BIOINFORMATICS
BIOINFORMATICS
After the completion of sequencing of human genome and the genome of other
organisms, there was an explosion of data. Bioinformatics grew out of the need to develop
1
software for management, analysis and dissemination of enormous information resulting
from the accumulated data.
Historically, protein databases were prepared first before nucleotide databases. Various
bodies were involved in the formation of various databases. Dayhoff and others prepared
Atlas of Protein Sequence. EMBL succeeded by EBI, developed a DNA sequence database.
NBRF established PIR while NCBI built the GenBank. DDBJ later joined the data collection
collaboration. The three main partners of the International Nucleotide Sequence Database
Collaboration are GenBank, EMBL, and DDBJ.
DATABASES
Classification of Databases
The databases are broadly classified according to the level of processing of information
contained in it. In this respect, databases can be classified into three categories:
(a) Primary databases
(b) Secondary databases
(c) Composite databases
2
Moreover, based on the nature of biological information concerning the molecules, data
bases can be classified into two categories: sequence databases which can be (i) nucleotide
or/and protein data bases and (ii) structural databases that involves only protein
databases.
3
Classification based on the Nature of Information
Nucleotide Sequence Databases
The major sources of nucleotide sequence data are the databases involved in the
International Nucleotide Sequence Data base Collaboration: DDBJ, EMBL, and GenBank:
again, new or updated data are shared between these three entities once every 24 hours.
This transfer is facilitated by the use of common data formats for the kinds of information
that is described in detail below.
DDBJ/EMBL/GenBank nucleotide records often are the primary source of sequence and
biological information from which records in other databases are derived. Because so
many other databases are dependent on the accuracy of DDBJ/EMBL/GenBank records,
some important considerations immediately come to the fore based on the following
conditions:
a. If a coding sequence is not indicated on a nucleic acid record, it will not lead to the
creation of a record in the protein databases. Sequence similarity searches against the
protein databases, which are the most sensitive way of doing sequence similarity searches,
therefore may miss important biological relationships.
b. If a coding feature in a DDBJ/EMBL/GenBank record contains incorrect information
about the protein, this incorrect information will be passed on to other databases directly
derived from the record: it could even be propagated to other nucleotide and protein
records on the basis of sequence similarity.
c. If important information about a protein is not entered in the appropriate place within a
sequence record, any programs that are designed to extract information from these
records more than likely will miss the information, meaning that the information will not
filter down to other databases.
The rapid pace of discovery in the genomic and proteomic works requires that databases
are built in a way that facilitates not just the storage of these data, but the efficient
4
handling and retrieval of information from these databases. Several databases are now
available, and they can be classified based on the level of processing of information or on
the nature of information contained therein. The elementary format underlying the
information held in DDBJ/EMBL/GenBank is the flatfile. The correspondence between
individual flatfile formats facilitates the exchange of data between each of these
databases; in most cases, fields can be mapped on a one-to-one basis from one flatfile
format to the other. Over time, various file formats have been adopted and have found
continued, widespread use; others have fallen to the wayside for a variety of reasons. The
success of a given format depends on its usefulness in a variety of contexts, as well as its
power in effectively containing the types of biological information that need to be achieved
and communicated to the community.
Note: The dotted lines represent several nucleotides usually there are 60 characters per
line. Only two lines out of many are shown for brevity.
The greater than character (>) designate the beginning of a new sequence record; this line
is called the definition line or def line. After „>‟ is t he accession version number
(U54469.1).
The accession.version number is followed by the DNA sequence either in uppercase or
lower case letters.
More detail can sometimes be added to this format making it more complex. For instance
one can add more information to the def line making it more informative:
The above modified FASTA file now has information on the source database (gb, for
GenBank), its accession.version number (U54469.1), a LOCUS name identifier (in GenBank),
or entry name identifier (in EMBL; DMU54469), and a short description of what biological
entity the sequence represents.
(i) The Header: contains the information (descriptors) that apply to the entire record;
(ii) The features: are the annotations on the record; and
(iii) The Nucleotide Sequence: All major nucleotide database flatfiles end with ?? on the
last line of the record.
Flatfile format is the basic unit of information within the primary databases
(DDBJ/EMBL/GenBank). It facilitates interchange of information between these databases.
5
Sequence information is presented as FASTA (Fast Approximation of Smith & waterman
Algorithm) format in the basic flatfiles. Flatfiles can be separated into Header, the features
and the sequence.
AACompident inputs the composition of the query and is useful when the query sequence
is not known. In fact, it may be used to identify the sequence from its composition.
AACompSim inputs a query sequence and computes its composition internally.
Accession Number
This is a unique identifier to a GenBank sequence record. The typical format is 1-2 letters
followed by 4-6 digits. Here are a few fictitious though syntactically correct examples:
AG123456, BF43251.
BLASTN
This is the version of BLAST that searches a nucleotide sequence against a nucleotide
database. It uses a primitive substitution matrix (match=1, mismatch = -2).
BLASTP
This is the version of BLAST that searches a protein sequence against a protein database. It
supports searches using the BLOSUM or the PAM family of substitution matrices.
BLOSUM62 is the most popular matrix used in BLAST searches.
BLASTX
This is the version of BLAST that searches a nucleotide sequence against a protein database
by translating the nucleotide sequence in all frames.
BLAST2SEQUENCES
This is a version of BLAST which locally aligns two sequences, instead of searching one
sequence against a database.
6
BLOSUM
This is a family of substitution matrices for scoring alignments, for example when doing
BLAST searches. BLOSUM62 is the most widely used member of this family.
BOOTSTRAP
This is a statistical method used to access the robustness of phylogenetic trees produced
by various tree-building methods. The original multiple alignment from which a
phylogenetic tree was first produced is used to generate numerous bootstrap alignment.
Thus a bootstrap alignment has the same number of columns as the original alignment. A
phylogenetic tree is built from each bootstrap alignment. Once all the trees have been
built, these trees may be compared to yield a consensus tree or consensus sub-trees. Well-
conserved branches (or more generally, sub-trees) are often deemed as reliable.
CLUSTALW
This is a popular multiple alignment tool based on the progressive alignment method.
CLUSTER ANALYSIS
This is a computational and statistical procedure for partitioning a data set into subsets of
similar items. It is often used to group together genes with similar expression patterns (or
experiments with similar response patterns of genes) from microarray gene expression
data. It is also used to group together proteins with similar sequences or similar structure
(many protein classification databases are constructed this way).
DOT MATRIX
This is a nice way to visualize a local alignment, especially many alignments of pairs of
possibly overlapping, fragments in the two sequences. The horizontal and vertical axes
correspond to the two sequences. Solid diagonal lines denote aligned fragments.
DDBJ
This is the Japanese sibling of GenBank.
EMBL
This is the European sibling of GenBank, an annotated collection of all public domain DNA
and protein sequences.
ENSEMBL
This is a web server which provides access to automatically generated annotations of the
genomes of complex organisms such as humans. One can search the human genome,
7
browse chromosomes, find genes, find genomic sequences similar to a given protein
sequence, etc.
ENTREZ
This is a text-based search engine for bioinformatics databases, at NCBI. It provides access
to a literature database (PubMed), nucleotide database (GenBank), protein sequence
database, 3D Structure database (MMDB), Genome database (complete genome
assemblies), population sets, and Online Mendelian Inheritance in Man (OMIM).
FASTA
This is a program similar to BLAST for heuristic local alignment and for sequence-based
database searching.
FASTA FORMAT
This is a widely used format for DNA and protein sequences. Many search tools accept
sequences in this format. For each sequence, there is a header line beginning with >
followed by one or more lines containing the sequence itself, as illustrated below:
>sequence header
ACAGAAA
>Sequence header
>ACAAAGA
GENBANK
This is the premier database of nucleotide sequences. It is in flat file format.
GENSCAN
This is a popular gene finding program. It uses hidden Markov models
GLOBAL ALIGNMENT
This is a full alignment of two nucleotide or protein sequences, with gaps inserted in one or
both sequences, as needed.
GRAIL
This is a popular gene finding program. It uses neural networks to combine information
about predicted local sites such as splice sites with predicted coding regions.
LOCAL ALIGNMENT
This is the process of finding and aligning highly similar regions of two DNA or protein
sequences.
NEME
8
This is a tool for automatically discovering motifs (represented by ungapped position
weight matrix profiles) from a set of related protein or DAN sequences. The motif discovery
algorithm is based on fitting a two-component mixture model to the given set of
sequences, using the EM algorithm. One component describes the motif by a fixed-width
position-weight matrix profile. The other component models background, i.e. all other
positions in the sequences.
MULTIPLE ALIGNMENT
This is a global alignment of more than two nucleotide or protein sequences. The
alignment is typically scored by scoring each column of the alignment and adding up the
column scores. Gaps costs may be incurred in the score of a column, or separately. One
way to score a column is by its degree of conservativeness (more conserved columns,
indicate better scoring alignments). This can be done by computing the information
content of the column. A more widely used method is called the sum-of-pairs method. In
this method, the score of a column is the sum of the scores of all distinct pairs of letters in
the column, where a pair of letters is scored via a substitution matrix (such as BLOSUM or
PAM in the case of protein sequences). A multiple alignment is also a first step in
phylogenetic tree-building.
NEIGHBOR-JOINING METHOD
This is a phylogenetic tree-building method that is “one notch above” the UPGMA tree-
building method.
PARSIMONY
This is a character-based method for constructing a phylogenetic tree from a multiply
aligned set of sequences. The parsimony of a tree is defined as the minimum number of
substitutions required to produce a given set of sequences, placed a particular way the
leaves of the tree. The parsimony of a tree may be computed efficiently by a clever
method. It is much more time consuming to find the tree which has maximum parsimony
(minimum number of substitutions).
PHI-BLAST
Pattern Hit Initiated BLAST. This is a version of BLAST that inputs a protein sequence and a
regular expression pattern in it. It may be used to find other protein sequences that not
only contain the same patter n but are also similar to the input protein sequence in the
proximity of the occurrence of the pattern, in the two sequences. This is illustrated below:
PHYLOGENETIC ANALYSIS
This is the process of building a phylogenetic tree from a given set of sequences (or other
data). The first step is to do a multiple alignment of the sequences, using CLUSTALW
perhaps. The second step is to clean up the multiple alignment (remove outlying
sequences, handle gaps, downweight overrepresented sequences, etc.). The third step is to
build one or more trees, using a distance-based method, a parsimony method, or a
9
likelihood-based method. The fourth step (which may interact with earlier steps) is to
assess the quality of the built trees perhaps using bootstrap.
PREDICTPROTEIN
This web server features the class of PHD programs for predicting secondary structure,
solvent accessibility, and transmembrane helices, as well as programs for prediction of
tertiary structure, coiled-coil regions, etc. At the same site, in the Meta PredictProtein
section is another secondary structure prediction program, JPRED, which takes a consensus
between a number of methods. There are also three other programs for predicting
transmembrane helices, TMHMM, TOPRED, and DAS. The tertiary structure prediction
programs include TOPITS, SWISS-MODEL, and CPHmodels.
SWISS-PROT
This is a curated database of protein sequences with a high level of annotation (functions
of a protein, domains in it, etc) and low redundancy.
THREADING
This is an alignment of a protein sequence to the 3D structure of another protein.
TOPITS
This is a program for predicting the tertiary structure of a protein from its sequence. It uses
a database of secondary structure strings derived from tertiary structures in PDB. (This
10
database has one such string for each tertiary structure in PDB). First, this program uses
the PHDsec program to predict the secondary structure string sse (x) of a protein sequence
x. Next, it aligns, one by one, this predicted string sse ( ) with each secondary structure
string in the database (Alignments are x done via dynamic programming).
TREMBL
This is an automatically annotated adjunct to SWISS-PROT.
UPGMA
This is a distance-based method for building a phylogenetic tree from a multiply aligned set
of sequences. It performs a hierarchical clustering of the given data set, which yields this
tree. Several processes and tasks can be performed in Bioinformatics with a view to
answering various biological questions. A good approach is to define the bioinformatics
problems clearly and map out the processes to employ in solving the problems.
There are several problem solving tools, techniques, processes and tasks in Bioinformatics.
They include data retrieval in which data retrieval systems like Entrez can be used.
Sequence alignment can be done using various BLAST facilities. Phylogenetic trees can be
built from aligned sequences.
The completion of sequencing of a number of model organisms, along with the continued
sequencing of others, underscores the necessity for all biologists to learn how to make
their way effectively through this sequence space. GenBank, or any other biological
database for that matter, serves little purpose unless the database can be easily searched
and entries can be retrieved in a usable, meaningful format. Otherwise, sequencing efforts
have no useful end, because the biological community as a whole cannot make use of the
information hidden within these millions of bases and amino acids. Much effort has gone
into making such data accessible to the average user, and the programs and interfaces
resulting from these efforts are the focus of this chapter. The discussion centers on
querying databases at the National Center for Biotechnology Information (NCB) because
these more “general” repositories are far and away the ones most often accessed by
biologists, but attention is also given to a specialized databases that provide information
not necessarily found through Entrez.
Coding for Nucleotide Bases and Amino Acid Residues in Sequence Information
Amino Acid 3-letter One Letter Amino Acid 3-letter One Letter
Code Code Code Code
1. Alanine Ala A 11. Leucine Leu L
2. Arginine Arg R 12. Lysine Lys K
3. Asparagi Ash N 13. Methion Met M
nes ine
4. Aspartic Asp D 14. Phenylal Phe F
Acid anine
5. Cysteine Cys C 15. Proline Pro P
6. Glutami Gln Q 16. Serine Ser S
ne
7. Glutami Glu E 17. Threoni Thr T
c Acid ne
8. Glycine Gly H 18. Tryptop Trp W
han
9. Histidine His H 19. Tyrosine Tyr Y
10. IsoLeuci Ile I 20. Valine Val V
ne
Database Search
Database analysis is of two categories:
(1) Genomic analysis: includes analysis of nucleic acid composition, restriction enzyme
cleavage sites, transcriptional factors, promoter sites, secondary structure, and sequence
similarity searches. (2) Proteomics analysis includes determination of amino acid
composition, sequence alignment, phylogenetic analysis, sequence similarity searches,
prediction of secondary structure, motifs, profiles, domains and tertiary structure.
12
Database Organisation
Searching of sequence databases is one of the most common tasks with a newly
discovered protein or nucleic acid. This is used to find if (i) the sequence is already in a
database, (ii) if it is new, then to infer its structure (secondary and tertiary), and its
function, and (iii) presence of active sites, substrate-binding sites etc.
There is a vast amount of gene sequence data available (e.g. from genome sequence
project). Two main databases that are widely used for novel gene discovery are high-
throughput genomic databases, and the expressed sequence tag (EST) databases. EST
databases are singlepass, partial sequences of 50-500 nucleotides from cDNA libraries.
They provide direct window onto the expressed genome. EST sequences are generated by
shotgun sequencing method. The sequencing is random and a sequence can be generated
several times, and can be inaccurate.
Search Engines: Altavista, Google, Yahoo, Infoseek, Medicine, Research Index, Pedro’s
Biomolecular Research Tools
Search Sites
1. DDBJ: (http://www.ddbj.nig.ac.jp/). (DNA Databank of Japan). A nucleic acid
database.
2. EBI: (http://www.ebi.ac.uk/). (European Bioinformatics Institute; UK, an outstation
of the EMBL).
3. EMBL: (http://www.ebi.ac.uk/). (European Molecular Biology Laboratory;
Germany).
4. ExPASy: (http://www.expasy.ch/). Expert Protein Analysis System, a Molecular
Biology Server, Switzerland, with SWISS-PROT, PROSITE, 2D-PAGE, and other proteomics
tools. Key site for protein sequence and structure information.
5. GenBank: (http://www.ncbi.nlm.nih.gov/Web/GenBank/). GenBank of the National
Institute of Health (NIH, USA genetic sequence database is an annotated collection of all
publicly available DNA sequences. GenBank is a part of the International nucleotide
sequence database, which is comprised of the DNA databank of Japan (DDBJ), the
European Molecular Biology Laboratory (EMBL, Germany) and GenBank at NCBI, USA.
6. GRAIL: (http://compbio.ornl.gov/Grail-1.3/). Gene Recognition and Assembly
Internet Link software. A suite of tools designed to provide analysis and putative
annotation of DNA sequences both interactively and through the use of automated
computation.
Websites
1. NCBI: (http://www.ncbi.nlm.nih.gov/). (National Center for Biotechnology
Information; NIH, USA)
2. OMIM: (http://www3.ncbi.nlm.nih-gov/Omim). On-line Mendelian inheritance in
Man (for human genes and genomics at NCBI).
3. Sanger Center: (http://www.sanger.ac.uk/DataSearch/). Genomic sequencing and
genomics analysis server (UK).
13
4. PUBMED: (http://www.ncbi.nlm.nih.gov/PubMed/). Covers mainly medical
literature.
5. SWISS-PROT: (http://expasy.hcuge.ch/sprot/sprot-top.html). A protein sequence
database (Switzerland).
1. BLAST: Basic Local Alignment and Search Tool (Home Page: NCBI, USA) sequence
retrieval and sequence similarity search engine, which consists of a suite of programs –
BLASTN (nucleotide BLAST), BLASTP (Protein BLAST), BLASTX (Translated BLAST),
PhyloBLAST and PIR-BLAST.
2. CLEVER: Command-line ENTREZ Version from NCBI. It is an interactive tool to
browse ENTREZ database using only test input/output.
3. ENTREZ: (http://www3.ncbi.nlm.nih.gov/ENTREZ). ENTREZ is a powerful search
engine, a part of NCBI server. The NCBI contains all the nucleotide and protein sequences
in GenBank and Medicine. The program allows one to start with only tentative set of
keywords, or a sequence identified in the laboratory, and rapidly accesses a set of relevant
list and a list related database sequences.
4. FASTA: (http://www2.igh.cnrs.fr/bin/fasta-guess.cgi). Sequence retrieval and
similarity search database.
5. FETCH: FETCH is sequence retrieval program that retrieves sequences from the
GenBank and other databases. The program requires the exact locus name or accession
number of a sequence.
6. LOOKUP: LOOKUP is a sequence retrieval program that uses SRS (Sequence
Retrieval System) and is useful if the accession number is not known, but one wishes to
download sequences of all proteins related to the query protein. LOOKUP identifies
sequence by name, accession number, keyword, title, reference, feature or date. The
output is a list of sequences.
14
PubMed records, nucleotide and protein sequence data, three-dimensional structure
information, and mapping information. The strength of Entrez lies in the fact that all of this
information, across numerous component databases, can be accessed by issuing one and
only one query. Entrez is able to offer integrated information retrieval through the use of
two types of connection between database entries: neighboring and hard links.
15
page in two rows. Identical or similar characters are placed in the same column and non-
identical characters can be placed opposite a gap in the other sequence. Gap is a space
introduced into an alignment to compensate for insertions and deletions in one sequence
relative to another. In optimal alignment, non-identical characters and gaps are placed to
bring as many identical or similar characters as possible into vertical register.
The objective of sequence alignment analysis is to analyze sequence data to make reliable
prediction on protein structure, function and evolution vis-a-vis the three-dimensional
structure. Such studies include detection of orthologous (same function in different
species), and paralogous (different but related functions within an organisms) features.
Sequence-similarity searches of unknown sequences to databases are commonly used in
biological laboratories as the first approach to obtain clues about the function of newly
sequenced genes. The National Center for Biotechnology Information (NCBI) provides the
Basic Local alignment Search Tool (BLAST) that allows for rapid comparison of nucleotide
and protein query sequences to database sequences. The BLAST algorithm works by
identifying short common regions of similarity (words) between a query sequence and
database sequences. These words are of fixed lengths (4 amino acids for proteins and 11
base pairs for nucleotides) and are considered to be the minimum length needed to
guarantee finding meaningful and significant patterns of similarity. Once a “word” is
identified it is extended in either direction to search for extended regions of similarity
between the query and the matched sequence, in order to determine the maximum level
of identity between the two sequences being compared. This lining up of the two
sequences is called an alignment and the solutions provided by BLAST are given in the form
of alignments.
We must define criteria so that algorithm can choose the best alignment. For instance
consider the following nucleotide sequences:
g c t g a a c g and c t a t a a t c
16
Pairwise Sequence Alignment
Pair-wise alignment is a fundamental process sin sequence comparison analysis. Pair-wise
alignment of two sequences (DNA or protein) is relatively straightforward computational
problem. In a pair-wise comparison, if gaps or local alignments are not considered (i.e.
fixed-length sequences), the optimal alignment method can be tried and the number of
computations required for two sequences is roughly proportional to the square of the
average length, as is the case in dotplot comparison. The problem becomes complicated,
and not feasible by optimal alignment method, when gaps and local alignments are
considered.
That a program may align two sequences is not a proof that a relationship exists between
them. Statistical values are used to indicate the level of confidence that should be attached
to an alignment. A maximum match between two sequences is defined to be the largest
number of amino acids from on protein that can be matched with those of another
protein, while allowing for all possible deletions. A penalty is introduced to provide a
barrier to arbitrary gap insertion.
Dotplot Analysis
The dotplot is a table of matrix representing a visual representation of similarities between
two sequences. Dotplot analysis is essentially a signal-to-noise graph, used in visual
comparison of two sequences and to detect regions of close similarity between them. The
concept of similarity between two sequences can be discerned by dotplots. Two sequences
are written along and x- and y-axes, and dots are plotted at all positions where identical
residues are observed, that is, at the intersection of every row and column that has the
same letter in both the sequences. Within the dotplot, a diagonal unbroken stretch of dots
will indicate a region where two sequences are identical.
Global Alignment
Global alignment is an alignment of two nucleic acid or protein sequences over their entire
length. The Needleman-Wunsch algorithm (GAP program) is one of the methods to carry
out pair-wise global alignment of sequences by comparing a pair of residues at a time.
Comparisons are made from the smallest unit of significance, a pair of amino acids, one
from each protein. All possible pairs are represented by a two-dimensional array (one
sequence along x-axis and the other along y-axis), and pathways through the array
represent all possible comparisons (every possible combination of match, mismatch and
insertion and deletion). Statistical significance is determined by employing a scoring
system; for a match = 1 and mismatch = 0 (or any other relative scores) and penalty for a
gap.
17
Local Alignment
Local alignment is an alignment of some portion of two nucleic acid or protein sequences.
Smith-Waterman algorithm is a variation of the dynamic programming approach to
generate local optimal alignments, best alignment method for sequences for which no
evolutionary relatedness is known. The program finds the region or regions of highest
similarity between two sequences, thus generating one or more islands of matches or sub-
alignment in the aligned sequences.
Local alignments are more suitable and meaningful for:
(i) aligning sequences that are similar along some of their lengths but dissimilar in
others.
(ii) sequences that differ in length
(iii) (iii) sequences that share conserved regions or domains.
18
It will be rewarding going through the following exercise using BLAST. Consider the DNA
sequence below:
Note: Since it is DNA-DNA alignment, we use BLASTn
Sample DNA Sequence:
ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAA
TCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTT
GTGGGCACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCT
ACCTGCTCAATGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCC
GCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCT
CTGGAATCTTCTTCACTCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTT
AAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTG
CGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCA
TTTTCCATACAGTCAGTATCAATTCTGGAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGG
TCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGAATCCTAAAAACTCTGCTTCGGTGTCGAAAT
GAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGG
GCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAG
CTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAA
CCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCAC
ATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCA
GTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA
1. From the NCBI home page (http://www.ncbi.nlm.nih.gov) follow the “BLAST” link
2. Then from “Genomes” select “Human”
3. Paste the sequence above into the box (note that it is in FASTA format)
4. Click on “Begin Search”
5. Wait for a short while then try “Format”
19
Aligned (similar) regions are in rectangles
Gene of Interest
Repeat the process above with any gene or protein that is of interest to you.
20
How many genes?
For an up-to-date report of the number of genes in various organisms, go back to the
original NCBI site in step 2, and search “HomoloGene” and leave the space after the word
“for” blank. You will see a recent count of identified genes for about 18 organisms.
>Unknown 1
gagcaggtgcctcactatcgacaagccctagacatgatcttggacctggaacctgatgaagagctggaagacaaccccaaccag
agtgacttgattgagcaggcggccgagatgctctatgggttgatccacgcccgctacatcctcaccaaccggggcattgcacaaat
gttggaaaagtaccagcaaggagactttggctactgtcctcgagtatactgtgagaaccagccgatgcttcccatcggcctttcgga
catcccaggagaggccatggtgaagctctactgccccaagtgcatggacgtgtacacacccaagtcctctaggcaccaccacacg
gatggcgcatacttcggcactggtttccctcacatgctcttcatggtgcatcccgagtaccggcccaagcggccggccaaccagttt
gtgcccaggctctacggtttcaagatccatccaatggcctaccagctgcagctccaagccgccagcaacttcaagagcccagtcaa
gacgattcgctgagtgccctcccacctcctctgcctgtgacaccaccgtccctccgctgccaccctttcaggaagtctatggtttttag
t
To perform BLAST on this sequence,, follow the steps below:
1. Go to the NCBI web page by typing the URL http://www.ncbi.nlm.nih.gov/
2. Go to BLAST.
3. Go to “Nucleotide BLAST under “Basic BLAST.”
4. Insert the query sequences (Unknown 1) in the window provided
5. Hit “BLAST.”
You will be prompted with a window informing you that your request was successfully
submitted to BLAST. It will assign you a “Request ID”. (NOTE: The NCBI web page is
changing constantly, so the figures presented in this example may differ from those you
may encounter).
21
Get back to your BLAST result page. Look at the graphical view of the results. You will see a
set of parallel horizontal bars of different colors and lengths. The color indicates the level
of similarity between the query sequence and the matching sequence from the database. A
red bar denotes a high similarity score while black denotes very low similarity between the
two sequences.
22