Current Applied Physics 9 (2009) e301–e303

Contents lists available at ScienceDirect

Current Applied Physics

journal homepage: www.elsevier.com/locate/cap

Electrochemical cell lysis on a miniaturized flow-through device

Sandeep Kumar Jha a, Gyu-Sik Ra a, Gi-Sung Joo a, Yong-Sang Kim a,b,*
a
Department of Nano Science and Engineering, Myongji University, Gyeonggi 449-728, Republic of Korea
b
Department of Electrical Engineering, Myongji University, Gyeonggi 449-728, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: A low-cost miniaturized flow-through device was fabricated using conventional photolithographic tech-
Received 31 March 2009 nique for lysis of whole cells using electrochemically generated hydroxyl groups. The device used low
Received in revised form 17 June 2009 impedance Au-interdigitated electrode (IDE) fabricated on glass substrate to input DC potential to the
Accepted 19 June 2009
overlaid PDMS based microchannel. The lysis of human cell line MCF-10A could be achieved between
Available online 25 June 2009
2 and 5 V of DC input with optimum release of genomic DNA at 5 V for 5 min, which is the lowest poten-
tial range reported in any such study. The lysate was extracted to confirm release of genomic DNA and
PACS:
was successfully tested for PCR grade purity of DNA by amplifying a known tumor suppressor gene
87.85.dh
SMAD4. The proposed method was non-destructive for biocomponents due to absence of Joule heating
Keywords: and shall find use in miniaturized PCR analysis as well as where native protein extraction is required
Cell lysis under aseptic conditions.
Microfluidics Ó 2009 Elsevier B.V. All rights reserved.
Lab-on-a-chip
PCR

1. Introduction vious reports of applying a DC voltage to electrochemically gener-

ate hydroxide ion inside the device [4]. The electrochemically
Lysis of whole cells for extraction of intracellular components generated hydroxide ions permanently disrupt the cellular mem-
such as DNA, RNA, protein and metabolites is a routine procedure brane by cleaving fatty acid groups, thereby releasing intracellular
in most of the biological laboratories and diagnostic industries. The material. In continuation to this idea, the microchip was com-
available methods [1] for this purpose are time consuming, labori- pletely redesigned in the present study for reagent-less and power
ous and require multistep chemical treatments, which are often efficient complete lysis of cells. Au-interdigitated electrodes were
quite expensive. For these reasons, miniaturization and automa- used to input DC potential across the cells flowing through the
tion of this technique is highly desirous [2]. The commonly used microchannel and lysate was examined for purity and
methods for lysis such as high voltage electroporation [3]; protein- denaturation.
ase-K, detergents and lysozyme treatment [4]; laser induced lysis
[5]; bead milling and sonication [6] or freeze–thaw in liquid nitro- 2. Materials and methods
gen [7] are unsuitable for miniaturization and also require addi-
tional separation or neutralization steps. 2.1. Chip design and fabrication
Therefore, various groups have attempted in past to develop on-
chip cell lysis protocol using different strategies. However, their The microchip was developed on glass substrate. Gold interdig-
methods lacked the aim of miniaturization. For example, a few itated microelectrodes were fabricated over the glass for applying
groups have used extremely high voltage to the order of 1–10 kV DC potential by using photolithography and evaporation method
[8,9] or laser induced cell lysis [10] and others needed sample pre- (Fig. 1). AZ-1512 was spin-coated on glass and patterned using
treatment with addition of yet expensive reagents [11]. On the photolithography. After photolithography process, gold electrode
contrary, our goal in the present study was to develop a relatively was deposited using evaporator. The electrode surface was cleaned
inexpensive method for cell lysis that uses minimal reagents, with acetone and dried using N2 gas. The microchannel was im-
power, and can be fabricated using common photolithographic printed in PDMS mold using negative molding method (Fig. 1)
techniques. The principle used for this purpose was based on pre- [12]. For fabrication of microchannels, 40 lm thick negative photo-
resist (SU-8) was spin-coated and patterned on the silicon wafer.
* Corresponding author. Address: Department of Nano Science and Engineering,
Myongji University, San 38-2 Namdong, Gyeonggi 449-728, Republic of Korea. Tel.:
The degassed PDMS mixture of Sylgard 184 silicone elastomer
+82 31 330 6365; fax: +82 31 321 0271. along with curing agent (10:1) was poured on the SU-8 patterned
E-mail address: [email protected] (Y.-S. Kim). wafer and cured for 4 h at 72 °C. The PDMS mold was then peeled

1567-1739/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.cap.2009.06.035
e302 S.K. Jha et al. / Current Applied Physics 9 (2009) e301–e303

off and manual drilling was performed to produce access holes of

3 mm diameter. The width and depth of the microchannel were
250 and 200 lm, respectively. The PDMS mold and Au-patterned
glass substrate were subjected to UV–ozone treatment for 40 min
and were bonded together.

2.2. Cultivation of cells

The MCF-10A cells were cultured in MEGM (Mammary Epithe-

lial Growth Medium, Serum-free, Clonetics) supplemented with
100 ng/ml cholera toxin (Sigma) to 70% confluence as per method
described by Caldas et al. [13]. The cells were detached from cul-
ture plate by trypsinization and then centrifuged, washed with
pH 7.4 phosphate buffer saline (PBS) twice and re-suspended (to
2  107 cells/ml concentration) in pH 7.4 PBS.

2.3. Cell lysis

A suspension of 50 ll (106 cells/ml) human cell line MCF-10A in

PBS was injected into the silicone tube carrying the same buffer in
the microchannel using a precision syringe pump. The lysate was
collected at the other end of the device (Fig. 2) and used in spectro-
scopic and agarose gel electrophoresis for confirmation of DNA
Fig. 1. Fabrication process for PDMS based microchannel and Au microelectrodes.
release.

2.4. Lysate analysis

The cell lysate was analyzed for presence of released genomic

DNA using conventional agarose gel (1%) electrophoresis. After
electrophoretic separation, genomic DNA band was cut with a ra-
zor and redissolved in Mega Spin gel elution kit (Intron Biotech.,
TM

Korea) for spectroscopic analysis and estimation of DNA concentra-

tion at 280 nm wavelength using an Eppendorf Biophotometer. For
estimation of PCR readiness of the extract, cell lysate was centri-
fuged to remove cell debris and thereafter, cell free extract was
analyzed for presence of SMAD4 gene using conventional PCR (Ap-
plied Biosystems Thermal cycler model 2720) technique.

3. Results and discussion

In the present study, a low-cost cell lysis device was fabricated

using conventional photolithographic technique. The glass sub-
strate was used to make transparent devices and for its suitability
Fig. 2. The cell lysis device after fabrication; showing gold IDE, microchannel in in bonding with PDMS by UV–ozone method [12]. The electro-
PDMS and connected silicone tubing for injection of whole cell sample and chemical lysis of human cell line could be achieved between 2
collection of lysate.

Fig. 3. State of MCF-10A cells flowing within microchannel: (1) before application of DC potential; (2) in-channel bubble formation at the onset and (3) next few second of
application of potential; (4) after treatment of +5 V DC for 5 min and (5) condition of microchannel after stopping the reaction, where cell debris could be seen adhered to
PDMS wall.
 S.K. Jha et al. / Current Applied Physics 9 (2009) e301–e303 e303

for generation of hydroxyl ions desired for lysis and at the same
time, electrode impedance was low enough to avoid generation
of Joule heat [15] inside microchannel. The hydrogen bubbles re-
leased at the anode were indicative of this process and were re-
quired to quench the lytic hydroxyl ions at the downstream by
recombination [4]. Therefore, the intracellular components, such
as DNA, RNA etc. were supposed to be intact using this method.
This was evident from Fig. 4, where no shearing of DNA could be
observed. To further verify this fact, the cell lysate from MCF-10A
cell line was analyzed for PCR grade purity of genomic DNA by
amplifying a known tumor suppressor gene SMAD4 [16] using con-
ventional PCR method (forward primer: GTCTATGGCACATCAAAC-
TATGCACAATGC; reverse primer: GTCTAACAATTTTCCTTGCAACG).
The different temperature zones used were 92, 55 and 68 °C for
melting, annealing and extension, respectively for 30 cycles and
for 30 s each. The PCR reaction yielded desired 193 base pair prod-
uct (Fig. 5) and thereby demonstrated the successful application of
the cell lysis microchip.

4. Conclusion

A PDMS based microfluidic system was devised for electro-

chemical cell lysis. The device size was small enough and it re-
quired just 5 V for operation. Extraction of PCR grade DNA under
Fig. 4. Gel-doc showing DNA extracted from lysis of MCF-10A cell line on the chip.
asceptic condition was possible. The process was non-destructive
Lanes: M = 1.5 kb marker (6 lL loading); 1 = 0 V; 2 = 2 V; 3 = 5 V; 4 = 10 V (lanes 1–
4 = 20 lL sample loading). A minimum potential of 2 V was required for lysis,
because it did not generate Joule heat as in case of previous reports
whereas 5 V was ideal for effective genomic DNA extraction. The genomic DNA where as high as 10 kV was used to achieve cell lysis [14]. The pro-
bands can be seen just below loading wells, whose respective concentrations were posed method shall find use in miniaturized PCR analysis as well as
0, 0.4, 0.7 and 1.0 lg/ml for 0–10 V treatment. where native protein extraction is required.

Acknowledgement

This work was supported by Grant No. ROA-2006-000-10274-0

from the National Research Laboratory Program of the Korea Sci-
ence & Engineering Foundation.

References

[1] P. Guerlava, V.r. Izac, J.-L. Tholozan, Current Microbiology 36 (1998) 131.
[2] J.A. Halla, E. Felnagleb, M. Friesa, S. Spearingc, L. Monacoc, A. Steelea, Planetary
and Space Science 54 (2006) 1600.
[3] Z. Lin, Z. Cai, Biotechnology Journal 4 (2009) 210.
[4] D.D. Carlo, C. Ionescu-Zanetti, Y. Zhang, P. Hung, L.P. Lee, Lab Chip 5 (2005)
171.
[5] R.B. Brown, J. Audet, Journal of the Royal Society, Interface 5 (Suppl. 2) (2008)
S131.
[6] E. Padilla, V. Gonzalez, J.M. Manterola, J. Lonca, A. Perez, L. Matas, M.D.
Quesada, V. Ausina, Diagnosis of Microbiological Infectious Diseases 46 (2003)
19.
Fig. 5. Gel-doc showing conventional PCR for 30 cycles using cell free extract of [7] S.A. Kim, J.A. Yoon, M.J. Kang, Y.M. Choi, S.J. Chae, S.Y. Moon, Fertility and
MCF-10A lysate: lane: M: 10 kb marker, lane 1: MCF-10A pre-PCR cell free extract, Sterility (2008).
[8] D.W. Lee, Y.-H. Cho, Sensors and Actuators B: Chemical 124 (2007) 84.
lane 2: MCF-10A cell extract. PCR product yield was 800 ng/106 cells. After PCR,
[9] J. Gao, X.-F. Yin, Z.-L. Fang, Lab Chip 4 (2004) 47.
20 ll was loaded on gel compared to 6 ll of 10 kb marker.
[10] M.D. Dhawan, F. Wise, A.J. Baeumner, Analytical and Bioanalytical Chemistry
374 (2002) 421.
and 5 V of DC input (Fig. 3) with optimum release of genomic DNA [11] C. Xing, C. Dafu, L. Changchun, C. Haoyuan, Chinese Journal of Analytical
at 5 V for 5 min (Fig. 4), which is the lowest potential range re- Chemistry 34 (2006) 1656–1660.
[12] J.-H. Kim, K.-H. Na, C.J. Kang, Y.-S. Kim, Sensors and Actuators A: Physical 120
ported in any such study. The reason for this success over similar (2005) 365.
experiments from other groups [8,9,11,14], where parallel elec- [13] H. Caldas, L.E. Honsey, R.A. Altura, Molecular Cancer 4 (2005) 11.
trodes were used along the microchannel [4] or the in-channel [14] S.-W. Lee, Y.-C. Tai, Sensors and Actuators A: Physical 73 (1999) 74.
[15] Y. Zhang, N. Bao, X.-D. Yu, J.-J. Xu, H.-Y. Chen, Journal of Chromatography A
electrodes were separated by wide gap [9], could be attributed to 1057 (2004) 247.
the Au-interdigitated electrode geometry. The alternate +5 and [16] S. Ali, C. Cohen, J.V. Little, J.H. Sequeira, M.B. Mosunjac, M.T. Siddiqui,
0 V DC across 200 lm gap between the Au electrodes was suitable Diagnostic Cytopathology 35 (2007) 644.