Development of Neutralizing and Non Neutralizing Antibodies Targeting Known and Novel Epitopes Os TCDB
Development of Neutralizing and Non Neutralizing Antibodies Targeting Known and Novel Epitopes Os TCDB
Specialty section: Keywords: Toxin B (TcdB), Clostridioides difficile, antibody phage display, recombinant antibody, epitope mapping,
This article was submitted to neutralization, scFv, scFv-Fc
Infectious Diseases,
a section of the journal
Frontiers in Microbiology INTRODUCTION
Received: 27 September 2018
Accepted: 13 November 2018 By the end of the 1970s, Clostridioides (former Clostridium) difficile (CDiff) was identified as the
Published: 06 December 2018 causative pathogen of antibiotic treatment associated diarrhea (CDAD) (Bartlett et al., 1978). Since
Citation:
then, the number of CDiff infections (CDI) has been increasing and in the last two decades CDiff
Fühner V, Heine PA, Helmsing S, even caused epidemic outbreaks (Rupnik et al., 2009; DePestel and Aronoff, 2013). In 2011, CDiff
Goy S, Heidepriem J, Loeffler FF, caused ∼453,000 incident infections in the USA with ∼29,000 deaths (Lessa et al., 2015). Due to its
Dübel S, Gerhard R and Hust M association with antibiotic treatment and the resulting high potential for development of antibiotic
(2018) Development of Neutralizing resistance, the Centers for Disease Control and Prevention (CDC) classify CDiff as an urgent threat
and Non-neutralizing Antibodies (Centers of Disease Control Prevention, 2013).
Targeting Known and Novel Epitopes
In standard therapy for mild to moderate CDI, CDiff is targeted with metronidazole,
of TcdB of Clostridioides difficile.
Front. Microbiol. 9:2908.
vancomycin or fidaxomicin (Tedesco et al., 1978; Bolton and Culshaw, 1986; Goldstein et al.,
doi: 10.3389/fmicb.2018.02908 2012). However, antibiotic therapy presumably further disrupts the gut microbiome that confers
colonization resistance against CDiff. Hence, in 20–30% of CDI toxin, by stabilization of the toxin conformation (Olling et al.,
cases, recurrences or relapses occur within 2–6 weeks after 2014). For TcdB the role of the CROPs is less defined, but due to
completion of antibiotic treatment (Pépin et al., 2006). Another the homology similar functions can be assumed. Recently it had
concern about antibiotic therapy is the high potential of CDiff been shown, that next to residues within the TLD the first three
to evolve resistances (Centers of Disease Control Prevention, short repeats of the CROPs are also involved in CSPG4 binding
2013; Gao and Huang, 2015), therefore, alternative therapeutic (Gupta et al., 2017).
approaches are urgently needed. Since TcdA and TcdB are the major virulence factors of CDiff
Disease and typical symptoms of CDI are only caused by responsible for damage of the gut epithelium upon CDI, efforts
strains that express at least Toxin B (TcdB), mostly together with have been made to develop therapeutics that directly target the
Toxin A (TcdA) (Natarajan et al., 2013). Some strains also express toxins instead of the bacterium (Kurtz et al., 2001; Puri et al.,
an additional binary Toxin CDT, but its role in disease is still 2015; Sturino et al., 2015; Ivarsson et al., 2017). One of these is the
poorly understood (Gerding et al., 2014). human monoclonal anti-TcdB antibody Bezlotoxumab, recently
In the last two decades, the incidence of so-called approved by the FDA as therapeutic for prevention of recurrent
hypervirulent CDiff strains has increased. These strains CDI (U.S. Food and Drug Administration, 2016). However, this
carry mutations within the toxin repressor gene tcdc, which may antibody only reduces the relapse rate by ∼40% (Navalkele and
lead to higher toxin expression levels and, therefore, to more Chopra, 2018) and is not approved for treatment of acute CDI.
severe disease (Razavi et al., 2007; Joost et al., 2009). Crystal structure analysis revealed binding of Bezlotoxumab to
TcdA and TcdB are homologous single-chain multidomain two homologous epitopes within the CROPs domain (Orth et al.,
proteins with a molecular weight of 308 and 270 kDa, 2014). For either TcdA and TcdB it had been shown that toxicity
respectively. A schematic representation of TcdB is given in is partially reduced, but not abolished in CROPs deletion mutants
Figure 1. (Frisch et al., 2003; Olling et al., 2011; Manse and Baldwin,
The N-terminal glucosyltransferase domain (GTD, TcdB aa 1– 2015), pointing out functionally independent receptor binding
543) acts on small Rho-GTPases, e.g., RhoA, within the cytosol of sites within at least TcdB, which could also affect neutralization
the host’s cells (Just et al., 1995; Busch et al., 1998). Due to the efficacy of Bezlotoxumab. Therefore, a combined approach
monoglucosylation, the GTPases are trapped in an inactive state, with a mixture of antibodies that target different epitopes or
which inhibits multiple signal cascades, leading to cytoskeleton domains may further improve toxin neutralization and clinical
breakdown and consequently cell rounding (Rothman et al., outcome.
1984; Erdmann et al., 2017). In this study, we describe the generation of a panel of human
Amino acids 544–767 build up a cysteine protease domain antibodies targeting different domains of TcdB by a phage display
(CPD) that catalyzes the proteolytic auto-processing and releases approach using the naïve human antibody libraries HAL9 and
the GTD into the cytosol upon translocation, after activation HAL10 (Kügler et al., 2015). In a cell based assay, the generated
induced by cytosolic inositol-6 phosphate (InsP6) (Egerer et al., antibodies were screened for TcdB neutralization. Furthermore,
2007; Reineke et al., 2007; Shen et al., 2011). domain and epitope mapping of the neutralizing and non-
Amino acids 768–1852 form the translocation domain neutralizing antibodies was performed by antigen ELISA, peptide
(TLD). Despite notable progress during the last years, the array (Weber et al., 2017a,b) and phage display. We mapped TcdB
exact function and the molecular mechanisms involving this in respect to its epitopes, related to neutralization or, respectively,
huge domain are still elusive. The TLD includes a stretch to non-neutralization. These resultsgive new insights into the
of amino acids (aa 830–990), which are proposed to be relevance of different toxin regions regarding neutralization and
involved in pore formation for translocation of the N-terminal toxicity. In addition, we identified a new epitope within the N-
portion across the endosome membrane upon acidification terminal glucosyltransferase domain (GTD) of TcdB that conveys
(Genisyuerek et al., 2011). Furthermore, for TcdB three neutralization.
putative receptors binding regions have been identified recently
within this domain, which interact with the following cell METHODS
surface receptors: chondroitin sulfate proteoglycan 4 (CSPG4),
polio virus receptor like 3 (PVRL3) or members of the Antigen Production
frizzled protein family (FZD1/2/7) (LaFrance et al., 2015; Full length TcdB from Clostridioides difficile strain VPI10463
Yuan et al., 2015; Tao et al., 2016; Gupta et al., 2017). (identical to TcdB from strain cdi630) as well as toxin
The role of these receptor binding sites in disease is still fragments and isolated domains were recombinantly expressed
unknown. as C-terminally 6 × His-tagged proteins in the Bacillus
The C-terminus of both toxins is composed of repetitive megaterium expression system (MoBiTec, Germany) (Burger
elements, where long and short repeats are combined in so- et al., 2003), except for TcdBCROP domain (aa 1853–2366) which
called CROPs (combined repetitive oligo peptides) (von Eichel- was expressed as GST-fusion protein in E. coli. Full length
Streiber et al., 1992). In case of TcdA, the CROPs interact with TcdB1−2366 (TcdBFL ), TcdB1−1852 , TcdB1−1128 , and TcdB1−542
carbohydrate structures [α-Gal-(1,3)-β-Gal-(1,4)-β-GlcNAc] on (TcdBGTD ) were cloned into pHIS1522 via BsrGI and BamHI
the cell surface of the target cells, mediating a first contact (Wohlan et al., 2014). For production of TcdBGTD we used the
between toxin and target cell (Krivan et al., 1986; Greco et al., glucosyltransferase-deficient mutant TcdB1−542 D286/288N for
2006) and prevent premature autoproteolytic cleavage of the higher yield and purity of protein. The His-tagged proteins were
FIGURE 1 | Schematic representation of TcdB fragments used in this study. All fragments were derived from TcdB of C. difficile strain VPI10463. TcdBFL : wild type
(wt) TcdB, TcdB1−1852 : wt TcdB missing the CROP domain, TcdB1−1128 : N-terminal 1128 aa of wt TcdB, TcdBGTD : enzymatically inactive mutant (D286/288N) of
TcdB glucosyltransferase domain, TcdBCROPs combined repetitive oligopeptides, missing the first short repeat.
purified via Ni2+ -affinity chromatography (Ni-IDA columns, The production in HEK293-6E cells and subsequent protein
Machery-Nagel, Germany) by gravity flow after protocol supplied A purification was performed as described before (Jäger et al.,
by company. The purified proteins were stored at −80◦ C 2013)
in storage buffer (50 mM NaCl, 20 mM Tris HCl, pH 8.0)
after buffer exchange via Zeba desalting columns (Pierce, Domain Mapping by Antigen ELISA
Thermofisher). The TcdBCROP domain was expressed as N- Costar High Binding microtiter plate were coated with 100 ng
terminal GST fusion protein. The fusion protein was purified of TcdB fragments or full length TcdB (TcdBFL ) in 100 µL of
via glutathione (GSH)-sepharose (GE Healthcare) after standard PBS overnight at 4◦ C. After saturating the wells with 250 µL
protocol in E. coli lysis buffer (20 mM Tris, pH 8.0, 50 mM NaCl, MPBST (PBS with 0.05% (v/v) Tween20 and 2% (w/v) milk
1 mM dithiothreitol). TcdBCROP was cleaved directly from GSH- powder) and three times washing, a serial dilution of scFv-
sepharose bound GST-tag by thrombin at 4◦ C overnight. The Fc in MPBST was added to the plate and incubated for 1 h
purity and specific concentration of all proteins was estimated by at room temperature followed by three times washing. Bound
SDS-PAGE. scFv-Fcs were detected using a Fcγ specific HRP conjugated
antibody (Sigma Aldrich, A0170, 1:70,000 in MPBST) for 45 min
incubation at room temperature followed by 3x washing. The
Antibody Generation detection was performed using TMB substrate. The colorimetric
Antibodies against TcdB were selected in scFv-format from the reaction was stopped by addition of 100 µL 0.5 M H2 SO4
human naïve antibody gene libraries HAL9 and HAL10 (Kügler and measured with an ELISA reader (TECAN Sunrise, 450 nm,
et al., 2015). The selection and screening was performed as reference 620 nm).
described before (Russo et al., 2018a). In brief, for antibody
selection, scFv phage from HAL9 and HAL10 were mixed and SDS-PAGE and Immunoblot
incubated on TcdBFL , TcdB1−1852, or TcdBCROPs , immobilized in TcdB was heated to 96◦ C in Leammli buffer with 3% 2–
Costar High Binding microtiter plates (Sigma-Aldrich Chemie Mercaptoethanol for 10 min to denature. Five microgram of
GmbH, Munich, Germany). Panning was performed at 37◦ C denatured TcdB was applied to an 10% SDS-PAGE and separated
or room temperature. In two approaches, negative selection of at 200 V for 45 min. The protein was transferred to a PVDF
the library on immobilized TcdB1−1128 was used to specifically membrane using the Trans-Blot R TurboTM (BioRad) transfer
isolate binders directed against the TLD domain of TcdB. After system according to manufacturer’s instructions using the high
three rounds of panning, monoclonal soluble scFv were produced molecular weight program (1.3 A, 25 V, 10 min). The membrane
and screened for TcdB binding by antigen-ELISA. DNA of was blocked in MPBST and placed into a Mini-Protean R II multi-
binding candidates was isolated and sequenced. The unique screen chamber (BioRad). The channels were completely filled
scFv sequences were recloned into pCSE2.6-hIgG1-Fc-XP (Beer with scFv-Fcs diluted in MPBST to a concentration of 1 µg/mL.
et al., 2018; Russo et al., 2018b) using NcoI/NotI (NEB) for After 1.5 h the channels were washed three times with PBST. The
mammalian production as scFv-Fc, an IgG-like antibody format. membrane was removed from the multi-screen chamber washed
again with PBST and incubated with an anti-human IgG (Fcγ concentrated using Amicon Ultra Centrifugal filters (30K
specific) AP conjugated antibody (Jackson Immuno Research MWCO, Millipore). Cohesive ends were blunted and blunt ends
Laboratories 109-055-098) in a 1:20,000 dilution in MPBST. After were phosphorylated according to manufacturer’s instructions
1 h the membrane was washed 2 times with PBST and once (Fast DNA End Repair Kit, Thermo Scientific). DNA product
with AP substrate buffer (100 mM Tris HCl pH 9.5, 0.5 mM was purified using HiYield R Gel/PCR DNA fragment extraction
MgCl2. Afterwards the immunoblot was developed with nitro kit, (SLG). A 10-fold molar excess of gene fragments was ligated
blue tetrazolium chloride (0.30 mg/mL) and 5-Bromo-4-chloro- into PmeI (NEB) linearized and CIP (Calf Instestine Phosphatase,
3-indolyl phosphate (0.15 mg/mL) in AP substrate buffer. The NEB) dephosphorylated pHORF3 library vector (Kügler et al.,
color reaction was stopped by removing the substrate through 2008) (16 h at 16◦ C, T4 DNA Ligase, Promega). The ligase was
washing with water. The membrane was dried between paper inactivated at 65◦ C for 10 min and the buffer was exchanged
towels and scanned. to H2 O using Amicon Ultra Centrifugal Filters (30K MWCO).
Five microliter of ligation was used to transform 25 µL of
Cultivation of Vero Cells and in vitro TcdB electrocompetent E. coli TOP10F’ (TOP10F’ ElectrocompTM Kit,
Life Technologies) by electroporation (1.8 kV, MicroPulserTM ,
Neutralization Assay
BioRad). Successfully transformed TOP10F’ cells were selected
For in vitro TcdB neutralization assay a Vero cell line (African
on 2 × YT agar [1.6% (w/v) tryptone, 1% (w/v) yeast extract,
green monkey kidney cells) was used. TcdB treatment leads to a
0.05% (w/v) NaCl, 1.2% (w/v) agar] supplemented with 100 mM
breakdown of the actin cytoskeleton which leads to cell rounding.
glucose and 100 µg/mL ampicillin.
This effect is easily visible using bright field microscopy.
Determination of transformation rate and packaging of
Vero cells were cultivated in RPMI medium supplemented
oligopeptide phage library and ORF enrichment was performed
with 2.0 g/L NaHCO3 , 2 mM stable glutamine (FG1215,
as described before (Zantow et al., 2016). Gene coverage and ORF
Biochrom) and 10% fetal calf serum at 37◦ C and 5% (v/v) CO2
enrichment was analyzed by sequencing of individual E. coli XL1
and passaged 2–3 times per week when confluency exceeded
blue MRF’ clones infected with TcdB-gene fragment phage.
90%. In an initial assay the working concentration of TcdB was
determined. Therefore, Vero cells were seeded at a density of
10,000 cells per well in a 96 well cell culture plate (Cellstar R , Epitope Mapping by Phage Display
Greiner bio-one) 16 h before intoxication, TcdBFL was diluted in Epitope mapping by phage display was either conducted
cultivation media and a serial dilution was prepared. Consumed by panning on scFv-Fc immobilized in Costar High
media was removed from the cells, and TcdBFL dilutions were Binding microtiter plates or as a panning in solution with
added. Cells were incubated at 37◦ C and 5% CO2 for 5 h. Pictures immunoprecipitation using Protein A coupled magnetic beads
of the wells were collected (Zeiss Axiovert 200 with Hamamatsu (SureBeads, BioRad) with subsequent screening ELISA using
C4742-95 digital camera) and the percentage of round cells was monoclonal TcdB-fragment phage.
determined by software assisted counting (Image J).
Panning on Immobilized scFv-Fc
For neutralization assay, cells were prepared as described
For negative-selection of the TcdB-fragment phage display
above and 0.1 pM TcdBFL was premixed with scFv-Fc
library, an irrelevant scFv-Fc (1 µg in 100 µL PBS/well) was
in cultivation media. After incubation of 30 min at room
immobilized in a Costar High Binding microtiter plate. After
temperature the antibody TcdBFL mixture was transferred to the
blocking with 250 µL panningblock [PBS with 0.05% (v/v)
cells. Pictures of the wells were collected when the percentage of
Tween20, 1% w/v BSA and 1% w/v milk powder] and 3x washing
round cells in the control wells (TcdBFL w/o antibody) reached
of the cavity using Tecan Columbus microplate washer, 109
70–80%.
cfu TcdB-fragment-phage diluted in 150 µL panningblock were
incubated in the negative-selection well for 1 h. The supernatant
Construction and Packaging of of the negative selection well and 1 µg of the irrelevant scFv-Fc
TcdB-Fragment Phage Display Library for competition were transferred to the first of three successive
The pHORF-tcdB-fragment library was generated as described panning wells, which had been coated overnight at 4◦ C with 1 µg
before (Zantow et al., 2016) with minor adjustments. In brief, of the scFv-Fc of interest and blocked with MPBST (PBS with
tcdB was amplified from genomic DNA of Clostridioides difficile 0.05% (v/v) Tween20, and 2% w/v milk powder). After 1 h of
strain 630 (kindly provided by Meina Neumann-Schaal, DSMZ) incubation, the phage were transferred to the second panning
by PCR using Phusion DNA polymerase and the following well, after one further hour to the third well. To prevent the first
oligonucleotides as primers: and the second well from drying, 1 µg of the irrelevant scFv-Fc
diluted in 150 µL PBST was added immediately after transfer.
5′ ATGAGTTTAGTTAATAGAAAACAGTTAGAAAAAATGG
To remove unbound phage, the first well was washed 10x with a
3′ (forward),
harsh bottom wash program using Tecan Columbus microplate
5′ CTATTCACTAATCACTAATTGAGCTGTATCAGG
washer, the second well was washed 6x and the third well 3x using
3′ (reverse)
PBST. Remaining phage were eluted with 150 µL trypsin in PBS
PCR product was fragmented using Bioruptor R Pico sonicator (10 µg /mL) by incubation at 37◦ C for 30 min. 10 µL of eluted
(Diagenode) using following settings: 4◦ C, 45 cycles, 30 s phage were used to infect 50 µL E. coli XL1 blue MRF’ at an
sonication (low intensity), 30 s pause. Fragmented DNA was O.D600nm of 0.5. To generate single clones infected E. coli was
plated on 2x YT-agar supplemented with 100 mM glucose and supernatant (25 µL in 75 µL MPBST). After 1 h incubation at
100 µg/mL ampicillin and incubated overnight at 37◦ C. room temperature and 3x washing, bound phage were detected
using HRP conjugated anti-M13 antibody (GE 27-9421-01,
Panning in Solution 1: 40,000) for 45 min at room temperature followed by 3x
For negative-selection of the TcdB-fragment phage library, a washing. The detection was performed using TMB substrate. The
cavity of a Costar High Binding microtiter plate was coated with colorimetric reaction was stopped by addition of 100 µL 0.5 M
1 µg of an irrelevant scFv-Fc in 100 µL PBS overnight at 4◦ C, H2 SO4 and measured with an ELISA reader (TECAN Sunrise,
then blocked with panningblock for 1 h at room temperature and 450 nm, reference 620 nm).
subsequently washed 3x with PBST using a microplate washer.
109 cfu TcdB-fragment-phage were diluted in 150 µL 2% (w/v) Epitope Mapping by Peptide Array
BSA in PBST and incubated in the negative-selection well for For epitope mapping by peptide array, custom microarray
1 h at room temperature. Magnetic protein A coated SureBeads slides were generated by PEPperPRINT (Heidelberg). Each
(Bio-Rad) were washed according to manufacturer’s instructions. slide contained three copies of the TcdB array [TcdB 15mer
Phage were transferred to a protein low binding (PLB) microtube peptides with 13 amino acids (aa) overlap (2 aa offset)]. To
(Sarstedt) and co-incubated with 15 µL resuspended beads for prepare the microarray slides, the array areas were hydrated
1 h on a programmable rotator-mixer (PRM) (PTR-30 Grant- for 15 min with 500 µL PBST [PBS 0.05% (v/v) Tween20] at
bio) to further remove sticky or unspecific phage. Beads were room temperature and slight orbital shaking (200 rpm). To avoid
separated in a magnetic rack and phage containing supernatant unspecific binding of the scFv-Fcs, the arrays were blocked with
was transferred to a fresh PLB microtube and co-incubated with blocking buffer (MB-070, Rockland, Limerick, USA) for 30 min
100 ng scFv-Fc diluted in 150 µL blocking buffer [2% (w/v) BSA (room temperature, 200 rpm agitation). After washing with PBST,
in PBST] for 2 h on a PRM. An excess of magnetic protein A 1 µg/mL (or 100 µg/mL) scFv-Fc diluted in assay buffer [PBS
coated SureBeads (Bio-Rad) was added to precipitate the scFv- 0.05% (v/v) Tween20 with 10% (v/v) Rockland blocking buffer]
Fc fragments together with the bound TcdB-fragment phage was incubated on the array area (overnight, 4◦ C, 200 rpm). To
(30 min, PRM). Beads were separated in a magnetic rack and remove unbound scFv-Fc, the arrays were washed three times
the supernatant was discarded. Beads were washed 10x with with PBST. The scFv-Fc was detected using a DyLight 680
1 mL PBST, then resuspended in 150 µL trypsin (10 µg/mL) conjugated anti-human Fc antibody (Biomol), diluted 1:2,000 in
and incubated at 37◦ C for 30 min to elute the phage. Infection assay buffer (30 min, room temperature, 200 rpm agitation). The
to obtain individual clones was performed as described before array was washed three times with PBST, dipped in 1 mM Tris
(Panning on immobilized scFv-Fc). HCl pH 7.4 and dried in a jet of air. Slides were scanned and
fluorescence signals were detected at 700 nm with an Odyssey
Production of Monoclonal TcdB-Fragment Phage and Scanner (LI-COR Biotechnology GmbH). Afterwards, the HA-
Screening ELISA tag control peptides were stained, using anti-HA Peptide Ready
Each well of a 96 well polypropylene U-bottom plate was filled Tag Mouse IgG2b (BioXcell) in a 1:5,000 dilution in assay
with 150 µL 2x YT-media [1.6% (w/v) tryptone, 1% (w/v) yeast buffer as a primary, and Anti-Mouse IgG (H+L) DyLight 680
extract, 0.05% (w/v) NaCl] supplemented with 100 mM glucose conjugated (Cell Signaling Technology) 1:5,000 in assay buffer
and 100 µg/mL ampicillin and inoculated with single E. coli as a secondary antibody. Incubation with both antibodies was
colonies derived from the panning (see above) and incubated 30 min at RT and 200 rpm, followed by three times washing with
(37◦ C, 800 rpm, Labnet Vortemp 56) overnight. The plate was PBST. After staining was completed, arrays were dipped in 1 mM
sealed with a breathable film (STARLAB INTERNATIONAL). Tris HCl pH 7.4, dried in a jet of air and used for a second scan.
For phage production 150 µL of fresh 2x YT-GA per well Analysis of the scans was performed using PepSlide Analyzer
were inoculated with 10 µL overnight culture and incubated software (SICASYS Software GmbH).
at 37◦ C and 800 rpm until cells reached exponential growth
phase. Cells were infected with 20 MOI (multiplicity of infection) RESULTS
Hyperphage (M13K071 gIII) (Rondot et al., 2001; Soltes
et al., 2007) for 30 min at 37◦ C without shaking and 30 min Antibody Generation
at 37◦ C at 800 rpm. After pelleting for 10 min at 3,220×g To generate antibodies against the various domains of C. difficile
cells were resuspended in phage production media (2x YT- Toxin B (TcdB) a phage display approach was used. Phage display
media supplemented with 100 µg/mL ampicillin and 50 µg/mL was performed using the two naïve human scFv-libraries HAL9
kanamycin). Phage were produced during overnight incubation and HAL10 (Kügler et al., 2015). To gain a broader antibody
at 30◦ C and 800 rpm. Cells were pelleted at 3,220×g for 10 min diversity and to cover a broader range of epitopes six pannings
and phage containing supernatant was used for screening ELISA. were performed on either domains or fragments of TcdB or the
For screening ELISA, a Costar High Binding microtiter plate full length toxin (TcdBFL ) and at room temperature or 37◦ C. For
were coated with 100 ng scFv-Fc, respectively, 100 ng of irrelevant two pannings, a negative preselection on the N-terminal fraction
scFv-Fc as control in 100 µL PBS overnight at 4◦ C. Wells were of TcdB was performed to direct the selection pressure toward
saturated with MPBST for 1 h at room temperature The plates antibodies that bind within the TLD, more exactly, between aa
were washed 3x with water containing 0.05% (v/v) Tween20 1,128 and 1,852. An overview over the panning strategies and
before adding the monoclonal phage containing production the success of the pannings is given in Table 1. After three
Panning TcdB Fragment ◦C Antigen for Clones Clones Unique Produced and
negative selection screened analyzed characterized as
Fc-Fusion
rounds of panning a total of 562 clones were screened for ViF087_B1, ViF087_B10, ViF087_F1 (Figure 2A), ViF091_B10,
production of TcdB specific scFv in an antigen ELISA (data ViF137A9, and ViF137_C1 (Figure 2E)] the binding to
not shown). On basis of the signal intensity and the signal TcdBFL was notably reduced (≤50% signal intensity at highest
to noise ratio in the screening ELISA, 96 scFv clones were concentration) compared to the respective panning TcdB variant.
further analyzed. Sequencing with subsequent V-gene analysis As expected, there was no binding to TcdB1−1852 or TcdBGTD
and CDR comparison using the VBASE2 tool (Mollova et al., of mAbs that were generated by panning against TcdBCROPs
2010), revealed the isolation of 36 unique scFvs (Table 2). Of the [mAbs ViF137 (Figures 2F,G)] and no binding to TcdBCROPs of
36 antibodies 15 (41%) are IGHV1, 18 (50%) IGHV3, two (5.5%) mAbs that were generated by panning against TcdB1−1852 [mAbs
IGHV5 and one IGHV6. No IGHV2 or IGHV4 antibodies were ViF087, ViF088, ViF090, and ViF091_B10 (Figures 2D,H)],
isolated. The majority (29) of the isolated antibodies contained a proving domain specificity of the mAbs generated in this study.
lambda light chain (9x IGLV1, 10x IGLV2, 8x IGLV3, 2x IGLV6) Of the 31 mAbs tested in this assay, 14 bound to
and only 7 antibodies (18.9%) a kappa light chain (2x IGKV1, 5x TcdBCROPs , among them all antibodies derived from the panning
IGKV3). against TcdBCROPs [mAbs ViF137 (Figure 2H)], as well as the
The scFv genes were cloned into the mammalian expression majority of the antibodies derived from the panning against
vector pCSE2.6-hIgG-Fc, which enables antibody production TcdBFL [SH1429_B10, SH1429_C10, SH1429_D6, SH1429_G1,
in HEK293-6E cells in an scFv-Fc format. After protein A SH1429_G6 (only very weak), and SH1429_H7 (Figure 2L)].
purification of the scFv-Fcs from the culture supernatant, Four mAbs [ViF087_E1, ViF088_C5, ViF088_H10, and
purity of the mAb preparations was controlled by SDS- ViF090_A6 (Figures 2C,G)] bound to TcdBGTD indicating an
PAGE and Coomassie staining (data not shown). There epitope within the GTD domain of TcdB. The remaining
were no visible impurities or breakdown products. Of 13 antibodies bound to immobilized TcdB1−1852 , but not to
the 36 mAbs, 31 were successfully produced and further TcdBGTD . Therefore, it is likely that these antibodies bound to
analyzed. epitopes between aa 543 and 1,852, but due to possible differences
in protein folding between the different TcdB variants, a lack of
TcdBGTD binding in this experiment is not sufficient to exclude
Validation of Antigen Binding and Domain an epitope within this domain.
Mapping
The 31 scFv-Fcs were analyzed by titration ELISA on four
different TcdB variants (TcdBFL , TcdB1−1852 , TcdBGTD and In vitro Neutralization
TcdBCROPs ) first, to verify that format change from scFv to the In a next step, the antibodies were tested for in vitro
bivalent scFv-Fc did not impair antigen recognition, second, neutralization of TcdB. Therefore, a cell based assay with Vero
to analyse TcdBFL binding of antibodies that were generated cells (African green monkey kidney cells) was chosen. Upon
on TcdB fragments, third, to validate antibody TcdB fragment cellular uptake of TcdB and release of the GTD into the cytosol,
specificity and fourth, to determine the binding domains or the GTD glucosylates small Rho GTPases which impairs several
regions of the respective mAbs (Figure 2 and Table 3). cell signaling pathways and consequently leads to a breakdown of
In this ELISA setup, all mAbs bound to their respective the actin cytoskeleton. This effect induces morphological changes
panning TcdB variant in a concentration dependent manner. The like the formation of retraction fibers and finally cell rounding
antibodiesViF137_C3 (Figure 2H) and SH1429_B10 (Figure 2I) (Just et al., 1995). Neutralization efficacy of an antibody was
showed only weak binding in ELISA. analyzed by comparing the percentage of round cells in samples
Interestingly, almost no binding to TcdBFL was detected for of cells treated with TcdB to cells treated with TcdB which was
some mAbs [ViF087_G11, ViF087_H5 (Figure 2A), ViF088_C5, preincubated with an antibody.
ViF088_E10, and ViF137_C2 (Figure 2E)] despite of binding to To determine the optimal working concentration of
the panning antigen. For further seven antibodies [ViF087_A10, TcdBFL for this assay, a serial dilution of TcdB in culture
# mAb name V VH D VH J VH V VL J VL
media was applied to Vero cells. After 5 h, pictures of In a first screening for neutralization, all tested mAbs
the cells were collected and the percentage of round reduced the percentage of round cells after TcdB treatment
cells was determined by counting using ImageJ software. to some extent, with significant neutralization (p > 0.0001)
Cell rounding correlated with TcdBFL concentration (see seen for 12 of 31 mAbs (Figure 3A). Preincubation of TcdB
Supplementary Figure 1). For following neutralization with either ViF087_B1, ViF087_E7, ViF090_G5, ViF137_E4 or
experiments, a TcdBFL concentration of 0.1 pM (resulting SH1429_H7 resulted in more than 50% neutralization. Best in
in around 80% cell rounding) was coincubated with 100 nM vitro neutralization of TcdB was achieved with ViF087_A10,
mAb in cultivation media and subsequently transferred to the ViF087_F3, or SH1429_B1 (>75% reduction of cell rounding).
Vero cells. TcdBFL neutralization of ViF087_A10 and SH1429_B1 was
To determine neutralization efficacy, the percentage of round further verified using serial dilutions of these antibodies
cells was determined and normalized to the percentage of round (Figure 3B). ViF087_F3 was not included since it contains the
cells in the control wells (Vero cells w/o TcdBFL and Vero cells same heavy chain as SH1429_B1 which suggests a neutralization
with TcdBFL w/o mAb). via the same mechanism, and size exclusion chromatography
FIGURE 2 | Antigen ELISA on TcdB variants. 31 mAbs were tested for binding on 100 ng of immobilized fragments of TcdB or full length TcdB. Bound scFv-Fcs were
detected using an HRP conjugated anti-human Fcγ antibody. (A,E,I) Titration on TcdBFL ; (B,F,J) Titration on TcdB1−1852 ; (C,G,K) TcdBGTD was used as antigen;
(D,H,L) Titration on TcdBCROPs .
revealed partial aggregation of ViF087_F3 which was not 2015; Yuan et al., 2015; Tao et al., 2016; Gupta et al., 2017; Chen
seen for SH1429_B1 (data not shown). The dilution series et al., 2018). Hence it might be possible that the anti-TcdBCROPs
confirmed the results of the neutralization screening. At the antibodies generated in this study reduce CROPs mediated
starting concentration of 100 nM ViF087_A10 or SH1429_B1 binding of TcdB to the cell surface but that TcdB induced cell
nearly completely inhibited the cell rounding induced by rounding is not reduced because of the numerous compensation
TcdBFL intoxication (Figure 3B). However, the dilution series mechanisms mediated by the additional cell surface receptors. In
revealed that SH1429_B1 is roughly 10 times more potent than this case a combination of the mAbs directed against TcdBCROPs
ViF087_A10, since 0.1 nM SH1429_B1 was sufficient to reduce with mAbs that bind to the N-terminal domains could lead
cell rounding by ∼50% whereas 1 nM of ViF087_A10 was needed to improved neutralization and synergistic effects. To test this
to achieve a comparable effect. hypothesis, combinations of either ViF087_A10 or SH1429_B1
Next, a combination of ViF087_A10 and SH1429_B1 was with a mAb directed against TcdBCROPs were tested in an in
tested to neutralize TcdBFL in an in vitro assay, but neutralization vitro TcdB neutralization assay. Therefore, 0.1 pM of TcdB was
achieved with this combination was not stronger than for preincubated with 1 nM ViF087_A10 or 0.1 nM SH1429_B1
SH1429_B1 alone (data not shown). [the concentration needed for ∼50% TcdB neutralization as
Unlike Bezlotoxumab, a human anti-TcdB antibody already determined by titration (Figure 3B)] and 100 nM of either of
approved by the FDA for therapy of recurrent CDI (Navalkele the 14 anti-TcdBCROPs mAbs for 30 min at room temperature
and Chopra, 2018), the two most potent neutralizing antibodies and then transferred to Vero cells. TcdB neutralization for
generated in this study (ViF087_A10 and SH1429_B1) bind each antibody combination was compared to neutralization
to epitopes within TcdB1−1852 (Figures 2B,J). Bezlotoxumab achieved with ViF087_A10, or SH1429_B1 alone in the same
binds to two epitopes within the CROPs. There are two assay.
distinct neutralization mechanism possible for Bezlotoxumab: Forty-one percent neutralization was observed for 1 nM
i) blocking of interaction with carbohydrate structures and ViF087_A10 in this assay. Addition of 100 nM of a second mAb
therefore inhibition of cell binding (Orth et al., 2014), ii) directed against TcdBCROPs improved neutralization. The best
inhibition of binding to CSPG4 (Gupta et al., 2017). However, neutralization of ViF087_A10 was achieved in combination with
this antibody proves that neutralization via this repetitive domain ViF137_E4 (73%), SH1429_C10 (70%) and SH1429_H7 (66%)
is feasible. Nevertheless, there are three cellular receptors for (Figure 4A).
TcdB described that bind to specific receptor binding sites 0.1 nM of mAb SH1429_B1 reduced cell rounding by 49%. As
within the TLD, e.g., members of the frizzled family binding for ViF087_A10, addition of 100 nM of an anti-TcdBCROPs mAb
to TcdB1285−1804 with low nanomolar affinity (LaFrance et al., increased neutralization and best neutralizing with SH1429_B1
# mAb name Antigen (Panning) TcdB variants bound in ELISA WB Epitope region (Peptide array; position Minimal epitope region (MER, No of clones
of 1st aa of 15mer peptide) phage display) contributing to MER
Fühner et al.
9
18 ViF137_A6 TcdBCROPs TcdBFL , TcdBCROPs + aa 2340–2344 aa 2275–2364 23
19 ViF137_A9 TcdBCROPs TcdBFL , (≤50%), TcdBCROPs + KYYF◦ (◦ =D or N) aa 1854–1862, aa 1858–1868 13
2080–2086, and 2212–2216
20 ViF137_C1 TcdBCROPs TcdBFL , (≤50%), TcdBCROPs + No hits –
21 ViF137_C2 TcdBCROPs TcdBFL , (–), TcdBCROPs + No hits –
22 ViF137_C3 TcdBCROPs TcdBCROPs (–) + aa 1922–1938 aa 1860–1992 3
23 ViF137_E4 TcdBCROPs TcdBFL , TcdBCROPs + aa 2342–2344 aa 2292–2364 18
24 ViF137_E7 TcdBCROPs TcdBFL , TcdBCROPs + *KYYF◦ (* =I, S or D; ◦ =D or N) aa 2 epitopes, shared motif: 17 + 5
1852–1860, 2078–2084, and 2212–2216 DKYYFNP aa 1862–1868 and
2220–2226
25 SH1429_B1 TcdBFL TcdBFL , TcdB1−1852 +/– aa 414–424 aa 423–432 8
26 SH1429_B10 TcdBFL TcdBFL , TcdBCROPs – aa 2267–2364 19
27 SH1429_C10 TcdBFL TcdBFL , TcdBCROPs + aa 2340–2342 aa 2333–2363 15
28 SH1429_D6 TcdBFL TcdBFL , TcdBCROPs + aa 2078 and 2084 aa 2010–2118 6
29 SH1429_G1 TcdBFL TcdBFL , TcdBCROPs + aa 2316–2324 aa 2267–2364 10
30 SH1429_G6 TcdBFL TcdBFL , TcdBCROPs (–) + aa 2228–2291 4
31 SH1429_H7 TcdBFL TcdBFL , TcdBCROPs + aa 2276–2364 11
Result of western blot shown as +: strong binding to linearized TcdB or its fragments, +/–: mixed results, –: no binding to linearized TcdB or its fragments.
FIGURE 3 | In vitro neutralization of TcdB. TcdB (0.1 pM) and mAbs were coincubated in cultivation media and transferred to subconfluent Vero cells in 96 well plates.
Pictures of each well were taken when cell rounding in NK control wells (TcdB w/o antibody) was 70–80%. Number of round cells were normalized to NK control and
percentage of round cells after media exchange (w/o toxin or antibody) was set to 100% neutralization. (A) Initial screening for neutralization using all 31 mAbs in a
10,000-fold molar excess. Bars represent technical triplicates with SD as error bars. A one-way ANOVA test was performed for each antibody against the isotype
control TM43_E10 (Kügler et al., 2015) *p < 0.0001. (B) IC50 of ViF087_A10 and SH1429_B1 were estimated with serial antibody dilutions.
was achieved in combination with the same TcdBCROPs binders binding regions of a significant number of antibodies, two
as for ViF087_A10, namely ViF137_E4 (79%), SH1429_C10 different approaches were used. First, all antibodies were tested
(78.9%) or SH1429_H7 (83.6%) (Figure 4B). Remarkably, on a peptide array consisting of 15mer peptides of TcdB. The
the anti-TcdBCROPs mAbs leading to the highest increase maximum resolution of this array was two amino acids due
of neutralization with either ViF087_A10 or SH1429_B1 in to the 2 aa offset of two neighboring peptides on the array.
this assay were the same mAbs that already showed best This approach was successful for about 40% of the antibodies
neutralization among TcdBCROPs binders in the initial screening (Table 3). Two antibodies (ViF137_A9 and ViF137_E7) were
as single antibodies (ViF137_E4 53%, SH1429_C1048%, found to exclusively bind to three clusters of peptides within the
SH1429_H7 56%). Therefore, the increase of neutralization in CROP domain (1858–1869, 2084–2095, 2216–2227, and 1858–
this combinatory assay seems to be based on additive rather than 1867, 2084–2093, 2218–2225, respectively) (Figure 5D). These
synergistic effects. clusters contain a common motif which probably resembles
the key amino acids necessary for antibody-antigen interaction
Epitope Mapping [KYYF† († = D or N) and ∗ KYYF† (∗ = I, S or D, † = D or N),
To identify the epitopes of ViF087_A10 and SH1429_B1 that respectively]. The two neutralizing antibodies ViF087_A10 and
elicit neutralization, and gain more information about the SH1429_B1 both specifically bound to the five 15mer peptides
binding sites of the other antibodies, epitope mapping was starting between aa 414 and 422. ViF087_A10 additionally also
performed. To generate reliable data and to increase the chance bound to the peptides starting at aa position 402 and 404
of identifying the epitopes or at least to narrow down the (Supplementary Figure 2).
FIGURE 5 | Crystal structures of the glucosyltransferase of TcdB (A–C, PDB 2bvm), the N-terminal (D,E PDB 4np4) and C-terminal (F, PDB 4nc2) fraction of the
CROP domain with highlighted epitopes of mapped antibodies. Figures were created using PyMOL (De Lano, 2002) (F) overview over epitopes mapped to TcdB in
this study. Neutralizing epitopes are highlighted in red. Neutralizing epitopes published by others are designated in gray (Orth et al., 2014; Kroh et al., 2018).
clinical efficacy in clinical phase 31 . In the clinical phase three due to steric hindrance, which could explain reduced antibody
study (MODIFY II) the CDI recurrence was reduced from 26 binding on full length TcdB. Different antibody binding on TcdB
to 16% by Bezlotoxumab (Wilcox et al., 2017). Because of this fragments and full length TcdB was also shown by Chung and
limited efficacy and the fact that currently three different TcdB coworkers (this issue of Frontiers Microbiology).
receptors and a potential carbohydrate structure (Greco et al., Fourteen of the antibodies characterized in this study bind
2006; LaFrance et al., 2015; Yuan et al., 2015; Tao et al., 2016; to TcdBCROPs , 14 to TcdB1−1852 but not to TcdBGTD . Despite of
Gupta et al., 2017) are described as interaction partners, new depletion of the library by incubation on immobilized TcdB1−1128
studies to describe neutralizing and non-neutralizing epitopes prior to the panning in cases of panning ViF087 and ViF090,
are necessary, for further development of antibody combinations four antibodies were obtained that bind to TcdB1−1852 and
that potentially improve clinical outcome. For these reasons, we TcdBGTD . For the domain mapping ELISA, an enzymatically
generated a set of novel human monoclonal antibodies targeting inactive GTD mutant (D286/288N) was used. Even though there
TcdB using phage display. are only two amino acids exchanged, the overall structure of
We performed a total of six antibody selections using different the domain might be changed. Therefore, epitopes might not be
fragments/ functional domains of TcdB, and different panning accessible or conformational epitopes might be destroyed. Loss
strategies. The panning strategies differed in regards of the TcdB of antibody binding after mutation of single amino acids had
fragments and temperature used. Since all six panning strategies already been described in the literature for antibodies targeting
led to the identification of unique and specific antibodies, the diphtheria DT toxin (Bigio et al., 1987), among many
enrichment of specific antibody phage directed against the others. To avoid the generation of antibodies which are not
different TcdB variants was successful in all cases. Sequencing binding the full length protein, antibody generation strategies
revealed the isolation of a total of 36 unique human antibodies. could be applied with alternating panning rounds on full length
In accordance to previous studies, pooling of lambda and kappa protein and protein fragments to focus on a particular epitope
libraries led to an enhanced but not exclusive selection of lambda (Thie et al., 2011).
antibodies (80%) and also the subfamily distribution of selected Since CROPs, GTD, and TLD of TcdB all harbor epitopes
antibodies represents the pattern that was described before that can be targeted for neutralization (Babcock et al., 2006;
(Kügler et al., 2015). Marozsan et al., 2012; Wang et al., 2012; Maynard-Smith et al.,
For further validation and characterization, the antibody 2014; Anosova et al., 2015) all antibodies were subsequently
candidates were converted into the IgG like bivalent scFv-Fc tested in an in vitro TcdB neutralization assay which is based on
format. Due to a fast cloning and better production rates, this cell rounding of Vero cells. All 31 mAbs reduced the percentage
format is preferred over the full IgG format for the rapid of round cells after TcdB treatment to some extent and therefore
screening of a higher number of candidate antibodies (Bujak had slight neutralizing effects. However, of the 14 antibodies
et al., 2014; Rasetti-Escargueil et al., 2017). directed against the CROPs domain only two (ViF137_E7 and
Thirty-one antibodies were tested for antigen binding and SH1429_H7) had neutralization efficacies of more than 75%. A
domain specificity in an antigen ELISA on four different TcdB previous study showed, that generation of neutralizing antibodies
variants (TcdBFL , TcdB1−1852 , TcdBCROPs , and TcdBGTD ). By against TcdB CROPs is difficult through immunization as well
antigen ELISA on the respective panning antigen, we validated (Maynard-Smith et al., 2014). Based on homology to TcdA, the
that the antibody antigen interaction was not impaired by the CROPs of TcdB were proposed to harbor 4 putative carbohydrate
format change from scFv to scFv-Fc and switch of the production binding sites (Greco et al., 2006; Orth et al., 2014) which
system, since all antibodies bound to their respective antigen, may contribute avidity effects upon cell binding. These binding
albeit 2 out of 31 weaker. sites share structural similarity (repetitive elements) but differ
Interestingly, for five antibodies almost no binding to TcdBFL in respect to their amino acid sequence, therefore it may be
was detected and for further seven antibodies the binding to difficult to develop a single antibody that completely blocks all
TcdBFL was drastically reduced compared to the respective interactions between the CROPs and the carbohydrate structures.
panning antigen. All these antibodies were generated on As revealed by crystal structure analysis, the already approved
fragments of TcdB, therefore the epitopes or binding regions of therapeutic antibody Bezlotoxumab binds to two epitopes within
these antibodies might not be accessible in the tertiary structure the CROPs, therefore it was suggested that this antibody blocks
of the full length TcdB or not folded correctly in the fragments. interaction of the CROPs with carbohydrate structures on the
For TcdA a 3D model of the holotoxin on the basis of electron cell surface (Orth et al., 2014). Nevertheless, binding to aa 1878–
micrographs reveals the domain organization of the toxin (Pruitt 1961 also inhibits interaction with CSPG4 receptor (Gupta et al.,
et al., 2010). In this model the CROPs form a long tail that 2017) and due to the existence of two epitopes within the
lays back onto the N-terminal portion of the toxin. Electron CROP domain also aggregation of the toxin as neutralization
micrographs of TcdB suggest a similar domain organization in mechanism cannot be excluded. As of today, it is not clear which
this homologous toxin (Pruitt et al., 2010). Epitope regions that of the above mentioned is the major neutralization mechanism of
are located at the interface between CROPs and the N-terminal Bezlotoxumab.
portion of the toxin may be less accessible in the full length toxin The anti-CROPs mAbs generated in this study did not lead
to a substantially increased neutralization when applied together
1 Merck Newsroom Home (2015). Available online at: https://www.mrknewsroom. with mAbs directed against the N-terminal fraction of TcdB (aa
com/ (Accessed September 26, 2018). 1–1852), showing at most an additive effect.
The two best neutralizers ViF087_A10 and SH1429_B1 with For most antibodies that exclusively bind to TcdB1−1852 and
neutralizing IC50 values of ∼1 nM and ∼0.1 nM, respectively, TcdBFL in antigen ELISA it was not possible to determine the
are directed against the N-terminal fraction of TcdB (aa 1– epitope by neither of the methods tested. These mAbs probably
1852). Via antigen ELISA it was not possible to narrow down bind to complex discontinuous epitopes, including aa that are
the binding region to a single domain. Therefore, an epitope located far apart on the primary structure of TcdB and only
mapping via peptide array and phage display was performed. come into close proximity upon folding of the polypeptide
In these assays all antibodies were included with the hope chain. Such epitopes might be hard to display on phage due
to identify correlations between epitopes and neutralization to a selection pressure toward smaller peptides during library
efficacy. Unfortunately, but not unexpectedly, epitope mapping packaging (Kügler et al., 2008) and potential misfolding of the
by peptide array was not successful for the majority of the antigen fragments.
tested antibodies. Since a prerequisite for binding of antibodies In conclusion, a panel of novel fully human monoclonal
to peptides immobilized on the array surface is that the antibodies was generated that target TcdB of C. difficile
antibodies bind to continuous epitopes not including complex (Figure 5F). A new neutralizing epitope was found located
folding (Abbott et al., 2014), this result suggests that most within the GTD of TcdB. For future development of neutralizing
of the identified human antibodies are very likely to bind to antibodies, the following regions may be addressed (i) aa 290–
complex conformational and/or discontinuous epitopes. This 360 (Kroh et al., 2018), (ii) aa 423 432 (epitope of the two best
hypothesis was also supported by data from immunoblot assays, neutralizers generated in this study), (iii) aa 1372-1493, involved
where most antibodies did not bind to denatured, linearized in binding to poliovirus receptor- like protein-3 (LaFrance et al.,
TcdB (example given in Supplementary Figure 3). Nevertheless, 2015; Manse and Baldwin, 2015), (iv) aa 1810–1850, involved in
even though ViF087_A10 does not bind to denatured TcdB CSPG4 binding (Gupta et al., 2017) and aa 1430–1600 containing
in immunoblot and SH1429_B1 only very weakly, the core the binding site for FZD- cysteine rich domain (Chen et al., 2018),
of their epitope is a continuous aa stretch within the GTD whereas the following regions may be omitted: (i) N-terminus
(aa 423–433 and 423–432, respectively). This epitope, primarily and C-terminus of GTD, since antibodies against these regions
found by peptide array, was also confirmed by antigen fragment generated in this study did not show significant neutralization,
phage display, a method that also allows the identification of (ii) the C-terminus of CROPs (Maynard-Smith et al., 2014; Gupta
conformational epitopes (Cariccio et al., 2016). Remarkably, both et al., 2017).
neutralizing antibodies share the same epitope that is a surface
exposed α-helical secondary structure located in close proximity AUTHOR CONTRIBUTIONS
to the substrate binding groove for the small Rho-GTPases
(Figure 5B). VF, PH, SH, SG, and JH performed experiments. VF, SG, FL,
This epitope is well conserved between the clinically most SD, RG, and MH planned and analyzed experiments. SD, RG,
relevant strains of CDiff clade 1 and clade 2 (hypervirulent and MH conceived the study. VF, SD, RG, and MH wrote the
strains), however strains of the TcdA− TcdB+ in clade 4 show manuscript. All authors contributed to the final manuscript.
some variance in this region.
Due to the localization of the epitope, at least two ACKNOWLEDGMENTS
neutralization mechanisms are possible for ViF087_A10 and
SH1429_B1: (i) inhibition of substrate binding or (ii) sterical This work was funded by the Federal State of Lower Saxony,
hindrance of TcdBGTD translocation through the pore. The Niedersächsisches Vorab VWZN2889 and VWZN3215/
latter mode of action was recently described for the humanized VWZN3266 (SD and MH Project B5 and RG, Project B1), as well
monoclonal antibody PA41 that binds to aa 290–360 (Kroh et al., as the BMBF NanoMatFutur (13XP5050A) and the Max Planck
2018). Society to FL.
For one antibody, ViF137_C3, an epitope (aa 1860–1992) We are grateful to Helma Tagte, Hannover Medical school,
was found that includes one of the epitopes described for Institute for Toxicology, for producing TcdB and the fragments
Bezlotoxumab where aa 1902–1907 were shown to be partially thereof.
protected from H/D exchange by bezlotoxumab (Orth et al.,
2014). Nevertheless, TcdB neutralization achieved with this SUPPLEMENTARY MATERIAL
antibody in cell rounding assays was only <50%. Unfortunately,
the minimal epitope region identified by phage display was larger, The Supplementary Material for this article can be found
thus not allowing conclusions on whether our antibody interacts online at: https://www.frontiersin.org/articles/10.3389/fmicb.
with the same amino acids of TcdB. 2018.02908/full#supplementary-material
REFERENCES Anosova, N. G., Cole, L. E., Li, L., Zhang, J., Brown, A. M., Mundle, S., et al. (2015).
A combination of three fully human Toxin A- and Toxin B-specific monoclonal
Abbott, W. M., Damschroder, M. M., and Lowe, D. C. (2014). Current approaches antibodies protects against challenge with highly virulent epidemic strains of
to fine mapping of antigen–antibody interactions. Immunology 142, 526–535. Clostridium difficile in the hamster model. Clin. Vaccine Immunol. 22, 711–725.
doi: 10.1111/imm.12284 doi: 10.1128/CVI.00763-14
Babcock, G. J., Broering, T. J., Hernandez, H. J., Mandell, R. B., Donahue, K., Greco, A., Ho, J. G. S., Lin, S. J., Palcic, M. M., Rupnik, M., and Ng, K. K. S. (2006).
Boatright, N., et al. (2006). Human monoclonal antibodies directed against Carbohydrate recognition by Clostridium difficile toxin A. Nat. Struct. Mol. Biol.
toxins A and B prevent Clostridium difficile-induced mortality in hamsters. 13, 460–461. doi: 10.1038/nsmb1084
Infect. Immun. 74, 6339–6347. doi: 10.1128/IAI.00982-06 Gupta, P., Zhang, Z., Sugiman-Marangos, S. N., Tam, J., Raman, S., Julien,
Bartlett, J. G., Chang, T. W., Gurwith, M., Gorbach, S. L., and Onderdonk, J. P., et al. (2017). Functional defects in Clostridium difficileTcdB toxin
A. B. (1978). Antibiotic-associated pseudomembranous colitis uptake identify CSPG4 receptor-binding determinants. J. Biol. Chem. 292,
due to toxin-producing clostridia. N. Engl. J. Med. 298, 531–534. 17290–17301. doi: 10.1074/jbc.M117.806687
doi: 10.1056/NEJM197803092981003 Ivarsson, M., Leroux, J. C., and Castagner, B. (2017). 4,6-di-(o-Thiophosphate)-
Beer, L. A., Tatge, H., Schneider, C., Ruschig, M., Hust, M., Barton, J., Inositol-1,2,3,5-Tetra-o-Sulfate for C. difficile Infection. Available online at:
et al. (2018). The binary Toxin CDT of Clostridium difficile as a tool for https://patents.google.com/patent/WO2017098033A1/en (Accessed May 14,
intracellular delivery of bacterial glucosyltransferase domains. Toxins 10:225. 2018).
doi: 10.3390/toxins10060225 Jäger, V., Büssow, K., Wagner, A., Weber, S., Hust, M., Frenzel, A.,
Bigio, M., Rossi, R., Nucci, D., Antoni, G., Rappuoli, R., and Ratti, G. (1987). et al. (2013). High level transient production of recombinant antibodies
Conformational changes in diphtheria toxoids: analysis with monoclonal and antibody fusion proteins in HEK293 cells. BMC Biotechnol. 13:52.
antibodies. FEBS Lett. 218, 271–276. doi: 10.1016/0014-5793(87)81060-8 doi: 10.1186/1472-6750-13-52
Bolton, R. P., and Culshaw, M. A. (1986). Faecal metronidazole concentrations Joost, I., Speck, K., Herrmann, M., and von Müller, L. (2009). Characterisation
during oral and intravenous therapy for antibiotic associated colitis due to of Clostridium difficile isolates by slpA and tcdC gene sequencing. Int. J.
Clostridium difficile. Gut 27, 1169–1172. Antimicrob. Agents 33(Suppl 1), S13–S18. doi: 10.1016/S0924-8579(09)70010-X
Bujak, E., Matasci, M., Neri, D., and Wulhfard, S. (2014). Reformatting of scFv Just, I., Selzer, J., Wilm, M., von Eichel-Streiber, C., Mann, M., and Aktories, K.
antibodies into the scFv-Fc format and their downstream purification. Methods (1995). Glucosylation of Rho proteins by Clostridium difficile toxin B. Nature
Mol. Biol. 1131, 315–334. doi: 10.1007/978-1-62703-992-5_20 375, 500–503. doi: 10.1038/375500a0
Burger, S., Tatge, H., Hofmann, F., Genth, H., Just, I., and Gerhard, R. Krivan, H. C., Clark, G. F., Smith, D. F., and Wilkins, T. D. (1986). Cell surface
(2003). Expression of recombinant Clostridium difficile toxin A using the binding site for Clostridium difficile enterotoxin: evidence for a glycoconjugate
Bacillus megaterium system. Biochem. Biophys. Res. Commun. 307, 584–588. containing the sequence Gal alpha 1-3Gal beta 1-4GlcNAc. Infect. Immun. 53,
doi: 10.1016/S0006-291X(03)01234-8 573–581.
Busch, C., Hofmann, F., Selzer, J., Munro, S., Jeckel, D., and Aktories, K. Kroh, H. K., Chandrasekaran, R., Zhang, Z., Rosenthal, K., Woods, R., Jin, X., et al.
(1998). A common motif of eukaryotic glycosyltransferases is essential for the (2018). A neutralizing antibody that blocks delivery of the enzymatic cargo
enzyme activity of large clostridial cytotoxins. J. Biol. Chem. 273, 19566–19572. of Clostridium difficiletoxin TcdB into host cells. J. Biol. Chem. 293, 941–952.
doi: 10.1074/jbc.273.31.19566 doi: 10.1074/jbc.M117.813428
Cariccio, V. L., Domina, M., Benfatto, S., Venza, M., Venza, I., Faleri, A., Kügler, J., Nieswandt, S., Gerlach, G. F., Meens, J., Schirrmann, T., and Hust,
et al. (2016). Phage display revisited: epitope mapping of a monoclonal M. (2008). Identification of immunogenic polypeptides from a Mycoplasma
antibody directed against Neisseria meningitidis adhesin A using the PROFILER hyopneumoniae genome library by phage display. Appl. Microbiol. Biotechnol.
technology. mAbs 8, 741–750. doi: 10.1080/19420862.2016.1158371 80, 447–458. doi: 10.1007/s00253-008-1576-1
Centers of Disease Control and Prevention (2013). Antibiotic Resistance Threats in Kügler, J., Wilke, S., Meier, D., Tomszak, F., Frenzel, A., Schirrmann, T., et al.
the United States, 2013 | Antibiotic/Antimicrobial Resistance | CDC. Antibiotic (2015). Generation and analysis of the improved human HAL9/10 antibody
Resistance Threats in the United States, 2013 | Antibiotic/Antimicrobial phage display libraries. BMC Biotechnol. 15:10. doi: 10.1186/s12896-015-
Resistance | CDC. Available online at: https://www.cdc.gov/drugresistance/ 0125-0
threat-report-2013/ (Accessed April 6, 2018). Kurtz, C. B., Cannon, E. P., Brezzani, A., Pitruzzello, M., Dinardo, C., Rinard,
Chen, P., Tao, L., Wang, T., Zhang, J., He, A., Lam, K., et al. (2018). Structural basis E., et al. (2001). GT160-246, a Toxin binding polymer for treatment of
for recognition of frizzled proteins by Clostridium difficile toxin B. Science 360, Clostridium difficile colitis. Antimicrob. Agents Chemother. 45, 2340–2347.
664–669. doi: 10.1126/science.aar1999. doi: 10.1128/AAC.45.8.2340-2347.2001
De Lano, W. L. (2002). The PyMOL Molecular Graphics System. San Carlos, CA: LaFrance, M. E., Farrow, M. A., Chandrasekaran, R., Sheng, J., Rubin, D. H., and
Schrödinger LLC. Lacy, D. B. (2015). Identification of an epithelial cell receptor responsible for
DePestel, D. D., and Aronoff, D. M. (2013). Epidemiology of Clostridium difficile Clostridium difficile TcdB-induced cytotoxicity. Proc. Natl. Acad. Sci. U.S.A.
infection. J. Pharm. Pract. 26, 464–475. doi: 10.1177/0897190013499521 112, 7073–7078. doi: 10.1073/pnas.1500791112
Egerer, M., Giesemann, T., Jank, T., Satchell, K. J. F., and Aktories, K. Lessa, F. C., Mu, Y., Bamberg, W. M., Beldavs, Z. G., Dumyati, G. K.,
(2007). Auto-catalytic cleavage of Clostridium difficile toxins A and B Dunn, J. R., et al. (2015). Burden of Clostridium difficile Infection in
depends on cysteine protease activity. J. Biol. Chem. 282, 25314–25321. the United States. N. Engl. J. Med. 372, 825–834. doi: 10.1056/NEJMoa14
doi: 10.1074/jbc.M703062200 08913
Erdmann, J., Junemann, J., Schröder, A., Just, I., Gerhard, R., and Pich, A. Manse, J. S., and Baldwin, M. R. (2015). Binding and entry of Clostridium
(2017). Glucosyltransferase-dependent and -independent effects of TcdB on the difficile toxin B is mediated by multiple domains. FEBS Lett. 589, 3945–3951.
proteome of HEp-2 cells. Proteomics 17:1600435. doi: 10.1002/pmic.201600435 doi: 10.1016/j.febslet.2015.11.017
Frisch, C., Gerhard, R., Aktories, K., Hofmann, F., and Just, I. (2003). Marozsan, A. J., Ma, D., Nagashima, K. A., Kennedy, B. J., Kang, Y., Arrigale, R.
The complete receptor-binding domain of Clostridium difficile toxin A is R., et al. (2012). Protection against Clostridium difficile infection with broadly
required for endocytosis. Biochem. Biophy. Res. Commun. 300, 706–711. neutralizing antitoxin monoclonal antibodies. J. Infect. Dis. 206, 706–713.
doi: 10.1016/S0006-291X(02)02919-4 doi: 10.1093/infdis/jis416
Gao, Q., and Huang, H. (2015). Update on antimicrobial resistance in Clostridium Maynard-Smith, M., Ahern, H., McGlashan, J., Nugent, P., Ling, R., Denton, H.,
difficile. Yi Chuan 37, 458–464. doi: 10.16288/j.yczz.15-131 et al. (2014). Recombinant antigens based on toxins A and B of Clostridium
Genisyuerek, S., Papatheodorou, P., Guttenberg, G., Schubert, R., Benz, R., and difficile that evoke a potent toxin-neutralising immune response. Vaccine 32,
Aktories, K. (2011). Structural determinants for membrane insertion, pore 700–705. doi: 10.1016/j.vaccine.2013.11.099
formation and translocation of Clostridium difficile toxin B. Mol. Microbiol. Mollova, S., Retter, I., Hust, M., and Müller, W. (2010). “Analysis of single
79, 1643–1654. doi: 10.1111/j.1365-2958.2011.07549.x chain antibody sequences using the VBASE2 Fab Analysis Tool,” in Antibody
Gerding, D. N., Johnson, S., Rupnik, M., and Aktories, K. (2014). Clostridium Engineering Vol. 2, eds R. Kontermann and S. Dübel, (Berlin;Heidelberg:
difficile binary toxin CDT: mechanism, epidemiology, and potential clinical Springer-Verlag), 3–10.
importance. Gut Microbes 5, 15–27. doi: 10.4161/gmic.26854 Natarajan, M., Walk, S. T., Young, V. B., and Aronoff, D. M. (2013). A clinical and
Goldstein, E. J. C., Babakhani, F., and Citron, D. M. (2012). Antimicrobial activities epidemiological review of non-toxigenic Clostridium difficile. Anaerobe 22, 1–5.
of fidaxomicin. Clin. Infect. Dis. 55(Suppl 2), S143–148. doi: 10.1093/cid/cis339 doi: 10.1016/j.anaerobe.2013.05.005
Navalkele, B. D., and Chopra, T. (2018). Bezlotoxumab: an emerging monoclonal Antimicrob. Agents Chemother. 59, 7178–7183. doi: 10.1128/AAC.
antibody therapy for prevention of recurrent Clostridium difficile infection. 05050-14
Biologics 12, 11–21. doi: 10.2147/BTT.S127099 Tao, L., Zhang, J., Meraner, P., Tovaglieri, A., Wu, X., Gerhard, R., et al. (2016).
Olling, A., Goy, S., Hoffmann, F., Tatge, H., Just, I., and Gerhard, R. (2011). Frizzled proteins are colonic epithelial receptors for C. difficile toxin B. Nature
The repetitive oligopeptide sequences modulate cytopathic potency but are not 538, 350–355. doi: 10.1038/nature19799
crucial for cellular uptake of Clostridium difficile toxin A. PLoS ONE 6:e17623. Tedesco, F., Markham, R., Gurwith, M., Christie, D., and Bartlett, J. G. (1978).
doi: 10.1371/journal.pone.0017623 Oral vancomycin for antibiotic-associated pseudomembranous colitis. Lancet
Olling, A., Hüls, C., Goy, S., Müller, M., Krooss, S., Rudolf, I., et al. (2014). The 2, 226–228.
combined repetitive oligopeptides of clostridium difficile toxin A counteract Thie, H., Toleikis, L., Li, J., von Wasielewski, R., Bastert, G., Schirrmann, T., et al.
premature cleavage of the glucosyl-transferase domain by stabilizing protein (2011). Rise and fall of an anti-MUC1 specific antibody. PLoS ONE 6:e15921.
conformation. Toxins 6, 2162–2176. doi: 10.3390/toxins6072162 doi: 10.1371/journal.pone.0015921
Orth, P., Xiao, L., Hernandez, L. D., Reichert, P., Sheth, P. R., Beaumont, M., U.S. Food and Drug Administration. Drug Innovation - Novel
et al. (2014). Mechanism of action and epitopes of Clostridium difficile toxin B- Drugs Summary 2016. Available online at: https://www.fda.gov/
neutralizing antibody bezlotoxumab revealed by X-ray crystallography. J. Biol. Drugs/DevelopmentApprovalProcess/DrugInnovation/ucm534863.
Chem. 289, 18008–18021. doi: 10.1074/jbc.M114.560748 htm(AccessedNov.21,2018).
Pépin, J., Routhier, S., Gagnon, S., and Brazeau, I. (2006). Management and von Eichel-Streiber, C., Sauerborn, M., and Kuramitsu, H. K. (1992).
outcomes of a first recurrence of Clostridium difficile-associated disease in Evidence for a modular structure of the homologous repetitive C-
Quebec, Canada. Clin. Infect. Dis. 42, 758–764. doi: 10.1086/501126 terminal carbohydrate-binding sites of Clostridium difficile toxins and
Pruitt, R. N., Chambers, M. G., Ng, K. K. S., Ohi, M. D., and Lacy, D. B. Streptococcus mutans glucosyltransferases. J. Bacteriol. 174, 6707–6710.
(2010). Structural organization of the functional domains of Clostridium doi: 10.1128/jb.174.20.6707-6710.1992
difficile toxins A and B. Proc. Natl. Acad. Sci. U.S.A. 107, 13467–13472. Wang, H., Sun, X., Zhang, Y., Li, S., Chen, K., Shi, L., et al. (2012). A Chimeric toxin
doi: 10.1073/pnas.1002199107 vaccine protects against primary and recurrent Clostridium difficile infection.
Puri, B. K., Hakkarainen-Smith, J. S., and Monro, J. A. (2015). The Infect. Immun. 80, 2678–2688. doi: 10.1128/IAI.00215-12
potential use of cholestyramine to reduce the risk of developing Weber, L. K., Isse, A., Rentschler, S., Kneusel, R. E., Palermo, A., Hubbuch, J., et al.
Clostridium difficile-associated diarrhoea in patients receiving long-term (2017a). Antibody fingerprints in lyme disease deciphered with high density
intravenous ceftriaxone. Med. Hypoth. 84, 78–80. doi: 10.1016/j.mehy.2014. peptide arrays. Eng. Life Sci. 17, 1078–1087. doi: 10.1002/elsc.201700062
11.020 Weber, L. K., Palermo, A., Kügler, J., Armant, O., Isse, A., Rentschler, S.,
Rasetti-Escargueil, C., Avril, A., Miethe, S., Mazuet, C., Derman, Y., Selby, et al. (2017b). Single amino acid fingerprinting of the human antibody
K., et al. (2017). The european AntibotABE framework program and its repertoire with high density peptide arrays. J. Immunol. Methods 443, 45–54.
update: development of innovative botulinum antibodies. Toxins 9:E309. doi: 10.1016/j.jim.2017.01.012
doi: 10.3390/toxins9100309 Wilcox, M. H., Gerding, D. N., Poxton, I. R., Kelly, C., Nathan, R., Birch, T.,
Razavi, B., Apisarnthanarak, A., and Mundy, L. M. (2007). Clostridium difficile: et al. (2017). Bezlotoxumab for prevention of recurrent Clostridium difficile
emergence of hypervirulence and fluoroquinolone resistance. Infection 35, infection. N. Engl. J. Med. 376, 305–317. doi: 10.1056/NEJMoa1602615
300–307. doi: 10.1007/s15010-007-6113-0 Wohlan, K., Goy, S., Olling, A., Srivaratharajan, S., Tatge, H., Genth, H.,
Reineke, J., Tenzer, S., Rupnik, M., Koschinski, A., Hasselmayer, O., Schrattenholz, et al. (2014). Pyknotic cell death induced by Clostridium difficile TcdB:
A., et al. (2007). Autocatalytic cleavage of Clostridium difficile toxin B. Nature chromatin condensation and nuclear blister are induced independently
446, 415–419. doi: 10.1038/nature05622 of the glucosyltransferase activity. Cell Microbiol. 16, 1678–1692.
Rondot, S., Koch, J., Breitling, F., and Dübel, S. (2001). A helper phage to improve doi: 10.1111/cmi.12317
single-chain antibody presentation in phage display. Nat. Biotechnol. 19, 75–78. Yuan, P., Zhang, H., Cai, C., Zhu, S., Zhou, Y., Yang, X., et al. (2015). Chondroitin
doi: 10.1038/83567 sulfate proteoglycan 4 functions as the cellular receptor for Clostridium difficile
Rothman, S. W., Brown, J. E., Diecidue, A., and Foret, D. A. (1984). Differential toxin B. Cell Res. 25, 157–168. doi: 10.1038/cr.2014.169
cytotoxic effects of toxins A and B isolated from Clostridium difficile. Infect. Zantow, J., Just, S., Lagkouvardos, I., Kisling, S., Dübel, S., Lepage, P., et al. (2016).
Immun. 46, 324–331. Mining gut microbiome oligopeptides by functional metaproteome display. Sci.
Rupnik, M., Wilcox, M. H., and Gerding, D. N. (2009). Clostridium difficile Rep. 6:34337. doi: 10.1038/srep34337
infection: new developments in epidemiology and pathogenesis. Nat. Rev.
Microbiol. 7, 526–536. doi: 10.1038/nrmicro2164 Conflict of Interest Statement: VF, SD, FL, RG and MH are inventors on a
Russo, G., Meier, D., Helmsing, S., Wenzel, E., Oberle, F., Frenzel, A., et al. (2018a). patent application regarding the novel neutralizing epitope within the GTD and
Parallelized antibody selection in microtiter plates. Methods Mol. Biol. 1701, corresponding antibodies. They hereby declare that the patent application does
273–284. doi: 10.1007/978-1-4939-7447-4_14 not alter their adherence to all Frontiers in Microbiology policies on sharing data
Russo, G., Theisen, U., Fahr, W., Helmsing, S., Hust, M., Köster, R. W., et al. and materials.
(2018b). Sequence defined antibodies improve the detection of cadherin
2 (N-cadherin) during zebrafish development. N. Biotechnol. 45, 98–112. The remaining authors declare that the research was conducted in the absence of
doi: 10.1016/j.nbt.2017.12.008 any commercial or financial relationships that could be construed as a potential
Shen, A., Lupardus, P. J., Puri, A. W., Albrow, V. E., Gersch, M. M., Garcia, conflict of interest.
K. C., et al. (2011). Defining an allosteric circuit in the cysteine protease
domain of Clostridium difficile toxins. Nat. Struct. Mol. Biol. 18, 364–371. Copyright © 2018 Fühner, Heine, Helmsing, Goy, Heidepriem, Loeffler, Dübel,
doi: 10.1038/nsmb.1990 Gerhard and Hust. This is an open-access article distributed under the terms
Soltes, G., Hust, M., Ng, K. K. Y., Bansal, A., Field, J., Stewart, D. I. H., et al. (2007). of the Creative Commons Attribution License (CC BY). The use, distribution or
On the influence of vector design on antibody phage display. J. Biotechnol. 127, reproduction in other forums is permitted, provided the original author(s) and the
626–637. doi: 10.1016/j.jbiotec.2006.08.015 copyright owner(s) are credited and that the original publication in this journal
Sturino, J. M., Pokusaeva, K., and Carpenter, R. (2015). Effective Sequestration is cited, in accordance with accepted academic practice. No use, distribution or
of Clostridium difficile protein toxins by calcium aluminosilicate. reproduction is permitted which does not comply with these terms.