Biology
Biology
20 Sets
Class : 12th
Sub : Biology
Disclaimer :
1. These papers are based on the SQP released by CBSE and
published by a private organization just for the practice of
the students.
2. CBSE has not released these papers and CBSE is not related to
these papers in any manner.
3. Publisher of these papers clearly state that these papers are
only for practice of students and questions may not be come in
main exam.
4. Please do not spread any rumors that any one paper will be
coming in main exam.
Page 1 NODIA Sample Paper 1 CBSE Biology Class 12
Sample Paper 1
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. If most individuals in a population are young, why is the population likely to grow rapidly in the future?
(a) Many individuals will begin to reproduce soon (b) Death rates will be low
(c) Immigration and emigration can be ignored (d) All of these
5. Hardy-Weinberg equilibrium is known to be essentially affected by factors like, gene flow, genetic drift, mutation,
genetic recombination and
(a) evolution (b) limiting factors
(c) saltation (d) natural selection
6. Plasmid used to construct the first recombinant DNA was isolated from which bacterium species?
(a) Escherichia coli (b) Salmonella typhimurium
(c) Agrobacterium tumefaciens (d) Thermus aquaticus
8. If a double stranded DNA has 20% of cytosine, what will be the percentage of adenine in it?
(a) 20% (b) 40%
(c) 30% (d) 60%
9. The density of a population in a given habitat during a given period, fluctuates due to changes in certain basic
processes. On this basis, fill up boxes A and B in the given flow chart with correct option.
10. The given Punnett’s square represents the pattern of inheritance in a dihybrid cross where yellow (Y) and round
(R) seed condition is dominant over white (y) and wrinkled (r) seed condition.
YR Yr yR yr
YR F J N R
Yr G K O S
yR H L P T
yr I M Q U
A plant of type ‘H’ will produce seeds with the genotype identical to seeds produced by the plants of
(a) type M (b) type J
(c) type P (d) type N
11. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Recombinant DNA technology (i) Chilled ethanol
(a) A-(iv), B-(i), C-(iii), D-(ii) (b) A-(i), B-(iii), C-(ii), D-(iv)
(c) A-(ii), B-(i), C-(iii), D-(iv) (d) A-(iv), B-(ii), C-(i), D-(iii)
12. The given table shows differences between spermatogenesis and spermiogenesis. Select the incorrect option.
Spermatogenesis Spermiogenesis
(a) Process of formation of spermatozoa. Process of differentiation of spermatozoon from a
spermatid.
(b) It changes a haploid structure into another haploid It involves conversion of a diploid structure into
structure. haploid structure.
(c) Growth and divisions occur. Divisions and growth are absent.
(d) A spermatogonium forms four spermatozoa. A spermatid forms a single spermatozoon.
13. Assertion : Elimination of a competitively inferior species in a closely related or otherwise similar group is known
as competitive exclusion principle.
Reason : If two species compete for the same resource, they could avoid competition by choosing different times
for feeding or different foraging patterns.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
14. Assertion : Mouse is the most preferred mammal for studies on gene transfers.
Reason : Mouse possesses features like short oestrous cycle and gestation period, relatively short generation time,
production of several offspring per pregnancy, etc.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Given below is the diagram of a normal 28 day menstrual cycle in a human female. It depicts phase I, II and III.
Study this diagram and comment upon the appropriateness of the Assertion and the Reason. Assertion : The
hormone secreted in large amounts in phase III is also responsible for maintaining pregnancy in human females.
Reason : Corpus luteum secretes progesterone in phase I however it degenerates completely in phase III.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Assertion : Emigration is outward movement of some individuals from local population.
Reason : Emigration is caused by occurrence of deficiencies and calamities.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Write the role of on and ‘restriction’ site in a cloning vector pBR322.
18. (a) It is generally observed that the children who had suffered from chicken-pox in their childhood may not
contract the same disease in their adulthood. Explain giving reasons the basis of such an immunity in an
individual. Name this kind of immunity.
(b) What are interferons? Mention their role.
A is an embryonic stage that gets transformed into B, which in turn gets implanted in the endometrium in human
females.
(a) Identify A, B and its parts C and D.
(b) State the fate of C and D in the course of embryonic development in humans.
20. Draw a pyramid of numbers considering a big banyan tree supporting a population of insects, small birds and
their predators.
O
Name the type of food chains responsible for the flow of larger fraction of energy in an aquatic and a terrestial
ecosystem respectively. Mention one difference between the two food chains.
21. Two children one with blood group ‘AB’ and other with blood group ‘0’ are born to parents where the father has
blood group W and the mother has blood group ‘B’. Work out a cross to show how is it possible?
SECTION - C
22. Carefully examine structures A and B of pentose sugar given below. Which one of the two is more reactive? Give reasons.
23. Explain the role of pituitary and ovarian hormones in the menstrual cycle of human females.
25. Convergent evolution and divergent evolution are the two concepts explaining organic evolution. Explain each one
with the help of an example.
26. (i) Name the plant source of the drug commonly called ‘smack. How does it affect the body of the abuser?
(ii) What is humoral immunity?
O
(i) What is colostrum? Why are breast-fed babies likely to be healthy?
(ii) Malaria, typhoid, pneumonia and amoebiasis are some of the human infectious diseases. Which one of these
are transmitted through mechanical carriers?
27. (a) Write the palindromic nucleotide for the following DNA segment : 5l -GAATTC- 3l
(b) Name the restriction endonuclease that recognises this sequence.
(c) How are ‘sticky-ends’ produced? Mention their role.
28. A particular species of wild cat is endangered. In order to save them from extinction, which is a desirable in situ
or ex situ? Justify your answer and explain the difference between the two approaches.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
(c) Write the conclusions Mendel arrived at on dominance of traits on the basis of monohybrid crosses that he
carried out in pea plants.
30. Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow
dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below
and answer the following questions.
SECTION - E
31. (a) Describe the events of oogenesis with the help of schematic representation.
(b) Write two differences between oogenesis and spermatogenesis.
O
(a) When a seed of an orange is squeezed, many embryos, instead of one are observed. Explain how it is possible.
(b) Are these embryos genetically similar or different? Comment.
32. (a) Describe the process of synthesis of fully functional mRNA in a eukaryotic cell.
(b) How is the process of mRNA synthesis different from that in prokaryotes?
O
(a) The given flow chart highlighting the steps in DNA fingerprinting technique. Identify a, b, c, d, e and 1
33. (a) Explain how to find whether an E. coli bacterium has transformed or not when a recombinant DNA bearing
ampicillin resistant gene is transferred into it.
(b) What does the ampicillin resistant gene act as in the above case?
O
There are two different farm lands, one where Bt-cotton crop was cultivated and the other where non Bt-cotton
crop (indigenous) was cultivated. Farmers responsible for this experimental cultivation were free to use the
farming practices of their choice. During the cultivation period, the data was collected with respect to the amount
of pesticide used, water required for irrigation and at harvesting time, the crop productivity. Based on the data
collected, a bar graph was plotted which is shown below.
******
Sample Paper 2
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. The structure in chromatin seen as ‘beads-on string’ when viewed under electron microscope are called
(a) nucleotides (b) nucleosides
(c) histone octamer (d) nucleosomes
2. For which of the following cases, population density can be easily determined by not utilising biological-entities
directly?
(a) Fish density (b) Density of bacteria in bacterial culture
(c) Siberian cranes at Bharatpur wetlands (d) Tiger census
CCTGG CGATA
(c) GGACC (d) GCTAA
4. Identify the incorrect pair from the following with respect to angiosperms.
(a) Primary endosperm nucleus-3n (b) Antipodals-2n
(c) Cells of nucellus of ovule-2n (d) Vegetative cell of male gametophyte-n
6. In a given population of 2000 individuals, 80 births and 125 deaths were reported over a given period of time.
Which of the following graphs will correspond to it?
Column I Column II
A. Fimbriae (i) Oviduct
B. Fallopian tube (ii) Capture ova released into coelom
C. Infundibulum (iii) Site of fertilization
D. Ampulla (iv) Part of oviduct closer to ovary
(a) A-(iv), B-(i), C-(ii), D-(iii) (b) A-(ii), B-(i), C-(iv), D-(iii)
(c) A-(i), B-(ii), C-(iii), D-(iv) (d) A-(i), B-(iii), C-(iv), D-(ii)
9. Replacement of the lighter-coloured variety of peppered moth (Biston betularia) to its darker variety (Biston
carbonaria) in England is the example of
(a) natural selection (b) regeneration
(c) genetic isolation (d) temporal isolation
10. The inoculum is added to the fresh milk in order to convert milk into curd, the term ‘inoculum’ here refers to
(a) a starter rich in vitamin B12 (b) a starter rich in proteins
(c) a starter containing millions of LAB (d) an aerobic digester
12. During insertional inactivation, the presence of a chromogenic substrate gives blue coloured colonies if the plasmid
in the bacteria does not have an insert. The blue colour is produced by the enzyme
(a) α -glucosidase (b) restriction endonuclease
(c) β -galactosidase (d) Taq polymerase
13. Assertion : The plant biomass which serves as the food of herbivores and decomposers is said to result from the
net primary productivity.
Reason : Gross primary productivity is the rate of total production of organic material (biomass) during
photosynthesis.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Assertion : Many endemic species are seen to flourish in sacred forests.
Reason : Sacred forests are undisturbed forest patches and biodiversity rich areas.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Assertion : The primary productivity of different ecosystems can be easily compared.
Reason : The magnitude of primary productivity depends on the photosynthetic capacity of producers and the
prevailing environmental conditions.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. What could be the possible treatments for a patient exhibiting ADA deficiency?
18. Where is sporopollenin present in plants? State its significance with reference to its chemical nature.
(a) Redraw the structure as a replicating fork and label the parts.
(b) Write the source of energy for this replication.
20. Name the genus of baculovirus that acts as a biological control agent in spite of being a pathogen. Justify by giving
three reasons that make it an excellent candidate for the job.
21.
The above graph show species-area relationship. Write the equation of the curve ‘a’ and explain it.
O
How does over-exploitation of beneficial species affect biodiversity? Explain with the help of one example.
SECTION - C
22. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain.
23. A cross was carried out between two pea plants showing the contrasting traits of height of the plants. The result
of the cross showed 50% parental characters.
(a) Work out the cross with the help of a Punnett square.
(b) Name the type of the cross carried out.
24. Prior to a sports event, blood and urine samples of sports persons are collected for drug tests.
(a) Why is there a need to conduct such tests?
(b) Name the drugs the authorities usually look for.
(c) Write the generic names of two plants from which these drugs are obtained.
26. Study the transverse section of human ovary given below and answer the questions that follow.
27. ‘Plasmid is a boon to biotechnology’. Justify this statement quoting the production of human insulin as an
example.
28. When does a geneticist need to carry a test cross? How is it carried?
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Refer to the given below flow chart that shows the sewage treatment.
(a) With reference to the above flow chart explain the role of step A in the given process.
(b) Identify A, B, C and D in the given process.
(c) Explain the process at step D.
O
(c) What is the significance of low B in the given process and how does it forms C?
30. Study the given figure and answer the following questions.
(c) What would happen in the given cross if the parents phenotype be reversed i.e., white eyed female and red
eyed male respectively?
SECTION - E
31. An experiment ‘X’ provided evidence in support of ‘Y’. In this experiment, four gases were circulated ‘A’, ‘B’, ‘C,
and ‘D’ in an air tight apparatus and electrical discharge from electrodes was passed at 800°C. The mixture of
gases were passed through a condenser. After a week, the chemical composition of the liquid inside the apparatus
was analysed. The results provided evidence through which ‘Y’ was more or less accepted.
(i) Identify gases A, B, C, D.
(ii) Which theory of origin of life is supported by the above experiment?
(iii) Draw a diagrammatic representation of experiment X.
(iv) What does A, B, C and D together produced in the experiment X?
O
Explain three different ways in which natural selection can affect the frequency of a heritable trait in a population.
33. Study the graph given below related with menstrual cycle in females:
(a) Identify ovarian hormones X and Y mentioned in the graph and specify their source.
(b) Correlate and describe the uterine events that take place according to the ovarian hormone levels X and Y
mentioned in the graph on -
(i) 6 - 15 days
(ii) 16 - 25 days
(iii) 26 - 28 days (when ovum is not fertilised)
O
Refer the given below figure and answer the questions that follows:
Sample Paper 3
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Level of which hormones get elevated by the intake of nicotine?
(a) FSH, LH (b) Thyroxine, progesterone
(c) Oxytocin, prolactin (d) Adrenaline, nor-adrenaline
3. In a population of 500 zebras, average natality is 25, average mortality is 20, immigration is 30 and emigration is
35. What will be the population at the end of 10 years?
(a) 550 (b) 600
(c) 650 (d) 500
5. Select the option that correctly identifies A, B and C in the given table.
6. The main reason why antibiotics could not always treat the bacteria-mediated diseases is
(a) insensitivity of the individual following prolonged exposure to antibiotics
(b) inactivation of antibiotics by bacterial enzymes
(c) decreased efficiency of immune system
(d) the development of mutant bacterial strains resistant to antibiotics.
7. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Methanogens (i) BOD
B. Fermentors (ii) Methane rich fuel gas
C. Organic waste in water (iii) Production of methane
D. Biogas (iv) Large vessels for growing microbes
(a) A-(ii), B-(iv), C-(iii), D-(i) (b) A-(iv), B-(iii), C-(ii), D-(i)
(c) A-(ii), B-(i), C-(iv), D-(iii) (d) A-(iii), B-(iv), C-(i), D-(ii)
8. Having become an expert on gel electrophoresis, you are asked to examine a gel. Where would you find the
smallest segments of DNA?
(a) Near the positive electrode, farthest away from the wells
(b) Near the negative electrode, close to the wells
(c) Near the negative electrode, farthest away from the wells
(d) Near the middle, they tend to slow down after the first few minutes
9. Which among the following birth control measures is considered to be highly effective?
(a) The rhythm method (b) The use of physical barriers
(c) Contraceptive pills (d) Sterilisation techniques
10. Hugo de Vries gave his mutation theory on organic evolution while working on
(a) Pisum sativum (b) Drosophila melanogaster
(c) Oenothera lamarckiana (d) Althea rosea
11. The most important human activity, leading to the extinction of wildlife, is
(a) pollution of air and water (b) hunting for valuable wildlife products
(c) introduction of alien species (d) alteration and destruction of the natural habitats.
12. Match column I with column II and select the correct option from the codes given below.
Column I Column II
A. Hyaluronidase (i) Acrosomal reaction
B. Corpus luteum (ii) Embryonic development
C. Gastrulation (iii) Progesterone
D. Colostrum (iv) Mammary gland
(a) A-(iii), B-(ii), C-(iv), D-(i) (b) A-(i), B-(iii), C-(ii), D-(iv)
(c) A-(iii), B-(ii), C-(i), D-(iv) (d) A-(i), B-(ii), C-(iii), D-(iv)
15. Age sex structure of a population can be depicted in the form of a pyramid by plotting the percentage of population
of each sex in each age class. Study this pyramid and comment upon the appropriateness of the Assertion and the
Reason.
16. Assertion : In eukaryotes, replication and transcription occur in the nucleus but translation occurs in the cytoplasm.
Reason : mRNA is transferred from the nucleus to the cytoplasm where ribosomes and amino acids are available
for protein synthesis.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. A student on a school trip started sneezing and wheezing soon after reaching the hill station for no explained
reasons. But, on return to the plains, the symptoms disappeared. What is such a response called? How does the
body produce it?
A is an embryonic stage that gets transformed into B, which in turn gets implanted in the endometrium in human
females.
(a) Identify A, B and its parts C and D.
(b) State the fate of C and D in the course of embryonic development in humans.
19. In a typical monohybrid cross the F2 population ratio is written as 3 : 1 for phenotype but expressed as 1 : 2 : 1
for genotype. Discuss with the help of an example.
20. Draw the vector DNA and a foreign DNA showing the sites where EcoRI has acted to form the sticky ends.
21. The given figure shows the different types of age pyramids for human population.
(a) What does the parts ‘X, ‘Y’ and ‘Z’ represent?
(b) Which type of population is represented by pyramids A, B and C? Explain.
O
Why the pyramid of energy is always upright? Explain.
SECTION - C
22. The sacred groves of Aravalli Hills and Ooty botanical garden both aim at biodiversity conservation. How do they
differ in their approaches? Explain.
23. Write the mode of pollination in Vallisneria and water lily. Explain the mechanism of pollination in Vallisneria.
26. Refer to the given figure showing the variety of beaks of finches that Darwin found in Galapagos Island. Refer this
figure and answer the following questions.
27. (a) Name the organism in which the vector shown is inserted to get the copies of the desired gene.
(b) Mention the area labelled in the vector responsible for controlling the copy number of the inserted gene.
(c) Name and explain the role of a selectable marker in the vector shown.
28. Identify A, B and C in the schematic diagram of an antibody given above and answer the questions.
Identify A, B and C in the schematic diagram of an antibody given above and answer the questions.
(a) Why do the symptoms of malaria not appear immediately after the entry of sporozoites into the human
body when bitten by female Anopheles? Explain.
(b) Give the scientific name of the malarial parasite that causes malignant malaria in humans.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. In 1958, Matthew Meselson and Franklin Stahl provided a strong experimental evidence to prove the template
mechanism of DNA replication given by Watson and Crick. They used heavy (15N) and light (14N) isotopes of
nitrogen to differentiate between parental and newly synthesised DNA strands. The experiment and results are
diagrammatically shown below.
(d) If E. coli is allowed to grow in N15 medium for 20 minutes and in N14 medium for next 40 minutes, then what
will be the number of hybrid and light double stranded DNA molecules respectively?
30. Biogas generation is done on a large scale in rural India. The given diagram shows a typical biogas plant.
SECTION - E
31. If a desired gene is identified in an organism for some experiments, explain the process of the following :
(a) Cutting of desired gene at specific locations.
(b) Synthesis of multiple copies of the desired gene.
O
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an
experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands
had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the
usage of pesticides on Bt crops and non-Bt crops in these farm lands.
(a) Which of the above 4 farm lands has successfully applied the concepts of biotechnology to show better
management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt
or Non- Bt) and why?
(b) Cotton bollworms were introduced in another experimental study on the above farm lands wherein no
pesticide was used. Explain what effect would a Bt and Non-Bt crop have on the pest.
32. Describe the post-zygotic events leading to implantation and placenta formation in humans. Mention any two
functions of placenta.
O
(a) Draw a diagram of an enlarged view of T.S. of one microsporangium of an angiosperm and label the
following parts:
(i) Tapetum
(ii) Middle layer
(iii) Endothecium
(iv) Microspore mother cells
(b) Mention the function of tapetum.
(c) Explain the following by giving reasons:
(i) Pollen grains are well preserved as fossils.
(ii) Pollen tablets are in use by people these days.
(i) Will the whole gene be transcribed into RNA primarily? State ‘Yes’ or ‘No’.
(ii) Name the shaded and unshaded parts of the gene.
(iii) Explain how these genes are expressed.
(iv) How is this gene different from prokaryotic gene in its expression?
O
Study the schematic representation of the genes involved in the lac operon given below and answer the questions
that follow:
(a) Identify and name the regulatory gene in this operon. Explain its role in ‘switching off’ the operon.
(b) Why is the lac operon’s regulation referred to as negative regulation?
(c) Name the inducer molecule and the products of the genes ‘z’ and ‘y’ of the operon. Write the functions of
these gene products.
******
Sample Paper 4
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Connel’s field experiment showed that on the rockysea coasts of Scotland, larger barnacle Balanus dominates the
intertidal area and removes the smaller barnade Chathamalus. This happened due to
(a) parasitism (b) predation
(c) mutualism (d) competition
4. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
(a) polysaccharides (b) RNA
(c) DNA (d) histones
8. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Glomus (i) Mosquitoes
B. Bacillus thuringiensis (ii) Phosphorus nutrition
C. Root nodules (iii) Leghaemoglobin
D. Ladybird (iv) Bioinsecticide
(a) A-(iii), B-(i), C-(ii), D-(iv) (b) A-(ii), B-(iii), C-(iv), D-(i)
(c) A-(ii), B-(iv), C-(iii), D-(i) (d) A-(iii), B-(iv), C-(ii), D-(i)
11. What is the criterion for movement of DNA fragments on agarose gel during gel electrophoresis?
(a) The smaller the fragment size, the farther it moves. (b) Positively charged fragments move to farther end.
(c) Negatively charged fragments do not move. (d) The larger the fragment size, the farther it moves.
12. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Sigma factor (i) 5l - 3l
B. Capping (ii) Initiation
C. Tailing (iii) Termination
D. Coding strand (iv) 5l end
(v) 3l end
(a) A-(iii), B-(v), C-(iv), D-(ii) (b) A-(ii), B-(iv), C-(v), D-(i)
(c) A-(ii), B- (iv), C-(v), D-(iii) (d) A-(iii), B-(v), C-(iv), D-(i)
13. Assertion : In barrier methods, ovum and sperms are prevented from physical meeting.
Reason : Barrier methods are used during coitus, to prevent the entry of ejaculated semen into the female
reproductive tract.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
14. Assertion : If the species-area relationships are analysed among very large areas like the entire continents, the
value of Z i.e., slope of line lies in the range of D.1 to 0.2.
Reason : The value of Z for frugivorous birds and mammals in the tropical forests is found to be 1.15.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. The given below figures show the different modification found in Bougainvillea and Cucurbita. Observe the figures
carefully and comment upon the appropriateness of the Assertion and Reason.
16. Assertion : Ex-albuminous seeds do not possess any residual endosperm, as it is completely consumed during
embryo development.
Reason : Wheat, castor, pea and groundnut all are examples of ex-albuminous seeds.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Refer to the given figure and answer the following questions:
(a) One of the sperms is observed to penetrate ‘A’ of the ovum, as shown in the above diagram. Name ‘A’.
(b) Why only one sperm can penetrate and fertilise the ovum?
18. In snapdragon a cross between true-breeding red flowered (RR) plants and true-breeding white flowered (rr) plants
showed a progeny of plants with all pink flowers.
(a) The appearance of pink flowers is not known as blending. Why?
(b) What is this phenomenon known as?
20. (a) How can we find whether an E. coli bacterium has transformed or not when a recombinant DNA bearing
ampicillin resistant gene is transferred into it?
(b) What does the ampicillin resistant gene act as in the above case?
21. (a) How many primary producers do you think will be needed to support six tertiary consumers in a grassland
ecosystem?
(b) Draw a grassland pyramid to substantiate your answer.
O
Define the following terms :
(a) Productivity
(b) Humification
SECTION - C
22. Explain the events in a normal woman during her menstrual cycle on the following days:
(a) Ovarian event from 13-15 days
(b) Ovarian hormones level from 16 to 23 days
(c) Uterine events from 24 to 29 days
24.
(a) Identify the polarity from a to a l in the above diagram and mention how many more amino acids are
expected to be added to this polypeptide chain.
(b) Mention the DNA sequence coding for serine and the anticodon of tRNA for the same amino acid.
(c) Why are some untranslated sequence of bases seen in mRNA coding for a polypeptide? Where exactly are
they present on mRNA?
26. (i) Identify the molecule shown and the site labelled ‘A’.
27. A segment of foreign DNA and that of a vector DNA are cut with restriction endonuclease to form a recombinant
DNA. Show with the help of schematic diagrams.
(a) The set of palindromic nucleotide sequence of base pairs the EcoRI will recognise in both the DNA segments.
Mark the site at which EcoRI will act and cut both the segments.
(b) Sticky ends formed on both the segments where the two DNA segments will join later to form a recombinant
DNA.
28. There are many animals that have become extinct in the wild but continue to be maintained in Zoological parks.
(a) What type of biodiversity conservation is observed in this case?
(b) Explain any other two ways which help in this type of conservation.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Study the diagram showing replication of HIV in humans and answer the following questions accordingly.
(c) Name the two different cells the new viruses ‘E’ subsequently attack. What are two ways of transmission of
HIV infection in humans other than sexual contact.
30. Study the schematic representation of the genes involved in the lac operon given below and answer the questions
that follow:
(c) Name the inducer molecule and the products of the genes ‘z’ and ‘y’ of the operon. Write the functions of
these gene products.
SECTION - E
31. Mention the site of fertilisation of a human female. List the events that follow in sequence until the implantation
of the blastocyst.
O
Write briefly the role of pollination in the growth and development in an angiosperm.
32.
(a) Write your observations on the variations seen in the Darwin’s finches shown above.
(b) Explain what conclusions did he draw and how.
O
(i) What do these pictures ‘a’ and ‘b’ illustrate with reference to evolution? Explain.
(ii) How does industrial melanism support Darwin’s theory of natural selection? Explain.
33. Unless the vector and source DNA are cut, fragments separated and joined, the desired recombinant vector
molecule cannot be created.
(a) How are the desirable DNA sequences cut?
(b) Explain the technique used to separate the cut fragments.
(c) How are the resultant fragments joined to the vector DNA molecule?
O
The clinical gene therapy is given to a 4-years old patient for an enzyme which is crucial for the immune system
to function. Observe the given flow chart of gene therapy and answer the following questions.
Sample Paper 5
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Swathi was growing a bacterial colony in a culture flask under ideal laboratory conditions where the resources are
replenished. Which of the following equations will represent the growth in this case? (Where population size is N,
birth rate is b, death rate is d, unit time period is t, and carrying capacity is K).
(a) dN/dt = KN (b) dN/dt = r N
(c) dN/dt = r N(K-N/K) (d) dN/dt = r N(K+N/K)
2. Which of the following food chains is the major conduit for energy flow in terrestrial and aquatic ecosystems
respectively?
Terrestrial ecosystem Aquatic ecosystem
(a) Grazing Grazing
(b) Detritus Detritus
(c) Detritus Grazing
(d) Grazing Detritus
3. Interferons are most effective in making non-infected cells resistant against the spread of which of the following
diseases in humans?
(a) Ascariasis (b) Ringworm
(c) Amoebiasis (d) AIDS
4. Which of the following water samples in the table given below, will have a higher concentration of organic matter?
5. Sea anemone gets attached to the surface of the hermit crab. The kind of population interaction exhibited in this case is
(a) amensalism (b) commensalism
(c) mutualism (d) parasitism
8. Apis mellifera are killer bees possessing toxic bee venom. Identify the treatment and the type of immunity
developed from the given table to treat a person against the venom of this bee.
Remedy Immunity
(a) Inactivated proteins Active
(b) Proteins of the venom Passive
(c) Preformed antibodies Passive
(d) Dead micro-organisms Active
9. An infertile couple was advised to undergo in vitro fertilisation by the doctor. Out of the options given below,
select the correct stage for transfer to the fallopian tube for successful results?
(a) Zygote only (b) Zygote or early embryo upto 8 blastomeres
(c) Embryos with more than 8 blastomeres (d) Blastocyst Stage
10. Which of the following amino acid residues will constitute the histone core?
(a) Lysine and Arginine (b) Asparagine and Arginine
(c) Glutamine and Lysine (d) Asparagine and Glutamine
12. Given below are four contraceptive methods and their modes of action. Select the correct match.
(a) (A)-(i), (B)-(ii), (C)- (iii), (D)-(iv) (b) (A)-(ii), (B)-(iii), (C)-(iv), (D)-(i)
(c) (A)-(iii), (B)-(iv), (C)-(ii), (D)-(i) (d) (A)-(iv), (B)-(i), (C)- (iii), (D)-(ii)
13. Assertion : When white eyed, yellow bodied Drosophila females were hybridised with red eyed, brown-bodied
males; and F1 progeny was intercrossed, F2 ratio deviated from 9 : 3 : 3 : 1.
Reason : When two genes in a dihybrid are on the same chromosome, the proportion of parental gene combinations
is much higher than the non-parental type.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
14. Assertion : Apomictic embryos are genetically identical to the parent plant.
Reason : Apomixis is the production of seeds without fertilisation.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Given is the age pyramid of population in one of the states in India as per 2011 census. It depicts the male
population on the left hand side, female population on the right hand side, newborns towards the base and
gradually increasing age groups as we move from base to the top, with the oldest population at the top. Study this
pyramid and comment upon the appropriateness of the Assertion and the Reason.
16. Assertion : Functional ADA cDNA genes must be inserted in the lymphocytes at the early embryonic stage.
Reason : Cells in the embryonic stage are mortal, differentiated and easy to manipulate.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. In the figure given below, parts A and B show the level of hormones which influence the menstrual cycle. Study
the figure and answer the questions that follow:
(a) Name the organs which secrete the hormones represented in parts A and B.
(b) State the impact of the hormones in part B on the uterus of the human female during 6 to 15 days of
menstrual cycle.
18. A true breeding pea plant, homozygous dominant for inflated green pods is crossed with another pea plant with
constricted yellow pods (ffgg). With the help of Punnett square show the above cross and mention the results
obtained phenotypically and genotypically in F1 generation?
19. During a field trip, one of your friend in the group suddenly became unwell, she started sneezing and had trouble
in breathing.
Name and explain the term associated with such sudden responses. What would the doctor recommend for relief?
20. CTTAAG
GAATTC
(a) What are such sequences called? Name the enzyme used that recognises such nucleotide sequences.
(b) What is their significance in biotechnology?
21. (a) Given below is a pyramid of biomass in an ecosystem where each bar represents the standing crop available
in the trophic level. With the help of an example explain the conditions where this kind of pyramid is
possible in nature.
(b) Will the pyramid of energy be also of the same shape in this situation? Give reason for your response.
O
(a) Draw a pyramid of numbers where a large number of insects are feeding on the leaves of a tree. What is the
shape of this pyramid?
(b) Will the pyramid of energy be also of the same shape in this situation? Give reason for your response.
SECTION - C
22. Explain the functions of the following structures in the human male reproductive system.
(a) Scrotum, (b) Leydig cells, (c) Male accessory glands
23. State the agent(s) which helps in pollinating the following plants. Explain the adaptations in these plants to ensure
pollination :
(a) Corn, (b) Water hyacinth, (c) Vallisneria
24. (a) Identify the polarity of X to Y in the diagram below and mention how many more amino acids are expected
to be added to this polypeptide chain.
26. Highlight the structural importance of an antibody molecule with a diagram. Name the four types of antibodies
found to give a humoral immune response, mentioning the functions of two of them you have studied.
O
(a) Explain the life cycle of Plasmodium starting from its entry in the body of female Anopheles till the
completion of its life cycle in humans.
(b) Explain the cause of periodic recurrence of chill and high fever during malarial attack in humans.
27. Carefully observe the given picture. A mixture of DNA with fragments ranging from 200 base pairs to 2500 base
pairs was electrophoresed on agarose gel with the following arrangement.
(a) What result will be obtained on staining with ethidium bromide? Explain with reason.
(b) The above set-up was modified and a band with 250 base pairs was obtained at X.
What change(s) were made to the previous design to obtain a band at X? Why did the band appear at the position
X?
28. (a) There was loss of biodiversity in an ecosystem due to a new construction project in that area. What would
be its impact on the ecosystem? State any three.
(b) List any three major causes of loss of biodiversity.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Study the Pedigree chart given below and answer the questions that follow:
(a) On the basis of the inheritance pattern exhibited in this pedigree chart, what conclusion can you draw about
the pattern of inheritance?
(b) If the female is homozygous for the affected trait in this pedigree chart, then what percentage of her sons
will be affected ?
(c) Give the genotype of offsprings 1,2,3 and 4 in III generation.
O
(c) In this type of inheritance pattern, out of male and female children which one has less probability of
receiving the trait from the parents? Give a reason.
30. The data below shows the concentration of nicotine smoked by a smoker taking 10 puffs/ minute.
(a) With reference to the above graph explain the concentration of nicotine in blood at 10 minutes.
(b) How will this affect the concentration of carbon monoxide and haembound oxygen at 10 minutes?
(c) How does cigarette smoking result in high blood pressure and increase in heart rate?
O
(c) How does cigarette smoking result in lung cancer and emphysema?
SECTION - E
31. Observe the segment of mRNA given below.
(a) Explain and illustrate the steps involved to make fully processed hnRNA.
(b) Gene encoding RNA Polymerase I and III have been affected by mutation in a cell. Explain its impact on
the synthesis of polypeptide, stating reasons.
O
Study the schematic representation of the genes involved in the lac operon given below and answer the questions
that follow:
(a) The active site of enzyme permease present in the cell membrane of a bacterium has been blocked by an
inhibitor, how will it affect the lac operon?
(b) The protein produced by the i gene has become abnormal due to unknown reasons. Explain its impact on
lactose metabolism stating the reason.
(c) If the nutrient medium for the bacteria contains only galactose; will operon be expressed? Justify your
answer.
32. Oil spill is a major environmental issue. It has been found that different strains of Pseudomonas bacteria have genes
to break down the four major groups of hydrocarbons in oil. Trials are underway to use different biotechnological
tools to incorporate these genes and create a genetically engineered strain of Pseudomonas-a ‘super-bug, to break
down the four major groups of hydrocarbons in oil. Such bacteria might be sprayed onto surfaces polluted with
oil to clean thin films of oil.
(a) List two advantages of using bacteria for such biotechnological studies.
(b) For amplification of the gene of interest PCR was carried out. The PCR was run with the help of polymerase
which was functional only at a very low temperature. How will this impact the efficiency of the PCR?
Justify.
(c) If such bacteria are sprayed on water bodies with oil spills, how will this have a positive or negative effect
on the environment? Discuss.
O
Insects in the Lepidopteran group lay eggs on maize crops. The larvae on hatching feed on maize leaf and
tender cob. In order to arrest the spread of three such Lepidopteran pests, Bt maize crops were introduced in an
experimental field.
A study was carried out to see which of the three species of lepidopteran pests was most susceptible to Bt genes
and its product.
The lepidopteran pests were allowed to feed on the same Bt-maize crops grown on 5 fields (A-E).
The graph below shows the leaf area damaged by these three pests after feeding on maize leaves for five days.
Insect gut pH was recorded as 10, 8 and 6 respectively for Species I, II and III respectively.
(a) Evaluate the efficacy of the Bt crop on the feeding habits of the three species of stem borer and suggest
which species is least susceptible to Bt toxin.
(b) Which species is most susceptible to Bt-maize? Explain why?
(c) Using the given information, suggest why similar effect was not seen in the three insect species?
33. Trace the events from copulation to zygote formation in a human female.
O
Trace the development of a megaspore mother cell to the formation of mature embryo sac in a flowering plant.
******
Sample Paper 6
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Animal vectors are required for pollination in
(a) Vallisneria (b) Wheat
(c) Yucca (d) maize
2. During transcription, the site of DNA molecule at which RNA polymerase binds is called
(a) promoter (b) regulator
(c) receptor (d) enhancer
3. Match column I containing transgenic organisms with their specific characteristics in column II and select the
correct option from the given codes.
Column I Column II
A. Golden rice (i) Protein - enriched milk
B. Bt cotton (ii) Increased shelf life
C. Flavr Savr (iii) Enriched with vitamin A
D. Rosie cow (iv) High yield and pest resistant
(a) A-(iii), B-(iv), C-(ii), D-(i) (b) A-(iii), B-(ii), C-(iv), D-(i)
(c) A-(ii), B-(iv), C-(iii), D-(i) (d) A-(i), B-(iv), C-(ii), D-(iii)
4. Total number of individuals of a species per unit area and per unit time is called
(a) population size (b) population density
(c) demography (d) population dynamics
6. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Turner’s syndrome (i) Trisomy
B. Linkage (ii) AA + XO
C. Y-chromosome (iii) Morgan
D. Down’s syndrome (iv) TDF
(a) A-(ii), B-(i), C-(iv), D-(iii) (b) A-(iv), B-(i), C-(ii), D-(iii)
(c) A-(iv), B-(ii), C-(i), D-(iii) (d) A-(ii), B-(iii), C-(iv), D-(i)
11. In laboratory experiments, two species of Paramecium (species 1 and 2) were grown alone and in the presence of
the other species. The following graphs show growth of species 1 and species 2, both alone and when in mixed
culture with the other species.
12. Match column I (terms) with column II (definitions) and select the correct option from the codes given below.
Column I Column II
A. Parturition (i) Attachment of embryo to endometrium
B. Gestation (ii) Release of egg from Graafian follicle
C. Ovulation (iii) Delivery of baby from uterus
D. Implantation (iv) Duration between pregnancy and birth
E. Menopause (v) Formation of zygote by fusion of the egg and sperm.
(vi) Stoppage of menstruation
(a) A-(ii), B-(iv), C-(i), D-(v), E-(vi) (b) A-(iv), B-(iii), C-(i), D-(v), E-(ii)
(c) A-(v), B-(vi), C-(ii), D-(iii), E-(iv) (d) A-(iii), B-(iv), C-(ii), D-(i), E-(vi)
13. Given below is the figure of a transverse section of a young anther. It depicts a bilobed, tetragonal structure
consisting of four microsporangia located at the corners; two in each lobe. Study this figure and comment upon
the appropriateness of the Assertion and the Reason.
16. Assertion : The primary productivity of different ecosystems can be easily compared.
Reason : The magnitude of primary productivity depends on the photosynthetic capacity of producers and the
prevailing environmental conditions.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Suggest a technique to a researcher who needs to separate fragments of DNA.
18. Ringworm is one of the most common infectious fungal disease in humans. Name any two genera of fungi which
cause ringworm and state any of its two symptoms.
19. Explain the processes of emasculation and bagging of flowers. State their importance in breeding experiments.
20. Study the schematic representation given below and answer the following questions.
21. The cytological observations made in a number of insects led to the development of the concept of genetic/
chromosomal basis of sex-determination mechanism. Honeybee is an interesting example to study the mechanism
of sex-determination. Study the schematic cross between the male and the female honeybees given below and
answer the questions that follow:
(a) Identify the cell divisions ‘A’ and ‘B’ that lead to gamete formation in female and male honeybees respectively.
(b) Name the process ‘C’ that leads to the development of male honeybee (drone).
SECTION - C
22. Explain the significance of `palindromic nucleotide sequence’ and restriction endonuclease in the formation of
recombinant DNA.
23. With the help of one example, explain the phenomena of co-dominance and multiple allelism in human population.
24. Study the diagram showing the entry of HIV into the human body and the process that follows.
25. Study the schematic representation of spermatogenesis and answer the following questions.
26. Alien species are highly invasive and are a threat to indigenous species. Substantiate this statement with any three
examples.
O
What are the two types of desirable approaches to conserve biodiversity? Explain with examples bringing out the
difference between the two types.
27. Name the disorder humans suffer from as a result of monosomy of the sex chromosome. Give the karyotype and
write the symptoms.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. In a plant species that follows Mendelian inheritance yellow flower colour is dominant over white and round fruit
shape is dominant over elongated. Crossing was performed between two purelines-one having yellow-flower and
round fruit and another with white flower and elongated fruits. About 20 plants survived in F1 progeny. Plants of
F1 were allowed to self fertilise and about 960 plants survived in F2.
(a) How many plants would have yellow flower and round fruit in F1 generation?
(b) How many plants would have yellow flower and round fruit in F2 generation?
(c) Mention the genotypic and phenotypic ratio when plant heterozygous for yellow flower and round fruit is
crossed with the double recessive parent.
O
(d) If the plant heterozygous for yellow flower and round fruit are self crossed, then what will be the genotype
of plant with yellow flower and elongated fruit?
30. In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are
vaccinated and their blood samples were tested. Mice developed mild disease symptoms. After few days those mice
were again infected with the virus. This time they did not show any disease symptoms. Their blood samples were
tested. Two graphs given show antibody concentration for the first and second infection in mice blood.
SECTION - E
31. Disease X is a chromosomal disorder occur due to autosomal aneuploidy. The children with this syndrome suffer
from severe mental retardation, short statured with small round head, furrowed tongue and partially open mouth.
Palm is broad with characteristic palm crease.
(a) Name the disease ‘X’ and state main cause of autosomal aneuploidy in it.
(b) How many number of chromosomes are present in the child suffering from this syndrome?
(c) What will be the sex chromosomal complement in males suffering from this disease?
O
Write the scientific name of the organism Thomas Hunt Morgan and his colleagues worked on for their experiments.
Why did they select that organism to study sex linked genes for lab experiments?
32. The given figure shows a fetus within the uterus. On the basis of the given figure, answer the questions that follow:
O
(a) Given below is a T.S. of an apple. Identify A, B and C.
33. (a) Describe the different steps in one complete cycle of PCR.
(b) Write the applications of PCR.
O
Explain the process by which a bacterial cell can be made ‘competent’. Why is it essential to make bacterial cells
‘competent’ in recombinant DNA technology?
Sample Paper 7
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. What type of ecological pyramid would be obtained with the following data?
Secondary consumer : 120 g
Primary consumer : 60 g
Primary producer : 10 g
(a) Inverted pyramid of biomass (b) Pyramid of energy
(c) Upright pyramid of numbers (d) Upright pyramid of biomass
4. According to Oparin, which one of the following was not present in the primitive atmosphere of the earth ?
(a) Methane (b) Oxygen
(c) Hydrogen (d) Water vapour
7. When does the growth rate of a population following the logistic model equal zero? The logistic model is given as
dN/dt = rN(1—N/K).
(a) When N/K equals zero
(b) When death rate is greater than birth rate
(c) When N/K is exactly one
(d) When N nears the carrying capacity of the habitat
8. Match column I with column II and select the correct answer from the given codes.
Column I Column II
A. Ganga action plan (i) N2 fixing cyanobacterium
B. Bt-cotton (ii) Ministry of environment and forests
C. Rhizobium (iii) Insect resistant plant
D. Nostoc (iv) N2 fixing bacterium
(a) A- (ii), B-(iii), C-(iv), D-(i) (b) A-(iii), B-(ii), C-(iv), D-(i)
(c) A-(ii), B-(iv), C-(iii), D-(i) (d) A-(i), B-(iii), C-(ii), D-(iv)
9. Transplantation of tissues/organs to save certain patients often fails due to rejection of such tissues/organs by the
patient. Which type of immune response is responsible for such rejections?
(a) Auto-immune response
(b) Humoral immune response
(c) Physiological immune response
(d) Cell-mediated immune response
10. The substance given to cancer patients in order to activate their immune system and destroy the tumor is
(a) histamine (b) interleukin
(c) α -interferon (d) morphine
11. Match the following sexually transmitted diseases (column I) with their causative agent (column II) and select
the correct option.
Column I Column II
A. Gonorrhoea (i) HIV
B. Syphilis (ii) Neisseria
C. Genital warts (iii) Treponema
D. AIDS (iv) Human papilloma virus
(a) A-(iv), B-(i), C-(ii), D(iii) (b) A-(iii), B-(iv), C-(i), D(ii)
(c) A-(i), B-(ii), C-(iii), D(iv) (d) A-(ii), B-(iii), C-(iv), D(i)
12. The basic procedure involved in the synthesis of recombinant DNA molecule is depicted below. The mistake in
the procedure is
(a) enzyme polymerase is not included (b) the mammalian DNA is shown double stranded
(c) two different restriction enzymes are used (d) only one fragment is inserted
13. Assertion : Plant-animal interactions do not generally involve co-evolution of the mutualist organisms.
Reason : Evolution of the plants and animals go side by side.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
14. Assertion : In Cocos nucifera, coconut water represents the cellular endosperm and the surrounding white kernel
represents the free-nuclear endosperm.
Reason : Endosperm persist in some mature seeds.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Assertion : The first clinical gene for ADA therapy was given to cure SCID.
Reason : The normal gene was delivered into the patient’s cells using retroviral vector.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Assertion : A geneticist crossed two plants and got 50% tall and 50% dwarf progenies.
Reason : This cross follows Mendelian law as one of the parent plant might be heterozygous.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. How are the desirable DNA sequences cut?
18. A student on a school picnic to a park on a windy day started sneezing and having difficulty in breathing on
reaching the park. The teacher enquired whether the student was allergic to something.
(a) What is an allergy?
(b) Write the two unique characteristics of the system involved in the response observed in the student.
19. Refer to the given figure of human female reproductive system and answer the following questions.
20. Identify the type of the given ecological pyramid and give one example of each pyramid of number and pyramid
of biomass showing such type.
O
(a) Draw a pyramid of numbers considering a big banyan tree supporting a population of insects, small birds
and their predators.
(b) Construct an ideal pyramid of energy when 1,000,000 joules of sunlight is available. Label all its trophic
levels.
21. A cross was carried out between two pea plants showing the contrasting traits of height of the plants. The result
of the cross showed 50% parental characters.
(a) Work out the cross with the help of a Punnett square.
SECTION - C
22. Explain three different modes of pollination that can occur in a chasmogamous flower.
23. Since the origin of life on earth, there were five episodes of mass extinction of species.
(a) How is the ‘Sixth extinction, presently in progress, different from the previous episodes?
(b) Who is mainly responsible for the ‘Sixth extinction’ ?
(c) List any four points that can help to overcome this disaster.
24. Given below is the diagram representing the observations made for separating DNA fragments by gel electrophoresis
technique. Observe the illustration and answer the questions that follow.
(a) Why are the DNA fragments seen to be moving in the direction A " B ?
(b) Write the medium used in which DNA fragments separate.
(c) Mention how the separated DNA fragments can be visualised for further technical use.
25. Construct and label a transcription unit from which the RNA segment given below has been transcribed. Write
the complete name of the enzyme that transcribed this RNA.
26. Name and explain the role of the inner and middle walls of the human uterus.
27. As we know that evolution occurs, when the genetic equilibrium is upset,
(a) List any four factors which affect genetic equilibrium.
(b) Describe Founder’s effect.
(c) What kind of evolution is shown by vertebrate brains?
O
Mention any two human diseases caused by roundworms alongwith their causative agents and their mode of
transmission into the human body.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD
level. The BOD levels of samples A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively.
O
(c) If number of offspring obtained in the above case is 847, then what will be the number of recombinants?
SECTION - E
31. (a) Study the following chart. Name the hormones involved at each stage. Explain their functions.
Hypothalamus
.
Pituitary
.
Testes
.
Sperms
(b) Explain with the help of schematic representation the process of formation of mature gamete in a human
female.
(c) How is spermatogenesis different from the process mentioned above? Explain.
O
Why is the process of fertilisation in a flowering plant referred to as double fertilisation?
(iii) Name the enzyme that can link these two DNA fragments.
(b) Why has a bacterium to first become ‘competent’ to be able to take up DNA? Explain how it become
‘competent’ and takes in the recombinant DNA.
O
Read the following base sequence of a certain DNA strand and answer the questions that follow:
G A A T T C
C T T A A G
33. During course of evolution why DNA was chosen over RNA as genetic material? Give reasons by first discussing
the desired criteria in a molecule that can act as genetic material and in the light of biochemical differences
between DNA and RNA.
O
Refer to the given double stranded DNA molecule.
3l - ATGCATGCATGCATGCATGCATGC - 5l
5l - TACGTACGTACGTACGTACGTACG - 3l
(a) What would be the template DNA strand, coding DNA strand and transcribed mRNA sequence from this
strand?
(b) How is mRNA made from DNA? Which enzyme catalyses this reaction?
Sample Paper 8
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION-A
1. The polymerase enzyme used in PCR is
(a) DNA polymerase I (b) restriction endonuclease
(c) reverse transcriptase (d) Taq polymerase
8. Who proposed that the first form of life come from pre-existing non- living molecules?
(a) Darwin and Lamarck (b) de Vries and Sturtevant
(c) Oparin and Haldane (d) Louis Pasteur and Miller
9. The figure below is the diagrammatic representation of the E.Coli vector pBR 322. Which one of the given options
correctly identifies its certain component (s)?
14. Assertion: Hybrid is formed by cross between two organisms that are different in one or more traits.
Reason: Mendel crossed two plants differing in one trust to obtain F1 plants in monohybrid cross.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is False but R is true.
16. Assertion: Replication and transcription occur in the nucleus but translation takes place in the cytoplasm.
Reason: mRNA is transferred from the nucleus into cytoplasm where ribosomes and amino acids are available for
protein synthesis.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is False but R is true.
SECTION-B
17. State the role of ‘biolistic gun’ in biotechnology experiments. Microparticles of which elements are used in this
technique?
18. A region of a coding DNA strand has the following nucleotide sequence: -ATGC-
What shall be the nucleotide sequence in the following?
(i) Sister DNA segment it replicates.
(ii) m-RNA polynucleotide it transcribes.
19. Refer the figure of a part of seminiferous tubule showing different stages of sperm formation and answer the
questions.
20. Define the term ‘health’. Mention any two ways of maintaining it.
o
Microbes play a dual role when used for sewage treatment as they not only help to retrieve usable water but also
generate fuel. Write in points how this happens?
21. Cucurbits and papaya plants bear staminate and pistillate flowers. Mention the categories they are put under
separately on the basis of the type of flowers they bear.
SECTION-C
22. A large number of married couples in the world are childless. It is shocking to know that in India the female
partner is often blamed for the couple being childless.
(a) State any two reasons responsible for the cause of infertility in case of male and female.
(b) Suggest a technique that can help the couple to have a child where the problem is with male.
23. Name the organic materials exine and intine of an angiosperm pollen grains are made up of. Explain the role of
exine.
25. Study the diagram given below and answer the following questions.
(i) Why have DNA fragments in band D moved far away in comparison to those in band C?
(ii) Identify the anode end in the diagram.
(iii) How are these DNA fragments visualised.
26. Scientists have succeeded in recovering healthy sugarcane plants from a diseased one.
(i) Name the part of the plant used as explant by scientists.
(ii) Describe the procedure the scientists followed by recover the healthy parts.
(iii) Name the technology used for crop improvement.
27. (a) State the cause and symptoms of Down’s syndrome. Name and explain the event responsible for causing this
syndrome.
(b) Haemophilia and Thalassemia are both examples of Mendelian disorder, but show difference in their
inheritance pattern. Explain how.
28. Name the ancestors of man based on the features given below:
(i) Human like, meat-eater with 900 cc brain, lived in Java.
(ii) More human with brain size 1400 cc, lived in central Asia, used hides and buried their dead.
(iii) Human like, vegetarian, with brain capacity between 650 cc and 800 cc.
SECTION-D
29. Read the following and answer any four questions from 29(i) to 29(iv) given below:
Ex-Situ Conservation:
In this approach, threatened animals and plants are taken out from their natural habitat and placed in special
setting where they can be protected and given special care. Zoological parks, botanical gardens and wildlife
safari parks serve this purpose. There are many animals that have become extinct in the wild but continue to
be maintained in zoological parks. In recent years ex situ conservation has advanced beyond keeping threatened
species in enclosures.
Now gametes of threatened species can be preserved in viable and fertile condition for long periods using
cryopreservation techniques, eggs can be fertilised in vitro, and plants can be propagated using tissue culture
methods. Seeds of different genetic strains of commercially important plants can be kept for long periods in seed
banks.
Biodiversity knows no political boundaries and its conservation is therefore a collective responsibility of all nations.
The historic Convention on Biological Diversity (‘The Earth Summit’) held in Rio de Janeiro in 1992, called upon
all nations to take appropriate measures for conservation of biodiversity and sustainable utilisation of its benefits.
In a follow-up, the World Summit on Sustainable Development held in 2002 in Johannesburg, South Africa, 190
countries pledged their commitment to achieve by 2010, a significant reduction in the current rate of biodiversity
loss at global, regional and local levels.
(i) What was the outcome of the 1992 Earth Summit in Rio de Janeiro?
(ii) For endangered species, Ex-situ conservation is a method that is?
(iii) Which one of the following is related to ex-situ conservation of threatened animals and plants?
(iv) World summit on sustainable development of 2002 was held in?
30. Read the following and answer any four questions from 30(i) to 30(iv) given below:
Microbes in commercial production of Chemicals, enzymes and Bioactive molecule:
Microbes are also used for commercial and industrial production of certain chemicals like organic acids, alcohols
and enzymes. Examples of acid producers are Aspergillus niger (a fungus) of citric acid, Acetobacter aceti (a
bacterium) of acetic acid; Clostridium butylicum (a bacterium) of butyric acid and Lactobacillus (a bacterium) of
lactic acid. Yeast (Saccharomyces cerevisiae) is used for commercial production of ethanol. Microbes are also used
for production of enzymes.
Lipases are used in detergent formulations and are helpful in removing oily stains from the laundry. You must have
noticed that bottled fruit juices bought from the market are clearer as compared to those made at home. This is
because the bottled juices are clarified by the use of pectinases and proteases.
Streptokinase produced by the bacterium Streptococcus and modified by genetic engineering is used as a ‘clot
buster’ for removing clots from the blood vessels of patients who have undergone myocardial infraction leading to
heart attack. Another bioactive molecule, cyclosporin A, that is used as an immunosuppressive agent in organ-
transplant patients, is produced by the fungus Trichoderma polysporum. Statins produced by the yeast Monascus
purpureus have been commercialised as blood-cholesterol lowering agents. It acts by competitively inhibiting the
enzyme responsible for synthesis of cholesterol.
(i) Which organisms has been Commercialised as blood cholesterol lowering agent?
(ii) Why bottled fruit juices bought from the market are clearer as compared to those made at home?
(iii) Identify a, b, c, d, e and fin the given table below
SECTION-E
31. (a) “X” part in the given diagram plays an important role in the formation of pollen grain wall. Identify “X”
and explain its role in the formation of pollen grain wall.
32. (a) Why are thalassemia and haemophilia categorized as Mendelian disorders ? Write the symptoms of these
diseases. Explain their pattern of inheritance in humans.
(b) Write the genotypes of the normal parents producing a haemophilic son.
o
Describe the experiment that helped demonstrate the semi-conservative mode of DNA replication.
******
Sample Paper 9
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Which of the following is incorrect regarding vasectomy?
(a) No sperm occurs in seminal fluid. (b) No sperm occurs in epididymis.
(c) Vasa deferentia is cut and tied. (d) Irreversible sterility
Column I Column II
A. Contraceptive pill (i) Prevents sperms reaching the female reproductive tract
3. The given figure is the diagrammatic representation of the E. coli vector pBR322. Which one of the given options
correctly identifies its certain component(s)?
5. Cuscuta is an example of
(a) ectoparasitism (b) brood parasitism
(c) predation (d) endoparasitism
6. Colostrum, the yellowish fluid, secreted by mother during the initial days of lactation is very essential to impart
immunity to the new born infants because it contains
(a) immunoglobulin A (b) natural killer cells
(c) monocytes (d) macrophages
8. The main reason why antibiotics could not always treat the bacteria-mediated diseases is
(a) insensitivity of the individual following prolonged exposure to antibiotics
(b) inactivation of antibiotics by bacterial enzymes
(c) decreased efficiency of immune system
(d) the development of mutant bacterial strains resistant to antibiotics.
9. Which one of the following animals may occupy more than one trophic levels in the same ecosystem at the same
time?
(a) Sparrow (b) Lion
(c) Goat (d) Frog
10. Replacement of the lighter-coloured variety of peppered moth (Biston betularia) to its darker variety (Biston
carbonaria) in England is the example of
(a) natural selection (b) regeneration
(c) genetic isolation (d) temporal isolation
11. The birth and death rates of four countries are given below. Which one will have the least population growth rate?
12. Tiger is not a resident in which one of the following national parks?
(a) Sunderbans (b) Gir
(c) Jim Corbett (d) Ranthambore
13. Assertion : In plants, apomixis is a form of asexual reproduction that mimics sexual reproduction.
Reason : Apomixis involves the production of seeds without the fusion of gametes.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Assertion : In Mirabilis jalapa the pink coloured flowers appear in F1 generation.
Reason : Pink colour is observed due complete suppression of white colour alleles in one of parental flowers by red
colour alleles.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Assertion : Tropical regions have got a long evolutionary time for species diversification as compared to temperate
regions.
Reason : Temperate regions have undergone frequent glaciations in the past whereas tropical regions have remained
relatively undisturbed for millions of years.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. List any four characteristics of an ideal contraceptive.
O
A woman decides to take contraceptive pills. What do contraceptive pills contain and how do they act as
contraceptives?
18. Enumerate four most common warning signs of drug and alcohol abuse amongst the youth.
SECTION - C
22. Linkage and crossing over of genes are alternative of each other. Justify with the help of an example.
23. (a) Expand VNTR and describe its role in DNA fingerprinting.
(b) List any two applications of DNA fingerprinting technique.
26. “Prevention is better than cure” is an apt slogan to safeguard adolescents from drug abuse. List any 6 steps that
could be taken in this regard.
O
Double fertilisation is reported in plants of both castor and groundnut. However, the mature seeds of groundnut
are non-albuminous and castor are albuminous. Explain the post fertilisation events that are responsible for it.
28. Differentiate between two different types of pyramids of biomass with the help of one example of each.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Natural selection can influence distribution of phenotype in three different ways as shown below in the figure. On
the basis of this figure answer the questions that follow.
(a) On the basis of the given graphs, what conclusion can you draw about case X and Y?
(b) What is the significance of higher and narrower peak in case X?
(c) What does graph in case Y indicates? Give suitable example.
O
30. The graphs below show the result of blood tests of a person X during illness (Graph I) and after recovering (Graph
II).
(a) With reference to the above graphs, what will you inferred about the disease in a person X?
(b) What would be the possible explanation with regards to no change in antibody type P and R in both the
graphs I and II.?
(c) Which antibody type among P, Q and R confirms that the person X is suffered from infection and how?
O
(c) If person X has contracted with an allergen, then which type of antibody will be produced in his body?
SECTION - E
31. (a) Explain the following phases in the menstrual cycle of a human female :
(i) Menstrual phase
(ii) Follicular phase
(iii) Luteal phase
(b) A proper understanding of menstrual cycle can help immensely in family planning. Do you agree with the
statement? Provide reasons for your answer.
O
When does oogenesis start in humans? Name the three hormones and their role in oogenesis. Explain different
phases of oogenesis in human female.
32. (a) Why are certain cotton plants called Bt-cotton plants?
(b) Why does Bt toxin not kill the bacterium that produces it but kill the insect that ingests it?
O
(a) What is biopiracy? Explain its significance with example.
(b) State the initiative taken by Indian Parliament against biopiracy.
33. Describe the process of synthesis of fully functional mRNA in a eukaryotic cell.
O
Explain the process of translation.
Sample Paper 10
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION-A
1. ABO blood group system is due to
(a) multiple allelism (b) incomplete dominance
2. According to size of air pollutants, range and types of chemical the device given below is best used to control
which of the following pollutants?
(d) There is no variation and the offsprings have the same phenotype and genotype.
6. DNA replication is
(a) semiconservative and discontinuous
(d) conservative
8. The site of origin of the new plantlets in potato, dahlia, ginger and banana is
(a) nodes of modified stem. (b) internodes of modified stem.
(c) floral buds present on stem. (d) adventitious buds present on root.
9. The linking of antibiotic resistance gene with the plasmid vector became possible with
(a) DNA polymerase (b) endonucleases
11. The kangaroo rats of North American deserts do not need to drink water because
(a) they are able to concentrate urine, to minimize water loss.
(b) they meet their water requirement through internal fat oxidation when the water is a byproduct.
12. Refer the given figure of nucleosome and select the option that correctly identifies the parts A, B and C.
A B C
(a) DNA Histone octamer H1 histone
(b) Histone octamer H1 histone DNA
(c) Histone octamer DNA H1 histone
(d) DNA H1 histone Octamer
(b) Both A and R are true and R is not the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
SECTION-B
17. Write about the importance of family planning programme in India ?
18. Why are angiosperm anthers called dithecous? Describe the structure of microsporangium and draw a well labelled
diagram.
19. What is meant by transgenic animal? List any four areas in which transgenic animals have wide applications.
20. Make a list of any three outbreeding devices that flowering plants have developed and explain how they help to
encourage cross-pollination.
21. Sex determination is based on particular chromosomes in both birds and humans. State two points of difference
between their mechanisms of sex determination.
SECTION-C
22. Study the figure given below and answer the questions.
23. Name a disorder, give the karyotype and write the symptoms where a human male suffers as a result of an
additional X-chromosome.
24. “Stability of a community depends on its species richness.” Write how did David Tilman show this experimentally.
25. (a) A mixture of fragmented DNA was electrophoresed in an agarose gel. After staining the gel with ethidium
bromide, no DNA bands were observed. What could be the reason?
(b) Do eukaryotic cells have restriction endonucleases? Justify your answer.
26. Explain adaptive radiation and convergent evolution by taking example of some of Australian marsupials and
Australian placental mammals.
o
Australian Marsupials and placental mammals are suitable examples of adaptive radiation and convergent
evolution. Explain giving reasons.
27. (i) Write the scientific name of most common species of honeybee reared.
(ii) Mention the kind of areas that are suitable for bee keeping practices.
(iii) Mention any two uses of bee-wax.
28. (i) Explain the events taking place at the time of fertilisation of an ovum in a human female.
(ii) Trace the development of the zygote up to its implantation in the uterus.
(iii) Name and draw a labelled sectional view of the embryonic stage that gets implanted.
SECTION-D
29. Read the following and answer any four questions from 29(i) to 29(iv) given below :
Events of Menstrual Cycle:
The major events of the menstrual cycle are as follows as the cycle starts with the menstrual phase, when
menstrual flow occurs and it lasts for 3-5 days. The menstrual flow results due to breakdown of endometrial lining
of the uterus and its blood vessels which forms liquid that comes out through vagina. Menstruation only occurs if
the released ouvm is not fertilised. Lack of menstruation may be indicative of pregnancy. However, it may also be
caused due to some other underlying causes like stress, poor health etc. The menstrual phase is followed by the
follicular phase.
During this phase, the primary follicles in the ovary grow to become a fully mature Graafian follicle and
simultaneously the endometrium of uterus regenerates through proliferation. These changes in the ovary and the
uterus are induced by changes in the levels of pituitary and ovarian hormones. The secretion of gonadotropins (LH
and FSH) increases gradually during the follicular phase, and stimulates follicular development as well as secretion
of estrogens by the growing follicles. Both LH and FSH attain a peak level in the middle of cycle (about 14th
day). Rapid secretion of LH leading to its maximum level during the mid-cycle called LH surge induces rupture of
Graafian follicle and thereby the release of ovum (ovulation). The ovulation (ovulatory phase) is followed by the
luteal phase during which the remaining parts of the Graafian follicle transform as the corpus luteum.
The corpus luteum secretes large amounts of progesterone which is essential for maintenance of the endometrium.
Such an endometrium is necessary for implantation of the fertilised ovum and other events of pregnancy. During
pregnanacy, all events of the menstrual cycle stop and there is no menstruation. In the absence of fertilisation,
the corpus luteum degenerates. This causes disintegration of the endometrium leading to menstruation, marking
a new cycle. In human beings, menstrual cycles cease around 50 years of age; that is termed as menopause. Cyclic
menstruation is an indicator of normal reproductive phase and extends between menarche and menopause.
(i) What causes menstrual flow?
(ii) Why secretory phase is also known as luteal phase?
(iii) What happen if LH secreted rapidly?
(iv) Which of the hormone has no role in menstruation?
30. Read the following and answer any four questions from 30(i) to 30(iv) given below:
Bt Cotton:
Some strains of Bacillus thuringiensis produce proteins that kill certain insects such as lepidopterans (tobacco
budworm, armyworm), coleopterans (beetles) and dipterans (flies, mosquitoes). B. thuringiensis forms protein
crystals during a particular phase of their growth. These crystals contain a toxic insecticidal protein. Why does
this toxin not kill the Bacillus. Actually, the Bt toxin protein exist as inactive protoxins but once an insect ingest
the inactive toxin, it is converted into an active form of toxin due to the alkaline pH of the gut which solubilise
the crystals. The activated toxin binds to the surface of midgut epithelial cells and creates pores that cause cell
swelling and lysis and eventually cause death of the insect. Specific Bt toxin genes were isolated from Bacillus
thuringiensis and incorporated into the several crop plants such as cotton (Figure 12.1). The choice of genes
depends upon the crop and the targeted pest, as most Bt toxins are insect-group specific. The toxin is coded by a
gene named cry. There are a number of them, for example, the proteins encoded by the genes cryIAc and cryIIAb
control the cotton bollworms that of cryIAb control corn borer.
(i) What is role of cry II Ab and cry I Ab?
(ii) Specific Bt toxin gene was isolated from which organism?
(iii) Name the gene that encodes for Bt protein specific to cotton bollworm?
(iv) Consider the following statements (A-D) about organic farming
(A) utilizes genetically modified crops like Bt cotton
(B) uses only naturally produced inputs like compost
(C) does not use pesticides and urea
(D) produces vegetables rich in vitamins and minerals.
Which of the above statements are correct?
(a) B, C and D
(b) C and D only
(c) B and C only
(d) A and B only
SECTION-E
31. Mr. Oberoi angrily says to his daughter not to marry Mohan since their family is known to inherit haemophilia.
The daughter objected to her father’s order. Mr. Oberoi was adamant and threatened also. Brijmohan’s daughter
explained the biological interpretation of his fear and convinced her father.
(a) Briefly discuss the inheritance pattern of haemophilia.
(b) Mohan was not haemophilic though his father is haemophilic. Explain the condition of Mohan by considering
following three conditions of his mother:
(i) Normal mother
(ii) Carrier mother
(iii) Haemophilic mother
(c) Is there any fear of haemophilia if Mr. Oberoi daughter marries Mohan (non-haemophilic)?
o
How Hershey and Chase proved that DNA is the genetic material?
32. Briefly explain the lifecycle of plasmodium. What measures would you take to control malaria?
o
(a) What measures do you suggest for prevention and control of alcohol and drug abuse among adolescents?
(b) The outline structure of a drug is given below.
(i) Which group of drugs does this represent? Name the plant from which it is obtained.
(ii) What are the modes of consumption of these drugs?
(iii) Name the organ of the body which is affected by consumption of these drugs.
33. Mention the factors which cause changes in the size of population of a species.
o
(a) State how ex-situ conservation helps in protecting biodiversity. Name four types of ex-situ methods.
(b) Explain the importance of sacred groves.
******
Sample Paper 11
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Percentage of photosynthetically active radiation (PAR) in the incident solar radiation is
3. During the life cycle of Plasmodium, sexual reproduction takes place in which of the following hosts?
5. A foreign DNA and plasmid cut by the same restriction endonuclease can be joined to form a recombinant plasmid
using
(a) EcoR I (b) Taq polymerase
6. In fruit flies, long wing is dominant to vestigial wing. When heterozygous long-winged flies were crossed with
vestigial-winged flies, 192 offsprings were produced. If an exact Mendelian ratio had been obtained, then the
number of each phenotype would have been
Long-winged Vestigial-winged
(a) 64 128
(b) 96 96
(c) 128 64
(d) 192 0
7. If the energy produced at the level of the producers is 1000 J, the energy available for the secondary consumers is
(a) 1000 J (b) 100 J
(c) 10 J (d) 1 J
8. Embryo with more than 16 blastomeres formed due to in vitro fertilisation is transferred into
(a) uterus (b) fallopian tube
(c) fimbriae (d) cervix.
9. A population has more young individuals compared to the older individuals. What would be the status of the
population after some years?
(a) It will decline. (b) It will stabilise.
(c) It will increase. (d) It will first decline and then stabilise.
10. Identify the blank spaces A, B, C and D in the given table and select the correct option.
Fungus A Cyclosporin A B
C Monascus Purpureus Statin D
(a) A-Trichoderma polysporum, B-As an immunosuppressive agent, C-Yeast (Fungus), D-Lowering of blood
cholesterol
(b) A-Trichoderma polysporum, B-Lowering of blood cholesterol, C-Yeast (Fungus), D-As an immunosuppressive
agent
(c) A-Penicillium notatum, B-Lowering of blood cholesterol, C-Bacteria, D-As an immunosuppressive agent
(d) A-Streptococcus, B-As an immunosuppressive agent, C-Bacterium, D-Lowering of blood cholesterol
11. Study the given figure carefully and select the incorrect statements regarding this.
(i) It represents a typical agarose gel electrophoresis in which lane 1 contains undigested DNA.
(ii) Smallest DNA bands are formed at A and largest DNA bands are formed at B.
(iii) The separated DNA fragments can be visualised after staining in the visible light.
(iv) The separated DNA bands are cut out from the agarose gel and extracted from the gel piece. This step is
known as elution.
(a) (i) and (ii) (b) (ii) and (iii)
(c) (ii) and (iv) (d) (i) and (iv)
12. When a natural predator (living organism) is applied on the other pathogen organisms to control them, this
process is called
(a) biological control (b) genetic engineering
(c) artificial control (d) confusion technique
14. Given below is the representation of the DNA fingerprinting depicting the amplified repeats separated by size using
gel electrophoresis. Study the given picture and comment upon the appropriateness of the Assertion and Reason.
15. Assertion : Only the pre-pollination growth of male gametophyte occurs inside the microsporangium whereas the
remaining growth occurs over the female reproductive organs.
Reason : Whole of the growth of female gametophyte occurs inside the megasporangium.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
Click the Following Button to See the Free MS/Solutions
Page 4 NODIA Sample Paper 11 CBSE Biology Class 12
16. Assertion : The regions outside the seminiferous tubules are called interstitial spaces, which contain Leydig’s cells.
Reason : Leydig’s cells synthesise and secrete testicular hormones called androgens.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Explain why it is scientifically incorrect to blame the mother for bearing female child.
18. Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved.
19. (a) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(b) Explain the basis on which he arrived at this conclusion.
21. (a) Mention the significant role of the thymus as a lymphoid organ.
(b) What kind of cells are released from thymus and how they help in immunity?
SECTION - C
22. Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology.
(b) Mention the difference in the synthesis based on the polarity of the two template strands.
24. Study the age pyramids ‘A, ‘B’ and ‘C’ of the human population given below and answer the questions that follow :
25. Differentiate between homology and analogy. Give one example of each.
26. Large quantities of sewage is generated everyday in cities and towns, which is treated in Sewage Treatment Plants
(STPs) to make it less polluted. Given below is the flow chart of one of the stages of STP.
Observe the given flow chart and answer the questions accordingly.
27. How is detritus decomposed step-by-step by different agents and made available as nutrients to the plants?
Explain.
O
(a) Describe the events during humification and mineralisation during decomposition in the soil.
(b) Enlist the conditions affecting the rate of decomposition.
28. With reference to the following schematic diagram of (a) Spermatogenesis and (b) Oogenesis, answer the following questions.
(a) About 300 million spermatozoa may be present in a human male ejaculation at one time. Calculate how
many primary spermatocytes will be involved to produce this number of spermatozoa.
(c) How many chromatids are found during oogenesis in primary oocyte and first polar body in a human
female?
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. The data below shows the concentration of nicotine smoked by a smoker taking 10 puffs/ minute.
(a) With reference to the above graph explain the concentration of nicotine in blood at 10 minutes.
(b) How will this affect the concentration of carbon monoxide and haembound oxygen at 10 minutes?
(c) How does cigarette smoking result in high blood pressure and increase in heart rate?
O
(c) How does cigarette smoking result in lung cancer and emphysema?
30. A geneticist crosses round yellow seeded pea plant to wrinkled green seeded pea plant and observed the inheritance
of both traits as per the following pattern. He collected total 1600 seeds in F2 generation.
(a) What would be the total number of seeds that are homogenous for yellow colour and heterogenous for round
seed shape?
(b) What phenotypic ratio would be obtained if the plants of F1 generation would be crossed with homogenous
wrinkled green seeded plant?
(c) How many seeds would be homogenous for wrinkled yellow and wrinkled green?
O
(c) Explain the “law of independent assortment” according to the given dihybrid cross.
SECTION - E
31. Refer to the given diagram that shows the human male reproductive system (one side only).
(a) Draw a sectional view of human ovary and label the following parts:
(i) Primary follicle
(ii) Secondary oocyte
(iii) Graafian follicle
(iv) Corpus luteum
(b) Name the hormones influencing follicular development of corpus luteum.
(a) How do the observations made during moth collection in pre- and post-industrialised era in England support
evolution by natural selection?
(b) Explain the phenomenon that is well represented by Darwin’s finches other than natural selection.
33. Describe the role of heat, primers and the bacterium Therm us aquaticus in the process of PCR.
O
Why is a recombinant protein so called? How can it be harvested on a large scale? Write two precautions to
maintain a higher yield.
Sample Paper 12
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION-A
1. Egg apparatus consists of
(a) egg cell and two synergids. (b) egg cell and central cell.
(c) egg cell and antipodal cells. (d) egg cell and one synergid.
4. The given figures (A, B and C) are types of gametes of different organisms. Identify gametes (A, B and C)
respectively.
6. The feature of some structures of male reproductive system is given below. Identify the structure on the basis of
the characteristics which surrounds the primary sex organ of male reproductive system.
(a) It is responsible for maintaining the low temperature by about 2 - 2.5° C from normal body temperature to
mature sperm.
(b) It travels through the penis and carry semen as well as urine.
7. Which of the following crosses will give tall and dwarf pea plants in same proportions?
(a) TT × tt (b) tt × tt
(c) TT × Tt (d) Tt × tt
10. Dark coloured Peppered Moth is able to survive in industrial areas as compared to light coloured form because of
(a) Natural selection in smoky environment
(b) Mimicry
11. The given figures show the members of fungi and simple plants such as algae which undergo asexual reproduction.
Identify the correct asexual reproductive structures found in the members A, B, C and D.
12. Person having genotype IA IB would show the blood group as AB. This is because of
(a) Pleiotropy
(c) segregation
(d) Codominance
(b) Both A and R are true and R is not the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
16. Assertion: Jave Ape man, Peking man and Heidelberg man are the fossils of Homo erectus.
Reason: Homo erectus evolved from Homo habilis.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
SECTION-B
17. How is genetic engineering used in molecular diagnosis of disease ?
18. What does S-shaped pattern of population growth represent ? How is J-shaped pattern different from it and why ?
19. In humans, insulin is synthesised as a pro-hormone that needs to be processed before it becomes a fully mature and
functional hormone. How is this challenge for production of insulin using rDNA techniques overcome for getting
insulin assembled into a mature form? Explain the steps using flow chart.
20. In the adjacent figure of a typical dicot embryo, label the parts (1), (2) and (3). State the function of each of the
labelled part.
21. What do you mean by gametogenesis ? Describe the structure of a human sperm.
SECTION-C
22. Gregor Mendel conducted hybridisation experiments on garden peas and proposed the laws of inheritance in living
organisms. For his experiments, Mendel
(A) conducted artificial pollination experiments using several true-breeding pea lines which were similar except
for one character with contrasting traits.
(B) applied statistical analysis and mathematical logic to problems in biology
(a) What are true-breeding lines? Explain with the help of an example.
(b) Why did Mendel use true-breeding lines for his hybridisation experiments?
(c) Name one mathematical logic used by Mendel. Which other method can be used for the same?
23. A person is suffering from ringworm disease. Mention the pathogen. Give the symptoms of the disease along with
the mode of transmission.
24.
Observe the diagram of gel electrophoresis and answer the questions which follow:
(a) Name the substance used as a medium/matrix in gel electrophoresis along with its source.
(b) Why does DNA move towards the anode in gel electrophoresis?
(c) How one can observe DNA in the gel after electrophoresis?
25. A decade ago, there was abundance of Abingdon tortoise in Galapagos Island but now this species has become
extinct?
(a) Why have they become extinct?
(b) What can you say about such a relation?
o
Name and describe different hierarchial levels of biological diversity
26. The diagram below shows embryo sac after fertilisation. Observe it and answer the following questions.
(a) Give the names of the structures which develop from parts labelled as A and B in the above diagram.
(b) How is the structure developed from part ‘13’ different from perisperm?
(c) Meiocyte of onion has 16 chromosomes. What will be the number of chromosomes in the structures developing
from parts ‘A’ and `13’ ?
SECTION-D
29. Read the following and answer any four questions from 29(i) to 29 (iv) given below:
Sex Determination:
The cytological observations made in a number of insects led to the development of the concept of genetic/
chromosomal basis of sex-determination. Henking (1891) could trace a specific nuclear structure all through
spermatogenesis in a few insects, and it was also observed by him that 50 per cent of the sperm received this
structure after spermatogenesis, whereas the other 50 per cent sperm did not receive it. Henking gave a name to
this structure as the X body but he could not explain its significance. Further investigations by other scientists led
to the conclusion that the ‘X body’ of Henking was in fact a chromosome and that is why it was given the name
X-chromosome. It was also observed that in a large number of insects the mechanism of sex determination is of
the XO type, i.e., all eggs bear an additional X-chromosome besides the other chromosomes (autosomes). On the
other hand, some of the sperms bear the X-chromosome whereas some do not. Eggs ertilised by sperm having an
X-chromosome become females and, those fertilised by sperms that do not have an X-chromosome become males.
Grasshopper is an example of X0 type of sex determination in which the males have only one X-choromosome
besides the autosomes, whereas females have a pair of X-chromosomes. insects and mammals including man, XY
type of sex determination is seen where both male and female have same number of chromosomes.
Among the males an X-chromosome is present but its counterpart is distinctly smaller and called the Y-chromosome.
Females, however, have a pair of X-chromosomes. Both males and females bear same number of autosomes. Hence,
the males have autosomes plus XY, while female have autosomes plus XX. In human beings and in Drosophila
the males have one X and one Y chromosome, whereas females have a pair of X chromosomes besides autosomes.
males produce two different types of gametes, (a) either with or without X-chromosome or (b) some gametes with
X-chromosome and some with Y-chromosome. Such types of sex determination mechanism are designated to be
the example of male heterogamety. Organisms, e.g., birds a different mechanism of sex determination is observed.
In this case the total number of chromosome is same in both males and females. But two different types of gametes
in terms of the sex chromosomes are produced by females, i.e., female heterogamety. In order to have a distinction
with the mechanism of sex determination described earlier, the two different sex chromosomes of a female bird
has been designated to be the Z and W chromosomes. In these organisms the females have one Z and one W
chromosome, whereas males have a pair of Z-chromosomes besides the autosomes.
(i) Organism that have XO type of sex-determination?
(ii) What factors determines a human child’s sex?
(iii) Which type of sex chromosome found in female bird?
(iv) Name the gametes produces by males?
30. Read the following and answer any four questions from 30(i) to 30 (iv) given below:
Acquired immunity and Graft Rejection:
Acquired immunity, on the other hand, is pathogen specific. It is characterised by memory. This means that our
body when it encounters a pathogen for the first time produces a response called primary response which is of
low intensity. Subsequent encounter with the same pathogen elicits a highly intensified secondary or anamnestic
response. This is ascribed to the fact that our body appears to have memory of the first encounter. The primary
and secondary immune responses are carried out with the help of two special types of lymphocytes present in
our blood, i.e., B-lymphocytes and T- lymphocytes.The B-lymphocytes produce an army of proteins in response
to pathogens into our blood to fight with them. These proteins are called antibodies. The T-cells themselves do
not secrete antibodies but help B cells produce them. Each antibody molecule has four peptide chains, two small
called light chains and two longer called heavy chains. Hence, an antibody is represented as H2L2. Different types
of antibodies are produced in our body. IgA, IgM, IgE, IgG are some of them.
Because these antibodies are found in the blood, the response is also called as humoral immune response. This
is one of the two types of our acquired immune response - antibody mediated. The second type is called cell-
mediated immune response or cell-mediated immunity (CMI). The T-lymphocytes mediate CMI. Grafts from just
any source - an animal, another primate, or any human beings cannot be made since the grafts would be rejected
sooner or later. Tissue matching, blood group matching are essential before undertaking any graft/transplant and
even after this the patient has to take immuno-suppresants all his/her life. The body is able to differentiate ‘self’
and ‘nonself and the cell-mediated immune response is responsible for the graft rejection.
(i) What type of response mediated by antibodies?
(ii) Which cell is responsible for cell mediated immunity?
(iii) Which molecules are most responsible for rejection of transplant?
(iv) Which immunoglobulin does constitute the largest percentage in human milk?
SECTION-E
31. (a) Bacillus thuringiensis acts as a microbial biocontrol agent for protecting Brassica and fruit trees from
butterfly caterpillers. Explain.
(b) (i) List the components of biogas.
(ii) How can the activated sludge be used as a source of biogas?
32. Many plant and animal species are on the verge of their extinction because of loss of forest land by indiscriminate
use by the humans.
(a) Why there is a need to conserve biodiversity?
(b) Mention a method that you would suggest to protect such threatened species from getting extinct.
(c) Alien species are highly invasive and are a threat to indigenous species. Substantiate this statement with
any two examples.
o
Refer the table given below and answer the following questions.
Table : Types of Interaction
33. DNA is a hydrophilic molecule so it cannot pass through cell membranes. In order to force host bacteria to take
up the plasmid, the bacterial cells must first be made ‘competent’. How are bacterial cells made competent?
Summarise the steps that are performed to introduce alien DNA into competent bacterial cells? How can alien
DNA be introduced into plant and animal host cells?
o
Given below is the schematic diagram of a cloning vector pBR322. Observe the diagram and answer the following
questions.
(a) Write the term for segment C of the vector. Why is it important?
(b) Segments A and B of the vector have restriction sites for many endonucleases, each of which is represented
by letters followed by Roman numeral. Explain the naming of any one restriction enzyme.
(c) A foreign DNA has been inserted in the segment B. How one can identify E. coli cells with recombinant
plasmids from cells with no plasmid or with non-recombinant plasmids?
******
Sample Paper 13
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Which of the following approaches does not give the defined action of contraceptive?
(a) Hormonal contraceptives - Prevent/retard entry of sperms, prevent ovulation and fertilisation
(b) Vasectomy - Prevents spermatogenesis
(c) Barrier methods - Prevent physical meeting of ovum and sperms
(d) Intrauterine devices - Increase phagocytosis of sperms, suppress sperm motility and fertilising capacity of
sperms
2. Biogas is produced by (i) breakdown of biomass with the help of (ii) bacteria.
(i) (ii)
(a) anaerobic Methanococcus
(b) aerobic Rhizobium
(c) anaerobic Rhizobium
(d) aerobic Methanobacterium
3. On the rocky sea coasts of Scotland, the larger and competitively superior barnacle Balanus dominates the
intertidal area and excludes the smaller barnacle Chathamalus from that zone.
Which kind of interaction is being depicted by this example?
(a) Predation (b) Parasitism
(c) Mutualism (d) Competition
4. Viral DNA after being converted from viral RNA by X, incorporates into host genome to undergo replication.
What is ‘X’ ?
(a) DNA polymerase
(b) Restriction endonuclease
(c) RNA polymerase
(d) Reverse transcriptase
5. In a grassland ecosystem, if the number of primary producers (plants) is approximately 6 million, the number of
top carnivores, which may be supported by them will be
(a) 3 million
(b) 30 million
(c) 6 million
(d) 60 million
9. Elderly people are advised to get influenza (flu) vaccinations every year. Each year, a different type of flu vaccine
has to be made. This is because
(a) different viruses attack people of different ages, so each year as the population ages, a new vaccine must be
produced
(b) vaccines are unstable and cannot be stored for more than one year
(c) the body learns to destroy the antibodies made against the vaccine, so a new type of vaccine is needed for
each vaccination
(d) flu viruses change their genetic constituents so rapidly that vaccines against them rapidly become obsolete.
10. The population of an insect species shows an explosive increase in numbers during rainy season followed by its
disappearance at the end of the season. What does this show?
(a) The food plants mature and die at the end of the rainy season.
(b) Its population growth curve is of J-type.
(c) The population of its predators increases enormously.
(d) S-shaped or sigmoid growth of this insect.
11. Which one of these is not included in the biodiversity hotspots of India?
(a) Western Ghats
(b) Himalayas
(c) Indo-Burma
(d) North Indian Plains
12. Observe the diagram of pBR322 and select the incorrect statement.
13. Assertion : Elimination of a competitively inferior species in a closely related or otherwise similar group is known
as competitive exclusion principle.
Reason : If two species compete for the same resource, they could avoid competition by choosing different times
for feeding or different foraging patterns.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
14. Assertion : Mouse is the most preferred mammal for studies on gene transfers.
Reason : Mouse possesses features like short oestrous cycle and gestation period, relatively short generation time,
production of several offspring per pregnancy, etc.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Assertion : Pairing and separation of pair of chromosomes would lead to segregation of a pair of factors they
carried.
Reason : Two alleles of a gene pair are located on similar sites of non-homologous chromosomes.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Some of the microbes used as biofertilisers are prokaryotes. Name the taxonomic group they come under. With
the help of an example, mention how they act as biofertilisers.
18. Why is Taq polymerase preferred in PCR? Mention the source of this enzyme?
19. The given figure shows karyotype of a child who is suffering from a sex chromosomal abnormality which occurs
during failure of segregation of chromatids during cell division cycle. This results in the gain or loss of a chromosome
(s), called aneuploidy. Study the figure and answer the questions that follow :
(a) Identify the disease from the given karyotype.
(b) Write the chromosomal complement of the child.
20. Name the stage of the human embryo that gets implanted in the uterus and draw its labelled diagram.
21. Write two differences between Homo erectus and Homo habilis.
SECTION - C
22. Differentiate between the genetic codes given below :
(a) Unambiguous and Universal
(b) Degenerate and Initiator
25. “In a food chain, a trophic level represents a functional level, not a species”. Explain.
O
(a) What is primary productivity? Why does it vary in different types of ecosystems?
(b) State the relationship between gross and net primary productiviy.
26. Study the given picture of biogas plant and answer the following questions:
(a) Name the components gaining entry from A into the chamber.
(b) Mention the group of bacteria and the condition in which they act on the component that entered from A
in the digester.
(c) Name the components that get collected in gas holder.
27. Medically it is advised to all young mothers that breast feeding is the best for their newborn babies. Do you agree?
Give reasons in support of your answer.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Human evolution is a lengthy evolutionary process within the history of primates. The stages given here show the
order of evolutionary history of man.
30. In the given flow chart, the replication of retrovirus in a host is shown. Observe and answer the following questions.
O
(c) Name the disease which is caused by a retrovirus. How this virus gets transmitted?
SECTION - E
31. Blood samples from a crime scene was collected and DNA analysis for the same was done. Given below are the
marker profiles collected at the crime scene of the victim and a suspect.
(a) Select the homologous structures from the combinations given below :
(i) Forelimbs of whales and bats
(ii) Tuber of potato and sweet potato
(iii) Eyes of octopus and mammals
(iv) Thorns of Bougainvillea and tendrils of Cucurbita.
(b) State the kind of evolution represent by the homologous structures.
(c) What are analogous structures? How are they different from homologous structures? Provide one example
for each.
32. Describe the various stages involved in the commercial production of human insulin by Eli Lilly.
O
Explain the application of biotechnology in producing Bt cotton.
33. (a) The given diagram shows a part of the human female reproductive system.
(i) Name the gamete cells that would be present in ‘X’ if taken from a newborn baby.
(ii) Name ‘Y’ and write its function.
(iii) Name ‘Z’ and write the events that take place here.
Continue on next page....
(b) Name the muscular and the glandular layers of human uterus. Which one of these layers undergoes cyclic
changes during menstrual cycle? Name the hormone essential for the maintenance of this layer.
O
(a) Refer to the given figure and answer the following questions :
(i) Identify the labelled parts X and Y.
(ii) Write the role of X and Y.
(iii) Draw labelled prior stage of the given figure.
(b) Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells
involved.
******
Sample Paper 14
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Match column I with column II and select the correct option from the codes given below.
Column I Column II
A. Statins (i) Methanobacterium
B. Biogas (ii) Saccharomyces cerevisiae
C. Ethanol production (iii) Monascus purpureus
D. Converts milk to curd (iv) Lactobacillus
3. Which of the following factors has a negative effect on the population growth rate?
(a) Emigration (b) Immigration
(c) (ii), (iii) and (iv) (d) (i), (ii), (iii) and (iv)
7. If a recombinant DNA bearing gene for resistance to antibiotic ampicillin is transferred to E.coli cells, the host
cells become transformed into ampicillin resistant cells. If such bacteria are transferred on agar plates containing
ampicillin, only transformants will gmw and the untransformed recipient cells will die. The ampicillin resistant
gene in this case is called as
(a) selectable marker (b) recombinant protein
10. Match column I with column II and select the correct option from the codes given below.
Column I Column II
A. Mutation (i) Change in allele frequency in a population due to chance alone
B. Gene flow (ii) Differences in survival and reproduction among variant individuals
C. Natural selection (iii) Immigration, emigration change allele frequencies
D. Genetic drift (iv) Random and directionless
(a) A-(i), B-(ii), C-(iii), D-(iv) (b) A-(iv), B-(ii), C-(iii), D-(i)
(c) A-(iii), B-(i), C-(iv), D-(ii) (d) A-(iv), B-(iii), C-(ii), D-(i)
(d) dt = tN b K l
dN = b K − N l dN K−N
(c) dt rN N
12. The given flow chart depicts the steps to transfer a desirable gene of interest into a plant.
Isolation of desirable gene using restriction endonucleases and gel electrophoresis
Identify the missing steps (A, B and C) with regard to following statements and select the correct option.
(i) Joining of desirable gene to a suitable cloning vector using ligases to create a recombinant DNA molecule.
(ii) Selection of transformed cells.
(iii) Transferring the recombinant DNA molecules to the target cells.
A B C
(a) (i) (ii) (iii) (b) (i) (iii) (ii)
13. Assertion : Tropical regions have got a long evolutionary time for species diversification as compared to temperate
regions.
Reason : Temperate regions have undergone frequent glaciations in the past whereas tropical regions have remained
relatively undisturbed for millions of years.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
(b) Both A and R are true and R is not the correct explanation of A.
15. Assertion : Water constitutes a major mode of pollination in most of the aquatic angiospermous plants.
Reason : Vallisneria and Zostera are examples of water pollinated plants.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Given below is the monohybrid cross. It depicts the cross between the red flower and white flower colour in the
Antirrhinum sp. Study this monohybrid cross and comment upon the appropriateness of the Assertion and Reason.
(b) Both A and R are true and R is not the correct explanation of A.
SECTION - B
17. Principle of vaccination is based on the property of “memory” of the immune system. Taking one suitable
example, justify the statement.
18. Why is making cells competent essential for biotechnology experiments? List any two ways by which this can be
achieved.
19. Draw a diagram of the structure of a human ovum surrounded by corona radiata. Label the following parts :
(i) Ovum
(ii) Plasma membrane
(iii) Zona pellucida
20. Study the graph given below and answer the questions that follows:
rN & K 0
dN = K−N
dt
What does ‘K’ stand for in this equation? Mention its significance.
O
Which curve represent the human population growth at present? Do you think such a curve is sustainable? Give
reason in support of your answer.
21. Given figure shows karyotype of a child who is suffering from a sex chromosomal abnormality which occurs during
failure of segregation of chromatids during cell division cycle. This results in the gain or loss of a chromosome (s),
called aneuploidy.
SECTION - C
22. The following figure shows a fetus within the uterus. On the basis of the given figure, answer the questions that
follow:
(c) Identify A.
23. (a) Explain the cause responsible in a human to have sex chromosomes as XXY instead of ‘XX’ or ‘XY’.
(b) List any two ways such individuals are different from the normal being.
26. Mention any six differences between active immunity and passive immunity.
28. Taking one example each of habitat loss and fragmentation, explain how are the two responsible for biodiversity
loss.
O
Several factors possess threats to indigenous species of a particular area. Introduction of alien species is one such
threat. Justify it with few examples.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Study the two cases carefully regarding the pattern of inheritance of disease.
(c) If inheritance pattern of disease is as case II and both parents are carrier of disease then what are the
chances of pregnancy resulting in an affected child?
O
(c) The possibility of a human female suffering from a hemophilia disease is rare. Why is it so?
30. Refer to the given figure of antibody and answer the following questions.
O
SECTION - E
31. According to Chargaff, almost all DNA-no matter what organism or tissue type it comes from maintains certain
properties, even as its composition varies. In particular, the amount of adenine (A) is usually similar to the
amount of thymine (T) and the amount of guanine (G) usually approximates the amount of cytosine (C).
(i) A sample of DNA having 5375 nucleotides was analysed, out of which the propagation of different bases were
: Adenine = 33%, Guanine 18%, Cytosine = 33%, Thymine = 17%. What can be concluded from this data?
(ii) If one strand of DNA has the following percentage.
A = 26%, T = 23%, C = 24%, G = 27%
What percentage will be found in the complementary strand?
(iii) If a sample of DNA has a cytosine content of 26%, what proportion of thymine do you expect?
O
Pea seeds with BB alleles have round seeds and large starch grains, while seeds with bb alleles have wrinkled
seeds with small starch grains. Work out the cross between these two parents. Explain the phenotypic ratio of the
progeny with respect to seed shape and the starch grain size of the progeny produced.
32. Can you think and answer how a reporter enzyme can be used to monitor transformation of host cells by foreign
DNA in addition to a selectable marker?
O
Explain the application of rDNA technology to produce insulin with diagram. Explain the difference between
humulin and insulin produced by rRNA technology.
33. Refer to the following diagram and answer the following questions:
O
Given below is an enlarged view of one microsporangium of a mature anther.
******
Sample Paper 15
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Along with nicotine, cigarette smokers also have the intake tars, phenols, hydrocarbons, arsenic and many other
chemicals. Which of the following is not an effect of smoking tobacco?
(a) Narrowing or hardening of blood vessels in the heart and brain
(c) A higher risk of cancer, including cancer of the lungs, mouth, larynx, bladder and kidneys
4. What does the shape of the given age pyramids reflects about the growth status of the related population?
5. In pBR322, tetracycline resistance gene (tetR) has recognition site for which of the following restriction endonuclease?
(a) Hind III (b) BamH I
(c) EcoR I (d) Pst I
7. The biomass available for consumption to heterotrophs and the rate of formation of new organic matter by
consumers are referred to as
(a) gross primary productivity and net primary productivity respectively
(b) net primary productivity and gross primary productivity respectively
(c) gross primary productivity and secondary productivity respectively
(d) net primary productivity and secondary productivity respectively.
8. Which of the following approaches does not give the defined action of contraceptive?
(a) Hormonal contraceptives Prevent/retard entry of sperms, prevent ovulation and fertilisation
(b) Vasectomy Prevents spermatogenesis
(c) Barrier methods Prevent fertilisation
(d) Intra uterine devices Increase phagocytosis of sperms, suppress sperm motility and fertilising
capacity of sperms
9. Refer to the given table of contrasting traits in pea plants studied by Mendel.
10. Study the following figures and identify the enzymes involved in steps I and II respectively.
(a) EcoR I and DNA ligase (b) Hind II and DNA ligase
12. Which of the following phenomena was experimentally proved by Meselson and Stahl?
(a) Transformation (b) Transduction
13. Assertion : Offsite collections can be used to restock depleted populations, reintroduce species in the wild and
restore degraded habitats.
Reason : In situ conservation refers to the conservation of endangered species in their natural habitats.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
14. Assertion : The introduction of Nile perch in lake Victoria caused cichlids to become extinct.
Reason : Nile perch is an indigenous species of East Africa.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
15. In the given diagram two plants of the same species depict different types of pollination indicated by the labellings
P1, P2 and P3. Study this diagram and comment upon the appropriateness of the Assertion and Reason.
16. Assertion : Biodiversity hotspots are the regions which possess low levels of species richness, high degree of
endemism and no loss to habitats.
Reason : Total number of biodiversity hotspots in the world is 34 with three of these hotspots found in India.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Write the relationship between productivity, gross primary productivity, net primary productivity and secondary
productivity.
O
State the difference between the first trophic levels of detritus food chain and grazing food chain.
18. Tallness of pea plant is a dominant trait, while dwarfness is the alternate recessive trait. When a pure-line tall is
crossed with pure-line dwarf, what fraction of tall plant in F2 shall be heterozygous? Give reasons.
19. Refer to the given figure and answer the following questions.
(i) Which of the labelled structures is a pre-birth structure and is not formed thereafter?
(ii) Which of the labelled structures responds to LH surge by rupturing?
20. A young boy when brought a pet dog home started to complaint of watery eyes and running nose. The symptoms
disappeared when the boy was kept away from the pet.
(a) Name the type of antibody and the chemicals responsible for such a response in the boy.
(b) Mention the name of any one drug that could be given to the boy for immediate relief from such a response.
21. State the functions of the following in the cloning vector pBR322 :
(a) ori (b) rop
SECTION - C
22. Explain the steps in the formation of an ovum from an oogonium in humans.
23. (a) Can a plant flowering in Mumbai be pollinated by pollen grains of the same species growing in New Delhi?
Provide explanations to your answer.
(b) Draw the diagram of a pistil where pollination has successfully occurred. Label the parts involved in
transferring the male gametes to their desired destination.
24. (a) What do ‘Y’ and ‘B’ stand for in ‘YAC’ and ‘BAC’ used for DNA sequencing in Human Genome Project
(HGP)? Mention their role in the project.
(b) Write the percentage of human genome that codes for proteins and the percentage of discovered genes whose
functions are unknown.
25. (a) Explain adaptive radiation with the help of a suitable example.
(b) Cite an example where more than one adaptive radiation have occurred in an isolated geographical area.
Name the type of a evolution your example depict and state why it is so named.
26. (a) Explain the basis on which the gel electrophoresis technique works.
(b) Write any two ways by which products obtained through this technique can be utilised.
27. Why are lymph nodes and bone marrows called lymphoid organs? Explain the functions of each one.
O
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Acquired immunity is pathogen specific and characterised by memory. Whenever our body encounters a pathogen
for the first time, it produces a response. Subsequent encounter with the same pathogen elicts a highly intensified
secondary response.
(a) Name the two lymphocytes which are responsible for acquired immunity.
(c) It is generally observed that the children who had suffered from chicken-pox in their childhood may not
contract the same disease in their adulthood. Explain giving reasons the basis of such an immunity in an
individual. Name this kind of immunity.
O
(c) Differentiate between the two lymphocytes responsible for acquired immunity.
30. The process of copying genetic information from template strand of DNA into RNA is called transcription. It is
mediated by RNA polymerase. Transcription takes place in the nucleus of eukaryotic cells. In transcription, only
a segment of DNA and only one of the strands is copied into RNA. Transcription mainly consists of three steps.
One of the steps of transcription is given below.
(a) Identify the given step and name the labels B and C.
(b) What will happen if C is not available in the above process?
(c) What changes will take place in A after the completion of above process in eukaryotes?
O
(c) Briefly explain the previous step or given figure taking place in prokaryotes.
SECTION - E
31. (a) Forelimbs of given animals have the same basic structural plan. Such organs have similar developmental
pattern and they develop in related organisms, but these do differ morphologically. What type of evolution
and structure is exhibited by the organisms given in the figure.
(b) (i) Differentiate between analogy and homology giving one example each of plant and animal.
(ii) How analogy and homology considered as an evidence in support of evolution?
O
Refer to the given information regarding human evolution given below and answer the following questions.
The fossil evidence clearly indicates that origin of man occured in Central Asia. About 15 mya, primates called
Dryopithecus and Ramapithecus were existing. Among the stories of evolution, the story of evolution of modern
man appears to parallel evolution of human brain and their charactristics development.
(a) Where did Australopithecus evolve?
(b) Write the scientific name of Java man.
(c) Name the first human like hominid. Mention his food habit and brain capacity.
(d) Write the characteristics of Ramapithecus and Neanderthal man.
32. Describe the roles of pituitary and ovarian hormones during the menstrual cycle in a human female.
O
(i) Trace the development of megaspore mother cell up to the formation of a mature embryo sac in a flowering
plant.
(ii) Draw a labelled diagram of the structure of mature dicot embryo.
33. (i) What is EcoRI? How does EcoRI differ from an exonuclease?
(ii) EcoRI is used to cut a segment of foreign DNA and that of a vector DNA to form a recombinant DNA.
Show with the help of schematic diagrams.
(a) The set of palindromic nucleotide sequence of base pairs the EcoRI will recognise in both the DNA
segments. Mark the site at which EcoRI will act and cut both the segments.
(b) Sticky ends formed on both the segments where the two DNA segments will join later to form a
recombinant DNA.
O
(i) (a) Identify A and B illustrations in the following:
******
Sample Paper 16
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. After double fertilisation, a mature ovule has
(a) 1 diploid and 1 haploid cell (b) 1 diploid and 1 triploid cell
(c) 2 haploid and 1 triploid cell (d) 1 haploid and 1 triploid cell
2. Which one of the following is the correct matching of the events occurring during menstrual cycle?
(a) Proliferative phase : Rapid regeneration of myometrium and maturation of Graafian follicle
(b) Secretory phase : Development of corpus luteum and increased secretion of progesterone
(c) Menstruation : Breakdown of myometrium and ovum not fertilised
(d) Ovulation : LH and FSH attain peak level and sharp fall in the secretion of progesterone
3. If the sequence of bases in one strand of DNA is ATGCATGCA, what would be the sequence of bases on
complementary strand?
(a) ATGCATGCA (b) AUGCAUGCA
(c) TACGTACGT (d) UACGUACGU
7. The birth and death rates of four countries are given below. Which one will have the least population growth rate?
(a) P (b) Q
(c) R (d) S
8. An isolated population of humans with approximately equal numbers of blue-eyed and brown-eyed individuals
was decimated by an earthquake. Only a few brown-eyed people remained to form the next generation. This kind
of change in the gene pool is called
(a) Hardy-Weinberg equilibrium (b) blocked gene flow
(c) genetic drift (d) gene migration
11. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Multiple allelism (i) Tt # tt
B. Back cross (ii) Tt # TT
C. Test cross (iii) Human blood groups
D. Crossing over (iv) Non-parental gene combination
E. Recombination (v) Non-sister chromatids
(a) A-(iii), B-(i), C-(ii) D-(v), E-(iv) (b) A-(iii), B-(ii), C-(i), D-(v), E-(iv)
(c) A-(iii), B-(ii), C-(i), D-(iv), E-(v) (d) A-(iv), B-(ii), C-(i), D-(v), E-(iii)
12. In a life table, the number of individuals alive at the beginning of the 1St year to 2nd year interval is 800. During
this interval, 200 individuals die. The death rate for this interval is
(a) 0.25 (b) 200
(c) 800 (d) 0.2
13. Assertion : Distribution of age groups is said to influence the population growth.
Reason : Population growth is a measure of increase in population over a period of time.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
14. Assertion : Herbivores are also called key industry animals because they convert plant matter into animal matter.
Reason : Decomposers play a pivotal role in the ecosystem and they indirectly support the producers.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Given below is the diagram of an ovum surrounded by few sperms. One of the sperms is observed to penetrate ‘A’
of the ovum. Study this figure and comment upon the appropriateness of the Assertion and the Reason.
Assertion : ‘A’ is zona pellucida, present just around the plasma membrane of the oocyte.
Reason : ‘A’ initiates acrosomal reaction of the sperms and also prevents polyspermy.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Write the difference between proinsulin and mature insulin.
18. What does the given age pyramid signify about the status of a population? (The bar at the base represents pre-
reproductive individuals.)
19. Why are copper containing intrauterine devices considered an ideal contraceptive for human females?
O
What is amniocentesis? How is it misused?
20. With the help of an algebraic equation, how did Hardy-Weinberg explain that in a given population the frequency
of occurrence of alleles of a gene is supposed to remain the same through generations?
21. How does a vaccine for a particular disease immunise the human body against that disease?
SECTION - C
22. How does the HIV breakdown the immune system of the AIDS patient?
24. Biotechnology is used to develop pest-resistant varieties of cotton plants. Justify the statement.
25. (a) How many kinds of phenotypes would you expect in F2 generation in a monohybrid cross exhibiting co-
dominance?
(b) How co-dominance is different from dominance?
26. How is ‘oogenesis’ markedly different from ‘spermatogenesis’ with respect to the growth till puberty in the
humans?
O
Name the pituitary hormones involved in the process of spermatogenesis. State their function.
27. Why is haemophilia generally observed in human males? Explain the conditions under which a human female can
be haemophilic.
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. The flow chart given below shows the different components of biogas plant.
(a) With reference to the given flow chart, explain why there is a need of A?
(b) What would happen if A is not added in the procedure?
(c) Where does A can be found apart from the biogas production?
O
30. Study the given below picture of the gel electrophoresis showing the banding pattern of DNA from crime scene.
(a) On the basis of the above given picture of gel electrophoresis, among A, B and C who will be the criminal?
Give reason.
(b) Which technique is used in the given question for the identification of the criminals?
(c) On what basis, the DNA fragments of individual A, B and C are separated in the gel electrophoresis?
O
(c) What is the basis of technique which is used in the criminal investigation and forensic science?
SECTION - E
31. State and explain the “law of independent assortment” in a typical Mendelian dihybrid cross.
O
A tall pea plant bearing violet flowers is given with its unknown genotypes. Explain by working out the crosses
how would you find the correct genotypes with respect to the two traits mentioned only by “selfing” the given
plants.
32. Reproductive and Child Health Care (RCH) Programmes are currently in operation. One of the major tasks of
these programmes is to create awareness amongst people about the wide range of reproduction related aspects as
this is important and essential for building a reproductively healthy society.
(a) “Providing sex education in schools is one of the ways to meet this goal.” Give four points in support of your
opinion regarding this statement.
(b) List any two ‘indicators’ that indicate a reproductively healthy society
O
(a) Mention the event that induces the completion of the meiotic division of the secondary oocyte.
(b) Trace the journey of the ovum from the ovary, its fertilisation and further development until the implantation
of the embryo.
33. (a) Mention the number of primers required in each cycle of polymerase chain reaction (PCR). Write the role
of primers and DNA polymerase in PCR. Give the characteristic feature and source organism of the DNA
polymerase in PCR.
(b) Rearrange the following in the correct sequence to accomplish an important biotechnological reaction :
(i) Denaturation of ds-DNA
(ii) Chemically synthesised oligonucleotides
(iii) Primers
(iv) Complementary region of DNA
(v) Thermostable DNA polymerase (from Thermus aquaticus)
(vi) Nucleotides provided
(vii) Genomic DNA template
(viii) In vitro synthesis of copies of DNA of interest
O
(a) Draw pBR322 cloning vector. Label ‘ori’, ‘rop’ and any one antibiotic resistance site on it and state their
functions.
(b) State the role of ‘biolistic gun’ in biotechnology experiments.
Sample Paper 17
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. Competition for light, nutrients and space is most severe between
(a) closely related organisms growing in different niches
(b) closely related organisms growing in the same area/niche
(c) distantly related organisms growing in the same habitat
(d) distantly related organisms growing in different niches.
2. Which one of the following immune system components does not correctly match with its respective role?
(a) Interferons-Secreted by virus-infected cells and protect non-infected cells from further viral infection.
(b) B-lymphocytes-Produce antibodies in response to pathogens into blood to fight with them.
(c) Macrophages-Mucus secreting cells that trap microbes entering in the body.
(d) IgA-Present in colostrum in early days of lactation to protect infant from diseases.
4. MALT is
(a) Muscle Associated Lymphoid Tissue
(b) Mucosal Associated Lymphoid Tissue
(c) Mucosal and Lymphoid Tissue
(d) Memory Associated Lymphoid Tissue.
5. In a 3.2 Kbp long piece of DNA, 820 adenine bases were found. What would be the number of cytosine bases?
(a) 780 (b) 1560
(c) 740 (d) 1480
6. Identify A, B and C in the flow chart given below that represents the process of recombinant DNA technology.
8. From a sewage treatment plant, three water samples A, B and C are tested for BOD value and the recorded values
of BOD are 6 mg/L, 400 mg/L and 20 mg/L respectively. What is correct about these samples?
(a) Sample A is taken from untreated sewage.
(b) Sample B belongs to secondary effluent of sewage treatment plant.
(c) Sample C is taken from primary effluent.
(d) Sample B is collected from untreated sewage.
9. Food chain in which microorganisms break down the dead organic matter is
(a) parasitic food chain
(b) detritus food chain
(c) consumer food chain
(d) predator food chain.
11. Given below are four methods (A-D) and their modes of action (i-iv) in achieving contraception. Select their
correct matching from the four options that follow.
13. Assertion : Human insulin can be produced into bacterial cells using biotechnology.
Reason : To produce human insulin the A, B and C polypeptides of the human insulin are produced separately in
the bacterial cells, extracted and combined by creating disulphide bonds.
(a) Both A and R are true and R is the correct explanation of A
(b) Both A and R are true and R is not the correct explanation of A
(c) A is true but R is false
(d) A is false but R is true
15. Mycorrhizae are kind of association between plant roots and fungi. Their major role is to enhance nutrient and
water uptake by the host plant by exploiting larger volume of soil than plant by exploiting larger volume of soil
than roots alone can do. Mycorrhizae come in a number of forms dependent upon several factors such as host
plants distribution climatic and soil conditions. Study the given figure showing plant growth with and without
mycorrhizae and comment upon the appropriateness of the Assertion and the Reason.
Assertion : Mycorrhizae represent a mutually beneficial interspecific interaction of fungi with roots of higher
plants.
Reason : In a mutualistic relationship, both the organisms enter into some sort of physiological exchange.
(a) Both A and R are true and R is the correct explanation of A
(b) Both A and R are true and R is not the correct explanation of A
(c) A is true but R is false
(d) A is false but R is true
16. Assertion : Ex-albuminous seeds do not possess any residual endosperm, as it is completely consumed during
embryo development.
Reason : Wheat, castor, pea and groundnut all are examples of ex-albuminous seeds.
(a) Both A and R are true and R is the correct explanation of A
(b) Both A and R are true and R is not the correct explanation of A
(c) A is true but R is false
(d) A is false but R is true
SECTION - B
17. Consider the following diagram
(a) State the hypothesis which S.L. Miller tried to prove in the laboratory with the help of the set up given
above.
(b) Name the chemicals found in samples drawn from X.
19. State the role of UV-light and ethidium bromide during gel electrophoresis of DNA fragments.
20. Different species belonging to genus Trichoderma are useful to humans as well as to plants. Justify their roles by
giving one instance of each.
21. Study the table given below in regard to population interactions and answer the questions that follow:
SECTION - C
22. Given below is the diagram of a human ovum surrounded by a few sperms. Study the diagram and answer the
following questions:
23. In pea plants, the colour of the flower is either violet or white whereas human skin colour shows many gradations.
Explain giving reasons how it is possible.
25. (a) Name the blank spaces a, b, c and d in the table given below :
(b) Why are some molecules called bioactive molecules? Give two examples of such molecules.
26. Describe the mutual relationship between fig tree and wasp and comment on the phenomenon that operates in
their relationship.
O
(a) Explain the birth rate and death rate in the population with the help of an example each.
(b) What is age-pyramid? Draw an age-pyramid of an expanding population.
Click the Following Button to See the Free MS/Solutions
Page 7 NODIA Sample Paper 17 CBSE Biology Class 12
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. Lac operon is a unit of co-ordinated control of protein synthesis which consists of an operator gene which controls
the activity of a number of structural genes which take part in the synthesis of proteins. The operator gene, in
return is under the control of a repressor molecule synthesised by a regulator gene, which is not a part of the
operon.
O
(c) How are the structural genes inactivated in lac operon in E.coli ? Explain.
30. Carefully observe the given structure and answer questions that follow :
(c) Write the chemical formula and draw the chemical structure of compound obtained from given plant.
SECTION - E
31. The forelimbs of man, cheetah, whale and bat have the same basic structural plan. Such organs have similar
developmental pattern and they develop in related organisms, but these do differ morphologically.
(a) What type of evolution is exhibited by these organisms?
(b) What can you infer about these structures?
(c) The forelimbs of cheetah, whale and bat are used for X , Y and Z , respectively. Identify X, Y and Z here.
(d) Give one example of similar structures in plants.
O
(a) Name the primates that lived about 15 million years ago. List their characteristic features.
(b) (i) Where was the first man-like animal found?
(ii) When did modern Homo sapiens appear on this planet?
32. How is the desired DNA for biotechnology experiments first fragmented and later separated by gel-electrophoresis?
Explain.
O
Write the steps you would suggest to be undertaken to obtain a foreign-gene-product.
33. (a) Identify the given figure and its labelled parts A, B, C and D.
(b) Explain the development of the given above structure from the embryo sac of dicot flower.
O
Study the graph given below and answer the questions that follow :
Sample Paper 18
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. The permissible use of the technique amniocentesis is for
(a) detecting sex of the unborn fetus
(b) artificial insemination
(c) transfer of embryo into the uterus of a surrogate mother
(d) detecting any genetic abnormality
3. Two closely related different species cannot live for long duration in the same niche or habitat. This law is called
(a) Allen’s law (b) Gloger rule
(c) Competitive exclusion principle (d) Weismann’s theory
4. Find the correct palindromic sequence for the given DNA segment.
5l ATTGCAAT 3l
(a) 5l GAACGTTA 3l (b) 3l TAACGTTA 5l
(c) 5l AAACGTTT 3l (d) 3l ATTGCAAT 5l
6. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Dihybrid test cross (i) 9:3:3:1
B. Law of segregation (ii) Dihybrid cross
C. Law of independent assortment (iii) 1:1:1:1
D. ABO blood group in man (iv) Purity of gametes
(v) Multiple allelism
7. Identify A, B, C and D in the flow chart given below that represents the process of recombinant
10. A sewage treatment process in which a part of decomposer bacteria present in the wastes is recycled into the
starting of the process is called
(a) primary treatment (b) activated sludge treatment
(c) tertiary treatment (d) none of these
12. Refer to the given table of contrasting traits in pea plants studied by Mendel.
14. Assertion : The endometrium undergoes cyclical changes during menstrual cycle.
Reason : The myometrium exhibits strong contractions during delivery of the baby.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
Assertion : The given karyotype shows that patient is suffering from Down’s syndrome.
Reason : In patient, the chromosome abnormality is caused due to the absence of one of the sex chromosomes,
i.e., 45 + X.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
16. Assertion : The development of embryo sac from a single functional megaspore is termed as monosporic development.
Reason : In monosporic (Polygonum) type of embryo sac development, usually the megaspore which is situated
towards micropylar end remains functional.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. State the role of thymus as a lymphoid organ. Name the cells that are released from it and mention their function.
18. Two different types of population growth curves are used to measure population density. Study the two growth
curves and answer the corresponding question.
A forest having unlimited food resource hardly has any carnivores. Identify the curve that will explain the
population growth of herbivores in that forest. Also give the equation representing the graph.
20. “Australian marsupials exhibit adaptive radiation but they along with placental mammals show convergent
evolution” . Justify the statement.
22. What do oral pills contain and how do they act as effective contraceptives?
O
When is sterilisation technique advised to married couples? How is it carried out in a human male and a female,
respectively?
SECTION - C
23. (a) What are the transcriptional products of RNA polymerase III?
(b) Differentiate between capping and tailing.
(c) Expand hnRNA.
25. Work out a cross upto F2 generation between two pure breed pea plants, one bearing purple flowers and the other
white flowers.
26. (a)
Read the graph given above and correlate the uterine events that take place according to the hormonal levels on
(i) 6-15 days
(ii) 16-25 days
(iii) 26-28 days (if the ovum is not fertilised)
(b) Specify the sources of the hormones mentioned in the graph.
O
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. BOD is a measure of organic matter present in the water. The data below shows the concentration of BOD in
different samples obtained from the primary effluent, secondary effluent, untreated sewage and river water.
(a) With reference to the above graph, identify the source of different samples A, B, C and D.
(b) What would happen if D is disposed off in B directly?
(c) Which among the given samples will contain large number of pathogenic microbes?
O
(c) What would be the reason for the higher value of BOD in sample D?
30. From a number of studies on the metabolism of bacterium Escherichia coli, two French scientists Jacob and
Monod in 1961 found that the genetic material possesses regulated gene units called operons. Study the given
below operon system operating in E.coli and answer the questions that follow:
(a) On the basis of the given operon system, what conclusion can you draw about case I and case II?
(b) What would happen in the presence of X in case II?
(c) What type of regulation can be seen in the given operon system by the repressor?
O
(c) Which structural gene codes for permease in both the cases and what is its function?
SECTION - E
31. A large number of married couples over the world are childless. It is shocking to know that in India the female
partner is often blamed for the couple being childless.
(a) Why in your opinion the female partner is often blamed for such situations in India? Is it correct? Justify.
(b) State any two reasons responsible for the cause of infertility.
(c) “Intra-Cytoplasmic Sperm Injection” and ‘Gamete Intra Fallopian Transfer’ are two assisted reproductive
technologies. How is one different from other?
O
(a) Arrange the following hormones in sequence of their secretion in a pregnant woman. hCG; LH; FSH; Relaxin
(b) Mention their source and the function they perform.
32. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each
molecule is cut and these ends have regions of single stranded DNA. BamHI is one such restriction enzyme which
binds at the recognition sequence, 5l -GGATCC- 3l and cleaves these sequences just after the 5l - guanine on each
strand.
(a) What is the objective of this action?
(b) Explain how the gene of interest is introduced into a vector.
(c) You are given the DNA shown below.
5l ATTTTGAGGATCCGTAATGTCCT 3l
3l TAAAACTCCTAGGCATTACAGGA 5l
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these
double-stranded DNA fragments with their respective polarity.
(d) A gene M was introduced into E.coli cloning vector pBR322 at BamHI site. What will be its impact on
the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant from
recombinant plasmids.
O
(a) Write the palindromic nucleotide for the following DNA segment : 5l -GAATTC- 3l
(b) Name the restriction endonuclease that recognises this sequence.
(c) How are ‘sticky-ends’ produced? Mention their role.
33. (a) Dihybrid cross between two garden pea plants one homozygous tall with round seeds and the other dwarf
with wrinkled seeds was carried.
(i) Write the genotype and phenotype of the F1 progeny obtained from this cross.
(ii) Give the different types of gametes of the F1 progeny.
(iii) Write the phenotypes and its ratios of the F2 generation obtained in this cross along with the
explanation provided by Mendel.
(b) How were the observations of F2 progeny of dihybrid crosses in Drosophila by Morgan different from that of
Mendel carried in pea plants? Explain giving reasons.
O
How do “pleiotropy”, “incomplete dominance”, “co-dominance” and “polygenic inheritance” deviate from the
observation made by Mendel? Explain with the help of one example for each.
******
Sample Paper 19
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1. During isolation of genetic material, the chemical used to precipitate out the purified DNA is
(a) bromophenol blue (b) chilled ethanol
(c) ethidium bromide (d) both (b) and (c)
2. The three codons which result in the termination of polypeptide chain synthesis are
(a) UAA, UAG, GUA (b) UAA, UAG, UGA
(c) UAA, UGA, UUA (d) UGU, UAG, UGA
3. Which of the following appeared during ice age between 75,000 - 10,000 years ago?
(a) Cro-Magnon man (b) Neanderthal man
(c) Modern Homo sapiens (d) Heidelberg man
4. Pollination in water hyacinth and water lily is brought about by the agency of
(a) water (b) insects or wind
(c) birds (d) bats
6. Which of the following is widely used as a successful biofertiliser in Indian rice field ?
(a) Rhizobium (b) Acacia arabica
(c) Acalypha indica (d) Azolla pinnata
7. For a population, the population density (N) was plotted against time (t) and growth curve obtained is shown in
figure marked by A, B and C. Find the correct information about marked phases.
8. The given flow chart represents the flow of genetic information between biomolecules. Identify the processes A, B,
C and D and select the correct option.
9. Match column I with column II and select the correct option from the given codes.
Column I Column II
A. Parthenocarpy (i) Seed formation without fertilisation
B. Polyembryony (ii) More than one embryo in same seed
C. Apomixis (iii) Seedless fruits without fertilsation
D. False fruit (iv) Thalamus contributes to fruit formation
10. Everytime, when the dosage of a drug has to be increased to achieve the same ‘kick’ that initially occurred in
response to a smaller dose, this condition is known as
(a) rebound effect (b) tolerance
(c) withdrawal symptoms (d) addiction
11. Which of the following equations correctly represents Verhulst-Pearl logistic growth?
dN = b K − N l dN rN
(a) dt rN K (b) dt = K
dN = N ]K − N g dN r ]K − N g
(c) dt K (d) dt = K
12. Match column I (enzyme) with column II (characteristic/activity) and select the correct answer from the given
codes.
Column I Column II
A. Taq DNA polymerase (i) Cleaves the ends of linear DNA
B. Exonuclese (ii) Breakdown of fungal cell wall
C. Protease (iii) Stable above 90c C
D. Chitinase (iv) Made only by eukaryotic cells
(v) Degradation of proteins
(a) A-(iii), B-(iv), C-(i), D-(ii) (b) A-(iv), B-(iii), C-(i), D-(ii)
(c) A-(ii), B-(i), C- (v), D-(iii) (d) A-(iii), B-(i), C-(v), D-(ii)
14. Assertion : Net primary productivity is equal to gross primary productivity minus respiration.
Reason : Secondary productivity is produced by heterotrophs.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
15. Given below is the figure of a transverse section of a young anther. It depicts a bilobed, tetragonal structure
consisting of four microsporangia located at the corners, two in each lobe. Study this figure and comment upon
the appropriateness of the Assertion and the Reason.
16. Assertion : A network of food chains existing together in an ecosystem is known as a food web.
Reason : An animal like kite cannot be a part of a food chain.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.
SECTION - B
17. Why are copper containing intrauterine devices considered an ideal contraceptive for human females?
O
What is amniocentesis? How is it misused?
18. Write two differences between Homo erectus and Homo habilis.
19. A patient showed symptoms of sustained high fever, stomach pain and constipation, but no blood clot in stools.
Name the disease and its pathogen. Write the diagnostic test for the disease. How does the disease get transmitted?
20. Observe the global proportionate number of vertebrate diversity in the figure given below and answer the questions.
21. “Intra-Cytoplasmic Sperm Injection” and ‘Gamete Intra Fallopian Transfer’ are two assisted reproductive
technologies. How is one different from other?
O
Why is ZIFT a boon to childless couples? Explain the procedure.
SECTION - C
22. Cotton bollworms enjoy feeding on cotton plants but get killed when feed on Bt cotton plant. Justify the statement.
23. Double fertilisation is reported in plants of both castor and groundnut. However, the mature seeds of groundnut
are non-albuminous and castor are albuminous. Explain the post fertilisation events that are responsible for it.
24. How is the phenotypic and genotypic ratio of F2 generation in a dihybrid cross is different from monohybrid cross?
25. At what stage does Plasmodium gain entry into the human body? Write the different stages of its life cycle in the
human body.
26. When does a geneticist need to carry a test cross? How is it carried?
SECTION - D
DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29. In an experiment to know the genotype of a red flowered plant it was crossed with a homozygous white flowered
plant. The progenies obtained were of two types as shown below in the figure.
(c) What would be the probability of homozygous and heterozygous plants in F1 progeny?
30. After a surgery drug ‘X’ was injected to the patient to counteract the effect of pain receptors in the body and to
induce sleep in patient. The structure of the drug ‘X’ is provided :
(a) Identify the drug from the chemical structure that was injected to the patient.
(b) Give the scientific name of the plant that can be used to obtain drug X.
(c) Write the effects of compound obtained by drug X on the human body.
O
(c) To which group X belongs to? Mention the location of its receptors in human body.
SECTION - E
31. (a) Describe the lactational amenorrhea method of birth control.
(b) (i) Why removal of reproductive organs cannot be a contraceptive option?
(ii) “Complete lactation is a natural method of contraception”. Justify this statement.
(c) Name and explain the surgical method advised to human males and females as a means of birth control.
Mention its one advantage and one disadvantage.
O
32. A teacher wants his/her students to find the genotype of pea plants bearing purple coloured flowers in their school
garden. Name and explain the cross that will make it possible.
O
Explain the causes, inheritance pattern and symptoms of any two Mendelian disorders.
******