CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 1
Self-assessment questions
1 a Structures that animal and plant cells have 3 a actual diameter = 20 µm (see caption)
in common:
diameter on diagram = 58 mm =
• nucleus with nucleolus and chromatin 58 000 µm

PDF from sachtienganhhanoi.com

• cytoplasm containing mitochondria, magnification, M = size of image,
Golgi apparatus and other small I
structures =
actual size of specimen A
• cell surface membrane. 58 000
=
20
b Structures found only in plant cells:
therefore magnification = ×2900
• chloroplasts
b magnification = ×16 000 (see caption)
• large, permanent central vacuole
length on micrograph = 65 mm =
• cell wall with middle lamella and 65 000 µm
plasmodesmata.
size of specimen, A = size of image,
c Structure found only in animal cells: I
=
• centriole. magnification M
65 000
2 • Use a sharp pencil. =
16 000
• Do not use shading / do not draw the therefore actual size of chloroplast = 4.1 µm
nucleus as a solid blob.
4 The resolution of a microscope is limited by the
• Do not cross label lines. radiation used to view the specimen. Resolution
• Do not use arrowheads on label lines. equals half the wavelength of the radiation used.
The shortest wavelength of light is 400 nm,
• Use a ruler to draw label lines. therefore the resolution of a light microscope
• Make outline of cells less sketchy – lines is 200 nm. The diameter of a ribosome is much
should be continuous, not broken. smaller than this, namely 25 nm.

• Write labels horizontally, not at the same

angle as the label line.
• Interpret what you see. For example, outlines
are not very accurate (too rounded).

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

5 • The nuclear membrane can be seen as a

double structure (envelope), continuous
Feature Light Electron with the rough endoplasmic reticulum,
microscope microscope and with pores in it.
source of light electrons • There is extensive rough and smooth
radiation endoplasmic reticulum throughout the cell.
wavelength 400–700 nm about 0.005 nm
of radiation • Free ribosomes are visible in the cytoplasm.
used • Microtubules are visible in the cytoplasm.
maximum 200 nm 0.5 nm in • The mitochondria have a double
resolution practice membrane (envelope), the inner layer
lenses glass electromagnets having folds into the matrix.
specimen living, non- non-living or • Chloroplasts have a double outer
living or dead dead membrane (envelope).
stains coloured dyes heavy metals
• Grana can be seen in the chloroplast, as
image coloured black and white stacks of sacs connected to other grana by

PDF from sachtienganhhanoi.com

longer sacs (thylakoids).
6 Detail in an animal cell seen with the electron
microscope but not apparent using a light 8a diameter of nucleus (I)
microscope: = 75 mm = 75 000 µm
• In the nucleus, chromatin can be magnification (M) = ×11 000
distinguished.
therefore actual diameter
• The nucleus is seen to be surrounded by a 75 000
of nucleus (A) = = 6.8 µm
double membrane (envelope) with pores 11 000
in it. b The nucleus may not have been sectioned
• Mitochondria have a surrounding double at its widest part. If you try cutting
membrane (envelope), the inner layer a model sausage, the cut surface of a
forming finger-like folds pointing inwards. transverse section will look like a circle.
The cut surface of a longitudinal section
• Endoplasmic reticulum is extensive will look like a sausage. Other sections
throughout the cell, some with ribosomes will be somewhere between circles and
(rough) and some without (smooth). sausages.
• Small structures seen under the light
9 Cilia in the oviduct beat in order to move the
microscope can be distinguished by the
egg from the ovary to the uterus. (It may be
electron microscope as lysosomes and
fertilised along the way.)
vesicles.
• Free ribosomes are seen throughout 10 Cell surface membrane: essential because it
the cell. forms a partially permeable barrier between
the cell and its environment, regulating
• The centriole is seen to be two separate movement of materials into and out of
centrioles. the cell. This is necessary to maintain an
• Finger-like extensions of the cell surface environment inside the cell which is different
membrane, known as microvilli, are seen. from that outside the cell.
• Microtubules are visible in the cytoplasm. Cytoplasm: site of metabolic activity. It
contains biochemicals in solution.
7 Detail in a plant cell seen with the electron
microscope but not apparent using a light Ribosomes: sites of protein synthesis, an
microscope: essential activity of all cells. (DNA controls
cells by controlling which proteins are
• In the nucleus, chromatin can be
made.) Protein synthesis is a complex process
distinguished.
involving the interaction of many molecules;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

the ribosome provides a site where this can Comparing the success of
happen in an organised way.
prokaryotic and eukaryotic cells
DNA: the genetic material. DNA contains the Criteria could be:
information which controls the activities of
• complexity of cells
the cell. It can replicate itself, enabling new
cells to be formed. • complexity of the whole organism
Cell wall (absent in animal cells): prevents the • size
cell from bursting as a result of osmosis if it is • total biomass on the planet
exposed to a solution of higher water potential.
• range of habitats they can live in
Flagellum: needed for locomotion by some cells.
• ability to survive adverse conditions
• ability to regulate their internal environments
Reflection
• number and variety of species.
What is a cell?
A cell is the basic unit of life. All living organisms Is this a meaningless question?

PDF from sachtienganhhanoi.com

are made of cells. All cells have a cell surface
This question probably is a meaningless question,
membrane, cytoplasm and genetic material in the
although it doesn’t stop people discussing it. All
form of DNA. All cells have a protein synthesising
living things have evolved to be adapted to their
machinery which includes ribosomes.
particular environments (ecological niches) and to
this extent are equally successful. Judgements can
Why are all living things made of cells? be made in various ways. Eukaryotes are far more
The biochemistry of life must be separated from complex than prokaryotes. Humans (probably
the surrounding environment. This separation is the most intelligent eukaryotes) have the greatest
achieved by the cell surface membrane. The cell control over their environments. Bacteria have the
surface membrane is partially permeable and greatest biomass and are the most versatile of cells.
controls what enters and leaves the cell. Without it, They are probably the most likely cells to survive
the chemicals of life would mix with the chemicals a catastrophic change in the Earth’s climate/
of the environment and a separate chemistry of environment.
life would be impossible.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 1
Exam-style questions
The mark schemes, suggested answers and 1 A ; [1]
comments that appear here were written by the 2 C ; [1]
author(s). In examinations, the way marks would
be awarded to answers like these may be different. 3 B ; [1]

PDF from sachtienganhhanoi.com

4 nucleus ;
Notes about mark schemes (smooth) endoplasmic reticulum ;
A or accept indicates an alternative acceptable rough endoplasmic reticulum ;
answer. 25 nm / larger / 80S ribosomes ;
linear / non-circular DNA ;
R = reject. This indicates a possible answer that
chromatin ;
should be rejected.
lysosome(s) ;
; The bold semicolon indicates the award of Golgi apparatus ;
1 mark. mitochondrion / mitochondria ;
/ This indicates an alternative answer for the same microtubule(s) ;
mark. The alternatives may be separated from the centriole(s) ;
rest of the answer by commas. centrosome ;
vacuole(s) ;
( ) Text in brackets is not required for the mark. microvillus / microvilli ;
Underlining This is used to indicate essential cilium / cilia ;
word(s) that must be used to get the mark. nucleolus / nucleoli ;
AW means ‘alternative wording’. It is used to nuclear envelope ;
indicate that a different wording is acceptable nuclear pore(s) ;
provided the essential meaning is the same, and it AVP ;  [max. 10]
is used where students’ responses are likely to vary  [Total: 10]
more than usual.
5 a magnification is the number of times
AVP means ‘additional valid point’. This means larger an image is compared with the real
accept any additional points given by the student size of the object ; AW
that are not in the mark scheme, provided they
are relevant. But accept only as many additional resolution is the ability to distinguish
points as indicated by the bold semicolons, e.g. between two separate points / the greater
AVP ; ; means award a maximum of 2 extra the resolution, the greater the detail that
marks. can be seen ; AW

ORA means ‘or reverse argument’ and is used a statement linking the terms, such
when the same idea could be expressed in the as both terms used with reference to
reverse way. For example: ‘activity increases microscopy ; [3]
between pH2 and pH5 ORA’ means accept b light microscope uses light as a source
‘activity decreases between pH5 and pH2’. of radiation ;
max. This indicates the maximum number of electron microscope uses electrons
marks that can be given. as a source of radiation ; [2]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c both organelles / both found in cell surface membrane very thin, cell wall
eukaryotic cells ; relatively thick ;
nucleolus is located inside nucleus ; cell wall outside cell surface membrane ;
nucleus controls cell activity ; cell wall strong / has strengthening
nucleolus makes ribosomes ; material, cell surface membrane not
strong / is fragile ;
AVP ; ; e.g. nucleus surrounded by

envelope, no membrane round cell wall protects cell (from mechanical
nucleolus [max. 4] damage/from bursting by osmosis), cell
surface membrane controls exchange
d chromatin and chromosomes both between cell and environment ;
contain DNA (and protein / histones /
RNA) / both found in nucleus ; cell wall freely permeable, cell surface
membrane partially permeable ;
chromatin is the loosely coiled form of
chromosomes ; AVP ; [max. 4]

chromatin is the form that exists between i both have a protective function ;
cell / nuclear divisions ; capsid found in viruses, cell walls found
in eukaryotes / plants, fungi and bacteria

PDF from sachtienganhhanoi.com

chromosomes are formed just before /
during, cell / nuclear division ; [max. 3] (and some protoctists) ;

e an envelope consists of two membranes capsid made of protein, cell walls contain
(one just inside / outside the other) ; strengthening material / not made of protein
/ made of or contain polysaccharides /
a membrane is a thin (partially permeable) contain cellulose, chitin or murein ;
barrier found around cells and some
organelles ; AVP ;  [max. 4]

example of at least one organelle j both found in viruses ;

surrounded by an envelope is given ; capsid is the protein coat surrounding
membranes found in / around all cells, the virus ;
envelopes only in eukaryotes ; [max. 3] the protein coat is made of (many)
f both consist of flattened membrane- protein subunits called capsomeres ; [3]
bound sacs ;  [Total: 34]
both found spreading through cytoplasm 6 a nucleolus ;
of eukaryotic cells ; ribosome ;
smooth ER lacks ribosomes, rough centriole ;
ER has ribosomes on surface ;
centrosome ;
one function of smooth ER given,
e.g. makes lipids / steroids ; microtubule ; [max. 3]
rough ER transports proteins made b lysosome ; ;
by ribosomes on its surface ; [max. 4] rough ER ;
g prokaryotes have no nucleus, eukaryotes smooth ER ;
have nucleus ; Golgi apparatus / Golgi body ;
prokaryotes are smaller / simpler ; cilium ;
prokaryotes have few organelles, flagellum ; [max. 3]
eukaryotes have many organelles, some
membrane-bound ; c nucleus ;
one other important difference given / mitochondrion ;
eukaryotes evolved from prokaryotes ; [4] chloroplast ; [3]
h all cells have cell surface membrane, only  [Total: 9]
some cells have cell walls / animal cells
lack cell walls ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

7 a Golgi apparatus ; h chloroplast ;

b nucleolus ; i centrosome (accept centriole) ;
c ribosome ; j nucleus ;
d ER / rough ER ; k membrane ;
e rough ER ; l ribosome / microtubule ;
f mitochondrion ; m cilium / flagellum ; [Total: 13]
g nucleus ;

Label Name of structure Function

A cell wall ; maintains the shape of the (plant) cell ;
prevents the cell bursting ; [3]
B nucleus ; contains the chromosomes / genetic material/DNA ;
the genetic code controls the activities of the cell ; [3]

PDF from sachtienganhhanoi.com

C nuclear envelope ; compartmentalises / separates the DNA / genetic material
from the rest of the cell ; [2]
D nucleolus ; contains DNA that controls the manufacture of ribosomes ; [2]
E cell surface controls which substances can enter and leave the cell ;
membrane ; selectively permeable ; [3]
F mitochondrion ; site of aerobic respiration ;
organelle where (most) ATP is made ; [3]
G chloroplast ; contains chlorophyll and is the site of photosynthesis ;
in the chloroplast grana / thylakoids, light-dependent
reactions take place, producing reduced NADP and ATP ;
in the chloroplast stroma, light-independent reactions take
place, producing carbohydrates ; [max. 3]
H sap vacuole ; storage of solutes in a plant cell ; [2]
I tonoplast ; membrane around plant sap vacuole controlling which
substances can enter and leave the vacuole ; [2]
J starch grain ; storage of carbohydrate ; [2]
 [Total: 25]

9 a 
1 mark for each accurately measured representative parts of main organelles
‘observed diameter’ (to within ±2 mm) drawn, including those below for which
and 1 mark for each accurately calculated label marks are awarded ; [5]
‘actual size’ ; ; ; ; ; ; labels:
1 mark for applying the formula ; nucleus ;
1 mark for measuring in mm and converting nuclear envelope ;
mm to μm for each calculation ;
nuclear pore ;
1 mark for rounding up actual size to no
more than one decimal place ; [9] nucleolus ;
b quality of drawing: rough ER ;
sharp pencil used ; ribosome(s) ;
more than half of available space used ; mitochondrion ;
clean, continuous lines / not sketchy ; crista or cristae ;
interpretation of structures accurate ; Golgi apparatus ;

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Golgi vesicle / secretory vesicle ; [max. 9] 10 a i 100 000 g

c mitochondria will appear circular if ii 1000 g
they are cut, in transverse section / iii 10 000 g ; [1]
across (the long axis) ; AW [1]
b lysosomes are, similar in size to / slightly
d i A: protein made on the ribosome is smaller than, mitochondria ;
moving into the rough ER ;
therefore sediment at same / similar, g
B: rough ER buds off small vesicles ; force / speed ;
vesicles fuse to form the Golgi
apparatus ; (therefore) protein moves therefore contaminate mitochondrial
into Golgi apparatus ; protein may sample ; AW
be modified / processed inside Golgi therefore cannot be sure whether effects
apparatus ; due to mitochondria or lysosomes in any
C: Golgi apparatus buds off Golgi experiments ; [4]
vesicles ;  [Total: 5]
D: Golgi vesicles travel to cell surface
membrane ; Golgi vesicle(s) fuses with

PDF from sachtienganhhanoi.com

cell surface membrane ; protein /
enzyme leaves cell ; exocytosis /
secretion ;  [max. 8]
ii ribosome / messenger RNA ; [1]
iii nuclear pore ; [1]
iv ATP ; [1]
 [Total: 35]

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 2
Self-assessment questions
1 a C3H6O3 or (CH2O)3 5 Some possible answers are shown in the table
below. When comparing two things, make the
b C5H10O5 or (CH2O)5 two features in each row genuine comparisons.
For example, in the first row in the table, the

PDF from sachtienganhhanoi.com

2 a You would need excess of the reagent to
type of glucose used is the property compared.
make sure that all of the sugar reacts with
the Benedict’s reagent.
Amylose Cellulose
b Prepare a range of samples of reducing made from made from β-glucose
sugar (e.g. glucose) of known concentration. α-glucose
Carry out a Benedict’s test on each all glucose units successive glucose units
solution. This will give you a range of have the same are at 180° to each other
different colours, each colour representing a orientation
different known concentration of reducing
molecule is not fibrous molecule –
sugar. These samples are known as colour
fibrous – chains chains held together by
standards. The test must be carried out in
not attracted to hydrogen bonds to form
exactly the same way for each sample
each other microfibrils and fibres
(e.g. same volumes).

If you have a colorimeter, take a reading 6 Similarities:

for each concentration and plot the • macromolecules
reading against concentration on a graph.
• fibrous structure
This is called a calibration curve. If you do
not have a colorimeter, line the tubes up in • structural role
a rack. Then carry out the test in exactly • fibres held together by hydrogen bonds
the same way on your unknown sample. • insoluble
If you are using a colorimeter, obtain a
reading for it and use the graph to read off Differences:
the concentration. If not, hold your tube
against the row of colour standards and Cellulose Collagen
judge by eye which is the closest match. carbohydrate / protein
polysaccharide
3 hydrolysis
made from beta made from amino acid
4 • macromolecules / polymers glucose subunits / subunits / monomers
• polysaccharides monomers
found in plants found in animals
• made from α-glucose
molecules are individual molecules
• glucose units held together by 1,4 links straight chains have a helical structure
(glycosidic bonds formed by condensation)
• branches formed by 1,6 links

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 2
Exam-style questions
The mark schemes, suggested answers and AVP means ‘additional valid point’. This means
comments that appear here were written by the accept any additional points given by the student
author(s). In examinations, the way marks would that are not in the mark scheme, provided they
be awarded to answers like these may be different. are relevant. But accept only as many additional

PDF from sachtienganhhanoi.com

points as indicated by the bold semicolons, e.g.
Notes about mark schemes AVP ; ; means award a maximum of 2 extra marks.
A or accept indicates an alternative acceptable ORA means ‘or reverse argument’ and is used
answer. when the same idea could be expressed in the
reverse way. For example: ‘activity increases
R = reject. This indicates a possible answer that
between pH2 and pH5 ORA’ means accept
should be rejected.
‘activity decreases between pH5 and pH2’.
; The bold semicolon indicates the award of 1 mark.
max. This indicates the maximum number of
/ This indicates an alternative answer for the same marks that can be given.
mark. The alternatives may be separated from the
rest of the answer by commas. 1 D ; [1]
( ) Text in brackets is not required for the mark. 2 C; [1]
Underlining This is used to indicate essential 3 B ; [1]
word(s) that must be used to get the mark.
AW means ‘alternative wording’. It is used to indicate
that a different wording is acceptable provided the
essential meaning is the same, and is used where
students’ responses are likely to vary more than usual.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

(e.g. haemoglobin)
Globlular protein

Monosaccharide
Fibrous protein
(e.g. collagen)

Disaccharide

Glycogen

Cellulose
Starch

Lipid
monomer ✘ ✘ ✔ ✘ ✘ ✘ ✘ ✘
polymer ✔ ✔ ✘ ✘ ✔ ✔ ✔ ✘
macromolecule ✔ ✔ ✘ ✘ ✔ ✔ ✔ ✘
polysaccharide ✘ ✘ ✘ ✘ ✔ ✔ ✔ ✘
contains subunits that form branched ✘ ✘ ✘ ✘ ✔ ✔ ✘ ✘
chains

PDF from sachtienganhhanoi.com

contains amino acids ✔ ✔ ✘ ✘ ✘ ✘ ✘ ✘
made from organic acids and glycerol ✘ ✘ ✘ ✘ ✘ ✘ ✘ ✔
contains glycosidic bonds ✘ ✘ ✘ ✔ ✔ ✔ ✔ ✘
contains peptide bonds ✔ ✔ ✘ ✘ ✘ ✘ ✘ ✘
one of its main functions is to act as an ✘ ✘ ✘ accept ✔ ✔ ✘ ✔
energy store
✔ or ✘
usually insoluble in water ✘ ✔ ✘ ✘ ✔ ✔ ✔ ✔
usually has a structural function ✘ ✔ ✘ ✘ ✘ ✘ ✔ ✘
can form helical or partly helical structures ✔ ✔ ✘ ✘ ✘ ✔ (see ✘ ✘
amylose)
contains only carbon, hydrogen and ✘ ✘ ✔ ✔ ✔ ✔ ✔ ✔
oxygen

Award 1 mark for each correct column. [8]

5 6 dissolve easily in water ;

Function Example sweet ;

structural collagen ; keratin ; AVP general formula (CH2O)n / contain the
e.g. elastin, viral coat elements carbon, hydrogen and oxygen /
protein ; [max. 2] hydrogen and oxygen are present in ratio
of 2 : 1 ;  [3]
enzyme AVP e.g. amylase ;
7 a lactose could be a source of energy ;
hormone ; insulin
it could be digested to, monosaccharides
respiratory haemoglobin and
/ glucose and galactose, which could
pigment / AW ; myoglobin
then be used as building blocks for larger
defence antibodies / fibrinogen / molecules ; [2]
AVP ;
b condensation ; [1]
contraction / actin and myosin
AW ; c glycosidic bond ; [1]
storage casein / ovalbumin / AVP ;
 [8]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d f carry out a Benedict’s test on both

OH on C atom 1 above solutions ;
ring (β-galactose) lactose would give a brick-red / brown
6CH OH
2 precipitate, sucrose would not ;
5 O
OH OH
accept positive result for lactose,
H negative result for sucrose [2]
4 1
DH H  [Total: 10]
H H
3 2 8 a i  
H OH
CH3 H
galactose H H
O O
(drawn according to convention)
N C C N C C
H OH H OH
H OH H H
3
2 alanine glycine
H H OH
OH H
4 1

PDF from sachtienganhhanoi.com

H CH3 H CH2
OH HOH O H O H O
O
5 N C C N C C N C C
6CH OH
2 H OH H OH H OH
H H H
galactose
(molecule rotated 180° in order alanine glycine serine
to line up with α-glucose)

OH
6CH OH
2

CH3 5 O H CH2
H H O H
H O H O
H
N C4 C N C C N C C
1
H OH H OH H OH
OH H
H OH 2 OH H H
3
alanine OH glycine serine
H
OH on C atom 1
α-glucose
below ring
   C
 of COOH joined to N of NH2 for
both peptide bonds ;
glucose correctly drawn ;    p
 eptide bonds shown as C=O
galactose correctly drawn ;  [2] joined to –NH (i.e. water has been
eliminated) ;

Carbon atoms need not be numbered.
Note that galactose will probably be drawn    a ll three amino acids joined and in
‘upside down’ as in the disaccharide – the correct sequence ; accept even if errors
conventional way of drawing it is also in bonding [3]
shown in the diagram answer. The form ii primary structure ;  [1]
used to make the disaccharide is the beta
form of galactose, but students will not iii water ; [1]
need to know this, other than for interest. iv ring drawn around –OH or whole
e alpha glucose / α-glucose ; R group (–CH2OH) of serine ; [1]

the –OH group on carbon atom 1 is v rings drawn around two peptide
below the ring ; [2] bonds and bonds labelled
appropriately ; [1]
vi ring drawn around –NH group one
side of a peptide bond and group
labelled A ; [1]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b held in place by hydrogen bonding ; 10 a

secondary structures ;
Collagen Haemoglobin
all the –NH and –C=O groups of, peptide
bonds / polypeptide backbone, are 1 Globular fibrous globular
involved ; [3] or fibrous?
2 Entirely entirely partly
c molecule made from repeating subunits ;
or partly
subunits similar or identical to each other ; helical?
giant molecule / macromolecule ;[max. 2] 3 Type of triple helix / alpha
d i  XXX, XXY, XYY, XYX, YYY, helix extended
YYX, YXX, YXY ; [1] helix / three-
stranded
ii 2 ;3
[1]
4 Prosthetic no yes
 [Total: 15] group
9 a A identified as lipid, present?
B identified as phospholipid ; [1] 5 Soluble in no / insoluble yes / soluble
b i  junction between head and tail for all water?

PDF from sachtienganhhanoi.com

three tails is indicated on diagram ; ; Award 1 mark for each correct row. No half marks
  allow 1 mark if only one or two  [5]
junctions indicated [2] b 
1 mark for structural feature, 1 mark for
ii fatty acids ; linking this feature to its function,
e.g. haemoglobin contains iron ; iron
  glycerol ; [2] combines with oxygen ; [2]
c head of phospholipid is labelled c molecule has more than one polypeptide
phosphate ; [1] chain ; [1]
d i phospholipid / B ; [1] R molecule has four polypeptide chains
ii phosphate is, charged / polar / d carbon, hydrogen, oxygen, nitrogen, iron ; ;
hydrophilic ; [1]
2 marks for all five correct, 1 mark for
e lipid: four correct, 0 marks for three or fewer
energy store / insulator / buoyancy / correct  [2]
source of metabolic water / any other  [Total: 10]
suitable example ;
phospholipid:
any reference to the importance of
phospholipids in structure of
membranes ; [2]
 [Total: 10]

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 3
Self-assessment questions
1 Explanation of results: 3 a
• Catalase, liver and potato were much more

Amount of starch in mixture

efficient than the inorganic catalysts:

PDF from sachtienganhhanoi.com

The catalase enzyme has evolved to
be the correct shape to catalyse the
decomposition of hydrogen peroxide
efficiently.
• Pure catalase was more efficient than
the liver and potato: The concentration
of the pure enzyme is higher than the
concentration in liver and potato. The
higher the concentration of an enzyme, Time
the faster it works.
• Liver was more efficient than potato: Liver b Calculate the slope of the curve right at
is an animal tissue. Animal tissues have a the beginning of the reaction.
higher metabolic rate than plant tissues.
Hydrogen peroxide therefore probably 4 Measure the volume of oxygen given off over
builds up faster in liver cells than potato regular time intervals for several hydrogen
cells and must therefore be got rid of peroxide–catalase reactions at different
faster. Liver cells therefore probably have temperatures. In each case, all conditions
a higher concentration of catalase than other than temperature must remain constant.
potato cells. In particular, the volume and concentration of
• Ground-up liver was more efficient than hydrogen peroxide solution, and the volume
pieces of liver: Grinding up the liver and concentration of catalase solution must
breaks open the cells and releases the be kept constant each time. Plot volume
contents, including catalase. The catalase of oxygen against time for each reaction.
therefore has easier access to the substrate Calculate the slope of the line at the beginning
(hydrogen peroxide). of the reaction in each case to give the initial
reaction rate. Then plot initial reaction rate
2 In case of inaccuracy of measurement at against temperature.
30 seconds. The overall shape of the curve is Alternatively, the volume of oxygen given
more likely to give an accurate value. off in a given time period, for example
1 or 2 minutes, could be found for each
temperature. The volume is proportional to
the rate, so a graph of volume (rate) against
temperature could be plotted. Another
alternative would be to time how long it takes
to collect a given volume of oxygen for each

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

temperature. In this case, the inverse of the 8 As soon as the reaction starts, the substrate
time taken would be a measure of rate. starts to be used up, so the substrate
concentration starts to fall. This results in a
5 a Haemoglobin is the coloured pigment corresponding fall in the rate of reaction. It is
that causes bloodstains. Haemoglobin the initial rate at the start of the experiment
is a protein. Protein-digesting enzymes that is the true rate.
(proteases) catalyse the hydrolysis of
haemoglobin to amino acids, which are 9 a carbonic anhydrase
colourless. They are also soluble, so will
wash away in water. b lysozyme, because it has the lowest Km

b Many protein-digesting enzymes have an 10 a

optimum temperature of around 40 °C,
which is a relatively low temperature for
a washing machine. Washing at lower
temperatures also helps to save money. enzyme B

Rate of reaction
c Other components of washing powders, enzyme A
such as the oil-removing detergents, work

PDF from sachtienganhhanoi.com

best at high temperatures.

6 One possible answer is as follows; other answers

might be equally acceptable.
Set up two sets of five tubes containing equal Substrate concentration
volumes of the same concentration of milk
suspension. Make up five buffer solutions b i enzyme B
of varying pH. Add equal volumes of buffer
ii enzyme B
solution, one of each pH, to each set of five
tubes containing milk suspension. To one iii enzyme B
set of tubes, add equal volumes of trypsin
solution. To the other set of tubes, add the iv enzyme B
same volume of water; these act as controls.
Time the disappearance of cloudiness in each 11 a Prepare a solution of lactase and a
tube containing trypsin. Cloudiness should separate sample of lactase immobilised
remain in the control tubes. Plot rate of in alginate beads. Suspend the beads in
reaction (1/time taken) against pH. water. Heat separate samples of lactase
in solution and immobilised lactase
7 beads suspended in water at a range of
temperatures (e.g. 40 °C to 100 °C) for
10 minutes each. Allow to cool to room
If substrate temperature.
becomes
limiting, the If the enzyme is still active, it will catalyse
Initial rate of reaction

addition of the hydrolysis of lactose to glucose

extra enzyme
and galactose: 1 mole of lactose will
cannot increase
the rate of produce 1 mole of glucose and 1 mole of
reaction. galactose. All are reducing sugars,
but the concentration of reducing sugar
will double as a result of the reaction.
A semi-quantitative Benedict’s test on a
sample before and after the reaction
Enzyme concentration can therefore be used to find out if the

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

enzyme is active. This can be done by

mixing the enzyme with lactose (or milk)
Reflection
at a suitable temperature (e.g. 37 °C), and A range of answers is possible, which may include
leaving it for a few minutes. In the case of the following:
the lactase beads, you would first have to
• amino acid sequence / primary structure
tip the beads into a sieve to remove the
surrounding water before adding them to • tertiary structure (to match any potential
a solution of lactose. substrate)

b Suspend the lactase beads in water. Leave • temperature optimum

samples of the enzyme solution and the • range of temperatures over which effective
immobilised lactase beads for different
lengths of time at 90 °C. Then test for • pH optimum and range
enzyme activity as in a above. • affinity for substrate
c Prepare a series of lactase solutions of • Vmax
different pH using appropriate buffer • ability to stick to a substrate for
solutions. For each pH, use some of immobilisation
the solution to make alginate beads

PDF from sachtienganhhanoi.com

containing immobilised enzyme. Then • longevity when immobilised / resistance to
carry out the reaction using milk or denaturation; disulfide bonds may increase
lactose as a substrate and test for enzyme stability
activity as in a above. • ability to add useful prosthetic groups.
12 Immobilised enzymes do not contaminate the There are many possible new uses for enzymes.
product. They are not lost, so they can be re- Being able to break down plastics using enzymes is
used. They are able to work at a wider range an obvious use. Scientists would like to be able to
of pHs than enzymes in free solution, and also carry out nitrogen fixation using enzymes.
at a wider range of temperatures. They are
more resistant to denaturation.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 3
Exam-style questions
The mark schemes, suggested answers and 1 C ; [1]
comments that appear here were written by the 2 D ; [1]
author(s). In examinations, the way marks would
be awarded to answers like these may be different. 3 D ; [1]

PDF from sachtienganhhanoi.com

4 B ; [1]
Notes about mark schemes 5 C ; [1]
A or accept indicates an alternative acceptable
6 straight line drawn from origin at zero to
answer.
show steepest gradient of curve ; [1]
R = reject. This indicates a possible answer that
7 a maximum activity / optimum pH, is pH
should be rejected.
5.5 ;
; The bold semicolon indicates the award of
activity gradually increases between pH 2
1 mark.
and pH 5.5, and decreases from pH 5.5 to
/ This indicates an alternative answer for the same pH 10 ; activity very low at pH 2 and pH
mark. The alternatives may be separated from the 10 ; AW [max. 2]
rest of the answer by commas.
b pH is a measure of the hydrogen ion
( ) Text in brackets is not required for the mark. concentration ;
Underlining This is used to indicate essential hydrogen ions are positively charged ;
word(s) that must be used to get the mark.
hydrogen ions can interact with the R
AW means ‘alternative wording’. It is used to groups of amino acids ;
indicate that a different wording is acceptable
affects ionic bonding / affects ionisation
provided the essential meaning is the same, and is
of R groups ;
used where students’ responses are likely to vary
more than usual. affects tertiary structure / affects 3D shape
of enzyme ;
AVP means ‘additional valid point’. This means
accept any additional points given by the student therefore substrate may not fit active
that are not in the mark scheme, provided they site (as precisely) ; [max. 4]
are relevant. But accept only as many additional  [Total: 6]
points as indicated by the bold semicolons, e.g.
AVP ; ; means award a maximum of 2 extra marks. 8 a optimum temperature ; [1]

ORA means ‘or reverse argument’ and is used b 37 °C ; accept 40 °C [1]
when the same idea could be expressed in the c as temperature increases the kinetic
reverse way. For example: ‘activity increases energy of the molecules increases ;
between pH2 and pH5 ORA’ means accept the rate of collision between substrate
‘activity decreases between pH5 and pH2’. and, enzyme / active site, increases ;
max. This indicates the maximum number of rate of reaction increases ;  [3]
marks that can be given.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d the enzyme is gradually being denatured ; leave several minutes / suitable time (for
when the rate is zero the enzyme is reaction to take place) ;
completely denatured ; carry out Benedict’s test on the two tubes ;
ORA enzyme loses tertiary structure ; only one will give a positive result (due to
substrate no longer fits into active site presence of maltose) and this will be the
/ active site loses its (specific) shape so one which contained the unheated enzyme ;
substrate does not fit ; Accept alternative wording for all steps in

 VP e.g. hydrogen bonds broken /
A the procedure, provided the same logical
increased vibration of enzyme molecule ; sequence is described [max. 6]
 [max. 3] b hydrolysis ; [1]
e the extra energy which must be given to  [Total: 7]
the substrate ; 11 a replication increases reliability ; AW [1]
before it can be converted into the product ;
b to act as a reference to show what
 [2]
happens if there is no denaturation ;
 [Total: 10] AW [1]
9 a succinic acid ; [1] c 40 °C is (close to) the optimum

PDF from sachtienganhhanoi.com

b malonic acid acts as a competitive temperature for a mammalian enzyme ; [1]
inhibitor ; d enzyme / amylase (molecules) diffuse(s)
it has a similar shape / structure to from wells into the agar ;
succinic acid ; enzyme / amylase digests the starch ;
it therefore competes with succinic acid to maltose ;
for a place in the active site of the
forms rings / halos, of digested starch
enzyme ; [3]
around the wells ;
c i cysteine ; [1]
amount of digestion / rate of digestion,
ii – SH groups form disulfide bridges ; is related to degree of denaturation of
   used to determine tertiary structure ; enzyme / amylase ; [max. 4]
  heavy metal would prevent formation e the more enzyme / amylase added, the
of disulfide bridges ; greater the amount of digestion of starch
  could change shape of active site ; or
  heavy metal could affect shape either by want results to be due to differences in
binding directly in the active site, or by preheating times, not to differences in
binding at another site which then results amount of amylase / enzyme ; AW [1]
in change in shape of the active site ; f Time (heated) at Diameter of
  substrate would not be able to fit into 60 °C / min halo / mm
active site ; [max. 4] 0 24
 [Total: 9] 1 19
10 a carry out Benedict’s test on solutions A, B 5 10
and C ;
10 6
a positive result / brick-red precipitate will
30 0
be seen, with the glucose solution ;
heat separate samples of the two 
table drawn with lines for border and to
remaining solutions, in boiling water separate columns and headings (ideally
bath / to high temperature (e.g. 80 °C), ruled lines and lines between rows, but not
for suitable time / at least two minutes essential for mark) ;
(enzyme will be denatured) ; for each correct headings to columns with units ;
heated solution, mix it with an unheated
sample of the other solution ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

if this is the rule taught, first column is j heat samples of mammalian, fungal and
independent variable (Time heated at bacterial amylases at different temperatures ;
60 °C) ; suitable range, e.g. between 40 °C and
correct measurements of halos ; [4] 120 °C ;
g measure the four halos and calculate 40 °C is a control (for reference to find out
the mean ; [1] size of halo with no denaturation) ;
(any anomalous results should be ignored) at least five temperatures, e.g. 40, 60, 80,
h 100, 120 °C ;
heat for suitable length of time (e.g. one
24 hour, at least ten minutes) ;

20
cool to room temp / 40 °C, add equal
volumes to wells in starch–agar plates,
replicate wells in each plate (e.g. four),
16
Diameter / mm

leave 24 hours, test for starch, measure

diameters of halos ; [max. 5]
12
Background information: amylase enzymes

PDF from sachtienganhhanoi.com

8 from the bacterium Bacillus licheniformis
and the fungus Aspergillus have been
4 developed by biotechnology companies for
use in industrial processes. For example,
0 a bacterial amylase that functions in the
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 range 90–110 °C has been developed and is
Time at 60˚C / minutes used in beer brewing and other processes,
and a fungal amylase that operates in the
x-axis (horizontal axis) is labelled ‘Time range 50–60 °C is used for pastry baking
(heated) at 60 °C’, y-axis (vertical axis) is and maltose syrup production.
labelled ‘Diameter’ (if the rule IV for the
x-axis, DV for the y-axis is taught) ; k pH ;

units given on axes, min / minutes and substrate concentration ;

mm; regular intervals on both axes (check enzyme concentration ; [3]
that 0, 1, 5, 10, 30 are not regularly spaced  [Total: 30]
on x-axis) ;
12 a 
see Figure 3.13. Award 1 mark for each
points plotted accurately ; correct label ; ; ; [3]
points joined with straight lines or b inhibitor A had no effect on Vmax ; and
smooth curve ; [5] increased Km ; [2]
i enzyme was completely denatured after c inhibitor B decreased Vmax ; and had
30 minutes ; no effect on Km ; [2]
rate of denaturation was rapid at first and d inhibitor A is competitive, B is non-
then gradually slowed down ; competitive ;
data quoted ; A is competitive because:
enzyme loses tertiary structure ; it increased Km / did not affect Vmax ;
substrate no longer fits into active site / decreased the affinity of the enzyme for its
active site loses its (specific) shape so substrate ;
substrate does not fit ; the substrate is competing with the
 VP e.g. hydrogen bonds broken /
A inhibitor for the active site ;
increased vibration of enzyme molecule ; the inhibition is overcome by increasing
 [max. 4] substrate concentration ; [max. 4]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

or
Alternative ways of explaining the same
marking points:
B is non-competitive because:
it did not affect Km/decreased Vmax ;
it did not affect the affinity of the enzyme
for its substrate ;
the substrate is not competing with the
inhibitor for the active site ;
the inhibition cannot be overcome by
increasing substrate concentration ;
 [Total: 11]

PDF from sachtienganhhanoi.com

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 4
Self-assessment questions
1 Refer to Section 4.3, Roles of the molecules 7 a the pure water or dilute solution
found in membranes.
b the solution with the same concentration
2 The interior of the membrane is made up of as the red cell

PDF from sachtienganhhanoi.com

the tails of phospholipid molecules which
provide a hydrophobic environment. If a 8 The animal cell does not have a cell wall.
hydrophobic molecule reaches the cell surface Plasmolysis is the pulling away of cytoplasm
membrane, it can easily cross the membrane. from the cell wall.

3 Large number of possible reasons: for 9 a The skin represents the cell surface
example, to gain nutrients, to remove waste membrane.
products such as carbon dioxide from b The balloon would burst, like an animal
respiration, to gain oxygen for respiration, cell would.
to secrete hormones, to secrete enzymes,
to maintain constant pH and ionic c The balloon would not burst. Eventually
concentration. it would be impossible to pump any
more air into the balloon if the box was
4 Cube A: SA 6, vol 1; SA : vol ratio 6 : 1 stronger than the pump. This is like trying
Cube B: SA 24, vol 8; SA : vol ratio 3 : 1 to pump up a bicycle tyre – it gets harder
Cube C: SA 54, vol 27; SA : vol ratio 2 : 1 and harder as the tyre inflates. Plant cells
are similar – the cell wall is strong enough
5 Larger organisms cannot rely on diffusion as a to prevent further expansion when the
means of transport for essential requirements pressure is high enough.
such as oxygen and nutrients. This means
that special long-distance transport systems 10 a from A to B
must be present, such as the blood system in
animals and the vascular system in plants. b Water molecules can move from A to B
This is discussed further at the beginning of and from B to A, but more move from A to
Chapter 7. B in a given time period. Overall, therefore,
A loses water and B gains water – the
6 a The water potentials are equal. overall movement is the net movement.

b i B c A has a higher water potential than B

and water always moves from regions of
ii Because the water potential in A is higher to lower water potential.
the same as in B. The pressure applied
to B prevents net movement of water
from A to B by osmosis.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d i Pure water has a water potential that measurements in three planes (and, in
is higher than that of cells A and B. practice, would probably not be any more
There is therefore a net movement of accurate).
water into cells A and B by osmosis
through their partially permeable d Replication increases reliability of results.
cell surface membranes. As water e They were covered to reduce evaporation
enters, the volume of the protoplasts from the chips.
increases, exerting pressure on the
cell walls. This increases the water f Easier/quicker. To measure change in
potential of the cells. This will mass requires drying the chips before
continue until equilibrium is reached weighing. This is not only more time-
when the contents of the cells reach consuming but is difficult to standardise.
the same water potential as the water.
The cells will then be turgid. g Change in mass directly reflects the
amount of water lost or gained by
ii 1 mol dm–3 sucrose solution has a the tissue, which is the variable being
lower water potential than that of investigated. It is therefore likely to be
cells A and B. There is therefore a net more reliable and valid if the procedure is

PDF from sachtienganhhanoi.com

movement of water out of cells A and carried out correctly.
B by osmosis through their partially
permeable cell surface membranes. 12 Pancreatic acinar cells carry out secretion by
As water leaves the cells, the the process of exocytosis. Exocytosis requires
protoplasts shrink and the pressure energy in the form of ATP. Mitochondria
they exert on the cell walls drops. make ATP as a result of respiration. The more
This decreases the water potential mitochondria, the more ATP is available.
of the cells. Eventually, the pressure
inside the cell drops to zero and the
cells are at incipient plasmolysis. As Reflection
shrinkage continues, the protoplasts There may be more than one suitable response for
pull away from the cell walls – this some pairs, depending on the explanation for the
is plasmolysis. The sucrose solution connection. Here are some suggested answers.
can pass freely through the permeable
cell walls and remains in contact with β-glucose – cell wall cellulose
the protoplasts. As water leaves the monomer – protein amino acid
cells, the contents of the protoplasts
get more and more concentrated Michaelis−Menten enzyme
and their water potential gets lower. constant – affinity
Equilibrium is reached when the centrosome – MTOC (microtubule
water potential of the cells equals that microtubule organising centre)
of the sucrose solution. animal storage product – glycogen
1,4 and 1,6 linkages
11 a The water potential of a tissue varies with
the external environment. If, for example, nm – mm µm
a beetroot was removed from the soil Golgi apparatus – lysosome
and left in a dry atmosphere, its water hydrolytic enzymes
potential would gradually decrease as ribosome – amino acid protein
water evaporated from the surface of the
amino acid – protein peptide bond
beetroot.
α-glucose – plant storage starch
b Once cut, the chips would begin to product
lose water by evaporation in a typical monomer – polymer condensation (or
laboratory atmosphere. This would result hydrolysis)
in a decrease in water potential.
microtubule – 9 + 2 cilium / flagellum
c Length involves one measurement induced fit – lock and key enzyme
only. Measuring volume would require

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

peptidoglycan – cellulose cell wall water – fluid The fluid mosaic model of
pinocytosis – phagocytic endocytosis mosaic model membrane structure explains
vacuole how phospholipids can
arrange themselves to form a
fatty acid – triglyceride ester bond / ester
bilayer in water.
linkage or glycerol or
condensation fluid mosaic The fluid mosaic model
model – of membrane structure
ligand – G protein signalling receptor
facilitated includes proteins that allow
nucleolus – protein ribosome diffusion facilitated diffusion across the
synthesis membrane.
There may be more than one suitable response water – Water molecules are attracted
for some pairs in the grid, depending on the hydrogen bond to each other by hydrogen
explanation for the connection. Here are some bonding.
suggested answers. fluid mosaic In the fluid mosaic model of
model – protein membrane structure, proteins
glycolipid – Both are types of lipid.
form a mosaic pattern in the
phospholipid Glycolipid has a carbohydrate
fluid phospholipid bilayer.

PDF from sachtienganhhanoi.com

chain attached; phospholipid
has phosphate attached. facilitated The fluid mosaic model
diffusion – of membrane structure
phospholipid – Phospholipid has a hydrophilic
active transport includes proteins that allow
hydrophilic phosphate group.
active transport across the
glycolipid – Glycolipid has a hydrophilic membrane.
water carbohydrate portion which
hydrogen Hydrogen bonds are
is attracted to water so it
bond – protein important in maintaining
faces the right way in the
secondary and tertiary
membrane.
structure of proteins (e.g.
phospholipid Phospholipids form bilayers alpha helix, beta-pleated
– fluid mosaic which are the basic structures sheet).
model found in the fluid mosaic
protein – active Active transport requires
model of membrane structure.
transport carrier proteins.
hydrophilic Facilitated diffusion can take
– facilitated place through channel proteins
diffusion that have hydrophilic pores to
allow the passage of water-
soluble ions.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 4
Exam-style questions
The mark schemes, suggested answers and 1 C ; [1]
comments that appear here were written by the 2 D ; [1]
author(s). In examinations, the way marks are
awarded to answers like these may be different. 3 C ; [1]

PDF from sachtienganhhanoi.com

4 C ; [1]
Notes about mark schemes 5 a 
Information for answering this question
A or accept indicates an alternative acceptable can be found in Section 4.5, Movement of
answer. substances across membranes, and in the
R = reject. This indicates a possible answer that answer to SAQ10di.
should be rejected. 
Award 1 mark for each term correctly
; The bold semicolon indicates the award of 1 mark. used. [12]
/ This indicates an alternative answer for the same b Information for answering this question
mark. The alternatives may be separated from the can be found in Section 4.5, Movement of
rest of the answer by commas. substances across membranes, and in the
( ) Text in brackets is not required for the mark. answer to SAQ10dii.
Underlining This is used to indicate essential Award 1 mark for each term correctly
word(s) that must be used to get the mark. used. [13]
AW means ‘alternative wording’. It is used to  [Total: 25]
indicate that a different wording is acceptable
6 a A phosphate head (of phospholipid) ;
provided the essential meaning is the same, and is
used where students’ responses are likely to vary B fatty acid tail(s) (of phospholipid) ;
more than usual. C phospholipid bilayer / membrane ; [3]
AVP means ‘additional valid point’. This means b 
Award max. of 2 marks: two or three
accept any additional points given by the student correct answers 1 mark, four correct
that are not in the mark scheme, provided they answers 2 marks.
are relevant. But accept only as many additional
points as indicated by the bold semicolons, e.g. i hydrophilic ;
AVP ; ; means award a maximum of 2 extra marks. ii hydrophobic ;
ORA means ‘or reverse argument’ and is used iii hydrophobic ;
when the same idea could be expressed in the
iv hydrophilic ; [max. 2]
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept c ions move by diffusion ;
‘activity decreases between pH5 and pH2’. channel has shape which is specific for
max. This indicates the maximum number of particular ion ;
marks that can be given. channel is hydrophilic / water-filled /
allows movement of polar substance ;
ions move down concentration gradient ;
 [max. 3]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d both intrinsic proteins ; f width of C measured in mm ;

both have specific shape ; [2] mm converted to µm and µm converted to
nm ;
e channel proteins have a fixed shape /
carrier proteins have a variable shape ; [1] correct formula used. Magnification:
M = I/A = width of C/7. Accept mm, µm or
nm ;
correct answer in nm ; [4]
 [Total: 15]
7

Process Uses energy Uses proteins Specific Controllable by cell

diffusion ✘ ✘ ✘ ✘
osmosis ✘ ✘ ✔ ✘
facilitated diffusion ✘ ✔ ✔ ✘
active transport ✔ ✔ ✔ ✔
endocytosis and exocytosis ✔ ✘ ✔ ✔

PDF from sachtienganhhanoi.com

 [20]
NB: It could be argued that facilitated diffusion is controllable, because the number of channel
proteins in the membrane can affect the rate.
8 explanation:
water (always) moves from a region of higher
Feature Cell wall Cell
water potential to a region of lower water
membrane
potential ;
is the thick- µm nm
ness normally (in this case) by osmosis ;
measured in through the partially permeable cell surface
nm or µm? membrane of the cell ;
cell location surrounds some surrounds as the cell fills with water, the cell / protoplast
cells / does not all cells (and expands and pressure increases ;
surround animal some or-
cells / only ganelles) / until the water potential of the cell = zero / is
found outside may be the same as the water potential of pure water ;
cells / found found in- the cell wall is rigid / will not stretch (far), and
outside plant, side cells
prevents entry of more water ;
fungal and
prokaryote (or cell is turgid ; [max. 5]
bacterial) cells
 [Total: 8]
permeability freely partially
permeable permeable 10 a the greater the concentration difference,
the greater the rate of transport ;  [1]
fluid or rigid rigid fluid
b rate of transport is zero for diffusion and
Award 1 mark for each correct row. [4] facilitated diffusion at zero concentration
9 description: difference / rate of transport is the same in
rate of entry of water is rapid at first but slows both directions ;
down gradually ; active transport can take place at zero
until rate is zero / no further entry of water or concentration difference ; [2]
water enters until water potential of c (net) diffusion and facilitated diffusion
cell = water potential of pure water ; only take place if there is a concentration
curve is not linear / curve is exponential ; difference across a membrane (due to
random motion of molecules or ions) ;
rate depends on / rate is proportional to,
difference in water potential between cell and, active transport does not depend on
external solution / water ;  [max. 3] a concentration difference because

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

molecules or ions are pumped (using    when the cell wall is fully stretched, no
energy from ATP) ; [2] more water can enter ;
d i active transport ; [1]    this is the point where the cell is at
ii  active transport depends on a supply 100% relative cell volume ; [max. 5]
of ATP ; c i 85% ; [1]
   provided by respiration ; [2] ii incipient plasmolysis is the point at
e the graph for diffusion is linear / a straight which the protoplast is about to pull
line (with no maximum rate) ; away / shrink away, from the cell wall /
the point at which plasmolysis is about
diffusion is a purely physical process / to occur ; AW [1]
diffusion is not dependent on, transport
proteins / channel or carrier proteins ; iii t he cell / protoplast, continues to lose
water / shrink ;
the graph for facilitated diffusion is a
curve with a maximum rate ; AW    the protoplast pulls away from the
cell wall ;
facilitated diffusion depends on the
presence of, transport / channel / carrier    the water potential of the cell
proteins ; continues to decrease ;

PDF from sachtienganhhanoi.com

as concentration increases, the (receptor    until the water potential of the cell
sites of the), transport/channel/carrier, equals that of the external solution ;
proteins become more and more saturated ;  [max. 3]

the more saturated the, receptor sites /  [Total: 12]

proteins, become, the less the effect of 12 a if it were diffusion, there would be
increasing concentration ; (net) movement of ions from a region
rate of transport reaches a maximum, of higher concentration to a region of
when all, transport / channel / carrier lower concentration until equilibrium
proteins, are working at full capacity / is reached when concentration inside =
when all receptor sites are, full / saturated ; concentration outside ; AW [1]
NB: This is similar to the effect of substrate R because concentrations different inside

concentration on rate of enzyme activity. and outside
 [max. 5] b active transport ;
 [Total: 13] active transport involves pumping ions
against a concentration gradient ;  [2]
11 a the living contents of a plant cell ; [1]
c if respiration is inhibited, no ATP is
b i 100% ; [1] produced ;
ii the water potential increases ; active transport uses ATP as an energy
   ( because) pressure builds up inside source ;
the cell ; active transport stops ;
   d
 ue to (more and more) water diffusion continues ;
entering the cell ;
ions move down concentration gradients
   t he rate of increase in, water by diffusion until equilibrium is reached ;
potential/pressure, increases as water
enters the cell ; AW  [max. 4]

   the cell wall is stretched ;  [Total: 7]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 5
Self-assessment questions
1 a The primary structure of a protein is the Mitosis is the type of nuclear division
amino acid sequence. required to produce genetically identical
nuclei.
b It suggests that any change in the primary

PDF from sachtienganhhanoi.com

structure would threaten survival – in 4 a 92 chromatids
other words, the precise tertiary structure
of the histones is vital for survival. It b 92 DNA molecules (each chromatid
highlights the critical importance of contains one DNA molecule)
histones. Only organisms with conserved / c 92 kinetochores
unchanged molecules are likely to survive.
d 46 chromatids
c 8.7 cm = 87 mm = 87 000 µm
e 92 chromatids
87 000 µm of DNA is packed into 10 µm
of chromosome 5 a
therefore packing ratio = 87 000 ÷ 10 =
8700

d total length of chromosomes = 46 × 6 µm =

276 µm

1.8 m = 1800 mm = 1 800 000 µm

1 800 000 µm of DNA is packed into

276 µm of chromosomes

therefore packing ratio = 1 800 000 ÷ 276 = metaphase


6522
b
e Histones provide a scaffolding around
which DNA molecules can coil. A coiled
strand can be packed into a smaller
volume than a straight strand.

2 Microtubules can be shortened by removal of

tubulin subunits (depolymerisation).

3 Asexual reproduction involves production of

new individuals that are genetically identical
to the parent. The nuclei in the cells of these
individuals must be genetically identical. anaphase


1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

6 Their function is to hold chromatids together 8 It suggests that specialisation is not due to
and to attach chromosomes to the spindle. different genes being present in different cells,
but that different genes are switched on in
7 Of 75 000 cells, 9 were undergoing mitosis. different cells. In a liver cell, for example, only
Mitosis lasts one hour. Therefore, cell cycle is the genes that control the activities of a liver
75 000 / 9 hours long cell are switched on, even though liver cells
contain all the information to make any cell.
= 8333 hours
9 Cancer cells are immortal. They achieve this
= 8333 / 24 days
by renewing their telomeres after each division.
= 347 days. To do this, telomerase is required. (A normal
cell would eventually use up its telomeres and
(Cell cycles vary in length in adult animals die if it divided repeatedly like a cancer cell.)
from less than eight hours to more than one
year.)

PDF from sachtienganhhanoi.com

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 5
Exam-style questions
The mark schemes, suggested answers and 1 D ; [1]
comments that appear here were written by the 2 B ; [1]
author(s). In examinations, the way marks are
awarded to answers like these may be different. 3 D ; explanation: as an example, human

PDF from sachtienganhhanoi.com

cells contain 46 chromosomes. At S phase
Notes about mark schemes in the cell cycle, each chromosome makes
a copy of itself, forming two chromatids.
A or accept indicates an alternative acceptable
Therefore there are 92 chromatids going into
answer.
mitosis. After mitosis, each daughter nucleus
R = reject. This indicates a possible answer that contains 46 chromatids. These are now called
should be rejected. chromosomes. The term chromosome can
; The bold semicolon indicates the award of therefore be confusing. The confusion arises
1 mark. because the term ‘chromosome’ was originally
applied to the structures which appear
/ This indicates an alternative answer for the same during mitosis, each of which consists of two
mark. The alternatives may be separated from the chromatids (duplicate chromosomes) and the
rest of the answer by commas. term chromosome is now also applied to the
( ) Text in brackets is not required for the mark. 46 structures found in the interphase nucleus
Underlining This is used to indicate essential between cell divisions. [1]
word(s) that must be used to get the mark. 4 B ; [1]
AW means ‘alternative wording’. It is used to 5 A ; [1]
indicate that a different wording is acceptable 6 centrosome:
provided the essential meaning is the same, and is
used where students’ responses are likely to vary a microtubule organising centre ;
more than usual. makes spindle during mitosis ;
AVP means ‘additional valid point’. This means contains two centrioles ;
accept any additional points given by the student
located just outside nucleus ;
that are not in the mark scheme, provided they
are relevant. But accept only as many additional centriole:
points as indicated by the bold semicolons, e.g. has nine triplets of microtubules ;
AVP ; ; means award a maximum of 2 extra marks.
no function (during mitosis) ;
ORA means ‘or reverse argument’ and is used
part of centrosome ; award this mark only if
when the same idea could be expressed in the
not mentioned under centrosome
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept centromere:
‘activity decreases between pH5 and pH2’. region of a chromosome that holds two
max. This indicates the maximum number of chromatids together ;
marks that can be given. point of attachment for microtubules during
mitosis ;

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

point of attachment of chromatids to spindle ; B True ;

AVP ; Sister chromatids are formed by the
 [max. 6 with a max. of 3 for centrosome] replication of DNA. Each contains one
daughter DNA molecule identical to the
7 a A anaphase ; parent molecule.
B prophase ; C False ;
C metaphase ; [3] Microtubules extend from the kinetochore
b 
Information for this answer can be found in to the nearest pole. The kinetochores
Figure 5.9 in the Coursebook. in sister chromatids are connected to
opposite poles.
Award 1 mark for each correct summary.[3]
D False ;
 [Total: 6]
This occurs during M phase during
8 a i metaphase ; [1] spindle manufacture (polymerisation)
ii prophase drawing shows two single and chromatid movement
chromosomes, each with a centromere (depolymerisation).
(not paired chromatids), ‘randomly’ E False ;

PDF from sachtienganhhanoi.com

distributed, surrounded by cell surface
Kinetochores are found on chromatids.
membrane but with no spindle ; [1]
F False ;
b a long and a short chromatid, each with
a centromere, are shown inside each Telomeres are the caps at the ends of
new nucleus ; [1] chromosomes. Microtubules are attached
at the centromeres (kinetochores).
c six chromatids about half-way between
equator and each pole (12 chromatids in G True ;
all) ; two long, two short, two hooked in Chromatids separate at the start of
each direction ; anaphase.
centromere leading for each chromatid ;[3]  [Total: 7]
 [Total: 6] 11 The following table of data is based on
9 a microtubules are made out of tubulin data obtained from the same source as the
molecules ; figure used for the question (visit https://
ourworldindata.org). The figure is interactive
the tubulin molecules stick together in a
on the website. The following table of data
particular pattern to form the microtubules,
may help teachers when marking.
so the presence of colchicine would
Year 1990 Year 2016
interfere with this ; AW [2]
Age millions % Age millions %
b spindle ;
group group
centrioles ; [2] 70+ 6.52 34.2 70+ 15.67 37.3
c (held up in) prophase ; 50 – 69 8.73 45.8 50 – 69 19.27 45.9
spindle cannot form (due to presence of 15 – 49 3.36 17.6 15 – 49 6.51 15.5
colchicine) ; under 0.46 2.4 under 0.55 1.3
so, metaphase / subsequent phases, –15s –15s
cannot occur ;  [3] Total 19.07 100 Total 41.99 100
 [Total: 7]
a cancer is caused by mutation ;
10 Award 1 mark for correct statement, True or
in, genes / a gene, controlling, cell division
False. No explanation is required.
/ mitosis ;
A True ;
a mutated gene causing cancer is called an
Centrosomes replicate during interphase, oncogene ; [max. 2]
before M phase begins.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b a, substance / chemical, (or environmental     could be due to the fact that exposure
factor) that can cause cancer ; [1] to risk factors is increasing / could be
c i 50–69 ; [1] due to changes in lifestyle / could be
due to increasing pollution / could
ii it contains the greatest number of be due to increased smoking (of
people ; tobacco) ;
  the people have had longer to     there is no / little change in the
accumulate mutations than younger number of cancer cases among the
age groups ; under-15s (actually gone down from
   the death rate in the 70+ age group is 2.4% to 1.2% of total) ;
higher, so fewer remaining sufferers     would expect an increase if there were
of cancer ; [3] more under-15s in 2016 than 1990 ;
iii 
Questions asking students to comment     could be due to better medical
on data can elicit a great variety of treatment of cancer in under-15s ;
answers, so some judgement is often
needed in deciding what is a suitable     there is no / little change in the actual
marking point. The use of AVP (any number of cancer cases among the
under-15s, although the % has gone

PDF from sachtienganhhanoi.com

valid point) in the marking scheme is
indicative of this. down from 2.4% to 1.3% of total
(almost halved) ;
    the total number of cancer sufferers
has increased ;     therefore, no new factors / no change
in factors, causing cancer (?) ;
    has (roughly) doubled ;
    any comment suggesting that further
    that could just be a result of information is needed to fully
population increase ; interpret the trends ;
   could be due to people living longer ;    any calculation of percentages ;
   AVP ; ; ; [max. 5]
 [Total: 12]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 6
Self-assessment questions
1 a diagram as Figure 6.2 with sugar labelled 7 The fact that the code is universal (the same
as deoxyribose and base labelled as in all organisms) suggests that all living
adenine, guanine, thymine or cytosine organisms have evolved from a single common
ancestor that used this code.

PDF from sachtienganhhanoi.com

b diagram as Figure 6.2 with sugar labelled
as ribose and base labelled as adenine, 8 TTT = Lys (lysine), GAA = Leu (leucine),
guanine, thymine or uracil CCC = Gly (glycine)

2 a peptide bond 9

b glycosidic bond Feature DNA messenger

RNA
3 A = T and G = C for all organisms (within sugar deoxyribose ribose
experimental error) present in
structure
4 a DNA, (DNA) nucleotides, DNA
polymerase, DNA ligase bases used adenine, guanine, adenine,
in structure thymine, cytosine guanine,
b Nucleotides are needed to make DNA uracil, cytosine
(DNA is a polynucleotide). number of 2 1
strands
DNA polymerase copies the DNA, lining
up nucleotides. overall double helix single linear /
structure unfolded
DNA ligase joins neighbouring strand
nucleotides with phosphodiester bonds. location in nucleus nucleus and
cell cytoplasm
c nucleus
function instructions for carries
5 a The two daughter molecules should have cell / code for code for a
one blue and one red strand each. making proteins polypeptide
/ molecule of from DNA /
b One daughter molecule should have two inheritance / nucleus to a
blue strands and one should have two red genetic molecule ribosome
strands.

6 4n, where n = number of bases coding for one

amino acid

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

10 There are various possible flow diagrams or word-only flow diagrams you could use. Examples
are shown.

DNA unwinds and the two strands separate

↓
complementary mRNA molecule built up against
one DNA strand (transcription)
↓
mRNA molecule attaches to ribosome
↓
complementary tRNA, loaded with appropriate
amino acid pairs, with one codon on mRNA
(translation)
↓
peptide bond forms between adjacent
amino acids

PDF from sachtienganhhanoi.com

nucleus translation

ribosome
DNA mRNA mRNA
tRNA
transcription

nuclear amino acid-tRNA

pore
amino acid
polypeptide

In the nucleus, DNA unwinds and the two strands separate → one strand is copied to make a
complementary mRNA molecule (transcription) → mRNA leaves the nucleus via a nuclear pore and
travels to and attaches to a ribosome → complementary tRNA carrying an appropriate amino acid
pairs with first codon on the mRNA (translation) → process is repeated with second amino acid-tRNA
→ peptide bond forms between neighbouring amino acids → process continues to make a polypeptide.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 6
Exam-style questions
The mark schemes, suggested answers and 1 B; [1]
comments that appear here were written by the 2 C; [1]
author(s). In examinations, the way marks are
awarded to answers like these may be different. 3 D; [1]

PDF from sachtienganhhanoi.com

4 D; [1]
Notes about mark schemes
5 labels should include:
A or accept indicates an alternative acceptable
answer. parent, molecule / DNA ;
R = reject. This indicates a possible answer that daughter molecules ;
should be rejected. parent / old / original DNA, acts as template ;
; The bold semicolon indicates the award of 1 mark. new strands / DNA, made from nucleotides
/ This indicates an alternative answer for the same binding to, old strands / DNA, by
mark. The alternatives may be separated from the complementary base pairing ;
rest of the answer by commas. semi-conservative ; [max. 4]
( ) Text in brackets is not required for the mark. 6
mRNA tRNA DNA triplet from
Underlining This is used to indicate essential codon anticodon which mRNA was
word(s) that must be used to get the mark. transcribed
AW means ‘alternative wording’. It is used to UUA AAU AAT
indicate that a different wording is acceptable
UUG AAC AAC
provided the essential meaning is the same, and is
used where students’ responses are likely to vary CUU GAA GAA
more than usual. CUC GAG GAG
AVP means ‘additional valid point’. This means CUA GAU GAT
accept any additional points given by the student CUG GAC GAC
that are not in the mark scheme, provided they
are relevant. But accept only as many additional Award 1 mark for each correct entry. [12]
points as indicated by the bold semicolons, e.g.
7 a substitution ;  [1]
AVP ; ; means award a maximum of 2 extra
marks. b the genetic code is degenerate / redundant ;
ORA means ‘or reverse argument’ and is used some amino acids are coded for by
when the same idea could be expressed in the more than one triplet ;  [max. 2]
reverse way. For example: ‘activity increases c change in the amino acid coded for ;
between pH 2 and pH 5 ORA’ means accept
primary structure of polypeptide changed ;
‘activity decreases between pH 5 and pH 2’.
may affect tertiary structure ;
max. This indicates the maximum number of
marks that can be given. therefore may affect functioning of
polypeptide ; [max. 3]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d all gametes produced by that cell will 9 a U mRNA ;

be affected ; V ribosome ;
all cells in any individual produced W amino acid ;
from that gamete will be affected ; [2]
X tRNA ;
e a single deletion or addition results in a
frame shift ; AW Y polypeptide ; [5]
all triplets after the mutation are affected ; b peptide bond ; [1]
a triplet may be altered to a stop signal ; c the ribosome is moving along the mRNA ;
if three bases are added or deleted a frame it moves three bases / one codon, at a
shift will not occur ; time ;
after the third addition or deletion ; as the code is being read ;

because the code is read in sets of three each time a tRNA brings in another
bases ; amino acid ; AVP [max. 3]

one amino acid will be added or deleted  [Total: 9]

from final polypeptide ; 10 a the DNA in the spleen and thymus of the

PDF from sachtienganhhanoi.com

this may not be harmful / affect same organism is the same / the DNA in
polypeptide functioning ; [max. 4] all the cells of an organism is the same /
the same genes are present in both
 [Total: 12]
organs ; [1]
8 b the DNA in different species is different /
different genes are present ; [1]
Transcription Translation
site in cell nucleus ribosome (in c the numbers of A and T, and of C and
where it cytoplasm) G, are similar because A pairs with T
occurs and C pairs with G ; [1]
molecule used DNA mRNA d no base pairing occurs (because the
as a template DNA is single stranded) ; [1]
molecule mRNA polypeptide /  [Total: 4]
produced protein
component (RNA) amino acids
molecules nucleotides
(monomers)
of molecule
produced
one other RNA tRNA / rRNA /
molecule that polymerase ribosomal
is essential for protein /
the process to enzyme that
occur adds amino
acid to tRNA
Award 1 mark for each correct entry.  [10]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 7
Self-assessment questions
1 a 
a sugar molecule consisting of two 5
monosaccharides joined together by a
glycosidic bond Xerophytic How it helps Example
feature of to conserve (name of

PDF from sachtienganhhanoi.com

b glucose and fructose leaves water plant)
c β-glucose thick cuticle waxy cuticle is marram grass,
impermeable Sitka spruce
d α-glucose to water
e in regions of growth (meristems) to help leaf rolling see Figures marram grass
make the cell walls of new cells 7.16a and
7.17
2 Pencil is not sharp.
hinge cells see Figures marram grass
Lines are not clear and continuous. 7.16a and
7.17
Individual cells are drawn in a low-power plan.
stomata only see Figures marram grass
Tissues are not completely enclosed by lines. in upper 7.16a and
epidermis in 7.17
A ruler has not been used for label lines.
rolled leaf
Label lines cross. hairy see Figure marram grass,
3 This is a way of conserving water. The upper 7.16d Phlomis italica
epidermis is more exposed to sunlight, so loss reduced see Figure Opuntia,
of water by transpiration would be greater surface 7.16b and e cardon, Sitka
from this surface. area : volume spruce
ratio / spiny
4 a Increased wind speed moves water vapour or needles
away from the leaf more rapidly, thus or small
maintaining a steeper water potential
gradient between the air spaces of the leaf sunken see Figures marram grass,
and the surrounding air. stomata 7.16c and Sitka spruce
(in pits or 7.17
b A rise in temperature increases the rate grooves)
of evaporation from the cell walls into outer (lower) see Figure marram grass
the air spaces. This is because the kinetic epidermis 7.17
energy of water molecules increases, has few or no
making them move, and therefore diffuse, stomata
more rapidly. High temperatures may also
decrease the humidity of the air (as warm
air can hold more water), so increasing
the diffusion gradient.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

6 a The total lack of cell contents provides Because it is relatively inert metabolically, it
an uninterrupted pathway for the flow of is less likely to be used along the route from
water. source to sink.
b The lack of end walls also provides an 12 a actual length = observed length ÷
uninterrupted pathway for the flow of magnification or A = I / M
water.
observed length of sieve tube element =
c The wider the diameter, the more water 50 mm (±1 mm)
can be moved up through a xylem vessel
per unit time. However, if the vessels actual length = 50 mm / 200 = 0.25 mm or
are too wide, there is an increased if you convert mm to µm the answer is
tendency for the water column to 250 µm
break, introducing an air bubble that b i 1 metre = 1000 mm
will stop flow. The diameter of xylem
vessels is a compromise between these 1000 / 0.25 = 4000
two requirements. or
d The lignified walls provide support, 1 metre = 1 000 000 µm

PDF from sachtienganhhanoi.com

preventing the vessels from collapsing
inwards when the water column is under 1 000 000 / 250 = 4000
tension.
ii sieve pores
e Pits in the walls of the vessels allow water
c (sieve tube element is 0.25 mm long)
to move into and out of the vessels.
(1 hour = 3600 seconds)
7 Cohesion is the term given to the tendency
of water molecules to stick to each other, 3600 seconds to travel 1 metre
which helps mass flow to occur. Tension is
the sucking force caused by transpiration. therefore: 0.25 / 1000 × 3600 seconds to
As water leaves the plant by transpiration, travel 0.25 mm (or you may use 250 and
the water molecules are pulled through 1 000 000 instead of 0.25 and 1000).
the plant because of the cohesion of the = 0.9 seconds (to one decimal place)
water molecules. This pulling is called
transpirational pull.
8 Examples include: Reflection
a proteins, amino acids, nucleic acids (RNA The tables give some possible comparisons of
and DNA), chlorophyll, NAD, NADP xylem and phloem.
b RNA, DNA, ATP, ADP, NADP, Similarities
phospholipids
structure tubes made from cells joined end
c the amino acids cysteine and methionine. to end
9 sucrose, amino acids, ATP and plant growth function transport fluids (called sap)
substances carry out long-distance transport
10 a nectary: sink fluid moves by mass flow
b developing fruit: sink fluid moves down a pressure
gradient
c sprouting potato tuber: source
solutes transported dissolved
d potato tuber forming: sink
in water
11 It is highly soluble in water so large quantities
can be transported in a relatively small volume
Table 7.2: Comparing xylem and phloem – similarities
of xylem sap (by mass flow).
(completed).

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Differences
Feature Xylem Phloem
tubes are called vessels sieve tubes
cells/tubes living or dead dead living
cell/tube contents empty thin layer of cytoplasm (no nucleus or
ribosomes)
walls lignified, strong normal plant cell walls with cellulose as
strengthening material
end walls of tubes none sieve plates with pores
substances transported water and mineral salts / ions assimilates / organic solutes such as
sucrose and amino acids
functional unit vessels work in isolation sieve tubes /sieve tube elements work
with companion cells
mechanism of movement passive active
passive or active

PDF from sachtienganhhanoi.com

direction of movement up the plant only up and down the plant
pressure gradient from high tension (low water from high hydrostatic pressure at the
potential) in the leaves to low source to low hydrostatic pressure at
tension (high water potential) the sink
in the roots
other function support none

Table 7.3: Comparing xylem and phloem – differences (completed).

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 7
Exam-style questions
The mark schemes, suggested answers and 1 A ; [1]
comments that appear here were written by the 2 B ; [1]
author(s). In examinations, the way marks are
awarded for answers like these may be different. 3 B ; [1]

PDF from sachtienganhhanoi.com

4 B ; [1]
Notes about mark schemes
5 a 
Refer to Section 7.4, The transport of
A or accept indicates an alternative acceptable water (Movement of water from the soil
answer. into root hairs). 1 mark for each valid point
R = reject. This indicates a possible answer that up to a max. of 3 [max. 3]
should be rejected. b 
Refer to Section 7.4, The transport of
; The bold semicolon indicates the award of water (Movement of water across the root
1 mark. from root hairs to xylem). 1 mark for each
/ This indicates an alternative answer for the same valid point up to a max. of 4 [max. 4]
mark. The alternatives may be separated from the c Refer to Section 7.4, The transport of
rest of the answer by commas. water (Movement of water from xylem
( ) Text in brackets is not required for the mark. across the leaf). 1 mark for each valid point
up to a max. of 3 [max. 3]
Underlining This is used to indicate essential
word(s) that must be used to get the mark.  [Total: 10]
AW means ‘alternative wording’. It is used to 6 soil solution > root hair cell > xylem vessel
indicate that a different wording is acceptable contents > mesophyll cell > dry atmospheric
provided the essential meaning is the same, and is air ; [1]
used where students’ responses are likely to vary
7 a the lower the relative humidity, the higher
more than usual.
the tension in the xylem ; ORA
AVP means ‘additional valid point’. This means
more evaporation from leaf (mesophyll
accept any additional points given by the student
cells) when low relative humidity ;
that are not in the mark scheme, provided they
are relevant. But accept only as many additional because water potential gradient between
points as indicated by the bold semicolons, e.g. leaf and atmosphere is steeper ;
AVP ; ; means award a maximum of 2 extra marks. results in lower water potential in leaf
ORA means ‘or reverse argument’ and is used (mesophyll cells) ;
when the same idea could be expressed in the therefore more water moves from xylem
reverse way. For example: ‘activity increases (vessels to replace water lost from leaf) ;
between pH 2 and pH 5 ORA’ means accept
down a water potential gradient ;
‘activity decreases between pH 5 and pH 2’.
sets up tension in the xylem vessels ;
max. This indicates the maximum number of
marks that can be given.  [max. 4]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b highest tension is at the top of the tree ; therefore water enters plant through roots ;
ORA time delay between rate of transpiration
because water is being lost at the top of and rate of water uptake is due to time
the tree ; taken for effect of transpiration to be
there is a tension gradient in the xylem transmitted through the plant ; AW
vessels ; [3]  [max. 4]
 [Total: 7]  [Total: 10]
8 transpiration / loss of water vapour / loss of 10 a hydrogen ions are actively transported out
water by evaporation, from the leaves occurs of the companion cell ;  [1]
during the day ; b there are, more hydrogen ions / there is
because the stomata are open ; a build-up of hydrogen ions, outside the
companion cell compared with inside ;
this results in tension in the xylem
(vessels) ; hydrogen ions are positively charged ;  [2]
walls of xylem vessels are pulled slightly c ATP is needed for the active transport of
inwards / vessels shrink slightly ; AW hydrogen ions out of the cell ; [1]

PDF from sachtienganhhanoi.com

overall effect is for diameter of tree trunk  [Total: 4]
to, shrink / get smaller ; 11 a i  when seed is forming / just after
stomata close at night, so no transpiration fertilisation ; [1]
at night ; [max. 4] ii germination ; [1]
9 a the loss of water vapour ; iii 
young immature leaf / leaf that is
from the leaves / from the surface of a still growing ; [1]
plant ; [2] iv mature photosynthesising leaf ; [1]
b light (intensity) ; v when food is being accumulated / when
temperature ; [2] storage organ is, growing (in size) /
developing / end of plant’s growing
c rate of water uptake shows the same season / just before winter ; [1]
pattern as rate of transpiration ; AW
vi when plant starts to grow (using food
but there is a time delay, with changes from the storage organ) ;  [1]
in rate of transpiration occurring before
changes in water uptake ; AW [2] b i to make starch ;
d transpiration causes water uptake ;    respiration ; [2]
loss of water (by transpiration) sets up a ii to make cellulose ;
water potential gradient in the plant ;    respiration ; [2]
water potential in roots is lower than  [Total: 10]
water potential in soil ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 8
Self-assessment questions
1 a The fish has a single circulatory system, b As thoracic volume increases, pressure
whereas the mammal has a double inside the thorax decreases. This decreases
circulatory system. the pressure in the blood vessels in the
thorax. The effect is very small in the

PDF from sachtienganhhanoi.com

In the fish, blood leaves the heart and arteries, but more significant in the veins.
travels to the gills, where it picks up The relatively low pressure of the blood in
oxygen, before continuing around the the veins in the thorax, compared with the
body. In the mammal, the blood returns pressure in veins elsewhere in the body,
to the heart after picking up oxygen at produces a pressure difference causing
the lungs and is then pumped around the blood movement towards the thorax.
body.
4 Answers should include reference to:
b Oxygenated blood can be pumped
around the body at a higher pressure, • the fluctuating pressure in arteries
and therefore faster, in a mammal than • why the fluctuations become gradually
in a fish, because pressure is lost in the smaller as the blood passes through the
capillaries in the gills. This can provide arterial system
a more efficient oxygen supply to
mammalian cells than to fish cells. • the rapid drop in pressure as the blood
flows along the arterioles and capillaries,
c Mammals regulate their body and reasons for this
temperature. This involves using
• the rise of pressure as blood enters the
respiration in cells to generate heat, and
pulmonary circulation via the right-hand
this uses a lot of oxygen. Fish do not
side of the heart, and the even higher rise
regulate their temperature. Mammals
in pressure in the aorta, and reasons
therefore need to be able to deliver oxygen
for this.
to cells more quickly than fish do.
5 There are many ways in which learners might
2 Blood cells, and haemoglobin in red blood
design this table, and there is no one ‘correct’
cells, would cause scattering and absorption
answer. The table summarises some of the
of light before it reached the retina. The
ideas that they might include. Answers to b
aqueous humour supplies the cornea with its
will depend on the comparisons that learners
requirements.
make between each other’s tables. Learners
3 a Gravity pulls blood downwards. should be encouraged to make changes to
Normally, contraction and relaxation of their tables, after making these comparisons,
leg muscles squeezes in on leg veins; valves if they wish.
in them ensure blood moves upwards
and not downwards. When standing to
attention, these muscles are still, so blood
accumulates in the feet.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Feature Artery Vein Capillary

elastic large amount, particularly in small amount none
tissue in elastic arteries
wall
This allows the wall to stretch Blood in veins is at low
and recoil as high-pressure pressure, as there is no
blood pulses through. need for walls to be elastic.
smooth relatively large amount, small amount none
muscle in particularly in muscular arteries
wall
Contraction of this muscle All blood in veins is
reduces the size of the lumen, travelling back to the heart,
which can divert blood from so there is no need to
one area to another. divert it to different tissues.
thickness relatively thick relatively thin only one cell thick with
of wall cells thin and flattened,
so the wall is a thin as
possible

PDF from sachtienganhhanoi.com

Artery walls must be strong The blood is at low This allows rapid
enough to withstand the high pressure, so there is no transfer of substances
pressure of the blood flowing need for a thick wall. by diffusion between
inside them. the blood and tissue
fluid.
valves none present present none
These prevent the low-
pressure blood from
flowing backwards.
diameter relatively small relatively large tiny – many are only just
of lumen wide enough to allow a
red blood cell to pass
through
This ensures that large volumes This reduces the resistance This brings the blood
of blood, at high pressure, to flow of the blood inside as close as possible to
move quickly from the heart to them, which helps to keep cells in the surrounding
the tissues. the low-pressure blood tissues, speeding
moving back towards the up the exchange of
heart. substances between
them.

6 The larger the relative molecular mass (RMM) haemoglobin and albumin results in a very
of a substance, the lower the permeability of large difference in permeability.
capillary walls to that substance. This is true
in all cases – there are no exceptions in this 7 Albumin in the blood plasma raises its solute
table. For example, water has the smallest concentration (lowers its water potential),
RMM (18) and the largest permeability thus helping to draw water back from the
(1.00), while the substance with the largest tissue fluid into capillaries as it moves down
RMM is albumin (69 000) and it has the the water potential gradient. If albumin could
smallest permeability (0.000 01). However, diffuse out of capillaries into tissue fluid, more
the relationship is not linear. For example, a water would accumulate in the tissue fluid.
relatively small difference in RMM between

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

8 If plasma protein concentrations are low, then • This allows it to dissolve in the cytoplasm
the water potential of the blood will be higher of a red blood cell.
than normal. There will no longer be a steep
• Each haemoglobin molecule is made up
water potential gradient between the tissues
of four polypeptide chains, each with a
and blood, and so water will not be drawn
haem group at its centre.
back into capillaries from tissue fluid. This will
result in a build-up of tissue fluid and swelling. • Each haem group can bind reversibly with
one oxygen molecule.
9 2.1 × 1011
• When one oxygen molecule binds with
10 a Protein synthesis – no. There is no DNA, one of the haem groups, it slightly
so no mRNA can be transcribed. changes the shape of the haemoglobin
molecule so that it becomes easier for
b Cell division – no. There are no more oxygen molecules to bind with the
chromosomes, so mitosis cannot occur, other haem groups.
nor are there centrosomes for spindle
formation. 14 a (The word ‘gradually’ is not correct.)

c Lipid synthesis – no. This occurs on the The partial pressure of oxygen is high in

PDF from sachtienganhhanoi.com

smooth endoplasmic reticulum, and there the lungs and low in muscle and does not
is none. change gradually as the blood flows from
the lungs to the muscle (because it is only
d Active transport – yes. This occurs across when it gets to the muscle that the blood
the cell surface membrane, and can be is in contact with anything that is using
fuelled by ATP produced by anaerobic oxygen).
respiration.
b (Arteries do not pump blood.)
11 a 195 cm3
Elastic artery walls enable the artery
b 25 cm3 to expand and recoil as pulses of high-
pressure blood pass through. The recoil of
12 a i 96.5%
the artery wall does help to give the blood
ii 1.25 cm3 a further ‘push’ in between these pulses,
but this is not ‘pumping’ and is due only
b i 24.0% to elasticity, not to muscle contraction.
ii 0.31 cm3 c (The student has confused a haemoglobin
molecule with a red blood cell.)
13 Points that could be made are given as bullet
points. You could award a mark for each point Each haemoglobin molecule can combine
made. with eight oxygen atoms. One red cell
• The haemoglobin molecule is a protein contains well over 200 million
with quaternary structure. haemoglobin molecules.

• Hydrogen bonds, ionic bonds and van der d (Red blood cells do have a large surface
Waals forces hold the protein in its three- area, but oxygen does not attach to their
dimensional shape. surface.)
• The primary structure of each The large surface area allows more oxygen
polypeptide chain determines how the to diffuse in and out at any one time,
chain will fold / where the bonds will form therefore increasing the rate at which the
(thus determining its three-dimensional cell can take up and release oxygen. Once
shape). inside the cell, the oxygen does not attach
• The haemoglobin molecule has R groups to its surface but to the haemoglobin
with small charges on its outer surface molecules within its cytoplasm.
(hydrophilic R groups), which help to
make it soluble in water.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

15 For the first heart beat shown:

Reflection
atrial systole: between 0 and 0.125 s
Ideas that might be raised include:
ventricular systole: between about 0.125 s
and 0.325 s • Similarities: in both flowering plants and
ventricular diastole: between about 0.325 s mammals, fluids move inside tubes that
and 0.625 s distribute them around the body of the
organism.
16 The valves in the heart normally prevent
• Differences:
backflow from the ventricles to the atria, or
from the main arteries to the ventricles. If the −− Plants have two separate systems (xylem
atrioventricular valves do not close correctly, and phloem) with different functions.
some blood will move back into the atria Learners could outline what these
rather than into the arteries as the ventricles functions are, and compare them with the
contract. Similarly, if the semilunar valves do functions of mammalian blood.
not close correctly, some blood will flow back −− The vessels in plants are made of rows of
from the arteries into the ventricles as the single cells with rigid walls. In mammals,
ventricles relax. they are much larger, and are made of

PDF from sachtienganhhanoi.com

Both of these events will mean that less blood many cells that form their flexible walls.
is pushed out of the heart and around the Learners could give more detail about the
body, or to the lungs. This can have several structures of the walls of xylem, phloem,
effects, but the main one is likely to be that arteries, veins and capillaries.
less oxygen is delivered to the tissues. The −− Plants rely on passive processes
person may feel tired, as there is less oxygen (transpiration) to provide the pressure
available for respiration in the muscles. The differences to move water and dissolved
heart may beat more quickly or more strongly ions through xylem, and active transport
as the body attempts to ‘make up for’ this lack, to produce pressure differences that move
which – over time – may increase the risk of water and dissolved assimilates through
heart failure. phloem. Mammals have a heart that
provides these pressure differences, using
muscle contraction. Learners could give
more detail about these processes.

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 8
Exam-style questions
The mark schemes, suggested answers and 1 C ; [1]
comments that appear here were written by the 2 C ; [1]
author(s). In examinations, the way marks are
awarded to answers like these may be different. 3 D; [1]

PDF from sachtienganhhanoi.com

4 B; [1]
Notes about mark schemes 5 a reference to diffusion ;
A or accept indicates an alternative acceptable
answer. down concentration gradient ;
R = reject. This indicates a possible answer that through the wall of a capillary ;  [max. 2]
should be rejected. b lower pressure ;
; The bold semicolon indicates the award of lower concentration of oxygen ;
1 mark.
lower concentration of glucose ;
/ This indicates an alternative answer for the same
mark. The alternatives may be separated from the lower water potential ;
rest of the answer by commas. lower concentration of proteins / amino
( ) Text in brackets is not required for the mark. acids / fatty acids / other named nutrient ;

Underlining This is used to indicate essential higher concentration of urea ;  [max. 3]

word(s) that must be used to get the mark. c i carbonic anhydrase ; [1]
AW means ‘alternative wording’. It is used to ii hydrogencarbonate ions diffuse out of
indicate that a different wording is acceptable red blood cells ;
provided the essential meaning is the same, and is    (hydrogencarbonate ions) are
used where students’ responses are likely to vary transported in solution in blood plasma ;
more than usual.
   conversion of CO2 to
AVP means ‘additional valid point’. This means hydrogencarbonate reduces
accept any additional points given by the student concentration of CO2 in the blood ;
that are not in the mark scheme, provided they
are relevant. But accept only as many additional    which maintains diffusion gradient
points as indicated by the bold semicolons, e.g. for CO2 to diffuse into the blood from
AVP ; ; means award a maximum of 2 extra marks. respiring tissues ;  [max. 3]

ORA means ‘or reverse argument’ and is used d i 73%, 62% ; [1]
when the same idea could be expressed in the ii presence of carbon dioxide causes
reverse way. For example: ‘activity increases affinity of haemoglobin for oxygen
between pH2 and pH5 ORA’ means accept to decrease ;
‘activity decreases between pH5 and pH2’.    hydrogen ions (from the dissociation
max. This indicates the maximum number of of H2CO3) bind with haemoglobin ;
marks that can be given.    cause change in shape of Hb
molecule ; [max. 2]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

iii Bohr shift ;  [1] 7 a i about 0.75 seconds ; [1]

iv causes more release of oxygen (than if ii 60 ÷ 0.75 = 80 beats per minute ; [1]
this effect did not occur) ;   For b, c, d, e and f, see diagram.
   in respiring tissues ;
   where demand for oxygen is high / 16 semilunar semilunar
valves open valves close
where production of carbon dioxide 14
is high ; [3] aorta
12
 [Total: 16]

Pressure / kPa
10
left
6 a blood goes through heart twice on one 8
ventricle

complete circuit of the body ; [1]

6 atrioventricular atrioventricular right
b has more smooth muscle / elastic tissue ; valves close valves open ventricle
4
to withstand higher (blood) pressure ; 2
left
atrium
to withstand fluctuating (blood) 0
pressure ; [max. 2] 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 1.2 1.3
Time / s

PDF from sachtienganhhanoi.com

c to prevent blood flowing into the capillary
bed / to divert blood to other capillary Marks for correctly indicating the positions of
beds ; [1] the following:
d permeable walls / reference to pores in b i ventricular systole ; [1]
walls ;
ii ventricular diastole ; [1]
allow water / dissolved ions / dissolved
c i atrial systole ; [1]
substances (from plasma) to pass out ;
ii atrial diastole ; [1]
do not allow large protein molecules / cells
to pass out ; d points at which atrioventricular valves
open and close ; [1]
reference to greater hydrostatic pressure
inside capillary than in tissue fluid ; e points at which semilunar valves open
and close ; [1]
 [max. 3]
f line to show probable pressure in right
e (plasma contains) more proteins ;
ventricle ; [1]
has lower water potential ;
 [Total: 9]
has lower, carbon dioxide / HCO3–
8 a i right ventricle ;
concentration ;
  pulmonary vein ; [2]
has greater glucose concentration ;
ii they open to allow blood to flow from
has greater oxygen concentration ;
atria to ventricles ;
 [max. 3]
  t hey close during ventricular systole /
 [Total: 10] when ventricles contract ;
  r eference to closure being caused by
differences in pressure in atria and
ventricles ; [max. 2]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Event during the cardiac Number

cycle
atrioventricular (bicuspid) 6
valve opens
ventricular systole 1;
semilunar (aortic) valve closes 5;
left ventricle and left atrium 2;
both relaxing
semilunar (aortic) valve opens 4;
 [4]
c SAN produces rhythmic pulses of
electrical activity ;
which spread across the muscle in the
atria ; causes muscle in atria to contract ;

PDF from sachtienganhhanoi.com

specialised tissue, in septum / near AVN,
slows spread / delays transfer to ventricles ;
Purkyne tissue conducts impulses down
through septum ;
impulses spread upwards through
ventricle walls ;
causing ventricles to contract from
bottom upwards ;
delay of 0.1–0.2 s after atrial walls ;
 [max. 5]
 [Total: 13]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 9
Self-assessment questions
1 formula: is not very soluble in water so large surface
compensates for this.
actual width = width of cartilage on image
magnification 4 drawing:

PDF from sachtienganhhanoi.com

trachea: lines at top and bottom to show depth of
width of cartilage on photomicrograph of epithelium
trachea = 30 mm = 30 000 μm cilia indicated by a narrow band at the top
shapes of no more than five nuclei shown
actual length = 30 000 ÷ 65
thin lines to show divisions between cells (cell
 = 462 μm membranes are not visible)

bronchus: quality of drawing:

lines are thin and continuous (not feathery)
width of cartilage on photomicrograph of
labels:
bronchus = 20 mm = 20 000 μm
goblet cell
actual length = 20 000 ÷ 300 droplets of mucus
ciliated epithelial cell
 = 67 μm cilia
nucleus / nuclei
2 a The smooth muscle layer is only a few cytoplasm
cells thick; smooth muscle
cells are elongated (long) cells; thin nuclei; actual depth of epithelium:
the ring of smooth muscle is incomplete; depth of epithelium measured from
smooth muscle is stained pink. Figure 9.6a =35 mm
calculation shown as depth of epithelium on
b Smooth muscle in the airways contracts Figure 9.6a divided by magnification
to reduce the diameter and relaxes to = 35 000 μm ÷ 550
increase the diameter so adjusting the
= 64 μm
passage of air in and out of the lungs;
when demand for oxygen increases, 5 for details of microvilli and cilia, see Chapter 1
smooth muscle relaxes to allow more air both are extensions of the cell surface;
into the alveoli per breath. both are surrounded by cell surface membrane;
cilia move back and forth microvilli do not;
3 Each alveolus is very small (only about cilia move fluid over the surface of an
250 μm in diameter); gas exchange requires epithelium (also move small organisms,
a huge surface area so that sufficient oxygen e.g. Stentor (Chapter 18));
can diffuse into the blood and carbon cilia have a 9 + 2 arrangement of microtubules
dioxide can diffuse out. Diffusion is a passive microvilli do not;
process relying on maintaining concentration microvilli increase surface area of cell surface
gradients between air and blood. Oxygen membrane for absorption cilia are not used
for absorption.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

6 some examples: labels for the trachea:

cell surface membrane (only 7 nm thick so not lumen
visible in LM) ciliated epithelium
mitochondria mucous glands (between epithelium and
Golgi apparatus cartilage)
rough endoplasmic reticulum / smooth (C-shaped / incomplete) ring of cartilage
endoplasmic reticulum smooth muscle between ends of cartilage ring
ribosomes
labels for a bronchus:
nuclear pores
lumen
microtubules
ciliated epithelium
7 a Mouth/nostril → nasal cavity → mucous glands (between epithelium and
pharynx → trachea → bronchus → terminal cartilage)
and respiratory bronchioles → alveolar blocks of cartilage
duct → alveolus → epithelium → connective smooth muscle
tissue (elastic fibres) → endothelium of annotations:
capillary → plasma → red blood cell cartilage stained purple in trachea
cartilage stained blue in bronchus
b Large surface area; thin epithelium

PDF from sachtienganhhanoi.com

smooth muscle stained red
(e.g. 25 nm at thinnest), therefore short epithelia stained purple
diffusion distance between air and blood; trachea circular in cross section, bronchus
well supplied with many blood capillaries. not circular
Not... thin membrane because all cell
surface membranes are about the same Reflection
thickness, e.g. 7–10 nm.
This planning activity is a good opportunity to
8 a During exercise the bronchioles are wider apply some principles of practical investigative
to allow more air to reach the alveoli to work covered in Chapters 2, 3 and 4 to a more
supply the large quantities of oxygen complex example.
needed during exercise and to remove
Points that should be considered in a discussion:
carbon dioxide.
• choice of subjects, e.g. athletes that compete in
b Five – into and then out of a squamous different sports = independent variable
epithelial cell in alveolar wall, into and
then out of an endothelial cell and then • choose athletes of same sex and age
into a red blood cell. • choice of parameters to measure –
question mentions breathing rate, depth
9 The thinnest parts of squamous epithelial
of breathing, oxygen uptake, pulse rate
cells are only about 25 nm thick; this is
and oxygen saturation of blood entering
much less than the resolution of the light
capillaries = dependent variables
microscope (200 nm in the best microscope);
in a light microscope it looks as if the • number of different intensities of exercise – at
alveolar wall is incomplete as the thinnest least five may be suggested based on earlier
parts of the squamous epithelial cells cannot practical work
be seen. • range of intensity of exercise, i.e. light exercise
10 plan diagrams: to strenuous exercise; the most strenuous
exercise should not be more extreme than
quality of drawing: subjects can cope with
lines are thin and continuous (not feathery)
plan diagrams of appropriate size (not smaller • length of exercise at each intensity
than the photographs) • number of readings for each athlete at each
lines used to show tissues (no cells drawn) intensity (to calculate means)
relative sizes of the tissues shown correctly
no shading • process results by calculating means
• presenting results as bar charts or line
graphs.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 9
Exam-style questions
The mark schemes, suggested answers and 1 C ; [1]
comments that appear here were written by the 2 D ; [1]
author(s). In examinations, the way marks would
be awarded to answers like these may be different. 3 A ; [1]

PDF from sachtienganhhanoi.com

4 C ; [1]
Notes about mark schemes 5 a i A squamous epithelial cell ;
A or accept indicates an alternative acceptable
B red blood cell ;
answer.
C endothelial cell ; [3]
R = reject. This indicates a possible answer that
should be rejected. ii D (blood) plasma ; [1]
; The bold semicolon indicates the award of b formula:
1 mark. length of line X−Y
actual distance =
length of scale bar
/ This indicates an alternative answer for the same
× distance represented by
mark. The alternatives may be separated from the
scale bar ;
rest of the answer by commas.
correct
 measurement of the line
( ) Text in brackets is not required for the mark.
X−Y = 42 mm
Underlining This is used to indicate essential
actual distance = (42 ÷ 13) × 10 ;
word(s) that must be used to get the mark.
actual distance = 32 μm ; [3]
AW means ‘alternative wording’. It is used to
indicate that a different wording is acceptable c (very) large number forming a large
provided the essential meaning is the same, and is surface area ;
used where students’ responses are likely to vary squamous epithelial cells are very thin to
more than usual. give short diffusion distance ;
AVP means ‘additional valid point’. This means surrounded by capillaries so well supplied
accept any additional points given by the student with blood ;
that are not in the mark scheme, provided they
capillaries are very close to the squamous
are relevant. But accept only as many additional
epithelium so short diffusion distance ;
points as indicated by the bold semicolons, e.g.
AVP ; ; means award a maximum of 2 extra marks. well ventilated so air constantly refreshed ;
ORA means ‘or reverse argument’ and is used ventilation maintains concentration
when the same idea could be expressed in the gradients for oxygen and carbon dioxide ;
reverse way. For example: ‘activity increases  [max. 4]
between pH2 and pH5 ORA’ means accept  [Total: 11]
‘activity decreases between pH5 and pH2’.
max. This indicates the maximum number of
marks that can be given.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

6 a i P ciliated epithelial cell ; b mucus secreted ;

  R goblet cell ; [2] by mucous glands (in the trachea) / goblet
ii S cilium / cilia ; cells (in trachea and bronchi) ;

  T mitochondrion ; bacteria / viruses / pathogens, stick to

mucus ;
U Golgi
   body / Golgi apparatus /
Golgi complex ; cilia move mucus, upwards / towards
throat ;
W nucleolus
   ; [4]
mucus and pathogens swallowed ;
b i (T / mitochondria) provide, energy /
ATP ; destroyed by acid in stomach ;
for
   movement of cilia ; [2] macrophages / phagocytes, in the
alveoli ;
ii (U / Golgi body / AW) packages
proteins into vesicles ; engulf and digest any pathogens ; [max. 5]
for
   secretion ; [2] c elastic fibres (to max. 3)
c formula: stretch / expand, on inhalation and recoil
length of diagram of cell ; on exhalation ;

PDF from sachtienganhhanoi.com

   actual length =
magnification R contraction

  length of diagram of cell
(stretch) to increase, surface area for, gas
P = 80 mm = 80 000 μm
exchange (by diffusion) ;
   actual length = 80 000 ÷ 750 ; (stretch) to increase volume of air held in
       = 107 μm ; [3] alveoli ;
A P = 80–82 mm, actual length
 (recoil) to help, expel air / force air out ;
= 107–109 μm A expel carbon dioxide
d cell P – cilia beat / move back and forth ; prevent alveoli, bursting / breaking apart /
move mucus ; AW ;
upwards / towards throat ; smooth muscle (to max. 3)
cell R – secretes mucus ; contracts to decrease the, diameter /
width, of the (named) airways ;
mucus traps, dust / bacteria / viruses /
pollen / AW ; A trachea / bronchi / bronchioles
prevents their entry to, alveoli / gas relax to increase the, diameter / width, of
exchange surface ; [max. 4] the (named) airways ;
 [Total: 17] relax to increase volume of air into lungs
during, breathing / ventilation ; [max. 5]
7 a Structure Trachea Respiratory  [Total: 15]
bronchiole
smooth mus- ✓ ✗ 8 a i  oxygen diffuses down its concentration
cle gradient ;
ciliated ✓ ✓   from alveolar air into, blood / red
epithelium blood cells ;
mucous ✓ ✗   gradient = 13.9 kPa → 5.3 kPa / 8.6 kPa ;
glands   carbon dioxide diffuses down its
cartilage ✓ ✗ concentration gradient ;
elastic fibres ✓ ✓   from, red blood cells / plasma, to
alveolar air ;
Award 1 mark for each row. [5]
  gradient = 6.0 kPa → 5.3 kPa / 0.7 kPa ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

  diffusion pathway – across squamous b breathing / ventilation ;

epithelial cells of alveolus (through introduces, fresh air / atmospheric air ;
connective tissue with elastic fibres) removes, stale air / air rich in carbon
and across endothelial cells of dioxide ; [3]
capillary ; [max. 4] c increase:
ii oxygen diffuses down its concentration depth of breathing ;
gradient ; rate of breathing ;
expansion of alveoli to give a larger
  from, blood / red blood cells, into, surface area ;
tissue fluid / (respiring) cells ; diameter of airways ; [max. 3]
   gradient = 13.3 kPa → 5.3 kPa / 8.0 kPa ;  [Total: 14]
  carbon dioxide diffuses down its
concentration gradient ;
  from, (respiring) cells / tissue fluid,
into, plasma / red blood cells ;
   gradient = 6.0 kPa → 5.3 kPa / 0.7 kPa ;
  diffusion pathway – across cell

PDF from sachtienganhhanoi.com

membrane of respiring cells, through
tissue fluid, across endothelial cells of
capillary, across cell surface membrane
of red blood cells (to react with water,
catalysed by carbonic anhydrase –
see Chapter 8) ;
 [max. 4]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 10
Self-assessment questions
1 a Each cell has a nucleus. They also of drinking water that is contaminated by
have membrane-bound organelles, cholera bacteria. Survivors of these natural
such as mitochondria, Golgi body and disasters often do not have access to proper
sanitation, clean water or uncontaminated

PDF from sachtienganhhanoi.com

endoplasmic reticulum.
food.
b Viruses do not have a cellular structure.
Each virus consists of a nucleic acid core 6 The visitor can drink bottled or boiled water
(RNA or DNA) surrounded by a protein and avoid eating salads and raw vegetables.
coat. Prokaryotes have cells with cell If the person is visiting a place where there
walls, cell membranes and cytoplasm. is an outbreak of cholera or is going to work
in places where taking the precautions listed
2 Viruses have nucleic acid (DNA or RNA) above is likely to be difficult, then they should
inside a protective protein capsid. Some are receive the cholera vaccine. If their stay is
surrounded by envelopes derived from the going to be longer than two years, they should
cell surface membrane of the cells that they receive a booster as the vaccine only gives
parasitise. Viruses cannot reproduce without short-term protection.
entering cells (prokaryote or eukaryote
depending on the type of virus) and using 7 When a female Anopheles mosquito bites an
their ‘machinery’ of nucleic acid production infected person, she takes up some gametes of
and protein synthesis to make new viral the malarial parasite. These develop into the
particles. Bacteria have cells with all the infective stage which enters the salivary glands
enzymes needed to sustain life, including those of the mosquito. The parasite is transmitted
for hydrolysis of food substances, respiration, when the mosquito takes another blood meal
DNA replication and protein synthesis. from an uninfected person.

3 Faeces from an infected person contain Vibrio 8 Plasmodium is eukaryotic so has a nucleus
cholerae. These bacteria are transmitted and membranous organelles (as can be seen
to uninfected people in drinking water, in Figure 10.5). Human red blood cells do
contaminated food (e.g. vegetables irrigated not have nuclei as they are lost during their
with raw sewage or food prepared by a development from stem cells. Mature red
symptomless carrier), or when washing blood cells do not have any membranous
or bathing in contaminated water. This is organelles either. See Chapter 8 for
sometimes called the faecal−oral route of structural adaptations of mammalian red
transmission. blood cells.
1013
4
106 = 10 million
5 Public services, such as provision of clean
water and safe removal and treatment of
sewage, are disrupted. People are at risk

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

9 a i Both numbers of cases and numbers 12 a i 2 7.7% / 28%

of deaths from malaria began to
decrease from 2002. Between 1999 and ii ‘Living with HIV’ means people
2002, the number of cases was 10 000 who have been infected with HIV,
a year and the number of deaths including those who have symptoms
about 375 a year. By 2008, the number of AIDS and those who show no
of cases had decreased to less than symptoms at all.
1000 a year and number of deaths to b i The estimated number of people living
75 a year. with HIV has increased by 28% / from
ii The decrease in numbers of cases 28.9 million to 36.9 million / by
could be due to better diagnosis of 8 million between 2000 and 2017.
malaria so people received treatment The estimated number of people
without having to be admitted receiving treatment has increased
to hospital. Prophylactic drugs by 2613% / from 0.8 million to
may have been provided to those 21.7 million / by 20.9 million between
at risk of malaria in the season 2000 and 2017.
when mosquitoes are most active.

PDF from sachtienganhhanoi.com

Insecticide-treated nets may have The estimated proportion of people
been provided to the population so living with HIV and receiving
reducing transmission of the disease. treatment has increased from 0.03 to
Mosquito control programmes 0.59 between 2000 and 2017.
may have been started or existing
programmes became more effective. Apart from 2016 there has been
an increase year on year for the
iii Data could have been collected for numbers estimated to be living with
the number of people who were HIV. The estimated numbers and
diagnosed with malaria and the the proportion of people receiving
number of people who were treated treatment increased year on year.
for malaria without attending
hospital. ii Many people who are infected with
HIV have not been diagnosed.
b The results of the initial tests may be false. Many who have been diagnosed
Results that suggest someone is infected may not have been recorded by
by Plasmodium when in fact they are free health authorities. Countries may
of the disease are known as false-positive underreport the numbers as they have
results. Providing them with drugs is an not collected sufficient data. Countries
unnecessary expense. may also overreport the numbers
perhaps in order to receive more
10 Factors that make malaria difficult to control funding from international donors.
include: The numbers may be estimated from
• the resistance of mosquitoes to small samples of the population, for
insecticides example the people who are tested
for HIV.
• the difficulty of controlling the breeding
of mosquitoes because they lay eggs in 13 Practise safer sex (e.g. use condoms); do not
small bodies of water use unsterile needles; have one sexual partner;
• the resistance of some strains of do not donate blood if at risk of HIV infection;
Plasmodium to anti-malarial drugs such do not use prostitutes (male or female); have a
as chloroquine and mefloquine. blood test to find out if you are HIV+.

11 People can avoid being bitten by mosquitoes, 14 HIV is a blood-borne virus; blood donations
sleep under nets impregnated with insecticide, may not be screened or heat-treated for HIV.
use repellents and use anti-malarial drugs
as prophylactics (but not those to which
Plasmodium is resistant).

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

15 It is important for people to know whether • Only consume pasteurised, sterilised or

they are living with HIV so that they can UHT milk and milk products made from
make sure that they reduce the chances of these types of milk.
transmitting the virus to others.
• Those at high risk of developing TB
16 a some suggestions: should have a tuberculin skin test to see
if they are infected with Mycobacterium
• incidence of TB / number of new cases tuberculosis or M. bovis before they leave.
of TB per 100 000 people per year = 154 The test should be repeated when they
per 100 000 people per year for 2018 return to see if they have contracted the
• number of new cases of TB found to disease while travelling.
be living with HIV per 100 000 per • Consult a medical professional to see if
year = 15 per 100 000 people per year they should be given the BCG vaccine.
for 2018
19 Viruses do not have targets for antibiotics;
• mortality rate / number of deaths
for example, viruses are not cells, so they have
from TB per 100 000 people per year
no cell walls. Also they do not have the cell
= 17 deaths per 100 000 people per
machinery for making proteins – they use the
year for 2018

PDF from sachtienganhhanoi.com

ribosomes and enzymes of their host cells
b some suggestions: to make their proteins. The antibiotics that
we use to control bacterial infections do not
• number of people diagnosed with interfere with human proteins, so none of
TB who started treatment within a them will inhibit the reproduction of viruses.
specific year
20 some ways in which bacteria can resist the
• number of people who completed
effects of antibiotics:
treatment successfully within a
specific year (e.g. 2018) • a thick cell wall that is impermeable to
antibiotics
• length of time each person who
was treated successfully was on the • membrane proteins that inactivate
treatment programme (this could be antibiotics
used to calculate the median length
• enzymes that catalyse the breakdown
of time)
of antibiotics (e.g. β-lactamase enzymes
• number of people who started the including penicillinases)
treatment programme who did not
• membrane proteins that pump antibiotics
conclude it (because they failed to
out of the cell
collect drugs / take drugs under
supervision / died / other reasons) • changing the part of the protein to which
the antibiotic binds so this is not possible
17 HIV/AIDS decreases the number of
T-lymphocytes, weakening the ability of 21 MRSA evolved because antibiotics are used
the body to mount an effective immune in hospitals and act as a selection pressure.
response against HIV and other pathogens. Also there has been transfer of genes between
About one-third of the human population different types of bacteria, for example
is infected with M. tuberculosis, and this Staphylococcus aureus and Enterococcus
may progress to cause the symptoms of TB faecalis, which is an intestinal bacterium.
if the immune system is weakened by HIV E. faecalis was the source of vancomycin
infection. resistance in S. aureus. MRSA is common in
prisons because many people are kept in close
18 some suggested precautions: proximity and a disease is easily transmitted
• Avoid close contact with people known to once it is present in such a community.
have active TB, for example avoid staying
in hostels where such people sleep.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

22 a  he more frequently antibiotics are used,

T • No new class of antibiotic has been developed
the more frequently resistant bacteria since 1987, although teixobactin, discovered
will be selected for. If antibiotic use is in 2016, could give rise to a new class of
infrequent, then other selection pressures antibiotics.
will be more important in bacterial
• Consider strategies to cope with antibiotic
populations, decreasing the likelihood of
resistance, for example not using certain
resistant bacteria surviving.
antibiotics for a long time, rotating antibiotics,
b  hanging the antibiotic changes the
C etc.
selection pressure. Different strains • Include strategies for developing new
of bacteria will be selected for when a antibiotics, for example use of genome
different antibiotic is used, decreasing the sequencing and designing new proteins to
likelihood of a resistant strain for each inhibit processes that occur in bacteria.
antibiotic becoming widespread.

c I t is far less likely that any individual

bacterium will be resistant to two antibiotics
than to any single antibiotic. Using two
antibiotics together therefore decreases the

PDF from sachtienganhhanoi.com

chance of any bacteria surviving.

23 B and E. These have inhibition zones larger

than the minimum required to be in the
sensitive range. These antibiotics could be
used together.

Reflection
Some points that are likely to be made in the
presentation:
• Many people are becoming infected with
antibiotic-resistant strains of bacteria.
• Data to support this statement should be
included, especially for TB but for other
bacterial diseases as well.
• Reasons for the increase in antibiotic
resistance should be listed – see this chapter
and supplement with research to find other
reasons.
• Examples are using antibiotics when they are
not necessary (e.g. to treat viral diseases) and
using antibiotics that are not suitable for the
treatment of the bacterial diseases concerned.
• Some strains of bacteria are very difficult to
treat and some cannot be treated with any
antibiotics.
• Examples are methicillin-resistant
Staphylococcus aureus (MRSA), Carbapenem-
resistant Enterobacteriaceae (CRE) and
Clostridium difficile.
• Antibiotics act as an agent of natural selection
(see Chapter 17).

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 10
Exam-style questions
The mark schemes, suggested answers and 1 A ; [1]
comments that appear here were written by the 2 C ; [1]
author(s). In examinations, the way marks would
be awarded to answers like these may be different. 3 D ; [1]

PDF from sachtienganhhanoi.com

4 C ; [1]
Notes about mark schemes 5 a unprotected sexual intercourse ;
A or accept indicates an alternative acceptable
sharing needles (between intravenous drug
answer.
users) / reuse of unsterilised needles ;
R = reject. This indicates a possible answer that
(via) blood transfusion / blood products ;
should be rejected.
(mother to child) across the placenta / at
; The bold semicolon indicates the award of 1 mark.
birth / in breast milk ; [max. 3]
/ This indicates an alternative answer for the same
b doctor’s / hospital, records ;
mark. The alternatives may be separated from the
rest of the answer by commas. tests for HIV status (e.g. at antenatal
( ) Text in brackets is not required for the mark. clinics for pregnant women) ;

Underlining This is used to indicate essential death certificates ;

word(s) that must be used to get the mark. data recorded by (named), national /
AW means ‘alternative wording’. It is used to international, organisations (e.g. World
indicate that a different wording is acceptable Health Organization) ; [max. 3]
provided the essential meaning is the same, and is c determine how numbers of people
used where students’ responses are likely to vary infected are changing ;
more than usual. see where medical resources should be
AVP means ‘additional valid point’. This means targeted ;
accept any additional points given by the student e.g. drugs for treating HIV infection ;
that are not in the mark scheme, provided they
are relevant. But accept only as many additional 
monitor success of HIV/AIDS programmes:
points as indicated by the bold semicolons, e.g. in reducing spread of HIV infection ;
AVP ; ; means award a maximum of 2 extra marks.
in treating people who are HIV+ so they
ORA means ‘or reverse argument’ and is used do not develop AIDS ;
when the same idea could be expressed in the
to see if more education is required ;
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept to provide support to national / regional
‘activity decreases between pH5 and pH2’. health organisations ;
max. This indicates the maximum number of AVP ; ; [max. 3]
marks that can be given.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

730 000   availability of workers to spray

d i = 0.029
25 500 000 buildings ;
  ratio = 0.029 : 1 ; [1]
  ability to reach, all / most, of the
ii better health care in North America ; population ;
  better diagnosis, so people who A refs to infrastructure such as
   
are tested as living with HIV start roads / transport
treatment early ;   mosquitoes become resistant to
  more affluent countries, so insecticides ;
antiretroviral drugs available to (nearly)   need to be several insecticides so the
all people who are living with HIV ; same one is not used in the same
  AVP ; [max. 3] places year after year ;
 [Total: 13]   nets have to be, looked after carefully /
kept intact / kept undamaged ;
6 a female Anopheles (mosquito) ;
  Plasmodium becomes resistant to drugs ;
takes a blood meal from an infected person ;
  AVP ; ; [max. 3]
transfers, parasite / pathogen /
 [Total: 13]

PDF from sachtienganhhanoi.com

Plasmodium, in saliva when takes a blood
meal from an uninfected person ; [3] 7 a bacteria pass out in faeces of infected
b decrease in, number / concentration, of person ;
red blood cells ; carried in, water / food, consumed by
less haemoglobin to transport oxygen ; uninfected person ; [2]
increase in risk of anaemia ; b poor sanitation ;

more likely to be, tired / fatigued ; not enough clean drinking water ;

AVP ; [max. 3] poverty ;

lowered immunity / malnutrition / HIV
c i mosquito nets, reduce chances /
infection ; [max. 3]
prevent, mosquitoes, feeding on
humans / taking blood meals ; 447
c i × 100 = 1.08 ; [1]
41 421
  mosquitoes are killed by insecticides ii treatment for cholera involves supply
(on nets / on internal surfaces of of oral rehydration therapy ;
houses) ;
  and provision of safe drinking water ;
  insecticides are long-lasting so, nets do
not need to be renewed often / houses   better response to emergencies (in
do not need to be sprayed often ; some countries) ;
  effectiveness of response may depend
  children (under 5) are, most
on number of cases ;
susceptible to malaria / more likely to
die from malaria ;   ref to very high number of cases in
Haiti ;
  drugs kill, Plasmodium / malarial
parasite, when it enters the body ;   may depend on remoteness of regions
affected by cholera ;
  rainy season is when mosquitoes breed ;
  or ways in which, emergency supplies /
  mosquitoes / Anopheles / vector, breeds personnel, can reach affected areas ;
in small pools of water ;
  ref to high case fatality rates in,
  (therefore) higher risk of transmission ; Nigeria / Somalia ;
AVP ; [max. 4]   use of data to compare case fatality
ii provision of, nets / insecticides / drugs, rates in individual country with
is dependent on funding ; global rate ; [max. 3]
  a vailability of, health workers / iii cholera is a serious disease ;
volunteers, to distribute, nets / drugs ;    death can occur very quickly after
infection ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

   s preads quickly in population   except in Belarus where decrease did

(especially after a disaster) ; not continue to 2013 ;
   deaths are avoidable ;   use of figures for numbers of new
   if oral rehydration therapy (ORT) is cases with year(s) to illustrate any of
available immediately ; the points above ;

   d
 ata is useful to predict, situations   (minimum of two data quotes from
/ places, where cholera may occur ; the graph, e.g. two countries for the
WHO can coordinate responses to same year or one country for two
outbreaks ; [max. 3] years) ; [max. 3]

d i infected person travelled from an area iii transmission where there is,
with an outbreak of cholera ; [1] overcrowding / poor housing ;

ii water supply is not contaminated with   high rates of transmission are linked
(human), sewage / faeces ; with poverty ;

  piped water / water supply is treated to    ref to drug-resistant forms of TB ;

kill bacteria ;    poor ventilation of housing ;
  V. cholera destroyed in sewage    poor nutrition ;

PDF from sachtienganhhanoi.com

treatment ; [max. 2]    poor access to health care ;
e cholera outbreaks occur after natural   poorly organised treatment for people
disasters before medical aid can be with TB ; [max. 5]
provided / AW ;
 [Total: 13]
e.g. during wars / civil unrest, when
medical aid cannot be provided ; 9 a i  as antibiotic use increases so does the
oral rehydration therapy is not started percentage of resistant bacteria ;
soon enough ;    a ccurate data quotes for a minimum
death occurs within 24 hours if no of two countries taken from the
treatment provided ; [max. 2] scatter graph ;
 [Total: 17]    e .g. country [4] 13 units and 3%,
country [19] 38 units and 42% ;  [2]
8 a i Mycobacterium tuberculosis ;
ii either
A Mycobacterium bovis [1]
   a minimum of any two countries with
ii infected person, coughs / sneezes /
similar antibiotic use, but different
spits ;
percentage resistance ;
  aerosol / droplets, containing bacteria,
   or
breathed in by uninfected person ; [2]
   a minimum of any two countries with
b i idea that the total populations of
similar percentage resistance, but
the five countries are different ;
different antibiotic use ;
  allows valid comparisons between
   and
the countries ; [2]
   accurate data quotes for a minimum
ii number of new cases / incidence,
of two countries to support ;
of TB increased from 1990 in all
countries ;    e.g. any two countries with antibiotic
use between 20 and 30 units show
  between 2000 and 2005 numbers
antibiotic resistance between 15%
of new cases, reached a maximum /
and 33% ;
remained constant ;
   e.g. any two countries with antibiotic
  except in Belarus which reached
resistance between 10% and 20% have
maximum number before 2000 ;
antibiotic use between 2 and 20 units ;
  number of new cases remained  [2]
constant and then decreased ;

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b examples of steps to reduce antibiotic break transmission cycle of resistant

resistance: bacteria / described example ; (e.g. put
doctors should not prescribe antibiotics people infected with antibiotic resistant
for viral infections ; strains in quarantine)

antibiotics should not be used as [max. 5]

preventative medicines ; [Total: 9]
antibiotics should only be used (for 10 a A 1.5 µg cm–3 ;
treatment) when necessary ;
B 0.094 µg cm–3 ;
doctors / hospitals, should use the most
C 0.25 µg cm–3 ; [3]
effective antibiotic(s) ;
b ref to ease of reading the E-test strip ;
e.g. carry out antibiotic sensitivity tests (see
Figure 10.17 and ESQ3) / find the minimum where edge of, growth / ellipse, intercepts
inhibitory concentration (see ESQ10) ; the test strip ;
carry out genetic tests to find resistance gives quantitative results ;
genes in pathogens ; avoids measuring areas of inhibition as
doctors / health authorities, should ensure with card discs (Figure 10.17) ;

PDF from sachtienganhhanoi.com

people take the correct dose ; indicates susceptibility / resistance ;
ensure that people complete the course of indicates degree of resistance ;
their antibiotic ;
ensures a suitable dosage of antibiotic is
A ensure people follow the instructions used ;
ensure people do not use, ‘left-over’ / AVP ; [max. 4]
other people’s, antibiotics ;
c shape of, growth / ellipse, the same as in
antibiotics should, only be supplied on the diagram in the question ;
prescription / not be supplied ‘over the
counter’ or for sale on the internet / AW ; 8 μg cm–3 shown in the same relative
position as on E-test strips in the diagram ;
use more than one antibiotic (at the same
time) / use antibiotics in combination ; no growth of bacteria shown at
concentrations higher than 8 μg cm–3 ;
A ‘a mixture of antibiotics’
different antibiotics should not be used all
ε
D
the time ; µg cm−3

i.e. some antibiotics should be rotated

so that they are used for a year and then
replaced by a different antibiotic for a while
some antibiotics should be kept to use as
a ‘last resort’ ;
the same antibiotics should not be used 8
for animals and for humans ;
use of antibiotics in, food production /
(livestock) agriculture, should be
reduced ;
use other antimicrobial drugs ;
develop new, types of antibiotics / drugs ;
[3]
improve, knowledge of antibiotic
resistance among, healthcare professionals d growth only occurs next to E-test strip ;
/ the general population ;
from top of E-test strip down to 6 µg cm–3 ;
improve disease prevention methods with [2]
an example ; (e.g. vaccines / good hygiene
[Total: 12]
in hospitals)

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 11
Self-assessment questions
1 a Antibodies are produced in the body by b 8.5 − 10.0 μm
cells of the immune system.
working
Antibiotics are medicinal drugs that are

PDF from sachtienganhhanoi.com

produced outside the body and are given width of neutrophil in Figure 11.3
by mouth or by injection. = 50 mm = 50 000 μm

Antibodies are (glyco)protein molecules. accept any measurement between 50 and

60 mm
Antibiotics have different chemical
structures and are not all made of one type e.g. actual width = 50 000 ÷ 6000
of substance as is the case with antibodies. = 8.3 − 10.0 μm
b an example: 4 The cells have lobed nuclei.
Red blood cells of type A are considered 5 The explanation should make the following
to be ‘self’ in a person who is blood group two points:
A, but in a person of blood group B they
are ‘non-self’. • pathogens are organisms that cause
disease
c A person who is blood group A recognises
red blood cells of type B as non-self and • antigens are substances, such as proteins;
produces anti-B antibodies. These will they are not whole organisms.
cause clotting of the transferred blood Pathogens, such as bacteria and viruses, have
which could be fatal. antigens on their surfaces. Viruses have few
2  he lymphocyte nucleus takes up most of the
T antigens on their surfaces as they are so small.
cell; there is very little cytoplasm. Neutrophils Bacteria have many more. Some pathogens
have a lobed nucleus, with a larger amount of release substances that are antigens. An
cytoplasm. The neutrophil is larger than the example is the toxin choleragen, released by
lymphocyte. Vibrio cholerae.

3 a The width of the largest bacterium is 0.8 μm 6 The activation of the specific clones of
lymphocytes only happens when antigens on
working the surface of the pathogen make contact
with the receptors on the surface of B cells.
length of largest bacterium in Figure 11.3 In that sense the pathogen does ‘choose’ the
= 5 mm = 5000 μm lymphocytes that can destroy it. ‘Choose’
suggests that the pathogen actively searches
actual width = 5000 ÷ 6000
out the appropriate lymphocytes, which it
= 0.8 / 1.0 μm does not. The interaction between pathogen
and lymphocytes occurs at random as the
pathogen passes through places where there

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

are large numbers of lymphocytes, such as in 12 The cytoplasm of plasma cells is full of
the spleen and in the lymph nodes. rough endoplasmic reticulum where protein is
made. There are Golgi bodies for modifying
7 The B cell receptors give each B cell its proteins to become antibody molecules and
specificity. The receptors are proteins with a packaging them into vesicles for exocytosis.
specific shape that is complementary to only The mitochondria provide energy for protein
one antigen. This means that all the B cells with synthesis and for moving vesicles to the
the same specificity (B cell clone) will become cell surface membrane for secretion by
active only when that antigen is detected. In exocytosis.
turn this means that only the B cells with the
greatest chance of producing antibodies that 13 The secondary immune response is faster and
will attach to the pathogen with that antigen produces a higher concentration of antibody
will be produced. This saves resources (amino molecules.
acids needed to make antibodies) and the energy
needed to make them. The discussion should 14 The primary response to an antigen is slow.
build on knowledge of protein structure from It can take several weeks to produce enough
Chapter 2, enzyme–substrate specificity from antibody molecules to fight the infection
Chapter 3 and cell signalling from Chapter 4. effectively. During this time, we usually show
the symptoms of the disease concerned.

PDF from sachtienganhhanoi.com

8 The analogy must convey the idea that among
a very large group there is a small number of 15 All antibodies have the same constant region
items that are complementary to a specific so they will all be recognised by the same
antigen. receptor on the surface of phagocytes. This
makes it much easier for phagocytes to
An example: anti-virus software looks for a recognise pathogens coated in antibodies all
specific electronic virus that is only found in with different specificities, which means, all
the devices that have been ‘infected’. with different variable regions.

9 Only cells in clone Y have B cell receptors of 16 a Each of the four polypeptides has
the correct specificity. a primary, secondary and tertiary
structure.The secondary and tertiary
10 12.3 μm structures are visible in Figure 11.9. Each
working antibody molecule is composed of four
polypeptides (two heavy and two light);
width of plasma cell in Figure 11.7 as each molecule is composed of more
= 74 mm = 74 000 μm than one polypeptide it shows quaternary
structure. Note that quaternary structure
accept 74 ± 1 mm does not mean that there must be four
polypeptides. Some enzyme molecules have
e.g. actual width = 74 000 ÷ 6000
two polypeptides and they show quaternary
= 12.3 μm structure as well.

accept 12.2 − 12.5 μm b The heavy polypeptides have a chain of

sugar molecules attached.
11 During the development of B cells, the DNA
of the antibody genes is reorganised to give a 17 Polysaccharides are made from only a small
specific arrangement that codes for a specific number of different sugars – unlike proteins,
antibody. Mitosis produces cells that are which are made from 20 different amino acids.
genetically identical so all the cells in the clone Polysaccharides would not give the same huge
that develops from one B cell will have the number of different molecular shapes in the
same DNA. The plasma cells will be identical variable region of antibodies as is achieved
to the original B cell and will therefore all with proteins.
produce exactly the same antibody molecules.
18 Cytokines are small proteins, so they interact
Also the memory cells will be identical, so the
with cell surface receptors in the same way as
same antibody molecules will be produced
shown in Chapter 4. The diagram should show
during any subsequent immune response to
the activation of T-helper cells and the release
the same antigen.
of cytokines to activate B-lymphocytes,

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

T-killer cells and macrophages. The diagram are removed from the circulation. This is
can include cell surface receptors on these cells natural passive immunity.
that are complementary in shape to the shapes
drawn for the cytokines. The fetus does not produce its own
antibodies, because it does not have any
19 a B cells with receptors complementary mature B cells or T cells and develops in a
to the toxin are activated and divide by sterile environment in the uterus. The infant
mitosis to form plasma cells and memory produces its own antibodies shortly after
cells. The plasma cells secrete antitoxins birth as it is infected by microorganisms.
that combine with molecules of the This is natural active immunity.
diphtheria toxin and make it harmless. If
there is another infection, then the memory b The infant is protected against diseases
cells will be activated and there will be a which are endemic and which the mother
much faster secondary immune response. has caught or been vaccinated against. For
example, measles is a serious childhood
b T-killer cells with receptors infection; the infant is protected for
complementary to antigens on the surface several months by its mother’s antibodies.
of the measles virus are activated and (Note that the infant will not gain passive
divide to form a larger clone of cells that immunity to any diseases that the mother

PDF from sachtienganhhanoi.com

recognise the measles antigens. These has not encountered.)
T-killer cells search for any cells that are
infected with the measles virus and kill 24 People may be immune to a disease because
them so preventing the reproduction of they have many memory cells which can mount
the virus within infected cells in the gas a fast immune response when the pathogen
exchange system. enters their bodies. They can make the specific
antibodies and T cells required to defend
20 Immunity to one strain does not provide themselves immediately the pathogen enters.
immunity to all strains, as they do not all
share the same antigens. A bacterium may be resistant to an antibiotic.
This means that it is able to survive even in the
21 Natural immunity is immunity gained presence of the antibiotic. For example, it may
by being infected (active) or by receiving produce enzymes, such as penicillinases, that
antibodies from the mother across the break down the antibiotic penicillin.
placenta or in breast milk (passive).
25 The primary immune response cannot take
Artificial immunity is immunity gained place as soon as the antigen enters the body.
either by vaccination (active) or by injecting This is because there are very few cells in
antibodies (passive). the B cell and T cell clones that recognise
this specific antigen. First the antigen has
22 Artificial active: antigens are introduced into the to come into contact with the lymphocytes
body by injection or by mouth, and stimulate with cell surface receptors complementary
an immune response by specific B cells and T to the antigen. This takes time as the B and
cells. This provides long-term immunity but is T cells are scattered throughout the body in
not immediate, as the immune response takes the blood and in lymphoid tissue. Once the
several weeks to become effective. specific cells are activated (clonal selection),
it takes time for them to divide by mitosis
Artificial passive: antibodies are injected into
(clonal expansion). Further time is required
the body to give immediate protection against
for B cells to differentiate into plasma cells
a pathogen or toxin. Antibodies are soon
and T-helper cells to secrete cytokines to
removed from circulation and no immune
activate the immune response. Even more
response has occurred, so this is a temporary
time is needed for the plasma cells to carry
form of immunity.
out transcription and translation and secrete
23 a The concentration of maternal antibodies antibody molecules into the blood.
increases during pregnancy as they cross
The secondary immune response can occur
the placenta. The concentration of these
almost immediately as there are many
antibodies decreases after birth as they
memory B cells and memory T cells which

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

have receptors specific for the antigen. There they will not catch these diseases and will
is a much higher chance that these cells will not require medical treatment. This reduces
recognise the antigen as there are more of the burden on health services.
these cells scattered throughout the body than
was the case before clonal expansion occurred 28 The discussion will probably centre round the
in the primary response. roles of B-lymphocytes and T-lymphocytes
and their specificities for different non-self
26 a The WHO routine immunisation schedule antigens. It may also deal with the difference
can be found at: between active and passive immunity and
between natural and artificial immunity.

https://www.who.int/immunization/policy/
immunization_tables/en/ 29 a

click on Immunization schedules Agglutination of red blood cells

Blood
The schedule for the USA is at: type Mab Mab Mab
anti-A anti-B anti-D
https://www.cdc.gov/vaccines/schedules/ A+ ✓ ✗ ✓
The schedule for Malaysia is at: B+ ✗ ✓ ✓

PDF from sachtienganhhanoi.com

AB- ✓ ✓ ✗

http://infomed.com.my/vaccination-in-
malaysia AB+ ✓ ✓ ✓
O+ ✗ ✗ ✓
b The number of cases of measles has
decreased from 4.25 million in 1980 to
0.25 million in 2017. The steepest decrease b It is important to check the cell surface
came between 1981 and 1987 during the antigens of the recipient’s red blood cells to
same period of time as the immunisation find out their blood type. In a transfusion,
coverage reached 50% of the children who if the person receives blood of the wrong
received one dose of the measles vaccine. type, then the donor’s red blood cells
Coverage has remained between 70% and will stimulate an immune response, and
90% ever since 1990 and the numbers of antibodies will be produced which will
cases has fallen from 1.5 million since cause agglutination of red blood cells and
then. could cause the blockage of blood vessels.
This may lead to the death of the recipient.
27 a A second dose stimulates a secondary
immune response that increases the People do not have the capability to
number of memory cells. This makes produce antibodies against any cell surface
it more likely that an immune response antigens, A, B or D, that they possess.
to an infection by the measles virus is These are self antigens. They do, however,
effective and that the virus does not possess lymphocytes with the ability to
spread through the body and symptoms mount an immune response against cell
do not develop. surface antigens that they do not possess.
These are non-self antigens. For example,
b High immunisation rates mean that nearly a person with blood group A+ can receive
all individuals are protected against the blood of the same blood group but not
disease(s) concerned. This gives herd any blood with the B antigen. Similarly, a
immunity (or mass immunity) that also person who is B+ can receive blood that is
protects vulnerable people from the B+ but not any with the A antigen.
diseases. Vulnerable people are those
who cannot be vaccinated or who do not 30 a Monoclonal antibodies are highly specific
respond to vaccines that they are given. for the protein (or other antigen) that
Herd immunity reduces the risk of a they detect by binding. As hybridomas
pathogen infecting someone who has no can be cultured continuously, there is
immunity, for whatever reason. Most of the an unlimited supply of monoclonal
vaccine preventable diseases can have very antibodies which makes them readily
serious effects. If people are immunised, available.

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b In theory, the monoclonal antibodies

should only bind with cells that carry
the protein (or other antigen) to which
they are designed to fit, so the drug that
they carry will be delivered only to these
cells. This means that less drug is needed
than if it simply goes all over the body.
There is also less chance that the drug will
adversely affect healthy body cells.

Reflection
Some ideas that could be used in a public health
campaign:
• details of the diseases that are prevented by
vaccination
• severity of these diseases

PDF from sachtienganhhanoi.com

• deaths caused in recent epidemics linked to
low vaccination rates
• protection of children from diseases that used
to be common in childhood and lead to ill
health and loss of schooling
• protection of whole communities as a result of
herd / mass immunity
• evidence from statistics for immunisation rates
and decrease in incidence / number of cases of
vaccine preventable diseases.

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 11
Exam-style questions
The mark schemes, suggested answers and 1 C ; [1]
comments that appear here were written by the 2 D ; [1]
author(s). In examinations, the way marks would
be awarded to answers like these may be different. 3 D ; [1]

PDF from sachtienganhhanoi.com

4 A ; [1]
Notes about mark schemes 5 B ; [1]
A or accept indicates an alternative acceptable
6 a red blood cells, become ‘worn out’ / do
answer.
not live long / last for approx. 120 days ;
R = reject. This indicates a possible answer that misshapen / damaged, red blood cells can
should be rejected. block capillaries ;
; The bold semicolon indicates the award of material in red blood cells can be, reused /
1 mark. recycled ;
/ This indicates an alternative answer for the same e.g. amino acids from, haemoglobin /
mark. The alternatives may be separated from the other named protein, can be used to make
rest of the answer by commas. new proteins ;
( ) Text in brackets is not required for the mark. e.g. iron in haem groups (of haemoglobin)
Underlining This is used to indicate essential used to make new haem groups ;
word(s) that must be used to get the mark. e.g. phospholipids used to make new
AW means ‘alternative wording’. It is used to cellular membranes ;
indicate that a different wording is acceptable AVP ;
 [max. 3]
provided the essential meaning is the same, and is
b red blood cells attach to surface of
used where students’ responses are likely to vary
macrophage ;
more than usual.
endocytosis / phagocytosis ;
AVP means ‘additional valid point’. This means
accept any additional points given by the student cell surface membrane infolds / cytoplasm
that are not in the mark scheme, provided they extends around red blood cell (as at top of
are relevant. But accept only as many additional the TEM) ;
points as indicated by the bold semicolons, e.g. membrane fusion to form a (phagocytic)
AVP ; ; means award a maximum of 2 extra marks. vacuole ;
ORA means ‘or reverse argument’ and is used red blood cell is enclosed in a vacuole ;
when the same idea could be expressed in the
lysosomes fuse with vacuole ;
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept (lysosomal) enzymes released into vacuole ;
‘activity decreases between pH5 and pH2’. proteases breaks down (named) protein(s) ;
max. This indicates the maximum number of lipases break down phospholipids ;
marks that can be given.
AVP ; [max. 6]
 [Total: 9]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

7 a Experiment 1 c i a ntigen refers to any substance

30−40% of phagocytic cells (both
 that stimulates the production of
neutrophils and macrophages) did not antibodies ;
take up any fungal cells ;    a ntibodies are proteins produced
very few phagocytic cells took up more by, plasma cells / (activated)
than four fungal cells ; B-lymphocytes ;

no phagocytic cells took up more than six    e ach antibody is specific to an
fungal cells ; antigen ;  [3]

Experiment 2 ii s elf refers to antigen(s) within a

person’s body (e.g. those of the ABO
fewer phagocytic cells did not take up any blood group system which they have) ;
fungal cells (than in Experiment 1) ;
   a ll the antigens that the immune
15% of macrophages and 30% of system does not recognise as
neutrophils did not take up any fungal foreign ;
cells ;
 [max. 1]
more phagocytic cells took up 4 fungal
cells (than in Experiment 1) ;    n
 on-self refers to antigen(s) that are

PDF from sachtienganhhanoi.com

more phagocytic cells took up more than not in a person’s body (e.g. those of,
4 fungal cells (than in Experiment 1) ; pathogens / the ABO system that they
do not have) ;
AVP ; ; [max. 5]
   a ll the antigens that the immune
b these are the results of an experiment with system recognises as foreign ; [max. 1]
cells in isolation ; d cell H is a memory cell ;
cells are not in their normal environment remains in, circulation / lymph system /
in the body / AW ; body ;
behaviour of cells in culture may be is specific to an antigen on tetanus
different ; bacteria ;
e.g. if no cytokines from T-lymphocytes responds quickly to another infection by,
to stimulate endocytosis ; pathogen with same antigen / same (strain
e.g. if no antibodies to coat pathogen to of) pathogen ;
facilitate endocytosis ; as there are a large number / there is a
ratios between pathogen and phagocytes large clone ;
may be different (i.e. not 1 : 1 or 3 : 1) ; during secondary immune response ;
cells were left for only six hours ; differentiate into plasma cells ;
phagocytes may need much longer than to give large number of antibody
this to start carrying out endocytosis ; molecules in short space of time ; [max. 3]
this may be responsible for large number  [Total: 13]
of phagocytes that did not take up any
fungal cells ; 9 a phagocyte has
AVP ; ; [max. 3] a lobed nucleus ;
 [Total: 8] lysosomes ;
8 a stem cells: larger quantity of cytoplasm ;
divide repeatedly (by mitosis) ;
 cytoplasm with granules / granular
cytoplasm ; [3]
for replacement of, (white) blood cells /
lymphocytes ; [2] b presentation of antigen(s) by,
macrophages / (other) APCs ;
b i mitosis ;  [1]
some T-lymphocytes have receptors
ii plasma cell ;  [1] complementary to antigen ;
iii antibody ; A immunoglobulin [1] these are selected ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

divide by mitosis ; some children may not receive boosters ;

T-helper lymphocytes secrete cytokines ; AVP ; [max. 3]
to activate B-lymphocytes ;  [Total: 10]
selected B-lymphocytes divide and 11 a i
X = variable region / antigen-binding
differentiate into plasma cells that secrete site ;
antibodies ;    Y = constant region ;  [2]
T-killer lymphocytes search for cells ii disulfide ;  [1]
infected by, parasite / pathogen ;
b transcription (of DNA) ;
T-killer lymphocytes destroy host cells
(and pathogen / and measles virus) ; translation (of mRNA) ;

prevent reproduction of, virus / pathogen ; assembly of amino acids to make each of
 [max. 6] the four polypeptides ;

c B-lymphocytes can be activated by assembly of polypeptides to make

presence of, antigen / pathogen, alone ; antibody molecule ;

without involvement of macrophages ; addition of sugar chains (to make

glycoprotein) / glycosylation ;

PDF from sachtienganhhanoi.com

B-lymphocytes differentiate into plasma
cells ; antibody molecules packaged in Golgi
body into vesicles ;
secrete antibodies (T-lymphocytes do not
secrete antibodies) ;  [max. 2] release of antibodies by exocytosis ;
 [max. 4]
 [Total: 11]
c variable region(s) are antigen-binding sites ;
10 a i immunity is gained by the transfer
of antibodies from, mother’s blood the two variable regions (on IgG
during pregnancy / another source ; molecules) are identical ;

  no immune response within the body ; variable regions, are specific /
complementary, to antigen ;
  antigen(s) / pathogen(s), have not
entered the body ; [max. 2] variable regions have different amino acid
sequences for different antigens ;
ii natural passive immunity:
20 different amino acids can be arranged
   antibodies cross the placenta ; to form different shapes ;
   in, breast milk / colostrum ; [2] disulfide bonds hold polypeptides together ;
b baby has passive immunity ; hinge region allows flexibility in binding
antibodies against measles antigens (from to antigen ;
mother) will interact with, measles constant region for binding to receptors
viruses / antigens, in vaccine ; on phagocytes ; [max. 4]
so prevent an immune response ; d monoclonal antibodies used in diagnosing
therefore no memory cells will be a condition all have the same specificity ;
formed ; [max. 3] each monoclonal antibody detects only
c some suggestions: one antigen ;
difficulty in reaching nearly 100% global monoclonals can be used to distinguish
coverage ; between different, pathogens / strains of
pathogens ;
some populations difficult to reach ;
monoclonals can be, labelled / tagged,
any reason, e.g. living in inaccessible /
with flourescent labels / radioactive labels ;
dangerous, places ;
can locate position of, cancers / infection
some children may not respond to the
by pathogens / blood clots ;
vaccine ;
diagnosis can be much fast(er) than by
other methods ;

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

comparison with any other method ; ii emits gamma rays, which pass through
e.g. growing pathogen in culture ; soft tissue and so can be detected from
outside the body ;
can detect pathogens that do not grow in
culture ;   weak gamma rays, reducing chance of
mutation ;
can be used to detect concentrations of,
antibodies / cells ;   short half-life, so no continuing source
of gamma rays ;
any e.g. ; HIV particles / antibodies to HIV
   indium has no biological role ; [max. 3]
AVP ;
 [max. 4]
iii a dd, a drug / an enzyme to activate a
 [Total: 15] drug, to kill cancer cells ;
12 a 2 ; 5 ; 3 ; 1 ; and 4 ; [1]    in place of radioactive label ; [2]
b i  inds only with tumour-associated
b  [Total: 9]
antigen (TAG) glycoprotein in cancer
cells ;
  source of gamma rays concentrated
by cancer ;

PDF from sachtienganhhanoi.com

  gamma rays can be detected from
outside the body ;  [3]

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter P1
Self-assessment questions
1 a The independent variable is temperature. temperature each time by heating or by
The dependent variable is the activity of adding hot water.
amylase.
b The most important control variables will

PDF from sachtienganhhanoi.com

b The lower end of the range should begin be pH, concentration of amylase solution
around 0 °C. It cannot be any lower than and concentration of starch suspension.
this, as this is the freezing point of water.
The upper end of the range should be c pH can be controlled using a buffer
about 80 °C – although it could go up to solution at a value that is close to the
just below 100 °C. This wide range would optimum pH for amylase (a value between
ensure that the optimum temperature pH7 and pH8 would be suitable). Add the
of the enzyme is included (optimum same volume of buffer to each reacting
temperatures are not always around mixture. Amylase concentration and
40 °C and can be much higher or lower starch concentration can be controlled by
than this). making up enough of each solution to use
for each temperature. Stir the solutions
c A suitable interval would be 10 °C. This thoroughly before taking out each sample.
gives a good compromise between getting
plenty of readings (if the range is 0 °C 4 The precise structure of the results table
to 80 °C there will be nine readings) and will vary, depending on the range of the
making it possible to do the investigation independent variable that has been decided
in a reasonable amount of time. on, the interval, and how the dependent
variable will be measured. The results
2 You can measure the dependent variable by table should:
measuring the rate of disappearance of starch
• have ruled columns and rows
or by measuring the rate of appearance of
reducing sugar (maltose). • include the independent variable
(temperature) in the first column, headed
3 a Temperature (the independent variable) ‘Temperature / °C’, and each value listed
could be changed using a water bath. from lowest to highest as a pure number
Partly fill a beaker with crushed ice. (no units except in the heading)
Measure the temperature using a
thermometer. Stand a tube containing • include a column for readings of the
amylase solution, and a separate tube dependent variable (second column)
containing starch suspension, in the ice. headed appropriately with the unit.
Leave for five minutes before adding them If repeats are to be done, the results table
to one another. For the next temperature, could include three columns for readings of
either heat the ice gently or add hot the dependent variable, and a final column in
water until the water reaches the desired which the mean values for each temperature
temperature. Continue upwards through can be recorded.
the temperature range, increasing the

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

5 a Answers will depend on the points chosen.

Reflection
Answers should include:
Learners are likely to decide that they understand
• a tangent drawn at each of the chosen the investigation better if they have been involved
points in planning it themselves. Just following a list of
instructions often results in a tendency to simply
• working showing the values of x and
do what the instructions say, without any effort
y for each tangent
to think about why the experiment is being done
• calculation of y ÷ x for each tangent in this way. Learners may be able to suggest how
they can deal with this, perhaps by spending some
• final answer expressed with units.
time thinking about the reasons for each step on a
b The last paragraph should be modified to worksheet or in an examination question, before
include specific references to the gradients actually beginning to do the practical work.
calculated in a.

6 Enzyme concentration remains constant, so

the number of active sites available to break
down rennin is constant. Assuming that all the

PDF from sachtienganhhanoi.com

active sites are always occupied (i.e. that the
enzyme is working at its maximum velocity,
Vmax), then each rennin molecule can only
enter an active site after its previous occupant
has been broken down and left (as product).
The more rennin molecules there are, the
longer it will take for all of them to undergo
this process.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter P1
Exam-style questions
At this level, practical skills are examined in a AW means ‘alternative wording’. It is used to
laboratory-based practical examination. The indicate that a different wording is acceptable
questions in the Coursebook are for practice in the provided the essential meaning is the same, and is
theoretical aspects of these skills. For laboratory- used where students’ responses are likely to vary

PDF from sachtienganhhanoi.com

based practice practical questions, please see the more than usual.
Practical Workbook in this series. AVP means ‘additional valid point’. This means
The mark schemes, suggested answers and accept any additional points given by the student
comments that appear here were written by the that are not in the mark scheme, provided they
author(s). In examinations, the way marks would are relevant. But accept only as many additional
be awarded to answers like these may be different. points as indicated by the bold semicolons, e.g.
AVP ; ; means award a maximum of 2 extra marks.
Notes about mark schemes ORA means ‘or reverse argument’ and is used
A or accept indicates an alternative acceptable when the same idea could be expressed in the
answer. reverse way. For example: ‘activity increases
R = reject. This indicates a possible answer that between pH2 and pH5 ORA’ means accept
should be rejected. ‘activity decreases between pH5 and pH2’.
; The bold semicolon indicates the award of 1 mark. max. This indicates the maximum number of
marks that can be given.
/ This indicates an alternative answer for the same
mark. The alternatives may be separated from the 1 C; [1]
rest of the answer by commas. 2 C; [1]
( ) Text in brackets is not required for the mark.
Underlining This is used to indicate essential
word(s) that must be used to get the mark.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

3
Two important control
Investigation Independent variable Dependent variable
variables
The effect of sucrose sucrose concentration % plasmolysis of • s ource of onion
concentration on plas- onion cells cells
molysis of onion cells • length of time
of immersion
The effect of pH on pH rate of activity of • c oncentration of
the rate of activity amylase, measured amylase
of amylase as e.g. the rate of • c oncentration of
disappearance of starch substrate
or rate of appearance • temperature
of maltose
The effect of tempera- temperature percentage of open •w  ind movement
ture on the percentage stomata in leaf • light
of open stomata in • humidity
a leaf •p  re-treatment of leaf
(i.e. anything that

PDF from sachtienganhhanoi.com

might affect its
degree of hydration)
• s ource of leaf (same
species, age, position
on plant)
1 mark for each box completed correctly [9]

4 a A epidermis ; vi no. of squares covered by lignified

B cortex / parenchyma ; tissue in stem counted ;
C phloem ; no. of squares covered by whole stem
D endodermis ;  [4] counted ;

b i LP plan drawn with no cell detail ; % squares occupied by lignified tissue

in stem calculated correctly ;
xylem only drawn inside circle ; (answer should be around 1%) [3]
correct proportions ; stem needs more support than root ;
vii 
lines continuous, not sketchy and because upright in air and needs
sharp pencil used ; [4] support to prevent it falling over /
collapsing ; AW  [2]
ii LP plan drawn showing vascular
bundles only and no cell detail ; c roots subjected to tugging / pulling
pressure from parts above ground ;
sclerenchyma, xylem and phloem
drawn in outline ;  [2] roots spread out, so like a series of guy
ropes ; stem a single column ;
iii no. of squares of graph paper
covered by lignified tissue in root greater strength from a ring of rods than
counted ;  [1] from one central rod ;
iv no. of squares of graph paper covered ring of rods provides greater resistance
by whole root section counted ;  [1] to compression from above than a single
central rod ;
v % squares occupied by lignified
tissue in root calculated correctly AVP ; accept any reasonable suggestion(s)
from student’s answers to iii and iv ; which are based on different stresses to
(answer should be greater than which roots and stems are subjected.
for root) [1]  [max. 2]
 [Total: 20]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

5 a i ‘Temperature / °C’ on x-axis and 6 a x-axis is ‘Time / minutes’, y-axis is

‘Enzyme activity / mean number of ‘Number of individuals’ ;
carbon dioxide bubbles released per scales on both axes with suitable range
minute’ on y-axis ; and interval ;
suitable scales on both axes – range all bars plotted accurately or points
from 10 or 15 to 40 on x-axis and 0 plotted accurately (using crosses or
or 5 to 20 on y-axis, in intervals of encircled dots) ; all lines neat and thin,
2 or 5 ; plus key ;  [4]
all points plotted accurately, using b on both days, minimum time taken is
crosses or encircled dots ; 35 minutes and maximum time taken is
thin, clear, best-fit line drawn or 55 minutes ;
points joined with ruled lines – no on both days, number of individuals is
extrapolation ; [4] greatest near the centre of the range ;
ii correct reading from graph, including on day 1, greatest number of individuals
unit (mean number of bubbles per take 45 minutes to digest starch, but on
minute) ; [1] day 2 greatest number of individuals take

PDF from sachtienganhhanoi.com

iii accuracy: 40 minutes to digest starch ;
use water bath to change independent mean time is greater on day 1 than on
variable ; day 2 ; [max. 3]
control of significant named variable c temperature may have been higher on
plus method of control (e.g. use same day 2 ;
type of yeast) ; animals on day 2 may have eaten recently
use named apparatus (e.g. gas syringe) and so had more saliva / amylase in their
to collect gas (for measurement of mouths ;  [max. 1]
dependent variable) ; d use individuals of same age/mass/
reliability: body weight ;
increase number / range of ensure pre-treatment is the same (e.g. food
temperatures ; repeat each given, environment) ;
temperature three times and use same volume of saliva ;
calculate mean ;  [max. 3]
use same volume and concentration
b hypothesis is supported ; of starch ;
quote figures for change in mean number keep temperature the same by using a
of bubbles between any two temperatures water bath ;  [max. 3]
between 15 °C and 40 °C ;
reference to no data below 15 °C or above  [Total: 11]
40 °C ; so cannot tell if hypothesis is also
supported outside this range ;  [max. 2]
 [Total: 10]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 12
Self-assessment questions
1 ADP + Pi(H3PO4) + 30.5 kJ → ATP + H2O c 
oxygen: the final electron acceptor and
hydrogen ion acceptor in oxidative
2 Learners may have various ideas about this. phosphorylation: the oxygen is reduced to
They should comment on the similarity of water

PDF from sachtienganhhanoi.com

using ATP and using money – for example,
that money exists in small packages (coins and 6 Learners will devise their own role play.
notes), just as ATP carries a small ‘package’ For example, some learners could stand in
of energy, and that money can be spent in two lines, facing one another, to represent
return for services and goods, while ATP can the inner mitochondrial membrane and the
be ‘spent’ to obtain benefits from energy- carriers in it. The three learners representing
requiring processes. They may also think reduced NAD can separate; the ‘electron’
about parallels between acquiring money and moves along the carriers, while the ‘proton’ is
acquiring ATP. pumped to the other side of the membrane;
when the ‘electron’ arrives at the end of the
3 The carbon dioxide diffuses out of the chain, the proton moves back through a
mitochonrial matrix, across the inner and channel in ATP synthase (played by other
outer membrane of the envelope, and into learners) in the membrane; this causes a
the cytoplasm. It then diffuses across the cell ‘phosphate’ to link to an ‘ADP’ to form
surface membrane, through the tissue fluid, ‘ATP’ – someone can make a loud bang at this
across the endothelium of a blood capillary. point – while a learner representing oxygen
It may then be transported in solution in the grabs the electron and proton to become a
blood plasma, as carbaminohaemoglobin, or as water molecule.
hydrogencarbonate ions. At the lungs, carbon
dioxide diffuses from the capillary, across its 7 Annotations should include: presence of
endothelium, and across the wall of the alveolus. enzymes in the matrix to catalyse the link
It is moved out of the body in expired air, reaction and the reactions of the Krebs cycle;
through the bronchioles, bronchus and trachea. permeability of the outer membrane to allow
movement of named substances into and out
4 By decarboxylation, citrate, a six-carbon of the mitochondrion; relative impermeability
compound, can be converted to five-carbon of the inner membrane, to prevent hydrogen
and four-carbon compounds, finally giving ions moving through it too easily and to
oxaloacetate, which can act as an acceptor enable the build-up of a concentration
for an incoming two-carbon unit from acetyl gradient for them; presence of carriers and
coenzyme A, giving citrate again. ATP synthase in the inner membrane, for
oxidative phosphorylation; increased surface
5 a 
NAD: a hydrogen carrier molecule: it area of inner membrane (cristae) to allow for
accepts a hydrogen from one reaction and large numbers of carriers and ATP synthases;
donates it to another presence of ribosomes and DNA for protein
synthesis, to provide some of the enzymes and
b 
coenzyme A: a carrier of an acetyl group
other proteins required.
from the link reaction to the Krebs cycle

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

8 D
9 A possible table could look like this:

Feature How this helps rice to survive with its roots submerged in water
stem grows quickly when stem stays above the water, so it can obtain carbon dioxide for
ground is flooded photosynthesis and oxygen for respiration, from the air
roots (and stem) contain oxygen can diffuse rapidly through the stem and into the roots,
aerenchyma allowing them to obtain enough oxygen for aerobic respiration
ethanol fermentation in root cells are able to synthesise some ATP in anaerobic conditions, if
roots oxygen supply is insufficient

10 C18H36O2 + 26O2 → 18CO2 + 18H2O + energy

RQ = CO2/O2 = 18/26 = 0.69

Reflection

PDF from sachtienganhhanoi.com

Learners are likely to think of the envelope, made
up of an inner membrane (from the invading
prokaryote) and an outer membrane (from the
original cell); the presence of DNA and ribosomes
in the mitochondrion. Some learners may like to
use the internet to research further evidence for
this hypothesis. The development of this symbiotic
relationship would give the original cell access to
the aerobic pathways provided inside the invader –
so that it can now carry out aerobic respiration
and make much more ATP than it was previously
able to. This would give it a great advantage over
cells lacking this ability.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 12
Exam-style questions
The mark schemes, suggested answers and max. This indicates the maximum number of
comments that appear here were written by the marks that can be given.
author(s). In examinations, the way marks would
1 a Lipid has more hydrogen atoms per
be awarded to answers like these may be different.

PDF from sachtienganhhanoi.com

molecule than does carbohydrate ;
Notes about mark schemes most energy liberated in aerobic
A or accept indicates an alternative acceptable respiration comes from the oxidation
answer. of hydrogen to water ; [2]
R = reject. This indicates a possible answer that b
should be rejected. volume of carbon dioxide given out
; The bold semicolon indicates the award of in unit time
RQ = ;;
1 mark. volume off oxygen taken in in unit time
/ This indicates an alternative answer for the same or
mark. The alternatives may be separated from the
rest of the answer by commas. moles / molecules of carbon dioxide
given in unit time
( ) Text in brackets is not required for the mark. RQ = ;;
molees / molecules of oxygen taken
Underlining This is used to indicate essential in in unit time
word(s) that must be used to get the mark. [2]
AW means ‘alternative wording’. It is used to c
indicate that a different wording is acceptable Respiratory substrate RQ
provided the essential meaning is the same, and is carbohydrate ; 1.0
used where students’ responses are likely to vary lipid ; 0.7
more than usual.
protein ; 0.9
AVP means ‘additional valid point’. This means  [3]
accept any additional points given by the student 17.5 cm 3
that are not in the mark scheme, provided they are d i RQ =
relevant. But accept only as many additional points 25 cm 3
as indicated by the bold semicolons, e.g. AVP ; ; = 0.7 ;  [2]
means award a maximum of 2 extra ii lipid ; [1]
marks.
e C6H12O6 + 6O2 → 6CO2 + 6H2O + energy ;
ORA means ‘or reverse argument’ and is used
when the same idea could be expressed in 6CO2
= 1.0 ;
the reverse way. For example: ‘activity 6H2 O  [2]
increases between pH2 and pH5 ORA’
means accept ‘activity decreases between pH5  [Total: 12]
and pH2’.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

2 1 air spaces ; b i increasing the concentration of

2 aerenchyma ; aluminium ions from 0 to 40 µmol
increases rate of fumarate production ;
3 roots ;
increases from 40 to 120 µmol have
4 oxygen ; little effect ; [2]
5 ethanol fermentation ; ii aluminium binds to enzyme / refer to
6 ethanol ; cofactor ;
7 ethanol dehydrogenase ;  [7] optimises shape of active site ; [2]
3 a provide hydrogen to reduce NAD and [Total: 7]
FAD ;
reduced carriers pass to electron transport
chain ;
provide energy for ATP synthesis in
oxidative phosphorylation ;
refer to chemiosmosis ; [max. 3]

PDF from sachtienganhhanoi.com

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 13
Self-assessment questions
1 The diagram should: of the envelope that contains the electron
transport chain, in the cristae.
• be large – preferably significantly larger
than the micrograph The membranes inside a chloroplast contain

PDF from sachtienganhhanoi.com

• be drawn with smooth, single lines photosynthetic pigments, which are not
present in a mitochondrion.
• show the envelope as two lines, close
together but not touching 3 Carotene is orange. It absorbs blue and green
light and reflects red and yellow light.
• not have any shading
• show the starch grain 4 Xanthophyll is yellow, so it does not absorb
yellow light. Yellow light has wavelengths in
• show other small spots the range 580−600 nm.
• show the membranes inside the
5 The composite line would show a broader
chloroplast
peak for the action spectrum than in
• have label lines drawn with a ruler, with Figure 13.7, with the high part of the line
the end touching the structure being extending further to the right. Similarities that
named the learners may identify include the peaks
at the lower end of the spectrum (within the
• include labels to envelope, lamellae,
wavelengths 425−475 nm and at the higher
thylakoid membranes, thylakoid spaces,
end (within the wavelengths 625−675 nm).
grana, stroma, ribosomes.
Differences include the peak for carotenoids
2 Both are surrounded by an envelope, just above 500 nm in the absorption spectrum,
contain small circles of DNA, contain small which does not show as a high peak in the
ribosomes, and have a system of membranes action spectrum – this could be because
that provide a large surface area. there is not as much carotenoid pigment
as chlorophyll in a plant, and so it has less
The background material of a chloroplast influence on the action spectrum.
is called the stroma. It contains the enzymes
and other substances required for the light- 6 In mitochondria, the energy for the
independent stages of photosynthesis. The production of ATP comes from oxidation
background material of a mitochondrion is reactions. In chloroplasts, the energy for the
called the matrix. It contains the enzymes and production of ATP comes from light.
other substances required for the Krebs cycle.
7 No, it is not correct. The carbon dioxide taken
The internal membranes of a chloroplast in by plants is not broken down to produce
form thylakoids, enclosing fluid-filled spaces. oxygen, but is incorporated into carbohydrates
Carriers are embedded in these membranes, within the plant. The oxygen that is released
forming the electron transport chain. In a comes from water, not carbon dioxide.
mitochondrion, it is the inner membrane

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

8 There are no correct answers to this question. d F

 rom D to E, carbon dioxide
Learners may suggest a variety of ways in concentration is the limiting factor;
which individuals could represent different increasing carbon dioxide concentration
compounds within the Calvin cycle and the increases rate – see the top line on the
reactions between them. graph.

9 TK e From A to F, the limiting factor is light;

you can tell this because increasing
10 Once all the TP has been used up, RuBP the light intensity increases the rate of
cannot be regenerated. photosynthesis.
11 In the light, the Calvin cycle can proceed f From F to G, either temperature or
normally, using reduced NADP and ATP carbon dioxide concentration could be the
from the light-dependent stages. In the dark, limiting factor.
no more reduced NADP or ATP is supplied.
RuBP can still combine with carbon dioxide 13 a light-dependent stage – this is the stage
and produce GP, but without reduced NADP that requires light energy to drive the
or ATP, this cannot be converted to TP. GP reactions
therefore builds up, and TP levels fall, as

PDF from sachtienganhhanoi.com

some of it is converted to other substances b light-independent stage – this stage uses
(including RuBP). Both level off quickly, the kinetic energy of molecules to drive
as only a small amount of RuBP can be its reactions
regenerated, after which the whole cycle stops. c light-independent stage – this stage
Once light is resupplied, the cycle can run requires carbon dioxide for the Calvin
normally again. cycle to run
12 a From A to B, the limiting factor is light;
you can tell this because increasing
the light intensity increases the rate of Reflection
photosynthesis. Learners are likely to identify the production
of ATP within both organelles and that ATP
b From B to C, temperature is the limiting
is produced using the electron transport chain,
factor; you can tell it is not light because
chemiosmosis and ATP synthase.
increasing light intensity has no effect;
increasing temperature does increase They may be able to state that energy is transferred
rate – see the line above. from sunlight to carbohydrates by photosynthesis
in cells that contain chlorophyll, and then from
c  rom A to D, the limiting factor is light;
F carbohydrates to ATP by respiration in all living
you can tell this because increasing cells; energy is then transferred from ATP to fuel
the light intensity increases the rate of life processes in all organisms.
photosynthesis.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 13
Exam-style questions
The mark schemes, suggested answers and 1 a allows chlorophyll and other pigments to
comments that appear here were written by the be arranged into photosystems ;
author(s). In examinations, the way marks would provides a large surface area for pigments ;
be awarded to answers like these may be different.

PDF from sachtienganhhanoi.com

increases efficiency of light harvesting ;
Notes about mark schemes allows electron carriers to be arranged
A or accept indicates an alternative acceptable appropriately ;
answer. provides structure for proton gradient for
R = reject. This indicates a possible answer that chemiosmosis ;
should be rejected. anchors ATP synthase ;  [max. 5]
; The bold semicolon indicates the award of b
1 mark.
/ This indicates an alternative answer for the same Structural feature Shared by chloroplast
mark. The alternatives may be separated from the and typical
rest of the answer by commas. prokaryotic cell
( ) Text in brackets is not required for the mark. circular DNA ✓
Underlining This is used to indicate essential DNA combined ✗
word(s) that must be used to get the mark. with structural
protein to form
AW means ‘alternative wording’. It is used to chromosomes
indicate that a different wording is acceptable
ribosomes about ✓
provided the essential meaning is the same, and is
18 nm in diameter
used where students’ responses are likely to vary
more than usual. complex arrange- ✗
ment of internal
AVP means ‘additional valid point’. This means membranes
accept any additional points given by the student
peptidoglycan ✗
that are not in the mark scheme, provided they
wall
are relevant. But accept only as many additional
points as indicated by the bold semicolons, e.g. size ranges over- ✓
AVP ; ; means award a maximum of 2 extra marks. lap
ORA means ‘or reverse argument’ and is used  [6]
when the same idea could be expressed in the  [Total: 11]
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept 2 a photolysis of water occurs in light ;
‘activity decreases between pH5 and pH2’. H+ released ;
max. This indicates the maximum number of accepted by DCPIP / methylene blue ;
marks that can be given. colourless when reduced ;

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

shows ‘reducing power’ of chloroplasts ; 5 a limiting factor: one factor, of many

 [max. 4] affecting a process, that is nearest its
b NADP ;  [1] lowest value and hence is rate-limiting ;[1]

 [Total: 5] b light intensity ;

light wavelength ;
3 a cyclic photophosphorylation:
concentration of carbon dioxide ;
electron emitted by chlorophyll of
photosystem I returns to chlorophyll by a temperature ;  [4]
series of carriers ; c shows that there are two sets of reactions
non-cyclic photophosphorylation: in photosynthesis ;
electron emitted by chlorophyll of a light-dependent photochemical stage ;
photosystem II does not return to a light-independent temperature-
that chlorophyll (but is absorbed by dependent stage ;
photosystem I and electron emitted by
photochemical reactions are not affected
photosystem I is absorbed by NADP) ;[2]
by temperature ;
b photophosphorylation:
at low light intensities, light intensity is

PDF from sachtienganhhanoi.com

synthesis of ATP using light energy in the rate-limiting factor ;
photosynthesis in a chloroplast ;
at high light intensities and low
oxidative phosphorylation: temperatures, temperature is the rate-
synthesis of ATP using energy limiting factor ; [max. 5]
released from the electron transport  [Total: 10]
chain in aerobic respiration in a
mitochondrion ; [2] 6 a absorption spectrum:
c NAD: a graph of the absorbance ;
hydrogen carrier in respiration ; of different wavelengths of light by a
compound ;
NADP:
action spectrum:
hydrogen carrier in photosynthesis ; [2]
a graph of the rate of a process ;
 [Total: 6]
e.g. photosynthesis at different
4 a and b wavelengths of light ; [4]
rubisco b number of bubbles shows rate of
CO2 (1C) photosynthesis ;
active here
rate similar at 450 nm (blue) and 650 nm
(red) ; these are wavelengths that are
absorbed by chlorophyll ;
rate, much lower / refer to figures, at
550 nm (green) ;
very little absorbed by any pigment ;
RuBP (5C)
 [max. 4]
GP/PGA (3C)
 [Total: 8]

triose phosphate (3C)

[Total: 5]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 14
Self-assessment questions
1 a The immediate surroundings of most cells 2 a Purines are nitrogenous bases that have
in the body is tissue fluid. Blood cells, two rings in their structure (pyrimidines
however, are surrounded by plasma. The have one). The purines adenine and
guanine are components of nucleotides in

PDF from sachtienganhhanoi.com

composition of tissue fluid is very similar
to that of blood plasma. See Chapter 8 for DNA and RNA. Adenine is the base in
more about tissue fluid. ATP (Figure 12.2).

b Cells function efficiently if they are kept b If carbon dioxide accumulates in the
in a constant environment. Maintaining body, it leads to acidosis and cells are
constant conditions, such as pH, damaged if the pH of the blood falls
temperature and water potential, ensures below its normal range. Some problems
that enzymes within cells may function at are: drowsiness, fatigue, confusion,
a constant rate. shortness of breath, headaches, sleepiness
and increase in heart rate. If ammonia
c Changes in external and internal factors, builds up in the body, it results in
such as temperature, are the stimuli an increase in pH in cytoplasm and
that are detected by receptors. Each interferes with metabolic processes such
homeostatic mechanism has a central as respiration and with receptors for cell
control. The hypothalamus is the signalling molecules in the brain. It also
central control for many homeostatic causes confusion, tiredness, and possibly
mechanisms. Coordination systems coma or death.
transfer information from receptors to
the central control and from the central 3 a glomerular capillaries via the efferent
control to effectors. Information is arteriole
transferred as nerve impulses travelling
along nerve cells and as hormones in b plasma proteins
the blood. Effectors are muscles and c Plasma proteins will increase the solute
glands that respond to information concentration of the blood plasma,
from the central control by changing the therefore lowering its water potential and
physiological factor. increasing the water potential gradient
d Input: sensory information from receptors between the filtrate and the blood.
about changes in physiological factors. d osmosis
This information goes to a control centre.

Output: corrective actions carried out

by effectors that return the physiological
factor to its normal value.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

4 a 80 cm3 The maximum concentration of urine is

determined by the relative width of the
working medulla compared with the cortex. Mammals
that have wide medullas have nephrons with
volume of filtrate entering the proximal
long loops of Henle. Mammals with narrow
tubules = 125 cm3 min−1
medullas have nephrons with short loops of
percentage of this volume entering loops Henle. The width of the medulla in human
of Henle = 64% kidneys allows us to concentrate our urine by
a maximum of four times the concentration of
64 blood plasma.
= × 25
100
= 80 cm3 6 a Flow rate is highest at the beginning
of the proximal convoluted tubule,
b A large percentage of the water in the where fluid is entering via filtration into
fluid is reabsorbed in the proximal Bowman’s capsule. As the fluid flows
convoluted tubule, thus the volume of along the proximal convoluted tubule, a
water in which the urea is dissolved large percentage of it is reabsorbed, thus
decreases. This increases the concentration decreasing its volume. There is thus less

PDF from sachtienganhhanoi.com

of urea in the fluid. fluid to flow, so less passes a given point
in a unit of time; in other words, its flow
c i Microvilli give the membrane rate decreases.
in contact with filtrate (luminal
membrane) a large surface area for This reabsorption continues all along
absorption of solutes and water. the nephron, which is why the flow rate
continues to drop. The rate of flow
ii There are many mitochondria to decreases rapidly in the CD, as a high
supply the ATP required by proteins proportion of water may be reabsorbed
in the basal membranes that pump from urine here. Remember that the fluid
sodium ions out of the cells. in the nephrons is filtrate, but by the time
iii The basal membranes are folded it reaches the CDs it is urine.
to give a large surface for the b i Glucose concentration decreases
many pump and carrier proteins rapidly to zero as the fluid passes
in the basal membranes that move through the proximal convoluted
substances out of the cells and into tubule, because all of it is reabsorbed
the blood. into the blood at this stage.
5 The discussion should centre on three aspects: ii 
Amino acids are also reabsorbed into
• The water potential of the tissue fluid in the blood in the proximal convoluted
the medulla of the kidney is low. tubule.
• The loops of Henle play a role in Glucose
 and amino acids are reabsorbed
producing tissue fluid with a high by secondary active transport.
concentration of solutes (mainly sodium
and chloride ions and urea). It is not iii Urea concentration increases because
necessary to explain how the loops of water is reabsorbed from nephrons
Henle maintain the high concentration of and CDs.
solutes in the tissue fluid of the medulla.
7 Water is an important component of
• The collecting ducts (CDs) are stimulated cytoplasm so needs to be absorbed from
by ADH to become permeable to water. the immediate surroundings of cells. In the
Water is reabsorbed by osmosis from the kidney, water is reabsorbed from the filtrate
urine into the surrounding tissue fluid and in the proximal convoluted tubules of the
then into the blood so it is conserved in the nephrons and from the urine in the CDs. The
body. It is necessary to explain how the cells phospholipid bilayer is not very permeable
lining the CDs become permeable to water to water, so water channels are required to
when stimulated by ADH. permit the movement of water into cells.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

8 a The normal water potential of the blood c 

The concentration of filtrate remains
is the set point; osmoreceptors compare constant at 300 mmol kg-1 along the length
the water potential of the blood that of the proximal convoluted tubule. This is
flows through the hypothalamus with the same concentration as blood plasma.
this set point. If the water potential is Although solutes, such as glucose, amino
less than the set point, then they secrete acids, ions and urea are reabsorbed, so is
ADH to stimulate the reabsorption of much water so the overall concentration
water from CDs in the kidney. This will does not change (Figure 14.14). The
help to restore the water potential of the volume of filtrate, however, decreases
blood to normal. The water potential of significantly because so much water is
the blood is an internal condition that is reabsorbed (see Figure 14.13).
kept near constant. Keeping physiological
conditions near constant is homeostasis. The concentration of urine in CDs
becomes slightly less concentrated if
b  here are many possible ways in which
T there is no ADH produced. Some urea
this flow diagram could be constructed. It is reabsorbed, but no water because the
should show the following: input (change epithelial cells of the CD are impermeable
in water potential of the blood) to to water as the luminal membranes

PDF from sachtienganhhanoi.com

receptors (osmoreceptor cells), resulting have no aquaporins in them. A dilute
in secretion of ADH from the posterior urine with a concentration of about
pituitary gland if water potential is lower 70 mmol kg-1 is produced.
than the set point, producing output
(change in rate of water reabsorption) When ADH is secreted, the concentration
by the effectors (cells of the CDs) and of urine in CDs becomes more
negative feedback to receptors. concentrated. ADH stimulates the
insertion of aquaporin molecules into
c 
If the plasma was too concentrated (had a the luminal membranes so water can be
lower water potential than the set point), absorbed by osmosis. By the end of the
water would diffuse out of the cells so CD the concentration of the urine is
causing them to decrease in volume. 1200 mmol kg-1, which is four times the
concentration of blood plasma.
If the plasma was too dilute (had a higher
water potential than the set point) water d i 
ADH is released by the posterior
would diffuse into the cells so causing pituitary gland into the blood. It
them to enlarge, putting pressure on the is transported in the blood to the
cell surface membranes. This might cause basal membranes of CD cells in the
cells to burst. Changes in cell volume kidney. ADH binds to receptors on
influence cell activities, for example the the membranes. ADH is a peptide
efficiency of intracellular enzymes in and water-soluble so cannot diffuse
catalysing reactions. through the phospholipid bilayers of
membranes.
9 a i L (accept B)
ii ADH stimulates the cells of the CD
ii D (and also the distal convoluted tubule
iii A (DCT)). ADH stimulates cells to
move these vesicles towards the cell
iv F surface membrane at the luminal
surface that faces the fluid. The
v H (also J) vesicles fuse with the membrane so
that aquaporins are in place. Water is
b The parallel arrangement of loops, CDs
reabsorbed from the urine as it flows
and surrounding capillaries maintains
through the DCTs and CDs down the
the high concentration of sodium (and
water potential gradient from urine
chloride) ions in the tissue fluid in the
to tissue fluid in the medulla.
medulla. The tissue fluid has a low water
potential, which is lower than the water
potential of the blood plasma.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

ADH is a peptide and is water- no point in them releasing glucose

soluble so cannot diffuse through the into the circulation.
phospholipid bilayer of cell surface
membranes. There are receptors on ii Insulin and glucagon are proteins
the surface of the target cells in the that cannot cross the cell surface
CD. The binding of ADH to these membranes of their target cells.
receptors activates a cell-signalling There needs to be another substance
pathway using the second messenger (a second messenger) to transfer their
cyclic AMP (cAMP) [or (c-AMP)]. message throughout the cytoplasm.
The final enzyme in the cascade iii Insulin and glucagon both have liver
phosphorylates the aquaporin cells as their target cells. If they had
molecules in the vesicles leading to the same second messenger, they
the movement of the vesicles towards would both have the same effect,
the luminal membranes of the cells. rather than having opposite effects on
10 The following structures are visible in the glycogen, for example.
electron micrograph: 13 The concentrations of insulin and glucagon
• mitochondria: aerobic respiration; in the blood are very low. The number of

PDF from sachtienganhhanoi.com

synthesis of ATP insulin or glucagon molecules that reach any
individual cell is very small. The production
• rough endoplasmic reticulum: protein
of a second messenger and activation of
synthesis
an enzyme cascade amplifies the signal
• nucleus: storage of genetic information; so that the response of the cell is rapid.
replication of DNA; transcription / This is required to decrease blood sugar
production of RNA concentration following the absorption of a
meal to prevent glucose being excreted and
11 a stimuli: changes in concentration of blood increase blood sugar concentration during
glucose above and below the set point fasting or during exercise to make sure that
it does not decrease below the critical level at
receptors: the α and β cells in the islets of

which brain function is impaired and a person
Langerhans in the pancreas
may go into a coma.

effectors: the cells that change the glucose
14 Specificity. Test strips contain the enzyme
concentration in the blood by absorbing it
glucose oxidase, which is specific to glucose
from the blood or by releasing it into the
and will not catalyse the oxidation of any
blood; liver cells and muscle cells respond
other reducing sugar. Benedict’s solution is
to insulin by absorbing glucose; liver cells
used to detect the presence of reducing sugars,
respond to glucagon by releasing glucose.
such as fructose and lactose, and will change
b The blood glucose concentration colour with any appropriate reducing agent.
fluctuates about a set point. In negative
15 a i glucose:
feedback, a change stimulates a response
that brings things back to normal. • non-diabetic: the concentration is
In the homeostatic control of blood always lower than in the diabetic
glucose an increase in the concentration and reaches a peak slightly earlier
stimulates mechanisms that reduce it
• non-diabetic: peak is at 150 mg
and a decrease in the concentration
100 cm-3; diabetic: peak is at
stimulates mechanisms that increase it.
220 mg 100 cm-3
These corrective actions restore the blood
glucose concentration to its set point. • non-diabetic: concentration
returns to normal / concentration
12 a The process is facilitated diffusion. at start after about 45 minutes;
diabetic: concentration does not
b i Muscle cells need their glycogen
return to concentration at start
stores to provide glucose for
even after 150 minutes
respiration during exercise; there is

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

insulin: thicker inner cell walls facing the stomatal

aperture
• non-diabetic: insulin
concentration increases • cell surface membrane
immediately; diabetic: no increase • nucleus (in at least one of the cells)
in insulin concentration
• cytoplasm
• non-diabetic: peak after about
• chloroplast(s)
25 minutes; diabetic no peak in
insulin concentration • mitochondria
• vacuole.
ii diabetic: β cells in the islets of
Langerhans do not respond to 18 a 
Suitable annotations for the drawing of
increase in glucose concentration so the guard cells are:
do not release insulin. Glucose is not
absorbed by liver, muscle and adipose • chloroplast and mitochondria provide
cells so remains in the blood, which energy for proton pumps
is why the concentration increases. • starch grains inside chloroplast are a
The concentration is greater than source of negatively charged malate

PDF from sachtienganhhanoi.com

the renal threshold so not all the ions for neutralising potassium ions
glucose that is filtered in the kidney • cell surface membranes have proton
is reabsorbed by proximal convoluted pumps for pumping out hydrogen
tubules. This explains the gradual ions to create a negative charge inside
decrease in glucose concentration as the cell surface
the glucose that is not reabsorbed is
lost in the urine. • cell surface membrane has channel
proteins for facilitated diffusion of

non-diabetic: insulin is secreted potassium, chloride and calcium ions
so glucose is absorbed by liver,
• thin cell wall for expansion of cell
muscle and adipose cells where it is
into adjacent epidermal cells
converted to glycogen. This explains
why the glucose concentration • cell walls have no plasmodesmata
decreases so rapidly. so that all exchanges of water and
ions occur across the cell surface
b i Insulin is a protein. Its molecules membrane through carrier and
would be hydrolysed to amino acids channel proteins by active transport
in the digestive system. and facilitated diffusion
ii People with diabetes may use test • waxy cuticle over outer walls and
strips to test their urine or use a ledges to reduce water loss from leaf
biosensor to monitor their blood when stomata are closed
glucose concentration.
• stomatal aperture allows diffusion of
16 Urine collects over several hours so the results gases between air in the intercellular
of a urine test only show that at some time spaces in the mesophyll and the
the glucose concentration was higher than atmosphere.
the renal threshold. Blood tests show the
b 
The flow chart diagram could show this
glucose concentration at the time of sampling.
sequence of stages:
Regular sampling using blood tests can show
whether the insulin that a diabetic is taking is  
1 ATPase pumps hydrogen ions out of
controlling blood glucose effectively. guard cells
17 The drawing should show: 2 
  decrease in concentration of
• two guard cells with the shapes as in hydrogen ions inside guard cell
Figure 14.34  
3 
inside the cell becomes negatively
• guard cells with thin outer cell wall on charged
side facing adjacent epidermal cells and
 
4 potassium ion channel proteins open

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

 
5 potassium ions diffuse into guard cells
Reflection
 
6 water potential of guard cells Cells that are described in this chapter and some
decreases of the specific features that should be included in
 
7 water enters guard cells by osmosis each diagram are:

 
8 volume of guard cells increases • liver cells:
many mitochondria, RER, ribosomes, nucleus
 
9 guard cells become turgid with nucleoli, glycogen granules
10 guard cells curve outwards to open • endothelial cells of capillaries in glomeruli:
stoma very thin cytoplasmic extensions with many
perforations, elongated nucleus, endocytotic
c At night, most plants close stomata vacuoles for transport across the endothelium
to reduce the rate of transpiration so
conserving water when there is no light • podocytes forming the inner lining of
energy for photosynthesis and so there is Bowman’s capsule:
no need to absorb carbon dioxide from long processes with slit pores between them
the air. • cuboidal epithelial cells of proximal

PDF from sachtienganhhanoi.com

convoluted tubules:
During the day when rates of
microvilli, folded basal membranes, many
transpiration are greater than rates of
mitochondria, RER, ribosomes, nucleus with
water absorption to conserve water and
nucleoli
reduce heat stress.
• cuboidal epithelial cells of CDs:
A plant is under water stress when the loss folded basal membranes, many vesicles with
of water by transpiration is greater than aquaporins, RER, ribosomes, nucleus with
the rate of water uptake. This is likely to nucleoli
happen on a hot, dry day with high wind
speed. The stomata may close during the
day to conserve water.

d Abscisic acid (ABA) is produced in times

of water stress. ABA binds with receptors
on the cell surface membrane that leads
to the inhibition of the proton pumps so
that hydrogen ions are not pumped out
of the guard cells. Channel proteins open
to allow negatively charged ions to leave
the cells followed by potassium ions. This
stimulates the closure of channel proteins
that allow potassium to enter the cells.
The concentration of calcium ions within
the cytoplasm increases and it may be that
they act as a second messenger for ABA.
The effect of these changes is that the
water potential increases within the guard
cells and water passes out by osmosis.
The cells become flaccid and close the
stomata.

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 14
Exam-style questions
The mark schemes, suggested answers and 1 a excretion:
comments that appear here were written by the removal of, nitrogenous waste / urea ;
author(s). In examinations, the way marks would
be awarded to answers like these may be different. (so) maintaining a low concentration of

PDF from sachtienganhhanoi.com

urea in the blood ;
Notes about mark schemes osmoregulation:
A or accept indicates an alternative acceptable removing excess water when the water

answer. potential of the blood (plasma) is too high ;
R = reject. This indicates a possible answer that 
reabsorbing water when the water potential
should be rejected. of the blood (plasma) is too low ;
; The bold semicolon indicates the award of 
(so) maintaining the water potential of
1 mark. the blood (plasma) at a near constant ;
/ This indicates an alternative answer for the same 
blood glucose control:
mark. The alternatives may be separated from the
reabsorption of all glucose in filtrate ;

rest of the answer by commas.
retains glucose in the blood / prevents loss
( ) Text in brackets is not required for the mark.
of glucose in urine ;
Underlining This is used to indicate essential
AVP ; e.g. reabsorption of amino
word(s) that must be used to get the mark.
acids so helping to maintain constant
AW means ‘alternative wording’. It is used to concentration in the blood
indicate that a different wording is acceptable
 [max. 3]
provided the essential meaning is the same, and is
used where students’ responses are likely to vary b i A distal convoluted tubule ;
more than usual. B Bowman’s capsule ;
AVP means ‘additional valid point’. This means C glomerulus / capillary ;
accept any additional points given by the student
that are not in the mark scheme, provided they D proximal convoluted tubule ;  [4]
are relevant. But accept only as many additional ii cortex ;
points as indicated by the bold semicolons, e.g. glomeruli / convoluted tubules, are
AVP ; ; means award a maximum of 2 extra marks. only found in the cortex ;  [2]
ORA means ‘or reverse argument’ and is iii
distance = 10 mm = 10 000 µm
used when the same idea could be expressed
in the reverse way. For example: ‘activity = 10 000 ;
180
increases between pH2 and pH5 ORA’ means actual distance = 56 µm ; [2]
accept ‘activity decreases between pH5 and pH2’.
 [Total: 11]
max. This indicates the maximum number of
marks that can be given.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

2 a i the volume of blood pumped out of membranes become permeable ;

the heart = 5.6 dm3 min–1 water moves by osmosis ;
the volume of blood that enters the down a water potential gradient ; A high
kidneys is 25% of this ; to low water potential
= 25 × 5.6 ; = 1.4 dm3 min–1 ; [2] water moves, out of collecting duct / into
100
ii 
the volume of filtrate blood / into medullary tissue / into tissue
formed = 125 cm3 min–1 fluid ;

the percentage of the blood that aquaporins in membrane of vesicles ; R

flows through the kidney that ‘water channels’
becomes filtrate movement / fusion, of vesicles ; R in
context of wall
= 125 × 100 ; = 8.93% ; [2]
1400 to produce a low concentration of urine:
iii 
the volume of filtrate produced
membranes become impermeable (to
in a day = 125 cm3 min–1 × 60 × 24
water) ;
= 180 dm3 ;
no aquaporins in luminal membranes ;
the volume of urine as a percentage

PDF from sachtienganhhanoi.com

of the volume of filtrate water remains in urine ;

= 1.5 × 100 = 0.83% ; [2]  [max. 5]

180  [Total: 19]
b i 
luminal membranes of proximal
3 a hypothalamus ; [1]
convoluted cells ;
b 1555 cm (or any answer within the range
3
many microvilli ;
1150–1160 cm3 or equivalent in dm3) ;  [1]

(on the left of TEM) microvilli
c water was absorbed into the blood (in
shown in longitudinal section ;
stomach / small intestine) ;

(on the right of TEM) microvilli
the water increases the water potential of
shown in cross section ;
the plasma ;

microvilli provide a large surface area
any effect of an increase in water
for reabsorption ;
potential of the plasma on, cells / tissues,

(large surface for) co-transporter e.g. water enters cells by osmosis /
proteins ; [max. 4] cells will swell / decreases efficiency of
ii 
mitochondria provide much, ATP / reactions inside cells / cells may burst ;
energy ; osmoreceptors detect increase in water
for active transport / AW ; potential ;
sodium-potassium pumps ; ADH not, secreted / released, ;
selective reabsorption of sodium ions / collecting ducts remain impermeable to water ;
sodium ions reabsorbed into the excess water lost in urine ;
blood ;
until water potential returns to set point ;
sodium ions pumped out of cells to A return to normal [max. 4]
create a concentration gradient from
d (after absorption of dilute salt solution)
the lumen into the cells ;
no change in water potential of blood
for absorption of, glucose / amino plasma ;
acids, through co-transporter
water and salt is not lost in the urine, so
proteins ;
must remain in the body ;
AVP ; e.g. secondary active transport

giving an increase in volume, of blood or
 [max. 4]
body fluids ;
c idea of change in permeability to water
body tolerates changes in blood volume,
due to ADH ;
but not its water potential ; [max. 2]
to produce a high concentration of urine:

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

e homeostasis is the maintenance of, (near) may already be a high concentration

constant internal conditions ; of insulin ;  [max. 3]
negative feedback: ii β cells secrete insulin ;
a deviation from the set point ; concentration of insulin increases
is detected by a receptor ; over first hour after taking the
glucose solution ;
a control centre instructs effector to carry
out a corrective action ; insulin concentration increases from
60 pmol dm–3 to 300 pmol dm–3 ;
to reverse the change / return factor to
set point ; α cells, do not secrete glucagon /
secrete very little glucagon ;
positive feedback:
glucagon concentration, remains
any (small) deviation in a factor leads to constant / decreases ;
an increase in the change (not a reversal) ;
 [max. 5] from 42 pmol dm–3 to 36 pmol dm–3 ;
 [max. 4]
 [Total: 13] iii insulin: stimulates / binds to,
4 a i D and G ; receptors on, liver / muscle / adipose,

PDF from sachtienganhhanoi.com

ii E and H ; cells ;
iii J; increase in uptake of glucose from
the blood ;
iv B, F, D and G ;
more glucose transporter molecules
v E and C ; [5] (GLUT4) insert into the cell surface
b 
glucose is needed inside muscle tissue to membrane of muscle cells (not liver
provide energy for muscle contraction ; cells) ;

the liver is the store of glucose for the body stimulation of (named) enzymes ;
 [1] e.g. glycogen synthase ;
c cells require a constant supply of glucose to increase conversion of glucose to
for respiration ; glycogen ;

some cells have no supply of glucose brings about a decrease in the blood
other than from the blood plasma ; glucose concentration ;  [max. 5]

e.g. red blood cells and neurones do not b i blood glucose concentration
store glycogen ; decreases (below 4 mmol dm–3) ;
glucose becomes available when a meal insulin concentration, remains
is absorbed and needs to be stored constant (at 60 pmol dm–3) / decreases
otherwise it is excreted ; (below 60 pmol dm–3) ;
between meals the concentration glucagon concentration increases
decreases and needs to be ‘topped (above 60 pmol dm–3) ;
up’ from stores of glycogen in the glucose concentration then increases
liver ; in response ; [4]
if a person’s blood glucose concentration ii membrane receptor activates G
falls below 60 mg 100 cm–3, they may enter protein ;
a coma ; [max. 4]
G protein activates adenylyl cyclase
 [Total: 10] (in membrane) that catalyses
5 a i glucose concentration may already conversion of ATP to cyclic AMP ;
be high ; cyclic AMP activates protein kinase
if person had eaten within 12 hours ; A by binding to it ;
effect of sudden increase would protein kinase A is the first enzyme in
not be seen / so there was a sudden an enzyme cascade
increase ;

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

protein kinase A activates c glucose concentration: 4.25 mmol dm–3 ;

i 
phosphorylase kinase ; insulin concentration: 25 pmol dm–3 ;
active phosphorylase kinase enzyme  [2]
activates glycogen phosphorylase ;
ii 
effects of high-sucrose diet on blood
glycogen phosphorylase catalyses the glucose concentration compared with
breakdown of glycogen to glucose ; high-starch diet:
glucose diffuses out of the (liver) cell concentration increased more rapidly
into the blood ; [max. 6] (after lunch, dinner and supper) ;
 [Total: 22] 
to a higher peak after three of the
6 a (near) constant glucose concentration is meals (not supper) ;
maintained ; 
any comparative data from the
glucose concentration is maintained graph, e.g. after dinner high-sucrose
within limits ; diet is 7.25 mmol dm–3, high starch is

e.g. 65–100 mg 100 cm–3 (3.6–5.8 mmol dm–3) ; 6.00 mmol dm–3 ;


concentration fluctuates above and below after the peaks, glucose concentration
decreased more rapidly ;

PDF from sachtienganhhanoi.com

a mean concentration ;

glucose concentration is regulated about 
decreased, to lower concentrations ;
a, set point / norm ; 
any comparative data from the

if concentration changes above and below graph, e.g. after lunch high-sucrose
the set point, corrective actions are taken diet is 3.75 mmol dm–3, high-starch is
to return it to normal ; 5.40 mmol dm–3 ;


any e.g. of a corrective action ; e.g. storage / 
decreased to concentrations below
breakdown, of glycogen in the liver ; the fasting values (after 0200) ;

 [max. 5] 
effects of high-sucrose diet on insulin
concentration compared with high-
b any three factors, e.g. starch diet:
age of the volunteers ; there is a higher peak after each of


sex of the volunteers / equal numbers of the meals ;
males and females ; any comparative data from the
body mass / body mass index ; graph, e.g. after dinner high-sucrose

no health problems / not diabetic / diet is 420 pmol dm–3, high starch is
not taking any medicines (that might 250 pmol dm–3 ;
influence response control of blood 
decreases more slowly after lunch
glucose concentration) ; and dinner ;
intake of fluids ; 
concentrations between meals are
total mass of food eaten ; lower ;


composition of the rest of the diet (the 
any comparative data from the graph,
non-carbohydrate part) ; e.g. after breakfast / just before lunch,
high-sucrose diet is 20 pmol dm–3, high
ambient conditions, e.g. temperature ; starch is 50 pmol dm–3 ;
levels of exercise undertaken by the concentrations during night-time fast
volunteers during the day ; are, the same / 50 pmol dm–3 ; [max. 6]
AVP ; ; ; [max. 3]

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

iii sucrose is a disaccharide, starch is a 7 a biosensor:

polysaccharide ; a device that uses a biological material


starch is likely to be in foods that such as an enzyme ;
take longer to digest / sucrose is to measure the concentration of a
digested more quickly ; chemical compound ;  [2]
in sucrose there is only one glycosidic b glucose oxidase ;
bond to break to release glucose
(instead of many in starch) ; immobilised ;

faster rate of absorption of glucose hydrogen peroxide ;
from digestion of sucrose into the electric ;
blood stream ; proportional ;

sucrose digestion releases as much insulin ; [6]
fructose as glucose (sucrose molecule
is glucose + fructose) ;  [Total: 8]
fructose may be converted into 8 a increases ; [1]
glucose to give the higher peaks ; b i concentration of protons in the

PDF from sachtienganhhanoi.com


this results in faster release of insulin stroma decreases (as enter grana) ;
into the blood (rather than slower shifts equilibrium to the right ;  [2]
release over a longer period of time) ;
ii increases diffusion into the
 [max. 6]
chloroplast ;
d the graph should have the same horizontal axis
as concentration of ABA–H
with the same times (0800 to 0800)
decreases ;
no information given for the values for glucagon
so maintaining a concentration
concentration so vertical axis is a line with an
gradient into the chloroplast ;
arrowhead
 [max. 2]
glucagon concentration decreases, during
c ABA stimulates closure of stomata ;
meals / when insulin is high ;
less water vapour is lost ;  [2]
increases between meals ;
 [Total: 7]
remains high during overnight fast from
around midnight onwards ; [3]
 [Total: 25]

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 15
Self-assessment questions
1 a 
Make an outline sketch of the body and 2 The table should have the following
draw in the organs. It’s a good idea to headings:
indicate the head, thorax and abdomen on
• Hormone

PDF from sachtienganhhanoi.com

your sketch before drawing in the position
of the organs. Note that the pituitary • Endocrine gland that is site of
gland is just below the hypothalamus. secretion (production and release into
You can put annotations on your the blood)
drawing to summarise information from • Target cells / tissues / organs
Chapters 4 and 14 about cell signalling
and the endocrine system that you • Responses of cells to the hormone
should know. • Effects of the hormone on the whole
b 
Glucagon and ADH have different body
molecular structures. They have different 3
shapes and fit into different cell surface
receptor proteins. There are no receptors Feature Motor neurone Sensory neurone
for ADH on liver cells therefore ADH
position of at one end of part way along
can have no effect on these cells. (There
cell body the cell the axon
are glucagon receptors on kidney cells
although these cells do not respond by location of grey matter dorsal root
releasing glucose.) cell body of CNS ganglion / near
receptor
c 
The cell surface membrane is a bilayer of direction of CNS to effector receptor to CNS
phospholipids. Steroids are fat-soluble impulses
so they can dissolve in these lipids and
so pass through. Hormones that cannot function stimulates transmits
pass through the cell surface membrane smooth muscle information
are peptides (ADH and glucagon), to contract and about internal
proteins (insulin), amino acid derivatives some glands or external
(adrenaline) and glycoproteins (anterior to secrete environment
pituitary hormones). These hormones (e.g. adrenaline to CNS
are water-soluble and cannot pass from adrenal
through the phospholipid bilayer. glands)

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

4 A good model needs to show the structure ii 

Annotations for the rising phase of the
of the myelin sheath as the concentric action potential could be:
arrangement of the Schwann cells rather
• Voltage-gated sodium ion channel
like a roll of paper towels wrapped around
proteins in the membrane open.
a cardboard tube. Small gaps should be left
between the Schwann cells to represent the • Sodium ions diffuse into the
nodes of Ranvier. The model can be made to axon down their electrochemical
scale if the width of the nodes and diameters gradient.
of axons and Schwann cells are researched. • The potential difference across
5 An alternative to the pathway shown in the axon membrane changes and
Figure 15.8 is for one neurone to connect a becomes less negative.
receptor directly to an effector. Because there • There is a positive feedback
are three neurones in the pathway, impulses at this time as depolarisation
can travel via other neurones in the CNS to stimulates more and more
other effectors and also go to the brain where voltage-gated sodium ion channel
more complex behaviour is controlled. proteins to open.
6 a 
Resting potentials vary between – 60 mV • The threshold potential is

PDF from sachtienganhhanoi.com

and –70 mV, so the line could be drawn reached and so more voltage-
anywhere between these two figures. gated sodium ion channel
proteins open.
b 
The inside of the axon has a charge
of –70 mV compared with the outside. • The membrane potential reaches
+30 mV.
c 
When at rest, the membrane is
impermeable to sodium ions as there are e Annotations could be:
no channel proteins that are open to let • Between 1 ms and 2 ms, the axon is
them in or out. There are a small number repolarised.
of channel proteins for potassium ions,
but because the inside of the membrane • The voltage-gated sodium ion channel
is negatively charged they do not proteins close (and cannot open for a
diffuse out. short time).
• Voltage-gated potassium ion protein
Active transport by sodium−potassium channels open.
pumps in the membrane of the axon.
Three sodium ions are pumped out for • Potassium ions diffuse out down their
every two potassium ions pumped in, so concentration gradient to restore the
this builds up a positive charge outside resting potential.
compared with inside.
f about 4 ms
There are also many negatively charged
organic compounds (e.g. proteins) inside g i 
The refractory period is the period
the axon that contribute to the resting of time after the axon membrane
potential. has been stimulated and an action
potential begun until the membrane
d i It is called depolarisation because the can be stimulated again. You can
axon was polarised so that it had a show it on the graph between the
negative charge inside and a positive time when the potential difference
charge outside. Now this is altered reaches –50 mV (the threshold for an
and there is a negative charge outside action potential) and the time when
and a positive charge inside. the resting potential is restored.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

ii The refractory period: b I ncreasing the strength of the stimulus

produces an increasing receptor
• allows repolarisation
potential. At a low strength, a small
• allows a gap between one action increase results in a relatively large
potential and the next. increase in receptor potential. At higher
strengths, the increase in receptor
h There is sufficient energy in the potential is less. (The functional
electrochemical gradient for sodium ions significance of this pattern, which is found
and potassium ions to continue diffusing in most receptors, could be discussed;
in and out of the membrane. It is not it results in a relatively high level of
necessary for the sodium−potassium sensitivity to low-level stimuli as long as
pump to work to restore the resting they are above the critical threshold.)
potential after each action potential.
The electrochemical gradients are like c 
The greater the strength of the stimulus
a battery that is gradually ‘running applied, the greater the frequency of
down’. The sodium−potassium pumps action potentials generated.
continually ‘recharge’ this battery.
d The length of the refractory period (see
7 Unmyelinated neurones transmit impulses Section 15.2, Nervous communication).

PDF from sachtienganhhanoi.com

at slower speeds than myelinated neurones.
Unmyelinated neurones transmit information e Receptors can adjust to a constant
that does not require a fast response. For strength of stimulus and reduce the
example, many of these neurones are frequency with which they send impulses
concerned with aspects of homeostasis. to the CNS. This saves energy in ion
pumping that results from sending
Giant axons transmit impulses very fast and many impulses along a sensory neurone.
are used for coordinating escape reflexes, Changing the threshold potential gives
for example retreating into a burrow when a the CNS information about changes in
predator approaches. environmental and internal stimuli.
8 a i 
A receptor potential is an electrical 9 a Exocytosis
potential generated in a receptor
such as a chemoreceptor. It is often b  cetylcholinesterase catalyses the
A
produced by the inflow of sodium hydrolysis of ACh so it does not remain in
ions through channel proteins. the synaptic cleft continuously stimulating
This causes a depolarisation of the postsynaptic neurone. If molecules of
the receptor to give a less negative ACh remained in synaptic gaps, muscle
potential inside the cell. It does not cells would be continuously stimulated
necessarily result in information to contract – a condition known as
being sent along a sensory neurone tetany.
(c in Figure 15.20).
10 a At the synapse, vesicles of transmitter
ii The threshold receptor potential substance are only present in the
is the smallest receptor potential presynaptic neurone, not in the
at which an action potential is postsynaptic neurone. Ligand-gated
generated (between c and b in receptors for neurotransmitters are
Figure 15.20). only on the postsynaptic neurone
(see Figure 15.23).
iii Neurones either send impulses
or they do not. For example, no b  epeated action potentials may cause the
R
impulses are sent by a sensory release of neurotransmitter substance
neurone if the receptor potential is into the cleft at a greater rate than it can
below threshold. (c in Figure 15.20). be replaced in the presynaptic neurone.
Neurones do not have graded Effectively, the neurone has no more
impulses with action potentials neurotransmitter substance until enough
of different sizes. All the action is resynthesised.
potentials in Figure 15.20 have the
same amplitude.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

11 This is an example of a table to compare coordination by the nervous system with coordination by the
endocrine system:

Feature Nervous system Endocrine system

structures nerves containing sensory and motor ductless glands containing secretory cells
neurones that produce and release hormones
use of energy energy expensive, e.g. sodium / energy cheap as small quantities are
potassium pumps in neurones use a produced and transport in the blood
great deal of energy
form of electrical impulses hormones (chemicals)
information
pathway to along neurones in the blood
target tissues
speed of fast slow
information
transfer

PDF from sachtienganhhanoi.com

duration of short-lived, e.g. muscle contracts for a usually slow and longer lasting (some are
effects short time rapid, e.g. response to adrenaline)
target area localised – only the area immediately at whole tissue or organ; some hormones
the end of a neurone affect the whole body
response muscle contraction or secretion by many different responses,
glands e.g. glycogenesis, protein synthesis, rate
of respiration, growth, absorption of
water in kidneys

12 a 
Striated muscle. Striations can be seen 4 Round up or round down to the
clearly across the muscle fibres. nearest whole number.

b and c 13 a 
The detail of the thick and thin filaments
in the sarcomeres is below the resolution
A band
Z line
of the light microscope. The diameter of
I band the thin filament is 5 nm and the diameter
⎫
⎬
⎭

H band of the thick filament is 15 nm. The

maximum resolution of the LM is 200 nm
(see Chapter 1).

b A – Z line, B – thick filament,

i 
C – thin filament
thick filament thin filament
D – H band, E – A band, F – I band
ii 
d Follow these steps. c 
The region of overlap between thick and
1 On the diagram, measure the length thin filaments in the A band.
of the sarcomere (Z line to Z line) in d 
A simple model should show how the
millimetres. movement of the thin filaments closer
2 Multiply this by 1000 to give the together shortens the sarcomere. It should
distance in micrometres. be possible to use the model to show what
happens to the Z line, A band, I band and
3 To calculate the magnification, H band during a contraction.
divide this distance in micrometres
by 2.25. A more complex model should show how
the movement of the myosin heads causes
the movement of the thin filaments.

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK


An explanation could be similar to this: • sarcolemma is postsynaptic membrane at
neuromuscular junctions
The thick and thin filaments do not
extend across the whole sarcomere. • sarcolemma is folded to give a large
When a muscle contracts, myosin heads surface area; postsynaptic neuronal
make contact with thin filaments and membranes are not folded
then tilt towards the centre of the • at the neuromuscular junction an action
sarcomere. This power stroke moves the potential passes along the sarcolemma
thin filaments closer together so that and down T-tubules; nothing equivalent
there is more overlap between thick and happens in an interneuronal synapse
thin filaments (H band gets smaller). (action potentials do not travel across the
This decreases the distance between cell bodies of neurones).
the Z lines so the overall length of the
sarcomere decreases. 15 Lactate fermentation occurs in muscle tissue
when there is not enough oxygen supplied
The combined effect of all the sarcomeres by the blood for aerobic respiration. The
shortening in the myofibrils shortens the breakdown of glucose to pyruvate provides
muscle fibre. ATP but is not very energy efficient. Look at

PDF from sachtienganhhanoi.com

Chapter 12 (Section 12.4, Respiration without
The answer to d can be helped with two
oxygen) to remind yourself about lactate
simple diagrams each showing one thick
fermentation. Reduced NAD is produced
filament and two thin filaments on either
during glycolysis and when the muscle tissue
side with two Z lines. One diagram shows
is respiring aerobically these molecules are
the sarcomere at rest with an H band.
oxidised and therefore recycled to be reused.
The second shows the sarcomere fully
When oxygen is not present, hydrogens from
contracted with no H band.
reduced NAD are passed to pyruvate so that
14 Similarities: NAD is recycled.

• arrival of an impulse at the end of the 16 This task requires you to do two things:
presynaptic neurone stimulates the
• choose a strategy to use to make up a
opening of voltage-gated calcium ion
number of different concentrations of a
channels and the entry of calcium ions
solution
into the synaptic bulb
• use standard form to express the very low
• calcium ions stimulate the movement of
concentrations of ABA required.
vesicles to the presynaptic membrane
The solution you are given is known as a stock
• neurotransmitter is released by exocytosis
solution. In this case, the stock solution of abscisic
• neurotransmitter substances are released acid (ABA) has a concentration of 1.0 millimole
to transmit impulses across a gap per dm3 (1.0 mmol dm–3). In standard form this is
written as 1.0 × 10–3 mol dm–3.
• neurotransmitter substances bind to
receptor proteins on the postsynaptic You are told that stomatal closure has been
membrane observed when a solution of ABA with a
concentration of 5.0 µmol dm–3 was sprayed on
• ligand-gated sodium ion channels open
the leaves of Arabidopsis thaliana. Call this the
to allow sodium ions to diffuse through
reported concentration. In standard form, this is a
the postsynaptic membrane (membrane
concentration of 5.0 × 10–6 mol dm–3.
of dendrite of neurone or sarcolemma of
muscle fibre) to cause depolarisation. The first decision to make is the range of
concentrations that should be used. What is the
Differences:
lowest concentration and what is the highest
• interneuronal synapses release a range concentration that should be used? The reported
of transmitter substances, including concentration should be included in the range,
acetylcholine, GABA and dopamine; but it should go lower than this and also it should
acetylcholine is the usual neurotransmitter go higher. Higher concentrations should be used
at neuromuscular junctions

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

to confirm the reported result. This will test the • plants may be able to respond
validity of the reported result. quickly to infection to prevent it
spreading.
The second decision to make is how many
concentrations to use within the range. You ii If two hairs are stimulated within
are recommended to use at least five different 20–35 seconds, the trap closes. If the
values of the independent variable (see second stimulus comes after
Chapter P1) so you should have at least five 35 seconds, the trap does not close.
different concentrations of ABA, but in a plan The trap does not half-close. Either it
you could always use more, for example ten. closes or it doesn’t.
The third decision when making up solutions is
iii 
Venus fly traps grow in soils that are
whether you should use simple (proportional)
deficient in nitrate ions. Insects are
dilution or serial dilution – see Figure P1.2.
rich in protein. By digesting protein
A serial dilution will give you a very wide range
to amino acids, Venus fly traps gain a
and will be useful for making the reported
good source of nitrogen compounds
concentration (5.0 × 10–6 mol dm–3) from the stock
to supplement what little nitrate they
solution. You can do this by using a ×10 serial
can absorb from the soil. Nitrate is
dilution to make a solution with a concentration
used for synthesis of amino acids. By

PDF from sachtienganhhanoi.com

of 1.0 × 10–5 mol dm–3. This is equivalent to
digesting insects these plants gain a
10.0 µmol dm–3. This solution can then be halved
‘ready-made’ source of amino acids.
to give 5.0 × 10–6 mol dm–3.
The range of solutions could be prepared by b Auxin stimulates ATP-ase proton pumps
proportional dilution from the 10.0 µmol dm–3 in the cell surface membrane to pump
solution. However, it is a good idea to use protons (hydrogen ions) out of a cell
a pilot investigation with a limited range of into the cell wall. This acidifies the cell
concentrations first and then use between wall. Proteins in the cell wall known as
five and ten concentrations in the main expansins loosen the connections between
investigation. cellulose microfibrils and the surrounding
substances (hemicelluloses) in the cell
You could complete your plan by deciding how wall. The hydrostatic pressure of the cell
to treat the leaves of Arabidopsis thaliana with pushes the microfibrils apart so the wall
the different solutions and how you will collect, stretches and the cell elongates.
analyse and present your results. You could sketch
a graph to show the results you expect. Look at
Figure 14.32 to help you decide how to collect
results.
Reflection
The notes could be set out under these headings:
17 a i Some advantages:
• Use of nerve impulses that travel long
• close stomata to conserve water distances very fast
when it is hot and dry
• Use of action potentials in plants
• open stomata when the carbon
• Use of hormones that travel long distances in
dioxide concentration in the leaf
the blood
decreases so more carbon dioxide
can diffuse in from outside for • Use of neurotransmitters for short distances
photosynthesis – at synapses between neurones and at
neuromuscular junctions
• the Venus fly trap can catch
insects as a source of nitrogen in • Use of cell-signalling compounds over
the form of amino acids digested short distances, for example cytokines in the
from proteins immune system
• the sensitive plant, Mimosa, can • Use of plant growth substances for controlling
remove its leaves from danger elongation growth, germination, stem
elongation and stomatal closure.

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 15
Exam-style questions
The mark schemes, suggested answers and 1 a i peptides and polypeptides are, water-
comments that appear here were written by the soluble/not lipid-soluble ;
author(s). In examinations, the way marks would cannot, diffuse/pass, through the
be awarded to answers like these may be different. phospholipid bilayer ;

PDF from sachtienganhhanoi.com

Notes about mark schemes therefore receptors on the cell
surface must be specific for each
A or accept indicates an alternative acceptable
hormone − they must have a shape
answer.
complementary to the hormone
R = reject. This indicates a possible answer that
 [2]
should be rejected.
ii 
ADH – epithelial cells lining
; The bold semicolon indicates the award of 1 mark.
collecting ducts in the kidneys ;
/ This indicates an alternative answer for the same

insulin – liver cells and, muscle cells /
mark. The alternatives may be separated from the
adipose cells ;
rest of the answer by commas.

glucagon – liver cells ; R muscle cells
( ) Text in brackets is not required for the mark.
[3]
Underlining This is used to indicate essential
b i glycogen synthase becomes more
word(s) that must be used to get the mark.
active, glycogen phosphorylase
AW means ‘alternative wording’. It is used to becomes less active ;
indicate that a different wording is acceptable
accurate data quote for at least one
provided the essential meaning is the same, and is
of the enzyme ;[2]
used where students’ responses are likely to vary
more than usual. ii increases until 8 minutes and then
remains constant (at 3.5 au) ;[1]
AVP means ‘additional valid point’. This means
accept any additional points given by the student c more glucose in the blood / incease in
that are not in the mark scheme, provided they blood glucose concentration ;
are relevant. But accept only as many additional glycogen synthase becomes active to store,
points as indicated by the bold semicolons, e.g. glucose / glycogen ;
AVP ; ; means award a maximum of 2 extra marks.
insulin ;
ORA means ‘or reverse argument’ and is used
from, pancreas / islets of Langerhans ;
when the same idea could be expressed in the
reverse way. For example: ‘activity increases stimulates, uptake / storage of glucose ;
between pH2 and pH 5 ORA’ means accept inhibits break down of glucose ;
‘activity decreases between pH 5 and pH 2’.
idea that glycogen phosphorylase
max. This indicates the maximum number of becomes less active as no need to /
marks that can be given. break down glycogen ;

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

ref to normal concentration of glucose in c 

current flow from the node to the left of
the blood / homeostatic mechanism ; the one in the drawing depolarises the
 [max. 4] axon membrane at A ;
d possible suggestions may include: 
some voltage-gated sodium ion channel
phosphorylated (as part of enzyme proteins open ;
cascade) to activate ; 
sodium ions diffuse into axon (down
dephosphorylated to inactivate ; electrochemical gradient) ;

also allosteric / non-competitive inhibitors ;

 
membrane potential becomes more
positive on the inside ;

bind to part of the enzyme other than the
active site ; 
depolarisation reaches threshold potential ;

idea that enzyme changes in shape so 

more voltage-gated sodium ion channel
active site cannot function ; proteins open and sodium ions diffuse into
the axon ; A ref to positive feedback in
also broken down by (protease) enzyme ; context of sodium channel proteins opening ;
 [max. 2]

potential difference reaches +40 mV ;
e 
two homeostatic mechanisms that are

voltage-gated sodium ion channel

PDF from sachtienganhhanoi.com

controlled by hormones are osmoregulation
and blood glucose concentration proteins close ;

large number of target cells in, liver /

 
voltage-gated potassium ion channel
kidney / collecting ducts ; proteins open ;


idea that blood passes close to all cells in 
potassium ions diffuse out to restore the
the body, so hormones can be distributed resting potential ;
everywhere ;  [max. 5]

there would have to be many neurones  [Total: 11]
throughout the effector organs if the 3 a ref to, receptor / generator, potential ;
nervous system was used ;

pressure / stimulus, causes deformation /

transport in the blood is more energy AW (of Pacinian corpuscle) ;
efficient than using nerve impulses ;

increased permeability to sodium ions /

responses, do not have to be fast / can be channel proteins for sodium ions open ;
slow ;

sodium (ions) move into, receptor / axon ;
AVP ; [max. 3]

causes depolarisation / AW (e.g. potential
 [Total: 17] difference changes from – ve to +ve) ;
2 a i node of Ranvier ; [1]  [max. 4]
ii Schwann cell ; [1] b 
no action potential recorded with low
b 
myelin insulates axons so that ion flow and medium pressure / action potential
during action potentials only occurs at recorded only with heavy pressure ;
nodes ; 
(no action potential at B because)
myelin prevents tissue fluid reaching the depolarisation of, receptor / unmyelinated
axon membrane ; part of axon, did not reach threshold ;


current flow along the neurone depolarises 
threshold is between medium and heavy
the axon membrane only at nodes ; pressure ;


transmission of impulses is fast(-er than 
threshold is between –40 mV and –30 mV ;
along neurones that are not myelinated) ; 
more depolarisation at heavy pressure

saltatory transmission ; because more sodium ion channel
proteins open ;

impulses appear to jump from node to node ;

sensory neurone either conducts impulses

up to 100 m s–1 / speed in non-myelinated or it does not / ref to all-or-none principle ;
neurones about 0.5 m s–1 ;  [max. 4]
 [max. 4]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c 
myelinated neurones transmit impulses e.g. ref to a reflex arc in which Pacinian
much faster than unmyelinated neurones ; corpuscle provides the sensory input ;
any suitable figures ; e.g. up to 100 m s–1 for  [max. 3]
myelinated and 0.5 m s–1 for unmyelinated ;  [Total: 11]
stimulation of Pacinian corpuscle might 4 a action potential arrives at end of
indicate damage to the skin ; presynaptic neurone ;
may need to remove the part of the body voltage-gated calcium ion channel
from danger very quickly ; proteins open ;
AVP ;


Effect on transmission
Compound Explanation
across synapse
curare no transmission ; ACh cannot bind to receptors on postsynaptic
membrane ;
eserine continuous transmission by eserine inhibits acetylcholinesterase, so ACh
acetylcholine ; remains in synapse stimulating receptors ;

PDF from sachtienganhhanoi.com

methylmercury no transmission ; ACh cannot be recycled so vesicles run out of it ;
nicotine transmission even if no sodium ions enter the post-synaptic neurone so
acetylcholine ; depolarisation occurs ;

 [8]

calcium ions diffuse into presynaptic longer, reducing the effect of curare
terminal ; as a competitive inhibitor ;

calcium ions stimulate vesicles to move to this effect of eserine is similar to the
membrane ; action of competitive inhibitors of
vesicles fuse with membrane / exocytosis, enzymes (see Chapter 3)
to release, acetylcholine / ACh ;  [3]
(named) neurotransmitter diffuses across  [Total: 17]
(synaptic) cleft ; 5 a i K A band ;
binds with receptor on postsynaptic L I band ;
membrane ;
M Z, line / disc ; [3]
stimulates opening of ligand-gated
sodium ion channel proteins ; ii 5;

sodium ions flow in through postsynaptic the myofibrils are separated from
membrane / depolarisation of each other by, mitochondria /
postsynaptic membrane ;  [max. 6] sarcoplasmic reticulum ;[2]

b i 
The answers to this question are b i 
glycogen granules are broken down
presented in the table above. to provide glucose for respiration ;

ii 
curare competes with acetylcholine mitochondria, carry out aerobic
for receptor sites on the postsynaptic respiration / provide (much) ATP
neurones ; (for muscle contraction) ;[2]

if curare fills these sites, any ACh ii there is a very wide I band ;
released from presynaptic neurones in the I band there is no overlap
will have little effect ; between thick and thin filaments ;
any ACh will be broken down by in contracted muscle the thin
acetylcholinesterase ; filaments would be closer together
if the enzyme is inhibited by eserine, giving a thin I band ;[3]
Ach remains in the synaptic cleft for

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c distance on the electron micrograph thin filaments slide past thick

magnification filaments to give, less overlap between
distance = 43 mm (accept 44 mm) them / wider I band ;

= 43 000 µm e.g. when the biceps muscle is

contracted and shortened, it can be
43 000 ; pulled back into its longer state by
16 000 contraction of the triceps muscle
= 2.7 µm ; [2]  [max. 2]
 [Total: 12]  [Total: 14]
6 a P − myosin / thick, filament ; 7 a 
the diagram shows (TS) of, sarcomere /
Q − actin / thin, filament ; thick and thin filaments ;
R − Z, line / disc ;[3] X shows, actin / thin, filaments, alone ;
(see diagram)
b the muscle is relaxed ;
Z is overlap between thick and thin
the troponin and tropomyosin molecules
filaments ; (see diagram)
are covering the myosin-binding sites on
the, actin / thin, filaments ; Y shows, myosin / thick, filaments alone ;

PDF from sachtienganhhanoi.com

(see diagram)
myosin cannot bind to actin to form
cross-bridges ; [max. 2] X is I band ;
c diagram C ; Z is (overlap region of) A band ;
greatest overlap between thick and thin Y is H band ;
filaments ; Each thick filament is surrounded by six thin
maximum number of cross-bridges can filaments. The thick filaments form cross-
form between thick and thin filaments ; bridges with all of them.
greatest force applied by movement of X Z Y
myosin heads ;
in the state shown in diagram D many
myosin heads are not making contact
with the thin filaments ; [max. 4]
d the sarcomere cannot shorten any more,
thick filament thin filament
without crumpling the thick and thin
filaments ;  [max. 4]
the thin filament cannot move any closer b 
if contracted muscle, then, no / little,
together / thick filament has reached the I band and H band ;
Z disc ; [max. 1] 
so there would be no section like X and
e i myosin heads can only move the thin no section like Y ;
filaments in one direction (during the when fully contracted the ends of the
power stroke) ; thick filaments reach the Z discs ;[3]
they are arranged so that when they c role of calcium ions at the end of a motor
do this they pull on the thin filaments neurone to max. 3
in such a way that the sarcomere is
shortened ; at, neuromuscular junction / motor end
plate ;
they cannot pull (or push) the thin
filaments in the other direction ; voltage-gated channel proteins for
calcium ions open when impulse arrives ;
 [max. 2]
calcium ions enter, axon terminal / AW,
ii most skeletal muscles are arranged in when action potential arrives ;
antagonistic pairs ;
contraction of an antagonist pulls on
the muscle so sarcomeres lengthen ;

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

stimulates vesicles to, move towards / fuse 

with an IAA concentration of
with, presynaptic membrane ; 1.0 μmol dm–3 no more expansins are
role of calcium ions in muscle to max. 3 released into the cell walls ;

impulse / action potential, in, sarcolemma / maximum concentration of IAA to have

T-tubules, stimulates release of calcium an effect on expansin release is between
ions from sarcoplasmic reticulum ; 0.1 μmol dm–3 and 1.0 μmol dm–3 ;

calcium ions bind to troponin ; AVP ; [max. 3]

stimulates movement of tropomyosin ;  [Total: 8]

myosin binding sites on thin filaments 9 The following points could be included in a
exposed ; strategy to investigate the effect of different
concentrations on the production of amylase in
cross-bridges form ; barley grains:

when no action potential calcium ions are independent variable = concentration of
pumped back into sarcoplasmic reticulum ; gibberellin ;
 [max. 6]
dependent variable is some measure of
 [Total: 13] amylase activity ;

PDF from sachtienganhhanoi.com

8 a the sections of shoot could be floated method of determining activity of amylase ;
on water and kept in exactly the same either disappearance of starch from barley
conditions as the other groups ;[1] grains or production of maltose (a reducing
b 
the initial lengths of the sections were sugar)
not the same ;[1] disappearance of starch could be followed
c 
greater mean percentage increase in over time by using iodine in potassium iodide
length with increase in concentration of solution ;
IAA (0.01 μmol dm–3 to 1.0 μmol dm–3) production of maltose over time could be
after 18 hours ; followed by using Benedict’s solution ;
most of the increase in length with IAA choice of a suitable range of gibberellin
occurs in the first four hours ; concentrations – could be 0 to 100 μmol dm–3 ;
increase in length with solutions choice of method for making solutions from a
0.1 μmol dm–3 and 1.0 μmol dm–3 is the stock solution ; either using serial dilution or
same after four hours ; using proportional (simple) dilution

greater increase in length in shoots in number of values of the independent variable
1.0 μmol dm–3 IAA than in the more dilute should be five or more ;
solutions between 4 and 18 hours ;
barley grains should be divided into groups
any comparative data quote, e.g. with and soaked in the different concentrations ;
1.0 μmol dm–3 there is a 33% increase after
4 hours, but at 18 hours the percentage after a known time the grains should be put in
increase is 50% − a change of 17% ; a pestle and mortar or blender and ground up ;
 [max. 3] the grains are then tested with iodine solution
d 
there may be a limit to the expansion that or Benedict’s solution and the relative
can occur in these sections ; quantities of starch or maltose in each group
can be determined by using colorimetry ;

the sections are cut from the shoots and (see Practical Activity P1.1 in Chapter P1 for
there are unlikely to be any new cells details of how to do this)
being produced by mitosis ;
 [max. 8]
IAA stimulates the release of expansins
into the cell walls ;  [Total: 8]


so in each case it is the expansins that
allow the cells to expand ;

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 16
Self-assessment questions
1 The chromosomes are arranged in order 6 Mitosis Meiosis
of size.
number of division 1 2
2 prophase; because this is when the cycles

PDF from sachtienganhhanoi.com

chromosomes appear as two chromatids number of daughter 2 4
joined by a centromere cells
3 during the growth of the zygote to an adult number of 8 4
chromosomes per
4 a prophase I (in fact, they pair before this, nucleus in daughter
during interphase but are seen for the first cells
time during prophase)
7 parental blood × blood
b prophase I
phenotypes group AB group AB
c anaphase I
parental IAIB IAIB
d anaphase II genotypes
parental IA or IB IA or IB
e telophase I gametes
5 Meiosis could not take place in a triploid,
3n, cell, because there is an odd number of male gametes
each chromosome, so they will not be able
IA IB
to pair up.
IA IAIA IAIB
In theory, meiosis can take place in a blood blood
tetraploid, 4n, cell because there is an even offspring group group
number of each kind of chromosome, so they genotypes female A AB
can each find a partner to pair up with. In and gametes IB IAIB IBIB
practice, meiosis is often very difficult in a phenotypes blood blood
4n cell because, if there are four homologous group group
chromosomes present, they all tend to join AB B
up with each other. Crossing over between
chromatids of different chromosomes results predicted offspring ratio:
in an inextricable tangle, so meiosis cannot 1 group A : 2 group AB : 1 group B
proceed effectively. There is therefore a one in four chance that the
child will have blood group B.

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

8 11 a See the answer to Question 9 to show that

no white offspring could be produced if
parental blood × blood
the brown rabbit was homozygous.
phenotypes group A group B
parental IAIo IBIo parental brown × white
genotypes phenotypes
parental IA or Io IB or Io parental Bb bb
gametes genotypes
parental B or b b
male gametes gametes
IB Io
gametes
IAIB IAIo
from one
blood blood parent
offspring IA
group group A
genotypes female b
AB
and gametes B Bb
IBIo IoIo gametes
phenotypes F2 genotypes brown
from the

PDF from sachtienganhhanoi.com

Io blood blood and
group B group O other b bb
phenotype
parent white
predicted offspring ratio:
1 group A : 1 group B : 1 group AB : 1 group O b Although the genetic diagram in a shows
that you would expect equal numbers
of brown and white offspring, this is
9 parental brown × white all down to chance. It is possible that,
phenotypes just by chance, all of the offspring are
parental BB bb brown, even though the brown parent was
genotypes heterozygous. You would need far larger
parental B b numbers of offspring, all brown, before
gametes you could safely say that the brown parent
does not have the b allele.
All offspring in the F1 generation will be Bb, 12 A man has one X and one Y chromosome, so
brown. half of his sperm carry an X chromosome and
10 parental half carry a Y chromosome. A woman has
brown × brown
two X chromosomes, so all of her eggs have
phenotypes
an X chromosome.
parental Bb Bb
genotypes If an X-carrying sperm fertilises an egg, the
child has XX and is female. If a Y-carrying
parental B or b B or b
sperm fertilises an egg, the child has XY and
gametes
is male.

male gametes The blood-clotting gene is on an X

chromosome, and the man passes his Y
B b
chromosome to his son. He cannot therefore
BB Bb pass on the haemophilia allele to his son.
F2 B brown brown
genotypes female 13 a For example, R for the normal, dominant
and gametes allele and r for the recessive allele. (It
Bb bb is always a good idea to choose a letter
phenotypes b brown white where the capital and small letters have
different shapes, so that you cannot
predicted offspring ratio in F2 generation: mistake them.)
3 brown : 1 white

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b parental man with × woman b

phenotypes normal with
parental male with × female with
vision normal
phenotypes orange fur tortoiseshell
vision
fur
parental XRY XRXr
genotypes parental XCoY XCoXCB
genotypes
parental XR or Y XR or Xr
gametes parental XCo or Y XCo or XCB
gametes
male gametes
XR Y male gametes
XR XRXR XRY XCo Y
female male with
with normal XCoYCo XCoY
normal vision
F2 XCo female male
vision

PDF from sachtienganhhanoi.com

genotypes female with with
and gametes Xr F2 orange orange
phenotype XRXr XrY genotypes female fur fur
female male with and gametes
with colour phenotype XCoXCB XCBY
normal blindness
female male
vision XCB
with with
There is a one in four chance that a child will be a tortoise- black
colour-blind boy. shell fur fur

14 a Male cats cannot be tortoiseshell because predicted offspring ratio: 1 orange female : 1
a tortoiseshell cat must have two different tortoiseshell female : 1 orange male : 1 black male
alleles of this gene. As the gene is on the
X chromosome, and male cats have one
X chromosome and one Y chromosome,
they can only have one allele of the gene.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

15 a Parent genotypes are GGDD and ggdd. All offspring will be heterozygous GgDd, and will have
grey body and dark eyes.

b parental phenotypes grey body, dark eyes × grey body, dark eyes
parental genotypes GgDd GgDd
parental gametes GD Gd gD gd GD Gd gD gd
offspring genotypes and phenotypes

gametes of one parent

GD Gd gD gd
GD GGDD GGDd GgDD GgDd
grey, dark grey, dark grey, dark grey, dark
Gd GGDd GGdd GgDd Ggdd
gametes of the grey, dark grey, pale grey, dark grey, pale
other parent gD GgDD GgDd ggDD ggDd

PDF from sachtienganhhanoi.com

grey, dark grey, dark white, dark white, dark
gd GgDd Ggdd ggDd ggdd
grey, dark grey, pale white, dark white, pale

The expected phenotype ratios are therefore 9 grey body, dark eyes : 3 grey body, pale eyes : 3 white
body, dark eyes : 1 white body, pale eyes.

16 Key to symbols used for the alleles:

T = allele for tall stem

t = allele for short stem
G = allele for green leaves
g = allele for white leaves

parental phenotypes tall stem, green leaves × short stem, variegated leaves
parental genotypes TTGG ttGg
parental gametes TG tG or tg

gametes from one parent

tG tg
offspring genotypes and gametes from the other TG TtGG TtGg
phenotypes parent tall, green tall, variegated

17 a BBFF, BBFf, BbFF, BbFf

b Perform a test cross – that is, breed the animal with an animal showing both recessive
characteristics. If the offspring show one of the recessive characteristics, then the ‘unknown’
genotype must be heterozygous for that characteristic.

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

18 a The F1 offspring will all have genotype FfGg.

b
F1 phenotypes white × white
parental genotypes FfGg FfGg

parental gametes FG  Fg  fG  fg FG  Fg  fG  fg

offspring genotypes and phenotypes

gametes of one parent

FG Fg fG fg
FFGG FFGg FfGG FfGg
FG
white white white white
FFGg FFgg FfGg Ffgg

PDF from sachtienganhhanoi.com

Fg
gametes of the white white white white
other parent FfGG FfGg ffGG ffGg
fG
white white coloured coloured
FfGg Ffgg ffGg ffgg
fg
white white coloured white

Predicted F2 ratios: 13 white : 3 coloured

19 a b

genotype phenotype parental pink × white

AABB purple phenotypes
parental AAbb aaBB
AABb purple genotypes
AAbb pink parental Ab aB
gametes
AaBB purple F1 genotype All AaBb, purple
AaBb purple and
phenotype
Aabb pink

aaBB white

aaBb white

aabb white

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c
F1 phenotypes purple × purple
parental genotypes AaBb AaBb
parental gametes AB  Ab  aB  ab AB  Ab  aB ab

offspring genotypes and phenotypes

gametes of one parent

AB Ab aB ab
AABB AABb AaBB AaBb
AB
purple purple purple purple
AABb AAbb AaBb Aabb
Ab
gametes of the other purple pink purple pink
parent

PDF from sachtienganhhanoi.com

AaBB AaBb aaBB aaBb
aB
purple purple white white
AaBb Aabb aaBb aabb
ab
purple pink white white

Predicted F2 ratios: 9 purple : 3 pink : 4 white

20 1 striped, normal : 1 striped, aristopedia : 1 b As one parent has the genotype yygg, you
ebony, normal : 1 ebony, aristopedia can assume that alleles y and g are on the
same chromosome.
21 The woman is nnIAIo. The man is NNIBIo.
The father’s gametes can therefore be YG
 here is no need to work through this in
T or yg.
detail. If the man is homozygous for normal
fingernails, all of his children will inherit allele The offspring can therefore be YyGg
N, and will therefore have normal fingernails. (yellow, green) or yygg (blue, orange), in a
There is no chance that the child can have 1 : 1 ratio.
fingernails like his mother’s.
c If crossing over takes place, then a few
22 (Answers could be given as genetic diagrams.) gametes will have genotypes Yg and yG,
allowing a small chance that an offspring
a The possible genotypes of the gametes are with recombinant phenotypes (yellow,
YG, Yg, yG and yg from one parent, and orange and blue, green) can be produced.
yg from the other.
23 a 1:1:1:1
The possible genotypes and phenotypes
of their children are therefore: b Linkage; that is, the two loci are on
the same chromosome. The alleles for
YyGg (yellow, green), Yygg (yellow,
 grey body and straight wings are on
orange), yyGg (blue, green) and yygg one homologous chromosome in the
(blue, orange) in equal proportions. heterozygote and the alleles for ebony
body and curled wings are on the other
homologous chromosome.

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c 30 + 29
113 + 30 + 29 + 115
× 100% = 20.6% Reflection
24 The expected ratio would be 9 grey, dark : 3 Learners may suggest that cells that look identical,
grey, pale : 3 white, dark : 1 white, pale. The and that have identical sets of genes, can express
total number of offspring is 80, so you would different selections of these genes. This would
expect 9 ÷ 16 × 80 of these to be grey, dark, mean that they synthesise different combinations
and so on. of proteins. We cannot know exactly what would
cause the differences in which genes are expressed,
Expected numbers: but it would involve transcription factors.

9 ÷ 16 × 80 = 45 grey, dark Analysing DNA from two cells just tells you which
genes they have, and we would expect all of the
3 ÷ 16 × 80 = 15 grey, pale cells in the human body, for example, to contain
exactly the same DNA. However, analysing
3 ÷ 16 × 80 = 15 white, dark mRNA tells you which genes are actually
expressed, and therefore which proteins the cell is
1 ÷ 16 × 80 = 5 white, pale
making. Cells with different functions will express
The table shows how χ2 is calculated. different sets of genes and therefore make different
proteins.

PDF from sachtienganhhanoi.com

Now look at Table 16.3. There are four classes
The newly discovered cell in the tracheal lining
of data, so there are three degrees of freedom.
involves the movement of chloride ions out of
The value for χ2 is much greater than any of
itself, which results in the movement of water
the numbers in this row so there is a significant
out of the cells as well. This keeps the mucus,
difference between the observed and expected
secreted by other cells in the tracheal lining,
results.
fluid, rather than becoming too viscous. The
Phenotypes of animals mucus traps microorganisms and particles in the
air moving down the trachea, and this mucus
dark grey white white is then swept upwards by the ciliated cells. The
Observed 54 4 4 18 chance of pathogens moving down into the lungs
number (O) is therefore reduced. It also means that the mucus
Expected ratio 9 3 3 1 itself is kept on the move easily, and does not
collect in the lungs, where it could be a breeding
Expected 45 15 15 5
ground for pathogens.
number (E)
O–E +9 –11 –11 +13
(O – E) 2
81 121 121 169
(O – E) /E
2
1.8 8.1 8.1 33.8
∑(O – E) /E 2

= 51.8
χ2 = 51.8

7 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 16
Exam-style questions
The mark schemes, suggested answers and max. This indicates the maximum number of
comments that appear here were written by the marks that can be given.
author(s). In examinations, the way marks would 1 a genotype: the genetic constitution of an
be awarded to answers like these may be different. organism with respect to a gene or genes ;

PDF from sachtienganhhanoi.com

Notes about mark schemes phenotype: the physical, detectable
expression of the particular alleles of a
A or accept indicates an alternative acceptable
gene or genes present in an individual ;  [2]
answer.
b 
homozygous: describes a diploid organism
R = reject. This indicates a possible answer that
that has the same allele of a gene at
should be rejected.
the gene’s locus on both copies of the
; The bold semicolon indicates the award of 1 homologous chromosomes ;
mark.
heterozygous: describes a diploid organism
/ This indicates an alternative answer for the same that has different alleles of a gene at
mark. The alternatives may be separated from the the gene’s locus on the homologous
rest of the answer by commas. chromosomes ;[2]
( ) Text in brackets is not required for the mark. c
Gametes ab ;
Underlining This is used to indicate essential
word(s) that must be used to get the mark. AB genotype: AaBb
phenotype: purple flowers
AW means ‘alternative wording’. It is used to and elongated pollen ;
indicate that a different wording is acceptable
Ab genotype: Aabb
provided the essential meaning is the same, and is
phenotype: purple flow-
used where students’ responses are likely to vary ers and spherical pollen ;
more than usual.
aB genotype: aaBb
AVP means ‘additional valid point’. This means phenotype: red flowers
accept any additional points given by the student and elongated pollen ;
that are not in the mark scheme, provided they ab genotype: aabb
are relevant. But accept only as many additional phenotype: red flowers
points as indicated by the bold semicolons, e.g. and spherical pollen ;
AVP ; ; means award a maximum of 2 extra marks.
[5]
ORA means ‘or reverse argument’ and is used
when the same idea could be expressed in the  [Total: 9]
reverse way. For example: ‘activity increases
between pH2 and pH 5 ORA’ means accept 2 a allele: variant form of a gene ;
‘activity decreases between pH 5 and pH 2’. dominant: allele that always expresses itself
in the phenotype when present ;[2]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b parental phenotypes: wild type × wild type ; offspring genotypes ; ; see table
parental genotypes: AaBb × AaBb ; offspring phenotypes ; see table
gametes: AB, Ab, aB, ab × AB, Ab, aB, ab ;
Gametes AB Ab aB ab
AB AABB AABb AaBB AaBb
wild type wild type wild type wild type
Ab AABb AAbb AaBb Aabb
wild type grey body, vestigial wild type grey body, vestigial
wings wings
aB AABB AaBb aaBB aaBb
wild type wild type ebony body, long ebony body, long
wings wings
ab AaBb Aabb aaBb aabb
wild type grey body, vestigial ebony body, long ebony body, vestigial
wings wings wings
 [6]

PDF from sachtienganhhanoi.com

c i Phenotypes of Drosophila melanogaster
grey body, grey body, ebony body, ebony body,
long wing vestigial wing long wing vestigial wing
Observed number (O) 207 79 68 30
Expected ratio   9 3 3 1
Expected 216 72 72 24
number (E)
O−E −9   7 ; −4 6
(O − E)2 81 49 ; 16 36
(O − E) 2
     0.38      0.68 ;     0.22     1.50
E

 [3]

ii 2.78 ;  [1] offspring genotypes and phenotypes:

χ value represents probability of >0.05 ;
iii  2
GCD GCP
difference between observed and
gCD GgCDCD GgCPCD
expected results is not significant and olive green dark green
could be due to chance ; [2]
gCP GgCDCP GgCPCP
[Total: 14] dark green light green
3 a i GGCDCP ; [1] all genotypes correct ;
ii ggCPCP ;  [1] phenotypes correctly linked to genotypes ;
parental genotypes: GGCDCP and ggCDCP ;
b  offspring ratios: 1 olive green : 2 dark
allow ecf if ai incorrect green : 1 light green ; [5]
gametes: GCD or GCP and gCD or gCP ;  [Total: 7]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

4 a i a cluster of genes ; 5 a amino acids are, polar / hydrophilic ;

that are controlled by the same so cannot move through the lipid bilayer ;
promoter ; [2] [2]
ii a gene that codes for a protein that b i transcription factor ;[1]
has a function in the cell ;  [1] ii myosin involved in muscle contraction ;
iii an enzyme that is synthesised only thyroxine causes more myosin to be
when its substrate is present ; [1] synthesised ;
b any five of: increases, quantity of muscle /
lactose is taken up by the bacterium ; strength of muscle / ability of muscle
lactose binds to the repressor protein ; to contract ;[3]

preventing repressor from binding to DNA ; c i 

dominant as it has an effect when
only one allele present ;[1]
at the operator site ;
ii 
thyroid hormone normally causes
transcription is no longer inhibited ; transcription of a gene ;
messenger RNA is produced from, the t hyroid hormone can still enter cells
β-galactosidase gene / the three structural but cannot bind to its receptor ;

PDF from sachtienganhhanoi.com

genes ;
so receptor continues to prevent
mRNA can be translated at a ribosome transcription ;[3]
(to produce β-galactosidase) ; [max. 5]
 [Total: 10]
protein synthesis uses, energy / amino acids ;
c 
wasteful to make a protein that is not
required ; [2]
[Total: 11]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 17
Self-assessment questions
1 Characteristics are passed from parents to deaths from MRSA as from the non-
offspring in their genes. Variation caused by resistant strain. By 2012, there were still
the environment does not change the DNA of slightly more deaths from MRSA, but the
proportion was much less than previously.

PDF from sachtienganhhanoi.com

an organism.

2 a environmental conditions c Antibiotics are widely used in hospitals, so

the bacteria are exposed to this selection
b environment only; they all have the same pressure in hospitals more than elsewhere.
genotype
d A reduction in the prescription of
c both genes and environment; they have antibiotics reduces the exposure of
different genotypes and you have already bacteria to this selection pressure, and
seen that environment always causes therefore means that there is no selective
variation in these plants advantage to bacteria carrying the allele
for resistance.
3 a There seems to be no selection pressure
against unusual colours, as there are no 5 a Genotypes DD and Dd have the same
predators. phenotype because allele D is dominant.
b Possibilities include ability to cope with b Homozygous recessives, dd = q2 = 16, so
a limited food or water supply, ability q = √0.16 = 0.4
to cope with the limited breeding space,
and susceptibility to diseases such as So, p = 1 – 0.4 = 0.6 and p2 = 0.36 = 36%
myxomatosis, if this is present on the
island. (homozygous dominants, DD).

4 a Deaths increased to a maximum in 2006, The heterozygotes, Dd = 2pq = 48%

and then decreased. 6 Their own plants, if they breed with each
b Deaths from non-resistant S. aureus other, will produce offspring with different
remained relatively constant throughout genotypes. The plants they grow are
the period from 1993 to 2012, with only heterozygous. If plants with genotypes AaBb
small fluctuations. In contrast, deaths from and AaBb are interbred, the offspring could
MRSA increased greatly between 1993 be AABB, AABb, AAbb, AaBB, AaBb, Aabb,
and 2006, before decreasing again. In 1993 aaBB, aaBb or aabb. These will not grow into
to 1996, most deaths were from the non- a uniform crop, and many of the plants will be
resistant strain, and MRSA deaths overtook homozygous and have no hybrid vigour.
them for the first time in 1997. By 2006,
there were more than 3.5 times as many

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Reflection
Learners may suggest that the term ‘struggle’
implies a fight or physical effort. In some cases,
this may be entirely appropriate – for example,
if the selection pressure is shortage of food, then
organisms may compete directly with one another
for food, and only those strong enough and
aggressive enough to prevent others from eating
their food may survive.
However, they may also recognise that in many
instances there is no physical ‘struggle’ or
competition. Most selection pressures do not
involve physical struggling. For example, bacteria
that are resistant to antibiotics do not ‘struggle’
with other bacteria in order to survive. Peppered
moths do not ‘struggle’ to be better camouflaged
on trees. The term can be misleading, as it suggests

PDF from sachtienganhhanoi.com

a physical effort and purposeful behaviour, which
is hardly ever the case.
On the other hand, learners may feel that it is a
good term to use because it is memorable. It also
helps people to understand that it is not easy to
survive and that only individuals with the ‘best’
characteristics may be able to do so.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 17
Exam-style questions
The mark schemes, suggested answers and
comments that appear here were written by the there is selection for bacteria with an allele
author(s). In examinations, the way marks would that confers resistance to the antibiotic ;
be awarded to answers like these may be different. so over time there is an increase in the

PDF from sachtienganhhanoi.com

frequency of that allele in the population ;
Notes about mark schemes  [max. 3]
A or accept indicates an alternative acceptable b 2, 4, 6, 3, 5, 1
answer.
2 before 4 ;
R = reject. This indicates a possible answer that
should be rejected. 6 before 3 ;
; The bold semicolon indicates the award of 1 mark. 5 before 1 ;
/ This indicates an alternative answer for the same all in correct sequence ; ;[5]
mark. The alternatives may be separated from the [Total: 8]
rest of the answer by commas. Inbred line 1 Inbred line 2
2
( ) Text in brackets is not required for the mark. Genotype: homozygous Genotype: homozygous ;
Phenotype: uniform Phenotype: uniform ;
Underlining This is used to indicate essential Yield: low Yield: low ;
word(s) that must be used to get the mark.
AW means ‘alternative wording’. It is used to indicate
that a different wording is acceptable provided the Hybrid
essential meaning is the same, and is used where Genotype: heterozygous ;
students’ responses are likely to vary more than usual. Phenotype: uniform ;
Yield: high ;
AVP means ‘additional valid point’. This means
accept any additional points given by the student [6]
that are not in the mark scheme, provided they 3 a
Natural selection Artificial selection
are relevant. But accept only as many additional
points as indicated by the bold semicolons, e.g. the selective agent the selective agent
AVP ; ; means award a maximum of 2 extra marks. is the total is humans ;
environment of
ORA means ‘or reverse argument’ and is used the organism
when the same idea could be expressed in the adaptations to phenotypes
reverse way. For example: ‘activity increases the prevailing wanted by humans
between pH2 and pH 5 ORA’ means accept conditions are are selected ;
‘activity decreases between pH 5 and pH 2’. selected
max. This indicates the maximum number of many different selection may be
marks that can be given. traits contributing for a single trait
to fitness are (which may not be
1 a direction selection is a type of natural
selected advantageous for
selection ; the organism) ;
directional selection results in a change in
frequency of alleles ; [3]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b i 40 × 40 ÷ 100 ; selection favours alleles for yellow shell and

= 16 ;[2] few or no bands in spring and summer ;

ii pale moths are camouflaged on pale gradual change in selection pressures as

bark, and dark moths on dark bark ; seasons change ;

predators / birds, hunt by sight ; keeps all alleles in the population ;[4]

fewer moths taken that match bark ;  [Total: 10]

refer to comparative figures: 20% v. 6 a only two varieties / no intermediates ;

44% of pale moths / 15% v. 40% of discontinuous variation ;[2]
dark moths ;[4] b on both islands percentage of striped
 [Total: 9] form greater than melanic form ;
4 a choose cows that have the highest milk much greater percentage of striped form /
yield ; lower percentage of melanic form, on
breed with a bull whose female relatives Bryher than on Tresco ;[2]
have a high milk yield ; c a few froghoppers colonised Bryher from
repeat for many generations ;[3] Tresco (or vice versa) ;

PDF from sachtienganhhanoi.com

b increase = 4470 – 4104 = 366 ; these individuals did not have all seven
alleles between them ;
So mean increase per
year = 366 ÷ 10 = 36.6 kg ;[2] so the gene pool on Bryer is smaller than
on Tresco (or vice versa) ;
c 
little change in the protein content / it has
fallen very slightly ; differences in phenotypes result from the
initial colonsiation, not different selection
by 0.04 percentage points ; pressures ;[4]
percentage fat content has fallen overall ;  [Total: 8]
both, fluctuated / increased at first and 7 a behaves as good species with no
then fell ; [max. 3] intermating in relation to H. melpomene ;
d producing more milk puts more strain on 15 matings between H. melpomene males
a cow ; and females and between hybrid males
more likely to get an inflamed udder / and females ;
heavier weight on legs / other suggestion ; behaves as less good species in relation to
breeders were not considering health issues H. cydno ;
/ breeders only selecting for milk yield ; no matings between H. cydno males and
may have inadvertently selected for cows hybrid females ;
prone to health issues ; [max. 3] but three matings between H. cydno
 [Total: 11] females and hybrid males ; [max. 4]
5 a camouflage from bird predators hunting b select mates on basis of wing colours and
by sight ; patterns ;
yellow blends into grass but pink or hybrid wing pattern sufficiently different
brown are easily seen ; from parent species to give good isolation
from H. melpomene ;[2]
bands break up outline against rough
vegetation ; c needs geographical separation ;
yellow or pink without bands are easily selection pressure different in the
seen ; [4] separated populations ;
b brown ; different alleles selected for ;
five bands ; [2] in time the differences between the two
populations are so great that they do not
c selection favours alleles for brown shell
interbreed should they happen to meet ;
and for bands in autumn and winter ;
[4]
 [Total: 10]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 18
Self-assessment questions
1 a b i 
taxonomic rank – a unit of
classification, a category that indicates
Taxonomic rank Giraffe a rank or level in the classification

PDF from sachtienganhhanoi.com

domain Eukarya system. Examples are species, genus,
family, etc.
kingdom Animalia
phylum Chordates ii hierarchical system – each taxonomic
rank above the level of species includes
class Mammalia all the ranks below it. For example, an
order Artiodactyla order includes all the families that have
similar features.
family Giraffidae
genus Giraffa
species Giraffa camelopardalis

2
Domains
Feature
Bacteria Archaea Eukarya
cell structure prokaryotic (e.g. no prokaryotic eukaryotic
membrane-bound
organelles)
nucleus ✗ ✗ ✓
DNA circular circular linear
DNA with histones ✗ ✓ ✓
plasmids present in many present in some present in very few, e.g. yeasts
ribosomes all 70S all 70S all in the cytosol are 80S (70S in
mitochondria and chloroplasts)
peptidoglycan in ✓ ✗ ✗
cell wall
method of cell division binary fission binary fission mitosis
organisation single-celled or single-celled or unicellular / colonial /
chains / groups of chains / groups multicellular
cells, e.g. filaments of cells, e.g.
filaments

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

3 Compared with bacteria, archaeans have 4 a i Protoctista and Plantae

different:
ii Protoctista, Fungi and Animalia
• ribosomal rRNA – the sequences of bases
in rRNA are different
• ribosomal proteins – the sequences of
amino acids in ribosomal proteins are
different
• lipids in their cell membranes
• compounds in their cell walls – no
peptidoglycans.

4 b
Kingdoms
Features
Protoctista Fungi Plantae Animalia
type of body unicellular and mycelium multicellular, multicellular,
multicellular composed of branching body most have

PDF from sachtienganhhanoi.com

hyphae; yeasts a compact
are unicellular body
cell walls present in some ✓ (made of chitin) ✓ (made of ✗
species cellulose)
cell vacuoles ✓ ✓ ✓ ✓
algae have large large permanent large small
permanent vacuoles, vacuoles permanent temporary
protozoans have small, vacuoles e.g. food
temporary vacuoles vacuoles
type of nutrition autotrophic and heterotrophic autotrophic heterotrophic
heterotrophic
cilia / flagella some have cilia for ✗ gametes in ✓
locomotion and some groups
feeding (e.g. Stentor) have flagella,
otherwise none
motility some are highly ✗ ✗ ✓
mobile, others are
(ability to move fixed to a substrate muscular
themselves) tissue
nervous ✗ ✗ ✗ ✓
coordination

5 a 
Viruses are acellular / they do not have a Arguments for agreeing that viruses are
cellular structure. non-living:
• no metabolism
b t he type of nucleic acid, DNA or RNA
and the number of strands in each of these • no respiration
molecules – one or two • no production of essential biochemicals,
e.g. no mechanism for making their own
c 
Some points that could be included in an proteins
answer:
• no way to reproduce on their own
• no way to replicate nucleic acid on their own
• rely on hosts cells to reproduce

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

but Release of farmed fish into the wild –

reduces genetic diversity.
• all organisms are interdependent, so
The fish will be selectively bred, therefore
maybe relying on hosts for
genetically uniform with very little
reproduction is not unique to living
variation in the alleles that they have for
organisms
each gene. If these fish breed with the wild
• viruses have genes like living organisms population, they are likely to dilute the
• viruses have niches, e.g. specific cells of gene pool.
their hosts where they reproduce 8 a 
to standardise their method so ensuring
• viruses evolve like living organisms. that their results could be compared

6 ecosystem – a relatively self-contained, b 

the numbers (abundance) of each species
interacting community of organisms, and the and the range of different types within
environment in which they live and with which each species (e.g. the various forms of
they interact C. nemoralis in Figure 18.20)

niche – the role of an organism in an 9 a i 

Sea anemones were found in five
ecosystem quadrats, so the species frequency

PDF from sachtienganhhanoi.com

is 50%.
7 a Using the biological species concept:
the snails are able to breed together to give ii Ten quadrats were placed, so the total
rise to fertile offspring. area is 10 × 0.25 m2, which equals
2.5 m2, was sampled. The total number
b 
Choose features that are easy to identify, of sea anemones found in this area was
e.g. shell colour, presence / absence of 12. Therefore, the species density is
banding and numbers of bands on the 12
shells.     2.5 m2 = 4.8 per m2
Carry out breeding experiments to identify b when it is not possible to count individual
the different alleles and find out which are organisms
dominant, recessive, codominant.
Mark out an area of land and collect a Some examples:
sample of snails. • some organisms form a covering
Complete a tally table to find out over the surface of rocks and it is
the number of snails with different impossible to count individuals
phenotypes.
• colonial animals, such as coral, have
Use the Hardy−Weinberg principle to
far too many individual polyps to
estimate allele frequencies and frequencies
count
of heterozygous individuals in the
population. • grass plants are often all
interconnected as they have spread by
c 
Artificial selection (selective breeding) – asexual reproduction.
reduces genetic diversity.
Humans select individual organisms that 10 a i species frequency:
have specific traits and therefore they number of quadrats on the lawn
select specific alleles; the alleles of other containing dayflowers = 6
organisms that are not selected to breed number of quadrats = 10
are selected out. This reduces the genetic 6
diversity in the gene pool. species frequency = × 100 = 60%
10
Habitat destruction – reduces genetic number of quadrats in the field
diversity. containing dayflowers = 3
The loss of habitat probably means that the number of quadrats = 10
number of organisms in a population of 3
species frequency = × 100 = 30%
a species will decrease or may all die. This 10
will reduce the number of different alleles
particularly those that adapt the organism
to the habitat which has been destroyed.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

ii species density: 11 a Shore B

total number of dayflowers counted on
Species n n 2
the lawn = 17 n
total area N N
sampled = 10 × 1.0 m2 = 10.0 m2 painted 51 0.059 0.003
17 topshells
species density = = 1.7 per m2
10 limpets 125 0.145 0.021
total number of dayflowers counted in
the field = 8 dogwhelks 63 0.073 0.005
8 snakelocks 0 0.000 0.000
species density = 10 = 0.8 per m2
anemones
b Using random quadrats ensures that the beadlet 22 0.026 0.001
results are likely to be representative of the anemones
whole area; the quadrat samples are not barnacles 391 0.454 0.206
biased in any way, e.g. not all taken from
one part of the area being studied or an mussels 116 0.135 0.018
area with most species, fewest species or periwinkles 93 0.108 0.012
with large areas of bare ground. total 861

PDF from sachtienganhhanoi.com

number of n 2
c They are subjective / not objective. It is Σ = 0.266
individuals, N
difficult to be sure that you are using the
N
same method to estimate the area covered
in each quadrat. Two or more people may
not agree.
It is difficult to assess cover when the For shore B, Simpson’s index of diversity
plants in your study area are of very (D) = 1 − 0.266 = 0.734
different heights.
Smaller species underneath a canopy of Shore A has an index of 0.8 and shore
b 
larger ones are often ignored. B has an index of 0.7. This means that
Large leafy plants are often overestimated shore A has a greater biodiversity than
compared with other methods. shore B. The absence of snakelocks
It can be time-consuming unless there anemones and the small number of beadlet
is only a small number of species to be anemones on shore B is not compensated
sampled. for by the larger numbers of barnacles.
With an abundance scale, such as Braun− There are many more limpets, dogwhelks,
Blanquet, some categories cover a wide mussels and periwinkles on shore A which
range of percentage cover so the results do contribute to the higher value for the index.
not discriminate, e.g. between 55% and 75%
12 a
cover – both are given the same score of 4. Woodland
Species n n 2
n
I n 11 a and 12 a the working shown in N N
both columns 3 and 4 has been rounded A 56 0.448 0.201
to 3 decimal places so the individual
B 48 0.384 0.147
steps in the procedure can be followed.
C 12 0.096 0.009
I f you use a calculator or a spreadsheet
it is best to round to an appropriate D 6 0.048 0.002
number of decimal places at the last step E 3 0.024 0.001
in the calculation to avoid introducing total 125
errors. number of n 2
Σ = 0.360
individuals, N
N

Simpson’s index of diversity =1 – 0.360 = 0.640

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b 
An ecosystem that has one dominant 70
species that is very abundant may have a
large number of other species but there 60
would be very few individuals of those 50
other species. If abundance is measured,

Distance / m
then there may be many individuals of 40
this dominant species, but there may not 30
be many other species so it is species poor.
An area with one dominant species which 20
is very abundant has a lower biodiversity
10
than an area with no dominant species
and many species of all roughly the same 0
abundance. 5 4 3 2 1 0 1 2 3 4 5
Abundance scale
c 
The area of grassland has a high
13 a 

Percentage cover of Vaccinium myrtillus

biodiversity; the area beneath the conifer
35
trees has a much lower biodiversity.
30
d Making a kite diagram:

PDF from sachtienganhhanoi.com

25
1 Draw a y-axis to represent the distance
along the transect. 20
2 Draw an x-axis to represent all the 15
different species recorded.
3 Draw vertical lines equidistant along 10
the x-axis to locate the positions of the 5
‘kites’ for each species. 0
4 Use an appropriate scale on either side 0 5 10 15 20 25 30 35 40
of each vertical line, e.g. 10 mm = 5 on Percentage cover of Calluna vulgaris
the abundance scale.
5 Plot the abundance data for each b 
The data is ranked, with the lowest
species along each vertical line. percentage cover being ranked as 1, the
next is ranked as 2, and so on. If there
6 Join the plots and shade in the ‘kites’
are two figures with equal percentage
or use different colours for each
cover, they are given an equal rank. In the
species.
example given, there are two quadrats for
See a kite for one species at the top of next each species where this applies.
column.

% cover % cover Rank

D D2
C. vulgaris V. myrtillus C. vulgaris V. myrtillus
30 15 9 8 1 1
37 23 11 10 1 1
15 6 5.5 4 1.5 2.25
15 10 5.5 5.5 0 0
20 11 7 7 0 0
9 10 3 5.5 −2.5 6.25
3 3 1 2 −1 1
5 1 2 1 1 1
10 5 4 3 1 1
25 17 8 9 −1 1
35 30 10 11 −1 1
n = 11 ∑D = 15.5
2

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK


Next, calculate D (the difference between If the value for rs is greater than the
the ranks). Then calculate D2 for each critical value, then you can reject the null
species (as in the χ2 test, this removes hypothesis. If the value of rs is less than
the negative signs). Calculate the sum the critical value, you can accept the null
of D2. (You could type the table into hypothesis.
a spreadsheet and get it to do all the
calculations for you.) c In this case, the value for rs is greater
than the critical value so the ecologist can
The figures are now inserted into the equation: reject the null hypothesis and accept the
alternative hypothesis.
D2 
66 × ∑ D
rsrs==11−−  33 
 nn −− nn  d There is a significant correlation between
the abundance (as measured by percentage
666×××∑15.5
∑DD2 2  cover) of the two species on the moorland.
rsrsr=s=1=1−1−−  3 3  
1331
 nn −−n−n11  e There are two variables: soil moisture
rs = 1 – 0.070 and percentage cover (or some other
measurement of abundance, such as
rs = 0.930 species density).

PDF from sachtienganhhanoi.com

A correlation coefficient of +0.930 is very Random sampling or systematic sampling
close to +1, so we can conclude that there is a could be used in this investigation. This is
positive correlation between the two species and the method for random sampling:
that the strength of the association is very high.
1 
Mark out a large plot of the moorland
Now look up the Spearman’s rank correlation with tapes at right angles to each other.
coefficient in the table of critical values
that correspond to the number of pairs of 2 Use a random number generator to
measurements in results table (there are 11). select coordinates where the quadrat
will be placed.
Number of pairs of Critical value at
3 Record percentage cover of each
measurements p = 0.05 (5%)
species.
5 1.00
4 Take a soil sample using any suitable
6 0.89
method – such as using a soil auger,
7 0.79 which is ‘screwed’ down into the soil
8 0.74 and then removed to extract a soil
9 0.70 sample all the way down to a fixed
depth
10 0.65
11 0.62 5 Take at least three samples of soil from
each quadrat.
12 0.59
13 0.56 6 Weigh a small quantity of soil from
14 0.54 each sample.

15 0.52 7 Dry the samples in an oven or leave in

16 0.50 the sun to dry.
17 0.49 8 Continue to dry and weigh the soil
18 0.47 until the mass remains constant / there
is no further decrease in mass.
19 0.46
20 0.45 9 Calculate the mass of water in the soil
30 0.36 (wet mass as extracted from the soil -
dry mass = mass of water or moisture
content).
Table showing the critical values of rs at p = 0.05
for different numbers of paired values.

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

10 Calculate the percentage of the Now insert these figures into the formula:
original soil sample that was water: ∑xy − n−x−y
r=
decrease in mass (= mass of water) (n – 1)sxsy
divided by the original mass of the
1151.8 − (12 × 1.608 ×50.083)
soil × 100. r=
11 × 0.708 ×27.484
11 Draw a scatter graph of percentage 185.398
cover against percentage soil moisture. r=
214.045
12 Calculate Spearman’s rank correlation r = 0.866
coefficient.
c This shows that there is a fairly strong
14 a
Mean width of crack in bark / mm

100 correlation, but is this significant? As

90 with Spearman’s rank, we can test this.
80 First we need a null hypothesis that
70 there is no linear correlation between the
60 circumference of the trees and the width
50
40 of the cracks in the bark.

PDF from sachtienganhhanoi.com

30
20 This is the table to use if the student has
10 made the hypothesis that there is a linear
0 correlation between the two variables.
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Circumference of trees / m
Number of pairs Critical value at
b The following steps are carried out: of measurements p = 0.05 (5%)
5 0.88
Step 1 Calculate the mean and standard
deviation for each variable: 6 0.81
7 0.75
−
x = mean for circumference,
 8 0.71
sx = standard deviation for circumference
9 0.67
−
y = mean for width, sy = standard
 10 0.63
deviation for width.
11 0.60
Step 2 Multiply each pair of values (for
12 0.58
each tree) together to give their
product, xy. 15 0.51

Step 3 Calculate the sum of the products 20 0.44

xy, to give Σxy.
Table showing the critical values of r at p = 0.05
Means and standard deviations can be
for different numbers of paired values.
calculated with a calculator or a spreadsheet.

x = 1.608 In this case there are 12 pairs of

measurements and the critical value at
sx = 0.708
p = 0.05 is 0.58. The value of r (0.866) is
y = 50.083 greater than this, so the null hypothesis can
be rejected.
sy = 27.484
d 
The student can reject the null hypothesis
∑xy = 1151.8 and we can accept the alternative
hypothesis that there is a correlation
between the circumference of the trees and
the width of the cracks in their bark.

7 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

15 a Some examples: b 
Artificial insemination (AI) – semen is
pollution collected from the male and stored in thin
deforestation tubes known as straws. These are injected
overgrazing into the vagina or uterus using a catheter
natural catastrophes (hurricanes, etc.) around the time of ovulation.
hunting / fishing In vitro fertilisation (IVF) – sperm are
habitat destruction collected from the male; eggs are collected
from the ovary. Sperm and eggs are mixed
b source of alleles for breeding to improve
together in a dish or tube to fertilise. The
agricultural species
embryo is kept for a few days in culture.
source of potential medicines
Sperm bank – sperm are collected from
economic reasons, e.g. for ecotourism
males, mixed with an albumen solution
to maintain, food webs / nutrient cycles
and put into thin tubes known as straws.
to maintain ecosystems that provide
These are kept at –196 oC until required.
‘services’ for humans
Embryo transfer – embryos formed during
aesthetic reasons, e.g. the intrinsic beauty
IVF are inserted into the uterus for
of the natural world
implantation to take place. They could be
16 Some possible answers: inserted into the female which donated

PDF from sachtienganhhanoi.com

pressure on national parks of many the eggs or into another female which has
visitors been treated with hormones so prepared
the need to provide facilities for visitors for implantation (embedding in the
the need to restrict any damage done by endometrium).
visitors Surrogacy – one or more embryos are
so some areas may be fenced off to placed into the uterus of a female who did
prohibit entry, e.g. during breeding season not provide the female gamete. Pregnancy
for some animals / time of flowering for therefore occurs in a female who is
plants biologically unrelated to the embryo/fetus.
populations of animals / plants must be This is to save the female who is the source
kept in check, e.g. to prevent overgrazing of the eggs from the risks of pregnancy.
park must provide habitats appropriate for ‘Frozen zoo’ – a store of sperm, eggs and
the species that live there embryos of animals, many / all of which
human activities in some parks need to be are endangered species. Stored material
controlled in some parks, e.g. building / can be made available to zoos anywhere
development / transport / farming in the world. The frozen zoo is a store of
genetic diversity to prevent inbreeding.
17 a Zoos may not be able to provide the right
‘habitat’ suitable for breeding. Animals c To prevent inbreeding. This reduces the
may need particular factors in their chances of them becoming increasingly
environment before their reproductive homozygous over several generations. The
systems become able to produce sperm or health and fertility of animals is likely to
eggs – e.g. to have plenty of space, or to decrease if they are inbred. For example,
have many others of their species around the risk of developing genetic diseases
them. These factors affect their physiology caused by recessive alleles increases.
and their behaviour. Courtship may be
18 Some possible answers:
difficult in the conditions in which they
live in a zoo. They may need particular 
Zoos provide a refuge for endangered
changes in day length or in food supply to animals, when their habitat no longer
trigger hormonal changes associated with exists or is too fragmented to support
reproduction. These may not occur in the populations in the wild. They can keep
latitude where the zoo is situated. Males animals in better health than in the wild.
and females may be from very different They conduct research on the best ways to
social groups and refuse to associate with breed them to increase the populations,
each other let alone mate. also ensuring that health is maintained
or improved by restricting inbreeding.
They allow people to see animals that they

8 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

would not otherwise see (except on video/ They may be herbivores in which case they
TV). Zoos provide an important role in will compete with the existing herbivores in
conservation education. the ecosystem. If plants, they will compete
with existing species for resources, e.g.
19 a Many wild plants are threatened with light, minerals, water and space. They may
habitat loss and the effects of climate introduce disease that the existing species
change. Seeds can be kept for a long have not experienced so have no immunity.
time – possibly until suitable places and They will compete with native species for
conditions are available for the plants to be space and breeding sites, etc. They may
reintroduced. Seed banks keep the genetic change the environment so that native
material that would otherwise be lost. species cannot survive
b Seeds that can be stored in seed banks b Find two areas: one invaded by an alien
are orthodox seeds. Some plants do not species and one that has not. Carry out
produce this type of seed. Their seeds random sampling. Count the number
are known as recalcitrant. The plants of different species / make a species list.
concerned have to grow as plants in a gene Record the abundance of the different
bank, e.g. for cocoa and coconut. species. Use an appropriate method,

PDF from sachtienganhhanoi.com

e.g. species frequency, species density,
20 a Selection pressures in the natural habitat
percentage cover or an abundance scale.
might include the ability of the adult
Use Simpson’s index of diversity to
plants to survive grazing, wide variations
compare the different areas.
in rainfall or competition with other
species. In the seed bank, none of these 22 Information about endangered or critically
selection pressures would apply. In the endangered species could be recorded as
seed bank, the greatest selection pressure a table showing common names, scientific
will become the ability of the seeds to names, IUCN classifications, threats (such as
survive the conditions in which they are habitat loss, hunting, etc.) and the steps taken
stored for a long period of time. Seeds to conserve each species.
from store are germinated every few
years to check on their viability. Also The IUCN database can be found at
some plants may be grown in protected https://www.iucnredlist
environments to set seeds to replenish
the stock in cold store.

b It is possible that the plants that grow from

Reflection
the seeds that have been saved will not There are many reasons for being concerned
have characteristics that will allow them about the biodiversity and conservation of
to survive the selection pressures they will microorganisms. These are examples.
encounter in their natural habitat. This Microorganisms fulfil many roles in ecosystems:
could reduce the chances of success in
returning them to the wild. • decomposition
• cycling nitrogen, e.g. nitrogen fixation
c Providing enough space to grow all the
(Figure 18.5), nitrification, denitrification
plants necessary to have a collection of the
genetic diversity in the species. Keeping • cycling carbon, e.g. decomposition,
plants disease-free. There are problems breakdown of complex compounds to simpler
involved in maintaining the collection in compounds so that they can be respired to
areas that might be susceptible to natural form carbon dioxide
catastrophes, such as hurricanes, severe
• cycling other elements, such as phosphorus
storms, flooding and drought.
and sulfur
21 a Some possible answers: • fixation of carbon as many are photosynthetic
Alien species may be carnivores so will (Figure 18.5)
prey on many animals. They will compete
with existing predators in the ecosystem.

9 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

• provide food for many organisms, e.g.

protoctists such as Stentor (Figure 18.7) at the
base of food webs.
Microorganisms are useful sources of:
• antibiotics
• enzymes, especially from extremophiles,
e.g. those that live in hot environments
(see Taq polymerase in Chapter 19)
• pharmaceutical products
• food products, e.g. yoghurt, bread, etc.
• biofertilisers in agriculture
• genes for use in genetic manipulation.

PDF from sachtienganhhanoi.com

10 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 18
Exam-style questions
The mark schemes, suggested answers and 1 a
Quadrat of side / cm Area / cm2
comments that appear here were written by the
author(s). In examinations, the way marks would 10   100
be awarded to answers like these may be different. 25   625

PDF from sachtienganhhanoi.com

50 2500
Notes about mark schemes
A or accept indicates an alternative acceptable 75 5625
answer. 100 10 000
(1 m2)
R = reject. This indicates a possible answer that
should be rejected. ; 2 marks if all correct, 1 mark if only three
The bold semicolon indicates the award of 1 mark. correct [2]
/ This indicates an alternative answer for the same b 
to collect results representative of the
mark. The alternatives may be separated from the whole area ;
rest of the answer by commas. to calculate a mean ;
( ) Text in brackets is not required for the mark. to see how much variation there is in the
Underlining This is used to indicate essential number of species per quadrat ;
word(s) that must be used to get the mark. to calculate, standard deviation / standard
AW means ‘alternative wording’. It is used to error ;
indicate that a different wording is acceptable 
to put range bars on their graph (showing
provided the essential meaning is the same, and is maximum and minimum readings for
used where students’ responses are likely to vary each size of quadrat) / put error bars on
more than usual. the graph (using standard deviation /
AVP means ‘additional valid point’. This means standard error / 95% confidence intervals) ;
accept any additional points given by the student  [max. 2]
that are not in the mark scheme, provided they c 
the 50 cm quadrat includes most of the
are relevant. But accept only as many additional species present in the habitat ;
points as indicated by the bold semicolons, e.g.
AVP ; ; means award a maximum of 2 extra marks. if the quadrat was larger there would be
many more individuals to count (which
ORA means ‘or reverse argument’ and is used would take longer) ;
when the same idea could be expressed in the
reverse way. For example: ‘activity increases if the quadrat was smaller some of the
between pH2 and pH 5 ORA’ means accept species might not be counted each time a
‘activity decreases between pH 5 and pH 2’. sample is taken ;

max. This indicates the maximum number of comparative reference to the data, e.g.
marks that can be given. mean number of 6 for quadrat of size
50 cm, but 7 for 100 cm ; [max. 2]

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d as the field is likely to be a uniform presence or absence of symbionts in the

habitat, quadrats are placed randomly ; ecosystem (e.g. fungi and bacteria that live

mark out a grid using tapes and take in mutualism with many plants) ;
random numbers to find coordinates application of, herbicides / fertilisers /
across the grid to place the quadrat ; other named agricultural chemical ;
either type / frequency, of cultivation ;
record presence/absence of species (for  [max. 4]
frequency)  [Total: 11]
or 3 a 
formula for calculating estimated number
record number of species and calculate in population:
species density n ×n
N = 1m 2
2
or
39 × 35
record percentage cover (for those species    ;
it is difficult to count) ;[3] 20
  = 68 ;[2]
 [Total: 9] b the marking must, not harm the animal /

PDF from sachtienganhhanoi.com

2 a 44 and 36 ; [1] be non-toxic ;
b 
one plant may overlie another, so both would the marking must not influence the
be included in the cover for the quadrat ; [1] animal’s behaviour ;
c it is difficult to estimate the percentage the marking must not put animals at
cover with any more precision than this ; greater risk of predation ;
 [1] animals must mix at random after release ;
d these results cannot be used to estimate there is no, immigration / emigration,
species frequency ; from the waste ground ;
there may have been plants present that no ‘birth’ and/or death of beetles between
did not cover 5% of a quadrat ; the two sampling times ;
there could be cowslips in all the quadrats  [max. 3]
but only in number 4 were there enough c 
one way to do this is by random sampling
to cover an area that could be rounded up with quadrats:
to 5% (e.g. 2.6% is the smallest area that 
generate random numbers to give
can be rounded up to 5%) coordinates for positioning quadrats ;
they would give an underestimate of put 10 (or more) quadrats on the waste
species frequency for small plants ; ground ;
five quadrats is a small sample ; leave for several hours ; (because putting
results are unlikely to be representative, down the quadrats may have disturbed
of the whole area ; [max. 4] the beetles)
e any four of the following: on return search for ground beetles in
climate ; each quadrat and count them ;

soil type / soil depth / soil fertility ; calculate the mean number per quadrat ;

temperature, qualified ; e.g. by minimum / calculate an estimate of the number of

maximum / mean annual / AW ; ground beetles in the area by dividing the
area of waste ground by the area of the
drainage / rainfall / irrigation / water quadrat and multiplying the answer by
supply ; the mean number of ground beetles per
grazing / predation (by primary quadrat ;
consumers / herbivores) ; repeat the investigation at different times
availability of light / shading ; of day ; [max. 4]
parasites / pests ;  [Total: 9]

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

4 a 100 axes labelled – percentage cover and light

Percentage cover of 90 intensity / percentage of full sun ;
Mercurialis perennis
80 points plotted accurately ;[2]
70
60
50 b 
null hypothesis – there is no relationship
40 between the light intensity and the
30 percentage cover of Mercurialis perennis.[1]
20
10
0
0 10 20 30 40 50 60 70 80 90 100
Light intensity / percentage of full sun

c
Light intensity / Rank
Percentage cover
Location percentage of Light Percentage D D2
of M. perennis
full sun intensity cover
A 90 10 6 2.5 3.5 12.25
B 50 65 3 6 −3 9

PDF from sachtienganhhanoi.com

C 30 90 2 8 −6 36
D 20 80 1 7 −6 36
E 80 34 4 5 −1 1
F 88 20 5 4 1 1
G 93 10 7 2.5 4.5 20.25
H 100 0 8 1 7 49
n=8 ∑D = 164.5
2

6 × ΣD2 the correlation between light intensity and

rs = 1 − percentage cover is significant ; [4]
n −n
3

 [Total: 11]
6 × 164.5 45
rs = 1 − 5 a
Number of stonefly nymphs

512 − 8 40
35
rs = 1 − 1.958 30
rs = −0.958 25
20
ranks stated correctly ; 15
ΣD2 calculated correctly ; 10
5
correct numbers substituted into the 0
equation ; 0 20 40 60 80 100 120 140 160
Concentration of calcium
value of rs = –0.958 (or –0.96) ;[4] carbonate / arbitrary units
correlation coefficient is –0.958 / –0.96 ;
d  axes labelled – concentration of calcium


there is a negative correlation between carbonate / arbitrary units and numbers
light intensity and percentage cover of of stoneflies ;
M. perennis ; points plotted accurately ;[2]
the critical value for 8 samples is 0.76, b There is no relationship between water
the value of rs is greater than the hardness and numbers of stonefly nymphs ;
critical value so the null hypothesis is
rejected ; [1]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

5 c

Number Concentration of Rank

Stream of stonefly calcium carbonate / D D2
Stonefly Calcium
nymphs arbitrary units
nymphs carbonate
1 2 145 1 11.5 −10.5 110.25
2 3 80 2 9 −7 49
3 5 145 3 11.5 −8.5 72.25
4 7 28 5 4 1 1
5 7 90 5 10 −5 25
6 7 75 5 8 −3 9
7 8 55 7 6.5 0.5 0.25
8 10 55 8 6.5 1.5 2.25
9 12 42 9 5 4 16
10 30 22 10 3 7 49

PDF from sachtienganhhanoi.com

11 40 20 11 2 9 81
12 42 17 12 1 11 121
n = 12 ∑D = 536
2

6 × ΣD2 6 a i 
to collect results representative of the
rs = 1 − whole area ;
n3 − n
to calculate a mean ;
6 × 536
rs = 1 − to see how much variation there is
1728 −12 in the number of species per
 
rs = 1 – 1.874 quadrat ;
rs = – 0.874 to calculate, standard deviation /
standard error ;
ranks stated correctly ;

to put range bars on his graph (showing
ΣD2 calculated correctly ; maximum and minimum readings for
correct numbers substituted into the each size of quadrat) / put error bars
equations ; on the graph (using standard deviation
value of rs = –0.874 (or –0.87) ;[4] / standard error / 95% confidence
intervals) ;
d correlation coefficient is −0.874 / −0.87 ;  [max. 2]

there is a negative correlation between ii 
the exact location (e.g. GPS
water hardness and numbers of stonefly coordinate) ;
nymphs ;
the depth of the soil sample ;
the critical value for 12 samples is 0.54,
the value of rs is greater than the critical 
the method to determine the percentage
value so the null hypothesis is rejected ; of organic matter in the soil ;
ignore the minus sign for this step the method for collecting the samples
the correlation between water hardness
 of leaf litter ;
and numbers of stonefly nymphs is AVP ; 
[max. 3]
significant ; [4]
 [Total: 11]

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b 14 axes labelled – percentage organic matter

Number of woodlice 12 and numbers of woodlice ;
10 points plotted accurately ;[2]
8
c 
There is no relationship between soil
6 organic matter and numbers of woodlice ;
4 [1]
2
0
0 5 10 15 20 25
Percentage organic matter in the soil

d Distance Percentage Mean Ranks

along organic number of Organic D D2
transect / m matter woodlice Woodlice
matter
1 5.42 0.6 1 1 0 0
4 10.02 2.3 5 3.5 1.5 2.25

PDF from sachtienganhhanoi.com

8 15.56 2.3 10 3.5 6.5 42.25
16 8.25 1.3 2 2 0 0
20 9.62 6.0 4 5 −1 1
24 11.73 9.0 8 6 2 4
28 10.67 12.3 6 12 −6 36
32 9.36 11.6 3 10.5 −7.5 56.25
36 11.35 11.6 7 10.5 −3.5 12.25
40 15.11 11.0 9 8.5 0.5 0.25
44 20.87 10.3 12 7 5 25
48 20.30 11.0 11 8.5 2.5 6.25
n = 12 ∑D = 185.5
2

6 × ∑D2 the critical value for 12 samples is 0.54,

rs = 1 − this value is below the critical value so
n3 − n
the null hypothesis is accepted ;
6 × 185.5 there is no significant correlation between
rs = 1 −
1728 − 12 percentage organic content of the soil
and numbers of woodlice ;[4]
rs = 1 – 0.649
 [Total: 16]
rs = 0.351
7 a 
the correlation coefficients for the data
ranks stated correctly ;
collected from the two samples of trees
ΣD2 calculated correctly ; indicate that there is a weak positive
correct numbers substituted into the correlation between the heights of the
equation ; trees and their diameters in both
forests ;
value of rs = 0.351 (or 0.35) ;[4]

both correlation coefficients are lower
e correlation coefficient is 0.351 ; than the critical value ;

there is a weak positive correlation the null hypothesis would be accepted ;
between percentage organic content of the
soil and numbers of woodlice ; there is no significant correlation between
the heights and the diameters ;[4]

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b the data is quantitative data ; c maintains stability of ecosystems ;

the data for both measurements (height 
idea that ecosystems provide ‘services’
and diameter) is very likely to show a for humans ;
normal distribution ; ecotourism / wildlife, is a source of

The researchers should check this before income for countries and source of
deciding to do the test.[2] employment ;
c independent variable = rainfall ;
i  species in the wild may be sources of new
dependent variable = diameter of trees ;
 medicines ;
 [2] wild species are sources of plant foods ;
ii collect rainfall data from a local wild species are sources of animal foods ;
weather station ; wild relatives of crop plants are a store
choose a technique for selecting of potential alleles for future breeding of
random samples of trees ; domesticated varieties ;
any suitable method ; e.g. giving trees AVP ; ; [max. 4]
numbers and selecting them by using  [Total: 11]
random numbers ;

PDF from sachtienganhhanoi.com

9 a 
standard error is a measurement of
measure the, diameter / width / the variation of the results about the
circumference, of the trees ; (population) mean ;
collect results from at least 20 trees an indication of the variation in the,
from each forest ; estimates / counts, that were made of the
ensure they are approximately the elephants ;[2]
same, age / height ; b description of pattern in the numbers:
calculate means ; [max. 5] numbers decreased to 1986 ;
iii use the t-test ; [1] increased to 1992 ;
 [Total: 14] fluctuated / AW, to 1998 ;
8 a ecosystem diversity ; increased to 2001 ;
species diversity ; data quote ; e.g. numbers of elephants for
genetic diversity within each species ;[3] minimum of two different years
b i 
a species that is, likely to become  [max. 4]
extinct / at high risk of extinction ; c high density:
[1]
woodland is destroyed ;
there is a ban on trade (Appendix I) ;
ii 
loss of habitat ;
or trade is, limited / highly regulated
(Appendix II and III) ; loss any named animal(s) ; e.g. beetles that
live in bark
prevents species being taken from the
wild (Appendix I) ; low density:
reduces the number of species grassland lost ;
taken from the wild (Appendices II tree seedlings / saplings, not trampled /
and III) ; eaten ;
helps to stabilise populations / AW ; grazers, decrease in number / migrate ;
so they can start to increase ; less dung for, decomposers / dung beetles /
poachers / traders, are prosecuted (to fungi ;
act as a deterrent) ; [max. 3] AVP ; [max. 4]

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

d 
the number of animals is too great for the b a store of sperm, eggs, embryos ;
resources available ; in, very cold conditions / liquid nitrogen
if the numbers are not controlled there at –196 ˚C ;
will be, overgrazing / AW ; for future breeding of endangered species ;
not enough food for other species ; store of embryos for rearing in surrogate
many animals will die of starvation ; mothers ; [max. 3]
not enough water ; c i 
bred in several places so not all at risk
especially in the dry season ; from same disease ;

animals may leave the park in search of, safe from, hunting / poaching ;
grazing / water ; safe from natural catastrophes ;
cause, damage to / loss of, crops ; increases numbers of animals ;
AVP ; [max. 4]  [max. 3]

 [Total: 14] ii close relatives are not bred together ;

10 a many wild plants are endangered ; e.g. not breeding siblings with each
other / not breeding father with

PDF from sachtienganhhanoi.com

any two reasons ; ; daughter ;
e.g. climate change / deforestation / sperm collected from males and stored ;
erosion / flooding / overgrazing
transported to females in other zoos ;
populations of many plant species (even
those not endangered) are decreasing ; artificial insemination ;

loss of genetic diversity ; in vitro fertilisation ;

seeds in seed banks can be stores of much zoo / international organisation, keeps
of this genetic diversity ; records of breeding ;

can be used in the future if habitats R embryo transfer / surrogacy

become available for reintroductions ;  [max. 3]

plants have genes yet to be discovered that iii proportion of animals that survive (for
may be useful in the future ; suitable length of time to reproduce) ;

crop plants are all genetically uniform ; number of females that have offspring ;

could be wiped out by epidemics of plant survival rate of offspring ;

diseases ; how fast the population grows ;
wild relatives of crop plants have alleles health of the animals ;
that might be useful in the future ; impact of reintroduction on the
for plant breeding with a reason e.g. ecosystem ;
developing crops able to resist diseases / AVP ; [max. 3]
grow in different conditions (e.g. the effect
of climate change on crops)  [Total: 18]
 [max. 6]

7 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter 19
Self-assessment questions
1 Selective breeding does not involve the EcoRI) give sticky ends that will form base
insertion of specific DNA directly into the pairs with complementary base sequences. It
DNA of the organism to form recombinant is possible to join two pieces of DNA from
different sources if they are cut with the same

PDF from sachtienganhhanoi.com

DNA. In selective breeding, specific varieties
of plants, animals or microbes (e.g. yeasts) restriction enzyme. It is possible to map the
are crossed together to improve a particular position of restriction sites in lengths of DNA
feature or give a desired combination of (e.g. chromosomes) and in genomes.
characteristics. This is achieved by combining
the genes inherited from two parents in sexual 3 rDNA is recombinant DNA made from
reproduction. Genetic engineering does not lengths of DNA from different sources,
involve any breeding between individuals. e.g. from two different species or from two
different organisms of the same species.
2 a Sticky end: a single-stranded length A plasmid with an inserted ‘foreign’ gene is
of several nucleotides at the end of a a form of recombinant DNA.
fragment of DNA that can form hydrogen
bonds with an equivalent length of cDNA is DNA produced by reverse
complementary nucleotides. Sticky ends transcription from a mRNA template.
are formed by restriction enzymes that 4 Advantages of using plasmids as vectors are:
make staggered cuts across DNA. They
can also be formed by adding a short • they exist naturally in bacteria, which
section of single-stranded DNA to a are able to take them up from their
blunt-ended fragment of double stranded surroundings
DNA (see Figure 19.3). • they are small so that they are easy to use
b A 6 • they can be produced artificially by
combining lengths of DNA from different
B 8 sources
C 1 • they are double stranded so genes from
prokaryotes and from eukaryotes can be
D 4
inserted into them
c The restriction sites are palindromic as • they replicate independently within
the base sequences read the same in the bacteria to clone any genes that are
5´− 3´ direction as in the 3´−5´ direction. inserted into them
HindIII, BamHI and EcoRI give
staggered cuts across DNA and HaeIII • they can be transferred between different
gives a straight cut across the DNA. bacterial species.

d Each restriction enzyme always cuts at

the same specific place in DNA. Some
restriction enzymes (e.g. HindIII and

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

5 The diagram should show the following: 7 Use a restriction enzyme to cut plasmids.
• A piece of DNA is cut from a longer length 10 Mix the double-stranded cDNA with
by a restriction enzyme to form sticky ends. plasmids.
• A plasmid is cut with the same restriction
9 Form recombinant plasmids by
enzyme as the piece of DNA to give sticky
complementary base pairing.
ends that are complementary to the sticky
ends of the gene. 3 Use ligase to seal the sugar−phosphate
• The sticky ends of the gene and plasmid backbone of the recombinant plasmid.
bind together. This can be shown by 1 Insert the plasmid into a host bacterium.
including complementary bases for the
two sticky ends. 5 Clone the modified bacteria and harvest
• The sealing of the sticky ends can be the recombinant protein.
shown and an annotation used to explain 8 a UUUAAAGCGAGUCGGAAGGG
that this is carried out by DNA ligase that
catalyses the formation of phosphodiester b Restriction enzymes have short target
bonds between sticky ends at either end of sequences that they recognise. See

PDF from sachtienganhhanoi.com

the piece of DNA. Table 19.1 for examples of the restriction
sites for EcoRI and BamHI, etc.
restriction sites
DNA cut by Molecules of gRNA have much longer
restriction plasmid target sequences so detect fewer specific
enzyme
sites compared with restriction enzymes.
restriction
The base sequences within the Crispr
DNA with site
sequence can be modified to match
sticky ends
many more sites, so many more gRNA
molecules can be made than there are
recombinant restriction enzymes.
plasmid cut plasmid
with the same
restriction enzyme c The enzyme Cas9 cuts double-stranded
as used to cut the DNA and removes a section of DNA.
DNA to be inserted If targeted correctly, the gene may be
disabled as the protein produced is not
6 Not necessarily. It depends where the gene for functional. It can also be used to insert
fluorescence is inserted into the plasmid. It is a piece of DNA that corrects a faulty
possible that some bacteria might have taken allele or insert a complete functioning
up plasmids that do not contain the desired gene.
gene but do still contain the fluorescence gene.
9 a A primer is a short length of DNA that
7 The sequence of steps in the flow chart should be: attaches to one end of a single strand of
DNA and allows DNA polymerase to
2 Isolate mRNA for the gene required. begin to make a complementary copy
of the single template strand. A probe is
6 Use reverse transcriptase to produce
a short length of DNA that attaches to
single-stranded cDNA.
part of single strand of DNA. The probe,
4 Use DNA polymerase to produce double- however, is labelled in some way, often
stranded cDNA. with the form of phosphorus that emits
beta radiation (32P). The position of the
8 Use an enzyme to add short lengths of probe indicates the position of DNA.
single-stranded DNA to form sticky ends.

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b The primers do not anneal together d 

All the people who have developed
as they do not have complementary Huntington’s have a band of DNA that
base sequences. If they did have has not travelled very far.
complementary base sequences, they
would form double-stranded DNA and be 
People who only have the smaller
useless as primers. fragments of DNA have not developed
Huntington’s.
c The four deoxynucleotide triphosphates
(dNTPs) are dATP, dCTP, dGTP and Huntington’s is caused by more than
dTTP. 40 repeats of the sequence CAG (see
Chapter 16).
d These have to be DNA polymerases that
are thermostable – able to withstand People with larger fragments of DNA
the high temperatures used in PCR for have developed Huntington’s at earlier
separating the strands of DNA. It is ages than people with the shorter
important to call them DNA polymerases fragments. There appears to be a
as RNA polymerases would not function correlation between length of DNA and
in a PCR machine to copy DNA. the age when symptoms first appeared;
e.g. K has larger fragments than A

PDF from sachtienganhhanoi.com

e Double-stranded DNA is denatured by and has developed symptoms at age 22
heat which breaks the hydrogen bonds compared with age 50.
between base pairs. Primers anneal to
opposite ends of the two strands. DNA B and F have not developed symptoms

polymerase builds complementary but have two different alleles. One of
strands to form double-stranded them has more repeats than the other, but
DNA. not enough to cause Huntington’s.

10 a 256 e K has inherited the dominant allele from

his father (H). The other members of the
b There is no enzyme that will use an RNA family in generations 3 and 4 may also
template to make double-stranded RNA. have inherited the dominant allele from
Instead, reverse transcriptase uses an C and from H, but it is not certain that
RNA template to make single-stranded they have. They could consider taking the
DNA. genetic test for Huntington’s.

This DNA can then be replicated using 12 STRs from the X and Y chromosomes are
DNA polymerase and this can be used used to identify the sex of the person whose
in PCR as shown in Figure 19.12. In this DNA is being tested.
way, multiple copies of cDNA can be
made which hold the information in the 13 a Gene probes from all of the genes in
original mRNA. the human genome can be placed on
a microarray. The mRNA from the
11 a PCR amplifies the samples of DNA cytoplasm of a cell is isolated and
from each member of the family so it is converted into single-stranded DNA
possible to see the DNA in bands on the using reverse transcriptase that uses DNA
electrophoretogram. nucleotides (dNTPs) that have fluorescent
tags. The quantity of this DNA can be
b 
Fragments of different lengths pass increased by PCR. Single-stranded cDNA
through the gel at different speeds. Larger is then applied to the microarray. cDNA
fragments travel more slowly through the hybridises with the appropriate gene
pores in the gel than smaller fragments. probes on the microarray and these are
detected when the microarray is scanned.
D has only one band so must be
c 
Spots that fluoresce indicate the genes
homozygous for the normal allele, all the
that have been transcribed to produce
others who were tested had two bands so
the mRNA that was isolated from the
are heterozygous.
cytoplasm.

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b Mature red blood cells have no nucleus • ensuring the gene is inserted into the
so transcription does not occur. However, genome in a place where it cannot do
there may still be some mRNA left in the harm, e.g. by inserting into the middle
cytoplasm especially if the red blood cell of a gene that codes for an important
has only just left the bone marrow where enzyme or protein that regulates the
it was produced from stem cells. Most of cell cycle
this mRNA will be for the α and β globin
• choosing a suitable promoter to ensure
polypeptides for making haemoglobin
the gene is transcribed
molecules.
• finding people who are willing to
14 The genotype will be either homozygous volunteer for trials of the gene therapy.
dominant or heterozygous for the CFTR gene.
18 rDNA is used in gene therapy. The rDNA
15 Genetic screening can be offered to couples to could be viral DNA and a normal allele used
find out if they are carriers of genetic diseases. to correct a genetic fault. rDNA is inserted
The tests are likely to target any disease(s) into microorganisms and cells of eukaryotes
known to be in their families and any that to make recombinant proteins. Examples
are known to be associated with their ethnic are (recombinant) insulin, factor VIII and
group. For example, sickle cell anaemia in

PDF from sachtienganhhanoi.com

adenosine deaminase (ADA). There are many
peoples in parts of Africa, the Caribbean, more recombinant human and animal proteins
South America, the Middle East and Asia. that are available.
Also thalassaemia in peoples from around the
Eastern Mediterranean and cystic fibrosis in 19 There is no easy answer to this question.
peoples of Northern European origin. Based on the text, you may wish to consider
the implications of germ line gene therapy and
16 Use gene editing to silence the dominant whether this should be permitted. There are
allele in all the cells where the gene HTT is several websites that have information which
expressed. This could be done using Crispr/ might help you:
Cas9 to disrupt a section of the DNA,
possibly its promoter. If the dominant allele is https://www.beep.ac.uk
not transcribed then the elongated molecules
of huntingtin would not be produced. https://learn.genetics.utah.edu/
Unfortunately, it is likely to prove difficult to 20 a The Bt toxin kills pests so farmers use less
alter the genomes of all the cells in the body pesticides and less of their crops are lost
where huntingtin is produced. to pests. This improves yields so reduces
Much more likely is to use genetic screening costs and increases profits for farmers.
and genetic counselling to reduce the number There are also health benefits for farm
of children born with Huntington’s disease. workers who used to apply pesticides
in many countries without taking the
17 Some of these challenges are: appropriate precautions.
• identifying the gene that causes the b 
Grow cells in tissue culture and insert
genetic disease gene(s) into individual cells. Each
• making copies of the normal allele of the genetically modified cell can grow into a
gene for use in gene therapy whole plant so that the inserted gene(s) are
in all of the cells of the plant. Plants are
• finding a suitable vector to deliver the grown that have been genetically modified
gene into the genome of the specialised and show all the features required, e.g. pest
cells where it is expressed resistance and high yield.
• finding a way to get cells to take up
the vector

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

21 potential risks: • The use of genetically modified (GM) crops

increases yields and provides more food for a
• The spread of herbicide resistance to
growing population.
weeds so they become ‘superweeds’ and
cannot be killed by spraying chemicals. • GM crops decrease losses to competition with
weeds and feeding by insect pests.
• Resistance genes may spread to non-
GM crops and ruin their organic status, • The use of pesticide-resistant crops reduces
especially important in countries where pesticide use by farmers.
GM crops are viewed with suspicion.
• Animals can be genetically modified so that
• Genes may spread to wild relatives of they grow faster and make more efficient use
crop plants and change their genomes. of their feed.
• Genetic modification may make crop • GMOS and eukaryotic cells can be used to
plants or their wild relatives invasive and produce human proteins, such as insulin,
spread rapidly in places where they are adenosine deaminase and factor VIII.
not wanted or make them poisonous
• Gene editing is likely to have many uses in
to wildlife.
changing DNA in silencing faulty alleles and
• Use of pesticide resistance genes increases correcting them.

PDF from sachtienganhhanoi.com

selection of resistance in the pest species
• Gene therapy can be used to treat and perhaps
(e.g. widespread use of Bt corn has
cure genetic diseases, such as ADA-SCID and
increased selection of corn rootworms
the eye disease LAC.
that are not killed by Bt).
Some of the hazards that could be incorporated into
• GM crops could produce substances that
a thinking map:
promote allergic reactions in people (e.g.
a gene from Brazil nuts inserted into soya • Herbicide resistance genes could be transferred
beans to improve their quality produced in pollen to weed species and lead to the
an allergic response in people). development of ‘superweeds’ that are resistant.

ways to minimise risks: • Foreign genes could be transferred to wild

relatives of crop plants so changing their
• Use crop rotations rather than plant the genomes; this may ‘pollute’ those species that
same crop year after year in the same fields may prove useful sources of genes for crop
to reduce any adverse effects of GM crops. improvement in the future.
• Test the effects of GM varieties on the • Foreign genes can ‘pollute’ non-GM and
environment before they are released for organic crops, which require certification that
use by farmers. they provide ‘GM-free’ food.
• Prevent transfer of genes from GM • GM crops require more herbicide applications
crops by making it impossible for them and just as much pesticide as non-GM crops
to interbreed with related species in the so there is no advantage in terms of cost to
nearby environment. farmers or reduction in chemicals used in
• Use ‘buffer zones’ around fields of GM agriculture.
crops to reduce transfer of genes to • Farmers cannot keep seed for sowing for the
related species or organic crops. following crop as GM crops do not ‘breed
true’; this favours large-scale commercial
farmers and does not favour many farmers in
Reflection less economically developed countries.
Templates for thinking maps can be found online. • GM microorganisms could ‘escape’ from
A ‘double bubble’ map is a good way to present industrial facilities where they are used.
comparisons – as here between benefits and
• Genes inserted into human genomes by gene
hazards.
therapy could have unforeseen effects.
Some of the benefits that could be incorporated into
a thinking map:

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter 19
Exam-style questions
The mark schemes, suggested answers and 1 a Enzyme Role
comments that appear here were written by the
author(s). In examinations, the way marks would DNA ligase catalysing formation of
be awarded to answers like these may be different. phosphodiester bonds

PDF from sachtienganhhanoi.com

to join together the
sugar–phosphate
Notes about mark schemes backbones of two
A or accept indicates an alternative acceptable pieces of DNA
answer.
DNA synthesises, polynu-
R = reject. This indicates a possible answer that polymerase cleotides / strands,
should be rejected. of DNA in (semi-con-
servative) replication
; The bold semicolon indicates the award of from, dNTPs / activated
1 mark. (DNA) nucleotides
/ This indicates an alternative answer for the same restriction cut DNA at specific
mark. The alternatives may be separated from the enzymes restriction sites
rest of the answer by commas.
reverse synthesises cDNA from,
( ) Text in brackets is not required for the mark. transcriptase dNTPs / activated
nucleotides, alongside
Underlining This is used to indicate essential
an RNA template
word(s) that must be used to get the mark.
Cas9 cuts DNA at specific
AW means ‘alternative wording’. It is used to positions determined
indicate that a different wording is acceptable by the base sequence
provided the essential meaning is the same, and is of a molecule of guide
used where students’ responses are likely to vary RNA
more than usual.
AVP means ‘additional valid point’. This means Award 1 mark per row. [5]
accept any additional points given by the student b 
recessive allele often, does not code for
that are not in the mark scheme, provided they a protein / codes for a non-functioning
are relevant. But accept only as many additional protein ;
points as indicated by the bold semicolons, e.g.
AVP ; ; means award a maximum of 2 extra marks. 
any allele inserted into a cell should
produce a functioning protein ;
ORA means ‘or reverse argument’ and is used
when the same idea could be expressed in the 
dominant allele codes for a
reverse way. For example: ‘activity increases malfunctioning allele ;
between pH2 and pH5 ORA’ means accept 
dominant allele needs to be, ‘switched off’
‘activity decreases between pH5 and pH2’. / ‘silenced’, which is difficult ;
max. This indicates the maximum number of 
gene therapy cannot target the exact
marks that can be given. location in a chromosome where a piece

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

of DNA should be inserted to disrupt an discrimination by, employers / insurers ;

allele (e.g. by introducing a stop codon) ; ethical issue(s) raised by termination of
 [max. 3] pregnancy following prenatal
c advantages to max. 4: screening ;

removes uncertainty for those with a

 AVP ; [max. 7]
genetic disease in the family ;  [Total: 15]
genetic screening provides information 2 a i guide RNA / gRNA ;
about the increased risk of people having to max. 2:
genetic conditions (e.g. breast cancer) ;
20-base sequence is complementary to
allows early treatment ; a specific sequence in DNA ;
which may improve, life expectancy / gRNA binds to DNA ;
quality of life ;
directs Cas9 to site that is to be cut ;
allows people to prepare for late-onset  [max. 3]
genetic conditions, such as Huntington’s
disease ; gRNA locates part of faulty allele ;
ii 

Cas9 cuts the sugar−phosphate

PDF from sachtienganhhanoi.com

genetic tests can identify whether embryos
produced by IVF or embryos / fetuses backbone of both strands of DNA ;
developing in the womb are going to 
piece of DNA with correct base
develop a genetic condition ; sequence inserts into the break in DNA ;
identifies fetuses that will need early 
DNA repair mechanism forms
treatment if they go to full term ; phosphodiester bonds so piece of
allows parents to prepare for the birth DNA restores correct base sequence ;
of a child who will need treatment for a  [max. 3]
considerable time or even throughout life ;
b i 
(helper) T-lymphocytes activate B cells
identifies carriers of genetic conditions ; during immune response ;
helps to provide early diagnosis ; 
stimulate B cells to differentiate into
allows couples who are both carriers of a plasma cells ;
genetic condition to make decisions about, 
(killer) T-lymphocytes search out
starting a family / having more children / infected cells ;
seeking IVF and embryo biopsy ;

release toxic substances into
reducing the number of people with, long- cells ;  max. [2]
term / incurable conditions and thereby
ii 
Cas9 cuts the gene that codes for
save the money that would be used to pay
protein PD-1 ;
for their treatment ;

repair mechanism introduces nucleotides
AVP ;
that change the coding for PD-1 ;
disadvantages to max. 4:

a stop codon could be introduced into
results may be false, positives / negatives ; the base sequence ;

genetic test may not be test for all 
so mRNA is produced but no
mutations ; functioning protein is translated ;
tests may not be available for genetic 
if there is an insertion of a base or a
condition in a family ; deletion of a base, a frameshift occurs ;
positive result gives, stress / fear ; 
all codons downstream of break in
presence of mutant allele may not result DNA are changed ;
in the condition ; so that a protein with a very different

may cause needless, worry / anxiety ; amino acid sequence is produced that
is non-functional ; [max. 5]
problem for people communicating result
of test (e.g. to friends / family) ;

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

c i 
easy to obtain blood cells and stem ii the DNA that is separated into two
cells from bone marrow ; strands in the first cycle is the DNA

remove cells from the body and culture from the whole sample ;
them ; this is much longer than the strands
easy to direct Cas9 into the cells ; that separate during all subsequent
cycles ;
far more difficult to direct Cas9 into
nerve / muscle cells throughout the there are more hydrogen bonds that
have to break during the first cycle ;
body ; [max. 3]  [max. 2]
ii 
no risk of an immune response (as d 
different target DNA has different base
there is to a virus) ; sequences, so a pair of primers like those

no risk of an infection (as there may in the previous question is not suitable ;
be with a virus) ;  [2]

targeting of the change to DNA is far e the concentration of primers is very high
more precise ; [3] and the concentration of single-stranded
DNA is very low ;
 [Total: 19]

PDF from sachtienganhhanoi.com


the chance of single-stranded DNA
3 a 
(thermostable) DNA polymerase / Taq
reforming double-stranded is very low ;
polymerase ;  [1]
 [2]
b i 
at high temperatures the double-
f 
PCR occurs at temperatures between 50 °C
stranded DNA is denatured ;
and 90 °C, not at temperatures below 40 °C ;

hydrogen bonds break so that the two
the primer is DNA not RNA ;
strands separate exposing the
bases ; [2] 
replication copies the entire DNA in a cell,
PCR only copies small stretches of DNA ;
ii 
polymerase is, thermostable / not
denatured at high temperature ; 
the DNA polymerase used in PCR is
thermostable, in most organisms it is not /

ref to bonding that maintains tertiary
only in thermophilic organisms ;
structure ; [2]
PCR occurs in small plastic tubes![4]
iii 
a buffer solution maintains a constant
pH in the region of 7 to 8 ;  [Total: 20]

optimum pH for DNA polymerase ; 4 a i 
a marker gene is transcribed along
with the structural gene(s) ;

magnesium ions are a cofactor for the
enzyme ; [max. 2] 
GFP is produced (as well as required
protein) ;
c i stage 2 is annealing:
GFP fluoresces ;
primers bind with the target sequence

on DNA where there is a sequence of 
fluorescent, cells / organisms, indicate
complementary bases ; that they have, been transformed /
received the required (foreign) gene ;

stage 3 is the elongation or extension
 [max. 3]
stage:
ii 
if provided with a substrate the
DNA polymerase adds nucleotides to
enzyme can produce larger quantity
the primer to form double-stranded
of fluorescent substance than
DNA ;
transcription and translation of a gene
using the original strand as a template ; for GFP ;
 [3]

intensity of colour less dependent on
the level of expression of the marker
gene ; [max. 1]

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

b i either     
direct entry by firing DNA-coated
use PCR with a suitable primer ; tungsten particles into cells ;


to amplify the region of the genome     
direct entry by injection into
that contains the gene ; cytoplasm ;

or     electroporation ;

identify mRNA from a suitable cells ;

     electric shock given to cell
membrane ; [max. 3]
use reverse transcriptase ;
c three copies of each gene ;
to synthesise cDNA ;
larger quantity of growth hormone
or produced than in diploid salmon ;

use amino acid sequence of growth triploid fish grow, faster / larger, than
hormone from chinook salmon to diploid fish ;
predict the nucleotide sequence ;
triploid organisms are sterile ;
synthesise the DNA without the
need for pre-existing DNA (synthetic 
chromosomes cannot pair at beginning of
biology) ; meiosis ;

PDF from sachtienganhhanoi.com

or so no gametes are formed ;


fragment DNA with restriction triploid fish cannot breed with wild fish ;
enzymes ;  [max. 3]

separate them by electrophoresis ; d GM salmon could escape from fish farms ;


use a gene probe to identify the compete successfully with, wild salmon /
appropriate gene ;  [max. 2] other species ;

ii 
promoter is, ‘upstream’ of the introduce (new), disease(s) / parasite(s) ;
structural gene / 5´ region next to the change the, ecosystem / food web ;
structural gene ; mutation may give rise to diploid salmon ;

the promoter is the region of DNA where GM salmon breed with wild salmon ;
(some) transcription factors bind ;
change the genome of wild salmon ;
where RNA polymerase binds to
DNA to begin transcription ; AVP ;

promoter determines the specific cells in  [max. 4]
which the structural gene is expressed ;  [Total: 22]

promoter determines, when / how 5 a vector ; [1]
much, expression there is ; b i use the genetic code ;
 [max. 3]
each DNA, triplet / codon (on coding
   iii 
sequences cut with restriction / non-template strand), codes for a
enzymes to form ‘sticky ends’ ; specific amino acid ;  [2]
    
‘sticky ends’ joined by hydrogen ii search databases for, identical / similar,
bonding ; sequences ;
    
complementary base pairing / A−T find a match with another sequence for
and C−G ; which the protein function is known ;
    sealed by ligase ; predict the tertiary structure of the
    
ligase catalyses formation of polypeptide from the primary
phosphodiester bonds ; structure ;
 [max. 3] compare with shapes of proteins of
   iv use of a vector ; known functions ; [max. 3]
    e.g. virus ;
    into, germ line cells / egg ;

4 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

iii change to bonding between R-groups ; 

tRNA molecules bring specific amino
any example, e.g. ionic / hydrogen, acids to ribosome ;
bond no longer forms ; 
pairing between codons on mRNA and
change to, tertiary structure / (3D) anticodons on tRNA ;
shape, of AChE ; 
enzyme / peptidyl transferase (in ribosome),
part of AChE / protein, where catalyses formation of peptide bonds
insecticide binds changes shape ; (between amino acids) ;

insecticide molecule can no longer ribosome assembles amino acids into

bind to AChE ; [max. 3] toxic protein ;

c spontaneous mutation ; 
ref to Golgi body and modification of
protein / any example ; [max. 5]
change in DNA base sequence (of the
gene Ace) ; d any two suitable reasons, examples:

any example ; e.g. base substitution (see see if GM crop grows well under,
example given in the question and use the field conditions / range of different
genetic code to suggest the base change) environmental conditions ;
to see if GM crop has a suitable yield ;

PDF from sachtienganhhanoi.com

aphids which express the mutation are not
killed by, pirimicarb / insecticide ; ORA ensures that resistance is effective ;
pirimicarb cannot bind to AChE, so it check that plants are not harmful to the
remains active ; environment ;
resistant aphids have greater chance to check that plants respond to fertiliser ;
reproduce ;  [max. 3]
(natural) selection ; e pesticides:
selective agent is pirimicarb ; reduce losses of crops to, pests ;
directional selection ; reduce use of pesticides ;
frequency of resistant allele increases ; better for health of, farm workers / local
allele remains beneficial so long as population ;
pirimicarb is used ; [max. 6] less pesticide residues in crops ;
 [Total: 15] better for health of consumers ;
6 a to allow RNA polymerase to start no / less, harm to non-pest species ;
transcription ; less pollution ;
in, host / plant, cells ; herbicides:
site of action of host transcription factors less competition with weeds for (named)

to activate transcription ; [max. 2] resources ;
b 
joins the phosphate−sugar backbone of 
idea that increase in food available for
(fragments of) DNA together ; human population which is increasing ;
catalyses formation of phosphodiester AVP ; (for either pesticides or herbicides
bonds ; or for both) [max. 5]
joins promoter to gene for Bt toxin and  [Total: 17]
gene + promoter to plasmid ; [max. 2]
7 a i substitution ; [1]
c 
gene / cry, codes for the sequence of
amino acids in, toxic protein ; ii 
tertiary structure of the, protein /
polypeptide, may change ;
gene / cry, is transcribed to form mRNA ;
A folding of the polypeptide is

mRNA moves from nucleus to cytoplasm ; different because amino acids with
mRNA attaches to ribosome where non-polar R groups form hydrophobic
translation occurs ; ‘pockets’ inside the tertiary structure ;

5 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

amino acids with polar R groups form ii founder effect ;

hydrogen bonds ; groups of people are all descended
hydrophobic ‘pocket’ may not from very small populations ;
form when proline is replaced with genetic drift ;
glutamine ;
non-random mating / mating within
hydrophobic (non-polar) R group the group rather than with people
replaced by hydrophilic (polar) R from other groups ;
group ;
increases the chances that frequency
this may change solubility of protein ; of mutant allele becomes common
AVP ; [max. 3] within the group ; [max. 3]
b BRCA-1: iii the proportion of the population
the mutant allele will be expressed in each that has mutations of BRCA-1 and
person who inherits it ; BRCA-2 may be quite small ;

so increasing risk of developing breast cost-effective to concentrate screening

cancer ; on, ethnic groups / populations, at
risk ;

PDF from sachtienganhhanoi.com

CFTR:
can offer screening to particular
anyone with one copy of mutant CFTR, families at risk ;
does not express it / is a carrier ;
more cost effective than mass
so not at risk of CF ; screening for the mutant allele(s) ;
woman who has one parent with one people identified as ‘at risk’ can be
mutant allele of BRCA-1 has a 50% offered genetic counselling ;
chance of increased risk of breast cancer
associated with the mutant allele ; allows people at risk to be given
appropriate information about the
person with one parent with mutant allele effects of the mutation ;
of CFTR has 0% chance of inheriting, the
disease / CF ; AVP ; [max. 3]

parents of person with CF are both  [Total: 15]

carriers ; ORA [max. 3]
c i deletion leads to a frameshift /
described as change to the reading
frame ;
results in a stop codon in the DNA ;
no tRNA for the stop codon, so
translation terminates (at amino acid 38) ;
 [max. 2]

6 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Sample answers have been written by the authors.

Coursebook answers
Chapter P2
Self-assessment questions
1 Read the position of the meniscus at time 0, 5 The intermediate values in the calculation
and then again after a measured length of have been given to 3 decimal places. The final
time – say, five minutes. The rate of movement value of s is rounded to 2 decimal places.

PDF from sachtienganhhanoi.com

of the meniscus will be proportional to the
rate of respiration of the yeast. x (x – x̄) (x – x̄)2
2.8 – 0.216 0.047
2 All except c, the length of the capillary tubing. 3.1   0.084 0.007
It is probably also unimportant to control the
2.9 – 0.116 0.013
light intensity, f.
3.2   0.184 0.034
3 a Use a top pan balance to measure 1 g of 2.9 – 0.116 0.013
glucose. Place in a volumetric flask with 2.7 – 0.316 0.100
some distilled water and dissolve fully. 3.0 – 0.016 0.000
Make up to 100 cm3 with distilled water.
2.8 – 0.216 0.047
b Use a top pan balance to measure 2.5 g of 2.9 – 0.116 0.013
glucose. Place in a volumetric flask with 3.0 – 0.016 0.000
some distilled water and dissolve fully. 3.2   0.184 0.034
Make up to 250 cm3 with distilled water. 3.1   0.084 0.007
c Calculate the relative molecular 3.0 – 0.016 0.000
mass of glucose. This is (6 × 12) + 3.2   0.184 0.034
(12 × 1) + (6 × 16) = 72 + 12 + 96 = 180. 3.0 – 0.016 0.000
3.1   0.084 0.007
Use a top pan balance to measure 180 g
3.3   0.284 0.081
of glucose. Add this to a small amount of
distilled water in a volumetric flask. Add 3.2   0.184 0.034
distilled water to make the solution up to 2.9 – 0.116 0.013
a total volume of 1 dm3. ∑x = 57.3 ∑(x - x̄ )2 = 0.484
n = 19 n − 1 = 18
d Measure 0.5 dm3 of the 1 mol dm–3 x̄ = 3.016 ∑(x − –x)2
solution into a volumetric flask. Add = 0.269
n−1
water to make up to 1 dm3.
s = 0.269
e A suitable range could be 0 (distilled = 0.16
water) to a 1% solution. The intervals
could be 0.2%, so that the individual 6 s = 0.16
solutions would be: 0, 0.2%, 0.4%, 0.6%, n = 19
0.8% and 1%. s
SE =
n
4 They are all the same. 0.16 0.16
= = 4.36 = 0.04
19

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

7 The intermediate values in the calculation Σ (x − x–)2 = 13 659

have been given to 3 decimal places. The final
∑(x − x–)2
value of s is rounded to 2 decimal places. s=
n−1
x (x – x̄) (x – x̄)2
57 −38.575 1488.031 13 659
=
60 −35.575 1265.581 39
67 −28.575 816.531
= 350.23
72 −23.575 555.781
= 18.71
72 −23.575 555.781
18.71
76 −19.575 383.181 8 SE =
78 −17.575 308.881 40
18.71
79 −16.575 274.731 =
6.32
81 −14.575 212.431
= 2.96
83 −12.575 158.131
84 −11.575 133.981 9 a
86 −9.575   91.681

PDF from sachtienganhhanoi.com

Error bars represent
87 −8.575   73.531 ±2 × the standard deviation
88 −7.575   57.381 100
88 −7.575   57.381
90 −5.575   31.081
92 −3.575   12.781
80
92 −3.575   12.781
93 −2.575    6.631
94 −1.575    2.481
95 −0.575    0.331 60
Mean mass / g

97   1.425    2.031
98   2.425    5.881
99   3.425   11.731
100   4.425   19.581 40
101   5.425   29.431
101   5.425   29.431
103   7.425   55.131
20
105   9.425   88.831
106   10.425 108.681
107   11.425 130.531
109   13.425 180.231 0
111   15.425 237.931 Lemon fruits set 1 Lemon fruits set 2
113   17.425 303.631
b The error bars for the two sets of fruits
119   23.425 548.731
do not overlap, so it is possible that the
120   24.425 596.581
difference between them is significant.
125   29.425 865.831 You cannot be sure about this and would
128   32.425 1051.381 need to do a further statistical test, such
132   36.425 1326.781 as a t-test, to be able to answer this
135   39.425 1554.331 question.
∑x = 3823 ∑(x - x̄ )2 = 13 643.790
n = 40 n – 1 = 39
x̄ = 95.575 ∑(x − –x)2
= 349.841
n−1
s= 349.841 = 18.7

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

10 a D, E

b A

c C, D

d C, D, E

e C, D

Reflection
Many learners (and teachers) will have experiences
that will cause them to support the idea that it
is more difficult to achieve the ‘right’ results in
biology experiments than in physics or chemistry.
Learners should be encouraged to use their own
experiences of practical work in biology, and

PDF from sachtienganhhanoi.com

also in physics and chemistry if they have this
experience, to support their viewpoint.
There could be quite wide-ranging discussion of
whether this is correct, and if so why. Learners
could be encouraged to think about:
• what is meant by the ‘right’ results – are any
results ever ‘wrong’, or do we just interpret
them inappropriately?
• the inherent variability of biological material
• the complexity of many experiments in
biology, where many different variables need
to be standardised, and it is often difficult or
impossible to do this successfully
• the complexity of the relationship between
independent variables in biology, where there
is rarely a simple mathematical relationship
such as you would expect to find in physics
• the difficulty of measuring the dependent
variable in many biology experiments, where
you cannot use a simple instrument to do so
but have to devise techniques that may not be
entirely valid, accurate or precise.
The discussion could then lead on to why we need
to use statistical tests in biology, whereas these are
not used in chemistry or physics (at least at this
level).

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.

Coursebook answers
Chapter P2 Underlining This is used to indicate essential
word(s) that must be used to get the mark.
Exam-style questions AW means ‘alternative wording’. It is used to indicate
At this level, practical skills are examined in a that a different wording is acceptable provided the
laboratory-based practical examination. The essential meaning is the same, and is used where
questions in the Coursebook are for practice in the students’ responses are likely to vary more than usual.
theoretical aspects of these skills. For laboratory- AVP means ‘additional valid point’. This means

PDF from sachtienganhhanoi.com

based practice practical questions, please see the accept any additional points given by the student
Practical workbook in this series. that are not in the mark scheme, provided they
are relevant. But accept only as many additional
The mark schemes, suggested answers and
points as indicated by the bold semicolons, e.g.
comments that appear here were written by the
AVP ; ; means award a maximum of 2 extra marks.
author(s). In examinations, the way marks would
be awarded to answers like these may be different. ORA means ‘or reverse argument’ and is used
when the same idea could be expressed in the
Notes about mark schemes reverse way. For example: ‘activity increases
A or accept indicates an alternative acceptable between pH2 and pH5 ORA’ means accept
answer. ‘activity decreases between pH5 and pH2’.
R = reject. This indicates a possible answer that max. This indicates the maximum number of
should be rejected. marks that can be given.

; The bold semicolon indicates the award of 1 a axes of scatter graph are labelled length /
1 mark. mm and mass of seeds / g ; note that it
does not matter which is on the x-axis and
/ This indicates an alternative answer for the same which is on the y-axis
mark. The alternatives may be separated from the
rest of the answer by commas. suitable scales on each axis ;
all eight points correctly plotted ;[3]
( ) Text in brackets is not required for the mark.
b positive linear correlation ;[1]

1 c Pod Length / mm x Mass of seeds / g y xy

1 134 35 4690
2 71 18 1278
3 121 30 3630
4 83 21 1743
5 99 23 2277
6 107 29 3103
7 82 17 1394
8 119 34 4046
mean –
x = 102.0 –
y = 25.9 Σxy = 22 161
nx–y– 8 × 102.0 × 25.9 = 21 134.4
standard sx = 22.1 sy = 7.1
deviation

1 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

∑xy − nxy 6 × ∑D 2
r= r1 = 1 −
nsxsy n3 − n
(6 × 160.5)
22 161 – 21 134.4 r=1−
r= (83 − 8)
8 × 22.1 × 7.1
22161– 21134.4 963
r= r = 1 − 512 − 8
1255.3
1026.6 963
r= r=1−
1255.3 504
r = 0.82 r = 1 − 1.91
This number is close to 1, which suggests that r = −0.91
there is a linear correlation between the length of Using Table P2.8, the critical value of r when
the pods and the mass of the seeds they contain. n = 8 is 0.76.
means for length and mass both correct ; The value of r is greater than this, so there is
mean for mass correct ; a significant negative correlation between the
numbers of F and the numbers of G.
all values for xy correct ;

PDF from sachtienganhhanoi.com

working is clearly laid out and easy to follow ;
Σxy correct ;
ranking correct for F and G ;
nx y correct ;
all values for D and D2 correct ;
correct formula used ;
ΣD2 correct ;
substitution into formula correct ;
substitution and calculation of r correct ;
correct value for r calculated ;
identification of the critical value in the
statement explaining what this value
table ;
indicates ; [max. 8]
correct conclusion drawn ;  [7]
 [Total: 12]
 [Total: 12]
2 a axes of scatter graph are number of
species F and number of species G ; note 3 a i light intensity / exposure to light ;  [1]
that it does not matter which is on the ii independent variable: collect large
x-axis and which is on the y-axis number of leaves from a sunny area
suitable scales on each axis ; and a shaded area ;
all eight points correctly plotted ;  [3]   control variables: collect leaves in
a way that controls at least one key
b a negative non-linear correlation ;  [1]
variable ; (e.g. all from same height,
c the correlation is non-linear ;[1] all from same relative position on the
ivy stem)
d
  measuring dependent variable /
Quadrat Rank for Rank for Difference D2 procedure: suitable description of
species species in rank, method of finding surface area of
F G D each leaf ;
1 5 2.5 2.5 6.25
  reference to multiplying by 2 to find
2 2 7 -5 25 total surface area ;
3 8 2.5 5.5 30.25   suitable description of how to find dry
4 3 6 -3 9 mass, including reference to method
5 1 8 -7 49 of drying and apparatus used for
measuring mass ;
6 7 1 6 36
7 4 5 -1   1   suitable description of how to measure
internode length, including apparatus
8 6 4 2 4
used ;
ΣD2 160.5

2 Cambridge International AS & A Level Biology © Cambridge University Press 2020

 CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

  suitable description of method of   use syringe to begin with water at a

measuring water loss (e.g. by weighing suitable point in the tubing ;
or by using a potometer) ;   leave for some time to settle
  description of controlling one key down before beginning to take
variable (temperature, humidity, measurements ;
wind speed) while measuring rate of   reliability: do replicates and calculate
water loss ; means ;
  description of replicates and   risk: no significant risk / reference
calculation of mean values ; to care needed when, cutting shoot /
  processing data: reference to pushing shoot into capillary ; [max. 8]
calculation and use of standard iii s uitable method described for finding
deviation (to give the ± values) ; the volume of a cylinder ;
  safety: reference to risk, e.g. that r efer to using distance moved by water
there are no significant risks in this calculation ;
involved ;  [max. 8]
  or
b i t = 23 – 15 ;
  use the syringe to push the water back

PDF from sachtienganhhanoi.com

   +32 ÷ 30 ; to its starting position ;
   8 ÷ 0.9 = 8.9 ; [3]   measure volume of water needed to
ii v = (n1 – 1) + (n2 – 1) = (30 – 1) do this ; [max. 2]
+ (30 – 1) = 58 ; [1] b axes with independent variable on the
iii 
both values of t are (much) greater x-axis and the dependent variable on the
than 2.00 / greater than the critical y-axis ;
value (for 60 degrees of freedom) ; suitable curve or bars to show results
   t herefore the results are significant / (this depends on what is being measured
the differences between the two sets and how) ; [2]
of leaves are significant / not due c i  area = 36 / 10 000 = 0.0036 m2 ;
to chance ; [2]
   water loss = 0.018 / 30 = 0.0006 cm3 min–1 ;
 [Total: 15]
  rate = 0.0006 / 0.0036 = 0.167 cm3
4 a i e .g. the rate of water loss from a m–2 min–1 ;[3]
mesophyte will be greater than the rate
of water loss from a xerophyte ;[1] ii t-test ;
ii independent variable: collect, shoots   comparing the means of two sets
/ leaves, from a mesophyte and of, data with normal distribution /
xerophyte ; continuous data ;[2]
  measuring the dependent variable: d mesophyte has a greater transpiration rate
record rate of movement of meniscus than the xerophyte ;
along the capillary tube, include both lose less mass when lower surface
reference to distance and time ; is covered ;
  control variables: shoots / leaves, with more water lost from lower surface than
similar surface areas ; from upper surface ;
same temperature / wind speed /
xerophyte loses almost no water from its
humidity ;
upper surface ; [max. 3]
  procedure: cut shoot under water with
 [Total: 21]
slanting cut ;
  dry shoot before beginning
measurements ;
   ensure apparatus entirely airtight ;

3 Cambridge International AS & A Level Biology © Cambridge University Press 2020