MLU January-March - 2021
MLU January-March - 2021
Medico-Legal Update
Editor-in Chief
Prof. (Dr) R K Sharma
Former Head, Department of Forensic Medicine & Toxicology
All-India Institute of Medical Sciences, New Delhi-110029
E-mail: [email protected]
INTERNATIONAL EDITORIAL ADVISORY BOARD 23. Dr. Ramesh Nanaji Wasnik (Associate Professor and Head)
Forensic Medicine Late B.R.K.M. Govt. Medical college, Jagdalpur
1. B. N. Yadav (Professor) 24. Dr. Sachin Sinha (Reader), Dept. of Oral Pathology & Microbiology
Forensic Medicine, BP Koirala Institute of Medical Sciences, Nepal Daswani Dental College & Research Centre, Rajasthan
2. Dr. Vasudeva Murthy Challakere Ramaswam (Senor Lecturer) 25. Dr. Sasi Kanth, Asst. Professor, A.C.S.R Government Medical College,
Department of Pathology, International Medical University, Bukit
Nellore, Andhra Pradesh.
Jalil, Kuala Lumpur. Malaysia
3. Babak Mostafazadeh (Associate Professor)
Department of Forensic Medicine & Toxicology, Shahid Beheshti
University of Medical Sciences, Tehran-Iran Medico Legal Update is a scientific journal which brings latest knowledge
4. Dr. Sarathchandra Kodikara (Lecturer) regarding changing medico legal scenario to its readers. The journal caters
Forensic Medicine Department of Forensic Medicine, Faculty of to specialties of Forensic Medicine, Forensic Science, DNA fingerprinting,
Medicine, University of Peradeniya, Sri Lanka Toxicology, Environmental hazards, Sexual Medicine etc. The journal has
been assigned international standard serial number (ISSN) 0971-720X. The
NATIONAL EDITORIAL ADVISORY BOARD
journal is registered with Registrar of Newspaper for India vide registration
1. Prof. N.K. Agarwal (Professor) Forensic Medicine, UCMS, Delhi numbers 63757/96 under Press and Registration of Books act, 1867. The
2. P.K. Chattopadhyay, (Professor) journal is also covered by EMBASE (Excerpta Medica Database) from
Forensic Sciences, Amity University, Noida 1997 and by INDEX COPERNICUS, POLAND. Medico legal update is
3. Dalbir Singh (Professor) Forensic Medicine, PGIMER, Chandigarh a half yearly peer reviewed journal. The journal has also been assigned
4. Dr. Harish Pathak, Mumbai E-ISSN 0973-1283 (Electronic version). The first issue of the journal was
5. J. Gargi (Professor) GGS Medical College, Faridkot published in 1996.
6. P.C. Dikshit (Professor) Website: www.medicolegalupdate.org
Forensic Medicine, Jamia Hamdard Medical College, New Delhi
7. Anil Mittal (Professor) © All Rights reserved The views and opinions expressed are of the authors
Forensic Medicine, Vardhman Mahavir Medical college, New Delhi and not of the Medico Legal Update. The Medico Legal Update does
8. Balbir Kaur (Professor) not guarantee directly or indirectly the quality or efficacy of any products
Forensic Medicine, MM institute of Medical Sciences, Ambala or service featured in the advertisement in the journal, which are purely
9. Mukesh Yadav (Professor) Forensic Medicine, School of Medical commercial.
Sciences and research,Greater Noida
10. T.K.K. Naidu (Professor) Forensic Medicine, Prathima Institute
of Medical Sciences Andhra Pradesh Editor
11. S. Das (Professor) Forensic Medicine, Himalayan Institute of Dr. R.K. Sharma
Medical Sciences Dehradun Institute of Medico-legal Publications
Logix Office Tower, Unit No. 1704, Logix City Centre Mall,
12. Col Ravi Rautji, Forensic Medicine, Armed Forces Medical
Sector- 32, Noida - 201 301 (Uttar Pradesh)
College, Pune
13. Dr. Manish Nigam (Professor and Head)
Department of Forensic Medicine & Toxicology Sri Aurobindo Printed, published and owned by
Institute of Medical Sciences, INDORE (M.P.) Dr. R.K. Sharma
14. Dr. Shailesh Kudva (Principal) Institute of Medico-legal Publications
Rajasthan Dental College and Hospital Jaipur-302026 Logix Office Tower, Unit No. 1704, Logix City Centre Mall,
15. Usmanganishah Makandar (Associate Professor) Sector- 32, Noida - 201 301 (Uttar Pradesh)
Anatomy, AIMS, Bhatinda
16. Dr. Pratik Patel (Professor and Head) Forensic Medicine, Smt Published at
NHL Municipal Medical College Ahmedabad Institute of Medico-legal Publications
17. Basappa S. Hugar (Associate Professor) Logix Office Tower, Unit No. 1704, Logix City Centre Mall,
Forensic Medicine, Ramaiah Medical College, Bangalore Sector- 32, Noida - 201 301 (Uttar Pradesh)
I
Medico-Legal Update
CONTENTS
1. Psychometric Validation of the Maslach Burnout Inventory (MBI) Adapted to Moroccan Teachers.......................1
Abdeslam Amri, Zakaria Abidli, Mounir Bouzaaboul, Ziri Rabea, Ahmed Omar Touhami Ahami, Abdelmajid
Soulaymani
2. COVID 19: Evaluate of Liver and Renal Function Tests in Iraqi Patients................................................................7
Abdullah Ali Mohammed, Mahmood Nazar Mustafa, Sura A. Abdulsattar, Ahmed Salam Al-zaidi
3. Assess the Level of Perception Regarding Instructor Caring Behaviour among Nursing Students at SRM College
of Nursing.................................................................................................................................................................11
Abirami P.
4. Medical, Human Rights and Legal Analysis of the Existence of Lesbian, Gay, Bisexual, and Transgender in
Indonesia...................................................................................................................................................................16
Aditya Yuli Sulistyawan, Tri Rahayu Utami
5. The Role of Kinship and the Effectiveness of Traditional Customary Law on Inheritance System in Berbah, Sleman
Regency....................................................................................................................................................................20
Agung Basuki Prasetyo
6. Does Education Level Matter in Women’s Risk of Early Marriage?: Case Study in Rural Area in Indonesia.......24
Agung Dwi Laksono, Ratna Dwi Wulandari, Ratu Matahari
8. Case-Control Analysis of Malaria Incidence in Sukamerindu Health Center Bengkulu City, Indonesia................35
Agung Sutriyawan, Tenike G. Miranda, Ucu W. Somantri, Hairil Akbar
9. Descriptive Online Survey: Knowledge, Attitudes, and Anxiety During the Period of Pandemic COVID-19 in
Indonesia...................................................................................................................................................................42
Agung Sutriyawan, Hairil Akbar, Fibrianti, Intan Pertiwi, Ucu W. Somantri, Lezi Y. Sari
11. The Influences of Antenatal Care, Postnatal Care and Early Initiation of Breastfeeding on an Exclusive Breastfeeding
Pattern in the Working Area of Manukan Kulon Public Health Center at Surabaya City.......................................53
Azizi Pridasari, Lutfi Agus Salim
II
14. Forensic Autopsy Study of Abdominal and Pelvic Trauma Due to Road Traffic Injuries.......................................70
Alok Kandpal, Ashok Chanana, Jaspinder Pratap Singh
15. To Compare the Effects of Footwear in Young Female’s Postural Balance in Prolonged Standing and Sitting Job..
77
Anandita Sharma, Yamini Sharma, Megha Yadav, Mangalam Kumari, Jyoti Sharma, Sakshi Arora, Akshay Anand
16. Prospective Studies on Pattern of Two Wheeler Injuries in Road Traffic Accidents...............................................82
Arun Prakash K.S., Sanjeev K., Gambhir Singh O.
17. A Review of Studies Assessing Cannabidiol’s (CBD) Therapeutic Action and Potentials in Respiratory Diseases..
87
Arwa Fairaq, Sahar El-Ashmony,, Yosra AL-Hindi
18. Evaluation the Door-to-Balloon Time in Patient with ST-Elevation Myocardial Infraction (STEMI) in King
Abdullah Medical City (KAMC) in Makkah Almukarramah: A Retrospective Single Center Study.....................92
Arwa Fairaq, Dunia Alfi, Halah Bahakeem, SehamMalki, Raheeq Algarrash, Shroug Allehyani, Yosra Al-Hindi
19. The Adsorption Effect of Pine Resin (Pinus Merkusii) in Reducing Hardness (CaCO3) in Clean Water............100
Ashari Rasjid, Syamsuddin S.
20. Assessment of the Knowledge and Attitude of Eligible Couples towards Tubectomy and Vasectomy................107
Ashish Dass, Jaspreet Kaur Dullat, Maninder Singh, Aanchal, Balpreet Kaur, Chandresh, Jahangir
21. Nursing Intervention for Caregivers of Post Autologous Bone Marrow Transplantation Patients at Home.........112
Asmaa Farouk Mohamed, Nawal Soliman, Hemat Abd-El-Moneem El-Sayied, Asmaa Talaat
22. Psychological Problems among the Health Workers During Pandemic Covid-19................................................118
Astabrak A. N. Al-Hamoodi, Burhan Hadi, Kafi Mohammad Nasir Al Asadi
24. The Influences of Antenatal Care, Postnatal Care and Early Initiation of Breastfeeding on an Exclusive Breastfeeding
Pattern in the Working Area of Manukan Kulon Public Health Center at Surabaya City.....................................129
Azizi Pridasari, Lutfi Agus Salim
27. Detection of Heavy Elements and Pathogenic Microorganisms in the Water and Sediments of Domestic Water
Tanks in the Center of AL-Nasiriyah.....................................................................................................................147
Basim Y. Al-khafaji, Hassan Abd Ali Namaa
III
28. Appraisal the Quality of Drinking Tap Water in Different Regions of Kirkuk City..............................................152
Batool Kh. Mohammad, Kameran Sh. Husien, Israa Zainal
29. Strategies Adopted by Women of Rural and Urban Areas for Weight Losspost-Pregnancy.................................161
Blessy Mohandass, Amanpreet Kaur; Timsy; Nitika Choudhary, Shivani Rana, Sonaly Robinson
30. Assess the Knowledge, Practice and Attitude Regarding Nosocomial Infections and their Preventive among Health
Care Staff................................................................................................................................................................168
Blessy Mohandass, Amanpreet Kaur, Timsy, Harmeet Kour, Navneet Kaur, Pema Choden, Aishwarya Thakur
31. Oncology Research Productivity of Iraqi Authors: A Bibliometric Analysis During 1955–2019.........................174
Bushra H Shnawa,, Shireen M Al-Majmaie,
32. A Study to Assess the Nursing Students Experience Regarding Online Classes During Covid-19 Lock Down
Periods in SRM College of Nursing, Kattankulathur, Kancheepuram District-603203, Tamil Nadu, India.........183
C. Kanniammal, T. Suseelal, P. Malarvizhi, P. Vijay Daniel Raj
33. Study of Anxiety Levels among Occupational Therapy Students During Various Academic Assessments.........187
Chirag Pincha, A.V. Anuja, A. Sangeetha, M. Karthika, Samuel Sundar Doss
34. Plasma CD4 Count and Duration ARV as a Predictor of Virological Failure Amongst AIDS Patients................192
Choirina Windradi,, Erwin Astha Triyono,, Musofa Rusli,
35. Physiotherapy Students Willingness to Report Misconduct to Protect the Patient’s Interests in Chennai............198
D. Malarvizhi, Bhagya Lakshmi K., Hariharan S.
36. Effect of Phase 1 Cardiac Rehabilitation to Non-Invasive Hemodynamics in Acute Myocardial Infarction
Patients....................................................................................................................................................................202
Desi Natalia Trijayanti Idris, Dian Taviyanda, Srinalesti Mahanani
37. Awareness among MBBS Students About Rise of Violence Against Doctors......................................................211
Divya Reddy Pannala, S.M. Krishna Sagar, Hemantha Rao Amara, Harshini Deshapathi
38. Study of Production and Characterization of Laccase Enzyme from Klebsiellapneumoniae K7 Isolate..............216
Doaa Khalid Mezaal, Essam Fadel Al-Jumaili, Ahmed Majeed Al-Shammari
42. Trend of Implementation Foster Family Toddlers (FFT) Programin East Java Province at 2015-2019................242
Fadilatul Fahmiyah, Lutfi Agus Salim
43. Assessment Knowledge of the Patients’ with Acute Renal Failure Concerning Dietary Pattern in Dialysis Unite of
AL-Zahraa Teaching Hospital at AL-Kut City.......................................................................................................249
Faisal Younus Sameen, Qassim Jawell Odah Abed, Tareq Al-Qassab, Ashwaq Yas Khudhair
IV
44. Assessment of Women’s Knowledge and Practices toward Family Planning at Maternity Hospitals in Baghdad
City.........................................................................................................................................................................253
Fatima Fadel Benyian
45. Regulation of Law Enforcement in Prevention and Handling of Fire Forests in Environmental Hazards............259
Fatma Ulfatun Najicha, I Gusti Ayu Ketut Rachmi Handayani, Lego Karjoko
46. Study on Effectiveness of Staff Welfare Program Regarding Occupational Stress During COVID 19 Pandemic
among Nursing Officers..........................................................................................................................................263
Franny Joel Emmanuel, Yugmi Vala, Tapan Dodia
49. Prevalence of Head Lice (Pediculus humanus capitis) among Primary School Children in Baghdad Suburbs..280
Hadeel T. Al-Barrak
50. Estimating the Concentration of Lead and Cadmium for Some Areas of Najaf Governorate...............................285
Hakeem J. I.
52. Predictors of Psychosocial Burden among Workers During the COVID-19 Pandemic Period in Indonesia........292
Hario Megatsari, Agung Dwi Laksono, Mursyidul Ibad, Yeni Tri Herwanto, Kinanty Putri Sarweni, Rachmad
Ardiansyah Pua Geno, Estiningtyas Nugraheni
53. Relationship of Family Support with Anxiety Levels in Preschool Children Hospitalized in Pediatric Ward Syech
Yusuf Hospital Gowa Regency, Indonesia.............................................................................................................298
Hartati, St. Aminah, Muh. Yusuf M.
54. The Effect of Qourum Sensing genes (lasI, rhlI) in Some Virulence Factors of Pseudomonas aeruginosa Isolated
from Different Clinical Sources..............................................................................................................................303
Hasan Falah Lahij, Abdulla H. Alkhater, Muthanna Hamid Hassan, Luma Amer Yassir
55. Total Matrix Metalloproteinase-2 and Prostaglandin E2 as Potential Biomarkers in Iraqi AML Patients............309
Hassnien S. AL- Hashemi, Sabah A. Hameid A. Rahman, Zeyad A. Shabeeb
56. Molecular Profile of Integrase gene intI and Carbapenem gene in Aeromonas sobria Isolates............................316
Hawraa Natiq Kabroot AL-Fatlawy, Taghreed Abdul Al-Kareem Al-Makhzoomy, Mohammed Abdulaali Al-
Hakeem
57. Comparative Study of Children with/without Iron Deficiency Anemia Based on Parents’ Knowledge, Attitude and
Practice in Basra/Al-Madinah City.........................................................................................................................321
Haydar Mohsin Abdulhussein, Jabbar Taresh Ahmed, Abbas Ali AL-Kinani, Faiz hussien ali, Rasha Mohammed
Jumaah
60. The Role of P53 Serine 46, Burkitt Cell Lymphoma 2 (BCL‑2), and Cysteinyl Aspartate Specific Proteinase 3
(Caspase 3) Proteins as Risk Factors in Abortion..................................................................................................340
Herlambang Herlambang, Firman F. Wirakusumah, Jusuf S. Effendi, Ida Parwati, Leri Septiani, Ahmad Faried,
Hiroyuki Kuwano
61. Healthy Home Concept According to Javanese Ethnic Panaragan Society: An Etnolinguistic Study..................346
Hujaefa Hi Muhamad, Titi Rapini, Sri Sugiharti, Alip Sugianto, Siska Diana Sari
62. Strengthen the Authoritative Function of the Regional Representative Councils in Legislation...........................351
I Gusti Bagus Suryawan
63. Knowledge, Attitude and Quality of Life among Type 2 Diabetic Patients in Palestine.......................................355
Imad Thultheen, Ayman M. Hamdan Mansour, Ward Zandeeq, Maysam Ewesat, Saleem Razek, Diana Jabareen
64. Education as Predictor of Low Birth Weight among Female Worker in Indonesia...............................................360
Ina Kusrini, Noviati Fuada, Sri Supadmi, Agung Dwi Laksono
65. Dental Care Interventions as Efforts to Reduce PUFA Index and Improve Nutritional Status in Children aged 9-12
Years in Orphanages...............................................................................................................................................366
Indrayati Fadjeri, Rahaju Budiarti, Tedi Purnama
66. Psychological and Personality Development Supports to the Prisoners in Correctional Institution in Indonesia.372
Irma Cahyaningtyas, Nur Rochaeti
67. Dispute Resolution through Mediation in Endowments Cases in the Legal Effectiveness Theoretical Perspective...
376
Islamiyati, Rofah Setyowati, Dewi Hendrawati, Aisyah Ayu Musyafah, Ahmad Rofiq
68. An Observational Study to Compare the Effect of Two Different Doses of Dexmedetomidine on Hemodynamic
Response to Laryngoscopy and Endotracheal Intubation.......................................................................................381
Jatin B. Patel, Riddhi Agrawal, Malini Mehta
69. Favipiravir, will it be the Answer for the Specific Management of COVID-19?: A Review................................389
Jayant Patharkar, Maulin Mehta, Janhavi Patharkar
70. Glycemic Control of Non-Hodgkin Lymphoma (NHL) Non-Diabetes Mellitus (DM) Patient in the First CHOP
Chemotherapy.........................................................................................................................................................393
Jualita Heidy Saputri, Hermina Novida, Ami Ashariati
72. Impact of COVID-19 Pandemic and National Lockdown on Mental Health among General Urban Indian Population:
An Online based Cross-Sectional Survey...............................................................................................................406
Jyoti Sharma, Irshad Ahmad, Shahin Naz Jamali, Yamini Sharma, Megha Yadav, Sakhshi Arora, Mangalam
Kumari
73. Information Disclosure and Control on Online Social Network Sites among Medical Undergraduates...............414
K. Sudha, Sangeetha A., Kumaresan M., Paarthasarathy B.
VI
74. Factors Related to Deaths Due to Suicides in Females Aged 12-24 Years............................................................417
Kandagatla Krishnamurthy, Shruthi Reddy Jillella, Abhijith Subedhar
76. Molecular Characterization of Sewage Bacteriophage and Their Efficiency in Treatment of Antibiotic Resistant
Bacteria...................................................................................................................................................................427
Khalid Ibrahim Mahmood, Ahmed Mohammed Turki
77. Assessment of Awareness on COVID-19 among Adults by Using an Online Platform: 26 Countries View.......434
Kogila Palanimuthu, Birhanu Gutu, Leta Tesfaye, BuliYohannis Tasisa, Yoseph Shiferaw Belayneh, Melkamu
Tamiru, Desalegn Shiferaw
78. Assessment of Stress, Fear, Anxiety and Depression on COVID-19 Outbreak among Adults in South-Western
Ethiopia...................................................................................................................................................................440
Kogila Palanimuthu, Hamba Yigazu, Eshetu Fikadu, Gemechu Gelalcha, Yirgalem Bekele, Getachew Birhanu,
Birhanu Gutu
79. Prevalence of Overweight and Obesity among School Going Adolescent in Patna..............................................446
Kumari Mangalam, Chauhan Muneesh, Anand Akshay, Fatima Ambreen, Saho Pramod
80. Relationship between Coronavirus (COVID-19) and Social Factors: Evidence from 24 Countries Over the World
During 88-Day Period from Jan 31 to April 27, 2020............................................................................................451
Lien Nguyen-Phuong, Hang Thu Thi Dang, Nhung Phuong Thi Nguyen
81. Satisfaction and Complaints of Patients with Removable Partial Dentures: In Sample at Baghdad City, Iraq.....456
Luma Musa Ibrahim
82. Deep Learning Classification Method to Detect and Diagnose the Cancer Regions in Oral MRI Images............462
M. Praveena Kirubabai, G. Arumugam
83. Chalk and Talk Versus Powerpoint: Perception among Medical Students............................................................469
Mahanta Putul, Lahkar Babita, Borah Pollov, Das D.K., Choudhury Manoj Kumar
84. In-vitro Cytotoxic Activity of E. coli Outer Membrane Vesicles (OMVs) Against Breast Cancer (MCF-7) Cell
Line.........................................................................................................................................................................474
Mahmood Abed Hamzah, Ali Husain Alwan, Suzan Saadi Hussain
85. The Predictive Value of Serum Progesterone and Estrogen Recepters as Diagnostic Tool for Premature Ovarian
Failure.....................................................................................................................................................................481
Mahmood Khalil Ibraheem, Mutazsabahahmied, Firas Shawqi Algburi, Amina Hamed Alobaidi
86. The Predictive Value of Osteocalcin, Granulin, Cathepsin K and Some Other Biomarkers in Women with Premature
Ovarian Failure.......................................................................................................................................................486
Mahmood Khalil Ibraheem, Mutazsabahahmied, Firas Shawqi Algburi, Amina Hamed Alobaidi
87. Relation of Human Papilloma Virus Infection with Pre Malignant and Malignant Endometrial Lesions.............490
Mahmoud Mohammed Mahmoud, Aseel Ghazi Rifat
88. Differences between Bribery and Gratification: A Review of Anti-Corruption Act of Indonesia.........................497
Mahrus Ali, Al Halim, WahyuPriyanka Nata Permana
VII
90. Methodical Learning on Organ Donation: Effect on Students Knowledge and Attitude.......................................508
Maninder Singh, Manpreet Kaur Grewal, Amanpreet Kaur, Yamini Chopra, Aarti Bhatt, Tenzin Choden,Manisha
Sharma
92. Patient’s Knowledge and Satisfaction with health Care of a Tertiary Care Hospital Situated in Rural area of
Northern India (Haryana).......................................................................................................................................520
Manisha Rani, Jyoti Phougat, Manpreet Kaur
94. Integration of Health Education and Cultural Value of Bimanesse Called “Maja Labo Dahu” toward the Intention
to Stop Smoking of Smoker Student at Bima District-Indonesia...........................................................................532
Martiningsih, Nurul Inayati, Rini Hendari, Ade Wulandari
95. Application of Poskestren as Health Promotion Strategy for Improving Clean and Healthy Behavior of Pesantren
in East Java Province..............................................................................................................................................537
Maygi Restu Yang Esa, Muhammad Baharuddin Wisudawan Putra, Diyah Werdiningtyas, S.Gz
97. Inhibition Activity of Water Hyacinth Leaf Extract (Eichornia Crassipes) to the Growth of Subgingival Plaque
Bacteria Colony......................................................................................................................................................552
Ayu Arismawati, Noer Ulfah, Lambang Bargowo
98. Study to Compare Progrip Mesh vs Conventional Mesh in Lichtenstein’s Open Inguinal Hernia Repair............557
Mohammad Farooque Dudhwala, Chiraag Hiran S., Vipul Gurjar, Honeypalsinh H. Maharaul, Vipul Shory
99. TMEM121 Protein Is a RegulatIon Factor in the Proliferation Activity of the Adrenocortical stem/Progenitor
Cells........................................................................................................................................................................562
Mohammed Abdalmalek Ali Al-Bedhawi
100. Impact of Broken Family upon Adolescents’ Behavior at Secondary Schools in AL- Najaf AL-Ashraf City......568
Mohammed Baqer Hassan, Khetam Mutashar Hatab
101. The Safety and Efficacy of Sacral Neuromodulation on Refractory Urgency Urinary and Fecal Incontinence in
Iraqi Patients...........................................................................................................................................................575
Mohammed Bassil Ismail, Wameedh Qays Abdullhussein
102. Glycodeline-A, sFlt-1, PlGF Combined as Predictor Markers of First Trimester Pregnancy Loss in Iraqi Women...
580
Mohammed H. Dawood, Halla G. Mahmood, Afraa M. Nedawi
VIII
103. The Effect of Using Panicum Mombasa Hay and Millet Hay in the diet on the Production Performance of Awassi
Lambs.....................................................................................................................................................................587
Mohammed H . Fannos, Husam H. Nafea, Ahmed A. Al-Ani
104. Effect of Combined Antibiotics and Biofilm Formation in Some Bacterial Pathogens from Otitis Media among
Children in Baghdad, Iraq......................................................................................................................................592
Mohammed Khudhair Alwan, Kais Kassim Ghaima, Zainab Shaban Khalaf
105. The Role of Religion and Spirituality in Alcohol Use Treatment and Recovery: An Integrative Review............599
Mohannad A. Aldiqs, Ayman M. Hamdan-Mansour
107. Socio-Legal Updates of Children’s Rights on the Protection and Shared Assets in Divorce Cases in Indonesian
Family Law.............................................................................................................................................................613
Muhyidin
110. Effect of Blood Groups and Complications on Orofacial Measurements of B Thalassemia Adult Patients.........627
Nada Hashim Mohammed, Nawal Mustafa Abdullah, Riad Altaee
111. Prevalence of Oral Maxillary and Mandibular Tori among Outpatients Attending Dental Collage in Basra
Governorate Southern of Iraq.................................................................................................................................635
Nadia Azzam Al-Shareeda, Majed Mohamed Refaat, Abdullah M. Hussain
112. Appraisal of Genotoxicity and Cytotoxicity of Depakine® and/or Epanutin® in Bone Marrow Erythrocytes and
Hepatocytes of Male Albino Mice by Comet and Micronucleus Assays...............................................................638
Nagla Zaky Ibrahim El -Alfy, Amany Ibrahim Alqosaibi, Mahmoud Fathy Mahmoud, Ayman Mohammad Abdullah
113. Assessment of Neutrophil-to-Lymphocyte Ratio, Platelet-to-Lymphocyte Ratio,Oxidative Stress and Anti Oxidants
levels in Polycystic Ovary Syndrome Patients with Low-Grade Chronic Inflammation.......................................644
Najlaa Abdulameer Ali AL-Dahhan, Aseel Jassim Albdairi, Ammar Jabbar Hamad
114. Impact of Breakfast Habits on Physical Parameters and Academic Performance of Nursing Students................653
Nalini M., Sukesh, Joyce Fernandes
116. Service Quality Assessment of Higher Education by Gray Approach (The Case of Kerbala University)............664
Nawal Mousa Almeyali, Ali Al Mousawi
117. Effectiveness of Breathing as a Non-Pharmacological Method to Reduce Pain Severity among Woman During
Labor.......................................................................................................................................................................674
Nawras Monim Alzurfi, Shukriyia Shadhan Al-Ogaili
IX
118. Vitik Detection of Aerobic Spore-Forming Bacteria Isolated from Raw Milk, Skim Milk Powder and UHT Milk...
678
Nawres N. Jaber, Nada Salih Hadi, Abeer Laily Mohammed, Marwa Idan, Adyan Niama
119. Counseling with Tooth Brushing Demonstration Method as an Effort to Improve Tooth Brushing Skills and the
Status of Dental and Oral Hygiene in Early Childhood at School.........................................................................684
Ngatemi, Tedi Purnama
120. Smoking Behavior among Female Worker in Indonesia Does Education Matter?................................................688
Nikmatur Rohmah, Anita Dewi Prahastuti Sujoso, Masruroh, Ilyas Ibrahim, Qurnia Andayani, Irfansyah
Baharuddin Pakki, Agung Dwi Laksono
122. Strategies of Carious Tissue Removal in Deep Carious Lesions among Dentists in Iraq: Online Based Survey
Study.......................................................................................................................................................................698
Noor H. Fadhil, Anas F. Mahdee, Ahmed H. Ali
123. Antibiofilm Activity of Nystatin, Aspirin and EDTA Against Candida albicans Isolated from Iraqi Women with
Vulvovaginitis........................................................................................................................................................703
Noor Naser Raheem, Kais Kassim Ghaima*
124. Radiographic Evaluation of Five Variables in Iraqi Young Subjects among Impacted and Erupted Lower Wisdom
Teeth Groups..........................................................................................................................................................712
Nuhad A. Hassan, Amal R.S. Mohammed
125. Information Seeking Problems that May Occur Against Covid-19 Vacccine When it is Ready...........................718
Olowo Emmanuel Opeyemi, Hamisah Hasan, Abdul Mua’ti, Julia Wirza Mohd Zawawi
126. Newly Emerged Online Educational Framework in Nursing Major During the Pandemic of COVID-19............722
Omar M. Khraisat, Ahmad M. Al-Bashaireh, Mohammad O. Khraisat, Fatima H. Khraisat, HD , Eman Nazly,
PhD, RN , Mohannad A. Aldiqs, MSN, RN
127. Factors Contributing to Emotional Distress among Postpartum Mothers with Newborns at Newborn Unit Kenyatta
National Hospital, Kenya.......................................................................................................................................728
Omulo O. Wycliffe, Cheptum Jebet Joyce, Mageto G. Irene Mageto
128. Assessment of Satisfaction Level and Quality of Life among Haemodialysis Patient’s on Dialysis Therapy......734
Parimala L., Mary Sofia
129. Exogenous Cushing’s Syndrome with Subsequent Secondary Adrenal Insufficiency in Patients with Long Term
Steroid Usage..........................................................................................................................................................738
Cynthia Ayu Permatasari, Ferdy Royland Marpaung
130. Influence of Exercise Classics on the Ability to Switch the Attention of Schoolchildren Aged 9-10 Years.........744
Polevoy G.G.
131. Effectiveness of Teaching and Text Message Based Intervention on Dietary Habits among Overweight Adolescents
in Selected Schools of Ambala, Haryana...............................................................................................................749
Pooja, Kanika, Srinivasan P.
X
132. Changing Trends Inpoisoningat a Tertiary Healthcare Centrein North Karnataka, India......................................755
Pratibha R. Kulkarni, Ranganath R. Kulkarni, R.B. Kotabagi
134. Behaviours (Cognitive, Affective and Psychomotor) among Patients with Gout Arthritis in Elderly...................763
Chilyatiz Zahroh, Asmaul Faujiyah, Ima Nadatien, Yasi Anggasari, Nur Ainiyah, Siti Nurjanah
135. Clinical Study of Functional Outcome of External Fixator Device as a Primary Definitve Treatment of Open Tibia
Fracture...................................................................................................................................................................768
Praveen Garg, Rajvirsinh Sodha, Fahad Bin Hamid, T. Somashekarappa
136. To Study Preloading and Relative Efficacy of Ringer’s Lactate and Pentastarch 6% Prior to Spinal Anaesthesia in
Lower Abdominal and Lower Limb Surgeries.......................................................................................................772
Priya Kishnani, Ishaan Batra, Tejash Sharma, Malini Mehta
137. Human Liver Morphology: Anatomical Study about the External Aspects...........................................................780
Priyanka N. Sharma, Nirali Chavda, Hetal V. Vaishnani, K.M. Parmar, Kinjal Jethva, Manoj Kulkarni, A.R.
Gandotra
138. Informed Consent to Patients in Root Canal Treatment (Case Study: Melati Dental Clinic Jakarta, Indonesia)..786
Pudentiana Rr RE, Tedi Purnama, Syifa Yulia Lestari, Yulianti
139. Assess Knowledge and Attitudes on First-Aid Measures for Selected Domestic Accidents among Caretakers of
Under-Five Children...............................................................................................................................................790
Pushplata Manta, Kanu Mahajan, Kanika Guleria
140. Anthropometric Assessment of Canthal Distances and Canthal Index of South Indian Region: A Cross-Sectional
Study.......................................................................................................................................................................794
Radha K., Srinivasan K.R.
142. Iron Content as an Indicator for Legionella Species in Artificial Water Systems.................................................803
Rajeshwari Vittal, Juliet Roshini Mohan Raj, Ballamoole Krishna Kumar, Indrani Karunasagar
143. Deleted
145. Risk Factors for Neonatal Death in Female Workers Mothers in Indonesia..........................................................822
Ratna Dwi Wulandari, Agung Dwi Laksono, Astridya Paramita, Pramita Andarwati, Naillul Izza
147. A Questionnaire Based Study Evaluating Awareness for Organ and Body Donation and Cadaveric Dissection
among the General Population Attending Medical and Dental Hospital...............................................................835
K.M. Parmar, Hetal Vaisnani, Nirali Chavda, Priyanka Sharma, Kinjal Jethava
XI
149. Effectiveness of Piriformis Stretching and Intermittent Lumbar Traction along with Spinal Extension Exercises in
Lumbar Disc Herniation: Comparative Study........................................................................................................844
Rituraj Verma, Taruna Verma, Vikas Sharma, Yash Pratap, Sanghamitra Jena, Sajjad Alam
150. Cassava Leaves Extract (Manihot esculenta) Prevents the Decrease of Albumin Serum Level in Mice with
Gentamicin-Induced Hepatotoxicity.......................................................................................................................848
Rosita Dewi, Rena Normasari
151. Common Warts Treatment by Intralesional (60,000 Versus 120,000) IU of Vitamin D3, Comparative Study....853
Ruya Thamer Ihsan Mahmoud, Mazin Hamid Ayyash
152. Using of Glycated Albumin Rather than Glycated Hemoglobin for assessing Glycaemic Control in Hemodialysis
Patients with Type II Diabetes Mellitus.................................................................................................................860
Salahaldin M. Fahad, Rashied M. Rashied, Waleed N. Jaffal
153. Pattern of Head Injuries in Deaths Due to Two-Wheeler Road Traffic Accidents.................................................866
S.M. Krishna Sagar, Divya Reddy Pannala, K.V. Ramanamurthy, K. Rajender Kumar
154. Maxillofacial Trauma and Alcohol Abuse: A Descriptive Cross Sectional Study.................................................871
S. Devakumari, T. Vijhayapriya, Nandini Biradar, P. Amudha, D.S. Dinesh, S. Devameena
155. Histopathological Grading and Enzyme Histochemical Study of the Placenta in Gestational Diabetes Mellitus
Pregnant Women....................................................................................................................................................878
Sahar A.H. AL-Sharqi, Amal Kadhem Chaloob, Ilham Abd Allah Ali Al-Saleem
156. Subjective Assessment of Satisfaction Degree and Psychosocial Status of Patients with Highly Atrophic Mandible
Treated by Implant-retained Over-denture.............................................................................................................886
Salah A. Al Omoush, Wijdan R. El Manaseer, Firas Al Soleihat, Kifah D Jamani
158. Serological Tests Assessment in Patients Suspected to have Celiac Disease Attending the Gastroenterology and
Hepatology Teaching Hospital in Baghdad............................................................................................................904
Samer Nema Yassen Alkemawy, Shymaa Nema Hamed Alsaltani
159. Evaluating the Sensitivity of (miR-378) as a Circulatory Screening Biomarker for Diabetic Cardiomyopathy:
Comparative Study.................................................................................................................................................912
Sana Abdul-Jabbar Ali, Hyder Hashim Al-Shlah, Mais Mazin Al-Hamdani, Oday Jasim Al-salihi
160. Using the Digital Occlusal Analysis (T-Scan NOVUS) in Diagnosis the MFDS in Iraqi Patients During Lateral
Excursion Movements............................................................................................................................................919
Sanaa Abdul Hameed Hussein, Jamal N. Ahmed
161. Awareness on Nutritional Anemia and its Prevention among Adolescent Girls....................................................925
Santhi P., G. Ambujam
162. Incidence and Predictors of Postoperative Acute Kidney Injury in Non-Cardiac Surgery....................................930
Sara Mary Thomas, Bhavika Sangada, Sanam Vasava, Lokesh Akkineni, Chaitri Shah
XII
163. Gender Differences in Life Satisfaction: The Moderation Role of Social Support among Older Persons............935
Sarah Al-ja’freh, Rabia Allari, Ayman M. Hamdan-Mansour
164. Effects of Emotional Intelligence on Multi-cultural Cognition and Multi-cultural Attitude in Undergraduate
Nursing Students in Korea......................................................................................................................................941
Seong Mihyeon, Chung Soojin, Hong Hyonjoo, Song Jihyun, Hwang Wonju
165. Characteristic of CD4+CD25+ T Cells in Chronic Myeloid Leukemia Patients Treated with Imatinib Mesylate
with Different BCR-ABL Transcripts Levels Response........................................................................................949
Shahla’a Fadhil Sabir,, Wifaq Mahmood Ali Alwatar, Bassam Francis Matti,
166. Effect of Segmented Sleeping on the Academic Performance of Medical Students. A Questionnaire Survey.....956
Shalini S.P., Balaji K., Yuvaraj Maria Francis, Gunapriya Raghunath, Vijayalakshmi S.
168. Prevalence of Child Physical Abuse among School Children in Mosul City\North of Iraq..................................966
Shatha Abdul-Rahman H. Al-Ghurairi, Eman Al- Khafaf, Hana A. Al seed
171. Awareness of Adverse Effects of Lead-containing Cosmetics among the Adolescence and Young Adult Population
in Chennai: A Survey.............................................................................................................................................984
Sneha A., Balaji K., Yuvaraj Maria Francis, Gunapriya Raghunath
172. Medical and Legal Constraints for Organizing 2020 Regional Head Election in the Covid-19 Pandemic in
Indonesia.................................................................................................................................................................990
Sri Wahyu Ananingsih, Ratna Dewi Pettalolo
173. Correlation between Disability and Stigma on Leprosy Patient at General Public Hospital of Daha Husada Kediri.
995
Srinalesti Mahanani, Desi Natalia Trijayanti Idris
174. Recurrence Rate of Surgical Resection with Reconstruction of Plate Osteosynthesis in the Ameloblastoma
Treatment..............................................................................................................................................................1000
Suha Mohammad Sami
175. Older People with Urinary Incontinence: A Nurse Practitioner’ Role in the Assessment and Management......1006
Supichaya Wangpitipanit
177. COVID 19: Evaluate of Liver and Renal Function Tests in Iraqi Patients..........................................................1018
Sura A. Abdulsattar, Mahmood Nazar Mustafa, Abdullah Ali Mohammed, Ahmed Salam Al-zaidi
XIII
178. Implementation of Cross-Sectoral Collaboration in the Leptospirosis Control in Jeneponto Regency: A Qualitative
Approach..............................................................................................................................................................1022
Syamsuar Manyullei, Muh. Fajaruddin Natsir, Wirdayanti
179. Impact of Quality of Healthcare Services on Consumer’s Satisfaction at Primary Healthcare Centers..............1029
Tariq Yassen Taha, Wissam Jabbar Qassim
180. The Relationship between Adolescent Risk Behavior in Drug Abuse: A Literature Review........................1037
Ahmad Yani, Sukri Palutturi, Ridwan Amiruddin, Sudirman Nasir, Aminuddin Syam, Rajindra, Anto J. Hadi
181. The Effect of Environmental Factors on the Enzyme Production of Aeromonas Hydrophila Isolates...............1043
Hawraa Natiq Kabroot AL-Fatlawy
183. Analysis of Prothrombin Time (PT) and Activated Partial Thromboplastin Time (aPTT) in Patients with Acute
Myocardial Infarction on Anticoagulation Therapy to Assess the Thrombogenic Potential...............................1058
Shubhi Saxena, Nishant Saxena, Richa Jain, Jasmin Jasani
184. Correlation of the Stature to Forearm Length in the Young Adults of Western Indian Population.....................1062
Suryabhan S. Dongre, Ravindra B. Deokar, Sachin S. Patil
185. Assessment of Nursing Students’ Knowledge toward Preventive Measures of Urinary Tract Infections in Mosul
Teaching Hospitals...............................................................................................................................................1070
Tahsein Muhsin Hussein, Munther Nather Al-Fattah, Tameem Thamir, Radhwan Hussein Ibrahim
186. Impact of Educational Program on Nurses’ Knowledge toward Coronary Artery Bypass Graft Surgery in Mosul
Teaching Hospitals...............................................................................................................................................1075
Tahsein Muhsin Hussein, Myasar Mohsin Azeez, Radhwan Hussein Ibrahim
187. Quality of Health Care System and Structure at Primary Health Care in Baghdad City.....................................1081
Tariq Yassen Taha, Wissam Jabbar Qassim
188. Relationship of IL-6 Level and Lipid Profile as Predictor Ventilator-Associated Pneumonia............................1088
Taufiq Gemawan, Arie Utariani, Kuntaman
189. Saliva of Tobacco Smokers a Profile of C3, IgA, Amylase and Total Protein....................................................1093
Zahraa Hussein M. Kadri, Hazima Mossa Alabassi, Ahlam Jassim Taher
190. Anti-Islet Cell Antibody and Anti-ovarian Antibody Levels in Iraqi Women with Polycystic Ovary Syndrome.......
1098
Zainab Ali Hlail, Ahmed Sahib Abd-ulamir, Khalil Ismail Abd-Mohammed, Mohammed Odah Salman
191. The Effect of Serum Estradiol Level at the Time of HCG Injection on the ICSE Outcome................................1102
Zainab Abd Alkathem Fatnan, Zainab Alkhafajy, Aseel Abdulameer Mohammed
192. The Satisfaction of Patient with Respect to the Aesthetic and Phonetic of Removable Partial Denture Therapy for
Iraqi Patient...........................................................................................................................................................1108
Zainab Mahmood Al-Jammali, Anas Al-Yasiry, Zahra S. Abed Karkosh, Azad Almuthaffer
193. The Accumulative Effect of Heavy Metals on Liver and Kidney Functions.......................................................1114
Zeyad Gattea Koshan Al-Rikabi, Montaha Abulkareem Al-Saffar, Adnan H. Abbas
XIV
Lecturer, Prof., Ministry of Science and Technology/Environment and Water Directorate/Baghdad, Iraq, Lecture,
Department of community health,Medical technical Institute, Middle Technical University, Baghdad, Iraq
194. Assess the Knowledge of Married Women in Reproductive Age Group Regarding the Contraceptive Method........
1120
Timsy, Amanpreet Kaur, Nirlep Kaur, Sandeep Kaur, Shiwani, Nikhil
195. An Analytical Prospective Study of Plasma Pseudo–Cholinesterase Level & its Co-Relation to Mortality in Acute
Organo Phosphate Poisoning................................................................................................................................1124
Tejas J., Siva Kumar V., Shruthi K., Vishwanathan K.G.
196. Perception of Nursing Care among Patients at SRM General Hospital, Kattankulathur, Kancheepuram District......
1130
Keerthana S., Deepika M., C. Kanniammal, Ushapriya Mathiazhakan
197. Spectrum of Clinical and Hematological Changes in Patients of Malaria: A Tertiary Care Hospital Experience in
Gujarat..................................................................................................................................................................1134
Trupti R. Jansari, Jigna P. Patel, Amit Chauhan, Jasmin Jasani
198. Relationship of Knowledge and Attitudes with Male Participation in Vasectomy in Indonesia.........................1139
Tjahja Bintoro, Bhisma Murti, Endang Sutisna, Suwarto
200. Health Literacy Associated with Raw Cyprinoid Fish Consumption in Northeastern Thailand..........................1149
Tiwakron Prachaiboon, Pannee Banchonhattakit, Nathkapach Kaewpitoon Rattanapitoon,, Surachai Phimha
201. Nutrient and Cost Optimization in Menu Planning at an Apex Tertiary Care Hospital Using Operational Research
Techniques............................................................................................................................................................1155
Vijay Kumar Tadia, Mahesh R., Sidhartha Satpathy
202. Picture Archiving and Communication Systems (PACS): A Pre-Post Comparative Analysis............................1162
Vijay Kumar Tadia
203. Medico Legal Documentation in a Public Hospital in India: An Analysis of 100 Cases.....................................1168
Vijay Kumar Tadia, Paresh Shekhar Jangale
204. Evaluation of Radiology Information Systems including PACS at Two Tertiary Hospitals in India from User’s
Perspective............................................................................................................................................................1171
Vijay Kumar Tadia
205. Spinal Region Segmentation for Intervertebral Distance of X-Ray Images Using Spectral Analysis.................1178
Virendra Singh, Vineeta Saxena Nigam
206. Assessment of the Knowledge and Attitude Regarding Plastic Use and its Health Effects among Nursing Students
of Selected Nursing Colleges of Ambala, Haryana..............................................................................................1186
Vijyeta Bhasin, Shalini, Kirandeep Kaur Dhaliwal, Anamika Gautam
207. Socio-Demographic Profile of Suicidal Cases Autopsied at Tertiary Care Centre in Uttarakhand: A Retrospective
Study.....................................................................................................................................................................1191
Vikas Vaibhav, Pawan Kumar Shukla, Sanchit Jain, Raviprakash Meshram
XV
208. Study of the Balance System between Some Enzymatic and Non-enzymatic Antioxidants in Blood Serum of
Patients with Rheumatoid Arthritis in Mosul City, Iraq.......................................................................................1197
Walaa A. Al-Jawadi Muna H. Jankeer
209. The Concentration of Lead and Cadmium in the Gill and Muscle of Common Carp Fish (Cyprinus carpio) in Three
Fish Farms in DhiQar City–South Iraq.................................................................................................................1202
Wesan Fadhel Khalef, Zainab Mohsen Ibrahim, Bushra Ali Ghyadh
210. Characteristics, Effective Reproduction Number (Rt), and Prediction SIR Model of Covid-19 at Banyumas District,
Central Java, Indonesia.........................................................................................................................................1206
Yudhi Wibowo, Nendyah Roestijawati, Siti Munfiah, Sadiyanto, Arif Burhanudin, Misti Rahayu
211. Medico-Legal Outlooks in Preventing Traffic Violations and Accidents by Enforcing the Structure and Function of
the Police Unit......................................................................................................................................................1213
Yusriyadi
212. Knowledge and Practice of Pregnant Iraqi Women about COVID-19 Preventive Measures..............................1217
Thikra N. Abdulla, Weqar Akram, Taghreed MardanAbullah
213. The Study Effects of Quercus infectoria on the Oral Environment in Gingivitis Patients..................................1224
Ali Hasanain Alhamadani, Rana Talib Al-Muswie, Sameerah Jameel Tarfa
214. Relations between Interlukin-6 and Some Biochemical Parameters in Diabetic Foot Syndrome.......................1230
Raid M.H. Al-Salih, Zeena M. Ali
215. Prevalence of Work from Home on Female-it Workers, on Neck Pain and its Psycho-Social Effects During
Epidemic Period...................................................................................................................................................1240
Taruna Verma, Rituraj Verma, Diksha Bameta, Vikas Sharma, Sonia Saroha, Ashu Taneja
216. Comparison between the Classical Symphony and Self Selected Music on Muscle Endurance in Young Obese
Males....................................................................................................................................................................1247
V. Mahammad Rafi, A. Sangeetha, Adlin K. Kazia, S. Prem Kumar, B. Arun Kumar, B. Vijayalakshmi
218. Non-Invasive Monitoring of Blood Glucose Concentration Based on Insulin Secretion Level Using NIR
Spectroscopy for Diabetes Detection...................................................................................................................1259
D. Arul Kumar, T. Jayanthy
219. Effects of Multidrug-Resistant Organism Infection Control Simulation Program on the Infection Control Fatigue,
Job Stress, and Performance of Nurses................................................................................................................1267
Mi Hyang Lee
221. In Silico Study Chitosan Snail Shell as Antioxidant Through Interesting NRF2-KEAP1 in Hypercholesterolemia..
1277
Umarudin, Dewi Ratih Tirto Sari,, Fatchiyah Fatchiyah,, Sri Rahayu,, Sri Widyarti,, Warsito
XVI
222. Synthesized Gold Nanoparticles Using Pseudomonas Supernatant and Study the Physical Characterization–
Antproliferative Activity of Breast Cancer Cells (MCF-7)..................................................................................1281
Karrar Nadhim, Nibras Nazar Mahmood, Aseel Mustafa
223. Molecular Detection of Tumor Necrosis Factor-Alpha (TNF- a) Gene in Mycotic aborted Placenta of Ewes Using
RT-PCR................................................................................................................................................................1287
Bushra Hamza Fares, Hameed Abdul Hussain Al-tememy, Ban Abbas Abdulmajeed, Mohammed M. Dakheel
224. Detection of Legionella pneumophila and Legionella dumoffii Biochemically in Water Samples in Baghdad City,
Iraq........................................................................................................................................................................1292
Jundi Alak Mahdi Al-Buhilal, Taghreed Khudhur Mohammed
225. The Relationship between Some Blood Components and Wool Production and Some of its Physical Traits in the
Local Arabian Sheep............................................................................................................................................1297
Hafetd Musa Ali AL-Taee, Rahman Hussein Hamza Al-Qasimi, Azhar Abdulabbas Jaffar Shareef
226. Evaluating the Sensitivity of (miR-378) as a Circulatory Screening Biomarker for Diabetic Cardiomyopathy:
Comparative Study...............................................................................................................................................1301
Sana Abdul-Jabbar Ali, Hyder Hashim Al-Shlah, Mais Mazin Al-Hamdani, Oday Jasim Al-salihi
227. Effects of Duration of Diabetes and Diabetes Therapy (Metformin) on Fbxw7 Levels in Iraqi Type II Diabetic
Patients..................................................................................................................................................................1308
Suhayla K. Mohammed, Hayyan I. Al-Taweil, NouraKaram M. Salih, Samer Abdulhasan Muhi, Ekhlass M. Taha
228. Color Change of Two Different Nano-Hybrid Resin Cоmроsite Materials after Staining and Bleaching. (An in
vitro Study)...........................................................................................................................................................1314
Zahraa Sabah Abdul Wahhab, Emad Farhan Alkhalidi
229. The Effect of Interfering Waves Strategy in Developing Some Basic Volleyball Skills for Intermediate First
Graders..................................................................................................................................................................1320
Aujeed Madlool Abbas, Sattar Jaber Ashour, Bashar Akram Mohammed, Jabbar Ali Kathim
230. Diagnostic Study of Some Microbiological Dacryocystitis with in Baghdad City Patients................................1326
Zena K. Khalil, Ala’a K. Husain, Saif S. Al-Kamil
231. The Effect of the Physical and Artistic Education Lesson Through Play and Art in Developing Some Motor Abilities
and Reducing Mobility for Pupils in the Fifth Grade of Primary School of the Primary Stage...........................1332
Aujeed Madlool Abbas, Nawfal Shamkhi Naji, Haider Sami Muhammad, Jabbar Ali Kathim
232. Molecular Study of Genetic Diversity in Escherichia coli Isolated from Tap Water in Baquba........................1338
Noor Jameel Allhaby, Hadi Rahman Rasheed Al-Taai
233. Asprosin Role for Obese Male Patients with Diabetic Mellitus Type II..............................................................1345
Dina A.M. Al-Khafajy, Maysaa J. Majeed, Omar F. Al-Azzawi; Ayad Ismael Khaleel
234. The Effect of the Advanced Organizations ’Strategy on Attentional Control and Learning Some Offensive Skills
Installed with Basketball for Students..................................................................................................................1350
Ahmedkhalid Awad
235. The Effect of Rehabilitative Physical Exercises to Develop Some Aspects of Muscle Strength and Range of Motion
in Rehabilitating the Deltoid Muscle of the Shoulder Joint of Badminton Players.............................................1356
Mustafa Muhammad Ali Farhan, Salman Dawood Tuaimah
XVII
236. Human Folate Receptor-1 Gene Expression and Correlation with Physiological Leptin hormone in Obese and Non-
obese Subjects.......................................................................................................................................................1363
Areej GH Al-Charak, Hawraa H. Naji, Hamzah H. Kzar
237. EV Targeting MCF-7 Breast Cancer Cell Lines Inhibit Both mTOR and HIF-1A: Molecular Docking Study..1367
Haider O. Mossa Al-Gazali, Hamzah H. Kzar, Moshtak A. Wtwt, Moaed E. Al-Gazally
238. Road Traffic Accidents and the Traumatic Brain Injuries: A Cross- Sectional Study.........................................1374
Ali Abbas Hashim Al musawi, Hasan Alwan Baiee
239. Frequency of Left Ventricle Dysfunction in non-Alcoholic Fatty Liver Disease (NAFLD) Patients Detected by
Global Longitudinal Strain and Tissue Doppler Imaging in Babylon Province in Iraq.......................................1380
Haitham Shaalan Sewan, Hassan Salim Aljumaily
242. Evaluation the Role of Malondialdehyde in Occurrence and Development of Diabetic Retinopathy Patients...1400
Marwa Riyadh Khalaf, Mutaz Sabah Ahmeid, Osamah Jihad Abdulqader Hashim Abdulsattar Jabar
244. IL-6, IL-0, IFN Gamma and CRP in Newly Diagnosed COVID 19 Patients......................................................1418
Mazin Jabbar Kathim; Tamara Amer Taha, Suzan Saadi Hussain, Nihad Khalawe Tektook
245. The Value of Measurment of Bilirubin in Pleural Fluid in the Differentiation between Exudative and Transudative
Pleual Effusion......................................................................................................................................................1423
Bint Al huda A. Jaber, Khalid Abd Alstar Hussein, Zahrah Salih
246. Serum Leptin Level and Thyroid Hormone in Type 2 Diabetes Patients............................................................1428
Hamza Mustaffa Khuder, Khudair Abbas Khudair, Ammar Lateef Hussein
247. Comparison between Using Bupivacaine 0.5% and Bupivacaine with Sodium Bicarbonate 8.4 % in Thoracic
Epidural Anesthesia for Laparoscopic Cholecystectomy.....................................................................................1435
Ayman G. Saeed, Khaled Ali Khaleel, Mohammed Asi Jabbar
248. Prevalence of Direct Peer Bullying among Primary Schools’ Children in Holly Karbala Center.......................1442
Ali Abdulrazzaq, Noor Fadhil Abass, Shaima’ Nasir Mohammed
249. Types of Cancer Prevalence in Al Muthanna Province for Two Years’ Duration (2018-2019)..........................1448
Sarah Ali Abed, Rana Dakhil Nafea, Suha Suhiel Hussein, Dergham Majeed Hameed, Ihab Abbas Taher
250. Histomorphometric and Histochemical Finding of the Proventicular and Ventricular Stomach between the African
Grey Parrot (Psittacus erithacus) and Black Francolin (francolinus) in South Iraq..........................................1457
Eyhab R.M. Al-Samawy, Shaima Khazaal Waad, Wissam Sajid Hashim Al-Uboody, Mustafa Salah Hasan
251. Salivary Sialic Acid Level and Oral Health Statues in Sample of Iraqi Children................................................1466
Lamia I. Sood, Ameena Ryhan Diajil
XVIII
252. Hypolipidemic and Antioxidant Efficacy of Apigenin in Hydrogen Peroxide induced Oxidative Stress in Adult
Male Rats..............................................................................................................................................................1473
Mohammed I. Al-Rawi, Aous Kahtan Almzaien, Kahtan A. Almzaien
253. Detection of Propionibacterium in Samples by Metagenomic Analysis that Collected from Patients Suffering
Acne Vulgaris in Babylon Province.....................................................................................................................1481
Rabab J H AL-Hasseny, Lamees A. Abdul-Lateef, Hussein Abbas AL-Sultany
254. Expression Levels of Efflux Pump mexR and norA Genes in Multi-Drug Resistant in Some Bacteria by Using
Quantitative RT-PCR Under Stress of Effect Efflux Pump Inhibitors.................................................................1486
Baidaa Adel Ibrahim, Mayadaa Abdullah Shehan
256. Impact of Vitamin D Elements in Insulin Sensitivity in Type 2 Diabetes Mellitus (DM2).................................1499
Wafaa Raji Alfatlawi, Zainab Majid Ali, Muhammed Abdul-Gabar Aldabagh
257. Angina and Sudden Fatal (Arrhythmia) Cardiac Disorders that affect People with the Presence of Risk Factors that
Show a Change in the Electrical Conductivity of the ECG..................................................................................1505
Salah Abd-Al Kader Omran
258. Effectiveness of an Educational Program on Nurses’ Knowledge about Communicable Diseases Control in Al-
Nassiriyah City Hospitals.....................................................................................................................................1514
Talal Mohammed Yousef, Wissam Jabbar Qassim, Zahid Jassim Mohammed
259. Evaluation Follicular Fluid Cytokines in Patients with Risk Factor for Development of Ovarian Hyper Stimulation
Syndrome..............................................................................................................................................................1521
Alaa K. Hameed, Alaa S. AL-Atabbi, Muna K. Mahmood
261. Assessment of Health Workers Knowledge toward Occupational Health and Safety Program in Alkut City’s
Primary Health Care Centers................................................................................................................................1536
Duaa Malik Dhahir, Naji Yasser Al Mayahi
262. A Comparative Study of Arch Width, Overjet and Overbite between Bilateral Congenital Missing Lateral Incisor
and Normal Class I Occlusion..............................................................................................................................1542
Zena Hekmat Altaee, Laith Hamood Aswad AL-Salmany, Maha Mishaal Turki
263. Application of Fractional Co2 Laser Modification of PEEK in Dental Implants, In vivo Study.........................1548
Nahida Zahir Kamil, Basima Mohammed Ali Hussein
264. Study of Verbal Bullying in Early Adolescents (Case Study of Pallangga 5 Junior High School and Sungguminasa
3 Junior High School)...........................................................................................................................................1553
Muh. Asrul Taufiq Arifuddin, Suriah, Sudirman Nasir, Muhammad Syafar, Lalu Muhammad Saleh, Nurhaedar
Jafar
265. The Effect of Massage Therapy Method, Therapy Duration and Injuries on the Reduction of Pain in Knee Ijuries..
1560
Arif Setiawan, Soegiyanto, Tri Rustiadi, Rumini
XIX
267. Test Instrument Model Talk Athletes for Martial Branch Sports of Tarung Derajat...........................................1577
Ipang Setiawan, Soegiyanto, Mugiyo Hartono, Tri Rustiadi
268. The Effect of Health Services, Supervisory and Team Orientation, Personnel Development and Tolerance of Error
on Job Satisfaction Head of Health Centre in South Sulawesi Province..............................................................1586
Wardiah Hamzah,, Suryanto, Oedojo, Sukri Palutturi, Nasruddin Syam
272. Management of Occupational Hygiene Therapy on the Ability to Perform Self-Care on Deficient Self-Care Patients
Who are Cared for in RSKD, South Sulawesi Province.......................................................................................1621
Syahrir, Fatmawati
273. The Effect of Massage Therapy Method, Inventory Levels and Stress Levels on Kinase Creatine Levels.........1627
Zainul Aziz, Soegiyanto, OktiaWoro K. Handayani, Mugiyo Hartono
274. Detection of Anti-GAD65 Antibodies in Sera of Diabetic Patients Using a Home-Made Latex Agglutination Kit...
1636
Alaa S. Alattabi, Dhamiaa M. Hamza, Khalid Khalil Alaaraji, Sawsan M. Jabbar, Abeer Thaher Naji AL-Hasnawi,
Ali Mansoor Jasim
276. The Significance of Serum Albumin Level as an Indicator for Severity of Hypertensive Disorders in Pregnancy in
Samawa City.........................................................................................................................................................1650
Wurood Mahdi Sale, Ryam Falih, Ayat Mohammad
277. Real-Time-PCR Assay Based on Phosphoglycerate Kinase Gene for Detection of Entamoeba histolytica
Trophozoites in Stool Samples in Holy Karbala, Iraq..........................................................................................1656
Dhamiaa Maki Hamza, Saba Fadhil Ali Malaa, Khalid Khalil Alaaraji
279. Deleted
280. Mammogenesis Effect of Hot Aqueous Extract of Mentha spicata Leaves on Mammary Tissue of Ovariectimized
Rabbits..................................................................................................................................................................1677
Sinaa Jaboury Al-Bazii, Ashwaq Kadhem Obeid, Rana Majeed Hameed
XX
282. Human Rights and Legal Protection of Persons with Disabilities in Aviation Industry in Indonesia.................1689
Adya Paramita Prabandari, Elfia Farida, Rahayu
283. Preparation and Identification of Metal Ions Complexes for 4-(P-Phenyl azo sulfonic acid)-1-Naphthol Dye..1694
Haider S. Mohammed, Shaimaa H. Mallah
284. The Effectiveness of 7 Counselor Contacts in Health Facility at the First Level to Increase Exclusive Breastfeeding
Coverage in Tangerang.........................................................................................................................................1700
Marthia Ikhlasiah, Atnesia Ajeng, Ika Oktaviani
285. Survey of Registered Nurses Working in the Metropolitan Hospitals on Bullying Experiences at Workplace in
South Korea..........................................................................................................................................................1706
Kwang Ok Lee
287. Influences of Mothers’ Parenting Attitude, Parenting Efficacy, and Stress Levels on Children’s Social Skills..1716
Kwang Ok Lee, Hyun Ju Chae
288. Relationships between Body Image Perception and Body Esteem and Sexual Assertiveness of Female College
Students: Comparision of Nursing Students and Non-nursing Students..............................................................1721
Hyun Ju Chae, Kwang Ok Lee
289. Study of Multiple Genotypes in the XPD gene for A/C Lys751Gln and Lung Cancer in Samples from Baghdad–
Iraq........................................................................................................................................................................1727
Maiss Adnan Al-Ward, Mohammed Mahdi Jawad
290. Assessment of Risk Factors of Asthma in Health Institutions in Maysan Governorate, Iraq..............................1732
Ali Abdulwahed AbdulJabbar, Buthaina Ateyah Rashid
291. Application of Care Bundle Approach for Preventing Device Associated Infections: A Training Program for
Pediatric and Neonatal Nurses..............................................................................................................................1744
Amal M. Ibrahim, Safy S. Al-Rafay, Hyam R. Tantawi
292. Effects of Modified-Continuous Ambulatory Peritoneal Dialysis (CAPD) Patient’s Handling Process on Nurse’s
Knowledge, Perceived Benefits and Performance in CAPD Care.......................................................................1752
Prichavijy Promjak, Samlee Plianbangchan, Ratana Somrongthong, Wongsa Laohasiriwong
293. Harmonization Over the Regulations of Electronic Medical Records and its Potential to be Abused................1760
Maskun, Rian Nugraha, Hasbi Assidiq, Muhammad Tayyib, Armelia Syafira
DOI Number: 10.37506/mlu.v21i1.2267 Medico-legal Update, January-March 2021, Vol. 21, No. 1 1
Abstract
Introduction: The literature on burnout research shows that more than 90% have used the Maslach Burnout
Inventory (MBI).
Objective: The aim is to establish the psychometric properties in terms of reliability, sensitivity and validity
of the Maslach Burnout Inventory (MBI) and to adapt it to the context of Moroccan teachers.
Method: This work was carried out through a process of translation and reverse translation of the
original instrument by adapting the elements to the teaching profession. To determine the psychometric
characteristics, we used Cronbach’s alpha to determine reliability, exploratory factor analysis to extract
factors and determine dimensionality, and confirmatory factor analysis to test the validity of the statistical
model. Validation of the instrument was carried out on a sample of 170 teachers working in public schools
in Ouezzane region (Morocco).
Results: Items 4, 5, 7, 9, 12, and 22 were relatively incoherent with respect to the other items, they were
eliminated. The factorial analysis made appear three factors whose are explain 58.22% of the total variance.
Cronbach’s α for the whole questionnaire (0.761), for emotional exhaustion (0.819), depersonalization
(0.850) and sense of personal accomplishment (0.785). The confirmatory factor analysis (CFA) showed
satisfactory adjustment indices (X2 = 164,938 - df = 101- CFI = .937 - TLI = .915 - RMSEA = .037- P
close = .984).
Conclusion: We propose to use Maslach’s Theoretical Model for the Moroccan Sample in Future Research
on the burnout of Moroccan teachers.
Cronbach’s α. 0,81 0,85 0,79 Age 38,30 8,92 ,16* ,04 ,01
% of the explained variance 37,05 13,79 7,38 Gender -,21** -,28* ,05
% of total variance explained 58,22 ** The correlation is significant at level 0.01 (bilateral).* The
Precision measurement correlation is significant at level 0.05 (bilateral).
of Kaiser-Meyer-Olkin
sampling (KMO) 0,88 4. Confirmatory Factor Analysis: Finally, by
respecting the quality of the adequacy indices of the
Bartlett sphericity test:
Schermelleh-Engel, Moosbrugger & Muller model
Chi-square approximate 1096,95
(Schermelleh-Engel K, 2003)9, the Confirmatory
Dl 120
Significance of Bartlett 0.000
Factor Analysis (CFA) carried out on the data of our
sample showed that our tested three-dimensional
EE: Emotional exhaustion, DP: Depersonalization, PA: Sense of model presents satisfactory adjustment indices. X2
personal accomplishment = 164.94; DF = 101; 0 ≤ X2 ≤ 2df; RMSEA = 0.03;
In view of these results, the translation and application CFI = 0.93 above the critical threshold of 0.9 and
of the MBI in Arabic to a sample of Moroccan teachers the P close of 0.98 is very close to 1 (Table 3).
4 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 3: Quality thresholds of the model’s adequacy indices According to Schermelleh, Engel, Moosbrugger
& Muller 9
Thresholds of acceptability
Indices Model
Good adequacy Acceptable adequacy
X2 164,93 0 ≤ X2 ≤ 2df
2df <X2 ≤ 3df
Df 101 0 ≤ 164,938 ≤202
CFI 0,93 CFI ≥ 0,90
0 ≤ RMSEA ≤ 0,05
RMSEA 0,03 0, 05 <RMSEA ≤ 0,08
0 ≤ 0,037 ≤ 0,05
0,10 <p ≤ 1
P close 0,98 0,05 ≤ p ≤ 0,10
0,10 <0,984 ≤ 1
In view of this table, our model shows a good Moroccan teachers. The 16-item Moroccan version
adequacy with the observed data, which allows us specific to MBI teachers proposed by this research is
to formulate the validation of the three-dimensional therefore a validated structure.
character of the MBI translated into Arabic specific to
Figure 1: Confirmatory Factorial Analysis (CFA) performed by the maximum likelihood estimation method.
MBI-ESM three-factor model (16 items). (X2 = 164,938 - df = 101- CFI = .937 - TLI = .915 - RMSEA =.037-
P close = .984.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 5
Discussion 14,
like those of Byrne and al in Canada Yadama GN and
Drake B in China15, and Boles JS and al in the United
The objective of this study was to construct and test
States16. This study reveals a deviation from items
the factor structure, internal reliability, sensitivity and
13, 16 and 20, which are theoretically associated with
validity of a scale of measurement translated into Arabic
emotional exhaustion in the initial version, towards
of professional burnout for Moroccan teachers, designed
depersonalization. This deviation of theoretical items
according to Maslach’s three-dimensional theoretical
from one dimension to another has been observed
model. The 16-item tool was validated on a representative
in Abu-Hilal’s study in 201817. Confirmatory Factor
sample of teachers from the Ouezzane exercising in
Analysis (CFA) confirmed the validity of the 16-
northern Morocco, using a sequential analysis (internal
item MBI specific to Moroccan teachers with very
coherence, EFA and CFA).Several validation tests have
satisfactory data adjustment indices (X 2 =164.938 - df
shown the inconsistency of some theoretical items of
= 101- CFI = 0, 937 - TLI = 0.915 - RMSEA = 0.037 and
the 22-item MBI with the characteristics of the samples
P close=0.984). This valid instrument is proposed for
studied, which forced the researchers to exclude certain
the evaluation of burnout among Moroccan teachers in
items to improve their model. Ellenge Denton and al, in
future research. Concerning internal consistency, MBI-
the United States of America and Jamaica, had excluded
ES reliability analyses through studies systematically
10 items, the teacher-specific version was validated at 12
give Cronbach’s alphas that vary between 0.8 and 0.9 for
items11. Aluja and al, in Spain, had excluded five items;
emotional exhaustion (EE), between 0.50 and 0.79 for
the teacher-specific version for them was validated at 17
depersonalization (DP), and between 0.69 and 0.82 for
point12. Concerning our study, we excluded the items 4,
personal achievement (AP)12. For this study, Cronbach’s
5, 7, 9, 12, and 22, and we kept a 16-item model. This
alphas on the global scale (0.761) as well as those of
inconsistency of these items could be explained by the
emotional exhaustion (0.819), depersonalization (0.850)
characteristics of the teaching profession, the Moroccan
and sense of personal accomplishment (0.785) are
language and culture. This confirms Wheeler’s idea
satisfactory and comparable to those reported in several
that further studies are needed on item-level analyses
versions, indeed, the Cronbach alpha value of emotional
to explain the divergent results across occupations,
exhaustion (0.819) is goobut remains lower than that of
languages and cultures13. The exploratory factorial
several studies. On the contrary, the depersonalization
analysis has retained the three dimensions for the 16-
rate (0.850) is higher (Table 4).
item MBI-ESM, which is consistent with several studies
Table 4: Cronbach’s Alpha of the different dimensions of MBI-ES according to different studies. DPS:
Depersonalization towards students. DPJ: Depersonalization towards work
8. Anderson J, Gerbing DW. Structural Equation 18. Fernando, J ., & Perez, J. Un instrumento para medir
Modeling in Practice: A Review and Recommended que mazon professional en los Docentes : Adaptation
Two-Step Approach. Psychol Bull. 1 janv Catalania del Maslach Burnout Inventry (MBI)
1988;103(3):41123. an instrument to evaluate professional burnout in
teachers: Catalonian adaptation of the MBI .Rivista
9. Schermelleh-Engel K, Moosbrugger H, Müller H.
de Ppsiquiatria de la facultad de medecine de la
Evaluating the Fit of Structural Equation Models:
universidad de Barcelona. 1996.23;11-18.
Tests of Significance and Descriptive Goodness-of-
Fit Measures. Method Psychol Res. 2003;8(2):2374. 19. Won Sun Chen .Translation, Cross-cultural
Adaptation and Validation of the Malay Version of
10. Nunnally JC (1978). Théoriepsychométrique, 2nd
the Maslach Burnout Inventory (MBI) in Malaysia;
Edn. New York, NY: McGraw-Hill.
International Journal of Social Science Studies.
11. Denton E, Chaplin WF, Wall M. Teacher Burnout: 2014;2:2324-8041.
A Comparison of Two Cultures Using Confirmatory
DOI Number: 10.37506/mlu.v21i1.2268 Medico-legal Update, January-March 2021, Vol. 21, No. 1 7
Abdullah Ali Mohammed1, Mahmood Nazar Mustafa2, Sura A. Abdulsattar3, Ahmed Salam Al-zaidi4
1
Assistant Lecturer (M.Sc.) Department of Chemistry and Biochemistry, 2Assistant Lecturer (M.Sc.) Department of
Pathology and Forensic Medicine, University of Fallujah, College of Medicine, Iraq, 3Prof. Dr. (PHD) Department
of Chemistry and Biochemistry, Mustansiriyah University, College of Medicine, Iraq, 4(M.Sc.) Department of
Medical Analysis, Al-Furat General Hospital, Iraq
Abstract
The clinical features of COVID-19 are varied, ranging from asymptomatic state to acute respiratory distress
syndrome and multi organ dysfunction. We aim to evaluate renal and liver functions of patients with COVID
19. Laboratory results were obtained from 107 patients with laboratory-confirmed COVID-19 who were
admitted to the only Al-Furat General Hospital in Baghdad, Iraq from March 3 to June 9, 2020 and followed
up until recovery. Normal levels of renal functions were presented. Meanwhile elevated levels of alanine
aminotransferase (ALT) was observed in 10% and of aspartate aminotransferase (AST) was observed in
40% of patients with COVID 19,yet on comparison of the results at entering with at recovery it was observed
significant differences (p<0.01) of all patients. From these findings we conclude that the virus might be
responsible for systemic inflammation.
Although available sex-disaggregated data for Patients with abnormal liver tests were at increased risk
COVID-19 show equal numbers of cases between of progressing to severe disease. The detrimental effects
sexes, current study indicates that infectious rates are on liverinjury mainly related to certain medications used
higher in male than in female, and that may be due to during hospitalization, and should be monitored and
sex hormone that contribute to different immunologic evaluated frequently18.
responses in men and women: As a general rule,
estrogens promote both innate and adaptive immune Conclusion
responses, which result in faster clearance of pathogens Elevated levels of alanine aminotransferase (ALT)
and greater vaccine efficacy13. Conversely, testosterone was observed in 10% and of aspartate aminotransferase
has largely suppressive effects on immune function, (AST) was observed in 40% of patients with COVID
which may explain the greater susceptibility to 19,yet on comparison of the results at entering with at
infectious diseases observed in men14. Notably, changes recovery it was observed significant differences (p<0.01)
in sex hormone may further shape the immune response of all patients. As AST is not specific for liver damage,
to pathogens14. Sex-related biological data may also be which indicated that the systemic inflammation induced
critical to investigate the contribution of sex hormones by the virus might be responsible for these findingsnot
in inflammatory response. In particular, reduction in related to certain medication.
testosterone levels in aging men has been associated
with increased proinflammatory cytokine levels 14 which Conflict of Interest Statement: All authors declare
may contribute to worse COVID-19 progression in older that they have no conflict of interest.
men. Sex differences in disease progression may also
be linked to estrogen-induced decreased expression of Source of Funding: Self
angiotensin-converting enzyme 215 Pre-print studies Ethical Clearance: Taken from Al-Furat general
are conflicting as to whether ACE2 expression in lung hospital-Iraq.
tissue is different between sexes16,17. Some patients with
COVID-19 pneumonia also present with kidney injury, References
and autopsy findings of patients who died from the
illness sometimes show renal damage7. In meta-analysis 1. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y,
study of Zhu j et al indicated that some patients with Zhang L, Fan G, Xu J, Gu X, Cheng Z, Yu T, Xia
COVID 19 (25.5%) presented elevated levels of renal J, Wei Y, Wu W, Xie X, Yin W, Li H, Liu M, Xiao
functions18. The results of current study indicated that Y, Gao H, Guo L, Xie J, Wang G, Jiang R, Gao Z,
all patients presented normal levels of renal functions. Jin Q, Wang J, Cao B. Clinical features of patients
Howeveron comparison of the results at entering with at infected with 2019 novel coronavirus in Wuhan,
recovery it was observed significant differences (p<0.01). China. Lancet. 2020; 395:497–506.
10 Medico-legal Update, January-March 2021, Vol. 21, No. 1
2. Chen N, Zhou M, Dong X, Qu J, Gong F, Han 10. Ozma MA, Maroufi P, Khodadadi E, Köse Ş,
Y, et al. (2019), Epidemiological and clinical Esposito I, Ganbarov K, Dao S, Esposito S, Dal T,
characteristics of 99 cases of novel coronavirus Zeinalzadeh E, Kafil HS. Clinical manifestation,
pneumonia in Wuhan, China: a descriptive study. diagnosis, prevention and control of SARS-CoV-2
Lancet. 2020;395:507–513. (COVID-19) during the outbreak period. Infez
3. Xinhua. China’s CDC detects a large number of Med. 2020;28(2):153-165.
new coronaviruses in the South China seafood 11. Humar A, McGilvray I, Phillips MJ, Levy GA.
market in Wuhan.2020; Available at: https://www. Severe acute respiratory syndrome and the liver.
xinhuanet.com/2020-01/27/c_1125504355.htm. Hepatology.2004; 39: 291- 294.
4. Liu J, Shu YL, and Zhou XN. Transmission patterns 12. Chan HLY, Leung W-K, To K-F, et al. Retrospective
and control of COVID-19 epidemic.Indian Journal analysis of liver function derangement in severe
of plant physiology .2020; 9:112. acute respiratory syndrome. Am J Med.2004; 116:
5. Rothe Camilla, Schunk Mirjam, Sothmann Peter, 566- 567.
Bretzel Gisela, Froeschl Guenter, Wallrauch 13. Bartz D, Chitnis T, Kaiser UB, et al. (2020), Clinical
Claudia, Zimmer Thorbjörn, Thiel Verena, Janke advances in sex- and gender-informed medicine
Christian, Guggemos Wolfgang, Seilmaier Michael, to improve the health of all: a review. JAMA
Drosten Christian, Vollmar Patrick, Zwirglmaier Intern Med. [PMID: 32040165] doi:10.1001/
Katrin, Zange Sabine, Wölfel Roman, Hoelscher jamainternmed.2019.7194GOOGLE SCHOLAR.
Michael. Transmission of 2019-nCoV Infection 14. Bianchi VE. . The anti-inflammatory effects of
from an Asymptomatic Contact in Germany. New testosterone. J Endocr Soc.2019;3:91-107.
England Journal of Medicine. 2020;(10):970–971.
15. La Vignera S, CannarellaR, Condorelli RA, et
6. Singhal T..A Review of Coronavirus Disease-2019 al. Sex-specific SARS-CoV-2 mortality: among
(COVID-19).Indian J Pediatr.2020; 87(4): 281– hormone-modulated ACE2 expression, risk of
286. venous thromboembolism and hypovitaminosis d.
7. Guangchang Pei, Zhiguo Zhang, Jing Peng, Liu Liu, Int J Mol Sci.2020;21.
Chunxiu Zhang, Chong Yu, Zufu Ma, Yi Huang, 16. Cai G. Bulk and single-cell transcriptomics identify
Wei Liu, Ying Yao, Rui Zeng, Gang Xu. (2020 tobacco-use disparity in lung gene expression
Apr 28),Renal Involvement and Early Prognosis of ACE2, the receptor of 2019-nCov. MedRxiv,
in Patients with COVID-19 Pneumonia. J Am Soc published online .2020; February 02.
Nephrol. 2020;31(6):1157-1165
17. Zhao Y, Zhao Z, Wang Y, Zhou Y, Ma Y, Zuo W.
8. Cai Q, Huang D, Yu H, Zhu Z, Xia Z, Su Y, Li Z, Zhou Single-cell RNA expression profiling of ACE2, the
G, Gou J, Qu J, SunY, Liu Y, He Q, Chen J, Liu L, putative receptor of Wuhan 2019-nCov. BioRxiv,
Xu L, Characteristics of Liver Tests in COVID-19 2020; 26
Patients, Journal ofHepatology.2020;April.
18. Jieyun Zhu, Pan Ji, Jielong Pang, Zhimei Zhong,
9. Chau TN, Lee KC, Yao H, Tsang TY, Chow TC, Hongyuan Li, Cuiying He, Jianfeng Zhang,
Yeung YC, et al. . SARS-associated viral hepatitis Chunling Zhao. Clinical Characteristics of 3062
caused by a novel coronavirus: report of three COVID-19 Patients: A Meta-Analysis. J Med
cases. Hepatology. 2004; 39:302–310. Virol. 2020; Apr 15 : 10.1002/jmv.25884.
DOI Number: 10.37506/mlu.v21i1.2269 Medico-legal Update, January-March 2021, Vol. 21, No. 1 11
Abirami P.
Ph.D. (N), Professor, Dept. of Obstetrics and Gynaecology Nursing, SRM College of Nursing,
Kattankulathur, Tamil Nadu
Abstract
Introduction: Caring is actually fundamental concept in nursing and manifests openness and honesty in the
humanitarian area and the core of nursing science. Caring is the heart and soul of nursing, and people expect
caring more than any other from nurses. Caring in nursing consist of two key dimensions, namely physical
and mental. The psychological caring behaviors results in building confidence the feeling, faith and honesty
of nursing: is caring a science.
Aim: A study to assess the level of perception regarding instructor caring behavior among nursing students
at SRM College of Nursing, SRM Institute of Science and Technology, Kattankulathur.
Methodology: Non experimental descriptive research design was used to assess the level of perception
regarding instructor caring behavior among nursing students. The study was conducted at SRM college of
nursing, Kattankulathur, Kancheepuram district. 200 students who were studying at SRM college of nursing
were selected by Non – probability convenient sampling technique. Research design was descriptive design.
The data collection consisted two parts.Part A Demographic variables, Part B The structured questionnaire to
assess the level of perception regarding instructor caring behavior among nursing students. It was validated
and found to be feasible.
Results and Conclusion: The following conclusions were drawn and the basis of the findings of the study.
121 (54.3%) Students have perceived that their was a moderate level of caring behavior by the instructor, 90
(40.4%) students have perceived that their was a high level of caring behavior by the instructor.
3. Woodward VM. Professional caring: a 15. Nahas VL, Nour V, Al-Nobani M. Jordanian
contradiction in terms? Journal of Advanced undergraduate nursing students’ perceptions of
Nursing. 1997;26(5):999–1004. effective clinical teachers. Nurse Educ Today .
1999; 19 (8):639–48.
4. Cook PR, Cullen JA. Caring as an imperative for
nursing education. Nursing Education Perspectives 16. Hanson L, Smith M. Nursing students’ perspectives:
. 2003; 24 (4):192–7. experiences of caring and not-so-caring interactions
with faculty. Journal of Nursing Education . 1996;
5. Wade GH, Kasper N. Nursing students’ perceptions
35 (3):105–12.
of instructor caring: an instrument based on
Watson’s theory of transpersonal caring. Journal of 17. Cook L. Inviting teaching behaviors of clinical
Nursing Education . 2006; 45 (5):162–8. faculty and nursing students’ anxiety. Journal of
Nursing Education . 2005; 44 (4):156–62.
6. Najafipour S, Raoofi R, Abdi MH, Mosalanejad
L. The nursing students’ viewpoints on influential 18. Heydari M, Shahbazi S, Sheykhi RA, Heydari K.
clinical instructor in Jahrom University of Medical Nursing students’ viewpoints about Problems of
Sciences. ournal of Jahrom University of Medical clinical education. Iranian Journal of Health &
Sciences . 2011;9:39–46. (Persian) Care. 2011;1(13):18–23. (Persian)
7. Pazandeh F, Abedian K, Jan-Nesari S, Alavi-Majd 19. Alavi M, Irajpour AR, Nasiri A, Abedi HA. Barriers
H. Opinions of nursing and midwifery students to clinical education: student nurses’ experiences.
regarding an effective clinical tutor at Medical Scientific Quarterly of Birjand Nursing and
Universities in Tehran. ournal of Shahid Beheshti Midwifery Faculty. 2009;1-4(6):5–11. (Persian)
school of Nursing & midwifery. 2006;55(16):46– 20. Delaram M, Raeisi Z, Alidousti M. Strengths
54. (Persian) and weaknesses of clinical education from the
8. Alavi M, Abedi H. Nursing students’ experiences viewpoints of nursing and midwifery students
and perceptions of effective instructor in clinical in Shahrekord University of Medical Sciences.
education. Iranian Journal of Medical Education. Qom University of Medical Sciences Journal.
2008;7(2):325–334. (Persian) 2012;6(2):76–81. (Persian)
9. Karaöz S. Turkish nursing students’ perception of 21. Abedini S, Agha Mullahei T, Jomehzadeh A,
caring. Nurse Education Today . 2005; 25 (1):31– Kamjo A. Clinical education problems from the
40. viewpoint of nursing and midwifery students
of Hormozgan University of Medical Sciences.
10. Wafaa GA. Caring and effective teaching behavior
Hormozgan Medical Journal. 2009;12(4):249–53.
of clinical nursing instructors in clinical area as
(Persian)
Medico-legal Update, January-March 2021, Vol. 21, No. 1 15
22. Salehian M, Armat MR.. Qualitative study of Schools. Iranian Journal of Medical Education.
nursing student experiences in clinical education. 2006;5(2):77–84.(Persian)
Journal of North Khorasan University of Medical 24. Vahid Zamanzadeh, Masoumeh Shohani,Tina
Sciences. 2009; 23(1):57–63. (Persian) Palmeh, Nursing Students’ Perception of
23. Rahimi A, Ahmadi F. The obstacles and improving Instructors’ Caring Behaviors in Tabriz University
strategies of clinical education from the viewpoints of Medical Sciences, Journal of Caring Sciences,
of clinical instructors in Tehran’s Nursing 2015 Mar; 4(1): 55–62.
16 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2270
Abstract
Globalization, which has now crossed the line, has had many impacts on all countries in the world including
Indonesia. One of the impacts of globalization is the impact of deviant associations such as LGBT and
it affects various countries. The emergence of the LGBT phenomenon, which is currently a hot topic of
discussion by various parties in Indonesia, has raised pros and cons views on the legality of LGBT in
society. LGBT legalization in various countries is currently encouraging LGBT survivors in Indonesia to
urge the government to legalize LGBT. Therefore, this article will discuss the reality of LGBT and its legal
arrangements in Indonesia and how to analyze the philosophy of law on the reality of LGBT in Indonesia.
The results of the study show that according to the constructivism paradigm in the contextual review of legal
philosophy in Indonesia, LGBT is not in accordance with the values of Pancasila as the nation’s life guide.
Abstract
Indigenous peoples in Indonesia have a diverse family system, this leads to diversity in the devolution
system. This form of parental kinship applies to the people of Berbah Sub-District of Sleman Regency. And
whoath is in the heavens and the earth, and who is in the heavens and the earth, and who is in the heavens
and the earth, and who is in the heavens and the earth, and whoth in the heavens and the earth, and currently,
the people in Berbah Sub-District of Sleman Regency are predominantly Muslim, which could potentially
influence the pattern of setting inheritance distribution in Islamic Law. There is still a strong principle of
togetherness, the principle of deliberation, and the principle of benefit in the order of life of the people of
Berbah District of Sleman Regency. Most importantly, they can accept the results of deliberation while
upholding the principle of harmony.
However, data is obtained, there are a small number Some of the legal principles underlying the
of families who when dividing the inheritance, only inheritance customary law are that according to the
boys get more inheritance assets with daughters, namely customary law system, inheritance property is not an
2 to 1 in accordance with the provisions of Islamic entity that can be valued in money but is a unit that is not
Inheritance Law. divided or can be divided according to types and kinds
and based on the interests of the inheritors10. According
As understood, the inheritance customary law is the to the customary law system, inheritance is based on
rules of customary law that govern how the inheritance equal rights, meaning that the rights of each heir are
or inheritance is passed on or shared from heirs to experts required to be the same in the process of passing on and
from generation to generation9. passing on assets, and are placed on the basis of harmony
Of course, there is an atmosphere of mysticism for in the process of distribution. Customary inheritance law
each family in dividing the inheritance for their children adheres to the principle of open inheritance, which can
or generations of descendants. Because customary law be carried out while the heir is still alive and after he
is a dynamic law, it can adapt to certain situations and dies. So, customary inheritance law does not recognize
conditions. So when the provisions of the customary any time when experts demand the opening of an
inheritance law are not implemented by certain families, inheritance. Settlement of inheritance using divine law
it does not mean that the community must make a principles, self-control, deliberation and consensus,
problem. The most important thing is that the principles harmony and kinship, and mutual rights.
of sharing his customary heritage are fulfilled. Inheritance customary law is a form of the legal
Factors of traditional inheritance law in Berbah system that applies to the Indonesian people, especially
sub-district, Sleman regency: In connection with the those who are subject to customary law. Customary
factors that cause Adat Waris Law to be effective in inheritance law is based or based on the principles of
Berbah District, Sleman Regency, data is obtained that the characteristics of the traditional Indonesian school
the people of Berbah Subdistrict have a high level of of thought, which have distinctive features, namely
compliance in carrying out the distribution of inheritance communal, religious magic, concrete, and cash (cash).
according to their customary provisions, because so far Hazairin said that customary inheritance law has its
there have been relatively no internal conflicts between own characteristics, namely that which originates
the heirs in a family who carry out the distribution of from the minds of traditional communities with the
inheritance from their parents. The existence of a magical form of kinship whose descent systems are based on
religious basis of thought in the people of Berbah patrilineal, matrilineal, and parental/bilateral9. Based
District, Sleman Regency, on the implementation of on this distinctive feature, customary inheritance law
inheritance distribution pays more attention to the heirs, is different from Islamic and western inheritance law.
parents and ancestors who have died calm in their graves. These differences stem from the way of thinking and
Mean while, the process of distributing inheritance way of life, such as customary inheritance law based
by using the principle of cumunal or togetherness, the on collective-communal rationalism, while western
principle of deliberation and the principle of benefit in inheritance law is based on individualism.
accordance with the provisions of customary law. So the
most important thing is to be able to receive the results Conclusion
of the deliberations while still upholding the principle of In general, people in the Berbah District of Sleman
harmony. Regency recognize parental forms of kinship. Namely
the kinship system, where there is a balance of position
Furthermore, the results of the above research,
between husband and wife or withdrawing from the
conducted discussions with competent parties, so it can
father and mother line. There is an equal inheritance
be understood that the customary inheritance law in the
between boys and girls, or there is an equal right to
Berbah District generally shows a distinctive feature
the acquisition of inheritance from the heir, namely his
of the traditional Indonesian mindset, which is based
parents.
on the principles that arise from a mind that is imbued
Medico-legal Update, January-March 2021, Vol. 21, No. 1 23
The factors causing the inheritance customary Funding: This research receives funding from
law are still effective in Berbah District, Sleman Faculty of Law, Universitas Diponegoro, Semarang,
Regency, namely: a). The people of Berbah District Indonesia.
have a high level of compliance in carrying out the
distribution of inheritance in accordance with their Conflict of Interests: There are no conflict of
customary provisions, because so far there has never interests
been an internal conflict between the heirs in a family
that distributes inheritance from their parents. b). The
References
existence of a magical religious basis of thought in the 1. Sismarwoto E. Islamic ethical value of customary
people of Berbah District, on the implementation of basis of marriage proposal application in
the distribution of inheritance, pays more attention to Indonesia. Indian Journal of Forensic Medicine and
the heirs, parents and ancestors who have died calm in Toxicology. 2020;14(3): 1843-1846.
their grave. c). The process of distributing inheritance by 2. Suparman E.Intisari Hukum Waris Indonesia.
more using the principle of cumunal or togetherness, the Armico; 1985
principle of deliberation and the principle of benefit in
3. Mulyadi L. Interpretation of judges in representing
accordance with the provisions of customary law. So the
the dynamics of religion of indigenous legal
most important thing is to be able to receive the results
inheritance of Bali. Jurnal Hukum dan Peradilan.
of the deliberations while still upholding the principle of
2019 Jul 31;8(2):214-27.
harmony.
4. Soepomo, R. Bab-bab Hukum Adat. Jakarta:
Suggestion: Village apparatus, especially in Pradnya Paramita;1981
the Berbah sub-district, Sleman Regency, as well as 5. Prodjodikoro, W. Hukum warisan di Indonesia.
related officials, so that they can better understand the Sumur Bandung; 1966.
substance of the distribution of inheritance carried out
6. Sendratari, LP. Perempuan Bali: Wajah
by their residents. So that there is certainty to provide
Sejuta Warna (Kajian tentangReproduksi dan
legal protection for parties related to the distribution of
Resistensiterhadap Patriarki). Media Komunikasi
inheritance.
Singaraja; 2002.
Village apparatus in the Berbah Subdistrict, Sleman 7. Sudiyat I. Hukum adat: sketsa asas. Liberty
Regency, should be able to act as mediators in resolving Yogyakarta; 1981.
disputes that may arise as a result of the distribution of 8. Hadikusuma H.. Pokok-pokok pengertian hukum
inheritance carried out based on local customary law, in adat. Alumni; 1980.
a fair manner.
9. Hilman H. Pengantar Ilmu Hukum Adat Indonesia.
Ethical Clearance: This research was ethically Mandar Maju, Bandung; 1992
approved by Faculty of Law, Universitas Diponegoro, 10. Samosir D. Hukum adat: eksistensi dalam dinamika
Semarang, Indonesia perkembangan hukum di Indonesia. Nuansa Aulia;
2013.
24 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2273
Abstract
Several studies inform that early marriage is correlated with several situations, including socioeconomic
status, cultural wisdom, religious values, education, and internet access. The study was aimed at analyzing
the effect of education level on women’s risk of early marriage in rural areas in Indonesia. The study used
data from the 2017 Indonesian Demographic and Health Survey. There were 2,252 women aged 19-24 years
in a rural area in Indonesia who was taken as a sample. The variables analyzed included early marriage,
education level, wealth status, and employment status. The final stage was used as a binary logistic regression
test to determine the risk factors. The result found that women who have secondary education have a risk of
0.396 times compared to women who have primary education to experience an early marriage (OR 0.396;
95% CI 0.309-0.506). Women who have a higher education have a risk of 0.091 times compared to women
who have primary education to experience an early marriage (OR 0.091; 95% CI 0.059-0.140). This finding
informs that the education level was a determinant of the incidence of early marriage among women in rural
Indonesia. The lower the education of a woman in a rural area, the higher the risk of experiencing an early
marriage. It could be concluded that a low level of education is a risk factor for women’s early marriage in
rural areas in Indonesia.
Education Level
Characteristics Primary Secondary Higher p
n % n % n %
Early marriage ***<0.001
No 96 15.7% 516 34.4% 101 70.6%
Yes 514 84.3% 983 65.6% 42 29.4%
Wealth status ***<0.001
Poorest 406 66.6% 687 45.8% 48 33.6%
Poorer 119 19.5% 394 26.3% 26 18.2%
Middle 59 9.7% 252 16.8% 27 18.9%
Richer 19 3.1% 115 7.7% 21 14.7%
Richest 7 1.1% 51 3.4% 21 14.7%
Employment status **0.002
Unemployed 387 63.4% 1055 70.4% 88 61.5%
Employed 223 36.6% 444 29.6% 55 38.5%
Table 2. The result of binary logistic regression of early marriage among women in rural area Indonesia
(n=2,252)
Early Marriage
Predictors
Sig. OR Lower Bound Upper Bound
Education level: Primary - - - -
Education level: Secondary ***<0.001 0.396 0.309 0.506
Education level: Higher ***<0.001 0.091 0.059 0.140
Wealth status: Poorest - - - -
Wealth status: Poorer *0.032 0.776 0.615 0.978
Wealth status: Middle **0.001 0.639 0.489 0.834
Wealth status: Richer ***<0.001 0.434 0.303 0.620
Wealth status: Richest *0.045 0.603 0.368 0.988
Employment status: Unemployed - - - -
Employment status: Employed *0.014 1.294 1.054 1.588
Women who have the wealth status of the poorer CI 0.303-0.620). The richest women had a risk of 0.603
category have a risk of 0.776 times compared to the times compared to the poorest women to experience
poorest women to experience an early marriage (OR an early marriage incident (OR 0.603; 95% CI 0.368-
0.776; 95% CI 0.615-0.978). Women who have wealth 0.988). This finding informs that poverty is a risk factor
status in the middle category have a risk of 0.639 times for early marriage among women in rural Indonesia.
compared to the poorest women to experience an early
marriage (OR 639; 95% CI 0.489-0.834). Women Previous studies in various developing countries
who have wealth status in the richer category have a have found similar results that poverty is a risk factor
risk of 0.434 times compared to the poorest women to for early marriage. Some of these countries are in South
experience an early marriage incident (OR 0.434; 95% Sudan, Bangladesh, and India24–27. In the context in
Indonesia, the phenomenon of early marriage tends to
Medico-legal Update, January-March 2021, Vol. 21, No. 1 27
occur in poor families of women. Early marriage is one 3. BKKBN. Survei Demografi dan Kesehatan
practical way for poor families to get out of poverty. Indonesia. 2017.
Marrying a girl from a poor family to a rich male family 4. Widyastari DA, Isarabhakdi P, Shaluhiyah Z.
is a shortcut to a better life28,29with girls constituting the Intergenerational patterns of early marriage and
majority (76 per cent. childbearing in Rural Central Java, Indonesia. J
Popul Soc Stud. 2020;28(3):254–60.
Finally, employed women have 1.294 times the
risk of unemployed women experiencing an early 5. Rahman RTA, Yuandari E. Early Marriage in
marriage (OR 1.294; 95% CI 1.054-1.588). The results Banjarmasin: The Impact on Reproductive Health
of this analysis inform that employed is a risk factor for and Prevention Strategy. Int J Clin Invent Med Sci.
early marriage among women in rural Indonesia. The 2020;2(1):15–9.
employment status of women is closely related to the 6. Widyastari DA. Revisiting the New Indonesia’s
wealth status of the family. In developing countries, Marriage Act 2019 : will it be effective to prevent
women tend to be responsible for domestic affairs. adolescent marriage? INSIGHTS Public Heal J.
If women take part in earning a living, especially in 2019;1(1).
non-formal manual labor, they often come from poor 7. Martin-Anatias N. On Being a “Good” Indonesian
families30–32. Muslim Woman: An Autoethnography. Humanity
Soc. 2019;43(4):351–74.
Conclusions
8. Ningsih AP, Muis M, Syafar M, Abdullah MT.
Based on the results of the analysis, it was found Adolescent ’ s P erception and Severity Related to
that low-level education is a risk factor for women’s Early Marriage, in Selayar Island. Int J Multicult
early marriage in rural areas in Indonesia. Two other Multireligious Underst. 2020;7(4):132–9.
variables that were also found as risk factors were low 9. Rahayu WD, Wahyuni, Ph.D. H. the Influence of
wealth status (poor) and employed. Early Marriage on Monetary Poverty in Indonesia.
These findings provide clear information on targets J Indones Econ Bus. 2020;35(1):30–43.
for the government to reduce the incidence of early 10. Velentza C. Early Marriage and Education Drop Out
marriage in Indonesia. It is recommended that the in Traditional Roma Communities in Transylvania.
government set targets that focus on those with low J Gypsy Stud. 2020;2(1):39–54.
levels of education and the poor for policies to reduce 11. Pratiwi NL, Fitrianti Y, Nuraini S, Rachmawati T,
the incidence of early marriage in Indonesia. Laksono AD, Afreni M, et al. Concealed Pregnant
Women or Kemel of Gayo Ethnic in Blang Pegayon
Source of Funding: Self-funding
District, Gayo Lues District, Aceh. Bull Heal Syst
Conflict of Interest: The authors declare no conflict Res. 2019;22(2):81–90.
of interest, financial or otherwise. 12. Laksono AD, Faizin K, Raunsay EM, Soerachman
R. Muyu women in exile (Perempuan Muyu
Ethical Clearance: The 2017 IDHS has received dalam Pengasingan) [Internet]. Jakarta: Lembaga
ethical approval from the National Ethics Committee. Penerbitan Balitbangkes; 2014. Available
All respondent identities have been deleted from the from: https://www.scribd.com/doc/261673624/
dataset. Respondents have signed and agreed to their Perempuan-Muyu-dalam-Pengasingan-Riset-
involvement in the 2017 IDHS. Utilization of 2017 Ethnografi-Kesehatan-2014-Boven-Digoel
IDHS data for this research has received permission
13. Laksono AD, Wulandari RD. “Children are Assets”:
from ICF through the website: https://dhsprogram.com/
Meta Synthesis of Child Values in the Lani and
data/new-user-registration.cfm.
Acehnese (“Anak adalah Aset”: Meta Sintesis Nilai
Anak pada Suku Lani dan Suku Aceh). J Kesehat
References
Reproduksi. 2019;10(1):11–20.
1. Unicef Indonesia. Saying No to Child Marriage in 14. Jones GW. Which Indonesian women marry
Indonesia. 2020. youngest, and why? J Southeast Asian Stud.
2. UNFPA. Government of Indonesia Commits to 2001;32(1):67–78.
End Child Marriage. 2020. p. 5–7.
28 Medico-legal Update, January-March 2021, Vol. 21, No. 1
15. Grijns M, Horii H. Child Marriage in a Village 24. Madut KK. Determinants of Early Marriage and
in West Java (Indonesia): Compromises between Construction of Gender Roles in South Sudan.
Legal Obligations and Religious Concerns. Asian SAGE Open. 10(2).
J Law Soc. 2018;5(2):453–66. 25. Razu SR. Determinants of early marriage among
16. Trommlerová SK. When children have children: The women: An experience from rural Bangladesh.
effects of child marriages and teenage pregnancies Gend Stud. 2018;17(1):127–36.
on early childhood mortality in Bangladesh. Econ 26. Talukder A, Hasan MM, Razu SR, Hossain MZ.
Hum Biol. 2020;39:Article number 100904. Early marriage in Bangladesh: A cross-sectional
17. Chauhan S, Sekher TV, Kumar P, Srivastava study exploring the associated factors. J Int
S, Patel R. Prevalence, determinants and socio- Womens Stud. 2020;21(1):68–78.
economic inequality of early marriage among men 27. Paul P. Effects of education and poverty on the
in India. Child Youth Serv Rev. 2020;116:Article prevalence of girl child marriage in India: A
number 105273. district–level analysis. Child Youth Serv Rev.
18. Heidari F, Dastgiri S. The prevalence and predicting 2019;100:16–21.
factors of female child marriage in north-west of 28. Singh R, Vennam U. Factors Shaping Trajectories
iran: A case-control multi-center study. Gazi Med to Early marriage : Evidence from Young Lives,
J. 2020;31(3):387–92. India. Young Lives Working Paper 149. 2016.
19. Wulandari RD, Laksono AD. Education as 29. Muharry A, Hakimi M, Wahyuni B. Family Structure
predictor of the knowledge of pregnancy danger and Early Marriage on Women in Indramayu
signs in Rural Indonesia. Int J Innov Creat Chang. Regency. J Kesehat Masy. 2018;13(3):314–22.
2020;13(1):1037–51.
30. Kohno A, Dahlui M, Nik Farid ND, Ali SH,
20. Wulandari RD, Laksono AD. Determinants of Nakayama T. In-depth examination of issues
knowledge of pregnancy danger signs in Indonesia. surrounding the reasons for child marriage in
PLoS One. 2020;15(5):Article number e0232550. Kelantan, Malaysia: A qualitative study. BMJ
21. Ipa M, Widawati M, Laksono AD, Kusrini I, Open. 2019;9(9):Article number e27377.
Dhewantara PW. Variation of preventive practices 31. Kohno A, Dahlui M, Nik Farid ND, Safii R,
and its association with malaria infection in eastern Nakayama T. Why girls get married early in
Indonesia: Findings from community-based survey. Sarawak, Malaysia - An exploratory qualitative
PLoS One. 2020;15(5):e0232909. study. BMC Womens Health. 2020;20(1):Article
22. Laksono AD, Wulandari RD. The Barrier to number 46.
Maternity Care in Rural Indonesia. J Public Heal 32. Keskiner E. Marriage decisions of Turkish second-
From Theory to Pract. 2020;Online First. generation women in Strasbourg: not a fate but a
23. Rohmah N, Yusuf A, Hargono R, Laksono AD, refuge. Ethn Racial Stud. 2020;43(16):231–48.
Masruroh, Ibrahim I, et al. Determinants of teenage
pregnancy in Indonesia. Indian J Forensic Med
Toxicol. 2020;14(3):2080–5.
DOI Number: 10.37506/mlu.v21i1.2274 Medico-legal Update, January-March 2021, Vol. 21, No. 1 29
Abstract
The border area is one area that needs government attention. The study was aimed at analyzing disparities
in hospital use in Kalimantan based on the border-non-border area category. The study was conducted using
data from the 2013 Indonesian Basic Health Survey. With the multi-stage cluster random sampling method,
69,043 respondents were obtained. In the final stage, a Multinomial Logistic Regression test was performed
to determine any disparities. The study results found that the utilization of inpatient at the hospital for those
living in the border area has a probability of utilization of 0.653 times compared to those who live in non-
border areas. Those who live in the border have a lower chance than those who live in non-border areas
of using inpatient hospital. The results of the study also found 8 other predictors that influence hospital
utilization among adults in Kalimantan Island, Indonesia. The eight predictors are the type of place of
residence, marital, education, work type, socioeconomic, health insurance, travel time, and transportation
cost. It could be concluded that there was a disparity in hospital utilization in the border–non-border areas
in Kalimantan Island, Indonesia. Those living in border areas have a lower likelihood of inpatient utilization
than those living in non-border areas.
Area
Characteristic All P
Border Non-Border
Hospital Utility 0.000
• Outpatient 59 (0.6%) 516 (0.9%) 575 (0.8%)
• Inpatient 78 (0.8%) 897 (1.5%) 975 (1.4%)
• Outpatient + inpatient 26 (0.3%) 139 (0.2%) 165 (0.2%)
• No utilization 9458 (98.3%) 57870 (97.4%) 67328 (97.5%)
Type place of residence 0.000
• Urban 3076 (32.0%) 26972 (45.4%) 30048 (43.5%)
• Rural 6545 (68.0%) 32450 (54.6%) 38995 (56.5%)
Age (mean) 9621 (38.40) 59422 (38.69) 69043 (38.65) 0.083
Gender
• Male 4890 (50.8%) 29010 (48.8%) 33900 (49.1%)
• Female (Ref.) 4731 (49.2%) 30412 (51.2%) 35143 (50.9%)
Marital status 0.000
• Single 2372 (24.7%) 12500 (21.0%) 14872 (21.5%)
• Married 6722 (69.9%) 42558 (71.6%) 49280 (71.4%)
• Divorce (Ref.) 527 (5.5%) 4364 (7.3%) 4891 (7.1%)
Medico-legal Update, January-March 2021, Vol. 21, No. 1 31
Area
Characteristic All P
Border Non-Border
Education level 0.000
• Primary school & under 5361 (55.7%) 29038 (48.9%) 34399 (49.8%)
• Junior high school 1952 (20.3%) 12184 (20.5%) 14136 (20.5%)
• Senior high school 1749 (18.2%) 14117 (23.8%) 15866 (23.0%)
• College (Ref.) 559 (5.8%) 4083 (6.9%) 4642 (6.7%)
Work type 0.000
• No work 3257 (33.9%) 23677 (39.8%) 26934 (39.0%)
• Public servant/army/police 481 (5.0%) 3361 (5.7%) 3842 (5.6%)
• Employee 443 (4.6%) 5489 (9.2%) 5932 (8.6%)
• Entrepreneur 1305 (13.6%) 9079 (15.3%) 10384 (15.0%)
• Farmer/Fisherman/Labor 3644 (37.9%) 15312 (25.8%) 18956 (27.5%)
• Others (Ref.) 491 (5.1%) 2504 (4.2%) 2995 (4.3%)
Socioeconomic status 0.000
• Quintile 1 2264 (23.5%) 9707 (16.3%) 11971 (17.3%)
• Quintile 2 1796 (18.7%) 10701 (18.0%) 12497 (18.1%)
• Quintile 3 1796 (18.7%) 11697 (19.7%) 13493 (19.5%)
• Quintile 4 1636 (17.0%) 11989 (20.2%) 13625 (19.7%)
• Quintile 5 (Ref.) 2129 (22.1%) 15328 (25.8%) 17457 (25.3%)
Insurance 0.000
• No insurance 4644 (48.3%) 28518 (48.0%) 33162 (48.0%)
• Askes, Jamkesmas, Jamkesda, Jamsostek 4913 (51.1%) 29115 (49.0%) 34028 (49.3%)
• Others (Ref.) 64 (0.7%) 1789 (3.0%) 1853 (2.7%)
Travel time 0.000
• ≤15 Minutes 2136 (22.2%) 23065 (38.8%) 25201 (36.5%)
• >15 Minutes (Ref.) 7485 (77.8%) 36357 (61.2%) 43842 (63.5%)
Transportation Cost 0.000
• ≤IDR 15,000 2140 (22.2%) 25928 (43.6%) 28068 (40.7%)
• >IDR 15,000 7481 (77.8%) 33494 (56.4%) 40975 (59.3%)
Note: Chi-Square test was used for dichotomous variables and a T-test for continuous variables.
Based on socioeconomic status, the border areas Based on the travel time it takes for the community
are dominated by those in quintile 1 (the poorest), to get to the hospital, table 1 shows that in the two
while those in non-border areas are dominated by those dominant regions the travel time is over 15 minutes.
in quintile 5 (the richest). Based on the ownership of But with a bigger proportion in the border area. This
insurance in the two regions, it is dominated by those condition is in line with the transportation costs required
who have insurance managed by the government (Askes, to get to the hospital. In the border area, people who
Jamkesmas, Jamkesda, Jamsostek), although with a need transportation costs more than IDR 15,000 have a
slightly higher proportion who do not have insurance at larger proportion.
all.
32 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2. The results of multinomial logistic regression (n=69,043)
Note: The reference category is “No Utilization”; 95% Confidence Interval for OR; *Significant at level 95%.
Table 2 presents the results of the multinomial To overcome disparities in hospital utilization in
logistic regression test to describe the differences in border areas, the Government of Indonesia has issued
hospital utilization in border areas - non-border areas in a special policy on disadvantaged areas, borders, and
Kalimantan. As a reference, the category “no utilization” islands. This policy was released to reduce inequality in
was selected. Table 2 shows that in inpatient utilization health services in these special areas, including border
in the hospital, those living in border areas had 0.653 areas5,6.
times the probability of utilization compared to those
living in non-border areas (OR 0.653; 95% CI 0.516- Table 2 also shows the differences in hospital
0.826). This means that those who live in border areas utilization based on the type of place of residence. Those
have a lower chance than those who live in non-border who live in urban areas are 1.250 times more likely to
areas to use inpatient care at the hospital. Meanwhile, benefit from outpatient hospital care than those who live
both outpatient and outpatient and inpatient utilization in rural areas (OR 1.250; 95% CI 1.007-1.553). Based
did not show a statistically significant difference between on their marital status, those who are single and married
the two regions. have a lower chance of utilization than those who are
divorced. This condition applies to both outpatient and
inpatient utilization.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 33
Disparities of hospital utilization related to rurality residence, marital status, education level, work type,
do not only happen in Indonesia. The research results socioeconomic status, health insurance, travel time, and
with the focus of disparities in many countries reporting transportation cost.
the disparities existing, among others in China, Canada,
and Ethiopia.7–9 Acknowledgments: The author would like to thank
the NIHRD for allowing the use of the 2013 Indonesian
Based on the education level, Table 2 shows that Basic Health Survey.
the categories of utilization, as well as outpatient and
inpatient in the junior high school and senior high school, Source of Funding: Self-funding
are likely to be lower than those with a college education. Conflict of Interest: The authors declare no conflict
Meanwhile, in the category of work type, those who do of interest, financial or otherwise.
not work have the possibility of using outpatient at the
hospital 2.109 times those who work in other categories Ethical Clearance: The 2013 Indonesian Basic
(OR 2.109; 95% CI 1.245-3.573). Higher education Health Surveyhad ethical clearance that was approved
levels are often found to be positive predictors of health by the national ethical committee in the NIHRD (ethic
performance10,11. Otherwise, a low education level is a number: 01.1206.207). Informed consent was used
barrier to performance in the health sector12,13. during data collection, which considered aspects of data
collection procedure, voluntary, and confidentiality.
Meanwhile, in outpatient utilization, the better
the socioeconomic level, the better the possibility of References
outpatient utilization. This condition also applies to
the use of inpatient. The same condition can be seen 1. Tzeng H-M, Okpalauwaekwe U, Yin C-Y, Jansen
in the category of insurance ownership. Those with SL, Feng C, Barker A. Do patients’ demographic
government-managed insurance had a better chance characteristics affect their perceptions of self-care
of using hospitals than those without, and those with actions to find safe and decent care? Appl Nurs
privately-managed insurance had better utilization rates Res. 2018;43:24–9.
than those with government-managed insurance. Similar 2. Mubasyiroh R, Nurhotimah E, Laksono AD. Health
information is also found in previous studies14,15 Service Accessibility Index in Indonesia (Indeks
Aksesibilitas Pelayanan Kesehatan di Indonesia).
Table 2 shows that those with a travel time of In: Supriyanto S, Chalidyanto D, Wulandari
less than or equal to 30 minutes had a chance of using RD, editors. Accessibility of Health Services in
outpatient hospitals 1.514 times than those with a travel Indonesia (Aksesibilitas Pelayanan Kesehatan
time of more than 30 minutes (OR 1.514; 95% CI 1.193- di Indonesia). Jogjakarta: PT Kanisius; 2016. p.
1.923). Meanwhile, those with transportation costs of 21‑58.
less than IDR 15,000 were more likely to use inpatient
3. Li J, Shi L, Liang H, Ding G, Xu L. Urban-rural
care 1.243 times than those who had transportation costs
disparities in health care utilization among Chinese
of more than IDR 15,000 (OR 1.243; 95% CI 1.037-
adults from 1993 to 2011. BMC Health Serv Res.
1.492). On a broader national scale, travel time and
2018;18(102):1–9.
transportation costs are also found to be determinants of
hospital utilization16–18. 4. Song Y, Tan Y, Song Y, Wu P, Cheng JCP, Kim
MJ, et al. Spatial and temporal variations of spatial
Conclusions population accessibility to public hospitals: a
case study of rural–urban comparison. GIScience
Based on the research results, it can be concluded that Remote Sens. 2018;55(5):718–44.
there is a disparity of hospital utilization in the border -
5. Senewe FP, Elsi E. Descriptive Analysis to
non-border areas in Kalimantan Island, Indonesia. Those
Environment Health in Less Development,
living in border areas have a lower likelihood of inpatient
Borderlands, Archipelagoes and Remote Areas
utilization than those living in non-border areas.
(DTPK-T). Media Litbangkes. 2014;24(3):153–60.
The results also found 8 other predictors that affect 6. Suharmiati, Laksono AD, Astuti WD. Policy
hospital utilization among adults in Kalimantan Island, Review on Health Services in Primary Health
Indonesia. The eight predictors are the type of place of Center in the Border and Remote Area (Review
34 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Kebijakan tentang Pelayanan Kesehatan Puskesmas 13. Laksono AD, Wulandari RD. The Barrier to
di Daerah Terpencil Perbatasan). Bull Heal Syst Maternity Care in Rural Indonesia. J Public Heal
Res. 2013;16(2):109–16. From Theory to Pract. 2020;Online First.
7. Li C, Yao NA, Yin A. Disparities in dental 14. Wulandari RD, Qomarrudin MB, Supriyanto
healthcare utilization in China. Community Dent S, Laksono AD. Socioeconomic Disparities in
Oral Epidemiol. 2018; Hospital Utilization among Elderly People in
8. Loree JM, Javaheri KR, Lefresne SV, Speers CH, Indonesia. Indian J Public Heal Res Dev. 2019;
Ruan JY, Chang JT, et al. Impact of Travel Distance 10(11):1800‑4.
and Urban-Rural Status on the Multidisciplinary 15. Nasution SK, Mahendradhata Y, Trisnantoro
Management of Rectal Cancer. J Rural Heal. L. Can a National Health Insurance Policy
2017;33(4). Increase Equity in the Utilization of Skilled Birth
9. Bobo FT, Yesuf EA, Woldie M. Inequities in Attendants in Indonesia? A Secondary Analysis
utilization of reproductive and maternal health of the 2012 to 2016 National Socio-Economic
services in Ethiopia. Int J Equity Health. 2017;16(9). Survey of Indonesia. Asia-Pacific J Public Heal.
2020;32(1):19–26.
10. Wulandari RD, Laksono AD. Education as
predictor of the knowledge of pregnancy danger 16. Laksono AD, Wulandari RD, Soedirham O. Urban
signs in Rural Indonesia. Int J Innov Creat Chang. and Rural Disparities in Hospital Utilization among
2020;13(1):1037–51. Indonesian Adults. Iran J Public Health [Internet].
2019;48(2):247–55. Available from: http://ijph.
11. Ipa M, Widawati M, Laksono AD, Kusrini I,
tums.ac.ir/index.php/ijph/article/view/16143
Dhewantara PW. Variation of preventive practices
and its association with malaria infection in eastern 17. Laksono AD, Wulandari RD, Soedirham O.
Indonesia: Findings from community-based survey. Regional Disparities of Health Center Utilization
PLoS One. 2020;15(5):e0232909. in Rural Indonesia. Malaysian J Public Heal Med.
2019;19(1).
12. Rohmah N, Yusuf A, Hargono R, Laksono AD,
Masruroh, Ibrahim I, et al. Determinants of teenage 18. Laksono AD, Wulandari RD, Efendi F.
pregnancy in Indonesia. Indian J Forensic Med Determinants of hospital utilisation among urban
Toxicol. 2020;14(3):2080–5. poor societies in Indonesia. Int J Innov Creat
Chang. 2020; 12(9):375–87.
DOI Number: 10.37506/mlu.v21i1.2275 Medico-legal Update, January-March 2021, Vol. 21, No. 1 35
Abstract
Background: Malaria is still one of the public health problems that can cause death primarily in high-risk
groups. High incidence of malaria caused by unhealthy environment and patterns of Society behavior.
Objectives: Assessing the relationship between environmental factors and the society behavior factors with
malaria incidence.
Method: This is a case-control study. Samples were taken using sampling purposive with criteria: Age 7-50
years and case groups were noted as clinical malaria patients. Data is collected by observing and filling out
questionnaires. Risk factors are analyzed using the Chi-Square test, knowing the risks with the odds ratio.
The dominant risk factors were analyzed using binary logistic regression.
Results: The variable associated with the malaria incident is ventilation (0,000), 2.5 (1.6-4.1), ceiling
(0,015), 1.7 (1.1-2.7), puddles around the house (0,005), 1.9 (1.2-3.0), using of mosquito nets (0,000), 4.1
(2.4-6.4) and using mosquito repellent (0.001), 2,2 (1,4-3,5).
Conclusion: The proven environmental factors associated with malaria incidents are ventilation, ceilings,
and puddles around the house. The Society behavior factor associated with malaria incidents is using
mosquito nets and using mosquito repellent. Proves that the use of mosquito nets is a major risk factor for
malaria incidents, with a risk of 4.3 times greater in those who when sleeping at night do not use mosquito
nets.
Malaria Incidence
OR(95% CI)
Environmental Factor Case Control P-value
n=150 % n=150 % Lower Upper
Ventilation
2,588
Not Qualify 92 61,3 57 38,0 0,000*
1,625-4,122
Qualify 58 38,7 93 62,0
Wall
1,456
Not Qualify 78 52,0 64 42,7 0,105
0,923-2,295
Qualify 72 48,0 86 57,3
Ceiling
1,763
Not Qualify 80 53,3 59 39,7 0,015*
1,114-2,788
Qualify 70 46,7 91 60.7
There are puddles around the house
1,758
Yes 88 58,7 67 44,7 0,015*
1,113-2,778
Not 62 41,3 83 55,3
There are trenches around the house
1,930
Yes 97 64,7 73 48,7 0,005*
1,215-3,068
Not 53 35,4 77 41,3
There are bushes around the house
1,218
Yes 61 40,7 54 36,0 0,406
0,64-1,942
Not 89 59,3 96 64,0
The study showed that environmental factors that around the house (P = 0,005), OR = 1.9 (1, 2-3.0). While
were significantly related to the malaria incident were the wall, life around the house, bushes around the house
kolowa ventilation (p = 0,000), OR = 2, 5 (1, 6-4.1), are not proven to be a risk factor for malaria incidents.
ceiling (p = 0,015), OR = 1.7 (1, 7-2.7), and puddles
Malaria Incidence
OR(95% CI)
Society Behavior Factors Case Control P-value
n=150 % n=150 % Lower Upper
Knowledge
1,240
High 86 57,3 78 52,0 0,354
0,787-1,956
Low 64 42,7 72 48,0
Attitude
1,028
Positive 63 42,0 62 41,3 0,907
0,649-1,627
Negative 78 58,0 88 58,7
Using mosquito nets
4,011
Yes 103 68,7 53 35,3 0,000*
2,480-6,487
Not 47 31,3 97 64,7
38 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Malaria Incidence
OR(95% CI)
Society Behavior Factors Case Control P-value
n=150 % n=150 % Lower Upper
Using mosquito repellent
2,250
Yes 91 60,7 61 40,7 0,001*
1,418-3,572
Not 59 39,4 89 59,3
Using long sleeves when out of the house at night
1,424
Yes 91 60,7 78 52,0 0,130
0,900-2,251
Not 59 39,3 72 48,0
The habit of hanging dirty clothes
1,276
Yes 88 58,7 79 52,7 0,296
0,808-2,014
Not 62 41,3 71 47,3
The study showed that the society’s behavior factors = 2.2 (1.4-3.5). While knowledge, attitude, using long
that were significantly related to the malaria incident sleeves when out of the house at night, and habit of
were using mosquito nets (P = 0,000), OR = 4.1 (2, hanging dirty clothes are not proven to be a risk factor
4-6.4), and using mosquito repellent (p = 0.001), OR for malaria incidents.
Table 4. Multiple Logistic Regression Test Results For The Final Risk Factor Related of Malaria Incidence
* Significant< 0,05
Multivariate analyses were conducted to view gauze on home ventilation. But in some houses that have
several risk factors that were jointly associated with been installed wire gauze, researchers found damaged
malaria incidents. The dominant risk factors for malaria wire gauze such as perforated and torn Karna has long
incidents are using mosquito nets. been not replaced. But there is still also a house that does
not use a gauze wire in ventilation, although it uses only
Discussion partially ventilation as it is installed only in the room
Environmental Factors: The study was conducted only. A study in Banjarnegara, Indonesia suggests that
to assess the physical environmental factors of the people who do not put mosquito nets in their home vents
home consisting of ventilation, Wall, and Ceiling. In have significantly higher chances of having malaria.
the population, studies proved that ventilation is a risk Wire netting is a barrier against mosquitoes entering the
factor for malaria events. Their risk of suffering from house.5
malaria if not attaching a gauze wire to the ventilation This study proves that the ceiling is a risk factor for
is doubling. The results of the survey have mostly used malaria events. With a risk of 1.7 times greater in those
Medico-legal Update, January-March 2021, Vol. 21, No. 1 39
who live at home do not have a ceiling. Another study study reported that knowledge and attitudes were not
in Indonesia proved the same, in-house environmental proven significantly with the incidence of malaria. The
factors that do not have a significant risk of malaria study was conducted in urban areas, with most of the
incidence is the condition of the wall.6,7 respondents well-educated, so that society has a good
knowledge of malaria. Knowledge of taking medication,
Environmental factors outside the home are proving malaria test, and vector control by spraying at home. It is
to be a risk factor for malaria events are puddles around important to keep a clean trench around the house so that
the house and life around the house. Studies in Uganda people are protected from illness.12 The study in South
suggest that malaria-repellent mosquitoes breed in Africa stated differently, that knowledge and attitudes
puddles and are often found near homes especially in were significantly related to the incidence of infectious
rural communities in endemic countries. This is an diseases, one of which was malaria.13
indication that conditions that support the breeding of
mosquitoes are allowed in the community.8Another This study proved that the use of mosquito nets was
study in Africa showed that the productivity of the significantly related to malaria events. Some previous
highest Anopheles larva was observed in paddy fields, studies have expressed the use of mosquito nets
agricultural moats, and irrigation wells.9 associated with malaria events.14,15 A double logistic
regression test proves that the use of mosquito nets is a
The results of observation, some puddle of water major risk factor of malaria. Chances of suffering from
such as the former Fish pond and the former pit around malaria in those who sleep at night do not use a mosquito
the respondent’s house there is a mosquito larva, but net of 4.3 times larger. A previous study in Central Java
this study is not done further to identify whether the province, Indonesia expressed sleep under mosquito
larva found is a mosquito repellent Anopheles or not. nets is a technique to protect from mosquito bites. In
Observation results are also obtained in almost every this study, people who slept under the mosquito net had
house adjacent to the ditch/ditch. When the trenches a lower chance (4.6 times) suffering from malaria than
observation does not flow well so there are a lot of those who did not.16. Another study conducted in China-
inundated trenches that could potentially be a place for Vietnam suggested that the effect of the control-based
mosquitoes to be missed. prevention measures vector. Those who do not sleep
This study cannot prove that a tightly-wall can under the mosquito nets have more than 5 times higher
prevent the occurrence of malaria. The results of chances of experiencing unsymptomatic infections
the survey, in general, the wall condition of many compared to those sleeping under the mosquito nets.17
respondents house made of concrete or cement. In some The study also proved that Using mosquito repellent
homes based on boards, some respondents closed the is a risk factor for malaria. The respondent did not use
holes with tape or paper pasted between the boards so mosquito repellent because it does not like the smell of
that mosquitoes did not go through the holes. The study mosquito repellent. Studies in India have said that the use
also could not prove the bush around the house was a of mosquito repellent is effective in preventing mosquito
risk factor for malaria events. bites. This study can not prove Using long sleeves when
The Gordon model known by a Trias epidemiology out of the house at night and the Habit of hanging dirty
of infectious diseases is influenced by three main clothes is significantly related to malaria.
factors namely the host, agent, and environment.10 The
intended environment includes sanitation, the physical Conclusion
environment of the home, and the environment around The proven environmental factors related to malaria
the house. Poor sanitation is not only directly related incidents are ventilation, ceiling, and puddles around
to infectious diseases but can also affect the health of the house. The Society’s proven behavior factors
children.11 The physical environment of the home such related to malaria incidents are using mosquito nets and
as ventilation and ceilings, as well as the environment using mosquito repellent. This study proves that using
that exists outside the home is closely related to the mosquito nets is a major risk factor for malaria incidents,
incidence of infectious diseases such as malaria. with a risk magnitude of 4.3 times greater in those who
do not use mosquito nets during nighttime sleep.
Society Behavior Factors: The study also assessed
the relationship of community behavior factors. The
40 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Conflict of Interest: All authors do not have a malaria-di-puskesmas-cluwak-dan-puskesmas-
conflict of interest to declare related to research and dukuhseti-kabup
work. 8. Musoke D, Miiro G, Ndejjo R, Karani G, Morris
K, Kasasa S, et al. Malaria prevention practices
Source of Funding: The source of this research
and associated environmental risk factors in a rural
costs from self.
community in Wakiso district, Uganda. PLoS One
Ethical Clearance: The study was approved by [Internet]. 2018;13(10):e0205210. Available from:
the institutional Ethical Board of Bhakti Kencana https://pubmed.ncbi.nlm.nih.gov/30300396/
University. 9. Matthys B, N’Goran EK, Koné M, Koudou BG,
Vounatsou P, Cissé G, et al. Urban agricultural land
References use and characterization of mosquito larval habitats
1. Herdiana H, Cotter C, Coutrier FN, Zarlinda I, in a medium-sized town of Côte d’Ivoire. J Vector
Zelman BW, Tirta YK, et al. Malaria risk factor Ecol [Internet]. 2006 Dec;31(2):319–33. Available
assessment using active and passive surveillance from: https://pubmed.ncbi.nlm.nih.gov/17249350/
data from Aceh Besar, Indonesia, a low endemic, 10. Sumampouw OJ. Eradication of Infectious
malaria elimination setting with Plasmodium Diseases [Internet]. Deepublish; 2017. Available
knowlesi, Plasmodium vivax, and Plasmodium from: https://books.google.co.id/books?hl=id
falciparum. Malar J [Internet]. 2016;15(1):468. & lr= & id=UkZHDwAAQBAJ & oi=fnd &
Available from: https://link.springer.com/ pg=PR6 & dq=faktor+risiko+penyakit+menular
article/10.1186/s12936-016-1523-z & ots=Oqw1Yp9QES & sig=OtaC4kXKDfxc5-
2. Organization WH. World malaria report 2015. rBWMGUY3OCehg & redir_esc=y#v=onepage &
World Health Organization; 2016. q=faktor risiko penyakit menular & f=false
3. Rulisa S, Kateera F, Bizimana JP, Agaba S, 11. Sutriyawan A, Nadhira CC. Kejadian Stunting Pada
Dukuzumuremyi J, Baas L, et al. Malaria prevalence, Balita Di Upt Puskesmas Citarip Kota Bandung.
spatial clustering and risk factors in a low endemic J Kesmas (Kesehatan Masyarakat) Khatulistiwa
area of Eastern Rwanda: a cross sectional [Internet]. 2020;7(2):79–88. Available from: http://
study. PLoS One [Internet]. 2013;8(7):e69443. openjurnal.unmuhpnk.ac.id/index.php/JKMK/
Available from: https://journals.plos.org/plosone/ article/view/2072
article?id=10.1371/journal.pone.0069443 12. Molineros-Gallón LF, Hernández-Carrillo
4. Arsin AA. Malaria in Indonesia reviews M, Castro-Espinosa J, Trujillo de Cisneros E.
epidemiological aspects. Makassar, masagenapress. [Knowledge, attitudes, perceptions and community
2012; practices for urban malaria. Tumaco, Colombia].
Rev Salud Publica (Bogota) [Internet]. 2018
5. Sulistyawati, Rokhmayanti, Fajar. Malaria
;20(1):82–8. Available from: https://pubmed.ncbi.
Risk Factors in Banjarnegara, Indonesia: A
nlm.nih.gov/30183889/
Matched Case-Control Study. J UOEH [Internet].
2020;42(2):161–6. Available from: https://pubmed. 13. Govere J, Durrheim D, la Grange K, Mabuza
ncbi.nlm.nih.gov/32507839/ A, Booman M. Community knowledge and
perceptions about malaria and practices influencing
6. Irawati I, Ishak H, Arsin A. Environmental
malaria control in Mpumalanga Province, South
Characteristics of Malaria Patients in Bulukumba
Africa. S Afr Med J [Internet]. 2000 Jun;90(6):611–
Regency. Afiasi J Kesehat Masy [Internet].
6. Available from: https://pubmed.ncbi.nlm.nih.
2019;2(3):73–7. Available from: http://afiasi.
gov/10918892/
unwir.ac.id/index.php/afiasi/article/view/47
14. Durnez L, Pareyn M, Mean V, Kim S, Khim N,
7. Wiwoho FH, Hadisaputro S, Suwondo A.
Menard D, et al. Identification and characterization
Risk Factors for Malaria Incidence in Cluwak
of areas of high and low risk for asymptomatic
Health Center and Dukuhseti Health Center
malaria infections at sub-village level in Ratanakiri,
Pati. J Epidemiol Kesehat Komunitas [Internet].
Cambodia. Malar J [Internet]. 2018;17(1):27.
2018;1(1):1–8. Available from: https://www.neliti.
Available from: https://pubmed.ncbi.nlm.nih.
com/publications/301965/faktor-risiko-kejadian-
gov/29334956/
Medico-legal Update, January-March 2021, Vol. 21, No. 1 41
15. Belete EM, Roro AB. Malaria prevalence Prev Med Public Heal [Internet]. 2018;51(3):148.
and its associated risk factors among patients Available from: https://pubmed.ncbi.nlm.nih.
attending Chichu and Wonago Health Centres, gov/29886710/
South Ethiopia. J Res Health Sci [Internet]. 17. Zhao Y, Zeng J, Zhao Y, Liu Q, He Y, Zhang J, et
2016;16(4):185. Available from: https://pubmed. al. Risk factors for asymptomatic malaria infections
ncbi.nlm.nih.gov/28087849/ from seasonal cross-sectional surveys along
16. Cahyaningrum P, Sulistyawati S. Malaria risk the China–Myanmar border. Malar J [Internet].
factors in Kaligesing, Purworejo district, central 2018;17(1):247. Available from: https://pubmed.
Java province, Indonesia: a case-control study. J ncbi.nlm.nih.gov/29973194/
42 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2276
Agung Sutriyawan1, Hairil Akbar2, Fibrianti3, Intan Pertiwi4, Ucu W. Somantri5, Lezi Y. Sari6
1
Research Scholar, Bachelor Programme Public Health, Bhakti Kencana University, 2Research Scholar, Graha
Medika Institute of Health Science, 3Research Scholar, Hamzar Institute of Health Science, 4Research Scholar,
Infectious Disease Hospital Prof. Dr. Sulianti Saroso, 5Research Scholar, Mathla ul Anwar University, 6Research
Scholar, Dehasen University of Bengkulu
Abstract
Background: The Government provides directives related to the prevention of cases spread, but the number
of cases still shows improvement. Community knowledge and attitudes influence the level of compliance
with the Government’s recommended COVID-19 deployment precautions.
Objectives: Assess knowledge, attitudes, and anxiety during the COVID-19 period.
Method: This is a quantitative descriptive study, sampling techniques using Snowball. Questionnaires have
four parts, social-demographic, knowledge, attitude, and anxiety during the pandemic. Online questionnaires
were developed using Google forms. Questionnaire link sent via email, Whats App, Facebook. Variables are
summarized into frequencies and percentages using SPSS version 25.
Results: Total (61.3%) The respondent knows how to spread COVID-19, (97.4%) and (95.3%) Know
COVID-19 is more dangerous for elderly and people have chronic diseases, (95.1%) Know the handwashing
is a preventive effort, almost all of the participants agreed on hand washing, hand sanitizer, using a mask,
(92%) Participants agreed to the screening COVID-19, (93%) Participants are willing to follow the
Government’s recommendation, (60%) Participants felt paranoid, (83%) Participants are always worried for
themselves and those closest to you.
Conclusion: This study resulted in respondents having demonstrated good knowledge, positive attitudes,
and feeling anxious during the COVID-19 pandemic
Preventive measures to limit the spread of COVID-19 in the hospital if they made contact with the COVID-19
and their responses are presented in table 3. The or infected people. Approximately 92% of participants
majority of participants agreed when meeting friends or agreed to the screening for COVID-19. The results of the
colleagues did not shake hands or embraced. Almost all study were obtained about 93% of the participants were
of the participants said they agreed to wash their hands willing to follow the Government’s recommendation
using soap or hand sanitizer regularly and use masks to regarding the prevention of COVID-19 transmission and
protect themselves from the transmission of COVID-19. willing to purchase COVID-19 preventive equipment
Most study participants agreed in isolation at home or such as masks and hand sanitizers.
46 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 4: Anxiety about COVID-19 among Participants Research (n = 1051)
Anxiety among study participants on COVID-19 community has a good knowledge of the spread of
was presented in table 4. More than 85% of the COVID-19, which is evident from some of the questions
participants were busy with a COVID-19 pandemic, we ask. Respondents to this study who have higher
around 60% of the paranoid participants with a mind knowledge are also due to most of the respondents over
contracted COVID-19 during a pandemic. About 85% of the age of 20. The results of the study were conducted
participants avoided party, social contact, and avoided in three countries (Jordan, Saudi Arabia, and Kuwait),
meetings such as worship, meetings, and others for that the higher COVID-19 knowledge scores proved to
fear of being displaced by COVID-19. About 83% of be significantly related to the age and achievement of
participants reported worrying for themselves and their education.6 Knowledge is considered important in the
closest people during the ongoing pandemic. About prevention efforts of COVID-19 if society has good
92% of participants always use masks even without any knowledge, hopefully, the community is more obedient
obvious symptoms of infection. in the prevention efforts of COVID-19 recommended
by the Indonesian Government. The study in China
Discussion obtained 89% demonstrated sufficient knowledge about
Indonesia is still not able to suppress the COVID-19. Knowledge is a prerequisite for building
transmission of COVID-19 effectively. The population preventative beliefs, shaping positive attitudes, and
of Indonesia participates in this study, most of the promoting positive behaviors, and individual cognition
Medico-legal Update, January-March 2021, Vol. 21, No. 1 47
and attitudes towards the disease affect the effectiveness Conclusion
of certain strategies and behaviors.7
Our study showed that respondents had a good
Participants of this study were optimistic about the knowledge of the way the transmission and prevention of
prevention of COVID-19, most of the participants took COVID-19 had a positive attitude during the pandemic
the precaution of spreading the infection by COVID-19, and some respondents felt anxiety during the COVID-19
such as: not shaking hands and hug when meeting pandemic. There need to be mental health consulting
friends or colleagues, always use masks when exiting facilities for the community throughout Indonesia to
the house and wash hands using soap or hand sanitizer reduce the level of public anxiety.
regularly. Previous research showed that most of the
Conflict of Interest: Nil.
population took the COVID-19 precautions, i.e. not
traveling in crowded places,8 and using masks.9 Study Source of Funding: Nil.
in Vietnam stated that the prevention of the transmission
of COVID-19 was by hand washing and using face Ethical Clearance: The study was approved by
masks.10 the institutional Ethical Board of Immanuel School of
Health Sciences Bandung.
Most of the study participants agreed to be isolated
at home if they made a contact or interaction with References
the COVID-19 infected person. Disconnecting the
1. Setiati S, Azwar MK. COVID-19 and Indonesia.
suggested transmission chain is to implement social
Acta Med Indones [Internet]. 2020;52(1):84–9.
distance as well as isolation and quarantine to the general
Available from: https://pubmed.ncbi.nlm.nih.
public who have symptoms of COVID-19. The patient’s
gov/32291377/
isolation is very effective in stopping the transmission if
early detection is possible before a clear virus release.11 2. Kim S-W, Su K-P. Using psychoneuroimmunity
against COVID-19. Brain Behav Immun [Internet].
Findings from this study, often the respondents 2020; Available from: https://www.sciencedirect.
wash their hands using soap, sanitizer, and mask. com/science/article/pii/S0889159120303913
This shows the respondent’s concern for the action to 3. Ho CSH, Chee CY, Ho RC. Mental health strategies
maintain personal hygiene to avoid the COVID-19 to combat the psychological impact of COVID-19
infection. Respondents ‘ awareness of the COVID-19 beyond paranoia and panic. Ann Acad Med
was seen in their behavior, as the frequent avoidance Singapore [Internet]. 2020;49(1):1–3. Available
of going to the party, avoiding meetings, and also avoid from: https://pubmed.ncbi.nlm.nih.gov/32200399/
going to the place of worship. Anxiety was also reflected
4. Roy D, Tripathy S, Kar SK, Sharma N, Verma SK,
by their fears that there was a COVID-19 transmission,
Kaushal V. Study of knowledge, attitude, anxiety
even a quarter of respondents were struggling to sleep
& perceived mental healthcare need in Indian
because of a COVID-19 spread. The level of anxiety
population during COVID-19 pandemic. Asian J
in respondents can cause unnatural behavior such as
Psychiatr [Internet]. 2020;102083. Available from:
anxiety, worry, or anger.
https://www.sciencedirect.com/science/article/pii/
Excessive anxiety in society will have an impact S1876201820301945
on mental life. Therefore, it is important to address the 5. Brooks SK, Webster RK, Smith LE, Woodland L,
difficulties of mental health in a pandemic situation. Wessely S, Greenberg N, et al. The psychological
Study in India states that when anxiety occurs a broad impact of quarantine and how to reduce it: rapid
population, it can lead to panic for the community, review of the evidence. Lancet [Internet]. 2020;
which causes the resources to quickly run out. Research Available from: https://www.sciencedirect.com/
in Iraq states that social media has a significant impact science/article/pii/S0140673620304608
on the spread of fear and panic related to the COVID-19 6. Naser AY, Dahmash EZ, Alwafi H, Alsairafi ZK,
outbreak, with a potential negative influence on mental Al Rajeh AM, Alhartani YJ, et al. Knowledge and
health and psychological wellbeing of society.12 practices towards COVID-19 during its outbreak:
48 Medico-legal Update, January-March 2021, Vol. 21, No. 1
a multinational cross-sectional study. medRxiv in/article.asp?issn=0019-557X;year=2020;volume
[Internet]. 2020; Available from: https://www. =64;issue=6;spage=205;epage=210;aulast=Dkhar
medrxiv.org/content/10.1101/2020.04.13.2006356 10. Huynh G, Nguyen TNH, Vo KN, Pham LA.
0v1 Knowledge and attitude toward COVID-19 among
7. Zhou M, Tang F, Wang Y, Nie H, Zhang L, You healthcare workers at District 2 Hospital, Ho
G, et al. Knowledge, attitude and practice regarding Chi Minh City. Asian Pac J Trop Med [Internet].
COVID-19 among health care workers in Henan, 2020;13(6):260. Available from: http://www.
China. J Hosp Infect [Internet]. 2020; Available apjtm.org/article.asp?issn=1995-7645;year=2020;
from: https://www.sciencedirect.com/science/ volume=13;issue=6;spage=260;epage=265;aulast=
article/pii/S0195670120301870 Huynh
8. Zhong B-L, Luo W, Li H-M, Zhang Q-Q, Liu X-G, 11. Wilder-Smith A, Freedman DO. Isolation, quarantine,
Li W-T, et al. Knowledge, attitudes, and practices social distancing and community containment:
towards COVID-19 among Chinese residents pivotal role for old-style public health measures
during the rapid rise period of the COVID-19 in the novel coronavirus (2019-nCoV) outbreak.
outbreak: a quick online cross-sectional survey. Int J Travel Med [Internet]. 2020;27(2):taaa020.
J Biol Sci [Internet]. 2020;16(10):1745. Available Available from: https://academic.oup.com/jtm/
from: https://www.ncbi.nlm.nih.gov/pmc/articles/ article/27/2/taaa020/5735321
PMC7098034/ 12. Ahmad AR, Murad HR. The impact of social
9. Dkhar SA, Quansar R, Saleem SM, Khan SMS. media on panic during the COVID-19 pandemic
Knowledge, attitude, and practices related to in Iraqi Kurdistan: online questionnaire study. J
COVID-19 pandemic among social media users Med Internet Res [Internet]. 2020;22(5):e19556.
in J & K, India. Indian J Public Health [Internet]. Available from: https://www.jmir.org/2020/5/
2020;64(6):205. Available from: http://www.ijph. e19556/
DOI Number: 10.37506/mlu.v21i1.2277 Medico-legal Update, January-March 2021, Vol. 21, No. 1 49
Abstract
Background: Local anesthesia in ocular surgery is a technique that mostly used now. Many type of
procedures were applied including retrobulbar, peribulbar, subconjunctival and topical anesthesia.
Aim: To study the efficacy of tetracaine topical anesthesia technique combined with anxiolytic midazolam
in cataract surgery, and to test patient’s and surgeon’s conviction by this method.
Patients and Method: Prospective study of one hundred three patients with dense cataract in Al-Basira
eye center with mean age of 60.32 years (range: 50-70). Patients were 57 male and 46 female. Topical
anesthesia was encouraged by intravenous anxiolytic, midazolam 0.1 mg/kg weight given in the beginning
of surgery. We used a special patient’s pain scoring and intraoperative surgeon’s conviction score to analyze
the reliability of this method. The study period lasted from October 2019 to March 2020.
Result: All patients had peaceful success phacoemulsification with an average surgery time of 15-20
minutes. Minimal or no movement noticed during surgery. No need for more anesthesia as there were no
intolerable pain.
Conclusion: Cataract surgery can be safely and effectively done by topical anesthesia using this method.
Discussion and Conclusion highly variable and opioids may be added for better pain
relief and higher patient satisfaction. Any side-effects
This study offer the use of a safe anesthetic technique
delaying the discharge after sedation are undesirable11.
with least intervention. It provided acceptable analgesia
Alsoit is undesirable for patients with ocular surgery to
and surgery can be performed without akinesia or sort
get postoperative nausea and vomiting with strain oneye
of ocular movement.Topical anesthesia is justified as a 12.All these undesired effects did not occur with our
means of improving safety without causing discomfort to
patients using this way of anesthesia.
the patient even in complicated cases of cataract surgery4
and has negligible complication as compared with other We noticed previously on usingdiazepam for
ways of local anesthesia using in ophthalmic surgery example, the patients went into deep sleep and awaked
that increases intraocular pressures like retrobulbar and suddenly with abnormal reaction that affects the
peribulbar5. Potentially life-threatening complications cooperation of the patients. Although there were patient
exist with all techniques except topical/intracameral squeezing and eye movement, they were neither a
local anesthesia6. In addition, significant pain during trouble to the surgeon nor to the patient. No additional
anesthetic administration, intraoperative surgery, or supply of anaesthesia was required. We as surgeons were
after the cataract procedure, is the major reasons for low satisfied with this method, patients accepted this type of
patient satisfaction7. Many surgeons do not consider anaesthesia for the surgery of other eye in the future.
akinesia an important requirement for cataract surgery,
but some prefer to operate under conditions in which eye Ethical Clearance: Taken from Alzahraa Medical
movements are blunted if not complete paralyzed8.Many College committee
type of drugs have been tried as a supplement to local
Source of Funding: Self
anesthesia 9, but here we choose midazolam.
Conflict of Interest: Nil
Midazolam is benzodiazepine medication used for
anesthesia0.1mg per kg weight.Midazolam is commonly
References
utilized for conscious sedation/anxiolysis/amnesia9
that is mean it can prevent physical and psychological 1. Boulton JE, Lopatatzidis A, Luck J, Baer RM.
discomfort, and it provides good cooperation of the A randomized controlled trial of intracameral
patient, and it arrest patients recall of intraoperative lidocaine during phacoemulsification under topical
events The patient is awaked and cooperative and obey anesthesia. Ophthalmology. 2000 Jan 1; 107(1):68-
commands.Midazolam alone may produce optimal 71. https://www.aao.org/bcscsnippetdetail.
block conditions for the patient and it is satisfactory aspx?id=c6bba5fc-cfa7-4c0f-a879-b184f4cf7f4d
during the procedure10. The choice of sedatives is
52 Medico-legal Update, January-March 2021, Vol. 21, No. 1
2. Malik A. Efficacy and performance of various local Anesthesia & Analgesia. 2005 Jun 1; 100(6):1644-
anesthesia modalities for cataract surgery. J Clinic 50. https://europepmc.org/article/med/15920189
Experiment Ophthalmol S. 2013; 1:2. https://www. 8. Friedman DS, Bass EB, Lubomski LH, Fleisher
longdom.org/abstract/efficacy-and-performance- LA, Kempen JH, Magaziner J, Sprintz M, Robinson
of-various-local-anesthesia-modalities-for- K, Schein OD. Synthesis of the literature on the
cataract-surgery-48614.html effectiveness of regional anesthesia for cataract
3. Eke T, Thompson JR. The national survey of surgery. Ophthalmology. 2001 Mar 1; 108(3):519-
local anaesthesia for ocular surgery. I. Survey 29. https://pubmed.ncbi.nlm.nih.gov/11237906/
methodology and current practice. Eye. 1999 9. Pérez-Castanedo J, Planell J, Barrachina V, Colilles
Mar; 13(2):189-95. https://pubmed.ncbi.nlm.nih. C, Lazaro A, Moral V. Effectiveness of topical
gov/10450380/ anesthesia enhanced by sedation and analgesia for
4. Jacobi PC, Dietlein TS, Jacobi FK. A comparative cataract surgery. Revistaespanola de anestesiologia
study of topical vs retrobulbar anesthesia in y reanimacion. 1998 Oct; 45(8):312-6. https://
complicated cataract surgery. Archives of pubmed.ncbi.nlm.nih.gov/9847641/
Ophthalmology. 2000 Aug 1; 118(8):1037- 10. Cok OY, Ertan A, Bahadir M. Comparison of
43. https://jamanetwork.com/journals/ midazolam sedation with or without fentanyl in
jamaophthalmology/fullarticle/413464 cataract surgery. Acta AnæsthesiologicaBelgica.
5. Lanini PG, Simona FS. Change in intraocular 2008 Jan 1; 59(1):27.https://www.sarb.be/site/
pressure after peribulbar and retrobulbar injection: assets/files/1142/05-cok_et_al_1.pdf
practical sequelae. KlinischeMonatsblatter fur Au 11. Katz J, Feldman MA, Bass EB, Lubomski LH,
genheilkunde.1998May;212(5):28.https://pubmed. Tielsch JM, Petty BG, Fleisher LA, Schein OD.
ncbi.nlm.nih.gov/9677555/ Adverse intraoperative medical events and their
6. Eke T, Thompson JR. Serious complications of association with anesthesia management strategies
local anaesthesia for cataract surgery: a 1 year in cataract surgery. Ophthalmology. 2001 Oct
national survey in the United Kingdom. British 1; 108(10):1721-6. https://pubmed.ncbi.nlm.nih.
Journal of Ophthalmology. 2007 Apr 1; 91(4):470- gov/11581040/
5. https://www.ncbi.nlm.nih.gov/pmc/articles/ 12. Nimmo WS. A Practice of Anaesthesia (5th Edn).
PMC1994745/ Edited by Churchill-Davidson HC Published
7. Fung D, Cohen MM, Stewart S, Davies A. What (1984) by Lloyd-Luke (Medical Books) Ltd. Pp
determines patient satisfaction with cataract care 1200; indexed; illustrated. Price£ 50.00. British
under topical local anesthesia and monitored Journal of Anaesthesia. 1985 Sep 1; 57(9):941.
sedation in a community hospital setting?
DOI Number: 10.37506/mlu.v21i1.2279 Medico-legal Update, January-March 2021, Vol. 21, No. 1 53
Abstract
Exclusive breastfeeding is very important for babies to maintain their immune system, brain intelligence,
emotion stability and to protect babies from various diseases that are causes of death. Breastfeeding will
also benefit the mother, which will reduce blood loss during menstruation, restore maternal weight as before
pregnancy, reduce the risk of breast cancer, and uterine cancer. The purpose of this study was to determine the
influences of antenatal care, postnatal care and early initiation of breastfeeding on an exclusive breastfeeding
pattern. The samples used in this study were mothers who had babies aged 7-12 months in June to August
2018 as many as 48 respondents in the working area of Manukan Kulon Health Center in Surabaya. This
study used the descriptive and bivariate analyses. The obtained results were antenatal care (p = 0.001),
postnatal care (p = 0.002) and early initiation of breastfeeding (p = 0,000). During pregnancy the majority of
mothers make complete antenatal care visits with a frequency of 10 times, antenatal care is very important
for mothers, especially the pattern of breastfeeding. In addition to the importance of antenatal care visits,
mothers who have given birth and are entering the postnatal care phase are required to make postnatal care
visits. Socialization from health workers and the support of closest people are required in order to achieve
the exclusive breastfeeding.
Keywords: Exclusive Breastfeeding, Early Initiation of Breastfeeding, Antenatal Care, Postnatal Care.
Breastfeeding Pattern
Total
ANC Visit Exclusive Non-Exclusive
n % n % N %
Complete 4 9,1 40 90,9 44 100,0
Incomplete 0 0,0 4 100,0 4 100,0
Total 4 8,3 44 91,7 48 100,0
Distribution results on the pattern of breastfeeding percentage of 90.9% while respondents who did not
based on Antenatal Care visit in the table 1 shows routinely make ANC visits gave breastfeeding with a
that most respondents with complete ANC visits gave non-exclusively pattern by 100%.
breastfeeding with a non-exclusive pattern with a
Table 2 Distribution of Breastfeeding Pattern Based on Post Natal Care (PNC) Visit
Breastfeeding Pattern
Total
PNC Visit Exclusive Non-Exclusive
n % n % n %
1 time 0 0,0 4 100,0 4 100,0
2 time 4 3,18 25 86,2 29 100,0
3 time 0 0,0 15 100,0 15 100,0
Total 4 8,3 44 91,7 48 100,0
Based on the results in table 2, the majority total of 86.2%. Meanwhile, the respondents who visited
of respondents visited Postnatal Care twice with a PNC once and three times and determined the pattern of
frequency of 29 respondents. The respondents who non-exclusive breastfeeding to their babies had a greater
visited PNC twice and determined the pattern of non- percentage by 100% respectively.
exclusive breastfeeding had a lower percentage with a
Table 3 Distribution of Breastfeeding Pattern Based on the Early Initiation of Breastfeeding (EIB)
Breastfeeding Pattern
Total
EIB Exclusive Non-Exclusive
n % n % n %
Yes 4 9,1 40 90,9 44 100,0
No 0 0,0 4 100,0 4 100,0
Total 4 8,3 44 91,7 48 100,0
The pattern of breastfeeding based on Early Initiation 90.9%. Meanwhile, the respondents who did not give an
of Breastfeeding in table 3 shows that there were more EIB tended to give a non-exclusive breastfeeding to their
respondents who did the EIB than those who did not. babies with a percentage of 100%. The analysis of the
Respondents who did EIB mostly gave non-exclusive independent and dependent variables by using logistic
breastfeeding to their babies with the percentage of regression analysis (a = 0,05) are as follows.
56 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 4 Bivariate Analysis of Antenatal Care, stated that ANC visits affect the increase in the scope of
Postnatal Care and Early Initiation of Breastfeeding exclusive breastfeeding (9).
Al Halim
Abstract
This study aims to analyze the rationality and application of strict liability for environmental offenses in the
Environmental Protection and Management Act of Indonesia. The strict liability set out in this law expressly
applies only to civil cases and covers the possibility that it may be used in criminal matters. Normative
legal research complemented by a statutory and conceptual approach was used. The results showed that it
generally applies to regulatory offenses aimed at protecting the public interest. This doctrine is necessary
to improve the long-term and prevents harm to people or the environment. The absence of mental element
proof should be limited to offenses that are characterized by the administrative dependence of criminal
law, which is reflected in the abstract and concrete endangerment models. Generally, prohibited behavior
related to waste/emissions disposed into the environment without approval causes damage. The offense is
formulated as formal offense by eliminating the element of the perpetrator’s culpability, and it is therefore
not necessary to prove it.
Keywords: Strict liability, Regulatory offenses, Administrative dependent of criminal law, Environmental
harm.
Abstract
444 cases were recorded of cutaneous leishmaniasis in Baghdad General Hospitals and some private clinics
in Baghdad city and reviewed during the period from 1/10/2019 until 5/2020. The lesions were clinically
diagnosed by dermatologists. Where the highest incidence was among males compared to females, it was
found that the age group of (1-10) and (10-20) is the highest injury and that the rest of the age groups showed
a decline. It was clear that the lowest percentage was among (50-60 yrs) patients, and the highest injury
among the youth category. The rate of infection was higher in rural and agricultural areas compared to the
city center. The infection rates in relation to different body sites are the highest in the upper extremities
compared to the lower extremities. And according to the ulcer number, the multiple types were more than
the single ulcers, and regarding the time of infection the highest rates of infection appear in December and
February compared to the rest of the year.
4. The results of the statistical analysis using the highest rate of infection among females, as it reached
Chi-square showed significant differences. Infection (24%) in comparison with males (21%). It also differed
with cutaneous leishmaniasis and its distribution with what Alawieh et al (16) in his studies in Syria, where
to different areas of the body under the probability he recorded the highest percentage of females (52%)
level of 0.05. compared to females (48.9%).
Table (4): Shows the percentage of parasitic Distribution of cutaneous leishmaniasis by age:
infection according to the site of infection from the The current study showed that the highest incidence
body. of cutaneous leishmaniasis is between (10-20) years,
with a rate of (36%), and the lowest in the age group
Infection site Number Percentage
(5-60) years with a rate of (2%). Significantly due to the
Face 210 25.00 external activities of young people more than other age
Neck 81 10.00 groups where young people are often ill (17). The low
Chest 26 3.00 incidence of cutaneous leishmaniasis for older adults
Back 22 2.00 may be related to the fact that they were infected during
the early ages and acquired long-term immunity during
Hand 299 36.00
Childhood(9,10,18). The current study agrees with(12),
Foot 198 24.00 which recorded the highest incidence of cutaneous
Total 836 100.0 leishmaniasis in the age groups between 5-24 years
X2 550.7 more than others (67.5%). The current study differs with
P value P <0.0001(HS) Al-Mafraji et al.,(19) in Baghdad governorate, where the
highest rates of infection were recorded for ages under 30
HS: Highly significant difference (P < 0.01) years of age from the youth category (42.6%). The study
differed with Al-Mayali & Al-Hassani,(3) in Diwaniyah
Discussion
governorate, where the highest incidence of cutaneous
Distribution of cutaneous leishmaniasis by leishmaniasis was recorded for less than 5 years of age
gender: The results of the statistical analysis of the group 34.7%.
relationship between cutaneous leishmaniasis and
the host’s sex showed that males had a higher rate of Distribution of cutaneous leishmaniasis according
infection than females with a rate of 55.6% and 44.4%, to residence: The obtained results showed that the rates
respectively. It may be attributed to the fact that males of infection increased in the agricultural areas, districts,
are more exposed to infected vectors than females. and poor neighborhoods, where they increased in Sadr
Arroub et al(8) stated that males who work or sleep in the City by 39%, followed by the Mahmudiyah District
open and rooftop areas with less body coverage are more by 27% and the lowest in the Adhamiya region by 7%,
susceptible than others. Some studies have assumed that attributed to the increase in the highest rates of infection
the sex difference observed in some parasitic diseases in the agricultural and districts And slum areas due to
can be attributed to hormonal influences, but the role the abundance of poor hosts that store the disease, which
of sex hormones in the immune response remains leads to an increase in the chances of infection with the
controversial(9,10,11). The current study agreed with parasite throughout the year, and it increases especially
Mohammad & Al-Khaliq(12) in Baghdad governorate, in agricultural areas due to the continuous cultivation of it
where it recorded the highest rates of infection in males in all seasons of the year, while this percentage decreases
with a rate of (65%) compared to (35%) of females. The in urban areas.(9,20). The study agreed with Kashkool,(21)
study also agreed with Salman et al. (13), where the highest reported the highest infection rates in rural and
percentage of males was recorded at 56 and (82.35%) agricultural areas, reaching 317 (92.4%), and the lowest
more than females whose number of injuries exceeded injury was recorded in urban areas, reaching 26 (7.6%).
12 and by (17.64%). It agrees with Al-Khayyat et al., The current study also agreed with Al-Mashhadany,(22);
Al-Mayali & Al-Hassani,(3); Khudhur,(23) they recorded
68 Medico-legal Update, January-March 2021, Vol. 21, No. 1
the highest rates of infection in agricultural and rural Journal of Biosciences, 2020. 14(1), 1999-2006.
areas and the lowest infection in urban areas. They also 5. Al-Obaidi JM, Abd Al-Hussein MY and Al-Saqur
agree with Reda,(12) in Babel governorate, where the IM. Survey Study on the Prevalence of Cutaneous
highest rates of infection were recorded in agricultural Leishmaniasis in Iraq. Iraqi Journal of Science,
regions with a rate of (55%) followed by the districts 2016. 57(3), 2181-2187
with (25%) and the lowest percentage in the city center
6. Ncci NGO. Coordination Committee for IRAQ.
with a rate of (20%). The study differed with Kattoof,(15)
Sulaymaniyah Governorate Profile. 2015.
in Baghdad governorate, where the highest rate of
infection was recorded in urban areas, at a rate of (28%), 7. Sheskin DJ. Handbook of parametric and
compared to rural areas and poor neighborhoods, at a nonparametric statistical procedures. 3rd ed. Boca
rate of (18%). The study also came different with what Raton: Chapman & Hall/CRC, 2004, 1-77.
Luma(24) found In the city of Babel, where the highest 8. Arroub H, Alaoui A and Habbari K. Etude Eco-
incidence of cutaneous leishmaniasis in urban areas was Epidemiologique de la Leishmaniose Cutanée
32 (53.3%) more than in rural areas 28 (46.7%). dans la Région de Foum Jamâa (Azilal, Maroc).
In Le Premier Colloque International sur les
Conclusions Changements Climatiques et Environnement.
Faculté des Sciences, Rabat, Maroco. 2010.
The Leishmania parasite infects both sexes and all
ages without exception and the highest incidence was 9. Al-Waaly ABM and Shubber HWK.
for young people, and infection were also recorded that Epidemiological study of Cutaneous leishmaniasis
the highest incidence was in January and February, in Al-Diwaniyah province, Iraq. EurAsian Journal
while multiple ulcers occupied the largest proportion of of BioSciences, 2020. 14(1), 269-273.
ulcers and the most affected sites were the hand and face 10. Al-Myahy FS, Al-waaly ABM and Shubber HW.
compared to different body sites. The city of Baghdad Laboratory diagnosed for some diseases in Al-
is one of the cities where cutaneous leishmaniasis is Diwaniya province. Journal of Al-Qadisiyah for
endemic, as infection varies according to the difference Pure Science (Quarterly), 2009, 14(1), 44-57.
in regions. 11. Bailey M and Lockwood D. Cutaneous
leishmaniasis. Dermatol. 2007; 25:203–211.
Conflict of Interest: None
College of Science, University of Baghdad: 2007,
Funding: Self 116 pages.
12. Mohamed Reda AZ. Epidemiological and
Ethical Clearance: Not required
immunological study of cutaneous leishmaniasis
in Al-Kifel, Babylon governorate Iraq. Msc thesis,
References
University of Kufa, Iraq. 2018.
1. Youssef NG. Black Fever. Scientific bulletin. Najaf 13. Salman IS, Vural A, Unver A and Sacar S.
Health Department, Primary Care Department. Cutaneous leishmaniasis cases in Nizip, Turkey
Ministry of Health, 2002. p. 119. after the Syrian civil war. Mikrobiyol Bul, 2014.
2. Khazaei S, Hafshejani AM, Saatchi M, Salehiniya 48(1), 106-13.
H and Nematollahi S. Epidemiological aspects 14. Al-Khayat H, Gurganus C, Newcomb DE and
of cutaneous leishmaniasis in Iran. Archives of Sakhaeifar MS. Developing Specification Limits
Clinical Infectious Diseases, 2015. 10(3), 218-222. for Hot Mix Asphalt Properties and Impact on Pay
3. Al-Mayali HMH and Al-Hassani MKK. Factors. Journal of Transportation Engineering,
Morphological Descriptive Study of Phlebotominae Part B: Pavements, 2020. 146(3), 502-507.
Species (Diptera: Psychodidae) in Eastern Al- 15. Kattoof WM. Intralesional streptomycin: New,
Hamza District, Al-Diwaniya City. Int. J. Curr. safe, and effective therapeutic option for cutaneous
Microbiol. App. Sci, 2016. 5(9), 667-674. leishmaniases. Mustansiriya Medical Journal,
4. Al-Hassani MKK and Al-Mayali HMH. 2018. 17(1), 42-46
Evaluation of some biochemical levels in patients 16. Alawieh H, Tehrani KA, Azzouz Y and Dakyo B.
with Cutaneous leishmaniasis serum and their A new active common-mode voltage elimination
relationship with antioxidant enzymes. Eurasian
Medico-legal Update, January-March 2021, Vol. 21, No. 1 69
method for three-level neutral-point clamped west of Iran. Jundishapur J. Health Sci, 2011. 3,
inverters. In IECON 2014-40th Annual Conference 11‑20.
of the IEEE Industrial Electronics Society, 2014. 21. Kashkool AH. Some ecological and biological
1060-1066. aspects of phlebotominae (Diptera; Psychodidae)
17. Akcali C, Çulha G, İnalöz HS, Savaş N, Önlen Y, and the epidemiology of cutaneous leishmaniasis
Savaş L and Kırtak N. Cutaneous Leishmaniasis in in Diwaniya Governorate”. M.Sc. thesis, college of
Hatay. Turkey Published: J Turk Acad Dermatol sciences, University of Al-Qadisiya, Iraq. 2009.
2007. 1(1),1-16. 22. Al-Mashhadany W. Present status of cutaneous
18. Zaph C, Uzonna J, Beverley SM and Scott P. Leishmaniasis and its vectors in Baghdad area.
Central memory T cells mediate long-term M.SC. Thesis, College of science, University of
immunity to Leishmania major in the absence of Baghdad, Iraq. 2002.
persistent parasites. Nature medicine, 2004, 10(10), 23. Khudhur HR and Alomashi GB. Effect of NRAMP1
1104-1110. gene polymorphism on levels of (TNF-α1and IL-
19. AL-Mafraji KH, Al-Rubaey MG and Alkaisy 1β) cytokines in cutaneous Leishmaniasis patients
KK. Clinco-eidemiological Study of cutaneous in Iraq. Journal of Immunology and Clinical
leishmaniases in AL-Yarmouk Teaching Hospital. Microbiology, 2018. 3(2), 15-22.
Iraq Journal Community, 2008. 21(3), 194-197. 24. Luma AH. Molecular study for cutaneous
20. Kassiri H, Mortazawi H and Kazimi SH. The leishmaniasis and its relation parameters in patients
epidemiological study of cutaneous leishmaniasis of Al-Najaf Al-Ashraf province. PhD. Thesis, Al-
in Khorramshahr city, Khouzestan Province,South- Qadisiya University, Iraq. 2019.
70 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 71
72 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 73
74 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 75
76 Medico-legal Update, January-March 2021, Vol. 21, No. 1
DOI Number: 10.37506/mlu.v21i1.2284 Medico-legal Update, January-March 2021, Vol. 21, No. 1 77
Abstract
Background: Footwear has an essential role in raising well-being of any person. Many females have wear
heel or flat footwear on their daily basis as if they are working or not. Footwear creates discomfort which
leads to pain in foot, and results in alteration of balance. Most of the working places requires prolonged
period of standing which is possibly associated with musculoskeletal disorders,likely affects our health and
acute trauma from the working places. Prolonged sitting and standing can directly affect the weight-bearing
joints majorly the hip, knee and ankle joint which in turn leads to deformities and effects balance. Changes
in this composite system results in the risk of falls and loss of stability.
Objective: The objective of the study was to identify the effects of footwear in young female’s postural
balance in prolonged standing and sitting job.
Materials and Method: 100 healthy females were taken for the study age 18-35 years but only 60 were
selected for the study. The subject had to perform Rhomberg test and tandem walk for balance assessment.
Result: On analysis, it was found that in rhomberg balance test, 73.33% population were positive with the
test. 8.33% population were positive with the eyes opened and 65% population were positive with the eyes
closed and in tandem walk, 31.66% population is positive who were unable to complete the test.
Conclusion: In conclusion, the balance tests shows that, wearing footwear for prolonged hours of standing
and sitting job,states that the balance and postural control worsening which is associated with decrease
in postural stability and increase in the risk of falls.. According to the study balance is more effected in
prolonged sitting than in prolonged standing.
Footwear has an essential role in raising well-being of Static postures such as prolonged sitting and
any person.3 As footwear passes the sensory information prolonged standing increase physical and mental
to the foot, and a person can control the postural stability exertion on the body and these exertions increases
through the touch and proprioception.4,5Footwear creates the force on the musculoskeletal system.13 Disuse
discomfort which leads to pain in foot, and results in of muscles by prolongedsitting can cause weakness
alteration of balance. of muscles. Prolonged sitting can lead to ischemia,
apoptosis (programmed cell death), it may directly
Balance can be defined as a situation in which affect the musculoskeletal system 13 like pain in legs,16
one’s body dynamics are proportionate just to prevent chronic venous insufficiency,18spinal compression,15
the person’s body from falling and also the ability to and impaired circulation which in result causes swelling
uphold, attain and reinstate the person’s body center of of the lower extremities.13,14. During standing in one
mass (COM) respective to the base of support (BOS). position or maintaining the erect posture without an ease
Maintaining balance is acknowledged as keeping of walking rhythmically, affects the blood circulation
the center of gravity (COG) in BOS defined by the and compromised body fluids.13 This causes swelling
feet.7Balance is sustained through dynamic combination and pooling in lower extremities.13,14
of internal and external.8 Functional activity and motion
is necessary for balance. Functional balance is capability Prolonged sitting and standing can directly affect
of an individual to maintain a position and posture during the weight-bearing joints majorly the hip, knee and the
any functional motion.2 ankle joint which in turn leads to deformities and effects
balance. Changes in this composite system results in the
Postural control or balance can be defined statically risk of falls and loss of stability. 3 In maintaining the
as the ability to maintain a base of support with minimal balance of the body which may be deformed both by
movement and dynamically as the ability to perform a intrinsic forces (body movement), and by the extrinsic
task while maintaining a stable position.10 forces (the forces which is acting on the body in a certain
The aim of the study is to determine the effects environment).3
of footwear on young female’s postural balance in There are many more researches based on balance
prolonged standing and sitting job. Many researches but there is no research had been done on the effects
have been done on effects of footwear on balance but this of footwear on young female’s postural balance in
research will leads to explain the how footwear effects prolonged standing and sitting job. This research
the balance in prolonged standing and sitting job. For will provide the intra subject reliability of balance
static balance test, rhomberg berg test has been done and measurements in young females.
for dynamic balance test, tandem walk has been done.
Data:
Table 1: Rhomberg Test
Table 2 This graphs showed the relation between the age and the test performed by the subjects.
Abstract
It is a prospective study of fatal two wheelers accident cases brought at Indira Gandhi Government General
Hospital & Post Graduate Institute, Puducherry. Amongst 118 cases, 79.66% were male whereas 20.33%
were female. Highest numbers of victims were in the age group of 36-55 years, accounting for 45 (38.13%).
There was a higher rate of head and neck injuries in the present study followed by head, neck & lower
limb and head, neck & upper limb. Numbers of people who succumb to two wheeler accidents are on an
increasing trend in India. Fatality rates among the people involved in RTA shows an alarming increase.
It was observed that violating the traffic rules is found to be the major contributory factor and men and
teenagers are the most common people involved in these accidents. Measures to prevent these accidents and
decrease the mortality rates in these situations includes strict adherence to traffic rules.
Keywords: Two wheelers, Road Traffic Accidents, Drunken Drive, Mechanical injuries.
Introduction study was conducted for five years form 2000 -2004
to draw the pattern between the age, sex of the victim,
Road traffic accidents are the only public health
type of injury, and their association with the road traffic
problem for which society and decision makers still
accidents. As per the results a majority of 77% were in
accept death and disability among young people on
the age group from 18-44 years accounted for nearly 69.6
a large scale1. India ranks 1st in the number of road
percent of road accident victims, the accident ratio was
accident deaths among 199 countries reported in the
83% in male whereas for the female it was 17%. They
World Road Statistics, 2018 followed by China and the
have also mentioned that 81% of the geared vehicles
US. As per the WHO Global Report on Road Safety
have been a part of the accidents that occurred (4).
2018, India accounts for almost 11% of the accident-
Tamil Nadu and Uttar Pradesh accounted for the highest
related deaths in the World2.
number of road accidents and death in road accidents
According to the National Crime Records Bureau respectively in 2018, the report revealed (2).
(2010), the number of vehicular accidents was 430600
Because, most of the national highways in India are
resulting in 133938 deaths and 470600 injuries, thereby
made by tar and the fact is that the national highway is 24
accounting for 37.2% of all accidental deaths (3). A
hrs busiest roads with vehicles travelling at high speeds,
the roads being less wider multiple intersections and
divider cuts are present at every kilometre for changing
the side.3,4,5.
Corresponding Author:
Dr. Arun Ks Prakash MD., LL.B. Though the facts of the motorcycle accidents are
Assistant Professor, Department of Forensic Medicine, obvious no much attention is paid to it. The accidents
SRM Medical College Hospital and Research Centre, by a motorbike is 27 times fatal than a caras by the
Kattankulathur–603 203 source 5. This does not imply that car accidents are less
Mobile Number: 9842292308 damaging but the impact and the numbers are greater on
e-mail: [email protected] the comparison.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 83
Method and Materials The data were analyzed with SPSS-20 software
and the results were interpreted in terms of percentage,
The study is a prospective analysis of cases of
mean, chi-square, and z-test. Then we compared our
fatal two wheelers accident autopsied at Indira Gandhi
findings with the works of other authors.
Government General Hospital & Post Graduate Institute,
Puducherry during the period November 2013 through Observation: There were 118 fatal two wheelers
April 2015 after obtaining ethical clearance. Out of the accident cases out of the total 159 fatal road traffic
total 159 cases of RTA we have chosen 118 cases where accident dead cases. Age-wise, Sex-wise and other
two wheelers were involved. External and internal findings are displayed in Table No.1. Amongst 118
postpartum findings were observed and recorded in the patients, 79.66% were male whereas 20.33% were
performa. History about the accident, the time, day, female. Highest numbers of victims were in the age group
month, type of road, type of vehicle, were obtained of 36-55 years, accounting for 45 (38.13%) patients. On
from investigating officer and relatives of the deceased applying, Chi-square test, it is shown that the age group
and were recorded in the Performa. The cases with 36-55 years and above 55 years is statistically significant.
incomplete details were not taken into consideration. Male are more vulnerable to two wheeler accidents than
female. 98.30% of the patients got accident in Tar road
than cement & Mud road.
Table No. 2 shows distribution of cases according to hitting against the pedestrian. In 25 cases, (21.23%)
to manner of accident. In 36 cases, (36.50%) it was due death were by collision with heavy passenger vehicle.
Most common injuries observed were abrasion, in the patients and followed by Abrasion, Abrasion &
laceration, sutured wound and contusion observed in all Sutured wound, Abrasion, Laceration, Sutured wound &
118 cases. In that combination of abrasion & laceration Contusion were 19.49%, 16.94%, 14.40% respectively
(26.27%) is the most common type of injuries observed shown in Table No. 4.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 85
Table No. 4: Cases Distribution According to Injury of these accidents occurred on the paved roads 116
Type (98.30%).
Type of Injury Frequency Percentage There was a higher rate of head and neck injuries in
Contusion 6 5.08% the present study followed by head, neck & lower limb and
head, neck & upper limb. A possible explanation might
Abrasion 23 19.49%
be that two wheeler inhabitants did not use seat belts,
Laceration 14 11.86% resulting in forward jerk during a collision and higher
Abrasion & Contusion 7 5.93% rate of injury. Abrasions, lacerations, sutured wound and
Abrasion & Laceration 31 26.27% contusion were the commonest types of injuries among
Abrasion & Sutured wound 20 16.94% the external injuries noted in this study. Similar results
were also observed by others researchers12-16). Common
Abrasion, Laceration, Sutured
17 14.40% sites for injuries were the lower and upper limbs and
wound & Contusion
face6,7.
Total 118 100%
Face & lower limb injury is more frequent in
As shown in figure 2, the injuries were commonly
motor vehicle occupant 27(22.88%) followed by Lobes
seen on the the face & lower limb 27(22.88%), followed
(21.18%), lobes, upper limb, lower limb & face (16.94%),
by cerebral Lobes (21.18%), lobes, upper limb, lower
lobes & lower limb (16.10%), upper limb & lower limb
limb & face (16.94%), cerebral lobes & lower limb
(16.10%). The less common area are lobes & upper
(16.10%), upper limb & lower limb (16.10%). The less
limb (6.77%). It therefore, appears that motor vehicle
common area are lobes & upper limb (6.77%).
occupant and motor cyclist were more vulnerable to the
different type of injuries than other categories of the
Discussion
victims possibly due to a greater force of impact in the
Road traffic accidents are more common in a former and a longer distance of the fall in the latter16,17
developing country like India. In this study, the majority whereas the study conducted by Clark DW reported that
of motor cyclist and pillion riders were adultsand in their more number of fractures appeared in the area of upper
most productive ages and showed a male preponderance. limbs, lower limbs and facial bones18. In line with our
Present study is in consistent with the works of other study Wong TW showed that commonest injury was
authors1.2,3,4. fracture of bones particularly of the head and face and
closely followed by the lower extremity18,19.
The results of the present study revealed that 94
(79.66%) of the patients were males and the rest 24
Conclusion
(20.33%) were females. The highest number of patients
45 (38.13%) were from 36-55 years of age group. The study highlights the pattern of injuries among the
Among males, the maximum numberof cases were motor cyclists. By analyzing the various data that were
seen in the age group of 36-55 years 35 (29.66%) and published on RTAs and their major contributing factors,
above 55 years 30(25.42%). The mean age of the RTA accidents are happening usually due to irresponsibility
victim came out to be 30.12yrs. However, other studies of the rivers. Hence, we recommend strict enforcement
observed that mean age of the male victimized in road of the traffic rules and safety law for the motor cyclist
traffic accidents is 33 years.6-11. like wearing the helmet, maintaining the speed limit etc.
Moreover, advancement in technology of the wheelers
Due to high activity levels, participation in high-risk has brought great advantages to the human but on the
activities, reckless driving/riding, over-speeding and other hand the mishandling of these two-wheelers can
drunken driving, driving without wearing helmetsetc even cause fatal death or injury. India has recorded the
are main reason for high incidence rate among males. maximum number of deaths in two-wheeler accidents
Similar observations were also reported by different with a greater ratio of men being affected than the women
authors6-9. On the other hand females due to social & because of not following the traffic laws Understanding
cultural practice are less expose to road traffic accidents. the speed limit and obeying traffic laws could reduce the
Moreover, extra precautions taken by family members to number of people affected by the accidents. It is high
keep them safe women have lesser possible to encounter time that the policy makers should take a look at these
road traffic accidents than male partners. Majority
86 Medico-legal Update, January-March 2021, Vol. 21, No. 1
types of studies and do concerned modifications in the 10. Clark DW, Morton JH. The motorcycle accident: A
years to come. growing problem. J Trauma. 1971;11:230–7.
11. Akang EE, Kuti MA, Osunkoya AO, Komolafe
Ethical Clearance is taken from Departmental
EO, Malomo AO, Shokunbi MT, et al. Pattern of
Research Committee to Amity Law School, Amity
fatal head injuries in Ibadan - A 10 year review.
University, Noida, U.P.
Med Sci Law. 2002;42:160–6.
Source of Funding: Self 12. Kual A, Sinha US, Pathak YK, Singh A, Kapoor
AK, Sharma S, et al. Fatal road traffic accidents,
Conflict of Interest: Nil
study of distribution, nature and type of injury. J
Indian Acad Forensic Med. 2005;27:71–6.
References
13. Dhillon S, Kapila P, Sekhon HS. Pattern of injuries
1. Mohan D. Road traffic injuries-a neglected in road traffic accidents in Shimla hills. J Punjab
pandemic. Bulletin World Health Organisation Acad Forensic Med Toxicol. 2007;7:50–3.
2003; 81(9):684-5
14. Kumar PM, Ziya A, Prashant A, Yadav S,
2. The Economic Times. Road Accidents Claimed Chaturvedi R, Tripathi SK. Fatality due to chest
over 1.5 lakhs in 2018. 2018 injury in Road traffic accident victims of Varanasi
3. National Crime Record Bureau. Annual Report on and adjoining districts, U.P. Medico-Legal Update.
Road Accidents. 2010 2006;6:7–9.
4. Jain A, Manazes RG, Kanchan T, Gagan S. Two 15. Singh H, Dhattarwal SK. Pattern and distribution
wheeler accidents on Indian roads – a study from of injuries in fatal road traffic accidents in
Mangalore. J Forensic and Legal Medicine. 2009; Rohtak (Haryana) J Indian Acad Forensic Med.
16(3): 130-3. 2004;26:20–3.
5. Dolman Law Group. Five facts you should know 16. Sharma BR, Harish D, Singh G, Vijay K. Patterns
about motor cycle accidents. 2018 a Head Injury in Road Traffic Accidents, Bahrain
6. Mehta SP. An epidemiological study of road traffic Medical Bulletin 2003;25(1):22-25. 12.
accident cases admitted in Safdarjang Hospital, 17. Kumar S, Suresh B, Kanchan T, Ritesh G,
New Delhi. Indian J Med Res. 1968;56:456–66. Shankar M, Bakkannavar, Vinod C, Nayak K,
7. Sathiyasekaran BW. Study of the injured and the Yoganarasimha. Victim Profile and Pattern of
pattern in road traffic accidents. Indian J Forensic Thoraco-Abdominal Injuries Sustained in Fatal
Sci. 1991;5:63–8. Road Traffic Accident. JIAFM 2012; 34(1):16-19
8. Ghosh PK. Epidemiological study of the victims of 18. Clark DW, Morton JH. The motorcycle accident: A
vehicular accidents in Delhi. J Indian Med Assoc. growing problem. J Trauma. 1971;11:230–7
1992;90:309–12. 19. Wong TW, Phoon WO, Lee J, Yiu PC, Fung
9. Varghese M, Mohan D. New Delhi: Proceedings KP, Smith G, et al. Non-fatal injuries among
of the International Conference on Traffic Safety; motorcyclists treated as in-patients in a general
1991. Jan 27-30, Transportation injuries in rural hospital. Ann Acad Med Singapore. 1989; 18:672‑4.
Haryana, North India 1991.
DOI Number: 10.37506/mlu.v21i1.2286 Medico-legal Update, January-March 2021, Vol. 21, No. 1 87
Abstract
Cannabidiol (CBD) is the major non-mind-altering section of the hairy glands of hemp plant that can be named
‘cannabinoids’ (CBs). Cannabinoid in the pharmacology field is becoming an extensive subject specifically
towards the therapeutic characteristics of cannabinoid receptor agonists. Examples such as analgesia,
muscle relaxation, immunosuppressive, antiinflammatory and anti-allergic effects, mood improvement,
appetite stimulation, antiemesis, lowering of intraocular pressure, bronchodilatation, neuroprotection, and
anti-neoplastic effects. Although this vast knowledge about the therapeutic properties of CBs, their clinical
uses remains a controversy and very limited. However, the focus now has been on CBD that constitutes up
to 40% of the extract of the Cannabis and represents one of the most attractive prospects for therapeutic use
owing to its extraordinary lack of both perceptual and psychoactive behavior. Finally, CBD is regarded as an
important putative lead compound to produce cannabinomimetic drugs because of its excellent tolerability
in humans.
Abstract
Background: ST-Elevation Myocardial Infarctionis a time-sensitive emergency condition. Thus, guidelines
recommended 90 minutes or less for door-to-balloon time at a percutaneous coronary intervention-capable
hospital and with in 120 minutes or less if transferred from per cutaneous coronary intervention-Uncapable
Hospital. The main objective was to evaluate the recommended time needed forreperfusion therapy
particularly percutaneous coronary intervention inpatients with ST-Elevation Myocardial Infarctionat King
Abdullah Medical City.
Method and Results: A retrospective single center study. Data were obtained from 47 patients records
diagnosed with ST-Elevation Myocardial Infarction and treated with percutaneous coronary interventionat
King Abdullah Medical Cityfrom Jan 2018 through March 2019. About 36.4% of patients received
percutaneous coronary intervention in more than 90 Minutes eventhough they arrived directly at King
Abdullah Medical City. For patients who were transferred to King Abdullah Medical City, 63.9% of those
patients did not achieve the recommended door-to-balloon time.
Conclusion: High percentage of patients with ST-Elevation Myocardial Infarctionat King Abdullah Medical
City did notreceive percutaneous coronary intervention within the recommended timeline.
Keywords: Ischemic heart disease, ST-Elevation Myocardial Infarction, percutaneous coronary intervention,
Door-to balloon time, door-to-needle time.
Table 1: Demographic characteristic. Table represents demographic characteristics of the study population;
data presented in actual patient’s numbers and percentage (%).
100%
90%
80% 36.40%
70% 63.90%
60%
50%
40%
30% 63.60%
20% 36.10%
10%
0%
Figure 1. Door-to-balloon time for patients directly arrived or transferred to KAMC. based on direct/
Patients directly arrived at Patient transferred to KAMC
transferred arrival (x-axis across the page) and patient percentage % (y-axis going into the page).
KAMC
96 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Percentage % 50%
40% 36%
30%
20%
10%
0%
Regular
Figure 2. Door-to-balloon time for hours
patients directly arrived at KAMCbased onarrival time (x-axis across the
page) and patient percentage % (y-axis going into the page).
PCI within 120 minutes
PCI more than 120 minutes
90%
80%
80%
70%
60%
60%
Percentage %
50%
40%
40%
30%
20%
20%
10%
0%
Figure 3. Door-to-balloon time Regular hours
for patients Off hours
transferred from non-PCI capable hospital based on arrival time
either regular hours or off hours (x-axis across the page) and patient percentage % (y-axis going into the page).
70%
60%
60%
Percentage %
50%
40%
40%
30%
20% 17%
10%
0%
Figure 4. Door-to-balloon ECG
timewithin 10 minutes
for patients directlyECG in more
arrived than 10 according
at KAMC minutes to time needed to have
ECG either within 10 minutes of arrival or more than 10 minutes of arrival (x-axis across the page) and
patient percentage % (y-axis going into the page).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 97
80% 77%
70%
60% 57%
Percentage %
50%
43%
40%
30%
23%
20%
10%
0%
ECG within
Figure 5. Door-to-balloon 10 for
time minutes ECG in more
patients transferred than
from 10 minutes
non-PCI capable hospital according to time
needed to have ECG either within 10 minutes of arrival or more than 10 minutes of arrival (x-axis across the
page) and patient percentage % (y-axis going into the page).
Abstract
Globally, the quantity of land and water resources on earth is relatively fixed, while the quality progressively
decreased. One of the problems with clean water quality is the hardness level caused by valence cation ions
of two metals such as Ca2 +, Mg2 +, Fe2 + and Mn2 +. The purpose of this study is to determine the effect
of pine resin (Pinus merkusii) in reducing hardness (CaCO3) in clean water. This type of research is a quasi-
experimental study by testing the treatment of hard water using pine resin media (Pinus merkusii) measuring
± 5 cm with variations in the thickness of the media that is 20 cm, 40 cm, and 60 cm by replicating 3 times.
The results of this study found that the reduction in hardness at 20 cm media thickness by 42.14%, at 40 cm
thickness by 51.58%, and a thickness of 60 cm 73.78%. And the one way ANOVA test results showed the
value of the comparison between hardness after filtration was sig.0.00 ≤ 0.05 so that there was a significant
difference between the thickness of the pine resin (Pinus merkusii) 20 cm, 40 cm, 60 cm. The conclusion
from the study of water management through filtration using pine resin media (Pinus merkusii) meets the
requirements according to the Health Ministry of Indonesia Regulation Number 32 of 2017. Water treatment
with pine resin if used for the community should use a thickness of 60 cm. As for researchers, it can further
use other variations such as the thickness of the pine resin used.
Resin is a hydrocarbon compound that can exchange The sample in the study was clean water from
ions so that the ions are often in drinking water treatment a community dug well in Citta Subdistrict, Soppeng
or wastewater treatment.9 Natural resins can be obtained Regency which had a high level of hardness. Primary
from plant sap such as pine trees (Pine merkusii) which data using data obtained based on the results of
are processed through the distillation process. This pine processing with pine resin (Pine merkusii) in reducing
sap contains abietic acid (C20H30O2) and terpene acid hardness in clean water. Secondary data was data
(C5H8).10 The use of this media only requires a relatively obtained from various references both articles, books,
low cost, and is widely available in South Sulawesi and and other literature that were considered to be able to
can be used many times. support existing theories, and were considered to have a
relationship with this research.
Based on the description above, the authors are
interested in examining how much the ability of pine The data analysis technique was carried out with the
resin adsorption in reducing hardness levels in clean ANOVA test from observations obtained at the time of
water. the implementation of the experiment and described in
tabular form. The results of the study were accompanied
Materials and Method by descriptions based on supporting theories.
This type of research is a quasi-experimental
Results
study by testing the treatment of hard water using pine
resin media (Pinus merkusii) measuring ± 5 cm with a Large Decreased Hardness in Thickness of Pine
variation of media thickness of 20 cm, 40 cm, and 60 cm Resin Media (Pinus merkusii) 20 cm. Based on research
by replicating 3 times. activities and examination of clean water samples in
the laboratory, the average results can be described in
Table 1:
Table 1: Average Hardness After Through Pine Resin Media Filtration Thickness of 20 cm in the 2019 Dug
Well Water Sample
Table 2: Average Hardness After Filtration Through Pine Resin Media Thickness of 40 cm in 2019 Dug Well
Water Samples
Based on Table 2 above was the average yield of Large Decreased Hardness in Thickness of Pine
hardness before and after treatment with pine resin Resin media (Pinus merkusii) 60cm. Based on research
media thickness of 40 cm used in water samples from activities and examination of clean water samples in
the first repetition to the third repetition. The results for the laboratory, the average results can be described in
hardness before treatment were 660.96 mg/L with three Table 3:
times repetition to control the average yield of 602.48
mg/L, after treatment on pine resin media thickness of
40 cm obtained an average result of 320.01 mg/l with the
effectiveness of 51.58%.
Table 3: Average Hardness After Filtration of Pine Resin Media Thickness of 60 cm in 2019 Dug Well
Water Samples
Based on Table 3 above was the average yield of times repetition to control the average yield of 592.28
hardness before and after treatment with pine resin mg/L, after treatment on pine resin media thickness of
media thickness of 60 cm used in water samples from 60 cm obtained an average result of 173.26 mg/L with
the first repetition to the third repetition. The results for the effectiveness of 73.78%.
hardness before treatment were 660.96 mg/L with three
Medico-legal Update, January-March 2021, Vol. 21, No. 1 103
The following are the results of data analysis using one way ANOVA statistical tests to determine whether there
are differences in filter media used as interventions/treatments:
Table 4: Statistical Analysis Results Using One Way Anova Test Difference in Decreased Hardness Levels
After Filtration Using Pine Resin Media with Thicknesses of 20 cm, 40 cm, and 60 cm in 2019
One way ANOVA test results based on Table 4 asblockage of heart arteries and kidney stones or damage
showed the comparison value between hardness levels household cookware and household or industrial piping
after going through filtration where filtration results at networks.
thicknesses of 20 cm, 40 cm, and 60 cm were obtained
from the One Way ANOVA statistical test results using Hardness can be reduced by several ways such as
SPSS results of Sig. if ≤ 0.05 then it showed that there heating to temporary hardness, adding chemicals to
was a difference but if the Sig. ≥ 0.05, it is showed that reduce pH in raw water such as the addition of lime soda
there was no difference. (Na2CO3) or the addition of caustic soda (NaOH), the
recarbonation process for pH stabilization, ion exchange
The results above indicated a difference because using zeolites, or the use of resins both natural and
of the Sig. 0.00. Or 0.00 ≤ 0.05 so the hypothesis was synthetic resins.8
accepted this showed that for the decrease in hardness
there was a significant difference between the thickness Hardness is classified in two ways, namely based on
of the pine resin media 20 cm, 40 cm, and 60 cm. metal ions and based on anions associated with metal
ions. Based on metal ions, hardness is divided into
Discussion calcium hardness and magnesium hardness. Based on
anions associated with metal ions, hardness is divided
Water is one of the natural resources that have a into carbonate hardness and non-carbonate hardness.5
very important function for human life and life, as well
as to advance public welfare so that it is the basic capital Hardness is caused by excessive amounts of mineral-
and the main factor of development. Water is also an containing metal cations with two-dimensional cations.
environmental component that is important for the Usually what often causes hardness is the Ca ++ and Mg
survival of humans and other living things. That can be ++ cations. Total hardness is hardness caused by Ca ++
seen from the fact that 70 percent of the earth’s surface and Mg ++ together.5
is covered with water and two-thirds of the human body
Resin is a hydrocarbon compound that can exchange
consists of water.11
ions so that the ions are often in drinking water treatment
Groundwater is a part of the water in nature that or wastewater treatment.9 Natural resins can be obtained
is below the surface of the land. The formation of from plant sap such as pine trees (Pine merkusii) which
groundwater follows the cycle of water circulation on are processed through the distillation process. This pine
earth called the hydrological cycle, which is a natural sap contains abietic acid (C20H30O2) and terpene acid
process that takes place in water in nature that undergoes (C5H8).10 The use of this media only requires a relatively
a sequential and continuous displacement.12 low cost, and is widely available in South Sulawesi and
can be used many times.
The hardness standard in Indonesia Regulation is
500 mg/L6 but another literature7 stated that the hardness The hardness of water is different from the acidity
level>300 mg/L is classified in very hard water. To of water, even though the two are closely related. Both
overcome this problem, it needs treatment efforts before can be easily distinguished. Acidic water usually shows
the water is used so it will not interfere with health such a soft reaction. Therefore, the hardness of water is often
104 Medico-legal Update, January-March 2021, Vol. 21, No. 1
called the hardness of the water.13 Hardness is the nature Adsorption is the capture or binding of free ions in
of water caused by the presence of valence metal ions. water by adsorbents. Examples of substances used for
Such ions can react with soap to form lumps. The main the adsorption process are zeolites and resins which
cause of hardness is cation Ca2+, Mg2 +, Fe2 + and are the polymerization of polyhydric phenols with
Mn2 +.14 formaldehyde. For example, the binding of Ca2 + and
Na2 + ions. Each gram of resin can adsorb 4-9 MeV
Hardness in groundwater is caused by contact (milliequivalent). The amount of adsorbent needed
between groundwater and the layers of rocks. Rainwater depends on the concentration of the solution. The
that falls to earth cannot dissolve the large amounts of higher the concentration of the solution, the greater the
solid material contained in water. That ability can only adsorbent needed to purify water.9
be achieved if it has reached the soil where CO2 is
released by the reaction of bacteria, this CO2 in the soil Pine resin has been through the distillation process
is in equilibrium with carbonic acid. produced by the merkusii pine tree classified as oleoresin
which is a liquid resinous acid in turpentine that trickles
Water that contains high hardness will result in high out when the resin channel on wood or needle bark is cut
use of soap, due to the chemical relationship between or broken. The name oleoresin is used to differentiate
hardness ions and soap molecules, causing detergent pine resin from natural resin that appears on the skin
properties of soap to disappear. Excess Ca2 + ions or is contained in cavities in wood tissue as a genus of
and CO3 ions (one of the alkalinity ions) result in the members of the Dipterocarpaceae, Leguminoceae, and
formation of scale on the pipe and pan walls caused by Caesalpiniaceae families.10
the deposition of calcium carbonate CaCO3.
The sap that comes from the pine tree is dark yellow
The processing used in this research was processing and sticky, which consists of a complex mixture of
with filtration which has a basis as physical, chemical, chemicals. The most important elements that makeup
and biological filtering to separate/filter out particles pine resin are terpene acids and abietic acids. The mixture
that were not deposited in the sedimentation process is dissolved in alcohol, gasoline, ether, and some other
through porous media. The filtering process was needed organic solvents, but it is not soluble in water. Besides,
to separate the small/fine-sized flocks that cannot be from the results of the distillation of Pinus merkusii
deposited by the deposition process.11 sap produced an average of 64% gondorukem, 22.5%
One effort to overcome hardness is by softening turpentine, and 12.5% impurities. The resin canal is not a
hard water. Softening is the removal of certain ions that part of the wood, but a cavity surrounded by parenchymal
are in water and can react with other substances until the cells or epithelial cells. All layers surrounding the resin
water distribution and use are disrupted. Theoretically, channel are called epitellium.10
the reduction or softening of water hardness consists of Distilled pine sap will produce gondorukem (gum
various processes that exist in the process of softening rosin) and turpentine (gum turpentine). The color is pale,
hard water, namely using an ion-exchange system where clear, and sticky and when evaporated becomes brittle, it
water treatment uses resin or zeolite to replace unwanted states that pine resin is composed of 66% resinous acid
ions in water such as Ca2 + and Mg2 + and replace them (resin), 25% turpentine (monoterpene), 7% neutral non-
with N + ions and K +.15 volatile material, and 2% water.17
This process is very fast (20-30 minutes), cannot Gondorukem or resinis a hydrocarbon compound
take place with other reactions and raw water must not that can exchange ions so that it is often used in drinking
be turbid, installation and operation are complicated, water treatment or wastewater treatment. At present,
high efficiency, price is relatively expensive (suitable for there are two types of resins, natural resins, and synthetic
the industry). This process can be used for processing resins. Natural resins are processed from pine wood sap
permanent and temporary hardness by separating taken specifically, usually in the industry used for lacquer.
unwanted ions contained in hard water. The material Synthetic resins are made from hydrocarbons through
used in this process is in the form of activated carbon chemical processes. This synthesis resin is widely used
and or synthetic resin which is put into a column where in the plastics industry, household appliances, toys, and
water can already flow through the compounds.16 decoration.9
Medico-legal Update, January-March 2021, Vol. 21, No. 1 105
The use of resin is one method to treat water by treatment system by passing through a media filter with
passing water to the resin media. Water treatment with direction flow from the bottom up so that if the media
this resin is one method of separation according to used is dirty the washing process will be very easy.
chemical changes by exchanging ions. The principle
of water treatment with resins is to replace or exchange Upstream flow direction requires a lot of water
ions bound to the polymer filling resin with the ions that samples because water samples will be flowed gravity
are passed. There are two kinds of ion exchange resins. and also use pressure so that water samples will flow
through the media that has been prepared.
Cation exchange resin is a resin that will exchange
or take cations from the solution. For example, if the When viewed from the effectiveness of the thickness
water contains Fe (iron) ions the Fe ions will be bound of the filter media, filtration with a thickness of pine
by resin into R-Fe ions. However, the bond is not resin 60 cm is the most effective in reducing hardness in
permanent so when it is saturated, the resin used for water samples, from 660.96 mg/L down to an average of
water filters can be washed with warm water that is 173.26 mg/L with the effectiveness of 73.78% compared
given salt (NaCl). Furthermore, the resin will be pure to the thickness of pine resin 20 cm which dropped to
again and can be reused. The resin takes the role of an average of 382.43 mg/L with the effectiveness of
taking cations from the solution. Cation exchange resins 42.14%, and the thickness of a 40 cm pine resin dropped
take cations from the solution. Cation exchange resins to an average of 320.01 mg/L with the effectiveness of
contain carboxylic, sulfonic, phenolate or other groups 51.58%.
and several equivalent cations.9 Based on the results of statistical tests using one
Anion exchange resins are used using separation way ANOVA test to determine the differences in more
based on the charge held by the solute. One example than two interventions with replication. On the results of
is the ion group containing sodium.9 Ion exchange that hardness inspection using variations in the thickness of
occurs in the filtration process is also influenced by the the pine resin media 20 cm, 40 cm, and 60 cm, the Sig.
thickness and height of the water sample when jetting the value was obtained. 0.00<0.05 so that the hypothesis
thicker the pine resin media used, the higher the decrease was accepted, this showed that for hardness there was
in hardness levels in water through the filtration process a significant difference in the intervention by using
with pine resin media. variations in the thickness of the pine resin media 20 cm,
40 cm, and 60 cm.
The basic principle of filtration is physical, chemical,
and biological particle filtering to separate/filter out However, if compared with Health Ministry of
particles that are not deposited in the sedimentation Health Regulation Number 32 in 2017 concerning
process through porous media.18 The most influential Environmental Health Standard Quality and Water
filtration principle in this research is the deposition Health Requirements for Sanitary Hygiene, Swimming
process that occurs on slow filters or filters with flow Pools, Solus Per Aqua and Public Baths, especially
direction from the bottom up. The space between the on water health requirements for sanitary hygiene
grains of sand media functions as small sedimentation. requirements from total samples for hardness levels
Even small particles, as well as colloids and some (CaCO3) nothing has passed the established quality
bacteria, will settle in the space between the grains and standard of 500 mg/L, on the results of sample water
adhere to the physical effect (adsorption) grains. that has been through filtration treatment.
Ashish Dass1, Jaspreet Kaur Dullat2, Maninder Singh3, Aanchal4, Balpreet Kaur4, Chandresh4, Jahangir4
1
Nursing Tutor, 2Associate Professor, 3Assistant Professor, Chitkara School of Health Sciences,
Chitkara University, Punjab, India, 4B.Sc. Nursing 4th Year Students
Abstract
Background: The populace is quickly expanding and has become a significant issue with the populace
developing at a yearly pace of 1.2%. India will have more than 1.53 billion people before the completion of
2030 with the masses improvement rate at 1.58%.
Materials and Method: A Non-Experimental Descriptive Survey Research Design was used. A sample was
comprised of 50 males and 50 females belongs to peer group of 20-45 years. Purposive sampling technique
was utilized to gather sample for additional investigation. The data was aggregated by applying selected
variables, Structured Knowledge Questionnaire and Attitude Rating Scale.
Results: The result showed a significant association of knowledge of males with their selected variables. The
calculated p value of males and females with selected variables of knowledge and attitude was nonsignificant
which showed that there was no association between the level of knowledge and attitude of males and
females towards tubectomy and vasectomy.
Conclusion: It was concluded that Knowledge of the males and females regarding tubectomy and vasectomy
was in average and Attitude was moderately favourable. There was not any relationship between knowledge
and attitude of males and females regarding tubectomy and vasectomy.
Figure 1: Percentage distribution in terms of level of knowledge among eligible couples towards tubectomy
and vasectomy.
Frequency and percentage distribution in terms of males had unfavourable attitude towards tubectomy and
level of attitude of eligible couples towards tubectomy and vasectomy. Out of 50 females, majority of the females
vasectomy. Out of 50 males, Half of the males 25(50%) 35(70%) had moderately favourable attitude while only
had moderately favourable attitude and 24(48%) of the 15(30%) of the females had favourable attitude towards
males had favourable attitude while only 1(2%) of the tubectomy and vasectomy as shown in figure 2.
Figure 2: Percentage distribution in terms of level of attitude among males and females towards tubectomy
and vasectomy.
110 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Relationship between the knowledge and attitude significant at 0.05 level of significance calculated by
scores of participants towards tubectomy and vasectomy Co-relational Co-efficient. So there was no relationship
in table 5 which shows that r value of males and females between knowledge and attitude of participants towards
were 0.10 and 0.66 respectively which were non tubectomy and vasectomy as shown in table 2.
Table 1: Correlation between the knowledge and attitude of males and females towards tubectomy and
vasectomy. N = 100
Chi square showing association between level of significant at 0.05 level of significance. This shows there
knowledge and attitude of males and females towards is no association between the level of knowledge and
tubectomy and vasectomy. The findings reveals that attitude of males and females towards tubectomy and
computed p value of males and females with selected vasectomy as shown in table 3.
variables of knowledge and attitude found to be not
Table 2: Chi square showing association in terms of level of knowledge and attitude of males and females
towards tubectomy and vadectomy. N=100
Asmaa Farouk Mohamed1, Nawal Soliman2, Hemat Abd-El-Moneem El-Sayied2, Asmaa Talaat3
1
M.Sc.N., Community Health Nursing, 2Professors of Community Health Nursing, 3Lecturer of Community Health
Nursing, Faculty of Nursing-Ain Shams University, Cairo, Egypt
Abstract
Background: Autologous bone marrow transplantation is a curative procedure forhematological diseases
and immune deficiencies. The unique and intensive nature of this treatment requires distinctive care during
and post the entire transplant course. Nursing intervention for caregivers post autologous bone marrow
transplantation patients at home is an important component of the care that improves and develops knowledge
and practice of the caregivers, to take care of the patients in order to help them follow the demanding
treatment plan to reach recovery.
Aim to evaluate the effect of nursing intervention for caregivers of post-autologous bone marrow
transplantation patients at home.
Material and Method: A Quasi-experimental study was carried out among convenient sample of 143
patients and their caregivers who attended the follow up clinic during the first six months post autologous
bone marrow transplantation. The study was conducted among patients and their caregivers in three different
hospitals Sheikh Zayed Specialized Hospital, National oncology institute, and Nasser institute at outpatient’s
follow-up clinics. A self-administered questionnaire of patients and their caregivers’ demographic data,
and reported checklist of caregivers’ knowledge and practices toward post-autologous bone marrow
transplantation patients at home.
Results: There was a statistically significant difference between pre and post nursing intervention, which
indicate improvement in caregivers’ knowledge and practice post implementation of the nursing intervention
program, and positive correlation between their knowledge and practice.
Conclusion and Recommendations: Although caregivers had adequate knowledge, practice on some
aspects, gaps were identified. There is a need for educational interventions and discharge plan to upgrade
knowledge and practices of the caregivers of post autologous bone marrow transplantation patient at home.
Figure (1): Distribution of total caregivers’ knowledge and practice total score level regarding pre and post
nursing intervention (n=143).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 115
Table (2): Relation between caregivers’ demographic characteristics and total caregivers’ knowledge and
practice score level pre & post interventional program (n = 143).
Table (3): Correlation between caregivers’ knowledge and practices pre & post training program (n=143).
6. Mahmoud HK, Fathy GM, Elhaddad A, Fahmy 13. Schoemans M, Finn L, Foster J, Roche-Green A,
OA, Abdel-Mooti M, Abdelfattah R et al.: Bevans M, Kullberg S et al. A Conceptual Framework
Hematopoietic Stem Cell Transplantation in Egypt: and Key Research Questions in Educational Needs
Challenges and Opportunities. Mediterranean of Blood and Marrow Transplantation Patients,
Journal of Hematology and Infectious Diseases Caregivers, and Families. Biology Blood Marrow
2020, 12(1): e2020023:1-7 DOI: http://dx.doi. Transplant 2019;25: 1416_1423.
org/10.4084/MJHID.2020.023 14. Berry L, Jacobson J. Supporting the Supporters:
7]J amani K, Onstad EL, Bar M, Carpenter AP, Krakow What Family Caregivers Need to Care for a Loved
FE, Salit BR et al.: Quality of Life of Caregivers One With Cancer.Journal of Oncology Practice
of Hematopoietic Cell Transplant Recipients. DOI: 10.1200/JOP.2016.017913; published online
ELSEVIER. Biology Blood Marrow Transplant ahead of print at ascopubs.org/journal/jop on
24(2018)2271-2276. December 20, 2016; 35-41.
118 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2291
Abstract
The COVID-19 is a globally problem influences in all function of life, from health to economic and political
of countries. It is still to elevated in incidence and killed people specially among health workers. The study
aimed to assess the psychological problems among health workers who work in health facilities at Babylon
Province.
Descriptive-analytic study conducted during the era of COVI-19 by using online GHQ-12 items as instrument
to measure the symptoms of psychological problems. Convenience sample included 220 health workers
participated in the study. The study revealed elevated in psychological problems among health workers
and found significant relationship between gender and psychological problems. The study concluded to the
support and available the enough training and medical health equipment may be reduced it.
Introduction [6],
but there is evidence reported to proof the health
workers are effected by the psychological problems after
The COVID-19 is a global outbreak is a highly
the COVID-19 reach to the maximum point such as
contagious and it is main cause of respiratory illness.[1]
stress, anxiety, insomnia and other health problems. [7]
It is a viral infection recognized by fever, shortness of
Everyone responds to stressful circumstances and reacts
breath, cough and chest infection.[2] First detect to it in
differently according to experiences, abilities to adapted
Wuhan, China[3], and rapidly spread in all world yet[1].
with it and how coping with emotional distress [8] due
But COVID-19 is becoming an increasing public event
to the highly risks of exposure or ethical dilemma and
being a rapid epidemic [4]. The World Health Organization
stress of workload and work hours [9,10, 11].
states in the official website (March, 2020), there is
100,000 person and more are diagnosed with COVID-19 Sadly, some healthcare workers can face rejection
infection around of world [5]. So that any person can be because of stigma or fear by their families or friends, so
affected emotionally and exposure to psychological it may be make them which is a victim and increased the
problems symptoms during of the COVID-19 now. Most psychological problems on them [12].
communities and people had overwhelming feelings
of fear, stress and anxiety about a COVID-19 disease The study goals to assess the symptoms of
psychological problems among the health workers
during pandemic Covid-19 at Babylon Province and find
out the relationship between their characteristics and the
Corresponding Author: symptoms of psychological problems among them .
Astabrak A. N. Al-Hamoodi
Asst. Lect., Master Degree in Mental and Psychological Material and Method
Health, University of Kufa-College of Nursing The descriptive-analytic study design conducted at
e-mail: [email protected] A Nonprobability convenience sample was conducted in
Medico-legal Update, January-March 2021, Vol. 21, No. 1 119
Babylon Province during the era pandemic Covid-19 in to General Health questionnaire (GHQ12-items) to
world generally and in Iraq especially from 20 March explore the psychological problems in health workers
to 5th April 2020 by using Google samples forms who are not have psychological problems by self-
online to self-reported questionnaire distributed on 220 reported. The questionnaire is translated and use in Al-
participants (57 female and 163 male) from general Hamoody study (2019)[13] and before him it used for
health workers (24500) were work in all health care first time by Goldberg (1970) was use GHQ to assess
facilities in Babylon Province (see table (1)). After psychological well-being. It has four scores (0-3) begin
get consent to participated in study. The study sample from much less than usual to better than usual. It has
is a non-probability convenience sample, included cutoff point 1.5, when a person had ≥ 1.5 that mean had
participants from all governmental health facilities of psychological distress. This scale is a common used in
Babylon Province weather worked in isolated facilities of primary health care setting.
COVID-19 or in another governmental health facilities.
The researchers are used descriptive statistics
The study questionnaire had two parts. Part one to describe the results of data and determine the
related to demographic characteristics of health workers achievements of the study goals or not by using
like age, gender, experiences duration with contagious computer programs (SPSS v.17 and Microsoft Office
diseases, level education, marital status. Part two related Excel (2010)) to reveal the results.
Results
Table (1): Total number of health workers in the health facilities at Babylon Province
Total number of nurses only Total number of other health workers Total
All governmental health workers at
12450 12050 24500
pandemic COVID-19
Total 12450 12050 24500
N = 220
Frequency Percent
Male 163 74.1
Gender
Female 57 25.9
≤ 30 yrs 151 68.6
Age groups 30 - 45 56 25.5
More than 45 yrs 13 5.9
Post Graduate 21 9.5
College Graduate 97 44.1
Level education
Institute Graduate 85 38.6
Medicine 35 15.9
Nursing 106 48.2
Specialty of health workers
Other health workers 63 28.6
Support health workers 16 7.3
Total 220 100
120 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 3. Social and duration of experiences of health workers at era of COVID-19 pandemic in health
facilities at Babylon Province.
N = 220
Frequency Percent
Married 144 65.5
Separated 2 0.9
Marital status
Single 73 33.2
Widow 1 0.5
Not had children 112 50.9
1-2 child 62 28.2
Number of children
3-4 child 33 155
More than 5 13 5.9
Health sector 17 7.7
Hospital 176 80
Place job Center of health office 14 6.4
Special centers 8 3.6
Voluntary work 5 2.3
Not worked previously 185 84.1
< 1 month 6 2.7
Table 4. Level of General Mental Health of governmental health workers in health facilities at Babylon
Province
(N = 220)
No. Items Ratings M. S.D.
F. %
- Better than usual 42 19.1
(N = 220)
No. Items Ratings M. S.D.
F. %
- Not at all 0 0
- No more than usual 86 39.1
2. Lost much sleep over worry? 2.47 1.24
- Rather more than usual 79 35.9
- Much more than usual 55 25
- More than usual 40 18.2
Felt you were playing a useful part - Same as usual 150 68.2
3. 3.03 0.61
in things? - Less than usual 26 11.8
- Much less than usual 4 1.8
- More than usual 50 22.7
Felt you couldn’t overcome your - No more than usual 118 53.6
2.58 1.09
difficulties? - Rather more than usual 0 0
- Much more than usual 37 16.8
122 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 5. Overall Psychological Well-being among governmental health workers in health facilities at
Babylon Province
(N = 220)
Psychological well-being G.H.Q
F. %
No Psychological Distress 111 50.5
Psychological Distress 109 49.5
Total 220 100.0
The table revealed (50.5 %) was have psychological distress (49.5 %) were have psychological distress.
Table (6): The relationship between Overall Psychological Well-being (GHQ) and Demographic
Characteristics of governmental health workers in health facilities at Babylon Province
Abstract
Helicobacter pylori (H. pylori) is a highly prevalence microbial infection, that acts as an iron stressor in
susceptible individuals the relationship between ferritin and cytokine levels in individuals infected with H.
pylori remains controversial. Based on serology testing for anti-H. pylori IgG, participants (70 seropositive
and 70 seronegative aged 30-60 years were enrolled. Serum iron profiles including iron, ferritin, and total
iron-binding capacity, were measured. IL-1β and IL-6 serum levels were compared. The mean value of
interleukin 1beta (IL-1β) level of patients and controls revealed that H. pylori patients had a significantly
higher at (P< 0.001) mean of (IL-1β) when compared to the controls, as shown in this study there is positive
correlation between gastric interleukin 1beta (IL-1β) and iron deficiency anemia (IDA) blood parameters
observed in resent study could be due to the powerful capability of IL-1β in inhibiting gastric acid secretion.
The mean value of Interleukin-6 (IL-6)) level of patients and controls revealed that H. pylori patients had a
significantly higher at (P< 0.001) mean of (IL-6) when compared to the controls.
Table (1): Comparison of mean values of Immunoglobulin G(IgG), Interleukin -1β and Interleukin-6 of
Helicobacter pylori patients and controls
Group
Parameters Patients (n-70) Control (n=70) t-test df = 138 p- value
Mean SD* Mean SD*
IgG pg/ml 53.78 9.7 3.46 1.5 42.71 <0.001 sig
IL-1β pg/ml 83.24 17.02 32.79 7.86 22.50 <0.001 sig
IL-6 pg/ml 565.49 177.48 72.01 14.91 23.18 <0.001 sig
Abstract
Exclusive breastfeeding is very important for babies to maintain their immune system, brain intelligence,
emotion stability and to protect babies from various diseases that are causes of death. Breastfeeding will
also benefit the mother, which will reduce blood loss during menstruation, restore maternal weight as before
pregnancy, reduce the risk of breast cancer, and uterine cancer. The purpose of this study was to determine the
influences of antenatal care, postnatal care and early initiation of breastfeeding on an exclusive breastfeeding
pattern. The samples used in this study were mothers who had babies aged 7-12 months in June to August
2018 as many as 48 respondents in the working area of Manukan Kulon Health Center in Surabaya. This
study used the descriptive and bivariate analyses. The obtained results were antenatal care (p = 0.001),
postnatal care (p = 0.002) and early initiation of breastfeeding (p = 0,000). During pregnancy the majority of
mothers make complete antenatal care visits with a frequency of 10 times, antenatal care is very important
for mothers, especially the pattern of breastfeeding. In addition to the importance of antenatal care visits,
mothers who have given birth and are entering the postnatal care phase are required to make postnatal care
visits. Socialization from health workers and the support of closest people are required in order to achieve
the exclusive breastfeeding.
Keywords: Exclusive Breastfeeding, Early Initiation of Breastfeeding, Antenatal Care, Postnatal Care.
Breastfeeding Pattern
Total
ANC Visit Exclusive Non-Exclusive
n % n % N %
Complete 4 9,1 40 90,9 44 100,0
Incomplete 0 0,0 4 100,0 4 100,0
Total 4 8,3 44 91,7 48 100,0
Distribution results on the pattern of breastfeeding percentage of 90.9% while respondents who did not
based on Antenatal Care visit in the table 1 shows routinely make ANC visits gave breastfeeding with a
that most respondents with complete ANC visits gave non-exclusively pattern by 100%.
breastfeeding with a non-exclusive pattern with a
Table 2 Distribution of Breastfeeding Pattern Based on Post Natal Care (PNC) Visit
Breastfeeding Pattern
Total
PNC Visit Exclusive Non-Exclusive
n % n % n %
1 Time 0 0,0 4 100,0 4 100,0
2 Time 4 3,18 25 86,2 29 100,0
3 Time 0 0,0 15 100,0 15 100,0
Total 4 8,3 44 91,7 48 100,0
Based on the results in table 2, the majority total of 86.2%. Meanwhile, the respondents who visited
of respondents visited Postnatal Care twice with a PNC once and three times and determined the pattern of
frequency of 29 respondents. The respondents who non-exclusive breastfeeding to their babies had a greater
visited PNC twice and determined the pattern of non- percentage by 100% respectively.
exclusive breastfeeding had a lower percentage with a
Table 3 Distribution of Breastfeeding Pattern Based on the Early Initiation of Breastfeeding (EIB)
Breastfeeding Pattern
Total
EIB Exclusive Non-Exclusive
n % n % n %
Yes 4 9,1 40 90,9 44 100,0
No 0 0,0 4 100,0 4 100,0
Total 4 8,3 44 91,7 48 100,0
The pattern of breastfeeding based on Early Initiation 90.9%. Meanwhile, the respondents who did not give an
of Breastfeeding in table 3 shows that there were more EIB tended to give a non-exclusive breastfeeding to their
respondents who did the EIB than those who did not. babies with a percentage of 100%. The analysis of the
Respondents who did EIB mostly gave non-exclusive independent and dependent variables by using logistic
breastfeeding to their babies with the percentage of regression analysis (a = 0,05) are as follows.
132 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 4 Bivariate Analysis of Antenatal Care, stated that ANC visits affect the increase in the scope of
Postnatal Care and Early Initiation of Breastfeeding exclusive breastfeeding (9).
Bambang Eko Turisno1, IGA Gangga Santi Dewi1, Suharto1, Ery Agus Priyono1
1
Lecturer at Faculty of Law, Diponegoro University, Indonesia
Abstract
Advertising is an integral part of modern business activities. Information on ad serving in the form of true,
clear and honest information about the condition and guarantee of goods is a consumer right that must be
given by business actors. In Indonesia, cigarette advertisements in laws and regulations limit and provide
several conditions. Some cigarette advertisements do not meet the conditions. The results showed that
cigarette advertisements include, visual, tagline, images, placement, airtime, and content of advertisements
using psychological persuasion, targeting the share of adolescents and children, who play a role in the onset
of cigarette use, encouraging young people to start smoking that threatens children and teenagers.
Abstract
The current research aims to detect the maternal risk factors that influence the birth weight of the babies.
Risk factors related to the mothers like gestational age, maternal age, nutrition, and medical problems play
a role in the delivery of infants with low birth weight. The sample consisted of 267 ladies give a birth to
newborns. Mothers with less than or = 150cm giving low birth weight babies (62.3%) while those with more
than 150cm giving low birth weight babies (37.7%) . In the normal birth weight group, working mothers
represent (82.1%) while in normal birth weight group they represent (17.4%). Mothers more than or = 35
years old giving (33.1%) normal birth weight babies. Young mothers less than 20 years old gave more low
birth weight babies (28.7%) than older mothers with more 20 years old.
The maternal risk factors of low birth weight babies include maternal age < 20 years old, low maternal
educational level, working mothers, smoking, pre-pregnancy weight<50kg, maternal height ≤150cm, low
socioeconomic status, inter pregnancy interval of less than one year, previous low birth weight babies,
history of infertility and first week neonatal death, low rate of visiting to antenatal care centers.
Keywords: Low birth weight, risk factors, antenatal care, fetal growth.
LBW NBW
Age of mother p-value
No. % No. %
<20 years 47 29 61.7 18 38.3
20-24 years 51 25 49.1 26 50.9
25-29 years 43 21 48.8 22 51.2
<0.001
30-34 years 60 15 25 45 75
≥ 35 years 66 11 16.6 55 83.3
Total 267 101 37.8 166 62.2
Residence
Rural 107 39 36.4 68 63.6
>0.05
Urban 160 62 38.7 98 61.3
Total 267 101 37.8 166 62.2
Level of education of mother
Illiterate 54 43 79.7 11 20.3
Primary 50 33 66 17 34
Intermediary 36 13 36.1 23 63.9 <0.001
Secondary 59 7 11.9 52 88.1
University & above 68 5 7.4 63 92.6
Total 267 101 37.8 166 62.2
Employment-status
Worker 112 83 74.1 29 25.9
<0.001
House-wives 155 11.6 17.9 137 88.4
Total 267 101 37.8 166 62.2
142 Medico-legal Update, January-March 2021, Vol. 21, No. 1
LBW NBW
Age of mother p-value
No. % No. %
Smoking habit
Non- smoker 112 16 14.3 96 85.7
Passive smoker 82 36 43.9 46 56.1 <0.001
Current Smoker 73 49 67.1 24 32.9
Total 267 101 37.8 166 62.2
Socioeconomic status
High 108 15 14.9 93 56
Moderate 66 21 20.8 45 27.1 <0.001
Low 93 65 64.3 28 16.9
Total 267 101 37.8 166 62.2
As shown in table (2), pre-delivery weight (less than 50k.g.), maternal height (≤150cm)and short-spacing (< 1
year) associated with significant relation with LBW.
LBW NBW
Pre-pregnancy weight p-value
No. % No. %
<50kg 47 29 61.7 18 38.3
50-89kg 149 51 34.2 98 65.8
<0.001
≥ 90kg 71 21 29.6 50 70.4
Total 267 101 37.8 166 62.2
Maternal height cm
≤ 150 95 63 66.3 32 33.7
<0.001
> 150 172 38 22.1 134 77.9
Total 267 101 37.8 166 62.2
Parity
Prime 110 52 51.5 58 35
2-3 73 28 38.4 45 61.6 <0.005
>3 84 21 25 63 75
Total 267 101 37.8 166 62.2
Spacing(years)
<1 31 26 46.4 5 7.0
1 25 14 25 11 15.5
<0.001
2 34 11 19.6 23 32.4
≥3 37 5 9.0 32 45.1
Total 127 56 44.1 71 55.9
Medico-legal Update, January-March 2021, Vol. 21, No. 1 143
Table (3) Distribution of the birth weight according to the mothers previous obstetrical history
*After exclusion of primiparous (114) from total number (267), the remain number (153).
As shown in table (3), mothers who had delivered significantly increased in mothers with history of still
LBW babies previously, (68.3%) gave birth to LBW birth (77.1%), previous history of first week neonatal
babies again. The risk of giving birth to LBW babies death (57.4%) and history of infertility (61.4%).
Table (4) Distribution of the birth weight according to the mother attendance to antenatal care centers
LBW NBW
ANC attendance p-value
No. % No. %
Antenatal care
Absent 26 25.8 24 14.5
1 ≤0.001
Present 75 74.2 142 85.5
Total 101 37.8 166 62.2
Number of visits
1-3 35 46.7 11 7.7
2 4-6 21 28.0 51 35.7 <0.001
≥7 19 25.3 81 56.6
Total 75 31.9 143 68.1
144 Medico-legal Update, January-March 2021, Vol. 21, No. 1
LBW NBW
ANC attendance p-value
No. % No. %
Date of 1st visit
1st trimester 15 20.0 59 41.3
3 2nd trimester 26 34.7 44 30.8 <0.005
3rd trimester 34 45.3 40 27.9
Total 75 31.9 143 68.1
Iron-folate supplementation
No 58 77.3 58 40.6
4 <0.005
Yes 17 22.7 85 59.4
Total 75 31.9 143 68.1
As shown in table (4). Significant association was In our study, there is a significant association
found between the number of visits to ANC center and between cigarette smoking and delivering LBW neonate.
giving LBW-babies. The mothers who was not received This finding was consistent with the finding reported
iron-folate supplementation were significantly at higher byZheng et al 11.
risk of giving LBW babies.
Maternal pre-pregnancy weight status has an
Discussion important rule on fetal growth and the ability of the
placenta to supply essential nutrients to the fetus depends
In this study a significant association was observed on the nutritional status of the mother12. This study show
between the age and fetal growth were mothers less that women with low pre-pregnancy weight (<50 k.g)
than 20 years old gave birth to a LBW babies. Similar were more prone to deliver small babies. the same result
finding was observed by Althabe et al study7. This was reported byZ. He et al 13.
could be explained by the fact that such teenagers have
not completed their physical growth and the additional Maternal height also revealed significant association
caloric requirement of the pregnancy may create a with LBW babies, women whose height were less than
competition between the mother and the fetus for or = 150cm appeared to be significantly at higher risk of
nutrients. having LBW-babies. This might be explained by genetic
susceptibility. This result was in accordance with the
human health may be effected by environmental finding in study in 2015 in Nepal14.
exposures but no significant association was found
between residence and fetal growth. This is in agreement The LBW babies were more likely to be the first
with the study of Domple8. born baby. This might be explained by the fact that
multiparous women know more about how to deal with
The present study showed that as the maternal their pregnancy. This finding was similar to that found
educational level increases, the chance of delivering byRosy et al15.
LBW neonate decreases, the same result was reported
in Pakistan9. Result demonstrated that those mothers with low
SES were more prone to delivering LBW neonate when
working mothers were more prone to deliver LBW compared with high SES mothers. The logic explanation
neonates, this is partially may explained by the lack for this finding is that mothers with low SES may not
of the time needed for mother to rest and that exercise attended health care and with poor nutrition. This result
during work may reduce blood flow from the uterus to supports that reported by Rosy et al15.
the placenta. This result coincides with study carried out
in Tehran which illustrate that LBW among employed This study showed that there was a significant
mothers was 5 times more likely than unemployed association between short spacing and LBW babies. This
ones10. might be due to nutritional deprivation and incomplete
Medico-legal Update, January-March 2021, Vol. 21, No. 1 145
return of the maternal physiology to normal levels Conflict of Interest:
encountered among rapid conceivers. similar finding
were reported by other studies in India16. Source of Funding: Self
Mother with history of previous LBW delivery are Ethical Clearance: Not required
more likely to having LBW neonates in subsequent
pregnancy. This finding was also obtained byMvunta et
References
al17. The explanation of this finding may be due to the 1. World Health Organization. Global nutrition
persistence of socio-demographic factors like age, poor targets 2025: Stunting policy brief. World Health
nutritional and social status. Organization; 2014.
2. Ballot DE, Potterton J, Chirwa T, Hilburn N,
The study also clarified a significant risk of LBW
Cooper PA. Developmental outcome of very low
in pregnancy preceded by history of stillbirth or first
birth weight infants in a developing country. BMC
week neonatal death. This finding was compatible to that
pediatrics. 2012 Dec 1;12(1):11.
found by Feresu18.
3. Choudhary AK, Choudhary A, Tiwari SC, Dwivedi
Compared with infants conceived within 12 months R. Factors associated with low birth weight among
of trying, those conceived after a waiting time of 12 newborns in an urban slum community in Bhopal.
months have a higher risk of preterm birth and LBW19. Indian journal of public health. 2013 Jan 1;57(1):20.
Mothers with history of infertility were more prone to 4. Bharati P, Pal M, Bandyopadhyay M, Bhakta A,
deliver LBW-babies. This finding was in agreement with Chakraborty S. Prevalence and causes of low birth
the study of Wannous et al in Syria20. weight in India. Malaysian Journal of Nutrition.
Regarding previous history of abortion, no 2011 Dec 1;17(3).
significant association was found with LBW babies, this 5. Mahumud RA, Sultana M, Sarker AR. Distribution
finding support the finding detected in Syria20. and determinants of low birth weight in developing
countries. Journal of preventive medicine and
Prenatal care considered an important tools public health. 2017 Jan;50(1):18.
available to detect obstetric risk factors that may impact
6. Deshpande Jayant D, Phalke DB, Bangal VB, D
on optimal fetal development, and final birth weight21
Peeyuusha BS. Maternal risk factors for low birth
Mothers with no antenatal care, were more prone to
weight neonates: a hospital based casecontrol
deliver LBW babies this was in agreement with that
study in rural area of western maharashtra, India.
found by Howlader22.
National Journal of Community Medicine. 2011
The prevalence of LBW significantly affected Oct;2(3):394-8.
by micronutrient deficiencies during pregnancy, 7. Althabe F, Moore JL, Gibbons L, Berrueta M,
particularly iron and folate23. This study detected that Goudar SS, Chomba E, Derman RJ, Patel A,
nutritional supplementation with iron and folate during Saleem S, Pasha O, Esamai F. Adverse maternal
pregnancy was associated with reducing the risk of and perinatal outcomes in adolescent pregnancies:
giving LBW neonate. This finding was in agreement The Global Network’s Maternal Newborn Health
with that observed by Howlader22. Registry study. Reproductive health. 2015 Dec
1;12(S2):S8.
Conclusion 8. Domple VK, Doibale MK, Nair A, Rajput PS.
The study showed the maternal risk factors for LBW Assessment of maternal risk factors associated with
neonates were maternal age 20 years, low maternal low birth weight neonates at a tertiary hospital,
educational level, working mothers, smoking habit, Nanded, Maharashtra. Nigerian medical journal:
pre-delivery weight (less than 50 kg), maternal height journal of the Nigeria Medical Association. 2016
(≤150cm), low socioeconomic status and short-spacing Jan;57(1):37.
(1 year), less frequent and late visits to ANC-centers and 9. Dayanithi M. Low birth weight and premature
with no supplementation of iron and folate. Previous bad births and their associated maternal factors.
obstetrical history is a probable risk factor. Int J Community Med Public Health. 2018
Jun;5(6):2277.
146 Medico-legal Update, January-March 2021, Vol. 21, No. 1
10. Mahmoodi Z, Karimlou M, Sajjadi H, Dejman 17. Mvunta MH, Mboya IB, Msuya SE, John B, Obure
M, Vameghi M, Dolatian M, Mahmoodi A. J, Mahande MJ. Incidence and recurrence risk of low
Association of maternal working condition with birth weight in Northern Tanzania: A registry based
low birth weight: The social determinants of health study. Plos one. 2019 Apr 22;14(4):e0215768.
approach. Annals of medical and health sciences 18. Feresu SA, Harlow SD, Woelk GB. Risk factors
research. 2015;5(6):385-91. for low birthweight in Zimbabwean women:
11. Zheng W, Suzuki K, Tanaka T, Kohama M, a secondary data analysis. PloS one. 2015 Jun
Yamagata Z, Okinawa Child Health Study Group. 26;10(6):e0129705.
Association between maternal smoking during 19. Jaques AM, Amor DJ, Baker HG, Healy DL,
pregnancy and low birthweight: effects by maternal Ukoumunne OC, Breheny S, Garrett C, Halliday
age. PloS one. 2016 Jan 21;11(1):e0146241. JL. Adverse obstetric and perinatal outcomes in
12. Field ME, Anthony RV, Engle TE, Archibeque subfertile women conceiving without assisted
SL, Keisler DH, Han H. Duration of maternal reproductive technologies. Fertility and sterility.
undernutrition differentially alters fetal growth 2010 Dec 1;94(7):2674-9.
and hormone concentrations. Domestic animal 20. Wannous S, Arous S. Incidence and determinants
endocrinology. 2015 Apr 1;51:1-7. of low birth weight in Syrian government hospitals.
13. He Z, Bishwajit G, Yaya S, Cheng Z, Zou D, EMHJ-Eastern Mediterranean Health Journal, 7
Zhou Y. Prevalence of low birth weight and its (6), 966-974, 2001. 2001.
association with maternal body weight status in 21. Pinzón-Rondón ÁM, Gutiérrez-Pinzon V,
selected countries in Africa: a cross-sectional Madriñan-Navia H, Amin J, Aguilera-Otalvaro P,
study. BMJ open. 2018 Aug 1;8(8):e020410. Hoyos-Martínez A. Low birth weight and prenatal
14. Shakya KL, Shrestha N, Kisiju P, Onta SR. care in Colombia: a cross-sectional study. BMC
Association of maternal factors with low birth pregnancy and childbirth. 2015 Dec 1;15(1):118.
weight in selected hospitals of Nepal. Journal of 22. Howlader M, Hossain MS. MS Relationship among
Nepal Health Research Council. 2015 Dec 31. Antenatal Care Practices and Socioeconomic
15. Rosy N, Sultana N, Naher L, Pervin Z, Das SK, Factors with Birth Weight of Neonates in Dhaka
Islam MM, Khair MA, Arif KM. Risk factors of City. Journal of Gynecology and Women’s
low birth weight baby. Faridpur Medical College Health.;8.
Journal. 2018 Aug 24;13(1):31-4. 23. Elhassan EM, Abbaker AO, Haggaz AD, Abubaker
16. Fourie N, du Rand SM, Morton DG. Risks of MS, Adam I. Anaemia and low birth weight in
preterm labour among women who attend public Medani, Hospital Sudan. BMC research notes.
antenatal care clinics. Africa Journal of Nursing 2010 Dec;3(1):1-5.
and Midwifery. 2018 Jun 1;20(1):1-6.
DOI Number: 10.37506/mlu.v21i1.2296 Medico-legal Update, January-March 2021, Vol. 21, No. 1 147
Abstract
The current study was conducted to show the presence of heavy elements and pathogenic microorganisms
and the quality and validity of water and sediments in the household water tanks at the city center of Nasiriyah
and their suitability for household and drinking uses from the autumn 2019 to summer 2020. Physical,
chemical and biological checks of water were carried out in three stations, two selected stations located in
the center of Nasiriyah city (1- Erido 2- Al-Salhiya), and the third station, Al-Asalah, which is located in
Al-Shatrah district. Samples were collected monthly and quarterly, with three replications per station. The
study included measuring the temperature of air and water, the pH, salinity, turbidity, dissolved oxygen DO,
and the Biological Oxygen Demand BOD5. In addition, the concentration of four heavy elements (cadmium,
copper, lead and zinc) in the water was measured in its entirety. The study included measuring the TOC
content and mixing the sediment, and also the concentration of four heavy elements (cadmium, Copper,
lead and zinc) are completely sediment. The study also included investigation of bacterial contamination by
detecting the total numbers of aerobic bacteria, the number of coliform bacteria, the number of fecal coliform
bacteria, the numbers of fecal and Pseudomonas Aeruginosa bacteria in the water and sediments. The results
of the physical and chemical tests of water in the study stations showed that the values of air and water
temperatures ranged between (20.1-40) C and (17.50-30) C, respectively, and that the water of the studied
stations was basic as the pH values ranged between (7.00-8.20) The salinity values ranged between (485-
837) ppm, and the turbidity values were between (2.50-6.79) NTU. The dissolved oxygen values ranged
between (5.39-8.01) mg/liter, and the Biological Oxygen Demand BOD5 were between (2.93-8.5) mg/liter.
Keywords: Heavy elements, pathogenic, microorganisms, sediments, domestic water, tanks, AL-Nasiriyah
Table (1) showed the rates of the physical and chemical properties of the study stations water for the period
from Autumn 2019 until Summer 2020
• Sediment Total Organic Carbon Content increase in the carbon concentration of total organic
(TOC %): The statistical analysis revealed that matter in the sediments. Likewise, organic carbon in
there are significant differences between the stations. sediments increases with small grain size (silt) and
Human activities and natural processes lead to an has great affinity for new crystalline deposits(11).
Table (2): TOC% rates for study stations for the period from Fall 2019 until Summer 2020
• Volumetric Analysis of Sediment Particles: The quality of the sediment, as it affects the ability of
statistical analysis showed statistically significant the sediment to retain the ions of heavy elements,
differences of sediment mixture between the stations. organic matter and salts in quantitatively and
The results showed that the sediment mixture was qualitatively(12), the more small-diameter granules
Clay-silty in all the stations studied. The percentage are, the more quantities are preserved.
of soil plays an important role in determining the
St.1 St.2
Sand 10.3 17.5
Autumn Clay 48 50
Silt 41.7 32.5
Sand 5.1 6.2
Winter Clay 54.8 55.1
Silt 40.1 38.7
Sand 1.7 2.4
Spring Clay 50.1 56.7
Silt 48.2 40.9
Sand 18.1 22.4
Summer Clay 40.9 50.4
Silt 41 27.2
150 Medico-legal Update, January-March 2021, Vol. 21, No. 1
• Heavy Elements in Water: The results of the highest concentrations of elements were recorded in
current study showed that the average levels of the summer and the lowest in the fall. This may be
concentrations of heavy elements in the water for due to differences in water levels between seasons,
the three study stations of cadmium, copper, lead as high water leads to dilution and dispersion of
and zinc (5.32, 0.46, 0.00432, 0.0052) mg/liter, elements, and that the change in the level of water
respectively, as an input of heavy elements in the level It contains two-fold concentrations of heavy
aquatic environment changes over time, and the elements, for example, high water levels reduce
main factor that effects on this change in element the concentrations of heavy elements in the water,
concentrations is the receipt of water for untreated and their decrease leads to an increase in the
household, agricultural and industrial wastes, and the concentrations of these elements(13).
• Total Number of Aerobic Bacteria (TBC): associated with pathogenic bacteria, which is an
The results of the statistical analysis recorded the appropriate microbial indicator to determine the
presence of significant differences between the quality of drinking water due to its ease of detection
stations. This group represented mostly the bacteria and calculation(15).
that enter the water from sewage waste and the types
• Number of Fecal Coliform Bacteria (FC):
of bacteria that wash with the soil into water bodies
Statistically, significant differences were recorded
during the rainy and flood seasons, in addition to the
between stations except for the second and third
original bacteria present in the water and the types
stations. No significant difference was recorded
of pathogenic bacteria, including optional aerobic
between them. Bacteria E. coli is a fecal source due
and anaerobic bacteria(14).
to its permanent presence in human feces and other
• Total Coliform Bacteria Count (TC): The results mammals and birds in large numbers and is rarely
of the statistical analysis recorded the presence found in soil or water not contaminated with fecal
of significant differences between the stations. waste(16).
Coliform bacteria are usually found in the intestines
• Counts of Fecal Coliform Bacteria (FSb):
of human and warm-blooded animals and are
Statistically, a significant difference was recorded
Medico-legal Update, January-March 2021, Vol. 21, No. 1 151
between the stations, as no significant difference 8. Helfric L.A.; Jams, P. and Richard, N. Guide to
was recorded between the second and third stations. understanding and managing lakes, part 1, physical
The current study recorded the highest rates of measurement publication, (2005). PP: 420- 538.
fecal coliform bacteria in the first station during 9. Abdul-Jabbar, R. A and al-Lami, A. A and Rushdie,
the summer of 2020, and this may be due to the S. A. The concentrations of some elements in
previously mentioned reasons about the rates of the waters of the Tigris River and the Lower Zab
coliform bacteria and the plant itself. Seasonal tributary. Tikrit University Journal of Agricultural
changes also play a role in increasing the numbers Sciences, (2006). 67-56: (1) 6.
of this bacterium(17).
10. Al-Samarrai, B. A. M. An environmental and
Conflict of Interest: Nil microbial study of liquefied water in Salah al-Din
Governorate, Master Thesis, College of Science,
Source of Funding: Self Tikrit University, (2009). p. 122.
Ethical Clearance: Not required 11. Al-Aqili, N. H. The Environmental Reality of
Drinking Water in Baghdad Governorate. The
References specialized symposium towards healthy and safe
drinking water for the Iraqi citizen. Ministry
1. Al-Fatlawi, Y .F. Study of drinking water quality
of Higher Education and Scientific Research,
for some Baghdad water liquefaction projects. PhD
University of Baghdad, Market Research and
thesis, College of Science, University of Baghdad.
Consumer Protection Center.(2007).
College of Science.(2007).
12. Al-Asadi, W. M. Phenotypic and ecological study
2. Al-Jubouri, A.A. Study of microbial evidence
of Hydrilla verticillata (L.F) Royl. Master Thesis,
of biological pollution and some physical and
College of Science - University of Basra,(2009).
chemical factors on them of the waters of the Tigris
and Zab rivers in Hawija and Tikrit, Master Thesis, 13. Szymanowska, A.; Samecka,A. and Kempers, A.J.
College of Education, University of Tikrit(2005.). (1999). Heavy metals in three lakes in west Poland
Ecotoxicol – Envi. Saf. 43(1): 9 – 21.
3. Van den Broek, J.L.; Gledhill, K.S. and Morgan,
D.G. Heavy metal concentrations in the Mosquito 14. Al-awady, A.A.M. Concentrations of some trace
fish, Gambusia Holbrooke, in the manly Lagoon metals in water, sediments and two cyprinidae
Catchment. UTS Fresh water Ecology, Department species in Al-Masab Alamm, Al-Nassiriya, Iraq.
of Environmental Science, university of Ph.D. Thesis, College of Science for Women,
Technology, Sydney.(2002). Baghdad University.(2012). p 191
4. Al-Khafaji, B.Y. Preliminary survey of selected 15. World Health Organization (WHO). Guideline for
heavy metals in Al-Jubayla creek connected with Drinking Water Qality. (2nd Ed.). Health Criteria
Shatt Al-Arab River. Marina Mesopotamica. and other Supporting Information, Geneva.(1996).
(2000). 15(1): 69 -80. 16. Edberg, S.C.C.; Rice, W.W.; Karlin, R.J. and
5. Yi, L, Hong, Y, Wang, D and Zhu, Y. ‘Determination Allen, M.J. E. coli the best biological drinking
of free heavy metal ion concentrations in soils water indicator for public health protection. J. App.
around a cadmium rich zinc deposit’, Geochemical Microb., (2000). 88: 106-116.
Journal, (2007), vol. 41, no. 4, pp. 235-40 17. Gary, H.I. and Adams, J.C. Indicator bacteria in
6. Al-Lami, A. A. The water quality of the Tigris water and stream sediments near the snowy Range
sediments before and after the city of Baghdad - in Southern WYON Ming. Water, air and Soil
Iraq. Iraqi Journal of Biology, (2002). 296-289: (2) Pollution, (1985). 25 (2): 133-144
2. 18. Mena, K. D. and C. P. Gerba. Risk assessment of
7. Al-Zamili, T. F; Abdul-Hussein, M. A. Evaluation Pseudomonas Aeruginosa in water. Reviews of
of the physical and chemical properties of the Environmental Contamination and Toxicology,
waters of the DhiQar Marshlands. Al-Qadisiyah (2009) .vol. 201, Spring US, p: 71 – 115.
Journal of Pure Sciences, (2009). 14 (1): 182-191.
152 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2297
Abstract
This study was conducted to demonstrate the suitability of drinking tap water from different regions of
Kirkuk city byanalyzing some chemical and physical properties included (temperature, pH, turbidity, electric
conductivity, total soluble solids, total hardness, total suspended solids, nitrates, calcium, magnesium,
chloride, sulfate, sodium and phosphate) and eight heavy metals concentration including (Cd, Cr, Cu,
Fe, Zn, Ni, Mn and Mg) which have been detected in drinking water. The drinking tap water of Kirkuk
city processed by the Directorate of Kirkuk’s water for human consumption, all data compared with (IQS
417/2001) except for temperature. The results offered that the concentrations of 8 studied metals are little
than National Standards Organization of Iraq (IQS) except for (Ni) which is found to be high (12.267mg/L)
dose which not meet specifications, the results were analyzed using the analytic Jena AAS NOVAA 350.
The results of chemical and physical properties compared with drinking water standards displays that the
concentration of studied chemical and physical are little than the estimated levels that were announced by
the National Standards Organization of Iraq(IQS) except for two analysis(turbidity and total soluble solids)
were found to be highest rate(6.9NTU) and (79mg/L) respectively which does not meet specifications.
Kirkuk City (1) Gharnata. (2) Quria. (3) Hazir. (4) Shorja . (5) Shurau. (6) Raheem Awa. (7) Arafa. (8) Khadraa. (9) Wasty.
Table (1): Physiochemical parameters of drinking tap water from different regions in Kirkuk city
Region pH T (C◦) EC° (µs/cm) *TDS (mg/l) Turbidity (NTU) **TSS (mg/l)
Gharnata 8 20.9 388 179 5.9 69.3
Quria 7.8 20.6 386 177 6.4 73.7
Haziran 7.9 19.9 410 185 6.9 79
Shorja 7.9 20.2 386 175 6.1 71.3
Shurau 8 21.5 556 259.3 4.4 54
Raheem Awa 7.9 20.4 411 188 5.6 68.7
Arafa 7.7 24.2 397 195.3 4.8 58
Khadraa 8.1 20.6 410 188 6.5 68.3
Wasty 8 20.2 407 181.3 5.8 75
The PO4-3 of drinking tap water regions of Kirkuk as in table (2). The permissible limit of PO4-3 is given as
city, found to be higher value in Quria region and lower 3 mg/L by IQS/417, it conform to the specifications. The
rate in Shurau region, where the PO4-ranges between total hardness and Ca+2 of the above regions drinking tap
(1.323 – 2.383) mg/L with an overall mean of (1.7) mg/L water of Kirkuk city was measured and found that the
156 Medico-legal Update, January-March 2021, Vol. 21, No. 1
highest value in Shurau region and the lowest value in of Na+ is 200 mg/L and Cl- as 250mg/L by IQS/417, they
Raheem Awa region, where the total hardness is between conform to the specifications. The SO4-2 concentration
(178 – 195) mg/L with an overall mean of (183) mg/L, of the drinking tap water regions of Kirkuk city found
Ca+2 is ranges between (36 – 47.3) mg/L with an overall that the higher value in Shurau region and the lower
mean of (39) mg/L as clear in table (2), the permissible value in Raheem Awa region, where the SO4-2 ranges
limit of total hardness is given as 500 mg/L and Ca+2 is between (33.3 – 46) mg/L with an overall mean of (37)
concentration equal to 50mg/L by IQS/417 and it conform mg/L as in table (2), the permissible limit of SO4-2 is
to the specifications. The measuring Mg+2 of drinking given as (250) mg/L by IQS/417 and it conform to the
tap water in different regions of Kirkuk city cleared that specifications . The NO3- concentration was measured of
higher value in Khadeaa region and the lower value the drinking tap water regions of Kirkuk city and found
in Shurau. The Mg+2 ranges between (18.63 –21.83) that the higher value in Quria region and the lower value
mg/L with an overall mean of (20.94) mg/L as in table in Wasty region, where the NO3- ranges between (6.758
(2), the permissible limit of Mg+2 is given as 50 mg/L – 7.69) mg/L with an overall mean of (7.2) mg/L as in a
by IQS/417, note that it conform to the specifications. table (2), the permissible limit of NO3- is given as (50)
Measuring the Na+ and Cl- concentration of the drinking mg/L by IQS/417, it conform to the specifications. The
tap water of Kirkuk city, the results indicated that the concentration of Cu in the drinking tap water samples
Higher value were in shurau region and the lower value ranges from (0 - 0.526) mg/L with the average of
in Raheem Awa region, where the Na+ ranges between (0.2012) mg/L as in a table(3). The permissible limit of
(9.3 - 14.7) mg/L with an overall mean of (10) mg/L, and Cu is specified as 1 mg/L by IQS/417, it conform to the
Cl- ranges between (13.3 – 23.3) mg/L with an overall specifications.24
mean of (17) mg/L as in table (2), the permissible limit
Table (3): The values of (Cu, Ni, Zn) by Flame atomic absorption spectrometer of drinking tap water in
different regions of Kirkuk city:
The concentration of Ni in the drinking tap water tap water of Kirkuk city, did not reach the percentage
samples ranges from (0.9442– 12.267) mg/L with of Kirkuk city regions as in table (3). The permissible
the average of (6.5759) mg/L as in a table (3). The limit of Zn is given as 3 mg/L IQS/417 for drinking
permissible limit of Ni is given as 0.02 mg/L IQS/417 tap water. Each specimen was within the permissible
for drinking tap water, all samples did not meet the limits of IQS/417.26 The concentration of Fe in the
permissible limits of IQS/417. The high Ni concentration drinking tap water samples ranged from (0- 0.0205)
was sound in samples of Shorja, Huzairan and Quria mg/L with the average of (0.01907 mg/L) mg/L as in
regions and the lower region in Wasty region.25 The a table (4). The permissible limit of Fe is given as 0.3
concentration of Zn of the different regions drinking mg/L IQS/417 for drinking water. Each the specimens
Medico-legal Update, January-March 2021, Vol. 21, No. 1 157
were within the permissible limits of IQS/417. The high Khadraa, Arafa, Raheem Awa, Shurau and shorja of the
Fe concentrations were noticed in Gharntaa and Quria study regions.
samples of the study regions but there are not in Wasty,
Table (4): Measurement of (Cd, Mn, Fe) by Flame atomic absorption spectrometer of drinking
Gharnata 0.020503 0.000794 4.364667 N.D N.D N.D 0.00299 0.000033 1.162333
Quria 0.018338 0.003821 48.9585 N.D N.D N.D 0.003707 0.0000497 1.474667
Haziran 0.01837 0.01378 75.04 N.D N.D N.D 0.004415 0.0000477 1.081667
Shorja N.D N.D N.D N.D N.D N.D 0.00464 0.0000213 0.433667
Shurau N.D N.D N.D N.D N.D N.D 0.005815 0.000055 0.968
Raheem Awa N.D N.D N.D N.D N.D N.D 0.005989 0.0001017 1.678
Arafa N.D N.D N.D N.D N.D N.D 0.006336 0.000037 0.616667
Khadraa N.D N.D N.D N.D N.D N.D 0.007591 0.0000297 0.390333
Wasty N.D N.D N.D N.D N.D N.D 0.007587 0.0000577 0.767667
The concentration of Mn in the drinking tap water percentage in the different regions of Kirkuk city as in a
samples ranges from (0.00299- 0.007591) mg/L with table (4). The permissible limit of Cd is given as 0.003
the average of (0.005452) mg/L as in a table (4). The mg/L IQS/417for drinking tap water. Each the specimens
permissible limit of Mn is given as 0.1 mg/L IQS/417 were within the permissible limits of IQS/417. The Cr
for drinking water. Each the specimens were within levels of the drinking tap water regions of Kirkuk city
the permissible limits of IQS/417. The higher Mg did not get a percentage in the regions of Kirkuk city as
concentrations were noticed in samples khadraa and in a table (5). The permissible limit of Cr is given as 0.05
Wasty of the study regions and the lower rate in Gharnata mg/L IQS/417 for drinking water. Each the specimens
of the study region. The levels of Cdpresent in drinking were within the permissible limits of IQS/417.27
tap water of Kirkuk city appeared that did not get a
Table (5): Mg and Cr concentration by Flame atomic absorption spectrometer of drinking tap water of
Kirkuk city.
Magnesium Chromium
Region
mg/l SD RSD[%] Mg/l SD RSD[%]
Gharnata 0.450333 0.003441 0.770667 N.D N.D N.D
Quria 0.380933 0.003969 1.042 N.D N.D N.D
Haziran 0.5796 0.003767 0.745333 N.D N.D N.D
Shorja 0.450967 0.003913 0.803 N.D N.D N.D
Shurau 1.187667 0.016068 1.777 N.D N.D N.D
Raheem Awa 0.628867 0.002311 0.392333 N.D N.D N.D
Arafa 0.622 0.010647 1.579333 N.D N.D N.D
Khadraa 0.635067 0.006713 0.849 N.D N.D N.D
Wasty 0.3641 0.001564 0.431333 N.D N.D N.D
158 Medico-legal Update, January-March 2021, Vol. 21, No. 1
The level of Mg of the drinking tap water samples the reason for this relates to some of the interference that
ranges from (0.3641- 1.187667) mg/L with the average has been challenged due to the presence of some element
of (0.5888) mg/L as in a table (5). The permissible limit ions that lead to interference with the magnesium ion.28
of Mg is given as 50 mg/L IQS/417 for drinking water.
Each the specimens were within the permissible limits of Table (6) cleared the water quality characteristics
IQS/417. The higher Mn levels were noticed in samples according to Iraqi specifications, (minimum, maximum
Shurau and Khadraa of the study regions and the lower and average) concentration of heavy metals, chemical
value in Wasty of the study region. Likewise, Mg, Mg+2 and physical properties of drinking tap water sample of
was measured in search and these was a large difference the studied regions.
between atom-shaped Mg and ion-shaped magnesium,
Table (6): Classifying water quality characteristics of drinking tap water sample of the studied regions.
Blessy Mohandass1, Amanpreet Kaur2; Timsy2; Nitika Choudhary3, Shivani Rana3, Sonaly Robinson3
1
Nursing Tutor, 2Assistant Professor, 3B.Sc. Nursing IVth Year Students, Chitkara School of Health Sciences,
Chitkara University, Punjab, India
Abstract
Pregnancy is the most important and pleasurable moment in a woman’s life when along with the bliss
of motherhood, they also tend to gain extra weight. In the field of medicine, health, or physical fitness,
weight loss refers to a reduction of the total body mass utilizing various weight loss techniques. Gaining an
adequate amount of weight during pregnancy is essential, but it is also crucial that one should lose the extra
pounds to decrease the chances of obesity. The study was conducted to assess the strategies used by nursing
mothers to reduce their weight after pregnancy residing in rural and urban areas. The study was conducted
to find out the strategies adopted by nursing mothers for weight loss. A self-structured checklist having 27
items of common strategies used for weight loss was used to collect data from the participants. The results
revealed that nursing mothers residing in the urban area adopted a higher number of weight-loss strategies
as compared to nursing mothers residing in the rural area. The findings of the study that the nursing mother
residing in the urban area adopted more weight-loss strategies as compared to nursing mothers residing in
the rural area. Level of Evidence: Level III, Evidence obtained from well-designed cohort or case-control
analytic studies
Keywords: Diet, Exercise, Gestational Weight gain, Obesity, Postnatal Weight loss, Pregnancy,Weight Loss.
Table 2: Comparison of exercise as a strategy adopted for weight control by nursing mothers residing in
rural and urban areas N = 100
Exercise as a Strategy Area Yes (f) No (f) Chi Test ‘p’ Value df
Rural n=50 2 48
I go to a Gym 3.053 0.081NS 1
Urban n=50 7 43
Rural n=50 21 29
I mildly/moderately exercise 1.004 0.316NS 1
Urban n=50 26 24
Rural n=50 4 46
I do yoga 6.775 0.009* 1
Urban n=50 14 36
Rural n=50 35 15
I go for a walk 1.333 0.248NS 1
Urban n=50 40 10
Rural n=50 4 46
I go to dance classes 0.444 0.505NS 1
Urban n=50 6 44
Dietary Modification as a Strategy Area Yes f (%) No f (%) Chi Test ‘p’ Value
Ruraln = 50 26 24
I drink 8-10 glasses of water daily 2.667 0.102NS
Urbann = 50 34 16
Rural n = 50 36 14
I drink water before taking meals 9.180 0.002*
Urban n = 50 21 29
Rural n = 50 10 40
I consult a dietician 3.934 0.047*
Urban n = 50 19 31
Rural n = 50 13 37
I eat by Calorie calculation/Diet chart 0.051 0.822NS
Urban n = 50 14 36
Rural n = 50 32 18
I skip my meals 0.170 0.680NS
Urban n = 50 30 20
Rural n = 50 34 16
I take short and frequent meals 0.045 0.832NS
Urban n = 50 33 17
Rural n = 50 33 17
I eat at home than outside 0.421 0.517NS
Urban n = 50 36 14
Rural n = 50 21 29
I opt for high fibre diet 6.828 0.009*
Urban n = 50 34 16
Rural n = 50 13 37
I take green tea everyday 0.437 0.509NS
Urban n = 50 16 34
Rural n = 50 15 35
I have stopped taking Oily foods 5.911 0.015*
Urban n = 50 27 23
Rural n = 50 23 27
I have stopped taking Diary food items 0.367 0.545NS
Urban n = 50 20 30
Rural n = 50 26 24
I have stopped taking Sweet food 2.667 0.102NS
Urban n = 50 34 16
Rural n = 50 36 14
I have stopped taking Caffeine 9.180 0.002*
Urban n = 50 21 29
Lifestyle Modifications as a Strategy Area Yes (f) No (f) Chi Test ‘p’ Value
Rural n = 50 18 32
I take dinner in early evening 1.714 0.190NS
Urban n = 50 12 38
Rural n = 50 20 30
I take medications for weight loss 4.762 0.029*
Urban n = 50 10 40
Rural n = 50 11 39
I check my weight regularly 13.500 0.000*
Urban n = 50 29 21
Rural n = 50 20 30
I am motivated to reduce weight 16.667 0.000*
Urban n = 50 40 10
Rural n = 50 30 20
I sleep for 06-08 hours straight regularly 0.694 0.405NS
Urban n = 50 34 16
Discussion References
The investigator found that there was a non- 1. Dietary Guidelines - health.gov [Internet]. Health.
significant relationship between the numbers of gov. (2019) [cited 14 January 2019]. Available
strategies adopted for weight with socio-demographic from: https://health.gov/dietaryguidelines/2015/
variables. Investigators also find that the nursing mothers guidelines/. Retrieved 20 January 2019.
residing in the urban area adopted more strategies for 2. Blackburn GL, Walker WA. Science-based
weight control as compare to nursing mother residing solutions to obesity: what are the roles of academia,
in the rural area. A study of 2,464 in the U.S. similarly government, industry, and health care?–. The
found that the women who tried to lose or maintain their American journal of clinical nutrition. (2005) Jul
weight had adopted exercise more as a strategy than 1;82(1):207S-10S.
dietary changes. Women who were advised to maintain
3. Cold F, Health E, Disease H, Disease L, Management
or gain weight were less as compared to women who
P, Conditions S et al. The Mayo Clinic Diet Review
were trying to lose weight.[18]
[Internet]. WebMD. (2019) [cited 14 March 2019].
Conclusion Available from: https://www.webmd.com/diet/
features/the-mayo-clinic-diet»High-Protein Diet
The finding shows that the number of strategies for Weight Loss». Retrieved 13 January 2019
adopted for weight control by nursing mothers residing
4. Feingold KR, Grunfeld C. The effect of inflammation
in the urban area was higher than mothers residing in the
and infection on lipids and lipoproteins. In
rural area. Controlled trials can be conducted to evaluate
Endotext [Internet] (2019) Jan 8. MD Text. com,
the effectiveness of specific strategies.
Inc. Retrieved 21 January 2019.
Acknowledgment: We would also like to thank 5. Harmon K. Sleep might help dieters shed more fat.
Dr. Harmeet Kaur, Principal, Chitkara School of Health Scientific American. [Internet] (2010). Retrieved
Sciences, Chitkara University, Punjab, India, for her 20 January 2019.
unending guidance during the period of our study. 6. Institute for Quality and Efficiency in Health
Care. «Health benefits of losing weight». Fact
Conflicts of Interest: None
sheet, Informed Health Online. (2017) Institute for
Source of Funding: Self Quality and Efficiency in Health Care. Retrieved 27
June 2018.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 167
7. Lau DC, Douketis JD, Morrison KM, Hramiak IM, after weight loss. Clinical Science. (2013) Feb
Sharma AM, Ur E. (2006) Canadian clinical practice 1;124(4):231-41.
guidelines on the management and prevention of 14. Tate DF, Jeffery RW, Sherwood NE, Wing
obesity in adults and children [summary]. Cmaj. RR. Long-term weight losses associated with
2007 Apr 10;176(8):S1-3. prescription of higher physical activity goals. Are
8. LeBlanc, E; O’Connor, E; Whitlock, EP (2011). higher levels of physical activity protective against
«Screening for and management of obesity and weight regain?. The American journal of clinical
overweight in adults». Evidence Syntheses, No. 89. nutrition. (2007) Apr 1;85(4):954-9.
U.S. Agency for Healthcare Research and Quality 15. Thangaratinam S, Rogozińska E, Jolly K,
(AHRQ). Retrieved 27 June 2018. Glinkowski S, Roseboom T, Tomlinson JW, Kunz
9. Nedeltcheva A, Kilkus J, Imperial J, Schoeller D, R, Mol BW, Coomarasamy A, Khan KS. Effects of
Penev P. Insufficient Sleep Undermines Dietary interventions in pregnancy on maternal weight and
Efforts to Reduce Adiposity. Annals of Internal obstetric outcomes: meta-analysis of randomised
Medicine. (2010); 153(7):435. evidence. Bmj. (2012) May 17;344:e2088.
10. Pathak K, Soares MJ, Calton EK, Zhao Y, Hallett 16. Weight loss - Howling Pixel [Internet].
J. Vitamin D supplementation and body weight Howlingpixel.com. (2019) [cited 14 March 2019].
status: a systematic review and meta-analysis of Available from: https://howlingpixel.com/i-en/
randomized controlled trials. Obesity reviews. Weight_loss. Retrieved 13 January 2019.
(2014) Jun; 15(6):528-37. 17. Williams SG, Schmidt DK, Redd SC, Storms
11. Shick SM, Wing RR, Klem ML, McGUIRE MT, W. Key clinical activities for quality asthma
Hill JO, Seagle H. Persons successful at long-term care. Recommendations of the National Asthma
weight loss and maintenance continue to consume Education and Prevention Program. MMWR
a low-energy, low-fat diet. Journal of the American Recommendations and Reports. (2003) Mar; 52
Dietetic Association. (1998) Apr 1;98(4):408-13. (RR-6):1-8.
12. Strychar I. Diet in the management of weight loss. 18. Yeganeholadadam, N. Association between
Cmaj. (2006) Jan 3;174(1):56-63. Weight Discrimination and Program Adherence in
13. Sumithran P, Proietto J. The defence of body a Clinical Weight Management Program. (2016).
weight: a physiological basis for weight regain
168 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2299
Abstract
Nosocomial infections are diseases acquired within 48 hours or more of hospital admission or within 30
days of discharge. The objectives of the study were to assess the knowledge, attitude and practice regarding
nosocomial infection and their prevention among health care workers. To determine the relationship
between knowledge, attitude and practice regarding nosocomial infection and their prevention among health
care workers. To find out association between the knowledge, attitude and practice regarding nosocomial
infection and their prevention among health care workers. The research design selected for the study was
descriptive research design and a total 100 health care staff were selected as study sample tool was used
for data collection. Self-introduction was given and purpose of gathering the information and nature of
study was explained before taking information through non probability convenient sampling technique. A
self- structured questionnaire, consent was signed by participants. The result revealed that the most of the
health care staff 76(76%) had excellent knowledge regarding nosocomial infection and their prevention
less than half, 43(43%) had positive attitude regarding nosocomial infection and their prevention. On the
contrary, 74(74%) had excellent practice regarding nosocomial infection and their prevention. On applying
the spearman correlation test, relationship between knowledge and attitude was found to be significant
at p<0.05. Hence, researchers concluded that the present study was undertaken to identify the level of
knowledge, attitude and practice regarding nosocomial infection and prevention among health care staff in
selected hospitals of Punjab. The finding showed that majority of the participants had excellent knowledge
and practice. There were gaps in relationship between knowledge and practice and attitude which is found
to be not significant at p<0.05.
Table 2: Relationship between the knowledge, attitude and practice regarding nosocomial infections and
their prevention among healthcare staff N=100
Table 3: Association between knowledge of healthcare staff regarding nosocomial infections and their
prevention and selected socio demographic variables. N=100
Age
21-25 years 0 10 39
26-30 years 0 8 23 0.809 0.847NS 3 7.815
31-35 years 0 4 9
36-40 years 0 2 5
Gender
Male 0 12 49 1.606 0.205 NS 1 3.841
Female 0 12 27
Medico-legal Update, January-March 2021, Vol. 21, No. 1 171
Table 4: Association between Attitude of healthcare staff regarding nosocomial infections and their
prevention and selected socio demographic variables. N=100
Level of Attitude
Table
Variable Negative Neutral Positive Chi Test P Value df
Value
Attitude Attitude Attitude
Age
21-25 years 3 25 21
26-30 years 2 19 10 6.880 0.332 NS 6 12.592
31-35 years 1 6 6
36-40 years 0 1 6
Gender
Male 4 27 30 2.863 0.239 NS 2 5.991
Female 2 24 13
Highest Educational Qualification
Master 5 21 14
Graduate 0 22 21 9.851 0.131 NS 6 12.592
Diploma 1 2 5
Others 0 6 3
Numbers of years in Healthcare practice
≤ 1 year 1 16 9
1-5 years 4 22 20 6.321 0.388 NS 6 12.592
6-10 years 1 9 5
More than 10 years 0 4 9
172 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Level of Attitude
Table
Variable Negative Neutral Positive Chi Test P Value df
Value
Attitude Attitude Attitude
Have You Ever Received Occupational Recently any Training on
Universal Precautions?
0.350 0.839 NS 2 5.991
Yes 4 38 30
No 2 13 13
Maximum Score = 12 *Significant
Minimum Score = 0 NSNot Significant
Table 5: Association between Practice of healthcare staff regarding nosocomial infections and their
prevention and selected socio demographic variables. N=100
Level of Practice
Table
Variable Good Excellent Chi Test P Value df
Poor practice Value
practice practice
Age
21-25 years 0 10 39
26-30 years 1 8 22 4.150 0.656 NS 6 12.592
31-35 years 0 5 8
36-40 years 0 2 5
Gender
Male 0 15 46 1.617 0.446 NS 2 5.991
Female 1 10 28
Highest Educational Qualification
Master 1 5 34
Graduate 0 12 31 9.218 0.162 NS 6 12.592
Diploma 0 4 4
Others 0 4 5
Numbers of years in Healthcare practice
≤ 1 year 0 6 20
1-5 years 0 13 33 7.065 0.315 NS 6 12.592
6-10 years 1 2 12
More than 10 years 0 4 9
Have You Ever Received Occupational Recently Any Training on
Universal Precautions?
4.791 0.091 NS 2 5.991
Yes 1 22 49
No 0 3 25
Maximum Score = 12 *Significant
Minimum Score = 0 NS
Not Significant
Abstract
Cancer is a major health enigma all over the world. In Iraq, cancer caused a large number of deaths and
significant morbidity. Nevertheless, limited information is available on how cancer–related literature has
developed. This study aimed to analyzethe published research on cancer carried out by Iraqi authors by
assessing a bibliometric analysis. Data from 1955 to 2019 was retrieved from Scopus and Google Scholar.
The findings of the current study showed significant growth in recent research output regarding cancer,
particularly after the 2000s, and more than half of Iraqi publications were internationally published as 79.4%
of them. Breast cancer was the type of cancer most targeted by researchers in a percentage of (29%), and
the degree of collaboration of Iraqi authors was high(0.808) according to the Subramanyamin method.
This study is the first one to analyze Iraqi publications regarding cancer. Our results can help to direct a
national knowledge program, planning, and funding assessments. Moreover, to establish new national and
international organized collaborations.
Analysis of published researches regarding cancer in The annual growth of Iraqi publications regarding
Iraq was conducted to analyze the trends of publications. cancer is represented in Figure 1, A. Thegraph shows
that the number of publications remained low, followed
The Database Used: In this study data from Scopus by a steady phase until 2004. There was a noticeable
(Elsevier) was used. Also, Google was searched to sharp increase in the number of publications after
gather more articles that not present in Scopus. As well 2005, which reached a maximum of approximately 269
as Scopus and Google Scholar were dependent to collect publications in the last 4 years of the study period, and
the citation number of articles. represented 49.4 % of the published articles concerning
Bibliometric analysis was performed on March 2019 cancer by Iraqi authors. The statistical analysis of the
by downloading all the cancer papers related to Iraqi present finding confirmed the occurrence of highly
researchers published between 1955 and 2019, using significant differences (P-value= 0.024)between Iraqi
the keywords including ‘‘Cancer’’, ‘‘Malignancy’’, cancer publication before 2000 and that published after
‘‘Lymphoma’’, ‘‘Leukemia’’, “Tumor”and “Iraq’’. this year as in Figure 1,B.
176 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure 1. A. Distribution of publications by years, B. Comparison between number of publication before and
after 2000s.
Breast cancer was the type of cancer most targeted the other types of cancer as shown in Figure 2. There
by Iraqi researchers 29.04 %, followed by the articles that was a significant difference between the number of
cover: cancer as general,female reproduction system, publications regarding breast cancer and that related to
intestinal, and cell line as 17.27%, 6.6%, 6.06%,5.8% the other types of cancer (P<0.05).
respectively, and then the articles that focused on
Medico-legal Update, January-March 2021, Vol. 21, No. 1 177
Moreover,the current study revealed that the double authors as 17.4% %, these results are summarized
majority of articles were published by three authors as in Figure 3. The degree of collaboration of Iraqi authors
29.59 %, followed by a single researcher as 19.1, and was high as 0.808.
Regarding the relationship between the number of the articles that related to cancer patients of Baghdad
articles and location, the current finding showed that (13.7%), Kurdistan (11.3%), and Basrah (7.7%) as
most publications included all Iraqi patients and didn’t shown in Figure 4.
restrict to one area which reached 57.5 %,followed by
178 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Moreover, the majority of Iraqi articles regarding published in national journals (P <0.05). Also, the Asian
cancer was published in the international journal, in the pacific journal of cancer prevention and the journal of
percentage of 79.4 % compared to national journals as, Faculty medicine - Baghdad University have recorded
20.5 % as shown in Figure 5. The number of internationally as the journals with most publications.
published publications significantly differing from that
Concerning citations, the current results showed recorded. The highest citation of the publications was
that a total of 213 articles had citations and 331 papers 465 times, that captured by a study related to gastric
without citations as shown in Figure 6. The top twelve cancer, published in Gastroenterology in 2007.
research that ranked by the total number of citations has
Medico-legal Update, January-March 2021, Vol. 21, No. 1 179
Abstract
Covid-19 is a dreadful communicable disease which brought dramatic changes in the Education system
globally. Online zoom classes are conducted all over the world to teach and guide the students, so that the
academic year will not be wasted. The present study aims to explore the learning experience of nursing
students regarding online classes during Covid-19 lockdown periods and to associate the learning experience
of nursing students with the demographic variables. A single blinded quantitative study with purposive
sampling technique, 250 B.Sc. Nursing students were enrolled in this study. Demographic variables and 23
questions on teaching, learning and difficulties of online classes were used in a 5 point likert scale. Data was
collected by sharing the questions in Google dox format to the students. The result of the study revealed high
level of satisfaction with maximum score of 63.0 and minimum score of 26.0. This result was significant
with the mean value of 46.21 and the standard deviation of 7.32. The association of the learning experience
of nursing students with the demographic variables was significant with the year of study of the participants.
Hence the research hypothesis formulated in this study was proved.
Keywords: Covid-19, Online classes, Lock down period, Teaching, Learning, Difficulties, Nursing students
experience.
Table 1: Frequency and percentage distribution of 46.21 and the standard deviation of 7.32. Hence the
level of learning experience among nursing students. study is significant.
N = 250
The association of the learning experience of nursing
Learning Experience No. % students with their demographic variables was significant
Unsatisfied (1–21) 0 0 with the year of study of the participants. Other variables
like age, gender,course of study, device used by students
Satisfied (22–42) 71 28.4
to attend online classes, online media used by teachers
Highly satisfied (43–63) 179 71.6 were not associated with the demographic variables.
The above table reveals majority of the students
Discussion
179 (71.6%) were highly satisfied and 71 (28.4%) of the
students were satisfied with the on line classes done by The present study on assessing the experience of
the teachers. Nursing students about online classes during Covid -19
lock down period is the need of the hour. This is the first
Table 2: Assessment of mean and standard time the Nursing faculty and students of SRM College
deviation of learning experience score among of Nursing were exposed to online classes. It is believed
nursing students. N = 250 that during this lock down period students are having
many difficulties to understand the classes. There is no
Variables Score
motivation, no social interaction and the students are
Minimum Score 26.0 psychologically upset due to the distraction and lack of
Maximum Score 63.0 support at home. Some of the students have very poor
Mean 46.21 net work coverage and the students had head ache due
Standard Deviation 7.32 to continuous online education mode. The students were
convinced by the teachers and by weekly 3 classes and
The above table reveals high level of satisfaction individual phone calls and watsup messages students
with maximum score of 63.0 and minimum score of were happy to cooperate with the classes.
26.0. This result is significant with the mean value of
186 Medico-legal Update, January-March 2021, Vol. 21, No. 1
In this study 250 B.Sc. Nursing students participated. Source of Funding: Self
The findings of the present study revealed that majority
of the students 179 (71.6%) were highly satisfied and References
71 (28.4%) of the students were satisfied with the on 1. Shatakshi L, Nardav S. CoVid-19 Unmasking
line classes done by the teachers. The result of the study the new face of Education among the students’
revealed high level of satisfaction with maximum score studying at Graphic Era Hill University, Dehradun,
of 63.0 and minimum score of 26.0. This result was Uttarakhand, India. IJ Research Pharm Sci. 2020;
significant with the mean value of 46.21 and the standard 11(1):48-53
deviation of 7.32. The association of the learning
2. VeenaS, Sheetal M, Navita V. COVID 19 Lockdown
experience of nursing students with the demographic
Technology Adaption, Teaching, Learning,
variables was significant with the age group of the
Students Engagement and Faculty Experience in
participants. Hence the research hypothesis formulated
Banglore. Muktshabd. 2020; 10(4),698-702
in this study was proved.
3. Giorgi B, David K. Transition to Online Education
This result is supported by the study ofDr. Anjana in Schools during aSARS-CoV-2 Coronavirus
kannankara (2020) on E-learning the Best Bet during (COVID-19) Pandemic in Georgia. Pedagogical
lockdown. The study states that online learning will Research. 2020; 5(4) : 2-9
facilitate to face the challenge of working in this new 4. Daniel J. Education and the COVID-19 pandemic.
environment as well as embrace the new opportunities to 2020.
everyone. Hence, this study can be done in other areas of
5. Vikram R. J, Bagul TD, Sagar R A. COVID-19
education to facilitate the online education.10
era: students’ role to look at problemsin Education
Conclusion system during lockdown issues in Maharashtra. I J
Research and Review. 2020; 7(5): 328-33
The present study high light the success of the
6. Russell M. V, Simon J R, Helen C, Joseph W,
online teaching and learning programme of B.Sc.
Claire S, et al ., School closure and management
Nursing students during this Covid-19 pandemic period.
practices during coronavirus outbreaks including
The teaching faculty and the students has to adapt new
COVID 19: a rapid systematic review. 2020; 4 (5) :
learning method for the completion of the curriculum.
397-404
The parents has to help and motivate the students in
continuous learning process during this critical situation. 7. Wei B. COVID-19 and online teaching in higher
This study can be done in other areas of education to education: Human behavior and emerging
develop knowledge and confidence among the students. technologies. A case study of Peking University.
2020; 2 (2):
Acknowledgement: The Dean and team of Medical 8. Amit K. A, Srinivasan R. Impact of Pandemic
Surgical faculty conceived and designed the study and COVID-19 on the Teaching – Learning Process :
collected the data. Analysis was done by Mr. Arvind A Study of Higher Education Teacher Manages.
statistitian. Interpretation and drafting of the article was Indian journal of management. 2020; 13 (4) :43-56
done by Dr. T. Suseelal, P. Malarvizhi and Mr. P. Vijai
9. Vikram R. J, Tushar D, Bagul, Sagar R.A.
Daniel Raj. Dean, college of Nursing has done the final
COVID-19 Era: Students’ Role to Look at Problems
revision and approval of version to be published.
in Education System during Lockdown Issues in
Conflict of Interest: The authors declared no Maharashtra. India IJ Research and Review. 2020;
competing interest. 7 (5): 328- 33
10. Anjana K.E.-Learning: The Best Bet during lock
Ethical Clearance: Ethical approval was obtained
down. 2020.
from the SRM University research committee who
follows WHO standards and the 1964 Helsinki
declaration and its later amendments.
DOI Number: 10.37506/mlu.v21i1.2302 Medico-legal Update, January-March 2021, Vol. 21, No. 1 187
Abstract
Test anxiety among university graduate students is significant and generates public interest. Test anxiety leads
to cognitive symptoms such as racing thoughts, nausea, blankness and difficulty in retrieving information.
When stress is experienced in excess it contributes to anxiety before and during exams and eventually affects
academic performance.
Aim: The aim of the study is to evaluate the anxiety levels among occupational Therapy students during
various academic assessments.
Method: A total of 160 Occupational Therapy Students participated in this study. The Anxiety Inventory
was used to evaluate the anxiety level.
Results: The results indicated that anxiety affects students performance during theory & practical assessments
and was found to be statistically significant (p<0.0001).
Recommendation: It is suggested that the pattern of conducting examinations may be modified to reduce
student test anxiety.
Table I show that more students were in the age group of 19 and 20 yrs with mean age 19 ±0.92 years. of the
participants >65 % were females.
Table II: Comparison of Anxiety scores between Theory and Practical Assessments
Assessment Low score Moderate score High Score Chi-Square (x2) P Value
Table II indicates a high degree of anxiety level (High score > 36-50) among occupational therapy students
during theory and practical assessment. The results show statistically significant. (x2 = 24.223, p < 0.5).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 189
Table III: Comparison of test anxiety among Occupational students during Theory & Practical assessment.
Theory Practicals
Parameters t-test
(Mean±SD) (Mean±SD)
1. Do you have any viable signs of nervousness such as sweaty palms, shaky p = 0.1150
2.18±0.93 2.44 ± 1.00
legs, right before the test? t = 1.5946
p = 0.039*
2. Do you experience butterflies in your stomach before the exam 2.00±0.86 2.32±1.04
t = 2.0744
p = 0.0001 *
3. Do you feel nauseous before the exam? 1.49±0.87 2.90±0.94
t = 9.8069
p = 0.5672
4. Does your mind go blank before the test? 2.43±0.87 2.35±0.89
t = 0.5734
5. Do you remember the information that you blanked out in the exam hall p = 0.2253
2.41±0.82 2.60±0.93
and remember as soon as you get out of the exam hall? t = 1.2225
6. Do you feel panicked knowing that the exam is time-limited and get more p = 0.4566
2.20±0.80 2.11±0.87
nervous and write the exam worse t = 0.7483
7. Do you feel that you have done your test badly as soon as you leave the p = 0.0399*
1.93±0.60 2.15±0.88
exam? t = 2.0915
8. Do you feel nervous if the teacher stands next to you and then You can no p = 0.1290
2.01±0.92 2.23±0.92
longer answer the questions? t = 1.5348
9. Do you feel you take most of the time in answering the questions or to p = 0.6890
2.12±0.73 2.07±0.78
decide to hand in the paper or not? t = 0.4018
10. Do you feel constantly restless throughout the test (moving your feet p = 0.0183*
2.12±0.92 2.57±1.13
playing with your pen looking around the room and looking at the clock) t = 2.4123
P = 0.0864
11. Do you feel that the invigilator/teacher is watching you? 2.00±1.83 2.27±0.96
t = 1.7376
Abstract
Background: The 90-90-90 strategy to overcome the HIV/AIDS (Human Immunodeficiency Virus/Acquired
Immunodeficiency Syndrome) epidemic in the world still has challenges because 20% of people live with
HIV/AIDS (PLWHA) received anti retroviral (ARVs) are at risk of virological failure. This study describes
and analyzes the factors that influence the occurrence of virological failure in AIDS patients who have taken
ARVs.
Method: A hospital based cross-sectional study and retrospective medical record review in Dr. Soetomo
Teaching Hospital Surabaya from January 2017 until December 2018. Virological failure is plasma viral
load greater than 1000 copies/ml.
Result: According to data analysis for each variable, we used a CD4 (Cluster of Differentiation) cut-off
of 134 cells/μl and ≥ 20.5 months for virological failure. There was a statistically significant relationship
between CD4 cell count 95% CI (1.33-11,281) p 0.010 and duration of ARV (1,396-11.78) 95% CI p 0.01.
Summation of total score from both variables has a p value <0.001 which means the total score of the two
variables is significant as a predictor of virological failure. The total area of the ROC curve is 73.6% with a
sensitivity of 81.5% and specificity of 44.4%.
Conclusion: The duration of ARV consumption and CD4 cell count have an effect and can be an initial
evaluation of the occurrence of virological failure.
Group
Variable p-value
Failure n (%) Non Failure n (%)
Gender
Men 18 (35,2%) 33 (64,8%) 0,598
Woman 9 (42,8%) 12 (57,2%)
Education
Primary 21(38,9%) 33 (61,1%) 0,782
College 6 (33,3%) 12 (67,7%)
ARVs Regimen
FDC 15 (31,2%) 33 (68,8%)
Non FDC 12 (50%) 12 (50%) 0,132
Risk Factors
Unsafe Sex 23 (34,3%) 44 (65,6%)
0,062
Drug injections 4 (80%) 1 (20%)
Hepatitis C
Positive 2 (66,67%) 1 (33,3%)
0,136
Negative 5 (19,2%) 21 (80,8%)
Tuberkulosis
Positive 7 (53,8%) 6 (46,2%)
Negative 20 (33,8%) 39 (66,1%) 0,214
Table 3. Logistic Regression Analysis and Model Scoring for Plasma CD4 count and Duration ARV
Consumption
Picture 1. ROC Curve For Total Score of Plasma CD4 Count and Duration ARV Consumption
Abstract
Background: Applying the ethics in practice is more essential than just learning it. Any sought of misconduct
to the patient is not just an ethical issue but it will also degrade the professionalism and it brings a sense of
insecurity in patients and this will slow down the progress of treatment. So it is not only important to avoid
the ethical issues and misconduct but it is also necessary to stand against ethical issues that happen within the
organization that may done by colleagues or higher authorities without any dilemma. OBJECTIVE: This
study aims to find out the difficulties and dilemmas of the physiotherapist in ethical decision making and
disclosing the misconduct of their colleagues without any hesitation. METHODOLOGY: A close ended
questionnaire was used to assess the willingness of the student physiotherapist to expose the misconduct
which might be an internal or external disclosure. The questionnaire consisted of two clinical scenarios
which were most likely to arise in a work place. Each scenario consisted of 5 questions that rated the severity,
likelihood of confronting, internal disclosure, external disclosure to the association and external disclosure
to media. The scoring was based on five point likert scale. It was a study that was done with convenient
sampling method. The questionnaire was given to 100 Physiotherapy students in Chennai of both the sexes
who were willing to participate in the study.RESULT: From the statistical analysis, there is a significant
difference obtained for the likelihood of reporting the manager’s misconduct than colleague’s misconduct.
Also their willingness to report internally within the organization is greater than that of reporting externally
to the association and to the media.CONCLUSION: Ethics being a part of Physiotherapy curriculum, these
students have well understood the ethical and professional behavior and have good ethical acceptance.
Hence we conclude that the students do understand the seriousness of any misconduct of a therapist to the
patient and are willing to expose any misconduct they encounter to the internal or external environment.
Introduction and the organisation but it also involves the patient who
is actually affected, this will lead to deterioration of the
Whistle blowing is usually defined as the reporting
hospital’s fame. This will put the whistle blower at risk1,2.
“by organization members (former or current) of illegal,
All though whistle blowing is a moral behaviour, it will
immoral, or illegitimate practices under the control of
risk the life of the one who reports the misconduct. The
their employers to persons or organizations that may be
person who voluntarily reports the misconduct might be
able to effect action” 1. Reporting any sought of unethical
exploited and might end up in losing his livelihood1,4.
behaviour is more inevitable and essential in the field
Despite these consequences it is to be noted that those
of health sciences as it is concerned with human lives.
who are with high self-ideals are the one to report the
Whistle blowing largely helps in the reducing the rates
misconduct as they are ones intolerable to the unethical
of misconduct in future 2,3.But still blowing a whistle
behaviour4. It must also be noted that a person will
against the organisation or colleague or a superior is a
hesitate to report his friend if found guilty because of
major dilemma faced by an individual because when
their bond or because of the fear that they might get
blowing a whistle, it not only involves the whistle blower
caught one day5.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 199
When a person is dishonest or unethical during Chennai were selected as participants. Departmental
his student life then there are high chances that he will ethical committee approval was obtained. A total
be more deviant during his professional life 5. Any of 100 participants were aimed and a closed ended
unethical behaviour as a professional will lead to distrust questionnaire was sent as google forms. Students from
of patients and a sense of insecurity which in turn colleges without ethics as a part of curriculum were
reduces the progress in the patient condition that will excluded. Initially the participants were asked to fill the
lead to ending up of the professional’s career 6. This is demographic data that included the name, age, college
the reason why any sought of unprofessional behaviour they belonged to, and the year they were studying. The
has to reported and stopped immediately.Since ethical questionnaire consisted of 2 clinical scenarios and 5 set
acceptance begins at the college level7, it is important to of questions were asked under each scenario. The first
know level of ethical knowledge and their willingness scenario was related to colleague’s misconduct and the
to follow ethics and their ability to make decisions in second one was concerned with the misconduct by the
critical cases and their willingness to report the unethical higher official. The first question dealt with how far
behaviour that is either conducted by their superior or the students were able to understand the seriousness of
their colleague.Though this subject is of high importance the situation while the second question dealt with the
there are not enough researches done in India to find out student’s willingness to confront the misbehaviour to
about the ethical dilemmas and decision making related the one who committed it and insisting him to correct
to physiotherapy. Our study aims to find out how well what he did. Question 3 and 4 dealt with blowing whistle
the students are able to understand the seriousness of the to the internal environment. Question 5 is related to the
misconduct of the therapist to the patient and how willing blowing of whistle to the external environment. All the
are they to expose any misconduct they encounter to the questions were rated according to 5-point likert scale.
internal or external environment. Internal disclosure The answer for the first question ranged from “very
implies reporting misconduct to an higher authority serious” to “not serious at all”. The answers for the
within the organization. External disclosure implies remaining four questions ranged from “strongly agree”
reporting misconduct outside the organization such as to “strongly disagree”.
law enforcement or media
Results
Materials and Methodology The mean differences between the groups were
Based on the selection criteria only physiotherapy assessed using the paired sample’s test. The data were
students of UG final year, PG first and second year analyzed using SPSS statistical software, PC version
and interns those who were pursuing their degree in 20.0
Table 1: Comparison between the respondents’ scores for the two case stories regarding the severity of the
misconduct, the likelihood of taking action to change the situation and the indices of internal and external
whistle blowing.
Table 1 shows the comparison between the a non-significant difference (0.056) between the external
respondents’ scores for the two case stories regarding whistle blowing for colleague and director misconduct
the severity of the misconduct, the likelihood of taking in reporting to the media.
action to change the situation and the indices of internal
and external whistle blowing. From the scores obtained, Discussion
the likelihood of reporting director’s misconduct is The purpose of this study is to find out how well
higher than that of colleague’s misconduct. the students are able to understand the seriousness
Table 2 shows the comparison between the scores of the misconduct of the therapist to the patient and
of the internal and external whistle blowing to the how willing are they to expose any misconduct they
association and to media. From the scores obtained, the encounter to the internal or external environment.
likelihood for internal whistle blowing is higher than Totally 100 physiotherapy students with ethics as a
that of external whistle blowing. There is a significant part of curriculum were taken into consideration out of
difference (0.010) between the internal whistle blowing which 58 female and 42 male students have participated.
for colleague and director misconduct. There is a From the study it is found that the physiotherapy
significant difference (0.016) between the external students witnessed the situations that are harmful to the
whistle blowing for colleague and director misconduct patients to be very serious. In such situations, they are
in reporting to the physical therapy association. There is likely to report to the higher authorities in both cases
Medico-legal Update, January-March 2021, Vol. 21, No. 1 201
of misconduct by their colleague as well as manager. In future studies can be done with a comparison between
However the rate of likelihood to report varied between physiotherapy students and practitioners.
both the case stories. Hence there was a significant
difference obtained by the statistical analysis of the Ethical Clearance: Departmental Ethical clearance
obtained data. From the scores obtained the likelihood was obtained.
of considering the severity of misconduct, confronting Conflict of Interest: Nil
the person responsible for the wrongdoing, reporting the
misconduct to someone in workplace, to the association Source of Funding: Self
or to the media for the director’s misconduct was higher
than that of colleague’s misconduct. This shows that the References:
students give more importance to the interest of patient 1. Mansbach A, Kushnir T, Ziedenberg H, Bachner
rather than supporting the misconduct of colleague or YG. Reporting misconduct of a coworker to protect
manager. In situations where such misconduct arises a patient: a comparison between experienced nurses
their willingness to report seems to be expressed rather and nursing students. The scientific world journal.
than supporting the misconduct. Similarly the scores 2014;2014.
obtained for internal whistle blowing was higher than
2. Mansbach A, Bachner YG. Internal or external
that of external whistle blowing. The reason for this
whistleblowing: nurses’ willingness to report
might be because the students prioritize to report to the
wrongdoing. Nursing Ethics. 2010 Jul;17(4):483-
superior authority within the organization than disclosing
90.
it outside the organization8. Also Abraham Mansbach
et al., (2011) has stated that the students prefers and 3. Ray SL. Whistleblowing and organizational ethics.
follows a pattern of internal whistle blowing after which Nursing ethics. 2006 Jul;13(4):438-45.
the external whistle blowing is being is approached 4. C.Fred Alford. Ithaca, NY; Whistleblowers:
rarely9. Anna Myers., (2008) has also stated that it is Broken Lives and Organizational Power. Cornell
wiser to whistle blow first internally and then externally University press,2001 17pp.
outside the organization. It is more ethical and also 5. Abdulghani HM et.al, Self-reported cheating
being loyal to the organization10. While also expresses among medical studuents: An alarming finding in
that whistle blowing to an unethical or a deviant act is a cross-sectional study from Saudi Arabia,PLoS
a core component of an employee and that at all costs ONE(2018)13(3)
whistle blowing to root out a criminal activity which is
6. Paul S Mueller et.al, Teaching and Assessing
possibly harmful to the client or the reputation of the
Professionalism in Medical Learners and Practicing
institution must be encouraged11.
Physicians. Ramban Maimonides Med J 2015;6(2)
Conclusion 7. Dworkin TM, Baucus MS. Internal vs. external
whistleblowers: A comparison of whistleblowering
Ethics being a part of Physiotherapy curriculum, processes. Journal of business ethics. 1998 Sep
these students have well understood the ethical and 1;17(12):1281-98
professional behavior and have good ethical acceptance.
8. Abraham Manasbachet.al, Physiotherapy students
Hence we conclude that the students do understand
willingness to report misconduct to protect the
the seriousness of any misconduct of a therapist to the
patient’s interest J Med Ethics 2010 36:802-805.
patient and are willing to expose any misconduct they
encounter to the internal or external environment. 9. Mansbach A, Bachner YG, Melzer I. Physical
therapy students’ willingness to report misconduct
The limitation and recommendation of the study are to protect the patient’s interests. Journal of medical
The answer that was recorded by the participants was ethics. 2010 Dec 1;36(12):802-5.
just their interest and opinion towards whistle blowing 10. Myers A. How to blow the whistle safely, Nursing
as a student. But the actual response that they give when Standard (through 2013). 2008 Feb 27;(25):24
they are into the situations might vary. In future studies
11. Dungan J, Waytz A, Young L. The psychology of
can be done with a comparison between physiotherapy
whistleblowing. Current Opinion in Psychology.
students with and without ethics as a part of curriculum.
2015 Dec 1;6:129-33.
202 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2305
Abstract
Cardiovascular emergencies often occur suddenly, delays in treatment cause the condition to worsen. One
of the cases of cardiovascular emergency is acute myocardial infarction (AMI). AMI patients must have
stable hemodynamics in order to improve their condition. Management of nursing care that can be done to
maintain hemodynamic stability of AMI patients is the implementation of Phase 1 Cardiac Rehabilitation.
The purpose of this study was to analyze the effect of Phase 1 Cardiac Rehabilitation on Non-Invasive
Hemodynamics for Acute Myocardial Infarction Patients in the ICCU Room of Kediri Baptis Hospital. The
research design used a quasy experiment one group pre post test design. Population in this study were all
AMI patients who were treated in the ICCU Room of the Kediri Baptist Hospital who were taken using a
quota sampling technique with a sample size of 35 respondents. The instrument used was an observation
sheet including: systolic - diastolic blood pressure and heart rate. Phase 1 cardiac rehabilitation program
intervention was carried out for 2 consecutive days, with 2 training sessions/day (morning and evening).
Each training session with a duration of 15 minutes. The data analysis of this study used the Paried T-Test
statistical test. The results of this study showed that p = 0.026, p = 0.014 p <0.05 and that p = 0.024 p <0.05,
which means there is an effect of phase 1 cardiac rehabilitation on cytolic, diastolic blood pressure and
heart rate in acute myocardial infarction patients in the ICCU room of Kediri Baptist Hospital. Conclusion
Cardiac Rehabilitation Phase 1 has a significant effect on heart muscle function based on the results of blood
pressure checks seen from systolic and diastolic and heart rate. Where the greatest significance is on heart
rate compared to blood pressure.
Keywords: Cardiac Rehabilitation Phase 1, Non-Invasive Hemodynamics, Blood Pressure, Heart Rate.
Table 1. Statistical Test of the Effect of Phase 1 Cardiac Rehabilitation on Systolic Blood Pressure in Acute
Myocardial Infarction Patients in the ICCU Room at Kediri Baptis Hospital April - August 2020 (n = 35)
t df Sig. (2-tailed)
Difference in systole before intervention - difference in systole after
Pair 1 2.333 34 .026
intervention
Table 2. Statistical Test of the Effect of Phase 1 Cardiac Rehabilitation on Diastolic Blood Pressure in Acute
Myocardial Infarction Patients in the ICCU Room at Kediri Baptis Hospital April - August 2020 (n = 35
t df Sig. (2-tailed)
Difference of Diastole Before Intervention - Difference of Diastole After
Pair 1 2.590 34 .014
Intervention
Table 3. Statistical Test of the Effect of Phase 1 Cardiac Rehabilitation on Heart Rate in Acute Myocardial
Infarction Patients in the ICCU Room at Kediri Baptist Hospital April - August 2020 (n = 35)
t df Sig. (2-tailed)
Difference of Diastole Before Intervention - Difference of Diastole After
Pair 1 2.363 34 .024
Intervention
Medico-legal Update, January-March 2021, Vol. 21, No. 1 205
Based on table 1, the results show that p = 0.026 p This disorder can be asymptomatic (asymptomatic),
<0.05. Based on table 2, the results show that p = 0.014 mild, to severe. Heart attack (myocardial infarction)
p <0.05 and based on table 3, the results show that p is a serious disorder in which heart blood flow stops,
= 0.024 p <0.05, which means that there is an effect causing the death of some heart cells. Heart problems
of phase 1 cardiac rehabilitation on cytolic, diastolic are the number one cause of death in adults in developed
blood pressure and heart in acute myocardial infarction countries. The factors that trigger a heart attack are
patients in ICCU room Kediri Baptist Hospital. smoking, consuming high cholesterol foods, lack of
movement, and laziness to exercise, stress, and lack of
Discussion rest21. In coronary heart disorders, there are variations
Mortality and morbidity of cases of cardiovascular in the level of atherosclerosis, the degree of myocardial
emergencies often occur suddenly, delays in handling ischemia, impaired heart ventricular function, the
brought to the emergency room cause the condition frequency and degree of heart symptoms such as
to worsen. Cardiovascular disease is a disease that dysrhythmias, increased blood pressure and heart rate
involves the heart and blood vessels. Heart disease is response to exercise and fatigue22. These conditions
estimated to be the leading cause of death worldwide, need to be evaluated to estimate the risk of further
this is evidenced by the rapidly increasing prevalence infarction, cardiac arrest and heart failure. The clinical
of cardiovascular disease in developed and developing judgment regarding the exercise program, type and type
countries. The prevalence and incidence of this disease of exercise is mainly based on the calculation of the risk
is quite high and is increasing from year to year18. (prognosis) and the functional capacity of the patient.
Heart problems are health problems whose incidence Hemodynamic treatment in AMI patients aims to
has increased from year to year. One of the heart disorders improve oxygen delivery in the body which is affected
is Acute Myocardial Infarction (AMI). Globally, this is by (Cardiac Output/CO), hemoglobin (Hb), and oxygen
the first major cause of death in developing countries, saturation (SaO2). If oxygen delivery is impaired due
replacing the death rate due to infection, another to decreased cardiac output (CO), proper handling is
thing stated by Waly et al (2014) is that one of the needed, cardiac output is an important hemodynamic
cardiovascular diseases that is the leading cause of death variable and is often assessed by one of which is
in the world is Acute Myocardial Infarction (AMI). based on NIBP and on the calculation of MAP (Mean
The case fatality rate (CFR) of the IMA is the highest AeterialPresure), by measuring pressure. Blood and
compared to other heart diseases. Intensive systematic mean arterial pressure (MAP), can indicate conditions of
efforts are needed to prevent increased morbidity cases cardiac output. Hemodynamics is divided into 2, namely
that can be handled by cardiac rehabilitation programs. invasive and non-invasive. No invasive hemodynamics
Patients with heart problems need a comprehensive consists of indicators as a measure. Two of them are
rehabilitative program to develop post-attack physical blood pressure and pulse rate. High and persistent
abilities and prevent recurrent attacks. Heart disorders blood pressure will cause direct trauma to the walls
are pathological conditions in the heart where there are of the coronary arteries, thereby facilitating coronary
abnormalities that cause physiological disorders of the atherosclerosis. This causes angina pectoris, coronary
heart. insufficiency and myocardial infarction to occur more
frequently in people with hypertension than normal
IMA is a condition in which the blood supply to people23. High blood pressure is a risk factor for AMI.
a part of the heart stops so that the heart muscle cells Patients with high blood pressure experience an increase
die19. This situation refers to the process of damage to in after load which indirectly increases the workload of
the myocardial tissue of the heart which experiences the heart. Conditions like this will trigger left ventricular
necrosis due to inadequate blood supply so that coronary hypertrophy as compensation for increased after load
blood flow is reduced. The cause of decreased blood which ultimately increases the heart’s oxygen demand.
supply may be due to critical narrowing of the coronary (AMI) can occur repeatedly, this recurrent myocardial
arteries due to atherosclerosis or total blockage of the infarction is called recurrent acute myocardial infarction
arteries by embolism or thrombus. Therefore, in each because of uncontrolled risk factors or patient non-
case there is always an imbalance between the supply compliance in undergoing rehabilitation therapy.
and demand for cardiac oxygen20. Patients who have experienced an AMI attack are 50%
206 Medico-legal Update, January-March 2021, Vol. 21, No. 1
likely to experience a recurrent24. Recurrent AMI can exercise program can be carried out over a longer time
be prevented by controlling risk factors. Several studies interval. In general, the training program is divided into
have shown that secondary prevention, including risk inpatient and outpatient programs21.
factor control and pharmacological treatment, can
prevent the incidence of recurrent acute myocardial Inpatient training program can be carried out
infarction and reduce mortality and morbidity in patients from 48 hours after heart trouble as long as there are
with coronary heart disease25. Secondary prevention by no contraindications. Physical exercise is limited to
controlling one of them by controlling blood pressure. daily activities, such as hand and leg movements and
Secondary prevention is based on clinical evidence and changing postures. The exercise program usually takes
studies using control, large numbers of samples26-27. the form of supervised ambnulatory physical therapy.
In this phase, ECG monitoring is necessary to assess
Current medical treatment for AMI patients is the response to exercise. Training in this phase must be
generally carried out with pharmacological therapy according to the readiness of the team that can handle
and cardiac revascularization28. Revascularization an emergency situation if a heart attack occurs during
measures that have been well proven in patients with training. The benefits of physical exercise in this phase
AMI caused by atherosclerosis are CABG (Coronary are as additional surveillance material, train patients to
Artery Bypass Graft) surgery and PCI (Percutaneous be able to carry out activities in daily activities, and to
Coronary Intervention) procedures. AMI patients avoid negative physiological and psychological effects
who have undergone cardiac revascularization will on bedrest. The goals of this first phase of physical
undergo further action, namely cardiac rehabilitation. exercise must be tailored to the patient’s needs. Patients
The rehabilitation program for people with heart with low activity may only need physical exercise to
problems is a multi-phase program designed to treat support daily activities (ADL: activity of daily life).
heart problems, especially those with coronary artery Patients with better physical capacity can run an exercise
disorders. In this program, patients are trained to return program for tertiary prevention and follow a long-term
to life optimally and productively. This program is based program to increase cardiorespiratory endurance, body
on physiological, psychological, social, vocational and composition, and flexibility and muscle endurance30.
recreational knowledge. This program includes exercise
therapy, psychological counseling, and behavioral AMI patients need heart rehabilitation, so that they
therapy towards a healthy lifestyle. Lifestyle suggestions can return to an optimal condition physically, medically,
include quitting smoking, a diet high in fiber, low in fat psychologically, socially, emotionally, sexually, and
and stress management. vocally, cardiac rehabilitation is also useful for exercising
mobility and heart work and restoring conditions to meet
The rehabilitation program for AMI patients aims the needs of daily life. . If no cardiac rehabilitation is
to: (1) optimize the physical capacity of the body, done, the heart muscles periodically decrease activity,
(2) provide counseling to patients and families in expand ischemia or infarction and trigger repeated
preventing worsening and (3) help patients to return attacks, this can lead to death. The physical exercise
to physical activities such as before experiencing heart program is based on the patient’s level of awareness and
problems29. The physical exercise program is based individual needs. The important thing to note is that the
on the patient’s level of awareness and indindual exercise program should be monitored based on target
ground. The important thing to note is that the exercise pulse frequency, perceived exertion and prediction of
program should be monitored based on the target pulse METs. If there are symptoms of cardiac, orthopedic or
frequency. In addition, the rehabilitative physical neuromuscular disorders, it is necessary to review the
exercise program for people with heart problems aims exercise program31. Patients with heart disease can return
to optimize the physical capacity of the body, provide to being productive people in their environment so that
counseling to patients and their families in preventing a new approach is needed as an additional method that
worsening and helping patients to return to activities’ can improve the care for people with “coronary prone”,
physical as before experiencing heart problems15. States patients after myocardial infarction, and sufferers after
those contemporary training programs are directed coronary bypass surgery. This additional treatment
based on individual needs. In low-risk individuals, program is known as “Cardiac Rehabilitation”. This is of
an unsupervised exercise program can be carried out course very much in accordance with the National Health
immediately, whereas in high-risk patients, a monitored System (SKN) which states that health efforts must
Medico-legal Update, January-March 2021, Vol. 21, No. 1 207
cover promotive, preventive, curative and rehabilitative the use of a cardiac rehabilitation program, namely
aspects. early mobilization in the care of AMI patients, is
highly recommended. The impact if hemodynamics is
The cardiac rehabilitation program is one of the not monitored carefully during early mobilization will
non-pharmacological management of AMI patients. result in deterioration, shock and loss of consciousness.
AMI patients are the main indication that a cardiac Early mobilization will increase the work of the heart,
rehabilitation program is recommended32. Deaner the body tolerates it quickly. Therefore monitoring is
further explained that the cardiac rehabilitation program very necessary during early mobilization interventions
consists of four phases, namely phase I while the patient to prevent worse conditions. Critically ill patients
is in the hospital, phase II immediately after the patient generally have poor vascular elasticity, malfunctioning
is discharged from the hospital, phase III immediately feedback cycles and/or low cardiovascular reserves. For
after phase II is still under the supervision of the cardiac patients whose hemodynamic status is imbalanced, a
rehabilitation team, and phase IV is the term maintenance solution that can be suggested is to train the patient to
phase long. The rehabilitation program for AMI patients tolerate changes in position rather than leaving them in
aims to restore the optimal physical, mental, social and a supine position37. Hemodynamic instability is one of
vocational conditions. the challenges for nurses to mobilize critical patients.
AMI can indeed cause immobilization and To balance the risks and benefits of mobilization in
instability of hemodynamics, however, so that patients critical patients, nurses must determine the right type
avoid various complications due to immobilization of mobilization, pay attention to certain diseases, assess
and hemodynamic instability, it is still necessary to do risk factors, determine the time for mobilization sessions,
cardiac rehabilitation where cardiac rehabilitation is and reduce the speed of mobilization that can affect the
done in phase 1 because it is done after the patient does cardiovascular system response37.
not feel pain. Phase 1 cardiac rehabilitation should be The results showed that there was an effect of phase
given immediately in order to train the range of motion of 1 cardiac rehabilitation on systolic and diastolic blood
the joints, change position exercises (tilt, sit, and stand), pressure. Cardiac rehabilitation phase 1 has a significant
muscle strengthening exercises, static balance exercises association with changes in heart muscle function (seen
either sitting or standing. All exercises are carried out from blood pressure). This can be seen from the paried
in stages, according to the patient’s condition. Cardiac T-Test where the p-value is 0.026, 0.014 (p <0.05),
rehabilitation in critical patients can increase muscle meaning that there is a significant effect between phase
strength, reduce oxidative stress and inflammation, 1 cardiac rehabilitation on blood pressure. This can also
during activity or exercise will maximize 60% -75% be explained by the extent of changes that occurred in
oxygen intake and increase antioxidant production33. patients with AMI before phase 1 cardiac rehabilitation
The cardiac rehabilitation program currently developed intervention and after being given phase 1 cardiac
by nurses can improve not only physical and cardiac rehabilitation. According to WHO (2000), the diastolic
outcomes, but also mental and psychological well-being filling cardiac cycle is determined by the effective filling
before discharge from the hospital34. pressure and resistance in the wall. The ventricular
Phase 1 cardiac rehabilitation therapy is very muscles (preload), while the ability of systolic ejection
beneficial for AMI patients, however the implementation depends on the strength of the contraction of the
of cardiac rehabilitation by nurses must be based on the heart muscles (myocardium) against blood pressure
patient’s level of awareness and individual needs. In (afterload). Phase 1 cardiac rehabilitation can affect
addition, the important thing for nurses to pay attention blood pressure due to the efficiency of the work of the
to is that the cardiac rehabilitation program should be heart or the ability of the heart to increase according to
monitored based on blood pressure targets and perceived the changes that occur. Changes that occur can be in the
exertion35. This is very necessary to optimize the health form of heart rate, stroke volume, and cardiac output.
status of AMI patients. The results of previous research When performing phase 1 cardiac rehabilitation, blood
conducted by36 proved that the cardiac rehabilitation pressure will rise considerably, systolic blood pressure
program, one of which is early mobilization, can can rise to 150 - 200 mmHg from resting systolic pressure
reduce heart rate and does not cause changes in blood of 110-120 mmHg. Conversely, as soon as the physical
pressure. Therefore, based on the results of this study, exercise is finished, the blood pressure will drop below
208 Medico-legal Update, January-March 2021, Vol. 21, No. 1
normal and lasts for 30 - 120 minutes. Regular phase age. Cardiac rehabilitation in myocardial infarction
1 cardiac rehabilitation can lower blood pressure. The must be started immediately after the patient is stable
recommended frequency of phase 1 cardiac rehabilitation and continued for life41. Heart rehabilitation phase 1 is
is 3-5 times a week, with duration of 15-60 minutes of highly recommended in influencing and improving the
exercise once. Changes in blood pressure, among others, work of the heart42. From the above explanation, it can
occur because the blood vessels are dilated and relaxed be concluded that the phase of Cardiac Rehabilitation
(relaxes the blood vessels) as well as widening a water affects the pulse of a patient with AMI, because in
pipe will reduce water pressure. In this case, exercise can principle, every increase in one’s activity will be
reduce peripheral resistance. Changes in blood pressure followed by an increase in pulse, because increased
can also occur due to reduced pumping activity of the activity requires body metabolism. Thus, to meet
heart. The heart muscle in people who regularly exercise these metabolic needs, high oxygen is needed as well,
is very strong, so the heart muscle is also strong, 12 this need will be met by increasing the heart rate to
weeks of programmed physical exercise is more likely pump blood throughout the body that needs it. This
to cause significant changes in the work efficiency of study is supported by research conducted by40which
the heart compared to peripheral resistance. The results states that phase 1 cardiac rehabilitation has an effect
of this study are supported by research conducted by38 on hemodynamic status (pulse frequency) p <0.005.
which states that there is a significant effect on blood Another supportive study is43 which states that a cardiac
pressure with a p-value of 0.001 (p <0.05), other studies rehabilitation program can help increase pulse frequency
that support39 stated that the cardiac rehabilitation with a value of p = 0.040. In addition, the results of this
program was effective in encouraging an initial increase study are also supported by the research of39 stating that
in exercise capacity and a significant reduction in resting after rehabilitation, the case group showed a significant
systolic and diastolic blood pressure (p <0.001) and increase in the rehabilitation time of the heart in phase
research that40 stated that phase 1 cardiac rehabilitation 1 heart rate (p <0.001). There are also studies that have
had an effect on hemodynamic status (blood pressure: different results from this study, namely research that
Systole, diastole) p <0.005. has been conducted by38 states that there is a significant
effect on blood pressure with a pvalue of 0.001 (p <0.05).
The results showed that there was an effect of Phase 1 cardiac rehabilitation has no significant effect
phase 1 cardiac rehabilitation on the pulse rate (heart significant changes to the respondent’s heart rate.
rate). Cardiac rehabilitation phase 1 has a significant
association with changes in heart muscle function Conclusion
(seen from and pulse rate). This can be seen from the
paried T-Test where the p-value is 0.014 (p <0.05), Cardiac Rehabilitation Phase 1 has a significant
meaning that there is a significant effect between phase effect on heart muscle function based on the results of
1 cardiac rehabilitation on pulse frequency. The heart blood pressure checks seen from systolic and diastolic
rate is produced by the contraction of the heart muscle and heart rate. Where the greatest significance is on heart
as it pumps blood. A normal heart rate has a contraction rate compared to blood pressure.
period of 0.40 from the cardiac cycle. Cardiovascular Acknowledgments: We would like to thank the
regulation is seen immediately after exercise. This work Ministry of Research and Technology/National Research
also serves to transport the O2 needed by the muscles to and Innovation Agency, Deputy for Strengthening
contract during exercise. When the heart is at rest, the Research and Development for the research grant for
pulse will be less. The normal pulse rate is 60-80 beats Beginner Lecturers for Research Implementation in
per minute. O2 consumption by the heart muscle can 2020. We also do not forget to thank the respondents
be calculated by multiplying the pulse rate and systolic and all those involved in it.
blood pressure. Trained cardiac muscle requires less
O2 for any given load and requires less O2 for physical Conflict of Interest: None to declare
work or activity. Cardiac Rehabilitation Phase 1 is a
good form of exercise for cardiorespiratory fitness. The Source of Funding: Ministry of Research and
increase in pulse rate during activity should be between Technology/National Research and Innovation Agency
70-75% of the maximum pulse rate. Meanwhile, the Deputy for Research and Development Strengthening
maximum pulse rate is 220 as an absolute number minus for Fiscal Year 2020.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 209
Ethical Clearance: Ethical clearance from the Kedokteran EGC; 2005.
Health Research Ethics Commission (KEPK) STIKES 11. Huang, B. Yang, Y. Zhu, J. Liang, Y. & Tan H.
Kediri Baptis Hospital. This research has passed ethics Clinical Characteristic and short-Term Outcomes
with letter number 076/30/III/EC/KEPK-3/STRIKES in Patients with Elevated Admission Systolic Blood
WSBK/2020. Pressure After Acute ST Elevation Myocardial
Infraction: A Population-Based Study. Bmjopen.
Reference 2014;
1. Rubenstein, D., Wayne, D., & Bradley J. Lecture 12. RI. D. Pharmaceutical care untuk pasien penyakit
notes kedokteran klinis edisi ke-6. 2017. jantung koroner : fokus sindrom koroner akut,
2. Idris DNT. Pengaruh Rehabilitasi Jantung Fase 1 Jakarta. 2007.
terhadap tingkat kenyamanan dan kualitas hidup 13. PERKENI. Pedoman tatalaksana sindrom koroner
pasien AMI di Ruang IPI Rumah Sakit Baptis akut. 2015.
Kediri. http://repository.umy.ac.id. 2017; 14. Al TP et. Pedoman Tatalaksana Sindrom
3. Patrick J, Scanlon, David P, Faxon, James L, Koroner Akut, Perhimpunan Dokter Spesialis
Ritchie et al. (2013). ACC/AHA Guidelines for Kardiovaskuler Indonesia. 2010.
coronary angiography: A report of the American 15. Arovah NI. Program Latihan Fisik Rehabilitatif
college of cardiology/American Heart Association pada Penderita Penyakit Jantung. 2012.
Task force on practice guidelines (Committee
16. Piotrowicz, R., & Wolszakiewicz J. Cardiac
on coronary angiography). J Am Coll Cardiol.
rehabilitation following myocardial infarction.
2013;33(6):1756–824.
Cardiol J. 2008;15(5):481–7.
4. Rao, N., S. & Binbrek, A. S. Erythropoitein to
17. Lubis AC. Rehabilitasi Jantung Paska Infark
augment myocardial salvage induced by coronary
Miokard Departemen Kardiologi dan kedokteran
thrombolysis in patients with ST segment elevation
vaskular FK USU. 2009.
acute myocardial infraction. Am J Cardial.
2009;104:1035–40. 18. Waly, Muhammad, T., Pujo, & Listyanto P.
Prevalensi Pasien Infark Miokard Akut yang
5. Alan S, Mary Ann Bauman, Sallyann M, Gregg C,
Menjadi Cardiac Arrest di ICU/HCU RSUP Dr.
Willie L, Kim A et al. An Effective Approach to
Kariadi Semararang. J Stud Fak Kedokt Univ
High Blood Pressure Control. A Science Advisory
Diponegoro. 2014;
From the American Heart Association, the
American College of Cardiology, and the Centers 19. Pratiwi F, Inne., Rifqi, S., & Maharani N.
for Disease Control and Prevention. J Am Coll Komplikasi pada pasien infark miokard akut ST-
Cardial. 2014;63(12):1230. elevasi (STEMI) yang mendapat maupun tidak
mendapat terapi reperfusi. J Stud RSUP Dr Kariadi
6. Gosh, Nina. et al. Noninvasive cardiovascular
Semarang. 2011;
imaging in coronary artery disease. Imaging Med.
2010;2(3). 20. Prasetyo, R.D., Syafri, M. & E. No Title. J Kesehat
Andalas. 2014;6(4).
7. Sulistyowati. Pengaruh sudut posisi tidur terhadap
kualitas tidur dan status kardiovaskuler pada pasien 21. Ades PA. Cardiac rehabilitation and secondary
Infark Miokard Akut (AMI) di ruang ICVCU prevention of coronary heart disease The New
RSUD Dr. Moewardi Surakarta. 2015. England. J Med. 2001(345):12.
8. Sitorus, M.R.P., Ketaren, I., dan Yanti S. Simplified 22. Williams M. A. Exercise testing in cardiac
Clinical Electrocardiogram Score sebagai Faktor rehabilitation. Exercise prescription and beyond.
Prediktor Mortalitas pada Pasien Infark Miokard Cardiol Clin. 2001;19(3).
Akut di Intensive Cardiac Care Unit (ICCU) RSUD 23. TB A. Faktor risiko penyakit jantung koroner.
Dr. Soedarso. J Kedokt Yars. 2016;24(3):116–74. 2004.
9. Overbaugh KJ. Acute coronary syndrome. AJN. 24. LE. WS & R. Secondary prevention strategies for
2009;105(5). coronary heart disease. J Thromb Thrombolysis.
10. Price SA WL. Patofisiologi: konsepklinis 2010;29(8).
prosesproses penyakit. 6th ed. Jakarta: Buku 25. Clark, A.M., Hartling, L., Vandermeer, B., &
210 Medico-legal Update, January-March 2021, Vol. 21, No. 1
McAlister FA. Meta analysis: secondary prevention 35. Yenni, E., Nurchayati, S., dan Sabrian F. Pengaruh
programs for patients with coronary artery disease. Pendidikan Kesehatan Latihan Rehabilitasi Jantung
Ann Intern Med. 2005;143(9). terhadap Pengetahuan dan Kemampuan Mobilisasi
26. Antman et al. ACC/AHA Guidelines for the Dini pada Pasien Congestive Heart Failure (CHF).
Management of Patients With ST-Elevation J Online Mhs Bid Ilmu Keperawatan. 2015;2(1).
Myocardial Infarction. Circulation. 2004;110. 36. Asgari et al. of Early Mobilization Program on the
27. Smith F, Gordon K DS. Effective chronic disease Heart Rate and Blood Pressure of Patients With
management: patients’ perspectives on medication- Myocardial Infarction Hospitalized at the Coronary
related problems. Patient Educ Couns. 2007;65(3). Care Unit. Middle East J Rehabil Heal. 2015;2(1).
28. Majid A. Penyakit Jantung Koroner dalam: 37. KM V. Understanding CriticallyIill Patients’
Patofisiologi, Pencegahan dan Pengobatan Terkini. Hemodynamic Response to Mobilization: Using
Medan: FK Universitas Sumatera Utara; 2007. The Evidence to Make it Safe and Feasible. Crit
Care Nurs Q. 2013;36(1).
29. Jolliffe, J. A., K. Recs, R. S. Taylor, D. Thompson
N. O and SE. Exercise-based Rehabilitation for 38. Badriyah D. Rehabilitasi Jantung Post Sindrome
Coronary Heart Disease. Sport Med J. 2001; Koroner Akut untuk Memperbaiki Hemodinamik
dan EKG di Wilayah Taman Sidoarjo. Universitas
30. Marchionni, N., F. FattirolU, S. Fumagalli, N .
Muhammadiyah Surabaya. 2013.
Oldridge, F. Del Lungo, L. Morosi CB and GM.
Improved Exercise Tolerance and Quality of Life 39. Shabani, Ramin et al. Effects of cardiac rehabilitation
with Cardiac Rehabilitation of Older Patients after program on physical capacity, blood pressure, heart
Myocardial Infarction: Results of a Randomised, rate recovery and myocardial oxygen consumption
Controlled Trial. Circulation. 2003;107(17). in patients undergoing coronary artery bypass
grafting. Med Sci. 2011;21(2).
31. Lavie, C. J. RVM and ABL. No TitleBenefits of
Cardiac Rehabilitation and Exercise Training in 40. Listyaningrum C. Pengaruh Rehabilitasi Jantung
Secondary Coronary Prevention in the Elderly. Am Fase 1 Terhadap Perubahan Hemodinamik pada
Coll Cardiol. 1993;22(3). Pasien STEMI di Ruang ICU-ICCU RSUD
Dr. Soedirman Kebumen. Sekolah Tinggi Ilmu
32. Deaner SL. Depresive Symptoms And Problem
Kesehatan Muhammadiyah Gombong. 2018.
Solving As Predictor of Adherence To The Cardiac
Medical Regimen. 1999; 41. Roveny. Rehabilitasi Jantung setelah Infark
Miokard. J Tek. 2017;44(9).
33. Nofiyanto, M. dan Adhinugraha TS. Pengaruh
Tindakan Mobilisasi Dini terhadap Denyut Jantung 42. Rahmanti A. Mobilisasi Progresif terhadap
dan Frekuensi Pernapasan pada Pasien Kritis di perubahan Tekanan Darah Pasien di Intensive Care
ICU RSUD Sleman Yogyakarta. Media Ilmu unit. 2010;
Kesehat. 2016;5(3). 43. Anari et al. Effect of Cardiac Rehabilitation Program
34. Rifai, A., Hadisaputro S dan S. Pengaruh Mobilisasi on Heart Rate Recovery in Coronary Heart Disease.
Dini terhadap Perubahan Tanda-tanda Vital pada J Tehran Univ Hear Cent. 2015;10(4).
Pasien Infark Miokard Akut. LINK. 2015;11(1).
DOI Number: 10.37506/mlu.v21i1.2306 Medico-legal Update, January-March 2021, Vol. 21, No. 1 211
Divya Reddy Pannala1, S.M. Krishna Sagar2, Hemantha Rao Amara3, Harshini Deshapathi4
1
Assistant Professor, Department of Forensic Medicine RVM Institute of Medical Sciences, Siddipet, 2Assistant
Professor, Department of Forensic Medicine, Mahavir Institute of Medical Sciences, Vikarabad, 3Professor,
Department of Forensic Medicine, 4nd Year UG, RVM Institute of Medical Sciences, Siddipet
Abstract
World Health Organisation defined workplace violence as incidents where employees are abused, threatened,
assaulted or subjected to other offensive behaviour in circumstances related to their work. According to an
ongoing study by the Indian Medical Association, over 75% of doctors have faced violence at work, majority
of the cases were reported from emergency wards and Intensive Care Units. In the last decade, Governments
of 19 states in India have passed laws for the protection of physicians. However, the law is not being
effectively implemented either due to lack of awareness or resistance from administration. A questionnaire
based study was conducted on MBBS students to assess their level of awareness about violence on doctors
and protection laws. The knowledge among the students about these laws was very low, which could be
improved if the topic “Violence on Doctors” is included in the new competency based curriculum, separately
in Forensic Medicine subject.
Keywords: Awareness, violence, MBBS students, protective laws, competency based curriculum, doctors.
Results
Table 1: Awareness on violence
Variables Frequency %
Yes 404 99.8
On rise in incidents
No 1 0.2
All components 315 77.8
Combination of more than 2 components 70 17.3
Components of Violence
Single Component 13 3.2
None 2 0.5
Media 371 91.6
Family 2 0.5
Mode of awareness
Friends/Colleagues 27 6.7
Teachers/Professors in College 5 1.2
Assaults in Telangana state 377 93
315 (77.8%) students mentioned that physical as only verbal abuse, 5 (1.2%) of them it a combination
assault, psychological violence including verbal abuse, of physical and verbal abuse. 70 (17.3%) considered it
telephonic threats and warning gestures, damage to to be a varying combination of the components. 2 (0.5%)
medical equipment and damage to clinical establishment participants did not consider any of the components as
constitute as violence on doctors. 12 (3%) students violence on doctors.
considered violence as only physical assault, 1 (0.2%)
Variables Frequency %
Yes 166 41
Awareness of any National and State Laws protecting doctors
No 239 59
Yes 188 46.4
Special judicial Punishments
No 217 53.6
Yes 201 49.6
If punishments for Hurt or Grievous Hurt (as per IPC) would be
No 16 4
applicable for miscreants
Don’ Know 188 46.4
If punishments are different for assault on doctors from assault on Yes 125 30.9
other health care providers (nurses/paramedical staff)? No 280 69.1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 213
356 (87.9%) of the participants said that the existing of the students mentioned that punishments should
laws are not sufficient for protecting doctors whereas 7 vary based on the type and severity of violence and 60
(1.7%) of them think they are and 42 (10.4%) do not (14.8%) do not consider so.
know the answer to the question posed. 345 (85.2%)
Variables Frequency %
Yes 366 90.4
Conducting workshops and CME programs
No 39 9.6
Yes 401 99
Participation of student unions for public awareness
No 04 1
Abstract
Sixty four local isolated of Klebsiella spp. have been isolated from environment samples (soil and water).
These isolates were identified and diagnosis according to phenotype and biochemical tests. These isolates
were subjected to primary and secondary screening, to select the isolate with the highest laccase activity.
Fifteen isolates chosen from primary screening for screening their enzyme activity in secondary screening.
It has been found the Klebsiella(K7) has the highest productivity of the enzyme (12 Unit/ml).Klebsiella(K7)
isolate was diagnosis by Vitak 2 system, it was identified asK. pneumonia. The laccase purified was
characterization, the experiments showed that: The molecular weight of laccase was 120KD and the optimum
pH for the purified laccase activity was 4.5 and forstability was 6.5. the optimum temperature for enzyme
activity was 40oC,the enzyme showed that laccase lost 22, 23 and 20% of its initial activity at 20, 25 and
35°C, respectively.
Materials and Method ranged between (25,30, 35, 40, 45, 50, 55, 60, 65,70)˚C .
followed by incubation in ice bathfor 30min. The enzyme
ABTS plate screen assay: The isolates showing
activity was assayed using ABTS, and the relation
methyl orange degradation were further screened for
between remaining activity (%) toward temperature was
enzyme laccase, on this media which prepared by adding
plotted to determine the optimum temperature of laccase
0.2 mM ABTS and 0.1 mM CuSO4 (after filtering them)
stability.
in Mineral Salt Agar. Blue green oxidation zone around
the bacteria colony indicated the presence of laccase. Laccase Kinetics :Km, Vmax values determination:
Pre-steady state kinetic analysis was performed
Laccase assay: Laccase activity was monitored
using ABTS at different concentration (0.1, 0.15, 0.2,
by measuring the maximum absorption of oxidation
0.25,0.3mM) in 0.1mM of sodium acetate buffer at pH 5
of ABTS at 25ºC as a substrate. The reaction mixture
and estimate the enzyme activity, then the initial velocity
containing 1ml of crude enzyme and 1ml of ABTS
(Vo) value was estimated. The relationship between [1/
(0.2mM). The oxidation of ABTS was determined by
Vo] versus [1/So] was plotted to determine the Km and
measuring the absorbance at 420 nm. The blank mixture
Vmax values according to Lineweaver-Burk reciprocal
containing 1ml of sodium acetate buffer (0.1mM, pH5)
plot.
and 1ml of ABTS . Laccase activity was calculated as
follows:
Results and Discussion
Screening of Klebsiella pneumoniae Isolates
for Laccase Production: Out of sixty four Klebsiella
pneumoniae isolates, there were thirty isolates showed
Where: A: Absorbance at 420nm; V: Total volume a clear zone around the colony on methyl orange plate,
of reaction mixture in (ml); € : molar extinction these isolate further screened for enzyme laccase on
coefficient of ABTS =36000M -1cm-1; t:incubation time ABTs plate, it found that twenty one give a positive
(1min) and v: volume of enzyme used in (ml)[10]. Protein results . The activity of the enzyme of the fifteen isolates
concentration was assayed by the method of Bradford[11]. of K. pneumoniae, that have ability to produce laccase,
was measured to select the highest isolation activity for
Effect of pH on Enzyme Activity: The effect of
choose the isolate that have the highest activity (Table
pH on the activity of the laccase was determined at
1). The laccase activity was monitored by measuring
37°C in 0.05M Tric-HCl buffer (pH 3,3.5,4,4.5,5,5.5,
the maximum absorption of oxidation of ABTS as a
6) 0.05 M sodium phosphate buffer (pH 6.5,7,7.5,8) and
substrate.
0.05M Tris-base buffer (pH 8) . The laccase activity
was determined at different pH (4-9) by mixing 1ml of Table (1) : Screening the Klebsiella pneumoniae
ABTS with 1ml of purified enzyme and the activity was producing Laccase enzyme.
measured with different buffers.
Klebsiella pneumoniae Isolates Enzyme activity (Unit/ml)
Effect of pH on Enzyme Stability: The effect of
K1 8.23
pH on laccase stability was examined by adding 1ml of
K2 7.60
enzyme of to a test tubes containing buffer at different
K3 10.23
pH (3, 3.5, 4,4.5, 5,5.5,6, 6.5,7,7.5,8), and incubated
30min at 37oC in a water bath, then added the ABTS to K4 10.06
mixer and measured the activity with different buffers. K5 9.37
K6 6.57
Effect of Temperature on Enzyme Activity: The
K7 12
temperature profile of the purified enzyme was studied by
K8 6.78
measuring the activity at different temperatures (25,30,
35, 40, 45, 50, 55, 60) ˚C . The purified laccase solution K9 7.83
was incubated with ABTS in different temperatures for K10 9.54
10 min and the activity was determined. K11 6.97
K12 7.94
Effect of Temperature on Enzyme Stability: The
K15 7.21
purified laccase was incubated at different temperature
218 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Molecular Weight Determination: The moleculare molecular weight of laccase from Bacillus sp. WT to be
weight of purifed laccase was determinaed by Gel 180KD and Verma and Shirkot[15] purified laccase from
filtration chromatograph, which depending on the size GeobacillusthermocatenulatusMS5 with molecular
of the separated molecules with their charge[12], using weight 42.5KD.By using another different substrates of
Sephacryl S-200. The results in Figure (2) shows the laccase the molecular weight was estimated.
relationship between logarithm of molecular weight
and (Ve/Vo) of four different standard proteins in gel Effect of pH on Enzyme Activity: The optimum
filtration column include Catalase (232KD), Arginine pH for laccase activity was determined with ABTS as
Deaminase (125.892KD), Bovine Serum albumin substrate in a pH range of (3-7) . As results in Figure
(67KD) and Pepsin (34.5KD), these proteins and laccase (1), it was found that the best pH of laccase activity
were eluted individually. The results in indicated in ranged between (4,4.5 and 5), with a maximum and
that laccase has a molecular weight of (120KD). The sharp decline in enzyme activityat pH 4.5 with enzyme
molecular weight of laccase was determined which activity (2.8 U/ml).While, observed that enzyme activy
that purified from c-Proteobacterium JBBy using was reduced at nearly acidic pH (3,3.5) and at alkaline
ABTS as substrate[13]. Also, Siroosiet al.[14] estimated pH (5.5-7).
Verma and Shirkot[15], and Liu et al.[16] were purified to the balance between the two opposing effects, first
laccase from Pseudomonas aeruginosa, Ochrobactrum. the redox potential difference between the substrates
sp.531 and Thermu- thermophilus SG0.5JP17-16, and type 1 copper site and second binding of hydroxide
receptivity by using ABTS as a substrate, found that the anion (OH-) to the type 2/type 3 copper site[18].
optimum pH of laccase activity was at 4.5. The optimum
pH on laccase activity was at 4.5, which purified Effect of pH on Enzyme Stability: Figure (2)
fromTrametes versicolor .[17] shown that the optimum pH of laccase stability ranged
between 6-7 and the a maximum stability was at pH 6.5,
Compared to phenolic substrates, the redox potential where the enzyme retained 100% of its activity. While,
of ABTS does not depend on the pH, oxidation does not retained 94.42% of its activity at pH 6 and about 94.42%
involve the protons . So, the effect of pH on the laccase and 82.03% at pH 7.
activity towards the different substrates could be related
Medico-legal Update, January-March 2021, Vol. 21, No. 1 219
The reason for decreasing in enzyme stability at Effect of Temperature on Enzyme Activity:
acidic pH is due to the effect of acidic environment in The temperature profile of the laccase was studied by
enzymatic structure which cause ionizing groups in measuring the activity in a range of 25–60oC with 5°C
active site. The declining in enzyme activity at pH above interval. The results in Figure (3) showed an increase in
the optimum pH may be due to irreversible denaturation laccase activity towards 40°C with an activity of 3.17 U/
of enzyme molecule that leads to change in enzyme ml. After 40°C the activity decrease and the minimum
structure associated with the formation of enzyme activity was recorded at 60°C which was 2.5 U/ml.
dimerization that leads to enzyme autolysis[19].
Most cold-adapted enzymes exhibit poor thermal general, laccases are stable at 30-50oC and rapidly lose
stability at temperatures above 40°C, and their activity activity at temperatures above 60oC[25].
decreases as temperature increases.[24]
Determination Km, Vmax Values: As shown in
The reduction of activity above 40°C is due to Figure (5) relation between substrate concentration
sensitivity to high temperature, reflecting the effect ABTS and enzyme activity. Activity was measured at
of temperature on the three dimensional structure of different ABTS concentrations (0.1, 0.15, 0.2, 0.25 and
protein by damaging R-groups of amino acids which 0.3mM) in 0.1mM of sodium acetate buffer at pH 5.
lead to denaturation of protein and losing its activity. In
Medico-legal Update, January-March 2021, Vol. 21, No. 1 221
Figure (5): Lineweaver-Burk double reciprocal plot of (1/Vo) versus the [So] for the purified laccase.
Singhal et al.[34] characterized laccase enzyme α-cellulose fibers super-magnetized and chitosan
activity produced by Cryptococcus albidus, ABTS functionalized for covalent laccase immobilization.
was used as a substrate. By Michaelis–Menten kinetics Bioresource Technology, 2018; 261:420–427.
the Km was 0.8158 mM and Vmax was 1527.74 U/mg. 2. Guan, ZB, Shui, Y, Song, CM., Zhang, N, Cai,
The Km of laccase purified Bacillus subtilisCotA by YJ. and Liao, XR. Efficient secretory production
Martins et al[7] was 0.106mM. Laccase purified from of CotA-laccase and its application in the
K. pneumoniae by using ABTS as substrate. The Km decolorization and detoxification of industrial
values were 0.467, 3.97 and 0.38mM for NITW715076, textile wastewater. Environmental Science and
NITW715076_1 and NITW715076_2 K. pneumoniae Pollution Research, 2015; 22:9515–9523.
strains, respectively[26].
3. Guan, ZB, Liao, Q, Wang, HR, Chen,Y and Liao,
XR. Bacterial laccases: promising biological green
Conclusion
tools for industrial applications. Cellular and
K. pneumonia have been proved to its ability to Molecular Life Sciences;2018; 75:3569–92.
produce laccase. And The molecular weight of laccase 4. Brisse, S, Issenhuth-Jeanjean, S and Grimont, P.
was determined at 120KD. The optimum pH of enzyme Molecular serotyping of Klebsiella species isolates
activity and stability is 4.5 and 6.5, receptivity. The by restriction of the amolified capsular antigen gene
optimum temperature for laccase activity is 40oC while cluster. Journal of Clinical Microbiology, 2004; 42:
forstability is (20- 35oC). 3388-3398.
Conflict of Interest: The author knows of no 5. Sharma, P, Goel, R and Capalsh, N. Bacterial
financial interest or any conflict of interest relative to laccase, World Journal of Microbiology and
this article. Biotechnology, 2007; 23: 823-832
6. Clive, D. A guide to protein Isolation. Kluer
Funding: Self
Academic Publisher. New York, USA 2002, 1-186.
Ethical Clearance: Not required 7. Martins, LO. Soares, CM; Pereira, MM, Teixeira
MT, Costa, GH and Henriques, AO. Molecular
References and biochemical characterization of a highly
stable bacterial laccase that occurs as a structural
1. Ghodake, GS, Yang, J, Shinde, SS, Mistry, BM,
component of the Bacillus subtilis endospore coat.
Kim, DY and Sung, JS, et al. Paper waste extracted
222 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Journal of Biological Chemistry,2002; 277: 18849- 17. Litwińska, K, Bischof, F, Matthes, F, Bode,
18859. R,Rutten, T and Kunze G. Characterization of
8. Suzuki, T, Endo, K, Ito, M,Tsujibo,H, Miyamoto,K. recombinant laccase from Trametes versicolor
and Inamori, YA, Thermostable laccase from synthesized by Arxulaadeninivorans and its
Streptomyces lavendulae REN-7: purification, application in the degradation of pharmaceuticals.
charac- terization, nucleotide sequence and AMB Express, 2019; 9:102.
expression . Bioscience, Biotechnology, and 18. Xu, F. Effects of redox potential and hydroxide
Biochemistry, 2003; 67:2167–2175. inhibition on the pH activity profile of fungal
9. Shi, X, Liu, Q, Ma, J, Liao, H, Xiong, X, Zheng, laccases. Journal of Biological Chemistry, 1997;
K, Wang, T, Liu, X, Xu, T, Yuan, S, Zhang, X and 272: 924-928.
Zhu, Y. An acid-stable bacterial laccase identified 19. Abdulah AR. The use of partially purified laccase
from the endophyte Pantoeaananatis Sd-1 genome produced by some fungal isolates in Aflatoxin
exhibiting lignin degradation and dye decolorization B1 degradation. M.Sc. Thesis in Biotechnology,
abilities, Biotechnol Lett,2015; 37:2279–2288. University of Baghdad College of Science
10. Liu, L, Lin, Z, Zheng, T, Lin, L, Zheng, C. and Lin, Department of Biotechnology.2008.
Z. Fermentation optimization and characterization 20. Siroosi, M, Amoozegar, MA and Khajeh, K.
of the laccase from Pleurotusostreatus strain 10969. Purification and characterization of an alkaline
Enzyme and Microbial Technology,2009; 44: 426– chloride-tolerant laccase from a halotolerant
433. bacterium, Bacillus sp. strain WT. Journal of
11. Bradford, MM. A rapid and sensitive method for the Molecular Catalysis B: Enzymatic, 2016; 134:89–
quantitation of microorganism’s protein utilizing 97.
the principle of protein-dye binding. Analytical 21. Demissie, AG and Kumar, A Isolation of novel
Bioch, 1976, 72: 248-254. bacteria isolate from soil for production of
12. Segel, IH. Biochemical calculations,JohnWiely extra-cellular laccase enzyme. International
and sons.NewYork.2nd edition.1976; pp34. Journal of Emerging Technology and Advanced
Engineering,2014; 4:404–407.
13. Singh,G. Ahuja, N, Batish, M,Capalash, N.
and Sharma, P. Biobleaching of wheat straw- 22. Dhiman, K and Shirkot, P. Bioprospecting and
rich-soda pulp with alkalophilic laccase from molecular characterization of laccase producing
γ-proteobacterium JB: Optimization of process bacteria from paper mills of Himachal Pradesh.
parameters using Response Surface Methodology. Proceedings of the National Academy of Sciences,
BioResources Technology, 2008; 99, 7472–7479. India, Section B,2015; 85:1095–1103.
14. Siroosi, M, Amoozegar, MA and Khajeh, K. 23. Ke, MM, Ramesh, B, Hang, YA and Liu, ZD.
Purification and characterization of an alkaline Engineering and characterization of a novel low
chloride-tolerant laccase from a halotolerant temperature active and thermo stable esterase from
bacterium, Bacillus sp. strain WT. Journal of marine. Enterobacter cloacae. International Journal
Molecular Catalysis B: Enzymatic, 2016; 134:89– of Biological Macromolecules,2018; 118, 304–310.
97. 24. Xu, F. Effects of redox potential and hydroxide
15. Verma, A and Shirkot, P. Purification and inhibition on the pH activity profile of fungal
characterization of thermostable laccase from laccases. Journal of Biological Chemistry. 1997;
thermophilic Geobacillusthermocatenulatus MS5 272: 924-928.
and its applications in removal of textile dyes Sch 25. Singhal, A, Choudhary, G and Thakur, I.
Acad.Journal of Biosciences, 2014; 2:479–485. Characterization of laccase activity produced by
16. Liu,Q, Luo, L, Wang, X, Shen, Z and Zheng, L. Cryptococcus albidus. Preparative Biochemistry
Comprehensive analysis of rice laccase gene and Biotechnology,2012; 42(2).
(OsLAC) family and ectopic expression of 26. Gaur, N, Narasimhulu, K and Setty, YP. Extraction
OsLAC10 enhances tolerance to copper stress in of ligninolytic enzymes from novel Klebsiella
Arabidopsis. International Journal of Molecular pneumoniae strains and its application in wastewater
Sciences,2017; 18:209. treatment. Applied Water Science,2018; Vol.8.
DOI Number: 10.37506/mlu.v21i1.2308 Medico-legal Update, January-March 2021, Vol. 21, No. 1 223
Transformation of the
Social Insurance Management Agency on Health
Abstract
Health insurance is a type of insurance product that specifically guarantees the cost of health or care of
the insurance members if they are sick or have an accident. Implementation of social security is a state
obligation mandated by the 1945 Constitution. The issuance of the Social Insurance Management Agency
(BPJS) act as the implementer of the National Social Security System act (SJSN) resulted in PT Askes
transforming into Social Insurance Management Agency on Health (BPJS Kesehatan). The National Social
Security System is organized on the basis of humanitarian principles, principles of benefit, and the principle
of social justice for all Indonesians. The National Social Security System aims to provide and guarantees
the fulfillment of a decent life base for each participant and/or his family member. The National Social
Security System is organized on the basis of such principles: mutual cooperation, non-profit, disclosure,
prudence, accountability, portability, mandatory membership, trust fund, and the social security fund will
be used entirely for program development and for the interest of participants. Although the preparation and
implementation of the National Social Security System is quite well, but in reality there are still various
impacts and problems encountered in the operation of BPJS Kesehatan such as lack of socialization, service
facilities, inappropriate data, and personnel who are still lacking in giving a good services and information.
Programs mentioned above cover only a small The development of material law and procedural
percentage of Indonesian, while the majority of them law follow certain stages, ranging from simple form
have not received adequate protection. In addition, the to the most advanced stage in which law is organized
implementation of various social security programs has systematically.3 He states that the changes of the law are
not been able to provide fair and sufficient protection to in accordance with the changes that occur in the social
the participants in accordance with the benefits of the system of society that supports the legal system.
program which are the rights of participants. In relation
to the above, it is deemed necessary to develop a social The law is said to be a tool for changing society, as it
security system capable of synchronizing the various is known that the law was born by man and to guarantee
forms of social security implemented by some organizers the interests and rights of man himself. From this man
in order to reach wider membership and provide greater the color of law and its application will determine
benefits for each participant. what he will experience in the association of his life.4
Law is a tool to change society. It means that the law
Act 4 of the BPJS Law (No. 24 of 2011) contains is used as a tool by the agent of change or a pioneer
BPJS principles such as mutual cooperation, non- of change (a person or group of people who gain the
profit, disclosure, prudence, accountability, portability, trust of the community as the leader of the community
mandatory membership, trust fund, and the social security institutions).A planned social change is always under
fund will be used entirely for program development and control of the pioneer of the change. Therefore, if the
for the interest of participants. government wants to establish bodies that have function
to change society, then the law is required to establish
The non-profit principle in BPJS is different from the body to determine and limit its power.5
the goal of the establishment of state-owned enterprises,
which is to pursue profits to improve the company. Health Insurance Management on National
The principles set forth in the BPJS law will change Constitution: Pancasila and the 1945 Constitution
many things in the implementation of social security in mandated that the state has a responsibility to protect
Indonesia. The preparation period of the transformation the entire Indonesian and promote the general welfare in
from PT ASKES (Persero) to BPJS Kesehatan was the context of realizing social justice for all Indonesian
starting from November 25, 2011 to January 1, 2013. people. It is to realize a decent and dignified life and to
It has started on January 1, 2014 and also explained the fulfill the right to the basic needs of the citizens for the
purpose of the transformation is to make it easier and achievement of social welfare, the State organizes the
improve health insurance services to the public. One of service and development of social welfare in a planned,
the principles of BPJS Health is the principle of mutual directed and sustainable manner. State and social security
cooperation which means to help each other so that the are components that integrate with social protection
Medico-legal Update, January-March 2021, Vol. 21, No. 1 225
systems. National social security systems include to serve community. It has a non-profit principle,
health insurance, life insurance, accident insurance and the management of trust funds by BPJS Kesehatan
pension benefits financed by employer contributions and is not for profit (for profit oriented) but to meet the
employee contributions. The National Social Security maximum interests of participants. Funds collected
System (SJSN) is a lifelong social program that forms from participating are trust funds which is managed
a social protection system composed of parts of the for the welfare of the participants. So the results of its
approach system in the provision of social security development will be utilized as much as possible for the
and as an effort to create jobs by the government and benefit of participants.
empowerment of the marginal community to become a
prosperous self-reliant community.6 The National Social As a private legal entity, a Persero Company is not
Security System which is based on Law No. 40 of 2004 established by a state authority with a law but established
(about the National Social Security System/SJSN) is a by an individual, as any other public company should be
state program for a lifetime that must be held by a public registered with a Notary and authorized by the Ministry
legal entity with permanent legal force.To answer the of Justice and Human Rights.
problem of juridical study of the transformation of PT In contrast, the establishment of the Social Insurance
Askes (Persero) into BPJS Kesehatan, the writer uses Management Agency (BPJS) by state authorities is
Utilitarianisme Theory and Social Change Theory. established under National Social Security System Act
Implementation of Article 57 BPJS Law on and Social Insurance Management Agency Act. The
Transformation of PT Askes (Persero) into BPJS establishment of BPJS is not registered with a notary
Kesehatan: The definition of policy implementation public and does not require the authorization of a
according to Van Metten and Van Horn is acts committed government agency.
by individuals, officials, government, or private groups The main obstacle encountered by BUMN Persero
directed to achieve the objectives outlined in policy is the ineffectiveness of social security law enforcement
decisions.7 because there is no authority to regulate, supervise or
As it is known that PT Askes (Persero) is a State- impose sanctions on participants. On the contrary, the
Owned Enterprise (BUMN) that organizes a social BPJS as a public legal entity has the power and authority
security program, its capital is partly or wholly owned by to govern the public through the authority to make public
the government. There are 3 kinds of BUMN. First, Perjan binding regulations. As a public legal entity, BPJS is
is a BUMN whose capital is owned by the government. obligated to convey responsibility for the performance of
Perjan is service-oriented towards the community. its duties to the President. BPJS deliver its performance
Second, Perum is a Business Entity managed by State in the form of annual program management and financial
whose purpose is to gain profit and provide services to report audited by a public accountant to the President
the public. Third, Persero is one of the Business Entities with carbon copy to the National Social Security Board,
managed by State or Region. Unlike Perum or Perjan, no later than June 30th of the following year.
the main purpose of establishing a Persero is to seek In 2004 the government established and enacted
profit (commercial). Law Number 40 of 2004 on National Security System as
At the beginning, the form of business entity of PT the implementation of Article 5 paragraph (1) and Article
Askes (Persero) was in the form of a public company 52 of the National Social Security System Law after the
(Perum) under the name of Perum Husada Bhakti and Constitutional Court’s decision No. 007/PUU-III/2005
based on Government Regulation No. 6 of 1992, the dated 25 November 2011 and enacted Law Number
status of Perum was changed to a company (PT) and 24/2011 on the Social Insurance Management Agency.
then on January 1, 2014 PT Askes (Persero) changed its BPJS Kesehatan starts to operate on January 1st, 2014
name to BPJS Kesehatan based on Law Number 24 of and PT Askes (Persero) was closed without liquidation.
2011 on BPJS. At the same time, the Minister of BUMN through the
General Meeting of Shareholders approved the report
Characteristics of BPJS Kesehatan that different on closing financial position of PT Askes (Persero) after
from other BUMNs is to pursue profit in order to increase the audit at the public accounting firm and the Minister
the value of the company. BPJS Kesehatan is oriented of Finance authorized the opening financial position of
226 Medico-legal Update, January-March 2021, Vol. 21, No. 1
BPJS Kesehatan and the opening social security fund in many patients experiencing delay in handling because
report. For the first time, the Board of Commissioners they have to wait for an empty treatment room to be served
and the Board of Directors of PT Askes (Persero) was (especially at government hospitals); (4) the number of
appointed as BPJS Kesehatan Supervisory Board for health personnel is less than the required amount; (5) the
a maximum period of 2 years since BPJS Kesehatan problem will arise in the contribution participants (PBI)
started to operate. because the data is not in accordance with conditions in
the field so this causes serious problems.
The final change from the transformation processes
of BPJS is the change of organizational culture.6 In Conclusion
Article 40 paragraph (2) of BPJS Law, it requires BPJS
to separate the assets of BPJS and the assets of the Social Based on Government Regulation No. 6 of 1992 the
Security Fund. Article 40 paragraph (3) of the BPJS Law status of Perum is changed to a Persero company and
affirms that the assets of the Social Security Fund are not from January 1, 2014, PT Askes changed its name to
an asset of BPJS. This assertion ensures that the Social BPJS Kesehatan based on Law no. 24 of 2011. At that
Security Fund is a trust fund of all participants and not time PT Askes (Persero) was closed without liquidation
the assets of BPJS. and also accompanied by the transfer of assets, rights
and obligations of PT Askes (Persero) and its employees
Furthermore, in Article 4 of BPJS Law, it regulates moved into BPJS Kesehatan. Characteristics of BPJS
BPJS principles: principles of mutual cooperation, non- are oriented to serve community. Funds collected from
profit principles, principles of openness, prudential participants’ contribution are trust funds that will be
principles, accountability principles, portability managed for the welfare of participants. The juridical
principles, compulsory membership principles and trust implications of PT Askes (Persero) transformation into
fund principles. BPJS Kesehatan is affecting the company where it is
required to register its employees to BPJS Kesehatan
Juridical Implications of the Transformation of
and the company must allocate funds to pay the
PT Askes (Persero) into BPJS Kesehatan: The legal
contribution of BPJS Kesehatan. Impact for participants
basis for the transformation of PT Askes (Persero)
or communities is participants must pay contributions to
into BPJS includes Law Number 40 of 2004 regarding
BPJS Kesehatan except for whose premium paid by the
National Social Security System and Law Number
government.
24 of 2011 on BPJS.Furthermore, some Government
Regulations (PP) and Presidential Regulations Ethical Clearance: This research was ethically
(Perpres) also regulate the implementation of BPJS approved by Sebelas Maret University.
Kesehatan. From the various legal basis underlying
the transformation of PT Askes (Persero) into BPJS Funding: This research receives no external
whether it is based on the Law, Government Regulation, funding.
or Presidential Regulation, there are various impacts Conflict of Interests: There are no conflict of
or consequences of it. For the company, the impact is interests
that the company must register its employees to BPJS
Kesehatan. Furthermore, company are required to References
allocate funds to pay contributions to BPJS Kesehatan.
For society, the impact is that membership is mandatory 1. Bentham J, Mill JS. The utilitarians. Garden City,
and participants must pay the contribution. NY: Anchor Press/Doubleday;1973.
2. Tanya BL, Simanjuntak YN, Hage MY. Teori
Factors that impede the implementation of the Hukum Strategi Tertib Manusia Lintas Ruang dan
National Health Insurance currently encountered Generasi. Genta Publishing;2010.
by BPJS Kesehatan are some, including (1) lack of
3. Weber M. From Max Weber: Essays in sociology.
socialization; (2) inadequate number of health service
Routledge;2009.
facilities and uneven distribution, especially for remote
areas, borders and islands with low service levels due 4. Dirdjosisworo S. Sosiologi Hukum. Rajawali Pers;
to geographical conditions and poor health facilities in 1983.
the area; (3) lack of treatment room facilities resulting
Medico-legal Update, January-March 2021, Vol. 21, No. 1 227
5. Soemardjan S. Sifat-sifat panutan di Dalam 7. El Kawaqi. http//:www.el kawaqi.blogspot.com,
Pandangan Masyarakat Indonesia. Masalah- Artikel Implementasi Menurut Para Ahli, 2012,
masalah Ekonomi dan factor-faktor Ipolsos, accessed January 15, 2018.
Leknas, Mipi, Rajawali Press;1965.
6. Sulastomo. Sistem Jaminan Sosial Nasional Sebuah
Introduksi. Rajawali Press;2008.
228 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2309
Bio-Nanocomposites:
Parepartion Technology and Applications
Abstract
In this paper, combinations of a ceramic mixture with a polymer were developed to be used as a substitute
for damaged bones or teeth. Overlays were prepared using the manual mixing method, followed by the use
of ultrasound technology to ensure uniform distribution of the powder within the polymer. The polymer
(PMMA) is supported with a ceramic powder (HAMgO) prepared using an effective mechanical mixing
method. Where the percentages were used for consolidation, starting from (1%-4%). The results of the tests
showed mechanical corrosion or the so-called wear and tear of a significant improvement for the reinforced
polymeric compounds as the corrosion rate decreased to less than half at 4%. Likewise, the results of the
particle hardness examination showed a successive increase in the percentages compared to the polymer
base material. The results of the durability of compressibility and the Yunk coefficient showed a direct
increase with the increase in the percentages of the added ceramic powder. The results were interpreted
using the scanning electron microscope and by relying on the density values approved from the results of
the exercise.
Fig.(1): Experimental of Mechanical Properties (a) Density, (b) Hardiness, (c) young modulus, and
(d) compassion with Wight percentage HA-MgO.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 231
Table (1): Practical results of the physical properties of Nano-composites PMMA\HA-nMgO
Samples Density g\cm3 Micro-Hardness MPa Compression Strength MPa Modulus – Elastic GPa
PMMA\0% HAMgO 1.144 36.2 77.4 0.877
PMMA\1%HAMgO 1.198 46.9 102.4 1.3
PMMA\2%HAMgO 2.22 65.5 111.5 1.6
PMMA\3%HAMgO 2.28 89.7 122.6 2.2
PMMA\4%HAMgO 2.32 100.5 135.3 2.8
Discuss the wear Rate properties: Table 2 and damaged bone compensation, because these prepared
Figure (2.3) show a summary of the practical results of nanocomposites have a high resistance to wear and
the triple properties of the prepared samples. A screw- wear, and this is consistent with the source.
on-disk device was used to calculate the dry mechanical
corrosion rate of the nanocomposites and the dominant In order to check the practical results of calculating
model. The results showed the calculation of the dry the dry mechanical corrosion rate, the volumetric
sliding wear factor and a clear decrease in the amount wear rate was calculated to ensure the accuracy of
of skimming of the nanocomposites. This is due to the calculation. It was included in the calculation of
the improvement of the outer surface of the samples the mechanical corrosion rate, the practical intensity
supported by the Nano powder, which led to blocking of the prepared models. Figure 3 shows volumetric
the pores and voids and strengthening the bonds between wear behavior and we note the significant decrease in
the components of the supported sample compared the volumetric corrosion values of nanocomposites
to the unsupported substance (polymer). Therefore, compared to the base material (Polymer).
such a work can be used in the dental industry and
Sample Mass before wear (g) Mass After wear (g) Wear Rate (g\cm)^10-5 Volume Wear^10-6 cm3
0%HA-nMgO 3.246 3.100 0.146 0.10138
1%HA-nMgO 3.677 3.645 0.032 0.02671
2%HA-nMgO 3.886 3.874 0.012 0.00545
3%HA-nMgO 3.998 3.989 0.009 0.00394
4%HA-nMgO 4.125 4.123 0.002 0.00086
Discuss the results of the scanning electron composition of the nano-magnesium oxide compound,
microscope: Figure (4) shows pictures of the powders while Figure 4 (c) shows the mixed composition of the
forming the HA-MgO compound. Figure (4) a shows two compounds to form a non-distinct homogeneous
the hexa-structure of the hydroxybite with a nanoscale compound.
of 20 nm. Figure (4) b shows the fibrous and spindle
Medico-legal Update, January-March 2021, Vol. 21, No. 1 233
Fig. (4): SEM-Images of (a) HA, (b) MgO, and (c) HA-MgO
Abstract
Objective: Since the vaccination rate is largely affected by low knowledge and negative attitudes of
healthcare professionals, so this study aimed to weigh up the vaccination knowledge and attitudes of
pharmacy students.
Method: A pilot study using a survey to investigate demographic data, knowledge (20 questions), and
attitudes (5 questions) of 156 fifth year and 121 third year pharmacy students from College of Pharmacy/
University of Baghdad.
Results: The mean score of knowledge and attitudes was intermediate (16.654 and 14.917 out of 25 for the
fifth and the third grades, respectively) with a significant difference between the two groups, the students
shown to have favorable attitudes about vaccination. The score of the students is not influenced by family-
related parameters like father’s education, mother’s education, the number of siblings and preschool children
in the family.
Conclusion: A positive attitude and intermediate knowledge level about vaccination among pharmacy
students were found. This could be improved by the addition of a specialized vaccinology course to the
curriculum in pharmacy colleges and schools in Iraqi universities and going toward implementing the
pharmacy-based immunization program for pharmacists by the health authorities which in turn can develop
pharmacists’ role in the healthcare system in Iraq.
Table 2: The knowledge and attitudes of Iraqi pharmacy students toward vaccination.
Abstract
Foster Family Toddlers (FFT) as an effort program to improve the knowledge and skills of parents fostering
the development of children in a whole and optimal way. The result of 2018 Basic Health Research, East
Java Province shows the percentage low birth weight is 6.5%, underweight of toddler is 15%, wasting of
toddler is 8% and the coverage of exclusive breast milk is 40%. East Java Health Profile 2018 showed of low
birth weight is 3,7% and the coverage of exclusive breast is 76.83%, underweight and wasting in toddler is
not found numbers, but there is the weight of toddler in under red line is 0.77%. Therefore, needs to know
trend of the implementation of FFT in East Java. This study was quantitative descriptive research design
with secondary data. The result showed the reporting of FFT group from 2015-2017 increased by 4.52% and
decreased in 2017-2019 by 4.52% and has not reached the target of KKP 80%. FFT member participation
in 2015-2017 increased by 3.78% and decreased in 2017-2019 by 12.55%. FFT family attendance at the
2015-2016 Meeting increased by 1.38% and decreased in 2016-2019 by 1.24%, and the family of members
of FFT Child Card Users in 2015-2019 saw a continuous increase of 9.52%. So the result of the trend of the
implementation of activities is less maximal because there are still some obstacles to be considered.
Based on the chart, showing that the trend from many as 655,862 of the families who became members
2015-2016 increased by 1.38% where in 2015 families of FFT as much as 789,918 which meant the achievement
attended the meeting as many as 630,963 of the families was 83.03%, in 2018 the family attended the meeting of
who were members of the FFT as much as 754,998 648,325 of the families who became members of FFT
which meant the achievement of 83.57%, then in 2016 as many as 784,004 which means the achievement of
the family attended the meeting as many as 642,762 82.69%, then in 2019 the family attended the meeting as
of the families who became members of FFT as much many as 654,633 of the families who became members of
as 757,142 which means its achievement amounted to FFT as much as 800,378 which means the achievement
84.89%.However, there was a decrease in 2016-2019 of of 81.79%.
1.24% where in 2017 the family attended the meeting as
246 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure 4 Trends of Family Members of FFT Using KKA in East Java in 2015-2019
Based on the chart, showing that the trend from Regulation No. 60/2013 on Integrative Holistic Early
2015-2019 increased continuously by 9.52% where in Childhood Development. With the implementation of
2015 FFT member families used Children’s Flower holistic integrative early childhood development, it is
Card (KKA) by 334,341 of the families who became hoped that the essential needs of early childhood in its
FFT members as much as 754,998 which means its entirety including health and nutrition, stimulation of
achievement of 44.28%, then in 2016 the family of FFT education, moral-emotional coaching, and parenting can
members used KKA as much as 387,288 from families be met(12).
who became members of FFT as much as 757,142
which means its achievement of 51.15% , in 2017 the The National Family Planning and Population
family of FFT members used KKA as much as 413,041 Board (NPFP) also plays a role in the implementation
from families who became members of FFT as much of integrative holistic early childhood development
as 789,918 which means its achievement of 52.29%, in through the Toddler Family Development (FFT) activity
2018, the family of FFT members used KKA as much group. Integrative holistic early childhood development
as 414,207 from families who became members of FFT is carried out in FFT, early childhood education program
as much as 784,004 which means its achievement of Post, and integrated service post-groups. The FFT group
52.83%, and in 2019 the family of FFT members used improves the knowledge of parents and families who
KKA as much as 430,575 from families who became have toddlers regarding parenting; early childhood
members of FFT as much as 800,378 which means its education program Post provides educational services to
achievement of 53.80%. early childhood; while integrated service post provides
health services for early childhood. Some of the obstacles
Discussion found in the implementation of FFT, include(13):
The government has made various efforts to improve 1. Limited number of FFT cadres, due to difficulty
the quality of human resources, among others through regeneration of workers and lack of operational
the Integrative Holistic Early Childhood Development support, among others: fee, etc.
Program. This program is strengthened by Presidential
Medico-legal Update, January-March 2021, Vol. 21, No. 1 247
2. Limited number of Family Planning Counselors continuously by 9.52%. Although the result of the trend
(PKB) handling in the field. has decreased or increased, in the implementation of
activities there are still some obstacles to be considered.
3. FFT cadres who are concurrent as integrated service
post cadres so that the implementation of FFT Recommendation:
activities does not optimal.
1. Improving institutional strengthening with
4. Number of cadres, because between the number of integrative systems and efforts to prepare aspects
cadres and the number of participants is not balanced of legitimacy such as decision letter (SK),
5. Inefficient time utilization is also a factor in implementation guidelines, technical instructions
inhibiting FFT program. and so on.
The pattern of child care is also inseparable from 2. Improving commitment, coordination and
the culture of child play. In developmental psychology cooperation with relevant partners, stakeholders
literature, children aged 0-6 are “good impersonators” and with communities/associations/organizations
and “tenacious learners”, but not a “good listener”(14). related to FFT group organizing
Children of this age will be easier to learn and understand Conflict of Interest: The authors have no conflict of
by doing activities, not by being told or just words. interest with the material presented in this paper.
Therefore, early childhood requires play activity to
stimulate nerve development. According to Freud and Source of Funding: None.
Erikson playing for a child is very useful as a form of
Ethical Clearance: None. This research was
self-adjustment, helping the child master the anxieties
conducted without treating informants
and conflicts it faces(3). The game is believed to be
able to relieve tension so as to help the child in solving
Reference
problems and conflicts faced in his life. To realize the
above, it is necessary to create a meaningful learning 1. The Coordinating Ministry for Human Development
environment for early childhood, among others through and Culture of the Republic of Indonesia. Undang-
a variety of meaningful games that are able to provide undang no 52Tahun 2009 tentang Perkembangan
comfort for the child in learning and the right stimulation Kependudukan dan Pembangunan Keluarga. 2009;
will be realized(15). 2. National Population and Family Planning Board
Indonesia. Keluarga Berencana dan Kesehatan
Conclusion Reproduksi. Jakarta: National Population and
The implementation of the Family Resilience Program Family Planning Board; 2005.
of Toddlers and Children is outlined in the Operational 3. Santrock JW. Adolescence [Internet]. McGraw-
Guide to the Implementation of The Resilience Program Hill; 1998. (Brown and Benchmark Series).
of Toddlers and Children namely the development Available from: https://books.google.co.id/
of operational policies and strategies, formation and books?id=KZIEAQAAIAAJ
development of FFT groups, the development and 4. Nutbrown C, Clough P. Pendidikan anak usia dini:
provision of FFT Kit facilities, socialization, coaching, Sejarah, filosofi, dan pengalaman. Yogyakarta:
monitoring and evaluation of coaching and recording Pustaka Pelajar. 2015;
and reporting. FFT Group Reporting Chart shows the
5. Minister of National Planning Development.
trend from 2015-2017 increased by 4.52% but decreased
Pedoman Pelaksanaan Intervensi Penurunan
in 2017-2019 by 31.32%. However, if you look at the
Stunting Terintegrasi di Kabupaten/Kota. Jakarta:
target of KKP 80%, then the results have not reached the
Minister of National Planning Development; 2018.
target. FFT Member Participation Chart shows that the
trend from 2015-2017 increased by 3.78% but decreased 6. Ministy of Health. Riset Kesehatan Dasar 2018.
in 2017-2019 by 12.55%. The FFT Family Attendance Jakarta: Ministry of Health; 2019.
graph in the Meeting shows that the trend from 2015- 7. Ministry of Health in East Java. Health Profile in
2016 increased by 1.38% but decreased in 2016-2019 East Java 2018. 2019.
by 1.24%, and the KKA User FFT Member Family 8. National Population And Family Planning Board
chart shows that the trend from 2015-2019 increased East Java. Hasil Analisis dan Evaluasi Program
248 Medico-legal Update, January-March 2021, Vol. 21, No. 1
KKBPK-Maret 2015. Surabaya: National 12. National Population and Family Planning Board
Population And Family Planning Board East Java; Indonesia. Buku Pegangan Kader Bina Keluarga
2015. Balita. Jakarta: National Population and Family
9. National Population and Family Planning Board Planning Board; 2007.
Indonesia. Kesehatan Reproduksi. Jakarta: National 13. Mardiyono. Model Pengelolaan Bina Keluarga
Population and Family Planning Board; 2008. Balita (BKB) Di Propinsi Jawa Timur. Cakrawala:
10. National Population and Family Planning Board Jurnal Litbang Kebijakan. 2012;6(2):184–94.
Indonesia. Kumpulan Istilah Bidang Keluarga 14. Susanto A. Perkembangan Anak Usia Dini:
Berencana. Jakarta: National Population and pengantar dalam berbagai aspeknya [Internet].
Family Planning Board; 1984. Yogyakarta: Kencana; 2011. Available from: https://
11. National Population and Family Planning Board books.google.co.id/books?id=qvOAAQAACAAJ
Indonesia. Pengasuhan dan Pembinaan Tumbuh 15. Santrock JW. Masa perkembangan anak. Jakarta:
Kembang Anak. Jakarta: National Population and Salemba Humanika. 2011;
Family Planning Board; 2009.
DOI Number: 10.37506/mlu.v21i1.2312 Medico-legal Update, January-March 2021, Vol. 21, No. 1 249
Faisal Younus Sameen1, Qassim Jawell Odah Abed2, Tareq Al-Qassab3, Ashwaq Yas Khudhair4
1
M.Sc. Adult Nursing, University of Kirkuk-College of Nursing, 2M.Sc. Adult Nursing, AL-Kut Technical Institute-
Middle Technical University, 3PhD. Food Hygiene, AL-Kut Technical Institute-Middle Technical University-Iraq,
4M.Sc. Biochemistry, Al-Karama Teaching Hospital, Lab. Biochemical-Ministry of Heath
Abstract
Objectives: To assess the knowledge of patients with acute renal failure concerning dietary pattern for
kidney failure in dialysis unite in AL-Zahraa Teaching Hospital at AL-Kut City and Find out relationship
between demographic data and knowledge of patient with acute kidney failure. By a non- probability sample
account of (30) subjects is selected for the purpose of the present study. A questionnaire as a incomes for
data gathering, it consist of two parts; include demographic data and knowledge of patients with acute
renal failure concerning dietary pattern which composed of (18) items. By self-administration, data are
collected from those who patients with renal failure come in dialysis unite in AL-Zahraa Teaching Hospital
and analyzed through the used descriptive and inferential statistic approach. The study results indicated
that the most of the participants are within married (60%), and most of them are male. In regarding level
of education, they most of them formally graduation, and administrative patients, as well the subjects have
chronic disease such as diabetes mellitus and find statistical high significant between level of education and
knowledge of patient at p-value <0.05 with non-significant between other demographical data
Table (1): Distribution patient with acute renal failure knowledge concerning dietary pattern for kidney
failure in dialysis unite
F: Frequency, P: Percentage, M.S: Mean of score, Asses = Assessment level, low (1-1.60) = L, moderate (1.61-1.80) = M, high (1.81-2) = H
Figure (1) Show distribution between level of education for patient’ with acute renal failure and knowledge
about dietary pattern
252 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table (2): Relationship between demographical data 2. Srinivasan K. A descriptive study to assess the
and knowledge of patient concerning dietary pattern knowledge on dietary management among chronic
renal failure patients undergoing hemodialysis at
Level of education selected hospital, Kanchipuram. Department of
M.S.+S.D.
Knowledge of patients medical surgical nursing. Awadhmadhav college of
Notable read and write 1.25 + 0.442 nursing sciences and research, Gwallor: PID=2014-
Able to read and write 1.31+0.471 2-3-13
Primary school 1.28+0.458 3. Pamidi S, Tasali E. Obstructive sleep apnea and
Secondary school 1.36+0.488 type 2 diabetes: is there a link? Front Neurol.
2012;3:126. Available from: http://www.ncbi.nlm.
Institute 1.50+0.511
nih.gov/pubmed/23015803
Collage and above 1.44+ 0.506
4. Kosseifi S, Bailey B, Price R, Roy TM, Byrd RP,
*F: 1.088 *d.f.: 2 *p. value : 0.346 Peiris AN. The association between obstructive sleep
apnea syndrome and microvascular complications
Conclusion in well-controlled diabetic patients. Mil Med
The study concludes that more of the patients who [Internet]. 2010 ,175(11):913–6. Available from:
come to dialysis unit in AL-Zahraa Teaching Hospital in http://www.ncbi.nlm.nih.gov/pubmed/21121505
AL-Kut City have low level of knowledge concerning 5. Blakeley, Sara (2010). Renal Failure and
dietary pattern that related to renal failure specific Replacement Therapies. Springer Science &
patients characterized by short period of diagnosis and Business Media. p. 19. ISBN 9781846289378.
low level of education 6. Bostrom, M.A.; Freedman, B.I. (2010). “The
Recommendation: Study recommendation is Spectrum of MYH9-Associated Nephropathy”.
established education program for teaching and increase Clinical Journal of the American Society of
patients knowledge concerning dietary pattern for Nephrology. 5 (6): 1107–13. DOI:10.2215/
renal failure and makes vide and poster with booklets CJN.08721209. PMC.
which includes definitions the renal failure and nutrition 7. Ricci, Zaccaria; Ronco, Claudio (2012). “New
management for kidney failure insights in acute kidney failure in the critically ill”.
Swiss Medical Weekly. 142: w13662
Ethical Clearance: Permission from dialysis unite,
8. Fadem, Stephen Z., M.D., FACP, FASN.
in Al-Zahraa directorate was attained before starting
Calculators for Health Care Professionals. National
the study. All the participants gave verbal consent with
Kidney Foundation. 2008. 13.
confidentiality of participants’ identification
9. Charles RF, Powe NR, Jaar BG, Troll MU, Parekh
Conflict of Interest: Nil RS, Boulware LE. Clinical testing patterns and
cost implications of variation in the evaluation of
Source of Funding: Nil CKD among US physicians. Am J Kidney Dis.
2009;54(2):227–237.
References
10. Whaley-Connell A, Sowers JR, McCullough PA,
1. R. Manjunatha. A study to assess the knowledge and Roberts T, McFarlane SI, Chen SC, Li S, Wang
practice regarding dietary management of patients C, Collins AJ, Bakris GL. KEEP Investigators:
from rural area with end stage of renal disease Diabetes mellitus and CKD awareness: the
undergoing hemodialysis in a selected hospital at Kidney Early Evaluation Program (KEEP) and
Mysore. Cauvery college of nursing Mysore; 2017. National Health and Nutrition Examination Survey
Cited on: N0: 5- 6148-16. (NHANES) Am J Kidney Dis. 2009; 53(4 Suppl
4):S11–S21.
DOI Number: 10.37506/mlu.v21i1.2313 Medico-legal Update, January-March 2021, Vol. 21, No. 1 253
Assistant Instructor, Maternal and Neonatal Nursing Department, College of Nursing, University of Baghdad
Abstract
Family planning is the decision that couples make about if they want to have children, when, how many
children, and how they are spaced. Knowledge is necessary to make decisions and know how to avoid
conception. Some couple needs counseling because contraception has failed.
Objectives: To assess women’s knowledge and practices about family planning and find out the association
between women’s knowledge and practices with some study variables.
Method: Descriptive study was conducted from October 2019 to March 2020 at maternity hospitals in
Baghdad city. Non probability (purposive sample) was used to collect the data from (79) women who
attending outpatient clinics at maternity hospitals in Baghdad city. A questionnaire was designed by the
researcher. A pilot-test is conducted in order to determine the reliability of the questionnaire in a sample
of (20) women who were excluded from the study sample. Data was analyzed through the use of SPSS
version 20.
Results: The results revealed that the highest percentage (49.4%) of women’s age was (30-39) years. More
than two third of them (69.6%) are graduated from college. The higher percentages (63.3) have knowledge
and (58.2%) used a family planning method. There are no statistical significant differences between women’s
knowledge and practice.
Conclusion: This study finds that the women have knowledge and used a family planning method, but there
are no significant differences between women’s knowledge and practices.
Recommendations: Based on study findings the source of knowledge from the internet and they choose a
type of family planning based on family and friends advice so the researcher recommend to activate the role
of health care professional especially doctors and nurses to provide scientific knowledge and counseling to
couples to choose the most appropriate method.
(M.S) mean score (R.S) relative sufficiency (Ass.) assessment (Low= ≥ 75), (Moderate= 75.1-87.5), (High= 87.6-100)
This table shows that there are a low level of relative Table (4) Women’s Practices toward Family
sufficiency and mean score regarding items No.(2,3), Planning Method
while there are a high level of relative sufficiency and
mean score regarding items No. (1). Also there are a low No. Item F %
level of relative sufficiency and mean score regarding A Type of family planning
items No. (B). Also the total knowledge relative 1 Natural Family planning method 4 5.1
sufficiency and mean score is moderate level. 2 Contraceptive Pills 7 8.9
Table (5): Association between Women’s Knowledge and Practices with Socio-Demographic Variables
(df) degree of freedom, (Sig) significant Probability value (P < 0.05), (NS) Non Significant, (s) significant.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 257
This table shows that there are no statistical [9-10].
relatives and (39%) from TV and radio
significant between women’s knowledge and practice
with socio-demographic variables toward family Women’s decision making to use contraceptive
planning method method is affected by many factors including knowledge
gained from various sources. Blackstock and collegues
Discussion found that the role of the social network regarding family
planning generally to provide women contraceptive
The findings of current study show about half of information and particularly to guide women to a
women’s age were (30-39) years, more than one third specific contraceptive method. They found that the
married for (6-10) years, their last child’s age was (1-4 knowledge gained from health care providers especially
years). Regarding educational level more than two third social network members often enhanced or clarified
was graduated from college. their knowledge gained from other informal sources, [4].
Agha and Rasheed stated that Iraq, like some other This study found more than half of study participant
developing countries, people have still appreciates were use a family planning method, they choose
early marriage, large families and a role for woman in intrauterine device and male condom as a higher percent.
the home. In addition, the previous Iraqi government, They choose the method based on advice from their
especially in the 1980s, encouraged high fertility to family and friends.
compensate for casualties during its wars. Until the
middle of the past decade, the Iraqi Ministry of Health The condom use was high rate compared to
neglected family planning in the country. This explains neighboring countries; this may be due to the free
why the crude birth rate in Iraq was one of the highest in availability of condoms in Dohuk. However, similar
the world in the late 1980s and early 1990s . At the time rates of condom use have been reported in Iraq and
of their study, health services in Iraq, including family the Islamic Republic of Iran and among Palestinian
planning, were almost free in government clinics, when refugees[7].
these were available, but not all family planning method
Many women want to delay pregnancy and avoid
were available in family planning clinics. Therefore, for
STIs, as options are difficult. There are many method
many mothers, the sources of family planning services
available today, and more will be offered in the near
were private clinics and pharmacies due to the limited
future. The ideal method of contraception for many
services[7].
women should have the following characteristics: ease of
The current study found more than half of study use, safety, efficacy, minimal side effects, “nature”, non-
sample have knowledge about family planning method, hormonal method, and immediate reversal. Currently,
while they didn’t know the ideal pregnancies spacing. no single method of contraception offers everything [8].
This might be due to most of the study sample were
graduate from college so they think in family planning Conclusion
are useful to be economically, self-sufficient and more This study revealed that more than half of study
likely to acquire greater confidence and personal control sample have knowledge about family planning method
in marital relationships including the discussion of and they used a family planning method. The most
family size and contraceptive use. More than third of common type of family planning was intra uterine
their source of knowledge were from the internet, and device. There are no statistical significant differences
second higher percent from family and friends. This between level of knowledge and women’s age or
finding supported with a study who found more than third educational level. There are no statistical significant
(42.3%) of study participants had good knowledge, and differences between women’s knowledge and practice;
(50.4%) had good practice towards family planning[3]. also there are no statistical significant differences
another study reported that the higher percentage (45%) between women’s knowledge and practice with socio-
of the women’s source of information was from media, demographical variables.
followed by (15%) from internet/friends and relatives
and ten percent from health professionals. This study Recommendation: This study findings shows the
finding also is consistent with a study who found (70%) most women’s source of knowledge from the internet and
had gained knowledge of contraception from friends and most of them choose a type of family planning based on
258 Medico-legal Update, January-March 2021, Vol. 21, No. 1
family and friends advice so the researcher recommend American Journal of Sexuality Education, 2010,
to activate the role of health care professional especially 5(2), 128‑143. https://doi.org/10.1080/10627197.2
doctors and nurses to provide scientific knowledge and 010.491060.
counseling to couples to choose the most appropriate 5. Kopp, D. M.; Bula, A., Maman, S.; Chinula, L.;
method. Tsidya, M.; Mwale, M.; Tang, J. H.: Influences on
birth spacing intentions and desired interventions
Funding: This research was funded by Author.
among women who have experienced a poor
Moreover, I would like to thank all the women who
obstetric outcome in Lilongwe Malawi: A
participated in this study and pay tribute to them for their
qualitative study. BMC Pregnancy and Childbirth,
supporting this project.
2018, 18(1), 1–11. https://doi.org/10.1186/s12884-
Conflict of Interest: None declared 018-1835-9
6. United Nations reproductive health agency
Ethical Approval: Not required
(UNFPA), 2014, Available from https://iraq.unfpa.
org/en/news/strengthening-and-scaling-family-
References
planning-services-iraq
1. Pillitteri, A,: Maternal and Child health Nursing: 7. Agha,S.; Rasheed,B.: Family planning and unmet
Care of the Childbearing and Childrearing need among Iraqi Kurds, Eastern Mediterranen
Family,6th ed., Lippincott Williams & Wilkins Health Journal, 2007, 13(6),1328-1390.
Publishers, Philadelphia, 2010, 118-139.
8. Ricci,S.,Kyle,T.: Maternity and pediatric nursing,
2. Hamed, Z. F.; El-gazzar, A. F.; Moftah, F. M.: 2nd edition, Lippincott Williams & Wilkins,
Knowledge, Attitude and Practice of Family Philadelphia, 2013, 108.
Planning Method among Husbands in a Village
9. Qazi, M.; Saqib, N.; Gupta, S.: Knowledge, attitude
of Assiut Governorate, The Egyptian Journal of
and practice of family planning among women
Hospital Medicine, 2018, 73(4), 6489–6493.
of reproductive age group attending outpatient
3. Semachew Kasa, A.; Tarekegn, M.; Embiale, N.: department in a tertiary centre of Northern
Knowledge, attitude and practice towards family India. International Journal of Reproduction,
planning among reproductive age women in a Contraception, Obstetrics and Gynecology, 2019,
resource limited settings of Northwest Ethiopia, 8(5), 1775. https://doi.org/10.18203/2320-1770.
BMC Research Notes, 2018, 11(577), 1-6. https:// ijrcog20191531
doi.org/10.1186/s13104-018-3689-7
10. Srivastava R; Srivastava DK; Jina R; Srivastava
4. Blackstock, O. J.; Mba-Jonas, A.; Sacajiu, G. K; Sharma N, Sana S.: Contraceptive knowledge,
M.: Family planning knowledge: The role of attitude and practice (KAP Survey). J Obstet
social networks and primary care providers as Gynecol India, 2005, 55(6),546-550.
information sources for African American women,
DOI Number: 10.37506/mlu.v21i1.2314 Medico-legal Update, January-March 2021, Vol. 21, No. 1 259
Fatma Ulfatun Najicha1, I Gusti Ayu Ketut Rachmi Handayani1, Lego Karjoko1
1
Faculty of Law, Sebelas Maret University, Surakarta, Indonesia
Abstract
Forest is an ecosystem that provides oxygen, wood and a place to live for a variety of flora and fauna and
places where interactions between plants (flora) and animals (fauna) are present. But in its development,
environmental pollution carried out by most humans that can cause environmental damage, especially
forests continue to occur with a variety of motives and types. Environmental damage is getting worse. This
condition has directly threatened the life of ecosystems in the forest. One example of forest destruction by
human activity is exploitation of natural resources by burning the forest. Forest fires have a wider impact on
society, both local, national and international communities. Areas of Indonesia that have many forests with
variations in community behavior are quite prone to fires. Knowledge about natural phenomena in the form
of forest fires does need to be disseminated to the community. This is important, in order to avoid the impact
of the danger caused by the fire.
Abstract
Background: No wonder who you are and what you are, make your soul strong enough to fight against
Stress, move ahead with joy, and let us make stress to be alone. Nursing Care for an individual no matter
whether an individual is health or unhealthy, no matter from which age group S/He belongs to, however
stress perception is highly subjective1. Work related stress amongst nursing fraternity can be generated by
copious reasons. These reasons are dangerous for nurses especially during the current scenario of “COVID
19 Pandemic”,this stress has been concern throughout the globe.2
Objectives: Researchers have set the objectives of computing the effectiveness of staff welfare program
regarding Occupational stress during “COVID 19 Pandemic” among nurses.
Methodology: Researchers have used quasi experimental research design. 60 Nursing staff from a ICU of a
reputed hospital of Pune city were recruited with Consecutive non probability technique. Expanded nursing
stress scale (ENSS) has used to measure nurses occupational stress during “COVID 19 Pandemic”. This tool
is in the form of 5 point likert scale.
Results: Researchers have identified that pre-test and post-test’s mean difference is 61.1in experimental
group, where as in control group mean difference is 2.3.
Conclusion: It reciprocates that experimental group pre test post test mean difference has vast difference
than control group, thus staff welfare program is effective in order to reduce the occupational stress
during“COVID 19 Pandemic” among nursing fraternity .
Keywords: Effectiveness; Staff welfare program; occupational stress; “COVID 19 Pandemic”; nurses.
Thus, researcher wants to detect occupational stress Variables: Demographic variable: Age, Gender,
among ICU nurses, construct and administer Staff welfare Years of experience, Marital status, Monthly salary,
program to reduce level of stress among nurses and so Education qualification, Number of dependency
they become strong enough to keep aside stress and give members in family, Year of experience at current
quality of work towards their institute and feel free to hospital, perception of nurses for doctor, perception of
work efficiently.5 This staff welfare program includes nurses for other colleague, skip meal at duty, night Duty
2 components’: “strike balance with maintenance of is…., are you getting rest/leave enough, Family Type.
workplace stress” and “Breathing exercise”. During the
hospital experience, the researchers had come across Independent variable: Staff welfare Program
manynurses suffering from occupational stress and Dependent Variable: Occupational Stress
nurses are not focused from resolving or decreasing this
stress. Hence researchers wants to put efforts to decrease Inclusion Criteria:
this occupational stress. So, that the need for this study
1. Staff who are willing to Participate in the study
is an important aspect to be carried out at the time of this
pandemic. 2. Staff who can read writes and understand English
language.
Objectives:
3. Staff that are registered with nursing council.
1. Assess the level of occupational stress during
“COVID 19 Pandemic” among nursing officers in 4. Staff who is working in medical and surgical ICU
experimental group and control group. 5. Staff who is having at least 1 year of experience of
2. Compute effectiveness of staff Welfare program ICU.
regarding occupational stress during “COVID 19 6. Staff who works in ICU at the time of COVID 19
Pandemic”. Pandemic but not associated with corona positive
H1: There will be a significant difference in post test patients.
occupational stress level between experimental group Exclusion Criteria:
and control group.
1. Staff who are undergone to any alternative therapy.
Assumptions: 2. Staff who has experience sudden loss
• Nurses of Selected hospital may have high level of 3. Staff who is having any other psychological or
stress level need to reduce their occupational stress physical problems
level.
4. Staff who is not available at the time of post tests
• They may develop interest during Staff Welfare
Program 5. Staff who can’t attend all the sessions of staff welfare
program
• Introducing of staff welfare program may reduce
stress in nurses. Explanation of the tool: Tool comprise of 2
sections:
Methodology
Section 1: Deals with 14 demographic variables.
Research Design: Quasi Experimental research It is in the form of Semi structured Questioners with
design multiple choice answers
Setting: One reputed Hospital of Pune City Section 2: Self modified “Expanded nursing stress
scale (ENSS)” has used to measure nurses occupational
Subject: Nursing Undergraduates
stress. The ENSS is an expanded and updated revision
Sampling techniques: Consecutive non probability of classic nursing scale developed by Gray–Toft
technique and Anderson (1981).6 This scale is used to assess
Medico-legal Update, January-March 2021, Vol. 21, No. 1 265
occupational stress in nurses. It is an expanded version Segment I: Plotting data Frequency and Percentage
of the original 34-items Nursing stress scale. ENSS data distribution of Population characteristics Variable
contained 57 items in nine subscales. The 57 each items
were arranged in 5 point Likert response scale. Segment II: Data Frequency and percentage
distribution of occupational stress score
Total score 285 which classified into, absolute
grading is used Segment III: Unpaired t test calculation
As per Year of experience in current hospital in Night duty in control group 26(86.66%) nurses feel
control group 17(56.67%) nurses have 1 to 2 year safe night duty, 4(13.34%) nurses feel reasonable safe
experience, 11(36.66%) nurses have 3 to 5 year night duty. Night duty in experimental group include
experience, 2(6.66%) nurses have more than 5 years 28(93.34%) nurses feel safe night duty, 2(6.66%) nurses
experience. Year of experience in current hospital in feel reasonable safe night duty as per above data.
experimental group include 20(66.67%) nurses have 1 As per above table nurses who are getting rest
to 2 year experience, 9(30.00%) nurses have 3 to 5 year enough in control group 19(63.33%) nurses getting
experience and 1(3.33%) nurses have more than 5 years rest some time, 6(20.00%) nurses never getting rest
of experience. and 5(16.67%) nurses always getting rest. Nurses who
Perception of nurse for doctor in control group are getting rest enough in experimental group include
16(53.33%) nurses has excellent perception for doctors, 18(60.00%) nurses are getting sometime rest, 8(26.66%)
10(33.33%) nurses has Average perception for doctor, nurses always getting rest, 4(13.34%) nurses never
4(13.34%) nurses has Poor perception for doctor. getting rest.
Perception of nurse for doctor in experimental group Family type in control group 16(20.00%) nurses
include 20(66.67%) nurses has excellent perception for are belongs form extended family type 13(43.33%)
doctor, 7(23.33%) nurses has Average perception for nurses are belongs form joint family, 11(36.67%) nurses
doctor, and 3 (10.00%) nurses has Poor perception for are belongs from Nuclear family type. Family type in
doctor as per data. experimental group include 16(53.34%) nurses are form
As per data, perception of nurse for other collages joint family type, 9(30%) nurses are form Nuclear family
in control group 22(73.34%) nurses have Excellent type, 5(16.66%) nurses are for extended family type as
perception for other collages, 8(26.66%) nurses have per above table.
Average perception for other collages, 0(0%) nurses Segment II: “Data Frequency and Percentage Data
have Poor perception for other collages. Perceptions of Distribution of Emotional Intelligence Score”
nurse for other collages in experimental group include
Table 1: Data Frequency and Percentage data distribution of occupational stress score
Table 2: Mean, standard deviation, mean difference and unpaired ‘t’ test value of pre-test and post-test
score in experimental group
*(0.05,29)2.04
Inference: This table Depicts mean, standard deviation of pre-test and post-test in experimental group with the
mean difference is 61.1, SD is 13, paired’ is 8.63 value and p value, df value of pre-test and post-test stress level
score.
Table 3: Mean, standard deviation, mean difference and ‘t’ value of pre-test and post-test score in control
group
*(0.05,29)2.04
Inference: This table Depicts mean, standard deviation of pre-test and post-test in experimental group with the
mean difference is 2.3, SD is 14.82, paired’ is -1.16 value and p value, df value of pre-test and post-test stress level
score
Discussion Conclusion
Pre-test stress level: Mean pre-test score = 194.7, To the best of our comprehension, this literature
pre-test stress level score reveals that 5 nurses (16.67%) review implicates the relationship between Occupational
are having mild occupational stress, 10 nurses (33.33%) stress and nursing fraternities are higher. With specific
are having moderate occupational stress and 15 nurses association to all above mentioned studies we researchers
(50%) are having severe occupational stress. Post- have come up with the serious note of discussion.6
test stress level: Mean post-test score = 133.6, where These Review divulge plethora of facts, these facts
post-test score reveals that 1 nurse (3.33%) is having are fascinating and interesting. This study review that
no occupational stress, 22 nurses (73.34%) are having there is a different score of occupational stress among
mild occupational stress, 7 nurses (23.33%) are having nursing officers after the intervention of staff welfare
moderate occupational stress and no one is having program, Researchers believe that to boost the favorable
severe occupational stress. Where the control group Pre- condition of nursing staff and to reduce the occupational
test stress level: Mean pre-test score = 182.93, pre-test stress, an individual should emphasize to receive staff
stress level score reveals that 9 nurses (30%) are having welfare program. This may also lead in positive social
mild occupational stress, 9 nurses (30%) are having change, reducing emotional conflicts, resulting in high
moderate occupational stress and 12 nurses (40%) are productivity.9
having severe occupational stress. Post-test stress level:
Mean post-test score = 185.23, post-test stress level Recommendations: In the light of the above
score reveals that 6 nurses (20%) are having mild stress, finding and personal experience of the investigator the
9 nurses (30%) are having moderate stress, 15 nurses following recommendations are offered: The study can
(50%) are having severe stress. be replicated on larger sample; thereby finding can
be generalized for a larger sample. Nurses working in
268 Medico-legal Update, January-March 2021, Vol. 21, No. 1
any set up can use the staff welfare program (manage Available from: https://nurseslabs.com/nola-
workplace and strike a balance and breathing exercises) pender-health-promotion-model/9.
to decrease occupational stress level. The department 4. B.T.Basvanthappa,”NURSING RESEARCH”, 2nd
should also create such kind of Protocols to keep their edition, Jaypee Brothers Medical Private Ltd, page
nurses fit and fine. no. 61-63
Suggestions: 5. Annals of Indian Psychiatry: Table of Contents
[Internet]. Anip.co.in. 2020. Available from: http://
• A study can be replicated on a large sample which www.anip.co.in/searchresult.asp?I1.x=0 & I1.y=0
will facilitate more reliable research. & search=A+profile+of+occupational+stress+in+n
• A similar study can be conducted in different setting. urses
Ethical Consideration: Inform consent was 6. Effect of Stress Management Interventions on Job
obtained from the samples who have participated in Stress among Nurses working in Critical Care Units
research study in the consent form. Confidentiality of all - ProQuest [Internet]. Search.proquest.com. 2020.
sample’s information is maintained properly. Available from: https://search.proquest.com/openv
iew/5fd1cd48c7bbfb57613e665fbd935054/1? pq-
Conflict of Interest: There is no any means of origsite=gscholar & cbl=35042
conflict of interest within the researchers 7. F Polit, Cheryi Tatano Beek, “Nursing Research
principles and method”, 7th edition, Lippincott
Funding Agency: Researchers have not received
Williams and Wilkins Publishers-Philadelphia,
any fund from any agency.
Page no. 450-452
References 8. French SE Lenton R, Walters V, Eyles J. An
empirical evaluation of expanded nursing stress
1. B M. Self-reported stress and its effects on nurses.-
scale. J Nurs Meas 2000:8 160-178.
PubMed-NCBI [Internet]. Ncbi.nlm.nih.gov.
Available from: https://www.ncbi.nlm.nih.gov/ 9. Karl Pearson’s Formula for Finding the Degree of
pubmed/12212429 Correlation [Internet]. Economics Discussion. 2020.
Available from: http://www.economicsdiscussion.
2. Novel Coronavirus (2019-nCoV) situation reports
net/correlation/karl-pearsons-formula-for-finding-
[Internet]. Who.int. 2020. Available from: https://
the-degree-of-correlation/2579
www.who.int/emergencies/diseases/novel-
coronavirus-2019/situation-reports
3. Nola Pender: Health Promotion Model (Nursing
Theory Guide) [Internet]. Nurseslabs. 2020.
DOI Number: 10.37506/mlu.v21i1.2316 Medico-legal Update, January-March 2021, Vol. 21, No. 1 269
Nomophobia:
An Assessment of No Phone Phobia among Adolescents
Abstract
Nomophobia is a fear of being without mobile phone and it’s like fear of losing phone, checking it for
call but it’s not ringing, mobile gaming and engage in social sites at maximum. This was a study to assess
nomophobia among adolescents. The aim of study was to identify the mobile usage pattern and risk of
developing nomophobia among the college students. The selected Setting was college of Education Halwara,
Ludhiana, Punjab. A non-experimental/exploratory research design was utilized and 80 Elementary teacher
training students were selected through consecutive sampling technique. A self – reporting checklist was
utilized to assess the mobile usage pattern and rating scale assessed the risk of developing nomophobia.
Analysis was done using SPSS 16.0 version. Descriptive and inferential statistics were used to analyze
the data. The findings indicated that the maximum 55 (68.25%) of students follows the normal mobile
usage pattern similarly the maximum 67 (83.75%) of participants were at the lower risk of developing
nomophobia. There was moderate uphill (positive) relationship between the mobile usage pattern and risk
of developing nomophobia.it is concluded that informative material and sensitizing sessions can help the
students to cope up with this addiction.
Figure 2 depicts that maximum 67 (83.75%) students at the lower risk of developing nomophobia followed by
10 (12.5%) students at higher risk, whereas 03 (3.75%) students at no risk of developing nomophobia.
Table 1 depicts that the mean scores was 51.41 of students. The calculated r value between mobile usage
students at risk of developing nomophobia, whereas the pattern and risk of developing nomophobia was 0.506.
mean score was 9.16 for the mobile usage pattern of Hence it was concluded that there was a moderate uphill
272 Medico-legal Update, January-March 2021, Vol. 21, No. 1
(positive) relationship between the mobile usage pattern reveals that the calculated F values betweenage (in years),
and risk of developing nomophobia among students. father and mother education, Family monthly income,
type of family and academic year found no significant
Table 1: Correlation between mobile usage pattern relationship with risk of developing nomophobia. The
and risk of developing nomophobia among students calculated t value between gender and risk of developing
(N=80) nomophobia had shown significant relations.
Correlation N Mean±SD r
Discussion
Mobile Usage Pattern 80 9.16±2.65
0.506 The findings of study were supported by Salloju
Risk of developing
80 51.41±14.16 V, Ranjith B (2017)6, the cross-sectional study was
nomophobia
conducted to assess the severity of mobile dependency
Table 2 reveals the relationship between mobile among 171 pharmacy students. The target age group
usage and demographic variables. The calculated F and was 17-25 years. Findings show that only 24.37 % of
t values of age (in years), gender, father and mother pharmacy students had risk of developing nomophobia.
education, Family monthly income, type of family and George S, Saif N, Joseph B (2017)7 supports the findings
academic year found no significantat p<0.05, which of study, topic was to find the utilization of mobile
means there was not significant relationship between the among medical students in Kerala, which shows that
variables. only 35% of medical students are frequent mobile users,
whereas 65% were normal mobile users. Similarly
Table 2: Relationship between mobile usage pattern finding were reported by Kaur A, Sharma P (2015)8an
with demographic data (N=80) investigation was conducted to find out the threat of
producing nomophobia among students of nursing. The
Sr.No. Demographic data F value P value
findings suggested that there was moderate correlation
1 Age 0.27 0.760
of mobile use andthreat of producing nomophobia.
2 Gender 0.19 0.421 Mertkan D Gezgin, OzlemCakir(2016)9 conducted an
3 Father’s education 0.06 0.992 investigation to find out theprevalence of nomophobia
4 Mother’s education 0.64 0.635 in pre-service teachers of Trakya university and results
5 Family income 0.74 0.528
concluded that age has relationship with the mobile usage
pattern in preschool teachers. Datta S, Nelson V, Simon
6 Type of family 0.70 0.496
S (2016)10 who conducted a study to assess the mobile
7 Academic year 0.80 0.372 use and problems reported by the students of medical
F – F value, t –t value, p<0.05 education. Findings concluded that father’s education
has no association with mobile usage pattern in medical
Table 3: Relationship between risk of developing students. Prasad M, Patthi B, Singla A, Gupta R, Saha
nomophobia with demographic data (N=80) S, Kumar J, et al. (2017)11who conducted a Cross-
sectional investigation of mobile usethreat of growing
Sr.No. Demographic data F value P value
nomophobia Among Students of dental. The association
1 Age 0.866 0.424 of father’s education was found not significant with risk
2 Gender 5.881* 0.001 of developing nomophobia. Sanjay Dixit, Harish Shukla,
3 Father’s education 0.956 0.436 A.K Bhagwat, Arpita Bindal, Abhilasha Goyal, Alia K
4 Mother’s education 0.742 0.566 Zaidi, et al.(2010)12 who conducted an investigation
to find out mobile addiction in the students of medical
5 Family income 2.110 0.105
college in India. Results showed no association of risk
6 Type of family 5.220 0.190
of developing nomophobia with academic sessions.
7 Academic year 2.242 0.138 The limitations of this research study was few studies
available in the field of mobile usage pattern. Secondly
F – F value, t –t value, * significant at p<0.05
the sample size limited and not containing responses
Table 3 depicts the relationship between risk of from the students of other professions.
developing nomophobia with demographic variables. It
Medico-legal Update, January-March 2021, Vol. 21, No. 1 273
Ghassan M. Ahmed
Abstract
This work aimed to identify biosurfactant-producing bacterial strains isolated from hydrocarbon-contaminated
sites and to evaluate their biosurfactant properties. The drop-collapse method and minimal agar added with
a layer of diesel as carbon source were used for screening, positive strains were able to grow in a liquid
medium, and surface tension and emulsification index were determined in cell-free supernatant and cell
suspension. 250 bacterial isolate were tested, and 16 were positive for the drop-collapse and hydrocarbon-
layer agar method. Most of the strains were Pseudomonas, except for three strains (Acinetobacter, Bacillus,
and Rhodococcus). Surface tension was similar in cell-free and cell suspension measurements, with values
in the range of 58 to 26 (mN/m), and all formed stable emulsions with engine oil (77-92% E24). Considering
the variety of molecular structures among microbial biosurfactants, they have different chemical properties
that can be exploited commercially, for applications as diverse as bioremediation or degradable detergents.
Table 1: Production of Biosurfactant and identification of isolates grown in glucose, sucrose and olive oil as
the carbon source
The substrates used had been reported to promote those microorganisms produced only a small amount of
biosurfactant production(14,19 and 20). Although the biosurfactant, or it remained intracellular (14).
biodegradation capacity of the 250 isolates has not been
tested by the reduction of hydrocarbons in pure culture, The majority of the positive strains were identified
many are likely to degrade hydrocarbons since they as Pseudomonas spp., which are one of the most
were isolated in mineral salt agar plates, incubated in reported biosurfactant producer, and rhamnolipid
a hydrocarbon-saturated atmosphere as carbon source. had been reported that the most known biosurfactant
However, only a small proportion were biosurfactant that they produce(22,23). Other Pseudomonas related
producers, which support the concept of the bacterial microorganisms, such as Burkholderia plantarii(24)
community, that will help other microorganisms to and Ps. chlororaphis(25) also reported as biosurfactants
degrade the wide variety of hydrocarbons found at the producer.
site(21,4). The 16 isolates described in Table (1)were
The drop-collapse test was considered positive inoculated in amineral salt agar plate covered with a
when within one minute, the drop expanded on the oily layer of a combustible material, a clear zone around
surface of the microplate lid. Besides the 16 positive the colonies was observed in the glucose-free plates
isolates, another 21 strains (18 in olive oil, one in maize after 24 h of incubation. Biosurfactantsare liberated to
starch, one in sucrose, and one in paraffin) showed a the surroundings and emulsification occurs as the main
partial collapsed drop after one minute, suggesting that mechanism to introduce water-insoluble substrates to
the cell interior (18).
278 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Surface tension measurement showed that to give phosphatidylethanolamine that are formed, as observed
a positive drop collapse test, a surface tension lower by Desai & Banat (10), and the emulsion formed by
than 45 mN/m was necessary. The surface tension of Rhodococcus cells incorporated air in the emulsion,
Mineral salt broth was 69.97 mN/m. No differences were giving a column height higher than the controls.
observed in the surface tension of cell-free supernatants
and cell suspensions for all bacterial strains tested Conclusion
(p>0.05, data are shown), opposing results obtained by Hydrocarbon contaminated sites can be considered
Batista et al.(11). The lower surface tension values, both as enrichment environments for the selection of
with or without cells, was reached by Pseudomonas hydrocarbon degrading and/or biosurfactant producing
strains (26.7 mN/m) and were closely followed by the microbial strains. Production of biosurfactants and
Bacillus strain (33.32 mN/m) (Table 2). bioemulsifiers by soil microorganisms provides them
Even though lipopeptides produced by Bacillus with an advantage in contaminated sited, since they can
are known as one of the most powerful microbial use water-insoluble carbon sources for growth.
biosurfactants (9), Pseudomonas rhamnolipids are also Conflict of Interest: Nil.
effective, and both of them are extracellular (29). The
important point is, if a surfactant that reduces the surface Source of Funding: Self-funding
tension of water can form stable emulsions (11). The term
emulsifier is often used in an application-oriented manner Ethical Clearance: Ethical Clearance from the
to describe the combination of all the surface-active institutional ethical committee obtained for the study.
compounds that constitute the bioemulsifier secreted
by the cell to facilitate the assimilation of an insoluble References
substrate (6). As described in Table 2, most of the strains 1 Rahman K, Rahman T, Korkoutas Y, Petsas I,
that had lower surface tension values were also the ones Marchant R, Banat I. Enhanced bioremediation
that formed the largest and more stable emulsions. In of n – alcane in petroleum sludge using bacterial
addition, there was no significant difference between consortium amended with rhamnolipid and
the emulsions formed by the released biosurfactant or micronutrients. Bioresour. Technol. 2003; 90, 159-
the cell suspension (p>0.05). For all water-insoluble 168.
compounds tested, emulsions were more stable in the 2 Prabhu Y, Phale P. Biodegradation of phenanthrene
hydro carbonated portion of the oil-water mixture. When by Pseudomonas sp. Strain PP2: novel metabolic
a supernatant without cells was used, emulsification pathway, role of biosurfactant and cell surface
index (after 24 hours) ranged from 0 to 99.9% for diesel, hydrophobicity in hydrocarbon assimilation. Appl.
from 0.0 to 99.9% for kerosene, and from 76.2 to 92.8% Microbiol. Biotechnol.2003; 61, 342-351.
for engine oil (Table 2).With high statistical differences
3.Christofi N, Ivshina I. Microbial surfactants and their
between strains within each compound (F=15.55 for
use in field studies of soil remediation. J. Appl.
diesel, F=99.9.60 for kerosene and F=2.35 for engine oil
Microbiol.2002; 93, 915-929.
respectively; p<0.01). For decane, the emulsion index
was in the range of 0-10% and there were no differences 4. Ron E. Rosenberg, E. Biosurfactants and oil
among strains (p>0.05). bioremediation. Current Opinion Biotechnol. 2002;
13, 249-252.
The emulsification index can vary with bacterial 5. Bognolo G.Biosurfactants as emulsifying agents for
growth phase(13). The highest emulsification index hydrocarbons. Colloids Surfaces A: Physicochem.
values of diesel, kerosene, and engine oil were detected Engineering Aspects.1999; 152, 41-52.
for Pseudomonas strains. Monteiro et al. (22) reported
6. Fiechter A.Biosurfactants: moving towards
an emulsification index of 70% after 30 days of
industrial application. Tibtech. 1992; 10, 208-217.
incubation, demonstrating that emulsions produced by
P. aeruginosa rhamnolipids are stable, and can be used 7. Bognolo G. Biosurfactants as emulsifying agents for
in the control of environmental contamination. Only hydrocarbons. Colloids Surfaces A: Physicochem.
Bacillus and Acinetobacter formed stable emulsions Engineering Aspects. 1999; 152, 41-52.
with decane. Emulsions formed by Acinetobacter were 8. Lin SC. Biosurfactants: Recent advances. J Chem.
small, but optically clear, probably due to vesicles rich in Tech Biotechnol. 1996; 66:109‑120.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 279
9. Lu JR, Zhao XB, Yaseen M.Biomimetic 18. Bouchez M, Rakatozafy H, Marchal R,Leveau
amphiphiles: biosurfactants. Current Opinion J, Vandecasteele J. Diversity of bacterial strains
Colloid Interface Sci. 2007; 12, 60-67. degrading hexadecane in relation to the mode of
10. Desai JD, Banat IM. Microbial production of substrate uptake. J. Appl. Microbiol.1999; 86, 421-
surfactants and their commercial potential. 428.
Microbiol. Mol. Biol. Rev.1997; 61, 47-64. 19. Olivera NL, Commendatore MG,Morán AC,
11. Batista SB, Mounteer AH, Amorim FR, Tótola Esteves JL. Biosurfactant-enhanced degradation
MR. Isolation and characterization of biosurfactant/ of residual hydrocarbons from ship bilge wastes. J.
bioemulsifier-producing bacteria from petroleum Ind. Microbiol. Biotechnol.2000; 25:70-73.
contaminated sites. Bioresour. Technol., 2006; 97, 20. Vipulanandan C, Ren X. Enhanced solubility and
868875. biodegradation of naphthalene with biosurfactant.
12. Bodour AA, Drees KP, Maier RM. Distribution J. Environm. Eng. Geophys.2000; 126, 629-633.
of biosurfactant-producing bacteria in undisturbed 21. Rahman K, Banat I, Thahira J,Thayumamavan
and contaminated arid Southwestern soils. Appl. T,Lakshmanaperumalsamy, P. Bioremediation of
Environm. Microbiol. 2003; 69, 3280-3287. gasoline contaminated soil by a bacterial consortium
13. Koneman E. Color Atlas and Textbook of amended with poultry litter, coir pith and ramnolipid
Diagnostic Microbiology. 6th Edition. Lippincott biosurfactant. Bioresour. Technol.2002; 81, 25-32.
Williams & Wilkins, USA.2005. 22. Monteiro SA, Sassaki GL, Souza LM, Meira JA,
14. Batista, S.B.; Mounteer, A.H.; Amorim, F.R.; Araújo JM, Mitchell DA. et al. Molecular and
Tótola, M.R. Isolation and characterization of structural characterization of the biosurfactant
biosurfactant/bioemulsifier-producing bacteria produced by Pseudomonas aeruginosa DAUPE614.
from petroleum contaminated sites. Bioresour. Chem. Phys. Lipids2007; 147, 1-13.
Technol.2006; 97, 868875. 23. Wu JY, Yeh K, Lu WB, Lin CL, Chang JS.
15. Kiyohara H, Nagao K, Yano K. Rapid screen Rhamnolipid production with indigenous
for bacteria degrading water-insoluble, solid Pseudomonas aeruginosa EM1 isolated from oil-
hydrocarbons on agar plates. Appl. Environm. contaminated site. Bioresour. Technol.2008; 99,
Microbiol. 1982;43, 454–457. 1157-1164.
16. Munguia T, Smith CA. Surface tension 24. Andrä J, Rademann J, Howe J, Koch MHJ, Heine
determination through capillary rise and laser H,Zähringer U. et al. Endotoxin-like properties
difraction patterns. J. Chem. Educ.2001; 78, 343- of a rhamnolipid exotoxin from Burkholderia
344. (Pseudomonas) plantarii: immune cell stimulation
and biophysical characterization. Biol. Chem.2006;
17. Nevárez-Moorillón GV, Piñón-Castillo H, Torres-
387, 301-310.
Muñoz V, MuñozCastellanos LN,Vélez-Sánchez
Verín C, Espinoza JV.et al. Soil contaminated with 25. Gunther IV, NW, Nuñez A, Fett W, Solaiman
diesel (residual fuel no. 6). Remediation strategies. DYK. Production of rhamnolipids by
2004; In Magar VI, Kelley ME. (eds). In Situ Pseudomonaschlororaphis, a nonpathogenic
and On-site Bioremediation-2003. Battelle Press, bacterium. Appl. Environm. Microbiol. 2005; 71,
Columbia OH. USA. Paper E-22 2288-2293.
280 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2318
Hadeel T. Al-Barrak
Abstract
A cross-sectional school-based study was performed with the objectives to determine the prevalence of head
lice infestation among primary schools in Baghdad suburbs (Abu Ghraib, Al-Yousifiya, Al-Radwaniyah,
Al-Al-Taji, and Al-Hussainiya). The study included examination of 920 male and female students in several
elementary schools’ class first to sixth (age 6-15 year). These schools include urban, rural, and economically
and culturally diverse regions for the period from February to June 2018. The results of the current study
showed that the total injury rate was 9%, and the Radwaniyah region recorded the highest infection rate of
13.2 and the Al-Al-Taji rejoin region recorded the lowest (6.1%). The female infection rate was greater than
that of males and reached 12.3 and 5.6 respectively. The results indicated a significant relationship between
the spread of head lice and the educational status of parents, sharing of the head comb, and infection with
dandruff.
Table 1: The parasites stages on the infected head of pupils in the elementary schools of the suburbs of
Baghdad
The results indicated that there are statistical differences for head lice infestation between the suburban areas
of Baghdad, where the region of Al-Radwaniyah topped the infection rate by 13.4% and the lowest infection was
recorded 6.1 % of the Al-Taji region (Table 2).
In Iraq, several epidemiological studies of head-lice by 10.1% and 7.5% respectively, and that may be due
were performed and a wide range of infection rates was to better hygiene in urban area, higher socio-economic
observed. In Baghdad the infestation rate ranged from levels, and better family education. These results were
2.9% (9) to 48.9% (10). In city of Kirkuk 20% (11), in city consistent with what found by Nejati (15), who reported
of Samarra 15.29% (12). And in Mosul 33.2%(13). In a 6.58% and 12.44% prevalence of pediculosis in urban
addition, infestation in rural areas outpaced urban areas, and rural areas in Iran
282 Medico-legal Update, January-March 2021, Vol. 21, No. 1
The results also proved that the female infection was girls ’clothes. Moreover, girls generally have longer
more than the male infection, as it recorded 12.3 % and hair compared to boys and long hair that requires
5.6 %, respectively (Table 3). This significant difference better combing. Moreover, fit female hair as a place for
can be attributed to the behavior patterns between boys breeding head lice, covering female hair with scarf etc.
and girls, which have affected prevalence rate such as
All Iraqi studies indicated a high rate of infection are signs of previous infection, which were successfully
among females compared to that of males, and it is treated, and remained for months, while short boys’ hair
believed that the difference in the infection between was cut, and led to removing head lice.
the sexes with head lice does not have a physiological
basis, but rather depends on the difference in hairstyle, With regard to the relationship of head lice
as long, wavy hair is a predominant characteristic of infestation with the age group (Table 4), it was observed
older girls and the few number of cuts hair in females that the highest rates of infection were a group of age 6–7
helps to maintain and permanence of the injury (16). This to 12-13 years % in both sexes (P > 0.05). This result is
phenomenon can be explained by the fact that girls have consistent with what Al-Aboody (16) found that head
longer hair, which facilitates the transmission of lice lice infestation abounds within the ages from 7 to more
from head to head, that they are more social, and often than 11 year, and Salehi (17) who found that there were
touch the hair of other girls. Additionally, in long hair, no statistical differences between the ages of primary
nits remain attached to hair growth accordingly, these school students for grades 1 through 6 in Isfahan, Iran.
Table 4: Prevalence of head lice by age group of primary schools in Baghdad suburbs
In Present study, the frequency of washing of hair, parents were uneducated was 19.1% compared to 4.5
the number of family members, sharing bed and towels, for pupils whose parents were educated (P-value <
and the length of the hair did not differ significantly 0.001). Likewise, the percentage of infection increased
between affected and uninfected children. Whereas, with the presence of dandruff, where the infection rate
parent education, the habits of sharing combs, and was recorded 52 and 48%, respectively. Sharing combs
the presence of dandruff had a significant effect on recorded 97.6% of the haired combs. These results are
the prevalence of head mice in pupils of elementary consistent with Degirli (18), Nejati (19).
schools (Table 5). The percent of infected pupils whose
Medico-legal Update, January-March 2021, Vol. 21, No. 1 283
Table 5: Prevalence of head lice in relation to frequency of bathing, sharing towel, sharing beds, sharing
combs, hair length, and dandruff infection of primary schools in Baghdad suburbs
Hakeem J. I.
Assistance Prof., Department of Environment, Faculty of Science, University of Kufa, Najaf, Iraq
Abstract
The study showed that lead element is higher than the normal limits due to the high level of gases. Which
makes the concentrations of lead vehicles in the fuel used high. Cadmium is within the normal level because
the sources of this element in the study areas are limited.
Lead is one of the most dangerous and widespread 2. The intersection of the twentieth revolution
pollutants as a result of the significant development 3. The intersection of Al-Sahedrin
achieved in the chemical and mining industries and the
4. Al-Zahra’a intersection
growing uses of this mineral in various technologies(2).
The importance of any source of exposure to lead 5. Al-Wafa University intersection
differs according to the geographical location, climate,
6. Al Mukhtar Tunnel
ground chemistry and industrial activities, as well as
the exposure intensity that the individual faces with 7. The intersection of the northern transportation
different age, gender, profession, food, and culture. The garage
population of developing countries is higher because 8. The intersection of the southern transport garage
their lead protection rules are less stringent than in
developed countries(3). 9. Najaf - Karbala checkpoint
10. Najaf Control - Abu Sukher
Cadmium is one of the toxic heavy metals that
play an important role in environmental pollution and The chemicals used:
constitutes a threat to human and animal health alike(4,5),
1. Hydrochloric acid
as it is found in nature in a pure form linked with other
raw materials(6) and is excreted to the environment from 2. Nitric acid
industrial waste and from agricultural fertilizers(7). Method of measuring concentrations
After drying and grinding the sample and sifting it,
Corresponding Author: we do the following
Hakeem J. I. 1. Take (0.5) grams from the sample and put it in a
Department of Environment, Faculty of Science, conical flask
University of Kufa, Najaf, Iraq
2. Digest the sample by adding a 3: 1 ratio of
e-mail: [email protected] hydrochloric acid to nitric
286 Medico-legal Update, January-March 2021, Vol. 21, No. 1
3. Evaporate the sample by placing the beaker on The study showed that the levels of the lead element
a constant heat source until all the liquid has are higher than the normal limits due to the high level of
evaporated gases emitted from cars, as these areas are very congested,
especially at peak time, and the lack of control over the
4. We add nitric acid with 2% dilution.
specifications of fuel used in automobile engines, which
5. Filter the sample and supplement the filtrate to 100 makes the concentrations of lead vehicles in the fuel
ml with distilled water used high. Cadmium is within the normal level because
6. The sample is measured using atomic absorption the sources of this element in the study areas are limited.
technology
Conclusions
Results and Discussion Lead element are higher than the normal limits due
Table 1 shows the concentration of lead in soil to the high level of gases emitted from cars. Cadmium
samples for some areas of Najaf Governorate. Table 2 is within the normal level because the sources of this
shows the concentration of cadmium in soil samples for element are limited.
some areas of Najaf Governorate.
Ethical Clearance: This study was approved by
Table 1 Concentrations of lead the Ethics Committee, University of Kufa. The study
protocol was thoroughly explained for using samples
Region Lead (ppm) This investigation was done according to the principals
Al Mukhtar Tunnel 0.142 of the Declaration of Helsinki.
Najaf-Karbala checkpoint 0.171
Source of Funding: By Self
The intersection of Al-Sahedrin 0.191
Twentieth Revolution Zone 0.174 Conflict of Interest: Nil
The control of Abu Sakhir 0.12
References
Airport junction 0.161
1. Heavy elements, sources and damages to the
The intersection of Wafa-Jahma 0.12
environment, promising research center in
Southern garage 0.141 biological control and agricultural information,
North garage 0.191 Qassim University, Saudi Arabia, 2012-1437.
Al-Zahra’a intersection 0.135 2. Word Health Organization Puplication, Childhood
lead poisoning,Geneva, Switzerland, 2010
Table 2 Concentrations of cadmium
3. OECD regulation, risk reduction monographs.
Region Cadmium (ppm) Paris, France, 1993
Al Mukhtar Tunnel 0.0182 4. Bhowmilk Debjit, Kumar K. P. Sampath and
Najaf-Karbala checkpoint 0.015
Umadevi M. Lead Poisoning the Future of Lead,s
Impact Alarming on our society. The Pharma
The intersection of Al-Sahedrin 0.0189
Innovation, vol. 1, No.6, 2012.
Twentieth Revolution Zone 0.0121
5. WHO/FAO/IAEA: Report on trace elements in
The control of Abu Sakhir 0.011 human nutrition and human health, Word Health
Airport junction 0.01 Organization, Geneva,1996.
The intersection of Wafa-Jahma 0.009 6. Jarup, K., Berglund. Health effect of cadmium
Southern garage 0.015 exposure Work Environ. Health, 24 (suppl. 1),199.
North garage 0.0058 7. Ikediobi, C. Response of antioxidant enzyme and
Al-Zahra’a intersection 0.017 redox, metabolites to cadmium induced oxidative
stress in CRL-1439 normal rat liver cell. Int. J. Mol.
Med., 14 (1):87-92. 2004
DOI Number: 10.37506/mlu.v21i1.2322 Medico-legal Update, January-March 2021, Vol. 21, No. 1 287
Socio-demographic Predictors of
Perceived Health among Syrian Refugees in Jordan
1RN, MPH, PhD. Director, Accreditation Department, Accreditation and Quality Assurance Center; Assistant
Professor, Community Health Nursing Department, School of Nursing, The University of Jordan, Amman, 11942,
Jordan, 2RN, PhD. Associate Professor, Clinical Nursing Department, School of Nursing, The University of Jordan,
Amman, 11942, Jordan, 3Professor, Community Health Nursing Department, School of Nursing, The University of
Jordan, Amman, 11942, Jordan
Abstract
The purpose of this study is to investigate the association between socio-demographic characteristics and
perceived health among Syrian refugees in Jordan.
Method: A cross-sectional quantitative descriptive design was adopted, where a sample of 151 Syrian
refugees living inside and outside camps in Amman,Jordan was surveyed for physical, psychological, social
and environmental perceived health using a 12-item questionnaire.
Results: Each domain’s score was computed out of 60. The mean perceived physical health was 27.6±11.5;
perceived psychological health 27.1±10.1; perceived social health 32.6±10.3; and perceived environmental
health 30±9.1. Predictors of perceived physical health included age group F(2) = 3.12, p = .012, marital
status F(3) = 4.71, p = .004, and income level F(2) = 1.75, p = .047. Predictors of perceived psychological
health included income level F(2) = 2.79, p = .005, place of living t = 3.32, p = .007, and marital status F(3)
= 4.09, p = .034. Predictors of perceived social health included gender t = 2.04, p = .026, age group F(2) =
3.64, p = .000, living place t = -3.61, p = .031, and household size r = .61, p = .048. And the only predictor
of perceived environmental health included was place of living t = 5.64, p = .000.
Conclusion: Living inside refugee camp, large household, poverty, older age, and being divorced or widow
are associated with lower perceived health. Modifying some factors may help improve perceived health
among Syrian refugees in Jordan and beyond.
Introduction
As a result of political turmoil, destruction, and
Correspondence Author: armed conflict, millions of Syrians have become
Hamza Alduraidi, RN, MPH, PhD refugees, faced with the reality of fleeing their previous
Director, Accreditation Department, Accreditation lives, their homes, and sometimes, even members of their
and Quality Assurance Center; Assistant Professor, families. They have headed to other regions in Syria,
Community Health Nursing Department, School of or other countries in search of safety and protection [1].
Nursing, The University of Jordan, Amman, 11942, Since the fighting in Syria began in 2011, more than
Jordan 470, 000 people have been killed, 1 million injured,
e-mail: [email protected] and several millions forced to flee their homes for fear
Phone: +962 6 5355000 Ext. 23169 of persecution and seek asylum elsewhere[1]. Syrian
Cell Phone: +962 7 7272 4079 refugeesfled to neighboring nations such as Lebanon,
288 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Jordan, and Turkey in order to stay safe and salvage their Review Board (IRB) Committee of the School of Nursing,
lives and their family’s lives[2]. The University of Jordan. Potential participants were
approached in their communities between September
Jordan historically hosted several waves of refugees and November 2019, merit of the study and its benefits
from neighboring countries, such as Palestine and Iraq [3]. were explained, informed consent was signed, and then
Today, Jordan alone hosts over 680 thousand registered the Arabic questionnaire was completed.
Syrian refugees, but this only represents a fraction of
the total number of Syrian refugees in country, which Instrument: The data was collected using a two-
is estimated to be 1.4 million, or 20% of Jordan’s part questionnaire:
population [2]. The vast majority of Syrian refugee
communities in Jordan (approximately 80%) are located 1. Socio-demographic data that include gender, age
in non-camp settings, specifically in cities close to the group, place of living, family size, marital status,
Northern border between Jordan and Syria, including educational level, employment status and income
Mafraq and Irbid, and in the capital, Amman[4]. Over level.
85% of Syrian refugee population live under poverty 2. A 12-item, Arabic, self-reported, perceived health
line [4]. questionnaire with four domains; perceived
physical, psychological, social and environmental
The aforementioned circumstances make the daily
health. This questionnaire was developed by the
life of Syrian refugees filled with hardships and stressors
authors in light of reviewing several international
on the physical and social levels. Syrian refugees often
instruments. Face validity was confirmed by three
live with limited means to provide shelter and food to
experts.
their children and families, representing basic necessities
of survival[5]. There is no question that Syrian refugees Pilot Study: A pilot study on 22 subjects prior to
residing in Jordan face grave and often insurmountable the main study. Result showed satisfactory reliability
financial barriers towards accessing basic health with a Cronbach’s alpha of .82.
services, which leads to poor health[3]. Therefore, this
Findings:
paper investigates the socio-demographic predictors
of Syrian refugees’ perceived physical, psychological, Sample Characteristics: As presented in table
social and environmental health. (1), the sample consisted of 151 adult Syrian refugees
whose ages ranged between 18 and 69 years, with a
Materials and Method mean of 31.3 years (SD = 10 years). Age was recoded
Design: A cross-sectional quantitative descriptive into three age groups for statistical purposes, as shown
design was utilized to identify association between in the table. Majority (73.5%) were males, and married
socio-demographic characteristics (such as gender, (54.3%), 31.8% were single, and those a few reported
age group, place of living, family size, marital status, being widowed (7.3%) or divorced (6.6%). Ninety-one
educational level, employment status and income level) participants (60.3%) resided outside camp in Amman
as independent variables, and perceived physical, or Zarqaa’, and 60 participants (39.7%) resided in Al-
psychological, social and environmental health as Azraq refugee camp. In terms of educational level, 38
dependent variables. participants (25.2%) reported receiving education lower
than middle school, 20 participants (13.2%) had middle
Settings: Sample was recruited from Syrian refugee school education, 70 participants (46.4%) had high
communities inside Zaatari refugee camp, and in non- school education, and only 23 participants (15.2%) had
camp settings in greater Amman and Zarqaa. some college or university degree. Those who reported
a monthly family income below absolute poverty line
Sample and Population: A sample of 151 registered
(at about JD200 per month per household) were only 7
Syrian refugees aged 18 years and above, willing to
(7.3%), those who reported a family monthly income
participate were included in this study. Those with
between absolute poverty line and poverty line (at about
terminal illnesses or severe disabilities were excluded.
JD400 per month per household) were 36 (37.5%),
Data collection Procedures: Data collection started and those who reported a family monthly income
after acquiring ethical approval from the Institutional above poverty line were 53 (55.2%) (DOS, 2019). It
is important to report that out of the 151 participants,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 289
55 decided not to answer the income question, so the Socio-demographic Predictors: The scores of each
numbers in the table add up to 96 participants. of the four domains of perceived health was tested for
its association with socio-demographic characteristics.
Table 1. Sample Characteristics (N = 151) These characteristics included gender, age group, marital
status, employment status, household size, educational
Characteristic Count (%)
level, income status, as well as living place (inside
Gender Male 111 (73.5)
vs. outside camp). This association was tested using a
Female 40 (26.5) series of independent-sample t tests, one-way ANOVA
Age Group 18-29 years 73 (48.3) tests, and Pearson’s r correlation tests according to
30-39 years 54 (35.8) each variable type. A number of socio-demographic
characteristics were found to be significantly associated
40 years or older 24 (15.9)
with each of the four domains’ scores, and are therefore
Marital Status Single 48 (31.8)
considered predictors.
Married 82 (54.3)
Widowed 11 (7.3) Socio-demographic predictors of perceived physical
health included age group, where participants aged 18-
Divorced 10 (6.6)
29 scored 31.3, those aged 30-39 scored 27.8, and those
Living Place Inside Camp 60 (39.7) aged 40 or older scored only 24.4 (F(2)=3.12, p=.012);
Outside Camp 91 (60.3) marital status, where single participants scored 28.8,
Educational Level Below Middle School 38 (25.2) married scored 26.9, divorced scored 22.9, and widow/
Middle School 20 (13.2) er scored only 22(F(3)=4.71, p=.004); and income level,
where participants whose families receive a monthly
High School 70 (46.4)
income below JD199 scored only 25.8, those between
College or Higher 23 (15.2)
JD200-299 scored 27, and those above JD300 scored
Employment Status Unemployed 75 (49.7) 30.1(F(2)=1.75, p=.047).
Employed 76 (50.3)
Socio-demographic predictors of perceived
Family Monthly Income Level* Below
JD199
7 (7.3) psychological health also included monthly income
level,where participants whose families receive a
JD200-299 36 (37.5)
monthly income below JD199 scored only 28, those
JD300 or Higher 53 (55.2) between JD200-299 scored 29.2, and those above JD300
*55 participants (36.4%) chose not to answer this question scored 31.4 (F(2)=2.79, p=.005); place of living, where
refugees inside camps scored 26.9, and those outside
Perceived Health Scores camps scored 29.6(t=3.32, p=.007); and marital status,
A 12-item, Arabic language questionnaire was where single participants scored 27.8, married scored
used to test the perceived health score for each of the 27.1, divorced scored 23.5, and widow/er scored only
four domains; physical, psychological, social and 22.9 (F(3)=4.09, p=.034).
environmental. Items of the questionnaire were Liker- Socio-demographic predictors of perceived social
scale type ranging from extremely poor to extremely health included gender, where males scored 32.6, and
satisfying. Each domain’s score was computed out of 60. females scored 29.9 (t=2.04, p=.026); age group, where
The score for perceived physical health ranged participants aged 18-29 scored 33, those aged 30-39
between 4.5 and 56.9, with a mean of 27.6±11.5 out scored 29.7, and those aged 40 or older scored only
of 60; perceived psychological health scores ranged 26.2(F(2)=3.64, p=.000); living place, where refugees
between 4 and 52.7 with a mean of 27.1±10.1 out of 60; living inside camps scored 32.6, and those living outside
perceived social health scores ranged between 6.8 and camps scored 27.3(t=-3.61, p=.031), and household size,
60, with a mean of 32.6±10.3 out of 60; and perceived where a statistically-significant correlation was found
environmental health scores ranged between 5.8 and between number of household members and perceived
58.8, with a mean of 30±9.1 out of 60. social health score (Pearson’s r=.61, p=.048).
290 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Finally, the only socio-demographic predictor of Conclusion
perceived environmental health was place of living,
The findings of this study provide an evidence that
where refugees living inside camps scored 29.6, and
some modifiable socio-demographic characteristics
those living outside camps scored 33.7(t=5.64, p=.000).
are associated with inferior perceived health scores
All other socio-demographic characteristics were not
among Syrian refugees in Jordan. Poverty and large
significantly associated with the score of environmental
household size were associated with inferior perceived
health domain.
physical, psychological and social health. It is, therefore,
recommended that policy makers should target resolving
Discussion
the problem of limited financial resources and large
Numerous research found a strong association family size among Syrian refugees in Jordan.
between health and socio-demographic factors in several
populations, namely among refugees [3]. Regarding living Living inside refugee camp was associated with
inside refugee camps, the findings of this study came inferior perceived psychological and environmental
in line with the results of a 2017 study by Alduraidi & health on one hand. On the other hand, perceived social
Waters, where Palestinian refugees inside refugee camps health inside the camp was superior. Policy makers
fared worse in terms of both physical and environmental should, therefore, establish psychological/mental health
health, but fared better in terms of social relationships[5]. services, and work on improving physical environmental
The explanation of these findings may be the strong conditions inside the camp. Meanwhile, policy makers
connections between refugee families inside the camp, should implement solutions for promoting social support
and the shared concerns, hopes and stressors between networks among refugees outside the camp. Finally, older
these families. refugees, divorced and widow individuals expressed
low scores in several domains. Thus, policy makers are
Regarding the association between poverty and invited to implement programs to help promote health in
inferior physical health, a 2015 study by Hamdan- these special demographics.
Mansour and colleagues suggested that poverty predicted
worse health and life satisfaction among Jordanian Conflict of Interest: The authors declare no conflict
patients[6]. This association was also evident in a of interest related to publication of this article.
2020 study by Alduraidi and colleagues, where Syrian
Financial Disclosure: There is no financial
refugees with lower financial resources demonstrated
disclosure.
lower resilience than their younger counterparts[7].
Ethical Clearance: The study has been approved
In terms of the association between age and
by the ethics and research committee at The school of
perceived physical and psychological health, the
Nursing, The University of Jordan.
findings of this study came in line with those of a 2017
study by Hamdan-Mansour and colleagues and a 2020 References
study by Khatib and colleagues, as well as a 2020 study
by Alduraidi and colleagues[8-9-7]. It is worth mentioning 1. Rizkalla, N., & Segal, S. P. Well-Being and
that another 2017 study by Hamdan-Mansour and Posttraumatic Growth Among Syrian Refugees in
colleagues, and a 2019 study by Saleh and colleagues Jordan. Journal of Traumatic Stress, 2018. 31(2),
have revealed that the older the person, the more likely 213–222. https://doi.org/10.1002/jts.22281
he/she is to express inferior physical health problems 2. United Nations High Commissioner for Refugees.
both subjectively and objectively[10-11]. External Statistical Report on Active Registered
Syrians in Jordan; 2200. http://data.unhcr.org/
Furthermore, relatively-high numbers of divorced syrianrefugees/download.php?id=8714. Accessed
and widow individuals, and relatively large family size June 2, 2020
are characteristics of refugee communities as revealed
3. Alduraidi H, Waters CM. Depression, Perceived
in a 2018 study by Alduraidi & Waters, where these
Health, and Right-of-Return Hopefulness of
socio-demographic characteristics were found to be
Palestinian Refugees. J Nurs Scholarsh. 2018;
significantly associated with distress, sadness, and poor
50(2):163-171. doi:10.1111/jnu.12363
perceived psychological health[3].
Medico-legal Update, January-March 2021, Vol. 21, No. 1 291
4. Government of Jordan, Fafo Institute for Applied 8. Hamdan-Mansour A. Sociodemographic correlates
International Studies. The living conditions of of somatic symptoms of older persons in Jordan.
Syrian refugees in Jordan: Results from the 2017- Jordan Med J 2017; 51 (3): 119-130.
2018 survey of Syrian refugees inside and outside 9. Khatib A, Hamdan- Mansour A, Ratrout H,
camps. Retrieved March 13, 2019 from: https:// Alenezi A, Chahien T. Testing the effectiveness
reliefweb.int/report/jordan/living-conditions- of integrated elderly care model on quality of care
syrian-refugees-jordan-results-2017-2018-survey- and health outcomes among hospitalized elderlies
syrian-refugees in West Bank. Malaysia Journal of Public Health
5. Alduraidi H, Waters CM. Health-related quality Medicine 2020; 20(1): 82-89.
of life of Palestinian refugees inside and outside 10. Hamdan-Mansour A, Shehadeh J, Puskar K, El-
camps in Jordan. Nurs Outlook. 2017;65(4):436- Hneiti M, M Haourani E. Investigating physical,
443. doi:10.1016/j.outlook.2017.05.007 psychological and social well-being of older
6. Hamdan-Mansour AM, Al Abeiat DD, Alzoghaibi persons in Jordan. Current Aging Science. 2017
IN, Ghannam BM, Hanouneh S I. Psychosocial and Aug 1;10(3):217-23.
sociodemographic correlates of life satisfaction 11. Saleh ZT, Lennie TA, Alhurani AS, Almansour
among patients diagnosed with cancer in Jordan. J IM, Alduraidi H, Moser DK. High Dietary Sodium
Cancer Edu 2015; 30(1): 31-36. Intake is Associated with Shorter Event-Free
7. Alduraidi H, Dardas LA, Price MM. Social Survival in Patients with Heart Failure and Comorbid
Determinants of Resilience Among Syrian Diabetes [published online ahead of print, 2019
Refugees in Jordan. J PsychosocNurs Ment Health Nov 18]. Clin Nurs Res. 2019;1054773819888743.
Serv. 2020;58(8):31-38. doi:10.3928/00989134- doi:10.1177/1054773819888743.
20200624-04
292 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2323
Hario Megatsari1, Agung Dwi Laksono2, Mursyidul Ibad3, Yeni Tri Herwanto4,
Kinanty Putri Sarweni4, Rachmad Ardiansyah Pua Geno4, Estiningtyas Nugraheni4
1
Faculty of Public Health, Universitas Airlangga, Surabaya, Indonesia, 2Researcher, National Institute of Health
Research and Development, the Indonesian Ministry of Health, Jakarta, Indonesia, 3Researcher, Faculty of Health,
Nadlatul Ulama University, Surabaya, Indonesia, 4Researcher, The Indonesian Public Health Union, Makassar,
Indonesia.
Abstract
Psychosocial burden as a result of the risk of decreasing income and the possibility of being laid off from
work is a problem that must be faced by workers during the COVID-19 pandemic. The study was aimed
at analyzing predictors of psychosocial burden among workers during the co-19 pandemic period. A total
of 6,053 worker respondents were involved in this study. The psychosocial burden was reviewed based
on the worries level. There were 4 independent variables involved in the analysis, including age, gender,
marital, and education. A multivariate test was performed using binary logistic regression. The results found
that the workers in the ≤ 19 age group were 1.900 times more likely than the≥ 50 age group to experience
a psychosocial burden. The workers in the 40-49 age group were 1.523 times more likely than the ≥50
age group. Male workers were 0.693 times more likely than female workers to experience a psychosocial
burden. The higher education workers were 0.563 times more likely than workers with secondary education.
It could be concluded that the 3 variables were proven as predictors of the psychosocial burden among
workers during the COVID-19 pandemic period in Indonesia, namely age, gender, and education.
Table 2. The result of binary logistic regression of psychosocial burden(the worries level) of community in
Indonesia, 2020 (n=6,053)
Table 2 informs that male workers are 0.693 Ethical Clearance: This study of the psychosocial
times more likely than female workers to experience burden of community during the COVID-19 pandemic
psychosocial burden (OR 0.693; 95% CI 0.598-0.803). period in Indonesia has received ethical approval from
The results of this analysis indicate that gender is a the national ethics commission (No: RK.05/KEPK/
predictor of psychosocial burden among workers during STIK/VIK/2020). The respondents’ identities have
the COVID-19 pandemic period in Indonesia. The all been deleted from the dataset. Respondents have
female workers have a higher chance of experiencing provided written approval for their involvement in the
psychosocial burden. study.
8. Costa MF da. Health belief model for coronavirus 20. Ozamiz-Etxebarria N, Idoiaga Mondragon N,
infection risk determinants. Rev Saude Publica. Dosil Santamaría M, Picaza Gorrotxategi M.
2019;54(47):1–12. Psychological Symptoms During the Two Stages
of Lockdown in Response to the COVID-19
9. Athbi HA, Hassan HB. Health Beliefs of Patients
Outbreak: An Investigation in a Sample of Citizens
with Coronary Heart Disease toward Secondary
in Northern Spain. Front Psychol. 2020;11:Article
Prevention: The Health Beliefs Model as a
number 1491.
Theoretical Framework. Indian J Public Heal Res
Dev. 2019;10(1):272–8. 21. Ozamiz-Etxebarria N, Dosil-Santamaria M,
Picaza-Gorrochategui M, Idoiaga-Mondragon N.
10. Evans G. Questions: COVID-19 mortality,
Stress, anxiety, and depression levels in the initial
conspiracy theories, and the mysterious lack of sick
stage of the COVID-19 outbreak in a population
children: “Flu has a mortality of 0.1% - This has a
sample in the northern Spain. Cad Saude Publica.
mortality 10 times that.” Hosp Infect Control Prev.
2020;36(4):Article number e00054020.
2020;47(4):1.
22. Kiely KM, Brady B, Byles J. Gender, mental health
11. Task Force for the Acceleration of Handling
and ageing. Maturitas. 2019;129:76–84.
COVID-19. Hoax Buster [Internet]. Jakarta; 2020.
Available from: https://covid19.go.id/p/hoax- 23. Ballering AV, Bonvanie IJ, Olde Hartman TC,
buster Monden R, Rosmalen JGM. Gender and sex
independently associate with common somatic
12. Meiryani, Siagian P, Lusianah, Lesmana T.
symptoms and lifetime prevalence of chronic
Technology’s role to avoid the spread of COVID-19.
disease. Soc Sci Med. 2020;253:Article number
Int J Psychosoc Rehabil. 2020;24(7):9902–9.
112968.
13. Dyer O. Trump claims public health warnings
24. Roy D, Tripathy S, Kar SK, Sharma N, Verma SK,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 297
Kaushal V. Study of knowledge, attitude, anxiety signs in Rural Indonesia. Int J Innov Creat Chang.
& perceived mental healthcare need in Indian 2020;13(1):1037–51.
population during COVID-19 pandemic. Asian J 27. Wulandari RD, Laksono AD. Determinants of
Psychiatr. 2020; In press: Article number 102083. knowledge of pregnancy danger signs in Indonesia.
25. Chen Q, Min C, Zhang W, Wang G, Ma X, Evans PLoS One. 2020;15(5):Article number e0232550.
R. Unpacking the black box: How to promote 28. Ipa M, Widawati M, Laksono AD, Kusrini I,
citizen engagement through government social Dhewantara PW. Variation of preventive practices
media during the COVID-19 crisis. Comput Human and its association with malaria infection in eastern
Behav. 2020;110:Article number 106380. Indonesia: Findings from community-based survey.
26. Wulandari RD, Laksono AD. Education as PLoS One. 2020;15(5):e0232909.
predictor of the knowledge of pregnancy danger
298 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2324
Abstract
The family is a collection of two or more people, with each other tied to each other emotionally, and living
in the same area in an adjacent area. Family support is the attitude, actions, and acceptance of the family of
its members. Anxiety is an individual’s response to an unpleasant situation experienced by all living things
in everyday life. The purpose of this study was to determine the relationship of family support with anxiety
levels in pre-school age children in the children’s care room at Syech Yusuf Hospital Gowa Regency. This
research method was analytic descriptive with a cross-sectional study design. The research sample of 31
people using Purposive Sampling techniques. Place of research in the Children’s Care Room Syech Yusuf
Hospital Gowa Regency. The study was conducted from July to October 2019. The data collection used
questionnaire sheets. Data analysis using the chi-square test. The results showed that family support of
31 respondents, the highest frequency of respondent family support was good as many as 16 respondents
(51.6%) and the lowest frequency was enough as many as 15 respondents (48.4%). Data on children’s
anxiety level were obtained from 31 respondents, the highest frequency of respondents’ anxiety level was
19 respondents (61.3%) and the lowest frequency was weight, which was 12 respondents (38.7%). Based
on the results of the Chi-Square statistical tests that have been done, it was obtained that the value of X2=
14,685 with a significant level of ρ = 0,000 with α = 0.05. The conclusion of the study showed that there was
a relationship between family support and anxiety levels in preschool children.
Table 5: Family Support Relationship With The factors that influence anxiety responses in
Anxiety Levels in Preschool Children Hospitalised sick children who are hospitalized are not only due to
in Pediatric Ward Syech Yusuf Hospital Gowa, family support but there are other factors including the
Indonesia 2019 foreign environment, the presence of strangers, medical
equipment, inability to do activities, pain due to medical
Anxiety Level action/injury to the body. Here family support only
Family Amount
Support
Mild-Moderate Severe exerts a few percent influences.14
n % n % n %
For children, illness is a difficult time, where the
Good 15 48.8 1 3.2 16 51.6 child must leave a familiar environment, move to a
Enough 4 12.9 11 35.5 15 48.4 hospital that is still unfamiliar to him, in a state of illness
Total 19 61.3 12 38.7 31 100 and loneliness, and must undergo a variety of frightening
treatment procedures.15 Foreigners who are around (in
X2 = 14.685, p-value = 0.000
the hospital) for children ages preschool considered the
From table 5 above showed data from the 31 person who threatened her. Moreover, health workers
respondents, it was found good family support that (nurses or doctors) who always carry out medical actions
was as much as 16 respondents (51.62%) and enough that are considered painful so that children easily arise
family support that was as much as 15 respondents anxiety when interacting with strangers to him.
(48.4%), whose level of anxiety was 19 respondents
(61.3%) in mild-moderate level and had severe anxiety Children aged 3 to 6 years are at the stage of
level experienced by 12 respondents (38.7%).Based psychosocial development initiative vs guilt. The
on the Chi-Square statistical test results that have been psychosocial development stage (Erikson) of children
obtained, the results obtained a value of X2=14.685 with aged 3 to 6 years is characterized by intrusive and
a significant level of p=0.000 with α=0.05. energetic behavior, the courage to strive, and strong
imagination. The explanation of pre-school age children’s
Discussion fantasy toward strange or excessive environments.16
Children aged 3 years experience the highest increase in
This study showed the results from the analysis attention span when compared to ages 4.5 and 6 years17
were p=0,000<α=0.05 so that according to the basis so this is a compelling reason to explain why 3-year-olds
of the hypothesis research decision making11 Ho was experience the most moderate anxiety.
rejected and Ha was accepted. This means that there was
a relationship between family support with the level of
anxiety in children ages preschool.
302 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Ethical Clearance: Taken from National Health 11. Notoatmodjo S. Health Research Methodology.
Research and Development Ethical Committee Ministry Jakarta: RinekaCipta. 2005.
of the Health Republic of Indonesia. 12. Sugiyono. Statistics for Research. Bandung:
Alfabeta. 2010.
References 13. Potter, Perry. Fundamental of Nursing. Vol. 1, 4th
1. Friedman MM. Family Nursing; Theory and Edition. Jakarta: EGC. 2005.
Practice. Jakarta: EGC. 1998. 14. Nursalam. Infant and Child Nursing Care. Jakarta:
2. Soetjiningsih. Children’s Growth and Development. SalembaMedika. 2005.
Jakarta: EGC. 1995. 15. Wong DL, et al. Textbook of Pediatric Nursing.
3. Wong DL. Pediatric Nursing Textbook. 6 Edition.th Jakarta: EGC. 2008.
Jakarta: EGC. 2002. 16. Wong DL. Clinical Guides for Pediatric Nursing.
4. Supartini Y. Textbook of Basic Concept Pediatric 4th Edition. Jakarta: EGC. 2003.
Nursing. Jakarta: EGC. 2004. 17. Erni M, Andika R. The Relationship between
5. Isranil E. Factors Affect Anxiety of School Family Support and Anxiety Levels Due to
Children Hospitalized in Pediatric Ward of Dr. Hospitalization in Pre-School Children in Pediatric
Sardjito Hospital. Thesis, Unpublished, Gadjah Ward Dr. SoeradjiTirtonegoro Hospital. 2007.
Mada University, Yogyakarta: 2006.
DOI Number: 10.37506/mlu.v21i1.2325 Medico-legal Update, January-March 2021, Vol. 21, No. 1 303
Hasan Falah Lahij1, Abdulla H. Alkhater2, Muthanna Hamid Hassan1, Luma Amer Yassir3
1
Lecturer, Biology Department-Collage of Sciences, University of Anbar, Ramadi, Iraq, 2Scholar researcher,
Al-Maarif University Collage, Department of Medical Laboratory Techniques, Iraq, 3Prof, National Center of
Hematology, Al -Mustansiryah University, Baghdad, Iraq
Abstract
Background and Objective: Quorum sensing (QS) is a chemical language of bacteria, and use of N-acyl-
homoserine lactone (AHL) signals is one of the most known mechanisms by which bacteria can communicate
with each other to regulate the gene expression based on bacterial density. Previous studies suggested that QS
has an important role in pathogenicity of P.aeruginosa, so that the present study investigation the correlation
of QS genes in local isolate of P.aeruginosa with production of virulence factors.
Materials and Method: The study included collection of 126 samples from various clinical sources and,
these samples included wounds, burns, ear, cystic fibrosis and urinary tract infections (UTI). Pyocyanin
and biofilm production were determined spectrophotometrically, QS genes were detected by PCR based on
specific sequences for lasI and rhlI genes.
Results: Final diagnosis showed that 51 isolates belong to target bacteria and, the phenotypic detection
of some virulence factors showed that 46 isolates (90%) showed variance in the strength of Pyocyanin
production, and 44 (86%) of the isolates showed a differences in their ability to biofilm formation and,
screed QS genes showed that 48 (94%) of isolates were positive for lasI gene, while 44 (86%) of isolates
have rhlI gene, and this study pointed that 9 isolates have one of QS genes lasI or rhlI, and also have one or
more of virulence factors, as well as the results showed that 1 isolate out of 51 negative for both QS genes
and weakly in production of virulence factors.
Conclusion: Most of local isolates were positive for QS genes and, QS plays an important role in the
pathogenesis, not all of the virulence factors controlled by QS. The study indicated that the isolates which
have both QS genes were more virulence than isolates that have single gene.
Gene Sequence of forward and reverse Primer(5΄- 3΄) Size (bp) Annealing Temp.°C
F GGGGGATCTTCGGACCTCA
16SrRNA 956 58
R TCCTTAGAGTGCCCACCCG
F GCGCGAAGAGTTCGATAAAA
Las I 537 60
R ATCTGGGTCTTGGCATTGAG
F CTTGGTCATGATCGAATTGCTC
Rhl I 626 61
R ACGGCTGACGACCTCACAC
Sequencing of lasI and rhlI genes: To search for the presence of mutations that may affect the QS genes, lasI
and rhlI underwent sequencing according to Senturk (23).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 305
Figure 1: Agarose gel electrophoresis (1.5%agarose, 7 V/cm2 for 90min) of 16SrRNA gene (956bp). Lane
M: represent 100bp DNA ladder, Lane C: represent negative control, Lanes 1-13: represent bands of
P.aeruginosa gene.
Molecular detection of (QS) genes by used specific have one or more of virulence factors, and one isolates
primers for lasI and rhlI genes showed that 48 (94.1%) of out of 51 negative for both QS genes. To determine if
isolates were positive for this gene, where are the bands QS genes have mutations in some isolate, sequence
appeared within the expected size of the gene (537bp) analysis of the PCR products showed that no difference
for all positive isolates (Figure 3) .While 44 (86.2%) of in sequences where the percent of matching 100% for
isolates have rhlI gene (Figure 3), the results pointed rhlI gene and 99% for lasI gene when comparing with
that 9 isolates have one of QS genes lasI or rhlI, and also the information bank within the site www.ncbi.nlm.gov.
306 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure 3: Agarose gel electrophoresis (1.5%agarose, 7 V/cm2 for 90min) for (a) rhlI gene (626bp) and
(b) lasI (537bp). Lane M: represent 100bp DNA ladder, Lane C: represent Negative control, Lanes
1-14, 18 represent bands of P.aeruginosa gene.
Abstract
Acute Myeloid Leukemias (AMLs) are rare but extremely malignant neoplasms that are liable for a big
amount of fatalities associated with cancer. Acute myeloid leukemia (AML) results from accumulation of
abnormal myeloblasts, most commonly in the bone marrow, leading to bone marrow failure and death. The
present study was carried out to evaluate MMP-2 and PG E2 in sera and of (50) AML Iraqi patients, In addition
to control group involving (50) matched apparently healthy subjects. This study was done in the National
center of hematology, Department of biology at AL-Mustansiyria University, Baghdad Medical City since
January 2019 to June 2020. The aim of study was to determine the level of total Matrix Metalloproteinase
2 and prostaglandin E2 in patients with AML by ELISA. and study the impact of these parameters on the
pathogenesis of disease, also predict the AML and how the parameters correlated with stages and severity
of disease and responsiveness to therapy. Conclusion: MMP-2 decreased and elevated of PGE2 in the serum
of AML patients .
Figure (1) Matrix Metalloproteinase 2 (Total MMP-2) concentration among patient and control
The concentration of prostaglandin E2 in AML Importantly, similar results were obtained (15) who
patient serum was (339.5± 60.8)while the concentration were show >100-fold PGE2 more than healthy control
of prostaglandin E2 of the healthy control serum were
(19.95±0.558) there were a highly significant differences The tumor-promotive activity of PGE2 regulated by
between patient and control ((P<0.01). the present result A vascular endothelial growth factor (VEGF) or cyclic
was agree with previous reports (9,24,30). Table (2) monophosphate-dependent adenosines (cAMP) pathway
(Figure (2) which induces an activation of the proliferation of the
cancer cell and has anti-apoptotic effects in various
The current result were agree with(22) who were tissues (34).
showed there was increase in the level of PG E2 in the
AML children compared with control .
Table (2): Prostaglandin E2 (PGE2) concentration among patient and control in serum . **(P<0.01)
Figure (2) Prostaglandin E2 (PGE2) concentration among patient and control in serum
In the course of current analysis, we examined serum The pervious study were measured the MMP-
samples of a total of 50 patients with Newly AML(8%) 9 level before treated with chemotherapy and after
(n =4), Partial remission AML(22%) (n=11), AML in treatment they showed decrease in the level of matrix
complete remission (10%) (n= 5), Refractory (36%) (n metalloproteinase in the patient with lung cancer (11).
= 18), and Relapse(24%) (n= 12).
While the concentration of Prostaglandin E2 were
The level of Matrix Metalloproteinase 2 (MMP-2) much higher in relapse patient (498±211 pg/ml) and also
were decreased in the relapse (2.23±0.8 ng/ml), refractory high in partial remission patients (347±132) and the level
(3.37±1.41 ng/ml),partial remission (3.57±1.54 ng/ of prostaglandin E2 in refractory (291.2±86.4),complete
ml) and newly diagnosis patients (2.03±1.55 ng/ml) remission (301±86.4) and newly diagnosis(246±140)
compared with healthy control (10.636±0.558 ng/ml) were higher than human control (19.95±0.558) Table (3).
Table (3). The present data agree with (32) who were Although there is a scarcity of researches that is similar
compared between AML-treated patients with intensive to the current research the current findings were agreed
chemotherapy, the expression of MMP-2 was not with (2) elevate of PGE2 that will lead to increases the
different in resistant cases and in patients with complete activation of Tregs and participates in the development
remission of Myeloid derived suppresser cell (MDSC) Such
cells infiltrate the microenvironment of the tumor and
MMP-2 pretreated lower than level of MMP-2 dampen the immune response of the tumor by inhibiting
post treated agreed with (3)However (23) who revealed the function of the T-cell effector, which in turn hampers
the patient with acute lymphoblastic leukemia (ALL) immunity against cancer(24).
patients, they found MMP-2 level were higher as
compared to BM donors.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 313
Table (3): AML patient Among All parameters and stages of disease
Abstract
The current study includes the detection of Aeromonas sobria isolates were obtained from total 157 samples
involved the clinical samples (diarrhea samples) from patients suffering from diarrheal infections during the
period from April 2017 to November 2017. at AL-Central Health Laboratory in Najaf governorate. These
isolates were diagnosed by four method as (Culture method, biochemical tests, Vitek@2GN cards system
and Polymerase chain reaction (PCR) technique). TheVitek@2GN cards system was the best method for
diagnosis, which have led to isolate and diagnosis of 33 isolate. Multidrug resistance (MDR) of bacteria
were detected by MIC testing and performed with the automated VITEK@2 GN/AST compact system.
A clear variation was observed in their susceptibility to 13 antibiotics disks, these isolates of A.sobria
were revealed resistance for some antibiotics such as Penicillin class Methicillin, Amoxicillin, Ampicillin,
Penicillin (100%), and (91.6%) for Carbenicillin, and high rates of resistance (100%) to Cephalosporins
that represented by Ceftazidime, Cefotaxime, Cefoxitin and Cefepime. The investigation of mobile genetic
elements among isolates demonstrated thatA.sobria have been Class I integron genes (class 1 integron
represented by integrase intI1, and IMP genes).
Keywords: Aeromonas soria, IMP gene, integrase intI1, Antibiotics and imipenem.
Fig. 2: Agarose Gel Electrophoresis (1.5%) of PCR products of IMP Genes (587bp) of A.sobria isolates for
(45) min at (100) volt.
Abstract
Background: Children under five years of age suffer from anemia is a common medical problem worldwide.
Iron deficiency anemia is the most prevalent in infants and has proven to be a public health issue. Many
studies have been conducted on anemia among infants but the scope of the studies focused on anemia
prevalence with less emphasis on anemia knowledge and parental practice.
Objective: To explore the level of parental knowledge, attitude, and practice towards iron deficiency anemia.
Method: A cross-sectional study in the first taken 150 children that attended to Children’s Counseling at
Madinah General Hospital from these in the second case control study show only 30 children that effect with
IDA and 30 children without IDA.
Results: In this study, the prevalence of anemia in less than two years is 46.7%. knowledge answers near
half study sample with their children previously diagnosed with IDA was 16 (53 %), the attitude of parents
about IDA between two groups not there is a significant relationship and most answers of parents with their
children previously diagnosed with IDA was between Fair 17 (57%) and Poor 11(36%), not there is a smaller
study in this article to refuse or accepted. Practices show a significant association between (case with IDA)
and (control without IDA) because (65% poor) practice About IDA in the case in other side control was
(26%) poor only About IDA in the differential in practice refer more vulnerable to the effect of children to
IDA.
Conclusion: Anemia is prevalent in infants 24 months old with substantial differences in parents’ knowledge
and practices.
Introduction
Anemia is one of the most widely held audiences
Corresponding Author: Problems with health, in particular in developing
Abbas Ali AL-Kinani countries. Its health, social and economic importance
Specialist in Epidemiology & Biostatistics, Wasit Following. Anemia According to WHO the most
Health Department, Iraqi Ministry of Health, Iraq common nutritional deficiency due to iron is Worldwide
e-mail: [email protected] disorder. Two billion people – more than 30 per cent
322 Medico-legal Update, January-March 2021, Vol. 21, No. 1
The world›s population – anemic, mostly because of ≤ 1 month: 200-600 ng/mL
iron Deficit 1
2-5 months: 50-200 ng/mL
Children under five years of age suffer from
anemia is a common medical problem worldwide. Iron 6 months-15 years: 7-142 ng/mL
deficiency anemia is the most prevalent in infants and Iron deficiency was defined as serum ferritin levels
has proven to be a public health issue. Many studies have of below 31 ng/ml, while iron-deficiency anemia was
been conducted on anemia among infants but the scope defined as hemoglobin of less than 11 g/dl and serum
of the studies focused on anemia prevalence with less ferritin of less than 31 ng/ml 4
emphasis on anemia knowledge and parental practice. In
Iraq, iron deficiency (ID) prevalence in children under 5. .Exclusion criteria: Children with hereditary
the age of five is 14.4%, and IDA prevalence is 6.8%. 2 blood diseases: thalassemia, sickle cell anemia and
macular (G6PD) glucose 6 phosphate dehydrogenase
Aim of the Study: To explore the level of parental deficiency excluded from this study.
knowledge, attitude and practice towards iron deficiency
anemia. 6. Measures and Parameters of KAP study
Regarding the Knowledge: The scale of the three
Method levels was rated on the 3 points (likert respondent scale)
1. Study Settings: In the Basra/Iraq, Children with it was scored as a scoring of agreed about by assigning
clinical signs of undernutrition were randomly a score of (3) for yes, (1) for (no) and score of (2) for I
selected from the Children›s Counseling at Madinah don’t know.
General Hospital by a pediatrician and newborn
Number of questions: 27
specialist in the Al-Madinah areas, north of Basra
Governorate, and laboratory investigation doing for Minimum =27, Maximum = 81, Medium =64
him including hemoglobin (Hb) and serum ferritin
measurement at nine months to 83 months. The medium was calculated for each participant
and those score below the medium (score < 64) consider
2. Study Design: This is case control study. poor score, (score > 64) good and acceptable score.
3. Data Collection: Data was collected over three
Questions was about Do you know what iron
months, from 7st January to 18nd April, 2020. Data
deficiency, symptoms of iron deficiency, causes of iron
(using a structured questionnaire tool) was obtained
deficiency, iron rich food, the negative effects of iron
from the parents of eligible infants through interview
deficiency, the source of your information about iron
(face to face).
deficiency anemia, Tea, coffee and milk are among the
4. Data Collection Tool: The data collection tool substances that reduce the body’s proper absorption
was based on medical references and previous of iron, A balanced diet should contain the following
researches The content validity was tested via ten nutrients, Iron deficiency anemia is one of the most
pediatric consultants working in Ministry of Health. common types and dietary anemia types.
The questionnaire is composed of three parts: the
first part is about the sociodemographic data of Regarding Attitude: A scoring of attitude divided
the parents. The second part includes questions into two score agreed about by assigning a score of (2) for
to explore the knowledge of parents about iron the answer by (agree), (1) for the answer by (disagree).
deficiency anemia,
Number of question: 10
Part Two: Laboratory measurements
Minimum =10, Maximum = 20, Medium =15
This part of the questionnaire consists of questions
related to child-related measures such as hemoglobin The medium was calculated for each participant and
level, serum ferritin level according Normal findings 3 those score below the medium (score <15) consider poor
score, (score > 15) good and acceptable score.
Hemoglobin = 1-6 years: 9.5-14 g/dL
Attitude was about are you with a child drinking tea
Ferritin = Newborn: 25-200 ng/mL with a meal, the child to drink iron drink after eating,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 323
iron drink children before eating, the child eating fruits the study was 46.7 between (9-23) month was suffering
regularly, eating red meat, eating ready-made juices, from IDA, and 43.3 control group, 72-83 month with
drinking cola and soft drinks, eating crackers (chips and high significant association between age group and
derivatives), eating breakfast daily, eating lunches daily study sample. This differential may be because of a split
and eating dinner every day. of age group to categories.
Regarding Practices: A scoring of practices agreed In another variable from DGDVs show not has the
about by assigning a score of (2) for the answer by (yes) association between group (case & control) but only
and (1) for the answer by (no). was weak a significant association in variable crowding
index P.Value < 0.05 half of the crowding index case
Number of question: 13 was (2.1- 4) and in control was (4.1- >5) person per bed
Minimum =13, Maximum = 26, Medium =24 in the room.
The medium was calculated for each participant and KAP study shown in figure (1) compressed between
those score below the medium (score <24) consider poor parents of children that attend to children’s constitution
score, (score > 24) good and acceptable score. asked about KAP about IDA.
Practice question was about does the child have Show in figures of knowledge does not have a
tea, drink tea with food or immediately after eating, eat significant association because the answer to the question
vegetables (spinach, parsley, radish, basil), eat fruits nearing.
regularly, eat red meat, eat chicken, eat eggs, eat ready- Also in figure attitude show non-significant
made juices, drink cola and soft drinks weekly, eat association P. Value > 0.05 because their attitude about
crackers (chips and derivatives), eat breakfast daily, eat IDA was smaller PV (0.024), but figure practice show
lunch daily and eat dinner every day a significant association between (case with IDA) and
Statistical analysis: Descriptive, frequencies, (control without IDA) because (65% poor) practice
central tendency, ANOVA, chi-square, correlation About IDA in the case in other side control was 26%poor
have been used to clarify the relationship between the only About IDA in the differential in practice refer more
research variables. The Statistical Package for the Social vulnerable to the effect of children to IDA.
Sciences (SPSS) version 24 was used in the statistical In table (1) show correlations between DGVs
analysis and treatments. and KAP study show a positive association between
The significance of different percentages (qualitative practices age group, occupation of father, and knowledge
data). Statistical significance was considered whenever (P. Value < 0.05) respectively, also show a significant
the P value was equal or less than 0.05. association between knowledge and SES (P.Value <
0.05) and gender (P.Value < 0.05).
Results
Data are collected orally by an interviewer using a
standardized questionnaire. The age group of children of
324 Medico-legal Update, January-March 2021, Vol. 21, No. 1
P. V = 0.068
c2 = 5.385
Good =2 (7%) Fair= 12 (40%) Poor= 16(53%) Good = 0 (0.0%) Fair= 20 (67%) Poor= 10(33%)
P. V = 0.856
c2 = 0.311
Good =2 (7%) Fair= 17 (57%) Poor= 11(36%) Good =2 (7%) Fair= 19 (63%) Poor= 9(30%)
P. V = 0.024
c2 = 7.498
Good =6 (8%) Fair= 7 (27%) Poor= 17(65%) Good =5 (17%) Fair= 17 (56%) Poor= 8(26%)
Figure (1)
Medico-legal Update, January-March 2021, Vol. 21, No. 1 325
Table (1): Correlations between Demographic and socioeconomic characteristics with KAP study
Crowding index
Occupational of
Educational of
Educational of
Knowledge
Age group
Correlations
Residence
Attitude
Practice
Gender
mother
father
father
S.E.S
C.C .202
Sex
Sig. .061
C.C .018 .114
Residence
Sig. .445 .193
**
Crowding C.C .138 .521 .171 -.049- -.266-* .029
index Sig. .146 .000 .096 .355 .020 .412
-.371- -.530-
C.C -.129- ** -.202- .493** .707** -.189- **
S.E.S
Sig. .163 .002 .061 .000 .000 .074 .000
*
C.C .040 -.236- -.110- -.113- .170 .110 -.179- .227*
Knowledge
Sig. .381 .035 .202 .195 .097 .201 .086 .040
C.C -.146- .081 .194 .212 .041 .010 .022 .054 .071
Attitude
Sig. .133 .268 .068 .052 .379 .470 .434 .340 .295
C.C .268* -.140- -.079- .125 .169 .408** .086 .007 .307** .016
Practice
Sig. .019 .143 .273 .171 .098 .001 .258 .478 .009 .453
C.C .647** .237* .156 .090 .098 -.168- .243* .034 .154 .062 .211
IDA
Sig. .000 .034 .117 .248 .228 .099 .031 .399 .120 .318 .050
Abstract
The study aimed to evaluate the beneficial effect of allogenic omental graft on esophageal healing in dogs.
Twenty healthy male adult dogs were used they were randomly divided into two equal groups (control
group 10, treated group 10). Under aseptic technique 4 cm skin incision was made in the midline of the
cervical(ventral) of animal by scalpel, after that the incision was sutured immediately by polyglycolic acid
suture materials 0.3 USP used simple continous technique, and the omental graft extracted from same animals
by laprotomy piece of greater omentum was then placed over the oesophagotomy incision of the experiment
group and secured in place with tacks sutures, In the control group, the esophagotomy suture line was left
without graft. Esophageal healing process follow up 1,2 and 3 weeks post operation by histopathological
examination, the result display in treated group on the first week post operation development of collagen and
lamina properia contain congested blood vessels with epithelial regeneration. 2 weeks post operation show
the epithelium of the mucosa of the esophagus was formed by hyperplasia of squamous cells. The surface
of these epithelia was covered by keratin with present of bundle of collagen and fibroblasts. 3 weeks post
operation showed the epithelium of esophagus was covered by keratin, with the presence of blood capillaries
and also, there was lymphocytic infiltration in the lamina properia with RBC. The tunica muscularis was
consisting of skeletal muscle fibers, inner longitudinal, and outer circular, proliferation of fibroblast with
deposition of collagen, while in control group histopathological examination in the first week show The
epithelium of the esophagus was stratified squamous with the presence of keratin on its surface, 2 weeks
post operation show The mucosa of the esophagus consisted of stratified squamous epithelium with a keratin
layer on its surface. The lamina properia was composed of loose connective tissue with infiltration of many
WBC and blood vessels, 3 weeks post operation show the basal layer of epithelium had many folds which
are interdigitation with the underlying lamina properia, which appeared loose connective tissue with few
numbers of fibroblasts and lymphocytes, the healing of treated group better than control group.
On day 14. The epithelium of the mucosa of the Figure 2: Stratified sequemous epithelium of
esophagus was formed by hyperplasia of squamous esophaguse (black arrow). lamina properia (red
cells which present with increasing of its thickness. arrow). (H&E X100)
The surface of these epithelia was covered by keratin
with present of bundle of collagen and fibroblasts. The
lamina properia was infiltrated with heavy population of
lymphocytes and other wbc with many blood capillaries
and larger congested blood vessels. The muscular coat
was formed by skeletal muscle fibers, these was an area
was devoid for these muscle but replaced by collagen
fibers of skeletal muscle and many blood capillaries
without blood, also present of many lymphocytes and
plasma cells (fig. 5).
Discussion
The cervical approach was chosen in this study
because we believed it is the easiest way to reach the
esophagus. Trans-abdominal approach and thoracotomy
in dogs are technically very difficult and accompanied
by high morbidity [9]. In esophageal surgery, there is a
higher risk of complications than in any other portion
of the digestive tract [10,11]. One explanation could be
that mesothelial cells are needed to promote anastomotic
healing [9, 12]. In the current study, the addition of NOA to
the esophageal suture line in an extra-abdominal position
might have provided the necessary mesothelial cells and
consequently promote healing. Some surgeons decided
Figure 4: Stratified sequemous epithelium of to use the pedicle omentum transposition for reinforcing
esophagus (red arrow), Lamina properia (black the anastomotic suture line to reduce the incidence of
arrow X20. leak significantly after esophagectomy and to decrease
the morbidity and mortality of the procedure(11). The
well-vascularized flap of omentum provides oxygen
and nutrient for improving healing. Moreover, the
omentum delivers vascular endothelial growth factor
and potent angiogenic growth factor (3); this substance
gives the ability to accelerate a neovascularization
cross anastomosis line (13). The exact mechanisms are
not completely understood, and there is some evidence
to suggest that neovascularization increases through
a process that is mediated by a lipid angiogenic factor
liberated by the omentum[14]. Goldsmith et al. [15, 16]
described the angiogenic properties of the omental
lipid factor and its ability to increase revascularization
and neovascularization. Accordingly, in our study, it
Figure 5: Hyperplasa of epithelium (black arrows), has been postulated that the transplanted NOA induced
Desqumated keratin (red arrow). X40. neovascularization, which is beneficial for esophageal
suture line reinforcement [9], possibly through the release
of its lipid angiogenic factors (particularly vascular
endothelial growth factor, VEGF). Nevertheless, it
should be noted that we did not use more rigorous,
accurate method, such as immunohistochemistry, to
quantify neovascularization. Another possible role for
the transplanted NOA in our study might be related to its
mechanical function. As a matter of fact, an explanation
for the impaired healing of cervical esophagotomies is
its close proximity to another fresh wound. Collagenase
levels might be higher in such an environment leading
to the weaker suture line and, therefore, leakage [9].
Hence, we assume that NOA, as a mechanical covering,
could keep esophagotomy suture line away from more
superficial fresh wounds in the region. Furthermore, it
Figure 6: Stratified sequemous epithelium (red has been presumed that the transplanted NOA played
arrow), (red arrow), blood vessels congestion (red another role as a space-occupying structure, exerting
arrow). X40. its enhancing function by diminishing regional dead
332 Medico-legal Update, January-March 2021, Vol. 21, No. 1
space from observation of experimental animals in Long-term functional outcomes after replacement
post-operational animals did not exhibit any signs of of the esophagus with gastric, colonic, or jejunal
anastomosis leak, and when euthanized the animals conduits: a systematic literature review. Dis
to take the specimen, it showed that’s all anastomotic Esophagus 30, 1, 2017.
site was normally healed without any dehiscence this 7. Urschel JD. Esophagogastrostomy anastomotic
study agree with (19). Also, all animals have no adhesion leaks complicating esophagectomy: a review. Am
and stricture this agree with (17) who showed no any J Surg 1995;169: 634-40
adhesion or stenosis at the site of anastomosis that used
8. Di Nicola, V. Omentum a powerful biological
omental pedicle, but its record increase in the thickness
source in regenerative surgery. Regenerative
of esophagus at the anastomosis site and it related with
Therapy, 2019. 11, 182-191.
the presence of omental pedicle. And disagree with (18)
that refer not to happen stricture in his study when used 9. Jansen PL, Klinge U, Anurov M, et al. Surgical
omentoplasty with diaphragmatic muscle in esophageal mesh as a scaffold for tissue regeneration in the
reconstruction. Our study 21 days post-operation esophagus. Eur Surg Res. 2004;36:104–111.
histopathologically showed formation of fibrous 10. Flanders JA. Problems and complications
connective tissue with infiltrated of fibroblast this agree associated with oesophageal surgery. Probl Vet
with (19) that refer in histopathological result showed the Med. 1989;1:183–194.
formation of fibrous connective tissue in adipose tissue 11. Lerut T, CoosemansW, Decker G, et al. Anastomotic
of omentum which infiltrated by inflammatory cells at complications after oesophagectomy. Dig Surg.
15 days post-operation in the treated group. 2002;19:92–98.
Conflict of Interest: None 12. Athar MT, Chaudhry NL, Shako RK, Khan MA.
Studies on end to end colonic anastomosis in
Funding: Self the dog: A compassion of technique. Acta Vet
Hung.1996;44:349- 354.
Ethical Clearance: Not required
13. Morgan E, Lima O, Goldberg M, Ferdman A, Luk
References S, Cooper J. Successful revascularization of totally
ischemic bronchial autografts with omental pedicle
1. Donington JS. Functional conduit disorders after flap in dogs. J Thora Cardiovasc Surg. 1982;84:204-
esophagectomy. Thor Surg Clin 2006;16:53-62 210.
2. Flanagan, J.C., Batz, R., Saboo, S.S., Nordeck, 14. Goldsmith, H.S.; Griffith, A.L. and Catsimpoolas,
S.M., Abbara, S., Kernstine, K., and Vasan, N. Increased vascular perfusion after administration
V. Esophagectomy and Gastric Pull-through of an omental lipid fraction. Surg Gynecol Obstet.
Procedures: Surgical Techniques, Imaging Features, 1986. 162:579–583.
and Potential Complications. Radiographics 36,
15. Goldsmith, M.S.; Griffith, A.L. and Kuperman, A.
107, 2016
Lipid angiogenic factor from omentum. J Am Med
3. Zhang QX, Magovern CJ, Mack CA, Budenbender Assoc. 1984. 252:2034–2046.
KT, Ko W, Rosengart TK. Vascular endothelial
16. Goldsmith, H.S. The Omentum. Research and
growth factor is the major angiogenic factor in
Clinical Applications. Berlin: Springer. 1988.
omentum: mechanism of omentum-mediated
angiogenesis. J Surg Res. 1997;67:147-54. 17. Zieren HU, Muller JM, Pichlmaier H. Prospective
randomized study of one or two - layer anastomosis
4. Hall JC, Heel KA, Papadimitriou JM, Platell C.
following esophageal resection and cervical
The pathobiology of peritonitis. Gastroenterology
esophaogastrotomy. Br J Surg.1993;80:608-611.
1998; 114:185e 96
18. Younis, B.Y. (2002). Esophageal anastomosis
5. AE. Oesophagus. In: Slatter D (ed) Text book
comparative study with or without use omental
of small animal surgery, 3rd edn. Saunders,
pedicle in dog. [master’s thesis]. College of vet
Philadelphia, 2003 pp 573–575
Med, Univ of Baghdad.
6. Irino, T., Tsekrekos, A., Coppola, A., Scandavini,
C.M., Shetye, A., Lundell, L., and Rouvelas, I.
DOI Number: 10.37506/mlu.v21i1.2330 Medico-legal Update, January-March 2021, Vol. 21, No. 1 333
Hayderkareemkataa AL-Aidy1, Ehab Dawood Salman2, Safa A Faraj3, Zaid Jamal Mahmood4
1
MSC Molecular Biology, Wassit Health Department, Ministry of Health, Iraq, 2Ph.D Molecular Biology
Department of Biotechnology, College of Science, University of Baghdad, Iraq, 3MD Pediatrics Hema-oncologist,
Wasit University, College of Medicine, Iraq, 4M.B.Ch.B . FIBMS, Congenital Bleeding, Children Welfare Hospital,
Medical City
Abstract
Case control study was used,with Glanzmann’s thrombasthenia (GT) patients (n=15) and healthy individual
control (n=20).
It was successfully identified three SNP in ITGB3 gene by using PCR technique and direct sequencing . The
first SNP c. * 1479T> C (rs115310198) was presented with three genotypes (TT, TC and CC). The genotype
frequencies of TT in control group (87.6 vs. 95 %) show non-significant difference (p>0.05) compared with
GT patients . It was also noticed the frequency of mutant allele (C) revealed non-significant difference (p >
0.05) in GT patients compared with controls group (13.3 vs. 2.5%; OR = 6; EF = 0.03; 95% C.I. = 0.65 to
55.05) that mean (C) allele is risk factor associated with GT patients .
The c.*713A>G (rs2317676) was given with three genotypes (AA, AG and GG) . The frequencies of these
genotypes show non-significant difference (p>0.05) between control and GT patient,while the mutant allele
(G) show non-significant difference (p > 0.05) in GT patients compared with controls group (16.6 vs. 5%;
OR = 3.8; EF = 0.4; 95% C.I. = 0.70 to 20.63) and it was risk factors of patient GT. The c.*1016T>A
(rs3809865) showed three genotypes (TT, TA and AA) with two alleles (T and A). The frequencies of these
genotypes TT (87.6 vs. 85 %), TA (6.6vs. 15 %) and the third genotype AA (6.6 vs. 0%) show non-significant
difference (p>0.05) between control and GT patient but the genotype (AA) (OR= 4.24) was considered as
risk factors with GT patients . It was also found the mutant allele (A) revealed non-significant difference (p
> 0.05) in GT patients compared with controls group (10 vs. 7.5%;OR = 1.37; EF = 0.11; 95% C.I. =0.26 to
7.14). (A) allele(OR = 1.37) is positively associated with GT patients and negatively associated with healthy
subject .
The SNP rs2317676 (c.*713A>G) at a place: C.I. = 0.70 to 20.63), while in the control group the
47310917 for chromosome (GRCh38.p12) was presented frequency of (A) allele show a non- significant difference
with two alleles (A and G) and three genotypes (AA, (p > 0.05) compared to GT patients (83.3 vs. 95%; EF
AG and GG). These genotypes showed deviation from 0.71; 95% C.I. 0.05 to 1.43) . In this case the (A) allele
HWE in GT patients, because there was a significant associated with healthy subject and non-associated with
difference between the observed and expected genotype GT patients(reciprocal OR = 3.8)and considered as
frequencies (p ≤ 0.05),it was also noticed the genotypes protective factor (Table).
frequencies (AA, AG and GG) show deviation from
HWE in controls group with significant difference (p ≤ The rs115310198 at position 47311683 for
0.05). Comparingcontrols to GT patients revealed that chromosome 17(GRCh38.p12) was presented with three
genotype frequencies of AA (80.6vs. 90%), AG (6.6vs. genotypes (TT, TC and CC), and two alleles (T and
5%), and The third genotype (GG) 13.3vs. 0% . These C) .These genotypes showed deviation from HWE in
genotypes were non-significant difference (P>0.05) GT patients, because there was a significant difference
compared between control and GT patient. it was also between the observed and expected genotype frequencies
noticed the frequency of mutant allele (G) show non- (p ≤ 0.001),it was also noticed a deviation from HWE in
significant difference (p > 0.05) in GT patients compared controls treatment with non-significant difference (p >
with controls (16.6 vs. 5 %; OR = 3.8; EF = 0.4; 95% 0.05). Comparing controls to GT patients revealed that
338 Medico-legal Update, January-March 2021, Vol. 21, No. 1
genotype frequencies of TT (87.6 vs. 95 %), TC (0 vs. (C) allele is risk factor associated with GT patients and
5 %), and The third genotype (CC) 13.3 vs. 0% . The negatively associated of healthy, while in the control
TT, TC, and CC genotypes were show non-significant group the frequency of (T) allele show non-significant
difference(p>0.05) between healthy subject and GT difference (p>0.05) compared to GT patients (86.6 vs.
patient . The CC genotype (OR= 7.5) was considered as 97.5; OR = 0.17; EF 0.37; 95% C.I. = 0.02 to 1.53) and it
risk factors . it was also noticed the frequency of mutant (OR = 6 reciprocal) was considered as protective factor
allele (C) show non- significant difference (p > 0.05) in of health subject (positively associated of health and
GT patients compared to controls (13.3 vs. 2.5%; OR negatively associated of GT patients) (Table).
= 6; EF = 0.03; 95% C.I. = 0.65 to 55.05) that mean
Abstract
An Incomplete abortion is one of the complications that often occur during pregnancy, but the biomolecular
mechanism is still unknown. It has proven to be an increase in apoptosis activity that is controlled by a
variety of proteins, including p53 Ser 46, Bcl-2, and caspase 3, in uteroplasenta and reproductive organs. The
aim of the study is to measure the level of protein p54 Ser 46, Bcl-2, and caspase 3 in abortion and normal
pregnancy. A case control study conducted in 38 cases of incomplete abortion and 38 normal pregnancies as
a control. The level of protein of Ser 46, Bcl-2, and caspase 3 examined by ELISA independent/Duplo. The
higher level of p53 Ser 46 (> 0,09 U/mL) led to higher risks of abortion with OR 8.52; 95% CI, 2.65 to 28.6.
The higher level of Bcl-2 led to higher risks of abortion with OR 3.75; 95% CI, 1.24 to 11.68. The higher
level of caspase 3 (> 7 mg/mL) and p53 Ser 46 (> 0,09 U/mL) led to higher risks of abortion with OR 71.15;
95% CI, 8.74 to 578.92; with the result of series p, p, 0.001; p < 0.008; and p = 0.001. Level of protein p53
Ser 46 and caspase 3 in abortion is higher than normal pregnancies, while the Bcl-2 protein levels in abortion
is lower than normal pregnancies.
Keywords: Burkitt cell lymphoma, cysteinyl aspartate specific proteinase 3, risk factors in abortion
The excessive apoptosis in syncytiotrophoblast will We examined the levels of protein p53 Ser 46, Bcl-
result in failure of pregnancy, in addition to the role of 2 and caspase 3 at the Laboratory of the Department
the decidua and plasenta to give support and protect of General Surgical Science, Graduate School of
embryo development. Result of human studies has not Medicine Gunma University, Maebashi, Gunma, Japan.
found an association between the gene p53 through The Shapiro-Wilk used for normality test data, the
the protein p53 expression on Ser 46 and Bcl-2 agains T test is used to compare two values average normal
caspase 3 in the first trimester and the association distribution of data, X2 test (Chi squared) was used to
with the incidence of abortion. Based on that, we were test for differences in percentage to the data presented
interested to investigate [17-19]. in contingency tables, Mann-Whitney test was used to
compare differences in 2 the middle value the data which
Research Method are not normally distributed, Rank Spearman correlation
The subjects were pregnant women with gestational test is used to find relationship between two numerical
age between 10-20 weeks who diagnosed with in variables, Odd ratio: in the case-control study pointed to
incomplete abortion (as the case group), whereas normal the ratio between the odds at-risk and non-risk groups,
pregnancy as a control group. The inclusion criteria logistic regression aims to analyze data in multiple
are 10 – 20 weeks of gestational age and maternal age independent variables and nominal numeric scale,
between 16 – 35 years. We excluded subjects with the nominal scale dichotomous dependent variable.
abnormal uterine; kidney disorders, heart disease, Significance based on the value of meaningful when
hypertension, diabetes mellitus, lung, thyroid, and p≤0,05, very meaningful p≤0,01.
other chronic diseases, malignancy; pregnant with help All of the subjects involved voluntary after receiving
medication or taking hormonal drugs. explanation of the advantages and disadvantages
This is a comparative analytic study with case (informed consent), the subject were also free to resign
control design. The sample size was determined at any time for any reason without causing changes in
based on the formula to test the hypothesis by using a the quality of service.
Table: 1. Characteristics of Subjects Research by Maternal Age, Total Parity and Gestational Age in
Normal Pregnancy and Abortion
Gestation
Characteristics Significance
Abortus (n=38) Normal (n=38)
Maternal age (year) ZM-W = 1.282 p = 0.200
< 20 2 (5.3%) 1 (2.6%)
20-24 4 (10.5%) 5 (13.2%)
25-29 18 (47.4%) 13 (34.2%)
30-35 14 (36.8%) 19 (50.0%)
`X (SD) 27.6 (4.2) 28.8 (4.6)
Median 28 29.5
Range 19-35 19-35
342 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Gestation
Characteristics Significance
Abortus (n=38) Normal (n=38)
Parity X2 = 0.234 p = 0.629
1-2 26 (68.4%) 24 (63.2%)
≥3 12 (31.6%) 14 (36.8%)
Range 19-35 19-35
Gestational Age X2 = 0.290 p = 0.990
10 week 9 (23.7%) 8 (21.1%)
11 week 7 (18.4%) 6 (15.8%)
12 week 10 (26.3%) 10 (26.3%)
13 week 6 (15.8%) 7 (18.4%)
14 week 6 (15.8%) 7 (18.4%)
Explanation: The p – value is calculated based on the Chi Square test or Mann-Whitney test
Meaningful when p≤0.05, very significant if p≤0.01;
ZM – W = Mann-Whitney
Table: 2. Comparative Levels of Protein p53 Ser 46, Bcl-2 and Caspase 3 between Normal Pregnancy and
Abortion
Gestation
Variable ZM-W p-value
Abortus (n=38) Normal (n=38)
p53 Ser 46 (U/mL) 4.413 <0.001**
`X (SD) 0.114 (0.023) 0.095 (0.013)
Median 0.11 0.09
Range 0.09-0.17 0.08-0.14
Bcl-2 (ng/mL) 1.928 0.027*
`X (SD) 7.265 (1.712) 7.493 (3.939)
Median 7.115 6.445
Range 2.60-11.15 5.58-29.44
Caspase 3 (mg/mL) 5.913 <0.001**
`X (SD) 112.74 (152.73) 14.94 (23.18)
Median 76.5 12.62
Range 6.50-707.75 0-76
Explanation: * = significant (p≤0.05), ** = very significant (p≤0.01);
ZM-W = Mann-Whitney test
Table: 3. Abortion Risks Based on Value Cut-off Levels of Protein p53 Ser 46, Bcl-2 and Caspase 3
Gestation
Variable P-values * OR (95% CI)
Abortus (n=38) Normal (n=38)
p53 Ser 46 (U/mL) < 0.001 8.52 (2.65-28.6)
`> 0.09 31 (81.6%) 13(34.2%)
< 0.09 7 (18.4%) 25 (65.8%)
Bcl-2 (ng/mL) 0.008 3.75 (1.24-11.68)
> 6.44 30 (78.9%) 19 (50%)
< 6.44 8 (21.1%) 19 (50%)
Caspase 3 (mg/mL) <0.001 71.15 (8.74-578.92)
>7 37 (97.4%) 13 (34.2%)
<7 1 (2.6%) 25 (65.8%)
Table 5: Opportunities occurrence of abortion based Risk Factors Levels of Protein p53 Ser 46, Bcl-2 and
Caspase 3
p53 Ser 46 (U/mL) Bcl-2 (ng/mL) Caspase 3 (mg/mL) Incident Abortion P (Y)x
≤ 0.09 ≤ 6.44 ≤7 0.008
≤ 0.09 ≤ 6.44 >7 0.291
≤ 0,09 > 6.44 ≤7 0.026
≤ 0.09 > 6.44 >7 0.583
> 0.09 ≤ 6.44 ≤7 0.043
> 0.09 ≤ 6.44 >7 0.701
> 0.09 > 6.44 ≤7 0.132
> 0.09 > 6.44 >7 0.889
In this study, table 3, 4, and 5 showed increased Conflict of Interest: The authors reported no
levels of caspase 3 was very significant in abortion conflicts of interest.
patients compared with normal pregnancy (p < 0.001).
This supports the theory that the higher the levels of Funding: This study is self-funding research.
caspase 3 in the first trimester of pregnancy will be more Ethical Clearance: The study was approved by the
at risk of pregnancy failure. Involvement proapoptosis Research Ethics Committee at the Faculty of Medicine
activators can cause excessive apoptosis, followed by Universitas Padjadjaran/Hasan Sadikin Hospital,
cell death characterized by increased levels of caspase-3, Bandung, Indonesia
and finally continue with abortion. Increased fetal
resistance to stress teratogen is an outcomes of maternal References
immunopotentiating associated with a decrease in the
intensity of apoptosis induced teratogenic substances on 1. Kurjak A, Chervenak FA. Donald School Textbook
fetal structure targets. These findings indicate maternal of Ultrasound in Obstetrics and.
immunopotentiating effect can be produced through the 2. Gabbe SG, Niebyl JR, Simpson JL, Landon MB,
modification of the expression of molecular regulation Galan HL, Jauniaux ER, et al. Obstetrics: normal
of apoptosis induced teratogenic substances. P53 and problem pregnancies e-book: Elsevier Health
expression increase significantly in pregnancies with Sciences; 2016.
fetal growth retardation, but did not get a reduction in the 3. Crum CP, Lee KR, Nucci MR, Granter SR, Howitt
expression of Bcl - 2 meaningful, The different results BE, Parast MM, et al. Diagnostic Gynecologic
shown in this study despite the increased levels of p53 and Obstetric Pathology E-Book: Elsevier Health
Ser 46 on abortion, the result the average levels of Bcl-2 Sciences; 2017.
in the study subjects who experienced abortion is lower 4. Catt JW, Henman M. Toxic effects of oxygen on
compared with normal pregnancy were significantly human embryo development. Human Reproduction.
different [12, 16, 17, 21, 22]. 2000;15(suppl_2):199-206.
The protein p53 Ser 46, Bcl-2 and caspase 3 was 5. Kurjak A, Chervenak FA, Carrera JM. The embryo
significantly associated with the incidence of abortion. as a patient: Parthenon Publishing; 2001.
Multivariable sequence of the protein was strongly 6. Jauniaux E, Farquharson RG, Christiansen
correlated with the incidence of abortion is caspase OB, Exalto N. Evidence-based guidelines for
3, following the protein p53 Ser 46, and last Bcl-2. the investigation and medical treatment of
Caspase 3 has the strongest risk for abortion because recurrent miscarriage. Human reproduction.
caspase 3 serves as the main effectors in both basic 2006;21(9):2216-22.
apoptotic pathway, namely receptor-mediated pathway 7. Sara H, Garmel M. Early Pregnancy Risks; Current
(extrinsic) and pathways mediated mitochondrial Obstetric and Gynecologic Diagnosis & Treatment.
(intrinsic). Abnormal embryonic development involves McGraw-Hill Companies; 2003.
several important things, namely: 1) apoptosis
8. Lashen H, Fear K, Sturdee D. Obesity is associated
induced teratogenic substances can cause structural
with increased risk of first trimester and recurrent
abnormalities; 2) the effect is obviously accompanied by
miscarriage: matched case–control study. Human
increased expression of TNF-α and TNFR 1 in embryonic
reproduction. 2004;19(7):1644-6.
organ; 3) resistance/sensitivity of the various structures
of the embryo to the substances teratogen depends on 9. Speroff L, Fritz MA. Clinical gynecologic
Medico-legal Update, January-March 2021, Vol. 21, No. 1 345
endocrinology and infertility: lippincott Williams Embryos Exposed to Stress. American Journal of
& wilkins; 2005. Reproductive Immunology. 2004;51(2):138-43.
10. Tomassetti C, Meuleman C, Pexsters A, Mihalyi A, 17. Toder V, Carp H, Fein A, Torchinsky A. The role
Kyama C, Simsa P, et al. Endometriosis, recurrent of pro‐and anti‐apoptotic molecular interactions in
miscarriage and implantation failure: is there an embryonic maldevelopment. American journal of
immunological link? Reproductive biomedicine reproductive immunology. 2002;48(4):235-44.
online. 2006;13(1):58-64. 18. Savion S, Lepsky E, Orenstein H, Carp H,
11. Pérez-Pérez A, Toro AR, Vilarino-Garcia T, Shepshelovich J, Torchinsky A, et al. Apoptosis
Guadix P, Maymó JL, Dueñas JL, et al. Leptin in the uterus of mice with pregnancy loss.
reduces apoptosis triggered by high temperature in American Journal of Reproductive Immunology.
human placental villous explants: The role of the 2002;47(2):118-27.
p53 pathway. Placenta. 2016;42:106-13. 19. Jerzak M, Bischof P. Apoptosis in the first trimester
12. Liu G-P, Wei W, Zhou X, Zhang Y, Shi H-H, Yin human placenta: the role in maintaining immune
J, et al. I2PP2A regulates p53 and Akt correlatively privilege at the maternal–foetal interface and in
and leads the neurons to abort apoptosis. the trophoblast remodelling. European Journal
Neurobiology of aging. 2012;33(2):254-64. of Obstetrics & Gynecology and Reproductive
13. Leber B, Lin J, Andrews DW. Embedded together: Biology. 2002;100(2):138-42.
the life and death consequences of interaction 20. Marchetti T, Cohen M, De Moerloose P. Obstetrical
of the Bcl-2 family with membranes. Apoptosis. antiphospholipid syndrome: from the pathogenesis
2007;12(5):897-911. to the clinical and therapeutic implications. Clinical
14. Lea RG, Riley SC, Antipatis C, Hannah L, Ashworth and Developmental Immunology. 2013;2013.
CJ, Clark DA, et al. Cytokines and the regulation 21. Reed JC. Bcl-2–family proteins and hematologic
of apoptosis in reproductive tissues: a review. malignancies: history and future prospects.
American Journal of Reproductive Immunology. Blood, The Journal of the American Society of
1999;42(2):100-9. Hematology. 2008;111(7):3322-30.
15. Brill A, Torchinsky A, Carp H, Toder V. The role 22. Nurdianto AR, Suryokusumo MG. Elevation of
of apoptosis in normal and abnormal embryonic Bcl2 Expression in Spiralis Artery of Pregnant
development. Journal of assisted reproduction and Rattus norvegicus Infected with tachyzoite of
genetics. 1999;16(10):512-9. Toxoplasma gondii with Hyperbaric Oxygen
16. Torchinsky A, Toder V. To Die or Not to Die: the Therapy. Qanun Medika Jurnal Kedokteran FK
Function of the Transcription Factor NF‐κB in UM Surabaya. 2019;3(2):157-67.
346 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2332
Hujaefa Hi Muhamad1, Titi Rapini2, Sri Sugiharti3, Alip Sugianto4, Siska Diana Sari5
1
Lecturer, Universitas Khairun, 2Lecturer, Universitas Muhammadiyah Ponorogo, 3Lecturer, Universitas Riau
Kepulauan, 4Lecturer, Universitas Muhammadiyah Ponorogo, 5Lecturer, Universitas PGRI Madiun
Abstract
Javanese ethnic Panaragan culture is very diverse. One of them is the traditional Javanese ethnic Panaragan
home. The home as a shelter is expected to bring outer and inner health to its inhabitants. The concept
of a healthy house can be known to the mindset of the people contained in language. The theory used
is ethnolinguistics which views language tends to reflect the mindset of a society. The method is used
ethnoscience by analyzing linguistic utterances in the realm of building a healthy house. As a result, there are
outer and inner concepts before building construction, healthy house space and griyowingking concept that
reflects a healthy home mindset for the comfort and safety of a residence which is summarized in language
patterns.
Daldini and Wistodiyono state that houses are not Theory and Method
only a building for shelter and rest but according to
Javanese ancestors used as a symbol of worship to Sang The theory used in this study refers to the adjusted
Hyang MahaWasesa.(2) Thus it can be understood that Sapir-Whorf hypothesis, namely, that basically language
Javanese society has a close relationship with mindset tends to reflect the mindset of a society. In other words,
with a belief that expresses a form of gratitude to the the language tends to reflect the ethnic mindset as
creator of the universe, with the hope of life in the contained in the knowledge system. (3) This study uses
household ark in a house always in His shade. For this an ethnoscience approach. The focus of attention is
reason, the Panaragan Ethnic Javanese Society before the principles of classification as expressed.(4)(5) This
setting up a house usually determines the best day, method is applied in an effort to find activities that
among other good days. On that day held a celebration apply to the Panaragan Javanese society in order to
of thanksgiving to God through the ritual selametan by find patterns related to how to build a healthy home,
presenting the neighbors led by warok (figure of society) ways before building healthy homes, patterns of form
or kyai (traditional religious scholar) as selametan and architecture that reflect their world view and other
ritual leaders who are believed to have closeness to the empirical concepts that apply on the Javanese Panaragan
strength believed. This activity, carried out in the hope society.
of obtaining the safety of the Almighty.
Results and Discussion
Besides that, in building a house, avoid locations
(a) The Concept of Ethnic Panaragan Inner Healthy
called sunduk sate (like satay) or just in front of the
Home: To create an inner healthy atmosphere, in
three way intersection (totokan). This perception is
building a house, the Javanese Panaragan ethnic
based, because of the safety factor which is of course
society first saw the place to be used which included
the location of the sunduk sate is worrying if there is an
the location and type of land. The location that is
accident that usually occurs due to someone’s negligence
used is safe from various possible disaster threats,
in driving a vehicle. In addition, this assumption also
such as landslides and floods that can occur naturally.
underlies psychologically it can disrupt the peace and
These considerations are chosen carefully, so that in
tranquility of the soul for residents because every day
the future there is no unwanted thing that can harm
they are faced with a vehicle that seems to go to the end
materially and immaterially. Although every human
of the road or called a taboo so that it is not good for the
disaster does not want, alert is the main road. The
health of the owner’s soul because his heart is likened to
calculation of the location is an important factor
every day crash (sunduki).
because many people experience material losses in
Abstinence (Pantangan) in building a home in the form of assets in the event of a natural disaster or
the Panaragan Javanese Ethnic society, of course immaterial in the form of psychological psychology
has a consequence that will occur if these restrictions such as traumatic, especially if left by a loved family
are violated by the society. Even though this belief Experience the history of land by the Panaragan
is increasingly fading, some people avoid it as a ethnic society as one of the important elements in
precaution. Therefore, in building a house, requires some building a home or buying a home. Therefore, you must
consideration of certain aspects in maintaining harmony first know the origin and history. In building a home, the
between physical and mental health. That is, the house Panaragan ethnic society after determining the location
that will be built gives comfort and tranquility in terms and history is free from the problems, then the next step
of physical buildings that affect the health aspects of is usually by holding calculate the day (pitungdino) with
the householder’s inner, but also gives spiritual health the use of the Javanese calendar. The person appointed
to the residents of the home because it brings peace is usually called pujonggo or a friend who is believed
and tranquility to the inhabitants. This study aims to to be smart and has the accuracy in determining the
348 Medico-legal Update, January-March 2021, Vol. 21, No. 1
best day between good days or called the exspresion of kitchen smoke, lighting, cages, and yard utilization.
linguistic nagadino. From these elements, above the construction structure
of the shape and space of the Javanese Panaragan ethnic
After the process of determining the day is good, the house is generally the same as the other traditional
next step is the process of surgical earth (ndudukris) in Javanese traditional houses.
modern terms now known as the laying of the first stone
by holding selametan inviting relatives and tonggoteparo According to Yunitathe main home is at least
to run the hajadan and prayer together to make a circular composed of three masses of this building, surrounded
formation in the place of the house to be built like by a wide yard.(9) The yard consists of latarngarep, on
a pager with the purpose of the home to be built is to the front, latarmburi, in the back and latarwetan and
avoid danger through prayer pagers in a circle sitting latarkulon on the side. Ngarep or front yard is an average
cross-legged in the middle of uborampe in the form of of 10 m to 15 meters of roadside, serves to dry the
chicken, banana, jenangsengkolo, money and eggs. This harvest. The background (latarmburi) is large to occupy
concept then becomes a life guideline for some Javanese sumur, jedhingblandhong (bathroom), kakus (WC), and
people in building a home that is very concerned about pawuhan (trash bins) tegalan and stables. side yard of
the harmony of inner and outer, because the house is the latarwetan is on the east side, while the latarkulon is
used for a long period of the time, so keeping the house on the west side, serves for moor or gardens and places
into a comfortable residence is a must even though in the blumbang or fish pond
form of a home that is not too luxurious, but it’s more
important to live happily and always bring blessings. c. The Variety of Ornaments: Art of Architecture
and symbolic meaning: The shape of the roof of
b) The concept of Physic Panaragan Ethnic a traditional Javanese Panaragan ethnic home has
Healthy Home: The home is a physical structure an interesting variety of decoration and architecture
consisting of room, yard and surrounding area that from a certain point of view. The variety, among
is used as a place of residence and means of family others, is found in the upper part of wuwungan
formation.(6)While the understanding of houses in the Panaraganjoglo house. The position of
according to WHO (World Health Organziation) is wuwungan which has an angle and aesthetic value
a physical structure or building for shelter, where is a symbol of the service of the crown of the king.
the environment is useful for physical and spiritual The ornament, sometimes resembling a tiger’s ear,
health and social conditions both for family and symbolizes the strength and dignity of a house.
individual health.(7) The function of the house is as
The decorative model is in the form of decorations
a place to let go of fatigue, socializing, fostering
with various shapes and motifs. Soko is a foundation that
a sense of kinship between family members,
serves to support the roof. Soko on the upper end usually
sheltering and storing valuables, and as a symbol of
has ornate carvings in the form of lists and carvings and
social status.(8)
at the bottom there is a umpaktampak that supports the
A healthy home is a physical structure of the building mighty. This Soko is often in the belief of the ancients
as a shelter or shelter and a place to rest so that it grows given a rope bond as a tight binding symbol of a single
a perfect life both physically, spiritually and socially entity, if someone who comes then feels comfortable,
culture and free from illness or weakness (Disability). like there is a brotherhood among guests who present
In general, the house is said to be healthy if it meets the with the home owner as a symbol of brotherly ties by
following criteria.(7) visiting each other. Tumpangsari is an ornament as
a form of aesthetic creation by placing tumpangsari
Physical aspects of the building for the Panaragan towards the outer midhangan and overlapping towards
ethnic society have several elements of a standard healthy the midhangan. According to Susilo The number of
home. A healthy home must have several important tumpangsari levels varies.(10) The number of levels is
components. Among other things are the components or no provision, depending on the availability of materials.
structure of the house, sanitation and healthy behavior which means showing the level of ability of homeowners.
of the occupants, which are then elaborated in the form The use of overlapping is not mandatory, but when using
of more indicators, namely components, structure overlapping the number of levels must be odd, three
and condition of the ceiling, walls, floors, windows, levels or five levels or not at all.
bedrooms, living room windows, ventilation, holes
Medico-legal Update, January-March 2021, Vol. 21, No. 1 349
The difference between tumpang and tumpangsari day by performing a petungandino tradition at the time
in addition to its position, as well as its structural of the earth in the hope that the house to be built brings
aspects. Tumpangsari supports the roof, its function is blessing During this process, the Ponorogo society
related to the function of the other elements, so it cannot also held a salvation as a form of gratitude to God by
be replaced at any time. Tumpang functions only as a holding a prayer together inviting the brothers, relatives
cover of the bottom roof cavity, do not support the and neighbors to join together to win the divine blessing
structural system. Then tumpang can be replaced, added of God. As for outwardly the concept of healthy ethnic
or reduced the level. Even carving decorations can also panoramic house is reflected in the safe construction,
be given, of course the other elements of the carving ornamental variety as a form of symbolization that
must be adjusted. reflects hope and prayer, healthy space with adequate
ventilation and lighting, clean floors, and sanitation
d. The Healthy Space: Expression of forms of air facilities that are protected from pollution and landfills
ventilation and lighting functions: Ventilation which is adequate as a form of behavior to maintain the
is a process of circulating air that enters the room health of its inhabitants. The concept that is actualized
naturally. Air ventilation serves to keep oxygen becomes an integral unity to realize a healthy home
levels intact and affect the level of humidity in a room avoiding various kinds of hazards, and diseases that can
Inside the traditional Panaragan ethnic home there be caused by lack of concern for health factors.
are usually two windows consisting of one window
on the west side and one window on the east side. Conflict of Interest: No
This ventilation, has a philosophy of air entering
from one side can come out on the other side so that Ethical Clearance: Yes
the air in the room will continue to experience change Source of Funding: Authors
and freshness for the occupants in it. In addition this
ventilation also functions as lighting in the morning References
and evening so that at that time there is no artificial
lighting as it is now, the room will remain bright 1. Sutarto A. Studipemetaankebudayaan Jawa Timur
even though there are no lights because the sun in studideskriptifpembagian 10 sub kebudayaan Jawa
the morning and evening can enter the room. This Timur (The mapping study of the cultures in East
concept indirectly has implications for the health Java: The descriptive study on the 10 sub-culture
of the residents of the house because in addition divisions in East Java). Jember: Program Studi-
to maintaining the circulation of air freshness in Antropologi, FisipUnej;2004.
helping breathing can also avoid moisture which 2. Wistodiyono & Daldini.Ilmuslamet (Merangkai-
can lead to susceptibility to disease seeds.(11) This mutiarafilsafat Jawa di era moderinisasi dan glo-
simple concept influences the pattern of action in balisasi) (The knowledge of safety: The Javanese
the expression of embodiment of a healthy home philosophy in the modernization and globalization
according to the Panaragan ethnic community. era). Jakarta: PT Bhuana IlmuPopuler; 2010.
Therefore, usually on the side of the house there 3. Fernandez IY. Sakit dan sehatdalampandangan
are emperkiwo and empertengen. Emperkiwo as the orang Bantik dan Tonsawang: Studietnolinguistik
road to pasucen is a place to clean yourself or the di Sulawesi Utara (Sick and healthy in the perspec-
bathroom and toilet As for empertengen as the road tive of Bantik and Tonsawang people: The ethno-
to the pawon and storing agricultural products such linguistic study in North Sulawesi). Yogyakarta:
as grain, casava, and corn Universitas Gadjah Mada; 1998.
Abstract
The existence of the Regional Representative Council (DPD) in the constitutional structure in Indonesia
can strengthen the parliamentary system which in turn can strengthen democracy. The substance of regional
representation in the DPD is the accommodation of regional interests which is guaranteed constitutionally
and elaborated with laws and regulations. This study is to analyze the reconstruction of DPD’s regulatory
functions in the fields of legislation, supervision and consideration. The regulation of DPD functions in the
field of legislation, supervision, must be reconstructed in the 1945 Constitution of the Republic of Indonesia
with the formulation of “legislative and oversight power exercised by the DPR and DPD” which is to replace
the regulation of the DPD function in the legislative field which is limited to filing bills and participating in
discussions at level I, but do not have authority for the decision making stage. Also the DPD does not have
a supervisory function, because the DPD cannot follow up on the results of supervision and the follow-up
to the results of supervision is a political and legal determination by the DPR (House of Representatives).
Abstract
The purpose of this study is to investigate the association between knowledge and attitude on quality of life
among diabetic patients type 2 in Palestine.
Method: A cross-sectional quantitative descriptive study that contains a sample of 120 diabetic patients
were selected from Nablus hospitals and outpatient clinics to assess the level of knowledge and attitudes
toward self-care and health-related quality of life.
Results: The mean score of Michigan Diabetic Knowledge Test was 8.04±2.48 and this consider a moderate
level. Of 120 diabetic patients, 27.5% had poor knowledge; 65.5% had moderate knowledge, and only 6.6
% had good knowledge. The mean for attitude score of all respondents was 125.4±10.57 and this consider
a positive attitude. There was a significant positive association between knowledge, attitude with HRQol
(P=0.00). The mean for HRQoL score was 0.72 and it represented a moderate level of quality of life.
Conclusion: Level of knowledge scores and HRQol were moderate and attitude toward the disease was
positive in type 2 diabetic patients in Palestine, and there was a strong association between knowledge,
attitude on HRQoL.
Settings: Sample recruited from, hospitals and 2. EuroQol five-dimensional (EQ-5D) to asses
outpatients’ units of Nablus, Palestine. HRQOL, it consistsfrom two parts. The first part
talks about self-reporting their health status, it
Sample and Population: a sample of 120 Patients talks about 5 dimensions: mobility, self care, usual
aged 18 years and above, with a confirmed diagnosis of activities, pain\discomfort, anxiety\depression, Each
DM-II and willing to participate were included in this dimension contains from five levels of severity,
study. While patients who were pregnant, documented (no problems,,slight problems,moderate problems,
psychological problems, mental illness and who have severe problems, unable problems). The range of
diabetic complications renal failure, retinopathy, and the each dimension was formed from 1 to 5, where
diabetic foot were excluded. the five is the highest score of the item known as the
highest level of quality of life and the 1 represents
Data collection Procedures: Data collection started
the low level of quality of life. The second part that
after ensuring ethical approval from the Institutional
was conducted contain a visual analog scale (VAS),
Review Board (IRB) Committee of the College of
with endpoint were 0 represent bad health status
Medicine, An- Najah University. Arabic versions of the
and 100 represent excellent health status, that was
tools were used adopting the who guideline in translation.
conducted to assess and record each of the subjects
Instrumentation: The data collected using the about their perception on her or his quality of life.
following instruments Findings:
1. Demographic data that include gender, age, marital Demographic Characteristics: 140 patients
status, type of treatment, HbgA1C, and duration of approached and 120 questionnaires completed, with
the disease. response rate of 85%. the mean age (SD) was (57.83±
2. Michigan diabetic knowledge test (MDKT) to asses 12.69) years; Mean HbA1c was (8.41±1.55) and the
level of knowledge, it consists of 14 multiple-choice mean duration of diabetes was (10.24± 8.28) years,
items. Each one of the patients was asked to choose 52.5% were female, 65.8% (n = 79) of the participants
only one answer for each question, the correct answer were married. About 60.8% (n =73) had average
scored one point, and the false answer scored zero. income, About 36.7% (n = 44) had a High school level
The range of the knowledge test was from 0 to 14 of education.
where the higher score of the test, the higher level
Medico-legal Update, January-March 2021, Vol. 21, No. 1 357
Table 1: Characteristic of the patients (N = 120) to food that should not be used when blood glucose was
low(68.3% were incorrect). Questions regarding the
Variable Frequency Percentages effect of unsweetened fruit juice on blood sugar (62.5%
Gender were incorrect), which foods contained the fattest also
Male 57 47.5% tended to be answered incorrectly (60% were incorrect).
Female 63 52.5%
Marital status
Differences in knowledge and attitude related
Married 79 65.8% to socio-demographic characteristics: According to
Single 11 9.2% knowledge among female and male patients, it wasn’t
Divorce 9 7.5% significant (p=0.5) also the attitude score wasn’t
Separated 3 2.5% significant (p=0.081), The age wasn’t significant for
Widowed 18 15% both attitude (p=0.11) and knowledge score (p=0.081),
Economic status According to marital status, it was only significant for the
Low income 39 32.5% knowledge score (p=0.005), divorced females slightly
Moderate income 73 60.8% more knowledgeable toward DM (8.44±2.4), according
High income 8 6.7% to attitude score it wasn’t significant.According to
Educational level economic status, it was significant both for knowledge
Elementary 41 34.2% (p=0.007) and attitude score (p=0.001), patients who
High school 44 36.7% had moderate-income has better knowledge(8.54±2.39)
Diploma 7 5.8% and better attitude (128±9.5). According to the education
Bachelor 17 14.2% level it was significant for the knowledge score
Master 2 1.7% (p=0.01) the patient who has a master’s degree is more
Another thing “ illiterate” 9 7.5% knowledgeable about DM for the score of(11±0.00).
Are you under diabetic But the attitude score wasn’t significant, for those
treatment? who receive a different type of treatment, it show
Yes 118 98.3% only significance for attitude score (p=0.014), and the
No 2 1.7% highest score was for those who receive diet treatment
Type of treatment (126.2±11.6), the knowledge score wasn’t significant
Medication/insulin 69 57.5% (p=0.107). According to the result of the last HbA1c,
Diet 4 3.3% it was significant for the knowledge score p= (0.028)
Insulin+diet 47 39.2% and attitude score (p=0.02) the highest result was for a
How much the last patient with HbA1c 7-8(128+-8.40), According to the
HbA1c duration of DM it was significant for the attitude score
<7”acceptable” 53 44.2%
with (p=0.02), those who have DM between 6-10 years,
7-8”good” 16 13.3%
have a better attitude(129.9±7.5) but it wasn’t significant
> 8”poor” 51 42.5%
for knowledge score.
Duration of diabetes
years 5 years or less 42 35% Differences in wellness scale related to socio-
6-10 42 35% demographic characteristics: According to gender,
11-15 14 11.7% there was no significance for the wellness score (EQ-
16-20 9 7.5% VAS) (p=0.88) and the (EQ-5D)(p=0.8). The marital
More than 20 13 10.8% status showed that there was significance in Qol, single
Patients had higher scores than married (20±5.6 vs.
Knowledge of DM: The mean score of the MDKT
19.7±5.8) for (EQ-5D). According to the economic status,
was (8.04±2.48), indicating that, the patients had a
it shows significance for both EQ-VAS (P=0.000) and
moderate level of knowledge about diabetes, good
EQ-5D (p=0.00), the patient who has moderate income
knowledge was most apparent in response to the questions
present the highest score for wellness (75.44±17.6) for
related to the problems that usually not associated with
EQ-VAS. The education level shows significance for
diabetes (80.8% were correct) and the effect of exercise
the EQ-VAS (p=0.000) and EQ-5D (p=0.000), for those
on blood glucose (80.8% were correct), Poor knowledge
patients who have a master and bachelor’s degree, they
was most apparent in response to the questions related
have the highest QOL (24±1) for (EQ-5D). According to
358 Medico-legal Update, January-March 2021, Vol. 21, No. 1
the duration time of DM, it show significant for the EQ- of pharmacy & bioallied sciences, 2016. 8(3): p.
VAS (p=0.012) and the EQ-5D(p=0.006), for those who 195.
had DM duration of 5 years or less, show the highest 2. Adepoju, O.E., The triad of diabetes, hospitalization
wellness score (73±22.4) for(EQ-VAS). For 5- and work-productivity losses. 2013, The Texas A
& M University System Health Science Center.
Discussion
3. Abu-Rmeileh, N.M., et al., Forecasting prevalence
In this study the mean score of knowledge was of type 2 diabetes mellitus in Palestinians to 2030:
(8.04±2.48), while using the Michigan diabetic validation of a predictive model. The Lancet, 2012.
knowledge test (MDKT), that was an indication of 380: p. S21.
moderate knowledge. The results are is consisted with 4. Guariguata, L., et al., Global estimates of diabetes
previous report[1, 11-15]. Also, 60% of the patients were prevalence for 2013 and projections for 2035.
incorrect regarding the food that contain most fat and Diabetes research and clinical practice, 2014.
this consist with indicating that patients with DM-II 103(2): p. 137-149.
had poor knowledge about the effect of unsweetened
5. Hamdan-Mansour A, Marmash L, Elayyan R,
fruit juice on blood sugar and the food that contain most
Hyarat S. Difference in perception between nurses
fat. In this study, we found that there is a relationship
and patients related to patients’ health locus of
between educational level and knowledge score in which
control. Int J NursPract 2014; 20: 242-249.
those participants with master degree got the highest
score(11+-00) and this consist with these studies[16-20]. 6. Ansari, T., et al., Assessment of knowledge,
It is obvious from previous studies that type 2 diabetic attitude, and practice of dietary pattern in patients
patients have lower scores of HRQoL than rest of with type 2 diabetes mellitus: a locality-based
populations of similar age. In this study, the mean of perspective study. International Journal of Medicine
EQ-5D score in type 2 diabetic patients was 0.72, which in Developing Countries, 2019. 3(7): p. 581-585.
is considered a moderate score, and this consistent with 7. Rubin, R.R. and M. Peyrot, Quality of life and
other studies that reported mean EQ-5D scores as 0.74, diabetes. Diabetes/metabolism research and
0.69, 0.70, 0.71 and 0.70[21-23]. reviews, 1999. 15(3): p. 205-218.
8. Saleem, F., M.A. Hassali, and A.A. Shafie, A cross‐
Conclusion sectional assessment of health‐related quality of life
In this study, level of knowledge was a moderate, (HRQoL) among hypertensive patients in Pakistan.
attitude was positive, and the level of HRQOL was also Health Expectations, 2014. 17(3): p. 388-395.
moderate level. Patients who receive diet management 9. Rwegerera, G.M., et al., Health-related quality of
had high attitude score, high score of knowledge and life and associated factors among patients with
attitude reported in 7-8 HbA1c. It is recommended to diabetes mellitus in Botswana. Alexandria journal
conduct a longitudinal study that address consequences of medicine, 2018. 54(2): p. 111-118.
of poor knowledge and low quality of life. 10. Hamdan-Mansour A. Sociodemographic correlates
of somatic symptoms of older persons in Jordan.
Conflict of Interest: The authors declare no conflict
Jordan Med J 2017; 51 (3): 119-130.
of interest related to publication of this article.
11. Hamdan-Mansour AM, Al Abeiat DD, Alzoghaibi
Financial Disclosure: There is no financial IN, Ghannam BM, Hanouneh S I. Psychosocial and
disclosure. sociodemographic correlates of life satisfaction
among patients diagnosed with cancer in Jordan. J
Ethical Clearance: the study has been approved by
Cancer Edu 2015; 30(1): 31-36.
the ethics and research committee at An-Najah National
University 12. Darawad MW, Hammad S, Mosleh S, Samarkandi
OA, Hamdan-Mansour A, Khalil AA, Arabiat
References D. Psychosocial correlates of diabetes self-
management practices. Iran J Public Health 2017;
1. Al-Aboudi, I.S., M.A. Hassali, and A.A. Shafie, 46(6): 771.
Knowledge, attitudes, and quality of life of type 2
13. Al Khatib A, Hamdan-Mansour A, BaniHani M.
diabetes patients in Riyadh, Saudi Arabia. Journal
Medico-legal Update, January-March 2021, Vol. 21, No. 1 359
Theoretical perspectives of hospitalized older 19. Hamdan-Mansour AM, Dardas LA, Nawafleh H,
patients and their health-related problems and Abu-Asba MH. Psychosocial predictors of anger
quality of care: systematic literature review. The among university students. Children and Youth
Open Public Health Journal 2017; 10: 215-225. Services Review. 2012 Feb 1;34(2):474-9.
14. Khatib A, Hamdan- Mansour A, Ratrout H, 20. Ghannam B, Hamdan-Mansour A, Al Abaiat D.
Alenezi A, Chahien T. Testing the effectiveness Psychosocial predictors of burden among caregivers
of integrated elderly care model on quality of care of patients with serious mental illness in Jordan.
and health outcomes among hospitalized elderlies Perspectives in Psychiatric Care. 2017;53(4):299-
in West Bank. Malaysia Journal of Public Health 306.
Medicine 2020; 20(1): 82-89. 21. Hamdan-Mansour AM, Constantino RE, Farrell
15. Mahadeen A, Hamdan-Mansour A, Halabi J, M, Doswell W, Gallagher ME, Safadi R, Shishani
Habashneh S, Bani Kenanah A. Psychosocial KR, Banimustafa R. Evaluating the mental health
wellbeing of infertile couples in Jordan. East of Jordanian women in relationships with intimate
Mediterr Health J. 2018; 4(2):169-176. partner abuse. Issues in Mental Health Nursing.
16. Mufunda, E., et al., Level and determinants of 2011 Sep 23;32(10):614-23.
diabetes knowledge in patients with diabetes 22. Hamdan-Mansour A, Shehadeh J, Puskar K, El-
in Zimbabwe: a cross-sectional study. The Pan Hneiti M, M Haourani E. Investigating physical,
African Medical Journal, 2012. psychological and social well-being of older
17. Dreidi H, Hamdan-Mansour A. Pain, Sleep persons in Jordan. Current Aging Science. 2017
Disturbance, and Quality of Life Among Palestinian Aug 1;10(3):217-23.
Patients Diagnosed with Cancer. J Cancer Edu 23. Hamdan-Mansour A, Nawafeh D, Hanouneh S,
2016; 31 (4): 796–803. Al Omari H. Psychosocial aspects of patients
18. Zowgar, A.M., M.I. Siddiqui, and K.M. Alattas, diagnosed with Diabetes mellitus type-II in Jordan.
Level of diabetes knowledge among adult patients International Journal of Diabetes in the Developing
with diabetes using diabetes knowledge test. Saudi Countries. 2015; 36:65-9.
medical journal, 2018. 39(2): p. 161.
360 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2335
Abstract
Female workers are a vulnerable group in Indonesia because in addition to working to help their husbands
earn a living, they also still have to be responsible for domestic affairs. This study aimed to analyze the effect
of the level of education on the incidence of LBW in female workers in Indonesia. The analysis uses the 2017
Indonesian Demographic and Health Survey data. Stratification and multistage random sampling method get
18,061 female workers as respondents. The final stage was done using binary logistic regression. The results
found that there was no difference between primary education female workers and no education female
workers at the risk of giving birth to LBW babies. Secondary education female workers have a 0.561 times
chance compared to no education female workers to give birth to LBW babies. Meanwhile, higher education
female workers have a possibility of 0.414 times compared to no education female workers to give birth to
LBW babies. Apart from the education level, the results of the analysis also found two other variables as
predictors of LBW among female workers, namely wealth status and ANCvisits. It was concluded that the
education level is a predictor of LBW among female workers in Indonesia. The higher the education level,
the lower the possibility of female workers to have LBW babies in Indonesia.
Table 1. The descriptive statistics of the education level of the female workers who had given birth in the last
5 years in Indonesia(n=18,061)
Education Level
Variables No Education Primary Secondary Higher P
n % n % n % n %
Low Birth Weight ***0.000
No 129 22.4% 1524 28.5% 3404 41.0% 2047 53.6%
Yes 448 77.6% 3831 71.5% 4905 59.0% 1773 46.4%
Age group ***0.000
15-19 3 0.5% 20 0.4% 72 0.9% 0 0.0%
20-24 24 4.2% 209 3.9% 693 8.3% 95 2.5%
25-29 51 8.8% 635 11.9% 1523 18.3% 797 20.9%
30-34 104 18.0% 1192 22.3% 2190 26.4% 1338 35.0%
35-39 157 27.2% 1710 31.9% 2215 26.7% 1067 27.9%
40-44 157 27.2% 1235 23.1% 1318 15.9% 413 10.8%
45-49 81 14.0% 354 6.6% 298 3.6% 110 2.9%
Marital status ***0.000
Never in union/Divorced/Widowed 24 4.2% 291 5.4% 382 4.6% 75 2.0%
Married/Living with partner 553 95.8% 5064 94.6% 7927 95.4% 3745 98.0%
Wealth status ***0.000
Poorest 481 83.4% 2953 55.1% 1833 22.1% 268 7.0%
Poorer 53 9.2% 979 18.3% 1694 20.4% 386 10.1%
Middle 25 4.3% 731 13.7% 1721 20.7% 519 13.6%
Richer 13 2.3% 467 8.7% 1706 20.5% 866 22.7%
Richest 5 0.9% 225 4.2% 1355 16.3% 1781 46.6%
ANC visits ***0.000
< 4 times 56 42.7% 307 18.2% 303 8.5% 99 5.1%
≥ 4 times 75 57.3% 1383 81.8% 3244 91.5% 1826 94.9%
Smoking Behavior
No 516 89.9% 5134 95.9% 8115 97.7% 3790 99.2%
Yes 58 10.1% 218 4.1% 192 2.3% 30 0.8%
A high level of education is one of the outputs compared to the poorest female worker to give birth to
of women’s empowerment. Better education has an LBW babies (OR 0.722; 95% CI 0.572-0.912). Wealth
impact on maternal nutrition and reduces the incidence status as a predictor of LBW because it relates to food
of LBW16,17. Several previous studies have informed availability in the household. The poorer a family, the
that a good level of education is a major predictor of lower the food availability22. Several studies provide
performance in the health sector18,19. On the other hand, consistent findings. Some of them were carried out in
poor education is an obstacle for the health sector to India, Ethiopia, Bangladesh, and Pakistan23–26.
produce quality output20,21.
The second, ANC visits. Female workers who made
Apart from the education level, the analysis also complete ANC visits (≥ 4 times) during their pregnancy
found two other variables as predictors of LBW among were 0.603 times more likely than female workers who
female workers in Indonesia. First, wealth status. made incomplete ANC visits (<4 times) to deliver LBW
The richer female worker has a 0.708 times chance babies (OR 0.603; 95% CI 0.497-0.730). The results of
compared to the poorest female worker to give birth this analysis inform that carrying out complete ANC
to LBW babies (OR 0.708; 95% CI 0.568-0.882). The visits is a protective factor for LBW among female
richest female worker has a probability of 0.722 times workers in Indonesia.
364 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Conducting ANC visits as recommended by the child nutrition in developing countries. Research
Ministry of Health at least 4 times during pregnancy Report of the International Food Policy Research
will monitor the health of pregnant women properly27. If Institute. 2003. 1–164 p.
there is a risk of pregnancy, for example, the mother is 6. Worldbank. Labor force participation rate, female
underweight, interventions can be immediately carried (% of female population ages 15+) (modeled ILO
out to provide the best delivery output for the mother estimate).
and the baby28.
7. Organization IL. Care Work And Care Jobs For
The Future Of Decent Work. Care Work and Class:
Conclusions
Domestic Workers’ Struggle for Equal Rights in
Based on the research results, it can be concluded Latin America. 2012. 1–10 p.
that the education level is a predictor of LBW among 8. UNICEF. Women Work UNICEF’s approach to
female workers in Indonesia. The higher the education women’s paid and unpaid work. 2019;1–9.
level, the lower the possibility of female workers to have
9. Suparmi S, Chiera B, Pradono J. Low birth weights
LBW babies in Indonesia.
and risk of neonatal mortality in Indonesia. Heal
Acknowledgments: The author would like to thank Sci J Indones. 2016;7(2):113–7.
the ICF International, who has agreed to allow the 2017 10. Mahmoodi Z, Karimlou M, Sajjadi H, Dejman
IDHS data to be analyzed in this article. M, Vameghi M, Dolatian M, et al. Association of
maternal working condition with low birth weight:
Source of Funding: Self-funding
The social determinants of health approach. Ann
Conflict of Interest: The authors declare no conflict Med Health Sci Res. 2015;5(6):385.
of interest, financial or otherwise. 11. Xu X, Ding M, Li B, Christiani DC. Association
of rotating shiftwork with preterm births and low
Ethical Clearance: The 2017 IDHS has received birth weight among never smoking women textile
ethical clearance from the National Ethics Commission. workers in China. Occup Environ Med. 1994
Utilization of the 2017 IDHS data in this study has been Jul;51(7):470–4.
permitted by ICF International through its website:
12. Khan JR, Islam MM, Awan N, Muurlink O.
https://dhsprogram.com/data/new-user-registration.cfm.
Analysis of low birth weight and its co-variants in
Bangladesh based on a sub-sample from nationally
References
representative survey. BMC Pediatr. 2018;18(1):1–
1. European Agency for Safety, at Work (EU-OSHA) 9.
H. Risks and trends in the safety and health of 13. Mahumud RA, Sultana M, Sarker AR. Distribution
women at work. EU-OSH. 2011;1–8. and determinants of low birth weight in developing
2. Davidson PM, McGrath SJ, Meleis AI, Stern P, countries. J Prev Med Public Heal. 2017;50(1):18–
DiGiacomo M, Dharmendra T, et al. The Health 28.
of Women and Girls Determines the Health and 14. Sharma M, Mishra S. Maternal risk factors and
Well-Being of Our Modern World: A White Paper consequences of low birth weight in Infants. IOSR
From the International Council on Women’s J Humanit Soc Sci. 2013;13(4):39–45.
Health Issues. Health Care Women Int. 2011
15. World Health Organization. Global Nutrition
Oct;32(10):870–86.
Targets 2025: Low birth weight policy brief
3. Bartley KA, Underwood BA, Deckelbaum RJ. A [Internet]. Geneva; 2014. Available from:
life cycle micronutrient perspective for women’s https://www.who.int/nutrition/publications/
health. Am J Clin Nutr. 2005 May;81(5):1188S- globaltargets2025_policybrief_lbw/en/
1193S.
16. Kabir A, Rashid MM, Hossain K, Khan A, Sikder SS,
4. Banerjee B. Physical hazards in employment and Gidding HF. Women’s empowerment is associated
pregnancy outcome. Indian J Community Med. with maternal nutrition and low birth weight:
2009;34(2):89–93. Evidence from Bangladesh Demographic Health
5. Smith LC, Ramakrishnan U, Ndiaye A, Haddad L, Survey. BMC Womens Health. 2020;20(1):Article
Martorell R. The importance of women’s status for number 93.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 365
17. Shome S, Pal M, Bharati P. Influence of maternal 23. Banerjee A, Singh AK, Chaurasia H. An
autonomy and socioeconomic factors on birth exploratory spatial analysis of low birth weight
weight of infants in India. Malays J Nutr. and its determinants in India. Clin Epidemiol Glob
2018;24(1):35–46. Heal. 2020;8(3):702–11.
18. Ipa M, Widawati M, Laksono AD, Kusrini I, 24. Alemayehu GM, Chernet AG, Dumga KT.
Dhewantara PW. Variation of preventive practices Determinants of child size at birth and associated
and its association with malaria infection in eastern maternal factor in gurage zone. J Reprod Infertil.
Indonesia: Findings from community-based survey. 2020;21(2):138–45.
PLoS One. 2020;15(5):e0232909. 25. Karim MR, Mondal MNI, Rana MM, Karmaker
19. Wulandari RD, Laksono AD. Education as H, Bharati P, Hossain MG. Maternal factors
predictor of the knowledge of pregnancy danger are important predictors of low birth weight:
signs in Rural Indonesia. Int J Innov Creat Chang. Evidence from Bangladesh demographic & health
2020;13(1):1037–51. survey-2011. Malays J Nutr. 2016;22(2):257–65.
20. Laksono AD, Wulandari RD. The Barrier to 26. Khan A, Nasrullah FD, Jaleel R. Frequency and
Maternity Care in Rural Indonesia. J Public Heal risk factors of low birth weight in term pregnancy.
From Theory to Pract. 2020;Online First. Pakistan J Med Sci. 2016;32(1):138–42.
21. Rohmah N, Yusuf A, Hargono R, Laksono AD, 27. Laksono AD, Rukmini R, Wulandari RD. Regional
Masruroh, Ibrahim I, et al. Determinants of teenage disparities in antenatal care utilization in Indonesia.
pregnancy in Indonesia. Indian J Forensic Med PLoS One. 2020;15(2):e0224006.
Toxicol. 2020;14(3):2080–5. 28. Siramaneerat I, Agushybana F, Meebunmak Y.
22. Laksono AD, Ibad M, Mursita A, Kusrini I, Maternal risk factors associated with low birth
Wulandari RD. Characteristics of mother as weight in Indonesia. Open Public Health J. 2018
predictors of stunting in toddler. Pakistan J Nutr. Aug;11(1):376–83.
2019;18(12):1101–6.
366 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2336
Abstract
The main problem in the child’s oral cavity to date is dental caries. Untreated dental caries could cause
difficulty eating and sleeping, experience pain, and need continuous care, so that it impacts on poor quality
of life, and health problems arise one of which is the condition of the child’s nutritional status. This research
aims at effectiveness Dental Care Interventions as Efforts to Reduce PUFA Index and Improve Nutritional
Status in Children aged 9-12 Years in Orphanages. Method: this study used a quasy experiment with a pretest
and posttest with control group design. This research was conducted at the Mizan Amanah Orphanage in
Cinere District, Depok City. Independent variable: Dental care intervention and dependent variable: PUPA
index and children’s nutritional status. Data tested using Wilcoxon/paired sample t-test and independent
t-test/mann whitney test and linear regression. Results: Dental care interventions were effective in reducing
PUPA index (p <0.001) and were effective in improving the status of children aged 9-12 years (p <0.011).
Conclusion: effective dental care interventions as efforts to reduce PUPA index and nutritional status of
children aged 9-12 years in orphanages
Intervention Control
No Variable
Pre-test Post-test Pre-test Post-test
1 PUPA index
Mean 1.44 0.47 1.28 1.09
SD 1,076 089 1,746 1,532
Min-Max 0-5 0-4 0-7 0-6
2 Nutritional status
Mean 17.55 17.77 16.14 16.36
SD 2,363 2,295 2,462 2,250
Min-Max 13.2 - 22.4 13.5 - 22.8 9.8 - 21.1 10 - 20.8
Table 2 shows, the average PUFA index in the was 1.09. This table also shows changes in nutritional
intervention group was 1.44 before treatment and in the status in the intervention group on average 17.55 before
control group was 1.28, which means that there were an treatment and there is an increase in nutritional status to
average of 2 cavities that were not treated. After dental an average of 17.77. Whereas in the control group the
treatment in the form of dental fillings and extractions, average nutritional status was 16.14 and after treatment
the average PUFA was found to decrease to 0.47 in it was 16.36.
the intervention group while in the control group it
Table 3. Test the effectiveness of the PUPA index and nutritional status before and after dental care
interventions
The results of effectiveness test data before and after 0.011 (p <0.05) and the p-value of the control group was
dental treatment showed PUPA index p-value of the 0.168 (p> 0.05) meaning that the administration of dental
intervention group was 0.003 (p <0.05) and the control care interventions effectively increased the PUPA index
group’s p-value was 0.064 (p> 0.05) while the nutritional of nutritional status in children of the Mizan Amanah
status showed the intervention group’s p-value was orphanage.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 369
Table 4. Different tests of PUPA index and Nutrition Status in the intervention and control groups
The results of the PUPA index difference test While the nutritional status shows the p-value between
showed the p-value between the intervention group and the intervention and control groups is 0.015 (p> 0.05)
the control group was 0.050 (p <0.05), meaning that the meaning that the provision of dental care interventions is
provision of dental care interventions was more effective more effective in improving nutritional status compared
in increasing the PUPA index than the control group. to the control group.
* Linear regression
Based on table 5, it can be seen that the constant The results of the test of the effectiveness of data
value is 19.28 with a dental filling coefficient of 1.083 before and after being given dental care showed a value
meaning that a 1% dental filling intervention will of p <0.05. This situation shows that by decreasing cases
increase nutritional status by 1,083. The tooth extraction of untreated caries (PUFA index) by treating dental
coefficient value of 1.502 means that the 1% tooth problems can improve the nutritional status of children.
extraction intervention will increase the nutritional This situation is in line with research conducted by
status by 1,502. The results of the analysis show the Rohmawati (2016), which states that there is a significant
results of R2 (R Square) of 0.177 or (17.7%), meaning relationship between the caries index that is not treated
that dental filling and tooth extraction interventions with nutritional status. This can happen because if a
have a 17.7% effect on improving nutritional status. tooth is damaged or disrupted it will interfere with the
The analysis showed that the value of p = 0.05 means function of mastication and will tend to choose soft
that the influence of dental filling intervention and tooth foods so that it will reduce the intake of nutrients that
extraction has an increase in nutritional status. will affect the child’s weight.10, 13
Abstract
The correctional institution is a place for treatment the prisoners. The current condition, the responsibility
for treatment prisoners lies with the state, carried out by one institution without assistance from other
institutions, namely the Correctional Institution. The problems in this paper are first, what is the current
form of treatment for prisoners in Correctional Institution; second, how to reconstruct the form of treatment
for prisoners in Correctional Institutions in the future. This paper uses an empirical juridical research method
using the socio-legal approach. The results in this paper are first; the treatment aimed at current prisoners is
personality treatment and independence treatment. In practice, both of these treatments found obstacles in the
form of inadequate facilities and infrastructure and overcapacity of the Correctional Institution conditions,
which resulted in no ideal coaching; second; based on this, it is necessary to reconstruct treatment of prisoners
in the Correctional Institution. Reconstruction was carried out by developing a form of community-based
correction and the existence of cooperation from the private sector in the form of partnerships. If this is
realized, the purpose of the treatment process can be achieved, and the prisoner, after finished treatment, can
return to the community properly.
First, personality development includes, among The reconstruction of the development of prisoners
others: development of religious awareness; development in prisons in the future can be carried out by developing
of the nation and state; development of intellectual ideas so that punishment leads to de-institutionalization
abilities (intelligence); development of legal awareness; or non-institutionalization of punishment in the form of
and development of integrating with the community. community-based correction and assistance from the
private sector in the form of partnerships. Developments
Second, development of independence is provided towards deinstitutionalization, such as social work,
through programs, namelyskills to support independent probation and diversion and restorative justice have
businesses; skills to support small industrial enterprises; been practiced in a number of countries for humanitarian
the skills are developed according to the talents of each considerations as well as to avoid the bad effects of
prisoner; and skills to support industrial businesses or imprisonment for children, women who still have
agricultural (plantation) activities using intermediate child dependents, and first offender crime categories
technology or high technology light. According to this article, philosophically, this
Hence, the guidance given to prisoners must be an development does not contradict the basic idea of
integral part of the correctional system. Correctional correctionalism. Partnerships are needed to help from
that is seen as a system must have an ultimate goal that the aspects of coaching, financing, partnerships as
must be achieved so that in its implementation it requires well as supporting the formulation of a more effective
assistance from parties other than the state which is strategy. Therefore, partnerships are needed both with
responsible for the functioning of the guidance process. other government agencies and elements of society.
Psychological and Personality Development The current situation, the training of prisoners
Supports for Prisoners: Penal reform is part of the carried out in the Correctional Institutions is too
criminal law policy/politics (penal policy). According bureaucratic, so this creates an impression of being
to Barda Nawawi Arief, Criminal law reform essentially unfriendly and inhuman. The presence of a third party,
contains meaning, an effort to reorient and reform in this case the private sector, is expected to be able to
criminal law in accordance with the central values of solve the problems of coaching prisoners. This paper
socio-political, socio-philosophical and socio-cultural describes the form of private participation in the prisoner
Indonesian society which underlie social policies, development program, which can include providing
criminal policies and law enforcement policies in skilled professionals such as psychologists, pedagogists,
Indonesia13. In essence, criminal law reform must be social workers; providing trainers and work equipment
pursued with a policy-oriented approach and at the same to support training for prisoners, including in the
time a value-oriented approach14. provision of raw materials and the throwing of products
produced by prisoners; after the convicts have finished
Efforts to reconstruct the development of prisoners serving their sentences, the private sector is expected
cannot be separated from the problem of value, because to distribute the labor of ex-convicts who are deemed
crime is used as a means of achieving correctional eligible; contributing funds to finance the basic needs of
objectives, namely in the implementation of criminal inmates while serving their sentences; providing reports
sanctions it does not mean that the punishment imposed on the development of prisoners to the government.
on prisoners must be in accordance with human values
but must also be able to raise awareness of prisoners of According to this paper, the presence of the private
value, human values and social values in society. sector in the process of coaching prisoners can be seen
from two sides. The first side, if the private sector helps
Reconstruction specifically regarding the formation ease the duties of correctional institutions in fostering
of prisoners must be carried out. The reconstruction is prisoners, it is hoped that it can focus on making inmates
expected to realize an effective, efficient and effective as citizens of society who are aware of illegal acts to
process of guiding prisoners. This is quite reasonable, become skilled in certain jobs and obey the law after
given the ideal purpose of the prison system. However, they are in society; the second side, there are advantages
Medico-legal Update, January-March 2021, Vol. 21, No. 1 375
for the government, namely constraints, both funds and Conflict of Interests: There are no conflict of
facilities and infrastructure can be overcome so that the interests
correctional institution can be a place to foster inmates
without retaliation; benefits for the private sector, References
namely developing company work programs, increasing 1. Sujatno A. Sistem Pemasyarakatan Indonesia:
the workforce for the development of the company’s membangun manusia mandiri. Directorate General
business progress, as the moral responsibility of of Corrections, Ministry of Justice and Human
Pancasilian Indonesian citizens. Rights; 2004.
It is hoped that the presence of the private sector in the 2. Harsono CI. Sistem Baru Pembinaan Narapidana.
process of coaching prisoners can make the Penitentiary Djambatan; 1995.
a productive institution in preparing prisoners to return 3. Nuraeny H, Utami T. The Impact Of Over
to society as working people who comply with the law15. Capacity On Fulfilling The Basic Rights Of The
In the end, the coaching process in the future can achieve Assisted Citizen In Prison In The Perspective Of
the goal of the correctional system, namely to restore the Human Right. InFirst International Conference on
life relationship between prisoners and the community. Progressive Civil Society (Iconprocs 2019) 2019
May. Atlantis Press.
Conclusions and Recommendations 4. Panjaitan PI. Pembinaan Narapidana Menurut
The form of guidance given to prisoners Sistem Permasyarakatan. to-ra. 2018;4(3):111-6.
in correctional institutions today is personality 5]. Langan PA, Levin DJ. Recidivism of prisoners
development and independence development. In released in 1994. Federal Sentencing Reporter.
practice, this guidance encountered obstacles, among 2002 Oct 1;15(1):58-65.
others, conditions in prisons that were over capacity,
6. Mulyono GP, Arief BN. Upaya mengurangi
limited facilities and infrastructure so that they could
kepadatan narapidana dalam Lembaga
affect the provision of guidance to prisoners to which
Pemasyarakatan di Indonesia. Law Reform.
the prisoners were entitled. On the basis of constraints
2016;12(1):1-6.
in the process of guiding prisoners, it is necessary to
reconstruct the development of prisoners in correctional 7. Fazel S, Baillargeon J. The health of prisoners. The
institutions in the future, namely by developing ideas Lancet. 2011 Mar 12;377(9769):956-65.
so that punishment leads to de-institutionalization or 8. Benuf K, Azhar M. Metodologi Penelitian Hukum
non-institutionalization of punishment in the form of sebagai Instrumen Mengurai Permasalahan Hukum
community based correction and partnership assistance Kontemporer. Gema Keadilan. 2020 Apr 1;7(1):20-
from the private sector. 33.
9. Asikin, Z. Amiruddin. Pengantar Metode Penelitian
The suggestions put forward in this paper are as soon
Hukum. Jakarta: Raja Grafindo Persada; 2004.
as possible the development program in reconstruction
through various forms of guidance so that the private 10. Irianto S. Sidharta, Metode Penelitian Hukum:
sector can help directly and increase the existence of the Konstelasi dan Refleksi. Yayasan Pustaka Obor
open prison. If this is realized, the role of the correctional Indonesia;2009.
institution can be helped in the process of developing a 11. Irawati D. Menuju Lembaga Pemasyarakatan
more humane and can produce productive prisoners so Berwawasan Hak Asasi Manusia. UKI Press;2006.
that when they have finished undergoing guidance, the 12. Priyatno D. Sistem pelaksanaan pidana penjara di
prisoners can return to the community properly. Indonesia. Refika Aditama; 2006.
Ethical Clearance: This research was ethically 13. Arief BN. Kapita Selekta Hukum pidana. Citra
approved by Faculty of Law, Universitas Diponegoro, Aditya Bakti; 2003.
Semarang, Indonesia 14. Jaya NS. Pembaharuan Hukum Pidana. Semarang:
Pustaka Rizki Putra. 2017.
Funding: This research receives funding from by
15. Holsinger AM, Hughes TT. Correctional Services
Faculty of Law, Universitas Diponegoro, Semarang,
Corporation v. Malesko: Boss,“They Can’t Hurt
Indonesia.
You Now”. Criminal Justice Policy Review. 2003
Dec;14(4):451-63.
376 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2338
Islamiyati1, Rofah Setyowati1, Dewi Hendrawati1, Aisyah Ayu Musyafah1, Ahmad Rofiq2
1
Lecturer at Diponegoro University, Semarang, Indonesia,
2
Professor at Universitas Islam Negeri Walisongo, Semarang, Indonesia
Abstract
The development of endowment land in Indonesia is very rapid which is directly proportional to the
problems that occur regarding endowment. The resolution of this endowment dispute is based on the charity
law, carried out by deliberation and mediation. In some cases, the mediation conducted was not following
the existing mediation rules so that eventually the resolution of the endowment dispute became ineffective.
It is important to study the problem of the resolution of endowment disputes through mediation from the
perspective of the theory of legal effectiveness. This study aims to understand and analyze the problematic
of endowment dispute resolution through mediation from the perspective of the theory of legal effectiveness
in Central Java. The research method used is socio-legal research, with an empirical juridical approach and
includes qualitative research. The results of this study are the settlement of endowment disputes through
mediation outside the court according to the theory of legal effectiveness, not yet effective, because there are
no formal legal rules. It is necessary to make regulations for the implementation of non-litigation mediation,
to provide practical guidance for the implementation of mediation in the community.
Introduction with nadzir, and nadzir with the heirs2. Factors causing
the appearance of endowment disputes, among others;
The endowment is developed or empowered by the
there is a misunderstanding about the understanding
community1. Land Endowment is always associated
of endowment between nadzir, waqif and waqif heirs,
with public interests and economic value. This is what
there is a conflict of interest between nadzir and waqif
often causes problems that cannot be resolved internally,
heirs, the economic value of land prices is higher so that
thus becoming a dispute. Objects that are used as land
waqif heirs sometimes try to seize it, there is no charity
endowment disputes, usually associated with the legality
land certificate, there is a conflict between religious
status, management, and changes in the function and
law and waqif and state law regarding the legality of
use of land endowment assets including buildings on
endowment land, nadzir defaults (breaking promises
it, which are adjusted to the needs of the community
and irresponsibility)3.
in utilizing endowment property. The parties to the
dispute can occur between the community and nadzir The resolution of endowment dispute has been
(endowment manager), waqif (people with endowment) explained in Article 62 of the Endowment Law No.
41/2004, that is, through deliberations to reach consensus,
if it cannot be resolved, then it can be resolved through
mediation, if mediation is not successful, then use
Corresponding Author: arbitration or through the Religious Courts. According to
Islamiyati Article 49 of Law No. 3/2006 explains that the Religious
Lecturer at Faculty of Law, Diponegoro University, Jl. Courts has the competence to resolve endowment
Prof. Soedarto, Tembalang, Semarang, Central Java disputes submitted by the disputing parties. This study
50275, Indonesia may be a fairly original study in presenting and examining
e-mail: [email protected] aspects of endowment and actual problems in the context
Medico-legal Update, January-March 2021, Vol. 21, No. 1 377
of resolution by involving the religious community the resolution of disputes, and the availability of funds11.
and arbitration and ADR. Although this relates to the Furthermore, the research shows that the implementation
field of business law, very few previous studies have of mediation in the resolution of endowment disputes
reviewed ADR in this endowment issue4,5,6,7,8,9. This in the above case has not been effective, because the
study aims to understand and analyze the problematic mediators are not sincere in helping the parties resolve
of endowment dispute resolution through mediation in endowment disputes and there is no awareness of
the perspective of the theory of legal effectiveness in the parties in having a good commitment to resolving
Central Java. In addition, also to find out the practice of endowment disputes.
the implementation of mediation in society and its legal
problems. The benefit is that it can be used as an effort to The effectiveness of the resolution of endowment
develop legal settlement of endowment disputes through land disputes through mediation is an attempt to explain
effective and optimal mediation in the community. whether the rules of mediation law can apply or be
implemented by the community in the resolution of
Resolution of Endowment Disputes: Research endowment disputes. If the rules of mediation law can
conducted by10 explains that the resolution of endowment be carried out by the community in the settlement of
disputes in the coastal communities of Central Java, uses endowment disputes, then the law is effective. In this
two pathways, namely the non-litigation route, such as; study, what is used as a benchmark for the effectiveness
deliberation (23%) and mediation (60.8%), and litigation of mediation in the resolution of endowment disputes
path in the Religious Courts (16.2%). According to are five factors as stated by14 in the theory of legal
these data shows that the majority of the people of the effectiveness. Five factors that influence the effectiveness
coastal regions of Central Java use non-litigation in of law in society are; statutory regulations (formal
the resolution of endowment disputes. This is because; juridical), law enforcement (institutional), facilities or
faster process, lower cost, informal and final nature, facilities for law enforcement (human resources), society
confidentiality guaranteed, can maintain good relations, (degree of community compliance with law), legal
there is freedom of choice of third parties, certain face- culture (customary law that applies in society). By using
to-face implementation, easier to make improvements, the theory of legal effectiveness is used as a benchmark
the parties can arrange procedures for dispute resolution. for the implementation of the effectiveness of mediation
It can be understood that mediation outside the judiciary in the resolution of endowment disputes in Central Java
is the most widely used way of resolving endowment society, it is revealed that factors of statutory regulations,
disputes by the parties to the dispute. However, after which means rules in written form (legal formal). Rules
being criticized, it turned out that mediation was carried for the resolution of endowment disputes through
out by the parties to the dispute, many of which did not mediation have been explained in Article 62 Paragraph
comply with the correct mediation rules, for example; (2) of Law No. 41 of 2004 concerning Endowment,
the mediator acts as the party that resolves the problem, ie if the resolution of an endowment dispute cannot
the mediator does not know the main tasks and functions be resolved by deliberation, then it can be resolved
so that it is not optimal in resolving disputes, and the through mediation. Mediation is a dispute resolution
parties are not given the opportunity to express their mechanism that cannot be resolved internally by parties,
opinions. Thus, this study shows that the implementation thus requiring other parties to resolve it15. Law no. 30
of mediation in the resolution of endowment disputes of 1999 concerning Arbitration and ADR are often used
has not been effective. by parties in dispute resolution in general, but for the
resolution of endowment disputes it still needs to be
Research conducted by11 about the Effectiveness tested, whether the law can be used as a guideline or not,
of Mediation in the Settlement of Endowment Disputes given the act of endowment has characteristics.16 The
(Case Study of the Endowment Land of the Baitul Qudus characteristics of endowment acts are the responsibility
Mosque on Gebanganom Genuk Sari Semarang Central of endowment property is intended for the community
Java) explains that the effectiveness of mediation depends and endowment property must not be lost, damaged, but
on the type of endowment dispute, the motivation of the preserved for the benefit of eternity. If there is a change
parties to form the Baitul Qudus Mosque Endowment in objectives and benefits, it must be licensed by PPAIW
Case on Gebanganom Genuk Sari Semarang Central and BWI as an institution responsible for endowment
Java), agreement in dispute resolution, relating to basic/ acts in Indonesia.
ideological values, the ability of mediators to assist in
378 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Abstract
Background: Laryngoscopy and intubation are associated with intensesympathoadrenal stimulation
resulting in hypertension, tachycardia & arrhythmias consequent to the release of catecholamines. Various
drug regimens and techniques have been used from time to time for attenuating the stress response to
laryngoscopy and intubation, including opioids, barbiturates, benzodiazepines, beta blockers, calcium
channel blockers, vasodilators etc. Dexmedetomidine is a highly selective alpha 2 receptor agonist having
eight times higher affinity and alpha 2 selectivity compared to clonidine and has a shorter duration of action
than clonidine.
Material and Method: 60 patients scheduled for elective surgical procedures under general anaesthesia
belonging to ASA Grade I and II, in the age group of 18 to 60 years were divided into two study groups,
D1 and D0.5 received dexmedetomidine 1 µg/kg and 0.5 µg/kg intravenously (iv) over 10 minutes before
induction. Hemodynamic responses were compared in both groups by measuring Heart rate (HR),Systolic
blood pressure (SBP),Diastolic blood pressure(DBP),Mean arterial pressure (MAP) and SpO2 before
giving the test drug (base line values),just before induction,during intubation and at 1 minute, 3 minutes, 5
minutes,10 minutes after intubation. Statistical data were analyzed by using student’s unpaired t test.
Observation and Results: Group D1 had 4.70% rise in HR and Group D0.5 had 9.59% rise during intubation
which was statistically significant(p<0.05). Maximum rise in SBP and DBP in Group D0.5 was 14.53% and
12.84% respectively, whereas in Group D1 it was 5.55% and 8.90% respectively. In Group D0.5, rise in BP
lasted longer after intubation compared to Group D1.
Conclusion: The present study demonstrated that ivdexmedetomidine 1µg/kg was better than
dexmedetomidine 0.5µg/kg in attenuation of the pressor response of laryngoscopy and intubation without
any significant side effects.
Introduction
Corresponding Author: Laryngoscopy and intubation are associated with
Dr. Riddhi Agrawal intense sympathoadrenal stimulation resulting in
Registrar, University Hospitals of North Midlands, hypertension, tachycardia & arrhythmias consequent
Stoke on Trent, Staffordshire, United Kingdom, to the release of catecholamine.(1) Patients with limited
Department of Anaesthesiology, Dhiraj Hospital, SBKS myocardial reserve, tachycardia and hypertension
MI & RC, Sumandeep Vidyapeeth, Piparia, Waghodia, may result in myocardial ischemia, infarction (MI);
Vadodara, Gujarat, India arrhythmias or precipitate cardiac failure.(2) The
e-mail: [email protected] hypertensive response may produce deleterious effects
382 Medico-legal Update, January-March 2021, Vol. 21, No. 1
in patients with raised intracranial pressures (ICP) or • Mallampatti class III, IV & V
intraocular pressures (IOP), pheochromocytomas and
• Allergy to trial drugs.
vascular lesions such as intracranial arterio-venous
malformations or those with aortic aneurysms and • Nasogastric tube insertion
dissection.(2,3) • Patient undergoing procedures requiring head and
Various drug regimens and techniques have been neck manipulation
used from time to time for attenuating the stress response Patients were explained about the procedure of
to laryngoscopy and intubation, including opioids, general anaesthesia and a written informed consent was
barbiturates, benzodiazepines, beta blockers, calcium obtained from them. Pre-operatively patient’s history,
channel blockers, vasodilators etc.(4,5,6,7,8) systemic examinations and routine investigations
were carried out.HR, SBP and DBP were recorded
α2 adrenergic agonists namely clonidine and
preoperatively.
dexmedetomidine decrease sympathetic tone and
preoperative use of clonidine has been shown to blunt Tab alprazolam 0.5 mg was given on the previous
the hemodynamic responses to noxious stimulation and night of surgery and patients were kept nil by mouth
to prevent overall hemodynamic variability.(9,10) overnight. In operation theatre multipara monitor was
applied and baseline HR, SBP, DBP, SpO2 and ECG
Dexmedetomidine is a highly selective α2 receptor
were recorded. Intravenous line was secured and iv fluid
agonist having eight times higher affinity and α2
was started.
selectivity and has a shorter duration of action than
clonidine.(11,12) All patients were premedicated with inj.
ondansetrone 0.08mg/kg, inj. glycopyrrolate 0.004
Materials and Method mg/kg and inj. midazolam 0.05mg/kg iv.Group
The study was conducted after obtaining permission D1received dexmedetomidine 1mg/kg iv diluted in 50
from ethical committee in Dhiraj Hospital, S.B.K.S.M.I. ml normal saline using syringe infusion pump over 10
& R.C. in department of anesthesiology. 60 patients of minutes. Group D0.5 patients were given intravenous
ASA I and II were allocated in 2 groups (n=30 in each dexmedetomidine 0.5 mg/kg iv diluted in 50 ml normal
group). They were included in the study only after saline, using syringe infusion pump over 10 minutes.
obtaining a written informed consent. Group D1(n=30) After completion of dexmedetomidine infusion,
received 1µg/kg and Group D0.5(n=30) received 0.5µg/ patients were pre-oxygenated with 100% oxygen for
kg body weight of dexmedetomidineiv over a period of 3 minutes. They were induced with 2.5% thiopentone
10 minutes. sodium 5-7 mg/kgiv till the loss of eyelash reflex. Inj.
Inclusion Criteria: succinylcholine 2mg/kg iv was given. Patients were
intubated with appropriate sized cuffed endotracheal
• Age between 18 years & 60 years tubes. After checking the equal bilateral air entry
• ASA I and II. endotracheal tube was fixed. Anaesthesia was maintained
with oxygen and nitrous oxide (50%-50%), isoflurane
• No known history of allergy, sensitivity to the study
and loading dose of inj. Atracuriumiv 0.5mg/kg and
drugs
after that intermittent dose of 0.1mg/kg.
• Patient willing to sign informed consent.
HR, SBP, DBP were recorded before giving
• Mallampatti class I and II the drug,just before induction of anaesthesia, during
Exclusion Criteria: intubation and at 1 minutes, 3minutes, 5 minutes,10
minutes after intubation. After the surgical procedure
• Patient’s refusal. was over, neuromuscular blockade was reversed with
• ASA III and IV inj. neostigmine 0.05 mg/kg and inj. glycopyrrolate
0.008mg/kg iv. Once all recovery criteria were fulfilled
• Known case of heart blocks, sinus bradycardia and
trachea was extubated. Patients were monitored in the
hypotension, autonomic neuropathy
post-operative recovery room for 24 hours. They were
• Patients on beta blocker drugs observed for analgesia and side effects like nausea,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 383
vomiting, sedation, respiratory depression, bradycardia For age, weight, genderand ASA grade there was
and hypotension. no statistically significant difference in patients of Group
D1 and Group D0.5 (p ˃0.05)
Observation and Results
Statistical data were analyzed by using student’s
unpaired t test.
Graph 1: Showing Heart Rate at different time intervals in Group D1 and Group D0.5
Mean HR in Group D1 was 86.27±1.447 per minutes showed maximum rise in HR during intubation but
and in Group D0.5 it was 86.23±2.027 per minutes at immediately after intubation it started decreasing. Rate
baseline level, which was comparable (p>0.05). There of fall was almost equal in both groups till 5 minutes post
was fall in HR in both Group D1 and Group D0.5. HR intubation. At 10 minutes after intubation HR reached
further decreased at induction in both groups. Group D1 to 79.10±1.892 per minutes in Group D1 with 9.06%
had 12.36% fall whereas Group D0.5 had 9.74% fall from fall and in Group D0.5 80.40±1.650 per minutes with
baseline value. In Group D1 at intubation mean HR was 6.76% fall. Difference in mean HR between two groups
90.33±1.431 per minutes showing 4.70% rise,whereas in at any time interval was statistically insignificant (p˃
Group D0.5 it was 94.50±0.5023 per minutes with 9.59% 0.05) except during intubation which was statistically
rise. The difference in mean HR between two groups significantly higher in group D1 than in group D0.5 (p
was statistically significant (p ˂ 0.05). Both groups ˂ 0.05).
384 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Graph 2: Mean SBP at different time interval in Group D1 and Group D0.5
At baseline mean SBP in Group D1 was 126.1± was statistically highly significant (p˂ 0.001).SBP in
1.281 mmHg and in Group D0.5 was 122.5±1.189 both groups started falling immediately after intubation
mmHg.There was fall in SBP from baseline value in from its maximum level. In Group D1, at 5 minutes after
both groups after study drug infusion and at induction intubation, SBP was below baseline value, whereas in
but Group D1 had significant fall (12.7%) compared Group D0.5 SBP remained higher than baseline value at
to Group D0.5 (6.19%) (p<0.05). During intubationin 5 minutesand took 10 minutes to reach baseline value.
Group D1, it increased from 126.1± 1.281mmHg to Difference in SBP from 1 minute after intubation till 10
133.1± 0.913mmHg (5.55%) whereas in Group D0.5 minutes post-intubation was statistically significant (p˂
it rose to 140.3±1.283mmHg from 122.5±1.189mmHg 0.05).
(14.53%). Difference in mean SBP between two groups
Graph 3: Mean DBP at different time interval in Group D1 and Group D0.5
Medico-legal Update, January-March 2021, Vol. 21, No. 1 385
At baseline mean DBP in Group D1 was 80.87±1.679 intubation DBP in both groups started decreasing but the
mmHg and in Group D0.5 it was 81.53±1.049 mmHg. rate of fall in DBP in Group D1 was faster compared
DBP in both groups decreased after study drug infusion to Group D0.5 and at 3 minutes after intubation DBP
and after induction. The difference was statistically in Group D1 was nearly same as baseline value. At 10
significant (p ˂ 0.05).There was maximum rise in DBP minutes post intubation DBP was 76.53±1.028 mmHg
in both groups at intubation. In Group D1 it increased that was 5.36% lower than basal DBP, whereas in Group
to 88.07±1.270 mmHg from its baseline value showing D0.5, DBP even at 10 minutes after intubation was higher
8.9% rise whereas in Group D0.5 it went to 92.00±0.996 than baseline DBP (83.13±1.137 mmHg).Difference
mmHg from basal DBP with 12.84% rise. This difference in mean DBP between two groups at any time interval
was statistically significant (p ˂ 0.05). Immediately after except at baseline was statistically significant (p˂0.05).
Graph 4: Mean Arterial Pressure At Different Time Intervals Between Group D1 and Group D0.5
Mean arterial pressure at baseline in Group D1 448.3±30.9 mg. The difference between two groups was
was 95.94±0.848 mmHg and in Group D0.5 it was statistically insignificant (p˃0.05)
95.52±0.925 mmHg which was comparable (p˃0.05).
There was fall in MAP in both groups after study drug No side effects or complication were seen in any
infusion and after induction, which was statistically patients of either group.
highly significant (p˂0.001). In Group D1 MAP increased
to 103.08±1.004 mmHg during intubation with rise of
Discussion
7.00% from baseline value whereas in Group D0.5, the Laryngoscopy and endotracheal intubation are
rise was 13.17%. The difference was statistically highly perceived as intense events during general anaesthesia.
significant (p ˂ 0.0001). In both groups after intubation They give rise to a transient, but marked sympathoadrenal
MAP decreased from its maximum rise and in Group response. Therefore controlling this perioperative
D1 at 3 minutespostintubation it reached to baseline stress response is pivotal goal of anaesthesia practice
level and at 10 minutes post intubation 7 % lower than (13)
. Various pharmacological & non pharmacological
baseline level but in Group D0.5, it remained above method were evaluated either in premedication or during
basal value even 10 minutes after intubation.Difference induction to attenuate these adverse stress responses but
in MAP between two groups remained highly significant no single anaesthetic technique is effective in completely
from time of intubation, till 10 minutes after intubation abolishing these responses. The drugs used were either
(p˂ 0.0001).Average dose of thiopentone used in Group partially effective or were with adverse effects.(14)
D1 was 412.5±26.0 mg and in Group D0.5 it was
386 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Dexmedetomidine offers a unique pharmacological Yildiz et al(17) also observed maximum increase
profile with sedation, sympatholysis, analgesia, in blood pressure immediately after intubation. During
cardiovascular stability by altering the stress induced intubation increase in SBP in placebo group was 40%
sympathoadrenal responses to intubation during surgery compared to 8% in the group of dexmedetomidine 1µg/
& during emergence from anaesthesia. Presynaptic kg. Also increase in DBP was 25% in placebo group as
activation of α2 adrenoceptor in the locus ceruleus in compared to 11% in the group of dexmedetomidine 1µg/
brain inhibits the release of nor epinephrine. In addition, kg.
the locus ceruleus is the site of origin for descending
medullospinal noradrenergic pathway,known to be an The initial fall in blood pressure can be explained by
important modulator of nociceptive neurotransmitter. peripheral α-2B adrenoceptors stimulation of vascular
Also, postsynaptic activation of α2 receptors in the CNS smooth muscles. The initial response is followed by
results in decrease in sympathetic activity leading to fall further decrease in blood pressure. Both these effects
in heart rate. are caused by inhibition of central sympathetic outflow
overriding the direct stimulant effects.
We compared the efficacy of dexmedetomidine at a
dose of 1µg/kg (Group D1) with 0.5µg/kg (Group D0.5) Average requirement of thiopentone was noted
when administered over 10 minutes before induction of during our study. The requirement was 8% less in
anesthesia in 30 patients of each group. The groups were the group receiving dexmedetomidine 1µg/kg when
comparable with respect to demographic factors like age, compared to dexmedetomidine 0.5µg/kg. The difference
weight,gender. Baseline heart rate was comparable in being not statistically significant(p>0.05).Similar to
both the groups. After 10 minutes of dexmedetomidine our findings, Bijoykumar panda et al(18) has also
infusion, there was fall in heart rate in both the groups, observed statistically insignificant reduced requirement
Group D1>group D0.5. The fall continued even after of thiopentone in dexmedetomidine group(1µg/kg) as
induction in both the groups except during intubation. compared to clonidine group (1µg/kg).
During intubation there was rise in heart rate in both the There was no side effect noted in our study.
groups, Group D0.5 >Group D1. The difference being
statistically significant (p<0.05). Similarly, Shirsedu et al(19) have also not found
any instability of vitals either with clonidine or
Sagiroglu A et al(15) in 2009 and Sunil et al(16) in dexmedetomidine . They compared clonidine at 2µg/kg
2012 compared the effect of dexmedetomidine at two with dexmedetomidine at 1µg/kg given over 10 minutes,
different doses i.e 0.5µg/kg vs 1µg/kg on attenuation of in patients undergoing general surgery.
haemodynamic responses to laryngoscopy & intubation.
They concluded that 1µg/kg is better in obtunding Bijoykumar panda et al(18) found bradycardia in
hemodynamic response to laryngoscopy. Thus only 2 patients out of 60 patients, using dexmedetomidine
comparable with our study. 1µg/kg when given over 10 minutes.
Our study results were also in accordance with the Belleville et al(20) found that dexmedetomidine
results of Yildizet al.(17) and Bijoy kumar panda et which was given in 2 minutes at doses of 1-2µg/kg
al(18). They too observed that dexmedetomidine when cause irregular ventilation and apnea episodes. Irregular
administered at a dose of 1µg/kg was able to suppress breathing seen with high dose of 1-2 µg/kg probably
the heart rate response to laryngoscopy. SBP, DBP related to deep sedation and anatomical features of the
and MAP were better managed in the group receiving patient.
dexmedetomidine 1µg/kg.
Such side effects were not seen in our study thus
Sagiroglu Aet al(15) similarly observed that SBP, making dexmedetomidine at dose of 1µg/kg and 0.5µg/
DBP and MAP values were lower post induction kg when given over 10 minutes to be free of side effects.
in both the groups of dexmedetomidine 1µg/kg and
0.5µg/kg, similar to the findings of our study.SBP Conclusion
and DBP were significantly lower at 60 seconds post Dexmedetomidine at dose of 1µg/kg significantly
intubation in dexmedetomidine 1µg/kg as compared to attenuated the sympathetic response of laryngoscopy
dexmedetomidine 0.5µg/kg. and intubation and also at dose of 0.5µg/kg reduced the
Medico-legal Update, January-March 2021, Vol. 21, No. 1 387
pressor response, but its effect was lesser than that of anaesthesia with thiopentone and rocuronium. Br J
dexmedetomidine 1µg/kg. Thus this study showed that Anaesth 2007;98:604-10.
dexmedetomidine 1µg/kg is superior to dexmedetomidine 9. Aantaa R, Scheinin M. α-2-adrenergic agents
0.5µg/kg in the attenuation of hemodynamic response to in anesthesiology. Acta Anaesthesiol Scand
laryngoscopy and endotracheal intubation with no side 1993;37:433-48.
effects. Dexmedetomidine is helpful in decreasing the
10. Quintin L, Bonnet F, Macquin I. Aortic
requirement of anaesthetic agent for induction.
surgery: Effect of clonidine on intraoperative
Conflict of Interest: Nil catecholaminutesergic and circulatory stability.
Acta Anaesthesiol Sc and 1990;34:132-7.
Source of Funding: Self 11. Virtanen R, Savola J, Nyman L. Characterization
Ethical Clearance: Taken from Sumandeep of the selectivity, specifity and potency of
Vidyapeeth Institutional Ethics Committee (SVIEC). medetomidine as an α-2 adrenoceptor agonist. Eur
J Pharmacol 1988:9-14.
References 12. Scheinin H, Virtanen R, MacDonald E,
Lammintausta R, Scheinin M. Medetomidine-a
1. Derbyshire DR, Chmielewski A, Fell D, Vater
novel α-2-adrenoceptor agonist: A review
M, Achola K, Smith G. Plasma catecholamine
of its pharmacological effects. ProgNeuro-
responses to tracheal intubation. BJA, 1983; 55:
Psychopharmacol Biol Psychiatry 1989;13:635-51.
855-60
13. Kunisawa T, Nagata O, Nagashima M, Mitamura
2. Fox EJ, Sklar GS, Hill CH, et al. Complications
S, Ueno M, Suzuki A, et al Dexmedetomidine
related to pressor response to endotracheal
suppresses the decrease in blood pressure during
intubation. Anaesthesiology, 1977; 47: 524-25
anaesthetic induction and blunts the cardiovascular
3. King BD, Harris LC, et al. Reflex circulatory responses to tracheal intubation. Journal of Clin
responses to direct laryngoscopy and tracheal Anaesth 2009; 21:194-9.
intubation performed during general anaesthesia.
14. Sukhminutesder JS, Kaur J, Singh A, Parmar
Anesthesiology,1951; 12:556-566
SS, Singh G, Kulshrestha A, et al Effects of
4. Charuluxananan S, Kyokong O, Somboonviboon Dexmedetomidine on hemodynamic response to
W, Balmongkon B, Chaisomboonpan S. intubation, surgery and extubation and effects on
Nicardipine versus lidocaine for attenuating the dose of opioids and isofluraneduring anaesthesia.
cardiovascular response to endotracheal intubation. Indian Journal of Anaesthesia May 2012:56(2)
J Anesth 2000;14:77-81. 123-128.
5. Menda F, Koner O, Sayin M, Ture H, Imer P, Aykac 15. Sagiroglu A, Celik M, Orhonv Z, Yüzer S, Sen
B. Dexmedetomidine as an adjunct to anesthetic B. Dıfferent doses of Dexmedetomidine on
induction to attenuate hemodynamic response to controllınghaemodynamıc responses to tracheal
endotracheal intubation in patients undergoing fast- intubatıon. The Internet Journal of Anesthesiology.
track CABG. Ann Card Anaesth 2010;13:16-21. 2009;27:2.
6. Gunes Y, Gunduz M, Ozcengiz D, Ozbek H, Isik 16. Sunil N., DhanpalR . The effect of intravenously
G. Dexmedetomidine-remifentanil or propofol- administered dexmedetomidine on hemodynamic
remifentanil anesthesia in patients undergoing response to intubation in patients undergoing
intracranial surgery. Neurosurg Q 2005;15:122-6. surgery under general anesthesia.
7. Powroznyk A, Vuylsteke A, Naughton C, Misso S, 17. Yildize M, Tavlan A, Tuncer S, Reisli R, Yosunkaya
Holloway J, Jolin-Mellgard A, et al. Comparison of A, Otelcioglu. Effect of dexmedetomidine on
clevidipine with sodium nitroprusside in the control haemodynamic responses to laryngoscopy and
of blood pressure after coronary artery surgery. Eur intubation: perioperative haemodynamics and
J Anaesth 2003;20:697-703. anaesthetic requirements. Drugs RD 2006; 7(1):43-
8. Abou-Arab MH, Heier T, Caldwell JE. Dose of 52.
alfentanil needed to obtain optimal intubation 18. Bijoy Kumar Panda, Priyanka Singh, Sourabh
conditions during rapid-sequence induction of Marne, Atmaram Pawar, Varshali Keniya,
388 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Sushma Ladi, Sarita Swami. A Comparison of sympathoadrenal responses and anesthetic
study of Dexmedetomidine vs Clonidine for requirements to laryngoscopy and endotracheal
sympathoadrenal response, perioperative drug intubation. Int J Basic Clin Pharmacol. 2014; 3(3):
requirements and cost analysis. Asian Pacific 501-506.
Journal of Tropical Disease(2012);1-6 20. Bellevillie JP, Ward DS, Bloor BC, Maze M.
19. Shirsendu Mondal, Hindol Mondal, Ritaban Effects of intravenous dexmedetomidine in
Sarkar, Musfikur Rahaman. Comparison of humans in sedation, ventilation and metabolic rate.
dexmedetomidine and clonidine for attenuation Anaesthesiology 1992; 77:1134-42.
DOI Number: 10.37506/mlu.v21i1.2340 Medico-legal Update, January-March 2021, Vol. 21, No. 1 389
Abstract
Background: The COVID-19 has created havoc all over the world as no specific treatment available till
date. Total COVID-19 cases had crossed 11,125,245 including 528,204 deaths as per the WHO data till 5
July 2020. Unfortunately, India secured third place in total tally of COVID-19 cases with 6,77,719 total
cases including 19693 deaths as of 5th July 2020. The antiviral drug, Favipiravir, previously known as T-705
approved in Japan for treatment of Influenza. It is selective & potent inhibitor of viral RNA polymerase. It
is promising drug for treatment of wide range of RNA viruses including SARSCoV-2.
Method: The systematic review of Articles was done with the help of search engines like Embase, Medline,
PubMed & Google Scholar, clinicaltrials.gov. The Peer reviewed articles published through 6th of July 2020
were included in the study. This review was done to establish clinical evidence for use of Favipiravir in
COVID-19.
Conclusion: It was found that due to lack of conclusive evidence, Favipiravir cannot be included in main
armamentarium for COVID-19.
Abstract
Non-Hodgkin’s lymphoma (NHL) chemotherapy is cyclophosphamide, doxorubicin, vincristine, and
prednisone (CHOP) have hyperglycemia side effects that affect the success of chemotherapy. Improved
glycemic control decreases morbidity and mortality. Determine the glycemic control changes in non-DM
NHL patients before and the sixth day after the first CHOP chemotherapy.
Method: Prospective longitudinal observational analytic study in the Internal Medicine Inpatient Unit Dr.
Soetomo Teaching Hospital Surabaya, involved all the first CHOP chemotherapy NHL patients during
November 2019-February 2020. A total of 21 patients met chemotherapy requirements and were not DM.
The glycemic control check uses the hexokinase method and a glucometer (Easy Touch®). Data analysis
using the Wilcoxon test was considered significant if p <0.05.
Results: Total research subjects were 21 people, female domination (66.7%), mean age 49.24 ± 13.96 years,
clinical stage 3 dominance (52.38%), mean HbA1C 5.75 ± 0.49%, average FBG 90.86 ± 13.13 mg/dL, the
mean PPBG 114.33 ± 20.16 mg/dL. Daily blood glucose levels during chemotherapy were highest on the
first day’s pre-dinner. There were significant differences in FBG and PPBG before chemotherapy and the
sixth day after chemotherapy (p-values 0.032 and 0.002). The incidence of new-onset DM on the sixth day
after the first CHOP chemotherapy was 2 subjects (9.53%).
Conclusion: There was an increase in FBG and PPBG of NHL non-DM patients before and the sixth day
after the first CHOP chemotherapy.
The effect of chemotherapy on FBG and PPBG levels in this study was statistically significant (p = 0.032 and
p = 0.002) with a significance level of 5%. In our study, the average increase in FBG was 177.5 ± 28.99 mg/dL and
PPBG 239.5 ± 58.69 mg/dL.
Abstract
The criminal sanction that occurred against the perpetrators of narcotic users is still inclined to apply
imprisonment rather than rehabilitation measures. The research is a normative legal research using a statute,
case, and conceptual approaches. The results show that The essence of medical rehabilitation sanctions
imposing against victims of narcotics abusers who adhere to the double track system which is oriented
to criminal and action sanction. Rehabilitation of narcotics abusers and addicts the purpose to cure the
narcotics dependence against abusers and addicts so that the abusers and addicts recover from narcotics. In
order to realize a narcotics-free State, the implementation of medical rehabilitation sanction imposing must
reflect philosophical, juridical and sociological values while considers the legal development and needs of
the community in implementing narcotics crime eradication.
In addition, because not a few of the abusers who The phase of assessment at the Institution of
are caught must lose their right to undergo rehabilitation Compulsory Reporting as described in the table is a
as they should so the right to obtain access to essential phase that is general in nature and applies to all addicts
health is not obtained especially for drug addicts, and victims of narcotics abusers. This stage is also in
because the addict will be sentenced to prison. While it is accordance with what is regulated in Government
common knowledge that prison is no longer a safe place Regulation No. 25 of 2011 concerning the implementation
from these illicit goods. Hence, rehabilitation sanctions of the Compulsory Reporting on Narcotics Addicts.
should be premium remidium and imprisonment as According to the author, this phase is still incomplete if it
ultimumremidium in the prevention and eradication of only reaches the rehabilitation phase. It is better to avoid
narcotics crime so that the narcotics circle can be broken the relapse of addicts and victims of narcotics abusers
down to its roots. that there must be progress monitoring after following
the rehabilitation phase to monitor the situation of the
Method former addict. As for the number of addicts and victims
The research is a normative legal research using a of narcotics abuse that run the compulsory reporting at
statute, case, and conceptual approaches.9 The research the research location, can be seen in Chart 1.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 403
Chart 1. Number of addicts and victims of narcotics abuse to compulsory reporting at BNNK Watampone,
South Sulawesi, Indonesia. (*Updates for January - March)
Based on the result of interview with Mrs. Eni as is done for medical purposes and scientific development.
the Division Head of Rehabilitation of BNNK Bone The Narcotics law also has two approaches to those who
as place to receive the compulsory reporting, as the use narcotics illegally or against the law, or in other
result of reporting, it will be processed by conducting words misuse narcotics.
an assessment to determine the condition of the addict.
Accordingly, the intended assessment includes: The first approach is to see narcotics users as
victims so that they must be rehabilitated and the
a. Interview is to find out the medical history of addicts, second is to see narcotic users as criminals. As in the
the extent of narcotics use, the psychological state, explanation section of the narcotics law, it also regulates
the social background and to explore whether there criminal sanctions for the abuse of narcotics precursors
is involvement with the network. for narcotics manufacturing. To create a deterrent
effect on the perpetrators of narcotics abuse and illicit
b. Observation is to see the behavior of addicts,
trafficking of narcotics precursors, it is regulated
whether there are things that are hidden.
regarding the imposition of criminal sanctions, both
c. Physical examination is to find out the vital signs in in the form of special minimum penalties, 20 (twenty
the body of an addict. years) imprisonment, life imprisonment, and capital
As result of assessment can be seen whether punishment based on the group, type, size, and number
the addict has a connection with the network. If an of narcotics.
indication of involvement with the network is found then The policy in combating criminal acts of narcotics
this will be a reference for the Sub-Section of BNNK abuse is a positive legal policy which in essence is not
Bone for immediate action. Regarding the identity of merely the implementation of normative juridical laws.
the addict who is obliged to report will be guaranteed Besides the normative juridical approach, criminal law
confidentiality. As a consequence, if not obey the rule of policy also requires a comprehensive and integral factual
this compulsory reporting, the parents or guardians will juridical approach. The law has provided sufficient legal
be threatened with imprisonment as stipulated further in umbrella and has regulated everything from suppliers,
Article 128 of Act No. 35 of 2009 concerning narcotics. importers or producers to users, but at the level of
Based on the narcotics laws, narcotics users can be implementation of law enforcement efforts still need to
seen from 2 (two) points of view. The first is the use of be improved. This is related to the performance of the
narcotics legally or in accordance with applicable legal legal apparatus itself.
requirements. The second is the use of narcotics illegally The policy of crime eradication through the making
or contrary to the law referred to as narcotics abuse. of criminal law is an integral part of the community
Narcotics can be used legally and not against the law if it
404 Medico-legal Update, January-March 2021, Vol. 21, No. 1
protection policy and is an integral part of social politics. abusers are victims and not free from prison sentences.
Social politics can be interpreted as all rational efforts From those who undergone prison sentences, not a few
to achieve the welfare of society and at the same time are returning to abuse narcotics (relapse). As well with
include community protection. One function of the those who undergo rehabilitation either through legal
imposition of rehabilitation sanctions is to carry out extra step or compulsory reporting, not a few who return to
countermeasures against the problem of narcotics abuse abuse narcotics (relapse). For this reason, according to
which resolves the problem from its roots, namely from the author, the imposition of sanctions that have been
abusers in this case is abusers for themselves, addicts there needs to be reformulated again, where in the
and victims of narcotics abuse. narcotics justice system that has been adhering to a
dual track system independently between criminal and
Legal reform on Medical Rehabilitation against rehabilitation can be cumulative. In the sense that the
Narcotics Abuse: Legal renewal is defined as a imposition of sanctions against abusers is given a double
process of conducting review on various formulations sanction namely rehabilitation and prison sanction
of applicable laws and regulations, and to which are altogether. Rehabilitation sanction were imposed by
implemented a number of changes in order to achieve considering the position of the abuser as a victim who
efficiency, fairness and also the opportunity to obtain should have received special treatment (medical) in
justice according to applicable law. It is generally order to be able to eliminate detox which could trigger
understood that the actual legal reform takes place, the return of relapse.
when the body of authority forms the law, namely the
judiciary and the legislators, the government and the For this reason, there are several articles in Act
legislative authority in power or authority in a country No. 35 of 2009 concerning narcotics which should be
take a number of steps (legal policy) which is required reformulated so that it can be imposed on abusers so that
to test the applicable law.12 The legal policy was made the purpose of this law can be achieved optimally, such
in the context of legal reform. as the narcotics addicts and victims of narcotics abuse
must undergo medical and social rehabilitation, this
The criminal justice system is a system in a society article only allows imposed on those who are addicted
to overcoming the problem of crime. This system is and those who are persuaded, tricked, deceived, forced
considered successful if the majority of public reports as and threatened with using narcotics. While, many of
crime victims can be resolved by bringing the perpetrators abusers who first used narcotics because they were
to court and convicted.13 The components that work persuaded and deceived, because it is difficult to prove
together in the system of sanctions imposing against that Article 54 cannot be imposed on him as a victim.
victims of narcotics abusers are the police, prosecutors,
courts, prisons, the National Narcotic Agency. The four Conclusion
components are expected to work together to form what
is known as the “integrated criminal justice system”. The essence of medical rehabilitation sanctions
imposing against victims of narcotics abusers who adhere
Hence, to be able to guarantee abusers as perpetrators to the double track system which is oriented to criminal
of narcotics misuse in accordance with the purpose of and action sanction. In order to realize a narcotics-free
making the Act, the Narcotics Act contains or adheres to State, the implementation of medical rehabilitation
the rehabilitation justice system in addition to criminal sanction imposing must reflect philosophical,
justice. Therefore, the Narcotics Law adheres to the juridical and sociological values, while considers the
Double Track Criminal System. The dealer follows legal development and needs of the community in
the criminal justice track while the abuser follows the implementing narcotics crime eradication. The ideal
rehabilitation justice track. The rehabilitation justice concept of medical rehabilitation sanctions imposing
system is a judicial system in which sanctions out of against on victims of narcotics abuse can be done by
criminal sanctions become rehabilitation sanctions reformulating several articles in Act No. 35 of 2009
with the purpose that the suspect is cured and does not concerning Narcotics which should be reformulated so
become a further abuser.14 that it can be imposed on abusers so that the purpose of
this law can be achieved optimally.
The justice system that has been in effect mostly
focuses only on the criminal justice system. Where, the Ethical Clearance: No ethical approval is needed.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 405
Source of Funding: Self melapor-ke-bnn-anda-tidak-akan-dipenjara,
accessed on 17 November 2018
Conflict of Interest: Nil
8. Liputan 6 News. Available online at: https://www.
References liputan6.com/news/read/3391765/bnn-pecandu-
yang-kembali-konsumsi-narkoba-usai-rehabilitasi-
1. Fellner, J. Race, drugs, and law enforcement in the 70-persen, accessed on 23 November 2018
United States. Stanford Law and Policy Review,
9. Fajar, M., and Ahmad, Y. DualismePenelitian
2009;20 (1) 257-264.
Hukum Normatif dan Empiris. Pustaka Pelajar.
2. Lisa, J., and Sutrisna, N. Narkoba, Psikotropika, Yogyakarta, 2017; 34
dan Gangguan Jiwa (Tinjauan Kesehatan dan
10. Adi, K. Diversi Tindak Pidana Narkotika Anak.
Hukum). NuhaMedika. Yogyakarta, 2019;4.
Malang: Setara Press, 2015; 31
3. Arif, B.N. Bunga Rampai Kebijakan Hukum
11. Iskandar, A. Penegakan Hukum Narkotika
Pidana. Semarang. Kencana, 2010;6.
(Rehabilitatif Terhadap Penyalah Guna Dan
4. Ariyanti, V. Indonesia’s criminal law policy on Pecandu Represif Terhadap Pengedar). Jakarta: PT
the victim of narcotics abuse in the perspective of Elex Media Komputindo. 2019; 7
victimology. Veteran Law Review, 2018; 1(1), 32-
12. Prasetyo, T. Pembaharuan Hukum Perspektif Teori
49.
Keadilan Bermartabat. Malang: Setara Press, 2017;
5. Triadi, R. Level of compliance of narcotics victims 26.
in turning medical and social rehabilitation. Journal
13. Reksodiputro. M. Sistem Peradilan Pidana
of Islamicate Studies, 2018; 1(2): 23-41
Indonesia (Peran Penegak Hukum Melawan
6. Febriana, M., Soewondo, S. S., Hamid, M. A., & Kejahatan). Jakarta: Pusat Pelayanan Keadilan dan
Heryani, W. Legal Protection of Narcotic Abusers: Pengabdian Hukum. 1997; 84.
A Restorative Justice Perspective. J. LPol’y &
14. Idaiani, S. Relapse in Drugs, Psychotropic,
Globalization, 2019; 88 (1) 64.
Addictive Abuse Post Rehabilitation: “Policy
7. Tribun News. Available online at: http://makassar. and Prevention Programs”. 4th International
tribunnews.com/2018/11/16/bnn-sulsel-jika- Symposium on Health Research, 2019; 56-59.
kecanduan-narkoba-jangan-malu-dan-takut-
406 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2343
Abstract
Purpose: The aim of the study is to assess the prevalence of anxiety and depression among the urban Indian
population during the period of national lockdown imposed by the government of India to combat the
COVID-19 pandemic
Method: Total 278 participants were participated in an online, cross-sectional survey. Anxiety and depression
was assessed. Gender, age, occupation and average time spent on gathering information on COVID-19 was
assessed.
Results: less than 30 years of age and students showed higher prevalence of depression. Participants
spending more than three hours on COVID-19 information showed that 18.2%, 42.4% and 37.9% were
mildly, moderately and severely affected by anxiety symptoms, respectively and 19.7%, 47% and 24.2%
were mildly, moderately and severely affected with depression. Further, more than three hours of time spent
on COVID-19 showed strong association with mild, moderate and severe anxiety (p<0.001) as well as mild,
moderate and severe depression (p≤0.01).
Conclusions: Participants, less than 30 years of age and students were found more likely to have anxiety
and depression symptoms. Participants who have been spending more than three hours on COVID-19
information were strongly affected with mild, moderate and severe anxiety as well as depression.
Table 1. Prevalence of generalize anxiety (GAD-7) stratified by gender, age, occupation and average time
spent on COVID-19 in the participants.
n: number of participants; %: percentage; <30 years: less than 30 years of age; ≥30 years: more than or equal to 30 years of age; <1
hours: less than 1 hour time spent; 1-3 hours: one to three hour of time spent; >3 hours: more than three hours of time spent; *: significant
difference.
Table 2. Prevalence of depression (PHQ-9) stratified by gender, age,occupation and average time spent on
COVID-19 in the participants.
n: number of participants; %: percentage; <30 years: less than 30 years of age; ≥30 years: more than or equal to 30 years of age; <1
hours: less than 1 hour time spent; 1-3 hours: one to three hour of time spent; >3 hours: more than three hours of time spent; *: significant
difference.
Table 3. Univariate and multivariate logistic regression analysis of potential factors for severity of
generalized anxiety (GAD-7).
n: number of participants; %: percentage; <30 years: less than 30 years of age; ≥30 years: more than or equal to 30 years of age; <1 hours:
less than 1 hour time spent; 1-3 hours: one to three hour of time spent; >3 hours: more than three hours of time spent; OR: odds ratio;
AOR: adjusted odds ratio; 95% CI: confidence interval at 95%; *: p<0.05; **: p<0.01
Table 4. Univariate and multivariate logistic regression analysis of potential factors for severity of
depression (PHQ-9).
n: number of participants; %: percentage; <30 years: less than 30 years of age; ≥30 years: more than or equal to 30 years of age; <1 hours:
less than 1 hour time spent; 1-3 hours: one to three hour of time spent; >3 hours: more than three hours of time spent; OR: odds ratio;
AOR: adjusted odds ratio; 95% CI: confidence interval at 95%; *: p<0.05; **: p<0.01
Medico-legal Update, January-March 2021, Vol. 21, No. 1 411
Abstract
Introduction: Internet usage has become a big part of many people’s lives, and among the many uses Social
Networking Sites (SNS) which became very prevalent. How privacy concerns, trust and control are affecting
SNS usage and self-disclosure has become an important question for many people.
Aim: Aim of the study is to assess the information disclosure and control on online social network sites
among medical undergraduates.
Methodology: The study was conducted at Saveetha medical college and hospital among medical
undergraduates. A questionnaire on usage of online social networks and information disclosures was
administered and analysed it for reliability, social network site usage, privacy concerns, and disclosure of
autobiographical memories.
Result: Almost 81.1% of the people feel that their browsing history were tracked by social networking sites.
Instagram is mainly used app by medical undergraduates (40%).
Conclusion: There is an excess usage of social networking sites and easy information disclosure is seen in
the population.
Abstract
Background: Suicide is a global health problem occurring in all parts of the world. It was the second
leading cause of death among 15-29 year olds in 2016. Hence, an understanding of specific factors related
to suicide would enable prevention strategies to be more sensitive.
Method: A cross sectional study was conducted in Department of Forensic Medicine, Gandhi Medical
College, Secunderabad, which included all cases of suicidal deaths in females in the age group of 12-24
years in the period of January 2017 to November 2018.
Results: Majority cases belonged to the age group of 19-24 years (49%). Many victims were from rural area
(60%), belonging to middle socioeconomic status (57%) and unmarried (80%). Majority of the victims were
graduates i.e. 32% and 55% of them were students. The leading motive behind the suicides was emotional
disturbances (21%). Hanging is the most commonly adopted method to commit suicide i.e. 53% of deaths.
Conclusions: Most of the factors related to suicide are preventable. Suicides among the young can be
prevented by starting student guidance clinics and should also incorporate woman specific strategies like
providing education, economic security and empowerment of women.
Fig 1: Marital status victims in deaths due to suicide in females aged 12-24 years
In this study group, 7(7%) cases of suicidal deaths deaths. The other motives in the decreasing order of
occurred during menstruation. 1 (1%) victim who frequency were illness and love related issues sharing
committed suicide was pregnant. In 92 (92%) of the 13(13%) each, failure in exams and economic problems
cases, hormonal status of the victim was not known. sharing same percentage i.e. 9(9%) each, marriage
According to the present study, in 24(24%)deaths, related issues i.e. 6(6%) of deaths, harassment for dowry
the motive behind the suicide was not known. In the i.e. 4(4%) deaths and the least motive behind the suicide
remaining deaths, the leading motive behind the suicide was death of a family member i.e. 1(1%) of deaths.
was emotional disturbances amounting to 21 (21%)
Abstract
Background: Ventral hernias result from weakness in the musculofascial layer of the anterior abdominal
wall. Ventral hernia can be operated through open or laparoscopic approach. Moreover, there are various
options available for mesh placement during the repair. We here report our experience in surgical management
of ventral hernias along with review of published literature along with laparoscopic repair of ventral hernias.
Method: It was a retrospective study of patients who were operated for ventral hernias over a period of 4
years in a teaching hospital of Vadodara SBKS research institute Dhiraj Hospital. All patients irrespective of
age and sex were included. All patients were evaluated by obtaining proper history and performing detailed
physical examination and routine blood investigations. Various intra operative and postoperative parameters
were observed and reported.
Conclusions: The ventral hernia repair can be done by open and laparoscopic technique. Each has its own
advantages and disadvantages. There is no conclusively guidelines about the superiority of one technique
over the other and also no conclusively guidelines for the proper position of mesh placement. The clear
advantages of open technique is avoidance of general anesthesia in many cases (as many ventral hernia
repairs can be done under local anaesthesia), lesser learning curve, cheap meshes can be used, easy to
learn, no requirement of any sophisticated instruments or OT setup and trained staff. The disadvantage of
laparoscopic technique includes the requirement for general anaesthesia (as many ventral hernias can be
performed with local anaesthesia in open technique), need to transverse the abdominal cavity, prolonged
learning curves, requirement of costly meshes and sophisticated equipment and technical staff. However,
laparoscopy has advantage over open hernia repair in terms of reduced postoperative pain, decreased
postoperative complications, reduced length of hospital stays, less time for return to normal activity and
bettercosmesis.
Abstract
Background: The increasing prevalence of multi-drug resistant of bacteria strains, has become a global
problem and therefore alternative method to antibiotics must be found. Bacteriophages are considered an
alternative agent to control infection and contamination of the bacteria. Method: We used RAPD-PCR
technique in present study, and used restriction endonuclease conformed presence unknown DNA fragments.
Results: In this study, we described the isolation and character development of lytic bacteriophages capable
of infecting bacteria specifically. Lytic bacteriophages, specific to Escherichia coli, Klebsiella pneumonia,
Salmonella typhi, clinical strains, was first isolated from sewage. We have analyzed the DNA (RAPD)-
PCR technique to produce unique and reproducible band from 21 different bacteriophages infecting E.coli,
K. pneumonia, S. typhi . Used restriction endonuclease conformed presence unknown DNA fragments.
Conclusion: Phages was capable of eliciting efficient lysis of studied bacteria, revealing its potential as a
non-toxic sanitizer for controlling bacterial infection and contamination in both hospital and other public
environments.
Figure 1. Plaque formation of (A) E.coli, (B) S.typhi, (C) K.pneumonia phages after 24h incubation at 37 °C
on BHA
Figure 2. The total titer of (A) K.pneumonia, (B) S.typhi, (C) E.coli specific phages after 24h incubation at
37◦C on BHA.
Extraction genomic DNA: DNA was extracted for all studied phages . The integrity of the extracted
for all selected bacteriophages with 21 phages, which DNA was confirmed after gel electrophoresis 1.5%.
were isolated from sewage from various sources. The Fig. 3.
extraction results highlights the presence of DNA bands
430 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure 3. 21 Bands of genomic DNA and (M): DNA ladder (100 bp), agarose 1.5%, at 70 volt for 1 hr.
Random amplification of polymorphic DNA weights according to the primer used. In Fig.4a, S. typhi
(RAPD-PCR) technique: Fig. 4 shows RAPD-PCR phages (1-9) and K. pneumonia phages (10-16) showed
random amplification technique was performed using positive results with OPL5 primer, while E.coli phages
two primers OPL5, RAPD5 for all phages . This (17-21) showed negative results. But when using RAPD5
technique showed obvious difference in the number of primer showed positive results of all the phages, Fig. 4b.
DNA bands and a marked variation in their molecular
Figure 4. RAPD PCR products, Gel electrophoresis at 70 volt and 1h on 1.5% agarose gel showing [A] using
OPL5 primer lanes positive of S. typhi phages(1-9), lanes positive K.pneumonia phages (10-16), negative
lanes of E.coli phages(17-21). [B] using RAPD5 primer, lanes positive of S. typhi phages (1-9), lanes positive
K.pneumonia phages (10-16), positive lanes of E.coli phages(17-21). Lane M: DNA ladder (100bp), C:
negative control.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 431
Restriction endonuclease enzymes: Four similar due to similar DNA bands and also similar all
Restriction endonuclease enzymes (NdeI, SspI, Swa E.coli phages(17-21), while showed K.pneumonia
I, TaqI) were performed for all phages. The enzymes phages (10-16) negative results with using NdeI
(Swa I, TaqI) did not produce positive result, while the enzyme. As shown Fig4b S.typhi phages(1-9) and E.coli
enzymes (NdeI, SspI,) digested the DNA at more than phages(17-21) positive results, and negative results of
one site and showed different bands and different weights K.pneumonia phages (10-16) after using SspI enzyme.
as positive results. Fig5a, showed S.typhi phages(1-9)
Figure 5. Restriction endonuclease products, Gel electrophoresis at 70 volt and 1h on1% agarose gel
showing [A]using NdeI enzyme lanes positive of S.typhi phages(1-9), lanes negative K.pneumonia phages (10-
16), positive lanes of E.coli phages(17-21). [B] using SspI enzyme, lanes positive of S. typhi phages (1-9), lanes
negative K.pneumonia phages (10-16), positive lanes of E.coli phages (17-21). Lane M: DNA ladder (100bp).
C: negative control.
Abstract
A study was conducted to assess the awareness on covid-19 by using online platform among global community.
The objectives were to assess the socio demographic characteristics, to determine the relationship between
levels of awareness of COVID-19 with their selected demographic variables.
A global community based cross sectional study was conducted by internet survey design with 2857
respondents. Data were collected by online Google form, researcher administered a questionaries’ awareness
on COVID 19 through goggle link to the online platform and receive responses from the respondents,. The
collected data was tabulated and analyzed. Descriptive and inferential statistics were used.
Researchers observed that 29.1% of the respondents reported high levels of awareness, 48.5% of the
respondents reported moderate levels of awareness and 23.4% of the respondents reported low levels of
awareness on COVID-19 respectively. It is very essential to create the awareness on COVID 19 among
global population and protect the global community from deadly disease.
This study was conducted to determine the public The questionnaire was prepared by the researchers,
response on Cognizance on COVID-19 by using online there were socio demographic questionnaire and
platform. This study surely helps the local, national and 15 awareness questions on COVID-19 with the
international organization to identify the awareness on sources adopted from WHO, UNICEF and NHS. The
COVID-19 and prevent further transmission questionnaire was translated from English into Afan
Oromo and Amharic again translated back in to English,
Objectives: and comparisons were made on the consistency of the
three versions.
General Objective: The aim of this study is to
assess the level of awarenesson COVID-19 by using Data Collection Procedure: Data was instinctively
online platform in Global community, 2020. collected by using online platform. Respondents were
filled the Google form for basic details voluntarily
Specific Objectives:
and also given the online consent to participate in the
1. To assess the respondents socio-demographic internet survey followed by respondents were filled
characteristics. the awareness questionnaire on COVID 19. Once who
2. To determine the relationship between level were successfully complete and submit the Google form
of awareness of COVID-19with their selected instantly received their score by given email ID.
demographic variables. Data Processing and Analysis: Data was copied
from Google spread sheet filled questionaries’ were
Materials and Method
checked manually for completeness and then coded.
Non-experimental evaluative approach was used.A Entered and cleaned using Epidata version 3.11. Double
community based cross sectional study internet survey entry made to minimize entry error and exported to SPSS
design was adopted. The source population was all the version 23.0 for analysis. Descriptive analysis was used
stages of people across the global community during the to describe the percentages and number distributions
study period. Person who satisfying the inclusion criteria of the respondents by socio-demographic and socio
such as age group 18 years and above were voluntarily economic characteristics. Inferential statistics like ‘t’
participated in the study during the study period. test and ANOVA test were used to analyze the data. P-
Value< 0.05 was considered to be declared statistically
Sample Size Determination: The minimum sample
significant.
size for online survey should be 100, required sample
436 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Results
The cross sectional study internet survey was carried out to assess the awareness on COVID-19 among peoples
from worldwide. The total of 2857 respondents was participated from 26 countries from the throughout the world as
denoted in Figure-1.
Socio demographic characteristics of the study Significant difference between male and female
respondents 1431 (50.05%) were belongs to 18-30 years, with respect to awareness on COVID19 among the
756 (26.46%) belongs 40 31-40 years, 417 (14.60%) respondents were presented in Table 1 and it is revealed
were 41-50 years and very few reporte in the age groups that significance difference between male and female
above 51 years as 253 (8.86%), in this 1236(43.26%) of respondents. Based on means core, the female
participants were male and 1621 (56.74%) belongs to respondents (1.843) have high level of perception on
female. awareness than male respondents (1.656). Field of
education is presented in Table 2.
Table 1: t-test for significant difference between Male and Female with respect to Factors of awareness on
COVID19 among the Respondents N=2857
Gender
Factors of perception on
Male Female t-value P-value
COVID19
Mean SD Mean SD
Awareness 1.6569 0.7272 1.8435 0.7943 2.849 0.005*
Since P value is less than 0.05, null hypothesis is Among 1236 (43.26) respondents were belongs
rejected at 5% level regard to Factors of awareness. to male, 1621 (56.74) respondents were belongs to
Hence there is significance difference between male female and their awareness on COVID 19 as follows:
and female of respondents with regard to the Factors of 832 (29.12), 1386 (48.51), 639 (22.36) low, moderate
awareness. Based on means core, the female respondents and high level of awareness respectively mentioned in
have high level of awareness on COVID 19 than male Figure 2.
respondents.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 437
Figure-2: Percentage of level of awareness on COVID19 among the Respondents.
Table 2: ANOVA for significant difference among field of education with respect to Factors of awareness on
COVID19 among Respondents
Note: The value within bracket refers to SD, *denotes significant at 5%level
Table 3 Chi-square test for association between Gender and Level of awareness on COVID19 among
respondents
Level of awareness
Gender Total Chi-square P value
Low Moderate High
356 591 281 1236
Male (42.8) (42.6) (44.0) (43.3)
[28.8] [47.8] [22.7] [100.0]
476 795 350 1621
Female (57.2) (57.4) (54.8) (56.7) 8.028 <0.005*
[29.4] [49.0] [21.6] [100.0]
832 1386 639 2857
Total (29.1) (48.5) (22.4) 100)
[100] [100] [100] [100]
Note: The value within() refers to column Percentage, The value within [ ] refers to row Percentage, *Denotes significant at 5%level
Since P value is less than 0.05, the null hypothesis respondents. Based on row percentage, 28.8% of male
is rejected at 5% level of significance. Hence concluded have low level of awareness, and 22.7% of male have
that there is association between Gender and Level high level of awareness whereas for female 29.4%
of perception of awareness on COVID 19 among the belongs to low level of awareness and 21.6% belongs
438 Medico-legal Update, January-March 2021, Vol. 21, No. 1
to high level of awareness. Hence majority of female Acknowledgement: The authors wholeheartedly
respondents have high level of awareness and majority wish to thank the university heads, Dambi Dollo
of males have low level of awareness as denoted in University, Oromia, Ethiopia for their support for
table 3. completing the research and also extending the sincere
acknowledgement to all the respondents from different
Discussion part of the world.
The study was aimed to assess the awareness of on Conflict of Interest: Nil
COVID 19. It was supposed that, this study provided
important information and created overall image on Source of Funding: The Corresponding Author
awareness on COVID 19 in global community. received funding from the Dambi Dollo University for
conducting the this global community research through
Present online study with 2857 responses from 26 online platform and obtained Permission for authorship
different countries, 969 (33.9) were from India, 682 and Publication of this article.
(22.9) responses from Ethiopia and responses from
others countries as follows: USA 183 (6.4) Scotland 65 Ethical Clearance: Official ethical clearance
(2.3) Kenya 72 (2.5) Philippines 23 (0.8) Dubai 85 (3.0) letter was received from Research and Technology
Oman 21 (0.7) Muscat 24 (0.8) Eretria 19 (0.7) Sharjah Innovative directorate office, Dambi Dollo University.
76 (2.7) Kuwait 22 (0.8) Saudi Arabia 116 (4.1) China After receiving the official letter from the University,
82 (2.9) Bahrain 52 (1.8) Zambia 11 (0.4) Nigeria 26 seeking for the consent and voluntary response from the
(0.9) Nepal 15 (0.5) Ireland 52 (1.8) Newzeland 27 (0.9) participants followed by they were recruited as study
Egypt 13 (0.5) Canada 38 (1.3) England 19 (0.7) South participant. Confidentiality, anonymity and privacy
Africa 92 (3.2) Abu Dhabi 64 (2.2) Bangladesh 9 (0.3) were maintained by excluding the name and ID of
study participants from the questionnaire. Autonomous
In this 1236 (43.26) respondents were belongs to was maintained for recruited respondents. Justice
male, 1621 (56.74) respondents were belongs to female was maintained by voluntary response to select all the
and their awareness on COVID 19 as follows: 832 participants and veracity also maintained by truthfulness
(29.12), 1386 (48.51), 639 (22.36) low, moderate and in each stage of the study.
high level of awareness respectively.
References
Conclusion and Recommendations
1. WMHC. Wuhan Municipal Health and Health
As the researchers observed and concluded that Commission’s Briefing on the Current Pneumonia
the present study of awareness on COVID 19 among Epidemic Situation in Our City. 2020.
global community was most of respondents exhibited
2. Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, et
moderate level of awareness on COVID 19,few had
al. Early transmission dynamics in Wuhan, China,
high level awareness and around 30% of the respondents
of novel coronavirus-infected pneumonia. N Engl J
are reported low level awareness. So, need to create the
Med. 2020.
awareness on COVID 19 throughout the world with the
aim to reduce the spread of infection and also protect the 3. Centers for Diseases Control and Prevention
global community from deadly disease. Coronavirus disease (COVID-19) outbreak (2020)
4. WHO. Novel Coronavirus, awareness–China.
Recommendations- Many Awareness program, 2020.
Pamphlets on COVID 19 are created by the organizations
5. Zhu N, Zhang D, Wang W, Li X, Yang B, Song
like WHO and circulated. But it can be possible only
J, et al. A novel coronavirus from patients with
by the common public, responsible persons should take
pneumonia in China, 2019. N Engl J Med. 2020.
initiatives in each country like ambassador’s to spread
the awareness to each and every individuals of the world. 6. WHO. Novel Coronavirus-Japan (ex-China). 2020.
It is very essential and important to create the awareness 7. Virological.org. Novel 2019 Coronavirus Genome
on pandemic disease to protect the global population 2020.
from the Coronavirus and to lead healthy life. 8. Fehr AR, Channappanavar R, Perlman S. Middle
East respiratory syndrome: emergence of a
Medico-legal Update, January-March 2021, Vol. 21, No. 1 439
pathogenic human coronavirus. Annu Rev Med. Emergency Committee regarding the outbreak of
2017; 68:387–99. novel coronavirus (2019-nCoV).
9. WHO. Statement on the second meeting of 10. UNICEF, Coronavirus disease, awareness on
the International Health Regulations (2020) COVID-19, (2020)
440 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2349
Abstract
A study was conducted to assess the level of stress, fear, anxiety and depression among adults in residing
in selected area. The objectives were to assess the socio demographic characteristics of adults, to find
out the association between level of Stress, fear, anxiety and depression of the respondents with selected
demographic variables.
A community based cross sectional study was conducted with 634 adults were selected by the multistage
random sampling technique. The data were collected by using standardized questionnaires, fear on COVID
19 and Stress, anxiety and depression on COVID 19. The collected data was tabulated and analyzed.
Descriptive and inferential statistics were used.
Researchers observed that 35.5%, 4.1%, 13.2%, 8.2% of the respondents reported moderate levels of fear,
stress, anxiety and depression respectively and 21.3%, 1.1%, 1.7%, 1.3% of the respondents reported extreme
levels of fear, stress, anxiety and depression respectively.It is essential and in evitable to alleviate the stress,
fear, anxiety and depression among general population and provide positive metal health.
Table: 1: t-test for significant difference between Male and Female with respect to Factors of fear, stress,
anxiety and depression on COVID19 among the Respondents
Gender
Factors of perception on
Male Female t value P value
COVID19
Mean SD Mean SD
Fear 1.8429 0.7841 1.6589 0.7382 2.849 0.005*
Stress 1.2167 0.6008 1.2009 0.6293 0.307 0.759
Anxiety 1.5690 0.9879 1.4720 0.9770 1.174 0.241
Depression 1.4000 0.7889 1.3785 0.7701 0.327 0.744
<0.001**
Overall SFAD 6.0286 3.1617 5.7103 3.1146 4.657
<0.001**
Fried man test for significant difference among is significant difference among mean ranks towards
mean ranks towards factors of fear, stress, anxiety Factors of SFAD. Based on mean rank, Fear (2.79) is the
and depression on COVID19 among the respondents most important factor, followed by anxiety (2.52), Stress
represented in Table: 2 and it concluded that there (2.37) and Depression(2.13).
Table: 2: Fried man test for significant difference among mean ranks towards Factors of fear, stress, anxiety
and depression on COVID19 among the respondents
Kumari Mangalam1, Chauhan Muneesh2, Anand Akshay3, Fatima Ambreen1, Saho Pramod1
1
Assistant Professor, Galgotias University, Greater Noida, 2Student, Galgotias University, Greater Noida,
3
Assistant Professor, Manav Rachna International University, Faridabad
Abstract
Introduction: Now a day’s Obesity has become pandemic concern globally and the prevention of later stage
obesity will require elimination and management of childhood obesity. Childhood obesity and overweight
are linked with hypertension, dyslipidemia and decreased metabolism of glucose that ultimately affects our
quality of life and physical health and further can lead to increment in the risk of early disease and death.
Aims and Objectives: The current investigation was conducted to find out the prevalence of overweight and
obesity in school going adolescents.
Material and Method: The present study was a cross-sectional, school-based study conducted in four
urban schools of Patna from June, 2019 to, February 2020 with sample size of 660 adolescents (380
boys and 280 girls). The study design was approved by the institutional ethical committee. Three schools
accepted our proposal out of 5 schools selected through systematic random sampling. A predesigned and
pretested questionnaire was used to collect data on sociodemographic, dietary intake, physical activity and
anthropometric measurements.
Result and Discussions: The pervasiveness of overweight and obesity was found to be 18.18%(120) and
10.9% (72), respectively in our study. The prevalence of overweight and obesity was 11.3% and 5.5%,
respectively among the males. Males are more affectionate to Non Vegan-compared to females where the
number of vegetarian supersedes the animal eater. Calories deficiency is 71.2% in the whole population on
the other hand overeating was seen more in male candidates than females. More than 20% of the population
was found to dine out once or more than once a week .Fast food intake found to be ingested in 44.6%
population once or twice a week on the other hand there is a huge population of 37.8 % who are consuming
3-5 times a week. Mehta et al. revealed the predominance of obesity and overweight as 5.3% and 15.2%,
respectively in his cross-sectional study which was directed in schools of Delhi. Sharma et al demonstrated
that 6.4% school children are obese in Delhi.
Conclusions: The current study suggests that juvenile overweight and obesity is a issue of serious concern
in urban community as well as all over. We can prevent this epidemic by doing lifestyle modifications and
spreading awareness among people. To achieve this appropriate health education training and awareness
program should be imparted to guardians, school authority and children.
Introduction
Corresponding Author: Presently, Obesity has become a serious and genuine
Akshay Anand unavoidable concern in all generation groups. Obesity is
Assistant Professor (Manav Rachna International characterised as a condition wherein there is abnormal
University, Faridabad) Tuglakabad Extension Delhi or uncurbed accumulation of fat in adipose tissue occurs,
e-mail: [email protected] to the degree that health may be compromised1. This
Medico-legal Update, January-March 2021, Vol. 21, No. 1 447
worldwide pandemic of excessive weight and obesity the parents prior to the study. Apparently Adolescents
-collectively termed as “globesity” - is quickly turning school children of Vth to Xth standard, in the range of
into a significant public health concern in all over the 8-15 years of age were included in the study. Following
globe. Children having Chronic illness, Severe malnutrition,
any type of Endocrinal problems, Physical & Mental
Obesity has outreached epidemic extent globally, disorders and Children with apparent obesity induced or
and is a remarkable patron to the chronic ailment and associated with any syndrome were excluded from the
disability having more than 1 billion adults overweight study.
and around 300 million clinically obese1. progressively
it is perceived as a critical issues in both developing and The data was collected by using the pre-structured
countries experiencing financial transition2. questionnaire to assess total food intake, Type of
diet, dietary habits, anthropometric measurement and
These issues are not only limited to adults but also physical activity.
being accounted among the children and adolescents of
developed3,4 as well as developing nations of the world5. Information on socio-demographic particulars,
This new drifting concern lead to various consequences dietary habits and usual physical activity, time spent in
in both adolescence6 and adult life7especially increased watching TV and with computer and in other sedentary
rate of coronary artery diseases, hypertension, diabetes, activities during the past one month, was assessed.
dyslipidaemia8, obstructive sleep apnoea9, esophageal Physical activity level (PAL) of the Children were
reflux & gastric emptying disturbances, osteoarthritis assessed by using Global Physical Activity Questionnaire
& flat feet10, psychological dysfunction, self esteem & (GPAQ). Anthropometric measurements of weight (kg)
social isolation6, and overall increase in morbidity and and standing height (cm), waist circumference (cm),
mortality in later life11. were taken by using standard equipment and procedures.
Utilizing the weight and height, Body mass index (BMI)
Epidemiological studies have reported that about was calculated in Kg/m2, for each subject.
a third of preschool children and a half of school-
age children become obese adults12. The effective For overweight and obesity - IOTF classification
prevention of adult obesity will require the prevention was considered for calculation of overweight and obese
and management of childhood obesity1. India has also subjects values between 85th -95th percentile were
witnessed a gradual and continuous rise in trends of defined under overweight. values above 95th percentile
childhood and adolescent overweight and obesity13. were considered as obese subjects.
Taking this into consideration of these realities, the
present study was conducted to the prevalence of Result and Discussion
Overweight and Obesity in Adolescent School Children Ms Excel was used for Data entry. Statistical
of “Patna”, capital of Bihar. Analysis was done using SPSS version 22.0 software for
Windows (SPSS Inc., Chicago, IL, USA) and P < 0.05
Material and Method was considered as statistically significant. Descriptive
The current study was a cross-sectional, school- statistics were calculated in the form of percentages,
based study conducted in four urban schools of Patna mean and standard deviation for the demographic data.
from June, 2019 to, February 2020 with sample size A total of 660 adolescent school children were recruited.
of 660 adolescents (380 boys and 280 girls) with the Out of 660 adolescents interviewed, 53.03(n=350)
aims and objectives to determine the prevalence of were males and 46.9% (n=310) were females. The
overweight and obesity in adolescent school children. pervasiveness of overweight and obesity was found to be
The study design was approved by the institutional 18.18%(120) and 10.9% (72), respectively in our study.
ethical committee. In this study Three schools accepted The prevalence of overweight and obesity was 11.3%
our proposal out of 5 schools selected through systematic and 5.5%, respectively among the males.
random sampling. Informed consent were taken from
448 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 1. Mean±S.D. Weight, Height, BMI and WC of Females
Table 3. Distribution of Study Population According to Age Group, Sex and Type of School
Among the females, we found the prevalence of Among the females, we found the prevalence of
overweight was 7.2% and that of obesity was 5.4%. The overweight was 7.2% and that of obesity was 5.4%.
prevalence of overweight and obesity was found to high The prevalence was found to high among the males.
among males. Males are more affectionate to Non Vegan-compared to
Medico-legal Update, January-March 2021, Vol. 21, No. 1 449
females where the number of vegetarian supersedes the to high socioeconomic class as compared to those who
animal eater. Calories deficiency is 71.2% in the whole belongs to the lower socioeconomic class16.
population on the other hand overeating was seen more
in male candidates than females. More than 20% of the The predominance of overweight and obesity among
population was found to dine out once or more than once the school-going adolescents of Patna was seen as high .
a week .Fast food intake found to be ingested in 44.6% Raj et al indicated a gradual increment pattern transition
population once or twice a week on the other hand there in health concerning with overweight and obesity13.
is a huge population of 37.8 % who are consuming 3-5 Among all sedentary actions, TV viewing has received
times a week. Only 36.3 % candidates were consuming unique attention, and in this study, it was seen as to be
fruits 5 times a week. Around 43% of Population in our a significant independent factor influencing overweight
study were performing moderate/vigorous activities and obesity.
remaining were performing the same activity level and Overweight is characterized as a BMI between the
they are 56% of the population. 50% of Population were 85th and 95th percentile for age and sex, and obesity−as
performing moderate PA, while 28.4% were stuck on a BMI greater than the 95th percentile. BMI is utilized
Low PA, Only 20.7% were performing High PA.13.3% as a particular pointer of abundance adiposity among
of candidates uses mobile phone more than 2 hours a day children.
while 42.7% of population still uses 1 hours every day.
A major section of population doesn’t uses computer i.e. The prevalence rates of adolescents overweight and
50.4% while 12.5% uses more than a hour. obesity in our region (Patna) were higher as compared to
previously reported data from other areas in Bihar.
Total sedentary time was 56.3% in 6-10 hours user.
While 35.7% is the percentage of least user. Conclusion and Recommendations
Discussion We Concluded that whether the city is enormous
or small this is a genuine concern to be dealt with. It
India, considered as an ethnic group are mainly at is very essential to take preventive measures such as
greater risk for insulin resistance and central obesity, awareness programs school based and community based
Prompting to diabetes, Heart Disease and other “life to avoid this crucial issue of overweight and obesity.
style” disorders. Over nutrition and sedentary lifestyle To sum up, our study also conclude that restricted
predisposes to various metabolic syndrome and type physical movement, undisciplined and detrimental food
2 DM. various investigations have demonstrated that tendency and increment in stationary and inactive way
these problems begins in childhood and manifest of life are turning out to be major contributing element
due to interactions and accumulation of multiple risk for overweight and obesity. The current study suggests
factors, throughout the life span. Mehta et al. revealed that juvenile overweight and obesity is a issue of serious
the predominance of obesity and overweight as 5.3% concern in urban community as well as all over. We can
and 15.2%, respectively in his cross-sectional study prevent this epidemic by doing lifestyle modifications
which was directed in schools of Delhi14.Sharma et al and spreading awareness among people. To achieve this
demonstrated that 6.4% school children are obese in appropriate health education training and awareness
Delhi15. program should be imparted to guardians, school
In our study the event of overweight and obesity authority and children.
was found to be 18.18% and 10.9%, respectively. Limitations: For more vital and precise information
Perhaps this is on the ground that in Patna city there is larger sample size could have taken. however due to
accessibility of wide range of fast/junk food corners, lockdown same could not be achieved. Information
modern electronic gadgets, games and transport facilities about the dietary habits, intake and others must be taken
which are contributing for the increased prevalence of in front of guardian for accurate information.
overweight and obesity in adolescents.
Acknowledgment: We would like to thank all the
Similar finding were accounted by Goyal et al. participants of the study for their cooperation. Financial
with 12% of overweight and obesity among adolescents support and sponsorship Nil. Conflicts of interest
(aged 12-18 years) in addition to this It was also reported There are no conflicts of interest.
that the prevalence was higher in children who belongs
Ethical Clearance: Institutional ethical committee
450 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Lien Nguyen-Phuong1, Hang Thu Thi Dang2, Nhung Phuong Thi Nguyen3
1
A PhD and lecturer, Business Administration Department, Faculty of Business Administration, Van Lang
University, Viet Nam. Address: 45 Nguyen Khac Nhu Street, Co Giang Ward, District 1, Ho Chi Minh City-70000,
2A MBA and lecturer, Accounting-Finance Department, Faculty of Economics and Business, Hoa Sen University,
Ho Chi Minh City, Viet Nam, 3A PhD and lecturer, Business Administration Department, Faculty of Economics and
Business, Hoa Sen University, Ho Chi Minh City, Viet Nam
Abstract
The paper investigates the relationship among social and demographic factors and a new case of spreading
coronavirus in 24 countries over 88-day period from Jan 31, 2020 to April 27, 2020. This study collected
second data from World Health Organisation (WHO)’s and World Bank’s database, applied Co-integration
test and Causality test for a panel data set.
The research provides crucial finding: there is causality between new cases of spreading coronavirus and
time to close school too late. Moreover, Asian region, where the studied countries are being increases, new
case of spreading coronavirus decrease. Furthermore, classification of income of the research countries is
statistically insignificant to new case equivalent to absent association between the changes in the new case
of spreading coronavirus and classification of income of the research countries.
The spreading COVID – 19 can happen everywhere from high income, middle income to low-income
countries. Another finding is that late closing school will enhance spreading COVID – 19 goes more than
one thousand cases.
New Case – Income with outlier New Case – Income without outlier
Statistic P-value Statistic P-value
Variance ratio 1.51 0.07* 3.21 0.00***
Before running the causality test we check the considered variables, as shown in Table 4. The study
outlier and get the results for exception of outlier during conducts OLS and Gini regression with and without
running regression for the lest bias later. outlier to check robust of the model and get the results
as seen as below.
Having examined the long-run equilibrium
relationship, we turn to the causality test among all
Gini with outlier OLS with outlier Gini without outlier OLS without outlier
Variables
Coef Std. Err z P>z Coef Std. Err t P>|t| Coef Std. Err z P>z Coef Std. Err t P>|t
1984.51 13.14 2552.05 18.29 1051.29 20.48 1252.34 25.29
TCSCH
(151.02) (0.00***) (139.55) (0.00***) (51.33) (0.00***) (49.53) (0.00***)
371.53 2.06 332.34 0.32 215.20 3.54 203.10 0.62
Income
(180.53) (0.04**) (1048.08) (0.75) (60.78) (0.00***) (329.33) (0.54)
–1834.38 –10.07 –1933.04 –10.07 –803.95 –13.00 –834.75 –2.53
REG
(182.13) (0.00***) (1048.32) (0.07*) (61.85) (0.00***) (329.55) (0.01***)
805.68 3.89 589.42 0.51 353.70 5.06 273.57 0.75
Constant
(207.33) (0.00***) (1159.49) (0.61) (69.86) (0.00***) (364.43) (0.45)
No. Obs. 2112 2112 2073 2073
R2/GR 0.80 0.13 0.75 0.24
Gamma YYhat 0.73 0.76
Gamma YhatY 0.58 0.57
MSE 3429.3 1151.9
338.69 647.07
Wald chi2
(0.00***) (0.00***)
Table 4 notes that both Gini and OLS regression with also provides evidence of the positive effect of INCOME
and without outlier points to the existence of direct effects on the NEWCASE. This means the INCOME causes a
on the new case of spreading coronavirus associated with new case of spreading coronavirus, the COVID – 19 has
time to close school too late. However, Gini regression a positive link with the high-income countries. Besides,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 455
their negative causality between REG and NEWCASE. Conflict of Interest: We hereby confirm that the
The difference of region except ASIA will lead to a manuscript has no any actual or potential conflict of
new case of spreading coronavirus. The model of Gini interest with any parties, including any financial, personal
without outlier provides the better robust than OLS or other relationships with other people or organizations
and Gini with outlier11.All P-value and coefficients are within three years of beginning the submitted work. Our
statistically significant at 1% level except for INCOME paper has not been published previously, it is not under
variable. A positive coefficient of TCSCH indicates that consideration for publication elsewhere.
the time to close school too late increases one day, the
new case of spreading coronavirus goes up more than one Ethical Clearance: Taken research from secondary
thousand cases. Moreover, a negative coefficient of REG data through World Bank and WHO’s database following
suggests that Asian region where the studied country are the COPE’s ethical committee.
being increases, the new case of spreading corona virus
decrease around eight hundred cases daily in Asia. This
References
means the COVID – 19 pandemic is different across 1. World Health Organization (WHO): Novel
countries and social distance. Furthermore, INCOME Coronavirus Situation Report - 1 21 January 2020;
is statistically insignificant to NEWCASE which means 1–7.
that there is no association between the changes in the 2. Wilder-Smith, A., Chiew, C. J., & Lee, V. J: Can
new case of spreading coronavirus and classification of we contain the COVID-19 outbreak with the same
income of the research countries. Actually, the spreading measures as for SARS? 2020;102–107.
COVID–19 can happen everywhere especially high
3. Meyers, L. A., Pourbohloul, B., Newman, M. E.
income countries such as Italy, USA, Singapore or
J., Skowronski, D. M., & Brunham, R. C: Network
even low-income country such as Nepal. The result also
theory and SARS: Predicting outbreak diversity.
supports and confirms the previous findings.6,7
2005;71–81.
Discussion 4. Gatrell, A. C: Complexity theory and geographies
of health: A critical assessment. 2005;2661–2671.
The pandemic COVID–19 virus outbreaks recently
5. Ruan, S., Wang, W., & Levin, S. A: The effect of
need to be discussed urgently for its effect on every
global travel on the spread of SARS. 2006;205–
society and economy globally. Applying both co-
218.
integration test and causality test, the research result
indicates that there is a bi-directional causality between 6. Glass, R. J., Glass, L. M., Beyeler, W. E., & Min, H.
new cases of spreading coronavirus and time to close J: Targeted social distancing design for pandemic
the schools too late as well as region where the studied influenza. 2006;1671–1681.
country are being. Close schools are important factor 7. Gumel, A. B., Ruan, S., Day, T., Watmough, J.,
to avoid infection and protect the young generation. Brauer, F., Van Den Driessche, P., … Sahai, B.
Furthermore, with the studied countries, located in M: Modelling strategies for controlling SARS
Asian region, the new cases of COVID – 19 can be outbreaks. 2004;2223–2232.
easily down to around eight hundred cases daily. Next, 8. Tan, J., Mu, L., Huang, J., Yu, S., Chen, B., &
the classification of income of the research countries Yin, J: An initial investigation of the association
is statistically insignificant tonew case of spreading between the SARS outbreak and weather: With
coronavirus. Actually, from January 31, 2020 to April the view of the environmental temperature and its
27, 2020, the coronavirus has been spreading in global variation. 2005;186–192.
scale and in all classification of economics from high
9. Levin, A., C.-F. Lin, and C.-S. J. Chu: Unit root
income to middle and low–income countries. Therefore,
tests in panel data: Asymptotic and finite-sample
all governments should take highly consideration in
properties. 2002;108, 1-24.
social isolation in preventing the COVID – 19 in the
absence of vaccine or antiviral medicine. 10. Westerlund, J., & Edgerton, D. L: Simple tests
for cointegration in panels with structural breaks.
Source of Funding: The researchers do not get any 2008;665–704.
research funding. 11. Ka, N., & Mussard, S: ℓ1 regressions: Gini
estimators for fixed effects panel data. 2016;1436–
1446.
456 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2352
Assistant Lecturer, Ms.C. Prosthodontics, College of Dentistry, Alfarahidi University, Baghdad, Iraq
Abstract
Objective: This study examined patients’ complain regarding pain on eating, esthetic and speech problems
and gag reflex with various types of removable partial dentures (RPDs).
Method: The study sample included 60 RPD wearers (36 females and 24 males) aged between (25-60)
years old. Sex, age, occupation, any experience with previous RPDs, and the complaint with RPDs were
recorded. Data were analyzed using Chi-square test was applied for comparison among different variables
of oral complaints related to removable prosthesis; an independent a sample t-test was utilized. A P-value <
0.01 was the criterion for rejection of the invalid hypothesis.
Results: the results show 60 patients, 16 (47.05%) were satisfied on acrylic and14 (77.77%) were satisfied
on flexible. And 6 (75%) were satisfied on metallic. The mean level of satisfaction among the three types
of RPDs was significantly different (P < 0.01). In cases satisfaction between flexible and acrylic RPDs
was significantly different. But, between either metal or acrylic, or metal and flexible RPDs no significant
differences (P < 0.01) were recognized.
Conclusions: Within the limitations of this study, approximately half of cases that tooka removable partial
dentures treatment were satisfied with it, showing that the quality of RPDs(in Iraq/Baghdad city) was
suitable for patients. Pain in eatingis the most common complaint that shows that dental treatments with
RPDs should be provided with care when patients have pain in eating.
Keywords: Patient satisfaction, Removable partial denture, oral complaint, Aesthetics, Dental prosthesis.
Statistical Analysis: The resulting data were from all patients. The mean ± SD age of the cases was
entered into a statistical software program (Statistical 49.8 ± 8.3 years for wore acrylic, 47.8 ± 8.9 years for
Package for the Social Sciences, version 16.0; SPSS), wore flexible and 47.2 ± 7.7 years for wore metallic
which was used for all the statistical analyses. Mean ± (range: 25–60 years) as shown in Table 1.
standard deviation (SD) counts and percentages are used
for recording variables. Chi-square test was applied for In table 2 Shows, the symptoms were: 23(38%)
comparison among different variables of oral complaints pain in eating,6(10%) esthetic problems, 16(26.66%)
related to removable prosthesis; a sample t-test was problems in speech, and 10(16.66%) gag reflex where
utilized. A P-value < 0.01 was the criterion for rejection 5(8.33) only had no complaint.
of the invalid hypothesis. Data were collected from cases Table 3 shows 60 patients, 16(47.05%) were
electronic files into a Microsoft Excel 2010. satisfied on acrylic and 14 (77.77%) were satisfied on
flexible. And 6 (75%) were satisfied on metallic.
Results
For the 260 patients who wear RPD from the three The mean level of satisfaction among the three
places from January 2018 to January 2019. Sixty cases types of RPDs was significantly different (P < 0.01).
(24 male and 36 female cases) participated in this survey In cases satisfaction between flexible and acrylic RPDs
with three types of RPDs. 34(56.66%) wore acrylic was significantly different. But,between either metal
RPDs, 18 (30%) had flexible RPDs, and 8 (13.33%) or acrylic, or metal and flexible RPDs no significant
wore metallic RPDs; variable information was obtained differences (P < 0.01) were recognized.
Gender
Type of RPD No. of Patients Age (Mean±SD)
Female Male
Acrylic 34 19 13 49.8 ± 8.3
Flexible 18 12 8 47.8 ± 8.9
Metal 8 5 5 47.2 ± 7.7
Total 60 36 24 -
Medico-legal Update, January-March 2021, Vol. 21, No. 1 459
Table 2 Patient’s symptoms and complaint
Symptoms
Type of RPD
Pain on eating Esthetic problems Speech problems Gag reflex No complaint
Acrylic 14 (41%) 3 (9%) 10 (30%) 7 (20%) 0
Flexible 8 (44%) 3 (17%) 5 (28%) 2 (11%) 0
Metal 1 (12.5%) 0 1 (12.5%) 1 (12.5%) 5 (62.5%)
Total 23 6 16 10 5
P values
Type of RPD No. of patients satisfied
Flexible Metal
Acrylic 16/34 0.03 0.15
Flexible 14/18 - 0.87
Metal 6/8 - -
*
P value < 0.01.
Abstract
The paper proposes deep learning algorithm used to classify the oral images into either normal or abnormal
images. The cancer regions are segmented using morphological operations. The segmented cancer regions
are further diagnosed into ‘Mild’ or ‘Severe’ using deep learning algorithm. The main advantage of the deep
learning algorithm is that it requires minimum number of oral images for both classification and diagnosis
stages of the proposed work. In this paper, the total number of cancers affected oral images used is about
160 and the proposed oral cancer detection system using CNN classification approach classifies 159 cancer
affected oral images correctly and achieves 99.3% of detection rate.
Keywords: Deep learning, cancer, oral images, detection system, detection rate.
Introduction for early diagnosis and treatment. Oral cancer rates are
rising in several countries dramatically. The mortality
The term cancer, means “crab” in Latin, was coined
rate due to oral cancer worldwide is 30% and 12% in male
by Hippocrates in the fifth century to describe a family
and female respectively. Tobacco smoking and chewing
of diseases. The tissues grow and spread unrestrained
are considered as the major predisposing factors for the
throughout the body, eventually choking of life. Cancer,
development of oral cancer. All forms of tobacco habits
in simple terms, is the disease caused by malfunctioning
are significantly associated with the development of oral
of cells, lost their control on proliferation. The cluster of
cancer. Smokeless Tobacco (SLT) has been accepted as
cells, called a tumor or a neoplasm, constantly expands
one of the strongest risk factors for the development of
in size. Occasionally, cells might spread throughout
oral carcinoma.
the body, forming new tumors at distant sites, and the
process of dissemination is called metastasis. Cancer, a In this paper, deep learning algorithm such as
multifactorial disorder, arises due to the defect in genetic Convolutional Neural Networks (CNN) is used to classify
makeup and exposure to environmental insult. Oral the oral images into either normal or abnormal images.
cancer, a life-threatening cancer worldwide, arises in The cancer regions are segmented using morphological
the oral cavity due to ill-habits such as tobacco smoking operations. The segmented cancer regions are further
and chewing. Cancer might occur anywhere in the body diagnosed into ‘Mild’ or ‘Severe’ using deep learning
and a common strategy is to name them based on the algorithm.
organ or the type of cell they originate; the net result is
more than 100 types of cancer. Among them, oral cancer Literature Survey: A hybrid method was used by
is one of the most common malignancies present in the combining Fuzzy C-Means and neutrosophic algorithm
head and neck region. for segmentation of tumors in the oral panoramic image
proposed by Alsmadi (2016)4. It used speckle reduction
Oral cancer, a malignant neoplasm of the mouth, is by 3 × 3 size median filter to reduce the speckle noise,
the fifth most frequent cancer in occurrence and eighth using neutrosophy algorithm. This approach provided
most common cause of cancer related deaths worldwide. a significant improvement in segmenting oral lesions.
The burden of oral cancer, worldwide, is drastically The accuracy comes from the use of indeterminacy
increasing despite of the advanced procedures available degree to cluster the region and determination of the
Medico-legal Update, January-March 2021, Vol. 21, No. 1 463
tumor. However, as this study was based on cluster carcinoma of different areas of oral cavity. They
calculation and image boundary location, shadow proposed the use of textural and run-length features of
areas on the panoramic image will be a concern in camera images. Hobdell et al. (2003)1 investigated the
terms of false detection. A study utilized variants of relationship between socioeconomic status variables and
Support Vector Machine (SVM), such as Linear SVM, oral health in an attempt to determine the association
Quadratic SVM and Cubic SVM, were used to classify between social, economic and behavioral risk factors
tumors on optical coherence tomography images. They and the incidence of oral cancer among other oral health
compared the sensitivity, specificity and accuracy in concerns. Their results described a marked gradient
six different classification conditions (Banerjee et al. in oral diseases between the most highly and the least
2016)5. Tanupriya Choudhury et al. (2016)6 proposed socio-economically developed countries and there was
the Intelligent Classification of Lung and Oral Cancer an apparent association between oral cancer and the
through diverse data mining algorithms. Logistic socioeconomic status variables.
regression was a powerful tool modeling and also used
for generalization of the linear regression. The optimal Proposed Methodology: In this paper, deep
quantity of the Logic Boost iterations was performed learning algorithm is used to classify the oral images into
and cross validated, taken to the selection of the attribute either normal or abnormal images. The cancer regions
was automatic. Yi-Ying Wang et al. (2016)7presented a are then segmented using morphological operations.
new color-based approach for automated segmentation The segmented cancer regions are further diagnosed
and classification of tumor tissues from microscopic into ‘Mild’ or ‘Severe’ using deep learning algorithm.
images. The procedure consists of a three-stage Color- The main advantage of this deep learning algorithm is
Based Feature Extraction (CBFE) system. It normalized that it requires minimum number of oral images for both
all the acquired images to the same color distribution by classification and diagnosis stages of the proposed work.
color transformation. Computerized selection of training Figure 1 shows the proposed oral cancer classification
samples was used for Automatic feature extraction. and diagnosis system using Convolutional Neural
A similar study was made by Chang et al. (2016)8 Network (CNN) classification approach.
using hybrid feature extraction and machine learning Enhancement: In this paper, adaptive local
classification algorithm with biomarkers. They proposed histogram equalization framework is applied on the low-
and tested five tumor classification method. The method, resolution oral MRI image for improving the intensity
Adaptive Neuro Fuzzy Inference System (ANFIS), level of each pixel in the source image. In this section,
achieved the highest classification rate of 93.81% by the following steps are used to detect and remove the
combining the clinical pathologic dataset and biopsy noisy pixels in oral MRI images.
images. This study considered patient’s case as a whole.
However, if the clinic pathologic dataset or images were Step 1: The source oral MRI image is divided into
considered as a separate sample, the result might not be n*n non–overlapping sub blocks, where, n is the odd
achieved over 90% accuracy rate. In other words, the number value.
accuracy of the method rely on the patient’s information.
Step 2: In each n*n non–overlapping sub blocks,
An automated oral lesion detection method was place the pixels in horizontal, vertical and two diagonal
studied by Galib et al. (2015)2. They discussed two direction into P1, P2, P3 and P4 sets, respectively.
systems to discover the two types of common lesions
in the oral cavity. It achieved 92% sensitivity with 32% Step 3: Make order of pixels in P1, P2, P3 and P4
of false positives on average in close border lesions and sets and eliminate the lower and higher order pixel from
85% sensitivity with no false positives in open border each set.
lesions. Moreover, it had also discussed the possibility Step 4: Find standard deviation of each pixel set and
of improvement in open border lesion algorithm to find similarity index of each pixel.
100% sensitivity with only 13% of false positives.
Belvin Thomas et al. (2013)3 proposed Texture Analysis Step 5: Consider the sub pixel set which has low
Based Segmentation and Classification of Oral Cancer value of standard deviation.
Lesions in Color Images using ANN. The objective was
Step 6: Apply adaptive mean filter in the final sub
to select a reduced set of features that clearly distinguish
pixel set in order to remove the noisy content.
between different groups of malignancy caused by
464 Medico-legal Update, January-March 2021, Vol. 21, No. 1
(a)
(b)
Figure 1 Proposed oral cancer classification and diagnosis system using CNN classification approach
(a) Classification method (b) Diagnosis method
The CNN architecture includes Convolutional weights and parameters. In general, each feature map
layers, pooling layers, and fully connected layers. The of the input is pooled in the same way and the number
Convolutional layer consists of a number of convolution of features of the original input remains unchanged.
kernels, which is a two-dimensional matrix of weights Then, the fully connected layer is used to map the
W. The convolution kernel convolves an input image feature representations from the Convolutional layer to
(also a two-dimensional matrix) in the form of a sliding the sample space in order for classification, composed
window with a matrix called feature map is obtained. of a group of neurons and connections with weighted
Each Convolutional layer has Convolutional kernel itself values. Since the number of the parameters of the fully
and it is convolved with the oral image. The pooling connected layers is very large, some networks use the
layer is also called the sampling layer, uses the sliding Convolutional neural networks to take place in the fully
window to convolve the input or the feature map so that connected layers. The proposed CNN method for oral
it might reduce the feature dimension and the amount cancer image detection and classification is depicted in
of calculation. Polling layer has two different types as the following algorithm.
“Average” and “maximum” pooling. Different from
the Convolutional layer, the pooled layer (maximum Input: Oral image;
pooling is adopted in this paper) does not depend on Output: Classification response;
466 Medico-legal Update, January-March 2021, Vol. 21, No. 1
are used to segment the cancer regions in classified oral Specificity 99.1
images. The morphological parameters such as area, Accuracy 99.7
width and height are computed for its diagnostic process.
The segmented oral cancer regions are analyzed for the Table 2 shows the analysis of data augmentation
mild and severity of the cancerous regions using CNN method in CNN architecture on proposed oral cancer
classification. detection and segmentation.
Table 4 shows the comparisons of proposed oral diagnosis method using CNN classification method
cancer diagnosis system with other method. The total classified 100 mild images as mild case category and the
number of mild case oral images used in this work is 100 proposed method classified 150 severe case images as
and the total number of severe case oral images used in severe case category (99.3%).
this work is 150 as illustrated in Table 4. This proposed
Table 4 Comparisons of proposed oral cancer diagnosis system with other method
Conclusions References
This paper develops a methodology using deep 1. Hobdell MH, Oliveria ER, Bautista R, Myburgh NG,
learning algorithm to classify the oral images into Lalloo R, et al. “Oral diseases and socio-economic
either normal or abnormal images. The cancer regions status (SES)”. Br Dent J.(2003);194(2):91-96.
are segmented using morphological operations. The 2. Galib, S., F. Islam, M. Abir & H.K. Lee. “Computer
segmented cancer regions are further diagnosed into aided detection of oral lesions on CT images,”
‘Mild’ or ‘Severe’ using deep learning algorithm. The Journal of Instrumentation, (2015);10(12).
main advantage of this deep learning algorithm is that
3. Belvin Thomas, Vinod Kumar, Sunil Saini. “Texture
it requires minimum number of oral images for both
Analysis Based Segmentation and Classification of
classification and diagnosis stages of the proposed work.
Oral Cancer Lesions in Color Images Using ANN,
In this paper, the total number of cancers affected oral
IEEE International Conference on Signal Processing
images used is about 160 and the proposed oral cancer
Computing and Control (ISPCC),(2013): 1-5.
detection system using CNN classification approach
correctly classifies 159 cancer affected oral images 4. Alsmadi, M.K.“A hybrid Fuzzy C-Means and
correctly and achieves 99.6% of detection rate. Neutrosophic for jaw lesions segmentation,” [Press
release], Retrieved from https://doi.org/10.1016/j.
Conflict of Interest: Nil asej.2016.03.016.(2016).
5. Banerjee, S., Chatterjee, S., Anura, A., Chakrabarty,
Ethical Clearance: Nil
J., Pal, M., Ghosh, B., Chatterjee, J. “Global
Source of Funding: Nil spectral and local molecular connects for optical
coherence tomography features to classify oral
468 Medico-legal Update, January-March 2021, Vol. 21, No. 1
lesions towards unravelling quantitative imaging 7. Yi-Ying Wang, Shao-Chien Chang, Li-Wha Wu,
biomarkers,” RSC Advances. (2016); 6(9):7511- SenTien Tsai and Yung-Nien Sun. “A Color-Based
7520. Approach for Automated Segmentation in Tumor
6. Tanupriya Choudhury, Vivek Kumar, Darshika Tissue Classification”, Conference of the IEEE
Nigam, Bhaskar Mandal. “Intelligent Classification EMBS CitéInternationale, Lyon, France. (2016).
of Lung Oral Cancer through diverse data mining 8. Chang, S.W., Abdul-Kareem, S., Merican, A.F.,
algorithms”, International Conference on Micro- Zain, R.B. “Oral cancer prognosis based on
Electronics and Telecommunication Engineering. clinicopathologic and genomic markers using a
(2016). hybrid of feature selection and machine learning
method,” BMC Bioinformatics,(2016); 14(1).
DOI Number: 10.37506/mlu.v21i1.2354 Medico-legal Update, January-March 2021, Vol. 21, No. 1 469
Mahanta Putul1, Lahkar Babita2, Borah Pollov3, Das D.K.4, Choudhury Manoj Kumar5
1
Professor, Forensic Medicine and Toxicology, Assam, India, 2Associate Professor of Anesthesiology FAA Medical
College, Barpeta, Assam, India, 3Associate Professor of Anesthesiology Jorhat Medical College and Hospital,
Jorhat, Assam, India, 4Professor of Microbiology Diphu Medical College, Diphu, Assam, 5Additional Director of
Medical Education and Executive Director of National Health Mission Assam
Abstract
Introduction: The emerging technologies made by day changing the techniques of teaching medical
education. The teaching technique has changed since the last decade from the old traditional technique
of chalk and talk (CNT) to a newer technique of Power-point presentation (PPT) to the video classrooms
converting the whole traditional environment of the classrooms. This paper aims to access the perception of
the medical students about these two instructional method.
Materials and Method: In this study cross-sectional descriptive survey was used. Medical students were
selected through non-probability convenient sampling. The data were collected using a questionnaire-based
survey about their views and perception of two method of lecture delivery, viz., PPT presentation, and using
a chalkboard. For each of the two method, the students were asked to rank twelve comments on a four-point
scale: strongly agree, agree, disagree, or strongly disagree. The data was analyzed using SPSS version 16
and the results expressed as proportions.
Results: In our study where more than 97% of our study respondents emphasized the value of chalk and
talk and declared it as the more effective and useful teaching tool in their learning experience compared to
PowerPoint (86%) and recommended it for teaching.
Conclusion: Both CNT, as well as PPT, are the effective method for medical education and both can be used
in combination for the effective delivery of classroom sessions.
Table 1 Distribution of perception of UG medical students regarding the method of chalk and talk
Strongly Strongly
Agree Disagree
Sl.No. Statements regarding perception Agree disagree
% % % %
1. I understand the lecture better when the teacher uses this technique 26 71 2 1
2. I feel the student interaction is better with the teacher 33 53 12 2
3. Eye contact between teacher and student is less 14 41 36 9
4. The lecture advances the understanding 20 67 12 1
5. This technique helps me to concentrate and remember better 38 50 10 2
6. The quality and quantity of my lecture notes can’t be maintained 12 48 30 10
7. The delivery of lecture is interesting 26 51 20 3
8. The content of the lecture informative 19 68 11 2
9. The lecture is audible 28 65 7 0
Medico-legal Update, January-March 2021, Vol. 21, No. 1 471
Strongly Strongly
Agree Disagree
Sl.No. Statements regarding perception Agree disagree
% % % %
10. The lecture content was well organized 30 47 20 3
11. The teacher remains more professional 25 59 15 1
12. The teacher needs more preparation for the class 30 50 18 2
The distribution of perception among the undergraduate medical student regarding PPT as a method of teaching
is narrated in Table 2.
Strongly Strongly
Agree Disagree
Sl.No. Statements regarding perception Agree disagree
% % % %
1. I understand the lecture better when the teacher uses this technique 30 56 12 2
2. I feel the student interaction is better with the teacher 29 45 24 2
3. Eye contact between teacher and student is less 14 47 34 5
4. The lecture advances the understanding 19 65 16 0
5. This technique helps me to concentrate and remember better 30 46 21 3
6. The quality and quantity of my lecture notes can’t be maintained 12 48 37 3
7. The delivery of lecture is interesting 20 58 22 0
8. The content of the lecture informative 20 71 7 2
9. The lecture is audible 24 64 12 0
10. The lecture content was well organized 35 50 10 5
11. The teacher remains more professional 27 52 20 1
12. The teacher needs more preparation for the class 31 42 23 4
In the present study, 97% of the participants An evaluation by the students can provide the
emphasized the value of chalk and talk and declared it teacher with the best user feedback regarding the best
as the more effective and useful teaching tool in their teaching method.
learning experience as compared to PowerPoint (86%)
and recommended it for teaching. In the present study, medical students favoured a
combination of teaching aids rather than single teaching
Discussion support. Regarding the preference of medical students,
the order of priority of combined teaching aids they have
Teaching is an art. This study highlights the fact that opted was PPT+CNT using blackboard.
the favourite stechnique of lecture delivery for students
by different faculties in the classroom can vary so much This preference may probably be because the inherent
within the same college. deficiency of each method is compensated by the other.
While CNT using blackboard teaching is deficient in
Different technologies are available in classrooms showing the three dimensional (3-D) diagrams, animated
for teaching in the present day scenario. The use of better videos and real-time sounds. However, the same can be
teaching technique aid allows students to understand demonstrated using a PPT. Furthermore, PPTs take less
better. This also allows more time for interaction and time to present the same information as compared to
further understanding. Use of technology can be a very CNT using blackboard teaching. CNT teaching allows
beneficial and time-saving tool for all teachers. the students to take down the notes and diagrams which
472 Medico-legal Update, January-March 2021, Vol. 21, No. 1
is difficult with PPTs as there is a tendency to deliver the References
lecture fast.13
1. Brown G, Atkins M. Effective teaching in higher
The current results agree with Chaudhary R et education. London, UK: Routledge; 1988. [cited
al.14 Here the author revealed that the majority of the 2017 March 13]; Available from: URL:http://www.
students (67.1%) favoured the combined teaching aids. itl.usyd.edu/supervision.org/
With the CNT using blackboard, the student pointed the 2. Cannon R. Lecturing, Kensington, NSW: Higher
drawback, is that it takes time to draw a labelled diagram education research and development society of
on the board and during that time teacher’s eye contact Australia; 1988. [cited 2017 March 13]; Available
with the students get interrupted. from: URL:http://www.rsc.org/
SN Baxi et al.,15in their study, revealed that an equal 3. Hithesh Mishra, Vipin Kumar, Pankaj Kumar.
number of students preferred CNT and multimedia-based Comparison of different teaching methodologies
lectures. Seth et al.,16 also compared the preference for in a medical college in North India. IJBAMR 2013
teaching aid between medical students versus dental March;6(2):464-469.
students. The medical students have preferred PPT 4. Sahu DR, Supe AN. The art and science of
whereas the dental students preferred the Chalkboard in presentation: 35-mm slides. J Postgrad Med
their study. 2000;46:280–285.
5. Estes A, Ressler S, Welch R, Hanus J. Seminar on
Some participating students opined that the
communication skills. Exceed teaching workshop
effectiveness of the teaching lecture depends upon the
2009. [cited 2017 March 13]; Available from:
teacher, regardless of the teaching aid used. What is
URL:http://www.asce.org/
fundamentally important in university teaching is not the
quality of the technology but the quality of the teacher as 6. Yoa, J. E., Ouyang, J. R., and Wang, H. A farewell to
revealed in a stduy17 agree the current results. Besides, a the traditional instructional media and technologies
good teacher knows to start at a basic point of the course, in the new millennium. 2000, [cited 2017 March
which students can understand and then lead them 13]; Available from: URL:http://www.unfi.edu/
gradually through the new and more difficult points.18 7. Prasad S, Roy B, Smith M. The art and science of
presentation: Electronic presentations. J Postgrad
Conclusion Med 2000;46:193–198.
In conclusion, combined teaching support is 8. Pedras, MJ, Horton, J. Using technology to
considered as most satisfying teaching support because enhance teacher preparation. Paper presented at
the inherent deficiency of one aid is compensated by the the annual meeting of the Northwest Association
other. If single teaching assistancesis to consider then of Teacher Educators 2009. [cited 2017 March 13];
the blackboard teaching aid is the most pleased by the 1996. Available from: URL:http://www.apbr.edu/
undergraduate medical students as they can follow the SRATE
teacher well with a deep understanding of the concept 9. Ljungdahl RT. Technology integration in the
effectively. teacher preparation program and public schools in
samhouston center for professional development
The present study, as well as the previous studies, and educational partnerships at samhouston state
does not bring out the superiority of any single support university. Dissertation Abstracts International
system of the teaching method. It seems that with the 61(8):3133.
hands of a trained teacher any teaching technique would
10. Does PowerPoint make you stupid? [cited 2017
be suitable and effective. This highlights the need
March 13]; Available from: URL:http://www.
for formal training of the teachers in teaching in the
sociable-media.com/PDF/
classroom to develop a perfect skill to motivate students.
11. Novelli ELB, Fernandes AAH. Student’s
Source of Funding: None declared. preferred teaching techniques for biochemistry in
biomedicine and medicine courses. Biochem Mol
Conflict of Interest: None declared. Biol Educ 2007;35:263–266.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 473
12. Prasad S, Roy B, Smith M. The art and science of 16. Vikas S, Prerna U, Mushtaq A, Vijay M. PowerPoint
presentation: electronic presentations. J Postgrad or chalk and talk: perceptions of medical students
Med 2000;46:193–198. versus dental students in a medical college in
13. Vikas Seth, Prerna Upadhyaya, Mushtaq Ahmad, India. Advances in Medical Education and Practice
Virendra Kumar. Impact of various lecture 2012;1:11-16.
delivery method in pharmacology. EXCLI Journal 17. Ahmed C. PowerPoint versus traditional
2010;9:96-101. overheads. Which is more effective for learning?
14. Chaudry R, Dullo P, Gupta U. 2009. Attitude of 1st Paper presented at conference for the South Dakota
MBBS medical students about two different visual Association for Health, Physical Education and
aids in physiology lectures. Pak Journal Physiology Recreation; 1998.
2005;5(2):94-96. 18. Shallcross DE, Harrison TG. Lectures: electronic
15. SN Baxi, CJ Shah, RD Parmar, Parmar, CB presentations versus chalk and talk – a chemist’s
Tripathi. Student’s perception of different teaching view. Chem Educ Res Pract 2007;8:73–79.
aids in a medical college. AJHPE 2009;1(1):15-16.
474 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2355
Abstract
Twenty-five samples of urine were collected from patients suffering Urinary Tract Infection (UTI) from
hospital in Baghdad,twenty-two bacterial isolated (88%) were identified. From our result showed the E. coli
number 5 is the best bacterial virulence factor for producing OMV, Tumor cells (1x104 – 1x106 cells/ml)
have been grown in 96 flat well micro-title plates, with a final volume of 200 cells per well. The microplate
was gently shackled and covered by sterilized parafilm then incubation of the plates at 37C°, 5 % CO2 for
24hrs. Two folded serial dilutions of the desired compound (12.5, 25, 50, 100, 200, 400µ g/mL) were added
to the wells after incubation. Triplicates were used per each concentration as well as controls (serum-free
medium treated cells). Plates were incubated for specified exposure time (24 hours) at 37C°, 5 percent
CO2. Applied 10µ liters of MTT solution to each well after exposure. The absorbance was determined by
a wavelength of 575 nm using an ELISA reader. Statistical analysis was performed on the optical density
data to calculate the compound concentration required to cause a 50 percent reduction in cell viability for
each cell line. The rate of cell growth inhibition (the cytotoxicity percentage) was calculated and plot of
% cytotoxicity against sample concentrations assisted to calculate the concentration which exhibited 50%
cytotoxicity (IC50). Calculate: cell number: determine cells per milliliter.
Keywords: Cytotoxic Activity; E. coli; outer Membrane Vesicles (OMVs); breast cancer (MCF-7).
Introduction and also strengthens their contact with the host. OMVs
were recognized for their role in nutrient procurement,
Outer membranes vesicles (OMVs) can to transfer
stress reactions and toxin transmission, adherence to
biological molecules to host cells and their development
and virulence factors in avoiding host defense systems
among gram-negative bacteria is intended. Apart from
among the prominent roles in various pathological and
their role in the communication of bacteria, virulence
physiological (2,3).
factors are transferred to the host for cargoes to OMVs
to boost bacterial survival(1). Cancer is an uncontrolled cellular development
and spreading disease, where cells do not respond to
Outer membranes vesicles have properties which
the normal controls and cause the tumor to grow and to
permit the transmission of DNA fragments, autolysins,
metastasize(4). However, chemotherapy does not target
cytotoxins, virulence factors, and various other
drugs directly in cancer sites, which ensures that healthy
biomolecules to be mediated by them and their secretion
cells are susceptible to adverse reactions. Also because
allows bacteria to interact with and within the species
of its fast removal and nonspecific distribution, a large
dose is needed(5). The goal of nanomedicine is to identify
cost-effective molecules with high cell specificities and
Corresponding Author: susceptibility(6).
Mahmood Abed Hamzah
Cancers’ immunotherapy may be categorized as
PhD Student, Department of Biology, College of
immunothérapic therapies with the goal of utilizing
Science, Al-Mustansiriyah University, Iraq
innate or adaptive immunity in oncology(7).
e-mail: [email protected]
Medico-legal Update, January-March 2021, Vol. 21, No. 1 475
Nevertheless, the successful treatment and 1. The medium EMEM containing: 10% bovine serum
eradication of cancer tumors have been avoidable due fetal, 1mM pyruvate, 100 units of penicillin, and
to inadequate induction of immune responses using 100μg/ml streptomycin (EPEM full solution), 1X
conventional vaccination approaches, despite the non-essential amino acids. It was used to treat the
tremendous potential of cancer vaccines(8). It highlights following compounds.
the need for new vaccine approaches, in which tumor
2. When 90% confluence was reached at a dilution of
antigens and APC adjuvants are administered effectively
1:4, MCF7 cells were divided. Using several of cells
and with a good enough immune response to kill tumor
at passage = 10.
cells. Over the past three decades, nanoparticles have
been intensively studied as a delivery method of modern 3. Tripsinisation of MCF7 cells, diluting to EMEM,
chemotherapy over firm tumors (9,10). was conducted on a complete medium and cell
density. In complete EMEM, cells have been diluted
Material and Method into 7.5 to 104 cells/ml.
Method for preparation of outer membrane 4. In each 96-well-microplate well the cell suspension
vesicles (OMV): Overnight on lysogeny broth, bacterial (100 μl) has been added to achieve 7.500cells/well
cells were cultivated with shaking at 37 °C (150rp.m.) (7.500cells/well- recommended planting density).
until the OD600 reached 1.5 (1 percent tryptone, 0 percent 5. Overnight the cells have been incubated at 37 °C
yeast extract, 1 percent NaCl, 7.0 pH). At 5000rpm twice with 5 % CO2.
for 20min, at 4°C, the cultivated cells were pelleted.
The supernatant was filtered with a 0.4 5 μm pore filter Cell Line Maintenance(11).
and then applied supernatant to cold absolute ethanol
The following protocol was performed when the
at 4oC (twice the volume of supernatant), which lasted
cells in the vessel formed confluent monolayer:
24 hours. This resulted in rough precipitation isolation.
The precipitation was dissolved in deionized water and The cell sheet was washed with PBS.
dialysed using a 14000D tubular dialyzis membrane
for 24-48 hours with Spectra/Por molecular pore.At A. The growth medium was drained.
15000rpm twice for 20min, at 4°C, the precept cells B. The cell has been given two to three ml of tetraacetic
were pelleted by using high speed centrifuge. A filter ethylene diamine (EDTA) solution. The ship
with a pore size of 0,22μm and the OMV pellet were was transformed into a soft rocking cover for the
filtered again into water and held at −80 °C for further monolayer. The vessel allowed incubation of the
experiments. cells at 37 °C for between 1 to 2 minutes.
Gel chromatography purification: The Pharmacia C. The cells were dispersed from the wedding surface
Fine Chemicals Company has prepared Sephadex G-200 into the pipetting medium for production. This
as recommended. A quantity of Sephadex G-200 has medium was applied to the Fresh RPMI medium
been suspended, degassed, and wrapped in 0.1 M Tris- (15-20 mL).
HCl buffer pH8 (1.5x80 cm), the gel has been preserved
Incubated at 37 °C and distributed in 5% of the
for 72 hours. Then balanced with the same buffer at room
CO2 incubator D- cells were redistributed in cultivated
temperatures for swelling. Elution was done at a flow
vessels, flasks or plates whatever is required.
rate of 30 ml/hr and the same control buffer was used.
At 280 nm, absorbance was measured for each fraction. By using the hemocytometer and using the formula,
cell concentration was determined by counting the cells:
In-vitro cell line design: From the National Center
for Cell Sciences (NCCS) Pune, breast cancer MCF-7 Total Cell Count/ml: Cell count x dilution factor
cell lines were obtained. The cells were maintained in (sample volume) x 104
a humidified atmosphere of 50 lg/ml CO2 at 37 LC in
Limited Essential Media supplemented with 10 percent MTT Protocol: The cytotoxic effect of different
FBS, penicillin (100 U/ml), and streptomycin (100 lg/ compounds isolated from Ag Nanoparticles, OMVs,
ml). and combination of OMVs and Ag Nanoparticles was
performed using MTT ready to use the kit.Tumor cells
Cell Preparation: (1x104 – 1x106 cells/ml) have been grown in 96 flat well
476 Medico-legal Update, January-March 2021, Vol. 21, No. 1
micro-title plates, with a final volume of 200 cells per A plot of % cytotoxicity against sample
well. The microplate was gently shackled and covered concentrations assisted to calculate the concentration
by sterilized parafilm. Incubation of the plates at 37C°, 5 which exhibited 50% cytotoxicity (IC50).
% CO2 for 24hrs. then two folded serial dilutions of the
desired compound (12.5, 25, 50, 100, 200, 400µ g/mL) Calculate cell number: determine cells per milliliter
were added to the wells after incubation. Triplicates were by the following calculation:
used per each concentration as well as controls (serum- Cells/mL = average count each square × dilution
free medium treated cells). Plates were incubated for factor × 104 total cells=Cells/mL × total unique volume
specified exposure time (24 hours) at 37C°, 5 percent of cell suspension from which sample was occupied.
CO2.10µ liters of MTT solution was applied to each well The number 104 is the volume correction factor for the
after exposure. Plates were further incubated for 4 hours hemocytometer: each square is 1× 1 mm also the depth
at 37 °C, 5 % CO2. Carefully removed media and added is 0.1 mm.
100µl of solubilization solution per well for 5 minutes.
The absorbance was determined by a wavelength of Results and Discussion
575 nm using an ELISA reader. Statistical analysis was
performed on the optical density data to calculate the The results of screening the highest and best bacterial
compound concentration required to cause a 50 percent virulence factors isolates for producing OMV showed
reduction in cell viability for each cell line. The rate of that isolate number five 5 is the best for the ability to
cell growth inhibition (the cytotoxicity percentage) was produce OMV Figure (3-6) and (3-7) with an average
calculated as the following equation:- diameter of 61.08 – 103.2 nm.
% Cell viability = (Absorbance of treated cell/ Isolation OMV: The results of screening the
Absorbance of the non-treated cell) x 100. highest and best bacterial virulence factors isolates for
producing OMV showed that isolate number five 5 is the
% Cytotoxicity = 100 – cell viability. best for the ability to produce OMV Figure (1 & 2) with
an average diameter of 61.08 – 103.2 nm.
IC50 (Dose concentration that inhibited cell growth
by 50%)values were calculated by the linear and
logarithmic correlation equation.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 477
Figure (1): SEM shows the ability of isolate no. 5 to produce outer membrane vesicles (OMV)
Figure (2): SEM shows the ability of isolate no. 5 to produce outer membrane vesicles(OMVs) by gel
filtration chromatography method
478 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Kim et al . (2017) have shown both E. coli wild OMV was 45–270 nm from the non-pathogenic strain(13)..
type and mutant bacteria-derived OMVs have nano- Rolhion et al., (2005) showed that the pathogenic strain
dimensional lipid-bilayer vesicular structures, both may produce significantly smaller vesicles than the non-
E.coli of which showed with an average diameter of pathogenic strain(14), they demonstrated that adequate-
38.6±3.6 and 38.7±4.2 nm along with the wild-type E. invasivity Escherichia coli strain LF82 can invade the
coli, OMVs had a higher range of production. OMV cultivated intestinal epithelial cells recovered from
E.coli, giving an extra advantage of OMVs, as naturally chronic injury of a patient with Crohn9s disease. Anand
generated OMVs have low productivity issues(12).. and Chaudhuri., (2016) have shown that both pathogenic
and nonpathogenic bacteria are made of outer membrane
Behrouzi et al., (2018) showed that the extracted vesicles (OMVs) (50-250 nm in diameter) as the
OMV was 20–75 nm from the disease strain, whereas the canonical result of secretion(15)..
Table (1): Percentage of cell viability MCF-7cancer cell line to E.coli Outer Membrane Vesicles (OMV) at
different concentrations
A B
X Title
Row Stats MCF-7 WRL68
X Mean ±SD N Mean ±SD N
1 400.000 44.414±5.048 3 76.196±3.855 3
2 200.000 44.421±9.090 3 85.957±2.609 3
3 100.000 54.553±1.860 3 93.596±2.100 3
4 50.000 59.568±0.821 3 95.332±1.183 3
5 25.000 72.801±0.904 3 95.216±0.821 3
6 12.500 85.687±4.186 3 95.949±1.028 3
Figure (3): Shows Cytotoxic activity of isolate no.5 outer membrane vesicles against Breast cancer (MCF-7)
using MTT test after 24 h. and 37o C.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 479
The IC50 which is the half- maximal inhibitory the endocytic pathway through a receptor. The host
concentration for cell growth constructing adose cell input could also be supplemented by common
response curve was measured. outer membrane vesicles components of vesicles, such as outer membrane protein
showed IC50 16.5 ϻg/ml compared with WRL68 A (OmpA), this adhesive is fully activated in the OMV
showed IC50 224µg/ml. membrane rather than as a mixture of purified vesicle
components, when it is presented. OMVs are sized (20-
At a concentration of 12.5 ϻg/ml, 85.687% cell 200 nm) and can present a variety of surface antigens in
viability was observed after treatment with OMVs. a native conformed that enables them to be introduced
However, cell viability reached to 44.414% using to lymph vessels and taken up by APCs. The natural
400Ϻg/ml concentration with OMVs. features of OMVs like immunogenicity, the ability to act
Zhang et al.,2019 demonstrated in many studies the as self-adjuvants, and the ability of immune cells also
propensity for immunization with OMV components make them appealing for use as pathogenic bacterial
can be caused by OMV (16). Toxins can act as adhesives vaccinations.
for OMVs and thus enable vesicles to enter cells via
(a) (b)
Figure (4): Showed the (a) untreated MCF-7 tumors cell mass showing the proliferating tumor cell
(b) treated MCF-7 tumors cell showing massive area of MCF-7
Bélteky et al., (2019) showed thatcell viability observed(18). The 50% inhibition dose of growth (ID50)
assays on human A549 adenocarcinoma as well as at 3.6 μM was observed. It was further observed that the
on non-cancerous MRC-5 fibroblast cells(17).. The nanoparticles had an immediate effect as observed under
aggregation dependent toxicity of both AgNP samples the Inverted Light Microscope following treatment with
was investigated at nanoparticle concentrations silver nanoparticles. There was a clear morphological
corresponding to the respective cell line-specific IC50 change in cells under the microscope when they lost
(A549: IC50AgNPC =72.2±4.1 ppm; IC50AgNPGT their attached nature and got rounded.
=63.1±3.8 ppm; MRC-5: IC50AgNPC =17.6±3.0 ppm;
IC50AgNPGT =1.3±0.2 ppm). Conclusion
Nazir et al., (2011) reported that for both cell lines In vitro experiment showed the OMV optimum
Human cancer cell lines HT144 (malignant melanoma cytotoxic activity against breast cancer(MCF- 7) cell
of skin) and H157 (squamous cell lung carcinoma) line by MTT method, the result showed 44.414% cell
against silver nanoparticles, cytotoxic activity was viability.
480 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Conflict of Interest: Non 10. He, Z., Schulz, A., Wan, X., Seitz, J., Bludau,
H., Alakhova, D. Y. & Kabanov, A. V. Poly
Source of Findings: Self-findings. (2-oxazoline) based micelles with high capacity for
Ethical Clearance: Non 3rd generation taxoids: Preparation, in vitro and in
vivo evaluation. Journal of controlled release,2015.
References 208, 67-75.
11. Al-Shammari A.; Yaseen Y.; Alwan, M.
1. 1 hattopadhyay, M. K., & Jaganandham, M. V.
Establishment and characterization of AMN3 first
Vesicles-mediated resistance to antibiotics in
murine mammary adenocarcinoma transplantable
bacteria. Front. Microbiol.2015. 6:758.
tumor line in Iraq. Journal of Iraqi Cancer.
2. Biller, S. J., Schubotz, F., Roggensack, S. E., 2008.1(2):1.
Thompson, A. W., Summons, R. E., & Chisholm,
12. Kim, O. Y., Park, H. T., Dinh, N. T. H., Choi, S.
S. W. Bacterial vesicles in marine ecosystems.
J., Lee, J., Kim, J. H., ... & Gho, Y. S. Bacterial
science, 2014.343(6167), 183-186.
outer membrane vesicles suppress tumor by
3. Fulsundar, S., Harms, K., Flaten, G. E., Johnsen, interferon-γ-mediated antitumor response. Nature
P. J., Chopade, B. A., & Nielsen, K. M.Gene communications, 2017.8(1), 1-9.
transfer potential of outer membrane vesicles
13. Behrouzi, A., Vaziri, F., Rad, F. R., Amanzadeh, A.,
of Acinetobacter baylyi and effects of stress on
Fateh, A., Moshiri, A., & Siadat, S. D.Comparative
vesiculation. Appl. Environ. Microbiol.,2014.
study of pathogenic and non-pathogenic Escherichia
80(11), 3469-3483.
coli outer membrane vesicles and prediction of
4. Jurj, A., Braicu, C., Pop, L. A., Tomuleasa, C., host-interactions with TLR signaling pathways.
Gherman, C. D., & Berindan-Neagoe, I. The new BMC research notes, 2018.11(1), 539.
era of nanotechnology, an alternative to change
14. Rolhion, N., Barnich, N., Claret, L., & Darfeuille-
cancer treatment. Drug design, development and
Michaud, A. Strong decrease in invasive ability
therapy, 2017.11, 2871.
and outer membrane vesicle release in Crohn’s
5. Rai, M., Kon, K., Ingle, A., Duran, N., Galdiero, disease-associated adherent-invasive Escherichia
S., & Galdiero, M.Broad-spectrum bioactivities coli strain LF82 with the yfgL gene deleted. Journal
of silver nanoparticles: the emerging trends and of bacteriology,2005. 187(7), 2286-2296.
future prospects. Applied microbiology and
15. Anand, D., & Chaudhuri, A. Bacterial outer
biotechnology, 2014.98(5), 1951-1961.
membrane vesicles: New insights and applications.
6. Riehemann, K., Schneider, S. W., Luger, T. A., Molecular membrane biology, 2016.33(6-8), 125-
Godin, B., Ferrari, M., & Fuchs, H.Nanomedicine— 137.
challenge and perspectives. Angewandte Chemie
16. Zhang, Y., Fang, Z., Li, R., Huang, X., & Liu, Q.
International Edition, 2009.48(5), 872-897.
Design of Outer Membrane Vesicles as Cancer
7. Adams, J. L., Smothers, J., Srinivasan, R., & Vaccines: A New Toolkit for Cancer Therapy.
Hoos, A. Big opportunities for small molecules Cancers, 2019.11(9), 1314.
in immuno-oncology. Nature reviews Drug
17. Bélteky, P., Rónavári, A., Igaz, N., Szerencsés,
discovery,2015. 14(9), 603-622.
B., Tóth, I. Y., Pfeiffer, I. & Kónya, Z. Silver
8. Rosenberg, S. A., Yang, J. C., & Restifo, N. P. nanoparticles: Aggregation behavior in biorelevant
Cancer immunotherapy: moving beyond current conditions and its impact on biological activity.
vaccines. Nature medicine, 2004.10(9), 909-915. International journal of nanomedicine, 2019.14,
9. Wang, X., Li, S., Shi, Y., Chuan, X., Li, J., Zhong, 667.
T., ... & Zhang, Q. The development of site-specific 18. Nazir, S., Hussain, T., Iqbal Md, M. K., Muazzam,
drug delivery nanocarriers based on receptor A. G., & Ismail, J. M. Novel and cost-effective
mediation. Journal of controlled release, 2014.193, green synthesis of silver nano particles and their
139-153. in vivo antitumor properties against human cancer
cell lines. Biosci Tech,2011. 2(6), 425-430.
DOI Number: 10.37506/mlu.v21i1.2356 Medico-legal Update, January-March 2021, Vol. 21, No. 1 481
Mahmood Khalil Ibraheem1, Mutazsabahahmied2, Firas Shawqi Algburi3, Amina Hamed Alobaidi4
1
Clinical Biochemistry Specialist, Tikrit University College of Medicine, Tikrit Iraq, 2Assistant Professor, Tikrit
University College of Medicine, Tikrit Iraq, 3Assistant Professor, Tikrit University College of Science, Tikrit Iraq,
4Assistant Professor, Kirkuk University College of Veterinary Medicine, Kirkuk
Abstract
Background: Premature ovarian insufficiency (POI) is a delicate medical problem in young women. This
condition is not unchangeable and permanent but is associated with intermittent and unpredictable ovarian
activity, resulting in low conception rate. Over the period of 8 years, the evaluation of secondary amenorrhea
was conducted in 90 patients below the age of 40 who wished to restore fertility and is characterized by
irregular or absent periods and reduced fertility. Symptoms include those associated with the natural
menopause (night sweats and vaginal dryness), and with the long-term adverse effects of estrogen deficiency
(osteoporosis and cardiovascular disease): The latter is believed to explain the shorter life expectancy
associated with POI.
Aim: To illustrate the predictive value of progesterone receptors (PRs), estrogen receptors (ERs), progesterone
(PRG), estradiol (E2), Lulilizing hormones (LH), Follicle stimulating hormones (FSH) and Anti mullerian
hormones (AMH) serum levels as diagnostic approach for POI.
Method: Sixty (60) women with idiopathic POF with thirty (30) women as control groups were included
in the study. Baseline investigation in all subjects included serum progesterone receptors(PRs), estrogen
receptors(ERs), progesterone (PRG), estradiol (E2), Lulilizing hormones (LH), Follicle stimulating
hormones (FSH) and Anti mullerian hormones (AMH) levels were estimated using appropriate assays in
biochemistry laboratory.
Results: There was statistically significant differences in the serum progesterone receptors, estrogen
receptors, progesterone, estradiol, LH, FSH and AMH in POI cases when compared with healthy control
(P=<0.05).
Conclusion: These results indicate that serum progesterone and estrogen receptors levels, is high in POI cases
as a result of lack progesterone and estradiol hormones as a result of loss negative feedback inhibition,this
result may be used to primary diagnosis of premature ovarian failure.
Keywords: Premature ovarian failure (POF), Anti mullarian hormones(AMH), progesterone receptors
(PRs), Estrogen receptors (ERs).
Table (1): Serum progesterone and estrogen receptors in patient cases and controls
Patient Control
Parameter P
Mean±Se Max Min Mean±Se Max Min
PRs ng/ml 4.14±0.42 13.27 0.11 2.44±0.33 8.32 0.15 0.001
ERs pg/ml 4969.92±271.51 8000 360 551.17±59.9 1198 50 0.003
Determination the serum LH, FSH and AMH: 6.00±0.31 mIu/ml,) respectively. However, AMH
The LH and FSH mean serum levels were significantly mean serum level (0.16±0.03 ng/ml) was significantly
(P<0.05) higher in women with POI,(43.36 ±3.01, (P<0.05) lower in women with POI than that in controls
62.15±3.98 mIu/ml) as compared to controls (6.06±0.40, (2.72 ±0.16), Table (2).
Table (2): Serum LH,FSH and AMH in patient cases and controls
Patient Control
Parameter P
Mean±Se Max Min Mean±Se Max Min
LH mIu/ml 43.36 ±3.01 100.87 10.23 6.06±0.40 9.79 3.12 S
FSH mIu/ml 62.15±3.98 181.32 22.28 6.00±0.31 11.15 2.97 S
AMH ng\ml 0.16±0.03 0.91 0.01 2.72±0.16 4.55 1.29 S
Determination the serum progesterone and POI (8.75±0.75 pg/ml, 0.23±0.03 ng/ml) than in controls
estradiol: Both Estradiol and progesterone mean serum (56.06±4.11 pg/ml, 0.60±0.04 ng/ml) respectively,
values were significantly (P<0.05) lower in women with Table (3).
484 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table (3): Serum progesterone and estradiolin patient cases & cotrole
Patient Control
Parameter P
Mean±Se Max Min Mean±Se Max Min
Estrogen pg\ml 8.75±0.75 19.99 0.32 56.06±4.11 102.11 22.36 0.002
Pregesterone ng\ml 0.23±0.03 0.95 0.01 0.60±0.04 0.99 0.24 0.003
Mahmood Khalil Ibraheem1, Mutazsabahahmied2, Firas Shawqi Algburi3, Amina Hamed Alobaidi4
1
Clinical Biochemistry Specialist, Tikrit University College of Medicine, Tikrit Iraq, 2Assistant Professor, Tikrit
University College of Medicine, Tikrit Iraq, 3Assistant Professor, Tikrit University College of Science, Tikrit Iraq,
4Assistant Professor, Kirkuk University College of Veterinary Medicine, Kirkuk
Abstract
Background: Premature ovarian failure (POF), often and misleadingly referred to as ‘premature menopause’,
is defined as a loss of ovarian activity before the age of 40 years and is characterized by irregular or absent
periods and reduced fertility. Symptoms include those associated with the natural menopause (night sweats
and vaginal dryness), and with the long-term adverse effects of estrogen deficiency (osteoporosis and
cardiovascular disease): the latter is believed to explain the shorter life expectancy associated with POF.
Method: Sixty (60) women with idiopathic POF with thirty (30) women as control groups were included in
the study. Baseline investigation in all subjects included serum Osteocalcin(OC), granulin(GRN), cathepsin
k (CTK), vitamin D, parathyroid hormones (PTH), calcium and phosphrus levels were estimated using the
appropriate assays for each.
Results: The mean serum levels of Osteocalcin, Ganulin,Parathyroid hormones,vitamin D and phosphorus,
were significantly higher in women with POF,when compared to healthy controls (P=<0.05). However, mean
serum levels of cathepsin k and calcium in POF group were non significant differences,when compared to
healthy controls.
Conclusion: Osteocalcin and granulin serum levels may be used as new biomarker for the diagnosis of
premature ovarian failure.
Patient Control
Parameter P
Mean±Se Min Max Mean±Se Min Max
Osteocalcin ng\ml 47.35± 5.35 0.54 130.98 17.21± 3.07 0.54 60.21 00.001
Cathepsin K ng\ml 0.27± 0.05 0.01 1.61 0.24± 0.07 0.02 2.16 0.691
Granulin ng\ml 7.87± 0.53 2.55 20.00 5.44± 0.56 1.80 16.25 0.002
Determination the serum PTH, vitamin level of calcium showed a nonsignificant (P>0.05) in
D,calcium and phosphorus: The Mean serum levels of patient cases (9.63±0.07), when compared with control
parathyroid hormones and vitamin D were significantly group (9.85±0.09), while the serum level of phosphorus
lower (P<0.01) in patient (35.42±1.34,12.43±0.90 demonstrated significant elevation (P=0.001),in patient
ng/ml), when compared with controls (46.53±1.77, cases (1.47±0.02), when compared with control group
20.88±1.99 ng/ml) respectively. While the mean serum (1.34±0.02), Table (2) .
Table (2) : Serum bone hormones and maniralin patient cases & controle
Patient Control
Parameter P
Mean±Se Max Min Mean±Se Max Min
PTH ng/ml 35.42±1.34 56.98 15.16 46.53±1.77 62.43 28.69 0.001
Vitamin D ng/ml 12.43±0.90 33.12 3.08 20.88±1.99 41.21 5.36 0.003
Calcium mg/dl 9.63±0.07 10.98 8.22 9.85±0.09 10.73 8.81 0.06
Phosphurse mmol/l 1.47±0.02 1.74 1.22 1.34±0.02 1.53 1.16 0.001
Abstract
Endometrial carcinoma is the second most common gynecologic cancer worldwide. Hyperplasia is a
precursor to endometrioid adenocarcinoma. There are few studies on the association of HPV with endometrial
adenocarcinoma.
Aim of the Study: To determine the relation of HPV with premalignant and malignant endometrial lesions.
Patients and Method: This study achieved on a total number of 90 patients with histopathological
examination revealing endometrial hyperplasia in 30 patient, endometrial carcinoma in 30 patient in addition
to 30 cases who underwent hystrectomy, for all patients detection of HR-HPV done by RT-PCR.
Results: The HR-HPV positivity was recorded in 23 patients. For the studied cases with endometrial
carcinoma, endometrial hyperplasia and controls the positivity rates were about (16.7%), (36.7%) and
(23.3%) respectively. Highest rate of HR-HPV positivity for the studied patients was found in the age group
(45-49). Highest rate of HR-HPV positivity in cases with endometrial carcinoma was reported in older age
groups [(45-49) and (50-54)], compared to endometrial hyperplasia and controls [(40-44) and (45-49)]. The
HR-HPV positivity was most frequently observed in cases with well-differentiated (22.2%). Higher HR-
HPV positivity rate was reported in the hyperplasia without atypia.
Endometrial histology 30-34 35-39 40-44 45-49 50-54 55-59 60-64 65-69 70+ Total
Well-differentiated 0 0 1 2 2 4 4 4 1 18(60%)
Endometrial
Moderately-differentiated 0 0 0 0 0 2 3 4 1 10(33.3%)
carcinoma
Poorly-differentiated 0 0 0 0 0 0 0 1 1 2(6.7%)
Hyperplasia without atypia 2 3 5 4 2 2 0 0 0 18(60%)
Endometrial Atypical hyperplasia/
hyperplasia endometrioid intraepithelial 0 0 1 1 3 4 2 1 0 12(40%)
neoplasia
Control cases 3 3 5 6 5 3 3 2 0 30(100%)
Total 5 6 12 13 12 15 12 12 3 90
492 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Overall HR-HPV positivity was recorded in 25.6% the HR-HPV positivity appear higher in endometrial
(in 23 cases) of the patients included in the study. For the hyperplasia group but the analysis did not identify any
studied cases with endometrial carcinoma, endometrial statistically significant difference between the three
hyperplasia and controls the positivity rates were about groups as shown in table (2).
(16.7%), (36.7%) and (23.3%) respectively. Although
Studied Groups HR-HPV (+) No. (%) HR-HPV (-) No (%) Total X2 P-value
Endometrial carcinoma 5 (16.7) 25 (83.3) 30
Endometrial hyperplasia 11 (36.7) 19 (63.3) 30
3.2706 0.194894
Control 7 (23.3) 23 (76.7) 30
Total 23 (25.6) 67 (74.7) 90
Table (3) shows the distribution of HR-HPV positive HPV positivity was reported in older age groups[(45-49)
cases in the three groups of endometrial carcinoma, and (50-54)], compared to endometrial hyperplasia and
hyperplasia and controls according to the age groups. controls[(40-44) and (45-49)], however this difference
Overall the highest rate of HR-HPV positivity for the in the distribution of HR-HPV positivity according to
studied patients was found in the age group (45-49). In age groups in the three studied groups was statistically
cases with endometrial carcinoma higher rate of HR- unsignificant.
*Fisher-exact test. Regarding the association of (22.2%) compared to moderate and poorly-differentiated
HR-HPV positivity with the grade (differentiation) of tumors,however this difference was statistically not
endometrial carcinoma, the HR-HPV positivity was most significantas shown in table (4).
frequently observed in cases with well-differentiated
Medico-legal Update, January-March 2021, Vol. 21, No. 1 493
Table 4: Frequency distribution of HR-HPV positivity in different grades of endometrial carcinoma.
In the current study 25 patients with endometrial carcinoma were of stage I and 5 patients were of stage II
cancer and no cases with stage III and IV carcinoma were reported. In addition our data analysis did not observe any
statistically significant differences between HR-HPV positivity and tumor staging as shown in table (5).
In the correlation of HR-HPV positivity with the type of endometrial hyperplasia, higher HR-HPV positivity rate
was reported in the hyperplasia without atypiacompared to cases withatypical hyperplasia/endometrioid intraepithelial
neoplasia however it was statistically non siginificantas shown in table (6).
Abstract
This study analyzes the concepts of bribery and gratification and the distinguishing parameters between
them as regulated in several Articles of the Anti-Corruption Law. This involved the application of the
normative legal research supported by court decisions to clarify these differences. The results of this study
showed that bribery requires a meeting of mind between the bribe givers and bribe recipients which is not
found in gratification. The reporting mechanism and the reversal burden of proof do not apply to bribery
while Operation Catching Hand does not apply to gratification due to its inability to satisfy the provisions
of Article 1 point 19 of the Criminal Procedure Code. Criminal sanctions are also imposed on both the giver
and the recipient of a bribe while the act of a giver in gratification is not considered as a criminal offense.
The study also found the wrong application of these essential differences in court decisions.
Keywords: Meeting of mind, reversal burden of proof, caught hand, report mechanism.
The data are processed by the authors: In the been accommodated in the Non-Customer Giro (GNC)
gratification case of Nur Alam, a former Governor of account of IDR 30,481,436,261.00. At the defendant’s
Southeast Sulawesi, the verdict of the first instance request, the money was transferred to the account of
court, appeal, and casation stated that Nur Alam was Timbel Mas Abadi Ltd. gradually with each transaction
proven to have received a gratuity considered a bribe below the nominal value of IDR 500,000,000 to avoid
from Richcorp International Ltd in the amount of IDR. suspicion from PPATK. Finally, the money in the Sultra
40,268,792,850 from illegal grounds and not reported to Timbel Mas Abadi Ltd. account, at the defendant’s
the KPK within the prescribed time limit. The decision request to Bank Mandiri, was also transferred in batches
was based on several legal considerations. The money with the value less than IDR 500,000,000 to avoid
borrowed by the defendant personally from Chen suspicion from PPATK with the destination account
Linzecertainly opened the opportunity for a conflict being Untung Anaugi Ltd, Gino Valentino Ltd, and
of interest to the defendant as the Southeast Sulawesi Bososi Pratama Ltd.18
Governor. Besides, sending money to the defendant
to buy an insurance policy at AXA Mandiri on behalf According to the researchers, the money received
of the defendant using his biological children as by the defendant was not a gratuity or a bribe and the
beneficiaries also proves that the money is not a Chen defendant’s actions are purely considered a civil law
Linze’s investment to advance Southeast Sulawesi but in the form of investment placements and personal
from Richcorp International Ltd for the defendant. In loans. It is strengthened by several facts that investment
addition, all cancellation/disbursement of the three AXA Agreement No. CI/NA/IA/2010/001 of 19 August
Mandiri insurance policies on behalf of the defendant has 2010 conducted by Richcorp International Ltd and the
Medico-legal Update, January-March 2021, Vol. 21, No. 1 501
defendant in a personal capacity. Provisional Fund References
Provision Agreement No. PPDS/RC/NA/2010/002 dated
1. Media Indonesia, 8 November 2019
August 19, 2010. Moreover, based on the investment
agreement and personal loan in the amount of IDR 2. Annual Report of Corruption Eradication
40,268,792,850, the defendant apparently returned the Commision of Indonesia, 2018 and 2019
money to Richcorp International Ltd as observed from 3. Adalgiza A. Nùñez, “International Business,
these two pieces of evidence. First, evidence of money Bribery, and Criminal Liability”, New Jersey
transfers from Giofedi Rauf to Richcorp International Lawyer, the Magazine, 2014; 288: 65.
Ltd totaling IDR 15,000,000,000 dated May 30, 2013, 4. William J. Stuntz, “The Pathological Politics of
IDR 15,000,000,000 dated June 3, 2013, and IDR 10. Criminal Law”, Michigan Law Review, 2001; 100:
750.000.000 dated June 4, 2013. A letter dated June 10, 519-520.
2013, from Richcorp International Ltd to Geofedi Rauf 5. David M. Fuhr, “Of Thieves and Repressors: The
regarding evidence of receipt of money transferred by the Interplay between Corruption and Human Rights
defendant in the amount of IDR. 40,750,229,110. This Violations”, Elon Law Review, 2013; 5: 273.
shows that the defendant returned the money to Richcorp
6. Eric C. Chaffee, “From Legalized Business Ethics
International Ltd before the investigation was conducted
to International Trade Regulation: The Role of
by KPK. The money was also returned in accordance
the Foreign Corrupt Practices Act and Other
with the contents of Investment Agreement No. CI/NA/
Transnational Anti-Bribery Regulations in Fighting
IA/2010/001 dated August 19, 2010, between Richcorp
Corruption in International Trade”, Mercer Law
International Ltd and the defendant is in a personal
Review, 2014; 65: 712.
capacity and Agreement of Temporary Funds Provision
No. PPDS/RC/NA/2010/002 dated 19 August 2010.19 7. Lawrence J. Trautman and Kara Altenbaumer-
This, therefore, means there is no connection between Price, “Lawyers, Guns, and Money: The Bribery
the defendant’s position as the Southeast Sulawesi Problem and the U.K. Bribery Act”, International
Governor and transactions. It is important to note that it Lawyer, 2013; 47: 485-486.
is only possible to establish gratification as long as it is 8. Marsha Z. Gerber & Elaine L. Lawson, “Business
related to the defendant’s position. Entertainment “Texas Style” Here and Abroad
What You Need to Know”, Texas Bar Journal,
Conclusion 2012; 75: 536.
Bribery and gratuity are malversations. Meanwhile, 9. Leonce Ndikumana: The Private Sector as Culprit
in bribery, the bribe giver and receiver need to agree to and Victim of Corruption in Africa. Political
commit a crime before it happens and the existence of the Economy and Research Institute, University of
word ‘agreed’ becomes the basis for the crime imposed Masshachusetts Amherst, 2013: 11.
on both of them. The Anti-Corruption Law shows the 10. Fariz Cahyana, “the Importance of Regulating
givers can be anybody from any background while Bribery in the Private Sector as Offense of
the recipients are limited only to certain performers. Corruption in Indonesia”, Juris-Diction, 2020; 3
Moreover, the OTT usually conducted by KPK are all (1): 63-67.
related to bribery cases. It was also discovered that 11. Lindsay B. Arrieta, “Attacking Bribery at its Core:
reversal burden of proof and reporting mechanism apply Shifting Focus to the Demand Side of the Bribery
only to gratuities and this means that the recipients have Equation”, Public Contract Law Journal, 2016; 45:
30 working days after gratification has been received to 590-592.
report to the KPK to avoid criminal prosecution. Failure
12. Jan Remmelink: Criminal Law. Translated by
to report means that the recipient is corrupt.
Tristan, Jakarta: Gramedia Pustaka, 2003: 314-315.
Conflict of Interest: Nil 13. Elizabeth K. Spahn. “Implementing Global Anti-
Bribery Norms: From the Foreign Corrupt Practices
Source of Funding: Faculty of Law Universitas
Act to the OECD Anti-Bribery Convention to the
Islam Indonesia
U.N. Convention against Corruption”, Indiana
Ethical Clearance: Taken from Legal and Ethical International & Comparative Law Review, 2013;
Committee/Board, Universitas Islam Indonesia 23: 25.
502 Medico-legal Update, January-March 2021, Vol. 21, No. 1
14. Muh. Arief Syahroni, M. Alpian, and Syofyan Abheseka, “Evaluation of Hand Arrest Operation
Hadi, “Reversal Burden of Proof of Corruption”, of KPK”, Journal of Integrity, 2019; 5(2): 119.
Jurnal Ilmu Hukum, 2020: 126-128. 17. Nur Mauliddar, Mohd. Din, and Yanis Rinaldi,
15. Lucinda A. Low, Sarah R. Lamoree, & John “The Gratification as Corruption in Regard with
London, “The “Demand Side” of Transnational a Report from a Gratification Receiver “, Kanun,
Bribery and Corruption: Why Leveling the Playing 2017; 19 (2): 162-164.
Field on The Supply Side isn’t Enough”, Fordham 18. Court Decision of Central Jakarta, 123/Pid.Sus/
Law Review, 2015; 84: 583-584. TPK/2017
16. Rizky Oktavianto and Norin Mustika Rahadiri 19. Supreme Court Decision No. 2933 K/Pid.Sus/2018
DOI Number: 10.37506/mlu.v21i1.2360 Medico-legal Update, January-March 2021, Vol. 21, No. 1 503
Abstract
Stress is a state created by amendment in atmosphere that is damaging to the person’s equilibrium and
is mostly prevalent in nursing students. The study aims to measure the stress level of nursing students.
Sample size consisted of 63 nursing students of GNM 1st year and B.Sc.(N) Post basic 1st year chosen
by convenience non-probability sampling technique and informed consent were taken from subjects. The
UN Management stress tool was used to collect data which was taken from UNO Management Booklet of
series. The results of the study has revealed that 97% of GNM 1st year students and 67% of Post Basic B.Sc.
Nursing students were in moderate stress. The stress level is high in GNM 1st year students as compare to
post basic BSc Nursing 1st year. Mean stress score of Post Basic B.Sc.(N) 1st year and GNM 1st year was 17
± 2.3 & 23 ± 3.5.
Figure 1 depicts that 97% subjects of GNM 1st and 33% of Post Basic BSc (N) 1st year had mild stress.
year and 67% subjects of Post basic B.Sc.(N) 1st year None of the subjects has severe stress.
had moderate stress. And 3% subjects of GNM 1st year
Demographic variables Mild stress Moderate stress df Table value Chi square p-value
Age
<18 or 18 1 19
19-22 7 17 2 5.99 5.3536S 0.0687
23 or >23 2 17
Marital status
Married 4 2
1 3.84 12.812s 0.002
Unmarried 6 51
506 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Demographic variables Mild stress Moderate stress df Table value Chi square p-value
Sex
Male 1 1
1 3.84 1.8015NS 0.1794
Female 9 52
Resident
Rural 9 38
1 3.84 1.4873NS 0.2226
Urban 1 15
Classes
1 35
GNM 1 3.84 10.7873S 0.0009
9 18
Post Basic B.Sc.(N)
Table 3 shows that the association between & level of moderate stress was higher than mild stress.
stress scores and socio demographic variable such as Mean of moderate stress is 99.2 & 72.33 in mild stress.
age, marital status and classes found significant, as
calculated value is greater than tabulated value at the Conclusion
p level of significance < 0.05. It means stress scores Stress has become a never ending, continuous &
were associated with age and marital status. And the prevalent condition in today’s world. Preset generation
association between stress scores and socio demographic is marked as generation of stress. Everyone experiences
variables such as sex and gender found non-significant, various forms of stress in their lives. Stress has become
as calculated value is less than tabulated value at the p very common among the students. In the present
level of significance <0.05. research, attempt was made to determine the stress among
nursing students in Nursing College, Punjab following
Discussion a descriptive design. This study has tried to assess the
The present study showed that level of moderate mental well-being or the lack thereof, of the students
stress was higher than mild stress. The level of moderate undergoing nursing training. The fact that these students
stress among 35 students of GNM 1St year was 97% are finding the subjects difficult, living in hostels, doing
percentage and 67% among 18 students of B.Sc (N) Post shift duties in hospitals, academic workload is reflected
basic 1st year. According to one study conducted among in the significantly higher incidence of stress that they
nursing students in Kathmandu university to assess the experience, as compared to the general population. We
academic stress, the result came out with 75% students suggest that an induction program at the start of the
with academic stress [8].Similar result was found in one nursing course, and positive mental health training can
study done on Nursing workers. It was a comparative go a long way toward reducing strain of nursing students
study to determine job related stress, stress reaction, and can provide betterment to their professional and
coping strategies adopted by nursing personnel working personal well-being.
in critical and non-critical unit of selected hospital of
Delhi. It was found that percentage of moderate stress Acknowledgement: The researchers would like
was higher that is 59.65% than mild stress 22.81%. Most to express their special thanks to Mrs Aditya Sharma,
of them felt troubles in participation in social life due to Former Principal of Kular College of Nursing for
institute’s timings, living away from home, lack of time permitting us to perform the study and all the participants
for self- study, strict rules and regulation in the hospital, of this study for their valuable responses.
unable to get leisure time for recreation. The finding of Financial Support & Sponsorship: Nil
the research showed that the moderate stress was more
in the age group of 18 or less than 18 (95%) as compare Conflict of Interest: There are no conflict of interest
to other age group. Similar result was found in one study
done on nursing students of B.Sc Nursing 1st year at PGI Ethical Clearance: Taken from the ethical and
Chandigarh. The results of the study has shown that the research committee of Kular College of Nursing.
stress level was greater in the age group of 17 – 22 years
Medico-legal Update, January-March 2021, Vol. 21, No. 1 507
Abstract
Introduction: Organ donation provides the recipient with a second chance to live. Inappropriate knowledge
and attitude of individuals to organ donation are one of the most important barriers for organ donation.
Aims and Objectives: To determine the effectiveness of structured teaching program on knowledge and
attitude regarding organ donation among students.
Study Variables: Age, Religion, Habitat, Family type,Education stream, and Information source.
Result and Discussion: It was found that after a structured teaching program knowledge level of students
in post-test was increased that is 66% adequate knowledge whereas 34% of participants have moderate
knowledge. Also, in pre-test 89% of the student had poor attitude and 79% student had satisfactory attitude
in post-test. Significant association between the level scoreof knowledge with an information source had
been found.
Conclusion: In the present study, a marked increase in knowledge and change in the attitude level of the
students has been observed during the post test.
Table 1: Frequency distribution of the level of knowledge of participants in pre-test & post-test. N=100
Table 1 shows that there is difference between posttest mean (12.91) and pretest mean (11.96) knowledge
regarding organ donation.
510 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2: Association between Knowledge levels with demographic variables N=100
Table 2 describes that chi square test for association The chi square value describes a significant
with the gender (χ2=2.492), with age (χ2=5.985), with association between level of knowledge score and
religion (χ2=3.968), with type of family (χ2=3.659), information source (p<0.05). There is no significant
with habitat (χ2=1.172), with previous board of school, association between level of knowledge score and other
(χ2=0.961) with personal/family experience of organ socio demographics profile.
donation (χ2=0.174), with have you attended any organ
donation program previously related to knowledge
(χ2=4.455) and association with information of organ
donation (χ2=14.799).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 511
Table 3: Association between attitude score with their socio demographic variables of the subjects N=100
Table 3 delineates that chi square test for association (χ2=0.789) and association with information source of
with the gender (χ2 =3.119), with age (χ2=1.606) with organ donation (χ2=5.405).
religion (χ2=3.883), with type of family (χ2=2.103),
with habitat (χ2=0.000), with previous board of school, The chi square value shows there is no any
(χ2=3.203) with personal/family experience of organ significant association between attitude score and other
donation (χ2=2.374), with have you attended any organ socio demographic profile.
donation program previously related to knowledge
512 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 4: Relationship between knowledge and attitude regarding organ donation among subjects N=100
Table 4 illustrates that there has been no relationship and Attitude regarding Organ Donation and
between pre knowledge and pre attitude but there is Transplantation among Adolescents in Selected
relationship between post knowledge and post attitude Junior Colleges of Guntur (Dt), AP. International
knowledge after structured teaching program. Journal of Advances in Nursing Management, 7(1),
p.45.
Conclusion 2. Organ receiving and giving awareness network.
Based on the present study knowledge level of Available from: https://www.organindia.org/make-
students increases after structured teaching and also a-pledge/[Accessed 19 March 2020].
change in attitude level. There was significant association 3. Beth, M. Baby, A. and Bhula, M., 2018.
between level score of knowledge with information Effectiveness of Planned Teaching Programme on
source whereas no statistically significant association Knowledge Regarding Organ Donation Among
was found with demographic variables. Under Graduate Students. Journal of Advanced
Health Informatics, 4(1).
References
1. Devi, S. and Jyothi, B., 2019. Effectiveness of
Structured Teaching Programme on Knowledge
DOI Number: 10.37506/mlu.v21i1.2363 Medico-legal Update, January-March 2021, Vol. 21, No. 1 513
Abstract
Background: Due to the vast spread of corona virus, lockdown was announced in many countries, and
hence many people are facing psychological, physical, economic and social changes. Students at the college
experience a variety of sleep problems which can have a direct effect on academic success, health and mood.
Sleep disruption and excessive daytime sleep are common problems for students.
Subject and Method: 141 college students between the age of 17 to 24 were taken from various colleges.
The structured Pittsburgh Sleep Quality Index was used and was circulated amongst students through Google
forms and the sleep log, and demographic sheet was used to test sleep length, daytime sleepiness and related
sleep issues.
Results: The result, on the basis of the sleep pattern of college students, was classified into 5 categories:
(healthy sleep pattern, mild, moderate, severe and worst). 53.90% out of 141 respondents o had healthy sleep
pattern range (0-5), 39.71% had mild sleep pattern range (6-10), 4.96% out of 141 respondents had moderate
sleep pattern range (11-15), and 1.41% out of 141 respondents had severe sleep pattern range (16-20).
Conclusion: In our study we found that during the lockdown majority of college students had a healthy
sleep pattern and least of the college students had a severe sleep pattern range.
Keywords: Pittsburgh Sleep Quality Index, Coronavirus, Lockdown, sleep pattern, college students.
According to Table 1: 32.6% out of 141 30.4% out of 141 respondents take time to sleep at
respondents, sleep quality rate is very good, 48.9% out of night in ≤ 15 minutes, 42.5% out of 141 respondents
141 respondents sleep quality rate is fairly good, 13.4% take time to sleep at night in 16 -30 minutes, 14.1% out
out of 141 respondents sleep quality rate is fairly bad of 141 respondents take time to sleep at night in 31-60
and 5 % out of 141 respondents sleep quality response, minutes, 12.7% out of 141 respondents take time to
the percentage is very low. sleep at night in > 60 minutes.
How many hours you have got to sleep at night during the last month?
According to Table 4: 14.1% have sleep 83.6% have taken sleep medicine not during past
disturbance not during pass month, 69.9% out of have month, 9.21% have taken sleep medicine less than once
sleep disturbance less than once a week, 16.3% out of a week, 6.38% have taken sleep medicine once or twice
have sleep disturbance once or twice a week and 0% a week and 0.70% have taken sleep medicine three or
out have sleep disturbance have occurred three or more more times per week.
times per a week.
Over the past few month, how often have you had trouble
Frequency (N) Percentage % Score
staying awake while driving, eating, or socializing?
91 64.5% Not during the last month 0
27 19.1% Less than one week 1
18 12.7% Once or two times a week 2
5 3.5% Three or more times per week 3
According to Table 5: 64.5% have trouble staying staying awake once or two times a week and 3.5% have
awake not during the past month, 19.1% have trouble trouble staying up three or more times per week.
staying awake less than once a week, 12.7% have trouble
Medico-legal Update, January-March 2021, Vol. 21, No. 1 517
Global PSQI Score: A total of seven components
Table 6
According to the global PSQI score: 53.90% The questionnaire instruction analyzed the results. There
have healthy sleep quality,39.71% have mild sleep are seven component scores in the scoring PSQI, each
quality,4.96% have moderate sleep quality and 1.41% score 0 (no difficulty) to 3 (severe difficulty).Scores of
have severe sleep quality. the components are summed up to generate a global
score (0 to 21) higher score mean poorer quality of sleep.
Result Good and satisfied sleep is not only central to sound body
Global PSQI Score: Sum of seven components: health, but is also of primary importance to cognitive
According to the global PSQI score 53.90% out of 141 and social activities. Learning plays a significant part in
respondents of college student have healthy sleep pattern, learning and memory process for the students.
39.71% have mild sleep pattern,4.96% have moderate In our analysis we identified the characteristics of
sleep pattern and 1.41% have severe sleep pattern. socio-demographic and lifestyle, nighttime behaviors
and sleep habits and their results. Besides low sleep
Discussion quality students also showed poor quality of sleep. Table
We investigated variation of the college students 1 reveals that 32.6% out of 141 response of college have
sleep pattern during lockdown in cross- sectional very good sleep pattern and 5% out of 141 responses
study. As expected, during lockdown college students have very disturbed sleep pattern. Poor sleep quality
sleep pattern may be changed. The information of the has been associated with negative moods reported to
results must consider the limitations of the study mainly be significantly higher by themselves. Table 2 shows
depend on self- reports regarding sleep schedule. The 42.5% out of 141 response of college student take 16
COVID-19 pandemic has created damaged millions to 30-minute times to sleep at nights. 12.7% out of 141
of people to live under strict blackout conditions and response take more than 60 minutes to sleep at night so
people who go to bed and wake up late, spend more we should stick to the same sleep schedule and wake up
time in bed and record a poorer standard of sleep as time even on the weekends, so that it can help us sleep
well. Decreased sleep quality was stronger with high at right time. Comparing the previous study, we found
levels of depression, anxiety, and stress. Loss of sleep that 43.9% had more than 7 hours of real night sleep
among college students poses a serious risk to academic and 16.3% had once or twice a week disrupted sleep.
performance, both physical and emotional health. For Sleep medicine is taken once or twice a week by 6.38%
the study, a total of 141 college students were chosen, students.
they were evaluated for the parameters of inclusion and
According to this research we found global PSQI
exclusion criteria. College student sleep pattern is tested
score is used to sum the seven components. In the current
on the basis of the result of PSQI they were put under the
study, data shows that during lockdown majority of the
five groups namely 1) Good Sleep quality, 2) Mild Sleep
college student had healthy sleep pattern (53.90%) range
quality,3) moderate Sleep quality, 4) Extreme Sleep
of the PSQI (0 -5), 39.71 % had mild sleep pattern range
quality, and 5) Worst Sleep quality.
of the PSQI (6-10), 4.96% had moderate sleep pattern
In our study one questionnaire is used to determine range of the PSQI (11-15) and 1.41 % had severe sleep
the sleep pattern of college students during lockdown. pattern range of the PSQI (16-20).
518 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Limitations of the study: Medical Science. 2001 Aug; 16(4):475.
• One of the limitations of this study is small sample 3. Heath AC, Eaves LJ, Kirk KM, Martin NG. Effects
size, study was of short duration, the interval of lifestyle, personality, symptoms of anxiety and
between the age group is less and study is done on depression, and genetic predisposition on subjective
young healthy individuals only. sleep disturbance and sleep pattern. Twin Research
and Human Genetics. 1998 Aug;1(4):176-88.
• Another drawback was that this analysis consisted
4. Singh R, Sharma R, Suri JC, Das S. Impact of sleep
of a one- time study, so it is difficult to determine
patterns on mood and academic performance of
the connection between sleep disturbance and poor
medical students. Indian Journal of Sleep Medicine
sleep quality.
(IJSM). 2009;4(2).
Recommendations: 5. Jenkins SM. Sleep habits and patterns of college
• This analysis can be carried out on a larger sample students and their relationship to selected
size. personality characteristics
• The period of research can be longer. 6. MAHRAN DG, AHMED SM. Sleep Disorders
among Female Students in Assiut University,
• There may be variations in the age group used for Upper Egypt. Med. J. Cairo Univ. 2012;83(2):179-
study. 85.
Conclusion 7. Ishita M, Kuldeep S. Impact of Digital Media on
Sleep Pattern Disturbance in Medical and Nursing
We assume there is need for more research into students. Science [ETEBMS-2016]. 2016 Mar;5(6).
sleep cycle and their effect on the working. There should
8. Kaur G, Sharma V, Singh A. Association of sleep
be a study of students with good sleep habits. Sleep
quality with general health: an Indian college
requirements differ according to individual needs. Some
students’ study. Int J Med Sci Public Health. 2015
need more than 7 hours of effective sleep, other may
Dec 1;4(12):1767
need as little as 5 hours of sleep. Further research can
identify factors in lifestyle which promote good quality 9. Lowry M, Dean K, Manders K. The link between
of sleep. sleep quantity and academic performance for the
college student. Sentience. 2010;3(2):16-9
In the current study we found that during lockdown 10. Anjum A, Bajwa MA, Saeed R. SLEEP
period most students had a healthy sleep pattern. Sleep PATTERNS. The Professional Medical Journal.
disorder can have a huge effect on people lives. These 2014;21(01):148-56.
findings support that there is no variation of sleep pattern
11. World Health Organization. Mental health and
during lockdown. Healthy sleep pattern decreases the
psychosocial considerations during the COVID-19
anxiety, tension, depression and stress .
outbreak, 18 March 2020. World Health
Ethical Clearance: Taken from University Ethical Organization; 2020.
Committee 12. Altena E, Baglioni C, Espie CA, Ellis J, Gavriloff
D, Holzinger B, Schlarb A, Frase L, Jernelöv S,
Source of Funding: Self
Riemann D. Dealing with sleep problems during
Conflict of Interest: Nil home confinement due to the COVID‐19 outbreak:
practical recommendations from a task force of
References the European CBT‐I Academy. Journal of Sleep
Research. 2020 Apr 4.
1. Orsal O, Orsal O, Alparslan GB, Unsal A. Evaluation
of the relation between quality of sleep and anxiety 13. Lund HG, Reider BD, Whiting AB, Prichard JR.
among university students. HealthMED. 2012 Jan Sleep patterns and predictors of disturbed sleep in
1;6(7):2244-55. a large population of college students. Journal of
adolescent health. 2010 Feb 1;46(2):124-32.
2. Ban DJ, Lee TJ. Sleep duration, subjective sleep
disturbances and associated factors among 14. Cellini N, Canale N, Mioni G, Costa S. Changes in
university students in Korea. Journal of Korean sleep pattern, sense of time, and digital media use
during COVID-19 lockdown in Italy.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 519
15. Saha S, Dutta T. A STUDY ON THE Patterns among Medical Students, Saudi Arabia.
PSYCHOLOGICAL CRISIS DURING THE Arch Med. 2017;9:3.
LOCKDOWN CAUSED DUE TO COVID-19 17. BuboltzJr WC, Brown F, Soper B. Sleep habits and
PANDEMIC. patterns of college students: a preliminary study.
16. Albhlal LA, Alanzi FG, Ghannam KB, Alqahtani Journal of American college health. 2001 Nov
A, Alenazi AQ, Alanazi MQ. Sleep Disturbance 1;50(3):131-5.
520 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2364
Abstract
Background: Nowadays health care quality is a universal concern. The most appropriate method to measure
a client’s experiences about available hospital services is a patient satisfaction survey. Present study aimed
to assess patient’s knowledge and satisfaction regarding health care.
Method: 330 patients were selected by purposive sampling technique attending various outdoor and indoor
departments of the selected hospital. Self-structured checklist and three-point rating scale each containing a
total 50 sets of items used to assess knowledge and satisfaction. The reliability coefficient for the knowledge
tool was 0.87 by KR 20 and satisfaction was found 0.85 by Cronbach’s Alpha.
Result: Study results showed that more than half (52.4%) and (60.6%) patients had very good level of
knowledge and 76.4% & 67.5% of patients were satisfied with overall health care. Item wise distribution
of satisfaction among patients reveals that “physician gave follow up instructions to the patient properly
(78.2%)”, “OPD card facility (78.2%),” and “hospital food facility for patients (75.2%)” was found ranked
1st with the highest satisfaction, whereas “Free of cost availability of drugs”, “long queues during OPD card
registration process” was found ranked lowest. A significant low positive correlation found between mean
knowledge and satisfaction scores regarding health care services as evident by computed ‘r’ value (0.38).
Conclusion: Using these necessary responses from the patients, various shortcomings can be pointed out
and notify to hospital administration for improvement of the health care.
Material and Method Rating scale for level of satisfaction had a score of
3 point i.e., satisfied score as 3, partially satisfied as 2,
Study Design and Study Area: This was a cross- dissatisfied as 1. The score obtained by the indoor patient
sectional study based on a descriptive survey design were arbitrarily categorized into three levels -: Satisfied
conducted in a tertiary care center situated in the rural (>75%), partially satisfied (50-75%), Dissatisfied
area of northern India. The hospital is a center for (<50%).
undergraduate and postgraduate medical teaching and
has an operational strength of 940 beds. Patients are Reliability of the structured knowledge checklist and
mainly seen in the Outpatient Department causality Rating scale was computed using Kudar Richardson 20
unit and special clinics. It receives patients from within (KR-20) and Cronbach alpha method which was found
Haryana, and the neighboring states of India (Uttar 0.83 and 0.80 respectively. The tool was found valid,
Pradesh, Himachal, Punjab, and Chandigarh). The reliable, and feasible for the purpose of the study. Both
majority of patients are indigenous Hindu, although tools were validated by 8 experts in the various nursing
the Muslim and Sikh ethnic groups also constitute a fields. An interview technique was used to collect the
substantial proportion of the clientele. Clients with data of the present study.
various occupational backgrounds like farmers, private,
Statistical analysis Collected data were entered
and govt. service holders, businessmen, etc get the
into Microsoft Excel software and data cleansing
benefit of services present over here.
was performed. Data were analyzed using SPSS
522 Medico-legal Update, January-March 2021, Vol. 21, No. 1
IBM Statistics version 20. Descriptive statistics were hospital 32.4% admitted in private hospitals previously
generated using mean, standard deviation (SD), and 19.7% admitted in government hospitals. More than
frequency, and percentages. Analytical statistics like half(68.8%) have less than 2 visits in hospital previously
correlation coefficient and Chi-square test was used to and, 3.9% has more than 4 visits. Nearly half number of
see correlation and association. The value of P < 0.05 patients, (42.4%) had 1-4 days length of stay and, 9.7%
was considered statistically significant. had more than 12 days length of stay in the hospital.
Figure 1: Bar Graph Showing the Percentage of Level of Satisfaction among Indoor Patients Regarding
Physician Services and Basic Services
Item wise distribution of level of satisfaction Among these, “gave follow up instructions to the patient
among patients regarding physician services: Results properly” was found 78.2% ranked 1st, “favoured
reveal the frequency, percentage and rank order of level patients over other.” was found 50.6% ranked lowest as
of satisfaction regarding various physician services. shown in table no. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 523
Table No. 1: Item Wise Distribution of Level of Satisfaction among Patients Regarding Physician Services
N=330
Item wise distribution of level of satisfaction of satisfaction regarding basic services which further
among patients regarding basic services: Findings include OPD services, Diagnostic services, Admission
reveal the frequency, percentage and rank order of level and discharge services.(as shown in table no. 2,3,4).
Table No. 2: Item Wise Distribution of Level of Satisfaction among Patients Regarding Provision of OPD
Services N=330
Table No. 3: Item Wise Distribution of Level of Satisfaction among Patients Regarding Provision of
Diagnostic Services N=330
Table No. 4: Item Wise Distribution of Level of Satisfaction among Patients Regarding Provision of
Admission Discharge Services N=330
Item wise distribution of satisfaction among ranked lowest as hospital is not having laundry facility
patients regarding Laundry & food services and for washing personal clothing.
Drug availability and administration: Frequency,
percentage and rank order of satisfaction regarding For Drug availability and administration, item wise
Laundry and food services reveals that satisfaction for distribution of satisfaction revealed that Patients were
“Hospital food facility for patients (75.2%), Availability highly satisfied with “Administration of drug on right
of clean bed sheets, Pillow and Blanket ranked (60%) patient at right time (69.1%)” whereas “Free of cost
ranked first and 2nd respectively whereas “Availability availability of drugs (16.7%)” found at lowest rank.
of laundry for washing personal clothing (33.4%)”
Medico-legal Update, January-March 2021, Vol. 21, No. 1 525
A significant low positive correlation was found Findings of our study revealed that satisfaction for
between mean knowledge and satisfaction scores of “listening the problem told by patient” was found 64.8%,
indoor patients regarding nursing services and physical more than half patients (64.5%) were satisfied with
infrastructure as evident by computed ‘r’ value of (0.38). waiting area with sitting arrangements in OPD area where
as very less patients were satisfied with cleanliness of
Chi square value showing the association of toilets(33.5%), These results were found to be consistent
knowledge score regarding availability of health with the study conducted byAntenehAsefa(2014)reveals
care services of hospital with selected sample that according to71% patients, health care providers
characteristics: Results of Chi square association were very polite with patients, 64%said that there
indicates that type of family (10.47) and present medical was convenient environment to ask question/s, 66%
conditions (5.99) was found statically significant at 0.05 were satisfied with comfort of waiting area28. Study
level which indicate that rate of scoring of knowledge result also coincide with another study conducted by
was dependent on type of family and present medical Kumari R, according to this less than half patients were
condition, as most of the patient who belonged to joint satisfied with availability (44.7%) andcleanliness of the
family have more level of knowledge as they received toilets (31.3%), for availability of seats in waiting area
information from family members and their relatives satisfaction rate was high(81.4%)8
and the patient with acute illness were more oriented and
able to receive information regarding available health Findings of our study further revealed that more
care services. than half (79.1%) patients were satisfied with Sample
collection in Laboratory, according to 57.6% patients,
The finding also revealed age, gender, religion, admission process was satisfactory. Hospital food
marital status, education, occupation, family income per facility was satisfactory for 75.2% patients. 69.1%
month, number of visits, previous hospitalization was found “Administration of drug on right patient at right
found statistically non significant at 0.05 level. time” process acceptable. These results were found to
Chi square value showing the association of be consistent with the study conducted by Bishwalata R
satisfaction score regarding availability of health (2020), findings reveals that (51.7%) found the waiting
care services with selected sample characteristics: A time and admission procedures acceptable, around
chi square association with level of satisfaction indicates 55.7% patients said that they always received medication
that Religion (20.96), occupation (9.79), and type of in a timely manner. For 37.2% of the patients, all
hospital (6.48) were found statistically significant at 0.05 scheduled investigations were not done in the hospital.
levels which indicate that satisfaction was dependent (24.9%)expressed dissatisfaction with the quality of the
on religion, occupation and type of hospital previously foodserved.29
admitted. The findings also revealed that age, gender, Ethical Clearance: Taken from Maharishi
type of family, marital status, education, family income Markandeshwar University institutional ethical
per month, number of visits, previous hospitalization committee.
was found statistically non significant at 0.05 level.
References
Discussion
1. Maxwell RJ. Quality assessment in health. Br Med
Results of our study shows that 76.4%patients J (Clin Res Ed). 1984. 288:1470-72.
have overall satisfaction regarding physician services.
2. Haddad S, Fournier P, Machouf N, Yatara F. What
Among these, “gave follow up instructions to the patient
does quality mean to lay people? Community
properly” was found 78.2% ranked 1st, these results
perceptions of primary health care services in
were found to be consistent with the study conducted
Guinea. Soc Sci Med. 1998. 47: 381-94.
by Kumari R to determine the areas and causes of low
satisfaction among the patients and suggest method for 3. Kumari Priyanka, Neetu, Rani Manisha. Satisfaction
improvement. Result shows that the overall satisfaction of women regarding availability of maternal and
regarding the doctor-patient communication was more child health services in community health centre,
than 60% at health care facilities but for examination ambala haryana, India. World Journal of Pharmacy
and consultation by physician was less than 60%27 and Pharmaceutical Sciences.2017; 6: 962-70
4. Rapert MI, Babakus E. Linking quality and
526 Medico-legal Update, January-March 2021, Vol. 21, No. 1
performance. Quality orientation can be a Agarwal M, Singh SK. Study on Patient Satisfaction
competitive strategy for health care providers. J in the Government Allopathic Health Facilities
Health Care Mark. 1996; 16:39-43. of Lucknow District, India. Indian J Community
5. Gombeski WR Jr, Miller PJ, Hahn JH, Gillette Med. Jan 2009; 34(1): 35–42. doi: 10.4103/0970-
CM, Belinson JL, et al. Patient callback program: 0218.45372: 10.4103/0970-0218.45372
a quality improvement, customer service, and 9. Anteneh Asefa1, Andargachew Kassa, Muluken
marketing tool. J Health Care Mark.1993; 13:60-5. Dessalegn.Patient satisfaction with outpatient
6. McKinley RK, Roberts C. Patient satisfaction with health services in Hawassa University Teaching
out of hours primary medical care. Qual Health Hospital Southern Ethiopia.Journal of Public
Care. 2001; 10: 23-28 Health and Epidemiology.February 2014; Vol.
6(2): 101-110.doi: 10.5897/JPHE2013.0613
7. Al-Emadi N, Falamarzi S, Al-Kuwari MG. Patients’
satisfaction with primary health care services in 10. Rajkumari B, Nula P. Patient’s satisfaction with
Qatar. Middle East J. Fam. Med.2009; 7: 4-9 care in a government health facility in North East
India: A cross-sectional study. J Med Soc 2017;
8. Kumari R, Idris MZ, Bhushan V, Khanna A,
31:94-8.
DOI Number: 10.37506/mlu.v21i1.2365 Medico-legal Update, January-March 2021, Vol. 21, No. 1 527
Abstract
Background and Purpose: Due to the vast spread of coronavirus, the lockdown has been announced in
many countries, and hence many people are facing psychological, physical, economic and social issues. It
has targeted all the population but this study focuses on the increased amount of perceived stress on women
who are undergoing work from home pattern of occupation.
Methodology: Sample comprised of 110 working women. The structured questionnaire, Perceived Stress
Questionnaire, was circulated through online google forms. Along with stress, demographic sheet was used
to study stress in working women due to lock down.
Result: The outcome, view of the respondents based on feeling of anxiety of working ladies was classified
into 3 categories (Mild, Moderate, Severe) and range. 7 persons of respondents are in 0.01 - 0.40 range i.e.
6.36%, 101 persons of respondents are in 0.40 – 0.70 range i.e. 91.81%, 2 persons of respondents are in
0.70 – 1.00 range i.e. 1.81%.
Conclusion: In this investigation we found that a large population of the females are under moderate pressure
and are overstressed while carrying out work from home.
Keywords: Stress, PSQ (Perceived Stress Questionnaire), COVID 19, Lockdown, coronavirus.
arranged into three classifications. Table 4.1 shows that Total 110 99.9
out of 110 respondents, 81% are in the age gathering of
30-40, 14.4% are in the age gathering of 40-50, 4.5% are
in the age gathering of 50-60.
Table 2: Mental and physiological side effects of worry among working ladies in Lockdown
Table 2 shows the consequence of information Table 4: Stress Level of Working Women
gathered from 110 respondents based on mental and
physiological manifestations of worry among working Description Range Person Percentage (in %)
ladies. 13.63% respondents said that they feel rested Mild 0.01-0.40 7 6.36
because of stress, while 68.18% said that occasionally Moderate 0.40-0.70 101 91.81
and 15.45% feel regularly and 2.72% normally. 3.63% Severe 0.70-1.00 0 1.81
respondents said that they typically feel issue of quiet.
Total 110 99.9
Table 3: Qualification of women
Table 4 shows the outcome, view of the respondents
Number of Percentage based on anxiety of working ladies. It is arranged into
Qualification
women (in %) 3 classes (Mild, Moderate, Severe) and go. 7 man of
Teacher 45 40.9 respondents are in 0.01 - 0.40 territory and 6.36%, 101
Engineer 18 16.3
man of respondents are in 0.40 – 0.70 territory and
91.81%, 2 man of respondents are in 0.70 – 1.00 territory
Private limited company 30 27.2
and 1.81%.
Other service(s) 17 15.4
Total 110 100 Discussion
Table 3 shows the view of the respondents based on In the current investigation, while the privately
their capability. It is characterized into 4 classes. 40.9% settled working women uncovered more satisfaction than
of respondents are instructors, 16.3% of respondents are working women, the past scored lower on certainty (both
engineer, 27.2% of respondents are private constrained saw and socially observed), which shows that working
organization and rest 15.4% have other expert help. from home could be both liberating and restricting.
Though privately arranged working ensured versatility,
530 Medico-legal Update, January-March 2021, Vol. 21, No. 1
it impacted the women’s needs to develop themselves reasons of pressure and to bargain with them however
full-time into their callings, harden their financial self- to empower solid work and diminished dangerous parts
rule and not wait behind their companions, which were of work. Instructive establishments need toconsider the
as strong as that of their working accomplices (Rani, requests of adjusting worry among working ladies to
1976). It was found that family stress, family difficulty, make nature increasingly steady, which will be useful
and work-family work over-trouble can transform into to hold gifted, able and experienced working ladies.
a grave issue for the working woman and can have a The board must work for preparing and instructing,
negative impact upon her general prosperity, work coaching, consistent picking up, directing, open doors for
execution, and occupation satisfaction.4 An investigation profession improvement, procedures of time the board to
on data innovation area working ladies which utilized deal with their outstanding task at hand at home along
authoritative job pressure scale detailed higher feeling with work spot to inspire them to take higher duties.
of anxiety as the age expanded, a finding rather than our The fundamental discoveries of the study show that all
examination. To restrict the apprehension issue, there the respondents have trouble because of individual and
should be a fine agreement between the quality and whole hierarchical sources. Dealing with the everyday home
of information one needs to extend. Information from exercises, kid care and caring for the family individuals
unconfirmed sources and web-based life stages make are the central point which cause trouble among the
sure to cause furious and make you annoyed. Obliging working school ladies.1
on the web life use can in like manner be a guide to our
mind and enthusiastic health.19 This examination shows Ethical Clearance: Taken from University Ethical
that high paces of depression, anxiety, insomnia and Committee.
perceived pressure, with young ladies having higher Source of Funding: Self
chances of embracing a psychological well-being
result. These results were related with various COVID- Conflict of Interest: Nil
19-related hazard factors, including being under
isolate, having a friend or family member perished by References
COVID-19, the working movement stopped because 1. Sharma B, Nair M. A qualitative study on causes
of lockdown gauges, or encountering other upsetting and effects of stress among working women in
occasions (for example working, budgetary, relationship management colleges in Jaipur. International
or lodging issues) because of the pandemic or lockdown Journal of Current Advanced Research. 2015:(152).
measures.20
2. MAMTA PARASHARA, MITASHA SINGHA,*,
Limitations of the study: JUGAL KISHOREB, RAMBHA PATHAKA,
MEELY PANDA. Prevalence and correlates of
1. Small sample size
stress among working women of a tertiary health
2. Study was for a short span of time center in Delhi, India (FEBRUARY 2017) (1)
3. The study was only a one-time survey 3. PROF. PARUL TRIPATHI*; PROF. SANDEEP
BHATTACHARJEE** A STUDY ON
Recommendations: PSYCHOLOGICAL STRESS OF WORKING
1. This study can be performed on a larger sample size WOMEN Vol.2 Issue 2, February 2012, ISSN 2231
5780 (434(1))
2. The duration of the study can be longer
4. MALAVIKA DESAI, BISHAKHA MAJUMDAR,
Conclusion TANUSREE CHAKRABORTY, KAMALIKA
GHOSH Working women in INDIA, https://doi.
Work related pressure is a major task for working
org/10.1108/17542411111164920 (2011) (432)
ladies in the lockdown. As quantities of working ladies
are expanding in training area, they need to manage 5. Panigrahi A, Padhy AP, Panigrahi M. Mental health
difficulties like long working hours, job challenges, status among married working women residing in
lack of oversight, poor relationship with partners, Bhubaneswar City, India: a psychosocial survey.
remaining task at hand, role struggle, lack of chance BioMed research international. 2014;2014.
for development and progression and occupation 6. PRIYANKA PULLA, Covid-19: India imposes
disappointment. Also, it isn’t just critical to distinguish lockdown for 21 days and cases rise, BMJ
Medico-legal Update, January-March 2021, Vol. 21, No. 1 531
2020;368:m1251 doi: 10.1136/bmj.m1251 14. World Health Organization. Mental health and
(Published 26 March 2020) (1) psychosocial considerations during the COVID-19
7. Lippi G, Henry BM, Bovo C, Sanchis-Gomar outbreak, 18 March 2020. World Health
F. Health risks and potential remedies during Organization; 2020
prolonged lockdowns for coronavirus disease 2019 15. Lu J. A New, Simple Projection Model for
(COVID-19). Diagnosis. 2020 May 26;7(2):85-90.. COVID-19 Pandemic. medRxiv. 2020 Jan 1.
8. Kumari V. Problems and challenges faced 16. Bakshi P, Kochhar V. A Study and Evaluation of
by urban working women in India (Doctoral Stress Role on Faculty: An Analysis of Professional
dissertation).2014 (8) Institutions in Haryana. International Journal of
9. Patel PA, Patel PP, Khadilkar AV, Chiplonkar Research in IT & Management. 2012;2(6):71-9.
SA, Patel AD. Impact of occupation on stress and 17. Patel PA, Patel PP, Khadilkar AV, Chiplonkar
anxiety among Indian women. Women & health. SA, Patel AD. Impact of occupation on stress and
2017 March (2) anxiety among Indian women. Women Health.
10. Pratheep S, Dharmaraj A. An empirical study on 2017;57(3):392‐401. doi:10.1080/03630242.2016.
stress levels among working women in export 1164273
oriented units of Tirupur district. Man In India. 18. Melchior M, Caspi A, Milne BJ, Danese A, Poulton
2016 (3079) R, Moffitt TE. Work stress precipitates depression
11. Kurina LM, Schneider B, Waite LJ. Stress, and anxiety in young, working women and men.
symptoms of depression and anxiety, and cortisol Psychological medicine. 2007 Aug.
patterns in working parents. Stress and Health: 19. Patnaik NM, Maji S. Psychological Issues and
Journal of the International Society for the Stress on People in the Purview of COVID-19
Investigation of Stress. 2004 Apr;20(54). Pandemic Lockdown.2020 May (39)
12. Kermane MM. A psychological study on stress 20. Rossi R, Socci V, Talevi D, Mensi S, Niolu C,
among employed women and housewives and Pacitti F, Di Marco A, Rossi A, Siracusano A, Di
its management through progressive muscular Lorenzo G. COVID-19 pandemic and lockdown
relaxation technique (PMRT) and mindfulness measures impact on mental health among the
breathing. J PsycholPsychother. 2016 Jan (1). general population in Italy. An N= 18147 web-
13. Brantley PJ, Dietz LS, McKnight GT, Jones GN, based survey. medRxiv. 2020 Jan 1.
Tulley R. Convergence between the Daily Stress
Inventory and endocrine measures of stress. Journal
of consulting and clinical psychology. 1988 Aug;
(549).
532 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2366
Abstract
Socio-cultural elements may affect someone to follow or leave a behavior. Cultural values in the Bima
District-West Nusa Tenggara Province community that are in line with health behavior are the cultural
values called “Maja Labo Dahu/MLD”, “Maja” means self-aware and “dahu” means carefulness. This study
aims to determine the effect of integrating the cultural value of “MLD” and health education toward the
intention of high school student to stop smoking in Bima district . This study is a quasy experiment with
pre-post-test with control group design with purposiv sampling on 60 students of 5 Senior High School in
Bima district. Self report was used to analyze the intention to stop smoking. Data analysis was examined by
using Pairred T-Test. The results showed 86.7% had strong intention to stop smoking and 13.3% had weak
intention. The mean standard pre-post deviation in the treatment group was 4,633 ± 8,046 with a p-value
<0.001. It can be concluded that there was a significant effect of interventions integrating MLD cultural
values and health education toward the intention of student to stop smoking. Therefore, “Smoking session”
efforts are required by considering elements of local culture and family resources.
Table 1. Characteristics of age and Risk Factor CVD Based on history of Alcohol use and family smoker
Based on Groupbased on group (n = 60)
Based on the data in table 1 all respondents with behavior 30% had tried and used alcohol and 53.3% had
an average age of 16 years (age range 15-18 years). families smoked.
CVD risk in the treatment group: based on alcohol use
534 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2. The intension of quitting of smoking before and after giving education on treatment and control
group (n = 60)
Based on table 2. in the treatment group before education there were still 4 (13.3%) with intention to
MLD education showed that 12 people (40%) had less quit smoking less smoking and 26 people (86.7%) with
intention to stop smoking and 18 people (60%) had good smoking cessation intentions.
good smoking cessation intentions whereas after MLD
Table 3. Distribution of mean the intension quit smoking of smoker student before and after giving
education on treatment and control group in DISTRICT of Bima (n = 60).
The intension quit smoking Mean,SD Min-Max Mean pre-post, SD 95% CI p-value
Treatment Group
• Pre 76.27±5.452 65-88 74.23 – 78.30
4.633±8.046 <0.001
• Post 80.85±6.063 60-90 78.47 – 83.00
Control Group
• Pre 76.21±6.772 63-88 73.81-78.61
4.467±6.425 0.005
• Post 80.73±6.379 56-91 78.59-83.11
Based on table 3, it shows that the difference in for health promotion of adolescents who have/just started
the mean of the first and second measurements in the smoking. Thus, it is the basis for the need of literacy to
treatment group is 4,467 with a standard deviation of bring up the intention to quit smoking. In line with the
8.046. The p-value is< 0.001, so it can be concluded research of Akmal, et al., 2016 in high school students
that there is a significant difference between pre and in the district of Bima entitle “Attitudes Influencing the
post education measurements in groups that get health Intention to Stop Smoking in High Schools students
education integrated with MLD cultural values. in the district of Bima” which suggest the need some
efforts to prevent risk behaviors or change risk behaviors
Discussion into health-supporting behaviors including through
In this study, risky behavior in intervened adolescents education especially in adolescents/adolescence. This
is smoking behavior by integrating the cultural values becomes important in the long-term preventive efforts
of MLD and health education “No smoking” so that it that continue to be sustainable and synergize with
is expected that adolescents have the knowledge and programs that support health and consider local cultural
awareness which further becomes a stimulus and has a value elements.
strong intention to stop smoking. Findings The results of The results of the bivariate analysis of the intention
this study indicate that integrated health education with to quit smoking before the MLD education of adolescents
local cultural values in this case MLD cultural values with the intention to quit smoking less as much as 40%
have a significant influence on the strong intention to while after the MLD education decreased to 13.3%
stop smoking in high school students in the district of compared to the control group before the education of
Bima. This study is as relatively same as the results of adolescents with the intention to quit smoking less as
Herawati, et al., 2017 research which suggests the need much as 46.7% while after education decreased to 30%.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 535
This shows that although there was a similar decline, 7.
epidemics The age of first smoking at the age of 16-
there were more smokers in the treatment group who had 18 years, significantly increases the risk of the incidence
stronger smoking cessation intentions than in the control of hypertension independently (people who smoke for
group. This means that health education integrated with the first time at the age of 16-18 years will immediately
the local cultural value of “MLD” which is the cultural become regular smokers, ie people who smoke at least 1
value of the Bimanesse society influences the emergence cigarette/days, not smoking anymore as a trial and error.
of intentions and increases motivation to quit smoking. According to the results of research that shows that as
In accordance with the results of research that a person much as 51.3% of CVD sufferers mostly start smoking
will follow or leave a behavior influenced by socio- at the age of adolescents. Based on these findings it is
cultural elements and a strong intention to stop smoking necessary to implement policies to promote healthy
is influenced by subjective norms that are believed by lifestyles in children and adolescents is very important
individuals4. for the prevention of CVD Healthy behavior is learned
from childhood and continues into adulthood8.
Based on the Big Indonesian Dictionary/KBBI
published by the Ministry of National Education, In addition, it is necessary to strive to increase
being ashamed means feeling very uncomfortable the role of the government in carrying out a strategy
(despicable, inferior, etc.) for doing something that is of cultural approach that is safe and acceptable to the
not good (not right, different from the habit) and afraid community9 and working with educational institutions
that can be interpreted as piety; reluctant, not brave and increasing the accessibility of adolescents to health
(doing something that is not appropriate6. The meaning promotion programs carried out using community
according to KBBI is in line with the meaning of the approaches in educational institutions that proven to
word MLD in the Bimanesse society. The word “Maja” have a positive effect on changes in adolescent health
means shame and “Dahu” means Afraid. If we review behaviors10. The results of other studies indicate that
the above words semantically or meaningfully, “Maja” Fear and Embarrassment or “Maja Labo Dahu” are
(shame) means that people or people of Bima will be values that need to be integrated in Education teaching
ashamed when doing something outside of God’s materials. This will complement each other’s successful
corridor, whether it is crime, sin, etc. whether related to educational process in schools5. In the end all of the
humans or to God. “Dahu” (afraid), almost have the same above efforts are expected to have a positive effect with
interpretation process as the word Shame. Equally afraid changes in adolescent health behavior.
when committing a crime or badness. In adolescent
smokers who get integrated health education states that Conclusion
education with a health hazard approach to the effects Integrated the cultural values “MLD” and health
of smoking alone is not enough to sensitize because of education about the dangers of smoking affect the
a sense “Excessive confidence” in his health status and strong intention to stop smoking in high school students.
adolescent age, so an additional approach cultural values Integrated and programmed education based on local
as general values that apply in social life and society are cultural values in high school as an effort to initiate the
more easily accepted and obeyed. intention to quit smoking influences giving stronger
Characteristics of smoking behavior in this study stimulation to increase smoking cessation intention so
83.3%, were active smokers in the last 6 months with as to then can encourage efforts to to Intention Quit
the age of the firstly smoking started at the age of 10 Smoking and avoid risky behavior among adolescents.
years -14 years and 16.7% started smoking at the age Continued efforts are needed in the literacy of the
of less than 10 years. This is consistent with the results prevention of smoking behavior in adolescents at an
of research related to smoking behavior in Indonesia earlier age level (elementary school and junior high
according to the Global Youth Tobacco Survey/GYTS, school) taking into account local cultural elements and
(WHO, 2015) that every year there are 16.4 million the resources available at school.
new smokers age between 10 and 19 years. So efforts Acknowledgement: Acknowledgments for the
to reduce the number of teenage smokers, prevent new advice and input of the expert team of the Health
smokers and educate young people about the effects Polytechnic research unit of the Ministry of Health of
and dangers of smoking are very important to save Mataram and to all those who have contributed morally
Indonesia’s future generations from cardiovascular and materially, which we are really appreaciated.
536 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Source of Funding: This research supported 5. Departemen Pendidikan Nasional. (2008). Kamus
by financial assistance from the Ministry of Health Bahasa Indonesia. Departemen Pendidikan
PPSDM RI through the Ministry of Health of the Health Nasional. Jakarta.
Polytechnic of Mataram. 6. Tan YL. and Dorotheo U. (2018). The Tobacco
Control Atlas: ASEAN Region, Fourth Edition,
Ethical Consideration: This study has received
September 2018. Southeast Asia Tobacco Control
Ethical approval from the Mataram University
Alliance (SEATCA), Bangkok. Thailand.https://
Health Research Ethics Committee No: 207/UN18.8/
seatca.org/dmdocuments/SEATCA/2018.pdf
ETIK/2019.
7. Mendis, S., Puska, P., Norrving, B., (2011).Global
Conflict of Interest: Nil Atlas on Cardiovascular Disease Prevention and
Control. World Health Organization, Geneva 2011.
References https://www.ncbi.nlm.nih.gov/pubmed/30301680.
1. WHO. (2015). Global Youth Tobacco Survey DOI:10.1016/j.gheart.2018.09.511
(GYTS): Indonesia report 2014. Who-Searo. 8. AN Maulidya, D Ayuningtyas (2018). Availability,
https://doi.org/http://www.searo.who.int/tobacco/ Accessibility, And Acceptability of Health Services
documents/ino_gyts_report_2014.pdf In Remote Indigenous Community of the Baduy
2. Thomas, H., Diamond, J., Vieco, A., Chaudhuri, Dalam Tribe. Indian Journal of Public Health
S., Shinnar, E., Cromer, S.,Moran, A. E. (2018). Research & Development 9 (12), 513-518
Global Atlas of Cardiovascular Disease 2000- 9. Minary L, Cambon L, Martini H, et al. Efficacy of
2016: The Path to Prevention and Control. Global a smoking cessation program in a population of
Heart, 13(3), 143–163. https://doi.org/10.1016/j. adolescent smokers in vocational schools: a public
gheart.2018.09.511 health evaluative controlled study. BMC Public
3. Herawati, L., Budiman, J. A., Haryono, W., & Health. 2013;13:149. Published 2013 Feb 18.
Mulyani, W. (2017). Jayapura Teenagers Smoking doi:10.1186/1471-2458-13-149.
Behavior. Journal of Community Health, 42(1), 10. Munir, A. (2018). Integrasi nilai-nilai budaya bima
78–82. https://doi.org/10.1007/s10900-016-0232-4 dalam bahan ajar pendidikan islam, 329–340.
4. Dzul Akmal, Bagoes Widjanarko, P. N. (2017).
Sikap Mempengaruhi Niat Berhenti Merokok pada
Remaja SMA di Kota Bima, 12.
DOI Number: 10.37506/mlu.v21i1.2367 Medico-legal Update, January-March 2021, Vol. 21, No. 1 537
Maygi Restu Yang Esa1, Muhammad Baharuddin Wisudawan Putra2, Diyah Werdiningtyas, S.Gz3
1
Undergraduate Student in Department Health Policy and Administration, Faculty of Public Health, Universitas
Airlangga, Surabaya, Indonesia, 2Undergraduate student in Department Health Promotion and Behavior, Faculty
of Public Health, Universitas Airlangga, Surabaya, Indonesia, 3Government employees in Sub Sector of Health
Promotion and Community Empowerment, Field of Public Health, Health Department of East Java Province,
Indonesia
Abstract
Islamic boarding schools (Pesantren) are Islamic educational institutions in Indonesia. The Ministry of
Health of the Republic of Indonesia has launched a concept to encourage people to care about their health,
namely the Clean and Healthy Behavior (PHBS). Islamic boarding schools also have health problems so
they need attention in efforts to improve public health. The health effort undertaken at the Pesantren is
Poskestren (Pesantren Health Care). Based on the Health Department Data of East Java Provincial (2019),
there are 3,965 islamic boarding schools with 1,284 Poskestren in East Java province. Poskestren can be a
solution in solving health problems in Pesantren. Therefore the Poskestren must be arranged properly. In
health promotion there are health promotion strategies which consist of advocacy, community development,
community empowerment and partnerships. This health promotion strategy can be a reference in the
implementation of the Poskestren in Pesantren.
Figure 1. Number of Pesantren and Poskestren in District/City in East Java Province in 2019
Figure 1 shows that not all pesantren have classification is the Poskestren which has a value of one
Poskestren. This shows that health efforts in Pesantren to five. The second classification is the Poskestren which
in each region have not been running optimally. For has a value of six to ten. The third classification is the
example in Sampang District which has 475 Pesantren Poskestren which has values of eleven to fifteen. And the
but only has 75 Poskestren (15.79% of the total number fourth classification has a value of sixteen to eighteen.
of Pesantren). Following are the success rates in (%) of the Poskestren
assistance program for improving the classification of
PHBS scores were collected to find out the Poskestren PHBS in East Java Province in 2019:
classification. There are four classifications. The first
Medico-legal Update, January-March 2021, Vol. 21, No. 1 539
Figure 2. The Success Rate of the Poskestren Assistance Program Against PHBS in East Java Province
in 2019
Figure 2 shows that there are 12 districts or cities health in the pretty good category (63%), and health
that have increased PHBS by 100% with the Poskestren the social category is quite good with a percentage of
Assistance Program. There are only two districts or 43.8%.(10) Therefore, every Pesantren needs to establish
cities that have not reached a success rate of 50%. The a Poskestren because if the Poskestren is run well, the
processed data shows that the data are not normally health of the santri will improve, especially at the level
distributed (sig 0.0000 <α 0.05) so that the difference of implementation of the Clean and Healthy Behavior
test for two Non Parametric Paired samples (Wilcoxon (PHBS) of the santri.
Test) is used. The Wilcoxon test results are sig 0,000
<<α 0.05. It can be concluded that there are differences in Poskestren is present as one of the health promotion
Clean and Healthy Behavior (PHBS) between before the strategies in Pesantren. However, the existence of the
Poskestren Assistance Program and after the Poskestren Poskestren cannot guarantee that PHBS in the pesantren
Assistance Program. This shows that the assistance is good. A strategy is needed to run the Poskestren. The
program for Poskestren was effective and succeeded in strategy in question is a health promotion strategy.
increasing PHBS in Pesantren. Health promotion strategies are based on the
complexity of the nature of people’s behavior. Based on
Discussion the Decree of the Minister of Health No. 1114/MENKES/
Poskestren as a Health Promotion Strategy in SK/VII/2005 concerning Guidelines for Implementing
Pesantren: There is a relationship between the role Health Promotion in the Regions, health promotion is
of the poskestren and the Personal Hygiene behavior an effort to increase the community’s capacity through
of adolescent santri in Al-Ghazaalie Islamic Boarding learning from, by, for and with the comunity, so that
School Kranjingan, Sumbersari District, Jember District. they can help themselves, and develop community-
(3)
. But there are also many other factors that influence based activities, in accordance with local socio-culture
this behavior. and supported by health-oriented public policies.
Another study said that the health status of santri To achieve the above objectives, the health
in a Pesantren that has a Poskestren is in a fairly good promotion strategy implemented at the Poskestren
category consisting of three health sub-variables namely contains four aspects.
physical health in the good category (100%), mental
540 Medico-legal Update, January-March 2021, Vol. 21, No. 1
1. Advocacy: Advocacy is an approach and motivation Menkes/Per/XI/2011 concerning Guidelines
towards certain parties which is calculated to be able for the Development of Clean and Healthy
to support the successful development of PHBS both Behavior (State Gazette of the Republic of
in material and non material aspects. The parties Indonesia Number 755, 2011) which states that
involved are both formal and informal community Pesantren are one of the targets of PHBS in
leaders who generally act as resource persons educational institutions.
(opinion leaders), or policy makers (norms) or
5. The program issued by the Governor of East
funders. Other certain parties can also be in the form
Java in the form of SAJADAH which is an effort
of society or mass media that can create a conducive
to assist Poskestren in East Java Pesantren.
atmosphere, public opinion and encouragement of
the creation of community PHBS. 2. Social Support: Community development is an
effort to create a social environment that encourages
The factors influencing the success of the poskestren
individuals in community members to want to
were knowledge, participation, motivation & support,
do the behavior that is introduced. Individual
leadership, community potential, cooperation, and
community members will be more motivated to
policy.(7) While the failure factors in the Poskestren
engage in introduced behavior if community leaders
program were weak community participation and
or influential people in the environment approve or
the emergence of a dependency towards the Ministry
support the introduced behavior.
of Health assistance and District Health Office. This
shows that Poskestren’s internal commitment and To achieve the objectives of fostering and enhancing
external support for Poskestren affect the success of the functions and performance of the Poskestren,
the Poskestren itself. the Puskesmas carries out several activities as the
person responsible for the Poskestren in its area. The
Policy is an example of the commitment of policy
puskesmas started the formation of the Poskestren
makers in an issue. Some regulations have been
by coordinating with the leaders or managers of
established by the government in the procurement
the Pesantren to approach it. This approach aims
of Poskestren as an effort to improve the degree
to prepare members of the pesantren so that they
of public health, especially in the pesantren
are willing to support the implementation of the
environment.
Poskestren. Furthermore, the Self-Inspection Survey
Supporting regulations and policies include: (SMD) was conducted involving members of the
Pesantren. Puskesmas staff, and related stakeholders.
1. Regulation of the Minister of Health of the
The purpose of SMD is to recognize and identify
Republic of Indonesia Number 1 of 2013
health problems in the pesantren environment so
concerning Guidelines for Organizing and
that they can be considered in what interventions
Developing Poskestren which are guidelines for
to take. The Puskesmas will also provide guidance
implementing Poskestren.
and monitoring to help manage the Poskestren on a
2. Joint Decree of the Minister of Health, regular basis.
Minister of Religion, and Minister of Home
Improving services at the Poskestren must
Affairs Number 1067/Menkes/SKB/VIII/2002,
be based on the health needs of the pesantren
Number 385 of 2002, and Number 37 of 2002
community. Therefore there needs to be support
concerning Improvement of the Health of
for the availability and skills of the Poskestren
Pesantren and Other Religious Institutions
resources. The Puskesmas assisted with the
3. Joint Decree of the Minister of National Pesantren apparatus will also form a Poskestren
Education, Minister of Health, Minister of cadre called SantriHusada. SantriHusada together
Religion, and Minister of Home Affairs Number with the manager of the Poskestren who will later
1/U/SKB/2003, Number 1067/Menkes/SKB/ become the spearhead in moving the pesantren
VII/2003, Number MA/230A/2003, and community to care about health. This will be the
Number 26 of 2003 about the Development and embryo of empowering the Pesantren community
Development of School Health Enterprises. by developing and empowering the potential or
4. Minister of Health Regulation No. 2269/ resources of the Pesantren itself.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 541
Based on the Wilcoxon test it was stated that there enable the implementation of the Poskestren to be
were differences in PHBS between before and after even better.
the Poskestren assistance program (SAJADAH).
Partners from Poskestren can support the
This is consistent with a research that there is a
implementation of Poskestren by providing resource
significant relationship between self-sanitation and
assistance. The resources provided can be in the
environmental sanitation socialization innovations
form of financial resources, materials, information,
through poskestren with santri attitudes towards
coaching and training. Stakeholders who can be
sanitation.(11)Socialization of self and environmental
an opportunity to become a Poskestren partner
sanitation through poskestren is in the high category
include Government Agencies or Institutions such
where socialization provides knowledge about self
as ministries of religion and health, Community
sanitation and the environment for students. In
Leaders, Community Organizations/NGOs,
addition, socialization makes students more active in
Business or private sector and Universities.
implementing cooperation in maintaining personal
hygiene and the environment of the pesantren where The government as the policy maker can play a role
they live and study. in formulating health-oriented policies to support
health activities and programs in Pesantren. The
3. Community Empowerment: In health promotion,
government can also provide facilities in the form
community empowerment is a very important
of cross-sector meeting and discussion. This can
part. Empowerment is the process of providing
enable and assist Poskestren to establish broader
information to health promotion targets continuously
partners.
and continuously following the development of
targets, and the process of helping targets to change Community leaders and organizations involved
from not knowing to knowing (knowledge aspects), such as in the religious field can be a companion
from knowing to being willing (attitude aspects), to the Poskestren. Human resource assistance
and from wanting to be able (practice aspects) carry can help in health improvement programs run by
out the introduced behavior. Therefore success the Poskestren. This is because the Poskestren,
in empowerment is to make the target understand Pesantren and Community Leaders/Community
and realize that something (a health problem) is a Organizations have emotional closeness to the
problem for him and for the community so that it Pesantren community. So that health programs or
leads to the application of the introduced behavior. interventions carried out in solving health problems
can be received with an appropriate approach.
Poskestren can be a facility for pesantren communities
to obtain health information. Through the managers The business or private sector has obligations related
of the Poskestren and SantriHusada, information to social responsibility (CSR). Increasing the role of
can be given continuously and continuously. CSR can be an opportunity to improve the degree
This is because they live together directly so they of public health. Businesses or the private sector
understand the development of health problems in can be involved in health promotion efforts such as
Pesantren. Health information from the Puskesmas involvement and assistance with the implementation
and other health media is expected to be received of the Poskestren.
by the Poskestren Manager and SantriHusada which Higher education in Indonesia has Tri Darma Higher
can then be passed on to the Pesantren community. Education as its basic principle. One of the Tri Darma
The puskesmas will also conduct regular training of Higher Education is “Community Service”. The
with the aim of implementing the Poskestren role of tertiary institutions is very clear to be able
to provide information and intervention to the to make people equal in solving problems in their
pesantren community appropriately. environment. The academic community can help
4. Partnership: Partnerships must be promoted well the community through education and research to
in order to support the other three aspects of health develop solutions or appropriate interventions for a
promotion strategies. The partnership is based on the problem. This can be an alternative for Poskestren
principles of equality, openness and mutual benefit. to obtain information and human resources sources
Partnerships with other individuals or groups will in intervening in health problems in Pesantren.
542 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Mihyeon Seong
Abstract
The purpose of this study is to apply Q methodologies to identify and understand the type of successful aging
perception in nursing students. The study organized the Q population through in-depth interviews to select
21 Q samples that could represent the Q population by coordination with two professors and researchers
familiar with the Q methodology, and 49 nursing students were selected as P-samples. The data collection
was about three months from September 10, 2020 to September 17, 2020 and was analyzed using the PQ
Method Program. According to this study, nursing students perception of successful aging was divided into
four types: Type 1 “capitalism type,” Type 2 “Self-esteem type,” Type 3 “Adaptive type,” Type 4 “Stable
type”. As a result of this study, the four types of nursing students recognized health, leisure, economic
power, and self-esteem. This study, understanding of each type of subjective aspect should be enhanced,
and a wide range of insights should be provided so that nursing students can establish a value system of
humanity and nursing professions in the undergraduate program in the future. In addition, it is expected that
it will be used as a basic material for nursing education that can grow into a nurse who can meet the national
expectations as a health care manager for the elderly through education that can develop the ability to cope
with various problems faced in the nursing field.
5. In order to analyze the reasons for selecting Looking at this in detail, the statements of
consent items and non-consent items of each type, respondents with the second type of representativeness
546 Medico-legal Update, January-March 2021, Vol. 21, No. 1
(factor weight 1.0 or more) are as follows. Typical of Table 1. Q Statement
this type, P-30 (factor weight = .73) said, “It is important
to be confident without money. What can be envious Statement
of others in old age? It is important to have children’s 1. Live happily without worries.
success, a strong sex life, and a friend or spouse who can 2. There is no economic burden.
be with them when they need help or are bored.” 3. Have a job.
Through this, in this study, type 2 with these 4. There is no problem with sexual function.
characteristics was named’ self-esteem type’. 5. There are no special health problems.
6. Children succeed.
Type 3: Adaptive type: Type 3 subjects said that
adaptation according to the life cycle is important for 7. You have a good relationship with your spouse.
successful aging (Table 5). 8. I have a lot of friends around me.
9. Honor those around you.
In particular, they said that they should not be afraid
of changes due to aging, act at times, adapt and manage 10. There are self-owned houses.
even if there are changes in the body, and devise a plan 11. I have a hobby.
to live happily. 12. You look young.
13. A experienced people
Specifically, the statements of respondents with
the 3rd type of representativeness (factor weight 1.0 14. You can get a pension in the country.
or more) are as follows. The epitome of this type, P-24 15. I get along well with the younger generation.
(factor weight = .77), says, “I think it is necessary to 16. I am not afraid of challenges and failures.
adapt flexibly over time. Everyone is aging and cannot 17. I am not afraid of change.
reverse it. It is important to go in order.” Said. Through
18. Raising grandchildren.
this, in this study, type 3 with these characteristics was
named’ adaptive type’. 19. You can go on a trip.
20. You are managing chronic diseases well.
Type 4: Stable type: Type 4 subjects recognized
21. There is no memory loss.
that it is important to feel a sense of stability for
successful aging (Table 5). Table 2. General characteristics and factor weights
of P samples by type
They said that they need a family next to them in
their old age, hobbies and housing that can lead to a Factor Age
successful and stable life for the family. In particular, Type ID Religion
weights (yrs)
they did not have any dynamic changes in their life after Type1 P-1 0.46 20 Protestant
retirement, and they showed a tendency to want a quiet
(n=23) P-5 0.83 20 None
and comfortable life.
P-7 0.63 20 None
Specifically, the statements of respondents with P-9 0.69 20 Buddhism
the 4th type of representativeness (factor weight 1.0 or
P-12 0.76 21 Buddhism
more) are as follows. The epitome of this type, P-24
P-14 0.66 21 Protestant
(factor weight = .74), said, “I only have my own home
and retire, but I wish there was no change in life. I hope P-17 0.79 23 None
to maintain my current life and continue my happiness.” P-18 0.73 23 None
Said. Through this, in this study, type 4 with these P-19 0.73 23 None
characteristics was named’ stable type’. P-20 0.76 23 Catholic
P-21* 0.90 23 Catholic
P-22 0.59 23 None
P-32 0.57 23 Protestant
P-35 0.43 21 None
Medico-legal Update, January-March 2021, Vol. 21, No. 1 547
Z-score
Statement
Type 1 Type 2 Type 3 Type 4
1. Live happily without worries. 1.51 1.13
2. There is no economic burden. 1.65
3. Have a job. -1.65
4. There is no problem with sexual function. -1.08 1.87
5. There are no special health problems. 1.83 1.67
6. Children succeed. 1.33 -1.02 1.05
7. You have a good relationship with your spouse. 1.32 1.58
8. I have a lot of friends around me. 1.30
9. Honor those around you.
10. There are self-owned houses. 1.11
11. I have a hobby. 1.23
12. You look young. -1.52
13. A experienced people -1.18 -1.39
14. You can get a pension in the country. -1.99
548 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Z-score
Statement
Type 1 Type 2 Type 3 Type 4
15. I get along well with the younger generation. -1.33
16. I am not afraid of challenges and failures.
17. I am not afraid of change. 1.31
18. Raising grandchildren. -1.53 -1.02 -1.40
19. You can go on a trip. -1.15
20. You are managing chronic diseases well. 1.17
21. There is no memory loss. -1.34 -1.73
※ Blank is a statement with no significant standard score.
Abstract
Background: Periodontitis is an infectious disease in periodontal tissue and is able to cause a plaque that
contains bacteria on the teeth. These bacteria colonize the oral cavity, invade the periodontal tissue, and
attack the body’s host system. Indonesia has many floras and one of them is called Water hyacinth. This flora
is commonly known as waste because its abbility to pollute the environment. However, water hyacinth has
a useful material including alkaloids, flavonoids, and tannins that can be used as the antibacterial agents.
The study aims to determine the effect water hyancinth leaf extract (echiorniacrassipes) to the growth of
subgingival plaque bacteria colony. Method: The study was conducted by using serial dilution techniques
in the BHIB media with 100%; 50%; 25%; 12,5%; 6,25%; 3,125%; 1,56%; 0,78% concentrations and
planting on MHA medium. The analysis method in this study uses the Shapiro-Wilk Test, Levene’s Test, and
statistical tests with One-Way Anova.
Results: There are significant differences at the growth of sub gingival plaque bacteria. There is no growth
of subgingival plaque bacteriain groups of 100%; 50%; 25%; 12.5% and 6.25%. The growth of subgingival
plaque bacteria colonies was only seen at 3.125% concentration and increased the number of bacteria
colonies at a 1.56%.
Conclusion: Water hyacinth leaf extract was effective to inhibit the growth of sub gingival plaque bacteria
colonies.
Results
The results of this study can be seen from the number of subgingival plaque bacteriacolonies growth.
Table 1. The number of subgingival plaque bacteriacolonies given water hyacinth leaf extract
(Eicchorniacrassipes) at a concentration of 1,56%-100%
Concentrations 1 2 3
100% 0 0 0
50% 0 0 0
25% 0 0 0
12,5% 0 0 0
6,25% 0 0 0
3,125% 10 12 11
1,56% 31 30 33
Positive controls 149 151 152
Negative controls 0 0 0 Concentration
Based on the results of the study it can be seen multiple comparisons using Post-hoc TukeyAnova which
that there is no growth of subgingival plaque bacteriain concluded that all groups had significant differences.
groups of 100%; 50%; 25%; 12.5% and 6.25%. The
growth of subgingival plaque bacteria colonies was only Discussion
seen at 3.125% concentration and increased the number The results of the analysis showed that the number
of bacteria colonies at 1.56%. of colonies at a concentration of 3.125% had a significant
The measurement results are tabulated according to difference with the number of colonies at a concentration
each group sample and followed by testing the normal of 1.56% and positive control. Likewise, the number
distribution using the Shapiro-Wilk Test with Sig> 0.05. of colonies in the extract of water hyacinth leaves
It can be concluded that the data are normally distributed. concentration of 1.56% has a significant difference to
Afterward, the homogeneity testing using Levene’s the number of colonies in the positive control group.
Test with Sig. <0.05 can be concluded that the data This shows that the extract of water hyacinth leaves at
is homogeneous. Afterward, the statistical tests were a concentration of 3.125% and 1.56% has a fairly good
conducted using One-Way Anova at the significance antibacterial effect. The results of this study also showed
level of Sig. <0.05 and significant differences were a bactericidal effect of 6.25% where subgingival plaque
obtained. Finally, it then continued by performing bacterial colonies were completely invisible and the
Medico-legal Update, January-March 2021, Vol. 21, No. 1 555
inhibitory power was best at a concentration of 3.125%, Source of Funding: This study is done with
where the subgingival plaque bacteria could grow at individual funding
minimal number. This is due to the presence of bioactive
substances in water hyacinth leaves which have been References
studied as antibacterial, andthe quantity of concentration 1. Engström M, Eriksson K, Lee L, Hermansson
that contains bioactive substances that play a role in M, Johansson A, Nicholas AP, et al. Increased
inhibiting bacteria. citrullination and expression of peptidylarginine
Based on scientific research stated that water hyacinth deiminases independently of P. gingivalis and
leaf extract contains alkaloids, flavonoids, and tannins A. actinomycetemcomitans in gingival tissue of
which are known to have antibacterial power that can patients with periodontitis. Journal of translational
inhibit bacterial growth10. The alkaloids contained in the medicine. 2018;16(1):214.
hyacinth leaf extract has antibacterial biological activity 2. Petersen PE. The World Oral Health Report 2003:
that can interfere with the constituent components of continuous improvement of oral health in the 21st
the bacterial cell that make the cell wall not formed and century–the approach of the WHO Global Oral
easily get lysed11. Antibacterial flavonoids has a working Health Programme. Community Dentistry and oral
mechanism that can interfere bacterial membrane epidemiology. 2003;31:3–24.
synthesis, and inhibits bacterial metabolism – which 3. Kinane DF, Stathopoulou PG, Papapanou PN.
can damage bacterial breeding pathways and damage Periodontal diseases. Nature Reviews Disease
bacterial membrane walls that will be followed by the Primers. 2017;3(1):1–14.
bacterial death13. This compound will also interfere 4. Ilgenli T, Vardar‐Sengul S, Gürkan A, Sorsa T,
with the energy metabolism in a similar manner to the Stackelberg S, Köse T, et al. Gingival crevicular
respiratory systembecause the energy demand for active fluid matrix metalloproteinase‐13 levels and
absorption of various metabolites andthe biosynthesis molecular forms in various types of periodontal
of macromolecules insufficient so that lead to bacterial diseases. Oral diseases. 2006;12(6):573–9.
dead14. Tannin known to has antibacterial activity
5. Silva N, Dutzan N, Hernandez M, Dezerega A,
related to their ability to form hydrogen bonds which
Rivera O, Aguillon JC, et al. Characterization
results in protein denaturation in the membrane so that
of progressive periodontal lesions in chronic
cells experience damage. Membrane damage causes the
periodontitis patients: Levels of chemokines,
fulfillment of nutrients needed by bacteria cannot be
cytokines, matrix metalloproteinase‐13, periodontal
achieved. This can be disrupted the bacterial metabolism
pathogens and inflammatory cells. Journal of
and reduce the bacterial energy15.
clinical periodontology. 2008;35(3):206–14.
Conclusion 6. Gursoy UK, Liukkonen J, Jula A, Huumonen
S, Suominen AL, Puukka P, et al. Associations
Water hyacinth leaf extract was effective to inhibit
between salivary bone metabolism markers and
the growth of sub gingival plaque bacteria colonies. So,
periodontal breakdown. Journal of periodontology.
it is expected to preserve the water hyacinth plant and
2016;87(4):367–75.
cultivate it.
7. Al-Bayaty FH, AI-Koubaisi AH, Ali NAW,
Ethical Clearance: The research process involves Abdulla MA. Effect of mouth wash extracted
participants in the survey using a questionnaire that was from Salvadora persica (Miswak) on dental
accordant with the ethical research principle based on plaque formation: a clinical trial. J Med Plant Res.
the regulation of research ethic committee. The present 2010;4(14):1446–54.
study was conducted in accordance with the research 8. Marsh PD, Moter A, Devine DA. Dental plaque
principles. This study implemented the basic principle biofilms: communities, conflict and control.
ethics of respect, beneficence, nonmaleficence, and Periodontology 2000. 2011;55(1):16–35.
justice.
9. Alzoreky NS, Nakahara K. Antibacterial activity
Conflict of Interest: There is no conflict of interest of extracts from some edible plants commonly
for all authors consumed in Asia. International journal of food
microbiology. 2003;80(3):223–30.
556 Medico-legal Update, January-March 2021, Vol. 21, No. 1
10. Muladi S. Kajian Eceng Gondok sebagai Bahan record.uri?eid=2-s2.0-85073549846 & doi=10.595
Baku Industri dan Penyelamat Lingkungan Hidup 8%2F0976-5506.2019.02044.8 & partnerID=40 &
di Perairan. In: Prosiding Seminar Nasional IV md5=5669a15aeaf32c85a7252aea2fdfc59e
Masyarakat Peneliti Kayu Indonesia (MAPEKI) 13. Roy R, Tiwari M, Donelli G, Tiwari V. Strategies
Samarinda. 2001. for combating bacterial biofilms: A focus on anti-
11. Retnowati Y, Bialangi N, Posangi NW. biofilm agents and their mechanisms of action.
Pertumbuhan bakteri Staphylococcus aureus pada Virulence. 2018;9(1):522–54.
media yang diekspos dengan infus daun sambiloto 14. Cushnie TPT, Lamb AJ. Recent advances in
(Andrographis paniculata). Sainstek. 2011;6(2). understanding the antibacterial properties of
12. Berniyanti T, Fardhani A, Palupi R, Bramantoro flavonoids. International journal of antimicrobial
T, Ramadhan D, Ramadhani A, et al. Effect agents. 2011;38(2):99–107.
of blood iron level on prevalence of recurrent 15. Sofiane G, Wafa N, Ouarda D. Antioxidant,
aphthous stomatitis (RAS) in traffic police officers. antimicrobial and anti-inflammatory activities of
Indian Journal of Public Health Research and flavonoids and tannins extracted from Polypodium
Development [Internet]. 2019;10(8):1103–8. vulgare L. Asian J Biochem Pharm Res. 2015;
Available from: https://www.scopus.com/inward/ 5:114–22.
DOI Number: 10.37506/mlu.v21i1.2370 Medico-legal Update, January-March 2021, Vol. 21, No. 1 557
Abstract
Background: A hernia is protrusion of a tissue or an organ such as omentum or bowel loops through a
defect in the weakened abdominal wall muscles . Amongst the various types of hernia, inguinal hernia is
the most commonest. The best modality of treating an inguinal hernia is surgery and hence most common
surgery done is inguinal hernia repair . Amongst the various techniques of hernia repair, Lichtenstein’s
tension free meshplasty is the latest, best and has become the gold standard . In 2008, COVIDIEN launched
progrip mesh which is a self fixating mesh used in both inguinal and incisional hernia repair . Progrip mesh
is made up isoelastic lightweight macroporous knitted monofilament polypropylene fabric that incorporates
resorbablepolylactic acid fabric on one side of the mesh to provide self fixation during first few months of
implantation.
Aim: The aim of this study is to compare the outcome on basis of incidence of postoperative pain and
operative time of self fixating pro-grip mesh with conventional mesh in Lichtensteins open inguinal
herniomeshplasty .
Objective:
• Comparing outcome in terms
• Post-operative pain
• Operative time
Conclusion: Lichtenstein’s open inguinal herniomeshplasty using self-fixating Progrip mesh has an
advantage over conventional mesh repair as it requires less operative time and the incidence of postoperative
pain is less frequent and occurs at an even more later period compared to conventional mesh repair which at
times is found to be present even at post-operative day 2.
Introduction
An inguinal hernia occurs when any tissue,protrudes
through a weak spot in the anterior abdominal wall
Corresponding Author:
muscles . Amongst the types of hernia, the most common
Dr. Honeypalsinh H. Maharaul
type is inguinal hernia . And the best modality of treating
Associate Professor, Smt. B.K. Shah Medical Institute an inguinal hernia is surgery .
and Research Centre, Sumandeep Vidyapeeth Deemed
to be University (An Institution), Pipariya Vadodara Inguinal hernia can be repaired either in its old
e-mail: [email protected] traditional modality of open hernioplasty or its new
Phone: 9426345105 modality of laparoscopic hernioplasty . But each
558 Medico-legal Update, January-March 2021, Vol. 21, No. 1
technique has got its advantage and disadvantage, despite the regeneration of healthy tissue inside its microgrips
that the main goal of any hernia repair is to provide the and shows low rate of complications with 100% self
best and strongest repair, least recurrence rate, least fixation [3] [4] . Hence our present study is to enlighten the
possible discomfort and quickest recovery. advantage of this self grippingprogrip mesh in reducing
the incidence of chronic groin pain after inguinal hernia
In open method hernia can be managed by: repair and reduce the operative time as it leads to less
• Herniotomy exposure to anaesthetic drugs.
• Herniorraphy
Materials and Method
• Hernioplasty
The prospective study was conducted between July
Laparoscopic repair is the recent advancement. It 2019 to June 2020 and around 20 patients were divided
can be done by 2 ways with mesh fixation and without into two groups with inguinal hernia and were admitted
mesh fixation and can be by two approaches : to Dhiraj General Hospital, S.B.K.S.M.I.R.C, Pipariya,
Vadodara, Gujarat, India.
• Total Extra Peritoneal (TEP)
Inclusion Criteria:
• Trans Abdominal Preperitoneal (TAPP)
Inguinal hernia repair still remains a problem Patients diagnosed with inguinal hernia and planned
because of chronic groin pain following mesh repair. for lichtensteinsinguila hernia repair
External oblique aponeurosis opened upto the Hernial sac identified and reduced and posterior
superior inguinal ring medially and deep inguinal ring wall repair done with prolene no. 1 R.B .
laterally .
Progrip mesh was taken after creating good space
Inguinal canal opened and space created upto underneath and around the spermatic cord
conjoint tendon medially and upturn part of inguinal
ligament laterally .
Sterile dressing done after attaining hemostasis The reason for such pain is unclear . But it can
be due to:
Patient shifted to post op room as was vitally stable
• Mesh material that is its structure and interaction
with tissue
560 Medico-legal Update, January-March 2021, Vol. 21, No. 1
• Scarring The microgrips integrate for upto 0.5 mm into the
tissue and provides stronger tissue incorporation at
• At times nerve damage
almost around 5 days.
• Entrapment by sutures
Hence because of these features available in the self
Because of these facts, fixation of the mesh with fixatingprogrip mesh can be placed in position safely
sutures during surgery continues to be an important and proper without the requirement for sutures which
factor to be thought and discussed about. can penetrate underlying tissues and might damage
Hence a new self-gripping mesh (Progrip) has been cutaneous nerves[8].
developed in 2008 by COVIDIEN .
Result
This self-gripping mesh is made of: Isoelastic
Operative time : Conventional mesh repair on an
large-pore lightweighted, knitted, monofilament
average takes around 35.5 minutes starting from skin
polypropylene fabric that incorporates microgrips which
incision to closure, whereas progrip mesh repair takes
are resorbable and these only provide self-gripping
only around 20 mins .
fixation in the initial few months of implantation[7].
Postoperative pain : as noted in these patients, after
The microgripsare: 1-mm projections that are club
conventional mesh repair the GROUP B complaints of
in shape and are made up of polylactic acid which is
chronic pain even after 3 months . Whereas in GROUP A
biodegradable.
progrip mesh repaired patients they were pain free after
post operative day 2 and on follow up after 3 months.
Figure 2: Showing time variation between the operative time between conventional hernioplasty and usage
of progrip mesh.
Scholar researcher, Institute of Genetic Engineering and Biotechnology, University of Baghdad, Iraq
Abstract
Several studies have identified adrenocortical sub-population cells located in the capsule/sub-capsular area,
carrying the aspects of stem/progenitor cells. We previously recognized a novel protein (Tmem121) highly
expressed in in this sub capsular area and also highly co-localised with Ki67 in this area. The suggestion
of these previous studies was considered to clone and transfect Tmem121 into adrenocortical stem/
progenitor cells studying the proliferation changes in the transfected cells. Adrenocortical stem/progenitor
cells were isolated and cultivated in vitro. The cells were previously isolated and prepared for testing the
effect of Tmem121 after three months of in vitro cultivation. Specific primers were used to detect and
amplified the coding sequence of the TMEM121 using RT-PCR followed by cloning into pIRES2-ERFP
vector. Immunocytofluorescent tests were carried out to detect the forced expression of TMEM121 into
these cells. Real time PCR assays were followed with specific primers to detect the synchronization of
Tmem121 expression with two proliferation markers Ki67 and proliferating cell nuclear antigen (PCNA).
Immunocytofluorescent tests results showed a significant expression of TMEM121 into these cells. Real
time PCR results showed a significant increase in the expression of both proliferation markers Ki67 and
(PCNA). These results suggested a propagating effect of TMEM121 to the adrenocortical stem/progenitor
cells.
Table 1: List of primers (Invitrogen) used in the RT-qPCR, their accession number, position in the mRNA
sequence and their product size.
Fragment
Gene Forward primer 5`-3` Reverse primer5`-3` Accession number
Size (bp)
Statistical Analysis: Results of RT-qPCR data were from agarose gel after electrophoresis. The purified DNA
analysed using Dunnett’s Multiple Comparison Test of band of Tmem121 was used as template in a second PCR
one-way analysis of variance (ANOVA). using specific primers of same sequences in addition
to restriction site sequence and platform up-stream
Results and Discussion the primers. The resulted PCR product was profiled
RT-PCR experiments were successfully carried out on agarose gel electrophoresis, which showed a single
to amplify the whole coding sequence of Tmem121. band represents the full coding sequence of Tmem121
RNA isolation from rat adrenals was achieved with flanked by the EcoR1 restriction sequence and HindIII
concentrations ranged from (0.8-1.2µg) with high restriction sequence to be ready for digestion with those
purity. Aliquots of RNA were used for cDNA synthesis two enzymes.
followed by PCR to amplify the full coding sequence The Tmem121 insert were successfully cloned into
of Tmem121using specific primers. The amplified the vector and all negative and positive controls were
amplicon was successfully detected, excised and purified prepared as well and successfully applied to competent
Medico-legal Update, January-March 2021, Vol. 21, No. 1 565
cells for transformation. Plasmid-insert complex was (as confirmed by the vector reporter (red fluorescent)
successfully detected in the transforms colonies, which confirming the successful transfection in the stem/
was purified with midiprep kit. The purified vectors were progenitor cells identified with anti-Thy-1 antibody in
used to transfect the adrenocortical stem/progenitor cells comparison with control cells (Figure 1).
with transfection reagent (Turbofect). The transfection
efficiency ranged from 35-60%. Although, Turbofect is a Although Thy-1 cells in this study were used
strong cationic polymer efficiently used for transfection, after spending three months in cultivation, they were
this low-medium transfection efficiency rate (35-60%) potentially young stem/progenitor cells because they
resulted from the refractory nature of the primary cell(11). hold similar proliferation rate to these cells in their niche,
which were proliferate more constantly and can survive
Immunocytofluorescent: The results of the dual longer in vitro (10) in comparison to the whole adrenal
Immunocytofluorescence assays were showed the co- primary culture which tends to lose their survival ability
expression of the Tmem121 in the transfected cells after 100 days in vitro(12).
RT-qPCR: The transfection of Thy-1 cells with the increase in the expression of Tmem121 two days and four
coding sequence of Tmem121 gene showed significant days after transfection respectively (figure1). This result
responses in both proliferation markers Ki67 and PCNA revealed the gradual elevation in the gene expression of
as measured using two steps-Real time PCR. The control Tmem121 due to the time required to SV40 promoter
group of this assay were the cells that transfected with in vector to elevate the expression level in the host cell.
native-plasmid which also compared with un-transfected
cells in addition to the cells received the Tmem121 gene. The response of both proliferation markers were
The results showed a significant (P<0.05) and (P<0.01) also increased in synchronising with the elevation of
566 Medico-legal Update, January-March 2021, Vol. 21, No. 1
the expression of Tmem121. Ki67 expression increased These results revealed a positive relationship
in harmony with the expression of Tmem121 which between the expression of Tmem121 and the proliferation
revealed similar significant (P<0.05) and (P<0.01) activity of the adrenocortical stem/progenitor cells
increase after two and four days of transfection represented by two proliferation markers. These results
respectively (figure2). Although PCNA also showed were confirming the suggested relationship between
positive response to Tmem121 elevated expression, it Tmem121 expression in capsule and sub-capsular areas
was less than the response of Ki67. PCNA showed non- of the adrenal cortex with Ki67 (9).
significant increase in the expression after two days of
transfection. However, after four days of transfection
PCNA showed a significant (P<0.05) increase in its
expression (figure 2).
Figure 2. RT-qPCR relative quantification represented fold changes of mRNA expression of Tmem121, Ki67
and PCNA in the Thy-1 cells after Tmem121 transfection. The cells were transfected in their 3rd month
of in vitro cultivation and the gene expression was then tested at two interval periods 2 and 4 days after
transfection. Three biological replicates were used in this experiment. Summarized one-way ANOVA results
showed significant * (P<0.05) and/or significant ** (P<0.01) difference.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 567
Funding: Self 7. ZHOU, J., LI, Y., LIANG, P., YUAN, W., YE, X.,
ZHU, C., CHENG, Y., WANG, Y., LI, G., WU,
Ethical Clearance: Not required X. & LIU, M. A novel six-transmembrane protein
hhole functions as a suppressor in MAPK signaling
List of Abbreviation pathways. 2005, Biochem Biophys Res Commun,
333, 344-52.
DMEM Dulbeccos Modified Eagle’s Medium
8. BRONNEKE, S., BRUCKNER, B., SOHLE, J.,
dNTP Deoxyribose nucleoside triphosphate
SIEGNER, R., SMUDA, C., STAB, F., WENCK,
E.coli Escherichia coli
H., KOLBE, L., GRONNIGER, E. & WINNEFELD,
ERFP Enhanced Red Fluorescent Protein M. Genome-wide expression analysis of wounded
FISH Fluorescent In situ hybridisation skin reveals novel genes involved in angiogenesis.
PCNA Proliferating cell nuclear antigen 2015, Angiogenesis, 18, 361-71.
RT-PCR Reverse transcription-polymerase chain reaction 9. AL-BEDHAWI, M. A. A. & BICKNEL, A.
Reverse transcription-quantitative polymerase
Tmem121 A Novel Gene Associated With The
RT-qPCR Proliferation Activity of Adrenocortical Stem/
chain reaction
Tmem121 Transmembrane protein121
Progenitor Cells. 2019, Research Journal of
Pharmaceutical, Biological and Chemical Sciences,
β-Actin Beta-Actin
10, 14.
Abstract
Background: Broken families It is the family under divorce, separation, death of father, death of mother
and death of both parents. It is the legal termination of marriage. It is also the dissolution of marriage that
is contracted between husband and wife by the judgment of a court of competent jurisdiction or by an act
of the legislature. Separation and divorce have exclusion and negative effects on the behavior of children as
well as the burden of education for those in charge of it, which involves risks to the psyche and the degree
of coping with children.
Objectives: To determine broken families among secondary school adolescents, assess secondary school’s
adolescents’ behaviors, determine the impact of broken families on adolescents’ behaviors, and to find-
out the relationship between adolescent’s behaviors underbroken family and their socio-demographic
characteristics of age, gender, parent’s education levels, family type and socio-economic status.
Methodology: Anon-probability (purposive) sample of (555) students, whose age are between 12 to 18
years have been selected; the sampling of study is divided into two stages which include: First stage: the
school’s selection by cluster, the AL-Najaf City divided to six districts, the schools selected randomly (36)
school’s boys and girls, from (130) total schools .Second stage: students under broken family selection by
using the purposive sampling, while control group from each school students were randomly selected.
Results: Indicate that there is significant relationship between the adolescent’s gender under broken family
and their behavior domain excessive suffering, poor anger control and poor social conformity. While there is
a non-significant relationship between the adolescent’s gender under broken family and their other behavior
domains. The results show that there is a highly significant relationship between adolescent’s Educational
level under broken family and their behavior domain poor impulse control and poor anger control. While
there is a non-significant relationship between the adolescent’s Educational level under broken family and
their other behavior domains.
Conclusion: That most of the secondary school’s adolescents under broken family have Behavior problems.
Recommendation: To the Governments and Schools should create awareness on the ills of broken homes
on the academic, emotional and social adjustments of students through training, workshops and seminars.
Parents should be enlightened on the need to stay together as husband and wife to raise a good family.
Introduction
Corresponding Author: God created mankind and made the production of
Mohammed Baqer Hassan the offspring and its perpetuity of life through marriage
Assistant Professor, Pediatric Department, Faculty of between a man and a woman. Therefore, the family
Nursing, University of Kufa, IRAQ, is considered the smallest social institution within the
e-mail: [email protected] community, and the relationship that binds the father and
Medico-legal Update, January-March 2021, Vol. 21, No. 1 569
the mother within the family, so the more coherent that behaviors, which are manifested by the increase in
relationship is, the stronger the society will be, because painful feelings of sadness, anxiety, confusion, fear,
through the family, the first signs for raising a child and guilt, and the reinforcement of misconceptions and
promoting values and good morals are launched(1). behaviors with the domination of some negative ideas
that increase the suffering of children when there is an
Family is the basic unit of society. A home is that incoherent and disassembled family that has an impact
where a family lives which provides children with On the quality of life of the adolescents in all areas (4).
feelings of security and stability. The members of family
constitute the child’s first environment for personal and Methodology
social adjustment. Anything that interferes with these
feelings can be regarded as hazardous for adolescents (2). Design of the Study: A descriptive study is
conducted through the period of November 11th, 2018
The effects of a broken family on children depend on to May 9th, 2019 in-order to Impact of Broken Family
numerous factors, including child’s age and personality upon Adolescent’s Behavior at Secondary Schools in
when parents got separated, family relationships and AL- Najaf AL-Ashraf City.
the surrounding circumstances in which changes in the
behavior of the child can occur from the simplest detail Setting of the Study: The setting of the study
of the most complex, in addition to the child’s ability to includes (36) schools;(12) intermediate schools, (12)
overcome these difficulties and favorable conditions (3). high schools (preparatory), and (12) secondary schools,
which are distributed in six districts of Al-Najaf Al-
The impact of the broken family on children by Ashraf City, six schools from each quarter’s.
shaping children’s attitudes, feelings, thoughts, and
Table (1) indicates that more than half (51.1%); (39.6%) of broken sample, while good level (89.7%) of
(67%) of ages are 16-17 years of broken and control education with control sample; the highest percentage
samples respectively; while the results revealed that the of number children in the family is (43.5%); (46.4%)
highest percentage (58%); (82.6%) is female of broken of four to six of both samples respectively; while age
and control samples respectively; the educational level at broken family is more than third percentage (31.7%)
more than half (54.7%); (54.9%) at secondary school at ten to twelve years; the children rank in family is
of broken and control samples respectively; more than more than third percentage (37.1%) at second in broken
quarter (29.3%); (45.1%) of broken and control samples sample, while (44.2%) at first in control sample.
respectively in fourth and fifth class, with average level
The findings in figure (1) indicate that the more than half percentage (54.7%) of no father alive; while mother
alive is two-third percentage (76.7%)of broken family sample.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 571
Figure (2): Distribution of the Study Sample by their Parents Marital Status
The findings in figure (2) indicates that the majority percentage (50.8%) of father died and the divorced is
(21.5%); while lowest percentage (3.9%) is both parent died of broken family.
Table (2): Association Between Educational Level for the Students and Adolescent’s Behavior Levels of the
Study Group
Table (2) represent the association between the adolescent’s behavior and their educational level for the students,
the study results indicate that there is a significant association at p-value more than 0.05; at p-value (0.007) .
Table (3): Association Between Type of Family and Adolescent’s Behavior Levels of the Study Group
Table (3) represent the association between the at p-value more than 0.05; Burks behavior rating scale)
adolescent’s behavior and their type of family, the study at p-value (0.041) .
results indicate that there is a non–significant association
572 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table (4): Association Between Socio Economic Status and Adolescent’s Behavior Levels of the Study Group
Table (4) represent the association between the Concerning the level of adolescent’s education, the
adolescent’s behavior and their socio economic status, study indicates that more than half (54.7%); (54.9%)
the study results indicate that there is a non –significant at secondary school of broken and control samples
association at p-value more than 0.05; Burks Behavior respectively; these findings agree with results obtained
Rating Scale (BBRS)at p-value (0.185) . from study done by)Atsushiet al., 2018) (7). While there
are more than quarter (29.3%); (45.1%) of broken and
Discussion of the Results control samples respectively in fourth and fifth class,
Table (1) show distribution of the study sample by with average level (39.6%) of broken sample, and good
their adolescents demographic data, this table indicates level (89.7%) of education with control sample; these
that the highest percentage (more than half) (58%); findings agree with results obtained from study done
(82.6%) are females of broken and control samples (Amato and Sobolewsk, 2001) (8). This result is due to
respectively. This result indicates that there were the fact that most of the samples members are between
females students of broken homes more than males 16-17 years old and who are usually in this stage of
students in the secondary schools; these findings agree study. Addition the lower educational level to middle
with results obtained from study done by) Pauwels and due to loss or lack of supervision by the parents, with
Svensson, (2017. This result is due to the presence of the mental, emotional and behavioral problems faced by
disputes between parents or family disintegration. This the teenager, as well as difficulties in the family. All of
generates conflicts and problems for the children, as it this reflects negatively on all levels of the adolescent’s
leads the children, especially the girls, to research and life, especially the academic level, with the loss or lack
clings to any outlet that leads them to alleviate or break of interest of the educational staff in the student, making
out of these conflicts and to prove their existence, and the student’s level be less than good.
this can only be found through school. Especially in the The highest percentage of number children in the
Najaf community, where the available resources for girls family are (43.5%); (46.4%) of fourth to sixth of both
are much less than for boys with more supervision for samples respectively; these findings agree with results
girls, especially in adolescence, which is characterized obtained from study done by (Cohen, 2014). This
by aspirations for freedom and independence (5). result is due to the occurrence of most cases of family
While the results revealed that more than half disintegration when the number of its members increases,
(51.1%); (67%) of age is 16-17 years of broken and which creates burdens on the family breadwinner and
control samples respectively; these findings agree with consequently the family’s neglect and disintegration.
results obtained from study done by (Tremblay et al., Therefore, the order of adolescents plays a major role in
2018). This result is due to the period in which they were determining the method of family upbringing, especially
born. The society has suffered in many political and in dealing with children (9).
economic problems, in addition to the openness that the While adolescent’s age at broken family indicates
country witnessed and other factors have rocked society, that more than third (31.7%) occurred at ten to twelve
especially the family. The disintegration has increased years; these findings agree with results obtained from
during that period (6). study done by) Banket al., 2001). This result is due to
Medico-legal Update, January-March 2021, Vol. 21, No. 1 573
the burdens of living and the increasing requirements of the association between the adolescent’s behavior and
adolescents as they get older, with the inability of parents their educational level for the students, the study results
to manage family affairs with the problems of life facing indicate that there is a significant association at p-value
the family in light of the unstable political, economic more than 0.05; these findings disagree with results
and security conditions of the country, with the increase obtained from study done by (Umar, 2019); the study
in the number of family members. These factors can lead results indicate that there is significant influence of
to family disintegration and incoherence(10). broken homes on the academic adjustment of secondary
school students (14).
Children rank in family are more than third
percentage (37.1%) at second in broken sample, while Table (3) show association between type of family
(44.2%) at first in control sample; while the results related to the adolescent’s behavior levels broken
revealed that the highest percentage (48.3%); (100%) is family in secondary schools, represent the association
number of failure at less than one year of broken and between the adolescent’s behavior and their type of
control samples respectively; these findings agree with family, the study results indicate that there is a non –
results obtained from study done by (Anderson et al., significant association at p-value more than 0.05; these
2017). This result is due to the varied socio-demographic findings agree with results obtained from study done
of the family who live in a poor or semi-poor family (11). by (Maggie, 2017);individual’s adolescent family
the study results indicate that the degree of support
Respondents were asked whether both parents were and sense of belonging individuals felt towards their
alive (Figure 1), the findings indicate that the more family during adolescence, as well as their parent’s
than half percentage (54.7%) of no father alive; while relationship history were associated with low. Table (4)
mother alive is two-third percentage (76.7%) of broken show association between socio economic status related
family sample; these findings agree with results obtained to the adolescent’s behavior levels broken family in
from study done by (Lauren and Laura, 2008). This secondary schools, represent the association between the
result is due to the Iraqi society, especially Najafi, the adolescent’s behavior and their socio economic status,
main breadwinner for the family is the father, and the the study results indicate that there is a non –significant
dependency is high, as well as the large role in meeting association at p-value more than 0.05; these findings
most of the basic needs necessary for family members, agree with results obtained from study done by (Hughes
especially individuals without adolescence. In the case et al., 2017); the study results indicate that lower levels
of losing the father, the entity and cohesion of the family of family cohesion are an indicator of poor family
can permeate or weaken and also generate economic relationships and may a healthy development. This result
and social burdens on the rest of the family members, is due to the families characterized by unsupportive and
especially the mother or big brother (12). neglectful relationships and conflict constitute risky
Figure (2) show distribution of the study sample by environments that may lead to worse mental and physical
their parents marital status, it indicates that the majority health across the life, operating through pathways such
percentage (50.8%) of father died and the divorced as stress, emotion processing, social competence, and
is (21.5%); while lowest percentage (3.9%) is both risky health behaviors(15).
parent died of broken family; these findings agree with
results obtained from study done by(Rialaet al., 2013). Conclusions
This result is due to living in single parent families 1. The study confirms that more than half of the study
or stepfamilies caused by death had higher negative are female adolescent under broken family.
consequences for adolescentthan living in single parent
2. The study indicates that the broken family has a
families caused by divorce, due to fathers take on the
non-significant relationship to SESS.
principal caring role. In general, the results of this study
give support to the weak social position of the mother 3. The study indicates that most of adolescents have a
as the most likely explanation for the negative effects of behavior problems with their broken family.
living in a single parent family (13). 4. The findings from this study lead to the conclusion
Table (2) show association between educational that broken family have immense Impact of
level for the students related to the adolescent’s behavior Adolescent’s Behavior at Secondary Schools in AL-
levels broken family in secondary schools, represent Najaf AL-Ashraf City.
574 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Recommendations: interventions targeting multiple risk behaviours in
young people. Journal of Consulting and Clinical
1. Government should review upward minimum
Psychology. 2018;63(4):560‐8.
salary from the current amount to reasonable and
substantial level to better the lives of the average 7. Amato PR, Sobolewski JM. The effects of
citizen in the country. divorce and marital discord on adult children’s
psychological well-being. American Sociological
2. Employment opportunities should be created for the Review. 2001;66:900-921.
unemployed parents.
8. Cohen GJ, The impact of family structure on the
3. Should, through enacting laws and the media, to health of children: Effects of divorce. London:
enhance and improve the quality of family life. University of London, Institute of Education,
3. Parents should be enlightened on the need to stay Thomas Coram Research Unit. 2014 Nov;
together as husband and wife to raise a good family. 110(5):1019-23.
They should persevere and tolerate each other in 9. Bank L, Marlowe JH, Reid JB, Patterson GR,
marriage. Weinrott MR. Family and parenting interventions
in children and adolescents with conduct disorder
Financial Disclosure: There is no financial and delinquency aged 10-11 Journal of Abnormal
disclosure. Child Psychology Published online 2001 : 23.
Conflict of Interest: None to declare. 10. Anderson NJ, Neuwirth SJ, Lenardson JD, Hartley
D.; 2017.Differences in Health Care, Family, and
Ethical Clearance: All experimental protocols Community Factors Associated with Mental,
were approved under the College of Nursing, University Behavioral, and Developmental Disorders Among
of Kufa, Iraq and all experiments were carried out in Children Aged 2-8 Years in Rural and Urban Areas.
accordance with approved guidelines. 2017; (17). 10: 155 .
11. Lauren E. Glaze and Laura M. Maruschak,Parents
References in Prison and Their Minor Children, Department of
1. Wade T. J., Veldhuizen S., and Cairney J., Justice Office (2008) .Amercain Joruna 8(3): 41-
Prevalence of Psychiatric Disorder in Lone Fathers 46.
and Mothers: Examining the Intersection of Gender 12. Riala, K., Isohanni, I., Jokelainen, J, Jones, P. and
and Family Structure on Mental Health, Canadian Isohanni, M. ‘The relationship between childhood
Journal of Psychiatry, 2016; 56(9), 567-573. family background and educational performance,
2. Langton C. E., and Berger L. M., Family Structure with special reference to single-parent families:
and Adolescent Physical Health Behavior and a longitudinal study’, Social Psychology of
Emotional Well-Being, Social Service Review, Education, (2013); 6(4), pp. 349–365.
2015; 85(3): 323-357. 13. Umar Usman Sani, Influence of Broken Homes
3. Wolchik S. A., Sandler I., Millsap R. E., Plummer on Senior Secondary School Students’ Academic,
B. A., Greene S. M., and Anderson E. R., Six Year Emotional and Social Adjustments in Katsina
Follow-up of a Randomized Controlled Trial of State, Nigeria. International Journal of Innovative
Preventive Interventions for Children of Divorce, Psychology & Social Development. 2019; 7(1):26-
Journal of the American Medical Association, 32.
2012; 288: 1-8. 14. Maggie L. Thorse . The Adolescent Family
4. Pedro-Carroll J. L., Sutton S. E., and Wyman P. A., Environment and Cohabitation across the
A Two Year Follow-up Evaluation of a Preventive Transition to Adulthood . Department of Sociology
Intervention for Young Children of Divorce, School & Anthropology, Montana State University.
Psychology Review, 2015; 28: 467-476. 2017;75(5):249-262.
5. Pauwels L, Svensson R. Analyzing Gender 15. Hughes K., Bellis M.A., Hardcastle K.A., Sethi
Differences in the Relationship between Family D., Butchart A., Mikton C., Jones L., Dunne M.P.
Influences and Adolescent Offending among Boys Poor Family Relationships in Adolescence and
and Girls. European Journal of Criminology. 2017; the Risk of Premature Death: Findings from the
10(4): 1079-1094. Stockholm Birth Cohort Study. Lancet Public
6. Tremblay RE, Pagani‐Kurtz L, Mâsse LC, Vitaro Health. 2017;2:e356-e366. doi: 10.1016/S2468-
F, Pihl RO. Individual family and school level 2667(17)30118-4.
DOI Number: 10.37506/mlu.v21i1.2373 Medico-legal Update, January-March 2021, Vol. 21, No. 1 575
Abstract
Background: Urinary urgency incontinence is characterized by symptoms of involuntary loss of urine that
preceded or accompanied by sudden desire to void. Fecal incontinence is defined as involuntary passage of
stool through the anus. It may vary from soiling to complete evacuation. This involuntary loss of feces, flatus
or urge incontinence adversely affects quality of life.
Objectives: To evaluate the efficacy and safety of sacral neuromodulation on these pathologies.
Method: Following a detailed investigation, 21 patients with either urinary incontinence, or both urinary
and fecal, who did not respond to medical and behavioral treatment were offered the sacral neuromodulation
therapy and followed for at least 12 months post implant regarding response and development of complication
if any found.
Results: In the period from November 2015 to May 2017. The unit of neurogenic bladder and neuromodulation
in surgical subspecialty hospital, medical city complex had implanted 21 Patients with urinary incontinence
were using from (4-17) pads/day (mean of 10.5/day) presacral neuromodulation which were declined
significantly to (0-3) pads/day (mean of 2.2/day).
From the eighteen patients who presented with fecal incontinence after the implantation of sacral
neuromodulation interstim 11 permanent devices only four remained incontinent .and from the nine patients
who presented with erectile dysfunction only two remained impotent.
Conclusion: The use of Sacral Neuromodulation in Iraqi patients with Urinary and Fecal Incontinence is
safe and effective
From the eighteen patients who presented with Table 4: Frequency of complications post SNS
fecal incontinence after the implantation of sacral
neuromodulation interstim 11 permanent devices only No. %
four remained incontinent .and from the nine patients Nill 17 81.0
who presented with erectile dysfunction only two Simple pain 2 9.5
remained impotent (nearly all those patients didn’t even Device infection 1 4.8
mention this complaint primarily may be due to that
Device malfunction 1 4.8
their incomitance where their major complaint or maybe
they were embarrassed). (Table 5). Total 21 100.0
From the twenty-one patients treated by sacral Table 5: Status of incontinent and ED pre and post
neuromodulatin two patients had simple pain at the site SNS N=21
of implantation some time radiating to their legs treated
No. %
by reprograming of the device and simple analgesia.
One patient had device infection and another had device Bowel status
malfunction due to direct trauma to the device treated Pre-sns 18 85.7%
Incontinent
by removal of the device and reimplantation of another post-sns 4 19.0%
device in the contralateral site. (table 4) Potency status
pre-sns 9 64.3%
Ed
Post-sns 2 14.3%
578 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Abstract
Objective: evaluate the serum level of Glycodeline-A, sFlt-1, PlGF combined with βhCGas predictor
markers of first trimester pregnancy loss in Iraqi women.
Method: A case-contol study, carried out from April 2019 to March 2020 and included 85 women, 40 of
them as patients which have abortion at the first trimester and 45 of them as healthy control which haven,
t any complication at the same time of gestation, investigations included serum measurements of βhCG,
Glycodeline-A, sFlt-1, PlGF By Method ELISA.
Results: Serum NiveausβhCG, sFlt-1 Was major higher in healthy controls than in patients, while serum
level of Glycodeline-A, PlGF was significantly lower in healthy control than in patients, and there is no
significant correlation among each of age with other parameters, and there is no significant correlation
among each of gest.age with Glycodeline-A and sFlt-1, while there is significant correlation among each of
ges.age with βhCG and PlGF P<0.05.
Conclusion: The present study suggested the significant role of Glycodeline-A, sFlt-1, PlGF in pathogenesis
of first trimester pregnancy loss and some of them was related to βhCGin this period and the age of patients
wasn, t effect on all of these parameters.
Results
Explain by table scales of various markers and their correlations according to the study assessment .
Table 1: Results and their obtained correlations for all markers in this study
Group Statistics
VAR00013 N Mean Std. Deviation Std. Error Mean
Age 1.00 40 27.1250 4.18292 .66138
cAge 2.00 45 27.2444 4.11293 .61312
Gest Age 1.00 40 9.6000 1.29694 .20506
cGestAge 2.00 45 9.5333 1.09959 .16392
Beta HCG 1.00 40 1024.7740 459.39406 72.63658
cBeta HCG 2.00 45 2309.9409 3007.11697 448.27453
Glycodein A 1.00 40 70.9447 56.87327 8.99245
cGlycodlin A 2.00 45 193.7416 200.56648 29.89868
sFlt1 1.00 40 118.2153 76.42478 12.08382
csFlt1 2.00 45 22.2696 19.16359 2.85674
PIGF 1.00 40 141.4350 284.10843 44.92149
CPIGF 2.00 45 340.2947 387.01779 57.69321
25
20
Data
15
10
0
Age cAge
Data
4
0
GestAge cGestAge
200
150
Data
100
50
0
GlycodeinA cGlycodlinA
100
80
Data
60
40
20
0
sFlt1 csFlt1
300
Data
200
100
0
PIGF CPIGF
Abstract
The current study was conducted at Al- Dawar Research Station (30 km to the northeast of Ramadi district
center in Anbar Governorate)/Ministry of Agriculture/Agricultural Research Organization/Department of
Animal Resource Researches, and for the period from November 1, 2019, to February 1, 2020. This research
aims to study the feeding role on the Panicum maximum Mombasa hay and Millet hay compared to the
alfalfa hay and the mixing between them on the production traits of Awassi lambs. In this experiment, 20
heads of Awassi sheep were used, their ages ranged from 5 to 6 months, and their average weight was 37 ±
0.75 kg. The animals were distributed randomly into five treatments, each treatment containing 3 females
and one male; all animals were fed (group feeding/treatment) during the experiment time on the same
diet of concentrated forage provided at a percentage of 2% of live body weight/treatment/day. As for the
rough forage, it was also provided daily/treatment, but freely, and the next morning the remainder of the
concentrated and rough forage was weighed/group. The average total weight gain, the average daily weight
gain, the average daily consumption, and the feed conversion efficiency were calculated, and it was observed
that there were no significant differences between the treatments in the average live body weight, the total
and daily weight gain, the amount of total feed intake (concentrated and rough) and the feed conversion
efficiency. It can be concluded from this that the use of Panicum maximum Mombasa hay and Millet hay did
not negatively affect the product performance of the Awassi lambs.
Keywords: Panicum Mombasa Hay, Millet Hay, Production Performance, Awassi Lambs.
Table [2] The chemical composition of the substances included in the composition of concentrate diet, alfalfa
hay, Panicum hay, and millet hay
Treatments
Weeks Sig.
T1 T2 T3 T4 T5
1 week 36.60 ±2.10 39.10 ± 2.00 39.26±3.18 38.13±1.77 38.66 ±1.04 NS
3 weeks 38.66 ±2.77 41.20 ±1.85 41.66 ±3.18 40.53 ±2.06 41.00 ± 1.70 NS
5 weeks 40.93 ±3.34 43.06 ±1.79 42.73 ±3.12 41.60 ±2.41 42.60 ± 2.10 NS
7 weeks 41.26 ±1.61 43.53 ±1.47 44.0 ±3.63 43.56 ±2.18 43.93 ± 2.00 NS
9 weeks 42.33 ±2.40 45.86 ±0.86 47.06 ±3.69 45.66 ±2.64 45.40 ± 2.38 NS
11 weeks 44.73 ±3.33 46.46 ±1.15 47.56 ±3.86 46.80 ±3.40 47.06 ± 2.45 NS
13 weeks 48.40 ±3.71 50.26 ±0.98 51.53±4.09 50.93 ±2.97 51.46 ± 3.13 NS
Note: NS means that there are no significant differences between the treatments.
Except, it was observed from the results that the the treatment fed on Panicum and the treatment fed on
treatment (T2) and (T3) are arithmetically superior over Panicum with an addition of 15% of the Moringa leaves.
the rest of treatments in the first week, and in the fifth The results did not agree with (13) finding, in which they
week, the results showed an arithmetic increase in body were observed significant differences (P≤0.05) between
weight in the treatment (T2) over the other treatments. the treatments in the average total weight gain. As well
In the other weeks, it is evident from the same Table as, (14) showed the presence of a significant difference
that there was an arithmetic increase in the average body (P≤ 0.05) between the treatment that fed only Panicum
weight in the treatment (T3) over the other treatments. and the treatment that fed on Panicum with the addition
The results of this study are agreed with the (12) findings of legume supplements, the treatments that were added
that they did not notice a significant difference between to the legume supplements were superior.
the treatments in the study, which included feeding
goats on Panicum hay, green Panicum, Panicum hay Daily Weight Gain: It is evident from the results
and Panicum silage in average body weight. Besides, of Table [4] that there were no significant differences
(13) did not notice a significant difference between the between animals in the average daily weight gain
treatment which are fed Panicum and other treatments between treatments and for all periods, and the Table
that are fed different types of forages. Whereas, the observed the arithmetic superiority in the treatments
results of the study did not agree with (14) when T4 and T5 over the other treatments. These results are
feeding Panicum to African rams with the addition of consistent with the(17) findings that showed there were no
leguminous grains, as the treatments of adding legume significant differences between calves fed on Panicum
supplements are significantly superior (P≤ 0.05) in body and calves fed on different grass, and(12) did not observe
weight over the treatment of Panicum only. Finally, (15) a significant difference between the treatments of four
noted significant differences (P≤ 0.05) in the average forms of Panicum (hay, green, silage, and hay) that were
body weight of goats fed on Panicum while providing fed to sheep. Moreover, the results of this study did not
cobalt in different proportions orally. agree with what (11) findings when feeding rams on the
millet silage with the addition of different percentages of
Total Weight Gain: The results of Table 4 showed urea, and significant differences (P≤0.05) were observed
the effect of using Panicum and millet hay in the diet between the treatments, as the addition treatments
on the average total weight gain during the experiment were superior in the daily weight gain. Furthermore,
time. It was observed from the results that there were no (18) showed in a study on African goats, there was a
significant differences between the treatments, but there significant difference (P≤0. 05) between the treatments,
is an arithmetic superiority in the treatment (T4) and the where the treatments fed on Panicum by adding 10 and
treatment (T5) over the other treatments. The results of 15% of the Moringa leaves were significantly superior
the study agreed with the (16) findings in their experiment (P≤ 0.05) to the treatment fed on Panicum only.
on goats, that there was no significant difference between
590 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Total feed intake: It is evident from the results between the treatments in the feed conversion efficiency,
of Table [4] that there were no significant differences where the treatment T2 achieved a mathematical
between the treatments in the amount of total feed improvement compared to other treatments. The study
intake. However, it was observed from the Table results results agreed with (13), and with (12) that observed no
that there was an arithmetic increase in the amount of significant differences in the feed conversion efficiency
feed intake in the treatments T1, T2, T5, the results are when feeding goats on Panicum compared to other
consistent with(17,18). These results differed with(14) treatments. The study results differed with the (14)
findings when they fed rams on Panicum and Panicum findings, that showed a significant difference (P≤0.05)
with the addition of legume supplements, as they found in the feed conversion efficiency of male African
a significant difference between the treatments in the sheep, where the treatment that fed Panicum with the
amount of feed intake.(19) observed the presence of a addition a variety of legume supplements exceeded over
significant increase in the amount of feed intake between the treatment fed on Panicum only.(11) study showed
the treatment of rams that fed on Panicum only and that there was a significant improvement (P≤0.05) in
treatments that were fed Panicum with the addition of the treatment of sheep fed on the millet silage with an
different proportions of cotton seeds and Moringa leaves. addition of 20% of urea in the feed conversion efficiency
over the treatment fed on the millet silage without any
Feed conversion efficiency: It is evident from the addition.
results of Table [4] that there was no significant difference
Table [4] The effect of using Panicum hay and millet hay in the diet on the total and daily weight gain, feed
consumption and feed conversion efficiency (mean ± standard error)
Studied traits
Treatments Amount of feed intake (hay Food conversion
Total weight gain (kg) Daily weight gain (g)
+ concentrate) (kg) efficiency
T1 11.80 ± 1.61 131.11 ±17.96 476.64 ± 12.36 8.25 ± 0.52
T2 11.16 ± 1.64 124.07 ±18.32 471.40 ± 10.55 7.90 ± 0.39
T3 12.26 ± 0.96 136.29 ± 10.75 462.80 ± 10.26 8.83 ± 0.64
T4 12.80 ± 1.24 142.22 ± 13.87 456.76 ± 9.46 9.34 ± 0.64
T5 12.80 ± 2.10 142.22 ± 23.23 475.75 ± 12.52 8.96 ± 0.51
Significance level NS NS NS NS
Note: N.S means no significant differences between the treatments
Abstract
Otitis media bacterial infections during childhood may contribute to the development of repeated
nasopharyngeal infections and it is complicated of recurrent or chronic middle ear diseases, especially with
multidrug resistant strains.
The results of antibiotic synergism for the most prevalent three bacterial species, isolated from otitis media
infections in children, and had the highest antibiotic resistance was revealed that combinations ceftazidime-
amikacin and ceftazidime- ciprofloxacin displayed synergistic activity fractional inhibitory concentration
(FIC ≤ 0.5) against the most of tested isolates; Pseudomonas aeruginosa, Porteus mirabilis, and Klebsiella
pneumonia. In the biofilm test all tested isolates were showed biofilm production by tissue culture plate
method (TCP), in the present study, the strong biofilm production was most prevalent in Pseudomonas
aeruginosa (100%) followed by S. aureus (71.4%). Biofilm formation increases the activity of antibiotics
in children otitis media infections and using antibiotics combinations may be essential for optimum
management of OM patients.
MIC of second
MIC of first MIC of first MIC of second
Antibiotics antibiotic in
Isolates antibiotic alone antibiotic in antibiotic alone FIC Result
combination combination
(μg/ml) combination (μg/ml) (μg/ml)
(μg/ml)
A1 AK-CAZ 64 16 64 8 0.375 Synergy
A1 CIP-CAZ 4 4 64 16 1.25 Indifferent
A5 AK-CAZ 8 2 128 32 0.5 Synergy
A5 CIP-CAZ 32 8 128 32 0.5 Synergy
A27 AK-CAZ 64 16 64 8 0.375 Synergy
A27 CIP-CAZ 4 2 64 16 0.75 Additive
P1 AK-CAZ 32 4 32 8 0.375 Synergy
P1 CIP-CAZ 2 1 32 16 1.0 Additive
P20 AK-CAZ 64 16 64 16 0.5 Synergy
P20 CIP-CAZ 32 32 64 32 1.5 Indifferent
P23 AK-CAZ 32 4 32 16 0.625 Additive
P23 CIP-CAZ 64 16 32 8 0.5 Synergy
K4 AK-CAZ 64 16 16 4 0.5 Synergy
K4 CIP-CAZ 16 4 16 8 0.75 Additive
K14 AK-CAZ 128 64 64 32 1 Additive
K14 CIP-CAZ 32 8 64 8 0.375 Synergy
K15 AK-CAZ 128 32 64 16 0.5 Synergy
K15 CIP-CAZ 16 4 64 16 0.5 Synergy
FIC: Fractional Inhibitory Concentration; AK: Amikacin; CAZ: Ceftazidime; CIP: Ciprofloxacin; A= Pseudomonas aeruginosa, P =
Proteus mirabilis, K= Klebsiella pneumoniae.
Results revealed combinations ceftazidime- In the current study, none of the antimicrobial
amikacin and ceftazidime- ciprofloxacin displayed combinations tested demonstrated antagonism against
synergistic activity (FIC ≤ 0.5) against the most of any of the isolates tested. Out of 18 isolates, 11 exhibited
tested isolates except tow isolates P. aeruginosa A 1 synergistic activities, while the additive activity showed
and P. mirabilis P20, which showed indifferent with the in 5 isolates, as the result of K. pneumoniae K4 (Figure 1).
ceftazidime-ciprofloxacin combination.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 595
the most frequent used for the treatment of many
infections especially due to P. aeruginosa. Many
studies reported these synergistic combinations(17,18).
In this study, it is detected that the synergy was
obvious between Ceftazidime and Amikacin against
P. aeruginosa isolates. Also, many reports indicated
to the combinations of quinolone and beta-lactam
antibiotics and the synergism with several rates was
observed (19, 20). In this study, synergy was less effective
in resistant strains with Ceftazidime-ciprofloxacin
combination. Mayer and Nagy (1999) (19) revealed that
the combination of third-generation cephalosporin with
fluoroquinolones rarely shows synergy. In agreement
with the results of current study, Hannan et al. (2014)
(21)
showed that among the four combinations evaluated
ceftazidime-ceftazidime-meropenem, piperacillin/
tazobactam, ceftazidime-amikacin and ceftazidime-
ciprofloxacin, ceftazidime-amikacin was in high rates of
synergy in multidrug resistant strains of P. aeruginosa.
Figure (1). FIC of antibiotics combination
Combinations of aminoglycosides and β-lactams have
ceftazidime-amikacin against K. pneumoniae K4.
synergic effects against gram negative isolates of this
The four isolates P. aeruginosa A1, A27, P. study. The mechanism of this combination may be
mirabilis P1, and K. pneumoniae K14 displayed the due to the action of β-lactams on bacterial cell wall by
highest affected by the 2 combinations especially with destruction of peptidoglycan polymers and then easily of
ceftazidime-amikacin (FIC = 0.375) (Table 1). the entry of the aminoglycosides into the bacterial cell
(22)
.
Antibiotic combinations to the treatment the
resistant infections, have been reported to be effective. Out of the total isolates of OM infections, 28 isolates
One drug may overwhelm or neutralize the mechanisms with high antibiotic resistance are selected for detection
of bacterial resistance, repurposing the antibiotic drug the Quantitative biofilm formation by Tissue Culture
by increasing its efficacy. May be the best-known Plate (TCP) method, these isolates were distributed
example of antibiotic synergy is the combination of as 7 from 4 species which include (Pseudomonas
clavulanic acid with β-lactam antibiotics (14). Antibiotic aeruginosa, Proteus mirabilis, Klebsiella pneumoniae
combination therapy is used to prevent the emergence and Staphyllococcus aureus). Quantification of biofilm
of resistant microbial strains, treat emergency cases formation has been shown in Table (2) and Figure (2).
during the process of etiological diagnosis, and to take
All isolates (100%) showed biofilm production by
advantage of antibiotic synergism. This is noted to be
TCP method. Strong biofilm producers were 14 (50 %),
effective when two bactericidal agents are combined,
10 (35.7%) were moderate and 4 (14.2%) isolates were
but antagonism occurs in vitro on combination
considered as weak biofilm producers. In this study, the
of a bacteriostatic and a bactericidal antibiotic(15)
strong biofilm production is the most prevalent in P.
checkerboard technique is an in vitro synergy test using
aeruginosa (7, 100%) followed by S. aureus (5, 71.4%),
to determine the antimicrobial combinations activity.
while the most of P. mirabilis and K. pneumoniae are
It is a simple to perform and remains to be a widely
moderate biofilm producers.
used technique to assess antimicrobial combinations(16).
Aminoglycoside and beta-lactam combinations are
596 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table (2). Screening of OM pathogenic isolates for biofilm formation by Tissue Culture Plate method.
* (P<0.05), ** (P<0.01).
Figure (2). Detection of biofilm producers of otitis media bacterial pathogens by Tissue Culture Plate
method with crystal violet staining.
In this study, the unique ability of P. aeuginosa to bacteria related to bacterial colonization of catheter
form biofim makes it as the main cause of OM infections devices infections such as urinary tract infections (24).
in Iraqi children, where, Chronic suppurative otitis media It finds that the mucosal biofilm has been implicated in
is largely due to biofilm-forming bacteria, of which a several pediatric respiratory infections, including otitis
common pathogen is Pseudomonas aeruginosa, and this media with effusion, tonsillitis, adenoiditis, persistent
species develop into biofilms and form chronic infections endobronchial infections, chronic rhinosinusitis,
in the middle ear of a mouse model of Eustachian tube and bronchiectasis(25). The nasopharyngeal biofilms
obstruction and acute tympanic membrane wounds(23). have the main role in the effectiveness of antibiotic in
children with otitis media, because the biofilm play
The weak biofilm formation of P. mirabilis and K. a role in the development of chronic nasopharyngeal
pneumoniae in OM infection may be due to that these inflammation, which is may be associated with chronic
Medico-legal Update, January-March 2021, Vol. 21, No. 1 597
or recurrent middle ear disease(26). The bacterial biofilms media in Rochester, NY. The Pediatric Infectious
of clinically H. influenzae in patients with acute otitis Disease Journal. 2016; 35(9): 1027-1032.
media infections are responsible for the development of 6. Ngo C, Maasa H, Thorntion R, Cripps A.
acute middle ear infections on the basis of the detection Predominant bacteria detection from the middle
of biofilms produced by this species(27). The production ear fluid of Children experiencing Otitis media: A
of biofilm may explain the failure of traditional antibiotic systematic review . Pols One . 2016; 11: e0150949.
treatment acute otitis media, which act as favourable
7. Toman J, Moll A, Barnes M, Shenoi S, Porterfield
environment(28). Biofilm formation is considered as a
JZ. The Role of Routine Culture in the Treatment
survival strategy by bacteria to antibiotics which are
of Chronic Suppurative Otitis Media: Implications
effective against bacteria. Biofilms are almost impossible
for the Standard of Care in Rural Areas of South
to grow in the laboratory media and are incredibly
Africa. Tropical medicine and infectious disease.
resistant to antimicrobials, which mean that the diagnosis
2019; 4(1): 10.
of chronic OM is one of the most challenging in the
management of middle-ear infection(29). The previous 8. Kumar A, Alam A, Rani M, Ehtesham NZ, Hasnain
results gave a role of biofilm formation in the entire SE. Biofilms: Survival and defense strategy for
cavity of the middle ear of children with recurrent AOM, pathogens. International Journal of Medical
contributing to the viscosity of effusion(30). Microbiology. 2017; 307(8): 481-489.
9. Rizvi M, Ahmad J, Khan F, Shukla I, Malik A,
Conclusion Sami H. Synergy of drug combinations in treating
multidrug-resistant Pseudomonas aeruginosa. The
The current study revealed that the strong biofilm
Australasian Medical Journal. 2015; 8(1): 1.
was the most prevalent in P. aeruginosa followed by S.
aureus and the biofilm formation leads to difficulty in 10. Elshikh M, Ahmed S, Funston S, Dunlop P,
treatment of OM, mainly due to its frequent association McGaw M, Marchant R. et al. Resazurin-based
with multidrug resistant bacteria, also, it was obvious 96-well plate microdilution method for the
that the Combinations ceftazidime-amikacin and determination of minimum inhibitory concentration
ceftazidime-ciprofloxacin displayed synergistic activity of biosurfactants. Biotechnol Lett. 2016; 38:1015-
against the most of tested isolates. 1019.
11. Nakamura A, Hosoda M, Kato T, Yamada Y, Itoh
Source of Funding: Authors M, Kanazawa K, Nouda H. Combined effects of
Ethical Clearance: Yes meropenem and aminoglycosides on Pseudomonas
aeruginosa in vitro. Journal of Antimicrobial
Conflict of Interest: Nil Chemotherapy. 2000; 46(6): 901-904.
12. Kırmusaoglu S. The Method for Detection of
References Biofilm and Screening Antibiofilm Activity
1. Biradar SK. Study of Microbiological Profile of Agents. In: Exopolysaccharides-Method of
and their Antibiogram in Patients with Chronic Preparation and Application. IntechOpen, 2019.
Suppurative Otitis Media. IJCMAS. 2015; 4(9): 13. SAS. Statistical Analysis System, Useres Guide.
981-85. Statistical. Version 9.1 th ed. SAS. Inst. Inc. Cary.
2. Klein JO. The burden of otitis media. Vaccine. N.C. USA, 2012.
2000; 19: S2-S8. 14. Holt KE, Wertheim H, Zadoks RN, Baker S,
3. Murphy TF, Chonmaitree T, Barenkam S, Kyd Whitehouse CA, Dance D. et al. Genomic analysis
J, Nokso-Koivisto J, Patel JA. Microbiology and of diversity, population structure, virulence, and
immunology panel. Otolaryngol Head Neck Surg. antimicrobial resistance in Klebsiella pneumoniae,
2013; 148(4): 64–89. an urgent threat to public health. Proceedings of
the National Academy of Sciences. 2015; 112(27):
4. Pelton SI, Leibovitz E. Recent advances in otitis
E3574-E3581.
media. The Pediatric Infectious Disease Journal.
2009; 28(10): S133-S137. 15. Daschner FD. Combination of bacteriostatic and
bactericidal drugs: lack of significant in vitro
5. Pichichero ME. Ten-year study of acute otitis
antagonism between penicillin, cephalothin,
598 Medico-legal Update, January-March 2021, Vol. 21, No. 1
and rolitetracycline. Antimicrobial Agents and arbekacin and vancomycin against methicillin-
Chemotherapy. 1976; 10(5): 802-808. resistant Staphylococcus aureus. Journal of
16. Vardakas K Z, Athanassaki F, Pitiriga V, Falagas Antimicrobial Chemotherapy. 1997; 39: 471–6.
ME. Clinical relevance of in vitro synergistic 23. Khomtchouk KM, Kouhi A, Santa Maria P. The
activity of antibiotics for multidrug-resistant Gram- Role of Neutrophils in Pseudomonas aeruginosa
negative infections: A systematic review. Journal Chronic Suppurative Otitis Media. J Immunol.
of Global Antimicrobial Resistance. 2019; 17: 250- 2019; 202 (1 Supplement): 190.
259. 24. Verma A, Bhani D, Tomar V, Bachhiwal R, Yadav
17. Sader HS, Huynh HK, Jones RN. Contemporary S. Differences in bacterial colonization and biofilm
in vitro synergy rates for aztreonam combined formation property of uropathogens between the
with newer fluoroquinolones and β-lactams two most commonly used indwelling urinary
tested against gram-negative bacilli. Diagnostic catheters. Journal of Clinical and Diagnostic
Microbiology and Infectious Disease. 2003; 47(3): Research: JCDR. 2016; 10(6): PC01 –PC3.
547-550. 25. Hamilos DL. Biofilm Formations in Pediatric
18. Song W, Woo HJ, Kim JS, Lee KM. In vitro Respiratory Tract Infection. Current Infectious
activity of β-lactams in combination with other Disease Reports. 2019; 21(2): 6.
antimicrobial agents against resistant strains of 26. Torretta S, Drago L, Marchisio P, Ibba T, Pignataro
Pseudomonas aeruginosa. International Journal of L. Role of Biofilms in Children with Chronic
Antimicrobial Agents. 2003; 21(1): 8-12. Adenoiditis and Middle Ear Disease. Journal of
19. Mayer I, Nagy E. Investigation of the synergic Clinical Medicine. 2019; 8(5): 671.
effects of aminoglycoside-fluoroquinolone and 27. Moriyama S, Hotomi M, Shimada J, Billal DS,
third-generation cephalosporin combinations Fujihara K, Yamanaka N. Formation of biofilm
against clinical isolates of Pseudomonas spp. by Haemophilus influenzae isolated from pediatric
Journal of Antimicrobial Chemotherapy. 1999; intractable otitis media. Auris Nasus Larynx. 2009;
43(5): 651-657. 36(5): 525-531.
20. Fish DN, Choi MK, Jung R. Synergic activity 28. Rayner MG, Zhang Y, Gorry MC, Chen Y, Post
of cephalosporins plus fluoroquinolones against JC, Ehrlich GD. Evidence of bacterial metabolic
Pseudomonas aeruginosa with resistance to one or activity in culture-negative otitis media with
both drugs. Journal of Antimicrobial Chemotherapy. effusion. JAMA. 1998; 279(4): 296-299.
2002; 50(6): 1045-1049.
29. Abu Bakar MB, McKimm J, Haque M. Otitis media
21. Hannan A, Gondal AJ, Saleem S, Arshad MU, and biofilm: An overview. Int J Nutr Pharmacol
Lateef W. In-vitro efficacy of ceftazidime in Neural Dis. 2018; 8: 70-78.
combinations with meropenem, piperacillin/
30. Thornton RB, Wiertsema SP, Kirkham LAS,
tazobactam, amikacin and ciprofloxacin against
Rigby PJ, Vijayasekaran S, Coates HL. Neutrophil
extensively drug resistant Pseudomonas aeruginosa.
Extracellular Traps and Bacterial Biofilms in
Pakistan J Zool. 2014; 46: 1111-1116.
Middle Ear Effusion of Children with Recurrent
22. Watanabe T, Obayashi K, Matsui K, Kubota Acute Otitis Media, A Potential Treatment Target.
T. Comparative studies of the bactericidal PLoS ONE. 2013; 8(2): e53837.
morphological and post-antibiotic affects of
DOI Number: 10.37506/mlu.v21i1.2377 Medico-legal Update, January-March 2021, Vol. 21, No. 1 599
Abstract
Despite the belief that religion and spirituality considered the most important cultural factors that give
meaning to human behaviors and values, religion and spirituality have been equally ignored in the empirical
alcohol studies. The purpose of this integrative review paper is to identify the role of religion and spirituality
in alcohol use treatment and recovery. An integrative review has been utilized to address the issue. There
is a presentation of findings from research examining religion and spirituality and their relationship to
alcoholism. Treatment requires awareness of underlying causes to establish effective treatment approaches.
Determining these underlying causes requires adequate knowledge of underlying personal beliefs and values
that adheres to religions and spirituality. Health professionals across disciplines have an important role in
implementing multidisciplinary interventions. Results, controversies, and concerns raised by the reported
results are addressed. Implications for future research are delineated.
Moly K.T.
Professor cum Principal, Amrita College of Nursing, Amrita Institute of Medical Sciences, AMRITA Vishwa
Vidyapeetham, Kochi, Kerala, India. PIN: 682041
Abstract
Bariatric surgery improves patients’ well-being beyond significant weight loss and resolution of comorbidities,
Quality of Life (QoL) is a relevant but challenging variable to assess in the process of weight loss and
lifestyle changes. The primary objective of the study was to determine the QoL of patients after bariatric
surgery in comparison with obese patients who have not undergone bariatric surgery. A descriptive analytical
approach was used to collect data from 100 subjects who had undergone Laparoscopic Sleeve Gastrectomy
(LSG) through SF 36 in comparison with 100 obese subjects without surgery. 50% data collection was
done directly from OPD and 50% from telephonic contact in both the groups. The mean scores in all the
eightdimensions of SF 36 were found to be good in Bariatric Surgery (BS) group. Both Physical Component
Score (PCS) and Mental Component Score (MCS) were found to be high, the MCS being higher (85.74 +
22.72) than the PCS (83.68 + 21.8) in BS group whereas the MCS was poor in obese group (49.98 + 11.84).
The overall QoL of BS group was found to be good (mean 80.93 + 18.18) compared to obese group (49.69 +
11.77). The health related QoL was found to be quite good in patients after LSG than those without surgery.
The study concludes that the health related quality of life is better in obese patients after LSG than those
without surgery. The study also strongly recommends the conduct of long term longitudinal qualitative
studies with multiple points of measurements and follow-ups to be extended to the community.
Keywords: Quality of Life, Laparoscopic Sleeve Gastrectomy, Physical Component Score, Mental
Component Score, Obesity.
Of the eight dimensions of QoL assessed, the mean respectively) and the lowest in General Health ie, GH
scores in all the dimensions were found to be good in BS (53.90 + 8.95). On the other hand, the dimension GH
group with the highest score in Role Limitations due to was found to be very poor in obese group (38.2 + 12.46)
Emotional Problems ie, REF (88.67 + 30.05), followed followed by REF with a score of 41.33 + 31.11 and RPF
by Physical Functioning ie, PF and Role Limitations due 47.75 + 24.89. The other dimensions showed only a
to Physical Health ie, RPF (86.95 + 23.41, 86.25 + 33.59 slightly above average score.
Table 2: Distribution of subjects based on the physical and mental component mean scores of QoL N=200
BS (n=100) OBESE(n=100)
Component
Min. Max. Mean SD Min. Max. Mean SD
Physical component score (PCS) 5 100 83.68 21.8 3 84 52.34 18.95
Mental component score (MCS) 0 100 85.74 22.72 25 83 49.98 11.84
Both PCS and MCS were found to be high in BS Table 3 Mean and Standard deviation of the overall
group. The mental component score was higher (85.74 + QoL in BS group and obese group N=200
22.72) than the physical component score (83.68 + 21.8)
in BS group whereas the mental component score was QoL Minimum Maximum Mean SD
poor in obese group (49.98 + 11.84) than the physical QoL BS group 22 94 80.93 18.18
component score (52.34 + 18.95). QoL Obese group 15 77 49.69 11.77
Majority (62%) in the BS group perceived their The mean scores of QoL (dimension wise,physical
present general health much better compared to one year and mental componentsand overall) were found to be
ago while only 6% of the obese group perceived it so. good in BS group than the obese group. Similar findings
The rest 42% in the obese group perceived their general were observed in studies conducted mostly abroad.
health as somewhat worse than one year ago and for Substantial and significant improvement in physical and
25%, it was status quo. mental health favouring the surgical group was observed
in a systematic review and meta-analysis on long term
Since the p-value obtained by the K-S test was HRQL in bariatric surgery patients compared with
less than 0.05 significance level in all the dimensions controls spanning 5 to 25 years after surgery.16 Sleeve
or components, the two groups were considered as gastrectomy has been found to improve QoL and allows
heterogeneous. Hence Mann - Whitney U test was used reduction of comorbidities.17,18
to compare the mean scores of both the groups. It showed
a highly significant statistical difference between the BS Studies by Akan et al., Fezzi et al., Porta et al. and
group and obese group in their Mean QoL (over all, Rebibo et al. demonstrated significant improvement in
dimension wise and component wise). Hence the null all domains of the SF-36 in 6 and 12 months after surgery
hypothesis was rejected. compared to preoperative scores.19,20,21,22 Two studies
in Indian settings also showed similar improvements in
Of the six socio-demographic variables (age, QoL one being in kerala.23,24
gender, marital status, education, occupation and type
of work), statistically significant association was found Long term studies like the famous Swedish Obese
between age, education, occupation and QoL (p value Subjects (SOS) intervention study, Norway(2014)
< 0.05). A highly significant statistical association was systematic database search for a period of 10 years
found between duration after surgery and QoL in the found significantly better outcome in the surgical group.
BS group. 86% of the subjects studied were between But the peak improvements in HRQL after bariatric
6 months to 5 years after LSG. Of, these 94.18% had surgery was during the first year, whereas the weight
good QoL. However, QoL was good only in nine out of regain phase (mainly between 1 and 6 year follow-up)
fourteen subjects who had undergone bariatric surgery was accompanied by a gradual decline in HRQL.25,26
five years before.
Some studies could prove significant improvement
Discussion only in selected dimensions of QoL.An Italian study
(2014) to evaluate the changes of HRQL after bariatric
LSG is the recent bariatric surgery performed to surgery in 110 patients using SF- 36 showed a significant
reduce excess weight and improve QoL in morbidly improvement in all dimensions of SF- 36 except General
obese. Though studies have shown that QoL can health and Mental health.27In Poland the SF 36 scores
improve as soon as three months after bariatric surgery, were statistically different in all parameters (P < 0.05)
the present study included only subjects who underwent except for “role limitations attributed to emotional
LSG from six months to six years under the assumption problems” and “mental health” in a group of 120 patients
that patients may have surgery related discomforts that in comparison with patients scheduled for surgery.28A
may interfere in their QoL within six months.15
610 Medico-legal Update, January-March 2021, Vol. 21, No. 1
systematic review with 72 studies on 9433 patients found of psychological disorders like depression so that
that bariatric surgery has a significant positive influence appropriate referral services could be offered. Finally
on QoL in general with a greater positive influence on aggressive, comprehensive measures should be taken
physical QoL compared to mental QoL.,29,30,31,32,33 by the regional, state and national level governments to
prevent obesity from childhood as patients after bariatric
These findings are different from the present study surgery have to live with restrictions hour as India ranks
findings in that the QoL had significantly improved in third in obesity in the world.
mental dimensions than the physical dimensions. The
difference may be due to the improvement in self esteem, Conclusion
societal and family acceptance felt by the subjects
probably influenced by the age, education and culture. The study concludes that the health related quality
of life is better in obese patients after LSG than those
Contradictory to the findings of the present study, without surgery in the study subjects. Hence the
the physical and mental component scores were null hypothesis is rejected. The study also strongly
significantly found to be lower than the norm population recommends the conduct of long term longitudinal
mean in a Midwestern academic medical center study qualitative studies with multiple points of measurements
on 350 patients after bariatric surgery (2015). The and follow-ups to be extended to the community.
study concluded that improvements in HRQL following
bariatric surgery do not appear to be sustained over long Acknowledgement: The investigator deeply thanks
term.34 the subjects for their active co-operation during the
study.
Recent literature has raised concerns regarding
the risk of adverse psychiatric events among bariatric Conflict of Interest: Nil
surgery patients. The improvement in MCS score found Source of Funding: Self
in the present study is contrary to a recent study by
Szmulewicz A, et al. 2019 who did a systematic review Ethical Clearance: The research proposal and
and meta-analysis of RCTs that compared surgical and tools were presented before the Institutional Scientific
non-surgical treatments and assessed mental health QoL Committee and Institutional Ethical Committee and
of bariatric surgery patients. Eleven randomized trials got approval. Permission for data collection was also
with 731 participants were included in the finalanalysis. obtained from the heads of the departments. Informed
The final mentalhealth QoL scores were similar for consent was obtained from each study subject
surgically and non-surgically treated patients (SMD:
0.37, 95% CI -0.07 to 0.81). These results suggest that References
intensive mental health follow-up following surgery
1. Alkassis M, Haddad FG, Gharios J, Noun R,
should be routinely considered.35
Chakhtoura G. Quality of Life before and after
In general it can be stated that most of the studies Sleeve Gastrectomy in Lebanese Population.
showed improvement in HRQL after LSG in 6-80 Journal of obesity. 2019;2019.
months follow-up in adult population. The impact varied 2. Hosseini SV, Al Hurry AM, Khazraei H, Hadavi
considerably across studies showing a significantly H. The effect of laparoscopic sleeve gastrectomy
greater positive influence on physical QoL compared to on patients’ quality of life in Shiraz. Journal of
mental QoL. Minimally Invasive Surgical Sciences. 2018
Feb;7(1).
Clinical Application: The compliance of the
3. Nickel F, Schmidt L, Bruckner T, Buchler WB,
bariatric surgery subjects to the new lifestyle and
Stich BP, Fischer L. Influence of bariatric surgery on
changes during weight loss/weight regain periods
quality of life, body image and general self-efficacy
could be enhanced only by consistent follow up by the
within 6 and 24 months- a prospective cohort
community health workers resulting in better QoL. The
study. Surgery for obesity and related diseases.
fluctuations in weight loss after crossing certain threshold
[Internet].2016 month[date of citation];volume:
needs further longitudinal studies with multiple check
[about 13 pages].
points.36 Listening to the psychosocial issues of these
patients would help in detecting early the manifestations 4. Brown D, Edwards H. Lewis’s Medical Surgical
Medico-legal Update, January-March 2021, Vol. 21, No. 1 611
Nursing- Assessment and management of clinical 16. Kristina F. Endocrinology Gastric Sleeve Works
problems. 7th ed. Place of publication: Elsevier; Long Term Obese patients., MedPage July 16, 2013,
year. 2011 Page No. 976 - 992. https://www.medpagetoday.org/endocrinology/
5. Le Foll D, Lechaux D, Rascle O, Cabagno G. Weight obesity/40490?vpass=1
loss and quality of life after bariatric surgery: a 17. Vasileios C, Georgios B, Vasileios L, Eelco de
2-year longitudinal study. Surgery for Obesity and B. Quality-of-Life Before and After Laparoscopic
Related Diseases. 2020 Jan 1;16(1):56-64. Sleeve Gastrectomy. A Prospective Cohort Study.
6. Still C, Sarwer DB, Blankenship J. The ASMBS Article in Surgery for Obesity and Related
Textbook of Bariatric Surgery. New York, NY: Diseases 11(1) · May 2014 DOI: 10.1016/j.
Springer Science, Media; 2014 soard.2014.04.024
7. Grothe KB, Dubbert PM, O’Jile JR. Psychological 18. Flolo TN, Tell GS, Kolotkin RL, Aasprang A,
assessment and management of the weight loss Norekvål TM, Våge V, Hufthammer KO, Andersen
surgery patient . American Journal of Medical JR. Changes in quality of life 5 years after sleeve
Sciences, 2006, 331(4), 201- 206. doi: 00000441- gastrectomy: a prospective cohort study. BMJ
200604000-00006 [pii]. open. 2019 Sep 1;9(9):e031170
8. Song A, Fernstrom MH. (2008). Nutritional 19. Akan S, Uruc F, Aydin MT, Verit A. The effect of
and psychological considerations after bariatric sleeve gastrectomy technique on women’s sexual
surgery. Aesthetic Surgery Journal, 28(2), 195- function: A prospective study. Rev Int Andrología
199. doi: S1090-820X(08)00027- 7 [pii]10.1016/j. [Internet]. 2018;16(4):167–73.
asj.2008.01.005 20. Fezzi M, Kolotkin RL, Nedelcu M, Jaussent
9. Moly KT, Shajan S, Johny S. Quality of Life and A, Schaub R, Chauvet MA, et al. Improvement
Depression in Obese. Indian Journal of Public in Quality of Life After Laparo- scopic
Health Research & Development. 2019;10(9):266- Sleeve Gastrectomy. Obes Surg [Internet].
70 2011;21(8):1161–7.
10. Sarkhosh K, Birch DW, Sharma A, Karmali S. 21. Porta A, Aiolfi A, Musolino C, Antonini I, Zappa
Complications associated with laparoscopic sleeve MA. Prospective Comparison and Quality of Life
gastrectomy for morbid obesity: a surgeon’s guide. for Single-Incision and Conventional Laparoscopic
Canadian journal of surgery. 2013 Oct;56(5):347. Sleeve Gastrectomy in a Series of Morbidly Obese
Patients. Obes Surg [Internet]. 2017;27(3):681–7.
11. Gilmartin J. Body image concerns amongst massive
weight loss patients. Journal of clinical nursing. 22. Rebibo L, Verhaeghe P, Tasseel-Ponche S, Cosse
2013 May;22(9-10):1299-309. C, Maréchal V, Dhahri A, et al. Does sleeve
gastrectomy improve the gait parameters of
12. Sarwer DB, Wadden TA, Fabricatore AN.
obese patients? Surg ObesRelat Dis [Internet].
Psychosocial and behavioral aspects of bariatric
2016;12(8):1474–81.
surgery. Obesity research. 2005 Apr;13(4):639-48.
23. Bal RS, Ahuja A, Virk SS. Difference in Quality
13. https://www.rand.org/health-care/surveys_tools/
of Life in Morbidly Obese Patients after Bariatric
mos/36-item-short-form.html
Surgery. Poster [Internet]. 2012 .
14. Sinha R, van den Heuvel WJ, Arokiasamy P.
24. Dasgupta A, Wasir J, Beloyartseva M, Malhotra S,
Validity and reliability of MOS short form health
Mithal A. An observational longitudinal study of the
survey (SF-36) for use in India. Indian journal of
impact of sleeve gastrectomy on glycemic control
community medicine: official publication of Indian
in type 2 diabetes mellitus. Diabetes Technology
Association of Preventive & Social Medicine. 2013
and Therapeutics. 2013; 15(12): 990-995
Jan;38(1):22
25. Karlsson J, Taft C, Ryde A, Sjo S, Sullivan M. Ten
15. Faria GF, Santos JM, Simonson DC. Quality of life
–year trends in health related quality of life after
after gastric sleeve and gastric bypass for morbid
surgical and conventional treatment for severe
obesity. Porto Biomedical Journal. 2017 Mar
obesity; SOS intervention study. International
1;2(2):40-6. Quality-of-life measures improve as
Journal of Obesity.[Internet].2007 month[date of
early as 3 months after bariatric surgery
citation];31: [about 13 pages]. Available from www.
612 Medico-legal Update, January-March 2021, Vol. 21, No. 1
nature.com site---- DOI:10.1038/SJ.IJO.0803573. on patients’ quality of life in Shiraz. Journal of
26. Andersen JR, Aasprang A, Karlsen TI, Natvig GK, Minimally Invasive Surgical Sciences. 2018
Våge V, Kolotkin RL. Health-related quality of Feb;7(1).
life after bariatric surgery: a systematic review of 32. Van Nunen AM, Wouters EJ, Vingerhoets AJ, Hox
prospective long-term studies. Surgery for Obesity JJ, Geenen R. The health-related quality of life of
and Related Diseases. 2015 Mar 1;11(2):466-73. obese persons seeking or not seeking surgical or
27. Nadalini L, Zenti MG, Masotto L, Indelicato L, non-surgical treatment: a meta-analysis. Obesity
Fainelli G, Bonora F, Battistoni M, Romani B, surgery. 2007 Oct 1;17(10):1357
Genna M, Zoppini G, Bonora E. Improved quality 33. Bolen SD, Chang HY, Weiner JP, Richards TM,
of life after bariatric surgery in morbidly obese Shore AD, et.al, Clinical outcomes after bariatric
patients. Interdisciplinary group of bariatric surgery surgery: a five-year matched cohort analysis in
of Verona (GICOV). Il Giornale di chirurgia. 2014 seven US states. Obes Surg. 2012 May;22(5):749-
Jul;35(7-8):161. 63. doi: 10.1007/s11695-012-0595-2
28. Haldis, Lier, Eva Bringer, Oddbjorn Hove, 34. Khandalavala BN, Geske J, Nirmalraj M, Koran-
BjarteStubhaug and Tong Tangen Health and Scholl JB, Neumann-Potash L, McBride CL.
Quality of life outcomes. Quality of life among Predictors of health-related quality of life after
patients undergoing bariatric surgery: associations bariatric surgery. Obesity surgery. 2015 Dec
with mental health. A 1 year follow-up study of 1;25(12):2302-5.
bariatric surgery patients. http//www.hqlo.com/ 35. Szmulewicz A, Wanis KN, Gripper A, Angriman
content/9/1/79 F, Hawel J, Elnahas A, Alkhamesi NA, Schlachta
29. Lindekilde N, Gladstone BP, Lübeck M, Nielsen CM. Mental health quality of life after bariatric
J, Clausen L, Vach W, Jones A. The impact of surgery: A systematic review and meta‐analysis of
bariatric surgery on quality of life: a systematic randomized clinical trials. Clinical obesity. 2019
review and meta‐analysis. Obesity reviews. 2015 Feb;9(1):e12290.
Aug;16(8):639-51. 36. Prof. Moly K. T., “Excessive Weight Loss
30. Hachem A, Brennan L. Quality of life outcomes and Quality of Life after Laparoscopic Sleeve
of bariatric surgery: a systematic review. Obesity Gastrectomy—A Correlational Study”, Indian
surgery. 2016 Feb 1;26(2):395-409. Journal of Public Health Research & Development,
31. Hosseini SV, Al Hurry AM, Khazraei H, Hadavi vol. 10, no. 6, pp. 296-301, 2019
H. The effect of laparoscopic sleeve gastrectomy
DOI Number: 10.37506/mlu.v21i1.2379 Medico-legal Update, January-March 2021, Vol. 21, No. 1 613
Muhyidin
Abstract
The focus of this research study is the law on the distribution of joint assets and child custody as a result of
divorce against husbands and wives who work based on justice value. Article 97 Compilation of Islamic Law
which determines that widows of divorced widows get a half share of the joint property. This is inseparable
from the provisions of Article 31 and Article 34 of Law Number 1 of 1974 concerning Marriage. This
study uses normative juridical method, sociological juridical method, and comparative juridical research
method; and using decision data and interviews with judges of the religious courts, using critical paradigms
and using inductive qualitative analysis. The results of the study were that the judge had begun to make
legal discoveries. Factors that influence the ruling of the religious courts that do not bring about justice
are substantial, structural, and cultural factors. The current division of shared assets and the rights of child
ownership as a result of divorce is not yet fair, meaning that the construction of the distribution of shared
assets and child rights as a result of divorce is currently granted by The reconstruction of the legal value of
the distribution of shared assets due to divorce is carried out casually based on its contribution by taking into
account the benefit and well-being of the company.
Keywords: Child rights, custody, child care, marital assets, family law.
Introduction has become a direct source of law without the need for
assistance/intermediaries for customary law3. Marriage
Marriage law is part of the teachings of Islam
law that applies to all Indonesian people, namely Law
that must be obeyed and implemented according to
Number 1 of 1974 concerning Marriage, was ratified and
the religious provisions. With the enactment of Law
signed by the President Soeharto in Jakarta on January
Number 1 of 1974 concerning Marriage, the reception
2, 1974, and that day was also promulgated and signed
theory by Snouck Hurgronje as taught in the Dutch East
by the Minister/Secretary of the Republic of Indonesia
Indies era was erased formally1. The reception theory
Maj. Gen. Sudarmono, as well as being included in the
is a theory which states that Islamic law only applies in
1974 State Gazette no. 1 and the explanation contained
Indonesia to adherents of Islam, if something Islamic
in the additional sheet of the Republic of Indonesia No.
law has clearly been permeated by and in customary
3019. This law contains 14 chapters and 67 articles. In it
law2. By looking at certain articles in this Marriage Law
regulates the basis of marriage, conditions for marriage,
there is no doubt to accept the argument that Islamic law
marriage prevention, marriage cancellation, marriage
agreements, rights and obligations of husband and
wife, property in marriage, marriage termination and
its consequences, child status, rights and obligations
between parents and children, guardianship and other
Corresponding Author:
provisions4,5,6.
Muhyidin
Lecturer at Faculty of Law, Diponegoro University, Jl. For the smooth implementation of Law Number 1
Prof. Soedarto, Tembalang, Semarang, Central Java of 1974 the government issued Government Regulation
50275, Indonesia Number 9 of 1975 concerning Implementation of Law
e-mail: [email protected] Number 1 of 1974. Government Regulation Number
614 Medico-legal Update, January-March 2021, Vol. 21, No. 1
9 of 1975 is contained in State Gazette No. 12 and its provisions: The state guarantees the independence of
explanation in the Supplement to the State Gazette each population to embrace their respective religions
No. 3050. Government Regulation Number 9 of 1975 and to worship according to their religion and beliefs.
contains 10 Chapters and 47 articles. The study aims to From the provisions of article 29 paragraph (2), the
examine further the case of the distribution of shared government has the right to regulate certain issues based
assets and the right of child care due to divorce of on Islamic law, to what extent these regulations are
husband and wife. Different from the perspective offered intended for citizens who are Muslim11.
in previous studies, this paper also aims to examine the
right for child custody after divorce7,8,9. This is based Child Rights on Shared Assets as Results of
on the assumption that there is an absence regarding Divorce: Regarding the consequences of divorce against
clear arrangements regarding the distribution of shared children Law Number 1 of 1974 concerning Marriage
assets, as well as child custody due to divorce in Islamic under Article 41 determines that the mother or father
Marriage Law. remains obliged to look after and educate their children,
solely based on the interests of the child, if there is a
Marriage in Religious and Legal Perspectives: dispute regarding childcare, the court gives its decision.
Marriage is very important in the lives of people, The father is responsible for all the maintenance and
individuals and groups. By way of a legal marriage, education costs required by the child, if in fact the
the association of men and women takes place in an father cannot provide this obligation, the court can
honorable manner according to the position of humans determine that the mother will share the costs. Article
as respectable beings. Relationships of married life are 149(d) Compilation of Islamic Law, stated that if the
fostered in an atmosphere of peace, tranquility, and marriage is broken because of divorce, then the ex-
affection between husband and wife. The offspring of husband is required to provide child custody fees for
the result of a legal marriage adorns family life and at his children who have not reached the age of 21 years
the same time is a continuation of human life in a clean old12,13,14. According to Law Number 1 of 1974 and
and respectful manner. Human relations between men the Compilation of Islamic Law, parental divorce does
and women are determined to be based on a sense of not eliminate the obligation of parents to care for and
devotion to God and devotion to humanity in order to educate their children. It is the father who is responsible
carry on the life of its kind. Marriage is carried out on for bearing the costs of maintaining and educating his
the basis of the willingness of the parties concerned, children with the provisions that if in reality the father
which is reflected in the provisions of the marriage cannot fulfill his obligations, then the mother can also be
before marriage and consent granted in the marriage burdened to bear the costs. As a result of divorce against
ceremony which is also witnessed before the public in a child is about the issue of parental power, with the
an event. The rights and obligations of a husband and divorce resulting in the termination of marriage, the court
wife are regulated very neatly and in an orderly manner, determined that each of the children who had not grown
as well as the rights and obligations between parents and up who of the parents who do guardianship. Regarding
children. If there is a dispute between husband and wife, the trusteeship it is up to the judge who determines and
it is also arranged how to deal with it. It also guided who will be appointed guardian only in the appointment
the customs of social courtesy in the family as well as must be considered the interests of the child.
possible so that harmony of life remains maintained and
guaranteed. Most people, especially parents or husband and
wife, do understand and realize that caring for their
From the foregoing, it can be seen that marriage child is an obligation. However, there are also those who
has a very important position in Islamic law because mistakenly carry out child care, so that there are only
the marriage law regulates family life procedures which those who are concerned only with the physical growth
are the core of people’s lives in line with the position of their children and meet the material needs of children
of humans as respectable beings over other creatures10. excessively, without regard to the child’s mental growth
Opinion which states that the reception theory both as and the spiritual needs of children in the form of attention
a theory and as a provision in article 134 paragraph 2 to mental development and giving love affection for him.
Indische Staatsregeling has been erased by the enactment This mistake may be caused by the lack of understanding
of the 1945 Constitution. This can be seen in the 1945 of the parents of the meaning and understanding of the
Constitution article 29 paragraph (2), which contains child care, as well as the obligations that exist in it.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 615
Child care is an authority to care for and educate result of the marriage breaking up due to divorce are that
people who have not been adults who have not sufficiently children who are in teen have the right to choose custody
acquired their intelligence. The emergence of the child of the child from their father or mother. One thing that
care problem is sometimes caused by divorce or because needs to be warned is that whoever is ultimately chosen
of death where children are not yet mature and are no to be followed, the success of education in order to
longer able to take care of themselves, hence the need for become a godly child becomes the joint responsibility of
people who are responsible for caring for and educating his father and mother. Everything is discussed together,
the child15,16,17. Child care is to equip children materially divorce father and mother do not result in the child being
and spiritually, mentally and physically so that children a victim. The child should never instill hatred to parents,
are able to stand alone in facing life and later life when mothers should not make the father’s name in the face
he is an adult. Child care covers all the needs of the of the child, and vice versa. The child who follows the
child, physically and spiritually. So including child care father should not be separated at all from his mother
is to develop the intellectual soul of children through and the child who follows the mother should never be
education. separated from his father’s relationship.
Assist Prof., Department of Optics Technology, College of Health and Medical Technology, Middle Technical
University, 10047 Bab Al Muadham, Baghdad, Iraq
Abstract
Introduction: Regular Astigmatism is one of the most common problems for the eye; it makes a patient
unable to see things clearly. Therefore, the aim of the study estimates the incidence of regular astigmatism
among age group (10-32) years by using physical exerciser in the college of health and medical technology.
We perform therapeutic exercises in an applied scientific way to activate the towed eye muscles by the
pulled during treatment sessions to get rid of regular astigmatism and improve vision without the use of
glasses or surgery to patients.
Materials and Method: The method used in this study was a cross-sectional analysis of 100 cases (51
males) (49 females) with different types of astigmatism through physical exercise. The data analysed using
the SPSS package program.
Results: We found the compound astigmatism (58%) is higher than simple astigmatism (33%), as well as
the compound astigmatism is higher than mixed astigmatism (13%). Also, we found to improve in (90%)
patients treatment for continuous exercise as requested by the therapist.
Conclusion: This study that most patients of Astigmatism were compound and improvement in 90% of
cases treatment by physical exercise and did not need to use any glasses to read during the examination and
get ‘Visual Acuity’ VA=6/6.
Keywords: Regular Astigmatism, Physical Exercises, New Treatment, Visual Acuity, Astigmatism Treatment.
Causes
Types of Regular Astigmatism Total
Smart Devices Continuous Reading Others
Simple Astigmatism 22 8 3 33
Compound Astigmatism 40 14 4 58
Mix Astigmatism 05 03 1 09
Total 67 25 8 100
Table (3): Distribution of cases of regular astigmatism by age (year) and type of regular astigmatism.
Table (4): Distribution Visual Acuity (VA) of cases of Regular Astigmatism (R.A) before and after treatment
without glass.
Table (5): Distribution of cases of regular astigmatism by groupage and family history.
Family history
Total
Family history Age Positive Negative
N % N % N %
10 – 15 15 37.5% 25 41.5% 40 40%
16 – 21 12 30% 20 33.5% 32 32%
22 – 27 7 17.5% 10 16.5% 17 17%
Up to 32 6 15% 5 8.4% 11 11%
Total 40 40% 60 60 100 100%
Table (5) shows that cases with a negative family exercises with the use of medicinal drugs and 90% of
history of astigmatism accounted for more than 60% patients have been treated, most of them were the degree
of those without a negative family history, particularly of vision produced 6/6 without glasses.
those with a 41.5% negative family history age group of
10-15 years. It also found that the prevalence of astigmatism
in patients between the ages of 10 and 15 due to the
Discussion excessive use of electronic devices (smart devices) and
their inability to wear glasses when continuous reading
The number of males is marginally higher than that is caused by a higher prevalence of 16 % between the
of females for a retrospective study of medical data on ages of 16 and 21. For this report, the number of patients
100 patients, the proportion of males is 51 %, while the who use smart devices are 67% .According to a study
ratio of females is 49%. In this study, we found that 52% carried out in the United States, we found similar results
of patients have a complex type of normal astigmatism in which compound astigmatism is more prevalent
and that most patients have modified the way visual among students than simple and mixed astigmatism. In
acuity(VA) is viewed from prescription glasses to addition, Family history is a significant risk factor in
physics therapy exercises. This is the ease of therapeutic children with regular astigmatism.
622 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Clinical initiatives and identification of method of review of astigmatism and its possible genesis.
treatment have shown how patient outcomes can be Clinical and Experimental Optometry; 2007.
improved, that is, by recognizing and moving weak 4. Gilbert Smolin; Charies Stephen Foster; Dimitri
eye muscles and finding the test. During exercises 1-6 T-Azar; Claes H.Dohlman.Smolin and Thofts
sessions, the patient turns the eye in all directions and the Cornea; Scientific Foundations and Clinical
forces it forward to minimize the eye muscle pressure by Practice; 2005.PP173.
about 15 minutes to strengthen the weak eye. Therefore,
5. Afsaneh Khetrapal, BSc Astigmatism Types-
both patients were treated and strengthened in the degree
Regular and Irregular. News Medical Life Sciences;
of concern of each session with therapeutic exercises
2018.
and did not need to use any glasses to read during the
test and to achieve ‘ visual acuity ‘ VA=6/6. 6. Waddell K. Spherical refraction for general eye
workers. J comma eye health 2000, 6-7.
Conclusion 7. Mohamed EL-Rifai. Text Book of Clinical
Ophthalmic Optics. Egypt, 2007.
It was recommended that all patients should
be tested for their visual acuity and that all cases of 8. Carlo Cavallotti; Luciano Cerulli.Age – Related
astigmatism (regular astigmatism) should be treated changes of the human eye. Springer Science &
with glasses at first and checked every six months to see Business Media; 2008.pp49.
the difference in the degree of astigmatism that, if any, 9. Harvery, EM. Development and treatment of
or any complications in the eye due to misuse of smart astigmatism. Optometry and vision science;
devices (It is necessary to use MC-lenses to prevent official publication of the American Academy of
harmful radiation from smart devices). It must to treat optometry; 2009.
by Physical exercises and at least advised the patient 10. Boyd, Benjamin F. Modern Ophthalmology, The
wearing glasses and conduct exercises according to high lights. Panama; Jaypee Brothers Medical Pub;
instructions the therapist. After the end of this study are 2011. P.388.
advised to adhere to therapeutic exercises to get rid form
11. Mozayan,E, Lee, astigmatism management.
correct regular astigmatism. Upon completion of this
Current opinion in ophthalmology. 2014.
research are advised to adhere to therapeutic exercises to
12. Kleinstein, R. N. Jones, LA; Hullett, S. Refractive
get rid form regular astigmatism.
Error and Ethnicity in Children; 2003.
Acknowledgments: The author would like to thank 13. Bourne, R; Dineen, BP;Ali, SM; Noorul Huq,
the patients who have kindly offered their time to take DM; Johnson, GJ. Prevalence of refractive error in
the information and confidence in the treatment method. Bangladeshi adults; 2004.
The author would also like to thank the College of Health
14. Yung-Feng Shih. The Prevalence of Astigmatism
and Medical Technology, Middle Technical University,
in Taiwan Schoolchildren, Optometry and Vision
Baghdad, Iraq, for their moral support.
Science; 02/2004.
Conflict of Interest: Non 15. Ostadimoghaddam H, Fotouhi A, Hashemi H,
Yekta A. Heravian J, Re zvan F,et al. Prevalence
Source of Findings: Self-findings. of the astigmatism by age and gender in Mashhad,
Ethical Clearance: Non Iran: The Mashhad eye study . Clin Experiment
Ophthalmic; 2011.
References 16. Andrew A. Dahl, MD, FACS. Astigmatism.
Medicine Net; 2013. https://www.medicinenet.com/
1. Andrew A. Dahl, MD, FACS. Astigmatism; 2012.
astigmatism_overview/article.htm#astigmatism_
https://www.emedicinehealth.com/astigmatism/
facts
article_em.htm#what_is_an_astigmatism
17. Gary L. Mancil, O.D., (Principal Author).
2. Gary Heiting, OD. What is astigmatism? 2018.
Optometric Clinical Practice Guideline Care of
https://www.allaboutvision.com/conditions/
the Patient with Presbyopia. American Optometric
astigmatism.htm
Associattion; 2011.
3. Read, Scott A; Collins, Michael J;Carney, Leo G.A
18. George Biddel Airy. On a peculiar Defect in the
Medico-legal Update, January-March 2021, Vol. 21, No. 1 623
eye,and a mode of correcting it. Transactions of 23. Munther. S SH.,Zina T.A, The biophysical efficacy
the Cambridge Philosophical Society; 28 October of smart phoneson the eyes of children from3=12
2016. years,Indian Journal of Forensic Medicine &
19. Jack J. Kanski, MD, MS, FRCS, FRCOphth. Toxicology.2020.
Clinical ophthalmology: A Systematic Approach, 24. Sophie J. Bakri, M.D. Book: Mayo Clinic Guide
Book, Clinical Ophthalmology;2006. to Better Vision. 2019. https://www.mayoclinic.
20. Grame Young, Anna Sulley, Chris Hunt. Prevalence org/tests-procedures/lasik-eye-surgery/about/pac-
of astigmatism in relation to soft contact lens fitting. 20384774
Eye & contact lens,2011. 25. PK Mukherjee MS Ophth. Manual of optics &
21. Rose Kivi, and Elizabeth Boskey, PhD Medically, Refraction, Refractive Surgeries; 2015 pp212-232.
MD on November, 2015. 26. Ming Wang, MD, PhD. Irregular Astigmatism
22. Azar Dimitri T. Refractive surgery (2nd). Mosby Diagnosis and Treatment, Book; 2008.
Elsevier; 2007.
624 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2381
Abstract
In this study was to analyse the patterns of maxillofacial fractures in children under 18 years of age admitted
at paediatric maxillofacial surgery department in Tashkent state dental institute, Uzbekistan in a period of 12
years between January 2007 and December 2018.Out of 757 children with maxillofacial bone fractures, the
majority were aged between 6-18 years (78,6%, n=595). The mean (±SD) age was 9.3±0.5 years and male
to female ratio was 6.2:1. Falls was the most frequent mode of injury (46,9%, n=355). The mandible was
most commonly involved (67.2%, n=509) of the cases. The incidence of paediatrics maxillofacial fractures
in Uzbekistan region was high. The 6-18-year olds and boys were most commonly involved in maxillofacial
paediatrics trauma. Mandibular fractures were the most common type of fracture. Safety programs should
be instituted in Uzbekistan region to increase public awareness and to decrease morbidity resulting from
paediatrics maxillofacial trauma.
1Lec./MB,ChB, MSc Anatomy, Department of Anatomy/Al Zahraa College of Medicine, University of Basrah,
2
Assist- Prof/MB,ChB, MSc, PhD Anatomy, Department of Anatomy/Al Zahraa College of Medicine, University of
Basrah, 3Assistant Prof/B.D.S, College of Dentistry/University of Basrah
Abstract
Background: β- thalassaemia is a common hereditary disorders in Iraq and worldwide .with different
treatment schemes,, including blood transfusion, iron chelation and splenectomy, patients with B thalassemia
may develop different skeletal changes. Limited studies link these complications with orofacial changes,
This study aimed to evaluate the orofacial dimensions in β- thalassemia patients with age, gender, blood
groups, splenectomy and cholecystectomy and to assist surgeons for planning their future intervention.
Method: This study was conducted on 130 ß-thalassemia patients of both gender,,and two age categories (20-
30 yrs), & (21-40 yrs), five orofacial measurements (face,eyes,nose,mouth and ears) and sixteen parameters
were measured and calculated for differences,P value is estimated,data analysis were done by using Chi
square test and SPSS version 20
Results: Significant findings were found for mandibular width and mouth width at older age group (31-40
years), the nasal width and ear height are more in male, patients with splenectomy have significance for
lower 1\3 face and ear width. Cholecystectomy increase eye length measurments and ear height but for
blood groups the P ˃ 0.05
Conclusions: Orofacial bone changes are pronounced in β- thalassaemia with distinct findings regarding sex
dimorphism, older are more prone to have variations, earlier splenectomy is advisable,cholecystectomy is
better choice for symptomatic patients, blood groups have no significance.
Age Group
OFM
20-30 31-40
Face width (zy-zy) 96.1 99.3087 0.129
Facial height (n-gn) 107.1111 107.8261 0.801
Face Upper facial Morphological height (n-sto) 68.7944 72.3957 0.099
Maxillary depth (t-sn) 117.1278 118.9174 0.505
Mandibular depth (t-gn) 128.0472 135.7652 0.022
Nasal width (al-al) 34.9139 35.4783 0.527
Nose Nasal height (n-sn) 48.0222 51.3783 0.083
Nasal length (sn-pr n) 14.7778 17.2391 0.136
Mouth width (ch-ch) 42.8556 45.6696 0.041
Mouth
Lower third face height (sn-gn) 59.0222 58.0826 0.616
Outer eye space (ex-ex) 90.8333 91.1261 0.94
Eye Inner corner eye space (en-en) 33.3306 34.0174 0.344
Eye length (en-ex) 30.6806 31.5 0.373
Ear width (pra-pa) 36.6861 37.1261 0.785
Ear
Ear Height (sa-sba) 54.9417 56.4917 0.367
P<0.05 is significant
630 Medico-legal Update, January-March 2021, Vol. 21, No. 1
No significant differences were detected between higher results in male patients (p = 0.019), (p = 0.011)
male and female in orofacial measurement, except for respectively Table 2.
nasal width (al-al), and ear height (sa-sba) which show
Sex
OFM P-value
Female Male
Face width (zy-zy) 96.5364 98.3846 0.377
Facial height (n-gn) 105.9182 109.2577 0.228
Face Upper facial Morphological height (n-sto) 69.0091 71.7077 0.211
Maxillary depth (t-sn) 115.2303 121.1192 0.022
Mandibular depth (t-gn) 129.1515 133.4731 0.199
Nasal width (al-al) 34.2485 36.2577 0.019
Nose Nasal height (n-sn) 48.5212 50.3577 0.338
Nasal length (sn-pr n) 16.3364 14.9769 0.405
Mouth width (ch-ch) 43.5515 44.4615 0.509
Mouth
Lower third face height (sn-gn) 57.3091 60.3654 0.093
Outer eye space (ex-ex) 89.7 92.5308 0.455
Eye Inner corner eye space (en-en) 33.0182 34.3346 0.062
Eye length (en-ex) 30.7303 31.3423 0.498
Ear width (pra-pa) 37.2667 36.3385 0.557
Ear
Ear Height (sa-sba) 53.6942 57.8962 0.011
Relation of different blood groups and orofacial parameters were insignificant for all parameters (face, nose, ear,
eyes and ears) as shown in Table 3.
Table 3: Comparison between blood groups of B thalassemia patients and orofacial measurments
Blood group
OFM P-value
A B O
Face width (zy-zy) 97.4048 97.7941 96.9381 0.947
Facial height (n-gn) 107.9714 108.3 106.0714 0.775
Face Upper facial Morphological height (n-sto) 71 71.4059 68.419 0.464
Maxillary depth (t-sn) 116.3905 118.4529 118.7524 0.716
Mandibular depth (t-gn) 130.7143 130.6 131.7667 0.952
Nasal width (al-al) 34.1095 36.4353 35.1048 0.096
Nose Nasal height (n-sn) 49.2857 50.5059 48.4238 0.685
Nasal length (sn-pr n) 16.9143 14.4353 15.6143 0.472
Mouth width (ch-ch) 43.6952 43.9118 44.2429 0.945
Mouth
Lower third face height (sn-gn) 58.6524 57.7588 59.3857 0.778
Outer eye space (ex-ex) 89.5429 92.6412 90.981 0.808
Eye Inner corner eye space (en-en) 33.6762 33.2059 33.8381 0.768
Eye length (en-ex) 31.3571 31.7588 30.0286 0.253
Ear width (pra-pa) 36.9762 36.3059 37.1857 0.9
Ear
Ear Height (sa-sba) 55.9286 55.7118 55.029 0.897
p˃0.05 NS
Medico-legal Update, January-March 2021, Vol. 21, No. 1 631
In evaluating the effect of splenectomy on OFM, significant difference was detected for the lower third face
height (sn-gn) p=0.04 and ear width (pra-pa) p=0.053. Table 4.
Splenectomy
OFM P-value
-ve +ve
Face width (zy-zy) 97.6 97.0 0.779
Facial height (n-gn) 107.3 107.5 0.926
Face Upper facial Morphological height (n-sto) 69.9 70.5 0.78
Maxillary depth (t-sn) 118.8 116.8 0.442
Mandibular depth (t-gn) 132.6 129.4 0.337
Nasal width (al-al) 35.6 34.6 0.226
Nose Nasal height (n-sn) 50.3 48.3 0.283
Nasal length (sn-prn) 14.3 17.3 0.066
Mouth width (ch-ch) 44.4 43.4 0.454
Mouth
Lower third face height (sn-gn) 56.9 60.6 0.04
Outer eye space (ex-ex) 93.0 88.6 0.244
Eye Inner corner eye space (en-en) 33.7 33.5 0.706
Eye length (en-ex) 31.1 30.8 0.74
Ear width (pra-pa) 38.3 35.3 0.053
Ear
Ear Height (sa-sba) 56.7 54.3 0.159
p ˂ 0.05 = Significant
Table 5 show significant difference for cholecystectomy and orofacial measurements regarding eye length (en-
ex) (p=0.000) and ear height (p= 0.019).
Cholecystectomy
OFM P-value
-ve +ve
Face width (zy-zy) 97.8 92.1 0.118
Facial height (n-gn) 107.8 102.8 0.31
Face Upper facial Morphological height (n-sto) 70.6 65.8 0.215
Maxillary depth (t-sn) 118.0 116.0 0.665
Mandibular depth (t-gn) 131.3 129.0 0.704
Nasal width (al-al) 35.1 36.0 0.545
Nose Nasal height (n-sn) 49.6 46.3 0.333
Nasal length (sn-pr n) 15.9 13.6 0.422
Mouth width (ch-ch) 44.1 42.5 0.53
Mouth
Lower third face height (sn-gn) 58.9 56.4 0.452
Outer eye space (ex-ex) 91.8 81.9 0.142
Eye Inner corner eye space (en-en) 33.7 32.6 0.372
Eye length (en-ex) 31.5 26.1 0.000
Ear width (pra-pa) 37.4 31.1 0.021
Ear
Ear Height (sa-sba) 56.1 49.2 0.019
p ˃ 0.05 NS
632 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Abstract
The objectives of the study is the assessment of torus palatinus (TP) prevalence as well as torus mandibular
is (TM) among different gender and age groups. Seven hundred and fifty (750) out door patients (380 male
and 370 female) were tested for the tori presence or absence at dentistry collage in Basrah city between
January 2019 and June 2019. Sex, gender and location factors were evaluated. The prevalence rate of TP
was 4.73% for male and 5.13% for female, and the prevalence rate of TM was 2.36% for male and 3.24%
for female. In females, TP prevalence was more compared to males. The TP incidence more commonly in
middle aged persons, While the TM more commonly in older persons.
Abstract
Background: Depakine and epanutin are widely used in the treatment of a variety of diseases. A special
attention should be given for their deleterious impacts on genetic material of patients.
Method: Sixty-five male albino mice were separated into four main sections. First is control injected with
normal saline 1ml/kg, second section injected with depakine 25 & 50 mg/kg/day, third section injected with
epanutin 3 & 6 mg/kg/day and fourth section injected with (depakine 25 + epanutin 3) & (depakine 50 +
epanutin 6) mg/kg/day. Injections were via intraperitoneal, samples of both bone marrow erythrocytes for
micronucleus test and hepatocytes for comet assay were collected after one and two weeks for each dose.
Conclusions: Human therapeutic doses range of depakine and/or epanutin generate (s) variable degrees
of damages in genetic material in both bone marrow erythrocytes and hepatocytes of male albino mice
depended on dose and time.
Figure1: Photomicrograph of bone marrow smear of male albino mouse Mus musculus treated with
single dose of epanutin (6 mg/kg b.wt.) for two weeks showing polychromatic erythrocytes (PCEs),
normochromatic erythrocytes (NCEs) and Polychromic erythrocytes with micronucleus (MnPCEs).
Table 1: The (Mean ± SD) of both polychromatic erythrocytes with micronucleus (MnPCEs) and
polychromatic erythrocytes (PCEs)/normochromatic erythrocytes (NCEs) in bone marrow of male albino
mice of control and all treated groups.
Micronucleus Cytotoxicity
Drug Dose mg/kg PCEs/mouse MnPCEs PCEs/NCEs
1st week 2nd week 1st week 2nd week
Control 6000/3 12.7±1.3 12.7±1.3 2.1 2.1
*
25 6000/3 14.0±0.8 19.7±1.7 1.9* 1.8**
Depakine
50 6000/3 24.0±0.8** 33.0±2.5** 1.8* 1.7**
3 6000/3 20.7±3.3 26.3±1.3** 1.7* 1.7*
Epanutin
6 6000/3 35.7±2.1** 39.7±3.3** 1.6* 1.5**
25+3 6000/3 17.7±0.5 23.3±4.2 1.6 1.5*
Depakine+Epanutin
50+6 6000/3 32.3±2.9* 35.3±2.1** 1.5 1.5
Comet Assay: According to tail length 3 classes (mean ± SD) of (number of comets multiplied by class
of nuclei were figured out. Class 0 had no tail; class 1 number) out of total scored 300 randomly selected and
tail is shorter than the diameter of nucleus and class 2 non-overlapping hepatocytes nuclei/group. Statistical
tail length 1 to 2x the diameter of the nuclei as shown analysis was summarized in table 2, it exhibited high
in figure 2. Hepatocytes with no heads were omitted significant increase (P<0.01) in the mean of total comet
from the calculation because they represented dead score in most of treated groups in comparison to control
cells. Total comet score results were expressed by group depend on dose and time.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 641
Figure 2: photomicrograph of comet-FISH product of hepatocytes nuclei of male albino mouse Mus
musculus treated with single dose of epanutin (6 mg/kg b.wt.) for two weeks showing comet class 0 (arrow
head), comet class 1 (single arrow) and comet class 2 (duple arrows).
Table 2: The (Mean ± SD) of comet classes and total comet score in hepatocytes of male albino mice of
control and all treated groups.
Najlaa Abdulameer Ali AL-Dahhan1, Aseel Jassim Albdairi2, Ammar Jabbar Hamad3
1Assist.
Prof., Department of Basic Science, College of Dentistry, University of Kufa, Al-Najaf, Iraq, 2Assist. Prof.,
Department of Physiology, College of Medicine, University of Kufa, Al-Najaf, Iraq, 3Assist. Prof.,Department of
Medicine, College of Medicine, University of Kufa, Al-Najaf, Iraq
Abstract
Background: The ratio of neutrophils to lymphocytes (NLR) and the ratio of platelets to lymphocytes
(PLR)are prognostic factors in many diseases such as inflammatory diseases, cardiovascular diseases and
cancer. However, racing NLR and PLR are important, it is important to establish reference values for NLR
and PLR in polycystic ovary syndrome (PCOS) patients with mild chronic inflammation.
Objective: To determine the neutrophil-lymphocyte ratio (NLR)and platelet-lymphocyte ratio (PLR), and
the relationship between oxidative stress markers and anti oxidants markers in PCOS patients with low-
grade chronic Inflammation. Methodology. The study included 92 patients with PCOS and 46 control. Serum
PON1, XO, SOD activities, 8-OHdG and NO levels were measured using enzyme linked immunosorbent
assay (ELISA) kits.
Results: Concentration of TNF-ɑ, IL-6, IL-8, IL-10 and CRP were significantly higher in PCOS patients
compared with control (P<0.001). Significant increases were recorded in WBC, ANC, PLT, NLR, PLR,
and ESR values. A significant decrease in ALC and MPV values in PCOS patients compared with control
(P<0.01). Serum XO, SOD activities and NOlevels were higher in PCOS patients than in the control
(p<0.001). Serum 8-OHdG levels and PON1 activities were lower in PCOS patients than in the control
(p<0.001). Serum CRP values is positively correlated with XO, NO, 8-OHdG and PON1 activity (r=0.377,
p<0.008; r=0.560, p<0.007; r=0.387, p<0.006; r=0.481, p<0.009), respectively. Serum CRP values is
negatively correlated with SOD activity in PCOS patients (r=−0.444, p<0.004).Serum XO activities were
negatively correlated with serum PON1 and SOD. Serum XO activities were Positively correlated with
serum NO and 8-OHdG levels.
Conclusion: Inflammation stimulates the oxidation process and reduces the ability of cellular antioxidants
in PCOS patients. NLR and PLR are good markers of inflammation, their highest values indicate the
severity of the disease and an imbalance between neutrophils and lymphocytes can be linked to cancer and
its development.
CRP, C-reactive protein; TNF-ɑ, tumor necrosis factor-ɑ; IL-6,interleukin-6; IL-8, interleukin-8.p<0.05 was considered significant
p<0.05 was considered significant; WBC, white blood count. Tumor necrosis factor-alphaCBC,Complete blood counts;ANC,Absolute
neutrophil count; ALC,Absolute lymphocyte count.
Table 4. Serum oxidative stress markers (XO, NO and 8-OHdG) and antioxidative stress markers (SOD and
PON1) in PCOS patients and control.
Table 5. Correlation between Oxidative stress markers, Antioxidative stress markers and CRP in PCOS
patients.
Parameter
p-value
8-OHdG (pg/mL) NO (μmol/L) SOD (U/gm of Hb) PON1 (U/L)
0.472 0.483 −0.375 −0.465
r
<0.006 <0.009 <0.007 <0.008
Abstract
Background: Breakfast is an important meal of the day. Skipping Breakfast has become very prevalent
among health science university students. Therefore, the present study was conducted to find the impact
breakfast habits on the Body Mass Index (BMI), Haemoglobin and Academic performance.
Methodology: Eighty-one, first year undergraduate nursing students from the Nitte (deemed to be University),
were taken for the study, after taking informed consent from them. Purposive sampling Technique was
used to select the students. Students Breakfast habits were assessed by questionnaires, and haemoglobin
(Hb) level was by lab investigation. Standard instruments were used to check the height and weight of the
students.
Results: Revealed that the majority of the students (55.6%) skipped Breakfast. Also, the majority of them
mentioned the reason for skipping Breakfast is lack of time, getting up late, not hungry, not interested
in having Breakfast, and tasteless food. Beside, there was no significant difference found between BMI,
Hb, and Academic Score in breakfast-skippers and non-skippers. Though the present study hasn’t shown
any impact of breakfast habits on physical parameters and academic performance, it may affect on total
nutritional status of the students. So it’s need of the hour to aware the students on the importance of regular
Breakfast.
The prevalence rate is even high among Health Statistical Analysis: Collected data were analyzed
science University students. The study conducted in using SPSS software 22 version. Descriptive statistics
Malaysian Health Science University revealed that the such as frequency and the percentage was used to
majority of students consume Breakfast between one explain the demographic characteristics and to assess the
to three times per week 13. The data from the Saudi reason for skipping Breakfast. An independent sample
Arabian College of Health Sciences showed, 38.7% of t-test was used to find the difference in the BMI, Hb, and
the students eat Breakfast three to four times a week and academic marks of breakfast-skippers and non-skippers.
daily by 49.9% 14. Also, a study from Ghana revealed that P-value is< 0.05 level is considered significant.
72% of Medical students skip the meal 15. The research
conducted in Iran told that 71% of nursing students skip Result
Breakfast 16. Beside a study conducted in Haryana, India Socio-Demographic Characteristics: In the
showed 78.2% of B.Sc Nursing students skip a meal 17. present study, among 81 students, the majority of them
The reason given towards skipping Breakfast was to lose were females (77%) belongs to the age group 17 to 19
weight, no time, waking up late, not having Breakfast to (77%). Most of them from the nuclear family (77%) and
eat, and not hungry 13. stays in the Hostel (74%). The majority of them were
As from the above review, it is clear that breakfast having a normal BMI range (63%) and Hb level (81%).
skipping habits are prevalent among health science Table 1: Reason for skipping Breakfast (n=81)
university students. Also, these reviews have shown that
it has a deleterious effect on cognitive functions; thus, Reason for skipping
Frequency Percentage
it may lead to poor academic performance. As there Breakfast
are very few studies in the field of Nursing concerning Lack of time 67 82.71
breakfast habits, the present study is done to know Anxiety 10 12.34
the prevalence of Breakfast skipping among first-year
Nauseated 7 8.64
nursing students and its effect on academic performance,
BMI, and Hb level. Getting up late 47 58.02
Not hungry 46 56.79
Method Food allergy 2 2.46
A descriptive cross-sectional study was conducted No interest 27 33.33
to assess the breakfast habits and its impact on academic Over weight 7 8.64
performance, BMI, and Hb level. After taking the Tasteless Food 47 58.02
informed consent total of of 81 students of First Year
Fasting 9 11.11
B.Sc. Nursing was taken for the study. Purposive
sampling technique was used to select the above students. Among 81 students, the majority of them said the
reason for skipping Breakfast is lack of time (82.71%),
Data Collection Instruments: Initially,
getting up late(58.02%), not hungry (56.79%), not
demographic characteristics of the participants such
interested in having Breakfast (33.33%), and tasteless
as age, gender, type of family, Residence, attendance,
food (58.02%). (Table 1).
academic grade, diet preference, Hight and weight,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 655
Table 2: Difference in Hb level, BMI and Academic Marks of Breakfast skippers and Non-Skippers (n=81)
An independent t-test showed that there is no significant difference in Hb level (t=-0.006, p=0.995), BMI
(t=1.063, p=0.291) and Academic marks (t=1.181, p=0.241) among Breakfast skippers and non-skippers. (Table2)
Abstract
Self medication is considered as key aspect of primary health care to treat minor symptoms. However,
inappropriate practice of self medication and related potential dangers has become public health concern
worldwide.
Objectives: This study aimed at assessing the prevalence and frequency of practicing self medication.
Common self diagnosed Disorders and prime reasons for engaging in self medication were explored by the
researchers. Also, association between self medication and various sociodemographic variables was also
discovered.
Method: The study employed exploratory design. A self structured questionnaire was administered to 500
students of selected University. The data were summarized and analyzed using descriptive and inferential
statistics.
Results: Overall 442 (88.4%) students practiced self medication and approximately 77% of study subjects
consume self medications occasionally. Headache (84.4%), common cold (83.8%), cough (82.6%) and
gastric acidity (81.8%) were the most common minor ailments for which self medication is being taken.
Major driving factors behind self medication are considering minor ailments non- seriously (83%), easy
availability of medicines (82%) and lack of trust in institute dispensaries (79%). Further, no significant
association was found between self medication practices and age, gender, year of study, academic disciplines,
parents’ education level, place of residence. Conclusion: Prevalence of self medication is remarkably high
among scholars which constitutes health concern that requires conduction of awareness programs on risk
and benefit of self medication at university level and stringent laws on sale of medicines without current
prescription needs to be enforced to control malpractice.
Conflicts of Interest: The researchers, hereby, 10. Bennadi D. Self-medication: a current challenge.
declare there are no conflicts of interest related with Journal of Basic and Clinical Pharmacy. 2014; 5
present study or with materials and procedures used in (1):19–23.
this study. 11. Abay SM, Amelo W. Assessment of self-medication
practices among medical, pharmacy, and health
Ethical Clearance: Ethical approval was taken science students in Gondar University, Ethiopia. J
from institutional ethical committee. Young Pharm. 2010; 2:306–10.
Funding: No 12. Loyola Filho AI, Lima-Costa MF, Uchôa E. Bambuí
project: A qualitative approach to self-medication.
References Cad Saude Publica. 2004; 20:1661–9.
13. G. B. Gutema, D. A. Gadisa, Z. A. Kidanemariam
1. Selvaraj K, Kumar GS, Ramalingam A. Prevalence
et al. Self-medication practices among health
of self-medication practices and its associated
sciences students: the case of Mekelle University.
factors in Urban Puducherry. Perspect Clin Res.
Journal of Applied Pharmaceutical Science 2011; 1
2014 Jan-Mar; 5(1): 32–36.
(10): 183–189.
2. Esan D T, Fasoro AA, Odesanya OE, Esan TO,
14. H. James, S. S. Handu, K. A. J. Al Khaja, S. Otoom,
Ojo EF, Faeji CO. Assessment of Self-Medication
Medico-legal Update, January-March 2021, Vol. 21, No. 1 663
and R. P. Sequeira. Evaluation of the knowledge, M D P. Self-medication and health academic staff.
attitude and practice of self-medication among Ciencia e SaudeColetiva 2010; 15 (5): 2533–2538.
first-year medical students. Medical Principles and 22. C. Buke, M. Hosgor-Limoncu, S. Ermertcan et
Practice 2006; 15(4): 270–275. al. Irrational use of antibiotics among university
15. D. Galato, L. D. M. Galafassi, G. M. Alano, and students. Journal of Infection 2005; 51 (2):135–
S. C. Trauthman. Responsible self-medication: 139.
review of the process of pharmaceutical attendance. 23. Kumar N, Kanchan T, Unnikrishnan B, Rekha T,
Brazilian Journal of Pharmaceutical Sciences 2009; Mithra P, Kulkarni V, et al. Perception and practices
45(4): 625–633. of self-medication among medical students in costal
16. Hussain A and Khanum A. Self-medication among South India. PLoS One. 2013; 8(8):e72247.
university students of Islamabad, Pakistan—a 24. R.M. Helal and H.S. Abou-Elwafa. Self-medication
preliminary study. Southern Med Review 2008. in University students from the city of Mansoura,
1(1): 14–16. Egypt. Journal of Environmental and Public health
17. N. Alam, N. Saffoon, and Uddin R. Self- 2017; 10:1-7.
medication among medical and pharmacy students 25. R. K. Verma, L. Mohan, and M. Pandey. Evaluation
in Bangladesh. BMC Research Notes 2015; 8 (1): of self-medication among professional students in
763. North India: proper statutory drug control must be
18. M. G. Corrêa da Silva, M. C. F. Soares, and A. implemented. Asian Journal of Pharmaceutical and
L. Muccillo-Baisch. Self-medication in university Clinical Research 2010; 3(1): 60–64,
students from the city of Rio Grande, Brazil. BMC 26. D. D. Goel. Self-medication patterns among
Public Health 2012; 12 (1): 339. nursing students in North India. IOSR Journal of
19. K. P. Osemene and A. Lamikanra. A study of the Dental and Medical Sciences 2013. 11(4). 14–17.
prevalence of self-medication practice among 27. A. Auta, D. Shalkur, S. Omale, and A. H. Abiodun.
university students in southwestern Nigeria. Medicine knowledge and self-medication practice
Tropical Journal of Pharmaceutical Research 2012; among students. African Journal of Pharmaceutical
11(4): 683–689. Research and Development 2012; 4 (1): 6–11.
20. S. Badiger, R. Kundapur, A. Jain et al. Self- 28. Lukovic JA, Miletic V, Pekmezovic T, Trajkovic
medication patterns among medical students in G, Ratkcovic N, Aleksic D, Grgurevic A. Self-
South India. Australasian Medical Journal 2012; 5 medication practices and risk factors for self-
(4) :217–220. medication among medical students in Belgrade,
21. De Aquino D S, De Barros J A C, and Da Silva Serbia. PLoS One. 2014; 9(12):e114644.
664 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2388
Abstract
The quality of higher education has become one of the main challenges facing educational systems in the
last two decades. The promotion of services in the field of education and scientific research require active
management that continuously improves academic services.
In this study, after identifying the indicators of the quality of higher education services, a questionnaire
was distributed to 15 experts in order to elite the quality of higher education services in the university to
assess these indicators and select the best effective ones. Then, a second questionnaire was provided to eight
experts to evaluate the performance and the weight of these criteria in the university by using Gray weights.
The result of research revealed that the staff has the highest score and the university has a solid foundation.
In order to reduce the existing gap, relevant academic subjects related to the disciplines need to be provided.
Access to administrative services was improved, as well as electronic office services tailored to students’
needs. In order to reduce the gap created for the environmental index, wider green space need to be developed
within the university and increasing the opportunity for free web access and free access to valid and up-to-
date scientific resources are needed.
Keywords: Service Quality, Higher Education, Gray Weighting, University of Kerbala. Introduction.
The literature review showed only few studies in standards “ at King Abdulaziz University (Saudi Arabia)
Iraq evaluated the service quality in higher education. A presented HEQAM model for improving academic
study assessing the private open university in a study in a services. This model has eight main dimensions
tourism college in Mosul in 2007 reported that technical (curriculum, academic staff, business perspective,
and administrative level was low(20). While a more recent infrastructure, e-services, library services, office services
study in the College of Tourism Sciences concluded and environments).
that there is a kind of good performance related for
the organization, planning and evaluation, and support Research Methodology:
for users, but there is a Kind of average performance Method of data collection
related to resources and facilities(21). Another study
in the Administration and Economics College at the The most important method of data collection in this
university of Anbar concluded that the quality team study were as follows:
lacks accountant of quality costs which made a weak
in detailed documentation of quality costs(22). While a 1. Library study: In this field to collect information in
study in Baghdad University tried to determine the links theoretical Foundations and topic research literature;
between strategic planning and entrepreneurial quality library resources, articles, books and the internet
through a survey among 65 academic staff in three have been used.
faculties concluded that a significant association was 2. Field researches: In this section, a questionnaire was
found(23). Additionally, a study in Dewaniyah Technical used to collect data and information for analysis.
Institute concluded that building a knowledge Society is The questionnaire is a highly structured technique
fundamental point for students satisfaction (24). for collecting data, in which for each answer the
same set of questions are asked. The mentioned
Methodology questionnaire includes:
Tsinidou, Noaman, Ragab, Madbouly, Khedra and (a) General questions: In general questions, the
Fayoumi(18), in their research titled “Higher Educational attempted concentrates on collecting project-
Quality Assesment Model to achieve educational quality
Medico-legal Update, January-March 2021, Vol. 21, No. 1 667
doers’ profile, general and demographic short as possible, hence easily understood, and
information of respondents. to avoid asking negative questions. To design
this section, the 5-option Likert spectrum has
(b) Particular questions: This section contains 57
been used, which is one of the most common
questions related to various factors adapted to
measurement scales.
the literature of the subject. When designing
this section, questions have been tried to be as
In each research, various stages are gone through. the Cronbach Alpha has been used. The estimated value
In many books, a precise number of research steps have of this index for the whole questionnaire was 0.927.
been mentioned, such as the formulation and clarification
of an issue or a topic, literature review, research design, Then, after collecting completed questionnaires and
data collection, data analysis, and writing. However, in order to distinguish criteria with a higher degree of
Sanders and colleagues (2009)(28), believe in rare cases, significance, the binomial test (sometimes called the
all of these steps happen in a row, without going back to ratio test) was used.
the previous stages. In reality, we may want to go back The assumptions of the mentioned test are as follows,
to the previous stages and review our operations. Every in which the null hypothesis (H0) which expresses
time previous stages are rectified, the idea of research the lack of effect for the variable and an alternative
slightly changes, and this change is reflected in all stages hypothesis (H1) which expresses the presence of effect
of the research. However, in this research, it has been for the variable.
attempted to do the research process in a reasonable
order. Equation 1:
Linguistic terms and synonyms Gray numbers (peer- criteria have been normalized. It seems that the staff in
to-peer) have been adapted by previously-performed the university, in terms of experts and quality specialists,
studies about performance assessment related to had acceptable performance. The lowest weight was
qualitative assessment and was confirmed by the experts. assigned to the university infrastructure criterion (2.58-
5.41). The other criteria were: educational program
Assessing the importance of gray weight of (3.72-6.81), environment (4.81-7.00), office services
quality characteristic: According to the following (4.75-7.58), library services (5.56-8.43), electronic
table, the weight of the lower and upper limit of the services (4.88-7.12) and job perspectives (4.15-7.06).
qualitative characteristics for each variable has been for
Educational program, Staff, Infrastructure, Environment, Performance rate of qualitative characteristics:
Office services, Library services, Electronic services A detailed assessment of the expert assessment of the
and Job perspectives: 0.894, 1, 0.832, 0.949, 0.982, qualitative characteristics showed that very good (VG)
0.989, 0.892, 0.915, respectively. The highest weight assessment formed the majority of answers (%, 23 Out
is for the staff criterion (6.85-8.95), and the rest of the of 40, table 4).
Table 4: Details of the expert assessment of the qualitative characteristics Integration of Gray rates and
weights
Experts evaluation
Qualitative Characteristics
E1 E2 E3 E4 E5 E6 E7 E8
Curriculum provides appropriate scientific subjects. VG VG VP VP F VG E F
The curriculum includes specialized courses (software education). F F VP E F F F F
University staff never turn down students’ requests to cooperate F F VG VG E VG E VG
Staff have a good relationship with students. VG VG E VG VG VG VG VG
University staff spend adequate time to consults with students VG F VG VG VG VG VG VG
Medico-legal Update, January-March 2021, Vol. 21, No. 1 669
The arithmetic means, mode and median are method equation three the general integrated Gray quality index
that are adapted to integrate multiple decision-makers (GQI) of qualitative characteristic is GQI=(4.80,7.33).
assessments. The arithmetic mean due to its widespread
use, have been used for research to integrate and unify Conclusion
comments, during the research. During the research, the Determining the Euclidean Distance to Adapt to
arithmetic mean of Gray performance rate and arithmetic Approximate Level of Quality: When the Gray quality
mean of performance rate for each characteristic has index is obtained, it should be adapted to the language
been determined by Rj and Wj symbols. Calculation of and verbal terms in order to determine the amount of
Rj and Wj through equation 1 and 2: quality level. During this study, the Euclidean distance
Equation 1: method will be used for this purpose, since this is the best
and most intuitive and understandable way for humans.
In this study, linguistic expressions such as, Extremely
Quality, Very Quality, Quality, Fairly Quality, Slowly
Becoming Quality have been used in order to adapt and
Equation 2: determine the quality level. Linguistic expressions and
corresponding Gray numbers are given below:
In order to unify and consolidate the Gray rates Very Quality (VQ) = (5.5-8.5)
and the Gray weights used to determine the overall
Quality (Q) = (3.5-5.5)
qualitative Gray index equation three have been used:
Fairly Quality (FQ) = (1.5-3.5)
Equation 3:
Slowly Becoming Quality (SQ) = (0-1.5)
Curriculum Characteristic:
Figure 1: Comparison between existing status and recommended status of higher education services quality
dimensions
Figure 2: The rate of guff in existing weights of quality dimensions in Kerbala university higher education
services
With a slight reflection in comparison of the current According to Figure 1 and by comparing the current
and desired weights, it can be understood that the and desired weights, it can be concluded that the lowest
lowest gap in staff index and the highest gap is in the gap is staff index. In other words, it can be said that from
university’s curriculum index. For a better analysis of the viewpoint of specialists and experts of the quality
the gap in weights of each criterion, the bar chart (Figure of Kerbala University, staff have performed their duties
2) is presented: correctly and have the necessary commitment to perform
their duties. Therefore, there is not a noticeable gap in
this criterion.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 671
Abstract
The aim of the study is identify the effect of non-pharmacological method technique (breathing) on severity
of pain through comparing woman’s pain score during labor.A quasi-experimental Design is used through
the present study in order to achieve the study objectives. The period of the study is from 15th January to 4th
June 2020. A Non-Probability (Purposive Sample) of (60) women (30) of them are control group and (30)
women are the study group, selected from those who are admitted to Al-Zahraa Maternity Teaching Hospital/
Al-Forat Teaching Hospital, are included in the study sample. Labor pain was assessed using the scale
known as: Face, Leg, Activity, Cry, And Consolability (FLACC). Breathing Technique was used as a non-
pharmacological method to reduce pain . The current study revealed that applying the non-pharmacological
pain managing interventions (breathing) showed a remarkably significant reduction in pain according to
in FLACC behavioral scale regarding the other stages (active phase (after intervention); transition phase;
second Phase; third Phase) which. . It is concluded that breathing has reduced pain during active phase,
transition phase, and second phase .
Table (1) Statistical distribution of study sample (women) by their demographic data
Table (2) reveals differences in the assessment pharmacological pain managing interventions; regarding
in FLACC behavioral scale at different labor stages the other stages (active phase (after intervention);
between study and control groups, it shows that there is transition phase; second Phase; third Phase) which show
no significant difference (p > 0.05) between study and a remarkably significant reduction pain according to in
control groups in the assessment in FLACC behavioral FLACC behavioral scale .
scale at the first active phase before applying the non-
676 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table (2) Differences in the assessment in FLACC behavioral scale at different labor stages between study
and control groups
Nawres N. Jaber1, Nada Salih Hadi1, Abeer Laily Mohammed1, Marwa Idan1, Adyan Niama1
1
Scholar Researchers, Department of Microbiology, College of Veterinary Medicine University of Basrah,
Basra, Iraq
Abstract
Background Aerobic spore-forming bacteria can be found in a wide range of environmental niches such
as food production. Among them, the aerobic spore-forming bacteria like Bacillus ceruse, pose a risk of
causing dairy product poisoning by the production of toxins.
Materials and Method: Out of 40 samples, 10 from each of Raw Milk, Skim Milk Powder, UHT Milk and
Wight chees were collected to isolate aerobic spore-forming bacteria by morphological, physiological and
biochemical tests.
Conclusion: A total of 25 isolates of heat resistant bacteria, 10(40%), 8(32%), 3(12%), 4(16%) from “RM,
white chees, SMP and UHT milk respectively,” were purified and characterized. Various spore forming
bacteria belonging to Bacilli spp. which include pathogenic were biochemically identified using vitek 2
systems, the result showed the highest rate of Bacillus subtilis (28%) followed by Bacillus ceruse and
Bacillus thuringiensis (24%).
Keywords: Vitik Detection, Aerobic Spore-Forming Bacteria, Raw milk, Skim milk Powder, UHT milk.
Table 1. Total bacterial counts for raw milk (RM), White cheese (Wch), skim milk powder (SMP) and
UHT milk
Table 2. Total aerobic spore forming cell for raw milk (RM), White chees (Wch), skim milk powder (SMP)
and UHT milk.
Characterization and Enzymatic properties of lactose, these can cause spoilage in sterilized milk due to
aerobic spore-forming isolates: A total of 25 isolates their production of proteolytic and lipolytic enzymes or
10, 8, 3, 4 from “RM, white chees, SMP and UHT recontamination during the filling of sterilized milk(18).
milk respectively”, were purified and characterized by A finding in accordance with the study of (19) who
gram positive, spore forming and motile bacteria, Fig 1 reported that contamination with spore formers can lead
(a, b, c). Biochemical tests were used for detection the to spoilage of milk and dairy products, mainly caused
enzymatic properties of the of aerobic spore-forming by enzyme deterioration (proteolytic and lipolytic
isolates isolated bacteria; the isolates were shown activity by Bacillus species), acid production, (i.e. lactic,
different enzymatic properties. According to the results butyric and acetic acid. Moreover, (20), mentioned that
illustrated in fig (2), it was revealed that the proportion the presence of B. cereus in UHT milk and 91.67% of
of 96% for total Bacillus Spp. isolates were able to mesophilic Bacillus ssp. isolates were able to hydrolyze
hydrolyze the casein, the results were determined as the casein and 36.36% of isolates able to hydrolyze
clearing of the agar around the bacterial growth while the casein were able to ferment the lactose. The UHT
there are 4% of the isolates was not able to hydrolyze processing of milk destroys all microorganisms that can
the casein. Furthermore, 60 % of the isolates were grow under normal storage conditions(21,22). Almost all
ferment lactose, and 40% were determined as lactose enzymes are also inactivated by UHT processing because
non fermenter. The study of enzymatic properties of the most enzymes in milk are inactivated at temperatures
aerobic spore-forming isolates showed that the isolates below 100 °C, but some bacterial proteinases and lipases
have the applet to hydrolyze the casein and fermented needs temperatures above 150°C for inactivation(23).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 681
a b
c
Fig. 1: a: Gram staining, b: spore staining, c: motility test
Fig (2): The Percentages of Casein hydrolyses and lactose fermenter isolates
The results showed that all the isolates were positive biochemically identified using vitek-2 system version:
for Catalase test and have variable activity for blood 07.01 according to the following test, AMY, APPA,
hemolysis activity 44% blood hemolysis, 48% non- LeuA, AlaA, Drib, NOVO, Draf, OPTO, PIPLC,
blood hemolysis and 8 % variable in hemolysis activity. CDEX, ProA, TyrA, ILATk, NC6.5, O129R, Dxyl,
AspA, BGURr, Dsor, LAC, d MAN, SAL, ADH,
Biochemical identification of Bacteria using BGAR, AGAL, URE, NAG, dMNAE, SAC, BGAL,
Vitek-2 System: Aerobic spore forming isolates were
682 Medico-legal Update, January-March 2021, Vol. 21, No. 1
AMAN, PyrA, POLYB, dMAL, MBdG, dTRE, AGLU, were found to be positive. The selected organisms were
AMAN, PyrA, POLYB, dMAL, MBdG, dTRE, AGLU, identified using VITEK 2 system imparts an automated,
PHOS, BGUR, dGAL, BACI, PUL, ADH2s. The result computer based technique of species identifications,
for 25 isolates were presented in figure (3), there are relies on advanced colorimetry technology, the
28% isolates were identified Bacillus subtilis, 24% measurement of light attenuation associated with each
isolates were identified as Bacillus ceruse and Bacillus biochemical reaction in VITEK cards. The reagent cards
thuringiensis, 8% isolates were identified as Bacillus have 63 wells and each well contain an individual test
licheniformis while 16% isolates were unidentified. substrate. Substrates assess various metabolic activities
such as alkalinisation, acidification, enzyme hydrolysis,
The preliminary identification of aerobic spore and growth in the presence of inhibitory compounds. The
forming isolates was performed and the results indicated VITEK-2 compact system combines several advantages
that morphological characteristics of isolates were bacilli. like rapid identification, a simple methodology, high level
The Gram staining techniques showed that all isolates of automation and taxonomically updated databases.
were gram positive and from the Catalase test all isolates
Antibiotic susceptibility test: Among the variety Tetracycline (TE), Erythromycin (E) and Vancomycin
of antibiotics tested, the aerobic spore-forming isolated (VA), its show highest sensitivity to Ciprofloxacin (CIP)
bacteria show resistance to Cadazolid (CDZ) and and Cephalexin (CN) (Table 3).
Chloramphenicol (C) and Show medium sensitivity for
In conclusion, raw milk, skimmed milk powder and the highest isolates from Bacillus species. There were
some of UHT milk samples were contaminated with differences among isolates in ability to hydrolyze the
aerobic spore forming bacteria. Bacillus subtilis was casein and ferment lactose.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 683
Conflict of Interest: None reagents for microbiology., 10th ed. Pub. Difco,s
laboratories, Detroit MchiGan. U.S.A. 1984.
Funding: Self
12. Macfaddin, J. F., Biochemical tests for identification
Ethical Clearance: Not required of medical bacteria. 3rd Ed. Lippincott Williams
and Wilkins USA. 2000.
References 13. Bauer, A. W; Kirby, W. M. and Sherris, J. C.,
1. Gopal N, Hill C, Ross PR, Beresford TP, Fenelon Antibiotic susceptibility testing by a standard
MA, Cotter PD., The prevalence and control of single disk method. American Journal of Clinical
Bacillus and related spore‐forming bacteria in the Pathology. 1966.45: 493-496.
dairy industry. Front Microbiol 2015.6:1418. 14. Sameh S. Yacoub, Sherif M. Shamsia, Sameh
2. Slepecky R. A., Hemphill H. E. The genus A. Awad, Hamid M. Ziena and Nabil M. Safwat
Bacillus—nonmedical. Prokaryotes. 2006. 4 530– Characterization of Aerobic Spore-Forming
562. 10.1007/0-387-30744-3_16 Bacteria Isolated from Raw Milk, Skim Milk
Powder and UHT Mil 1 Food, Dairy Science &
3. Ranieri M.L. and Boor K.J. Short communication:
Technology Dept., Faculty of Agric., Damanhour
Bacterial ecology of high-temperature, short-time
Univ., Egypt. 2-Dairy Science & Technology
pasteurized milk processed in the United States.J.
Dept., Faculty of Agric. El-Shatby, Alexandria
Dairy Sci. 2009; 92: 4833-4840
Univ., Egypt. 2017.
4. Setlow, P., Germination of spores of Bacillus
15. Kim, E.R., Jung, B.M., Yu, B.H., Jung, H.K., Kang,
species: what we know and do not know. J.
K.H. and Chun, H.N., Comparative characterization
Bacteriol. 2014. 196, 1297–1305. doi: 10.1128/
of the bacteria isolated from market milk treated
JB.01455-13.
with ESL and conventional system. Korean J. Food
5. Ternstrom A, Lindberg AM, Molin G., Classification Sci. Anim Resources 2003.23, 327–332.
of the spoilage flora of raw and pasteurized bovine
16. Aaku, E.N., Collison, E.K., Gashe, B.A. and
milk, with special reference to Pseudomonas and
Mpuchane, S., Microbiological quality of milk
Bacillus. J Appl Bacteriol. 1993. 75:25-34.
from two processing plants in Gaborone Botswana.
6. Heyndrickx M, Scheldeman P., Bacilli associated Food Control 2004.15, 181–186.
with spoilage in dairy products and other food. In:
17. Pacheco-Sanchez, C.P. and de Massaguer, P.R.,
Berkeley R, Heyndrickx MN, de Vos P. editors.
Bacillus cereus in Brazilian ultra-high temperature
Applications and systematics of Bacillus and
milk. Sci Agric (Piracicaba, Braz) 2007. 64, 152–
relatives. 1st ed. Oxford: Blackwell Science, 2002.
161.
pp 64–82.
18. Chen L., T., Coolbear and R.M. Daniel,
7. Quiberoni A, Guglielmotti D, Reinheimer J., New
Characteristics of proteinases and lipases produced
and classical spoilage bacteria causing widespread
by seven Bacillus Spp. Isolated from milk powder
blowing in Argentinean soft and semihard cheeses.
production lines. International Dairy Journal, 2004.
Int J Dairy Technol 2008.61:358–63.
14: 495-504.
8. Burgess SA, Lindsay D, Flint SH., Thermophilic
19. Garde, S., Gómez-Torres, N. and Ávila, M. Spore
bacilli and their importance in dairy processing. Int
forming bacteria in dairy product. Wiley Blackwell
J Food Microbiol 2010.144:215–25.
Editors: Palmiro Poltronieri. 2017. pp.11-36
9. Garde S, Ávila M, Gómez N, Nuñez M., Clostridium
20. Bahout A.A., Prevalence of Bacillus species in
in late blowing defect of cheese: detection,
UHT milk. Assoc. Vet. Med. J., 2000. 42: 47-53.
prevalence, effects and control strategies. In:
Castelli H, du Vale L. editors. Cheese: production, 21. Lewis M. J. and H. C. Deeth . Heat treatment of
chemistry and sensory properties. New York: Nova milk. In A. Y. Tamime (Ed.), Milk processing and
Science Publishers, 2013. pp 503–18. quality management (pp. 168e204). West Sussex:
Blackwell Publishing Ltd. 2009.
10. Standard Method for Examination of Dairy
Products. American Public Health Association. 22. Deeth H.C. Improving UHT techniques. In Mansel
17th edit. 2014. W. Griffiths (Ed.), Improving the safety and quality
of milk (pp. 302-329) Cambridge, U.K.: Woodhead.
11. Difco S, manual of dehydrated culture media and
2010.
684 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2391
Abstract
Dental health problems suffered by many people in Indonesia is dental caries. Poor dental and oral hygiene
is one of the factors causing dental caries or oral and dental health problems. Teaching oral health with
demonstration method can improve tooth brushing skills and reduce oral and dental hygiene in early
childhood. This study aims to the effectiveness of counseling with brushing demonstration method as an
effort to improve tooth brushing skills and the status of dental hygiene in early childhood in school. Method:
this study used a quasy experiment with a pretest and posttest with one group design. This research was
conducted at Kindergarten Dharma Putra Nusantara 86 Cilandak District, South Jakarta City. Independent
variable: counseling by demonstration method and the dependent variable: brushing skills and the status
of early childhood dental and oral hygiene. Data were tested using Wilcoxon. Results: counseling with a
tooth brushing demonstration method was effective in improving brushing skills (p <0.001) and effective in
improving the status of early childhood dental and oral hygiene (p <0.001). Conclusion: Counseling with
the demonstration method of tooth brushing is effective as an effort to improve tooth brushing skills and the
status of dental and oral hygiene in early childhood at school.
Keywords: Tooth brushing demonstration method,brushing skills, the status of dental and oral hygiene.
This is because early childhood children do not yet This success was also seen in the improvement of
have the ability to brush their teeth properly proven the the child’s dental and oral hygiene status. The results of
average value of children’s tooth brushing skills of 5.67, the effectiveness test of oral and dental hygiene status
including the category of less skilled, so that it affects and after being treated showed that the p-value was
the cleanliness of teeth and mouth. Strengthened Arianto 0.001 (p <0.05) meaning that counseling with a tooth
et al (2014), states that brushing their teeth properly brushing demonstration method effectively improved
and correctly can affect the status of dental and oral the status of dental and oral hygiene in early childhood
hygiene.7,14 at school. The dental and mouth hygiene status scores
decreased because they were given treatment in the
Then the respondent is given an intervention, the first form of counseling using a demonstration method about
step is to introduce the tooth brushing equipment along oral health, especially how to brush teeth correctly
with the storage area stored in the school environment. so that with this counseling, students will increase
The response of the sample in initiating more enthusiasm their knowledge so they are able to practice the right
and enthusiasm, means that the stimulus given to the teeth brushing. The practice of brushing your teeth
Medico-legal Update, January-March 2021, Vol. 21, No. 1 687
properly will be able to remove plaque. Purnama et al school students. Dentofacial Journal of Dentistry.
(2019), proving that brushing your teeth with the right 2012; 11 (2): 91-95.
techniques will improve your brushing skills and clean 7 Arianto A, Shaluhiyah Z, Nugraha P. Teeth
teeth and mouth. Ilyas (2012) also proved the promotion Brushing Behavior in Elementary School Students
of dental and oral health with a demonstration method Class V and VI in Sumberejo District. Indonesian
for decreasing dental and oral hygiene scores.6, 8 Health Promotion Journal. 2014; 9 (2): 127-135.
8 Purnama T, Rasipin R, Santoso B. Effects of Tedi’s
Conclusion
Behavior Change Model Training on Teachers and
Based on the results of the study, it can be Parents on the Teeth Brush Skills of Preschoolers.
concluded that: Journal Health Quality. 2019; 13 (2): 75-81.
1. Counseling with demonstration method proved 9 Yuliana NM, Setiawan H, Hendari R. Effect of
significantly (p <0.001) effectively improve early Education Through Dental Care to Clean Dental
childhood toothbrushing skills in school. and Mouth Patients in Post-Dental Patients Due to
Caries. Journal of Dental Health. 2014; 2 (2): 249-
2. Counseling with demonstration method proved 259.
significantly (p <0.001) effectively improve the
10 Zulfikri Z, Huda Z. The Relationship of the Dental
status of dental hygiene in early childhood
and Mouth Clean Index With The Dental Career
Source Funding: This study was done by self- Index In The Disciples of SDN 03 Features of Kurai
funding from the authors. Subdistrict, Long Guguk District, Bukittinggi City.
Journal of Dental Health. 2017; 4 (1): 55-62.
Conflict of Interest: The authors declare that they
11 Prasko P, Santoso B, Sutomo B. Counseling of
have no conflict interests.
audio visual method and demonstration of the
Ethical Clearance: All participants were signed the knowledge of brushing teeth in elementary school
informed consent prior to the data collection. children. Journal of Dental Health. 2016; 3 (2): 53-
57.
Reference 12 Agustin D. The Use of Demonstration Method
1 Ministry of Health. School Dental Health Business Against Ability to Brush Teeth in Children with
Guidelines (UKGS). Jakarta, Directorate General ADHD (Attention Deficit Hyperactivity Disorder).
of Health Efforts; 2012. Special Education Journal. 2014; 6 (6).
2 Ministry of Health. National Action Plan for Dental 13 Ngatemi, Purnama T. Dental Health Handbook
and Oral Health Services 2015-2019. Jakarta, as Parents Monitoring in the Formation of
Directorate General of Health Efforts; 2015. Independence for Brushing Teeth in Early
Childhood. Indian Journal of Public Health
3 Alhamda S. Status of dental and oral hygiene with
Research Development. 2020; 11(1):785-790
dental caries status (study of 12-year-old students
in the Bukittinggi city state elementary school). 14 Pantow CB, Warouw SM, Gunawan PN. The Effect
Journal of Community Medicine News. 2011; 27 of Counseling on Brushing Teeth Against Dental
(2): 108. Plaque Index on Elementary Inpres Field Students.
Journal e-Gigi 2014; 2 (2).
4 Purnama T, Rasipin R, Ngatemi. Tedi’s Behavior
Change Model to Improving Brushing Teeth 15 Pujiyasari S, Asih SHM, Nurullita U. The effect of
Behavior Parents. Journal of Applied Health brushing teeth training method on the independence
Management Technology. 2020; 2 (1): 1-12. of brushing children’s teeth in school-age mental
retardation. Journal of Nursing and Midwifery.
5 Ministry of Health. Main results Riskesdas 2018.
2014; 3:1-11
Research and Development Agency; 2018. p.179-
217 16 Makuch A, Reschke K, Rupf S. Effective teaching
of tooth-brushing to preschool children. J Dent
6 Ilyas M, Putri I. The effect of counseling on
Child (Chic). 2011; 78 (1): 9-12.
the demonstration method of brushing teeth on
decreasing the dental plaque index in elementary
688 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2392
Abstract
Smoking behavior in women has a risk of fertility problems, the reproductive system, and many other
health problems. This study was aimed at analyzing the effect of education level on smoking behavior
among female workers in Indonesia. The samples used were a female worker. The sample size was 51,815
respondents. Apart from education, other independent variables analyzed were the place of residence, age,
marital, wealth, and pregnant status. Determination of determinant by binary logistic regression. The results
of the study informed that female workers with primary education were 0.456 times more likely than no
education to become smokers. Female workers with secondary education are 0.428 times more likely than
no education to become smokers. Female workers with higher education are 0.219 times more likely than
no education to become smokers. The results of this analysis indicate that the higher the education level, the
lower the possibility of female workers becoming smokers. Apart from the education level, 4 other variables
were also found as predictors of smoking behavior among female workers, namely the place of residence,
age, wealth, and pregnant status. It was concluded that the education level was a predictor of smoking
behavior among female workers in Indonesia. The higher the education level, the lower the possibility of
female workers becoming smokers.
Table 1. The descriptive statistics of the education level of female workers in Indonesia (n=51,815)
Education Level
Variables No Education Primary Secondary Higher P
n % n % n % n %
Smoking Behavior ***0.000
No 2672 91.9% 31546 96.6% 40080 97.2% 9302 98.7%
Yes 237 8.1% 1125 3.4% 1154 2.8% 123 1.3%
Type of place of residence
Urban 575 19.7% 11233 34.4% 23219 56.3% 6300 66.8%
Rural 2337 80.3% 21450 65.6% 18025 43.7% 3126 33.2%
Age Group ***0.000
15-19 7 0.2% 114 0.3% 318 0.8% 6 0.1%
20-24 45 1.5% 718 2.2% 2354 5.7% 241 2.6%
25-29 113 3.9% 2085 6.4% 4918 11.9% 1278 13.6%
30-34 247 8.5% 4336 13.3% 7646 18.5% 2209 23.4%
35-39 443 15.2% 7125 21.8% 9597 23.3% 2231 23.7%
40-44 724 24.9% 8856 27.1% 9111 22.1% 1812 19.2%
45-49 1333 45.8% 9449 28.9% 7300 17.7% 1649 17.5%
Marital Status 0.527
Never in union/Divorced/Widowed 2 0.1% 17 0.1% 27 0.1% 9 0.1%
Married/Living with partner 2910 99.9% 32666 99.9% 41217 99.9% 9417 99.9%
Wealth status ***0.000
Poorest 2065 70.9% 13508 41.3% 7895 19.1% 547 5.8%
Poorer 476 16.3% 7737 23.7% 7817 19.0% 803 8.5%
Middle 220 7.6% 5801 17.7% 8458 20.5% 1088 11.5%
Richer 102 3.5% 3916 12.0% 9134 22.1% 2019 21.4%
Richest 49 1.7% 1721 5.3% 7940 19.3% 4969 52.7%
Pregnant ***0.000
No 2872 98.6% 31955 97.8% 39802 96.5% 9083 96.4%
Yes 40 1.4% 728 2.2% 1442 3.5% 343 3.6%
Second, the results of the analysis found that the age 0.523; 95% CI 0.460-0.595). Female workers with
group had a partial effect on smoking behavior among richer wealth status have a 0.483 times chance compared
female workers. Female workers in the 35-39 age group to the poorest female workers to become smokers (OR
were 2.140 times more likely than female workers in the 0.483; 95% CI 0.421-0.554). The richest female worker
15-19 age group to become smokers (OR 2.140; 95% CI was 0.481 times more likely than the poorest female
1.057-4.330). Female workers in the 45-49 age group worker to become a smoker (OR 0.481; 95% CI 0.414-
were 2.168 times more likely than female workers in the 0.560). This information is in line with the findings of
15-19 age group to become smokers (OR 2.168; 95% the previous studies27.
CI 1.071-4.387). Previous studies in Costa Rica, Iran,
and Cuba also informed the same finding, that age is a Fourth, pregnant status. Pregnant female workers
predictor of smoking behavior23,25,26. had 0.723 times the probability of non-pregnant female
workers becoming smokers (OR 0.723; 95% CI 0.542-
Third, wealth status. Female workers with poorer 0.965). This means that pregnancy is a protective factor
wealth status have a probability of 0.771 times compared to prevent female workers from smoking.
to the poorest female workers to become a smoker (OR
0.771; 95% CI 0.692-0.859). Female workers with Conclusions
middle wealth status have a 0.523 times chance compared Based on the analysis, it can be concluded that
to the poorest female workers to become smokers (OR education was a predictor of smoking behavior among
692 Medico-legal Update, January-March 2021, Vol. 21, No. 1
female workers in Indonesia. The higher the education, 7. Lukowski A. Women & Smoking Health risk.
the lower the possibility of female workers to become 2015.
smokers. Apart from education, 4 other variables were 8. Laksono AD, Wulandari RD, Rukmini R, Matahari
also found as predictors of smoking behavior among R. Determinant of Smoking Behavior among
female workers, namely type of place of residence, age Childbearing Age Women in Indonesia. Int J
group, wealth status, and pregnant status. Psychosoc Rehabil. 2020;24(8):6292–303.
Acknowledgments: The author would like to thank 9. Baheiraei A, Ghafoori F, Nedjat S, Foroushani AR.
the ICF International, who has agreed to allow the 2017 Sociodemographic characteristics and secondhand
IDHS data to be analyzed in this article. smoke exposure among women. Tanaffos.
2013;12(2):41–7.
Source of Funding: Self-funding 10. Madeira Domingues RMS, Figueiredo VC, Carmo
Conflict of Interest: The authors declare no conflict Leal M do. Prevalence of pre-gestational and
of interest, financial or otherwise. gestational smoking and factors associated with
smoking cessation during pregnancy, Brazil, 2011-
Ethical Clearance: The 2017 IDHS has received 2012. PLoS One. 2019;14(5):2011–2.
ethical clearance from the National Ethics Commission. 11. Gilbert NL, Nelson CRM, Greaves L. Smoking
Utilization of the 2017 IDHS data in this study has been Cessation During Pregnancy and Relapse After
permitted by ICF International through its website: Childbirth in Canada. J Obstet Gynaecol Canada.
https://dhsprogram.com/data/new-user-registration.cfm. 2015;37(1):32–9.
12. Islam FMA, Walton A. Tobacco Smoking and Use
References
of Smokeless Tobacco and Their Association with
1. Phetphum C, Pongpreecha B, Hangsantea J, Psychological Distress and Other Factors in a Rural
Muankaew W. Predicting Factors for Smoking District in Bangladesh: A Cross-Sectional Study. J
Behavior among Women Who Frequent Nightlife Environ Public Health. 2019;2019:11.
Entertainment Venues around a University in the 13. European Agency for Safety and Health at Work
Northern Region of Thailand. Subst Abus Res (EU-OSHA). New risks and trends in the safety and
Treat. 2018;12. health of women at work. Luxembourg: Publications
2. Solomon A. Gender, women, and the future Office of the European Union. Luxembourg; 2014.
of tobacco control. Drugs and Alcohol Today. 51 p.
2020;May:1–15. 14. Kabir H, Maple M, Fatema SR. Vulnerabilities of
3. Jones ME, Schoemaker MJ, Wright LB, Ashworth Women Workers in the Readymade Garment Sector
A, Swerdlow AJ. Smoking and risk of breast cancer of Bangladesh : A Case Study of Rana Plaza. J Int
in the Generations Study cohort. Breast Cancer Womens Stud. 2018;19(6):224–35.
Res. 2017;19(1):1–14. 15. Ansoleaga E, Ahumada M, Cruz AGS. Association
4. Wong JYY, Chang PY, Gold EB, Johnson WO, of workplace bullying and workplace vulnerability
Lee JS. Environmental tobacco smoke and risk in the psychological distress of chilean workers. Int
of late-diagnosis incident fibroids in the Study of J Environ Res Public Health. 2019;16(20):1–14.
Women’s Health across the Nation (SWAN). Fertil 16. Mehrotra S, Sinha S. Explaining falling female
Steril. 2016;106(5):1157–64. employment during a high growth period. Econ
5. Jones AM, Carter-Harris L, Stiffler D, Macy JT, Polit Wkly. 2017;52(39):54–62.
Staten LK, Shieh C. Smoking Status and Symptoms 17. Wunrn. Current Trends Suggested Global Strategies
of Depression During and After Pregnancy Among to Support the Feminization of the Workforce the
Low-Income Women. JOGNN - J Obstet Gynecol Double Burden of Working Women. 2018;
Neonatal Nurs. 2020;49(4):361–72.
18. Ginting PA. Implementasi Teori Maslow dan
6. Soneji S, Beltrán-Sánchez H. Association of Peran Ganda Pekerja Wanita K3L Universitas
Maternal Cigarette Smoking and Smoking Padajajaran. Focus J Pekerj Sos. 2019;1(3):220.
Cessation With Preterm Birth. JAMA Netw open.
19. Wulandari RD, Laksono AD. Education as
2019;2(4):1-14.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 693
predictor of the knowledge of pregnancy danger 24. Barik A, Rai RK, Gorain A, Majumdar S,
signs in Rural Indonesia. Int J Innov Creat Chang. Chowdhury A. Socio-economic disparities in
2020;13(1):1037–51. tobacco consumption in rural India: Evidence from
20. Ipa M, Widawati M, Laksono AD, Kusrini I, a health and demographic surveillance system.
Dhewantara PW. Variation of preventive practices Perspect Public Health. 2016;136(5):278–87.
and its association with malaria infection in eastern 25. Masjedi MR, Roshanfekr P, Naghdi S, Higgs
Indonesia: Findings from community-based survey. P, Armoon B, Ghaffari S, et al. Socio-economic
PLoS One. 2020;15(5):e0232909. contributors to current cigarette smoking among
21. Rohmah N, Yusuf A, Hargono R, Laksono AD, Iranian household heads: findings from a national
Masruroh, Ibrahim I, et al. Determinants of teenage household survey. J Subst Use. 2020;25(2):217–23.
pregnancy in Indonesia. Indian J Forensic Med 26. Thomson B, Rojas NA, Lacey B, Burrett JA,
Toxicol. 2020;14(3):2080–5. Varona-Pérez P, Martínez MC, et al. Association of
22. Laksono AD, Wulandari RD. The Barrier to childhood smoking and adult mortality: prospective
Maternity Care in Rural Indonesia. J Public Heal study of 120 000 Cuban adults. Lancet Glob Heal.
From Theory to Pract. 2020;Online First. 2020;8(6):e850-7.
23. Aguirre AE, Fantin R, Solis CB, Miranda AS. 27. Buffarini R, Abdalla S, Weber AM, Costa
Sociodemographic characteristics associated JC, Menezes AMB, HelenGonçalves, et al.
with the prevalence of tobacco use in Costa Rica. The Intersectionality of Gender and Wealth in
Rev Panam Salud Publica/Pan Am J Public Heal. Adolescent Health and Behavioral Outcomes in
2020;44:Article number e17. Brazil: The 1993 Pelotas Birth Cohort. J Adolesc
Heal. 2020;66(1):S51-7.
694 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2393
Abstract
Background: Breast lesions are a basic term for a benign or malignant tumor or bump in the breast. This
study is aimed to evaluate the biostatistics range of the malignant lesions in women breast in Baghdad/Iraq
and compared it with other types of breast lesions by using ultrasound in diagnoses.
Method: The study is done on 1494 of women patients from different ages and screened through six months
in Al-Elwiya Educational Hospital in Baghdad/Iraq, by using ultrasound machine to diagnosis of the breast
lesion type’s and divided it into groups (normal, benign, suspected and malignant).
Conclusion: Our result showed horizontally significant differences (P≤0.01),(P≤0.05) in groups of (normal,
Begnin, suspected) in percentages about (35.94%), (30.79%), (32.20%) respectively. Except of malignant
group has no significant differences and percentage about (1.07%) throughall months. And vertically
our result showed high significant differences (P≤0.01) between all the studied groups (normal, benign,
suspected, and malignant) and percentages was (35.94%, 30.79%, 32.20%, and 1.07%) respectively. That
means there is little case of malignant lesion significantly improved by ultrasound,because all the suspicious
breast lesions detected by ultra-sound should be biopsied in histologic results to confirm or exclude the
presence of malignancy.
*(P≤0.05), ** (P≤0.01)
Discussion Conclusion
Horizontally, our results in all six months showed At the end, our study of Biostatistics evaluation
significant differences (P≤0.01 & P≤0.05)of normal, of women breast lesions in Baghdad/Iraq showed
benign and suspected cases group except the malignant that breast thickness (lesion size, lesion depth, lesion
that showed no significant differences because of location and pathologic finding)are factors influencing
the Variable consequences depending on the applied the image quality at ultrasound, with sensitivity for the
techniques used, as well as their diagnostic measures. classification of benign and malignant masses improving
Additionally, thickness, lesion size, shape of breast that with higher quality scores. And all the suspicious breast
affected on ultrasound for differentiation of normal, lesions detected by ultrasound should be biopsied in
benign, suspected and malignant breast lesions. And this histologic results to confirm or exclude the presence of
finding is agreed with.11 malignancy.
Malignant lesions that are soft, like: mucinous Conflict of Interest: Nil
carcinomas, necrotic tumors, and ductal carcinoma
in situ, may be false diagnosed as benign, and benign Source of Funding: Self-funding
conditions that are stiff, such as: scarring, fibrosis, Ethical Clearance: All the data collected was
and complex fibroadenomas, may be misjudged as approved by doctors in Al-Elwiya Educational Hospital
malignant. And this result is fixed with12,13 and 14. in Baghdad/Iraq. The patient name and personal data
Vertically, the results showed high significant have not been collected.
differences (P≤0.01) between all the studied groups
(normal, benign, suspected, and malignant). The highest
References
percentage was in normal cases (35.94%), but the lowest 1. Liberman L, Bonaccio E, Hamele-Bena D,
percentage was in malignant cases (1.07%). That means Abramson AF, Cohen MA, Dershaw DD. Benign
there is little case of malignant lesion significantly and malignant phyllodes tumors: mammographic
improved by ultrasound, because all the suspicious and sonographic findings. Radiology. 1996 Jan;
breast lesions detected by U/S should be biopsied in 198 (1):121-4.
histologic results to confirm or exclude the presence of 2. Enzinger FM, Weiss SW. Soft tissue tumors 2nd
malignancy. And all that is agreed with.15 ed. St Louis, Mo: Mosby-Year Book. 1988:719-
860.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 697
3. Guinebretiere JM, Menet E, Tardivon A, Cherel 10. SAS. J. Statistical Analysis System, User’s Guide.
P, Vanel D. Normal and pathological breast, the Statistical. Version 9.1th ed. SAS. Inst. Inc. Cary.
histological basis. European journal of radiology. N.C. USA. 2012.
2005 Apr 1;54 (1):6-14. 11. Chang JM, Moon WK, Cho N, Kim SJ. Breast mass
4. Rouhi R, Jafari M, Kasaei S, Keshavarzian P. evaluation: factors influencing the quality of US
Benign and malignant breast tumors classification elastography. Radiology. 2011 Apr;259(1):59-64.
based on region growing and CNN segmentation. 12. Itoh A, Ueno E, Tohno E, Kamma H, Takahashi
Expert Systems with Applications. 2015 Feb H, Shiina T, Yamakawa M, Matsumura T. Breast
15;42(3):990-1002. disease: clinical application of US elastography for
5. Rahbar G, Sie AC, Hansen GC, Prince JS, Melany diagnosis. Radiology. 2006 May;239(2):341-50.
ML, Reynolds HE, Jackson VP, Sayre JW, Bassett 13. Berg WA, Cosgrove DO, Doré CJ, Schäfer FK,
LW. Benign versus malignant solid breast masses: Svensson WE, Hooley RJ, Ohlinger R, Mendelson
US differentiation. Radiology. 1999 Dec;213 EB, Balu-Maestro C, Locatelli M, Tourasse C.
(3):889-94. Shear-wave elastography improves the specificity
6. Parker SH, Dennis MA, Stavros AT, Johnson KK. of breast US: the BE1 multinational study of 939
Ultrasound-guided mamtmeotomoy: a new breast masses. Radiology. 2012 Feb; 262(2):435-49.
biopsy technique. Journal of Diagnostic Medical 14. Chang JM, Moon WK, Cho N, Yi A, Koo HR,
Sonography. 1996 May; 12(3):113-8. Han W, Noh DY, Moon HG, Kim SJ. Clinical
7. https://www.radiologyinfo.org/en/info. application of shear wave elastography (SWE)
cfm?pg=breastus in the diagnosis of benign and malignant breast
8. Hagen-Ansert SL. Textbook of Diagnostic diseases. Breast cancer research and treatment.
Sonography: 2-Volume Set. Elsevier Health 2011 Aug 1;129(1):89-97.
Sciences; 2011 Jun 20. 15. Cha JH, Moon WK, Cho N, Kim SM, Park SH, Han
9. Alwan NA. Breast cancer among Iraqi women: BK, Choe YH, Park JM, Im JG. Characterization
Preliminary findings from a regional comparative of benign and malignant solid breast masses:
Breast Cancer Research Project. Journal of global comparison of conventional US and tissue harmonic
oncology. 2016 Oct;2(5):255. imaging. Radiology. 2007 Jan;242(1):63-9.
698 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2394
Abstract
The aim was to find out the preferences of dentists in Iraq regarding strategies of carious tissue removal
in management of deep carious lesions (CR) in asymptomatic teeth and how demographics (sex, years of
experience, qualification, specialty, place of work) influences these preferences. An online questionnaire
of two months duration was constructed and distributed randomly via social media (Facebook). The
questionnaire’ questions investigated the demographics, CR (included non-selective removal to hard dentine
(NS), stepwise (SW) and selective (SE) removal). 238 dentists participated in the study, 164 (69%), 56
(23.5%) and 18 (7.5%) of respondents prefer NS, SW and SEremoval, respectively. Significantly both GDP
and males prefer NS more than Endodontists and females (P<0.05), Percent of respondents work in private
clinics who perform non-selective removal (53.6%) significantly lower than those who work in hospitals
(73.6%) (p<0.01). less invasive CR significantly associated with being an endodontist or female or work in
a private clinic (OR=2.02, CI 95% 1.02-4.0), (OR=2.04, CI 95% 1.12-3.7) and (OR=2.1, CI 95% 1.0-4.0),
respectively. In conclusion Iraqi GDPs prefer invasive strategy of carious tissue removal in management of
deep carious lesions. Specialty, place of work and sex of respondents affected these choices significantly.
Table 2: Distribution of frequencies and percentages of Strategy of Carious tissue removal among significant
demographic categories.
Abstract
The vulvovaginitis candidiasis is often associated with biofilm formation by Candida albicans and using of
antifungal agents against C. albicans biofilms is urgently needed. Microtiter plate assay using crystal violet
was used for detection the ability of Candida albicans to form biofilm and the microtiter broth dilution
method was used for determination the minimum inhibitory concentrations (MICs). Out of 42 Candida
albicans isolated from vulvovaginitis, 37 (88%) can produce biofilm at the varying degrees. Twenty-eight
(75.7%) isolates could form a strong biofilm. The results of minimum inhibitory concentrations (MICs) of
Nystatin, Aspirin and EDTA (Ethylenediaminetetraacetic acid) against 28 C. albicans isolates which formed
the strong biofilm, revealed that range of concentrations of Nystatin were (6.25-100 µg/ml), while the MICs
of aspirin and EDTA were more than 1000 µg/ml. It was obvious that the Nystatin had the inhibitory activity
at the concentrations 6.25 and 12.5 µg/ml. The highest antibiofilm activity by Nystatin were demonstrated
at the subinhibitory concentration 50 μg/ml with biofilm eradication percent (75.80%), while the lowest
antifungal effect (2.86-10.70%) was at very low concentrations (3.125-6.25 μg/ml). Also, there was an
obvious biofilm eradication of Aspirin and EDTA at the concentrations 500 and 1000 μg/ml but the effect
of aspirin at the concentration 1000 μg/ml (70.51%) is more than EDTA (60.12%) in contrast with the
concentration 500 μg/ml, it was found that the effect of EDTA (51.29%) is more than aspirin (34.25%). In
conclusion, the present study highlights the role of Aspirin and EDTA as antibiofilm agents when used with
Nystatin which have the ability to inhibit the growth of C. albicans in patients with vulvovaginitis.
Biofilm formation
Candida albicans
Weak Moderate Strong Negative
Total no of Isolate = 42 3 6 28 5
% 7.14% 14.29% 66.67% 11.90%
Chi-Square (χ2) 12.073 **
** (P≤0.01).
Figure 1. Biofilm formation detection of Candida albicans isolates by microtiter plate assay.
This study revealed that the most of Candida biofilm formers were 12/22 (54.5%). In a previous
albicans isolated from Iraqi women patients with study, it was found the Candida biofilms have important
vulvovaginitis formed a strong biofilm. Many studies clinical implications since the biofilm associated with
demonstrated the ability of Candida albicans clinical Candida or Gardnerella genital infections may act as a
isolates to form heterogeneous biofilms. The presence of chlamydial reservoir contributing to the transmission of
these communities in vulvovaginitis may explain why C. Chlamydia trachomatis in the population, alongside its
albicans infections remain unresponsive to therapy, and dissemination in the female upper genital tract (15). The
there was a relationship between biofilm formation and biofilm formation is very important virulence factor in
antifungal resistance among Candida isolates (11, 12). The C. albicans, where this species expresses hyphal-specific
study of Shreif et al. (2019) (13) in Egypt which included adhesins and regulators required for adhesion. Also,
one hundred Candida albicans isolates from patients the morphological dimorphism in Candida albicans
with nosocomial infections revealed that the biofilm supports noticeable phagocyte escape mechanism (16).
capacity was identified by the microplate method in
58% of C. albicans and the optical density was intense The present study investigated the role of some
in 20 isolates, moderate in 21 isolates and mild in 17 compounds as antibiofilm agents against the biofilm
isolates. The local study of Mohammed et al. (2017) (14) formation in C. albicans isolates, these compounds are
demonstrated that C. albicans was the most predominant Nystatin, Aspirin and EDTA. At first, the minimum
species among vaginal specimens in percentage (45%) inhibitory concentrations (MICs) of these compounds
and all C. albicans isolates were biofilm producers with were measured by microdilution method in 96 well
variable strength, Among vaginal isolates; 10/22 (45.5%) microtiter plates with resazurin dye and then detection
were weak biofilm formers whereas moderate or strong the antibiofilm concentration by exposing the yeast
706 Medico-legal Update, January-March 2021, Vol. 21, No. 1
to subinhibitory concentration in the same plate with were more than 1000 µg/ml. The table 2 and figure 2
crystal violet staining. demonstrated the MICs of 2 isolates by using the double
concentrations (from 0.39 to 200 µg/ml) and it was
The results of minimum inhibitory concentrations obvious that there is no effect of Aspirin and EDTA on
(MICs) of Nystatin, Aspirin and EDTA against 28 C. the growth of C. albicans at the used range while the
albicans isolates which formed the strong biofilm, Nystatin had the inhibitory activity at the concentrations
revealed that range of concentrations of Nystatin were 6.25 and 12.5 µg/ml against the isolates 1 and 2
(6.25-100 µg/ml), while the MICs of aspirin and EDTA respectively.
Table 2. The minimum Inhibitory Concentrations (MICs) of antibiofilm agents against Candida albicans
isolates.
Figure 2. The minimum Inhibitory Concentrations (MICs) of antibiofilm agents against Candida albicans
isolates by microtiter plate assay with resazurin dye.
The previous study included 14 yeast strains 7 and spectrophotometric measuring after 24 and 48
control strains were investigated regarding their in vitro hours incubation time at 36°C. The visual read-out
susceptibility to the polyene antifungal agent nystatin, of growth inhibition revealed MICs for nystatin in a
the Minimum inhibitory concentrations (MICs) for range from 0.625 to 1.25 μg/ml for all Candida species
nystatin were measured by both visual examination, tested, where the Candida albicans strains, and both
Medico-legal Update, January-March 2021, Vol. 21, No. 1 707
strains of C. glabrata and C. tropicalis, showed low It is also known that anticoagulant and calcium and
MIC values 0.625 μg/ml (17). Many previous studies magnesium chelator EDTA (Ethylenediaminetetraacetic
found that nystatin MICs for C. albicans isolated from Acid) may have antimicrobial activity against several
vulvovaginitis ranged from 1 to 16 μg/ml, with a MIC Gram-positive bacteria and Candida spp. EDTA
inhibiting 90% of isolates (MIC90) of 4 to 16 μg/ml (18,19). forms chelation with divalent metals such as Mg(2+)
and Ca(2+), which are required by various essential
The current study consistent with Al-Bakri et enzymes(24,25). EDTA demonstrated the highest
al. (2009) (20) study which indicated to need of high antifungal activity in comparison with routine antifungal
concentrations of Aspirin and EDTA to achieve MIC drugs by prevent the binding of C albicans to the proteins
against C. albicans, where Aspirin MIC values (mg/ in a dose-dependent manner and reduces the growth of
ml) of 2.03, 1.2 and 2.65 were achieved against P. C albicans by removing calcium from the cell walls
aeruginosa, E. coli and C. albicans, respectively. An and causing collapses in the cell wall, and by inhibiting
EDTA concentration as high as 60 mg/ml failed to attain enzyme reaction(26). EDTA acts on the cell surface,
the MBC value, while aspirin MBC values (mg/ml) of resulting in the rapid release of approximately half of the
4.8, 4.9 and 5.28 were reported against P. aeruginosa, lipopolysaccharide with a negligible loss of other cell
E. coli and C. albicans, respectively. Also, the results components. The disruption of the lipopolysaccharide
of Cederlund and Mardh (1993) (21) demonstrated structure in the outer membrane of Gram-negative
that Aspirin possesses a relatively weak broad- bacteria occurs because EDTA chelates divalent
spectrum antimicrobial activity where relatively high cations. The release of lipopolysaccharides increases
concentrations of aspirin are needed to effect biostatic the membrane permeability to other agents, hence the
activities and even higher concentrations are needed potentiating action(27).
for biocidal activities. Antipyretics such as Aspirin
primarily act by inhibiting prostaglandin synthesis. The effect of some antifungal and antibiofilm agents
Fungi produce prostaglandins, and although their exact (Nystatin, Aspirin and EDTA) on the biofilm formation
function is uncertain, it is thought that they influence of C. albicans isolates were achieved using microtiter
virulence, in particular controlling the yeast-to-hypha plate assay with crystal violet staining (figure 3).
transition and biofilm production. Also, changing the
surface hydrophobicity of microbes and modifying the
susceptibility of microbes to antimicrobial therapy(22;23).
Figure 3. Biofilm quantification by microtiter plate assay of Candida albicans (isolate 5) at different
subinhibitory concentrations of Nystatin, Aspirin and EDTA.
708 Medico-legal Update, January-March 2021, Vol. 21, No. 1
The results of effect Nystatin, Aspirin, and EDTA of biofilm formation by nystatin was stronger relative
at subinhibitory concentrations against the biofilm to Aspirin and EDTA, and this antifungal agent had
formation of 28 C. albicans isolates which formed the antibiofilm effect even though at very low concentrations
strong biofilm, revealed that the Inhibition activity (table 3).
Table 3. The percentages of biofilm reduction by Aspirin, EDTA and Nystatin against Candida albicans at
different subinhibitory concentrations.
** (P≤0.01).
EDTA (Ethylenediaminetetraacetic Acid): The effect of three antibiofilm agents (Nystatin, Aspirin and
EDTA) on the nystatin resistant C. albicans isolate 5 (MIC=100 μg/ml) was summarized at the figure 3 and table 4.
Table 4. The absorbance of biofilm formation of Candida albicans (isolate 5) at different subinhibitory
concentrations of Aspirin and EDTA.
O.D. (630nm)
LSD value
Antibiofim agent (μg/ml) 1000 500 250 125 62.5 31.25
Aspirin 0.581 b 1.138 a 1.211 a 1.589 a 1.384 a 1.050 a 0.456 *
EDTA 0.695 d 0.808 cd 1.505 ab 1.601 a 1.509 ab 1.195 bc 0.398 *
O.D. (630nm)
Antibiofim agent (μg/ml) 100 50 25 12.5 6.25 3.125 ---
Nystatin 0.262 d 0.411 cd 0.724 bc 1.030 b 1.401 a 1.580 a 0.377 *
Means having with the different letters in same row differed significantly.
* (P≤0.05).
O.D. of positive control = 0.063
O.D. of negative control = 1.569
Abstract
Objective: To look at those contrasts in five variables in connection to sex between impacted and erupted
lower wisdom teeth groups on digital panoramic radiographs in Iraqi young subjects.
Those variables that compared were: retromolar space might have been measured by drawing a line starting
with Ricketts (Xi) by drawing accordance with the focal point of the ramus on the distal surface of the lower
2nd molar. Retromolar space starting from the anterior edge of claiming ramus (AER-7) might have been
measured dependent upon those distal surfaces of the more level the 2nd molar along the occlusal plane.
The angle of the tooth axis of the 2nd and 3rd molar (β angle). Mesiodistal width of the lower wisdom tooth
(MDW) was calculated, while space/width ratio (SWR) might have been gotten through (AER-7/MDW).
Materials and Method: This study comprised 80 patients their ages varying between 20 and 25 years all
of them having full dentition with bilaterally present mandibular 3rd molars. After they examine clinically,
lower 3rd molars were distributed into two; Group A erupted (20 male and 20 female), whereas Group B
included the impacted mandibular 3rd molars (20 male and 20 female). Five variables were measured in
all radiographs to make a comparison between the two groups. The data analysis was done by using SPSS
(ver.10) by applying T-test and descriptive tests.
Results: The means of (Xi-7, AER-7, MDW) are larger in males than females in both groups A and B. The
means of (Xi-7, AER-7,) are larger in group A than group B. the mean of the β angle is larger in group B. the
mean of SWR in group B is less than1.
Conclusion: This study demonstrated that the long axes of the 2nd molar and wisdom teeth (β angle) and a
space parameter were important parameters in predicting mandibular 3rd molar eruption.
Figure (1): The measuring of the retromolar area was accomplished through sketching a straight line starts
from Ricketts Xi point i.e. center of ramus and it attains till the distal surface of the lower 2nd molar. The
retromolar area from the anterior fringe of the ramus (AER-7) became measured as much as the distal
surface of the lower 2nd molar along the occlusal plane. The angle of the tooth axis of the 2nd and 3rd molar
(β angle). Mesiodistal width of the lower 3rd molar (MDW).
714 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Results
The means of (Xi-7, AER-7, MDW, β angle) would bigger for males than females in group A and the means of
(Xi-7, AER-7, MDW) would bigger for males than females of group B, as shown in table (1).
In group A, the means of (Xi-7, AER-7) are larger than group B, the mean of SWR in group B is less than 1 while
the mean of β angle is larger in group B, table (2), figure (2) illustrated that.
The T-test between group A and group B showed a highly statistically significant difference for (AER-7, SWR,
β angle), table (4) clarified that.
Olowo Emmanuel Opeyemi1, Hamisah Hasan2, Abdul Mua’ti3, Julia Wirza Mohd Zawawi4
1
Doctoral Degree Student, 2Associate. Professor, 3Professor, 4Senior Lecturer, Department of Communication,
Faculty of Modern Languages and Communication, 43400 Univ. Putra Malaysia, Serdang, Selangor
Abstract
Information-seeking patterns of vaccine receivers have over time been determined their vaccine decisions.
These patterns are mostly represented by their demographic representation. Therefore it is interesting to
review how these demographic representations have affected vaccine choices in the past. This paper would
serve as a guide to health officials, human communication experts and pharmaceutical companies in the
development and distribution of Coronavirus vaccines when it is ready.
Keywords: Information seeking, Corona virus, Religion, Income, Side-effects, and Vaccine Hesitancy.
Introduction Feel, it you feel unwell, please report to the local health
authorities around you[4]. These measures could only
The 8th of December, 2019 foresaw the first reported
serve as more of a preventive measure against the virus
case of Corona Virus Disease 2019 (COVID-19) in
than a permanent cure or anti vaccine solutions that have
Wuhan, China[1]. By April 25th 2020 over 2.8 million
been put in place to tackle past epidemic and pandemic
cases and 200,000 deaths have been confirmed all over
crisis. COVID-19 does not just alter and stretch medical
the world with the United states of America, Italy, China
personals and systems it has broken the world’s economy
and Spain were countries with most reported cases[2].
as stocks and oil prices are falling by the data[4]..
More so as at the time of this study vaccine against or
to prevent this pandemic is not available. However, This chaos has led to an emergency call/need for
the World Health Organization (WHO) were able to vaccines against, and to cure COVID-19. Vaccine
team up with global forces, the mainstream media, and development is ridiculously expensive. normally it takes
the government to pass out “the kick out coronavirus” between 20-30 months for a vaccine to complete clinical
campaigns[3]. This message published in 18 languages trials and Food and Drug administration FDA approvals.
were protrude as (i) hands, washing of hands generally the race is on for the first pharmaceutical com to develop
with soap or alcohol-based solutions (ii) elbow, covering an approved (COVID-19) vaccine, but at what cost?
of mouth and nose with a bent elbow or tissue whilst would it be affordable? These are questions this paper
sneezing or coughing (iii) Face, avoid touching your face will try to collate together. For example, [5] reported
especially the “T-Zone” to prevent virus from entering that over four thousand works have begun a trial for a
your body (iv) distance, social distancing is way to break century-old vaccine for tuberculosis to see it if it could
the chain of the virus. Keep a safe space always (v) serve as an immune build up against the virus but not
a cure. The assumption of this vaccine is that if your
immune are stronger, it would limit the fatality of the
Corresponding Author: virus if you were infected. Subsequently, the Murdoch
Hamisah Hasan, PhD Children’s Research Institute (MCRI) explained that the
Associate. Professor, Department of Communication, vaccine results were expected in about six months’ time.
Faculty of Modern Languages and Communication Another by [5] illustrated that COVID-19 is expected
43400 Univ. Putra Malaysia, Serdang, Selangor to be on the market in at least 18 months. Although
Tel: +6012-371 7054 leading pharmaceuticals like ‘Inovio’ explained that a
e-mail: [email protected] DNA-based vaccine has begun pre-clinical trials (human
Medico-legal Update, January-March 2021, Vol. 21, No. 1 719
test ready). More so GlaxoSmithKline are developing the ability of human intellect and emphasises to always
a protein vaccine “molecular Clamp” that enables “save lives.” The protestant on the other hand are of the
COVID-19 to enter human cells. The United States view that vaccination is an act of lack of faith in God.
company “Moderna” has already begun testing an RNA- This explains why side effects following vaccinations
based treatment [6]. On April the 20thDr.Jennifer Miller, are seen as a punishment from God [17]The Jewish
Ph.D stated in an interview to abc NEWS that one of the have a contradicting view to that of the Orthodox,
challenges involved in the clinical trials for a COVID-19 they believe that people should vaccinate based on the
vaccine is procurement of a vaccine that is responsive recommendations of the health care professionals[16].
to population needs/demands as the vaccine would be The Islamic tradition forbids use of certain food “haram”
needed all over the world when it is ready [5].. However, add this irritations are transfer to vaccinations as well, as
it is important to understand how people approach seen In the case of Islam vs vaccines which contained
health related issues based on their information seeking pig DNA[7]These religions sentiments can/would be a
behaviours. major problem for vaccine developers should there be a
break through with the vaccine against COVID-19. They
Wilson defines ‘information behaviour’ or would have to find a balance where all of the population
‘information seeking behaviour’ as a need that arises in are comfortable with the ideology of vaccination[12].
order to fill a knowledge quest or to satisfy an information
need [7].Case, [8] explained that, an information need Yes, the race to bit time and this pandemic means
may consist or perceive a difference between an actual vaccines ought to be ready like yesterday, but would
state of knowledge or an ideal state of knowledge. This the emergency bypass for this vaccines not lead to
information need might be satisfied by searching or another catastrophe in side effects? According to the
seeking information from an informal or formal services study by the World Health Organization (WHO) in 2013
or source of information, which might result in failure they explained that the public has a really tolerance
or success in finding that information. If this search for to vaccine adverse reactions. Therefore, vaccines can
information is successful, the person might then make only be administered when there are very rare or minor
use of such information acquired to satisfy the need for reactions reported[13].Logically a vaccine that has passed
it or transfer such a knowledge to another[10]. The race all medical/clinical trials have been deem good enough
to develop a vaccine is much impressive, and the with by the appropriate authorities as good enough for the
the aid of technology one could be ready in 6-8 months. public. These vaccinations could be in oral or injection
The questions remains that are manufactures putting into forms. Subsequently, such adverse effects like dizziness,
consideration everyone in the world and trying to learn fever, headache, pain, swelling, and loss of appetite [14].
from previous mistake? With the race to create an emergency vaccine to help
combat COVID-19 which should be out there in the
would the manufacturers of this vaccine put into the market as soon as possible, pharmaceuticals need to be
consideration religious sentiments and beliefs during vary of the possible side effects that could follow such
production? as we know people reject vaccines simply vaccine, because a severe reaction or complication might
because it contains (religious) forbidden ingredients. For lead to an out-right of the vaccine [13].
example, [9]could be referred to as one of the pandemic
era in medical history because of the outbreak of measles More so, we have people who believe non-medical
and pertussis. This event in similar fashion like the exemption for vaccines. they were never vaccinated. if a
COVID-19 caused for social distancing and exclusion vaccine is available, would they be forced to accept the
from work and school in the affected areas[11].Although vaccine even if it is against their right knowing full well
as at the arrival of the vaccine, there were certain relgious that they could endanger the whole nation?
complications which influenced vaccine decisions [17].
A study by [19] found that some groups in india refused In the United States of America (USA) for example,
their childern vaccinations due to relgious predictive there are states that allow nonmedical exemptions
factors. For the catholicis the most common issues (NMEs). These emptions are allow children to be
regarding vaccinaions has been the moral reflection on exempted from vaccines due to medically contradictory
vaccines derived from using cells of a voluntatry aborted reasons[15]More so, parents are allowed to be exempted
fetus[18]. However, the catholic doctorines didn’t directly based on their personal, philosophical and religious
cover this vaccination topic directly, it only expalins on beliefs as NMEs are considered as a balance in child
720 Medico-legal Update, January-March 2021, Vol. 21, No. 1
welfare and protection of parental rights and public the vaccine. However, the protestants who believe that
health[20].In the State of Texas the main reason for NEMs vaccinations is against the almighty protection of God
has been philosophical exemptions. Although states might also posit another complication. Lastly, due to
like Oregon, Washington and California have made the the pandemic a lot of companies have been forced to lay
process of [2]. off their employees. How affordable would the vaccine
be that a family would not be forced to choose between
Lastly, would the vaccine be acceptable to 1/3 of their daily meal and vaccination? Affordability is a key
the world’s population due to the cost of the vaccine? essential in vaccine acceptance.
[6]explained that, income can be categorized into two;
i) High income countries, ii) low income countries. Conflict of Interest: There are no conflict of interest
[6],
continued that high-income countries (HIC) are noted.
often of the opinion that vaccine is a victim of its own
success. Parents in this category believe or argue that the Ethical Clearance: Taken from Universiti Putra
decrease of Vaccine preventable diseases (VPD) means Malaysia Ethics Committee (JKEUPM). Ref no-
they don’t need the vaccine anymore, as thus, the fear JKEUPM-2019-248.
of receiving “useless vaccine” is more prominent that Source of Funding: Self.
the fear of VPD. Low income countries on the other
hand, still believe in the ideology of vaccination. So, it’s References
really unclear as to why there is a decrease in acceptance
amongst them [6].[8] in an article reported for the Los 1. WHO, “Pass the message: Five steps to kicking out
Angeles Times, explained that vaccine exemptions in coronavirus,” 2020. [Online]. Available: https://
more than 150 schools in Los Angeles rose above 8%. www.who.int/news-room/detail/23-03-2020-pass-
Parents responsible for these emptions were those who the-message-five-steps-to-kicking-out-coronavirus.
earn an average of $94,500. Hiltzik concluded that 2. F. Wu, S. Zhao, B. Yu, Y. Chen, W. Wang and
schools and government shouldn’t allow these “rich” e. al., “A new coronavirus associated with human
parents affect the herd immunity with their poor vaccine respiratory disease in China,” Nature, 2020.
decisions[8].[21] illustrated in their study that, Low 3. COVID-19, “Coronavirus Pandemic cases,” 2020.
income adults are more open to accepting vaccinations [Online]. Available: https://www.worldometers.
when compared to the high-income adults. also pointed info/coronavirus/.
out that, due to personal experience, with VPD most 4. C. Joanne, “Global stocks fall as Oil Dips Below
women view vaccination positively [22]. $20,” 2020. [Online]. Available: https://www.
wsj.com/articles/global-stock-markets-dow-upda
Conclusion te-3-30-2020-11584925602-11585531131.
As the world currently seek possible solutions to the 5. K. Byron, “Austrialia enters 4,000 healthcare
COVID-19 pandemic, it is empirical for pharmaceutical to workers in trial for coronavirus vaccine,” 2020.
reflect on the possible determinates of vaccine hesitancy. [Online]. Available: https://www.thestar.com.
A vaccine is only as useful as the acceptance rate. More my/news/world/2020/03/26/australia-enters-
so, given that the nature of this kind of vaccine that 4000-healthcare-workers-in-trial-for-coronavirus-
would be useful to everyone irrespective of their socio vaccine.
demographic representation. This is tricky because of
6. M. Mark, “Coronavirus vaccine: How soon will
the contagion rate of the pandemic. One cannot afford to
we have one?,” 2020. [Online]. Available: https://
leave out a certain heterogenous anti vaccine population.
www.weforum.org/agenda/2020/03/vaccine-
Questions of how the United Nations (UN) would
covid-19-coronavirus-pandemic-healthcare/.
enforce those against non-medical exemptions to take the
vaccine when it is eventually ready is fascinating. Would 7. N. B. Angela, “Injecting healthy adults with live
the rights of private individuals be treated and put into coronavirus provides moral dilemma, faster path
consideration before the safety of the herd? How would to vaccine,” 2020. [Online]. Available: https://
they be convinced to accept the vaccine? As for religion, abcnews.go.com/Health/injecting-healthy-
as observed above that might be a little flexible if the adults-live-coronavirus-moral-dilemma-faster/
“forbidden’ materials are not used in the procurement of story?id=70331610.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 721
8. U. A Knol M, “Large ongoing measles outbreak 16. S. K. McCauley, “Exploring the choice to refuse or
in a religious community in the Netherlands since delay vaccines: A national survey of parents of 6-
May 2013,” Euro Surveill, 2013. through 23-month olds,” Academic Pediatre, 2012.
9. H.. Ruijs WL, “The role of religious leaders in 17. S. N. Omer SB, “Vaccine refusal, mandatory
promoting acceptance of vaccination within a immunization, and the risks of vaccine-preventable
minority group: a qualitative study.,” BMC Public diseases.,” N Engl J Med., 2009.
Health, 2013. 18. R. Silverman, “No more kidding around:
10. G. M. Shrivastwa N, “Predictors of vaccination in restructuring non-medical childhood immunization
India for children aged 12-36 months.,” Vaccine, exemptions to ensure public health protection.,”
2015. Ann Health Law, 2003.
11. E. Sgreccia, “Moral reflection on vaccines prepared 19. N. Blank, A. Caplan and C. Constable, “Exempting
from cells derived from aborted human foetus,” schoolchildren from immunizations: states with
Pontificial Academia Pro Vita., 2005. few barriers had highest rates of nonmedical
12. Rabbinical, “Rabbinical Council of America. exemptions.,” Health Aff (Millwood), 2013.
Statement on Vaccinations from the OU and 20. M. Hiltzik, “Rich, educated and stupid parents
Rabbinical Council of America,” 2016. [Online]. are driving the vaccination crisis,” 15 December
Available: http://www.rabbis.org/news/article. 2018. [Online]. Available: https://www.latimes.
cfm?id=105814. com/business/hiltzik/la-fi-mh-vaccination-crisis-
13. J. D. Grabenstein, “What the world’s religions 20140903-column.html.
teach, applied to vaccines and immune globulins,” 21. P. Jeudin, E. Liveright, G. Marcela, C. Del and
Vaccine, 2013. B. Rebecca, “Race, Ethnicity, and income factors
14. WHO, “Adverse events following immunization,” impacting human papillomavirus vaccination
The World Health Organisation, 2013. rates,” Clinical Therapeutics, p. 36, 2014.
15. E. O. Olowo, H. Hamisah and W. M. Z. Julia, 22. E. Dube, M. Vivion and N. E. MacDonald, “Vaccine
“Information Seeking and Trust on Vaccination hesitancy, vaccine refusal and the anti-vaccine
Practices,” Human Communication PACA, 2018. movement: Influence, impact and implications,”
Vaccines, 2015.
722 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2398
Jordanian Ministry of Education, Jordan, 5Associate Professor, Vice Dean for Deanship of Scientific Research, Al-
Ahliyya Amman University (AAU), Jordan, 6Mohannad A. Aldiqs MSN, RN, CNS, Lecturer, Mental Health Nursing,
Al-Ahliyya Amman University (AAU)/Faculty of Nursing, Jordan
Abstract
The pandemic of COVID-19 has globally interrupted the education systems. Many countries including
Jordan forcefully moved to online education. This study is designed to build an innovative Framework to
overcome the concerns and challenges of online clinical teaching.
A cyclical module of the Online Clinical Training Pathway (OCTP) was created to provide an opportunity for
students to document their learning, in the form of a reflection guide. Each module aims to attain the intended
learning outcomes through a set of four integrated learning activities. OCTP success was assessed by regular
evaluation parallel with semi-structured interview targeted faculty members and students across courses and
student levels. The results emerged a new framework of the teaching and learning of synchronous distance
learning among participants. Technical limitations were also observed with regards to internet-connection
speed and reliability. Quality indicators of the synchronous and asynchronous online environment were
issues that need to be addressed. Creating opportunities to enhance online engagement through the use of
new framework methodology provides a promising direction to bring experiential education into the online
context.
Ensure the Lecturer Sees Participants’ Faces The online teaching environment creates some
along with the Lecture Slides: It is always helpful for obstacles for student-instructor interactions during the
lecturers to see students’ faces to recognize students’ sessions. Several actions need to be considered by the
reactions. Microsoft Teams can display up to 40 Instructor. Instructors normally need to ask students
participants on a screen and allows users to use dual to mute their microphones during the session, as
screens (2,3). Unfortunately, the number of students you microphones can catch a background noise, which makes
can display depends on your (Personal Computer) PC’s the instructor’s voices less audible. Even if the Instructor
specification. The instructor PC’s CPU should be Intel i7 displays all students’ faces, it is still challenging for a
or equivalent to be able to show 49 participants on display lecturer to visually notice signs that students want to
(4). If the computer has Intel Quad-Core i3, so it could say something. Instructors need to more systematically
only display 15 on a window, and when there are a larger (rather than naturally) organize interactions.
number of participants, the instructor needs to scroll the To enhance students’ readiness and interaction
window to watch all students, which is not convenient in a weekly manner proceeding of the online session,
(4,5). So, instructors need to use two sets of PC and
the standardized videos, competency checklists, and
external monitors to see all participants. Additionally, structured case scenarios were uploaded on a synchronize
the quality of the internet used by the Instructor may (MOODLE/V class) system.
limit the uses of options within the Microsoft Team.
Further, on daily basis, the Clinical Training Portfolio
The Quality Standards of Case Sceneries: The was used by the instructor. Portfolios are valuable for
online-training methodology is a method that tries clinical evaluation because students provide evidence in
to rebuild real-world characteristics and to enhance their portfolios to confirm their clinical competencies and
learners’ clinical judgment, by using a problem- document new learning and skills acquired in a course.
solving approach integrated into interactive learning The focus will be on inter-professional communication,
scenarios(3,4). These scenarios provide students with collaboration professionalism, and teamwork by
practical experience and immediate feedback through applying meaningful, and realistic scenarios(9) followed
debriefing and guided reflection(7). by a guided reflection that is a helpful tool in health care,
Faculty of Nursing adopted a set of quality standards to develop professional practice and improve the quality
when the case sceneries designed as follows: (a) identify of care(3,10).
patient and other problems apparent or expected in Evaluation for Students’ Interaction: In follow-
the case, (b) suggest alternative problems that might up for debriefings of student-instructor interactions,
be possible if more information were available, (c) the training provided to learners with feedback about
identify the information needed, (d) identify relevant their professional manner, attitude, and interpersonal
and irrelevant information in the case, (e) interpret the skills, thus promoting standardized, rather than personal
information to enable a response, (f) propose different learning; this feedback is immediate and from the critical
approaches that might be used, weigh approaches against point of the adopted course portfolio.
the evidence, select the best approaches for the case
situation, and provide a rationale for those approaches, The evaluation was conducted in three steps. The
(g) Identify gaps in the literature and evidence as first step aimed to assess the current status of each
related to the case, and (h) evaluate the effectiveness of competency for students based on the course portfolio.
interventions, and plan alternative interventions based An evaluation was conducted every week. Various
on analysis of the case. method focusing on the critical and/or core points were
724 Medico-legal Update, January-March 2021, Vol. 21, No. 1
used such as the folded and unfolded case scenario, self- Results
exam module, short quizzes, and students’ presentation.
Newly Emerged Online Framework: The huge
The second step aimed to explore the opportunities for
challenges in online teaching for clinical courses were
improvement; the faculty members were conducted a
to tell students exactly what they should achieve and
weekly basis meeting to do a gap analysis to each course.
to continuously monitor their progression. The student
The analysis was done by discussing the achievement
is required to learn predetermined sets of intended
report provided in the form of reflection which includes
learning outcomes for each course supervised by Faculty
the target and desired level of competencies based on
members.
Benner’s adopted model.
He/she worked intensively and closely with the
In the third step, the evaluation aimed to follow up on
administrative support system to make this framework
the implementation of the action plan using an objective
evident and ready for implementation. First, there is an
structured clinical examination (OSCE) and a final
agreement to run the clinical training in three phases:
written exam. OSCE and the final written exam cover
Phase- 1 preliminary phase (pre-training phase) refers
all educational materials uploaded in the MOODLE and
to the activities and preparatory work made before
matched with the Nursing Student Clinical Training
the actual conduct of training. In this phase, actual
Portfolio and parallel with learning outcomes for each
preparations are made for launching the program. It
clinical course.
involves the following activities: assessment of the
needs of training design, and development of the training
Method
courses according to intended learning outcomes.
The study was guided by Benner’s model. Online
Clinical Training Pathway (OCTP) was created to Phase -2 will follow the framework that was created
provide an opportunity for students to document, in and named as Online Clinical Training Pathway (OCTP)
the form of a reflection guide. Using a semi-structured (Figure 1). Figure 1 describes the four consequent steps
interview, purposive sampling of faculty members during the OCTP. Before the launching of OCTP and
(focus group) (n = 4) and students (n = 6) from different going live a crash session was conducted to all faculty
courses and levels were recruited to evaluate barriers members to explain the OCTP steps, integrate OCTP
and facilitators of OCTP utilization. effectively within in a dual system of synchronized and
a synchronized online training, and to obtain feedback
The interviewer (moderator) guided the discussion of online training via a structured weekly performance
according to a written set of questions or topics to be report submitted by the instructors to the coordinator of
covered, as in a semi-structured interview. Focus group clinical training.
sessions are carefully planned discussions that take
advantage of group dynamics for efficiently accessing In phase-2 of OCTP, students will be assigned to
rich information in an efficient manner. Typically, the direct assignments depending on their level of learning
people selected for a group (usually through purposive and the nature of the course (e.g. standardized video, case
or snowball sampling) are a fairly homogeneous group, scenarios, short essay, questions, log paper, self-exam
to promote a comfortable group dynamic. The setting for module, and critical point care, etc.). All assignments
the focus group sessions selected carefully and, ideally, were submitted through a synchronized online learning
should be a neutral one. platform (V-class/Moodle). Following the assignments
submission, all graded assignments will be discussed in
Analysis: Use quantitative method as adjuncts an interactive online session conducted via synchronized
to qualitative analysis was used similar to Kidd et distance learning (Microsoft Team). The online session
al., (11). Filling gaps of OCTP evaluation and return via Microsoft Team provides students a chance to
demonstration end by implementing a New framework interact with their instructors and other students and help
for clinical course distance training. faculty members to explore the clinical reasoning and
judgment of their students.
Ethical Considerations: Written IRB approval
was obtained as an expedited review from the Scientific Additionally, students need to go a long standardized
Research Committee of Nursing Faculty at Al-Ahliyya video, and competency-based check-off based on the
Amman University (AAU). National Council Licensure Examination (NCLEX)
Medico-legal Update, January-March 2021, Vol. 21, No. 1 725
standards. Students are required to be mastered certain objectives. In this phase, four criteria were included:
psychomotor skills in a real clinical setting. So, a reaction, learning, behavior, and results. OCTP program
structured of folded and unfolded case scenarios were is continuously assessed and the gap noticed in this
built and match with clinical intended learning outcomes training will be followed by remedial actions after
for each course and compatible with the Nursing Student the commencement of education on campus. Phase 3
Clinical Training Portfolio to achieve this goal. These and phase 4 were proposed based on the continuous
blended method provided to students in touch with evaluation method during phase 2. In phase 3 and
the clinical area will enhance their critical thinking, phase 4, a 2 weeks intensive training in a simulation lab
reasoning, and clinical judgment once since they are followed by a final written exam and objective structured
way from the clinical area due to the constraints of clinical examination (OSCE) are an example of future
lockdown and quarantine associated with the pandemic proposed remedies. The integration of all online training
state of COVID-19. phases starting from preliminary to OCTP use and
evaluation process was ended by the emerging Khraisat
In phase 2 evaluation is evident and continuously and Al-Bashaireh Distance Training Model (KADTM)
monitored, it is a process to determine the relevance, as showed in Figure 1.
effectiveness, and impact of activities in light of their
Hence, the first few days up to the first week most References
of the issues were related technologies such as access, 1. Field DE. Moving from novice to expert–the value
use, connectivity, voice, noise, and control while using of learning in clinical practice: a literature review.
Moodle or Microsoft Team. However, in the second Nurse education today. 2004 Oct 1;24(7):560-5.
week, these complaints vanished, students become more
2. Farhadi B. “ The Sky’s the Limit”: On the
focused on the material, reading, Instructor feedbacks,
Impossible Promise of E-learning in the Toronto
and the anxiety toward the midterm exam.
District School Board (Doctoral dissertation).
Conclusions 3. Petrucci C, La Cerra C, Caponnetto V, Franconi
I, Gaxhja E, Rubbi I, Lancia L. Literature-based
Both faculty members and students reported they “
analysis of the potentials and the limitations of using
learned a new strategy of the teaching and learning of
simulation in nursing education. InInternational
synchronous distance learning”. Distance Learning is an
Conference in Methodologies and intelligent
educational occasion that helps students to understand
Systems for Techhnology Enhanced Learning 2017
the content better and improves their engagement in
Jun 21 (pp. 57-64). Springer, Cham.
learning.
4. Cheng A, Morse KJ, Rudolph J, Arab AA, Runnacles
Creating opportunities to enhance online J, Eppich W. Learner-centered debriefing for health
engagement through the use of simulation provides care simulation education: lessons for faculty
a promising direction to bring experiential education development. Simulation in Healthcare. 2016 Feb
1;11(1):32-40.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 727
5. Murphy MP. COVID-19 and emergency coronavirus (COVID-19). InStatpearls [internet]
eLearning: Consequences of the securitization of 2020 Mar 8. StatPearls Publishing.
higher education for post-pandemic pedagogy. 9. Luhanga FL. The traditional-faculty supervised
Contemporary Security Policy. 2020 May 1:1-4. teaching model: Nursing faculty and clinical
6. Zhao J, Xiao H, Li Y, Wen D, Xu P, Fu Y, Piao instructors’ perspectives. Journal of Nursing
J, Liu J, Cao D, Zhong Z, Zhao G. Experience of Education and Practice. 2018;8(6):124-37.
Massive Distance Online Education for Medical 10. Barak M, Hussein-Farraj R, Dori YJ. On-campus
Colleges and Universities in China to Counter the or online: examining self-regulation and cognitive
COVID-19 Pandemic. transfer skills in different learning settings.
7. Oh PJ, Jeon KD, Koh MS. The effects of simulation- International Journal of Educational Technology in
based learning using standardized patients in Higher Education. 2016 Dec;13(1):1-8.
nursing students: A meta-analysis. Nurse education 11. Kidd PS, Parshall MB. Getting the focus and
today. 2015 May 1;35(5): e6-15. the group: enhancing analytical rigor in focus
8. Cascella M, Rajnik M, Cuomo A, Dulebohn SC, group research. Qualitative health research. 2000
Di Napoli R. Features, evaluation and treatment May;10(3):293-308.
728 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2399
Abstract
Background: The expectation of a woman during pregnancy is to have a healthy live bay with no
complications. Admission of a newborn baby to the newborn unit is distressing to the parents, more so in
cases where there is little or no support from the health care team and other players.
Objective: To establish factors contributing to emotional distress among postpartum mothers with newborns
at newborn unit Kenyatta National Hospital, Kenya.
Method: This was a descriptive cross-sectional study employing a quantitative method by use of an
interviewer-administered questionnaire. The study was conducted among 59 postpartum mothers with
newborns at the Newborn Unit Kenyatta National Hospital. Simple random sampling technique was
employed and data collected using a pretested semi-structured questionnaire. Data was analyzed using
Statistical Package for The Social SPSS version 25 software. Qualitative data was coded, categorized into
themes and thematic analysis done.
Results: The factors contributing to maternal emotional distress were low levels of education primary
14(23.7%) and secondary 23(39.0%) and unemployment 27(45.8%). In addition, lengthy NBU stays
34(57.6%), ineffective communication patterns 18(30.5%) and null communication 9(15.3%) between
mothers and the healthcare givers contributed to emotional distress.
Conclusion: There are sociodemographic, socioeconomic, and hospital factors contributing to maternal
emotional distress.
Abstract
Background: Chronic diseases have become a major public health problem and the leading cause of
morbidity and mortality. The burden of chronic kidney disease in India cannot be assessed accurately.
QOL is an overall assessment of a person’s well-being, which may include physical, emotional, and social
dimensions, as well as stress level, sexual function, and self-perceived health status. Patients’ quality of life
(QOL) and satisfaction assessment are becoming increasingly important in health care delivery. There is
evidence that better QOL and patient satisfaction might be associated with better medical outcome including
reduced hospitalization and reduced mortality. The present aims are to assess the satisfaction level and
quality of life among haemodialysis patients on dialysis therapy.
Method: A descriptive study was chosen to assess the satisfaction level and quality of life among 100
haemodialysispatients. The structured questionnaire was used to assess the satisfaction level and quality of
life among haemodialysispatients. The present study results depicts that in regards to the level of satisfaction
on dialysis procedure 16%were completely dissatisfied, 37% were dissatisfied, 18% were neither satisfied
nor dissatisfied, 12% were satisfied and 17% were completely satisfied. The level of quality of life among
haemodialysis patients, 8% had very negative impact, 42% had negative impact, 22% had no impact, 23%
had positive impact and 5% had very positive impact.
Conclusion: The present study findings concluded that patients on HD were not having adequate QOL in
all domains except patient satisfaction due to changes in the physiological, chemical changes occur in the
kidney.
Keywords: Satisfaction level, Quality of life, Hemodialysis, CKD and Dialysis Therapy.
Ethical Clearance: This project has been approved 10. Kim JY, Kim B, Park KS, Choi JY, Seo JJ, Park SH,
by the ethical committee of the Saveetha Institute of et al. Health-related quality of life with KDQOL-36
Medical and Technical Sciences. and its association with self-efficacy and treatment
satisfaction in Korean dialysis patients. Qual Life
Financial Support and Sponsorship: Nil Res 2013;22:753-8.
11. Wan EY, Chen JY, Choi EP, Wong CK, Chan AK,
Conflicts of Interest: The authors declare no
Chan KH, et al. Patterns of health-related quality
conflicts of interest.
of life and associated factors in Chinese patients
undergoing haemodialysis. Health Qual Life
Reference
Outcomes 2015;13:108.
1. Khan IA, Nasiruddin M, Haque SF, Khan RA. A 12. Baby B, Antony CL, Wilson S, Xavier T, Tamilselvan
randomized clinical trial to evaluate the efficacy T. Evaluation of impact of pharmaceutical care on
and safety of keto amino acids in stage 3 and 4 of improving knowledge and medication adherence in
chronic kidney disease. Asian J Pharm Clin Res CKD Patients. Int J Pharm Pharm Sci 2017;9:63-6.
2014: 7:21-4.
13. Eissa MA, Sulaiman AM, Jondeby M, Karkar A,
2. Schieppati A, Remuzzi G. Chronic renal diseases Barahmein V, Shaheen FA, et al. Factors affecting
as a public health problem: Epidemiology, social, haemodialysis patients’ satisfaction with their
and economic implications. Kidney Int Suppl 2005: dialysis therapy. Int J Nephrol 2010:340-46.
68:S7-10.
14. Abraham S, Venu A, Ramachandran A, Chandran
3. Raines N, González M, Wyatt C, Kurzrok M, PM, Raman S. Assessment of quality of life
Pool C, Lemma T, et al. Risk factors for reduced in patients on haemodialysis and the impact of
glomerular filtration rate in a Nicaraguan community counselling. Saudi J Kidney Dis Transpl. 2012;
affected by Mesoamerican nephropathy. MEDICC 23:953-7.
Rev 2014; 16:16-22.
738 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2401
Abstract
Exogenous Cushing’s syndrome is a collection of symptoms and clinical signs due to elevated levels
of glucocorticoids (cortisol) in the blood because of prolonged consumption of glucocorticoid drugs.
Glucocorticoids were introduced in the 1950s and have been used for anti-inflammatory treatment. Withdrawal
of glucocorticoids can lead to complications of secondary adrenal insufficiency caused by suppression of
the Hypothalamic-Pituitary-Adrenal (HPA) axis. Male, 28 years old, with weakness in both hands and feet
throughout 3 days before admission to hospital. Other complaints include nausea (+), vomiting (+), diarrhea
(-). He had been taking dexamethasone daily in the past 3 years until one month ago when he suddenly
stopped. Physical examination revealed moon facies (+), striae (+) in the abdomen, and motor strength of 2
in all four extremities. Laboratory: K 2.0 mmol/L, Mg 0.8 mg/dL, GDA 64 mg/dL, Total cholesterol 240 mg/
dL, cortisol 18.67 ng/mL, ACTH 2.1 pg/mL. The patient was diagnosed with exogenous Cushing’s syndrome
based on a history of long-term use of dexamethasone. Physical examination revealed moon face, buffalo
hump, purplish striae, and hypertension. The patient stopped dexamethasone consumption suddenly and is
consequently experiencing secondary adrenal insufficiency at the present time. As evidenced by laboratory
values, there was a decrease in serum cortisol (18.67 ng/mL), as well as a decrease in serum ACTH (2.1 pg/
mL). Based on the history of dexamethasone use, physical examination, and laboratory results, this patient
had exogenous Cushing’s syndrome. Sudden discontinuation of dexamethasone results in withdrawal
symptoms in the form of secondary adrenal insufficiency as indicated by low cortisol and ACTH values.
Supporting Examination:
Conclusion: The results of blood gas analysis on 26-08-2020 showed a metabolic alkalosis with compensation
for respiratory acidosis. Blood gas analysis tests on 28-08-2020 revealed an uncompensated metabolic alkalosis.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 741
Table 4. Immunological Examination.
Conclusion: Immunological and thyroid function examination results in the patient were within normal range.
Polevoy G.G.
Abstract
Background: The problem of switching the attention of schoolchildren can be solved by exercises in
physical education classes at school.
Aim: To determine the influence of exercise Classics on the ability of schoolchildren to switch their attention
at the age of 9-10 years.
Method: The study was conducted over a period of 9 months, in which 40 9-10-year-olds took part.
Physical education classes were held 2 times a week for 40 minutes each lesson. The level of development
of coordination abilities was assessed on the «Shuttle run» test, and the indicators of attention switching on
the «Method of Numbers» test. The programs bio-stat 2009, Microsoft excel 2016 and t-student were used
for mathematical and statistical processing of results.
Results: Before the beginning of the pedagogical experiment, the indicators of school children between the
groups did not have significant differences (P>0.05). After the end of the study, the indicators in both groups
improved. In CG, in the «Shuttle run» test, the indicators improved from 10.2±0.6 to 9.9±0.5 (P>0.05),
and in the test for the level of attention switching, the indicators improved by 5.4% (P>0.05). In EG, in the
«Shuttle run 3x10 m» test, the indicators improved from 9.9±0.5 to 8.5±0.4 (P<0.05), and in the «Method of
Numbers» test, the indicators improved by 26.6%. These results indicate the effectiveness of using exercise
Classics in physical education lessons in working with younger schoolchildren.
Conclusion: If schoolchildren will perform exercise Classics in physical education classes at school, they
will improve not only coordination abilities, but also attention switching indicators.
Keywords: Attention switching, coordination abilities, school children, physical education, Classics.
1 5 6 2 8 5 9 3 4
4 8 2 7 4 1 8 2 7
9 7 3 9 3 6 1 6 5
Exercise Classics: In the gym, there are three large the side of the small square is 60 cm. Inside each small
squares on the floor. The side of one square is 180 cm. square are numbers from 1 to 9.
Inside each large square there are nine small squares,
746 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Task: the schoolchild must use jumps from square Statistical Analysis: The results of the pedagogical
to square to get from number 1 to number 2, then to experiment were processed using Microsoft excel 2016,
number 3, and so on, to number 9. After that, it should which allows you to determine the average value of the
jump on the same squares in reverse order (from number indicators of both groups. The bio-stat 2009 program
9 to number 1). You can move around the squares in any allows us to compare groups and determine the reliability
way (from one leg to the other, jump on one leg or on of the results (P<0.05) using the t-student parametric
two). If the schoolchild makes a mistake, he returns to criterion19.
the previous square. During the lesson, each schoolchild
must overcome three large squares. The numbers in the Results
squares must be changed by the teacher before each Before the beginning of the pedagogical research,
lesson. You can perform the exercise in any part of the all 40 schoolchildren took control tests. It should be
lesson. noted that before the study, the differences in indicators
Before and after the pedagogical experiment all between schoolchildren were not significant (P>0.05).
schoolchildren took control tests: After the study, the indicators changed in both classes
(table 3).
1. “Shuttle run 3x10 m” (indicator of coordination
abilities)17. Table 3 shows that the performance of schoolchildren
from CG and EG improved in both tests. However, the
2. “Method of Numbers”18. improvement in both tests was different. In children in
The A4 sheet shows 2 large squares. Each square grade 3A who were engaged in the standard physical
has 16 small squares with numbers from 1 to 16 written education program at school, the performance in the
in them (table 2). «Shuttle run» test improved from 10.2±0.6 to 9.9±0.5
(P>0.05). Schoolchildren who were engaged in the
Table 2. Example of a blank in the “Method of standard program and performed the exercise Classics
Numbers” test in each lesson improved their coordination abilities
from 9.9±0.5 to 8.5±0.4 (P<0.05). In the same way,
4 9 14 11 15 14 2 7 the pedagogical experiment affected the indicators of
16 1 2 6 3 5 8 10 switching the attention of schoolchildren. Children from
CG in the «Method of Numbers» test had 5.4% higher
13 8 15 3 12 9 13 16 scores (P>0.05), and children from EG had 26.6% better
5 12 7 10 1 11 6 4 scores (P<0.05). Thus, we can talk about the insignificant
effectiveness of the standard physical education
Schoolchildren should switch their attention program in secondary schools for the development of
from square to square so that they can cross out the coordination abilities, and the introduction of exercise
numbers in turn, first in the left square (number 1), Classics in the educational process in physical education
then in the right square (number 1). The exercise ends has a significant and positive effect on both coordination
when the schoolchildren has crossed out number 16 in abilities and the ability of schoolchildren to switch
both squares. Result: the time that children spent on attention.
completing the task (0.1 seconds).
Table 3. Indicators of coordination abilities and abilities of children 9-10 years old to switch attention
CG EG
Test
Before After % P Before After % P
Shuttle run 3x10 m (s) 10.2±0.6 9.9±0.5 2.9 P>0.05 9.9±0.5 8.5±0.4 14.1 P<0.05
Method of Numbers (s) 44.1±3.4 41.7±4.1 5.4 P>0.05 42,9±3.9 31.5±3.3 26.6 P<0.05
Medico-legal Update, January-March 2021, Vol. 21, No. 1 747
Abstract
Background: Overweight and obesity is associated with an increased risk of morbidity and mortality as
well as reduced life expectancy.
Objectives: The objectives of the study was to assess and compare the dietary habits among overweight
adolescents before and after teaching and text message based intervention in experimental and comparison
group, to determine the association of dietary habits among overweight adolescents with their selected
variables in experimental and comparison group.
Methodology: A quasi experimental non equivalent control group pretest-posttest design was used for the
study. Fifty nine (59) overweight adolescents were selected by using purposive sampling technique. The
data was collected by rating scale to assess the dietary habits for overweight.
Results and Conclusion: The findings revealed that mean post test score of dietary habits (29.5 ± 2.55) was
significantly higher in experimental group than mean post test score of dietary habits. There was a significant
association found between post test of dietary habits of experimental group with BMI (p=0.02) and with
age (p=0.05) in comparison group. It was concluded from the study that teaching and text message based
intervention was effective in improving the dietary habits among overweight adolescents.
Keywords: Dietary habits, overweight adolescents, teaching and text message based intervention.
Material and Method i.e. frequency, mean, median, standard deviation, chi-
square, ANOVA and ‘t’ test.
The study was conducted in January 2017 in the
state Haryana, India. A sample of 60 (analyzed 59 due
Results and Discussions
to attrition of one adolescent) overweight adolescents
(13-16 years of age) participated in the study with the Homogeneity between the experimental and
prior permission from the Principals of participating comparison group was checked by x2 test in terms of
schools. The ethical clearance was obtained from selected variables that is age, gender, religion, total
university research ethics committee of Maharishi family income per month (in rupees), number of
Markandeshwar University Mullana, Ambala (MMU/ siblings, birth order, type of family, dietary habits, kind
IEC/775) and the study was carried out in accordance of medication taken, other health risk habits, mother’s
with the guidelines laid by Indian Council for Medical educational status, father educational status, mother’s
Research ICMR (2006). The assent was taken from occupation, father’s occupation, place of living, height,
the overweight adolescents and telephonic consent weight, Body Mass Index. There was no significant
was taken from the parents prior to the study. A quasi difference between experimental and comparison group
experimental Non Equivalent Control Group Pretest- in terms of selected variables at 0.05 level of significance
Posttest Research Design was used in this study. The which infer that both the groups were homogenous in
overweight adolescents who were in the age group of terms of selected variables except number of siblings
13-15 years and were studying in selected schools of (p=0.01), mother’s educational status (p=0.004) and
Mullana/Ambala and were available to be accessed as place of living (p=0.00).
study subjects. The overweight adolescents who were
There was no significant difference between
not regular to school were excluded from the study. Fifty
experimental and comparison group in terms of selected
nine (59) overweight adolescents were enrolled in the
variables at 0.05 level of significance which infer that
study. Out of which 30 were enrolled in experimental
both the groups were homogenous in terms of selected
group and 29 were enrolled in comparison group on
variables except number of siblings (p=0.01), mother’s
convenient basis. Data was collected by using rating
educational status (p=0.004) and place of living (p=0.00).
scale to assess dietary habits for overweight. Reliability
of the tool was established by Cronbach’s alpha and was Percentage distribution of experimental and
found to be 0.74 (acceptable range is 0.07-1.00). comparison group in terms of level of dietary habits is
shown in figure 1. Majority of overweight adolescents
Statistical Analysis: According to the objectives,
in both experimental and comparison group were
hypothesis of the study and opinion of the expert, it
following unhealthy dietary habits i.e. 90% and 89.65%
was planned to organize, analyze and interpret the
respectively.
data by using both descriptive and inferential statistics
Figure 1: Pre test score of level of Dietary Habits before Administration of Teaching and Text Message
Based Intervention
752 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Majority of overweight adolescents in experimental adolescents were following unhealthy dietary habits
group were following healthy dietary habits i.e. i.e. 27(93.1%) after administration of teaching and text
26(86.66%) whereas in comparison group majority of message based intervention. [Figure 2].
Figure 2: Post test score of level of Dietary Habits after Administration of Teaching and Text Message Based
Intervention
In order to find out the significant difference independent ‘t’ test was applied which is shown in
between experimental and comparison group in dietary table 1.
habits after teaching and text message based intervention
Table 1: Mean score of dietary habits after teaching and text message based intervention among overweight
adolescents in experimental and comparison group N=59
The table shows that there was a significant Further, paired ‘t’ test was applied to find out the
difference between experimental and comparison group significant difference within the experimental group
in dietary habits after teaching and text message based which is shown in table 2.
intervention as computed ‘t’ value 19.44 was higher than
the tabulated ‘t’ value (2.00) at 0.05 level of significance.
Table 2: Mean pre test and post test scores of dietary habits among overweight adolescents in experimental
group n=30
Abstract
Background: Acute poisoning is a medical emergency as well as a major public health problem as it leads
to significant burden on healthcare services. It is pertinent to know the nature and outcome of poisoning for
effective prevention and management strategies.
Method: A comparative retrospective analysis of 622 poisoning cases admitted to a tertiary care hospital
during the period from 2011-12 and 2018-19 were compared to assess the age, sex, mode of poisoning and
the nature of the poisonous substance.
Conclusion: The study reveals a sharp increase in the acute poisoning cases and changing trends of
commonly used poisons with passage of time. Although, males outnumbered females, a steep rise in female
poisoning cases, with majority (60%) being young adults especially in the age group of 21-30 years is
alarming. Suicide was the most common manner of poisoning, while organophosphates and medicinal drugs
were the most commonly used substances.
Keywords: Drug overdose; Organophosphates; Pesticides; Poisoning; Prescription drug misuse; Suicide.
Organophosphorus compound was the commonest During the years 2011-12, mortality was noted in 14
poison in both the time periods, owing to its easy cases (6.9%), of which 12 cases (85.71%) were due to
availability [Fig. 1]. This finding is consistent with most organophosphate poisoning, compared to 28 cases(6.7%)
of the Indian studies,5,10 although studies from northern during in the years 2018-19, of which 17 cases (60.71%)
parts of India have reported aluminium phosphide as were due to organophosphorus poison and 6 cases
a common cause of poisoning8. Rise in drug overdose (21.43%) due to other pesticides. Although some studies
cases is gaining popularity in recent years as a means have reported higher mortality rate of 15%,4,10 lower
of poisoning in majority of victims in their second and mortality in our study could be due to early accessibility
third decades, especially in students and housewives.12 to health centre, early therapeutic interventions and
This could possibly be due to easy availability and sophisticated tertiary care centre facility.
accessibility to all types of medicines over the counter
2011-12 2018-19
Statistics p<0.05
Variables Males Females Total Males Females Total significant
n=114 (%) n=90 (%) n=204 (%) n=215 (%) n=203 (%) n=418 (%)
< 10 6 (5.26) 0 (0) 6 (2.94) 12 (5.58) 10 (4.93) 22 (5.26)
ᵡ² for males=3.19,
11-20 18 (15.79) 32 (35.56) 50 (24.52) 34 (15.81) 47 (23.15) 81 (19.38) df=6, p>0.05, NS*;
21-30 56 (49.12) 44 (48.89) 100 (49.02) 89 (41.40) 75 (36.95) 164 (39.23) ᵡ² for females=18.59,
Age in df=6, p<0.05,
31-40 16 (14.04) 6 (6.67) 22 (10.78) 43 (20.00) 37 (18.23) 83 (19.86)
years significant.
41-50 10 (8.77) 4 (4.44) 14 (6.86) 18 (8.37) 16 (7.88) 34 (8.12) ᵡ² for total
51-60 4 (3.51) 2 (2.22) 6 (2.94) 7 (3.26) 10 (4.93) 17 (4.07) cases=15.04, df=6,
p<0.05, significant.
> 61 4 (3.51) 2 (2.22) 6 (2.94) 12 (5.58) 8 (3.94) 20 (4.78)
ᵡ² for males=0.92,
Married 62 (54.39) 60 (66.67) 122 (59.80) 105 (48.84) 143 (70.44) 248 (59.33) df=1, p>0.05, NS
Marital ᵡ² for females=0.42,
status df=1, p>0.05, NS
Single 52 (45.61) 30 (33.33) 82 (40.20) 110 (51.16) 60 (29.56) 170 (40.67) ᵡ² for total cases=0.01,
df=1, p>0.05, NS
ᵡ² for males=0.01,
Suicidal 96 (84.21) 84 (93.33) 180 (88.24) 182 (84.65) 176 (86.70) 358 (85.65) df=1, p>0.05, NS;
Manner of ᵡ² for females=2.75,
poisoning^ df=1, p>0.05, NS.
Accidental 18 (15.79) 6 (6.67) 24 (11.76) 33 (15.35) 27 (13.30) 60 (14.35) ᵡ² for total cases=0.79,
df=1, p>0.05, NS
*NS=not significant; ^none of the cases were reported to be homicidal in nature;
758 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2: Changing trends in distribution of poisoning cases according to occupation
2011-12 2018-19
Occupation Percentage change (%)
n=204 (%) n=418 (%)
Farmers 57 (27.94) 120 (28.71) 0.77
Housewives 50 (24.51) 140 (33.49) 8.98
Students 45 (22.06) 105 (25.12) 3.06
Others 28 (13.73) 42 (10.05) -3.68
Unemployed 24 (11.76) 11 (2.63) -9.13
ᵡ² =26.152, df=4; p<0.05; significant (Others - include businessmen, drivers, labourers, teachers and children less than 5 yrs)
ᵡ² =41.201, df=8, p<0.05; significant (Others - includes plant poisons, glass pieces)
Abstract
Haemorrhoids is considered to be one of the most common surgical condition nowadays. Its prevalence is
4.4% i.e. 10 million world population. The purpose of this study is to observe outcomes of various procedures
and conservative management in patients respective to their grades of haemorrhoids. In our setup we used
dietary and lifestyle modification, Medications (Topical/Systemic) stapled haemorrhoidopexy, Milligan
Morgan Hemorrhoidectomy.
M1- Dietary and lifestyle modifications, M2- Medical Management, M3- Stapled Haemorrhoidopexy,
M4- Milligan Morgan Hemorrhoidectomy
Chilyatiz Zahroh1, Asmaul Faujiyah1, Ima Nadatien1, Yasi Anggasari1, Nur Ainiyah1, Siti Nurjanah1
1
Lecturer, Faculty of Nursing and Midwivery, Universitas Nahdlatul Ulama Surabaya, Surabaya, Indonesia
Abstract
The phenomenon that occurs in the community at this time, many elderly gout arthritis as many as 41 of 61
elderly people in Posyandu Wonokromo Surabaya Indonesia who still complain of joint pain suddenly and
stiffness in the joints that causes limited movement. This study aims to describe the behavior (cognitive,
affective, and psychomotor) of patients with gout arthritis in the elderly. The design of this study uses
descriptive research with cross sectional approach. The population in this study were 41 elderly with gout
arthritis. The sample in this study were all elderly patients with gout arthritis, with a large sample of 41
respondents. Sampling with Total Sampling technique. This research instrument used a questionnaire and
data analysis using descriptive statistics. The results showed that of 41 elderly people with gout arthritis
almost half had low cognitive behavior (48.7%), almost half had moderate affective behavior (46%), and
almost half had moderate psychomotor behavior (46%). The conclusion of the research is that the elderly
who suffer from gout arthritis have low cognitive behavior, moderate affective behavior, and moderate
psychomotor behavior. It is expected that all elderly people with gout arthritis, in order to always improve
their ability and continue to shift information about the disease gout arthritis in order to improve health and
change behavior (cognitive, affective, and psychomotor) to be high.
Results
Table 1. Demographic characters of respondents.
Socio-demography Category N %
45-59 4 7.3
Age (years old) 60-74 25 61
75-90 13 31.7
Male 11 26.8
Gender
Female 30 73.2
Basic 36 88
Education level
High 5 12
Ever 15 37
Information about gout arthritis
Never 26 63
Table 2. Behaviours (cognitive, affective, and psychomotor) among patients with gout arthritis in elderly.
Abstract
Background: Open fractures of leg are quite common in Road traffic accidents. The ideal protocol for open
fractures of leg is initial thorough debridement, soft tissue coverage and intramedullary nailing or external
fixator application. External fixator may be later converted to internal fixation with reamed or unreamed
intramedullary nail or left as a definitive treatment.
Methodology: This prospective study was conducted at Rohilkhand Medical College And Hospital from
January 2019 to January 2020 on patients presenting with open tibial fracture. Tubular External Fixator was
used. Total 30 patients were enrolled in this study.
Results: In our study 30 patients were included in which 20 were male and 10 were females with mean
age 32.2 years including children and elderly age group there was no age bar. Mean operative time was 60
minutes. Average time for union was 24 weeks.
Conclusion: External fixation as a primary definitive treatment for open tibial fracture is a cost effective
procedure in developing country with minimal morbidity and mortality.
The study was done at Rohilkhand Medical College Wound swab was taken for culture and sensitivity
And Hospital from January 2019 to before closure.
Inclusion Criteria: The pins were cleaned and dressed with beta dine on
alternate days.
Open fractures of both bones of leg type II, type III
A and B (Gustilo Anderson) Follow Up: Each patient was evaluated clinically
and radiographically at three weeks, six weeks, 3
Exclusion Criteria: months, then after every four week to assess the union
Fractures with bone defects of the fracture.
Thorough wound debridement and wound wash Partial weight bearing was allowed at 6 weeks and
with normal saline was done full weight bearing at around 3 months.
Proximal and Distal pins applied on arterio-medial The external fixator was removed when there is
aspect of tibia union of the fracture. A pop slab was given for two
weeks for the healing of pin tracks.
Anatomical reduction and alignment were done and
connecting rods was applied The patients were assessed for healing of soft
tissues, fracture union, function of knee and ankle.
Open tibial fractures are associated with infection, Pin tract infection 6 8
Abstract
Background and Objectives: Hypotension after spinal anaesthesia remains a common and a serious
complication. Various method have been recommended for the prevention and treatment of this problem.
Preloading has become the cornerstone for prophylaxis of hypotension post spinal anaesthesia. This current
study reassessed the efficacy of this volume preloading and also compared the efficacy between Ringer’s
lactate and Pentastarch 6%.
Method: In this study, 60 patients (ASA I & II) presenting for elective lower abdominal and lower limb
surgeries under spinal anaesthesia were allocated into two groups, group P and group R to receive 5 ml/kg of
6% Pentastarch and 10 ml/kg of Ringer’s lactate preload respectively. After institution of spinal anaesthesia
in a sitting position with 3.8 ml of Bupivacaine 0.5% (heavy) using 23G Quincke spinal needle, patients
were made to assume supine position. The heart rate(HR), systolic blood pressure(SBP) and diastolic blood
pressure(DBP) were monitored intra-operatively every 2 minutes for first 10 minutes and every 5 minutes
for next one hour and every 15 minutes thereafter. Electrocardiogram (ECG) and oxygen saturation(SpO2)
were monitored continuously. The amount of ephedrine, used intra-operatively were noted and compared
among the different groups.
Results: The incidence of hypotension in group R was more than that in group P. There were no significant
difference in HR and the SpO2 between the groups. The difference in mean basal SBP and DBP were
statistically insignificant in both groups. Thereafter, the fall in SBP and DBP was more prominent in group
R at all time intervals with a statistically highly significant difference between the two groups (p value
<0.001). The amount of ephedrine used in group R was more than that used in group P. There were minimal
complications like shivering and vomiting which were statistically non–significant . There were no allergic
reactions to the fluids used.
Conclusion: Volume preloading, still has a substantial role in reducing the incidence and severity of
hypotension in patients operated under spinal anaesthesia. Pentastarch 6% is found to be a better agent for
preloading, as it is safe and effective in preventing spinal-induced hypotension in patients.
Figure 2: Mean heart rate (bpm) over various time intervals in both the group
Figure 2: Mean heart rate over various time intervals in both groups
Mean HR variations during the study reveal no statistically significant difference between the two groups with a
p value > 0.05 during all time intervals.
Figure 3: Mean systolic blood pressure (mm Hg) over various time intervals in both the groups.
Figure 4: Mean diastolic blood pressure (mm Hg)over various time intervals in both the groups.
The mean basal DBP for group P was 84.73mm the two groups as shown in the table.(p value <0.001)
Hg and that in group R was 84.47mm Hg the difference The lowest mean DBP was 67mm Hg at 20 minutes in
being statistically non – significant . Thereafter the fall in group R and in group P was 75.87mm Hg at 25 minutes,
DBP was more prominent in group R at all time intervals corresponding to a fall in DBP of 20.68% in group R and
with a statistically highly significant difference between a fall of 10.45 % in group P.
Figure 5: Mean oxygen saturation (%) over various time intervals in both groups:
The amount of ephedrine used was more in group R as compared to group P. Ephedrine was not at all required
in 21 patients in group P(70%) as compared to 6 patients in group R (20%) the difference being statistically highly
significant with a p value< 0.001. The amount of cumulative ephedrine used in group P was 66mg as against a use
of 228 mg in group R.
Figure 7: Complications:
There were similar incidences of shivering and vomiting between the two groups.
778 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Abstract
Knowledge of the anatomy of liver is a prerequisite for a complete understanding of the mechanics of
diagnostic imaging and minimally invasive surgical approaches. So the aim of the study is to carry out
the morphological feature of right lobe, left lobe, caudate lobe, quadrate lobe and surfaces of liver. This
is retrospective observational study done on 75 human livers irrespective of age and sex in Department of
anatomy, Smt. B.K. Shah Medical Institute and Research Center, Vadodara, Gujarat. The livers were studied
for morphological variationsuch as accessory fissure, accessory mini lobe, Quadrant lobe with tongue like
projection, Pons hepatis connecting left lobe with quadrate lobe, Riedel’s lobe present, Narrow and elngated
left lobe, Absence of quadrant lobe, Absence of fissure for ligamentum teres, Bilobed caudate lobe and
classified according to Netter’s classification.Out of 75 embalmed human liver 23 (30.67%) livers were
normal and 52 (69.33%) livers shown one or more than one morphological variation of liver. Out of 52 liver
found abnormal fissures were in 23 (30.67), pons hepatis in 2 (2.66%), riedel’s lobe in 3 (4%), absence of
quadrant lobe in 1(1.33%) deep renal impression and corset constriction observed in 15 (20%) specimens
of liver, diaphragmatic deep groove were observed in 1 (1.33%) specimen. The presence of knowing extra
lobes and fissure lies in the fact that might help to interpretation during imaging of hepatobilliary system and
may intern lead to surgical implication in operation theater.
Keywords: Liver, Accessory fissures, Accessory lobes, Caudate lobe, Quadrate lobe, Pons hepatis, Riedel’s
lobe, Hepatectomy.
Figure 1 A: Liver showing RL- Right Lobe, LL- Left lobe, QL- Quadrate Lobe, CL- Caudate Lobe, AF-
Accessory Fissure on Right lobe, IVC- Inferior Vena Cava, Figure B: Liver showing RL- Right Lobe, LL-
Left lobe, QL- Quadrate Lobe, CL- Caudate Lobe, AF- Accessory Fissure on Caudate Lobe, Figure C: Liver
showing PH- Pons hepatic connecting left lobe with quadrate lobe, RL- Right Lobe, LL- Left lobe, QL-
Quadrate Lobe, CL- Caudate, Figure D: Liver showing AFLT- Absence of Fissure for Ligamentum Teres,
AQL- Absence of Quadrate Lobe, GB- Gall Bladber, PH- Pons hepatic connecting left lobe with quadrate
lobe, RL- Right Lobe, LL- Left lobe, QL- Quadrate Lobe, CL- Caudate.
782 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure 2 A:Liver showing Riedel’s lobe, AQL- Absence of Quadrate Lobe, RL- Right Lobe, LL- Left lobe,
QL- Quadrate Lobe, CL- Caudate, Figure B:Liver showing LL- Narrow and Elongated Left lobe, QLTP-
Quadrate Lobe with Tongue like Projection, RL- Right Lobe, CL- Caudate, Figure C:Liver showing MAL-
Mini Accessory Lobe, AS- Accessory Lobe, RI- Deep Renal Impression LL- Left lobe, RL- Right Lobe, CL-
Caudate, Figure D: Liver showing, CL- Caudate, PP- Large Papillary Process, CP- Long Cuadate Process,
QL- Quadrate Lobe, LL- Left lobe, RL- Right Lobe.
Figure 3 A:Liver showing AF- Accessory Fissure on Right Lobe, AF*- Accessory Fissure on Quadrate Lobe,
RL- Right Lobe, CL- Caudate, LL- Narrow and Elongated Left lobe, Figure B: Netter’s Type 4 - Liver
showing QLTP- Quadrate Lobe with Tongue like Projection, RL- Right Lobe, CL- Caudate, LL- Narrow
and Elongated Left lobe,Figure C:Netter’s Type 5 - Liver showing CL- Caudate Lobe AS- Accessory
Fissure, LL- Left lobe, QL- Quadrate Lobe, RI- Deep Renal Impression, RL- Right Lobe.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 783
Table 1: Different morphological features of liver.
Congenital anomalies of liver confront are lobes and Chadhari et al4 revealed 14% and 17.5 % of the
does not developed or a segment, lobes may be malform livers had accessory fissures. In the present study, the
or may be tiny. These anomalies may occur due to accessory fissures were also present in 30.67% of livers.
abnormal cell lines in the septum transversum in which
the liver develops3. Most of the times the liver exibits Presence of accessory lobes persented on caudate
malformation due to any chang in the microenviornment lobe, quadrate lobe and left lobe. It was found to be
during organogenesis4 and it need to be research such 5.33% of livers in preent study. The similar finding was
studies have been carried out by many research workers seen by Chaudhari et al4, 3.7 %. And Patil et al fonud
throughout world and in the country bu no such research lower incidence was 2%.
work has been carried out in rural Gujarat. Pons hepatis is connecting left lobe with quadrate
The present study conducted on various lobes lobe. Pons hepatis was seen 2.66% of the liver in the
of liver. Variations in the fissures were studied by present stydy. The similar finding was observed by
many researchers5‑13. A study carryout by Joshi D et Chaudhari et al4 reported in 1.25%. Where in other
al6 reported 30% of accessory fissures in their study. studies found higher incidence as Patil et al reported
Similar another study was conducted by Patil et al14 10%, Joshi et al6 reported 30%.Clinically, metastatic
784 Medico-legal Update, January-March 2021, Vol. 21, No. 1
hepatomas have been found originating from the similar to findings of Nayak et al11 and chaudhari et al
pons hepatis as well as harboring site of peritoneal results. When enlarged papillary process or prominent
disseminated tumor cells. papillary process it is look like body mass of pancrease
in cirrosis of liver. Caudate lobe enlargement commonly
In present study,it was seen absence of fissure for accompanies occlusion of the hepatic veins; along with
ligamentum teres in 2.66%. The similar finding was seen patchy areas of low and high attenuation on CT.
by Nayak et al repoeted 1.81 % and Patil et al observed
4% incidence in liver. Where in other studies found Elongated and narrow left lobe found in 9.33%
higher incidence as Chaudhari et al4 reported 11.2%, incidence in our study which was similar with that of
Muktyaz et al9 seen 9.7%. Chaudhari et al4 observed in 12.5%. Where as it was
found low incidence in Nayak et al11, 1.81%.
The prominent papillary process and long caudate
process were seen in 1.25% specimen in our study,
Abstract
Teeth with necrosis require root canal treatment. Before taking any action, the treatment plan that will be
carried out along with the risks must be explained clearly to the patient and his family, and then must get
informed consent for the treatment plan. The purpose of this study was to the description of informed consent
in patients with root canal treatment at the Melati Dental Clinic in Jakarta. Method: This research uses
descriptive method with research sample using technique total sampling of 50 respondents. The data used
are secondary data taken from the patient’s medical record. Results: Respondents 33 people (66%) provided
complete informed consent and 17 people (34%) did not give complete informed consent. Respondents
doing root canal treatment caused by caries as many as 38 people (76%) and respondent root canal treatment
caused not because of caries as many as 12 people (24%). Respondents provided complete informed consent
in patients with root canal treatment because of caries by 27 people (71%) and giving complete informed
consent not because of caries by 6 people (50%). Whereas giving informed consent was incomplete because
of caries as many as 11 people (29%) and incomplete informed consent was not due to caries as many as 6
people (50%). Conclusion: Management of Informed Consent in Root Canal Treatment patients at Melati
Dental Clinic in Jakarta has been carried out well.
Abstract
Background: Mishaps are one of the fifth driving reasons for death in industrialized and creating nations.
Wounds emerging from mishaps are an expanding general medical issue. Mishaps are a noteworthy reason
for dreariness and mortality in kids.
Objectives: The present study was undertaken to find out the knowledge level of women regarding domestic
accidents among children.
Method: A descriptive comparative research design was used for the present study. A study sample of 100
care takers of under- five children (50 residing in rural area and 50 residing in urban area) were selected with
help of purposive sampling method. Structured questionnaire was used to assess the knowledge and Likert
scale was used to find out the attitude regarding first aid measures regarding selected domestic accidents
among under five children.
Results: In rural area maximum numbers of care takers had average knowledge regarding domestic accidents
i.e. 74%, 22% had good knowledge and 4% had below average. Where as in urban area maximum numbers
of care takers had average knowledge regarding domestic accidents i.e. 62%, 33% had good knowledge and
8% had below average. In rural area maximum numbers of care takers had undecided attitude regarding
domestic accidents i.e. 64%, 36% had strongly disagree attitude and 0% had strongly agree attitude regarding
statements. Where as in urban area maximum numbers of care takers had undecided attitude regarding
domestic accidents i.e. 78%, 20% had strongly disagree attitude and 2% had strongly agree attitude regarding
statements.
Conclusion: The study findings concluded that majority of care takers have average knowledge and undecided
attitude towards domestic accidents of under five children. So, the researcher provides the information
booklet to enhance and improve knowledge and attitude of care takers towards domestic accidents.
Abstract
Background: Orbitofacial anthropometric measurements can be used in identification of gender and ethnicity
in forensic anthropology. It also plays a crucial role used in plastic surgery and for identifying genetic
syndromes. Canthus is the term employed to explain the either corner of the eyes. Inner canthus is also
called as medial or nasal canthus. Outer canthus, is otherwise called as lateral or temporal canthus. Normal
canthal values can function as a guide for the diagnosis of pathology and interventions for craniofacial
abnormalities. Thus, it is necessary to have a knowledge about the local data of those parameters since
this standard reflects the doubtless different pattern of craniofacial growth resulting from racial, ethnic,
sexual and dietary differences. Hence this study is undertaken to find out the normative inner canthal and
outercanthal distance measurement in population of South Indian region.
Aims and Objectives: The present study was done to find out the normal inner and outercanthal distance
and also canthal index of population of South Indian ethnic origin and also to analyse the sexual dimorphism
in them.
Materials and Method: This descriptive cross-sectional study was conducted on 200 volunteers of age
group 18-25 years of both sexes belonging to South Indian region. Innercanthal distance(ICD) and Outer
canthal distance(OCD) were measured using digital vernier caliper.Canthal index was calculated. All the
data were analysed using SPSS 16.0 version software and correlated with gender.
Results: Mean innercanthal distance was found to be 2.64 ±0.51 cm in males and 2.51 ±0.46 cm in females
respectively in the present study. There is significant sexual dimorphism in ICD . The study also showed
outercanthal distance to be 10.35± 0.81cm in males and 10.19 ±1.02 cm in females respectively. Canthal
index was 25.71 ±4.91 in males and 24.83±7.83 in females. There is no significant sexual dimorphism in
OCD and Canthal index.
Conclusion: It was observed that all the values were significantly higher in males than females of south
Indian ethnic origin. And there is a significant sexual dimorphism in inner intercanthal distance.
Table II: Gender with variables Mean±sd comparison using independent sample t test
Male Female
Variable t p value
N(%) Mean±SD N(%) Mean±SD
ICD 90(45%) 2.64±0.51 110(55%) 2.51±0.46 2.689 0.008
OCD 90(45%) 10.35±0.81 110(55%) 10.19±1.02 1.195 0.234
CANTHAL Index 90(45%) 25.71±4.91 110(55%) 24.83±7.83 0.935 0.351
Table II shows the mean value of ICD, OCD and values are higher in males than females. And there is a
CANTHAL INDEX among males and females. All significant sexual dimorphism in ICD.
796 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table III: Mean values of ICD,OCD And Canthal index of various regions of South India
The ANOVA test had shown that the ICD and OCD Vasanthakumar et al did their study in Malaysian
significantly varied between regions with (p value -0.006 South Indian ethnic adults and found that the
for ICD and 0.039 for OCD) (Table IV). outercanthal distance was 97.15 mm in males and 91.78
mm in females which was lower than present study. And
Table IV: Showing values for ICD,OCD AND they also noted intercanthal distance and canthal index
Canthal index between states to be 34.1 mm and 35.22 in males; and 32.77 mm and
35.86 in females respectively. These values are very
Variable F P value
high compared to the values of present study. They have
ICD 4.336 0.006
observed sexual dimorphism in all parameters whereas in
OCD 2.845 0.039 the present study there is significant sexual dimorphism
Canthal Index 0.760 0.518 in intercanthal distance only[14].
Abstract
Introduction: Tuberculosis (TB) of the breast is a rare manifestation of extra-pulmonary localization of the
disease. The incidences vary from a minimum in developed countries to a high in developing countries like
India and Africa.
Materials and Method: This study was a hospital-based observational study carried out in 75 cases of
benign breast disease which were studied with special reference to Tuberculosis of the breast. All patients
who were clinically diagnosed as a benign breast lump, above the age of 14-years and among them who were
willing to undergo investigations and treatment were included. Ziehl-Neelsen staining was performed in all
fine needle aspirates and finally, treatment modality used.
Results: The present study involved 67 cases of benign breast lumps and 8 cases of recurrent breast abscesses.
Further, it depicts predominant benign breast lumps which were fibroadenoma in 65.7% fibroadenosis in
23.80%, TB breast in 4.50%, ductal papilloma in 2.90% and phyllodes tumour of the breast in 1.5% of cases.
Conclusion: For the TB of the breast in India, various treatment modalities are available. With timely
diagnosis, the morbidity can be minimised with less amount of suffering.
Keywords: Breast diseases; Ziehl-Neelsen staining, fine needle aspiration cytology (FNAC).
70%
60%
50%
40%
30% 25%
20%
10%
0%
Painful lump Abscess
Table 2: Significance of Ziehl-Neelsen staining in while one presented as an abscess. All of them stained
tubercular mastitis negative for Ziehl-Neelsen, however, lumps were
histopathologically diagnosed as tuberculosis of the
Ziehl-Neelsen staining No. of Cases Percentage breast. While abscess was empirically started on ATT
Positive 0 0% due to recurrent history. One case of fibroadenoma also
Negative 4 100% stained positive for Ziehl-Neelsen, however, it was
histopathologically diagnosed postoperatively to be
Table 2 depicts Four cases of tubercular mastitis fibroadenoma and was a false positive.
were diagnosed, three of them presented as lumps
Figure 2 Bar diagram showing the significance of Ziehl-Neelsen staining in the diagnosis of tuberculosis of
the breast
Medico-legal Update, January-March 2021, Vol. 21, No. 1 801
Figure 2 describes Tuberculous mastitis (TM) Tuberculous mastitis (TM) occurs far more
occurs far more frequently in women, especially in their frequently in women, especially in their reproductive
reproductive age, and is uncommon in prepubescent and age, and is uncommon in prepubescent and elderly
elderly women. women.13 This parallels the highest incidence of
pulmonary tuberculosis. This could be because the
Treatment Modalities: female breast undergoes frequent changes during the
Tuberculosis of the Breast: In this study 4 cases period of childbearing activity and is more susceptible
of tuberculosis of breast were diagnosed. 3 of them to trauma and infection.14
presented as lumps and one as an abscess. Lumps Treatment Modalities:
were excised due to initial diagnostic uncertainty and
abscess was drained by open drainage. Pus was sent Tuberculosis of the Breast: Our treatment protocol
for both Ziehl-Neelsen staining and AFB culture. was similar to that followed by Mallika Tewari and
Although Ziehl-Neelsen came out to be negative, AFB HS Shukla.12 However the protocol followed by Prem
culture identified Mycobacterium Tuberculosis. All Prakash et al.,11 was of 6 months ATT and observed
were given 9 months of antitubercular therapy with 2 good response rate in 96% of the cases. In our study,
months of intensive therapy with ethambutol (E) 1200 there were only 2 cases of ductal papilloma and single
mg; rifampicin (R) 450 mg, isoniazid (H) 600 mg and case each of phyllodes tumour and ductal papilloma.
pyrazinamide (Z) 1500 mg., followed by 7 months of Simple mastectomy was performed for the phyllodes
ethambutol and isoniazid. Improvement was observed tumour and microdiscectomy for ductal papilloma and
during our period of study, however, long term follows duct ectasia. Wide excision is usually sufficient for
up was not possible. phyllodes tumour however in this case size was large
enough to make wide excision improbable. Techniques
Discussion we followed were similar to the technique followed by
The relative incidence of various benign breast Akshara et al.,15 and Naveen et al.,16 in their studies on
lumps in were found to be concurrent with other reported benign breast disease for these lesions.
series of Sangma et al.,6 Seema et al.,7 Amruthavalli et In the era of minimally invasive surgery,
al.,8 Jagtap et al.,9 and Abhijit MG et al.10 percutaneous drainage has proven a safe and effective
Significance of Ziehl-Neelsen staining in alternative to incision and drainage in acute abscesses,
tuberculosis of breast: Four cases of tubercular while chronic and recurrent abscesses are best treated
mastitis were diagnosed, three of them presented with the classical means of drainage. The method
as lumps while one presented as an abscess. All the of percutaneous aspiration combined with irrigation
lumps stained negative for Ziehl-Neelsen; however, and installation of antibiotics has proved effective in
it was histopathologically diagnosed as tubercular 96% of cases reported in one series.17 In this current
mastitis. Abscess aspirate also stained negative for study, only patients with recurrent breast abscess were
Ziehl-Neelsen. Positivity of Ziehl-Neelsen staining was included. Hence, we performed emergency incision and
found to be statistically insignificant. This finding was drainage and pus was sent for culture and sensitivity.
consistent with the study by Gupta PP et al.11 On all 7 Our management method was similar to that followed
patients of tuberculosis of breast in which the positive by different studies on benign breast diseases.18,19
Ziehl-Neelsen stain was only in 38%, and was found to
be statistically insignificant for the diagnosis.
Conclusion
Benign breast diseases are essential to differentiate
Presentation of tuberculosis of breast: Among from malignant ones and also between one another. An
four patients diagnosed with tuberculosis of breast, appropriate diagnosis is key to have a proper outcome.
3 (75%) of them presented with a lump and 1 (25%)
presented as an abscess. Finding was consistent with the Conflict of Interest: None declared.
study by Mallika Tewari and HS Shukla12 on 30 patients
with Tuberculosis of the breast in which 73% presented Ethical Clearance: Taken.
with lump and 27% with abscess. Source of Funding: None declared
802 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Author Disclosure: The article is original with the 8. BV Amruthavalli, V Srihari. Clinical study of
author(s) and does not infringe any copyright or violate benign breast diseases. IOSR Journal of Dental
any other right of any third party. The article has not and Medical Sciences (IOSR-JDMS) 2015
been published (whole or in part) elsewhere and is not Nov;14(11):34-40.
being considered for publication elsewhere in any form, 9. Jagtap SV, Nihalani RR, Boral S.
except as provided herein. The first author has conceived Clinicocytopathological study of breast lump in the
the study design and helped in the collection of data non-malignant categories. Asian Pac J Health Sci
along with author second. The third and fourth author 2018;5(1):107-110.
has helped in interpreting the data thus collected and
10. Abhijit MG, Anantharaman D, Sumanth B, Ranjani
also in writing the manuscript along with the author one
R. Benign breast diseases: experience at a teaching
and second. All author(s) have contributed sufficiently
hospital in rural India. Int J Res Med Sci 2013;1:73-
in the article to take public responsibility for it and
8.
have reviewed the final version of the manuscript and
approved it for publication. 11. Gupta PP, Gupta KB, Yadav RK, Agarwal
D. Tuberculous mastitis: A review of seven
References consecutive cases. Indian J Tub 2003;50:47–50.
12. Tewari M, Shukla HS. Breast tuberculosis:
1. Cooper SA. Illustrations of the diseases of the
Diagnosis, clinical features and management.
breast Part 1. London: Longmans, Rees, Brown
Indian J Med Res 2005;122:103–10.
Orme, Green, and Longman; 1829. p. 7
13. Jalali U, Rasul S, Khan A, Baig N, Khan A, Akhter
2. Luh SP, Chang KJ, Cheng JH, Hsu JD, Huang
R. Tuberculous mastitis. J Coll Physicians Surg
CS. Surgical treatment for primary mammary
Pak 2005;15:234–7.
tuberculosis – report of three octogenarian cases and
review of literature. Breast Journal 2008;14:311– 14. Raw N. Tuberculosis of the breast. Br Med J
312. 1924;J:657–8.
3. Maroulis I, Spyropoulos C, Zolota V, 15. Gupta A, Gupta AK, Goyal R, Sharma K. A study of
Tzorakoleftherakis E. Mammary tuberculosis clinical profile of benign breast diseases presenting
mimicking breast cancer: a case report. Journal of at a tertiary care centre in central India. Scholar J
Medicine Case Reports 2008;2:34. Appl Med Sci 2015;3(2C):695-700.
4. Mirsaeidi SM, Masjedi MR, Mansouri SD, Velayati 16. Gupta A, Gupta AK, Goyal R, Sharma K. A study of
AA. Tuberculosis of the breast: report of 4 clinical clinical profile of benign breast diseases presenting
cases and literature review. East Mediterranean at a tertiary care centre in central India. Scholar J
Health Journal 2007;13:670–676. Appl Med Sci 2015;3(2C):695-700.
5. Sriram KB, Moffatt D, Stapledon R. Tuberculosis 17. Naveen N, Avijeet M and Vikrant M.A clinical
infection of the breast mistaken for granulomatous study of benign breast disease in rural population.
mastitis: a case report. Cases J 2008 Oct 25;1:273. Journal of Evolution of Medical and Dental
Sciences 2013;12:5499-511.
6. Sangma MB Maychet, Panda Kishori, Dasiah
Simon. (2013). A clinico-pathological study on 18. Leborgne F. Treatment of breast abscesses with
benign breast diseases. J clin Diagn Res 2013 sonographically guided aspiration, irrigation, and
Mar;7(3):503-506. instillation of antibiotics. AJR 2003;181(4):1089–
91.
7. Seema Nagger, Irbinder Kour Bali, Prachi Arun,
Vinay Kumar, Kalpana Goyal, Parveen Shah, et 19. Abdel Hadi, Maha Bukhari, Huda. Breast infections
al. Clinico-pathological study on benign breast in non-lactating women. Journal of family &
diseases in Gurugram NCR. IOSR Journal of community medicine 2005;12:133-7.
Dental and Medical Sciences (IOSR-JDMS) 2018
April;17(4):59-62.
DOI Number: 10.37506/mlu.v21i1.2415 Medico-legal Update, January-March 2021, Vol. 21, No. 1 803
Rajeshwari Vittal1, Juliet Roshini Mohan Raj2, Ballamoole Krishna Kumar3, Indrani Karunasagar4
1
Senior Lecturer, Nitte University Centre for Science Education and Research, Deralakatte, Mangaluru,
India-575018, 2Assistant Professor, Division of Infectious Diseases, 3Assistant Professor, Division of Infectious
Disease, 4Director, Nitte University Centre for Science Education and Research, Mangaluru, India-575 018
Abstract
Background: Legionella have emerged as a pathogenic group due to increased use and poor maintenance
of artificial water environments. World Health Organization considers Legionella associated diseases to
be underestimated, especially in developing countries due to difficulty in detection. The aim of this study
was isolation and culture of Legionella spp. from artificial water systems and to test the importance of iron
concentration which can be developed as a reliable chemical marker.
Method: Thirty samples each were collected from drinking water coolers, cooling towers and shower heads
fitted in different houses of Mangaluru city. Isolation and identification of the bacteria were carried out as per
the standard protocols followed by determination of iron content prescribed by IS 3025 (Part 53).
Conclusion: Our study shows that concentrations of iron, is an important factor that increases the likelihood
of Legionella spp. Statistically, a concentration of 300 mg Fe/L shows a positive correlation with Legionella
presence. Therefore, monitoring suspect sites for iron concentration and chelation of available iron, can
be developed as respective assays for identifying Legionella spp. Furthermore, we show that PCR based
detection of Legionella is a more robust method than the classical 3-plate method, especially for virulent
strains.
Keywords: Cooling tower, iron content. Legionella, Legionnaires disease, potable water, water distribution
systems.
Figure 1: Representative Legionella spp. cultures, showing typical round pearl-white colonies on
(a) GVPC and (b) BCYE agar plates.
Figure 2. Representative agarose gel electrophoresis of one of the cooling tower samples. Lane 1: DNA
ladder, lane 2: negative control, lane 3: JFP gene with expected size of 386 bp, lane 4: dot A step 1 product
with expected size of 440 bp, lane 5: dot F step 2 product with expected size of 387 bp.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 807
Table 1: Summary of Legionella positive cultures based on 3-plate method.
Deleted
810 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 811
812 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 813
814 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Medico-legal Update, January-March 2021, Vol. 21, No. 1 815
816 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2417
Abstract
A medical record plays a major role for the patient and health care sector in terms of treatment and making
policies on certain diseases. In any suit of negligence, this medical record will help the doctors to defend
them. Many a times the complete and accurate documentation only have helped the medical fraternities
from getting entangled in various consumer cases made by the patient against the doctors. Even though we
have seen so many negligence cases on doctors, documentations are still incomplete in any medical record.
There are studies shown that the average time spent by a doctor on a medical record is very less and the
scenario is much worse when it comes to critical areas of the hospitals like casualty where the time is very
precious in treating the patient and not much of importance is given for documentation. So to identify the
current practice of documentation of medical records, this study was carried out to assess the documentation
practice of the admission case sheets in the casualty of SMVMCH, Puducherry. An intervention was done
to improve the completeness of documentation in the casualty and post-intervention analysis was also done.
The results of the study showed that the percentage of documentation out of the 34 variables documented in
the admission case sheets found to have significant deficiencies. But following the intervention on improving
the documentation there has be a significant decrease of the deficiencies in the documentation practice on
all those 34 variables.
Table no 2 shows the details of documentation of “History variables” in the admission case sheets during the
pre- and post- intervention period and its comparison analysis. Except the variables like referred by and past history,
rest all variable showed a significant increase in the practice of documentation in the post-intervention period.
Table No 2: Comparison of pre and post interventional documentation of history related variables
On comparison between the documentation practice of “Physical examination and Vitals variables”it was
observed from the study that variables like BP, Pulse rate and General examination were documented properly even
during the pre- intervention period itself.(Table No 3).
Table No 3: Comparison of pre and post interventional documentation of Physical examination and Vitals
variables
In this study, it was observed that doctors were proper in documenting the important variables like CVS, RS,
CNS and Abdomen examination under the category of “Systemic examination variables”. (Table No 4).
Medico-legal Update, January-March 2021, Vol. 21, No. 1 819
Table No 4: Comparison of pre and post interventional systemic examination related variables
The study has shown that doctors have documented category of “Diagnosis related variables”but during
variables like Investigation and Provisional diagnosis pre-intervention period documentation of Plan of
without any fail in the admission case sheets during management wasn’t done properly but later on after the
the pre- and post- intervention period under the intervention it was done properly. (Table No 5).
In this study even though the doctors were found to period, later on after the intervention, significant
be only proper in documenting their signature apart from improvement was observed in all the other variables as
other variables under the category of“Documentation the doctors understood the importance of documenting
of doctor related variables”during the pre-intervention these variables properly. (Table No 6).
Ratna Dwi Wulandari1, Agung Dwi Laksono2, Astridya Paramita3, Pramita Andarwati3, Naillul Izza3
1
Lecturer, Faculty of Public Health, Universitas Airlangga Surabaya, Indonesia, 2Researcher, National Institute
of Health Research and Development, The Ministry of Health, The Republic of Indonesia, Jakarta, Indonesia,
3Researcher, Functional Unit of Health Technology Innovation, The Republic of Indonesia, Jakarta, Indonesia.
Abstract
Female worker mothers have a greater risk of neonatal death during childbirth. The study aimed to analyze
the risk factors for neonatal death among female worker mothers in Indonesia. The study used data of the
2017 Indonesia Demographic and Health Survey. With stratification and multistage random sampling, 18,061
female worker mothers aged 15-49 years old with live births in the last 5 years were sampled. The final
analyzed using a binary logistic regression test. The results of the study found that female worker mothers
with the wealth status of the poorer category had 0.738 times the probability of experiencing neonatal
death compared to the poorest. Female worker mothers with wealth status in the middle category have a
probability of 0.702 times compared to the poorest to experience neonatal death. Meanwhile, the richest
female worker mothers had a probability of 0.662 times compared to the poorest to experience neonatal
death. Meanwhile, female worker mothers who made ANC visits ≥4 times had a probability of 0.331 times
compared to female worker mothers who made ANC visits <4 times. It could be concluded that there were
2 factors which are the risk factors for neonatal death among female worker mothers in Indonesia, namely
poverty and ANC visits <4 times.
Introduction life, per 1,000 live births in a given year. Based on the
age group of infants, neonatal mortality is categorized
The third goal of the Sustainable Development
into two, namely early neonatal mortality and late
Goals, which was formulated and agreed upon to be
neonatal death. Early neonatal mortality is the death of
achieved by all countries without exception, is to ensure
a live-born baby within the first week of life or 7 days
a healthy life and support the welfare of all for all ages.
after birth, which is also called perinatal death (infants
One of the targets set to achieve this goal is to reduce the
aged 0-7 days). Late neonatal mortality is the death of
neonatal mortality rate to at least less than 12 per 1,000
a live-born baby at the age of more than 7 days to 28
births by 20301.
days, that is, the second to the fourth week of life. In
Neonatal mortality is death that occurs before the general, neonatal mortality is caused by endogenous
baby is 28 days old. Neonatal Mortality Rate is the factors, namely factors that the child carries from birth,
number of live births that died within the first 28 days of which is obtained from the parents at conception or
during pregnancy, as well as conditions during and after
delivery such as the occurrence of nosocomial infections
from the ward or due to bleeding diseases in newborn
Corresponding Author:
baby2.
Ratna Dwi Wulandari
Faculty of Public Health, Universitas Airlangga Global data in 2018 shows that 2.5 million children
Surabaya, Indonesia, Campus C Mulyosari Surabaya, die in their first month of life, of which around 7000
Indonesia newborn deaths occur every day with about one-third
e-mail: [email protected] dying on the day of birth and nearly three-quarters
Medico-legal Update, January-March 2021, Vol. 21, No. 1 823
of them dying within the first week of life. Neonatal last birthday. The education level is the last educational
mortality decreases more slowly than mortality in certificate the respondent has.
children 1-59 months of age3. Meanwhile, Indonesia
recorded a fairly high neonatal mortality rate. Analysis Wealth status was a wealth of respondents compiled
of the Indonesian Demographic and Health Survey based on the index of goods ownership quintile stated
in 2017 reports that the Neonatal Mortality Rate in by the respondent. The five categories were the poorest
Indonesia reaches 15 neonates per 1000 live births. This (quintile 1), poorer (quintile 2), middle (quintile 3),
achievement is higher than the achievement recorded by richer (quintile 4), and richest (quintile 5). Parity is the
countries in the region4. number of living children a woman has ever born. In this
study, parity was divided into two, namely primiparous
Female workers are suspected of having a greater (<2 children), and multiparous (≥2 children).
risk of experiencing neonatal death because of their dual
duties to support daily family needs and pregnancy care. Complications during pregnancy were the
A previous study informed that female workers had a respondent’s acknowledgment of complications
1.52 times greater risk of experiencing neonatal death experienced during pregnancy until delivery. These
than non-female workers5.Meanwhile, another study problems consist of: prolonged labor, vaginal bleeding,
informed that women who do not work are more likely fever, convulsions, baby in the wrong position, swollen
to experience neonatal pulse 0.576 times compared to limbs, faint, breathlessness, tiredness, and others4.
female workers6. Based on the background description, Childbirth assistance was divided into two categories,
the study was aimed at analyzing the risk factors namely non-health workers and health workers.
for neonatal death among female worker mothers in Meanwhile, the place of delivery consists of non-
Indonesia. healthcare facilities and healthcare facilities.
Neonatal Death
Variables No Yes P
n % n %
Place of Residence 0.056
Urban 8211 46.6% 178 41.9%
Rural(ref.) 9425 53.4% 247 58.1%
824 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Neonatal Death
Variables No Yes P
n % n %
Age groups 0.686
15-19 yo. 93 0.5% 2 0.5%
20-24 yo. 1001 5.7% 20 4.7%
25-29 yo 2939 16.7% 67 15.8%
30-34 yo. 4716 26.7% 108 25.4%
35-39 yo. 5030 28.5% 119 28.0%
40-44 yo. 3037 17.2% 86 20.2%
45-49 yo. (ref.) 820 4.6% 23 5.4%
Education level ***<0.001
No education (ref.) 556 3.2% 21 4.9%
Primary 5199 29.5% 156 36.7%
Secondary 8125 46.1% 184 43.3%
Higher 3756 21.3% 64 15.1%
Wealth status ***<0.001
Poorest (ref.) 5358 30.4% 177 41.6%
Poorer 3045 17.3% 67 15.8%
Middle 2937 16.7% 59 13.9%
Richer 2987 16.9% 65 15.3%
Richest 3309 18.8% 57 13.4%
Parity ***<0.001
Primiparous 2088 11.8% 20 4.7%
Multiparous (ref.) 15548 88.2% 405 95.3%
ANC ***<0.001
< 4 times (ref.) 11214 63.6% 358 84.2%
≥ 4 times 6422 36.4% 67 15.8%
Complication during pregnancy 0.078
No 5744 82.0% 65 74.7%
Yes (ref.) 1259 18.0% 22 25.3%
Childbirth assistance ***<0.001
Non-health worker (ref.) 10305 58.4% 318 74.8%
Health worker 7331 41.6% 107 25.2%
Place of delivery ***<0.001
Non-Healthcare (ref.) 11532 65.4% 339 79.8%
Healthcare 6104 34.6% 86 20.2%
Table 1 shows that the two categories of neonatal Meanwhile, based on complications during pregnancy,
death are also dominated by multiparous female worker the two categories of neonatal death were dominated
mothers, and have incomplete ANC visits (<4 times). by female worker mothers who did not experience
Medico-legal Update, January-March 2021, Vol. 21, No. 1 825
complications during pregnancy. The two categories included in the final stage of determining risk factors
of neonatal death are also dominated by female worker for neonatal death among female worker mothers in
mothers who are accompanied by health workers during Indonesia. The results of the analysis found that 2
childbirth, and who do childbirth in non-healthcare. variables were proven as risk factors for neonatal death
among female worker mothers in Indonesia.
Table 2 provides the results of the multivariate test
with binary logistic regression. There are 6 variables
Table 2. The result of binary logistic regression of the risk factors for neonatal death among female worker
mothers in Indonesia (n=18,061)
First, female worker mothers with the wealth status Information on the results of this analysis indicates
of the poorer category had 0.738 times the probability that poverty is one of the risk factors for neonatal death
of experiencing neonatal death compared to the poorest among female worker mothers in Indonesia. The same
(OR 0.738; 95% CI 0.550-0.991). Female worker findings of information were also found in the previous
mothers with wealth status in the middle category had studies7,8. The results of the analysis informed that the
a probability of 0.702 times compared to the poorest to richest group also had a risk of neonatal death, although
experience neonatal death (OR 0.702; 95% CI 0.514- the number was less than the other groups. This finding
0.960). Meanwhile, the richest female worker mothers contradicts most studies which reveal that the low
had a probability of 0.662 times compared to the poorest economic status (poorest, poorer, middle) is more at risk
to experience neonatal death (OR 0.662; 95% CI 0.468- of neonatal mortality9–11. This information suggests that
0.937). the economic status of the family, at any level, is likely
to increase the risk of neonatal mortality. So that a more
826 Medico-legal Update, January-March 2021, Vol. 21, No. 1
comprehensive program approach is needed to reduce sector, it is necessary to think about providing a social
neonatal mortality. safety net in the form of maternal cash benefits that
can be implemented together with the National Health
The reason female workers leave their children to Insurance. This policy is needed to reduce neonatal
return to work early after childbirth is the demand to death in Indonesia.
make a living for their families12,13. This condition also
explains a large number of neonatal mortality rates in Acknowledgments: The author would like to thank
the group of working mothers with the poorest, poorer, the ICF International, who has agreed to allow the 2017
and poor economic status. The pressure to make a living IDHS data to be analyzed in this article.
is greater in this group. The provision of paid leave for
working mothers is one of the initiatives in the neonatal Source of Funding: Self-funding
mortality reduction program recommended by WHO Conflict of Interests: Nil
and ILO. Output in the form of maternal and neonatal
health levels was found to be better for working mothers Ethical Clearance: The 2017 IDHS has passed
who received paid maternity leave for longer14,15. ethical tests from the National Institute for Health
Research and Development of the Indonesian Ministry
Second, female worker mothers who performed of Health. The use of the 2017 IDHS data for this study
ANC completely (≥4 times) were 0.331 times more has received permission from ICF International through
likely than female worker mothers who performed its website: https://dhsprogram.com/data/new-user-
ANC incompletely (OR 0.331; 95% CI 0.229-0.480). registration.cfm.
The results of this analysis inform that doing ANC
incompletely, or <4 times, is one of the risk factors References
for neonatal death among female worker mothers in
Indonesia. 1. SDG Indonesia 2030. Goal 03 SDGs (Tujuan 03
SDGs) [Internet]. 2020 [cited 2020 Aug 25]. p. 3.
The findings of this analysis are in line with the Available from: https://www.sdg2030indonesia.
recommendation of the Indonesian government which org/page/11-tujuan-tiga
states that the ANC during pregnancy is done at least 4 2. UNICEF. Neonatal mortality. 2019.
times, namely in the first trimester 1 time, in the second
3. World Health Organization. Newborns: reducing
trimester 1 time, and in the third trimester 2 times16. This
mortality [Internet]. 2019 [cited 2020 Aug 25].
information also confirms the results of previous studies
p. 1. Available from: https://www.who.int/en/
in several countries that ANC is a positive determinant
news-room/fact-sheets/detail/newborns-reducing-
for preventing neonatal death17–20. Meanwhile, a study
mortality
in Afghanistan informed that ANC by skilled providers
reduced the risk of neonatal death to 0.7 times compared 4. National Population and Family Planning Board,
to non-skilled providers21. Statistics Indonesia, Ministry of Health, The DHS
Program. Indonesia Demographic and Health
Conclusions Survey 2017 [Internet]. Jakarta; 2018. Available
from: https://www.dhsprogram.com/pubs/pdf/
Based on the research results, it could be concluded FR342/FR342.pdf
that 2 factors are the risk factors for neonatal death
5. Faisal A. Factors Associated with Infant Mortality
among female worker mothers in Indonesia. These two
in Indonesia 2003-2007 (Faktor-Faktor Yang
factors were poverty and incomplete ANC.
Berhubungan dengan Kematian Bayi di Indonesia
It is recommended that the government issue a Tahun 2003-2007). Universitas Indonesia Jakarta,
policy that can encourage companies that employ female Indonesia; 2010.
worker mothers to facilitate the ANC process when 6. Wulandari RD, Laksono AD. Is parity a predictor of
they are pregnant, especially for poor female worker neonatal death in Indonesia? Analysis of the 2017
mothers. Working mothers in the formal sector need Indonesia demographic and health survey. Indian J
to be paid maternal leave for at least 12 weeks after Forensic Med Toxicol. 2020;14(3):2161–6.
giving birth to provide opportunities for mothers to care 7. Vijay J, Kumar Patel K. Risk factors of infant
for their babies. For mothers working in the informal mortality in Bangladesh. Clin Epidemiol Glob
Medico-legal Update, January-March 2021, Vol. 21, No. 1 827
Heal. 2020;8(1):211–4. 15. Aitken Z, Garrett CC, Hewitt B, Keogh L, Hocking
8. Morakinyo OM, Fagbamigbe AF. Neonatal, JS, Kavanagh AM. The maternal health outcomes
infant and under-five mortalities in Nigeria: An of paid maternity leave: A systematic review. Soc
examination of trends and drivers (2003-2013). Sci Med. 2015;130:32–41.
PLoS One. 2018;12(8):Article number e0182990. 16. Laksono AD, Rukmini R, Wulandari RD. Regional
9. Afshan K, Narjis G, Qureshi IZ, Cappello M. disparities in antenatal care utilization in Indonesia.
Social determinants and causes of child mortality PLoS One. 2020;15(2):e0224006.
in Pakistan: Analysis of national demographic 17. Laksono AD, Wulandari RD. Understanding
health surveys from 1990 to 2013. J Paediatr Child Neonatal Death in Urban Area in Indonesia.
Health. 2020;56(3):457–72. Medico-Legal Updat. 2020;20(2):825–9.
10. Lu SSM, Stewart Williams J, Sommar JN. 18. Wulandari RD, Laksono AD. Antenatal Care as
Inequalities in early childhood mortality in Myanmar Predictor of Neonatal Death in Rural Indonesia.
- Association between parents’ socioeconomic Int Med J [Internet]. 2020;25(2):511–8. Available
status and early childhood mortality. Glob Health from: https://www.seronijihou.com/article/
Action. 2019;12(1):Article number 1603516. antenatal-care-as-predictor-of-neonatal-death-in-
11. Khajavi A, Pishgar F, Dehghani M, Naderimagham rural-indonesia
S. Socioeconomic inequalities in neonatal and 19. Basha GW, Woya AA, Tekil AK. Determinants of
postneonatal mortality: Evidence from rural Iran, neonatal mortality in Ethiopia: An analysis of the
1998-2013. Int J Equity Health. 2017;16(1):Article 2016 Ethiopia demographic and health survey. Afr
number 83. Health Sci. 2020;20(2):715–23.
12. Baxter J. Is money the main reason mothers 20. Mersha A, Bante A, Shibiru S. Neonatal mortality
return to work after childbearing? J Popul Res. and its determinates in public hospitals of Gamo
2008;25:141–160. and Gofa zones, southern Ethiopia: Prospective
13. Schmidt E-M, Rieder I. All about the money? follow up study. BMC Pediatr. 2019;19(1):Article
Parents’ justification patterns behind their number 499.
parental leave arrangements. SWS - Rundschau. 21. Kibria GMA, Burrowes V, Choudhury A, Sharmeen
2016;56(4):489–508. A, Ghosh S, Mahmud A, et al. Determinants of early
14. Hewitt B, Strazdins L, Martin B. The benefits of neonatal mortality in Afghanistan: An analysis of
paid maternity leave for mothers’ post-partum the Demographic and Health Survey 2015. Global
health and wellbeing: Evidence from an Australian Health. 2018;14(1):Article number 47.
evaluation. Soc Sci Med. 2017;182(97–105).
828 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2419
Ratna Dwi Wulandari1, Agung Dwi Laksono2, Tety Rachmawati2, Rukmini Rukmini2
1
Faculty of Public Health, Universitas Airlangga, Surabaya, Indonesia. Campus C Mulyorejo Surabaya, Indonesia,
2Researcher, National Institute of Health Research and Development, Indonesian Ministry of Health, Jakarta,
Indonesia
Abstract
MMR data in Indonesia fluctuates according to the data source used. Based on Indonesia Demographic
and Health Survey data, MMR in Indonesia in 1990 was 390 per 100,000 live births, in 2004/2007 it was
228/100,000 live births, then increased sharply in 2008-2012 by 359/100,000 live births. Whereas based on
the 2015 SUPA data, MMR in Indonesia decreased by 305 per 100,000 per live birth. This study aims to
analyze the barrier to ≥4 ANC visits during pregnancy. The analysis uses the 2017 Indonesian Demographic
and Health Survey data. Stratification and multistage random sampling method get 15,351 respondents.
Barrier determination was done using Binary Logistic Regression. The barriers consisted of the following
variables: young age, low education, high parity, poverty, not having health insurance, not being able to read,
not being exposed to the media, never using the internet, not knowing the danger signs of pregnancy, and
belief in traditional birth attendants.
Keywords: Antenatal care, healthcare utilization, the barrier of utilization, mother and child health.
ANC
Variables All P
<4 visits ≥4 visits
Place 0.000***
• Urban 627(34.45%) 6941(51.30%) 7568(49.30%)
• Rural(ref.) 1193(65.55%) 6590(48.70%) 7783(50.70%)
Age <0.001***
• 15-19 102(5.60%) 314(2.32%) 416(2.71%)
• 20-24 309(16.98%) 2105(15.56%) 2414(15.73%)
• 25-29 394(21.65%) 3453(25.51%) 3847(25.06%)
• 30-34 408(22.42%) 3555(26.27%) 3963(25.82%)
• 35-39 351(19.29%) 2705(19.99%) 3056(19.91%)
• 40-44 201(11.04%) 1156(8.54%) 1357(8.84%)
• 45-49 (ref.) 55(3.02%) 243(1.80%) 298(1.94%)
Marital <0.001***
• Single/Never in union (ref.) 8(0.44%) 20(0.15%) 28(0.18%)
• Married/Living with partner 1702(93.52%) 13141(97.12%) 14843(96.69%)
• Widowed/Divorced 110(6.04%) 370(2.73%) 480(3.13%)
Education <0.001***
• No education(ref.) 88(4.84%) 116(0.86%) 204(1.33%)
• Primary 695(38.19%) 3164(23.38%) 3859(25.14%)
830 Medico-legal Update, January-March 2021, Vol. 21, No. 1
ANC
Variables All P
<4 visits ≥4 visits
• Secondary 857(47.09%) 7771(57.43%) 8628(56.20%)
• Higher 180(9.89%) 2480(18.33%) 2660(17.33%)
Parity <0.001***
• <2 459(25.22%) 4296(31.75%) 4755(30.98%)
• 2-4 1013(55.66%) 8394(62.04%) 9407(61.28%)
• >4 (ref.) 348(19.12%) 841(6.22%) 1189(7.75%)
Wealth status <0.001***
• Poorest (ref.) 913(50.16%) 3160(23.35%) 4073(26.53%)
• Poorer 368(20.22%) 2663(19.68%) 3031(19.74%)
• Midle 260(14.29%) 2630(19.44%) 2890(18.83%)
• Richer 171(9.40%) 2589(19.13%) 2760(17.98%)
• Richest 108(5.93%) 2489(18.39%) 2597916.92%)
Health insurance <0.001***
• No(ref.) 851(46.76%) 4988(36.86%) 5839(38.04%)
• Yes 969(53.24%) 8543(63.14%) 9512(61.96%)
Table 1 informs that women who make ANC visits Table 2 shows that women who were able to read
during pregnancy are dominated by women who are whole sentences were exposed to the media less than
married or living with partners. The education level once a week, and had never used the internet were
category is dominated by secondary education women. more dominant in both ANC frequency categories.
Table 1 shows that women who made ANC visits during While in the “know the danger sign of pregnancy”
pregnancy were dominated by women who had parity category, the group of women who made ≥4 ANC visits
2-4 and were very poor. Dominance is also shown by during pregnancy was dominated by those who knew.
women who are covered by health insurance. While the group of women who made ≥4 ANC visits
during pregnancy was dominated by those who did not
Table 2 is a statistical description of the characteristics know. Table 2 informs us that in both categories ANC
of knowledge and information exposure of respondents frequencies were dominated by women who did not
aged 15-49 years old who gave birth in the last five years believe in traditional birth attendants.
in Indonesia. Table 2 informs that there are significant
differences between women who make <4 ANC visits
compared with women who make ≥4 ANC visits during
pregnancy in all categories.
ANC
Variables All P
<4 visits ≥4 visits
Literacy <0.001***
• Cannot read at all (ref.) 180(9.89%) 324(2.39%) 504(3.28%)
• Able to read only part of sentences 96(5.27%) 251(1.85%) 347(2.26%)
• Able to read whole sentence 1540(84.62%) 12939(95.62%) 14479(94.32%)
• Blind/visually impaired 4(0.22%) 17(0.13%) 21(0.14%)
Medico-legal Update, January-March 2021, Vol. 21, No. 1 831
ANC
Variables All P
<4 visits ≥4 visits
Media exposure <0.001***
• No (ref.) 185(10.16%) 414(3.06%) 599(3.90%)
• Yes 1635(89.84%) 13117(96.94%) 14752(96.10%)
Frequency of media <0.001***
• Less than once a week (ref.) 1394(76.59%) 9109(67.32%) 10503(68.42%)
• At least one a week 426(23.41%) 4422(32.68%) 4848(31.58%)
Use of internet <0.001***
• Never (ref.) 1349(74.12%) 7029(51.95%0 8378(54.58%)
• Yes, last 12 months 428(23.52%) 6221(45.98%) 6649(43.31%)
• Yes, before last 12 month 43(2.36%) 281(2.08%) 324(2.11%)
Know the danger sign of pregnancy <0.001***
• No (ref.) 1061(58.30%) 4406(32.56%) 5467(35.61%)
• Yes 759(41.70%) 9125(67.44%) 9884(64.39%)
Belief in traditional birth attendant <0.001***
• No (ref.) 1661(91.26%) 13034(96.33%) 14695(95.73%)
• Yes 159(8.74%) 497(3.67%) 656(4.27%)
Table 3 shows the results of the binary logistic 0.569 times more likely than women in the 44-49 age
regression test which illustrates the barrier of using group. This shows that younger age is a barrier to make
ANC in Indonesia. As reference is <4 ANC visits during ≥4 ANC visits during pregnancy. A study in Angola
pregnancy. Table 3 shows that women in the 15-19 from a different perspective also found similar results.
age group were 0.286 times more likely than women The study found that older women had better chances of
in the 44-49 age group to make ≥4 ANC visits during utilizing ANC7.
pregnancy. While women in the 20-24 age group were
≥4 ANC visits
Predictor
P OR Lower Bound Upper Bound
Place: Urban 0.905 0.993 0.879 1.121
Age: 15-19 <0.001*** 0.286 0.185 0.443
Age: 20-24 0.003** 0.569 0.392 0.827
Age: 25-29 0.195 0.790 0.554 1.128
Age: 30-34 0.668 0.927 0.655 1.312
Age: 35-39 0.849 1.034 0.734 1.458
Age: 40-44 0.799 0.955 0.668 1.364
Marital: Married/Living with partner 0.487 1.360 0.571 3.238
Marital: Widowed/Divorced 0.326 0.639 0.261 1.562
Education: Primary 0.013* 1.593 1.104 2.300
832 Medico-legal Update, January-March 2021, Vol. 21, No. 1
≥4 ANC visits
Predictor
P OR Lower Bound Upper Bound
Education: Secondary 0.007** 1.713 1.161 2.526
Education: Higher 0.507 1.155 0.755 1.767
Parity: <2 <0.001*** 3.930 3.142 4.915
Parity: 2-4 <0.001*** 2.627 2.215 3.115
Wealth status: Poorer <0.001*** 1.528 1.323 1.764
Wealth status: Midle <0.001*** 1.807 1.530 2.134
Wealth status: Richer <0.001*** 2.328 1.907 2.842
Wealth status: Richest <0.001*** 3.127 2.441 4.006
Insurance: Yes <0.001*** 1.408 1.266 1.566
Literacy: Able to read only part of sentences 0.554 0.902 0.640 1.270
Literacy: Able to read whole sentence 0.016* 1.385 1.061 1.807
Literacy: Blind/visually impaired 0.680 1.273 0.404 4.010
Media exposure: yes 0.004** 1.366 1.106 1.687
Frequency of media: At least one a week 0.196 0.920 0.810 1.044
Internet: Yes. last 12 months <0.001*** 1.413 1.215 1.644
Internet: Yes. before last 12 month 0.647 1.085 0.766 1.537
Know the danger sign of pregnancy: Yes <0.001*** 1.900 1.703 2.121
Belief in traditional birth attendant: Yes <0.001*** 0.527 0.432 0.643
The women with primary education are 1.593 times poverty is a barrier to ≥4 ANC visits during pregnancy.
more likely than no education women to make ≥4 ANC Moreover, the women who were covered by health
visits during pregnancy. While women with secondary insurance had 1.408 times more likely than women who
education were 1.713 times more likely than no education. were not covered by health. This shows that not having
This condition shows that uneducated is a barrier to ≥4 health insurance is a barrier to making ≥4 ANC visits
ANC visits during pregnancy. The result is similar to during pregnancy.
previous research that found the same phenomenon8.
The higher a person’s education, the better her chance Poor and without health insurance were found as
in utilizing health services, because she knows about her barriers to get ≥4 ANC visits. These two conditions are
needs, and knows how to fulfill them9–11. interrelated. In general, it is known that health insurance
can increase public access to health care facilities14.
The research shows that have many children is The same condition also applies to accessibility to get
a barrier to making ≥4 ANC visits. The results of ≥4 ANC visits. Not having health insurance is a barrier
this analysis are in line with studies conducted in to getting ≥4 ANC visits during pregnancy. Health
Eastern Ethiopia. The study found that primiparous financing policies in Indonesia try to reduce this barrier
and multiparous women had lower birth preparedness by providing subsidies for contributions to the National
and complication readiness than primiparous women. Health Insurance mechanism. It is hoped that this policy
Having many children was also informed as a predictor can improve the access of the poor to health services,
of neonatal death in Indonesia12,13 including the ANC15.
Wealth status in all categories there is a better chance Table 3 informs us that in the literacy category,
than the poorest women. The richer the more likely it women who were able to read whole sentences were
is to make ≥4 ANC visits. This condition shows that 1.385 times more likely than women who could not read
Medico-legal Update, January-March 2021, Vol. 21, No. 1 833
at all to make ≥4 ANC visits. This condition shows that the ICF International, who has agreed to allow the 2017
the inability in literacy is a barrier to make ≥4 ANC visits IDHS data to be analyzed in this article.
during pregnancy. This finding is in line with the results
of research in Afghanistan which found that women Source of Funding: Self-funding
who could read were three times better than those who Conflict of Interest: The authors declare no conflict
could not read when using ANC16. Literacy ability is a of interest, financial or otherwise.
determining factor in the level of knowledge of obstetric
danger signs and perceptions of the need for obstetric Ethical Clearance: The 2017 IDHS has received
care17. ethical clearance from the National Ethics Commission.
Utilization of the 2017 IDHS data in this study has been
Table 3 shows that women who were exposed to the permitted by ICF International through its website:
media were 1.366 times more likely than women who https://dhsprogram.com/data/new-user-registration.cfm.
were not exposed to the media to make ≥4 ANC visits.
This shows that media exposure is a barrier to making References
≥4 ANC visits during pregnancy. While the frequency of
media exposure did not show any influence on the ANC 1. Communication and Community Service Bureau
frequency. Moreover, the women who used the internet Ministry of Health Republic of Indonesia. The
last 12 months were 1.413 times more likely than women Ministry of Health Encourages Development in the
who never used the internet. This shows that never using 4.0 Era (Kemenkes Dorong Pembangunan SDM Era
the internet is a barrier to making ≥4 ANC visits during 4.0.) [Internet]. Jakarta; 2019. Available from: http://
pregnancy. This condition is in line with the inability www.depkes.go.id/article/print/19031200002/
to read and low education, as well as its effects, being kemenkes-dorong-pembangunan-sdm-era-4-0.html
ignorant of the danger signs of pregnancy. 2. Directorate General of Community Health
Development. Guidelines for Integrated Antenatal
Table 3 shows that women who knew the danger Services (Pedoman Pelayanan Antenatal Terpadu).
sign of pregnancy were 1.900 times more likely than Jakarta: Ministry of Health of the Republic of
women who did not know the danger sign of pregnancy. Indonesia; 2010.
This shows that ignorance of the danger sign of
3. Wulandari RD, Laksono AD. Relationship between
prevention is a barrier to making ≥4 ANC visits. While
Midwife Ratio and Performance of Maternal and
the women who believe in traditional birth attendants
Child Health Programs in Indonesia (Hubungan
are 0.527 times more likely than women who do not
antara Rasio Bidan dengan Kinerja Program
believe in traditional birth attendants. This shows
Kesehatan Ibu dan Anak di Indonesia). Bul Penelit
that belief in traditional birth attendants is a barrier to
Sist Kesehat. 2019;22(3):208–214.
make ≥4 ANC visits during pregnancy. Indonesia has
thousands of ethnic groups. There are still many health 4. Laksono AD, Soerachman R, Angkasawati TJ.
beliefs that exist among these tribes. This condition Case Study of Muyu Ethnic’s Maternal Health
encourages Indonesian women to still trust traditional in Mindiptara District-Boven Digoel (Studi
birth attendants4. Kasus Kesehatan Maternal Suku Muyu di Distrik
Mindiptana, Kabupaten Boven Digoel). J Reprod
Conclusions Heal. 2016;07/03:145–55.
5. Bago J-L, Lompo ML. Exploring the linkage
Based on the results of the study, it could be concluded
between exposure to mass media and HIV
that 10 variables become a barrier for Indonesian
awareness among adolescents in Uganda. Sex
women to make ≥4 ANC visits during pregnancy. The
Reprod Healthc. 2019;21:1–8.
barriers consisted of the following variables: young age,
low education, high parity, poverty, not having health 6. National Population and Family Planning Board,
insurance, not being able to read, not being exposed to Statistics Indonesia, Ministry of Health, The DHS
the media, never using the internet, not knowing the Program. Indonesia Demographic and Health
danger signs of pregnancy, and belief in traditional birth Survey 2017 [Internet]. Jakarta; 2018. Available
attendants. from: https://www.dhsprogram.com/pubs/pdf/
FR342/FR342.pdf
Acknowledgments: The author would like to thank
834 Medico-legal Update, January-March 2021, Vol. 21, No. 1
7. Rosário EVN, Gomes MC, Brito M, Costa D. 13. Laksono AD, Wulandari RD. Understanding
Determinants of maternal health care and birth Neonatal Death in Urban Area in Indonesia.
outcome in the Dande Health and Demographic Medico-Legal Updat. 2020;20(2):805–9.
Surveillance System area, Angola. PLoS One. 14. Laksono ADAD, Soedirham O, Saptandari P,
2019;14(8):Article number e0221280. Wulandari RDRD. Study of family size among
8. Tayfur I, Günaydin M, Suner S. Healthcare Service tenggerese in Indonesia. Int J Innov Creat Chang.
Access and Utilization among Syrian Refugees in 2020;13(4):964–78.
Turkey. Ann Glob Heal. 2019;85(1). 15. Agustina R, Dartanto T, Sitompul R, Susiloretni
9. Wulandari RD, Laksono AD. Education as KA, Suparmi, Achadi EL, et al. Universal health
predictor of the knowledge of pregnancy danger coverage in Indonesia: concept, progress, and
signs in Rural Indonesia. Int J Innov Creat Chang. challenges. Lancet. 2019;393(10166):75–102.
2020;13(1):1037–51. 16. Azimi MW, Yamamoto E, Saw YM, Kariya T,
10. Rohmah N, Yusuf A, Hargono R, Laksono AD, Arab AS, Sadaat SI, et al. Factors associated with
Masruroh, Ibrahim I, et al. Determinants of teenage antenatal care visits in Afghanistan: secondary
pregnancy in Indonesia. Indian J Forensic Med analysis of Afghanistan Demographic and Health
Toxicol. 2020;14(3):2080–5. Survey 2015. Nagoya J Med Sci. 2019;81(1):121–
11. Laksono AD, Wulandari RD. Predictors of Hospital 31.
Utilization Among Papuans in Indonesia. Indian J 17. Oguntunde O, Nyenwa J, Yusuf FM, Dauda DS,
Forensic Med Toxicol. 2020;14(2):2319–24. Salihu A, Sinai I. Factors associated with knowledge
12. Wulandari RD, Laksono AD. Is parity a predictor of of obstetric danger signs and perceptions of the need
neonatal death in Indonesia? Analysis of the 2017 for obstetric care among married men in northern
Indonesia demographic and health survey. Indian J Nigeria: A cross-sectional survey. BMC Pregnancy
Forensic Med Toxicol. 2020;14(3):2161–6. Childbirth. 2019;19(1):Article number 123.
DOI Number: 10.37506/mlu.v21i1.2420 Medico-legal Update, January-March 2021, Vol. 21, No. 1 835
K.M. Parmar1, Hetal Vaisnani2, Nirali Chavda3, Priyanka Sharma4, Kinjal Jethava1
1
Associate Professor, 2Professor, 3Tutor, 4Assistant Professor, Dept of Anatomy, Smt. B.K. Shah Medical Institute &
Research Center Sumandeep Vidyapeeth and Institution Deemed to be University, Piparia, Vadodara Gujarat
Abstract
Introduction: This study intended to assess the awareness among subjects regarding body donation and
cadaveric dissection and their willingness to donate body.
Methodology: A cross sectional study conducted in Anatomy Department, SBKS Medical Institute and
Research Centre, Vadodara. A self-administered questionnaire containing 18 questions was to be filled by
the participants in 15 minutes. Responses of participants were collected and analysed.
Results: 130 participants were enrolled, 47.69% were males while 52.31% were females. Majority (38.46%)
were ≥45 years in age. Around 41.54% of the participants had received no schooling. Majority of the
participants were unaware of the Organ (54.62%) and Body donations (63.85%), however, around 51.54%
of the subjects were aware of the cadaveric dissections occurring in medical colleges. Also, 50.77% agreed
for body donations. As compared to males, higher proportion of females were aware of the organ (47.1%)
and body (38.2%) donations and 61.8% females were willing to donate bodies. Higher proportion of subjects
in the age groups of 26-45 years were aware of organ (52.3%) and body (38.6%) donation and cadaveric
dissection (65.9%), however, proportionately more subjects in the age group of 18-25 years (77.8%) were
willing to donate body. A higher proportion of subjects with college education were aware of the organ
(84.6%) and body (92.3%) donation and cadaveric dissection (92.3%) and were also willing to donate body
(92.3%).
Conclusion: Gender, education and socioeconomic background have an impact on organ/body donation and
willingness to donate body.
Materials and Method iii. Those willing to give written informed consent for
participation in the study
This was a cross sectional study conducted in
Department of Anatomy of SBKS Medical Institute Exclusion Criteria:
and Research Centre, Piparia, Vadodara from i. Medical and dental students, doctors and faculty
December 2019 to February 2020. A self-administered members were excluded
questionnaire was to be filled by the participants. The
questionnaire evaluated awareness, attitude, knowledge ii. Those that did not give consent for participation in
and willingness towards body/organ donation based on the study
18 points scale. Subjects were given questionnaire in the The study was conducted an aim to study gender and
vernacular language and were asked to clarify doubts if age group based difference in awareness and willingness
any, prior to filling the questionnaire. The questionnaire for organ and body donation and to evaluate familiarity
had multiple choice questions and a separate space for with cadaveric dissection. The study also evaluated the
providing personal option was also provided for each impact of literacy on the awareness. The subjects were
question. The researcher made the participants fill divided as those having no school education, those
questionnaire in their presence and did not allow cross with primary, secondary, higher secondary and college
discussion among participants while filling it. Duly education.
filled and signed questionnaire were collected from the
participants. Each participant was given 15 minutes for Data was entered in MS excel and analysed.
filling the questionnaire. Frequencies and percentages were calculated.
Significance was assed using Chi square test.
A total of 130 participants, attending medical and
dental outpatient department and providing written Results
informed consent for participation in the study and
agreeing to fill the questionnaire were enrolled in the A total of 130 questionnaire were collected and
study. analysed.
When the literacy of the study group was evaluated, literacy of the population was on lower side as shown in
it was observed that higher proportion of the females table 2.
(45.59%) had no schooling as compared to males. The
Medico-legal Update, January-March 2021, Vol. 21, No. 1 837
Table 2: Literacy status of participants
Majority of the participants were unaware of the Organ (54.62%) and Body donations (63.85%), however,
around 51.54% of the subjects were aware of the cadaveric dissections occurring in medical colleges. Also, 50.77%
agreed for body donations.
Gender based evaluation of awareness of donation showed that as compared to males, higher proportion of
females were aware the organ (47.1%) and body (38.2%) donations and 61.8% females were willing to donate
bodies. (Table 5).
Age group based evaluation, as shown in table 6, suggested that higher proportion of subjects in the age groups
of 26-45 years were aware of organ (52.3%) and body (38.6%) donation and cadaveric dissection (65.9%), however,
proportionately more subjects in the age group of 18-25 years (77.8%) were willing to donate body.
As shown in table 7, a higher proportion of subjects with college education were aware of the organ (84.6%) and
body (92.3%) donation and cadaveric dissection (92.3%) and were also willing to donate body (92.3%).
838 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 6: Literacy based evaluation of awareness
Abstract
Introduction: Neck and upper limb musculoskeletal disorders are a major source of disability which is also
resulting in economic loss. Housemaids are exposed to repetitive tasks which causes them to be at high risk
of neck pain. This result in increased burden on health care costs and also adds to reduced work productivity.
The aim of the study is to evaluate scapula muscle strength in housemaids to determine magnitude of the
problem.
Methodology: A total of 100, divided as 50 participants in housemaid group with neck pain and 50 age
matched normal individuals in the asymptomatic group were recruited for the study. Self made questionnaire
and scapula muscle strength were tested using push - pull dynamometer.
Results and Discussion: The study highlights the weakness of scapula muscle strength with neck pain in
housemaids as compared to asymptomatic group. This gives us an insight into significance of scapula muscle
strength in neck pain cases which will help us in formulating effective treatment strategies for treating neck
pain cases.
One potential reason for impaired scapulothoracic Ethical Clearance: It is obtained from institutional
muscle strength in housemaids with neck pain is during ethics committee
strength testing,subjects did not exert maximum effort
Source of Funding: It is self funded
as pain might be a barrier.[21] Secondly,our study shows
that housemaids are involved in long working hours Conflict of Interest: Nil
with inadequate rest breaks. This results in prolonged
repetitive movements which is exhausting. Also, the References
worker is unable to recover in the short rest periods of
1. Hogg-Johnson S, van der Velde G, Carroll
time between work duration, thus exposing at increased
LJ,Holm LW, Cassidy JD, Guzman Jet al. The
neck and upper limb MSDs.[22]
burden anddeterminants of neck pain in the general
In our study, the scapula muscle strength of subjects population: results of the Boneand Joint Decade
with neck pain were significantly weaker on the affected 2000–2010.Task Force on Neck Pain and its
side of neck pain as compared to asymptomatic group. associated Disorders. J Manip Physiol Ther 2009;
These changes in scapular kinematics can also be 32(2 Suppl):46–60.
associated to altered serratus anterior muscle recruitment 2. Cote P, van der Velde G, Cassidy JD, Carroll LJ,
pattern also, muscle performance such as force imbalance Hogg-Johnson S, Holm LWet al. The burden and
in the upper and lower trapezius muscle,and flexibility determinants ofneck pain in workers: results of the
deficits in the anatomical location surrounding the Bone and Joint Decade 2000–2010Task Force on
scapula which may restrict normal scapular movement Neck Pain and Its Associated Disorders. J Manip
during daily activity.[23-26] Movement pattern correction Physiol. Ther 2009; 32(2 Suppl):70–86.
plays a vital role of muscle-recruiting strategies in 3. Coyte PC, Asche CV, Croxford R, Chan B. The
rehabilitation. economic cost of musculoskeletal disorders in
Recovering the normal activation of the serratus Canada. Arthritis Rheum 1998;11:315–25.
anterior and trapezius muscles is essential for neck 4. Mäkelä M, Heliövaara M, Sievers K, Knekt P,
and shoulder disorder rehabilitation.[27] Proper firing Maatela J, Aromaa A. Musculoskeletal disorders as
patterns and recruitment of muscles require coupling determinants of disability in Finns aged 30years or
of the serratus anterior muscle with the upper, middle, more. J Clin Epidemiol. 1993;46:549–59.
and lower trapezius muscles, consequently resulting 5. Picavet H, Schouten J. Musculoskeletal pain in the
in “force couples,” which are considered necessary Netherlands: prevalences,consequences and risk
fornormal scapular orientation.[28, 29]Previous study groups, the DMC 3-study. Pain 2003;102:167–78
have shown that the main goal was to inhibit the over 6. Nordin M, Carragee EJ, Hogg-Johnson S, et al:
activity of muscle and to facilitate the muscle with weak Assessment of neck painand its associated disorders:
activity for postural control.[27] results of the Bone and Joint Decade 2000–2010.
Thus, the early diagnosis of scapula muscle Task Force on Neck Pain and Its Associated
involvement in neck pain in housemaids will help Disorders. Spine 2008;33(4 Suppl):101–122.
in planning effective interventions which can help 7. European Agency for Safety and Health at
Medico-legal Update, January-March 2021, Vol. 21, No. 1 843
Work: E-fact 39 - Cleaners and musculoskeletal 19. Behrsin JF, Maguire K. Levator scapulae action
disorders. 2008. https://osha.europa.eu/en/tools- during shoulder movement: A possible mechanism
andpublications/publications/e-facts/efact39. for shoulder pain of cervical origin. Aust J
8. Bell AF, Steele JR. Risk of musculoskeletal injury Physiother 1986;32:101–6.
among cleaners during vacuuming. Ergonomics 20. Gwendolen J,Michele S, Deborah F, Julia T, Shaun
2012;55:237–47. L. Whiplash, headache and neck pain. 1st edn.
9. Canadian Centre for Occupational Health and Churchill Livingstone, 2008.
Safety: Hotel Housekeeping. 2016. https://www. 21. Shannon M. P, Nathan A.D, Chad E.C.
ccohs.ca/oshanswers/occup_workplace/hotel_ Scapulothoracic muscle strength in individuals with
housekeeping.html neck pain. Journal of Back and Musculoskeletal
10. El Tayeb I, Ghareeb N, Zalat M. Prevalence of Rehabilitation 2016;29: 549–555.
musculoskeletal problemsamong full time lady 22. Sintayehu D.W, Awrajaw D, Daniel H.C. The impact
servants in Doqqi area, Cairo. Egypt J Occup Med of work-related risk factors on the development
2013;37:47–59. of neck and upper limb pain among low wage
11. Mammen R. Assessment of physical workload, hotel housekeepers in Gondar town, Northwest
ergonomic problems and prevalence of pain among Ethiopia: institution-based cross-sectional study.
low wage hotel housekeepers in Orlando; 2017. Environmental Health and Preventive Medicine
2019;24:27.
12. Frumin E,Joan M, Pamela V, John H, Peter O,
Niklas K et al. Workload-related musculoskeletal 23. Ludewig PM, Cook TM. Alterations in shoulder
disorders among hotel housekeepers: employer kinematics and associated muscle activity in people
records reveal a growing national problem; 2006. with symptoms of shoulder impingement. Phys
Ther 2000;80:276–91.
13. Falla D, Jull G, Hodges P. Patients with neck
pain demonstrate reduced electromyographic 24. Cools AM, Witvrouw EE, Declercq GA, et al.
activity of the deep cervical flexor muscles during Scapular muscle recruitment patterns: trapezius
performance of the craniocervicalflexion test. Spine muscle latency with and without impingement
2004; 29(19): 2108-2114. symptoms. Am J Sports Med 2003;31:542–9.
14. Jull GA, Falla DL, Vicenzino B, Hodges PW. The 25. Borstad JD, Mathiowetz KM, Minday LE, et
effect of the rapeutic exercise on activation of the al. Clinical measurement of posterior shoulder
deep cervical flexormuscles in people with chronic flexibility. Man Ther 2007;12:386–9.
neck pain. Man Ther 2009;14(6): 696–701. 26. Borich MR, Bright JM, Lorello DJ, et al. Scapular
15. Petersen SM, Wyatt SN. Lower trapezius muscle angular positioning at end range internal rotation
strength in individuals with unilateral neck pain. J in cases of glenohumeral internal rotation deficit. J
Orthop Sports Phys Ther 2011; 41(4): 260-265. Orthop Sports Phys Ther 2006;36:926–34.
16. Shahidi B, Johnson C, Curran-Everett D, Maluf 27. Boyoung Im, Young Kim, Yijung Chung, Sujin
K. Reliabilityand group differences in quantitative Hwang. Effects of scapular stabilization exercise on
cervicothoracic measures among individuals with neck posture and muscle activation in individuals
and without chronic neck pain. BMC Musculoskelet with neck pain and forward head posture. J. Phys.
Disord 2012; 13: 215 Ther. Sci 2016. 28: 951–955.
17. Guihem G, Cornu C, Guevel A. Neuromuscular 28. Lindstrøm R, Schomacher J, Farina D, et al.
and muscle-tendon system adaptions to isotonic Association between neck muscle coactivation,
and isokinetic eccentric exercise. Ann Phys Rehab pain, and strength in women with neck pain. Man
Med 2010; 53:319-341. Ther 2011, 16: 80–86.
18. Lewis VM, Merritt JL, Piper SM, Sinaki M. 29. Wegner S, Jull G, O’Leary S, et al. The effect of
Correlations between isotonic and isometric a scapular postural correction strategy on trapezius
measurements of trunk muscle strength. Arch Phys activity in patients with neck pain. Man Ther 2010,
Med Rehabil 1987; 68:639. 15: 562–566
844 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2422
Rituraj Verma1, Taruna Verma2, Vikas Sharma3, Yash Pratap4, Sanghamitra Jena5, Sajjad Alam6
1
Associate Prof., HOD Physiotherapy dept, Galgotias University, 2Assistant Prof., Galgotias University, 3Assistant
Prof., Galgotias University, 4Associate Prof., Galgotias University, 5Assistant Prof., Galgotias University,
6Associate Prof., Galgotias University
Abstract
Objective: To compare the effect of Piriformis Stretching and Intermittent Lumbar Traction along with
Spinal Extension Exercises in Lumbar Disc Herniation.
Method: 30 subjects fulfilling selection criteria participated in the study. All of them were told about the
procedure of study. All their queries were answered satisfactorily, and informed consent was taken from
them. Intermittent lumbar traction, piriformis stretching, and spinal extension exercises were given to the
participants. In the beginning of treatment, they were given VAS, Roland- Morris Low Back Pain and
Disability Questionnaire and Oswestry Low Back Pain Disability Questionnaire. They were asked to fill
these questionnaires. After 1 week protocol of treatment they were again told to fill these outcome measures.
The participants were selected for the inclusion and exclusion criteria of the study. The patient consent was
taken to be comfortable and relaxed.
Conclusion: Study suggests that Piriformis Stretching along with Spinal Extension Exercises plays a
significant role in reducing pain and disability as compared to traction along with Spinal Extension Exercises.
By using Piriformis Stretching, in a short period of time, patients are able to carry out functions of daily
living smoothly.
Keywords: Pain, Disability, Lumbar disc herniation (LDH), tumor necrosis factor (TNF).
Comparision of Visual Analogue Scale (Piriformis Stretching) between Pre and Post Test:
Standard Error
Variable Group Treatment N Mean S. D. D.F t-value
Mean
Comparision of Visual Analogue Scale (Intermittent Lumbar Traction) between Pre and Post Test:
Standard Error
Variable Group Treatment N Mean S.D. DF t-value
Mean
Standard
Variable Group Treatment N Mean S. D. D.F. t-value
Error Mean
Post-Test Piriformis Stretching 15 2.86 1.06 .27
Visual Analogue
Intermittent Lumbar 28 4.42*
Scale Post-Test 15 4.46 .91 .23
Traction
Comparision of Oswestry between Post Test Piriformis Stretching) and Post Test (Intermittent
Lumbartraction):
Standard Error
Variable Group Treatment N Mean S. D. D.F t-value
Mean
Post-Test Piriformis Stretching 15 29.68 8.39 2.16
Oswestry 28 1.57**
Post-Test Intermittent Lumbar Traction 15 35.65 12.07 3.11
** Not Significant at 0.01 level df =28, At 0.01 t-value of the Table is 2.76
Comparision of Roland Morris Back Pain and Disability (Intermittent Lumbar Traction) Pre and Posttest:
Standard Error
Variable Group Treatment N Mean S. D. DF t-value
Mean
Comparision of Roland Morris Back Pain and Disability between Post Test (Piriformis Stretching) and
Post Test (Intermittent Lumbar Traction):
Standard
Variable Group Treatment N Mean S. D. D.F t-value
Error Mean
Result Conclusion
The results of this study support that Piriformis Study suggests that Piriformis Stretching along
stretching will be more effective and significant with Spinal Extension Exercises plays a significant role
in reducing pain and disability (due to LDH) than in reducing pain and disability as compared to traction
Intermittent Lumbar Traction. along with Spinal Extension Exercises.
Future Scope and Research: Present study was Ethical Clearance: Prior Patient consent form was
limited to 35-45 age group. Further research examining taken.
the effects of both PS and ILT on individuals in younger
and older age groups would be of interest. Future Source of Funding: Self
research must include a follow-up of at least 15 days/16 Conflict of Interest: Nil
days to check the short term/long term effects of PS and
ILT.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 847
Abstract
Gentamicin is effectively used for the treatment of gram-negative bacterial infection but it has a hepatotoxic
effect. Lipid peroxidation and suppression of endogenous antioxidants by gentamicin increases the
production of reactive oxygen species which leading to necrosis ofhepatocyte. Cassava leaves (Manihot
esculenta) contain phenolic compounds, flavonoids, vitamin C, carotene, and iron which act as antioxidant
and enzymatic antioxidant cofactor which can inhibit lipid peroxidation. This research aimed to determine the
influence of cassava leaves extract to serum albumin level in mice with gentamicin-induced hepatotoxicity.
Mice were divided into groups N, K (gentamicin 80 mg/kg b.w.); P1, P2, P3 (gentamicin 80 mg/kg b.w. and
cassava leaves extract 150 mg/kg b.w., 300 mg/kg b.w., 450 mg/kg of b.w. for 14 days). Serum albumin level
in group K was decreased compared to group N; group P1, P2, P3 were respectively gradually increased.
One Way Anova analysis showed significant difference among groups (p<0.05). Post Hoc Tukey test showed
that serum albumin level in group P3 was significantly different from group K (p<0.05). It can be concluded
that cassava leaves extract prevent the decrease of serum albumin level in mice with gentamicin-induced
hepatotoxicity.
Abstract
Background: Wart is common disease cause by infection with HPV, there are many modalities for treatment
most of them resolve wart with many side effects as scars and recurrence.
Objective: To identify the significant difference between two doses of intralesional vitamin D3 (60,000 vs
120,000) iu injection in treatment of warts.
Patients and Method: A total of 47 patients were included in the study divided into two groups. Group A
received intralesional 60,000 iu of vt.D3, and group B received intralesional 120,000 iu vt. D3 into each
lesion with maximum of five warts treated in one session. Four sessions was done every 2 weeks in both
groups. Follow-up was done for 4 months after last session of treatment for any recurrence.
Results: In group A: complete response in 77.7%, partial response in 6.67%, minimal response in 6.67%,
and no response in 6.67% of patients. About 60% of patients with multiple warts showed complete clearance
of distant untreated warts. In group B: complete response in 66.7%, partial response in 6.67%, minimal
response in 20%, and no response in 6.67% of patients. There was no significant difference between both
groups. No recurrence was observed in both groups in the follow-up period.
Conclusions: Immunotherapy by both intralesional MMR vaccine and vitamin D3 is simple, well-tolerated,
and effective.
Cells in the skin have receptors for Vitamin • Mild response achieve when 1% to<50% of
D3 analogues are keratinocytes, Langerhans’ cells, reduction occur. [5]
melanocytes, fibroblasts and endothelial cell [6], so
Materials
1. It works through Vitamin D receptor (VDR) to • 27 gauge insulin syringe.
regulate cell growth, differentiation and immune
function. It inhibits the proliferation of keratinocytes • vit. D3 ampule 300,000 IU/ml.
and modulates epidermal differentiation Method of Administration of Vitamin D3 Injection:
2. Vitamin D prevent production of several pro- We give slow gentl intralesional injection of vitamin
inflammatory cytokines by T-cell clones, including D3 without local anaesthesia after proper encourgement
IL-2 and IFN-γ. and reasurance to the patients.
3. It inhibits interleukin-6 (from B cell) and
• Patients in group 1 A (no. = 27) were treated with
interleukin-8 (that produced from macrophage).
60,000 IU vit. D3 (0.2ml of 1ml of vit. D3 300,000
4. It inhibits transcription of granulocyte-macrophage IU) whereas group 2 B (no. = 20) were treated
colony-stimulating factor and messenger ribonucleic with 120,000 IU vit. D3 (0.4ml of 1ml of vit. D3
acid. 300,000iu), vit. D3 injected to the base of wart with
5. It block activity of cytotoxic T cells and Natural 27 gauge insulin syringe (Figure 18).
Killer cells.[8] • The injections were repeated 2weeks apart; for 4
sessions.
Patient and Method
• The large number of wart treated in single session
The study was conducted in the departments of
were 5 warts.
dermatology of Salahuldin-General Hospital in Tikrit
city and Azadi Teaching Hospital in Kirkuk city, Iraq. • Follow up of recurrence will obtained after 4 months
From Nov. 2019 to 30 June 2020. It was an opened, a of last injection.
comparative and a therapeutic trial study to estimate
the efficacy of the vit. D3 in different two doses to treat
Results
wart. A total of 47 patients were enrolled in the study. Demographics and clinical informations of the
27 of them treated with 60,000 IU of vit. D3 as group patients in each groups were mentioned in table 1 with no
(A) and other 20 patient treated with 120,000 IU of vit. statistically significant difference between both groups.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 855
Regarding to the response of wart to treatment (table sessions figure 1,9 patients (42.8%) show complete
1) show that group A has 77.7% complete response, response after 3 sessions and 6 patients (28.5%) show
14.8% moderate response and 7.4% mild response complete response after 4 sessions while others show
(2 patients of 27 while in group B has 55% complete partial response after 4 sessions. In group B there’s
response, 35% moderate response and 10% mild 5 patients (45.5%) show complete response after 2
response with no significant difference between groups sessions figure 2, 4 patients (36.5%) show complete
(p value =0.3130). response after 3 sessions and 2 patients (18.2%) show
complete response after 4 sessions while other patients
Relationship between clinical response and numbers have partial response after 4 sessions. No significant
of sessions shown in table 2, group A there’s 6 patients difference between groups (p value =0.879).
(28.5%) of patients have complete response after 2
856 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2: Relationship between complete response and number of sessions.
Figure 1: Periungual wart for 11 years old boy since 1 year durations (A) before treatment, (B) after
2 weeks of treatment, (C) after 2 sessions, and (D) complete response after 3 sessions of treatments with
vt.D3 60.000 IU.
Figure 2: Filiform wart on upper lips of 19 years old man for 5 months duration (A) before treatment,
(B) after 2 weeks of 1st session, and (C) after the second session of treatment with vt. D3 120,000 IU.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 857
Regarding reduction of the diameter of the wart diameter of wart before treatment was 337mm reduced to
(table 3), in group A the total diameter before treatment 97mm after treatment also there’s significant difference
was 289mm reduced to 32mm there’s significant (p=0.0000317). (Figure 33) show mean of diameters in
difference (p =0.004428), while in group B the total both groups before and after injection.
Regarding to sides effect table 4 show in group A In group B 17 patients (85%) developed the
15 patients (55.5%) developed sides effect including same sides effect at site of injection with one patient
erythema, pain, swelling and itching at site of injection developed vasovagal attack after injection immediately
with one patient developed pustule at site of injection. and resolved within minutes, other patient developed
ulcer at site of injection. (p= 0.545).
Regarding clearance of distal warts in group Our results match with many studies as:
A there’s one patient with distal wart who has no
improvement while in group B there’s 5 patients 3 (60%) Shalmoud et al (2020) reported 66.7% of patient’s
of them getting improved of distal wart spontaneously complete response, 6.67% had partial response, 20% had
with treatment of target wart. minimal response, and 6.67% had no response. [9]
There was no significant relation between clinical Raghukumar et al18(2017) reported complete
response and either age, sex, site of wart, type of wart response in 90%, partial response in 6.66%, and no
and duration of disease in each groups. response in 3.33%. [10]
This result refers to ability of 120,000 IU of vitamin Ethical Clearance: Not required
D3 to be superior on 60,000 IU of vitamin D3 in treatment
of wart but the results of nonsignificant difference
Reference
in other measures between two groups may be due to 1. Salman S, Ahmed M, Ibrahim A. Intralesional
the larger diameter of the warts in group B which may immunotherapy for the treatment of warts: A
require for more sessions to achieve the better response.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 859
network meta-analysis. J AM ACAD DERMATOL. 9. Shaldoum DR, Hassan GFR, El Maadawy EH,
2018;80(4). El-Maghraby GM. Comparative clinical study
2. Howley PM, Lowy DR. Papillomaviruses. In: of the efficacy of intralesional MMR vaccine vs
Knipe DM, Howley PM, editors. Fields virology. intralesional vitamin D injection in treatment of
5th ed. Philadelphia: Lippincott Williams & warts. J Cosmet Dermatol. 2020;00:1–8.
Wilkins; 2001. p. 2299–354. 10. Raghukumar S, Ravikumar BC, Vinay KN, et al.
3. Khanna N. Illustrated Synopsis of Dermatology Intralesional Vitamin D3 Injection in the Treatment
and Sexually Transmitted Diseases. 5th ed. Delhi/ of Recalcitrant Warts: A Novel Proposition. J Cut
India: Elsevier; 2016. Med Surg. 2017;21(4):320-324.
4. KANG S, AMAGAI M, MARGOLIS D. 11. Aktaş H, Ergin C, Demir B, et al. Intralesional
Fitzpatrick’s Dermatology. 9th ed. New York: vitamin D injection may be an effective treatment
McGraw-Hill Education; 2019. option for warts. J Cutan Med Surg. 2016;20(2):118-
122.
5. Kavya M, Shashikumar B. Safety and efficacy of
intralesional vitamin D3 in cutaneous warts: An 12. Chia-Han Yeh M, Tsai T-Y, Huang Y-C,
open uncontrolled trial. Cutaneous and Aesthetic Intralesional vitamin D3 injection in the treatment
surgery. 2017;10(2):90-94. of warts: A systematic review and meta-analysis,
Journal of the American Academy of Dermatology
6. Al Ghamdi, K. M., & Khurram, H. (2011).
(2019)
Successful treatment of peri- ungual warts with
diluted bleomycin using translesional multipuncture 13. Kareem IMA, Ibrahim IM, Mohammed SFF,
technique: A pilot prospective study. Dermatologic Ahmed AA-B. Effectiveness of intralesional
Surgery, 37(4), 486–492. vitamin D3 injection in the treatment of common
warts: Single-blinded placebo-controlled study.
7. Shahriari M, Kerr PE, Slade K, et al. Vitamin D and
Dermatologic Therapy. 2019;32:e12882.
the skin. Clin Dermatol. 2010;28(6):663-668.
14. El Sayed MH, Sayed FS, Afify AA. Intralesional
8. Gautam D, Agarwal D, Nikalji D. DYP
zinc sulfate 2% vs intralesional vitamin D in plantar
SURVIVAL GUIDE FOR POST GRADUATE
warts: A clinicodermoscopic study. Dermatol Ther.
DERMATOLOGY EXAMINATION PART-II.
2020;33(3):e13308. doi:10.1111/dth.13308
2nd ed. India: Torrent Pharmaceuticals; 2013.
860 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2425
Abstract
Diabetes mellitus (DM) is a global epidemic that is correlated with long-term damage and causes dysfunction
of many organs like the kidney leading to diabetic nephropathy (DN) which need for heamodialysis (HD) to
protect progressive renal decline. This study was designed to evaluate the significance of glycated albumin
(GA), compared with fasting blood sugar (FBS) and glycated hemoglobin (HbA1c), were evaluated as an
indicator of glycemic control, also determinant of insulin. This study was conducted on 95 patients at age
rang (30-70) years, and patients include (35) HD patients with diabetes, (35) HD patients without diabetes
and (25) Type 2 diabetes mellitus, who attended atRamadi General Hospital and (25) samples as control
included in this study. This study showed that HbA1c% was significantly lower than simultaneous FBS and
GA% in HD patients in comparison with in diabetic patients and control, as illustrated in significantly shallow
slope of regression line between FBS with HbA1c and FBS with GA. Also, GA% was nearly corresponding
between before and after one hemodialysis in HD patients compared with HbA1c.In conclusion, GA provides
a better measure to estimate glycemic control in HD patients with diabetes compared with HbA1c.
Keywords: Chronic kidney disease, Diabetes mellitus, Glycated Albumin, HbA1C, Hemodialysis.
Table (1): The mean levels of FBS between the four study groups.
These results suggested that glycemic control of average FBS levels reflect the initial degree of glycemic
control group and patients groups were stable during control achieved at this stage of hemodialysis therapy.
the study period (60 days) before determined of GA The 3- months FBS levels reflect the long-term glycemic
and HbA1c and a single determination immediately control of hemodialysis therapy and the general condition
before HD can be indicative of glycemic control in HD of the hemodialysis patient at this stage(9).
diabetes patients. The stable glycemic control during
the preceding 2 mo may negate the different impact of Determination of Average Fasting Blood Sugar
acute glycemic control changes between HbA1c and (FBS) Level: Table (2) showed average of FBS was
GA in this study. In the first month of hemodialysis, the a significant increase in diabetic group (215±11.1)
862 Medico-legal Update, January-March 2021, Vol. 21, No. 1
mg/dl, followed by HD patients with diabetes group and HD patients without diabetes were (88.5±4.88
(188.7±18.39)mg/dl compared with other groups, while and 92.2±2.7) mg/dl respectively compared with other
the average of FBS was decreased in control group groups.
Table (2): The mean of average FBS between four study groups.
The results in table (2) agreement with Khalaf, (10); been result from an increased rate of glucose production
Abid Hammed, (11)who recorded that the significantly which including increased rate of hepatic glycogenolysis
higher in diabetic patients and HD patients with diabetic and gluconeogenesis. While in HD patients, FBS affects
compared to control, but our results disagreed in another by dialysis fluid, and changes in glucose levels in the
part of study by Abid Hammed, (11) when demonstrated dialysis fluid during and after hemodialysis (10;11).
non-significant difference between diabetic patients and
HD patients with diabetes. The level of blood glucose Determination of Glycoheamoglobin (HbA1):
normally represents balance between the inflow of Table (3) showed mean HbA1C was a significantly
glucose into blood and its uptake by the tissue. This increased in diabetic patients (10.41±1.16) % compared
result demonstrated an increase in gluconeogenesis in with other groups, also a significant increase in HD
diabetic patients which is the predominant mechanism patients with diabetes (8.194±1.22)%. While the mean of
responsible for increased hepatic glucose output in HbA1C was decreased in HD patients without diabetes
patients with T2DM and it is correlated with fasting and control were (5±1.23 and 5.31±0.76)% respectively.
plasma glucose level. The fasting hyperglycemia has
Table (3): The mean of HbA1c percent between four study groups.
The results in table (3) agreed with Hadi and HD patients with diabetes (8.5±1.8) %, compared with
Sultan,(12) who recorded that the HbA1C increased in control (4.8 ± 0.7)%. The rise in the HbA1c levels was
diabetic patients compared with control. Also agreed associated with the increasing level of FBS in diabetic
with Abid Hammed, (11)who showed that HbA1C was groups, indicating that testing of HbA1c appears as a
significantly higher among T2DM (10.6±1.6) % and measure of chronic hyperglycemia in diabetic patients.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 863
The HbA1c has been used as an objective marker of Determination of GA: Table (4) showed that the
average glycemic control because the levels of HbA1c mean GA% was a significantly increased in diabetic
in the blood reflect the glucose levels which erythrocyte patients and HD patients with diabetes were (30.5±4.15
has been exposed during its lifetime of the RBC(13).Thus, and 29.2±4.5)% respectively, while the mean of GA%
the elevation of HbA1C levels in our study indicates was decreased in control (16.1±1.8)% followed by HD
reduced control of blood glucose levels(10). patients without diabetes (17±1.12) %.
Results in table (4) consistent with Lu et al.,(3);Chen Correlation between FBS with GA% or FBS
et al., (14) who recorded that mean of GA% increase with HbA1c% in study groups.
in HD patients with diabetes compared with HD
patients without diabetic and control. And consistent There were significant and positive correlations
with Fukami et al., (15) who recorded that the mean of between FBS with GA% (r =0.34, P < 0.01; Figure (1)
GA% was increased in diabetes patients compared with A1) and (r =0. 371, P < 0.01; Figure (2) A2) or FBS
control. GA concentrations could accurately reflect with HbA1c% (r =0.459, P < 0.01; Figure (1) B1) and (r
the glycaemic control in such patients without being =0.356, P < 0.01; Figure (2) B2) in diabetic patients and
influenced by anaemia and hypoalbuminemia. GA may HD patients with diabetic respectively. As shown, the
be desirable in diabetic patients with ESRD complicated correlation between FBS and GA% was similar between
with both renal anaemia and hypoalbuminemia. While HD patients with diabetes and diabetic patients, but FBS
in HD patients without diabetes, increased GA and and HbA1c% seemed to be significantly lower in HD
impaired renal function should be closely monitored for patients with diabetes than in diabetic patients.
the development of arterial stiffness (15).
Figure (1):Correlation between average FBS values with GA% (Figure A2) or average FBS values with
HbA1c% (Figure B2) in diabetic patients group.
864 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Figure (2): Correlation between the average FBS values with GA % (Figure A3) or average FBS values with
HbA1c% (Figure B3) in HD patients with diabetic group.
Effect of a Single HD Session on GA% and These data clearly indicated that the substances that
HbA1c%: These results show that serum GA% were accumulated into uremic serum did not affect GA values
almost identical between before and after a single HD at all. The only factor that associated independently
session in HD patients with diabetes were (29.4±4.71 with GA value was the average FBS, which associated
and 29.3±4.5) respectively. While HbA1c also identical to a greater degree with GA compared with HbA1c (16).
between before and after a single HD but to a lesser Although the specificity and positive predictive value of
degree from GA, where in HD patients with diabetes HbA1c were acceptable, they were not promising; thus,
were (8.5 ±1.83 and 8.19 ±1.2) respectively. to confirm diagnosis, we can not only rely on a slight
elevation of HbA1c. The elevated GA/HbA1c ratio in
The ratio of GA/HbA1C in study groups: The GA/ diabetic dialysis patients, relative to diabetic subjects
HbA1c ratio was (3.0) in control groups and (2.93) in without nephropathy, strongly suggests that HbA1c was
diabetic patients with no significant difference between falsely reduced in diabetic subjects on hemodialysis.
these two groups. Also the GA/HbA1C ratio showed no HD patients draw iron and vitamin B12 for the purpose
significant difference between HD patients with diabetes of anemia correction such as external ESA. These
(3.5) and HD patients without diabetes (3.3). treatment increases the development of immature RBC,
The results in figures (1, 2) identify with the which ultimately changes the original structure of the
finding of study by Inaba et al., (8) who recorded that hemoglobin. Such RBCs are given inadequate exposure
the significant and positive correlations between time to go through the process of glycosylation, which
average FBS with serum GA. Also identify with Gan may result in lower concentration of HbA1c. The lower
et al.,(4) who found that GA showed a strong correlation level of HbA1c may thus offer a false impression about
with mean FBS and supply a more reliable marker the overall glycemic regulation (15; 16).
of glycemic control, compared with HbA1c which Conclusion: GA is a better marker for detecting
showed heterogeneity correlation with average FBS was short term glycemic control in HD patients with diabetes
indicated in HD patients. The results in table (5) agreed and the assessment of glycemic control by HbA1c in
with Gan et al.,(4) who indicated that the GA is superior those patients might lead to underestimation, where the
to HbA1C in estimating glycemic control in HD patients principle of treatment of DN is based on tight control of
with diabetes.While GA/HbA1c ratio symmetrical with hyperglycemia.
Inaba et al., (8) who recorded that GA/HbA1c ratio was
(2.9) in diabetic patients group and it raised significantly Ethical Clearance: In this study all patients
in the HD patients with diabetes was (3.81). provided written informed consent before participation
Medico-legal Update, January-March 2021, Vol. 21, No. 1 865
in this study, which was approved by institutional ethics the American Society of Nephrology. 2007 Mar
committees (university of Anbar\ ethical approval 1;18(3):896-903.
committee). 9. Lin YC, Lin YC, Chen HH, Chen TW, Hsu CC, Wu
MS. Determinant effects of average fasting plasma
Source of Funding: Self.
glucose on mortality in diabetic end-stage renal
Conflict of Interest: Nil disease patients on maintenance hemodialysis.
Kidney international reports. 2017 Jan 1;2(1):18-
References 26.
1. Freitas PA, Ehlert LR, Camargo JL. Glycated 10. Khalaf DT. Evaluation of Heat Shock Protein 60
albumin: a potential biomarker in diabetes. and its autoantibodies in Patients with Diabetes
Archives of endocrinology and metabolism. 2017 Mellitus Type1. M.Sc. Thesis. College of Education
Jun;61(3):296-304. for Pure Sciences. University of Anbar. Iraq.2018.
2. George SV, Pullockara JK, Kumar SS, Mukkadan 11. Abid Hammed SM. Study of Relationship between
JK. A study to assess changes in the hematological Several Interleukins and Some Biochemical
profile in chronic kidney disease. The Pharma Parameters in Type II Diabetics Patients. Ph. Thesis.
Innovation. 2015 Aug 1;4(6, Part A):1. College of Science, University of Anbar.2019
3. Lu CL, Ma WY, Lin YF, Shyu JF, Wang YH, 12. Abdul Hadi FS, Sultan AS. The effects of type
Liu YM, Wu CC, Lu KC. Glycated albumin 2 diabetes mellitus on the levels of glycated
predicts long-term survival in patients undergoing hemoglobin, testosterone, leptin and calcium in
hemodialysis. International journal of medical Iraqi male patients. GJBB. 2016;5(2):164-70.
sciences. 2016;13(5):395. 13. Moulani MR, Gawali PS. Effect of Iron deficiency
4. Gan T, Liu X, Xu G. Glycated albumin versus on glycation of hemoglobin in non diabetics. Annals
HbA1c in the evaluation of glycemic control of Clinical Chemistry and Laboratory Medicine.
in patients with diabetes and CKD. Kidney 2016;2(2):4-7.
International Reports. 2018 May 1;3(3):542-54. 14. Chen CW, Drechsler C, Suntharalingam P,
5. Kim IY, Kim MJ, Lee DW, Lee SB, Rhee H, Karumanchi SA, Wanner C, Berg AH. High
Song SH, Seong EY, Kwak IS. Glycated albumin glycated albumin and mortality in persons with
is a more accurate glycaemic indicator than diabetes mellitus on hemodialysis. Clinical
haemoglobin A1c in diabetic patients with pre‐ chemistry. 2017 Feb 1;63(2):477-85.
dialysis chronic kidney disease. Nephrology. 2015 15. Fukami K, Shibata R, Nakayama H, Yamada
Oct;20(10):715-20. K, Okuda S, Koga M. Serum albumin-adjusted
6. Nuttall FQ. Diabetes Care. 1998; 21:1475-1480. glycated albumin is a better indicator of glycaemic
control in diabetic patients with end-stage renal
7. Young DS. Effects of drugs on clinical laboratory
disease not on haemodialysis. Annals of Clinical
tests, 5th ed AACC press. 2005.
Biochemistry. 2015 Jul;52(4):488-96.
8. Inaba M, Okuno S, Kumeda Y, Yamada S, Imanishi
16. Zaman SB, Hossain N, Rahman AE, Islam
Y, Tabata T, Okamura M, Okada S, Yamakawa T,
SM. Can glycated hemoglobin act as a reliable
Ishimura E, Nishizawa Y. Glycated albumin is a
glycemic indicator in patients with diabetic chronic
better glycemic indicator than glycated hemoglobin
kidney disease? evidence from the Northeast of
values in hemodialysis patients with diabetes: effect
Thailand. Medical Journal of Indonesia. 2017 Aug
of anemia and erythropoietin injection. Journal of
18;26(2):102-8.
866 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2426
S.M. Krishna Sagar1, Divya Reddy Pannala2, K.V. Ramanamurthy3, K. Rajender Kumar4
1
Assistant Professor, Department of Forensic Medicine, Mahavir Institute of Medical Sciences, Vikarabad,
2
Assistant Professor, Department of Forensic Medicine, RVM Institute of Medical Sciences, Siddipet, 3Professor,
Department of Forensic Medicine, Osmania Medical College, Hyderabad, 4Professor & Head, Department of
Forensic Medicine, Gandhi Medical College, Secunderabad
Abstract
Background: In India, from the past two decades, along with urbanization, industrialization, population
explosion and migration of people, there has also been rapid growth in the field of road transportation. Cons
of this can be seen in the form of increased deaths due to RTA.
Method: We conducted a cross sectional studyin department of forensic medicine, Gandhi Medical College,
Hyderabad including all cases of accidental deaths due to two-wheeler, aged above 6 years between October
2014 to May 2016.
Results: Majority cases were in the age group of 21-30 years, 27 (25.7%) and males 89(84.8%). Majority
victims encountered accident due to skid 40(38.1%) and head on collision being common 50(47.6%). Linear
fracture of vault was found in almost half cases, 53(50.5%). Subdural and subarachnoid haemorrhage were
the most common one we encountered.
Conclusions: Males in productive age group encountered fatal RTA and also linear fracture, SDH and SAH
were common pattern of injury seen in them. Stringent laws and awareness have to be created to reduce the
fatalities.
Keywords: Head injury, road traffic accident, two-wheeler, skull fracture, intra cranial haemorrhage.
In this study most of the cases used with gear was self-fall, 40(38.1%) due to skid and when accident
vehicles, 75(71.4%) and were riding 94(89.5%) them was due to vehicle, then it was mostly two-wheeler, 27
at the time of accident. The major cause of accident (25.7%) and the collision was head on,50 (47.6%).
868 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2 Type of skull fracture due to head injury intracranial haemorrhages, a combination of SDH
and SAH accounted for 42(40%) cases followed by
Variable Number (n) Percentage (%) combination of SAH and ICH 20 (19%) cases and SDH
Linear 53 50.5% alone accounting for 16 (15%) cases, 7 (6.6%) cases
Depressed 9 8.6% were SAH, 4(3.8%) ICH, 2 (1.9%) EDH and rest of the
Compressed 8 7.6%
cases, there were multiple combination of intracranial
lesions.
Crush 3 2.9%
Compressed & depressed 8 7.6% [Depicted in Table-2,3 and Figure-1,2]
Linear & compressed 1 1.0%
Operated 7 6.7%
Nil 16 15.2%
Abstract
Background: To assess the relationship of alcohol abuse in maxillofacial trauma in a tertiary care hospital,
Puducherry, South India.
Materials and Method: A descriptive cross sectional study was done by retrieving the patient’s inpatient
and operative records from the year 2011 to 2018. The parameters that were assessed includes association of
the alcohol during injury, etiology, demographic data and the type of fracture.
Conclusion: The descriptive analysis of the facial fractures in Puducherry, INDIA provides an insight in to
type of facial fractures and their etiology recorded in patients with alcohol abuse during injury. These kinds
of studies in the particular geographical region are important in developing prevention strategies.
Fig :3 Frequency-Etiology
874 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Age Group
Total Chi
Etiology ≤20 21-30 31-40 41-50 51-60 >60 P Value
Square
N % N % N % N % N % N % N %
Assault 4 44.4 3 9.1 2 8.3 5 20.8 0 0.0 0 0.0 14 14.0
RTA 4 44.4 19 57.6 16 66.7 14 58.3 5 62.5 2 100.0 60 60.0 13.036 0.222
Self fall 1 11.1 11 33.3 6 25.0 5 20.8 3 37.5 0 0.0 26 26.0
Age Group
Total Chi P
Etiology ≤20 21-30 31-40 41-50 51-60 >60
Square Value
N % N % N % N % N % N % N %
Angle Mandible 3 33.3 8 24.2 5 20.8 5 20.8 1 12.5 0 0.0 22 22.0
Body Mandible 1 11.1 4 12.1 4 16.7 2 8.3 1 12.5 0 0.0 12 12.0
Condyle Mandible 3 33.3 4 12.1 2 8.3 4 16.7 1 12.5 0 0.0 14 14.0
Para symphysis
0 0.0 6 18.2 1 4.2 0 0.0 0 0.0 1 50.0 8 8.0
Mandible
Symphysis
0 0.0 0 0.0 0 0.0 3 12.5 0 0.0 1 50.0 4 4.0 66.707 0.019
Mandible
Lefort I Maxilla 1 11.1 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1 1.0
Lefort II Maxilla 0 0.0 0 0.0 0 0.0 1 4.2 1 12.5 0 0.0 2 2.0
Lefort III Maxilla 0 0.0 1 3.0 0 0.0 0 0.0 0 0.0 0 0.0 1 1.0
Zygoma 1 11.1 2 6.1 2 8.3 5 20.8 0 0.0 0 0.0 10 10.0
Zygomatic arch 0 0.0 8 24.2 10 41.7 4 16.7 4 50.0 0 0.0 26 26.0
Medico-legal Update, January-March 2021, Vol. 21, No. 1 875
Table 4: Association between type of fracture and etiology
Etiology
Total Chi P
Type of fracture Assault RTA Self fall
Square Value
N % N % N % N %
Angle Mandible 8 57.1 11 18.3 3 11.5 22 22.0
Body Mandible 2 14.3 5 8.3 5 19.2 12 12.0
Condyle Mandible 0 0.0 12 20.0 2 7.7 14 14.0
Parasymphysis Mandible 1 7.1 6 10.0 1 3.8 8 8.0
Symphysis Mandible 0 0.0 3 5.0 1 3.8 4 4.0
29.877 0.039
Lefort I Maxilla 0 0.0 0 0.0 1 3.8 1 1.0
Lefort II Maxilla 0 0.0 2 3.3 0 0.0 2 2.0
Lefort III Maxilla 0 0.0 1 1.7 0 0.0 1 1.0
Zygoma 2 14.3 7 11.7 1 3.8 10 10.0
Zygomatic Arch 1 7.1 13 21.7 12 46.2 26 26.0
Frequencies of different parameters assessed (table (table-3) revealed that this particular age group had
-1) shows males at the age group of 21 to 30 years fracture Mandible more commonly than fracture
suffered maxillofacial injuries under the influence Zygoma.
of alcohol. RTA was the most common etiology and
Mandibular fracture is the commonest type of fracture Further, the association between the etiology and
encountered. the type of fracture (table-4) revealed that most of the
RTA resulted in fracture Mandible followed by fracture
On assessment of age distribution (fig-1)it reveals Zygoma.
that the most vulnerable age group is 21 to 30 years
followed by 31 to 40 yrs and 41 to 50 years with equal Discussion:
frequency. Males (94%) suffered maxillofacial trauma Alcohol drinking is a severe socio economic issue in
under the influence of alcohol in a larger proportion India. Consumption of alcohol small amounts every day,
compared to females (fig-2). RTA is the most common drinking alcohol 6 hrs before driving, binge drinking
etiology followed by self fall and then assault (fig-3). everyday or occasionally in a week all leads to RTA6.
On assessment of type of fracture (fig-4), the most RTA is the major etiology of maxillofacial trauma in
common fracture encountered were fracture Mandible developing countries like India7. Alcohol abuse and its
(symphysis,parasymphysis,angle,body,ramus and relationship to trauma had reached massive proportions8.
condyle of the mandible). Mandibular fracture (60%) Alcohol with blood levels 0.04 g/dl can hinder in
was followed by fracture zygoma (36%) (zygomatico patients decision making and does not make them to
maxillary complex and the zygomatic arch). In realise the foreseen danger, 0.05g/dl increases the risk
mandibular fracture the common subtype encountered by 1.83% and affects treatment and prognosis in RTA
was angle of the mandible followed by mandibular management9,10,11. In India alcohol breath testing is done
condyle. randomly on susceptible drivers in police checkpoints.
On analysis of the association between the Alcohol breathe testing and alcohol blood testing is done
parameters such as age and the etiology of trauma under on crash drivers in the hospitals but a clear data on this
the influence of alcohol (table-2), the most vulnerable is lacking. Thailand is the only south East Asian country
age group being 21 to 30 years and they succumbed to to enforce special blood alcohol concentration limit 12.
RTA was elicited. Alcohol interferes with neuro transmission and the
Association between the commonest types of function of brain receptors13. This decrease in function
fracture in the vulnerable age group of 21 to 30 years makes people fearless and less bothered about legal or
876 Medico-legal Update, January-March 2021, Vol. 21, No. 1
health implications14. Alcohol consumption reduces References
cognitive behaviour and reduces a person’s problem
1. Pal R, Ghosh A, Kumar R, Galwankar S, Paul
solving ability in a conflicting situation. Further it causes
SK, Pal S, Sinha D, Jaiswal A K, Moscote-Salazar
increase in aggressiveness and increases emotional
LR, Agrawal A. Public health crisis of road traffic
responses15-18. Adeyoma et al19 recorded that 90% of
accidents in India: Risk factor assessment and
fatalities in developing countries were because of RTA
recommendations on prevention on the behalf
under alcohol abuse.
of the Academy of Family Physicians of India. J
Use of restraints such as helmets and seat belts is Family Med Prim Care 2019;8:775-83.
of paramount importance in preventing maxillofacial 2. Jaiswal AK, Krishna S, Agarwal A, Ghosh A, Pal
trauma. Bekal et al20 recorded that the incidence of R. Alcohol and road safety: Investigation and legal
maxillofacial trauma increased due to non utilisation aspects. Al Ameen J Med Sci 2018;11:154-60.
of restraining devices in and around Bengaluru, India. 3. Pal R, Agarwal A, Galwankar S, Swaroop M,
Helmets are not gender specific. In India a common Stawicki SP, Rajaram L, et al. The 2014 Academic
misconception is that full facial helmets are meant for College of Emergency Experts in India’s INDO-
males and semi helmets are meant for females. This US Joint Working Group (JWG) White Paper on
renders most of the females vulnerable to facial fractures. “Developing Trauma Sciences and Injury Care in
Although use of restraints such as helmets and seat belts India.” Int J Crit Illn Inj Sci 2014;4:114-30.
are mandatory in any part of India, the compliance is
4. Pal R. Injury science in India: Call for the action.
less. Bekal et al20 and Pandey et al21 recorded maxillo
Indian J Prev Soc Med 2012;43:229-32
facial fractures in RTA because of not wearing helmets
or not wearing seat belts. 5. HO. Report of the Committee on Road Safety
and Traffic Management, The Secretariat for the
In our study males were commonly affected than Committee on Infrastructure Planning Commission,
females which are in concurrence with most of the studies Government of India [online] Available from:
published from India22,23. Puducherry city, capital of the www.infrastructure.gov.in.
union territory is a former French colony and a major 6. Watt K, Purdie DM, Roche AM, McClure RJ.
tourist attraction. The city attracts lots of tourists and Risk of injury from acute alcohol consumption
workers from adjoining rural area. The main modes of and the influence of confounders. Addiction 2004;
transportation are two wheelers and hence the recorded 99:1262–73
maxillofacial trauma was high in males as males are the
7. Karne M, Mishra S, Ashish T, et al. Study of
earning members in developing country like India. We
pattern of injuries by road traffic accident on
recorded maxillofacial trauma in six females who were
National Highway-24. International Journal of
pillion riders without use of helmets or wearing semi
Contemporary Surgery 2017;5:37-41.
helmets under the influence of alcohol.
8. Rehm J, Gmel G, Sempos CT, et al. Alcohol-related
Mandible is the most common fracture encountered morbidity and mortality. Alcohol Res Health
in this region (60%). This can be explained by the fact 2003;27(1):39-51.
that most of the injuries are due to RTA involving 9. Gururaj G. Alcohol and road traffic injuries in South
motorised two wheelers without the use of helmets. Asia: Challenges for prevention. J Coll Physicians
The next common type of fracture being zygoma and Surgeons Pakistan 2004;14:713‑8.
zygomatic arch (36%). The type of fractures recorded
10. Gururaj G. The effect of alcohol on incidence,
were similar to the study recorded by Kapoor et al24.
pattern, severity and outcome from traumatic brain
injury. J Indian Med Assoc 2004;102:157‑60, 163.
Conclusion
11. McLean A, Holubowycz OT. Alcohol and the
The descriptive study, maxillofacial trauma under risk of accident involvement. Alcohol, drugs and
alcohol abuse clearly reveals the association of the trauma traffic safety Proceedings of the 8th International
under the influence of alcohol in and around Puducherry. Conference on Alcohol, Drugs and Traffic Safety,
Use of restraining devices, proper maintenance of faulty Stockholm; 1980:15‑9
roads, rehabilitation of drunk and drive crash drivers to
12 Regional report on status of road safety: WHO
prevent repeated injury are mandatory.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 877
South‑East Asia region. [online] Availabe from: to burden of disease: an overview. Addiction
http://www. searo. who.int/entity/disabilities_ 2003;98:1209–28.
injury_rehabilitation/documents/9789290223559/ 19. Adeyemo WL, Ladeinde AL, Ogunlewe MO, et al.
en Trends and characteristics of oral and maxillofacial
13. Pihl RO, Peterson JB, Lau MA. A biosocial model injuries in Nigeria: a review of the literature. Head
of the alcohol aggression relationship. J Stud Face Med 2005;1:7
Alcohol Suppl 1993;11:128–39 20. Bekal M, Brijesh K, Suresha KR. Retrospective
14. Pihl RO, Hoaken PN. Biological bases of addiction analysis of the effect of alcohol abuse and restraining
and aggression in close relationships. In: Wekerle device on maxillofacial injury- a study of 225 cases.
C, Wall AM, editors. The violence and addiction J. Evolution Med. Dent. Sci. 2019;8(47):3526-30
equation: theoretical and clinical issues in 21. Pandey S, Roychoudhury A, Bhutia O, et al. Study
substance abuse and relationship violence. New of the pattern of maxillofacial fractures seen at a
York: Brunner-Routledge; 2001. p. 25–43. tertiary care hospital in North India. J Maxillofac
15. Peterson JB, Rothfleisch J, Zelazo P, Pihl RO. Oral Surg 2015;14(1):32-9
Acute intoxication and cognitive functioning. J 22. Shankar AN, Shankar VN, Hegde N, et al. The
Stud Alcohol 1990;51:114–22. pattern of the maxillofacial fractures-a multicenter
16. Sayette MA, Wilson GT, Elias MJ. Alcohol, retrospective study. J Craniomaxillofac Surg 2012;
aggression: a social information processing 40(8):675-9
analysis. J Stud Alcohol 1993;54:399–407. 23. Gupta R, Suryanarayan S, Sharma A, et al.
17. Pliner P, Cappell H. Modification of affective Traumatic mandibular fractures: pendulum towards
consequences of alcohol: a comparison of social and closed reduction. The World Articles in Ear, Nose
solitary drinking. J Abnorm Psychol 1974;83:418– and Throat 2010;3:1-3
25. 24. Kapoor P, Kalra N. A retrospective analysis of
18. Rhem J, Room R, Graham K, Monteiro M, Gmel maxillofacial injuries in patients reporting at a
G, Sempos CT. The relationship of average volume tertiary care hospital in East Delhi. Int J Crit Iln Inj
of alcohol consumption and patterns of drinking Sci 2012;2(1):6-10
878 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2428
Sahar A.H. AL-Sharqi1, Amal Kadhem Chaloob2, Ilham Abd Allah Ali Al-Saleem3
1
Assistant Professor, Department of Biology, College of Science, Mustansiriyah University, Baghdad/Iraq,
2
Assistant Professor, Department of Basic Science, College of Dentistry, Mustansiriyah University, Baghdad/Iraq,
3Lecturer, Department of Biology, College of Science, Al-Mosul University, Mosul/Iraq
Abstract
Gestational diabetes mellitus (GDM) constitutes carbohydrate metabolism disorders that lead to severe and
sometimes life-threatening complications of pregnancy.
Materials and Method: 40 placenta biopsies with blood samples were taken from gestational diabetic
pregnant women and 20 placenta biopsies with blood samples were taken from healthy pregnant women,
the tissues were fixed,processed, embedded and cutting separately depending on procedure for enzyme
histochemical and routine histological technique and the bloodwas centrifuged.
Results: The histological changes inthe GDM group represented by villous oedema in approximately (30%)
of the GDM group, an excessive amount of collagen fibres in the villous stroma (57.5%). Syncytial knots
were formed (70 %) in addition to an excessive number of cytotrophoblast cells in about (65 %). The stromal
fibrinoid deposition was noticed in (52.5 %). Hypo-vascular villi are seen in (32.5%) also, atherosis of the
uteroplacental arteries in (40%) of biopsies. In enzyme histochemistry, the villous stroma of the GDM
grouphas a strong reaction to the G-6-P enzyme. There is a significant increase (p<0.05) in serum blood
sugar, cholesterol, blood urea in the GDM group when compared with the normoglycemic group.
Conclusions: The increment of serum blood sugar caused histologicaland enzyme histochemical alteration
during pregnancies.
On the other hand, an excessive amount of collagen confirm that one of indicator of placentae tissue of
fibres in the stroma of the villi was easily demonstrated, GDMpregnant is cytotrophoblast cells proliferation6.
stromal fibrosis was observed in 2 placentae (10%)
of the normoglycemic group, but increased up to 23 Stromal fibrinoid deposition affecting of the villi
placentae (57.5%) from GDM group, (Fig. 2B). This was observed in the normoglycemic group 4 placenta
results matchedwith other studies that observeda (20 %). Although it was found in 21 placentae (52.5 %)
histological change in GDMplacentae represented by in placentae obtained from the GDM group, (Fig. 2D).
stromal fibrosis6 Another study confirmsthat the morphological feature
ofvillous tissue in GDM of women is fibrin deposite13.
Syncytial knots were formed in more than one- Hypo-vascular villi are seen in 3 placentae (15%) of
third of the examined villi, in 28 placentae (70 %) the normoglycemic group and 13 placentae (32.5%) of
from the GDM group. However, this deviation from the GDM group, (Fig. 2E).Astudy on placentae tissue
the normoglycemic group was noticed only in 4 in hyperglycemic pregnancy noticed alterations in
placentae (20 %) (Fig. 2C).More than previous paper vascularity repeating by surprisingly hypovascular and
observed Syncytial knots in placentae of GDM pregnant these had a smaller diameter and show a wavy course
women6,.13. Immoderate forming Syncytial knotsis a compared with normal villi.16Also, atherosis of the
relationship with placental pathology, and a knotting uteroplacental arteries appears as multiple foamy cells
indicator is employed to estimateriskiness.14 within the walls of the vessels. It was seen only in one
placenta from the normoglycemic group (5%), and in 16
In GDM group cases an excessive number of placentae (40%) from the GDM group, (Fig. 2F).Astudy
cytotrophoblast cells have been frequently observed. found that placental atherosclerosis occurred in 28.94%
This change was observed in the normoglycemic of the group with GDM compared to 10.52% of the
group in only 2 placentae (10 %), in the GDM group group with normoglycemicpregnancy17.
in 26 placentae (65 %). El Sawy etal6 and other study15
Histological finding Normoglycemic group n=20 (%) GDM group n=40 (%) P-Value
Villous edema 0 (0 %) 12 (30 %) 0.01
Stromal fibrosis 2 (10 %) 23 (57.5 %) 0.01
Syncytial knots 4 (20 %) 28 (70 %) 0.01
Medico-legal Update, January-March 2021, Vol. 21, No. 1 881
Histological finding Normoglycemic group n=20 (%) GDM group n=40 (%) P-Value
Cytotrophoblastic cell hyperplasia 2 (10 %) 26 (65 %) 0.01
Fibrinoid deposition 4 (20 %) 21 (52.5 %) 0.01
Hypo-vascular villi 3 (15 %) 13 (32.5 %) 0.01
Atherosis of uteroplacental vessels 1 (5 %) 16 (40 %) 0.01
Figure (2): Light microscopical appearance of GDM placenta showing, (A):Villous oedema (B):stromal
fibrosis (red arrows), (C):Syncytial knots (red arrows), (D):Fibrinoid deposition (black arrows), (E):Hypo-
vascular villi (red arrows), (F):Atherosis of uteroplacental vessels (A & B:H & E X10).
Figure (3): The light microscopical appearance of placental tissue: A & B obtained from normoglycemic
showing a weak reaction to the G-6-Pase (arrows), C & D: strong reaction to the G-6-Pase in
syncytiotrophoblast (red arrows) and cytotrophoblast cells, E & F: moderate reaction to the G-6-Pase, in
placenta GDM(G-6-Pase, X10).
C-Biochemical study: The serum level of glucose in carbohydrate metabolism during pregnancy lead to
for both healthy pregnant women and GDM pregnancy many complications for the mother 25.
is shown in (Table -2). A significant (p<0.05) increase
is found in the mean value of the glucose in GDM While the serum cholesterol level is found to be
pregnancy (173.82±2.47mg/dl) compared with that of significantly (p<0.05) increased in the mean of GDM
the healthy pregnancy (84.04±2.3mg/dl). pregnancy when compared with that of a healthy
pregnancy. Table (2) showed the mean of GDM
High glucose or diabetes during pregnancy may pregnancy to be (224.50±7.68 mg/dl), while in a healthy
be caused by a decrease or resistance to the hormone pregnancy is (184.80±4.34 mg/dl). The increase of total
insulin by placenta hormones such as progesterone or cholesterol level in the serum of women with GDM in the
human placental lactogen, or as a result of the increase in current study supports the results study of Quinlivan and
the secretion of the hormone cortisol that occurs during Lam26, and its rise can be attributed to the occurrence of
pregnancy (22,23). Jansson et al24 showed that the high a disorder of fat metabolism ((Dyslipidemia) as a result
level of glucose from its normal level leads to an increase of the disease27. Several studies have shown approaches
in its transmission to the placenta. Also, the imbalances during the and beyond the pregnancy, adverse metabolic
consequences of diabetes28.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 883
Recently, the high levels of cholesterol can cause the other hand, kidney disease may increase the risk of
atherosclerosis,research has shown that low density (DM), including urea or other uraemic elements 32,33.
lipoprotein cholestrol LDL-C is not the only type of Our result showed the level of serum urea shows an
cholesterol that increases the risk of atherosclerosis, increase in GDM pregnancy as compared with a healthy
and that any non-HDL-C cholesterol, such as very- pregnancy, (Table 2). The mean value of serum urea in
low-density lipoprotein cholesterol (VLDL-C) and GDM pregnancy is found to be (28.12±1.06 mg/dl), and
apolipoprotein B, that increase that risk 29. Study of in a healthy pregnancy is (21.5±1.2 mg/dl). Statistically,
Ryckman et al.30 found that women with previous GDM there is a significant (p<0.05) difference between the two
Insulin resistance elevate the VLDL-C abnormalities groups.
contained in non-high-density lipoprotein cholesterol
(HDL-C) along with (LDL-C) and lipoprotein of This result is consistent with many researchers who
intermediate density. indicated that the GDM condition leads to a rise in the
level of urea in the blood serum, and this rise is due to
Recently, blood urea has been documented to be the physiological change as a result of the pathological
associated with diabetes mellitus(DM), commonly condition which leads to a decrease in the rate of
regarded as one of the markers of kidney functions 31. glomerular filtration rate (GFR). This causes a rise in the
On the one hand, (DM)cause kidney disease, and on level of urea in the blood serum 34,35.
Table 2: Serum Glucose, Cholesterol and Urea level in GDM and Normoglycemic women.
Abstract
This study aimed at assessing patient’s satisfaction with new optimized conventional complete upper and
lower dentures as compared to their previous problematic conventional dentures. A random sample of
patients was selected (group 1). Each patient was provided with new optimized conventional upper and lower
dentures (group 2), then a subset who were not satisfied with the optimized lower prostheses were provided
with two implant-retained lower over-dentures (group 3). Self-assessment questionnaires were voluntarily
filled by the participants. Male-female differences were assessed using the two independent samples t-test.
Inter-group differences were evaluated using the two dependent samples t-test. Significant differences were
found between sexes in group 2, but not in group 3, in the direction of females being less satisfied than males
especially with the lower denture, and between the groups in a number of variables in the direction of more
satisfaction with the lower dentures among group 3 as compared to group 2. Meanwhile, group 2 and 3 were
found to be equally satisfied with the upper denture.
Keywords: Patient’s satisfaction; conventional complete denture; optimized conventional complete denture;
two implant retained lower over-denture; atrophic edentulous mandibular ridge
It was found that the average degree of abstinence Median scores for the following variables: pain
from wearing upper dentures was zero in groups 2 and 3. from wearing a lower denture, slipping of the lower
denture while eating, problems with speech, chewing
Average scores were found for the following problems, and a denture being considered a foreign body
variables: abstinence from wearing lower dentures, were significantly higher among Group 2 compared to
refusal to participate in social activities, and negative Group 3.
<3
Illiterate (5) < 5 yrs (3) Upper Lower (10) GP (25) No post-dam (5)
sets
Peripheral
>3
School (15) 5-10 yrs (7) Well-developed (28) - (20) DT (5) Under-extended
sets
(15)
College (7) 10-15 yrs (15) Moderately resorped (2) (10) - - Centric off (5)
University (3) > 15 yrs (5) Severely resorped - (20)
Table 2: Response to questions concerning oral functions of dentures before and after treatment.
Abstract
Due to their popular uses, Salvadora persica (Miswak) plant possesses several bioactive effects and it is
important to focus on their valuable effectiveness, especially on dental and oral health. The present review
deals with many sections to obtain suitable knowledge about miswak such as chemical compositions,
bioactivity, partitioning of active materials, method of obtaining miswak extract and the potent of this plant on
dental and oral health according to their antioxidant, antifungal, antibacterial, antimicrobial, antiphlogistic,
antimycotic, anticarcinogenic, anticandidal, anti-inflammatory and anti-plaque properties.
O
H S
O
H O
Salvadoside
O- N
a +
O
H
O
O
O
H
O
O O
H O
O
S
O
H O
O H
O O
O
O S H
O H
O
O Salvadosaside
O O
H
H
O
H
C 3
O
H3C
O H
C 3
O
H3C
H3C
H
O
Sitosterol
H H
Salvdorin
H3C H
H
O
O
O
H O O
H
O
H
O O
H
Quercetin
H
O O
H H
C O
2
H
C H
H
O O O
H Ascorbic acid
Protein-SH
Protein -SOH
H2O
D-glucose
hypothiocyanite
thiocyanate glucose
active antiviral oxidase
hydrogen peroxide
or antibacterial
products
Lactoperoxidase
iodide D-gluconic acid
hypoiodite
Figure 2. Antimicrobial products mechanism.
896 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Nitrogen organic and inorganic components may or nitrate). This replacement is with important influence
be presented in any plant parts that may converted to because chloride accumulation causes salt stress and
another different compounds causing various effects toxicity, especially in plants and microbiological
depending upon their chemical structures and other systems(69,70,71).
factors. Oxidation – Reduction of nitrogen compounds
like ammonia, urea, nitrate, nitrite, amino acid, peptide, The essential micronutrient (Cl‑) can be found
protein, … etc. may result in ecosystem antimicrobial in almost biological systems as a consequence of
activity(50,51,52). high solubility of its salts in water towards various
maintaining functions(51,72) such as catalytic protein or
Organic and inorganic nitrogen – sulfur compounds enzyme activator in plant or animal, controlling carbon
in plants varied in their structures and functions in plants dioxide concentration in cell, oxygen role in photosystem
itself or in other biological systems(53,54,55,56,57). II or redox processes, energy production and consuming,
fungicide treatment, and anion : cation balance.
Thiocyanate is one of these active acidic component
found in various biological systems by being a part of Bio- data showed that chloride ion have a noticeable
human or enter human body through daily intake plants cell membrane crossing of different bio-systems and this
or animal products(58). This important metabolism transportation can be done in cooperation with necessary
product utilizes several important actions even with cations and/or anions. This collaboration produces
its low concentration in human tear (150µM), human nitrogen fixation, photosynthesis of organic or inorganic
breast milk (100 nM), while cow milk (170 µM) nitrogen compounds towards effective regulation or
through its bacteriostatic function. Accumulation of it accumulation between acidic and basic compounds or
leads to biological toxicity that can be lowered by renal ions depending on required and/or produced energy for
elimination in human. Thiocyanate- hydrogen peroxide each process. These cooperative processes raise some
system catalyzed by peroxidase enzyme produces the important bio-functions like plant growth and production
antimicrobial agent (hypothiocyanous acid, HOSCN) of active components or macromolecules for example in
that crosses cell wall of bacteria then reacting with plant tissues(70,71,73).
sulfuhydryl (-SH), nitrogen, or selenium containing
material to form (S-S), (S-O), (S-N), or (S-Se) bonds In conclusion, all the mentioned activities of active
giving its antibacterial performance in many sites like components may be performed in the target bio-system
oral cavity and saliva. This HOSCN may inhibit the or its production. So, these organic/inorganic active
growth of oral fungi or echovirus towards improving ingredients varied in their concentrations, extraction
lung role(59,60,61,62,63,64). method, contributions with other ingredients, and
applications. Their roles under question mainly based
In general, thiocyanate is less toxic than cyanide on structure, medium, and target. For example, chloride
(CN‑) and it is eliminated by kidney. This toxicity did plays major role in cell expansion accompanied by other
not prevent researchers from using thiocyanate as an ions and organic molecules. Also, biological activity
oral under controlling dose to avoid sensitizing or of any ingredient can be performed through enzyme
suicide cases in Central Nervous, thyroid, skin, or renal catalysis that needs specific anion assistance. So, miswak
system or any related toxicity of SCN- as a metabolite of have different active organic and inorganic compounds
cyanogenic drug, dietary, or smoking(65,66,67). work together to achieve the biological actions.
Chlorine atom in its ionic form is another important Partitioning of the important chemical
micronutrient found in plant parts with biological components in miswak(74): Mohamed et al. (2018)
importance even at low needed concentration(68). It was able to separate the active chemical compounds
controls many activities in plant and other biological of miswak by cutting 1.1 kg of miswak roots to small
systems like electric charge balance, cell osmotic, pieces and treated them with alcoholic solvent (75%
enzyme, ionic, pH, and water regulations that contribute ethanol) by cold socking. After filtration step, the filtrate
in other biological performances such as growth, ion was concentrated under reduced pressure to obtain
– ion interchangeable operation, or disease resistance. brown residue. To the dried extracts, 200 mL distil water
Published articles confirmed that chloride ion can be and 400 mL petroleum ether was added. The upper layer
replaced by other important anions (phosphate, sulfate, (petroleum ether) was introduced into silica gel column
Medico-legal Update, January-March 2021, Vol. 21, No. 1 897
and n-Hexane-Ethyl acetate was used to elute the two solvents. After drying step, the extracts were weighed in
compounds. Fractionation of compounds was carried out DMSO for antibacterial activity purpose(76).
using 5% and 7% acetonitrile in water (H2O:CH3CN).
Compound (3) was eluted by 5% and compound (4) Miswak were cutted into small pieces after washing
eluted by 7%. The aqueous layer was treated with 150 step by distil water and kept 14 days at room temp. to
mL 0.2N HCl and 300ml chloroform and shaken for 16 be full dry. 100 g of dried miswak powder were mixed
hrs. The chloroform layer was subjected to silica gel with either 1L of 95% methanol (as alcoholic solvent) or
column and CHCl3–MeOH was used as elution agent. 1L distil water (as aqueous solvent). Filtration step were
1% MeOH was used to elute compound (2) and 15% carried out using Whatman filter paper no, 1 and then
MeOH is suitable to elute compound (1). the filtrates were concentrated using vacuum evaporator
at 60 oC (for both water and alcoholic solvent). The
Ammonium hydroxide was added to the aqueous extracts stored under -20 oC for the later use(77).
layer until pH reach 11, then 400 mL of chloroform was
added and mixed well. By tap water, roots of miswak were washed and then
(300-400) g in 1500 mL 80% ethanol were dissolved for
Alkaloid Rich Fraction can be obtained by 0.5 hr. at 80 oC. The filtration step was carried out using
chloroform evaporation. After this fraction was subjected cotton wool. To be sure for complete extraction, the
to column of silica gel, 78% MeOH in H2O can elute residue was dissolved again in 1 L of the same solvent
compound (5), while compound (6) can be obtained by for 5 min. using water bath at boiling point degree and
direct crystallization kept overnight to be filtered again by a cotton wool. Both
filterates (step 1 and 2) were mixed and concentrated by
From 1.1 kg of miswak roots, the above partition rotary evaporator at 40 oC. The produced extracts were
process can produce the following amounts: stored at -80oC(78).
8 mg sulphur-containing imidazoline alkaloid After drying the miswak plants for 10 days at room
(persicaline) compound (4). temperature, they were cutted by Omni mixer to small
13mg Benzyl-thiocarbamicacid-O-ethyl ester parts. 20 grams of the dried powder were mixed with
compound (3). 100 mL of deionized water and kept to soak at 4oC for 24
hrs. and then centrifuged at low temperature (4oC) and
30 mg hexadecanoic acid benzylamide then filter the supernatants by very small pore membrane
compound(1). (0.45 μm) membrane. finally, freezedried was carried
out to get dry miswak.
18 mg benzyl isothiocyanate compound(2).
Saleh et al. used different types of solvents such as
21 mg N-benzyl-2-phenylacet- amide compound(5) acetone, ethanol, methanol (all were 80 percent in water)
7 mg Benzylurea compound(6) in addition to distilled water where percent of miswak to
solvent was (1:10, wt/v). After filtration step, the extracts
Literature review of the method of obtaining were concentrated by vacuum evaporator(79).
miswak extract: The collected roots were washed,
dried, and grinded to small size, followed by treating Chevalier (2003) use modified procedure to obtain
with 50% (v/v) ethanol in distill water by mixing the miswak extracts. After cutting the sticks of miswak to
ratio of 1:10 root/solvent in dark space at 25Co for 24 small pieces, food blender was used to ground the pieces
hr, then filter paper (Whatman No. 1442) used to filter to powder. Sterile hot distilled water was added to
the solution twice. The liquid concentrated by vacuum miswak powder with 1:10, wt/v (miswak:water) and left
rotary evaporator at high temp, to get a dark brownish to sock at 37oC for 48 hrs. then the mixture was filtered
miswak extract(75). by 0.45 μm pore filter paper. Drying of the extracts was
established by incubation system at 37oC. The final
Collected miswak were dried at the shade and then extracts were stored at sterilized vials in refrigerator
powdered by grinder to fine particles. Using soxhlet system(80).
extractor, the powder was treated with different solvents
such as methanol, ethanol and the mixture of both Firas et al. used soxhlet extractor to recover
Salvadora persica L. by methanol solvent for 10 hrs.
898 Medico-legal Update, January-March 2021, Vol. 21, No. 1
The experiment still continued until the solvent became Himawan H. etal. observed that Miswakis more
colorless. Rotary vacuum evaporator was used at 40 oC potent than ordinary toothpaste in its ability to reduce
to concentrate the extracts and kept store until use(81). the amount of plaque accumulation in fixed orthodontic.
Two groups (20 patients for each group) were examined,
Darmani et al. mixed 1.5:10 w/v of miswak powder: 95% reduction in the plaque score was recorded when
sterile water for 48 hrs. at 4oC after drying the fresh Miswak is used, against 65% reduction in the ordinary
sticks at room temperature for 2 days, (miswak powder toothpaste(96).
was obtained using ball mill). The treated material was
centrifuged and filtered by 0.45 μm pore filter paper(82). Almas K. studied the effect of miswak and
Chlorahexidine Gluconate (CHX) on the removal
Miswak as potent dental materials: The efficiency of smear layer. He recorded that miswak was
Salvadora persica (the scientific name for Miswa)” more potent than CHX to remove the layer. He also
has great beneficial effects on the oral cavity, like the observed that dentinal tubules were more opened in both
silica and sodium bicarbonate which are constituents etched (periodontal and healthy dentin)(97).
of miswaq,work as abrasive materials, reduce the tooth
stains and improve its whiteness(83). Organic acids are produced due to the fermentation
of sucrose which is metabolized by biofilm bacteria
Plaque and gingivitis usually reduce in Miswak resulting in decrease the plaque pH which causes dental
users due to the “Tannic Acid” which is an astringing caries according to Stephan curve. Lower pH can
material(84,85). demineralize the enamel and cause caries. Because of
Other constituents can protect the tooth enamel strong taste of miswak, rinsing with its extract increases
by a layer of resin, while alkaloid has a bacteriocidal salivary flow and secretion from parotid gland which
effect(86,87), supported by sulfur present in Salvadora leads to raise the pH plaque after half hr. and prevents
persica(88). dental caries(98).
Calculus formation usually inhibited by high Mixture of miswak (3.5%) and monofluorophosphate
concentration of chlorine(87). (0.8 %) enhance significantly the plaque reduction and
improve the gingival index(99,100).
Inhibition of demineralization and promotion
of remineralization is achieved due to the calcium Conclusion
saturation of saliva of Miswak users(89).
Miswak (as chewing sticks) is one of the most
Benzylisothiocyanate (BITC), one of the S. Persica popular important herbs used for good dental health due
root showed a virucidal activity specially against herpes to its active chemical components which are considered
simplex, also it can inhibit the growth of Streptococcus the main keys of the potent bioactive properties that
mutans, as many reports support its fungistatic action relate to its therapeutic characteristics. Miswak is
against Candida albicans(90,91,92). considered (by World Health Organization/WHO) as
a safe tool for healthy tooth. Anti-plaque properties
Depending on significant effects of Miswak extracts of miswak is very significant to prevent dental caries.
against the oral cavity pathogens, it is recommended to Antioxidant, antiphlog- istic, anticarcinogenic, antifun-
use Miswak as a dental hygiene method to prevent tooth gal, antimicrobial, antibacterial, antimycotic, and
caries. anticandidal behaviors of miswak represent the real
reasons of its therapeutic characteristics for oral tooth
High concentrations of Miswak extract
health.
works as good as chemical oral disinfectant (e.g.
Triclosan and chlorhexidine) showing antibacterial Conflict of Interest: Nil
actions(4,89,90,91,92,93,94). Also Alcoholic and aqueous
extract of S. persica showed anticandidal activity(93,95). Sources of Funding: Self-funding.
77. Mohamed S., Ahmed M., Mohamed A., Hany 91. Al-Bagieh NH. Effect of benzylisothiocyanate on
G., and Abduljabbar H., Antibacterial Activity of the growth and acid production of Candida albicans.
Salvadora persica L. (Miswak) Extracts against Biomed Lett. 1998;58:139-145.
Multidrug Resistant Bacterial Clinical Isolates, 92. Al-Bagieh NH, Weinberg ED. Benzylisothiocyanate:
Evid. Based Complementary Altern. Med. 2016:1- a possible agent for controlling dental caries.
5. Microb Lett. 1998; 39:143-151.
78. Mohamed M, Abdul Aziz A, Ibrahim A, Ali A, 93. Al-Bagieh NH, Idowu A, Salako NO. Effect of
Mostafa E, EL-Gaaly G, Assessment of antioxidant aqueous extract of miswak on the in vitro growth of
activities in roots of Miswak (Salvadora persica) Candida albicans. Microbios Lett. 1994; (80) 107-
plants grown at two different locations in Saudi 113.
Arabia Saudi. Res J Biol Sci. 2015: 22, 168–175. 94. Ali H, Konig CM, Khalid SA. Evaluation of
79. Saleh A,Jalaluddin A. Antioxidant capacity of selected Sudanese medicinal plants for their in vitro
chewing stick miswak Salvadora persica. BMC activity against hemoflagellates selected bacteria,
Complement Altern Med. 2013,13:40. HIV-1-RT and tyrosine kinase inhibitory, and for
80. Kadhum S, Sabah N, Mauyad S. Antifungal cytotoxicity. J. Ethnopharmacol. 2002;83:219-228.
efficiency of Miswak & Cardamom Extract on 95. Deborah K, Mecky I., Olipa D, Cosam C, and
Some Virulence Factors of Candida albicans as Zakaria H. Screening of Tanzanian medi- cinal
Oral Pathogen.Biolo J Kufa univ. 2011; 3(2): 1-7. plants for anti-Candida activity, BMC Complement
81. Firas A, Khudir D. In Vitro Antimicrobial Activity Dent pract. 2006;6:11, 1-10
of Salvadora persica L. Extracts Against Some 96. Himawan H, Talitha A. The effectiviveness of
Isolated Oral Pathogens in Iraq. Turk J Biol. using siwak toothpaste on plaque acuumalation in
2008;32:57-62 fixed orthodontic applications users. Asian J Pharm
Medico-legal Update, January-March 2021, Vol. 21, No. 1 903
Clin Res. 2020;13(3):113-115. 99. Stafa M., Sadek S. The efficacy of Miswak
97. Khalid A. The Effect of Salvadora Persica Extract concentrate, tooth paste: I. Clinical report, Egypt
(Miswak) and Chlorahexidine Gluconate on Human Dent J. 1987;33;75-84
Dentin: A SEM Study. J. Contemp. Dent. Pract. . 100. Walter H, Lewis, Memory P.F. Elvin-Lewis,
2002;3(3);1-10. Medical Botany: Plants Affecting Human Health,
98. Sote E. The relative effectiveness of chewing sticks 2nd ed., Willey, page 412, 2003.
and toothbrush on plaque rem- oval. Afr Dent
J.1987;1:48–53.
904 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2431
M.B.Ch.B, D.M, F.I.B.M.S (Internal Medicine), F.I.B.M.S (Gastroenterology & Hepatology), Lecturer, Iraq/
University of Kufa/College of Medicine, 2M.B.Ch.B, F.I.B.M.S (Family Medicine), Family Physician Specialist,
Iraq/Ministry of Health/Najaf Health Circle
Abstract
Background: Celiac disease is characterized by small intestinal malabsorption of nutrients after the ingestion
of wheat gluten or related proteins from rye and barley, villus atrophy of the small intestinal mucosa, prompt
clinical and histologic improvement following strict adherence to a gluten-free diet, and relapse when gluten
is retaken.
Aim of the Study: Evaluation of patients seeking gastroenterology and hepatology teaching hospital/medical
city/Baghdad with suspected celiac disease regarding serological investigation, histological findings and
genetic testing, to determine sensitivity, specificity, positive predictive value and negative predictive value
for every test.
Patients and Method: The study is a cross sectional descriptive analytic study conducted at the teaching
hospital of gastroenterology and hepatology/Baghdad/Iraq during a period from the 1st of February 2018 to
the 1st of April 2019. After thorough history and Clinical examination patients with suspected celiac disease
were sent for serological investigation (TTG IgA and IgG), (antigliadin IgA and IgG), all patients were sent
for endoscopic examination for duodenal biopsies with subsequent histological assessment. Patients who
failed to be confirmed (positive serology and negative histology or vice versa) were sent either for HLA
genotyping or for IgG Deaminated gliadin peptide. Sensitivity & specificity were measured for each test.
Results: A total of 140 suspected celiac disease patients involved in this study. Mean age was 18.9 years
and ranged from 2 years to 60 years. Male represented 36.4% of the cases while female represented 63.6%.
Only 19 patients show positive family history of celiac disease (13.6 %). Regarding associated autoimmune
diseases, the majority (111 patients) have no associated diseases (79.3%) while the other patients who have
associations most of them show positive association with type 1 DM (16.4%).
Fifty patients (35.7%) presented with short stature, (25.7%) came with diarrhea. The other symptoms vary
between bloating and distention, unexplained anemia and weight loss. Constipation was seen in one patient.
tTG IgA and tTG IgG showed high sensitivity, specificity, positive predictive value and negative predictive
value while antigliadin antibody failed to show these significant results.
Histology
Marsh 2, 3a,3b and 3c Marsh 0,1
Sensitivity 93.3 %
Positive 84 2
Specificity 96 %
TTG IgA
Positive predictive value 97.6 %
Negative 6 48
Negative predictive value 88.8 %
tTG IgG Serology: From patients with marsh 0 or From the patients who were found to be marsh 2 or
1 only 4 patients tested positive for TTG IgG so some 3, 85 patients tested positive for TTG IgG (true positives)
of those was sent for IgG DGP and another for HLA while only 5 patients tested negative and those was sent
and the results was negative and so they are regarded as for IgG DGP or HLA and the results were positive and
(false positives) while 46 patients tested negative (true so they are regarded as (false negatives). From these
negatives). results we concluded that sensitivity, specificity, PPV
and NPV of TTG IgG were 94.4%, 92%, 95.5% and
90.1% respectively (Table 2).
Histology
Marsh 2, 3a,3b and 3c Marsh 0,1
Sensitivity 94.4 %
Positive 85 4
Specificity 92 %
TTG IgG
Positive predictive value 95.5 %
Negative 5 46
Negative predictive value 90.1 %
Antigliadin IgA Serology: From the patients who positives) while 57 patients tested negative those was
were found to be marsh 0 or 1, 13 patients tested positive sent for IgG DGP or HLA and the results were positive
for antigliadin IgA those was sent for IgG DGP or HLA and so they are regarded as (false negatives). From these
and the results was negative and so they are regarded as results we concluded that sensitivity, specificity, PPV
(false positives) while 37 patients tested negative (true and NPV of antigliadin IgA were 36.6%, 74%, 71.7%
negatives). From the patients who were found to be marsh and 39.3% respectively (Table 3).
2 or 3, 33 patients tested positive for antigliadin IgA (true
908 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 3: Sensitivity, specificity, PPV and NPV of antigliadin IgA
Histology
Marsh 2, 3a,3b and 3c Marsh 0,1
Sensitivity 36.6 %
Positive 33 13
Specificity 74 %
Antigliadin IgA
Positive predictive value 71.7 %
Negative 57 37
Negative predictive value 39.3 %
Antigliadin IgG Serology: From the patients who positives) while 68 patients tested negative those was
were found to be marsh 0 or 1, 7 patients tested positive sent for IgG DGP or HLA and the results were positive
for antigliadin IgG those was sent for IgG DGP or HLA and so they are regarded as (false negatives). From these
and the results was negative and so they are regarded as results we concluded that sensitivity, specificity, PPV
(false positives) while 43 patients tested negative (true and NPV of antigliadin IgG were 24.4%, 86%, 75.8%
negatives). From the patients who were found to be marsh and 38.7% respectively (Table 4).
2 or 3, 22 patients tested positive for antigliadin IgG (true
Histology
Marsh 2, 3a,3b and 3c Marsh 0,1
Sensitivity 24.4 %
Positive 22 7
Specificity 86 %
Antigliadin IgG
Positive predictive value 75.8 %
Negative 68 43
Negative predictive value 38.7 %
Sana Abdul-Jabbar Ali1, Hyder Hashim Al-Shlah2, Mais Mazin Al-Hamdani3, Oday Jasim Al-salihi2
1
Assistant Lecturer, Al-Safwa University, Iraq, 2Prof., Faculty of Medicine/Babylon University/Iraq,
3Assistant Lecturer, Faculty of Pharmacy/Al-Ayn University/Iraq
Abstract
Background: Diabetic cardiomyopathy is one of the serious complication of diabetes mellitus, with a silent
development and it is often underestimated, Currently available diagnostic techniques are limited in their
ability to identify patients who present with uncommon symptoms or silent myocardiopathy in its early
stages.
Aim: To evaluate role of miRNA-378 compared to GLS as a sensitive biomarker for early detection of
subclinical diabetic cardiomyopathy.
Method: This case control study involved 75 DM2 patients from Merjan Medical City in addition to age
and sex-matched 25 apparently healthy subjects . The echocardiographic assessment for GLS was done
for control group (H) and normotensive diabetic patients and these patients were divided into (CD) group
without cardiomyopathy, and (M)group with cardiomyopathy diagnosed by negative GLS and positive GLS,
respectively. Group (F) include Hypertensive and/or ischemic diabetic patients with overt heart failure .
conventional Echocardiography was performed to all patients and control groups, all of them were of normal
EF, except group F who have EF less than 40%. Bloodsampling was done for all and miRNA extraction and
analysis done according to the manufacturer recommendations.
Results: There is significant elevation in miR-378 Ct value between H in one side & other three diabetic
gps. (CD, M, F) as presented in table (3-17) (p< 0.05). There is significant elevation in miR-378 Ct value in
M than CD groups. There is significant elevation in Ct value in F than M gp. (p=0.000). In the ROC curve
(AUC) was 0.965. The sensitivity and specificity were 0.978 and 0.646, respectively according to the chosen
cut-off value.
Conclusion: This study showed that miRNA-378 could be regarded as a novel sensitive biomarker which
could play a significant role for early detection of subclinical diabetic cardiomyopathy.
CD group Normotensive diabetic patients without cardiomyopathy diagnosed by negative strain echo study
M group Normotensive diabetic patients with cardiomyopathy diagnosed by positive strain echo study
F group Hypertensive and/or ischemic diabetic patients with heart failure diagnosed by conventional echo study
H group Apparently healthy subjects with negative strain echo study
Clinical Evaluation: All subjects underwent a hypertension, family history of DM2, medications
questionnaire include: medical history which involve: already taken and alcohol consumption history. Previous
history of DM2 and its duration, ischemic heart disease, history of ischemic heart disease (IHD) was considered
914 Medico-legal Update, January-March 2021, Vol. 21, No. 1
positive if there was any history of admission to CCU the questionnaire includes anthropometric measures
with records by physician suggestive of IHD. The involving BMI which was calculated from the measured
absence of ischemia and structural abnormalities was height and weight and categorized into the following
verified in groups M, CD, and H. Nonischemic is categories: normal BMI <25, over weight BMI (25-
defined by normal resting ECG and negative stress ECG 29.9) and obese ≥30 kg/m2. All were subjected to clinical
test. Structural abnormalities were excluded by normal examination including, heart rate and blood pressure.
resting conventional echo study having EF% >50%. Further clinical details are shown in Supplementary
Table (2).
The questionnaire includes also socio demographic
measures involving: age, gender. In addition to those
Table (2): Clinical data for patients in all study groups and control subjects
Groups
Variables
CD group M group F group H group
Total number (n) 25 25 25 25
Age/Mean±SD 52.76±6.3 53.04±6.2 58.44±5.9 50.88±8.1
Male 14 15 18 17
Gender
Female 11 10 7 8
BMI (Kg/m2)/Mean±SD 26.4±4.1 32.1±5.3 30.6±3.5 29.2±5.9
+ve 19 17 18 4
Family history of DM2
-ve 6 8 7 21
HbA1c% 8.5±2.3 8.9±2.3 9.1±2.2 4.4±0.27
Descriptive
Ct of miR-378
95% Confidence Interval for Mean
Groups Mean Std. Deviation ±
Lower Bound Upper Bound
CD 19.6 2.1 18.80208 20.54192
F 30.4 3.4 28.97827 31.89006
H 17.6 2.9 16.30735 18.89526
M 25.9 3.4 24.39589 27.45138
Multiple Comparisons
Dependent Variable: Ct of miR-378
LSD
95% Confidence Interval
Groups Mean Difference p-value
Lower Bound Upper Bound
CD -2.070 .020 -3.80996- -.33143-
H F -12.832 .000 -14.58941- -11.07632-
M -8.322 .000 -10.11752- -6.52714-
CD 6.251 .000 4.49190 8.01137
M
F -4.510-* .000 -6.28734- -2.73372-
Figure (1): ROC curves for miRNA-378 Ct value in all study groups
Medico-legal Update, January-March 2021, Vol. 21, No. 1 917
miRNA-378 as a screening marker: To evaluate type of cardiomyopathy associated with diabetic
the potential diagnostic value of miRNA-378, the ROC glomerulosclerosis. Am J Cardiol. 1972;30:595---
curve has been used. For cut-off value, values exceeding 602.
the cut-off are positive, while those below the cut-off are 2. Boudina S, Abel ED. Diabetic cardiomyopathy,
negative. causes and effects. Rev Endocr Metab Disord.
2010;11:31---9.
It is found that the area under the ROC curve (AUC)
was 0.965 (Fig. 1). The sensitivity and specificity were 3. Saeed M, Van TA, Krug R, et al. Cardiac MR
0.978 and 0.646, respectively. The cut-off Ct value was imaging: current status and future direction.
20.06, it was appeared to have independent associations Cardiovasc Diagn Ther. 2015;5:290---310.
with the clinical end-points that are studied. As a blood- 4. Amundsen BH, Helle-Valle T, Edvardsen T, et
based marker, the miR-378 characteristics as highly al. Noninvasive myocardial strain measurement
sensitivemay improve the screening values of DbCM. by speckle tracking echocardiography: validation
These results suggested that miR-378 may be highly against sonomicrometry and tagged magnetic
sensitive and moderately specific enough to detect resonance imaging. J Am Coll Cardiol. 2006;47:
DbCM. 789---93.
5. Saito M, Okayama H, Yoshii T, et al. Clinical
The extremely high sensitivity (0.978) of miR-378 to
significance of global two-dimensional strain
identify DbCM patients from non-symptomatic diabetic
as a surrogate parameter of myocardial fibrosis
individuals exceeded our most optimistic expectations.
and cardiac events in patients with hypertrophic
These findings strengthen the clinical applicability cardiomyopathy. Eur Heart J Cardiovasc Imaging.
of circulating miR-378 as a biomarker of diabetic 2012;13:617---23.
cardiomyopathy in type 2 diabetes patients. 6. Yingchoncharoen T, Agarwal S, Popovic ZB, et
al. Normal ranges of left ventricular strain: a meta-
Conclusion analysis. J Am Soc Echocardiogr. 2013;26:185---
Serum miR-378 expression level can be regarded as 91.
a non-invasive tool to improve the detection, prediction, 7. Mor-Avi V, Lang RM, Badano LP, et al. Current
and monitoring of cardiac-related complications in the and evolving echocardiographic techniques for
early stages of diabetes. the quantitative evaluation of cardiac mechanics:
ASE/EAE consensus statement on methodology
Ethical Issues: and indications endorsed by the Japanese Society
a. Approval of scientific committee of the Clinical of Echocardiography. Eur J Echocardiogr. 2011;
Biochemistry Department in Babylon Medical 12:167---205.
College/University of Babylon/Iraq. 8. Hogg K, Swedberg K, McMurray J. Heart failure
b. Approval of Babylon Health Directorate/Ministry with preserved left ventricular systolic function;
of Health & Information Center for Research & epidemiology, clinical characteristics, and
Development of Babylon Province. prognosis. J Am Coll Cardiol. 2004;43:317---27.
9. Fang ZY, Schull-Meade R, Leano R, Mottram
c. The objectives and methodology were explained to
PM, Prins JB, Marwick TH. Screening for heart
all participants in the current study and their vocal
disease in diabetic subjects. Am Heart J 2005 Feb
consent was gained.
1;149(2):349-354.
Conflict of Interest: The authors declare no 10. Redfield MM, Rodeheffer RJ, Jacobsen SJ,
competing interest on this paper. Mahoney DW, Bailey KR, Burnett JC. Plasma brain
natriuretic peptide to detect preclinical ventricular
Funding: Self-funding by all authors in equal
systolic or diastolic dysfunction. A community-
percentage.
based study. Circulation 2004;109:3176-3181.
References 11. Kiencke S, Handschin R, von Dahlen R, et al.
Pre-clinical diabetic cardiomyopathy: prevalence,
1. Rubler S, Dlugash J, Yuceoglu YZ, et al. New
screening, and outcome. Eur J Heart Fail 2010
918 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Sep;12(9):951-957. 22. Costantino S, Paneni F, Lüscher TF, Cosentino
12. Devereux RB, Roman MJ, Paranicas M, et al. Impact F. MicroRNA profiling unveils hyperglycaemic
of diabetes on cardiac structure and function: the memory in the diabetic heart. Eur Heart J.
Strong Heart Study. Circulation 2000;101:2271- 2015;37(6):572–6.
2276. 23. Waldenström, A., Genneback, N., Hellman, U. &
13. Swoboda PP, McDiarmid AK, Erhayiem B, et Ronquist, G. Cardiomyocyte microvesicles contain
al. Diabetes mellitus, microalbuminuria, and DNA/RNA and convey biological messages to
subclinical cardiac disease: identification and target cells. PLoS One. 7, e34653 (2012).
monitoring of individuals at risk of heart failure. J 24. Knezevic I, Patel A, Sundaresan NR, Gupta
Am Heart Assoc 2017 Jul 1;6(7), e005539. MP, Solaro RJ, Nagalingam RS, et al. A novel
14. Quiat D, Olson EN. MicroRNAs in cardiovascular cardiomyocyte-enriched MicroRNA, miR-378,
disease: from pathogenesis to prevention and targets insulin-like growth factor 1 receptor
treatment. J Clin Invest 2013 Jan;123(1):11-18 implications in postnatal cardiac remodeling and
https://doi.org/10.1172/JCI62876. cell survival. J Biol Chem. 2012;287(16):12913–
26.
15. de Gonzalo-Calvo, D., Cenarro, A., Civeira, F. &
Llorente-Cortes, V. microRNA expression profile 25. Liam J. Murphy, Insulin-Like Growth Factor-I:
in human coronary smooth muscle cell-derived A Treatment for Type 2 Diabetes Revisited,
microparticles is a source of biomarkers. Clin Endocrinology, Volume 147, Issue 6, 1 June 2006,
InvestigArterioscler. 28, 167–177 (2016). Pages 2616–2618
16. Ortega, F. J. et al. Profiling of circulating microRNAs 26. Assmann TS, Recamonde-Mendoza M, Costa
reveals common microRNAs linked to type 2 AR, Puñales M, Tschiedel B, Canani LH, et al.
diabetes that change with insulin sensitization. Circulating miRNAs in diabetic kidney disease:
Diabetes Care. 37, 1375–1383 (2014). case–control study and in silico analyses. Acta
Diabetol. 2019;56(1):55–65.
17. Guo R, Nair S. Role of microRNA in diabetic
cardiomyopathy: from mechanism to intervention. 27. Zhang Y, Li C, Li H, Song Y, Zhao Y, Zhai L, et
BiochimBiophys acta (BBA)-molecular basis Dis. al. miR-378 activates the pyruvate-PEP futile cycle
2017;1863(8):2070–7. and enhances lipolysis to ameliorate obesity in
mice. EBioMedicine. 2016;5:93–104.
18. Shehata IE, Eldamanhory AS, Shaker A. Early
predictors of left ventricular dysfunction in 28. Nagalingam RS, Sundaresan NR, Gupta MP,
hypertensive patients: comparative cross-section Geenen DL, Solaro RJ, Gupta M. A cardiac-
study. Int J Cardiovasc Imaging. 2020;1–10. enriched microRNA, miR-378, blocks cardiac
hypertrophy by targeting Ras signaling. J Biol
19. Wang J, Pei Y, Zhong Y, Jiang S, Shao J, Gong
Chem. 2013;288(16):11216–32.
J. Altered Serum MicroRNAs as Novel Diagnostic
Biomarkers for Atypical Coronary Artery Disease. 29. Puthanveetil P. FoxO1–miRNA interacting
2014;9(9). networks as potential targets for mitochondrial
diseases. Drug Discov Today. 2019;24(1):342–9.
20. Blondal, T. et al. Assessing sample and miRNA
profile quality in serum and plasma or other 30. Fiedler J, Baker AH, Dimmeler S, Heymans S,
biofluids. Method. 59, S1–6 (2013). Mayr M, Thum T. Update on non-coding RNAs in
vascular disease–from basic discoveries to clinical
21. Guo R, Nair S. Role of microRNA in diabetic
applications. Cardiovasc Res. 2018.
cardiomyopathy: from mechanism to intervention.
BiochimBiophys acta (BBA)-molecular basis Dis.
2017;1863(8):2070–7.
DOI Number: 10.37506/mlu.v21i1.2433 Medico-legal Update, January-March 2021, Vol. 21, No. 1 919
Abstract
The aim of the study is to evaluate the effectiveness of digital occlusal analysis (T- scan) in diagnosis
the patients with MFDS during lateral excursion movements. Method and materials: participants with full
dentition and angle class I relation. Patients diagnosed based on DC/TMD criteria, digital occlusal analysis
including (disclusion time, occlusion time) registered by T-Scan NOVUS device during the excursion
movements in both (Right and Left) sides. Results: Non-significant differences between the age groups, a
significant differences between the gender groups and the females were more prevalent than the males, all
the means values of occlusal parameters (disclusion time, occlusion time) were higher in MPDS patients
group than healthy control group, Highly significant difference according (disclusion time, occlusion time)
are documented between MPDS patients and the healthy control in lateral excursion movements (R &
L). Conclusion: This study concluded, that the digital occlusal analysis measured by T scan Novus devise
is a more accurate and objective method in diagnosis the patients with MPDS during lateral excursion
movements.
Keywords: Occlusion time, disclusion time, occlusal force, MFDS, T-scan, OT, DT, lateral excursion.
Results was (17:68) and within the control group was (10:15).
Table (1) showed the demographic characteristic of
One hundred and ten (110) participant were
the study groups. There were no significant differences
included in this study with age range (18-43) years old
P>0.05 according to the age between the two study
and divided into two main groups: diseased group (show
groups while according to gender this study reported a
signs and symptoms of myofacial pain syndrom) with (85)
significant difference P≤0.05 and the females were more
patients and (25) healthy controlled free from signs and
predominant than males.
symptoms of MPDS. The male: female ratio of the DG
Medico-legal Update, January-March 2021, Vol. 21, No. 1 921
Table (1) Demographic characteristic of the study groups.
*Significant difference between proportions using Pearson Chi-square test at 0.05 level,
NS: Non–Significant, SD: Standard Deviation, No: Number, % Percentage
Table (2) represented the descriptive Statistics of were higher than control group also a highly significant
[Disclusion time test] parameter in the studied groups difference P< 0.01 has been documented between the
during lateral excursion movement (Right and left). diseased and control groups.
The results showed the mean values in diseased group
Table (2) Descriptive Statistics of [Discclusion time test] parameter in the studied groups distributed for
different locations
As shown in table (3) the occlusion time test excursion movements (R & L) and with average mean
parameter showed a significant difference P≤0.05 values higher in diseased group than control group.
between the diseased group and control group during the
Table (3) Descriptive Statistics of [Occlusion time test] parameter in the studied groups during lateral
excursion movements (R & L)
Abstract
Background: Adolescence is the period of rapid growth with physical & physiological development and
profound biological, emotional, social, and cognitive changes in human beings. Nutritional anemia is the
common & worldwide public health problem among adolescent girls and overall prevalence of nutritional
anemia varies from 40-90%. It may produce adverse effects like increased risk of morbidity and mortality
and affects adolescent’s future health.
Objective: This study aimed to assess the awareness on nutritional anemia and its prevention among
adolescent girls.
Method: A non experimental descriptive design was adopted to assess awareness on nutritional anemia and
its prevention among adolescent girls at Keezhakasakudi, Karaikal. A total of 60 adolescent girls between
10-15 years of age were selected by convenience sampling technique. Data was collected by using self
structured interview schedule. Both descriptive and inferential statistics were used to analysis the gathered
data.
Results: The study results reported that the majority 63% (38) of adolescent girls had inadequate awareness,
27% (16) had moderately adequate awareness and only 10% (6) had adequate awareness on nutritional
anemia and its prevention. The overall mean was 9.6 with standard deviation±2.49. The results of the
present study also revealed that there was statistically significant association between level of awareness on
nutritional anemia with age of the adolescent girls.
Conclusion: Nutritional anemia as the major non communicable disease and contributing negative impact
on health, it necessitates the need to organize counseling programs to adolescent girls in schools and colleges
with much emphasis on impact of nutritional anemia on future health.
Sara Mary Thomas1, Bhavika Sangada2, Sanam Vasava3, Lokesh Akkineni4, Chaitri Shah5
1
Associate Professor, 2Associate Professor, 3Assistant Professor, Department of Anaesthesiology, Smt. B.K. Shah
Medical Institute & Research Centre, Sumandeep Vidyapeeth Deemed to be University, Vadodara, Gujarat,
India, 4Medical Director (MD Anaesthesia) Akhila Health Services, Charla, Karimnagar, Telangana, 5Professor,
Department of Anaesthesia, SMS MC Hospital, Ahmedabad, Gujarat, India
Abstract
Background and Aims: Incidence of Postoperative (Postop) Acute Kidney Injury (AKI) and related
comorbidities can be prevented by identifying various preoperative and intraoperative predictors in the
patients. Early recognition of risk factors and timely intervention can reduce morbidity and mortality related
to AKI in a patient with preoperative normal renal function .
Method: This prospective observational cohort study was done in 100 patients undergoing major noncardiac
surgery under spinal, epidural or general anaesthesia, who were having normal preoperative renal function.
Intraoperative predictors of AKI monitored were bloodloss, hypotension, duration of surgery, volume of
fuid infused, urine output (UOP), use of vasopressor and diuretics. Postoperatively urine output and serum
creatinine level were noted for 3 days. Postoperative AKI was defined and classified as per RIFLE criteria.
Results: Total 33% patients were diagnosed to have Postop AKI and the major risk factors identified were
duration of surgery, volume of fluid given intraoperatively, blood loss and UOP postoperatively (p value
<0.001). Non significant risk factors were demographic data, mode of anaesthesia given, diuretic usage,
drug therapy.
Conclusion: We concluded in our study that in patient with preoperative normal renal function undergoing
noncardiac surgery various predictors for AKI can be identified early and optimised for better outcome.
These factors are duration of surgery, blood loss, volume of fluid infused.
Keywords: Acute kidney injury, Diuretics, non cardiac surgery, RIFLE criteria, S.creatinine.
There was significant decrease in urine output in Postop Day 1,2,3 in patients who developed Postop AKI as
compared to those who had normal Postop renal function as shown in Table 1.
On evaluating the predictors for Post op Acute The significant intraoperative parameters were
Kidney Injury, it was found that, both groups were duration of surgery, volume of fluid used and blood loss.
comparable with respect to their demographic profile It was found that longer duration of surgery, increased
.Both groups did not differ significantly with respect blood loss and increased volume of intravenous fluid
to type of anaesthesia provided – spinal anaesthesia, played a significant role in the development of Postop
general anaesthesia and epidural anaesthesia (p value – AKI as shown in Table 2.
0.78, 0.58 and 0.44 respectively). Diabetes Mellitus and
Hypertension were not found to be significant risk factors
for Postop AKI (p value-0.357, 0.022 respectively.)
Post op Acute Renal failure (n=33) Normal post op Renal Function (n=67) p-value
Duration of Sx (hours) 2.9139±0.69652 1.9422±0.6987 <0.001
Vol. of Fluid in Sx (ml) 2374.55±617.789 1718.81±482.545 <0.001
Blood loss (ml) 398.79±84.512 190±119.598 <0.001
Abstract
Introduction: Life satisfaction among older persons is one significant component of quality of life. However,
differences related to gender and moderation role of social support might affect life satisfaction. The purpose
of this study was to examine the moderation effect of perceived social support on the relationship between
gender and life satisfaction among older persons.
Method: A predictive-exploratory approach was used. Data collected from 966 persons at age of 60 years
or older using a structured interview format.
Results: In general, older persons had moderate to a high level of life satisfaction and perceived social
support. Perceived social support had a significant moderation effect on the relationship between gender and
life satisfaction (F 7,913= 52.37, p<.001; R2= .152).
Conclusion: Life satisfaction among older persons is influenced by social support indicating importance of
creating and enhancing the supportive system available to older persons.
• To examine the moderating effect of perceived 2. The Arabic version of the Multidimensional
social support on the relationship between gender Scale of Perceived Social Support [25] was used to
and life satisfaction among older person diagnosed measure Perceived social support [26]. The scale is
with chronic illness? a 12-item tool measuring perceived social support
from family, friends and others the respondents are
• To test the differences in life satisfaction in relation expected to make their responses on a 7-point Likert
to gender among older person diagnosed with scale ranging from very strongly disagree (1) to
chronic illness? very strongly agree (7). The higher the score is the
Materials and Method higher the perceived social support. This scale had
good internal consistency with Cronbach’s alpha of
Design: A cross sectional, predictive explorative .83[25].
design was used. Data collected using structured
interview format. Sociodemographic factors included information
related to age,gender, marital status, education level, type
Sample and Setting: A total of 996 older persons of chronic diseases if they have, duration of diagnosis of
agreed and completed the questionnaire of a total of the disease, and smoking status.
1200 approached forming 83% response rate. Multistage
sampling technique was used. Inclusion criteria Results and Discussion
included: all those above the age of 60 years and able Descriptive Characteristics: The analysis showed
to read and write in Arabic. Exclusion criteria included that age ranged from 60 to 100 years with a mean of 68.0
persons who are physically and mentally incompetent to (SD = 7.3). of them, 54.0% (n = 538) were males and
answer the survey questions according to their next of 46.0% (n = 456) were females. The majority of the older
kind statements. persons (68.6%, n = 683) were married, and 107% (n =
Data collection Procedures: Data collection started 107) had fulltime work. of them, 28.1% (n=280) have
after ensuring ethical approval from the University of comorbid diagnoses of medical diagnosis, compared to
Jordan. Privacy and confidentiality maintained and 26% (260) are not diagnosed with any medical (or do not
guaranteed for the participants. Structured format of data know). For more details see table 1.
collection was used in the respondents’ households by Table 1: Descriptive characteristics of the older
research team. The family members acted as co-signer persons (N=996)
of the consent form. The questionnaires were presented
in Arabic language. Variable n %
Male 538 54.0
Instrumentation: The data collected using the Gender
Arabic version of scales. The instruments were: Female 456 46.0
< High School 770 77.3
1. The Arabic version of the Satisfaction with Life Education level
> High School 226 22.7
Scale[23] was used to measure Life satisfaction[24].
The scale is a five items scale measuring general
Medico-legal Update, January-March 2021, Vol. 21, No. 1 937
Table 3: Regression examining moderation effect of perceived social support on the relationship between
gender and life satisfaction (N =996)
Block 1 Block 2
Variables
β p-value β p-value
Gender -.523- .226 -.549- .170
PSS-FA .163 p <.001
PSS-FR .120 p <.001
PSS-OTHER .256 p <.001
R2 .005 .151
R2adj .001 .146
R2 change .146 p< .001
e .97 .70
PSSFA: perceived social support from family; PSSFR: perceived social support from friends; PSSOTHER: perceived social support
from others.
In block-2, in which perceived social support from support from model 1 to model 2 where the magnitude of
family, friends and others added to test its moderation R2 changes value is .146 indicating the perceived social
effect, the analysis showed that the model was statistically support has great moderation effect on the relationship
significant (F = 52.37, p<.001) with R2= 0.152 and between gender and life satisfaction among older person
adjusted R2= .145. The R2 value of .152 indicates that (see table 3). In general, the results infer that adding
almost 15% of the variation in the relationship between perceived social support from family, friends and others
gender and life satisfaction is related to the moderation has buffered the negative influence of gender on the life
effect of perceived social support. The variation has satisfaction.
been improved largely with inclusion of perceived social
938 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Differences in life satisfaction related to selected satisfaction supporting previous report [30-31] who found
demographics: The analysis showed no significant no significant differences in life satisfaction in relation to
differences related to gender (t = .08, p = 941). However, sociodemographic factors.
using the univariate analysis to examine the differences
between males and females in their life satisfaction However, when controlling for health characteristics
controlling for type of medical diagnosis, the analysis (type and duration of medical diagnosis)we found
showed a significant difference (F 1,996 = 8738.7, p significant differences in life satisfaction in relation to
< .001). Males had higher mean score (M = 24.5, SD gender in which older males were more satisfied with their
= 5.7) than females (M = 23.9, SD = 7.1).significant lives than older females. Such findings would sustain the
differences found between males and females controlling notion that life satisfaction is complicated within social
for duration of medical diagnosis with mean score for context. This would suggest that life satisfaction among
males ((M = 24.5, SD = 5.6) higher than females (M = older persons cannot be measured using global life
23.8, SD = 7.0). satisfaction scale. There is a need to develop a measure
that emphasizing the social and psychological context of
Discussion gender role among older persons.
Older persons are struggling to manage their One limitation of this study is that the sample the
biopsychosocial needs within limited available study is cross sectional in which a longitudinal approach
resources in the developing countries[5]. The literature measuring life satisfaction at various points of life would
Asserted that older persons are suffering from number be more informative.
of psychological and physical deteriorations[27-30]. This
study is extending the body of knowledge identifying Conclusion
the role of social support as moderating factor on the Given the results of the present study, specifically
relationship between life satisfaction and gender. The understanding the relationship between ageing, gender,
findings of the study provide a new perspective of and biopsychosocial wellbeing, the results indicated that
understanding that the relationship between ageing and adding perceived social support from family, friends and
the biopsychosocial wellbeing of older persons. We others has buffered the negative influence of gender on
have found that social support is one core component the perception of life satisfaction. Older male persons
of older persons’ quality of lifedue to the effect of social had higher life satisfaction than females controlling
support on the life satisfaction regardless of gender of for health-related factors. The study implies that social
the older persons. males and females are not simply support is one particular factor to consider while
similar in their social functions.Women are assuming attempting to explain or intervene to improve quality of
different roles in the Arabian culture in which most of life among older person.
women’s responsibilities are geared towards home-
related and family-related mattersindicating that women Conflicts of Interest: the authors declare no conflict
need more social support than men. However, we found
that older men and women regardless of their age need Funding: None
an equal social support to successfully maintain their Ethical Clearance: The study was approved by the
life satisfaction. The results are not in line with other scientific research committee at the University of Jordan
studies [31]who found that perceived social support (#10/2017-2018).
was more closely related to life satisfaction for women
than for men. One explanation is that older women References
preserve their social roles through maintaining their
strong connectedness with their adult male and female 1. United Nation (UN) (2017) World population
children. In Arabian culture, adult male and female ageing. https://www.un.org/en/development/desa/
children are obliged to seek more constant appraisals population/publications/pdf/ageing/WPA2017_
from their mothers than fathers in all their life matters. Highlights.pdf
This would explain the higher level of social support 2. World health organization (WHO) (2018) fact
that older women received than men. This also explains sheet (ageing and health).https://www.who.int/
what we have also found that age and gender of older news-room/fact-sheets/detail/ageing-and-health
persons are not significantly related to the level of life 3. Help Age International (2018). http://www.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 939
helpage.org/global-agewatch/population-ageing- 15. Darawad M, Alfasfos N, Saleh Z, Saleh A,
data/country-ageing-data/?country=Jordan. (Last Hamdan-Mansour A. Predictors of delay in seeking
accessed: 3 February 2020). treatment by Jordanian patients with acute coronary
4. Department of Statistic (2015). Population and syndrome.Int EmergNurs 2016; 26: 20-25. DOI:
housing census 2015. DOS. Amman. 10.1016/j.ienj.2015.09.003.
5. Al Khatib A, Hamdan-Mansour A, BaniHani M. 16. Oshio T. Gender differences in the associations of
Theoretical perspectives of hospitalized older life satisfaction with family and social relations
patients and their health-related problems and among the Japanese elderly. J Cross Cult Gerontol
quality of care: systematic literature review. The 2012; 27(3): 259-274.
Open Public Health Journal 2017; 10: 215-225. 17. Böhm AW, Mielke GI, da Cruz MF, Ramires VV,
6. Khatib A, Hamdan- Mansour A, Ratrout H, Wehrmeister FC. Social support and leisure-time
Alenezi A, Chahien T. Testing the effectiveness physical activity among the elderly: A population-
of integrated elderly care model on quality of care based study. J Phys Act Health 2016; 13(6): 599-
and health outcomes among hospitalized elderlies 605.
in West Bank. Malaysia Journal of Public Health 18. Angner E, Ghandhi J, Purvis KW, Amante D,
Medicine 2020; 20(1): 82-89. Allison J. Daily functioning, health status, and
7. Mahadeen A, Hamdan-Mansour A, Halabi J, happiness in older adults. Journal of Happiness
Habashneh S, Bani Kenanah A. Psychosocial Studies. 2013; 14(5): 1563-1574.
wellbeing of infertile couples in Jordan. East 19. Hajian-Tilaki K, Heidari B, Hajian-Tilaki A. Are
Mediterr Health J. 2018; 4(2):169-176. gender differences in health-related quality of life
8. Chiaranai C, Chularee S, Srithongluang S. Older attributable to sociodemographic characteristics
people living with chronic illness. GeriatrNurs and chronic disease conditions in elderly people?
2018; 39(5): 513-520. Int J Prev Med 2017; 8.
9. Darawad M, Hammad S, Samarkandi SA, Hamdan- 20. Hamdan-Mansour A. Sociodemographic correlates
Mansour A, Khalil A. Evaluating the psychometric of somatic symptoms of older persons in Jordan.
properties of the Arabic version of diabetes Jordan Med J 2017; 51 (3): 119-130.
distress scale among Arabic patients with Diabetes 21. Hamdan-Mansour AM, Al Abeiat DD, Alzoghaibi
Mellitus.J PsychosocNursMent Health Serv 2017; IN, Ghannam BM, Hanouneh S I. Psychosocial and
55 (9): 43-51 sociodemographic correlates of life satisfaction
10. Dreidi H, Hamdan-Mansour A. Pain, Sleep among patients diagnosed with cancer in Jordan. J
Disturbance, and Quality of Life Among Palestinian Cancer Edu 2015; 30(1): 31-36.
Patients Diagnosed with Cancer. J Cancer Edu 22. Darawad MW, Hammad S, Mosleh S, Samarkandi
2016; 31 (4): 796–803. OA, Hamdan-Mansour A, Khalil AA, Arabiat
11. Zhao C, Wong L, Zhu Q, Yang H. Prevalence D. Psychosocial correlates of diabetes self-
and correlates of chronic diseases in an elderly management practices. Iran J Public Health 2017;
population: A community-based survey in Haikou. 46(6): 771.
PloS one 2018; 13(6). 23. Hamdan Mansour A, Shehadeh J, Puskar K, El-
12. Hamdan-Mansour A, Nawafeh D, Hanouneh S, Hneiti M, Haourani E. Investigating Physical,
A l Omari H. Psychosocial aspects of patients Psychological and Social Well-being of Older
diagnosed with Diabetes Mellitus type –II in Persons in Jordan. Curr Aging Sci 2017; 10(3):
Jordan.Int J Diabetes Dev Ctries2016; 36 (1): 65- 217-223.
69. DOI 10.1007/s13410-015-0423-z. 24. Diener ED, Emmons RA, Larsen RJ, Griffin S. The
13. Diener E, Tay L. Subjective well‐being and human satisfaction with life scale. J Person Assess 1985;
welfare around the world as reflected in the Gallup 49(1): 71-75.
World Poll. Int J Psychol 2015; 50(2): 135-149. 25. Amer N, Hamdan-Mansour A. Psychosocial
14. Rathaur A, Mishra S. Study on institutionalized and predictors of suicidal ideation among patients
non-institutionalized elderly people. J Nurs Home diagnosed with chronic illnesses in Jordan.Issues
Res Sci 2016; 2: pp.77-79. Ment Health Nurs 2014; 35: 864–871.
940 Medico-legal Update, January-March 2021, Vol. 21, No. 1
26. Zimet GD, Dahlem NW, Zimet SG, Farley GK. The 29. Attallah M, Hamdan-Mansour A, Al-Sayyed M,
multidimensional scale of perceived social support. Aboshaiqa A. Patient Satisfaction with the quality
J Person Assess 1988; 52(1):30-41. of nursing care provided: the Saudi experience. Int
27. Jaradat AKM, Abood MH. Life-satisfaction and J NursPract 2013; 19: 584–590
social support among the elderly living in care 30. Hamdan-Mansour A, Constantino R, Farrell M,
homes and those living in their own homes. J Edu Doswell W, Gallagher ME, Safadi R, Shishani K,
Psychol Sci 2016; 17(01). Banimustafa R.Evaluating the Mental Health of
28. Hamdan-Mansour A, Marmash L, Elayyan R, Jordanian Women in Intimate Partner Abuse. Issues
Hyarat S. Difference in perception between nurses in Mental Health Nursing. 2011; 32:614–623.
and patients related to patients’ health locus of 31. Berg AI, Hassing LB, McClearn GE, Johansson B.
control. Int J NursPract 2014; 20: 242-249. What matters for life satisfaction in the oldest-old?
Aging Ment Health 2016; 10(3): 257-264.
DOI Number: 10.37506/mlu.v21i1.2437 Medico-legal Update, January-March 2021, Vol. 21, No. 1 941
Seong Mihyeon1, Chung Soojin2, Hong Hyonjoo3, Song Jihyun4, Hwang Wonju5
1
Department of Nursing, ChangshinUniversity. Assistant Professor, MSN, PhD, 2Department of Nursing, Graduate
School, Kyung Hee University. Doctoral student, MSN, 3National Center for Mental Health, RN, MSN, PhD,
4Department of Nursing, Cheju-Halla University. Assistant Professor, MSN, PhD, 5College of Nursing Science,
Abstract
Introduction: The purpose of this study was to provide basic data to develop effective multicultural
education programs related to emotional intelligence by understanding its relationship with multicultural
cognition, and the attitude of college students in the nursing science departments.
Method: A descriptive correlational survey design was administered on a total of 197 nursing students in
Korea. The collected data were analyzed using descriptive statistics, t-test, ANOVA, and multiple regression
analysis, with the SPSS/WIN 21.0 program.
Result: The multicultural perception was 3.61 ± 0.40 out of 5, and the multicultural attitude was 4.52 ±
.61 out of 6. Emotional intelligence which comprises multicultural cognition (p< .001), and multicultural
attitude (p<.001), all had a positive correlation with multicultural attitude (p<.001).
Discussion: To develop multicultural education programs for nursing students and college students, it is
necessary to develop and apply differentiated intervention strategies using emotional intelligence.
Implications for nursing: This can contribute to promote flexibility of nursing students and help them adapt
themselves to clinical practice.
In some studies, the main factors that affect the Korean Research Method
university students’ perspective of multiculturalism
1. Research Design: This study was a descriptive
and biases are categorized into personal, tendency,
research study with the objective of understanding
experience, and capability factors. Furthermore, out of
the effects of emotional intelligence on the
these factors, the cultural capability factor is a part of
acknowledgement of multiculturalism. This study
emotional intelligence, and this factor interacts with the
also analyzed the emotional intelligence and the
following knowledge and the acknowledgement10.
acknowledgement of multiculturalism in nursing
Studies show that emotional intelligence is deeply students.
related to self-efficiency, and it plays an intermediary 2. Research Subject: The participants were nursing
role for problem behaviors. In the same perspective, the students from S city to J city. The sample size
relationship between emotional intelligence and personal included 200 people, calculated using the G-power
factors that influence stress and anxiety in healthcare 3.1.1 program. The effect size needed in multi-
providers in the clinical field is also a growing issue in regression analysis was 0.25, with power (1-β)
nursing science11,12. = 0.80, and significant level (α)=.5. The results
Previous research implies that emotional intelligence showed that 180 participants were appropriate, and
is related to one’s ability to smoothly solve problems an elimination rate of 10% was considered, resulting
and deal with stressful situations13,14. Therefore, without in a sample of 200 participants. However, in the
any exposure to multiculturalism in the education final analysis, 3 participants were excluded due to
process, emotional intelligence is thought to have a missing information and inadequate responses to the
positive influence on healthcare providers in the clinical survey.
field. However, further research on this subject is still 3. Research Tools:
insufficient.
1. Emotional Intelligence: Emotional intelligence
Finding and identifying the exact relationship is a term used to describe the ability to understand
between emotional intelligence and the cognition of one’s feelings and those of others, and the
multiculturalism is critical in nursing education. In the acknowledgment of these feelings before getting
rapidly changing multicultural medical arena, nursing into action8. This study used a scale that was
should be done under the firm implication of a thorough adapted from WLEIS (Wong & Law’s Emotional
Medico-legal Update, January-March 2021, Vol. 21, No. 1 943
Intelligence Scale15) by Jung16. Permission was the precautions and the data usage. They were
granted for its use. This scale consists of 4 questions informed that data will be used only for research
on self- emotional understanding, 4 questions on purposes and will be handled anonymously.
emotional understanding of others, 4 questions on The participants provided their written informed
emotional control, and 4 questions on emotional consent. Furthermore, 10 pre-surveys were done
application. The Likert Scale is used to rates to ensure that the participants fully understood the
responses, where 1= highly unlikely and 7= highly survey questions.
likely. Higher scores indicate higher emotional
The research was approved by the research ethics
intelligence. Validity verification was also done,
review committee in the institution (approval
which showed reliability with Cronbach’s α= 0.87
number: KHSIRB-16-071 (RA)).
(when the tool was created), and α= 0.89 (when the
research was conducted) 5. Data Analysis: The collected data were analyzed
using the IBM SPSS/WIN 21.0 program. The
2. Acknowledgement of Multiculturalism:
degree of the subjects’ general properties, emotional
Acknowledgement of multiculturalism is the level
intelligence, acknowledgement and attitude
measuring how much nurses accept and respect the
towards multiculturalism were expressed using
cultural differences in a society17. The tool designed
real numbers, average, and standard deviation.
by Kim18 for teenagers was used, and permission
The difference between the three terms were found
for the use of such was granted. Eight questions
using the Independent t-test and One-way ANOVA.
regarding acceptance of differences, 6 on sensitivity
The relationship between the three terms were
towards differences, and 6 on openness towards
analyzed using the Pearson’s correlation coefficient,
differences were asked, totaling to 20 questions.
and multiple regression analysis was done to
The Likert Scale was used to rate responses, where
determine the effect of emotional intelligence on the
1 = highly unlikely and 5= highly likely, with higher
acknowledgement and attitude of the participants
scores indicating a higher level of acknowledgement.
toward multiculturalism.
The scales’s validity was measured, with reliability
showing Cronbach’s α= 0.89 (when the tool was Results
created), α= 0.82 (when the study was conducted)
1. The degree of the subjects’ emotional intelligence,
3. Attitude towards multiculturalism: This is an acknowledgement and attitude towards
owned property regarding the consistent reaction multiculturalism.
towards the multicultural society and recognize the
Emotional Intelligence – Out of 7 points, subjects’
cultural difference between various cultures19. The
average = 4.80 ±0.72
tool adapted from MASQUE (Munroe Multicultural
Attitude Scale Questionnaire20) by Kang and Acknowledgement of multiculturalism—Out of 5
Lim19 was used, excluding questions that overlap points, subjects’ average = 3.61 ±0.40
with questions from the “Acknowledgment of
Multiculturalism” portion. Six questions regarding Attitude towards multiculturalism—Out of 5 points,
different cognitions, 4 regarding openness and subjects’ average = 4.52 ±0.61 (Table 1)
acceptance, and 4 regarding willingness to get in
2. The difference between emotional intelligence,
action were included resulting in a total number
acknowledgement and attitude towards
of 14 questions. A Likert-type scale was used
multiculturalism based on general properties of
to rate responses, with 1= highly unlikely and
subjects
6= highly likely, with higher scores indicating a
more optimistic attitude towards multiculturalism. Results showed meaningful differences in emotional
Validity was measured, with reliability indicating intelligence between participants who had experience
Cronbach’s α= 0.89 (when the tool was created), α= regarding multiculturalism other than major education
0.92 (when the study was conducted). and those who had no experience at all. (t= 2.34, p= .020)
4. Data collection: The data collection period was Results regarding the difference between degrees of
from December 1, 2016 to March 1, 2017. Before acknowledgement towards multiculturalism regarding
data collection, all participants were informed about the participants’ general characteristics showed the
944 Medico-legal Update, January-March 2021, Vol. 21, No. 1
highest results in grade 2 (3.75 ±0.46), followed by intelligence have higher acknowledgement and
grade 3 (3.58 ±0.39), grade 1 (3.56 ±0.40), and grade positive attitudes, and higher acknowledgement led
4 (3.55 ±0.32) (F= 2.84, p=.039). Participants who had to more optimistic attitudes. (Table 2).
experiences of activities regarding multiculturalism
2. Factors influencing acknowledgement and
had higher scores than those who had no experiences
attitude towards multiculturalism: Multi-
at all (t=2.30, p=.023). Participants who had received
regression analysis was performed to determine
education on multiculturalism other than their majors
the effects of emotional intelligence on a
had higher scores (t= 2.66, p=.009). Those who have
participant’s acknowledgement and attitude towards
friends from different cultures also had higher scores
multiculturalism. The results are shown in Tables 3
(t=2.01, p=.046).
and 4.
Questions regarding relations with multicultural Along with emotional intelligence, grades,
societies were answered by 1) do not know firsthand, experience of practical training, education experience,
but have talked to them (3.80 ± 0.43), 2) have known existence of multicultural friends, experience with
them and lived with them in the same neighborhood multicultural members, frequency of contacts with
(3.72 ±0.43), 3) only seen them on TV or in movies (3.58 them, and necessity of multiculturalism education were
±0.23), and 4) do not know them firsthand, but have independent variables. The results showed the following:
seen them in the neighborhood (3.56 ±0.40) (F=2.50, Durbin Watson statistics was 2.039, indicating no
p=.044). Results regarding differences in attitudes influence since the number is close to 2; tolerance =
towards multiculturalism based on participants’ general 0.661, lower than 0.1; VIF was lower than 10, thus there
properties showed higher scores in participants who were no problems in multicollinearity. The analysis
have experienced various practical trainings than those using these independent variables were meaningful
who have not (t=3.97, p<.001). Higher scores were also (F=5.775, p<.001), and estimated the acknowledgement
recorded in participants who have multi-cultural friends of multiculturalism of nursing students in grade 2,
(t=2.95, p=.010). Questions regarding contacts with necessity of multicultural education, and emotional
multicultural societies in the previous year were answered intelligence (28.0%). (Table 3)
by 1) very often (3.72 ±0.60), 2) sometimes (3.65 ±0.39),
and 3) not at all (3.52 ±0.34) (F=3.14, p=.046). Questions Along with attitude towards multiculturalism,
regarding the necessity of multiculturalism education in practical training experience, existence of multicultural
the nursing education system were answered by 1) very friends, experience with multicultural members, and
necessary (3.80 ±0.34), 2) a little bit necessary (3.54 necessity of multicultural education were independent
±0.40), and 3) so-so (3.50 ±0.39) (F=8.17, p<001). variables. Results showed the following: Durbin Watson
statistics was 1.826, indicating no influence since the
1. The relationship between emotional intelligence, number is close to 2; tolerance = 0.715, lower than 0.1,
acknowledgement and attitude towards VIF was lower than 10, thus there were no problems in
multiculturalism: Emotional intelligence is in multicollinearity. The analysis using these independent
direct proportion with acknowledgement and variables was significant (F=7.422, p<.001). Influence
attitude (both p<.001), while acknowledgement is factors were estimated as practical training experience,
in direct proportion with attitude (p<.001). Thus, necessity of multiculturalism education, and emotional
this means that participants with higher emotional intelligence (24.7%). (Table 4).
Second, since the necessity of multiculturalism- Funding: This research received no specific grant
related education is also an influencing factor, from any funding agency in the public, commercial, or
acknowledgement and attitude-based education is not-for-profit sectors.
needed for a suitable approach to diversity in the nursing Declaration of Conflicting Interests: The
field28. This result is similar to Hwang et al.’s study29, Author(s) declare(s) that there is no conflict of interest.
which showed that multicultural related lectures raised
the standard regarding attitudes toward multiculturalism. References
Therefore, for an effective healthcare and approach,
education regarding multiculturalism must be carried 1. Shin, SJ. A Study on the social workers’ cultural
out in advance. competence for multi-cultural practice. Discourse
and Policy in Social Science, 2013;6(2), 61–88.
Lastly, multiculturalism related practical training 2. Security Administration. Statistics on the status
is an influencing factor as well. This means that of foreign residents in local governments in
opportunities for nursing students to meet actual 2016 [online]; 2016. [cited 2018 January 2].
multicultural members and interaction with their cultures Available from: http://www.mois.go.kr/frt/
must be provided during the education process30. bbs/type010/commonSelectBoardArticle.
do?bbsId=BBSMSTR_000000000008 &
This study shows significance in the fact that it
nttId=60494.
provided basic information in designing an education
process for nursing students to meet multicultural 3. Reimann JO, Talavera GA, Salmon M, Nuñez
members and gain the abilities to understand them. To JA, Velasquez RJ.Cultural competence among
raise levels of acknowledgement and attitude towards physicians treating Mexican Americans who have
multiculturalism, examples (North Korean deserters, diabetes: a structural model.Social Science &
married foreign residents, emigrant workers), and Medicine. 2004;59(11):2195-205.
policies regarding them must be included in lectures, 4. Benjamins MR, Whitman S. Relationships between
and an education method to raise emotional intelligence discrimination in health care and health care
must be developed and included as well. outcomes among four race/ethnic groups. Journal
of Behavioral Medicine. 2014;37(3):402-13.
Conclusion 5. Chae DH, Park YH, Kang KH, Lee TH. A study
The objective of this study was to find out on factors affecting cultural competency of general
the relationship between emotional intelligence, hospital nurses. Journal of Korean Academy of
acknowledgement and attitude towards multiculturalism Nursing Administration. 2012;18(1):76-86.
through comparison between the significant factors. 6. Glittenberg JA. Transdisciplinary, transcultural
The final results have shown that acknowledgement model for health care. Journal of Transcultural
and attitude are indeed related. Therefore, emotional Nursing. 2004;15(1):6-10.
intelligence is necessary for healthcare providers to 7. Kang HY, Han SY. A study on social distance
take a flexible stance towards multiculturalism and fully of nursing students toward minority groups in a
understand it. Metropolitan city. Journal of Korean Public Health
For further research, the following must be kept in Nursing 2013;27(1):166-78.
mind. First, a research to create an education program 8. Nam KA, Jeong GH. Analysis of prejudice
using emotional intelligence for nursing students and to toward foreigners by nurses and physicians in
verify them is necessary. Second, this study used only a Korea. Journal of Korean Public Health Nursing.
948 Medico-legal Update, January-March 2021, Vol. 21, No. 1
2013;27(3):437-49. for multicultural studies. Educational and
9. Goleman D. Emotional intelligence. New York: Psychological Measurement. 2006; 66(5):819-34.
Bantam Books; 1995. 21. Song HY, Shin SH. The effects of emotional
10. SunGok YH, Park SD, Lee YS. Research trends intelligence on the career decision-making self-
on multicultural perception and attitude of efficacy and career decision levels of the nursing
Korean college Students. Multiculture & Peace. students. Journal of the Korea Academia-Industrial
2013;7(2):173-203. Cooperation Society. 2016;17(9):628-40.
11. Lee KH, Song JS. The Effect of emotional 22. Lee OS, Gu MO. Development and effects of
intelligence on self-efficacy and job stress of emotional intelligence program for undergraduate
nurses-mediating role of self-efficacy. Journal nursing students: mixed method research. Journal
of Korean Academy of Nursing Administration. of Korean Academy of Nursing. 2014;44(6):682-
2010;16(1):17-25. 96.
12. Downey L, Johnston P, Hansen K, Birney J, Stough 23. Beydler KW. The role of emotional intelligence in
C. Investigating the mediating effects of emotional perioperative nursingand leadership: Developing
intelligence and coping on problem behaviours skills for improved performance. AORN Journal.
in adolescents. In Austin EH and Saklofske DH 2017;106(4):317-23.
(eds). Emotional Intelligence. Australian Journal of 24. Afolabi OA. Roles of personality types, emotional
Psychology. 2010;62(1):20-9. intelligence and gender differences on prosocial
13. Shin EJ, Park YS. Emotional intelligence, ego behavior. Psychological Thought. 2013;6(1):124-
resilience, stress in clinical practice of nursing 39.
students. Journal of the Korea Academia-Industrial 25. Kim NH, Lim SY. Relationships between
Cooperation Society.2013;14(11):5636-45. multicultural awareness, multicultural attitude and
14. Yang SY. The effect of emotional intelligence and multicultural efficacy among nursing students.
self-efficacy on clinical competence of the nursing Journal of Multicultural Education Studies.
students. The Journal of The Korea Contents 2014;7(4):169-84.
Association. 2015;15(6):370-8. 26. Jeon MS, Kim HJ, Ka YR, Kim JW, Kim JS, Park
15. Wong CS, Law KS. The effects of leaders and SH, et al. Recognition and attitude of multiculture
follower emotional intelligence on performance in undergraduate students. Journal of the Korean
and attitude: An exploratory study. The Leadership Society for Multicultural Health. 2013;3(1):9-14.
Quarterly. 2002;13(3):243-74. 27. Ponterotto JG, Ruckdeschel DE, Joseph AC,
16. Jung HY. Effectiveness of emotional leadership and Tennenbaum EA, Bruno A. Multicultural
emotional intelligence of foodservice employees personality dispositions and trait emotional
on organizational performance in contracted food intelligence: an exploratory study. The Journal of
service management company [dissertation]. Social Psychology. 2011;151(5):556-76.
[Seoul]: Yonsei University; 2006. 28. Beard KV. Examining the impact of critical
17. Kim JA, Choi J. Correlation and influencing factors multicultural education training on the
of multicultural awareness and cultural sensitivity multicultural attitudes, awareness and practices of
among Korean nursing students. Journal of nurse educators. Journal of Professional Nursing.
Multicultural Education Studies. 2016;9(4):67-88. 2016;32(6):439-48.
18. Kim NY. Development and validation of the 29. Hwang HY, Chyn YE, Hur J. Effects of multicultural
multicultural awareness scale for adolescents understanding subject on the empathy and
[master’s thesis]. [Seoul]: Sung Kyun Kwan multicultural attitude of nursing student. Journal
University; 2012. of the Korea Academia Industrial Cooperation
Society. 2015;16(1):106-15.
19. Kang HJ, Lim EM. Validation study of multicultural
attitude scale for Korean university students. Asian 30. Kim JH. A study about cultural sensitivity and
Journal of Education. 2012;13(4):35-57. stereotype about immigrant women among
nursing students. Journal of Digital Convergence.
20. Munroe A, Pearson C. The Munroe multicultural
2014;12(7):305-14.
attitude scale questionnaire: a new instrument
DOI Number: 10.37506/mlu.v21i1.2438 Medico-legal Update, January-March 2021, Vol. 21, No. 1 949
Shahla’a Fadhil Sabir1,2, Wifaq Mahmood Ali Alwatar3, Bassam Francis Matti4,5
1Lecturer, The National Center of Hematology, Al-Mustansiriyah University, Baghdad, Iraq, 2Microbiology &
Immunology Department, College of Medicine, University of Baghdad, Baghdad, Iraq, 3Assist. Prof. Unit of
clinical & communicable disease, College of Medicine, University of Baghdad, Baghdad, Iraq, 4Consultant Adult
Clinical Hematology Department, Baghdad Teaching Hospital, Medical City, Baghdad, Iraq, 5Bone Marrow
Transplant Center, Medical City, Baghdad, Iraq
Abstract
Background: Several clinical trials on cancer showed a correlation between elevated levels of regulatory
T cells with either poor prognosis or poor response to some therapies. Hence, in this study we tried to
measure the regulatory T cells (CD4+CD245+) count and to evaluate the program death receptor 1(PD1)
as a one of the main suppressive mechanisms that regulatory T cells use in CML patients with different
molecular response to imatinib therapy. Method: Flow cytometry technique was used to analyze 30 sample
of optimal molecular response of CML patients (BCR-ABL transcripts ≤ 0.1%) and 30 sample of failure
molecular response patients (BCR-ABL transcripts >1%) with or without hematological failure, in order to
assess the CD4+CD25+ T cells (Tregs) and PD1 expression on these cells. Thirty samples age and gender
matched were used as healthy controls. Results: A high proportion of CD4+CD25+ T cells was found in
failure groups compared to control and optimal groups(P= <0.001), while there was no significant difference
between control and optimal groups with (P= 0.481). A cutoff value of CD4+CD25+ T cells at >33.7 % was
highly significant with high sensitivity and specificity. This value can be used to determine the failure from
the optimal CML responders. There was no noticeable differences (P= 0.125) in PD1+ expression among
CD4+CD25+ T cells. Conclusion: A high percentage of Treg cells in the failure CML group might be an
indication of immune escape of leukemic cells in those patients compared to the other investigated groups.
Monoclonal antibodies and flow cytometry The median for white blood cells count (WBCx10³/
analyses: The flow cytometry analysis was performed µL) for control was 7.63, range (6.65-8.81). For optimal
on peripheral blood at a maximum interval of 24 hours. response was 6.0, range (5.15-7.29). For failure response
Fluorescently labeled monoclonal antibodies (mAbs) patients was 10.4, range (5.6-27.68), with no significant
included [anti-CD45 (FITC), anti-CD4 (APC/CY7), difference only between control and failure CML
anti-CD25 (APC) and anti-CD279 (PE/CY7)] purchased response group (P= 0.999) as shown in (Fig. 1C).
from (Biolegand, USA), flow cytometry staining was
Medico-legal Update, January-March 2021, Vol. 21, No. 1 951
Figure 1: Patients characteristics according complete blood count among different CML groups and control
group. A) Hemoglobin levels B) Platelet count C) WBCs count.
All CML cases were categorized according to and failure molecular response (FMR), 13(43.3%) had
imatinib therapy response depending on the results of only FMR and there were only 2(6.7%) with BCR-ABL
QPCR for p210 BCR-ABL transcripts and peripheral levels between (> 0.1–1%) had FHR.
blood indices for each patient. There was a significant
difference (P =<0.001) between failure response group By the flow cytometry analysis of CD4+CD25+ T
with mean (28.4 ± 25.1%) and optimal response group cells and PD1 expression among these cells in CML
with mean (0.02 ± 0.03%) regarding the BCR-ABL patients treated with imatinib therapy (Fig. 2). The
transcript levels. All patients with optimal response (mean±SD) of CD4+T cells percentage for the control,
were with major molecular response (p210 BCR-ABL optimal and failure response patients were (37.70±7.96%,
transcripts ≤ 0.1%), and 19(63.3%) of them had molecular 38.39±8.55% and 35.86±9.55%, respectively) with
response with BCR-ABL level (0.1– >0.0032%) log3 (P= 0.5). Among these CD4+ T cells the median of
& 4 reduction in BCR-ABL1 transcripts levels, while CD4+CD25+ Tregs percentage for the control was 8.8,
the other responders patients with 11(36.7%) had BCR- range (4.8-16.2), for optimal response 16.6, range (5.2-
ABL (≤0.0032) log4.5 & 5 reduction levels. 50.2) and for failure response patients was 71.7, range
(52.0-92.8). There was no significant difference between
Among failure responders patients, there were control and optimal groups with (P= 0.481), while there
93.3% had (BCR-ABL transcripts >1%). 15(50%) out was a significant increase in percentage of CD4+CD25+
of them had a failure hematological response (FHR) Tregs in failure groups compared to the control and
952 Medico-legal Update, January-March 2021, Vol. 21, No. 1
optimal groups (P= <0.001) for both as shown in (Table CD4+CD25+ T cells, although data fail to reach
1; Fig. 3). significancy but there was a higher expression in PD1
percentage in failure groups compared to optimal and
Regarding PD1expression, data demonstrate no control groups (Table 1).
significant differences (P= 0.125) in PD1+ among
Table 1: Assessment of CD4+CD25+ T cells percentage among different CML patients and control group.
*Presented using their mean ± standard deviation, # Presented using their median (interquartile range)
Figure 2: Flow cytometric analysis among different CML groups and control group.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 953
A) Gate for CD4+CD25+Tregs in all CD4+ T cells B) Gate for PD1 expression in CD4+CD25+ Tregs.
Figure 3: Percentage of CD4+CD25+ T cells among different CML groups and control group.
Receiver operating characteristic (ROC) curve in (Table 2). However, a cutoff value at (>33.7 %) was
analysis was applied in order to determine a cutoff value highly significant with high sensitivity and specificity
of CD4+CD25+ Tregs by comparing their percentage that can be utilized to discriminate failure from optimal
among studied groups. Data failed to discriminate responders as shown in (Table 3).
between optimal response and healthy control as shown
Table 2: The Roc analysis for CD4+CD25+ Tregs percentage in studied groups
AUC: area under the curve, CI: confidence interval, SN: sensitivity, SP: specificity
Shalini S.P.1, Balaji K.2, Yuvaraj Maria Francis3, Gunapriya Raghunath4, Vijayalakshmi S.5
1
Phase I MBBS, Saveetha Medical College and Hospital, Thandalam, Chennai, India, 2Tutor, Department of
Anatomy, Saveetha Medical College and Hospital, Thandalam, Chennai, India, 3Assistant Professor, Department
of Anatomy, Saveetha Medical College and Hospital, Thandalam, Chennai, India, 4Professor & Head, Department
of Anatomy, Saveetha Medical College and Hospital, Thandalam, Chennai, India, 5Professor, Department of
Anatomy, Saveetha Medical College and Hospital, Thandalam, Chennai, India
Abstract
Background: Sleep is a basic need of every individual, essential for a better quality of life and performance
in the activity of daily living. Humans spend a third of their life sleeping. Even then, sleep disturbance is
the common health issue in modern society which promotes late-night gatherings and shift-based work.
Segmented sleep is one or many naps with one core sleep where the awake period also takes place in two or
more sessions. Segmented sleep is considered to be an unhealthy practice today, is the way that our ancestors
slept until the last few centuries.
Aim and Objectives: The study aims to assess the effect of segmented sleep patterns among medical
students and correlating it with the academic performance of them.
Method and Materials: This study was done on 300 students with both male and female participants. A
questionnaire was developed after the elaborated discussion and circulated among the students. The data was
then analyzed using Microsoft Excel 2010.
Results: The overall quality of the sleep, regardless of how long participants slept was highly satisfactory in
61% and about 47% of participants spend 6–7 sleeping hours. Segmented sleeping among the participants
has a positive impact on academic performance which was both, directly and indirectly, related to the amount
of time spent by the participants in their studies.
Conclusion: Segmented sleep is the most natural way of treating sleep deprivation among the adolescent.
Therefore, the segmented sleep pattern can be inducted in the daily schedule and then modifying to suit the
individual’s lifestyle.
Figure 1: Showing the number of sleeping hours per day among the participants
Figure 3: Showing the segmented sleep among hostelers and day scholars
960 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Acknowledgments: The authors are thankful to all 8. Nissin, Laura. Sleeping culture in Roman literary
the faculties of the Department of Anatomy, Saveetha sources. Arctos. 2015; 49.
Medical College and Hospital, Saveetha Institute of 9. Barbato G, Barker C, Bender C,Giesen HA,Wehr
Medical And Technical Sciences (SIMATS), Chennai, TA, Extended sleep in humans in 14 hour nights
India, for the support and gratitude to carry out this work. relationship between REM density and spontaneous
awakening Electroencephalography and clinical
Funding: Self-funding
Neurophysiology. 1994; 90: 291-297
Conflicts of Interest: The authors don’t have any 10. Niemi PM, Vainiomaki PT. Medical students’
conflicting interests. distress – quality, continuity and gender differences
during a six-year medical programme. Med Teach
References 2006; 28(2):136–141.
1. Curcio G, Ferrara M, De Gennaro L. Sleep loss, 11. Pelayo RP, Thorpy MJ, Glovinsky P. Prevalence of
learning capacity and academic performance. Sleep delayed sleep phase syndrome among adolescents.
Med Rev.2006;10(5):323–337. Sleep Res.1998;17:391
2. Jewett ME, Dijk DJ, Kronauer RE, Dinges DF. 12. Regestein QR, Pavlova M. Treatment of delayed
Dose-responserelationship between sleep duration sleep phase syndrome. Gen Hosp Psychiatry.
and human psychomotor vigilance and subjective 1995;17:335-345.
alertness. Sleep. 1999; 22(2):171–179. 13. Ando K, Kripke DF, Ancoli-Israel S. Estimated
3. Roth T, Ancoli-Israel S. Daytime consequences and prevalence of delayed and advanced sleep phase
correlates of insomnia in the United States: Results syndromes. Sleep Res. 1995;24:509.
of the 1991 National Sleep Foundation Survey II. 14. Phillips, A. J. K., Clerx, W. M., O’Brien, C. S., Sano,
Sleep. 1999; 22:S354–S358. A., Barger, L. K., Picard, R. W., Lockley, S. W.,
4. Foley DJ, Monjan AA, Brown SL, Simonsick EM, Klerman, E. B., & Czeisler, C. A. Irregular sleep/
Wallace RB, Blazer DG. Sleep complaints among wake patterns are associated with poorer academic
elderly persons: An epidemiologic study of three performance and delayed circadian and sleep/wake
communities. Sleep. 1995; 18(6):425–432. timing. Scientific Reports, 2017; 7(1):3216.
5. Loayza HMP, Ponte TC, Carvalho CG, Pedrotti 15. Mirghani HO, Mohammed OS, Almurtadha YM,
MR, Nunes PV, Souza CM,Zanette CB, Voltolini Ahmed MS: Good sleep quality is associated with
S, Chaves ML. Association between mentalhealth better academic performance among Sudanese
screening by self-report questionnaire and insomnia medical students. BMC Res Notes. 2015; 8:706.
in medicalstudents. ArqNeuropsiquiatr.2001; 16. Ekirch, A. Roger. “Sleep We Have Lost: Pre-
59(2–A):180–185. Industrial Slumber in the British Isles.” The
6. Parkerson Jr GR, Broadhead WE, Tse CK. The American Historical Review 2001; 106(2): 343-86.
health status and life satisfaction of first-year 17. Alotaibi AD, Alosaimi FM, Alajlan AA, Khalid
medical students. Acad Med. 1990; 65(9):586–588. A. Rahman BA,The relationship between sleep
7. Eliasson AH, Lettieri CJ, Eliasson AH. Early quality, stress, and academic performance among
to bed, early to rise! Sleep habits and academic medical students J Family Community Med. 2020;
performance in college students. Sleep Breath. 27(1): 23–28.
2010; 14(1):71–75.
DOI Number: 10.37506/mlu.v21i1.2440 Medico-legal Update, January-March 2021, Vol. 21, No. 1 961
Abstract
Pseudomonas aeruginosa have ability to form biofilm, this biofilm responsible for wide infections and
antibiotic resistance development. A novel mechanism to antibiotic resistance mechanisms utilized by
biofilm represented by the presence of ndvB geneencodes a glucosyltransferase enzyme involved in the
formation of this glucans, thisglucan mediated sequestration antibiotic away from their cellular targets.
In this study was collected 145 samples from burns patients and identification by biochwmicaltsets and
Vitek-2 compact. The studied the biofilm formation was measured using micro titer plate method we found
that 49 isolates (100%) of P.aeruginosa were biofilm positive and measured minimal biofilm inhibitory
concentration(MBIC) of biofilm P.aeruginosa positive biofilmused cefepime as antibiotic was tested using
microtiter plate microdilution method (MBIC) values (1gm/ml).Molecular detection of ndvB gene was
measured using PCR 100% of isolates were found to contain ndv B gene. Expression of ndvB gene was
significantly high in biofilm isolates using sub- MBIC values of cefepime. Expression of ndvB gene was
significantly high in biofilm isolates using glucose with concentration 1% and 2%. This study we concluded
biofilm formation is an important trait of P.aeruginosa that isa cause of antibiotic resistance. ndvB gene
expression responsible for the biofilm resistance mechanism in P. aeruginosa biofilms.
Abstract
Background and Aims: Physical abuse is the most critical problem in Mosul city children and the extent of
physical abuse is currently unknown. Aim of this study to determine the prevalence of physical abuse among
sample of Mosul schoolchildren, aged 12–18 years.
Material and Method: A cross-sectional study was carried out from 1st, December 2018 to 4th March 2019.
The settings chosen by multicultural sampling with a systematic sampling technique of 800 child (396 male
and 404 female) using a self-reported questionnaire.
Result: A total of 800 intermediate school children, age group 14-15 years represent 43.6%, male to female
ratio 1:1, 36.1% of these had experienced physical abuse and 32.6% abused by mothers. The relationship
between the parent educations and father’s job shows high significant rate 0.000, 0.004.
Conclusion: physical abuse Mosul city had high prevalent in comparison with others. Psychological and
physical problems of children were the main predictors.
Results
Table 1: Social and demographic characteristics of study sample
Table 1:shows that age group 14-15 year represent 43.6%. male to female ratio approximately 1:1.
968 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 2: Abuse characteristic of the study samples
Table 2:36.1% is the prevalence of abuse in family sample and 32.6% of children abused by their mothers.
Table 3 shows that children not have psychological and medical problem in 73.1% and 73.4 respectively.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 969
Table 4: The child response after hits of the study samples
Table 4 shows the child response after hits the children for family in the study is social withdrawal in 27.9%.
Table 5: The relationship between the parent educations, Jobs with child Abuse
Table 5 shows the relationship between the parent educations, job and child abuse shows high significant rate
0.000.
970 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 6: The relationship between the social factors with child abuse
Table 6 shows that highly significant with family income, presence of stress at work, absence of father, and
alcoholic father.
Abstract
As we know that healthy periodontium, is affected in most of the periodontal diseases. Which further leads to
damage of hard and soft tissues. To attain back the lost structures the use of bone grafts have shown promising
results. Managed either by mechanically recontouring it or by grafting techniques. Replacement grafts are
widely accepted as bone formation by promoting for periodontal regeneration . There are many bone graft
material which are used as bone substitute to fill the defect site the graft material acts like scaffold on which
body react it by certain bone mechanism helps to regenerate new bone. This article give an overview on
history, rationale and objectives of bone replacement grafts, Biology of bone healing, Indications for bone
grafting include, Ideal requirements of bone grafts,List of bone graft according to origin.
Abstract
Suicide is an important mental health problem in our society, as it is in most of the world’s developed
nations. It’s an affliction that robs us of some of our community’s most active leaders. It is a most troubling
type of mental disease to imagine, a mental disorder in which the victim’s pain and fear causes him to prefer
death to his misery. Suicide is widespread. Most communities have earlier treated suicide as a felony and
have instituted laws to restrict the act and prosecute those who attempt it whereas the notion have changed
and now individuals who try or commit suicide are frequently viewed as depressed or mentally unstable.
This Covid(Corona virus) pandemic had made the situation worse because many people are taking help
from professionals for the first time due to severe increase of anxiety and stress. During this lockdown
period many have developed suicidal tendencies and seeking physicians’ help. After the suicide of famous
bollywood actor Sushant Singh Rajput many are talking about the mental health awareness. In this present
paper we will analyze the problem of suicide, mental health care laws and suicide regulation and some
strategies for suicide prevention.
Abstract
Background: Lead and it’s compound induced health problems are continue to be an important, preventable
public health issue. The common source of lead exposure in modern days is cosmetic products.
Aim and Objectives: The study aims to evaluate the awareness about the adverse effects of lead-containing
cosmetics in adolescence and the young adult population including factors influencing customers, knowledge
about the product ingredients, and quality.
Materials and Method: In this study, a questionnaire was prepared using Google form and circulated
among the adolescence and young adult subjects to assess the awareness about the adverse effect of lead in
cosmetics. The study sample comprised of totally 203 participants of both males and females with the age
group between 16 to 24 years.
Results: In this study, it is found that 87% of the participants were aware that cosmetic products harm their
health. 78% of the participants know lead and its compounds present in the cosmetics. 86% of participants
have the habit of checking the ingredients and quality of cosmetic products. About 96% of the participants
were influenced by the advertisement of the product before buying it.
Figure 2: Showing knowledge presence of lead and its compounds in the cosmetics
Abstract
In 2020, Indonesia will hold regional head elections simultaneously in 270 regions covering 9 provinces,
224 districts and 37 cities, voting on 9 December 2020. This study aims to analyse the potential for general
elections in the midst of Covid-19 pandemic in Indonesia..Descriptive qualitative research method are
used in which the data is obtained through interactive discussions, interviews and document searches. The
results of our analysis conclude that there are 4 potential vulnerabilities in the 2020 elections, namely the
availability of the budget, the readiness of election organizers, the number of alleged violations and the level
of community participation. Recommendations for this study are the efforts to collaborate, coordinate and
communicate well between the government and the election organizer and increase public participation.
Likewise, at the campaign stage carried out on The third potential vulnerability is the number of
September 26 to December 5, 2020. Participants in alleged violations that occurred during the regional
the regional head election can carry out campaign head election. This potential vulnerability is likely to
forms such as limited meetings, face-to-face/dialogue arise due to conditions affected covid-19, for example
meetings, public debates, installation of campaign the stages that are usually carried out in physical
props, media advertisements and forms others that do meetings or face to face now turn to virtual. This can
not violate laws and regulations. The KPU also provides result in the stages not running optimally, the level of
time for regional head election participants to carry out compliance of the organizers with the covid-19 protocol
Medico-legal Update, January-March 2021, Vol. 21, No. 1 993
and alleged violations committed by participants in the situation there is a possible cause for the decline in the
elections. Alleged violations that are expected to occur level of community participation due to the concern/fear
include alleged abuse of authority, vote buying, black of the danger of covid-19 transmission. For this reason,
campaigns, campaign violations on social media and the government and election organizers must actively
also the neutrality of the civil servants. Furthermore, disseminate information to the public on the importance
allegations of campaign violations on social media are of community participation. Without the participation of
expected to increase compared to the 2019 elections. the community, there will be no regional head election
This estimate arises because of restrictions on campaign with integrity and fair. In addition to the criteria for
activities that are mass gathering or physical gatherings. public participation, elections with integrity and fairness
These restrictions are carried out in accordance with must meet the criteria of equality between citizens, legal
the recommendations of the Covid-19 health protocol certainty, free and fair competition between election
from the government. Instead, campaign activities contestants, professional, impartial and independent
can be carried out using internet media/online. This organizing institutions, integrity of collection and vote
will later encourage increased use of social media in counting and fair and timely resolution of election
the 2020 elections. Moreover, the cost of using social disputes11.
media campaigns is cheaper than campaigns using mass
media9. Conclusion
Regarding the alleged violation of the neutrality of Indonesia will hold a regional head election 2020
the civil servants, this alleged violation has been rife in the midst of Covid-19 pandemic. There are 270
since the start of the 2020 elections until now. This regions holding regional elections this year, consisting
violation is prone to occur in areas where the incumbent of 9 provinces, 224 districts and 37 cities. The voting
regional head is running again. With his power, the itself will be held on December 9, 2020. Potential
incumbent head easily mobilized civil servants to vulnerability in the regional head election this time
support his candidacy. Meanwhile, Law No. 5 of 2014 includes 4 potential namely availability of budget,
concerning civil servants and also Gov. Reg No.42/2004 readiness of election organizers, the emergence of
explicitly explained that civil servants must be neutral, many allegations of violations and public participation.
impartial and impartial, but in practice many civil Recommendations from this study are collaborative
servants committed violations. Bawaslu recorded in the efforts, coordination, and communication between the
2020 regional head elections there were 342 suspected government and election administrators. In addition to
cases of violation of civil servants neutrality as of June increasing public participation is also needed so that the
19, 2020. election of regional heads 2020 in Indonesia is quality
and fair.
The fourth potential vulnerability is community
participation. Participation in this case includes not only Ethical Clearance: This research was ethically
participation in exercising their voting rights but also approved by Faculty of Law, Universitas Diponegoro,
actively participating in each stage of the election. For Semarang, Indonesia
example, in the factual verification stage for individual Funding: The research was financially funded by
candidate pairs, residents who support the candidate Faculty of Law, Diponegoro University from the 2020
pairs are willing to be met by the verification team fiscal year.
of the KPU, or at the voter data update stage, active
citizens check and re-check whether they are registered Conflict of Interests: There are no conflict of
on the voter list; residents are also expected to actively interests
participate in conducting participatory supervision at
each stage and report suspected violations. References
Under normal conditions, several things that cause a 1. Simamora J. Eksistensipemilukadadalamrangka-
low level of community participation in the elections are mewujudkanpemerintahandaerah yang demokratis.
the distrust of the community towards the candidate pair, Mimbar Hukum-Fakultas Hukum Universitas Gad-
the disinterest with the candidate and the perceived lack jah Mada. 2011;23(1):221-36..
of benefits from the elections10. In the covid-19 pandemic 2. Nuryanti S. Intervensipenyelenggaraanpemilukada:
994 Medico-legal Update, January-March 2021, Vol. 21, No. 1
regulasi, sumberdaya dan eksekusi. JurnalIlmu Kerangka Hukum Pemilu. Jakarta: Internasional
Sosial dan IlmuPolitik. 2015;19(2):125-40. IDEA; 2004.
3. Lincoln YS, Denzin NK, editors. Handbook of 8. Goodwin-Gill GS. Free and Fair Election:
qualitative research. Sage; 1994. International Standar and Practices. The Asia
4. MDN News Magazines, Impact on elections Foundation; 1999.
International IDEA Stockholm, MDN News 9. Saraswati MS. Social media and the political
Magazine 1 June; 2020. campaign industry in Indonesia. Jurnal Komunikasi
5. United Nation Development Program, Principles Ikatan Sarjana Komunikasi Indonesia. 2018 Jun
for Independent and Sustainable Electoral 12;3(1):51-65.
Management, International Standard for Electoral 10. Winengan W. Local Political Democratization
Management Bodies, Cairo, Egypt, 9-11 April Policy: Voter Participation in the Direct Regional
2012. Head Elections. Jurnal Ilmu Sosial dan Ilmu Politik.
6. Santoso T. Penegakan Hukum Pemilu; Praktik 2018 Sep 5;22(1):61-73.
Pemilu 2004. Tim Peneliti Perdulem; 2006. 11. Surbakti R. Pemilu Berintegritas dan Adil. Harian
7. IDEA Internasional. Standar-Standar Internasional Kompas 14; 2014.
Pemilihan Umum: Pedoman Peninjauan Kembali
DOI Number: 10.37506/mlu.v21i1.2446 Medico-legal Update, January-March 2021, Vol. 21, No. 1 995
Abstract
Leprosy is a disease that has a high burden in the community or called triple burden disease. Support from
the family increase the confidence of individual to interact with others and building positive relationships.
The purpose of this study was to explain the correlation between family social support and the prevention of
disability in patients with leprosy at General Public Hospital of Daha Husada Kediri. The research design was
Cross Sectional. Respondents in the study of Leprosy Patients who met the inclusion criteria at outpatient as
many as 50 respondents used purposive sampling data collection techniques. The variables were disability
and stigma on leprosy patients. The research instrument used a questionnaire filled out by respondents and
more than 50% have moderate stigma and degree of disability in leprosy at most respondents have grade
1. Spearman Rho Test results α <0.005, ρ = 0.035. The conclusion was that there is a relationship between
disability and stigma on Leprosy Patient at General Public Hospital of Daha Husada Kediri.
Result
Table 1: Stigma on Leprosy Patient at General Public Hospital of Daha Husada Kediri
(May-June, 2020)
Stigma Category f %
Mild 0 0
Medium 4 11,43
Moderate 18 51,43
Heaviness 13 37,14
Jumlah 35 100
Table 2: Degree of Disability on Leprosy Patient at General Public Hospital of Daha Husada Kediri (May-
June, 2020)
Degree of Disability f %
0 3 6,0
1 35 70,0
2 12 24,0
Jumlah 50 100
Table 3: Correlation between Disability and Stigma on Leprosy Patient At General Public Hospital of Daha
Husada Kediri (May-June, 2020)
The results of the Spearman’s Rho statistical Based on the results of a study of 50 respondents
test using computer software, based on the level of about the prevention of disability in leprosy at General
significance set at α <0.005, the results obtained ρ Public Hospital of Daha Husada Kediri, the most
= 0.035, it means that there is a relationship between respondents had sufficient disability prevention as many
disability and stigma in leprosy patients at General as 75% respondents
Public Hospital of Daha Husada Kediri.
Disability is a term used to cover three aspects, namely
Discussion damage to structure and function (impairment), activity
limitations and problems of participation (participation
Prevention of Disabilities in Leprosy At General problems). These three aspects are very much influenced
Public Hospital of Daha Husada Kediri. by individual factors and environmental factors. Efforts
Medico-legal Update, January-March 2021, Vol. 21, No. 1 997
to prevent disability can be carried out at home, health regularly for injuries that may occur due to using the
centers or referral service units such as public hospitals hands with bent fingers. On the feet, routinely check the
or referral hospitals. Patients must understand that MDT feet for any parts of the feet that have cracks and injuries.
treatment can kill leprosy germs. But defects in his eyes, Therefore, often stop and check the feet for even minor
hands or feet have already occurred and will remain cuts or bruises or abrasions.3
throughout his life, so he must be able to carry out self-
care regularly so that the disabilities do not get worse.5 Based on the results of behavioral leprosy patient
research, it is sufficient to examine the eyes, hands and
Behavior in an effort to prevent disability and feet. This is because the patient understands enough
increasing disability at home is sufficient. Many things about how to regularly check his eyes, hands and feet.
affect the prevention of patient disability, namely the This is evidenced by the prevention of disability obtained
patient understands the condition of his body by carrying from 50 respondents, there are 9 respondents who have
out the 3M principle, namely, checking the eyes, hands the behavior of examining their eyes, hands and feet
and feet regularly, protecting the eyes, hands and feet both with a percentage (84.1%) in statement number
regularly, caring for the eye, hands and feet of physical 8, namely when walking I avoid friction from shoes/
trauma, caring for oneself. It can be proven that leprosy sandals or sharp objects such as thorns, glass and wire to
patients in examining their eyes, hands and feet have prevent injury to the leg. The age factor can also affect
sufficient preventive behavior. It is supported by the a person’s health. The higher the age of a person, the
results of the research that most of the knowledge about bigger the person is also suffering from various diseases.
leprosy in general, however, knowledge in efforts to The high age must be balanced with a healthy lifestyle
prevent disability through regular treatment is sufficient. such as routine checking of the eyes, hands and feet so
In addition, the current level of disability also affects the that disabilities do not increase.
prevention of disability, the disability experienced by
lepers causes leprosy patients to be careful when doing a Based on the results of research from 50 respondents
job, therefore people with leprosy must always protect, regarding the prevention of leprosy disabilities at
examine and care for their eyes, hands and feet so that General Public Hospital of Daha Husada Kediri, most of
disability does not increase to severe.6 This is evidenced the respondents protect their eyes, hands and feet, only
by disability prevention obtained from 50 respondents, 78.8% respondents.
there are 5 respondents who have sufficient disability Protects the eyes, hands and feet from physical
prevention behavior with a percentage (75.4%) in trauma. Provides protection to the eyes from dust and
statement number 12, namely so that I do not get hurt drying out the eyes. Protect your hands from objects
while working I do not do parts that are dangerous to or the environment that cause harm, for example: fire,
my hands. knives, etc. Protects the skin of the hands from objects
Based on the results of a study of 50 respondents that are easy to cause injury such as: sharp objects, heat.
regarding the prevention of leprosy disabilities at Use tools for everyday activities that are modified for
General Public Hospital of Daha Husada Kediri, Kediri, use by crooked fingers. To prevent the broken feet from
more than 50% of respondents examined their eyes, getting more deformed, it is advisable to always wear
hands and feet, only 69.2% respondents. shoes so that the fingers do not get tangled. Prevent dry
skin by soaking feet for 20 minutes every day in plain
Based on the theory, how to keep your eyes in good water, rubbing the thickened area with direct rubbing
condition when your eyes feel dry is to close your eyes stones, smearing (without drying) with coconut oil to
as often as possible.7 Often look in the mirror to see if moisture the skin. Protect your feet by wearing footwear,
there is a foreign object or redness in the eye. How to dividing household tasks so that other people do the
check the hands or feet when there are cuts or blisters dangerous parts if your feet are numb.8
can also affect the risk of deformity or increased defects.
On the hands often stop and check the hands carefully Based on the results of research on leprosy patients
for cuts or blisters, generally if the skin is Dry hands in taking preventive measures by protecting body parts
are accompanied by numbness causing muscle weakness that can cause disability and increasing disability, this is
or even paralysis. Therefore always check for possible because protecting the eyes and feet can reduce the risk
dryness of the hands and fingers, check the hands of injury, so patients need to get education and attention
998 Medico-legal Update, January-March 2021, Vol. 21, No. 1
every time they exercise control in health services. This The results of statistical tests using Spearman’s
is evidenced by the prevention of disability, obtained Rho at the level of significance set at α ≤0.05 obtained
from 50 respondents, there are 4 respondents who have results of ρ = 0.053, where ρ> α which means there is
good behavior in examining their eyes, hands and feet a relationship between stigma and disability in leprosy
with a percentage (75.9%) in the statement about me patients at General Public Hospital of Daha Husada
not doing the part that is dangerous for numb feet. In Kediri.
addition, work also affects the prevention of protecting
the eyes, hands and feet, the higher the workload, the Based on the results of the data research, it was
higher the disability. This can be proven because most found that the majority of respondents experienced
of the leprosy patients work as entrepreneurs, if the sufficient stigma, that is, most civil servants experienced
patient does not protect the eyes, hands and feet then the severe stigma, namely 3 respondents or (75.0%).
disability can occur and the disability will increase. The results of this study are inversely proportional to
research (Soedarjatmi et al., 2009) Most of the patients
Based on the results of a study of 50 respondents do not work, apart from finding it difficult to find work
regarding the prevention of leprosy disabilities at for leprosy patients, they are afraid if their leaders and
General Public Hospital of Daha Husada Kediri most friends know that the respondent has leprosy and the
of the respondents treated their eyes, hands and feet as respondent is very aware that fatigue will result in a
many as 73.1% respondents. recurrence of the disease. By not working, the respondent
stated that they had no income.
Take care of the eyes, hands and feet. If they feel dry,
give an eye patch at rest. If there is, no matter how small, Leprosy has a wide impact on the lives of sufferers,
take care and rest some of it until it heals. Soak for 20 from marriage, work, personal relationships, business
minutes every day in water, clean thick skin (not drained) activities to their attendance at events in the community.
then smear with coconut oil or other oil to keep moisture. Most of the respondents have suffered from leprosy
Caring often maybe every day using hands to straighten between 1 year and 5 years, in this long period of time
joints -Joint and prevent heavier stiffness. Take care of the respondent must always seek medication and take
your semper legs so they don’t get worse by sitting with medication as regularly as possible, if it is late for
your legs straight forward. Prevention of wounds if there treatment, the respondent states that the disease will
are bruises or small abrasions, immediately treat and rest reappear. Stigma causes discrimination so that it is
the feet until they heal, namely resting the feet. Give eye difficult to find accommodation and work because of the
drops containing saline, if the eyes clinical manifestations that arise and the complications
that occur. People also feel reluctant to live side by
Based on the results of the study of leprosy patients side with leprosy patients. Most of the leprosy patients
in the behavior of caring for the eyes and feet, it is are civil servants because civil servants can elevate a
sufficient to understand the things that cause disability. person’s social status to the highest level, giving more
The consequences that occur are not done every day respect from society, so if leprosy patients get stigma
which can prevent disabilities and increasing disabilities then their social status will decrease. One of the impacts
in sufferers so it is very necessary to carry out preventive caused by stigma is the occurrence of physical disability.
behavior, but patients tend not to pay attention in the act Based on the results of the study, it was found that the
of caring for oneself. This is evidenced by the prevention level of disability 2 was more than 50.0% namely 60.5%
of disability obtained from 50 respondents, there are respondents. Stigmatization because physical disabilities
4 respondents who have good behavior in examining are part of the group with physical deformities so that
their eyes, hands and feet with a percentage (82.6%) there are visible deformities in leprosy patients.
in statement number 18, namely I treat numb hands by
avoiding hot objects and sharp. Therefore, the treatment Conclusion
that leprosy patients should do is soak for 20 minutes
every day in water, clean the thick skin (not dried) then Leprosy patients at General Public Hospital of
smear it with coconut oil or other oil to keep moisture, Daha Husada Kedirihave moderate stigma and disability
straighten joints and prevent heavier stiffness.9 degree is grade 1. However, there is a relationship
between stigma and disability on leprosy patient at
Correlation between Disability and Stigma in General Public Hospital of Daha Husada Kediri.
Leprosy Patients at General Public Hospital of Daha
Husada Kediri
Medico-legal Update, January-March 2021, Vol. 21, No. 1 999
For people with leprosy, they can take preventive Reference
measures for disability and increasing disability by
1. Nsagha, D.S., Bissek, A. C. Z., Njuanda AL. Social
implementing the 3M principle, checking, protecting
Stigma as an Epidemological Determinant for
and treating, so that disabilities do not increase and they
Leprosy Elimination in Cameroon. J Public Health
can carry out activities so that they do not affect the
Africa. 2018;2.
fulfillment of daily needs. In addition, the need for health
education to families and lepers about the importance of 2. Kunouli. Asuhan Keperawatan Penyakit Tropis.
the role of the family in preventing disability to help the Jakarta: CV Trans Info Media; 2012.
healing process for leprosy patients.10 3. Indonesia KR. Pedoman Nasional Progam
Pengendalian Penyakit Kusta. Jakarta: Bakti
Acknowledgement: We thank the Ministry of Husada; 2012.
Science Research, Technology and Higher Education
4. House. Buku Ajar Keperawatan Keluarga: Aplikasi
of Indonesia (RISTEKDIKTI RI) for Research Grants
Teori Pada Praktik Asuhan Keperawatan Keluarga.
2019 and providing 2020. We thank you to Director of
Jakarta: Trans Info Media; 2013.
Kediri Daha Husada General Public Hospital and all
research respondents 5. Kesehatan K. Penanggulangan Kusta. Indonesia:
Kementerian Kesehatan Republik Indonesia; 2019.
Conflict of Interest: None to declare 6. Wiwiek N. Gambaran Konsep Diri Klien Kusta. J
Source of Funding: Ministry of Research and Ilm Kesehat. 2013;5(2).
Technology/National Research and Innovation Agency 7. Susanto. Perawatan Klien Kusta Di Komunitas.
Deputy for Research and Development Strengthening Jakarta: Trans Info Media; 2013.
for Fiscal Year 2020. 8. Dhelya W. Penyakit Kusta Sebuah Prespektif
Klinis. Malang: UB Press; 2018.
Ethical Clearance: Ethical clearance from the
Health Research Ethics Commission (KEPK) STIKES 9. Arianti PM. Psycoeducative Family Therapy
Kediri Baptis Hospital. This research has passed ethics Mempengaruhi Pengetahuan, Dukungan Keluarga
with letter number 077/30/III/EC/KEPK-3/STIKES dan Stigma Kusta. J Ners [Internet]. 2016;11(1).
RSBK/2020. Available from: https://www.e-journal.unair.ac.id/
JNERS/article/view/1701
10. Rahman. Hubungan pengetahuan dan sikap
masyarakat terkait kusta terhadap perlakuan
diskriminasi pada pasien kusta. Med Respati. 2013;
11(3).
1000 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2447
Professor, Department of Maxillo Facial Surgeon, College of Dentistry, University of Kufa, Najaf, Iraq
Abstract
This study was conducted to treat patients with primary ameloblastoma and solid/multicystic ameloblastoma
histopathologically. Twenty-seven patients with primary ameloblastoma were treated in the period between
2008 and 2019 in the Department of Oral and Maxillofacial Surgery, and these patients ranged from 16
y to 58 y old and the average age was 37 y. The number of males reached 16 individuals and the number
of females 11 individuals. Twenty-two patients with solid/multicystic ameloblastoma histopathologically
were treated for partial jaw excision along with the restoration of bone plate osteosynthesis and 2 cm was
used to remove a surgical free margin with bone correction, and three patients with bone metastasis were
treated with excision, and the marginal jaw was removed with a 1 cm free margin with a reconstructive
bone structure. Patients with unicystic ameloblastoma were treated through partial removal of the lower jaw
with bone structure with titanium, and 1.5 cm was used as a free margin useful for bone health. There are
3 patients out of twenty-two infected primary solid/multicystic ameloblastoma were present with cases of
repeated visualization of radiation are sick after 7 y of surgery and during routine follow-up, one patient was
offered during the 6 y after the operation.
Figure 1: (a) Extraoral swelling. (b) Intraoral tumor. (c) Axial CT.(d) Mandibular segmental resection.
(e) Performed reconstructive plate. (f)Postoperatively
The results showed that two patients had unicystic osteosynthesis; thus, 1.5 cm was used as a margin with
ameloblastoma and were treated by segmental resection some health of bone (Table 2).
of the mandible with titanium reconstructive bone plate
Two patients received surgery during routine ameloblastoma, and those treated with resection of soft
follow-up after seven years, and there is one patient tissues and marginal mandibulectomy with a 1 cm free
came six years after the operation. Also, there was one margin part of the muscle that communicated with the
patient suffered from primary peripheral ameloblastoma lesion was removed with the bone, with reconstructive
(extraosseous) after nine years of surgery, and that there bone plate osteosynthesis was applied. Likewise, the
were four patients were presented with twenty-seven results of the study showed that there are two patients
were operated as primary ameloblastoma, the recurrence with unicystic ameloblastoma were treated by segmental
rate was (14.8%). resection of the mandible with titanium reconstructive
bone plate osteosynthesis so that 1.5 cm was used as an
Discussion important margin for dental health.
Admantinoma is considered a dental polyp, and this
Conclusions
is what Ivory and Churchill called what is known as
ameloblastoma[28]. As for the results that have to do with The treatment depends on several factors, the most
the age group, according to what was mentioned in this important of which is the aggressiveness of the tumor,
study, the average age ranged 30-39 years. This is in line duration, extent, size, histopathological type, and
with Fatemah Faras et al. (2017) study, which stated that radiographically appearance, especially if the radiation
the average age was 20-40 years, while the age group is multi-site while maintaining an indefinite margin. As
that was present in Andrew (2015)[27] study ranged 30- for the recurrence of occurrence, it depends on the age of
60 years, i.e. ameloblastoma It was introduced during the patient, anatomical site, molecular histopathology,
the third and fourth decades of life[17]. In this study, genetic mutation, and/or density of bone, which is
radical surgery was addressed with appropriate margins, the main barrier to the repetition of the local area, so
so that twenty-two patients with solid/multicystic aggressive surgery is a good indicator of removing the
ameloblastoma were treated through partial removal of tumor. Also, the frequency is affected by the type of
the lower jaw with the completion of the restoration and molecular etiological cause, how early patientsreceive
bone-building process, as 2 cm was used as an important treatment, and type of surgery affected the recurrence
surgical free margin to maintain bone health. Three rate of ameloblastoma.
patients were suffering from an extraosseous type of
1004 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Ethical Clearance: This study was approved by 9. Jussila M, Thesleff I. Signaling networks regulating
the Ethics Committee, University of Kufa. The study tooth organogenesis and regeneration, and the
protocol was thoroughly explained for using samples of specification of dental mesenchymal and epithelial
patients and written informed consents were obtained cell lineages. Cold Spring Harbor, Perspect Biol
from them prior to participation in the study. This 2012;4(4): a008425.
investigation was done according to the principals of 10. Gupta N, Saxena S, Rathod VC, Aggarwal P.
the Declaration of Helsinki. All patients were informed Unicystic ameloblastoma of the mandible. Oral
about the aims and protocol of the study. MaxillofPathol 2011;15(2):228.
Source of Funding: By Self 11. Kurppa KJ, Catón J, Morgan PR, Ristimäki A,
Ruhin B, Kellokoski J, Elenius K, Heikinheimo
Conflict of Interest: Nil K. High frequency of BRAF V600E mutations in
ameloblastoma. Pathol 2014;232(5):492-8.
References 12. Sweeney RT, McClary AC, Myers BR, Biscocho J,
1. Oginni FO, Stoelinga PJ, Ajike SA, Obuekwe ON, Neahring L, Kwei KA, Qu K, Gong X, Ng T, Jones
Olokun BA, Adebola RA, et al. A prospective CD, Varma S. Identification of recurrent SMO and
epidemiological study on odontogenic tumours BRAF mutations in ameloblastomas. Natu Genet
in a black African population, with emphasis on 2014;46(7):722-5.
the relative frequency of ameloblastoma. Oral 13. Fregnani ER, Perez DE, Paes de Almeida O, Fonseca
MaxillSurg 2015;44(9):1099-105. FP, Soares FA, Castro‐Junior G, Alves FA. BRAF‐
2. DeVilliers P, Suggs C, Simmons D, Murrah V, V600E expression correlates with ameloblastoma
Wright JT. Microgenomics of ameloblastoma. aggressiveness. Histopath 2017;70(3):473-84.
Dent Resear 2011;90(4):463-9. 14. Niault TS, Baccarini M. Targets of Raf in
3. Oomens MA, Van der Waal I. Epidemiology of tumorigenesis. Carcinog 2010;31(7):1165-74.
ameloblastomas of the jaws; a report from the 15. Mishra P, Panda A, Bandyopadhyay A, Kumar H,
Netherlands. Medic Oral, Patol Oral Y Cirug Buca Mohiddin G. Sonic hedgehog signalling pathway
2014;19(6):e581. and ameloblastoma–a review. Clinic DiagnoResea
4. Bansal S, Desai RS, Shirsat P, Prasad P, Karjodkar 2015;9(11): ZE10.
F, Andrade N. The occurrence and pattern of 16. Heikinheimo K, Jee KJ, Niini T, Aalto Y, Happonen
ameloblastoma in children and adolescents: An RP, Leivo I, Knuutila S. Gene expression profiling of
Indian institutional study of 41 years and review of ameloblastoma and human tooth germ by means of
the literature. Oral Maxillof Surg. 2015;44(6):725- a cDNA microarray. Dent Resear. 2002;81(8):525-
31. 30.
5. Bassey GO, Osunde OD, Anyanechi CE. 17. Dias LF, de Araujo Vian RL, Nunes PM, Magalhaes
Maxillofacial tumors and tumor-like lesions HE, do Carmo CD, Passos EC, Neves LR. Major
in a Nigerian teaching hospital: an eleven- considerations on the clinical, epidemiological,
year retrospective analysis. AfricHeal Scie. histopathological and therapeutic aspects of
2014;14(1):56-63. ameloblastomas: a systematic review. HealtScie
6. Brown NA, Betz BL. Ameloblastoma: a review 2019;13(3).
of recent molecular pathogenetic discoveries. 18. Dhanuthai K, Chantarangsu S, Rojanawatsirivej S,
BiomarkCanc 2015;7:BIC-S29329. Phattarataratip E, Darling M, Jackson-Boeters L,
7. Sciubba JJ, Eversole LR, Slootweg PJ. Odontogenic Said-Al-Naief N, Shin HI, An CH, Hong NT, An
tumours. In: Barnes L, Eveson JW, Reichart P, PH. Ameloblastoma: a multicentric study. Oral Surg
Sidransky D, eds. World Health Organization Oral Med Oral Path Oral Radio 2012;113(6):782-8.
classification head and neck tumours. 2005, IARC 19. Wright JM, Odell EW, Speight PM, Takata T.
Press: Lyon: p. 283–328. Odontogenic tumors, WHO 2005: where do we go
8. Fan K, Andrews BT, Tabit CJ, Bradley JP. The from here? Head and neck pathology 2014;8(4):373-
Sarnat studies in craniofacial biology. Craniof Surg 82.
2012;23(1):37-43.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1005
20. Ritchie AC. Boyd’s textbook of pathology. Lea and 25. Antonoglou GN, Sándor GK. Recurrence rates
Febiger; 1990. of intraosseous ameloblastomas of the jaws:
21. Dandriyal R, Gupta A, Pant S, Baweja HH. Surgical a systematic review of conservative versus
management of ameloblastoma: Conservative or aggressive treatment approaches and meta-analysis
radical approach. Natiomaxillof surg 2011;2(1):22. of non-randomized studies. Journal of Cranio-
Maxillofacial Surgery. 2015;43(1):149-57.
22. Shen YF, Rodriguez ED, Wei FC, Tsai CY,
Chang YM. Aesthetic and functional mandibular 26. Zhang B, Zhang J, Huang HZ, Xu ZY, Xie HL.
reconstruction with immediate dental implants in Expression and role of metalloproteinase‐2 and
a free fibular flap and a low-profile reconstruction endogenous tissue regulator in ameloblastoma.
plate: five-year follow-up. Annal Plast Surg Oral Pathol Medic 2010;39(3):219-22.
2015;74(4):442-6. 27. McClary AC, West RB, McClary AC, Pollack JR,
23. Huang IY, Lai ST, Chen CH, Chen CM, Wu CW, Fischbein NJ, Holsinger CF, Sunwoo J, Colevas
Shen YH. Surgical management of ameloblastoma AD, Sirjani D. Ameloblastoma: a clinical review
in children. Oral Surgery, Oral MedOral Pathol and trends in management. Europ Arch Oto-Rhino-
Oral RadiolEndod 2007;104(4):478-85. Laryng 2016;273(7):1649-61.
24. Hertog D, Schulten EA, Leemans CR, Winters 28. Hariram SM, Malkunje LR, Singh N, Das S,
HA, Van der Waal I. Management of recurrent Mehta G. Ameloblastoma of the anterior mandible.
ameloblastoma of the jaws; a 40-year single NatiMaxillof Surg 2014;5(1):47.
institution experience. Oral Oncol 2011;
47(2):145‑6.
1006 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2448
Supichaya Wangpitipanit
Abstract
Urinary incontinence is a common problem symptom of urination, an inability to control the urinary
excretion on its own, causing a loss of the ability to control urination. Most often, this happens in situations
where urination is not ready and accidentally slips out. The symptoms will cause hygiene problems, such
as a wound rash, or red marks on the wrong skin until the subsequent infection problem is also a problem
for physical health, impacting the mind, economy, and society. It is a health problem that affects physical,
mental, emotional, and social aspects lead to reduced quality of life. Older people with urinary incontinence
problems, it is caused by several reasons and factors that can cause various issues. This article aims to describe
urinary excretion mechanisms, meaning, types and effects, method for assessing urinary incontinence, and
primary care guidelines for the older people and their families providing home and hospital care. Therefore,
nurse practitioners’ action plays a significant role in helping older people with urinary incontinence. It is a
service through four dimensions: prevention, medical treatment, and nursing care, health promotion, and
rehabilitation. Furthermore, medical history taking by interviews, physical examination, and self-assessment
those are the service nurse roles: health care provider, health educator, counselor, coordinator, and advocator
in the follow-up and contact for improving caring to receive quality care and reasonable to continue to bring
an as good quality of life.
Keywords: Assessment, management, nurse practitioner, older people, role, urinary incontinence.
Sura A. Abdulsattar1, Raghd A.Y. Alkhader2, Haider Ridha Mohammed Saeed3, Fatin F. AlKazazz4
1
Professor, 2Assistant Tutor, 3Assistant Tutor, Department of Chemistry and Biochemistry, College of Medicine,
Mustansiriyah University, Baghdad, Iraq, 4Professor, Department of Chemistry, College of Science,
Mustansiriyah University, Baghdad, Iraq
Abstract
Hepatotoxicity disorders are relatively common in patients with inflammatory bowel disease that includes
ulcerative colitis and Crohn’s disease. Abnormal serum liver functions tests can develop during treatment with
(TNF-α) blocking agents, such as, Infliximab. The aim of this review is to clarify the role of infliximab in the
development of liver enzyme abnormalities in patients with Crohn’s disease. The most common presentation
of infliximab -associated liver injury is a hepatocellular type with auto-immune features, marked by
increased serum aminotransferases levels. Cholestatic injury is much less common, and marked by jaundice
and increased serum ALP and bilirubin levels,with elevations of serum ALT and AST. Abnormalities of liver
function tests in sera of patients with Crohn’s disease typically resolve after discontinuation of infliximab,
although sever liver injury leading to liver transplant cannot be ruled out.
Sura A. Abdulsattar1, Mahmood Nazar Mustafa2, Abdullah Ali Mohammed3, Ahmed Salam Al-zaidi4
1
Prof. Dr. (PHD) Department of Chemistry and Biochemistry, Mustansiriyah University, College of Medicine,
Iraq, 2Assistant Lecturer (MSc) Department of Pathology and Forensic Medicine, University of Fallujah, College
of Medicine, Iraq, 3Assistant Lecturer (MSc) Department of Chemistry and Biochemistry, University of Fallujah,
College of Medicine, Iraq, 4(MSc) Department of Medical Analysis, Al-Furat General Hospital, Iraq
Abstract
The clinical features of COVID-19 are varied, ranging from asymptomatic state to acute respiratory distress
syndrome and multi organ dysfunction. We aim to evaluate renal and liver functions of patients with COVID
19. Laboratory results were obtained from 107 patients with laboratory-confirmed COVID-19 whowere
admitted to the only Al-Furat General Hospital in Baghdad, Iraq from March 3 to June 9, 2020 and followed
up until recovery. Normal levels of renal functions were presented. Meanwhile elevated levels of alanine
aminotransferase (ALT) was observed in 10% and of aspartate aminotransferase (AST) was observed in
40% of patients with COVID 19,yet on comparison of the results at entering with at recovery it was observed
significant differences (p<0.01) of all patients. From these findings we conclude that the virus might be
responsible for systemic inflammation.
Although available sex-disaggregated data for of progressing to severe disease. The detrimental effects
COVID-19 show equal numbers of cases between on liverinjury mainly related to certain medications used
sexes, current study indicates that infectious rates are during hospitalization,and should be monitored and
higher in male than in female, and that may be due to evaluated frequently18.
sex hormone that contribute to different immunologic
responses in men and women: As a general rule, Conclusion
estrogens promote both innate and adaptive immune Elevated levels of alanine aminotransferase (ALT)
responses, which result in faster clearance of pathogens was observed in 10% and of aspartate aminotransferase
and greater vaccine efficacy13. Conversely, testosterone (AST) was observed in 40% of patients with COVID
has largely suppressive effects on immune function, 19,yet on comparison of the results at entering with at
which may explain the greater susceptibility to recovery it was observed significant differences (p<0.01)
infectious diseases observed in men14. Notably, changes of all patients. As AST is not specific for liver damage,
in sex hormone may further shape the immune response which indicated that the systemic inflammation induced
to pathogens14. Sex-related biological data may also be by the virus might be responsible for these findings not
critical to investigate the contribution of sex hormones related to certain medication.
in inflammatory response. In particular, reduction in
testosterone levels in aging men has been associated Conflict of Interest Statement: All authors declare
with increased proinflammatory cytokine levels 14 which that they have no conflict of interest.
may contribute to worse COVID-19 progression in older
men. Sex differences in disease progression may also Source of Funding: Self
be linked to estrogen-induced decreased expression of Ethical Clearance: Taken from Al-Furat general
angiotensin-converting enzyme 215 Pre-print studies hospital-Iraq.
are conflicting as to whether ACE2 expression in lung
tissue is different between sexes16,17. Some patients with References
COVID-19 pneumonia also present with kidney injury,
and autopsy findings of patients who died from the 1. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y,
illness sometimes show renal damage7. In meta-analysis Zhang L, Fan G, Xu J, Gu X, Cheng Z, Yu T, Xia
study of Zhu j et al indicated that some patients with J, Wei Y, Wu W, Xie X, Yin W, Li H, Liu M, Xiao
COVID 19 (25.5%) presented elevated levels of renal Y, Gao H, Guo L, Xie J, Wang G, Jiang R, Gao Z,
functions18. The results of current study indicated that Jin Q, Wang J, Cao B. Clinical features of patients
all patients presented normal levels of renal functions. infected with 2019 novel coronavirus in Wuhan,
However on comparison of the results at entering with at China. Lancet. 2020; 395:497–506.
recovery it was observed significant differences (p<0.01). 2. Chen N, Zhou M, Dong X, Qu J, Gong F, Han
Patients with abnormal liver tests were at increased risk Y, et al. (2019), Epidemiological and clinical
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1021
characteristics of 99 cases of novel coronavirus 10. Ozma MA, Maroufi P, Khodadadi E, Köse Ş,
pneumonia in Wuhan, China: a descriptive study. Esposito I, Ganbarov K, Dao S, Esposito S, Dal T,
Lancet. 2020;395:507–513. Zeinalzadeh E, Kafil HS. Clinical manifestation,
3. Xinhua. China’s CDC detects a large number of diagnosis, prevention and control of SARS-CoV-2
new coronaviruses in the South China seafood (COVID-19) during the outbreak period.Infez Med.
market in Wuhan.2020; Available at: https://www. 2020;28(2):153-165.
xinhuanet.com/2020-01/27/c_1125504355.htm. 11. Humar A, McGilvray I, Phillips MJ, Levy GA.
4. Liu J, Shu YL, and Zhou XN. Transmission patterns Severe acute respiratory syndrome and the liver.
and control of COVID-19 epidemic.Indian Journal Hepatology.2004; 39: 291‐ 294.
of plant physiology .2020; 9:112. 12. Chan HLY, Leung W‐K, To K‐F, et al. Retrospective
5. Rothe Camilla, Schunk Mirjam, Sothmann Peter, analysis of liver function derangement in severe
Bretzel Gisela, Froeschl Guenter, Wallrauch acute respiratory syndrome. Am J Med.2004; 116:
Claudia, Zimmer Thorbjörn, Thiel Verena, Janke 566‐ 567.
Christian, Guggemos Wolfgang, Seilmaier Michael, 13. Bartz D, Chitnis T, Kaiser UB, et al. (2020), Clinical
Drosten Christian, Vollmar Patrick, Zwirglmaier advances in sex- and gender-informed medicine
Katrin, Zange Sabine, Wölfel Roman, Hoelscher to improve the health of all: a review. JAMA
Michael. Transmission of 2019-nCoV Infection Intern Med. [PMID: 32040165] doi:10.1001/
from an Asymptomatic Contact in Germany. New jamainternmed.2019.7194GOOGLE SCHOLAR.
England Journal of Medicine. 2020;(10):970–971. 14. Bianchi VE. . The anti-inflammatory effects of
6. Singhal T..A Review of Coronavirus Disease-2019 testosterone. J Endocr Soc.2019;3:91-107.
(COVID-19).Indian J Pediatr.2020; 87(4): 281– 15. La Vignera S, Cannarella R, Condorelli RA, et
286. al. Sex-specific SARS-CoV-2 mortality: among
7. Guangchang Pei, Zhiguo Zhang, Jing Peng, Liu Liu, hormone-modulated ACE2 expression, risk of
Chunxiu Zhang, Chong Yu, Zufu Ma, Yi Huang, venous thromboembolism and hypovitaminosis d.
Wei Liu, Ying Yao, Rui Zeng, Gang Xu . (2020 Int J Mol Sci.2020;21.
Apr 28),Renal Involvement and Early Prognosis 16. Cai G. Bulk and single-cell transcriptomics identify
in Patients with COVID-19 Pneumonia.J Am Soc tobacco-use disparity in lung gene expression
Nephrol. 2020; 31(6):1157-1165. of ACE2, the receptor of 2019-nCov. MedRxiv,
8. Cai Q, Huang D, Yu H, Zhu Z, Xia Z, Su Y, Li Z, published online .2020; February 02.
Zhou G, Gou J, Qu J, SunY, Liu Y, He Q, Chen 17. Zhao Y, Zhao Z, Wang Y, Zhou Y, Ma Y, Zuo W.
J, Liu L, Xu L, Characteristics of Liver Tests Single-cell RNA expression profiling of ACE2, the
in COVID-19 Patients, Journal ofHepatology putative receptor of Wuhan 2019-nCov. BioRxiv,
.2020;April. 2020; 26
9. Chau TN, Lee KC, Yao H, Tsang TY, Chow TC, 18. Jieyun Zhu, Pan Ji, Jielong Pang, Zhimei Zhong,
Yeung YC, et al. . SARS-associated viral hepatitis Hongyuan Li, Cuiying He, Jianfeng Zhang,
caused by a novel coronavirus: report of three Chunling Zhao. Clinical Characteristics of 3062
cases. Hepatology.2004; 39:302–310. COVID-19 Patients: A Meta-Analysis.J Med Virol.
2020; Apr 15 : 10.1002/jmv.25884.
1022 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2451
Abstract
Background: Leptospirosis is an infectious disease caused by leptospira sp. and many are found in
populations of people who live in rural areas. Leptospirosis is also a zoonotic disease that can be endemic
and has adverse economic, social and psychological impacts. Zoonotic disease is closely related to human
health, animals, and also the environment so that in controlling and preventing it is necessary to have the
involvement or cooperation of various parties absolutely.
Objectives: This study aims to determine cross-sectoral partnership through coordination, communication,
and collaboration in the context of controlling leptospirosis in Jeneponto Regency.
Method: This study is a qualitative study with a phenomenological design. The number of informants in
this study were 14 people. Determination of informants obtained by purposive sampling by determining the
criteria of informants who are willing to be interviewed and play an important role in controlling infectious
diseases.
Results: The findings of this study showed that communication and collaboration during the control of
infectious diseases such as leptospirosis in Jeneponto Regency had been carried out well through a workshop
conducted by the puskesmas by inviting other sectors. However, there are obstacles when coordinating that
health workers sometimes forget to coordinate with the sectors involved to secure the community. So that
the sector is too late to take action when cases occur in the community.
Conclusion: Implementation of cross-sectoral collaboration in controlling leptospirosis has been carried out
with good communication and collaboration.
Suggestions: Health workers need to improve their coordination with all sectors in Jeneponto in order to get
better leptospirosis control.
“Yes, important. It was related to cross-sector “One obstacle that sometimes occurs is when he
anyway. That all must come along. For example, from (health worker) does not coordinate with us who should
health alone, it can’t be. There must be cross-sectoral, contribute to protecting the community. Sometimes if
such as from the sub-district office, the village head to something has happened and I just found out, then I will
move the community” (HW5, 34) still be there to help to give direction to the community”
(Mr4, 37)
This answer was supported by the answers of other
health workers at the Focus Group Discussion (FGD) But rather than that, for this point one of the
which said that cooperation could facilitate disease informants provided input during an in-depth interview
control. The following is an excerpt from the health that could be used as advice in the future, the informant
worker informant’s answer: said that
“They all work together in accordance with their “if you want to coordinate the road, one of them is to
respective main tasks. Cross-sectoral collaboration improve communication between fellow health workers
starting from villages, sub-district heads, and districts and other sectors involved in control” (HW5, 34)
continues to collaborate so that controlling an illness is The findings of study related to the implementation of
easy to do” (HW4, 51) cross-sector collaboration in Jeneponto can be seen from
“We work together to control a disease. Especially the quotation of the answer from one of the following
cadres must always be diligent in monitoring the health informants during an in-depth interview:
conditions that are happening in the community. All are “Maintaining the existing ones and if there is
responsible both the village head and the village head anything that needs to be improved, improve it, because
towards the community environment”(HW9, 38) it is very important to do it” (HW4, 51)
The findings were obtained that there were no The informant’s answer was strengthened by the
obstacles in coordination in cross-sectoral cooperation answer of one of the informants during the FGD. The
in Jeneponto Regency. The results are proven from informant said that
the following excerpts from the answers of the health
workers during an in-depth interview: “Hopefully in the future every month cross-sector
will be implemented. Because this cross-sector is only
“There are no obstacles in coordinating across done every quarter. So hopefully it can be implemented
these sectors because our communication has also been every month” (Mr1, 49)
smooth so far” (W6, 40)
Then for this point, the informant hopes to always
The informants’ answers were strengthened by the confirm if a case occurs. This can be seen from the
answers from other sector’s informants during the FGD. excerpts from the cross-sectoral informants’ answers
The following is an excerpt from the informant’s answer: during in-depth interviews. The informant said that:
“No obstacle so far” (Mr1, 49) “I hope that in the future if something happens like
But rather than that, for this point one of the this, please confirm with us” (Mr4, 37)
informants answered that there were obstacles in cross-
sectoral coordination in Jeneponto Regency. This is
Discussion
evidenced from the excerpts from the informants’ Analysis of the data in this study can illustrate
answers during FGD as follow: the implementation of cross-sectoral cooperation in
1026 Medico-legal Update, January-March 2021, Vol. 21, No. 1
the context of controlling leptospirosis in Jeneponto region need to have a good ability to recognize the
Regency by observing communication, collaboration, epidemiology of leptospirosis in order to be able to make
and coordination between health workers and related early detection, management and appropriate prevention
sectors. Leptospirosis control in Jeneponto Regency method to deal with the incidence of leptospirosis around
does not have a special program in handling the disease, them. Control of leptospirosis also cannot be completed
but it is associated with controlling infectious diseases. by the health sector but collaboration and coordination
Leptospirosis control in Jeneponto Regency is only done between sectors is needed.19
when the results are found during an outbreak.
Good coordination must be based on cooperation
The direct effect between communication on the (between the central government, between the central
implementation of cross-sector collaboration was and regional governments, and between regional
proven in the study of Hasibuan et al (2016) when governments) and mutual understanding by promoting
analyzing the implementation of the Dengue Fever the spirit of equality. So that in carrying out the tasks to
Disease Control (P2DBD) program in the Medan region. deal with Extraordinary Events (EE) or zoonotic diseases
Even his study concluded that communication directly are encouraged to optimize the utilization of resources in
affected the implementation of the P2DBD program. their respective institutions and encourage integration.
So in line with that, several things make it clear that Coordination will run continuously if there is mutual
communication in cross-sectoral collaboration in trust between institutions and always maintain the trust
Jeneponto Regency is the holding of a workshop every that has grown. Trust will grow if the commitment
three months conducted by the puskesmas by inviting to the agreed duties and responsibilities. With the
other sectors. With the frequent implementation of the commitment, consistency, and professional in carrying
community service program related to problems that are out the tasks, the integrity of the ‘group’ coordination
occurring in the community environment, all program will go well.12Based on the results of study conducted
implementers understand the purpose, instructions, and at the Buludoang Health Center, Tuju Village, West
series of activities in controlling leptospirosis.Based on Bangkala District, Jeneponto Regency, it was found
the results of in-depth interviews and FGDs from several that coordination of health informants and other sectors
informants it was found that collaboration in controlling has been carried out. Cross-sectoral and cross-program
infectious diseases has been established. This is indicated coordination such as village heads and community leaders
by the statements of several informants about the who play an active role in mobilizing the community and
importance of cross-sector collaboration. The informant its members in controlling leptospirosis. For example,
considers that when collaboration does not work well, each puskesmas activity must have permission from the
problems that are happening in the community will be regional stakeholders, because the regional stakeholders
difficult to solve. This is in line with the main principles act as the owner of the area for licensing in every
of collaboration, namely the transparency of the process activity that will be carried out by the Puskesmas or the
and the involvement of all stakeholders in making a Health Office. The puskesmas cooperates with cadres
policy. The aspect of collaboration is dialogue, building who function as a channel of information between the
commitment, goals, and mutual agreement. puskesmas and the general public.13
Cross-sector involvement in controlling leptospirosis Based on the results of this study, the informant
is one of the ways that must be properly maintained and began to understand the importance of coordination in
improved. Sectors involved in controlling leptospirosis controlling infectious diseases in the community. Cross
are the Ministry of Health who plays a role in interventions sector involvement in controlling leptospirosis is carried
related to public health and the Ministry of Agriculture out through monitoring by the District Health Office as
that is needed in efforts to control animals or reservoirs the highest holder in decision making related to efforts
carrying disease. In this case, rats are the main reservoir to implement leptospirosis control in the region. In this
for leptospirosis transmission. However, in this study the study, the informant also explained that coordination is
researchers did not include the Agriculture Service as an indeed needed by humans or organizations to achieve
informant because it did not meet the criteria determined the goals together.
by the researcher, namely the presence in the FGD.
The results of the study explained that in carrying
Early diagnosis of leptospirosis is needed to reduce out cross-sectoral collaboration, stakeholders have
the number of patients dying. Health workers in each
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1027
been given their respective responsibilities to carry out Menerapkan Metode Rule Base Reasoning’,
their respective tasks and functions. Some informants Informasi dan TeknologiIlmiah (INTI). 2018:
explained that in coordinating with other sectors in 13(1), pp. 34 – 39.
handling a case a whatsapp group was made to facilitate 4. Ikawati, B., Sulistiyani and Nurjazuli. Analisis
communication so that coordination was carried out Karakteristik Lingkungan Pada Kejadian
well. So that in controlling leptospirosis or other diseases Leptospirosis di Kabupaten Demak Jawa Tengah
that are endemic in the community environment can be Tahun 2009, Media Kesehatan Masyarakat
resolved quickly and accurately. Indonesia. 2009: 8(2), pp. 39–45. doi: 10.14710/
mkmi.9.1.33 - 40.
Conclusions
5. Kementerian Kesehatan Republik Indonesia.
Based on the results of study that has been carried Petunjuk Teknik Pengendalian Leptospirosis.
out on the implementation of cross-sectoral cooperation DirektoratJendral Pengendalian Penyakit dan
in the context of controlling leptospirosis in Jeneponto Penyehatan Lingkungan Kementrian Kesehatan
Regency, the researcher draws the conclusion that cross- Republik Indonesia. Jakarta. 2017.
sectoral collaboration that has been carried out so far still 6. Kementerian Kesehatan Republik Indonesia.
needs to be improved. Considering the results of in-depth Profil Kesehatan Indonesia 2017. Direktorat
interviews that have been conducted, the informant said Jendral Pengendalian Penyakit dan Penyehatan
that coordination in cross-sectoral cooperation still needs Lingkungan Kementrian Kesehatan Republik
to be well coordinated with the sectors that should be Indonesia. Jakarta. 2018.
involved in disease control. However, this information is
7. Kemenkes, RI. Peraturan Menteri Kesehatan
different from the answers of the informants in the FGD
Republik Indonesia Nomor 50 Tahun 2017 Tentang
which said that the coordination that had been carried
Standar Baku Mutu Kesehatan Lingkungan
out so far needed to be maintained, bearing in mind that
dan Persyaratan Kesehatan UntukVektor dan
the handling of cases that had occurred in Jeneponto
BinatangPembawaPenyakit Serta Pengendaliannya,
Regency had been well coordinated by the sectors
Menteri Kesehatan Republik Indonesia Peraturan
involved in the control. It is suggested for stakeholders
Menteri Kesehatan Republik Indonesia. 2017.
to improve coordination by always conducting cross-
sector workshops every month to evaluate the results of 8. Andis, A.M. Identifikasi Keberadaan Serovar
work that has been carried out and the things that need to Bakteri Leptospira pada Serum Darah Tikus di
be improved through coordination. Bandar Udara Internasional Sultan Hasanuddin
Menggunakan Metode Microscopic Aglutination
Ethical Clearance: The study obtained ethics Test (MAT). Skripsi. Departemen Kesehatan
approval from the Health Research Ethics Committee of Lingkungan Fakultas Kesehatan Masyarakat
Public Health Faculty, Hasanuddin University. Universitas Hasanuddin. 2018.
Abstract
Background: Current trend in quality healthcare services is to work toward providing ‘people-centered’,
healthcare that puts the consumers at the center in the health delivery system. This study aims to determine
the level of quality of healthcare services in primary healthcare centers.
Method: The study included a simple random sample of (180) health and medical care providers in primary
healthcare centers in Baghdad City by (5-8) healthcare providers for each center.
The study results showed that the general evaluation of the quality of primary healthcare services is highly
efficient and that the result has a significant impact on the beneficiaries’ satisfaction.
Conclusion: The researchers concluded that the primary healthcare centers are not commensurate with
the increasing population density, and the lack of an ambulance in most of the primary healthcare centers.
Furthermore, the level of confidence in our health institutions regarding service efficiency indicates a high
level.
Evaluation f % M.S SD
Inefficient 0 0
Efficient 6 21.4
2.79 0.418
Highly efficient 22 78.6
Total 28 100
More of centers are highly efficient (78.6%) and (21.4%) are showing efficient system and structure.
60 ≤ years 9 5
Total 180 100
Gender
Male 83 46.1
2 .340
Female 97 53.9 2.159 2
(N.S)
Total 180 100
Level of education
Secondary school 15 8.3
Diploma 61 33.9
3 Bachelor 87 48.3 .845
4.132 8
Master 6 3.3 (N.S)
Doctorate 11 6.1
Total 180 100
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1031
21 ≤ years 82 45.6
Total 180 100
No: Number, f: Frequency, %: Percentage, ᵪ2= Chi-square, df: degree of freedom, p-Value: probability value, Sig: Significance,
N.S: Not significant
More than a third of healthcaregivers age 50-59-years as: radial photographer, biologist, chemist, pharmacist,
(35%), morethan a half are females (53.9%), less than medical technician, and vital statistician. Those
a half hold a bachelor’s degree (48.3%) and diploma healthcaregivers are reported that they are working for
(33.9%). It has known of specialty variable that (39.4%) more than 21-years at the primary healthcare (45.6%) as
were physicians, (22.9%) nurses, and the remaining years of experience.
percentage was distributed on other specialties such
Table 3. Evaluation the tangibility of primary healthcare services at primary healthcare centers (N=180)
Primary healthcare centers having high tangibility That mean most of healthcare centers are having enough
(M.S= 2.39) as seen in scores of mean that associated equipment and supplies in addition to the appropriate
with all items except the item (2) that refer to moderate. staff that fit to mission of these centers.
1032 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Table 4. Evaluation the reliability of primary healthcare services at primary healthcare centers (N=180)
Primary healthcare centers are high reliable (M.S= for their consumers, responding to any complaints
2.73), the mean of scores is showing high in all items that that committed to centers, providing a services in
indicate a good quality of services related to reliability accurate time and manner, keep that trust between the
that represented by: primary healthcare centers are consumers and staff, and working with documentation
providing a therapeutic and appropriate environment of information regarding the consumers.
Table 5. Evaluation the responsiveness of primary healthcare services at primary healthcare centers
(N=180)
Primary healthcare centers are showing high are working on telling the consumers the time of service
responsiveness (M.S= 2.59) as seen in scores of mean availability, providing the expected services that meet for
that associated with all items except the item (2) that consumers’ perception, and responding to consumers’
refer to moderate. That mean most of healthcare centers requests immediately.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1033
Table 6. Evaluation the assurance of primary healthcare services at primary healthcare centers (N=180)
Primary healthcare centers are providing high centers have violated international standards (2-3 per
assurance (M.S= 2.82), the mean of scores is showing 10,000) (Ministry of Health) regarding their coverage.
high in all items that indicate a good quality of services This may be due to the difference in population size
related to assurance that represented by the opinion of between the health sectors in Baghdad. Community
healthcare providers about the mission and vision of health can be affected by the size of the population, so
the primary healthcare that working in, it has known of knowing the size of the community provides community
findings that high confidence and opinion are expressed health workers with important planning information (5).
about the work of primary healthcare services.
Concerning the presence of an ambulance in the
Discussion primary healthcare centers, the results indicate that more
than (89%) of the primary healthcare centers do not
The evaluation of the structure of elements and have an ambulance, and these results are consistent with
systems in primary healthcare centers, with an average of thatof(6)who stated that the availability of an ambulance
more than 75% of the total item as good average scores in primary healthcare centers at (17%), and these results
in more elements. It reflects the availability of standard do not comply with international standards in the quality
criteria for the system and the structure represented and of primary healthcare services.
device availability, complaints boxes, and wheelchair
availability. Regarding the evaluation of tangibility in the field
of quality of healthcare services, the results indicate that
These results are consistent with the findings of(4) primary healthcare centers with high tangibility as seen
who indicated that all of the above are available in 85% in mean of scores that associated with all items except
of primary Healthcare centers. the item (2) that refer to moderate. That mean most of
The Environmental Protection Agency(EPA) healthcare centers are having enough equipment and
requirement for medical waste disposal are for waste to supplies in addition to the appropriate staff that fit to
be segregated into categories of, sharps, toxic, hazardous, mission of these centers.
regulated or infectious fluids of greater than 20 ml. and The results are consistent with a study conducted
other materials. Although incineration has long been by (7) (2012) in Iran who concluded that the tangibility
recognized as an efficient method for disposing safely of dimension in the quality of primary healthcare centers
sharps and other contaminated medical waste(5). services was high, and that is consistent with the good
While, the coverage area of the population through reputation and excellence that the care system craves
the services of the healthcare center, two primary Primary health in Iran, where reached.
healthcare centers provide healthcare services to less The tangibility dimension indicates the appearance
than (20,000) consumers. While, 26 primary healthcare of the facilities, physical and human equipment at the
centers of these coverage are equal to or more than health service delivery site with respect to (22) regarding
(20,000). These results show that all primary healthcare the tangibility of the services in terms of availability of
1034 Medico-legal Update, January-March 2021, Vol. 21, No. 1
equipment and materials Means of education and the patients through flexibility in procedures and means of
outward appearance of workers (8). providing services (13). and willingness and permanent
desire to provide services to patients when they need
Regarding the reliability evaluation in the quality them (14).
of healthcare services, the results revealed that primary
healthcare centers are highly reliability, the average Regarding the assurance evaluation and the quality
score appears in all elements indicating good quality of healthcare services; the results showed that primary
of the services related to the reliability it represents: healthcare centers offer a high assurance, the average
primary healthcare centers are providing a therapeutic score appears in all elements indicating good quality of
and appropriate environment for their consumers, services related to assertion represented in the opinion of
responding to any complaints that committed to centers, healthcare providers in Mission and vision for primary
providing a services in accurate time and manner, healthcare that you work in.
keep that trust between the consumers and staff, and
working with documentation of information regarding These results are consistent with a study conducted
the consumers. This corresponds to the good reputation in United Kingdom by (20). The levels of awareness
of our health institutions for their services to make the of both patients and staff on the levels of application
level of high trust and applies to international standards of the dimensions of the quality of services provided
to service quality. in outpatient clinics and healthcare centers. The study
concluded that the evaluation of workers and patients’
This result is consistent with that of (9)who indicated quality dimension application levels were high for the
the positive effect of the application of reliability assurance dimension.
dimension in the evaluation of primary healthcare
providers in healthcare centers. Regarding the meaning of assurance, it means
the quality of information and the policy of those
Whereas, reliability means the ability to provide responsible for providing services and their policy, and
services on time and with the required accuracy, the their ability to inspire confidence and respond to patient
extent of fulfillment of obligations, and the performance and customer inquiries. It also indicates the confidence
of health services promised by beneficiaries. It also of patients in the health center staff, and the ability of
includes adherence to the deadlines set for beneficiaries those responsible for managing the health center to
(patients) as well as seeking to preserve their files and provide safety and security at the place of service (15).
documents from damage and loss (10).
Primary healthcare centers showed a high degree of
For the responsiveness and the quality of healthcare empathy and mean the average scores in all items that
services, the results indicate that the primary healthcare indicate a good quality of services related to empathy,
centers show a high response as they appear in the which is: giving health services with appropriate attention
average scores associated with all elements except for to consumers, and providing health according to the
item (2) that indicates moderate. This means that most needs of consumers, The evaluation of empathy to this
healthcare centers inform consumers when the service high degree It does not come out of the void, but thanks
is available, and provide expected services that meet to the concerted efforts of primary healthcare providers,
consumers’ perceptions, and respond to consumer it gave an important impression to auditors and reached
demands immediately, and this is felt in the tangibility international standards for quality of services.
analysis table, With this result, can say that the primary
healthcare centers implement international standards The results of this dimension are consistent with
of quality of services at a high level with regard to the thatof (16)in Sao Paulo, and the features that have
responsiveness dimension.These results are consistent reached the highest levels of satisfaction are compatible
with the study of (11) whostated that the response was with the education and commitment of the medical and
high. nursing staff, interpretations and instructions on the
user’s health problem, respect for privacy and guidance
Concerning the responsiveness that is the ability for continuing care after discharge from the hospital.
and desire of the health center provider services to the Empathy were the dimension that affected satisfaction,
beneficiaries at the time and meet (12) to provide them as they demonstrated a high degree of empathy.
appropriate to the current, future and urgent needs of
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1035
Referring to the sympathy dimension as it includes with nursing care: experience of using the
many variables that include the interest and care of Newcastle Satisfaction with Nursing Scale. Journal
workers who benefit from the services personally, of Advanced Nursing (Wiley-Blackwell) [Internet].
and understanding and realizing their needs and the 1999 Feb [cited 2020 Aug 31];29(2):307–15.
appropriateness of working hours and providing services Available from: https://search-ebscohost-com.
in a way that suits the desires patients (17). ezproxy.okcu.edu/login.aspx?direct=true &
db=ccm & AN=5866779 & site=ehost-live
Conflict of Interest: The researchers confirm that
2. Nowotarski P,Pasławski J,Kadler A. Quality
there is no any conflict of interest.
management systems as a key element for company
Source of Funding: This study is self-funded. strategy selection—Case study. MATEC Web
Conf. 2018, 222, 01012.
Ethical Clearance: The researchers obtained
3. Kaura, Vinita Pasławski J,and Kadler A. Service
the ethical approval from the University of Baghdad,
quality, service convenience, price and fairness,
College of Nursing.
customer loyalty, and the mediating role of
customer satisfaction. International Journal of
Conclusion
Bank Marketing 33 (2015): 404-422.
1. Primary healthcare centers whose numbers are 4. Al-Miahi, N. Determination of quality assurance
not commensurate with the increasing population for maternal and child- health services in Baghdad
density, as the number of people included in the City. Master Thesis, University of Baghdad,College
geographical area exceeds 20,000 for the main of Nursing,2010, 90.
health center, and this violates the international
5. Alwan Q. Total quality management and ISO
standards for the quality of services, which
2000,9001 requirements, Amman, Dar Al Thaqafa
stipulates that no more than 10,000 people.
Publishing, 2005.
2. The level of confidence in our health institutions
6. Allender A. & Spradley W.Community health
regarding service efficiency indicates a high level,
nursing promoting and protecting the public’s
and this is high consistent with international
health, 6th ed. Philadelphia: Lippincott Williams
standards for service quality.
and Wilkins, 2005,596, 599, 602, 608, 611, 614-
3. An indication the evaluation of the healthcare 617.
system and structure in the primary healthcare
7. Al-Khudairi J.Evaluation of primary healthcare
centers, that the Criteria of the existence of a lecture
system as a prerequisite for Iraqi health system
hall at the health center, the evaluation (fair).
reform. PHD Dissertation,Al-Mustaniriya
Recommendations: University, College of Medicine, Community
There is a need to: Medicine,2005,123,141.
1. Increase the number of primary healthcare centers 8. Zarei A, Arab M, Froushani AR, Rashidian A,
to fit the increasing population so that it does Ghazi Tabatabaei SM. Service quality of private
not exceed 10,000 people until it conforms to hospitals: the Iranian patients’ perspective. BMC
international standards for the quality of services. Health Services Research [Internet]. 2012 Jan [cited
2. Provide all primary healthcare centers with an 2020 Aug 29];12(1):31. Available from: https://
ambulance to transport patients and critical cases to search-ebscohost-com.ezproxy.okcu.edu/login.
the nearest hospital. aspx?direct=true & db=ccm & AN=104492433 &
3. Maintain the high level of confidence in our health site=ehost-live
institutions by developing the health sector with all 9. Kossman M. Delivering excellent service quality in
new scientific and material capabilities to enhance aviation: A practical guide for internal and external
the level of workers in primary healthcare centers to service providers. England: Ashgate Publishing
ensure the continued quality of healthcare services. Limited, 2006.
10. Yaacob M, Zakaria Z, Salamat A, Yaacob,
References
Z,Salmi,N, Hasan N, Razak R, and Rahim S. Patients
1. Walsh M, Walsh A. Measuring patient satisfaction satisfaction towards service quality in public
1036 Medico-legal Update, January-March 2021, Vol. 21, No. 1
hospital: Malaysia perspective. Interdisciplinary 15. Murray C. & Evans D. Health Systems performance
Journal of Contemporary Research in Business, assessment: Debates, method and empiricism.
2(12): 2011, 635-640. Geneva: World Health Organization, 2003.
11. Kuhn, K.; Warren, J. and Leong, T. Building 16. Alwan, Q. Total quality management and ISO
sustainable health systems, 2nd ed. United 2000,9001 requirements. Amman, Dar Al Thaqafa
Kingdom: Gazella Books Services, 2007. Publishing, 2005.
12. Anbori A. Client›s satisfaction of healthcare 17. Cruz WBS, & Melleiro MM. Assessment levels of
services in Iraq: The study and analysis of the views the user’s satisfaction in a private hospital. Rev Esc
of client›s in Baghdad City, quality management Enferm USP, 44(1):2010, 147-53.
and client›s satisfaction,Iraqi Institute for Economic 18. Parasuraman A, Zeithaml VA. and Berry LL.
Reform Journal, 2(10),2011, 13-17. SERVQUAL: A multi-item scale for measuring
13. Creveling C, Slutsky J. and Antis D. Design for six consumer perceptions of the service quality, Journal
sigma in technology and product development.New of Retailing, 64(1), 1988, 12- 40.
Jersey: Prentice Hall, 2003.
14. Verma H. Services Marketing: Text and Cases, 2/e.
New Delhi: Person Education in South Asia, 2012.
DOI Number: 10.37506/mlu.v21i1.2453 Medico-legal Update, January-March 2021, Vol. 21, No. 1 1037
Abstract
This review aimed to explore the relationship between risk behaviors and drug abuse in adolescents. This
review was reported according to PRISMA guidelines (Selected Reporting Items for Systematic Review).
A review protocol was developed to identify all articles published investigating the relationship between
Adolescent Risk Behavior and Drug Abuse. Relationship between risk behavior and drug abuse among
adolescents; some studies measured the risk behaviors of adolescent drug users. Other studies intervened
to prevent risk behaviors in adolescents related to drug abuse. At the same time, some studies found no
significant relationship between drug-related behavior and drug abuse. Limitations on methodology are
significant in organizing the literature to see connections. This review concludes that all deviant behavior
is highly risky for adolescent health. Attitudes toward risk behavior refer to adolescents’ perception of
vulnerability to the possible negative consequences of unsafe behavior.
Search strategy and data sources: There were Articles found in the initial search contained 109
three steps to find articles in this study. The first step items based on keywords that have been described in
was with the help of research librarians. A search was the method section. Thirty-three articles were excluded
then done through the Web of Science, Pubmed, and the because of the duplication; 76 materials were included
Scopus database to analyze text words in titles, abstracts, in the screening stage. Items that were complete and
and keywords in the last ten years (2009-2019). After this deemed worthy were 25. Then 12 articles were excluded,
analysis, the final keywords related to Adolescent Risk with the reason the results are not relevant. Then 13
Behavior and Drug Abuse were chosen, and a search reports that met the requirements for review.
strategy was developed through the relevant database.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1039
Table 1. Summary of the included studies’ findings and authors’ conclusions.
Abstract
The current study demonstrates that the effect of some the environmental factors on enzymes production that
included (heamolysin, protease, lipase and phospholipase enzymes) of A.hydrophila. The present study included
the detection of A.hydrophilain some clinical cases and environmental sources in the governorate of AL-Najaf,
(159) Clinical samples were taken from patients suffering from various infection at Al-Sadder Medical City and Al-
Zahraa Educational Hospital during the period from October 2011 to March 2012. Also, (92) Environmental samples
were involve three different of environmental regions(Kufa river, Bahar Najaf and tap water) .A.hydrophila isolates
which were diagnosed by four method as (Culture method, biochemical tests, Api20E system and Polymerase chain
reaction (PCR)). The results show that the optimal production of enzymes at temperature (37ºC) and pH (7) for
clinical. While (22 and 37ºC) and pH (7 and 9), for environmental isolates. Some clinical and environmental isolates
containing heamolysingene were tested Ligated Ileal intestinal of rabbit. The results indicate that the gene(hyl) was
responsible for the pathogenicity of A.hydrophila, whereas causes accumulation of fluids in comparison with control
positive (V.cholera) which caused accumulation of fluids and control negative (Normal saline).
Pathogenicity for A.hydrophila: The results in this loop compared to the control loop. Likewise,
of the presence study demonstrate the existence the second loop which is injected a suspension of
of the fluid accumulation in Rabbit Ligated Ileal A.hydrophila from the same isolate but with (106 cell/
intestinal loops injected with bacterial suspensions ml) concentration, also causes accumulation of fluids
to A.hydrophilabacteria (isolated from clinical with largest extend from other loops of the intestinal.
and environmental) which give a positive result to The isolates of A.hydrophilathat is isolated from Kufa
heamolysin gene in PCR technique . river water also have caused accumulation of fluids but
less than that of diarrhea isolates . The test is compared
The first loop that is injected with bacterial suspension with loop for V.cholerabacteria that is considered
with (104) cell/ml concentration of A.hydrophila, may as a positive control to these strain that has caused
have caused accumulation of fluids with clearly changes accumulation of fluid in constant loop to normal saline
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1049
and considered as negative control.21who indicates to of medical bacteria. 2000; (3rd ed.). Lippincott
the infection of suckling mice and the determination of Williams and Winkins .AwolterKlumerCompany .
fluid accumulation (FA) the gut is studied according to Philadelphia Baltimor, New York.
the method of22,26. The results agree with8,23,24.25 who 6. Varadarai,M.C.; Keshara, N.; Devi,
found that experimental infected mice died between 18- Dwarkanath,C.T., and Manjerkary, S.P.
24 hours with signs of septicemia, blindness and liver Occurrence of Bacillus cereus and other Bacillus
necrosis. species in Indian snack and lunch foods and their
ability to grow in a rice preparation .J. Food . Sci .
Conclusions Technol.1992; 29(6) : 344-347.
The followingconclusions are extracted from the 7. Chakraborty,S.;Deokule,J.S.;Garg,P.;Bhattacharya
present study: The frequency of A.hydrophilaisolates ,S.K.;Nandy,R.K.;Nair,G.B.;Yamasaki,S.;Takeda
in Najaf was higher among clinical and environmental ,Y. and Ramamurthy,T. Concomitant infection of
isolates. Most clinical and environmental isolates enterotoxigenic Escherichia coli in an outbreak of
produce many virulence factors involve heamolysin, cholera caused by Vibrio cholerae O1 and O139
lipase,protease, phospholipase. The best productivity in Ahmedabad, India. J.Clinic.Microbiol. 2001;
of heamolysin,lipase,protease and phospholipase at (9):3241-3246.
temperature (37ºC), pH (7) in clinical isolates and (22 8. Bhattachaiya, M.; Choudhury, P. and kumar,
and 37ºC), pH (7-9) in environmental isolates. The R. Antibiotic and metal resistance strains of
bacteria A.hydrophilahave exotoxin like heamolysin Vibrioparahaemolyticus isolated from shrimps.
which is responsible for the pathogenesis of bacteria in Microb. Drug Resist, 2006; 6(2): 171-172 .
lab animals (Rabbits).
9. Martin-Carnahan,A. and Joseph. S. W.Genus I.
Funding: None Aeromonas Stanier1943, 213AL, p. 557–578.
In D. J. Brenner, N. R. Krieg, J. T. Staley, andG.
Conflict of Interest: The author is no conflict of M. Garrity (ed.), Bergey’s manual of systematic
interest. bacteriology, 2nd ed., 2005; 2, partB. Springer,
New York, NY.
Contribution: The author in this work has approved
it for publication in your journal. 10. Figueras, M.J.; Beaz-Hidalgo, R.; Collado, L.
& Martínez-Murcia, A.J.Point of viewon the
Data: All data were analyzed during this work are recomendations for new bacterial species description
included in the manuscript. and their impact on thegenus Aeromonas and
Arcobacter. The Bulletin of Bergey´s International
Ethics Statement: The work does not contain any
Society forMicrobial Systematics, 2011b;2, part 1,
study with human participant by the author.
pp. 1-16.
References 11. Jayavignesh,V.;Sendesh Kannan K. and Bhat .A.D.
Biochemical characterization and cytotoxicity of
1. Naharro G., Riano J.; de Castro L.; Alvarez S.; the AeromonasHydrophilaisolated from Catfish.
Luengo J.M.Aeromonas: Molecular Detection Arch. Appl. Sci. Res. 2011; 3 (3):85-93
of Foodborne Patho-gens, CRC Press. North
12. Awaad,M.H.H.;Hatem.M.H.; Abd El-Ghany,W.A.;
Ryde,2009; 273-289.
El-Sawy,A. Certain Epidemiological Aspects
2. Janda, J.M. & Abbott, S.L. The genus Aeromonas, of Aeromonas hydrophilaInfection in Chickens.
taxonomy, pathogenicity, andinfection. Clinical Journal of American Science, 2011;2(3).
Microbiology Reviews, 2010; 23, pp. 35-73.
13. Collee,J.G.; Fraser,A.G.; Marmino,B.P.; and
3. WHO.Microbiological agents in drinking water. Simons,A.Mackin and McCartney Practical
Vibrio cholera, 2000;(2nded.). Medical Microbiology. 14thed The Churchill
4. Jawetz E.; Melnick J.I. and Adelberg E.A. Medical Livingstone, Inc.1996. U.S.A.
Microbiology, 2007 24th ed.,Appleton and Lange, 14. Jawetz, E.; Melnick,J.I. and Adelberg,E.A. Medical
USA. Microbiology. (27nd ed.). Appleton and Lange
5. MaccFadin,J.K. Biochemical test for identification U.S.A., 2016.
1050 Medico-legal Update, January-March 2021, Vol. 21, No. 1
15. Bijay, K.; Khajanchi- Amin, A. Fadl, Mark A. from clinical source. M.Sc . Thesis, College of
Borchardt, Richard L. Berg, Amy J. Horneman,. science,University of Baghdad. 2002,In Arabic.
Mary E. Stemper, Sam W. Joseph, Nelson P. 21. Aslani,M.M., and Alikhani,M.Y. The role of
Moyer, Jian Sha, and Chopra, A.K. Distribution Aeromonas hydrophila in diarrhea .Irani .J.Publi
of Virulence Factors and Molecular Fingerprinting .Health. 2004; 33(3):54-59.
of Aeromonas Species Isolates from Water
22. Wong, C.Y.F.; Heuzenroeder, M.W, and Flower,
and Clinical Samples: Suggestive Evidence of
R.L.P. Inactivation of two haemolytic toxin genes
Water-to-Human Transmission. Applied and
in Aeromonas hydrophila attenuates virulence in a
Environmental Microbiology, 2010; 76(7), 2313–
suckling mouse model. Microbiology, 1998; 144:
2325. doi:10.1128/aem.02535-09.
291-298.
16. AL-Fatlawy, H.N.K; Aldahhan,H.A and
23. Al-Hadrawy, H.A.N. A Comparative study of
Alsaadi,A.H. Phylogenetic of ERIC-DNA
Bacteriological and Molecular Vibrio Cholera
Fingerprinting and New Sequencing of Aeromonas
Isolated from the Tigris and Euphrates. Ph. D.
Species and V. Cholerae DNA. American Journal
Thesis, College of the science, University of Kufa.
of Applied Sciences 2017, 14 (10): 955.964.
2012.In Arabic .
DOI:10.3844/ajassp.2017.955.964.
24. Al-Fatlawy, H.N.K and AL-Hadrawy, H.A.
17. AL-Hadrawi1, H.A.N, AL-Harmoosh, R.A and
Isolation and Characterization of A. hydrophila from
AL-Fatlawy, H.N.K. Detection of Some Virulence
the Al-Jadryia River in Baghdad (Iraq). American
Factors of Clinical V.choleraeisolates in Najaf/
Journal of Educational Research, 2014, Vol. 2, No.
Iraq. J. Pharm. Sci. & Res. 2019; 11(2). 375-379.
8, 658-662. DOI:10.12691/education-2-8-14.
18. Wai, S.N.; Mizunoe, Y.; Takade,A. & Yoshida,
25. Al-Hadrawi, H.; Al-Harmoosh R.; Al-Fatlawy,
S. A comparison of solid and liquid media for
H.N.K. Isolation and Identification of Streptococcus
resuscitation of starvation and low temperature
pneumonia Causing Respiratory and Thoracic
induced non-culturable cells of Aeromonas
Diseases in Najaf Province. J Pure Appl Microbiol,
hydrophila . Arch Microbiol, 2000; 173, 307-310.
2019; 13(4). doi 10.22207/JPAM.13.4.
19. Sautour, M.; Mary, P.;Chihib,N.E.; Hornez,J.P.
26. Ali, A.andKarunasagar, I. Effect of oxytetracycline
The effects of temperature, water activity and
on the immune response of Labaeorohita to
pH on the growth of Aeromonashydrophila and
Aeromonashydrophila vaccine. In: Flegel T,
subsequent survival in microcosm water. J. Appl.
MacRae IH (eds) Diseases in Asian aquaculture6
Microbiol.2003; 95: 807-813.
Vol. III. Fish Health Section, Asian Fisheries
20. Al-Taee, R. K.I. Study of some virulence factors Society, Manila, Philippines,1997; 6(3) pp 187–
of the Aeromonas hydrophilabacteria isolated 191.
DOI Number: 10.37506/mlu.v21i1.2455 Medico-legal Update, January-March 2021, Vol. 21, No. 1 1051
Abstract
Background: Abnormal sleep patterns are health challenge facing the Iraqi community and related to
modernized behavioral changes.
Aim of Study: To identify the prevalence of abnormal sleep patterns among overweight/obese adults in
Baghdad city.
Patients and Method: A descriptive cross sectional survey carried out in two Nutrition Clinics in Baghdad.
During six months including 250 overweight/obese adults. The short sleep duration was defined as <7 hours/
day and late sleep onset was defined as sleeping at 11 o’clock pm and later.
Results: Mean sleep duration was (7.23 hours). Sleep onset was in 66.8% of participants. Mean body mass
index (BMI) was significantly higher in participants with short sleep duration (p<0.001). Short sleep duration
was associated with younger age, male gender and negative medical history, while significant risk factors for
late sleep onset are younger age, students and smoking.
Conclusions: The prevalence of abnormal sleep patterns among overweight/obese was high. There is a
strong link between short sleep duration and higher BMI.
The data were collected by the researcher using a 30-39 years 80 32.0
pre designed questionnaire prepared by the researcher 40-49 years 51 20.4
Age (year)
depending on previous literatures. Data included general 50-59 years 34 13.6
characteristics (age, gender, weight, height, occupation, ≥60 years 37 14.8
marital status, smoking and medical history) and sleep Mean ±SD 40.8±13.4 year -
patterns. Overweight or obesity defined according to
Gender Male 154 61.6
World Health Organization standard values; obesity
Female 96 38.4
(BMI: 30 Kg/m2 and more) and overweight (BMI: 25-
29.9 Kg/m2) 33. Overweight 62 24.8
2
BMI (Kg/m ) Obese 188 75.2
The sleep patterns were assessed as the average for Mean ±SD 32.3±2.5 -
the last 7 days. Short sleep duration defined as sleep
Housewife 42 16.8
for<7 hours/day. Latesleep onset defined as sleeping at
Student 23 9.2
11 o’clock pm or later35.
Occupation Public servant 58 23.2
The data were analyzed using the Statistical Package Self employed 100 40.0
of Social Sciences software version 22. Appropriate
Retired 27 10.8
statistical tests were applied accordingly at level of
Married 182 72.8
significance of 0.05 or less. Marital status
Not married 68 27.2
Results Yes 83 33.2
Smoking
No 167 66.8
This study included 250 overweight/obese adults
with mean age of (40.8 years) .General characteristics of Medical Positive 107 42.8
the study participants are shown in (Table 1). history Negative 143 57.2
Normal 141 56.4
Mean BMI of adults with short sleep duration was
Sleep duration Short 109 43.6
significantly higher than that of adults with normal sleep
duration (P. value <0.001). No significant difference in Mean±SD 7.23±1.6 hours -
mean BMI across sleep onset (P. value>0.05), (Table 2). Early 83 33.2
Sleep onset
Late 167 66.8
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1053
Table 2. Distribution of BMI of adults according to sleep duration and onset.
Sleep Duration
Variable Normal Short P. value
No. % No. %
<30 18 12.8 30 27.5
30-39 50 35.5 30 27.5
Age (year) 40-49 25 17.7 26 23.9 0.008 S
50-59 21 14.9 13 11.9
≥60 27 19.1 10 9.2
Male 68 48.2 86 78.9
Gender <0.001 S
Female 73 51.8 23 21.1
Housewife 29 20.6 13 11.9
Student 11 7.8 12 11
Occupation Public servant 31 22 27 24.8 0.060 NS
Self employed 50 35.5 50 45.9
Retired 20 14.2 7 6.4
Married 98 69.5 84 77.1
Marital status 0.100 NS
Not married 43 30.5 25 22.9
Yes 50 35.5 33 30.3
Smoking 0.300 NS
No 91 64.5 76 69.7
Positive 77 54.6 30 27.5
Medical history 0.040S
Negative 64 45.4 79 72.5
Early 64 45.4 19 17.4
Sleep onset < 0.001S
Late 77 54.6 90 82.6
Sleep onset
Variable Early Late P. value
No. % No. %
<30 10 12 38 22.8
30-39 33 39.8 47 28.1
Age (year) 40-49 22 26.5 29 17.4 0.004 S
50-59 4 4.8 30 18
≥60 14 16.9 23 13.8
1054 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Sleep onset
Variable Early Late P. value
No. % No. %
Male 48 57.8 106 63.5
Gender 0.380 NS
Female 35 42.2 61 36.5
Housewife 8 9.6 34 20.4
Student 0 0.00 23 13.8
Occupation Public servant 11 13.3 47 28.1 <0.001S
Self employed 51 61.4 49 29.3
Retired 13 15.7 14 8.4
Married 61 73.5 121 72.5
Marital status 0.800 NS
Not married 22 26.5 46 27.5
Yes 17 20.5 66 39.5
Smoking 0.003 S
No 66 79.5 101 60.5
Positive 37 44.6 70 41.9
Medical history 0.680 NS
Negative 46 55.4 97 58.1
Abstract
Background: Activated partial thromboplastin time and prothrombin time measures the action of the
intrinsic and extrinsic pathways of coagulation needed to maintain homeostasis in the body. We studied
aPTT and PT levels in acute myocardial infarction (AMI) patients on anticoagulation therapies and normal
subjects. The aim of the study is to assess aPTT and PT in patients of acute MI on anticoagulation.
Materials And Method: This study was conducted on 42 patients with chest pain and 84 AMI patients,
admitted to Dhiraj hospital, Vadodara. The AMI patients were classified into STEMI (n=28) and NSTEMI
(n=56). PT and aPTT were assayed on a fully automatic Stago-coagulometer instrument (STA Compact
Max).
Conclusion: Patients with STEMI had mean aPTT of 40.79 ± 1.83 s, NSTEMI had 41.33 ± 2.06 s, aPTT in
control subjects was 31.35 ± 0.48 s. Patients with acute coronary syndrome had significantly higher levels
of aPTT. Patients with STEMI has PT of 17.42 ± 5 s, NSTEMI had 18.56 ± 5 s. Patients on anticoagulation
therapy had higher aPTT and PT values.Both PT and aPTT are high in acute MI patients on anticoagulants.
The elevations in PT values were more than 3 fold greater than aPTT suggesting that PT has a higher
sensitivity for predicting blood clotting capacity in patients already on anticoagulations.
• The PT test evaluates coagulation factors in the Patients with STEMI were classified on the basis of:
extrinsic and common pathways of the coagulation (i) ST-segment elevation of ≥0.1-0.2mV in ≥2
cascade work together: factors I (Fibrinogen), II contiguous precordial leads or ≥0.2mV in ≥2
(Prothrombin), V, VII and X. contiguous limb leads or development of new left
• The aPTT, which evaluates the clotting factors that bundle branch block.
are part of the intrinsic and common pathways: (ii) Presentation within the first 24 hours from first
XII, XI, IX, VIII, X, V, II (prothrombin) and I episode of chest pain.
(fibrinogen) as well as prekallikrein (PK) and high
molecular weight kininogen (HK)3 (iii) Continuous chest pain not relieved by nitrates or rest
and lasting ≥30 min9.
During a laboratory test, there are two “pathways”
that can initiate clotting, the extrinsic and intrinsic Patients with NSTEMI were required to have:
pathways. Both of these then merge into a common (i) ST segment downloping sagging of ≥0.1-0.2 mV in
pathway to complete the clotting process4. Increase ≥3 contiguous ECG leads.
fibrinopeptide A in MI predisposes patients to increased
(ii) Typical radiating chest pain even at rest lasting ≥ 15
risk for sudden cardiac death5. Increase in fibrin turn
min9.
over can be estimated by plasma concentrations of
crosslinked FDP’s (fibrin degradation products), proves The patient exclusion criteria included chronic
to be a marker for risk of myocardial infarction6. Soluble inflammatory diseases, active infection, recent surgery,
fibrin was found significantly higher in acute coronary significant renal or hepatic dysfunction and malignancy.
syndrome patients than in controls especially in young
myocardial infarction7. The PT and PTT evaluate the Blood samples for aPTT and PT were collected in
overall ability to produce a clot in a reasonable amount 3.2% trisodiumcitrate anticoagulant vaccutainers in the
of time and, if any of these factors are deficient in proportion of 1 volume of citrate to 9 volumes of blood
quantity or not functioning properly, the test results will is processed by centrifugation at room temperature
be prolonged. for 15 minutes at 2000 rpm. Prothrombin time (PT),
activated partial thromboplastin time (aPTT) assayed
Materials and Method on a fully automatic Stago coagulometer instrument
(STA Compact Max) which is based on clotting time or
This study was conducted on 84 AMI patients and clot-based tests (i.e. chronometric) measurements and
42 patients with chest pain, admitted to Dhiraj Hospital photometric assays (at specific wave lengths) on plasma
coronary care unit, Sumandeep Vidyapeeth deemed samples.
university, Vadodara, Gujarat for a period of 1 year from
January 2019 to January 2020. The AMI patients were Results and Discussion
classified into STEMI (n=28) and NSTEMI (n=56).
Mean age group of STEMI, NSTEMI patients were This study was conducted on 84 acute MI patients
60-70 years and 50-60 years respectively. All the AMI and 42 patients with chest pain. The AMI patients were
patients received standard IHD treatment according to classified into STEMI (n=28) and NSTEMI (n=56)
recent ACC/AHA guidelines. (Graph 1). Mean age group of STEMI, NSTEMI and
chest pain patients were 65-75 years, 55-65 years and 45-
The diagnosis of myocardial infarction done by 55 years respectively (Table 1). Their were significant
any two: increase in PT level in NSTEMI from 13 s to 23 s as
compared to control group which ranges from 11 s to 14
(i) Troponins levels above the 99th percentile of upper s. PT levels in patients with STEMI ranging from 12 s to
limit of normal 22 s. The level of aPTT in control subjects was 30 s to 40
(ii) History of prolonged dull aching radiating chest s. Patients with NSTEMI shows 37 s to 47 s and STEMI
pain or discomfort with perspiration shows 35 s to 45 s which has significantly higher levels
of aPTT. (Table 2).
1060 Medico-legal Update, January-March 2021, Vol. 21, No. 1
of recurrent angina. aPTT tended to be prolonged in the
group with physical training, while it was shortened in
the control group13. Granger et al14 showed a positive
correlation between the aPTT and the risk of subsequent
reinfarction. PT and aPTT may also be used to monitor
therapy in acute myocardial infarction with or without
venous thromboembolism, atrial fibrillation or LV clot.
Conclusion
Both PT and aPTT are useful to measure the
thinning potential of the blood and can be used to
Graph 1: Total number of AMI patients. guide medical therapy and post PTCA patients also to
Table 1: Mean Age group of AMI patients prevent stentthrombosis. The values of aPTT are higher
in acute coronary syndromes due to associated usage of
Mean Age Group of AMI Patients anticoagulation to stop further thrombosis in coronaries.
AMI Patients Age Group in years The elevations in PT values were more than 3 times
higher than aPTT suggesting a greater responsive
Stemi 55-65
potential of PT for predicting blood clotting tendency in
Nstemi 45-55
patients receiving anticoagulation therapy.
Table 2: Alterations in PT & aPTT Ethical Clearance: Taken from sumandeep
vidyapeeth deemed university ethical committee.
Alterations in PT & aPTT of AMI Patients
S.No. Patients PT aPTT Source of Funding: Self funded
1 Stemi 12-22 sec 35-45 sec
Conflict of Interest: Nil
2 Nstemi 13-23 sec 37-47 sec
3 Control 11-14 sec 30-40 sec References
Patients of acute myocardial infarction are on dual 1. Kostis JB, Baughman DJ and Kuo PT. Association
antiplatelets and anticoagulants like unfractionated of recurrent myocardial infarction with hemostatic
heparin, low-molecular weight heparin or warfarin, for factors: a prospective study.Chest 1982;81:571-75.
which PT and aPTT are used. 2. Li YH, Teng JK, Tsai WC, Tsai LM, Lin LJ,
Guo HR and Chen JH. Prognostic significance of
PT/INR detects disorders of the extrinsic and elevated hemostatic markers in patients with acute
common coagulation pathways. Abnormal result is myocardial infarction. Journal of American College
usually seen when factor I, II, V, VII, X are deficient [10] of Cardiology 1999;33:1543-48.
while the aPTT looks for abnormalities of the intrinsic
3. Galvani M, Ferrini D, Ottani F and Eisenberg
and common coagulation pathways. It monitors the
PR. Early risk stratification of unstable angina/
activities of FI, II, V, VIII, IX, X, XI, XII11. Schwartz et
non-Q myocardial infarction: biochemical markers
al12 studied 220 subjects with acute coronary syndrome
of coronary thrombosis. International Journal of
and found out that 30 (13.6%) and 28 (12.7%) had
Cardiology 1999;68 Suppl 1: S55-S61.
INR and aPTT values not within the reference range.
Salamonson studied that patients reaching the therapeutic 4. Derhaschnig U, Laggner AN, Röggla M, Hirschl
aPTT threshold after heparin treatment within 1 day were MM, Kapiotis S, Marsik C and Jilma B. Evaluation
less than those who did not reach threshold suggesting of coagulation markers for early diagnosis of
that a non-weight based heparin regimen is ineffective in acute coronary syndromes in the emergency room.
the achievement of therapeutic aPTT9. Pearson showed Clinical Chemistry 2002;48:1924-30.
positive correlations for myocardial infarction and death 5. Saigo M, Waters DD, Abe S, Biro S, Minagoe S,
in ACS patients treated with unfractionated heparin but Maruyama I and Tei C. Soluble fibrin, C-reactive
negative correlations between aPTT and the day of onset protein, fibrinogen, factor VII, antithrombin,
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1061
proteins C and S, tissue factor, D-dimer, and acute coronary syndromes. Israel Medical
prothrombin fragment 1+ 2 in men with acute Association Journal 2005;7:502-06.
myocardial infarction ≤ 45 years of age. American 11. Salamonson Y. The ineffectiveness of a nonweight
Journal of Cardiology 2004;94:1410-13. based heparin regimen in achieving therapeutic
6. Alpert JS, Thygesen K, Antman E and Bassand activated partial thromboplastin time (aPTT)
JP. Myocardial infarction redefined–a consensus in acute coronary syndrome. AustCrit Care
document of The Joint European Society of 2000;13:128-33.
Cardiology/American College of Cardiology 12. Mitrovska S and Jovanova S. Correlation between
Committee for the redefinition of myocardial the aPTT and clinical events in acute coronary
infarction. Journal of American College of syndromes treated with unfractionated heparin.
Cardiology 2000;36:959-69. BratislLekListy2006;107:422-25.
7. Braunwald E. Unstable angina: a classification. 13. Suzuki T, Yamauchi K, Yamada Y, Furumichi
Circulation 1989;80:410-14. T, Furui H, Tsuzuki J, Hayashi H, Sotobata I
8. Ng VL. Prothrombin time and partial thromboplastin and Saito H. Blood coagulability and fibrinolytic
time assay considerations. Clinical Laboratory of activity before and after physical training during
Medicine2009;29:253–63. the recovery phase of acute myocardial infarction.
9. Korte W, Clarke S, Lefkowitz JB. Short activated Clinical Cardiology1992;15:358-64.
partial thromboplastin times are related to increased 14. Granger CB, Hirsch J, Califf RM, Col J, White HD,
thrombin generation and an increased risk for Betriu A, Woodlief LH, Lee KL, Bovill EG, Simes
thromboembolism. American Journal of Clinical RJ and Topol EJ. Activated partial thromboplastin
Pathology2000;113:123–27. time and outcome after thrombolytic therapy
10. Schwartz D. Utility of routine coagulation studies for acute myocardial infarction: results from the
in emergency department patients with suspected GUSTO-I trial.Circulation1996;93:870-78.
1062 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2457
Abstract
Introduction: Forensic anthropometry dealing with the application of anthropometric measurements of
human individual for the purposes of the identification of human remains. Inter and intra population variations
can be observed in relation to anthropometric measurements due to factors such as genetic makeup, age,
gender and ethnicity and help in the identification of individual in criminal investigations.
Method: This is cross sectional study using young adult students of age group 17 to 24 years. Participants
enrolled after due consent and stature(S) and forearm length (FAL) were measured using standard
anthropometric techniques. SPSS statistical package used to calculate Pearson’s coefficients of correlation
and regression equations between stature and the anthropometric variables.
Results: There were total 255 participants including 54 (21.18%) males and 201 (78.82%) females.
Regression equation for estimation of stature from right forearm length is S = 1.4111 Rt FAL+ 126.72, and
from left forearm length is S = 1.3774 Lt FAL+ 128.39. There were strong positive correlations between
height and forearm lengths in all regressions (r >0.9; p < 0.0001).
Conclusions: The proposed regression equations based on forearm length presented here will simplify the
task of stature estimation for adults in clinical forensic medicine or as aids to the identification in criminal
investigation in endogenous population. The left forearm length is more accurate in estimating the stature of
young adults of western Indian population.
The differences between male and female group (23.2 cm). Left Forearm (Lt FAL) of the participants
were compared using unpaired t-test (S, Rt FAL, Lt ranged from 16.9 to 35.8 cm in males and 11.9 to 34.2
FAL, Av FAL). Stature (S) of the participants ranged cm in females. Mean left forearm in males (28.5 cm)
from 152.0 to 179.0 cm in males and 145.0 to 175.0 was significantly larger (p < 0.001) than that in females
cm in females. Mean stature in males (167.8 cm) was (22.5 cm). Average Forearm (Lt FAL) of the participants
significantly larger (p < 0.001) than that in females ranged from 17.25 to 35.75 cm in males and 12.2 to 34.3
(159.4 cm).Right Forearm (Rt FAL) of the participants cm in females. Mean average forearm in males (28.7 cm)
ranged from 17.6 to 35.7 cm in males and 12.5 to 34.4 was significantly larger (p < 0.001) than that in females
cm in females. Mean Right forearm in males (28.9cm) (22.9 cm).Sex-wise descriptive statistics for stature and
was significantly larger (p < 0.001) than that in females forearms length are shown in Table 2.
Table 2: Sex-wise descriptive statistics for Stature (S), Right Forearm length (Rt FAL), Left Forearm length
(Lt FAL), Average Forearm length (Av FAL).
Scatter diagram and regression line plotted to show relationship for whole sample for estimation of stature from
Right forearm, left forearm shown in fig. 01 to 02.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1065
Figure 1: Scatter diagram and regression line showing relationship between stature and Right Forearm
length. (All dimensions in Centimeters).
Figure 2: Scatter diagram and regression line showing relationship between stature and Left Forearm
length. (All dimensions in Centimeters).
1066 Medico-legal Update, January-March 2021, Vol. 21, No. 1
Linear regression equations were derived for The resulting linear regression equation in the form of
whole sample, for total males & females separately y = ax+ b (where, ‘y’ is stature in centimeters; ‘x’ is
for estimation of stature from right forearm length, left actual forearm length in centimeters; ‘a’ is the slope of
forearm length and average forearm length. The right regression line and ‘b’ is the intercept of the regression
arm length and left forearm length were used as the line) were tabulated in table no. 03.
dependent variable to calculate the estimated stature.
Table No. 03: Various Linear regression equations for stature with forearm lengths (Right, Left average in
whole sample, male & females.
Right Forearm length (Rt FAL) showed high is ± 0.30. The equation derived for total sample can be
positive value of correlation coefficient (>0.9) which used within the predictive range (R2) of ± 0.9752 for Left
suggest a strong positive correlation between stature and Forearm length. Regression equation for estimation of
Rt FAL [Figure 1]. Standard error for the total sample stature from right forearm length is S = 1.4111 Rt FAL+
is ± 0.29. The equation derived for total sample can be 126.72, and from left forearm length is S = 1.3774 Lt
used within the predictive range (R2) of ± 0.9599 for right FAL+ 128.39.
forearm length. Left forearm showed high positive value
of correlation coefficient (>0.9) which suggest a strong The observed linear correlation of the various
positive correlation between stature and left forearm parameters tabulated with Pearson’s correlation
length [Figure 2]. Standard error for the total sample coefficient value tabulated in table no. 04.
Regressions are given in Tables indicates highly In our study, mean right forearm length in male
significant results for all regressions (r >0.9; p < 0.0001); (28.9) was more than female (23.2), and mean left
t-statistics for intercepts and slopes likewise display high forearm length in male (28.5) was more than female
significance in all cases. Correlations between stature (22.5). The differences were statistically significant
to Right forearm length/left forearm length are very (P < 0.001). So, the same regression equation can’t be
high for all and highly predictive with the left forearm used in both sexes to estimate stature. We found strong
measurements. correlation between stature and forearm length and it
was similar to the previous studies.9,15,16 Chikhalkar et
Discussion al9 showed that the highest degree of correlation (r =
In absence of whole body of individual, where the 0.6558) with forearm length followed by foot-length (r
accurate, direct measurement for stature is not possible, = 0.6102) of stature. Our study showed the comparable
other parameters are used to predict individual’s stature results with more strong correlation.
as it is the most important and useful anthropometric Ilayperumaet al14 conducted a study on 258 medical
parameter to establish the physical identity of an students (140 males and 118 females) of faculty of
individual.2,4 Forearm length can be used to predict medicine, university of Ruhana, Galle, Srilanka in
stature in mutilated remains involving part of upper age range of 20-23 years with a mean value of stature
limb of deceased person or in living subjects, if stature in males and females was 170.14± 5.22cm. The mean
measurement not possible due to vertebral column forearm length in Srilankan male and females was
deformity, bedridden, old or frail patients.5-7 27.56± 1.30 and 25.11± 1.24cm compared with Western
In the present study, a total of 255 students between Indian males and females was 28.5 ± 4.17 cm and 22.5±
the age of 17 and 24 years were considered. As maximum 4.2 cm respectively. The r vale values for Shrilankan
height of an individual is attained between 17 and 24 males & females were 0.66 and 0.76 respectively and
years,these individuals were selected for the study. 0.9843 and 0.9793 for Western Indians, respectively.
Many recent studies 8,9,11,14-16 also enrolled subjectsof Nath et al15 conducted a research for reconstruction
same age group. of stature using percutaneous length of forearm bones
In present study, we observed that the males among the 199 Munda (110 males and 89 females) of
have higher anthropometric measurement than that Midnapur district, West Bengal in age group of 18-30
of females.8-11 These differences can be due to gender years. The mean value of stature in males was 156.19cm
associated hormonal factors, genetic factors and lifestyle whereas in Western Indian males it was 167.8 cm.
factors. Age of puberty being later in males and even Similarly, the mean value of stature in Munda females
the bony epiphyseal fusions are around two year later was 148.64cm whereas in Western Indian females
in males as compared to females leads to additional were 159.4 cm. The mean values offorearm length in
growth and increase in height. Inter and intra population Munda males and females was 24.60 cm and 22.85 cm
variations were observed in relation to anthropometry respectively and in Western Indian males & females
due to factors such as genetic makeup, age, gender and were 28.5 cm and 22.5 cm for left forearm and 28.9 cm
ethnicity.9-14 and 23.2 cm for right forearm, respectively.
1068 Medico-legal Update, January-March 2021, Vol. 21, No. 1
2.2cm and 26.56± 15.01cm respectively. The ‘r’ References
value was 0.66 and 0.76 in Srilankan and 0.601 and 0.53
1. “Anthropometry”. biologydictionary.net. Cited
respectively for North Indians
on 2020 May 21. Available from: https://
The stature found by different authors5,8,9,14-16 in biologydictionary.net/anthropometry/
India in different region or state is different than the 2. Mukherjee JB, editor. Forensic Medicine and
present study. Author from Chandigarh (North India)16 Toxicology. 2nd ed. New Delhi: Arnold Associates;
found mean (SD) stature of male was 168.2 (6.5) and 1994. Personal identification; pp. 128–9.
offemale was 155 (5.2). These variations could be due to 3. Krishan K. Determinaton of stature from foot and
different genetic constitution, environmental factorsand its segments in a North Indian Populaton. Am J
nutrition in different population groups.15,16 In this Forensic Med Pathol2008;29:297-303.
study, students were enrolled which are from middleto
4. Akhlaghi M, Hajibeygi M, Zamani N, Moradi
higher socioeconomic class. So, the anthropometric
B. Estimation of stature from upper limb
measurements may be on higher side in comparison to
anthropometry in Iranian population. Journal of
the general population. A community based study to
Forensic and Legal Medicine. 2012; 19(5):280-4.
formulate regression equation for all population needed.
5. Dongare SS, Deokar RB, Patil SS, Jadhav
Conclusion: PL. Correlation of Stature to Arm Span and
BiacromialShoulder Width in Young Adults of
Average Stature of male was 167.8 (± 5.9) cm,
Western Indian Population. Int J Educ Res Health
and it was more than female [159.4(± 5.9) cm] with
Sci 2017;3(2):64-70.
statistical significance. Similarly, right and left forearm
lengths of male was more than that of female. We found 6. Lundy JK. The mathematical versus anatomical
correlation coefficient (R) of 0.9699 in male and 0.9739 method of stature estimation from the long bones.
in female for stature using simple regression with right Am J Forensic Med Pathol 1985;(6) No.1: 73- 76.
forearm and 0.9698 in male and 0.9843 in female for 7. Madden AMT, Tsikoura T, Stott DJ. The estimation
stature using simple regression with left forearm, which of body height from ulnar length in adults from
shows strong correlation between stature and forearm different ethnic groups. J. Hum. Nutr. Diet. 2008;
length. Stature can be accurately estimated from forearm 21(4):394.
length more precisely with left forearm length using 8. Potdar AB, Rathod P, Potdar PA, Desai MM.
simple regression equation. Indian Journal of Forensic Medicine & Toxicology,
2019;13(2):219-21.
We proposed that these regression equations
presented by this study will help the task of stature 9. Chikhalkar BG, Mangaonkar AA, Nanandkar SD,
estimation for adults in forensics to aids in identification Peddawad RG. Use measurement of long bones,
in criminal investigation. Especially in endogamous hand and foot dimensions of local populaton of
populations, correlation coefficients for forearm lengths Mumbai. J Indian Acad Forensic Med 2009;32:329-
and stature are high, and thus applicable for identification 31.
in the forensic field. These population specific results 10. Akhlaghi M, Sheikhazadi A, Ebrahimnia A,
may be applied in endogenous populations only. Hedayati M, Nazparvar B, Anary SHS. The value
of radius bone in prediction of sex and height in the
Conflict of Interests: None. Iranian population. Journal of Forensic and Legal
Medicine. 2012; 19(4):219-22.
Source of Funding: None.
11. Ahmed AA. Estimation of stature from the upper
Ethical Clearance: Yes. limb measurements of Sudanese adults. Forensic
Science International. 2013; 228(1):178. e1- e7.
Contributor-ship of authors: Data collection done
by first author. All the authors contributed equally in 12. Varun R, Jayasinghearachchi TM, Priyalini R,
conception, analysis and interpretation of the study as Gunasena MD. Arm span and knee height as
well drafting, revising the manuscript and approval of predictors of stature among Peradeniya medical
final version. students. Sri Lankan J Anaesthesiol. 2011;19:76–
80.
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1069
13. Ebite LE, Ozoko TC, Eweka AO, Otuaga PO, Oni 15. Nath S, Duggal N and Chandra NS. Reconstruction
AO, Om’Iniabohs FAE. Height: Ulna ratio: A of stature on the basis of percutaneous length of
method of stature estimation in a rural community forearm bones among the Munda of Midnapur
in Edo state, Nigeria. The Internet Journal of district. West Bengal Human Science 1998;37 170-
Forensic Science 2008; 3(1). 175.
14. IlayperumaI, Nanayakkara G and Palahepitiya 16. Singh B, Kaur M, Kaur J, Singh M, Batra A.
N. A model for the estimation of personal stature Estimation of stature from forearm length in north
from the length of forearm. International Journal of Indians: an anthropometric study. International
Morphology 2010;28(4) 1081-1086. Journal of Basic and Applied Medical Sciences.
2013; 3(1):201- 4.
1070 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2458
Tahsein Muhsin Hussein1, Munther Nather Al-Fattah2, Tameem Thamir3, Radhwan Hussein Ibrahim4
1
PhD. Adult Nursing, Lecturer, Clinical Nursing Department, College of Nursing, University of Mosul, Iraq, 2M.Sc.
Adult Nursing, Assistant Lecturer, Clinical Nursing Department, College of Nursing, University of Mosul, Iraq,
3M.Sc. Adult Nursing, Lecturer, Clinical Nursing Department, College of Nursing, University of Mosul, Iraq, 4PhD.
CHN, Professor, Clinical Nursing Department, College of Nursing, University of Mosul, Iraq
Abstract
Background and Objectives: UTI is a common bacterial infection known to affect the different parts of the
urinary tract and the occurrence is found in both males and females. It’s the most common site of nosocomial
infection, accounting for greater than (40%) of the total number reported by hospital and affecting about
(600,000) patients each year. The objective of this study is to assess the knowledge of regarded preventive
measures among nursing college students and to determine the association between their knowledge and
selected demographical data.
Materials and Method: A cross-sectional study was conducted among (120) students enrolled in the
nursing college at Mosul university during the period of 25st January, 2019 to 25th of May, 2019. A self-
administered structured questionnaire which consists of (16) items was obtain to assess the knowledge
regarding preventive measures of UTI and other demographic details. The SPSS (version 18) was used for
the data analysis. The demographic characteristics of the study samples were reported by using descriptive
statistics (frequencies, percentages, and mean). The mean of scores were compared by one-way ANOVA
were done to find the association between variables.
Results: The results of the present study showed that (40.8%) of respondents were belonged tothe age group
(20-22) years old, more than half of them (55%) were females, and the majority of them (86.7%) were single.
Conclusions: The study concluded that the general level of the knowledge among the participants was
overall (52.5%) of the (120) participants had moderate level of knowledge, while (36.7%) of them had poor
knowledge regarding preventive measures of urinary tract infection.
Recommendations: Based on the results of the study, the researchers recommended the necessary to
preparation of educational programs for students of the university of Mosul to develop their knowledge and
knowledge about the seriousness of UTI diseases, as well as the establishment of units for counseling and
health guidance.
Introduction
Coresponding Author: Urinary tract infections (UTIs) are characterized
Radhwan Hussein Ibrahim by colonization, invasion and multiplication of
PhD.CHN, Professor, Clinical Nursing Department, microorganisms in the urinary system(1)(2). UTI is an
College of Nursing, University of Mosul, Iraq infection of the urinary system that may involve the
e-mail: [email protected] lower urinary tract or both the lower and upper urinary
Tel:+964-770-1620-882 tract(3). UTIs are considered as the most frequent
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1071
bacterial infections worldwide(4)(5).UTI is a common to the students’ demographical characteristics sheet
bacterial infection known to affect the different parts which include (age, gender, marital status). While Part
of the urinary tract and the occurrence is found in both Two is a questionnaire concerned with data to assess
males and females. Urinary tract infections (UTIs) are the their knowledge which was consists of list of (16)
caused by pathogenic microorganisms in urinary tract items. Each item has three option yes, no, and uncertain.
(the normal urinary tract is sterile above the urethra). The researchers were used three points to measure each
UTIs are generally classified as infections involving items of the knowledge sheet. (3) for the right answer
the upper or lower urinary tract and further classified (yes), (2) for uncertain answer, and (1) for the wrong
as uncomplicated or complicated depending on other answer (no). The general level of students’ knowledge
patient related conditions(6-8). The urinary tract is the were divided into three levels according to the mean
most common site of nosocomial infection,accounting of score; poor level of knowledge were (less than 2),
for greater than 40% of the total number reported by moderate level of knowledge ranges from (2 - 2.5),
hospital and affecting about 600,000 patients each and good level of knowledge ranges from (more than
year(9-10).Manifestations of (UTI) account for more 2.5 - 3). The SPSS (version 18) was used for the data
than 7 million heath care visits and 1 million hospital analysis. The demographic characteristics of the study
admission annually in United States and The incidence samples were reported by using descriptive statistics
of UTI is second only that of upper respiratory infection (frequencies, percentages, and mean). The mean of
in primary care(11-13). In this study, we aimed to to scores were compared by one sample independent
assess the students’ knowledge of regarded preventive t-test, and one-way ANOVA. The content validity of
measures of UTIs, and to determine the association the knowledge test tool was established in consultation
between socio- demographical data and their knowledge with a panel of (10) experts in different specializations.
regarding prevention of UTI. All of them agreed that the questionnaires were clear,
relevant, and adequate. Minor changes were employed
Methodology based on their recommendations and suggestions. Data
Quantitative research, a “cross- sectional” study were collected through direct interviews of the samples,
was carried out to achieve the objectives of study by using a constructed questionnaire to the period from
among the nursing college students. The present study 25st January, 2019 to 25th of May, 2019.
was conducted in Mosul University at the College of
Results
Nursing. Aaccedental sample of (120) students (males
and females) from the nursing college students, were According to table (1), out of (120) participants
included in the study. To assess students’ knowledge (40.8%) of respondents their age were range from (20-
the researchers construct questionnaire format which 22) years old. In relation to gender, more than half of
consisted of (16) questions: The researchers interviewed them (55%) were females. Regarding to the marital
all students, and each student was given a time period status that (86.7%) of the samples were single. Table
between (10- 15) minutes to answer the questions. (2) presented that the overall (52.5%) of the (120)
In order to a chive the study aim and objectives, participants had moderate knowledge, while (10.8%)
the structured knowledge questionnaire toward the of them had poor knowledge regarding preventive
preventive measures of UTIs were given and filled measures of UTIs. Table (4) indicated that there are no
questionnaires were obtained from the subjects, which significant differences between students’ knowledge in
is composed of two parts:- Part One: Demographic regard to their age and marital status respectively.
Characteristics Sheet that include information related
Table (1): Distribution of the studied students’ level of Knowledge regarding preventive measures of UTIs.
Table (3): Association between student’ knowledge with selected demographic variable.
DF = (118), α = (0.05)
Abstract
Background: Coronary artery bypass grafting (CABG) is a common surgery to treat coronary artery disease
which is the leading reason of death in advanced countries. It involves a section of a vein or an artery to
produce a connection (or bypass) between the aorta and the coronary artery beyond the obstruction.
Objectives: The objectives of the study were to assess the nurses’ knowledge toward CABG, to identify
the impact of the educational program, and to determine the relation between nurses’ knowledge and their
demographical characteristic.
Method: A quasi-experimental study was conducted to assess the effectiveness of educational program
on nurses’ knowledge regarding to CABG. A non-probability purposive sample consisting of (40) nurses.
The samples were divided into two equal groups (study and control). An educational program was focus
to administer for the study group. All participants completed a self-administered instruments at pre and
post-tests. The assessment was carried out during the period from 17th of January, 2018 to 4th of May, 2018.
The Instrument validity was determined through content validity, by a panel of experts.Reliability of the
instrument was determined through the use of test- retest approach.
Results: The results revealed that the mean post- test knowledge scores in the study group were significantly
higher than mean pre- test knowledge score.
Conclusion: The study concluded that the educational program had great effective on emerging and
enhancing nurses› knowledge regarding CABG.
Results
Table 1: Comparative differences between the study and control groups of the nurses’ knowledge relative to
pre and post- tests.
Knowledge Mean of Score Std. Deviation Std. Error Mean t- Observe Sig.
Pair 1 pre-test for study G. 1.3225 .06382 .01427 .514
0.665
Pre-test for control G. 1.3100 .05758 .01288 N.S
Pair 2 pre-test for study G. 1.3225 .06382 .01427 .000
-17.979
Post-test for study G. 1.8100 .08974 .02007 S.
Pair3 pre-test for control G. 1.3100 .05758 .01288 .716
0.370
Post-test for control G. 1.3050 .03940 .00881 N.S
Pair4 Post-test for study G. 1.8100 .08974 .02007 .000
21.508
Post-test for control G. 1.3050 .03940 .00881 S.
T- critical = 2.093 DF = 19
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1077
Table 2: Association between nurse’ knowledge scores with gender.
Table (4): Comparison between nurses’ knowledge scores regarding (pre and post) tests for the study and
control groups.
M.S= Mean of score, G= Grads, L.S= Low significant, H.S= High significant.
Abstract
Background: Consumers satisfaction is the level of satisfaction that clients experience having used a service.
This study aims to determine the level of quality of healthcare services in primary healthcare centers.
Method: The study included a simple random sample of beneficiaries of healthcare services in primary
healthcare centers in the city of Baghdad by (5-8) beneficiaries for each center using a questionnaire to
measure the satisfaction of beneficiaries with the quality of services and the use of the direct interview
method, which took from (6-10) minutes.
The study results showed that customer satisfaction scale is very important to assess the quality of health
services and can predict compliance and use of international standards for quality of services. The study also
found that most primary healthcare centers are located in densely populated areas. Therefore, primary health
care services are adequately provided.
Conclusion: The researchers concluded that most primary health care centers are located in densely
populated areas. Therefore, primary health care services are adequately provided.
Following this thinking, there has been growing 8. Provision of essential medication (8).
interest in measuring consumer’s satisfaction, mostly Method
through collecting the views of service users. These
views have become important in the evaluation of A descriptive “Evaluation Correlation” study was
healthcare delivery and have become a tool for health conducted to determine the Impact of Quality of Health
service performance evaluation. Client satisfaction Care Services on consumer’s satisfaction at Primary
is now viewed as an important measure of protection Health Care Centers in Baghdad City. From (13th
against potential problems in healthcare delivery and is January to 5th March 2019).
linked to changes in service delivery policies (6).
A simple random sample consisting of (176)
Essential healthcare is based on practical, beneficiaries of health care services in primary health
scientifically sound and socially acceptable method and care centers in the city of Baghdad by (5-8) consumer’s
technology, made universally accessible to individuals for each center using a questionnaire to measure the
and families in the community. It is through their full satisfaction of consumers with the quality of services
participation and at a cost that the community and the and the use of the direct interview method, which took
country can afford to maintain at every stage of their from (6-10)) Accurate. These centers are distributed into
development in the spirit of self-reliance and self- (2) sides and divided into (8) health sectors according to
determination(7). ministry of health directorate of primary health care. A
total of (28) primary health care centers are selected for
The Approach to providing health care resources the purpose of the study.
focuses on provision of essential health care using
socially acceptable and affordable method and The data collection starts with providers primary
technology, accessibility, public participation in policy health care services in primary health care centers in
development, and intersects oral collaboration. The Baghdad City. Utilizing of the developing questionnaires
declaration of Alma Alta proposes a set of core activity and the interview technique as means of data collection
to be included in primary health care and tailors to the and keeping records of all available contacts that
needs of a particular population. These activities include: facilitate the access to study sample.
1. Education to prevent and control major health The reliability of the questionnaire which is
problem in the area determined through a pilot study and the validity are
achieved through a panel of (17) experts. A pilot study
2. Promotion of nutrition and a safe and sufficient food was conducted among a convenient sample of (17)
supply providers who were selected among persons concerning
3. Provision of safe water and basic sanitation with primary health care centers. This preliminary Study
was conducted from 15th December to 28th December
4. Provision of maternal and child health care,
2018.
including family planning services
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1083
Results
Table 1. Consumers’ socio-demographic characteristics (N=176)
Information f % ᵪ2 df Sig
Age (Years)
≤ 19 7 4
20 – 29 52 29.5
30 – 39 54 30.7
.900
40 – 49 36 20.5 4.860 10
(N.S)
50 – 59 15 8.5
≥ 60 12 6.8
Total 176 100
Gender
Male 71 40.3
.258
Female 105 59.7 2.707 2
(N.S)
Total 176 100
Level of education
Doesn’t read & write 18 10.2
Read & write 24 13.6
Primary school 40 22.7
Intermediate school 23 13.1 .543
10.946 12
Secondary school 17 9.7 (N.S)
Information f % ᵪ2 df Sig
Employee 34 19.3
Free work 21 11.9
Retired 7 4
Neglect the work 3 1.7 .082
19.295 12
Unemployed 100 56.8 (N.S)
Disabled 2 1.1
Student 9 5.1
Total 176 100
Type of service provided for the consumer
Maternal & childcare 18 10.2
Childcare 24 13.6
Health promotion 1 0.6
Critical care/accident 0 0
Immunization 55 31.3
.001
Family planning 1 0.6 57.303 16
(H.S)
Assessment & treatment 44 25
Dental care 30 17
School health 1 0.6
Others 2 1.1
Total 176 100
No: Number, f: Frequency, %: Percentage, Iq D: Iraqi Dinar, ᵪ2= Chi-square, df: degree of freedom, p-Value: probability value, Sig:
Significance, N.S: Not significant
A high percentage among age groups was associated ID) (48.3%). Regarding occupational status, more
with (30-39) years which is (30.7%), more of consumers than half of consumers are unemployed (56.8%). The
are females (59.7%). The analysis of educational level for types of services that are utilized by consumers were
those consumers indicates that high percentage refers to immunization (31.3) that presents the highest percentage
primary school education (22.7%). The socioeconomic followed by the services of assessment and treatment
variable indicates that those consumers are associated (25%), dental care (17%), childcare (13.6%) and
moderate socio-economic status of (301000-600000 maternal and child health (10.2%).
Consumers’ are highly satisfied with the type and and leave the school, as the lower the educational level,
quality of services that are provided by primary health the lower the health culture, and this will increase the
care centers evidenced by high mean of scores among health problems in the country, as well as increase the
all items of the scale. material and human burdens.
Table 3. Overall evaluation consumers’ satisfaction Whereas in Afghanistan there is a study similar to
level for primary healthcare services (176) ours, but it was recorded that the educational level in
which the highest level of illiteracy occurred, not read or
Levels f % M.S SD write, was found that about two thirds of the participants
Low 4 2.3 were illiterate, at a rate of (61.6%). The overall literacy
Moderate 46 26.1 rate (38.5%) (10).
2.69 0.510
High 126 71.6 The socio-economic variable indicates that these
Total 176 100 consumers are linked to the moderate social and economic
situation (301000-600000 Iraqi dinars) (48.3%) table (4-
f: Frequency, %: Percentage, M.S: Mean of score, SD: Standard
Deviation, Low= 11-18, Moderate= 19-26, High= 27-33 6). The Central organization for Statistics in the ministry
of Iraqi planning, a whole survey the poverty level and
Consumers show a high level of satisfaction for the income rate for individual to the period of (2018-
the services provided at the primary health care centers 2020) showed the results of the poverty rate (10%), and
(71.6%). the income rate less than (50%) is moderate in Baghdad
City (11), these results give stability for study. we would
Discussion like to point out that the level of individual income to
Regard to discussing the Socio-demographic helps in resolving many health problems and prevents
characteristics of consumers attending the primary the ignorance spread.
health care centers as the number of consumers who have
been taken into account in the quality of health services Regarding the occupational situation, more than
provided in primary health care centers in Baghdad half of the consumers are unemployed (56.8%) table (4-
City (176) table(4-6); the results showed that a high 6), and these results are consistent with the evaluation of
percentage of age groups was associated (30-39) years, the Central organization for Statistics and the executive
average (30.7%), followed by the age group of (20-29) management of the poverty alleviation strategy in the
years, at a rate of (29.5%), and the lowest category (≤ Ministry of Planning (11).
19) years, at a rate of (4%). The percentage of the unemployed reached (57.3%),
These results are consistent with a study conducted For the whole society according to the above, the average
by (9).
The study included people from four groups in economic activity of individuals aged 15-years and over
Baihsud District in Jalal Abad City, Afghanistan. The (42.7%) with a difference in the ratio between men
age was between (25-34) years at a rate of (33.4%). (29.7%) and women (13%). the unemployment rate for
adults to the age group (15-24) years, when it reached
Analysis of the educational level of these consumers (27.5%), and from 25 or more (29.8%).
indicates that a high percentage indicates education in
primary schools (22.7%) Table (4-6). The reason high is The types of services that are utilized by consumers
because most of the views taken are women, and because were immunization (31.3%) that presents the highest
most of the women are in the elementary or middle stage percentage followed by the services of assessment and
1086 Medico-legal Update, January-March 2021, Vol. 21, No. 1
treatment (25%), dental care (17%), childcare (13.6%) system, which leads to better compliance, continuity of
and maternal and child health (10.2%). care and ultimately better health outcomes. Identifying
customer needs and assessing the health services
All of the above explanation it is shown in table (4- provided is a starting point for a customer-focused
6) has been the division of services based on a global approach to health care provision. Therefore, customer
scale in the quality of service provided to the consumer’s satisfaction is an important measure for assessing the
in primary health care centers in the Baghdad City. quality of health services and can predict compliance and
These results are consistent with thoughtful study use. The function of health care services is to improve
by(12) in the Iraqi Institute for Economic Reform. the health status of the population(15).
General Hospital, Mayjend Moestopo Street No. 6-8, Gubeng, Surabaya, East Java 60285, Indonesia, 3Staff of
Department of Clinical Microbiology, Faculty of Medicine, Airlangga University-Dr Soetomo General Hospital,
Mayjend Moestopo Street No. 6-8, Gubeng, Surabaya, East Java 60285, Indonesia
Abstract
Background: Respiration support by mechanical ventilation is an important aspect in intensive care.
However, it could induce complication as infection. Ventilator Associated Pneumonia (VAP) is the most
common infection in patient with ventilator support. This infection have an impact to patient’s length of stay
and prognosis. VAP will be followed with inflamatory responses consist of elevation IL-6 level and lipid
profile abnormality. Therefore objective evaluation for acute inflamation could be a tool to diagnose VAP
early.
Method: This study is analitic observational with prospektif design, to know the relationship of IL-6 dan
lipid profile (HDL and LDL) toward VAP incidence in 38 patient under Intensive Care treatment. Subject
observed for 7 days and IL-6, HDL,LDL levels were examined in the day with ventilator and 48 hours after
it.
Result: VAP occur in 23 subject (65,53%) from all population. IL-6 (1), IL-6(2) and ∆ IL-6 levels have
significant effect to VAP incidence. HDL (1), HDL (2), LDL (1), and LDL (2) levels have significant effect to
VAP group. And ∆ HDL and ∆ LDL levels have significant effect to both group, VAP and non-VAP subjects.
Conclusion: IL-6, HDL and LDL level change have relation as predictor VAP incidence.
This study is aimed to find an association between This study shows there are 23 patient diagnosed for
IL-6 and lipid profile as predictors of VAP events. VAP (60,53%) from study population. It consist of 18
male and 5 female. These VAP patient are treated in ICU
(5 patients), Resucitation Room (RES) (3 patients) and
Intermediet Observation Room (ROI) (15 patients).
VAP
Total P value RR (CI95%)
Yes (n=22) No (n=15)
Gender
Male 18(69,2%) 8(30,8%) 26 0,157 1,66(0,81-3,4)
Female 5(41,7%) 7(58,3%) 12
Unit
ICU 5(71,4%) 2(28,6%) 7
RES 3(33,3%) 6(66,7%) 9
ROI 15(68,2%) 7(31,8%) 22
Age
Mean ± SD 49,8±11,2 43,5±11,9 47,3±11,76 0,114 1,05(0,49-1,12)
Diagnose
Perforated Appendicitis 1
Hematothorax 1
Metabolic Acidosis+ CKD 3
Pulmonary Edema+ CKD 4
Severe Brain Injury 4
Coronary Artery Disease 2
1090 Medico-legal Update, January-March 2021, Vol. 21, No. 1
VAP
Total P value RR (CI95%)
Yes (n=22) No (n=15)
Pulmonary edema+ Eclampsia 4
Intra Cerebral Hematoma 7
Severe Pre-eclampsia 3
Myastenia Gravis 4
Guillen-Barre Syndrome 2
Phlegmon 2
Peritonitis 2
The difference value (∆) of IL-6 obtained 18.9 ng/L dL)(p values <0, 0001) with a correlation coefficient of
(1.8 - 188.5 ng/L) in the VAP case and ∆ IL-6 value was 1,000. The ∆ LDL value is -27 mg/dL (-61 - (-11) mg/dL)
-1.6 ng/L (-22.9 - 1 ng/L) in non-VAP cases (p value in the VAP case and the ∆ LDL value is -1 mg/dL (-3-3
<0,0001) with a correlation coefficient of 1,000. The ∆ mg/dL) (p value <0,0001) with a correlation coefficient
HDL values obtained -19 mg/dL (-32 - (-5) mg/dL) in of 1,000. All of these value described in table 2.
VAP cases and ∆ HDL values of -1 mg/dL (-2-2 mg/
Table 2. Relationship of different value (∆) IL-6, HDL, LDL with VAP incidence
Kejadian VAP
Nilai ∆ Nilai p Koefisien Korelasi RR (CI 95%)
Ya Tidak
IL-6 18,9(1,8–188,5) -1,6(-22,9–1) <0,0001 1,000 NA
HDL -19(-32–(-5)) -1(-2–2) <0,0001 1,000 NA
LDL -27(-61–(-11)) -1(-3–3) <0,0001 1,000 NA
As described earlier, in this study we examine two already supported by ventilaor for two days (value 2).
times, first we do ata the first time patient supported with The value of of these examination described in table 3.
ventilator(value 1) and the the second is when patients
Table 3. Relationship between IL-6, HDL, and LDL value with VAP incidence
Abstract
Objective: The present study aimed to shed light on the role of narghileh and cigarette smoking on immunity
status of oral cavity by assess (C3 complement component, Immunoglobulin A, Total protein, α-Amylase
and EBV IgG antibody).
Method: Saliva levels in two smokers groups the first include 28 narghileh smokers and the second include
32 narghileh and cigarette smokers as well as 30 non-smokers consider as control.
Results: As compared control, the levels of C3, IgA and total protein were significantly decreased, and the
highest decreased was observed in saliva of narghileh and cigarette smokers, the result was (C3= 0.400 ±
0.194µg vs. 9.728 ± 3.561µg; IgA= 2.460 ± 0.492mg/dl vs. 5.048 ± 0.937mg/dl; Total protein= 170.20 ±
45.93mg% vs. 452.20 ± 136.57mg%, respectively) while the level of α-amylase was slightly dropped but
with a non-significant, the result was (246.37 ± 122.47,243.56 ± 178.69 vs,213.51 ± 101.88) respectively.
Conclusion: The narghileh and cigarette can alter the microenvironment of oral cavity and influence the
immunity of mucosa tissue, then increase the risky for many diseases such as blood hypertension, heart
diseases, and lung diseases and may contribute to a variety of cancer.
The topic of this study is to evaluate the important In this study different salivary constituent were
saliva component that may contribute to maintain oral assessed in saliva of narghile and cigarette smokers these
immunity in narghile smokers. factor included (C3, IgA Ab, total protein, α-amylase
and specific IgG EBV Ab). As shown in table 1, which
Materials and Method reveal the saliva level of C3 complement component
Subjects and saliva samples: A total of 90 Iraqi in the three understudying groups (Non-smokers; NS,
(healthy males) aged (18-25) years. They were distributed Narghile smokers; NAS and Cigarette smokers; CS)
in to two groups the first include 28 Narghileh smokers, respectively the result of mean ± SD. was (9.728 ± 3.561,
the second include 32 Narghileh and cigarette smokers 3.60 ± 3.082 and 0.400 ± 0.194µ/ml) respectively.
C3 (micrograms/ml)
Groups
Mean±SD Minimum Miximum
Non-smokers (No.= 30) 9.728±3.561C 4.80 15.00
Narghileh smokers (No.= 28) 3.608±3.082B 0.80 9.00
Narghileh and Cigarette smokers (Mo.=32) 0.400±0.194A 0.12 0.64
IgA (mg/dl)
Groups
Mean±SD. Minimum Miximum
Non-smokers (No.=30) 5.048 ± 0.937C 4.00 6.11
Narghileh smokers (No.=28) 3.560 ± 0.0381B 2.90 4.00
Narghileh and Cigarette smokers (Mo.=32) 2.460 ± 0.492A 1.80 3.00
In respect to the total protein saliva level, and as and 170.20 ± 45.93 mg%) respectively as compare to
shown in table 3, this research finding record a significant non-smokers (452.20 ± 136.57mg%). This finding was
decreasing of saliva total protein among the three disagree with study carried out by (Zainulabdeen and
understudying groups the result was (306.20 ± 70.872 Alak 2014) (14), which recorded a high elevating total
1096 Medico-legal Update, January-March 2021, Vol. 21, No. 1
serum protein in smokers vs. non-smokers. The conflict research in which the reduction of amylase activity of
between our results may relate to the type of specimen. serum narghileh smokers is most probably due to the
Also the decreasing of saliva total protein is parallel interaction between smoke aldehyde and SH-groups of
to the decreasing of saliva constituent which recorded the amylase molecule (Singh et al. 2018) (15). Another
decreasing in this investigation. study recorded a non-statistically significant difference
in salivary α-amylase level between smokers and non-
As shown in Table 4 the saliva level of α-amylase smokers this study is agree with the present study. While
enzyme recorded a non-significantly increasing among Greabu and colleagues (Greabu et al. 2007) (16) indicated
the three groups P≤0.05 and result was (213.51 ± that exposure to cigarette smoke decreased salivary
101.88, 246.73 ± 122.47 and 243.56 ± 178.69 U/L) amylase activities.
respectively. This finding is agree with the previous
α-amylase (U/L)
Groups
Mean±SD Minimum Miximum
Non-smokers (No.=30) 213.51 ± 101.88A 67.22 343.99
Narghileh smokers (No.=28) 246.73 ± 122.47A 130.48 470.52
Narghileh and Cigarette smokers (Mo.=32) 243.56 ± 178.69A 126.52 581.23
* Similar letters represent no significant difference between these means (P > 0.05).
Zainab Ali Hlail1, Ahmed Sahib Abd-ulamir2, Khalil Ismail Abd-Mohammed3, Mohammed Odah Salman3
1
Lecturer, College of Medicine/University of Baghdad, Baghdad, Iraq, 2Prof., College of Medicine/Al-Nahrain
University, Baghdad, Iraq, 3Prof. High Institute of Infertility Diagnosis and Assisted Reproductive Technology
(ART)/Al-Nahrain University, Baghdad, Iraq
Abstract
Objective: The objective of this analysis was to assess serum islet cell anti-bodies concentrations and anti-
ovarian anti-bodies in the relationship between the PCOS patient and the stable control group.
Material and Method: In this study, 250 Iraqi women aged between 20-50 years were studied. The patients
were divided into two groups: study group (n=125, PCOS women) and age-matched controls group (n=125
normal women). The blood sample was obtained on the 2nd day of menstruation cycle. Islet cells Ab and
anti ovarian Ab concentrations were determined in both groups.
Results: Women with PCOS had higher serum islet cell concentrations higher than control levels (p < 0.05).
The levels of islet cells Ab and Anti-ovarian Ab were substantially positively associated with BMI, high
levels of anti-mullerian hormone (AMH) and insulin resistance.
Conclusion: The evidence from this study indicated that serum Islet cells Ab and anti-ovarian Ab levels in
women with PCOS were observed to be higher compared with controls. Elevated serum Islet cells Ab and
anti-ovarian Ab levels can be associated with high AMH and insulin resistance.
Keywords: Islet cells, anti-ovarian Ab, anti-mullerian hormone, body mass index, polycystic ovary
syndrome.
Table 1: Islet cell antibodies (ICA) level in PCOS patients and healthy control groups.
*E2: ×100
The level of serum anti-ovarian Ab (AOAB) showed (Pg/ml), 92.37± 112.81 (Pg/ml) in PCOS patients and
significant differences in PCOS patients in comparison healthy control group respectively. The serum level was
with healthy control. The level was 2.12E2± 130.44 ranging between 0 and 520 Pg/ml, table 2.
Table 2: Anti-ovarian Ab (AOAB) level in PCOS patients and healthy control groups
*E: ×100
1Specialist OBG at Al Zahraa Teaching Hospital, Teacher at Kufa, Medical School, 2Consultant OBG at Al Zahraa
Teaching Hospital, Assistant Professor at Kufa Medical School, 3Specialist OBG at Al Zahraa Teaching Hospital,
Teacher at Kufa Medical School
Abstract
Background: In addition to multi-follicular development, controlled stimulation of ovaries is associated
with a high serum level of estradiol (E2). The increased serum E2 level during COS may therefore be
associated either with an increased chance of pregnancy or an impaired reproductive outcome secondary to
changed endometrial receptivity.
Objective: To assess the effect of serum estradiol level at the day of hCG administration on the success of
intracytoplasmic sperm injection (ICSI) cycles
Patients and Method: A retrospective study, in which a total of 235 women who were undergo a single
ICSI cycle were introduced in this retrospective study, All patients were received gonadotrophin agonist
either short or long protocol. The patients were classified at the day of hCG administration into three groups
according to serum E2 level group A <1000pg/ml, group B 1000-3000pg/ml and group C >3000pg/ml.
Results: The mean number of retrieved oocytes and embryos obtained in group C were more than in group
A and B but clinical pregnancy rate was higher in group B than in group A and group C which is statistically
significant.
Conclusion: Although there is no high quality evidence to support a positive correlation between serum E2
levels and IVF-ICSI products, the E2 level in the serum may has a level –dependent effect on the success
of pregnancy. The optimal range of serum E2 is 1000-3000pg/ml is associated with higher rate of clinical
pregnancy.
1. Long Protocol: GnRh agonist (3.7 mg) was Detection of the gestational sac and positive heart
administered to suppress the pituitary gland on day beat. Clinical pregnancy rate calculated as the number
21 of the menstrual cycle (middle luteal phase). of women with clinical pregnancy per number of women
Vaginal ultrasound performed on day 2 or 3 of that did embryo transfer.
the next menstrual cycle to confirm the absence
Embryos were classified according to the number of
of any functional ovarian cyst larger than 10 mm.
blastomeres, percentage of fragmentation & blastomere
Gonadotropin stimulation consisted of 1-2 ampoules
appearance as type 1, 2, 3 or 4.
per day of recombinant FSH (Gonal-FR, 75 IU).
The initial dose was individualized according to the Regarding the equality of embryos, good quality
patient›s age, the reserve ovarian test was adjusted embryos are those of grade 1 and 2, while bad quality
according to its response after the first 4-5 days of embryos are those of grade 3 and 4.
stimulation.
Statistical Analysis: This study was analyzed
2. Short Protocol or Flare-up protocol: Involves statistically by using SPSS (statistical package for social
agonist treatment (decapeptyl 0.1mg S.C daily) for science) version 20. In which we use chi sequare (x2)
10-14 days started one day before or concurrently
1104 Medico-legal Update, January-March 2021, Vol. 21, No. 1
For categorical data and independent sample Results
T-test for measurement data. We set P value <0.005 as
Table (1) shows demographic characteristic of the
significant.
women according to E2 level in three groups were no
significant difference in their age, BMI, endometrial
thickness and hormonal assay (FSH,LH, E2 and
Prolactin) hormone.
E2 at HCG
Characteristic P value
<1000 Mean±SD 1000-3000 Mean±SD >3000 Mean±SD
Age/years 30.45±6.4 30.5±5.7 28.6±5.6 0.104
BMI(kg/m2 ) 27.7±3.1 27.3±3 27.1±3.4 0.576
FSH(IU/L) 4.2±2.3 4.1±2.7 4.2±1.7 0.716
LH(IU/L) 2±1.4 2.7±1.8 2.3±4 0.319
E2(pg/ml) 27.8±14.3 35.6±16.4 45.6±22.5 <0.001
Prolactin(ng/ml) 23.5±8.6 26.7±23.7 24.3±8.2 0.514
Table (2) shows the mean number of retrieved Fertilization rate (number of embryos obtained
oocytes (p=0.001), no. metephase II oocytes (p=0.001) per number of injected oocytes) was higher in group
and number of embryos obtained (p=0.001) were A (0.6067± 0.2469) than in group B (0.5170±0.2615)
significantly higher in group C than in groups A & B. and group C(0.4330±0.2865) but it was not statistically
significant (p=0.088).
Percentage of metaphase were not statistically
different among three groups (p=0.284).
Table (2): Demonstrates the comparison of the outcome according to E2 at HCG level.
E2 at HCG
Characteristic P value
<1000 Mean±SD 1000-3000 Mean±SD >3000 Mean±SD
No. of oocyte 6.1±3.6 9.4±4.8 13.1±6.2 <0.001
No. of M2 2.9±2 4.4±2.1 5.8±2.6 <0.001
No. of embryo 2±0.9 2.5±0.7 2.7±0.5 <0.001
Percentage of M2 52.7±23.4 50.1±17 47.3±14.1 0.284
Fertilization rate 0.606±0.246 0.517±0.261 0.433±0.286 0.088
Table (3) shows the types of protocols and type <1000 and 1000-3000 and <1000 and >3000 while there
of infertility were not significantly different among the is no significant difference between 1000-3000 and
studied group. There is significant difference between >3000
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1105
Table (3) The type of protocol and indication of ICSI according to level of E2 at HCG
E2HCGG
Variable P value
<1000 1000-3000 >3000
Long 924.3% 2156.8% 718.9%
Protocol 0.385
Short 3517.7% 10653.5% 5728.8%
Female 1719.3% 4955.7% 2225.0%
Indication Male 2418.3% 7053.4% 3728.2% 0.980
Unexplained 318.8% 850.0% 531.2%
Table (4) shows clinical pregnancy rate (calculated per embryo transferred) was higher in group B 49/127(37.8%)
than in groups A 5/44(9.1%) and C 20/64 (29.7%). It was statistically significant (p=0.002).
Table (4): Relation between E2 HCG level and clinical pregnancy rate.
Fertilization
P value
Negative Positive
39 5
<1000
90.9% 9.1%
78 49
E2HCGG 1000-3000 0.002
62.2% 37.8%
44 20
>3000
70.3% 29.7%
161 74
Total
69.8% 30.2%
Table (5) regarding the quality of embryos, good quality embryos were more frequent in group B (113) than
group C (57) and group A (38) this difference was not statistically significant.
Table (5): shows the comparison of the quality of embryos among three groups.
Grading
P value
Good quality Bad quality
38 6
<1000
86.4% 13.6%
113 13
E2HCGG 1000-3000 0.833
89.7% 10.3%
57 7
>3000
89.1% 10.9%
Zainab Mahmood Al-Jammali1, Anas Al-Yasiry2, Zahra S. Abed Karkosh3, Azad Almuthaffer1
1
MD Lecturer Prosthodontics/College of Dentistry, University of Babylon/Iraq, 2MD Lecturer Department of
Basic Science College of Dentistry, University of Babylon, Iraq, 3MD Assistant Lecturer Prosthodontics/College of
Dentistry, University of Babylon/Iraq.
Abstract
Background: The purpose of the dental treatment is getting the satisfaction of patient, in addition to
reestablish and improve oral health and functions. Negative effect on aesthetic and speech can produced
from losing of teeth, so; substituting of losing teeth with suitable prostheses was mandatory for maintenance
of oral health.
Method: The patients participated in this study were (160) with aRPD, sixty males and one hundred females,
age range (30-60) years. After construction of the prosthesis, then ask the patients questions about aesthetic
and phonetic after placement of RPD, and the satisfaction of patient was evaluated.
Conclusion: From the point of phonetic and esthetic of the denture, largest percentage of the female were very
satisfy compared with the male. Non-significant differences between the age groups in respect of esthetic,
while about the phonetic, the largest percentage of the younger patient was very satisfy compared with the
older patient. The employed patient have largest percentage of satisfaction to the esthetic of the denture,
while the non-employed patient have largest percentage of satisfaction to the phonetic of the denture .
Severely Severely
Employment Dissatisfied (%) Neutral (%) Satisfied(%)
dissatisfied(%) satisfied(%)
Employee (71) 0 0 5.3 36.8 57.9
Non-employee(89) 0 0 15.4 15.4 69.2
Note: p-value more than0.05
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1111
Abstract
Some of the heavy metals exist in the outer layer of the earth, which is utilized for different economic and
manufacturing objectives. As some of these minerals impact humans in several ways, which are direct and
indirect, others like Cadmium and Zinc are needed for several body activities, such as organ functions and
biological chemical processes. Within these tests, we employed analysis of liver enzyme, urea, and creatinine,
to discover the damaged tissue causing after exposure to heavy metals. Results of liver function enzymes,
Aspartate aminotransferase (AST), Alanine transaminase (ALT), and Alkaline phosphatase (ALP), were
registered a significantly increasing (P≤0.05) for control, Cadmium treatment and zinc treatment groups,
with (32.1, 39.3, and 30.5) IU/ml, (9.6, 16.0, and 8.4) IU/ml, and (1.6, 2.5 and 2.12) IU/ml, respectively.
Cadmium administration was significantly reduced (P≤0.05) in serum creatinine concentration (1.26) IU/
ml, compared to the control group (2.02) IU/ml. While the average serum creatinine concentration increased
to (4.99) IU/ml after giving rat group Zinc solution. Moreover, the urea concentration was significantly
decreased to (18.85) IU/ml in the Cadmium treatment group than values of control and Zinc group (30.61,
and 35.97) IU/ml, respectively.
The high toxicity of Cd is due to its long biological Whereas, the second group was given concentration
half-life (10-30) years in person tissues, which makes of Zinc salts (0.572) mg/l with drinking water, while
him attack numerous organs and systems, mainly the third group was considered as a control group,
the liver, kidney, and neural system, also. Acute and which was given only distilled water throughout this
chronic Cd exposure causes hepatocyte swelling and period. Finally, blood was collected after drawn directly
massive necrosis as a result of elevation in enzymatic from the heart to obtain the blood serum, and then
biomarkers [4] [23]. Human tissue is exposed to Cd by biochemical examinations of liver and kidney functions
smoking cigarettes, agricultural uses, electroplating Cd- were performed. The diagnostic examination kit was of
Nickel batteries as industrial sources, and paint pigment AFCO type.
manufacturing units [39].
Results
Although numerous researches on Cd toxicity
performed, the molecular technique dependent on Cd The difference in liver function enzyme
toxicity has not been defining so far. The presence of concentrations is an indirect indication in diagnosing
Reactive Oxygen Species (ROS) resulting from the liver damage, as high concentrations of these enzymes
destruction of macromolecules indicates to pathogenicity in the blood cause an imbalance in liver cells. Table
caused by Cd-toxicity [22]. Anyway, it is not recognized (1) shows that the level of AST in the Cd treatment
if Cd was producing ROS directly by interacting with group significantly increasing (P≤0.05) was (39.3) IU/
molecular oxygen or after represses the antioxidant ml compared to a control group (32.1) IU/ml. Whereas,
protection system. the average significantly decreased to (30.5) IU/ml in
the Zinc treatment group compared to a Cd treatment
Cellular regulatory proteins are the target of free group and control group. While, ALT was significantly
1116 Medico-legal Update, January-March 2021, Vol. 21, No. 1
increasing to (16) IU/ml in the Cd treatment group the Cd treatment group. However, ALP concentration
compared to the control group and Zinc treatment significantly increased (P≤0.05) in the Cd treatment
group with (9.6, and 8.4) IU/ml, respectively. At low group reaching to (2.57) IU/ml compared to the control,
concentrations of liver function enzymes, we note the and Zinc treatment groups with (1.61, and 2.12) IU/ml,
presence of mathematical differences compared to the respectively.
control group and significant differences when using
Besides, table (2) showed that the concentration of lipid peroxidation, and decrease the antioxidant supply.
serum creatinine was significantly decreased (P≤0.05) in Increasing oxidative stress markers may refer to elevate
the Cd treatment group with (1.26) IU/ml compared to the generation of ROS, which causes damage to large
the control group (2.02) IU/ml. While the average serum molecules through an occurrence of diseases related to
creatinine concentration significantly increased to (4.99) aging, like heart disease, Parkinson’s disease, diabetes,
IU/ml when gave Zinc treatment group. Moreover, the and mitochondrial diseases[19] [4] [37].
concentration of urea was significantly decreasing to
(18.85) IU/ml in the Cd treatment group compared to Existence high concentration of heavy metals in the
control, and Zinc treatment groups with (30.61, and environment like Zinc and/or Cd causing food fracturing
35.97) IU/ml, respectively. to molecules, and throw away free radicals which killing
some friendly bacteria, as well as, damage to vitamins,
Table (2): Effect of cadmium and zinc enzymes, and yields chemicals like pesticides can form
administration on kidney functions new chemicals called unique radiolysis products-URLs
or toxins[5]. Some of these chemicals the long-term
Urea Creatinine Treatment effect on our food was unknown, so we cannot be safe,
Control group 2.02±0.41c 30.61±9.40a while the immune system was affected and inhibited its
Cadmium group 1.26±0.65b 18.85±8.18b functions by forming the oxidizers[38].
Zinc group 4.99±0.79a 35.97±6.93a On the contrary, Zinc exhibit increases the efficacy
LSD 0.76 11.76 of liver enzymes due to its antioxidant activity, which
gives rise to a decrease in oxidative pressures, oxidation
Statistical Analysis: Statistical analysis achieving and damages the cell as a result of the interaction
by extracting the mean ± standard error and significant between hydroxyl root (unstable free root) and some life
differences were tested between the mathematical rate molecules. Researchers, Stohs and Bagchi [31] and Sies
using the Duncan test [6]. Analysis by using a T-test [28] indicated that hydroxyl produced from hydrogen
accomplish to study differences between rates of various peroxide by lipid peroxidation or oxidizing the DNA
samples [30]. or protein gave an improvement to the texture of liver
tissue.
Discussion
In this research, determined the toxic influences DNA damage causes mutations and maybe cancer
of Cd and Zinc on liver and kidney tissues. Oxidative if the repair mechanisms for DNA do not work, whereas
stress was the harmful effect of heavy metals on human protein damage causes inhibition of enzymes and
health. Cd metal can generate several ROS, increase teratogen proteins [29] [35] [21]. A system of antioxidant
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1117
metabolites and enzymes prevents damage of nucleic concentration of liver transaminase enzymes. After liver
acids, proteins, and lipids, from occurring or removed parenchymal cells damage or membrane permeability,
before they cause damage, and the amount of protection enzymes like glutamate pyruvate transaminase (GPT),
depends on the concentration of antioxidant and reaction glutamate oxaloacetate transaminase (GOT), lactate
conditions [28] [36]. dehydrogenase, arginase, and gamma-glutamyl
transaminase, discharged out of the cell, and the result
Oxidative stress is an essential causative of is an increase in the level of enzymes in the blood than
several chronic diseases, such as cardiac disorders, normal [1] [20].
immunologic disorder, cancer, atherosclerosis, and
neurodegeneration[25]. In eukaryotic cells, the sources of Conclusion
ROS such as O2, H2O2, and OH, were a mitochondrial
respiratory chain, microsomal cytochrome P450 The research determined a new path to the study
enzymes, flavoprotein oxidases, and peroxisomal fatty of biological impacts associated with environmental
acid metabolism [3]. Zinc is an inhibitor of nicotinamide susceptibility to heavy metals. The aim is to distinguish
adenine dinucleotide phosphate (NADPH) oxidase, antioxidant defense disorders and the oxidative
decreased production a cofactor of superoxide dismutase processes in organs, like the kidney and liver, as a result
(SOD) (enzyme catalyzes the transfer of H2O2 to O2), like of continuous exposure to lower doses of Cd and Zinc,
ROS, and stimulate the generation of metallothionein, and establish the effects of these metals on oxidation
which is very rich in cysteine (an excellent scavenger of processes in the liver and kidney function indicator.
OH). Supplementation of Zinc to healthy human (20-50) Source of Funding: This study is self-funded
years decreasing the concentration of malondialdehyde
(MDA), 4hydroxy alkenes (HAE), and 8-hydroxy Conflict of Interest: Disclosure the authors declare
deoxyguanine in the plasma[24]. no conflict of interest.
The period of exposure was the main cause of Cd Ethical Clearance: Ethical clearance from the
accumulation in all tissues, for example, the concentration institutional ethical committee obtained for the study.
of Cd in mice was much higher in the blood, liver, and
kidneys exposing for only one-day per/week for 5 weeks References
than exposed through 5 weeks [18]. Several tests in mice
1. Aminah N. Perbandingan Kadar Pb, Hb, fungsi
were done and discovered that the concentration of Cd
hati, fungsi ginjal pada karyawan BBKTL and
in blood plasma was more than red cells after injection,
PPM Surabaya bagian sampling dan non sampling.
and the first symptom of Cd toxicity remarked in the
J kseshatan Lingkungan. 2006; 2(2): 111-120.
epithelium of blood vessels, and damage of hepatocytes
due to oxygen deficiency [9] [11] [14]. 2. ATSDR (Agency for Toxic Substances and Disease
Registry), CERCLA Priority List of Hazardous
The accumulation of Cd in kidneys has several Substances. 2005.
reasons, transmitted from other tissues, and release 3. Bao B, Prasad AS, Beck FWJ, Fitzgerald JT,
from hemoglobin during hemolysis, or liberating Snell D and Bao GW. Zinc decreases C Reactive
metallothionein from red cells [9]. The molecular analysis protein, lipid peroxidation, and implication of zinc
of Cd toxicity in kidneys is still unknown, and propose as another protective agent. Am J Clin Nutr. 2010;
that Cd encourage the lipid peroxidation and inhibits 91: 1634-41.
enzymes implicated in removing of activated oxygen
4. Chen Q, Zhang R, Li WM, Niu YJ, Guo HC and Liu
species from various tissues [27].
XH. The protective effect of grape seed procyanidin
Large numbers of macromolecules and more than extract against cadmium-induced renal oxidative
300 enzymatic reactions in which Zinc performs as damage in mice. Env Toxic Pharma. 2013; 36: 759-
a necessary element responsible for its structure and 68.
functions [32]. Whereas, Cd is a toxicity element causes 5. Duarte RC, Araujo MM, Salum DC, Marchioni E
structural distortions to proteins due to its association and Villavicencio ALCH. Effects of the ionizing
with sulfhydryl groups [35]. radiations, freezing and thawing duration on
chicken liver cells. Rad Phys and Chem. 2009;
Liver destruction is determined by estimating the
1118 Medico-legal Update, January-March 2021, Vol. 21, No. 1
78(7-8): 631-634. 17. Kulkarni BG and Kulakarni RG. Effect of Mercury
6. Duncan DB. Multiple range and multiple F- test exposure on enzymes in the Clam Katelysia opima.
biometrics. 1955; 11: 1-42. J Mar Sci. 1987; 16 (4): 265-266.
7. Engwa AG, Ihekwoaba CJ, ILO US, Unaegbu M, 18. Lind Y, Engman J, Jorhem L and Glynn AW.
Ayuk LE and Osuji AG. Determination of some Cadmium accumulation in liver and kidney of
soft drink constituents and contamination by some mice exposed to the same weekly cadmium dose
heavy metals in Nigeria. Toxic Rep. 2015; 3: 384- continuously or once a week. Food Chemo Toxicol.
390. 1997; 35: 891-895.
8. Florea AM, Dopp E, Obe G and Rettenmeier 19. McMurray J, McLay J, Chopra M, Bridges A and
AW. Genotoxicity of organometallic species. In: Belch JJF. Evidence for enhanced free radical
Hirner AV, Emons H, editors. Organic Metal and activity in chronic congestive heart failure,
Metalloid Species in the Environment: Analysis, secondary to coronary artery disease. Am J Cardio.
Distribution, Processes and Toxicological 1990; 65: 1261-1262.
Evaluation. Heidelberg: Springer-Verlag. 2004; 20. Muchtaromah BK and Adi TK. Transaminase
205-219. enzyme and liverhistological profile of mice
9. Friberg L, Piscator M, Nordberg GF and Kjellstrom administered extract of Pegagan (Centella asiatica
T. Cadmium in the environment, 2nd ed. Cleveland: (L.) Urban). Media Peternakan. 2010; 34(2): 88.
CRC Press Inc. 1974. 21. Nakabeppu Y1, Sakumi K, Sakamoto K, Tsuchimoto
10. Gagnon A, Jumarie C and Hontela A. Effects of D, Tsuzuki T and Nakatsu Y. Mutagenesis and
Cu on plasma cortisol and cortisol secretion by carcinogenesis caused by the oxidation of nucleic
adrenocortical cells of rainbow trout (Oncorhynchus acids. Bio Chem. 2006; 387(4): 373-9.
mykiss). Toxicol. 2006; 78: 59-65. 22. Ognjanovic BI, Markovic SD, Pavlovic SZ, Zikic
11. Godowicz B. Cadmium-induced liver and spleen RV, Stajn AS and Saicic ZS. Effect of chronic
damage in inbred mouse strains. Folia. Biol. 1988; cadmium exposure on antioxidant defense system
36(1-2): 47-52. in some tissues of rats: protective effect of selenium.
Phys Res. 2008; 57: 403-411.
12. IARC (International Agency for Research on
Cancer). Monographs on the Evaluation of the 23. Paul A, Das J, Das S, Samadder A and Khuda-
Carcinogenic Risk of Chemicals to Humans: Bukhsh AR. Poly (lactide-co-glycolide)
Arsenic and Arsenic Compounds (Group 1), World nano-encapsulation of chelidonine, an active
Health Organization, Lyon, France. 1987; 7: 100- bioingredient of greater celandine (Chelidonium
106. majus), enhances its ameliorative potential against
cadmium induced oxidative stress and hepatic
13. Ibrahim D, Froberg B, Wolf A and Rusyniak DE.
injury in mice. Env Toxic Pharma. 2013; 36: 937-
Heavy metal poisoning: clinical presentations and
47.
Pathophysiology. Clinics in Laboratory Medicine.
2006; 26: 67-97. 24. Prasad AS, Bao B, Beck FWJ, Kucuk O and Sarkar
FH. Antioxidant effect of zinc in humans. Free Rad
14. Kaji T, Mishima A, Yamamoto C, Sakamoto M and
Biol Med. 2004; 37: 1182-90.
Koizumi F. Effect of cadmium on the monolayer
maintenance of vascular endothelial cells in culture. 25. Prasad AS, Beck FWJ, Bao B, Fitzgerald JT,
Toxicol. 1992; 71: 267-276. Snell DC and Steinberg JD. Zinc supplementation
decreases incidence of infections in the elderly:
15. Kim HS, Kim YJ and Seo YR. An overview of
effect of zinc on generation of cytokines and
carcinogenic heavy metal: Molecular toxicity
oxidative estress. Am J Clin Nut. 2007; 85: 837-44.
mechanism and prevention. J of Canc Prevent.
2015; 20: 232-240. 26. Rajanna B and Chapatwala KD. Changes in ATPase
activities in tissues of rats fed on Cadmium. J Env
16. Krishna AK and Mohan KR. Distribution,
Biol. 1981; 2(1): 1-9.
correlation, ecological and health risk assessment
of heavy metal contamination in surface soils 27. Shiraishi N, Uno H and Waalkes MP. Effects of
around an industrial area, Hyderabad, India. Env L-ascorbic acid pretreatment on cadmium toxicity
and Earth Sci. 2016; 75: 411. in the male Fisher (F344/NCr) rat. Toxic. 1993; 85:
Medico-legal Update, January-March 2021, Vol. 21, No. 1 1119
85-100. antioxidant status of selected fruit samples sold in
28. Sies H. Oxidative stress: Oxidants and antioxidants. Enugu, Nigeria. Inter J of Food Cont. 2016; 3(7):
Expr Phys. 1997; 82: 291-295. 1-8.
29. Stadtman ER. Metal-ion catalyzed oxidation 35. Valko M, Morris H and MTD C. Metals, toxicity
of proteins: biochemical mechanism and and oxidative stress. Curr Med Chem. 2005; 12(10):
consequences. Free Rad Biol Med. 1990; 9: 315- 1161-1208.
325. 36. Vertuani S, Angusti A and Manfredini S. The
30. Steel RGD and Torrie JH. Principle and Procedure antioxidants and pro-antioxidants network: an
of Statistics. 2nd Ed. McGraw Hill: New York. overview. Curr Pharm Des. 2004; 10: 1677-1694.
1980. 37. Wang K, Zhang H, Chen S, Yang G, Zhang J,
31. Stohs SJ and Bagchi D. Oxidative mechanisms in Tian W, Su Z and Wang Y. Organic Polymorphs:
the toxicity of metal ions. Free Rad Biol and Med. One-Compound-Based Crystals with Molecular-
1995; 18: 321-336. Conformation-and Packing-Dependent
Luminescent Properties. Adv Mater. 2014; 26:
32. Tapiero H, Townsend DM and Tew KD. The
6168-6173.
antioxidant role of selenium and seleno-compounds.
Biomed Pharm. 2003; 57: 134-44. 38. Watson AD. Ssn6-Tup1 interacts with class I
histone deacetylases required for repression. Genes
33. Thirumavalavan R. Effect of cadmium on
Dev. 2000; 14(21): 2737-44.
biochemical parameters in fresh water fish,
Oreochromis mossambicus. Asia J Sci Tech. 2010; 39. Yuan Y, Jiang CY, Xu H, Sun Y, Hu FF and Bian
4: 100-104. JC. Cadmium-induced apoptosis in primary rat
cerebral cortical neurons culture is mediated by a
34. Unaegbu M, Engwa GA, Abaa QD, Aliozo SO,
calcium signaling pathway. PLoS One. 2013; 31:
Ayuk EL and Osuji GA. Heavy metal, nutrient and
8(5): e64330.
1120 Medico-legal Update, January-March 2021, Vol. 21, No. 1 DOI Number: 10.37506/mlu.v21i1.2467
Abstract
Background: Population is not a static entity and tends to change over time. Worldwide population
increases every year by more than 81 million people Such an explosion affects public health in every country
but like India face higher detrimental effects on the health infrastructure thereby making it prone severe
consequences. In Indian culture Women have the highest source pedestal of respect among all far more than
a man that is why she is called the Goddess of Life. We conducted this study to assess knowledge of married
women in reproductive age group regarding contraceptive method.
Material and Method: A quantitative Non experimental research design was adopted and the study was
conducted at an apex level tertiary care maternity hospital using non probability convenient sampling
technique was adopted and 100 married women were selected as sample for the study. A self-structured
questionnaire was developed and data was collected to be analyzed.
Results: The results revealed that majority 56 (56%) of married women belong to age group 26- 35 years.
Most 63 (63%) of the women had average knowledge scorerest all of them 37 (37 %) had poor knowledge.
On application of chi square test to determine association with selected socio demographic variables, age of
the women was found to be significantly associated with level of knowledge.
Table No. 1: Frequency and percentage of the knowledge of married women of reproductive age group
regarding the contraceptive method in selected Hospital of District Patiala, Punjab. N=100
Table No. 2: Descriptive statistics of the knowledge of married women in reproductive age group regarding
the contraceptive method in selected Hospital of District Patiala, Punjab. N=100