CRISPR Ebook
CRISPR Ebook
Intro
Genome editing is a process that involves several actions affecting DNA
sequences in the genome, such as deletion, insertion or alteration of
these sequences. Researchers in the field of genome editing spent
many years attempting to create genome editing tools that were
effective, easy-to-use and non-expensive.
CRISPR – History
It began in 1993, when researchers identified repetitive The Cas9 molecule is guided to the target DNA by a guide RNA
palindromic segments of DNA in prokaryotes. These segments (gRNA). This short RNA fragment (the gRNA) is complementary to
were found among other sections of genetic material and were the target viral DNA sequence. This specific guiding system allows
soon called Clustered Regularly Interspaced Short Palindromic the Cas9 to cleave the DNA at a very specific level. This cleaving
Repeats (CRISPR). As it turned out, the sections of genetic process destroys the virus. Additionally, a piece of the foreign DNA
material between the CRISPR sections were actually the (referred to as a “spacer”) can be retained by the prokaryote and
interesting thing. This discovery built the foundation for the stored. The spacer will be kept in between the palindromic sequences
creation of CRISPR-Cas9 technology. of the CRISPR segments, which allows the prokaryote to retain a
memory of previous infections. In this way, any attempted re-infection
In 2007, a leap forward was made when researchers realised by the virus would be rapidly prevented and the attacking virus would
that the function of CRISPR was for prokaryotic immunity. The be destroyed. This is basically the equivalent of the human immune
underlying process, at a molecular level, was not fully system, which takes and retains antigens to prevent re-infection.
understood for another 5 years. Both bacteria and archaea (the
prokaryotes) use CRISPR-Cas9 to fight off invading viruses. Researchers quickly understood, after figuring out the CRISPR
When the viral infection occurs, the prokaryotic cell uses Cas9 mechanism in prokaryotes, that it could have massively beneficial
(which is a CRISPR-associated nuclease) to cleave the viral uses in humans, other animals, plants and microbes.
DNA by creating a double-strand break (DSB) in the target DNA
sequence.
complex.
Cas is a protein that acts to cut the target DNA while the gRNA guides Target DNA PAM
it to the target DNA site. In prokaryotes, the gRNA is used to target
viral DNA, but as a gene editing tool, it can be designed to target any
gene site in almost any location.
Target Target
RNA RNA
cas9
gRNA gRNA sgRNA
DSB
gRNA Target Sequence gRNA Target Sequence
Figure 2. Figure 3.
Single guide RNAs and two component RNAs. The crRNA (green) and tracrRNA CRISPR-Cas9 produces a double strand break (DSB). Cas9 and sgRNA
(purple) components can be annealed together to form the two component combine to create a ribonucleoprotein. The sgRNA binds to the target DNA
gRNA, or the two components can be joined by a linker loop (blue) to create a and Cas9 cleaves the DNA, causing a DSB.
continuous molecule (sgRNA).
(NHEJ)
Homology Arms
Knock-In Sequence
NHEJ can be used when the desired result is to DNA donar template
If the gene editing result desired by the researchers is to replace the targeted DNA sequence with another sequence, then HDR can be used.
A DNA template from a donor that possessed that desired DNA segment is introduced. This template is surrounded by sections of
homologous DNA sequences. The host’s repair mechanisms will use this template to fix the DSB by using homologous recombination. By
this process, the donor’s sequence is incorporated into the sequence being repaired.
3’ 5’
Linker
loop tracrRNA
cas9
3’
tracrRNA RNP
cas9 sgRNA 3’
or ~20 nt
gRNA
or
sgRNA
~20 nt gRNA
5’ 5’
3’ 5’
Insertion
5’ 3’
cas9 or
3’ 5’ 5’ 3’
sgRNA
DSB
3’ 5’
5’ 3’
3’ 5’ Deletion
Target DNA PAM
or
Homology-Directed Repair
Homology 5’ 3’
Arms
3’ 5’
Figure 5.
5’ 3’
3’ 5’
Knock-In Sequence
Knock-In Sequence
DNA Donor Template
Figure 6.
CRISPR is being used for many applications in gene editing, not just knocking in and knocking out genes. Research into CRISPR and
development of new CRISPR methods has led to several new applications of the technique. Examples include CRISPRi and CRISPRa,
anti-CRISPR proteins, CRISPR screens, and tagging genes via CRISPR to allow for tracking and visualization.
Anti-CRISPR
Cas9 + gRNA
CRISPR-Cas9 allows the fine-tuning of genomic DNA. CRISPR library Apply drug/
treatment
However, there is a downside. There is a risk of off-target Systematically disrupt a
effects, such as cleaving the DNA in the wrong location. set of genes using a
CRISPR library
The solution is to use anti-CRISPR proteins that inhibit the
activity of Cas9. This can be seen in nature, when
bacteriophages use these types of proteins to deflect the
prokaryote’s CRISPR machinery. This technology can be Figure 8.
applied to decrease errors in the editing process. When the gRNAs to target each gene are added to
ATGTCGTAGCGCCGTCGTAGC
CTCTCGTCGASGCAGSTGSCA
anti-CRISPR machinery is introduced after the editing each well of the well plate. A treatment, for GATCTGCAGCCCCGTCTATCT
process occurs, the cleavage at on-target sites is only example a drug, being applied to the target
cells would allow for the identification of
partially decreased, while cleavage at off-target sites is
which genes are responsible for the Identify cells with mutant
greatly decreased. increased or reduced sensitivity to the drug. phenotype and underlying
genotype
Steps
Design
An experiment with CRISPR begins with organising the parameters and
components for it. The gRNA must be designed and the suitable Cas nuclease
must be selected. Once they are completed, it is necessary to select the CRISPR
component format, choose a method of transfection, and prepare the optimal
conditions for the cell type being used. These steps will give a strong likelihood for
the success of the gene editing experiment.
Edit
After designing the experiment, you can begin to introduce the target-specific
gRNA and Cas9 nuclease to the cells. Carry out the transfection and allow CRISPR
to act.
Analyze
When the editing is completed, analyse the relevant genomic sequences to find
out the frequency and type of edits that have occurred in the genome. Several
analysis tools exist that can be used to evaluate the genomic results and Background photo created by kjpargeter - www.freepik.com
ascertain the editing efficiency. Protein and phenotypic assays are available to
evaluate gene editing effectiveness.
Understanding CRISPR – The Basics
CRISPR
Future
CRISPR is extremely popular because of how specific and
feasible it is as a tool for genome editing. CRISPR has vastly
advanced and redefined the field of genome engineering.
CRISPR has facilitated many advances in recent years.
Researchers are attempting to develop the technology to
reveal its huge potential.
CRISPR is becoming more important in the biomedical industry. Drug discovery and development is renowned as a long, expensive and
difficult process, but with CRISPR it is believed that the pre-clinical stage will become easier. An example is CRISPR screening libraries
which are now available to find new drug targets. Also, CRISPR can help to create accurate disease models for drug development, as well
as CRISPR research for in vivo and ex vivo therapies. Gene editing could greatly benefit the development of improved therapies and
medicines in the future.
CRISPR is advancing research into the most problematic areas of the field of biomedical science. It is also facilitating advances in other
fields of science, such as human therapeutics, agriculture, biofuels and general scientific research.