1997). Purification and characterization of an aminopeptidase
from Lactobacillus sake. Journal of Agricultural and Food Chemistry, 45, 1552–1558.
Sanz, Y. and Toldrá, F. (2001). Purification and characterization of an X-prolyl-
dipeptidyl peptidase from Lactobacillus sake. Applied and Environmental
Microbiology, 67, 1815–1820.
Sanz, Y. and Toldrá, F. (2002). Purification and characterization of an arginine ami-
nopeptidase from Lactobacillus sakei. Applied and Environmental Microbiology, 68,
1980–1987.
Sentandreu, M. A., Armenteros, M., Calvete, J. J., Ouali, A., Aristoy, M. C. and Toldrá,
F. (2007). Proteomic identification of actin-derived oligopeptides in dry-cured
ham. Journal of Agricultural and Food Chemistry, 55(9), 3613–3619.
Sentandreu, M. A. and Toldrá, F. (1998). Biochemical properties of dipeptidylpepti-
dase III purified from porcine skeletal muscle. Journal of Agricultural and Food
Chemistry, 46, 3977–3984.
Sentandreu, M. A. and Toldrá, F. (2000). Purification and biochemical properties of
dipeptidylpeptidase I from porcine skeletal muscle. Journal of Agricultural and
Food Chemistry, 48, 5014–5022.
Sentandreu, M. A. and Toldrá, F. (2001a). Importance of dipeptidylpeptidase II in
postmortem pork muscle. Meat Science, 57, 93–103.
Sentandreu, M. A. and Toldrá, F. (2001b). Dipeptidylpeptidase IV from porcine skele-
tal muscle: Purification and biochemical properties. Food Chemistry, 75, 159–168.
Sentandreu, M. A. and Toldrá, F. (2007.) Oligopeptides hydrolysed by muscle dipep-
tidylpeptidases can generate angiotensin I converting enzyme inhibitory dipep-
tides. European Food Research and Technology, 224, 785–790.
Sforza, S., Cavatorta, V., Lambertini, F., Galaverna, G., Dossena, A. and Marchelli,
R. (2012). Cheese peptidomics: A detailed study on the evolution of the oli-
gopeptide fraction in Parmigiano-Reggiano cheese from curd to 24 months of
aging. Journal of Dairy Science, 95(7), 3514–3526.
Tan, P. S. T., Poolman, B. and Konings, W. S. (1993). Proteolytic enzymes of Lactococcus
lactis. Journal of Dairy Research, 60, 269–286.
Toldrá, F. (1998). Proteolysis and lipolysis in flavour development of dry-cured meat
products. Meat Science, 49, S101–S110.
Toldrá, F. (2002). Dry-Cured Meat Products. Trumbull, CT: Food and Nutrition Press,
pp. 7–134.
Toldrá, F. (2004). Meat: Fermented meats. In: Scott Smith, J. and Hui, Y. H. (eds.) Food
Processing: Principles and Applications. Ames, IA: Blackwell Publishing, 399–415.
Toldrá, F. (2012a). Biochemistry of fermented meat. In: Simpson, B. K., Nollet, L. M.
L., Toldrá, F., Benjakul, S., Paliyath, G. and Hui, Y.H. (eds.) Food Biochemistry and
Food Processing (2nd Ed.). Ames, IA: Wiley-Blackwell, pp. 331–343.
Toldrá, F. (2012b). Biochemistry of processing meat and poultry. In: Simpson, B. K.,
Nollet, L. M. L., Toldrá, F., Benjakul, S., Paliyath, G. and Hui, Y.H. (eds.) Food
Biochemistry and Food Processing (2nd Ed.). Ames, IA: Wiley-Blackwell, pp.
303–316.
Toldrá, F., Aristoy, M. C. and Flores, M. (2000). Contribution of muscle aminopepti-
dases to flavor development in dry-cured ham. Food Research International, 33,
181–185.
Proteomic Tools for Improved Processing of Dry-Cured Meats 557

Toldrá, F. and Etherington, D. J. (1988). Examination of cathepsins B, D, H and L activ-

ities in dry cured hams. Meat Science, 23, 1–7.
Toldrá, F. and Flores, M. (1998). The role of muscle proteases and lipases in flavor
development during the processing of dry-cured ham. CRC Critical Reviews in
Food Science and Nutrition, 38, 331–352,
Villanueva, J., Martorella, A. J., Lawlor, K. et al. (2006). Serum peptidome patterns that
distinguish metastatic thyroid carcinoma from cancer-free controls are unbiased
by gender and age. Molecular and Cellular Proteomics, 5(10), 1840–1852.
Visser, S. (1993). Proteolytic enzymes and their relation to cheese ripening. Journal of
Dairy Science, 76, 329–350.
Xing, L. J., Hu, Y. Y., Hu, H. Y., Ge, Q. F., Zhou, G. H. and Zhang, W. G. (2016).
Purification and identification of antioxidative peptides from dry-cured
Xuanwei ham. Food Chemistry, 194, 951–958.
Yadav, A. K., Kumar, D. and Dash, D. (2011). MassWiz: A novel scoring algorithm with
target-decoy based analysis pipeline for tandem mass spectrometry. Journal of
Proteome Research, 10(5), 2154–2160.
Zhu, W., Smith, J. W. and Huang, C. M. (2010). Mass spectrometry-based label-free
quantitative proteomics. Journal of Biomedicine and Biotechnology, 840518, 6 pages.
Zhu, C. Z., Zhang, W. G., Zhou, G. H., Xu, X. L., Kang, Z. L. and Yin, Y. (2013).
Isolation and identification of antioxidant peptides from jinhua ham. Journal of
Agricultural and Food Chemistry, 61, 1265−1271.
Zhu, C. Z., Zhang, W. G., Zhou, G. H. and Xu, X. L. (2016). Identification of anti-
oxidant peptides of Jinhua ham generated in the products and through the
simulated gastrointestinal digestion system. Journal of the Science of Food and
Agriculture, 96, 99–108.
18
The Use of Bacteriocins against
Meat-borne Pathogens

Carmen A. Campos, Marcela P. Castro,

María E. Cayre, and Franco P. Rivas

CONTENTS
18.1 Introduction. Microbial Flora Associated with Meat and Meat
Products....................................................................................................... 559
18.2 Application of Bacteriocin and/or Bacteriocinogenic Cultures to
Improve the Microbial Safety of Meat Products ................................... 563
18.2.1 Raw Meat Products ........................................................................564
18.2.2 Cooked and Cured-Cooked Meat Products ............................... 567
18.2.3 Fermented Sausage Meat Products ............................................. 571
18.3 Bacteriocins and New Preservation Technologies to Increase the
Safety of Meat and Meat Products .......................................................... 575
18.3.1 High Hydrostatic Pressure ........................................................... 575
18.3.2 Active Packaging............................................................................ 577
18.4 Problems to Overcome for the Successful Application of
Bacteriocins in Meat and Meat Products ................................................ 579
18.4.1 Interaction with Meat Components and/or Additives ............. 579
18.4.2 Appearance of Resistant Strains .................................................. 582
18.5 Overview of Actual Industrial Application and Regulatory Aspects .... 584
References............................................................................................................. 585

18.1 Introduction. Microbial Flora Associated

with Meat and Meat Products
Meat and meat products are very perishable foods since they have a high
content of proteins and other nutrients. Therefore, microbial growth of spoil-
age and foodborne pathogens can occur at all stages of the production chain
including slaughter, preparation, storage, and distribution. Moreover, lipid
oxidation and autolytic enzymatic reactions also contribute to the spoil-
age process leading to economic losses (Dave and Ghaly, 2011). The main
pathogenic microorganisms that represent major hazards in meat and meat

559
560 Advanced Technologies for Meat Processing, Second Edition

products are Salmonella spp., Listeria monocytogenes, Escherichia coli O157:H7,

Clostridium botulinum, Clostridium perfringens, Campylobacter jejuni, Yersinia
enterocolítica, and Staphylococcus aureus. Unless products are preserved and
handled properly, these microorganisms could grow in the food and/or pro-
duce toxins provoking illnesses in consumers.
Particularly, the growth of pathogenic flora is a public health issue. Accord-
ing to fresh reports of the U.S. Centers for Disease Control and Prevention
(CDC), the main foodborne illness outbreaks were caused by norovirus,
Salmonella, E. coli, and L. monocytogenes (CDC, 2015). Herein, the main charac-
teristics of foodborne pathogens related to meat are described.
Salmonella spp. are facultative anaerobic Gram-negative rods that belong
to the Enterobacteriaceae family. These bacteria are able to grow in adverse
environmental conditions such as refrigerated temperatures and pH values
of 4.5 or lower (depending on the strain), and they have the ability to tolerate
moderate NaCl levels and heat (D Aoust, 1997). The mentioned characteris-
tics raise concerns about the effectiveness of conservation factors needed to
avoid Salmonella growth even in fermented foods. Salmonella is a widespread
bacterium in the food chain. In the case of the meat industry, poultry prod-
ucts are the main reservoirs of Salmonella among other meats in many coun-
tries. This trend has been growing due to (1) intense animal husbandry
practices, (2) the difficulty in controlling salmonellae spread into the produc-
tion chain, and (3) the selection of resistant strains due to widespread use of
antibiotic. To highlight the importance of this bacterium as a pathogen, it can
be mentioned that a large outbreak of Salmonella infections in 2010 caused
nearly 2000 illnesses. Some of the infections were from food origin. The food
commodities most often implicated were beef (13%), dairy (12%, nearly all
unpasteurized), fish (12%), and poultry (11%) (CDC, 2015).
According to the microbiological criteria for foodstuffs established by the
Commission Regulation (EC, No 2073/2005), in minced meat and meat prep-
arations intended to be eaten raw, Salmonella spp. must be absent in 10 g. In
the case of minced meat and meat preparations intended to be eaten cooked,
Salmonella spp. must be absent in 25 g.
L. monocytogenes represents the Listeria species most commonly associated
with illness in animals and humans. As a facultative pathogenic saprotroph,
L. monocytogenes can live in soil and decaying vegetation, but in an animal or
human host, it can cause severe disease in immune-depressed individuals
(Orsi et al., 2011). The majority of the infections caused by L. monocytogenes
are of foodborne origin (Swaminathan and Gerner-Smidt, 2007). Ingestion
of contaminated food being the source of infection, governments and food
safety agencies worldwide have taken serious measurements to reduce the
occurrence of L. monocytogenes in the food production chain. The pathogen
is psychrotrophic and can support adverse conditions such as refrigera-
tion temperature, low pH, and high salt concentrations (Ahmed et al., 2015).
L. monocytogenes can be found in a wide range of meat and meat products
such as beef, pork, minced meat, smoked, and fermented sausages and ham.
The Use of Bacteriocins against Meat-borne Pathogens 561

In most circumstances, it involves surface contamination (Rocourt and Cos-

sart, 1997). Major listeriosis outbreaks have been related to contaminated
ready-to-eat (RTE) meat and poultry products (Georgaras et al., 2006). In the
United States, the average annual incidence was 0.92 cases/100,000 popula-
tion for 2009–2011 (CDC, 2015). Furthermore, 1600 illnesses and 260 deaths
were due to listeriosis (Scallan et al., 2011). In RTE foods intended for infants
and for special medical purposes, L. monocytogenes must be absent in 25 g
(EC, No 2073/2005). While a population of 100 colony forming units (CFUs)/g
in RTE foods unable to support L. monocytogenes growth at the time of con-
sumption is not considered a risk in some countries, the U.S. regulation
demands zero tolerance for this type of food. In recent decades, food pro-
cessing industries have made considerable progress in reducing the preva-
lence of Listeria in plants and, consequently, a decrease in the incidence of the
illness was observed.
E. coli O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome
(HUS), the latter being the most severe foodborne illness. The bacterium is
found in cattle, and undercooked meat is the most frequent vehicle of trans-
mission (Doyle et al., 1997). In the case of meat products, E. coli O157:H7
must be absent in 65 g of product (EC, No 2073/2005). In 2013, 12 out of 73
outbreaks caused by this bacterium had bovine meat and products thereof
as the main food vehicles, followed by vegetables, juices, and cheese (Euro-
pean Food Safety Authority [EFSA], 2015). In order to control this pathogen
growth in RTE foods, proper sanitation, cooking, refrigeration at appropriate
temperatures, and prevention of cross-contamination are useful tools (Ray
and Bhunia, 2014).
S. aureus is a Gram-positive coccus with the ability to grow at adverse
environmental conditions, and therefore it is present in many foods where
other microorganisms do not grow. This bacterium is present in healthy
humans and animals. Food is contaminated by contact with the aforemen-
tioned sources. Some strains produce enterotoxins and they are associated
with food intoxication. The enterotoxigenic strains can produce serologi-
cally different enterotoxins that differ in stability and toxicity. The rate of
toxin production depends on growth rate and cell concentration. In general,
the toxin can be detected when the population is higher than 107 CFU/g.
Foods containing the enterotoxin produce severe vomiting and gastroenteri-
tis. Foods implicated in the intoxication include ham, corned beef, salami,
bacon, barbecued meat, salad dressings, and cheese. In order to reduce the
incidence of Staphylococcus intoxication, it is necessary to apply measures to
reduce the bacterial population; in this sense, the addition of preservatives
can be useful. Furthermore, the acquisition of antibiotic resistance by some
strains requires special attention. This trend increases the role of S. aureus as
a public health concern bacterium (Teramoto et al., 2016).
C. botulinum is a spore-forming, Gram-positive, anaerobic bacterium
widely distributed in the environment and in the intestinal tract of animals.
There are different types with different physiological characteristics but all
562 Advanced Technologies for Meat Processing, Second Edition

produce neurotoxins. Control of foodborne botulism relies on: (1) thermal

destruction of spores, (2) inhibition of bacterial growth, and (3) inhibition
of spore germination. The increased consumption of RTE minimally pro-
cessed foods packaged in modified atmosphere free of oxygen is of special
concern, since the preservation factors applied do not assure the inhibition
of C. botulinum growth (Dods and Austin, 1997). The incorporation of a pres-
ervation factor with antibotulinal activity is a must in the mentioned type
of foods.
C. perfringens is also a spore-forming Gram-positive anaerobic bacterium
which produces different toxins, type A being the more involved in food poi-
soning. The bacterium is present in the environment, yet meat and poultry
are considered the most common food vehicles. Its growth in food is affected
by water activity, pH, and curing agents. Therefore, these are the relied-upon
factors to control C. perfringens growth and to inhibit the germination of
spores (McClane, 1997).
Ca. jejuni is an enteric Gram-negative nonsporulating, microaerophilic bac-
terium. It can enter the food through fecal material from animals or indi-
rectly from sewage or contaminated water. Albeit Ca. jejuni has been very
frequently isolated from raw meats, it can also be found in milk, vegetables,
eggs, mushrooms, and clams. In addition, it is considered the most com-
mon causative agent of gastroenteritis worldwide (Ray and Bhunia, 2014).
Outbreaks result from the consumption of raw milk and improperly cooked
chicken and turkey products. According to Melo et al. (2013), poultry meat
is the main disseminator of Ca. jejuni. The Panel on Biological Hazards pre-
sented by EFSA (2010) revealed a high prevalence of Campylobacter spp. in
poultry meat, with alarming rates in Europe (of 10 carcasses, 8 were con-
taminated). There were approximately 200,000 cases of campylobacteriosis
in Europe during 2013 (EFSA, 2015).
Y. enterocolitica is one of the three pathogenic species of the genus Yersinia.
It is a Gram-negative nonspore-forming and facultative anaerobic psychro-
troph that causes gastroenteritis. Approximately 100,000 cases of yersinosis
are reported annually in the United States and 90% of them are originate in
food. Y. enterocolítica is found in the environment; however, pork products
are the most frequently reported source. Good sanitation during handling
and processing and adequate heat treatment are important to prevent infec-
tion (Ray and Bhunia, 2014). Furthermore, addition of a preservation factor
with activity against this pathogen can be useful to increase the safety of
refrigerated meats.
From data previously mentioned, it can be seen that meat and meat prod-
ucts available at the markets nowadays can stand the growth of pathogenic
bacteria and that it is necessary to improve the safety of these products. More-
over, consumers demand more fresh tasty foods, free of chemical additives,
and with a longer shelf life. The application of new preservation methods is
the foundation for the satisfaction of these modern demands. In this context,
biopreservation has received increasing attention, since it is a natural way
The Use of Bacteriocins against Meat-borne Pathogens 563

for controlling the shelf life and safety of meat and meat products. In Sec-
tion 18.2, the application of biopreservation strategies, particularly the use of
bacteriocins to control meatborne pathogens, is discussed.

18.2 Application of Bacteriocin and/or Bacteriocinogenic to

Improve the Microbial Safety of Meat Products
Biopreservation refers to the extended shelf life and improvement of the
microbial safety of food products using their natural microflora or their
metabolites (Stiles, 1996). Lactic acid bacteria (LAB) are the main tool for bio-
preservation of meat and meat products since they comprise the normal flora
of these goods and because of their ability to provide metabolic products
with antimicrobial effect against spoilage and pathogenic bacteria as bacte-
riocins (Gialamas et al., 2010). Bacteriocins are ribosomally synthesized pep-
tides or small proteins with antimicrobial activity, produced by bacteria. The
use of bacteriocins in meat products has been extensively investigated since
they have been proven to be highly effective against microbial agents caus-
ing food poisoning, mainly against the opportunistic psychrotroph food-
borne pathogen L. monocytogenes (Zhu et al., 2005).
Strategies for meat product biopreservation including bacteriocins com-
prise the use of different approaches:

1. The inoculation of the meat products with bacteriocinogenic viable

strains, as protective cultures, with consequent in situ production of
bacteriocin. Lücke (2000) defined protective cultures as those added
to meat products in order to inhibit pathogens or extend shelf life
without changing their sensory profile. These can be applied either
by surface inoculation or mixed with the food, and produce anti-
bacterial substances during storage, fermentation, and/or ripening.
The appropriate application of protective cultures must be based on
the careful selection of well-adapted safe strains that can grow and
possess the ability to produce enough bacteriocins to inhibit spe-
cific pathogenic or spoilage microorganisms on the conditions pre-
vailing in the meat environment (Vermeiren et al., 2004; Vesković
Morač anin et al., 2014).
2. The use of purified or semipurified bacteriocins preparations, obtai-
ned by ex situ production, incorporated into meat as food additives.
In this case, the bacteriocin dosage is precise and predictable but its
application is limited by regulations on food additives. To date nisin
is the only bacteriocin that has been approved for commercial use
in many countries. One drawback of the direct application of bacte-
riocins to a food matrix is that activity loss arises over time because
of enzymatic degradation and interactions with food components
564 Advanced Technologies for Meat Processing, Second Edition

such as proteins and lipids (see details in Section 18.4.1). Further-

more, bacteriocins produced ex situ can be applied in the form of
immobilized preparations, where a partially purified bacteriocin is
bound to a carrier. This strategy helps to protect the bacteriocin and
represents a valuable tool to overcome the negative effects of certain
food components and potential enzyme inactivation.
3. The development of innovative bioactive packaging with the direct
incorporation of bacteriocin or bacteriocin-producing strains into
polymeric matrices. The advantage of incorporating them in films
is that the bacteriocins are localized at the food surface—where the
microbial growth is mostly found—giving more functionality to the
biopreservation process (Coma, 2008).

The aforementioned strategies are continuously evolving and being evalu-

ated in order to control spoilage and pathogenic microorganisms in meat and
meat products. However, the outgrowth of surviving or bacteriocin-resistant
bacteria after prolonged incubation points out that bacteriocins should not
be the only preservative principle used in meat. Indeed, they should be part
of a system with multiple preservative principles, so-called “hurdles” (Hart-
mann et al., 2011).

18.2.1 Raw Meat Products

Pathogenic species such as S. aureus, L. monocytogenes, C. perfringens,
Ca. jejuni, Y. enterocolitica, and enteropathogenic bacteria such as E. coli and
Salmonella spp. can contaminate fresh meat during every step of the produc-
tion and marketing chain, leading to loss of quality and potential public
health problems (Nychas et al., 2008; Solomakos et al., 2008). In order to
improve the safety of raw meats, the use of bacteriocins and bacteriocino-
genic strains is presented herein as an additional hurdle to inhibit and/or
inactivate pathogens.
In spite of the studies published by a number of authors on the use of nisin
as an antimicrobial in raw meat (Thomas et al., 2000), its use in this matrix
is still a matter of controversy. The high dose (750 UI/g) required to be effec-
tive, hence, its cost, low solubility at meat pH values, uneven distribution,
and lack of stability make nisin the least-desired option for the biopreserva-
tion of raw meat. Nevertheless, nisin showed good performance when it was
combined with other antimicrobial agents, such as organic acids, chelating
agents, and lysozyme, and/or vacuum-packaging or modified atmosphere
packaging (MAP). The application of nisin + the aforementioned treatments
before manufacturing or packaging of the product enhanced the inactivation
of pathogens and spoilage bacteria—L. monocytogenes, Brochothrix thermos-
phacta, and E. coli O157:H7. (Gálvez et al., 2007; Aymerich et al., 2008; Jun-
cioni de Arauza et al., 2009). Furthermore, the joint use of nisin with new
The Use of Bacteriocins against Meat-borne Pathogens 565

preservation methods, namely irradiation, high pressure, active packaging,

etc., has given effective alternatives to the meat industry. These methods are
further described in Section 18.3.
In addition, other bacteriocins have shown antimicrobial activity in raw
meat. Nieto-Lozano et al. (2006) reported that use of the pediocin (50, 1000,
and 5000 AU mL–1) from Pediococcus acidilactici (Chr. Hansen Laboratories) on
the surface of raw meat pork was effective for inhibition of L. monocytogenes
at 4°C and 15°C. A bacteriostatic effect on C. perfringens was observed only
when the meat treated with 5000 AU mL–1 of the bacteriocin was stored at
4°C. Hartmann et al. (2011) tested cell-free culture supernatants (CFS) of dif-
ferent antagonistic bacterial strains containing class IIa bacteriocins, namely
leucocin A, leucocin B, mundticin L, pediocin PA-1, sakacin A, and sakacin X
for their ability to inhibit L. monocytogenes in ground beef at 4°C. Taking into
account the minimal effective concentration (MEC), defined as the minimal
concentration of CFS that resulted in a reduction of L. monocytogenes below
the detection limit, pediocin PA-1 and sakacin A resulted in a more effective
meat environment.
The effects of pentocin 31-1, a bacteriocin produced by Lactobacillus pentosus
31-1, on microbiological counts, physicochemical change, and sensory qual-
ity of chill-stored nonvacuum-tray-packaged pork meat was investigated by
Zhang et al. (2010). Results from samples treated with 80 AU mL–1 of pentocin
confirmed that the shelf life of the product could be extended. In addition,
good sensory characteristics of the final product were preserved.
The strain Weissella paramesenteroides J1 produces a bacteriocin called BacJ1.
The analysis of the N-terminal sequence of this active peptide revealed
no significant similarity to currently available antimicrobial peptides as
informed by Chakchouk-Mtibaa et al. (2014). The effect of BacJ1 on Salmo-
nella Typhimurium ATCC14028 growth in turkey escalope was evaluated.
The addition of bacteriocin, at a final concentration of 400 AU/g, led to a
rapid reduction in the number of S. Typhimurium ATCC14028 during stor-
age at 4°C.
The in situ bacteriocin production by potential protective cultures has been
also evaluated in the preservation of raw meats. The abilities of Sakacin-A
producer Lactobacillus sakei Lb706 to control the growth of L. monocytogenes
in vacuum-packaged lamb during 12 weeks storage at –1.5°C was investi-
gated by Jones et al. (2009). In this work, lamb samples were coinoculated
with L. monocytogenes and Lb. sakei Lb706 (0.3 and 3000 CFU cm–2) or Lb. sakei
Lb706b (bacteriocin-negative variant). Results obtained showed that, albeit
both Lb. sakei Lb706 and its nonbacteriocinogenic analog predominated in
the flora of lamb meat, significant levels of L. monocytogenes inhibition were
obtained in packs inoculated with the bacteriocin-producing strain. This fact
highlighted that the antilisterial effect was predominantly because of bacte-
riocin activity, rather than other mechanisms. Moreover, the extent to which
L. monocytogenes was inhibited by Lb. sakei Lb706 varied with the size of the
inoculum: the higher the size the better the inhibition.
566 Advanced Technologies for Meat Processing, Second Edition

Another bacteriocinogenic strain, Lactobacillus curvatus CRL705, evidenced

its biopreservative potential in vacuum-packaged fresh meat stored at chilled
temperatures (Castellano et al., 2008). This strain produces two bacteriocins:
lactocin 705 with antilisterial activity and lactocin AL705 active against
closely related LAB and B. thermosphacta. Furthermore, the live culture of
Lb. curvatus CRL705 sprayed onto the surface of the meat disc (106 UFC cm–2)
showed to be similarly effective in preventing the growth of B. thermosphacta
and Listeria innocua as the use of synthetic lactocin 705 (2.8 μmol L–1) and
purified lactocin AL705 (6400 AU mL–1) during storage of vacuum-packaged
fresh meat at 2°C (Castellano and Vignolo, 2006). Besides, Castellano et al.
(2010) demonstrated that the organoleptic quality of inoculated beef steaks
was not negatively affected by the surface spraying of Lb. curvatus CRL705
compared to the noninoculated samples.
The combined application of different class IIa bacteriocins produced
by LAB has proved to be an effective strategy to enhance the antilisterial
activity in raw meats. Dortu et al. (2008) evaluated the effect of Lb. sakei
CWBI-B1365, a sakacin G producer, Lb. curvatus CWBI-B28, which produces
sakacin P, and their combination on the survival and growth of L. monocy-
togenes in raw beef and chicken stored at 5°C in sealed bags during 21 days.
The meats were surface-inoculated with L. monocytogenes and 106 CFU g–1
of Lb. sakei CWBI-B1365, Lb. curvatus CWBI-B28, or a combination of both
strains at 5 × 105 CFU/g each. While in beef, the joint use of both bacte-
riocinogenic strains did not represent an advantage in the reduction of
L. monocytogenes numbers compared to the sole use of the individual strains
in poultry meat, only the strains in combination inhibited the growth of
the pathogen throughout the storage period. Similarly, the combination of
Lb. curvatus CWBI-B28wt (sakacin P producer) and P. acidilactici H (pedio-
cin Ac/H producer) resulted in more effective control of L. monocytogenes in
raw pork meat than individual use of Lb. curvatus CWBI-B28wt (Kouakou
et al., 2008, 2010).
Apart from Lb. sakei and Lb. curvatus, other bacteriocinogenic species—pro-
ducing class IIa and IIb bacteriocins—have been tested as protective cultures
in raw meats. As an illustration, Enterococcus faecium PCD71 and Leuconos-
toc pseudomesenteroides PCK18—which possess multiple enterocin genes—
showed antilisterial activity (Maragkoudakis et al., 2009; Carlini et al., 2010).
The strain Ec. faecium PCD71 has been evaluated as a potential protective
culture against L. monocytogenes in chicken meat under domestic refrigera-
tion, and it was observed that the growth of the pathogenic microorganism
was adversely affected by the presence of the protective cultures without
any detrimental effect on biochemical parameters related to spoilage of the
chicken meat (Maragkoudakis et al., 2009). On the other hand, the use of
Ln. pseudomesenteroides PCK 18 as a protective culture combined with MAP
was able to control the growth of L. monocytogenes in fresh suckling-lamb
meat when the differences between them are around 2 log CFU/g (Osés et al.,
2015) and chicken meat burgers (Melero et al., 2012).
The Use of Bacteriocins against Meat-borne Pathogens 567

As a closing remark, growth control of Gram-negative pathogens in raw

meats by means of bacteriocinogenic protective culture is more compli-
cated since bacteriocins are not normally active against these microorgan-
isms. However, the combination of protective cultures and chelating agents
could favor bacteriocin effectiveness. For instance, reduction in the count of
E. coli O157:H7 and indigenous coliforms was observed in frozen ground-
beef patties under temperature abuse (5°C) in the presence of bacteriocino-
genic Lb. curvatus CRL705 combined with nisin productor Lactococcus lactis
CRL1109 and Na2EDTA (48 mM) (Castellano et al., 2011). Although several
studies have reported Gram-negative pathogen inhibition by LAB protec-
tive cultures of species as feared as E. coli O157:H7, S. Typhimurium, and
Ca. jejuni, these cultures were comprised of more than one bacterial strain,
and it is uncertain whether the inhibition could be attributed to the bacterio-
cins themselves or not. Such is the case of protective culture on lamb (Jones
et al., 2010), poultry meat products (Melero et al., 2013), and beef (Chaillou et
al., 2014). In these studies, the nature of the inhibitory effect was not attrib-
uted to a bacteriocin in particular; consequently, the inhibitory effect has not
been completely elucidated. Other inhibitory mechanisms or their combina-
tion would probably be responsible for the reported results.

18.2.2 Cooked and Cured-Cooked Meat Products

Sliced cooked and cured meats are one of the most consumed RTE food
products around the world. The two major reasons that fuel the demand for
such products are convenience and good acceptance by consumers. During
preparation and sale, cooked meat products can be contaminated by patho-
genic bacteria causing illness in consumers if infective doses are reached
at the time of consumption (Garrido el al., 2009; Norrung and Buncic, 2008;
Gudbjornsdottir et al., 2004; Gombas et al., 2003; EFSA, 2007). Epidemiologi-
cal and microbiological studies have identified cross-contamination (dur-
ing preparation and sale) and subsequent bacterial growth (during storage)
as the main causes of RTE food contamination and illnesses. Cooked meat
products are likely to be contaminated after processing due to recontamina-
tion events during handling at retail points. Particularly, slicing machines
and cutting utensils are recognized as important vehicles of contamination
of cooked meat products both at factory and sale points (Pérez-Rodríguez
et al., 2007, 2010; Vorst et al., 2006). Hence, several outbreaks have been asso-
ciated to contaminated slicing machines (Public Health Agency of Canada
[PHAC], 2008). Improper food handling practices have been most related to
distribution and sale of RTE products (Lues and Van Tonder, 2007) and, espe-
cially, to small establishments such as delicatessen and butchery premises.
Various studies have suggested that foods handled in small- and medium-
sized establishments (SMEs) are associated with lower microbiological qual-
ity than large-sized establishments (Norrung and Buncic, 2008; Violaris et al.,
2008). Deficient education programs, financial constraints, and insufficient
568 Advanced Technologies for Meat Processing, Second Edition

food safety awareness can influence significantly poorer hygiene in SMEs

(Violaris et al., 2008).
L. monocytogenes is well adapted to survival on equipment and in produc-
tion facilities and the occurrence of this microorganism in cooked meat prod-
ucts is known to be connected with cross-contamination after heat treatment
(Bredholt et al., 1999). Heat survivors appear to be the main cause of contami-
nation (Samelis and Metaxopoulos, 1999). Listeria spp. and L. monocytogenes
survived in ham and other tumbled meats cooked in boilers at core tem-
peratures below 70°C and in traditional Greek country-style sausages heated
to 65°C–68°C. In contrast, Listeriae did not survive in samples heated to
72°C–75°C (Samelis and Metaxopoulos, 1999; Mataragas et al., 2003). Hence,
the maintenance of the cold chain is an effective means to prevent micro-
bial growth in food products. However, psychrotrophic pathogens such as
L. monocytogenes can overcome this hurdle due to their capacity to grow at
refrigerated storage conditions, reaching infective doses at consumption.
Furthermore, L. monocytogenes and other Listeria spp. contaminate most
areas where raw materials are being processed and colonize certain equip-
ment which are not made from stainless steel or are not disinfected properly
(Stiles, 1996).
Cooked cured meat products are sensitive to spoilage. The low salt content
(2.0% in water phase), a pH value above 6.0, and a water activity higher than
0.95 are only small hurdles in terms of inhibiting the growth of psychro-
trophic pathogens like L. monocytogenes. After cooking, the normal flora of
the product, consisting of LAB, is too low to protect the products against
the growth of pathogens (Pérez-Rodríguez et al., 2010). Since these products
are heated to a temperature of 65°C–75°C, most vegetative cells are killed
and postheat treatment recontamination determines their shelf life (Borch
et al., 1996). Ham and ham-like products are contaminated to a great extent
during tumbling since the need to operate tumblers continuously does not
enable their proper cleaning and disinfection on a daily basis (Samelis and
Metaxopoulos, 1999). Not only product handling after cooking plus slicing
prior to packaging recontaminates these products with about 0.5–2-log CFU/g
of total bacteria, but also the psychrotrophic pathogen L. monocytogenes can
be found as a result of postcontamination (Uyttendaele et al., 1999; Samelis
et al., 2000).
Several authors reported that the population of Listeriae decreased when
cooked meat products had been inoculated with bacteriocinogenic LAB,
probably due to the production of bacteriocin. Several authors have reported
the antilisterial effect of bacteriocinogenic LAB strains as bioprotective cul-
tures in cooked meat products. Lb. sakei CTC494, sakacin K producer, dimin-
ished the number of Listeria from an initial inoculum of 2 × 102 CFU/g to
2 most probable number (MPN)/g in cooked ham after seven days of stor-
age at 7°C (Hugas et al. 1998). Mataragas et al. (2003) showed that two LAB
had an antagonistic effect on L. innocua growth in sliced cooked cured pork
under vacuum conditions. At the beginning of storage (7th day), L. innocua
The Use of Bacteriocins against Meat-borne Pathogens 569

population increased, from 3.5 to 3.9 log10 CFU/g and to 4.4 log10 CFU/g in the
presence of Leuconostoc mesenteroides L124 and Lb. curvatus L442, respectively.
After this initial increase, the number of the listeriae population decreased
until the end of storage, with final population numbers of 2.5 and 2.9 log10
CFU/g, respectively. The reduction of the listeriae population was the same
(1.5 log10 CFU/g) for both LAB strains. In the presence of Ln. mesenteroides
L153 (bac–), L. innocua increased by 1 log10 CFU/g, from 3.3 to 4.0 log10 CFU/g
at the end of storage. In the samples inoculated with L. innocua, the popula-
tion reached 7.3, 4 log10 CFU/g more than the initial number. When the bac-
teriocins were present, listeriae population reduced by 1 log10 CFU/g on the
third day of storage and on the fourteenth day the population was below the
enumeration limit. In the noninoculated samples, Listeria was not detected
during storage, reflecting good hygiene during the production of meat prod-
uct. The results showed that bacteriocins were able to inhibit L. innocua.
Mathieu et al. (1994) and Hanlin et al. (1993) studied the use of a combi-
nation of two bacteriocins to provide greater antibacterial activity against
L. monocytogenes and other Gram-positive bacteria and their spores. This
study demonstrated that Ln. mesenteroides L124 and Lb. curvatus L442 have
several attributes as potential protective organisms against listeriae. Since
the listeriae can grow or survive under vacuum or modified atmosphere,
respectively, at low temperatures and the two bacteriocinogenic LAB strains
grow rapidly because they are well adapted to growth in the meat products
and they can reduce the listeriae numbers, they can be either employed as
biopreservatives or as starter cultures with antilisterial properties in meat
products. Additionally, their bacteriocins have a bactericidal effect on the
listeriae growth and could be used to improve meat safety (Mataragas et al.,
2003).
The results obtained by Kouakou et al. (2008) with samples of cooked pork
meat showed that when samples were treated with Lb. curvatus CWBI-B28wt,
the Listeria CFU count dropped to an undetectable level by the end of week
1 and remained at that low level until the end of week 2, at which point
regrowth occurred. When samples were treated with cell-adsorbed bacte-
riocin, the count dropped similarly but remained at an undetectable level
from the end of week 1 until the end of the experiment (28 days). In parallel,
untreated controls, the Listeria CFU count increased three-fold in the course
of the experiment. Bacteriocin activity was higher in samples treated with
cell-adsorbed bacteriocin (4500–2000 AU/g) than in samples treated with the
bacteriocin-producing strain (2000–1000 AU/g).
Rivas et al. (2014) evaluated the inhibition of L. innocua on the surface of
cooked pork using the strain Lb. curvatus ACU-1 isolated from artisanal
dry sausages manufactured in Argentina, which produces the bacteriocin
sakacin Q. The pork meat slices were immersed for five minutes in differ-
ent suspensions (pH 6.5) containing the bacteriocin-producing strain alone
and/or with bacteriocin. Bacteriocin production in situ significantly reduced
counts of Listeria (approximately 5-log cycles at the end of the trial), while
570 Advanced Technologies for Meat Processing, Second Edition

the antilisterial activity decreased after three weeks when the pathogen was
only inoculated with the bacteriocin. A larger effect was achieved by the
combination of the producer strain together with bacteriocin. However, the
greatest effect was accomplished by using freeze-dried bacteriocin.
Jacobsen et al. (2003) reported that the use of living cells of Leuconostoc
carnosum 4010 was better than the partially purified leucocin 4010 in prevent-
ing the growth of L. monocytogenes in pork saveloys. In the control batch, Listeria
grew up to 107 CFU/g, whereas in batches with the bacteriocin producer strain,
the counts never exceeded 10 CFU/g during the four weeks of storage at 10°C.
A study by Scannell et al. (2000) on keeping the quality of fresh pork
sausage found that lacticin and nisin exhibited better antimicrobial action
against Gram-positive organisms than sodium metabisulfite. The combina-
tion of organic acids with either of these bacteriocins enhanced their anti-
microbial activity against L. innocua and Salmonella Kentucky and was even
more effective against C. perfringens. This study also suggested that lacticin
combined with sodium lactate or sodium citrate can be used as an alterna-
tive preservative of fresh pork sausage since it gave lower total aerobic plate
counts throughout storage than sodium metabisulfite.
Pediocin is produced by P. acidilactici or Pediococcus pentosaceus and has
been shown to be effective against L. monocytogenes and other Gram-positive
pathogens on meat surfaces (Coma, 2008). Pediocin has generally recog-
nized as safe (GRAS) status in certain food applications (Juneja et al., 2012).
Research on some meat products indicated that pediocins (especially pedio-
cin PA-1) could be more effective than nisin especially when used in com-
bination with nisin, lysoszyme, organic acids, sodium dodecyl sulfate, or
ethylenediaminetetraacetic acid (EDTA) (Hugo and Hugo, 2015).
In the experiment of Ananou et al. (2010a), AS-48 effectively inhibited
L. monocytogenes in cooked ham in a concentration-dependent way at 5°C and
15°C. Nevertheless, even at the higher concentration used (60 μg/g), it was
not possible to avoid the regrowth of Listeria after 15–30 storage days at 5°C.
They attributed the lower effectiveness of AS-48 in cooked ham compared
to brain–heart infusion (BHI) broth to a higher retention of the bacteriocin
molecules by meat and fat components, to a slower diffusion, and also to
the irregular distribution of the bacteriocin molecules and the bacterium in
the meat matrix with a higher dry matter content compared to liquid media.
Also, results from bacteriocin extraction experiments revealed that bacterio-
cin levels in the meat decreased markedly after day 7, which could explain
regrowth of surviving bacteria. Other previous experiments carried out by
these authors in a sausage model demonstrated that it was necessary to apply
450 AU/g (40 μg/g) to a meat mixture to maintain Listeria below detection
level from six to nine days of incubation at 20°C (Ananou et al., 2005).
Regarding the effect of the bacteriocin AS-48 on S. aureus in cooked ham,
a slight inhibitory effect was observed. On the contrary, in vegetable sauces,
the bacteriocin showed an antistaphylococci effect (Ananou et al., 2010a).
Furthermore, the mentioned effect was lower compared to previous results
The Use of Bacteriocins against Meat-borne Pathogens 571

obtained in liquid media for AS-48 (Ananou et al., 2004; Muñoz et al., 2007)
reinforcing the suggestion that interaction of AS-48 with food components
can interfere with its efficacy.
Another pathogen of concern in cooked RTE foods is C. botulinum and
the spores produced by this microorganism, even under refrigerated stor-
age conditions. Okereke and Montville (1991) demonstrated that LAB can
produce bacteriocins at refrigeration temperatures and that the bacteriocins
produced by Lc. lactis, Lactobacillus plantarum, and P. pentosaceus are inhibi-
tory against proteolytic and nonproteolytic C. botulinum spores. Rodgers
et al. (2003) have demonstrated the inhibition of nonproteolytic C. botulinum
with the bacteriocinogenic LAB Lactobacillus rhamnosus, Lc. lactis, Ec. faecium,
and P. pentosaceus at refrigerated temperatures, as demonstrated by spot-on-
the-lawn tests (Kostrzynska and Bachand, 2006).
Nieto-Lozano et al. (2010) found that the treatment of frankfurters with
5000 bacteriocin unit/mL of the pediocin PA-1 had an inhibitory effect
against L. monocytogenes CECT4031 after storage for 60 days at 4°C. Thus,
counts of this target bacteria strain were 8 × 105 CFU/g after 60 days in con-
trol samples but only 8 × 103 CFU/g in treated samples. There were significant
differences between both treatments for samples stored at 4°C, whereas the
inhibitory effect was only 0.6-log cycles (not significant) for samples stored at
15°C after 30 days. Moreover, counts of C. perfringens CECT376 were reduced
by 2-log cycles in the pediocin-treated frankfurters after storage at 10°C for
60 days. They found significant differences between the samples stored at
10°C and the control, whereas only a small inhibitory effect (only 0.8-log
cycles; not significant) was observed in samples stored at 15°C after 30 days
compared with the control. These results have shown the inhibitory effect of
the pediocin-producing strain and the pediocin PA-1 itself against L. monocy-
togenes CECT4031 and C. perfringens CECT376. Inhibition of the target bacte-
rial strains varied with temperature and was greater in refrigerated products.
Reuterin is a broad spectrum antimicrobial substance produced by Lac-
tobacillus reuteri during fermentation of glycerol. Reuterin was found capa-
ble of significantly decontaminating cooked pork contaminated with E. coli
O157:H7 and L. monocytogenes (El-Ziney et al. 1999). Kuleasan and Cakmakei
(2002) also found that the application of reuterin to the surface of sausage
significantly reduced the growth of L. monocytogenes.

18.2.3 Fermented Sausage Meat Products

The applied manufacturing processes can mainly lead to two distinct groups
of fermented meat products: (1) dry sausages (i.e., pepperoni, Genoa salami,
dry salami, etc.) and (2) semidry sausages (summer sausage, Lebanon bologna,
cervelat, etc.). Whereas dry sausages require lower temperatures and a longer
manufacturing process, semidry sausages have a longer shelf-stable life due to
their low Aw. Having unfavorable environmental conditions—low pH, low Aw,
and salts, among others—does not prevent the growth of pathogenic bacteria
572 Advanced Technologies for Meat Processing, Second Edition

such as E. coli, Salmonella spp., L. monocytogenes, S. aureus, and C. perfringens

(Benito et al., 2007; Ferreira et al., 2007). As Enterobacteriaceae are common
contaminants of meat, they can be detected in fermented substrates in dif-
ferent counts depending on the initial microbial load of raw material, type
of sausage, and ripening process (Casquete et al., 2012). Bacterial numbers
decline persistently under the conditions of ripening, an essential process to
inhibit food pathogens such as Salmonella, Shigella, or E. coli. Yet, Moore (2004)
reported the survival of Salmonella and E. coli in this type of product. The use
of selected LAB as protective cultures stands as an effective extra hurdle to
increase food safety of dry-fermented products without increasing the content
of chemical additives. The most regularly identified LAB species in tradition-
ally fermented sausages are Lb. sakei, Lb. curvatus, and Lb. plantarum (Aymerich
et al., 2006b; Talon et al., 2008; Urso et al., 2006a). Many strains belonging to
these species are bacteriocin producers, hence their application seems not be a
drawback for the processing and/or production of these products.
New bioprotective cultures for food fermentation purposes can be selected
by means of three steps: (1) isolation and selection of bacteriocinogenic LAB
from endogenous microbiota, (2) assessment of antibiotic resistance and pro-
duction of biogenic amines, and (3) evaluation of technological features, such
as acidification profile, proteolytic and lipolytic activities, etc. (Lücke, 2000;
Aymerich et al., 2006b).
Several bacteriocin-producing LAB species, including Lactobacillus, Lacto-
coccus, Pediococcus, and Enterococcus spp., have been evaluated for improve-
ment of microbial safety of fermented meat products. These species can be
applied as starter cultures or as adjunct cultures. In the latter, the bacteriocin
producer does not need to contribute to the fermentation; besides, it does not
interfere with the function of the starter, which of course needs to be insensi-
tive to the bacteriocin (Gálvez et al., 2007). Below are some examples of the
applications implemented during the last 10 years.
Pediocin-producing strains have been used in fermented meat products
to improve the quality and safety of these products. Nieto Lozano et al.
(2010) evaluated the inhibitory effect of the P. acidilactici MCH14, a pediocin-
producing strain, in Spanish dry-fermented sausages using L. monocytogenes
as the target bacteria strain. Inhibition of the pathogen by the bacterioci-
nogenic P. acidilactici MCH14 was effective in the product, the counts being
reduced by 2-log cycles compared to the control. In another study, Albano
et al. (2009) analyzed the ability of P. acidilactici HA-6111-2, a producer of
pediocin PA-1, to inhibit a cocktail of L. innocua strains during production
and shelf life of “Alheira,” a traditional naturally fermented meat sausage
typical of Trás-os-Montes (Portugal). The results demonstrated that P. acidi-
lactici HA-6111-2 has several attributes as a potential bioprotective organism:
It is able to inhibit L. innocua in “Alheiras” during storage, has a good capac-
ity for colonization of meat, and produces sufficient amounts of bacteriocin.
Furthermore, no significant antibiotic resistance was detected and a trained
panel considered the treated product as sensorially acceptable.
The Use of Bacteriocins against Meat-borne Pathogens 573

Successful applications of Lb. curvatus strains as biopreservatives in fer-

mented meat products have been published. Benkerroum et al. (2005) used
the bacteriocin-producing strains Lc. lactis subsp. lactis LMG21206 and Lb. cur-
vatus LBPE as adjunct cultures for sausage fermentations to control the occur-
rence and survival of L. monocytogenes. In this study, a commercial starter
culture (Bel’meatTM SL-25) not inhibitory to L. monocytogenes was mixed (1:1)
with each of the two lyophilized bacteriocinogenic strains to obtain starters
active against the pathogen. The effectiveness of these Bac+ starters was eval-
uated in dry-fermented sausages experimentally contaminated with a mix-
ture of four different strains of L. monocytogenes (102–103 CFU/g). The results
showed that both strains caused a decrease in cell counts. However, the Lb.
curvatus strain resulted in more efficient pathogen control, reducing Listeria
counts to below the detectable limit after four hours of fermentation. Recently,
Casaburi et al. (2016) informed on the suitability of bacteriocinogenic Lb. cur-
vatus 54M16 to be used as starter culture for sausage fermentation. This strain
produces multiple bacteriocins as confirmed by molecular mass spectrom-
etry analysis and N-terminal amino acid sequencing, with activity against
L. monocytogenes, Bacillus cereus, and the meat spoilage organism B. thermo-
sphacta. Microbiological, physiochemical, and sensorial evaluation of inocu-
lated samples during sausage fermentation showed that the use of Lb. curvatus
54M16 might contribute to increase the quality and safety of the traditionally
fermented sausages prepared without antimicrobial additives.
Based on the capacity to produce several bacteriocins, meatborne Lb. sakei
is another strain tested in the biopreservation of fermented meat products.
Antilisterial activity was reported for bacteriocinogenic Lb. sakei CTC494 in
fermented sausages (Ravyts et al., 2008), Lb. sakei strains 1155 in Croatian
traditionally fermented sausages (Zdolec et al., 2007), and a bacteriocin pro-
ducer Lb. sakei in fermented sausages from four European countries (Drosi-
nos et al., 2006). The Lb. sakei strain (sakacin P producer), originally isolated
from naturally fermented sausages, was evaluated as a starter culture by
Urso et al. (2006b). The strain was able to grow in conditions used in the pro-
duction line and colonized rapidly the ecosystem. A high number of isolates,
capable of producing sakacin P, were isolated after the third day of fermenta-
tion and persisted throughout the course of the fermentation. Moreover, total
bacterial count and fecal enterococci showed a rapid decrease at the end of
the fermentation; in addition, the sensory evaluation panelists preferred the
sausages produced with the Lb. sakei when compared to a fermented sausage
produced with a commercial starter. Similarly, Gao et al. (2014) analyzed the
use of bacteriocinogenic Lb. sakei C2 in the production of Chinese fermented
sausages. This strain can produce a bacteriocin, named after sakacin C2 (Gao
et al., 2010), with a broad inhibitory spectrum which has certain probiotic
potential (Gao et al., 2012). Results obtained showed that Lb. sakei C2 could
quickly colonize the meat matrix, effectively control spoilage and pathogenic
microorganisms, and decrease the content of lipid oxidation products and
nitrite, while improving the sensory characteristics of final products.
574 Advanced Technologies for Meat Processing, Second Edition

The use of enterococci as starter cultures or cocultures has been studied

not only for their organoleptic properties, but also for their negative effect
on food pathogens because of the production of enterocins (Khan et al.,
2010). Rubio et al. (2013) examined the bioprotective effect of three bacterio-
cinogenic, nonaminogenic, and nonvirulent Enterococcus strains (Ec. faecium
CTC8005, Enterococcus devriesei CTC8006, and Enterococcus casseliflavus
CTC8003) against L. monocytogenes and S. aureus in the elaboration of Spanish
fuets (low-acid fermented sausages) when applied alone, or in combination
with an high hydrostatic pressure (HHP) treatment (600 MPa for 5 minutes at
15°C) after ripening. The inoculated strains, monitored by random amplifica-
tion of polymorphic DNA by polymerase chain reaction (RAPD-PCR), were
able to grow, survive, and dominate the endogenous enterococci population.
Ec. devriesei CTC8006 and Ec. faecium CTC8005 predominantly inhibited the
growth during the ripening process. S. aureus was not affected by the strains.
The application of HHP treatment (600 MPa for 5 minutes) at the end of the
ripening period (day 21) promoted a decrease of 1-log unit in the counts of
S. aureus and increased the antilisterial effect. From these results, the authors
concluded that the combination of the bacteriocinogenic strain Ec. faecium
CTC8005 as a bioprotective starter culture with an HHP treatment—applied
after ripening—could be recommended in order to produce low-risk, high-
quality low-acid fermented sausages.
In addition to the in situ production, purified or semipurified bacterio-
cins have also been explored as preservatives in fermented meat products.
In Turkish fermented sausage (sucuk) contaminated with L. monocytogenes
ATCC 7644 at a concentration of 106 CFU/g, the addition of 50 and 100 μg/g
commercial nisin resulted in effective control of L. monocytogenes since
counts were reduced during storage and no surviving cells were detected at
day 25 and 20, respectively (Hampikyan and Ugur, 2007). In another study,
semipurified bacteriocins, homologous to sakacins P and X from Lb. curvatus
MBSa2, were incorporated into the batter for production of salami contami-
nated with L. monocytogenes (104–105 CFU/g). The bacteriocins caused 2-log
and 1.5-log reductions in the counts of the pathogen in the product after 10
and 20 days, respectively (de Souza Barbosa et al., 2015).
Furthermore, the application of enterocins resulted in effective control
of some pathogens in low-acid fermented sausages. Ananou et al. (2010b)
reported that the use of enterocin AS-48 (148 AU/g) applied as an additive in
the formulation of fuet caused a drastic 5.5-log CFU/g decrease in L. monocy-
togenes and a significant reduction for Salmonella enterica at the end of ripen-
ing (10 days) but did not affect S. aureus. On the other hand, Jofré et al. (2009)
applied the enterocins A and B (2000 AU/g) in raw sausages spiked with
3-log CFU/g of Salmonella, L. monocytogenes, and S. aureus. Both enterocins
caused a fast reduction in the counts of L. monocytogenes, while S. aureus was
not inhibited. On the other hand, Salmonella was more affected by the endog-
enous hurdles associated with the ripening process. Regarding the last two
studies using enterocins, it can be concluded that neither the enterocin AS-48
The Use of Bacteriocins against Meat-borne Pathogens 575

nor the enterocins A and B could control the growth S. aureus in low-acid
fermented sausages.

18.3 Bacteriocins and New Preservation Technologies to

Increase the Safety of Meat and Meat Products
Application of bacteriocins in foods is performed as a part of the hurdle tech-
nology. The latter takes advantage of the possible synergistic action between
stress factors, which allows the use of a lower concentration of antimicrobial
agents and/or the application of milder treatments.
Many antimicrobials have been used in combination with bacteriocins in
order to inhibit the spoilage flora and decrease the risk of pathogens. There is
a trend to select antimicrobials from natural sources and to use GRAS com-
pounds as previously mentioned. Some examples of the use of bacteriocins
are presented in Table 18.1. Nisin is mainly applied—in combination with
antimicrobials—for the preservation of meat and meat products.
Many new preservation technologies have been proposed in order to
increase food safety without damaging sensory and nutritional properties.
Among them, active packaging systems and HHP are the most relevant and
innovative techniques for raw meat and meat products.

18.3.1 High Hydrostatic Pressure

HHP has probably been the most investigated technology in recent decades.
This preservation method is able to destroy microbial vegetative cells and
inactivate enzymes without changing sensory and nutritional characteris-
tics of the food. It has been applied at a commercial scale for the production
of some products (Ananou et al., 2010b). Since some foodborne pathogens
can survive after the application of mild HHP, its use in combination with
bacteriocins has been explored. Different studies demonstrated that HHP
treatment sensibilize Gram-negative bacterial cells to nisin action, suggest-
ing that HHP and nisin can be a useful combination of stress factors.
Regarding meat products, effectiveness of HHP and bacteriocins has been
evaluated mostly in ham and in low-acid fermented sausages. Jofré et al.
(2008) studied the effect of a HHP at 600 MPa in combination with nisin,
lactate, or both on the growth of L. moncytogenes, Salmonella, and S. aureus in
sliced cooked ham at refrigeration temperatures. It was found that the joint
use of HHP and nisin and the storage at 6ºC reduced Salmonella and L. mono-
cytogenes population to less than 10 CFU/g and reduced S. aureus population
to 2.4 CFU/g for three months. Hereu et al. (2012) evaluated the effect of nisin
application (directly applied or through active packaging) combined with
HHP (600 MPa for 5 minutes) on the behavior of L. monocytogenes CTC1034
onto the surface of RTE sliced dry-cured ham stored for 60 days at 8°C. It was
576 Advanced Technologies for Meat Processing, Second Edition

TABLE 18.1
Compilation of the Use of Bacteriocins in Combination with Antimicrobials for the
Preservation of Meat and Meat Products
Bacteriocin
Producer Antimicrobial— Product—Target
Form of Application Other Hurdles Microrganisms Reference

Carnocin Chitosan Pork sausages— Roller et al. (2002)

Carnobacterium Refrigeration Aerobic flora, Listeria
piscicola innocua
Meat batter
Nisin Potassium lactate, Cooked ham— Jofré et al. (2008)
Meat batter high hydrostatic Listeria monocytogenes
pressure Staphylococcus aureus
Refrigeration Salmonella enterica
serovars
Nisin Sodium chloride Raw buffalo meat Pawar et al. (2000)
mixing Refrigeration mince—
Listeria monocytogenes
Nisin mixing Thyme essential Minced beef— Solomakos et al.
oil Escherichia coli O157:H7 (2008)
Refrigeration
Nisin mixing Sodium chloride, Meat model system— Dominic Dussault
sodium acetate Listeria monocytogenes et al. (2016)
and lactate, hop
alpha acids
Refrigeration
Nisin mixing Grape seed extract Turkey frankfurter— Theivendran et al.
Edible film Listeria monocytogenes (2006)
Refrigeration
Nisin mixing EDTA and Ham and bologna— Gill and Holley
lysozyme Aerobic flora (2000)
Nisin mixing Sodium lactate, Ham steaks— Ye et al. (2008)
sodium diacetate Listeria monocytogenes
Nisin mixing Oregano essential Minced sheep meat— Govaris et al.
oil Salmonella Enteritidis (2010)

observed that the presence of nisin increased the inactivation induced by

HHP when the bacteriocin was applied directly on the surface of ham. Liu
et al. (2012) evaluated the effect of HHP (200 and 400 MPa for 10 minutes)
and enterocin (256 and 2560 AU/g) on the inhibition of L. monocytogenes and
Salmonella enteriditis inoculated in cooked sliced ham at 4ºC. Results obtained
showed that the most effective treatment from microbiological and sensorial
points of view was achieved with the combination of 400 MPa HHP and 2560
AU/g enterocin.
The slightly fermented sausages exhibit a moderate decrease in pH, and
therefore pathogens such as L. monocytogenes, S. aureus, and Salmonella spp.
may be able to survive. To increase the safety of these products, the com-
bined use of enterocins and HHP was satisfactorily evaluated. For example,
The Use of Bacteriocins against Meat-borne Pathogens 577

the application of a HHP treatment at the end of the ripening or its combina-
tion with enterocins A and B proved to be necessary to decrease the levels
of Salmonella and L. monocytogenes, respectively, to <1-log CFU/g at the end
of storage. It must be remarked that the ability of S. aureus to tolerate hur-
dles such as curing salts, low water activity, enterocins, and HHP (400 MPa)
suggests the need of higher intensity HHP treatments to obtain safe low-
acid fermented sausages (Jofré et al., 2009). Furthermore, enterocin AS-48
(148 AU/g) applied alone can be slightly effective against Salmonella at the
end of ripening but very effective for the inhibition of L. monocytogenes in
low-acid fermented sausages. The combination of this bacteriocin with HHP
treatment improved the inhibition of Salmonella. However, neither enterocin
AS-48 nor HHP treatment inhibits S. aureus growth (Ananou et al., 2010b).
The aforementioned trends suggest that the combined use of HHP and
bacteriocins provides a useful tool to control L. monocytogenes and Salmonella
during the storage of RTE meat products. But control of S. aureus needs the
application of other stress factors.

18.3.2 Active Packaging

Active packaging systems are based on the inclusion of active compounds—
mainly antimicrobials—into the packaging, with the aim of improving qual-
ity and extending food shelf life. There are different ways to incorporate
the active compounds: (1) by addition into a pad placed in the package from
which the volatile agent is released, (2) by inclusion into the packaging film
during its manufacture, (3) by coating the packaging with a matrix carrying
the active compound, and (4) by using an active compound possessing film-
forming ability (Coma, 2008; Campos et al., 2011). These strategies have been
intensively studied in recent years, edible films and coatings being the most
developed ones (Campos et al., 2011).
Inclusion of the active compound into the packaging instead of its addi-
tion into the food has been proposed as an efficient way to prevent surface
microbial growth. Meat from healthy animals is sterile and microorganims
are present at the external surface. For this reason, the presence of an anti-
microbial where microbial growth happens can be effective using a smaller
antimicrobial amount. Furthermore, a controlled released from the external
surface to the food can assure the presence of the antimicrobial in the food
during storage. This strategy is very useful to prevent the loss of antimicro-
bial activity due to the reaction or binding of the antimicrobial with food
components or other additives.
A compilation of the use of bacteriocins in active packaging systems for
the preservation of meat and meat products is shown in Table 18.2. As can be
observed, nisin is the most selected bacteriocin to be included within anti-
microbial films. The latter were mainly edible and formed by proteins and
polysaccharydes. Most of the studies have been conducted to address the inhi-
bition of L. monocytogenes in processed meats. It must be stressed that for a
578 Advanced Technologies for Meat Processing, Second Edition

TABLE 18.2
Compilation of the Use of Bacteriocins in Active Packaging Systems for the Preser-
vation of Meat and Meat Products
Polymer Carrier—
Other Hurdles Product—Target
Bacteriocin— Applied Microrganism Reference

Nisin Whey protein isolate— Turkey frankfurter— Gadang et al.

organic acids, and Listeria monocytogenes, (2008)
natural extracts E. coli O157:H7, and
Refrigeration Salmonella Typhimurium
Nisin Soy protein film—with Turkey frankfurters— Theivendran
grape seed extract or Listeria monocytogenes et al. (2006)
green tea extract
Refrigeration
Nisin Zein protein film Ready-to-eat chicken— Janes et al.
Refrigeration Listeria monocytogenes (2002)
Nisin Bacterially produced Frankfurters— Nguyen et al.
cellulose film Listeria monocytogenes (2008)
Refrigeration
Nisin Alginate films and Beef— Millette et al.
beads Staphylococcus aureus (2007)
Refrigeration
Nisin Sodium alginate film Ham slices, frankfurters— Kapetanakou
Refrigeration Listeria monocytogenes et al. (2016)
Enterocins A and Perforated polypropyl- Cooked ham— Jofré et al.
B, sakacin K, ene, polyamide and Salmonella spp (2008)
nisin A nonperforated
polypropylene—natu-
ral preservatives
Refrigeration
Nisin Gelatin film Turkey bologna— Min et al. (2010)
Refrigeration Listeria monocytogenes
Pediocin Cellulose acetate films Sliced ham— Santiago-Silva
Refrigeration Listeria innocua, Salmonella et al. (2009)
spp
Lactocin 705 and Cryovac® synthetic film, Wieners— Massani et al.
lactocin AL705 Agroprotein film Listeria innocua (2014)
Refrigeration
Nisin Z Pullulan films— Fresh and processed Pattanayaiying
natural preservatives meats— et al. (2015)
Refrigeration Salmonella Typhimurium
and Salmonella Enteriti-
dis, Listeria monocyto-
genes, E. coli O157:H7

successful inhibition of postprocess contamination, the release of the bacte-

riocin into the food must be controlled in order to have enough inhibitory
amount at the surface of the food throughout the storage. The rate of release
depends on the characteristics of the film and the food. For example, Massani
The Use of Bacteriocins against Meat-borne Pathogens 579

et al. (2014) observed that after 45 days of storage, the activity of lactocin 705
and lactocin AL705 added to a multilayer synthetic film and to a wheat gluten/
starch film was lost in the case of the multilayer syntethic film but was present
in the edible film. Both films were used to wrap wieners, and they exhibited a
bacteriostatic effect on L. innocua until the fourth week of storage at 5ºC.
Inclusion of a bacteriocin in a film can modify the physical properties of the
film. As an example, addition of pediocin to a cellulose acetate matrix caused
an increment on film thickness and on the maximum force needed for rupture.
These results could be attributed to a possible interaction between pediocin
and the cellulosic matrix which became more rigid (Santiago-Silva et al., 2009).
The combined use of bacteriocins with other preservatives and their inclu-
sion in an edible film can be useful to inhibit several pathogens. For example,
Pattanayaiying et al. (2015) reported that pullulan films with the inclusion of
a mixture of nisin Z and lauric arginate were effective to control the growth
of Salmonella spp., L. monocytogenes, S. aureus, and E. coli O157:H7 in vacuum-
packaged, refrigerated fresh, and RTE muscle foods.
Results discussed herein show that bacteriocins incorporated into films
represent a promising tool to control foodborne pathogens in meat products.

18.4 Problems to Overcome for the Successful Application

of Bacteriocins in Meat and Meat Products
Bacteriocin application appears to be a laudable aim for preserving food;
however, it could also be a double-edged sword. The antimicrobial activity
of bacteriocins is uneven and unpredictable, as it depends on a vast array of
chemical and physical conditions of foods together with factors involving the
inherent microbiota and the target microorganisms. Processing conditions,
spontaneous cell loss of the bacteriocin producer bacteria, phage infection
of the cell, and the presence of competitive microorganisms in the medium
can interfere with the bacteriocin production by LAB (da Silva Sabo et al.,
2014). Furthermore, the bacteriocin effectiveness would also be affected by
the presence of bacteriocin-resistant microorganisms, enzymes (namely pro-
teases), occurrence of oxidation–reduction reactions, interaction with con-
stituents of the food formula (fats, proteins, surfactants, for instance) and
diffusion restraints due to high salt concentration. In addition, the presence
of nitrate and nitrite and low water activity can lead to inadequate distribu-
tion of the bacteriocin throughout the food product (Alves et al., 2015).

18.4.1 Interaction with Meat Components and/or Additives

From a physicochemical point of view, meat and meat products exhibit
a structure that comprises the presence of tissues, and hydrocolloids
and lipids which contribute to the viscous, gelled, or emulsified feature
580 Advanced Technologies for Meat Processing, Second Edition

of the product. According to Wilson et al. (2002), food structure is one of

the growth constraints that microorganisms find on foods—together with
storage conditions, food composition, and presence of additives. Food
structure not only modifies water mobility and distribution of solutes
such as acidulants, water activity depressors, and preservatives, but also
affects the mobility of microorganisms (Brocklehurst et al., 1993; Castro
et al., 2003; Wimpenny et al., 1995). On account of close spatial distribution,
microorganisms grow as colonies—rather than planktonically—compet-
ing for nutrients and oxygen; in addition, their metabolic end products can
be accumulated near colonies affecting growth (Wilson et al., 2002). These
considerations must be taken into account when using a protective culture
destined to produce the bacteriocin in situ. Meat tissue consists of long, thin,
parallel cells arranged into fiber bundles which are surrounded by elastin
fibers. Its surface comprises the simplest physical arrangement affecting
the growth of microorganisms. As the aqueous phase is structured among
the network of meat fibers and the crevices of the surrounded tissue, micro-
organisms are immobilized and constrained to grow as colonies. This fact
limits nutrient diffusion and produces depletion of oxygen and accumu-
lation of protons beneath the colony; this results in local changes in the
concentration of substrates and acidic metabolic end-products, which leads
to decreasing growth rates. Hence, the effectiveness of bacteriocinogenic
LAB for the biopreservation of meat and meat products critically depends
on interactions with meat constituents (mainly fat, proteins, and endog-
enous enzymes), and the distribution of bacteriocin molecules within the
food. Unfortunately, little information has been recorded on this topic, the
meat matrix being an unexplored field in this matter. Conversely, many are
the studies conducted on cheese matrices that successfully depicted the
interaction issue. As an illustration, when nisin is produced in situ, bacteria
are entrapped in the cheese and grow as colonies (Jeanson et al., 2011). To
be effective after being released, nisin has to migrate (Aly et al., 2011) and
reach the target colonies. All these steps can fairly be compared to those
found in meat products.
Additionally, the use of bacteriocins, i.e., purified and concentrated extracts,
as biopreservatives in meat and meat products faces several limitations
resulting from random interactions. For instance, application of nisin in
meat products may deal with phospholipid emulsifiers and other food com-
ponents, poor solubility at pH above 6.0, and inactivation by formation of a
nisin-glutathione adduct. Nevertheless, this inactivation is lower in cooked
meats due to the loss of free sulfhydryl groups during cooking as a result of
the reaction of glutathione with proteins (Stergiou et al., 2006).
With the limitations for nisin application in meats as a biopreservative, a
search for alternative sources of biopreservative agents is necessary. In this
sense, Rivas et al. (2014) assessed antilisterial activity of sakacin Q produced
by Lb. curvatus ACU-1 on the surface of cooked pork meat. As a preliminary
attempt to find out whether this bacteriocin adsorbs to food matrices, fat
The Use of Bacteriocins against Meat-borne Pathogens 581

and meat particles (cubes bounded by squared faces of approximately 1 cm2)

were added to the CFS of the bacteriocinogenic culture (50 mL). Periodically,
samples were withdrawn to measure bacteriocin activity in the superna-
tant. Antimicrobial activity of sakacin Q was halved in the presence of both
food matrices (fat and meat tissues), which could be attributed to bacteriocin
adsorption to them. Though the remaining concentration was approximately
400 AU mL−1 at the end of the trial (after 24 hours) in both tissues, it was still
effective against L. innocua ATCC 33090. The authors attributed this phenom-
enon to adsorption of the bacteriocin to fat and meat particles. Hydropho-
bic sites of bacteriocins are prone to establishing unspecified unions to the
hydrophobic surface of fat particles (Holzapfel et al., 1995). As an illustration,
fat in the bulk of CFS from Lb. sakei CTC 494 caused a great loss of bacteriocin
activity (Leroy and De Vuyst, 2005). Regardless of being bound to the food
matrix, part of the bacteriocin sakacin Q could exert its antimicrobial activ-
ity. This fact was supported by a simple qualitative assay: small pieces of
meat and fat, which were subjected to the aforementioned procedure, were
placed onto BHI agar seeded with L. innocua. Inhibition halos recorded after
incubation of the plates suggested that the adsorption of the bacteriocin to fat
and meat tissues did not hinder its antimicrobial activity.
Furthermore, Kouakou et al. (2009) found that high-fat content meat antag-
onizes the antilisterial effect of bacteriocinogenic Lb. curvatus CWBI-B28wt
in pork meat systems. The unsatisfactory effect of bacteriocin-producing
strains in situ is due to hydrophobic interactions of the bacteriocins with
fat. However, several factors regarding the type of bacteriocin may interfere
with its activity. While some bacteriocins—like nisin—associate reversibly
with fat and have a stabilizing effect on the fat–water interface, preserving
their antilisterial effect (Bani-Jaber et al., 2000), other bacteriocins—like saka-
cin P—bind tightly to lipids in the food matrix and lose their antimicrobial
activity (Aasen et al., 2003).
On the other hand, endogenous proteases may lead to a pathogen rebound
after a certain amount of storage time since proteolytic degradation of bacte-
riocin can proceed at the end of the culture. Kouakou et al. (2009) observed
this listerial rebound; they attributed it also to the presence of nitrites. It has
been suggested that this nitrite-triggered repression of bacteriocin produc-
tion is due to interference of salt molecules with binding of the induction
factor to its receptor (Nilsen et al., 1998). Other authors suggested different
mechanisms such as direct interference of nitrite with the action of bacte-
riocin through binding to its pathogen-targeting pole (Dykes and Hastings,
1998; Ennaharet al., 2000) and enhancement of listeria resistance through
nitrite-induced stress (Gravesen et al., 2002).
As a whole, in situ bacteriocin production for the biopreservation of meat
and meat products should be conducted with a technologically competent
strain—capable of producing higher levels of bacteriocins—in order to over-
come the adverse effects on bacteriocin effectiveness that may occur in some
situations.
582 Advanced Technologies for Meat Processing, Second Edition

18.4.2 Appearance of Resistant Strains

The development of bacteriocin resistance (BacR) might hinder bacteriocin
application in food preservation. Moreover, an undesirable consequence of
an extended use of natural antimicrobials such as nisin in food might be
cross-resistance to clinically used antibiotics in foodborne pathogens such
as L. monocytogenes.
Most LAB bacteriocins impair the overall integrity of the cytoplasmic
membrane by pore formation. Moreover, nisin and related lantibiotics use
the membrane-bound peptidoglycan precursor lipid II as a docking mol-
ecule for pore formation and, thus, cell wall synthesis is inhibited. Target
microorganisms may become in some measure resistant to the pore-forming
bacteriocins. The resistance may be transient or remain stable. Changes in
the membrane composition and fluidity and polysaccharide production are
examples of resistance mechanisms toward nisin (Martínez and Rodríguez,
2005). While in nisin-resistant mutants of L. monocytogenes an altered gene
expression was detected, resistance to class IIa bacteriocins has been related
to the absence of one of the components of the mannose transport system
(Naghmouchi et al., 2007).
A word of caution must be taken toward this topic since arguments depicted
by researchers devoted to these investigations rely on specific antibiotics
and pathogen strains. On the one hand, Martínez and Rodríguez (2005)
suggested that the development of nisin resistance in L. monocytogenes
would not hamper antibiotic therapy towards listeriosis based on β-lactam
treatment. As found in their study, nisin-resistant strains were more sus-
ceptible to β-lactams than the wild types; indeed, a higher sensitivity has
been frequently correlated to enhanced nisin resistance in L. monocytogenes
(Gravesen et al., 2001). On the other hand, Naghmouchi et al. (2006) found
an increased resistance of all L. monocytogenes bacteriocin-resistant vari-
ants to several antibiotics, which target different cellular sites. All variants
were more resistant to ampicillin, bacitracin, chloramphenicol, vancomy-
cin, and kanamycin than was the wild-type strain. These authors proposed
that increased resistance to these antibiotics may indicate that the compo-
sitional changes in the cell wall fraction of variants selected by exposure to
bacteriocin can also confer protection to other inhibitory substances such as
antibiotics.
It is well known that Gram-negative bacteria have natural resistance to nisin
due to the presence of the outer membrane; however, the use of chelating
agents, such as EDTA, allows for their sensitization. Nevertheless, Salmonella
can alter the composition and the structure of their lipopolysaccharide (LPS)
layer in response to changes in environmental conditions, diminishing their
sensitivity to bacteriocins, such as nisin. Prudêncio et al. (2015) demonstrated
and characterized tolerance to nisin combined with EDTA in S. Typhimurium
cultured under specific conditions of temperature and pH. In this study, it
was presumed that the modifications related to the tolerance phenotype of
The Use of Bacteriocins against Meat-borne Pathogens 583

nisin combined with EDTA possibly involve changes in the phospholipid

acyl chains, in the sugar content of LPS, and in the peptidoglycan present in
the cell wall. Arguably, these findings demonstrate the importance of better
understanding the behavior of the cells treated with nisin and EDTA, espe-
cially due to widespread use of this bacteriocin in food preservation.
Resistance to a bacteriocin may extend to other bacteriocins within the
same class or even in other classes (Naghmouchi et al., 2007). As an illustra-
tion, Kaur et al. (2013) determined that resistance to a bacteriocin extended
to other bacteriocins within the same class, e.g., Pediocin 34, conferred cross-
resistance to Enterocin FH 99 (class IIa bacteriocins) but not to nisin (class I).
The acquirement of resistance to bacteriocins can significantly affect physi-
ological activity, alter cell-envelope lipid composition, and modify the antibi-
otic susceptibility/resistance profile of L. monocytogenes. An interesting work
conducted by Macwana and Muriana (2012) took full advantage of this fact,
proposing a practical system for grouping LAB bacteriocins based on their
mode of action as determined by changes in inhibitory activity to spontane-
ously acquired BacR. Bacteriocin sensitive wild-type L. monocytogenes 39–2,
sensitive to five bacteriocins produced by three genera of LAB: pediocin PA-1
and pediocin Bac3 (Pediococcus), lacticin FS97 and lacticin FS56 (Lactococcus),
and curvaticin FS47 (Lactobacillus). Spontaneous BacR derivative of L. mono-
cytogenes 39–2 obtained by selective recovery against lacticin FS56 provided
complete resistance to the bacteriocin made by Lc. lactis FS56. The lacticin
FS56-resistant strain of L. monocytogenes 39–2 was also cross-resistant to cur-
vaticin FS47 and pediocin PA-1, but not to lacticinFS97 or pediocin Bac3. A
spontaneous mutation that renders a strain cross-resistant to different bacte-
riocins indicates that they share a common mechanism of resistance due to
similar modes of action of the bacteriocins. Furthermore, these authors also
proved that mixtures of bacteriocins of different modes of action provided
greater inhibition than mixtures of bacteriocins of the same mode of action.
This methodical approach to classify bacteriocins into functional groups
based on mechanism of resistance (i.e., mode of action) could be used for
identifying the best mixture of bacteriocins for use as biopreservatives.
In conclusion, the occurrence of bacteriocin-resistant variants of meatborne
pathogens, mainly L. monocytogenes and Salmonella spp., became evident in
the last decade (Naghmouchi et al., 2006, 2007; Collins et al., 2010; Macwana
and Muriana, 2012; Kaur et al., 2013). Knowledge of the features of classes I
and IIa bacteriocin-resistant variants and the conditions that prevent their
emergence will help to determine optimal conditions for bacteriocin applica-
tions in foods and minimize the incidence of resistance. Since bacteriocins
are regarded as potential tools for biopreservation, more study is needed to
determine the distribution of BacR phenomena among microorganisms that
cause food spoilage and among foodborne pathogens, especially L. monocy-
togenes. In addition, the relationship between acquiring resistance to bacte-
riocins and the pathogenicity of singly or multiply resistant L. monocytogenes
remains to be elucidated.
584 Advanced Technologies for Meat Processing, Second Edition

18.5 Overview of Actual Industrial Application

and Regulatory Aspects
In spite of the GRAS status that many (bacteriocinogenic) protective cul-
tures already have, only two LAB bacteriocins, i.e., nisin and pediocin PA-1,
have been authorized for the biopreservation of foods. Nisin is commercially
available as a dried concentrated powder called Nisaplin (Danisco, Copen-
hagen, Denmark) and was admitted into the European food additive list in
the early 1980s, where it was assigned the number E234 (EEC, 1983). In 1988,
nisin received GRAS status from the Food and Drug Administration (FDA)
(Federal Register, 1988), and is the only bacteriocin that has been approved
by the World Health Organization for use as a food preservative (Sobrino-
López and Martín-Belloso, 2008). Pediocin PA-1 is marketed as a bacterio-
cin-containing fermentate powder, namely ALTA®2351 (Kerry Bioscience,
Carrigaline, Co. Cork, Ireland) (Mills et al., 2011).
The authority under which a given bacteriocin will be regulated for use in
food will depend on the foods in which it is used and the purpose for which
it is used. International regulatory agencies have different criteria concern-
ing doses and food applications. For instance, an additional suitability
assessment by the U.S. Department of Agriculture’s (USDA) Food Safety and
Inspection Service (FSIS) is required for bacteriocins used in meat products.
According to the FAO/WHO Codex Alimentarius (2013), nisin—named as
INS 234 by this international organization—application in meats comprise
RTE products, such as hot dogs and smoked sausages, 25 ppm being the high-
est suggested concentration within the products. These regulations take into
account that nisin should be part of a multiple hurdle system where sodium
lactate or diacetate are added and aid the preservation. When talking about
nisin incorporation to a product, FAO/WHO experts consider that there is
an extra challenge for the meat industry: the equipment and the technology
necessary for the suitable packaging of the product, since the extensive use
of nisin implies external application immediately before packaging.
On the other hand, protective cultures from LAB have been included in the
manufacturing process of many RTE meat products; the legislation treat them
as food additives. The way they have to be incorporated, their concentration,
and shelf life of the final products are regulated by many international pub-
lic health organisms. The determination that specific strains of Carnobacte-
rium maltaromaticum are GRAS—on the basis of scientific procedures—can
be found as one example from the FDA Federal Register (62 FR 18937–18964,
2004). Cb. maltaromaticum strains CB1, CB2, CB3LV17, UAL26, ATCC 35586,
and ATCC43225 for use in RTE and fresh comminuted processed meat prod-
ucts, at a maximum inoculation concentration of l × l04 CFU/g, are meant
to be used as inhibitors of L. monocytogenes. Furthermore, commercial pro-
tective cultures are already marketed, comprised of a mixture of several
The Use of Bacteriocins against Meat-borne Pathogens 585

bacteriocinogenic cultures. For instance, the DuPont™ Danisco® protective

culture called HOLDBAC® Listeria can be added to semidry-cured meats
and cooked and fresh ground meats to inhibit the growth of the aforemen-
tioned pathogen.
In addition to the information given, the reader is invited to read Aymerich
et al. (2006), since neither regulations nor legislation related to biopreserva-
tion of meat and meat products have been substantially changed in the last
decade.

References
Aasen, I. M., Markussen, S., Moretro, T., Katla, T., Axelsson L. and Naterstad, L.
(2003). Interactions of the bacteriocin sakacin P and nisin with food constituents.
International Journal of Food Microbiology, 87, 35–43.
Ahmed, O. M., Pangloli, P., Hwang, C. A. et al. (2015). The occurrence of Listeria mono-
cytogenes in retail ready-to-eat meat and poultry products related to the levels of
acetate and lactate in the products. Food Control, 52, 43–48.
Albano, H., Pinho, C., Leite, D. et al. (2009). Evaluation of a bacteriocin-producing
strain of Pediococcus acidilactici as a biopreservative for “Alheira”, a fermented
meat sausage. Food Control, 20, 764–770.
Alves, V. F., Martinez, R. C. R., Lavrador, M. A. S. and De Martinis, E. C. P. (2006).
Antilisterial activity of lactic acid bacteria inoculated on cooked ham. Meat Sci-
ence, 74, 623–627.
Aly, S., Floury, J., Famelart, M. H. et al. (2011). Nisin quantification by ELISA allows
the modeling of its apparent diffusion coefficient in model cheeses. Journal of
Agricultural and Food Chemistry, 59, 9484–9490.
Ananou, S., Baños, A., Maqueda, M., Martínez-Bueno, M., Gálvez, A. and Valdivia,
E. (2010a). Effect of combined physico-chemical treatments based on enterocin
AS-48 on the control of Listeria monocytogenes and Staphylococcus aureus in a
model cooked ham. Food Control, 21, 478–486.
Ananou, S., Garriga, M., Jofré, A. et al. (2010b). Combined effect of enterocin AS-48
and high hydrostatic pressure to control food-borne pathogens inoculated in
low acid fermented sausages. Meat Science, 84, 594–600.
Ananou, S., Maqueda, M., Martínez-Bueno, M., Gálvez, A. and Valdivia, E. (2005).
Control of Staphylococcus aureus in sausages by enterocin AS-48. Meat Science,
71, 549–556.
Ananou, S., Valdivia, E., Martínez-Bueno, M., Gálvez, A. and Maqueda, M. (2004).
Effect of combined physico-chemical preservatives on enterocin AS-48 activ-
ity against the enterotoxigenic Staphylococcus aureus CECT 976 strain. Journal of
Applied Microbiology, 97, 48–56.
Aymerich, T., Garriga, M., Jofré, A., Martín, B. and Monfort, J. M. (2006a). The use
of bacteriocins against meat-borne pathogens. In: Nollet, L. M. L. and Toldra,
F. (eds.) Advanced Technologies for Meat Processing, Chapter 15. New York, NY:
Taylor & Francis Group LLC, pp. 371–399.
586 Advanced Technologies for Meat Processing, Second Edition

Aymerich, T., Martín, B., Garriga, M., Vidal-Carou, M. C., Bover-Cid, S. and Hugas,
M. (2006b). Safety properties and molecular strain typing of lactic acid
bacteria from slightly fermented sausages. Journal of Applied Microbiology,
100, 40–49.
Aymerich, T., Picouet, P. A. and Monfort, J. M. (2008). Decontamination technologies
for meat products. Meat Science, 78, 114–129.
Bani-Jaber, A., McGuire, J., Ayres, J. W. and Daeschel, M. A. (2000). Efficacy of the
antimicrobial peptide nisin in emulsifying oil in water. Journal of Food Science,
65, 502–506.
Benito, M. J., Martín, A., Aranda, E., Pérez-Nevado, F., Ruiz-Moyano, S. and Córdoba,
M. (2007). Characterization and selection of autochthonous lactic acid bacteria
isolated from traditional Iberian dry-fermented salchichón and chorizo sau-
sages. Journal of Food Science, 72, 193–201.
Benkerroum, N., Daoudi, A., Hamraoui, T. et al. (2005). Lyophilized preparations
of bacteriocinogenic Lactobacillus curvatus and Lactococcus lactis subsp. lactis as
potential protective adjuncts to control Listeria monocytogenes in dry-fermented
sausages. Journal of Applied Microbiology, 98, 56–63.
Blanco Massani, M., Molina, V., Sanchez, M., Renaud, V., Eisenberg, P. and Vignolo,
G. (2014). Active polymers containing Lactobacillus curvatus CRL705 bacterio-
cins: Effectiveness assessment in Wieners. International Journal of Food Micro-
biology. 178, 7–12.
Borch, E., Kant-Muermans, M. and Blixt, Y. (1996). Bacterial spoilage of meat and
cured meat products. International Journal of Food Microbiology, 33, 103–120.
Bredholt, S., Nesbakken, T. and Holck, A. (1999). Protective cultures inhibit growth
of Listeria monocytogenes and Escherichia coli O157:H7 in cooked, sliced, vacuum-
and gas-packaged meat. International Journal of Food Microbiology, 53, 43–52.
Brocklehurst, T. F., Parker, M. L., Gunning, P. A. and Robins, M. M. (1993). Microbiol-
ogy of emulsions: Physicochemical aspects. Lipid Technology, 83–88.
Campos, C. A., Gerschenson, L. N. and Flores, S. K. (2011). Development of edible
films and coatings with antimicrobial activity. Food and Bioprocess Technology,
4(6), 849–875.
Carlini, N., Mogna, L., and Strozzi, G. P. (2010). Reducing foodborne pathogens in
the food chain by the use of protective and probiotic cultures. In J. Rovira (Ed.),
How to Improve the Food Safety of My Products? Madrid, Spain: International
Marketing & Communication, pp. 73–88.
Casaburi, A., Di Martino, V., Ferranti, P., Picariello, L. and Villani, F. (2016). Techno-
logical properties and bacteriocins production by Lactobacillus curvatus 54M16
and its use as starter culture for fermented sausage manufacture. Food Control,
59, 31–45.
Casquete, R., Benito, M. J., Martín, A., Ruiz-Moyano, S., Aranda, E. and Córdoba,
M. G. (2012). Microbiological quality of salchichón and chorizo, traditional
Iberian dry-fermented sausages from two different industries, inoculated with
autochthonous starter cultures. Food Control, 24, 191–198.
Castellano, P., Belfiore, C., Fadda, S. and Vignolo, G. (2008). A review of bacteriocino-
genic lactic acid bacteria used as bioprotective cultures in fresh meat produced
in Argentina. Meat Science, 79, 483–499.
Castellano, P., Belfiore, C. and Vignolo, G. (2011). Combination of bioprotective
cultures with EDTA to reduce Escherichia coli O157:H7 in frozen ground-beef
patties. Food Control, 22, 1461–1465.
The Use of Bacteriocins against Meat-borne Pathogens 587

Castellano, P., González, C., Carduza, F. and Vignolo, G. (2010). Protective action of
Lactobacillus curvatus CRL 705 on vacuum-packaged raw beef. Effect on sensory
and structural characteristics. Meat Science, 85, 394–401.
Castellano, P. and Vignolo, G. (2006). Inhibition of Listeria innocua and Brochothrix ther-
mosphacta in vacuum-packaged meat by addition of bacteriocinogenic Lactobacillus
curvatus CRL705 and its bacteriocins. Letters in Applied Microbiology, 43, 194–199.
Castro, M. P., Garro, O., Gerschenson, L. N. and Campos, C. A. (2003). Interaction
between potassium sorbate, oil and Tween 20 on the growth and inhibition of
Z. bailii in model salad dressings. Journal of Food Safety, 23, 47–59.
Centers for Disease Control and Prevention (2015). Centers for disease control and
prevention, outbreak surveillance data. Available at http://www.cdc.gov/food-
safety/outbreaks/investigating-outbreaks/index.html (accessed January 2015).
Chaillou, S., Christieans, S., Rivollier, M., Lucquin, I., Champomier-Vergès, M. C. and
Zagorec, M. (2014). Quantification and efficiency of Lactobacillus sakei strain mix-
tures used as protective cultures in ground beef. Meat Science, 97, 332–338.
Chakchouk-Mtibaa, A., Elleuch, L., Smaoui, S. et al. (2014). Characterization of the bac-
teriocin BacJ1 and its effectiveness for the inactivation of Salmonella typhimurium
during turkey escalope storage. Food Chemistry, 152, 566–572.
Codex Alimentarius. (2013). FAO/OMS. Secretariat of the Codex Alimentarius Commis-
sion. Roma, Italia. Available at http://www.fao.org/3/a-i3243s.pdf.
Collins, B., Curtis, N., Cotter, P. D., Hill, C. and Ross, R. P. (2010). The ABC transporter
AnrAB contributes to the innate resistance of Listeria monocytogenesto nisin, bac-
itracin, and various β-lactam antibiotics. Antimicrobial Agents and Chemotherapy,
54, 4416–4423.
Coma, V. (2008). Bioactive packaging technologies for extended shelf life of meat-
based products. Meat Science, 78, 90–103.
D Aoust, J. I. (1997). Salmonella species. In: Doyle, M. P., Beuchat, L. R. and Montville,
T. J. (eds.) Food Microbiology. Fundamentals and Frontiers. Washington, DC: ASM
Press, pp. 129–158.
da Silva Sabo, S., Vitolo, M., Domínguez González, J. M. and Pinheiro de Souza
Oliveira, R. (2014). Overview of Lactobacillus plantarum as a promising bacterio-
cin producer among lactic acid bacteria. Food Research International, 64, 527–536.
Dave, D. and Ghaly, A. E. (2011). Meat spoilage mechanisms and preservation tech-
niques: A critical review. American Journal of Agricultural and Biological Sciences,
6(4), 486–510.
de Souza Barbosa, M., Todorov, S. D., Ivanova, I., Chobert, J-M., Haertle, T. and Gom-
bossy de Melo Franco, B. D. (2015). Improving safety of salami by application of
bacteriocins produced by an autochthonous Lactobacillus curvatus isolate. Food
Microbiology, 46, 254–262.
Dods, K. L. and Austin, J. W. (1997). Clostridium botulinum. In: Doyle, M. P., Beuchat,
L. R. and Montville, T. J. (eds.) Food Microbiology. Fundamentals and Frontiers.
Washington, DC: ASM Press, pp. 288–304.
Dominic Dussault, D., Vu, K. D. and Lacroix, M. (2016). Development of a model
describing the inhibitory effect of selected preservatives on the growth of Liste-
ria monocytogenes in a meat model system. Food Microbiology, 53, 115–121.
Dortu, C., Huch, M., Holzapfel, W. H., Franz, C. M. A. P. and Thonart, P. (2008). Anti-
listerial activity of bacteriocin-producing Lactobacillus curvatus CWBI-B28 and
Lactobacillus sakei CWBI-B1365 on raw beef and poultry meat. Journal of Applied
Microbiology, 47, 581–586.
588 Advanced Technologies for Meat Processing, Second Edition

Doyle, M. P., Zhao, T., Meng, J. and Zhao, S. (1997). Escherichia coli O157:H7. In: Doyle,
M. P., Beuchat, L. R. and Montville, T. J. (eds.) Food Microbiology. Fundamentals
and Frontiers. Washington, DC: ASM Press, pp. 171–191.
Drosinos, E. H., Mataragas, M., Vesković -Morač anin, S., Gasparik-Reichardt, J.,
Hadžiosmanović , M. and Alagić , D. (2006). Quantifying nonthermal inac-
tivation of Listeria monocytogenes in European fermented sausages using bac-
teriocinogenic lactic acid bacteria or their bacteriocins: A case study for risk
assessment. Journal of Food Protection, 69, 648–2663.
Dykes, G. A. and Hastings, J. W. (1998). Fitness costs associated with class IIa bacterio-
cin resistance in Listeria monocytogenes B73. Letters in Applied Microbiology, 26, 1–5.
EC, European Parliament and Council of the European Community. (2005). Commis-
sion Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological
criteria for foodstuffs. Official Journal of the European Union, L338, 1–26. Brussels,
Belgium.
European Food Safety Authority (EFSA). (2007). The community summary report of
trends and sources of zoonoses, zoonotic agents, antimicrobial resistances and
foodborne outbreaks in the European Union in 2006. EFSA Journal, 130, 3−352.
Available at http://www.efsa.europa.eu/cs/BlobServer/DocumentSet/Zoon-
report2006en,0.pdf?ssbinary=true (accessed October 2009).
European Food Safety Authority (EFSA). (2010). Analysis of the baseline survey on
the prevalence of Campylobacter in broiler batches and of Campylobacter and
Salmonella on broiler carcasses in the EU, 2008. European Food Safety Author-
ity, Italy. EFSA Journal, 8, 3, 1503.
El-Ziney, M. G., van den Temple, T., Debevere, J. and Jakobsen, M. (1999). Application
of reuterin produced by Lactobacillus reuteri 12002 for meat decontamination
and preservation. Journal of Food Protection, 62, 257–261.
Ennahar, S., Sashihara, T., Sonomoto, K. and Ishizaki, A. (2000). Class IIa bacteriocins:
Biosynthesis, structure and activity. FEMS Microbiology Reviews, 24, 85–106.
European Commission. (EEC). (1983). Commission Directive 83/463/EEC 22 of July
introducing temporary measures for the designation of certain ingredients in
the labeling of foodstuffs for sale to the ultimate consumer. Official Journal of
European Communities, L255, 1–6.
European Food Safety Authority. (2015). The European Union summary report on
trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in
2013. European Food Safety Authority Journal, 2015(13), 3991. Available at http://
ecdc.europa.eu/en/publications/Publications/EU-summary-report-trends-
sources-zoonoses-2013.pdf.
Federal Register. (1988). Nisin preparation: Affirmation of GRAS status as a direct
human food ingredient. Federal Register, 53, 11247–11251.
Ferreira, V., Barbosa, J., Silva, J. et al. (2007). Chemical and microbiological charac-
terization of “Salpicão de Vinhais” and “Chouriça de Vinhais”: Traditional dry
sausages produced in the North of Portugal. Food Microbiology, 24, 618–623.
Gadang, V. P., Hettiarachchy, N. S., Johnson, M. G. and Owens, C. (2008). Evaluation
of antibacterial activity of whey protein isolate coating incorporated with nisin,
grape seed extract, malic acid, and EDTA on a Turkey frankfurter system. Jour-
nal of Food Science, 73, M389–M394.
Gálvez, A., Abriouel, H., López, R. L. et al. (2007). Bacteriocin-based strategies for
food biopreservation. International Journal of Food Microbiology, 120, 51–70.
The Use of Bacteriocins against Meat-borne Pathogens 589

Gao, Y., Jia, S., Gao, Q. and Tan, Z. (2010). A novel bacteriocin with a broad inhibitory
spectrum produced by Lactobacillus sake C2, isolated from traditional Chinese
fermented cabbage. Food Control, 21, 76–81.
Gao, Y., Li, D. and Liu, X. (2014). Bacteriocin-producing Lactobacillus sakei C2 as starter
culture in fermented sausages. Food Control, 35, 1–6.
Gao, Y., Li, D., Liu, S. and Liu, Y. (2012). Probiotic potential of L. sake C2 isolated from
traditional Chinese fermented cabbage. European Food Research and Technology,
234, 45–51.
Garrido, V., Vitas, A. I. and García-Jalón, I. (2009). Survey of Gisteria monocytogenes in
ready-to-eat products: Prevalence by brands and retail establishments for expo-
sure assessment of listeriosis in Northern Spain. Food Control, 20, 986−991.
Georgaras, I., Panagiotis, N., Skandamis, N. et al. (2006). Post-processing application
of chemical solutions for control of Listeria monocytogenes, cultured under dif-
ferent conditions on commercial smoked sausage formulated with and without
lactate-sodium diacetate. Food Microbiology, 23, 762–771.
Gialamas, H., Zinoviadou, K., Biliaderis, C. and Koutsoumanis, K. (2010). Develop-
ment of a novel bioactive packaging based on the incorporation of Lactobacillus
sakei into sodium-caseinate films for controlling Listeria monocytogenes in foods.
Food Research International, 43, 2402–2408.
Gill, A. O. and Holley, R. A. (2000). Inhibition of bacterial growth on ham and bologna
by lysozyme, nisin and EDTA. Food Research International, 33, 83–90.
Gombas, D. E., Chen, Y., Clavero, R. S. and Scott, V. N. (2003). Survey of Listeria mono-
cytogenes in ready-to-eat foods. Journal of Food Protection, 66, 459−469.
Govaris, A., Solomakos, N., Pexara, A. and Chatzopoulou, P. S. (2010). The antimicro-
bial effect of oregano essential oil, nisin and their combination against Salmo-
nella Enteritidis in minced sheep meat during refrigerated storage. International
Journal of Food Microbiology, 137, 175–180.
Gravesen, A., Axelsen, A., da Silva, J. M., Hansen, T. B. and Knøchel, S. (2002). Fre-
quency of bacteriocin resistance development and associated fitness costs in Lis-
teria monocytogenes. Applied and Environmental Microbiology, 68, 756–764.
Gravesen, A., Sorensen, K., Aarestrup, F. M. and Knochel, S. (2001). Spontaneous
nisin-resistant Listeria monocytogenes mutants with increased expression of a
putative penicillin-binding protein and their sensitivity to various antibiotics.
Microbial Drug Resistance, 7, 127–135.
Gudbjornsdottir, B., Suihko, M. L., Gustavsson, P. et al. (2004). The incidence of Listeria
monocytogenes in meat, poultry and seafood plants in the Nordic countries. Food
Microbiology, 21, 217−225.
Hampikyan, H. and Ugur, M. (2007). The effect of nisin on L. monocytogenes in Turkish
fermented sausages (sucuks). Meat Science, 76, 327–332.
Hanlin, M. B., Kalchayanand, P. B. and Ray, B. (1993). Bacteriocins of lactic acid bac-
teria in combination have greater antibacterial activity. Journal of Food Protection,
56, 252–255.
Hartmann, H. A., Wilke, T. and Erdmann, R. (2011). Efficacy of bacteriocin-containing
cell-free culture supernatants from lactic acid bacteria to control Listeria monocy-
togenes in food. International Journal of Food Microbiology, 146, 192–199.
Hereu, A., Bover-Cid, A., Garriga, M. and Aymerich, T. (2012). High hydrostatic pres-
sure and biopreservation of dry-cured ham to meet the Food Safety Objectives
for Listeria monocytogenes. International Journal of Food Microbiology, 154, 107–112.
590 Advanced Technologies for Meat Processing, Second Edition

Holzapfel, W. H., Geisen, R. and Schillinger, U. (1995). Biological preservation of foods

with reference to protective cultures, bacteriocins and food-grade enzymes.
International Journal of Food Microbiology, 24, 343–362.
Hugas, M., Pages, F., Garriga, M. and Monfort, J. M. (1998). Application of the bacte-
riocinogenic Lactobacillus sakei CTC494 to prevent growth of Listeria in fresh and
cooked meat products packed with different atmospheres. Food Microbiology,
15(6), 639–650.
Hugo, C. J. and Hugo, A. (2015). Current trends in natural preservatives for fresh
sausage products. Trends in Food Science and Technology, 45, 12–23.
Jacobsen, T., Budde, B. B. and Koch, A. G. (2003). Application of Leuconostoc carno-
sum for biopreservation of cooked meat products. Journal of Applied Microbiology,
95(2), 242–249.
Janes, M. E., Kooshesh, S. and Johnson, M. G. (2002). Control of Listeria monocyto-
genes on the surface of refrigerated, ready-to-eat chicken coated with edible
zein film coatings containing nisin and/or calcium propionate. Journal of Food
Science, 67, 2754–2757.
Jeanson, S., Chadoeuf, J., Madec, M. N. et al. (2011). Spatial distribution of bacte-
rial colonies in a model cheese. Applied and Environmental Microbiology, 77(4),
1493–1500.
Jofré, A., Aymerich, T. and Garriga, M. (2009). Improvement of the food safety of low
acid fermented sausages by enterocins A and B and high pressure. Food Control,
20, 179–184.
Jofré, A., Garriga, M. and Aymerich, T. (2008). Inhibition of Salmonella sp., Listeria
monocytogenes and Staphylococcus aureus in cooked ham by combining antimi-
crobials, high hydrostatic pressure and refrigeration. Meat Science, 78, 53–59.
Jones, R., Wiklund, E., Zagorec, M. and Tagg, J. (2010). Evaluation of stored lamb
bio-preserved using a three-strain cocktail of Lactobacillus sakei. Meat Science, 86,
955–959.
Jones, R., Zagorec, M., Brightwell, G. and Tagg, J. (2009). Inhibition by Lactobacillus
sakei of other species in the flora of vacuum packaged raw meats during pro-
longed storage. Food Microbiology, 26, 876–881.
Juncioni de Arauza, L., Faustino Jozala, A., GavaMazzola, P. and Vessoni Penna, T. C.
(2009). Nisin biotechnological production and application: A review. Trends in
Food Science and Technology, 20, 146–154.
Juneja, V. K., Dwivedi, H. P. and Yan, X. (2012). Novel natural food antimicrobials.
Annual Reviews in Food Science and Technology, 3, 381–403.
Kaur, G., Singh T. P. and Malik, R. K. (2013). Antibacterial efficacy of Nisin, Pediocin
34 and Enterocin FH99 against Listeria monocytogenes and cross resistance of its
bacteriocin resistant variants to common food preservatives. Brazilian Journal of
Microbiology, 44(1), 63–71.
Kapetanakou, A. E., Karyotis, D. and Skandamis, P. N. (2016). Control of Listeria
monocytogenes by applying ethanol-based antimicrobial edible films on ham
slices and microwave-reheated frankfurters. Food Microbiology, 54, 80–90.
Khan, H., Flint, S. and Yu, P.-L. (2010). Enterocins in food preservation. International
Journal of Food Microbiology, 141, 1–10.
Kostrzynska, M. and Bachand, A. (2006). Use of microbial antagonism to reduce
pathogen levels on produce and meat products: A review. Canadian Journal of
Microbiology, 52, 1017–1026.
The Use of Bacteriocins against Meat-borne Pathogens 591

Kouakou, P., Ghalfi, H., Destain, J., Duboisdauphin, R., Evrard P. and Thonart, P.
(2008). Enhancing the antilisterial effect of Lactobacillus curvatus CWBI-B28 in
pork meat and cocultures by limiting bacteriocin degradation. Meat Science, 80,
640–648.
Kouakou, P., Ghalfi, H., Destain, J., Dubois-Dauphin, R., Evrard, P. and Thonart, P.
(2009). Effects of curing sodium nitrite additive and natural meat fat on growth
control of Listeria monocytogenes by the bacteriocin-producing Lactobacillus cur-
vatus strain CWBI-B28. Food Microbiology, 26, 623–628.
Kouakou, P., Ghalfi, H., Dortu, C., Evrard, P. and Thonart, P. (2010). Combined use
of bacteriocin-producing strains to control Listeria monocytogenes regrowth
in raw pork meat. International Journal of Food Science and Technology, 45,
937–943.
Kuleasan, H. and Cakmakei, M. L. (2002). Effect of reuterin produced by Lactobacillus
reuteri on the surface of sausages to inhibit the growth of Listeria monocytogenes
and Salmonella spp. Nahrung, 46, 408–410.
Leroy, F. and De Vuyst, L. (2005). Simulation of the effect of sausage ingredients and
technology on the functionality of the bacteriocin-producing Lactobacillus sakei
CTC 494 strain. International Journal of Food Microbiology, 100, 141–152.
Liu, G., Wang, Y., Gui, M., Zheng, H., Dai, R. and Li, P. (2012). Combined effect of high
hydrostatic pressure and enterocin LM-2 on the refrigerated shelf life of ready-
to-eat sliced vacuum-packed cooked ham. Food Control, 24, 64–71.
Lücke, F. K. (2000). Utilization of microbes to process and preserve meat. Meat Science,
56, 105–115.
Lues, J. F. R. and Van Tonder, I. (2007). The occurrence of indicator bacteria on hands
and aprons of food handlers in the delicatessen sections of a retail group. Food
Control, 18, 326−332.
Macwana, S. and Muriana, P. M. (2012). Spontaneous bacteriocin resistance in Listeria
monocytogenes as a susceptibility screen for identifying different mechanisms of
resistance and modes of action by bacteriocins of lactic acid bacteria. Journal of
Microbiological Methods, 88, 7–13.
Maragkoudakis, P. A., Mountzouris, K. C., Psyrras, D. et al. (2009). Functional proper-
ties of novel protective lactic acid bacteria and application in raw chicken meat
against Listeria monocytogenes and Salmonella enteritidis. International Journal of
Food Microbiology, 130, 219–226.
Martínez, B. and Rodríguez, A. (2005). Antimicrobial susceptibility of nisin resistant
Listeria monocytogenes of dairy origin. FEMS Microbiology Letters, 252, 67–72.
Mataragas, M., Drosinos, E. H. and Metaxopoulos, J. (2003). Antagonistic activity of
lactic acid bacteria against Listeria monocytogenes in sliced cooked cured pork
shoulder stored under vacuum or modified atmosphere at 4 ± 2°C. Food Micro-
biology, 20, 259–265.
MCClane, B. A. (1997). Clostridium perfringens. In: Doyle, M. P., Beuchat, L. R. and
Montville, T. J. (eds.) Food Microbiology. Fundamentals and Frontiers. Washington,
DC: ASM Press, pp. 305–326.
Melero, B., Diez, A. M., Rajkovic, A., Jaime, I. and Rovira, J. (2012). Behaviour of
non-stressed and stressed Listeria monocytogenes and Campylobacter jejuni cells
on fresh chicken burger meat packaged under modified atmosphere and inoc-
ulated with protective culture. International Journal of Food Microbiology, 158,
107–112.
592 Advanced Technologies for Meat Processing, Second Edition

Melero, B., Vinuesa, R., Diez, A. M., Jaime, I. and Rovira, J. (2013). Application of
protective cultures against Listeria monocytogenes and Campylobacter jejuni in
chicken products packaged under modified atmosphere. Poultry Science, 92,
1108–1116.
Melo, R. T., Nalevaiko, P. C., Mendonça, E. P. et al. (2013). Campylobacter jejuni strains
isolated from chicken meat harbour several virulence factors and represent a
potential risk to humans. Food Control, 33, 227–231.
Millette, M., Le Tien, C., Smoragiewicz, W. and Lacroix, M. (2007). Inhibition of Staph-
ylococcus aureus on beef by nisin-containing modified alginate films and beads.
Food Control, 18, 878–884.
Mills, S., Stanton, C., Hill, C. and Ross, R. P. (2011). New developments and applica-
tions of bacteriocins and peptides in foods. Annual Review of Food Science and
Technology, 2, 299–329.
Min, B. J., Han, I. Y. and Dawson, P. L. (2010). Antimicrobial gelatin films reduce Liste-
ria monocytogenes on turkey bologna. Poultry Science, 89, 1307–1314.
Moore, J. E. (2004). Gastrointestinal outbreaks associated with fermented meats. Meat
Science, 67, 565–568.
Muñoz, A., Ananou, S., Gálvez, A. et al. (2007). Inhibition of Staphylococcus aureus in
dairy products by enterocin AS-48 produced in situ and ex situ: Bactericidal
synergism with heat. International Dairy Journal, 17, 760–769.
Naghmouchi, K., Drider, D., Kheadr, E., Lacroix, C., Prévost, H. and Fliss, I. (2006).
Multiple characterizations of Listeria monocytogenes sensitive and insensitive
variants to divergicin M35, a new pediocin-like bacteriocin. Journal of Applied
Microbiology, 10, 29–39.
Naghmouchi, K., Kheadr, E., Lacroix, C. and Fliss, I. (2007). Class I/Class IIa bacte-
riocin cross-resistance phenomenon in Listeria monocytogenes. Food Microbiology,
24, 718–727.
Nguyen, V. T., Gidley, M .J. and Dykes, G. A. (2008). Potential of a nisin-containing
bacterial cellulose film to inhibit Listeria monocytogenes on processed meats.
Food Microbiology, 25, 471–478.
Nieto-Lozano, J. C., Reguera-Useros, J. I., Peláez-Martínez, M. C. and Hardisson de
la Torre, A. (2006). Effect of a bacteriocin produced by Pediococcus acidilactici
against Listeria monocytogenes and Clostridium perfringens on Spanish raw meat.
Meat Science, 72, 57–61.
Nieto-Lozano, J. C., Reguera-Useros, J. I., Peláez-Martínez, M. C., Sacristán-Pérez-
Minayo, G., Gutiérrez-Fernández, A. J. and Hardisson de la Torre, A. (2010). The
effect of the pediocin PA-1 produced by Pediococcus acidilactici against Listeria
monocytogenes and Clostridium perfringens in Spanish dry-fermented sausages
and frankfurters. Food Control, 21, 679–685.
Nilsen, T., Nes, I. F. and Holo, H. (1998). An exported inducer peptide regulates bac-
teriocin production in Enterococcus faecium CTC 492. Journal of Bacteriology, 180,
1848–1854.
Norrung, B. and Buncic, S. (2008). Microbial safety of meat in the European Union.
Meat Science, 78, 14−24.
Nychas, G. J. E., Skandamis, P. N., Tassou, C. C. and Koutsoumanis, K. P. (2008). Meat
spoilage during distribution. Meat Science, 78, 77–89.
Okereke, A. and Montville, T. J. (1991). Bacteriocin-mediated inhibition of Clostridium
botulinum spores by lactic acid bacteria at refrigeration and abuse temperatures.
Applied and Environmental Microbiology, 57, 3423–3428.
The Use of Bacteriocins against Meat-borne Pathogens 593

Orsi, R. H., den Bakker, H. C. and Wiedmann, M. (2011). Listeria monocytogenes lin-
eages: Genomics, evolution, ecology, and phenotypic characteristics. Interna-
tional Journal of Medical Microbiology, 301, 79–96.
Osés, S., Diez A., Gómez, E., et al. (2015). Control of Escherichia coli and Listeria mono-
cytogenes in suckling-lamb meat evaluated using microbial challenge tests. Meat
Science, 110, 262–269.
Pattanayaiying, R. H-Kittikun, A. and Cutter, C. N. (2015). Incorporation of nisin Z
and lauric arginate into pullulan films to inhibit foodborne pathogens associ-
ated with fresh and ready-to-eat muscle foods. International Journal of Food
Microbiology, 207, 77–82.
Pawar, D. D., Malik, S. V. S., Bhilegaonkar, K. N. and Barbuddhe, S. B. (2000). Effect of
nisin and its combination with sodium chloride on the survival of Listeria mono-
cytogenes added to raw buffalo meat mince. Meat Science, 56, 215–219.
Pérez-Rodríguez, F., Castro, R., Posada-Izquierdo, G. D. et al. (2010). Evaluation of
hygiene practices and microbiological quality of cooked meat products during
slicing and handling at retail. Meat Science, 86, 479–485.
Pérez-Rodríguez, F., van Asselt, E. D., García-Gimeno, R. M., Zurera, G. and Zwieter-
ing, M. H. (2007). Extracting additional risk managers information from a risk
assessment of Listeria monocytogenes in deli meats. Journal of Food Protection, 70,
1137−1152.
Prudêncio, C. V., Vanetti, M. C. D. and Prieto, M. (2015). Tolerance of Salmonella
enteric serovar Typhimurium to nisin combined with EDTA is accompanied by
changes in cellular composition. Food Research International, 69, 281–288.
Public Health Agency of Canada (PHAC). (2008). Listeria Monocytogenes Outbreak.
Available at http://www.phac-aspc.gc.ca/alert-alerte/listeria/listeria_2008-
eng.php (accessed October 2009).
Ravyts, F., Barbuti, S., Frustoli, M. A. et al. (2008). Competitiveness and antibacte-
rial potential of bacteriocin-producing starter cultures in different types of fer-
mented sausages. Journal of Food Protection, 71, 1817–1827.
Ray, B. and Bhunia, A. (2014). Fundamental Food Microbiology. Boca Raton, FL: CRC
Press/Taylor & Francis.
Rivas, F. P., Castro, M. P., Vallejo, M., Marguet, E. and Campos, C. A. (2014). Sakacin
Q produced by Lactobacillus curvatus ACU-1: Functionality characterization and
antilisterial activity on cooked meat surface. Meat Science, 97(4), 475–479.
Rocourt, J. and Cossart, P. (1997). Listeria monocytogenes. In: Doyle, M. P., Beuchat,
L. R. and Montville, T. J. (eds.) Food Microbiology. Fundamentals and Frontiers.
Washington, DC: ASM Press, pp. 337–352.
Rodgers, S., Peiris, P. and Casadei, G. (2003). Inhibition of nonproteolytic Clostridium
botulinum with lactic acid bacteria and their bacteriocins at refrigeration tem-
peratures. Journal of Food Protection, 66, 674–678.
Roller, S., Sagoo, S., Board, R. et al. (2002). Novel combinations of chitosan, carnocin and
sulphite for the preservation of chilled pork sausages. Meat Science, 62, 165–177.
Rubio, R., Bover-Cid, S., Martín, B., Garriga, M. and Aymerich, T. (2013). Assessment
of safe enterococci as bioprotective cultures in low-acid fermented sausages
combined with high hydrostatic pressure. Food Microbiology, 33, 158–165.
Samelis, J., Kakouri, A. and Rementzis, J. (2000). Selective effect of the product type
and the packaging conditions on the species of lactic acid bacteria dominating
the spoilage microbial association of cooked meats at 4°C. Food Microbiology,
17, 329–340.
594 Advanced Technologies for Meat Processing, Second Edition

Samelis, J. and Metaxopoulos, J. (1999). Incidence and principal sources of Listeria

spp. and Listeria monocytogenes contamination in processed meats and a meat
processing plant. Food Microbiology, 16, 465–477.
Santiago-Silva, P., Soares, N. F .F., Nóbrega, J. E. Júnior, M. A. W. Barbosa, K. B. F.,
Volp, A. C. P., Zerdas, E. R. M. A. and Würlitzer, N. J. (2009).Antimicrobial effi-
ciency of film incorporated with pediocin (ALTAÒ 2351) on preservation of
sliced ham. Food Control, 20, 85–89.
Scallan, E., Hoekstra, R. M., Angulo, F. J. et al. (2011). Food borne illness acquired in
the United States—Major pathogens. Emerging Infectious Diseases, 17, 7–15.
Scannell, A. G. M., Ross, R. P., Hill, C. and Arendt, E. K. (2000). An effective lacticin
biopreservative in fresh pork sausage. Journal of Food Protection, 63, 370–375.
Sobrino-López, A. and Martín-Belloso, O. (2008). Use of nisin and other bacteriocins
for preservation of dairy products. International Dairy Journal, 18, 329–343.
Solomakos, N., Govaris, A., Koidis, P. and Botsoglou, N. (2008). The antimicrobial
effect of thyme essential oil, nisin and their combination against Listeria monocy-
togenes in minced beef during refrigerated storage. Food Microbiology, 25, 120–127.
Stergiou, V. A., Thomas, L. V. and Adams, M. R. (2006). Interactions of nisin with
glutathione in a model protein system and meat. Journal of Food Protection, 69,
951–956.
Stiles, M. E. (1996). Biopreservation by lactic acid bacteria. Anton van Leeuwenhoek, 70,
331–345.
Swaminathan, B. and Gerner-Smidt, P. (2007). The epidemiology of human listeriosis.
Microbes Infections, 9, 1236–1243.
Talon, R., Leroy, S., Lebert, I. et al. (2008). Safety improvement and preservation of
typical sensory qualities of traditional dry fermented sausages using autoch-
thonous starter cultures. International Journal of Food Microbiology, 126, 227–234.
Teramoto, H., Salaheen, S. and Biswas, D. (2016). Contamination of post-harvest poul-
try products with multidrug resistant Staphylococcus aureus in Maryland-Wash-
ington DC metro area. Food Control, 65, 132–135.
Theivendran, S., Hettiarachchy, N. S. and Johnson, M. G. (2006). Inhibition of Listeria
monocytogenes by nisin combined with grape seed extract or green tea extract
in soy protein film coated on turkey frankfurters. Journal of Food Science, 71(2),
39–44.
Thomas, L. V., Clarkson, M. R. and Delves-Broughton, J. (2000). Nisin. In: Naidu, A. S.
(ed.) Natural Food Antimicrobial Systems. Boca Raton, FL: CRC-Press, 463–524.
Urso, R., Comi, G. and Cocolin, L. (2006a). Ecology of lactic acid bacteria in Italian
fermented sausages: Isolation, identification and molecular characterization.
Systematic and Applied Microbiology, 29, 671–680.
Urso, R., Rantsiou, K., Cantoni, C., Comi, G. and Cocolin, L. (2006b). Technologi-
cal characterization of a bacteriocin-producing Lactobacillus sakei and its use in
fermented sausages production. International Journal of Food Microbiology, 110,
232–239.
Uyttendaele, M., De Troy, P. and Debevere, J. (1999). Incidence of Listeria monocyto-
genes in different types of meat products on the Belgian retail market. Interna-
tional Journal of Food Microbiology, 53(1), 75–80.
Vermeiren, L., Devlieghere, F. and Debevere, J. (2004). Evaluation of meat born lactic
acid bacteria as protective cultures for the biopreservation of cooked meat prod-
ucts. International Journal of Food Microbiology, 96, 149–164.
The Use of Bacteriocins against Meat-borne Pathogens 595

Vesković Morač anin, S. M., Ðukić , D. A. and Memiši, N. R. (2014). Bacteriocins pro-
duced by lactic acid bacteria—A review. Acta periodica technologica, 45, 271–283.
Violaris, Y., Bridges, O. and Bridges, J. (2008). Small businesses—Big risks: Current
status and future direction of HACCP in Cyprus. Food Control, 19, 439−448.
Vorst, K. L., Todd, E. C. D. and Ryser, E. T. (2006). Transfer of Listeria monocytogenes
during mechanical slicing of turkey, bologna, and salami. Journal of Food Protec-
tion, 69, 619−626.
Wilson, P. D. G., Brocklehurst, T. F., Arino, S. et al. (2002). Modelling microbial growth
in structured foods: Towards a unified approach. International Journal of Food
Microbiology, 73, 275–289.
Wimpenny, J. W. T., Leistner, L., Thomas, L. V., Mitchell, A. J., Katsaras, K. and Peetz,
P. (1995). Submerged bacterial colonies within food and model systems: Their
growth, distribution and interactions. International Journal of Food Microbiology,
28, 299–315.
Ye, M., Meetoo, H. and Chen, H. (2008). Control of Listeria monocytogenes on ham
steaks by antimicrobials incorporated into chitosan-coated plastic films. Food
Microbiology, 25, 260–268.
Zdolec, N., Hadziosmanovic, M., Kozacinski, L. et al. (2007). Protective effect of Lac-
tobacillus sakei in fermented sausages. Archiv furLebensmittelhygiene, 58, 152–155.
Zhang, J., Liu, G., Li, P. and Qu, Y. (2010). Pentocin 31-1, a novel meat-borne bacte-
riocin and its application as biopreservative in chill-stored tray-packaged pork
meat. Food Control, 21, 198–202.
Zhu, M., Du, M., Cordray, J. and UkAhn, D. (2005). Control of Listeria monocytogenes
contamination in ready-to-eat meat products. Comprehensive Reviews in Food Sci-
ence and Food Safety, 4, 34–42.
19
Functionalities of Meat Bacterial Starters

Régine Talon and Sabine Leroy

CONTENTS
19.1 Introduction ................................................................................................ 597
19.2 Bacterial Starter Cultures and Competitiveness ................................... 598
19.3 Protective Cultures .................................................................................... 599
19.4 Starters and Sensory Quality ...................................................................600
19.4.1 Texture ............................................................................................. 601
19.4.2 Color................................................................................................. 601
19.4.3 Flavor ............................................................................................... 602
19.4.3.1 Carbohydrate Catabolism .............................................. 603
19.4.3.2 Protein Hydrolysis .......................................................... 603
19.4.3.3 Amino Acid Catabolism.................................................604
19.4.3.4 Lipid Hydrolysis .............................................................. 605
19.4.3.5 Fatty Acid Oxidation ...................................................... 605
19.4.3.6 Formation of Esters ......................................................... 606
19.5 Probiotic Cultures ...................................................................................... 606
19.6 Conclusion ..................................................................................................608
References.............................................................................................................608

19.1 Introduction
The production of fermented foods is one of the oldest food processing tech-
nologies known to man. Of course, these processes were first artisanal in
nature. Today, even though some of these traditional processes remain in use,
large-scale industrial processes have been developed. The advent of retail-
ing and mass marketing required the availability of products with consistent
quality and safety. For many fermented foods, thus for fermented meat prod-
ucts, the characterization of microorganisms responsible for the fermentation,
toward the end of the nineteenth century, led to the development of starter cul-
tures. This development had a major impact on the process and contributed to
ensuring consistency of the product and reliability of fermentation. Research
on starter cultures continued to advance at a very impressive rate and con-
siderable knowledge was developed to manipulate and control these bacteria.

597
598 Advanced Technologies for Meat Processing, Second Edition

The original and primary purpose of fermentation was to ensure shelf life
and microbiological safety of the products. Thus, the research on starter cul-
tures was mainly focused on their protective effect. Then as many preser-
vation technologies were developed, fermented meats were manufactured
because of their unique flavor, aroma, and texture. Beside preservation and
safeguard as objectives of fermentation, the role of starter cultures in the
sensory quality of fermented products was questioned. Finally, other aspects
such as wholesomeness and acceptability have become increasingly impor-
tant and valued features to consumers. In this context, probiotic cultures for
production of fermented sausages were investigated.

19.2 Bacterial Starter Cultures and Competitiveness

Most fermented sausages formulated with nitrate and/or nitrite are pro-
duced with a starter culture, generally consisting of lactic acid bacteria (LAB)
and coagulase negative staphylococci (CNS) (Hammes, 2012; Table 19.1).
Lactobacillus sakei, Lactobacillus curvatus, and Lactobacillus plantarum (mainly
in Europe) and Pediococcus pentosaceus and Pediococcus acidilactici (mainly

TABLE 19.1
Most Currently Used Bacteria in Meat Fermentation with Published Genomes
Species References
Lactobacillus curvatus CRL705 AGBU01000000, Hebert et al. (2012)
Lactobacillus plantarum JDM1 CP001617, Zhang et al. (2009)
L. plantarum ST-III CP002222, Wang et al. (2011)
L. plantarum NC8 AGRI01000000, Axelsson et al. (2012)
L. plantarum ZJ316 CP004082, Li et al. (2013)
Lactobacillus sakei 23 K CR936503, Chaillou et al. (2005)
L. sakei LS25 ASTI00000000, McLeod et al. (2013)
Pediococcus acidilactici MA18/5M AGKB00000000, Barreau et al. (2011)
P. acidilactici D3 AQGT00000000, Sturino et al. (2013)
Pediococcus pentosaceus ATCC 25745 CP000422, Makarova et al. (2006)
P. pentosaceus IE-3 CAHU01000001 to CAHU01000091,
Midha et al. (2012)
P. pentosaceus SL4 CP006854, Dantoft et al. (2013)
Staphylococcus carnosus subsp. carnosus TM300 AM295250, Rosenstein et al. (2009)
S. carnosus subsp. utilis LTH 7013 LAIU00000000, Müller et al. (2015)
Staphylococcus equorum Mu2 CAJL01000001 to CAJL01000030,
Irlinger et al. (2012)
S. equorum KS1039 CP013114, Jeong et al. (2016)
Staphylococcus xylosus SMQ-121 CP008724, Labrie et al. (2014)
S. xylosus C2a LN554884, Vermassen et al. (2014, 2015)
Functionalities of Meat Bacterial Starters 599

in North America) are the starters most currently used for their fermenta-
tive role in sausage manufacturing (Talon et al., 2004). Staphylococcus xylosus
and Staphylococcus carnosus are widely used for their involvement in color
and aroma development (Talon et al., 2002). Staphylococcus equorum is more
and more often mentioned in dry-fermented sausages (Mauriello et al., 2004;
Leroy et al., 2010). It is also used as a commercial starter culture. In general,
the starters are inoculated at 106 viable germs/g of product.
Research on starter cultures continued to advance at a very impressive rate
through the twentieth and twenty-first centuries. The sequencing of genomes
of some of the species used as starters (Table 19.1), and consequently, the
development of postgenomics studies (transcriptomic, proteomic) either in
vitro or in situ have provided basic knowledge on their adaptation to the meat
environment and their main functionalities.
These genomic studies have revealed that L. sakei have a metabolic rep-
ertoire that may contribute to their adaptation to meat including nucleo-
tide scavenging, catabolism of arginine, and the use of heme and nonheme
iron sources (Chaillou et al., 2005; Duhutrel et al., 2010; Nyquist et al., 2011;
Rimaux et al., 2011, 2012). This species was shown to be able to cope with
cold temperatures, salt, changing redox, and oxygen levels (Marceau et al.,
2004; Chaillou et al., 2005; Nyquist et al., 2011). Comparative genome anal-
ysis revealed that L. curvatus CRL705 and L. sakei 23K strains were highly
similar (Hebert et al., 2012). L. plantarum is a versatile species that can use a
broad range of fermentable carbon sources (Molenaar et al., 2005). The use of
nucleotides as an alternative energy source appears to be a common feature
in CNS including S. carnosus, S. xylosus, and S. equorum (Janssens et al., 2014)
while the use of arginine either by arginine deiminase or arginase pathway
varied among the species as well as the strains (Sànchez Mainar et al., 2014).
The ability to cope with osmotic stress is well known for staphylococci. Nine
systems for osmoprotectant transport or biosynthesis were identified in
the genome of S. carnosus (Rosenstein et al., 2009) and the overexpression
of genes involved in transport and synthesis of osmoprotectants and Na+/
H+ extrusion were evidenced in S. xylosus in a salted meat model (Vermas-
sen et al., 2016). S. xylosus was also shown to be able to cope with nitrosative
stress generated by nitrate and nitrite in a meat model by modulating the
expression of genes involved in iron homeostasis and antioxidant defense
(Vermassen et al., 2014).

19.3 Protective Cultures

The use of bacterial starter cultures with protective effects can enhance the
safety of meat products and prevent potential foodborne microbial hazards.
Strategies using a biopreservation approach are investigated to “naturally”
control the growth of pathogenic and spoilage microorganisms. Rapid growth
600 Advanced Technologies for Meat Processing, Second Edition

and production of acids by bacterial meat starter cultures are important for
sensory qualities of fermented sausages and for controlling undesirable bac-
teria. LAB can inhibit the growth of these microorganisms by a variety of
antimicrobial agents such as organic acids, bacteriocins, and the competition
for nutrients in the product (Granly Koch, 2004). Organic acids including lac-
tic and acetic acids are produced during the fermentation process. These acids
under their undissociated form at low pH exert strong antagonistic effects
particularly against Gram-negative bacteria (Holzapfel, 2002).
The main LAB used as meat starter cultures can inhibit pathogenic and
spoilage bacteria by bacteriocins production. Bacteriocins are heterogeneous
groups of peptides and proteins, and the majority produced by LAB belong
to two categories: the lanthionine-containing lantibiotics (class I) and the
nonlanthionine-containing lantibiotics (class II) (De Vuyst and Leroy, 2007;
Vignolo et al., 2015). L. sakei strains can produce several sakacins and lactocin
S while L. curvatus strains produce sakacin P, curvacin, several curvaticins,
and lactocins, which are active against LAB, Clostridium, Listeria monocyto-
genes, and Enterococcus (Vignolo et al., 2015). L. plantarum synthesize plan-
taricin active against LAB and Li. monocytogenes while pediococci produce
pediocins with a large spectrum of inhibition against other LAB, Clostridium,
Li. monocytogenes, Staphylococcus aureus, Enterococcus, and propionibacteria
(Vignolo et al., 2015). However, the role of bacteriocins in meat products
appears to be limited because they are often bound to the matrix, and could
be degraded by tissue proteases and inhibited by sodium nitrite and sodium
chloride (Verluyten et al., 2003; Leroy et al., 2015). Nevertheless, in various
sausages, a 1.5–2.5-log reduction of Li. monocytogenes was obtained by the
presence of bacteriocin-producing strains belonging to P. acidilactici, L. sakei,
L. plantarum, and L. curvatus species. These bacteria could be used alone or in
combination (Vignolo et al., 2015).
Few works mentioned the production of bacteriocins by CNS and only
two concerned CNS used as starter cultures. One strain of S. xylosus iso-
lated from Italian sausages not only produced an inhibitory substance active
against Li. monocytogenes on a solid medium but also in Naples-type sau-
sages in which a 2-log reduction of Li. monocytogenes was measured (Villani
et al., 1997). One strain of S. equorum was found to produce a macrocyclic
peptide antibiotic, called micrococcin, which is a substance exhibiting a bac-
teriostatic effect on a variety of Gram-positive bacteria, and in particular
Li. monocytogenes (Carnio et al., 2000).

19.4 Starters and Sensory Quality

Sausages are made with minced meat and fat, mixed with salt and spices,
often inoculated with starter cultures, stuffed into casings, and then ripened
Functionalities of Meat Bacterial Starters 601

and dried. During the combined, consecutive, and interactive changes that
take place during fermentation and drying, the specific color, texture, and
flavor of the sausages are developed. Starter cultures are involved in the
development of these different attributes.

19.4.1 Texture
During chopping, salt solubilizes muscle proteins (mainly myosin), which
on the drop in pH during fermentation coagulate and form a gel surround-
ing the fat and meat particles that is stabilized during drying (Demeyer and
Toldrá, 2004). A pH of 5.3 is required for coagulation at the often-used salt
concentration of 3% (Talon et al., 2004). Acidification by LAB during fermen-
tation produces two opposing effects on gel strength: coagulation and the
induction of proteolysis of the myosin by cathepsin D, lowering its contribu-
tion to gel strength (Demeyer and Toldrá, 2004).

19.4.2 Color
The typical cured meat color is associated with the formation of the nitroso-
myoglobin, which results from a series of reactions involving the formation
of nitrogen oxide (NO) and its reaction with myoglobin producing nitrosyl-
ated pigments, which yield a red color (Hammes, 2012).
The substrate added to produce NO could be nitrate or nitrite. Nitrite acts
as a very reactive oxidant and is reduced to NO immediately after prepa-
ration of the sausage mix. The reduction of nitrite to NO is favored by the
acidification caused by LAB. The use of nitrate involves bacterial reduction
to nitrite carried out by the nitrate reductase of CNS (Sànchez Mainar and
Leroy, 2015). There is heterogeneity in the capacity of the CNS to reduce
nitrate, but high nitrate reductase activity is found for the strains belonging
to the three species used as starters (Mauriello et al., 2004; Gøtterup et al.,
2007). Furthermore, S. carnosus and S. xylosus are able to reduce nitrite in
ammonia (Hammes, 2012). The nitrite and nitrate reductases of S. carnosus
are well characterized. They are encoded by the nir and nar operons, respec-
tively (Rosenstein et al., 2009). These operons are similar in the S. xylosus C2a
genome (Vermassen et al., 2014).
Safety considerations in meat fermentation relate to the use of nitrate and
nitrite based on their potential to form nitrosamines with carcinogenic prop-
erty (Hammes, 2012). An alternative to these additives could be the exploita-
tion of the nitric oxide synthase (NOS) activity generating NO from arginine
catabolism. NOS-like enzymes were identified from several Gram-positive
bacteria (Crane et al., 2010). Up to now, the nos gene has been identified in
many CNS but the NOS activity has been only characterized in Staphylococcus
aureus (Sapp et al., 2014). The contribution of the NOS activity of CNS to the
color development in meat remains to be demonstrated.
602 Advanced Technologies for Meat Processing, Second Edition

Discoloration of cured meat can be observed by the formation of peroxide.

This default can be avoided by the catalase activity of CNS that protects the
color (Talon et al., 2004).

19.4.3 Flavor
Flavor is one of the most important properties in sausage. It covers the taste,
aroma, and odor of the product, and its perception depends on the texture
of the product. A large variety of compounds are likely to contribute to the
desired aroma and taste of fermented sausages. Some of them are added to
sausage mix such as salt, constituents of spices, and smoke. Others result
from the catabolism of carbohydrates, proteins, and lipids from tissue and
microbial enzyme reactions and chemical reactions (Figure 19.1). It is still
difficult to distinguish between tissue enzymes and microbial enzymes, and

Flavor formation

Taste Aroma

Lactic acid Carbohydrate

Volatile acids catabolism
Alcohols

Aldehydes
Peptides Protein
Amino acids hydrolysis Esters

Ketones
Amino acids
degradation Volatile acids

Sulfured compounds
Lipid hydrolysis

Fatty acids
oxidation

Salt Pepper Terpens

Garlic Allylic sulfides
Salt Allylic thiols

FIGURE 19.1
Formation of important flavor compounds in fermented sausages. (Data from Stahnke, L. H.,
in Toldrá, F. [ed.], Research Advances in Quality of Meat and Meat Products. Trivandrum, Research
Signpost, 2002; Talon, R. et al., in Toldrá, F. [ed.], Research Advances in Quality of Meat and Meat
Products. Trivandrum: Research Signpost, 2002; Flores, M. and Olivares, A., Handbook of Fer-
mented Meat and Poultry, 2015, pp. 217–225. Copyright Wiley-VCH Verlag GmbH & Co. KGaA.)
Functionalities of Meat Bacterial Starters 603

also to determine the origin of certain compounds. (For reviews in this field,
see Ravysts et al., 2012; Talon and Leroy, 2014; Cocconcelli and Fontana, 2015;
Flores and Olivares, 2015; Leroy et al., 2016.)

19.4.3.1 Carbohydrate Catabolism

The acid taste is an important component of the overall taste of fermented
meat products, sought in the northern process, whereas it may be rejected
in the southern process. It is positively correlated with lactate and acetate
contents (Demeyer and Toldrá, 2004; Lücke, 2000). In 100 g of dry material,
lactic acid is present in the range of 0.4–2.8 g in various sausages such as Bel-
gian, Italian, Norwegian, Spanish, and Swedish types (Stahnke, 2002). Many
factors influence lactic acid production. The most important factors are tem-
perature, type and amount of carbohydrates, and LAB (Leroy et al., 2015).
L. sakei, L. curvatus, and L. plantarum, the most common starters used in
meat, produce l- and d-lactate by metabolizing the carbohydrates added
to the mixture (glucose, sucrose, etc.) via the homofermentative pathway
(Axelsson, 2004). Pediococcus also degrades glucose via the homofermentative
pathway (Josephsen and Jespersen, 2004). Some lactobacilli such as L. sakei
ferment pentoses via the heterolactic pathway producing lactate and acetate
(Champomier-Vergès et al., 2002).
The genomes of S. carnosus and S. xylosus are well equipped with func-
tions involved in various sugar degradation pathways such as glucose and
ribose occurring in the meat or added to the batter (Rosenstein et al., 2009;
Vermassen et al., 2016). S. xylosus produced mainly acetate as an end product
and simultaneously metabolized glucose and lactate in a meat model supple-
mented with glucose (Vermassen et al., 2016). Acetate contributes to acidic
taste and also plays an important role in sausage aroma by providing a hint
of vinegar. In excess, however, it can lead to a pungent, sour taste. This odor
is higher in northern than in southern sausages (Talon et al., 2002).
The buttery or dairy product aroma of certain sausages is related to the pres-
ence of diacetyl and acetoin, which may result from the metabolism of pyruvate
by staphylococci. S. xylosus and S. equorum produced more diacetyl and acetoin
than S. carnosus (Sondergaard and Stahnke, 2002). The production of these com-
pounds was dependant on the curing ingredients (Olesen et al., 2004a,b).

19.4.3.2 Protein Hydrolysis

During sausage ripening, both the soluble (sarcoplasmic) and insoluble
proteins (myofibrillar) are hydrolyzed into smaller proteins and peptides
(Hughes et al., 2002; López et al., 2015). Their breakdown is mainly due to
endogenous enzymes but bacteria are involved in this degradation. LAB
indirectly contributed to proteolysis by reducing the pH, which increases
cathepsin D activity (Fadda et al., 2010). L. plantarum, L. curvatus, and L. sakei
have been reported to make a remarkably hydrolytic contribution to the
604 Advanced Technologies for Meat Processing, Second Edition

initial hydrolysis of sarcoplasmic proteins when whole cells, or whole cells

combined with cell free extracts (CFEs), are used as an enzyme source (Fadda
et al., 2010). The starter cultures (P. pentosaceus plus S. xylosus or L. sakei plus
S. carnosus) influenced the proteolytic activity and the release of amino acids
in sausages (Aro Aro et al., 2010; Hughes et al., 2002).
The degradation of peptides into amino acids in sausage results in micro-
bial and tissue activities, but great differences in the content of amino acids
were noticed (Beriain et al., 2000; Aro Aro et al., 2010; Hughes et al., 2002;
López et al., 2015). High peptidases and aminopeptidases activities on
sarcoplasmic or myofibrillar extracts have been observed in L. plantarum,
L. curvatus, and L. sakei strains from meat (Fadda et al., 2010). A compari-
son between L. sakei and L. curvatus showed that these two species harbored
three similar peptide transport systems and 19 genes encoding peptidases
(Freiding et al., 2011). S. xylosus grown in a meat model overexpressed genes
involved in peptide transport and peptidases (Vermassen et al., 2016).
Peptides and amino acids have an important influence on meat flavor
development (Hughes et al., 2002). Hydrophilic peptides are associated with
desirable flavor while hydrophobic peptides give rise to off-flavor. Although
the intrinsic sensory potential of amino acids is disputed, their role as pre-
cursors of aroma compounds is obvious (Leroy et al., 2016).

19.4.3.3 Amino Acid Catabolism

Amino acids can be transformed into amines, ammonia, or various com-
pounds. Some of them have aromatic properties such as methyl aldehydes,
-acids, and -alcohols.
Given its contribution to the increase in pH observed during drying,
ammonia could also influence the sensory properties of compounds and the
metabolic reactions (Flores and Olivares, 2015). Ammonia production is par-
ticularly evident in sausages with a long drying phase such as southern-type
sausages (Demeyer et al., 2000).
Amino acids, in particular, branched-chain amino acids (leucine, iso-
leucine, and valine), aromatic amino acids (phenylalanine, tyrosine, and
tryptophan), and sulfured amino acids (methionine), are catabolized into
aldehydes, alcohols, and acids, which play an important role in acquir-
ing flavor (Stahnke, 2002; Flores and Olivares, 2015). With the exception of
dimethyldisufide, which confers a putrid odor, 2- or 3-methyl butanol with
fermented fruit odors, 2- or 3-methyl butanal, and 2-methyl propanal with
malt and cacao odors and phenyl-alcohol, -aldehyde, -acid with floral and
honey notes are important in terms of aroma (Stahnke, 2002; Flores and Oli-
vares, 2015). Acids confer an animal and cheese note on products (Stahnke,
2002; Flores and Olivares, 2015).
The catabolism of amino acids could involve the Strecker reaction that
could occur due to the high amino acid content and the low water activity
values (Flores and Olivares, 2015). Nonetheless, the production of methyl-
Functionalities of Meat Bacterial Starters 605

aldehydes, -acids, and -alcohols in sausage is modulated by the starter cul-

tures and, in particular, by staphylococci such as S. carnosus, S. xylosus, and
S. equorum (Sondergaard and Stahnke, 2002; Stravopoulou et al., 2015). The
catabolism of branched-chain amino acids by staphylococci is influenced by
various parameters such as temperature, salt, nitrate, nitrite, and pH (Olesen
and Stahnke, 2003; Olesen et al., 2004a,b; Tjener et al., 2004). The branched-
chain amino acid aminotransferase involved in the first step of this catab-
olism from S. carnosus has been characterized (Madsen et al., 2002). The
pathway leading to the synthesis of the methyl compounds from the catabo-
lism of leucine has been identified in S. xylosus (Beck et al., 2004). S. xylosus
overexpressed several genes involved in this pathway during its growth in a
meat model (Vermassen et al., 2016).
LAB have restricted aromatic potential. Under laboratory conditions, L. sakei,
L. plantarum, L.curvatus, and P. acidilactici only weakly degrade leucine, mainly
into α-ketoisocaproate, a molecule with no odor (Larrouture. et al., 2000).
Strains of L. curvatus and L. sakei lacked known aminotransferases specific for
branched-chain amino acids and aromatic amino acids (Freiding et al., 2011).

19.4.3.4 Lipid Hydrolysis

Lipolysis in dry sausages releases free fatty acids with chain length between
16 and 18 carbon atoms and is, to a great extent, of endogenous origin with
triglyceride lipases and phospholipases (Talon et al., 2004). Staphylococci
could contribute to lipolysis. In S. xylosus, two lipases have been identified
(Mosbah et al., 2005; Sakinc et al., 2005). Most strains of these species had
lipolytic activity on pork fat while few strains of S. equorum had this capacity
(Mauriello et al., 2004). The strain S. carnosus TM300 was devoid of gene cod-
ing lipase (Rosenstein et al., 2009) and S. carnosus strains appeared unable to
hydrolyze pork fat (Casaburi et al., 2005).
Short-chain fatty acids have a taste of sour cheese. However, the longer the
chain, the weaker the sensory characteristics are (Flores and Olivares, 2015).
In fact, fatty acids are mainly precursors of aroma molecules.

19.4.3.5 Fatty Acid Oxidation

Fatty acid oxidation results in numerous compounds, which belong to six
families: alkanes, alkenes, aldehydes, alcohols, ketones, and acids. Although
the production of these compounds in sausages is low—in the order of ppm—
their low sensory threshold, except for alkanes and alkenes which are odor-
less, means that they have a real effect (Flores and Olivares, 2015). Oxidation
of fatty acids can be either chemical (peroxidation) or enzymatic (β -oxidation).
Peroxidation is affected by many factors such as oxygen content, the presence
of pro-oxidative compounds (NaCl, metals) or antioxidative compounds (nitrite,
spices), and the amount of unsaturated lipids. Staphylococci via their antioxi-
dant properties contribute to the regulation of oxidation (Talon et al., 2004).
606 Advanced Technologies for Meat Processing, Second Edition

Under laboratory conditions, S. xylosus and S. carnosus limited the oxidation

of linoleic and linolenic unsaturated fatty acids (Talon et al., 2000). The cata-
lase and superoxide dismutase (SOD) activities of S. carnosus have been char-
acterized (Barrière et al., 2001a). Mutants deficient in SOD or catalase activity
of S. xylosus were less efficient than the wild type in limiting the oxidation of
unsaturated fatty acids (Barrière et al., 2001b,c). The presence of nitrate and
nitrite in a meat model generated a nitrosative stress and S. xylosus responded
to this stress by the regulation of 12 genes involved in protection and detoxifi-
cation mechanisms (Vermassen et al., 2014). Among these genes, three encode
catalases revealing that the S. xylosus strain C2a has three distinct catalases.
The S. carnosus strain TM300 has two catalases (Rosenstein et al., 2009). Some
strains of S. xylosus and S. equorum have been reported as having two catalases
(Blaiotta et al., 2010). In addition, in the S. xylosus strain C2a, the genes ahpC
encoding alkyl hydroperoxide reductase and trxB encoding thioredoxin reduc-
tase were upregulated (Vermassen et al., 2014). All these genes encode enzymes
involved in H2O2 detoxification or conferring resistance to other reactive oxy-
gen species (Gaupp et al., 2012).
Methyl ketones have been identified in sausages and could arise from
incomplete β -oxidation of fatty acids. In this case, intermediate CoA esters
can be freed; they are successively converted into α -ketoacid via thioesterase
activity and then into methyl-ketone and secondary alcohol via decarboxyl-
ase and dehydrogenase action. Engelvin et al. (2000) have shown that inter-
mediates were freed during the β -oxidation cycle in S. carnosus. They also
reported thioesterase activity in this strain. Fadda et al. (2003) have high-
lighted the presence of β -decarboxylase activity in S. carnosus. These results
suggest that S. carnosus may produce ketones via this pathway.

19.4.3.6 Formation of Esters

Esters are present in fermented meat products and their aromatic character-
istics contribute to the fruity note of the products (Stahnke, 2002). Most of the
esters in sausages are ethyl esters. Their production depends on the presence
of ethanol and different acids (from two to eight carbon atoms) as well as on
technological factors and microorganisms.
Esters could be of chemical origin as they are found in dry raw ham with
a low bacterial count. However, they can also be of bacterial origin. In sau-
sages, esters are associated with the presence of S. xylosus or S. carnosus
strains (Stahnke, 2002).

19.5 Probiotic Cultures

The relationship between certain foods and their health benefits has allowed
the development of the concept of functional food as a food or food ingredient
Functionalities of Meat Bacterial Starters 607

with positive effects on host health. In this context, attention has been directed
toward probiotics, which are defined as living microorganisms that beneficially
affect the health of the host when ingested in adequate amounts (Arihara, 2015).
Utilization of probiotic bacteria is one of the criteria for the development of
healthier meat products. This possibility has been discussed in several papers
(Työppönen et al., 2003; Kröckel, 2006; De Vuyst et al., 2008; Arihara, 2015).
The first approach was to consider the probiotic species originating from
isolates from the intestinal tract. This ecological niche is the natural habi-
tat for Bifidobacterium, Lactobacillus acidophilus, and Lactobacillus rhamnosus
(Arihara, 2015). Lactobacillus casei may also be found in the microbiota of the
oral cavity, in various fermented foods, and in spoiled foods (Kröckel, 2006).
Foremost, these probiotic bacteria must survive in sausages. Indeed, their
viability could be affected by various factors including the process, the acidi-
fication, the additives, and the competition with starter cultures (De Vuyst
et al., 2008). The potentiality of the six probiotic species belonging to the
L. acidophilus group was investigated for their application in meat fermenta-
tion. Among them, Lactobacillus gasseri was the most appropriate; it grew in
the sausage model and decreased the pH during fermentation, however it
was sensitive to sodium chloride and nitrite (Arihara, 2015). L. rhamnosus and
Lactobacillus paracasei subsp. paracasei were able to carry out the fermentation
as the commercial L. sakei starter culture suggesting that intestinal Lactoba-
cillus could be used for developing probiotic starter cultures in fermented
sausages (Arihara, 2015). Pidcock et al. (2002) showed that nontraditional
meat starter (NTMS) cultures survived in salami throughout fermentation
and maturation. These NTMS cultures included one strain of L. acidophilus,
two of L. paracasei, one of Lactobacillus spp, and one of Bifidobacterium lactis.
Furthermore, the addition of these NTMS cultures in conjunction with the
commercial meat starter increased the safety of Hungarian salami. Similarly,
three probiotic strains of L. rhamnosus and one of L. plantarum were studied
for their capacity to act as main fermenting bacteria in sausage manufactur-
ing (Erkkilä et al., 2001a,b). These lactic bacteria decreased the pH from 5.6
to 4.9 or 5.0 and produced a flavor profile similar to that produced by com-
mercial lactic meat starter cultures. Microencapsulation has been shown to
protect a probiotic L. reuteri strain during sausage manufacturing (Muthu-
kumarasamy and Holley, 2006). From all of these studies, it seems possible
to successfully use probiotics as starter cultures for dry-fermented sausages,
as there were no significant technological and sensorial differences between
the sausages fermented by probiotic or nonprobiotic strains.
A second approach was to consider the LAB used as starters as potential
probiotics. Their main requirements are acid and bile tolerance, safety in
use, and clinical documentation of health effects (De Vuyst et al., 2008; Ari-
hara, 2015). Considering the criteria of acid and bile tolerance, Erkkilä and
Petäjä (2000) screened eight commercial meat starter cultures for their poten-
tial probiotic use. One strain of L. sakei and one of P. acidilactici had the best
survival capacities under acidic conditions and high concentration of bile
608 Advanced Technologies for Meat Processing, Second Edition

salts. The selection of potentially probiotic lactobacilli from Greek fermented

sausages (Papamanoli et al., 2003) and Italian fermented sausages (Pennac-
chia et al., 2004) was realized. Twenty-four strains of L. curvatus and seven
of L. plantarum isolated from the Greek products were resistant to 0.3% bile
salts. Strains of L. plantarum and L. casei from Italian sausages were found to
be potentially usable in the future as probiotic starter cultures for the manu-
facture of novel fermented sausages.
The question of usefulness of probiotics in meat products is still in debate.
The proof of a beneficial effect should be based on sound studies performed
with the probiotics in the meat matrix as it is consumed. Mahoney and Hen-
riksson (2003) investigated if a salami batter inoculated with a meat starter
culture, a probiotic (L. acidophilus), or a mixture of both reduced the gastroin-
testinal colonization and virulence of Li. monocytogenes in mice. Consumption
of salami fermented with the mixture reduced fecal levels of the pathogen by
2.5-log units compared to a reduction of 1.0- and 1.5-log units by the starter
and L. acidophilus, respectively. The amount of sausage prepared with pro-
biotic that must be ingested to confer the claimed beneficial health effect to
consumer is still unknown. Only one study states that a daily consumption of
50 g of sausage, fermented with L. paracasei, by human volunteers modulates
their immune system (Jahreis et al., 2002). Further studies on the relationship
between the consumption of probiotic sausage and human health are needed.

19.6 Conclusion
The exploitation of data on bacterial genomes of technological interest offer
new research opportunities by revealing properties that could explain their
adaptation to the meat environment, their interaction with a specific sub-
strate, and their competitiveness. This increasing basic knowledge will lead
to the development of bacterial meat starter cultures that exhibit protective
and probiotic properties as well as achieving the required technological and
sensory tasks in the fermented sausages.

References
Arihara, K. (2015). Probiotics. In: Toldrá, F. (ed.) Handbook of Fermented Meat and
Poultry (2nd Ed.). Chichester, West Sussex, UK: John Wiley & Sons, pp. 155–160.
Aro Aro, J. M., Nyam-Osor, P., Tsuji, K., Shimada, K. I., Fukushima, M. and Sekikawa,
M. (2010). The effect of starter cultures on proteolytic changes and amino acid
content in fermented sausages. Food Chemistry, 119, 279–285.
Axelsson, L. (2004). Lactic acid bacteria: Classification and physiology. In: Salminer,
S., Ouwehand, A. and Von Wright, A. (eds.) Lactic Acid Bacteria: Microbiology and
Functional Aspects (3rd Ed.). New York, NY: Marcel Dekker.
Functionalities of Meat Bacterial Starters 609

Axelsson, L., Rud, I., Naterstad, K. et al. (2012). Genome sequence of the naturally
plasmid-free Lactobacillus plantarum strain NC8 (CCUG 61730). Journal of Bacte-
riology, 194, 2391–2392.
Barreau, G., Tompkins, T. A. and de Carvalho, V. G. (2011). Draft genome sequence of
probiotic strain Pediococcus acidilactici MA18/5M. Journal of Bacteriology, 194, 901.
Barrière, C., Brückner, R. and Talon, R. (2001b). Characterization of the single super-
oxide dismutase of Staphylococcus xylosus. Applied and Environmental Microbiol-
ogy, 67, 4096–4104.
Barrière, C., Centeno, D., Lebert, A., Leroy-Sétrin, S., Berdagué, J. L. and Talon, R.
(2001c). Roles of superoxide dismutase and catalase of Staphylococcus xylosus in
the inhibition of linoleic acid oxidation. FEMS Microbiology Letters, 201, 181–185.
Barrière, C., Leroy-Sétrin, S. and Talon, R. (2001a). Characterization of catalase and
superoxide dismutase in Staphylococcus carnosus 833 strain. Journal of Applied
Microbiology, 91, 514–519.
Beck, H. C., Hansen, A. M. and Lauritsen, F. R. (2004). Catabolism of leucine to
branched-chain fatty acids in Staphylococcus xylosus. Journal of Applied Microbiol-
ogy, 96, 1185–1193.
Beriain, M. J., Lizaso, G. and Chasco, J. (2000). Free amino acids and proteolysis
involved in salchichon processing. Food Control, 1, 41–47.
Blaiotta, G., Fusco, V., Ercolini, D., Pepe, O. and Coppola, S. (2010). Diversity of
Staphylococcus species strains based on partial kat (catalase) gene sequences and
design of a PCR-restriction fragment length polymorphism assay for identifi-
cation and differentiation of coagulase-positive species (S. aureus, S. delphini,
S. hyicus, S. intermedius, S. pseudintermedius, and S. schleiferi subsp. coagulans).
Journal of Clinical Microbiology, 48, 192–201.
Carnio, M. C., Holtzel, A., Rudolf, M., Henle, T., Jung, G. and Scherer, S. (2000). The
macrocyclic peptide antibiotic micrococcin P(1) is secreted by the food-borne
bacterium Staphylococcus equorum WS 2733 and inhibits Listeria monocytogenes on
soft cheese. Applied and Environmental Microbiology, 66, 2378–2384.
Chaillou, S., Champomier-Vergès, M. C., Cornet, M. et al. (2005). Complete genome
sequence of the meat-born lactic acid bacterium Lactobacillus sakei 23K. Nature
Biotechnology, 23, 1527–1533.
Champomier-Vergès, M. C., Chaillou, S., Cornet, M. and Zagorec, M. (2002). Lactoba-
cillus sakei: Recent developments and future prospects. Research in Microbiology,
153, 115–123.
Casaburi, A., Blaiotta, G., Mauriello, G., Pepe, O. and Villani, F. (2005). Technological
activities of Staphylococcus carnosus and Staphylococcus simulans strains isolated
from fermented sausages. Meat Science, 71, 643–650.
Cocconcelli, P. S. and Fontana, C. (2015). Starter cultures: Bacteria. In: Toldra, F. (ed.)
Handbook of Fermented Meat and Poultry (2nd Ed.). Chichester, West Sussex, UK:
John Wiley & Sons, pp. 117–127.
Crane, B., Sudhamasu, J. and Pantel, B. (2010). Bacterial nitric oxide synthases. Annual
Review of Biochemistry, 79, 445–470.
Dantoft, S. H., Bielak, E. M., Seo, J.-G., Chung, M.-J. and Jensen, P. R. (2013). Complete
genome sequence of Pediococcus pentosaceus strain SL4. Genome Announcements,
1, e01106–e01113.
Demeyer, D., Raemaekers, M., Rizzo, A. et al. (2000). Control of bioflavour and safety
in fermented sausages: First results of a European project. Food Research Interna-
tional, 33, 171–180.
610 Advanced Technologies for Meat Processing, Second Edition

Demeyer, D. and Toldrá, F. (2004). Fermentation. In: Devine, C. and Dikeman, M.

(eds.) Encyclopedia of Meat Sciences. Amsterdam: Elsevier, 467–474.
De Vuyst, L., Falony, G. and Leroy, F. (2008). Probiotics in fermented sausages. Meat
Science, 80, 75–78.
De Vuyst, L. and Leroy, F. (2007). Bacteriocins from lactic acid bacteria: Production,
purification, and food applications. Journal of Molecular Microbiology and Biotech-
nology, 13, 194–199.
Duhutrel, P., Bordat, C., Wu, T. D., Zagorec, M., Guerquin-Kern, J. L. and Champo-
mier-Vergès, M. C. (2010). Iron sources used by the non pathogenic lactic acid
bacterium Lactobacillus sakei as revealed by electron energy loss spectroscopy
and secondary-ion mass spectrometry. Applied and Environmental Microbiology,
76, 560–565.
Engelvin, G., Féron, G., Perrin, C., Molle, D. and Talon, R. (2000). Identification of
beta-oxidation and thioesterase activities in Staphylococcus carnosus 833 strain.
FEMS Microbiology Letters, 190, 115–120.
Erkkilä, S. and Petäjä, E. (2000). Screening of commercial meat starter cultures at low
pH and in the presence of bile salts for potential probiotic use. Meat Science, 55,
297–300.
Erkkilä, S., Petäjä, E., Eerola, S., Lilleberg, L., Mattila-Sandholm, T. and Suihko, M.
L. (2001a). Flavour profiles of dry sausages fermented by selected novel meat
starter cultures. Meat Science, 58, 111–116.
Erkkilä, S., Suihko, M. L., Eerola, S., Petaja, E. and Mattila-Sandholm, T. (2001b). Dry
sausage fermented by Lactobacillus rhamnosus strains. International Journal of Food
Microbiology, 64, 205–210.
Fadda, S., Leroy-Sétrin, S. and Talon, R. (2003). Preliminary characterization of
β -decarboxylase activities in Staphylococcus carnosus 833, a strain used in sau-
sage fermentation. FEMS Microbiology Letters, 228, 143–149.
Fadda, S., López, C. and Vignolo, G. (2010). Role of lactic acid bacteria during meat
conditioning and fermentation: Peptides generated as sensorial and hygienic
biomarkers. Meat Science, 86, 66–79.
Flores, M. and Olivares, A. (2015). Flavor. In: Toldrá, F. (ed.) Handbook of Fermented
Meat and Poultry (2nd Ed.). Chichester, West Sussex, UK: John Wiley & Sons,
pp. 217–225.
Freiding, S., Gutsche, K. A., Ehrmann, M. A. and Vogel, R. F. (2011). Genetic screen-
ing of Lactobacillus sakei and Lactobacillus curvatus strains for their peptidolytic
system and amino acid metabolism, and comparison of their volatilomes in a
model system. Systematic and Applied Microbiology, 34, 311–320.
Gaupp, R., Ledala, N. and Somerville, G. A. (2012). Staphylococcal response to oxida-
tive stress. Frontiers in Cellular and Infection Microbiology, 2, 33.
Gøtterup, J., Olsen, K., Knöchel, S., Tjener, K., Stahnke, L. H. and Møller, J. K. S. (2007).
Relationship between nitrate/nitrite reductase activities in meat associated
staphylococci and nitrosylmyoglobin formation in a cured meat model system.
International Journal of Food Microbiology, 120, 303–310.
Granly Koch, A. (2004). Biopreservation. In: Devine, C. and Dikeman, M. (eds.) Ency-
clopedia of Meat Sciences. Amsterdam: Elsevier, pp. 68–74.
Holzapfel, W. H. (2002). Appropriate starter culture technologies for small-scale fer-
mentation in developing countries. International Journal of Food Microbiology, 75,
197–212.
Functionalities of Meat Bacterial Starters 611

Hammes, W. P. (2012). Metabolism of nitrate in fermented meats: The characteristic

feature of a specific group of fermented foods. Food Microbiology, 29, 151–156.
Hebert, E. M., Saavedra, L., Taranto, M. P. et al. (2012). Genome sequence of the bac-
teriocin-producing Lactobacillus curvatus strain CRL705. Journal of Bacteriology,
194, 538–539.
Irlinger, F., Loux, V., Bento, P. et al. (2012). Genome sequence of Staphylococcus equo-
rum subsp. equorum Mu2, isolated from a French smear-ripened cheese. Journal
of Bacteriology, 194, 5141–5142.
Jahreis, G., Vogelsang, H., Kiessling, G., Schubert, R., Bunte, C. and Hammes, W. P.
(2002). Influence of probiotic sausage (Lactobacillus paracasei) on blood lipids and
immunological parameters of healthy volunteers. Food Research International, 35,
133–138.
Janssens, J., Van de Mijnsbrugge, A., Sànchez Mainar, M., Bazarini, T., De Vuyst, L.
and Leroy, F. (2014). The use of nucleosides and arginine as alternative energy
sources by coagulase negative staphylococci in view of meat fermentation. Food
Microbiology, 39, 53–60.
Jeong, D. W., Na, H., Ryu, S. and Lee, J. H. (2016). Complete genome sequence of
Staphylococcus equorum KS1039 isolated from Saeu-jeotgal, Korean high-salt-
fermented seafood. Journal of Biotechnology, 219, 88–89.
Hughes, M. C., Kerry, J. P., Arendt, E. K., Kenneally, P. M., McSweeney, P. H. H. and
O’Neill, E. E. (2002). Characterization of proteolysis during the ripening of
semi-dry fermented sausages. Meat Science, 62, 205–216.
Josephsen, J. and Jespersen, L. (2004). Starters cultures and fermented products. In:
Hui, Y. H., Meunier-Goddik, L., Hansen, A. S. et al. (eds.) Handbook of Food and
Beverage Fermentation Technology. New York, NY: Marcel Dekker, pp. 23–49.
Kröckel, L. (2006). Use of probiotic bacteria in meat products. Fleischwirtschaft, 86,
109–113.
Labrie, S. J., El Haddad, L., Tremblay, D. M. et al. (2014). First complete genome
sequence of Staphylococcus xylosus, a meat starter culture and a host to propagate
Staphylococcus aureus phages. Genome Announcements, 2, e00671–e00714.
Larrouture, C., Ardaillon, V., Pépin, M. and Montel, M. C. (2000). Ability of meat
starter cultures to catabolize leucine and evaluation of the degradation products
by using an HPLC method. Food Microbiology, 17, 563–570.
Leroy, S., Giammarinaro, P., Chacornac, J. P., Lebert, I. and Talon, R. (2010). Biodiversity
of indigenous staphylococci of naturally fermented dry sausages and manufactur-
ing environments of small-scale processing units. Food Microbiology, 27, 249–301.
Leroy, F., Goudman, T. and De Vuyst, L. (2015). The influence of processing param-
eters on starter cultures performance. In: Toldrá, F. (ed.) Handbook of Fermented
Meat and Poultry (2nd Ed.). Chichester, West Sussex, UK: John Wiley & Sons,
pp. 169–175.
Leroy, S., Vermassen, A. and Talon, R. (2016). Staphylococcus: Occurrence and proper-
ties. In: Cabalerro, B., Finglas, P. M. and Toldrá, F. (eds.) Encyclopedia of Food and
Health, vol. 5. Oxford: Academic Press, pp. 140–145.
Li, X., Gu, Q., Lou, X. et al. (2013). Complete genome sequence of the probiotic Lacto-
bacillus plantarum strain ZJ316. Genome Announcements, 1, e00094–e00113.
López, C., Bru, E., Vignolo, G. and Fadda, S. (2015). Identification of small peptides
arising from hydrolysis of meat proteins in dry fermented sausages. Meat Sci-
ence, 104, 20–29.
612 Advanced Technologies for Meat Processing, Second Edition

Lücke, F. K. (2000). Utilization of microbes to process and preserve meat. Meat Science,
56, 105–115.
Madsen, S. M., Beck, H. C., Ravn, P., Vrang, A., Hansen, A. M. and Israelsen, H. (2002).
Cloning and inactivation of a branched-chain-amino-acid aminotransferase
gene from Staphylococcus carnosus and characterization of the enzyme. Applied
and Environmental Microbiology, 68, 4007–4014.
Mahoney, M. and Henriksson, A. (2003). The effect of processed meat and meat starter
cultures on gastrointestinal colonization and virulence of Listeria monocytogenes
in mice. International Journal of Food Microbiology, 84, 255–261.
Makarova, K., Slesarev, A., Wolf, Y. et al. (2006). Comparative genomics of the lactic
acid bacteria. Proceedings of the National Academy of Sciences, 103, 15611–15616.
Marceau, A., Zagorec, M., Chaillou, S., Méra, T. and Champomier-Vergès, M. C.
(2004). Evidence for the involvement of at least six proteins in Lactobacillus sakei
adaptation to cold temperature and addition of NaCl. Applied and Environmental
Microbiology, 70, 7260–7268.
Mauriello, G., Casaburi, A., Blaiotta, G. and Villani, F. (2004). Isolation and techno-
logical properties of coagulase negative staphylococci from fermented sausages
of Southern Italy. Meat Science, 67, 149–158.
McLeod, A., Brede, D. A., Rud, I. and Axelsson, L. (2013). Genome sequence of Lacto-
bacillus sakei subsp. sakei LS25, a commercial starter culture strain for fermented
sausage. Genome Announcements, 1, e00475–e00513.
Midha, S., Ranjan, M., Sharma, V. et al. (2012). Genome sequence of Pediococcus pento-
saceus strain IE-3. Journal of Bacteriology, 194, 4468.
Molenaar, D., Bringel, F., Schuren, F. H., de Vos, W. M., Siezen, R. J. and Kleerebezem,
M. (2005). Exploring Lactobacillus plantarum genome diversity by using microar-
rays. Journal of Bacteriology, 187, 6119–6127.
Mosbah, H., Sayari, A., Mejdoub, H., Dhouib, H. and Gargouri, Y. (2005). Biochemi-
cal and molecular characterization of Staphylococcus xylosus lipase. Biochemica
Biophysica Acta General Subjects, 1723, 282–291.
Müller, A., Huptas, C., Wenning, M., Schmidt, H. and Weiss, A. (2015). Draft genome
sequence of Staphylococcus carnosus subsp. utilis LTH 7013, isolated from South
Tyrolean Ham. Genome Announcements, 3, e00456–e00515.
Muthukumarasamy, P. and Holley, R. A. (2006). Microbial and sensory quality of dry
fermented sausages containing alginate-microencapsulated Lactobacillus reuteri.
International Journal of Food Microbiology, 111, 164–169.
Nyquist, O. L., McLeod, A., Brede, D. A., Snipen, L., Aakra, Å. and Nes, I. F. (2011).
Comparative genomics of Lactobacillus sakei with emphasis on strains from
meat. Molecular Genetics and Genomics, 285, 297–311.
Olesen, P. T., Meyer, A. S. and Stahnke, L. (2004a). Generation of flavour compounds
in fermented sausages—The influence of curing ingredients, Staphylococcus
starter culture and ripening time. Meat Science, 66, 675–687.
Olesen, P. T. and Stahnke, L. (2003). The influence of precultivation parameters on the
catabolism of branched-chain amino acids by Staphylococcus xylosus and Staphy-
lococcus carnosus. Food Microbiology, 20, 621–629.
Olesen, P. T., Stahnke, L. and Talon, R. (2004b). Effect of ascorbate, nitrate and nitrite
on the amount of flavour compounds produced from leucine by Staphylococcus
xylosus and Staphylococcus carnosus. Meat Science, 68, 193–200.
Functionalities of Meat Bacterial Starters 613

Papamanoli, E., Tzanetakis, N., Litopoulou-Tzanetaki, E. and Kotzekidou, P. (2003).

Characterization of lactic acid bacteria isolated from a Greek dry-fermented
sausage in respect of their technological and probiotic properties. Meat Science,
65, 859–867.
Pennacchia, C., Ercolini, D., Blaiotta, G., Pepe, O., Mauriello, G. and Villani, F. (2004).
Selection of Lactobacillus strains from fermented sausages for their potential use
as probiotics. Meat Science, 67, 309–317.
Pidcock, K., Heard, G. M. and Henriksson, A. (2002). Application of nontraditional
meat starter cultures in production of Hungarian salami. International Journal of
Food Microbiology, 76, 75–81.
Ravysts, F., De Vuyst, L. and Leroy, F. (2012). Bacterial diversity and functionalities in
food fermentations. Engineering in Life Sciences, 12, 356–367.
Rimaux, T., Rivière, A., Illeghems, K., Weckx, S., De Vuyst, L. and Leroy, F. (2012).
Expression of arginine deiminase pathway genes in Lactobacillus sakei is strain
dependant and is affected by the environmental pH. Applied and Environmental
Microbiology, 78, 4874–4883.
Rimaux, T., Vrancken, G., Vuylsteke, B., De Vuyst, L. and Leroy, F. (2011). The pen-
tose moiety of adenosine and inosine is an important energy source for the
fermented-meat starter culture Lactobacillus sakei CTC 494. Applied and Environ-
mental Microbiology, 77, 6539–6550.
Rosenstein, R., Nerz, C., Biswas, L. et al. (2009). Genome analysis of the meat starter
culture bacterium Staphylococcus carnosus TM300. Applied and Environmental
Microbiology, 45, 811–822.
Sànchez Mainar, M. and Leroy, F. (2015). Process-driven bacterial community dynam-
ics are key to cured meat colour formation by coagulase negative staphylococci
via nitrate reductase or nitric oxide synthase activities. International Journal of
Food Microbiology, 212, 60–66.
Sànchez Mainar, M., Weckx, S. and Leroy, F. (2014). Coagulase negative staphylo-
cocci favour arginine conversion into ornithine despite a widely present poten-
tial for nitric oxide synthase activity. Applied and Environmental Microbiology, 80,
7741–7751.
Sapp, A. M., Mogen, A. B., Almand, E. A. et al. (2014). Contribution of the nos-pdt
operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.
PLOS ONE, 9(10), e108868. doi:10.1371/journal.pone.0108868.
Sakinc, T., Woznowski, M., Ebsen, M. and Gatermann, S. G. (2005). The surface asso-
ciated protein of Staphylococcus saprophyticus is a lipase. Infection and Immunity,
73, 6419–6428.
Sondergaard, A. K. and Stahnke, L. (2002). Growth and aroma production by Staphy-
lococcus xylosus, S. carnosus and S. equorum: A comparative study in model sys-
tems. International Journal of Food Microbiology, 75, 99–109.
Stahnke, L. H. (2002). Flavour formation in fermented sausage. In: Toldrá, F. (ed.)
Research Advances in Quality of Meat and Meat Products. Trivandrum, India:
Research Signpost, pp. 193–223.
Stravopoulou D. A., Borremans, W., De Vuyst, L., De Smet, S. and Leroy, F. (2015).
Amino acid conversions by coagulase negative staphylococci in a rich medium:
Assessment of inter- and intraspecies heterogeneity. International Journal of Food
Microbiology, 212, 34–40.
614 Advanced Technologies for Meat Processing, Second Edition

Sturino, J. M., Rajendran, M. and Altermann, E. (2013). Draft genome sequence of the
pediocin-encoding biopreservative and biocontrol strain Pediococcus acidilactici
D3. Genome Announcements, 1, e00208–e00213.
Talon, R., Leroy-Sétrin, S. and Fadda, S. (2002). Bacterial starters involved in the qual-
ity of fermented meat products. In: Toldrá, F. (ed.) Research Advances in Quality
of Meat and Meat Products. Trivandrum, India: Research Signpost, pp. 175–191.
Talon, R., Leroy-Sétrin, S. and Fadda, S. (2004). Dry fermented sausages. In: Hui, Y. H.,
Meunier-Goddik, L., Hansen, A. S. et al. (eds.) Handbook of Food and Beverage
Fermentation Technology. New York, NY: Marcel Dekker, pp. 397–416.
Talon, R. and Leroy, S. (2014). Fermented meat products and the role of starter cul-
tures. In: Batt, C. A. and Tortorello, M. L. (eds.) Encyclopedia of Food Microbiology,
vol. 1. Oxford: Elsevier, Academic Press, pp. 870–874.
Talon, R., Walter, D. and Montel, M. C. (2000). Growth and effect of staphylococci and
lactic acid bacteria on unsatured free fatty acid. Meat Science, 54, 41–47.
Tjener, K., Stahnke, L. H., Andersen, L. and Martinussen, J. (2004). The pH-unrelated
influence of salt, temperature and manganese on aroma formation by Staphylo-
coccus xylosus and Staphylococcus carnosus in a fermented meat model system.
International Journal of Food Microbiology, 97, 31–42.
Työppönen, S., Petäjä, E. and Mattila-Sandholm, T. (2003). Bioprotectives and probiot-
ics for dry sausages. International Journal of Food Microbiology, 83, 233–244.
Verluyten, J., Messens, W. and De Vuyst, L. (2003). The curing agent sodium nitrite,
used in the production of fermented sausages, is less inhibiting to the bacterio-
cin-producing meat starter culture Lactobacilluscurvatus LTH 1174 under anaero-
bic conditions. Applied and Environmental Microbiology, 69, 3833–3839.
Vermassen, A., de La Foye, A., Loux, V., Talon, R. and Leroy, S. (2014). Transcriptomic
analysis of Staphylococcus xylosus in the presence of nitrate and nitrite in meat
reveals its response to nitrosative stress. Frontiers in Microbiology, 5, 691, 1–15.
Vermassen, A., Dordet-Frisoni, E., de La Foye, A. et al. (2016). Adaptation of Staphy-
lococcus xylosus to nutrients and osmotic stress in a salted meat model. Frontiers
in Microbiology, 7, 87, 1–17.
Vignolo, G., Castelano, P. and Fadda, S. (2015). Bioprotective cultures. In: Toldrá, F.
(ed.) Handbook of Fermented Meat and Poultry (2nd Ed.). Chichester, West Sussex,
UK: John Wiley & Sons, pp. 129–137.
Villani, F., Sannino, L., Moschetti, G. et al. (1997). Partial characterization of an antag-
onistic substance produced by Staphylococcus xylosus 1E and determination of
the effectiveness of the producer strain to inhibit Listeria monocytogenes in Italian
sausages. Food Microbiology, 14, 555–566.
Wang, Y., Chen, C., Ai, L. et al. (2011). Complete genome sequence of the probiotic
Lactobacillus plantarum ST-III. Journal of Bacteriology, 193, 313–314.
Zhang, Z. Y., Liu, C., Zhu, Y. Z. et al. (2009). Complete genome sequence of Lactobacillus
plantarum JDM1. Journal of Bacteriology, 191, 5020–5021.
20
Modified Atmosphere Packaging

Joseph G. Sebranek and Terry A. Houser

CONTENTS
20.1 Introduction ................................................................................................ 616
20.2 Definitions................................................................................................... 617
20.3 History ......................................................................................................... 618
20.4 Purposes ...................................................................................................... 619
20.5 Applications ................................................................................................ 620
20.6 Gases Used in Map Systems ..................................................................... 620
20.6.1 Carbon Dioxide .............................................................................. 621
20.6.2 Nitrogen .......................................................................................... 623
20.6.3 Oxygen ............................................................................................ 624
20.6.4 Carbon Monoxide .......................................................................... 625
20.6.5 Dynamic Headspace Changes in MAP Systems ....................... 626
20.7 Product Characteristics Following Map Applications ......................... 627
20.7.1 Fresh (Raw) Meat ........................................................................... 627
20.7.1.1 High-Oxygen MAP ......................................................... 627
20.7.1.2 High-Carbon-Dioxide MAP .......................................... 629
20.7.1.3 MAP with Carbon Monoxide ........................................ 629
20.7.2 Cooked and Cured-and-Cooked Meat Products ....................... 629
20.8 Comparisons of Map with VP for Meat and Poultry............................630
20.8.1 Vacuum versus MAP for Fresh Meat ..........................................630
20.8.2 Vacuum versus MAP Packaging of Cooked and
Cured-and-Cooked Meat Products ............................................. 631
20.8.3 Effects of High-Carbon-Dioxide MAP ........................................ 632
20.9 Packaging Films and Film Properties ..................................................... 632
20.9.1 Exterior Film Materials .................................................................633
20.9.1.1 Nylon.................................................................................633
20.9.1.2 Polyester............................................................................633
20.9.1.3 Polypropylene ..................................................................633
20.9.2 Barrier Film Materials ...................................................................633
20.9.2.1 Ethylene Vinyl Alcohol ...................................................633
20.9.2.2 Polyvinylidene Chloride ................................................634
20.9.3 Sealant Materials ............................................................................634
20.9.3.1 Polyethylenes ...................................................................634
20.9.3.2 Ethylene Vinyl Acetate ...................................................634

615
616 Advanced Technologies for Meat Processing, Second Edition

20.9.4 Rigid Materials ...............................................................................634

20.9.4.1 Polyvinyl Chloride..........................................................634
20.9.4.2 Polystyrene ......................................................................634
20.10 Effects of MAP on Pathogens in Meat and Poultry............................. 635
20.10.1 Salmonella spp. .............................................................................. 635
20.10.2 Yersinia enterocolitica ..................................................................... 635
20.10.3 Escherichia coli O157:H7 ............................................................... 635
20.10.4 Campylobacter jejuni ...................................................................... 636
20.10.5 Staphylococcus aureus .................................................................... 636
20.10.6 Clostridium botulinium .................................................................. 636
20.10.7 Clostridium perfringens ................................................................. 637
20.10.8 Bacillus cereus ................................................................................ 637
20.10.9 Listeria monocytogenes................................................................... 637
20.11 MAP as a Component in the Hurdle Concept ..................................... 638
20.12 AP Components........................................................................................ 638
20.13 Leakers and Package Integrity ...............................................................640
20.14 Regulatory Issues .....................................................................................640
20.15 Conclusions ............................................................................................... 641
References.............................................................................................................642

20.1 Introduction
Modified atmosphere packaging (MAP) for meat and poultry products is
a food preservation concept that is far from new. However, the develop-
ment of plastic films in the 1960s (Siegel, 2010a) made it possible to eas-
ily and cheaply enclose meat products in clear films and to incorporate
preservative gases with the closed atmosphere to improve product shelf
life and appearance. This has allowed the successful commercialization
of MAP. Prior to the development of flexible films, carbon dioxide (CO2)
gas was recognized as a preservative agent for meat and poultry for well
over 100 years (Rao and Sachindra, 2002), and consequently, use of carbon
dioxide gas in MAP has been studied extensively (Brooks, 1933; Clark
and Lentz, 1969; Gill and Tan, 1980; McMillin, 2008). Various other gases
including nitrogen, oxygen, and carbon monoxide (CO) have been stud-
ied more recently as MAP technology for meat and poultry products has
continued to develop (Kropf, 2004). The current use of MAP for commer-
cial applications has become commonplace because more and more meat
and poultry products are processed in centralized facilities followed by
transportation over increasingly long distances. As a result, it has become
critical for the industry to increase the shelf life of meat and poultry
products as much as possible in order to consistently deliver wholesome,
high-quality products to consumers. Consumers demand, and have come
to expect, fresh-like, high-quality food products, and the role of pack-
aging systems such as MAP has become increasingly important to meet
Modified Atmosphere Packaging 617

consumer expectations. New developments in flexible film properties and

new technology for gas handling and packaging equipment have facili-
tated the development of an increasingly sophisticated body of scientific
knowledge about MAP systems.
There are several distinct advantages to MAP technology for meat and
poultry products. Use of gases such as carbon dioxide will slow the growth
of many microorganisms and, therefore, extend the microbiological shelf life
of fresh (raw) meat products. Gases can also be used to slow some of the
chemical and biochemical processes that are responsible for product dete-
rioration, and this will also contribute to improved shelf life (Summo et al.,
2016; Bao and Ertbjerg, 2015).
One of the recent developments in MAP technology that has contrib-
uted to further improvements in shelf life for meat and poultry is the
case-ready option for retail packages. Retail-ready products that are
packaged in centralized facilities under controlled, highly sanitary con-
ditions will have a reduced number of contaminating microorganisms,
and because there is no opportunity for subsequent contamination, bac-
terial numbers will remain low for a longer period of time. In addition
to the advantage of time for transport over longer distances, increased
shelf life typically means less wasted products at the retail level because
there are less throwaways due to spoilage. MAP also offers a significant
opportunity to improve product appearance. Attractive meat color, for
example, can be maintained longer and even dramatically improved in
some cases, with MAP gases. Package purge (free water inside the pack-
age) is reduced by MAP compared with vacuum, and product appearance
is improved as a result. Finally, the use of trays and rigid containers to
provide a headspace for gases also offers opportunity for attractive visual
displays of the products inside the packages.
There are also some potential disadvantages to MAP systems. Packaging
costs may be greater than other systems, though a longer product shelf life
and less waste can more than pay the difference. Specialized equipment and
worker training may also be necessary and, if so, represent increased time
and money commitments though, again, the return on these investments is
most often positive.

20.2 Definitions
MAP has been defined as a process whereby a perishable product is
placed in a barrier film package, air is removed by vacuum or flushing,
and the package is filled with a predetermined gas or mixture of gases
with a composition different than air, followed by sealing of the pack-
age (Kropf, 2004; McMillin, 2008). Simply put, this means that MAP is a
618 Advanced Technologies for Meat Processing, Second Edition

packaging technique that utilizes an atmosphere modified to be differ-

ent from air. It is important to note that MAP atmospheres for meat and
poultry, particularly raw meat and poultry, are dynamic and will change
with time. The gas or gas mixture used in the packages will change as a
result of product and microbial metabolism, absorption of gases by the
product and, in some cases, by limited diffusion of gases through the
barrier film. Controlled atmosphere packaging (CAP), on the other hand,
is a similar packaging concept but one in which the gas atmosphere is
kept relatively constant during the package life. For meat and poultry,
this usually means very complete evacuation of the package, very high-
barrier packaging film, and a means of maintaining the gas composition,
often by utilizing a compound or component that will slowly generate the
desired gases to maintain the target composition. Active packaging (AP)
is yet another packaging concept in which the package actively modi-
fies conditions during storage. Examples of this concept include packages
with oxygen, odor or moisture absorbers, carbon dioxide emitters, and
packaging films that release antimicrobial compounds and other sub-
stances during storage.
Vacuum packaging (VP), commonly used for fresh, raw meat and poultry,
is simply the removal of air prior to sealing the product in a barrier film.
However, in reality, for fresh meat this is a form of MAP because muscle and
microbial metabolism will utilize residual oxygen to produce carbon dioxide
and the net result is a modified atmosphere that achieves significant shelf-
life extension due to both decreased oxygen and increased carbon dioxide
concentrations. MAP is distinguished from VP by the headspace that allows
introduction of a much larger volume of gases to the package, and by elimi-
nation of the physical pressure on the product that occurs with vacuum.

20.3 History
The use of carbon dioxide as a preservative for meat was suggested as
early as in 1882 and was further developed for long-range shipments
of meat from Australia and New Zealand to Great Britain in the 1930s
(Dixon and Kell, 1989). By the 1950s, researchers were investigating the
relationships between carbon dioxide concentrations, product shelf life,
and product quality. It was determined that fresh meat was likely to dis-
color when high concentrations of carbon dioxide were used, and rec-
ommendations of an upper limit of about 20%–25% were common for
red meat species (beef, pork, and lamb). Nitrogen was typically added to
exclude oxygen in atmospheres that included increased carbon dioxide.
In the 1970s and 1980s, the use of oxygen in MAP to achieve attractive
meat color was studied, and it was demonstrated that high oxygen levels
Modified Atmosphere Packaging 619

(40% or more) would help to overcome the discoloration of high carbon

dioxide concentration (Bartkowski et al., 1982). The combination has been
shown to achieve an improved color and shelf life but there have been
concerns for oxidized odor and taste as a result of the high-oxygen atmo-
sphere (Kropf, 2004; Bao and Ertbjerg, 2015). More recently, use of carbon
monoxide for MAP packaging of fresh meat has been commercialized.
The U.S. Food and Drug Administration (FDA) approved master-bag
packaging with 0.4% carbon monoxide for fresh meat in 2002 (U.S. FDA,
2002), and in 2004, extended this approval to retail case-ready packaging
(U.S. FDA, 2004). However, approval of carbon monoxide is not universal
around the world with only Australia and New Zealand in addition to the
United States allowing its use.

20.4 Purposes
The primary purpose of MAP systems for meat and poultry products is
to achieve a longer shelf life in order to meet the demands of distribution
over increasingly greater distances. Improved shelf life for distribution
can be achieved in two general ways: first, by packaging of large primal
cuts in either vacuum or MAP for transportation, followed by fabrica-
tion and repackaging at or near the retail location, or second, by MAP
packaging of fully case-ready units which are then shipped to the retail
location. A variation of the case-ready packaging approach is to use a
large master package with MAP technology to enclose several case-ready
units which are then removed from the master package for retail display.
In each case, shelf life is improved over simple overwrap packaging. Shelf
life, however, is not a simple issue. The predominant concern for shelf
life is bacterial growth, which is most often the limiting factor. However,
an attractive color is also a critical component in the determination of
shelf life and products must be capable of providing an attractive color for
retail display. For fresh, raw meat, desirable color may be developed and
retained by the packaging system during distribution or may be allowed
to develop later in display. These two approaches require very different
packaging systems in order to achieve the same color end point for fresh
meat. For cooked and for cured-and-cooked meat products, packaging is
more critical for color preservation than for color development. Conse-
quently, MAP systems for these two types of cooked products are gener-
ally similar. In addition to reduced microbial growth and extended color
life, shelf life also includes product quality attributes such as odor, flavor,
and texture. Minimal change in these attributes from what is typical for
freshly harvested or further processed products is an important objective
of MAP systems.
620 Advanced Technologies for Meat Processing, Second Edition

Finally, MAP systems have been studied both for concerns about, and con-
tributions to, product safety. There has been concern in the past that sup-
pression of spoilage microorganisms in anaerobic conditions might result in
growth of pathogens, especially in case of temperature abuse. More recently,
MAP systems have been studied as a means of improving the impact of vari-
ous other product preservation treatments. This “hurdle concept” would
mean that MAP might be most valuable for improving product safety when
combined with other antimicrobial treatments.

20.5 Applications
Applications of MAP systems for meat and poultry products include use of
a variety of gases, depending on the product being packaged. In addition,
gas blends in a variety of ratios are also utilized to meet different product
needs. For example, fresh meat primals may be packaged in a blend of car-
bon dioxide and nitrogen because at least 20%–25% carbon dioxide is nec-
essary to impact bacterial growth and extend shelf life. For retail display
of fresh meat, however, MAP packaging may include high levels of oxygen
(up to 80%) with carbon dioxide or sometimes nitrogen for the balance. The
purpose of oxygen is color development. Carbon monoxide at 0.3%–0.5%
may also be included, where permitted, for color development of fresh
meat and, in this case, because color is more stable with carbon monoxide,
carbon dioxide can be included at greater concentrations to improve micro-
bial inhibition. Nitrogen gas is commonly used at 100% in MAP applica-
tions for cooked and cured-and-cooked meat products where the microbial
load is very low and exclusion of oxygen is the most critical concern for
shelf life. Further, MAP systems can take the form of a master pack (large
package overwrap of several smaller packages) or stand-alone small units
(typically retail-ready packages) (Siegel, 2010b). The master-pack approach
typically utilizes a high-barrier bag for the outer package, which contains
the desired atmosphere, and films with relatively high permeability for the
smaller units. The case-ready pack approach will use high-barrier films for
the final package in order to retain the MAP gas mixture, which is placed
inside the package.

20.6 Gases Used in Map Systems

The three most common gases used for MAP are carbon dioxide, nitrogen,
and oxygen. All of these are present in the air that is removed from the
Modified Atmosphere Packaging 621

package initially, but the ratio of these gases is considerably different in MAP
applications compared to the ambient atmosphere. Air is composed of about
0.03% carbon dioxide, 78% nitrogen, and 21% oxygen. In MAP systems, how-
ever, ambient air is typically replaced by gas mixtures that are much higher
in one or more of these gases.
In addition to these three gases, carbon monoxide at levels of 0.3%–0.5%
has been used in some MAP systems for fresh meat because of the unique
effects that carbon monoxide has on the formation and stability of an attrac-
tive red meat color. The noble gases (helium, argon, xenon, and neon) have
also been studied for use in MAP systems because they are very inert and
serve well as filler gases. These gases are used in some MAP systems for
food products (Mullan and McDowell, 2003; Heinrich et al., 2016). However,
there is no scientific advantage to the noble gases over the use of nitrogen for
meat and poultry, and there is very little, if any, use of these gases for meat
and poultry packaging.

20.6.1 Carbon Dioxide

Carbon dioxide is a colorless gas with a slightly pungent odor (Mullan and
McDowell, 2003). The gas dissolves readily in water and will produce car-
bonic acid (H2CO3) in solution (Jakobsen and Bertelsen, 2002), reducing the
solution pH. A pH change in meat held under a high-carbon-dioxide atmo-
sphere is typically observed despite the relatively high buffering capacity of
meat.
The centerpiece of MAP systems for fresh meat has long been carbon
dioxide because of the ability of this gas to inhibit a wide range of micro-
organisms. Carbon dioxide is most effective for inhibition of gram-negative
bacteria that grow rapidly on fresh meat. Consequently, carbon dioxide
is considered the primary antimicrobial agent in MAP systems. Carbon
dioxide has been shown to increase both the lag phase of growth and the
generation time of affected microorganisms, but the mechanism by which
carbon dioxide achieves microbial inhibition is not entirely clear. Certainly,
the replacement of oxygen by carbon dioxide will help to suppress growth of
aerobic organisms. However, it has been most frequently suggested that the
primary antimicrobial effect of carbon dioxide is due to its ability to penetrate
bacterial membranes and alter the interior pH of cells, thus affecting cellu-
lar metabolic processes (Dixon and Kell, 1989). The effect of carbon dioxide
on meat pH is well recognized and may, by itself, contribute to the inhibi-
tion of microbial growth that has been observed. Even though the amount
of carbonic acid formed from carbon dioxide is relatively small (~2%) at the
normal pH range of meat, it has been reported that meat pH can decline as
much as 0.35 pH units in a carbon dioxide atmosphere (Daniels et al., 1985;
Tan and Gill, 1982). In addition to the pH effect, it has also been reported
that carbon dioxide inhibited substrate uptake by microbial cells. Substrate
limitation is another potential explanation of the inhibitory effect of carbon
622 Advanced Technologies for Meat Processing, Second Edition

dioxide on bacteria (Farber, 1991). Other theories on the antimicrobial action

of carbon dioxide include the direct inhibition of enzymes and changes in
the basic properties of proteins (Dixon and Kell, 1989). While the mechanism
of action of carbon dioxide that results in bacterial inhibition is not entirely
understood, it is clear that carbon dioxide is an effective antimicrobial agent.
The effectiveness of carbon dioxide as an antimicrobial agent is usually
considered to be a function of the concentration of the gas in the package
headspace but several researchers have suggested that the concentration of
carbon dioxide in the product may be more indicative of inhibitory effective-
ness (Devlieghere et al., 2001; Jakobsen and Bertelsen, 2004). The effectiveness
of carbon dioxide atmospheres on bacterial growth has been reported to be
greater for products with low initial bacterial contamination (Gill and Tan,
1980; Krause et al., 2003). This may be the result of carbon dioxide extend-
ing the lag phase of bacterial growth for a bacteriostatic effect rather than a
bacteriocidal effect.
Carbon dioxide is highly soluble in meat and aqueous solutions. The solu-
bility of carbon dioxide in water is about 30 times greater than the solubility
of oxygen and about 60 times greater than the solubility of nitrogen (Gill,
1988). Solubility in the water phase means that carbon dioxide dissolves
readily in lean meat tissue. Because carbon dioxide has a linear molecular
structure (O=C=O) with little polarity, the gas is even more soluble in non-
polar solvents than in water. Consequently, carbon dioxide is also readily
soluble in fats, and is more soluble in fats than oxygen or nitrogen. Thus, car-
bon dioxide is highly soluble in both lean and fat tissues of meat and poul-
try products. The solubility of carbon dioxide gas in meat is great enough
that when a large volume of the gas is used in meat package headspace, the
gas concentration in the headspace will decline very significantly and will
continue to do so until a product saturation point or equilibrium is reached
(Daniels et al., 1985). The amount of gas absorbed can be great enough to
cause collapse of the package. Typically, package collapse results in an unat-
tractive appearance and can be so extreme that the package appears to have
been sealed under vacuum; consequently, it is recommended that the amount
of carbon dioxide used in MAP for fresh meat be applied in the amount that
will not collapse the package. Including an inert, filler gas such as nitrogen is
effective for preventing package collapse. However, several factors can influ-
ence carbon dioxide solubility in meat tissue. For example, fat content, water
content, pH, and temperature are product factors that affect carbon dioxide
absorption (Gill, 1988; Jakobsen and Bertelsen, 2002; Mullan and McDowell,
2003; Zhao et al., 1995) while gas partial pressure and the ratio of headspace
volume-to-meat volume are package factors that are important.
The solubility of carbon dioxide increases with decreasing temperature
and it has been noted that the antimicrobial activity of carbon dioxide is
considerably greater at temperatures below 10°C, compared with tempera-
tures of 15°C or higher (Devlieghere et al., 2001). The solubility of carbon
dioxide in meat has also been reported to change by as much as 35% for
Modified Atmosphere Packaging 623

each unit change in pH (Kropf, 2004). The relationships between tempera-

ture, gas pressure, gas volume, absorbed carbon dioxide, pH changes, and
penetration of microbial cells by the gas are complex, but are likely to be a
very important part of the shelf-life extension achieved by carbon dioxide
in MAP systems. These factors were studied in a multifactorial experiment
to determine the relative impact of each factor on the amounts of carbon
dioxide absorbed by ground pork samples (Jakobsen and Bertelsen, 2002).
The results of this study suggested that the gas partial pressure and the gas
headspace-to-meat volume ratio were the most important factors. If more
than 30% carbon dioxide was used, a volume of at least 2 L of gas/kg of meat
was necessary to prevent package collapse. For volume ratios greater than
2 L:kg, the partial pressure of carbon dioxide was most predictive of the
amount of absorbed gas. The product factors of fat/lean composition, pH,
and temperature did not have as great an impact on absorption of carbon
dioxide as gas partial pressure and volume.
Package atmospheres that contain relatively low levels of carbon dioxide
(less than 30%) seldom result in package collapse because the proportion
of total headspace gas absorbed is relatively small (Jakobsen and Bertelsen,
2004). In some cases, carbon dioxide concentrations have been observed to
increase in the headspace of packages with less than 30% initially due to gen-
eration of carbon dioxide from muscle or microbial metabolism of residual
oxygen. Excessive carbon dioxide in package headspace can be an issue in
ground meat packages when carbon dioxide is used to chill the ground meat
prior to packaging. Excess carbon dioxide “snow” remaining in the meat will
volatilize in the package, causing an initial swelling followed by extreme
package collapse when the carbon dioxide is slowly absorbed by the meat.
It has been observed that products that have absorbed significant amounts
of carbon dioxide may show evidence of physical disruption including vis-
ible pores and fissures following cooking. The physical disruption appears
to result from volatilization of the absorbed gas when heat is applied (Bruce
et al., 1996). Sørheim et al. (2004) reported greater cooking losses from ground
beef stored in 100% carbon dioxide, and observed fissures in the product fol-
lowing cooking.

20.6.2 Nitrogen
Nitrogen is an inert gas that is colorless, odorless, and tasteless (Mullan and
McDowell, 2003). The gas is nonflammable, has a lower density than air, and
has a low solubility in water and fat. Nitrogen can affect meat product shelf
life indirectly because when nitrogen is used to completely displace oxygen,
the atmosphere will not allow growth of aerobic microorganisms. Because
aerobic organisms are the fastest growing organisms normally present on
fresh meat and poultry, preventing aerobic growth will improve shelf life.
However, nitrogen has no direct effect on microbial growth and, conse-
quently, has no impact on anaerobic bacteria. The low solubility of nitrogen
624 Advanced Technologies for Meat Processing, Second Edition

is advantageous for use as a filler gas with carbon dioxide to prevent package
collapse that can occur when carbon dioxide is absorbed by the product.
Nitrogen gas, usually 100%, is most often used for flush-and-fill packages
of cooked, cured meats, particularly sliced items where slice adhesion is to
be prevented. In these packages, oxygen must be reduced to 0.5% or less for
good cured color stability (Møller et al., 2000). For uncured, cooked products,
exclusion of oxygen is critical to suppression of rancidity and flavor losses.
It is important to remember that fully cooked products, either cured or
uncured, will typically have low microbial numbers and prevention of flavor
changes during storage is often more critical to shelf life of these products
than microbial inhibition. The use of 100% nitrogen can extend shelf life of
the products by preventing the chemical changes and flavor losses induced
by exposure to oxygen. Carbon dioxide is seldom used for packaging these
products because microbial control has been achieved by other means.

20.6.3 Oxygen
Oxygen is a colorless, odorless gas that has relatively low solubility in water,
supports combustion (is explosive), and is very reactive with a wide variety
of biological compounds (Mullan and McDowell, 2003). Oxygen is involved
in many of the deteriorative reactions in food systems that result in serious
losses of quality. These reactions include fat oxidation, rancidity develop-
ment, browning reactions, and pigment oxidation. The principle role of oxy-
gen in packaging of meat and poultry is for development and maintenance
of the cherry-red color that is considered essential to display of fresh meat
(Kropf, 2004). The red oxymyoglobin pigment develops readily in normal
atmospheric oxygen pressure but an elevated oxygen concentration of 65%–
80% in MAP helps to form a deeper layer of oxymyoglobin pigment on the
product surface that will extend the time during which the color appears
attractive (Siegel, 2010b). However, because oxygen will also promote growth
of rapidly proliferating, aerobic microorganisms, oxygen in MAP systems
for fresh meat is usually combined with 20%–25% carbon dioxide to achieve
improved microbial control (Siegel, 2010b). High-oxygen MAP systems with
carbon dioxide will achieve a greater shelf life for fresh meat than conven-
tional (atmospheric) aerobic packages but will not match the shelf life of
vacuum-packaged products under similar conditions.
It should be noted that fresh meat is particularly susceptible to discoloration
by low levels of oxygen. A partial oxygen pressure in the range of 5–10 mm
of mercury (normal atmospheric partial pressure of oxygen is 159.2 mmHg)
will rapidly convert the myoglobin pigment in meat to metmyoglobin, which
is brown. Further, even very low levels of residual oxygen in MAP packages of
fresh meat will result in at least some metmyoglobin. The meat tissue will utilize
metmyoglobin reducing capacity to convert metmyoglobin back to myoglobin,
but if this occurs, the subsequent reducing capacity is lessened, and the meat
color may not be as stable in later display. Because of this, it is recommended
Modified Atmosphere Packaging 625

that, for fresh meat MAP systems that exclude oxygen, residual oxygen should
not be more than 0.01% (100 parts per million [ppm]) after packaging, and
essentially zero within 24 hours following packaging (Solomon, 2004).
Atmospheric or greater concentration of oxygen results in an attractive red
color for fresh red meat, whereas complete elimination of oxygen (i.e., VP)
prevents color deterioration so that later exposure to oxygen will allow for-
mation of attractive color. A poorly flushed package, a poorly sealed package,
or one that has been subjected to inadequate vacuum is likely to discolor
quickly if low levels of oxygen are present. Low levels of oxygen can also be
a problem in cooked or cured-and-cooked meats where color fading and ran-
cidity may result. In this case, 0.5% or less oxygen in package atmospheres
is recommended. The problems of excess residual oxygen are sometimes
solved by using oxygen scavengers or absorbers to react with any residual
oxygen that may remain in a package. Packets containing iron powders are
most often used for this and can be frequently found in packages of highly
oxygen-susceptible products such as dried snack sticks and jerky (Siegel,
2010a). Use of oxygen scavengers also extends into the concept of AP systems
where oxygen absorbers and other atmosphere modifiers are used to keep
the package atmosphere constant.

20.6.4 Carbon Monoxide

Carbon monoxide is a colorless, odorless, tasteless gas that is flammable
and highly reactive (Mullan and McDowell, 2003). Carbon monoxide has
low solubility in water but is soluble in some organic solvents. It binds
very strongly to blood hemoglobin and muscle myoglobin. The binding to
hemoglobin is the basis for concerns about human toxicity and exposure
when working with carbon monoxide because the carbon monoxide dis-
places oxygen on hemoglobin and prevents oxygen transport in the blood-
stream. While exposure to high concentrations of carbon monoxide can
be fatal, low level exposure is not harmful (Krause et al., 2003). Concern
about toxicity and human exposure, however, is one reason why carbon
monoxide has not been universally used for meat and poultry packaging.
On the other hand, carbon monoxide is not uncommon for treatment of
fish, particularly tuna. In this case, carbon monoxide is applied as a single
gas or as a component of what is termed “tasteless smoke” to improve the
color stability of tuna.
The reaction between carbon monoxide and myoglobin also results in a
strong bond between them, similar to that for hemoglobin, and this bond
is about 1000-fold stronger than the bond between oxygen and myoglobin
(Siegel, 2010b). A beneficial result of this reaction is a stable, bright red meat
color that is visibly undistinguishable from the cherry-red meat color pro-
duced by oxygen. The color induced by carbon monoxide, however, due to
the strong attraction between carbon monoxide and myoglobin, is much
more stable than that resulting from oxygen and can last for several weeks
626 Advanced Technologies for Meat Processing, Second Edition

as opposed to several days for oxymyoglobin color. Because of the color

stability, there are several commercial applications of low levels of carbon
monoxide for MAP packaging. Research has demonstrated that concentra-
tions of 0.3%–0.5% carbon monoxide in MAP are adequate to result in sta-
ble, attractive meat color and that at these concentrations, no human hazard
exists. The US FDA approved use of 0.4% carbon monoxide for meat packag-
ing in 2002, and categorized carbon monoxide as a Generally Recognized As
Safe (GRAS) substance when used as described for MAP (U.S. FDA, 2002).
A distinct advantage of the meat color stability resulting from carbon mon-
oxide in MAP is that discoloration from elevated levels of carbon dioxide is
no longer a problem. Consequently, greater concentration of carbon dioxide
can be introduced to improve microbial control without affecting color. Com-
mercial packaging applications typically combine carbon monoxide with up
to 60% carbon dioxide but research has shown that carbon dioxide at concen-
trations as high as 99.5% will not result in discoloration when combined with
0.5% carbon monoxide (Krause et al., 2003). However, excessive absorption
of carbon dioxide by the meat tissue precludes use of carbon dioxide at such
high concentrations.
The highly stable meat color resulting from carbon monoxide, however,
does not require continuous exposure to carbon monoxide gas. For example,
it has been reported that exposure of beef to 5%–100% carbon monoxide for
up to 24 h, followed by VP, resulted in bright red color for several weeks
(Jayasingh et al., 2001). This approach would allow exposure of meat cuts
to carbon monoxide in a central facility followed by VP for distribution and
retail display.
Another approach, which has been utilized for commercial applications of
carbon monoxide in the United States (U.S. FDA, 2002), is to package retail
fresh meat in a permeable film, then enclose the retail package with a large
master package containing a low (0.4%) level of carbon monoxide combined
with carbon dioxide (30%) and nitrogen (69.6%). Retail packages are then
removed from the master package for retail display.
One of the issues that has been raised relative to use of carbon monoxide
for stabilizing meat color is a concern that the color might be too stable, result-
ing in good color even after microbiological spoilage. However, research has
demonstrated that the combined use of low carbon monoxide with high-
carbon dioxide levels to suppress bacterial growth and spoilage circumvents
this concern (Hunt et al., 2004).

20.6.5 Dynamic Headspace Changes in MAP Systems

Because MAP systems, by definition, are a onetime modification of the
package atmosphere during packaging, all subsequent metabolic and chem-
ical activities that occur within the package are likely to change the atmo-
sphere by consuming some gases and emitting others. In the case of fresh
meat, muscle respiration is still an active process that consumes residual
Modified Atmosphere Packaging 627

oxygen to produce carbon dioxide. Microbial metabolism is also commonly

recognized as a source of oxygen depletion and carbon dioxide emission
(Jakobsen and Bertelsen, 2002). Other factors that contribute to changes in
the gas composition of MAP atmospheres include absorption of gases by the
product and permeability of the packaging film (Zhao et al., 1995). Muscle
respiration generally is most important during the early stages of package
storage while muscle enzyme and metabolic systems are most active (Dan-
iels et al., 1985). Clearly, the amount of carbon dioxide emitted by respiration
will be dependent upon the initial amount of oxygen available. Microbial
effects on the atmospheric gas composition become more pronounced dur-
ing the later stages of storage, when growth of microorganisms becomes
more extensive. Absorption of gases by the product generally reaches equi-
librium early, during the first 12–72 h after packaging (Jakobsen and Ber-
telsen, 2004). Change in the MAP atmosphere resulting from gas exchange
through the package film is usually very slow with high-barrier films, but
will be affected by factors such as the partial pressure of gases inside and
outside the package, environmental temperature, and package film thick-
ness.

20.7 Product Characteristics Following Map Applications

Because the objectives of MAP systems for various meat and poultry prod-
ucts are different, the use of different gases and gas blends have been devel-
oped. Thus, the effects of MAP systems on product characteristics can vary
considerably depending on the gases used and the product involved. Fresh
meat MAP systems, for example, are vastly different than those for cooked
or cured-and-cooked products.

20.7.1 Fresh (Raw) Meat

As discussed earlier, fresh meat MAP systems can range from atmospheres
utilizing high oxygen concentrations to those using high carbon dioxide lev-
els. Atmospheres containing high levels of either oxygen or carbon dioxide
usually are balanced with nitrogen. Some package atmospheres will also
incorporate carbon monoxide.

20.7.1.1 High-Oxygen MAP

Case-ready MAP packages that utilize high oxygen levels for color devel-
opment of fresh red meat most often utilize a gas blend of about 70%–80%
oxygen and 20%–30% carbon dioxide. This combination results in a deeper-
than-usual layer of red oxymyoglobin on the product surface for improved
628 Advanced Technologies for Meat Processing, Second Edition

color life and improved shelf life, both of which are increased about three-fold
over that of conventional overwrapped aerobic packages (Kropf, 2004; Siegel,
2010b). The color advantages of high-oxygen packaging are generally real-
ized best in those red meats that have a high concentration of muscle pig-
ment.
Comparison of beef packaged in a high-oxygen (80% oxygen: 20% carbon
dioxide) atmosphere with beef packaged in a low-oxygen (80% nitrogen: 20%
carbon dioxide) atmosphere has demonstrated that the high-oxygen atmo-
sphere can be expected to result in significantly longer color life (Seyfert
et al., 2004a). High-oxygen packaging of pork has also been demonstrated to
achieve increased color life and consumer acceptability (Buys, 2004). While
color and microbial shelf life are usually improved by high-oxygen–carbon
dioxide combinations over conventional aerobic packaging, there have been
reports of increased lipid oxidation in meat packaged in high-oxygen atmo-
spheres (Spanos et al., 2016). The increased lipid oxidation induced by high-
oxygen packaging has been shown to be effectively reduced by the use of
antioxidants, particularly rosemary extract. Addition of rosemary extract
enhanced lipid stability in beef patties (Sánchez-Escalante et al., 2001; Lund
et al., 2007, Brooks et al., 2008) and in ground chicken meat (Keokamnerd
et al., 2008), both of which were packaged in 80% oxygen atmospheres. The
oxidative environment of high-oxygen packaging has also been observed to
result in reduced meat tenderness due to reduced protein hydrolysis during
aging and to increased protein cross-linking (Clausen et al., 2009; Bao and
Ertbjerg, 2015).
Exposure of beef to high-oxygen atmospheres has been observed to result
in “premature browning” when the beef is cooked (Seyfert et al., 2004b).
Premature browning occurs when cooked beef turns brown at lower-than-
usual cooking temperatures. The result is a well-done appearance in meat
that is heated to medium doneness (71.1°C internal) or less. Research has
shown that premature browning can occur in ground beef at cooked tem-
peratures as low as 49°C (John et al., 2004). The concern arising from this
observation is for microbial safety because many consumers use cooked
color as an indicator of the temperature achieved during cooking (done-
ness). Ground beef patties stored in an 80% oxygen atmosphere have been
observed to result in premature browning in nearly 100% of the patties eval-
uated (John et al., 2004).
Another problem sometimes observed with high-oxygen packaging of
bone-in meat cuts is discoloration of bone marrow, sometimes called black
bone. The problem results from disruption of red blood cells in the bone
marrow during cutting of the bone, followed by exposure to high levels of
oxygen. It has been demonstrated that the problem can be avoided by reduc-
ing oxygen in the package to less than 100 ppm or by including 0.4% CO in
a MAP system (Mancini et al., 2005). The use of an ascorbic acid solution
applied to cut bone surfaces has been reported to also prevent bone discolor-
ation (Raines et al., 2006; Grobbel et al., 2006).
Modified Atmosphere Packaging 629

20.7.1.2 High-Carbon-Dioxide MAP

Packaging with elevated carbon dioxide is sometimes referred to as a low-
or ultralow-oxygen system (Kropf, 2004). This is because, to be capable of
good fresh meat color development later when the products are exposed to
oxygen, a high-carbon-dioxide atmosphere must exclude as much oxygen as
possible. This means that, in addition to adding carbon dioxide at levels of
20%–30% or more to the atmosphere for microbial inhibition, it is also critical
to eliminate oxygen as completely as possible. Even though fresh meat will
metabolize residual oxygen and thereby remove the oxygen from the atmo-
sphere, this activity will consume some of the inherent reducing capacity of
the muscle and subsequent color life is likely to be lessened. Residual oxy-
gen typically ranges from about 0.1% to 1.0% or more in MAP packages and
this is enough to impact color longevity in retail displays. Because of this,
addition of oxygen absorbers to packages can be advantageous. The use of
oxygen absorbers, for example, has been reported to improve the subsequent
color stability of pork cuts first stored in a 100% carbon dioxide atmosphere
to a level comparable to high-oxygen packaged products (Buys, 2004).

20.7.1.3 MAP with Carbon Monoxide

Fresh meat products packaged with carbon monoxide demonstrate dra-
matically improved color stability. For example, comparison of ground beef,
beef steaks, and pork chops packaged in 0.4% CO/60% CO2/40% N2 or 70%
O2/30% CO2 showed that the carbon monoxide atmosphere extended the
color life three to seven days longer than that of the high-oxygen atmosphere
(Sørheim et al., 1999). Pork chops packaged in 0.5% CO/70% CO2/29.5% N2
were reported to have desirable color after 36 days of storage at 3°C while
conventionally overwrapped packages showed color losses after seven days
of storage (Krause et al., 2003). Including carbon monoxide in MAP for bone-
in meat cuts has been shown to prevent the bone discoloration that often
occurs in high-oxygen MAP systems (Mancini et al., 2005).
One of the concerns for carbon monoxide packaging systems has been
the potential for color to outlast microbial spoilage. This could be the case
considering the length of color life observed in relation to microbial num-
bers (Sørheim et al., 1999). Because consumers utilize color as an indicator of
microbial quality, it is important that sanitation, good manufacturing prac-
tices, and additional microbial inhibitors, such as carbon dioxide, be consid-
ered when color stability is extended with carbon monoxide.

20.7.2 Cooked and Cured-and-Cooked Meat Products

Because cooked items such as sliced roast beef and turkey, and cured-and-
cooked products like sliced ham and dry sausage, are normally low in bacte-
rial numbers, the principle concerns for spoilage during storage are flavor
630 Advanced Technologies for Meat Processing, Second Edition

and color deterioration. Changes in both flavor and color in these products
are most often due to chemical oxidation rather than microbial growth, so
exclusion of oxygen from the package is the principle objective for maximiz-
ing the shelf life of these products. A study of several factors affecting cured
ham color in a package atmosphere of 20% carbon dioxide/80% nitrogen
suggested that residual oxygen, nitrite concentration, degree of illumination,
headspace volume, and film permeability to oxygen were all important for
color stability (Møller et al., 2003). However, headspace volume relative to
product volume was found to be among the most important because of the
effect of volume on total oxygen content in the headspace. A second study
of color stability for cured ham with similar MAP atmospheres included a
range of headspace:product volume ratios and included low levels (up to
1.5%) of oxygen. Results of this study confirmed the importance of elimi-
nating residual oxygen as much as possible for cured color stability and
showed that the absolute oxygen content (the product of volume and con-
centration) was more important than concentration alone (Nannerup et al.,
2004). Although 100% nitrogen is the most common atmosphere used for
cured meats, carbon dioxide is included in some commercial applications.
However, because fading of cured meat pigment is sensitive to oxygen there
has been some question about the effects of carbon dioxide on cured meat
color as well. A recent study of the stability of cured meat pigment to both
autoxidation and photooxidation in the presence of 5%, 20%, and 30% car-
bon dioxide atmospheres (Summo et al., 2016) reported that autoxidation was
decreased by carbon dioxide, which might have implications for reducing
rancidity and off-flavor development in MAP systems. Other researchers
have also reported reduced lipid oxidation in the presence of carbon diox-
ide atmospheres. Photooxidation, however, which, in the presence of oxygen,
is the most important reaction contributing to cured meat color losses, was
unaffected by carbon dioxide (Møller et al., 2005). Consequently, either 100%
nitrogen or carbon dioxide/nitrogen blends can be used for MAP applica-
tions involving cooked or cured-and-cooked meat and poultry products.

20.8 Comparisons of Map with VP for Meat and Poultry

20.8.1 Vacuum versus MAP for Fresh Meat
Because VP is used a great deal for meat and poultry products and is, in
reality, a form of modified atmosphere, a consideration of VP in relation to
MAP is appropriate. VP is a simple process whereby product is packaged
“in a high barrier package from which air is removed . . .” (Rao and Sachin-
dra, 2002). As described earlier, for fresh meat, a vacuum package typically
becomes a carbon-dioxide-enhanced package because residual oxygen is
Modified Atmosphere Packaging 631

converted to carbon dioxide by muscle and microbial respiration. The carbon

dioxide concentration in vacuum packages of fresh meat typically reaches
10%–20% of the gases present (Tewari et al., 1999). Much of the antimicrobial
impact of VP on shelf life of fresh meat has been credited to the production
of carbon dioxide rather than to the removal of oxygen. For cooked or cured-
and-cooked meats, there is very little formation of carbon dioxide after pack-
aging because respiration is not active. In this case, VP is used because the
exclusion of oxygen for control of chemical changes is the most critical factor
for shelf life of these products. Microbial growth is less of a concern as long
as microbial recontamination after cooking is restricted.
VP of fresh meat has typically been restricted to distribution of wholesale
cuts because the dark purple color of vacuum-packaged red meat is unac-
ceptable for retail display. Color is not as critical for poultry meat depending
on the amount of pigment present (white vs. dark poultry meat) because color
change is not as great. VP of beef, pork, lamb, and poultry will extend the
shelf life of products by several folds over that of aerobic packaging (Siegel,
2010b). Similar to MAP, the actual shelf life achieved for a specific product is
very dependent on the meat species, film permeability, initial microbial load,
and storage temperature. The two most critical factors for VP are the micro-
bial load at time of packaging and the storage temperature. For MAP, the gas
atmosphere must be considered in addition to microbial load and tempera-
ture. VP has also been used commercially for storage of beef to achieve “wet
aging” for tenderization and flavor development, though MAP has been
shown to be equally effective for this application as well (Lee et al., 1996).
In addition to a lack of attractive color, VP for fresh meat typically results
in the separation of a small amount of free water from the product. The sepa-
rated water or purge forms a pool on the product surface beneath the pack-
age film, and in corners and creases of the package film. Purge occurs from
the physical pressure of the external atmosphere on the surface of the prod-
uct under vacuum, and results in product weight loss when the package is
opened. Purge in vacuum-packaged cooked and cured-and-cooked products
is also common, especially those products that have additional water added
during manufacturing. The physical pressure of VP on product surfaces is
also a disadvantage for sliced products where the pressure can cause slices to
stick together. These effects of physical pressure on the product surface can
be avoided by the use of MAP systems.

20.8.2 Vacuum versus MAP Packaging of Cooked and

Cured-and-Cooked Meat Products
Both VP and MAP are widely used for cooked and cured-and-cooked prod-
ucts. Because exclusion of oxygen is the most important consideration for these
products, the two packaging systems can function equally well for preserving
color, suppressing microbial spoilage, and extending shelf life (Siegel, 2010a,b).
The principle difference between applications of VP or MAP for cooked and
632 Advanced Technologies for Meat Processing, Second Edition

cured-and-cooked products results from the production of purge and adhesion

of slices that can result from VP but that are largely avoided by MAP.

20.8.3 Effects of High-Carbon-Dioxide MAP

Because carbon dioxide is the active antimicrobial agent in both VP and
MAP, there has been significant interest in utilizing increased concentrations
of this gas in MAP systems. This has not been feasible in the past for fresh
meat because of the discoloration that occurs at more than about 30% carbon
dioxide. However, the research with carbon monoxide in MAP has shown
that as much as 99.5% carbon dioxide will not cause discoloration if 0.5% car-
bon monoxide is included for color stability (Krause et al., 2003), though this
concentration typically results in extreme package collapse. Consequently, it
has been suggested that increased carbon dioxide concentrations, within the
limits that avoid package collapse, could be used for both fresh and cooked
cured-and-cooked products to further improve the shelf life.
Because high-carbon-dioxide atmospheres can affect meat pH and result
in increased carbon dioxide absorbance by the meat tissue, a variety of qual-
ity changes of meat in high-carbon-dioxide atmospheres have been studied.
One of the visual observations reported for meat stored in 40% carbon diox-
ide or more was development of pores between muscle bundles after cooking
(Bruce et al., 1996). The pore development was observed for beef packaged in
carbon dioxide for three days and for beef repackaged in vacuum for three
days after 48 hours in a carbon dioxide atmosphere. It was suggested that the
pores were formed by evolution of dissolved carbon dioxide induced by heat
during cooking. The development of pores and fissures as well as changes in
pH could cause product quality changes, particularly for protein function-
ality and product texture. It has been reported that when ground beef was
stored in atmospheres containing 20%–100% carbon dioxide, reduced cook-
ing yield of 1%–3% resulted (Sørheim et al., 2004).

20.9 Packaging Films and Film Properties

The development of flexible films with a wide array of strength and barrier
properties has allowed MAP applications to reach their full potential. Currently
available films offer a range of oxygen and moisture barriers, shrinking proper-
ties, sealing characteristics, smoke and/or color transfer options, shirred or roll
stock, cook-in and retort capability, and a variety of print and color options.
The majority of flexible packaging films used for meat and poultry are
based on nylon, polyester, or polypropylene to provide basic strength. Most,
if not all, MAP packages consist of multiple layers of several plastic films
combined by coextrusion, lamination, or coating treatments to create the
Modified Atmosphere Packaging 633

desired blend of film properties for control of moisture and gas permeability
and for heat-sealing properties. There are no single films that provide all
the properties needed for effective MAP systems. Flexible packaging film
materials can be generally categorized as exterior materials, barrier materi-
als, sealants, or rigid materials (Dawson, 2010; Siegel, 2010a). The following
discussion briefly addresses properties of some of the basic individual films
that might be used in MAP packaging. This is by no means a comprehensive
list or discussion and more details can be obtained from the references listed.

20.9.1 Exterior Film Materials

20.9.1.1 Nylon
Nylon or polyamides are widely used for strength and are resistant to punc-
ture, abrasion, and tearing (Mullan and McDowell, 2003; Dawson, 2010;
Siegel, 2010a). The toughness of nylon means that it is often used as a com-
ponent of fresh meat pouches where puncture resistance and strength are
important. Nylon is generally difficult to heat seal and will be combined
with other films that provide sealing ease. Because of the strength and rigid-
ity, this film is often part of thermoformed base packs for MAP applications.

20.9.1.2 Polyester
Polyesters are condensation polymers, polyethylene terephthalate, with a
wide range of properties. These films are heat resistant (Dawson, 2010; Siegel,
2010a) so they may not seal well. Polyester is often used for barrier pouches
and lids for tray packs where strength is needed without flexing since they
are prone to flex cracking. Polyester can be metallized with aluminum to
provide an exceptional barrier to oxygen and may be used this way as part
of the package for highly oxygen-sensitive products.

20.9.1.3 Polypropylene
Polypropylene applications for MAP systems are most often found in rigid
base trays. This material is a good water vapor barrier but a poor gas barrier
so combinations with high gas barrier films are likely (Mullan and McDow-
ell, 2003; Dawson, 2010; Siegel, 2010a). This film has a high heat tolerance but
can be heat sealed, though shrinkage when sealing can be an issue.

20.9.2 Barrier Film Materials

20.9.2.1 Ethylene Vinyl Alcohol
This film is generally laminated between two or more films when used for
MAP to protect it from moisture. The film has good gas barrier properties
when dry but must be protected from moisture to retain its barrier properties
634 Advanced Technologies for Meat Processing, Second Edition

(Mullan and McDowell, 2003; Dawson, 2010; Siegel, 2010a). The film is often
coextruded with nylon and other films for fresh meat applications.

20.9.2.2 Polyvinylidene Chloride

Polyvinylidene chloride is a flexible film that is a superior barrier for water
vapor, gases, and odors (Mullan and McDowell, 2003; Dawson, 2010; Siegel,
2010a). This film is best known by the trade name of Saran®. The film is heat
sealable, highly shrinkable when heated, and commonly used in combined
films. Heat-shrink packages may include monolayer films of polyvinylidene
chloride but the film is most often used in coextrusions with multiple layers
of other flexible film materials.

20.9.3 Sealant Materials

20.9.3.1 Polyethylenes
Polyethylenes are commonly used in multiple layer package films primarily
for heat-sealing properties. The film melts at relatively low temperature (~20°C)
and welds to itself readily, thus forming effective seals. The film is not a good
barrier and requires combination with other films for any significant MAP bar-
rier package (Mullan and McDowell, 2003; Dawson, 2010; Siegel, 2010a).

20.9.3.2 Ethylene Vinyl Acetate

This film is relatively weak but has a low initial heat-sealing temperature as well
as a wide window of heat-sealing temperatures, which makes it a very effec-
tive sealant. Consequently, ethylene vinyl acetate is used primarily for its heat-
sealing properties (Mullan and McDowell, 2003; Dawson, 2010; Siegel, 2010a).

20.9.4 Rigid Materials

20.9.4.1 Polyvinyl Chloride
Polyvinyl chloride is a material that can be softened and formed relatively
easily by heat. Consequently, it is often used for thermoformed structures
such as base trays (Mullan and McDowell, 2003; Dawson, 2010; Siegel, 2010a).
The film is not a good gas barrier so combinations with barrier films are usu-
ally necessary for MAP applications.

20.9.4.2 Polystyrene
Polystyrene is relatively low cost with good stiffness. It is not transparent
and does not have good moisture or gas barrier properties so other films
need to be included to provide necessary oxygen and/or moisture barrier
properties (Siegel, 2010a).
Modified Atmosphere Packaging 635

20.10 Effects of MAP on Pathogens in Meat and Poultry

Elevated concentrations of carbon dioxide have been shown to have an
inhibitory effect on several pathogenic microorganisms. As a result, MAP
systems have the potential to increase the safety of meat and poultry prod-
ucts. Because meat and poultry products are normally chilled, psychrotro-
phic pathogens are of greatest concern. However, temperature abuse can
also give rise to those pathogens that grow at warmer temperatures.
There are several pathogens of concern to meat and poultry. These include
Salmonella spp., Yersinia enterocolitica, Escherichia coli O157:H7, Campylobacter
jejuni, Staphylococcus aureus, Clostridium botulinum, Clostridium perfringens,
Bacillus cereus, and Listeria monocytogenes.

20.10.1 Salmonella spp.

Salmonella-caused illnesses are classified as infections, meaning that live
organisms must be ingested to cause illness. This organism is quite sensi-
tive to heat; consequently most cases of salmonellosis result from under-
cooked meat, poultry, or eggs (Knabel, 1995; Baer et al., 2013). A review
of several studies suggests that high-carbon-dioxide (60% to 100%) MAP
can slow the growth of Salmonella compared to aerobic packaging but the
organism will survive in the carbon dioxide environment and may grow
when exposed to more favorable conditions. At best, MAP with high carbon
dioxide may offer partial inhibition of Salmonella but temperature control
and adequate cooking are still required to assure safety, and addition of
antimicrobial treatments may be necessary if this organism is a concern
(Sukumaran et al., 2016).

20.10.2 Yersinia enterocolitica

Y. enterocolitica is a facultative anaerobe and can grow well in the absence
of oxygen (Knabel, 1995; Baer et al., 2013). Yersiniosis is an infection fre-
quently resulting from undercooked meat, most often pork. Several studies
have reported that high-carbon-dioxide atmospheres will slow the growth
of Y. enterocolitica but there are reports that this pathogen can grow even
under a 100% carbon dioxide atmosphere. Adequate cooking, rather than
MAP, provides assurance of safety from this pathogen.

20.10.3 Escherichia coli O157:H7

There appears to be relatively little information on the effects of MAP sys-
tems on E. coli O157:H7 (Rao and Sachindra, 2002). This organism commonly
contaminates raw meat, induces illness as an infection, and is easily killed
by heat. It appears that E. coli O157:H7 is similar to Salmonella in that growth
636 Advanced Technologies for Meat Processing, Second Edition

can be slowed by high-carbon-dioxide atmospheres as long as temperature

is relatively low but the organism is largely unaffected by MAP gas atmo-
spheres (Heinrich et al., 2016).

20.10.4 Campylobacter jejuni

C. jejuni is classified as a microaerophilic organism (Baer et al., 2013) meaning
that it prefers a small amount of oxygen but seems to be largely unaffected by
carbon dioxide atmospheres. C. jejuni causes illnesses as a foodborne infec-
tion, meaning that a significant number of live organisms must be ingested
to induce illness. The organism is very heat sensitive and does not compete
well for growth against other microorganisms (Knabel, 1995). Studies on
C. jejuni growth under a variety of atmospheres suggest that the absence
of oxygen has a larger impact on this organism than the presence of high
concentrations of carbon dioxide (Baer et al., 2013). C. jejuni is frequently
associated with poultry and adequate cooking is the preferred method for
assuring product safety.

20.10.5 Staphylococcus aureus

S. aureus is a pathogen that causes illness by producing a toxin during growth,
resulting in what is considered a food poisoning rather than a food infection.
However, because a relatively large number of organisms are needed for
detectable levels of the enterotoxin, prevention of growth of this organism is
important. There is evidence that high-carbon-dioxide atmospheres inhibit
growth of S. aureus and, in some cases, reduce cell counts (Baer et al., 2013).
It appears that low temperature is very important and may be synergistic
with carbon dioxide concentrations to increase cell death rate of S. aureus. It
may be that the greatly increased solubility of carbon dioxide that has been
observed at lower temperatures plays a role in the greater antimicrobial
impact on S. aureus at reduced temperatures.

20.10.6 Clostridium botulinium

C. botulinum is an anaerobic organism that produces a very potent toxin
under conditions favorable to growth. Because ingestion of C. botulinum
toxin frequently results in death, this organism is notorious for potential
risk in low-acid foods packaged under anaerobic conditions. Several stud-
ies of the effects of MAP atmospheres on C. botulinum, especially with fish,
have shown that this pathogen is largely unaffected by high-carbon-dioxide
or nitrogen atmospheres. Fortunately, the incidence of C. botulinum on meat
and poultry is typically very low. Further, refrigeration temperatures are
normally sufficient to prevent toxin production. In fish products, where
C. botulinum contamination is high, anaerobic modified atmospheres are not
considered safe for refrigerated products (Baer et al., 2013).
Modified Atmosphere Packaging 637

20.10.7 Clostridium perfringens

C. perfringens also induces illness by producing a toxin, but unlike C. botulinum,
this food poisoning is seldom fatal. This organism does not appear to be
affected by high-carbon-dioxide atmospheres at warm temperatures (above
20°C) but at lower temperatures (5°C or less) high carbon dioxide has been
reported to prevent growth (Hardin, 2012). The general consensus seems to
be that, similar to C. botulinum, preventing contamination and maintaining
proper temperature control are more important than MAP for assuring con-
trol of this pathogen on meat and poultry.

20.10.8 Bacillus cereus

B. cereus is a toxin-producing pathogen that induces a food poisoning illness,
but the illness is usually not fatal. While this pathogen is among the less-
common causes of foodborne illness from meat and poultry, it also seems
to be the pathogen that is most susceptible to the antimicrobial effects of
carbon dioxide atmospheres. Several studies have documented that B. cereus
is inhibited by carbon dioxide even at 25°C (Baer et al., 2013). Carbon dioxide
has been reported to be much more effective against B. cereus than nitrogen
or anaerobic atmospheres.

20.10.9 Listeria monocytogenes

L. monocytogenes has become a major concern to the meat and poultry
industry because this pathogen can grow at very low refrigerated tempera-
ture, and is widespread, very hardy, and very difficult to eradicate from
food processing plants. Further, listeriosis is a foodborne infection that can
result in a 20%–30% fatality rate in an outbreak (Devlieghere et al., 2001).
The heat process used during production of fully cooked (71°C internal)
products has been shown to eliminate L. monocytogenes from meat and
poultry, but because L. monocytogenes is a common environmental contami-
nant, postcooking contamination, particularly during slicing and packag-
ing, is likely. Because fully cooked products are often eaten without further
heating, this ready-to-eat (RTE) category of meat and poultry products has
been the source of most listeriosis outbreaks (Hardin, 2012; Baer et al., 2013;
Heinrich et al., 2016).
There have been conflicting reports on the effects of MAP atmospheres on
L. monocytogenes. Studies with fresh beef reported that 100% carbon dioxide
inhibited L. monocytogenes growth at 5°C but not at 10°C (Nissen et al., 2000).
Other reports have suggested that carbon dioxide atmospheres will reduce
L. monocytogenes counts only by about 1.5 log, meaning that additional anti-
microbial treatments should be included for adequate control of this patho-
gen (Saraiva et al., 2016).
638 Advanced Technologies for Meat Processing, Second Edition

20.11 MAP as a Component in the Hurdle Concept

Most microorganisms have been shown to be more resistant to change in a
single environmental factor than to change in two or more environmental
factors at the same time. As a result, sublethal levels of two or more treat-
ments can often be applied to create a total inhibitory effect or “hurdle”
that the organism cannot overcome (Jay, 2000). This “hurdle” concept is fre-
quently credited to Dr. Luther Leistner of Germany who has been a strong
proponent of this approach. The hurdle concept is being studied in many
applications because it often allows reduced intensity of any one antimicro-
bial treatment while improving the overall antimicrobial protection.
The use of MAP as one component in the hurdle concept to add to a greater
overall inhibition of spoilage or pathogenic microorganisms is very com-
patible with many other inhibitory treatments. Because MAP exerts poten-
tially inhibitory effects following processing and during storage, it is easy to
include MAP as an “add-on” treatment to complement preservatives, thermal
processes, high pressure processing, irradiation, and many other antimicro-
bial treatments. There have been several reports of MAP, as part of a hurdle
concept, contributing to increased overall inhibition of microorganisms or
improved product quality (Rao and Sachindra, 2002). For example, treatment
of poultry carcasses with lactic acid or sorbate solutions combined with MAP
increased the inhibition of spoilage and pathogenic microorganisms, respec-
tively (Gammariello et al., 2014). High pressure processing has been demon-
strated in multiple studies to be effective (Myers et al., 2013; Lavieri et al., 2014;
Lerasle et al., 2014), and the use of bacteriophage in combination with MAP
can provide control of pathogens like Salmonella (Sukumaran et al., 2016).
Combining a variety of treatments to achieve an adequate microbiological
hurdle for safety and to retain product quality at the same time is a complex
challenge and will require a great deal of product-specific research to har-
monize the effects of product and packaging treatments.

20.12 AP Components
While AP systems are generally considered separately from MAP, there are
some elements of AP that are becoming important for improving the effec-
tiveness of MAP. The concept of AP is an interactive packaging system that
modifies package conditions according to needs (Ozdemir and Floros, 2004).
The AP concept includes a wide variety of potential package adjustment
mechanisms including oxygen scavengers, flavor releasers, flavor absorb-
ers, moisture absorbers, time–temperature indicators, and films that contain
antimicrobial agents (Siegel, 2010a).
Modified Atmosphere Packaging 639

Where AP and MAP are beginning to overlap is in the use of oxygen

scavengers. It is clear that for anaerobic MAP systems applied to fresh meat,
small amounts of oxygen are very detrimental (Kropf, 2004). It is also clear
that it is time consuming to achieve very low oxygen levels during packag-
ing operations because vacuum and/or flush treatments must be extended
to remove as much oxygen as possible. In some cases, products may be vac-
uumized or flushed multiple times. The addition of oxygen scavengers is
advantageous, not only because they will remove small amounts of residual
oxygen, but also because use of scavengers will permit faster packaging
operations and greater production line speed.
Oxygen scavengers are also used in many RTE meat applications where
flavor preservation is critical (Ozdemir and Floros, 2004). A good example is
dried products such as jerky or sliced pepperoni. These products are usually
packaged in a nitrogen atmosphere and will develop rancid flavors easily in
the presence of small amounts of oxygen. An oxygen scavenger significantly
increases the shelf life of these products from the quality standpoint. The
oxygen scavengers are typically added to MAP systems as a small packet of
iron powder that is oxidized to iron oxide when oxygen is absorbed (Siegel,
2010a). In the United States, these packets must be labeled as “Do Not Eat”
to prevent consumption by children or by accident. Recent developments in
packaging have included the incorporation of oxygen scavengers into the
packaging film. This alternative solves the potential problems associated
with the iron packet on the inside of the package.
A second component of AP systems that may be effective in MAP appli-
cations is carbon dioxide emitters. Because high levels of carbon dioxide
are important to antimicrobial effects, it might be useful for packaging
systems to include the capability to generate more carbon dioxide after a
package containing a high amount of carbon dioxide is sealed. However, this
concept does not appear to be used a great deal for meat and poultry.
Packaging films that include antimicrobial compounds would be a pow-
erful complement for MAP systems to help control microorganisms and
pathogens that tolerate MAP atmospheres. There has been a considerable
amount of research on antimicrobial films and coatings including antibi-
otics and organic acids (Bhatia and Bharti, 2015; Clarke et al., 2016), bacte-
riophages (Gouvea et al., 2015), spice essential oils (Ahmed et al., 2016), and
silver nanoparticles (Azlin-Hasim et al., 2015). In many cases, the properties
of the film involved may be modified by the inclusion of the incorporated
materials and would need to be taken into consideration for applications of
this technology.
A final example of an AP innovation for meat products is the development
in 2010 of a nitrite-containing film for fresh meat (Siegel, 2010b). This film,
when used to vacuum package fresh meat, releases a very small quantity
of nitrite when in contact with meat surfaces, which results in a bright red
color from formation of nitric oxide myoglobin on the product surface while
under vacuum. The color is visually indistinguishable from the red oxymyo-
640 Advanced Technologies for Meat Processing, Second Edition

globin color of fresh meat in oxygen atmospheres. The nitrite concentration

is far too low (less than 10 ppm) to result in cured color when the product is
cooked or to have an antimicrobial effect. In this case, the vacuum package
provides the microbial control and shelf-life extension (Siegel, 2010b).

20.13 Leakers and Package Integrity

One of the minor disadvantages to MAP technology in comparison to VP for
meat and poultry is that leaks and faulty seals are not as visibly obvious. If
the integrity of the package and/or the seal is not intact, the gas atmosphere
is likely to be lost very quickly and product safety and quality will be com-
promised, but the shape or form of the package may not change in the case of
MAP the way it does with a vacuum package. Because the majority of MAP
systems employ a heat-sealing operation, this step is a critical control point
in the process and needs to be carefully monitored during production.
There are a variety of testing methods to check the integrity of MAP pack-
ages. These include immersion in water, compression of packages, and dye
penetration as well as several others. (Smolander et al., 1997; Mullan and
McDowell, 2003). Most of these methods are destructive and can be used to
measure only selected packages. More recent developments in monitoring
systems for package integrity have suggested that leak indicators should be
an integral part of every package to be most effective. The use of oxygen
sensors, for example, attached to the inside of the lid of packages of cooked
chicken patties was reported to detect oxygen levels as low as 0.07%. These
sensors were composed of a phase-fluorimetric membrane that was mea-
sured for phosphorescence intensity and phase shift (Smiddy et al., 2002).

20.14 Regulatory Issues

The use of carbon dioxide, nitrogen, and oxygen gases for MAP systems is
common around the world for meat and poultry and for many other food
products. Fish, fruits, vegetables, and dairy products are among the most
common foods packaged in MAP. There are relatively few regulatory limits
for the use of these three gases, though safety concerns for fish in anaerobic
MAP systems have been expressed. Carbon monoxide, on the other hand,
has not been permitted in many countries. The most substantial use was
in Norway where 0.5% carbon monoxide was approved for use in 1985 and
was utilized for over half of the retail packaging of fresh meat (Sørheim
et al., 2001). However, because Norway moved to the European Union (EU)
Modified Atmosphere Packaging 641

for commodity trade, use of carbon monoxide for red meat packaging in
Norway was discontinued in 2004 to comply with EU regulations.
Because of a considerable amount of research demonstrating the advan-
tages of low carbon monoxide MAP, in February 2002, the US FDA approved
use of 0.4% carbon monoxide for MAP used as part of a master-pack system
(ActiveTech™ by Pactiv Corp. Pactiv LLC, Lake Forest, IL) (U.S. FDA, 2002).
This system utilizes retail packages that have an oxygen-permeable film and
are enclosed in a master pack with 0.4% carbon monoxide, 30% carbon diox-
ide, and 69.6% nitrogen. An oxygen scavenger is added to the master pack
to eliminate residual oxygen and protect the product color for later retail
display. The FDA categorized this use of carbon monoxide as a GRAS proce-
dure. Packaging systems utilizing carbon monoxide for master-pack applica-
tions similar to the Pactiv system have been approved for use in Australia
and New Zealand as well (Sørheim et al., 2001). The FDA also, in July 2004,
approved use of 0.4% carbon monoxide with carbon dioxide and nitrogen for
MAP packaging of case-ready beef and pork (U.S. FDA, 2004). This approval
was granted on behalf of Precept Foods, LLC, and utilizes the MAP atmo-
sphere for retail packages as opposed to a master pack (Siegel, 2010b).
While carbon dioxide, oxygen, and nitrogen enjoy widespread acceptance
as components of MAP systems, carbon monoxide suffers from the percep-
tion of environmental toxicity. Even though the risk represented by the con-
centrations of carbon monoxide used in MAP systems is negligible (Sørheim
et al., 2001; U.S. FDA, 2002, 2004), the perception of danger continues to limit
potential applications of this gas.

20.15 Conclusions
An extensive amount of research and development has shown that MAP
technology offers very significant improvements in preservation and safety
of meat and poultry products. The meat industry is utilizing MAP technol-
ogy more and more as case-ready packaging of fresh meat becomes more
widely adopted. Because case-ready packaging is done in centralized loca-
tions, the sanitation and temperature control is typically more consistent,
and as a result, products not only achieve longer shelf life but are delivered
to consumers with a more consistent quality. Utilization of MAP systems for
cooked, RTE products has been in place for quite some time but is changing
as new ways to use MAP for improved safety are being developed. This is an
active area of current research because more information is needed on how
MAP interacts with other inhibitory processes and ingredients for control of
quality and safety.
It is important to realize that MAP is far from a stand-alone technology for
preservation of meat and poultry products. The use of MAP is much more
642 Advanced Technologies for Meat Processing, Second Edition

effective when the packaged product is of high microbial quality and when
subsequent temperature is well controlled. For meat and poultry products,
the mixture of gases used must be appropriate to the application and, for
anaerobic MAP environments, residual oxygen must be removed as com-
pletely as possible. Additional considerations include use of appropriate
films and materials for necessary barriers or permeability, adequate sealing
of packages and monitoring for leakers, and attractive presentation to appeal
to consumers. The use of MAP systems for meat and poultry has become
widespread and, with the additional research and development currently
underway, has great potential for even wider use in the future.

References
Ahmed, J., Hiremath, N. and Jacob, H. (2016). Antimicrobial, rheological, and thermal
properties of plasticized polyactide films incorporated with essential oils to inhibit
Staphyloccus aureus and Campylobacter jejuni. Journal of Food Science, 81, E419–E429.
Azlin-Hasim, S. M., Cruz-Romero, C., Morris, M. A., Cummins, E. and Kerry, J. P.
(2015). Effects of a combination of antimicrobial silver low density polyethylene
nanocomposite films and modified atmosphere packaging on the shelf life of
chicken breast filets. Food Packaging and Shelf Life, 4, 26–35.
Baer, A. A., Miller, M. J. and Dilger, A. C. (2013). Pathogens of interest to the pork
industry: A review of research on interventions to assure food safety. Compre-
hensive Reviews in Food Science and Food Safety, 12, 183–217.
Bao, Y. and Ertbjerg, P. (2015). Relationship between oxygen concentration, shear
force and protein oxidation in modified atmosphere packaged pork. Meat Sci-
ence, 110, 174–179.
Bartkowski, L., Dryden, F. D. and Marchello, J. A. (1982). Quality changes of beef
steaks stored in controlled gas atmospheres containing high or low levels of
oxygen. Journal of Food Protection, 45, 41–45.
Bhatia, S. and Bharti, A. (2015). Evaluating the antimicrobial activity of nisin, lyso-
zyme and ethylenediaminetetraacetate incorporated in starch based active food
packaging film. Journal of Food Science and Technology, 52(6), 3504–3512.
Brooks, J. (1933). The effects of carbon dioxide on the color changes or bloom of lean
meat. Journal of the Society of Chemical Industry, 52, 17–19.
Brooks, J. C., Alvarado, M., Stephens, T. P. et al. (2008). Spoilage and safety charac-
teristics of ground beef packaged in traditional and modified atmosphere pack-
ages. Journal of Food Protection, 71, 293–301.
Bruce, H. L., Wolfe, F. H., Jones, S. D. M. and Price, M. A. (1996). Porosity in cooked
beef from controlled atmosphere packaging is caused by rapid CO2 evolution.
Food Research International, 29, 189–193.
Buys, E. M. (2004). Colour changes and consumer acceptability of bulk packaged
pork retail cuts stored under O2, CO2 and N2. Meat Science, 68, 641–647.
Clark, D. S. and Lentz, C. P. (1969). Use of carbon dioxide for extending shelf-life of pre-
packaged beef. Canadian Institute of Food Science and Technology Journal, 5(4), 175–178.
Modified Atmosphere Packaging 643

Clarke, D., Molinaro, S., Tyuftin, A., Bolton, D., Fanning, S. and Kerry, J. P. (2016).
Incorporation of commercially-derived antimicrobials into gelatin-based films
and assessment of their antimicrobial activity and impact on physical film prop-
erties. Food Control, 64, 202–211.
Clausen, I., Jakobsen, M., Ertbjerg, P. and Madsen, N. T. (2009). Modified atmosphere
packaging affects lipid oxidation myofibrillar fragmentation index and eating
quality of beef. Packaging Technology and Science, 22, 85–96.
Daniels, J. A., Krishnamurthi, R. and Rizvi, S. S. H. (1985). A review of effects of car-
bon dioxide on microbial growth and food quality. Journal of Food Protection, 48,
532–537.
Dawson, P. L. (2010). Packaging. In: Owens, C. M., Alvarado, C. Z. and Sams, A. R.
(eds.) Poultry Meat Processing (2nd Ed.). Boca Raton, FL: CRC Press, pp. 101–123.
Devlieghere, F., Geeraerd, A. H., Versyck, K. J., Vandewaetere, B., Van Impe, J.
and Debevere, J. (2001). Growth of Listeria monocytogenes in modified atmo-
sphere-packed, cooked meat products: A predictive model. Food Microbiol-
ogy, 18, 53–66.
Dixon, N. M. and Kell, D. B. (1989). The inhibition by CO2 of the growth and metabo-
lism of micro-organisms. Journal of Applied Bacteriology, 67, 109–136.
Farber, J. M. (1991). Microbiological aspects of modified-atmosphere packaging—A
review. Journal of Food Protection, 54, 58–70.
Gammariello, D., Incoronato, A. L., Conte, A. and Del Nobile, M. A. (2014). Use of
sodium lactate and modified atmosphere packaging for extending the shelf life
of ready-to-cook fresh meal. Packaging Technology and Science, 28, 101–112.
Gill, C. O. (1988). The solubility of carbon dioxide in meat. Meat Science, 22, 65–71.
Gill, C. O. and Tan, K. H. (1980). Effect of carbon dioxide on growth of meat spoilage
bacteria. Applied and Environmental Microbiology, 39, 317–319.
Gouvea, D. M., Mendonca, R. C. S., Soto, M. L. and Cruz, R. S. (2015). Acetate cellu-
lose film with bacteriophages for potential antimicrobial use in food packaging.
LWT—Food Science and Technology, 63, 85–91.
Grobbel, J. P., Dikeman, M. E., Yancey, E. J., Smith, J. S., Kropf, D. H. and Milliken,
G. A. (2006). Effects of ascorbic acid, rosemary, and Origanox™ in preventing
bone marrow discoloration in beef lumbar vertebrae in aerobic and anaerobic
packaging systems. Meat Science, 72, 47–56.
Hardin, M. (2012). Processed Meats Microbiology: Food Safety and Shelf Life Consider-
ations. Meat Processing Technology Series. Champaign, IL: American Meat Science
Association.
Heinrich, V., Zunabovic, M., Nehm, L., Bergmair, J. and Kneifel, W. (2016). Influence
of argon modified atmosphere packaging on the growth potential of strains of
Listeria monocytogenes and Escherichia coli. Food Control, 59, 513–523.
Hunt, M. C., Mancini, R. A., Hachmeister, K. A. et al. (2004). Carbon monoxide in
modified atmosphere packaging affects color, shelf life and microorganisms of
beef steaks and ground beef. Journal of Food Science, 45, 45–52.
Jakobsen, M. and Bertelsen, G. (2002). The use of CO2 in packaging of fresh meats and
its effect on chemical quality changes in the meat: A review. Journal of Muscle
Foods, 13, 143–168.
Jakobsen, M. and Bertelsen, G. (2004). Predicting the amount of carbon dioxide
absorbed in meat. Meat Science, 68, 603–610.
Jay, J. M. (2000). Modern Food Microbiology (6th Ed.). Gaithersburg, MD: Aspen Pub-
lishers.
644 Advanced Technologies for Meat Processing, Second Edition

Jayasingh, P., Cornforth, D. P., Carpenter, C. E. and Whittier, D. (2001). Evaluation

of carbon monoxide treatment in modified atmosphere packaging or vacuum
packaging to increase color stability of fresh beef. Meat Science, 59, 317–324.
John, L., Cornforth, D., Carpenter, D. E., Sørheim, O., Pettee, B. C. and Whittier, D.
R. (2004). Comparison of color and thiobarbituric acid values of cooked ham-
burger patties after storage of fresh beef chubs in modified atmospheres. Journal
of Food Science, 69, C608–C614.
Keokamnerd, T., Acton, J. C., Han, I. Y. and Dawson, P. L. (2008). Effect of commercial
rosemary oleoresin preparations on ground chicken thigh meat quality pack-
aged in a high-oxygen atmosphere. Poultry Science, 87, 170–179.
Knabel, S. J. (1995). Foodborne illness: Role of home food handling practices. Food
Technology, 49(4), 119–131.
Krause, T. R., Sebranek, J. G., Rust, R. E. and Honeyman, M. S. (2003). Use of carbon
monoxide packaging for improving the shelf life of pork. Journal of Food Science,
68, 2596–2603.
Kropf, D. H. (2004). Packaging/modified and controlled atmosphere. In: Jensen,
W., Devine, C. and Dikeman, M. (eds.) Encyclopedia of Meat Sciences (1st Ed.).
Oxford: Elsevier, pp. 962–969.
Lavieri, N. A., Sebranek, J. G., Cordray, J. C. et al. (2014). Effects of different nitrite
concentrations from a vegetable source with and without high hydrostatic pres-
sure on the recovery of Listeria monocytogenes on ready-to-eat restructured ham.
Journal of Food Protection, 77(5), 781–787.
Lee, M., Sebranek, J. G. and Parrish, F. C., Jr. (1996). Accelerated postmortem aging of
beef utilizing electron-beam irradiation and modified atmosphere packaging.
Journal of Food Science, 61, 133–136, 141.
Lerasle, M., Federighi, M., Simonin, H. et al. (2014). Combined use of modified atmo-
sphere packaging and high pressure to extend the shelf-life of raw poultry sau-
sage. Innovative Food Science and Emerging Technologies, 23, 54–60.
Lund, M. N., Hviid, M. S. and Skibsted, L. H. (2007). The combined effect of anti-
oxidants and modified atmosphere packaging on protein and lipid oxidation in
beef patties during chill storage. Meat Science, 76, 226–233.
Mancini, R. A., Hunt, M. C., Hachmeister, K. A., Kropf, D. H. and Johnson, D. E.
(2005). Exclusion of oxygen from modified atmosphere packages limits beef rib
and lumber vertebrae marrow discoloration during display and storage. Meat
Science, 69, 493–500.
McMillin, K. W. (2008). Where is MAP going? A review and future potential of modi-
fied atmosphere packaging for meat. Meat Science, 80(1), 43–65.
Møller, J. K. S., Jakobsen, M., Weber, C. J., Mortinussen, T., Skibsted, L. H. and Ber-
telsen, G. (2003). Optimization of colour stability of cured ham during packag-
ing and retail display by a multifactorial design. Meat Science, 63, 169–175.
Møller, J. K. S., Jensen, J. S., Olsen, M. B., Skibsted, L. H. and Bertelsen, G. (2000).
Effect of residual oxygen on color stability during chill storage of sliced pasteur-
ized ham packaged in modified atmosphere. Meat Science, 54, 399–405.
Møller, J. K. S., Nannerup, L. and Skibsted, L. H. (2005). Effect of carbon dioxide on
autoxidation and photooxidation of nitrosylmyoglobin. Meat Science, 69, 71–78.
Mullan, M. and McDowell, D. (2003). Modified atmosphere packaging. In: Coles, R.,
McDowell, D. and Kirwan, M. J. (eds.) Food Packaging Technology. Boca Raton,
FL: CRC Press, pp. 303–331.
Modified Atmosphere Packaging 645

Myers, K., Montoya, D., Cannon, J., Dickson, J. S. and Sebranek, J. G. (2013). The
effect of high hydrostatic pressure, sodium nitrite and salt concentration on the
growth of Listeria monocytogenes on RTE ham and turkey. Meat Science, 93(2),
263–268.
Nannerup, L. D., Jakobsen, M., Van den Berg, F., Jensen, J. S., Møller, J. K. S. and
Bertelsen, G. (2004). Optimizing colour quality of modified atmosphere packed
sliced meat products by control of critical packaging parameters. Meat Science,
68, 577–585.
Nissen, H., Alvseike, O., Bredholt, S., Holck, A. and Nesbakken, T. (2000). Comparison
between the growth of Yersinia enterocolitica, Listeria monocytogenes, Escherichia
coli O157:H7 and Salmonella spp. in ground beef packed by three commercially
used packaging techniques. International Journal of Food Microbiology, 59, 211–220.
Ozdemir, M. and Floros, J. D. (2004). Active food packaging technologies. Critical
Reviews in Food Science and Nutrition, 44, 185–193.
Raines, C. R., Dikeman, M. E., Grobbel, J. P. and Yancey, E. J. (2006). Effects of ascorbic
acid and Origanox™ in different packaging systems to prevent pork lumbar
vertebrae discoloration. Meat Science, 74, 267–271.
Rao, D. N. and Sachindra, N. M. (2002). Modified atmosphere and vacuum packaging
of meat and poultry products. Food Reviews International, 18, 263–293.
Sánchez-Escalante, A., Djenane, D., Torrescano, G., Beltrán, J. A. and Roncalés, P.
(2001). The effects of ascorbic acid, taurine, carnosine and rosemary powder on
colour and lipid stability of beef patties packaged in modified atmosphere. Meat
Science, 58, 421–429.
Saraiva, C., Fontes, M. C., Patarata, L., Martins, C., Cadavez, V. and Gonzales-Barron,
U. (2016). Modelling the kinetics of Listeria monocytogenes in refrigerated fresh
beef under different packaging atmospheres. LWT—Food Science and Technology,
66, 664–671.
Seyfert, M., Hunt, M. C., Mancini, R., Hachmeister, K. A., Kropf, D. H. and Unruh,
J. A. (2004a). Accelerated chilling and modified atmosphere packaging affect
colour and colour stability of injection-enhanced beef round muscles. Meat Sci-
ence, 68, 209–219.
Seyfert, M., Mancini, R. A. and Hunt, M. C. (2004b). Internal premature browning in
cooked ground beef patties from high-oxygen modified-atmosphere packaging.
Journal of Food Science, 69, C721–C725.
Siegel, D. G. (2010a). Packaging for Processed Meats. Meat Processing Technology Series.
Champaign, IL: American Meat Science Association.
Siegel, D. G. (2010b). Retail Packaging for Fresh Meats. Meat Processing Technology Series.
Champaign, IL: American Meat Science Association.
Smiddy, M., Papkovskaia, N., Papkovsky, D. B. and Kerry, J. D. (2002). Use of oxygen
sensors for the non-destructive measurement of the oxygen content in modi-
fied atmosphere and vacuum packs of cooked chicken patties; impact of oxygen
content on lipid oxidation. Food Research International, 35, 577–584.
Smolander, M., Hurme, E. and Ahvenainen, R. (1997). Leak indicators for modified
atmosphere packages. Trends in Food Science and Technology, 8, 101–106.
Solomon, J. (2004). Eliminating oxygen. Meat and Poultry, 50(9), 38–41.
Sørheim, O., Nissen, H., Aune, T. and Nesbakken, T. (2001). Use of carbon monoxide
in retail meat packaging. In Proceeding of the Reciprocal Meat Conference. Savoy,
Illinois. American Meat Science Association, 47–51.
646 Advanced Technologies for Meat Processing, Second Edition

Sørheim, O., Nissen, H. and Nesbakken, T. (1999). The storage life of beef and pork
packaged in an atmosphere with low carbon monoxide and high carbon diox-
ide. Meat Science, 52, 157–164.
Sørheim, O., Ofstad, R. and Lea, P. (2004). Effects of carbon dioxide on yield, texture
and microstructure of cooked ground beef. Meat Science, 67, 231–236.
Spanos, D., Torngren, M. A., Christensen, M. and Baron, C. (2016). Effect of oxygen
level on the oxidative stability of two different retail pork products stored using
modified atmosphere packaging (MAP). Meat Science, 113, 162–169.
Sukumaran, A. J., Nannapaneni, R., Kiess, A. and Sharma, C. S. (2016). Reduction
of Salmonella on chicken breast fillets stored under aerobic or modified atmo-
sphere packaging by the application of lytic bacteriophage preparation Salmo-
Fresh™. Poultry Science, 95, 668–675.
Summo, C., Pasqualone, A., Paradiso, V. M., Centomani, I., Centoducati, G. and
Caponio, F. (2016). Lipid degradation and sensory characteristics of ripened
sausages packed in modified atmosphere at different carbon dioxide concentra-
tions. Journal of the Science of Food and Agriculture, 96, 262–270.
Tan, K. H. and Gill, C. O. (1982). Physiological basis of CO2 inhibition of a meat spoil-
age bacterium, Pseudomonas flourescens. Meat Science, 7, 9–17.
Tewari, G., Jayas, D. S. and Holley, R. A. (1999). Centralized packaging of retail meat
cuts: A review. Journal of Food Protection, 62, 418–425.
U.S. FDA. (2002). Food and Drug Administration. Agency Response Letter GRAS
Notice No. GRN 000083.
U.S. FDA. (2004). Food and Drug Administration. Agency Response Letter GRAS
Notice No. GRN 000143.
Zhao, Y., Wells, J. H. and McMillin, K. W. (1995). Dynamic changes of headspace gases
in CO2 and N2 packaged fresh beef. Journal of Food Science, 60, 571–575, 591.
21
Nanotechnology-Based Packaging
Materials for Fresh and Processed Meats

Brandon Guild, Hans Bernard Tee, and Loong-Tak Lim

CONTENTS
21.1 Nanotechnology in Food........................................................................... 647
21.1.1 Spoilage Reactions in Fresh and Processed Meat...................... 649
21.2 Nanotechnology-Based Meat Packaging Systems ................................650
21.2.1 Enhanced Barrier Using Nanoclay .............................................. 651
21.2.2 Application of Nanoclay Composites in Meat Packaging ....... 653
21.2.3 Antimicrobial Active Packaging ..................................................654
21.2.3.1 Antimicrobial Ions .......................................................... 658
21.2.3.2 Bacteriophage .................................................................. 661
21.2.3.3 Antimicrobial Proteins and Peptides ........................... 663
21.2.4 Intelligent Packaging .....................................................................664
21.2.4.1 Colorimetric Indicators .................................................. 667
21.2.4.2 Biosensors ........................................................................ 670
21.3 Nanostructured Edible Films and Coatings ........................................... 671
21.4 Societal Implications .................................................................................. 675
21.4.1 Potential Risks ................................................................................ 676
21.4.2 Regulation ....................................................................................... 678
21.4.3 Public Acceptance .......................................................................... 679
21.5 Conclusion .................................................................................................. 679
References.............................................................................................................680

21.1 Nanotechnology in Food

The meat industry comprises a large segment of the food industry in many
developed countries, significantly contributing to the gross domestic prod-
uct (Barbut, 2015). Meat consumption is increasing around the world due to
rising income levels and increased population growth. The United Nations
Population Fund estimates the global population will reach 9 billion in the
mid-2040s (UNDESA, 2015; Population Division, 2015). In developing coun-
tries, people tend to shift from a plant-based diet to a diet higher in meat as

647
648 Advanced Technologies for Meat Processing, Second Edition

the society becomes more affluent (Barbut, 2015). As the demand for meat
increases, there is a need to develop packaging technology that will meet
the requirements of the modern meat processing industry, fulfill changing
consumer preferences, and at the same time, address environmental and
societal issues.
Nanotechnology is a rapidly growing field, which encompasses scientific
and engineering phenomena observed at the nanoscale. By and large, nano-
materials are referring to those that have at least one dimension ranging
between 1 and less than 100 nm. Growing research interest and advance-
ment in nanotechnology can be seen across many industries, such as automo-
biles, biomedical, and electronics. At nanoscale, properties such as melting
point, fluorescence, electrical conductivity, magnetic permeability, chemical
reactivity, and so on, change dramatically as compared to the larger bulk
counterparts (Gupta, 2014). Due to recent advances in manufacturing tech-
nologies and atomic microscopy, it is now possible to manipulate and study
nanomaterials more efficiently than ever, greatly facilitated by the commer-
cial exploitation of nanomaterials for various applications.
In the food industry, nanotechnologies have been applied in the formula-
tion of various products and packaging materials. For example, nanotech-
nology has been applied in the development of controlled release systems for
flavors and antimicrobials in foods through nanoencapsulation (Figure 21.1).
Applying nanotechnology in the manufacturing of food packaging can
result in composite structures with enhanced material properties (Lim,
2014). By virtue of their large modulus and crystalline structure, dispersing
of nanoparticles within a thermoplastic matrix can form composite materials
with an increased tortuous path for gas diffusion, resulting in enhanced bar-
rier properties. Surface modification of these rigid fillers for optimal disper-
sion in the polymer can also result in packaging structures with substantial
mechanical reinforcement, providing potential opportunities for package
lightweighting. Other means of improving protection is through the appli-
cation of surface coatings containing nanomaterials on conventional pack-
aging materials, for improving barrier properties. Figure 21.2 shows how
nanomaterials can be incorporated in packaging material. For some pre-
Bioactive encapsulated in
Solvent nonwoven fiber Electrospun polymer fiber

Bioactive

Electrospinning
Polymer
solution
Bioactive dispersed in Environmental trigger Bioactive released in response
polymer solution (e.g., heat, gas, moisture) to environmental trigger

FIGURE 21.1
Schematic of the activated release of a bioactive agent from electrospun nonwoven membrane.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 649

Applicator Solvent
Polymer solution Polymer coating

Untreated surface Drying

(a)
Activated surface

Adding
Functionalized surface nanomaterial
(b)
Filler

Polymer

Extrusion Mix nanofillers with polymer

Mix nanofillers with polymer
(c)

FIGURE 21.2
Incorporation of nanomaterials by (a) coating, (b) surface functionalization, and (c) adding as
a filler.

mium products, “intelligent” packaging features that enhance product

traceability and those capable of communicating with consumers on actual
product freshness will become more integral to meat package design. These
meat-packaging advancements will increase the efficiency of supply chain
management, improve food safety, reduce waste, and enhance brand and
product protection.
In order to leverage nanotechnology for food packaging applications,
developing an adequate regulatory framework will also be important for
assessing the potential risks and benefits involved. This chapter discusses
how nanotechnology can be used to improve the functions of meat packag-
ing, opportunities for using nanomaterials in enhancing material properties
of meat packaging, and reviews selected examples in intelligent and edible
packaging. In Section 21.4, the societal implications of using nanomaterials
in meat packaging are discussed.

21.1.1 Spoilage Reactions in Fresh and Processed Meat

Color and microbiological count are the main factors that dictate the quality
of meat products. Color is typically regarded as the first limiting factor in
product shelf life. The red color of fresh meat produced via the oxygenation
of deoxymyoglobin is a desirable trait for consumers shopping for fresh meat
650 Advanced Technologies for Meat Processing, Second Edition

at retail. For cured and processed meats, the pink-red color is fixed by the
conversion of myoglobin to nitrosomyoglobin in the presence of nitric oxide
from nitrate. In both cases, inadequate packaging design or inappropriate
storage temperature can compromise meat color. For fresh meat products,
insufficient oxygen ingress will not allow for sufficient “blooming” of red
coloration and may be perceived by consumers as expired product. In cured
and processed meats, excess oxygen ingress can lead to microbial activ-
ity and discoloration due to the growth of spoilage microorganisms. The
microflora of fresh and processed meat is diverse. Pathogens associated with
meat include Campylobacter spp., Clostridium botulinum, verotoxigenic Esch-
erichia coli, Salmonella spp., Shigella spp., Listeria monocytogenes, and Yersinia
enterocolitica (Gill and Gill, 2010). At chill temperatures, Pseudomonas and
Lactobacillus strains that thrive under cold conditions can outcompete other
microbes in aerobic and anaerobic conditions, respectively. Pseudomonas is
most commonly implicated in the formation of the slimy, sticky appearance
of old meat. When glucose in meat tissue is used up, Pseudomonas begins to
degrade protein and metabolize amino acids, resulting in the formation of
ammonia and other offensive volatiles. For meats packaged under modified
atmosphere, the absence of O2 inhibits the growth of Pseudomonas and other
aerobic strains, giving way to a microflora dominated by anaerobes and fac-
ultative anaerobes such as Bronchothrix thermosphacta, Enterobacteriaceae,
Lactobacillus, and other lactic acid bacteria (Robertson, 2013).

21.2 Nanotechnology-Based Meat Packaging Systems

Typical packaging format for meat products are presented in Figure 21.3. The
simplest package involves wrapping the meat product in flexible materials,
such as laminated kraft paper, for temporary containment of meat products
sold at retailers and butcher shops to facilitate consumer’s transportation. To
enhance protection and facilitate product sales on the shelf, meat products

(a)
(b)

(c) (d)

FIGURE 21.3
Illustrations of meat packaging: (a) kraft/butcher paper, (b) expanded polystyrene foam tray
with stretch film, (c) vacuum skin package, and (d) modified atmosphere packaging.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 651

are often packaged in thermoformed plastic containers or foamed trays that

are overwrapped with stretched film. To further extend the shelf life, more
complicated packaging systems such as vacuum packaging and modified
atmospheric packaging (MAP) are being used, in conjunction with refrigera-
tion or freezing. In each of these scenarios, the use of nanotechnology can
lead to novel packaging designs that improve meat product quality.

21.2.1 Enhanced Barrier Using Nanoclay

Nanoclays, the most common type being montmorillonite (MMT), are lay-
ered silicates. The building block of MMT structure consists of two tetrahe-
dral sheets of silica that sandwich a central octahedral sheet of aluminum,
iron, magnesium, or lithium hydroxides. Particles of MMT and other nano-
clays such as bentonite and kaolinite are available commercially. The use
of nanoclay or MMT can allow for an enhanced barrier of meat packaging
material when modified and dispersed in a compatible polymer, such as
polyethylene (PE), to create a nanocomposite packaging film for meat prod-
ucts (Busolo and Lagaron, 2012). Polymer–clay nanocomposites can improve
mechanical, barrier, and physical properties, and thermal stability of poly-
mer and biopolymer composite films due to the high surface area to volume
ratio (Lim, 2014). Understanding the factors that affect the physical properties
of nanocomposites is important in order to fully exploit nanomaterials for
food packaging applications. Of great importance are nanoparticle–matrix
and particle–particle interactions (Pukanski and Fekete, 1999). For instance,
when 1 or 3 wt% MMT is incorporated into chitosan (a deacetylated deriva-
tive of chitin), water vapor permeability of MMT–chitosan composite film
can be reduced by about 40% or 45%, respectively (Abdollahi et al., 2012).
Tensile strength of the composite film created by these researchers increased
significantly through the incorporation of MMT into chitosan up to 3 wt%,
but adding more MMT beyond this point does not further improve the
mechanical properties of the composite due to MMT particle aggregation.
Improved mechanical properties can be achieved through surface modifica-
tion of nanoparticles that increases interfacial interaction between the nano-
material filler and matrix, as well as results in uniform dispersion of the
fillers to form a coherent polymer network to optimize load transfer between
the polymer matrix and the nanofillers (Islam et al., 2013). Other reinforc-
ing fillers for enhancing the material properties of packaging include carbon
nanotubes as well as nanoparticles of silver, titanium oxide, silica, nanocal-
cium carbonate, hydroxyapatite, and nanocellulose crystals.
The use of MMT and other fillers in packaging thermoplastics can enhance
barrier performance, which is important in preserving the shelf life of pro-
cessed meat products, particularly cooked ready-to-eat (RTE) products that
are susceptible to color change and spoilage due to O2 ingress. For fresh meat
products, it is important to have the optimal O2 concentration to maintain
color and quality during the limited shelf life. In this regard, nanomaterials
652 Advanced Technologies for Meat Processing, Second Edition

can be used to modify the barrier of a film or packaging material to have the
necessary O2, CO2, and water vapor flow to ensure microbial growth and
light-inducted photooxidation is minimized.
To enhance the material properties of packaging composite structure, the
filler particles must be dispersed homogeneously in the polymer matrix by (1)
in situ polymerization, (2) solution casting, or (3) melt processing. For in situ
polymerization, the layered silicates are expanded with the monomers and the
galleries of the silicate layers are being intercalated with the polymer chains
as they grow during polymerization. By contrast, in solution casting, the poly-
mer is dissolved in a solvent to form a solution, the nanomaterial added, and
the resulting mixture is cast onto a solid surface and the solvent is allowed to
evaporate, forming a solidified film. Melt processing is more commonly used
in the industry, where nanofillers are dispersed in the molten polymer during
extrusion or compounding processes, followed by cooling to solidify the poly-
mer. Regardless of the method used, modification of the filler is often needed
to promote its interaction with the polymer. For MMT, one of the strategies
used to ensure its homogeneous distribution in thermoplastic is to modify
the layered silicate with an organic surfactant. Native MMT is relatively more
hydrophilic than typical thermoplastic polymers used in food packaging
applications. To ensure the compatibility of the dispersed and continuous
phases, organo-modified MMT is often used, where the clay is modified by
exchanging the sodium, lithium, calcium cations within the gallery of the lay-
ered silicates with organic surfactants, such as trimethyl stearyl ammonium,
octadecylamine, and methyl dihydroxyethyl hydrogenated tallow ammonium
(Singala et al., 2012; Sengwa and Choudhary, 2012). The exchange of cations
within MMT with surfactants allows polymer chains or monomers to inter-
calate into the galleries in the MMT. The enhanced mechanical strength and
barrier properties of MMT nanocomposite, as compared with the neat poly-
mer, can be attributed to the MMT’s physical anchorage effects on the polymer
molecules, which limit the segmental chain mobility. Moreover, by applying
adequate shear during melt processing, the expanded MMT can be exfoli-
ated into separate silicate layers, the dispersion of which in a polymer matrix
can increase the tortuous path of permeant molecules moving through the
composite structure (Figure 21.4). Another study observed the effect four dif-
ferent surfactants had on their ability to modify MMT clay. Field-emission
scanning electron microscopy (SEM) results showed that the size of the dis-
persed poly(butylene succinate-co-adipate) (PBSA) phase was reduced with
the addition of organoclay and the extent of this size reduction was dependent
on interlayer spacing of the clay, in addition to enthalpic interaction between
the clay surface and the poly(lactic acid) (PLA)–PBSA polymer blend (Ojijo
et al., 2011). Dispersion of silicate layers in the blend matrix was also charac-
terized by x-ray diffraction. An improved adhesion between the continuous
polymer phases and the fine morphology of the dispersed phase contributed
to the improvement in the mechanical and thermal properties of the final com-
posites (Ojijo et al., 2011).
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 653

Tortuous diffusion path

FIGURE 21.4
Torturous diffusion path of a permeant molecule through a nanocomposite.

21.2.2 Application of Nanoclay Composites in Meat Packaging

Picouet et al. (2014) investigated the use of nanoclay to modify a polyamide 6
(PA6)-multilayer film in vacuum-packed meat. The films were prepared via
A/B/C/B/A structure. The outer layers (A) were composed of low-density
polyethylene (LDPE) (LDPE Dow 410E), while the interlayer (C) was com-
posed of either commercial nanoclay modified polyamide or a standard PA6
(Ultramid B36LN, BASF, Ludwigshafen, Germany). B layers were adhesives.
The prototype films were prepared via cast film coextrusion at 38 rpm for
the LDPE, 50 rpm for the polyamide, and 15 rpm for the adhesive. Vacuum-
aging of meat in the multilayer polyamide nanocomposite took place for 7,
14, and 21 days at 2 ± 2°C in darkness. After each aging time, the 100 mm
pieces of beef loin were cut into four slices in 20 mm thick, packed in MAP,
and displayed using the same conditions as the nonaged meat slices, which
were in a display case with 12 h exposure to fluorescent light and 12 h expo-
sure to darkness. It was found that reinforced PA6 films reduced the oxygen
transmission rate by over 50%, as compared with the neat PA6 films at an
equivalent thickness (Picouet et al., 2014).
Beatrice et al. (2010) reported enhanced barrier and mechanical proper-
ties of PA6 nanocomposites with organo-modified exfoliated MMT. They
observed improved tensile mechanical properties with the addition of 5 wt%
modified MMT in the PA6 nanocomposite film prepared by first compound-
ing PA6 with nanomaterial twin-screw extrusion, then processed into films
by extrusion-blowing (Beatrice et al., 2010). Water vapor and oxygen perme-
ability rates of the nanocomposites containing 3% or 5% MMT were lower
than the neat PA6 (Beatrice et al., 2010). In another study, Mohammad and
Abolghasemi (2011) observed that O2 gas permeability through PA6 nano-
composite films decreased significantly by the addition of 3 wt% of modified
sodium MMT clay.
The rising popularity of nanoclay fillers for food applications can be attrib-
uted to the relatively low cost of the raw materials and improvements to the
O2 barrier that can be made for films for which the barrier would be other-
654 Advanced Technologies for Meat Processing, Second Edition

wise low. Concerning the costs of using MMT, though the cost of many MMT
nanoclays can be high on a per-kilo basis, a relatively small amount, often less
than 5 wt% in a film formulation, is required to achieve the desired effect.
The wt% of MMT used in the formulation also substitutes a given amount
of polymer of known cost, and the benefits to product shelf life imparted
by using the MMT may further help to offset the cost increase. Future work
should continue on evaluating the efficacy of MMT composite materials
for modified atmosphere meat packaging under typical storage conditions
encountered during distribution. Enhanced barrier and mechanical proper-
ties of nanocomposite over the neat polymer imply that less packaging mate-
rial could be used in meat packaging through the incorporation of nanoclays
in the package structure, providing opportunities for weight reduction and
cost savings. Commercially available nanoclay-based polymer films that
may be advantageous for meat packaging are the Imperm® and Durethan®
film series by Nanocor© and Lanxess©, respectively. These nanoclay-based
polymers are transparent with improved stiffness and oxygen-scavenging
ability (Pradhan et al., 2015). Imperm is made up of nylon and nanoclay with
oxygen-scavenging properties. Durethan is a polyamide-based film which
can be used as synthetic sausage casings (Flanagan and Singh, 2006). In con-
trast to the many benefits to performance imparted by MMT, one area of con-
cern for clay-based nanocomposites is the potential migration and toxicity of
the dispersed nanomaterials—an important but seldom studied issue. These
risks are addressed in Section 21.4.2 of this chapter.

21.2.3 Antimicrobial Active Packaging

Over the past 10–15 years, many studies incorporated antimicrobials and
antioxidants such as organic acids, essential oils, and natural extracts into a
variety of polymers to create active packaging for food. Active packaging is
defined as “packaging in which subsidiary constituents have been deliber-
ately included in or on either the packing material or the package headspace
to enhance the performance of the package system” (Robertson, 2013). Recent
advances in this area have been focusing on exploiting the unique properties
of nanomaterials. This section reviews some of the recent developments in
nano- and micromaterial-enabled active packaging systems.
Thymol is a natural extract of thyme known to have antimicrobial effects on
pathogens and spoilage organisms in meat products, as well as provide anti-
oxidant effects (Fratianni et al., 2010; Jayasena and Jo, 2013). The nanocomposite
can be used as a carrier for gradual release of thymol from the composite matrix
over time, allowing for enhanced preservation of foods for extended time. Elu-
cidating the release kinetic will be important when deploying such compounds
in meat products to inhibit certain strains of spoilage and pathogenic microor-
ganisms, especially under typical refrigerated distribution and storage condi-
tions. Further research in developing food-grade solvent for the preparation of
antimicrobial composites will be essential to ensure commercial viability.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 655

In another study, MMT nanoclay and polyphenols extracted from brewery

waste were incorporated into ethylene vinyl acetate (EVA) and LDPE films
(Barbosa-Pereira et al., 2014). In beer production, surplus polyphenols cause
excess haze and cloudiness. The removal of these polyphenols will improve
the stability and shelf life of beers. Barbosa-Pereira et al. (2014) developed
a method to remove the polyphenols using polyvinylpolypyrrolidone resin
(PVPP) in a clarification step, producing a PVPP “sludge” with a high content
of phenolic compounds such as flavonols, hydroxycinnamic, and hydroxy-
benzoic acids including gallic acid, caffeic acid, p-coumaric acid, and ferulic
acid. Briefly, in their approach, the sludge from beer filtration was acidi-
fied to pH 1.5 with HCl (37%), followed by extraction of polyphenols using
ethyl acetate (1:2 ratio) by stirring for 30 min at room temperature. Follow-
ing phase separation, the organic portion was collected via decanting and
evaporated to dryness at 40°C under vacuum. These researchers added the
dry phenolic extract to organo-modified MMT clay (Nanobioter® AE 21) at
20 wt% level to create functionalized MMT. The functionalized nanoclays
were then incorporated into EVA and LDPE films during extrusion, or the
dry polyphenol powder was added directly into the polymer matrix of films
during extrusion by dry compounding using a microcompounder (Haake
MiniLab II Micro Compounder, Thermo Scientific, Germany) with a corotat-
ing twin-screw extruder operating at a speed of 150 rpm at 150°C for 6 min.
The antimicrobial activity of the active films in this study was assessed by
the ASTM E 2149-01 standard test method. EVA film with 6 wt% of free,
unfunctionalized phenol extract was effective against E. coli after incubation
for 48 h and throughout the entire incubation time for Staphylococcus aureus.
All EVA-active films with MMT-functionalized phenolic extract showed anti-
microbial activity against S. aureus during incubation. Considering the over-
all bioactive migration and antimicrobial effects, EVA films appeared to be
the more suitable type of film for incorporating the MMT-factionalized phe-
nolic extract and provided more favorable antimicrobial and antioxidative
results than LDPE in this work (Barbosa-Pereira et al., 2014). An intriguing
finding from this study was that the inclusion of the functionalized nano-
clays improved the effectiveness of the active packaging film, even though
they contained lower amounts of natural extract (Barbosa-Pereira et al., 2014).
These studies suggest there is an advantage in functionalizing MMT with
low molecular weight antimicrobials such as phenolic compounds, and that
nanoclay functionalization may facilitate their controlled release into in
vitro systems.
Halloysite (HT) is a two-layered aluminosilicate nanotube with internal
diameter of 20–50 nm and length up to 10 mm (Lvov et al., 2015). These nano-
tubes are cost-effective, widely available, durable, and possess high levels of
mechanical strength and biocompatibility. They are of particular research
interest due to the chemistry of the inner and outer surface of these nano-
tubes, and the possibilities of loading antimicrobial agents inside their core,
thereby designing carrier systems to control their release for meat packaging
656 Advanced Technologies for Meat Processing, Second Edition

applications. Recent research in this area has shown the ability of HT nano-
tubes to be used for controlled released bioactives and antimicrobials in food
packaging systems (Boelter and Brandelli, 2016; Tornuk et al., 2015). The effec-
tiveness of active packaging films of linear low-density polyethylene (LLDPE)
with thymol-loaded HT for controlling discoloration, lipid oxidation, and
E. coli O157:H7 growth in fermented sausage and fresh beef was investigated
by Tornuk et al. (2015). Fresh beef color was maintained up to four days by
active use of the nanocomposite films, while a bacteriostatic/bactericidal
effect on E. coli O157:H7 in fresh beef was reported during a seven-day storage
period (Tornuk et al., 2015). Reduced lipid oxidation for fermented sausage
vacuum-packaged in active nanocomposite films was observed as well.
In a study by Boelter and Brandelli (2016), liposomes prepared with either
soybean lecithin or Phospholipon® 90G (a pure phosphatidylcholine stabi-
lized with 0.1% ascorbyl palmitate supplied by Lipoid GMBH, Germany),
with particle sizes ranging from 124 to 178 nm, showed that the Phospho-
lipon liposomes displayed greater stability than those prepared with soy-
bean lecithin. The researchers further loaded Phospholipon liposomes with
1.0 mg/mL nisin into HT and dispersed into casein or gelatin at 0.5 g/L of HT
to form composite films that had a smooth surface, but increase in roughness
with increasing liposomes and HT contents. Both gelatin and casein nano-
composite films exhibited antimicrobial activity against L. monocytogenes in
zone of inhibition tests performed on Brain–Heart Infusion agar plates pre-
viously inoculated with a swab submerged in a suspension of L. monocyto-
genes ATCC 7644 (Boelter and Brandelli, 2016). In another study, starch/HT/
nisin nanocomposite films were developed as active antimicrobial packag-
ing and tested on skimmed milk agar and on cheese (Meira et al., 2016). SEM
of composite films revealed that all samples were homogeneous, but that
aggregates appeared on film surfaces when a higher amount of nisin was
added. Moreover, the addition of nisin decreased thermal stability of nano-
composites as compared with starch/HT films without nisin. The antimicro-
bial activity was tested against L. monocytogenes, C. perfringens, and S. aureus
in skimmed milk agar and on Minas Frescal cheese surface previously inoc-
ulated with L. monocytogenes. Inhibition toward all the organisms tested was
seen in skim milk agar, and during storage of cheese over 14 days, antimi-
crobial nanocomposite films with 2 g/100 g nisin significantly reduced the
initial counts of the bacterium after four-day storage (Meira et al., 2016). For
films with 6 g/100 g nisin, significant decrease in L. monocytogenes popula-
tion was observed after day 1, with no bacteria detected at the 4-, 7- and
14-day sample points indicating a bactericidal effect from the applications of
the active nanocomposites. While much of the research on HT application on
meat systems demonstrates the ability of HT to permit controlled release of
a bioactive into a meat product, as well as improve some mechanical prop-
erties such as tensile strength in starch films (Meira et al., 2016), more work
needs to be done on a broader variety of meat products, as well as coupling
studies with sensory evaluation of the product and nanotoxicity studies.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 657

Studies have shown that composite packaging film loaded with MMT
or HT and bioactives from botanicals may be promising in direct contact
applications, such as for wrapping or skin packaging of fresh meats. Future
studies on elucidating the mechanism of release of bioactives, stability of
these compounds during storage, as well as more in-depth investigation of
the nanocomposite films on meat systems under typical distribution condi-
tions will be useful to demonstrate the antimicrobial efficacy and commer-
cial viability. A summary of select works in antimicrobial active packaging
appears in Table 21.1.

TABLE 21.1
Summary of Antimicrobial Active Packaging Systems Relevant to Meat Systems
Meat
Bioactive Packaging Product
Nanomaterials (If Added) Material(s) Application Effects References
MMT nanoclay n/a PA6 Beef loins Enhanced Picouet et al.
shelf life (2014)
Lowered
thick-
ness of
packaging
material
MMT n/a PA6 Not tested Reduced Beatrice et al.
WVTR and (2010)
O2 perme-
ability
Silver (Ag) n/a LDPE Chicken Inhibited Panea et al.
nanoparticles breasts Escherichia (2014)
and zinc oxide coli, Pseudo-
(ZnO) monas
aeruginosa,
Listeria
monocyto-
genes
Ag nanopar- n/a PLA Growth Inhibited Munteanu
ticles media E. coli, et al. (2014)
Salmonella,
L. monocy-
togenes
Ag nanopar- n/a Microcrys- Growth Inhibition of Vivekanand-
ticles talline media Bacillus han et al.
cellulose stearother- (2012)
mophilus

(Continued)
658 Advanced Technologies for Meat Processing, Second Edition

TABLE 21.1 (Continued)

Summary of Antimicrobial Active Packaging Systems Relevant to Meat Systems
Meat
Bioactive Packaging Product
Nanomaterials (If Added) Material(s) Application Effects References

O2Block® Thymol PCL Growth Nanoclay Sanchez-

(modified essential media increased Garcia et al.
nanoclay) oil solubility (2008)
of thymol
and
enabled
controlled
release
MMT nanoclay Polyphe- EVA and Beef Reduced Barbosa-
nol LDPE Staphylo- Pereira
extract films coccus et al. (2014)
from beer aureus
retentate growth
Reduced
oxidation
and color
changes
Halloysite Thymol LLDPE Fermented Reduced Tornuk et al.
nanoclay essential sausage lipid oxida- (2015)
oil and fresh tion in
beef fermented
sausage
Bacterio-
static
against
E.coli in
fresh beef
over 7-day
shelf life
Encapsulated bacteriophage Alginate None Reduced Dini et al.
and pectin sensitivity (2012) and
micro- to low pH Singla et al.
spheres; Prolonged (2016)
phospho- storage
lipids times
EVA, ethylene vinyl acetate; LDPE, low-density polyethylene; LLDPE, linear low-density
polyethylene; MMT, montmorillonite; PA6, polyamide 6; PCL, polycaprolactone; PLA,
poly(lactic acid); WVTR, water vapor transmission rate.

21.2.3.1 Antimicrobial Ions

One of the most investigated antimicrobial ions in recent literature is the sil-
ver nanoparticle (AgNP) with particle size ranging from 1 to 100 nm. While
AgNPs are often described as “silver,” some are composed of silver oxide, in
addition to the silver element. AgNPs of different shapes can be produced
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 659

depending on the synthesis processes, but sphere, octagon, and thin sheet
are common. AgNPs have been investigated in depth for their antimicrobial
properties. Reasons why AgNPs are of notable interest as an antimicrobial
are their high thermal stability, sustainable bactericidal activity, and broad
spectrum efficacy against bacteria, viruses, and fungi (Dehnavi et al., 2012).
Also, from a safety perspective, the toxicity of silver to human is fairly low.
A study assessing the acute toxicity of AgNPs indicated the LD50 of colloi-
dal AgNPs is greater than 5000 mg/kg body weight (Maneewattanapinyo
et al., 2011). Another study observed the cytotoxicity of ZnO nanoparticles
and AgNPs in human epithelial colorectal adenocarcinoma (Caco-2) cells. It
was determined that ZnO nanoparticles possessed higher cytotoxicity than
AgNPs when applied in the concentration range, and that the LD50 of ZnO
NPs in Caco-2 cells is 0.431 mg/L. In comparison, the amount of nano sil-
ver used in many packaging materials is approximately 0.05 mg/m3 (Travan
et al., 2009; Vivekanandhan et al., 2012).
To facilitate end-use deployment, AgNP is often temporarily encapsulated
in carrier matrices that allow for controlled release of the ions to achieve opti-
mal antimicrobial efficacy. For example, electrospun PLA nanofibers incor-
porating AgNP and vitamin E may be used in fruit and juice packaging due
to large surface area of nanofibers, which allows for the diffusion of AgNP
and antioxidant onto the surface of these products (Munteanu et al., 2014).
Conceivably, a similar approach may be feasible for fresh meats, which have
a high moisture content that facilitates the diffusion of these active agents
to inhibit the proliferation of microorganisms. The mode of antimicrobial
action exhibited by AgNP is depicted in Figure 21.5.
AgNP has been encapsulated in chitosan gels, PE, polyvinyl acetate, and cel-
lulose films by various researchers. Combining AgNP and chitosan films can
result in packaging materials with synergistic antimicrobial effects. Travan

e– Interruption of
electron transport
AgNP

e–
Damage of Damage of
membrane/ cell DNA
cell wall
Protein
oxidation

AgNP
ROS generation

FIGURE 21.5
Possible modes of antimicrobial activity for nanosilver.
660 Advanced Technologies for Meat Processing, Second Edition

et al. (2009) developed a novel method to coat AgNP particles in chitosan and
encapsulate them in an alginate hydrogel (Travan et al., 2009). The results sug-
gested that the gels could prevent AgNP against aggregation, providing anti-
bacterial activity against E. coli, S. aureus, and Pseudomonas aeruginosa without
exhibiting toxicity to mammalian cells (Travan et al., 2009). Potara et al. (2011)
also showed that chitosan-coated AgNP exhibited antimicrobial activity
against two strains of S. aureus when incorporated into Mueller Hinton agar.
These findings may be of interest to meat processors, as these pathogens can
often be a source of foodborne illness from meat products.
Recently, a study reported one interesting approach to encapsulate AgNP
ions by impregnating them into microcrystalline cellulose, followed by the
inclusion in PLA polymer to produce antimicrobial (AM) films (Vivekanand-
han et al., 2012). Here, the researchers used a curry leaf extract-mediated biore-
duction process to reduce silver nitrate. The silver ions formed were nucleated
as AgNP on dispersed fragments of microcrystalline cellulose (MCC). The
AgNP-impregnated MCC was washed with deionized water and dried in
an oven at 55°C overnight. The powder was then dispersed in solvent-casted
PLA films that demonstrated antimicrobial properties against Bacillus stea-
rothermophilus via Charm disk assay. Transmission electron microscopy and
x-ray diffraction, respectively, confirmed the formation of spherical AgNP and
a face-centered cubic lattice crystalline structure within the MCC network
(Vivekanandhan et al., 2012). In another approach, researchers have exploited
corona discharge as a pretreatment for PE and LDPE films to activate their
surfaces prior to attaching AgNP (Sundaram et al., 2013; Dehnavi et al., 2012).
Using surface activation methods, or mediated release methods from inside
the film, effective active packaging films may be created for packaging meat in
vacuum-sealed packages for either fresh or processed meats.
Besides AgNP, other inorganic nanoparticles such as zinc oxide and tita-
nium dioxide have also been exploited for the development of antimicrobial
active packaging for meat products. In a study, both silver and zinc oxide
nanoparticles were added to LDPE, at 5% or 10% (w/w) levels to packaging
prepared using a JSW J85 ELII electrical injection molding machine, using a
clamping force of 85 t and a screw diameter of 35 mm to prepare composite
structures for the packaging of chicken meats (Panea et al., 2014). Freshly
skinned and deboned chicken breasts were packaged in neat LDPE, 5 wt%
ZnO + AgNP, or 10 wt% ZnO + AgNP, and flushed with a gas mixture of 70%
O2, 20% CO2, and 10% N2. Samples were stored and evaluated up to 21 days.
The researchers reported that adding ZnO + AgNPs to LDPE packaging has
an antimicrobial effect against Enterobacteriaceae at 10 and 15 days of stor-
age, and that the amount of AgNP and ZnO migration from packaging was
well within the level prescribed by the European Union (Panea et al., 2014).
These results are encouraging for meat processors in extending the shelf life
of highly perishable meat products, as well as packaging converters in devel-
oping commercially viable antimicrobial packaging films by direct incorpo-
ration of inorganic nanoparticles into polymers via melt processing.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 661

21.2.3.2 Bacteriophage
Besides organic and inorganic antimicrobial species, bacteriophages have
also been investigated by researchers for AM packaging of food. For exam-
ple, the ListexTM P100 bacteriophage, which is considered as Generally Rec-
ognized as Safe (GRAS) by the Generally Recognized as Safe (GRAS) by the
United States Food and Drug Administration (USFDA), specifically targets
and lyses cells of pathogenic L. monocytogenes (USFDA, 2007). The phage has
been tested on RTE cooked turkey and roast beef products (Chibeu et al.,
2013). These researchers found topical application of a ListexP100 cocktail
of 107 PFU/cm2 to be effective in reducing counts of L. monocytogenes by 2.1
log10 CFU/cm2 for cooked turkey and 1.7 log10 CFU/cm2 for roast beef, com-
pared to untreated meat samples. Listex also exhibits listericidal effect on
fresh sausages (Rossi et al., 2011), fresh salmon fillets (Soni et al., 2010), and
fresh cut fruit and fruit juice (Oliveira et al., 2014). Other approved phage
preparations that may be applied to meat products include Salmonellex™
(Micreos; Wageningen, the Netherlands) targeting Salmonella spp., as well as
SalmoFresh™ and ListoShield™ (Intralytix; Baltimore, Maryland), targeting
Salmonella spp. and Listeria spp. bacteria, respectively.
To extend the use of bacteriophage in packaging for food, several challenges
must be addressed to maintain phage stability and activity (Figure 21.6). First,
the phage must be oriented or incorporated in the packaging matrix such
that it can diffuse to the contacting food and bind with the target pathogens.
Second, the stability of the phage in elevated temperature and pressure con-
ditions typically encountered during food processing needs to be investi-
gated, especially for products that are subjected to thermal processes (e.g.,
retort, pasteurization) and high hydrostatic pressure processing for RTE pro-
cessed meat products. Thermal stability of the phage is genetic and strain
type dependent. For instance, some mutants of the T7 phage cannot replicate
at temperatures above 40°C (Kumar et al., 2001). Loss of phage DNA from

(a)

(b)

FIGURE 21.6
Bacteriophages aligned (a) randomly and (b) aligned with tail facing away from the packaging
surface.
662 Advanced Technologies for Meat Processing, Second Edition

capsids and phage head and tail disintegration can also occur in some phages
during prolonged exposure near 80°C (Marvig et al., 2011). In a study by Black
et al. (2010), coliphages—T4, MS2, Qβ, λ imm434, λ cI 857, and λ cI 857A—were
used as surrogates for Hepatitis A and Aichi viruses for high-pressure treat-
ment of an oyster slurry. They reported that the MS2 phage could survive
treatment at 60°C at 500 MPa for 5 min, while other surrogate phages dis-
played resistance up to 250 and 400 MPa (Black et al., 2010).
High pathogen specificity and the great antimicrobial efficiency of phages
make bacteriophages a desirable means for controlling pathogen growth in
meat products. While this area has received considerable growing research
and commercial interests, several hurdles remain to be tackled. From an end-
use standpoint, long-term stability of the phage in the packaging material is
important to ensure its AM efficacy. This is of concern considering that food
packaging materials are usually being stored for a prolonged period in typi-
cal commercial settings. A few methods have been investigated as a means
of prolonging phage stability. To increase storage stability, bacteriophages
selective for S. aureus (strains 9563 and 8588, NCIMB, respectively) and P.
aeruginosa (strain 217M) have been freeze-dried from SM buffer with or with-
out the addition of gelatin (Puapermpoonsiri et al., 2010). The lytic activity of
freeze-dried phage was compared against control samples stored in a tris-
buffer (1 M tris–HCl, 0.1 M NaCl, 8 mM MgSO4, 0.1 g/L gelatin, pH 7.5) with
and without gelatin and sucrose or poly(ethylene glycol) (PEG) 6000. Phage
samples were stored at 4°C and lytic activity was tested up to 30 days. The
freeze-dried formulations proved more stable than for bacteriophage encap-
sulated in PEG matrix (Puapermpoonsiri et al., 2010). Besides freeze-drying,
other encapsulation methods involving different biopolymer matrices and
preparation technologies may also be useful in enhancing the stability of
the bacteriophage. For example, alginate or pectin biopolymers have been
utilized to encapsulate CA933P phage (lytic for Enterohemorrhagic E. coli
[EHEC] serotypes of E. coli) in microspheres. Microspheres of emulsified
pectin displayed good encapsulation efficiency and protection against acid-
ity, with phages remaining active after 30 min exposure at pH 1.6, and also
protected the phage from pepsin activity (4.2 mg/mL). On the other hand,
free phages were completely inactivated at pH 1.6 or with pepsin (0.5 mg/mL)
after 10 min of exposure (Dini et al., 2012). Another study developed a bac-
teriophage encapsulation system utilizing liposomal phospholipid bilayers
to ensure efficient phage delivery to the site of infection by multidrug-resis-
tant strains of bacteria (Singla et al., 2016). In this study, liposome prepared
using soy phosphatidylcholine with Tween 80 and protamine sulfate was
most stable at 4°C, having insignificant reduction (0.096 log PFU/mL) in the
number of entrapped phages during the entire nine-week storage period.
The phage liposomes were found to be less stable at room temperature and
highly unstable at 37°C with 1.16 log PFU/mL reduction as compared to the
initial number of entrapped phages after nine weeks for phages stored at
room temperature (Singla et al., 2016).
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 663

Comparisons have also been made between storage of bacteriophage in

dry versus wet/moist environments. It was observed that when wet micro-
spheres of 0.8% alginate–5% whey protein, containing Felix O1, were stored
at 4°C, the phage remained viable for up to six weeks (Tang et al., 2013).
This is comparable to results obtained for chitosan-coated alginate micro-
spheres used to encapsulate bacteriophage for oral delivery in another report
(Ma et al., 2008). Tang et al. (2013) also tested the activity of Felix-O1 bacterio-
phages that were immersed in maltodextrin, drained, and then dried at 22°C
for 30 h in a laminar flow hood. For air-dried phage, storage at 4°C showed
better stability than those at room temperature. Moreover, 100% survival was
observed for over two weeks (Tang et al., 2013). In another study, the antimi-
crobial efficacy and stability of a phage in edible films made from whey pro-
tein isolate was characterized using an E. coli growth inhibition assay and
plaque-forming unit determination (Vonasek et al., 2014). The researchers
reported that whey protein isolate films stabilized phages during storage on
a light-exposed laboratory bench at 22°C, and in dark, 4°C conditions with-
out significant loss in phage infectivity for greater than one month.
These studies are relevant to meat processors and packaging designers to
demonstrate the encapsulation technologies available to enhance the stabil-
ity of bacteriophages, in order to ensure that they survive the thermal and
pressure treatment processes essential to achieve the required lethality on
the target pathogens. This will give meat processors the flexibility to add
an approved bacteriophage as an in-process treatment and as an additional
microbial growth hurdle prior to packaging of finished product.

21.2.3.3 Antimicrobial Proteins and Peptides

Lysins, also known as endolysins or murein hydrolases, are enzymes pro-
duced by bacteriophages for the purpose of disrupting a host’s cell wall dur-
ing the final stage of the lytic cycle. Lysins are highly evolved enzymes that
are able to target one of the five bonds in peptidoglycan (murein), the main
component of bacterial cell walls. This allows the release of progeny virions
from the lysed cell. These enzymes are being investigated for their use as
biocontrol agents in the food industry due to their effectiveness and specific-
ity (Mahony et al., 2011; Garcia et al., 2010a). Lysins may prove a preferable
biocontrol agent over antibiotics, the latter being susceptible to the evolution
of bacterial resistance in target strains. Lysins have shown to have a syn-
ergetic effect with nisin on reducing S. aureus growth in pasteurized milk
(Garcia et al., 2010b). Future studies should determine if synergistic effects
can also be demonstrated in fresh or RTE meat products.
Nisin is a polycyclic antibacterial peptide produced by the bacterium Lacto-
coccus lactis that is used as a food preservative. In foods, nisin has primarily
been applied to meats and cheeses to control growth of Gram-positive spoil-
age and pathogenic bacteria. It is common to use nisin in foods at levels rang-
ing from ~1 to 25 ppm, depending on the food type and regulation in the
664 Advanced Technologies for Meat Processing, Second Edition

jurisdiction of production. The effect of nisin and ethylenediaminetetraacetic

acid (EDTA) treatments on the shelf life of fresh chicken meat stored using
MAP at 4°C has been evaluated (Economou et al., 2009). Chicken meat was
subjected to nine different antimicrobial treatment combinations: N1 (AM-
free control sample), N2 (500 IU/g; no EDTA added), N3 (1500 IU/g; no EDTA
added), N4 (500 IU/g; 10 mM EDTA), N5 (1500 IU/g; 10 mM EDTA), N6 (500
IU/g 50 mM EDTA), N7 (1500 IU/g; 50 mM EDTA), N8 (10 mM EDTA; no
nisin added), and N9 (50 mM EDTA; no nisin added). In each treatment, the
chicken breast samples were dipped in one of the test solutions, packaged in
MAP with a 65%:30%:5% CO2:N2:O2 gas mixture, and stored at 4°C for up to
24 days. Plating stomached chicken samples during the study period showed
that N3, N4, N5, N6, and N7 decreased populations of mesophilic bacteria,
B. thermosphacta, lactic acid bacteria, and Enterobacteriaceae. Sensory analysis
suggested chicken was best preserved under treatments N6 and N7, maintain-
ing acceptable odor attributes up to 24 and 20 days of storage, respectively
(Economou et al., 2009). In another study, the effect of nisin combined with dif-
ferent packaging treatments on L. monocytogenes growth in RTE meat (turkey
bologna) was evaluated (Naas et al., 2013). Here, bologna was inoculated with
L. monocytogenes and exposed to 100% CO2, air, or vacuum MAP, each with and
without nisin. L. monocytogenes counts were 1–2 log CFU/cm2 lower for each
treatment with nisin. 100% CO2 packaging prevented outgrowth throughout
42 days of storage whereas a 1–2-log increase in populations during storage
was observed for air and vacuum packed. Reportedly, nisin (500 IU/mL) com-
bined with 100% CO2 was the most effective in preventing the growth of L.
monocytogenes on bologna during 42 days of refrigerated storage (Naas et al.,
2013). More recently, another study has focused on assessing the bacterial com-
munities in beef burgers stored in nisin-coated LLDPE packaging, and high-
lighted the effectiveness of this strategy in prolonging beef burger shelf life
(Ferrocino et al., 2016). In this study, the researchers evaluated beef from two
different production lots. Control samples showed a significantly higher abun-
dance of bacteria taxa sensitive to nisin, such as Kocuria rhizophila, Staphylococ-
cus xylosus, Leuconostoc carnosum, and Carnobacterium divergens, as compared
to control samples. However, the nisin-treated batch exhibited a significantly
lower amount of nisin-sensitive bacteria found on treated samples (Ferrocino
et al., 2016). These nisin studies demonstrate the effectiveness of this antimi-
crobial under different meat packaging configurations, which is promising for
inhibiting the growth of both spoilage and pathogenic bacteria.

21.2.4 Intelligent Packaging

The U.S. Center for Disease Control (CDC) estimates that 9.4 million cases of
foodborne illnesses are caused by 31 major pathogens in the United States
each year (Scallan et al., 2011). Most cases in the United States have been attrib-
uted to produce (46%) while meat and poultry are the second most common
sources at 26% (Painter et al., 2013). To help manufactures and consumers
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 665

identify contaminated products, intelligent packaging with enhanced com-

municative functions that provide indication on food quality and safety of
the food can be useful for reducing the spread of foodborne illness, pro-
tecting brand name, and avoiding financial strain of lawsuits. As fresh or
processed meats approach their end of shelf life, they will deteriorate and
develop off odors, discoloration, and other physical and sensory cues that
result in product rejection by consumers. However, many packaged prod-
ucts are isolated from the environment and as a result, consumers must rely
on “best before” or “sell-by” dates to accept or reject the products. Unfortu-
nately, these printed dates are often determined conservatively by meat pro-
cessors based on a “worst-case” scenario and typical conditions encountered
by the product during storage and transportation. Thus, a deviation from
these assumed conditions, such as unexpected thermal abuses during prod-
uct distribution and postprocessing contamination, will overestimate the
shelf life, potentially resulting in product rejection, or worse still, foodborne
illness. To overcome these hurdles, an intelligent packaging approach has
been explored by researchers. By definition, intelligent packaging in food is
equipped with internal or external indicators that provide information about
the quality or history of the product, hence enhancing the communication
aspect of the product (Lim, 2014). Selected intelligent examples relevant to
the packaging of meats are presented below. Select intelligent and biosens-
ing packaging systems and their tested or potential application in meat prod-
ucts is summarized in Table 21.2.

TABLE 21.2
Summary of Intelligent and Biosensing Packaging Systems Cited with Tested or
Potential Application in Meat Systems
Packaging
Nanomaterials Material(s) Meat Products Effects Reference
Semiconductor Polyethylene Uncooked Detect O2 to Mills (2005)
nanocrystals bacon assure
package seal
integrity
Carbon-coated n/a Not tested RH detection Luechinger et al.
copper due to optical (2007)
nanoparticles shifting; 50 nm
change for 1%
change in RH
Nanocubic Sputter-coated Not tested RH detection Md Sin et al.
ZnO/SnO2 glass via lumines- (2013)
substrate cence change
in the
presence of
different RH
levels

(Continued)
666 Advanced Technologies for Meat Processing, Second Edition

TABLE 21.2 (Continued)

Summary of Intelligence and Biosensing Packaging Systems Cited with Tested or
Potential Application in Meat Systems
Packaging
Nanomaterials Material(s) Meat Products Effects Reference
TiO2 nanopar- PEO with Not tested Electrospun Mihindukula-
ticles glycerol, MB, indicator more suriya and Lim
and nano- sensitive to (2013)
TiO2 RH change
than solvent
cast nanocom-
posite
Nanofibrils of Deposition on Not tested Millisecond Che et al. (2008)
perylene-based glass response time
fluorophores substrate for vapor
sensing
Color change
from red to
blue
SnO2 nanopar- Sensor material TMA detection Good sensitiv- Zhang and
ticles + ZnO coated on in fish ity to TMA Zhang (2008)
microrod Al2O3 rods
composite placed inside
test jars
containing
fish
Fe3O4 nanopar- (n/a—Biosen- E.coli O157:H7 Detected as low Varshney et al.
ticles biocon- sor) in ground as 1.2 × 103 (2007)
gugated to beef cells of E. coli
streptavin in ground beef
Anti-Salmonella (n/a—Biosen- Salmonella on Bacteria bound Wang et al.
antibody gold sor) growth media to antibody- (2010)
nanoparticles coated
nanoparticles
exposed to
near-infrared
radiation,
photothermal
lysis observed
Silver-coated (n/a—Biosen- Tested on Rapid Sundaram et al.
PVA immobi- sor) chicken rinse identification (2013)
lized on mica water of Salmonella
sheets Typhimurium,
E. coli, and
L. innocua via
surface-
enhanced
Raman
scattering
MB, methylene blue; PEO, poly(ethylene oxide); PVA, polyvinyl alcohol; RH, relative humid-
ity; TMA, trimethylamine.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 667

21.2.4.1 Colorimetric Indicators

One of the potential applications of intelligent packaging is in meat products
packaged in MAP systems, which will benefit from continuous monitoring
of the headspace gas composition during distribution. Nanomaterial-based
indicators that provide visibly interpretable information have been devel-
oped by Mills and coworkers for relative humidity (RH) and oxygen detec-
tions. Humidity detection is of importance in meat packaging because
excess moisture in meat packaging can accelerate spoilage in dried meats
such as jerky and for this reason, desiccants are often included in packaging
to enhance quality and shelf life. The reversible RH indicator ink is based
on methylene blue (MB) and urea (Mills et al., 2010). In the work done by
Mills and coworkers, it was also found that when MB is encapsulated within
a polymer, such as hydroxyethyl cellulose with an excess of urea, the dye
appears white under ambient or dry conditions yet is rapidly and revers-
ibly rendered blue colored when exposed to RH values >85% (Mills et al.,
2010). The oxygen indicator involved a reaction between nanosized TiO2 or
SiO2 with a redox MB dye (Lawrie et al., 2013; Mills, 2005). To create the indi-
cator, TiO2 particles, with diameter ~5 nm, were prepared via hydrother-
mal treatment of titanium isopropoxide in the presence of tartaric acid. The
indicator ink was composed of a redox dye (MB), a colloidal semiconductor
photocatalyst (TiO2), and a sacrificial electron donor (tartaric acid). The ink
was inkjet-printed on a polyester film, resulting in a colorimetric oxygen-
indicating film with a thickness of ~63 nm. Upon exposure to three minutes
UVA light (4 mW/cm2), the indicator was photobleached to a white/light blue
color where MB was reduced to leucomethylene blue. The photobleached
film recovers its blue color in approximately 12 h under ambient conditions
(~21°C, ~60% RH, 21% O2), but remained bleached in the absence of oxygen.
The rate of recovery increased linearly with increasing O2 concentration, and
also RH and temperature dependent. The process of color loss and recovery
of the O2 indicator as part of a meat package can be seen in Figure 21.7.
CO2 is one of the gases commonly deployed in MAP. Typically, CO2 concen-
tration in MAP of meat products ranges from 20% to 100% for the purpose of
inhibiting the proliferation of microorganisms, especially the Gram-negative
bacteria such as Pseudomonads and psychrotrophs, but is less effective against
the lactic acid bacteria. To ensure the efficacy of the elevated CO2 MAP for
meat, it is desirable to continuously monitor the in-package CO2 level. Zhang
and Lim (2016) developed a printing methodology, based on bubble-jet print-
ing technology, for printing colorimetric CO2 indicators. In their studies, pH
dyes (M-cresol purple and/or phenol red), along with a phase transfer agent
(tetrabutylammonium hydroxide) were dissolved in ethylcellulose solution
using a 1:2 ethanol:1-butanol solvent. Different formulations of inks were
printed on paper or plastic substrates using a commercially available thermal
inkjet printer, resuling in colorimetric indicators that were sensitive to CO2
in the absence of moisture (Zhang and Lim, 2016). Mills and Skinner (2010)
668 Advanced Technologies for Meat Processing, Second Edition

(a) (b)

(d) (c)

FIGURE 21.7
Photographs of O2 indicators based on UV-activated TiO2 nanoparticles and methylene blue
dye, showing that one indicator was placed inside of a food package flushed with CO2 and one
placed outside. (a) Package freshly sealed and both indicators are blue. (b) Indicators immedi-
ately after photobleaching with UVA irradiation. (c) Indicator outside of the package returned
to blue color, whereas the indicator inside the oxygen-free atmosphere package remained
white. (d) Package was opened—influx of oxygen caused the indicator to change back to blue
color. This oxygen indicator could be used to easily and noninvasively detect the presence of
leaks in packaged products throughout distribution. (Reproduced from Mills (2005 with per-
mission of The Royal Society of Chemistry.)

investigated similar solvent- and water-based indicator inks sensitive to

CO2 that can be applied to ceramic, paper, and metal substrates using a felt-
tipped pen. These researchers applied the ink to a variety of different surfaces
including ceramics, paper, and aluminum foil. Additionally, they found the
solvent-based CO2 indicator to be more sensitive toward CO2 than its water-
based counterpart, but it had a short shelf life, while increasing the amount of
plasticizer in both water and solvent formulations helped to improve indicator
response and recovery time (Mills and Skinner, 2010).
Other works have shown RH can also be detected using carbon-coated cop-
per nanoparticles with silicon surfactant (Luechinger et al., 2007), or nanocubic
ZnO/SnO2 film-based detectors (Md Sin et al., 2013). Luechinger et al. (2007)
prepared porous metal films for humidity detection from copper nanopar-
ticles coated with 2–3 nm of carbon, followed by amphiphilic surfactant. The
unique preparation of the copper coating resulted in sensitivity to water or
its vapor with optical shifts in the visible light range of up to 50 nm for a 1%
change in RH. In a study by Md Sin et al. (2013), a humidity sensor was pre-
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 669

pared using nano ZnO/SnO2 prepared via sol–gel and immersion method and
deposited on sputtered ZnO-film-coated glass substrate. The emission bands
were apparent in the thin ZnO-film sensor at ultraviolet (UV) emission with
low intensity at 408 nm and in the broad visible region dominating the peak
emission around 600 nm. They also found that the sensitivity of the sensor
was dependent on the porosity of materials in the detector, which agreed with
the findings of Zhang and Zhang (2008), who used SnO2 nanoparticles supple-
mented with 5–15 wt% ZnO microrods to detect trimethylamine.
A UV-activated oxygen indicator has been prepared by dispersing TiO2
nanoparticles, glycerol, and MB in poly(ethylene oxide) solution using aque-
ous ethanol as a solvent (Mihindukulasuriya and Lim, 2013). The solution
was either electrospun or solvent cast, producing oxygen-sensitive fibrous
membrane and continuous cast film, respectively. SEM assessment of fibers
showed the diameter of the electrospun fibers varied from about 350–1000 nm.
The electrospun indicators were four to five times more sensitive to UV irra-
diation as compared to continuous film indicators prepared by casting. This
was mainly due to morphological differences between the two preparation
methods, and a much greater surface area on electrospun indicators for color-
changing reactions to take place. It was also discovered that increasing etha-
nol concentration of the electrospinning solvent enhanced the sensitivity of
the indicator to UV irradiation (Mihindukulasuriya and Lim, 2013).
The production of gaseous amines, due to the growth of spoilage bacteria,
is one of the hallmarks of meat deterioration. The growth of Pseudomonas on
meat results in the degradation of proteins, forming ammonia and other foul-
smelling amines. The detection of these alkaline volatiles can be made at the
parts per trillion level using fluorescence quenching of nanofibrils of perylene-
based fluorophores (Che et al., 2008). Upon deposition onto a substrate, via a
technique such as electrospinning, the resulting porous nonwoven made up
of entangled nanofibers allowed for maximal exposure to the gaseous analyte
molecules. This substrate permits rapid diffusion of the molecules through
the film coating and increased adsorption and accumulation of gas molecules
within a porous matrix. Compared to the sensors prepared by Luechinger
et al. (2007) and Md Sin et al. (2013), the sensor developed by Che et al. (2008)
was relatively simpler for chemical detection. At the ppm level, another study
detected volatile trimethylamine from fish during spoilage with composites
consisting of SiO2 nanoparticles and TiO2 microrods (Zhang and Zhang, 2008).
By doping SiO2 nanoparticles with 5–15 wt% ZnO microrods, the researchers
observed enhanced gas-sensing properties, as measured by the change in the
ratio of the resistance in air to that in a sample of the sensor.
In MAP packaged meats, the growth of facultative anaerobes such as
B. thermosphacta, Enterobacteriaceae, Lactobacillus, and other lactic acid bacteria is
undesirable, and their metabolic activity may alter the gas composition initially
flushed into the product headspace during packaging. Indicators and sensors
capable of detecting a change in headspace gas composition are worthy of inves-
tigation for real-time monitoring of freshness of meat. However, many of the
670 Advanced Technologies for Meat Processing, Second Edition

indicator/sensor innovations mentioned above have yet to be applied in com-

mercial food systems. Further research is needed to elucidate if they are robust
enough for the detection of spoilage volatiles in meat packaging during actual
end-use conditions. Issues such as stability and accuracy of the indicator/sensor,
as well as the effects of temperature and RH effects, will need to be addressed.

21.2.4.2 Biosensors
Besides detecting gaseous compounds indicative of product freshness, other
strategies are based on detecting the presence of specific microorganisms
by using biosensors. These sensors take advantage of antibodies that bind
specifically to antigens present on the pathogens of interest. However, food
is a complex system consisting of many components that can interfere with
the antibody–antigen interaction. Therefore, the target microorganism’s anti-
gens will need to be somehow isolated from the food matrices and surround-
ing environment, in sufficient quantities, to ensure adequate signal-to-noise
ratios for optimal detection. To this end, various techniques have been used.
For example, immunomagnetic separation (IMS) has been used by research-
ers to increase the amount of the analyte. Here, nanomagnetic particles are
functionalized with selected antibodies, onto which the antigens from the
pathogens attached. A magnetic force is then applied to selectively sepa-
rate the target analyte from the food matrix before detection. On the basis
of this principle, Varshney and coworkers extended the IMS concept and
developed a method to detect E. coli O157:H7. They applied an interdigitated
array microelectrode-based impedance biosensor in combination with anti-
body-conjugated nanoparticles to detect the presence of the microorganism
(Varshney et al., 2005, 2007). Rather than measuring electrical signals, other
indicators rely on color changes as a means for detection. Rapid colorimet-
ric identification of Salmonella bacteria by using bioconjugated oval-shaped
gold nanoparticles has also been demonstrated (Wang et al., 2010). These
researchers were able to detect Salmonella Typhimurium with an excellent
detection limit (104 bacteria/mL). When bacteria bound to the conjugated gold
nanoparticles and these were exposed to near-infrared radiation, a reduction
in bacterial cell viability was observed due to photothermal lysis. Different
concentrations of bound Salmonella resulted in a unique color change,
ranging from black at 10 CFU/mL, to dark blue at 50 CFU/mL, light blue at
103 CFU/mL, and pink at 104 CFU/mL (Wang et al., 2010). Other studies have
demonstrated that silver-coated PVA immobilized on mica sheets can be used
as a biosensor in the rapid identification of S. enterica ser. Typimurium, E. coli,
Listeria innocua, and S. aureus, isolated from chicken rinse water (Sundaram
et al., 2013). These researchers used silver ion-encapsulated PVA deposited on
a mica sheet to use as substrate in surface-enhanced Raman scattering (SERS)
assessment. Cultures of S. Typhimurium, E. coli, S. aureus and L. innocua were
isolated from chicken rinse water and suspended in 10 mL of sterile deion-
ized water. Approximately 5 μL of the bacterial suspensions was placed on
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 671

the coated mica sheet detector and exposed to 785 nm HeNe laser excitation;
spectral data was recorded between 400 and 1800 cm-1 for 15 different spots
on the detector strip for each bacterial sample. While many of these direct
microbial detection methods are intended for rapid detection of microorgan-
isms in meat prior to packaging, attempts have been made to integrate them
into packaging technology with a few modifications. For instance, either of
the biosensors in Wang et al. (2010) or Sundaram et al. (2013) could be included
as a small strip underneath product packaged fresh in a Styrofoam tray or
MAP. To permit pathogen detection, workers at meat plants would have to be
equipped with the appropriate detection equipment to read packaging prior
to shipping and/or upon receiving. The major constraint for such an indicator
system is that the components used for the manufacturing of the indicator
must be nontoxic and approved for food contact applications. Also, antigen-
binding to food-grade nanoparticles should couple with a reaction that results
in color change to provide freshness indication that can be visually detected
by the consumer/manufacturer. The choice of color may need to be consid-
ered when designing the indicator, as certain consumers may be affected by
color blindness. Because the food industry, in general, is sensitive to the cost
of packaging materials, the deployment of a freshness indicator will need to
be justified on the basis of how the technology can help in enhancing product
safety and increasing brand name protection.

21.3 Nanostructured Edible Films and Coatings

The formation of edible films for processed meat products can be achieved
either by wet or dry processing. Wet processed films are produced from
polymers with good film-forming ability, such as long-chain polysaccha-
rides or proteins. Here, the polymers must be dissolved and dispersed in
a food-grade solvent (e.g., water, alcohol, or mixture of both) to form film-
forming solution. Other additives (e.g., plasticizers, antimicrobial agents,
colors, flavors, and fillers) are often added to enhance the functionalities of
the film. Adjustment of pH and/or heating the film-forming solutions may
be done to facilitate dispersion of polymer in the solvent to increase chain–
chain interactions essential for the formation of coherent film structure. The
film-forming solution is then casted or extruded to obtain free-standing
films. Alternatively, the film-forming solutions can also be applied directly
onto the surface of food to form coating via methods such as dipping, spray-
ing, and brushing followed by drying. On the other hand, dry processing of
an edible film does not involve solvent dispersion, but rather relies on the
thermoplastic characteristics of the polymer. Here, the polymer is compres-
sion molded or extruded above its glass transition or melting temperatures,
along with the additive components, to form a continuous film (Pommet
et al., 2005; Liu et al., 2006). Because of the elevated temperature involved, the
dry process may not be suitable for active components that are heat labile.
672 Advanced Technologies for Meat Processing, Second Edition

To produce a coherent protein film, globular proteins must be denatured by

disrupting the disulfide bonds, as well as hydrogen and hydrophobic bonding
interactions inherently present in native protein molecules, often through heat-
ing, the addition of denaturant, and adjusting the pH of the protein solution
away from the isoelectric point. The main purpose of the denaturation process
is to unfold the protein, allowing the intermolecular chain interaction to occur,
which is essential for forming a coherent and strong film. Edible protein films
are generally good gas and oxygen barriers at low RH. This gas barrier prop-
erty may be used to prevent oxidative rancidity and enzymatic browning, and
minimize flavor loss in processed meat products. Types of edible proteins that
are well established for coating on meat products are collagen, corn zein, wheat
gluten, and soy. Zein is a prolamine protein from corn that has been applied
as a nanomaterial for active packaging purposes (Moomand and Lim, 2014;
Fernandez et al., 2009). Enhancing the barrier of corn and whey protein films
by incorporating TiO2 or SiO2 has also been demonstrated (Kadam et al., 2014).
The drawback of protein films, such as those derived from wheat gluten and
soy, is that they are food allergens to some consumers. Polysaccharide-based
edible films do not have this limitation. Polysaccharides that have been widely
used for the formation of edible films include pullulan, xanthan, chitosan, starch,
and cellulose. Pullulan and xanthan are both derived from microorganisms,
while chitosan is a deacetylated derivative of chitin—an abundant polysaccha-
ride found in nature, second only to cellulose. Recent research has shown that
chitosan is nontoxic, biodegradable, antimicrobial, and has the ability to chelate
cations (Rinaudo, 2006; Srinivasa and Tharanathan, 2007; Aider, 2010). However,
poor mechanical and gas barrier properties and weak water resistance limit its
application, particularly in applications involving elevated moisture content or
RH (Wang et al., 2005; Xu et al., 2006). Therefore, the creation of composite edible
films of chitosan with a nanomaterial filler is desirable for preserving meat qual-
ity. The incorporation of nanoclay in the range of 1–5 wt% has led to improve-
ment of mechanical properties of chitosan (Lavorgna et al., 2010; Xu et al., 2006),
thermal stability (Wang et al., 2005), functional properties (Rhim et al., 2006),
and barrier properties (Casariego et al., 2009; Rhim et al., 2006). In another study,
potato starch-based nanocomposite films were prepared using microfibrillated
cellulose (Dufresne et al., 2000). The researchers reported that the addition of a
filler significantly reinforced the starch matrix, increasing tensile modulus by
adding up to 50 wt% fraction of potato starch nanocellulose in the finished film.
At a high RH, the reinforcing effect diminished due to plasticization effects of
the absorbed water. In addition, a higher modulus value was observed for a for-
mulation with less glycerol plasticizer (Dufresne et al., 2000). Similar findings
were reported by Moran et al. on nanocellulose reinforced potato starch (Moran
et al., 2013). Other modified cellulose polymers that have been used in the area of
food packaging include hydroxypropyl methyl cellulose, methyl cellulose, and
ethyl cellulose (Lua et al., 2007; Imran et al., 2010; Arnon et al., 2015).
Besides strengthening the physical properties of edible films, other combina-
tion of materials may be applied to provide antimicrobial effects for shelf life
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 673

extension of meats. One study evaluated the effects of alginate films dispersed
with MMT nanoclay and essential oil from marjoram herb on the shelf life of
trout fillets inoculated with L. monocytogenes. The nanoclay was pretreated by
dispersing 3 wt% in distilled water, followed by gradual addition of 1% w/v
alginate solution for four hours to form the film-forming solution. Marjoram
essential oil and Tween 80 (0.25 g/g of essential oil) were added, followed by
homogenization, degassing under vacuum, casting, and finally drying to form
composite films (Alboofetileh et al., 2016). Fish samples wrapped in the film
with 1% marjoram essential oil significantly delayed the growth of L. mono-
cytogenes during the 15-day storage at 4°C, with final counts of approximately
1.2 log CFU/g lower than those observed in the untreated control samples.
Total viable and psychrotrophic counts, as well as volatile nitrogen levels in
the trout slices during storage were lower as well (Alboofetileh et al., 2016).
Chitosan–nanocellulose nanocomposite films have been developed for direct
contact application on the surface of ground meat slabs (Dehnad et al., 2014).
The researchers observed a lower lactic acid bacterial population on ground
meat samples packaged with nanocomposite active packaging compared to
control samples which received a nylon film covering. The active packaging
treatments had lactic acid bacteria counts that were lower than control by 1.3
and 3.1 log cycles at 3°C and 25°C, respectively, after six days of storage. Con-
sidering that cellulose is a renewable feedstock and abundantly available as a
food processing byproduct, it is anticipated that composite films with nanocel-
lulose fillers would be a growing area of research potentially making signifi-
cant impact on food packaging in the future (Khan et al., 2012).
Food-grade coatings can be applied to packaging films that are in contact
with meat for various purposes, such as for the delivery of antimicrobial or
antioxidative agents, and therefore can be considered as an active packaging
system component. This approach is often applied in the delivery of bioactive
agent with relatively low volatility, where the mass transport of the compound
takes place via diffusion across the packaging–food interface. For instance,
a food contact approved active packaging with an inner coating of bioactive
agent (rosemary or oregano extract) enhanced the oxidative stability and shelf
life of lamb steaks compared to control samples stored under modified atmo-
sphere conditions (Camo et al., 2008). There are several natural antimicrobial
compounds such as essential oils and spice extracts which can be effectively
used in edible films or coatings against foodborne pathogens found in meat
such as E. coli, Campylobacter jejuni, Salmonella enterica, and L. monocytogenes
(Olasupo et al., 2003). Rosemary and oregano essential oils and silver and zinc
oxide nanoparticles incorporated into pullulan films prepared with xanthan
and locust bean gum were effective against pathogenic microorganisms,
such as S. aureus, L. monocytogenes, E. coli O157:H7, and S. Typhimurium, all
of which may be potential pathogens in various meat products (Morsy et al.,
2014). Future work should determine if nanoencapsulation of bioactive agents
and the incorporated nanomaterial might benefit the delivery efficiency of the
biocontrol agent. Optimization of the amount of edible material applied as a
674 Advanced Technologies for Meat Processing, Second Edition

coating in food through sensory evaluation is essential considering the fact

that the applied coating may impact the sensory attributes of the products. A
summary of select edible film systems cited herein can be seen in Table 21.3.
TABLE 21.3
Summary of Edible Packaging Systems Cited with Tested or Potential Application
in Meat Systems
Nanomaterials Bioacitve(s) Packaging Food Effects Reference
Added Material(s) Product(s)
Applica-
tion or
Other
Testing
MMT nanoclay Marjoram Alginate Trout fillet Enhanced shelf Alboofetileh
essential life et al. (2016)
oil Reduced growth
of L. monocyto-
genes in vitro
and in food
system
Halloysite Nisin Corn starch Fresh Inhibition of Meira et al.
nanoclay cheese L. monocyto- (2016)
genes on cheese
and in vitro
Halloysite Nisin Liposomes in Growth Reduced counts Boelter and
nanoclay casein and media of B. cereus, Brandelli
gelatin films C. perfringens, (2016)
and L.
monocytogenes
Liposomes
increased
surface
roughness of
films
Casein films were
thinner, slightly
yellow, and
more elastic than
gelatin films
CNT AIT Cellulose Cooked Reduction in Dias et al.
chicken Salmonella (2013)
breasts chloeraesuis
Reduction in
oxidation and
color changes
Zein prolamine Β-carotene Zein as encap- Tested for Stabilized Fernandez
nanofibers and fish oil sulating stability against UV–Vis et al. (2009)
nanomaterial outside of irradiation and and
food heat-induced Moomand
systems oxidation and Lim
(2014)
(Continued)
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 675

TABLE 21.3 (Continued)

Summary of Edible Packaging Systems Cited with Tested or Potential Application
in Meat Systems
Food
Product(s)
Applica-
tion or
Bioacitve(s) Packaging Other
Nanomaterials Added Material(s) Testing Effects Reference

Nanocellulose Not added Potato– Tested Increased tensile Dufresne

nanostarch material modulus et al. (2000)
nanocom- properties Reduced and
posite reinforcement at Moranet al.
elevated RH (2013)
Nanocellulose Chitosan Chitosan– Ground Inhibited Dehnad et al.
nanocellu- meat S. aureus, (2014)
lose S. enteritidis,
nanocom- and E. coli
posite Reduced
population of
lactic acid
bacteria in
anaerobic
packaging
environment
Silver and zinc Rosemary Pullulan films Growth Reduced counts Morsy et al.
oxide and blended with media and of E.coli (2014)
nanoparticles oregano xanthan and vacuum- O157:H7, L.
essential locust bean packaged monocytogenes,
oils gum raw turkey S. aureus, and S.
breast, raw Typhimurium.
beef (top Reduction
round), varied from 1–3
and RTE log CFU/g
turkey depending on
breast food/microor-
ganisms system
AIT, allyl isothiocyanate; CNT, carbon nanotube; MMT, montmorillonite; RH, relative humid-
ity; RTE, ready-to-eat.

21.4 Societal Implications

The success of nanotechnology-enabled packaging ultimately depends on
consumer acceptance of the product, which is affected by its costs, perfor-
mance, and perceived benefits and risks as compared with existing products
(Siegrist et al., 2008; Bieberstein et al., 2013). Considering many consumers
are unfamiliar with and/or skeptical of nanotechnology, strategic knowledge
676 Advanced Technologies for Meat Processing, Second Edition

transfer and translation will be beneficial to increase the level of understand-

ing on how nanomaterials can help in enhancing food safety and quality,
as well as communicating risks involved under typical end-use conditions.
Because nanomaterials tend to exhibit properties different from their bulk
counterparts, the onus is on the food manufacturers to ensure that their
products are safe. Enforcing safety regulations and guidelines established
by governmental regulatory agencies will strengthen consumer confidence
in nanotechnology-based packaging materials.

21.4.1 Potential Risks

The main concern with nanotechnology-based food packaging is unintended
migration of nanoparticles from the packaging matrix into the food during
storage, exposing consumers to these materials (Ramachandraiah et al., 2015;
Bumbudsanpharoke and Ko, 2015; Dimitrijevic et al., 2015). Unfortunately,
there is a lack of understanding regarding the safety of nanomaterials, as
the toxicity of some materials is unpredictable when scaled down to nano
dimension. Furthermore, differences in morphology, reactivity, hydropho-
bicity, and surface functionalization affect the toxicity of nanomaterials,
further complicating the characterization and making it difficult to fully
understand the mechanisms that make these materials hazardous. As such,
extensive research and testing need to be done by governing and health
agencies to fully understand these materials before they can be safely used.
This is a challenging task considering the rapid development of many new
nanomaterial-based products today.
Metal and metal oxide nanoparticles, which are used as antimicrobial
agents, have been shown to be cytotoxic in vitro as well as in animal stud-
ies (Prabhu and Poulose, 2012; Kang et al., 2015). The synthesis method and
surface functionalization also affect the toxicity of the nanoparticles (Kwok
et al., 2012). It should be noted that these studies are typically acute exposure
studies involving doses significantly higher than those observed in migra-
tion studies from packaging materials. When performing risk assessments
for nanocomposite packaging materials, the following parameters have to
be considered: realistic exposure doses from consumer products, the abil-
ity of these nanoparticles to be absorbed through the gastrointestinal track,
and whether or not the body is able to clear these materials in a reasonable
timeframe.
There have also been studies that examined the potential of nanoparticles
to diffuse from nanocomposites into food simulants. Schmidt et al. (2011)
examined the migration of synthesized Mg–Al layered double hydroxide
nanoparticles from PLA films into a food simulant of 95% ethanol. They
found that increased nanoparticle loading from 1.8% to 5.5% w/w resulted
in an increase in the migration of packaging components into the simulant,
but is still able to conform to the total migration limit of 10 mg/dm2 set
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 677

by the European Commission (EC) (Schmidt et al., 2011). Lin et al. (2014)
showed that the migration of these nanomaterials from the packaging to
the food simulant depends on the compatibility of the nanoparticles with
the packaging matrix. It was shown that TiO2 nanoparticles of around
30 nm in PE films diffuse slower compared to nanoparticles of around
100 nm due to the better incorporation of the smaller nanoparticles into the
PE matrix. Studies have shown that the initial loading, time, and tempera-
ture are important factors that affect the amount and rate of nanomaterial
migration from packaging films (Farhoodi et al., 2014; Lin et al., 2014; Ram-
achandraiah et al., 2015).
There are, however, limitations to migration studies. Many studies used
homogeneous solutions (e.g., 95% or 50% aqueous ethanol and 3% aqueous
acetic acid) to simulate food matrices, which are significantly more complex
in composition with multiphase components (Schmidt et al., 2011; Lin et al.,
2014; Farhoodi et al., 2014). These studies neither consider the potential for
these materials to be absorbed by the gastrointestinal track nor whether
they simply pass through unchanged. Furthermore, since the amounts of
nanoparticles that migrate are very low, sample preparation and analysis
methods have to be chosen carefully to ensure the measurements performed
are accurate (Bumbudsanpharoke and Ko, 2015).
The release of nanoparticles into the environment at the end of the life-
cycle of the nanocomposite packaging is another area of concern. AgNPs,
in particular, have gained much attention as their use in consumer prod-
ucts has spread over the recent years. AgNPs possess nonspecific toxic-
ity and could negatively affect bacterial and aquatic populations when
released into the environment (Oberdörster et al., 2005; Marambio-Jones
and Hoek, 2010; Prabhu and Poulose, 2012). As such, lifecycle analyses for
these nanocomposites are needed to ensure they do not have a negative
impact on the environment when these packaging materials are ultimately
disposed of.
A potential tool that permits evaluation of nanoclay toxicity is environ-
mental biomonitoring using bioassays or plant genetic models. For exam-
ple, the use of Allium cepa (onion) could be applied as a test organism for
analysis of compost samples containing nanoclay biocomposites. Allium cepa
has demonstrated a great potential for environmental monitoring of met-
als, pesticides, and other complex mixtures (Leme and Marin-Morales, 2009).
One study observed the manifestation of disease in the organs of Wistar
rats exposed for 90 days to an extract of PLA and MMT-derivative nano-
composite. Tissues were observed using optical microscopy and SEM, while
inflammation and oxidative stress biomarkers were determined as well. The
subchronic oral exposure over a 90-day period did not produce significant
adverse effects in any of the markers studied; however, it is recommended
more studies are performed in this area over a longer period to confirm toxi-
cological effects (Maisanaba et al., 2014). Yoshida et al. (2012) showed that
nanosilica particles with an external diameter of 70 nm induced cytotoxicity,
678 Advanced Technologies for Meat Processing, Second Edition

reactive oxygen species generation, and DNA damage in rat and human cell
lines during acute exposure. Adverse effects were reduced by surface modi-
fication with carbonyl and amine groups, and it is speculated that surface
modification changed cellular distribution of the nanomaterial, considering
it was previously observed that the unmodified and carbonyl-coated nano-
silica were taken up equally into cells.

21.4.2 Regulation
Currently, there is no universally accepted definition as to what a nanomate-
rial is. Typically, agencies and organizations around the world define a nano-
material as a material having at least one dimension that is less than 100 nm
(Amenta et al., 2015; Bumbudsanpharoke and Ko, 2015). However, this defi-
nition is inadequate as there may be materials with dimensions larger than
100 nm which exhibit behavior that is different than that of its bulk counter-
part (USFDA, 2014).
There has also been difficulty in setting regulations on the use of nanoma-
terials in food packaging due to lack of data. The toxicity of nanomaterials is
affected greatly by both intrinsic (e.g., size, morphology, charge, and function-
alization) and extrinsic (e.g., pH, temperature, agglomeration, and matrix in
which they are dispersed in) factors, and so there are numerous parameters
that need to be studied in order to fully understand the hazards associated
with using these materials. The long-term effects of being exposed to these
materials also need to be examined (Handy and Shaw, 2007). As a result, a
large number of studies are needed to fully understand these hazards, mak-
ing risk assessment and regulation with reasonable assumptions difficult at
this time. A balance that adequately protects consumers from harm without
discouraging the industry from further investing in and developing these
technologies is required when regulating these materials.
In the United States, jurisdiction on the use of nanocomposite food pack-
aging falls under the Food and Drug Administration (FDA) (Amenta et al.,
2015). The FDA does not have a formal definition for nanomaterials, but
rather only provides guidelines as to what may be considered as nanomate-
rials (USFDA, 2014). The FDA recommends preliminary safety assessments
of products that may contain nanomaterials on a case-by-case basis, but
does not have any specific regulations regarding the use of nanomaterials in
products (Chau et al., 2007; Amenta et al., 2015). In the European Union, any
chemical or material, including nanomaterials, have to be registered under
Regulation (EC) No 1907/2006, called registration, evaluation, authorization,
and restriction of chemicals (REACH), before it can be commercially used
(Amenta et al., 2015). This approval process ensures that the material haz-
ards are identified and risk management strategies are employed. Moreover,
the legislation tends to place the burden of proof of safety on the companies
that use these materials (European Council and Parliament, 2006). Specific
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 679

to food packaging, the EU also sets limits on amounts of migrants that are
allowed to transfer from the packaging material into the food (European
Commission, 2009).

21.4.3 Public Acceptance

The public perception of using nanomaterials in the food industry is compa-
rable to the consumer perception on genetically modified foods (Scheufele
and Lewenstein 2005; Chau et al., 2007). In general, many consumers
are reluctant to embrace these new technologies due to the potential for
unknown hazards associated with using them. Consumer confidence can be
improved by further research on the safety of these materials and informing
consumers of the benefits and risks associated with these products. As more
data regarding its safety become available and as consumers are more well
informed on this topic, they will see nanotechnology as one of the tools for
enhancing the quality and safety of food products, as well as for reducing
food waste.
Studies have shown that nanotechnology in food packaging is considered
to be more acceptable to consumers compared to incorporating nanotech-
nology into food products themselves (Siegrist et al., 2007, 2008; Bieberstein
et al., 2013). This is likely due to the lower perceived risk of incorporating
them into packaging, where they are not directly consumed by its users. As
such, the use of nanotechnology-enabled food packaging is likely the first
step in introducing this concept to the public for the public to gain consumer
confidence for the use of nanotechnology in the food industry.

21.5 Conclusion
Technologies based on exploiting nanomaterials discussed in the chapter
can be promising in advancing active and intelligent packaging for meat
products, in order to enhance the protective and communication functions
of a meat package. More research and development activities in these areas
are expected especially to integrate low-cost sensors/indicators fabricated
from printing sensors/indicators onto meat packaging structures. Edible
films and coatings incorporated with nanomaterials (e.g., nanocellulose)
and antimicrobials (e.g., chitosan, nisin, and essential oils) offer unique
opportunities to improve physical and antimicrobial properties of meat
packages. To achieve full potential in the marketplace, besides being cost-
effective, the new nanotechnology-based packaging materials must exhibit
benefits that outweigh the perceived risks of these new materials. Govern-
ing bodies should institute rules and regulations on the basis of sound
science.
680 Advanced Technologies for Meat Processing, Second Edition

References
Abdollahi, M., Rezaei, M. and Farzi, G. (2012). A novel active bionanocomposite film
incorporating rosemary essential oil and nanoclay into Chitosan. Journal of Food
Engineering, 111(2), 343–350.
Aider, M. (2010). Chitosan application for active bio-based films production and
potential in the food industry: Review. LWT—Food Science and Technology, 43(6),
837–842.
Alboofetileh, M., Rezaei, M., Hosseini, H. and Abdollahi, M. (2016). Efficacy of acti-
vated alginate-based nanocomposite films to control L. monocytogenes and spoil-
age flora in rainbow trout slice. Journal of Food Science and Technology, 53(1),
521–530.
Amenta, V., Aschberger, K., Arena, M. et al. (2015). Regulatory aspects of nanotech-
nology in the agri/feed/food sector in EU and non-EU countries. Regulatory
Toxicology and Pharmacology, 73(1), 463–476.
Arnon, H., Granit, R., Porat, R. and Poverenov, E. (2015). Development of polysac-
charides-based edible coatings for citrus fruits: A layer-by-layer approach. Food
Chemistry, 166, 465–472.
Barbosa-Pereira, L., Angulo, I., Lagarón, J. M., Paseiro-Losada, P. and Cruz, J. M.
(2014). Development of new active packaging films containing bioactive nano-
composites. Innovative Food Science and Emerging Technologies, 26, 310–318.
Barbut, S. (2015). The Science of Meat and Poultry Processing. Creative Commons
Open Source. Available at http://www.poultryandmeatprocessing.com/
Beatrice, C. A. G., Branciforti, M. C., Alves, R. M. V. and Bretas, R. E. S. (2010). Rheo-
logical, mechanical, optical, and transport properties of blown films of polyam-
ide 6/residual monomer/montmorillonite nanocomposites. Journal of Applied
Polymer Science, 116, 3581–3592.
Bieberstein, A., Roosen, J., Marette, S., Blanchemanche, S. and Vandermoere, F. (2013).
Consumer choices for nano-food and nano-packaging in France and Germany.
European Review of Agricultural Economics, 40(1), 73–94.
Black, E. P., Cascarino, J., Guan, D. et al. (2010). Coliphage as pressure surrogates for
enteric viruses in foods. Innovative Food Science and Emerging Technologies, 11(2),
239–244.
Boelter, J. F. and Brandelli, A. (2016). Innovative bionanocomposite films of edible
proteins containing liposome-encapsulated nisin and halloysite nanoclay. Col-
loids and Surfaces: Biointerfaces, 145, 740–747.
Bumbudsanpharoke, N. and Ko, S. (2015). Nano-food packaging: An overview of
market, migration research, and safety regulations. Journal of Food Science, 80(5),
R910–R923.
Busolo, M. A. and Lagaron, J. M. (2012). Oxygen scavenging polyolefin nanocom-
posite films containing an iron modified kaolinite of interest in active food
packaging applications. Innovative Food Science and Emerging Technologies, 16,
211–217.
Camo, J., Beltrán, J. A. and Roncalés, P. (2008). Extension of the display life of lamb
with an antioxidant active packaging. Meat Science, 80(4), 1086–1091.
Casariego, A., Souza, B. W. S., Cerqueira, M. A. et al. (2009). Chitosan/clay films’
properties as affected by biopolymer and clay micro/nanoparticles’ concentra-
tions. Food Hydrocolloids, 23(7), 1895–1902.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 681

Chau, C. F., Wu, S. H. and Yen, G. C. (2007). The development of regulations for food
nanotechnology. Trends in Food Science and Technology, 18(5), 269–280.
Che, Y., Yang, X., Loser, S. and Zang, L. (2008). Expedient vapor probing of organic
amines using fluorescent nanofibers fabricated from an N-type organic semi-
conductor. Nano Letters, 8(8), 2219–2223.
Chibeu, A., Agius, L., Gao, A., Sabour, P. M., Kropinski, A. M. and Balamurugan, S.
(2013). Efficacy of bacteriophage LISTEXTM P100 combined with chemical anti-
microbials in reducing L. Monocytogenes in cooked turkey and roast beef. Inter-
national Journal of Food Microbiology, 167(2), 208–214.
Dehnad, D., Mirzaei, H., Emam-Djomeh, Z., Jafari, S. M. and Dadashi, S. (2014). Ther-
mal and antimicrobial properties of chitosan-nanocellulose films for extending
shelf life of ground meat. Carbohydrate Polymers, 109, 148–154.
Dehnavi, A. S., Aroujalian, A., Raisi, A. et al. (2012). Preparation and characterization
of polyethylene/silver nanocomposite films with antibacterial activity. Journal
of Applied Polymer Science, 127(2), 1180–1190.
Dias, M. V., De Fátima, N., Soares, F. et al. (2013). Use of allyl isothiocyanate and
carbon nanotubes in an antimicrobial film to package shredded, cooked chicken
meat. Food Chemistry, 141(3), 3160–3166.
Dimitrijevic, M., Karabasil, N., Boskovic, M. et al. (2015). Safety aspects of nanotech-
nology applications in food packaging. Procedia Food Science, 5, 57–60.
Dini, C., Islan, G. A., De Urraza, P. J. and Castro, G. R. (2012). Novel biopolymer
matrices for microencapsulation of phages: Enhanced protection against acidity
and protease activity. Macromolecular Bioscience, 12(9), 1200–1208.
Dufresne, A., Dupeyre, D. and Vignon, M. (2000). Cellulose microfibrils from potato
tuber cells: Processing and characterization of starch–cellulose microfibril com-
posites. Journal of Applied Polymer Science, 76, 2080–2092.
Economou, T., Pournis, N., Ntzimani, A. and Savvaidis, I. N. (2009). Nisin-EDTA
treatments and modified atmosphere packaging to increase fresh chicken meat
shelf-life. Food Chemistry, 114(4), 1470–1476.
European Commission. (2009). Commission regulation (EC) No. 450/2009 of 29 May
2009 on active and intelligent materials and articles intended to come into con-
tact with food. Official Journal of European Union, L135.
European Council and Parliament. (2006). Regulation (EC) No 1907/2006 of the
European Parliament and of the council of 18 December 2006 concerning the
registration, evaluation, authorisation and restriction of chemicals (REACH),
establishing a European Chemicals Agency, amending directive 1999. Official
Journal of the European Union, L 396, 1.
Farhoodi, M., Mousavi, S. M., Sotudeh-Gharebagh, R., Emam-Djomeh, Z. and
Oromiehie, A. (2014). Migration of aluminum and silicon from PET/clay nano-
composite bottles into acidic food simulant. Packaging Technology and Science,
27(2), 161–168.
Fernandez, A., Torres-Giner, S. and Lagaron, J. M. (2009). Novel route to stabilization
of bioactive antioxidants by encapsulation in electrospun fibers of zein prola-
mine. Food Hydrocolloids, 23(5), 1427–1432.
Ferrocino, I., Greppi, A., Lastoria, A., Rantsiou, K. and Ercolini, D. (2016). Impact of
nisin-activated packaging on microbiota of beef burgers during storage. Applied
and Environmental Microbiology, 82(2), 1–13.
Flanagan, J. and Singh, H. (2006). Microemulsions: A potential delivery system for
bioactives in food. Critical Reviews in Food Science and Nutrition, 46(3), 221–237.
682 Advanced Technologies for Meat Processing, Second Edition

Fratianni, F., De Martino, L., Melone, A., De Feo, V., Coppola, R. and Nazzaro, F.
(2010). Preservation of chicken breast meat treated with thyme and balm essen-
tial oils. Journal of Food Science, 75(8), M528–M535.
Garcia, P., Martinez, B., Rodriguez, L. and Rodriguez, A. (2010b). Synergy between
the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized
milk. International Journal of Food Microbiology, 141(3), 151–155.
Garcia, P., Rodriguez, L., Rodriguez, A. and Martinez, B. (2010a). Food biopreserva-
tion: Promising strategies using bacteriocins, bacteriophages and endolysins.
Trends in Food Science and Technology, 21(8), 373–382.
Gill, A. O. and Gill, C. O. (2010). Packaging and the shelf life of fresh red and poultry
meats. In: Robertson, G. L. (ed.) Food Packaging and Shelf Life: A Practical Guide.
Boca Raton, FL: CRC Press, pp. 259–272.
Gupta, S. R. N. (2014). Advances in molecular nanotechnology from premodern to
modern era. International Journal of Materials Science and Engineering, 2(2), 99–106.
Handy, R. D. and Shaw, B. J. (2007). Toxic effects of nanoparticles and nanomateri-
als: Implications for public health, risk assessment and the public perception of
nanotechnology. Health, Risk and Society, 9(2), 125–144.
Imran, M., El-Fahmy, S., Revol-Junelles, A. and Desobry, S. (2010). Cellulose deriva-
tive based active coatings: Effects of nisin and plasticizer on physico-chemical
and antimicrobial properties of hydroxypropyl methylcellulose films. Carbohy-
drate Polymers, 81(2), 219–225.
Islam, M. S., Masoodi, R. and Rostami, H. (2013). The effect of nanoparticles percent-
age on mechanical behavior of silica-epoxy nanocomposites. Journal of Nanosci-
ence, 2013, 1–10.
Jayasena, D. D. and Jo, C. (2013). Essential oils as potential antimicrobial agents in
meat and meat products: A review. Trends in Food Science and Technology, 34(2),
96–108.
Kadam, D. M., Wang, C., Wang, S., Grewell, D., Lamsal, B. and Yu, C. (2014). Micro-
structure and antimicrobial functionality of nano-enhanced protein-based
biopolymers. Transactions of the American Society of Agricultural and Biological
Engineers, 57(4), 1141–1150.
Kang, T., Guan, R., Song, Y., Lyu, F., Ye, X. and Jiang, H. (2015). Cytotoxicity of zinc
oxide nanoparticles and silver nanoparticles in human epithelial colorectal ade-
nocarcinoma cells. LWT—Food Science and Technology, 60(2), 1143–1148.
Khan, A., Huq, T., Khan, R. A., Riedl, B. and Lacroix, M. (2012). Nanocellulose based
composites and bioactive agents for food packaging. Critical Reviews in Food sci-
ence and Nutrition, 54(2), 163–174
Kumar, J. K., Kremsdorf, R., Tabor, S. and Richardson, C. C. (2001). A mutation
in the gene-encoding bacteriophage T7 DNA polymerase that renders the
phage temperature-sensitive. Journal of Biological Chemistry, 276(49), 46151–
46159.
Kwok, K. W. H., Auffan, M., Badireddy, A. R. et al. (2012). Uptake of silver nanopar-
ticles and toxicity to early life stages of Japanese medaka (Oryzias latipes): Effect
of coating materials. Aquatic Toxicology, 120–121, 59–66.
Lavorgna, M., Piscitelli, F., Mangiacapra, P. and Buonocore, G. G. (2010). Study of the
combined effect of both clay and glycerol plasticizer on the properties of chito-
san films. Carbohydrate Polymers, 82(2), 291–298.
Lawrie, K., Mills, A. and Hazafy, D. (2013). Simple inkjet-printed, UV-activated
oxygen indicator. Sensors and Actuators B: Chemical, 176, 1154–1159.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 683

Leme, D. M. and Marin-Morales, M. A. (2009). Allium cepa test in environmental

monitoring: A review on its application. Mutation Research: Reviews in Mutation
Research, 682(1), 71–81.
Liu L., Kerry J.P. and Kerry, J.F. (2006). Effect of food ingredients and selected lipids
on the physical properties of extruded edible films/casings. International Jour-
nal of Food Science and Technology, 41, 295–302.
Lim, L.-T. (2014). Application of nano- and microencapsulated materials to food
packaging. In: Kwak, H.-S. (ed.) Nano- and Microencapsulation for Foods. Oxford:
Wiley, pp. 301–323.
Lin, Q.-B., Li, H., Zhong, H.-N., Zhao, Q., Xiao, D.-H. and Wang, Z.-W. (2014). Migra-
tion of Ti from nano-TiO2-polyethylene composite packaging into food simu-
lants. Food Additives and Contaminants: Part A, 0049(June 2015), 1–7.
Lua, Y. Y., Cao, X., Rohrs, B. R. and Aldrich, D. S. (2007). Surface characterizations of
spin-coated films of ethylcellulose and hydroxypropyl methylcellulose blends.
Langmuir, 23(8), 4286–4292.
Luechinger, N., Loher, S., Athanassiou, E. K., Grass, R. N. and Stark, W. J. (2007).
Highly sensitive optical detection of humidity on polymer/metal nanoparticle
hybrid films. Langmuir, 23(6), 3473–3477.
Lvov, Y. M., Shchukin, D. G. and Price, R. R. (2015). Halloysite clay nanotubes for
controlled release of protective agents. ACS Nano, 2(5), 814–820.
Ma, Y., Pacan, J. C., Wang, Q., Xu, Y., Huang, X., Korenevsky, A. and Sabour, P. M.
(2008). Microencapsulation of bacteriophage Felix O1 into chitosan- alginate
microspheres for oral delivery. Applied and Environmental Microbiology, 74(15),
4799–4805.
Mahony, J., McAuliffe, O., Ross, R. P. and van Sinderen, D. (2011). Bacteriophages
as biocontrol agents of food pathogens. Current Opinion in Biotechnology, 22(2),
157–163.
Maisanaba, S., Gutiérrez-Praena, D., Puerto, M. et al. (2014). In vivo toxicity evalu-
ation of the migration extract of an organomodified clay-poly(lactic) acid
nanocomposite. Journal of Toxicology and Environmental Health. Part A, 77(13),
731–746.
Maneewattanapinyo, P., Banlunara, W., Thammacharoen, C., Ekgasit, S. and Kaewa-
matawong, T. (2011). An evaluation of acute toxicity of colloidal silver nanopar-
ticles. Journal of Veterinary Medical Science/Japanese Society of Veterinary Science,
73(11), 1417–1423.
Marambio-Jones, C. and Hoek, E. M. V. (2010). A review of the antibacterial effects of
silver nanomaterials and potential implications for human health and the envi-
ronment. Journal of Nanoparticle Research, 12(5), 1531–1551.
Marvig, C. L., Aideh, B., Neve, H., Heller, K. J., Knøchel, S. and Vogensen, F. K. (2011).
Heat tolerance of dairy lactococcal c2 phages. International Dairy Journal, 21(8),
556–560.
Md Sin, N. D., Mamat, M. H., Malek, M. F. and Rusop, M. (2013). Fabrication of
nanocubic ZnO/SnO2 film-based humidity sensor with high sensitivity by
ultrasonic-assisted solution growth method at different Zn:Sn precursor ratios.
Applied Nanoscience, 4(7), 829–838.
Meira, S. M. M., Zehetmeyer, G., Scheibel, J. M., Werner, J. O. and Brandelli, A. (2016).
Starch-halloysite nanocomposites containing nisin: Characterization and inhibi-
tion of Listeria monocytogenes in soft cheese. LWT—Food Science and Technology,
68, 226–234.
684 Advanced Technologies for Meat Processing, Second Edition

Mihindukulasuriya, S. D. F. and Lim, L.-T. (2013). Oxygen detection using UV-

activated electrospun poly(ethylene oxide) fibers encapsulated with TiO2
nanoparticles. Journal of Materials Science, 48(16), 5489–5498.
Mills, A. (2005). Oxygen indicators in food packaging. Chemical Society Reviews, 32(12),
1003–1011.
Mills, A., Grosshans, P. and Hazafy, D. (2010). A novel reversible relative-humidity
indicator ink based on methylene blue and urea. Analyst, 135(1), 33–35.
Mills, A. and Skinner, G. a. (2010). Water-based colourimetric optical indicators for
the detection of carbon dioxide. The Analyst, 135, 1912–1917.
Mohammad, F. and Abolghasemi, M. R. (2011). Oxygen barrier and mechanical prop-
erties of masterbatch-based PA6/nanoclay composite films. Journal of Applied
Polymer Science, 125, E2–E8.
Moomand, K. and Lim, L.-T. (2014). Oxidative stability of encapsulated fish oil in
electrospun zein fibres. Food Research International, 62, 523–532, Elsevier.
Moran, J. I., Vazquez, A. and Cyras, V. P. (2013). Bio-nanocomposites based on deriva-
tized potato starch and cellulose, preparation and characterization. Journal of
Materials Science, 48(20), 7196–7203.
Morsy, M. K., Khalaf, H. H., Sharoba, A. M., El-Tanahi, H. H. and Cutter, C. N. (2014).
Incorporation of essential oils and nanoparticles in pullulan films to control
foodborne pathogens on meat and poultry products. Journal of Food Science,
79(4), M675–M684.
Munteanu, B. S., Aytac, Z., Pricope, G. M., Uyar, T. and Vasile, C. (2014). Polylac-
tic acid (PLA)/Silver-NP/VitaminE bionanocomposite electrospun nanofibers
with antibacterial and antioxidant activity. Journal of Nanoparticle Research,
16(10), 1–12.
Naas, H., Martinez-Dawson, R., Han, I. and Dawson, P. (2013). Effect of combining
nisin with modified atmosphere packaging on inhibition of L. monocytogenes in
ready-to-eat turkey bologna. Poultry Science, 92(7), 1930–1935.
Oberdörster, G., Oberdörster, E. and Oberdörster, J. (2005). Nanotoxicology: An
emerging discipline evolving from studies of ultrafine particles. Environmental
Health Perspectives, 113(7), 823–839.
Ojijo, V., Cele, H. and Sinha Ray, S. (2011). Morphology and properties of polymer
composites based on biodegradable polylactide/poly[(butylene succinate)-
co-adipate] blend and nanoclay. Macromolecular Materials and Engineering,
296(9), 865–877.
Ojijo, V. and Sinha Ray, S. (2013). Processing strategies in bionanocomposites. Progress
in Polymer Science, 38(10–11), 1543–1589.
Olasupo, N. A., Fitzgerald, D. J., Gasson, M. J. and Narbad, A. (2003). Activity of
natural antimicrobial compounds against Escherichia coli and Salmonella enterica
serovar Typhimurium. Letters in Applied Microbiology, 37(6), 448–451.
Oliveira, M., Vinas, I., Colas, P., Anguera, M., Usall, J. and Abadias, M. (2014). Effec-
tiveness of a bacteriophage in reducing Listeria monocytogenes on fresh-cut
fruits and fruit juices. Food Microbiology, 38, 137–142.
Painter, J. A., Hoekstra, R. M., Ayers, T. et al. (2013). Attribution of foodborne ill-
nesses, hospitalizations, and deaths to food commodities by using outbreak
data, United States, 1998–2008. Emerging Infectious Diseases, 19(3), 407–415.
Panea, B., Ripoll, G., González, J., Fernández-Cuello, Á. and Albertí, P. (2014). Effect of
nanocomposite packaging containing different proportions of ZnO and Ag on
chicken breast meat quality. Journal of Food Engineering, 123, 104–112.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 685

Picouet, P., Fernandez, A., Realini, C. E. and Lloret, E. (2014). Influence of PA6 nano-
composite films on the stability of vacuum-aged beef loins during storage in
modified atmospheres. Meat Science, 96(1), 574–580.
Pommet, M., Redl, A., Guilbert, S. and Morel, M. (2005) Intrinsic influence of various
plasticizers on functional properties and reactivity of wheat gluten thermoplas-
tic materials. Journal of Cereal Science, 42, 81–91.
Potara, M., Jakab, E., Damert, A., Popescu, O., Canpean, V. and Astilean, S. (2011).
Synergistic antibacterial activity of chitosan silver nanocomposites on S. aureus.
Nanotechnology, 22(13), 135101–135110.
Prabhu, S. and Poulose, E. K. (2012). Silver nanoparticles: Mechanism of antimicrobial
action, synthesis, medical applications, and toxicity effects. International Nano
Letters, 2(1), 32.
Pradhan, N., Singh, S., Ojha, N. et al. (2015). Facets of nanotechnology as seen in food
processing, packaging, and preservation industry. BioMed Research International,
2015, 1–17.
Puapermpoonsiri, U., Ford, S. J. and van der Walle, C. F. (2010). Stabilization of bac-
teriophage during freeze drying. International Journal of Pharmaceutics, 389(1–2),
168–175, Elsevier.
Pukanski, B. and Fekete, E. (1999). Adhesion and surface modification. Advances in
Polymer Science, 139, 109–153.
Ramachandraiah, K., Gu Han, S. and Bok Chin, K. (2015). Nanotechnology in meat
processing and packaging: Potential applications—A review. Asian-Australasian
Journal of Animal Sciences, 28(2), 290–302.
Rhim, J. W., Hong, S. I., Park, H. M. and Ng, P. K. W. (2006). Preparation and char-
acterization of chitosan-based nanocomposite films with antimicrobial activity.
Journal of Agricultural and Food Chemistry, 54(16), 5814–5822.
Rinaudo, M. (2006). Chitin and chitosan: Properties and applications. Progress in Poly-
mer Science, 31, 603–632.
Robertson, G. L. (2013). Food Packaging: Principles and Practices (3rd Ed.). Boca Raton
FL: CRC Press, Taylor and Francis, 703p.
Rossi, L., Aleida, R. C. C., Lopes, L. S., Figueiredo, A. C. L., Ramos, M. P. P. and
Almeida, P. F. (2011). Occurrence of Listeria spp. in Brazilian fresh sausage and
control of L. monocytogenes using bacteriophage P100. Food Control, 22(6), 954–
958.
Sanchez-Garcia, M. D., Ocio, M. J., Gimenez, E. and Lagaron, J. M. (2008). Novel
polycaprolactone nanocomposites containing Thymol of interest in antimicro-
bial film and coating applications. Journal of Plastic Film and Sheeting, 24(3–4),
239–251.
Scallan, E., Hoekstra, R. M., Angulo, F. J. et al. (2011). Foodborne illness acquired in
the United States-major pathogens. Emerging Infectious Diseases, 17(1), 7–15.
Scheufele, D. A. and Lewenstein, B. V. (2005). The public and nanotechnology: How
citizens make sense of emerging technologies. Journal of Nanoparticle Research,
7(6), 659–667.
Schmidt, B., Katiyar, V., Plackett, D. et al. (2011). Migration of nanosized layered dou-
ble hydroxide platelets from polylactide nanocomposite films. Food Additives
and Contaminants: Part A, 28(7), 956–966.
Sengwa, R. J. and Choudhary, S. (2012). Dielectric properties and structural dynamics
of melt compounded hot-pressed poly(ethylene oxide)-organophilic montmo-
rillonite clay nanocomposite films. Bulletin of Materials Science, 35(1), 19–25.
686 Advanced Technologies for Meat Processing, Second Edition

Siegrist, M., Cousin, M. E., Kastenholz, H. and Wiek, A. (2007). Public acceptance of
nanotechnology foods and food packaging: The influence of affect and trust.
Appetite, 49(2), 459–466.
Siegrist, M., Stampfli, N., Kastenholz, H. and Keller, C. (2008). Perceived risks and
perceived benefits of different nanotechnology foods and nanotechnology food
packaging. Appetite, 51(2), 283–290.
Singala, K. J., Mungray, A. A. and Mungray, A. K. (2012). Degradation behavior of
polypropylene—Organically modified clay nanocomposites. Industrial and
Engineering Chemistry Research, 51, 10557–10564.
Singla, S., Harjai, K., Raza, K., Wadhwa, S., Katare, O.P. and Chhibber, S. (2016). Phos-
pholipid vesicles encapsulated bacteriophage: A novel approach to enhance
phage biodistribution. Journal of Virological Methods, 236, 68–76.
Soni, K. A., and Nannapaneni, R. (2010). Bacteriophage significantly reduces Listeria
monocytogenes on raw salmon fillet tissue. Journal of Food Protection, 73(1), 32–38.
Srinivasa, P. C. and Tharanathan, R. N. (2007). Chitin/chitosan—Safe, ecofriendly pack-
aging materials with multiple potential uses. Food Reviews International, 23(1), 53–72.
Sundaram, J., Park, B., Kwon, Y. and Lawrence, K. C. (2013). Surface enhanced
Raman scattering (SERS) with biopolymer encapsulated silver nanosubstrates
for rapid detection of foodborne pathogens. International Journal of Food Micro-
biology, 167(1), 67–73.
Tang, Z., Huang, X., Baxi, S., Chambers, J. R., Sabour, P. M. and Wang, Q. (2013). Whey
protein improves survival and release characteristics of bacteriophage felix O1
encapsulated in alginate microspheres. Food Research International, 52(2), 460–466.
Tornuk, F., Hancer, M., Sagdic, O. and Yetim, H. (2015). LLDPE based food packaging
incorporated with nanoclays grafted with bioactive compounds to extend shelf
life of some meat products. LWT—Food Science and Technology, 64(2), 540–546.
Travan, A., Pelillo, C., Donati, I. et al. (2009). Non-cytotoxic silver nanoparticle-
polysaccharide nanocomposites with antimicrobial activity. Biomacromolecules,
10(6), 1429–1435. USFDA. 2007. Agency Response Letter GRAS Notice No.
GRN 000198.
USFDA. (2014). Guidance for Industry—Considering whether an FDA-Regulated Product
Involves the Application of Nanotechnology. Silver Springs, MD: US FDA.
Varshney, M., Yang, L., Su, X.-L. and Li, Y. (2005). Magnetic nanoparticle-antibody
conjugates for the separation of Escherichia coli O157:H7 in ground beef. Jour-
nal of Food Protection, 68(9), 1804–1811.
Varshney, M., Li, Y., Srinivasan, B. and Tung, S. (2007). A label-free, microfluidics and
interdigitated array microelectrode-based impedance biosensor in combination
with nanoparticles immunoseparation for detection of Escherichia coli O157:H7
in food samples. Sensors and Actuators, B: Chemical, 128(1), 99–107.
Vivekanandhan, S., Christensen, L., Misra, M. and Amar, K. M. (2012). Green pro-
cess for impregnation of silver nanoparticles into microcrystalline cellulose and
their antimicrobial bionanocomposite films. Journal of Biomaterials and Nanobio-
technology, 3(3), 371–376.
Vonasek, E., Le, P. and Nitin, N. (2014). Encapsulation of bacteriophages in whey
protein films for extended storage and release. Food Hydrocolloids, 37, 7–13.
Wang, S. F., Shen, L., Tong, Y. J. et al. (2005). Biopolymer chitosan/montmorillon-
ite nanocomposites: Preparation and characterization. Polymer Degradation and
Stability, 90(1), 123–131.
Nanotechnology-Based Packaging Materials for Fresh and Processed Meats 687

Wang, S., Singh, A. K., Senapati, D., Neely, A., Yu, H. and Ray, P. C. (2010). Rapid colo-
rimetric identification and targeted photothermal lysis of Salmonella bacteria by
using bioconjugated oval-shaped gold nanoparticles. Chemistry—A European
Journal, 16(19), 5600–5606.
Xu, Y., Ren, X. and Hanna, M. A. (2006). Chitosan/clay nanocomposite film prepara-
tion and characterization. Journal of Applied Polymer Science, 99(4), 1684–1691.
Zhang, W. H. and De Zhang, W. (2008). Fabrication of SnO2-ZnO nanocomposite sen-
sor for selective sensing of trimethylamine and the freshness of fishes. Sensors
and Actuators, B: Chemical, 134(2), 403–408.
Yoshida, T., Yoshioka, Y., Matsuyama, K., Nakazato, Y., Tochigi, S., Hirai, T., et al.
(2012). Surface modification of amorphous nanosilica particles suppresses
nanosilica-induced cytotoxicity, ROS generation, and DNA damage in various
mammalian cells. Biochemical and Biophysical Research Communications, 427(4),
748–752.
Zhang, Y. and Lim, L.-T. (2016). Inkjet-printed CO2 colorimetric indicators. Talanta,
161, 105–113.
Index

A agents, addition of, 216

ions, 658–660
ACE inhibitory peptides, see
peptides, 382, 384
Angiotensin I-converting
properties, 526–528
enzyme inhibitory peptides
proteins, 663–664
Acetate, glucose vs., 364–366
Antimicrobial active packaging
Acetic acid, 364
antimicrobial ions, 658–660
Acousto-optic tunable filter (AOTF), antimicrobial proteins and peptides,
29–30 663–664
Acrylamide, 387 bacteriophage, 661–663
Active packaging (AP) systems, 618, 654 halloysite, 655
antimicrobial, see Antimicrobial liposomes, 656
active packaging polyphenols, 655
bacteriocins in, 577–579 summary of, 657
components, 638–640 thymol, 654
Additives, 216, 238 Antioxidants
Aging of meats, 373 addition of, 217
AgNP, see Silver nanoparticle properties, 523–525
β-Agonists, 174 and vitamins, 413–414, 424–427
Agricultural Research Service (ARS), 49 Antioxidative peptides, 378–379
Agrobacterium tumefaciens, 4 Anti-Stokes Raman scattering, 84
Alanyl aminopeptidase, 449 Antithrombotic peptides, 381–382
Aliphatic hydrocarbons, 323 AOTF, see Acousto-optic tunable filter
Allergens, 419–420 AP, see Active packaging
Allium cepa, 677 Aqueous smoke condensates, see Liquid
Amino acid(s), 422–423 smoke flavorings
catabolism, 604–605 Area scanning mode, 31
Amortization cost, 289 Area under the curve (AUC), 44
Analysis of spectral differences (ASD), 44 ARS, see Agricultural Research Service
Analysis of variance (ANOVA) test, 68 Artificial neural networks (ANN), 42
Angiotensin I-converting enzyme Aryl hydrocarbon hydroxylases, 325
(ACE) inhibitory peptides, 373, Ascorbic acid, 426
375–378 ASD, see Analysis of spectral differences
Animal by-products, 383 Asini Corii Collas, 388
Animal production strategies, see Raw Aspergillus, 377
meat, animal production AUC, see Area under the curve
strategies for Autoxidation, meat, 630
ANN, see Artificial neural networks
ANOVA test, see Analysis of variance
B
test
Antihypertensive peptides, 375–378 Bacillus cereus, 637
Antimicrobial(s), 238 BacJ1, 565
activity, 549 “Background toughness,” 268

689
690 Index

Backward interval partial least squares Benchtop Raman devices, 86

(biPLS), 44 Benzo[a] pyrene (BaP) content
Bacteria foodborne infection, qPCR in charcoal-grilled frankfurters, 324
detection diffusion coefficients for, 347
Campylobacter, 127 methanolic solution, 340
Listeria monocytogenes, 122–124 Biacore® Q biosensor, 176
Salmonella detection, 119–122 Bifidobacterium, 383
verotoxin-producing E. coli, 124–126 BIL format, see Band-interleaved-by-line
Yersinia, 127–129 format
Bacteria foodborne intoxications, qPCR Bioactive peptides, 372, 374, 389, 422
detection ACE inhibitory peptide, 375–378
Clostridium botulinum, 131–132 antimicrobial peptides, 382
Staphylococcus aureus, 129–131 antioxidative peptides, 378–379
Bacterial rapid detection using optical antithrombotic peptides, 381–382
scattering technology from by-products, 383–384
(BARDOT), 166 hypocholesterolemic peptides, 381
Bacterial starter cultures, 598–599 immunomodulatory peptides,
color, 601–602 380–381
flavor formation, 602–606 opioid peptides, 379–380
probiotic, 606–608 Bioinformatics, 390
with protective, 599–600
Biological sensors, 154
texture, 601
BIOPEP database, 390
Bacteriocins, 238
Biopreservation, 563
appearance of resistant strains,
Biosensors, 670–671
582–585
optical fiber-based, 159
application of, 563
recognition elements in, 155
industrial application and regulatory
BIP format, see Band-interleaved-by-
aspects, 584
pixel format
interaction with meat components,
579–581 biPLS, see Backward interval partial
microbial flora, 559 least squares
preservation technologies, 575, 576 “Black-smoked,” 322
Bacteriophage, 661–663 Blending, 519
Band-interleaved-by-line (BIL) format, 24 Blood, by-product of meat industry, 383
Band-interleaved-by-pixel (BIP) format, Bone detection, in chicken, 52–55
24 Bone marrow, in meat, 628
Band sequential (BSQ) format, 25 Botulinum neurotoxin (BoNT), 131
BARDOT, see Bacterial rapid detection Bovine spongiform encephalopathy
using optical scattering (BSE), 1
technology Bran, 477
Barrier film materials, 633–634 Branched-chain amino acids, 605
Batch-pilot equipment, 265 Breaded meat products, 495
BAX® system real-time polymerase Breading system, 495
chain reaction assay, 1247 Brine curing, 517–518
Bayesian classification, 36 Brine injection, 273
“Bay region” dihydrodiol epoxides, 325 Brining, 302–303
Beef, 98–100 Broadband illumination sources, 27
high-oxygen packaging of, 628 BSQ format, see Band sequential format
peptide in, 373, 385 Butyric acid, 363
Index 691

C HDP treatment of, 272

meat, 664
Calcium-activated factor, 537
Cholesterol, 417–418
Calcium-activated neutral proteinases,
Chopping, 519
537
Cigarette smoking, 325
Calcium-dependent proteases, 537
Ciprofloxacin, 173
Callipyge lamb meat, 272
CLAs, see Conjugated linoleic acids
Calpains, 374, 537
Clavicle, 54
Campylobacter, 127
CLB, see Clenbuterol (CLB)
C.jejuni, 140–141, 562, 636
Clenbuterol (CLB), 175
CAP, see Controlled atmosphere
Clostridium botulinum, 131–132, 561, 571,
packaging
Capillary electrophoresis (CE), 277 636
Carbohydrate Clostridium perfringens, 562, 637
based extenders/proteins, 492 clpP, 139
catabolism, 603 CLSM, see Confocal laser scanning
Carbon dioxide, 618, 621–623 microscopy
Carbon monoxide, 620, 625–626 Clupea harengus, 340
Carboxypeptidases, 538 Clustered regularly interspaced short
Carcinogens, 419 palindromic repeat (CRISPR)
L-Carnitine, 422 technology, 5
Carotenoids, 426 CMOS cameras, see Complementary
Carrageenan gum, 471 metal oxide semiconductor
Casecidin, 382 cameras
Casein-derived peptides, 380 Cold plasma technology (CPT), 304–308
Casomorphins, 379 Collagen, 384, 387, 388
Catacondensed PAHs, 320 Color
Cathepsin, 276 attributes, fat, 468
Cavitation, 282 changes, in cooked meat, 212–213
CCD, see Charge-coupled device of meat, 601–602, 649
CCMP, see Cooked cured meat pigment Colorimetric indicators, 667–670
CCR, see Correct classification rate Complementary DNA (cDNA), 358
cDNA, see Complementary DNA Complementary metal oxide
Cell-free culture supernatants (CFS), 565 semiconductor (CMOS)
Cellulose-peelable casing, 340 cameras, 26, 30
Charcoal grilling, 324 “Compton effect,” 202
Charge-coupled device (CCD), 19, 85, “Compton electron,” 202
166 Computer vision, 19
Chemical contamination Conducting organic polymers (CPs), 169
electromechanical sensors, 177–182 Confocal laser scanning microscopy
optical sensors, 176–177 (CLSM), 278, 279
veterinary drug residues, 171–175 Conjugated linoleic acids (CLAs), 361
Chemical sensors, recognition elements Controlled atmosphere packaging
in, 155 (CAP), 618
Chemometric principal component Cooked cured meat pigment (CCMP), 519
analysis (CPCA), 67 Cooked meat
Chemometric techniques, 39 color changes in, 212–213
Chicken emulsions, fat in, 467
brine injection, 273 products, 567–571, 629–630
692 Index

vacuum vs. MAP packaging, Dry-fermented sausages, 451

631–632 Durethan®, 654
Correct classification rate (CCR), 43
Cost analysis of HDP technology, 286
E
equipment, 287–289
packaging, 286 Edible coatings, 671–674
quantifying meat benefits, 289 Edible films, nanostructured, 671–674
CPCA, see Chemometric principal Eicosapentaenoic acid (EPA), 464, 465
component analysis EIS, see Electrochemical impedance
CPs, see Conducting organic polymers spectroscopy
CPT, see Cold plasma technology Electric nose, 57
Cq, see Quantification cycle Electrochemical biosensors, 167
Crossline-markers, 52 Electrochemical impedance
Cross-validation, 43 spectroscopy (EIS), 168
Ct, see Threshold cycle Electrochemical sensors, 167–168
Cured-and-cooked meat products, Electromagnetic waves, 21
567–571, 629–630 Electromechanical sensors, 167–168,
vacuum vs. MAP packaging, 631–632 177–182
Electron beam, 203
Electronic nose-based sensors, 169–170
D
Emerging technologies
Decontamination of meat, 300–301 cold plasma technology, 304–308
Denaturation process, 672 light-based technologies, 308–310
Designing meat products, 516 pulsed electric field, 303–304
DHA, see Docosahexaenoic acid ultrasound, see Ultrasound
Dibenzo[a,h]pyrene (DBa,hP), 325 technology
Dietary fiber, 423, 424 EMSC, see Extended multiplicative
Dietary salt intake, 444 signal correction
Differential gene expression, 358 Emulsified lipid gel, 488
Digestible oligosaccharides (DOs), 478 Emulsified meat products, 465, 466,
Dipeptidylpeptidases (DPP), 536, 537 492–493
DNA bases detection strategies, 7, 10 heat treatment, 468
polymerase chain reaction-based Emulsion gels, 491
methods, 10–11 Endolysins, see Lysins
sequencing, 11–13 Endopeptidases, 373, 537, 540–541
DNA isolation, 114 Enterobacteriaceae family, 572
Docosahexaenoic acid (DHA), 464, 465 Enterococci, use of, 574
Dos, see Digestible oligosaccharides Enterococcus strains, 574
DPP, see Dipeptidylpeptidases Enterotoxigenic strains, 561
Drip loss, 71 Enzymatic amplification, of DNA, 8
Dry-cured ham, 450, 451 Enzyme-linked immunosorbent assay
data analysis, 550–552 (ELISA), 9
peptidomics, applications of, 545–550 EPA, see Eicosapentaenoic acid
protein mass fingerprint approach, Ergosterol, 324
544 Escherichia coli, 561
from traditional proteomics to E.coli O157:H7, 284, 285, 635–636, 656
peptidomics, 545 Esters, 606
Dry-cured meats, proteolysis in, 542 Ethylene vinyl acetate (EVA), 634, 655
Dry curing method, 516–517 Ethylene vinyl alcohol, 633–634
Index 693

European Food Safety Agency (EFSA), 3 in ruminants, 412

European Union, 678 synthesis
Exopeptidases, 537–538, 541–543 conjugated linoleic acids as
Explosives, in food industry, 263 regulators, 361–364
Extended multiplicative signal de novo, 365
correction (EMSC), 39 primary precursor for, 364
Exterior film materials, 633 Feed forward neural network, 42
Fermentation
F of by-product, 384
of meats, 374
“Farmhouse smoked,” 322 Fermented foods
Fat, 417–418 production of, 597
content, 59 purpose, 598
deposition model, 365 Fermented meat products, 465, 493–494
and fatty acid profile, 420–422 Fermented sausages, 468, 493
mimetics, 471 Fiber-optic approach, 157
substitutes, 471 Fibers, as functional ingredients,
Fat consumption, health implications, 474–483
462–463 Fickian laws of diffusion, 335, 339
mono and polyunsaturated fatty
Fish
acids, 464–465
chemical compositions, 58–60
saturated fatty acids, 463–464
differentiation and classification, 62
Fat reduction, in processed meats, 462
freshness, 57–58
challenges of, 492–495
microbial spoilage, 61–62
as fat source, 465–466
parasites and defects, 60–61
flavor and taste, 467
Fisher’s linear discriminant (FLD), 67
insoluble fibers, 474–478
Flat-field correction, 32–33
lipid reformulation using vegetable
Flavor, 467
oils, 483–491
mono and polyunsaturated fatty characteristics, 525–526
acids, 464–465 formation, 602
perception of satiety, 469 amino acid catabolism, 604–605
physicochemical properties, 467–468 carbohydrate catabolism, 603
saturated fatty acids, 463–464 esters, 606
soluble fibers, 478–483 fatty acid oxidation, 605–606
strategies for, 469–491 lipid hydrolysis, 605
texture, 466–467 protein hydrolysis, 603–604
use of structured lipids, 488–491 FLD, see Fisher’s linear discriminant
Fat replacers Flexible packaging film, 632–634
effects on meat products, 479–481 barrier materials, 633–634
gums, 471–472 exterior materials, 633
nonprotein extenders, 471 sealant materials, 634
protein-based, 473–474 Food and Drug Administration (FDA),
starch derivatives, 472–473 678
Fatty acids Foodborne botulism, 131
fat and, 420–422 Foodborne diseases, 157
ώ-3 fatty acids, 361 Food contamination, 159
oxidation, 605–606 Food-grade coatings, 673
in pigs, 408–411 Food irradiation, 199–204
694 Index

Food packaging applications, raw meat, see Raw meat, animal

nanotechnology for, 648 production strategies for
Food safety, 281 safety and scientific criteria, 428
Food Safety and Inspection Service sodium and phosphate, 418–419
(FSIS), 48 Fungal contamination detection,
Foods for specified health use (FOSHU), sensors for, 160, 161
404 Furanones, 387
Formulating, meat products, 515–516 Furans, 387
FOSHU, see Foods for specified health use
FOSs, see Fructooligosaccharides
G
Fourier transform infrared (FTIR)
spectroscopy, 164–165 Gadus morhua, 60
Free-radical oxidation, 210 Galactomannans, 472
Free solution conjugate electrophoresis Gamma rays, 202
(FSCE), 542 Gaseous amines production, 669
Fresh beef, color, 656 Gastrointestinal proteolysis, 373
Fresh meat, 273 Gaussian maximum likelihood (GML),
carbon monoxide, 619 61
case-ready packaging, 641 Gel from emulsion, formation of, 490
high hydrostatic pressure on, 247–257 GenBank, 358
MAP systems, 627–629 Generally recognized as safe (GRAS),
nitrite-containing film, 639 473, 570, 584
nitrogen, 623 Genetic algorithms (GAs), 44
vacuum packaging, 631 Genetically modified (GM) farm
vacuum vs. MAP, 630–631 animals
Fructooligosaccharides (FOSs), 478, 479 authorization process, 3
FSAs, see saturated fatty acids clustered regularly interspaced short
FSCE, see Free solution conjugate palindromic repeat system, 5
electrophoresis detection options, 7
FSIS, see Food Safety and Inspection DNA bases detection strategies, 10–13
Service DNA level modification, 5
FTIR spectroscopy, see Fourier field use of, 3–4
transform infrared microinjection, 4
spectroscopy protein-based detection strategies,
Functionality modification, 274–276 7–10
Functional meat products protein level modification, 6
allergens, 419–420 quantitative polymerase chain
antioxidants and vitamins, 424–427 reaction methods, 13–14
definition of, 404 quantitative protein methods, 13
development of, 415, 416 traceability process, 1
fat and cholesterol, 417–418 Genetically modified organisms
fatty acid profile, 420–422 (GMOs), 2
meat and, 405–429 Genetics, for animal fats reduction,
minerals, 427 407–408
nitrite, 419 GLGCM method, see Gray-level gradient
other compounds, 427–429 co-occurrence matrix method
prebiotics and probiotics, 423–424 Glucose, vs. acetate, 364–366
proteins, peptides, and amino acids, Glycine, 387
422–423 Glycosylated peptides, 383
Index 695

gmk gene, 139 HILIC, see Hydrophilic interaction

GML, see Gaussian maximum liquid chromatography
likelihood Housekeeping genes, 117
Goat placenta, 384 HPLC, see High-performance liquid
Gram-negative bacteria, 582 chromatography
Gram-negative pathogens, 567 HPP, see High-pressure processing
GRAS, see Generally recognized as safe HT, see Halloysite
Grass-fed beef, 356 HUFAs, see Highly unsaturated
Gray-level gradient co-occurrence omega-3 fatty acids
matrix (GLGCM) method, 58 Human foodborne viruses, 141
Grilling, 324 Humidity detection, in meat packaging,
Guar gum, 472 667
Gums, 471–472 Hurdle concept, 239–240, 638
Hydrodynamic pressure processing
H (HDP), 260
bacterial inactivation, 283
Halloysite (HT), 655 cost analysis of, 286–291, 289–291
Halogen lamps, 27 improving meat safety, 281–285
HDL, see Highdensity lipoprotein modification of functionality, 274–276
HDP, see Hydrodynamic pressure
molecular and structural effects,
processing
276–280
Heat-treated pork, 94–95
shock wave technology, see Shock
Hemoglobin, 384
wave technology
Hemolytic uremic syndrome (HUS), 561
tenderness, effect on, 269, 270, 271,
Hemorphins, 380
272
Hemorrhagic colitis, 561
vs. high-pressure processing, 260
HHP, see High hydrostatic pressure
Hydrodyne process, 263, 284
HI, see Hyperspectral imaging
Hydrophilic interaction liquid
Highdensity lipoprotein (HDL), 464
High hydrostatic pressure (HHP) chromatography (HILIC), 542
and bacteriocins, 575–577 Hydrophilic peptides, 604
consumer acceptance of, 244 Hypercube, for salmon fillet, 23
limitations of, 247–257 Hyperspectral imaging (HI), 166
Listeria monocytogenes inactivation, acquisition, 24–26
230–232 basic principles, 20–22
microbial inactivation during, 230, data structure, 22–23
232–241 fluorescence/reflectance imaging, 53
multipulsed treatment, 238–239 image sensing modes, 23–24
quality attributes, effect on, 241 instruments
Highly unsaturated omega-3 fatty acids area detectors, 30
(HUFAs), 360, 361 illumination unit, 27–28
High-performance liquid system calibration, 30–33
chromatography (HPLC), 18, wavelength dispersion devices,
329 28–30
High-pressure processing (HPP) system calibration
hydrodynamic pressure processing flat-field correction, 32–33
vs., 260 spatial calibration, 31
for structural modification, 274 spectral calibration, 31–32
for tenderness improvement, 269 Hypocholesterolemic peptides, 381
696 Index

I Irradiated raw meat, color changes in,

212–213
IAC, see Internal amplification control
Irradiation dose, 205
IARC, see Working Group of
Isracidin, 382
International Agency for
Research on Cancer
IEC, see Ion exchange chromatography K
Image segmentation, 33–34 Kappa carrageenan, 472
spectral image segmentation, 36
thresholding and morphological
processing, 34–36 L
Image sensing modes, 23–24 β-Lactam antibiotics, 172
IMF, see Intramuscular fat Lactic acid, 216
Immunological protein detection Lactic acid bacteria (LAB), 540, 563, 598,
methods, 9 600
Immunomagnetic separation (IMS), 670 Lactobacillus acidophilus, 607
Immunomodulatory peptides, 380–381 Lactobacillus casei, 607
Impedance biosensors, 168 Lactobacillus curvatus, 378, 598, 599, 603,
Imperm®, 654 604, 608
IMS, see Immunomagnetic separation Lactobacillus curvatus CRL705, 566
IN, see Inulin Lactobacillus gasseri, 607
Inelastic scattering, 84 Lactobacillus paracasei, 607
Ingenuity Pathway Analysis (IPA), 359 Lactobacillus plantarum, 598, 599, 603, 604,
Injected meat product, 274 608
Inoculation, of meat products, 563 Lactobacillus sakei, 378, 565, 573, 598, 599,
Insoluble fibers, 474–478 603, 604
Instrumentation, of hyperspectral Lactococcus lactis, 663
imaging, 26 α-Lactorphin, 379–380
Intelligence packaging Lamb, 95–98
biosensors, 670–671 Lasers, 27
colorimetric indicators, 667–670 Lauric acid, 463
Interactance mode, 24 LCTF, see Liquid crystal tunable filter
Internal amplification control (IAC), 118 LDA, see Linear discrimination analysis
Interval partial least squares (iPLS), 44 LDPE, see Low-density polyethylene
Intramuscular fat (IMF), 356 Lean animals, 356
adipocytes, 364, 365 Lean meats
deposition, 357 fat content in, 465
glucose vs. acetate, as precursors, fat reduction and selection, 470
364–366 Least squares-support vector machine
Inulin (IN), 478, 479, 480 (LS-SVM) model, 58
Ion exchange chromatography (IEC), 542 LEDs technology, see Light-emitting
Iota carrageenan, 472 diodes technology
IPA, see Ingenuity Pathway Analysis Leucine, 363
iPLS, see Interval partial least squares Ligand-forming compounds, 213
Irradiated meat Light-based technologies, 308–310
color changes, mechanism of, applications, 310
213–215 efficacy of, factors affecting, 309
consumer acceptance of, 215–216 UV light, 310
Index 697

Light-emitting diodes (LEDs) Lutein, 426

technology, 27 Lycopene, 426
Light-scattering sensors, 166 Lysins, 663
Linear discrimination analysis (LDA), 41
Linear low-density polyethylene
M
(LLDPE), 656
Line scanning method, 24, 31 Machine learning methods, 41
Lipid hydrolysis, 605 Maillard reaction
Lipidomics, 358 Amadori compound and, 385–386
Lipid oxidation, 209–210, 628 of amino compounds and reducing
of meat and meat products, 241–242 sugars, 386
Lipid peroxidation, 425 and meat, 386–387
Lipid reformulation, using vegetable Maillard reaction products (MRPs), 372
oils, 483–491, 484 bioactivities, from peptides, 387–388
Lipogenesis, 361 in cooked meat, 386
Lipolysis, 493, 605 of enzymatic hydrolysates, 387
Lipopolysaccharide (LPS), 582 volatile, 388–389
Liquid crystal tunable filter (LCTF), MALDI-ToF MS, see Matrix-assisted
29–30 laser desorption/ionization
Liquid media, 335–339 time-of-flight mass
Liquid smoke flavorings (LSFs), 324,
spectrometry
326–328
Maltodextrin, 473
Listeria innocua, 568
MAP, see Modified atmospheric
Listeria monocytogenes, 637, 673
packaging
in beef frankfurters, 284, 285
Marbling, 64
in foodborne illness, 122–124, 560
Marinated meat products, 494
growth of, 382
Mass spectrometry (MS), 10
inhibition of, 565, 570, 577
Master-pack approach, 620
RT-qPCR evaluation, 139–140
Matrix-assisted laser desorption/
LLDPE, see Linear low-density
polyethylene ionization time-of-flight mass
Locust gum, 472 spectrometry (MALDI-ToF
Long-chain fatty acids, 360–364 MS), 544
Longissimus thoracis, 279, 280 Meat components/additives, 579–581
Low-density polyethylene (LDPE), 329, Meat composition, 205
331 Meat contamination monitoring
liquid media and, 335–339 chemical contamination, 170–182
Low-energy electromagnetic radiations, microbial contamination, 157–191
202 Meat decontamination, by irradiation
Low-salt foods control of quality changes, 216–218
dry-fermented sausages, 451 food irradiation, 199–204
manufacturing strategies for, microbial decontamination, 204–208
445–446 Meat emulsions, 492
Low-temperature long-time treatment Meat matrix, 465
(LTLT), 273 Meat packaging systems,
LS-SVM model, see Least squares- nanotechnology-based
support vector machine model antimicrobial active packaging,
LTLT, see Low-temperature long-time see Antimicrobial active
treatment packaging
698 Index

enhanced barrier using nanoclay, light-scattering sensors, 166

651–652 optical fibers and microarrays,
intelligence packaging, see 159–163
Intelligence packaging sensors for, 160, 161
nanoclay composites in, 653–654 Microbial inactivation, 232–241, 306
nanostructured edible films and Microbial metabolism, 627
coatings, 671–674 Microbial proteolytical system
packaging format, 650 endopeptidases, 540–541
societal implications, 675–679 exopeptidases, 541–543
Meat products, as fat source, 465–466 Micrococcus luteus, 384
Meat protein-derived peptides, 372–375, Microcrystalline cellulose (MCC), 660
389 Microencapsulation, 607
aging of meats, 373 Microinjection, 4
bioactivities of, see Bioactive peptides microRNA, 359
enzymatic treatment, 374–375 Milk caseins, hydrolysates of, 380
fermentation of meats, 374 Milk clotting, 381
gastrointestinal proteolysis, 373 Milk fat depression (MFD), 362
Meat quality/safety assessment Minerals, 414–416, 427
fish, 56–62 MLR, see Multiple linear regression
poultry carcass, see Poultry carcass Modified atmosphere packaging (MAP),
red meats, 62–72 306, 616
Meat tenderization, 64, 375 active packaging components,
biological interventions for, 268 638–640
brine injection, 273 applications of, 620
chemical interventions for, 269 barrier film materials, 633–634
effect of ultrasound, 301–302 carbon monoxide, 629
hydrodynamic pressure processing, component in hurdle concept, 638
269–272 cured-and-cooked meat products,
low-temperature long-time 629–630
treatment, 273 definitions, 617–618
Meat tissue, 580 dynamic headspace changes, 626–627
Melanoidins, 386 exterior film materials, 633
Melt processing, 652 fresh chicken meat, 664
Metabolomics, 358 gases used in, 620–627
Metal oxide nanoparticles, 676 high-oxygen, 627–628
Metal–oxide–semiconductor fieldeffect intelligent packaging, 667
transistors (MOSFETs), 169 leakers and package integrity, 640
Metal-oxide-semiconductors (MOSs), packaged meats, 669
169, 170 on pathogens effects, 635–637
Metal–oxide–semiconductors (MOSs), 169 purpose of, 619–620
MFD, see Milk fat depression regulatory issues, 640–641
Microbial contamination rigid materials, 634
electrochemical and sealant materials, 634
electromechanical sensors, vacuum packaging vs., 630–631
167–168 Modified atmospheric packaging
electronic nose-based sensors, (MAP), 306, 651
169–170 Monounsaturated fatty acids (MUFAs),
fourier transform infrared 464–465
spectroscopy, 164–165 Montmorillonite (MMT), 651, 652, 654
Index 699

Mosaic principal component analysis regulation, 678–679

(MPCA), 67 toxicity of, 678
MOSs, see Metal-oxide-semiconductors Nanoparticles, toxicity of, 676
MPCA, see Mosaic principal component Nanotechnology
analysis in food industry, 647–650
MpHHP, see Multipulsed high in packaging food, 679
hydrostatic pressure NASH, see Nonalcoholic steato
MRPs, see Maillard reaction products hepatitis
MSC, see Multiplicative scatter Native granular, 482
correction NDOs, see Nondigestible
MUFAs, see Monounsaturated fatty oligosaccharides
acids Near-infrared spectroscopy (NIRS), 19
Multiple linear regression (MLR), 42 Negative polymerase chain reaction
Multiple-needle pumping, 518 control, 118
Multiplicative scatter correction (MSC), NIRS, see Near-infrared spectroscopy
37 Nisin, 238, 564, 663
Multipulsed high hydrostatic pressure Nitrite, 419, 519
(MpHHP), 238–239 Nitrite curing, 519–528
Multivariate analysis Nitrite/nitrate, 601
classification, 39–41 Nitrogen, 618, 623–624
model evaluation, 43–44 Nitrogen gas, 620
regression, 41–42 Nitrogen oxide (NO), 601
Multivariate regression, 41–42 N-nitrosamines, 515
Murein hydrolases, see Lysins nlpD, 139
Muscle proteolytic system Nonalcoholic fatty liver disease
endopeptidases, 537 (NAFLD), 360
exopeptidases, 537–538 Nonalcoholic steatohepatitis (NASH),
Musculus longissimus dorsi, 63 360
Musculus semimembranosus, 281 Nondigestible oligosaccharides (NDOs),
Myofibrillar proteins, 492 478
Myristic acid, 463 Nonglycosylated peptides, 383
Nonprotein extenders, 471
Nontemplate polymerase chain reaction
N
control, 118
NAFLD, see Nonalcoholic fatty liver Nontoxic nonhemagglutinin (NTNH)
disease gene, 131
Nanoclay, 651 Novel sensors, 156
composites, in meat packaging, NTNH gene, see Nontoxic
653–654 nonhemagglutinin gene
enhanced barrier using, 651–652 Nutrigenomics, 355, 389
toxicity, 677 animal agriculture and, 356
Nanocomposite films, 673 conjugated linoleic acids, 361
Nanoencapsulation, 648 differential gene expression, 358
Nanomaterial implementation, experimental approaches, 360
for enhanced sensing glucose vs. acetate, 364–366
performance, 156–157 long-chain fatty acids as, 360–364
Nanomaterials reductionism, 357–359
incorporation of, 649 Nutrition Facts Label, 453
public perception of, 679 Nylon, 633
700 Index

O PEF, see Pulsed electric field

Pentocin 31-1, 565
Ochratoxin A (OTA), 132, 170
Peptidase, 276
Ochratoxin A-producing penicillia, 142
Peptides, 371, 422–423, 604
Octapeptide, 385
bioactive, see Bioactive peptides
Off-odor production, in irradiated meat,
generation, from meat proteins,
210
372–375
Oleic acid, 464
Maillard reaction and, 385–389
Oligopeptides, 373
with sensory properties, 385
Oligosaccharides, 382, 424
Peptidomic approach, 552
OMFs, see Oscillating magnetic fields
Pericondensed PAHs, 320
Omics technologies, 390
Peroxidation, 605
Opioid peptides, 379–380
PGP principle, see Prism-grating-prism
Optical fibers, 159–163
principle
Optical microarrays, 159–163, 163
Phosphate, 418–419
Optical sensors, 176–177
Phospholipon liposomes, 656
latest trends in, 166–167
Photodecomposition, 340–342
Optical waveguides, 157
Photons, 202
Organic selenium, 415
Photooxidation, meat, 630
ORP, see Oxidation-reduction potential
Physical sensors, 154
Oscillating magnetic fields (OMFs), 297,
Physicochemical processes, 335–339
304
Physicochemical properties, of fat,
OTA, see Ochratoxin A
467–468
Oxidation of lipids, 306
Plant stanol, 427
Oxidation-reduction potential (ORP), 214
Plant sterols, 427
Oxygen, 624–625
PLSA, see Partial least squares analysis
Oxygen scavengers, 635, 639
PLS-DA, see Partial least squares-
discriminant analysis
PLSR, see Partial least squares
P
regression
Package integrity, 640 PLS regression, see Partial least squares
Packaging films, 632–634, 639 regression
PAH4 content, 329, 347 PMF, see Protein mass fingerprint
Palmitic acid, 463 Point scanning method, 24
Partial least squares analysis (PLSA), 67 Polyamides, 633
Partial least squares-discriminant Polycyclic aromatic hydrocarbons
analysis (PLS-DA), 41 (PAHs), 344
Partial least squares regression (PLSR), characterization of, 320–321
41, 164, 168 content in processed meats, 339–348
Pathogen detection techniques., 158 cooking of smoked sausages, 342–344
Pathogens associated with meat, 650 diffusion coefficients of, 332
Pattern recognition, 39, 41 formation of, 321–324
PCA, see Principal component analysis international normalization, 326–328
PCCMP, see Powdered cooked cured in liquid media and low-density
meat pigment polyethylene, 335–339
PCR, see Principle component regression in liquid smoke flavorings, 329
PD, see Polydextrose on living organisms, 325–326
Pediocin, 570, 572 in roasted duck, 344
Pediococcus, 603 in smoked meats, 328–329
Index 701

and smoked sausages, 344–348 Principal component analysis (PCA), 36,

Polydextrose (PD), 478, 480, 481, 482 37, 39–40, 94, 103
Polyelectrolyte films, electrogeneration score plot, 551
of, 182 Principle component regression (PCR),
Polyester, 633 42
Polyethylenes, 634 Prism-grating-prism (PGP) principle, 28
Polymerase chain reaction (PCR), 10 Probiotics, 423–424
Polymer–clay nanocomposites, 651 Propionic acid, 364
Polyphenols, 655 Proteases, 374
Polypropylene, 633 Proteasome complex, 537
Polysaccharides, 672 Protein, 422–423
Polystyrene, 634 denaturation, 282
Polyunsaturated fatty acids (PUFAs), as emulsifiers, 490
360, 361, 408, 409, 464–465 film, 672
Polyvinyl chloride, 634 modification of, 274–276
Polyvinylidene chloride, 634 Proteinase B (PrB), 541
Polyvinylpolypyrrolidone resin (PVPP), Protein-based detection strategies, 7–10
655 enzyme linked immunosorbent
Pork assay, 9
back fat, 492 flow strip, 8–9
decontamination of, 306 mass spectrometry, 10
heat-treated pork, 94–95 Protein-based fat replacers, 473–474
meat, hydrodynamic pressure Protein mass fingerprint (PMF), 544
processing of, 272 Proteolytic enzymes for meat
oxygen packaging, 628 tenderization, 375
peptide in, 373 Proteomics, 390, 545
postrigor pork, 93 Pseudomonas, 650
prerigor pork, 88–92 PUFAs, see Polyunsaturated fatty acids
Positive polymerase chain reaction Pulsed electric field (PEF), 303–304
control, 118 Purge, vacuum packaging, 631
Postharvest interventions, 198 Purified bacteriocins, 563
Postrigor pork, 93 Pushbroom method, 24
Poultry carcass, 48 hyperspectral imaging system, 26
contamination detection, 49–52 Pyrazines, 387
microbiological spoilage detection,
55–56
Q
tumor and bone detection, 52–55
Poultry meat, 411 QCMs, see Quartz crystal microbalances
Powdered cooked cured meat pigment Qflex® kit, 176
(PCCMP), 521 QIAamp DNA Mini kit (QIAGEN), 115
PrB, see Proteinase B QIM, see Quality index method
Prebiotic peptides, 382–383 QIS, see Quality index scores
Prebiotics, 423–424 qPCR, see Quantitative polymerase
Premature browning, beef, 628 chain reaction
Prerigor pork, 88–92 QTH lamps, see Quartz–tungsten–
Preservation technologies, bacteriocins halogen lamps
and Quality index method (QIM), 56
active packaging systems, 577–579 Quality index scores (QIS), 58
high hydrostatic pressure, 575–577 Quantification cycle (Cq), 116
702 Index

Quantitative polymerase chain reaction microbiological properties, 69–70

(qPCR) sensory attributes, 64–67
bacteria foodborne infection, see technological attributes, 70–72
Bacteria foodborne infection, Reductionism to global gene expression,
qPCR detection 357–359
bacteria foodborne intoxications, Reflectance calibration, 32
129–132 Reflectance spectra, 49
considerations for, 116–117 Reformulated meat products, 467
controls of, 118 Relative humidity (RH), 667
Quantitative regression, 43 Residual predictive deviation (RPD), 43
Quartz crystal microbalances (QCMs), Resistant starch (RS), 478, 481, 482–483
168 Resistant strains, appearance of, 582–585
Quartz–tungsten–halogen (QTH) Restructured injected meat products,
lamps, 27 494
Quasi-nutrigenomic, 363 Restructured meat products, 466, 482
Quinolones, 173 Retrovirus-mediated gene transfer, 4
Reuterin, 245, 571
Reversed-phase high-performance
R
liquid chromatography
Radial basis function (RBF) kernel, 42 (RP-HPLC), 278, 542
“Radiation absorbed dose,” 204 Reverse transcriptase-polymerase chain
Radiation destruction, of reaction (RT-PCR), 359
microorganisms, 205–207 Reverse transcription quantitative
Radionuclides, 202, 203 polymerase chain reaction
Raman spectra of pork chops, 101 (RT-qPCR) tool
Raman spectroscopic devices, 84, 86–87 Campylobacter jejuni, 140–141
Random forests (RF), 41 Listeria monocytogenes, 139–140
Raw hyperspectral image, 22 ochratoxin A-producing penicillia,
Raw meat, animal production strategies 142
for Salmonella, 135–139
fatty acids in pigs, 408–411 shiga toxin-producing E. coli, 140
fatty acids in ruminants, 412 Staphylococcus aureus, 141
genetics for reduction, 407–408 viruses, 141–142
minerals, 414–416 RF, see Random forests
products, 564–567 Ribosomal RNA (rRNA), 117
vitamins and antioxidants, 413–414 Rice bran, 477
RBF kernel, see Radial basis function Rice starch, 473
kernel RMSEC, see Root mean square error of
Reactive gas species (ROS), 304 calibration
Real-time polymerase chain reaction RMSECV, see Root mean square error of
principles and characteristics of, 114 cross-validation
quantitative polymerase chain RMSEP, see Root mean square error of
reaction for, 119 prediction
reverse transcription quantitative ROC curves, see Receiver operator
polymerase chain reaction, 134 characteristics (ROC) curves
Receiver operator characteristics (ROC) Root mean square error of calibration
curves, 44 (RMSEC), 43
Red meats Root mean square error of cross-
chemical compositions, 67–69 validation (RMSECV), 43
Index 703

Root mean square error of prediction Sealant materials, 634

(RMSEP), 43 SEC, see Size-exclusion chromatography
ROS, see Reactive gas species Selenium, 415
Rotatable disk, 29 SEM, see Scanning electron microscopy
RPD, see Residual predictive deviation Semipurified bacteriocins, 563
RP-HPLC, see Reversed-phase Sensor electrode coating, 182
high-performance liquid Sensory inspection, 57
chromatography Sensory properties, peptides with, 385
rpoS, 139 Sensory tenderness score, 273
rRNA, see Ribosomal RNA SEP, see Standard error of prediction
RS, see Resistant starch SFAs, see Saturated fatty acids
RT-PCR, see Reverse transcriptase- Shiga toxin-producing E. coli, 140
polymerase chain reaction Shock wave technology
RT-qPCR, see Reverse transcription cost analysis of, 287, 289–291
quantitative polymerase chain damages in packaging material, 288
reaction development of equipment, 263–267
Ruminants, fatty acids in, 412 generation of shock waves, 261
Rupture effect, 261 historical perspective of, 263
principle of, 262
Short-chain fatty acid (SCFA), 363, 364,
S
605
SA, see Simulated annealing Signal-to-noise ratio (SNR), 29
Safety assurance, 260 Silicon-based optical thinfilm biosensor,
Salmonella spp., 119–122, 135–139, 560, 635 163
S.typhimurium, 284, 285, 565, 670 Silver nanoparticle (AgNP), 658, 659, 677
Salmon fillet, hypercube for, 23 Simulated annealing (SA), 44
Salt reduction in processed meats Single-pulsed high hydrostatic pressure
crystal size and shape of, 446 (spHHP), 238
enzyme inhibition, 448–449 Single-ring aromatic hydrocarbons, 323
and labeling, regulations, 453 Size-exclusion chromatography (SEC),
masking agents, 446 542
physical properties, 447–448 Slice shear force (SSF), 65
preservation properties, 452 Smoked meat
raised blood pressure, 444 polycyclic aromatic hydrocarbons in,
sensory effects, 449–452 326–328
sodium reduction, 445 occurrence of, 328–329
Sample principal component analysis reduction of, 339–340
(SPCA), 67 products, 321–324
Satiety, 469 Smoothing, 37
Saturated fatty acids (SFAs), 463–464 SNR, see Signal-to-noise ratio
Sausages, 342–344 SNV, see Standard normal variate
Savory peptides, 385 Sodium, 418–419
Savory taste-enhancing peptide, 385 reduction, 445
Scanning electron microscopy (SEM), replacement, 445–446
278, 280 selenite, 415
SCFA, see Short-chain fatty acid Sodium chloride, 448
SDS-PAGE, see Sodium dodecyl Sodium dodecyl sulfate-polyacrylamide
sulfate-polyacrylamide gel gel electrophoresis (SDS-
electrophoresis PAGE), 276, 277, 542
704 Index

Sodium hypophosphite, 527 Taste, 467

Soluble fibers, 478–483 TBARS, see Thiobarbituric acid reactive
Sourness-suppressing peptides, 385 substances
Soy proteins, 423 Tender Class System (TCS), 264
Spatial calibration, 31 Tenderness, see Meat tenderization
Spatial scanning methods, 25 Texture, 601
SPCA, see Sample principal component change of meat, 215
analysis fat, 466–467
Spectral calibration, 31–32 of muscle foods, 241
Spectral classifier, 53 TFs, see Transcription factors
Spectral image segmentation, 36 Thermo-labile nature of protein meat
Spectral preprocessing, 37–39 systems, 246
Spectral variables, 44 Thiobarbituric acid reactive substances
Spectrum derivatives, 44 (TBARS), 209, 306, 384
spHHP, see Single-pulsed high Three-dimensional (3D) hyperspectral
hydrostatic pressure cube, 22
Spoilage reactions, in meat, 649–650 Threshold cycle (Ct), 116
SPR transduction, see Surface plasmon Thresholding, 34–36
resonance transduction Thymol, 654
SSF, see Slice shear force Time of curing, in dry-cured ham, 550
Standard error of calibration (SEC), 43 TnT degradation, see Troponin T
Standard error of prediction (SEP), 43 degradation
Standard normal variate (SNV), 37 Torturous diffusion path, of
Staphylococcal foodborne poisoning, 129 nanocomposite, 653
Staphylococcus aureus, 129–131, 141, 561, Total viable count (TVC), 18
636 Toxic equivalency factors, 326
Staphylococcus carnosus, 599, 601, 603, 606 Toxigenic molds, quantitative
Staphylococcus equorum, 599, 605, 606 polymerase chain reaction for,
Staphylococcus xylosus, 599, 601, 603, 606 132–142
Starch derivatives, 472–473 TPP, see Tripeptidylpeptidases
Stepwise regression, 44 Transcription factors (TFs), 355, 360,
Stokes Raman scattering, 84 362
Strip test, 8 Trans-fatty acids intake, 463
Structured lipids, use of, 488–491 Transmission electron microscopy
Sulfonamides, 173 (TEM), 278, 286
Support vector machines (SVMs), 36, 41 Transmission grating, 28
Support vector regression (SVR), 42 Transmittance mode, 24
Surface plasmon resonance (SPR) Trichinella spiralis, 284
transduction, 176 Tripeptidylpeptidases (TPP), 537
SVMs, see Support vector machines Troponin T (TnT) degradation, 277
SVR, see Support vector regression Tumbling/massaging, of pickle-injected
SYBR Green chemistry, 116 meat cuts, 518
Synthetic peptide, 385 Tumor detection, in chicken, 52–55
Tunable light sources, 27
Turkey breast, hydrodynamic pressure
T
processing of, 272
Tailor designing nitrite-free meat TVC, see Total viable count
products, 528–529 Two-dimensional gel electrophoresis
TaqMan® hydrolysis probes, 116 (2-DGE), 542
Index 705

U Water emulsion, formation of oil and,

490
Ultralow-oxygen system, 629
Water holding capacity (WHC), 447, 448
Ultrasound technology, 298
Wavelength calibration, 31
decontamination of meat, 300–301
Wavelength dispersion devices
meat brining, 302–303
filter wheels, 29
meat tenderization, 301–302
imaging spectrographs, 28–29
Umami taste-enhancing peptides, 385
tunable filters, 29–30
Underwater electrical discharge, 264
Wavelengths, selection of important,
United Nations Population Fund, 647
44–45
Up-to-date meat processing procedures,
WBSF, see Warner–Bratzler shear force
320
Whiskbroom method, 24
UV irradiation, 669
Wild/direct smoking, 322
Wishbone, 54
V
Working Group of International Agency
Vacuum packaging (VP), 217, 618 for Research on Cancer (IARC),
modified atmosphere packaging vs., 326
630–632 World Health Organization (WHO), 463,
Valorphin, 380 474
Venous thromboembolism, 381
Verotoxin-producing E. coli (VTEC), 124 X
Veterinary drug residues, 171
antibiotics, 172–174 X-prolyl-dipeptidylpeptidase, 541
hormones acting as growth X-rays, 202, 204
promoters, 174–175
Visual identification, of genetically
Y
modified animals, 7
Vitamin E, 413, 425 Yersinia, 127–129
Vitamins, 413–414, 424–427 Y.enterocolitica, 115, 172, 562, 635
Volatile organic compound (VOC), 169 Yersiniosis, 635
VP, see Vacuum packaging
VTEC, see Verotoxin-producing E. coli
Z
W
Zein, 672
Warner–Bratzler shear force (WBSF), Zero-current devices, 167
272 Zero-order first-class Bessel function, 331