DATE : 05/05/2024 Test Booklet Code

T5
IGUDR

Corporate Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 | Ph.: 011-47623456

Questions & Answers

Time : 3 hrs. 20 Min. for M.M. : 720

NEET (UG)-2024
Important Instructions :
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple-choice questions (four
options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology). 50 questions
in each subject are divided into two Sections (A and B) as per details given below:
(a) Section-A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos-1 to 35, 51 to 85, 101 to
135 and 151 to 185). All Questions are compulsory.
(b) Section-B shall consist of 15 (Fifteen) questions in each subject (Question Nos- 36 to 50, 86 to 100, 136 to
150 and 186 to 200). In Section B, a candidate needs to attempt any 10 (Ten) questions out of 15 (Fifteen)
in each subject.
Candidates are advised to read all 15 questions in each subject of Section B before they start attempting the
question paper. In the event of a candidate attempting more than ten questions, the first ten questions answered
by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect
response, one mark will be deducted from the total scores. The maximum marks are 720.
3. Use Blue / Black Ball Point Pen only for writing particulars on this page / marking responses on Answer Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must hand over the Answer Sheet (ORIGINAL and OFFICE copy) to
the Invigilator before leaving the Room / Hall. The candidates are allowed to take away this Test Booklet with
them.
6. The CODE for this Booklet is T5. Make sure that the CODE printed on the Original Copy of the Answer
Sheet is the same as that on this Test Booklet. In case of discrepancy, the candidate should immediately report
the matter to the Invigilator for replacement of both the Test Booklet and the Answer sheet.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the Answer
Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test Booklet/Answer Sheet.
8. Use of white fluid for correction is NOT permissible on the Answer Sheet.
9. Each candidate must show on-demand his/her Admission Card to the Invigilator.
10. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her seat.
11. Use of Electronic/Manual Calculator is prohibited.
12. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in the
Examination Room / Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
13. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
14. The candidates will write the Correct Test Booklet Code as given in the Test Booklet / Answer Sheet in the
Attendance Sheet.

-1-
 NEET (UG)-2024 (Code-T5)

PHYSICS

SECTION-A
1. A bob is whirled in a horizontal plane by means of a string with an initial speed of  rpm. The tension in the
string is T. If speed becomes 2 while keeping the same radius, the tension in the string becomes:

T
(1) (2) 2T
4

(3) T (4) 4T

Answer (4)

2. A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and
3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :

(1) 6N (2) 10 N

(3) Zero (4) 4N

Answer (1)

3. The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus,
respectively, are 8 × 108 N m–2 and 2 × 1011 N m–2, is:

(1) 40 mm (2) 8 mm

(3) 4 mm (4) 0.4 mm

Answer (3)

4. In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as
shown. The moment of inertia of the needle is 9.8 x 10 –6 kg m2. If the magnitude of magnetic moment of the
needle is x × 10–5 Am2, then the value of ‘x’ is :

(1) 502

(2) 12802

(3) 52

(4) 1282

Answer (2)

-2-
NEET (UG)-2024 (Code-T5)
5. If c is the velocity of light in free space, the correct statements about photon among the following are:
A. The energy of a photon is E = h.
B. The velocity of a photon is c.
h
C. The momentum of a photon, p = .
c
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses positive charge.
Choose the correct answer from the options given below:
(1) A, C and D only (2) A, B, D and E only
(3) A and B only (4) A, B, C and D only
Answer (4)
6. The output (Y) of the given logic gate is similar to the output of an/a

(1) OR gate (2) AND gate

(3) NAND gate (4) NOR gate
Answer (2)
7. Consider the following statements A and B and identify the correct answer:

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measured in (A), is due to majority charge carriers.
(1) Both A and B are correct (2) Both A and B are incorrect
(3) A is correct but B is incorrect (4) A is incorrect but B is correct
Answer (3)
8. A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

(1) –90 J (2) –60 J

(3) Zero (4) 30 J
Answer (3)

-3-
 NEET (UG)-2024 (Code-T5)

9. A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water
is 0.07 N m–1, then the excess force required to take it away from the surface is
(1) 1.98 mN (2) 99 N
(3) 19.8 mN (4) 198 N
Answer (3)

10. At any instant of time t, the displacement of any particle is given by 2t – 1 (SI unit) under the influence of force
of 5 N. The value of instantaneous power is (in SI unit):
(1) 7 (2) 6
(3) 10 (4) 5
Answer (3)

11. 290  e+ − e−
82 X ⎯⎯→Y ⎯⎯⎯
→ Z ⎯⎯⎯
→ P ⎯⎯⎯
→Q

In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are
(1) 288, 82 (2) 286, 81
(3) 280, 81 (4) 286, 80
Answer (2)

12. A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in figure. It
travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the
prism is:

3 3
(1) (2)
4 2

5 5
(3) (4)
4 2
Answer (4)

13.

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of
induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:
(1) AB and CD (2) BA and DC
(3) AB and DC (4) BA and CD
Answer (3)

-4-
NEET (UG)-2024 (Code-T5)

NP 1
14. In an ideal transformer, the turns ratio is = . The ratio VS : VP is equal to (the symbols carry their usual
NS 2
meaning) :
(1) 1:1 (2) 1:4
(3) 1:2 (4) 2:1
Answer (4)

 1 
15. The graph which shows the variation of   and its kinetic energy, E is (where  is de Broglie wavelength
 2 
of a free particle):

(1) (2)

(3) (4)

Answer (2)

16. If the monochromatic source in Young’s double slit experiment is replaced by white light, then
(1) There will be a central bright white fringe surrounded by a few coloured fringes
(2) All bright fringes will be of equal width
(3) Interference pattern will disappear
(4) There will be a central dark fringe surrounded by a few coloured fringes
Answer (1)
17. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole
moment vector P of magnitude, 4 × 10–6 C m, is ± 9 × 103 V.
1
(Take = 9 × 109 SI units)
4 0

2P
Reason R: V =  , where r is the distance of any axial point, situated at 2 m from the centre of the
4 0 r 2
dipole.
In the light of the above statements, choose the correct answer from the options given below:
(1) A is true but R is false.
(2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true and R is NOT the correct explanation of A.
Answer (1)

-5-
 NEET (UG)-2024 (Code-T5)

18. Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves
with velocity v1 while body B is at rest before collision. The velocity of the system after collision is v2. The ratio
v1 : v2 is
(1) 4 : 1 (2) 1 : 4
(3) 1 : 2 (4) 2 : 1
Answer (4)
19. In the following circuit, the equivalent capacitance between terminal A and terminal B is :

(1) 0.5 F (2) 4 F

(3) 2 F (4) 1 F
Answer (3)
20. The quantities which have the same dimensions as those of solid angle are:
(1) strain and arc (2) angular speed and stress
(3) strain and angle (4) stress and angle
Answer (3)
21. A logic circuit provides the output Y as per the following truth table :
A B Y
0 0 1
0 1 0
1 0 1
1 1 0
The expression for the output Y is :
(1) B (2) B
(3) A.B + A (4) A.B + A
Answer (1)
22. A thin spherical shell is charged by some source. The potential difference between the two points C and P
(in V) shown in the figure is:
1
(Take = 9  109 SI units)
40

(1) 0.5 × 105 (2) Zero

(3) 3 × 105 (4) 1 × 105
Answer (2)

-6-
NEET (UG)-2024 (Code-T5)

23. Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below.
(1) Statement I is correct but Statement II is incorrect
(2) Statement I is incorrect but Statement II is correct
(3) Both Statement I and Statement II are correct
(4) Both Statement I and Statement II are incorrect
Answer (1)
24. Match List I with List II.
List I List II
(Spectral Lines of (Wavelengths (nm))
Hydrogen for
transitions from)
A. n2 = 3 to n1 = 2 I. 410.2
B. n2 = 4 to n1 = 2 II. 434.1
C. n2 = 5 to n1 = 2 III. 656.3
D. n2 = 6 to n1 = 2 IV. 486.1
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-I, D-II (2) A-I, B-II, C-III, D-IV
(3) A-II, B-I, C-IV, D-III (4) A-III, B-IV, C-II, D-I
Answer (4)
25.  
If x = 5 sin  t +  m represents the motion of a particle executing simple harmonic motion, the amplitude
 3 
and time period of motion, respectively, are
(1) 5 cm, 1 s (2) 5 m, 1 s
(3) 5 cm, 2 s (4) 5 m, 2 s
Answer (4)
26. Match List-I with List-II.
List-I List-II
(Material) (Susceptibility ())
A. Diamagnetic I. =0
B. Ferromagnetic II. 0    –1
C. Paramagnetic III.   1
D. Non-magnetic IV. 0     (a small positive number)
Choose the correct answer from the options given below
(1) A-III, B-II, C-I, D-IV (2) A-IV, B-III, C-II, D-I
(3) A-II, B-III, C-IV, D-I (4) A-II, B-I, C-III, D-IV
Answer (3)

-7-
 NEET (UG)-2024 (Code-T5)

27. A wire of length ‘l’ and resistance 100  is divided into 10 equal parts. The first 5 parts are connected in series
while the next 5 parts are connected in parallel. The two combinations are again connected in series. The
resistance of this final combination is:
(1) 55  (2) 60 
(3) 26  (4) 52 
Answer (4)

28. The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 , when connected through
an external resistance of 4  as shown in the figure is:

(1) 8V (2) 10 V
(3) 4V (4) 6V
Answer (1)
29. A particle moving with uniform speed in a circular path maintains:
(1) Constant velocity but varying acceleration (2) Varying velocity and varying acceleration
(3) Constant velocity (4) Constant acceleration
Answer (2)

30. A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at
the centre of the coil is (Take permeability of free space as 4 × 10–7 SI units):
(1) 4.4 mT (2) 44 T
(3) 44 mT (4) 4.4 T
Answer (1)

31. In a vernier callipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD
represents 0.1 mm, the vernier constant (in cm) is:
(1) 100N (2) 10(N + 1)
1 1
(3) (4)
10N 100(N + 1)
Answer (4)
32. An unpolarised light beam strikes a glass surface at Brewster's angle. Then
(1) Both the reflected and refracted light will be completely polarised.
(2) The reflected light will be completely polarised but the refracted light will be partially polarised.
(3) The reflected light will be partially polarised.
(4) The refracted light will be completely polarised.
Answer (2)

-8-
NEET (UG)-2024 (Code-T5)

33. 1
The mass of a planet is th that of the earth and its diameter is half that of the earth. The acceleration due
10
to gravity on that planet is:
(1) 4.9 m s–2 (2) 3.92 m s–2
(3) 19.6 m s–2 (4) 9.8 m s–2
Answer (2)

34. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is  in the
direction shown, which one of the following options is correct (P and Q are any highest and lowest points on
the wheel, respectively)?

(1) Both the points P and Q move with equal speed (2) Point P has zero speed
(3) Point P moves slower than point Q (4) Point P moves faster than point Q
Answer (4)

35. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is
2400 g cm2. The length of the 400 g rod is nearly:
(1) 20.7 cm (2) 72.0 cm
(3) 8.5 cm (4) 17.5 cm
Answer (3)

SECTION-B
36. Choose the correct circuit which can achieve the bridge balance.

(1) (2)

(3) (4)

Answer (3)

-9-
 NEET (UG)-2024 (Code-T5)
37. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the
circuit, then in the gap between the plates:
(1) Displacement current of magnitude equal to I flows in a direction opposite to that of I
(2) Displacement current of magnitude greater than I flows but can be in any direction
(3) There is no current
(4) Displacement current of magnitude equal to I flows in the same direction as I
Answer (4)
38. The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume)
at three pressures P1, P2 and P3 compared with those of Charles’s law represented as dotted lines.

Then the correct relation is:

(1) P2 > P1 > P3 (2) P1 > P2 > P3
(3) P3 > P2 > P1 (4) P1 > P3 > P2
Answer (2)

39. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half
x
its original length, then the new time period of oscillation is times its original time period. Then the value of
2
x is:
(1) 2 3 (2) 4
(3) 3 (4) 2
Answer (4)
40. Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in
series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
(1) 1:2 (2) 2:3
(3) 1:1 (4) 2:9
Answer (4)

41. If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then
A. the charge stored in it, increases.
B. the energy stored in it, decreases.
C. its capacitance increases.
D. the ratio of charge to its potential remains the same.
E. the product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
(1) B, D and E only (2) A, B and C only
(3) A, B and E only (4) A, C and E only
Answer (4)

- 10 -
NEET (UG)-2024 (Code-T5)

42. A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The
magnifying power of telescope for viewing a distant object is:
(1) 17 (2) 32
(3) 34 (4) 28
Answer (4)

43. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. hold the sheet there if it is magnetic.
B. hold the sheet there if it is non-magnetic.
C. move the sheet away from the pole with uniform velocity if it is conducting.
D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
(1) A, C and D only (2) C only
(3) B and D only (4) A and C only
Answer (4)

44. A metallic bar of Young’s modulus, 0.5 × 1011 N m–2 and coefficient of linear thermal expansion 10–5 °C–1,
length 1 m and area of cross-section 10–3 m2 is heated from 0°C to 100°C without expansion or bending. The
compressive force developed in it is :
(1) 100 × 103 N (2) 2 × 103 N
(3) 5 × 103 N (4) 50 × 103 N
Answer (4)

45. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius
R in a circular orbit at an altitude of 2R from the surface of the earth is:

GmM GmM
(1) (2)
2R 3R

5GmM 2GmM
(3) (4)
6R 3R
Answer (3)

46. A 10 F capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is
nearly ( = 3.14):

(1) 1.20 A (2) 0.35 A

(3) 0.58 A (4) 0.93 A
Answer (4)

- 11 -
 NEET (UG)-2024 (Code-T5)

47. An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms
make an angle 60° with each other. The magnetic moment of this new magnet is :

M
(1) 2M (2)
3

M
(3) M (4)
2
Answer (4)

48. The velocity (v) – time (t) plot of the motion of a body is shown below:

The acceleration (a) – time (t) graph that best suits this motion is :

(1) (2)

(3) (4)

Answer (1)

49. The property which is not of an electromagnetic wave travelling in free space is that:

1
(1) They travel with a speed equal to
0 0

(2) They originate from charges moving with uniform speed

(3) They are transverse in nature
(4) The energy density in electric field is equal to energy density in magnetic field
Answer (2)

50. A force defined by F = t2 + t acts on a particle at a given time t. The factor which is dimensionless, if  and
 are constants, is:


(1) t (2)
t
t t
(3) (4) 

Answer (4)

- 12 -
NEET (UG)-2024 (Code-T5)

CHEMISTRY

SECTION-A
51. In which of the following processes entropy increases?
A. A liquid evaporates to vapour.
B. Temperature of a crystalline solid lowered from 130 K to 0 K.
C. 2NaHCO3(s) → Na2CO3(s) + CO2(g) + H2O(g)
D. Cl2(g) → 2Cl(g)
Choose the correct answer from the options given below:
(1) A, C and D (2) C and D
(3) A and C (4) A, B and D
Answer (1)

52. On heating, some solid substances change from solid to vapour state without passing through liquid state.
The technique used for the purification of such solid substances based on the above principle is known as
(1) Distillation (2) Chromatography
(3) Crystallization (4) Sublimation
Answer (4)

53. Identify the correct reagents that would bring about the following transformation.

(1) (i) BH3 (2) (i) H2O/H+

(ii) H2O2 / OH (ii) PCC

(iii) alk.KMnO4

(iv) H3O

(3) (i) H2O/H+ (4) (i) BH3

(ii) CrO3 (ii) H2O2 / OH

(iii) PCC
Answer (4)

54. The energy of an electron in the ground state (n = 1) for He + ion is –x J, then that for an electron in n = 2
state for Be3+ ion in J is
4
(1) –4x (2) − x
9

x
(3) –x (4) −
9
Answer (3)

- 13 -
 NEET (UG)-2024 (Code-T5)

55. Match List I with List II.

List I List II
(Molecule) (Number and types of
bond/s between two
carbon atoms)
A. ethane I. one -bond and two -bonds
B. ethene II. two -bonds
C. carbon molecule, C2 III. one -bond
D. ethyne IV. one -bond and one -bond
Choose the correct answer from the options given below:

(1) A-III, B-IV, C-II, D-I

(2) A-III, B-IV, C-I, D-II

(3) A-I, B-IV, C-II, D-III

(4) A-IV, B-III, C-II, D-I

Answer (1)

56. For the reaction 2A B + C, KC = 4 × 10–3. At a given time, the composition of reaction mixture is:
–3
[A] = [B] = [C] = 2 × 10 M.
Then, which of the following is correct?
(1) Reaction has a tendency to go in backward direction.
(2) Reaction has gone to completion in forward direction.
(3) Reaction is at equilibrium.
(4) Reaction has a tendency to go in forward direction.
Answer (1)

57. The E° value for the Mn3+/Mn2+ couple is more positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to change of
(1) d4 to d5 configuration (2) d3 to d5 configuration
(3) d5 to d4 configuration (4) d5 to d2 configuration
Answer (1)

58. Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order
H2O > H2Te > H2Se > H2S.
Statement II: On the basis of molecular mass, H2O is expected to have lower boiling point than the other
members of the group but due to the presence of extensive H-bonding in H2O, it has higher boiling point.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (3)

- 14 -
NEET (UG)-2024 (Code-T5)
59. Match List I with List II.
List-I List-II
(Process) (Conditions)
A. Isothermal process I. No heat exchange
B. Isochoric process II. Carried out at constant temperature
C. Isobaric process III. Carried out at constant volume
D. Adiabatic process IV. Carried out at constant pressure
Choose the correct answer from the options given below:
(1) A-I, B-II, C-III, D-IV (2) A-II, B-III, C-IV, D-I
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer (2)
60. 1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide
left unreacted is equal to
(1) Zero mg (2) 200 mg
(3) 750 mg (4) 250 mg
Answer (4)
61. Match List I with List II.
List I (Complex) List II (Type of isomerism)
A. [Co(NH3)5(NO2)]Cl2 I. Solvate isomerism
B. [Co(NH3)5(SO4)]Br II. Linkage isomerism
C. [Co(NH3)6][Cr(CN)6] III. Ionization isomerism
D. [Co(H2O)6]Cl3 IV. Coordination isomerism
Choose the correct answer from the options given below:

(1) A-I, B-IV, C-III, D-II (2) A-II, B-IV, C-III, D-I

(3) A-II, B-III, C-IV, D-I (4) A-I, B-III, C-IV, D-II

Answer (3)
62. Among Group 16 elements, which one does NOT show –2 oxidation state?

(1) Te (2) Po

(3) O (4) Se

Answer (2)

63. The compound that will undergo SN1 reaction with the fastest rate is

(1) (2)

(3) (4)

Answer (2)

- 15 -
 NEET (UG)-2024 (Code-T5)
64. Which one of the following alcohols reacts instantaneously with Lucas reagent?

(1) (2)

(3) CH3 – CH2 – CH2 – CH2OH (4)

Answer (2)
65. Match List I with List II.
List I List II
(Conversion) (Number of Faraday required)
A. 1 mol of H2O to O2 I. 3F
B. 1 mol of MnO−4 to Mn2+ II. 2F
C. 1.5 mol of Ca from molten CaCl2 III. 1F
D. 1 mol of FeO to Fe2O3 IV. 5F
Choose the correct answer from the options given below:
(1) A-II, B-III, C-I, D-IV (2) A-III, B-IV, C-II, D-I
(3) A-II, B-IV, C-I, D-III (4) A-III, B-IV, C-I, D-II
Answer (3)
66. The highest number of helium atoms is in
(1) 4 g of helium (2) 2.271098 L of helium at STP
(3) 4 mol of helium (4) 4 u of helium
Answer (3)
67. ‘Spin only’ magnetic moment is same for which of the following ions?
A. Ti3+ B. Cr2+
C. Mn2+ D. Fe2+
E. Sc3+
Choose the most appropriate answer from the options given below.
(1) B and C only (2) A and D only
(3) B and D only (4) A and E only

Answer (3)
68. Intramolecular hydrogen bonding is present in

(1) (2) HF

(3) (4)

Answer (3)

- 16 -
NEET (UG)-2024 (Code-T5)

69. Fehling’s solution ‘A’ is

(1) alkaline solution of sodium potassium tartrate (Rochelle’s salt)
(2) aqueous sodium citrate
(3) aqueous copper sulphate
(4) alkaline copper sulphate
Answer (3)

70. Match List I with List II

List I List II
(Quantum Number) (Information provided)
A. ml I. Shape of orbital
B. ms II. Size of orbital
C. l III. Orientation of orbital
D. n IV. Orientation of spin of
electron
Choose the correct answer from the options given below :
(1) A-III, B-IV, C-II, D-I (2) A-II, B-I, C-IV, D-III

(3) A-I, B-III, C-II, D-IV (4) A-III, B-IV, C-I, D-II

Answer (4)

71. Arrange the following elements in increasing order of first ionization enthalpy:
Li, Be, B, C, N
Choose the correct answer from the options given below:
(1) Li < Be < C < B < N (2) Li < Be < N < B < C
(3) Li < Be < B < C < N (4) Li < B < Be < C < N
Answer (4)

72. 1
Which plot of ln k vs is consistent with Arrhenius equation?
T

(1) (2)

(3) (4)

Answer (2)

- 17 -
 NEET (UG)-2024 (Code-T5)
73. Arrange the following elements in increasing order of electronegativity:
N, O, F, C, Si
Choose the correct answer from the options given below:

(1) O < F < N < C < Si

(2) F < O < N < C < Si

(3) Si < C < N < O < F

(4) Si < C < O < N < F

Answer (3)

74. Match List I with List II.

List I List II
(Reaction) (Reagents/Condition)

A. I.

B. II. CrO3

C. III. KMnO4/KOH, 

D. IV. (i) O3

(ii) Zn-H2O
Choose the correct answer from the options given below:

(1) A-IV, B-I, C-II, D-III

(2) A-I, B-IV, C-II, D-III

(3) A-IV, B-I, C-III, D-II

(4) A-III, B-I, C-II, D-IV

Answer (1)
75. Given below are two statements:
Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II : Aniline cannot be prepared through Gabriel synthesis .
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is correct but Statement II is false
(2) Statement I is incorrect but Statement II is true
(3) Both statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (3)

- 18 -
NEET (UG)-2024 (Code-T5)

76. In which of the following equilibria, Kp and Kc are NOT equal?

(1) CO(g) + H2O(g) CO2(g) + H2(g) (2) 2BrCl(g) Br2(g) + Cl2(g)

(3) PCl5(g) PCl3(g) + Cl2(g) (4) H2(g) + I2(g) 2HI(g)

Answer (3)

77. The most stable carbocation among the following is :

(1)

(2)

(3)

(4)

Answer (2)

78. The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH2OH
E. NaHSO3
Choose the correct options from the given below:
(1) B and E (2) E and D
(3) B and C (4) A and D
Answer (1)

79. Given below are two statements :

Statement I: Both [Co(NH3)6]3+ and [CoF6]3– complexes are octahedral but differ in their magnetic behaviour.
Statement II: [Co(NH3)6]3+ is diamagnetic whereas [CoF6]3– is paramagnetic.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (3)

- 19 -
 NEET (UG)-2024 (Code-T5)
80. Activation energy of any chemical reaction can be calculated if one knows the value of
(1) orientation of reactant molecules during collision
(2) rate constant at two different temperatures
(3) rate constant at standard temperature
(4) probability of collision
Answer (2)
81. A compound with a molecular formula of C6H14 has two tertiary carbons. Its IUPAC name is :
(1) 2,3-dimethylbutane (2) 2,2-dimethylbutane
(3) n-hexane (4) 2-methylpentane
Answer (1)
82. Match List I with List II.
List I List II
(Compound) (Shape/geometry)
A. NH3 I. Trigonal Pyramidal
B. BrF5 II. Square Planar
C. XeF4 III. Octahedral
D. SF6 IV. Square Pyramidal
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II (2) A-II, B-III, C-IV, D-I
(3) A-I, B-IV, C-II, D-III (4) A-II, B-IV, C-III, D-I
Answer (3)
83. The Henry’s law constant (KH) values of three gases (A, B, C) in water are 145, 2 × 10 –5 and 35 kbar,
respectively. The solubility of these gases in water follow the order:
(1) A>C>B (2) A>B>C
(3) B>A>C (4) B>C>A
Answer (4)
84. Which reaction is NOT a redox reaction?
(1) H2 + Cl2 → 2HCl (2) BaCl2 + Na2SO4 → BaSO4 + 2NaCl
(3) Zn + CuSO4 → ZnSO4 + Cu (4) 2KClO3 + I2 → 2KIO3 + Cl2
Answer (2)
85. Given below are two statements:
Statement I : The boiling point of three isomeric pentanes follows the order
n-pentane > isopentane > neopentane
Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller
surface area for contact, due to which the intermolecular forces between the spherical molecules are weak,
thereby lowering the boiling point.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect
(2) Statement I is incorrect but Statement II is correct
(3) Both Statement I and Statement II are correct
(4) Both Statement I and Statement II are incorrect
Answer (3)

- 20 -
NEET (UG)-2024 (Code-T5)

SECTION-B

86. The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of
activation.
Given R = 8.314 J K–1 mol–1, log4 = 0.6021
(1) 3.80 kJ/mol (2) 3804 kJ/mol
(3) 38.04 kJ/mol (4) 380.4 kJ/mol
Answer (3)

87. Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N2 = 3.0 × 10–3 M, O2 = 4.2 × 10–3 M and NO = 2.8 × 10–3 M.

2NO(g)  N2(g) + O2(g)

If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what will be degree of dissociation () of NO(g) at
equilibrium?
(1) 0.8889 (2) 0.717
(3) 0.00889 (4) 0.0889
Answer (2)

88. During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is
added to prevent hydrolysis of Fe2+ ion?
(1) dilute nitric acid (2) dilute sulphuric acid
(3) dilute hydrochloric acid (4) concentrated sulphuric acid
Answer (2)
89. A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of
X is :
(Given atomic masses of A = 64; B = 40; C = 32 u)
(1) AB2C2 (2) ABC4
(3) A2BC2 (4) ABC3
Answer (4)
90. The pair of lanthanoid ions which are diamagnetic is
(1) Gd3+ and Eu3+ (2) Pm3+ and Sm3+
(3) Ce4+ and Yb2+ (4) Ce3+ and Eu2+
Answer (3)

91. Major products A and B formed in the following reaction sequence, are

(1) (2)

- 21 -
 NEET (UG)-2024 (Code-T5)

(3) (4)

Answer (3)

92. The plot of osmotic pressure () vs concentration (mol L–1) for a solution gives a straight line with slope
25.73 L bar mol–1. The temperature at which the osmotic pressure measurement is done is
(Use R = 0.083 L bar mol–1 K–1)
(1) 25.73°C (2) 12.05°C
(3) 37°C (4) 310°C
Answer (3)

93. Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group
number from 0 to VI.
A. Al3+ B. Cu2+
C. Ba2+ D. Co2+
E. Mg2+
Choose the correct answer from the options given below.
(1) E, C, D, B, A (2) E, A, B, C, D
(3) B, A, D, C, E (4) B, C, A, D, E
Answer (3)

94. The products A and B obtained in the following reactions, respectively, are
3ROH + PCl3 → 3RCl + A

ROH + PCl5 → RCl + HCl + B

(1) H3PO4 and POCl3 (2) H3PO3 and POCl3
(3) POCl3 and H3PO3 (4) POCl3 and H3PO4
Answer (2)

95. For the given reaction:

‘P’ is

(1) (2)

(3) (4)

Answer (4)

- 22 -
NEET (UG)-2024 (Code-T5)

96. The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure
of 20 atmosphere to 10 atmosphere is
(Given R = 2.0 cal K–1 mol–1)
(1) 413.14 calories
(2) 100 calories
(3) 0 calorie
(4) –413.14 calories
Answer (4)

97. Identify the major product C formed in the following reaction sequence:

CH3 − CH2 − CH2 − I ⎯⎯⎯

NaCN
⎯→A
−
⎯⎯⎯⎯⎯⎯⎯OH
Partial hydrolysis
→ B ⎯⎯⎯⎯
NaOH
Br
→ C
2 (major )

(1) butanamide (2) –bromobutanoic acid

(3) propylamine (4) butylamine
Answer (3)

98. Identify the correct answer.

(1) Dipole moment of NF3 is greater than that of NH3

(2) Three canonical forms can be drawn for CO32− ion

(3) Three resonance structures can be drawn for ozone

(4) BF3 has non-zero dipole moment
Answer (2)

99. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper
sulphate solution for 100 seconds is (Given : Molar mass of Cu : 63 g mol–1, 1 F = 96487 C)
(1) 31.5 g (2) 0.0315 g
(3) 3.15 g (4) 0.315 g
Answer (4)

100. Given below are two statements :

Statement I : [Co(NH3)6]3+ is a homoleptic complex whereas [Co(NH 3)4Cl2]+ is a heteroleptic complex.
Statement II : Complex [Co(NH3)6]3+ has only one kind of ligands but [Co(NH3)4Cl2]+ has more than one
kind of ligands.
In the light of the above statements, choose the correct answer from the options given below.
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (3)

- 23 -
 NEET (UG)-2024 (Code-T5)
w

BOTANY

SECTION-A
101. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

(1) Competitive inhibition

(2) Enzyme activation

(3) Cofactor inhibition

(4) Feedback inhibition

Answer (1)

102. Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in F2 generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

(1) B, C and D only

(2) A, B, C, D and E

(3) A, B and C only

(4) A, C, D and E only

Answer (4)

103. Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

(1) Glycerides

(2) Carbohydrates

(3) Amino acids

(4) Phospholipids

Answer (4)

- 24 -
NEET (UG)-2024 (Code-T5)
104. Match List I with List II

List-I List-II

A. Nucleolus I. Site of formation of glycolipid

B. Centriole II. Organization like the

cartwheel

C. Leucoplasts III. Site for active

ribosomal RNA synthesis

D. Golgi apparatus IV. For storing nutrients

Choose the correct answer from the options given below:

(1) A-III, B-IV, C-II, D-I

(2) A-I, B-II, C-III, D-IV

(3) A-III, B-II, C-IV, D-I

(4) A-II, B-III, C-I, D-IV

Answer (3)

105. Which of the following is an example of actinomorphic flower?

(1) Pisum (2) Sesbania
(3) Datura (4) Cassia
Answer (3)
106. How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
(1) 3 molecules of ATP and 3 molecules of NADPH
(2) 3 molecules of ATP and 2 molecules of NADPH
(3) 2 molecules of ATP and 3 molecules of NADPH
(4) 2 molecules of ATP and 2 molecules of NADPH
Answer (2)

107. Formation of interfascicular cambium from fully developed parenchyma cells is an example for
(1) Dedifferentiation (2) Maturation
(3) Differentiation (4) Redifferentiation
Answer (1)

108. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
(1) does not affect mature monocotyledonous plants.
(2) can help in cell division in grasses, to produce growth.
(3) promotes apical dominance.
(4) promotes abscission of mature leaves only.
Answer (1)

- 25 -
 NEET (UG)-2024 (Code-T5)
109. Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO2
D. ATP
E. NADPH
Choose the correct answer from the options given below:
(1) C, D and E only (2) D and E only
(3) A, B and C only (4) B, C and D only
Answer (1)
110. The lactose present in the growth medium of bacteria is transported to the cell by the action of
(1) Permease (2) Polymerase
(3) Beta-galactosidase (4) Acetylase
Answer (1)
111. The cofactor of the enzyme carboxypeptidase is:
(1) Flavin (2) Haem
(3) Zinc (4) Niacin
Answer (3)

112. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

(1) C (2) D
(3) A (4) B
Answer (1)
113. Given below are two statements:

Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

(1) Statement I is true but Statement II is false

(2) Statement I is false but Statement II is true

(3) Both Statement I and Statement II are true

(4) Both Statement I and Statement II are false

Answer (3)

- 26 -
NEET (UG)-2024 (Code-T5)
114. The type of conservation in which the threatened species are taken out from their natural habitat and placed
in special setting where they can be protected and given special care is called
(1) Semi-conservative method (2) Sustainable development
(3) in-situ conservation (4) Biodiversity conservation
Answer (4)

115. Given below are two statements:

Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of
angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (2)
116. dN K − N 
The equation of Verhulst-Pearl logistic growth is = rN  .
dt  K 
From this equation, K indicates:
(1) Carrying capacity (2) Population density
(3) Intrinsic rate of natural increase (4) Biotic potential
Answer (1)

117. Match List I with List II

List I List II
A. Clostridium butylicum I. Ethanol
B. Saccharomyces cerevisiae II. Streptokinase
C. Trichoderma polysporum III. Butyric acid
D. Streptococcus sp. IV. Cyclosporin-A
Choose the correct answer from the options given below:
(1) A-III, B-I, C-IV, D-II (2) A-IV, B-I, C-III, D-II
(3) A-III, B-I, C-II, D-IV (4) A-II, B-IV, C-III, D-I
Answer (1)
118. Which one of the following is not a criterion for classification of fungi?
(1) Mode of spore formation (2) Fruiting body
(3) Morphology of mycelium (4) Mode of nutrition
Answer (4)

119. The capacity to generate a whole plant from any cell of the plant is called:
(1) Differentiation (2) Somatic hybridization
(3) Totipotency (4) Micropropagation
Answer (3)

- 27 -
 NEET (UG)-2024 (Code-T5)
120. Given below are two statements:
Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect
the inactive protoxin gets converted into active form due to acidic pH of the insect gut.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (1)

121. Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below.

(1) A, C, D and E only

(2) B, C, D and E only

(3) C, D and E only

(4) A, B, C and D only

Answer (2)

122. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to
upstream and down stream end;
(1) Inducer, Repressor, Structural gene
(2) Promotor, Structural gene, Terminator
(3) Repressor, Operator gene, Structural gene
(4) Structural gene, Transposons, Operator gene
Answer (2)

123. Bulliform cells are responsible for

(1) Increased photosynthesis in monocots.

(2) Providing large spaces for storage of sugars.

(3) Inward curling of leaves in monocots.

(4) Protecting the plant from salt stress.

Answer (3)

- 28 -
NEET (UG)-2024 (Code-T5)
124. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary
from the given figures (a) and (b)

(1) (a) Perigynous; (b) Epigynous

(2) (a) Perigynous; (b) Perigynous
(3) (a) Epigynous; (b) Hypogynous
(4) (a) Hypogynous; (b) Epigynous
Answer (2)

125. What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiply and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromosome.
E. It shows ability to replicate.
Choose the correct answer from the options given below:
(1) B and C only
(2) A and E only
(3) A and B only
(4) D and E only
Answer (1)

126. Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was
available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below.
(1) A, B and E only
(2) A, B and D only
(3) A, C, D and E only
(4) A and B only
Answer (3)

- 29 -
 NEET (UG)-2024 (Code-T5)
127. A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of
phenotype/s is/are expected in the progeny?

(1) Only pink flowered plants

(2) Red, Pink as well as white flowered plants

(3) Only red flowered plants

(4) Red flowered as well as pink flowered plants

Answer (4)

128. These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

(1) A, B and E only

(2) A, B and D only

(3) A, C and D only

(4) A, B, C and D only

Answer (2)

129. Match List I with List II

List-I List-II

A. Rhizopus I. Mushroom

B. Ustilago II. Smut fungus

C. Puccinia III. Bread mould

D. Agaricus IV. Rust fungus

Choose the correct answer from the options given below:

(1) A-III, B-II, C-I, D-IV

(2) A-IV, B-III, C-II, D-I

(3) A-III, B-II, C-IV, D-I

(4) A-I, B-III, C-II, D-IV

Answer (3)

- 30 -
NEET (UG)-2024 (Code-T5)
130. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype
of the black seed plant, with which of the following genotype will you cross it?
(1) Bb
(2) BB/Bb
(3) BB
(4) bb
Answer (4)

131. In the given figure, which component has thin outer walls and highly thickened inner walls?

(1) A (2) B
(3) C (4) D
Answer (3)
132. List of endangered species was released by
(1) FOAM
(2) IUCN
(3) GEAC
(4) WWF
Answer (2)

133. Match List I with List II

List I List II

A. Two or more alternative forms of a gene I. Back cross

B. Cross of F1 progeny with homozygous II. Ploidy

recessive parent

C. Cross of F1 progeny with any of the parents III. Allele

D. Number of chromosome sets in plant IV. Test cross

Choose the correct answer from the options given below:

(1) A-III, B-IV, C-I, D-II

(2) A-IV, B-III, C-II, D-I

(3) A-I, B-II, C-III, D-IV

(4) A-II, B-I, C-III, D-IV

Answer (1)

- 31 -
 NEET (UG)-2024 (Code-T5)
134. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

(1) 4 bp

(2) 10 bp

(3) 8 bp

(4) 6 bp

Answer (4)

135. Spindle fibers attach to kinetochores of chromosomes during

(1) Anaphase
(2) Telophase
(3) Prophase
(4) Metaphase
Answer (4)

SECTION-B
136. Match List I with List II
List I List II
A. Robert May I. Species-Area relationship
B. Alexander von Humboldt II. Long term ecosystem experiment using out door
plots
C. Paul Ehrlich III. Global species diversity at about 7 million
D. David Tilman IV. Rivet popper hypothesis
Choose the correct answer from the options given below:
(1) A-I, B-III, C-II, D-IV
(2) A-III, B-IV, C-II, D-I
(3) A-II, B-III, C-I, D-IV
(4) A-III, B-I, C-IV, D-II
Answer (4)

137. Match List I with List II

List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson & Stahl IV. Lac operon
Choose the correct answer from the options given below:
(1) A-II, B-III, C-IV, D-I (2) A-IV, B-I, C-II, D-III
(3) A-III, B-II, C-I, D-IV (4) A-III, B-IV, C-I, D-II
Answer (4)

- 32 -
NEET (UG)-2024 (Code-T5)
138. Match List I with List II
List I List II
(Types of Stamens) (Example)
A. Monoadelphous I. Citrus
B. Diadelphous II. Pea
C. Polyadelphous III. Lily
D. Epiphyllous IV. China-rose
Choose the correct answer from the options given below:
(1) A-I, B-II, C-IV, D-III (2) A-III, B-I, C-IV, D-II
(3) A-IV, B-II, C-I, D-III (4) A-IV, B-I, C-II, D-III
Answer (3)
139. Match List-I with List-II
List-I List-II
A. GLUT-4 I. Hormone
B. Insulin II. Enzyme
C. Trypsin III. Intercellular ground substance
D. Collagen IV. Enables glucose transport into cells
Choose the correct answer from the options given below.
(1) A-II, B-III, C-IV, D-I (2) A-III, B-IV, C-I, D-II
(3) A-IV, B-I, C-II, D-III (4) A-I, B-II, C-III, D-IV
Answer (3)
140. Which of the following statement is correct regarding the process of replication in E.coli?
(1) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
(2) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
(3) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
(4) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
Answer (2)

141. Match List I with List II

List I List II

A. Citric acid cycle I. Cytoplasm

B. Glycolysis II. Mitochondrial matrix

C. Electron transport system III. Intermembrane space of mitochondria

D. Proton gradient IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

(1) A-III, B-IV, C-I, D-II (2) A-IV, B-III, C-II, D-I
(3) A-I, B-II, C-III, D-IV (4) A-II, B-I, C-IV, D-III
Answer (4)

- 33 -
 NEET (UG)-2024 (Code-T5)
142. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
(1) Succinyl-CoA → Succinic acid (2) Isocitrate → -ketoglutaric acid
(3) Malic acid → Oxaloacetic acid (4) Succinic acid → Malic acid
Answer (1)

143. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem,
thus, increasing the yield?

(1) Cytokinin (2) Abscisic acid

(3) Auxin (4) Gibberellin

Answer (4)

144. The DNA present in chloroplast is:

(1) Linear, single stranded (2) Circular, single stranded
(3) Linear, double stranded (4) Circular, double stranded
Answer (4)

145. Given below are two statements:

Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not
show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (1)

146. Which of the following are fused in somatic hybridization involving two varieties of plants?
(1) Protoplasts (2) Pollens
(3) Callus (4) Somatic embryos
Answer (1)

147. Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
(1) A, C, D and E only (2) A, B, C and E only
(3) A, B, C and D only (4) B, C, D and E only
Answer (1)

- 34 -
NEET (UG)-2024 (Code-T5)
148. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m–2) yr–1, what would
be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
(1) 10 x ( kcal m–2 ) yr –1

(2)
100 x
(kcal m–2 ) yr –1
3x

(3)
x
(kcal m–2 ) yr –1
10
(4) x ( kcal m –2 ) yr –1
Answer (1)
149. Identify the correct description about the given figure:

(1) Cleistogamous flowers showing autogamy.

(2) Compact inflorescence showing complete autogamy
(3) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
(4) Water pollinated flowers showing stamens with mucilaginous covering.
Answer (3)

150. Match List I with List II

List I List II

A. Rose I. Twisted aestivation

B. Pea II. Perigynous flower

C. Cotton III. Drupe

D. Mango IV. Marginal placentation

Choose the correct answer from the options given below :

(1) A-IV, B-III, C-II, D-I
(2) A-II, B-III, C-IV, D-I
(3) A-II, B-IV, C-I, D-III
(4) A-I, B-II, C-III, D-IV
Answer (3)

- 35 -
 NEET (UG)-2024 (Code-T5)

ZOOLOGY
SECTION-A
151. Match List I with List II :
List I List II
A. Pleurobrachia I. Mollusca
B. Radula II. Ctenophora
C. Stomochord III. Osteichthyes
D. Air bladder IV. Hemichordata
Choose the correct answer from the options given below :
(1) A-II, B-IV, C-I, D-III (2) A-IV, B-III, C-II, D-I
(3) A-IV, B-II, C-III, D-I (4) A-II, B-I, C-IV, D-III
Answer (4)
152. Match List I with List II
List I List II

A. Non-medicated IUD I. Multiload 375

B. Copper releasing IUD II. Progestogens

C. Hormone releasing IUD III. Lippes loop

D. Implants IV. LNG-20

Choose the correct answer from the option given below:

(1) A-IV, B-I, C-II, D-III (2) A-III, B-I, C-IV, D-II
(3) A-III, B-I, C-II, D-IV (4) A-I, B-III, C-IV, D-II
Answer (2)
153. Match List I with List II :
List I List II

A.  –I antitrypsin I. Cotton bollworm

B. Cry IAb II. ADA deficiency

C. Cry IAc III. Emphysema

D Enzyme replacement therapy IV Corn borer

Choose the correct answer form the options given below:

(1) A-III, B-IV, C-I, D-II
(2) A-II, B-IV, C-I, D-III
(3) A-II, B-I, C-IV, D-III
(4) A-III, B-I, C-II, D-IV
Answer (1)

- 36 -
NEET (UG)-2024 (Code-T5)
154. Match List I with List II :
List I List II
A. Common cold I. Plasmodium
B. Haemozoin II. Typhoid
C. Widal test III. Rhinoviruses
D. Allergy IV. Dust mites
Choose the correct answer from the options given below :
(1) A-III, B-I, C-II, D-IV
(2) A-IV, B-II, C-III, D-I
(3) A-II, B-IV, C-III, D-I
(4) A-I, B-III, C-II, D-IV
Answer (1)
155. Match List I with List II :
List I List II
A. Cocaine I. Effective sedative in surgery
B. Heroin II. Cannabis sativa
C. Morphine III. Erythroxylum
D. Marijuana IV. Papaver somniferum
Choose the correct answer from the options given below:
(1) A-II, B-I, C-III, D-IV
(2) A-III, B-IV, C-I, D-II
(3) A-IV, B-III, C-I, D-II
(4) A-I, B-III, C-II, D-IV
Answer (2)
156. Match List I with List II :

List I List II
(Sub Phases of Prophase I) (Specific Characters)

A. Diakinesis I. Synaptonemal complex formation

B. Pachytene II. Completion of terminalisation of chiasmata

C. Zygotene III. Chromosomes look like thin threads

D. Leptotene IV. Appearance of recombination nodules

Choose the correct answer from the options given below

(1) A-II, B-IV, C-I, D-III
(2) A-IV, B-III, C-II, D-I
(3) A-IV, B-II, C-III, D-I
(4) A-I, B-II, C-IV, D-III
Answer (1)

- 37 -
 NEET (UG)-2024 (Code-T5)
157. Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below :

(1) Statement I is true but Statement II is false

(2) Statement I is false but Statement II is true

(3) Both Statement I and Statement II are true

(4) Both Statement I and Statement II are false

Answer (1)

158. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
(1) 5’AUGUACCGUUUAUAGGGAAGU3’
(2) 5’ATGTACCGTTTATAGGTAAGT3’
(3) 5’AUGUACCGUUUAUAGGUAAGU3’
(4) 5’AUGUAAAGUUUAUAGGUAAGU3’
Answer (3)
159. Match List I with List II :
List I List II
A. Expiratory capacity I. Expiratory reserve volume + Tidal volume +
Inspiratory reserve volume
B. Functional residual II. Tidal volume + Expiratory reserve volume
capacity
C. Vital capacity III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume
Choose the correct answer from the options given below :
(1) A-II, B-I, C-IV, D-III
(2) A-I, B-III, C-II, D-IV
(3) A-II, B-IV, C-I, D-III
(4) A-III, B-II, C-IV, D-I
Answer (3)
160. Which of the following are Autoimmune disorders?
A. Myasthenia gravis B. Rheumatoid arthritis
C. Gout D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
(1) B, C & E only (2) C, D & E only
(3) A, B & D only (4) A, B & E only
Answer (4)

- 38 -
NEET (UG)-2024 (Code-T5)
161. Consider the following statements :
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates
D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below :
(1) C only (2) D only
(3) B only (4) A only
Answer (4)
162. Given below are two statements :
Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable
to electrolytes.
Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and
increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the option given below :
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (4)
163. Match List I with List II :
List I List II
A. Pterophyllum I. Hag fish
B. Myxine II. Saw fish
C. Pristis III. Angel fish
D. Exocoetus IV. Flying fish
Choose the correct answer from the options given below :
(1) A-IV, B-I, C-II, D-III
(2) A-III, B-II, C-I, D-IV
(3) A-II, B-I, C-III, D-IV
(4) A-III, B-I, C-II, D-IV
Answer (4)
164. Which of the following is not a steroid hormone?
(1) Progesterone
(2) Glucagon
(3) Cortisol
(4) Testosterone
Answer (2)

- 39 -
 NEET (UG)-2024 (Code-T5)
165. Match List I with List II :
List-I List-II
A. Lipase I. Peptide bond
B. Nuclease II. Ester bond
C. Protease III. Glycosidic bond
D. Amylase IV. Phosphodiester bond
Choose the correct answer from the options given below :
(1) A-II, B-IV, C-I, D-III (2) A-IV, B-I, C-III, D-II
(3) A-IV, B-II, C-III, D-I (4) A-III, B-II, C-I, D-IV
Answer (1)
166. Match List I with List II :
List I List II
A. Down’s syndrome I. 11th chromosome
B. -Thalassemia II. ‘X’ chromosome
C. -Thalassemia III. 21st chromosome
D. Klinefelter’s syndrome IV. 16th chromosome
Choose the correct answer from the options given below :
(1) A-III, B-IV, C-I, D-II
(2) A-IV, B-I, C-II, D-III
(3) A-I, B-II, C-III, D-IV
(4) A-II, B-III, C-IV, D-I
Answer (1)
167. The “Ti plasmid” of Agrobacterium tumefaciens stands for
(1) Tumor inducing plasmid
(2) Temperature independent plasmid
(3) Tumour inhibiting plasmid
(4) Tumor independent plasmid
Answer (1)
168. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a
healthy baby.
Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new
born baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) A is correct but R is not correct
(2) A is not correct but R is correct
(3) Both A and R are correct and R is the correct explanation of A
(4) Both A and R are correct but R is NOT the correct explanation of A
Answer (3)

- 40 -
NEET (UG)-2024 (Code-T5)
169. Which of the following is not a component of Fallopian tube?
(1) Infundibulum (2) Ampulla
(3) Uterine fundus (4) Isthmus
Answer (3)
170. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
(1) 8th and 9th segment (2) 11th segment
(3) 5th segment (4) 10th segment
Answer (4)
171. Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
(1) Gene migration
(2) Constant gene pool
(3) Genetic recombination
(4) Genetic drift
Answer (2)
172. Match List I with List II :
List I List II
A. Pons I. Provides additional space for Neurons, regulates posture
and balance.
B. Hypothalamus II. Controls respiration and gastric secretions.
C. Medulla III. Connects different regions of the brain.
D. Cerebellum IV. Neuro secretory cells
Choose the correct answer from the options given below :
(1) A-I, B-III, C-II, D-IV (2) A-II, B-I, C-III, D-IV
(3) A-II, B-III, C-I, D-IV (4) A-III, B-IV, C-II, D-I
Answer (4)
173. The flippers of the Penguins and Dolphins are the example of the
(1) Convergent evolution
(2) Divergent evolution
(3) Adaptive radiation
(4) Natural selection
Answer (1)
174. Following are the stages of pathway for conduction of an action potential through the heart
A. AV bundle B. Purkinje fibres
C. AV node D. Bundle branches
E. SA node
Choose the correct sequence of pathway from the options given below
(1) B-D-E-C-A (2) E-A-D-B-C
(3) E-C-A-D-B (4) A-E-C-B-D
Answer (3)

- 41 -
 NEET (UG)-2024 (Code-T5)
175. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’
genes :

(1) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
(2) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
(3) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of
Plasmid.
(4) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved
in the replication of Plasmid.
Answer (4)
176. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in
male human being.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true but R is NOT the correct explanation of A
Answer (2)
177. Which of the following statements is incorrect?
(1) Bio-reactors are used to produce small scale bacterial cultures
(2) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
(3) A bio-reactor provides optimal growth conditions for achieving the desired product
(4) Most commonly used bio-reactors are of stirring type
Answer (1)
178. Match List I with List II :
List I List II
A. Axoneme I. Centriole
B. Cartwheel pattern II. Cilia and flagella
C. Crista III. Chromosome
D. Satellite IV. Mitochondria
Choose the correct answer from the options given below :
(1) A-II, B-IV, C-I, D-III (2) A-II, B-I, C-IV, D-III
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer (2)

- 42 -
NEET (UG)-2024 (Code-T5)
179. Match List I with List II :

List I List II

A. Fibrous joints I. Adjacent vertebrae, limited movement

B. Cartilaginous joints II. Humerus and Pectoral girdle, rotational movement

C. Hinge joints III. Skull, don’t allow any movement

D. Ball and socket joints IV. Knee, help in locomotion

Choose the correct answer from the options given below :

(1) A-II, B-III, C-I, D-IV
(2) A-III, B-I, C-IV, D-II
(3) A-IV, B-II, C-III, D-I
(4) A-I, B-III, C-II, D-IV
Answer (2)
180. Given below are some stages of human evolution.
Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
(1) C-B-D-A
(2) A-D-C-B
(3) D-A-C-B
(4) B-A-D-C
Answer (2)
181. Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in
human body:

- 43 -
 NEET (UG)-2024 (Code-T5)
Name of muscle/location
(1) (a) Skeletal – Biceps
(b) Involuntary – Intestine
(c) Smooth – Heart
(2) (a) Involuntary – Nose tip
(b) Skeletal – Bone
(c) Cardiac – Heart
(3) (a) Smooth – Toes
(b) Skeletal – Legs
(c) Cardiac – Heart
(4) (a) Skeletal – Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart
Answer (4)
182. Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :
(1) B-D-E-A-C (2) E-C-A-D-B
(3) C-E-D-A-B (4) E-B-D-A-C
Answer (2)
183. Which of the following is not a natural/traditional contraceptive method?
(1) Lactational amenorrhea (2) Vaults
(3) Coitus interruptus (4) Periodic abstinence
Answer (2)
184. Match List I with List II :

List I List II

A. Typhoid I. Fungus

B. Leishmaniasis II. Nematode

C. Ringworm III. Protozoa

D. Filariasis IV. Bacteria

Choose the correct answer from the options given below:

(1) A-III, B-I, C-IV, D-II (2) A-II, B-IV, C-III, D-I
(3) A-I, B-III, C-II, D-IV (4) A-IV, B-III, C-I, D-II
Answer (4)

- 44 -
NEET (UG)-2024 (Code-T5)
185. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
(1) Low pCO2 and High H+ concentration
(2) Low pCO2 and High temperature
(3) High pO2 and High pCO2
(4) High pO2 and Lesser H+ concentration
Answer (4)

SECTION-B
186. Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are
produced.
Statement II : Both bone marrow and thymus provide micro environments for the development and
maturation of T-lymphocytes.
In the light of above statements, choose the most appropriate answer from the options given below :
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer (3)
187. Match List I with List II :

List I List II

A. P wave I. Heart muscles are electrically silent.

B. QRS complex II. Depolarisation of ventricles.

C. T wave III. Depolarisation of atria.

D. T-P gap IV. Repolarisation of ventricles.

Choose the correct answer from the options given below :

(1) A-II, B-III, C-I, D-IV (2) A-IV, B-II, C-I, D-III
(3) A-I, B-III, C-IV, D-II (4) A-III, B-II, C-IV, D-I
Answer (4)
188. Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer (1)

- 45 -
 NEET (UG)-2024 (Code-T5)
189. Match List I with List II:

List I List II

A. Unicellular glandular epithelium I. Salivary glands

B. Compound epithelium II. Pancreas

C. Multicellular glandular epithelium III. Goblet cells of alimentary canal

D. Endocrine glandular epithelium IV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

(1) A-III, B-IV, C-I, D-II (2) A-II, B-I, C-IV, D-III
(3) A-II, B-I, C-III, D-IV (4) A-IV, B-III, C-I, D-II
Answer (1)
190. Match List I with List II related to digestive system of cockroach.

List I List II
A. The structures used for storing of food I. Gizzard
B. Ring of 6-8 blind tubules at junction of foregut and midgut. II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction III. Malpighian tubules
of midgut and hindgut.
D. The structures used for grinding the food. IV. Crop
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-II, D-I
(2) A-III, B-II, C-IV, D-I
(3) A-IV, B-II, C-III, D-I
(4) A-I, B-II, C-III, D-IV
Answer (3)
191. Match List I with List II:

List I List II

A. Mesozoic Era I. Lower invertebrates

B. Proterozoic Era II. Fish & Amphibia

C. Cenozoic Era III. Birds & Reptiles

D. Paleozoic Era IV. Mammals

Choose the correct answer from the options given below :

(1) A-I, B-II, C-IV, D-III
(2) A-III, B-I, C-IV, D-II
(3) A-II, B-I, C-III, D-IV
(4) A-III, B-I, C-II, D-IV
Answer (2)

- 46 -
NEET (UG)-2024 (Code-T5)
192. Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.
In the light of the above statements, choose the mis appropriate answer from the options given below:
(1) Statement I is correct but Statement Il is incorrect.
(2) Statement I is incorrect but Statement Il is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer (1)
193. As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their
respective genotype can be
A. IBi/IAi/ii B. IBIB/IAIA/ii
C. IAIB/iIA/IBi D. IAi/IBi/IAi
E. iIB/iIA/IAIB
Choose the most appropriate answer from the options given below :
(1) C & B only (2) D & E only
(3) A only (4) B only
Answer (3)
194. Match List I with List II :
List I List II
A. Exophthalmic goiter I. Excess secretion of cortisol, moon face &
hypergylcemia.
B. Acromegaly II. Hypo-secretion of thyroid hormone and
stunted growth.
C. Cushing’s syndrome III. Hyper secretion of thyroid hormone &
protruding eye balls.
D. Cretinism IV. Excessive secretion of growth hormone.
Choose the correct answer from the options given below :
(1) A-III, B-IV, C-II, D-I (2) A-III, B-IV, C-I, D-II
(3) A-I, B-III, C-II, D-IV (4) A-IV, B-II, C-I, D-III
Answer (2)
195. Match List I with List II:
List I List II
A. RNA polymerase III I. snRNPs
B. Termination of II. Promotor
transcription
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA
Choose the correct answer from the options given below :
(1) A-III, B-IV, C-I, D-II (2) A-IV, B-III, C-I, D-II
(3) A-II, B-IV, C-I, D-III (4) A-III, B-II, C-IV, D-I
Answer (2)

- 47 -
 NEET (UG)-2024 (Code-T5)
196. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

(1) FSH, Sertoli cells, Leydig cells, spermatogenesis.

(2) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
(3) FSH, Leydig cells, Sertoli cells, spermiogenesis.
(4) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
Answer (3)
197. The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:
(1) B, D & E only (2) B, C & D only
(3) A & C only (4) A, B & D only
Answer (1)
198. Choose the correct statement given below regarding juxta medullary nephron.
(1) Loop of Henle of juxta medullary nephron runs deep into medulla.
(2) Juxta medullary nephrons outnumber the cortical nephrons.
(3) Juxta medullary nephrons are located in the columns of Bertini.
(4) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
Answer (1)
199. Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for
different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be
true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer (2)

- 48 -
NEET (UG)-2024 (Code-T5)
200.
Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below :
(1) B, A, C, D, E (2) E, D, C, B, A
(3) E, A, D, C, B (4) A, E, B, D, C
Answer (3)

❑ ❑ ❑

- 49 -