Microbial Genetics Genetics = science of heredity

(Chapter 8) study of what genes are, how they carry

info, how they are replicated, passed along,
Lecture Materials
and how expression of the info determines
for characteristics of the organism
Genome = all genetic info in a cell
Amy Warenda Czura, Ph.D.
Chromosome = organized unit of genome;
Suffolk County Community College bundle of DNA
bacteria have 1, humans have 46
Eastern Campus
Genes = segments of DNA that code for
functional products (rRNA, tRNA or
Primary Source for figures and content: protein)
Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson
Benjamin Cummings, 2004, 2007, 2010. Genomics = field of genetics involved in
sequencing and molecular characterization
of genomes
Many organisms sequences known: e.g.
E.coli = 4 million bp (~3-4 thousand genes)
Yeast= 12 million bp (~5-6 thousand genes)
Human= 3 billion bp (~25-50 thousand genes)

DNA = macromolecule, strands of nucleotides Features of biological info storage:

nucleotide = nitrogenous base + deoxyribose + 1. linear sequence of bases provides actual
phosphate genetic info: only four bases but in chain of
X length there are 4X possibilities of
different orders
e.g. chain 2 bases long, using 4 possible
-deoxyribose and phosphate bases, 42 = 16 possible configurations:
form linear strand, “backbone” AA TA CA GA
-nitrogenous bases hang AT TT CT GT
off side AC TC CC GC
-two strands held together by AG TG CG GG
H-bonding between bases,
forms a double helix, two 2. complementary structure of DNA allows
strands wound around each precise duplication: one strand determines
other sequence of other: A-T, G-C
-base pairing: A-T, G-C
-bases on one strand determine bases
on the other: the strands are
complementary
-sequence contains genetic info

Amy Warenda Czura, Ph.D. 1 SCCC BIO244 Chapter 8 Lecture Notes

Genotype = DNA, genetic makeup -the DNA is ~1000x longer than cell but
all the genes that can encode characteristics chromosome structure is organized to
of an organism, potential properties occupy only 10% of cell volume
Phenotype = protein
the observed outcome of gene expression
the appearance or metabolic capabilities of
an organism
Gene expression = turning the info from the
gene in DNA into the molecule it encodes,
usually a protein
Not all genes are expressed: if not expressed
the gene cannot contribute to the DNA Replication
phenotype -must replicate DNA to pass genetic info to
progeny cells
DNA and Chromosomes -process converts one parental molecule into
-bacteria: usually one chromosome two identical daughter molecules
(yeast -7 humans -46)
-bacterial chromosome is circular DNA with
associated proteins, attached to plasma
membrane
(eukaryotes = linear chromosomes, in nucleus)

-DNA is a directional molecule

-two strands in double helix are anti-parallel:
run in opposite directions
-directionality
dictated by the
sugar-phosphate
-process is bonds of the
semi-conservative: backbone:
each strand of parental
molecule is template for P on 5’carbon
new strand, and new of nucleotide
molecules contain half gets bound to
parental and half new OH on 3’
DNA complementary carbon of next
base paired nucleotide

-DNA polymerase (enzyme for DNA

synthesis) can add nucleotides only to
the 3’ end of a growing molecule

Amy Warenda Czura, Ph.D. 2 SCCC BIO244 Chapter 8 Lecture Notes

-new strands synthesized in opposite DNA Replication
directions
-energy for bond making comes from free
nucleotides in tri-phosphate forms: ATP,
TTP, GTP, CTP
-two phosphates are removed and energy is
used to create the sugar-phosphate (OH to
P) bond between nucleotides

1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication.
2. Proteins stabilize the unwound parental DNA creating the replication fork.
3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the
leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the
replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are
complementarily base paired with the parental strand and chemically bonded to the 3’end of the
RNA primer and subsequently to each other at the 3’ends (via removal of two phosphates) to create a
new DNA strand.
4. The lagging strand is synthesized discontinuously:
At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA.
Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the
3’ end of the RNA primer and growing chain by DNA polymerase, working away from the
replication fork for ~1000bases. The resulting segment is called an Okazaki fragment.
5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3’
end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA
primers on completed Okazaki fragments on the lagging strand and replaces them with DNA
nucleotides.
6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the

DNA Replication Events neighboring fragments into a single continuous molecule.

7. Replication continues down the full length of the chromosome until both parental strands are completely
separated and each is base paired to a newly synthesized strand.
(on handout)

Bacterial chromosomes can replicate -origin of replication is associated with the

bidirectionally: one origin of replication plasma membrane to insure separation of
with two replication forks moving in duplicated chromosomes to each daughter
opposite directions cell during binary fission

DNA replication accurate: DNA polymerase

has proofreading ability to insure proper
base pairing before backbone is chemically
bonded
Error rate = ~1 in 109 bases
error = mutation

Gene Expression:
RNA and protein synthesis
-DNA replication only occurs in cells that are
dividing
-gene expression occurs in all cells all the
time: cells are constructed of protein and
require enzymes to function
DNA --------------> RNA --------------> Protein
transcription translation

Amy Warenda Czura, Ph.D. 3 SCCC BIO244 Chapter 8 Lecture Notes

Transcription = synthesis of complementary Transcription
strand of RNA from DNA template making RNA from DNA
Translation = synthesis of protein from info on 3 types of RNA:
mRNA template 1. Ribosomal RNA (rRNA) - integral part of
ribosomes, which carry out protein
synthesis
Gene Structure (on handout) 2. Transfer RNA (tRNA) - bring amino acids
Open Reading Frame (ORF) to ribosome for use in protein synthesis
Promoter Terminator
(codons for amino acids)
3. Messenger RNA (mRNA) - carries coded
Start codon Stop codon info for synthesis of specific proteins from
The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be DNA gene to ribosome for use
transcribed
The start and stop codons are directions for the ribosome to indicate where the amino acid information for RNA is synthesized as complementary copy
translation begins and ends
The ORF is the “coding” region of the gene: it begins at the start codon and contains in order all the codons of a DNA gene except that T is replaced by U
The complement is produced from the
for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of
the 20 amino acids) The ORF ends at the stop codon.

template or sense strand of the DNA gene

Coding/Antisense strand of the DNA:
ATGGTATTCTCCTATCGTTAA
Template/Sense of the DNA gene:
TACCATAAGAGGATAGCAATT
RNA:
AUGGUAUUCUCCUAUCGUUAA

Transcription Events Translation

(on handout) -protein synthesis at the ribosome
DNA: 4 different bases in a particular order
make up the gene sequence
RNA: 4 bases complementary to the DNA
gene make up the RNA sequence
Nucleotide bases are like letters in the
alphabet: used in groups of three to make
“words”; each word indicates a particular
amino acid
3 nucleotides = 1 codon
Each codon = one amino acid of the 20
possible
Translation involves “reading” the codons on
the mRNA to build the polypeptide using
the correct amino acids in the order
specified by the gene

The Genetic Code

-all organisms use the same codons to specify
the particular amino acids

Amy Warenda Czura, Ph.D. 4 SCCC BIO244 Chapter 8 Lecture Notes

64 possible codons (43) but only 20 amino Use the genetic code chart to decode the
acids: some are redundant amino acid sequence of any mRNA:
61 codons code for amino acids = sense AUG /GUA /UUC /UCC /UAU /CGU /UAA
codons

t
dou
3 nonsense codons serve as the STOP signal

han
to terminate protein synthesis

on
For each sense codon there is a tRNA with a
complementary antisense codon: this tRNA
carries the amino acid specified by the
codon
There are no tRNA molecules with anticodons
to the 3 nonsense codons (stop codons):
UAA, UAG, UGA, and thus no amino
acids
The start codon is AUG and codes for the
amino acid methionine
The start codon establishes the reading frame
of the mRNA: all other codons (each three
nucleotides) can be read once the start has
been identified AUG /GUA /UUC /UCC /UAU /CGU /UAA
Met - Val -Phe -Ser -Tyr -Arg -STOP

Translation Events (on handout)

Transcription begins at the AUG codon

Amy Warenda Czura, Ph.D. 5 SCCC BIO244 Chapter 8 Lecture Notes

 Once the ribosome begins moving along the
mRNA molecule the start codon is exposed
and another ribosome can assemble and
begin translation
In prokaryotes
there is no
nuclear
separation
so translation
can begin
before
Transcription ends at the stop codon because: transcription
-no tRNA with a complementary anticodon is complete
exists to pair with a stop codon
-no amino acid arrives to be peptide bonded
to the chain

Amy Warenda Czura, Ph.D. 6 SCCC BIO244 Chapter 8 Lecture Notes

In eukaryotes, transcription occurs in the Small nuclear ribonucleoproteins (snRNPs)
nucleus: mRNA must exit to the cytoplasm cut out the introns and splice together the
before translation can begin exons to form mRNA that can be used for
Also eukaryotic RNA must be processed translation
before a functional mRNA is generated
Eukaryotic genes contain introns and exons
exons = coding portion (codons)
introns = “junk”
RNA generated by complementary base
pairing to the template DNA contains both
introns and exons.

Exons can provide variability: many mRNA

configurations can be formed from a single
gene with multiple exons
e.g. use all or only some of the exons:
3 exons = 7+ different mRNAs (and thus
proteins) 1-2-3, 1-2, 1-3, 2-3, 1, 2, 3

Regulation of Bacterial Gene Expression 1. Induction = mechanism that turns on the

-protein synthesis metabolically expensive: transcription of a gene and thus
cells only make what is needed translation of its enzyme product
-60-80% of genes constitutively expressed: -tends to control catabolic pathway
“housekeeping genes” enzymes
-genes not involved in normal or continuous -gene expression induced by substrate for
processes have expression regulated pathway
-feedback inhibition regulates enzymes that -default position of gene expression is ‘off’
have already been synthesized Mode of Action:
-genetic control mechanism control the -Gene expression is off because active
synthesis of new enzymes repressor protein blocks RNA
polymerase
Genetic Control Mechanisms: -Inducer (substrate) binds to repressor thus
-regulate transcription of mRNA, thus control inactivating it
enzyme synthesis -RNA polymerase now free to transcribe
Two Mechanisms: gene (gene expression on)
1. Induction -mRNA synthesized
2. Repression -protein synthesized

Inducible gene system ! inducible enzyme

Amy Warenda Czura, Ph.D. 7 SCCC BIO244 Chapter 8 Lecture Notes

2. Repression = mechanism that inhibits gene All genes involved in one pathway are often
expression thus decreasing synthesis of organized together on the chromosome
corresponding enzyme under control of one promoter in a unit
-tends to control anabolic pathway enzymes called an operon
-gene expression repressed by final product
produced in pathway
-default position of gene expression is ‘on’
Mode of Action:
-Gene expression is on Terminator

-Repressor (regulatory protein) is activated

by corepressor (product) Operon consists of:
-repressor + corepressor block RNA 1. Promoter: region of DNA where RNA
polymerase polymerase initiates transcription
-no mRNA synthesis (gene expression off) 2. Operator: region of DNA that serves as
-no protein synthesis stop/go signal for transcription
3. Genes: all the ORFs for all the enzymes in
the pathway linked end to end; each has its
own start and stop codon
4. Terminator: region of DNA where RNA
polymerase ends transcription

An operon has only one promoter and one Examples of genetic control of gene expression:
operator that control all the genes at once: 1. Lac Operon (on handout)
all are expressed or none are.
Each gene has its own start & stop codon: all
will be transcribed on one mRNA but O
during translation each ORF will form its
own separate protein.

Terminator

Transcription

Translation
D
E
B A
C

Amy Warenda Czura, Ph.D. 8 SCCC BIO244 Chapter 8 Lecture Notes

2. Tryptophan Synthesis Operon Genetic Mutations
(on handout) Mutation = change in base sequence of DNA

Silent mutation = no change in the activity of

the gene product
-no change in amino acid (often third base
in codon)
e.g. G-C-anything = alanine
-change in amino acid did not affect
function of the protein
Some mutations harmful:
decreased activity, loss of activity
Some mutations beneficial:
new or enhanced activity
(this drives evolution)

Types of mutations: e.g. Sickle cell anemia:

1. Base substitution / point mutation A ! T, GAG ! GTG in hemoglobin
single base at one point in DNA glutamic acid (+ charge) ! valine (neutral)
replaced by another base folded hemoglobin globular ! fibrous
A. Silent point mutation: does not change RBCs round ! elongated (block
the amino acid capillaries, don’t carry O2 well
B. Missense point mutation: causes
insertion of the wrong amino acid C. Nonsense point mutation: creates a stop
codon in the middle of a gene - protein
will be incomplete
template

Amy Warenda Czura, Ph.D. 9 SCCC BIO244 Chapter 8 Lecture Notes

2. Frameshift mutation Spontaneous mutations: occur in absence of
one or a few nucleotides are deleted or any mutation causing agent, represent the
inserted - this can alter the translational error rate of DNA polymerase (1 in 109)
reading frame
e.g. AUG GCU ACC GUC... Mutagen = agent in environment that brings
Met - Ala - Thr - Val about DNA mutation. Usually chemically
insert A at 4th position: or physically interact with DNA to cause
AUG AGC UAC CGU C… change. Once mistake is fixed into the
Met - Ser - Tyr - Arg- DNA the change is permanent.
1. Chemical mutagens (examples)
template
A. Nitrous acid: converts A so it pairs with
C instead of T

Frameshift mutations almost always cause

long stretch of altered amino acids
resulting in inactive protein.
Nonsense mutations (stop codons) can also
be created

B. Nucleoside analogs: have chemical

structure similar to a base but do not
base pair correctly
e.g. 5-bromouracil incorporated in place
of T but base pairs with G not A

2. Radiation
A. x-rays and "-rays: create ions and free
radicals that break molecular bonds
B. UV: causes crosslinking of T bases
C. Benzopyrene (cigarette smoke): causes (Thymine dimer) which can prevent
frameshift mutations: binds between unwinding for replication or
bases and offsets the double helix transcription
strands, repair mechanisms add a base Cells have light repair enzymes called
to the other strand to re-set alignment photolyases which cut out damaged Ts
and replace them

Amy Warenda Czura, Ph.D. 10 SCCC BIO244 Chapter 8 Lecture Notes

Nucleotide excision repair = enzymes that 1. damaged parts are removed leaving gap in
function to cut out and replace DNA damage strand
2. gap is filled by complementary base pairing
from other strand
-often repair restores correct sequence
-sometimes errors are made during repair:
once nucleotide excision repair mechanisms
seal the DNA, mutation is permanent
Damage on one strand Damage on both strands
ATGCTAGGCTATTATCG
TACGATCCGATAATAGC

ATGCTAGGCTATTATCG
TACGATCCGATAATAGC

ATGCT GCTATTATCG
TACGAT GATAATAGC

ATGCTA?GCTATTATCG
TACGAT?CGATAATAGC

Mutation rate = probability that gene will Genetic Transfer and Recombination
mutate when cell divides genetic recombination = exchange of genes
Spontaneous mutation rate ~10-9 between two DNA molecules to form new
(1 in a billion) combinations of genes on chromosome
Average gene ~103 bp long, so approximately -involves crossing over
1 in 106 genes mutated each replication
Mutations are random
If harmful, organism dies
If beneficial, organism thrives and passes
mutation to offspring (drives adaptation
and evolution)

Mutagens change rate 10-1000 fold: up to

1:1000 genes mutated each replication

Amy Warenda Czura, Ph.D. 11 SCCC BIO244 Chapter 8 Lecture Notes

Genetic recombination contributes to -transfer involves donor cell that gives portion
population diversity: recombinations more of DNA to recipient cell
likely than mutations to provide beneficial -when donor DNA incorporated into recipient,
change since it tends not to destroy gene recipient now called recombinant cell
function -if recombinant cell acquired new
Eukaryotes: recombination during meiosis for function/characteristic as result of new
sexual reproduction DNA, cell has been transformed
-creates diversity in offspring but parent Generation of recombinant cells is very low
remains unchanged frequency event (less than 1%): very few
-vertical gene transfer = genes passed from cells in population are capable of
organism to offspring exchanging and incorporating DNA

Prokaryotes: recombination via gene transfer Three methods of prokaryotic gene transfer:
between cells or within cell by 1. Bacterial Transformation
transformation, conjugation, or -genes transferred as naked DNA
transduction -can occur between unrelated genus/species
-original cell is altered
-horizontal gene transfer = genes passed to
neighboring microbes of same generation

-discovered by F. Griffith 1928 who studied -competent cells can pick up DNA from dead
Streptococcus pneumoniae cells and incorporate it into genome by
-virulent strain had capsule recombination (e.g. antibiotic resistance)
-non-virulent stain did not -transformed cell
-in mouse, dead virulent strain could than passes
pass “virulence factor” to live non- genetic
virulent strain recombination
to progeny

competent =
permeable to
DNA:
alterations in
cell wall that
allow large
molecule like DNA to get through (in lab
we use chemical agents to poke holes)
-transformation works best when donor and
recipient are related but they do not have to
be

Amy Warenda Czura, Ph.D. 12 SCCC BIO244 Chapter 8 Lecture Notes

2. Conjugation During conjugation plasmid is replicated and
-genes transferred between two live cells via single stranded copy is transferred to
sex pilus (Gram -) or surface adhesion recipient. Recipient synthesizes
molecules (Gram +) complementary strand to complete plasmid
-transfer mediated by a plasmid: small circle
of DNA separate from genome that is self
replicating but contains no essential genes
-plasmid has genes for its own transfer
-Gram negative plasmids have genes for pilus
-Gram positive plasmids have genes for
surface adhesion molecules -plasmid can remain as separate circle or
Conjugation requires cell to cell contact -plasmid can be integrated into host cell
between two cells of opposite mating type, genome resulting in permanent
usually the same species, must be same chromosomal changes
genus

3. Transduction 3. New phages are

-DNA from a donor is carried by a virus to a assembled: phage
recipient cell DNA is packaged
Bacteriophage / Phage = virus that infects into capsids
bacterial cells Occasionally
-each phage is species specific (donor and bacterial DNA is
recipient are the same species) packaged by mistake
Transduction mechanism: 4. Capsid containing
1. Phage attaches to donor cell and injects bacterial DNA
phage DNA “infects” new host
recipient cell by
injecting the DNA
5. Donor DNA does not
direct viral
replication (not viral
DNA): instead
integrates into
2. Phage DNA directs donor cell to synthesize recipient genome
phage proteins and DNA, phage enzymes
digest the bacterial chromosome

Amy Warenda Czura, Ph.D. 13 SCCC BIO244 Chapter 8 Lecture Notes

DNA entities used for genetic change: 2. Transposons = small segments of DNA that
(in both prokaryotes and eukaryotes) can move independently from one region
1. Plasmids = self-replicating circle of DNA of DNA to another
containing “extra” genes -discovered 1950s by McClintock: mosaic
A. conjugative plasmids: used in bacterial pattern in indian corn (Nobel Prize 1983)
conjugation, at minimum contain genes for -transposons pop out and randomly insert at
pili or adhesion molecules rate of 10-5 to 10-7 per generation
B. dissimilation plasmids: carry genes that -integration is random: can disrupt genes
code for enzymes to trigger catabolism of -at minimum transposons carry genetic info to
unusual carbs or hydrocarbons carry out own transposition, may also carry
C. pathogenicity plasmids: carry genes that other genes
code for virulence traits ! capsules, Simplest transposon = insertion sequence
toxins, adhesion molecules, bacteriocins
D. resistance factor plasmids: carry genes for
resistance to antibiotic and toxins
-plasmids can be transferred between species: -gene for transposase (enzyme that cuts DNA
-allows spread of antibiotic resistance at recognition sites and religates it
between different pathogens elsewhere in genome)
-wide use of antibiotics has put selective -two recognition sites called inverted repeats,
pressure on microbes to “develop” and mark ends of transposon, recognized by
“share” resistance genes transposase

-complex transposons have inverted repeats

outside other genes

-genes will get carried with transposon when it

moves
-transposons can be carried between cells on
plasmids or by viruses, even between
species
-depending on where it inserts and what genes
it carries it can mediate good or bad
genetic changes

Amy Warenda Czura, Ph.D. 14 SCCC BIO244 Chapter 8 Lecture Notes