Food Control 140 (2022) 109138

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Development and validation of a novel real-time PCR protocol for the

detection of buffalo worm (Alphitobius diaperinus) in food
Cristiano Garino a, *, Ralf Winter a, Hermann Broll a, Matthias Winkel a, Albert Braeuning a,
Felix Reich b, Jutta Zagon a
a
German Federal Institute for Risk Assessment (BfR), Dept. Food Safety, Max-Dohrn-Str. 8-10, 10589, Berlin, Germany
b
German Federal Institute for Risk Assessment (BfR), Dept. Biological Safety, Max-Dohrn-Str. 8-10, 10589, Berlin, Germany

A R T I C L E I N F O A B S T R A C T

Keywords: The year 2021 represented a benchmark for the insect feed and food sector: while new species were authorized
Alphitobius diaperinus for the first time for human consumption, for other insects the authorization as feed for aquaculture was
Food allergy extended to poultry and swine. While these statutory provisions represent a huge incentive for the sector,
Insects
consumers’ safety needs to be safeguarded. This includes as well the setting up of robust laboratory methods for
Real-time PCR
the authentication of these novel products. We present the development and validation of a real-time PCR-based
Detection
Authentication method for the identification of the buffalo worm Alphitobius diaperinus in foods. The specificity of the system was
confirmed with a broad range of plant and animal species. The technical limit of detection with pure A. diaperinus
DNA was lower than a single genome copy. In food, we observed a sensitivity limit ranging from 1 to 20 ppm,
depending on the matrix analyzed and on the degree and the nature of food processing. Practical applicability of
the proposed system was tested on 31 commercial foods declaring the presence of A. diaperinus as well as of other
insects. Based on the validation carried out, the tested system is suitable for routine tests, enabling the sensitive
and reliable detection of the buffalo worm A. diaperinus in complex and processed foods.

1. Introduction drawn up by the European Food Safety Authority (EFSA). The EFSA
Panel on Nutrition, Novel Foods and Food Allergens needs to consider
Insects as food have received quite a lot of attention over the past data on the production process, composition, level of contaminants,
decade, since the FAO has presented them as a potential solution to stability and microbiological status, expected figures of sales, intake
address problems like earth population growth and the increasing de­ assessment, protein digestibility, geno- and cytotoxicity, and allerge­
mand for protein, the subsequent rising cost of animal-derived products, nicity (EFSA NDA Panel, 2021a, b, c, d). Insect allergens can induce
food insecurity and environmental pollution (van Huis et al., 2013, p. primary sensitization (Broekman et al., 2017), and many proteins are
187). homologous to known allergens from crustaceans, house dust mites and
There are thousands of species of edible insects, however, only few other arthropods. Individuals sensitized or allergic to these sources can
have reached the European market so far. Originally considered only as therefore develop symptoms after the ingestion of insects as food due to
a feed source for pets and fur animals, they are slowly making their way cross-reactivity (Garino et al., 2020). Insect-based products for which an
onto the shelves of our supermarkets and into our kitchens. The market approval is pending may be put on the market for a transitional period,
situation within the EU is, at the moment, heterogeneous: because in­ until a decision is made, but only if a corresponding application had
sects have not been traditionally consumed in Europe before 1997, they been filed before 2018. At the time of writing of this manuscript there
are considered as novel foods according to EU Regulation 2015/2283. are four types of insect-derived products included into the EU list of
Their placement on the EU market must be subject to the aforemen­ novel foods, namely the dried larvae of Tenebrio molitor (EU, 2021a), the
tioned regulation, which requires sending an official application frozen, dried and powder forms of Locusta migratoria (EU, 2021b), the
demonstrating the safety of the food product to the European Commis­ frozen, dried and powder forms of yellow mealworm (T. molitor larva)
sion (EC), whose decision will be based on a risk assessment opinion (EU, 2022a) and the frozen, dried and powder forms of Acheta domesticus

* Corresponding author.
E-mail address: [email protected] (C. Garino).

https://doi.org/10.1016/j.foodcont.2022.109138
Received 18 March 2022; Received in revised form 11 May 2022; Accepted 25 May 2022
Available online 27 May 2022
0956-7135/© 2022 Elsevier Ltd. All rights reserved.
C. Garino et al. Food Control 140 (2022) 109138

(EU, 2022b). Table 1

Apart from the official list of authorized novel foods, the current Species and products used for specificity assessment. Weak cross reactions are
situation of the EU market sees the presence of several insect-based reported in footnotes.
products, such as pasta, cookies, breakfast cereals, protein bars, bur­ Insects Reinhardtius hippoglossoides
gers, chips, various snacks, candies and so on, and a daily growing (Greenland halibut)
multitude of small and medium-sized companies operating in the sector. Acheta domesticus (house cricket) Salmo salar (Atlantic salmon)
By mid-2021 there were at least fifteen companies marketing buffalo Alphitobius diaperinus (lesser mealworm Salvelinus alpinus (Arctic char)
worm products in the EU, mostly burgers, protein powder or snacks. beetle)
Blaptica dubia (Guyana orang. spot. Sander lucioperca (zander)
Buffalo worms, also known as lesser mealworms, are common insect
cockroach)
pests in commercial poultry farms, dwelling in litter and manure. It is Bombyx mori (silkworm) Sardina pilchardus (sardine)
one of the most abundant and resilient pest within poultry houses, and a Calliphora vomitoria (blue bottle fly) Scomber scombrus (Atlantic mackerel)
vector of several pathogenic bacteria, viruses, fungi, protozoa and pla­ Drosophila melanogaster (common fruit fly) Scorpaena cardinalis (Eastern red
tyhelminthes that can cause serious poultry and human diseases (Smith scorpionfish)
Galleria mellonella (honeycomb moth) Sebastes marinus (ocean perch)
et al., 2021). The extreme spread of these pests has given rise to the idea Gryllodes sigillatus (Indian house cricket) Solea solea (common sole)
of being able to breed them using side stream products from the Gryllus assimilis (Jamaican field cricket) Sparus aurata (gilt-head bream)
agri-food sector, with the aim of using them as protein source (van Huis Gryllus bimaculatus (Mediterranean field Spondyliosoma cantharus (black
2020). It is to mention though, that farming insects as food or feed re­ cricket) seabream)
Hermetia illucens (black solder fly) Squalus acanthias (spiny dogfish)
quires the same standards of hygiene and high quality feeding stuff as for
Locusta migratoria1 (migratory locust) Thunnus albacares (yellowfin tuna)
any other farmed animal and must follow the European food legislation. Lucilia sericata (Green blow fly) Mammals
Moreover, this insect has found an application also as feed, being Musca domestica (house fly) Antilope cervicapra (antelope)
approved for use in aquaculture since 2018 (EU Regulation 2017/893), Nauphoeta cinerea (speckled cockroach) Bison bison (bison)
and since last year also for poultry and swine (EU Regulation Phoetalia pallida (pallid cockroach) Bos taurus (cattle)
Schistocerca gregaria (desert locust) Bubalus bubalis (domestic water
2021/1372).
buffalo)
Within this study we aimed at developing and validating a new Teleogryllus spp. (cricket) Capra hircus (goat)
robust real-time PCR protocol for the reliable detection of the buffalo Tenebrio molitor (yellow mealworm) Capreolus capreolus (roe deer)
worm Alphitobius diaperinus as native and processed material in food. Zophobas morio (giant mealworm) Cervidae fam. (deer)
Crustaceans Equus caballus (horse)
Cancer pagurus (edible crab) Lepus europaeus (European hare)
2. Materials and methods Cherax quadricarinatus (Australian Oryctolagus cuniculus (rabbit)
freshwater crayfish)
2.1. Samples Crangon crangon (sand shrimp) Ovis aries (sheep)
Eriocheir sinensis (Chinese mitten crab) Sus scrofa (wild boar)
Euphausia superba (Antartic krill) Sus scrofa domesticus (pig)
All 143 DNA samples used in method development and specificity
Homarus americanus (American lobster) Birds
testing in this study were isolated from the products listed in Table 1. Macrobachium rosenbergii (giant river Anas platyrhynchos (duck)
Most of them belonged to the reference material collection of the prawn)
German National Reference Laboratory (NRL) for Animal Proteins in Nephrops norvegicus (Norway lobster) Anser anser (goose)
Pandalus borealis (northern red shrimp) Gallus gallus (chicken)
Feed, BfR, Berlin (Zagon et al., 2018). Samples of L. migratoria, T.
Paralithodes camtschaticus (red king crab) Meleagris gallopavo (turkey)
molitor, Hermetia illucens, A. domesticus and Gryllodes sigillatus dried in­ Penaeus monodon (giant prawn, tiger Phasianus colchicus (pheasant)
sects were kindly provided by the German company Six Feet to Eat prawn)
(Backnanger Strasse 58, 71672 Marbach am Neckar, Germany) and used Penaeus vannamei (European white shrimp) Struthio camelus (ostrich)
for the preparation of the insect mixed powder. Information about the Pleoticus muelleri (Argentine red shrimp) Plants
Portunus pelagicus (blue crab) Allium sativum (garlic)
source of all other samples is reported in Table S1.
Varuna litterata (river swimming crab) Anacardium occidentale (cashew nut)
For the determination of the method sensitivity in a food sample, Xiphopenaeus kroyeri (Atlantic seabob) Apium graveolens (celery)
larvae of A. diaperinus were milled in a laboratory blender (IKA A10 Mollusks Arachis hypogaea (peanut)
Janke und Kunkel Analysenmühle) until a fine powder was obtained. Achatina fulica (giant African snail) Avena sativa (oat)
Amphioctopus aegina (sandbird octopus) Bertholletia excelsa (Brazil nut)
The powder was then mixed at 1% (w/w) ratio with crumbled bread
Buccinum spp. (waved whelks) Cannabis sativa (hemp)
purchased in a local supermarket, and shaken for 1 h in a rotating mixer Callista chione (smooth clam) Capsicum annuum (bell pepper)
(Turbula T2 F, W.A. Bachofen GmbH, Niederau-Heldenbergen, Ger­ Cerastoderma edule (common cockle) Carum carvi (caraway)
many). Two more 100-fold dilutions in crumbled bread were prepared Chamelea gallina (common clam) Carya illinoinensis (pecan)
similarly from this sample, thus obtaining the 100 ppm and the 1 ppm Crassostrea gigas (Pacific oyster) Coriandrum sativum (coriander)
Doryteuthis gahi (Patagonian squid) Daucus carota (carrot)
levels.
Eledone moschata (musky octopus) Fagopyrum esculentum (buckwheat)
Glycymeris spp. (bittersweet clams) Glycine max (soya)
2.2. Model foods preparation Helix lucorum (European snail) Helianthus annuus (sunflower)
Littorina spp. (periwinkles) Hordeum vulgare (barley)
Loligo reynaudii (Cape Hope squid) Juglans spp. (walnut)
Model foods (cookies and canned meat product) were prepared as
Mercenaria spp. (quahogs) Lupinus albus (lupine)
part of the activities envisaged by the national project ALLERGEN-PRO Mizuhopecten yessoensis (Yesso scallop) Macadamia integrifolia (Macadamian
(BLE 281A304A18). nut)
The preparation of the model foods started by preparing an insect Mytilus edulis (blue mussel) Myristica fragrans (nutmeg)
mixed powder containing 6 species of insect: A. diaperinus, T. molitor, H. Paphia spp. (Venus clams) Ocimum basilicum (basil)
Perna canaliculus (greenshell mussel) Oryza sativa (rice)
illucens, A. domesticus, G. sigillatus and L. migratoria. These species were Placopecten magellanicus (sea scallop) Pimpinella anisum (aniseed)
chosen because they were all targets of study for the project ALLERGEN- Ruditapes philippinarum (Manila clam) Pistacia vera (pistachio)
PRO. Whole dried insects were first milled in a laboratory blender (IKA Sepia officinalis (common cuttlefish) Pisum sativum (pea)
A10 Janke und Kunkel Analysenmühle) until a fine powder was ob­ Spisula solidissima (Atlantic surf clam) Salvia officinalis (garden sage)
Fishes Salvia rosmarinus (rosmary)
tained. Equal amounts from each powder were mixed together by
Anguilla anguilla (eel) Secale cereale (rye)
shaking for 1 h in a rotating mixer (Turbula T2 F, W.A. Bachofen GmbH, Cephalopholis fulva (coney, butterfish) Sinapis alba (white mustard)
Niederau-Heldenbergen, Germany). The homogeneity of the insect (continued on next page)
mixed powder was verified through real-time PCR by testing 10

2
C. Garino et al. Food Control 140 (2022) 109138

Table 1 (continued ) A description of all model food samples is provided in Table S2.
Cyprinus carpio (carp) Solanum lycopersicum (tomato)
Dicentrarchus labrax (European seabass) Spirulina spp. (spirulina alga) 2.3. DNA purification and evaluation
Esox lucius (northern pike) Thymus spp. (thyme)
Gadus chalcogrammus (Alaska pollock) Triticum aestivum subsp. spelta (spelt) DNA from all samples included in Table 1 was extracted using a
Gadus morhua (Atlantic cod) Triticum spp. (wheat)
Melanogrammus aeglefinus (haddock) Vaccinium myrtillus (blueberry)
standard cetyl-triammonium bromide (CTAB) protocol according to DIN
Merluccius merluccius (seapike) Zea mays (corn) EN ISO 21571:2013–08 (2013), Appendix A.3. DNA from model and
Mullus spp. (goatfish) Zingiber officinale (ginger) commercial foods was isolated with the NucleoSpin® DNA Food Kit
Oncorhynchus mykiss (rainbow trout) Others (Macherey & Nagel, Düren, Germany), according to the manufacturer’s
Oreochromis niloticus (Nile tilapia) Asteroidea class (starfishes)
instructions. The concentration of DNA extracts was measured by the
Pleuronectes platessa (European plaice) Crocodylidae fam. (crocodile)
Pollachius virens (pollock) Qubit v4 Fluorometer (Thermo Fisher Scientific, Waltham, Massachu­
setts, USA). All DNA samples were tested for the lack of inhibition using
1average Ct of 33.6.
a universal 18S eukaryotic PCR system, as previously described (Zagon
et al., 2017; 2018).
independent DNA extractions for the presence of A. diaperinus,
A. domesticus and H. illucens, using the AdiaCOI as well as two previously 2.4. AdiaCOI primers and probe and real-time PCR conditions
published systems (Garino et al., 2021; Zagon et al., 2018).
For the preparation of the model cookies, whole wheat spelled flour, The primers and probe sequences of the A. diaperinus real-time PCR
purchased in a local supermarket, was incurred with defined amounts of system named AdiaCOI are given in Table 2. Real-time PCR was per­
the insect mixed powder. At first, wheat flour was incurred at 10% (w/ formed as previously described (Zagon et al., 2018). Primers were
w) with the insect mixed powder and shaken for 1 h in the rotating concentrated 300 nM, while the probe concentration was 100 nM (oli­
mixer. Subsequently, a further dilution in wheat flour was performed, in gonucleotides synthesized by TIB MOLBIOL, Berlin, Germany). All
order to obtain the level of incurrence 2400 ppm (400 ppm from each of samples were measured in triplicates. PCR was carried out on a
the 6 employed species). The homogeneity of the dispersion of the insect QuantStudio™ 6 Flex system (Thermo Fisher Scientific, Waltham,
mixed powder, as well as the absence of DNA from A. diaperinus in the Massachusetts, USA) with the following standard program: initial (UNG)
non-incurred whole wheat spelled flour, was verified in real-time PCR step of 2 min at 50 ◦ C and 10 min at 95 ◦ C, followed by 40 cycles of 15 s
using the AdiaCOI system. The so obtained incurred flour was mixed at at 95 ◦ C and 1 min at 60 ◦ C. In all runs a triplicate of no template control
different proportions with more “white” flour and with another (NTC) with water instead of DNA and, if appropriate, negative extrac­
admixture of whole wheat spelled flour and degreased peanut flour at tion controls (NEC) were included. If results of different runs had to be
1000 ppm. The presence of a known amount of peanut in the final compared (e.g. in specificity testing) the threshold was set manually to
cookies was requested by some of the ALLERGEN-PRO project partners. the same level. Baseline was automatically set.
The result was 3 mixed flours incurred at 1200, 240 and 60 ppm of insect
mixed powder, respectively, and at 200 ppm each of peanut. An addi­ 2.5. Method validation
tional flour admixture spiked at 200 ppm with peanut but without in­
sects was prepared for the blank controls. One hundred and fifty grams For the evaluation of the efficiency and the sensitivity the concen­
of each flour admixture were added to butter and white sugar to prepare tration of the DNA extracted from the target organism A. diaperinus was
4 different doughs of 300 g (50% flour, 25% butter, 25% sugar). The expressed as genome copies instead of ng/μl. The conversion was
doughs, containing increasing levels of A. diaperinus powder (0, 5, 20 possible using the information on the genome size retrieved from the
and 100 ppm) were kneaded manually in different bowels. From each public animal genome size database of the University of Guelph, Canada
dough, 12 portions of approximately 20 g were laid down on baking (www.genomesize.com), considering an average genome weight of 0.3
paper and placed on an oven tray. Cookies were in prepared in a Steamer pg (C-value = 0.28) for this insect. To calculate the efficiency, 6 serial
Space Combi Compact MP (Maschinenfabrik Kurt Neubauer GmbH & 10-fold dilutions of native A. diaperinus DNA were prepared in a back­
Co. KG, Wolfenbüttel, Germany). Three different time/temperature ground of wheat DNA (10 ng/μl), starting from a maximum of 10000
baking conditions were used, namely 10 min/180 ◦ C, 20 min/180 ◦ C genome copies down to 0.1 copies. Triplicates of each dilution point
and 10 min/210 ◦ C. The weight of each single cookie was registered were measured in real time PCR, and the efficiency was calculated using
before and after baking, in order to keep track of the loss due to the formula E = (10− 1/s - 1) * 100 from the regression curve. For the
water evaporation. calculation of the technical LOD, 7 serial 2-fold dilutions (from 0.4 to
For the analysis in a meat product, canned sausages were prepared in 0.0062 copies) of native A. diaperinus DNA in a background of wheat
the style of a cooked sausage (“Kochstreichwurst”, category 2.231) DNA (10 ng/μl) were measured in 12 replicates. The LOD was consid­
(BMEL, 2015). The meat batter was prepared from lean veal meat and ered valid when all of the 12 replicates displayed Ct values < 35.
fatty pork belly (51% and 49%, respectively). For 1 kg of meat batter, “Practical” LOD was calculated by testing in triplicates the DNA
760 g of diced cooked meat, 90 g of fresh onion, 20 g nitrite curing salt extracted from the 3 serial admixtures of A. diaperinus powder and
and 7 g of spice mixture were added into a knife mill (Grindomix GM crumbled bread described in section 2.1. DNA was extracted in triplicate
300, Retsch, Haan, Germany) topped up to 1000 g with meat broth, and from the first and highest concentration (1% or 10000 ppm), while 10
minced four times at 4000 rpm for 70 s. One batch of canned cooked independent extractions were carried out from the 100 and 1 ppm levels,
sausage was prepared and inoculated with the six species insect mixed to verify the homogeneity of the dispersion of the A. diaperinus powder.
powder at 600 ppm, by evenly spreading the insect powder on the Finally, to evaluate the robustness of the system we followed the
batter. Three more cycles of mincing were performed, until the texture indications provided by the European Network of GMO Laboratories
conformed to typical product characteristics. After the homogeneity of (ENGL, 2015). A 4-factors test (mastermix/real-time PCR instru­
the dispersion of the insect mixed powder was verified in real-time PCR, ment/annealing temperature/primer-probe ratio) was developed: each
three batches were prepared with different concentrations of insect DNA sample was analyzed using 2 mastermixes (TakyonTM Low ROX
powder (incurred at 0 ppm, 30 ppm and 120 ppm). As for the experi­ Probe MasterMix UNG, Eurogentec, Liège, Belgium, and qPCR Master­
mental cookies, each batch also contained peanut powder (100 ppm). mix for probe, low-Rox, Steinbrenner Laborsysteme GmbH, Wiesenbach,
Each 140 g of the sausage batter was filled into 90mm/33 mm com­ Germany), 2 combined primers and probe concentrations (300 and 210
mercial tin cans and each batch was either cooked at 80 ◦ C for 90 min, at nM of primers, 100 and 70 nM of probe), at 2 different annealing tem­
100 ◦ C for 90 min or autoclaved at 121 ◦ C for 30 min. perature (59 and 61 ◦ C), on 3 thermocyclers (QuantStudio™ 6 Flex by

3
C. Garino et al. Food Control 140 (2022) 109138

Table 2
Primers and probe of the A. diaperinus specific real-time PCR system AdiaCOI.
Sequence 5’→ 3′ Concentration/PCR

AdiaCOI-F GGAGCAGGAACTGGATGAACAGT 300 nM

AdiaCOI-R TCTGAAAATGGCTAGGTCTACAGAAGAC 300 nM
AdiaCOI-P FAM-ACCCCCCACTCTCTTCCAATATTGCACAC-BHQ1 100 nM
Amplicon (87 bp) GGAGCAGGAACTGGATGAACAGTGTACCCCCCACTCTCTTCCAATATTGCRCACGGAGGGTCTTCTGTAGACCTAGCCATTTTCAGA

Thermo Fisher, AriaDX 1.5 and Stratagene MX3005P by Agilent mitochondrial targets, and all signals beyond this threshold were judged
Technologies). negative (Garino et al., 2021). The DNA samples of the 3 insects that
showed earlier Ct values were further diluted and analyzed loading only
3. Results 1000 genome copies to each well of the plate. Due to the multi-copy
presence of the target sequence in the mitochondrial genome, a more
3.1. Species specificity appropriate normalization was applied using a specific genome copy
number of 1000 in this subsequent analysis step. The Animal Genome
The AdiaCOI PCR system is targeting the mitochondrial cytochrome Size Database (www.genomesize.com) was used to retrieve C-values of
oxidase c subunit I (COI) barcode sequence. At the time of the investi­ animal genomes for copy number calculation. After this second run, only
gation, only 11 entries of A. diaperinus COI–5P were available from the the grasshopper L. migratoria showed an average Ct value of 33.6.
BOLD database, 3 of them showing unique sequence. The sequence with
the GenBank Accession No. KU910480.1 (658 bp), was used for method
3.2. Efficiency and sensitivity
development. The specificity was first checked in silico by a BLAST
search against primer and probe binding sites on GenBank. A compari­
Efficiency of the AdiaCOI PCR system was assessed by serial dilutions
son between the A. diaperinus-specific primer and probe binding sites
of native A. diaperinus DNA in a background of wheat DNA. An efficiency
with COI sequences from six other closely related species, all belonging
of 97.2% was calculated from the regression curve (slope − 3.4). Good
to the same Tenebrioninae subfamily, demonstrated an encouraging
linearity was observed across the whole dilution range (Fig. 2).
number of mismatches (Fig. 1).
A technical LOD, defined as the lowest dilution level of DNA still
In order to confirm the identity of the A. diaperinus larvae purchased
giving positive results in all the technical replicates, was assessed in a
online, the barcode sequence known as Folmer region (Folmer et al.,
separate experiment. The LOD was considered valid when all of the 12
1994) was amplified according to Nelson et al. (2007), and the resulting
replicates displayed Ct values < 35, and it was 0.1 target copies, cor­
amplicon was sent for DNA sequencing. The results confirmed that the
responding to approximately 30 fg of A. diaperinus DNA, considering an
sample belonged to the correct species. The purified DNA was used for
average genome weight of 0.3 pg for this insect.
the initial end-point PCR to verify the functionality of the primers, dis­
Furthermore, in order to determine the sensitivity of the method in a
playing clear bands of the expected size on the agarose gel (data not
food sample, serial dilutions of A. diaperinus powder in a commercial
shown). Amplification conditions were tested in a preliminary real-time
sample of crumbled bread were prepared. The results of the analysis are
PCR experiment, where different concentrations of each primer were
shown in Fig. 3: for all levels and all replicates, target DNA could be
evaluated. Each primer was tested at 5 different concentrations between
identified.
100 and 500 nM with a SYBR Green-based reaction mix. Ten nanograms
of A. diaperinus DNA displayed Ct values between 14 and 16. Based on
these results, we decided to set the operative conditions at 300 nM for 3.3. Influence of food processing on the sensitivity of the method
both primers.
Specificity was further experimentally confirmed by testing DNA In order to study the impact of physical processing on the sensitivity
samples isolated from different organisms by real-time PCR. These were of the detection method, as well as the ability of the method to work in
19 insects belonging to 5 different taxonomical orders (Blattodea, processed foods, two series of model foods containing A. diaperinus
Coleoptera, Diptera, Lepidoptera and Orthoptera), 16 crustaceans, 22 powder at known incurring levels were prepared (cfr. material and
mollusks, 28 fish, 19 land animals, 37 plants, 1 starfish meal and 1 methods section). Three levels of contamination (5, 20 and 100 ppm)
crocodile (Table 1). Before the analysis, the concentration of each were investigated, while three different “processing” conditions were
sample was measured, and DNAs were diluted down to 10 ng/μl. Two chosen for each series. Three independent DNA extractions were per­
microliters of DNA were used for the analysis. After a first run, samples formed on each model food (cookie or canned meat), the concentration
from Calliphora vomitoria, G. sigillatus and L. migratoria showed positive of each DNA was measured, and a final quantity of 10 ng was used for
results characterized by Ct values between 30 and 35; samples from the analysis. DNAs isolated from cookies were amplified in PCR at all
Blaptica dubia, Phoetalia pallida, H. illucens, Gryllus assimilis, levels of incurrence of insect powder, although at 5 ppm some of the
A. domesticus, Teleogryllus spp. and tomato (Solanum lycopersicum) dis­ replicates displayed Ct values higher than the cut-off value of 35
played late amplification curves with Ct > 35; all other samples did not (Fig. 4A). As for the canned meat, neither the pasteurization at 80 ◦ C nor
amplify. A cut-off at 35 cycles was applied in order to minimize false the boiling at 100 ◦ C hindered the detection of the target insect DNA
positive results occurring when analyzing highly abundant even at the lowest incurring level, as expected. Conversely, DNA samples
isolated from autoclaved meat containing 5 ppm of buffalo worm

Fig. 1. Comparison between A. diaperinus primer and probe binding sites (AdiaCOI) and other members of the Tenebrioninae subfamily. Mismatches highlighted;
agreements = dots.

4
C. Garino et al. Food Control 140 (2022) 109138

Fig. 2. AdiaCOI PCR. Regression curve resulting from three replicates in tenfold dilutions in a background of wheat DNA.

T. molitor, or unspecified cricket flour. The presence of target DNA was

highlighted in most of the samples (21/31), but while the 12 foods
containing buffalo worm were all clearly positive, with Ct values span­
ning from 16 to 23, most of the other foods generated amplification
signals after the 30th cycle (Table 3).

3.5. Robustness test

A qualitative robustness test was performed with the new developed

PCR method. In this test, DNA from A. diaperinus was diluted down to 0.3
genome copies in a background of wheat DNA (10 ng/μl). Three
different real-time PCR instruments, two master mixes, two annealing
temperatures and four primer/probe ratios were included in this
experimental series. The overall robustness of the method is satisfying
(Table 4).

Fig. 3. Performance of AdiaCOI PCR with mixtures of A. diaperinus flour in 4. Discussion

crumble bread.
Foods containing insects are regulated products in the EU, therefore
powder displayed Ct values slightly higher than our internally set it is necessary to develop methods to determine compliance of product
threshold of 35, resulting therefore as not detected (Fig. 4B). content with the label. The undeclared presence of insects among the
ingredients, as well as the presence of a species of insect other than the
one declared, could be an indication of economic fraud, as well as rep­
3.4. Practical applicability to foods resenting a potential risk for the consumer. The hidden ingredient could
pose a threat to the consumer’s health, because it could be the source of
In order to verify the performance of the proposed method on real dangerous contaminants, such as chemicals, biological toxins or aller­
samples, 31 commercial foods from 8 different producers were pur­ gens. As pointed out by the EFSA Panel on Nutrition, Novel Foods and
chased, and DNA was extracted. Twelve foods declared the presence of Food Allergens in its last four opinions on the safety of T. molitor,
A. diaperinus on the label, while the others contained A. domesticus, L. migratoria and A. domesticus as novel foods (EFSA NDA Panel, 2021a,

Fig. 4. Performance of AdiaCOI PCR on processed model foods incurred at known level of A. diaperinus flour.

5
C. Garino et al. Food Control 140 (2022) 109138

Table 3 the presence of insect remains inside the analyzed matrix. However, the
Commercial foods tested. combination of attenuated total reflectance (ATR) FTIR spectroscopy
Food sample insect type labeled content (%) Real-time PCR result and multivariate analysis has recently allowed the specific detection of
A. diaperinus, A. domesticus, L. migratoria, T. molitor and G. sigillatus
protein bar 1 crickets 10 + (30 < Ct < 35)
protein bar 2 crickets 10 + edible insect powders (Mellado-Carretero et al., 2020). Molecular
protein bar 3 crickets 10 – methods are instead able to provide information at species level, and are
protein bar 4 crickets 10 – generally quali-quantitative. The specific detection of A. diaperinus has
protein bar 5 crickets 6 + (30 < Ct < 35) been already achieved in feeds using mass-spectrometry, both in a
protein bar 6 crickets 6
qualitative (Belghit et al., 2019; Ulrich et al., 2017) and with a quanti­
+
protein bar 7 A.domesticus 5.5 + (30 < Ct < 35)
protein bar 8 A.domesticus 5.5 – tative protocol, reaching a LOD of 1% (Leni et al., 2020). As for the
protein bar 9 A.domesticus 5.5 + (30 < Ct < 35) DNA-based molecular methods, many have been published in the recent
protein bar 10 A.domesticus 5.5 – years on the most commonly marketed insects (Debode et al., 2017;
protein bar 11 A.diaperinus 12 +
Marien et al., 2018; Zagon et al., 2018; Kim et al., 2018; Kim et al.,
protein bar 12 A.diaperinus 12 +
protein bar 13 A.diaperinus 12 + 2019a,b; Köppel et al., 2019; Daniso et al., 2020a,b; Zarske et al., 2021;
protein bar 14 A.diaperinus 8 + Garino et al., 2021). A multiplex endpoint PCR method for the simul­
breakfast cereals 1 A.diaperinus 4 + taneous detection of A. diaperinus, Schistocerca gregaria (desert locust)
breakfast cereals 2 A.diaperinus 4 + and Zophobas atratus (giant mealworm) was successfully set up and
breakfast cereals 3 A.diaperinus 4
tested on food (Tramuta et al., 2018). In the course of 2022, the detec­
+
breakfast cereals 4 A.domesticus 50 –
breakfast cereals 5 T. molitor 30 – tion of A. diaperinus by Real-Time PCR for feed control was published.
pasta 1 A.diaperinus 14 + The Authors selected a single-copy cadherin gene as target, and the
pasta 2 A.diaperinus 14 + system was tested on DNA purified from whole insects and insect meals,
pasta 3 A.diaperinus 10 +
obtaining an LOD of 20 copies (Marien et al., 2022). To the best of our
pasta 4 A.domesticus 17 –
burger A.diaperinus 27 + knowledge, this is the first report on a real-time PCR method for the
protein powder A.diaperinus 15 + species-specific detection of the buffalo worm A. diaperinus in food using
backing mix 1 A.domesticus 10 + (30 < Ct < 35) a multi-copy target. The method is based on the amplification of the
backing mix 2 A.domesticus 10 + (30 < Ct < 35) mitochondrial gene for the cytochrome oxidase subunit 1 (COI). This
crispbread A.domesticus 10 (30 < Ct < 35)
multi-copy gene is well known as barcode for animal species recognition
+
crispies T. molitor 47 –
chips T. molitor 18 – (Nelson et al., 2007), it guarantees a high sensitivity and it has been
tortillas T. molitor 38 – extensively used as marker for the identification of insects in complex
matrices (Zagon et al., 2018; Kim et al., 2019a, b; Köppel et al., 2019;
Daniso et al., 2020a; Siozios et al., 2020; Zarske et al., 2021; Garino
b, c, d), the concentration of contaminants in the food depends mainly
et al., 2021). The primer-probe system was tested on a total of 143
on the occurrence levels of these substances in the insect feed, as well as
species, a much greater number of controls compared to those employed
on the other farming conditions. The International Platform of Insects
in recently issued papers on the detection of insects in food (Debode
for Food and Feed (IPIFF) has compiled a guide on good hygiene prac­
et al., 2017; Kim et al., 2019a,b; Köppel et al., 2019; Daniso et al.,
tices addressed to all producers of insects as food and feed in the Eu­
2020b, Marien et al., 2022). The selection of the species was aimed to
ropean Union (IPIFF 2021), but in general by following a correct
have a wide representation of the insects currently available on the EU
protocol it is possible to farm insects that are safe and suitable for human
market. Moreover, we chose to include as many crustaceans and mol­
consumption. Producers following these practices have an interest in
luscs as possible, to fully represent the group of the invertebrates.
developing methods to track their products and confirm the labelling
Finally, fish, mammals, birds and plants commonly used in food prep­
information, while a discrepancy with the label could conceal an
aration were included to rule out the possibility of cross reactions. The
attempt to disguise an altered or contaminated product. Moreover,
system showed good amplification only on the target species, although
independently from the practices followed to farm them, insect proteins
few other insect species displayed late amplification signals: such low
may pose a threat to allergic individuals, particularly those sensitized to
levels of cross-reactivity, as previously acknowledged by other authors
crustaceans or house dust mites (de Gier & Verhoeckx, 2018), and the
(Debode et al., 2017; Köppel et al., 2019; Marien et al., 2018), occurred,
dose at which symptoms start to occur is subjective, therefore a correct
however, at concentration of DNA much higher than the target DNA. It
labelling of insect containing foods would help safeguarding the health
needs to be acknowledged however, that in cases when the concentra­
of allergic consumers (Garino et al., 2020).
tion of template DNA coming from these cross-reactive species is high,
The identification of insects in food and feeds can be realized using
the possibility of false positive results is not negligible. The sensitivity
physical as well as molecular methods. The most common physical
showed a technical limit of detection of 0.1 genome copies, lower than
methods are light microscopy (Ottoboni et al., 2017; Veys & Baeten,
the one reported by Marien and colleagues (2022) and comparable to
2018) and infrared spectroscopy (Mandrile et al., 2018). These methods
the one registered for the detection of H. illucens in feeds using the same
are generally not species-specific, and can only provide information on
genomic target COI (Zagon et al., 2018). The reason for this low

Table 4
Results of a 4-factor (mastermix/real-time PCR instrument/annealing temperature/primer-probe ratio) robustness test.
Ta [primers]/[probe] nM Takyon (validated in this study) Steinbrenner

QuantStudio 6 Flex ARIA DX Stratagene MX3005P QuantStudio 6 Flex ARIA DX Stratagene MX3005P

59 C ◦
300/100 34,54 ± 0,26 34,52 ± 0,45 34,32 ± 0,17 34,19 ± 0,31 34,20 ± 0,24 34,01 ± 0,24
300/70 34,55 ± 0,37 34,26 ± 0,13 34,42 ± 0,46 34,76 ± 0,10 34,50 ± 0,50 34,08 ± 0,31
210/100 34,29 ± 0,24 33,97 ± 0,09 34,18 ± 0,19 34,68 ± 0,33 33,61 ± 0,14 33,87 ± 0,05
210/70 34,34 ± 0,21 34,25 ± 0,53 34,30 ± 0,39 34,32 ± 0,42 34,11 ± 0,08 34,08 ± 0,23
61◦ C 300/100 33,66 ± 0,28 33,17 ± 0,17 34,53 ± 0,18 33,61 ± 0,11 33,12 ± 0,26 34,30 ± 0,41
300/70 33,83 ± 0,43 32,73 ± 0,02 34,81 ± 0,63 34,03 ± 0,38 33,36 ± 0,30 34,17 ± 0,20
210/100 32,84 ± 0,21 32,13 ± 0,23 34,02 ± 0,02 33,18 ± 0,21 31,86 ± 0,37 34,16 ± 0,15
210/70 33,85 ± 0,30 32,74 ± 0,30 34,48 ± 0,04 33,96 ± 0,67 33,15 ± 0,67 34,02 ± 0,26

6
C. Garino et al. Food Control 140 (2022) 109138

sensitivity lays in the choice of the target. Mitochondrial genes are suggests that the method is capable to detect traces of buffalo worms
multi-copy, so even a total amount of DNA corresponding to only one derived from cross-contaminations even in those heavily processed,
copy of the genome (depending on the genome weight for that particular which might have been produced in the same plant. In the light of a
species) can give rise to a number of sites for the primer annealing. When future expansion in the use of these new protein sources, as well as a
the system was tested on a simulated crumbled bread-based flour, we possible future establishment of threshold levels and minimum refer­
were able to detect our target down to 1 ppm. Even though this cannot ence doses for insect allergic subjects, the proposed analytical method is
be considered the real LOD of the method, since no further dilutions suitable for monitoring (Holzhauser et al., 2020).
have been tested experimentally, in practical terms a contamination To complete the method validation, we tested the robustness on
lower than 1 ppm could be considered as negligible, because it would three different instruments and slightly changing the amplification
represent less than one genome copy present in an insect cell. conditions. The same approach has been previously applied for the
The applicability of the developed method was verified using both detection of silkworm in feeds (Zarske et al., 2021), producing satis­
model foods, prepared in-house under controlled conditions, and com­ factory results in both cases in our study.
mercial foods purchased from the market. When extreme sterilizing Finally, a real-time PCR method for the specific, sensitive and robust
processing (autoclave) was employed on experimental canned sausages, detection of the buffalo worm A. diaperinus in food has been developed
A. diaperinus was identified in the samples incurred with 20 ppm, but not and validated. The method could be applied in routine analyses for the
in those with only 5 ppm. Conversely, the other two conditions used identification of the presence of insects in food, both for the protection
(pasteurization at 80 ◦ C and boiling at 100 ◦ C) did not hinder the of allergic consumers and to check for the compliance with the in­
detection of the target insect even at the lowest level. Temperatures dications reported on the label.
higher than 100 ◦ C are needed to sterilize foods from sporogenic bac­
teria, such as Clostridium spp., or from highly heat-resistant ones, such as Funding
Bacillus stearothermophilus, target of the sterilization of tropical canned
foods. However, especially for products in which nitrite curing salt is Research was carried out in the frame of the national project
used, for example boiled sausage, lower thermal loads can be applied “Allergen-Pro” (#281A304A18). Allergen-Pro is supported by funds of
due to the inhibition or reduced microbial growth by the nitrite (Kruse the Federal Ministry of Food and Agriculture (BMEL) based on a decision
and Lemnitzer, 2013). The application of different time/temperature of the Parliament of the Federal Republic of Germany via the Federal
baking protocols did not seem to impact the detectability in experi­ Office for Agriculture and Food (BLE) under the innovation support
mental cookies: while 20 and 100 ppm were clearly positive, those program.
containing only 5 ppm of insect flour were approaching and in some
cases overpassing the threshold of 35 Ct, independently from the pro­ CRediT authorship contribution statement
tocol used. The high temperatures reached during oven baking can
degrade part of the template DNA, which would explain the difference Cristiano Garino: Conceptualization, Investigation, Writing of the
observed between the 5 ppm cookies and the 1 ppm unprocessed original draft, Data curation. Ralf Winter: Investigation, Data curation,
crumbled bread mix. However, even the 20 ppm limit in processed review & editing. Hermann Broll: Conceptualization, Supervision, re­
cookies is lower compared to what has been obtained in similar studies view & editing, Funding acquisition. Matthias Winkel: Supervision,
on the setting up of molecular methods to detect food allergens (Brezná review & editing. Albert Braeuning: review & editing, Funding
et al., 2006), thus confirming the high sensitivity of the method. The acquisition. Felix Reich: Investigation, review & editing. Jutta Zagon:
observed standard deviation among the replicates was much broader Visualization, Supervision, review & editing.
compared to the canned meat, which might be due to a suboptimal
homogeneity of the dispersion of the insect flour in the dough.
When applied to commercial insect-based foods, the protocol clearly Declaration of competing interest
showed its ability to detect the target insect, if the latter was listed as
ingredient in the label. Insects in these food products are present in The authors declare no conflict of interest in publishing this work.
considerable amounts, because they represent the main added value for
the consumer. Despite the specificity of the real-time PCR protocol was Acknowledgements
very high, we observed that, in some of the products we tested, the
system highlighted the presence of the low amounts of the target species We are grateful to Mr. Michael Bullmer of the company Six Feet To
even if that was not reported in the label. These results could be the Eat for kindly providing reference samples of insect and insect powders.
consequence of small contaminations occurring during the food prepa­
ration, especially when the buffalo worm is used by the same company Appendix A. Supplementary data
in other lines of production, such in the case of the producer Jimini’s.
Another explanation could be that, when the quantity of the source of Supplementary data to this article can be found online at https://doi.
the insect DNA is high in the analyzed matrix, such as the case for these org/10.1016/j.foodcont.2022.109138.
slightly positive insect-based foods (from 5,5–10% as declared on the
label), some low cross-reactive insect species could display late but
References
positive amplification curves. This could be the case of the house cricket
A. domesticus, contained in all these foods and displaying a Ct value of Belghit, I., Lock, E.-J., Fumière, O., Lecrenier, M.-C., Renard, P., Dieu, M., et al. (2019).
36,6 when 20 ng of native DNA were tested. In other cases, for example Species-specific discrimination of insect meals for aquafeeds by direct comparison of
tandem mass spectra. Animals, 9, 222. https://doi.org/10.3390/ani9050222
the three foods containing high amounts of T. molitor, no amplification
Brezná, B., Hudecová, L., & Kuchta, T. (2006). A novel real-time polymerase chain
was observed. However, from the perspective of an allergic individual reaction (PCR) method for the detection of walnuts in food. European Food Research
who must decide whether or not to buy an insect-based product, the and Technology, 223, 373–377.
possibility that this is contaminated with traces of A. diaperinus are Broekman, H. C., Knulst, A. C., den Hartog Jager, C. F., van Bilsen, J. H. M.,
Raymakers, F. M. L., Kruizinga, A. G., et al. (2017). Primary respiratory and food
irrelevant towards his/her decision to purchase it, because from a allergy to mealworm. Journal of Allergy and Clinical Immunology S0091–, 6749,
toxicological point of view insects behave like crustaceans, so the 30340–30348.
occurrence of the symptoms does not depend on the species ingested. Bundesministerium für Ernährung und Landwirtschaft. (2015). German guidelines for
meat and meat products. Neufassung vom, 25, 11, 2015 (BAnz AT23.12.2015B4,
As for all other commercial foods non containing insects as main GMBl 2015 S. 1357), zuletzt geändert durch die Bekanntmachung vom 11.03.2021
ingredients, the high sensitivity observed in experimental model foods (BAnz AT 06.04.2021B2, GMBl24/2021S. 561, 562.

7
C. Garino et al. Food Control 140 (2022) 109138

Daniso, E., Melpignano, P., & Tulli, F. (2020a). An OLED-based genosensor for the species-specific marker peptides for authentication in food and feed. Food Chemistry,
detection of Hermetia illucens in feeds. Food Control, 113, Article 107179. https://doi. 320, Article 126681. https://doi.org/10.1016/j.foodchem.2020.126681
org/10.1016/j.foodcont.2020.107179 Mandrile, L., Fusaro, I., Amato, G., Marchis, D., Martra, G., & Rossi, A. M. (2018).
Daniso, E., Tulli, F., Cardinaletti, G., Cerri, R., & Tibaldi, E. (2020b). Molecular approach Detection of insect’s meal in compound feed by Near Infrared spectral Imaging. Food
for insect detection in feed and food: The case of Gryllodes sigillatus. European Food Chemistry, 267, 240–245.
Research and Technology, 246, 2373–2381. https://link.springer.com/artic Marien, A., Debode, F., Aerts, C., Ancion, C., Francis, F., & Berben, G. (2018). Detection
le/10.1007/s00217-020-03573-1. of Hermetia illucens by real-time PCR. Journal of Insects as Food and Feed, 4(2),
Debode, F., Marien, A., Gerard, A., Francis, F., Fumiere, O., & Berben, G. (2017). 115–122. https://doi.org/10.3920/JIFF2017.0069.
Development of real-time PCR tests for the detection of Tenebrio molitor in food and Marien, A., Sedefoglu, H., Dubois, B., Maljean, J., Francis, F., Berben, G., et al. (2022).
feed. Food Additives & Contaminants: Part A, 34(8), 1421–1426. https://doi.org/ Detection of Alphitobius diaperinus by real-time polymerase chain reaction with a
10.1080/19440049.2017.1320811 single-copy gene target. Frontiers in Veterinary Science, 9, Article 718806. https://doi.
ENGL. (2015). European Network of GMO Laboratories. Definition of minimum performance org/10.3389/fvets.2022.718806. https://doi.org/10.3920/JIFF2019.0032.
requirements for analytical methods of GMO testing. Luxembourg: Publication of the Mellado-Carretero, J., Garcia-Gutietzez, N., Ferrando, M., Guell, C., Garcia-Gonzalo,
European Union. D., & De Lamo-Castellvi, S. (2020). Rapid discrimination and classification of edible
European Union. (2021a). Commission implementing regulation (EU) 2021/882 of 1 June insect powders using ATR-FTIR spectroscopy combined with multivariate analysis.
2021 authorising the placing on the market of dried Tenebrio molitor larva as a novel food Journal of Insects as Food and Feed 6(2), 141–148.
under regulation (EU) 2015/2283 of the European parliament and of the council, and Nelson, L. A., Wallman, J. F., & Dowton, M. (2007). Using COI barcodes to identify
amending commission implementing regulation (EU) 2017/2470. forensically and medically important blowflies. Medical and Veterinary Entomology,
European Union. (2021b). Commission Implementing Regulation (EU) 2021/1975 of 12 21(1), 44–52. https://doi.org/10.1111/j.1365-2915.2007.00664.x
November 2021 authorising the placing on the market of frozen, dried and powder forms Ottoboni, M., Tretola, M., Cheli, F., Marchis, D., Veys, P., Baeten, V., et al. (2017). Light
of Locusta migratoria as a novel food under Regulation (EU) 2015/2283 of the European microscopy with differential staining techniques for the characterisation and
Parliament and of the Council and amending Commission Implementing Regulation (EU) discrimination of insects versus marine arthropods processed animal proteins. Food
2017/2470. Additives & Contaminants: Part A, 34(8), 1377–1383. https://doi.org/10.1080/
European Union. (2022a). COMMISSION IMPLEMENTING REGULATION (EU) 2022/169 19440049.2016.1278464
of 8 February 2022 authorising the placing on the market of frozen, dried and powder Regulation (EC) No 2021/1372 of 17 August 2021amending Annex IV to Regulation (EC)
forms of yellow mealworm (Tenebrio molitor larva) as a novel food under Regulation No 999/2001 of the European Parliament and of the Council as regards the
(EU) 2015/2283 of the European Parliament and of the Council, and amending prohibition to feed non-ruminant farmed animals, other than Fur animals, with
Commission Implementing Regulation (EU) 2017/2470. protein derived from animals. Official Journal of the European Union, L295, 64.
European Union. (2022b). Commission Implementing Regulation (EU) 2022/188 of 10 Regulation (EC) No 2017/893 of 24 May 2017 amending annexes I and IV to regulation
February 2022 authorising the placing on the market of frozen, dried and powder forms of (EC) No 999/2001 of the European Parliament and of the Council and annexes X,
Acheta domesticus as a novel food under Regulation (EU) 2015/2283 of the European XIV and XV to commission regulation (EU) No 142/2011 as regards the provisions
Parliament and of the Council, and amending Commission Implementing Regulation (EU) on processed animal protein. Official Journal of the European Union, L138, 92–116.
2017/2470. Siozios, S., Massa, A., Parr, C. L., Verspoor, R. L., & Hurst, G. D. D. (2020). DNA
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for barcoding reveals incorrect labelling of insects sold as food in the UK. PeerJ, 8,
amplification of cytochrome c subunit I (gene) COI from diverse metazoan Article e8496. https://doi.org/10.7717/peerj.8496
invertebrates. Molecular Marine Biology and Biotechnology, 3(5), 294–299. Smith, R., Hauck, R., Macklin, K., Price, S., Dormitorio, T., & Wang, C. (2021). A review
Garino, C., Mielke, H., Knüppel, S., Selhorst, T., Broll, H., & Braeuning, A. (2020). of the lesser mealworm beetle (Alphitobius diaperinus) as a reservoir for poultry
Quantitative allergenicity risk assessment of food products containing yellow bacterial pathogens and antimicrobial resistance. World’s Poultry Science Journal.
mealworm (Tenebrio molitor). Food and Chemical Toxicology, 142, Article 111460. https://doi.org/10.1080/00439339.2022.2003172
Garino, C., Zagon, J., & Nesic, K. (2021). Novel real-time PCR protocol for the detection Tramuta, C., Gallina, S., Bellio, A., Bianchi, D. M., Chiesa, F., Rubiola, S., et al. (2018).
of house cricket (Acheta domesticus) in feed. Animal Feed Science and Technology, 280, A set of multiplex polymerase chain reactions for genomic detection of nine edible
Article 115057. insect species in foods. Journal of Insect Science, 18(5), 1–6. https://doi.org/10.1093/
de Gier, S., & Verhoeckx, K. (2018). Insect (food) allergy and allergens. Molecular jisesa/iey087, 3.
Immunology, 100, 82–106. https://doi.org/10.1016/j.molimm.2018.03.015 Novel Foods and Food Allergens) EFSA NDA Panel (EFSA Panel on Nutrition, Turck, D.,
Holzhauser, T., Johnson, P., Hindley, J. P., O’Connor, G., Chan, C.-H., Costa, J., et al. Bohn, T., Castenmiller, J., De Henauw, S., Hirsch-Ernst, K. I., et al. (2021c). Scientific
(2020). Are current analytical methods suitable to verify VITAL® 2.0/3.0 allergen Opinion on the safety of frozen and dried formulations from whole house crickets
reference doses for EU allergens in foods? Food and Chemical Toxicology, 145, Article (Acheta domesticus) as a Novel food pursuant to Regulation (EU) 2015/2283. EFSA
111709. https://doi.org/10.1016/j.fct.2020.111709 Journal, 19(8), 6779. https://doi.org/10.2903/j.efsa.2021.6779.
van Huis, A. (2020). Insect pests as food and feed. Journal of Insects as Food and Feed, 6 Novel Foods and Food Allergens) EFSA NDA Panel (EFSA Panel on Nutrition, Turck, D.,
(4), 327–331. Bohn, T., Castenmiller, J., De Henauw, S., Hirsch-Ernst, K. I., et al. (2021d).
van Huis, A., Itterbeeck, J. V., Klunder, H., Mertens, E., Halloran, A., Muir, G., et al. Scientific Opinion on the safety of frozen and dried formulations from whole yellow
(2013). Edible insects: Future prospects for food and feed security. FAO Forestry Paper mealworm (Tenebrio molitor larva) as a novel food pursuant to Regulation (EU)
171. Rome/Wageningen, Italy/the Netherlands: Food and Agriculture Organization 2015/2283. EFSA Journal, 19(8), 6778. https://doi.org/10.2903/j.efsa.2021.6778.
of the United Nations/Wageningen University and Research Centre. Available at: Novel Foods and Food Allergens EFSA NDA Panel (EFSA Panel on Nutrition, Turck, D.,
http://www.fao.org/docrep/018/i3253e/i3253e.pdf. Castenmiller, J., De Henauw, S., Hirsch-Ernst, K. I., Kearney, J., et al. (2021a).
IPIFF. (2021). Guide on good hygiene practices for European union (EU) producers of insects Scientific Opinion on the safety of dried yellow mealworm (Tenebrio molitor larva) as
as food and feed. Available at: https://ipiff.org/good-hygiene-practices/. a novel food pursuant to Regulation (EU) 2015/2283. EFSA Journal, 19(1), 6343.
Kim, M.-J., Jung, S.-K., Kim, S.-Y., & Kim, H.-Y. (2018). Development of detection https://doi.org/10.2903/j.efsa.2021.6343.
method for edible silkworm (Bombyx mori) using real-time PCR. Food Control, 94, Novel Foods and Food Allergens) EFSA NDA Panel (EFSA Panel on Nutrition, Turck, D.,
295–299. Castenmiller, J., De Henauw, S., Hirsch-Ernst, K. I., Kearney, J., et al. (2021b).
Kim, M.-J., Kim, S.-Y., Jung, S.-K., Kim, M.-Y., & Kim, H.-Y. (2019b). Development and Scientific Opinion on the safety of frozen and dried formulations from migratory
validation of ultrafast PCR assays to detect six species of edible insects. Food Control, locust (Locusta migratoria) as a Novel food pursuant to Regulation (EU) 2015/2283.
103, 21–26. https://doi.org/10.1016/j.foodcont.2019.03.039 EFSA Journal, 19(7), 6667. https://doi.org/10.2903/j.efsa.2021.6667.
Kim, S.-Y., Kim, M.-J., Jung, S.-K., & Kim, H.-Y. (2019a). Development of a fast real-time Ulrich, S., Kühn, U., Biermaier, B., Piacenza, N., Schwaiger, K., Gottschalk, C., et al.
PCR assay based on TaqMan probe for identification of edible rice grasshopper (Oxya (2017). Direct identification of edible insects by MALDI-TOF mass spectrometry.
chinensis) in processed food products. Food Research International, 116, 441–446. Food Control, 76, 96–101. https://doi.org/10.1016/j.foodcont.2017.01.010
https://doi.org/10.1016/j.foodres.2018.08.059 Veys, P., & Baeten, V. (2018). Protocol for the isolation of processed animal proteins from
Köppel, R., Schum, R., Habermacher, M., Sester, C., Piller, L. E., Meissner, S., et al. insects in feed and their identification by microscopy. Food Control, 92, 496–504.
(2019). Multiplex real-time PCR for the detection of insect DNA and determination Zagon, J., di Rienzo, V., Potkura, J., Lampen, A., & Braeuning, A. (2018). A real-time PCR
of contents of Tenebrio molitor, Locusta migratoria and Achaeta domestica in food. method for the detection of black soldier fly (Hermetia illucens) in feedstuff. Food
European Food Research and Technology, 245, 559–567. https://doi.org/10.1007/ Control, 91, 440–448. https://doi.org/10.1016/j.foodcont.2018.04.032
s00217-018-03225-5 Zagon, J., Schmidt, J., Schmidt, A. S., Broll, H., Lampen, A., Seidler, T., et al. (2017).
Kruse, I., & Lemnitzer, S. (2013). Produktsicherheit Thermisch haltbar gemachte A novel screening approach based on six real-time PCR systems for the detection of
Fleischwaren. Messgeräte ermöglichen die Überwachung von Pasteurisations- und crustacean species in food. Food Control, 79, 27–34.
Sterilisationsprozessen. Fleischwirtschaft vom 22.04.2013, S. 125/Schwerpunkt Zarske, M., Zagon, J., Schmolke, S., Seidler, T., & Braeuning, A. (2021). Detection of
Qualitätsmanagement und -sicherung. silkworm (Bombyx mori) and Lepidoptera DNA in feeding stuff by real-time PCR.
Leni, G., Prandi, B., Varani, M., Faccini, A., Caligiani, A., & Sforza, S. (2020). Peptide Food Control, 126, Article 108059. https://doi.org/10.1016/j.foodcont.2021.108059
fingerprinting of Hermetia illucens and Alphitobius diaperinus: Identification of insect