EDITORIAL BOARD

EDITOR-IN-CHIEF Douglas L. Mann, MD, St. Louis, MO

DEPUTY EDITOR L. Kristin Newby, MD, Durham, NC

ASSOCIATE EDITORS Brian H. Annex, MD, Charlottesville, VA Peter Libby, MD, Boston, MA
Nanette H. Bishopric, MD, Miami, FL Geoffrey Pitt, ScM, MD, PhD, Cornell, NY
Daniel P. Kelly, MD, Orlando, FL Eva van Rooij, PhD, Utrecht, the Netherlands
William Robb MacLellan, MD, Seattle, WA

GUEST EDITOR-IN-CHIEF Robert Roberts, MD, Tucson, AZ

GUEST EDITOR Juan F. Granada, MD, Orangeburg, NY

STATISTICAL EDITOR Eric Novak, St. Louis, MO

VICE PRESIDENT, PUBLISHING Kim Murphy, Washington, DC

EXECUTIVE MANAGING EDITOR Meredith T. Hurt, Washington, DC

MANAGING EDITOR Kimberly Trevey, Washington, DC

EDITORIAL ASSISTANT Meghan Valdes, Washington, DC

DIRECTOR, PRODUCT MANAGEMENT, Nandhini Kuntipuram, Washington, DC

DIGITAL PUBLISHING

SOCIAL MEDIA EDITORS Reza Ardehali, MD, PhD, Los Angeles, CA Meena S. Madhur, MD, PhD, Nashville, TN

ETHICS COMMITTEE Holly Atkinson, MD, New York, NY Philip J. Landrigan, MD, New York, NY
Lawrence S. Cohen, MD, New Haven, CT Richard L. Popp, MD, Palo Alto, CA
Kim Fox, MD, London, UK Eric Prystowsky, MD, Indianapolis, IN
Robert Frye, MD, Rochester, MN James Willerson, MD, Houston, TX

EDITOR-IN-CHIEF, JACC Valentin Fuster, MD, PhD, New York, NY

EDITOR-IN-CHIEF, JACC: Y. Chandrashekhar, MD, Minneapolis, MN

CARDIOVASCULAR IMAGING

EDITOR-IN-CHIEF, David J. Moliterno, MD, Lexington, KY

JACC: CARDIOVASCULAR
INTERVENTIONS

EDITOR-IN-CHIEF, Christopher M. O’Connor, MD, Durham, NC

JACC: HEART FAILURE

EDITOR-IN-CHIEF, JACC: David J. Wilber, MD, Chicago, IL

CLINICAL ELECTROPHYSIOLOGY
EDITORIAL CONSULTANTS

Mark Anderson, MD, PhD, Baltimore, MD Peter Ganz, MD, San Francisco, CA Kenneth Margulies, MD, Philadelphia, PA

Themistocles Assimes, MD, PhD, Josh Hare, MD, Miami, FL Peter McCullough, MD, MPH, Dallas, TX
Palo Alto, CA
Ray Hershberger, MD, Columbus, OH Jorge Plutzky, MD, Boston, MA
Noel Bairey-Merz, MD, Los Angeles, CA
Carolyn Ho, MD, Boston, MA David Port, PhD, Aurora, CO
Craig Basson, MD, Needham, MA
Jennifer Ho, MD, Boston, MA Sumanth Prabhu, MD, Birmingham, AL
Don Bers, PhD, Davis, CA
Farouc Jaffer, MD, PhD, Boston, MA Hani Sabbath, PhD, Detroit, MI
Michael Bristow, MD, PhD, Aurora, CO
Tim Kamp, MD, PhD, Madison, WI
Paul Simpson, MD, San Francisco, CA
Daniel Burkoff, MD, PhD, Framingham, MA
Walter Koch, PhD, Philadelphia, PA
Mark Sussman, PhD, San Diego, CA
John Burnett, MD, Rochester, MN
David Lanfear, MD, Detroit, MI
Jenny Van Eyk, PhD, Los Angeles, CA
John Canty, MD, Buffalo, NY
Richard Lee, MD, Boston, MA
Xander Wehrens, MD, PhD, Houston, TX
Karen Christman, PhD, San Diego, CA
Jonathan Lindner, MD, Portland, OR
Peter Crawford, MD, PhD, Arthur Wilde, MD, PhD, Amsterdam,
the Netherlands
Orlando, FL Peter Liu, MD, Ottawa, Ontario,
Canada
Craig Emter, PhD, Columbia, MO Myles Wolf, MD, MMSc, Chicago, IL
Eduardo Marban, MD, PhD,
Zahi Fayad, PhD, New York, NY Los Angeles, CA Sean Wu, MD, PhD, Stanford, CA

Glenn Fishman, MD, New York, NY Ali Marian, MD, Houston, TX Edward Yeh, MD, Houston, TX
 2018-2019 OFFICERS

C. Michael Valentine, MD, FACC, President

Richard J. Kovacs, MD, FACC, Vice President

Howard “Bo” T. Walpole, Jr., MD, MBA, FACC, Treasurer

Andrew P. Miller, MD, FACC, Secretary and Board of Governors Chair

Catherine C. Gates, Interim Chief Executive Officer

2018-2019 PUBLICATIONS AND EDITORIAL COORDINATION COMMITTEE

Paul L. Douglass, MD, MACC, Chair

Rhonda M. Cooper-DeHoff, MD, FACC, Annual Scientific Session Program Committee

Prasad C. Gunasekaran, MD FIT Representative

Fadi G. Hage, MD, FACC

Spencer King III, MD, MACC

Fred M. Kusumoto, MD, FACC, Awards Committee

Renato D. Lopes, MD, PhD, FACC

Sandra M. Oliver-McNeil, DNP, ACNP-BC, AACC Committee

CORRESPONDENCE FOR
AMERICAN COLLEGE OF Viviany R. Taqueti, MD, MPH, FACC
CARDIOLOGY
James E. Tcheng, MD, FACC, (Ex Officio) Chair, Digital Steering Committee
All correspondence for the
College, other than that related to William J. Oetgen, MD, MBA, FACC, ACC Staff
JACC: Basic to Translational Science
should be sent to Resource Center, Kim Murphy, ACC Staff
American College of Cardiology,
2400 N Street, NW,
Washington, DC 20037
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

CLINICAL RESEARCH

Alterations in Titin Properties and

Myocardial Fibrosis Correlate With
Clinical Phenotypes in Hemodynamic
Subgroups of Severe Aortic Stenosis
Michael Gotzmann, MD,a Susanne Grabbe,b Dominik Schöne,b Marion von Frieling-Salewsky,c
Cristobal G. dos Remedios, PHD,d Justus Strauch, MD,e Matthias Bechtel, MD,e Johannes W. Dietrich, MD,f
Andrea Tannapfel, MD, PHD,g Andreas Mügge, MD,b Wolfgang A. Linke, PHDc

JACC: BASIC TO TRANSLATIONAL SCIENCE CME/MOC

This article has been selected as the month’s JACC: Basic to Translational these patients; and 3) review the current guidelines and management of
Science CME/MOC activity, available online at http://www.acc.org/jacc- severe aortic stenosis, including evaluation focused on hemodynamic
journals-cme by selecting the JACC Journals CME/MOC tab. subtypes.

Accreditation and Designation Statement CME/MOC Editor Disclosure: CME/MOC Editor L. Kristin Newby, MD, is
supported by research grants from Amylin, Bristol-Myers Squibb
The American College of Cardiology Foundation (ACCF) is accredited by
Company, GlaxoSmithKline, Sanofi-Aventis, Verily Life Sciences
the Accreditation Council for Continuing Medical Education (ACCME) to
(formerly Google Life Sciences), the MURDOCK Study, NIH, and PCORI;
provide continuing medical education for physicians.
receives consultant fees/honoraria from BioKier, DemeRx, MedScape/
The ACCF designates this journal-based CME/MOC activity for a TheHeart.org, Metanomics, Philips Healthcare, Roche Diagnostics, CMAC
maximum of 1 AMA PRA Category 1 Credit(s). Physicians should only Health Education & Research Institute; serves as an Officer, Director,
claim credit commensurate with the extent of their participation in the Trustee, or other Fiduciary Role for AstraZeneca HealthCare Foundation
activity. and the Society of Chest Pain Centers (now part of ACC); and serves in
another role for the American Heart Association and is the Deputy Editor
Method of Participation and Receipt of CME/MOC Certificate
of JACC: Basic to Translational Science.

To obtain credit for JACC: Basic to Translational Science CME/MOC, you must: Author Disclosures: This work was supported by the German Heart
1. Be an ACC member or JACC: Basic to Translational Science subscriber. Foundation/German Foundation of Heart Research. Dr. Dietrich has
2. Carefully read the CME/MOC-designated article available online and received funding from Sanofi-Henning, Hexal AG, Bristol-Myers Squibb,
in this issue of the journal. and Pfizer; and is co-owner of the intellectual property rights for the
3. Answer the post-test questions. At least 2 out of the 3 questions patent “System and Method for Deriving Parameters for Homeostatic
provided must be answered correctly to obtain CME/MOC credit. Feedback Control of an Individual” (Singapore Institute for Clinical
4. Complete a brief evaluation. Sciences, Biomedical Sciences Institutes, Application Number
5. Claim your CME/MOC credit and receive your certificate electronically 201208940-5, WIPO number WO/2014/088516). All other authors have
by following the instructions given at the conclusion of the activity. reported that they have no relationships relevant to the contents of this
paper to disclose.
CME/MOC Objective for This Article: Upon completion of this paper, the
reader should be able to: 1) understand the different patterns of myocardial Medium of Participation: Online (article and quiz).
fibrosis and the degree of isoform-expression and phosphorylation
CME/MOC Term of Approval
changes in cardiomyocyte titin in the different hemodynamic subgroups of
aortic stenosis; 2) examine the extent of myocardial remodeling in para- Issue Date: June 2018
doxical aortic stenosis to help better understand the poor prognosis of Expiration Date: May 31, 2019

From the aDepartment of Cardiology, Marien Hospital Witten, Ruhr University Bochum, Bochum, Germany; bCardiology and
Angiology, Bergmannsheil, Ruhr University Bochum, Bochum, Germany; cInstitute of Physiology II, University of Münster,
Münster, Germany; dDepartment of Anatomy & Histology, Bosch Institute, University of Sydney, Sydney, Australia; eDepartment
of Cardiac and Thoracic Surgery, Bergmannsheil, Ruhr University Bochum, Bochum, Germany; fDepartment of Internal Medicine,
Bergmannsheil, Ruhr University Bochum, Bochum, Germany; and the gInstitute of Pathology, Ruhr University Bochum, Bochum,
Germany. This work was supported by the German Heart Foundation/German Foundation of Heart Research. Dr. Dietrich has
received funding from Sanofi-Henning, Hexal AG, Bristol-Myers Squibb, and Pfizer; and is co-owner of the intellectual property
rights for the patent “System and Method for Deriving Parameters for Homeostatic Feedback Control of an Individual” (Singapore

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.02.002

336 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

Alterations in Titin Properties and Myocardial

Fibrosis Correlate With Clinical Phenotypes in
Hemodynamic Subgroups of Severe Aortic
Stenosis
Michael Gotzmann, MD,a Susanne Grabbe,b Dominik Schöne,b Marion von Frieling-Salewsky,c
Cristobal G. dos Remedios, PHD,d Justus Strauch, MD,e Matthias Bechtel, MD,e Johannes W. Dietrich, MD,f
Andrea Tannapfel, MD, PHD,g Andreas Mügge, MD,b Wolfgang A. Linke, PHDc

VISUAL ABSTRACT
HIGHLIGHTS

The extent of myocardial fibrosis and the

degree of isoform-expression and phos-
phorylation changes in cardiomyocyte
titin were unknown in different hemody-
namic subgroups of AS, including “para-
doxical” low-flow, low-gradient AS with
preserved ejection fraction.

Hemodynamic subtypes of AS were found
to exhibit increased cardiac fibrosis, titin-
isoform transition toward more compliant
N2BA variants, and both total and site-
specific titin (N2Bus) hypophosphor-
ylation compared with donor heart
controls.

A significant shift toward N2BA titin
appeared in “paradoxical” AS, whereas
alterations in total-titin phosphorylation
and cardiac fibrosis were similar in all
hemodynamic subtypes of AS, suggesting
increased myocardial passive stiffness.

The unfavorable prognosis of
“paradoxical” AS could be explained by
the pronounced myocardial remodeling,
which is no less severe than in other AS
subtypes.

Gotzmann, M. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):335–46.

Institute for Clinical Sciences, Biomedical Sciences Institutes, Application Number 201208940-5, WIPO number WO/2014/088516).
All other authors have reported that they have no relationships relevant to the contents of this paper to disclose.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’
institutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information,
visit the JACC: Basic to Translational Science author instructions page.

Manuscript received September 18, 2017; revised manuscript received February 12, 2018, accepted February 13, 2018.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Gotzmann et al. 337
JUNE 2018:335–46 Titin and Fibrosis in Aortic Stenosis

ABBREVIATIONS
SUMMARY
AND ACRONYMS

Titin-isoform expression, titin phosphorylation, and myocardial fibrosis were studied in 30 patients with severe AS = aortic stenosis

symptomatic aortic stenosis (AS). Patients were grouped into “classical” high-gradient, normal-flow AS with AVA = aortic valve area
preserved ejection fraction (EF); “paradoxical” low-flow, low-gradient AS with preserved EF; and AS with BNP = B-type
reduced EF. Nonfailing donor hearts served as controls. AS was associated with increased fibrosis, titin-isoform natriuretic peptide

switch toward compliant N2BA, and both total and site-specific titin hypophosphorylation compared with EF = ejection fraction

control hearts. All AS subtypes revealed titin and matrix alterations. The extent of myocardial remodeling in LV = left ventricular
“paradoxical” AS was no less severe than in other AS subtypes, thus explaining the unfavorable prognosis. MHC = myosin heavy chain
(J Am Coll Cardiol Basic Trans Science 2018;3:335–46) © 2018 The Authors. Published by Elsevier on behalf of the N2Bus = unique sequence
American College of Cardiology Foundation. This is an open access article under the CC BY-NC-ND license within the cardiac-specific N2B

(http://creativecommons.org/licenses/by-nc-nd/4.0/). titin domain

NYHA = New York

Heart Association

Z = valvuloarterial impedance

S evere symptomatic aortic stenosis (AS) is a

common cardiac disease associated with poor
prognosis in the absence of heart valve replace-
ment (1). In AS, chronically elevated afterload induces
emerged as a main contributor to myocardial relaxa-
tion and stiffness (14). Titin properties can be
severely altered in heart failure, including AS (14).
Titin is expressed in 2 major isoforms in adult hearts:
left ventricular (LV) hypertrophy, increased myocar- stiff N2B and compliant N2BA isoforms (15). In recent
dial stiffness, and impaired relaxation (2,3). This years, there has been growing evidence for a titin
myocardial remodeling is associated with progressive isoform switch toward the more compliant N2BA
dyspnea, the most common symptom of AS, and poor isoform in various cardiac diseases, for example,
prognosis (1). heart failure with reduced or preserved EF (14). This
isoform transition may be compensatory, to coun-
SEE PAGE 347
teract the increased stiffening from myocardial
fibrosis. In contrast, for AS patients, it is not clear
Patients with severe, high-gradient, normal-flow whether titin isoforms switch toward N2BA, N2B, or
AS with preserved ejection fraction (“classical” AS) not at all (16–18). In addition, there are no studies of
benefit with a high probability from aortic valve titin isoform expression in different hemodynamic
replacement (1). However, there are other hemody- subtypes of AS. Phosphorylation of titin is another
namic types of AS, such as low-flow, low-gradient parameter that determines myocardial passive stiff-
severe AS with preserved ejection fraction (EF) ness (14), but likewise, has not been studied in
(“paradoxical” AS) and aortic stenosis with reduced hemodynamic subtypes of AS. To our knowledge,
ejection fraction (ASrEF), which occur in more than site-specific titin phosphorylation has never been
30% of all cases (4,5). Probably due to advanced investigated in human AS, but would be important to
myocardial remodeling, the positive effect of measure in particular at 2 mechanically active regions
aortic valve replacement is more uncertain in these within the titin springs present in both the N2B and
patients (1,5). N2BA isoforms, the N2B-unique sequence (N2Bus)
In particular, the pathophysiology of “paradoxical” and the proline/glutamate/valine/lysine-rich (PEVK)
AS is not fully understood. There is controversy about region, because the stiffness of these segments is
whether it is merely a moderate form of AS with altered when they become phosphorylated (14) or
favorable prognosis or an advanced form of AS. It dephosphorylated (19).
could be a pseudo-severe AS due to inaccuracies in In the present study, we investigated titin-isoform
the measurements or inconsistencies in the guide- expression, total-titin and site-specific N2Bus/PEVK
lines (6–8), or it could be a true AS associated with phosphorylation, and the degree of fibrosis in
pronounced myocardial stiffening, severe intrinsic endomyocardial biopsy samples from AS patients
myocardial damage, impaired relaxation, and there- compared with nonfailing donor heart samples. We
fore, worse prognosis than “classical” AS (5,9,10). examined these properties in 3 hemodynamic sub-
Pathological myocardial relaxation and stiffness in groups of AS: “paradoxical” AS, “classical” AS, and
AS are determined, in part, by fibrosis (11–13). More ASrEF. We aimed to establish whether such indexes
recently, the giant sarcomere protein titin has of structural and functional cardiac remodeling with
338 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

relevance for myocardial passive stiffness are similar Z (Z ¼ SAP $ MG/SVI, where SAP is the systolic arterial
or different among those patients and compared with pressure, MG is the mean gradient, and SVI is the
the nonfailing control hearts. stroke volume index) was calculated. Measurements
of global longitudinal strain were performed by
METHODS speckle tracking. Quantification of valve regurgita-
tion was performed according to current recommen-
PATIENT COHORT. In this prospective study, we dations (21). The volume of the left atrium was
examined patients with severe AS and an indication measured and related to the body surface. LV dia-
for surgical aortic valve replacement. Inclusion stolic dysfunction with abnormal relaxation and
criteria were: aortic valve area (AVA) <1 cm 2, accord- diastolic stiffness was assumed when the criteria of
ing to continuity formula; AVA index <0.6 cm 2/m 2; the European Society of Cardiology consensus state-
and symptoms of severe AS, such as dyspnea ment of 2007 were met (22). On the day of the
(New York Heart Association [NYHA] functional echocardiographic examination, B-type natriuretic
class $II), angina pectoris (Canadian Cardiovascular peptide (BNP) was measured (normal value <100 pg/
Society class $II), or syncope. Exclusion criteria were: ml). The blood samples were collected in tubes
1) more than moderate valve regurgitation or stenosis; containing ethylenediaminetetraacetic acid. After
2) previous cardiac surgery; and 3) a previous immediate centrifugation, BNP was measured using a
myocardial infarction. A previous myocardial infarc- chemiluminescent immunoassay kit (Biosite Triage,
tion was defined according to current recommenda- San Diego, California).
tions (20). Coronary angiography was performed
AORTIC VALVE REPLACEMENT AND BIOPSY
pre-operatively. Coronary heart disease was diag-
SAMPLING. Aortic valve replacement was performed
nosed when coronary artery stenosis was $50%. The
in the Department of Cardiothoracic Surgery, Ruhr
presence of coronary artery occlusions, including
University Hospital Bergmannsheil–Bochum. During
those that were subclinical, was considered an exclu-
surgery, endomyocardial biopsies (30 to 40 mg) were
sion criterion for the study. All patients gave written
taken from the basal septum. Samples were immedi-
consent to participate in this study. The study protocol
ately separated into one-half stored in formaldehyde,
was approved by the local ethics committee (approval
to be used for histochemistry, and one-half frozen in
4379-12, Ethics Committee of the Ruhr University
liquid nitrogen, to be used for titin protein analysis.
Bochum). The study protocol has been published
The study protocol was approved by the Ethics
(BOREAS [BOchum heaRt failurE in Aortic Stenosis]
Committee of the Ruhr University Bochum (approval
study, DRKS-ID: DRKS00005623).
4379-12).
ECHOCARDIOGRAPHY AND B-TYPE NATRIURETIC
CONTROL HEART SAMPLES. Nonfailing human LV
PEPTIDE. Transthoracic echocardiography was per-
samples (control group) were obtained from brain-
formed with the Vivid 7 or 9 System (General Electric,
dead human donors for whom normal LV function
Horton, Norway) within 48 h before aortic valve
had been confirmed by echocardiographic evidence.
replacement. Established parameters were used to
Sample collection was done in full accordance with
quantify AS. Patients were divided into 3 groups us-
Australian National Health Medical Research guide-
ing LVEF and mean gradient: 1) classical AS with a
lines and approved by the Human Research Ethics
high gradient, normal flow, and preserved LVEF,
Committee of the University of Sydney (HREC
defined as a mean transaortic gradient of $40 mm Hg,
2 approval: 2012/2814).
stroke volume index >35 ml/m , and LVEF >50%;
2) paradoxical AS with low flow, low gradient, and QUANTIFICATION OF FIBROSIS. The quantification

preserved LVEF, diagnosed according to current rec- of myocardial fibrosis was performed by an experi-
ommendations as mean transaortic gradient <40 enced pathologist (A.T.) according to the method of
mm Hg, stroke volume index <35 ml/m2 , and Tanaka et al. (23). Fibrosis was classified as no/mild,
LVEF $50% (5); and 3) ASrEF, defined as reduced moderate, or severe.
LVEF (<50%), regardless of transaortic gradient and TITIN PROTEIN CHEMISTRY. A total of 20 to 25 mg of
stroke volume. Dobutamine echocardiography was protein prepared from frozen human heart tissue were
performed in all patients with AS and reduced EF. All loaded onto 1.8% polyacrylamide/1% agarose gels for
of these patients had a flow reserve. Patients with AS the detection of titin isoforms by Coomassie-blue
and preserved EF did not undergo dobutamine staining, as previously described (24). All-titin phos-
echocardiography. LV mass was calculated according phorylation was quantified by Western blotting using
to the modified method of Devereux and was related antiphosphoserine/-threonine antibodies (Biotrend
to the body surface. Valvuloarterial impedance Chemicals, Cologne, Germany) (25). In lieu of a protein
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Gotzmann et al. 339
JUNE 2018:335–46 Titin and Fibrosis in Aortic Stenosis

marker in the size range of titin, Coomassie-stained

T A B L E 1 Characteristics of Different Subgroups of Patients With Severe Aortic Stenosis
polyvinylidenfluoride membranes served as markers
of protein loading for immunoblots. Site-specific titin cAS pAS ASrEF
(n ¼ 14) (n ¼ 8) (n ¼ 8) p Value
phosphorylation was measured within the unique
Age, yrs 77  3 71  9 72  10 0.264
N2Bus element of cardiac titin at 3 phosphoserines and
Female 29 38 0 0.170
within the PEVK domain of titin at 1 phosphoserine NYHA functional class III/IV 29 63 75 0.079
(both titin regions are mechanically active). The Coronary artery disease 50 50 75 0.474
following custom-made, affinity-purified polyclonal Atrial fibrillation 7 38 25 0.212
antibodies against the phosphosites in human titin Diabetes mellitus 29 13 25 0.687

were used (24): anti-P-S4010, anti-P-S4099, anti-P- B-type natriuretic 146 (107, 192) 222 (169, 331) 1,399 (477, 1,788)*† <0.001
peptide, pg/ml
S4185 (all N2Bus), and P-S11878 (PEVK). Except for Systolic blood pressure, 132  15 139  22 126  18 0.463
anti-P-S4185 (generated by Immunoglobe, Himmel- mm Hg
stadt, Germany), these antibodies were made by Diastolic blood pressure, 75  10 80  7 81  7 0.325
mm Hg
Eurogentec (Brussels, Belgium). To measure the titin
Aortic valve area, cm2 0.7  0.1 0.7  0.1 0.6  0.2 0.226
to myosin heavy chain (MHC) ratio, Coomassie-stained Aortic mean gradient, mm Hg 50  7 34  4‡ 46  14† 0.001
2.5% polyacrylamide/1% agarose gels were prepared. SVI, ml/m2 40  7 30  4‡ 30  11* 0.008
We note that a substantial number of AS biopsies Z, mm Hg/ml $ m2 4.8  1.1 5.9  1.1‡ 6.7  2.8* 0.040
revealed no or barely measurable signals in the titin Left ventricular ejection 65  4 60  6 36  6*† <0.001
fraction, %
isoform/phosphorylation analysis, which was prob-
LVEDDI, cm/m2 2.4  0.3 2.2  0.4 2.8  0.3*† 0.005
ably due to the fact that the biopsy material sometimes
LVESDI, cm/m2 1.6  0.3 1.6  0.4 2.3  0.3*† 0.002
contained a low number of cardiomyocytes, whereas Global longitudinal strain, % 14  4 13  3 9  3*† 0.007
fibrotic regions were abundant. LVMI, g/m2 130  25 154  82 192  50* 0.017
Bands were visualized using the LAS-4000 Image Mitral regurgitation, 65/35/0 50/50/0 0/75/25 0.017
grade 0/1/2
Reader (Fuji Science Imaging Systems, Stamford,
LAVI, ml/m2 32  8 41  11‡ 39  13* 0.117
Connecticut), and densitometry was performed using
Diastolic dysfunction 71 100 100 0.072
Multi Gauge version 3.2 software (Fuji Science Imag-
E/A ratio 0.9  0.3 2.2  1.5‡ 3.4  2.1* 0.115
ing Systems). Titin N2B (z3,000 kDa) and N2BA sPAP, mm Hg 24  11 30  12 41  11* 0.011
(z3,300 kDa) isoforms were quantified by setting
total N2B þ N2BA band density to 100% and calcu- Values are mean  SD, %, or median (first quartile, third quartile). *cAS vs. ASrEF (p < 0.05). †pAS vs. ASrEF (p <
0.05). ‡cAS vs. pAS (p < 0.05).
lating percentages of the 2 isoforms. Titin/MHC ratios ASrEF ¼ aortic stenosis with reduced ejection fraction; cAS ¼ classical aortic stenosis; LAVI ¼ left atrial volume
were directly calculated from the densitometric index; LMVI ¼ left ventricular mass index; LVEDVI ¼ left ventricular end-diastolic diameter index; LVESDI ¼ left
ventricular end-systolic diameter index; NYHA ¼ New York Heart Association; pAS ¼ paradoxical aortic stenosis;
values measured for the respective protein bands. sPAP ¼ systolic pulmonary artery pressure; SVI ¼ stroke volume index; Z ¼ valvuloarterial impedance.

Quantification of titin phosphorylation was done by

normalizing immunoblot signals to corresponding
distributed variables), when appropriate. Chi-square
signals on (Coomassie-stained) polyvinylidenfluoride
analysis was used to compare categorical variables
transfer membranes. Because total phospho-titin
between groups. Adjusted results were obtained by
signals were consistently detected only in the N2B
multivariable analysis via generalized linear models
isoform, the N2BA isoform was excluded from the
and analysis of variance with age and sex as additional
analysis of total-titin phosphorylation.
predictors. Post-hoc multiple pairwise comparisons
FOLLOW-UP. Three months after aortic valve were made using Bonferroni correction. Continuous
replacement, the patients were evaluated at a clinical variables were compared between patients before and
follow-up visit with renewed echocardiography. after aortic valve replacement via paired Student’s t
Another clinical follow-up was carried out 12 months test (for normally distributed variables) or Wilcoxon
after aortic valve replacement to determine NYHA test (for non-normally distributed variables). For
functional class and survival. outcome analysis, Kaplan-Meier survival curves were
STATISTICS. Numerical values were expressed as the generated and differences between all-cause mortal-
mean  SD. Continuous variables without normal ity were assessed using log-rank test. All reported
distribution were summarized by the median (first probability values are 2-tailed, and p < 0.05 was
quartile, third quartile). Continuous variables were considered statistically significant. Analyses were
compared between groups using an unpaired performed with the SPSS statistical software package
Student’s t test or analysis of variance test (for version 22.0 (IBM, Armonk, New York) and with
normally distributed variables) or a Mann-Whitney custom S scripts for R version 3.4.2 (R Foundation
U test or Kruskal-Wallis test (for non-normally for Statistical Computing, Vienna, Austria).
340 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

AS group (p ¼ 0.009). The proportion of females

T A B L E 2 Follow-Up Evaluation Before and 3 Months After AVR
differed between the AS (7 of 30; 23%) and control
Before AVR After AVR p Value groups (5 of 8; 63%; p ¼ 0.034).
NYHA functional class III/IV, % 44 9 0.021
CLINICAL FOLLOW-UP. Clinical and echocardio-
B-type natriuretic peptide, pg/ml 338  377 279  143 0.568
Aortic valve area, cm2 0.7  0.1 1.7  0.2 <0.001
graphic follow-up evaluations were performed after 3
Aortic mean gradient, mm Hg 45  9 93 <0.001 months. During this time, 6 patients died due to
Z, mm Hg/ml $ m 2
5.7  2.1 4.2  1.2 0.015 acute cardiogenic shock (n ¼ 1), sepsis (n ¼ 2), ven-
Left ventricular ejection fraction, % 59  12 58  8 0.749 tricular fibrillation (n ¼ 1), and heart pump failure
LVEDDI, cm/m2 2.5  0.4 2.4  0.3 0.086 (n ¼ 2). The 30-day mortality rate was 3%. There was
LVESDI, cm/m2 1.8  0.5 1.6  0.3 0.077
no significant difference in outcome between pa-
LVMI, g/m2 139  34 117  30 0.002
tients with or without coronary artery bypass grafting
Values are % or mean  SD. (p ¼ 0.750). In the 24 surviving patients, NYHA
AVR ¼ aortic valve replacement; other abbreviations as in Table 1. functional class improved; aortic mean gradient,
valvuloarterial impedance Z, and LV mass index
decreased; and AVA increased significantly (Table 2).
RESULTS Among the different AS subgroups, significant dif-
ferences were found only for LVEF and aortic mean
PATIENT CHARACTERISTICS. A total of 30 patients gradient (Table 3). The 1-year survival rates were 93%
with severe symptomatic AS were included in this in patients with classical AS, 75% in patients with
study. The mean age of the patients was 74  7 years, ASrEF, and 63% in patients with paradoxical AS.
2
and the mean AVA was 0.7  0.1 cm . Diastolic Although the differences in survival were not signif-
dysfunction was found in 26 of 30 patients (87%). Of icant, there was a trend toward worse survival in
the patients with AS, 14 patients had classical AS, 8 patients with paradoxical AS.
had paradoxical AS, and 8 had ASrEF. Patients with FIBROSIS IS INCREASED IN AS. In endomyocardial
paradoxical AS had a significantly lower mean biopsies, significantly more cases of severe fibrosis
gradient and a lower stroke volume index compared were found in patients with severe AS than in the
with patients with classical AS (Table 1). Moreover, control group (severe AS: no/mild fibrosis, n ¼ 1;
the E/A ratio, valvuloarterial impedance Z, and left moderate fibrosis, n ¼ 13; severe fibrosis, n ¼ 14; vs.
atrial volume index were higher in the paradoxical control group: no/mild fibrosis, n ¼ 8; p ¼ 0.001).
than in the classical AS group. Compared with clas- After adjusting for age and sex, aortic stenosis was
sical AS, patients with ASrEF had significantly the only predictor for the degree of fibrosis. The de-
increased BNP values and larger LV diameter, valvu- gree of myocardial fibrosis appeared to be similar
loarterial impedance Z, LV mass index, and E/A ratio. among patients with classical AS, paradoxical AS, and
Additional characteristics of the patients are listed in ASrEF (Figure 1). In patients with or without coronary
Table 1. Donor heart subjects had a mean age of 64  8 heart disease, there was no significant difference in
years (5 female, 3 male), significantly lower that the the degree of fibrosis (coronary artery disease: no/
mild fibrosis, n ¼ 3; moderate fibrosis, n ¼ 5; severe
fibrosis, n ¼ 8; vs. no coronary artery disease: no/mild
T A B L E 3 Changes in NYHA Functional Class, B-Type Natriuretic Peptide and
fibrosis, n ¼ 4; moderate fibrosis, n ¼ 7; severe
Hemodynamics in Different Subgroups of Patients With Severe Aortic Stenosis
fibrosis, n ¼ 6; p ¼ 0.231).
cAS pAS ASrEF
(n ¼ 13) (n ¼ 5) (n ¼ 6) p Value TITIN ISOFORMS SWITCH TOWARD N2BA IN AS. A

D NYHA functional class III/IV, % 31 40 33 0.717 relatively large variability in titin-isoform composi-
D B-type natriuretic peptide, pg/ml 39  154 112  18 523  750* 0.110 tion was observed among the biopsies of patients
D Aortic valve area, cm2 1.0  0.2 0.9  0.3 1.1  0.4 0.571 with AS (n ¼ 25), but not among the donor samples
D Aortic mean gradient, mm Hg 41  8 24  7† 36  9 0.006 (n ¼ 8) (Figure 2). The median (first quartile, third
D Z, mm Hg/ml $ m2 1.2  1.0 0.7  2.4 3.3  4.1 0.571
quartile) N2BA/N2B titin isoform ratio was signifi-
D Left ventricular ejection fraction, % 6  5 1.6  8.2† 13  12* 0.012
cantly higher in patients with AS than in the
D LVEDDI, cm/m2 0.1  0.3 0.1  0.3 0.3  0.3 0.349
control group (0.42 [0.34, 0.56] vs. 0.31 [0.25, 0.34];
D LVESDI, cm/m2 0.1  0.6 0.3  0.2 0.5  0.4 0.086
D LVMI, g/m2 19  32 19  22 35  30* 0.612 p ¼ 0.005) (Figure 2B). After adjusting for age and
sex, aortic stenosis was the only predictor for N2BA/
Values are % or mean  SD. *cAS vs. ASrEF (p < 0.05). †cAS vs. pAS (p < 0.05). D indicates comparison of N2B ratio.
baseline parameters to parameters at 3-month follow-up.
Abbreviations as in Table 1. Comparing the AS subgroups to the donor group,
the median (first quartile, third quartile) N2BA/N2B
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Gotzmann et al. 341
JUNE 2018:335–46 Titin and Fibrosis in Aortic Stenosis

ratio was significantly higher only for patients with

F I G U R E 1 Myocardial Fibrosis in Subtypes of Aortic Stenosis
paradoxical AS (0.53 [0.37, 0.68] vs. 0.31 [0.25, 0.34];
p ¼ 0.013) (Figure 2C). The median (first quartile, third
quartile) titin/MHC ratio showed no significant dif-
ferences between the donor and AS groups (0.21 [0.17,
0.24] vs. 0.20 [0.19, 0.22]; p ¼ 0.949) and there were
no significant differences among the AS subgroups or
between a given AS subgroup and the control group
(Supplemental Figure 1). In patients with or without
coronary heart disease, there was no significant dif-
ference in the median (first quartile, third quartile)
N2BA/N2B ratio (0.50 [0.36, 0.63] vs. 0.38 [0.26, 0.51];
p ¼ 0.131) and the median titin/MHC ratio (0.20 [0.17,
0.25] vs. 0.22 [0.17, 0.23]; p ¼ 0.542).
TOTAL TITIN PHOSPHORYLATION IS REDUCED IN
AS. Analysis of total-titin phosphorylation by West-
ern blot using antiphosphoserine/-threonine anti-
bodies revealed signals from the N2B isoform of 7 of
the 8 donor samples and 16 of the 30 AS samples
(Figure 3). Compared with the donor cohort, a signif-
icantly lower degree of phosphorylation was
observed in the AS hearts (median [first quartile, third
quartile] phosphorylation 75% [71%, 79%] vs. 96%
[74%, 98%]; p ¼ 0.022) (Figure 3B). After adjusting for
age and sex, aortic stenosis was the only predictor for
total-titin phosphorylation. Titin-phosphorylation
signals were obtained for 8 of 14 patients with clas-
sical AS, 4 of 8 patients with paradoxical AS, and 4 of
8 patients with ASrEF. All 3 AS subgroups showed
significant hypophosphorylation compared with
donor hearts (p < 0.05), including patients with par-
adoxical AS, which tended to have a relatively high
degree of titin hypophosphorylation (Figure 3C). In
patients with or without coronary heart disease, there (A) No/mild myocardial fibrosis in a patient with “classical” aortic stenosis. (B) Severe
was no significant difference in the median (first myocardial fibrosis in a patient with “paradoxical” aortic stenosis. (C) Distribution of

quartile, third quartile) total-titin phosphorylation different degrees of myocardial fibrosis. Mann-Whitney U test revealed significant dif-
ferences between control group and all AS patients (p ¼ 0.001). Comparison was made
level (75% [73%, 78%] vs. 75% [64%, 81%]; p ¼ 0.689).
between study patients’ subgroups using Kruskal-Wallis test (p ¼ 0.007). ASrEF ¼

MECHANICALLY RELEVANT PHOSPHOSERINE AT aortic stenosis with reduced left ventricular ejection fraction; cAS ¼ “classical” aortic
stenosis; pAS ¼ “paradoxical” aortic stenosis.
TITIN N2Bus IS HYPOPHOSPHORYLATED IN AS. Site-
specific titin phosphorylation was measured for
several phosphosites within the elastic spring regions
N2Bus and PEVK, using a panel of phospho-specific in median phosphorylation was observed for P-S4010,
antibodies (Table 4, Figure 4). Phosphorylation of P-S4099, and P-11878 (Table 4). However, N2Bus
these titin spring elements affects cardiomyocyte and phosphosite P-S4185 was significantly less phos-
myocardial passive stiffness (14). The phosphoserines phorylated in AS than in donors (median [first quar-
within N2Bus measured here are known to be phos- tile, third quartile] 0.77 [0.70, 0.84] vs. 0.89 [0.88,
phorylated by protein kinase (PK)A or extracellular 0.94]; p ¼ 0.023) (Figure 4B). Using multivariable
signal-regulated protein kinase 2 (P-S4010), cGMP- analysis, both aortic stenosis and age were found
activated PKG (P-S4099), and PKG or PKA (P-S4185), to predict phosphorylation of the titin phosphosite
and they can be dephosphorylated by protein phos- P-S4185 (p < 0.01 for both). The subgroup pAS showed
phatase 5 (19), whereas phosphoserine P-S11878 a trend for hypophosphorylation at S4185, compared
within the PEVK domain can be phosphorylated by with donor hearts and cAS, whereas the ASrEF sub-
PKC a (14). In AS versus donor samples, no difference group was significantly hypophosphorylated at S4185
342 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

F I G U R E 2 Titin Isoform Expression in Nonfailing Donor F I G U R E 3 Phosphorylation of Total Titin in Nonfailing Donor
(Control) and AS Patient Hearts (Control) and AS Patient Hearts

(A) Representative loose gel (1.8% polyacrylamide/1% agarose)

resolving the titin isoforms N2BA and N2B. (B and C) Summary
of results of densitometric analysis of titin protein composition,
demonstrated as N2BA/N2B isoform expression ratio. Shown
(A) Representative Western blot (WB) from 1.8%
are box plots (median [first quartile, third quartile]) with
polyacrylamide/1% agarose gel, using antiphosphoserine/
whiskers and individual data points (red circles). (B)
-threonine antibodies, as well as Coomassie-stained poly-
Mann-Whitney U test revealed statistically significant differ-
vinylidenfluoride (PVDF) membrane indicating protein load.
ences between control hearts and all AS patients (p ¼ 0.005).
All bands shown were from the same gel/blot. (B and C)
(C) Comparison was made between study patients’ subgroups
Summary of results of densitometric analysis of titin
using the Kruskal-Wallis test (p ¼ 0.042). Post hoc multiple
phosphorylation (N2B isoform), indexed to protein load.
pairwise comparisons revealed significant differences between
Shown are box plots (median [first quartile, third quartile])
the control group and paradoxical AS (*p < 0.05). AS ¼ aortic
with whiskers and individual data points (red circles).
stenosis; other abbreviations as in Figure 1.
(B) Mann-Whitney U test revealed statistically significant
differences between control hearts and all AS patients
(p ¼ 0.022). (C) Comparison was made between AS
versus donors (Table 4, Figure 4C). In summary, the
subgroups using Kruskal-Wallis test (p > 0.05). Post hoc
PKA/PKG-dependent phosphoserine P-S4185 within multiple pairwise comparisons revealed significant
human N2Bus was hypophosphorylated in AS, differences between control group and cAS, pAS, and
explaining part of the total titin phosphorylation ASrEF (*p < 0.05). Abbreviations as in Figure 1.
deficit in AS versus nonfailing control hearts.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Gotzmann et al. 343
JUNE 2018:335–46 Titin and Fibrosis in Aortic Stenosis

T A B L E 4 Site-Specific Titin Phosphorylation

Control AS cAS pAS ASrEF p Value*

P-S4010/PVDF 0.80 (0.76, 0.82) (n ¼ 5) 0.75 (0.65, 0.81) (n ¼ 20) 0.80 (0.69, 0.83) (n ¼ 8) 0.80 (0.68, 0.84) (n ¼ 4) 0.70 (0.65, 0.72) (n ¼ 8) 0.216
(N2Bus) 0.156
P-S4099/PVDF 0.86 (0.83, 0.92) (n ¼ 6) 0.85 (0.78, 0.90) (n ¼ 22) 0.85 (0.78, 0.90) (n ¼ 9) 0.79 (0.76, 0.80) (n ¼ 5) 0.85 (0.78, 0.88) (n ¼ 8) 0.214
(N2Bus) 0.353
P-S4185/PVDF 0.89 (0.88, 0.94) (n ¼ 5) 0.77 (0.70, 0.84) (n ¼ 22) 0.82 (0.74, 0.94) (n ¼ 9) 0.72 (0.69, 0.80) (n ¼ 5) 0.74 (0.61, 0.81) (n ¼ 8) 0.023
(N2Bus) 0.017
P-S11878/PVDF 0.91 (0.78, 1.00) (n ¼ 6) 0.94 (0.87, 0.98) (n ¼ 21) 0.94 (0.89, 0.98) (n ¼ 9) 0.97 (0.92, 1.02) (n ¼ 4) 0.88 (0.81, 0.98) (n ¼ 8) 0.712
(PEVK) 0.570

Values are median (1st quartile, 3rd quartile). *Upper p value compares control group and all AS subgroups using the Mann-Whitney U test. Lower p value compares control and subgroups of AS using the
Kruskal-Wallis test.

DISCUSSION shift of the titin-isoform expression ratio toward more

compliant N2BA (16). The reason for these diverging
In this study, we examined patients with severe results is unknown. We investigated the largest num-
symptomatic AS who underwent surgical aortic valve ber of AS patients yet for titin-isoform expression.
replacement. There were no significant differences In our patient group, we found a significant shift
between the subgroups of AS in terms of clinical toward the more compliant N2BA titin isoform
symptoms and AVA. However, the hemodynamic versus nonfailing donor heart samples (Figure 2). The
analysis revealed fundamental differences between magnitude and direction of this isoform transition
classical high-gradient, normal-flow AS; paradoxical were similar to those seen in end-stage failing human
low-flow, low-gradient AS with preserved LV ejection hearts with ischemic or dilated cardiomyopathy,
fraction; and AS with reduced EF. In particular, there compared with nonfailing donor hearts (26,27).
were significant differences in aortic mean gradient, Such a transition toward compliant titin isoforms may
stroke volume, valvuloarterial impedance Z, LVEF, be a compensatory mechanism accompanying the
and BNP (Table 1). A trend toward worse outcome was increase in myocardial stiffness through fibrosis
observed in patients with paradoxical AS after aortic or titin-hypophosphorylation. Similar observations
valve replacement (1-year survival was 63%, have been made in various other human myocardial
compared with 93% in classical AS). This trend is diseases, including HF with preserved EF (14).
consistent with earlier findings (9). Our study examined, for the first time, the
MYOCARDIAL FIBROSIS. The myocardium in AS is expression of titin isoforms in different hemody-
known to be characterized by increased cell mass and namic subgroups of AS. The titin-isoform switch
increased fibrosis (1–3,11–13). In our study, we toward N2BA was significant in patients with para-
confirmed that patients with severe symptomatic AS doxical AS (Figure 2C). This could be an indication of
have significant myocardial fibrosis. Patients with substantial remodeling taking place in the myocar-
paradoxical AS showed a degree of fibrosis similar to dium in this AS subtype. In classical AS, there was a
that of patients with classical AS or ASrEF (Figure 1). strong trend toward increased N2BA proportions,
Our findings are consistent with those of Herrmann whereas in ASrEF, a relatively low degree of titin-
et al. (12), who examined different forms of AS (12), and isoform shift was found, despite pronounced fibrosis
underscore the view that paradoxical AS is a disease in all AS subtypes. However, the low sample sizes in
with severe intrinsic myocardial damage (9,10). the individual AS subgroups precludes a generaliza-
tion of these findings. Collectively, our data support
TITIN N2BA/N2B ISOFORM EXPRESSION RATIO.
the view that the titin-isoform transition in human AS
Diverging published data exist regarding the ratio of
typically is in the direction of the more compliant
the more compliant titin isoform N2BA to the stiffer
N2BA variant.
isoform N2B in patients with AS. One study demon-
strated a reduced N2BA/N2B expression ratio in 19 TITIN PHOSPHORYLATION. We also demonstrated
patients with AS, compared to donor hearts (18). hypophosphorylation of total titin in patients with
Another study reported no significant alterations in severe AS compared with healthy donor hearts
titin-isoform composition in 14 AS patients versus (Figure 3). Phosphorylation is an important
healthy hearts (17). Yet, another study with 9 AS pa- factor in the modification of myocardial protein
tients, from the same group, detected a significant function (14,28). Previous studies demonstrated
344 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

hypophosphorylation of titin at the cardiac-specific

F I G U R E 4 Site-Specific Phosphorylation of N2Bus Titin in
Nonfailing Donor (Control) and AS Patient Hearts
N2B element in human heart failure (29–31) and in
animal models of heart failure with preserved EF
(32,33). Some studies also showed an increased ratio
of phosphorylated N2BA over phosphorylated N2B in
human heart failure with reduced or preserved ejec-
tion fraction (16,17). Incubation of isolated (skinned)
failing human cardiomyocytes with PKA or PKG cor-
rected a pathologically elevated titin-based passive
stiffness (17,34). Here, we provided evidence that
human AS patients have a phosphorylation deficit at
the elastic N2Bus domain, specifically, at residue
S4185 (Figure 4). Phosphorylation of this serine, as
well as other residues within the N2Bus region, is
known to reduce titin-based myocardial passive
stiffness (29). Conversely, dephosphorylation (19) or
hypo-phosphorylation of N2Bus is predicted to in-
crease titin-based stiffness. P-S4185 in human titin
can be phosphorylated by both PKA and PKG (29,30),
and low activity of these protein kinases in AS may be
a reason for the hypophosphorylation of N2Bus. Other
known phosphoserines within the N2Bus and PEVK
regions were unaltered in AS versus nonfailing
hearts. Notably, hypophosphorylation of total titin
and P-S4185 within N2Bus were also present or
tended to be present in patients with paradoxical AS
(Figures 3 and 4). These results provided additional
evidence that this type of AS is similarly affected by
remodeling as classical AS or ASrEF. In conclusion,
although we did not measure titin-based passive
tension, the reduced titin phosphorylation, especially
at the N2Bus element, could be a factor underlying
the increased passive stiffness and diastolic
dysfunction in AS.

STUDY LIMITATIONS. In the relatively small popula-

tion group, a subdivision into a group with low-flow,
low-gradient AS with reduced LVEF was not possible.
However, the present study is the largest yet to
(A) Representative WBs from 1.8% polyacrylamide/1% agarose
investigate the expression of titin isoforms and
gels, using antititin antibodies against phosphoserine P-S4185
within the N2Bus element. Coomassie-stained PVDF membrane is
phosphorylation in AS, and to our knowledge is the
also shown to indicate protein load. (B and C) Summary of results only study to look at site-specific titin phosphoryla-
of densitometric analysis for the P-S4185 phosphosite in N2Bus tion. Notably, it is not settled whether or not the basal
titin, which was the only phosphosite showing significant differ- septum endocardial biopsy site is representative of
ences in AS versus nonfailing donor hearts. Titin phosphorylation
the entire LV. However, it was not possible in this
was indexed to protein load. Shown are box plots (median [first
quartile, third quartile]) with whiskers and individual data points
study to take a sample from other regions of the LV,
(red circles). (B) Mann-Whitney U test revealed statistically sig- as this would have meant a much higher risk for the
nificant differences between control hearts and all AS patients patients. In our study, more than 50% of all patients
(p ¼ 0.023). (C) Comparison was made between the control had coronary heart disease. The characteristics of our
group and AS subgroups using the Kruskal-Wallis test, revealing
study cohort thus correspond to the usual character-
significant differences within the study groups (p ¼ 0.017). A
post hoc test (pairwise Wilcoxon Mann-Whitney U test) suggested
istics of patients with severe AS (1,2). However, we
a significant difference between donor and ASrEF hearts excluded patients with previous myocardial infarc-
(*p < 0.05). Abbreviations as in Figures 1 and 3. tion to prevent bias in the analysis of titin and
fibrosis. Due to the small size of the myocardial
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Gotzmann et al. 345
JUNE 2018:335–46 Titin and Fibrosis in Aortic Stenosis

biopsies available, functional studies at the cellular These changes could explain the unfavorable prognosis
level (e.g., passive tension measurements) were not of the disease.
feasible. Thus, it remains open whether the titin-
based passive stiffness was altered in the AS versus ADDRESS FOR CORRESPONDENCE: Dr. Michael
donor cohorts, considering that the titin isoform shift Gotzmann, Department of Cardiology, Marien Hospi-
toward more compliant N2BA in AS and the hypo- tal Witten, Ruhr University Bochum, Marienplatz 2,
phosphorylation at N2Bus would be expected to 58452 Witten, Germany. E-mail: michael.gotzmann@
change this stiffness in opposite directions. ruhr-uni-bochum.de. OR Dr. Wolfgang A. Linke,
Institute of Physiology II, University of Münster,
CONCLUSIONS
R.-Koch-Str. 27B, 48149 Münster, Germany. E-mail:
[email protected].
Our study demonstrated an increase in myocardial
fibrosis and titin-isoform shift toward the more
PERSPECTIVES
compliant N2BA variants in AS. This titin-isoform
switch could be a compensatory mechanism following
or accompanying the increased matrix stiffness, or COMPETENCY IN MEDICAL KNOWLEDGE 1: Myocardial
it could compensate for increased cardiomyocyte relaxation and stiffness in AS are determined by myocardial
stiffness due to chronic titin hypophosphorylation. fibrosis and the giant cytoskeletal protein titin.
There was significant hypophosphorylation of total
COMPETENCY IN MEDICAL KNOWLEDGE 2: Paradoxical
titin and N2Bus-titin residue P-S4185 in AS compared
low-flow, low-gradient AS with preserved ejection is a common
with healthy hearts. This study is the first to investigate
subtype of severe AS. It is characterized by increased myocardial
the expression of titin isoforms (N2BA/N2B), titin
fibrosis, titin-isoform transition toward compliant variants, and
phosphorylation, and titin/MHC ratio in different
significant hypophosphorylation of titin compared with healthy
hemodynamic subtypes of AS. Alterations in titin
hearts.
phosphorylation and myocardial fibrosis were found
to be similar in paradoxical AS, classical high-gradient
TRANSLATIONAL OUTLOOK: Additional research, such as
AS, and AS with reduced EF. “Paradoxical” AS,
measurements of cardiomyocyte function in AS and invasive
but not cAS or ASrEF, showed a significant shift
hemodynamics, may also improve our understanding of the
toward compliant N2BA titin compared with control
pathophysiology of paradoxical AS.
hearts. Findings suggest that paradoxical AS is a
severe AS with pronounced myocardial remodeling.

REFERENCES

1. Otto CM, Prendergast B. Aortic-valve stenosis— 7. Chin CW, Ding ZP, Lam CS, Ling LH. Paradoxical 12. Herrmann S, Störk S, Niemann M, et al. Low-
from patients at risk to severe valve obstruction. low-gradient aortic stenosis: the HFpEF of aortic gradient aortic valve stenosis myocardial fibrosis
N Engl J Med 2014;371:744–56. stenosis. J Am Coll Cardiol 2016;67:2447–8. and its influence on function and outcome. J Am
Coll Cardiol 2011;58:402–12.
2. Carabello BA, Paulus WJ. Aortic stenosis. Lancet 8. Chhabra L. Inconsistency of hemodynamic data
2009;373:956–66. in low-gradient severe aortic stenosis. J Am Coll 13. Milano AD, Faggian G, Dodonov M, et al.
Cardiol 2016;67:2446–7. Prognostic value of myocardial fibrosis in patients
3. Hess OM, Ritter M, Schneider J, Grimm J,
with severe aortic valve stenosis. J Thorac Car-
Turina M, Krayenbuehl HP. Diastolic stiffness and 9. Clavel MA, Dumesnil JG, Capoulade R,
diovasc Surg 2012;144:830–7.
myocardial structure in aortic valve disease before Mathieu P, Sénéchal M, Pibarot P. Outcome of
and after valve replacement. Circulation 1984;69: patients with aortic stenosis, small valve area, and 14. Linke WA, Hamdani N. Gigantic business: titin
855–65. low-flow, low-gradient despite preserved left properties and function through thick and thin.
ventricular ejection fraction. J Am Coll Cardiol Circ Res 2014;114:1052–68.
4. Hachicha Z, Dumesnil JG, Bogaty P, Pibarot P.
Paradoxical low-flow, low-gradient severe 2012;60:1259–67. 15. Freiburg A, Trombitas K, Hell W, et al. Series of
aortic stenosis despite preserved ejection 10. Dayan V, Vignolo G, Magne J, Clavel MA, exon-skipping events in the elastic spring region
fraction is associated with higher afterload Mohty D, Pibarot P. Outcome and impact of aortic of titin as the structural basis for myofibrillar
and reduced survival. Circulation 2007;115: valve replacement in patients with preserved LVEF elastic diversity. Circ Res 2000;86:1114–21.
2856–64. and low-gradient aortic stenosis. J Am Coll Cardiol 16. Borbély A, Falcao-Pires I, van Heerebeek L,
5. Clavel MA, Magne J, Pibarot P. Low-gradient 2015;66:2594–603. et al. Hypophosphorylation of the stiff N2B titin
aortic stenosis. Eur Heart J 2016;37:2645–57. isoform raises cardiomyocyte resting tension in
11. Krayenbuehl HP, Hess OM, Monrad ES,
failing human myocardium. Circ Res 2009;104:
6. Jander N, Minners J, Holme I, et al. Outcome of Schneider J, Mall G, Turina M. Left ventricular
780–6.
patients with low-gradient “severe” aortic stenosis myocardial structure in aortic valve disease before,
and preserved ejection fraction. Circulation 2011; intermediate, and late after aortic valve replace- 17. Falcão-Pires I, Hamdani N, Borbély A, et al.
123:887–95. ment. Circulation 1989;79:744–55. Diabetes mellitus worsens diastolic left ventricular
346 Gotzmann et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Titin and Fibrosis in Aortic Stenosis JUNE 2018:335–46

dysfunction in aortic stenosis through altered 23. Tanaka M, Fujiwara H, Onodera T, Wu DJ, 31. Zile MR, Baicu CF, Ikonomidis JS, et al.
myocardial structure and cardiomyocyte stiffness. Hamashima Y, Kawai C. Quantitative analysis of Myocardial stiffness in patients with heart
Circulation 2011;124:1151–9. myocardial fibrosis in normals, hypertensive failure and a preserved ejection fraction:
hearts, and hypertrophic cardiomyopathy. Br contributions of collagen and titin. Circulation
18. Williams L, Howell N, Pagano D, et al. Titin
Heart J 1986;55:575–81. 2015;131:1247–59.
isoform expression in aortic stenosis. Clin Sci
(Lond) 2009;117:237–42. 24. Hamdani N, Krysiak J, Kreusser MM, et al. 32. Hamdani N, Bishu KG, von Frieling-
Crucial role for Ca2(þ)/calmodulin-dependent Salewsky M, Redfield MM, Linke WA. Deranged
19. Krysiak J, Unger A, Beckendorf L, et al. Protein protein kinase-II in regulating diastolic stress of myofilament phosphorylation and function
phosphatase 5 regulates titin phosphorylation and normal and failing hearts via titin phosphorylation. in experimental heart failure with preserved
function at a sarcomere-associated mechano- Circ Res 2013;112:664–74. ejection fraction. Cardiovasc Res 2013;97:
sensor complex in cardiomyocytes. Nat Commun
25. Mohamed BA, Schnelle M, Khadjeh S, et al. 464–71.
2018;9:262.
Molecular and structural transition mechanisms in 33. Hamdani N, Franssen C, Lourenço A, et al.
20. Thygesen K, Alpert JS, Jaffe AS, et al., for the long-term volume overload. Eur J Heart Fail 2016; Myocardial titin hypophosphorylation importantly
Writing Group on the Joint ESC/ACCF/AHA/WHF 18:362–71. contributes to heart failure with preserved ejec-
Task Force for the Universal Definition of tion fraction in a rat metabolic risk model. Circ
26. Neagoe C, Kulke M, del Monte F, et al. Titin
Myocardial Infarction, ESC Committee for Practice Heart Fail 2013;6:1239–49.
isoform switch in ischemic human heart disease.
Guidelines (CPG). Third universal definition of
Circulation 2002;106:1333–41. 34. van Heerebeek L, Borbély A, Niessen HWM,
myocardial infarction. Eur Heart J 2012;33:
2551–67. 27. Makarenko I, Opitz CA, Leake MC, et al. Passive et al. Myocardial structure and function differ in
stiffness changes caused by upregulation of systolic and diastolic heart failure. Circulation
21. Lancellotti P, Tribouilloy C, Hagendorff A, 2006;113:1966–73.
compliant titin isoforms in human DCM hearts. Circ
et al., for the Scientific Document Committee of
Res 2004;95:708–16.
the European Association of Cardiovascular Imag-
ing. Recommendations for the echocardiographic 28. Hudson B, Hidalgo C, Saripalli C, Granzier H. KEY WORDS myocardial fibrosis,
assessment of native valvular regurgitation: an Hyperphosphorylation of mouse cardiac titin con- myocardial stiffness paradoxical aortic
executive summary from the European Association tributes to transverse aortic constriction-induced stenosis, titin isoforms, titin phosphorylation
of Cardiovascular Imaging. Eur Heart J Cardiovasc diastolic dysfunction. Circ Res 2011;109:858–66.
Imaging 2013;14:611–44. 29. Krüger M, Kötter S, Grützner A, et al. Protein
kinase G modulates human myocardial passive A PPE NDI X For a supplemental figure, please
22. Paulus WJ, Tschöpe C, Sanderson JE, et al.
stiffness by phosphorylation of the titin springs. see the online version of this paper.
How to diagnose diastolic heart failure: a
Circ Res 2009;104:87–94.
consensus statement on the diagnosis of
heart failure with normal left ventricular 30. Kötter S, Gout L, Von Frieling-Salewsky M, Go to http://www.acc.org/
ejection fraction by the Heart Failure and et al. Differential changes in titin domain phos- jacc-journals-cme to take
Echocardiography Associations of the European phorylation increase myofilament stiffness in the CME/MOC quiz for
Society of Cardiology. Eur Heart J 2007;28: failing human hearts. Cardiovasc Res 2013;99: this article.
2539–50. 648–56.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHOR. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

EDITORIAL COMMENT

Determinants of Passive Myocardial

Stiffness Along the Spectrum
of Aortic Stenosis*
Martin M. LeWinter, MD

I n their study in this issue of JACC: Basic to Trans-

lational Science, Gotzmann et al. (1) report alter-
ations in determinants of passive myocardial
stiffness in patients with aortic stenosis (AS) under-
protein that accounts for cardiomyocyte stiffness
over the physiological sarcomere length range (8,9).
Titin’s contribution can be modulated by isoform
variation and phosphorylation (10,11). The splice
going valve replacement. factor RBM20 is responsible for generation of 2 iso-
forms: the larger, more compliant N2BA, and the
SEE PAGE 335
smaller N2B isoform (12). Titin phosphorylation oc-
curs at multiple sites in its N2B and PEVK segments
Changes in the relaxation and filling properties of
(10,11). Protein kinase (PK) A and PKG are active at the
the left ventricle (LV) in cardiac hypertrophy and
same sites; PKC- a is active at different sites. PKA/PKG
heart failure (HF) have been recognized for decades
reduces and PKC-a phosphorylation increases titin
(2,3). Some of these include alterations in the speed
stiffness. Phosphorylation can rapidly alter titin and
and/or extent of myofilament deactivation. Thus, in
myocardial passive stiffness, for example, during
patients with heart failure with reduced ejection
exercise. Other kinases that phosphorylate titin (e.g.,
fraction (HFrEF), abnormalities in both Na-Ca
ERK2) and other post-translational modifications
handling (4) and acto-myosin kinetics (5) lead to
(e.g., disulfide bond formation) have been reported
slowed and/or incomplete relaxation. Impaired
(10,11). These may be significant in human disease
myofilament deactivation due to abnormal Na-Ca
and are an emerging research focus. Recently, ag-
handling and slowed acto-myosin kinetics has also
gregation of titin was shown to contribute to elevated
been reported in patients with hypertension (HTN),
cardiomyocyte stiffness in AS and HFrEF (13).
concentric LV remodeling, and heart failure with
Changes in determinants of passive stiffness have
preserved ejection fraction (HFpEF) (6,7).
been reported in nonischemic dilated cardiomyopathy
Altered passive filling properties of the myocar-
(HFrEF). Collagen content is increased (14,15). Titin
dium are also prominent in cardiac hypertrophy and
undergoes a shift to the N2BA isoform that decreases
HF. These are determined by the combined effects of
its stiffness (14–16), but a concomitant decrease in
collagen and titin, the giant myofilament spring
N2B phosphorylation (presumably PKA/PKG sites)
serves to increase stiffness. Passive myocardial stiff-
ness is decreased in HFrEF (15), which implies that the
*Editorials published in JACC: Basic to Translational Science reflect the titin isoform shift is the single most important change.
views of the authors and do not necessarily represent the views of JACC:
The syndrome of HFpEF is the most relevant
Basic to Translational Science or the American College of Cardiology.
clinical scenario in relation to AS. Pressure overload
From the Cardiology Unit, Department of Medicine, University of
(HTN) is present in the vast majority of patients, and as
Vermont–Larner College of Medicine and the University of Vermont
Medical Center, Burlington, Vermont, USA. Dr. LeWinter has reported that he
in AS, concentric remodeling is present in most (17). In
has no relationships relevant to the contents of this paper to disclose. HFpEF, comorbidities (type 2 diabetes, obesity,
The author attests he is in compliance with human studies committees obstructive sleep apnea, and chronic kidney disease)
and animal welfare regulations of the authors’ institutions and Food and
almost always contribute to impaired LV filling
Drug Administration guidelines, including patient consent where
appropriate. For more information, visit the JACC: Basic to Translational properties (18). Although similar comorbidities are
Science author instructions page. common, AS patients have a purer form of pressure

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.04.004

348 LeWinter JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Myocardial Stiffness in AS JUNE 2018:347–9

overload. Several groups have studied passive reported a decrease in total titin phosphorylation,
myocardial stiffness and its determinants in HFpEF which did not appear to differ by AS group. Phos-
using tissue obtained by epicardial biopsy during phorylation of a PKA/PKG site (S4185) was signifi-
cardiac surgery or endomyocardial biopsy at time of cantly reduced in AS patients when taken together.
cardiac catheterization (9,19–21). Although there is This appeared to be similar across groups; possibly
good reason to believe that passive stiffness is due to small numbers, it was not statistically signifi-
increased in HFpEF, its measurement is challenging cant in any single group. This change would be ex-
and requires properly oriented, adequately sized pected to counteract the isoform shift and increase
muscle strips. We reported passive stiffness in strips stiffness. There was no change in a PKC-a site phos-
obtained from intraoperative biopsies in patients with phorylation. Thus, with respect to determinants of
normal EF and a history of HTN undergoing coronary passive stiffness, patients with AS were qualitatively
bypass surgery (CBG) with and without HFpEF similar to HFpEF patients with regard to fibrosis and
compared with control subjects without HTN under- titin PKA/PKG site phosphorylation, but not PKC- a
going CBG (9). Passive stiffness was markedly site phosphorylation. Because titin isoform results in
increased in HFpEF, but was similar in control subjects HFpEF have been inconsistent (9,19), it is unclear
and HTN without HFpEF. Similar to Kasner et al. (21), whether AS patients resemble HFpEF in this regard.
we reported increased collagen content and cross The results in general indicate that patients with
linking in HFpEF. PAS are not fundamentally different from other AS
Paulus et al. (18-20,22) pioneered investigations of patients with regard to determinants of stiffness.
titin in HFpEF patients. They reported increased Gotzmann et al. (1) are to be congratulated for
resting tension in cardiomyocytes (endomyocardial conducting these demanding studies. It is critical to
biopsies) and decreased phosphorylation of PKA/PKG understand how and why myocardial function is
sites. This was reversed by PKG treatment and associ- altered in patients with disease. Animal models are
ated with reduced PKG activity. They also reported a valuable, especially for elucidating mechanisms, but
decrease in the N2BA isoform, presumably outweighed may not reliably reproduce human disease.
by phosphorylation changes. This was the first There are limitations to this study that should be
demonstration of a role for titin in HFpEF. In our study noted. Passive stiffness was not measured. Because
(9), we did not detect an isoform shift, perhaps because the observed titin isoform shifts should reduce stiff-
our patients had less advanced disease. We confirmed ness, it is possible, albeit unlikely, that passive stiff-
reduced PKA/PKG site phosphorylation in HFpEF ness is not in fact increased in AS. Measurements of
and also documented increased phosphorylation of cardiomyocyte resting tension also were not per-
a PKC- a site. All of these phosphorylation changes formed. As a result, the net effect of titin alterations is
increase cardiomyocyte and myocardial stiffness. unknown. The intriguing recent finding of titin ag-
Collagen content/fibrosis is increased in AS (23), gregation (13) was also not assessed.
and it is believed that passive myocardial stiffness is Research employing human myocardial tissue has
increased (although it has never been measured). some inherent limitations. Numbers of patents are
However, relatively little is known about titin. often limited and “noise” in the data is often rela-
Moreover, there is an ongoing debate about the sig- tively high. The method of obtaining tissue has
nificance of low flow–low gradient AS with respect to consequences. Endomyocardial biopsies are small
whether this indicates severe AS, less-severe AS with (<w5 mg) and not suitable for myocardial mechanics
impaired contractile function, or measurement inac- studies (e.g., passive stiffness), where undamaged
curacies. In their report, Gotzmann et al. (1) fill a linear strips are preferred. The small volume of tissue
major knowledge gap by quantifying fibrosis and titin can also limit other measurements of interest. The
characteristics in endomyocardial biopsy tissue from intraoperative biopsies we have employed (9) are
3 categories of AS patients, “classical” (high gradient, larger (25 to 50 mg) and can be sculpted into linear
normal flow, normal LVEF), “paradoxical” aortic ste- strips, allowing various mechanical measurements.
nosis (PAS) (low gradient, low flow, normal LVEF), However, these biopsies are limited to patients un-
and reduced EF. Control measurements were made in dergoing cardiac surgery. Thus, as discussed, we
tissue from brain-dead patients. Fibrosis was have studied coronary bypass surgery patients (9). As
increased and similar in all AS groups. A shift toward pointed out by Gotzmann et al. (1), human biopsy
a higher proportion of N2BA titin was found, serving methods are subject to sampling error because it is
to reduce passive stiffness. This appeared to be usually only possible to biopsy 1 site. Last, identi-
greatest in PAS, but the observation is limited by the fying suitable control subjects can be problematic.
relatively small number of patients. The investigators Brain-dead patients, as used by Gotzmann et al. (1),
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 LeWinter 349
JUNE 2018:347–9 Myocardial Stiffness in AS

have often been employed. The amount of tissue with AS. Patients with PAS do not appear to differ
available is large, and it is usually possible to be fundamentally from other AS patients. Whereas
confident that they do not have cardiac dysfunction. studies using human myocardium may have limita-
However, these patients are subject to high stress tions compared with more mechanistically rigorous
and have often received cardioactive drugs, for animal experiments, there is no substitute for care-
example, pressors. The control coronary bypass fully conducted research such as this in patients with
surgery patients we have used are difficult to come heart disease.
by and obviously have underlying coronary artery
disease. ADDRESS FOR CORRESPONDENCE: Dr. Martin M.
In summary, Gotzmann et al. (1) have provided LeWinter, Cardiology Unit, University of Vermont
important new information in regard to changes in Medical Center, 111 Colchester Avenue, Burlington,
the determinants of passive stiffness in patients Vermont 05401, USA. E-mail: [email protected].

REFERENCES

1. Gotzmann M, Grabbe S, Schöne D, et al. Alter- and a preserved ejection fraction: contributions of 18. Paulus WJ, Tschope C. A novel paradigm for
ations in titin properties and myocardial fibrosis collagen and titin. Circulation 2015;131:1247–59. heart failure with preserved ejection fraction:
correlate with clinical phenotypes in hemodynamic comorbidities drive myocardial dysfunction and
10. LeWinter MM, Granzier HL. Titin is a major
subgroups of severe aortic stenosis. J Am Coll remodeling through coronary microvascular
human disease gene. Circulation 2013;127:938–44.
Cardiol Basic Trans Science 2018;3:335–46. endothelial inflammation. J Am Coll Cardiol 2013;
11. Linke WA, Hamdani N. Gigantic business: titin 62:263–71.
2. Lewis GA, Schelbert EB, Williams SG, et al.
properties and function through thick and thin.
Biological phenotypes of heart failure with pre- 19. Borbely A, van der Velden J, Papp Z, et al.
Circ Res 2014;114:1052–68.
served ejection fraction. J Am Coll Cardiol 2017; Cardiomyocyte stiffness in diastolic heart failure.
70:2186–200. 12. Guo W, Sun M. RBM20, a potential target for Circulation 2005;111:774–81.

3. Weintraub RG, Semsarian C, MacDonald P. treatment of cardiomyopathy via titin isoform 20. Borbely A, Falcao-Pires I, van Heerebeek L,
Dilated cardiomyopathy. Lancet 2017;390:400–14. switching. Biophys Rev 2018;10:15–25. et al. Hypophosphorylation of the stiff N2B titin
13. Franssen C, Kole J, Musters R, Hamdani N, isoform raises cardiomyocyte resting tension in
4. Hasenfuss G, Schillinger W, Lehnart SE, et al.
Relationship between Naþ-Ca2þ-exchanger pro- Paulus WJ. a-b crystallin reverses high diastolic failing human myocardium. Circ Res 2009;104:
stiffness of failing human cardiomyocytes. Circ 780–6.
tein levels and diastolic function of failing human
myocardium. Circulation 1999;99:641–8. Heart Fail 2017;10:e003626. 21. Kasner M, Westermann D, Lopez B, et al.
14. Makarenko I, Opitz CA, Leake MC, et al. Passive Diastolic tissue Doppler indexes correlate
5. Hasenfuss G, Mulieria LA, Leavitt BJ, et al.
stiffness changes caused by upregulation of with the degree of collagen expression and
Contractile protein function in failing and non-
compliant titin isoforms in human dilated cardio- cross-linking in heart failure and normal
failing human myocardium. Basic Res Cardiol
myopathy hearts. Circ Res 2004;95:708–16. ejection fraction. J Am Coll Cardiol 2011;57:
1992;87 Suppl 1:107–16.
977–85.
6. Runte KE, Bell SP, Selby DE, et al. Relaxation 15. Nagueh SF, Shah G, Wu Y, et al. Altered titin
22. van Heerebeek L, Hamdani N, Falcao-Pires I,
and the role of calcium in isolated contracting expression, myocardial stiffness, and left ventric-
et al. Low myocardial protein kinase G activity in
myocardium from patients with hypertensive heart ular function in patients with dilated cardiomy-
heart failure with preserved ejection fraction. Cir-
disease and heart failure with preserved ejection opathy. Circulation 2004;110:155–62.
culation 2012;126:830–9.
fraction. Circ Heart Fail 2017;10. pii:e004311.
16. Borbély A, Falcao-Pires I, van Heerebeek L,
23. Krayenbuehl HP, Hess OM, Monrad ES,
7. Donaldson C, Palmer BM, Zile M, et al. Myosin et al. Hypophosphorylation of the stiff N2B titin
Schneider J, Mall G, Turina M. Left ventricular
cross-bridge dynamics in patients with hyperten- isoform raises cardiomyocyte resting tension in
myocardial structure in aortic valve disease before,
sion and concentric left ventricular remodeling. failing human myocardium. Circ Res 2009;104:
intermediate, and late after aortic valve replace-
Circ Heart Fail 2012;5:803–11. 780–6.
ment. Circulation 1989;79:744–55.
8. Granzier HL, Irving TC. Passive tension in
17. Zile MR, Gottdiener JS, Hetzel SJ, et al., for the
cardiac muscle: contribution of collagen, titin,
I-PRESERVE Investigators. Prevalence and signifi-
microtubules, and intermediate filaments. Biophys
cance of alterations in cardiac structure and
J 1995;68:1027–44.
function in patients with heart failure and a pre- KEY WORDS myocardial fibrosis, myocardial
9. Zile MR, Baicu CF, Ikonomidis JS, et al. served ejection fraction. Circulation 2011;124: stiffness, paradoxical aortic stenosis, titin
Myocardial stiffness in patients with heart failure 2491–501. isoforms, titin phosphorylation
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

PRECLINICAL RESEARCH

Diabetes Exacerbates Myocardial

Ischemia/Reperfusion Injury by
Down-Regulation of MicroRNA and
Up-Regulation of O-GlcNAcylation
Dandan Wang,a Xiaoyue Hu, MD,b Seung Hee Lee, PHD,b Feng Chen, BS,a Kai Jiang, BS,a Zizhuo Tu, BS,a
Zejian Liu, PHD,c Jing Du, MD, PHD,b Li Wang, PHD,d Chaoying Yin, PHD,d Yu Liao, MD,e Hongcai Shang, PHD,f
Kathleen A. Martin, PHD,b Raimund I. Herzog, MD,c Lawrence H. Young, MD,b Li Qian, PHD,d John Hwa, MD, PHD,b
Yaozu Xiang, MD, PHDa

VISUAL ABSTRACT
HIGHLIGHTS

Optimal treatment for patients with

diabetes and myocardial infarction
remains a challenge.

Hyperglycemia- and hyperinsulinemia-
induced miR-24 reduction and
O-GlcNAcylation in the diabetic heart
contributes to poor survival in diabetic
myocardial I/R and increased infarct size
post-I/R.

Overexpression of miR-24 in murine hearts
significantly reduces myocardial infarct size.

miR-24 targets multiple key proteins
including O-GlcNac transferase, ATG4A
(a key protein in autophagy), and BIM
(a pro-apoptosis protein) to protect the
myocardium from I/R injury.

miR-24 is a promising therapeutic
candidate for diabetic I/R injury.

Wang, D. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):350–62.

From the aShanghai East Hospital, School of Life Sciences and Technology, Advanced Institute of Translational Medicine, Tongji
University, Shanghai, China; bSection of Cardiovascular Medicine, Department of Internal Medicine, Yale Cardiovascular Research
c
Center, Yale University School of Medicine, New Haven, Connecticut, USA; Section of Endocrinology, Department of Internal Med-
icine, Yale University School of Medicine, New Haven, Connecticut, USA; d McAllister Heart Institute, Department of Pathology and
e
Laboratory Medicine, University of North Carolina, Chapel Hill, North Carolina, USA; Department of Endocrinology and Metabolism,

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.01.005

JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 351
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

ABBREVIATIONS
SUMMARY
AND ACRONYMS

Management for patients with diabetes experiencing myocardial infarction remains a challenge. Here the authors ATG4A = autophagy-related

show that hyperglycemia- and hyperinsulinemia-induced microRNA-24 (miR-24) reduction and O-GlcNAcylation in gene 4a

the diabetic heart contribute to poor survival and increased infarct size in diabetic myocardial ischemia/reperfusion BIM = Bcl-2-like protein 11

(I/R). In a mouse model of myocardial I/R, pharmacological or genetic overexpression of miR-24 in hearts significantly CVD = cardiovascular disease

reduced myocardial infarct size. Experimental validation revealed that miR-24 targets multiple key proteins, including DM = diabetes mellitus

O-GlcNac transferase, ATG4A, and BIM, to coordinately protect the myocardium from I/R injury. These results I/R = ischemia/reperfusion
establish miR-24 as a promising therapeutic candidate for diabetic I/R injury. (J Am Coll Cardiol Basic Trans Science MI = myocardial infarction
2018;3:350–62) © 2018 The Authors. Published by Elsevier on behalf of the American College of Cardiology Foundation. OGT = O-GlcNac transferase
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

D iabetes mellitus (DM) is of growing concern,

with a prevalence approaching 400 million
worldwide and 30 million in the United
States (1). Type 2 diabetes mellitus (T2DM), account-
hemoglobin [HbA1c] >6.5% with absent C-peptide
levels) and T2DM (HbA1c >6.5% with normal or
higher C-peptide levels) due to hyperglycemia,
contributing to endothelial dysfunction (20). In the
ing for approximately 95% of DM, is particularly present study, we have uncovered a possible unifying
increasing due to insulin resistance from obesity (1). mechanism that reconciles the disparate glucose
Both type 1 diabetes mellitus (T1DM) and T2DM control and cardiovascular disease results between
enhance the risk for cardiovascular disease (CVD) by T1DM and T2DM. Excessive insulin in T2DM patients,
2- to 6-fold (2), with mortality arising predominantly from the use of insulin therapy on a background of
from acute thrombotic cardiovascular events (3). increased insulin, leads to dysregulation of a key
Intensive glycemic control appears to reduce the protective miRNA: miR-24. These results may present
risk of CVD in T1DM (4). In contrast, whether there a significant therapeutic dilemma in treating patients
is a beneficial role for intensive glycemic control on with both T2DM and MI (21–23). Our study suggests
CVD in T2DM remains unclear (5–13). that therapeutic strategies leading to reduced insulin
SEE PAGE 363
usage, and thus up-regulating miR-24, potentially
protect against acute cardiovascular events in T2DM.
Over the past several years it has become clear that
alterations in the expression of microribonucleic acid METHODS
(microRNA or miRNA) contribute to the pathogenesis
of diabetes (14–18). MicroRNAs are small (w22 nt) HUMAN STUDIES. C l a m p s t u d y . A total of 5 in-
regulatory ribonucleic acid (RNA) molecules that dividuals with T1DM participated in the study and
functionally modulate the activity of specific underwent hyperinsulinemic (2 mU/kg/min) hypo-
messenger RNA targets involved in a wide range of glycemic (glucose w2.8 mmol/l) clamp studies, as
physiological and pathological processes (19). previously described (24). Subjects had no medical
Profiling of microRNA expression in patients with problems other than T1DM and had a normal physical
diabetes has identified signatures associated with examination and electrocardiogram. Blood tests
diagnosis, progression, prognosis, and response to confirmed normal liver and renal function, but absent
treatment (14). We recently reported that miR-24 is C-peptide levels. Briefly, an intravenous catheter
significantly reduced in both T1DM (glycated was inserted into an antecubital vein; a primed

Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China; and the fKey laboratory of Chinese Internal
Medicine of Ministry of Education and Beijing, Dongzhimen Hospital, Beijing University of Chinese Medicine, Beijing, China. This
work was supported by National Institutes of Health, National Heart, Lung, and Blood Institute grants (RO1HL122815,
RO1HL115247, and U54 HL117798 to Dr. Hwa), and grants from the National Natural Science Foundation of China (81770256) and
the Fundamental Research Funds for the Central Universities (both to Dr. Xiang). Dr. Young has served as a consultant to Portage
Pharmaceuticals; and has received grant support through Yale University from Merck Pharmaceuticals. All other authors have
reported that they have no relationships relevant to the contents of this paper to disclose.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’
institutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information,
visit the JACC: Basic to Translational Science author instructions page.

Manuscript received December 11, 2017; revised manuscript received January 15, 2018, accepted January 16, 2018.
352 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

continuous infusion of insulin (regular human insulin levels were measured using an ultrasensitive
insulin, Novo Nordisk, Bagsvaerd, Denmark) was mouse insulin enzyme-linked immunosorbent assay
then initiated and maintained at a constant rate of kit (Crystal Chem, Downers Grove, Illinois).
2.0 mU/kg/min, and a variable rate of 20% dextrose miRNA MIMICS DELIVERY IN VIVO. The mirVanamiR-24
was infused concomitantly. mimic and mimic controls (Life Technologies,
B l o o d m i R N A a n a l y s i s . Blood samples were drawn Waltham, Massachusetts) were complexed with
from consenting volunteers (healthy and DM sub- Invivofectamine 3.0 reagent (Invitrogen, Waltham,
jects) with overnight fasting at Yale University School Massachusetts) to form nanoparticles for in vivo
of Medicine (Human Investigation Committee applications. miRNA oligonucleotides (5 mg/ml in
1005006865). Written informed consent was obtained water, 250 m l) were mixed with manufacturer’s
from all participating individuals. A total of 40 sub- complexation buffer (250 m l), and then Invivofect-
jects with DM (27 T2DM and 13 T1DM, American Dia- amine 3.0 reagent was added (500 m l). After a 30-min
betic Association definition) and 10 healthy control incubation at 50 C, filtration was performed in 15 ml
subjects (HCs) were consecutively recruited for the phosphate-buffered saline to remove excessive salts
studies (Supplemental Table 1). A glucose tolerance and solvents. The final concentration of miRNA oli-
test was utilized to exclude participants with pre- gonucleotides was 1.25 mg/ml and was intravenously
diabetes (impaired glucose tolerance). Platelet-rich delivered to db/db mice at a concentration of 5 mg/kg
plasma (PRP) was prepared from blood by venipunc- body weight. Mice were euthanized 2 weeks after
ture into 3.8% trisodiumcitrate (weight/volume). PRP in vivo delivery for detailed assessment.
was obtained by centrifugation of blood at 250 g
IN VIVO MYOCARDIAL ISCHEMIA AND REPERFUSION.
(or 1,200 revolutions/min) at 25  C for 15 min. Platelet-
WT, db/db, and miR-24-tg mice were anesthetized
poor plasma (PPP) was obtained by centrifugation of
with pentobarbital (60 mg/kg intraperitoneal injec-
the PRP at 1,400 g at 25  C for 10 min (or 1,800 revo-
tion) and subjected to left coronary artery occlusion
lutions/min for 5 min). The supernatant PPP was
for 20 min, followed by 3 h of reperfusion. Hearts
stored at 80 C. PPP was used to determine levels of
were then excised and stained with Evans blue
miR-24 as described in the previous text.
and triphenyl tetrazolium chloride to measure
ANIMALS. All mouse studies were approved by Yale the ischemic area at risk and the area of necrosis
Institutional Animal Care and Use Committee. Wild- (25), respectively. Serum troponin I was measured
type (WT) (C57BL/6J background) and diabetic mice by enzyme-linked immunosorbent assay (Life
(BKS.Cg-Dock7m1/1 Lepr d/b/j) were purchased from Diagnostics, West Chester, Pennsylvania). In separate
The Jackson Laboratory (Farmington, Connecticut). mice, reperfusion was limited to 10 min, and hearts
Streptozotocin (STZ)-induced diabetic mice in the were then removed to study early reperfusion cell
C57BL/6J background were purchased from The signaling.
Jackson Laboratory and were injected with STZ VECTORS, PLASMIDS, AND LUCIFERASE ASSAYS.
(50 mg/kg) intraperitoneally for 5 consecutive days to The human Bcl-2-like protein 11 (BIM) 3ʹUTR
induce recurrent episodes of acute hyperglycemia. (NM_138621, 4216bp), O-GlcNac transferase (OGT)
Four weeks after STZ administration, diabetic mice 3ʹUTR (NM_181672, 2103bp), and autophagy-related
were injected with insulin (lantus), and the whole gene 4a (ATG4a) 3ʹUTR (NM_052936, 959bp) were
hearts were harvested. To generate the Myh6-miR-24 amplified from human genomic DNA by PCR,
mice, a cDNA construct containing a 400-bp mouse confirmed by sequencing, and cloned into the XhoI
genomic region encompassing the miR-24-2 locus was and NotI sites of psiCHECK-2 (Promega, Madison,
cloned downstream of the mouse cardiac myosin Wisconsin). The sequence GAGC in the predicted seed
heavy chain (aMHC/Myh6) promoter. Transgenic sequences of BIM/OGT/ATG4A was mutated to ACTA.
mice were produced by microinjection of the Luciferase assays were performed in 96-well plates.
Myh6-miR-24 construct into fertilized mouse em- 293T cells were cotransfected with the 3ʹ UTR reporter
bryos (C57BL/6 background), as previously described. or the empty control reporter, and a single miRNA
Transgenic mice were identified by polymerase chain construct or an empty construct in each well. After
reaction (PCR) analysis of tail genomic DNA. 2 days, luciferase assays were carried out using the
PLASMA ANALYSIS. Glucose was measured from the Dual-Glo Luciferase kit (Promega) according to the
tail-tip with a glucometer. The total RNA, including manufacturer’s instructions.
miRNAs, was extracted and purified using QIAzol miRNA TRANSFECTION ASSAYS. Transient lipo-
lysis reagent and kits according to the manufacturer’s somal transfection of miRNAs was performed ac-
instructions (Qiagen, Hilden, Germany). Plasma cording to the manufacturers’ instructions. Briefly,
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 353
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

F I G U R E 1 Diabetes Exacerbates Myocardial Infarction and Ischemia/Reperfusion Injury

(A) Comparison of fasting blood glucose levels in diabetic mouse models (n ¼ 10 to 12). (B) Enzyme-linked immunosorbent assay analysis of
fasting plasma insulin levels in diabetic mouse models (n ¼ 8 to 10). (C to E) Comparison of infarct size between wild-type (WT) and db/db
(leptin receptor knockout) mice subjected to ischemia for 20 min and reperfusion for 3 h. (F) Survival curve (log-rank [Mantel-Cox] test) of
WT, streptozotocin (STZ)-induced type 1 diabetes (with or without insulin therapy), and db/db (with or without insulin therapy) subjected to
20 min ligation of left anterior descending coronary artery (LAD) followed by ischemia/reperfusion (I/R) for 4 weeks.

cells were split 1 day before transfection to reach 100 nmol/l). Cells were incubated for 4 h before the
60% to 70% confluence on the day of transfection. media were changed to fresh media. Silencing of
miR-24 mimic (Ambion, Thermo Fisher Scientific, miRNA targets was monitored for 48 h after trans-
Waltham, Massachusetts; Catalog #4464066, mir- fection by quantitative PCR analysis or by Western
Vana, miRNA mimic) and negative control (Ambion) blot analysis.
and Lipofectamine RNAiMAX Transfection Reagent CARDIOMYOCYTE CULTURE AND TREATMENT. Car-
were mixed separately and incubated for 5 min with diomyocytes were isolated from male mice (1 to 2
Opti-MEM I media. Complexes were added together days). In brief, after dissection, hearts were
and incubated for 20 min. Media were changed to washed and minced in 4-(2-hydroxyethyl)-
antibiotic-free media before the addition of 1-piperazineethanesulfonic acid–buffered saline
liposomal/miRNA complexes (final concentration solution. Tissues were then dispersed in a series
354 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

correlation coefficient. All p values <0.05 were

T A B L E 1 Survival in WT and Diabetic Mice Subjected to MI or I/R
considered statistically significant.
1-Week Survival 4-Week Survival

Mice Type MI MI þ Insulin I/R I/R þ Insulin

RESULTS
WT (C57BL/6J) 58% NA 91% 100%
STZ (T1DM) 14%* 63%† 31%‡ 77%§ DIABETES EXACERBATES MYOCARDIAL INFARCTION
Db/db (T2DM) NA NA 69% 25%k AND ISCHEMIA/REPERFUSION INJURY. We initially
applied 2 diabetic mouse models (STZ alone modeling
Survival curves were analyzed using GraphPad Prism 6 (GraphPad Software,
La Jolla, California) (a log-rank [Mantel-Cox] test).*MI, STZ vs. WT, 14% vs. 58%;
insulin deficient T1DM and db/db for T2DM) (Figures 1A
p ¼ 0.0099. †MI, STZ þ insulin vs. STZ, 63% vs. 14%; p < 0.0065. ‡I/R, STZ vs. and 1B, Supplemental Figures 1A to 1D) to perform
WT, 31% vs. 91%; p ¼ 0.0023. §I/R, STZ þ insulin vs. STZ, 31% vs. 77%;
p ¼ 0.0223. kI/R, db/db þ insulin vs. db/db, 25% vs. 69%; p ¼ 0.0241. myocardial I/R surgery (subjected to 20 min ligation of
I/R ¼ ischemia/reperfusion; MI ¼ myocardial infarction; STZ ¼ streptozotocin; left anterior descending coronary artery) followed by
WT ¼ wild-type.
reperfusion for 3 h (for observation of infarct size) or 4
weeks (for observation of survival). The infarct size in
db/db mice had over a 3-fold increase compared with
of incubations at 
37 C in 4-(2-hydroxyethyl)- WT mice (Figures 1C to 1E), consistent with previous
1-piperazineethanesulfonic acid–buffered saline clinical reports of increased morbidity and mortality
solution containing 1.2 mg/ml pancreatin and 0.14 post-myocardial infarction (MI) in diabetes mellitus
mg/ml collagenase. Subsequent supernatants were (1). STZ-induced diabetic mice had significantly
collected and centrifuged at 200 g for 5 min. After decreased survival post-I/R relative to that of WT mice
centrifugation, cells were resuspended in Dulbecco’s (survival 31% vs. 91%; p ¼ 0.0023) (Figure 1F, Table 1).
modified Eagle medium/F-12 (GIBCO, Thermo Fisher) However, insulin infusion significantly increased
containing 5% heat-inactivated horse serum, 0.1 survival post-I/R in STZ-induced diabetic mice
mmol/l ascorbate, insulin-transferring-sodium sele- compared with noninsulin treated mice (survival 77%
nite media supplement, 100 U/ml penicillin, 100 mg/ml vs. 31%; p ¼ 0.0223) (Figure 1F, Table 1, Supplemental
streptomycin, and 0.1 mmol/l bromodeoxyuridine. Figure 1D). In contrast, there was a 45% decrease in
The dissociated cells were pre-plated at 37  C for 1 h. survival post-I/R between insulin- and noninsulin-
The cells were then diluted to 1  10 cells/ml and 6 treated db/db mice (survival 69% vs. 25%; p ¼
plated in 10 mg/ml laminin-coated different 0.0241) (Figure 1F, Table 1, Supplemental Figure 1B).
culture dishes according to the specific experimental These suggest both T1DM and T2DM contributed to
requirements. Isolated cardiomyocytes or H9C2 cells worse outcomes in myocardial ischemia/reperfusion
were transfected with miR-24 mimic (Ambion, (I/R), and the difference in response to insulin therapy
mirVana miRNA mimic) or negative control (Ambion, between them was possibly due to their baseline in-
Catalog #4464066) via Lipofectamine RNAiMAX sulin level and/or insulin sensitivity.
Transfection Reagent. Western Blot will be applied DOWN-REGULATION OF miR-24 BY INSULIN. T1DM
for ATG4a (Abcam ab108322), OGT (CST #5368), is characterized with hyperglycemia plus hypo-
LC3 (Abcam ab51520), O-GlcNAc (CTD110.6 #12938), insulinemia, whereas T2DM (early stage) character-
and BIM (CST #2933). For O-glcNAcylation detection, ized with hyperglycemia plus hyperinsulinemia. To
CTD110.6 antibody was covalently conjugated to assess whether insulin regulates miR-24 levels, we
anti-IgM as described previously (26). performed in vivo insulin infusion clamp studies
STATISTICAL ANALYSES. Statistical analyses were in DM human subjects (Yale Institutional Review
performed using GraphPad Prism 6 (GraphPad Soft- Board–approved protocol). To confirm that insulin
ware, La Jolla, California) and SPSS (IBM, Statistics was being infused, plasma insulin levels were
V22, Armonk, New York). Survival curves were measured as well as progression to hypoglycemia
analyzed using a log-rank (Mantel-Cox) test. Statis- (Figures 2A and 2B). Level of miR-24 decreased
tical differences were assessed with unpaired or despite progressing from hyperglycemia to euglyce-
paired Student’s t test using GraphPad Prism 6. mia (from 0 to 50 min), supporting that the insuli-
Otherwise, statistical significance was determined n infusion rather than glucose levels is the direct
using 1-way analysis of variance followed by cause for the reduction in miR-24 level (Figure 2C). As
Bonferroni’s multiple comparison correction. A 1-way further supporting evidence, in patients with T1DM
analysis of covariance was conducted to compare (where patients are on various forms of exogenous
differences of 3 or more independent groups insulin therapy for low insulin levels) we observed an
while controlling for covariates. Relationships be- inverse correlation between circulating miR-24 and
tween variables were determined by the Pearson plasma levels of insulin (Figure 2D). In a small pilot
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 355
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

F I G U R E 2 Down-Regulation of miR-24 in Response to Insulin Infusion in Human Plasma

Human plasma insulin (A), glucose (B), and miR-24 level (C) response to insulin infusion, normalized to spiked-in cel-miR-238. (D) Correlation of
plasma miR-24 levels with insulin levels in T1DM patients. (E) Comparison of human plasma miR-24 levels in type 1 diabetes mellitus (T1DM)
(n ¼ 13) and type 2 diabetes mellitus (T2DM) (n ¼ 27), normalized to spiked-in cel-miR-238; analysis of covariance was conducted while adjusting
for age and sex. (F) Comparison of human plasma miR-24 levels in healthy subjects (HC) (n ¼ 10) and T2DM without insulin therapy (n ¼ 13) or
with insulin therapy (n ¼ 13), normalized to spiked-in cel-miR-238; analysis of covariance was conducted while adjusting for age and sex.
356 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

study, we observed an intriguing significant reduc- cardiac protection effect in vivo. A time course after
tion in plasma miR-24 levels in T2DM (n ¼ 27) insulin injection in mice followed by cardiomyocyte
compared with T1DM patients (n ¼ 13) (Figure 2E, analysis demonstrated a significant increase in
Supplemental Table 1), despite no significant differ- canonical signaling through Akt phosphorylation at
ences in fasting glucose or HbA1c. Almost one-half of 30 min (post-insulin infusion), which persisted for
T2DM patients were on insulin for glucose control, so approximately 2 h (Supplemental Figure 2A). This
we separated the T2DM patients who took insulin. was associated with phosphorylation of c-Myc
The lowest miR-24 levels were observed in T2DM which peaked at 60 min, and a delayed increase
patients on insulin therapy (Figure 2F, Supplemental in total c-Myc (Supplemental Figure 2B). c-Myc is
Table 1). This suggested that insulin itself (particu- known to be downstream of Akt (31). We have
larly on a high background of insulin/insulin resis- previously demonstrated that c-Myc negatively
tance) may reduce miR-24 plasma level and possibly regulates miR-24 (20).
further affect cardiac miR-24. The important question remained as to the
OVEREXPRESSION OF miR-24 REDUCES CARDIAC molecular mechanism by which miR-24 can protect
DAMAGE AFTER MYOCARDIAL I/R INJURY. To deter- against cardiac damage after myocardial I/R injury.
mine the potential consequences of reduced miR-24 During myocardial reperfusion, the electron
on myocardial function, we first compared the transport chain is reactivated, generating reactive
myocardial infarction size in response to I/R between oxygen species (ROS). Other sources of ROS include
WT and db/db mice (Figure 3A). As mentioned in the xanthine oxidase from endothelial cells and NADPH
previous text, we observed a significantly increased oxidase from neutrophils. Such excessive ROS can
infarct size in diabetic hearts (Figures 1C to 1E). mediate cardiac myocyte damage, apoptosis, and
Remarkably, with systemic injection of miR-24 mimic necrosis. Like other miRNAs, miR-24 has many
into db/db mice (2 weeks prior to I/R), we observed predicted targets, including key proteins involved in
significant restoration of cardiac miR-24 levels myocardial reperfusion pathophysiology. Using both
(Figure 3B) (miR-126 served as a control) and a reduc- TargetScan and miRANDA, we selected potential
tion in infarct size (Figures 3C to 3E). The increase in miR-24 targets that intersected myocardial I/R
infarct size in DM mice (low miR-24) and its rescue by response genes and diabetic response genes
exogenous miR-24 (restoring levels of miR-24) further (Supplemental Figure 3). Four interesting potential
support a myocardial protective role for miR-24. targets were identified: BIM (a pro-apoptosis pro-
Notably, we also observed a significant reduction in tein), OGT (a protein involved in O-GlcNAc transfer)
plasma insulin level and fasting glucose level with (Figure 5A), and ATG4a (a key protein in the auto-
intravenously delivery of miR-24 to db/db mice phagy pathway) (Figure 5B). To confirm direct
(Figures 3F and 3G), which could contribute to the binding, we generated a reporter vector containing
decrease in infarct size in DM mice. a mutant in each 3 0 UTR of OGT, ATG4a and BIM
To demonstrate a cardiac-specific effect, we used a (the sequence GAGC in the predicted seed se-
cardiac-specific miR-24 overexpression mouse model. quences of each 3 0 UTR was mutated to ACTA).
Circulating miR-24 (including nanoparticle-packaged Cotransfection of the miR-24 mimic with these
miR-24) is easily endocytosed by cardiomyocytes constructs in HEK 293T cells markedly decreased
(27). Interestingly, miR-24 inhibits cardiomyocyte the luciferase expression from the WT sequence,
apoptosis (28–30). To clarify cell-autonomous but not each mutant OGT/ATG4A/BIM construct
effects of miR-24 on myocardial function during I/R, (Figure 5C). The addition of miR-24 to car-
we used a Myh6-miR-24 transgenic mouse model diomyocytes significantly decreased the expression
where miR-24 is overexpressed in cardiomyocytes of BIM, OGT, and ATG4A (Figures 5D and 5E, top),
(Figure 4A). In response to I/R injury (Figure 4B), consistent with the bioinformatics analysis and
overexpression of miR-24 in cardiomyocytes previous findings (29) showing direct targeting of
ameliorated the damages caused by myocardial I/R BIM by miR-24. Intriguingly, when cardiomyocytes
compared with littermate controls (Figures 4C to 4E). were overexpressed with miR-24 treated with
The protective effects observed in our transgenic different concentrations of insulin for 1 h, we
mice under myocardial I/R supports an essential observed that miR-24 effectively reversed the
role for miR-24 in reducing myocardial infarct size. insulin-induced up-regulation of OGT in high
miR-24 DOWN-REGULATES MULTIPLE TARGETS TO glucose-cultured cardiomyocytes (Figure 5E, bot-
COORDINATELY PROTECT MYOCARDIUM FROM I/R tom). We further examined the OGT expression
INJURY. We then characterized the molecular and O-GlcNAcylation in mice models we utilized.
signaling from insulin to miR-24 and determined its Both OGT and O-GlcNAcylation in heart lysates
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 357
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

F I G U R E 3 Overexpression of miR-24 Ameliorates Diabetic Ischemia/Reperfusion Injury

(A) Schematic protocol of miR-24 delivery and I/R surgery. (B) Quantitative polymerase chain reaction analysis of miR-24 expression in hearts of
db/db mice treated with mimic control (n ¼ 6) or treated with miR-24 mimic (n ¼ 6) for 2 weeks (normalized to U6). (C) Myocardial infarction size
assessed following in vivo I/R (20 min LAD ligation and 3 h reperfusion) after treatment with miR-24 mimic (5 mg/kg) or scramble control
intravenously, 2 weeks before LAD ligation. Representative images of myocardial tissue slices stained with Evans blue and triphenyl tetrazolium
chloride. (D) Quantitation of infarct risk area. (E) Quantitation of infarct area expressed as percentage of the nonperfused risk area during
coronary occlusion. (F) Enzyme-linked immunosorbent assay analysis of fasting plasma insulin levels in WT and db/db mice with without miR-24
mimic delivery (n ¼ 8 to 10). (G) Fasting plasma glucose levels in db/db mice with without miR-24 mimic delivery (n ¼ 10 to 12) (paired t test).
Abbreviations as in Figure 1.
358 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

F I G U R E 4 Cardiomyocyte-Specific Knock-In miR-24 Ameliorates Ischemia/Reperfusion Injury

(A) Quantitative polymerase chain reaction analysis of miR-24 expression in hearts of WT and transgenic mice [miR-24 tg] (normalized to U6).
(B) Schematic protocol for myocardial I/R surgery. (C) Representative images of WT and transgenic mice myocardial tissue slices stained with
Evans blue and triphenyl tetrazolium chloride. (D) Quantitation of infarct risk area. (E) Quantitation of infarct area expressed as percentage of
the nonperfused risk area during coronary occlusion. Abbreviations as in Figure 1.

were remarkably reduced when overexpression of DISCUSSION

miR-24 with either genetic (miR-24 tg) or pharma-
cological approaches (miR-24 mimic delivery CARDIOPROTECTION OR CARDIOTOXICITY ASSOCIATED
in vivo) (Figure 5F). Taken together, these data WITH INSULIN THERAPY. Our studies help explain
further support that OGT, ATG4A, and BIM are some of the longstanding conundrum of why inten-
direct targets of miR-24, all of which contribute to sive glucose control does not appear to improve
myocardial I/R injury. cardiovascular morbidity and mortality in patients
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 359
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

F I G U R E 5 miR-24 Regulates OGT and ATG4A to Play Cardioprotective Effects

Sequence alignment of miR-24 targeting sites on OGT (A) and ATG4A (B) 3ʹUTR among mammals based on the Targetscan database
information. (C) miR-24 inhibited luciferase activity of WT 3ʹUTR of OGT, ATG4A, and BIM, but exhibited no effect on luciferase activity of
each mutant 3ʹUTR. The assays were performed in triplicate from 3 independent experiments. (D) The change in intracellular miR-24 levels
when cardiomyocytes were transfected with miR-24 mimics and performed in triplicate from 3 independent experiments. (E) (Top)
Representative Western blot analyses of OGT, ATG4A, and BIM expression in response to miR-24 overexpression in cardiomyocytes,
normalized to HSP90 and actin. (Bottom) Cardiomyocytes were transfected with miR-24 mimic (Ambion mirVana miRNA mimic) or negative
control via Lipofectamine RNAiMAX Transfection Reagent. A total of 48 h after transfection, cells were treated with 100 nmol/l insulin for
another 1 h before harvested. The expression of OGT was analyzed by western blot. (F) OGT expression and O-GlcNAcylation of heart lysates
from WT mice or mice with cardiomyocyte-specific overexpression of miR-24, and heart lysates from in db/db mice with control or miR-24
mimic (Life Technologies, 5 mg/kg) delivery. Abbreviations as in Figure 1.
360 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

with T2DM. Our data suggests that insulin therapy on

F I G U R E 6 miR-24 Overexpression Ameliorates Diabetic
a background of higher insulin levels may lead to Ischemia/Reperfusion Injury
reduced myocardial protection through a reduction of
miR-24. A significant percentage of T2DM patients
receive exogenous insulin injections despite already
having high baseline levels in the context of insulin
resistance. However, the mechanism underlying
intensive insulin therapy–induced cardiac injury in
T2DM remained unclear. Nolan et al. (32) proposed
insulin resistance as a physiological defense against
metabolic stress in T2DM. High doses of exogenous
insulin therapy promote excess glucose uptake and
glucolipotoxicity, resulting in increased ROS genera-
tion and toxic lipid accumulation that contributes
to cardiac injury. We previously reported hypergly-
cemia repression of miR-24 through activation of
aldose reductase and ROS production (20). Here, we
found that short-term insulin injection decreased
miR-24 in diabetic mice hearts, and intensive insulin
injection also decreased miR-24 in the plasma of
T1DM patients (Figure 2C). Our combined data sup-
ports that excessive insulin leads to reduced miR-24
levels, which acts as a key factor in myocardial
dysfunction associated with myocardial infarction
in DM. Apart from insulin therapy, whether other
antidiabetic agents such as DDP4i (33) and GLP1RA
(34) also affect miR-24 levels remains largely
unknown.
miR-24 TARGETS AND CARDIOVASCULAR DISEASE.
miR-24 has multiple targets in cardiomyocytes (29), We observed an increase in mortality post-myocardial infarction
or ischemia/reperfusion (I/R) in type 2 diabetic mice. We also
endothelial cells (28), and macrophages (35), all of
found a reduction of plasma and heart miR-24 levels in diabetic
which are involved in diabetic cardiac complications. mice. Systemic enrichment of miR-24 in db/db mice or
In the heart, miR-24 has been reported to target BIM cardiomyocyte-specific overexpression of miR-24 in wild-
and junctophilin-2 in cardiomyocytes, and targeting type (WT) mice significantly reduced myocardial infarct size

transcription factor GATA2, p21-activated kinase and alleviated cardiac injury. The possible mechanism underly-
ing miR-24–based therapeutics in diabetic I/R may involve
PAK4, and eNOS in endothelial cells (36). In the
O-GlcNac transferase (OGT)–mediated heart protein
vascular system, miR-24 was found to target chitinase O-GlcNAcylation, autophagy-related gene 4a (ATG4A)–mediated
3-like 1 to limit vascular inflammation and matrix autophagy, and Bcl-2-like protein 11 (BIM)–mediated apoptosis.
metalloproteinase-14 in macrophage to retard
atherosclerotic plaque progression (35). Apart from
the reported targets of miR-24, bioinformatics also
predicts other targets, some of which are validated deletion of OGT exacerbates heart failure, although
in vitro in the present study, including O-GlcNAc cardiac-specific ablation of OGT had no effect on
transferase (OGT). In diabetic hearts, O-GlcNAc levels infarct size (24 h) and survival (4 weeks) (42). Thus,
are increased and removal of O-GlcNAcylation re- we suggest that fine-tuning of microRNA-mediated
stores Ca2þ handling in diabetic hearts (37–39), sug- repression of OGT and O-GlcNAcylation is indispens-
gesting that targeting OGT represents a new possible able for cardiac function. Our findings support a novel
strategy for treating diabetic cardiomyopathy. mechanism for the cardiovascular outcome when
Although increased O-GlcNAcylation is directly linked chronic hyperglycemia (detrimentally increased
to hyperglycemia-induced glucose toxicity (40) and O-GlcNAcylation) encounters acute myocardial I/R
insulin resistance (26), O-GlcNAcylation has been (beneficially increased O-GlcNAcylation). Interest-
reported to contribute to cardioprotection against ingly, miR-24 is also highly expressed in beta cells,
I/R in WT mice (41). In addition, cardiac-specific which requires further exploration.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Wang et al. 361
JUNE 2018:350–62 Diabetes Exacerbates Myocardial I/R by miR-24

CONCLUSIONS cardiovascular disease reported in T2DM patients

(46). However, based on our current and recent
We have previously demonstrated that high glucose findings that decreased miR-24 in diabetes increases
levels can also reduce miR-24 from the endothelium the risk of diabetic thrombotic and vascular compli-
predisposing to thrombosis (20). Together, high cations, miR-24 enrichment therapy may be an
glucose and high insulin, as observed most dramati- appealing adjunct therapy for patients with diabetes
cally in T2DM, lead to a severe reduction in miR-24 who are at particular cardiac risk. Although the cell-
level and an enlarged infarct through promoting specific delivery, dosage, and timing for delivery are
apoptosis and excessive O-GlcNAcylation (Figure 6). the important factors for consideration, the use of
Our data suggest that overload insulin is detrimental miR-24 mimics to diabetic cardiomyopathy and
to myocardial function through reducing the protec- thrombosis may offer exciting new therapeutic
tive miR-24, particularly because the heart is nor- opportunities.
mally one of the highest producers of miR-24. There
ACKNOWLEDGMENTS The authors thank Robert
is strong evidence that patients with an AMI and
Sherwin and Silvio Inzucchi for their support in
increasingly high glucose levels have increased mor-
recruiting the patients; Dr. Yi-Han Chen for support in
tality at both 30 days and 1 year (43). This can be
clinical studies and animal experiments; and
attributed to both the hyperglycemia and insulin
Drs. Shengxian Li and Jijun Cheng for comments on
therapies in addition to other factors.
the manuscript.
CLINICAL PERSPECTIVES
ADDRESS FOR CORRESPONDENCE: Dr. Yaozu Xiang
Our data presented here pose a therapeutic dilemma OR Dr. Li Qian OR Dr. John Hwa, Advanced Institute of
as well as its possible solution: if insulin therapy is Translational Medicine, School of Life Sciences and
potentially detrimental to cardiac outcomes, as data Technology, Tongji University, 1239 Siping Road, Shanghai
from our group and others suggest (32,44), then how 20092, China. E-mail: [email protected] OR
can we approach T2DM patients with hyperglycemia [email protected] OR [email protected].
not controlled by standard oral therapy? Although 1
analysis of the ACCORD (Action to Control Cardio-
vascular Risk in Diabetes) trial does not support that PERSPECTIVES
insulin dose contributed to cardiovascular mortality
(45), our results demonstrate that type of insulin
COMPETENCY IN MEDICAL KNOWLEDGE: Insulin infusion
infusion affects survival post-myocardial I/R in
decreased miR-24 levels in patients and survival post-myocardial
type 2 diabetic mice. Although most pharmacological
I/R in diabetic mice. Overexpression of miR-24 in murine hearts
agents used in the treatment of T2DM are geared
significantly reduced myocardial infarct size.
toward increasing endogenous insulin production,
only a small number enhance insulin sensitivity or
TRANSLATIONAL OUTLOOK: Given that miRNA inhibitors
result in a lowering of circulating insulin levels.
(e.g., miR-122 and -34) are already in clinical trials, the present
Those agents include metformin, thiazolidinediones,
study motivates advanced clinical testing of miR-24 mimic
and SGLT2 inhibitors. It is intriguing to speculate
therapeutics in diabetic cardiomyopathy and MI.
that miR-24 may play an important role in the hereto
unexplained large benefit of empagliflozin on

REFERENCES

1. Nathan DM. Diabetes: advances in diagnosis and 4. Nathan DM, Cleary PA, Backlund JY, et al. outcomes in type 2 diabetes. N Engl J Med 2015;
treatment. JAMA 2015;314:1052–62. Intensive diabetes treatment and cardiovascular 372:2197–206.
disease in patients with type 1 diabetes. N Engl J
2. Preis SR, Pencina MJ, Hwang SJ, et al. Trends in 7. Group AC, Patel A, MacMahon S, et al. Intensive
Med 2005;353:2643–53.
cardiovascular disease risk factors in individuals blood glucose control and vascular outcomes in
with and without diabetes mellitus in the Framing- 5. Holman RR, Paul SK, Bethel MA, Matthews DR, patients with type 2 diabetes. N Engl J Med 2008;
ham Heart Study. Circulation 2009;120:212–20. Neil HA. 10-year follow-up of intensive glucose 358:2560–72.
control in type 2 diabetes. N Engl J Med 2008;
3. Di Angelantonio E, Kaptoge S, Wormser D, 8. Gerstein HC, Miller ME, Ismail-Beigi F, et al., for
359:1577–89.
et al., for the Emerging Risk Factors Collaboration. the ACCORD Study Group. Effects of intensive
Association of cardiometabolic multimorbidity 6. Hayward RA, Reaven PD, Wiitala WL, et al. glucose lowering in type 2 diabetes. N Engl J Med
with mortality. JAMA 2015;314:52–60. Follow-up of glycemic control and cardiovascular 2008;358:2545–59.
362 Wang et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Diabetes Exacerbates Myocardial I/R by miR-24 JUNE 2018:350–62

9. Gerstein HC, Miller ME, Ismail-Beigi F, et al. and non-insulin-treated diabetic patients: results 36. Boon RA, Dimmeler S. MicroRNAs in myocar-
Effects of intensive glycaemic control on ischae- from the FREEDOM trial. J Am Coll Cardiol 2014; dial infarction. Nat Rev Cardiol 2015;12:135–42.
mic heart disease: analysis of data from the 64:1189–97.
37. Ramirez-Correa GA, Ma J, Slawson C, et al.
randomised, controlled ACCORD trial. Lancet
24. Page KA, Williamson A, Yu N, et al. Medium- Removal of abnormal myofilament O-GlcNAcyla-
2014;384:1936–41.
chain fatty acids improve cognitive function in tion restores Ca2þ sensitivity in diabetic cardiac
10. Lago RM, Singh PP, Nesto RW. Congestive intensively treated type 1 diabetic patients and muscle. Diabetes 2015;64:3573–87.
heart failure and cardiovascular death in patients support in vitro synaptic transmission during acute 38. Hu Y, Belke D, Suarez J, et al. Adenovirus-
with prediabetes and type 2 diabetes given thia- hypoglycemia. Diabetes 2009;58:1237–44. mediated overexpression of O-GlcNAcase im-
zolidinediones: a meta-analysis of randomised
25. Miller EJ, Li J, Leng L, et al. Macrophage proves contractile function in the diabetic heart.
clinical trials. Lancet 2007;370:1129–36.
migration inhibitory factor stimulates AMP- Circ Res 2005;96:1006–13.
11. McMurray JJ, Gerstein HC, Holman RR, activated protein kinase in the ischaemic heart. 39. Erickson JR, Pereira L, Wang L, et al. Diabetic
Pfeffer MA. Heart failure: a cardiovascular Nature 2008;451:578–82. hyperglycaemia activates CaMKII and arrhythmias
outcome in diabetes that can no longer be
26. Yang X, Ongusaha PP, Miles PD, et al. Phos- by O-linked glycosylation. Nature 2013;502:
ignored. Lancet Diabetes Endocrinol 2014;2:
phoinositide signalling links O-GlcNAc transferase 372–6.
843–51.
to insulin resistance. Nature 2008;451:964–9. 40. Liu K, Paterson AJ, Chin E, Kudlow JE. Glucose
12. Committee ASGW. The ACCORD Study Group.
stimulates protein modification by O-linked
Nine-year effects of 3.7 years of intensive glyce- 27. Fiedler J, Jazbutyte V, Kirchmaier BC, et al.
GlcNAc in pancreatic beta cells: linkage of
mic control on cardiovascular outcomes. Diabetes MicroRNA-24 regulates vascularity after myocar-
O-linked GlcNAc to beta cell death. Proc Natl Acad
Care 2016;39:701–8. dial infarction. Circulation 2011;124:720–30.
Sci U S A 2000;97:2820–5.
13. Zoungas S, Chalmers J, Neal B, et al. Follow-up 28. Meloni M, Marchetti M, Garner K, et al. Local
41. Wang ZV, Deng Y, Gao N, et al. Spliced X-box
of blood-pressure lowering and glucose control in inhibition of microRNA-24 improves reparative
binding protein 1 couples the unfolded protein
type 2 diabetes. N Engl J Med 2014;371:1392–406. angiogenesis and left ventricle remodeling and
response to hexosamine biosynthetic pathway.
function in mice with myocardial infarction. Mol
14. Guay C, Regazzi R. Circulating microRNAs as Cell 2014;156:1179–92.
Ther 2013;21:1390–402.
novel biomarkers for diabetes mellitus. Nat Rev
42. Watson LJ, Facundo HT, Ngoh GA, et al.
Endocrinol 2013;9:513–21. 29. Qian L, Van Laake LW, Huang Y, Liu S,
O-linked beta-N-acetylglucosamine transferase is
Wendland MF, Srivastava D. miR-24 inhibits
15. Poy MN, Eliasson L, Krutzfeldt J, et al. indispensable in the failing heart. Proc Natl Acad
apoptosis and represses Bim in mouse car-
A pancreatic islet-specific microRNA regulates in- Sci U S A 2010;107:17797–802.
diomyocytes. J Exp Med 2011;208:549–60.
sulin secretion. Nature 2004;432:226–30.
43. Kosiborod M, Rathore SS, Inzucchi SE, et al.
16. Trajkovski M, Hausser J, Soutschek J, et al. 30. Guo C, Deng Y, Liu J, Qian L. Cardiomyocyte- Admission glucose and mortality in elderly pa-
MicroRNAs 103 and 107 regulate insulin sensi- specific role of miR-24 in promoting cell survival. tients hospitalized with acute myocardial infarc-
tivity. Nature 2011;474:649–53. J Cell Mol Med 2015;19:103–12. tion: implications for patients with and without
recognized diabetes. Circulation 2005;111:
17. Kornfeld JW, Baitzel C, Konner AC, et al. 31. Zhu J, Blenis J, Yuan J. Activation of PI3K/Akt
3078–86.
Obesity-induced overexpression of miR-802 im- and MAPK pathways regulates Myc-mediated
pairs glucose metabolism through silencing of transcription by phosphorylating and promoting 44. Khunti K, Davies M, Majeed A, Thorsted BL,
Hnf1b. Nature 2013;494:111–5. the degradation of Mad1. Proc Natl Acad Sci U S A Wolden ML, Paul SK. Hypoglycemia and risk of
2008;105:6584–9. cardiovascular disease and all-cause mortality in
18. Belgardt BF, Ahmed K, Spranger M, et al. The
insulin-treated people with type 1 and type 2
microRNA-200 family regulates pancreatic beta 32. Nolan CJ, Ruderman NB, Kahn SE, Pedersen O,
diabetes: a cohort study. Diabetes Care 2015;38:
cell survival in type 2 diabetes. Nat Med 2015;21: Prentki M. Insulin resistance as a physiological
316–22.
619–27. defense against metabolic stress: implications for
the management of subsets of type 2 diabetes. 45. Siraj ES, Rubin DJ, Riddle MC, et al. Insulin
19. Bartel DP. MicroRNAs: genomics, biogenesis,
Diabetes 2015;64:673–86. dose and cardiovascular mortality in the ACCORD
mechanism, and function. Cell 2004;116:281–97.
Trial. Diabetes Care 2015;38:2000–8.
20. Xiang Y, Cheng J, Wang D, et al. Hyperglyce- 33. Kanasaki K, Shi S, Kanasaki M, et al.
46. Zinman B, Wanner C, Lachin JM, et al., for
mia repression of miR-24 coordinately upregulates Linagliptin-mediated DPP-4 inhibition ameliorates
the EMPA-REG OUTCOME Investigators. Empa-
endothelial cell expression and secretion of von kidney fibrosis in streptozotocin-induced diabetic
gliflozin, cardiovascular outcomes, and mortality
Willebrand factor. Blood 2015;125:3377–87. mice by inhibiting endothelial-to-mesenchymal
in type 2 diabetes. N Engl J Med 2015;373:
transition in a therapeutic regimen. Diabetes
21. Group BDS, Frye RL, August P, et al. 2117–28.
2014;63:2120–31.
A randomized trial of therapies for type 2 diabetes
and coronary artery disease. N Engl J Med 2009; 34. Shang J, Li J, Keller MP, et al. Induction of
360:2503–15. miR-132 and miR-212 expression by glucagon-like
KEY WORDS hyperinsulinemia, infarct size,
22. Holzmann MJ, Rathsman B, Eliasson B, et al. peptide 1 (GLP-1) in rodent and human pancre-
microRNA, O-GlcNAcylation
Long-term prognosis in patients with type 1 and 2 atic beta-cells. Mol Endocrinol 2015;29:1243–53.
diabetes mellitus after coronary artery bypass
35. Maegdefessel L, Spin JM, Raaz U, et al. miR-24
grafting. J Am Coll Cardiol 2015;65:1644–52.
limits aortic vascular inflammation and murine A PPE NDI X For a supplemental table and
23. Dangas GD, Farkouh ME, Sleeper LA, et al. abdominal aneurysm development. Nat Commun figures, please see the online version of this
Long-term outcome of PCI versus CABG in insulin 2014;5:5214. paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

EDITORIAL COMMENT

MicroRNA-24 and the Diabetic Heart*

Marieke Rienks, MD, PHD, Abhishek Joshi, BA, MBCHB, MD, Manuel Mayr, MD, PHD

P atients with diabetes are at risk of vascular

complications, leading to cardiovascular,
renal, and neurological disease. In this issue
of JACC: Basic to Translational Science, Wang et al.
approach, as large studies found benefits and poten-
tial harm associated with these strategies (4). The
higher mortality and complication rates in T2D pa-
tients are multifactorial and probably related to the
(1) suggest that impaired infarct healing in duration of glycemic dysregulation. Why do T2D pa-
diabetics results from a hyperinsulinemia- and tients treated with insulin fail to show an improved
hyperglycemia-induced down-regulation of microri- clinical outcome?
bonucleic acid (microRNA, miRNA)-24 (miR-24). The Wang et al. (1) suggest that insulin therapy, added
authors ascribe the protective effect of miR-24 to to higher baseline insulin levels reduces miR-24
repression of protein targets involved in apoptosis, levels, with adverse effects after ischemic injury.
autophagy, and protein O-GlcNAcylation. Raising According to the authors, this may, at least in part,
miR-24 is proposed as a potential therapeutic explain the lack of therapeutic efficacy of insulin
approach for improving post-infarct healing in pa- treatment in T2D patients post-MI.
tients with type 2 diabetes (T2D). A strength of this study is the use of 2 murine
models, one akin to T2D and type 1 diabetes (T1D).
SEE PAGE 350
Although insulin use increased mortality post-MI in
In contrast with the absence of a preventative db/db mice (T2D), insulin use decreased mortality in
benefit of intense glucose control in a primary pre- mice treated with streptozotocin (T1D). Wang et al.
vention setting (2), incident acute myocardial infarc- demonstrate a reduction in infarct size after
tion (MI) in diabetic patients is associated with ischemia reperfusion in db/db mice after systemic
increased subsequent heart failure and mortality (3), administration of nanoparticles containing miR-24
both during initial hospitalization and long-term as well as in transgenic mice that have
follow-up. However, early enthusiasm for intensive cardiomyocyte-specific overexpression of miR-24.
insulin treatment has given way to an agnostic O-GlcNAc transferase, Bcl-2-like protein 11, and
autophagy-related 4A cysteine peptidase are the
proposed targets of miR-24 responsible (Figure 1).
Similar to most miRNAs, miR-24 is ubiquitously
*Editorials published in JACC: Basic to Translational Science reflect the expressed (5). Qian et al. (6) have previously shown
views of the authors and do not necessarily represent the views of JACC:
that in vivo administration of miR-24 nanoparticles
Basic to Translational Science or the American College of Cardiology.
inhibited cardiomyocyte apoptosis in a mouse
From the King’s British Heart Foundation Centre, King’s College London,
model of MI, thereby attenuating infarct size and
London, United Kingdom. Dr. Joshi is a British Heart Foundation (BHF)
Clinical Research training fellow (FS/16/32/32184). Dr. Mayr is a BHF Chair
reducing cardiac dysfunction by directly acting on
Holder (CH/16/3/32406) with BHF program grant support (RG/16/14/ Bcl-2-like protein 11.
32397) and member of a network on “MicroRNA-based Therapeutic MiR-24 is also part of a pri-miR cluster, together
Strategies in Vascular Disease” funded by the Fondation Leducq; and he
with miR-23 and miR-27 (7). Increased expression
is named as an inventor on patents related to microRNA biomarkers in
cardiometabolic disease. All other authors have reported that they have
of miR-24 but also of miR-27b has been associated
no relationships relevant to the contents of this paper to disclose. with cardiac dysfunction (8,9). Previously, the au-
All authors attest they are in compliance with human studies committees thors reported that hyperglycemia represses miR-24
and animal welfare regulations of the authors’ institutions and Food and
in endothelial cells. Reduced miR-24 was associ-
Drug Administration guidelines, including patient consent where
appropriate. For more information, visit the JACC: Basic to Translational ated with increased von Willebrand factor secretion
Science author instructions page. by endothelial cells (10). Notably, Fiedler et al. (11)

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.05.002

364 Rienks et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

miR-24 and the Diabetic Heart JUNE 2018:363–5

F I G U R E 1 MiR-24 and the Diabetic Heart

The infarct size after ischemia-reperfusion is reduced in a mouse model of type 2 diabetes upon microribonucleic acid 24 (miR-24) overexpression. O-GlcNAc transferase
(OGT), Bcl-2-like protein 11 (BIM), and autophagy-related 4A cysteine peptidase (ATG4A) are proposed as targets of miR-24. Insulin treatment reduced mortality in a
mouse model of type 1 diabetes, but not type 2 diabetes. The observed plasma changes in miR-24 may not be connected to myocardial tissue.

revealed that miR-24 is up-regulated after MI and especially as the plasma isolation protocol in Wang
enriched in cardiac endothelial cells under normo- et al. does not prevent pre-analytic platelet acti-
glycemia. Blocking endothelial miR-24 using anta- vation (16). The rapid reduction of plasma miR-24
gomirs limited infarct size by preventing seen in Wang et al.’s glucose clamp experiment
endothelial cell apoptosis and enhancing vascu- supports this suggestion; as insulin levels increase,
larity (6). Thus, miR-24 appears to affect both platelet reactivity is reduced and platelet “poor”
endothelial cells and cardiomyocytes, with opposite plasma subsequently demonstrates reduced miR-24
outcomes in post-MI remodeling levels (17).
Wang et al. further demonstrate a decrease in Although it would be an oversimplification to
miR-24 in response to hyperinsulinemia in a clamp attribute myocardial dysfunction after MI in T2D to
study in 5 T1D patients. A significant decrease in the dysregulation of an individual miRNA such as
miR-24 levels was observed in the plasma of T2D miR-24, the study by Wang et al. emphasizes the
compared with T1D patients. We have recently significance of miR-24 in the ischemic diabetic heart
identified miR-24 as an abundant miRNA in plate- (Figure 1). Also, the proposed role for circulating
lets. Its plasma levels are reduced by antiplatelet miRNAs such as miR-24 in the pathophysiology of
therapy (12). Diabetics are known to have increased infarct healing in diabetics in relation to insulin
platelet reactivity (13). Reduced platelet miRNAs, sensitivity and production as demonstrated by this
including miR-24, were among the predominant study encourages further exploration.
changes in circulating miRNAs in patients with T2D
(14,15). Insulin antagonizes platelet activation, but
platelets from T2D are less sensitive to this effect ADDRESS FOR CORRESPONDENCE: Dr. Manuel Mayr,
due to their insulin resistance (15). Therefore, dif- King’s British Heart Foundation Centre, King’s Col-
ferential miR-24 detection in the plasma of T2D lege London, 125 Coldharbour Lane, London SE5 9NU,
may reflect differential platelet reactivity, United Kingdom. E-mail: [email protected].

REFERENCES

1. Wang D, Hu X, Lee SH, et al. Diabetes exacer- 3. Ertl G, Frantz S. Healing after myocardial 6. Qian L, Van Laake LW, Huang Y, Liu S,
bates myocardial ischemia/reperfusion injury by infarction. Cardiovasc Res 2005;66:22–32. Wendland MF, Srivastava D. miR-24 inhibits
down-regulation of microRNA and up-regulation 4. Malmberg K, Ryden L, Wedel H, et al. Intense apoptosis and represses Bim in mouse car-
of O-GlcNAcylation. J Am Coll Cardiol Basic metabolic control by means of insulin in patients diomyocytes. J Exp Med 2011;208:549–60.
Trans Science 2018;3:350–62. with diabetes mellitus and acute myocardial
infarction (DIGAMI 2): effects on mortality and 7. Li RC, Tao J, Guo YB, et al. In vivo sup-
2. Stratton IM, Adler AI, Neil HA, et al. Association of morbidity. Eur Heart J 2005;26:650–61. pression of microRNA-24 prevents the transi-
glycaemia with macrovascular and microvascular 5. Barwari T, Joshi A, Mayr M. MicroRNAs in car- tion toward decompensated hypertrophy in
complications of type 2 diabetes (UKPDS 35): pro- diovascular disease. J Am Coll Cardiol 2016;68: aortic-constricted mice. Circ Res 2013;112:
spective observational study. BMJ 2000;321:405–12. 2577–84. 601–5.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Rienks et al. 365
JUNE 2018:363–5 miR-24 and the Diabetic Heart

8. Xu M, Wu HD, Li RC, et al. Mir-24 regulates 12. Willeit P, Zampetaki A, Dudek K, et al. 15. Zampetaki A, Kiechl S, Drozdov I, et al. Plasma
junctophilin-2 expression in cardiomyocytes. Circ Circulating microRNAs as novel biomarkers for microRNA profiling reveals loss of endothelial
Res 2012;111:837–41. platelet activation. Circ Res 2013;112: miR-126 and other microRNAs in type 2 diabetes.
595–600. Circ Res 2010;107:810–7.
9. Wang J, Song Y, Zhang Y, et al. Cardiomyocyte
overexpression of miR-27b induces cardiac hypertro- 16. Randriamboavonjy V, Fleming I. Insulin, insulin
13. Keating FK, Sobel BE, Schneider DJ. Effects of
phy and dysfunction in mice. Cell Res 2012;22:516–27. resistance, and platelet signaling in diabetes.
increased concentrations of glucose on platelet
reactivity in healthy subjects and in patients with Diabetes Care 2009;32:528–30.
10. Xiang Y, Cheng J, Wang D, et al. Hyperglyce-
mia repression of miR-24 coordinately upregulates and without diabetes mellitus. Am J Cardiol 2003; 17. Sunderland N, Skroblin P, Barwari T, et al.
endothelial cell expression and secretion of von 92:1362–5. MicroRNA biomarkers and platelet reactivity: the
Willebrand factor. Blood 2015;125:3377–87. clot thickens. Circ Res 2017;120:418–35.
14. Kaudewitz D, Skroblin P, Bender LH,
11. Fiedler J, Jazbutyte V, Kirchmaier BC, et al. et al. Association of MicroRNAs and YRNAs
MicroRNA-24 regulates vascularity after myocar- with platelet function. Circ Res 2016;118: KEY WORDS diabetes, microRNAs, myocardial
dial infarction. Circulation 2011;124:720–30. 420–32. infarction
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY LICENSE (http://creativecommons.org/licenses/by/4.0/).

PRECLINICAL RESEARCH

L-PhenylalanineRestores Vascular
Function in Spontaneously Hypertensive
Rats Through Activation of the
GCH1-GFRP Complex
Lamia Heikal, PHD,a Anna Starr, PHD,a Dania Hussein, PHD,a Jesus Prieto-Lloret, PHD,b Phil Aaronson, PHD,b
Lea Ann Dailey, PHD,a Manasi Nandi, PHDa,c

VISUAL ABSTRACT
HIGHLIGHTS

Tetrahydrobiopterin is an essential
cofactor for NO production.

Limitation of endogenous
tetrahydrobiopterin reduces NO
bioavailability, enhances oxidative stress,
and impairs vascular function.

Orally supplemented tetrahydrobiopterin
has therapeutic challenges because it is
rapidly oxidized in vivo.

Here, the authors demonstrate that
L-phenylalanine, when administered orally,
raises vascular tetrahydrobiopterin,
restores NO, reduces superoxide, and
enhances vascular function in
spontaneously hypertensive rats.

This effect is achieved by activation of a
protein complex (GCH1-GFRP) involved in
the biosynthesis of tetrahydrobiopterin.

Activation of this protein complex by
L -phenylalanine or its analogues
represents a novel therapeutic target for
vascular disorders underpinned by
Heikal, L. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):366–77.
reduced NO bioavailability.

From the aInstitute of Pharmaceutical Sciences, Faculty of Life Sciences and Medicine, King’s College London, London, United
Kingdom; bDivision of Asthma, Faculty of Life Sciences and Medicine, King’s College London, London, United Kingdom; and the
c
Cardiovascular Division, Faculty of Life Sciences and Medicine, King’s College London, London, United Kingdom. The work was
funded by The Maplethorpe Trust Fellowship and British Heart Foundation PG/09/073. The authors have reported that they have
no relationships relevant to the contents of this paper to disclose.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’ in-
stitutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information, visit
the JACC: Basic to Translational Science author instructions page.

Manuscript received August 8, 2017; revised manuscript received October 27, 2017, accepted January 24, 2018.

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.01.015

JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 367
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

ABBREVIATIONS
SUMMARY
AND ACRONYMS

Reduced nitric oxide (NO) bioavailability correlates with impaired cardiovascular function. NO is extremely labile ACh = acetylcholine

and has been challenging to develop as a therapeutic agent. However, NO bioavailability could be enhanced by ANOVA = analysis of variance
pharmacologically targeting endogenous NO regulatory pathways. Tetrahydrobiopterin, an essential cofactor BH2 = dihydrobiopterin
for NO production, is synthesized by GTP cyclohydrolase-1 (GCH1), which complexes with GCH1 feedback BH4 = tetrahydrobiopterin
regulatory protein (GFRP). The dietary amino acid L-phenylalanine activates this complex, elevating vascular
EC50 = effective concentration
BH4. Here, the authors demonstrate that L-phenylalanine administration restores vascular function in a rodent for 50% maximal response
model of hypertension, suggesting the GCH1-GFRP complex represents a rational therapeutic target for dis- EDHF = endothelium derived
eases underpinned by endothelial dysfunction. (J Am Coll Cardiol Basic Trans Science 2018;3:366–77) hyperpolarizing factor

© 2018 The Authors. Published by Elsevier on behalf of the American College of Cardiology Foundation. eNOS = endothelial nitric

This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). oxide synthase

GCH1 = GTP cyclohydrolase-1

C
GFRP = GCH1 feedback
regulatory protein
ardiovascular diseases pose a considerable attenuated in patients with a loss-of-function
L-phe = L-phenylalanine
societal and economic burden on health GCH1 mutation (23). Targeting endogenous
L-tyr = L-tyrosine
care systems (1). Such diseases are usually BH 4 biosynthesis, by activating the GCH1-
associated with functional and structural changes GFRP axis pharmacologically, thus repre- NO = nitric oxide

within the vascular network as well as concomitant sents a method to enhance vascular BH4 ROS = reactive oxygen species

increases in oxidative stress (2). Endothelial dysfunc- levels at the level of the endothelium, cir- SHR = spontaneously
hypertensive rat(s)
tion is characterized by impaired vasodilation, cumventing the poor bioavailability
mainly due to loss of nitric oxide (NO) signaling following oral BH 4 administration (14,24). WKY = Wistar Kyoto rat(s)

(3,4). NO biosynthesis in the vasculature is primarily To support this hypothesis, it is known the GCH1-
catalyzed by endothelial nitric oxide synthase (eNOS) GFRP axis regulates BH 4 and NO in endothelial cells
(5), and tetrahydrobiopterin (BH 4) is an essential (25). Overexpression of GFRP reduces basal BH4 levels
cofactor for all 3 isoforms of NOS (6,7). When BH 4 (26) and attenuates the rise in BH 4 and NO that occurs
bioavailability is limited, NOS may become in response to a proinflammatory stimulus (27).
“uncoupled,” producing superoxide at the expense Additionally, the primary source of BH 4 appears to be
of NO, thereby potentiating oxidative stress (8). derived from GCH1 localized within the vascular
Thus, raising endothelial BH4 levels has been sug- endothelium, and GFRP is coexpressed within these
gested as a strategy to maintain healthy NO produc- cells (28,29). Finally, oral L-phe elicits a rise in
tion and bioavailability at the level of the vascular BH4 —an effect that is absent in mice lacking
endothelium (9,10). To support this, intra-arterial endothelial GCH1 (24).
administration of BH 4 improves endothelial dysfunc- The GCH1-GFRP axis thus ensures that BH 4 levels
tion in patients with hypertension (11), coronary ar- are kept within a tight physiological range. However,
tery disease (12), and hypercholesterolemia (13). the crucial mechanistic link between GCH1-GFRP
However, due to its unstable nature, orally adminis- activation by L-phe, the concomitant rise in BH 4 and
tered BH4 (or its analogue sapropterin) has limited ef- its potential impact on NO and vascular function is
ficacy in improving vascular hemodynamics (14–16). lacking. The aim of this study was to determine
Therefore, other strategies to raise endogenous BH4 whether L-phe raises vascular BH 4 levels by acti-
bioavailability at the level of the endothelium are vating the GCH1-GFRP complex in vivo and improves
desirable. endothelial function in an animal model of essential
BH 4 is synthesized from GTP in a reaction where hypertension.
the committing step is mediated by GTP
cyclohydrolase-1 (GCH1) (17). Modulation of GCH1 METHODS
expression has been shown to regulate BH 4 , NO, and
cardiovascular function (18–20). GCH1 is subject to Further details of all assays can be found in the
feed-forward regulation by L -phenylalanine (L-phe), Supplemental Methods.
via an allosteric protein interaction with GCH1 feed- EFFECT OF L-PHE ON RECOMBINANTLY EXPRESSED
back regulatory protein (GFRP) (21,22). This GCH1- GCH-1 ACTIVITY. A kinetic microplate assay was used
GFRP complex is operative in humans because oral to determine the effects of L-phe (1 mmol$l 1 ) on the
challenge with L-phe leads to a 3-fold rise in plasma activity of recombinantly expressed human GCH1
biopterin levels (a correlate of BH 4 )—an effect that is (0.1 m mol$l1) either alone or when coincubated with
368 Heikal et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

L-Phenylalanine Effect on GCH1-GFRP Complex JUNE 2018:366–77

recombinantly expressed human GFRP (1 mmol$l1 ) ultraviolet spectrophotometric detection in plasma

(24). This assay measures the accumulation of the and tissues (38) (see the Supplemental Methods for
intermediate reaction product, dihydroneopterin full details).
triphosphate (H 2NTP), by monitoring an increase in VASCULAR REACTIVITY OF AORTIC RINGS. Experi-
A340 over time (30) (Supplemental Methods). ments were carried out in fresh rat aortic rings w2
ANIMALS. Spontaneously hypertensive rats (SHR) mm in length. Vessels were carefully dissected, and
and Wistar Kyoto rats (WKY) were used throughout. the endothelium was denuded using a steel wire in a
All animal experiments were performed under U.K. proportion of rings. All intact and denuded aortic
Home Office approval according to the Animals rings were suspended in an organ bath containing
Scientific Procedures Act, 1986 and subsequent Krebs buffer, 5 m mol$l 1 indomethacin (a cyclo-
revisions and conformed to the Guide for the Care and oxygenase inhibitor) and gassed with 95% O 2 and
Use of Laboratory Animals published by the National 5% CO 2 at 37  C, as previously described (39). The
Institutes of Health (NIH Publication No. 85-23, presence of a functional endothelial cell layer was
revised 1996). Studies were designed and conducted confirmed if a clear vasorelaxant response was
in accord with the ARRIVE (Animals in Research: observed to 1 mmol$l1 acetylcholine (ACh) in tissues
Reporting In Vivo Experiments) guidelines (31). The pre-contracted with 0.1 m mol$l1 phenylephrine.
scientific rational for choice of animal, age group, and Endothelium intact vessels that did not display >70%
details of experimental design are fully described in relaxation to the highest ACh dose were excluded
the Supplemental Methods (31). from the study.

L-PHE ORAL CHALLENGE: BOLUS DOSING AND VASCULAR REACTIVITY OF MESENTERIC ARTERIES. Small
LONG-TERM TREATMENT. A short-term bolus dose of resistance arteries (approximately 300 mm, length 3 to
L-phe (100 mg/kg) or saline control was orally 4 mm) were isolated from SHR and WKY mesenteries,
administered via gavage to 13-week-old WKY or SHR. dissected free of surrounding fat and connective tis-
Venous blood was collected, under brief inhaled iso- sue, and mounted as isometric preparations on a
flurane anesthesia, from the tail of each animal 0.5, 1, Mulvany–Halpern wire myograph (Danish Myo Tech-
and 4 h after bolus dosing. nology, Aarhus, Denmark) containing Krebs buffer (as
For assessment of the long-term effects of L-phe in the preceding text). As before, the endothelial layer
supplementation, 4-week-old SHR in their pre- was intentionally removed in a proportion of the
hypertensive stage were given free access to drink- mesenteric rings. Vessels were stretched to a
ing water supplemented with 2.5% w/v L-phe or circumference 90% of that obtained when subjected
saline until they reached 12 weeks of age, after which to a transmural pressure of 13.4 kPa (40) before a
plasma and tissue samples were acquired (see the routine “run-up” procedure consisting of 4 alternate
Supplemental Methods for L-phe dose calculation; contractions to high K þ solution (as in the preceding
Supplemental Figure 1 for justification of the time text). Endothelial viability was again assessed by the
course of the long-term L-phe dosing study). addition of 1 m mol$l 1 ACh to pre-contracted tissues.

BH 4 , DIHYDROBIOPTERIN (BH 2 ), AND BIOPTERIN EFFECTS OF SHORT-TERM EXOGENOUS L-PHE ON

MEASUREMENT. BH 4, BH 2, and biopterin were THE VASCULAR REACTIVITY OF AORTIC AND

measured from snap-frozen whole tissue and plasma MESENTERIC ARTERIES FROM NAIVE 13-WEEK-OLD

using fluorescence and electrochemical detection (32– SHR AND WKY. Following the initial vessel setup and

34) (see the Supplemental Methods for full details). endothelial integrity assessment (described in the
preceding text), all blood vessels were contracted with
NITRITE MEASUREMENT. Quantification of total NOx
effective concentration of phenylephrine for 80%
was performed as previously described using the
maximal contraction (EC 80 ) followed by a concentra-
modified Greiss assay (35) and fluorometric detection
tion response curve to ACh (0.01 to 1 m mol$l1). Tissues
(36) (see the Supplemental Methods for full details).
were subsequently washed out and incubated with
QUANTIFICATION OF SUPEROXIDE LEVELS. Super- 0.5 mmol$l1 L-phe or saline control, for 30 min.
oxide levels were quantified using a lucigenin Post-incubation, vessels were recontracted with
chemiluminescence-based assay as previously phenylephrine (EC 80), and a second ACh concentration
described (37) (see the Supplemental Methods for full response curve was constructed. The EC 50 values for
details). ACh were recorded and compared in all vessels, pre-
AROMATIC AMINO ACID AND CATECHOLAMINE and post–L-phe incubation. Six aortic and 6 mesenteric
MEASUREMENT. Phenylalanine, tyrosine, dopamine, rings were acquired from each animal. Three aortic/
and adrenaline/noradrenaline were measured by mesenteric rings were treated with L-phe, and the
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 369
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

F I G U R E 1 Effects of Short-Term L-Phe On Recombinant GCH1 Activity (In Vitro) and Systemic BH 4 and Nitrite (In Vivo)

(A) GCH1 activity, determined by the production of the intermediate product reaction; dihydroneopterin triphosphate (DHNTP) at 340 nm of purified GCH1 (0.1 mmol$l1)
alone or in the presence of purified GFRP (1 mmol$l1) and/or L-phe (1 mmol$l1). The datasets shown represent the mean  SEM of n ¼ 4 (*p < 0.05). Quantitative
measurement of temporal changes in plasma (B) BH4, and (C) nitrite, (D) BH2, and (E) biopterin following 100 mg$kg1 L-phe challenge in WKY and SHR (given via oral
gavage). The datasets shown represent the mean  SEM of n ¼ 6 animals per group per time point compared with baseline control (0 h) (*p < 0.05, ** p < 0.01,
***p < 0.001). (Exact p values are tabulated in Supplemental Table 2). BH2 ¼ dihydrobiopterin; BH4 ¼ tetrahydrobiopterin; eNOS ¼ endothelial nitric oxide synthase;
GCH1 ¼ GTP cyclohydrolase 1; L-Arg ¼ L-arginine; L-phe ¼ L-phenylalanine; SHR ¼ spontaneously hypertensive rat(s); WKY ¼ Wistar Kyoto rat(s).

remaining 3 were controls (saline treated) in each D a t a a c q u i s i t i o n . The changes in tension of all
experiment. Therefore, a total of 6 animals were tissues/rings were measured using a force transducer,
used in 6 independent experiments, conducted in and responses were recorded and analyzed using
triplicate. LabChart software version 4.2 (ADInstruments
EFFECTS OF LONG-TERM ORAL L-PHE SUPPLEMENTATION Ltd., Oxford, United Kingdom) by a blinded
ON THE VASCULAR REACTIVITY OF AORTIC AND investigator.
MESENTERIC ARTERIES FROM 13-WEEK-OLD SHR. To STATISTICAL ANALYSIS. All data were analyzed us-
assess the effects of long-term L-phe on vascular ing GraphPad Prism software version 5 (GraphPad
reactivity, aortic rings, and mesenteric arteries were Software, La Jolla, California). Normal distribution of
isolated from SHR treated long term with oral L-phe data was assessed followed by a Student’s t test or
(8 weeks via drinking water) or saline control, as repeated-measures 1-way analysis of variance
described earlier. Aortic and mesenteric rings were (ANOVA) followed by Bonferroni’s multiple compar-
isolated and their integrity assessed as described in isons post-test. Two-way ANOVA with Bonferroni
the preceding text. Vessels were pre-contracted with post hoc test was used in the vascular activity ex-
phenylephrine (EC 80), and concentration response periments where the ANOVA compared the control
curves to ACh were constructed. The EC50 for ACh (saline-treated) versus L-phe–treated curve for each
was recorded and compared between L-phe–treated experiment. EC50 values were compared using the
SHR and compared with vehicle-treated SHR. Six Student’s t test. The following annotation system was
aortic and 6 mesenteric rings were acquired from each used: *p < 0.05; **p < 0.01; and ***p < 0.001. Exact
animal, and a total of 6 animals/group were used in 6 p values are listed where feasible in the figure,
independent experiments in triplicate. legend, or in the Supplemental Table 2.
370 Heikal et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

L-Phenylalanine Effect on GCH1-GFRP Complex JUNE 2018:366–77

F I G U R E 2 Effects of Short-Term and Long-Term L-Phe on Tissue BH 4 and Nitrite In Vivo

Short-term (100 mg$kg1 L-phe, oral gavage, 4 h, n ¼ 6) and long-term administration (2.5% L-phe in drinking water for 60 days, n ¼ 6) in
SHR on (A) BH4, (B) nitrite, (C) BH2, and (D) biopterin in heart, lung, and liver tissues. The datasets shown represent the mean  SEM where
*p < 0.05, **p < 0.01, and ***p < 0.001. (Exact p values are in the Supplemental Data.) Abbreviations as in Figure 1.

RESULTS Interestingly, there were no statistically significant

differences in BH2 and biopterin in all groups
EFFECTS OF L-PHE ON RECOMBINANT GCH1 although trend increases were observed (Figures 1D
ACTIVITY (IN VITRO) AND SYSTEMIC BH 4 AND and 1E).
NITRITE (IN VIVO). As previously described (24,30), EFFECTS OF BOLUS AND LONG-TERM L-PHE ON
the combination of purified recombinant GFRP with TISSUE BH 4 AND NITRITE IN VIVO. Baseline BH 4 ,
GCH1 protein had a higher basal activity than GCH1 BH2 , and biopterin levels were measured in plasma,
alone in vitro. The addition of L-phe (2 mmol$l1 ) heart, lung, and liver tissues from 13-week-old SHR
had no effect on purified GCH1 activity alone but and WKY. BH4 , BH 2, and/or biopterin were signifi-
caused a significant rise in GCH1 activity when cantly reduced in lungs and plasma of SHR compared
coincubated with GFRP, confirming that L-phe is an with WKY (Figures 2A, 2C, and 2D, Supplemental
allosteric regulator of the GCH1-GFRP complex only Figure 2). L-phe supplementation increased BH4
(Figure 1A). levels in lung and liver tissues in SHR in the short
In vivo, oral L-phe (100 mg$kg1 ) bolus to WKY term (oral gavage, 4-h time point) and long term
and SHR significantly increased plasma BH 4 levels (drinking water, 8 weeks) (Figure 2A).
within 30 min, and levels returned back to baseline Nitrite levels were significantly lower in the heart,
within 4 h (Figure 1B). Correspondingly, a significant lung, and liver, but not the plasma, of SHR compared
rise in nitrite levels was also detected within 30 min, with WKY (Figure 2B, Supplemental Figure 2). Both
but whereas this returned to baseline in WKY, it bolus and long-term supplementation of L-phe
remained elevated in SHR for at least 4 h (Figure 1C). normalized nitrite levels in SHR to WKY control
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 371
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

F I G U R E 3 Effects of L-Phe on Aortic BH 4 and ROS

Effects of L-phe on aortic levels of (A) BH4, (B) superoxide, (C) BH2, and (D) biopterin after short-term (100 mg$kg1 L-phe, oral gavage, 4 h) and
long-term administration (2.5% L-phe in drinking water for 60 days, n ¼ 6) in SHR. The datasets shown represent the mean  SEM
where *p < 0.05, **p < 0.01, and ***p < 0.001. Exact p values are in the Supplemental Data. ROS ¼ reactive oxygen species; SOD ¼ superoxide
dismutase; other abbreviations as in Figure 1.

values (Figure 2B). There were no statistically signif- EFFECTS OF SHORT-TERM L-PHE INCUBATION ON
icant differences in BH 2 or biopterin in all groups AORTIC AND MESENTERIC VASCULAR REACTIVITY.
following bolus dose and long-term L-phe treatment, Initial assessment of vascular responses showed that
although trend increases were observed (Figures 2C both the aortic and mesenteric vessels from SHR and
and 2D, Supplemental Figure 2). WKY had similar contractile responses to phenyl-
EFFECTS OF L-PHE ON VASCULAR BH4 AND ROS. Further ephrine, whereas endothelial dependent vaso-
detailed studies in aortic tissue revealed a signifi- relaxation to ACh was diminished in SHR compared
cantly lower BH4 level in SHR compared with WKY, with WKY (Figures 4A and 4C vs. 4B and 4D). Endo-
which was restored to WKY values following thelial denudation conferred an 80% to 95% reduc-
short-term bolus and long-term L-phe treatment tion of Ach-induced vasorelaxation, and there were
(Figure 3A). As anticipated, superoxide levels were no additional effects of L-phe, suggesting that it does
higher basally in SHR compared with WKY (Figure 3B). not directly relax the smooth muscle (Figure 4).
Bolus dose or long-term administration of L-phe Following incubation with 0.5 mmol$l1 L-phe, in the
significantly reduced superoxide levels in SHR organ bath, contractile responses to phenylephrine
(Figure 3B). Superoxide dismutase, the positive con- were unaffected in both SHR and WKY vessels.
trol, reduced superoxide in all study groups Similarly, L-phe incubation had no effect on Ach-
(Figure 3B). Again, we observed no significant changes induced vasorelaxation in WKY vessels (Figures 4A
in BH 2 or biopterin in aortic tissue  L-phe adminis- and 4C). However, endothelial dependent relaxation
tration (Figures 3C and 3D). Unfortunately, in aortic to ACh was significantly improved by L-phe in aorta
tissues, nitrite levels fell below the limit of detection and mesenteric vessels from SHR, as reflected by the
and were therefore not quantifiable. leftward shift of the dose-response curves (Figures 4B
372 Heikal et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

L-Phenylalanine Effect on GCH1-GFRP Complex JUNE 2018:366–77

F I G U R E 4 Effects of Short-Term L-Phe on Aortic and Mesenteric Vascular Reactivity

Concentration response curves for acetylcholine in (A) WKY mesenteric rings, (B) SHR mesenteric rings, (C) WKY aortic rings, and (D) SHR
aortic rings, with intact or denuded endothelium following short-term incubation with 0.5 mmol$l1 L-phe. Data represent mean  SEM n ¼
6 animals (in triplicate/animal) for mesenteric arteries and aortic rings (*p < 0.05 and *** p < 0.001 for the whole curve). Table (E) shows
EC50 values (nmol$l1) comparing saline control with L-phe treatment for each study. Data represent mean EC50 values  SEM, n ¼ 6 in-
dependent experiments (**p < 0.01 and ***p < 0.001). Ach ¼ acetylcholine; EC50 ¼ effective concentration for 50% maximal response;
other abbreviations as in Figure 1.

and 4D) and corresponding changes in the EC 50 values L-phe/L-tyr was higher in WKY compared with SHR
(Figure 4C), an effect that was more pronounced in basally. However, the L-phe/L-tyr ratio was increased
the mesenteric arteries compared with the aorta. following a bolus dose of L-phe challenge in SHR,
EFFECTS OF LONG-TERM L-PHE TREATMENT ON confirming that L-phe was absorbed following oral
AORTIC AND MESENTERIC VASCULAR REACTIVITY. gavage (Figure 6A, Supplemental Table 1). We did not
Consistent with the effects of short-term L-phe in- detect a significant rise in the L-phe/L-tyr ratio in
cubation, endothelial-dependent relaxation to ACh in animals treated long-term with L-phe. This is not
all vessels from SHR treated long-term with L-phe (8 surprising because the long-term ad libitum L-phe
weeks in drinking water) was significantly improved dosing was at a much lower dose than the short-term
(p < 0.01) compared with saline control, as reflected bolus dose challenge. Although there were trends of
by the leftward shift of the dose-response curves and decreased dopamine and increased adrenaline/
change in the EC 50 values (Figure 5C). noradrenaline between SHR and WKY, these did not
EFFECTS OF BOLUS DOSE AND LONG-TERM L-PHE ON reach statistical significance in most tissues. The
SYSTEMIC AND TISSUE PHENYLALANINE, TYROSINE, exception was the heart, where adrenaline/
DOPAMINE, ADRENALINE/NORADRENALINE. L-phe is noradrenaline levels were significantly higher in SHR
metabolized to L -tyrosine (L-tyr) via the action of than WKY basally, but equaled WKY levels following
phenylalanine hydroxylase in vivo. The ratio of L-phe treatment (Figures 6B and 6C).
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 373
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

F I G U R E 5 Effects of Long-Term L-Phe Treatment on Aortic and Mesenteric Vascular Reactivity

Concentration response curves for acetylcholine in (A) mesenteric arteries and (B) aortic rings isolated from L-phe treated long-term treated
SHR and saline controls. The table (C) shows corresponding EC50 values (*p < 0.05). Data represent mean  SD, n ¼ 6 independent
experiments (*p < 0.05 for the whole curve). Abbreviations as in Figures 1 and 4.

DISCUSSION to and enhance this protein complex may be of clin-

ical value. Our data suggest that L-phe could itself be
The salient findings of this work are that oral sup- translated into the clinic given the minimal effects
plementation of the dietary amino acid L-phe was observed on catecholamines but should be advanced
able to enhance endogenous BH 4 biosynthesis with caution, given L-phe’s diverse biological action
through the GCH1-GFRP protein complex, elevate and potential for predictable adverse drug reactions.
nitrite levels, reduce vascular ROS levels, and GCH1 binds to GFRP to form a protein complex that
improve endothelium-dependent vascular relaxation. is receptive to allosteric regulation by both L-phe
The functional improvements of L-phe were seen (feed forward) and BH 4 (feedback) regulation (21). Our
only in hypertensive animals (SHR), and no change in results have confirmed numerous previous reports
functional reactivity was observed in normotensive that L-phe only enhances GCH1 activity when it is
(WKY) controls. These beneficial effects were ach- bound to GFRP (24,30).
ieved following both high bolus dose short-term In addition to its essential cofactor role for NOS
challenge and following long-term lower-dose ad activation, BH 4 is also required by phenylalanine
libitum supplementation in the drinking water. BH 2 hydroxylase to catalyze the conversion of L-phe to
and catecholamine levels were not significantly L-tyr, which is further converted to dopamine,
altered by L-phe. adrenaline, and noradrenaline (41). L-phe thus regu-
Importantly, this is a proof-of-concept study lates its own metabolism via feed-forward activation
demonstrating that GCH1-GFRP is a rational thera- of GCH1-GFRP with subsequent increases in BH4 and
peutic target for vascular dysfunction. Hence, the hence phenylalanine hydroxylase activity. This is
development of L-phe mimetics that selectively bind important because sustained elevation of L-phe can
374 Heikal et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

L-Phenylalanine Effect on GCH1-GFRP Complex JUNE 2018:366–77

F I G U R E 6 Effects of Short-Term and Long-Term L-Phe on Systemic and Tissue Phenylalanine, Tyrosine, Dopamine, and Adrenaline/Noradrenaline

Effects of short-term (100 mg$kg1 L-phe, oral gavage, 4 h, n ¼ 6) and long-term administration (2.5% L-phe in drinking water for 60 days, n ¼ 6) in SHR and WKY on
levels of different catecholamines: (A) L-phe/L-tyr ratio, (B) dopamine, and (C) adrenaline/noradrenaline in plasma and tissues. The datasets shown represent the
mean  SEM (n ¼ 6) where *p < 0.05 and **p < 0.01. Abbreviations as in Figure 1.

become neurotoxic (42). Indeed, BH4 has been suc- reactive oxygen species (ROS) (48–50). Interestingly,
cessfully used as a treatment for a subset of patients in this study, L-phe caused a more sustained increase
with phenylketonuria (43). Consistent with raised of plasma nitrite in SHR compared with WKY. This
biopterin levels seen in patients after L-phe loading unexpected, but welcome, observation may be
(23) and our previous observations in mice (24), explained by an exaggerated improvement from a
plasma BH4 levels were significantly increased in short-term surge in BH 4 in the already compromised
control WKY and SHR after 100 mg$kg1 L-phe bolus SHR. In other words, the spike in BH 4 following L-phe
oral challenge in the present study. dosing may have temporarily “recoupled” NOS and
The SHR is an appropriate model to study endo- elicited further direct antioxidant effects on other
thelial dysfunction because the animals demonstrate ROS, thereby greatly enhancing NO and hence nitrite
reduced NO signaling, reduced endothelial- levels. By contrast, WKY should not have BH4 insuf-
dependent vascular relaxation, enhanced cardiovas- ficiency and should have “fully coupled” eNOS.
cular remodeling, and increased oxidative stress Hence, the short-term effects of BH 4 elevation on
(19,44,45). In this study, lung BH 4 levels were lower nitrite should be less pronounced. Further mecha-
in SHR than in age-matched WKY, consistent with nistic studies would be required to confirm this
published reports (46). Following a short-term oral suggestion.
dose (4 h) or long-term daily (8 weeks) L-phe chal- To verify whether L-phe could activate the GCH1-
lenge, tissue BH 4 levels in SHR were restored to GFRP axis functionally, a series of studies were car-
control WKY levels. ried out using fresh conduit (aortic) and resistance
Correspondingly, we observed increased aortic (mesenteric) blood vessels from WKY and SHR.
superoxide production in SHR basally and L-phe Consistent with published reports, Ach-mediated
administration increased aortic BH4 and concomi- vascular relaxation in SHR was significantly
tantly reduced superoxide levels. These data support impaired in comparison to WKY rats. Short-term
the hypothesis that L-phe activates the GCH1-GFRP L-phe incubation within the organ bath significantly
complex in vivo, raising endogenous BH4 biosyn- improved vascular relaxation in SHR vessels yet had
thesis to support full “coupled” NOS activity, thereby no effect on WKY. This implies that L-phe, via local
reducing oxidative stress in this model of elevation of BH4 within the vasculature, enhances NO
hypertension. bioavailability and endothelial function only in cir-
Limited BH 4 bioavailability is believed to lead to cumstances where the pathway is dysfunctional. This
NOS uncoupling, generating superoxide instead of is consistent with the differential effects on plasma
NO (8,47). In SHR, the observed endothelial nitrite between SHR and WKY discussed in the pre-
dysfunction is, in part, a result of eNOS uncoupling ceding text. Interestingly, L-phe had a more pro-
attributed to BH 4 insufficiency and NO scavenging by nounced effect on vascular relaxation in mesenteric
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 375
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

arteries, suggesting that non-NO–mediated pathways this was not anticipated and may suggest that the
may have likely been involved as well. Indeed, within bioavailability of L-phe may influence the GCH1-
this vascular bed, endothelium-derived hyper- GFRP complex and hence vascular regulation in
polarizing factor (EDHF) has been proposed to play a these animals.
prominent role (51–53). Hydrogen peroxide has been Our study builds upon an existing published re-
shown to induce EDHF-like relaxations and promotes ports where numerous attempts to restore NO
endothelium-dependent and -independent re- bioavailability have been trialed by targeting
laxations (52,54,55). BH 4 can react with molecular different elements of the NOS-NO pathway. These
oxygen producing hydrogen peroxide, thereby offer- pathways include substrate enhancement (via L -argi-
ing an additional pathway to promote vascular nine supplementation), cofactor enhancement (via
relaxation within such resistance vessels (10,56). BH 4 supplementation), or manipulation of the
Thus, the improved Ach-induced relaxations by L-phe endogenous NOS inhibitors (asymmetric dimethy-
in mesenteric arteries may have also been mediated larginine [ADMA] and L-NMMA) (57). L -Arginine sup-
by an improvement of EDHF-like signaling. To rule plementation is by far the most extensively studied,
out the influence of prostaglandins on vascular but results have been variable. Indeed the VINTAGE
relaxation, indomethacin was employed throughout MI (Vascular Interaction With Age in Myocardial
these studies. Infarction) randomized controlled trial demonstrated
BH 4 is highly unstable and can be rapidly oxidized not only lack of efficacy but also higher post-
to BH2. Previously, studies have demonstrated that infarction mortality (58). Further, a meta-analysis of
BH2 can itself bind to the BH 4 binding site on NOS but L -arginine supplementation in myocardial infarction
does not confer any cofactor functionality. Thus, showed no efficacy (59). Thus, there are efficacy and
raised BH2 can be problematic, competing with BH 4 safety concerns regarding L -arginine supplementa-
for the NOS binding site and promoting NOS uncou- tion in cardiovascular disease patients. The endoge-
pling. Importantly, in our study, we did not observe nous NOS inhibitor, ADMA competes with L-arginine
any significant differences in BH 2 levels following for the substrate binding site of NOS, and hence the
L-phe supplementation. This was a surprising finding efficacy of supplemented L -arginine is dependent
because elevated BH 4 is typically associated with a upon the intracellular arginine/ADMA ratio. Finally,
corresponding rise in BH2 . Whether the absence of L -arginine has poor oral bioavailability (60), likely
BH2 elevation was a consequence of our experimental attributable to intestinal arginase activity, and hence
design and the time points investigated—or a poten- L -citrulline has more recently been suggested as an
tial antioxidant effect of L-phe—remains to be alternative method to enhance L -arginine bioavail-
determined. ability (61).
It would now be important to establish the in vivo Thus, there is still much work to be undertaken to
significance of our findings and to ascertain whether improve the efficacy and safety of pharmacotherapies
activation of the GCH1-GFRP axis could attenuate the that enhance NO bioavailability, but our present
development of hypertension in vivo in SHR and in study provides the first proof-of-concept data that the
the clinic. We have previously postulated that L-phe GCH1-GFRP complex is a rational therapeutic target to
is not necessarily a viable therapeutic agent in itself, achieve BH4 elevation and NO restoration within
given its role in catecholamine biosynthesis. How- blood vessels.
ever, our data revealed no significant effects To translate these findings further, we propose 2
following both short-term and long-term L-phe parallel research strategies. The first clinical devel-
challenge on dopamine, noradrenaline, and adrena- opment strategy would investigate the impact of L-
line levels, indicating that endogenous regulatory phe administration on vascular function using flow
mechanisms may tightly control the bioavailability of mediated dilatation, in patients with existing endo-
these catecholamines. However, our study used L- thelial dysfunction versus healthy controls. It may be
phe supplementation over a relatively short period of predicted that flow-mediated dilatation would be
time and does not reflect the projected timeframe for improved in the patient cohort, whereas negligible
clinical therapeutics (years). Thus, the observed lack effect would be seen in the nonpatient controls.
of effect of L-phe on catecholamine biosynthesis However, L-phe, as a therapy, may have challenges
should be treated with caution and further investi- given its diverse biological activity, raising potential
gated to fully understand the impact on non–GCH1- safety concerns, and these would need to be
BH4 -NO pathways. Interestingly, SHR display signif- concomitantly investigated in trial participants. The
icantly lower basal L-phe levels compared with WKY; second parallel strategy would be focused around
376 Heikal et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

L-Phenylalanine Effect on GCH1-GFRP Complex JUNE 2018:366–77

drug discovery, to identify small molecules that PERSPECTIVES

selectively bind to and activate the GCH1-GFRP
complex without displaying the dual substrate ac-
COMPETENCY IN MEDICAL KNOWLEDGE:
tivity for phenylalanine hydroxylase, minimizing the
L-phe–mediated GCH1-GFRP activation leads to a rise in
potential for off-target adverse drug reactions.
vascular BH4 levels and improved vascular relaxation in a
rodent model of hypertension. Small molecules that
CONCLUSIONS
mimic this allosteric activation of GCH1 represent a po-
tential novel therapy to treat a diverse range of cardio-
Our proof-of-concept study confirms that activation
vascular diseases underpinned by limited NO and/or
of GCH1-GFRP can directly affect vascular BH4 , NO,
enhanced oxidative stress.
and ROS and restore vascular function in a model of
hypertension. This was achieved using the dietary
TRANSLATIONAL OUTLOOK: Our studies
amino acid L-phe. It now remains to be determined
demonstrate the mechanism via which L-phe restores
whether small-molecule L-phe mimetics require
endothelial function in a model of hypertension,
development or if L-phe itself is a safe and efficacious
indicating that the GCH1-GFRP complex represents a
treatment for endothelial dysfunction.
viable therapeutic target for the restoration of
ACKNOWLEDGMENTS The authors would like to endothelial function. This method circumvents the
thank Dr. Mark Crabtree and Prof. Keith Channon, potential oxidative inactivation of BH4 following oral
Division of Cardiovascular Medicine, University of dosing. Although L-phe has been used as a tool to
Oxford, for access to the HPLC detection systems for probe the GCH1-GFRP pathway, it may not be a viable
neopterin and biopterin measurements. therapeutic agent, given its precursor role for the
biosynthesis of catecholamines. However, small
molecules that mimic the allosteric effects of L-phe
ADDRESS FOR CORRESPONDENCE: Dr. Manasi
at the GCH1-GFRP interface but do not bind to
Nandi, Pharmacology and Therapeutics, Faculty of
phenylalanine hydroxylase could be developed,
Life Sciences and Medicine, King’s College London,
underpinned by endothelial dysfunction.
150 Stamford Street, London SE1 9NH, United
Kingdom. E-mail: [email protected].

REFERENCES

1. Heidenreich PA, Trogdon JG, Khavjou OA, et al. synthase uncoupling contribute to atherosclerosis 15. Reverter E, Mesonero F, Seijo S, et al. Effects
Forecasting the future of cardiovascular disease in induced by disturbed flow. Arterioscler Thromb of sapropterin on portal and systemic hemody-
the United States: a policy statement from the Vasc Biol 2011;31:1547–54. namics in patients with cirrhosis and portal
American Heart Association. Circulation 2011;123: hypertension: a bicentric double-blind placebo-
9. Crabtree MJ, Channon KM. Synthesis and recy-
933–44. controlled study. Am J Gasterenterol 2015;110:
cling of tetrahydrobiopterin in endothelial func-
985–92.
2. Briones AM, Touyz RM. Oxidative stress and tion and vascular disease. Nitric Oxide 2011;25:
hypertension: current concepts. Curr Hypertens 81–8. 16. De Maria R, Campolo J, Frontali M, et al. Ef-
Rep 2010;12:135–42. fects of sapropterin on endothelium-dependent
10. Starr A, Hussein D, Nandi M. The regulation of
vasodilation in patients with CADASIL a random-
3. Endemann DH, Schiffrin EL. Nitric oxide, oxida- vascular tetrahydrobiopterin bioavailability. Vasc
ized controlled trial. Stroke 2014;45:2959–66.
tive excess, and vascular complications of diabetes Pharmacol 2013;58:219–30.
mellitus. Curr Hypertens Rep 2004;6:85–9. 17. Nichol CA, Lee CL, Edelstein MP, Chao JY,
11. Porkert M, Sher S, Reddy U, et al. Tetrahy- Duch DS. Biosynthesis of tetrahydrobiopterin by
4. Davignon J, Ganz P. Role of endothelial drobiopterin: a novel antihypertensive therapy. denovo and salvage pathways in adrenal medulla
dysfunction in atherosclerosis. Circulation 2004; J Hum Hypertens 2008;22:401–7. extracts, mammalian-cell cultures and rat brain
109:27–32.
12. Maier W, Cosentino F, Lutolf RB, et al. Tetra- in vivo. Proc Natl Acad Sci U S A 1983;80:1546–50.
5. Forstermann U, Sessa WC. Nitric oxide syn- hydrobiopterin improves endothelial function in 18. Carnicer R, Hale AB, Suffredini S, et al.
thases: regulation and function. Eur Heart J 2012; patients with coronary artery disease. J Cardiovasc Cardiomyocyte GTP cyclohydrolase 1 and tetra-
33:829–37. Pharmacol 2000;35:173–8. hydrobiopterin increase NOS1 activity and
6. Kwon NS, Nathan CF, Stuehr DJ. Reduced bio- accelerate myocardial relaxation. Circ Res 2012;
13. Cosentino F, Huerlimann D, Gatti CD, et al.
pterin as a cofactor in the generation of nitrogen 111:718–27.
Chronic treatment with tetrahydrobiopterin re-
oxides by murine macrophages. J Biol Chem 1989;
verses endothelial dysfunction and oxidative 19. Cosentino F, Luscher TF. Tetrahydrobiopterin
264:20496–501.
stress in hypercholesterolaemia. Heart 2008;94: and endothelial function. Eur Heart J 1998;19
7. Tayeh MA, Marletta MA. Macrophage oxidation 487–92. Suppl G:G3–8.
of L-arginine to nitric oxide, nitrite, and nitrate-
14. Cunnington C, Van Assche T, Shirodaria C, 20. Chuaiphichai S, McNeill E, Douglas G, et al.
tetrahydrobiopterin is required as a cofactor. J Biol
et al. Systemic and vascular oxidation limits the Cell-autonomous role of endothelial GTP cyclo-
Chem 1989;264:19654–8.
efficacy of oral tetrahydrobiopterin treatment in hydrolase 1 and tetrahydrobiopterin in blood
8. Li L, Chen W, Rezvan A, Jo H, Harrison DG. patients with coronary artery disease. Circulation pressure regulation. Hypertension 2014;64:
Tetrahydrobiopterin deficiency and nitric oxide 2012;125:1356–66. 530–40.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Heikal et al. 377
JUNE 2018:366–77 L-Phenylalanine Effect on GCH1-GFRP Complex

21. Harada T, Kagamiyama H, Hatakeyama K. 35. Verdon CP, Burton BA, Prior RL. Sample pre- expression lowers blood pressure in hypertensive
Feedback regulation mechanisms for the control treatment with nitrate reductase and glucose-6- rats. J Am Coll Cardiol 2006;47:2536–44.
of GTP cyclohydrolase-1 activity. Science 1993; phosphate-dehydrogenase quantitatively reduces
50. Landmesser U, Dikalov S, Price SR, et al.
260:1507–10. nitrate while avoiding interference by NADP(þ)
Oxidation of tetrahydrobiopterin leads to uncou-
when the Griess reaction is used to assay for ni-
22. Yoneyama T, Hatakeyama K. Ligand binding to pling of endothelial cell nitric oxide synthase in
trite. Analytical Biochemistry 1995;224:502–8.
the inhibitory and stimulatory GTP cyclohydrolase hypertension. J Clin Invest 2003;111:1201–9.
I/GTP cyclohydrolase I feedback regulatory pro- 36. Bryan NS, Grisham MB. Methods to detect 51. Archer SL, Gragasin FS, Wu XC, et al. Endothelium-
tein complexes. Protein Sci 2001;10:871–8. nitric oxide and its metabolites in biological sam- derived hyperpolarizing factor in human internal
ples. Free Radic Biol Med 2007;43:645–57. mammary artery is 11,12-epoxyeicosatrienoic acid and
23. Saunders-Pullman R, Blau N, Hyland K, et al.
Phenylalanine loading as a diagnostic test for 37. Li JM, Shah AM. Differential NADPH- versus causes relaxation by activating smooth muscle BKCa
DRD: interpreting the utility of the test. Mol Genet NADH-dependent superoxide production by channels. Circulation 2003;107:769–76.
Metab 2004;83:207–12. phagocyte-type endothelial cell NADPH oxidase. 52. Ozkor MA, Quyyumi AA. Endothelium-derived
Cardiovasc Res 2001;52:477–86. hyperpolarizing factor and vascular function. Car-
24. Hussein D, Starr A, Heikal L, Nandi M. Inves-
tigating the interaction between GTP- 38. Atherton ND, Green A. HPLC measurement of diol Res Pract 2011;2011:156146.
cyclohydrolase1 and its feedback regulatory phenylalanine in plasma. Clin Chem 1988;34: 53. Scotland RS, Madhani M, Chauhan S, et al.
protein. Nitric Oxide 2015;27 Suppl:S29–30. 2241–4. Investigation of vascular responses in endothe-
25. Li L, Rezvan A, Salerno JC, et al. GTP cyclo- lial nitric oxide synthase/cyclooxygenase-1
39. Heikal L, Aaronson PI, Ferro A, Nandi M,
hydrolase I phosphorylation and interaction with double-knockout mice: key role for
Martin GP, Dailey LA. S- Nitrosophytochelatins:
GTP cyclohydrolase feedback regulatory protein endothelium-derived hyperpolarizing factor in
investigation of the bioactivity of an oligopeptide
provide novel regulation of endothelial tetrahy- the regulation of blood pressure in vivo. Circu-
nitric oxide delivery system. Biomacromolecules
drobiopterin and nitric oxide. Circ Res 2010;106: lation 2005;111:796–803.
2011;12:2103–13.
328–36. 54. Rubanyi GM, Romero JC, Vanhoutte PM. Flow-
40. Mulvany MJ, Halpern W. Contractile proper-
26. Kalivendi S, Hatakeyama K, Whitsett J, induced release of endothelium-derived relaxing
ties of small arterial resistance vessels in sponta-
Konorev E, Kalyanaraman B, Vasquez-Vivar J. factor. Am J Physiol 1986;250:1145–9.
neously hypertensive and normotensive rats. Circ
Changes in tetrahydrobiopterin levels in endo- Res 1977;41:19–26. 55. Chidgey J, Fraser PA, Aaronson PI. Reactive ox-
thelial cells and adult cardiomyocytes induced by ygen species facilitate the EDH response in arterioles
LPS and hydrogen peroxide: a role for GFRP? Free 41. Kaufman S. New cofactor required for the
by potentiating intracellular endothelial Ca2þ
Radic Biol Med 2005;38:481–91. enzymatic conversion of phenylalanine to tyro-
release. Free Radic Biol Med 2016;97:274–84.
sine. J Biol Chem 1958;230:931–9.
27. Nandi M, Kelly P, Vallance P, Leiper J. Over- 56. Garry A, Edwards DH, Fallis IF, Jenkins RL,
expression of GTP-cyclohydrolase 1 feedback 42. Heintz C, Cotton RGH, Blau N. Tetrahy- Griffith TM. Ascorbic acid and tetrahydrobiopterin
regulatory protein attenuates LPS and cytokine- drobiopterin, its mode of action on phenylalanine potentiate the EDHF phenomenon by generating
stimulated nitric oxide production. Vasc Med hydroxylase, and importance of genotypes for hydrogen peroxide. Cardioavasc 2009;84:218–26.
2008;13:29–36. pharmacological therapy of phenylketonuria. Hum
Mutat 2013;34:927–36. 57. Rochette L, Lorin J, Zeller M, et al. Nitric oxide
28. d’Uscio LV, Katusic ZS. Increased vascular synthase inhibition and oxidative stress in cardio-
biosynthesis of tetrahydrobiopterin in apolipo- 43. Scala I, Concolino D, Della Casa R, et al. Long- vascular diseases: possible therapeutic targets?
protein E- deficient mice. Am J Physiol Heart Circ term follow-up of patients with phenylketonuria Pharmacol Ther 2013;140:239–57.
Physiol 2006;290:H2466–71. treated with tetrahydrobiopterin: a seven years
experience. Orphanet J Rare Dis 2015;10:14. 58. Schulman SP, Becker LC, Kass DA, et al.
29. Gesierich A, Niroomand F, Tiefenbacher CP. L-arginine therapy in short-term myocardial
Role of human GTP cyclohydrolase I and its reg- 44. Aboudonia MM, Duch DS, Nichol CA, infarction: the Vascular Interaction With Age
ulatory protein in tetrahydrobiopterin metabolism. Viveros OH. Hormonal regulation of guanosine in Myocardial Infarction (VINTAGE MI) randomized
Basic Res Cardiol 2003;98:69–75. triphosphate cyclohydrolase activity and biopterin clinical trial. JAMA 2006;295:58–64.
levels in the rat adrenal cortex. Endocrinology
30. Kolinsky MA, Gross SS. The mechanism of 59. Sun T, Zhou WB, Luo XP, Tang YL, Shi HM. Oral
1983;112:2088–94.
potent GTP cyclohydrolase I inhibition by 2,4- L-arginine supplementation in acute myocardial
diamino-6-hydroxypyrimidine: requirement of the 45. Bernatova I, Conde MV, Kopincova J, infarction therapy: a meta-analysis of randomized
GTP cyclohydrolase I feedback regulatory protein. Gonzalez MC, Puzserova A, Arribas SM. Endothe- controlled trials. Clinical Cardiology 2009;32:
J Biol Chem 2004;279:40677–82. lial dysfunction in spontaneously hypertensive 649–52.
rats: focus on methodological aspects.
31. Kilkenny C, Browne WJ, Cuthill IC, Emerson M, 60. Schwedhelm E, Maas R, Freese R, et al. Phar-
J Hypertens Suppl 2009;27:S27–31.
Altman DG. Improving bioscience research macokinetic and pharmacodynamic properties of
reporting: the ARRIVE guidelines for reporting 46. Hong HJ, Hsiao G, Cheng TH, Yen MH. Sup- oral L-citrulline and L-arginine: impact on nitric ox-
animal research. PloS Biol 2010;8:e1000412. plementation with tetrahydrobiopterin suppresses ide metabolism. Br J Clin Pharmacol 2008;65:51–9.
the development of hypertension in spontaneously
32. Howells DW, Smith I, Hyland K. Estimation of 61. Morita M, Hayashi T, Ochiai M, et al.
hypertensive rats. Hypertension 2001;38:1044–8.
tetrahydrobiopterin and other pterins in cerebro- Oral supplementation with a combination of L-
spinal fluid using reversed phase high performance 47. Alp NJ, McAteer MA, Khoo J, Choudhury RP, citrulline and L-arginine rapidly increases plasma
liquid chromatography with electrochemical and Channon KM. Increased endothelial tetrahy- L-arginine concentration and enhances NO
fluorescence detection. J Chromatogr 1986;381: drobiopterin synthesis by targeted transgenic GTP- bioavailability. Biochem Biophys Res Commun
285–94. cyclohydrolase I overexpression reduces endothelial 2014;454:53–7.
dysfunction and atherosclerosis in apoE-knockout
33. Starr A, Sand CA, Heikal L, et al. Over-
mice. Arterioscler Thromb Vasc Biol 2004;24:445–50.
expression of GTP cyclohydrolase 1 feedback KEY WORDS cardiovascular disease,
regulatory proteins is protective in a murine model 48. Bhatt SR, Lokhandwala MF, Banday AA. endothelium, L -phenylalanine, nitric oxide,
of septic shock. Shock 2014;42:432–9. Resveratrol prevents endothelial nitric oxide syn- tetrahydrobiopterin, vascular activity
thase uncoupling and attenuates development of
34. Cai S, Alp NJ, McDonald D, et al. GTP cyclo-
hypertension in spontaneously hypertensive rats.
hydrolase I gene transfer augments intracellular
Eur J Pharmacol 2011;667:258–64.
tetrahydrobiopterin in human endothelial cells:
effects on nitric oxide synthase activity, protein 49. Li HG, Witte K, August M, et al. Reversal of A PP END IX For an expanded Methods section
levels and dimerisation. Cardiovasc Res 2002;55: endothelial nitric oxide synthase uncoupling and as well as supplemental figures and tables,
838–49. up-regulation of endothelial nitric oxide synthase please see the online version of this paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

PRECLINICAL RESEARCH

In Vivo Reactive Oxygen Species

Detection With a Novel Positron Emission
Tomography Tracer, 18F-DHMT, Allows for
Early Detection of Anthracycline-Induced
Cardiotoxicity in Rodents
Nabil E. Boutagy, PHD,a,* Jing Wu, PHD,b,* Zhengxi Cai, PHD,b Wenjie Zhang, PHD,b,c Carmen J. Booth, DVM, PHD,d
Tassos C. Kyriakides, PHD,e Daniel Pfau, BS,a Tim Mulnix, PHD,b Zhao Liu, PHD,a Edward J. Miller, MD, PHD,a
Lawrence H. Young, MD,a Richard E. Carson, PHD,b Yiyun Huang, PHD,b Chi Liu, PHD,b Albert J. Sinusas, MDa,b

VISUAL ABSTRACT
HIGHLIGHTS

LVEF is used to detect

doxorubicin-induced cardiotoxicity in
patients, but this index is variable and has
limited ability to detect early
cardiotoxicity.

Doxorubicin induces cardiotoxicity largely
through the excessive production of ROS.

We hypothesized that 18
F-DHMT, a PET
tracer that detects superoxide
production, would provide an early index
of cardiotoxicity in rodents.
18

F-DHMT PET imaging was able to detect
an elevation in cardiac superoxide
production before a fall in LVEF.

The early elevation in myocardial
superoxide production was associated
with only mild myocardial toxicity and
occurred before cellular apoptosis or
significant activation of MMPs; enzymes
associated with myocardial remodeling.

A drop in LVEF was associated with a
significant increase in MMP activation,
cellular apoptosis, and significant
myocardial toxicity.

Boutagy, N.E. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):378–90.

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.02.003

JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 379
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

ABBREVIATIONS
SUMMARY
AND ACRONYMS

Reactive oxygen species (ROS) are involved in doxorubicin-induced cardiotoxicity. The authors investigated the 2D = 2-dimensional

efficacy of 18F-DHMT, a marker of ROS, for early detection of doxorubicin-induced cardiotoxicity in rats. Echocar- CT = computed tomography
diography was performed at baseline and 4, 6, and 8 weeks post-doxorubicin initiation, whereas in vivo superoxide DOX = doxorubicin HCl
production was measured at 4 and 6 weeks with 18F-DHMT positron emission tomography. Left ventricular ejection H&E = hematoxylin and eosin
fraction (LVEF) was not significantly decreased until 6 weeks post-doxorubicin treatment, whereas myocardial
LV = left ventricle/ventricular
superoxide production was significantly elevated at 4 weeks. 18F-DHMT imaging detected an elevation in
LVEF = left ventricular
cardiac superoxide production before a fall in LVEF in rodents and may allow for early cardiotoxicity ejection fraction
detection in cancer patients. (J Am Coll Cardiol Basic Trans Science 2018;3:378–90) © 2018 The Authors. MMP = matrix
Published by Elsevier on behalf of the American College of Cardiology Foundation. This is an open access metalloproteinase

article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). MT = Masson’s trichrome

PET = positron emission

D
tomography

oxorubicin (DOX) (Adriamycin) is a widely cardiotoxicity that precede decrements in ROS = reactive oxygen species

used antineoplastic agent of the anthracy- LVEF have been proposed (6–10); however, SUV = standardized uptake
value
cline drug class that is effective against limited or inconsistent data exist regarding
solid tumors and hematologic malignancies (1). the efficacy of these approaches (4). TUNEL = terminal
deoxynucleotidyl transferase-
Although effective, a common side effect of DOX The precise mechanisms of DOX-induced mediated nick-end labeling
therapy is cardiotoxicity, which affects 3% to 26% cardiotoxicity are not fully elucidated;
VOI = volume of interest
of patients and often manifests as heart failure although it is well established that DOX in-
(1,2). DOX-induced cardiotoxicity is largely dose- duces cardiotoxicity largely through the excessive
dependent, thus limiting the use of this agent and production of reactive oxygen species (ROS) that
optimal oncological treatment (3). Current guidelines lead to direct myocardial apoptosis, contractile ab-
to detect DOX-induced cardiotoxicity are based on normalities, inflammation, and vascular injury
the serial assessment of global systolic function. (11,12), and promote deleterious cardiac remodeling
Generally, the left ventricular (LV) ejection fraction by increasing the activity and abundance of matrix
(LVEF) is assessed by nuclear gated blood pool studies metalloproteinases (MMPs) (13,14). Some studies
or cardiac ultrasound (4). However, assessment of report that elevations in circulating biomarkers of
LVEF is variable and has limited ability to detect early oxidative stress (myeloperoxidase) precede clini-
cardiotoxicity, as many patients have histological evi- cally significant systolic dysfunction in
dence of cardiotoxicity before decrements in systolic anthracycline-treated patients (8,15). However, the
function occur (5). Importantly, a reduction in LVEF signal-to-noise ratio for cardiac-specific detection of
is often an irreversible side effect of DOX therapy, as ROS with circulating oxidative stress biomarkers
45% to 58% do not recover systolic function despite may be low considering that DOX induces oxidative
receiving optimal medical therapy (6). As such, stress in extracardiac organs (e.g., liver, skeletal
early detection methods of anthracycline-induced muscle) (16,17), and tumor cells can also produce

From the aSection of Cardiovascular Medicine, Department of Medicine, Yale Translational Research Imaging Center, Yale School
of Medicine, New Haven, Connecticut, USA; b Department of Radiology and Biomedical Imaging, Yale School of Medicine, New Haven,
c d
Connecticut, USA; Department of Nuclear Medicine, West China Hospital of Sichuan University, Chengdu, China; Section of
e
Comparative Medicine, Yale School of Medicine, New Haven, Connecticut, USA; and the Yale School of Public Health (Biostatistics),
Yale School of Medicine, New Haven, Connecticut, USA. This study was supported by National Institutes of Health grants R01HL123949
(Dr. C. Liu), R01HL113352 (Dr. Sinusas), T32HL098069 (Dr. Sinusas), and S01OD010322 (Dr. Carson). Dr Miller has received grant
funding from Bracco, Inc. for FDG-PET examinations in cardiac sarcoidosis unrelated to the present study; and is a consultant for
GE, Bracco, Inc., and Alnylam. Dr. Young has received research grant support, unrelated to this study, from Merck, Mifcor, and
Novartis (to Yale University); and has as served as a consultant for Portage. Dr. C. Liu has had research contracts with GE
Healthcare, Siemens Medical Solutions, and Philips Healthcare. Dr. Sinusas is a paid consultant and limited partner of MicroVide,
LLC, which holds patents related to Tc99m-RP805 imaging in heart failure. All other authors have reported that they have no
relationships relevant to the contents of this paper to disclose. *Drs. Boutagy and Wu contributed equally to this work.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’
institutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information,
visit the JACC: Basic to Translational Science author instructions page.

Manuscript received August 14, 2017; revised manuscript received February 6, 2018, accepted February 9, 2018.
380 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

F I G U R E 1 Schematic of Experimental Design

Animals were treated with either doxorubicin HCl (DOX) (15 mg/kg total, n ¼ 10) or saline (control [CTL], n ¼ 10) every 3 days (2.15 mg/kg/dose)
for 21 days. Left ventricular function was assessed in all animals with echocardiography (echo) at baseline and 4 weeks after the initiation of DOX
(n ¼ 20). At this time, a subgroup of animals (CTL, n ¼ 5; DOX, n ¼ 5) were imaged with 18F-DHMT positron emission tomography (PET)/computed
tomography (CT). Myocardial MMP activity (99mTc-RP805), cellular cardiotoxicity and apoptosis were also assessed in these animals following
euthanasia. In the remaining rats, echo (CTL, n ¼ 5; DOX, n ¼ 5) and 18F-DHMT PET/CT (CTL, n ¼ 4; DOX, n ¼ 4) imaging were repeated at
6 weeks. At 8 weeks, the remaining animals (CTL, n ¼ 5; DOX, n ¼ 4) underwent echo imaging and evaluation of myocardial 99mTc-RP805, and
histological assessment of cardiotoxicity and apoptosis following euthanasia. mPET ¼ micro-positron emission tomography.

ROS (18). Therefore, more targeted detection of ROS METHODS

activity in the heart may provide a higher sensi-
tivity approach for detecting early cardiotoxicity ANIMAL MODEL. A schematic of the overall study
that often complicates DOX therapy. Recently, a design is illustrated in Figure 1. Male Wistar rats
18 18
F-labeled analog of dihydroethidium, F-DHMT, (Crl:Wl) (10 to 11 weeks old) were purchased from
was synthesized that permits positron emission Charles River Laboratories (Wilmington, Massachu-
tomographic (PET) imaging of superoxide genera- setts) and were acclimatized to their environment for
tion in vivo (19,20). Initial studies reported an w2- 5 days before any study procedures. All animals were
fold short-term increase in 18
F-DHMT cardiac up- housed in a temperature-controlled facility (22  C to
take, indicative of elevated ROS production, in mice 24  C), kept on a 12:12-h light/dark cycle, and fed a
following a 1-time bolus injection of DOX (20 mg/ standard chow diet ad libitum for the duration of the
kg) compared with controls (19). However, whether study. We employed an established model of chronic
18
F-DHMT is increased before a fall in LVEF in a progressive cardiotoxicity (14), in which rats were
more clinically relevant, progressive rodent model treated with DOX (2.15 mg/kg intraperitoneally every
of DOX-induced cardiotoxicity is unknown. Taken 3 days for 21 days [15 mg/kg total]) (n ¼ 10). Control
together, we hypothesized that the novel PET rats received an equal volume of 0.9% NaCl intra-
18
radiotracer F-DHMT would provide an early peritoneally over the same period as DOX-treated rats
in vivo index of cardiotoxicity before a decrease in (n ¼ 10). All animals were used in accordance with
systolic function in a well-established rodent model protocols and policies approved by the Yale Institu-
of progressive DOX-induced cardiotoxicity. tional Animal Care and Use Committee.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 381
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

Systolic function and LV dimensions were reconstructed using a 3D ordered subset expectation
measured with 2-dimensional (2D) echocardiography maximization/maximum a posteriori algorithm with 2
in all animals at baseline (n ¼ 20). Four weeks ordered subset expectation maximization iterations
following the first chemotherapy dose, cardiac func- and 18 maximization/maximum a posteriori iterations
tion was reassessed with echocardiography (n ¼ 20). At on the Siemens Inveon Acquisition Workplace. PET
this time, a subgroup of control (n ¼ 5) and DOX- images were corrected for attenuation, scatter, ran-
18
treated (n ¼ 5) animals were injected with F-DHMT doms, decay, normalization, and dead time. Further
and microPET/computed tomography (CT) imaging detail is provided in the Supplemental Methods.
was performed for the in vivo assessment of superox- The 3D Gaussian filtering with 2-mm full-width-at-
18
ide production. Three days following F-DHMT half-maximum was applied on the reconstructed im-
microPET/CT imaging, animals were injected with ages using AMIDE software (version 1.0.4) (22). In this
99m
Tc-RP805, a radiotracer that binds to the catalytic study, the filtered PET images were only used for
site of activated MMPs (21) for quantitative assessment volumes of interest (VOIs) definition and image
99m
of myocardial Tc-RP805 uptake with gamma well display, whereas the image quantification was per-
counting. Left ventricular tissue was harvested to formed on the unfiltered PET images. VOIs were
assess the degree of cardiotoxicity with standard mo- drawn on the LV myocardium and within the LV
lecular and histopathologic techniques (see below). cavity using the Seg3D software (version 2.1.5) (23).
Cardiac function/dimensions (control, n ¼ 5; DOX, n ¼ CT images were used to localize the heart and confirm
5) and in vivo superoxide production (control, n ¼ 4; the epicardial surfaces for VOI edge placement.
DOX, n ¼ 4) were measured in the remaining animals 6 Standard uptake values (SUVs) were then calculated
weeks following the first dose of chemotherapy with for the LV myocardium, liver, and LV blood pool.
18
2D echocardiography and F-DHMT microPET/CT Differences in blood pool and liver SUV were
imaging, respectively. These animals were followed observed between groups (see later in the text);
for an additional 2 weeks (8 weeks following the first therefore, the ROS activity ratio was determined as
dose of chemotherapy) and had cardiac function the ratio between LV myocardial SUV and LV blood
reassessed with 2D echocardiography, and had LV pool SUV to account for differences in tissue tracer
MMP activity and the degree of cardiotoxicity deter- clearance and bioavailability.
mined as described in the preceding text (control, n ¼ TRANSTHORACIC ECHOCARDIOGRAPHY. Transthoracic
5; DOX, n ¼ 4). One DOX-treated animal died before the echocardiography was performed under light iso-
last imaging session at 8 weeks. flurane anesthesia (1.5% isoflurane/98.5% oxygen)
18
F-DHMT SYNTHESIS. 18
F-DHMT was synthesized by under physiological temperatures (35.9  C to 37.5  C)
an optimized and fully automated process developed using standardized cardiac views and imaging modes
at the Yale University PET Center as recently with a high-resolution ultrasound system (Vevo 2100,
described (20). Further detail is provided in the VisualSonics, Toronto, Ontario, Canada) equipped
18
Supplemental Methods. The formulated F-DHMT with an ultra-high frequency (24 MHz) linear array
product had a specific activity of 2.19  0.9 mCi/nmol transducer. LV volumes and dimensions, and systolic
for the PET imaging studies. function were measured offline using Vevo Lab soft-
18
F-DHMT microPET/CT IMAGING. Rats were injected ware (version 1.7.1, VisualSonics) by an experienced
with 0.32  0.02 mCi of 18
F-DHMT (0.64  0.004 mg sonographer blinded to the treatment groups. Mitral
injected mass) via the tail vein and underwent E-A fusion was present in most rats due to tachy-
microPET imaging for 10 min on a dedicated small cardia, thus diastolic function parameters were
animal hybrid microPET/CT system (Inveon, Siemens excluded from the analyses because many diastolic
Healthineers, East Walpole, Massachusetts) 60 to 70 indices could not be accurately determined.
99m
min following tracer injection. Following microPET GAMMA WELL COUNTING OF MYOCARDIAL Tc-RP805
99m
imaging, all animals underwent a noncontrast ACTIVITY. Tc-RP805 was used to quantify
microCT (80 KVp, 500 m A) for attenuation correction myocardial MMP activity in control (n ¼ 5) and in
of the PET images and to facilitate localization of DOX-treated (n ¼ 5) rats at 4 weeks, and control
radiotracer within the myocardium for quantitative (n ¼ 5) and DOX-treated (n ¼ 4) rats at 8 weeks
image analysis. Imaging was performed under light following chemotherapy initiation with gamma well
isoflurane anesthesia (1.5% to 2.0% isoflurane/98% to counting, as previously described (21,24) and
98.5% oxygen) under physiological temperatures described in further detail in the Supplemental
(35.9  C to 37.5  C). Methods. Briefly, rats were injected with w5 mCi of
99m
MicroPET/CT IMAGE RECONSTRUCTION, DATA Tc- RP805 via the tail vein and were euthanized
CORRECTION, AND ANALYSIS. All PET images were with saturated KCl 4 h following tracer injection.
382 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

99m
Tc-RP805 radioactivity in each tissue segment was algorithm for thresholding and segmentation (26,27)
measured by gamma well counting (Cobra implemented in MATLAB 2017a (The MathWorks,
Auto-Gamma, PerkinElmer, Waltham, Massachusetts) Natick, Massachusetts). The number of TUNEL-
using an energy window (120 to 160 keV) centered on positive cells was corrected for the number of DAPI-
99m 99m
the peak gamma emission of Tc. Global LV Tc- stained cells and multiplied by 100 to obtain a
RP805 uptake values are reported in percent injected TUNEL-positive index per field. The TUNEL-positive
dose per gram of tissue. index was then averaged over the 8 fields for subse-
quent statistical analysis. A biological positive control
HISTOPATHOLOGICAL ANALYSES OF MYOCARDIUM.
(infarct) and negative control were used to facilitate
Paraffin embedded mid-ventricular sections (3 to
accurate TUNEL scoring.
5 m m) were stained with hematoxylin and eosin (H&E)
or Masson’s trichrome (MT) by routine methods. STATISTICAL ANALYSIS. All statistical analyses were
H&E-stained sections were evaluated for the presence performed with SAS (version 9.4, SAS Institute, Cary,
and severity of myocardial toxicity (cardiomyocyte North Carolina). Longitudinal mixed-effects models
vacuolation, degeneration) or necrosis, inflammation were used to compare the 2 groups with respect to
(histiocytic myocarditis), and MT-stained sections echocardiographic variables (LVEF, global longitudi-
were evaluated for the presence and severity of nal strain, global radial strain, LV end-diastolic vol-
myocardial fibrosis by a veterinarian (C.J.B.) trained in ume, LV end-systolic volume, and relative wall
veterinary pathology with extensive expertise in ro- thickness). Repeated measures models (with un-
dent pathology, blinded to both treatment group and structured covariance) were used to assess the change
time point. The tissue parameters were assessed and in these parameters over time with the group and
scored using a semiquantitative criterion-based anal- group*time interactions used as covariates. The sig-
ysis adapted from prior published methods (25) as nificance level was adjusted for multiple comparisons
described in the Supplemental Methods. Myocardial for overall and between-group differences at each
degeneration, inflammation, and fibrosis were inde- time point (0, 4, 6, 8 weeks), thus the significance
pendently scored, and a total severity score was level was set at p < 0.01 for this model. Significance is
determined by summing the values for the 3 variables. provided for between-group differences only if the
overall difference in least-squares means between the
IMMUNOFLUORESCENCE. The terminal deoxy-
groups was significant. All other data were nonpara-
nucleotidyl transferase-mediated nick-end labeling
metric and not matched; thus, a Wilcoxon rank sum
(TUNEL) assay was performed to assess in situ cell
test was used to determine differences between
death according to the manufacturer’s directions
groups with a significance level set a priori at
(Sigma-Aldrich, St. Louis, Missouri) using paraffin-
p < 0.05. All nonparametric data are expressed as
embedded tissue as described in further detail in
median (first quartile, third quartile). Pearson’s
the Supplemental Methods. To ensure that nuclei
Product Moment correlations were used to determine
were only considered for quantification, the nuclear
relationships among variables of interest with a sig-
stain DAPI (1:20,000 dilution) (ThermoFisher Scien-
nificance level set a priori at p < 0.05.
tific, Waltham, Massachusetts) was used as a coun-
terstain according to the manufacturer’s directions. RESULTS
In addition, the extracellular matrix antibody, anti-
laminin (1:50 dilution) (Sigma-Aldrich), was used as TRANSTHORACIC ECHOCARDIOGRAPHY–DERIVED
a counterstain according to the manufacturer’s SYSTOLIC FUNCTION AND LEFT VENTRICULAR
directions to avoid counting cells within pericardial DIMENSIONS. The most widely used clinical imaging
fat and blood vessel lumens. index for detection of cardiotoxicity is the LVEF,
Tissue sections were imaged on a fluorescent mi- which was not significantly reduced in DOX-treated
croscope (Nikon 80i, Nikon, Tokyo, Japan) and sub- rats at 4 weeks after initiation of treatment
endocardial and subepicardial fields for the anterior, compared with time-matched controls. Only after 6
septal, posterior, and lateral walls of the LV were weeks (p ¼ 0.0012) and 8 weeks (p ¼ 0.0009) did
imaged at 40 magnification for each tissue section. DOX-treated rats have a significant reduction in the
The number of cardiomyocytes with TUNEL-positive LVEF compared with time-matched controls
and DAPI costaining were counted manually per (Figure 2A). Similarly, global longitudinal strain, a
field using ImageJ software (version 1.6.0_24) (NIH, reported index of early cardiotoxicity, only trended to
Bethesda, Maryland) (analysis grid and cell counter). be lower in DOX-treated rats at 8 weeks (p ¼ 0.02)
The number of DAPI-stained nuclei was counted after initiation of treatment compared with time-
semiautomatically with a custom-developed matched controls (Figure 2B). Conversely, the global
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 383
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

F I G U R E 2 Transthoracic Echocardiography–Derived Systolic Function and Ventricular Dimensions

(A) Ejection fraction, (B) global longitudinal strain, (C) global radial strain, (D) left ventricular (LV) end-diastolic volume, (E) end-systolic
volume, and (F) relative wall thickness at baseline (CTL, n ¼ 10; DOX, n ¼ 10), and 4 weeks (CTL, n ¼ 10; DOX, n ¼ 10), 6 weeks (CTL, n ¼ 5;
DOX, n ¼ 5), and 8 weeks (CTL, n ¼ 5; DOX, n ¼ 4) following the initiation of chemotherapy in DOX-treated rats and time-matched controls.
*p < 0.01 between-group difference. Box plots display the median (horizontal bar), first quartile, third quartile, and minimum and maximum
values (whiskers). LVPwd ¼ left ventricular posterior wall thickness at end-diastole; LVID ¼ left ventricular internal diameter; other
abbreviations as in Figure 1.

radial strain, another reported early index of car- any decrease in the LVEF (Figure 3B). At 6 weeks, this
diotoxicity, was not significantly different between ratio was 56% higher in DOX-treated animals
the groups overall or at any time point (Figure 2C). compared with time-matched controls (p ¼ 0.03).
LV end-diastolic volumes were significantly Interestingly, we observed a modest inverse correla-
different between control and DOX-treated rats at 4 tion (r2 ¼ 0.65; p ¼ 0.01) between ejection fraction
weeks (p ¼ 0.0108) and 8 weeks (p ¼ 0.006) and in vivo myocardial ROS production at 6 weeks in
(Figure 2D). In addition, LV end-diastolic volumes in DOX-treated rats (n ¼ 4) and matched controls (n ¼ 4)
DOX-treated rats trended lower than controls at 6 (Figure 3C), suggesting that the magnitude of the
(p ¼ 0.048) (Figure 2D). Aligned with the LVEF decline in LV function is associated with an increase
changes, LV end-systolic volume trended to increase in myocardial ROS production. Similarly, LV end-
at 6 weeks (p ¼ 0.052) and was significantly increased systolic volume was modestly and directly corre-
at 8 weeks after the initiation of DOX treatment lated (r 2 ¼ 0.72; p ¼ 0.007) with 18
F-DHMT uptake in
compared with time-matched controls (p ¼ 0.0006) these rats (Figure 3D).
(Figure 2E). DOX treatment did not influence relative LV, liver, and blood SUV values for DOX-treated
wall thickness (2  posterior wall thickness/LV in- animals (and time-matched controls) at 4 and 6
ternal diameter) overall or at any time point weeks after DOX initiation are shown in
compared with controls (Figure 2F). Supplemental Table 1. At 4 weeks post-DOX initia-
18
MicroPET/CT F-DHMT IMAGING OF IN VIVO tion, the LV SUV tended to be lower in the
MYOCARDIAL ROS PRODUCTION. Representative DOX-treated animals compared with time-matched
18
F-DHMT microPET/CT images of each experimental controls (p ¼ 0.06), whereas both liver (p ¼ 0.007)
group are shown in Figure 3A. The myocardium-to- and blood pool (p ¼ 0.03) SUVs were significantly
blood ROS SUV ratio was 35% higher in DOX-treated lower in the DOX-treated animals compared with
animals compared with time-matched controls at 4 controls at this time. At 6 weeks post-DOX initiation,
weeks after initiation of treatment (p ¼ 0.03), before there were no differences in the LV SUV between
384 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

18
FIGURE 3 F-DHMT microPET/CT Imaging and Quantitation of the Myocardial ROS Activity Ratio

18
(A) Representative micro/PET (top row) and fused microPET/CT (bottom row) images following F-DHMT injection from a control and a
matched DOX-treated rat imaged at 4 weeks after chemotherapy initiation (left), and a control and corresponding DOX-treated rat imaged at
6 weeks following chemotherapy initiation (right). Each individual image is scaled to the blood pool SUV. (B) Quantified myocardial-to-blood
pool SUV ratios between controls (n ¼ 5) and DOX-treated rats (n ¼ 5) at 4 weeks, and controls (n ¼ 4) and DOX-treated rats (n ¼ 4) at 6
weeks following chemotherapy initiation. (C) Correlation between LVEF and LV 18F-DHMT uptake (myocardial-to-blood pool SUV), and (D)
18
between LV end-systolic volume and LV F-DHMT uptake (myocardial-to-blood pool SUV) in DOX-treated rats at 6 weeks (n ¼ 4) and
matched controls (n ¼ 4). *p < 0.05 between-group difference. Values are expressed as median with interquartile range. LVEF ¼ left ven-
tricular ejection fraction; ROS ¼ reactive oxygen species; SUV ¼ standardized uptake value; other abbreviations as in Figures 1 and 2.

DOX-treated animals and time-matched controls modest inverse linear correlation (r 2 ¼ 0.67; p ¼ 0.01)
18 99m
(p ¼ 0.34), whereas liver F-DHMT uptake was between ejection fraction and Tc-RP805 uptake in
significantly lower in DOX-treated animals compared DOX-treated rats (n ¼ 4) at 8 weeks and matched
with controls (p ¼ 0.03). At this time, blood pool SUVs controls (n ¼ 5) (Figure 4B), suggesting that a decline
also tended to be lower in the DOX-treated rats in LV function is associated with increased myocar-
compared with controls (p ¼ 0.06). dial MMP activity. Similarly, LV end-systolic volume
MYOCARDIAL 99m
Tc-RP805 ACTIVITY. Temporal had a direct linear correlation (r 2 ¼ 0.63; p ¼ 0.02)
99m
changes in the retention of 99m
Tc-RP805 in the with Tc-RP805 uptake in these rats (Figure 4C).
myocardium of the LV, which reflect myocardial MMP HISTOPATHOLOGY. Blinded review of H&E- and MT-
activity, are shown in Figure 4A for control and DOX- stained tissue confirmed graded cardiotoxicity asso-
99m
treated rats. At 4 weeks, Tc-RP805 retention was ciated with this rat model. As expected, control rats
nonsignificantly elevated in DOX-treated rats displayed no significant pathological findings.
compared with time-matched controls (p ¼ 0.056). Aligned with the model, DOX-treated rats euthanized
99m
However, at 8 weeks, Tc-RP805 retention was at 4 weeks had a nonsignificantly greater overall
significantly increased in DOX-treated rats compared severity score compared with time-matched control
with time-matched controls (p ¼ 0.01) and to DOX- rats (p ¼ 0.08) with some evidence of fibrosis,
treated rats at 4 weeks (p ¼ 0.01). inflammation, and myocardial degeneration. DOX-
In 8-week rats, we correlated LV systolic function treated rats euthanized at 8 weeks following chemo-
and dimensions with MMP activity to assess the therapy initiation had more progressive fibrosis, focal
relationship between changes in LV function and myocardial inflammation, and myocardial vacuola-
volumes to elevations in MMP activity. We observed a tion (degeneration) contributing to a nonsignificantly
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 385
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

99m
F I G U R E 4 LV Tc-RP805 Uptake

99m
(A) LV Tc-RP805 uptake between controls (n ¼ 5) and DOX-treated rats (n ¼ 5) at 4 weeks, and controls (n ¼ 5) and DOX-treated rats
(n ¼ 4) 8 weeks following chemotherapy initiation. Correlation between (B) LV ejection fraction and LV 99mTc-RP805 uptake, and (C) LV end-
systolic volume and LV 99mTc-RP805 uptake in DOX-treated rats at 8 weeks (n ¼ 4) and matched controls (n ¼ 5). **p ¼ 0.01 between-group
difference. ‡p < 0.05 within-group difference compared with 4-week rats. Values are expressed as median with interquartile range.
Inj. ¼ injected; MMP ¼ matrix metalloproteinase; other abbreviations as in Figures 1 to 3.

elevated overall severity score compared with DOX- DOX-treated rats, was associated with a significant
treated rats at 4 weeks and a significantly elevated increase in myocardial degeneration, MMP activation,
overall severity score compared with time-matched and cellular apoptosis. Thus, decline in LVEF, which
controls (p ¼ 0.02) (Figure 5). is typically used clinically for detection of car-
CELLULAR APOPTOSIS. Representative fluorescent diotoxicity, occurs at a point where irreversible
images for laminin, DAPI, and TUNEL stains, and a myocardial injury has already occurred.
merged image of these 3 stains are shown in DOX has been shown to increase ROS levels through
Figures 6A to 6D from a DOX-treated rat at 8 weeks. multiple pathways including, but not limited to,
The results of the quantitative analysis of TUNEL- mitochondrial redox cycling of iron–doxorubicin
positive staining for all rats is shown in Figure 6E. complexes (28), activation of the renin-angiotensin-
Unlike the observed progressive histopathologic aldosterone system (29), increased expression of
changes described in the preceding text, cellular nicotinamide adenine dinucleotide phosphate
apoptosis only trended to increase in DOX-treated (NADPH) oxidases (30), and changes in the mitochon-
rats at 8 weeks compared with time-matched con- drial and nuclear transcriptome (31). In addition, DOX
trols rats (p ¼ 0.06) and was significantly increased decreases reduced gluthathione levels and decreases
compared with DOX-treated rats at 4 weeks (p < 0.02) catalase activity, thus impairs the inherent cardiac
(Figure 6E). antioxidant defense system (11). The ROS-dependent
cardiotoxic effects of DOX are numerous and include
DISCUSSION apoptosis through direct DNA damage (11,12), a
reduction in mitochondrial function (32), increased
The major finding from the present study is that fibrosis and remodeling through direct activation and
18
F-DHMT, a novel ROS-targeted PET radiotracer, was increased expression of MMPs (13,14), up-regulation of
able to noninvasively detect an early elevation in the proinflammatory pathways (12), and altered
myocardial in vivo ROS production before a fall in the excitation–contraction coupling through impairing
LVEF in an established rodent model of progressive calcium dynamics (33). It appears that excessive ROS
DOX-induced cardiotoxicity. The early elevation in production is a key upstream event in DOX-induced
myocardial ROS production was associated with only cardiotoxicity, because numerous studies report an
mild histologic evidence of myocardial toxicity and improvement or reversal of cardiotoxicity with anti-
occurred before any significant activation of oxidant therapy (34–36) or direct manipulation of key
myocardial remodeling enzymes (e.g., MMP activity) molecular targets in ROS producing or quenching
or cellular apoptosis compared with controls. Other pathways (11,12,30,37). Our findings extend these prior
more sensitive echocardiographic indices of systolic observations, because we show that in vivo cardiac
18
function were also unchanged at this time of early ROS production with F-DHMT PET/CT imaging pre-
ROS activation. It is important to note that the sub- cedes the impairment in cardiac function often asso-
sequent drop in LVEF, which occurred over time in ciated with DOX-induced cardiotoxicity. Notably, a
386 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

factors other than elevated ROS production contrib-

F I G U R E 5 Histopathology Score
uted to MMP activation observed in this model.
Several noninvasive imaging modalities have been
proposed for early detection and prediction of car-
diotoxicity. Preclinical and clinical reports indicate the
use of myocardial deformation (e.g., global longitudi-
nal strain) imaging with echocardiography, although
the high technical variability of these methods and
nonstandardized analysis packages have led to
inconsistent support of these functional indices (6).
Similarly, perturbations in some echocardiographic
indices of diastolic function, such as prolonged iso-
volumic relaxation time, reduced mitral inflow veloc-
ity, a reduction in mitral inflow velocity/atrial flow
velocity, and a reduction in mitral inflow velocity
deceleration time have been shown to precede changes
Quantified cardiotoxicity grading (summed severity score)
in systolic function after anthracycline treatment (40–
between controls (n ¼ 5) and doxorubicin (DOX)-treated rats
(n ¼ 5) at 4 weeks, and controls (n ¼ 5) and DOX-treated rats
42). However, the poor reproducibility of these echo-
(n ¼ 4) 8 weeks following chemotherapy initiation. *p < 0.05 cardiographic indices of diastolic function has limited
between-group difference. Values are expressed as median their application as early indicators of anthracycline-
with interquartile range. induced cardiotoxicity (4). Magnetic resonance imag-
ing has also been applied for evaluation of early
myocardial edema and/or inflammation (T2-weighted
separate, independently acting mechanism of DOX- imaging) and early cardiac fibrosis/extracellular vol-
induced cardiotoxicity has been proposed that de- ume changes (T1-weighted imaging) in the setting of
scribes DOX binding to topoisomerase-2 b and DNA as a cardiotoxic chemotherapy agents (10,43); however,
trigger of cell death and transcriptome changes that the utility of these magnetic resonance indices remains
secondarily lead to excessive ROS formation (31). Our controversial due to conflicting reports (43,44).
findings of increased in vivo cardiac ROS production A few studies have proposed radiotracer-based
before cellular apoptosis are inconsistent with these molecular imaging methods as highly sensitive diag-
reports; however, it is unclear at this time how specific nostic tools for early detection of cardiotoxicity,
pathways that lead to cardiotoxicity may predomi- because these methods are able to directly target mo-
99m
nate, when they may be activated, and how they may lecular (apoptosis, Tc-annexin V), metabolic (fatty
123
interact. Differences in chemotherapy dosing and acid oxidation, I-beta-methyl-p-iodo-phenyl-
animal models may also account for discordance pentadecanoic acid), and physiological (sympathetic
123
between studies. denervation, I-metaiodobenzylguanidine) alter-
Accumulating preclinical evidence suggests ations associated with the underlying disease patho-
that activation of several MMP isoforms (MMP-1, -2, physiology and progression (45–47). Along these lines,
-9, -14) play a key role in acute and chronic we hypothesized that 18 F-DHMT PET imaging of in vivo
DOX cardiotoxicity by contributing to myocardial ROS production may be valuable for early detection of
fibrosis, collagen disorganization, and contractile DOX-induced cardiotoxicity, because increased ROS
dysfunction (13,14). Here, we observed an elevation in production plays a critical role in DOX-induced car-
myocardial MMP activity in DOX-treated rats observed diotoxicity. In accordance with this hypothesis, we
at a later time point following DOX therapy (8 weeks), show for the first time to our knowledge, that
18
but not in DOX-treated animals observed at an earlier F-DHMT imaging was able to detect an early eleva-
time point (4 weeks) compared with controls. In tion in cardiac ROS production before a fall in ejection
addition, we observed a modest correlation between fraction in a progressive rodent model of DOX-induced
systolic dysfunction and myocardial MMP activity in cardiotoxicity. These findings extend initial studies
DOX-treated rats at 8 weeks and matched controls. In that reported an w2-fold increase in 18 F-DHMT cardiac
agreement with other studies (14,38,39), our data uptake compared with controls following a 1-time
suggest that ROS production may lead to activation of bolus injection of DOX (20 mg/kg) in mice (19). As
myocardial MMPs, and that MMP activation contrib- compared with that acute model, the chronic model
utes, at least in part, to LV remodeling and dysfunc- used in the current work more adequately
tion. However, we cannot rule out the possibility that resembles clinically observed anthracycline-induced
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 387
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

F I G U R E 6 TUNEL Staining and Quantitation of Cellular Apoptosis

(A) Representative laminin, (B) DAPI, (C) TUNEL, and (D) a merged image of these 3 stains from a doxorubicin (DOX)-treated rat at 8 weeks
following chemotherapy initiation. Yellow arrows point to nuclei costained with DAPI and TUNEL that were considered positive. (B)
Quantified TUNEL-positive nuclei per 40 field (average over subendocardial and subepicardial fields for the lateral, septal, inferior, and
lateral walls) between controls (n ¼ 5) and DOX-treated rats (n ¼ 5) at 4 weeks, and controls (n ¼ 5) and DOX-treated rats (n ¼ 4) 8 weeks
following chemotherapy initiation. (E) ‡p < 0.05 within-group difference compared with 4-week rats. Values are expressed as median with
interquartile range. TUNEL ¼ terminal deoxynucleotidyl transferase-mediated nick-end labeling.

cardiotoxicity, which manifests as LV systolic and tracer clearance. Thus, SUV measurements pre-
dysfunction, is progressive, and typically occurs after sented herein only provide a semiquantitative
18
completion of chemotherapy (4). assessment of myocardial F-DHMT retention and
18
STUDY LIMITATIONS. First, F-DHMT oxidation and superoxide production in this complex model.
subsequent cellular retention largely reflect superox- Observed changes in the bioavailability of the tracer
ide activity. Therefore, the utility of measuring other between groups were addressed by correcting the LV
ROS, such as hydrogen peroxide with peroxy-caged- SUV to the blood SUV, which is appropriate for tracers
[ 18 F]fluorodeoxy thymidine-1 (PC- 18 F-FLT-1) (48) or that can be best characterized by a 2-tissue irreversible
redox status with 1-[C 11]methyl-1,4-dihydroquinoline- kinetic model. Because 18F-DHMT oxidation within the
11
3-carboxamide ( C-DHQ1) (49) using PET/CT for early myocardium is irreversible, the trend of ROS in
detection of DOX-induced cardiotoxicity is unknown. response to chemotherapy based on our calculation of
However, a large portion of cardiac ROS produced myocardium-to-blood pool SUV ratio is appropriate to
during DOX therapy arises from the mitochondria and account for potential confounding factors in the blood
NADPH oxidases, both sources of superoxide (30,37), and is expected to be directly proportional to quanti-
18
thus supporting the use and early rise of cardiac F- fication parameters (e.g., K i ) derived from the kinetic
18
DHMT uptake observed in this model. Second, it is analysis in dynamic PET. For example, a recent F-
18
possible that DOX influences F-DHMT myocardial FDG study reported that the ratio of tumor SUV to
kinetics, peripheral tissue uptake and metabolism, blood SUV derived from static PET had a much stronger
388 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

correlation with the retention index Ki derived from ACKNOWLEDGMENTS The authors gratefully
dynamic PET with kinetic modeling, when compared acknowledge the technical assistance of Nicole
with tumor SUV alone, because the SUV ratio reduced Mikush and Xiangning Wang of the Yale Translational
the residual interstudy variability of the input func- Research Imaging Center, along with the technical
tion in the SUV calculation (50). Ultimately, full staff at the Yale PET Center.
compartmental modeling with an arterial input func-
tion and high-performance liquid chromatography ADDRESS FOR CORRESPONDENCE: Dr. Albert J.
analysis of blood and tissue metabolites will be needed Sinusas, Section of Cardiovascular Medicine, Yale
to absolutely quantify myocardial 18F-DHMT retention University School of Medicine, P.O. Box 208017,
and superoxide production, although this approach Dana 3, New Haven, Connecticut 06520-8017, USA.
will be most effectively accomplished in larger animals E-mail: [email protected].
and humans. Third, we were unable to accurately
quantify diastolic function in these animal’s due to E-A
wave fusion, thus we cannot exclude the possibility PERSPECTIVES
that diastolic dysfunction may have preceded systolic
dysfunction in this model. Therefore, it is unknown at
18 COMPETENCY IN MEDICAL KNOWLEDGE 1:
this time whether F-DHMT PET imaging would out
Doxorubicin is an effective chemotherapy agent but is
perform this echocardiographic index of early
associated with cardiotoxicity. Current noninvasive
anthracycline-induced cardiotoxicity. Finally, the
screening methods for doxorubicin-induced cardiotox-
specific molecular pathways that led to the increase in
icity are based on the serial assessment of the LVEF.
cardiac superoxide production were not addressed in
However, the measurement of LVEF is variable and
this study, and are beyond the scope of this study.
unable to detect cardiotoxicity before overt, non-
However, measuring global superoxide production
18 reversible myocardial toxicity. Decades of basic science
with F-DHMT is valuable for diagnostic and predic-
research have indicated that ROS are key mediators in
tive applications in the early assessment of DOX-
doxorubicin-induced cardiotoxicity. Our study provides
induced cardiotoxicity and potentially other disease
evidence that PET/computed tomography imaging of
processes involving ROS activation, because superox- 18
F-DHMT, a marker of superoxide production, allows for
ide produced from all pathways contributes to aber-
early detection of cardiotoxicity in rodents, and that the
rant cell signaling and damage/death.
early elevation in myocardial 18F-DHMT uptake occurs

CONCLUSIONS before decrements in LVEF and overt myocardial toxicity

following doxorubicin administration.
18
F-DHMT PET/CT imaging was able to noninvasively
COMPETENCY IN MEDICAL KNOWLEDGE 2:
detect an early elevation in myocardial ROS produc-
Assessment of myocardial superoxide production can
tion in vivo, before a fall in LVEF in an established
be achieved noninvasively using PET imaging of
chronic rodent model of progressive DOX-induced 18
F-DHMT. The application of this technique in cancer
cardiotoxicity. Importantly, this early elevation in
patients receiving doxorubicin or other anthracyclines
myocardial ROS was associated with only mild
may facilitate the early detection of cardiotoxicity,
myocardial toxicity, and no significant changes in
thereby helping to guide optimal oncological treat-
MMP activity or cellular apoptosis. On the other hand,
ment and avoid cardiotoxicity.
a fall in the LVEF was associated with higher levels of
ROS production, more advanced myocardial toxicity,
TRANSLATIONAL OUTLOOK: Studies in large an-
activation of myocardial MMPs, and cellular
18
imal models of anthracycline-induced cardiotoxicity
apoptosis. These preliminary data suggest that F-
and in cancer patients receiving anthracycline
DHMT PET/CT imaging may allow for early assess-
chemotherapy are warranted to determine the po-
ment of cardiotoxicity that precedes the often- 18
tential clinical utility of F-DHMT PET imaging for
irreversible decline in systolic function in cancer pa-
early detection of cardiotoxicity. The ability to detect
tients receiving DOX. Future investigations should
18
in vivo myocardial superoxide production with
focus on evaluating the ability of F-DHMT PET/CT 18
F-DHMT PET imaging also provides the opportunity
imaging to predict changes in systolic dysfunction
to apply this tracer in other cardiovascular diseases in
with DOX therapy and evaluate therapeutic in-
which excessive production of ROS contributes to
terventions to limit cardiotoxicity in order to fully
disease progression.
elucidate the clinical potential of this ROS-targeted
radiotracer.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Boutagy et al. 389
JUNE 2018:378–90 PET Cardiac Reactive Oxygen Species Imaging

REFERENCES

1. Yeh ET, Bickford CL. Cardiovascular complica- metalloproteinases in rats. Acta Pharmacol Sin 30. Zhao Y, McLaughlin D, Robinson E, et al. Nox2
tions of cancer therapy: incidence, pathogenesis, 2012;33:459–69. NADPH oxidase promotes pathologic cardiac
diagnosis, and management. J Am Coll Cardiol remodeling associated with Doxorubicin chemo-
15. Putt M, Hahn VS, Januzzi JL, et al. Longitudinal
2009;53:2231–47. therapy. Cancer Res 2010;70:9287–97.
changes in multiple biomarkers are associated
2. Swain SM, Whaley FS, Ewer MS. Congestive with cardiotoxicity in breast cancer patients 31. Zhang S, Liu X, Bawa-Khalfe T, et al. Identifi-
heart failure in patients treated with doxorubicin: treated with doxorubicin, taxanes, and trastuzu- cation of the molecular basis of doxorubicin-
a retrospective analysis of three trials. Cancer mab. Clin Chem 2015;61:1164–72. induced cardiotoxicity. Nat Med 2012;18:1639–42.
2003;97:2869–79.
16. Gilliam LA, Fisher-Wellman KH, Lin C-T, 32. Clementi ME, Giardina B, Di Stasio E,
3. Von Hoff DD, Layard MW, Basa P, et al. Risk Maples JM, Neufer PD. Doxorubicin impairs skel- Mordente A, Misiti F. Doxorubicin-derived me-
factors for doxorubicin-induced congestive heart etal muscle mitochondrial respiratory capacity in tabolites induce release of cytochrome C and in-
failure. Ann Intern Med 1979;91:710–7. skeletal muscle. FASEB J 2012;26:1144. 8. hibition of respiration on cardiac isolated
mitochondria. Anticancer Res 2003;23:2445–50.
4. Russell RR, Alexander J, Jain D, et al. The role 17. Kalender Y, Yel M, Kalender S. Doxorubicin
and clinical effectiveness of multimodality imag- hepatotoxicity and hepatic free radical metabolism 33. Timolati F, Ott D, Pentassuglia L, et al.
ing in the management of cardiac complications of in rats: the effects of vitamin E and catechin. Neuregulin-1 beta attenuates doxorubicin-induced
cancer and cancer therapy. J Nucl Cardiol 2016;23: Toxicology 2005;209:39–45. alterations of excitation-contraction coupling and
856–84. reduces oxidative stress in adult rat car-
18. Pelicano H, Carney D, Huang P. ROS stress in diomyocytes. J Mol Cell Cardiol 2006;41:845–54.
5. Ewer MS, Ali MK, Mackay B, et al. A comparison
cancer cells and therapeutic implications. Drug
of cardiac biopsy grades and ejection fraction es- 34. Dong Q, Chen L, Lu Q, et al. Quercetin atten-
Resist Updat 2004;7:97–110.
timations in patients receiving adriamycin. J Clin uates doxorubicin cardiotoxicity by modulating
Oncol 1984;2:112–7. 19. Chu W, Chepetan A, Zhou D, et al. Develop- Bmi-1 expression. Brit J Pharmcol 2014;171:
ment of a PET radiotracer for non-invasive imag- 4440–54.
6. Thavendiranathan P, Poulin F, Lim K-D,
ing of the reactive oxygen species, superoxide,
Plana JC, Woo A, Marwick TH. Use of myocardial 35. Chandran K, Aggarwal D, Migrino RQ, et al.
in vivo. Org Biomol Chem 2014;12:4421–31.
strain imaging by echocardiography for the early Doxorubicin inactivates myocardial cytochrome c
detection of cardiotoxicity in patients during and 20. Zhang W, Cai Z, Li L, et al. Optimized and oxidase in rats: cardioprotection by Mito-Q. Bio-
after cancer chemotherapy: a systematic review. automated radiosynthesis of [18F] DHMT for phys J 2009;96:1388–98.
J Am Coll Cardiol 2014;63:2751–68. translational imaging of reactive oxygen species
36. Seifert CF, Nesser ME, Thompson DF. Dexra-
with positron emission tomography. Molecules
7. Cardinale D, Colombo A, Lamantia G, et al. zoxane in the prevention of doxorubicin-induced
2016;21:1696.
Anthracycline-induced cardiomyopathy: clinical cardiotoxicity. Ann Pharmacother 1994;28:
relevance and response to pharmacologic therapy. 21. Su H, Spinale FG, Dobrucki LW, et al. Nonin- 1063–72.
J Am Coll Cardiol 2010;55:213–20. vasive targeted imaging of matrix metal-
37. Ichikawa Y, Ghanefar M, Bayeva M, et al. Car-
loproteinase activation in a murine model of
8. Ky B, Putt M, Sawaya H, et al. Early increases in diotoxicity of doxorubicin is mediated through
postinfarction remodeling. Circulation 2005;112:
multiple biomarkers predict subsequent car- mitochondrial iron accumulation. J Clin Invest
3157–67.
diotoxicity in patients with breast cancer treated 2014;124:617–30.
with doxorubicin, taxanes, and trastuzumab. J Am 22. Loening AM, Gambhir SS. AMIDE: a free soft-
38. Spallarossa P, Altieri P, Garibaldi S, et al. Ma-
Coll Cardiol 2014;63:809–16. ware tool for multimodality medical image anal-
trix metalloproteinase-2 and-9 are induced
ysis. Mol Imaging 2003;2:131–7.
9. Serrano JM, Gonzalez I, Del Castillo S, et al. differently by doxorubicin in H9c2 cells: the role
Diastolic dysfunction following anthracycline- 23. Seg3D: volumetric image segmentation and of MAP kinases and NAD (P) H oxidase. Cardiovasc
based chemotherapy in breast cancer patients: visualization (Software). Scientific Computing and Res 2006;69:736–45.
incidence and predictors. Oncologist 2015;20: Imaging Institute (SCI) (2015) Available at: http:// 39. Siwik DA, Colucci WS. Regulation of matrix
864–72. www.seg3d.org. Accessed March 2018. metalloproteinases by cytokines and reactive ox-
10. Vasu S, Hundley WG. Understanding cardio- 24. Sahul ZH, Mukherjee R, Song J, et al. Targeted ygen/nitrogen species in the myocardium. Heart
vascular injury after treatment for cancer: an imaging of the spatial and temporal variation of Fail Rev 2004;9:43–51.
overview of current uses and future directions of matrix metalloproteinase activity in a porcine 40. Tassan-Mangina S, Codorean D, Metivier M,
cardiovascular magnetic resonance. J Cardiovasc model of postinfarct remodeling relationship to et al. Tissue Doppler imaging and conventional
Magn Reson 2013;15:66. myocardial dysfunction. Circ Cardiovasc Imaging echocardiography after anthracycline treatment in
11. Mukhopadhyay P, Rajesh M, Batkai S, et al. 2011;4:381–91. adults: early and late alterations of left ventricular
Role of superoxide, nitric oxide, and peroxynitrite 25. Montgomery RR, Booth CJ, Wang X, Blaho VA, function during a prospective study. Eur J Echo-
in doxorubicin-induced cell death in vivo and Malawista SE, Brown CR. Recruitment of macro- cardiogr 2006;7:141–6.
in vitro. Am J Physiol Heart Circ Physiol 2009;296: phages and polymorphonuclear leukocytes in 41. Marchandise B, Schroeder E, Bosly A, et al.
H1466–83. Lyme carditis. Infect Immun 2007;75:613–20. Early detection of doxorubicin cardiotoxicity: in-
12. Wang S, Kotamraju S, Konorev E, Kalivendi S, terest of Doppler echocardiographic analysis of
26. Otsu N. A threshold selection method from
Joseph J, Kalyanaraman B. Activation of nuclear left ventricular filling dynamics. Am Heart J 1989;
gray-level histograms. IEEE Trans Syst Man
factor-kappaB during doxorubicin-induced 118:92–8.
Cybern Syst 1979;9:62–6.
apoptosis in endothelial cells and myocytes is
42. Stoddard MF, Seeger J, Liddell NE, Hadley TJ,
pro-apoptotic: the role of hydrogen peroxide. 27. Meyer F. Topographic distance and watershed
Sullivan DM, Kupersmith J. Prolongation of iso-
Biochem J 2002;367:729–40. lines. Signal processing 1994;38:113–25.
volumetric relaxation time as assessed by Doppler
13. Polegato BF, Minicucci MF, Azevedo PS, et al. 28. Rochette L, Guenancia C, Gudjoncik A, et al. echocardiography predicts doxorubicin-induced
Acute doxorubicin-induced cardiotoxicity is asso- Anthracyclines/trastuzumab: new aspects of car- systolic dysfunction in humans. J Am Coll Cardiol
ciated with matrix metalloproteinase-2 alterations diotoxicity and molecular mechanisms. Trends 1992;20:62–9.
in rats. Cell Physiol Biochem 2015;35:1924–33. Pharmacol Sci 2015;36:326–48.
43. Jordan JH, D’Agostino RB Jr., Hamilton CA, et al.
14. Ivanova M, Dovinova I, Okruhlicova L, et al. 29. Toko H, Oka T, Zou Y, et al. Angiotensin II type Longitudinal assessment of concurrent changes in
Chronic cardiotoxicity of doxorubicin involves 1a receptor mediates doxorubicin-induced cardio- left ventricular ejection fraction and left ventricular
activation of myocardial and circulating matrix myopathy. Hypertgens Res 2002;25:597–603. myocardial tissue characteristics after administration
390 Boutagy et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PET Cardiac Reactive Oxygen Species Imaging JUNE 2018:378–90

of cardiotoxic chemotherapies using T1-weighted 47. Saito K, Takeda K, Okamoto S, et al. Detection of 50. van den Hoff J, Oehme L, Schramm G, et al.
and T2-weighted cardiovascular magnetic reso- doxorubicin cardiotoxicity by using iodine-123 BMIPP The PET-derived tumor-to-blood standard up-
nance. Circ Cardiovasc Imaging 2014;7:872–9. early dynamic SPECT: quantitative evaluation of early take ratio (SUR) is superior to tumor SUV as a
abnormality of fatty acid metabolism with the Rut- surrogate parameter of the metabolic rate of
44. Neilan TG, Coelho-Filho OR, Pena-Herrera D,
land method. J Nucl Cardiol 2000;7:553–61. FDG. EJNMMI Res 2013;3:77.
et al. Left ventricular mass in patients with a car-
diomyopathy after treatment with anthracyclines. 48. Carroll V, Michel BW, Blecha J, et al.
Am J Cardiol 2012;110:1679–86. A boronate-caged [18F] FLT probe for
hydrogen peroxide detection using positron KEY WORDS cardiotoxicity, doxorubicin,
45. Bennink RJ, van den Hoff MJ, van Hemert FJ, et al. emission tomography. J Am Chem Soc 2014; positron emission tomography, reactive
Annexin V imaging of acute doxorubicin cardiotoxicity 136:14742–5. oxygen species
(apoptosis) in rats. J Nucl Med 2004;45:842–8.
49. Okamura T, Okada M, Kikuchi T, Wakizaka H,
46. Carrió I, Estorch M, Berná L, Lopez-Pousa J, Zhang M-R. A 11C-labeled 1, 4-dihydroquinoline
Tabernero J, Torres G. Indium-111-antimyosin and derivative as a potential PET tracer for imaging of A PPE NDI X For an expanded Methods section
iodine-123-MIBG studies in early assessment of doxo- redox status in mouse brain. J Cereb Blood Flow as well as a supplemental table, please see the
rubicin cardiotoxicity. J Nucl Med 1995;36:2044–9. Metab 2015;35:1930–6. online version of this paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

PRECLINICAL RESEARCH

A Morpholino Oligomer Therapy Regime

That Restores Mitochondrial Function and
Prevents mdx Cardiomyopathy
Helena M. Viola, PHD,a Victoria P.A. Johnstone, PHD,a Abbie M. Adams, BSC HONS,b Susan Fletcher, PHD,b,c
Livia C. Hool, PHDa,d

VISUAL ABSTRACT
HIGHLIGHTS

DMD patients develop reduced myocardial

metabolic activity and dilated
cardiomyopathy due to the absence of
dystrophin.

Current clinical trials demonstrate
patients receiving PMO therapy exhibit
accumulation of functional dystrophin and
improved ambulation; however, cardiac
abnormalities remain.

Utilizing the murine model of the disease
(mdx), we identify a novel early-intervention
PMO treatment regimen for the prevention of
DMD cardiomyopathy.

Pre-cardiomyopathic mdx mice were
administered a nontoxic, long-term, high-
dose PMO treatment regimen.

Treated mdx mice exhibited accumulation
of functional dystrophin, restoration of
cardiac metabolic activity, and did not
develop the cardiomyopathy.

Viola, H.M. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):391–402.

From the aSchool of Human Sciences, The University of Western Australia, Crawley, Western Australia, Australia; bCentre for
Comparative Genomics, Murdoch University, Murdoch, Western Australia, Australia; cPerron Institute for Neuroscience and
Translational Science, and Centre for Neuromuscular and Neurological Disorders, The University of Western Australia, Nedlands,
Western Australia, Australia; and the dVictor Chang Cardiac Research Institute, Sydney, New South Wales, Australia. This study
was supported by a grant from the National Health and Medical Research Council of Australia and Australian Research Council
(1062740). Dr. Viola is supported by a grant from Raine Priming (RPG50). Dr. Hool is a National Health and Medical Research
Council Senior Research Fellow (APP1002207). Dr. Fletcher and Ms. Adams were supported by grants from the Muscular Dys-
trophy Association USA (272200) and the National Health and Medical Research Foundation of Australia (1062740 and 1043758);
and receive support from Sarepta Therapeutics. Dr. Fletcher is a consultant to Sarepta Therapeutics; and is named as inventor on
patents licensed to Sarepta Therapeutics. The phosphorodiamidate morpholino oligomers used in this study were a gift from Sarepta

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.03.007

392 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

ABBREVIATIONS
SUMMARY
AND ACRONYMS

DMD = Duchenne muscular Current clinical trials demonstrate Duchenne muscular dystrophy (DMD) patients receiving phosphorodiami-
dystrophy date morpholino oligomer (PMO) therapy exhibit improved ambulation and stable pulmonary function;
ICa-L = L-type Ca2D channel however, cardiac abnormalities remain. Utilizing the same PMO chemistry as current clinical trials, we have
JC-1 = 5,5’,6,6’-tetrachloro- identified a non-toxic PMO treatment regimen that restores metabolic activity and prevents DMD cardio-
1,1’,3,3’-tetraethylbenzimidazolyl-
myopathy. We propose that a treatment regimen of this nature may have the potential to significantly
carbocyanine iodide
improve morbidity and mortality from DMD by improving ambulation, stabilizing pulmonary function, and
mdx = murine model of
Duchenne muscular dystrophy
preventing the development of cardiomyopathy. (J Am Coll Cardiol Basic Trans Science 2018;3:391–402)
© 2018 The Authors. Published by Elsevier on behalf of the American College of Cardiology Foundation. This is an
PMO = phosphorodiamidate
morpholino oligomer open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
RT-PCR = reverse transcriptase

D
polymerase chain reaction

wt = wild type uchenne muscular dystrophy Massachusetts) (9,10). However, established cardiac
Jm = mitochondrial membrane (DMD) is a fatal X-linked disease abnormalities consistent with the DMD phenotype
potential
that affects 1 in 3,600 to 6,000 remain in these patients.
live male births (1,2). It is caused by a lack Using the murine model of Duchenne muscular
of expression of dystrophin, an important cytoskel- dystrophy (mdx mice), we previously identified a
etal protein that plays a role in maintaining structural novel mechanism by which absence of expression of
integrity in muscle cells (3). DMD patients exhibit dystrophin leads to myocardial metabolic dysfunc-
muscle degeneration primarily in skeletal muscles tion and compromised cardiac function in mdx hearts
(2). However, in addition to this, patients develop (11). This involves a structural and functional
dilated cardiomyopathy that is associated with cyto- communication breakdown between the L-type
skeletal protein disarray, contractile dysfunction, Ca2þchannel (I Ca-L ) and mitochondria. We have
and reduced myocardial metabolic activity (4,5). demonstrated that in addition to regulation of
Approximately 20% of DMD patient deaths result calcium-dependent mechanisms, the cardiac I Ca-L
from dilated cardiomyopathy (6). plays an important role in regulating mitochondrial
Approximately 70% of DMD-causing mutations are function through structural and functional commu-
located between exons 45 and 55 (7). The effect of nication via cytoskeletal proteins, independently of
several therapeutic approaches on DMD cardiac pa- alterations in intracellular calcium (11,12). Myocytes
thology have been investigated, with varying degrees isolated from mdx mice that exhibit cytoskeletal
of efficacy reported (8). Effective therapy must be disarray due to the absence of dystrophin, exhibit
able to induce expression of dystrophin while impaired I Ca-L regulation of mitochondrial function
improving function without inducing toxicity. We (11). Importantly, this lack of response occurs in both
have utilized a nontoxic phosphorodiamidate mor- pre- and post-cardiomyopathic mdx mice, suggesting
pholino oligomer (PMO) therapy that induces skip- that metabolic dysfunction precedes development of
ping of dystrophin exon 51, resulting in accumulation the cardiomyopathy (11).
of truncated, functional dystrophin. Current clinical We have previously shown that long-term,
trials demonstrate improved ambulation and stable low-dose treatment of pre-cardiomyopathic mdx
pulmonary function in DMD patients receiving this mice with an antisense oligomer of the same
treatment (30 or 50 mg/kg/week, Phase 2b Eteplirsen PMO chemistry administered clinically to DMD pa-
Study 202, Sarepta Therapeutics, Cambridge, tients (13), partially restores mitochondrial function

Therapeutics (Cambridge, Massachusetts) to Sue Fletcher at Murdoch University, for the purpose of investigation of exon skipping
and expression of dystrophin in the heart, diaphragm and tibialis anterior. All in vitro and in vivo assessment of cardiac function
was performed in the Cardiovascular Electrophysiology Laboratory of Livia Hool at The University of Western Australia, where no
financial benefit or research funds were received from Sarepta Therapeutics. All other authors have reported that they have no
relationships relevant to the contents of this paper to disclose.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’ in-
stitutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information, visit
the JACC: Basic to Translational Science author instructions page.

Manuscript received February 12, 2018; accepted March 15, 2018.

JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Viola et al. 393
JUNE 2018:391–402 PMO Therapy to Prevent mdx Cardiomyopathy

in response to activation of I Ca-L in cardiac myo-

T A B L E 1 RT-PCR Primers Used to Amplify Dystrophin Exons 20 to 26
cytes isolated from treated mice (11). Because
metabolic dysfunction precedes the mdx cardiomy- PCR Primer Sequence 50 -30 Expected Size (bp)

opathy, we reasoned that early PMO treatment and Mouse exon 20-26 outer MExon20F CAGAATTCTGCCAATTGCTGAG
MExon26R TTCTTCAGCTTGTGTCATCC
subsequent restoration of metabolic function may
Mouse exon 20-26 inner MExon20F CCCAGTCTACCACCCTATCAGAGC 900
prove beneficial in the prevention of DMD cardio-
MExon26R CCTGCCTTTAAGGCTTCCTT
myopathy. Here, we treated mdx mice long term
with a high concentration (120 mg/kg/week), yet bp ¼ base pairs; RT-PCR ¼ reverse transcriptase polymerase chain reaction.

non-toxic PMO dosing regimen that commenced

prior to the development of the cardiomyopathy.
This treatment regimen completely restored mito-
Kingdom) and Alexafluor 488 secondary antibody
chondrial function and prevented subsequent
(goat anti-rabbit immunoglobulins, A11008, 1:400
development of the cardiomyopathy.
dilution; Thermo Fisher Scientific, Melbourne,
METHODS Australia). Detailed methods are provided in the
Supplemental Methods.
ANIMAL MODEL AND PMO TREATMENTS. Male ISOLATION OF VENTRICULAR MYOCYTES. Animals
C57BL/10ScSn-Dmdmdx/Arc (mdx) and C57BL/10ScSnArc were anesthetized with intraperitoneal injection of
wild-type (wt) mice were used for all studies. Exper- pentobarbitone sodium (240 mg/kg) prior to excision
iments were performed in myocytes isolated from 3 to of the heart. Cells were isolated based on methods
9 mice for each experimental group. Four- to 5-day- described (11,18). Detailed methods are provided in
old mdx mice were treated with either 40 mg/kg PMO the Supplemental Methods.
M23D (Sarepta Therapeutics), 3 per week or 120 mg/
FLUORESCENT STUDIES. All studies were performed
kg PMO M23D once per week by subcutaneous injec-
in intact mouse cardiac myocytes at 37  C.
tion for 3 weeks. In other studies, 24-week-old C57BL/
Fluorescent indicator 5,5’,6,6’-tetrachloro-1,1’,3,3’-
10ScSn-Dmdmdx/Arc (mdx) mice were treated with
tetraethylbenzimidazolylcarbocyanine iodide (JC-1)
40 mg/kg PMO M23D 3 per week for 19 weeks (M23D
was used to measure mitochondrial membrane po-
was a generous gift from Sarepta Therapeutics). Age-
tential ( J m) as described previously (19). Flavopro-
matched untreated wt and mdx counterparts were
tein autofluorescence was used to measure
used for comparisons. All animal studies were
flavoprotein oxidation based on previously described
approved by the Animal Ethics Committee of the
methods (20,21). Detailed methods are provided in
University of Western Australia and Murdoch Uni-
the Supplemental Methods.
versity in accordance with the Australian Code of
Practice for the Care and Use of Animals for Scientific 3 - ( 4 , 5 - D I M E T H Y L- 2 - T H I A Z O L Y L ) - 2 , 5 - D I P H E N Y L-

Purposes (14). 2H-TETRAZOLIUM BROMIDE A S S A Y. The rate

of cleavage of 3-(4,5-dimethyl-2-thiazolyl)-2,5-
RIBONUCLEIC ACID PREPARATION AND RT-PCR
diphenyl-2H-tetrazolium bromide to formazan by
ANALYSIS. Total ribonucleic acid was extracted
the mitochondrial electron transport chain was
from cardiac muscle using a MagMax-96 Total RNA
measured spectrophotometrically as previously
Isolation Kit (Ambion, Melbourne, Australia), and
described (11,12). Each n represents the number of
reverse transcriptase polymerase chain reaction (RT-
replicates for each treatment group from myocytes
PCR) was performed for analysis of exons 20 to 26
isolated from a total of 9 wt, 6 mdx, and 6 PMO-
using a Superscript III One-step PCR system with
treated mdx hearts. Detailed methods are provided
Platinum Taq (Invitrogen, Melbourne, Australia).
in the Supplemental Methods.
Primers are listed in Table 1. Detailed methods are
provided in the Supplemental Methods. ECHOCARDIOGRAPHY. Echocardiographic measure-
IMMUNOBLOTTING AND IMMUNOSTAINING. Dystro- ment of left ventricular function were performed on
phin in cardiac muscle was assessed by immunoblot mice under light methoxyflurane anesthesia using an
with NCL-DYS2 (Novocastra Laboratories, Newcastle- i13L probe on a Vivid 7 Dimension (GE Healthcare,
upon-Tyne, United Kingdom) (15), using a protocol Little Chalfont, United Kingdom) as previously
derived from previously described methodology described (20,21). Quantitative measurements repre-
(16,17). Immunohistochemistry was performed on sent the average of 24- 30-, 38-, and 43-week-old wt
heart, diaphragm, and tibialis anterior cryosections (n ¼ 3), mdx (n ¼ 3 to 5), and PMO-treated mdx (n ¼ 4
using rabbit anti-dystrophin primary antibody to 9) mice. Detailed methods are provided in the
(ab15277, 1:200 dilution; Abcam, Cambridge, United Supplemental Appendix.
394 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

SERUM PARAMETERS OF KIDNEY AND LIVER that does not act as an agonist (BayK[þ]) did not
TOXICITY FOLLOWING IN VIVO TREATMENT. significantly alter Jm in wt or mdx myocytes
Following treatment, mice were anaesthetized, ter- (Figure 1C). As a positive control, mdx myocytes were
minal blood collected, and serum extracted to mea- exposed to adenosine triphosphatase synthase
sure kidney and liver toxicity. Urea, creatinine, and blocker oligomycin, resulting in a significant increase
alanine transaminase concentration was assessed in JC-1 fluorescence demonstrating functional elec-
using urea, creatinine, and alanine transaminase tron transport (Figure 1C). Mitochondrial electron
assay kits (BioAssay Systems, Hayward, California). transport blocker NaCN collapsed J m in all myocytes
STATISTICAL ANALYSIS. Results are reported as demonstrating that the signal was mitochondrial in
mean  SEM. Statistical significance was accepted at origin (Figure 1B). These data indicate that treatment
p < 0.05 using the Kruskal-Wallis or Mann-Whitney U of pre-cardiomyopathic mdx mice with a short-term,
test for nonparametric data (GraphPad Prism version high-dose PMO treatment regimen partially restores
5.04, GraphPad, San Diego, California). the increase in Jm measured in response to activation
of I Ca-L .
RESULTS Metabolic activity is dependent on oxygen con-
sumption and electron flow down the inner mito-
EFFECT OF TREATMENT OF PRE-CARDIOMYOPATHIC chondrial membrane. Therefore, we examined
MDX MICE WITH A SHORT-TERM, HIGH-DOSE PMO alterations in mitochondrial electron transport in
TREATMENT REGIMEN. We previously demonstrated intact cardiac myocytes by measuring alterations in
that treatment of pre-cardiomyopathic mdx mice with flavoprotein oxidation. Consistent with previous
10 mg/kg/week PMO for 24 weeks partially restored findings, BayK(–) caused a significant increase in
increases in J m and metabolic activity in response to flavoprotein oxidation in myocytes from 4-week-old
activation of I Ca-L in cardiac myocytes (11). Because wt mice that was prevented with nisoldipine
the half-life of dystrophin is shorter in cardiac versus (Figure 1E) (11). No alteration was observed in age-
skeletal muscle (22), a higher PMO dose may induce matched mdx myocytes (Figures 1D and 1E). Howev-
more skipping of dystrophin exon 23 and accumula- er, myocytes isolated from 4-week-old mdx mice
tion of functional dystrophin in the heart. Therefore, treated with either PMO dosing regimen exhibited a
we investigated the effect of a short-term, but high- significant increase in flavoprotein oxidation in
concentration PMO treatment (120 mg/kg/week), on response to BayK(–) (Figures 1D and 1E). Both treat-
Jm and metabolic activity. First we treated 4- to 5- ment regimens rescued the response. BayK(þ) did not
day old pre-cardiomyopathic mdx mice (11), with significantly alter flavoprotein oxidation in wt or
either 40 mg/kg PMO 3 per week for 3 weeks, or 120 mdx myocytes (Figure 1E). Mitochondrial electron
mg/kg PMO once per week for 3 weeks. Cardiac up- transport chain uncoupler carbonyl cyanide-4-
take of PMO was then determined as evidence of exon (trifluoromethoxy)phenylhydrazone increased flavo-
skipping using RT-PCR. Treatment with both dosing protein signal confirming the signal was
regimens resulted in exon skipping (Figure 1A). mitochondrial in origin (Figures 1D and 1E). These data
Next, we examined the efficacy of a short-term, indicate that treatment of pre-cardiomyopathic mdx
high-dose PMO treatment regimen on alterations in mice with a short-term, high-dose PMO treatment
Jm and metabolic activity induced by activation of regimen restores metabolic activity in the mdx heart.
I Ca-L in cardiac myocytes. Consistent with previous EFFECT OF TREATMENT OF PRE-CARDIOMYOPATHIC
findings under calcium-free conditions, application of MDX MICE WITH A LONG-TERM, HIGH-DOSE PMO
I Ca-L agonist BayK(–) elicited a significant increase in TREATMENT REGIMEN. We investigated whether a
Jm assessed as changes in JC-1 fluorescence in myo- long-term, high PMO treatment dose (120 mg/kg/
cytes from 4-week-old wt mice that was attenuated week) would more effectively restore J m and meta-
with application of I Ca-L antagonist nisoldipine bolic activity in mdx cardiac myocytes, compared
(Figure 1C) (11,12). No change in Jm was observed in with short-term treatment. The 24-week-old pre-
age-matched mdx myocytes (Figures 1B and 1C). cardiomyopathic mdx mice were treated with 40
However, myocytes from 4-week-old mdx mice mg/kg PMO M23D 3 per week for 19 weeks. Rather
treated with either PMO treatment regimen exhibited than 1 weekly dose, a triweekly treatment regimen
a significant increase in J m in response to BayK(–) was used because multiple injections may improve
(Figures 1B and 1C). Both treatment regimens partially PMO distribution and prolong half-life (22). Cardiac
rescued the response compared with the response of uptake of PMO was then examined by assessing exon
wt mice. Application of the (þ)enantiomer of BayK skipping using RT-PCR and detecting the presence of
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Viola et al. 395
JUNE 2018:391–402 PMO Therapy to Prevent mdx Cardiomyopathy

F I G U R E 1 Short-Term, High-Dose Treatment of 4- to 5-Day-Old mdx Mice With PMO Results in Exon Skipping of Dystrophin, and Partial
Restoration of J m and Flavoprotein Oxidation in Response to Activation of I Ca-L

(A) Reverse transcriptase polymerase chain reaction on cardiac ribonucleic acid from phosphorodiamidate morpholino oligomer (PMO)-treated
murine model of Duchenne muscular dystrophy (mdx) mice demonstrating exon 23 skipping (D 23 687 base pairs [bp]), as indicated by
asterisks, and untreated mdx and wild-type (wt) control mice. (B) Representative ratiometric 5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzi-
midazolylcarbocyanine iodide (JC-1) fluorescence recorded in myocytes from PMO-treated mdx mice, and an untreated mdx mouse before
and after exposure to 10 mM BayK(–) under calcium-free conditions (0 mM Ca2þ). (C) Mean  SEM of JC-1 fluorescence for all myocytes
exposed to drugs as indicated. (D) Representative traces of flavoprotein fluorescence recorded in myocytes from PMO-treated mdx mice and
an untreated mdx mouse before and after exposure to 10 mM BayK(–). (E) Mean  SEM of flavoprotein fluorescence for all myocytes exposed
to drugs as indicated. PMO treatments: 40 mg/kg (3/week) or 120 mg/kg (1/week) for 3 weeks. BayK(þ) ¼ 10 mM; FCCP ¼ 50 mM carbonyl
cyanide-4-(trifluoromethoxy)phenylhydrazone; ICa-L ¼ L-type Ca2þ channel; NaCN ¼ 40 mM sodium cyanide; Nisol ¼ 15 mM nisoldipine;
NS ¼ not significant; Oligo, 20 mM oligomycin; -ve ¼ negative control; Jm, mitochondrial membrane potential.

dystrophin on immunoblot and immunohistochem- We also examined the efficacy of a long-term, high-
istry. This treatment regimen resulted in exon skip- dose PMO treatment regimen on restoring Jm in
ping (Figure 2A) and positive expression of dystrophin isolated cardiac myocytes. Under calcium-free con-
(Figures 2B and 2C). ditions, BayK(–) elicited a significant increase in J m
396 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

F I G U R E 2 Long-Term, High-Dose Treatment of 24-Week-Old mdx Mice With PMO Results in Exon Skipping and Expression of Dystrophin

(A) Reverse transcriptase polymerase chain reaction performed on cardiac muscle ribonucleic acid from PMO-treated mdx mice demonstrating
exon 23 skipping (D 23 687 bp) (indicated by asterisk) and age-matched untreated mdx and wt control mice. The 22/23 541 bp amplicon
represents an out-of-frame transcript missing exons 22 and 23 and has been previously reported (37,38). (B) Immunoblot performed on
cardiac muscle from untreated wt (5%, 2%, and 1% dilutions), untreated mdx mice (undiluted), and PMO-treated mdx mice (undiluted)
demonstrating presence of dystrophin (indicated by asterisk). (C) Immunostaining of heart cryosections from untreated wt and mdx mice
and PMO-treated mdx mice demonstrating presence of dystrophin. Bars ¼ 100 mm. PMO treatment: 40 mg/kg PMO 3 per week for 19
weeks; other abbreviations as in Figure 1.

in wt myocytes that was attenuated with nisoldipine (Figures 3A and 3B). The response was attenuated
(Figure 3B). No alteration was observed in age- with nisoldipine (Figure 3B). BayK(þ) did not signifi-
matched mdx myocytes (Figures 3A and 3B). Howev- cantly alter Jm in wt or mdx myocytes (Figure 3B).
er, treatment of mdx mice with 40 mg/kg PMO 3 per Oligomycin induced a significant increase in JC-1
week for 19 weeks completely rescued this response fluorescence in mdx myocytes demonstrating
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Viola et al. 397
JUNE 2018:391–402 PMO Therapy to Prevent mdx Cardiomyopathy

F I G U R E 3 Long-Term, High-Dose Treatment of 24-Week-Old mdx Mice With PMO Completely Restores J m and Flavoprotein Oxidation in
Response to Activation of I Ca-L

(A) Representative ratiometric JC-1 fluorescence recorded in myocytes from a PMO-treated mouse and an untreated mdx mouse before and
after exposure to 10 mM BayK(–)  15 mM nisoldipine (Nisol) under calcium-free conditions (0 mM Ca2þ). Arrow indicates addition of drugs.
(B) Mean  SEM of JC-1 fluorescence for all myocytes exposed to drugs as indicated. (C) Representative traces of flavoprotein fluorescence
recorded in myocytes from a PMO-treated mouse and an untreated mdx mouse before and after exposure to 10 mM BayK(–)  15 mM
nisoldipine (Nisol). Arrow indicates addition of drugs. (D) Mean  SEM of flavoprotein fluorescence for all myocytes exposed to drugs as
indicated. BayK(þ) ¼ 10 mM; FCCP ¼ 50 mM carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone; NaCN ¼ 40 mM sodium cyanide; PMO
treatment ¼ 40 mg/kg PMO 3 per week for 19 weeks; Oligo ¼ 20 mM oligomycin; other abbreviations as in Figure 1.

functional electron transport (Figure 3B). Application myocytes confirming the signal was mitochondrial in
of NaCN collapsed Jm in all myocytes demonstrating origin (Figures 3C and 3D).
that the signal was mitochondrial in origin Metabolic activity was also assessed by measuring
(Figure 3A). These data indicate that treatment of pre- alterations in mitochondrial electron transport in
cardiomyopathic mdx mice with a long-term, high- intact cardiac myocytes, as formation of formazan
dose PMO treatment regimen completely restores the from tetrazolium salt (3-[4,5-dimethyl-2-thiazolyl]-
increase in Jm in response to activation of I Ca-L . 2,5-diphenyl-2H-tetrazolium bromide). Consistent
We also investigated the efficacy of a long-term, with previous findings, BayK(–) elicited a significant
high-dose PMO treatment regimen on metabolic ac- increase in metabolic activity in 43-week-old wt mice
tivity. BayK(–) caused a significant increase in flavo- that was prevented with nisoldipine (Figure 4B) (11).
protein oxidation in myocytes from 43-week-old wt The response was also attenuated with mitochondrial
mice that was prevented with nisoldipine (Figure 3D). calcium uniporter (mitochondrial calcium uptake)
No alteration was observed in age-matched mdx blocker Ru360, but not with ryanodine receptor
myocytes (Figures 3C and 3D). However, myocytes (sarcoplasmic reticulum calcium release) blocker
isolated from 43-week-old mdx mice treated with PMO dantrolene (Figure 4B). No alteration was observed in
exhibited a significant increase in flavoprotein in age-matched mdx myocytes (Figures 4A and 4B).
response to BayK(–) that was attenuated by nisoldi- However, myocytes isolated from 43-week-old mdx
pine (Figures 3C and 3D). BayK(þ) did not significantly mice treated with PMO exhibited a significant in-
alter flavoprotein oxidation in wt or mdx myocytes crease in metabolic activity in response to BayK(–)
(Figure 3D). Carbonyl cyanide-4-(trifluoromethoxy) that could be attenuated by nisoldipine or Ru360, but
phenylhydrazone increased flavoprotein signal in all not dantrolene (Figures 4A and 4B). BayK(þ) did not
398 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

F I G U R E 4 Long-Term, High-Dose Treatment of 24-Week-Old mdx Mice With PMO Completely Restores Metabolic Activity in Response to
Activation of I Ca-L

(A) Formation of formazan measured as change in absorbance in myocytes from untreated wt and mdx mice and PMO-treated mice (40 mg/kg
PMO 3 per week for 19 weeks), after addition of 10 mM BayK(þ) or BayK(–). (B) Mean  SEM of increases in absorbance for all myocytes
exposed to drugs as indicated. Dant ¼ 20 mM dantrolene; Nisol ¼ 15 mM nisoldipine; Oligo ¼ 20 mM oligomycin; Ru360 ¼ 15 mM; other
abbreviations as in Figure 1.

significantly alter metabolic activity in wt, mdx, or and after treatment with 40 mg/kg PMO M23D 3
PMO-treated mdx myocytes (Figures 4A and 4B). Oli- per week for 19 weeks. Twenty-four-week-old mdx
gomycin induced a significant decrease in metabolic mice exhibited no significant difference in any
activity in all myocytes demonstrating the myocytes echocardiographic parameter compared with un-
were metabolically active (Figure 4B). These data treated wt mice, indicating that these mice were
indicate that treatment of pre-cardiomyopathic mdx pre-cardiomyopathic (Figures 5A and 5B). Consistent
mice with a long-term, high-dose PMO treatment with the development of dilated cardiomyopathy,
regimen restores metabolic activity in the mdx heart. untreated mdx mice, compared with age-matched
TREATMENT OF PRE-CARDIOMYOPATHIC MDX MICE untreated wt mice, exhibited a significant increase
WITH A LONG-TERM, HIGH-DOSE PMO TREATMENT in left ventricular end-systolic diameter (from 38
REGIMEN PREVENTS THE DEVELOPMENT OF weeks) and left ventricular end-diastolic diameter
CARDIOMYOPATHY. We examined the efficacy of a (at 43 weeks) and a significant decrease in fractional
long-term, high-dose PMO treatment regimen on shortening (from 38 weeks) (Figures 5A and 5B).
the development of cardiomyopathy. Serial echo- PMO treatment significantly decreased left ventric-
cardiography was performed on mdx mice before ular end-systolic diameter (from 38 weeks) and left
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Viola et al. 399
JUNE 2018:391–402 PMO Therapy to Prevent mdx Cardiomyopathy

F I G U R E 5 Long-Term, High-Dose Treatment of 24-Week-Old mdx Mice With PMO Prevents Development of mdx Cardiomyopathy and Is
Not Toxic

(A) Representative images of serial echocardiographic measurements from PMO-treated mdx mice and untreated wt and mdx mice pre- (24
weeks) and post-treatment (Rx; 43 weeks). (B) Mean  SEM of all echocardiographic measurements. *p < 0.05 compared with untreated
age-matched wt; #p < 0.05 compared with untreated age-matched mdx. (C) Mean  SEM of urea, creatinine, and alanine transaminase (ALT)
concentrations in PMO-treated mice compared to untreated mdx mice. bpm ¼ beats/min; FS ¼ fractional shortening; HR ¼ heart rate; IVDS ¼
intraventricular septum in diastole; IVSS ¼ intraventricular septum in systole; LVEDD ¼ left ventricular end-diastolic diameter; LVESD ¼ left
ventricular end-systolic diameter; LVDPW ¼ left ventricular posterior wall in diastole; LVSPW ¼ left ventricular posterior wall in systole; PMO
Rx ¼ 40 mg/kg PMO 3 per week for 19 weeks; other abbreviations as in Figure 1.
400 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

ventricular end-diastolic diameter (at 43 weeks) and treatment (0.5 to 6 mg/kg for 5 weeks, followed by 6
significantly increased fractional shortening (from mg/kg for 12 weeks) versus placebo cohorts, but by
38 weeks) to values comparable to those of age- week 49, the difference was no longer significant
matched untreated wt counterparts (Figures 5A and (27,28). A subsequent phase 3 double-blinded pla-
5B). These data indicate that treatment of pre- cebo-controlled study involving prolonged treatment
cardiomyopathic mdx mice with a long-term, high- of DMD patients with 6 mg/kg/week (48 weeks) did
dose PMO treatment regimen prevents development not improve ambulation (6-min walk test) or sec-
of mdx cardiomyopathy. ondary assessments of motor function (29).
LONG-TERM, HIGH-DOSE PMO TREATMENT Furthermore, adverse events including kidney and
REGIMEN IS NOT TOXIC IN VIVO. Following long- liver toxicity, likely to be off-target effects of the 2 0 O-
term, high-dose PMO treatment, serum was extrac- methylated phosphorothioate backbone, were re-
ted and used to measure kidney and liver toxicity. ported in 46% of patients (27,28,30).
Urea, creatinine, and alanine transaminase concen- PMO consist of a 6-membered morpholine ring
trations were measured. We found no evidence of moiety, joined by phosphorodiamidate linkages.
toxicity following treatment of the mice (Figure 5C). Unlike phosphorothioates, the backbone carries no
charge at physiological pH, reducing off-target ef-
DISCUSSION fects (31). PMO are nontoxic and stable (32). A phase
2 randomized placebo-controlled study involving
DMD patients exhibit progressive muscle degenera- treatment of 8 DMD boys (7 to 13 years of age) with
tion primarily in skeletal and cardiac muscles. Ad- 30 or 50 mg/kg/week (24 weeks) demonstrated a
vances in respiratory care have resulted in an increase significant increase in dystrophin production in
in life expectancy for DMD patients over the last half- these patients (Eteplirsen Study 201, Sarepta Thera-
century; however, this prolongation of life has been peutics). With this, the placebo group joined the
accompanied by an increasing number of patients PMO treatment group. All 12 patients continued
experiencing from an ultimately fatal dilated cardio- receiving PMO treatment in an ongoing extension
myopathy (23). The effect of several therapeutic ap- study for over 3 years (phase 2b Eteplirsen Study
proaches on DMD cardiac pathology have been 202, Sarepta Therapeutics) (9). At week 168, the
investigated, with varying degrees of efficacy (8). continuously treated ambulatory patients continued
This includes use of antisense oligonucleotides to to walk within 18% of their week-12 distance,
alter exon or splice site selection in order to restore whereas the placebo/delayed treatment cohort
the correct dystrophin reading frame (24) and pro- continued to walk within 23% of their week-36 dis-
duction of a truncated, but functional dystrophin tance (10). Pulmonary function remained stable in
protein. these patients, and the hallmark decline in respira-
Because approximately 70% of DMD-causing mu- tion observed in DMD patients appears to have been
tations are located between exons 45 and 55 (7), the repressed. Furthermore, no clinically significant
majority of antisense oligonucleotides therapeutic treatment-related adverse events have been
development to date has focused on exon skipping observed. However, cardiac abnormalities consistent
within this region. It has been estimated that skipping with the DMD phenotype remain in these patients.
exons 51, 45, and 53 could benefit 13%, 8.1%, and 7.7% Effective therapy must be able to improve cardiac
of all DMD mutations, respectively (25). Two types of function and prevent ultimately fatal dilated car-
modified antisense oligonucleotides have been eval- diomyopathy, without inducing toxicity.
uated clinically for exon 51 skipping in DMD patients, The mdx mouse manifests a mild dystrophic
including 2 0 O-methylated phosphorothioate and phenotype relative to the human disease and is
PMO. Both have elicited recovery in skeletal and therefore not regarded as an ideal clinical model for
pulmonary function, but with limited ability to pre- DMD. However, it provides an excellent molecular
vent progressive cardiac decline (8). model for the study of dystrophin function and novel
2 0 O-methylated phosphorothioate oligonucleo- therapeutics. Using the mdx mouse model of DMD, we
tides consist of a phosphorothioate backbone that previously identified that cytoskeletal disarray due to
contains internucleotide linkages that confer a the absence of dystrophin results in impaired regu-
negative charge, resulting in enhanced binding to lation of mitochondrial function by I Ca-L (11). Impor-
circulatory proteins and an increase in plasma half- tantly, we identified that this decrease in myocardial
life (26). A phase 1 to 2a trial of this compound re- metabolic activity occurs in pre-cardiomyopathic mdx
ported an improvement in the 6-min walk test in mice and persists through to the development of the
DMD patients 25 weeks following commencement of cardiomyopathy (11).
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Viola et al. 401
JUNE 2018:391–402 PMO Therapy to Prevent mdx Cardiomyopathy

Cardiomyopathy in DMD patients shows variable development of mdx cardiomyopathy (11). Here we
onset and severity, with no clear correlation be- find that a long-term, high-dose yet nontoxic PMO
tween genotype and phenotype. Conflicting reports treatment regimen that commences prior to the
on such an association are likely due to small sample development of mdx cardiomyopathy completely re-
size, variability in cardiac function analysis, clinical stores metabolic function and, subsequently, pre-
care and cardiac medications, and unverified con- vents development of the cardiomyopathy. This
sequences of the mutation on dystrophin transcript study utilized the same PMO chemistry used in cur-
and/or protein (33–35). Patients with the same DMD rent clinical trials demonstrating that DMD patients
genotype can show very different severity and age of receiving this treatment exhibit improved ambulation
onset of left ventricular dysfunction and, ultimately, and stable pulmonary function (9,10). However, car-
survival (35). This confounds the interpretation of diac abnormalities consistent with the DMD pheno-
potential treatment-related effects. Although car- type remain in these patients. Based on our current
diomyopathy in the mdx mouse is relatively mild findings, we propose that a long-term, high-dose PMO
with late onset, this model has allowed us to treatment regimen that commences prior to the
investigate the mechanistic basis of metabolic development of cardiomyopathy may have the po-
dysfunction in the dystrophic heart and the conse- tential to concurrently improve ambulation, stabilize
quences of partial restoration of a functional dys- pulmonary function, and prevent cardiomyopathy in
trophin. We have demonstrated that a long-term, DMD patients.
low-dose PMO treatment regimen partially restores
regulation of cardiac metabolic activity by I Ca-L (11). ADDRESS FOR CORRESPONDENCE: Dr. Livia C. Hool,
Based on the success of current long-term, 30 to 50 Physiology M311, School of Human Sciences (Physi-
mg/kg/week PMO trials on improving ambulation ology), The University of Western Australia, 35 Stir-
and pulmonary function, and the knowledge that the ling Highway, Crawley, WA, 6009, Australia. E-mail:
half-life of dystrophin is shorter in cardiac versus [email protected].
skeletal muscle (22), we reasoned that a higher PMO
dose may induce a higher level of skipping of dys-
PERSPECTIVES
trophin exon 23 and expression of functional dys-
trophin in the mdx heart.
COMPETENCY IN MEDICAL KNOWLEDGE: Advances in
Initial studies indicated that treatment of pre-
respiratory care have resulted in an increase in life expectancy for
cardiomyopathic mdx mice with a high PMO dose
DMD patients over the last half-century; however, this prolon-
(120 mg/kg/week) for 3 weeks was sufficient to induce
gation of life has been accompanied by an increasing number of
exon skipping and partially rescue alterations in Jm
patients suffering from an ultimately fatal dilated cardiomyop-
and metabolic activity in response to activation of I Ca-L
athy. Approximately 20% of DMD patient deaths result from
(Figure 1) (11). Based on these findings, we proposed
dilated cardiomyopathy. Current clinical trials demonstrate that
that a long-term, high-dose treatment regimen would
PMO therapy induces skipping of dystrophin exon 51 and accu-
result in a more complete restoration of Jm and
mulation of functional dystrophin, and that these patients exhibit
metabolic activity. We find that administering pre-
improved ambulation and stable pulmonary function; however,
cardiomyopathic mdx mice with 40 mg/kg PMO 3
cardiac abnormalities remain. Effective therapy must be able to
per week for 19 weeks induced exon skipping and
improve cardiac function and prevent ultimately fatal dilated
expression of dystrophin in the heart (Figure 2),
cardiomyopathy without inducing toxicity. Utilizing the same
completely rescued alterations in J m and metabolic
PMO chemistry as current clinical trials, we have identified a
activity (Figures 3 and 4), prevented development of
nontoxic PMO treatment regimen to restore metabolic activity
the cardiomyopathy, and, importantly, is not toxic
and prevent mdx cardiomyopathy.
in vivo (Figure 5). Consistent with previous studies, we
find that PMO treatment results in accumulation of as
TRANSLATIONAL OUTLOOK: The efficacy of a long-term,
little as 5% of normal dystrophin protein expression in
high-dose PMO treatment regimen in DMD patients will now
mdx mice (Figure 2B) (36). Importantly, this is suffi-
need to be determined. We propose that a treatment regimen of
cient to result in functional improvement in the mdx
this nature may have the potential to significantly improve
heart (Figures 5A and 5B).
morbidity and mortality from DMD because in addition to
Using the mdx mouse model of DMD, we previously
improving ambulation and stabilizing pulmonary function, the
identified that cytoskeletal disarray due to the
treatment will prevent the development of cardiomyopathy in
absence of dystrophin results in impaired regulation
DMD patients.
of mitochondrial function by I Ca-L (11). Additionally,
we identified that metabolic dysfunction precedes
402 Viola et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

PMO Therapy to Prevent mdx Cardiomyopathy JUNE 2018:391–402

REFERENCES

1. Emery AE. The muscular dystrophies. Lancet 15. Fletcher S, Honeyman K, Fall AM, Harding PL, 28. Voit T, Topaloglu H, Straub V, et al. Safety
2002;359:687–95. Johnsen RD, Wilton SD. Dystrophin expression in and efficacy of drisapersen for the treatment
the mdx mouse after localised and systemic of Duchenne muscular dystrophy (DEMAND
2. Bushby K, Finkel R, Birnkrant DJ, et al., for the
administration of a morpholino antisense oligo- II): an exploratory, randomised, placebo-
DMD Care Considerations Working Group. Diag-
nucleotide. J Gene Med 2006;8:207–16. controlled phase 2 study. Lancet Neurol
nosis and management of Duchenne muscular
2014;13:987–96.
dystrophy, part 1: diagnosis, and pharmacological 16. Cooper ST, Lo HP, North KN. Single section
and psychosocial management. Lancet Neurol Western blot: improving the molecular diagnosis 29. GlaxoSmithKline. A clinical study to assess
2010;9:77–93. of the muscular dystrophies. Neurology 2003;61: the efficacy and safety of gsk2402968 in
93–7. subjects with Duchenne muscular dystrophy.
3. Gao QQ, McNally EM. The dystrophin complex:
structure, function, and implications for therapy. 2013. Available at: https://clinicaltrials.gov/
17. Nicholson LV, Davison K, Falkous G, et al.
Compr Physiol 2015;5:1223–39. ct2/show/NCT01254019. Accessed May 2018.
Dystrophin in skeletal muscle. I. Western blot
4. Finsterer J, Stollberger C. The heart in human analysis using a monoclonal antibody. J Neurol Sci 30. Flanigan KM, Voit T, Rosales XQ, et al. Phar-
dystrophinopathies. Cardiology 2003;99:1–19. 1989;94:125–36. macokinetics and safety of single doses of drisa-
persen in non-ambulant subjects with Duchenne
5. Khairallah M, Khairallah R, Young ME, Dyck JR, 18. Viola HM, Davies SM, Filipovska A, Hool LC.
muscular dystrophy: results of a double-blind
Petrof BJ, Des Rosiers C. Metabolic and signaling The L-type Ca2þ channel contributes to alter-
randomized clinical trial. Neuromuscul Disord
alterations in dystrophin-deficient hearts precede ations in mitochondrial calcium handling in the
2014;24:16–24.
overt cardiomyopathy. J Mol Cell Cardiol 2007;43: mdx ventricular myocyte. Am J Physiol Heart Circ
119–29. Physiol 2013;304:H767–75. 31. Douglas AG, Wood MJ. Splicing therapy for
neuromuscular disease. Mol Cell Neurosci 2013;
6. Shirokova N, Niggli E. Cardiac phenotype of 19. Viola HM, Arthur PG, Hool LC. Transient
56:169–85.
Duchenne muscular dystrophy: insights from exposure to hydrogen peroxide causes an increase
cellular studies. J Mol Cell Cardiol 2013;58:217–24. in mitochondria-derived superoxide as a result of 32. Amantana A, Iversen PL. Pharmacokinetics and
sustained alteration in L-type Ca2þ channel biodistribution of phosphorodiamidate morpholino
7. Muntoni F, Torelli S, Ferlini A. Dystrophin and antisense oligomers. Curr Opin Pharmacol 2005;5:
function in the absence of apoptosis in ventricular
mutations: one gene, several proteins, multiple 550–5.
myocytes. Circ Res 2007;100:1036–44.
phenotypes. Lancet Neurol 2003;2:731–40.
20. Viola H, Johnstone V, Cserne Szappanos H, 33. Jefferies JL, Eidem BW, Belmont JW, et al.
8. Johnstone VP, Viola HM, Hool LC. Dystrophic Genetic predictors and remodeling of dilated car-
et al. The role of the L-type Ca2þ channel in
cardiomyopathy-potential role of calcium in diomyopathy in muscular dystrophy. Circulation
altered metabolic activity in a murine model of
pathogenesis, treatment and novel therapies. 2005;112:2799–804.
hypertrophic cardiomyopathy. J Am Coll Cardiol
Genes (Basel) 2017;8:E108.
Basic Trans Science 2016;1:61–72. 34. Brinkmeyer-Langford C, Balog-Alvarez C,
9. Mendell JR, Goemans N, Lowes LP, et al., for Cai JJ, Davis BW, Kornegay JN. Genome-wide as-
21. Viola H, Johnstone V, Szappanos HC, et al. The
the Eteplirsen Study Group and Telethon Foun- sociation study to identify potential genetic
L-type Ca channel facilitates abnormal metabolic
dation DMD Italian Network. Longitudinal effect of modifiers in a canine model for Duchenne
activity in the cTnI-G203S mouse model of hy-
eteplirsen versus historical control on ambulation muscular dystrophy. BMC Genomics 2016;17:665.
pertrophic cardiomyopathy. J Physiol 2016;594:
in Duchenne muscular dystrophy. Ann Neurol
4051–70. 35. Ashwath ML, Jacobs IB, Crowe CA,
2016;79:257–71.
22. Wu B, Lu P, Cloer C, et al. Long-term rescue of Ashwath RC, Super DM, Bahler RC. Left ventricular
10. Pane M, Mazzone ES, Sormani MP, et al. 6 dysfunction in Duchenne muscular dystrophy and
dystrophin expression and improvement in muscle
Minute walk test in Duchenne MD patients with genotype. Am J Cardiol 2014;114:284–9.
pathology and function in dystrophic mdx mice by
different mutations: 12 month changes. PLoS One
peptide-conjugated morpholino. Am J Pathol 36. Li D, Yue Y, Duan D. Marginal level dystrophin
2014;9:e83400.
2012;181:392–400. expression improves clinical outcome in a strain of
11. Viola HM, Adams AM, Davies SM, Fletcher S, dystrophin/utrophin double knockout mice. PLoS
23. Spurney CF. Cardiomyopathy of Duchenne
Filipovska A, Hool LC. Impaired functional One 2010;5:e15286.
muscular dystrophy: current understanding and
communication between the L-type calcium
future directions. Muscle Nerve 2011;44:8–19. 37. Mann CJ, Honeyman K, Cheng AJ, et al.
channel and mitochondria contributes to meta-
bolic inhibition in the mdx heart. Proc Natl Acad 24. Wilton SD, Veedu RN, Fletcher S. The em- Antisense-induced exon skipping and synthesis of
Sci U S A 2014;111:E2905–14. peror’s new dystrophin: finding sense in the noise. dystrophin in the mdx mouse. Proc Natl Acad Sci
Trends Mol Med 2015;21:417–26. U S A 2001;98:42–7.
12. Viola HM, Arthur PG, Hool LC. Evidence for
regulation of mitochondrial function by the L-type 25. Aartsma-Rus A, Fokkema I, Verschuuren J, 38. Mann CJ, Honeyman K, McClorey G, Fletcher S,
Ca2þ channel in ventricular myocytes. J Mol Cell et al. Theoretic applicability of antisense-mediated Wilton SD. Improved antisense oligonucleotide
exon skipping for Duchenne muscular dystrophy induced exon skipping in the mdx mouse model of
Cardiol 2009;46:1016–26.
mutations. Hum Mutat 2009;30:293–9. muscular dystrophy. J Gene Med 2002;4:644–54.
13. Gebski BL, Mann CJ, Fletcher S, Wilton SD.
Morpholino antisense oligonucleotide induced 26. Bennett CF, Swayze EE. RNA targeting thera-
dystrophin exon 23 skipping in mdx mouse muscle. peutics: molecular mechanisms of antisense oli-
Hum Mol Genet 2003;12:1801–11. gonucleotides as a therapeutic platform. Annu Rev KEY WORDS cardiomyopathy, L-type
Pharmacol Toxicol 2010;50:259–93.
14. National Health and Medical Research Council. calcium channels, mitochondria
Australian Code of Practice for the Care and Use of 27. Goemans NM, Tulinius M, van den Akker JT,
Animals for Scientific Purposes. 8th edition. Can- et al. Systemic administration of PRO051 in Du-
berra, Australian Capital Territory: National Health chenne’s muscular dystrophy. N Engl J Med 2011; A PPE NDI X For supplemental material,
and Medical Research Council, 2013. 364:1513–22. please see the online version of this paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHOR. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

TRANSLATIONAL TOOLBOX

Expanding Patient Access to

Investigational New Drugs
Overview of Intermediate and Widespread Treatment
Investigational New Drugs, and Emergency Authorization
in Public Health Emergencies

Gail A. Van Norman, MD

SUMMARY

Individual patients with life-threatening or severely debilitating diseases can petition the U.S. Food and Drug Adminis-
tration (FDA) through their physicians to have expanded access (EA) to drugs that are in clinical trials but have not
reached full FDA approval (the “single-patient” investigational new drug [IND] application). Additionally, recent state
and federal laws—so-called “right to try legislation”—allow patients to approach drug companies directly for access prior
to FDA approval. While these pathways provide potential access for individual patients to investigational drugs, different
EA pathways permit entire groups of certain patients to access investigational drugs prior to FDA approval. This review
focuses on special categories of EA INDs intended for multiple patients—the intermediate-group IND and the widespread-
treatment IND—as well as emergency authorization for use of investigational drugs and biological products (e.g.,
vaccines) in public health emergencies. (J Am Coll Cardiol Basic Trans Science 2018;3:403–14) © 2018 The Author.
Published by Elsevier on behalf of the American College of Cardiology Foundation. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

U .S. Food and Drug Administration (FDA)

approval is required for interstate transport
and marketing of drugs for human con-
sumption in the United States (1,2). The FDA approval
the FDA objects. Thereafter, the average time for
completion of all clinical trials is about 8 years (1,3).
For patients with life-threatening or severely
debilitating disease, the wait for approval is simply
process begins when an investigational new drug too long, and can both abolish hope for those who
(IND) is filed with the FDA. The IND filing provides diseases will be quickly fatal, and lead to sustained or
the drug investigators with an exemption to the law even permanent disability for those whose diseases
prohibiting interstate transport of nonapproved linger but are without effective proven therapies.
drugs so that investigational substances can be Spurred by patient advocacy during the early days of
distributed to researchers. It also launches FDA moni- the acquired immunodeficiency syndrome (AIDS)
toring of in-human testing, through periodic reports, epidemic in the late 1980s, and facilitated by subse-
inspections, and audits throughout clinical trials to quent legislative efforts over the next 20 years, reg-
demonstrate efficacy and safety in humans. Drug ulatory initiatives permit the FDA to release drugs for
testing can begin 30 days after an IND filing unless use in individual patients through expanded access

From the Department of Anesthesiology and Pain Medicine, University of Washington, Seattle, Washington, USA. Dr. Van Norman has
received financial support from the Journal of the American College of Cardiology.
The author attests he is in compliance with human studies committees and animal welfare regulations of the authors’ institutions
and Food and Drug Administration guidelines, including patient consent where appropriate. For more information, visit the JACC:
Basic to Translational Science author instructions page.

Manuscript received February 8, 2018; accepted February 23, 2018.

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.02.001

404 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

ABBREVIATIONS (EA) INDs (4,5), in many cases allowing of the 20th century, the newer mission of ensuring
AND ACRONYMS emergency treatment with nonapproved that marketed drugs are actually efficacious for their
drugs within hours of application, and advertised/approved use. EA for a single patient may
CMV = cytomegalovirus
nonemergency treatment within an average not present much of a challenge to the assertion that
EA = expanded access
of 4 days (6). Further, most states have a drug’s benefits outweigh the risks, because as
EUA = emergency use
enacted so-called “right to try” legislation, presumably the patient requesting compassionate
authorization
permitting “compassionate use” of investi- use faces an otherwise dismal clinical future, taking
FDA = U.S. Food and Drug
Administration
gational drugs by individual patients through even significant risks with a new drug still presents
applications directly to the manufacturer (6). potential benefits to a patient without other options.
IND = investigational new drug
It should be noted that although the terms Early in a drug’s regulatory pathway, however, it is
REMS = risk evaluation and
mitigation strategy “compassionate use” or “preapproval access” not usually possible to ensure that a drug has a
STEPS = System for
are often used informally to refer to the reasonable risk/benefit ratio for all patients,
Thalidomide Education and use of an investigational drug to treat a including those in the early stages of disease.
Prescribing Safety program patient outside of a clinical trial, these terms Drug companies face bigger issues when the seeker
are not defined or described in FDA regulations, which of EA is a group of patients or an entire class of patients.
simply refer to expanded access to investigational Before marketing, manufacture of the drug for clinical
drugs. studies is nearly an “all cost” proposition for the com-
The call for EA is not limited to individual patients. mercial entity; the drug cannot be marketed to cover its
Advocacy organizations have pressed for groups of costs. Thus, companies generally only manufacture
patients with rare and/or “orphan” diseases, for sufficient quantities (plus a small margin) to cover the
example, to be able to access promising new therapies requirements of clinical studies, rather than devote
prior to their approval. Indeed, social media is resources to manufacturing large quantities of a drug
increasingly becoming a consumer/patient advocacy which has a <10% chance of ever making it to market
tool for implementing FDA regulatory changes and (1,2). The FDA approval process begins with the filing of
promoting access to investigational therapeutics (7). an investigational new drug (IND). Making the drug
In addition, once a drug has completed phase 3 available to groups or classes of patients who might
testing and is awaiting approval, patients who have then deplete the supply of drug for clinical studies
benefited from in-trial treatments may want could compromise the very research that would more
continued therapy, and such use requires some form completely disclose a drug’s risks and benefits; thus, it
of “bridging approval” from the FDA to allow poten- could possibly impede full market approval that would
tially large groups of patients to continue treatment make the drug more widely available.
while final FDA approval is pending. Companies have also expressed concern about how
A previous review discussed individual patient data from such “compassionate use” may be applied
emergency and nonemergency access to investiga- in the approval process. Patients seeking EA are
tional drugs (6). This review will focus on FDA EA for usually sicker and have more advanced disease, and
intermediate-sized groups of patients (the “interme- therefore are more likely to experience unfavorable
diate-sized IND”) and EA for entire classes of patients outcomes of all types. Their experience does not
(the “widespread treatment use” IND), as well as necessarily apply to the entire patient population for
emergency release of investigational drugs and bi- which the drug is eventually targeted. An excess
ologics for use in public health emergencies. number of adverse outcomes in a compassionate use
group could compromise marketing approval after
PITFALLS IN COMPASSIONATE USE clinical studies are complete.
Finally, if the drug is made available to a large
Releasing investigational new drugs to individual enough patient base prior to marketing approval,
patients who are facing certain death or disability then what patients would be willing to subject
seems to be a relatively uncomplicated decision, but themselves to placebo-controlled trials, in which they
allowing EA to entire groups of patients for treat- might not receive the active therapy? Patient
ment with an investigational new drug presents recruitment for clinical studies could be compro-
more complex regulatory, logistical, and ethical mised, which could slow or even prevent the clinical
challenges for scientists, commercial entities, and trials process for full drug approval.
the FDA. The current regulatory process from IND Such concerns are not merely theoretical, but have
filing to drug approval has evolved and includes not in fact caused significant controversy and potentially
only the FDA’s historical primary mission of impeded the approval of some important medical
ensuring patient safety, but also, since the latter half treatments.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Van Norman 405
JUNE 2018:403–14 Intermediate and Widespread Expanded Use IND

THE GANCICLOVIR STORY peripheral retinopathy, but no patients would enroll.

An attempt was made to “force” patients to sign up by
Probably no drug better illustrates the pitfalls of denying victims of early or less severe retinitis access
compassionate use than ganciclovir, the first com- to ganciclovir through compassionate use exemp-
pound discovered with activity against human cyto- tions. These actions were met by a severe public
megalovirus (CMV), which can cause devastating backlash: doctors simply began declaring any patient
disease in immunocompromised patients. In 1984, with CMV retinitis as having a “sight threatening”
Syntex Corporation (later integrated into the Roche condition, while patients refused enrollment in the
group) was engaged in animal studies of ganciclovir clinical trial. AIDS advocates lobbied Congress for
when a physician requested the drug under a compas- improved access to investigational drugs, and sit-ins
sionate use agreement with the FDA to treat a young began in protest. Ultimately, the FDA succumbed to
mother dying of CMV pneumonia (8). Unfortunately, public pressure and approved ganciclovir 5 years after
the woman died despite treatment. CMV infection was its first in-human treatment use.
emerging as the cause of death in up to 30% of patients Prior to ganciclovir, the FDA did have mechanisms
with AIDS, attacking the retina, lungs, liver, brain, by which they could approve the use of experimental
spinal cord, and intestines, and only a few weeks later drugs for individual patients; however, the struggle
another physician requested compassionate use of to approve ganciclovir and public advocacy during
ganciclovir in a 41-year-old man with advanced AIDS the AIDS epidemic had 2 critical effects on future drug
who was going blind from CMV retinitis. Based on this approval processes: 1) a large patient advocacy group
second patient’s dramatic and quantifiable improve- demonstrated its ability to move government regu-
ment, Syntex decided they had an ethical obligation to lations toward early access and streamlined drug
provide the drug when requested, and developed a approval; and 2) compassionate use was opened up
written protocol setting criteria of documented for entire groups of patients, rather than being
immunocompromise and CMV infection that was an restricted to individuals. Regulations have evolved
immediate threat to life or sight (8). In 1986, a series of over the last 35 years, and now formalized pathways
26 patients who received the drug under compas- exist at the FDA that permit EA to intermediate pa-
sionate use was published in the New England Journal tient groups and entire patient classes.
of Medicine, documenting the first effective treatment
for CMV infection (9). Later studies also showed that FSA EXPANDED ACCESS PATHWAYS FOR
ganciclovir patients were living longer (10). GROUPS OF PATIENTS
The FDA refused approval of ganciclovir for treat-
ment of CMV retinitis, because they had no animal Within all INDs, there are 2 classifications: research
studies for that use, nor significant human placebo- and commercial INDs. The FDA defines a commercial
controlled trials on which to base a marketing IND as one in which either: 1) the sponsor is a
application. Many questioned whether the use of corporate entity or is 1 of the institutes of the National
ganciclovir was wise, or safe (11,12). But, because of Institutes of Health; or 2) if it is clear that the drug
ganciclovir’s known efficacy, it became paradoxically will eventually be commercialized. The IND is defined
impossible to carry out human controlled trials, as a research IND if the drug is sponsored by an in-
because such trials are only ethically justifiable if in- dividual. Within each class of IND, commercial and
vestigators are honestly uncertain about whether net research, there are subcategories of INDs, of which
positive benefits over placebo exists (13). Further- the most common is the “investigator IND”—in which
more, neither patients nor doctors were willing to risk the investigator initiates and conducts the studies
assignment to placebo and further loss of eyesight and provides the immediate supervision of the drug’s
after the results were published. use. The FDA allowed individual patient EA as far
Syntex then sought approval to study ganciclovir back as the 1970s, but there were no specific pathways
for treatment of CMV colitis, knowing that once for such EA until the late 1980s, and even those were
marketing approval of the drug was obtained, FDA only codified in 2009. EA pathways at the FDA have
rules would allow “off-label” use for retinitis (14). undergone continual updates, the most recent of
Physicians at the FDA refused the IND filing due to which was published in October of 2017 (14).
insufficient animal studies on which to base use of At this time, EA of nonapproved drugs for treat-
ganciclovir in colitis. ment of more than 1 patient at a time is achievable
Eventually, the FDA and Syntex developed a only through the FDA, in contrast with access for in-
research protocol involving patients with less severe, dividual patients, which technically can be legally
406 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

obtained without the FDA by applying to the manu- risk evaluation and mitigation strategy (REMS) for
facturer directly (6). As with individual EA INDs, diagnostic monitoring, or treatment purposes, but the
specific conditions for group patient access apply: use is sought by patients who cannot obtain the drug
1) the patients must have a serious or immediately under such REMS (see the following section); or 4)
life-threatening disease or condition with no compa- “other reasons” approved by the FDA.
rable therapy or satisfactory alternative therapy; Both intermediate- and widespread-treatment INDs
2) the potential benefit must justify the potential risks can each be obtained through 2 types of regulatory
of the treatment; and 3) providing the treatment must submissions to the FDA: 1) as an EA protocol submitted
not compromise or interfere with the ongoing FDA as an amendment to a protocol in an existing IND; or 2)
drug development program, such as by critically as a new IND submission that is separate and distinct
depleting a limited supply of investigational drug from any existing IND, and is intended only for the
that is also needed for an ongoing study or a future purpose of making a drug available for treatment use
study that is in the planning stages (4). (15). When there is an existing IND, the FDA usually
An “immediately life-threatening condition or encourages submission of an EA protocol under the
disease” is defined by the FDA as “a stage of disease existing IND to keep all EA use and clinical trials
in which there is reasonable likelihood that death will consolidated. This may simplify identification of
occur within a matter of months or in which prema- safety issues, decrease the administrative burden to
ture death is likely without early treatment.” A investigators and the FDA, and eventually help the
serious disease or condition is defined as being review of the drug for approval. When there is no
“associated with morbidity that has substantial existing IND on a drug, or if the sponsor under an
impact on day-to-day functioning.” Furthermore, existing IND declines to sponsor the proposed EA, then
while short-lived or self-limited morbidity will usu- a new treatment IND must be filed.
ally not be a sufficient qualifying condition, the For intermediate-sized EA INDs, a major difference
morbidity “need not be irreversible, provided it is between submitting an EA protocol under an existing
persistent or recurrent.” The FDA states that whether IND versus submitting a new, separate EA IND is that
a condition is serious or not “is a matter of clinical treatment may begin much earlier under an EA pro-
judgment, based on its impact on such factors as tocol in an existing IND. Any new EA IND must go
survival, day-to-day functioning, or the likelihood through all of the processes of any new IND, with the
that the disease, if left untreated, will progress from a obligatory 30-day waiting period after submission for
less severe condition to a more serious one” (15). treatment to begin. But if the EA protocol is submit-
ted under an existing IND, there is no 30-day waiting
THE INTERMEDIATE-SIZE TREATMENT IND
period (15).
For widespread treatment INDs, in contrast, both
An intermediate-size treatment IND is intended to
EA protocols under an existing IND and new EA INDs
provide EA to more than 1 patient at time, but
require a 30-day waiting period after submission for
generally to a smaller patient group than might, for
treatment to begin.
example, be recruited for a clinical trial under an
existing IND (15). A primary feature distinguishing an RISK EVALUATION AND
intermediate EA protocol from a clinical study under MANAGEMENT STRATEGIES
an existing IND is that an intermediate EA protocol is
not primarily intended to obtain data or other infor- In 2007, the Food and Drug Administration Amend-
mation about a drug’s safety or efficacy. ments Act, or “FDAAA” gave the FDA authority to
Under an existing IND or protocol, EA can only be require REMS from manufacturers to ensure that the
provided if the drug’s sponsor is already actively benefits of a drug or biological product outweigh its
pursuing marketing approval of the drug for the same risks (16). A REMS is a safety strategy to manage a
use for which EA is being requested. However, other known or potential serious risk of a medication, while
circumstances do allow EA if an existing treatment still allowing patients to have continued access to
IND is not in place. EA can also occur: 1) when a drug that medication. The FDA can require a REMS as a
has been withdrawn due to safety concerns, but there condition of approval of a new drug, or can demand a
exists a patient group in which the benefits of the REMS if new safety issues arise regarding an already
drug outweigh the risks; 2) use of a similar, unap- approved drug. The FDA can also require a REMS for
proved drug (e.g., foreign-approved drug) is sought an entire class of drugs. Because medications differ
due to a shortage of the approved drug; 3) use of an from one another, specific REMS for each medication
approved drug where availability is limited due to a are different from one another (17).
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Van Norman 407
JUNE 2018:403–14 Intermediate and Widespread Expanded Use IND

REMS programs can include a variety of re- September of 1960 when Frances Oldham Kelsey—
quirements involving patients, pharmacists, pre- the FDA’s first woman reviewer, who was on her first
scribing physicians, and other health care providers. assignment in the agency during her first month of
Such requirements might, for example, be: 1) to employment—intervened over her concerns about
educate patients in how to monitor for specific types the lack of rigorous scientific human studies (19,20).
of infection that are associated with administration In Dr. Kelsey’s words, “It just so happened that my
of a medication; 2) certification of health care pro- first application was for the drug thalidomide. I got
viders to administer a drug that has a heightened this because I was new and they thought I should
risk of acute severe reaction; 3) periodic laboratory have an easy one to start on” (19). Because of Dr.
evaluation of the function of organs that may be at Kelsey’s quick action, the United States largely
risk of damage from chronic administration of a escaped the tragedy of thalidomide, in contrast to
medication; 4) a requirement for a negative preg- other Western countries—only 17 U.S. cases of
nancy test prior to administration of a drug that has thalidomide-related birth defects were ever reported
potential severe fetal adverse outcomes; 5) the (18). Globally, the first known case of a thalidomide-
establishment of a patient registry; and 6) “other induced birth defect occurred when a baby girl, the
requirements.” REMS protocols include details of the daughter of an employee of the drug developer, was
safety strategy, the plans for communication of the born without ears in Germany on Christmas day of
safety strategy to health care workers, details of 1956. The number of infants born with thalidomide-
such elements as certification of prescribing physi- related deformities worldwide grew to over 10,000
cians, and a timetable for follow-up on outcomes of cases (21). As a direct result of the thalidomide
the REMS strategy. Other specific steps dealing with tragedy, the U.S. Congress was galvanized in 1962 to
drug administration, such as provider or health pass the Kefauver Harris Amendments to the 1938
care
setting certification, laboratory monitoring, Food, Drug and Cosmetics Act to strengthen drug
patient monitoring, required patient follow-up regulation in the United States (22,23).
visits, and the establishment of patient registries, Thalidomide was ultimately banned in 1962, and
are referred to as Elements to Assure Safe Use, or would never have been heard of again, had it not
ETASU requirements (17). been for a chance discovery in Jerusalem in 1964. Dr.
THALIDOMIDE: A HUMANITARIAN EA AND REMS. The Jacob Sheskin was treating a patient with leprosy
story of thalidomide illustrates the advantages of whose pain was so great the patient could not sleep.
granting humanitarian drug use with REMS in place. He obtained permission to treat the patient with
Prior to its use in humans, thalidomide had been thalidomide, and found that the drug treatment also
determined to have an excellent safety profile, due caused regression of the leprosy. With cautious sup-
to extensive research in animals. J.L. Schardein port from the March of Dimes, one of the thalidomide
observed that “in approximately 10 strains of rats, victim advocacy groups, the FDA approved thalido-
15 strains of mice, 11 breeds of rabbits, 2 breeds of mide for treatment of leprosy in 1998 (24,25). Until
dogs, 3 strains of hamsters, 8 species of primates, better drugs came along, thalidomide became the
and other animal species such as cats, armadillos, drug of choice in treating erythema nodosum lep-
guinea pigs, swine and ferrets in which thalidomide rosum, a complication of leprosy (21). In 1992, on a
had been tested, teratogenic effects had been different front, Dr. Robert D’Amato was looking for a
induced only occasionally” (18). In fact, when hu- drug to treat macular degeneration. He discovered
man birth defects began to appear in the offspring that thalidomide inhibited vascular proliferation and
of women who had ingested thalidomide during might be useful in this disorder (26). Although its use
pregnancy as a sedative and to treat nausea, re- in macular degeneration was not ultimately satisfac-
searchers pointed out that thalidomide had failed to tory, the drug is now used to treat a number of other
demonstrate teratogenicity in rats, and at first ailments: tuberculosis, multiple sclerosis, Crohn’s
insisted that thalidomide could not be the culprit. disease, human immunodeficiency virus, AIDS, and
In Germany, where the drug was first developed, multiple myeloma (19,20,22).
thalidomide was held to be so safe that no pre- The use of thalidomide is severely restricted in the
scription was required for its use, it was advertised United States by the FDA, with the original safety
for use in pregnant women (19), and the drug requirements (then called the System for Thalido-
company distributed free samples to its factory mide Education and Prescribing Safety [STEPS] pro-
employees (18,19). gram) initiated in 1998 (27,28). Thalidomide was
Indeed, thalidomide was just 1 day away from given the most severe rating for drugs that contribute
automatic FDA approval in the United States in to fetal deformities, and for drugs whose risks
408 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

outweigh possible benefits to patients. The STEPS A significant regulatory shortcoming of the EUA is
program requires registration by both prescribing that it does not contain provisions to collect pro-
physicians and their patients, required proof of an spective outcome data during the use of the investi-
initial negative pregnancy test prior to treatment of gational drug or biologic, and limited retrospective
female patients, proof that the patient was using 2 reports provide very limited information for
forms of contraception, and submission of monthly answering safety and efficacy questions in a sub-
pregnancy tests (27). Male patients are encouraged to stantiated way. EUAs also raise particular questions
use condoms during sexual intercourse because it is of what role, if any, investigational drugs should play
unknown whether thalidomide in semen is terato- in a communicable disease outbreak (33). Communi-
genic. The STEPS program would later provide a cable diseases often present urgent needs by patients,
framework for similar measures regarding isotreti- because outbreaks are usually acute in nature, with
noin, a drug used to treat severe acne, and also high transmissibility and potentially high community
known to cause severe birth defects. Elsewhere in the morbidity and mortality. Determining benefits and
world where the drug is not so well regulated, risks of an investigational drug or biologic in the
thalidomide birth defects are still reported (19). setting of a public health crisis involves a certain
STEPS and the measures taken with isotretinoin are amount of duress on investigators, health care pro-
the forerunners of the modern REMS. viders, and patients, with limited time for a consid-
ered decision. Thus, EUAs may not be appropriate for
COMPASSIONATE USE AND drugs that are in very early-phase testing, where
PUBLIC HEALTH EMERGENCIES reasonable risk/benefit ratios are almost entirely un-
known, and a potentially large number of subjects
In the Bioshield Legislation of 2004, the U.S. will be exposed to the drug. With regard to benefits,
Congress created a separate class of authorization infectious disease emergencies also carry a unique
for release of investigational drugs and biologics consideration: treatment of an index patient has po-
(e.g., vaccines) for use in entire civilian populations tential to both benefit the individual, but also the
in a declared public health emergency—the emer- community at large, by containing the outbreak.
gency use authorization (EUA) (29,30). Examples of Conditions for which there are current EUAs in effect
such emergencies include epidemic outbreaks, bio- are listed in Table 1 (34).
terrorism attacks, chemical spills and attacks, and The Ebola outbreak in West Africa in 2014 to 2015
radiation and nuclear attacks. EUA is different from demonstrates some of the problems regarding release
the emergency use of an investigational product of investigational products on a population under
under the EA program of the FDA, because an EUA duress. Over 1,700 people were sickened, and over
requires the declaration of a public health emer- 930 died. The World Health Organization knew of
gency by the Secretary of Health and Human Ser- several vaccines and biologics that were in the pipe-
vices, the Secretary of Defense, or the Secretary of line to treat the Ebola virus, but none had been sub-
Homeland Security. They can then request an EUA to jected to human studies, and the organization
permit the use of unapproved investigational drugs, initially ruled out their use. Despite this, 2 U.S. citi-
or unapproved uses of approved medical products. zens involved in epidemic response became ill with
An FDA workgroup then takes into account the Ebola and were treated with an experimental mixture
availability, safety, and efficacy of the drug or bio- of monoclonal antibodies called ZMapp (Mapp Bio-
logic, weighed against the communicability, pharmaceutical, Inc. and LeafBio [San Diego, Cali-
morbidity, and mortality of the public health threat fornia], Defyrus Inc. [Toronto, Ontario, Canada], the
in deciding whether to release the treatment. EUA U.S. government and the Public Health Agency of
does not require documentation of individual Canada). Both patients survived (35). Their treatment
informed consent, although information about the resurrected debate about the use of untested drugs in
product must be provided to health care providers such dire circumstances: the WHO convened a panel
and individual patients (31). The process for of ethicists to discuss whether treatments without
approval of an EUA is summarized in Figure 1 (32). prior in-human testing should be tried in circum-
The first use of an EUA was in 2005, allowing the stances where an epidemic had such a high fatality
U.S. Department of Defense to provide anthrax vac- rate. With only 2 test cases, no scientific conclusions
cines to service members deployed in regions of the could be drawn about ZMapp’s efficacy or safety
world subject to high threats for biological weapons. (35,36). The published report of the WHO set out
Other examples have included the use of diagnostic considerations for when unregistered drugs could be
devices in the Zika outbreak of 2016. used to treat Ebola, and principles regarding
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Van Norman 409
JUNE 2018:403–14 Intermediate and Widespread Expanded Use IND

F I G U R E 1 Process for Issuance of an Emergency Use Authorization

The Secretary of Homeland The Secretary of Homeland The Secretary of Defense The Secretary of Health and
Security determines that there Security determines that there determines that there is a Human Services determines
is a domestic emergency or is a material threat to national military emergency or that there is a public health
potential emergency involving security or the health and potential emergency emergency or potential
heightened risk of attack with security of U.S. citizens involving attack of military emergency
a CBRN agent forces with a CBRN agent

A Request for EUA is sent to the FDA† by either a government (e.g. Department of Defense) or industry sponsor.
Requests include
• A description of the product and its intended use
• A description of the product’s approval status, including foreign approval status
• The need for the product and description of available alternatives
• The unmet need the product would meet
• Available safety and efficacy data
• Risks and benefits
• Information on chemistry, manufacturing, sites of manufacturer
• Information on the quantity of product on hand and surge capabilities of the manufacturer
• Information comparable to an FDA package insert

The Commissioner of the FDA consults

With ASPR, CDC and NIH experts

The Commissioner of the FDA issues the EUA

†Submission are to the appropriate Department of the FDA: CDER, CBER, or CDRH. ASPR ¼ HHS Assistant Secretary for Preparedness and Response; CBER ¼ Center for
Biologics Evaluation and Research; CBRN ¼ chemical, biological, radiation, or nuclear; CDC ¼ U.S. Centers for Disease Control and Prevention; CDER ¼ Center for Drug
Evaluation and Research; CDRH ¼ Center for Devices and Radiological Health; HHS ¼ Health and Human Services; NIH ¼ National Institutes of Health.

prioritizing those who should receive treatment, such titled “Experts: Ebola vaccine at least 50 white people
as women and children (36). The fact that the treat- away” (37).
ment was made available to 2 U.S. citizens and not to
THE ANIMAL RULE
Africans, who comprised most of its victims, engen-
dered anger over the social justice of such decisions,
FDA EA rules allow patient access to drugs that have
providing, as Enserink (35) points out, a tragic vali-
had at least some in-human exposure. The ganciclo-
dation to the satirical yet somewhat prophetic paper vir saga, ZMapp, and other experiences raise the
that had appeared in The Onion only weeks before question of what to do when a potentially beneficial
drug is needed that has not undergone any in-human
testing, and furthermore cannot undergo such human
T A B L E 1 Conditions for Which Current FDA EUAs Are in Place studies due to ethical concerns. In 2015, the FDA
released a guidance for industry to address “drugs
Anthrax
Ebola virus developed to ameliorate or prevent serious or life-
Enterovirus threatening conditions caused by exposure to lethal
H7N9 influenza or permanently disabling toxic substances, when
Middle East Respiratory Syndrome human efficacy studies are not ethical and field trials
Nerve agent are not feasible” (38). Under certain conditions, the
Zika virus
FDA may accept animal studies in lieu of human
EUA ¼ emergency use authorization; FDA ¼ U.S. Food and Drug Administration.
clinical trials, provided that there is reasonable
expectation that the animal studies are predictive of
410 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

vaccines and drugs that were considered for use had

T A B L E 2 Specific Requirements to Invoke the Animal Rule
not yet undergone human trials, and the quantities of
There is a reasonably well-understood pathophysiological mechanism of the toxicity of the toxic
substance and its prevention or substantial reduction by the product.
these agents were not sufficient at the start of the
The effect is demonstrated in more than 1 animal species expected to react with a response epidemic to support human use. Currently, studies
predictive for humans, unless the effect is demonstrated in a single animal species that are underway of Ebola survivors (41,42).
represents a sufficiently well-characterized animal model for predicting the response in
humans.
The animal study endpoint is clearly related to the desired benefit in humans, generally the
FDA INTERMEDIATE OR WIDESPREAD
enhancement of survival or prevention of major morbidity. TREATMENT IND FILINGS
The data or information on the kinetics and pharmacodynamics of the product or other relevant
data or information, in animals and humans, allows selection of an effective dose in humans.
EA INDs in the United States usually involve indi-
vidual patients, rather than groups. In contrast with
in-human effects. Such conditions may apply not individual patient IND applications, which numbered
only to individual patient use, but potentially to between 322 and 1,110 annually between 2010 and
widespread use during a public health emergency 2016, intermediate EA IND submissions ranged be-
and must meet specific requirements (Table 2) (39). tween 0 and 50 annually (total ¼ 171 over the entire
As of now, 12 products have been approved under the period), and only 2 widespread treatment IND appli-
Animal Rule, 7 of which were issued quickly after the cations were filed during that same period. FDA re-
guidance was published (Table 3) (40). Approval via fusals of EA INDs are uncommon, with a total of 10
the Animal Rule is usually subject to several condi- intermediate IND refusals and zero widespread
tions: 1) post-marketing “field” studies must verify treatment IND refusals from 2010 through 2016
and describe the product’s clinical efficacy and safety (Figure 2, Supplemental Figure 1) (43).
when such studies are ethical and feasible; 2) re-
strictions may be imposed to ensure safe use only INTERMEDIATE VERSUS WIDESPREAD
under the approved labelling (i.e., off-label use may TREATMENT IND: WHICH IS THE
be forbidden); and 3) information must be provided APPROPRIATE PATHWAY?
to patients prior to administration regarding the
conditions of approval and directions for use, con- CONSOLIDATING MULTIPLE SINGLE-PATIENT EA INDs.

traindications, foreseeable risks, adverse reactions, When multiple individual patients are seeking EA to a
and drug interactions. The FDA provides guidance on particular drug and meet criteria for EA, the FDA
product development under the Animal Rule, encourages all individual applications to be consoli-
including general expectations and qualified animal dated under a single intermediate-sized IND or EA
models under FDA Center for Drug Evaluation and protocol, and that the commercial sponsor be the
Research and Center for Biologics Evaluation and sponsor of the EA IND or EA protocol. This is to avoid
Research programs, as well as study design consid- having multiple single-patient INDs and multiple
erations (38). sponsors for a single investigational drug. That being
The guidance was not in place during the 2014 to said, regulations do not actually forbid authorizing
2015 West African Ebola virus outbreak. At that time, more than 1 single- or intermediate-patient IND for
the same drug.

HOW MANY PATIENTS ARE APPROPRIATE FOR AN

T A B L E 3 FDA Approvals Under the Animal Rule From 2015 to Present
INTERMEDIATE-SIZE EA INDs? The FDA generally
Date Drug Purpose considers the following factors when determining
February 2, 2015 Ciprofloxacin Supplemental NDA approved: new indications whether an intermediate-size EA IND or widespread
for treatment and prophylaxis of plague due
treatment protocol is appropriate (Figure 3) (15).
to Yersinia pestis in adult and pediatric patients.
March 25, 2015 Anthrasil, Anthrax Treatment for inhalation anthrax Is the drug being developed for commercial
immune globulin u s e ? If the drug is not being developed for com-
March 30, 2015 Neupogen Treatment of patients with radiation-induced mercial use, and the sponsor seeking EA intends to
myelosuppression following a radiological/
nuclear incident treat more than 1 patient, then the FDA requires an
May 8, 2015 Avelox Treatment for plague intermediate-size EA IND or protocol. If, on the
November Neulasta Treatment of adult and pediatric patients at other hand, the drug is being developed for mar-
13, 2015 (pegfilgrastim) risk of developing myelosuppression
after radiological/nuclear incident keting for EA use, then a treatment IND or protocol,
November BioThrax Vaccine for use after known or not intermediate-size IND or protocol, will be
23, 2015 suspected anthrax exposure necessary.

NDA ¼ New Drug Application.

H o w f a r a l o n g i n d e v e l o p m e n t i s t h e d r u g ? If
clinical development of the drug is essentially
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Van Norman 411
JUNE 2018:403–14 Intermediate and Widespread Expanded Use IND

F I G U R E 2 Intermediate and Widespread Treatment IND Applications to the FDA, 2010 to 2016

Also see Supplemental Figure 1. IND ¼ investigational new drug. Adapted with permission from U.S. Food and Drug Administration (FDA) (43).

complete—that is, clinical trials have ended and the willing to make the drug available for the EA use to a
drug is awaiting marketing approval—regardless of larger patient population under a treatment IND or
the number of patients involved, the FDA generally protocol. The FDA “anticipates that there would
requires a treatment EA IND or protocol, rather than ordinarily be a seamless transition from intermediate-
an intermediate-sized EA IND or protocol. size patient population expanded access to expanded
How many patients are included in the EA access under a treatment IND or protocol” (15),
a p p l i c a t i o n ? Although there is no specific size limi- although this requires close coordination with the
tation to intermediate-sized EA INDs or protocols, in FDA review division overseeing the drug’s
general, the FDA intends intermediate-sized EA INDs development.
and protocols to serve populations that are smaller
than those that would be included in clinical trials THE FILING PROCESS
under a regular IND, and for drugs that have not yet
essentially completed clinical trials. Both intermediate and widespread treatment INDs
Does an already-existing intermediate-size EA require the submission of an EA application, which
IND or protocol require transitioning to a follows the same processes as an IND filing. The
t r e a t m e n t E A I N D o r p r o t o c o l ? In some cases, the submission can be in the form of a new IND, or as a
FDA will require transitioning of an intermediate-size protocol amendment to an existing IND (4).
EA IND or protocol to a treatment EA IND or protocol. As with regular INDs, commencement of treatment
This can occur when clinical evidence supports a may begin within 30 days of FDA receipt of the
treatment IND or protocol, when drug development application if the FDA does not object or place a
has sufficiently progressed to warrant transition to a clinical hold (1), or earlier if the FDA notifies that early
treatment IND or protocol, and when the sponsor is treatment can begin.
412 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

F I G U R E 3 Intermediate Versus Widespread Treatment IND

EA ¼ expanded access; IND ¼ investigational new drug.

CONCLUSIONS investigational treatments or, if enrolled in a late-

phase clinical trial, to continue treatment with an
For patients with terminal or severe and debilitating investigational drug or biologic after clinical trials
illnesses who have few treatment options, the wait are concluded and the treatment awaits final FDA
for approval of investigational therapeutics may be approval. In addition, FDA mechanisms allow
too long, and effective treatment may come too late emergency release of investigational drugs and bi-
to prevent severe debilitation or death. The FDA ologics in a declared public health emergency. The
has long had mechanisms to approve “compas- release of unapproved drugs for patient populations
sionate use” for individual patients, but more carries special risks: larger patient populations may
recently has developed expanded access pathways be exposed to drugs of unproven value, with un-
for groups and entire classes of patients to access known risks. In cases where human trials would be
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Van Norman 413
JUNE 2018:403–14 Intermediate and Widespread Expanded Use IND

unethical, such as in testing a treatment of a known

life-threatening toxin, harmful radiation exposure, ADDRESS FOR CORRESPONDENCE: Dr. Gail A. Van

or other danger to health, new guidance from the Norman, Department of Anesthesiology and Pain
FDA allows release of investigational agents that Medicine, University of Washington, 2141 8th Avenue
have not had any in-human trials, under the West, Seattle, Washington 98119, USA. E-mail: lbspar-
“Animal Rule.” [email protected] .

REFERENCES

1. Van Norman G. Drugs, devices, and the FDA: 14. U.S. Food and Drug Administration. “Off-label” 24. Schwarts J. Thalidomide wins limited
part 1. J Am Coll Cardiol Basic Trans Science 2016; and investigational use of marketed drugs, bi- approval. The Washington Post July 17, 1998.
1:170–9. ologicals and medical devices—information sheet. Available at: http://www.washingtonpost.com/wp-
Available at: https://www.fda.gov/regulatory srv/washtech/longterm/thalidomide/thalidomide.
2. Holbein MEB. Understanding FDA regulatory
information/guidances/ucm126486.htm. Accessed htm. Accessed January 31, 2018.
requirements for investigational new drug appli-
February 3, 2018.
cations for sponsor-investigators. J Investig Med 25. Stolberg SG. Thalidomide approved to treat
2009;57:688–94. 15. U.S. Food and Drug Administration. Expanded leprosy, with other uses seen. The New York Times
access to investigational drugs for treatment use— July 17, 1998. Available at: http://www.nytimes.
3. U.S. Food and Drug Administration. Policy and
questions and answers; guidance for industry. U.S. com/1998/07/17/us/thalidomide-approved-to-
procedures: Office of New Drugs: IND clinical
FDA Center for Drug Evaluation and Research treat-leprosy-with-other-uses-seen.html. Accessed
holds. 1998. Available at: https://www.fda.gov/
(CDER). 2017. Available at: https://www.fda.gov/ March 6, 2018.
downloads/aboutfda/centersoffices/officeofmedical
productsandtobacco/cder/manualofpoliciesprocedures/ downloads/drugs/guidancecomplianceregulatory 26. D’Amato R, Lounghnan MS, Flynn E,
ucm082022.pdf. Accessed January 31, 2018. information/guidances/ucm351261.pdf. Accessed Folkman J. Thalidomide is an inhibitor of angio-
October 30, 2017.
4. U.S. Food and Drug Administration. Expanded genesis. Proc Natl Acad Sci 1994;91:4082–5.
access (compassionate use). Available at: https:// 16. U.S. Food and Drug Administration. Food and 27. Zeldis JB, Williams BA, Thomas SD,
www.fda.gov/NewsEvents/PublicHealthFocus/ Drug Administration Amendments Act (FAAA) of Elsayed ME. S.T.E.P.S.: a comprehensive program
ExpandedAccessCompassionateUse/default.htm. 2007. Available at: https://www.fda.gov/ for controlling and monitoring access to thalido-
Accessed November 7, 2017. RegulatoryInformation/LawsEnforcedbyFDA/ mide. Clin Ther 1999;21:319–30.
SignificantAmendmentstotheFDCAct/FoodandDrug
5. Patil S. Early access programs: benefits, chal- 28. The Embryo Project Encyclopedia. US regula-
AdministrationAmendmentsActof2007/default.htm.
lenges and key considerations for successful tory response to thalidomide (1950-2000).
Accessed February 3, 2018.
implementation. Perspectives Clin Res 2016;7: Available at: https://embryo.asu.edu/pages/us-
4–8. 17. U.S. Food and Drug Administration. FDA basics regulatory-response-thalidomide%20(1950-2000.
webinar: a brief overview of risk evaluation and Accessed January 31, 2018.
6. Van Norman G. Expanding patient access to
mitigation strategies (REMS). Available at: https://
investigational drugs: single patient INDs and the 29. S.15. Project Bioshield Act of 2004. 108th
www.fda.gov/AboutFDA/Transparency/Basics/ucm
“right to try.” J Am Coll Cardiol Basic Trans Science Congress (2003-2004). Available at: https://
325201.htm. Accessed January 8, 2018.
2018. In press. www.congress.gov/bill/108th-congress/senate-
18. Schardein JL. Drugs as Teratogens5. Cleve- bill/15. Accessed January 31, 2018.
7. Mackey T. Going “social” to access experimental
land: CRC Press, 1976:49.
and potentially life-saving treatment: an assess- 30. Russell PK. Project Bioshield: what is it, why is
ment of the policy and on-line patient advocacy 19. Winerip M. The death and afterlife of thalido- it needed, and its accomplishments so far. Clin
environment for expanded access. BMC Med 2016; mide. Retro Report. The New York Times, Infec Dis 2007;45:S68–72.
14:17. September 23, 2013. Available at: http://www.
31. U.S. FDA. Regulatory information: emergency
8. Buhles WC. Compassionate use: a story of nytimes.com/2013/09/23/booming/the-death-and-
use authorization of medical products. July 2007.
ethics and science in the development of a afterlife-of-thalidomide.html Accessed January 15,
Available at: https://www.fdanews.com/ext/resources/
new drug. Perspectives Biology Med 2011;54: 2018.
files/archives/e/Emergency-Use-Authorization.pdf.
304–15. 20. U.S. National Library of Medicine. Changing Accessed January 31, 2018.
9. Collaborative DHPG Treatment Study Group. the face of medicine: Dr. Frances Kathleen Oldham
32. U. S. FDA. Summary of process for EUA issuance.
Treatment of serious cytomegalovirus infections Kelsey. Available at: https://cfmedicine.nlm.nih.
Available at: https://www.fda.gov/Emergency
with 9-(1,3dihydroxy-2-propoxymethyl)guanine in gov/physicians/biography_182.html. Accessed
Preparedness/Counterterrorism/MedicalCounter
patients with AIDS and other immunodeficiencies. January 15, 2018.
measures/MCMLegalRegulatoryandPolicyFrame
N Engl J Med 1986;314:801–5. 21. World Health Organization. Use of thalidomide work/ucm411445.htm. Accessed February 3, 2018.
10. Spector SA, McKinley GF, Lalezari JP, et al. in leprosy. Available at: http://www.who.int/lep/
33. Kirchoff MC, Pierson JF. Considerations for use
Oral ganciclovir for the prevention of cytomega- research/thalidomide/en/. Accessed January 31,
of investigational drugs in public health emer-
lovirus disease in persons with AIDS. N Engl J Med 2018.
gencies. Ther Innov Regul Sci 2017;51:146–52.
1986;334:1491–7.
22. Hamburg M. 50 years after thalidomide: why 34. U.S. Food and Drug Administration. Emer-
11. Harrington M, Wiley K, Eigo J. Blinded by sci- regulation matters. U.S. FDA Blog Feb 7, 2012. gency use authorizations. Available at: https://
ence: DHPG and the conflict between “clean data” Available at: https://blogs.fda.gov/fdavoice/ www.fda.gov/emergencypreparedness/counter
and humane health care (abstract Th.G.P.11). Pa- index.php/2012/02/50-years-after-thalidomide- terrorism/ucm182568.htm. Accessed February
per presented at: Int Conf AIDS; June 4 to 9, 1989; why-regulation-matters. Accessed January 30, 3, 2018.
Montreal, Quebec, Canada. 2018.
35. Enserink M. How two U.S. patients changed
12. Thompson D. Medicine: drugs from the un-
23. U.S. Food and Drug Administration. Kefauver- the debate about using untested Ebola drugs.
derground. TIME July 10, 1989.
Harris amendments revolutionized drug develop- Science Aug 7, 2014. Available at: http://www.
13. Hey SP, Truog RD. The question of clinical ment. 2017. Available at: https://www.fda.gov/ sciencemag.org/news/2014/08/how-two-us-
equipoise and patients’ best interests. AMA J ForConsumers/ConsumerUpdates/ucm322856.htm. patients-changed-debate-about-using-untested-
Ethics 2015;17:1108–15. Accessed February 3, 2018. ebola-drugs. Accessed January 30, 2018.
414 Van Norman JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Intermediate and Widespread Expanded Use IND JUNE 2018:403–14

36. World Health Organization. Ethical consider- 39. Park GD, Mitchel JT. Working with the U.S. longer-term clearance of Ebola virus and safety in
ations for use of unregistered interventions for Food and Drug Administration to obtain approval male Ebola survivors with evidence of Ebola virus
Ebola virus diseases: report of an advisory panel to of products under the Animal Rule. Ann NY Acad persistence. Available at: https://clinicaltrials.gov/
WHO. WHO, Geneva Switzerland. Available at: Sciences 2016;1374:10–6. ct2/show/NCT02818582. Accessed February 3,
http://apps.who.int/iris/bitstream/10665/130997/ 2018.
40. U.S. Food and Drug Administration. Animal
1/WHO_HIS_KER_GHE_14.1_eng.pdf?ua¼1. Accessed
Rule information. Available at: https://www.fda. 43. U.S. FDA. Expanded Access (Compassionate
January 31, 2018.
gov/EmergencyPreparedness/Counterterrorism/ Use): IND submissions. Available at: https://www.
37. News in Brief: Experts: Ebola vaccine at least MedicalCountermeasures/MCMRegulatory fda.gov/downloads/drugs/guidances/ucm351261.
50 white people away. July 30, 2014. Available at: Science/ucm391604.htm. Accessed February pdf. Accessed January 31, 2018.
https://www.theonion.com/experts-ebola-vaccine- 2, 2018.
at-least-50-white-people-away-1819576750.
Accessed January 31, 2018. 41. ClinicalTrials.gov. Ebola virus disease survi-
KEY WORDS animal rule, compassionate
vors: clinical and immunologic follow-up. 2015.
38. U.S. FDA. FDA product development use, emergency use authorization,
Available at: https://clinicaltrials.gov/ct2/show/
under the animal rule: guidance for industry intermediate IND, widespread-treatment IND
NCT02431923. Accessed February 3, 2018.
2015. Available at: https://www.fda.gov/
downloads/Drugs/GuidanceComplianceRegulatory 42. ClinicalTrials.gov. PREVAIL IV: double-blind,
Information/Guidances/UCM399217.pdf. Accessed randomized two-phase, placebo-controlled phase A PPE NDI X For a supplemental figure, please
January 31, 2018. II trial of GS-5734 to assess the antiviral activity, see the online version of this paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHOR. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

TRANSLATIONAL PERSPECTIVES

Potentiation of Insulin Signaling

Contributes to Heart Failure
in Type 2 Diabetes
A Hypothesis Supported by Both Mechanistic Studies
and Clinical Trials

Milton Packer, MD

SUMMARY

The heightened risk of heart failure in type 2 diabetes cannot be explained by the occurrence of clinically overt
myocardial ischemic events or hyperglycemia. Experimentally, insulin exerts detrimental effects on the heart,
vasculature, kidneys, and adipose tissue that can lead to heart failure. In both randomized clinical trials and obser-
vational studies, antihyperglycemic drugs that act through insulin signaling (i.e., sulfonylureas, thiazolidinediones,
and incretins) increase the risk or worsen the clinical course of heart failure, whereas drugs that ameliorate hyperin-
sulinemia and do not signal through insulin (i.e., metformin and sodium-glucose cotransporter 2 inhibitors) reduce
the risk of heart failure. (J Am Coll Cardiol Basic Trans Science 2018;3:415–9) © 2018 Published by Elsevier
on behalf of the American College of Cardiology Foundation. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).

T he primary aims of the treatment of pa-

tients with type 2 diabetes are control of
hyperglycemia and reduction in the risk of
macrovascular and microvascular events. Historical-
The most distinctive feature of type 2 diabetes is
hyperinsulinemia. Insulin can
adverse effects on the heart, vasculature, kidneys,
and adipose tissue, which can hasten the onset of
exert important

ly, the definition of macrovascular events has heart failure or lead to worsening of its clinical
generally focused on the occurrence of occlusive course. Of interest, the phenotype of heart failure
or thrombotic events in atherosclerotic vessels appears to differ in patients with types 1 and 2 dia-
(i.e., myocardial infarction, stroke, and major limb betes, possibly because only the latter patients have
ischemia); however, heart failure is a common and sustained hyperinsulinemia. Furthermore, many
serious complication of type 2 diabetes (1), and its antidiabetic drugs that work through the actions of
occurrence cannot be explained by ischemic injury insulin have been associated with an increased risk of
to the heart. Little is known about why heart failure heart failure and an increased mortality in patients
is so common in patients with type 2 diabetes, even with established symptoms (1). By contrast, anti-
when cardiovascular risk factors are well-controlled hyperglycemic drugs that do not depend on insulin
(Supplemental Appendix A). signaling often reduce the risk of heart failure, and it

From the Baylor Heart and Vascular Institute, Baylor University Medical Center, Dallas, Texas, USA. Dr. Packer has recently consulted
for Admittance, Amgen, AstraZeneca, Bayer, Boehringer Ingelheim, Cardiorentis, Celyad, Daiichi Sankyo, Gilead, Novartis, Novo
Nordisk, Relypsa, Sanofi, Takeda, and ZS Pharma.
The author attests he is in compliance with human studies committees and animal welfare regulations of the authors’ institutions
and Food and Drug Administration guidelines, including patient consent where appropriate. For more information, visit the JACC:
Basic to Translational Science author instructions page.

Manuscript received February 23, 2018; revised manuscript received April 11, 2018, accepted April 13, 2018.

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.04.003

416 Packer JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Insulin Signaling and Heart Failure JUNE 2018:415–9

is possible that their action to ameliorate hyper- Such an action may be particularly important if it
insulinemia contributes to this benefit (Supplemental occurs in epicardial adipose tissue, which is charac-
Appendix A). teristically hypertrophied in type 2 diabetes (2). The
accumulation and dysfunction of epicardial adipose
EFFECT OF INSULIN ON THE HEART,
tissue causes the release of numerous proin-
VASCULATURE, KIDNEYS, AND
flammatory adipocytokines, which can adversely
ADIPOSE TISSUE
affect the structure and function of the adjoining
myocardium, with which it shares an unobstructed
Insulin receptors are ubiquitously expressed and are
microcirculation. This inflammatory response may
abundant in the heart and blood vessels. Interaction
lead to microvascular rarefaction and cardiac fibrosis,
of insulin with its receptors leads to activation of 2
both of which can impair ventricular distensibility.
intracellular pathways: the Akt/mTOR signaling
Insulin can also promote fibroblast proliferation in
cascade and the mitogen-activated protein kinase
the myocardium and the secretion of collagen, further
(MAPK)/extracellular-regulated kinase pathway.
impairing the ability of the cardiac chambers to
Experimentally, overexpression of Akt leads to path-
enlarge (Supplemental Appendix C). If the anti-
ological cardiac hypertrophy, and if sustained for long
natriuretic action of insulin leads to plasma volume
periods, to heart failure. A reduction of insulin or Akt
expansion, the net result is ventricular overfilling,
signaling in murine models of cardiac hypertrophy
which leads to the syndrome of heart failure with a
prevents heart failure, suggesting that this mecha-
preserved ejection fraction. This phenotype is
nism contributes to adverse cardiac remodeling. At
particularly common in patients with type 2 diabetes.
the same time, activation of the MAPK/extracellular-
Insulin can therefore exert adverse effects on the
regulated kinase pathway depresses cardiac contrac-
heart, vasculature, kidneys, and adipose tissue,
tility and enhances matrix remodeling, even in the
which (acting in concert) can lead to heart failure or
absence of hypertrophy; it may also lead to the
accelerate the clinical course of the disease (Figure 1).
release of proinflammatory cytokines, leading to
fibrosis. Either pathway (acting alone or in concert) CONTRASTING EFFECTS OF TYPES 1 AND 2
might provide a molecular basis for an effect of insulin DIABETES ON HEART FAILURE
to cause heart failure (Supplemental Appendix B).
Hyperinsulinemia may also have important effects If insulin exerts adverse biological and pathophysio-
on the structure and function of the vasculature. logical effects that lead to heart failure, then the
Although insulin signaling through the Akt pathway incidence of heart failure might be expected to differ
might be impaired in endothelial cells in states of in patients with type 1 versus type 2 diabetes because
insulin resistance, activation of MAPK signaling only the latter characteristically have sustained
pathways remains active, resulting in the induction hyperinsulinemia (Supplemental Appendix D). In the
and potentiation of various endogenous vasocon- only prospective study in type 1 diabetes that
strictors. Additionally, insulin can contribute directly measured ventricular function and biomarkers of
to vascular smooth muscle cell hyperplasia heart failure, the incidence of heart failure over a
(Supplemental Appendix B). 7-year follow-up period was low, unless patients
Insulin exerts a powerful antinatriuretic action, developed overt hypertension or coronary artery
which may have evolved to counter the natriuresis disease (3). In contrast, the incidence of heart failure
caused by hyperglycemia. The infusion of insulin in- is increased 2- to 3-fold in type 2 diabetes, and this
creases sodium reabsorption in the proximal and risk cannot be readily attributed to known cardio-
distal tubules, promotes the actions of angiotensin II, vascular risk factors.
and inhibits the effects of endogenous natriuretic Differences in the cardiac effects of types 1 and 2
peptides. Insulin can directly increase activity of diabetes have also been observed in animal models of
numerous ion transport mechanisms in the renal tu- the 2 diseases (Supplemental Appendix D). Rodent
bules, including the epithelial sodium channel, models of type 2 diabetes, including db/db mice,
sodium-phosphate cotransporter, sodium-hydrogen ob/ob mice, and Zucker diabetic fatty rats, exhibit
exchanger type 3, and sodium-potassium adenosine notable degrees of ventricular hypertrophy and
triphosphatase (Supplemental Appendix B). fibrosis, which is accompanied by mitochondrial
Additionally, insulin promotes adipogenesis by dysfunction, oxidative stress, abnormalities of cal-
facilitating the transition of mesenchymal cells into cium handling, and activation of neurohormonal
preadipocytes and by enhancing their differentiation systems. Echocardiographic studies reveal both sys-
into mature fat cells (Supplemental Appendix C). tolic and diastolic dysfunction. In contrast, animal
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Packer 417
JUNE 2018:415–9 Insulin Signaling and Heart Failure

models of type 1 diabetes, streptozotocin-treated

F I G U R E 1 Pathophysiological Mechanisms by Which Enhanced Insulin Signaling May
mice or Akita diabetic mice, do not exhibit cardiac Lead to Heart Failure
hypertrophy, fibrosis, inflammation, or oxidative
stress; instead, the hearts of diabetic animals are
smaller than in control animals, possibly because of
the absence of insulin’s effects on myocardial growth.

CONTRASTING EFFECTS OF ANTIDIABETIC

DRUGS ON THE RISK OF HEART FAILURE

It is commonly believed that inadequate glycemic

control increases the risk of heart failure in the clinical
setting. The likelihood of heart failure increases as the
level of glycated hemoglobin rises; yet, it is not clear
whether this observation is explained by an adverse
effect of hyperglycemia on the heart or is attributable
to a deleterious action of the hyperinsulinemia that
invariably accompanies hyperglycemia in patients
with type 2 diabetes (Supplemental Appendix E).
Nonetheless, it is noteworthy that pre-diabetes is
associated with a striking increase in the risk of heart Enhanced insulin signaling can lead to heart failure by exerting adverse effects on cardiac
failure, despite only modest elevations of blood remodeling, promoting renal tubular sodium reabsorption, and stimulating accumulation
glucose. Hyperinsulinemia is also associated with poor and inflammation of epicardial adipose tissue, thereby aggravating its deleterious effects
on the underlying myocardium. (Top) Drugs that potentiate insulin signaling (insulin,
outcomes following an acute myocardial infarction in
sulfonylureas, and thiazolidinediones). (Bottom) Drugs that attenuate insulin signaling
patients without diabetes (4).
(metformin and sodium-glucose cotransporter-2 [SGLT2] inhibitors).
Is the relationship between glycated hemoglobin
and heart failure related to poor glycemic control and
its adverse effects on cardiac energy utilization or
metabolism? Alternatively, is the relationship be- The mechanisms by which metformin and SGLT2
tween glycated hemoglobin and heart failure related to inhibitors may act on heart failure have not been
their shared association with hyperinsulinemia, which clearly defined. Through its action on AMP kinase,
exerts direct detrimental effects on the circulation? metformin orchestrates a metabolic response that
These 2 possibilities can be distinguished by exam- preserves myocardial adenosine triphosphate (ATP);
ining the effects of interventions that influence insulin it also has antiproliferative, antifibrotic, and anti-
levels and blood glucose in opposite directions (1). apoptotic properties that may contribute to favorable
Two classes of medications exert an anti- effects on cardiac remodeling. The drug also inhibits
hyperglycemic effect that is not dependent on insulin adipocyte differentiation and adipose tissue inflam-
(Figure 1). Biguanides (such as metformin) decrease mation, thereby potentially minimizing the ability of
hepatic glucose production, mostly through inhibi- diabetes-related derangements of epicardial adipose
tion of the mitochondrial respiratory-chain complex 1 tissue biology that cause microvascular rarefaction,
and activation of AMP kinase. Sodium-glucose cardiac fibrosis, and impaired ventricular distensi-
cotransporter 2 (SGLT2) inhibitors promote glycos- bility. SGLT2 inhibitors have also been shown to
uria by an inhibitory effect on the proximal tubular inhibit the accumulation and inflammation of
reabsorption of glucose. The action of both drugs is epicardial fat in patients with type 2 diabetes. Addi-
accompanied by amelioration of hyperinsulinemia in tionally, SGLT2 inhibitors may inhibit the deleterious
patients with type 2 diabetes. It is therefore note- effect of sodium-hydrogen exchanger activation in
worthy that the use of metformin has been reported the myocardium and in the kidney, thus leading to
to decrease the risk of heart failure in observational cardioprotection and natriuresis (Supplemental
studies, although evidence from clinical trials is Appendix F). Because insulin itself exerts detri-
lacking. Similarly, in large-scale randomized mental effects of insulin on the heart, vasculature,
controlled trials, long-term treatment with SGLT2 and kidneys, however, it is possible that the benefits
inhibitors has been shown to reduce the risk of new- of both biguanides and SGLT2 inhibitors to reduce the
onset heart failure as well as hospitalization and risk of heart failure may (in part) be related to their
death from heart failure (Supplemental Appendix F). shared ability to reduce hyperinsulinemia.
418 Packer JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Insulin Signaling and Heart Failure JUNE 2018:415–9

By contrast, the majority of antihyperglycemic other deleterious effects of these drugs or may su-
medications act by stimulating the release of or persede potentially favorable effects on the heart.
potentiating the actions of insulin (Figure 1). Insulin Interestingly, drugs that signal through insulin are
use is independently associated with an increased often associated with weight gain; in clinical trials,
risk of heart failure, despite improved glycemic such weight gain is accompanied by an increased
control (5). Thiazolidinediones promote insulin risk of heart failure, even if glycemic control is
signaling by increasing the sensitivity of tissues to improved (Supplemental Appendix G).
its metabolic actions. Both pioglitazone and rosigli- If insulin signaling exerts adverse effects to in-
tazone have been shown to increase the risk of heart crease the risk of heart failure in patients with dia-
failure in randomized controlled clinical trials. betes without overt symptoms of left ventricular
Incretin-based drugs (i.e., glucagon-like peptide-1 dysfunction, then the same mechanism would also be
receptor agonists and dipeptidyl peptidase-4 in- expected to worsen the clinical course of patients
hibitors stimulate the release of insulin from with diabetes who have established heart failure. It is
pancreatic b cells by potentiating the actions of GLP-1). therefore noteworthy that, in several observational
The GLP-1 receptor agonist liraglutide increases the studies, patients with chronic heart failure who had
clinical instability of patients with overt left ventric- levels of glycated hemoglobin #7.0% had a worse
ular systolic dysfunction, and treatment with the DPP- survival than those with levels of 7.0% to 8.0%, even
4 inhibitors saxagliptin, alogliptin, and vildagliptin after adjustment for other predictors of a poor
have been associated with adverse remodeling or an outcome. Importantly, that this relationship was
increased risk of heart failure in patients with type 2 observed only in patients whose diabetes was treated
diabetes. Sulfonylureas are insulin secretagogues as a with drugs, not in those who were managed only with
result of their action to inhibit the ATP-sensitive po- diet. This finding suggests that the poor survival of
tassium channel, and their use has been associated patients with heart failure with a glycated
with an increased risk of heart failure that is compa- hemoglobin #7.0% may have been related to the use
rable to that seen with thiazolidinediones of antihyperglycemic medications. The drugs used to
(Supplemental Appendix G). intensify glycemic control in these studies (insulin,
The mechanisms by which these drugs exert their sulfonylureas, and thiazolidinediones) acted through
deleterious effects on the clinical course of heart insulin signaling (Supplemental Appendix H). A
failure are unknown. The action of sulfonylureas to relationship between mortality and intensive glyce-
inhibit the ATP-sensitive potassium channel may mic control has not been seen in patients with heart
interfere with an important endogenous compensa- failure whose diabetes has been managed using non–
tory mechanism that serves to reduce calcium insulin-dependent therapeutic regimens.
overload during periods of stress. Both GLP-1 re-
ceptor agonists and DPP-4 inhibitors have been SUMMARY AND CONCLUSIONS
shown to augment cyclic AMP and potentiate
adrenergic mechanisms, both of which may exacer- The development of heart failure is common in states
bate heart failure. Furthermore, signaling through of hyperinsulinemia, but not in states of glucose
the GLP-1 receptor can promote inflammation in intolerance that is accompanied by a deficiency of
adipose tissue, which may explain why the use of insulin. This finding has been supported by the find-
DPP4 inhibitors promotes cardiac fibrosis in dia- ings in both experimental models of types 1 and 2
betes, predisposing to the development of heart diabetes as well as in cohort studies of patients with
failure with a preserved ejection fraction. Although diabetes in the community. Insulin can exert a wide
thiazolidinediones can ameliorate adipose tissue range of detrimental effects on the heart, vasculature,
inflammation, both pioglitazone and rosiglitazone kidneys, and adipose tissue that can lead to heart
exert deleterious effects on the clinical course of failure. Of importance, antihyperglycemic drugs that
heart failure because of their action to promote act through insulin signaling appear to consistently
sodium reabsorption in the renal tubules. In increase the risk of heart failure, whereas drugs that
experimental studies, thiazolidinediones exert their ameliorate hyperinsulinemia have been shown to
sodium-retentive effects (in part) by enhancing in- reduce the onset and progression of heart failure. In
sulin signaling in the renal tubules; in clinical patients with diabetes and established heart failure,
studies, the risk of heart failure produced by these intensive glycemic control with insulin-dependent
drugs is increased by concomitant treatment with therapeutic regimens is associated with an increased
insulin. For many antihyperglycemic drugs, there- risk of death. The totality of evidence therefore sup-
fore, an increase in insulin signaling may exacerbate ports the hypothesis that heightened insulin
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Packer 419
JUNE 2018:415–9 Insulin Signaling and Heart Failure

signaling, rather than hyperglycemia, may be the

primary determinant of the development and pro- ADDRESS FOR CORRESPONDENCE: Dr. Milton
gression of heart failure in type 2 diabetes. This Packer, Baylor Heart and Vascular Institute, Baylor
conclusion suggests that the risk and course of heart University Medical Center, 621 North Hall Street,
failure are meaningfully influenced by the choices Dallas, Texas 75226, USA. E-mail: milton.packer@
physicians make to lower blood glucose. baylorhealth.edu.

REFERENCES

1. Packer M. Heart failure: the most important, pre- prospective cohort study. Acta Diabetol 2013;50: infarction in non-diabetic patients. Eur Heart J
ventable, and treatable cardiovascular complication 597–606. 2004;25:1891–7.
of type 2 diabetes. Diabetes Care 2018;41:11–3.
4. Nichols GA, Koro CE, Gullion CM,
2. Greulich S, Maxhera B, Vandenplas G, et al. Secre- Ephross SA, Brown JB. The incidence of
tory products from epicardial adipose tissue of patients congestive heart failure associated with anti- KEY WORDS antidiabetic drugs, diabetic
with type 2 diabetes mellitus induce cardiomyocyte diabetic therapies. Diabetes Metab Res Rev mellitus, heart failure, insulin
dysfunction. Circulation 2012;126:2324–34. 2005;21:51–7.

3. Konduracka E, Cieslik G, Galicka-Latala D, et al. 5. Kragelund C, Snorgaard O, Køber L, et al.

Myocardial dysfunction and chronic heart failure in Hyperinsulinaemia is associated with increased A PP END IX For supplemental material,
patients with long-lasting type 1 diabetes: a 7-year long-term mortality following acute myocardial please see the online version of this paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

STATE-OF-THE-ART REVIEW

Emerging Applications of Virtual

Reality in Cardiovascular Medicine
Jennifer N.A. Silva, MD,a,b Michael Southworth, MS,b Constantine Raptis, MD,c Jonathan Silva, PHDb

SUMMARY

Recently, rapid development in the mobile computing arena has allowed extended reality technologies to achieve per-
formance levels that remove longstanding barriers to medical adoption. Importantly, head-mounted displays have
become untethered and are light enough to be worn for extended periods of time, see-through displays allow the user to
remain in his or her environment while interacting with digital content, and processing power has allowed displays to
keep up with human perception to prevent motion sickness. Across cardiology, many groups are taking advantage of
these advances for education, pre-procedural planning, intraprocedural visualization, and patient rehabilitation. Here,
we detail these applications and the advances that have made them possible. (J Am Coll Cardiol Basic Trans Science
2018;3:420–30) © 2018 The Authors. Published by Elsevier on behalf of the American College of Cardiology Foundation.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

F or many years, extended reality technologies

have promised physicians the ability to move
beyond 2-dimensional (2D) screens, allowing
them to understand organ anatomy in 3-dimensions
longstanding barriers to adoption in the medical
community.
Advances in digital light projection, organic light
emitting diode, and optics manufacturing have
(3D) noninvasively. However, this promise has been resulted in thinner, lower-power, and brighter
stymied by bulky equipment that was incapable of display systems (2). Speech recognition and gener-
displaying high-quality virtual images coherently ation advancements brought the earliest forms of
enough to prevent user motion sickness. Recent ad- augmented aural reality; the online digital assistant
vances in high-resolution display technology, expo- now known as Siri (Apple, Cupertino, California) or
nential increases in computational power, and Google’s assistant (Google, Mountain View, Califor-
miniaturization of components led by mobile device nia) are in use daily, along with automated tran-
manufacturers have enabled a new class of head scription systems. Sensor technology advancements
mounted display (HMD) devices (1). These low-cost, in positioning and navigation systems originally
comfortably-worn devices can display high-quality designed to function with the global positioning
clinical data at response times that are fast enough system have been extended to include satellite-free
to be used for extended periods of time, overcoming indoor navigation, tracking user position via their

From the aDivision of Pediatric Cardiology, Washington University School of Medicine, St. Louis, Missouri, USA; b Department of
Biomedical Engineering, Washington University School of Engineering and Applied Science, St. Louis, Missouri, USA; and the
c
Department of Radiology, Washington University School of Medicine, St. Louis, Missouri, USA. This work was funded by Children’s
Discovery Institute Grant CH-II-2017-575. Abbott has provided research support (software) for this project. Dr. Jennifer N.A. Silva
has received research support from Medtronic, St. Jude Medical, Abbott, and AliveCor. Drs. Jennifer N.A. Silva and Jonathan Silva
serve on the Board of Directors of and are consultants for SentiAR. Dr. Southworth is a SentiAR shareholder. Dr. Jonathan Silva is a
Board Director of and consultant for SentiAR. Dr. Raptis has reported that he has no relationships relevant to the contents of this
paper to disclose. Drs. Jennifer N.A. Silva and Southworth contributed equally to this work and are joint first authors. Robert
Roberts, MD, served as Guest Editor for this paper.
All authors attest they are in compliance with human studies committees and animal welfare regulations of the authors’
institutions and Food and Drug Administration guidelines, including patient consent where appropriate. For more information,
visit the JACC: Basic to Translational Science author instructions page.

Manuscript received August 4, 2017; revised manuscript received November 16, 2017, accepted November 22, 2017.

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2017.11.009

JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Silva et al. 421
JUNE 2018:420–30 VR in Cardiology

mobile device by leveraging software and hardware AR applications minimally interfere with the ABBREVIATIONS

such as Project Tango and ARCore (Google) or ARKit normal field of vision, providing useful in- AND ACRONYMS

(Apple). Eye and hand tracking provides new hu- formation only when called upon by the user.
AR = augmented reality
man machine input capabilities for understanding In the medical setting, contextually relevant
CGH = computer-generated
natural intent with less burden on the user to un- graphics, reference data, or vital information
holography
derstand the language of a specific manufacturer. is presented alongside (rather than in place
EAMS = electroanatomic
This combination of hardware and software inno- of) the physical surroundings. The first, and mapping system
vation has enabled new classes of 3D platforms. most widely publicized commercial platform, FOV = field of view
Based on these advances in 3D platforms, the Google Glass for example, was shown to
HMD = head-mounted display
number of clinical applications has grown exponen- display patient vital signs, relevant history,
HVS = human visual system
tially in the areas of education, pre-procedural plan- and prescription information from a patient’s
IMU = inertial measurement
ning, rehabilitation, and even intraprocedural electronic health record during a visit (8). unit
visualization. Here, we focus on the application of More recently, other platforms have been
MeR = merged reality
virtual reality (VR) and related technology for clinical developed for education, patient point of care
MxR = mixed reality
cardiac practice, focusing on what is possible based (Evena [9]), emergency response, and tele-
SLM = spatial light modulator
on current technology and what barriers still exist for medicine (AMA Xperteye [10]).
VAC = vergence and
widespread adoption. VR and AR denote the 2 bookends of the
accommodation conflict
continuum of experiences, and as the in-
VR = virtual reality
DEFINING REALITY dustry has grown, 2 new classes of experi-
ences have emerged: merged reality (MeR) and
Extended reality describes the spectrum, or “virtual- mixed reality (MxR). Both approaches achieve a
ity continuum” (3) from fully immersive, curated similar experience: to allow for interaction with
digital experiences in VR, to unobtrusive annotations digital objects while preserving a sense of presence
within easy access of the operator in augmented re- within the true physical environment. MeR captures
ality (AR) (Table 1). It encompasses 2D annotations on a user’s surroundings and re-projects them onto on a
real-time video, 3D models, and true interference- VR-class HMD, which can mediate the environment
based holograms, like animated versions of those up or down as desired. This allows for a more
seen on baseball cards. Although most headsets refer seamless transition between mediated and unmedi-
to their models as “holograms,” HMDs typically ated virtuality and reality. For consumers, this is
create the perception of depth for 3D models through portrayed as the ability to transport users to a
stereoscopy, simulating depth without generating completely different room and back to their living
true holograms. room with the same device (Intel Alloy [11]), which
VR provides complete control over the wearer’s could also be applied to patients in hospital rooms.
visual and auditory experience as they interact within MxR accomplishes a similar experience by projecting
a completely synthetic environment. This control digital objects onto a semitransparent display. As
over the environment can provide virtual experiences such, the MxR platforms do not obscure, or mediate,
of either subdued or amplified versions of reality. the physical environment, allowing the wearer to
Commercially available VR platforms from Oculus, maintain situational awareness of their surroundings
HTC, and Sony, among others, use high-resolution as well as maintain normal interactions with those
displays to fully replace the wearer’s visual field. not participating in the MxR experience. This
These immersive displays have been applied to pain advance has opened a window of opportunity for
management (4), exposure therapy (5), stroke reha- this type of technology for intraprocedural use,
bilitation (6), education, and surgical planning (Sur- allowing physicians to remain in their environment
gical Theater). while viewing the virtual image (Central Illustration).
Conversely, AR allows the wearer to see their Currently, MxR displays commercialized by Micro-
native environment while placing 2D or 3D images soft and DAQRI (Los Angeles, California) have been
within it through a “window-on-the-world” (3). This demonstrated in medical education and medical
annotated window-on-the-world can be displayed on imaging (12).
an unobtrusive HMD or on a mobile device, using the Several additional prominent 3D display platforms
onboard camera to provide a live view of the envi- have been developed without using an HMD,
ronment. Perhaps the most successful consumer including 3D flat-panel displays, and interference-
application of AR technology has been Pokémon Go based computer-generated holography. Flat-panel
(7) in which a mobile phone camera feed was anno- 3D displays, first introduced in 2010 (13), were pri-
tated with avatars and contextual game data. These marily displays only and lacked input devices for
422 Silva et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

VR in Cardiology JUNE 2018:420–30

plastic models. This improved depth of under-

T A B L E 1 The Extended Reality Spectrum
standing should help parents better participate in
Virtual Reality Merged Reality Mixed Reality Augmented Reality their child’s complex medical care. This application
Interactive virtual Interactive virtual Interactive virtual Virtual objects has been expanded to Stanford medical students
objects objects objects
and trainees, who can visualize normal and
Virtual background True background True background True background
Immersive display Immersive display See-through display See-through display abnormal anatomies and understand how congenital
anomalies affect physiology. Using a fully
Fully Immersive Experience Unobstructed Experience immersive VR headset, the students can inspect,
manipulate, and walk through the models,
providing a more complete understanding of the
manipulating 3D data. Hewlett Packard’s (Palo Alto, anatomy and physiology. A library of approximately
California) Zvr 3D display and input device is used in 2 dozen common congenital lesions is available to
conjunction with EchoPixel’s (Mountain View, Cali- the trainees. The aim of these experiences is to
fornia) software to provide diagnostic quality images provide a deeper anatomic understanding of these
(14). A second example, computer interference-based lesions, improving the understanding and speed of
holography, generates realistic 3D images by shaping learning of these complex abnormal physiologies
light waves using a combination of complex pro- and hemodynamic sequelae.
cessing, specialized computer-controlled light sour- The final application is the use of a 3D monitor,
ces, and optics. Although real-time display of Echopixel (as discussed later in the section “Pre-
holograms was first demonstrated in 1992 (15), recent Procedural Planning”), in the cardiothoracic oper-
advances by RealView imaging have enabled their ating room. A 3D workstation in the surgical suite
practical use, and they have explored several clinical may allow for accurate assessments of intracardiac
applications using this technology, including cardi- anatomy and geometry, which may be difficult to see
ology (16,17). after patients are placed onto cardiopulmonary
bypass and the heart is decompressed.
CARDIAC APPLICATIONS OF
VIRTUAL REALITY H o l o A n a t o m y . At Case Western Reserve University,
investigators are using the HoloLens (Microsoft) to
Various cardiac applications of virtual reality are change medical student education, particularly
depicted in Figure 1. anatomy (19). The ability to better understand 3D
anatomic relationships not only eases the learning
EDUCATION. Extended reality provides a wide range
curve, but also encourages students to “think like a
of possibilities for educational and training applica-
doctor.” In conjunction with the Cleveland Clinic, the
tions. Some applications leverage the immersion that
team at Case Western Reserve University is devel-
VR enables to simulate the entire operating environ-
oping a curriculum, HoloAnatomy, that will allow
ment along with the educational material. Another
medical students to perform holographic dissections
class of applications brings the existing medical sim-
to better visualize and understand the body’s organs
ulations for tablets and mobile phones to VR as the
and systems. Preview versions of this software are
next platform that trainees will have access to. These
freely available to download.
VR-use cases are generally available across most
consumer VR platforms. Other applications take PRE-PROCEDURAL PLANNING. E c h o P i x e l . One of
advantage of the presence of MxR to allow multiple the first 3D displays to gain approval from the U.S.
wearers to interact and discuss with each other while Food and Drug Administration is the True 3D system
viewing the same educational material in a natural that has been developed by Echopixel, which is in-
environment. These applications rely on the view tegrated into a diagnostic grade DICOM workstation.
through nature of MxR, combined with the freedom The system provides 3D visualization using a tech-
of untethered headsets to walk around and commu- nique similar to that used in 3D movie theaters and
nicate naturally. early 3D consumer televisions: by providing different
S t a n f o r d v i r t u a l h e a r t . The Stanford Virtual Heart images to each eye using specialized glasses. A single
Project (18), working with Lighthaus, Inc., uses an Echopixel user wearing polarized glasses can addi-
immersive VR headset for educational purposes. tionally manipulate the onscreen image using a
This project has a few distinct arms. The first is handheld wand. Initial cardiology studies include
geared at patient and family education to help using the Echopixel system to visualize arteries in
families better understand their child’s cardiac patients with pulmonary atresia with major aorto-
anatomy, which is currently limited to drawings and pulmonary collateral arteries. In this study (20),
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Silva et al. 423
JUNE 2018:420–30 VR in Cardiology

C ENTR AL I LL UST RA TI O N Mixed Reality Cardiac Electrophysiology Workflow

Silva, J.N.A. et al. J Am Coll Cardiol Basic Trans Science. 2018;3(3):420–30.

Mixed reality allows for the display and interaction with existing displays within the cardiac catheterization suite, including integration with fluoroscopy
(top left), electroanatomic mapping systems (top center), electrocardiograms (top right), as well as previously acquired and computed tomography– or
magnetic resonance–derived 3-dimensional (3D) anatomic models (middle row). Although augmented reality platforms (bottom left) can show 2-
dimensional (2D) data unobtrusively, mixed reality platforms (bottom center) allow for hands-free 2D and 3D visualization as well as direct sterile control
of these data without otherwise obstructing the normal visual field, as in virtual reality (bottom right).
424 Silva et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

VR in Cardiology JUNE 2018:420–30

geometry with real-time catheter locations, but also

F I G U R E 1 Emerging Applications of Extended Reality Applications
allows direct control of the display without breaking
sterility, which is a key advance (21).

ELVIS can display data that is exported from an
EAMS or that is obtained pre-procedurally via
computed tomography or cardiac magnetic resonance

imaging. To date, we have connected ELVIS to the
EnSite Velocity EAMS (Abbott, Abbott Park, Illinois)
via the CoHesion module to display electroanatomic
data, including cardiac geometry, catheter localiza-
tion data, and electroanatomic maps, including local
activation time and voltage maps. Most recently, we
have demonstrated the ability to display historical
cases for review, as well as a live case observed in
real-time from the control room. In addition to the
ability to improve visualization, the system allows
the user to utilize gesture, gaze, or voice control for
sterile control of the display. This improved interac-
tion allows the interventionalist to directly control
this single cohesive model in manner that is optimal
The x-axis is a condensed representation of the virtuality continuum, with virtual reality
(VR) on the left, mixed reality (MxR) and merged reality (MeR) in the center, and for a given procedure.
augmented reality (AR) on the right. The y-axis categorizes the applicability of each Sharing functionality provides a single shared
solution. Intraprocedural applications are the most sensitive platform type, and cardiac holographic model for as many as 5 users with
currently are only being developed for MxR.
the model remaining fixed in the room, allowing all
users to visualize the model from their vantage
points. Using the sharing system, there is a single
person in control of the system at any given time with
cardiologists evaluated patients who had undergone the ability to pass controller privileges to other users.
computed tomography angiography either by using Supplemental Video 1 demonstrates the current
the 3D display or a traditional readout. Cardiologists functionality of the prototype, including sharing,
using the True 3D display had interpretation times of gesture control, and the display of intracardiac ge-
13 min compared with 22 min for those that used a ometry and catheter movement that were obtained
traditional display. Both groups were similarly accu- from the EnSite system.
rate in their interpretations when compared to cath- R e a l v i e w . In 2016, the pediatric cardiology group at
eter angiography. Schneider’s Children’s Medical Center partnered with
The True 3D display is also being used as part of the Realview Medical Imaging (Yokneam, Israel) to assess
Stanford Virtual Heart Project (see the previous sec- the feasibility of creating real-time 3D digital holo-
tion, “Education”). grams in a standard cardiac catheterization laboratory
INTRAPROCEDURAL VISUALIZATION. E n h a n c e d (16). The Realview computer-generated holography
electrophysiology visualization and interaction (CGH) were created using 3D rotational angiography
 V I S ) . Currently, visualization in
s y s t e m ( P r o j e c t EL coupled with 3D transesophageal echocardiography.
the electrophysiology laboratory relies on a combi- A total of 8 patients were enrolled in this study,
nation of fluoroscopy, electroanatomic mapping sys- including patients with structural heart disease and
tems (EAMS), and echocardiography (intracardiac post-operative cardiac patients. In all patients, the
echocardiography and transesophageal echocardiog- team generated real-time 3D holograms with high
raphy), with most laboratories using EAMS plus other accuracy (as measured by instructing 4 independent
tools. Although improvements in visualization have observers to identify anatomic landmarks within the
been a source of research and development over the hologram and typical cardiac imaging) with “very
years, there have not been equal gains in improve- easy” interactions including image marking, crop-
ments in interaction. Our prototype, the Enhanced ping, zoom, rotation, movement of hologram, and

ELectrophysiology and Interaction System (ELVIS), slicing. This is the first study of its kind to demon-
not only empowers the interventional electrophysi- strate feasibility within the cardiac catheterization
ologist to visualize patient-specific 3D cardiac laboratory.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Silva et al. 425
JUNE 2018:420–30 VR in Cardiology

F I G U R E 2 Simplified Image Formation Diagrams for the HVS and Common Extended Reality Displays

Sample extended reality optics configurations for extended reality displays for visualizing a gray sphere at the top of each diagram, as
perceived by an observer eye at the bottom of each diagram. (A) The normal human visual system (HVS) observes the sphere directly, and can
accommodate variable focal distances. (B) Virtual/merged reality systems magnify an opaque, distortion-compensated display through a
plano-convex type (shown) or Fresnel equivalent lens (not shown). (C) In reflective half mirror (“birdbath”) view through systems, light from
the display reflects off a semitransparent splitter and focus/combiner to the eye. (D) In computer-generated holography (CGH), an incoming
light wave front (right) is shaped through the spatial light modulator (SLM) (center) to match the wave front of the sphere from the correct
focal distance. (E) In polarizing reflector waveguides, the input display is coupled into the waveguide with a polarizing mirror and reflected
internally. Polarized reflectors selectively decouple light from waveguide to the eye. (F) In an array of half mirrors, light from the display is
internally reflected through the waveguide, and is reflected to the eye through an array of small, semi-reflective mirrors (shown as a bold
line) rather than an equivalent large mirror (not shown). (G) In diffraction waveguides, light is coupled from the display through diffraction
structures such as surface grating diffraction (SGD) shown or holographic optical element (HOE), not shown. Light is then reflected internally
through the waveguide and decoupled out through a corresponding output diffraction structure. Note that only the normal HVS (A) and CGH
(D) support multiple focal planes as shown.

REHABILITATION. M i n d M a z e . MindMaze (San Francisco, the technology continues to evolve rapidly. In the
California) is creating both hardware and software in following text, we describe currently available sys-
the VR space with a current medical application tems and future devices that will certainly expand the
in neurorehabilitation. Their current solution, number of opportunities for extended realities to
MindMotion PRO, is cleared by the U.S. Food and improve patient care.
Drug Administration for use in post-stroke patients, DISPLAYS. Typical displays project either a single
combining virtual reality, brain imaging, and gaming coherent image to 1 or both eyes as a near-eye display,
technologies to retrain the brain to improve upper or in a stereoscopic pair for 3D simulation. Monocular
limb mobility. In acute post-stroke patients, a systems are either opaque or view through, and avoid
clinical study has enrolled patients who engage in disruption of normal vision by positioning a small
20- to 30-min sessions as soon as 4 days post- display outside of the normal working visual field.
hospitalization without continuous supervision, This allows a user to access the information contained
with increasing training intensity over time (22). All on the display “at a glance.” Equivalent capabilities
patients had a positive user experience using the can be achieved using biocular displays, or the dis-
MindMotion PRO, with 90% reporting an improve- plays can provide 2 different images to provide ste-
ment in movement capacity (22). reoscopic image pairs. Most HMD platforms generate
image pairs by using a panel display or small projector
EXTENDED REALITY HARDWARE and a series of optics to enlarge the image and
simulate projection at a distance to ease focusing, as
Significant advances in extended reality devices have illustrated for several common systems in Figure 2.
enabled the previously mentioned applications, yet For a given projected distance and resolution, as the
426 Silva et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

VR in Cardiology JUNE 2018:420–30

F I G U R E 3 Positional Tracking Systems

The perception of depth is influenced by the distance at which the eyes converge and the focal distance of the eye, referred to as vergence
(left) and accommodation (right), respectively. 3-dimensional displays, which rely on stereo vision, can only influence vergence by adjusting
the stereo disparity between the left and right eye, and the focal plane of the optics remains fixed. The eyes (bottom) perceive the vergence
depth of the image of the sphere on the displays by the distance of the intersection of the displayed images. On the right, the accom-
modation distance is the distance to the focal plane at which the cube is in focus. Objects at closer and farther focal distances appear out of
focus. Vergence and accommodation conflicts cause discomfort due to the disagreement in vergence and accommodation distances,
particularly at close distances where accommodation cues are most influential.

apparent display and field of view (FOV) is increased, resolution in the depth plane in addition to FOV of
apparent pixel size is also increased. traditional stereo HMDs.
3 D d i s p l a y . Most 3D displays use either active or I n t e r f e r e n c e - b a s e d h o l o g r a p h y . Holographic dis-
passive shutters to simulate stereoscopic 3D without plays refer to interference-based holography, gener-
a near-eye display. These displays simulate depth ated using a spatial light modulator (SLM) to create a
similarly to head-mounted displays, by projecting a hologram in space, at video framerates. The SLM
displaced image to each eye, controlled by either shapes the incoming reference light to replicate the
shutters or polarization in the glasses to provide the wave front that would originate from a real object at
perception of depth. These displays can be used for the appropriate position in 3D space, creating a true,
navigating and interacting with medical images in a multifocal, 3D hologram. This approach is being used
conventional office setting using a stylus for interac- by Realview to display 3D images of the heart
tion (EchoPixel, Hewlett Packard’s Zvr). Current dis- (described in the previous text). The process of
plays are readily available and can be integrated into generating an interference pattern for a given 3D
hospital workflows; however, disadvantages include model and generating instructions for the SLM is
the required use of glasses, the capacity to support computationally complex, but the resulting hologram
only a single user at a time, and a limited depth vol- best satisfies the requirements of the human visual
ume for tracking and display. system. In general, CGH, however, is restricted by
L i g h t fi e l d d i s p l a y s . Light field displays use the render volume, viewing angle, and brightness.
projection of light directly onto the retina. The pri- W a v e g u i d e s . There are many different variants of
mary advantage of these techniques is that they waveguide-based displays (23), but all fundamentally
encode both the position of light and the angle, rely on reflecting the output of a display through
providing a more realistic image by recreating depth. reflection to a view-through display in front of the
True light field displays require much more compu- user’s eye. The fundamental tradeoff of these dis-
tational capacity to render a point in space and plays is that the cost and complexity of a given design
generate the bundles of light necessary. The Avegant increases as FOV increases. The relatively uncompli-
Light Field display (Belmont, California) is not yet cated design of the reflective half mirror, utilized by
commercially available and is not a true, full, light devices like the ODG R-9 (San Francisco, California),
field display, but circumvents this complexity by ac- uses a single reflective half mirror and a reflector/
commodating a limited number of fixed focal depths. combiner, first developed for aircraft head-up dis-
Displays of this type fundamentally trade spatial or plays. Improvements on this design rely on minia-
temporal resolution in the viewing plane for turizing the mirror using embedded polarizing
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Silva et al. 427
JUNE 2018:420–30 VR in Cardiology

reflectors (Lumus, Rechovot, Israel), arrays of micro- Real Sense, Microsoft Time of Flight) and voice
structure mirrors (Optinvent, Monte Sereno, Califor- recognition (Google Assistant, Microsoft Cortana)
nia), and diffractive etched surface (HoloLens, provide the basis for navigation and control for most
Microsoft; Vuzix, Rochester, New York) or holo- platforms. Most commercial VR displays use headset-
graphic gratings (Digilens, Sunnyvale, California; mounted or external-fixed optical tracking (Optitrack,
WaveOptics, Oxfordshire, England). Microstructure Corvallis, Oregon; Polaris, Medina, Minnesota; Sco-
mirrors provide a compact, cost-effective view- pis, Cambridge, Massachusetts) to provide accurate
through display, whereas diffractive waveguides, positioning and tracking within a volume, known as
although currently more expensive to produce, can “outside-in” tracking (Figure 3, left). AR platforms
achieve complex optical systems in a relatively thin may rely on the same optical tracking, or use onboard
package. These view-through displays allow a clini- cameras to track fiducial markers within the envi-
cian to visualize data in either 2D or stereo 3D without ronment. IMUs provide high-resolution angle and
otherwise obstructing the normal visual field. rate information for updating the view on screen,
VIRTUAL INTERACTION. The breadth and depth of which is coupled with optical tracking information to
interactions with these different display platforms provide correction updates to the tracking system,
have expanded as sensor and processing capabilities known as “inside-out” tracking (Figure 3, right).
have improved, ranging from marker-free tracking to Network communications can provide access to
neural and voice inputs. The simplest form of inter- highly trained voice recognition algorithms, or
action common to most HMDs is through the move- simpler local models can be used for specific com-
ment of the head, measured by accelerometers in the mands. Near-eye pupil tracking (Pupil Labs, Berlin,
display. This angular movement updates the display Germany) cameras are available for simple tracking as
based on the direction the head is pointing, and a an input device or as an enhancement to gesture
display cursor representing the center of the user’s input. Ultrasound arrays (Ultrahaptics, Bristol,
focus is rendered in a fixed position relative to the England) can provide sterile haptic feedback through
display. This gaze cursor is usually rendered on the free air by using ultrasonic speakers to induce
vertical midline of the display, although not neces- sensation on skin. This can help overcome the lack of
sarily in the center of the FOV depending on the haptic feedback when interacting with digital objects.
manufacturer and ergonomics. If the gaze cursor is on CHALLENGES
an interactive element, such as a button, there are
generally 2 methods of interaction with it. The first The applicability of different modalities of extended
gaze-based interaction is referred to as gaze-dwell, reality to education, pre-procedural planning, intra-
and is triggered by holding the gaze cursor on the procedural guidance, and therapeutic use depends on
interactive element for an application-determined their inherent advantages and limitations, particu-
amount of time. If the HMD is equipped with inter- larly with respect to isolation from the natural phys-
nal or external hand tracking hardware, the user ical environment. VR and MeR completely occlude
could also initiate activation of the interactive the normal visual field, whereas AR and MxR enhance
element using a recognized hand gesture, which in the visual field. This is most apparent when power is
combination with gaze is referred to as a gaze-gesture removed from the display; VR and MeR are
command. completely opaque and must be removed to be able to
In addition to these gaze-based commands, some see, whereas AR and MxR are transparent and only
displays can recognize more complex hand gesture or the digital additions are removed. VR, for example,
controller gesture commands by tracking the hand or can allow an individual student to interact in a fully
a controller in the hand. Controllers have the added immersive simulation, isolated from outside distrac-
benefit of supporting physical buttons in place to tion. However, AR, MeR, and MxR will allow inter-
further enhance interaction. Finally, most platforms ventionalists to maintain presence in a physical room
support a microphone to support varying levels of to perform procedures as well as maintain the ability
voice command automation. Although gesture inter- to interact with the patient and cooperate with their
action offers a rich, efficient means to interact with supporting personnel. MeR platforms, however, pre-
the environment, voice and gaze-dwell inputs have sent a potential safety risk during a procedure in the
the advantage of being hands-free, and controllers event of power loss, which would cause complete
lose the advantage of being touch free. obstruction of the normal visual field.
SENSORS. Compact inertial measurement units Extended reality platforms are constrained pri-
(IMUs), optical tracking, depth sensing cameras (Intel marily by cost, size, weight, and power to achieve
428 Silva et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

VR in Cardiology JUNE 2018:420–30

the human visual system (HVS). The lower bound of

F I G U R E 4 Principles of Vergence and Accommodation
a normal human visual acuity (roughly 20/20 or 6/6)
is 1 arc min/pixel with an approximately 150o to 170 o
by 135 o to 150 o elliptical FOV (24–26). A display
system that achieves this angular resolution contains
pixels that are considered indistinguishable,
commonly referred to by Apple as a Retina Display.
This equates to a roughly 9,000 by 8,100 pixel/eye
requirement to fully emulate and immerse the hu-
man visual system. By comparison, 4K HMD displays
contain 3,840
2,160 pixels and commonly require
workstation class graphics for processing. Under-
standably, this resolution and FOV is currently not
economically feasible with current optics and
display technologies. As a result, device manufac-
turers compromise FOV, pixel density, and display
brightness to achieve the optimum capabilities for a
Extended reality platforms rely on positional tracking systems
to track head mounted display, hand, and instrument positions. given application (Table 2). Cost, size, weight, and
Tracking systems are either external (“outside-in”) systems power will only decrease as technology advances, as
(left) or on-board (“inside-out”) systems (right). Outside-in demonstrated by the recent release of the Apple
optical systems use visual and time-of-flight cameras to track
iPhone X (27), which contains miniaturized, lower-
the relative angles to triangulate positions and poses of active
power versions of the depth sensors, IMU, and pro-
or passive marker arrays mounted to the headset, controllers,
and tools. Inside-out tracking systems track the relative an- cessing required for advanced, handheld AR.
gles, hands, tools, and landmarks to triangulate the position Depth at close distances is also perceived through
and pose of the headset relative to landmarks, and the position accommodation (Figure 4, right), or the perception of
of hands and tools relative to the headset without any external
depth due to disparity in focal depth, which is a
hardware.
challenge facing all conventional stereoscopic dis-
plays. Accommodation is required to allow a user to
focus on instruments and digital objects at the same
the highest visual quality, mobility, processing simulated distance (28) (e.g., surgical guidance
speed, and interactivity. Visual quality is dependent overlays, within “personal space” and “action
on resolution, brightness, focal depth, and FOV. space”). Disparity between vergence depth displayed
Display technology is the most demanding aspect of by HMD and accommodation expected by HVS is
extended reality, and is generally the largest design referred to the vergence and accommodation conflict
and cost constraint (23). For 3D systems, this is (VAC) and is responsible for discomfort at these close
compounded by requiring stereoscopic pairs of im- working distances (29). Most display systems only
ages to generate the perception of depth through support a single, fixed, focal plane for all digital ele-
vergence, or the angularity disparity between 2 dis- ments (Figure 4), although some emerging technolo-
plays (Figure 4, left). The display system must gies can provide multiple fixed focal planes by
compromise size and cost with providing the employing adaptive optics.
maximum visual quality to match the capabilities of
PLATFORM DIFFERENTIATION

T A B L E 2 Technical Resolution and Field of View for Various Displays

Every design decision to mitigate these challenges
affects applicability for use in each procedural envi-
Angular Resolution Diagonal Field of
(arc-min) View (o ) Tethered ronment. AR and MxR displays provide the best
Human eye (20/20) 1.0 w150 compromise between digital annotation and clear
60-inch 4K UHD @ 40” 1.0 73.7 FOV. The high pixel density, large FOV devices
24-inch 1,080P @ 24” (ZvR) 1.4 53.1 designed for desktop or office use, require an umbil-
Oculus Rift (VR) 4.9 132.2 Yes ical to a high-powered workstation to support the
HoloLens (MxR) 1.4 34.5 processing required for their displays. These devices
Meta2 (MxR) 2.8 90.0 Yes
provide a larger digital display and a higher-
MxR ¼ mixed reality; UHD ¼ ultra high-definition; VR ¼ virtual reality.
resolution display, but at the expense of compli-
cated setup before procedures and limited
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Silva et al. 429
JUNE 2018:420–30 VR in Cardiology

maneuverability during procedures. Untethered CONCLUSIONS

platforms generally have a reduced FOV and require
battery power, but allow for unrestricted movement. Rapid hardware advances driven by the revolution in
CGH platforms provide the most realistic, true holo- mobile computing have finally brought devices that
grams within close working distance, but still require are tractable for medical applications into existence.
large supporting systems tethered to the display, and These devices have the potential to provide physi-
have limited working volume. These CGH displays cians with a sterile interface that allows them to
and others that compensate for VAC are well suited control 3D images. Early data show that this improved
where near-field interaction between the digital and visualization will allow the physician to learn more
physical is critical (e.g., projection of pre-procedural quickly, interpret images more accurately, and
imagery onto a surgical field). Systems that cannot accomplish interventions in less time. These im-
simulate accommodation can avoid discomfort by provements in physician performance based on better
placing digital objects farther away, where the HVS is information will most likely translate into lower-cost
less sensitive to disparity in accommodation. Plat- procedures and better outcomes for patients.
forms utilizing external optical tracking achieve
consistent tracking volumes but require additional ADDRESS FOR CORRESPONDENCE: Dr. Jennifer N.A.
equipment and clear lines of sight between cameras Silva, Division of Pediatric Cardiology, Washington
and devices, which increases initial installation and University School of Medicine, 1 Children’s Place, CB
maintenance complexity. Mobile AR platforms with 8116 NWT, St. Louis, Missouri 63110-1093, USA. E-mail:
inside-out tracking of both position and gestures [email protected]. OR Dr. Jonathan Silva,
provide the most flexible platforms for intra- Department of Biomedical Engineering, Washington
procedural use, and can mitigate VAC through careful University in St. Louis, 1 Brookings Drive, CB 1097, St.
placement of digital objects. Louis, Missouri 63108-1097, USA. E-mail: [email protected].

REFERENCES

1. Rubin P. The inside story of oculus rift and how 10. AMA Xperteye. The Xpert Eye solution revolu- stanfordchildrens.org/en/about/news/releases/2017/
virtual reality became reality. Wired. May 20, tionize the modern medicine. Available at: http:// virtual-reality-program. Accessed December 11,
2014. Available at: https://www.wired.com/2014/ www.amaxperteye.com/us/. Accessed August 1, 2017.
05/oculus-rift-4/. Accessed December 11, 2017. 2017.
19. Case Western Reserve, Cleveland Clinic.
2. Sisodiaa A, Bayerb M, Townley-Smith P, et al. 11. Intel. Intel unveils Project Alloy. Available at: Case Western Reserve, Cleveland Clinic collabo-
Advanced helmet mounted display (AHMD). Proc https://newsroom.intel.com/chip-shots/intel-unveils- rate with Microsoft on ‘earth-shattering’
of SPIE Vol 2007:65570N–1. project-alloy/. Accessed December 11, 2017. mixed-reality technology for education. Available
at: http://case.edu/hololens/. Accessed December
3. Milgram P, Kishino FA. Taxonomy of mixed reality 12. Kamps HJ. Touch Surgery brings surgery
11, 2017.
visual-displays. Ieice T Inf Syst 1994;E77d:1321–9. training to augmented reality. TechCrunch. Avail-
able at: https://techcrunch.com/2017/01/06/ 20. Chan F, Aguirre S, Bauser-Heaton H, Hanley F,
4. Li A, Montano Z, Chen VJ, Gold JI. Virtual reality
touch-surgery-ar/. Accessed August 1, 2017. Perry S. Head tracked stereoscopic pre-surgical
and pain management: current trends and future
evaluation of major aortopulmonary collateral ar-
directions. Pain Manag 2011;1:147–57. 13. Whitworth D, First 3D television sets go on sale
teries in the newborns. Paper presented at:
in UK. BBC. Available at: http://www.bbc.co.uk/
5. Parsons TD, Rizzo AA. Affective outcomes of Radiological Society of North America 2013 Sci-
newsbeat/article/10085219/first-3d-television-sets-
virtual reality exposure therapy for anxiety and entific Assembly and Annual Meeting; Chicago,
go-on-sale-in-uk. Accessed December 11, 2017.
specific phobias: a meta-analysis. J Behav Ther Illinois; 2013.
Exp Psychiatry 2008;39:250–61. 14. HewlettPackard. EchoPixel True 3D, powered
by HP. HewlettPackard 2016. Available at: http:// 21. Silva JN, Southworth MK, Dalal A, Van
6. Comstock J, MindMaze receives FDA clearance Hare GF, Silva JR. Abstract 15358: Improving
h20195.www2.hp.com/v2/getpdf.aspx/4AA6-6086
to bring VR rehab platform to the US. August 3, 2017. visualization and interaction during transcatheter
ENW.pdf. Accessed January 2018.
Available at: http://www.mobihealthnews.com/ ablation using an augmented reality system:
content/mindmaze-receives-fda-clearance-bring- 15. Lucente ME. Optimization of hologram first-in-human experience (abstr). Circulation
vr-rehab-platform-us. Accessed December 11, 2017. computation for real-time display. SPIE Proceed- 2017;136:A15358.
ing #1667, Practical Holography VI 1992:32–43.
7. Ahn SJG. Pokemon Go is AR’s foot in the door to
22. Chevalley OH, Schmidlin T, Perez Marcos D,
our world. IEEE Spectrum: Technology, Engineer- 16. Bruckheimer E, Rotschild C, Dagan T, et al.
et al. Intensive upper limb neurorehabilitation with
ing, and Science News: IEEE Spectrum, 2017. Computer-generated real-time digital holography:
virtual reality in chronic stroke: a case report.
Available at: https://spectrum.ieee.org/view- first time use in clinical medical imaging. Eur Heart
Paper presented at: Annual Meeting of American
from-the-valley/consumer-electronics/gaming/ J Cardiovasc Imaging 2016;17:845–9.
Society of Neurorehabilitation; Chicago, Illinois;
pokemon-go-is-ars-foot-in-the-door-of-our-world.
17. Bruckheimer E, Rotschild C. Holography for October 15–16, 2015.
Accessed January 2018.
imaging in structural heart disease. Euro-
23. Kress B, Shin M. Diffractive and
8. Schuman AJ. What’s new in “connected” medi- Intervention 2016;12 Suppl X:X81–4.
holographic optics as optical combiners in
cal devices? Contemp Pediatr 2015;32:43–7.
18. Stanford Children’s Health, Stanford LPCsH, head mounted displays. Proceedings of the
9. EvenaMedical. Eyes-On Glasses 3.0. Available at: Lucile Packard Children’s Hospital Stanford pio- 2013 ACM conference on pervasive and
https://evenamed.com/eyes-on-glasses/. Accessed neers use of VR for patient care, education and ubiquitous computing adjunct publication
August 1, 2017. experience. Available at: http://www. 2013;1479–82.
430 Silva et al. JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

VR in Cardiology JUNE 2018:420–30

24. Strasburger H, Rentschler I, Jüttner M. Pe- 27. Apple I, iPhone X–technical specifications– 29. Shibata T, Kim J, Hoffman DM, Banks MS. The
ripheral vision and pattern recognition: a review. Apple. Available at: https://www.apple.com/ zone of comfort: predicting visual discomfort with
J Vision 2011;11:13. iphone-x/specs/. Accessed November 1, 2017. stereo displays. J Vision 2011;11:11.

25. Graham CH. Vision and visual perception. Ox-

28. Cutting JE, Vishton PM. Perceiving layout
ford: Wiley, 1965. KEY WORDS augmented reality,
and knowing distances: the integration, relative
cardiology, virtual reality
26. Caelli T. Visual Perception: Theory and Prac- potency, and contextual use of different infor-
tice: Pergamon International Library of Science, mation about depth. In: Epstein W, Rogers S,
Technology, Engineering and Social Studies. editors. Perception of Space and Motion. San AP PE NDIX For a supplemental video,
Elsevier, 2014:103–14. Diego, CA: Academic Press, 1995:69–117. please see online version of the paper.
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

ª 2018 THE AUTHOR. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN

COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER

THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/).

GUEST EDITOR’S PAGE

Partnerships Promote Translation

in Biomedicine
Peter Libby, MD, Associate Editor, JACC: Basic to Translational Science

T he term “translational research” trips lightly

off the tongue, but the actual practice often
proves elusive. I argue here that partnerships
can prove pivotal in promoting the translation of lab-
maintaining clinical contact can heighten apprecia-
tion of the talents and dedication of their more
clinically-oriented colleagues. Taking a turn in caring
for hospitalized patients keeps the laboratory-based
oratory studies to advances in clinical medicine. I partner in touch with the problems posed by pa-
focus particularly on what I will define as “horizon- tients in actual practice. As opposed to the laboratory
tal” and “vertical” partnerships. “Horizontal” part- world, the care of patients involves making decisions
nerships pertain to the relationships between and judgments in the absence of precise prior infor-
laboratory investigators with more patient-based or mation, rigorous controls, or abundant data that
clinically-oriented participants in the biomedical en- apply directly to the patient in front of them. While
terprise. “Vertical” partnerships refer to interactions the practitioner has clinical guidelines and the results
between academic investigators and those involved of trials as touchstones, in actual practice the indi-
in biotechnology and pharmaceutical enterprises. vidual face-to-face with the physician often does not
“Horizontal” partnerships in translational research meet the entry criteria for the pivotal clinical trials,
usually involve an individual dedicated principally to and each patient’s care requires a good deal of indi-
laboratory research who has made discoveries that vidual judgment. For the laboratory-based physician,
hold promise for clinical application and clinical confronting the uncertainties and ambiguities of
trialists. Few laboratory researchers have the skill set actual practice can foster humility and also engender
necessary for taking a laboratory finding through all deep respect for the seasoned clinician and clinical
the phases of clinical investigation and development investigator whose partnership proves essential to
to establish a new therapy or indication in the clinic. enable effective translation.
What key ingredients can foster partnership between Beyond mutual respect, a shared language can
these too often disparate types of individuals? facilitate translational partnerships. Often more
Mutual respect comprises one essential compo- clinically-oriented partners in translational relation-
nent. Laboratory-based researchers must accord ships have trained in some aspect of more fundamental
equal esteem to their more clinically-oriented col- research. Individuals who have spent some time
leagues as to peers in the basic research community. grappling with the delayed gratification common in
The practice of clinical medicine and investigation at the laboratory can appreciate better the travails of the
the highest level requires many of the same attributes experimental investigator. In addition, an acquain-
that enable success in laboratory undertakings. These tance with the concepts involved in research beyond
qualities include intelligence, investment in training, that which can be gleaned from textbooks provides a
judgment, and of course the sine qua non: hard work. common language: a Rosetta stone that facilitates
For the laboratory-based physician-investigator, communication in translational partnerships.
In addition, institutional culture can catalyze
translational research. Leadership that fosters, en-
ables, and rewards partnerships along the lines
From the Division of Cardiovascular Medicine, Department of Medicine,
described above can stimulate and sustain the types
Brigham and Women’s Hospital, Harvard Medical School, Boston, Mas-
sachusetts, USA. Dr. Libby has reported that he has no relationships relevant of interactions that enable success in translational
to the contents of this paper to disclose. research. In many great institutions, a cultural divide

ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2018.05.001

432 Libby JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018

Guest Editor’s Page JUNE 2018:431–3

Many laboratory-based investigators do not

F I G U R E 1 Interlocking Skills and Platforms Provided by Partners in
Clinical Translation
appreciate the extent of the inner workings of large-
scale clinical trials. Such investigations are delicate,
intricate, and arduous undertakings that involve
multiple trade-offs and compromises foreign to the
formulation of laboratory experiments. Clinical trials
require incredible dedication and effort for successful
completion. The clinical trialist lacks the ability to
repeat an experiment, a luxury available in the labo-
ratory environment.
While successful clinical trials entail many me-
chanical aspects which must perform correctly for
success, the judgment and scientific discernment of
the clinical trialist also participates pivotally in the
design, execution, analysis, and mining of the data
from clinical trials. On the other hand, input from the
more laboratory-based investigators can contribute to
the design and interpretation of trials. Input from the
laboratory investigator can help prioritize subsidiary
analyses and provide advice regarding what bio-
markers or genetic studies would enable the most
productive use of the biobanks and databases ac-
quired by contemporary large-scale clinical trials. The
remarks above provide some personal observations
regarding the value of partnerships in maximizing
opportunities for translational advances within aca-
demic institutions.
“Vertical” partnerships provide another key to
successful translation. The best academic-industrial
partnerships maximize the opportunities afforded
by interlocking skill sets, strengths, expertise, and
platforms (Figure 1). Academic investigators excel at
defining biological pathways that can identify new
HTS ¼ high-throughput screening; PD ¼ pharmacodynamics; targets for therapeutics as well as enlightening un-
PK ¼ pharmacokinetics; POC ¼ proof-of-concept.
derstanding of the pathogenesis of disease. Yet po-
tential targets lie fallow without the application of
skillful medicinal chemistry, access to compound
exists between the clinically-oriented faculty and libraries, or biological agent development to
those engaged in basic research. Such a “twin tower” generate therapeutics based on the targets identified
environment can present a barrier to the very types of in academic research. High-throughput screening
interactions that cultivate effective translation. with large libraries and robotic technology most
Leadership that values contributors along the entire often exceed the resources of any single academic
spectrum of translation from the most fundamental laboratory and many academic institutions. The
through to master clinicians can inspire the types of medicinal chemistry and high-throughput screens of
interactions that kindle success in translation. An compound libraries, as well as the development of
environment that encourages laboratory researchers biological agents, represent strengths of industry
to attend clinical conference and participate actively that complement discovery research conducted in
can enhance the likelihood of successful translation. the academic laboratory.
Including in clinical conferences laboratory-oriented The design of preclinical “proof-of-concept”
individuals who can communicate the concepts of studies can benefit enormously from input from aca-
their basic science findings clearly and understand- demic investigators. The choice of target populations,
ably to more clinically-oriented individuals and biomarkers, and surrogate endpoints in early clinical
trainees can nurture the culture of cooperation in development thrives when true partnership prevails
translation. between industry and academic physicians
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL. 3, NO. 3, 2018 Libby 433
JUNE 2018:431–3 Guest Editor’s Page

acquainted with the disease processes based on close transparency regarding financial relationships be-
clinical contact. These clinical insights—coupled with tween academic investigators and industry. The right
the strong pharmacokinetic and pharmacodynamic of the academic investigators to publish even nega-
modeling expertise of industry—can help to avoid tive data or possible adverse effects requires rigorous
some of the pitfalls of early clinical development. preservation. Academic investigators should have a
Such challenges commonly include issues related duplicate of the database of clinical trials and have
to dosing, enrollment criteria, and the choice of access to the biobanks generated during the investi-
outcome measures. The conduct of toxicology studies gation. Academic investigators should have the abil-
for new chemical entities in drug development not ity to perform independent statistical analyses of the
only lies outside the expertise and resources available study database. The steering committees of clinical
to academic investigators, but also does not provide a trials and the data and safety monitoring board must
fertile field for training in academic laboratories. This have sufficient independence to assure the rigor of
consideration limits the appropriateness of involve- the conduct of an analysis of a trial and protect the
ment of students or fellows in such projects in aca- participants.
demic laboratories. Yet, toxicology studies including Many look askance at partnerships between aca-
in vitro mutagenesis and animal toxicity studies must demic investigators and their institutions and the
precede bringing a compound into the clinic. These biotechnology or pharmaceutical industry. I argue
undertakings lie well within the expertise and re- that such partnerships not only enable or speed
sources of the industrial partner, and illustrate the translation, but can actually provide substantial
necessity of joining the interlocking expertises of societal benefit by enhancing the public health.
academia and industry to achieve effective With adequate safeguards, partnerships between
translation. academia and industry can hasten the development
The design and execution of clinical trials at its of novel therapies and also provide pathways for the
best involves a balletic coordination between aca- development of careers of physician investigators.
demic investigators and the pharmaceutical sponsor. The rich databases generated by contemporary clin-
As in earlier clinical development, a great deal of ical trials not only inform the primary endpoint, but
discernment and judgment can maximize the possi- should give rise to many subsidiary analyses which
bility of obtaining a clear answer from a clinical trial. prove hypothesis-generating, and can provide
Collaboration between academic and industrial stat- mechanistic insight or increased knowledge of
isticians can help assure the most rigorous approach pathophysiology.
to the all-important development of the trial protocol, Thus, both horizontal and vertical partnerships can
choice of endpoints, dosages for study, and the all- help promote translational medicine. Like many hu-
important statistical analysis plan. The tension be- man enterprises, these partnerships require consid-
tween resources allocated by the sponsor to the trial erable care and curation. Yet, at the end of the day
and the academic partner’s interest in maximizing they help to increase human knowledge and under-
power (for example, for subsidiary, subgroup, or standing of disease, and provide advances in clinical
exploratory analyses beyond the primary endpoint) care that can alleviate suffering and prolong life.
provides another example of the intricacy and
importance of the partnership between academia and ADDRESS FOR CORRESPONDENCE: Dr. Peter Libby,
industry. Division of Cardiovascular Medicine, Department of
Of course, academic-industry partnerships in Medicine, Brigham and Women’s Hospital, Harvard
development of novel therapies and their translation Medical School, 77 Avenue Louis Pasteur, Boston, Mas-
to the clinic require safeguards. There must be sachusetts 02115, USA. E-mail: [email protected].