Methods in

Molecular Biology 2967

Lucília Domingues Editor

PCR
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
 PCR

Methods and Protocols

Second Edition

Edited by

Lucília Domingues
CEB - Centre of Biological Engineering, University of Minho, Braga, Portugal
Editor
Lucı́lia Domingues
CEB - Centre of Biological Engineering
University of Minho
Braga, Portugal

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-3357-1 ISBN 978-1-0716-3358-8 (eBook)
https://doi.org/10.1007/978-1-0716-3358-8
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Cover illustration by Carlos E. Costa (CEB – Centre of Biological Engineering, University of Minho).

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface

With 40 years since its official discovery and 51 years since its theoretical proposition, the
polymerase chain reaction (PCR) has revolutionized the fields of biotechnology, medicine,
food microbiology, environmental microbiology, industry, and science, in general. The
concept is so perfectly simple that the elemental scheme remains unchanged since its
foundation. There are very few inventions that can compete with the importance of PCR.
PCR is still today a fundamental tool in current scientific research and its importance has
been recently disclosed to the general public with its widespread use during the COVID-19
pandemic that began in 2019. Being such a relevant technique with wide-range applications,
significant literature exists on the basics of PCR. Still, the specificities for its application in
diverse areas of the biotechnology and bioengineering field are mostly dispersed and are
preferentially found in the health area. PCR is a powerful and flexible tool in modern
biotechnology and the continued development of this technology is still expanding its
wide range of applications.
This new edition of PCR Methods and Protocols maintains the focus of the first edition
on PCR application specificities to the biotechnology and bioengineering field with updated
content on recently developed cutting-edge methodologies and novel applications. While
the previous edition almost exclusively covered end-point PCR, this volume is balanced with
real-time PCR and with fresh applications in the biotechnology and bioengineering field, in
particular in the food sector, in which a growing trend for the use of this technology is
observed. Topics such as detection of foodborne microbial contaminants, toxins, and
allergens are included as well as food authentication. Two protocols involving high-
resolution melting assays are illustrated for the detection of foodborne pathogens and
fungi detection in plant matrices. Relevant applications in biotechnology are emphasized
with protocols for accurate absolute quantification of bacterial populations in mixed cultures
and for gene expression quantification from pathogenic bacterial biofilms. Applications in
synthetic biology for the assessment of recombination efficiency in minicircle production
and quantification of plasmid copy number are also included. More recently developed PCR
techniques like digital PCR protocols were incorporated in this new edition highlighting the
applications for SARS-Cov-2 detection and surveillance from sewage samples and food
herbal spices and products authentication. Emulsion PCR coupled with denaturing gradient
gel electrophoresis is described in the context of microbial diversity studies. New develop-
ments for end-point PCR like the use of disruptors for PCR improvement are included as
well as novel applications such as the use of mitochondrial DNA D-loop amplification and
sequencing for species differentiation in milk. Highly used end-point PCR applications from
the previous edition were kept and updated like long fragment PCR and megaprimer
applications in the synthesis of fusion genes, colony PCR, inverse PCR for site-directed
mutagenesis, and degenerate PCR.
It is amazing as such a straightforward methodology like PCR has evolved and expanded
its applications over 40 years. The ongoing development of PCR technology has enabled
PCR to continue to play an indispensable role in the biotechnology and bioengineering
field. The trend is the development of new PCR technologies and applications with digitali-

v
vi Preface

zation, accessibility, and adaptability to different settings and contexts, contributing to

further streamlined analyses while maintaining and improving the sensitivity and specificity
required for PCR’s wide range of applications. This book aims to contribute to a current
update of the dynamic field of PCR-dependent methods and, thus, to be a valuable,
indispensable, and useful resource to wet-lab researchers, particularly within the biotech-
nology and bioengineering field.

Braga, Portugal Lucı́lia Domingues

Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Digital PCR: A Partitioning-Based Application for Detection
and Surveillance of SARS-CoV-2 from Sewage Samples. . . . . . . . . . . . . . . . . . . . . . 1
Bhumika Prajapati, Dalipsingh Rathore, Chaitanya Joshi,
and Madhvi Joshi
2 Digital PCR: A Tool to Authenticate Herbal Products and Spices . . . . . . . . . . . . . 17
Abhi P. Shah, Tasnim Travadi, Sonal Sharma, Ramesh Pandit,
Chaitanya Joshi, and Madhvi Joshi
3 Emulsion Polymerase Chain Reaction Coupled with Denaturing
Gradient Gel Electrophoresis for Microbial Diversity Studies . . . . . . . . . . . . . . . . . 31
Maria-Eleni Dimitrakopoulou, Dimosthenis Tzimotoudis,
and Apostolos Vantarakis
4 Real-Time PCR High-Resolution Melting Assays for the Detection
of Foodborne Pathogens. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Prashant Singh and Frank J. Velez
5 High-Throughput Real-Time qPCR and High-Resolution Melting
(HRM) Assay for Fungal Detection in Plant Matrices . . . . . . . . . . . . . . . . . . . . . . . 53
Filipe Azevedo-Nogueira, Sara Barrias, and Paula Martins-Lopes
6 Multiplex Real-Time PCR for the Detection of Shiga Toxin-Producing
Escherichia coli in Foods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Ana Costa-Ribeiro, Sarah Azinheiro, Foteini Roumani,
Marta Prado, Alexandre Lamas, and Alejandro Garrido-Maestu
7 DNA Isolation from Cocoa-Derived Products and Cocoa Authentication
by TaqMan Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Ana Caroline De Oliveira, Yordan Muhovski, Herve Rogez,
and Frédéric Debode
8 Quantitative Real-Time PCR for the Detection of Allergenic Species
in Foods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
Joana Costa, Caterina Villa, and Isabel Mafra
9 Accurate Absolute Quantification of Bacterial Populations in Mixed
Cultures by qPCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
Ângela Lima, Lúcia G. V. Sousa, and Nuno Cerca
10 Real-Time PCR Method for Assessment of ParA-Mediated
Recombination Efficiency in Minicircle Production . . . . . . . . . . . . . . . . . . . . . . . . . 117
Cláudia P. A. Alves, Duarte Miguel F. Prazeres,
and Gabriel A. Monteiro

vii
viii Contents

11 Gene Expression Quantification from Pathogenic Bacterial Biofilms

by Quantitative PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Angela França and Nuno Cerca
12 A Real-Time Quantitative PCR Protocol for the Quantification
of Plasmid Copy Number in Lactococcus lactis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151
Sofia O. D. Duarte and Gabriel A. Monteiro
13 Improved PCR by the Use of Disruptors, a New Class of Oligonucleotide
Reagents. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
Yong Ma and Minxue Zheng
14 Mitochondrial DNA D-Loop Amplification and Sequencing for Species
Differentiation in Milk . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
Marlene Baptista and Lucı́lia Domingues
15 Long-Range Polymerase Chain Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181
Ping Siu Kee, Harsheni Karunanathie, Simran D. S. Maggo,
Martin A. Kennedy, and Eng Wee Chua
16 Megaprimer-Based PCR to Synthesize Fusion Genes for Cloning . . . . . . . . . . . . . 193
Tatiana Q. Aguiar, Carla Oliveira, and Lucı́lia Domingues
17 Bacteria and Yeast Colony PCR. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
Humberto Pereira, Paulo César Silva, and Björn Johansson
18 Inverse PCR for Site-Directed Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 223
Diogo Silva, Gustavo Santos, Mário Barroca, Diogo Costa,
and Tony Collins
19 Optimized Design of Degenerate Primers for PCR Based on DNA
or Protein Sequence Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239
Maria Jorge Campos, Alejandro Gallardo, and Alberto Quesada

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
Contributors

TATIANA Q. AGUIAR • CEB - Centre of Biological Engineering, University of Minho, Braga,

Portugal; LABBELS - Associate Laboratory, Braga/Guimarães, Portugal
CLÁUDIA P. A. ALVES • iBB- Institute for Bioengineering and Biosciences, Department of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Lisbon, Portugal;
Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto Superior Té
cnico, Universidade de Lisboa, Lisbon, Portugal
FILIPE AZEVEDO-NOGUEIRA • DNA & RNA Sensing Lab, University of Trás-os-Montes e Alto
Douro, Department of Genetics and Biotechnology, School of Life Science and Environment,
Vila Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of
Lisboa, Faculty of Sciences, Lisbon, Portugal
SARAH AZINHEIRO • International Iberian Nanotechnology Laboratory, Food Quality and
Safety Research Group, Braga, Portugal; Department of Analytical Chemistry, Nutrition
and Food Science, Faculty of Veterinary Science, University of Santiago de Compostela,
Lugo, Spain
MARLENE BAPTISTA • CEB-Centre of Biological Engineering, University of Minho, Braga,
Portugal
SARA BARRIAS • DNA & RNA Sensing Lab, University of Trás-os-Montes e Alto Douro,
Department of Genetics and Biotechnology, School of Life Science and Environment, Vila
Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of Lisboa,
Faculty of Sciences, Lisbon, Portugal
MÁRIO BARROCA • CBMA - Centre of Molecular and Environmental Biology, Department of
Biology, University of Minho, Braga, Portugal
MARIA JORGE CAMPOS • MARE-Marine and Environmental Sciences Centre & ARNET—
Aquatic Research Network Associated Laboratory, ESTM, Polytechnic of Leiria, Peniche,
Portugal
NUNO CERCA • Laboratory of Research in Biofilms Rosário Oliveira (LIBRO), CEB – Centre
of Biological Engineering, University of Minho, Braga, Portugal; LABBELS –Associate
Laboratory, Braga, Guimarães, Portugal
ENG WEE CHUA • Centre for Drug and Herbal Development, Faculty of Pharmacy,
Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia
TONY COLLINS • CBMA - Centre of Molecular and Environmental Biology, Department of
Biology, University of Minho, Braga, Portugal
DIOGO COSTA • CBMA - Centre of Molecular and Environmental Biology, Department of
Biology, University of Minho, Braga, Portugal
JOANA COSTA • REQUIMTE-LAQV, Faculdade de Farmácia, Universidade do Porto, Porto,
Portugal
ANA COSTA-RIBEIRO • International Iberian Nanotechnology Laboratory, Food Quality and
Safety Research Group, Braga, Portugal; Department of Biochemistry, Genetics and
Immunology, University of Vigo, Vigo, Spain
ANA CAROLINE DE OLIVEIRA • Department of Life Sciences, Unit Bioengineering, Walloon
Agricultural Research Centre (CRA-W), Gembloux, Belgium
FRÉDÉRIC DEBODE • Department of Life Sciences, Unit Bioengineering, Walloon
Agricultural Research Centre (CRA-W), Gembloux, Belgium

ix
x Contributors

MARIA-ELENI DIMITRAKOPOULOU • Department of Public Health, Medical School, University

of Patras, Patras, Greece
LUCÍLIA DOMINGUES • CEB - Centre of Biological Engineering, University of Minho, Braga,
Portugal; LABBELS - Associate Laboratory, Braga/Guimarães, Portugal
SOFIA O. D. DUARTE • iBB- Institute for Bioengineering and Biosciences, Department of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Lisbon, Portugal;
Associate Laboratory i4HB—Institute for Health and Bioeconomy at Instituto Superior Té
cnico, Universidade de Lisboa, Lisbon, Portugal
ANGELA FRANÇA • LIBRO-Laboratorio de Investigação em Biofilmes Rosário Oliveira,
Centre of Biological Engineering, University of Minho, Braga, Portugal; LABBELS-
Associate Laboratory, Braga/Guimarães, Portugal
ALEJANDRO GALLARDO • Departamento de Bioquı́mica, Biologı́a Molecular y Genética,
Facultad de Veterinaria, Universidad de Extremadura, Cáceres, Spain
ALEJANDRO GARRIDO-MAESTU • International Iberian Nanotechnology Laboratory, Food
Quality and Safety Research Group, Braga, Portugal
BJÖRN JOHANSSON • CBMA - Centre of Molecular and Environmental Biology, Department
of Biology, University of Minho, Braga, Portugal
CHAITANYA JOSHI • Gujarat Biotechnology Research Centre (GBRC), Department of Science
and Technology, Government of Gujarat, Gandhinagar, India
MADHVI JOSHI • Gujarat Biotechnology Research Centre (GBRC), Department of Science
and Technology, Government of Gujarat, Gandhinagar, India
HARSHENI KARUNANATHIE • Centre for Drug and Herbal Development, Faculty of Pharmacy,
Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia
PING SIU KEE • Department of Pathology and Biomedical Science, University of Otago,
Christchurch, New Zealand
MARTIN A. KENNEDY • Department of Pathology and Biomedical Science, University of
Otago, Christchurch, New Zealand
ALEXANDRE LAMAS • Food Hygiene, Inspection and Control Laboratory, Department of
Analytical Chemistry, Nutrition and Bromatology, Universidad de Santiago de
Compostela, Lugo, Spain
ÂNGELA LIMA • Laboratory of Research in Biofilms Rosário Oliveira (LIBRO), CEB – Centre
of Biological Engineering, University of Minho, Braga, Portugal; LABBELS –Associate
Laboratory, Braga, Guimarães, Portugal
YONG MA • School of Biomedical Engineering (Suzhou), Division of Life Sciences and
Medicine, University of Science and Technology of China, Hefei, Anhui, China; Suzhou
Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou,
Jiangsu, China
ISABEL MAFRA • REQUIMTE-LAQV, Faculdade de Farmácia, Universidade do Porto,
Porto, Portugal
SIMRAN D. S. MAGGO • Department of Pathology and Biomedical Science, University of
Otago, Christchurch, New Zealand; Department of Pathology, Center for Personalized
Medicine, Children’s Hospital Los Angeles, California, LA, USA
PAULA MARTINS-LOPES • DNA & RNA Sensing Lab, University of Trás-os-Montes e Alto
Douro, Department of Genetics and Biotechnology, School of Life Science and Environment,
Vila Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of
Lisboa, Faculty of Sciences, Lisbon, Portugal
 Contributors xi

GABRIEL A. MONTEIRO • iBB- Institute for Bioengineering and Biosciences, Department of

Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Lisbon, Portugal;
Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto Superior Té
cnico, Universidade de Lisboa, Lisbon, Portugal
YORDAN MUHOVSKI • Department of Life Sciences, Unit Bioengineering, Walloon
Agricultural Research Centre (CRA-W), Gembloux, Belgium
CARLA OLIVEIRA • Universidade Catolica Portuguesa, CBQF - Centro de Biotecnologia
e Quı́mica Fina – Laboratorio Associado, Escola Superior de Biotecnologia, Rua Diogo
Botelho, Porto, Portugal
RAMESH PANDIT • Gujarat Biotechnology Research Centre (GBRC), Department of Science
and Technology, Government of Gujarat, Gandhinagar, India
HUMBERTO PEREIRA • CBMA - Centre of Molecular and Environmental Biology,
Department of Biology, University of Minho, Braga, Portugal
MARTA PRADO • International Iberian Nanotechnology Laboratory, Food Quality and Safety
Research Group, Braga, Portugal
BHUMIKA PRAJAPATI • Gujarat Biotechnology Research Centre (GBRC), Department of
Science and Technology, Government of Gujarat, Gandhinagar, India
DUARTE MIGUEL F. PRAZERES • iBB- Institute for Bioengineering and Biosciences,
Department of Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Lisbon,
Portugal; Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto
Superior Técnico, Universidade de Lisboa, Lisbon, Portugal
ALBERTO QUESADA • Departamento de Bioquı́mica, Biologı́a Molecular y Genética, Facultad
de Veterinaria, Universidad de Extremadura, Cáceres, Spain
DALIPSINGH RATHORE • Gujarat Biotechnology Research Centre (GBRC), Department of
Science and Technology, Government of Gujarat, Gandhinagar, India
HERVE ROGEZ • Centre for Valorisation of Amazonian Bioactive Compounds (CVACBA) &
Universidade Federal Do Pará, Belém, Pará, Brazil
FOTEINI ROUMANI • International Iberian Nanotechnology Laboratory, Food Quality and
Safety Research Group, Braga, Portugal; Department of Analytical Chemistry, Nutrition
and Food Science, Faculty of Veterinary Science, University of Santiago de Compostela,
Lugo, Spain
GUSTAVO SANTOS • CBMA - Centre of Molecular and Environmental Biology, Department of
Biology, University of Minho, Braga, Portugal
ABHI P. SHAH • Gujarat Biotechnology Research Centre (GBRC), Department of Science and
Technology, Government of Gujarat, Gandhinagar, India
SONAL SHARMA • Gujarat Biotechnology Research Centre (GBRC), Department of Science
and Technology, Government of Gujarat, Gandhinagar, India
DIOGO SILVA • Instituto de Tecnologia Quı́mica e Biologica Antonio Xavier (ITQB),
Universidade NOVA de Lisboa, Oeiras, Portugal
PAULO CÉSAR SILVA • CBMA - Centre of Molecular and Environmental Biology, Department
of Biology, University of Minho, Braga, Portugal
PRASHANT SINGH • Department of Nutrition, and Integrative Physiology, Florida State
University, Tallahassee, FL, USA
LÚCIA G. V. SOUSA • Laboratory of Research in Biofilms Rosário Oliveira (LIBRO),
CEB – Centre of Biological Engineering, University of Minho, Braga, Portugal
TASNIM TRAVADI • Gujarat Biotechnology Research Centre (GBRC), Department of Science
and Technology, Government of Gujarat, Gandhinagar, India
xii Contributors

DIMOSTHENIS TZIMOTOUDIS • Department of Public Health, Medical School, University of

Patras, Patras, Greece
APOSTOLOS VANTARAKIS • Department of Public Health, Medical School, University of Patras,
Patras, Greece
FRANK J. VELEZ • Department of Nutrition, and Integrative Physiology, Florida State
University, Tallahassee, FL, USA
CATERINA VILLA • REQUIMTE-LAQV, Faculdade de Farmácia, Universidade do Porto,
Porto, Portugal
MINXUE ZHENG • School of Biomedical Engineering (Suzhou), Division of Life Sciences and
Medicine, University of Science and Technology of China, Hefei, Anhui, China; Suzhou
Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou,
Jiangsu, China
 Chapter 1

Digital PCR: A Partitioning-Based Application for Detection

and Surveillance of SARS-CoV-2 from Sewage Samples
Bhumika Prajapati, Dalipsingh Rathore, Chaitanya Joshi,
and Madhvi Joshi

Abstract
The wastewater-based surveillance of SARS-CoV-2 has emerged as a potential tool for cost-effective,
simple, and long-term monitoring of the pandemic. Since the COVID-19 pandemic, several developed
countries have incorporated the national wastewater surveillance program into their national policies related
to pandemic management. Various research groups have utilized the approach of real-time quantitative
reverse transcription PCR (RT-qPCR) for the quantification of SARS-CoV-2 from environmental samples
like sewage water. However, detection and quantification using RT-qPCR relies on standards and is known
to have lesser tolerance to inhibitors present in the sample. Unlike RT-qPCR, digital PCR (dPCR) offers an
absolute and sensitive quantification without a need reference and offers higher tolerance to inhibitors
present in the wastewater samples. Additionally, the accuracy of detection increases with the presence of rare
target copies in the sample. The methodology herein presented comprises the detection and quantification
of SARS-CoV-2 from sewer shed samples using the dPCR approach. The main features of the process
include virus concentration and absolute quantification of the virus surpassing the substantial presence of
inhibitors in the sample. This chapter presents the optimized PEG and NaCl-based protocol for virus
concentration followed by nucleic acid extraction and quantification using CDC-approved N1 + N2 assay.
The protocol uses MS2 bacteriophage as a process recovery or internal control.
The methodology herein described highlights the importance of digital PCR technologies for environ-
mental surveillance of important emerging pathogens or pandemics.

Key words Absolute quantification, Digital PCR, Wastewater-based epidemiology, SARS-CoV-2,

COVID-19 pandemic

1 Introduction

Environmental surveillance (ES) by testing the sewage or wastewa-

ter samples for detecting the presence of different pathogens has a
long history of importance in public health [1]. Wastewater-based
epidemiology (WBE) of SARS-CoV-2 is a promising tool for com-
plementation for diagnosing SARS-CoV-2 in a clinical setting
which can provide early warning of infection spread, nearly real-

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

1
2 Bhumika Prajapati et al.

time monitoring of outbreaks, and cost-effective detection in

pooled samples even in asymptomatic individuals [2]. Since the
COVID-19 pandemic, WBE surveillance has been widely accepted
as an unbiased tool for monitoring virus outbreaks and disease
dynamics in particular populations during the course of pandemics.
The process workflow generally involves the collection of compos-
ite or grab samples from different wastewater sources such as sew-
age treatment plants (STPs) or pumping stations, virus
concentration, nucleic acid extraction, and detection/quantifica-
tion of genes of targets through molecular approaches, i.e., real-
time quantitative reverse transcription PCR (RT-qPCR) or digital
PCR (dPCR) [3, 4]. The ongoing approach of RT-qPCR relies
on bulk reaction real-time quantification of unknown target based
on a standard curve of the reference sample. The last generation of
PCR, i.e., digital PCR (dPCR), has been developed to overcome
the challenges of conventional RT-qPCR. The dPCR works on the
principle of partitioning in which the PCR mix containing a sample
divides into thousands of tiny partitions through a nanowell plate
which either contains zero, one, or few copies of target molecules.
The individual tiny partitions having one or more copies of the
target molecule are then amplified by thermal cycling or PCR
[5, 6]. Unlike qPCR, where the amplification occurs in a single
bulk reaction, dPCR enables partitioning in thousands of parti-
tions, in which PCR occur simultaneously, which ultimately
increases the tolerance to inhibitors and limit of detection of the
assay [7]. The dPCR approach offers several advantages such as
absolute quantification without reference, higher sensitivity, cost-
effectiveness, and tolerance to inhibitors present in environmental
samples [8]. Different groups of research have shown one or more
orders of magnitude differences in results using different kinds of
methods. However, the majority of the work has been focused on
the comparison of viral concentration and RNA extraction methods
from wastewater samples because the wastewater sample contains a
very low amount of target with a pronounced presence of PCR
inhibitors. Thus, there is an ultimate need to develop an efficient
protocol for sample concentration and viral RNA extraction
method for the sensitive detection of any pathogen from wastewa-
ter samples [9]. We had previously developed the PEG-NaCl-based
in-house protocol for virus concentration from samples like waste-
water while adapting the protocol from the QIAcuity® user manual
quantification using dPCR with minor changes by following the
dMIQE guidelines [10]. The present protocol provides a complete
overview of SARS-CoV-2 detection and quantification using dPCR
from untreated wastewater samples from any sample source.
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 3

2 Materials

2.1 Wastewater 1. Sterile polypropylene bottles (500 mL).

Sample Collection 2. Gloves and face mask.

2.2 Filtration, 1. 50 mL sterile centrifuge tubes.

Centrifugation, and 2. Polyethylene glycol (PEG-8000).
Precipitation
3. Sodium chloride (NaCl).
4. 0.22 μm syringe filter.
5. Biosafety cabinet, Class II, Type A2.
6. Vortex mixer.
7. Refrigerated centrifuge.
8. Shaker incubator with refrigeration.
9. -80 °C/-20 °C deep freezer.

2.3 RNA Extraction 1. MS2 bacteriophage (Thermo Fisher Scientific) or equivalent.

from Concentrated 2. Double distilled, nuclease-free, or Milli-Q H2O.
Pellet
3. Proteinase K.
4. Viral RNA extraction kit (spin column based) which contains
different buffer components, i.e., buffer AVE, NFW containing
0.04% sodium azide to prevent microbial growth and contami-
nation with RNases; buffer AVL (50–70% guanidinium thiocy-
anate), AW1 & AW2 (wash buffer containing guanidine salts).
Preparation of buffer AVL-carrier RNA mix: If buffer
AVL precipitates, incubate at 80°C for dissolution of precipi-
tates. Calculate buffer AVL-carrier RNA mix for each batch of
samples using the formula below:

n × 0:56 mL = y mL
y mL × 10 μL=mL = z μL
where n = number of samples to be processed
y = calculated volume of buffer AVL
z = volume of carrier RNA-buffer AVE to add to buffer AVL
Gently mix by inverting the tube 10 times. To avoid foam-
ing, do not vortex.
5. 0.5–10, 10–100, and 100–1000 μL micropipettes with their
suitable filter tips (pipette tips with aerosol barriers for prevent-
ing cross-contamination are recommended).
6. Refrigerated centrifuge.
7. Ethanol (96–100%).
8. 1.5 mL microcentrifuge tubes.
4 Bhumika Prajapati et al.

2.4 Primer and Probe 1. SARS-CoV-2 N1 + N2 assay kit.

Design for Digital PCR

2.5 Digital PCR Mix 1. QIAcuity nanoplate with 26,000 nanopartitions with sealing
Preparation film (Qiagen, see Note 1).
2. Primers and probe cocktail (10 μM).
3. Sterile PCR strips or plate.
4. One-step viral RNA probe assay (Qiagen or equivalent).
5. DNase, RNase-free Eppendorf tubes (1.5 mL).
6. RNAout: Solution containing surfactant like Tween-20 in
nuclease-free water.
7. Mini centrifuge.
8. 0.5–10, 10–100, and 100–1000 μL micropipettes with their
suitable filter tips (pipette tips with aerosol barriers for prevent-
ing cross-contamination are recommended).
9. PCR workstation.
10. QIAcuity digital PCR system (Qiagen; see Note 2).

2.6 Software Setup 1. QIAcuity software suite (Qiagen).

and Thermal Cycling
Conditions

3 Methods

3.1 Wastewater The wastewater samples from an in-flow of eight different STPs
Sample Collection across Ahmedabad city in Gujarat, India, were collected in the
morning hours once on a weekly basis using the grab sampling
method. Collect the samples in 250 mL sterile polypropylene bot-
tles, and transport them to the lab on the same day by maintaining
appropriate cooling and sterile conditions. The sampling sites
should be selected on the basis of the catchment area and minimal
liquid discharge (MLD) capacity of each plant [11]. The entire
workflow for the process of SARS-CoV-2 detection from wastewa-
ter samples is presented in Fig. 1 [12].

3.2 Filtration, 1. Collect the sample in 250 mL sterile polypropylene bottles, and
Centrifugation, and transport it to the lab on the same day by maintaining appro-
Precipitation priate conditions. Each sample should be labeled giving infor-
mation regarding the name of the collector, the date, time, and
exact geographical location with co-ordinates.
2. On the same day, open the collected sample in the biosafety
cabinet, and transfer 30 mL of wastewater samples to a 50 mL
centrifuge tube, and centrifuge at 1800 × g for 40 min at
10–14 °C temperature.
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 5

Fig. 1 Overview of process workflow. The entire process workflow includes sample collection with different
types of samples, sampling methods such as grab or composite sampling, sample/virus concentration using
PEG-8000 and NaCl, viral RNA extraction using spin column-based kit, absolute quantification using digital
PCR assay, and data analysis

3. After centrifugation, take 25 mL of supernatant without dis-

turbing the bottom, and filter it with a 0.22 μm syringe filter in
a fresh centrifuge tube.
4. Then, add 2 g of polyethylene glycol (PEG-8000) and
0.437 g sodium chloride (NaCl) (8% PEG and 0.3 M NaCl)
to the collected supernatant.
5. Vortex the mixture and incubate it on a shaker incubator
overnight by maintaining 120 rpm and 10–17 °C of
temperature.
6. On the following day, take fresh Oakridge tubes, and transfer
25 mL of overnight precipitated/concentrated sample (from
the previous step) to it, and centrifuge the tube at 12,000 × g
for 90 min at 4 °C.
7. After centrifugation, discard the supernatant, and add 300 μL
of nuclease-free water, and transfer the 300 μL of concentrated
sample from the above step in a fresh Eppendorf tube (1.5 mL)
which will be further used for RNA isolation (or store it at
-80 °C for future use).

3.3 RNA Extraction 1. Perform the RNA extraction from the concentrated pellet
from Concentrated using a commercially available spin column-based kit. In the
Pellet current study, QIAamp viral RNA mini kit (Qiagen) has been
used as per the protocol mentioned by the manufacturer with
slight modifications [12]. Take 300 μL of concentrated sample
from the above procedure using a sterile filter tip for RNA
isolation, and add 300 μL nuclease-free water (NFW) in a
separate tube which will act as negative control (NC). Add
10 μL of MS2 bacteriophage (see Note 3) as internal process
recovery control for each sample and controls.
6 Bhumika Prajapati et al.

2. Pipet 560 μL of prepared buffer AVL containing carrier RNA

into a 1.5 mL microcentrifuge tube. Mix by pulse-vortexing for
15 s (see Note 4).
3. Add 20 μL of proteinase K and vortex it and incubate the tube
at room temperature for 10 min.
4. Add 560 μL ethanol (96–100%) to the sample, and mix by
pulse-vortexing for 15 s. After mixing, briefly centrifuge the
tube to remove drops from inside the lid. Incubate at room
temperature for 5 min.
5. Carefully load around 630 μL of this preparation to the spin
column provided in the kit and spin at 7200 × g for 1 min.
6. Change the collection tube and add 750 μL of buffer AW1
(wash) solution and centrifuge at 7200 × g for 1 min.
7. Change the collection tube and add 750 μL of buffer AW2
(wash) solution and centrifuge at 7200 × g for 1 min.
8. Empty spin 13,500 × g for 2 min.
9. Discard the flow through and transfer the column to a fresh
1.5 mL Eppendorf tube.
10. Carefully open the QIAamp mini spin column. Add 30 μL
elution buffer AVE equilibrated to room temperature. Close
the cap, and incubate at room temperature for 1 min. Centri-
fuge at 7200 × g for 1 min.
11. Store it at -80 °C (RNA samples) up to PCR assay.

3.4 Primer and Probe The dPCR assay for quantifying the viral RNA consists of a set of
for Digital PCR primers and a set of fluorescent probes. The assay quantitatively
detects the SARS-CoV-2 nucleic acid from the upper and lower
respiratory clinical and environmental specimen (nasopharyngeal or
oropharyngeal swabs, sputum, lower respiratory aspirates, bronch-
oalveolar lavage, environmental samples, etc.). The cocktail of
N1 + N2 primers and probes targets the genomic regions
(N1 and N2) of the SARS-CoV-2 viral genome [13]. The primer-
probe mix has been acquired commercially. The two probes are
coupled with FAM as a reporter dye and use ZEN™ quenchers for
enhanced sensitivity (sequence provided in Table 1 [12, 14]). Dur-
ing the PCR amplification, the (5′-3′) exonuclease activity of DNA
polymerase will degrade the probes that are hybridized to the target
sequence. When the fluorophore (FAM or HEX or ROX) dye
molecules are released from the probes and thus are no longer in
close proximity to the quencher, they can be detected and quanti-
fied by the imaging analysis steps in the dPCR.
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 7

Table 1
Primers and probe sequence used in the protocol herein described for the detection of SARS-CoV-2

Oligonucleotide Final conc. per

designation Sequence (5′-3′) reaction (μM) Ref.
nCoV_N1-F GACCCCAAAATCAGCGAAAT 0.8 [14]
nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG 0.8
nCoV_N1-P FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 0.25
nCoV_N2-F TTACAAACATTGGCCGCAAA 0.8
nCoV_N2-R GCGCGACATTCCGAAGAA 0.8
nCoV_N2-P FAM-ACAATTTGC/ZEN/CCCCAGCGCTTCAG- 0.25
3IABkFQ

3.5 Digital PCR Mix 1. Before setting up the final reaction mixture for the dPCR assay,
Preparation for enough precautions should be taken to avoid cross-
Wastewater Samples contamination of the sample and reagents. All reagents includ-
ing PCR master mix, enzymes, primer-probe mix, and
nuclease-free water should be properly thawed before use.
Wipe the entire PCR hood surface area and micropipettes
with the RNAout (carryover RNA-degrading solution) to
degrade or remove any contaminant RNA from the surface
and pipettes (see Note 5).
2. After thawing the reagents, vials should be gently inverted 2–3
times and spun down using microcentrifuge to ensure proper
mixing of all enzymes and components in the reagent vials. The
master mix preparation and sample/template addition area
should be separated to avoid aerosol-based contamination (see
Note 6).
3. Prepare the PCR master mix in sterile 1.5 μL of Eppendorf
tubes as mentioned below. The QIAcuity viral probe kit con-
tains a 4× concentrated PCR master mix, which is optimized
for microfluidic use in the QIAcuity nanoplate.
4. Make the mixture of all components as mentioned in Table 2
(see Note 7) except for the RNA sample or positive control.
Vortex the mixture well, and dispense appropriate volumes of
the reaction mixture into the wells of a standard 24-well,
26,000 partitions PCR nanoplate. Carry the plate to the desig-
nated area for template addition to prevent contamination. The
PCR along with samples and controls should be prepared at
least in duplicates (see Note 8).
5. Dilute the positive control RNA to appropriate dilutions (1:50
or 1:100) using nuclease-free water. Critical: Samples that are
not sufficiently diluted will result in a saturation of the micro-
chambers with the target RNA that will preclude calculating
 8

Table 2
PCR mixture composition
Bhumika Prajapati et al.

Component Mix 1 (for N1 + N2 assay) Mix 1 (for MS2 assay) Mix N Final concentration
Nanoplate type 26,000 partitions 26,000 partitions 26,000 partitions (24-well) –
(24-well) (24-well)
4× one-step viral RT-PCR master mix 10 μL 10 μL 10 μL × N 1×
100× multiplex reverse transcription mix 0.4 μL 0.4 μL 0.4 μL × N 1×
10× primer-probe mix 2 μL (N1N2 assay mix) 1 μL (MS2 assay mix) 2 μL (N1N2)/1 μL MS2 × N 0.4 μM forward primer
0.4 μM reverse primer
0.2 μM probe
Template RNA/PC/NC 7 μL 7 μL 7 μL × N 100–200 ng
Nuclease-free water 20.6 μL 21.6 μL Up to 40 μL × N –
Total reaction volume 40 μL 40 μL 40 μL 1×
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 9

an accurate percentage of editing events in the sample (see

Note 9).
6. Add appropriate volume of template RNA/positive control/
nuclease-free water to wells containing the reaction mix labeled
as samples/positive control/negative template control (NTC),
respectively. After ensuring the mixing of the reaction mix
along with the template RNA, carefully close the Eppendorf
tubes, and briefly centrifuge the content to remove any
bubbles.
7. Take out the fresh 24-well nanoplate, and one by one add a
master mix containing RNA samples from the previous step to
the designated wells. Seal the entire plate without disturbing
the plate content as vortex or centrifugation is not recom-
mended with nanoplate because it might damage the tiny
partitions inside the plate.

3.6 Software Setup 1. Before starting the experiment, it is always recommended to set
and Thermal Cycling up experimental design in the software by following the guide-
Conditions lines provided by the manufacturer.
2. Open the software suite, and assign a reaction mix name con-
taining N1 + N2 assay and MS2 assay in QIAcuity software
suite. Assign appropriate wells with sample annotations such as
positive control, unknown, NTC and NC.
3. Assign the respective sample numbers in the plate layout prior
in the software to avoid any mistakes. Set the thermal cycling
program with a heated lid as mentioned in Table 3.
4. In the software suite, select the imaging tab, and capture the
appropriate channel (based on the dye or probes), exposure
duration, and gain value for fluorescent signal imaging. The
current assay targets the N1 + N2 gene and the probe is labeled
with FAM dye; thus a green channel with default exposure
duration and gain value should be selected.

Table 3
PCR amplification profile of the digital PCR system herein described

Name Time Temperature (°C)

Reverse transcription 50 min 50
PCR initial heat activation 2 min 95
Two-step cycling
Denaturation 5s 95
Combined annealing/extension 30 s 60
10 Bhumika Prajapati et al.

5. For MS2 bacteriophage assay, assign the ROX dye as a fluor-

ophore dye option, for which the software will automatically
assign the red channel.
6. Place the QIAcuity sealed nanoplate into the QIAcuity digital
PCR system and start the dPCR program. The three major
steps of the program are priming, thermal cycling, and
imaging.

Priming
Nanoplates micropartitions are filled with the input volume by
plunging of elastic top seal and the input wells which creates a
peristaltic pressure that pumps the input well liquid into the micro-
channel and partitions. Subsequently, the connecting channels
between the partitions are closed by a pressure-controlled rolling
process.

Thermocycling
The thermal cycling step performs the polymerase chain reaction in
the QIAcuity thermal cycler with high speed and precise tempera-
ture control of the various cycling steps.

Imaging
The image acquisition of all wells is the final step in the dPCR
system. The microfluidics partitions that have one or few copies
of target molecule inside can emit fluorescence land are brighter
than those without the target.

3.7 Result 1. Post-run analysis can be easily performed and exported from
Interpretation and the QIAcuity software suite. After the run, view the file, and
Data Analysis observe the threshold line in the 1D scatter plot (Fig. 2) which
separates the negative and positive partitions. There should be
good separation among positive and negative partitions for
getting output copies in a precise manner (see Note 10).
2. Baseline thresholds for each well/sample can be adjusted man-
ually by clicking into the respective wells and adjusting the
recalculation tab.
3. Save the results of the run and remove the plate from the
instrument.
4. Analyze each well for valid partitions. The valid partition indi-
cates the total analyzable volume of the PCR mixture. It is
recommended to achieve around 25,000 valid partitions for
each well.
5. The obtained copy numbers/μL should be reviewed as per the
dMIQE guideline and final (total) copy numbers of tar-
get genes should be calculated using the following formula:
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 11

Fig. 2 Representative image of 1D scatter plot: 1D scatter plot indicates the separation of negative and
positive partitions based on the fluorescence intensity. The fluorescence amplitude threshold is represented
by the red line. Positive partitions are seen above the red line, while negative are seen below the line. B1,
positive control; B2,C1, wastewater samples

Total reaction volume ðμLÞ × Obtained copy number per μL

Volume of RNA template ðμLÞ
As per example, if we get a copy number of 1.2 in sample
number A, then in 40 μL of reaction system, while using 7 μL
of RNA as a template, then
40 × 1:2
7
= 6:85 copies=μL of eluted RNA sample
Further, 300 μL of concentrated wastewater sample was
taken as a starting material for RNA extraction, and in the final
step, the RNA was eluted in a total of 30 μL of elution buffer.
12 Bhumika Prajapati et al.

Therefore, the viral genome copies in 1 liter of wastewater

samples will be
Copies
of RNA × Elution volume ðμLÞ × 1000
μL
Volume of concentrated sample ðμLÞ
6:85 × 30 × 1000
300
= 685 copies per liter of wastewater sample
Accordingly, calculate the final copies in each of the sam-
ples by applying the formula given. Before interpretation of
results in samples, properly analyze the controls (Table 4).

4 Notes

1. There are a total three types of nanoplate available: (1) 24-well

26,000 partitions, (2) 24-well 8,500 partitions, and
(3) 96-well 8,500 partitions. Use the selected nanoplate as
required. It is suggested to use 26,000 partition well plates
for rare target quantification as a higher number of partitions
can increase the sensitivity of the assay. Always be careful to
design the experiment so that it occupies the entire well plate
because the nanoplate cannot be used again.
2. There are around three types of dPCR platforms available in the
market. They all are based on a similar principle, i.e., partition-
ing whether it can be droplet- (oil in water emulsion) or
nanoplate-based system (microfluidics system), which can be
used for the absolute quantification of SARS-CoV-2 or any
pathogen from sewage samples containing plenty of inhibitors.
3. Always use a matrix recovery control (also known as process
control) while analyzing the wastewater samples for detection
of SARS-CoV-2 to understand the amount of inhibitors during
the sample processing. The process control is necessary for
comparison of concentration resulting from various testing
methods over time. It is an utmost need to quantitatively assess
the recovery of the target because wastewater is a biologically
and chemically complex and variable sample and often contains
the entities which can interfere with the sample/virus concen-
tration, nucleic acid extraction, and molecular quantification
methods. It is always recommended to include the matrix
recovery controls such as MS2 bacteriophage, murine or
bovine coronavirus, etc. for each sample for accounting for
unexpected changes in the wastewater composition.
4. To ensure efficient lysis, it is essential that the sample is mixed
thoroughly with buffer AVL to yield a homogeneous solution.
Table 4
Results of dPCR assay

Total valid Positive Negative Total copy number/

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

Sample Target Channel Copies/μL partitions partitions partitions μL of RNA sample
A1 N1 + N2 Green (FAM) 0.301 25,451 07 25,444 1.72
MS2 Red (ROX) 3.5 24,441 80 25,361 20
A2 N1 + N2 Green (FAM) 0.258 25,448 06 25,442 1.47
MS2 Red (ROX) 5.1 25,453 119 25,334 29.1
A3 N1 + N2 Green (FAM) 1.1 25,455 26 25,429 6.29
MS2 Red (ROX) 3.9 25,442 91 25,351 22.3
A4 N1 + N2 Green (FAM) 0.86 25,438 20 25,418 4.91
MS2 Red (ROX) 3.1 25,452 72 25,380 17.7
NC N1 + N2 Green (FAM) 0.086 25,386 02 25,384 0.49
MS2 Red (ROX) 4.6 25,446 106 25,340 26.2
PC N1 + N2 Green (FAM) 71.2 25,480 1604 23,876 101.7
MS2 Red (ROX) NA NA NA NA –
NTC N1 + N2 Green (FAM) 0 25,434 0 25,434 –
MS2 Red (ROX) 0 25,678 0 25,678 –

13
14 Bhumika Prajapati et al.

5. Some precautions should be taken while setting up the dPCR

mixture and assay to avoid contamination to reagents and
samples. Always wear a clean lab coat and disposable nitrile
gloves while working with molecular biology assays. It is
recommended to use separate sets of micropipettes for reagent
preparation and template addition. It is of utmost importance
to work in three separate molecular biology areas. One area
must be designated for RNA or DNA extraction, another for
preparing the PCR master mix, and the last designated for the
template addition. Use properly autoclaved sterile pipette tips
with filters. Wipe out the working space and lab ware using
RNAout or any RNA-degrading solution to avoid any foreign
RNA or carry-over contamination.
6. Storage or preparation of DNA/RNA-containing samples or
positive controls should be separated from other reagents. In a
dPCR-like sensitive platform, pipetting accuracy and precision
affect the consistency of results. All reagents including primer-
probe mix, master mix, and reverse transcriptase enzyme
should be aliquoted in multiple tubes to avoid the repeat
freeze-thaw and contamination. All the micropipette and
instruments should be checked and calibrated according to
the manufacturer’s recommendations.
7. The protocol has been developed using instrument specific kit
(Qiagen) but other equivalent kit may be used.
8. The samples or controls should be analyzed in duplicate or
triplicate based on the individual statistical requirement of the
respective laboratory. An excessive variability among duplicate
or triplicate indicates a problem with master mix preparation or
pipetting error. Ensure that master mix is prepared properly
and well mixed before aliquoting it to individual wells and that
the micropipettes are calibrated and dispensing proper volume
of reagents.
9. While performing analysis after a run, carefully observe the
results of positive and negative controls before interpreting
the results of unknown samples. The NTC should not produce
any amplification. If it shows amplification, this can be due to
amplicon contamination in the PCR master mix preparation.
Repeat the assay with a fresh set of primer-probe and other
reagents. NC represents the negative control of the RNA
extraction procedure, which should be free of any amplification
of N1 + N2 genes. NC should amplify only MS2 as it contains
bacteriophage with NFW as a starting sample for RNA extrac-
tion. Amplification in NC indicates the presence of carryover
contamination in the reagents or plastic wares used in the RNA
extraction process. The PC should show the proper amplifica-
tion of target genes without signal saturation. If PC or any
 Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 15

Fig. 3 Representative image of signal map: The figure represents the signal map of the N1 + N2 target gene,
which is captured in the green channel with FAM as a fluorescent molecule. (a) Positive control. (b) Negative
control. (c) Wastewater samples. The higher copies in positive control indicate more green fluorescent wells,
while samples contain very few target copies, thus showing few wells with green fluorescence. A negative
control should not show any wells with fluorescence

sample shows saturation in the signal map, it is recommended

to use the dilutions of samples and PC (Fig. 3).
10. Observe the scatter plot and signal map in the results output
for each positive and negative control. The 1D scatter plot
should have proper separation of positive and negative parti-
tions for each sample. The software auto adjusts the threshold
value for scatter plot; if not one can also adjust the threshold
manually and recalculate the copies in samples accordingly. In
the signal map, green dots indicate the partitions or nanowell
showing amplification. The signal map for samples or control
should not show saturation of fluorescence; in case of satura-
tion, re-perform the assay with appropriate dilutions of samples
and controls (Fig. 2).

Acknowledgments

The authors are grateful to Ahmedabad Municipal Corporation

(AMC) for providing the permission for sample collection from
different sewage treatment plants. We acknowledge SERB, DST,
GOI and DST, GoG for financial support for research study.
16 Bhumika Prajapati et al.

References
1. Guidance for surveillance of SARS-CoV-2 var- using droplet digital PCR for environmental
iants: interim guidance (2021) World Health samples. Appl Microbiol 1(1):74–88
Organization 8. Ahmed W, Smith WJM, Metcalfe S, Jackson G,
2. D’Aoust PM, Graber TE, Mercier E, Choi PM, Morrison M et al (2022) Compari-
Montpetit D, Alexandrov I, Neault N et al son of RT-qPCR and RT-dPCR platforms for
(2021) Catching a resurgence: increase in the trace detection of SARS-CoV-2 RNA in
SARS-CoV-2 viral RNA identified in wastewa- wastewater. ACS ES & T Water 2(11):
ter 48 h before COVID-19 clinical tests and 1871–1880
96 h before hospitalizations. Sci Total Environ 9. Ma D, Straathof J, Liu Y, Natalie HNM (2022)
770:145319 Monitoring SARS-CoV-2 RNA in wastewater
3. Baldovin T, Amoruso I, Fonzo M, Buja A, with RT-qPCR and chip-based RT-dPCR:
Baldo V, Cocchio S et al (2021) SARS-CoV- sewershed-level trends and relationships to
2 RNA detection and persistence in wastewater COVID-19. ACS ES & T Water 2(11):
samples: an experimental network for COVID- 2084–2093
19 environmental surveillance in Padua, 10. Huggett JF (2020) The digital MIQE guide-
Veneto Region (NE Italy). Sci Total Environ lines update: minimum information for publi-
760:143329 cation of quantitative digital PCR experiments
4. Chik AHS, Glier MB, Servos M, Mangat CS, for 2020. Clin Chem 66:1012–1029
Pang X, Qiu Y et al (2021) Comparison of 11. Kumar M, Joshi M, Patel AK, Joshi CG (2021)
approaches to quantify SARS-CoV-2 in waste- Unravelling the early warning capability of
water using RT-QPCR: results and implica- wastewater surveillance for COVID-19: a tem-
tions from a collaborative inter-laboratory poral study on SARS-CoV-2 RNA detection
study in Canada. J Environ Sci 107:218–229 and need for the escalation. Environ Res 196:
5. K€astner A, Lücker P, Sombetzki M, Ehmke M, 110946
Koslowski N, Mittmann S et al (2022) SARS- 12. Kumar M, Patel A, Shah A, Raval J, Rajpara N,
CoV-2 surveillance by RT-qPCR-based pool Joshi M et al (2020) The first proof of the
testing of saliva swabs (lollipop method) at capability of wastewater surveillance for
primary and special schools—a pilot study on COVID-19 in India through the detection of
feasibility and acceptability. PLoS One 17(9): the genetic material of SARS-CoV-2. Sci Total
e0274545 Environ 746:141326
6. Jenney A, Chibo D, Batty M, Druce J, 13. Natarajan A, Han A, Zlitni S, Brooks EF, Vance
Melvin R, Stewardson A et al (2022) Surveil- SE, Wolfe M et al (2021) Standardized preser-
lance testing using salivary RT-PCR for SARS- vation, extraction and quantification techni-
CoV-2 in managed quarantine facilities in ques for detection of fecal SARS-CoV-2 RNA.
Australia: a laboratory validation and imple- Nat Commun 12:5753
mentation study. Lancet Reg Health West Pac 14. Centers for Disease Control and Prevention.
26:100533 2019-Novel Coronavirus (2019-nCoV) real-
7. Kokkoris V, Vukicevich E, Richards A, time rRT-PCR panel primers and probes
Thomsen C, Hart MM (2021) Challenges
 Chapter 2

Digital PCR: A Tool to Authenticate Herbal Products

and Spices
Abhi P. Shah, Tasnim Travadi, Sonal Sharma, Ramesh Pandit,
Chaitanya Joshi, and Madhvi Joshi

Abstract
Authentication of herbal products and spices is experiencing a resurgence using DNA-based molecular
tools, mainly species-specific assays and DNA barcoding. However, poor DNA quality and quantity are the
major demerits of conventional PCR and real-time quantitative PCR (qPCR), as herbal products and spices
are highly enriched in secondary metabolites such as polyphenolic compounds. The third-generation digital
PCR (dPCR) technology is a highly sensitive, accurate, and reliable method to detect target DNA
molecules as it is less affected by PCR inhibiting secondary metabolites due to nanopartitions. Therefore,
it can be certainly used for the detection of adulteration in herbal formulations. In dPCR, extracted DNA is
subjected to get amplification in nanopartitions using target gene primers, the EvaGreen master mix, or
fluorescently labeled targeted gene-specific probes. Here, we describe the detection of Carica papaya
(CP) adulteration in Piper nigrum (PN) products using species-specific primers. We observed an increase
in fluorescence signal as the concentration of target DNA increased in PN-CP blended formulations (mock
controls). Using species-specific primers, we successfully demonstrated the use of dPCR in the authentica-
tion of medicinal botanicals.

Key words Absolute quantification, Digital PCR, Herbal products, Species-specific PCR assay, Third-
generation PCR

1 Introduction

The demand and supply chains of the herbal market are expanding
with industrialization and globalization. However, a bottleneck is
created, which leads to an increased incidence of economically
motivated adulteration in herbal products and spices [1]. As DNA
is a stable biomolecule, it is unaffected by the environmental and
physiological parameters of the plant life cycle which makes it very
suitable to be used for authentication methods with a universal,
reliable, and reproducible approach [1, 2]. Regulatory guidelines
and various pharmacopeia advocate the inclusion of DNA-based
methods such as species-specific PCR assays and DNA barcoding to

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_2,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

17
18 Abhi P. Shah et al.

authenticate plant raw materials and processed products [3]. Digital

PCR (dPCR) is a third-generation PCR technology that employs
the divide and conquer rule, in which template DNA is diluted and
distributed into thousands of nanopartitions using a microfluidics
mechanism. Here, individual partitions will act as single PCR, and
amplification will take place if target DNA is present as shown in
Fig. 1 [4, 5]. Poisson statistical analysis of the numbers of positive
(PCR +ve) and negative (PCR -ve) partitions yields absolute quan-
titation of the target sequence without the need for a calibration
curve, which is required for quantifying target DNA using quanti-
tative real-time PCR (qPCR). Plant raw materials, processed herbal
products, and spices will yield DNA of poor quality and quantity
due to secondary metabolites such as polyphenolic compounds.
In this case, the phenomenon of distributing the DNA template
into thousands of nanopartitions provides high sensitivity and
specificity of amplification by diluting secondary metabolites
(Fig. 1). Furthermore, DNA may not be extracted equally from
all the ingredients used in polyherbal or multi-ingredient formula-
tions, which may also contain different plant components like
leaves, fruits, barks, or roots. Partitioning will increase the proba-
bility of detecting low-frequency targeted DNA in the unequally
extracted DNA pool. Thus, nowadays, dPCR has been widely used
for authenticating herbal products, foods, and spices [3]. We have

Fig. 1 Overview of digital PCR workflow. The steps in the dPCR workflow are as follows: (1) prepare the PCR
mixture; (2) load the PCR mixture containing the template DNA onto the QIAcuity nanoplate and seal it;
(3) partitioning of template DNA, amplification of targeted DNA, and detection of the target DNA by the QIAcuity
digital PCR system; and (4) data analysis after adjusting the threshold line
 Digital PCR for Authentication of Herbal Products and Spices 19

adapted the protocol from the QIAcuity® user manual followed by

the dMIQE guidelines [6] and used the QIAcuity digital PCR
system (QIAGEN, India) (see Note 1) to authenticate Ocimum
basilicum and Ocimum tenuiflorum [7], Piper nigrum, and Carica
papaya [8 and the protocol described here]. This protocol is based
on the quantification of targeted DNA copies using species-specific
sets of primers and DNA-binding EvaGreen fluorescent dye
(Fig. 1).

2 Materials

2.1 Preparation of 1. Weighing balance.

Blended Formulations 2. Dried Carica papaya (CP) seed and Piper nigrum (PN) berries.
3. Mortar and pestle.
4. Liquid nitrogen.

2.2 DNA Extraction, 1. DNA extraction can be done either with manual CTAB-based
Quantification, and modified methods [8–11] or using commercially available
Dilution plant DNA extraction kit-based methods. The necessary mate-
rials/reagents should be prepared in accordance with that.
2. DNA quantification can be performed using Qubit fluorome-
ter with Qubit dsDNA BR (broad-range) assay kit or Qubit
dsDNA HS (high-sensitivity) assay kit, as directed by the man-
ufacturer, or with a nanodrop spectrophotometer, QIAxpert,
or a UV/VIS spectrophotometer (see Note 2). A DNA quanti-
fication requirement should be prepared in accordance with it.
3. 1 M stock solution of Tris–HCl (pH 8.0): For preparing 1 M
stock solution of Tris–HCl, add about 500 mL water to a 1 L
graduated cylinder or a glass beaker, weigh 121.14 g Tris base,
and transfer to the cylinder. Mix and adjust pH with HCl.
Make up the final volume to 1 L with water. Store at 4 °C.
4. 0.5 M stock solution of EDTA (pH 8): For preparing 0.5 M
stock solution of EDTA, add about 500 mL water to a 1 L
graduated cylinder or a glass beaker, weigh EDTA, and transfer
to the cylinder. Add NaOH pellets to dissolve the EDTA and
adjust the pH. Make up the final volume to 1 L with water.
Store at 4 °C.
5. Low TE (Tris-EDTA) buffer: 10 mM Tris–HCl (pH 8.0),
0.1 mM EDTA (pH 8.0). For preparing low TE, add 10 mL
of 1 M stock solution of Tris–HCl (pH 8.0) and 0.2 mL of
0.5 M stock solution of EDTA (pH 8) to a 1 L graduated
cylinder or a glass beaker, and make up the final volume to
1 L with water. Store at 4 °C.
20 Abhi P. Shah et al.

Table 1
Primers used for the authentication of Piper nigrum (PN) and Carica papaya (CP) with the protocol
described herein

Targeted Oligonucleotide Molecular Amplicon

plant (designation) Sequence (5′-3′) marker size (bp) References
Piper PN-forward AACATTGATCCTTGGG rps16 gene 400 bp [7]
nigrum TTTAGACA
(PN) PN-reverse TCCGCCACTTTCTA
TATCCTCGAAG
Carica CP-forward ATGATAATCGTAATG trnK-UUU 360 bp
papaya TAATGGG gene
(CP) CP-reverse TGAGATCGTGGAAA
TGATGGCA

2.3 Primer Dilution 1. Primers are generally received at 100 μM concentration. By

diluting the stock solution by a factor of 10 in either low TE
buffer or nuclease-free water, the working solution of 10 μM
can be prepared.
2. Working aliquots must be prepared as required, and both
working aliquots and stock must be stored at -20 °C.

2.4 Preparation of 1. 1.5 mL microcentrifuge tubes.

Reaction Mixture 2. Micropipettes.
3. 1 mL, 200 μL, and 10 μL sterile micropipette tips.
4. EvaGreen or SYBR Green PCR Master Mix.
5. 10 μM forward and reverse primers (Table 1).
6. EcoRI restriction enzyme and buffer.
7. Template DNA.
8. Nuclease-free water (NFW).
9. Sterile PCR strips or plate.
10. Laminar flow hoods or PCR cabinet.
11. Vortex mixer.
12. Centrifuge for PCR plate or PCR strips.
13. 24-well QIAcuity nanoplate with 26,000 nanopartitions (see
Note 3).
14. QIAcuity nanoplate sealer.
 Digital PCR for Authentication of Herbal Products and Spices 21

3 Methods

3.1 Preparation of 1. Grind the sample materials [here, dried Carica papaya
Blended Formulations (CP) seed and Piper nigrum (PN) berries] with liquid nitrogen
in a mortar and pestle (see Note 4).
2. For preparing a blended formulation (mock control) contain-
ing 75% (w/w) of CP and 25% (w/w) PN, weigh 75 mg of CP
seed powder and 25 mg of PN barriers powder in a single
1.5 mL microcentrifuge tube.
3. For preparing a blended formulation containing 50% (w/w) of
CP and PN, weigh 50 mg of CP seed powder and 50 mg of PN
barriers powder in another 1.5 mL microcentrifuge tube.
4. For preparing a blended formulation containing 25% (w/w) of
CP and 75% (w/w) of PN, weigh 25 mg of CP seed powder
and 75 mg of PN barriers powder in a third 1.5 mL
microcentrifuge tube.
5. After weighing, homogenize each prepared mixture.

3.2 DNA Extraction, 1. Extract DNA either with manual CTAB-based modified meth-
Quantification, and ods [8–11] or using commercially available plant DNA extrac-
Dilution tion kit-based methods (see Note 5).
2. Quantify the extracted DNA by any method that is described in
Subheading 2.2.
3. After quantification, dilute the extracted DNA using low TE
according to the desired final concentration. Here, we have
diluted the extracted DNA of each blended formulation using
low TE to obtain a final concentration of 0.25 ng/μL.

3.3 Digital PCR Setup Precautions should be taken while setting up digital PCR at all
stages to prevent contamination of the sample and reagent. To
avoid cross-contamination, DNA extraction and PCR setup should
be performed in different rooms (see Note 6). Preparation of the
reaction mixture for PCR should be performed in a laminar flow
hood or PCR cabinet:
1. All reagents should be thawed and mixed by repeatedly
inverting the tubes or, for small volumes, by flicking the tube
and spinning briefly in a centrifuge, prior to preparing the
reaction mixture. For the selection or design of primers, refer
to Note 7.
2. Prepare the PCR mixture in 1.5 mL microcentrifuge tubes, as
shown in Table 2. To ensure homogeneous distribution of the
template across the partitions on the plate, circular DNA such
as plasmids or long DNA templates (>20 kb) such as genomic
DNA extracted from plants and animals must be digested with
22 Abhi P. Shah et al.

Table 2
Components of PCR mixture (see Note 10)

For authentication of PN
Mixture for N and CP (mixture for N
Mixture for one reaction reactions reactions)
Component Nanoplate with 26,000 Nanoplate with Nanoplate with 26,000
partitions (24-well) 26,000 partitions partitions (24-well)
(24-well)
3× EvaGreen PCR 13.3 μL 13.3 × N μL 13.3 × N μL
Master Mix
(QIAGEN)
10 μM forward 1.6 μL 1.6 × N μL 1.6 × N μL
primer
10 μM reverse 1.6 μL 1.6 × N μL 1.6 × N μL
primer
Restriction Up to 1 μL (final concentration Up to 1 μL × N 1 μL EcoRI (1 U/μL), i.e.,
enzyme in reaction system: 0.025 U/μL reaction
(optional) 0.025–0.25 U/μL) volume
Template DNA Variablea (in μL) Variablea × N 2 μL (0.25 ng/μL)
Nuclease-free Variablea (in μL) Variablea × N 20.5 μL
water (NFW)
Final volume 40 μL 40 × N μL 40 × N μL
See Notes 10 and 11
a

a restriction enzyme (see Note 8). The final volume of the PCR
mixture is calculated by multiplying the total number of reac-
tions required for the dPCR experiment by the volume of each
reaction. To account for pipetting variations, PCR mixtures can
be made in excess, i.e., 10–12% more than required. It is not
required to keep samples on ice during reaction setup or when
programming the QIAcuity instrument because of the
hot-start polymerase in the dPCR Master Mix. Mix the master
mix thoroughly, centrifuge it, and dispense equal aliquots into
each well of the PCR plate or each tube of PCR strips.
3. Add template DNA (here we have used 2 μL of 0.25 ng/μL
DNA of each blended formulation, i.e., a total of 0.5 ng of
DNA) to each reaction tube as needed [make sure that negative
template control (NTC) does not receive any template] (see
Note 9). For each sample, prepare at least duplicate reactions
(see Note 9).
4. Seal the PCR plate or PCR strips and vortex it for proper
mixing. Then, centrifuge the PCR plate or PCR strips.
 Digital PCR for Authentication of Herbal Products and Spices 23

5. After that, load each reaction mixture into a 24-well QIAcuity

nanoplate comprising 26,000 nanopartitions (see Note 3).
Load each reaction carefully so that no bubbles are introduced
into the wells of the dPCR nanoplate, allowing for a greater
number of valid partitions.
6. Carefully seal the QIAcuity nanoplate using the QIAcuity
nanoplate sealer by the instructions provided in the QIAcuity®
user manual. Improper sealing can affect areas of the reference
and target channels to not be filled with the reaction mixture,
lowering the number of valid partitions.
7. If the reaction contains a restriction enzyme for DNA diges-
tion, leave the plate at room temperature (15–25 °C) for
10 min.

3.4 PCR Thermal 1. Operate the QIAcuity digital PCR system and software accord-
Cycle and Run Set Up ing to the manufacturer’s recommendations.
in QIAcuity Digital PCR 2. Set the thermal cycling program as follows: initial heat activa-
System tion at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s,
58 °C for 30 s, and 72 °C for 40 s, and a final cooling step at
40 °C for 5 min (see Note 12).
3. In the Imaging tab of QIAcuity software, select the channel,
exposure duration, and gain value for fluorescent signal imag-
ing depending on the dye or probes used (see Note 13). We
chose a green channel with the default exposure duration and
gain value for the EvaGreen-based reaction system.
4. Place the QIAcuity nanoplate into the QIAcuity digital PCR
system and start the dPCR program.
5. To start the PCR run, click on the “Run” icon located on the
plate’s pane in the QIAcuity software.

3.5 Data Collection 1. After the run is completed, you can adjust the threshold line to
and Analysis obtain a good separation between negative and positive parti-
tions using automatic thresholding.
2. When the positive and negative partitions are not well sepa-
rated, automatic thresholding fails, and the threshold line must
be adjusted manually. The threshold line can be adjusted man-
ually by clicking into the different wells and adjusting the
threshold line vertically. After adjusting the threshold, the
analysis can be updated by selecting “recalculate” (Fig. 2,
Table 3).
3. Save the results of the run and remove the plate from the
instrument.
4. The obtained copy numbers/μL should be reviewed and as per
the dMIQE guideline [6]. Further, the final (total) copy num-
bers of targeted DNA should be calculated using the following
24 Abhi P. Shah et al.

Fig. 2 Digital PCR assay of Piper nigrum (PN) and Carica papaya (CP) blended formulations. Digital PCR assay
of 75% CP + 25% PN, 50% CP + 50% PN, 25% CP + 75% PN blended formulations with CP- and PN-specific
primers. The fluorescence amplitude threshold is represented by the red line. Above the threshold, positive
partitions were seen, and below the threshold, negative partitions. NTC = no template control. (a) Digital PCR
assay using CP primers. (b) Digital PCR assay using PN primers

Table 3
Copy numbers of Piper nigrum (PN) and Carica papaya (CP) determined by digital PCR with the
protocol described herein

Obtained copy Total copy numbers (obtained Total valid Positive Negative
Target Samplea numbers/μL copy numbers/μL × 20 μL) partitions partitions partitions
CP 75% CP 698.4 13,968 25,474 12,010 13,464
50% CP 389.55 7,791 25,332 7,609 17,723
25% CP 322.4 6,448 25,480 6,495 18,985
PN 25% PN 9.2 184 25,232 219 25,013
50% PN 107.85 2,157 25,463 2,387 23,076
75% PN 137.95 2,759 25,439 3,011 22,428
Total valid partitions and valid positive and valid negative partitions are also described in the table
a
Digital PCR assay of 75% CP + 25% PN, 50% CP + 50% PN, 25% CP + 75% PN blended formulations with CP- and
PN-specific primers

formula: [(total PCR volume in μL/volume of DNA template

in μL used in PCR) x (obtained copy numbers/μL)]; here,
(40 μL PCR volume/2 μL DNA template) × (obtained copy
numbers/μL) = 20 μL × (obtained copy numbers/μL)
(Table 3).
5. The obtained copy numbers of the targeted DNA must be
taken into account for the interpretation of the results or for
authenticating herbal products and spices. If the copy number
of target DNA is detected in the samples, it implies that the
samples include the desired species, and if the copy number of
the target DNA is not found, it means that the desired species
are not present in the herbal products or spices.
 Digital PCR for Authentication of Herbal Products and Spices 25

4 Notes

1. Commercially available dPCR is classified into two types:

(1) Chamber-based dPCR is composed of thousands of parti-
tions, which are referred to as nanopartitions, microwells,
chambers, or chip-based dPCR. Using the microfluidics mech-
anism, the reactions are divided by subvolumes into partitions,
chambers, or wells. BioMark, the QuantStudio series, Constel-
lation/QIAcuity, Clarity, and Optolane are illustrations of
chamber-based PCR. (2) Droplet-based dPCR is primarily a
microfluidics mechanism based on oil/water partitions (i.e.,
emulsion PCR). The formulations of surfactant and oil,
which stabilize the droplet PCR machinery, are a vital part of
this technology. Droplets could be formed using a T-junction,
a nozzle, or a step emulsifier. Bio-Rad Laboratories, RainDance
Technologies, and Stilla have commercialized these technolo-
gies [12]. In this protocol, QIAcuity digital PCR system (QIA-
GEN, India) was used.
2. DNA Quantification: In this protocol, quantification of the
extracted DNA was done using Qubit dsDNA HS assay kit.
For that, we mixed 2 μL of extracted DNA with 198 μL 1×
dsDNA high-sensitivity reagent in Qubit vials and measured
quantification using a Qubit fluorometer.
3. There are two types of QIAcuity nanoplates available, which
have 24 wells with 26,000 nanopartitions and 24 wells with
8500 nanopartitions. If the targeted gene is in lower abun-
dance, the sensitivity would increase with the increased number
of partitions. Therefore, a nanoplate with 8500 partitions is
recommended for high-frequency target genes, and a nano-
plate with 26,000 partitions is recommended for genes with
low-frequency target genes (QIAcuity® user manual).
4. If the sample is in the form of a “churna,” then it can be
subjected directly to DNA extraction without grinding.
Depending on the purpose of the experiment, blended formu-
lations (mock controls) can be prepared. For the authentica-
tion of market samples and to determine the presence of
labeled species, blended formulations containing different
amounts of the target standard reference can be prepared.
Various biomass ratios of adulterated/substituted plant mate-
rial and reference plants can be prepared as a mock control to
detect adulteration or substitution [7, 13].
5. DNA extraction from herbal products and spices is the first and
crucial step for any PCR setup. The extraction of degraded and
low-quality DNA from processed material will be one key
impediment to successful PCR. Additionally, contamination
of secondary metabolites, especially phenolic compounds in
the extracted DNA, is also a major concern. To address this
26 Abhi P. Shah et al.

issue, DNA extraction could be performed to improve the

efficiency of DNA recovery and to remove potential PCR
inhibitors. Here, DNA extraction was done from 100 mg of
each blended formulation using the DNeasy Plant Mini Kit
(QIAGEN) according to the manufacturer’s instructions.
6. To avoid cross-contamination or aerosol contamination, stan-
dard operating procedures (SOPs) and good laboratory prac-
tice (GLP) must be followed. According to the SOPs, separate
cubicles must be designated for DNA isolation, master mix
preparation, and template addition. The template should be
added with a designated pipette set and the reagents with a
different pipette set. Keep the reagent separate from the pri-
mers and template DNA. Only sterile filter tips and plasticware
should be used. Always wear gloves while performing the
experiment. Spray gloves with a freshly prepared 1.0% bleach
or 70% alcohol solution before beginning work.
7. The primer pair is selected from literature or designed in such a
way that the PCR product size ranges between 60 and 150 bp.
Even if QIAGEN dPCR EvaGreen chemistry can be applicable
for 400–500 bp product sizes, for multiplexing PCR (see Note
13), the length of PCR products should be kept in the range of
60–150 bp. Make sure to follow the standard primer designing
criteria listed in the QIAcuity® User Manual Extension when
designing primers, such as the primer length must be between
18 and 30 nucleotides and the primer melting temperature
(Tm) must be between 58 and 62 °C. For authentication of
herbal products or spices, primer pair that targets single-copy
nuclear genes (e.g., the diacylglycerol kinase 1 gene), multi-
copy nuclear genes (e.g., the ITS gene), genes of mitochondrial
DNA (mtDNA), or genes of chloroplast DNA (cpDNA) (e.g.,
the rbcL gene) can be selected. However, nuclear genes that are
present in multicopy and genes from mtDNA and cpDNA that
show great variation in different tissues cannot give an accurate
quantitative analysis with respect to the quantity of plant mate-
rials. A single-copy nuclear gene is more suitable for quantita-
tive analysis of plant materials. For instance, Yu et al. [11] used
single-copy nuclear genes to develop a duplex dPCR assay for
the authentication and quantification of Panax notoginseng and
its adulterants, rice, and soybean. In the weight/weight pro-
portion of P. notoginseng/rice or P. notoginseng/soybeans, they
were able to obtain linearity in the copy numbers of the tar-
geted genes. In here, the linearity in copy number for PN and
CP is obtained in proportion to PN and CP weights. However,
the accurate quantification of plant materials (weight/weight)
cannot be determined using this data due to cpDNA gene copy
number variability [14].
 Digital PCR for Authentication of Herbal Products and Spices 27

8. Larger DNA molecules (>20 kb) can produce rainy partitions,

i.e., partitions that fall between positive and negative partitions
(positive partitions are those that contain one or a few targeted
DNA copies, and negative partitions are those that have none),
and may lead to inaccurate quantification because of poor
target accessibility and uneven partitioning. The addition of
restriction enzymes into the PCR mixture leads to the frag-
mentation of large templates into smaller sizes that can be
distributed evenly in the partitions and become accessible for
PCR amplification, which results in a reduction in the number
of rainy partitions and accurate quantification. Six cutter
restriction enzymes (REs) include EcoRI, Pvu II, and Xba I,
and four cutter restriction enzymes include Alu I, Hae II, and
CviQ I, which may be added as recommended by the QIA-
cuity® user manual with 0.025–0.25 U per μL PCR mixture
and 10 min of incubation at room temperature (15–25 °C).
However, make sure the enzymes do not cut the target ampli-
con sequence. The amount of restriction enzyme and incuba-
tion time needed to digest larger DNA fragments to achieve
equal distribution of template DNA in the partitions and
reduce rainy partitions must be optimized if you are using
different restriction enzymes other than the ones recom-
mended in the QIAcuity® user manual.
9. The experiment must be repeated if the negative template
control (NTC) results are positive. A probable reason would
be contamination during the procedure, whether from
reagents or aerosols. To avoid amplification in NTC, repeat
the experiment with freshly aliquoted reagent, and/or clean
the pipette properly. In the case of species-specific determina-
tion, negative controls (NC) containing DNA from allied spe-
cies can be employed to confirm that no cross-reactivity is
observed in allied species. DNA samples from standard refer-
ence materials such as herbal products or spices in which ampli-
fication of the target gene is observed can be used as a positive
control (PC). To validate the dPCR assay for adulteration
detection and authentication of market samples (test samples),
in-house blended formulations or mock controls that resemble
market formulations should be prepared, e.g., here for detec-
tion of Carica papaya (CP) adulteration in Piper nigrum (PN),
we have prepared blended formulations of 75% CP + 25% PN,
50% CP + 50% PN, and 25% CP + 75% PN. Blended formula-
tions can also be used as positive controls. Market samples of
herbal products or spices, as well as controls, should be eval-
uated in duplicate or triplicate, according to statistical
robustness.
10. The range of input DNA template (i.e., the highest and lowest
amount of input DNA) can be decided by serial dilution of
28 Abhi P. Shah et al.

template DNA either in twofold, fivefold, or tenfold to achieve

the range of valid positive partitions to valid negative partitions
dynamics. The dynamic range of an input DNA template is the
range within which it can quantify targeted gene copy numbers
with good linearity (R2 ≥ 0.980) and efficiency (ideally
between 90 and 110%). In the PCR mixture, add the desired
volume of template DNA (input DNA), and add NFW to make
up the final volume of 40 μL. If an 8500-partition nanoplate is
used, the PCR mixture should be made with a final volume of
12 μL, and all components should be added in accordance with
the instructions given in the QIAcuity® user manual. The
dynamic range of input DNA in dPCR is smaller and is propor-
tional to the partition numbers and inversely proportional to
the input volume. The dynamic range of the dPCR is also
influenced by the primer specificity and sensitivity and the
targeted gene copy numbers. Although dPCR has a smaller
dynamic range, it applies to finding a needle in a haystack
because it is more sensitive to detecting low copy numbers,
has a high tolerance to inhibitors, and is more precise than
qPCR. In addition, possibly contaminated nucleic acids, pro-
teins, and salts can impact the measurement of DNA using a
spectrophotometer. To address this issue, dPCR can be used to
perform absolute quantification of targeted DNA or qPCR
plasmid standards [5].
11. Limit of Detection (LOD) and Limit of Quantification
(LOQ): The lowest stable copy number that can be detected
with more than a stated percentage of confidence is described
as the limit of detection (LOD); it is not necessarily quantified
as an exact value. For dPCR-based molecular authentication,
the limit of quantification (LOQ) can be defined as the
detected lowest copy number that can be quantitatively deter-
mined with a coefficient of variation (CV) ≤ 25% [6, 15].
12. PCR conditions can be optimized by the dMIQE [6] and
manufacturer guidelines to maximize partition separation,
PCR efficacy, optimal primer specificity, and sensitivity and
reduce artifacts of noise and nonspecificity. Generally, with
the standard thermal cycling conditions (given in the QIA-
cuity® user manual), optimal results will be obtained. If opti-
mal results are not obtained, thermal cycler parameters can be
optimized, among which annealing temperature optimization
is one of the most important parameters in PCR optimization.
If the annealing temperature is too high, the yield of the
desired product is lowered, leading to false-negative signals.
If the annealing temperature is too low, nonspecific DNA
fragments are amplified, leading to false-positive signals. That
will lead to erroneous copy number detection. The QIAGEN
dPCR does not have gradient PCR facilities; hence, the
 Digital PCR for Authentication of Herbal Products and Spices 29

QIAcuity® user manual recommends optimizing the annealing

temperature using the gradient facilities of qPCR with Eva-
Green chemistry. The numbers of cycles also play a crucial role
in endpoint detection. To achieve the best effects, the thermal
cycling condition should be repeated 30–40 times.
13. As an alternative to EvaGreen chemistry, probe-based chemis-
try can also be used, in which target-specific probes are labeled
with different fluorescent dyes. Probe-based chemistry
enhances specificity and sensitivity, and one of the key strengths
of this approach is that it can be used for the development of
multiplex dPCR by using species-specific probes labeled with
different fluorescent dyes. Optimization of the probe, primers,
and DNA concentration is needed for multiplex PCR, and no
cross-reactivity should be observed. Yu et al. [16] developed
duplex PCR for P. notoginseng and rice as well as for
P. notoginseng and soybean. Xu et al. [17] developed triplex
dPCR for the authentication of Akebiae caulis and its two
adulterants, Clematis armandii and Aristolochia
manshuriensis.

References

1. Ichim MC (2019) The DNA-based authentica- 7. Travadi T, Sharma S, Pandit R, Nakrani M,

tion of commercial herbal products reveals Joshi C, Joshi M (2022) A duplex PCR assay
their globally widespread adulteration. Front for authentication of Ocimum basilicum L. and
Pharmacol 10:1–9. https://doi.org/10. Ocimum tenuiflorum L in Tulsi churna. Food
3389/fphar.2019.01227 Control 137: https://doi.org/10.1016/j.
2. Raclariu AC, Heinrich M, Ichim MC, de Boer foodcont.2021.108790
H (2018) Benefits and limitations of DNA 8. Aboul-Maaty NA-F, Oraby HA-S (2019)
barcoding and metabarcoding in herbal prod- Extraction of high-quality genomic DNA
uct authentication. Phytochem Anal 29:123– from different plant orders applying a modified
128. https://doi.org/10.1002/pca.2732 CTAB-based method. Bull Natl Res Cent 43:
3. Wu HY, Shaw PC (2022) Strategies for molec- 1–10. https://doi.org/10.1186/s42269-019-
ular authentication of herbal products: from 0066-1
experimental design to data analysis. Chinese 9. Porebski S, Bailey LG, Baum BR (1997) Mod-
Med (United Kingdom) 17:1–15. https://doi. ification of a CTAB DNA extraction protocol
org/10.1186/s13020-022-00590-y for plants containing high polysaccharide and
4. Quan PL, Sauzade M, Brouzes E polyphenol components. Plant Mol Biol
(2018) DPCR: a technology review. Sensors Report 15:8–15. https://doi.org/10.1007/
(Switzerland) 18. https://doi.org/10.3390/ BF02772108
s18041271 10. Clarke JD (2009) Cetyltrimethyl ammonium
5. Beinhauerova M, Babak V, Bertasi B, Boniotti bromide (CTAB) DNA miniprep for plant
MB, Kralik P (2020) Utilization of digital PCR DNA isolation. Cold Spring Harb Protoc
in quantity verification of plasmid standards 2009:pdb-prot5177
used in quantitative PCR. Front Mol Biosci 7: 11. Krizman M, Jakse J, Baricevic D, Javornik B,
1–13. https://doi.org/10.3389/fmolb.2020. Prosekm M (2006) Robust CTAB-activated
00155 charcoal protocol for plant DNA extraction.
6. Huggett JF (2020) The digital MIQE guide- Acta Agric Slov 87:427–433
lines update: minimum information for publi- 12. Tan LL, Loganathan N, Agarwalla S, Yang C,
cation of quantitative digital PCR experiments Yuan W, Zeng J, Wu R, Wang W, Duraiswamy S
for 2020. Clin Chem 66:1012–1029. https:// (2022) Current commercial dPCR platforms:
doi.org/10.1093/clinchem/hvaa125 technology and market review. Crit Rev
30 Abhi P. Shah et al.

Biotechnol 0:1–32. https://doi.org/10. authentication and quantification of Panax

1080/07388551.2022.2037503 notoginseng and its adulterants. Food Control
13. Travadi T, Shah AP, Pandit R, Sharma S, 132:108493
Joshi C, Joshi M (2022) Detection of Carica 16. Yu N, Han J, Deng T, Chen L, Zhang J,
papaya adulteration in Piper nigrum using Xing R, Wang P, Zhao G, Chen Y (2021) A
chloroplast DNA marker-based PCR assays. novel analytical droplet digital PCR method for
Food Anal Methods. https://doi.org/10. identification and quantification of raw health
1007/s12161-022-02395-z food material powder from Panax notoginseng.
14. Sakamoto W, Takami T (2018) Chloroplast Food Anal Methods 14:552–560. https://doi.
DNA dynamics: copy number, quality control org/10.1007/s12161-020-01887-0
and degradation. Plant Cell Physiol 59:1120– 17. Xu W, Zhu P, Xin T, Lou Q, Li R, Fu W, Ma T,
1127. https://doi.org/10.1093/pcp/pcy084 Song J (2022) Droplet digital PCR for the
15. Yu N, Xing R, Wang P, Deng T, Zhang J, identification of plant-derived adulterants in
Zhao G, Chen Y (2022) A novel duplex droplet highly processed products. Phytomedicine
digital PCR assay for simultaneous 105:154376. https://doi.org/10.1016/j.
phymed.2022.154376
 Chapter 3

Emulsion Polymerase Chain Reaction Coupled

with Denaturing Gradient Gel Electrophoresis for Microbial
Diversity Studies
Maria-Eleni Dimitrakopoulou, Dimosthenis Tzimotoudis,
and Apostolos Vantarakis

Abstract
Emulsion PCR-DGGE is a molecular biology technique used to amplify and analyze DNA fragments. This
technique combines two processes, emulsion PCR and denaturing gradient gel electrophoresis (DGGE), to
enhance the specificity and yield of the amplification process and to separate the amplified fragments based on
their melting behavior. In the emulsion PCR step, a high-quality DNA template is mixed with the PCR
reagents and droplet generator oil to create an oil-in-water emulsion. The emulsion is then subjected to
thermal cycling to amplify the target DNA fragments. The amplified fragments are recovered from the
droplets and purified to remove any impurities that may interfere with downstream applications. In the
DGGE step, the purified amplicon is loaded onto a DGGE apparatus, where the DNA fragments are separated
and visualized based on their melting behavior. This method allows for the concurrent amplification and
separation of multiple DNA fragments, thereby enhancing the resolution and sensitivity of the analysis. It is
widely used in environmental and medical microbiology research, as well as in other fields that require the
identification and characterization of microorganisms, such as the study of microbial diversity in soil, water, and
other natural environments, as well as in the human gut microbiome and other medical samples.

Key words Emulsion PCR, DGGE, Polyacrylamide gel, DNA extraction, Omics technologies, Digi-
tal PCR

1 Introduction

Emulsion PCR is a technique that enables the simultaneous ampli-

fication of multiple DNA sequences in a single reaction. The sample
is initially emulsified, which forms minuscule droplets containing a
single PCR amplification product. This allows for the amplification
of multiple genetic targets, thereby increasing the resolution and
sensitivity of the analysis. Emulsion PCR is widely employed in
environmental and medical microbiology research, as well as in

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_3,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

31
32 Maria-Eleni Dimitrakopoulou et al.

other fields requiring the identification and characterization of

microorganisms [1, 2].
DGGE (denaturing gradient gel electrophoresis) is a method
that separates DNA fragments based on their melting temperature.
The separation is performed on a gel matrix, where the DNA
fragments migrate through the gel in response to an electric field.
The gel contains a denaturing gradient, which causes the DNA
fragments to denature (unwind) at varying temperatures. The frag-
ments that denature at lower temperatures migrate further through
the gel, while those that denature at higher temperatures migrate
less. This results in a separation of the fragments based on their
melting temperature [3, 4].
Emulsion PCR-DGGE combines the use of emulsion PCR
with DGGE to analyze genetic diversity among microorganisms
in a sample. After emulsion PCR, the droplets containing the
amplified DNA are collected and utilized as the template for
DGGE (Fig. 1). This allows for the concurrent amplification and
separation of multiple DNA fragments, thereby increasing the res-
olution and sensitivity of the analysis.
Emulsion PCR-DGGE is a robust tool for studying microbial
communities. It enables the identification and characterization of a
wide range of microorganisms in a sample, including those that are
challenging to culture or detect using other methods. It is widely
used in environmental and medical microbiology research, as well
as in other fields requiring the identification and characterization of
microorganisms. For example, it has been employed to study the
diversity of microorganisms in soil, water, and other natural envir-
onments, as well as in the human gut microbiome and other
medical samples [4–6].

Fig. 1 Principle of emulsion PCR-DGGE in comparison to conventional PCR-DGGE (food sample is presented) [5]
This article was published in Current Research in Food Science, 4, Dimitrakopoulou, M. E., Panteleli, E., &
Vantarakis, A, Improved PCR-DGGE analysis by emulsion-PCR for the determination of food geographical
origin: A case study on Greek PDO “avgotaracho Mesolonghiou,” 746–751, Copyright Elsevier (2021).
 Emulsion PCR-DGGE 33

2 Materials

2.1 DNA Extraction 1. Commercial kit for DNA extraction.

2. Agarose gel.
3. Staining reagents.
4. 1× TAE buffer (40 mM Tris-acetate, 1 mM EDTA).
5. Molecular weight ladder.
6. Casting tray.
7. Well combs.
8. Voltage source.
9. Gel box.
10. UV light source.
11. Microwave.

2.2 PCR 1. Taq-polymerase.

Amplification 2. Buffer with Mg+2.
3. Primers (reconstituted in water to concentration 100 mM and
stored at -20 °C).
4. MgCL2 (25 mM).
5. Water.
6. dNTPs (10 mM).
7. Thermal cycler.

2.3 Droplet 1. Droplet generator oil.

Generator 2. Droplet generator cartridge.
3. Chloroform 100%.

2.4 Emulsion PCR 1. 20 × Taq-polymerase.

2. Primers.
3. MgCL2.
4. Water.
5. dNTPs.

2.5 Polyacrylamide The purpose of materials used in the gel-DGGE is presented on

Gel-DGGE Table 1 and the list of materials needed is presented below.
1. 8% polyacrylamide gel (acrylamide/bisacrylamide, 37.5:1)
2. Denaturants: 40% formamide and 7 M urea (see Notes 1
and 2).
3. Ammonium persulfate: 10% solution in water.
34 Maria-Eleni Dimitrakopoulou et al.

Table 1
Purpose of specific reagents required for DGGE protocol

Reagent Purpose
Polyacrylamide gel Matrix used to separate DNA fragments based on their melting behavior
Gel apparatus Equipment used to cast and run the polyacrylamide gel
Electrophoresis buffer Buffer used to run the gel and maintain a stable pH during electrophoresis
Loading buffer Solution used to visualize the DNA fragments during electrophoresis
Template DNA The sample of DNA to be separated by DGGE
Denaturants Substances used to create a denaturant gradient within the gel matrix to
separate DNA fragments based on melting behavior
Power supply Used to provide the electrical current for electrophoresis
UV transilluminator Used to visualize the DNA fragments after the electrophoresis is complete

4. TEMED.
5. Staining (GelStar nucleic acid).
6. 50×TAE buffer.

3 Methods

3.1 DNA Extraction An optimized protocol for DNA extraction should be employed on
the specific sample under examination. The selection of a commer-
cial kit for DNA extraction should be accompanied by strict adher-
ence to the manufacturer’s protocols. For example, commercial kits
such as DNeasy PowerFood Microbial Kit and DNeasy mericon
Food Kit are suitable for DNA extraction from food samples. Post-
extraction, it is crucial to ensure the integrity of the DNA sample by
assessing its degradation, which can be determined through elec-
trophoresis on a 0.8% (w/v) agarose gel, with a threshold of 60 °C
for thermal degradation. Additionally, the purity and concentration
of the extracted DNA should be verified using a nanodrop spectro-
photometer (see Note 3).

3.2 Emulsion PCR 1. Introduce into the droplet generator plate a combination of
Amplification DNA template, master mix, and droplet generator oil (see
Notes 4, 12 and 18).
2. Prepare the PCR mixture in 50 μL final volume containing
100 ng of template DNA, 0.2 μM primers, 200 μM deoxyribo-
nucleotide triphosphate (dNTP), and 2.5 μL of 10× reaction
buffer A with Mg+2. In parallel, add an increased concentration
of Taq-polymerase (20×) in accordance with literature
 Emulsion PCR-DGGE 35

suggesting that excess polymerase enzyme can enhance ampli-

fication efficiency (see Note 16).
3. Run the amplification program: initial denaturation at 95 °C
for 3 min and 10 touchdown cycles for 1 min at 65 °C (with the
temperature decreasing 1 °C per cycle), followed by 20 cycles
of denaturing 95 °C for 1 min, annealing at 55 °C for 1 min,
extension at 72 °C for 10 min (see Notes 5, 13, 14 and 15).
4. Discard excess oil.
5. Add 20 μL of elution buffer and 70 μL of chloroform to the
PCR products, and vortex the mixture for 1 min.
6. Centrifuge at 14,000g for 10 min to separate the water-oil
emulsion (see Notes 6 and 17).
7. Collect 2 μL of the upper aqueous phase of PCR products,
which contain the DNA.
8. Prepare same mixture to amplify again under the same condi-
tions the PCR products.
9. Analyze aliquots of PCR products by conventional electropho-
resis in 2% (w/v) agarose gel with TAE 1× buffer stained with
GelRed 0.5 μg/mL in TAE 1× and quantified by using a
standard DNA mass ladder 100 bp (see Note 24).

3.3 Emulsion PCR- 1. Set up the purring apparatus, making sure that the valve con-
DGGE necting the two wells of the gradient maker is closed.
3.3.1 Preparation of 2. Thoroughly mix the acrylamide solutions (20% with either
Polyacrylamide Gel for 40% or 60% or 80%), formamide and urea with the APS and
DGGE Analysis TEMED (see Notes 1, 2, 7, 19, 21 and 25).
3. As quickly as possible, pour the higher concentration solution
into the front chamber (the one closest to the outlet valve), and
pour the lower concentration solution into the back chamber.
4. Open the valve between the wells on the gradient chamber
(bring to horizontal position), and begin the mixing and the
pouring of the gel.
5. To promote even mixing, reduce the speed of the stir bar as the
gel pours (one should just barely be able to see the mixing in
the front chamber). If the stirring speed is too great, the higher
concentration denaturant will flow back into the other
chamber.
6. Allow the gel to sit for at least 2 h.
7. Prepare the stacking gel to load above the already prepared
acrylamide gel.
8. Pour stacking gel as quickly as possible.
36 Maria-Eleni Dimitrakopoulou et al.

3.3.2 Assembling the D- 1. Clean off a set of glass plates (dish soap only).
Code (Gel Running) System 2. Lock plates into place with supports, ensuring they are flush.
3. Carefully remove the comb from the gel, along with any excess
gel from around the wells.
4. With the tall glass facing out and short glass facing in, snap
both assemblages into the holder.
5. Fill D-Code system with approximately 7 L of 1×TAE (140 mL
50×TAE and 6860 mL Milli-Q water) until fill line is reached.
6. Place the holder down into the buffer, ensuring that it is
properly in place.
7. Place the top of the D-Code system on top of the apparatus.
Verify that all electrical connections are created.
8. Plug in electrical cord and turn power switch on.
9. Set temperature to 60 °C and turn on the heater and pump.
Make sure that the buffer level rises and remains above the
negative electrode wire (see Note 11).

3.3.3 Loading the Gel 1. Turn off power and remove top of D-Code system.
2. Prepare samples by combining equal amounts of template
(at least 300 ng) with 5× loading buffer in 500 μL PCR tubes
(see Note 8 and 20).
3. Using corresponding gel loading tips, load samples by placing
the pipettor tip half-way into the well and expunging sample
with extreme care (see Note 22).
4. Load the standard into every fourth lane.
5. Replace top to the D-Code system, ensuring all electrical con-
nections are made.
6. Plug in D-Code and plug it into both the electrical outlet.
7. Turn on D-Code system and set temperature to 60 °C.
8. Set PowerPack300 (with DCODE chip) to appropriate vault
(see Note 9).
9. Turn on the pump only after samples are pulled into the gel
(approximately 15 min see Note 23).
10. Let gel run (see Note 10).

3.3.4 Staining and 1. Drain the excess buffer from the top of the gel and dismantle
Imaging the Gel the apparatus.
2. With the upmost of caution, remove the supports and spacers.
3. With extreme care, use one of the spacers as a lever to pry off
the short glass plate, leaving the gel on the tall glass plate.
4. Soak the tall plate (with gel) in staining (see Note 26), and place
on rocker (slow mode) for 30 min.
 Emulsion PCR-DGGE 37

5. Distain in Milli-Q water for 15–20 min.

6. Thoroughly wet the imager’s glass plate with water.
7. Tilt the glass plate onto the wet surface of the imager, allowing
the gel to slowly slide off (continually wetting the edges of the
gel is helpful).

4 Notes

1. Formamide must be kept wrapped in foil throughout its use

due to it sensitivity to light.
2. Resolve urea in preheated dH20 at 60 °C.
3. Choose high-quality template DNA: To obtain optimal results,
start with high-quality, pure DNA as the template. Resulted
purity of DNA (A260/280) should be 1.8.
4. Use an appropriate emulsion: Select an emulsion that is com-
patible with the reagents being used and has been shown to
produce reliable results.
5. Optimize reaction conditions: Optimal reaction conditions,
such as temperature and pH, will vary depending on the type
of polymerase and other reagents used.
6. Break emulsion carefully: Carefully break the emulsion to avoid
any damage to the amplified DNA fragments.
7. We usually use gels with 30%–60% denaturing gradients.
8. Load an appropriate amount of the purified amplicon onto the
DGGE apparatus to ensure that the DNA fragments are sepa-
rated and visualized effectively.
9. Regarding appropriate ratio time: voltage concerns, time has
been proven of providing a noteworthy impact on the final
band pattern.
10. Improve DGGE resolution: To improve the resolution of
DGGE, consider using alternative electrophoresis systems,
such as capillary electrophoresis, or using a different gradient
format.
11. Monitor the denaturant gradient: The denaturant gradient
should be monitored to ensure that it remains stable during
the run.
12. Control the size of the droplets: The size of the droplets should
be controlled to minimize the number of non-specific
amplifications.
13. Monitor the reaction temperature: The reaction temperature
should be monitored to ensure that it stays within the optimal
range for the polymerase being used.
38 Maria-Eleni Dimitrakopoulou et al.

14. Minimize contamination: To minimize contamination, it is

recommended to use dedicated PCR setups and reagents, and
to practice good laboratory techniques.
15. As an example, if the V3 variable region of bacterial 16S rDNA
is targeted, the primers GC338f (5′ CGCCCGCCGCGCGC
GGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACG
GGAGGCAGCAG-3′, Sigma, France) and 518r (5′-ATT
ACCGCGGCTGCTGG-3′) may be used [7].
16. A 40-bpGC-clamp is usually added to the forward primer. This
is to ensure that the fragment of DNA will remain partially
double-stranded, and that the region screened is in the lowest
melting domain.
17. Purify amplicon: It is recommended to purify the amplicon
after the reaction to remove any impurities that may interfere
with downstream applications.
18. Optimize the volume of emulsion: The volume of emulsion
should be optimized to minimize the number of empty dro-
plets and maximize the yield of amplicon.
19. Adjust the DGGE conditions: Adjust the denaturant gradient,
running temperature, and buffer composition to suit the
amplified fragment length and GC content.
20. Optimize the concentration of bromophenol blue: A higher
concentration of bromophenol blue can be used to help resolve
smaller amplicon fragments.
21. Choose appropriate denaturant: Select an appropriate denatur-
ant for the DGGE matrix to ensure that the amplified DNA
fragments are separated based on their melting behavior.
22. Before you load PCR products in wells, make sure you wash the
wells with 1xTAE buffer.
23. Make sure you perform a pre-run electrophoresis for 15 min-
utes before you load PCR products.
24. Store amplicons correctly: Store the amplified fragments in a
suitable buffer or ethanol to prevent degradation and maintain
the quality of the amplicon.
25. APS solution should be freshly prepared.
26. We usually stain the gel with GelStar nucleic acid for 30 min.
 Emulsion PCR-DGGE 39

References
1. Shao K, Ding W, Wang F, Li H, Ma D, Wang H emulsion-PCR for the determination of food
(2011) Emulsion PCR: a high efficient way of geographical origin: a case study on Greek
PCR amplification of random DNA libraries in PDO “avgotaracho Mesolonghiou”. Curr Res
aptamer selection. PLoS One 6(9):1–7 Food Sci [Internet] 4:746–751. https://doi.
2. Verma V, Gupta A, Chaudhary VK (2020) org/10.1016/j.crfs.2021.10.005
Emulsion PCR made easy. BioTechniques 6. Iacumin L, Cecchini F, Vendrame M, Comi G
69(1):65–69 (2020) Emulsion pcr (ePCR) as a tool to
3. Ercolini D (2004) PCR-DGGE fingerprinting: improve the power of dgge analysis for microbial
novel strategies for detection of microbes in population studies. Microorganisms 8(8):1–11
food. J Microbiol Methods 56(3):297–314 7. Ampe F, Ben Omar N, Moizan C, Wacher C,
4. El Sheikha AF (2019) Molecular detection of Guyot JP (1999) Polyphasic study of the spatial
mycotoxigenic fungi in foods: the case for distribution of microorganisms in Mexican
using PCR-DGGE. Food Biotechnol [Internet] pozol, a fermented maize dough, demonstrates
33(1):54–108. https://doi.org/10.1080/ the need for cultivation-independent methods
08905436.2018.1547644 to investigate traditional fermentations. Appl
5. Dimitrakopoulou ME, Panteleli E, Vantarakis A Environ Microbiol 65(12):5464–5473
(2021) Improved PCR-DGGE analysis by
 Chapter 4

Real-Time PCR High-Resolution Melting Assays

for the Detection of Foodborne Pathogens
Prashant Singh and Frank J. Velez

Abstract
Real-time PCR high-resolution melting assays are a method for the identification of single nucleotide
polymorphisms (SNPs). The assay is performed by amplifying a short DNA fragment using a specific primer
pair flanking a target SNP in the presence of a high-resolution melting dye. The HRM analysis of amplicons
groups the samples based on the differences in the melting temperature and the shape of the melt curves,
facilitating a convenient genotyping of samples. This chapter describes the steps and considerations of real-
time PCR HRM assay standardization.

Key words Genotyping, Melting, Pre-melt, Post-melt, Protocol, Saturating dye, SNP

1 Introduction

Real-time polymerase chain reaction assays are a workhorse for the

detection of foodborne pathogens. These real-time PCR assays can
be broadly divided into two broad categories, i.e., hydrolysis probe-
based assays and intercalating dye-based assays. The intercalating
dye-based assays rely on double-strand DNA binding dyes, which
emit a fluorescent signal when they bind to PCR amplicons. These
dsDNA binding dyes can be grouped into two categories, i.e.,
non-saturating dye (e.g., SYBR) and saturating dye or high-
resolution dye (e.g., ResoLight, SYTO9, EvaGreen, LCGreen). A
saturating dye can be used at a higher concentration without inhi-
biting PCR, and assays using these dyes are known as high-
resolution melting (HRM) real-time PCR assays. The use of high-
resolution dye helps to saturate the PCR amplicon and enables
high-fidelity genotyping results. The higher fidelity of HRM dyes
can be attributed to less redistribution of these dyes to
non-denatured regions of the amplicons [1].
The HRM assay was first described by Carl Wittwer’s group for
the differentiation of homozygotes and heterozygotes markers

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_4,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

41
42 Prashant Singh and Frank J. Velez

[2, 3]. The HRM is a post-PCR, closed-tube method for accurately

analyzing the response of a gradual increase in the reaction temper-
ature to the denaturation behavior of the amplicon generated in the
PCR [4]. The HRM assays are a low-cost method for screening and
identifying the mutations such as single nucleotide polymorphisms
(SNPs), tandem-repeat number, and DNA methylation in a target
region. The method has been used for microbial identification
[5–7], clinically important markers [8], and mutations conferring
antibiotic resistance [9, 10]. The advantage of HRM assays is their
simplicity, low cost, use of real-time PCR instruments which are
commonly available in a diagnostic laboratory, higher accuracy of
genotyping known targets, and ease of application for new SNP
discovery.
A real-time PCR HRM assay works by designing a target-
specific PCR primer, which amplifies the target region of the
genome, resulting in the accumulation of an increasing amount of
PCR amplicons with every amplification cycle. These amplicons
bind to the high-resolution melting dye present in the reaction
mixture, increasing the fluorescent signal, which can be observed
as a sigmoidal amplification plot [4, 11]. At the end of all amplifi-
cation cycles, the reaction mixture emits the highest fluorescent
value. After completion of all the amplification cycles, the samples
go through a high-resolution melt step, where samples are first
incubated at 65 °C for 1–2 min to anneal any single-stranded
DNA into a double-stranded complex and facilitate maximum
intercalation of the high-resolution melting dye to all amplicons
generated in the reaction. After that, the amplicons are heated from
65 °C to 95 °C by gradually increasing the temperature (0.02–0.2 °
C). These numbers may vary slightly with real-time PCR make and
model. The fluorescent value of each sample, with each temperature
increment, is recorded. As an amplicon has specific GC content,
each amplicon denatures at a specific temperature causing the
release of the intercalating dye and resulting in a crash in fluorescent
value. This denaturation of the amplicon in response to gradually
increasing temperature is called the “melting curve analysis,” which
is sigmoidal in shape. In melting curve analysis, the amplicon’s
melting temperature (Tm) can be determined by the peak in the
-dF/dT plot.
The HRM analysis can be considered as an advanced form of
melting curve analysis where the regions before the pre-melt (100%
fluorescence) and after the post-melt (0% fluorescence) are
excluded from analysis, and only the melt-phase data is used for
the identification of genotypes (Fig. 1). Further, in an HRM analy-
sis, the instrument software takes into consideration both the
amplicon’s melting temperature and the shape of the curve and
uses it to differentiate between genotypes. Based on our extensive
experience working with multiple master mixes and real-time PCR
 High-Resolution Melting (HRM) Assays 43

Fig. 1 A high-resolution analysis plot showing the pre-melt region with 100% fluorescence, a post-melt region
with 0% fluorescence, and the melt-phase region showing the difference in the melting behavior of the
amplicons

instruments, a Tm difference of 0.2 °C or higher between two

genotypes can be reliably identified by the HRM assays.
In the published literature, two terms, “high-resolution melt-
ing assays” and “melting curve assay,” have been interchangeably
used. However, a major difference between them is the HRM assays
are always performed in singleplex, whereas the melting curve
assays can be performed using multiple primer pairs (two to six
primer pairs) [12, 13]. Moreover, the HRM analysis uses the spe-
cific melting temperature of the amplicon as well as the shape of the
curve for identifying the different gene variants, whereas the melt-
ing curve assays only use melting temperature for analysis.
The HRM assay, once standardized, is a simple, reproducible,
and low-cost method for the identification of target SNP. The
HRM assays have diverse applications ranging from the identifica-
tion of clinical markers to microbial identification. This chapter
focuses on HRM assays and discusses factors that should be consid-
ered for optimizing an HRM assay. The points discussed in this
chapter will enable laboratories to standardize and troubleshoot
HRM assays.

2 Materials

2.1 DNA Purification There are a wide range of published protocols and commercially
available DNA isolation kits. These kits vary in their ability to
remove impurities from DNA and the length of time and effort to
complete the protocol steps [e.g., DNeasy PowerFood Microbial
Kit (QIAGEN, Valencia, CA, USA); PrepMan™ Ultra Sample
Preparation Reagent (Applied Biosystems, Foster City, CA, USA);
Extracta DNA Prep for PCR (Quanta Biosciences, Beverly, MA,
USA); and InstaGene™ Matrix (Bio-Rad Laboratories, Hercules,
CA)] (see Note 1).
44 Prashant Singh and Frank J. Velez

2.2 PCR 1. Primer stocks are reconstituted in nuclease-free water (NFW)

or l× Tris-EDTA to a concentration of 100 μM and further
diluted to 10 μM for mother and working stock, respectively.
2. Commercial master mix (see Notes 2–4).
3. Purified genomic DNA samples (see Note 1).
4. PCR additives (see Note 5).
5. Real-time PCR instrument (see Note 6).
6. Real-time PCR software (see Note 7).
7. Plasticware (see Note 8).

3 Methods

3.1 Primer Design Primer3 is a freely available web-based tool that can be used for
designing primers for HRM assays [14]. The Primer3 “target”
feature is useful for designing SNP-specific primer pairs. Further,
NCBI’s primer designing tool can be used to check the specificity of
the designed primer pairs. When considering the design of the
HRM primer, it is recommended to target a small-sized amplicon
(60–150 bp) (see Note 9), e.g., O26-32F: 5′-GTG GCA CTG
GTT CTT TTG GT-3′ and O26-118R: 5′-TTT CAT CCC TGC
TAA ATA TTC G-3′ [6].

3.2 Real-Time PCR 1. Set up a protocol on a HRM-capable real-time PCR instrument

(see Notes 10–13).
2. Set up all reagents that are needed for the assay over ice and
away from direct light source (see Note 14).
3. A 10–20 μL PCR reaction will consist of half of the final
volume (5–10 μL) of a 2× master mix, 2 μL of DNA
(20–150 ng), 0.3–1 μL of forward and reverse primers,
1.5–3 mM MgCl2, and nuclease-free water to adjust the final
reaction volume (see Notes 2, 4, 5, and 15).
4. Briefly mix and spin down the reaction mixture for about 5 s.
5. Pipette the reaction mix in all the wells containing DNA sam-
ples or nuclease-free water as a no-template control.
6. Seal the PCR strip or plate.
7. Place the samples into the real-time PCR, and set up the PCR
amplification and HRM analysis protocol (see Note 13).
8. After completion of the real-time PCR run, download the data
file from the instrument, and analyze the data file using recom-
mended HRM analysis software. If needed, save the PCR
product, by storing the samples at -20 °C (see Note 16).
 High-Resolution Melting (HRM) Assays 45

4 Notes

1. A wide range of published protocols and DNA isolation kits are

commercially available. Each kit or method has its advantages
and limitations. Kits like DNeasy PowerFood Microbial Kit
(QIAGEN, Valencia, CA, USA) have been extensively validated
for their ability to isolate high-purity DNA free of PCR inhi-
bitors [6, 7, 15]. In contrast, quick dirty lysis-based methods
such as PrepMan™ Ultra Sample Preparation Reagent
(Applied Biosystems, Foster City, CA, USA), Extracta DNA
Prep for PCR (Quanta Biosciences, Beverly, MA, USA), and
InstaGene™ Matrix (Bio-Rad Laboratories, Hercules, CA) are
preferred by the food testing laboratories due to their quick
turnaround time. HRM assay using a DNA obtained from a
quick dirty lysis method can be used for pure culture bacterial
strains. However, a high-purity DNA isolation kit is necessary
for HRM assays when working with complex samples (i.e.,
enriched food samples). The HRM assays are sensitive to the
presence of impurities (i.e., protein, fat, inhibitors) present in
crude DNA extract and can interfere with the HRM analysis
and genotyping [6].
2. A wide range of DNA concentrations can be used in a real-time
PCR. Some commercially available mixes have a higher toler-
ance for the DNA in a PCR reaction, i.e., MeltDoctor HRM
Master Mix (Applied Biosystems, Foster City, CA, USA), can
tolerate up to 150 nanograms of DNA in a 10 μL reaction
volume [16]. In our studies, we have observed that Light-
Cycler® 480 high-resolution melting master mix (Roche Diag-
nostics, Indianapolis, IN, USA) and Apex SYBR Green master
mix (Genesee Scientific, California, USA) can also tolerate up
to 100 ng of DNA. Increasing DNA concentration in a PCR
above the tolerance of the mix can result in a reaction failure
[16]. As the HRM assays are performed without any internal
amplification control, the use of DNA concentration outside
the recommended range can result in false-negative results. For
an HRM assay, it is important to keep the DNA concentration
of all samples and controls at the same level, as samples with
higher DNA concentration can generate higher fluorescence
compared to samples with lower DNA concentration, interfer-
ing with the grouping of samples during HRM analysis. In all
our studies, we have used 20 ng of DNA in a 10 μL reaction
volume.
3. A high-resolution master mix is the most important compo-
nent for standardizing an HRM assay. Historically a PCR mix
was prepared by adding individual PCR components, e.g., Taq
DNA polymerase, reaction buffer, magnesium chloride
46 Prashant Singh and Frank J. Velez

solution, and deoxynucleotide triphosphates (dNTPs). At pres-

ent multiple commercially available HRM master mixes are
available, which typically consists of all essential reaction com-
ponents including a high-resolution melting dye, and it may
sometime include proprietary PCR additives. All these reagents
at specific concentrations make a product unique and define its
HRM capabilities. The use of a commercially available master
mix is highly recommended for a HRM assay as it improves the
assay reproducibility.
4. The MgCl2 is a critical and essential component of any PCR.
The MgCl2 is needed for the DNA polymerase activity and is
optimized for each master mix based on the enzyme concen-
tration and buffer composition. Its concentration in a PCR
varies from 1.5 to 3.5 mM. In addition to Taq polymerase
activity, the MgCl2 concentration plays a crucial role in the
resolution of genotypes during high-resolution melt analysis.
MgCl2 concentration is often optimized and pre-added in the
master mix for some commercially available products, i.e.,
MeltDoctor HRM Master Mix. However, some products are
sold without MgCl2 and include a separate vial of MgCl2, i.e.,
LightCycler® 480 high-resolution melting master mix. In this
case, MgCl2 concentration can be individually optimized for
each HRM assay. In our experience, 1.5–2.5 mM MgCl2 con-
centration usually works [6]. However, some assays require
higher concentrations (i.e., 3 mM) for differentiating the two
genotypes [7, 17] (Fig. 2). Optimization of MgCl2 concentra-
tion must be considered for HRM assay for differentiating
genotypes, which differ by a small Tm change (i.e., A to T
change).
5. The commercial HRM master mixes commonly advertise the
products’ ability to identify all major types of SNPs, i.e., class
one to four SNPs. However, the performance of master mixes
varies depending on the type of SNP and composition of the
target region being amplified in the PCR. In our experience
development of an assay for the identification of SNP located in
a AT-rich region is challenging [7], and some commercially
available HRM master mixes may fail to resolve the target
SNP. Supplementation of 1.25 μM EvaGreen (Biotium, Cali-
fornia, USA) to SYBR Green master mix can facilitate the
identification of the target genotypes and outperformed com-
mercially available mixes. We believe the addition of an Eva-
Green dye to the PCR enabled saturation of the amplicon and
enhanced the HRM genotyping capability of the assay. Data
from the study further shows that the SYBR Green and Eva-
Green dyes are compatible with each other in a real-time PCR.
6. The HRM assays are commonly performed on HRM-capable
real-time PCR instruments. Currently, there are multiple
 High-Resolution Melting (HRM) Assays 47

Fig. 2 Effect of (a) 2 mM, (b) 3 mM, and (c) 3.5 mM MgCl2 concentrations on HRM genotyping assay. Addition
of optimum concentration of MgCl2 to HRM assay facilitate resolution of genotypes

HRM-capable real-time PCR instruments available (i.e., Roche

Diagnostics, Qiagen, Applied Biosystems). The most critical
feature of an HRM-capable instrument is its ability to precisely
increase the sample temperature by very small increments (i.e.,
0.02–0.1 °C), sensitive optical detectors, fast data acquisition
rate, and minimum sample-to-sample temperature and optical
variations. The smaller temperature increments a
HRM-capable instrument can achieve enable the instrument
to perform superior genotyping.
7. The instrument commonly comes with HRM analysis software.
Additionally, the instrument is calibrated for a HRM dye (i.e.,
LightCycler 96). However, in some cases, it may require pur-
chasing a separate HRM analysis software (e.g., High-
Resolution Melt Software, ThermoFisher Scientific, Waltham,
MA, USA), and the instrument may need to be regularly
calibrated for the recommended HRM dye (i.e., StepOnePlus).
48 Prashant Singh and Frank J. Velez

The HRM analysis software allows to define the pre-melt and

post-melt regions of the HRM analysis. Further, it enables the
user to define the analysis parameter, i.e., SNP differentiation
based on Tm only, the shape of the curve only, or a combination
of Tm and shape both.
8. Each instrument works only with its compatible plasticware
recommended by the manufacturers. Real-time PCR assays
can be performed using either clear or white plasticware (i.e.,
plates and eight-tube strips). However, some instrument allows
the use of both clear and white plasticware. In our experience
working with LightCycler 96, white plasticware generated data
with higher fluorescence values and superior results compared
to clear eight-tube strips. This may be due to the complete
blocking of any nonspecific fluorescence signal generated from
spilled PCR amplicons present on the real-time PCR block.
9. Primers play a crucial role in an HRM assay design. A small-
sized amplicon (60–150 bp) is preferred for an HRM assay
[5, 18]. However, in some cases, amplicons close to
150–200 bp can be considered [7]. The reason smaller ampli-
con size is critical for HRM assays is smaller the amplicon, the
more prominent and predictable the ΔTm change associated
with a SNP. Additionally, the amplicon length defines the GC
content and the intercalating dye binding properties, which
eventually affects the HRM assay’s ability to differentiate
between the different genotypes [11, 13]. The HRM assay
works by detecting small differences between the melt profiles
of the samples. As the amplicon size increases, the ability of the
HRM assay to measure small differences decreases, which
affects the assay’s ability to differentiate between genotypes.
Based on our experience, the best strategy for standardizing an
HRM assay is to design five to ten primer pairs (60–150 bp
amplicon) for the amplification of the target SNP. However, in
some cases, an AT-rich region might not allow designing
primer pairs for amplifying short amplicon (60–150 bp). In
such cases, amplicons greater than 150 bp and forced primer
design strategies can be considered. All designed primer pairs
can be tested for their ability to differentiate between geno-
types. Primer pairs showing good amplification and the poten-
tial to differentiate genotypes can be further optimized for
assay standardization.
10. A real-time PCR program often is defined by the master mix
and the instrument make and model. Fast real-time PCR
instruments, compared to standard instruments, require
shorter denaturation and amplification steps. Universal master
mixes are currently available, which can amplify most targets
using the same amplification protocol, minimizing the need for
standardization. However, optimization of PCR protocols is
 High-Resolution Melting (HRM) Assays 49

needed in case of challenging targets such as AT-rich regions.

To amplify a target located in the AT-rich region, a lower
annealing temperature (55–58 °C) with a lower and longer
extension should be considered (60 °C–120 s).
11. Once target-specific HRM primer pairs are designed and a
high-purity DNA is available, the process of PCR HRM assay
standardization can be started.
12. Depending on the target and/or the master mix used, there are
many PCR amplification protocols that can be used for the
amplification of a target.
13. The standard amplification protocol entailed an initial denatur-
ation step at 95 °C from 180 to 900 s. This step is specific for
each master mix and is needed for the activation of the DNA
polymerase. This initial denaturation is followed by 40–-
45 cycles of a two- or three-step PCR amplification protocol
of denaturation at 95 °C for 3–15 s, with annealing at 55–65 °
C for 30–60 s and with or without an extension at 72 °C for
5–25 s. Finally, at the end of all amplification cycles, HRM is
performed with a gradual temperature increase of 0.04 °C/s
from 65 °C to 97 °C.
14. Master mixes use light-sensitive HRM dyes. Hence all work
should be performed on ice and avoid an extended periods of
light exposure. However, many companies claim that their
product can be stable at room temperature for hours.
15. A typical real-time PCR HRM reaction can be between 10 and
20 μL. Despite different reaction volume recommendations on
each commercially available HRM master mix, our laboratory
has consistently used a 10 μL reaction volume for all the HRM
assays. A typical HRM reaction mixture consists of primers,
DNA samples, magnesium chloride, a master mix, and
nuclease-free water. The volume and concentration of all
these reaction components can be optimized for an HRM
assay. In our opinion, a commercially available master mix
tends to generate more consistent results compared to a lab
mix, as a lab mix is prone to batch-to-batch variations and
pipetting errors, which can affect the genotyping results.
DNA polymerase is the enzyme that amplifies the target region
and plays a crucial role in defining the Cq-values. Extensive
research has been performed in identifying and developing
novel DNA polymerases with unique properties, e.g., amplifi-
cation of AT-rich regions, tolerance to PCR inhibitors, and
hot-start capabilities. These properties, which are unique to
each DNA polymerase, define the PCR program, the time
needed for assay completion, and Cq-values. Based on our
experience, the high-resolution master mixes are often opti-
mized for genotyping and may generate amplification with
50 Prashant Singh and Frank J. Velez

Fig. 3 (a) A non-sigmodal amplification plots obtained using 2× LightCycler® 480 high-resolution melting
master mix. Sample showed a non-sigmoidal amplification curve and high Cq values. (b) Sigmodal amplifica-
tion plots obtained using Apex green master mix for the same sample set

poor Cq-value [7, 17]. Our group has extensively worked with
LightCycler® 480 high-resolution melting master mix (Roche
Diagnostics, Indianapolis, IN, USA) for the development of
HRM-based SNP detection assays [6, 7, 17, 18]. Data from
our studies demonstrate the LightCycler® 480 high-resolution
melting master mix’s ability to differentiate target SNP; how-
ever, for two of our studies, the master mix generated data with
poor Cq-value, making presence/absence calls difficult
(Fig. 3). In such cases the presence/absence calls based on
presence of target genotype in the HRM analysis can be con-
sidered. As initially mentioned, each polymerase is unique; each
mix has its optimum activation temperature and extension
temperatures. Therefore, it is crucial to follow the manufac-
turer’s recommendation for these two steps.
16. The HRM data for the target is analyzed by determining the
pre-melt and post-melt regions. The amplicons of the same
genetic makeup group together in the analysis.
17. HRM assay is a method for the identification of a target SNP
located in a small amplicon, and one limitation of HRM assays
is its inability to identify all the SNP which can be present in the
 High-Resolution Melting (HRM) Assays 51

amplicon. As the number of SNPs present in the amplicon

increases, the HRM assay’s ability to accurately differentiate
SNPs may reduce. The method is only suitable for the identifi-
cation or discovery of SNPs, which cause a GC content change
in the amplicon. Additionally, the HRM assay starts losing its
genotyping ability when the amplicon size is greater than
200 bp.

References
1. Wittwer CT, Reed GH, Gundry CN et al 9. Keikha M, Karbalaei M (2021) High resolution
(2003) High-resolution genotyping by ampli- melting assay as a reliable method for diagnos-
con melting analysis using LCGreen. Clin ing drug-resistant TB cases: a systematic review
Chem 49:853–860. https://doi.org/10. and meta-analysis. BMC Infect Dis 21:989.
1373/49.6.853 https://doi.org/10.1186/s12879-021-
2. Erali M, Voelkerding KV, Wittwer CT (2008) 06708-1
High resolution melting applications for clini- 10. Rezaei F, Haeili M, Fooladi AI, Feizabadi MM
cal laboratory medicine. Exp Mol Pathol 85: (2017) High resolution melting curve analysis
50–58. https://doi.org/10.1016/j.yexmp. for rapid detection of streptomycin and etham-
2008.03.012 butol resistance in Mycobacterium tuberculosis.
3. Gundry CN, Vandersteen JG, Reed GH et al Maedica (Bucur) 12:246–257
(2003) Amplicon melting analysis with labeled 11. Monis PT, Giglio S, Saint CP (2005) Compar-
primers: a closed-tube method for differentiat- ison of SYTO9 and SYBR Green I for real-time
ing homozygotes and heterozygotes. Clin polymerase chain reaction and investigation of
Chem 49:396–406. https://doi.org/10. the effect of dye concentration on amplification
1373/49.3.396 and DNA melting curve analysis. Anal Bio-
4. Tong SYC, Giffard PM (2012) Microbiological chem 340:24–34. https://doi.org/10.1016/
applications of high-resolution melting analy- j.ab.2005.01.046
sis. J Clin Microbiol 50:3418–3421. https:// 12. Singh P, Pfeifer Y, Mustapha A (2016) Multi-
doi.org/10.1128/JCM.01709-12 plex real-time PCR assay for the detection of
5. Liu Y, Singh P, Mustapha A (2018) High- extended-spectrum β-lactamase and carbape-
resolution melt curve PCR assay for specific nemase genes using melting curve analysis. J
detection of E. coli O157:H7 in beef. Food Microbiol Methods 124:72–78. https://doi.
Control 86:275–282. https://doi.org/10. org/10.1016/j.mimet.2016.03.014
1016/j.foodcont.2017.11.025 13. Singh P, Mustapha A (2014) Development of a
6. Singh P, Cubillos G, Kirshteyn G, Bosilevac JM real-time PCR melt curve assay for simulta-
(2020) High-resolution melting real-time neous detection of virulent and antibiotic resis-
PCR assays for detection of Escherichia coli tant Salmonella. Food Microbiol 44:6–14.
O26 and O111 strains possessing Shiga toxin https://doi.org/10.1016/j.fm.2014.04.014
genes. LWT 131:109785. https://doi.org/10. 14. Untergasser A, Cutcutache I, Koressaar T et al
1016/j.lwt.2020.109785 (2012) Primer3—new capabilities and inter-
7. Velez FJ, Bosilevac JM, Delannoy S, et al. faces. Nucleic Acids Res 40:e115–e115
(2022) Development and validation of high- 15. Jana M, Adriana V, Eva K (2020) Evaluation of
resolution melting assays for the detection of DNA extraction methods for culture-
potentially virulent strains of Escherichia coli independent real-time PCR-based detection
O103 and O121. Food Control 109095. of Listeria monocytogenes in cheese. Food Anal
https://doi.org/10.1016/j.foodcont.2022. Methods 13:667–677. https://doi.org/10.
109095 1007/s12161-019-01686-2
8. Riahi A, Kharrat M, Lariani I, Chaabouni- 16. Singh P, Liu Y, Bosilevac JM, Mustapha A
Bouhamed H (2014) High-resolution melting (2019) Detection of Shiga toxin-producing
(HRM) assay for the detection of recurrent Escherichia coli, stx1, stx2 and Salmonella by
BRCA1/BRCA2 germline mutations in Tuni- two high resolution melt curve multiplex real-
sian breast/ovarian cancer families. Familial time PCR. Food Control 96:251–259.
Cancer 13:603–609. https://doi.org/10. https://doi.org/10.1016/j.foodcont.2018.
1007/s10689-014-9740-5 09.024
52 Prashant Singh and Frank J. Velez

17. Sharma L, Watts E, Singh P (2020) High reso- 18. Velez FJ, Bosilevac JM, Singh P (2021) Valida-
lution real-time PCR melting curve assay for tion of high-resolution melting assays for the
identification of top five Penaeidae shrimp spe- detection of virulent strains of Escherichia coli
cies. LWT 133:109983. https://doi.org/10. O26 and O111 in beef and pork enrichment
1016/j.lwt.2020.109983 broths. Food Control 128:108123. https://
doi.org/10.1016/j.foodcont.2021.108123
 Chapter 5

High-Throughput Real-Time qPCR and High-Resolution

Melting (HRM) Assay for Fungal Detection in Plant Matrices
Filipe Azevedo-Nogueira, Sara Barrias, and Paula Martins-Lopes

Abstract
Crop producers are under great pressure to produce more and better food items. Effective control of crop
pathogens is fundamental to guaranteeing food safety and reducing economic losses. Therefore, their
identification throughout the production chain is of utmost interest. To achieve this goal, genomic analysis
tools are currently being developed allowing to control crop production more effectively.
Genomic analysis in some samples is difficult, mostly due to the sample’s intrinsic characteristics, i.e., high
levels of phenols, fatty acids (e.g., oleaginous fruits, such as olives), and carbon hydrates (e.g., honey),
among others. Additionally, some samples yield very low DNA recovery with high content of contaminants,
imposing protocol improvements to overcome these difficulties.
Here we present protocols focused on qPCR and HRM to detect the presence of fungal pathogens
collected from plant-derived samples.

Key words qPCR, HRM, Fungi, Food safety, Fluorescence

1 Introduction

Economic and health interests lead to a constant need of accessing

the presence of food contaminants. The identification of undesired
microorganisms throughout the production chain indicates the
contamination of edible products, thus reducing their economic
value and quality [1]. Molecular methodologies have been imple-
mented to control the whole production chain, aiming to contain
the contamination. Nevertheless, faster and easier molecular meth-
ods are mandatory, leading to action time reduction and increased
efficacy control [2].
Polymerase chain reaction (PCR) has been a crucial tool to
achieve such objectives. With a continuous increase of sensitivity
and sensibility in PCR methodologies, new tools with faster

Filipe Nogueira-Azevedo and Sara Barrias contributed equally with all other contributors.

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_5,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

53
54 Filipe Azevedo-Nogueira et al.

response time and increased sensitivity have been raised, such as

quantitative PCR (qPCR) and high-resolution melting (HRM)
technologies [3, 4]. These are based on PCR methodology with a
resource to fluorescent dyes; hence results are easier and faster to
obtain [5].
Herein, we describe qPCR and HRM methods for assessing
fungal pathogens’ presence in complex matrices samples with low
DNA recovery.

2 Materials

These protocols are described using StepOne™ Real-Time PCR

System of Applied Biosystems™, although they may be adapted to
other systems if the analyzing software is available and the equip-
ment presents similar characteristics. PCR should be performed
according to manufacturer indications. Nevertheless, we found
that “Xpert Fast SYBR MasterMix” from Grisp© worked well for
quantitative PCR in our samples which are rich in PCR inhibitors.
The following equipment, reagents, consumables, and software
are required:
1. StepOne™ Real-Time PCR System with installed StepOne™
Software v2.3 and Applied Biosystems™ High Resolution Melt
(HRM) Software v2.0 or equivalent.
2. Optical 48-well reaction plates.
3. 48-well optical adhesive film.
4. Xpert Fast SYBR MasterMix or equivalent.
5. MeltDoctor™ HRM Master Mix or equivalent.

3 Methods

3.1 qPCR These assays must account for DNA concentration (see Notes 1–4),
primer concentration (see Notes 5–7), annealing temperature, and
3.1.1 Experimental
temperature cycle (see Note 8). Our experience shows us that good
Design of qPCR
results are in the range of 20 cycles (Ct, cycle threshold) or lower
and using 50 ng of DNA and 2 μM of primers per reaction (see
Note 8). Also, the product must be checked on gel electrophoresis
to confirm the absence of nonspecific bands and/or primer dimers.
If nonspecific bands and/or primer dimers are observable, further
optimizations are required.
To assess the specificity of the reaction, positive controls should
always be used, and the comparison of the melting peaks can rule
out unspecific amplicons.
 qPCR and HRM Assay for Fungal Detection 55

3.1.2 Standard Curve The target amplicon obtained by amplification with the designed
Design primers for qPCR is cloned into a plasmid-transformed vector, and
positive colonies are selected by blue-white screening and con-
firmed by Sanger sequencing.
The standard curve method is used to compare qPCR results to
the curve, to determine copy number or concentration of the
targeted amplicon (see Note 9). The qPCR is followed by a melting
curve stage, to ensure assay specificity.
Serial dilutions of the target amplicon, with a known copy
number, are obtained, starting with the determination of the
more concentrated curve point that is based on the following
parameters:
(a) The weight of the plasmid with insert.
(b) The number of copies of the target sequence in each curve
point.
(c) The quantity of DNA used in the qPCR standard curve
reaction.
1. Calculate the mass of the plasmid with the insert (mtp). Thus,
the number of base pairs of the transformed plasmid (plasmid
length (np) and insert sequence length (nt)) must be known
and multiplied by the mean dsDNA base pair weight
(1.096 × 10-21 g) as shown in formula 1:

mtp = np þ nt × 1:09 × 10 - 21 ð1Þ

2. Calculate the weight of the insert present in one of the curve
points (mrx), e.g., 3 × 109 number of insert (nrx) represented in
one reaction, as shown in formula 2:

m rx = mtp × nrx ð2Þ

3. This step allows us to calculate the DNA concentration
([DNA]) for each reaction of the chosen standard curve
point, by following formula 3, which will be added to the
qPCR curve reaction, using the mass of plasmid (mrx) and the
volume of plasmid DNA solution (Vtemplate) used (Table 1):

½DNA  = mrx =V template ð3Þ

4. Serial dilutions are based on a dilution factor of tenfold and are
obtained accordingly (see Note 10). qPCR are equally per-
formed for every point of the standard curve, in triplicates
(Tables 1 and 2). The results obtained allow to translate of
C(t) qPCR values and other standard curve characteristics
(slope and Yintersection) in copy number (#copies) of the target
sequence in each sample, as shown in formula 4:
C t = Y intersection þ slope × log 10 ð#copiesÞ ð4Þ
56 Filipe Azevedo-Nogueira et al.

Table 1
qPCR mix for the standard curve

Quantity
Component Concentration (μL)a
Xpert Fast MasterMix Provided 10
Primer forward 10 μM 0.2
GCCAACAAATAAACGCCACT [7]
Primer reverse 10 μM 0.2
GACTTATTCGGTGACGTGCC [7]
Ultrapure H2O 7.6
Plasmid DNA Adjusted per standard 2
curve point
a
Per reaction

Table 2
qPCR temperature cycle

Cycle stage Cycle step Temperature Duration

Holding Enzyme activation 95 °C 3 min
Cycling (40×) Denaturation 95 °C 5s
Annealing and extensiona 60 °C 30 s
Melt curve Denaturation 95 °C 15 s
Annealing 60 °C 1 min
Meltinga,b Rising to 95 °C 15 s
Annealing 60 °C 15 s
a
Fluorescence acquisition step
b
Select the Step and Hold ramp mode and select the ramp rate to 0.3%

3.1.3 Quantitative PCR The samples were tested after the standard curve was designed,
Assay following the same temperature regime (Table 2) and reaction
conditions (Table 3) as used to obtain the standard curve.
To perform the qPCR assay, follow the instructions below:
1. Pipette 5 μL (50 ng) of each sample into a pre-established well
in a reaction plate. Perform triplicates of each sample, and add a
negative (non-template) control and positive controls (posing
as references) to the plate.
2. Prepare the qPCR mix according to Table 3.
3. Briefly vortex the mix (see Note 11).
4. Add 15 μL of qPCR mix to each sample.
5. Seal the reaction plate with the optical adhesive film, using the
appropriate accessory included in the MicroAmp™ plate box.
 qPCR and HRM Assay for Fungal Detection 57

Table 3
qPCR mix for sample quantification

Component Concentration Quantity (μL)a

Xpert Fast MasterMix Provided 10
Primer forward 10 μM 0.2
GCCAACAAATAAACGCCACT [7]
Primer reverse 10 μM 0.2
GACTTATTCGGTGACGTGCC [7]
Ultrapure H2O 4.6
Genomic DNA 10 ng/μL 5
a
Per reaction

6. Spin the reaction plate and confirm that the liquid is at the
bottom of the wells.
7. Open the StepOne™ software, and set up the experiment using
the following steps:
1. Experiment Properties
– Name the experiment.
– Experiment Type: Quantitation—standard curve.
– Select Reagents: Other.
– Select Ramp Speed: Standard (~2 h to complete a run).
2. Plate Setup
– Define targets and samples.
– Name the target.
– Select “SYBRGreen” as the reporter.
– Add and name the samples.
– Select “ROX” as the passive reference.
– Assign targets and samples.
– Setup the plate layout following the order of the samples
in the optical plate.
– Assign the chosen target to all samples.
– Select task U (unknown) for every sample to be analyzed
and task N (negative) for the negative (non-template)
control.
3. Run Method
– Set the thermal cycler conditions as followed.
– Reaction Volume Per Well: 20 μL.
– Thermal profile as shown in Table 2.
58 Filipe Azevedo-Nogueira et al.

Fig. 1 Amplification of fungal samples in olive samples and comparison to a standard curve. (a) A standard
curve with an indication of the standard curve points (red) and fungi-infected olive samples (blue). (b) The
melting curve ensures reaction specificity, where olive samples infected by the target fungus have a distinct
melt peak (blue arrow) as compared to negative (black arrow). (Adapted from [7])

8. Save the experiment, load the reaction plate into the instru-
ment, and select “START RUN” on the navigation panel.
9. When the reaction is finished, save the file to a desired location.
10. Review the amplification plot: fluorescence levels must exceed
the threshold between cycles 8 and 35, and an exponential
increase in fluorescence should be observed.
11. Finally, obtain the cycle threshold (C(t)) values.
Reaction specificity was defined by melting peak analysis
(Fig. 1). Triplicates were performed, and medium C(t) was
obtained and substituted in formula 4 to obtain the copy number
of the target sequence in each sample.

3.2 High-Resolution High-resolution melting (HRM) assays allow distinguishing small

Melting sequence variations in closely related target sequences. This is
achieved by a step of melting peak with HRM adequate fluorescent
dye, e.g., MeltDoctor™.
To perform the HRM assay, follow the instructions below:
1. Pipette 5 μL (50 ng) of each sample into a pre-established well
in a reaction plate. Perform triplicates of each sample and add
negative control and positive controls (posing as references) to
the plate.
2. Prepare the HRM mix according to Table 4.
3. Briefly vortex the mix (see Note 11).
4. Add 15 μL of HRM mix to each sample.
 qPCR and HRM Assay for Fungal Detection 59

Table 4
qPCR mix for HRM assay

Components Concentration Quantity (μL)a

MeltDoctor™ HRM Master Mix Provided 10
Primer forward 10 μM 0.2
TCCGTAGGTGAACCTGCGG [8]
Primer reverse 10 μM 0.2
TCCTCCGCTTATTGATATGC [8]
Ultrapure H2O 4.6
Genomic DNA 10 ng/μL 5
a
Per reaction

5. Seal the reaction plate with the optical adhesive film, using the
appropriate accessory included in the MicroAmp™ plate box.
6. Spin the reaction plate and confirm that the liquid is at the
bottom of the wells.
7. Open the StepOne™ software, and set up the experiment using
the following steps:
1. Experiment Properties
– Name the experiment.
– Experiment Type: Quantitation—standard curve.
– Select Reagents: Other.
– Select Ramp Speed: Standard (~2 h to complete a run).
2. Plate Setup
– Define targets and samples.
– Name the target.
– Select “MeltDoctor” as the reporter.
– Add and name the samples.
– Select “None” on the passive reference.
– Assign targets and samples.
– Setup the plate layout following the order of the samples
in the optical plate.
– Assign the chosen target to all samples.
– Select task U for every sample to be analyzed and task N
for the negative control.
3. Run Method
– Set the thermal cycler conditions as indicated in Table 5.
– -Reaction Volume Per Well: 20 μL.
60 Filipe Azevedo-Nogueira et al.

Table 5
HRM temperature cycle

Stage Step Temperature Time

Holding Enzyme activation 95 °C 10 min
Cycling stage Denature 95 °C 30 s
(40 cycles) Anneal 58 °C 30 s
Extenda 72 °C 30 s
Melt curve Denature 95 °C 30 s
Anneal 65 °C 1 min
High-resolution melta,b Rising to 95 °C 15 s
Anneal 65 °C 15 s
a
Fluorescence acquisition step
b
Select the Continuous ramp mode and select the ramp rate to 0.3 °C/s

8. Save the experiment, load the reaction plate into the instru-
ment, and select “START RUN” on the navigation panel.
9. When the reaction is terminated, save the file to the desired
location.
10. Review the amplification plot: fluorescence levels must exceed
the threshold between cycles 8 and 35, and an exponential
increase in fluorescence should be observed.
11. Open the High-Resolution Melt Software v3.0 to perform
high-resolution melting analysis of the data and review the
variants.
12. Adjust the pre-melt and post-melt regions in the Derivative
Melt Curves plot to optimize the variant calls. Select all the
wells, and set the pre-melt and post-melt regions as close as
possible to the melting transition region, including the
melting peak.
13. Click Analyze, and then save the changes.
Good results allow us to discriminate variants by analysis of two
HRM plots (aligned melt curve plot and difference plot) as pre-
sented in Fig. 2.

4 Notes

1. We find that CTAB-based DNA extraction methods work bet-

ter in samples that are rich in fatty acids, polysaccharides, and
secondary metabolites; however, any extraction procedure can
be used. Just keep in mind that CTAB buffer components in
high concentrations may be overcarried during extraction steps
and affect PCR.
 qPCR and HRM Assay for Fungal Detection 61

Fig. 2 Representative HRM plots that distinguish two fungal species with the same set of primers. With the
same conditions of amplification, we observe that fungal species are discriminated by (a) melting tempera-
ture, where one fungal species (red) presents an amplicon with a lower melting temperature than the other
(green) and (b) where both species present distinct curve profiles that group the two variants. Therefore, this
shows that the assay can distinguish fungal samples

2. DNA purity and concentration must be assessed. Pure DNA

absorbance ratios at 260 nm/280 nm and 260 nm/230 nm
should be close to 2. Absorbance ratios that diverge from this
can also be used but can compromise the assay accuracy due to
the presence of contaminants derived from the extraction pro-
cedure or related to sample composition.
3. To avoid PCR inhibitor compounds, we found that diluting
the DNA sample to a lower concentration with ultrapure water
improves PCR, as contaminants present in the sample are also
diluted.
4. DNA integrity should be assessed by an electrophoretic run on
1% agarose gel.
5. When designing primers, assure that they meet these
guidelines:
– Primer length ~20 bases
– Tm 58 °C to 60 °C (optimal Tm is 59 °C), as normally the
PCR temperature regime is facilitated by using two steps in
the amplification step, combining annealing and extension
in one unique step
– 30–80% GC content in each primer
6. Primers for qPCR and HRM should amplify a DNA fragment
up to 200 bp long, to avoid multiple melting points. Amplicons
with greater size can be used [6]; however, results can be harder
62 Filipe Azevedo-Nogueira et al.

to interpret. Additionally, hairpins and primer dimers should be

avoided since they interfere with the melting curve analysis.
7. Primer dilution should be made using ultrapure water and, if
possible, in a laminar flow chamber to avoid contaminations
that can interfere due to the assay sensitivity.
8. PCR should be optimized to obtain the best results; however,
during standard curve and quantification procedures, the con-
ditions should be maintained. Primer concentration and DNA
concentration can differ accordingly to each assay; however,
these conditions should be maintained when comparing
experiences as they influence PCR efficiency.
9. Standard curve should be adapted to each situation, taking into
consideration the copy number predicted in each sample type,
so they cover all the possible situations.
10. Standard curve serial dilutions can be prepared with other
dilution factors. To obtain a higher curve definition, the dilu-
tion factor should be lower.
11. Preparation of qPCR and HRM mix with fluorescent dyes
should be set up in the dark and on ice to minimize sample
degradation and nonspecific reactivity.

References
1. Bansal S, Singh A, Mangal M et al (2017) Food to olive oil and wine authenticity. Food Res Int
adulteration: sources, health risks, and detection 103:170–181
methods. Crit Rev Food Sci Nutr 57:1174– 6. Pereira L, Martins-Lopes P (2015) Vitis vinifera
1189 L. single-nucleotide polymorphism detection
2. Umesha S, Manukumar HM (2018) Advanced with high-resolution melting analysis based on
molecular diagnostic techniques for detection of the UDP-glucose:flavonoid 3- O -glucosyltrans-
food-borne pathogens: current applications and ferase gene. J Agric Food Chem 63:9165–9174
future challenges. Crit Rev Food Sci Nutr 58: 7. Azevedo-Nogueira F, Gomes S, Lino A et al
84–104 (2021) Real-time PCR assay for Colletotrichum
3. Martins-Lopes P, Gomes S, Pereira L et al acutatum sensu stricto quantification in olive
(2013) Molecular markers for food traceability. fruit samples. Food Chem 339:127858
Food Technol Biotechnol 51:198–207 8. White TJ, Bruns TD, Lee SB et al (1990) Ampli-
4. Druml B, Cichna-Markl M (2014) High resolu- fication and direct sequencing of fungal ribo-
tion melting (HRM) analysis of DNA - its role somal RNA genes for phylogenetics. In: PCR –
and potential in food analysis. Food Chem 158: protocols and applications – a laboratory man-
245–254 ual. Academic Press, pp 315–322
5. Pereira L, Gomes S, Barrias S et al (2018) Apply-
ing high-resolution melting (HRM) technology
 Chapter 6

Multiplex Real-Time PCR for the Detection of Shiga

Toxin-Producing Escherichia coli in Foods
Ana Costa-Ribeiro, Sarah Azinheiro, Foteini Roumani, Marta Prado,
Alexandre Lamas, and Alejandro Garrido-Maestu

Abstract
Shiga toxin-producing Escherichia coli (STEC) is a group of human foodborne pathogens transmitted to
humans through the consumption of different types of food. Their detection is mainly performed by
targeting specific serogroups by classical microbiological methods and, later, by molecular typing with
different techniques. The application of multiplex real-time PCR (qPCR) can significantly improve the
turnaround time of the existing methodologies as in one single run it is possible to detect and characterize
specific microorganisms. In the present chapter, a pentaplex qPCR assay is described for the identification of
STEC which may also be applied for the rapid screening of these pathogens in different types of foods. The
assay targets the most important virulence factors of these microorganisms, the genes stx1, stx2, and eae,
along with the rfbE gene which encodes for the “O157” antigen as this is the most prevalent serogroup
among all STEC, as well as an internal amplification control to rule out false-negative results due to qPCR
inhibition.

Key words qPCR, Multiplex, Shiga toxin-producing E. coli, Internal amplification control

1 Introduction

Nowadays, microbiological food testing mostly relies on culture-

based methods. However, these methods are known to have certain
limitations such as long turnaround times and intensive hands-on
work [1]. On the other hand, molecular methods have been
demonstrated to be a suitable alternative, or at least an excellent
complement. This is particularly true for PCR and real-time PCR
(qPCR) methods which are now already key parts of certain work-
flows. In line with this, certain official organizations have imple-
mented these techniques, such as the ISO standard for the
detection of Shiga toxin-producing Escherichia coli (STEC) [2]
and the corresponding one described by the Food and Drug
Administration [3]. In both cases, a PCR/qPCR screening of the

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_6,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

63
64 Ana Costa-Ribeiro et al.

pathogens is performed in enriched samples, and positives have to

be confirmed by plating on selective media.
One added value of the mentioned techniques relies on their
multiplexing capabilities so that more than one target can be
detected in the same reaction, thus increasing the throughput of
the methods by implementing them. As a result, several pathogens
may be detected simultaneously [4–6], several genes from the same
microorganism [7, 8], or a combination of both [9, 10].
In the present chapter, an assay for the identification of STEC
by multiplex qPCR is presented. The described methodology tar-
gets four bacterial genes, namely, stx1, stx2, eae, and rfbE, along
with an internal amplification control (IAC), making it a pentaplex
assay. Additionally, the assay presented is suitable for the rapid
screening of STEC in different foodstuffs.

2 Materials

2.1 Media (See Note 1. Nutrient broth: 10.0 g tryptone, 5.0 g meat extract, 5.0 NaCl,
1) 1000 mL Milli-Q water, pH 7.2 ± 0.2.
2. Tryptic soy agar: 15.0 g tryptone, 5.0 g papainic digest of
soybean meal, 5.0 g NaCl, 15.0 g bacteriological agar,
1000 mL Milli-Q water, pH 7.3 ± 0.2.

2.2 Chemicals 1. Tris-EDTA solution (TE 1×): 10 mM Tris–HCl, 1 mM EDTA.

Final pH = 8.0 ± 0.2. See Note 2.
2. 6% (w/v) Chelex (Bio-Rad Laboratories, Inc., USA), from now
on chelex.
3. Qubit™ 1× dsDNA HS Assay Kit (Invitrogen™, Thermo-
Fisher Scientific, Carlsbad, CA, USA).
4. Primers and probes (see Table 1).
5. NZYSupreme qPCR Probe Master Mix (NZYTech, Lisbon,
Portugal).

2.3 Equipment 1. Real-time PCR thermocycler with at least five different chan-
nels for the detection of different fluorophores. In the
described assay, a QuantStudio™ 5 (Applied Biosystems™,
Foster City, CA, USA) was used. Reactions may be run in
0.1 mL PCR tubes/strips or 96-well plates sealed with optical
quality adhesive film or plastic lids.
2. Centrifuge with a speed range of 300–16,000 × g. Also must
have a rotor suitable for 1.5–2 mL tubes.
3. Thermomixer comfort (Eppendorf AG, Germany). Similar
devices may be used to incubate and shake simultaneously.
4. Qubit™ 4 fluorometer (Invitrogen™, Carlsbad, CA, USA).
Suitable 0.5 mL tubes must also be acquired.
 STEC Detection by Multiplex qPCR 65

Table 1
Multiplex STEC qPCR primers and probes

Primer Sequence 5′ → 3’ Modifications Reference

stx1-P3F TGT CGC ATA GTG GAA CCT CAC – [23]
stx1-P3R CAG CTG TCA CAG TAA CAA ACC G –
stx1-P3P ACG CAG TCT// GTG GCA AGA GCG ATG T FAM/ZEN/IABkFQ
stx2-P3F AAC GGT TTC CAT GAC AAC GG –
stx2-P3R CAG TGA GTG ACG ACT GAT TTG C –
stx2-P3P TGC AAC GTG TCG CAG CGC TGG ATTO550N/IAbRQSp
eae-P3F TGA CGG TAG TTC ACT GGA CTT C –
eae-P3R TGA CCC GCA CCT AAA TTT GC –
eae-P3P TGG TCA GGT CGG AGC GCG TTA CA TexRd-XN/IAbRQSp
O157-rfbE-F TCA ACA GTC TTG TAC AAG TCC AC – [24]
O157-rfbE-R ACT GGC CTT GTT TCG ATG AG –
O157-rfbE-P AC TAG GAC CGC AGA GGA AAG AGA GGA A Cy®5/IAbRQSp
NC-IAC-F AGT TGC ACA CAG TTA GTT CGA G – [15]
NC-IAC-R TGG AGT GCT GGA CGA TTT GAA G –
IAC-P AGT GGC GGT//GAC ACT GTT GAC CT YY/ZEN/IABkFQ [16]
YY (Yakima Yellow), IABkFQ (Iowa Black®FQ), IAbRQSp (Iowa Black®Sp), and ZEN (secondary, internal quencher)
are trademarks from IDT. TexRd-XN (Texas Red®). See Note 8

3 Methods

3.1 Bacterial 1. Pick one well isolated colony from a TSA plate and resuspend it
Enrichment in 1–4 mL of nutrient broth. Incubate at 37 ± 1 °C overnight.
2. After incubation, take an aliquot (1–2 mL) for DNA extraction.

3.2 DNA extraction 1. Centrifuge aliquots at 16,000 × g for 2 min.

(see Note 3) 2. Eliminate the supernatant, resuspend the bacterial pellet in
1 mL of TE 1×, and centrifuge again at 16000 × g for 2 min.
3. Discard the supernatant and resuspend the pellet in 200 μL of
chelex, and incubate at 56 °C for 15 min and constant agitation
(1000 rpm) in the thermomixer (see Note 4).
4. Place the tubes at 99 °C for 10 min and constant agitation
(1400 rpm).
5. Finally, centrifuge the tube at 16,000 × g for 2 min, at 4 °C to
further aid in with the thermal lysis. Transfer the supernatant,
containing the DNA to a clean tube (see Note 5).
6. The DNA is ready for the qPCR. In the event that the samples
are not analyzed, they may be stored at 4 °C and will remain
stable for some days; however, if excessive delay from extraction
until the analysis is expected, the DNA should be stored at -
20 °C to assure its integrity.
66 Ana Costa-Ribeiro et al.

3.3 DNA 1. Remove Qubit™ reagents from the refrigerator and allow
Quantification them to reach room temperature. It is recommended to per-
form the assay at room temperature (18–28 °C). Temperature
fluctuations may influence the accuracy of the assay.
2. Prepare the standards and sample reactions. For standards
transfer 190 μL of Qubit™ 1× dsDNA HS working solution
to two Qubit™ 0.5 mL compatible tubes (label the tubes only
in the cap and not in the walls as it can interfere with the
reading of the sample). Add 10 μL of Standard #1 (0 ng/ μL)
in one tube, and 10 μL of Standard #2 (10 ng/μL) in another
one. For the samples, 1–20 μL may be measured, and the
working solution will be added to make a final volume of
200 μL. The amount of sample used depends on the sample
volume available and the DNA concentration of the sample. In
this protocol, 1 μL is used.
3. Mix the standards and samples vigorously using a vortex for 5 s
and incubate in the dark for at least 2 min. Reactions are stable
for 3 h in the dark.
4. Read the standards in the equipment to perform the calibra-
tion, and then proceed with the samples indicating in the
equipment the volume of sample used in the reaction. This is
necessary for the equipment to calculate the DNA concentra-
tion in the original sample. In the case the equipment indicates
“concentration too high,” perform a 1/ 10 dilution of the
original sample, and repeat the process from step 2 of Sub-
heading 3.3. In the case the equipment indicates “concentra-
tion too low,” increase the volume of the sample in step 2 of
Subheading 3.3. If the problem persists, perform again the
DNA isolation.

3.4 STEC Multiplex 1. The assay described herein targets three different STEC viru-
qPCR Assay lence markers, namely, stx1, stx2, and eae, along with the gene
rfbE which encodes for the “O157” antigen (this serogroup is
the most commonly reported STEC in most countries world-
wide) and an IAC. The sequences of all the primers and probes
are provided in Tables 1 and 2. See Notes 6 and 7.
2. Perform tenfold serial dilutions from the original DNA extract
in TE 1×, e.g., 10 μL of DNA and 90 μL of TE 1×.
3. Considering the number of dilutions to be tested, prepare
enough reaction mixture to test each one in technical dupli-
cates (ideally triplicates), along with negative control (Milli-Q
water) and at least one extra reaction having some excess vol-
ume. In Table 3 the volumes required for one reaction are
presented.
4. To perform a pentaplex assay, a qPCR thermocycler with five
filters, or channels, is needed. The thermal profile run is sum-
marized in Table 3.
 STEC Detection by Multiplex qPCR 67

Table 2
Reagent concentrations and volumes for one STEC multiplex qPCR assay

Final
Primer/probe Volume/rxn (μL) concentration (nM)
NZYSupreme 12.5 –
stx1-P3F 0.1 400
stx1-P3R 0.1 400
stx1-P3P 0.05 200
stx2-P3F 0.1 400
stx2-P3R 0.1 400
stx2-P3P 0.05 200
eae-P3F 0.1 400
eae-P3R 0.1 400
eae-P3P 0.05 200
O157-rfbE-F 0.1 400
O157-rfbE-R 0.1 400
O157-rfbE-P 0.05 200
IAC F 0.2 100
IAC R 0.2 100
IAC P 0.2 100
IAC DNA 1.0 7 × 102a
H2O 1.0 –
Template DNA 3b –
Final volume 25 –
Primer volumes indicated are calculated based on a working solution of 100 μM except
for the IAC in which 10 μM stocks were used. Final concentrations may vary depending
on specific Master Mixes
a
Copies/μL, the volume may vary depending on the DNA stock concentration
b
To reduce pipetting errors, avoid pipetting volumes below 2 μL

5. A bacterial isolate will be considered as a non-STEC if no

amplification is observed for stx1 and/or stx2 as these genes
encode for the Shiga toxin. Amplification of the eae gene is
considered a virulence marker but it may be present in non-
STEC E. coli. Amplification of the rfbE indicates that the isolate
under study belongs to the serogroup O157, but has no impli-
cations on the virulence potential of the bacteria (it is of interest
for surveillance purposes). A sample negative for all the men-
tioned genes must still be positive for the IAC as a reaction
negative for all five targets will indicate that reaction inhibition
68 Ana Costa-Ribeiro et al.

Table 3
Thermal profile for multiplex qPCR

Stepa Temperature (°C) Time (s) Cycles

Activation 95 300 1
Dissociation 95 15 40
Annealing-amplificationb 60 30
a
The steps, temperatures, and times may be modified depending on the master mix
selected
b
Annealing and amplification may be separated making it a three-step qPCR assay.
Optimal temperatures and times may change among brands. The fluorescence is detected
at the end of each annealing-amplification step. See Note 9

Fig. 1 (a) stx1 amplification plot, (b) stx2 amplification plot, (c) eae amplification plot, (d) rfbE amplification
plot, (e) IAC amplification plot, (f) simultaneous multiplex amplification

occurred. In Fig. 1A–1F, typical amplification plots are pre-

sented. Lack of amplification in the IAC may be observed in
samples with high DNA concentrations exhibiting early ampli-
fication of one or more targets. In these cases, the absence of
amplification of the IAC is not considered an issue. In Table 4 a
summary of the qPCR results interpretation is provided.
6. The Cq values obtained for each dilution can be plotted against
the DNA concentration, previously quantified, to determine
the amplification efficiency; see Fig. 2a, e. This parameter must
be between 90 and 110% with an R2 < 0.99 and may also serve
to determine the analytical sensitivity of the assay [11, 12]. See
Note 10.
 STEC Detection by Multiplex qPCR 69

Table 4
qPCR result interpretation
stx1/ stx2 eae rfbE IACa
Gene
Positive Negative Positive Negative Positive Negative Positive Negative

Positive STEC STEC O157-STEC NON-O157/ STEC STEC STEC

stx1/ stx2
Negative P NON-STEC O157 NON-O157/ NON-STEC NEGATIVE I

Positive STEC STEC O157 NON-O157/ NON-STEC

P P
eae
Negative P NON-STEC NON - P/ O157 NON-O157/ NON-STEC NEGATIVE I

Positive O157-STEC NON-O157/ STEC P - O157 NON-P/ O157 O157 O157

rfbE
Negative O157 NON-O157/ NON-STEC P/ NON-O157 NON-P/ NON-O157 NEGATIVE I

Positive STEC STEC p NON-STEC O157 O157

IAC*
Negative STEC I P I O157 I

a
Certain samples with a high concentration of target DNA may result in no amplification of the IAC. “P,” pathogenic.
“I,” inconclusive, inhibition in the IAC, the test must be repeated

Fig. 2 (a) Dynamic range of stx1, (b) dynamic range of stx2, (c) dynamic range of eae, (d) dynamic range of
rfbE, (e) standard curves generated from the dynamic range, used to calculate the multiplex qPCR amplifica-
tion efficiency

4 Notes

1. If desired to apply the assay for food analysis, the media speci-
fied in the ISO 13136 may be used [2]; these are modified TSB
supplemented with novobiocin (mTSBn): 17 g enzymatic
digest of casein, 3 g enzymatic digest of soy, 2.5 g D(+)
70 Ana Costa-Ribeiro et al.

glucose, 5 g NaCl, 4 g K2HPO4, 1.5 g bile salts No. 3, and

1000 mL Milli-Q water. Final pH = 7.4 ± 0.2. Dissolve 0.16 g
of novobiocin in 10 mL of Milli-Q water (0.12 g of acriflavine
may be used instead of novobiocin), and sterilize filtering
through a 0.22 μm filter. Immediately before use add 1 mL
to basal medium mTSB. The final concentration will be
16 mg/L (or 12 mg/L of acriflavine). Alternatively, whenever
stressed bacteria, and/ or low background microflora, are
expected, buffered peptone water (BPW) may be used. Its
typical composition is 10 g peptone, 5.0 g NaCl, 3.5 g
Na2HPO4, 1.5 g KH2PO4, and 1000 mL Milli-Q water,
pH 7.0 ± 0.2.
The FDA recommends the usage of modified BPW
(mBPW) supplemented with acriflavine, cefsulodin, and vanco-
mycin (ACV) [3]. The composition of this broth is 10 g pep-
tone, 5.0 g NaCl, 3.6 g Na2HPO4, 1.5 g KH2PO4, 6.0 yeast
extract, 5.0 casamino acids, 10.0 g lactose, 1.0 g sodium pyru-
vate, and 1000 mL Milli-Q water, pH 7.2 ± 0.2. The selective
agents are added at a final concentration of 10 mg/L of acrifla-
vine and cefsulodin and 8 mg/L of vancomycin (the antimi-
crobials are filter sterilized and added right before using the
medium).
2. TE 1× is intended for sample cleaning; thus any other general
buffer/solution may be used such as PBS or a 0.9% NaCl
solution.
3. The DNA extraction procedure detailed herein was selected
based on its simplicity and low cost; however, commercial
DNA extraction kits may also provide satisfactory results.
These may include other reagents intended for bacterial ther-
mal lysis such as PrepMan™ Ultra Sample Preparation Reagent
and/ or InstaGene™ Matrix from Applied Biosystems™ and
Bio-Rad, respectively, or column-based kits like NucleoSpin®
Food or DNeasy PowerSoil Pro from Macherey-Nagel and
Qiagen, respectively. Even though many kits and protocols
may include an enzymatic lytic step, considering that STEC
are Gram-negative bacteria, and the rapid growth of Entero-
bacteriaceae, simple thermal lysis protocols tend to provide
good results.
4. The agitation during steps 4 and 5 of the DNA extraction
protocol may be performed at different speeds, from 1000 to
1400 rpm. If the process cannot be performed automatically,
the samples should be mixed by hand, or inverting the tubes,
every few minutes to avoid the settling of the resin.
5. It is of utmost importance to not disturb the pellet with the
cellular debris and chelex. Loading the resin into the qPCR,
along with the DNA, may result in reaction inhibition (detect-
able by lack or delay of amplification of the IAC).
 STEC Detection by Multiplex qPCR 71

6. Different types of IAC may be designed and used [13, 14], and
commercial products are also available. These may be identified
as internal positive control (IPC). In the current chapter, the
noncompetitive IAC described by Garrido-Maestu et al. was
selected [15, 16]. Any chimeric DNA accommodating the
primers and probe described herein will be suitable; thus, no
particular DNA sequence was provided. The IAC included in
this protocol is expected to provide a Cq of 30–33 in
non-inhibited negative samples; if inhibition is observed, this
can typically be overcome by performing a ½–1/10 dilution of
the DNA in Milli-Q water of TE 1×.
7. Primer and probe design may be performed with different
software. Primer3 is an online free tool [17] where this task
can be performed automatically or manually specified attend-
ing to specific requirements such as length, GC %, or Tm
among others with particular caution when designing hydroly-
sis probes to avoid placing a G in the 5′ end, where the
fluorophore is attached, due to the high natural quenching
capacity of this nucleotide [18, 19]. As input for the design,
the sequence of the desired gene may be used, e.g., obtained
from NCBI’s Refseq, or several may be retrieved from the same
database and aligned and the consensus sequence of a con-
served region may be used; free tools to perform this visualiza-
tion and alignment are also available, for instance, CLC
Sequence Viewer [20].
The inclusivity and exclusivity of newly designed primers
should be tested in silico prior to their acquisition and later by
in vitro testing. This task may be initially performed by a
BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and
later through an in silico PCR [21]. For in vitro studies, the
optimized assay must be used (see Notes below) against a panel
of target and nontarget strains [22].
The optimal primers and probes concentration must be
optimized for optimal performance. The optimization typically
begins with the primers using an intercalating dye such as SYBR
Green I and testing different relative concentrations of the
forward and reverse primer in the range of 100–500 nM.
Once determined the optimal primer concentration, one may
perform the same step for the probe where concentrations in
the range 100–300 nM typically lead to good results.
8. Attention must be paid to the selection of fluorophores. The
ones specified in Table 1 are a suitable combination that works
well in the qPCR instrument that was used. It is advised to
confirm that the fluorophores selected do not have overlapping
emission peaks. Oligonucleotide suppliers may have alternative
dyes and quenchers equivalent to the ones indicated in Table 1
which may be more economic (e.g., Cy®5 for TYE665 or
72 Ana Costa-Ribeiro et al.

TexRd for TEX615 from IDT). In the link provided, options

from IDT may be found (https://eu.idtdna.com/site/cata
log/modifications/dyes).
In addition to the primers indicated, the ISO standard
13,136 and the FDA have made publicly available their oligo-
nucleotide sequences, which may be found in the
corresponding methods [2, 3].
9. The master mix selected requires a “Hot-Start” for polymerase
activation; however enzymes from different suppliers may have
different requirements in terms of temperature and time; thus
it is of utmost importance to confirm the proper profile as
suboptimal activation of the enzyme may generate unsatisfac-
tory results.
Regardless of the need of the “Hot-Start,” some master
mixes implement, or if not may be added separately, uracil
DNA glycosylase (UDG). The addition of this enzyme is
intended to avoid, or reduce, carryover contamination between
experiments. For this treatment to work, the master mixes
selected must contain dUTP instead of dTTP so that the
amplicons will incorporate the dUTP which will not be present
in the template DNA, it will be degraded by the UDG with a
simple incubation at 50 °C for 2–20 min, and then it is dena-
tured in the “Hot-Start” step before the beginning of the PCR
amplification.
Amplification time and temperature should be optimized
whenever a new assay is developed for optimal performance and
if the brand of the master mix, or the equipment, is changed. In
terms of annealing temperature, the range to be tested typically
goes from 58 °C to 66 °C, and the time from 15 to 60 s.
10. In multiplex qPCR assays, the amplification efficiency must be
calculated individually for each one of the targets selected, as
well as for the combination of all of them to assure that the
reaction performs well under the different conditions. The
IAC must be loaded but it does not account for the evaluation.

References
1. Kim SO, Kim SS (2021) Bacterial pathogen 3. Feng P, Weagant SD, Jinneman K (2011) Diar-
detection by conventional culture-based and rheagenic Escherichia coli. http://www.fda.
recent alternative (Polymerase Chain Reaction, gov/Food/ScienceResearch/
isothermal amplification, Enzyme Linked LaboratoryMethods/Bacteriolo
Immunosorbent Assay, bacteriophage amplifi- gicalAnalyticalManualBAM/ucm070080.htm
cation, and gold nanoparticle aggregation) 4. Garrido-Maestu A, Chapela M-J, Peñaranda E
methods in food samp. J Food Saf 41:1–12 et al (2015) Re-evaluation of enhanced qPCR
2. ISO/TS (2012) Microbiology of food and ani- prevalidated method for next-day detection of
mal feed – Real-time polymerase chain reaction Salmonella spp., Shigella spp., Escherichia coli
(PCR)-based method for the detection of O157 and Listeria monocytogenes. Food Bio-
food-borne pathogens – horizontal method technol 29:317–335
for the detection of Shiga toxin-producing 5. Bundidamorn D, Supawasit W, Trevanich S
Escherichia coli (STEC) and the determination (2021) Taqman® probe based multiplex
of O157
 STEC Detection by Multiplex qPCR 73

RT-PCR for simultaneous detection of Listeria controls for diagnostic PCR assays. J Clin
monocytogenes, Salmonella spp. and Shiga Microbiol 42:1863–1868
toxin-producing Escherichia coli in foods. 15. Garrido-Maestu A, Azinheiro S, Carvalho J
LWT 147:111696 et al (2019) Combination of immunomagnetic
6. Villamizar-Rodrı́guez G, Lombó F (2017) separation and real-time recombinase polymer-
Multiplex Detection of Food-Borne ase amplification (IMS-qRPA) for specific
Pathogens. In: Domingues L (ed) PCR: meth- detection of Listeria monocytogenes in smoked
ods and protocols. Springer New York, salmon samples. J Food Sci 84(7):1881–1887
New York, pp 153–162 16. Garrido-Maestu A, Azinheiro S, Carvalho J
7. Dhital R (2021) Detection of virulence and et al (2018) Development and evaluation of
extended spectrum β-lactamase genes in Salmo- loop-mediated isothermal amplification, and
nella by multiplex high-resolution melt curve Recombinase Polymerase Amplification meth-
real-time PCR assay. J Appl Microbiol 132(3): odologies, for the detection of Listeria mono-
2355–2367 cytogenes in ready-to-eat food samples. Food
8. Müştak İB, Müştak HK (2022) Detection and Control 86:27–34
differentiation of Salmonella Enteritidis and 17. Untergasser A, Cutcutache I, Koressaar T et al
Salmonella Typhimurium by multiplex quanti- (2012) Primer3-new capabilities and inter-
tative PCR from different poultry matrices. Br faces. Nucleic Acids Res 40:e115–e115
Poult Sci 63:171–178 18. Mackay IM (2004) Real-time PCR in the
9. Bundidamorn D, Supawasit W, Trevanich S microbiology laboratory. Clin Microbiol Infect
(2018) A new single-tube platform of melting 10:190–212
temperature curve analysis based on multiplex 19. Biassoni R, Raso A (eds) (2020) Quantitative
real-time PCR using EvaGreen for simulta- real-time PCR methods and protocols.
neous screening detection of Shiga toxin- Humana, New York, NY
producing Escherichia coli, Salmonella spp. 20. CLC Bio-Qiagen (2016) CLC Sequence
and Listeria monocytogenes in food. Food Con- Viewer
trol 94:195–204
21. Bikandi J, San Millán R, Rementeria A et al
10. Vitullo M, Grant KA, Sammarco ML et al (2004) In silico analysis of complete bacterial
(2013) Real-time PCRs assay for serogrouping genomes: PCR, AFLP–PCR and endonuclease
Listeria monocytogenes and differentiation from restriction. Bioinformatics 20:798–799
other Listeria spp. Mol Cell Probes 27:68–70
22. Kralik P, Ricchi M (2017) A basic guide to real
11. Raymaekers M, Smets R, Maes B et al (2009) time PCR in microbial diagnostics: definitions,
Checklist for optimization and validation of parameters, and everything. Front Microbiol 8:
real-time PCR assays. J Clin Lab Anal 23: 1–9
145–151
23. Costa-Ribeiro A, Azinheiro S, Fernandes SP,
12. Bustin SA, Benes V, Garson JA et al (2009) The Lamas A, Prado M, Salonen LM, Garrido-
MIQE guidelines: minimum information for Maestu A (2023) Evaluation of covalent
publication of quantitative real-time PCR organic frameworks for the low-cost, rapid
experiments. Clin Chem 55:611–622 detection of Shiga Toxin-producing Escheri-
13. Deer DM, Lampel KA, González-Escalona N chia coli in ready-to-eat salads. Anal Chim
(2010) A versatile internal control for use as Acta 341357. https://doi.org/10.1016/j.aca.
DNA in real-time PCR and as RNA in real-time 2023.341357
reverse transcription PCR assays. Lett Appl 24. Garrido-Maestu A, Azinheiro S, Carvalho J
Microbiol 50:366–372 et al (2020) Optimized sample treatment,
14. Hoorfar J, Malorny B, Abdulmawjood A et al combined with real-time PCR, for same-day
(2004) Practical considerations in design of detection of E. coli O157 in ground beef and
internal amplification controls for diagnostic leafy greens. Food Control 108:106790
PCR assays MINIREVIEW practical considera-
tions in design of internal amplification
 Chapter 7

DNA Isolation from Cocoa-Derived Products and Cocoa

Authentication by TaqMan Real-Time PCR
Ana Caroline De Oliveira, Yordan Muhovski, Herve Rogez,
and Frédéric Debode

Abstract
Cocoa (Theobroma cacao L.) is an international commodity used as an ingredient in the manufacturing of
chocolate making its authentication a key issue in the cocoa chain. Various molecular techniques have been
increasingly applied for quality requirements. These issues highlight the need for techniques that allow the
extraction and detection of cocoa DNA from highly processed cocoa products and chocolate. The applica-
bility of real-time PCR to highly processed cocoa-derived products for authentication purposes depends on
the possibility of extracting high-quality and amplifiable DNA and further developing efficient PCR tests.
This methodology herein describes the use of a classical CTAB method providing DNA suitable for
TaqMan real-time PCR amplification. Real-time PCR is a simple and fast method, with a high potential
application in a wide range of food products. The main features of this technique are focused on two DNA
targets, one located in the nuclear genome (vicilin-li PCR test) and a second one based on chloroplast DNA
(lipids PCR test), which successfully passed the performance criteria considering the specificity, sensitivity,
efficiency of amplification, robustness, and applicability in processed cocoa-derived products and chocolate.

Key words Chloroplast DNA, Chocolate, DNA extraction, Nuclear DNA, Theobroma cacao, qPCR

1 Introduction

Cocoa bean (Theobroma cacao L.) is an international agricultural

commodity largely produced in several countries, and it is the key
raw material in chocolate manufacturing. Since cocoa deliveries are
frequently characterized by vast heterogeneity in their quality attri-
butes, a reliable quality assessment is of great importance for both
producers and purchasers. Molecular authenticity based on the
analysis of DNA extracted from cocoa-derived products could
open new opportunities for the marketing of cocoa beans from a
single origin and help to check the quality requirements, as well as
being a preliminary stage in the future development of fast and

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_7,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

75
76 Ana Caroline De Oliveira et al.

cost-effective tests to differentiate bulk and fine cocoa for the

chocolate industry [1].
Food authentication has increasingly become at the forefront
of consumer concerns, industry strategies, and government policy
initiatives and also an essential element of the agricultural supply
chain quality assurance management system [2]. The European
Union defines several specific common rules for cocoa and choco-
late products that complement the legislation applicable to food-
stuffs [1]. In this context, DNA technologies (extraction and
amplification) represent a useful tool in food authenticity and reg-
ulation. DNA quality is an essential element for most amplification-
based analyses. In particular, the quality of nucleic acids extracted
from cocoa-derived product samples is influenced by different fac-
tors including the presence of PCR inhibitors mainly phenolic
compounds and polysaccharides, the level of DNA damage, and
the average fragment length of the nucleic acid obtained. These
factors are dependent on the sample itself and the processes carried
out during the production of the cocoa and chocolate such as high
temperature or the presence of an alkalizing step, which could
considerably degrade the DNA into small fragments and, conse-
quently, affect detection by PCR amplification [3, 4].
In highly processed foods, real-time PCR techniques are prov-
ing to be useful alternatives owing to the great sensitivity and
specificity in detecting minute amounts of DNA in processed
foods. Real-time PCR is a very sensitive approach that can amplify
very low amounts of DNA of plant species in foodstuffs [3]. It is
however necessary to know if amplifiable DNA can be recovered
from the processed products considered to ensure the applicability
of the methods [4].
This chapter is dedicated to the description of a protocol for
cocoa DNA extraction from highly processed cocoa products and
chocolate and further analysis of the extracted DNA by TaqMan
real-time PCR assay using a specific set of primers and probe
targeting chloroplast and nuclear genome of T. cacao allowing the
authentication of cocoa-derived products. Therefore, the described
methodology is valuable for cocoa authentication purposes and
constitutes a preliminary step for developing an easy, fast, and
cost-effective real-time PCR-based method for the distinction
between “fine” and “bulk” cacao genotypes.

2 Materials

2.1 General Supplies 1. Sterile DNase-free microtubes of 1.5 mL and 2.0 mL.
2. Micropipettes of variable volume and their respective tips
(0.1–2.5 μL; 0.5–10 μL; 10–100 μL; 100–1000 μL).
3. Water purification system (Milli-Q, Millipore).
4. Sterile nuclease-free ultrapure water.
 Cocoa-Derived Products Authentication 77

2.2 DNA Extraction 1. Mortar and pestle.

2. Hot water bath or thermal block.
3. Spectrophotometer (NanoDrop).
4. Vortex mixer.
5. Microcentrifuge.
6. Isopropanol, stored at -20 °C.
7. 70% and 95% ethanol, stored at -20 °C.
8. 20 mg/mL RNase A.
9. 20 mg/mL proteinase K.
10. DNA extraction CTAB buffer (CTAB 1): 20 g/L of CTAB,
1.4 mol/L of NaCl, 0.1 mol/L of Tris hydrochloride solution,
0.02 mol/L of Na2EDTA, pH 8.0 (to facilitate the dissolution
of the components, preheat on a hot plate with stirring at
65 °C). Autoclave for sterilizing the solution.
11. DNA precipitation buffer CTAB (CTAB 2): 5 g/L of CTAB,
0.04 mol/L of NaCl.
12. NaCl solution (CTAB 3): 1.2 mol/L of NaCl.

2.3 Real-Time PCR 1. QuantStudio 3 or 5 Real-Time PCR Systems (Thermo Fisher

Scientific).
2. Microplate centrifuge.
3. MicroAmp® Optical 96-Well Reaction Plate (Thermo Fisher
Scientific).
4. MicroAmp optical adhesive film (Thermo Fisher Scientific).
5. TaqMan Universal Master Mix or TaqMan Fast Universal Mas-
ter Mix (Applied Biosystems).
6. Primers and probes set for vicilin-like seed storage protein
(nuclear target) and lipids (chloroplast target) (see Table 1).
7. FAM-TAMRA-labeled oligonucleotide probe.

3 Methods

3.1 DNA Extraction 1. DNA is extracted using a CTAB-based protocol [5]. Prepare
CTAB solutions, use within 3 months, and store capped in the
refrigerator at 4 °C.
2. For the DNA extraction from the cocoa-derived and chocolate
samples, prepare the samples as described (see Note 1):
For raw cocoa beans:
(a) Freeze dry the sample material for 24 h.
(b) Grind sample material with a mortar and pestle, and weigh
200 mg of it into a 2.0 mL microtube.
78 Ana Caroline De Oliveira et al.

Table 1
Primers and probes used for cocoa detection in processed cocoa-derived products

Oligonucleotide Amplicon
Target NCBI acc. no. designation Sequence (5′-3′) size (bp)
Lipids XM007027212 Forward primer TCCCTTATTCCCA 86
(chloroplast ATTTTCTCCTT
target) Reverse primer AGATTGGGAGAG
TTCGGTTTCTAA
Probe (FAM-TAMRA CCAAGAAACAAAA
labeled) CCCGAAACGCCA
Vicilin-like XM018124728 Forward primer CCCAAACTACTAA 77
seed storage AGCCCTCATCT
protein Reverse primer GCTTTGCCCATGC
(nuclear TTTCG
target) Probe (FAM-TAMRA CTTCCCTCCCCT
labeled) CACCTCAAAAACTCAA

For fermented and dried or roasted beans:

(a) Grind sample material with a mortar and pestle, and weigh
200 mg of it into a 2.0 mL microtube.
For chocolate:
(a) Chop finely into small pieces.
(b) Weigh 200 mg of crushed sample into a 2.0 mL
microtube.
3. Add 1.5 mL CTAB 1 buffer, 5 μL of 20 mg/mL RNase A to
each sample (200 mg in 2.0 mL microtube), and vortex
vigorously.
4. Incubate for 30 min at 60 °C (shake after 15 min to resuspend
the material).
5. Add 10 μL of 20 mg/mL proteinase K and vortex.
6. Incubate for 30 min at 60 °C (shake after 15 min to resuspend
the material).
7. Centrifuge for 10 min at 15,000g.
8. Transfer the supernatant into a new 1.5 mL microtube.
9. Centrifuge for 10 min at 15,000g.
10. Transfer 900 μL of supernatant into a new 2.0 mL microtube
containing 900 μl of chloroform.
11. Vortex for 30 s.
12. Centrifuge for 15 min at 15,000g.
13. Transfer 650 μL of supernatant into a new 2.0 mL microtube.
 Cocoa-Derived Products Authentication 79

14. Add 1300 μL of CTAB 2 (precipitation buffer).

15. Incubate for 60 min at room temperature.
16. Centrifuge for 15 min at 15,000g.
17. Carefully decant the supernatant without disturbing the pellet.
18. Add 700 μL of CTAB 3 (NaCl solution) and vortex to dissolve
the DNA.
19. Add 700 μL of chloroform and vortex for 30 s.
20. Centrifuge for 10 min at 15,000g.
21. Pipette 600 μL of the aqueous phase (top) taking care not to
aspirate any of the chloroform phase.
22. Place the aqueous phase into a new 2.0 mL microtube.
23. Add 0.6 volume (360 μL) of isopropanol, and mix the tubes
gently by inverting them four to five times (see Note 2).
24. Incubate for 20 min at room temperature.
25. Centrifuge for 15 min at 15.000g. Position the tubes in an
equal fashion to facilitate the subsequent removal of superna-
tant without disturbing the resulting DNA pellet.
26. Eliminate the supernatant carefully without disturbing the
DNA pellet (see Note 2).
27. Add 500 μL of cold (-20 °C) 70% ethanol, and mix the tubes
gently by inverting them four to five times.
28. Centrifuge for 10 min at 15,000g.
29. Eliminate the supernatant carefully without discarding the
DNA pellet (see Note 2).
30. Dry the pellet in a vacuum centrifuge or on a thermal block at
55 °C.
31. Resuspend the DNA with 100 μL of molecular biology-grade
water.
32. After the extraction, the sample is ready to use for further
downstream applications (see Note 3).
33. The extracted DNA must be quantified spectrophotometrically
using the absorbance at 260 and 280 nm (see Note 4).

3.2 TaqMan Real- The reaction components are assembled in a final volume of 25 μL
Time PCR as described below:
1. Keep all reaction components on ice (see Note 5).
2. Mix and prepare master mix in 1.5 mL microcentrifuge tubes,
following the proportions indicated in Table 2. Prepare the
reaction mix for each target separately. The final volume of
the master mix depends on the number of reactions required
for each real-time PCR (see Note 6).
80 Ana Caroline De Oliveira et al.

Table 2
Components of real-time PCR

Final volume for

Target final Volume for the number of
Mix reagents concentration single reaction (μL) reactions required (μL)
2× TaqMan Master Mix 1× 12.5 N × 12.5
Forward primer (15 μM) 0.3 μM 0.5 N × 0.5
Reverse primer (15 μM) 0.3 μM 0.5 N × 0.5
Probe (15 μM) 0.3 μM 0.5 N × 0.5
Nuclease-free water – 6.0 N × 6.0

3. Mix gently by vortexing and briefly centrifuge to settle down

the tube contents.
4. Carefully aliquot 20 μL of template master mix into each
plate well.
Set up the real-time PCR in a 96-well plate, including
nontemplate control (NTC) (see Note 7), positive control (see
Note 8), and the experimental sample (see Note 9).
Setup reaction:
(a) For NTC reactions, add 5 μL of water to the
corresponding plate well.
(b) For the experimental samples reactions, add 5 μL of DNA
template to the corresponding plate well.
(c) For the positive control reactions, add 5 μL of reference
material to the corresponding plate well.
5. After pipetting, seal the plate with optical adhesive film.
6. Centrifuge the 96-well plate briefly to remove any air bubbles,
and load the plate onto a Real-Time PCR System.

3.3 Thermocycling 1. Incubate the 96-well plate containing the DNA and the master
mix in a Real-Time PCR System.
2. Run the program with the standard or fast cycling:
(a) Standard cycling: 10 min at 95 °C (initial denaturation)
and 40 cycles of 15 s at 95 °C (denaturation) and 1 min at
60 °C (annealing and extension).
(b) Fast cycling: 20 s at 95 °C (initial denaturation) and
40 cycles of 3 s at 95 °C (denaturation) and 30 s at 60 °
C (annealing and extension).
 Cocoa-Derived Products Authentication 81

3.4 Program and Run 1. Operate the Real-Time PCR System and software according to
the manufacturer’s recommendations. Define the experiment
properties including the set reaction volume to 25 μL and the
amplification program. Use FAM-TAMRA as a detector/
quencher.
2. Briefly, launch the software, and open a new plate template
window to denote well locations on the 96-well plate for the
controls and experimental samples. Define the plate wells with
sample names and targets. Save the template window with the
recorded data as a run file.
3. Load the 96-well plate in the instrument. Select the “Start
Run” button to begin the actual run and determine Cq (cycle
threshold) values for each sample.

3.5 Data Collection 1. After the run is completed, select baseline (see Note 10), and
and Analysis place the threshold line at the exponential phase of amplifica-
tion (see Note 11). Remove the plate from the instrument and
save the results of the run. When the analysis button is selected
in the software, the results will be analyzed automatically if the
standards and testing sample information were recorded as
noted in the previous section. The obtained Cq values should
be thoroughly reviewed, and interpretation of the results must
be made taking into account the acquired data in the internal
validation performed in each laboratory for a given detection
limit (see Note 12).

4 Notes

1. DNA extraction can be carried out using an increased sample

weight (up to 1 g in the case of matrices likely to contain
low amount of DNA). In this case, the volumes of the reagents
used must be adapted accordingly.
2. Absolute isopropanol should be kept at -20 °C before use, as
the low temperature decreases DNA solubility and allows faster
and more efficient precipitation. It should be noted that,
depending on its concentration, the DNA pellet may not be
visible or can appear only as a thin smear on the microtube wall,
so the supernatant removal should be carefully performed to
avoid accidental discard of DNA.
3. The DNA can be stored at 4 °C if used in the next few days or at
-20 °C in the freezer for long-term storage.
4. The extraction protocol will inevitably result in DNA solutions
containing contaminants that may inhibit PCR, so we suggest
selecting samples with purity ratios of A260/280 superior to
1.6 and A260/230 superior to 1.0, as lower ratios indicate
82 Ana Caroline De Oliveira et al.

high contamination with proteins or organic compounds/

chaotropic salts, respectively, and which may affect the assay.
Values higher than 2 may be due to the presence of RNA in the
DNA solution. If the DNA purity is not adequate, DNA
extraction should be repeated.
5. Prepare a stock solution of 100 μM of TaqMan probe and
primers with molecular biology-grade water. This stock solu-
tion can be diluted to achieve a working solution concentration
(15 μM). Probe working solutions should be aliquoted in
volumes that are sufficient for one-time use. These aliquots
should be stored at -20 °C. In addition, repeated freeze-
thaw cycles and long exposure to the light of probe solutions
should be avoided.
6. Master mixes can be made more than what is needed to account
for pipetting variations, i.e., prepare 10% excess of the
master mix.
7. Negative reaction control (NTC) produces amplification. A
signal in the no template control demonstrates amplicon con-
tamination in the master mix reagents. It is often easier to
simply repeat the real-time PCR using new reagents (except
DNA prep). If the problem disappears, one can proceed.
8. The positive control is a reaction with DNA extracted from
cocoa material used as a reference for limit detection of the
technique [6]. The reference material used may be cocoa
powder.
9. Test samples should be analyzed in duplicate or triplicate
according to individual laboratory statistical requirements. If
the samples display large variability between Cq of duplicate or
triplicates, there might be a problem in the preparation of the
master mix or a pipetting error. Check whether the master mix
was prepared and mixed correctly and if the micropipettes are
calibrated and dispensing the appropriate volume of liquid
reproducibly.
10. The amplification curve begins after the maximum baseline. If
the amplification curve begins too far to the right of the
maximum baseline, the end cycle value increases. If the curve
begins before the maximum baseline, the end cycle value
decreases.
11. The threshold is set in the exponential phase of the amplifica-
tion curve. Threshold settings above or below the optimum
increase the standard deviation of the replicate groups. When
the threshold is settled below the exponential phase of the
amplification curve, the standard deviation is significantly
higher than that for a plot where the threshold is set correctly.
Similarly, when the threshold is fixed above the exponential
phase of the amplification curve, the standard deviation is
 Cocoa-Derived Products Authentication 83

significantly higher than that for a plot where the threshold is

set correctly. Drag the threshold bar down or up into the
exponential phase of the curve, if necessary.
12. The amplification plot is useful for identifying and examining
abnormal amplification. Abnormal amplification can include
increased fluorescence in negative control wells and the
absence of detectable fluorescence at positive control wells.

References

1. Perez M, Lopez-Yerena A, Vallverdú-Queralt A 4. Mano J, Nishitsuji Y, Kikuchi Y et al (2017)

(2020) Traceability, authenticity and sustainabil- Quantification of DNA fragmentation in pro-
ity of cocoa and chocolate products: a challenge cessed foods using real-time PCR. Food Chem
for the chocolate industry. Crit Rev Food Sci 226:149–155. https://doi.org/10.1016/j.
Nutr 62:475. https://doi.org/10.1080/ foodchem.2017.01.064
10408398.2020.1819769 5. AFNOR XP V03-020-2. (2008) Produits ali-
2. Hassoun A, Abdullah NA, Aı̈t-Kaddour A, mentaires. Détection et quantification des orga-
Ghellam M, Beşird A, Zannou O, Önal B, nismes végétaux génétiquement modifiés et
Aadil RM, Lorenzo JM, Khaneghah AM, produits dérivés. Partie 2: Méthodes basées sur
Regenstein JM (2022) Food traceability 4.0 as la réaction de polymérisation en chaı̂ne. Norme
part of the fourth industrial revolution: key expérimentale
enabling technologies. Crit Rev Food Sci Nutr. 6. De Oliveira AC, Marien A, Hulin J et al (2022)
https://doi.org/10.1080/10408398.2022. Development of real-time PCR methods for
2110033 cocoa authentication in processed cocoa-derived
3. Kang TS (2019) Basic principles for developing products. Food Control 131:108414. https://
real-time PCR methods used in food analysis: a doi.org/10.1016/j.foodcont.2021.108414
review. Trends Food Sci Technol 91:574–585.
https://doi.org/10.1016/j.tifs.2019.07.037
 Chapter 8

Quantitative Real-Time PCR for the Detection of Allergenic

Species in Foods
Joana Costa, Caterina Villa, and Isabel Mafra

Abstract
Food allergy is an increasing challenge to public health, with widespread global distribution. With no cure
for this pathology, the food-allergic individuals are forced to adopt food eviction measurements, relying on
label information to avoid consuming the offending foods. To safeguard these individuals, the analytical
methods based on real-time PCR approaches are currently faced as excellent tools to verify labeling
compliance, aiding industry and regulatory agencies to efficiently manage food allergen control programs.
Therefore, this chapter intends to describe a protocol of real-time PCR to analyze allergenic food species.
For method development, the main steps to be considered are (i) in silico sequence analysis and primer/
hydrolysis probe design, (ii) preparation of calibrators (model foods containing the allergenic ingredient),
(iii) efficient DNA extraction from complex food matrices, (iv) amplification by real-time PCR with
hydrolysis probe (90–200 bp) targeting a highly specific DNA region (allergen-encoding gene),
(v) sequencing PCR products for identity confirmation, and (vi) validation and application to commercial
foods. Herein, a real-time PCR approach for the detection and quantification of cashew nut as an allergenic
food is described as an example protocol, including all the steps for method development and validation.

Key words Food allergen, Real-time PCR, Detection, Quantification, Allergen-encoding genes

1 Introduction

Food-induced allergy is an emerging public health issue, as well as

an increasing societal challenge, which is transversal to different
countries and world regions. Food allergy is an immunological
disease mediated by immunoglobulin E (IgE), and there is no
cure for this pathology, meaning that food-allergic patients are
recommended to eliminate the causative offending foods from
their diet [1, 2]. However, these individuals are still at risk of
suffering accidental allergic reactions due to the inadvertent pres-
ence of hidden allergens in foods and must rely on the labeling
information to avoid accidental exposure. In the European Union,
the legislation compels the labeling of 14 groups of allergenic
ingredients, namely, cereals containing gluten, peanut, tree nuts,

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_8,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

85
86 Joana Costa et al.

soybean, fish, crustaceans, egg, milk, mollusks, mustard, sesame,

lupine, celery, and sulphites, which must be highlighted from the
rest of the list of ingredients, regardless of their amount [3]. Con-
sequently, the advancement of proficient analytical tools to detect
and quantify allergenic components of foods, capable of verifying
labeling compliance as well as the efficiency of allergen cleaning
plans in the food industry, is much needed [4].
For several years, the analytical methods targeting allergens
(proteins), especially the enzyme-linked immunosorbent assays
(ELISA), have been the preferential approaches for allergen con-
trol, mostly due to their simplicity, rapidity, minimal requirement
for specialized personnel, and availability as commercial kits. How-
ever, since they rely on protein-antibody recognition, they are
highly prone to false-positive or false-negative results due to
cross-reactivity phenomena or structural changes of marker pro-
teins induced by food processing, respectively. More recently,
DNA-based methods gained great attention because they take
advantage of the higher stability of nucleic acids over proteins
toward harsh processing, as well as the high specificity conferred
by the uniqueness of selected marker sequences. Real-time PCR has
been the preferred DNA-based technique for the detection of
allergenic foods due to the high specificity and sensitivity and
rapid performance, providing quantitative and multiplex analysis
[5]. Real-time PCR approaches can be tailored for each allergenic
food by selecting species-specific regions that can be allergen-
encoding sequences, including different DNA or mRNA
sequences. Allergen-encoding genes are often targeted for their
high specificity (no cross-reactivity with nontarget species),
although other DNA regions (e.g., multicopy genes) are also
being used because of their potential for high sensitivity [4, 6].
For quantification purposes, real-time PCR methods must rely
on the use of calibrators, which should be based on model foods
containing known amounts of the target allergenic ingredient.
Calibrators may include different allergenic ingredients (e.g., wal-
nut, almond, hazelnut, sesame, lupine, soybean) in a matrix that
should be as close as possible to the foods to be tested, such as
cookies, ice creams, bread, chocolates, sausages, and cooked hams,
among others [7–16]. The calibrators for method development
should go down to trace levels (e.g., 0.1–1 mg/kg of allergenic
food in matrix) to comply with the requirements of high sensitivity
for food allergen analysis and cover the widest range possible (e.g.,
0.0001% (1 mg/kg) to 50% (500,000 mg/kg)).
Real-time PCR methods targeting single food species are
among the most used approaches for allergen detection (Fig. 1)
[8, 9, 12, 13, 15–17]. Multiplex real-time PCR assays for the
simultaneous detection of two or more allergenic targets provide
cost-effective and high-throughput tools [18–21], though often
compromising sensitivity. Moreover, other types of real-time PCR
have also been successfully proposed for improved sensitivity and
 Real-Time PCR for Allergenic Food Detection 87

Fig. 1 Schematic representation of a real-time PCR assay targeting Ana o 3 gene from cashew nut

PCR efficiency, namely, single-tube nested real-time PCR and nor-

malized real-time PCR, respectively. The former combines the
advantages of nested PCR (two primer pairs) with real-time PCR
(probe) in a single run, thus allowing to increase the sensitivity and
specificity of the method [8–11, 17]. A normalized real-time PCR
method is based on the simultaneous amplification of two DNA
targets, namely, a species-specific marker sequence (target gene)
and a universal region to serve as an endogenous (reference)
sequence [7, 11, 14], which enables to obviate the variability of
food matrices and processing treatments. Therefore, the develop-
ment of a real-time PCR method should consider the
target allergenic food, the matrix and food processing conditions,
as well as the required levels of specificity and sensitivity. In any case,
the methods for allergen analysis must be validated, considering the
applicable acceptance criteria regarding the calibration curve para-
meters of the slope, PCR efficiency, coefficient of correlation, and
dynamic range, as well as trueness, precision, repeatability, and
reproducibility [22, 23].
This chapter intends to provide detailed steps for developing a
real-time PCR method for allergenic food analysis. With this aim,
the development and validation of a real-time PCR for the detec-
tion and quantification of cashew nut as an allergenic food in a
complex matrix (biscuits) is described as an example. The method
targets a mRNA region (first step of gene expression for protein
production), which encodes the Ana o 3 allergen, including the
required optimization steps, from the in silico analysis and primer/
probe design to model food preparation and attainment of the
calibration curve, ending up with the assessment of analytical per-
formance parameters for validation [11].

2 Materials

Prepare all solutions with analytical-grade reagents and PCR-grade

water (DNase- and RNase-free water) (see Note 1). Prepare and
keep all solutions at room temperature (unless otherwise stated).
88 Joana Costa et al.

For DNA extraction and PCR analysis, use molecular biology-

grade reagents (sterile, DNase-, and RNase-free) and consumables
(e.g., reaction tubes, filtered tips, PCR tubes, real-time PCR strips,
and caps). Other non-sterile materials and consumables can also be
used after being carefully in-house autoclaved (121 °C, 15 min) or
chemically decontaminated with a DNA/RNA cleaning solution
(see Note 2). Use a PCR workstation to manipulate the DNA
extracts and PCR reagents, as well as to execute all tasks related to
the preparation of PCR or real-time PCR mixes. Follow all waste
disposal regulations/procedures when discarding waste materials,
consumables, and reagents.

2.1 Bioinformatic 1. Use the NCBI database (https://www.ncbi.nlm.nih.gov/),

Tools and select DNA or mRNA sequences of potential interest for
the unequivocal identification of the allergenic species (e.g.,
allergen-encoding genes or mRNA sequences) (see Note 3).
2. Use BLASTn (basic local alignment search tool for nucleo-
tides) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify
regions of local similarity between the selected nucleotide
sequence and orthologues of different species.
3. Select DNA regions of none or very low local similarity
between target species and orthologous genes, as templates
for primer design.
4. Upon sequence selection, use Primer-BLAST (https://www.
ncbi.nlm.nih.gov/tools/primer-blast/) with appropriate cri-
teria to design primers (see Note 4).

2.2 Reagents 1. DNA extraction: NucleoSpin Food kit (Macherey-Nagel,

Düren, Germany) (see Note 5).
2. Agarose gel electrophoresis: 1.5% of agarose in 1× SGTB
(Grisp, Porto, Portugal) or 2% agarose in TAE (40 mM Tris-
acetate, 1 mM EDTA) buffer with 1× GelRed (Biotium Inc.,
Hayward, CA, USA); DNA marker (e.g., DNA 100 bp marker,
Bioron GmbH, Römerberg, Germany); loading buffer (4%
(w/v) sucrose, 0.05% (w/v) bromophenol blue,
120 mM EDTA).
3. Qualitative PCR mix: SuperHot Taq DNA polymerase (e.g.,
Genaxxon Bioscience GmbH, Ulm, Germany) that includes
10 × buffer and 25 mM of MgCl2; PCR-grade water; 10 mM
of dNTP mix and primers (forward/reverse) outsource synthe-
sized (e.g., Eurofins Genomics, Ebersberg, Germany). Choose
a Taq DNA polymerase that is chemically inactivated prior to
the activation step (normally at 95 °C for 5–10 min) to maxi-
mize PCR formation without unspecific amplification.
4. PCR product purification kit (e.g., GRS PCR & Gel Band
Purification Kit, Grisp, Porto, Portugal).
 Real-Time PCR for Allergenic Food Detection 89

5. Real-time PCR mix with hydrolysis probe: pre-prepared mixes

containing all the reaction components (buffer, dNTP,
enzyme, and Mg2+) are normally better choices (e.g., SsoAd-
vanced Universal Probes Supermix, Bio-Rad Laboratories,
Hercules, CA, USA) (see Note 6); PCR-grade water; primers
(forward/reverse) and hydrolysis probe outsource synthesized
(e.g., Eurofins Genomics, Ebersberg, Germany).

2.3 Equipment 1. Laboratory knife mill Grindomix GM200 (Retsch, Haan,

Germany).
2. Thermomixer block (e.g., thermomixer comfort, Eppendorf
AG, Hamburg, Germany).
3. Refrigerated centrifuge (e.g., Heraeus Fresco 17, Thermo Sci-
entific, Osterode am Harz, Germany).
4. Vortex stirrer.
5. Water bath (0–100 °C).
6. Microplate reader UV/Vis spectrophotometer (SPECTROstar
Nano, BMG Labtech GmbH, Ortenberg, Germany) with
microvolume plate accessory for nucleic acid and protein quan-
tification (BMG LVis MicroDrop, SPECTROstar Nano, BMG
Labtech GmbH, Ortenberg, Germany), software SPECTRO-
star Nano v2.1 (SPECTROstar Nano, BMG Labtech GmbH,
Ortenberg, Germany) for data acquisition, and MARS Data
Analysis software (BMG Labtech GmbH, Ortenberg, Ger-
many) for data analysis (see Note 7).
7. DNA electrophoresis apparatus (electrophoresis tanks and
power supply).
8. PCR workstation with UV cleaner-recirculator, UV light, and
white lamp (e.g., VWR International GmbH, Darmstadt,
Germany).
9. UV light photographic system (e.g., UV light tray Gel Doc™
EZ Imager, Bio-Rad Laboratories, Hercules, CA, USA) and
respective image recording software (Image Lab software ver-
sion 5.2.1, Bio-Rad Laboratories, Hercules, CA, USA).
10. Thermal cycler (e.g., SimpliAmp™ Thermal Cycler (Applied
Biosystem™, Thermo Fisher Scientific, Waltham, MA, USA)).
11. Real-time PCR thermocycler (e.g., CFX96 Real-time PCR
System, Bio-Rad Laboratories, Hercules, CA, USA) capable
of reading at least one fluorophore (e.g., FAM) and respective
software for real-time PCR data analysis (Bio-Rad CFX man-
ager 3.1, Bio-Rad Laboratories, Hercules, CA, USA).
90 Joana Costa et al.

3 Methods

To advance a real-time PCR protocol for food allergen analysis,

the assessment and optimization of several experimental conditions
should be previously performed, namely, selecting the most
appropriate DNA extraction method to ensure the best quality/
yield/purity of extracts, designing a set(s) of primers and hydrolysis
probe to guarantee the best specificity and sensitivity of the
method, evaluating the best real-time PCR protocol (e.g., fast,
standard, normalized, non-normalized, etc.), and including the
amount of primers/probe in the mix and temperature program.
In this specific chapter, a real-time PCR method for the detection
of cashew nut as an allergenic ingredient in different matrices is
described as an example protocol, whose development includes
several optimization tests [11]. To maximize reproducibility, all
steps should be performed at a controlled room temperature
(20 °C) unless otherwise stated. Perform all tasks related to the
preparation of PCR mixes and manipulation of DNA extracts in a
sterilized PCR workstation using refrigerated platforms to avoid
the degradation of the extracts and the accidental activation of the
amplification enzymes.

3.1 In Silico Analysis 1. Consult the NCBI database, and select regions (gene or mRNA
sequences) for the potential discrimination of the target species
(Anacardium occidentale) (see Note 8). Look for local simila-
rities with orthologue genes/sequences using the BLASTn
algorithm (see Note 9).
2. Design primers and hydrolysis probe, either manually or using
primer designing tools, such as Primer-BLAST (https://www.
ncbi.nlm.nih.gov/tools/primer-blast/) (see Note 10). Check
the properties of primers and hydrolysis probe (physicochemi-
cal parameters, absence of hairpins, 3′-complementary and self-
annealing) using specific algorithms (e.g., OligoCalc: Oligonu-
cleotide Properties Calculator, http://biotools.nubic.north
western.edu/OligoCalc.html). Verify the specificity of the
designed primers and hydrolysis probe with target and nontar-
get sequences using the software Primer-BLAST (see Note 11).
3. Order primers (Ana 3-F, AGGTACGTGAAGCAGGAGGT
CCA and Ana3-R, GCTGCAGCTGCCTCACCATTTG) and
hydrolysis probe (Ana3-P, FAM-AAAGCTTGAGGGAATGC
TGCCAGGAGTT -BHQ1) [11] synthesis in specialized
outsourced facilities (e.g., Eurofins Genomics, Ebersberg,
Germany), which might take up to 1 week, depending on the
selected production facility.
 Real-Time PCR for Allergenic Food Detection 91

3.2 Preparation of Although some reference materials have been proposed by the
Model Foods Standard Reference Materials Program of the National Institute
of Standards and Technology (NIST, Gaithersburg, USA) for
food allergen analysis, they are still in a development phase, and
none of them can mimic real foods. Therefore, for method devel-
opment, the preparation of reference/model foods is a crucial step.
Herein, it is provided an example of a model food based on biscuits
containing known amounts of cashew nut [11]:
1. Prepare a dough matrix using the following ingredients and
recipe, namely, 225 g of wheat flour (Triticum aestivum),
100 g of sugar, 90 g of butter, and 50 mL of milk.
2. Ground cashew nut into a fine powder of approximately
0.3 mM of diameter in a laboratory knife mill.
3. Prepare the model reference foods with concentrations
of 100,000 mg/kg, 50,000 mg/kg, 10,000 mg/kg,
5000 mg/kg, 1000 mg/kg, 500 mg/kg, 100 mg/kg,
50 mg/kg, 10 mg/kg, 5 mg/kg, 1 mg/kg, (w/w) of cashew
nut in the dough. Add 30 g of cashew nut to 270 g of dough to
prepare the first model mixture of 10% (100,000 mg/kg).
Prepare the following concentrations by serial additions of
dough until the level of 0.0001% (1 mg/kg).
4. Divide each mixture into two portions. Immediately store one
portion at -20 °C to serve as raw model foods, while the
second portion should be oven-baked at 180 °C for 20 min
to simulate the production of biscuits. After cooling, ground
the biscuits to a fine powder of approximately 0.3 mM of
diameter with a laboratory knife mill, and store at -20 °C
until DNA extraction.

3.3 DNA Extraction The selection of an appropriate protocol to extract DNA from
foods with high purity and yield is a critical step for the successful
development of real-time PCR methods. Firstly, the DNA extrac-
tion protocol should be selected according to the composition of
the food(s) to be analyzed. This might require testing several DNA
extraction protocols. The NucleoSpin Food Kit (Macherey-Nagel,
Düren, Germany) has proved to be appropriate for most food
matrices, thus being the recommended protocol for the detection
of allergenic species. Herein, it is described its protocol according
to manufacturer’s instructions with minor alterations (see Note 5):
1. Weigh approximately 200 mg of material (raw dough or
grounded (model) food) in a 2.0 mL sterile reaction tube.
Add 550 μL of CF buffer (preheated at 65 °C) to each tube
and 10 μL of proteinase K (10 mg/mL) solution, vortex vigor-
ously, and incubate for 1 h at 65 °C in the thermomixer
(~1000 rpm). Vortex occasionally (every 15–20-min interval)
during incubation.
92 Joana Costa et al.

2. After lysis incubation, add 2–5 μL of RNase A (2 mg/mL) and

incubate for 5 min at room temperature (see Note 12).
3. Centrifuge the tubes at 4 °C, 17,000 × g for 10 min and
remove the supernatant carefully to a new tube. Perform a
second centrifugation in the same conditions but for 5 min
(see Note 13).
4. Transfer the supernatant to a new 2.0 mL sterile reaction tube,
and add similar volume of C4 and ethanol (e.g., if 450 μL of
supernatant is transferred, add 450 μL of C4 buffer and 450 μL
of ethanol 100%). Mix gently by pipetting or tube inversion
and transfer all volume to the NucleoSpin Food column. Cen-
trifuge for 1 min at 11,000 × g (room temperature), and
discard the flowthrough (the column has a maximum capacity
of 700 μL, so repeat loading until the total volume of sample
has passed the column).
5. Wash the silica membrane (NucleoSpin Food column) with
400 μL of CQW, 700 μL and 200 μL of C5, respectively, and
centrifuge for 1 min (11,000 × g, room temperature) after each
wash or 2 min after the final wash, discarding the supernatant
after each centrifugation. Ensure that the column is dry after
the final centrifugation (residues of ethanol will inhibit DNA
polymerase).
6. After the washing steps, place the column in a new 1.5 mL
sterile reaction tube, and add 100 μL of elution buffer
(CE) (5 mM Tris–HCl, pH 8.5) preheated at 70 °C. Incubate
for 5 min and elute DNA through 1-min centrifugation
(11,000 × g, room temperature) (see Note 14).

3.4 Determination of 1. Use a microplate reader UV/Vis spectrophotometer with

DNA Yield and Purity microvolume plate accessory for nucleic acid quantification.
Calibrate the microvolume plate accessory (16 wells) with
4 μL of pure water (e.g., PCR water) and validate the assay.
2. Add 4 μL of each DNA extract (in duplicate) to each spot of the
microvolume plate accessory, and read the absorbencies at
230, 260, 280, and 320 nM. The purity and yield of each
DNA extract will be automatically assessed, following the
nucleic acid quantification protocol with sample type defined
for dsDNA.
3. Dilute DNA extracts to a specific concentration (for extracts
from allergenic foods, a final DNA concentration of
50–100 ng/μL is highly recommended). Store DNA extracts
and dilutions at -20 °C until analysis.
 Real-Time PCR for Allergenic Food Detection 93

3.5 Qualitative PCR 1. Prepare the PCR mix for a total volume of 25 μL by mixing all
the components needed for the specified reaction. Add
PCR-grade water (adjust the volume considering the total
amount of remaining reagents), 2.5 μL of buffer 10×, 2.0 μL
of 10 mM of dNTP, 3.0 μL MgCl2 (3.0 mM), 7.0 μL of each
primer (Ana3-F/Ana3-R) (280 nM), and 0.2 μL of SuperHot
Taq DNA polymerase (1.0 U).
2. Add 23 μL of the reaction mix and 2 μL of DNA extract
(100–200 ng) in each 0.2 mL reaction tube. Include a positive
(DNA from target species) and a negative (no DNA template)
control in the PCR amplification.
3. Set the temperature program in the thermal cycler, which was
previously optimized [11]: initial denaturation at 95 °C for
5 min; 40 cycles at 95 °C for 30 s, 65 °C (Ana3-F/ Ana3-R)
for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for
5 min.
4. Prepare a 1.5% agarose gel stained with GelRed 1× (Biotium
Inc., Hayward, CA, USA) to visualize the amplicons. Mix
20 μL of the PCR product with 4 μL of loading buffer, apply
to gel wells, and run electrophoresis using SGTB 1× (Grisp,
Porto, Portugal) for 25–30 min at 200 V. For each gel, use a
DNA marker (e.g., DNA 100 bp marker, Bioron GmbH,
Römerberg, Germany) according to the size of expected PCR
products. Add 4 μL of loading buffer to unstained DNA mar-
kers and load to each gel.
5. Visualize the agarose gel with a UV light tray and the Gel Doc
EZ Imager using the GelRed dye protocol. Register a digital
image with Image Lab software version 5.2.1 and analyze the
results.

3.6 DNA Sequencing It is highly recommended to confirm the size and sequence of the
amplified PCR products, especially if primers are previously
designed in mRNA sequences [10] (see Note 8). Therefore, the
amplicons should be analyzed by Sanger sequencing that can be
easily outsourced. Prior to sequencing, it is recommended a clean-
ing step of PCR products, which can be performed according to the
following steps:
1. Go to Subheading 3.5 “Qualitative PCR,” and execute the
described steps to obtain the PCR products from the template
species (e.g., cashew nut, pistachio nut) (see Note 15).
2. Use a PCR Purification Kit to remove the interferents that are
present in the amplified PCR products (e.g., remaining com-
ponents of amplification reaction like primers, dNTP, enzyme).
Perform amplicon purification according to manufacturers’
instructions (see Note 16).
94 Joana Costa et al.

3. Place the purified PCR products into two sterile reaction tubes,
and add primer-F or primer-R (e.g., Ana3-F or Ana3-R) to the
respective tube (this will ensure sequencing both strands in the
opposite directions of each target amplicon). Tag each tube,
and send them to a specialized research facility (Eurofins Geno-
mics, Ebersberg, Germany) for direct Sanger sequencing (see
Note 17).
4. Verify the quality of the electropherograms using an appropri-
ate software (e.g., FinchTV 1.4 software, Geospiza Inc.,
https://digitalworldbiology.com/FinchTV). Analyze the
PCR electropherograms and align the high-resolution/quality
product sequences with the consensus sequence. For sequence
alignment, use a sequence alignment tool/software like BIOE-
DIT v7.2 (Biological Sequence Alignment Editor, https://
bioedit.software.informer.com/versions/) or MEGA (Molec-
ular Evolutionar y Genetics Analysis, https://www.
megasoftware.net/) (see Note 18).
5. Critically analyze the sequencing data, assessing the size and
nucleotide identity, and compare it with the consensus
sequence.

3.7 Real-Time PCR When performing a real-time PCR run, the components of
with Hydrolysis Probe the reaction mixture, namely, the amounts of primers/probe and
template DNA, should be previously adjusted, as well as the tem-
perature program that should be appropriate for each primer/
probe set (see Note 19). The following steps were previously
evaluated and defined when developing a real-time PCR approach
for the detection of Ana o 3-encoding gene [11] using the CFX96
Real-Time PCR System and respective software (Subheading 2.3)
(see Note 20):
1. Open the startup wizard of Bio-Rad CFX Manager 3.1, and
define the program of temperatures (protocol total duration
<100 min): initial step at 95 °C for 5 min, 50 cycles at 95 °C
for 15 s and 65 °C for 45 s, with the collection of fluorescence
signal at the end of each cycle (Fig. 2a) (see Notes 21 and 22).
2. Prepare the plate, by selecting the correct fluorophore (FAM),
the plate type (white for white strips/plate), and the unit
(define “percent” if using model foods). Set the number of
samples and respective replicates (three to four replicates per
sample by run are recommended), and define their place in the
plate (Fig. 2b) (see Note 23). Define the standards and provide
correct concentrations of the target species. Unknown samples
or blind mixtures should be defined as “Unknown.” A negative
control (no DNA template) per gene target should be added to
each run.
 Real-Time PCR for Allergenic Food Detection 95

Fig. 2 Real-time PCR temperature program for the amplification of cashew nut targeting the Ana o 3-encoding
gene (a); example of a real-time PCR plate defining the calibrators as standards and the blind samples as
unknown samples (negative control included) (b)
96 Joana Costa et al.

3. Prepare the reaction mixture by adding the components neces-

sary for all tubes/wells (prepare reaction mixture for one or
two additional tubes/wells to ensure enough volume due to
the losses from the viscosity of the master mix). Add
PCR-grade water (adjust volume according to the amounts of
other reagents), 1× of SsoAdvanced™ Universal Probes Super-
mix (10 μL), primers Ana3-F/R (400 nM), and hydrolysis
probe Ana3-P (250 nM) for a total of 20 μL of reaction volume
(see Note 24).
4. Calculate the number of wells and place the tube strips
(or plate) accordingly, and add 18 μL of the reaction mixture
in each tube/well and 2 μL of DNA extract (100 ng). Include a
negative control (no DNA template) in each run (mandatory).
Close the tubes/wells and ensure the caps are clean (the fluo-
rescence signal is acquired vertically by the caps). Use a PCR
spinner to guarantee a full homogeneity of the reaction mix-
ture, and make sure that all volume is at the bottom of the
wells. Frame the tube strips (or plate) on the real-time PCR
instrument and start the run.
5. Use the Bio-Rad CFX Manager 3.1 software to analyze the data
by defining the baseline threshold level (automatic defined
threshold level is often the best option) (see Note 25).
Figure 3a, b provides an example of amplification curves and
respective calibration curve of real-time PCR targeting Ana o
3 allergen-encoding gene using model mixtures of cashew nut
in biscuits. The obtained calibration curve shows adequate
performance parameters (correlation coefficient of 0.993,
slope of -3.255, and PCR efficiency of 102.9%), limit of
detection (LOD), and limit of quantification (LOQ) of
0.005% (50 mg/kg of cashew nut in biscuits), with a dynamic
range covering 3.5 log10 concentrations, confirming that all
parameters are within the criteria of acceptance for this type of
assays (see Note 26) [22, 23].

3.8 Real-Time PCR 1. Perform the real-time PCR assays using the same conditions as
Validation described in Subheading 3.7, running the calibrators (model
mixtures of biscuits containing known amounts of cashew nut)
to construct the calibration curve, along with blind samples
(as theoretical unknown samples). Use three to four replicates
per blind sample and per standard.
2. Perform all the calculations necessary to determine the LOD,
LOQ, dynamic range, precision (coefficient of variation
(CV) or relative repeatability standard deviation (RSDr)), true-
ness (bias), and robustness of the method, as well as other
important parameters [22, 23] (see Note 26).
 Real-Time PCR for Allergenic Food Detection 97

Fig. 3 Real-time amplification curves (a) and respective calibration curve (b) targeting Ana o 3 gene using
reference model mixtures of biscuits containing known amounts of cashew nut (100,000 to 10 mg/kg) (n = 4
replicates per run)

4 Notes

1. Solutions may also be prepared with ultrapure or deionized

water, following autoclaving before use.
2. DNA/RNA cleaning solutions, such as DNA/RNA-Exitus-
Plus™ (AppliChem GmbH, Darmstadt, Germany), should be
98 Joana Costa et al.

used to clean the laboratory benches and PCR workstations, as

well as other instruments (e.g., electrophoresis apparatus, pip-
ettes, etc.).
3. When targeting allergen-encoding sequences, it is highly
recommended to consult the ALLERGEN Nomenclature
(http://www.allergen.org/), which is a database that gathers
information on the identified allergens and links the accession
numbers from NCBI and UniProt databases.
4. Other advanced criteria can also be defined (e.g., primer size,
primer CG content, among others). Besides Primer-BLAST,
there are other online free programs specialized in primer
design, namely, PCR Primer Design Tool (https://
eurofinsgenomics.eu/en/ecom/tools/pcr-primer-design/).
Primers can also be manually designed following specific guide-
lines, such as those presented in PCR Primer Design Tips
(https://www.thermofisher.com/blog/behindthebench/pcr-
primer-design-tips/).
5. Depending on the target allergenic food and the type of
matrix/processing state, different DNA extraction methods
can be used. To extract DNA from allergenic foods, it is highly
recommended to use commercial kits, although in-house
developed extraction protocols might constitute appropriate
choices. Most of the commercial kits have protocols containing
lysis buffers with cationic (cetyltrimethyl ammonium bromide,
CTAB) or anionic (sodium dodecyl sulfate, SDS) detergents,
which might be combined with solid-phase silica-based mem-
branes, thus improving DNA washing steps and subsequent
recovering of high-purity/quality DNA extracts. Normally,
DNA extracts from commercial kits have higher-yield/purity
than those extracted with in-house developed methods. For
the efficient extraction of DNA from allergenic foods, commer-
cial kits like DNeasy mericon Food Kit (Qiagen, Hilden, Ger-
many), NucleoSpin Food Kit (Macherey-Nagel, Düren,
Germany), or SureFood® PREP Advanced (R-Biopharm AG,
Darmstadt, Germany) can be recommended.
6. There are other options for real-time PCR mixes, such as
QuantiNova Probe PCR Kit (Qiagen, Hilden, Germany).
7. The use of a UV/Vis spectrophotometer with microvolume
measurement allows the direct determination of the DNA
extract concentration and purity, using a limited amount of
extract (2–4 μL) and avoiding unnecessary dilutions/manipu-
lations. Presently, there are several systems based on the nano-
drop (e.g., NanoDrop™ 2000, Thermo Fisher Scientific,
Delaware, USA), which is a well-known equipment for these
determinations using just 1–2 μL of extract. However, the
systems combined with microplate reading, despite using
 Real-Time PCR for Allergenic Food Detection 99

higher extract volumes (minimum suggested volume of 4 μL),

are recommended because they allow simultaneous determina-
tions of at least 16 extracts, depending on the available plate.
The herein referred UV/Vis spectrophotometer microplate
reader (SPECTROstar Nano, BMG Labtech GmbH, Orten-
berg, Germany) is combined with a plate of microvolume
(BMG LVis MicroDrop) defined for double-stranded nucleic
acids (dsDNA) and a software for data analysis (MARS Data
Analysis software, BMG Labtech GmbH, Ortenberg, Ger-
many). To ensure precise measurements, each extract should
be read in duplicate with a volume of 4 μL.
8. Unicopy genes or mRNA regions encoding for allergens are
normally appropriate sequences for designing specific primers.
However, mRNA regions only comprise exons (introns were
previously spliced by RNA polymerases during transcription),
which means that the designed primers might hybridize on an
exon or intron or on a transition region(s), thus increasing the
chances of producing amplicons with unexpected size (or even
no amplicon at all). Therefore, it is mandatory to experimen-
tally test them, followed by sequencing and alignment with the
consensus sequence [10].
9. It is important to compare the target sequence with others
from relevant species, especially the closely related ones because
of their most likely sequence similarity. In the specific case of
cashew nut, high sequence similarity is common with mango
(Mangifera indica) and pistachio nut (Pistacia vera), which
means that the in silico evaluation of cashew nut sequences
with these two species must be carefully conducted.
10. Several online platforms allow designing primers, such as
Primer3 (https://primer3.ut.ee/), GenScript Online PCR Pri-
mers Designs Tool (https://www.genscript.com/tools/pcr-
primers-designer), Eurofins Genomics’ PCR Primer Design
Tool (https://eurofinsgenomics.eu/en/ecom/tools/pcr-
primer-design/), and Primer3Plus (https://www.bioinformat
ics.nl/cgi-bin/primer3plus/primer3plus.cgi). When design-
ing the primers and/or hydrolysis probe manually, the
following criteria/tips should be considered: (i) the length of
the primers ranging 18–24 bp, with 40–60% G/C content
(3′-ending with a C or G promotes higher binding);
(ii) avoid more than 1 or 2 G/C pairs at the 3′- and 5′-ends;
(iii) the ideal temperature of melting (Tm) of primers should
range 60–65 °C, although Tm closer to 65 °C provides more
specific amplifications; (iv) the pair of primers should have
closely matched Tm to maximize PCR product formation
(difference of Tm < 2 °C between primers); (v) avoid runs
with four or more base or dinucleotide repeats (e.g., ACCCC
or ATATATAT); (vi) primer pairs should not have
100 Joana Costa et al.

complementary regions to avoid self-annealing; (vii) design

hydrolysis probe close to the forward or reverse primer, but
ensuring no overlapping; (viii) the hydrolysis probe should not
have a G-base at the 5′-end to avoid quenching the fluoro-
phore; and (ix) the hydrolysis probe should have a Tm of
8–10 °C above the Tm of primers [24, 25].
11. For successful real-time PCR protocols, small-length ampli-
cons should be targeted (ideally 90–200 bp), although higher
length fragments can also be used. Consider designing primers
that anneal at high temperatures (~65 °C). Label the hydrolysis
probe with a fluorophore (fluorescein, 6-FAM) and an appro-
priate quencher (BHQ1—black hole quencher 1). Other fluor-
ophores and quenchers might also be used, although both
must be combined considering their absorption range wave-
lengths (e.g., ATTO 590/BHQ-2).
12. The addition of RNase A is recommended because the elimi-
nation of RNA improves the purity (A260/A280 of 1.7–2.0)
and stability of the DNA extract, thus enabling the amplifica-
tion efficiency by both qualitative PCR and real-time PCR. The
incubation time and concentration of RNase A should be
experimentally adjusted according to the type of sample
because it also degrades DNA.
13. This step allows removing particles in suspension that might
hamper the DNA binding to the C4 buffer (DNA-binding
solution) and to the silica membrane.
14. The elution of DNA from the column might also be performed
by adding TE (10 mM Tris–HCl, 1 mM EDTA, pH 8.0).
Adjust the volume of the elution buffer to increase the final
concentration or the total volume of the DNA extract.
15. Before purifying PCR amplicons for sequencing, it is highly
recommended to perform electrophoresis in 1.5% agarose gel
to confirm PCR amplification (using only 2 μL of the amplified
product) following the instructions described in Subheading
3.5 Qualitative PCR.
16. GRS PCR & Gel Band Purification Kit (Grisp, Porto, Portu-
gal) and QIAquick PCR Purification Kit (Qiagen, Hilden,
Germany) are two examples of PCR purification kits that may
be used prior to Sanger sequencing.
17. The service of Sanger sequencing can be requested in different
forms, such as the acquisition of prepaid barcodes that are used
to label each tube, thus enabling an unequivocal identification
of each sequenced PCR product.
18. Online alignment tools might also be used (e.g., Clustal
Omega Multiple Sequence Alignment, https://www.ebi.ac.
uk/Tools/msa/clustalo/).
 Real-Time PCR for Allergenic Food Detection 101

19. For the development of a real-time PCR method, the reac-

tional components and the temperature program should be
optimized. For this purpose, a previous study on the quantity
of primers and the optimal annealing temperature can be per-
formed by qualitative PCR, thus allowing to reduce the costs
associated with the optimization by real-time PCR.
20. Other real-time PCR instruments (e.g., QuantStudio 6 or
7 Pro Real-Time PCR Systems, Applied Biosystems, Thermo
Fisher Scientific, Waltham, MA, USA) and respective software
(e.g., QuantStudio Design and Analysis 2, Applied Biosystems,
Thermo Fisher Scientific, Waltham, MA, USA) might also
be used.
21. The software has a Protocol Autowriter that allows to simulate
the best protocol of temperatures and cycle duration, accord-
ing to the amplicon length, primers’ composition (sequence),
and the type of master mix (enzyme) used. Normally, the
proposed protocol is near the experimentally determined by
qualitative PCR.
22. Depending on the master mix, other conditions might be used,
such as defining an initial step at 98 °C for 1 min (as often
recommended by the master mix). However, based on our
experience on the development of real-time PCR methods for
allergenic species detection, using an initial step at 95 °C for
5 min allows a good activation of the enzyme and correct
denaturation of the DNA helices.
23. Other type of strips and plates might be used, such as the
standard clear/transparent strips/plates, although the use of
white ones is highly recommended for real-time PCR as they
reduce the background noise and enhance the fluorescence
intensity.
24. The quantities of primers and probe should be experimentally
determined, considering that the probe concentration should
be set as half or 2/3 of the concentration of the primers
(previously determined by qualitative PCR).
25. If two or more runs will be considered for performing calcula-
tions in terms of Cq values, the baseline threshold level should
be set equal for all runs. Presently, most thermocyclers have
adopted the designation of the cycle of quantification (Cq),
although cycle threshold (Ct) is still often used, as they have
the same meaning.
26. Real-time PCR performance parameters must comply with the
acceptance criteria established for this type of assays
[22, 23]. Accordingly, PCR efficiency should be between 90%
and 110%, the slope within -3.6 and -3.1, and the correlation
coefficient (R2) ≥ 0.98. The LOD should be defined as the
lowest concentration level of the analyte with positive
102 Joana Costa et al.

amplification at least 95% of the time, while the LOQ corre-

sponds to the lowest amplified level within the linear dynamic
range of the calibration curve. The dynamic range should cover
at least 3 orders of magnitude and should ideally extend to 5 or
6 log10 concentrations. For method validation, values of CV
(precision) should be ≤25%, while the criterion of acceptance
for bias (trueness) is ±25% of the actual value.

Funding
This work was funded by national funds (FCT, Fundação para a
Ciência e Tecnologia) through project Hypoallergen (PTDC/
BAA-AGR/4005/2021) and the strategic funding of UIDB/
50006/2020|UIDP/50006/2020 from FCT/MCTES and the
European Union (EU) through European Regional Development
Fund (FEDER funds through NORTE-01-0145-FEDER-
000052). This work was also supported by project SYSTEMIC
which received funding from national research funding parties in
a joint action of JPI HDHL, JPI-OCEANS, and FACCE-JPI
launched in 2019 under the ERA-NET ERA-HDHL (n°
696295). JC and IM thank FCT for funding through the Individ-
ual Call to Scientific Employment Stimulus (2021.03583.CEE-
CIND/CP1662/CT0012 and 2021.03670.CEECIND/
CP1662/CT0011, respectively).

References
1. Michelet M, Balbino B, Guilleminault L, Reber 4. Holzhauser T (2018) Protein or no protein?
LL (2021) IgE in the pathophysiology and Opportunities for DNA-based detection of
therapy of food allergy. Eur J Immunol 51(3): allergenic foods. J Agric Food Chem 66(38):
531–543. https://doi.org/10.1002/eji. 9889–9894. https://doi.org/10.1021/acs.
202048833 jafc.8b03657
2. Sicherer SH, Sampson HA (2018) Food 5. Costa J, Fernandes TJR, Villa C, Oliveira
allergy: a review and update on epidemiology, MBPP, Mafra I (2017) Advances in food aller-
pathogenesis, diagnosis, prevention, and man- gen analysis. In: Spizzirri G, Cirillo G (eds)
agement. J Allergy Clin Immunol 141(1): Food safety: innovative analytical tools for
41–58. https://doi.org/10.1016/j.jaci.2017. safety assessment. Wiley, Hoboken, NJ, pp
11.003 305–360
3. Regulation (EU) No 1169/2011 of 6. Holzhauser T, Johnson P, Hindley JP,
25 October 2011 on the provision of food O’Connor G, Chan C-H, Costa J et al (2020)
information to consumers, amending Regula- Are current analytical methods suitable to ver-
tions (EC) No 1924/2006 and (EC) No ify VITAL® 2.0/3.0 allergen reference doses
1925/2006 of the European Parliament and for EU allergens in foods? Food Chem Toxicol
of the Council, and repealing Commission 145:111709. https://doi.org/10.1016/j.fct.
Directive 87/250/EEC, Council Directive 2020.111709
90/496/EEC, Commission Directive 1999/ 7. Costa J, Amaral JS, Grazina L, Oliveira MBPP,
10/EC, Directive 2000/13/EC of the Mafra I (2017) Matrix-normalised real-time
European Parliament and of the Council, PCR approach to quantify soybean as a poten-
Commission Directives 2002/67/EC and tial food allergen as affected by thermal proces-
2008/5/EC and Commission Regulation sing. Food Chem 221:1843–1850. https://
(EC) No 608/2004., L304 doi.org/10.1016/j.foodchem.2016.10.091
 Real-Time PCR for Allergenic Food Detection 103

8. Costa J, Mafra I, Kuchta T, Oliveira MBPP the novel single-tube nested real-time PCR for
(2012) Single-tube nested real-time PCR as a the detection of walnut allergens in sponge
new highly sensitive approach to trace hazel- cakes. Food Res Int 54(2):1722–1729.
nut. J Agric Food Chem 60(33):8103–8110. https://doi.org/10.1016/j.foodres.2013.
https://doi.org/10.1021/jf302898z 09.047
9. Costa J, Oliveira MBPP, Mafra I (2013) Novel 18. Köppel R, Velsen-Zimmerli F, Bucher T
approach based on single-tube nested real-time (2012) Two quantitative hexaplex real-time
PCR to detect almond allergens in foods. Food PCR systems for the detection and quantifica-
Res Int 51(1):228–235. https://doi.org/10. tion of DNA from twelve allergens in food. Eur
1016/j.foodres.2012.12.006 Food Res Technol 235(5):843–852. https://
10. Costa J, Silva I, Villa C, Mafra I (2023) A novel doi.org/10.1007/s00217-012-1806-8
single-tube nested real-time PCR method to 19. Waiblinger H-U, Boernsen B, Geppert C,
quantify pistachio nut as an allergenic food: Demmel A, Peterseil V, Koeppel R (2017)
influence of food matrix. J Food Compost Ring trial validation of single and multiplex
Anal 115:105042. https://doi.org/10.1016/ real-time PCR methods for the detection and
j.jfca.2022.105042 quantification of the allergenic food ingredi-
11. Costa J, Villa C, Grazina L, Mafra I (2022) ents mustard, celery, soy, wheat and rye. J Con-
Single-tube nested real-time PCR versus nor- sum Prot Food Saf 12(1):55–72. https://doi.
malised real-time PCR for the quantification of org/10.1007/s00003-016-1063-z
allergenic cashew nut in foods: impact of ther- 20. Waiblinger H-U, Boernsen B, N€aumann G,
mal processing and matrix. Food Chem 397: Koeppel R (2014) Ring trial validation of single
1 3 3 7 7 8 . h t t p s :// d o i . o r g / 1 0 . 1 0 1 6 / j . and multiplex real-time PCR methods for the
foodchem.2022.133778 detection and quantification of the allergenic
12. Fernandes TJR, Costa J, Oliveira MBPP, Mafra food ingredients sesame, almond, lupine and
I (2018) Exploiting 16S rRNA gene for the Brazil nut. J Verbr Lebensm 9(3):297–310.
detection and quantification of fish as a poten- https://doi.org/10.1007/s00003-014-
tial allergenic food: a comparison of two real- 0868-x
time PCR approaches. Food Chem 245:1034– 21. Waiblinger H-U, Geppert C, Bartsch D,
1041. https://doi.org/10.1016/j.foodchem. Neumann K, Hochegger R, Peterseil V et al
2017.11.068 (2022) Collaborative trial validation of a new
13. Fernandes TJR, Costa J, Oliveira MBPP, Mafra multiplex real-time PCR to sensitively detect
I (2018) A new real-time PCR quantitative allergenic nuts in food. J Consum Prot Food
approach for the detection of shrimp crusta- Saf 17(3):265–277. https://doi.org/10.
ceans as potential allergens. J Food Compost 1007/s00003-022-01385-x
Anal 72:7–14. https://doi.org/10.1016/j. 22. Bustin SA, Benes V, Garson JA, Hellemans J,
jfca.2018.05.012 Huggett J, Kubista M et al (2009) The MIQE
14. Villa C, Costa J, Gondar C, Oliveira MBPP, guidelines: minimum information for publica-
Mafra I (2018) Effect of food matrix and ther- tion of quantitative real-time PCR experi-
mal processing on the performance of a nor- ments. Clin Chem 55(4):611–622. https://
malised quantitative real-time PCR approach doi.org/10.1373/clinchem.2008.112797
for lupine (Lupinus albus) detection as a poten- 23. ENGL (2015) Definition of minimum perfor-
tial allergenic food. Food Chem 262:251–259. mance requirements for analytical methods of
https://doi.org/10.1016/j.foodchem.2018. GMO testing. European network of GMO
04.079 laboratories, Joint Research Center, EURL.
15. Villa C, Costa J, Mafra I (2019) Detection and Available online at http://gmo-crl.jrc.ec.
quantification of milk ingredients as hidden europa.eu/doc/MPR%20Report%20Applica
allergens in meat products by a novel specific tion%2020_10_2015.pdf. Accessed Dec 2022
real-time PCR method. Biomol Ther 9(12): 24. Rodrı́guez A, Rodrı́guez M, Córdoba JJ,
804. https://doi.org/10.3390/biom912 Andrade MJ (2015) Design of primers and
0804 probes for quantitative real-time PCR
16. Villa C, Costa J, Mafra I (2023) Detection and methods. In: Basu C (ed) PCR primer design,
quantification of white and black sesame as vol 1275. Springer, New York, pp 31–56
potential allergenic ingredients in processed 25. Primer Design Tips. Available from: https://
foods: a comparative gene marker study. Food www.thermofisher.com/pt/en/home/life-sci
Control 145:109449. https://doi.org/10. ence/oligonucleotides-primers-probes-genes/
1016/j.foodcont.2022.109449 custom-dna-oligos/oligo-design-tools.html.
17. Costa J, Oliveira MBPP, Mafra I (2013) Effect Accessed Dec 2022
of thermal processing on the performance of
 Chapter 9

Accurate Absolute Quantification of Bacterial Populations

in Mixed Cultures by qPCR
Ângela Lima, Lúcia G. V. Sousa, and Nuno Cerca

Abstract
Quantitative PCR (qPCR) is a well-established technique that allows to accurately quantify nucleic acids or
proteins, being widely used in several types of biological samples for bacterial load quantification. However,
there are many recent studies that do not consider the potential pitfalls involved in key experimental qPCR
stages, namely, those related to the extraction and purification of genomic DNA and to the thermal
amplification process, that can lead to biased results in mixed cultures. Herein, we outline a proper protocol
for bacterial quantification by qPCR, addressing how to overcome the main issues in that methodology.

Key words qPCR, DNA extraction, Exogenous control, Bacterial populations, Calibration curves,
Reaction efficiency

1 Introduction

Quantitative PCR (qPCR) is a molecular method whereby the

fluorescence signal of a specific or unspecific probe is monitored,
in real time, and its intensity correlates with the amount of DNA
being amplified [1]. This technique is extensively used to quantify
bacteria [2], gene expression [3], and proteins [4], due to its
affordability, accuracy [5], and ease of use [6]. An interesting
application of qPCR is the ability to detect and quantify bacterial
populations in mixed cultures by targeting specific species genomic
regions [7]. Despite its widespread utilization, there are still many
studies that do not take into account the drawbacks of this quanti-
fication technique, which can lead to inconsistent results [8]. qPCR
includes two main critical steps, namely, (i) the DNA extraction and
purification step and (ii) the nucleic acids thermal amplification
process. The first step has been reported as the main source of
post-processing variability [9], as several studies have shown that
genomic DNA (gDNA) extraction efficiencies can vary significantly
between experiments [10–12]. Therefore, it is of utmost

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_9,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

105
106 Ângela Lima et al.

importance to quantify gDNA loss during the extraction process in

order to properly normalize the extraction efficiency between sam-
ples [13]. Furthermore, when performing the thermal amplifica-
tion, it is absolutely essential to experimentally assess the reaction
efficiency [14], which is normally determined by performing serial
dilutions of a specific DNA sample, for each primer set used
[15]. While this step is essential for any qPCR run, it should not
be confused as a calibration curve to correlate fluorescence signal
intensity with initial bacterial load [13]. For bacterial quantification
by qPCR, a proper calibration curve requires extraction of gDNA
from pure cultures, prepared at different bacterial concentrations,
in order to assess differences in gDNA extraction efficiency, at
different bacterial loads [16].
Here, we demonstrate how to perform an adequate bacterial
quantification of mixed cultures using qPCR. For the purposes of
this protocol, a triple-species microbial culture, simulating a bacte-
rial vaginosis biofilm [17], was characterized, and three pure cul-
tures of each individual species were used for the determination of
the bacterial calibration curves.

2 Materials

2.1 Culture Media 1. Bacterial species (see Note 1).

and Bacterial Species 2. Appropriate growth media for the bacterial species to be used
(see Note 2).
3. 10× PBS, pH 7.4 ± 0.05: weigh 4 g of NaCl, 0.1 g of KCl,
0.1 g of KH2PO4, and 0.575 g of Na2HPO4, and transfer to a
glass bottle. Add 500 mL of deionized water to the glass bottle.
Mix and adjust pH with HCl. Store at room temperature.
4. Spectrophotometer.

2.2 Genomic DNA 1. Commercial silica-based gDNA extraction kit (see Note 3).
Extraction 2. Ice.
3. DNase-free water.
4. Silica beads (see Note 4).
5. 2 mL microcentrifuge tubes with caps.
6. 2 mL collection tubes.
7. Vortex.
8. Centrifuge.
9. Microtube cell disrupter (see Note 5).
 Proper Bacteria Quantification by qPCR 107

2.3 qPCR Material 1. Any commercial qPCR SYBR master mix (see Notes 6 and 7).
2. DNase-free water.
3. Primers (see Notes 8 and 9).
4. qPCR 96-well plates, low profile.
5. qPCR plate seals.
6. qPCR instrument: thermocycler with fluorescence detector.

3 Methods

3.1 Preparation of 1. Grow the target bacterial species for the required incubation
Bacterial Cultures for conditions until the needed cell density is achieved.
gDNA Calibration 2. Prepare pure cultures of each target bacterial species. Adjust the
Curves initial bacterial concentrations to a certain optical density
(OD), and confirm the bacterial concentration through
colony-forming units (CFUs) (see Note 10), by making
ten-fold serial dilutions of the adjusted suspension and plating
these dilutions on the appropriate solid medium. Incubate the
plates under adequate conditions and count the CFUs.
3. Prepare at least four dilutions from the initial concentration (see
Note 11), adjusted in the previous step, with PBS 1× in 2 mL
collection tubes. The volume of each dilution should be
900 μL; therefore, if the expected concentration values of the
targets are between 1 × 106 CFU/mL and 1 × 109 CFU/mL,
the bacterial cultures should be prepared with concentrations
between ~1.11 × 106 and ~ 1.11 × 109 CFU/mL, since the
final volume will be 1 mL (900 μL of target species +100 μL of
exogenous control).
4. Adjust the bacterial concentration of the exogenous control to
a certain OD, and confirm the bacterial concentration through
CFUs (see Note 10), by making tenfold serial dilutions of the
adjusted suspension and plating these dilutions on solid
medium. Incubate the plates under adequate conditions and
count the CFUs.
5. Add 100 μL of the exogenous control (see Note 12) with a
concentration of 1 × 109 CFU/mL to 900 μL of each prepared
concentration of the target bacteria, in a 2 mL collection tube.
The final concentration of the exogenous control will be
1 × 108 CFU/mL.
6. Centrifuge the 2 mL collection tubes at 16,000 × g for 10 min.
Completely remove the supernatant with a pipette tip and
freeze the pellets at -20 °C overnight (see Note 13).
108 Ângela Lima et al.

3.2 gDNA Extraction 1. Defrost the bacterial pellets prepared in Subheading 3.1, at
Using a Commercial room temperature.
Kit 2. Resuspend the bacterial pellets in the appropriate volume of the
lysis buffer that is supplied in the kit. Transfer the resuspended
bacteria to a microcentrifuge tube containing approximately
0.4 g of silica glass beads (see Note 14).
3. To lyse the cells, put the tubes with beads in a cell disrupter,
using 2 × 3 cycles of 30 s at maximum × g. Keep the samples on
ice between cycles, for 1 min.
4. Centrifuge the tubes at a maximum of 10,000 × g for 30 s.
5. Avoiding the glass beads, transfer the supernatant to a clean
2 mL collection tube provided.
6. Add 100 μL of an ethanol or isopropanol solution (or any other
solution that precipitates non-DNA organic and inorganic
material) to the supernatant, and vortex for 5 s. Incubate at
4 °C for 5 min.
7. Centrifuge the tubes at 10,000 × g for 1 min.
8. Avoiding the pellet, transfer the entire volume of supernatant
to a clean 2 mL collection tube (provided) (see Note 15).
9. Add 900 μL of a highly concentrated salt solution (washing
buffer 1) to the supernatant, and vortex for 5 s (see Note 16).
10. Add the maximum volume possible to the column (see Note
17) and centrifuge at 10,000 × g for 30 s. Discard the flow-
through, add the remaining supernatant to the silica column,
and centrifuge again at 10,000 × g for 30 s.
11. Add 300 μL of an ethanol-based wash solution (washing buffer
2), and centrifuge at 10,000 × g for 30 s (see Note 18).
12. Discard the flow-through. Centrifuge at 10,000 × g for 1 min.
13. Place the silica column in a new 2 mL collection tube (see Note
19).
14. Add 50 μL of DNase-free water to the center of the white filter
membrane.
15. Centrifuge at 10,000 × g for 30 s and discard the silica column.
16. The gDNA is now ready for downstream applications (see Note
20).

3.3 qPCR Efficiency 1. For each target bacterial species, dilute one gDNA sample
extracted from a pure culture, at least four ten-fold dilutions
in DNase-free water (see Note 21).
2. For each target species, prepare one reaction master mix
solution to a final individual qPCR of 10 μL (see Note 22), as
described in Table 1.
 Proper Bacteria Quantification by qPCR 109

Table 1
Description of the master mix preparation for a set of primers (see
Note 28)

Elements Volume (μL) Proportion

SYBR green master mix (see Note 29) 5 5×n+1
Forward primer (10 μM) (see Note 30) 0.5 0.5 × n + 1
Reverse primer (10 μM) (see Note 30) 0.5 0.5 × n + 1
DNase-free water 2 2×n+1
Total master mix solution volume 8 8×n+1

3. For each reaction (well), add 2 μL of the gDNA sample, diluted

1:10 in DNase-free water, and 8 μL of the master mix prepared
in step 2 (see Note 23).
4. Include one well of “no template control” (NTC) on the qPCR
96-well plate for each set of primers used. In this well, add 2 μL
of DNase-free water plus 8 μL of master mix (see Note 24).
5. Set up the qPCR thermocycler following the qPCR SYBR
Green master mix manufacturer instructions (see Note 25).
6. Analyze the melt curve to confirm the specificity of the reaction
amplicon (see Note 26).
7. Ensure that the reaction efficiency is 90–110% and that the
R2 > 0.9 (see Note 27).

3.4 qPCR Calibration 1. Start by extracting gDNA from the samples prepared as
Curve Construction for described in Subheading 3.1, using the method described in
Each Target Species Subheading 3.2.
2. Dilute all the DNA samples at least 1:10 (see Note 31), in
DNase-free water.
3. Repeat the steps 2–6 described in Subheading 3.3.
4. Add an inter-run calibrator to the qPCR 96-well plate (see
Note 32).
5. Normalize the results of the cycle threshold using the equation
ΔCT = 2ðCTtarget species - CTcontrol species Þ (see Note 33).
6. Construct the calibration curve “Relative quantification
(ΔCT),” as depicted in Fig. 1a.

3.5 Absolute 1. After collection of the polymicrobial samples, add the exoge-
Quantification of nous bacterial control, as described at the step 5, of the
Bacterial Species Subheading 3.1.
Concentration in
Polymicrobial Samples
110 Ângela Lima et al.

Fig. 1 Quantification of bacterial species concentration in polymicrobial samples. (a) calibration curves for
each species plotted with the relative quantification (ΔCT) vs bacterial concentration (CFU/mL). (b) bacterial
species concentration (CFU/mL) in a polymicrobial sample determined using the calibration curves

2. Centrifuge the samples at 16,000 × g for 10 min. Completely

remove the supernatant with a pipette tip and freeze the pellets
at -20 °C overnight.
3. Isolate the gDNA of the target biological sample, as described
in Subheading 3.2.
4. Run the samples in the qPCR instrument, as described in the
steps 2–4 of Subheading 3.3.
5. Normalize the results of cycle threshold, as described in the
previous item, step 5.
6. Determine the bacterial concentration of each species using the
respective calibration curve (Fig. 1b).

4 Notes

1. This protocol was used for the study of polymicrobial biofilms,

with species associated with bacterial vaginosis, including the
following bacteria: Gardnerella vaginalis, Fannyhessea vaginae,
Peptostreptococcus anaerobius, Prevotella bivia, Lactobacillus
iners, and Mobiluncus curtisii. Herein we report an example
of a triple-species biofilm. However, this protocol can be used
with other bacteria.
2. Any appropriated culture media can be used to grow the bac-
teria. It should not interfere with the downstream applications.
3. This protocol was tested with commercial extraction kits (with
silica-based columns) as well as with chemical lysis (phenol-
chloroform extraction). Herein we report the detailed protocol
 Proper Bacteria Quantification by qPCR 111

for silica-based columns extraction, since these kits are more

broadly used.
4. Some extraction kit does not contain silica beads. We recom-
mend buying them separately, as their use facilitates cell lysis.
This is particularly relevant when working with Gram-positive
bacteria.
5. There are many alternatives that can be used. In our experience,
the higher g forces involved, the better the lysis efficiency.
Vortexes adaptors are cheaper but not as efficient as dedicated
cell disrupters.
6. We choose a qPCR SYBR master mix because it is the most
commonly used, but other alternatives such as specific fluores-
cent probes can be used; however, they have a higher cost of
acquisition.
7. The qPCR SYBR master mix should be kept at -20 °C and
protected from the light when it is not being used.
8. Design primers that will bind specifically to one of the species
tested, but not the others. The primers can be freely designed
with NCBI Primer-BLAST. When performing that, have in
consideration that primer efficiency varies with temperature
and the enzyme used in the qPCR master mix. It’s advisable
to start the test at 60 °C and design the primers with a melting
temperature of 3–5 °C above 60 °C. The primers should have
identical melting temperatures, as well as the annealing tem-
peratures. The last one mentioned should be no more than 5 °
C below the first one to avoid nonspecific amplification. The
primer specificity should be confirmed first, and this can be
achieved using Primer-BLAST and then experimentally
determined.
9. The primers should be stored at -20 °C when they are not
being used.
10. The determination of bacterial concentration through CFUs
should only be used for bacteria that grow well on solid media
and that do not form viable but not culturable (VBNC) bacte-
ria. In case of doubt, this quantification may be confirmed by
flow cytometry.
11. Calibration curves must have a range of concentrations wide
enough to include the maximum and minimum values
expected in the biological system.
12. To quantify bacteria loss during the DNA extraction proce-
dure, it is necessary to add some exogenous control to the
samples, to normalize the results from qPCR runs. In this
sense, we used a bacterium that is unrelated to our target,
and it is added to the samples/pure cultures before the centri-
fugation step (step 4 of Subheading 3.1.), allowing to quantify
112 Ângela Lima et al.

bacteria loss during the procedure. The use of bacteria as

exogenous control has also been reported in some studies
[16, 20]. Choose a bacterium/bacteria biologically similar to
the bacteria in the target samples to use as exogenous control,
as the DNA extraction kit will be chosen based on this. If the
samples contain Gram-negative bacteria, choose a Gram-
positive bacterium as exogenous control, and if the samples
contain Gram-positive bacteria, choose a Gram-negative bac-
terium. If the samples contain Gram-positive and Gram-
negative bacteria, it should be used an exogenous control
that includes both types of bacteria, as it has been demon-
strated [20]. Other studies [18, 19] use DNA molecules as
plasmids, entire genomes, as well as synthetic cDNA unrelated
to the target, as exogenous control. However, this only allows
to quantify gDNA loss after the step where it is added in DNA
extraction process, not considering the loss of bacteria in the
previous steps. In the case of choosing this type of exogenous
control, it would be added before step 8 of the
Subheading 2.2.
13. We freeze bacterial pellets at -20 °C overnight to improve cell
lysis in the DNA extraction process. In our experiments, this
could increase the yield of DNA up to twofold.
14. Some lysis buffers come with separate components, and it may
be necessary to add more than one compound to the samples.
Regarding silica glass beads, they can either be purchased in
bulk (cheaper) or already preloaded in the
microcentrifuge tube.
15. The pellet at this point contains non-DNA organic and inor-
ganic materials, including proteins and cell debris; therefore,
avoid transferring any of the pellet. It is essential to remove
these contaminants, as they may reduce DNA purity and
inhibit downstream applications.
16. The highly concentrated salt solution establishes the high-salt
condition, which is required to bind DNA to the silica column
membrane.
17. Depending on the extraction kit used, the maximum volume
that can be added to the column will be different.
18. This wash solution removes residues of salt and other contami-
nants but allows the gDNA to stay bound to the silica
membrane.
19. Be careful not to splash any of the liquid on the silica column.
20. Measure gDNA concentration and purity in a nanodrop. Keep
the gDNA samples at 4 °C.
21. For example, use the serial dilutions of the starting gDNA: 1:
10, 1:100, 1:1000, 1:10000, and 1:100000. It is not required
 Proper Bacteria Quantification by qPCR 113

to know the exact concentration of gDNA copies, but it is

fundamental to know the exact ratio between each of the four
to five dilutions used.
22. It is necessary to be careful when pipetting such low volumes.
Do not mix different sets of primers in the same master mix
(one set of primers should have the forward and reverse primer
for each gene).
23. It is important to mention that too much concentrated samples
can inhibit qPCR due to the possible presence of inhibitors.
Hence, this should be taken into consideration when preparing
the working concentration of the gDNA sample. A good start-
ing point should be to dilute 1:10 after gDNA extraction. This
would be the highest concentration to be used for the effi-
ciency curve determination.
24. The NTC allows to verify if there are contaminations in the
master mix, since without the gDNA, no amplification should
be detected.
25. Set up the qPCR instrument with an adequate cycling protocol
for the experiment. The cycling parameters will depend on the
qPCR master mix kit that is being used, since there are kits that
allow to perform the annealing and extension together, while
others require three steps, namely, denaturation, annealing,
and extension, all at different temperatures.
26. When using SYBR Green qPCR master mixes, melt-curve
analysis needs to be performed to ensure the absence of unspe-
cific products and primer-dimers. A distinct peak in the plot of
the graphic “Fluorescence vs Temperature” indicates that the
amplified DNA product corresponds to a specific PCR ampli-
con. On the contrary, more than one peak indicates that more
than one product was amplified, which could mean that the
reaction is not specific.
27. If the reaction efficiency is lower, repeat the assay, and if it
persists, the design of the primers must be improved.
28. The “n” represents the number of reactions that will be used
for each set of primers. Pipetting errors should be considered;
therefore, for each ten reactions, consider one extra reaction
that needs to be prepared. For example, if it is needed to
prepare 5 reactions, the n should be n = 5 + 1 = 6; to run
10 reactions, n = 10 + 1 = 11; in the case of 18 reactions,
n = 18 + 2 = 20. Consider also that each sample shall be run in
triplicates.
29. Normally, qPCR master mixes with SYBR Green come 2×
concentrated; therefore, in a total reaction volume of 10 μL,
half (5 μL) should be qPCR master mix.
114 Ângela Lima et al.

30. Quantify the samples with primers designed for the target
species and with primers for the exogenous control species.
31. The DNA extracted should be diluted at least 1:10, with the
purpose of decreasing the qPCR inhibitors concentration in
the extracted samples.
32. This inter-run calibrator, added on the qPCR plate, serves to
avoid the fluorescence variations between the qPCR runs to be
performed. It can be a bacterium genome, a plasmid, or a
cDNA molecule at a known concentration.
33. This equation, however, makes several assumptions including
that the efficiency of PCR is close to one and that the efficiency
of the primers for target species is similar to the efficiency of the
primers for control species [21].

Acknowledgments

This work was funded by the Portuguese Foundation for Science

and Technology (FCT) under the scope of the strategic funding of
the unit (UIDB/04469/2020) and EXPL/SAU-INF/1000/
2021. AL and LGVS are supported by FCT with individual grants
2022.13112.BD and 2020.04912.BD, respectively.

References

1. Benes V, Castoldi M (2010) Expression 6. Bustin SA (2010) Why the need for qPCR
profiling of microRNA using real-time quanti- publication guidelines ? – the case for MIQE.
tative PCR, how to use it and what is available. Methods 50:217–226. https://doi.org/10.
Methods 50:244–249. https://doi.org/10. 1016/j.ymeth.2009.12.006
1016/j.ymeth.2010.01.026 7. Cotto A, Looper JK, Mota LC, Son A (2015)
2. Yu J, Wang HM, Zha MS et al (2015) Molecu- Quantitative polymerase chain reaction for
lar identification and quantification of lactic microbial growth kinetics of mixed culture sys-
acid bacteria in traditional fermented dairy tem. J Microbiol Biotechnol 25:1928–1935.
foods of Russia. J Dairy Sci 98:5143–5154. https://doi.org/10.4014/jmb.1503.03090
https://doi.org/10.3168/jds.2015-9460 8. Leigh Greathouse K, Sinha R, Vogtmann E
3. Rocha D, Santos C, Pacheco L (2015) Bacte- (2019) DNA extraction for human micro-
rial reference genes for gene expression studies biome studies: the issue of standardization.
by RT-qPCR: survey and analysis. Antonie Van Genome Biol 20:1–4. https://doi.org/10.
Leeuwenhoek 108:685–693. https://doi.org/ 1186/s13059-019-1843-8
10.1007/s10482-015-0524-1 9. Costea PI, Zeller G, Sunagawa S et al (2017)
4. Ståhlberg A, Thomsen C, Ruff D, Åman P Towards standards for human fecal sample pro-
(2012) Quantitative PCR analysis of DNA, cessing in metagenomic studies. Nat Biotech-
RNAs, and proteins in the same single cell. nol 35:1069–1076. https://doi.org/10.
Clin Chem 58:1682–1692. https://doi.org/ 1038/NBT.3960
10.1373/clinchem.2012.191445 10. Magalhães AP, França Â, Pereira MO, Cerca N
5. Smith CJ, Osborn AM (2009) Advantages and (2019) RNA-based qPCR as a tool to quantify
limitations of quantitative PCR (Q-PCR)- and to characterize dual-species biofilms. Sci
based approaches in microbial ecology. FEMS Rep 9:1–12. https://doi.org/10.1038/
Microbiol Ecol 67:6–20. https://doi.org/10. s41598-019-50094-3
1111/j.1574-6941.2008.00629.x 11. Marotz C, Amir A, Humphrey G et al (2017)
DNA extraction for streamlined metagenomics
 Proper Bacteria Quantification by qPCR 115

of diverse environmental samples. BioTechni- red wine using real time PCR. Front Microbiol
ques 62:290–293. https://doi.org/10.2144/ 7:1–9. https://doi.org/10.3389/fmicb.2016.
000114559 00831
12. O’Connell GC, Chantler PD, Barr TL (2017) 17. Rosca A, Castro J, Sousa L et al (2022) In vitro
High interspecimen variability in nucleic acid interactions within a biofilm containing three
extraction efficiency necessitates the use of species found in bacterial vaginosis
spike-in control for accurate qPCR-based mea- (BV) support the higher antimicrobial toler-
surement of plasma cell-free DNA levels. Lab ance associated with BV recurrence. J Antimi-
Med 48:332–338. https://doi.org/10.1093/ crob Chemother 77:2183–2190
LABMED/LMX043 18. Coyne KJ, Handy SM, Demir E et al (2005)
13. Cerca N, Lima Â, França A (2022) Accurate Improved quantitative real-time PCR assays for
qPCR quantification in polymicrobial commu- enumeration of harmful algal species in field
nities requires assessment of gDNA extraction samples using an exogenous DNA reference
efficiency. J Microbiol Methods 194:1–4. standard. Limnol Oceanogr Methods 3:381–
https://doi.org/10.1016/j.mimet.2022. 391. https://doi.org/10.4319/lom.2005.
106421 3.381
14. Bustin SA, Benes V, Garson JA et al (2009) The 19. Taskin B, Gozen AG, Duran M (2011) Selec-
MIQE guidelines: minimum information for tive quantification of viable Escherichia coli bac-
publication of quantitative real-time PCR teria in biosolids by quantitative PCR with
experiments. Clin Chem 55:611–622. propidium monoazide modification. Appl
https://doi.org/10.1373/CLINCHEM. Environ Microbiol 77:4329–4335. https://
2008.112797 doi.org/10.1128/AEM.02895-10
15. Svec D, Tichopad A, Novosadova V et al 20. Scarsella E, Zecconi A, Cintio M, Stefanon B
(2015) How good is a PCR efficiency estimate: (2021) Characterization of microbiome on
recommendations for precise and robust qPCR feces, blood and milk in dairy cows with differ-
efficiency assessments. Biomol Detect Quantif ent milk leucocyte pattern. Animals 11:1–14.
3:9–16. https://doi.org/10.1016/j.bdq. https://doi.org/10.3390/ani11051463
2015.01.005 21. Livak KJ, Schmittgen TD (2001) Analysis of
16. Longin C, Guilloux-benatier M, Alexandre H relative gene expression data using real-time
(2016) Design and performance testing of a quantitative PCR and the 2-ΔΔCT method.
DNA extraction assay for sensitive and reliable Methods 25:402–408. https://doi.org/10.
quantification of acetic acid bacteria directly in 1006/meth.2001.1262
 Chapter 10

Real-Time PCR Method for Assessment of ParA-Mediated

Recombination Efficiency in Minicircle Production
Cláudia P. A. Alves, Duarte Miguel F. Prazeres, and Gabriel A. Monteiro

Abstract
The in vivo intramolecular recombination of a parental plasmid allows excising prokaryotic backbone from
the eukaryotic cassette of interest, leading to the formation of, respectively, a miniplasmid and a minicircle.
Here we describe a real-time PCR protocol suitable for the determination of recombination efficiency of
parental plasmids with multimer resolution sites (MRS). The protocol was successfully applied to purified
DNA samples obtained from E. coli cultures, allowing a more reproducible determination of recombination
efficiency than densitometry analysis of agarose gels.

Key words Minicircles, ParA resolvase, Intramolecular recombination, Recombination efficiency,

Real-time PCR

1 Introduction

Minicircles (MCs) are covalently closed circular DNA molecules

obtained from a larger parental plasmid [1, 2]. MCs are interesting
nonviral DNA delivery vectors because they present lower immu-
nogenicity and higher transfection efficiency than standard plasmid
DNA vectors [1, 2]. The molecules are produced in vivo in Escher-
ichia coli, by inducing the expression of a resolvase, which acts on
specific sites in the parental plasmid (e.g., multimer resolution sites
(MRS) [3–5], attB and attP sites [6, 7]). The action of the resolvase
leads to the conversion of the parental plasmid into two molecules:
a miniplasmid with the prokaryotic backbone and a minicircle with
the eukaryotic cassette [8]. Both molecules comprise the sequence
originated from the action of the resolvase. In systems where
resolvases act on attB and attP sites, different sequences are
obtained after recombination [9, 10]. On the contrary, in the case
of ParA-mediated recombination, the MRS targeted by the resol-
vase do not suffer alterations during recombination [11]. This
means that parental plasmids, miniplasmids, and minicircles

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_10,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

117
118 Cláudia P. A. Alves et al.

obtained by ParA-based recombination cannot be distinguished by

PCR with primers that target MRS.
Strategies to evaluate the efficiency of ParA-mediated recombi-
nation typically rely on densitometry analysis of agarose gels [3, 4]
or on qPCR-based approaches, which rely on the detection of
sequences common to the parental plasmid and its recombination
products [12]. Densitometry analysis implies a pre-linearization of
DNA molecules and relies on the use of image processing software
(e.g., ImageJ) and user visual analysis [3, 4]. Real-time qPCR is a
sensitive and specific technique, allowing the specific detection of
DNA molecules in solution [13]. Co-detection of miniplasmid or
minicircle by qPCR along with parental plasmid implies the
subsequent subtraction of the amount of these molecules from
the amount of parental plasmid detected, to determine the amount
of each molecule in solution [12]. The current real-time PCR
protocol, which is an alternative approach for the quantification
of recombination efficiency [14], was designed to target the regions
flanking the MRS. Primers located in these regions were designed
and arranged into four pairs: two pairs specific for the parental
plasmid, one pair specific for the miniplasmid, and one pair specific
for the minicircle. Although all primers anneal on the parental
plasmid, pairs designed to amplify fragments from the miniplasmid
and minicircle should not result in detectable amplification from
the parental plasmid due to the short amplification time. Applica-
tion of the method, described in here, yielded successful determi-
nation of recombination efficiency in pure DNA samples with low
standard deviation between replicates (<2%) [14].

2 Materials

2.1 Recombination 1. Commercial kit for plasmid DNA purification.

Efficiency 2. Cell samples collected during minicircle production (see Note
Determination 1).
3. Purified parental plasmid, miniplasmid, and minicircle (see
Notes 2, 3, and 4).
4. Bacterial culture of the E. coli strain used for minicircle produc-
tion non-transformed with any plasmid (see Note 5).
5. NanoVue Plus spectrophotometer or an equipment equivalent.
6. Sequence map of parental plasmid, miniplasmid, and
minicircle.
7. Oligonucleotides at 10 μM (see Note 6).
8. PCR-grade water.
9. 0.2 mL PCR tubes, 96-well plates, or capillaries (see Note 7).
10. Caps for PCR tubes/capillaries or sealing film for well plates
(see Note 7).
 Real-Time PCR Method for Recombination Efficiency Evaluation 119

11. Pipettes.
12. Sterile filter pipette tips.
13. Real-time qPCR system.
14. Benchtop minicentrifuge.
15. Commercial qPCR kit (see Note 8).

2.2 Agarose Gel 1. 1× TAE buffer pH 8 (see Note 9).

Electrophoresis 2. 1% agarose gel (see Note 9).
3. DNA molecular weight marker.
4. Gel loading dye for DNA samples.
5. Horizontal agarose gel system.
6. Power supply for gel system.
7. Gel documentation system.

3 Methods

3.1 Primer Design 1. Identify the multimer resolution sites (MRS) in the parental
plasmid (see Fig. 1).
2. Design primers in the locations identified in point 1 (regions
from the prokaryotic backbone and eukaryotic cassette flanking
the MRS). The use of primer design software is recommended
(e.g., Primer 3, https://bioinfo.ut.ee/primer3/ [15, 16]).
This allows users to set the desired melting temperature and
constraints to minimize the probability of primer-dimer forma-
tion. Ideally, primer sequences should have a length of 20–24
nucleotides, a GC content of about 40–60%, and a melting
temperature close to 60 °C [17, 18] (see Note 10).

3.2 Calibration 1. Determine the concentration of pure samples of parental plas-

Curves Preparation mid, miniplasmid, and minicircle (see Notes 3 and 4).
2. Convert the volumetric concentration of the samples into
molecules per μL using the:

ng
Molecules Concentration μL × 6:022 × 10
23

=
μL DNA size ðbpÞ × 1 × 109 × 660
3. Calculate the volume of pure DNA sample to prepare a solu-
tion with 1 × 109 molecules per μL using:

1 × 109 molecules
μL × Final volume ðμLÞ
Volume of pure sample ðμLÞ =
molecules
Initial concentration μL
120 Cláudia P. A. Alves et al.

Fig. 1 Representation of the parental plasmid, with an indication of the regions that originate the miniplasmid,
which contains the prokaryotic backbone, and the minicircle, which contains the eukaryotic cassette. These
regions are flanked by multimer resolution sites (MRS). Four primers are designed to anneal to the sequences
upstream and downstream of the MRS. Primer sequences should be oriented to form pairs and amplify
amplicons containing each MRS, being indicated by their annealing sites in the parental plasmid, miniplasmid,
and minicircle. Amplicons expected by real-time PCR using this strategy are also presented

4. Ensure that all the following steps are performed with sterile
filter pipette tips.
5. Prepare tenfold dilutions with between 1 × 109 and 1 × 104
molecules per μL, by mixing the appropriate volume of sample
(calculated as described in step 3) with the appropriate volume
of PCR-grade water. Keep the solution in ice (see Note 11).
6. Prepare PCR-grade water containing 150,000 cells/μL by
making serial dilutions of the bacterial culture of
non-transformed cells (see Note 5 and 12).
7. Thaw qPCR reagents (commercial qPCR mixture and primers)
in ice.
8. Prepare qPCR in 200 μL PCR tubes by mixing the following
components: 2 μL of DNA standard (parental plasmid, mini-
plasmid, or minicircle), 2 μL of PCR-grade water containing
150,000 cells per μL, 4.4 μL of PCR-grade water, 0.8 μL of
10 μM forward primer, 0.8 μL of 10 μM reverse primers, and
10 μL of commercial qPCR mix. Keep reactions in ice.
 Real-Time PCR Method for Recombination Efficiency Evaluation 121

Table 1
Description of the real-time PCR program used for quantification [14]

Target Signal
temperature Hold Slope acquisition Analysis
Step description Cycles (°C) (min:s) (°C/s) mode mode
Polymerase 1 95 02:00 20 – –
activation
Amplification 30 95 00:10 20 – Quantification
55 00:05 20 –
72 00:07 20 Single
Coolinga 1 40 00:30 20 – –
a
Cooling can be performed after the amplification cycles or only at the end, if a program for melting temperature analysis
is included after amplification

Depending on the DNA standard in the reaction mixture, the

primers used should be a pair for parental plasmid (primer
MP1 + primer MC1 or primer MP2 + primer MC2), a pair
for miniplasmid (primer MP1 + primer MP2), and a pair for
minicircle (primer MC1 + primer MC2) (see Note 13).
9. Prepare negative controls by setting up reaction mixtures as
indicated above but replacing the DNA standard with
PCR-grade water.
10. Transfer the 20 μL reactions into a qPCR capillary and spin in a
benchtop minicentrifuge (see Note 13).
11. Place the reaction in real-time PCR equipment and run the
program described in Table 1. To allow an analysis of amplicon
denaturation, include a hold at 70 °C for 30 s after the amplifi-
cation cycles followed by a temperature increase of 0.05 °C/s
until 95 °C is reached. Include a continuous signal acquisition
mode during the temperature increase (see Notes 13 and 14).
12. Calculate the quantification cycles (Cq) for each reaction by
using an automated method (e.g., second derivative method)
from the software of the real-time equipment. Data used was
acquired during the “Quantification” analysis mode chosen, as
indicated in Table 1.
13. Perform a melting temperature calling analysis for the data
from continuous signal acquisition, using the software of the
real-time qPCR equipment (see Note 15).
14. Collect the samples from the equipment, mix them with a
DNA gel loading dye, and run in a 1% agarose gel, using a
DNA molecular weight marker as reference (see Note 9).
15. Acquire the gel image, and analyze the size of amplicons, which
should correspond to the expected sizes based on the primers
used (see Note 16).
122 Cláudia P. A. Alves et al.

16. Use the Cq obtained to construct the calibration curves: make

a plot of the Cq as a function of the log10 of the number of
molecules/reaction (see Note 17). Perform a linear regression
analysis, and calculate the correlation coefficient for each cali-
bration curve (parental plasmid, miniplasmid, and minicircle)
(see Note 11).
17. Calculate the amplification efficiency (see Note 18) for each
primer pair, using the slope of the correspondent calibration
curve:

PCR efficiency = 10 - 1=slope - 1

18. Further validate the calibration curves by determining the
linear dynamic range, the limit of quantification, and the limit
of detection of the assay [13, 18–20].
19. If calibration curves do not comply with the requirements for
each test, optimization of the annealing temperature, primer
concentration, or magnesium concentration should be
attempted [17]. If needed, design new primers. Obtain and
validate new calibration curves.

3.3 Determination of 1. Prepare purified DNA samples by performing minipreps of the

Recombination samples collected during bacterial growth, following the kit
Efficiency manufacturer’s instructions (see Note 19).
2. Measure the concentration of the samples using the NanoVue
spectrophotometer.
3. Make serial dilutions of the samples in PCR-grade water to
obtain a final concentration of 0.05 ng/μL (see Note 20).
4. Prepare PCR-grade water containing 150,000 cells/μL by
making serial dilutions of the bacterial growth of
non-transformed cells (see Notes 5 and 12).
5. Thaw qPCR reagents (commercial qPCR mix and primers)
in ice.
6. Prepare qPCR in 200 μL PCR tubes by mixing the following
components: 8 μL of PCR-grade water containing 150,000
cells per μL, 17.6 μL of PCR-grade water, 8 μL of the diluted
DNA sample, and 40 μL of commercial qPCR mix. Transfer
18.4 μL into three separate PCR tubes and keep in ice (see Note
13).
7. Prepare the reaction mixtures to evaluate the amount of paren-
tal plasmid, miniplasmid, and minicircle by adding a primer pair
(parental plasmid, primer MP1+ primer MC1 or primer
MP2 + primer MC2; miniplasmid, primer MP1 + primer MP
2; minicircle, primer MC1 + primer MC2) to each tube. Add
Real-Time PCR Method for Recombination Efficiency Evaluation 123

0.8 μL of the 10 μM forward primer and 0.8 μL of the 10 μM of

the reverse primer (see Note 13).
8. For each primer pair, prepare negative controls by setting up
reaction mixtures as indicated above but replacing the DNA
sample with PCR-grade water.
9. Transfer the 20 μL reactions into a qPCR capillary and spin in a
benchtop minicentrifuge (see Note 13).
10. Place the reaction mixtures in a real-time PCR equipment and
subject them to the amplification program indicated in Table 1.
To allow an analysis of amplicon denaturation, include a hold at
70 °C for 30 s after the amplification cycles followed by a
temperature increase of 0.05 °C/s until 95 °C is reached.
Include a continuous signal acquisition mode during the tem-
perature increase (see Notes 13 and 14).
11. Calculate the quantification cycles (Cq) for each reaction mix-
ture by using an automated method (e.g., second derivative
method) from the software of the real-time equipment. Data
used was acquired during the “Quantification” analysis mode
chosen, as indicated in Table 1.
12. Perform a melting temperature calling analysis for the data
from continuous signal acquisition, using the software of the
real-time equipment (see Note 15).
13. Collect the samples from the equipment, mix them with a
DNA gel loading dye and run in a 1% agarose gel, using a
DNA molecular weight marker as reference (see Note 9).
14. Acquire the gel image and analyze the size of amplicons, which
should correspond to the expected sizes based on the primers
used (see Note 16).
15. Determine the amount of miniplasmid and parental plasmid in
each sample. The calculation is performed using the Cq
obtained for each DNA species (miniplasmid or parental plas-
mid). Using the appropriate calibration curve, use the Cq to
calculate the corresponding number of molecules of each DNA
species (see Notes 17 and 20).
16. Use the amounts calculated in point 15 to determine the
recombination efficiency. For this, divide the number of mole-
cules of miniplasmid by the sum of the number of molecules of
miniplasmid and parental plasmid. Multiply the result by
100 to obtain the percentage of recombination efficiency (see
Notes 21 and 22).
124 Cláudia P. A. Alves et al.

4 Notes

1. This protocol was developed using the E. coli BW2P strain [3]
and pMINILi-CVG plasmid [4, 14, 21].
The strain was constructed by engineering the genome of
an E. coli strain optimized for L-arabinose uptake (E. coli
BW27783, CGSC#: 12119, obtained from the Coli Genetic
Stock Center, Yale, USA) [3]. Modifications consisted of the
knockout of the recA gene and disruption of the endA gene by
insertion of an optimized cassette for L-arabinose expression,
containing a D-glucose-repressible promoter (PBAD) [3]. Nev-
ertheless, other systems are described in which ParA resolvase is
expressed from the parental plasmid [5, 12] or, alternatively,
from a helper plasmid [3]. In the latter case, however, an
additional contaminating plasmid molecule will be present.
The model plasmid (pMINILi-CVG) [4, 14, 21] used
presented multimer resolution sites (MRS) flanking the pro-
karyotic and eukaryotic backbone. These sequences have a
length of 133 bp, are identical, and do not suffer modifications
during the recombination process [11]. Since MRS sequences
are present in parental plasmids (two MRS), minicircles (one
MRS), and miniplasmids (one MRS), primers that anneal at
MRS will not be able to distinguish the molecules. The
pMINILi-CVG (4563 bp) plasmid was previously obtained
after successive modifications of the pMINI plasmid, which
was derived from the commercial pVAX1™/LacZ (Invitrogen,
Carlsbad, CA) [3, 22, 23]. Plasmid pMINI was modified by
(i) site-directed mutagenesis to include PvuII restriction sites in
the prokaryotic backbone, (ii) removal of remaining sequences
of a PBAD/AraC-parA cassette, and (iii) cloning of the VEGF
(vascular endothelial growth factor) gene. The prokaryotic
backbone of pMINILi-CVG harbors six PvuII recognition
sites and consists of a pMB1-derived replication origin and
the kanamycin resistance gene. The plasmid’s eukaryotic cas-
sette comprises the CMV (human cytomegalovirus)
immediate-early promoter, a VEGF-GFP (green fluorescent
protein) gene fusion, and the BGH (bovine growth hormone)
polyadenylation signal. Prokaryotic and eukaryotic sequences
on the plasmid are separated by MRS [4, 14, 21].
The protocol applied for the production of the minicircle
used in the development of the real-time PCR method
described here can be found in [21].
2. Pure miniplasmid is needed as a standard to construct the
corresponding calibration curve. To obtain a strain trans-
formed with the miniplasmid, first, perform cultures for mini-
circle production as described in [21]. Use a sample collected at
the end of the bacterial exponential growth to perform a
Real-Time PCR Method for Recombination Efficiency Evaluation 125

miniprep purification with a commercial kit, following the

instructions of the manufacturer of the kit selected. Run the
pure DNA sample in two lanes in an agarose gel. Cut the gel
and stain the portion with the DNA molecular weight marker
and one of the lanes with the DNA of interest. Cut the band
corresponding to the miniplasmid from the non-stained gel
portion. A commercial kit for the extraction of plasmid DNA
from agarose gels is recommended. Use the purified miniplas-
mid to transform the same E. coli strain used for minicircle
production.
3. Pure standards of parental plasmid, miniplasmid, and minicircle
are needed to construct the calibration curves. This will depend
on the parental plasmid used. In the case of the system used to
develop this protocol, the parental plasmid presents a recogni-
tion site for BbvCI, allowing it to convert parental plasmid and
miniplasmid molecules from supercoiled into open circular iso-
forms by restriction with Nb.BbvCI (cuts only one of the DNA
strands). This allows their separation from supercoiled mini-
circles by hydrophobic interaction chromatography
[4, 21]. For parental plasmids with this characteristic, minicir-
cle purification can be performed following the indications in
[21] from primary purification and intermediate recovery until
the end of supercoiled minicircle isolation by hydrophobic
interaction chromatography. Adjustments to the protocol in
[21] allow to purify the parental plasmid or the miniplasmid.
During the production stage, the following modifications were
performed: (i) addition of D-glucose (to repress the PBAD
promoter and avoid the leaky expression of ParA resolvase) at
a final concentration of 0.5% (w/v) at the beginning of the
growth at 250 mL scale, (ii) no addition of L-arabinose during
culture, and (iii) no collection of samples during culture. For
isolation of each molecule, perform the primary purification
and intermediate recovery, and proceed directly to HIC purifi-
cation without subjecting the samples to the diafiltering/con-
centration steps and enzymatic restriction described in [21].
4. This protocol only requires parental plasmid and miniplasmid
detection for the calculation of recombination efficiency. Thus,
if not needed, minicircle standards and steps for its detection
can be omitted. Nevertheless, the minicircle calibration curve
and its detection are useful for assay validation.
5. This protocol was designed to evaluate the recombination
efficiency of parental plasmid using whole-cell samples without
previous purification, to minimize sample handling and
pre-purification. However, further optimization is needed to
allow successful application in these conditions [14].
126 Cláudia P. A. Alves et al.

6. Stock solutions of oligonucleotides are typically made at a

concentration of 100 μM. If the oligonucleotides ordered are
lyophilized, first, resuspend with 100 μL of PCR-grade water
per each 10 nmoL of the oligonucleotide. Working solutions
are obtained by performing a tenfold dilution of the stock.
7. Material needed depends on the real-time qPCR equipment
available.
8. Choose a qPCR kit compatible with the real-time system that
will be used. This protocol was developed based on assays
performed with a qPCR kit which contains a fluorescent
green dye that intercalates in dsDNA.
9. Agarose gel and TAE buffer may be prepared in the laboratory
or acquired commercially. A detailed description of the prepa-
ration of these materials can be found in [21].
10. The length recommended for amplicons in qPCR is typically
75–150 bp [17]. Due to MRS length, amplicons will need to
be longer than 133 bp but should not exceed the length
recommended by the qPCR kit in use.
In the case of the model plasmid used to develop the
protocol [14] described in here, the sequence and properties
of the primers selected were as indicated in Table 2. The
primers combination used for each target DNA molecule, as

Table 2
Sequence and properties of oligonucleotides used in the real-time PCR program

Oligonucleotides information

Melting
temperature
Primer Sequence (5′-3′) (°C) %GC
MP1 GCCTTTTGCTCACATGTTCTTGC 59 48
MP2 ATTCCGGTTCGCTTGCTGTC 59 55
MC1 ACTAGTCAATAATCAATGTCAACGCG 57 38
MC2 CGGTGGGCTCTATGGCTTCTAATG 60 54
Primers combinations for real-time PCR
Target DNA molecule Primer forward Primer reverse Amplicon length
expected (bp)
Parental plasmid MP1 MC1 199
Miniplasmid MP1 MP2 223
Minicircle MC2 MC1 201
Combinations used to amplify fragments from parental plasmid, miniplasmid, and minicircle target molecules are also
indicated
Real-Time PCR Method for Recombination Efficiency Evaluation 127

well as the length of amplicons generated, is also indicated.

This information is exemplificative, being its purpose to aid
during primer design to apply the protocol for different paren-
tal plasmids.
11. Range of dilutions should allow a good fit with linear regres-
sion. It is advisable to use more than six different concentra-
tions in at least two dilution series to establish the linear range
[18, 19]. For the second series, perform the dilution from point
3 of Subheading. 3.2 to a concentration lower than 1 × 109
molecules per μL. To obtain the calibration curves, the linear
range of the calibration curve should be evaluated. Detailed
guidelines and procedures can be found in [13, 18–20].
12. Spiking with cells not harboring a plasmid was designed to
simulate the impurities present in the solution in the case of
whole-cell analysis.
13. Reaction volume, the primer concentration, volume of com-
mercial qPCR mix and possible additives, as well as the proto-
col used for the qPCR assay might vary depending on the
qPCR equipment and commercial qPCR kit in use.
14. To allow further evaluation of reaction specificity, the protocol
should include an analysis of the temperatures at which the
amplicons are denatured.
15. Melting temperature analysis should result in a single peak for
each primer pair, indicating the specificity of amplified
products.
16. A single band should be obtained. Nonspecific amplification
and/or formation of primer-dimers can be detected, which
hints at the need for assay optimization.
17. The calibration curve is used to determine the amount of target
molecules in a sample with unknown composition. Therefore,
the precision of the calibration curve is highly important (see
Notes 11 and 18). An example of a calibration curve is shown
in Fig. 2 (the number of molecules per reaction is calculated by
multiplying the corresponding standard molecular concentra-
tion by the volume of the standard used in the reaction). The
calibration curve can then be used to estimate the number of
molecules of a DNA species in a reaction by using Cq values
obtained for samples under evaluation.
18. PCR efficiency should be similar for all three pairs of primer
used in the assays, being desired an efficiency over 90%. Varia-
tion of PCR efficiency between primer pairs can lead to inaccu-
rate results, as different slopes can lead to miscalculation of
relative concentrations. A PCR efficiency of 1 means that a
perfect doubling of DNA molecules occurs at each PCR cycle
[18, 19].
128 Cláudia P. A. Alves et al.

Fig. 2 Representation of a calibration curve. Quantification cycles obtained for two series of tenfold dilution
samples are plotted in function of the log10 of target molecules per reaction

19. Instead of using purified culture samples, the recombination

efficiency can be calculated for artificial mixtures of the stan-
dards. This is useful to test the assay validity, as the sample
composition is known and thus the value expected for the
recombination efficiency that can be calculated is also known.
In this case, steps 1–3 of Subheading 3.3 would be skipped
being instead prepared samples by mixing different amounts of
standards according to the linear range of the calibration
curves.
20. The amount of sample to use should be in the linear range of
the assay. Thus, this value can be adjusted depending on the
linear range obtained. Testing different concentrations of the
same sample can improve the reliability of the results. Note that
miniplasmid and minicircle are not expected to be present in
samples before recombination induction. Thus, these DNA
species should not be detected. After complete recombination,
the detection of parental plasmid should not be obtained.
21. Each parental plasmid originates one miniplasmid and one
minicircle molecule; however only the miniplasmid and paren-
tal plasmid will be able to replicate. This calculation is based on
the assumption that replication is not significant after recombi-
nation. It is important to mention that, in the system used,
miniplasmid and parental plasmid are not degraded in vivo. If
that is the case, the calculation of recombination efficiency has
to be revised, being more appropriate to use the minicircle
instead of miniplasmid in the calculation.
22. During the development of this protocol, the results were
confirmed by resorting to densitometry analysis of agarose
gels. Figure 3 is presented as an example of the analysis of
 Real-Time PCR Method for Recombination Efficiency Evaluation 129

Fig. 3 Representative results of analysis of parental plasmid recombination. Samples collected during
minicircle production (0 h, 1 h, and 2 h) were purified and run on an agarose gel before (non-digested) and
after enzymatic restriction. Recombination efficiency was calculated by densitometry analysis of linearized
bands on the agarose gel and by real-time PCR using pure samples. MC minicircle, MP miniplasmid, PP
parental plasmid, Lin linear, sc supercoiled, MWM molecular weight marker

samples collected at 0 h, 1 h, and 2 h after recombination

induction.
After miniprep purification, samples were run on agarose
gels. Non-digested samples show that parental plasmid (PP),
miniplasmid (MP), and minicircle (MC) are obtained mainly in
supercoiled (sc) isoform. It is also possible to observe that
before recombination (0 h) only PP is present in the sample.
To allow densitometry analysis, samples were subjected to
incubation with a restriction enzyme (Alw44i) with a recogni-
tion site only in the prokaryotic backbone. This resulted in the
linearization (lin) of parental plasmid and miniplasmid mole-
cules. The bands corresponding to linearized forms were used
for densitometry analysis, resulting in the calculation of recom-
bination efficiencies between 0% (0 h) and 97% (2 h). The
non-digested samples were directly used for real-time PCR
analysis, resulting in the determination of a recombination
efficiency between 0% (0 h) and 87% (2 h). Analysis of addi-
tional samples showed a more precise determination of recom-
bination efficiency by real-time PCR, being observed standard
deviations lower than 2% between culture samples. In compar-
ison, densitometry analysis results presented a standard devia-
tion between 7% and 10% for the same samples under
evaluation [14].
130 Cláudia P. A. Alves et al.

Acknowledgement

This work was funded by FCT, Fundação para a Ciência e a Tecno-

logia, I.P., in the scope of the project UIDB/04565/2020 and
UIDP/04565/2020 of the Research Unit Institute for Bioengi-
neering and Biosciences, iBB, and the project LA/P/0140/2020
of the Associate Laboratory Institute for Health and Bioeconomy –
i4HB. Cláudia Alves studies were funded by FCT-Portuguese
Foundation for Science and Technology (Grant PD/BD/
116842/2016, BIOTECnico Ph.D. program).

References

1. Mairhofer J, Grabherr R (2008) Rational vec- 9. Smith MCM, Brown WRA, McEwan AR,
tor design for efficient non-viral gene delivery: Rowley PA (2010) Site-specific recombination
challenges facing the use of plasmid DNA. Mol by φC31 integrase and other large serine
Biotechnol 39:97–104. https://doi.org/10. recombinases. Biochem Soc Trans 38:388–
1007/s12033-008-9046-7 394. https://doi.org/10.1042/BST0380388
2. Hardee C, Arévalo-Soliz L, Hornstein B, 10. Stark WM (2014) The serine recombinases.
Zechiedrich L (2017) Advances in non-viral Microbiol Spectr 2:MDNA3–0046–2014.
DNA vectors for gene therapy. Genes 8:65. https://doi.org/10.1128/microbiolspec.
https://doi.org/10.3390/genes8020065 MDNA3-0046-2014
3. Šimčı́ková M, Alves CPA, Brito L et al (2016) 11. Thomson JG, Yau Y-Y, Blanvillain R et al
Improvement of DNA minicircle production (2009) ParA resolvase catalyzes site-specific
by optimization of the secondary structure of excision of DNA from the Arabidopsis
the 5′-UTR of ParA resolvase. Appl Microbiol genome. Transgenic Res 18:237–248.
Biotechnol 100:6725–6737. https://doi.org/ https://doi.org/10.1007/s11248-008-
10.1007/s00253-016-7565-x 9213-4
4. Alves CPA, Šimčı́ková M, Brito L et al (2016) 12. Mayrhofer P, Blaesen M, Schleef M, Jechlinger
Development of a nicking endonuclease- W (2008) Minicircle-DNA production by site
assisted method for the purification of minicir- specific recombination and protein-DNA inter-
cles. J Chromatogr A 1443:136–144. https:// action chromatography. J Gene Med 10:1253–
doi.org/10.1016/j.chroma.2016.03.035 1269. https://doi.org/10.1002/jgm.1243
5. Jechlinger W, Azimpour Tabrizi C, Lubitz W, 13. Kubista M (2014) Prime time for qPCR – rais-
Mayrhofer P (2004) Minicircle DNA immobi- ing the quality bar. Eur Pharm Rev 19:63–67
lized in bacterial ghosts: in vivo production of 14. Alves CPA, Prazeres DMF, Monteiro GA
safe non-viral DNA delivery vehicles. J Mol (2021) Recombination efficiency measurement
Microbiol Biotechnol 8:222–231. https:// by real-time PCR: a strategy to evaluate ParA-
doi.org/10.1159/000086703 mediated minicircle production. Anal Biochem
6. Chen Z-Y, He C-Y, Ehrhardt A, Kay MA 628:114285. https://doi.org/10.1016/j.ab.
(2003) Minicircle DNA vectors devoid of bac- 2021.114285
terial DNA result in persistent and high-level 15. Koressaar T, Remm M (2007) Enhancements
transgene expression in vivo. Mol Ther 8:495– and modifications of primer design program
500. https://doi.org/10.1016/S1525-0016 Primer3. Bioinformatics 23:1289–1291.
(03)00168-0 https://doi.org/10.1093/bioinformatics/
7. Kay MA, He C-Y, Chen Z-Y (2010) A robust btm091
system for production of minicircle DNA vec- 16. Untergasser A, Cutcutache I, Koressaar T et al
tors. Nat Biotechnol 28:1287–1289. https:// (2012) Primer3 – new capabilities and inter-
doi.org/10.1038/nbt.1708 faces. Nucleic Acids Res 40:e115–e115.
8. Darquet A-M, Cameron B, Wils P et al (1997) https://doi.org/10.1093/nar/gks596
A new DNA vehicle for nonviral gene delivery: 17. Nolan T, Huggett J, Sanchez E (2013) Good
supercoiled minicircle. Gene Ther 4:1341– practice guide for the application of quantita-
1349. https://doi.org/10.1038/sj.gt. tive PCR (qPCR). LGC
3300540
 Real-Time PCR Method for Recombination Efficiency Evaluation 131

18. Svec D, Tichopad A, Novosadova V et al 21. Alves CPA, Šimčı́ková M, Brito L et al (2018)
(2015) How good is a PCR efficiency estimate: Production and purification of supercoiled
recommendations for precise and robust qPCR minicircles by a combination of in vitro endo-
efficiency assessments. Biomol Detect Quantif nuclease nicking and hydrophobic interaction
3:9–16. https://doi.org/10.1016/j.bdq. chromatography. Hum Gene Ther Methods
2015.01.005 29:157–168. https://doi.org/10.1089/hgtb.
19. Bustin SA, Benes V, Garson JA et al (2009) The 2018.046
MIQE guidelines: minimum information for 22. Azzoni AR, Ribeiro SC, Monteiro GA, Pra-
publication of quantitative real-time PCR zeres DMF (2007) The impact of polyadenyla-
experiments. Clin Chem 55:611–622. tion signals on plasmid nuclease-resistance and
https://doi.org/10.1373/clinchem.2008. transgene expression. J Gene Med 9:392–402.
112797 https://doi.org/10.1002/jgm.1031
20. Forootan A, Sjöback R, Björkman J et al 23. Šimčı́ková M, Prather KLJ, Prazeres DMF,
(2017) Methods to determine limit of detec- Monteiro GA (2014) On the dual effect of
tion and limit of quantification in quantitative glucose during production of pBAD/AraC-
real-time PCR (qPCR). Biomol Detect Quantif based minicircles. Vaccine 32:2843–2846.
12:1–6. https://doi.org/10.1016/j.bdq. https://doi.org/10.1016/j.vaccine.2014.
2017.04.001 02.035
 Chapter 11

Gene Expression Quantification from Pathogenic Bacterial

Biofilms by Quantitative PCR
Angela França and Nuno Cerca

Abstract
Quantitative PCR (qPCR) is one of the most used techniques to quantify gene expression in bacterial
biofilms due to its easiness, sensitivity, and robustness. However, several practical aspects need to be
considered to obtain accurate and reliable results. Here, we describe a detailed and optimized protocol to
quantify mRNA transcripts from bacterial biofilms using qPCR, including pieces of advice to improve RNA
quality, which ultimately increases the accuracy, consistency, and relevance of gene expression data.

Key words Bacteria, Biofilms, Sample collection, RNA isolation, DNase treatment, RNA quality,
Complementary DNA synthesis, qPCR

1 Introduction

Gene expression analysis by quantitative PCR can be very useful for

the study of biofilm samples, having supported major break-
throughs over the years. However, these measurements can be
biased by several experimental conditions (Fig. 1), giving rise to
high variability among experiments and inaccurate and difficult-to-
interpret results. The workflow of gene expression quantification
assays by qPCR is lengthy, including numerous steps, namely,
(i) sample collection, (ii) RNA isolation, (iii) genomic DNA
removal/degradation, (iv) RNA quality assessment,
(v) complementary DNA synthesis, and (vi) the amplification and
quantification of cDNA synthesized molecules by qPCR. Several of
these experimental steps are known to introduce variability among
experiments, particularly RNA isolation [1, 2], cDNA synthesis
[3, 4], and qPCR thermal amplification [3]. Other factors can
also influence the reproducibility of gene expression assays. Sample
nature, for instance, can pose difficulties. It was shown that due to
the inherent cell heterogeneity, biofilm samples account for most of
the variability found in gene expression experiments [5]. Moreover,

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_11,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

133
134 Angela França and Nuno Cerca

Fig. 1 Schematic representation of the main factors impacting RNA quality and, consequently, the accuracy of
gene expression quantification. RNA quality has direct implications on the amount of RNA that is converted into
cDNA, which has a direct impact on qPCR quantification. Hence, care shall be taken to obtain high-quality RNA
for gene expression assays

besides the elements listed above, the quality of the RNA isolated is
one of the most critical aspects to consider in gene expression assays
[6–9]. Because of the natural regulation of mRNAs in response to
environmental stimuli [10], mRNA degrades quickly, and, thus,
diligent processes are essential to maintain the profile of mRNA
molecules being produced under the testing conditions. Overall, to
obtain representative gene expression data, it is important to be
aware of the good practices that support the isolation of high-
quality RNA. In this chapter, we describe a detailed and optimized
two-step protocol (cDNA synthesis and qPCR run performed sep-
arately) for gene expression quantification of biofilm samples by
qPCR, providing tips to improve RNA quality and, ultimately, data
reproducibility, accuracy, and relevance.

2 Materials

Before starting to prepare the reagents and consumables necessary,

all surfaces and equipment shall be thoroughly cleaned and, then,
treated with commercial or in-house prepared RNase-degrading
solutions, to avoid sample contamination with external RNases.
Also, it is required to prepare all solutions using certified RNase-
free water or reagents and consumables.
 Biofilm Cells Gene Expression Quantification by qPCR 135

2.1 Sample 1. RNA-stabilizing solution.

Collection and RNA 2. RNA isolation kit.
Isolation
3. Phosphate-buffered saline (PBS) solution or 0.9% NaCl.
4. Phenol (optional).
5. β-Mercaptoethanol (optional).
6. 70% ethanol.
7. Filter tips/RNase-free tips.
8. 1.5 and 2 RNase-free tubes.
9. 2 mL skirted RNase-free tubes with lids.
10. Acid-washed glass beads (sizes between 150 and 200 μm).
11. Cell disruptor.
12. Benchtop centrifuge.
13. Fume hood (if phenol and/or β-mercaptoethanol are used).

2.2 DNase Treatment 1. RNase-free DNase I kit (that includes enzyme, buffer
and EDTA).
2. Filter tips/RNase-free tips.
3. Thermal block (for 37 and 65 °C incubations).

2.3 RNA Quality 1. Agarose.

Assessment 2. Tris-acetate-EDTA (TAE) or Tris-borate-EDTA (TBE) buffers.
3. Nucleic acid staining solution.
4. 0.2 mL RNase-free tubes.
5. Filter tips/RNase-free tips.
6. Electrophoresis system.
7. Imaging system.
8. NanoDrop/spectrophotometer.

2.4 Complementary 1. Reverse transcriptase enzyme and buffer.

DNA Synthesis 2. dNTPs.
3. Random or specific reverse primers (10 μM).
4. RNase-free water.
5. 0.2 mL RNase-free tubes.
6. Filter tips/RNase-free tips.
7. Thermal cycler.

2.5 Quantitative PCR 1. qPCR master mix.

2. Forward and reverse primers (10 μM).
3. 1.5 mL DNase-free tubes.
4. 96-well plates and respective sealing sheets.
136 Angela França and Nuno Cerca

5. PCR-grade water.
6. Thermal cycler with fluorescence detection module (qPCR).

3 Methods

Before initiating any procedure, prepare all reagents and consum-

ables necessary to be able to proceed with RNA isolation, DNase
treatment, and complementary DNA synthesis without any unnec-
essary stops. Keep in mind the fast mRNA turnover.

3.1 Sample Sample collection is one of the most crucial steps in gene expression
Collection assays [11], as all the subsequent steps depend on initial sample
quality. During sample collection changes in gene expression profile
can occur due to specific (enzymatic) and nonspecific (mRNA life-
span) RNA degradation or due to transcriptional induction. Thus,
immediate stabilization is essential. For that, there are several com-
mercially available stabilizing solutions. If it is not possible to use
them, collect and process samples immediately:
1. Place biofilm plates on ice and remove the spent culture
medium.
2. Carefully wash biofilms once with phosphate-buffered saline
(PBS) to remove planktonic cells.
3. Immediately stabilize your sample by adding an
RNA-stabilizing solution into each well (see Note 1). From
then on, the RNA isolation procedure can be performed at
room temperature (see Note 2).
4. Harvest biofilm cells by scraping the bottom of the plate with a
tip or with the help of a 1 mL insulin syringe plunger.
5. Pool at least ten biofilms together (see Note 3).
6. Collect 1 mL of the pooled biofilm suspension, and centrifuge
following the stabilizing solution manufacturer’s indications
(see Note 3).

3.2 RNA Isolation RNA isolation is considered to be the second critical step when
performing gene expression assays [11]. There are several commer-
cially available kits for RNA isolation, and, depending on the lyses
method (chemical, enzymatic, or mechanical) and the isolation
principle (organic or columns), different kits will yield RNA with
varying quality levels [1, 2, 12]. It has been also demonstrated that
bacterial structures, such as Gram-positive or Gram-negative struc-
tures, along with the phenotype, planktonic or biofilm, can impact
the efficiency of the kit used [1, 2]. Herein, we present a protocol
that combines the efficacy of mechanical and chemical lysis with the
quickness of column-based isolation kits. As tested before, this
 Biofilm Cells Gene Expression Quantification by qPCR 137

protocol can be used with numerous column-based kits [3] and has
shown to be efficient in isolating high-quality RNA from a varied
array of samples, ranging from single biofilms formed by Staphylo-
coccus epidermidis [13, 14] and Gardnerella vaginalis [15] to com-
plex consortia associated with bacterial vaginosis [16] and
Staphylococcus aureus-Pseudomonas aeruginosa mixed biofilms
[17, 18]:
1. After stabilizing and centrifuging your sample, discard the
supernatant, and suspend the pellet in 500 μL of the lysis
buffer, previously supplemented with β-mercaptoethanol
(optional) and in 500 μL of molecular-grade phenol (optional)
(see Note 4). If phenol is not used, then add the volume of lysis
buffer indicated by the manufacturer.
2. Transfer the bacterial suspension into tubes with acid-washed
glass beads (see Note 5).
3. Place the tubes in a cell disruptor for 35 s at 6.5 m/s. To cool
the samples down, incubate the tubes on ice for 5 min. Repeat
this step 2 times more (see Note 6).
4. Centrifuge the lysate at 16,000 g for 2 min to remove cell
debris and bring the beads down.
5. Transfer the supernatant into a 2 mL RNase-free tube. Avoid
aspirating beads that may clog the RNA binding membrane,
reducing RNA yield.
6. Add an equal volume of 70% ethanol and mix by inverting the
tubes a couple of times (see Note 7).
7. Transfer the lysate into the RNA isolation column. Consider-
ing the maximum capacity of the isolation column, this step
may be repeated more than once.
8. Centrifuge the column at ≥10,000 g for 1 min (see Note 8).
Discard the flow-through and reuse the collection tube.
9. Add wash buffer 1 (see Note 9) and centrifuge at ≥10,000 g for
1 min. Discard the flow-through and reuse the collection tube.
10. Add wash buffer 2 (see Note 9) and centrifuge at ≥10,000 g for
1 min. Discard the flow-through and reuse the collection tube.
11. Add wash buffer 2 for a second time and centrifuge at
≥10,000 g for 2 min. Discard the flow-through and place the
column into a new collection tube.
12. Centrifuge the column (without any liquid) at ≥10,000 g for
3 min (see Note 10).
13. Transfer the column into a 1.5 mL RNase-free tube.
14. Add 50 μL of RNase-free water into the center of the mem-
brane (see Note 11), and incubate for 1 min at room
temperature.
15. Centrifuge the column at full speed for 2 min.
138 Angela França and Nuno Cerca

16. Immediately transfer RNA to ice or store at -20 °C or - 80 °

C, for short- or long-term storage, respectively.

3.3 Genomic DNA The presence of genomic DNA (gDNA) has important repercus-
Degradation/Removal sions in gene expression quantification, resulting in the detection of
false positives and/or difficult-to-interpret data [12]. Thus, the
reduction of gDNA contamination to minimal levels is crucial.
This is most often achieved by the addition of DNase I due to its
easiness and because there is no need to use hazardous chemicals.
Importantly, when using DNase I, the enzyme needs to be inacti-
vated at the end because, while with reduced activity (1–2%) [19], it
can also degrade mRNA/DNA hybrid molecules produced during
cDNA synthesis or double-stranded DNA products formed during
the qPCR run. DNase can be inactivated/removed from the reac-
tion in several ways, but the most common is inactivation by heat.
Hence, we present a protocol for a DNase treatment followed by
the inactivation of the enzyme by heat:
1. Add the indicated quantity of DNase enzyme (see Note 12) and
the respective buffer, and mix gently but thoroughly by
performing up and down.
2. Incubate the tubes at 37 °C for 30 min so the DNase can act.
3. Add the indicated quantity of EDTA and mix gently but thor-
oughly by performing up and down (see Note 13).
4. Incubate the tubes for 10 min at 65 °C.
5. Immediately transfer RNA to ice or safely store it at -20 °C or
-80 °C, for short- or long-term storage, respectively.

3.4 RNA Quality Since RNA quality can greatly impact gene expression quantifica-
Assessment tion [1, 2, 7, 9], it is imperative to ensure acceptable RNA quality
among comparing samples. RNA quality term includes RNA quan-
tity, purity, and integrity, and, so far, there is not a single method
that can examine all indicators at once. Usually, the quantity and
purity of RNA samples are determined by spectrophotometry and
RNA integrity by agarose gels. As such, we present a protocol for
both methods.

3.4.1 RNA Quantity and As referred to above, RNA quantity and purity are easily deter-
Purity mined by spectrophotometry, more specifically using a NanoDrop,
where only 1 μL of the sample is required:
1. Initialize the equipment by selecting the nucleic acids option
and, then, RNA.
2. Thoroughly clean the pedestal of the upper and lower arms
with water.
 Biofilm Cells Gene Expression Quantification by qPCR 139

3. Prepare the blank by adding 1 or 2 μL of water or buffer where

samples were eluted. Then, add a new drop of the blank and
ensure that is near zero.
4. Clean both pedestals and add 1 or 2 μL of the sample (see
Note 14). There is no need to clean the pedestal among
samples, but if analyzing several samples, from time to time,
ensure the blank is correct.
5. Write down the values for concentration (ng/μL) and A260/
A280 and A260/A230 ratios (see Note 15).

3.4.2 RNA Integrity Agarose gels, either under denaturant or non-denaturant condi-
tions, are one of the simplest and cheapest methods to evaluate
mRNA molecules’ integrity (Fig. 2). As such, a protocol for an
agarose gel under non-denaturant conditions is presented:
1. Clean all material needed for electrophoresis, including tanks,
trays, and combs with 0.1% sodium dodecyl sulfate (SDS) or
with 0.1 M of sodium hydroxide (NaOH) and 1 M EDTA
solution. In the alternative, commercial RNase-degrading solu-
tions may be used. Thereafter, rinse with plenty of RNase-free
or ultrapure water and protect all material from dust.
2. Prepare a 1% RNase-free agarose gel with Tris-acetate-EDTA
(TAE) or Tris-borate-EDTA (TBE) buffer (see Note 16).
3. Let agarose cool down and add nucleic acid staining solution.
4. Pour the gel and let it solidify (protect the gel from dust).

Fig. 2 Agarose gel, in non-denaturing conditions, of RNA samples. RNA integrity

is inferred by evaluating the conditions of the ribosomal RNA (rRNA) subunits:
intact rRNA shall show two sharp bands, corresponding to 23S and 16S rRNA
subunits, and the 23S rRNA band shall be as twice as intense as the 16S rRNA.
Keep in mind that samples with very different levels of integrity shall not be
compared. If you need a quantitative analysis, capillary electrophoresis with
fluorescence detection can be used instead
140 Angela França and Nuno Cerca

5. If possible, normalize the amount of RNA to 250 ng, in

RNase-free 0.2 mL tube and water, to get a smooth and easier-
to-interpret image (see Note 17).
6. Heat the sample for 5 min at 70 °C and then place the samples
immediately on ice (optional) (see Note 18).
7. Add the loading dye to your samples and load the gel.
8. Run the gel at 80 V for approximately 60 min.

3.5 Complementary cDNA synthesis is another important source of variability because

DNA Synthesis of the impact that RNA degradation and the presence of contami-
nants have on the efficiency of the reaction [7, 20, 21], which, in
turn, is dependent on the efficiency of the reverse transcriptase
(RT) enzyme:
1. In one 0.2 mL RNase-free tube, placed on ice, prepare a master
mix (see Note 19) with all the reagents necessary for the
reaction except for the RNA target, primers, and water
(Table 1).
2. Mix gently but thoroughly by pipetting up and down, and
centrifuge the tube to collect all the mixture at the bottom.
3. A control containing all the reagents except for the RT enzyme,
i.e., no RT control (NRT), needs to be prepared for each RNA
sample isolated to later assess the gDNA contamination level
(see Note 20). Hence, this has to be accounted for when
preparing the master mix.
4. In another 0.2 mL tube, placed on ice, add the RNA template
and primers (see Note 21), and fill up to the total volume of the
reaction (10 μL) (see Note 22) with water (Table 2). Consider
that 3 μL of the master mix needs to be added to each sample.
5. Incubate the tube with RNA, primers, and water for 5 min at
65 °C, and, then, cool the sample on ice for additional 5 min
(optional) (see Note 24).

Table 1
An example of cDNA synthesis master mix preparation. n, the total
number of samples to be analyzed

Component Volume (μL) Master mix

5× reaction buffer (with RNase inhibitor) 2 2×n+1
dNTPs 0.5 0.5 × n + 1
Reverse transcriptase (RT) enzyme 0.5 0.5 × n + 1
Total reaction volume 3 3 × (n + 1)
 Biofilm Cells Gene Expression Quantification by qPCR 141

Table 2
An example of sample preparation for cDNA synthesis reaction, in 10 μL of
volume

Component Volume (μL)

RNA template (≥ 40 ng) (see Note 23) 4
Primers (random or 10 μM reverse sequence-specific primer) 1 a

RNase-free water 2
Master mix (prepared in step 1) 3
Total reaction volume 10
a
In the case of reverse sequence-specific primers, ~1 μL of each primer, including
reference genes, needs to be added. The quantity of water may be reduced, or absent,
to accommodate the volume necessary for all reverse primers

6. Thereafter, mix the RNA sample with the master mix, and
centrifuge the samples briefly to burst possible bubbles created
during sample preparation.
7. Follow the thermal cycler conditions indicated by the manu-
facturer to complete cDNA synthesis and RT inactivation.
8. The newly synthesized cDNA may be immediately used or
stored until further use. For short-term storage (2 days),
cDNA can be placed at 4 °C, and for long-term storage, it is
advisable to store cDNA at -20 or - 80 °C.

3.6 Quantitative PCR Quantitative PCR can be used for the absolute or relative quantifi-
Run cation of gene expression. Due to its easiness and accuracy, relative
quantification is the most widely used method. However, to work
properly, a normalization strategy needs to be used to account for
the variability introduced by both biological and technical varia-
tions. Normalization with a reference gene is the most popular and
comprehensive normalization strategy. In this optimized protocol,
we use reference genes as the normalization strategy and SYBR®
Green dye for amplification quantification:
1. Dilute your cDNA, as well as NRT controls, at least 100× in
ultrapure water (see Note 25).
2. When evaluating the qPCR efficiency, which shall be deter-
mined every time a new set of primers are being used or
when qPCR master mixes are altered, from the first cDNA
dilution, prepare two- to tenfold dilutions (depending on the
abundance of the target), to obtain standard curves with at least
5 points (see Note 26). Consider that each dilution shall be
analyzed in triplicates.
3. Prepare the qPCR master mix for each of the genes under
study, including the reference genes, by mixing the
142 Angela França and Nuno Cerca

Table 3
An example of qPCR master mix preparation for a set of primers/target
genes, in 10 μL of volume. This has to be repeated to all sets of primers/
target genes under study

Component Volume (μL) Master mix

2× SYBR green Taq polymerase 5 5×n+1
Forward primer_gene#1 (10 μM) 0.5 0.5 × n + 1
Reverse primer_gene#1 (10 μM) 0.5 0.5 × n + 1
Water 2 2×n+1
Total reaction volume 10 10 × (n + 1)

components necessary, as detailed by the manufacturer. The

number of master mixes to be prepared is the same as the
number of genes being analyzed (Tables 3 and 4). Do not
forget to account for the NRT and no template controls
(NTC) (see Note 27) in your calculations.
4. Pipette 2 μL of diluted cDNA or NRT control directly into
each appropriated well. Each condition, including controls,
needs to be evaluated in triplicate. Discard replicates that have
≥0.5 difference in the cycle quantification (Cq) values.
5. Add 8 μL of each master mix into the appropriate wells, to
perform 10 μL of reaction volume (see Note 22). For each
sample being analyzed, both the reference and target genes
need to be quantified. Avoid forming bubbles, as this may
interfere with reading if they persist during the protocol. If
possible, perform a centrifugation step before starting the
PCR run.
6. Cover the plate with the plastic seal.
7. Run the protocol detailed by the manufacturer, including the
melt curve analysis (see Note 28).
8. The publication of the results obtained is the main objective of
the assays that we perform. To promote experimental transpar-
ency, please read the manuscript about the minimum informa-
tion for publication of qPCR experiments (MIQE) [11].

4 Notes

1. There are several RNA-stabilizing solutions in the market;

however, their efficacy was mostly tested with planktonic cul-
tures. As such, it is important to ensure that these solutions are
effective in penetrating and stabilizing biofilms.
Table 4
Examples of primers successfully used for quantification of transcription of genes classically associated with biofilm formation in Staphylococcus
epidermidis [3, 5, 29, 30]. To obtain primers for Staphylococcus aureus, Pseudomonas aeruginosa, or BV-associated bacteria, please see [15, 18]

Amplicon Efficiencya
Target gene Sequence 5′ ! 3′ size (bp) (%) Function

Biofilm Cells Gene Expression Quantification by qPCR

16S rRNAb Fw: GGGCTACACACGTGCTACAA 176 93 Reference gene
Rv: GTACAAGACCCGGGAACGTA
gyrBb Fw: GCATTTGGTACGGGTATTGG 88 93 Reference gene
Rv: CATCAACATCGGCATCAGTC
icaA Fw: TGCACTCAATGAGGGAATCA 134 90 Biosynthesis of poly-N-acetylglucosamine
Rv: TAACTGCGCCTAATTTTGGATT
Aap Fw: GCACCAGCTGTTGTTGTACC 190 95 Biosynthesis of accumulation-associated
Rv: GCATGCCTGCTGATAGTTCA protein
Fw forward, Rv reverse
a
Reaction efficiency depends on several factors, such as the qPCR enzymes, annealing temperature, sample nature, and quality. As such, the efficiency values presented, which were
determined at 60 °C, are merely indicative
b
More than one reference gene shall be used for the quantification of gene expression by qPCR

143
144 Angela França and Nuno Cerca

2. It is normally assumed that RNA isolation samples need to be

processed on ice. However, since all buffers used are detergent-
based, these may crystallize decreasing RNA purity. Therefore,
RNA isolation shall be done at room temperature, but as
quickly as possible. When using stabilizing solutions, RNA
molecules are protected and the isolation can be done safely
at room temperature.
3. Biological variability introduced by the growth in biofilm may
be minimized by pooling biofilms together and using a sample
of this mixture for gene expression quantification. For
S. epidermidis biofilms, a pool of ten individual biofilms was
sufficient to significantly reduce variability [5]. However, when
working with other bacterial species, please consider that opti-
mizations may be necessary. Keep in mind that too many
bacteria can decrease the yield and purity of the extracted
RNA, as the RNA isolation membranes have a maximum bind-
ing capacity.
4. The use of phenol and β-mercaptoethanol is optional; however,
when working with samples rich in RNases, the use of these
reagents may be helpful. Phenol and β-mercaptoethanol help
to maintain an RNase-free environment since they denature
proteins, including RNases. Additionally, phenol helps to lyse
cells, increasing the total RNA yield. Be aware though that
phenol and β-mercaptoethanol are hazardous reagents.
5. There are beads made of several materials (glass, zirconium, or
stainless steel) and different sizes. To lyse bacteria, glass or
zirconium beads with 150–200 μm are the most indicated. Be
aware that these beads need to be at least acid-washed to avoid
the presence of RNases. These tubes can be bought or can be
prepared in-house by transferring 0.4 g of acid-washed beads,
with sizes between 150 and 200, to a 2 mL safe lock tube [3],
under RNase-free conditions.
6. This lysis protocol was tested in both Gram-negative and
Gram-positive bacterial biofilms. However, if studying biofilms
formed by bacteria of other species or composed of mixed
species, the number and duration of cycles may need to be
optimized. If a cell disruptor is not available, there are adaptors
for vortex that can be used. Keep in mind that in this case, the
time of incubation with beads needs to be optimized.
7. The addition of ethanol is very important to allow the selective
binding of RNA molecules to the membrane of the column.
Ethanol should be freshly prepared as it tends to absorb water.
Do not forget to use RNase-free water for ethanol preparation.
8. Although the majority of the kits recommend 30 s of centrifu-
gation, centrifuging for 1 min may increase RNA yield.
 Biofilm Cells Gene Expression Quantification by qPCR 145

9. All column-based RNA isolation kits include two washing buf-

fers that need to be used sequentially to be able to remove
unwanted molecules and inhibitors.
10. Independent of the brand of the kit used, wash buffer 2 is
mainly composed of ethanol. Since ethanol carryover may
lead to incorrect estimates of relative target quantities [7], it
is important to ensure that any traces of ethanol are removed.
As such, an additional 3 min of centrifugation is required.
11. Ensure that the elution buffer or RNase-free water is dispensed
directly into the center of the silica membrane, without dis-
turbing the membrane. If the elution buffer/water is lost
within the walls of the column, RNA yield will be lower.
12. The quantity of DNase I will mainly depend on the enzyme
efficiency and the estimated gDNA contamination. Hence,
follow the manufacturer’s instructions.
13. Since RNA is very unstable at temperatures higher than 65 °C
when in the presence of divalent cations such as Ca2+ and Mg2+
[22], which are present in the buffer of the DNase, the DNase
inactivation is usually performed in the presence of an effective
chelating agent such as EDTA. This way, RNA is protected
from nonenzymatic heat-induced strand scission. However,
you can consider other methods for gDNA degradation/
removal (during RNA isolation, although normally less effi-
cient, and phenol extraction) or DNase I inactivation (highly
dense reagent that binds DNase I and divalent cations) that are
not deleterious for RNA sample.
14. Keep in mind that too concentrated samples can impact the
accuracy of the readings. Thus, sample dilution may be
necessary.
15. The contamination of the sample with proteins or carbohy-
drates and chemical contaminants such as phenol, chaotropic
salts, and EDTA is inferred, respectively, by the ratios A260/
A280 and A260/A230. The rule of thumb is that these ratios
should be equal to or higher than 2.0, so the sample can be
considered “pure.” However, the values of the purity indica-
tors are highly dependent on the pH and ionic strength of the
diluent used [23]. For that reason, low salt buffers such as Tris-
EDTA are normally used to accurately determine these purity
indicators.
16. Considering that we are not interested in assessing the size of
the bands, a non-denaturant gel is enough. In addition, the
preparation of an agarose gel in non-denaturant conditions
avoids the use of hazardous chemicals.
17. The quantity of total RNA necessary to be visualized in a gel
will depend on several aspects such as the sensitivity of the
146 Angela França and Nuno Cerca

nucleic acid staining solution or imaging system. Hence, the

quantity suggested may need to be determined experimentally.
18. This heat-cool cycle will break RNA secondary structures
which will help to linearize the molecule and improve its elec-
trophoretic mobility. This step is important if you want to
determine the length of the ribosomal subunits. If not, this
step is not essential.
19. The preparation of a master mix is very important to avoid
sample-to-sample variations. Of note, you shall always prepare
a master mix for more samples than the ones you need. If you
have five samples, then you need to do at least six samples
(n + 1) to account for pipetting errors.
20. It is virtually impossible to get rid of all contaminating gDNA
and, thus, gDNA will always be present in the sample. Then,
what is important is to determine the level of contamination in
the sample during the qPCR run. While a difference of five
cycles between the signal of the NRT control and the specific
signal usually indicates irrelevant contamination with gDNA
[24], we prefer to set the limit to ten cycles of difference.
21. Ten μL reactions are used since we have previously shown that
the reaction volume can be reduced in several kits without
losing accuracy [3].
22. For cDNA synthesis in prokaryotes, two types of priming
strategies can be used: (i) random and (ii) sequence-specific
reverse primers. Although the last is normally more sensitive,
giving better results when working with small gene expression
alterations, random primers are more flexible, as one single
cDNA synthesis can be used to quantify the expression of
several genes of interest. Furthermore, random primers can
help surpass the difficulties in reverse sequence-specific primers
binding in degraded samples. However, one shall consider that
the use of random primers can lead to an overestimation of
copy numbers.
23. It has been shown that the use of amounts below 40 ng of total
RNA may lead to inconsistent results [4]. In addition, it is also
advisable to use the same concentration of RNA to try to
ensure that the reaction in all tubes is similar, with comparable
efficiencies [20].
24. This heat-cool step helps to break secondary structures
improving primer binding and ultimately the efficiency of the
cDNA synthesis reaction.
25. We have observed that too concentrated samples may inhibit
the qPCR and result in non-reproducible results [3, 25]. How-
ever, inhibitors effect dependent, to some extent, on the sus-
ceptibility of the enzyme used for molecule amplification, with
 Biofilm Cells Gene Expression Quantification by qPCR 147

some qPCR kits being more influenced than others by the

presence of inhibitors [3].
26. Due to the presence of inhibitors, one cannot assume that the
amount of target cDNA doubles after each cycle. Hence, for
proper quantification, the efficiency of the reaction (with each
pair of primes) needs to be experimentally determined and shall
fall between 90% and 110%. The efficiency of the reaction of
both the target and reference genes shall be within the indi-
cated range if using the Livak method for data analysis [26]. In
the alternative, the Pfaffl model can be used [27]. The most
used method to determine reaction efficiency is the dilution
curve method, which consists in running a set of serial dilutions
of a target cDNA [11, 28]. Linear regression is then drawn,
and using the slope value obtained, amplification efficiency can
be determined.
27. No template control (NTC) includes all PCR reagents except
for the template. This is used to identify reagent contamination
and primer-dimer product amplification.
28. The generation of a melt curve is mandatory when using
SYBR® Green as detection chemistry. If one single peak is
observed, it means that only one product, with the same
sequence, is being produced. On the other hand, when the
reaction is either not specific or efficient, more than one prod-
uct will be produced, and more than one peak will be visualized
in the melting peak. In this situation, several optimizations
need to be performed, such as using different melting tem-
peratures or different primer concentrations or even choosing a
new pair of primers.

Acknowledgments

This work was funded by the Portuguese Foundation for Science

and Technology (FCT) under the scope of the strategic funding of
the unit (UIDB/04469/2020), EXPL/BIA-MIC/0032/2021
and EXPL/SAU-INF/1000/2021.

References
1. França A, Bento JC, Cerca N (2012) Variability Res Notes 4:572. https://doi.org/10.1186/
of RNA quality extracted from biofilms of 1756-0500-4-572
foodborne pathogens using different kits 3. França A, Freitas AI, Henriques AF, Cerca N
impacts mRNA quantification by qPCR. Curr (2012) Optimizing a qPCR gene expression
Microbiol 65:54–59. https://doi.org/10. quantification assay for S. epidermidis biofilms:
1007/s00284-012-0124-5 a comparison between commercial kits and a
2. França A, Melo LD, Cerca N (2011) Compari- customized protocol. PLoS One 7:e37480.
son of RNA extraction methods from biofilm https://doi.org/10.1371/journal.pone.
samples of Staphylococcus epidermidis. BMC 0037480
148 Angela França and Nuno Cerca

4. Sieber MW, Recknagel P, Glaser F et al (2010) biofilms: a transcriptomic analysis by

Substantial performance discrepancies among RNA-seq. Appl Microbiol Biotechnol 98:
commercially available kits for reverse tran- 2585–2596. https://doi.org/10.1007/
scription quantitative polymerase chain reac- s00253-014-5548-3
tion: a systematic comparative investigator- 15. Castro J, França A, Bradwell KR et al (2017)
driven approach. Anal Biochem 401:303–311. Comparative transcriptomic analysis of Gard-
https://doi.org/10.1016/J.AB.2010.03.007 nerella vaginalis biofilms vs. planktonic cul-
5. Sousa C, França A, Cerca N (2014) Assessing tures using RNA-seq. NPJ Biofilms
and reducing sources of gene expression varia- Microbiomes 3:1–7. https://doi.org/10.
bility in Staphylococcus epidermidis biofilms. 1038/s41522-017-0012-7
BioTechniques 57:295–301. https://doi.org/ 16. Castro J, Rosca AS, Muzny CA, Cerca N
10.2144/000114238 (2021) Atopobium vaginae and Prevotella
6. Fleige S, Pfaffl MW (2006) RNA integrity and bivia are able to incorporate and influence
the effect on the real-time qRT-PCR perfor- gene expression in a pre-formed Gardnerella
mance. Mol Asp Med 27:126–139. https:// vaginalis biofilm. Pathogens 10:1–16.
doi.org/10.1016/j.mam.2005.12.003 h t t p s : // d o i . o r g / 1 0 . 3 3 9 0 /
7. Carvalhais V, Delgado-Rastrollo M, Melo PATHOGENS10020247
LDR, Cerca N (2013) Controlled RNA con- 17. Magalhães AP, França A, Pereira MO, Cerca N
tamination and degradation and its impact on (2022) Unveiling co-infection in cystic fibrosis
qPCR gene expression in S. epidermidis bio- airways: transcriptomic analysis of Pseudomonas
films. J Microbiol Methods 95:195–200. aeruginosa and Staphylococcus aureus dual-
https://doi.org/10.1016/j.mimet.2013. species biofilms. Front Genet 13:883199.
08.010 https://doi.org/10.3389/fgene.2022.
8. Fleige S, Walf V, Huch S et al (2006) Compar- 883199
ison of relative mRNA quantification models 18. Magalhães AP, França Â, Pereira MO, Cerca N
and the impact of RNA integrity in quantitative (2019) RNA-based qPCR as a tool to quantify
real-time RT-PCR. Biotechnol Lett 28:1601– and to characterize dual-species biofilms. Sci
1613. https://doi.org/10.1007/S10529- Rep 9:13639. https://doi.org/10.1038/
006-9127-2 s41598-019-50094-3
9. Vermeulen J, De Preter K, Lefever S et al 19. Sutton DH, Conn GL, Brown T, Lane AN
(2011) Measurable impact of RNA quality on (1997) The dependence of DNase I activity
gene expression results from quantitative PCR. on the conformation of oligodeoxynucleotides.
Nucleic Acids Res 39:e63. https://doi.org/10. Biochem J 321(Pt 2):481–486. https://doi.
1093/NAR/GKR065 org/10.1042/BJ3210481
10. Doma MK, Parker R (2007) RNA quality con- 20. Ståhlberg A, Håkansson J, Xian X et al (2004)
trol in eukaryotes. Cell 131:660–668. https:// Properties of the reverse transcription reaction
doi.org/10.1016/J.CELL.2007.10.041 in mRNA quantification. Clin Chem 50:509–
11. Bustin SA, Benes V, Garson JA et al (2009) The 515. https://doi.org/10.1373/clinchem.
MIQE guidelines: minimum information for 2003.026161
publication of quantitative real-time PCR 21. Ståhlberg A, Kubista M, Pfaffl M (2004) Com-
experiments. Clin Chem 55:611–622. parison of reverse transcriptases in gene expres-
https://doi.org/10.1373/CLINCHEM. sion analysis. Clin Chem 50:1678–1680.
2008.112797 https://doi.org/10.1373/CLINCHEM.
12. Rump LV, Asamoah B, Gonzalez-Escalona N 2004.035469
(2010) Comparison of commercial RNA 22. AbouHaidar MG, Ivanov IG (1999)
extraction kits for preparation of DNA-free Non-enzymatic RNA hydrolysis promoted by
total RNA from salmonella cells. BMC Res the combined catalytic activity of buffers and
Notes 3:1–5. https://doi.org/10.1186/ magnesium ions. Z Naturforsch C 54:542–
1756-0500-3-211/TABLES/3 548. https://doi.org/10.1515/ZNC-1999-
13. França A, Carvalhais V, Maira-Litrán T et al 7-813
(2014) Alterations in the Staphylococcus epider- 23. Wilfinger WW, Mackey K, Chomczynski P
midis biofilm transcriptome following interac- (1997) Effect of pH and ionic strength on the
tion with whole human blood. Pathog Dis 70: spectrophotometric assessment of nucleic acid
4 4 4 – 4 4 8 . h t t p s : // d o i . o r g / 1 0 . 1 1 1 1 / purity. BioTechniques 22:474–481. https://
2049-632X.12130 doi.org/10.2144/97223ST01
14. Carvalhais V, França A, Cerca F et al (2014) 24. Laurell H, Iacovoni JS, Abot A et al (2012)
Dormancy within Staphylococcus epidermidis Correction of RT–qPCR data for genomic
 Biofilm Cells Gene Expression Quantification by qPCR 149

DNA-derived signals with ValidPrime. Nucleic recommendations for precise and robust qPCR
Acids Res 40:e51–e51. https://doi.org/10. efficiency assessments. Biomol Detect Quantif
1093/NAR/GKR1259 3:9–16. https://doi.org/10.1016/j.bdq.
25. Huggett JF, Novak T, Garson JA et al (2008) 2015.01.005
Differential susceptibility of PCR reactions to 29. Freitas AI, Lopes N, Oliveira F et al (2018)
inhibitors: an important and unrecognised Comparative analysis between biofilm forma-
phenomenon. BMC Res Notes 1:70. https:// tion and gene expression in Staphylococcus epi-
doi.org/10.1186/1756-0500-1-70 dermidis isolates. Future Microbiol 13:415–
26. Livak KJ, Schmittgen TD (2001) Analysis of 4 2 7 . h t t p s : // d o i . o r g / 1 0 . 2 2 1 7 / f m b -
relative gene expression data using real-time 2017-0140
quantitative PCR and the 2-ΔΔCT method. 30. Gaio V, Lopes N, Cerca N, França A (2021)
Methods 25:402–408. https://doi.org/10. codY and pdhA expression is induced in Staphy-
1006/meth.2001.1262 lococcus epidermidis biofilm and planktonic
27. Pfaffl MW, Pfaffl MW (2001) A new mathemat- populations with higher proportions of viable
ical model for relative quantification in real- but non-Culturable cells. Front Cell Infect
time RT-PCR. Nucleic Acids Res 29:e45. Microbiol 11. https://doi.org/10.3389/
https://doi.org/10.1093/nar/29.9.e45 FCIMB.2021.771666
28. Svec D, Tichopad A, Novosadova V et al
(2015) How good is a PCR efficiency estimate:
 Chapter 12

A Real-Time Quantitative PCR Protocol for the Quantification

of Plasmid Copy Number in Lactococcus lactis
Sofia O. D. Duarte and Gabriel A. Monteiro

Abstract
The determination of the number of plasmid copies in each cell of Lactococcus lactis is critical for the control
and regulation of the production of recombinant proteins and plasmids. This protocol describes a method
for the determination of the plasmid copy number per genome of L. lactis, which is based on the detection
by real-time quantitative PCR of the number of plasmid molecules and the number of chromosomes and
subsequently their ratio after calculating the amplification efficiency.

Key words Lactococcus lactis, Plasmid copy number, Real-time quantitative PCR

1 Introduction

The majority of the plasmid copy number (PCN) determination

protocols developed for bacteria were tested using Escherichia coli.
However, the relevance of using food-grade and GRAS (generally
recognized as safe) bacteria increased in recent years, leading to the
necessity of adapting these protocols for Gram-positive bacteria
and, more specifically, lactic acid bacteria. These types of bacteria
have different cell wall characteristics when compared with Gram-
negative bacteria, which makes it more challenging to accurately
measure the PCN. The protocol for Lactococcus lactis PCN deter-
mination by real-time quantitative PCR was adapted from the
method developed by Carapuça et al. [1] together with the relative
quantification method developed by Skulj et al. [2]. This protocol
was validated and its results were published in Duarte et al. [3].

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_12,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

151
152 Sofia O. D. Duarte and Gabriel A. Monteiro

2 Materials

2.1 L. lactis PCN Prepare all solutions using PCR-grade water (prepared by filtering
Determination by Real- Milli-Q water with a 0.1 μm syringe filter and then autoclaved) and
Time Quantitative PCR analytical-grade reagents. Prepare and store all reagents at room
temperature (unless indicated otherwise). Filter tips should be used
while preparing all the dilutions and solutions. Diligently follow all
waste disposal regulations when disposing of waste materials:
1. Primer design:
(a) Appropriate primer design software (see Note 1).
2. Genomic and plasmid DNA standards preparation:
(a) Commercial kit for gDNA and pDNA purification.
(b) Microcentrifuge tubes.
(c) Filter tips.
(d) PCR-grade water.
(e) 0.5 M EDTA stock solution: Weigh the EDTA disodium
salt and add 800 mL of Milli-Q water. Adjust the pH to
8.0 with sodium hydroxide pellets (see Note 2). Adjust the
volume to 1 L using a volumetric flask.
(f) TAE 50×: 2 M Tris base, 50 mM EDTA disodium salt,
1 M acetic acid. Solubilize the three components in
800 mL of distilled water in a suitable container. Adjust
the volume to 1 L using a volumetric flask.
(g) TAE 1×: Dilute the TAE 50x solution using Milli-Q
water.
(h) 1% agarose gel: To do a 50 mL gel, add 0.5 g of agarose to
50 mL of TAE 1×. Microwave until totally dissolved (see
Note 3).
3. L. lactis cell growth:
(a) 15 mL tubes.
(b) M17 medium: Suspend 42.25 g in 1 L distilled water. Mix
until dissolved. Dispense into 15 mL tubes. Sterilize by
autoclaving at 121 °C for 15 min.
4. Real-time qPCR:
(a) Cooling block.
(b) Real-time qPCR appropriate capillaries and lids (see Note
4).
(c) Microcentrifuge tubes.
(d) Filter tips.
(e) PCR-grade water.
(f) SYBR Green mixture kit.
 Quantification of Plasmid Copy Number in Lactococcus Lactis 153

(g) Forward and reverse primers: The lyophilized primer

should be resuspended in the correct volume to obtain a
final primer concentration of 100 mM. Dilute the primers
ten times with PCR-grade water, in order to achieve a
concentration of 10 mM.

3 Methods

3.1 L. lactis PCN Carry out all procedures at room temperature unless otherwise
Determination by Real- specified:
Time Quantitative PCR
1. Primer design: Design two sets of forward and reverse primers,
one specific to a sequence present in the plasmid and the other
specific to a conserved single-copy sequence present in the
L. lactis strain chromosome (see Note 5). Synthesize
(or order) the primers.
2. Genomic DNA standards preparation: Purify gDNA from an
overnight culture of the plasmid-free strain, using an appropri-
ate kit. Perform its quantification using a microvolume spec-
trophotometer and assess its quality by agarose gel
electrophoresis. Serially dilute the gDNA using PCR-grade
water in order to achieve the following masses: 1, 10,
100, 1000, and 10,000 pg per reaction (see Note 6).
3. Plasmid DNA standards preparation: Purify pDNA from an
overnight culture of the strain harboring the backbone plasmid
(see Note 7), using an appropriate kit. Perform its quantifica-
tion using a microvolume spectrophotometer and assess its
quality by agarose gel electrophoresis. Serially dilute the
pDNA using PCR-grade water in order to achieve the follow-
ing masses: 1, 10, 100, 1000, and 10,000 pg per reaction (see
Note 8).
4. Plasmid-free cell preparation: Grow overnight the plasmid-free
strain in a 15 mL tube containing 5 mL of M17 medium.
Calculate the necessary volume to spike each pDNA standard
with 1000 cells, diluting in PCR-grade water if necessary (see
Notes 9 and 10).
5. Sample preparation: Grow overnight each plasmid-harboring
strain in a 15 mL tube containing 5 mL of M17 medium.
Calculate the necessary volume for each reaction having 1000
cells, diluting in PCR-grade water if necessary (see Note 11).
6. Real-time qPCR: For each 20 μL reaction mixture, mix 2 μL of
10× SYBR Green mix, 1 μL of each primer (final concentration
0.5 μM), 1.6 μL of MgCl2 (final concentration 3 mM), and
10.4 μL of PCR-grade water, and the remaining volume was
completed with the samples (4 μL with 1000 cells containing
154 Sofia O. D. Duarte and Gabriel A. Monteiro

the different plasmids) or with pDNA (2 μL of pDNA plus 2 μL

with 1000 spiking cells) or gDNA (4 μL) standards (see Notes
12 and 13). Keep the reagents at 4 °C using a cooling block.
Include negative controls without cells and without pDNA
or gDNA in all cycling reactions, as well as at least one point of
each standard curve for experimental validation.
Protect the SYBR Green reagent from light. Run the reac-
tions in a detection system using an appropriate SYBR Green
kit. The cycling conditions should be as follows: initial dena-
turation for 10 min at 95 °C, followed by 40 cycles of 10 s at
95 °C, 5 s at 57 °C, and 14 s at 72 °C (see Note 14). The
fluorescence signal is detected and quantified automatically by
the instrument at the end of each extension step. To confirm
that only the desired specific targets were amplified, perform
melting curve analyses by making a temperature gradient of
0.05 °C/s from 70 to 95 °C. Lastly, cool down the samples to
40 °C for 30 s. Each sample should be analyzed separately using
the two sets of primers. Perform each sample and standard in
triplicate.
7. Plasmid copy number quantification: The software from the
detection equipment determines automatically the crossing
point (CP) values, using the second derivative maximum
method. Determine the standard curves for pDNA and
gDNA by plotting the logarithm of each concentration against
the CP values (Fig. 1).
Estimate each linear regression equation, and use the slope
of each standard curve to determine the amplification efficiency
(E) according to Eq. (1):
- 1
E = 10 slope ð1Þ
Knowing the amplification efficiencies of both the pDNA
(Ep) and gDNA (Eg) standards, as well as the CP values for
each sample amplified independently with the two primer sets
(CPp with plasmid primer set and CPg with gDNA primer set),
calculate the PCN of each sample using Eq. (2) (see Note 15):

EgCPg
PCN = ð2Þ
EpCPp

8. qPCR validation: Check the melting temperature (Tm) of each

amplicon in order to verify the specificity of the real-time qPCR
amplification. Also, run the content of each capillary in a 1%
agarose gel, and check if the amplicons with the expected sizes
for each set of primers are visible, confirming the specificity of
all the performed reactions. Analyze the CPs from the negative
 Quantification of Plasmid Copy Number in Lactococcus Lactis 155

Fig. 1 Example of plasmid and chromosome DNA standard curves using real-time qPCR equipment. The
plasmid standard curve was performed in triplicate, using four log serial dilutions of pDNA spiked with L. lactis
LMG19460 cells, while the chromosome standard curve was performed using five log serial dilutions of
non-spiked gDNA. The linear regression trendlines are represented. The equation for the plasmid standard
curve is y = -3.46x + 23.68, with a R2 of 0.996 and an efficiency of 94.68%. The equation for the
chromosome standard curve is y = -3.33x + 27.76, with a R2 of 0.997 and an efficiency of 99.77%. The
primers to quantify the pTRKH3 plasmid targeted the erythromycin resistance gene (erm) and had the
following sequences: forward primer, CTTCGTTATGATTTTACA, and reverse primer, CAATATCAACAATTCCAT
(amplified sequence with 190 bp). The primers designed to quantify the L. lactis LMG19460 chromosome
targeted the ferrous iron transport protein A ( feoA) gene and had the following sequences: forward,
TCAGACGCCGCTTGATGGAC, and reverse, AGTTCAAGAGGGTCGCCAAGTG (amplified sequence with 89 bp)

controls without cells and without pDNA or gDNA in order to

check if background amplification could be considered negligi-
ble. Evaluate the validity of the qPCR results by determining
the coefficient of determination (R2) and by calculating the
percentage of amplification efficiency of each standard curve,
using Eq. (3):

- 1
Eð%Þ = 10 slope - 1 × 100 ð3Þ

Determine the quality and integrity of the pDNA in each

analyzed sample by purifying pDNA from OD = 20 samples,
using an appropriate plasmid isolation kit. Quantify the pDNA
in a microvolume spectrophotometer and analyze the isoforms
by agarose gel electrophoresis.
9. Statistical analysis: Determine the average PCN from the dif-
ferent cycling reactions for each independent growth, and then
calculate the average and inter-assay variability by determina-
tion of the standard error of the mean (SEM). When necessary,
perform a t-student statistical test (differences were considered
statistically significant when p < 0.05).
156 Sofia O. D. Duarte and Gabriel A. Monteiro

4 Notes

1. Examples of freely available primer design software are Primer-

Quest™ Tool from Integrated DNA Technologies or Oligo-
Perfect Designer from Thermo Fisher Scientific.
2. EDTA solution will only solubilize when the pH is near
8. Closely monitor the pH decrease while adding the sodium
hydroxide pellets, using a magnetic stirrer to keep the solution
homogeneous.
3. Microwaving the agarose solution will make it lose water. That
amount of water should be added at the end. Register the
initial weight of the flask containing the agarose solution,
and, in the end, bring the weight to its initial value, by adding
Milli-Q water.
4. The described protocol was developed and optimized for a
capillary real-time qPCR detection system, but with appropri-
ate adjustments, it should work in a microplate-based system.
5. Primers should have a GC content between 40% and 60%, with
the 3′ of the primer ending in a G or C to promote binding.
The length should be between 18 and 30 bases, and the melt-
ing temperature should not differ more than 5 °C between
forward and reverse primers. Try to avoid secondary structure
formation and nucleotides/dinucleotides repeats. The ampli-
con size should not exceed 200 bp. The plasmid sequence for
the primer design could be chosen from an antibiotic resistance
gene or reporter gene sequence. The other pair of primers
should be chosen from a conserved single-copy sequence pres-
ent in the L. lactis strain chromosome, such as the ferrous iron
transport protein A ( feoA) chromosomal single-copy gene of
L. lactis [3].
6. Each gDNA dilution must have a concentration that allows
using a constant volume of 4 μL for each point of the standard
curve.
7. If the goal is to compare the PCN of different plasmid deriva-
tives, the calibration curve should be performed using the
backbone plasmid, i.e., the parental plasmid without
modifications.
8. Each pDNA dilution must have a concentration that allows
using a constant volume of 2 μL for each point of the standard
curve.
9. Prepare a dilution that allows to have 1000 cells in each 2 μL, in
order to keep a constant volume in each reaction.
 Quantification of Plasmid Copy Number in Lactococcus Lactis 157

10. The pDNA standard curve reactions were spiked with 1000
L. lactis cells without plasmid, to ensure that the samples and
the pDNA standards have the same putative inhibitors. Since
the L. lactis genome of the cells used to spike the capillaries
could mislead the gDNA quantification, the gDNA standard
reactions should not be spiked with plasmid-free cells.
11. Prepare a dilution that allows to have 1000 cells in each 2 μL, in
order to keep a constant volume in each reaction.
12. If the SYBR Green mix is not a HotStart one, ensure that it is
the last component to be added to the reaction.
13. We recommend preparing each reaction mixture separately in
microcentrifuge tubes. Each tube should be thoroughly mixed
using a vortex and then spun in a tabletop microcentrifuge.
Next, each reaction could be transferred to the top part of the
capillary. Before closing the lid, the capillary should be spiked
in a tabletop microcentrifuge to ensure that all the reaction
volume moves to the bottom of the capillary.
14. The amplification parameters may need to be adjusted, consid-
ering the SYBR Green kit specificities and the primers melting
temperature.
15. Each parameter in the equation should be the average value of
at least three independent experiments.

Acknowledgments

This work was supported by FCT-Portuguese Foundation for Sci-

ence and Technology (project grant PTDC/BTM-SAL/28624/
2017) and funding received from FCT, Fundação para a Ciência e a
Tecnologia, I.P., in the scope of the project UIDB/04565/2020
and UIDP/04565/2020 of the Research Unit Institute for Bioen-
gineering and Biosciences, iBB, and the project LA/P/0140/2020
of the Associate Laboratory Institute for Health and
Bioeconomy—i4HB.

References

1. Carapuça E, Azzoni AR, Prazeres DM, Mon- processes. Microb Cell Factories 7:6. https://
teiro GA, Mergulhao FJ (2007) Time-course doi.org/10.1186/1475-2859-7-6
determination of plasmid content in eukaryotic 3. Duarte SOD, Martins MC, Andrade SM, Pra-
and prokaryotic cells using real-time PCR. Mol zeres DMF, Monteiro GA (2019) Plasmid copy
Biotechnol 37(2):120–126 number of pTRKH3 in Lactococcus lactis is
2. Skulj M, Okrslar V, Jalen S, Jevsevar S, Slanc P, increased by modification of the repDE
Strukelj B, Menart V (2008) Improved determi- ribosome-binding site. Biotechnol J 14(8):
nation of plasmid copy number using quantita- e1800587. https://doi.org/10.1002/biot.
tive real-time PCR for monitoring fermentation 201800587. Epub 2019 May 20. PMID:
31009171
 Chapter 13

Improved PCR by the Use of Disruptors, a New Class

of Oligonucleotide Reagents
Yong Ma and Minxue Zheng

Abstract
As a powerful tool, polymerase chain reaction (PCR) has been indispensable and widely used in a large array
of applications. In practice, many factors may affect the overall performance of a PCR. One such factor is the
stability of intramolecular secondary structure formed within single-stranded template. The higher the
stability of such a structure, the more likely it will have adverse effects on PCR performance. Traditionally,
chemical reagents believed to reduce the stability of nucleic acid secondary structures, such as DMSO and
betaine, have been used to mitigate their adverse effects on PCR performance. However, these reagents
have apparent downsides including increasing replication error rate, inhibiting polymerase activity, and
being ineffective against secondary structures of very high stabilities. Disruptors, a new class of oligonucle-
otide reagents, do not exhibit such downsides. They are specifically designed to target intramolecular
secondary structures only without any effect on the replication of other regions of the template. Their
effective concentration range for improving PCR performance is well tolerated by PCR. And they are very
effective in improving PCR performance on templates that are notoriously difficult to amplify by PCR even
in the presence of DMSO or betaine, e.g., the inverted terminal repeat of adeno-associated virus
(AAV-ITR). In this chapter, the application of disruptors in PCR is described with AAV-ITR as the example
template.

Key words Polymerase chain reaction (PCR), Intramolecular secondary structure, Disruptor, Free
energy (ΔG), Adeno-associated virus (AAV), Inverted terminal repeat (ITR)

1 Introduction

PCR is a molecular biology technique that can amplify a segment of

a specific sequence, or an amplicon, with an existing DNA molecule
as the starting template [1]. Due to its versatility and high sensitiv-
ity, PCR has been widely used in a large variety of applications
including basic biomedical research, disease diagnosis, food safety,
public health surveillance, as well as industrial biotechnology [2–6].
During the PCR, double-stranded template DNA is denatured
into two complementary single DNA strands, allowing the binding
of two sequence-specific primers to their respective template

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_13,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

159
160 Yong Ma and Minxue Zheng

strands in the annealing step [7]. The primer-template hybrid

molecules are then recognized and extended by DNA polymerase
during the elongation step, resulting in the generation of two
double-stranded daughter molecules. Thus repeated cycles of dena-
turation, annealing, and elongation can lead to exponential ampli-
fication of the amplicon sequence.
In practice, many factors that can affect the fidelity, efficiency,
sensitivity, and specificity of a PCR need to be considered when
designing a successful reaction [7–11]. One such factor is the
presence of stable intramolecular secondary structure within ampli-
con sequence [12]. After the denaturation step of each PCR cycle,
complementary sequences within single-stranded templates can
form intramolecular secondary structures [13]. If such structures
are sufficiently stable, they may interfere with the primer extension
by DNA polymerase (Fig. 1). First, stable intramolecular secondary
structures may stall the progression of polymerase, leading to

Fig. 1 Diagram to illustrate the proposed mechanism of disruptor function. In the absence of disruptors, primer
binding and intramolecular secondary structure formation occur during temperature drop and annealing step.
Taq polymerase extends primer until encountering stable intramolecular secondary structure. Due to the
interference of such a structure, the following three outcomes may occur. First, polymerase stalls, resulting in
premature termination of elongation. Second, polymerase destabilizes the intramolecular secondary structure
through cleavage within its duplex region to generate truncated PCR product. Finally, polymerase continues
elongation to generate full-length PCR product at a low frequency. In the presence of disruptors, besides
primer binding and intramolecular secondary structure formation, the anchor of a disruptor binds to template
during temperature drop and annealing step. While polymerase extends primer, the effector of bound disruptor
unwinds the intramolecular secondary structure by strand displacement. And then polymerase continues
elongation to generate full-length product
 Improve PCR Performance with Disruptors 161

premature termination of elongation [12]. Second, when encoun-

tering a stable intramolecular secondary structure, Taq DNA poly-
merase may cleave template DNA within the duplex region of the
structure through its endonuclease activity [14]. The resulting
unwinding of the intramolecular secondary structure allows Taq
DNA polymerase to continue elongation, leading to the produc-
tion of truncated PCR products. Third, without template cleavage,
stable intramolecular secondary structure may still be unwound at
low frequency for polymerase to continue elongation to generate
full-length PCR product. Regardless of the specific interfering
mechanism, stable intramolecular secondary structures within tem-
plate DNA can significantly reduce the overall performance of a
PCR assay.
Many chemical reagents have been employed to improve PCR
performance of templates containing stable intramolecular second-
ary structures. For example, believed to be capable of reducing
thermal stabilities of secondary structures, dimethylsulfoxide
(DMSO) [15] and betaine [16] have been widely used to facilitate
PCR of GC-rich template. However, such reagents have their
shortcomings. First, their effects are not sequence-specific. Besides
reducing the stability of intramolecular secondary structures, they
may also have the adverse effect of reducing fidelity of PCR, leading
to higher error rate [17]. Second, for template DNA containing
extremely stable intramolecular secondary structures, the
PCR-improving effects of these reagents are minimal [18]. Finally,
the reagents themselves may interfere with Taq polymerase
activity [19].
Disruptors, a new class of oligonucleotide reagents, can signifi-
cantly improve PCR performance on templates containing stable
intramolecular secondary structures without the above shortcom-
ings of chemical reagents [18]. First, they are specifically designed
to compete for intramolecular secondary structure formation with-
out any impact on the replication of other template regions. Sec-
ond, disruptors can be very effective in improving PCR
performance of template DNA containing extremely stable intra-
molecular secondary structures that chemical reagents have little or
no effect on. One example of the drastic difference in
PCR-improving effects between disruptors and chemical reagents
involves the PCR amplification of the inverted terminal repeat
sequence (ITR) of adeno-associated virus (AAV) that contains an
extremely stable T-shaped hairpin structure (Fig. 2) [18, 20]. Lastly,
the concentrations of disruptors at which they can exert the maxi-
mal PCR-improving effects are well tolerated by PCR. The pro-
posed mechanism of disruptor function involves the binding of the
anchor region of disruptor close to the intramolecular secondary
structure and subsequent unwinding of the structure by the effec-
tor region of the bound disruptor through the process of strand
displacement (Fig. 1).
162 Yong Ma and Minxue Zheng

Fig. 2 PCR amplification of the ITR sequence of a rAAV vector plasmid was successful in the presence of
disruptors but not DMSO or betaine. (a) The characteristic T-shaped hairpin structure of this AAV-ITR
sequence. Failed PCR amplification in the absence and presence of 2–15% DMSO (b) and 0.5–2 M betaine
(c) was shown by 3% agarose gel electrophoresis. (d) In contrast, the AAV-ITR was successfully amplified by
PCR in the presence of 2 μM disruptors

In this chapter, the design and application of disruptors will be

illustrated with AAV-ITR as an example of PCR templates contain-
ing stable intramolecular secondary structures.

2 Materials

2.1 PCR 1. Template DNA. It is preferable to use purified DNA dissolved

in nuclease-free deionized water or 1× TE (10 mM Tris–HCl,
1 mM EDTA, pH 8.0) buffer as template. Store template DNA
solution at -20 °C and avoid repeated freezing and thawing.
 Improve PCR Performance with Disruptors 163

2. PCR primers, TaqMan probe if developing a real-time quanti-

tative PCR and disruptors (see Note 1). For best PCR perfor-
mance, HPLC- or PAGE-purified oligonucleotides are
recommended. Resuspend lyophilized oligonucleotides in
nuclease-free deionized water or 1× TE buffer to an appropri-
ate concentration as stock solutions. Store the solutions at
-20 °C and avoid repeated freezing and thawing.
3. Hotstart Taq DNA polymerase with proofreading activity. Any
brand of validated polymerase, e.g., EzAmp MPX Taq DNA
Polymerase (NuHigh Biotechnologies, Inc., Suzhou, China),
can be used. Store at -20 °C.
4. PCR buffer, usually supplied together with DNA polymerase,
e.g., NuHi 5× MgCl2-free PCR buffer (NuHigh Biotechnolo-
gies, Inc., Suzhou, China) (see Note 2). Store at -20 °C.
5. 1 M MgCl2 stock solution supplied by vendors or prepared
in-house. For in-house preparation, dissolve 20.33 g
MgCl2·6H2O in nuclease-free deionized water to a final vol-
ume of 100 mL. Sterilize the solution by autoclaving or filter-
ing through a filter unit of 0.22 μM pore size. Store at room
temperature.
6. Deoxyribonucleoside triphosphate mix (dNTPs) containing
dATP, dGTP, dCTP, and dTTP at equal concentration, usually
10 mM for each dNTP. Store at -20 °C.
7. Nuclease-free, deionized water prepared in-house or purchased
from vendors.
8. 0.2 mL PCR microtubes, 8-well PCR strips, or 96-well PCR
microplates.
9. Thermal cycler.

2.2 Agarose Gel 1. Agarose, molecular biology grade.

Electrophoresis 2. Either of two widely used DNA electrophoresis buffers, TAE
and TBE (see Note 3). 50× stock TAE solution: 2.0 M Tris
base, 1.0 M acetic acid, and 0.05 M EDTA. 10× stock TBE
solution: 0.9 M Tris base, 0.9 M boric acid, and 0.02 M EDTA.
3. 6× stock solution of DNA loading buffer purchased or
prepared in-house: 0.25% (w/v) bromophenol blue, 0.25%
(w/v) xylene cyanol FF, 15% (w/v) Ficoll 400, 60 mM
EDTA, and 10 mM Tris–HCl, pH 7.6.
4. 10 mg/mL ethidium bromide stock solution (see Note 4).
5. DNA molecular weight marker appropriate to the expected size
of PCR product.
6. Agarose gel electrophoresis equipment including gel casting
tray, combs, electrophoresis chamber, and power supply.
7. Gel imaging and documentation system, e.g., Gel Doc XR+
system (Bio-Rad, Richmond, CA, USA).
164 Yong Ma and Minxue Zheng

3 Methods

When designing a new PCR assay, in addition to the routine con-

sideration for well-known factors affecting PCR performance
including sequences and concentrations of primers and probe,
thermal cycling conditions and the composition of reaction mixture
including enzyme and dNTPs concentrations, pH, ionic strength,
and Mg2+ concentration, it is a good practice to perform intramo-
lecular secondary structure prediction of the amplicon sequence. If
a stable intramolecular secondary structure is predicted, the sim-
plest way to avoid potentially poor PCR performance is to select
another sequence region as amplicon if the purpose of PCR allows.
However, in applications that amplicon sequences are defined, e.g.,
single nucleotide polymorphism detection, the presence of stable
intramolecular secondary structures warrants the consideration of
introducing disruptors to preclude the adverse effects of such
structures.

3.1 Secondary In silico prediction of intramolecular secondary structures of single-

Structure Prediction of stranded DNA can be performed on DNA Folding Form page of
Amplicon Sequence UNAFold Web Server (http://www.unafold.org/mfold/
applications/dna-folding-form.php) [21] (see Note 5). The most
important information required by the software is the nucleotide
sequence of the intended amplicon. For most analysis and output
parameters, default entries are usually sufficient for a successful
prediction targeted for PCR design. Among the results returned
by the software, the most relevant information is the predicted
structures and their respective stabilities represented by free energy
(ΔG), which can be found in circular structure plots. Below the
analysis process is illustrated with AAV-ITR sequence as an
example:
1. Enter AAV-ITR as the sequence name (see Note 6).
2. Enter AAV-ITR amplicon sequence in the designated text box
(see Note 7).
3. Select either “linear” or “circular” as the sequence type. For
AAV-ITR, select the default option of “linear.”
4. Enter 60 °C as folding temperature (see Note 8).
5. For ionic conditions, enter 50 mM Na+ and 3 mM Mg2+ (see
Notes 8 and 9).
6. For the remaining parameters, default values or options will
be used.
7. Press “Fold DNA” button to perform the analysis.
8. For our AAV-ITR sequence, the software returns six predicted
structures with ΔG values ranging from -33.51 kcal/mol to
-32.54 kcal/mol (see Note 10). The circular structure plots
 Improve PCR Performance with Disruptors 165

Fig. 3 The intramolecular secondary structures predicted by UNAFold web server for full-length AAV-ITR
amplicon (a) and trimmed AAV-ITR sequence (b). For the full-length amplicon, in addition to the T-shaped
hairpin structure (green triangle), the predicted structure contains another two standalone small hairpin
structures, which also contribute to the -33.51 kcal/mol free energy of the entire structure. To determine the
free energy of the T-shaped hairpin structure itself, the full-length amplicon is trimmed on both ends to leave
five nucleotides just outside of the T-shaped hairpin structure. As expected, only the same T-shaped hairpin
structure is predicted by the software for the trimmed sequence, and its free energy is calculated as -
32.49 kcal/mol

can be downloaded as a single zip file or as individual plots.

Each plot shows the structure at nucleotide level and the ΔG
value of the entire structure. The characteristic T-shaped hair-
pin structure of AAV-ITR is successfully predicted for the most
stable structure (ΔG = -33.51 kcal/mol, Fig. 3a). It is also
present in the other five predicted structures, and the differ-
ences among all six structures reside in the sequences outside of
the T-shaped hairpin structure.
9. In addition to the common T-shaped hairpin structure, each
predicted structure contains other structural elements that also
contribute to the overall stability of the entire structure. There-
fore, to obtain the stability of T-shaped hairpin structure itself,
a second round of prediction needs to be performed. Thus the
original AAV-ITR input sequence is trimmed on both ends to
leave five nucleotides outside of the T-shaped hairpin structure.
166 Yong Ma and Minxue Zheng

The trimmed sequence is then subjected to structure predic-

tion. As expected, the T-shaped hairpin structure is the only
structural element predicted, and the ΔG value of -
32.49 kcal/mol represents its stability (Fig. 3b).

3.2 Disruptor Design 1. The threshold of stability level of a predicted intramolecular

secondary structure, at which disruptors are required for PCR,
depends on its intended usage. Disruptors are usually not
needed for PCR that high performance is not absolutely
required, e.g., PCR-mediated site-directed mutagenesis with
relatively high concentration of pure plasmid as template. On
the other hand, disruptors will be required when high overall
performance is critical for the successful application of a PCR
assay, e.g., rare mutation detection from clinical samples for
disease diagnosis.
2. Each disruptor includes three functional parts, the 3′ anchor
sequence complementary to template sequence just outside of
predicted stable intramolecular secondary structure, the 5′
effector sequence complementary to the adjacent 3′ sequence
within predicted stable intramolecular secondary structure, and
a 3′ adduct that can prevent the recognition of disruptor by Taq
polymerase for elongation (Fig. 4) (see Note 11).

Fig. 4 The three parts of a disruptor exemplified with AAV-ITR sequence: effector
(red), anchor (green), and 3′ adduct. The AAV-ITR region complementary to both
anchor and effector sequences is marked in blue. The 3′ adduct can be any
chemical moiety that can prevent disruptor elongation by polymerase, such as
minor groove binders, inverted DNA nucleotides, 3-carbon spacers, etc.
 Improve PCR Performance with Disruptors 167

Fig. 5 PCR amplification of AAV-ITR in the absence and presence of disruptors of

different lengths. (a) qPCR results indicate that among all the tested disruptors,
the two showing the best PCR-improving effects are 32 nt and 36 nt in length but
not the two of longer lengths. (b) When examined by 3% agarose gel electro-
phoresis, the band intensities of qPCR products mirror the Ct values of qPCR
results

3. For each PCR, two different disruptors can be designed to

target the two template strands. While adding either one of
the two disruptors can improve PCR performance, adding
both disruptors will provide the most improvement.
4. The optimal lengths of anchor and effector sequences of a
disruptor can be determined empirically. As an example,
Fig. 5 shows the results of such an experiment for AAV-ITR
disruptors (see Note 12).

3.3 PCR 1. Other than the inclusion of disruptors, the composition of

PCR mixture including template DNA, primer and probe,
dNTPs, polymerase, Mg2+, and PCR buffer is the same to
routine PCR (see Note 13).
168 Yong Ma and Minxue Zheng

Fig. 6 PCR amplification of AAV-ITR in the absence and presence of 36-nt

disruptors at different concentrations. (a) qPCR results indicate that the optimal
disruptor concentration for improving PCR performance is between 1 and 3 μM.
(b) The band intensities of qPCR products in agarose gel electrophoresis are
consistent with the Ct values of qPCR results

2. The optimal disruptor concentration can be determined empir-

ically. As an example, Fig. 6 shows the results of such an
experiment for AAV-ITR disruptors.
3. No special step is required for the cycling program of
disruptor-containing PCR (see Note 14).

3.4 Result Analysis 1. For real-time quantitative PCR, the software output files for
thermal cycler can be analyzed according to manufacturer’s
instructions.
2. For traditional PCR, routine agarose gel analysis can be used
for result analysis.
 Improve PCR Performance with Disruptors 169

4 Notes

1. Primer design software are recommended for the design of PCR

primers and probes. Many free online or downloadable software
are well suited for this purpose, such as Primer-BLAST (https://
www.ncbi.nlm.nih.gov/tools/primer-blast/), PrimerQuest
(https://sg.idtdna.com/Primerquest/Home/Index), Primer3-
Plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/
primer3plus.cgi/), and PerlPrimer (https://perlprimer.
sourceforge.net/). If manual design is required, the following
design rules should be followed as much as possible: GC content
of 40–60%, less than 2 °C difference between the Tms of forward
and reverse primers, the desired annealing temperature less than
5 °C below the Tms of both primers, the Tm of TaqMan probe
5–10 °C higher than those of primers, avoiding sequences that
may form hairpins or primer-dimers, avoiding runs of four or
more of the same base, and performing BLAST search to avoid
nonspecific amplification.
2. Some commercial PCR buffers can be supplied with or without
Mg2+. Mg2+-free PCR buffers are preferred in our laboratory
because they can provide a wider range of Mg2+ concentration
for optimization.
3. Mostly TAE and TBE buffers are interchangeable for DNA gel
electrophoresis. However, they do have minor differences that
can be considered when deciding which buffer to use for better
results. First, TBE resolves smaller DNA fragments (< 2 kb)
better than TAE, whereas TAE resolves larger DNA fragments
better than TBE. Second, TBE has better conductivity than
TAE so that it is less likely to be overheating during long
electrophoresis runs. Third, borate can inhibit enzyme activ-
ities and should not be used if DNA needs to be purified for
downstream enzymatic reactions.
4. Ethidium bromide is the traditional visualization dye for DNA
electrophoresis. However, it is highly toxic as a mutagen and
requires extreme caution during handling. Protective personal
equipment, i.e., lab coat, gloves, face shield, etc., are required
when working with ethidium bromide. It is also recommended
to avoid preparing solution with ethidium bromide powder
in-house, rather purchase stock solution directly from suppliers
to reduce the possibility of exposure.
5. In addition to UNAFold web server, other free online software
can also be used for intramolecular secondary structure predic-
tion of single-stranded DNA, such as RNAfold (http://rna.tbi.
univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi), RNAs-
tructure (http://rna.urmc.rochester.edu/RNAstructureWeb/
Servers/Predict1/Predict1.html), and KineFold (http://
kinefold.curie.fr/).
170 Yong Ma and Minxue Zheng

6. Input of sequence name is optional. It can be left blank if

preferred.
7. For this case, the AAV-ITR amplicon sequence is from the
recombinant AAV vector plasmid, pFastBacDual-ITR-
CMV-EGFP. Since primer and probe binding sites are located
outside ITR itself, the amplicon also contains a stretch of
plasmid vector sequence.
8. As the purpose of intramolecular secondary structure predic-
tion here is for PCR design, it is preferable to enter the
intended annealing temperature as folding temperature and
desired Na+ and Mg2+ concentrations for ionic conditions.
9. The default unit of ionic concentration is M. Make sure to
enter the correct numbers or change the unit to mM.
10. It is very common for the software to predict multiple different
structures of different ΔG levels for the same input sequence.
The differences among the structures are usually the results of
different combinations of distinct structural elements.
11. As the function of 3′ adduct is to prevent disruptor-initiated
replication, any chemical moiety that prevents elongation by
polymerase can be used, including minor groove binders,
inverted DNA nucleotides, 3-carbon spacers, or even a stretch
of nucleotides not complementary to template sequence as
short as a tetranucleotide.
12. In this example, the anchor and effector sequences of each
disruptor have the same length. This is not absolutely required
for a functional disruptor. For the best performance, the
anchor and effector sequences of a disruptor can be indepen-
dently tested, and they do not have to be of the same length.
13. Similar to the development of any new PCR, optimization of
primer and probe sequences and concentrations of various
components of the reaction mixture are required to achieve
the best PCR performance.
14. Similarly, optimization of temperatures and durations of vari-
ous steps of the PCR cycling program is also required to
achieve the best PCR performance.

References

1. Saiki RK et al (1985) Enzymatic amplification 4. Khodakov D, Wang C, Zhang DY (2016)

of beta-globin genomic sequences and restric- Diagnostics based on nucleic acid sequence
tion site analysis for diagnosis of sickle cell variant profiling: PCR, hybridization, and
anemia. Science 230(4732):1350–1354 NGS approaches. Adv Drug Deliv Rev 105
2. Zhu H et al (2020) PCR past, present and (Pt A):3–19
future. BioTechniques 69(4):317–325 5. Tang WL, Zhao H (2009) Industrial biotech-
3. Postollec F et al (2011) Recent advances in nology: tools and applications. Biotechnol J
quantitative PCR (qPCR) applications in food 4(12):1725–1739
microbiology. Food Microbiol 28(5):848–861
 Improve PCR Performance with Disruptors 171

6. Tiwari A et al (2022) Application of digital endonuclease activity of Taq DNA polymerase.

PCR for public health-related water quality Gene 764:145095
monitoring. Sci Total Environ 837:155663 15. Varadaraj K, Skinner DM (1994) Denaturants
7. Waters DL, Shapter FM (2014) The polymer- or cosolvents improve the specificity of PCR
ase chain reaction (PCR): general methods. amplification of a G + C-rich DNA using genet-
Methods Mol Biol 1099:65–75 ically engineered DNA polymerases. Gene
8. Cha RS, Thilly WG (1993) Specificity, effi- 140(1):1–5
ciency, and fidelity of PCR. PCR Methods 16. Henke W et al (1997) Betaine improves the
Appl 3(3):S18–S29 PCR amplification of GC-rich DNA sequences.
9. Elnifro EM et al (2000) Multiplex PCR: opti- Nucleic Acids Res 25(19):3957–3958
mization and application in diagnostic virology. 17. Hardjasa A et al (2010) Investigating the
Clin Microbiol Rev 13(4):559–570 effects of DMSO on PCR Fidelity using a
10. Schrader C et al (2012) PCR inhibitors – restriction digest-based method
occurrence, properties and removal. J Appl 18. Liu Z et al (2021) Disruptors, a new class of
Microbiol 113(5):1014–1026 oligonucleotide reagents, significantly
11. Vallone PM, Butler JM (2004) AutoDimer: a improved PCR performance on templates con-
screening tool for primer-dimer and hairpin taining stable intramolecular secondary struc-
structures. BioTechniques 37(2):226–231 tures. Anal Biochem 624:114169
12. McDowell DG, Burns NA, Parkes HC (1998) 19. Montgomery JL, Wittwer CT (2014) Influ-
Localised sequence regions possessing high ence of PCR reagents on DNA polymerase
melting temperatures prevent the amplification extension rates measured on real-time PCR
of a DNA mimic in competitive PCR. Nucleic instruments. Clin Chem 60(2):334–340
Acids Res 26(14):3340–3347 20. Lusby E, Fife KH, Berns KI (1980) Nucleotide
13. Chen C et al (2007) Influence of secondary sequence of the inverted terminal repetition in
structure on kinetics and reaction mechanism adeno-associated virus DNA. J Virol 34(2):
of DNA hybridization. Nucleic Acids Res 402–409
35(9):2875–2884 21. Zuker M (2003) Mfold web server for nucleic
14. Liu Z et al (2021) Transient stem-loop struc- acid folding and hybridization prediction.
ture of nucleic acid template may interfere with Nucleic Acids Res 31(13):3406–3415
polymerase chain reaction through
 Chapter 14

Mitochondrial DNA D-Loop Amplification and Sequencing

for Species Differentiation in Milk
Marlene Baptista and Lucı́lia Domingues

Abstract
Adulteration of dairy products, mainly through the substitution of high-quality milk for lower-quality milk,
results in the production of low-value products, raising health, social, and economic concerns. As such, the
development of methods to ensure dairy products’ safety and quality is of great concern for governments
and consumers. Although several methods have been developed for species differentiation in dairy pro-
ducts, their application and the establishment of reliable molecular markers for authentication purposes still
need to be improved. In this chapter, we describe a low-cost, sensitive, fast, and reliable PCR-based method
for mitochondrial D-loop DNA amplification for efficient detection of cattle milk in binary mixtures with
sheep milk, thereby allowing the authentication of processed dairy products.

Key words Species differentiation, Milk adulteration, Dairy authentication, DNA extraction and
purification, Food quality, Mitochondrial D-loop DNA

1 Introduction

Food fraud for economic gain has increasingly become a worldwide

problem, mainly driven by rapid innovation in the food sector and
consumers’ requirements. In the dairy industry, adulteration
involves, most of the time, the undeclared substitution of high-
quality milk with cheaper/lower-quality milk, thereby resulting in
the commercialization of lower-quality/lower-value products. The
growing consumers’ awareness of food fraud events in dairy, among
other factors, is driving the improvement or establishment of more
reliable authentication methods to ensure food safety and quality.
As a result, DNA-based methods have been replacing protein-based
techniques for authenticating processed dairy products due to their
higher sensitivity and reproducibility. Since Lipkin et al. (1993)
demonstrated that DNA can be extracted from somatic cells pres-
ent in milk [1], PCR became the most used method for the identi-
fication of animal origin in dairy products. Furthermore, several

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_14,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

173
174 Marlene Baptista and Lucı́lia Domingues

PCR-based methods have been developed to identify milk from

different species in dairy products, including real-time [2–6], mul-
tiplex [7–12], and restriction fragment length polymorphism
(RFLP) PCR [13, 14]. The detection limit of these methods for
species differentiation has been reported to be as low as 0.01% of
contaminated species.
Commonly, PCR-based methods target genes belonging to the
mitochondrial genome, such as cytochrome b, 12S and 16S rRNA,
cytochrome c oxidase subunit I (COI), ATP synthase membrane
subunit 6 encoding gene (ATP6), and NADH-ubiquinone oxido-
reductase chain 1 encoding gene (ND1), due to their high copy
number, absence of introns, low recombination rate, and high
conservation in a species [15]. The control region of the mitochon-
drial DNA, or D-loop, is a noncoding region located between the
tRNA genes of phenylalanine and proline that also present those
characteristics. This region has been used for the identification of
polymorphisms and maternal origin of ewe breeds [16].
The implementation of molecular methods for detecting food
fraud in traditional products has been complicated due to technical
process conditions. Moreover, the establishment of reliable and
universal molecular markers for species differentiation will be cru-
cial for the standard application of PCR-based methods for dairy
product authentication. Considering this, in this chapter we
describe a PCR-based protocol, relying on the amplification of
the mitochondrial D-loop DNA, for species differentiation in
milk samples. This approach requires previous knowledge of the
size and sequence of the mitochondrial D-loop of the species
usually found in dairy products, which is available in the public
database NCBI. Next-generation sequencing (NGS) can be used to
confirm which species are present given the uniqueness of the
D-loop in each species. The technique consists of the amplification
of the mitochondrial D-loop DNA using primers described in the
literature [17], separation of the PCR product(s) in agarose gels,
and sequencing. Species differentiation is accomplished due to
varying sizes and sequences of the mitochondrial D-loop DNA.

2 Materials

2.1 Equipment 1. Microtubes (0.2 mL PCR tubes and 1.5 mL microcentrifuge

tubes).
2. Pipettes and pipette tips.
3. Microcentrifuge.
4. Incubator with orbital shaking.
5. Fume hood.
6. Microvolume UV-Vis spectrophotometer.
 Species Differentiation by PCR for Dairy Authentication 175

7. Thermal cycler.
8. Agarose gel electrophoresis apparatus.
9. UV transilluminator with a gel documentation unit.

2.2 Supplies and 1. Milk samples stored at -20 °C (to prevent contamination and
Reagents degradation).
2. Clearing solution: 0.25 M EDTA, pH 8.0, 0.5% Triton X-100.
3. Extraction buffer: 10 mM Tris–HCl, pH 7.5, 150 mM NaCl,
2 mM EDTA, pH 8.0, and 1% SDS.
4. 5 M guanidine hydrochloride.
5. 20 mg/mL proteinase K.
6. Phenol-chloroform-isoamyl alcohol (25:24:1) pH 8.0.
7. Sterile ultrapure water.
8. Ethanol 100%.
9. Oligonucleotide primers: Ordered at a synthesis scale of
0.01 μmol and salt-free purification. Working solutions at
20 μM were prepared from a 100 μM stock solution to avoid
contamination of the stock and repeated freeze-thaw cycles.
10. Taq DNA polymerase: As an example, this protocol works
using the NZYTaq II DNA polymerase, supplied with a 10×
reaction buffer and a 50 mM MgCl2 solution (NZYTech,
Portugal).
11. dNTPs, 10 mM each.
12. 1X Tris-acetate-EDTA (TAE) buffer: 40 mM Tris, 20 mM
acetate, 1 mM EDTA, pH 8.5.
13. 1% (w/v) agarose gels (in 1× TAE buffer) with 0.05% (v/v)
GreenSafe Premium (NZYTech, Portugal), or equivalent.
14. Molecular weight marker, NZYDNA Ladder VII (NZYTech,
Portugal) or equivalent.
15. Gel Loading Dye, Purple or Blue (6X) (New England Biolabs,
USA), or equivalent.
16. QIAquick Gel Extraction Kit (Qiagen, Germany) or
equivalent.

3 Methods

3.1 Total DNA 1. Mix 1 mL of milk sample with 0.5 mL of clearing solution and
Extraction in Milk centrifuge at 12,500 × g for 5 min. Remove as much as possible
of the resulting cream pad and supernatant (see Note 1).
2. Lyse the pellet comprising the somatic cells by resuspending it
in 860 μL of extraction buffer, 100 μL of 5 M guanidine
hydrochloride, and 20 μL of 20 mg/mL proteinase K. Incubate
for 3 h or o/n (for higher efficiency) at 55 °C, 80 rpm.
176 Marlene Baptista and Lucı́lia Domingues

3. Cool samples at room temperature. In a fume hood, add

500 μL of phenol-chloroform-isoamyl alcohol mixture (25:
24:1), and centrifuge at 12,500 × g for 15 min. Collect the
clear aqueous top phase containing the nucleic acids (see
Note 2).
4. Precipitate DNA by adding 800 μL of ice-cold ethanol 100%,
and centrifuge at 4 °C and 12,500 × g for 30 min to separate
contaminants (supernatant) from the DNA (pellet). Discard
the supernatant and let the pellet dry in a fume hood or an
incubator (see Note 3).
5. Elute the DNA in 30 μL of sterile ultrapure water pre-warmed
at 50 °C (to facilitate DNA solubilization), and determine its
concentration and purity in a microvolume UV-Vis spectro-
photometer (see Note 4).

3.2 PCR 1. Prepare primers reported by [17] (Table 1), according to the
Amplification of description in step 9, Sect. 2.2.
Mitochondrial D-Loop 2. For the PCR amplification of the mitochondrial D-loop region
DNA from milk samples, prepare the following reaction mixture:
• 10× reaction buffer: 5 μL.
• 50 mM MgCl2: 4 μL.
• 10 mM dNTPs: 2.5 μL.
• 20 μM primer PRO: 2.5 μL.
• 20 μM primer PHE: 2.5 μL.
• 5 U/μL Taq polymerase: 0.25 μL.
• Template DNA: 200 ng.
• Sterile ultrapure water: up to 50 μL.
3. Perform the reaction in a thermal cycler as outlined in Table 2.
4. Load at least 5 μL of PCR product on 1% agarose gel in TAE
and run in the same buffer at 80 V for 90 min.
5. According to the number of bands visualized in the gel, it is
possible to infer the number of animal species present in the
milk sample. Moreover, the size of the bands could indicate the
species present by comparison with data deposited in the NCBI
for the mitochondrial D-loop region size (see Note 7).

Table 1
Primers for mitochondrial D-loop amplification

Primer name Primer sequence (5’→3’)

PRO CACCATCAACCCCCAAAGCTGAAG
PHE CAGTGCCTTGCTTTGGGTTAAGC
 Species Differentiation by PCR for Dairy Authentication 177

Table 2
PCR conditions for mitochondrial D-loop amplification

Number of cycles Step Temperature (°C) Time (seconds)

1 Initial denaturation 95 120

Denaturation 95 60
35 Annealing 56 60
Extension 72 30
1 Final extension 72 300

6. Excise the bands from the agarose gel, and purify the DNA
using the QIAquick Gel Extraction Kit, or equivalent. Send the
resulting purified fragments for sequencing (for instance, to
Eurofins Genomics) (see Note 8).
7. Perform sequence alignment with known mitochondrial
D-loop regions deposited in NCBI to identify the species.

3.3 Validation 1. Prepare binary mixtures of pasteurized and unpasteurized cow

milk in ewe milk. In those mixtures, five different percentages
of cow’s milk (1%, 5%, 10%, 25%, and 50% (v/v)) are added in a
final volume of 1 mL.
2. Extract DNA from the milk mixtures according to the details in
Sect. 3.1.
3. Perform PCR amplification according to the details in
Sect. 3.2.
4. Analyze the number and size of the bands in agarose gel.
Figure 1 shows an example of the PCR products obtained
when testing the binary mixtures described in this section.
5. The steps described in this section can be repeated by preparing
new milk mixtures, using eventually different milk samples, and
different percentages of contaminant milk to ensure
reproducibility.

4 Notes

1. The amount of somatic cells in milk is affected by many factors,

including the species of the source organism, the animal itself,
the lactation state, the season, and the feeding, among others.
As such, in some cases, a volume greater than 1 mL may be
required to attain a suitable DNA concentration for the PCR
(see Note 4).
178 Marlene Baptista and Lucı́lia Domingues

Fig. 1 PCR products obtained from different binary mixtures of cow and ewe’s milk (CM and EM, respectively)
using primers PRO and PHE. MM, molecular marker; NTC, no template control. Lanes 1, 2, 3, 4, and 5 are from
mixtures containing 1% CM-99% EM, 5% CM-95% EM, 10% CM-90% EM, 25% CM-75% EM, and 50%
CM-50% EM of unpasteurized cow milk. Lanes 6, 7, 8, 9, and 10 are from mixtures containing identical
percentages of pasteurized cow milk

2. DNA extraction from organic samples using the phenol-

chloroform-isoamyl alcohol results in the formation of two
separate phases: a top phase, composed of nucleic acids, and a
bottom organic phase, composed of denatured proteins. The
collection of the nucleic acids phase should be performed
carefully to avoid contamination with the protein-rich phase
since proteins are considered PCR inhibitors (see Note 5).
3. Ethanol 100% should be stored at -20 °C before use for
efficient DNA precipitation since its solubility is decreased at
lower temperatures. The supernatant should be carefully
removed to prevent DNA from being accidentally discarded
in cases where the pellet seems invisible/transparent, mostly
due to low DNA concentration. DNA pellet can be dried at
room temperature for 3 h, at 30 °C for 1 h, or at 50 °C for
30 min. Temperatures above 50 °C should be avoided to
prevent DNA from forming strong precipitates that can be
difficult to further solubilize.
4. The DNA extraction method described in this chapter is advan-
tageous compared to other methods due to the higher DNA
concentration attained, but still, the presence of contaminants
(such as proteins), which affect PCR efficiency, is recurrent (see
Notes 5 and 6). As such, we recommend from our experience
the use of DNA templates with concentrations of DNA above
30 ng/μL as this will indicate that the inhibitors concentration
will not be enough to inhibit the PCR. In the same sense, we
recommend the use of DNA templates with purity ratios of
 Species Differentiation by PCR for Dairy Authentication 179

A260/280 higher than 1.6 and A260/230 higher than 1.0, as

smaller ratios indicate high contamination with protein or
organic compounds, respectively.
5. Common PCR inhibitors present in dairy product samples
include proteinases, high-fat content (especially in butter and
cheese), and calcium ions. Also, residual chemicals used in the
DNA extraction process, such as EDTA, phenol, ethanol, and
isopropanol, can negatively affect PCR performance.
6. As an alternative to the phenol-chloroform-isoamyl alcohol
method described in this chapter, we suggest silica-based
extraction, in which DNA is purified by selective and reversible
binding to a silica matrix present in a column. Several commer-
cial kits consisting of silica-based columns are available, and we
have experienced the DNeasy Blood & Tissue Kit (Qiagen).
This method is more reproducible, efficient, less time-
consuming, and more environmentally sustainable than
phenol-chloroform extraction. Nonetheless, phenol-
chloroform extraction is probably the most used method due
to the good integrity, high purity, and yield of the
obtained DNA.
7. Primers described in this chapter can be used for mammal
species differentiation in dairy products, as long as the mito-
chondrial D-loop DNA of different species is sufficiently differ-
ent in size to be separated in an agarose gel. Higher resolution
can be achieved by running the gel at a lower voltage for a
longer period. For D-loop regions with very similar sizes,
internal primers can be designed to facilitate species
identification.
8. As an alternative to directly sequence the purified PCR pro-
ducts, those can be cloned into a commercial vector by TA
cloning when Taq polymerase is used for amplification, such as
pGEM-T Easy vector, or similar. After that, the final plasmids
with the desired fragment can be sent to sequence, thereby
ensuring higher coverage of the sequence.

Acknowledgments

This work was supported by the ProDOP Serra da Estrela

(PDR2020-101-032096) funded by PDR2020, Programa de
Desenvolvimento Rural 2014–2020, Portugal 2020, European
Agricultural Fund for Rural Development (EAFRD), and the Por-
tuguese Foundation for Science and Technology (FCT) under the
scope of the strategic funding of UIDB/ 04469/2020 and of
Marlene Baptista PhD scholarship (2020.06888.BD) and by
LABBELS—Associate Laboratory in Biotechnology, Bioengineer-
ing and Microelectromechanical Systems, LA/P/0029/2020.
180 Marlene Baptista and Lucı́lia Domingues

References
1. Lipkin E, Shalom A, Khatib H et al (1993) 9. Gonçalves J, Pereira F, Amorim A, van Asch B
Milk as a source of deoxyribonucleic acid and (2012) New method for the simultaneous
as a substrate for the polymerase chain reaction. identification of cow, sheep, goat, and water
J Dairy Sci 76:2025–2032 buffalo in dairy products by analysis of short
2. Liao J, Liu YF, Ku T et al (2017) Qualitative species- specific mitochondrial DNA targets. J
and quantitative identification of adulteration Agric Food Chem 60:10480–10485
of Milk powder using DNA extracted with a 10. Guo L, Qian JP, Guo YS et al (2018) Simulta-
novel method. J Dairy Sci 100:1657–1663 neous identification of bovine and equine DNA
3. Di Domenico M, Di Giuseppe M, Wicochea in milks and dairy products inferred from tri-
Rodrı́guez JD, Cammà C (2017) Validation of plex Taq man real-time PCR technique. J Dairy
a fast real-time PCR method to detect fraud Sci 101:6776–6786
and mislabeling in Milk and dairy products. J 11. Deng L, Li A, Gao Y et al (2020) Detection of
Dairy Sci 100:106–112 the bovine Milk adulterated in camel, horse,
4. López-Calleja I, González I, Fajardo V et al and goat Milk using duplex PCR. Food Anal
(2007) Quantitative detection of goats’ milk Methods 13:560–567. https://doi.org/10.
in sheep’s milk by real-time PCR. Food Con- 1007/s12161-019-01678-2
trol 18:1466–1473 12. Golinelli LP, Carvalho AC, Casaes RS et al
5. Lopparelli RM, Cardazzo B, Balzan S et al (2014) Sensory analysis and species-specific
(2007) Real-time TaqMan polymerase chain PCR detect bovine milk adulteration of frescal
reaction detection and quantification of cow (fresh) goat cheese. J Dairy Sci 97:6693–6699
DNA in pure water buffalo mozzarella cheese: 13. Abdel-Rahman S, Ahmed M (2007) Rapid and
method validation and its application on com- sensitive identification of buffalo’s, cattle’s and
mercial samples. J Agric Food Chem 55:3429– sheep’s milk using species-specific PCR and
3434. https://doi.org/10.1021/jf0637271 PCR–RFLP techniques. Food Control 18:
6. Rentsch J, Weibel S, Ruf J et al (2013) Inter- 1246–1249
laboratory validation of two multiplex quanti- 14. Plath A, Krause I, Einspanier R (1997) Species
tative real-time PCR methods to determine identification in dairy products by three differ-
species DNA of cow, sheep and goat as a mea- ent DNA-based techniques. Z Leb Unters
sure of milk proportions in cheese. Eur Food Forsch 205:437–441
Res Technol 236:217–227. https://doi.org/ 15. Baptista M, Cunha JT, Domingues L (2021)
10.1007/s00217-012-1880-y DNA-based approaches for dairy products
7. Cottenet G, Blancpain C, Golay PA (2011) authentication : a review and perspectives.
Simultaneous detection of cow and buffalo Trends Food Sci Technol 109:386–397.
species in milk from China, India, and https://doi.org/10.1016/j.tifs.2021.01.043
Pakistan using multiplex real-time PCR. J 16. Liu J, Ding X, Zeng Y et al (2016) Genetic
Dairy Sci 94:3787–3793. https://doi.org/10. diversity and phylogenetic evolution of Tibetan
3168/jds.2011-4195 sheep based on mtDNA D-loop sequences.
8. Bottero MT, Civera T, Nucera D et al (2003) A PLoS One 11:e0159308. https://doi.org/10.
multiplex polymerase chain reaction for the 1371/journal.pone.0159308
identification of cows’, goats’ and sheep’s 17. Wood NJ, Phua SH (1996) Variation in the
milk in dairy products. Int Dairy J 13:277– control region sequence of the sheep mito-
282. https://doi.org/10.1016/S0958-6946 chondrial genome. Anim Genet 27:25–33
(02)00170-X
 Chapter 15

Long-Range Polymerase Chain Reaction

Ping Siu Kee, Harsheni Karunanathie, Simran D. S. Maggo,
Martin A. Kennedy, and Eng Wee Chua

Abstract
Polymerase chain reaction (PCR) is a laboratory technique used to amplify a targeted region of DNA,
demarcated by a set of oligonucleotide primers. Long-range PCR is a form of PCR optimized to facilitate
the amplification of large fragments. Using the adapted long-range PCR protocol described in this chapter,
we were able to generate PCR products of 6.6, 7.2, 13, and 20 kb from human genomic DNA samples. For
some of the long PCRs, successful amplification was not possible without the use of PCR enhancers. Thus,
we also evaluated the impact of some enhancers on long-range PCR and included the findings as part of this
updated chapter.

Key words Long-range polymerase chain reaction (PCR), Long amplicons, PCR enhancers, PCR
additives, Agarose gel electrophoresis, DNA polymerase, Proofreading enzyme, Thermal cycling,
Primer design, Pharmacogenetics

1 Introduction

Polymerase chain reaction (PCR) is a valuable tool which has

revolutionized molecular biology and genetic research since its
introduction in the mid-1980s [1, 2]. One of the oft-mentioned
contributions of PCR lies in its pivotal role in driving the comple-
tion of the Human Genome Project [3]. PCR operates on three
main principles: (a) high-temperature-induced separation of
double-stranded templates into single strands, (b) annealing of
specific oligonucleotides or primers to the complementary DNA
strands, and (c) synthesis of new DNA strands by a thermostable
DNA polymerase [4]. Repeated cycles of this process, driven by
controlled temperature changes, generate multiple copies (amplifi-
cation) of the target DNA region demarcated by the primers.
This technology has evolved and diversified into many applica-
tions, especially in research and diagnostic medicine [5, 6]. Despite
its extensive use, the amplification of long DNA segments, usually

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_15,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

181
182 Ping Siu Kee et al.

Fig. 1 Amplification of long PCR fragments from three pharmacogenes: CYP2A6 (left panel), CYP2D6 (middle
panel), and CYP2C19 (right panel). A–F represent different human genomic DNA samples. For sizing of PCR
products, GeneRuler 1 kb plus DNA ladder (Thermo Fisher Scientific, Baltics UAB, Lithuania) or KAPA Universal
Ladder (KAPA Biosystems, Roche Holdings, Inc., Basel, Switzerland) were used as markers

defined as having an amplicon length exceeding 3 kb [7], remains

challenging. In order to improve the performance of long-range
PCR, different approaches have been trialed over the years. One of
the most notable methods was the simultaneous use of DNA poly-
merases with and without proofreading activity [8]. Others
included the application of PCR suppression method for targeted
amplification [9] and the addition of PCR enhancers. For PCR
enhancers, there is an extensive range of agents with different
mechanisms of action. We refer the readers to Karunanathie et al.
(2022) for a detailed review of these enhancers and their applica-
tions in long-range PCR [10].
Using the protocols detailed in this chapter, we have success-
fully and routinely obtained PCR products of 6.6, 7.2, 13, and
20 kb from human genomic DNA samples (Fig. 1). These ampli-
cons were obtained for the pharmacogenes of interest to our work,
namely, CYP2A6, CYP2C19, and CYP2D6. Herein we provide
updates on the PCR of long fragments, stemming from our
continued work using the technique and our interest in the under-
appreciated role of enhancers in long PCR.

2 Materials

2.1 PCR 1. Primer stocks reconstituted in 1× Tris-EDTA to a concentra-

tion of 50–100 μM, stored at -20 °C (see Note 1). These
should be diluted to 5–10 μM, for use as working solutions,
and kept at 4 °C (see Note 2).
2. Long-range PCR enzyme (a single proofreading enzyme mod-
ified from the Pfu DNA polymerase) or enzyme mix
(a combination of a Taq DNA polymerase and a proofreading
enzyme) (see Note 3).
 Long PCR 183

3. Manufacturer-supplied 10× reaction buffer (see Note 4).

4. 25–50 mM magnesium chloride solution (see Notes 4 and 5).
5. 8 mM deoxynucleoside triphosphate (dNTP) mix (see Notes 4
and 5).
6. Genomic DNA or other types of templates such as plasmid
DNA (see Notes 6 and 7).
7. Optional: PCR enhancers such as betaine, dithiothreitol
(DTT), and trehalose (see Note 8).
8. Horizontal laminar flow hood.
9. Thermal cycler (see Note 9).

2.2 Agarose Gel 1. Low electroendosmosis agarose gel powder (HyAgarose™,

Electrophoresis Multipurpose Agarose, Hydragene Co. Ltd.).
2. 10× Tris-acetic acid-EDTA (TAE) buffer (as running buffer
and for dissolving gel): In a 1 L bottle, add 48.4 g of Tris
base, 3.7 g of ethylenediaminetetraacetic acid (EDTA) diso-
dium salt or 20 mL of 0.5 M EDTA solution, 11.4 mL of
glacial acetic acid (see Note 10), and sterile water up to 1 L.
Replace the lid and shake the bottle to evenly mix the ingre-
dients. There is no need to adjust the pH of the buffer; the
EDTA powder should dissolve readily. Heating may speed up
the dissolution.
3. Agarose gel electrophoresis apparatus (e.g., cast and tray).
4. Ultraviolet transilluminator with a gel documentation unit.

3 Methods

3.1 Primer Design The specificity and efficiency of a primer pair are one of the factors
contributing to a successful PCR, and they are heavily dependent
on two criteria: primer length and annealing temperature. For a
standard PCR, the ideal primer length ranges between 18 and
24 bases, with a suggested annealing temperature that is 54 °C or
higher and is usually a few degrees below the melting temperature
(Tm) [11]. For certain genes such as CYP2A6 and CYP2D6, the
presence of pseudogenes or genes with similar consensus sequences
further adds challenges to optimizing amplification. In such situa-
tions, primers that are highly specific are required.

3.1.1 Obtaining 1. Access National Center for Biotechnology Information

Reference Sequence (NCBI), a reference sequence (RefSeq) database for genes at
http://www.ncbi.nlm.nih.gov/gene/ [12]. Key in and search
for the gene of interest.
184 Ping Siu Kee et al.

2. The search will extract the targeted gene RefSeq for all available
species, each assigned with a unique gene ID. Locate and select
the Refseq of interest, which will bring the user to a subsequent
page with comprehensive information on the selected Refseq.
3. Go to the “Genomic regions, transcripts, and products” tab.
From the dropdown list, select the appropriate genome assem-
bly (see Note 11). After that, select the “FASTA” hyperlink
option, located next to the genome assembly.
4. Update the FASTA sequence shown to include 500 bp on both
sides of the gene. This can be done by changing the coverage of
genomic region numbers at the top right column labeled
“Change region shown.”
5. Download the FASTA sequence using the “Send to” option.

3.1.2 Obtaining Specific 1. Copy or upload the updated FASTA sequence onto an online
Primer Sequences (Fig. tool for primer design, Primer-BLAST; this tool can be
2 (See Note 12)) accessed at http://www.ncbi.nlm.nih.gov/tools/primer-
blast/ [13].
2. Specify the desired primer positions relative to the inserted
FASTA sequence. As we have allowed for 500-bp flanking
sequences on both sides of the gene, forward and reverse
primers can start anywhere within the 500-bp window. The
primers should be positioned in such a manner that they are at
least 150 bp away from the first and last exons to cover the
entire gene of interest.

Fig. 2 A simple guide to primer design using Primer-BLAST, a free Web-based tool. Circled numbers refer to
steps described in the text
 Long PCR 185

3. Adjust the primer parameters to suit the requirements for long-

range PCR (see Note 13). Primers for long-range PCR should
be designed to have a melting temperature of at least 65 °C so
that a two-step cycling protocol can be employed, whereby
both annealing and extension temperatures are set to 68 °C.
4. Select Refseq representative genomes as the reference sequence,
and choose the appropriate target organism (e.g., Homo
sapiens).
5. The parameters for primer specificity stringency can be left
unchanged. All primers are ideally designed to contain at least
two mismatches to nontarget templates near the 3′ end.
Increasing the minimum number of mismatches to unwanted
targets augments primer specificity but also diminishes the
likelihood of the tool finding suitable primer pairs.
6. Adjust the maximum target size so that it equals or exceeds the
estimated product size.
7. Click on the Get Primers button to initiate the tool.

3.2 PCR 1. Prepare all reaction mixes inside a horizontal laminar flow
hood. Also, it is important to have strictly separate areas for
pre- and post-PCR work to reduce the chances of sample
contamination with amplified products.
2. Irradiate the tools (e.g., pipettes and pipette tips) and plastic-
ware (e.g., microfuge tubes and PCR strip tubes) used for PCR
setup with ultraviolet light for about 15–20 min, in order to
minimize the risk of carryover contamination [14–16].
3. While waiting for the decontamination procedure to finish, set
up the PCR protocol in a thermal cycler (see Note 14).
4. Add, in a 0.7 mL microfuge tube (or larger if required), the
following reagents: reaction buffer, magnesium chloride,
dNTP mix, primers, enhancers (if necessary, see Note 8), and
enzyme mix (see Note 15).
5. Briefly flick the tube to mix all reaction components, and spin
down the mixture with a 5- to 10-s pulse in a microcentrifuge.
6. Divide the master mix into equal-volume aliquots, and transfer
these into individual PCR strip tubes (see Notes 16 and 17).
Add template DNAs (or PCR-grade water for no-template
controls; see Note 15). Always keep the tubes at 4 °C (on ice
or in a cold block) prior to thermal cycling, in order to mini-
mize unspecific amplification that may arise from residual Taq
polymerase activity at low temperatures. Some Taq polymerases
branded as “hot-start” have been found to be not entirely
devoid of enzymatic activity prior to heat activation [17].
186 Ping Siu Kee et al.

7. Close the strip tubes with their lids. Make sure that a tight seal
is formed to prevent evaporation of the reaction mixes during
thermal cycling.
8. Transfer the tubes into the thermal cycler and initiate the
cycling protocol. Note the positions in which the tubes are
placed within the thermal block (see Note 18).
9. At the end of the cycling protocol, remove the tubes from the
thermal cycler. Store the products at 4 °C until further analysis
or other downstream applications such as DNA sequencing.

3.3 Agarose Gel 1. On an electronic scale, weigh out the required amount of
Electrophoresis (See agarose gel powder (see Note 20).
Note 19) 2. Add the agarose powder into an adequate volume of 1× TAE
buffer in a glass bottle and swirl briefly to mix.
3. Heat the mixture in a microwave oven until it begins to boil.
The bottle should only be loosely capped to avoid a dangerous
build-up of pressure.
4. Remove the bottle from the microwave oven and gently swirl
the partially molten agarose mixture. Wear a pair of heatproof
gloves and safety glasses while doing this.
5. Replace the bottle in the microwave, and repeat steps 3 and
4 twice or until the agarose powder completely dissolves in the
buffer. At this point the cloudy mixture should turn into a clear
solution.
6. Allow the agarose solution to stand on the bench or in a water
bath until it has cooled to ~50 °C. Alternatively, hold the bottle
under cold running tap water, and gently swirl the molten
agarose solution to make sure that it is thoroughly cooled.
Do not overcool as the agarose solution will begin to solidify
(see Note 21).
7. Add an adequate amount of nucleic acid stain (see Note 22),
swirl to mix, and set aside the stained agarose solution to cool
further.
8. Place the gel tray, in its casting position, into the buffer cham-
ber. Pour the warm molten agarose solution onto the gel tray
and insert a well comb. Do not pour the agarose solution while
it is still hot as this may cause the gel tray to warp. Check for
and remove any bubbles inside the gel solution with a clean
pipette tip.
9. Once the gel solidifies, remove the comb, and add the TAE
buffer until it covers the entire gel to a depth of about 1 mm.
Make sure that all the wells are properly formed.
 Long PCR 187

10. Prior to loading, mix the PCR products with an adequate

amount of DNA loading dye on a piece of Parafilm® (Bemis
Co., Inc., Oshkosh, WI, USA) (see Note 23). This can be done
by pipetting the mixture up and down.
11. The voltage applied during electrophoresis depends on both
the anode-cathode distance and the size of PCR products;
1–5 V/cm should work in many cases [18, 19]. Consider
using a low voltage if the resolution of large PCR fragments
is suboptimal (see Note 24).
12. Electrophorese the PCR products for ~45 min or until the dye
front has visibly traversed half the length of the gel. A DNA size
marker should be run alongside the PCR products.

4 Notes

1. Commercially synthesized primers are typically lyophilized for

ease of shipment. On receipt, the tubes should be briefly cen-
trifuged prior to resuspension of the DNA pellet, as dried
pellets may become dislodged during transport. Storage at -
20 °C should extend the shelf-life of the primer stocks.
2. Use of diluted working solutions is advisable, in order to
minimize the number of freeze-thaw cycles and to preserve
the primary stock of primers in the event of contamination.
Primer solutions are stable for at least 24 months when stored
at -20 °C. For a detailed guide on primer resuspension and
storage, please see reference [20].
3. Commercial preparations that have worked well in our labora-
tories are KAPA LongRange HotStart DNA Polymerase (Kapa
Biosystems, Inc., Wilmington, MA, USA), PrimeSTAR® GXL
DNA Polymerase (Takara Bio, Inc., Otsu, Shiga, Japan),
AtMax Taq DNA Polymerase (Vivantis Technologies Sdn.
Bhd., Subang Jaya, Selangor, Malaysia), LongAmp® Hot
Start Taq DNA Polymerase (New England Biolabs. Inc. Ips-
wich, Massachusetts, USA.), and PCRBIO HS VeriFi™ Poly-
merase (PCR Biosystems Ltd., London, UK). The
recommended cycling protocol and the amplification limit
vary between these enzyme systems; however, they were
found to be equally effective in the amplification of the
CYP2D6 gene. Other polymerases are likely to be also suitable,
but it may be necessary to test more than one for specific
applications.
4. When not regularly used, these reagents should be stored at
-20 °C; otherwise they can be kept at 4 °C.
188 Ping Siu Kee et al.

5. For certain commercial preparations such as PCRBIO HS Ver-

iFi™ Polymerase (PCR Biosystems Inc., Pennsylvania, USA),
magnesium chloride and dNTPs are included in the reaction
buffer [21].
6. Input DNA should be checked for purity and integrity prior to
PCR. An OD260/280 (optical density) ratio of ~1.8 indicates
pure DNA [8, 22]. DNA should be of high molecular weight
[23], preferably exceeding 20–40 kb. DNA templates of lower
molecular weight may result in substantially decreased amplifi-
cation efficiency. The Agilent TapeStation system measures the
integrity of a DNA sample and generates a DNA integrity
number (DIN) ranging from 1 to 10, where a low score indi-
cates substantial DNA degradation and a score of “10” indi-
cates high-quality DNA [24].
7. For routine use in PCR, a diluted aliquot of a DNA sample can
be stored at 4 °C for up to 12 months without substantial
degradation [25]. The remainder of the sample should be
stored at -20 °C or - 80 °C, with observed stability of up to
24 months [25, 26]. However, DNA is expected to remain
relatively stable for a longer period of time, up to years if the
blood source is stored appropriately at -30 °C [27].
8. We investigated the effects of three PCR enhancers (betaine,
DTT, and trehalose) on a PCR amplifying a 10-kb fragment.
Table 1 summarizes the mechanisms of action for each of the
enhancers tested [10] and the range of recommended concen-
trations for inducing the desired PCR-enhancing effects. To
ensure consistency and reproducibility, two commercial long
PCR kits, AtMax Taq DNA Polymerase (Vivantis Technologies
Sdn. Bhd., Subang Jaya, Selangor, Malaysia) and KAPA Long-
Range HotStart PCR Kit (Kapa Biosystems, Inc., Wilmington,

Table 1
The recommended range of concentrations for betaine, DTT, and trehalose as PCR enhancers
Recommended
PCR
Mechanism(s) of action Tested concentrations range of
enhancers
concentrations

x Reduces the formation of

secondary structures in GC-
0.0 M, 0.4 M, 0.8 M, 1.2
Betaine rich regions 0.8 M – 1.6 M
M, 1.6 M, 2.0 M, 2.4 M
x Lowers strand separation
temperatures
0.0 mM, 2.5 Mm, 5.0
Stabilises DNA polymerase at 15 mM – 20
DTT mM, 10 mM, 15 mM,
high temperatures mM
20 mM, 25 mM
x Stabilises DNA polymerase
at high temperatures
0.0 M, 0.2 M, 0.4 M, 0.6
Trehalose x Lowers DNA melting 0.4 M – 0.8 M
M, 0.8 M, 1.0 M, 1.2 M
temperatures especially in
GC-rich regions
 Long PCR 189

MA, USA), were used in the experiments. PCR product yields

were assessed based on the intensities of amplicon bands visua-
lized on agarose gels and analyzed using Image Lab v5.2.1
(Bio-Rad Laboratories, Inc. California, USA). The enhancing
effects of betaine, DTT, and trehalose were observed across
different concentrations.
9. Long-range PCRs may be sensitive to the characteristics of a
thermal cycler. This could be due to at least two reasons:
(a) performance variation between Peltier heating blocks or
machines may result in well temperatures that deviate consid-
erably from the thermal cycling protocol and (b) the thermal
ramp rates vary between thermal cyclers [28]. Thermal cyclers
used for long PCR should be fitted with heated lids, which
prevent sample evaporation. Temperature gradient blocks are
optional but may be useful for determining optimal annealing
temperatures where three-step cycling protocols are used. The
thermal cyclers used in our experiments were TProfessional
Basic Thermocycler (Biometra GmbH, Goettingen, Germany)
and Arktik Thermal Cycler (Thermo Fisher Scientific,
Massachusetts, USA).
10. The buffer should be made up in a fume cupboard, as glacial
acetic acid is corrosive and has a strong, unpleasant odor. In
addition to such general laboratory precautions, double glov-
ing may be necessary for handling the chemical.
11. The human genome assembly is regularly updated. GRCh38.
p14 is the latest genome assembly available.
12. Alternatively, Geneious Prime (https://www.geneious.com)
(Biomatters Ltd., Auckland, New Zealand) is a commercial
bioinformatics software platform which includes a primer
design function.
13. Melting temperatures are predicted by the nearest-neighbor
formula with salt correction, assuming the concentrations of
monovalent cations, divalent cations, oligonucleotides, and
dNTPs to be 50 mM, 1.5 mM, 0.5 μM, and 0.6 mM, respec-
tively [29]. For further details about how these concentrations
are derived, please see Advanced Parameters in Primer-BLAST.
14. A PCR protocol for the amplification of a 6.6-kb fragment
from the CYP2D6 gene is shown here. DNA samples are
initially denatured at 94 °C for 3 min and then subjected to
thermal cycling as follows: 35 cycles of 94 °C for 25 s, 68 °C for
10 s, and 68 °C for 7 min and a final elongation step of 72 °C
for 7 min. For the amplification of very long products exceed-
ing 15 kb in size, a two-phase auto-extension protocol may be
adopted. The first phase comprises ten cycles of usual steps of
heating and cooling. In the second phase, the extension time is
successively prolonged by 20 s per cycle, for a total of 25 cycles.
The additional extension time ensures that the synthesis of
PCR products progresses to completion in each cycle.
190 Ping Siu Kee et al.

Fig. 3 The effect of different amounts of input DNA on the CYP2D6 long-range
PCR, performed in 10 μL reactions, was ascertained. It is obvious that 40 ng/
10 μL of DNA resulted in greater amplification than 20 ng/10 μL. Increasing the
concentration to 80 ng/10 μL did not enhance the yield further; doubling it to
160 ng/10 μL was clearly detrimental. The samples used in these experiments
were human genomic DNAs

15. Calculate the volumes of all reagents required for n + 1 samples

to account for manipulative loss. Always include a no-template
control for each primer pair. A typical reaction may comprise
1.5–2 mM of magnesium chloride, 0.2–0.5 μM of forward or
reverse primer, 0.1–0.2 mM of each nucleotide, and
1.25–2.5 U of Taq polymerase, though the composition may
vary with the enzyme system used and the target region. The
enzymes should be added last into the reaction mixture, espe-
cially when this already contains a DNA template, to minimize
unspecific amplification at low temperatures. For a 10 μL reac-
tion, 30–50 ng of DNA is usually sufficient for ample amplifi-
cation. Adding too much DNA may result in PCR inhibition
(Fig. 3).
16. The reaction volume may be adjusted depending on the down-
stream applications. For instance, if the long amplicons serve as
sequencing templates in subsequent procedures, a large reac-
tion volume, ranging from 25 to 50 μL, may be required.
17. Colorless PCR strip tubes are preferred. We have found some
colored PCR tubes to have an inhibitory effect on long-range
PCRs, causing amplification failure [30]. When there is a sud-
den decline in PCR performance, it may be worthwhile to
check the source or batch of plasticware in use. If these are
identified as the source of PCR inhibition, the following stra-
tegies may be effective in remedying the problem: (a) use a
different batch of the same tubes; (b) try PCR tubes from a
 Long PCR 191

different supplier; or (c) where colored PCR tubes are probably

the culprit, switch to colorless tubes.
18. The effect of heating may not be entirely consistent across the
wells in a thermal cycler. Such positional effects may sometimes
affect the performance of long-range PCRs and can be mini-
mized by regular calibration of the thermal cycler.
19. Alternatively, there are commercial pre-cast electrophoresis
gels with a variety of specifications (e.g., gel percentages, gel
compositions, and well numbers).
20. Resolution of fragments larger than 1 kb typically requires the
use of gels with concentrations ranging from 0.7 to 1%. For a
1% gel measuring 7 × 8 cm (width × length), add 0.5 g of
agarose powder in 50 mL of TAE buffer.
21. Where an agarose gel has not homogenously formed, the
samples loaded within different wells may not migrate in a
synchronous manner.
22. For a 10,000× DNA dye concentrate, add 5 μL of the dye in
50 mL of TAE buffer. If ethidium bromide is used, strict
disposal procedures should be followed; this is not necessary
for other safer alternatives such as SYBR® Safe (Invitrogen™,
Life Technologies, Carlsbad, CA, USA).
23. For PCR products, usually 10–20% should be sufficient for
visualization, but more could be loaded if the products have
no other use after electrophoresis. For instance, 2–4 μL of PCR
products may be loaded if the starting reaction volume is
20 μL.
24. In our experience, ~80 V works well for a mini-sized electro-
phoresis system with an anode-cathode distance of ~12 cm
(Owl™ EasyCast™ B1A, Thermo Fisher Scientific,
Massachusetts, USA), although the supplied power exceeds
the recommended range of optimal voltages.

References

1. Mullis KB, Faloona FA (1987) Specific synthe- Protocols. Humana Press, Totowa, NJ, pp
sis of DNA in vitro via a polymerase-catalyzed 1–29
chain reaction. In: Methods in enzymology, vol 5. Long S (2022). Digital PCR: methods and
155. Academic Press, pp 335–350 applications in infectious diseases. Methods
2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, (San Diego, Calif.)
Higuchi R, Horn GT, Mullis KB, Erlich HA 6. Zhu H, Zhang H, Xu Y, Laššáková S,
(1988) Primer-directed enzymatic amplifica- Korabečná M, Neužil P (2020) PCR past, pres-
tion of DNA with a thermostable DNA poly- ent and future. BioTechniques 69(4):317–325
merase. Science 239(4839):487–491 7. Green MR, Sambrook J (2019) Long and
3. Collins F, Galas D (1993) A new five-year plan accurate polymerase chain reaction (LA PCR).
for the US human genome project. Science Cold Spring Harb Protoc 2019(3):pdb-
262(5130):43–46 prot095158
4. Delidow BC, Lynch JP, Peluso JJ, White BA 8. Barnes WM (1994) PCR amplification of up to
(1993) Polymerase chain reaction. In: PCR 35-kb DNA with high fidelity and high yield
192 Ping Siu Kee et al.

from lambda bacteriophage templates. Proc https://pcrbio.com/row/products/pcr/

Natl Acad Sci U S A 91(6):2216–2220 pcrbio-hs-verifi-polymerase-mixes/. Accessed
9. Zhao Z, Xie X, Liu W, Huang J, Tan J, Yu H, 27 Sept 2022
Zong W, Tang J, Zhao Y, Xue Y, Chu Z (2022) 22. Thermo Fisher Scientific Inc (2008) Nano-
STI PCR: an efficient method for amplification Drop 8000 Spectrophotometer V2.2 User
and de novo synthesis of long DNA sequences. Manual. Available from: https://tools.
Mol Plant 15(4):620–629 thermofisher.com/content/sfs/manuals/
10. Karunanathie H, Kee PS, Ng SF, Kennedy MA, User-Manual-nd-8000-v2.2-users-manual-8.
Chua EW (2022) PCR enhancers: types, 5-x-11.pdf. Accessed 27 Sept 2022
mechanisms, and applications in long-range 23. Cheng S, Chen Y, Monforte JA, Higuchi R,
PCR. Biochimie 197:130–143 Higuchi R, Van Houten B (1995) Template
11. Dieffenbach CW, Lowe TM, Dveksler GS integrity is essential for PCR amplification of
(1993) General concepts for PCR primer 20- to 30-kb sequences from genomic DNA.
design. PCR Methods Appl 3(3):S30–S37 PCR Methods Appl 4(5):294–298
12. The NCBI handbook [internet] (2013) 2nd 24. Kong N, Ng W, Cai L, Leonardo A, Kelly L,
edn. Bethesda (MD): National Center for Bio- Weimer BC (2014) Integrating the DNA
technology Information (US). Available from: integrity number (DIN) to assess genomic
h t t p : // w w w. nc b i . n l m . n i h. g o v / b o ok s / DNA (gDNA) quality control using the Agi-
NBK143764/ lent 2200 TapeStation system. Available from:
13. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, h t t p s : // w w w. a g i l e n t . c o m / c s / l i b r a r y /
Rozen S, Madden TL (2012) Primer-BLAST: a applications/5991-5442EN.pdf. Accessed 27
tool to design target-specific primers for poly- Sept 2022
merase chain reaction. BMC bioinformatics 25. Wu J, Cunanan J, Kim L, Kulatunga T,
13(1):1–11 Huang C, Anekella B (2009) SeraCase life
14. Cone RW, Fairfax MR (1993) Protocol for sciences: stability of genomic DNA at various
ultraviolet irradiation of surfaces to reduce storage conditions. Available from: https://
PCR contamination. PCR Methods Appl www.colorado.edu/ecenter/sites/default/
3(3):S15–S17 files/attached-files/seracare_stability_of_geno
mic_dna_at_various_storage_conditions_
15. Fox JC, Ait-Khaled M, Webster A, Emery VC isber2009.pdf. Accessed 27 Sept 2022
(1991) Eliminating PCR contamination: is UV
irradiation the answer? J Virol Methods 33(3): 26. Röder B, Frühwirth K, Vogl C, Wagner M,
375–382 Rossmanith P (2010) Impact of long-term
storage on stability of standard DNA for
16. Tamariz J, Voynarovska K, Prinz M, Caragine nucleic acid-based methods. J Clin Microbiol
T (2006) The application of ultraviolet irradia- 48(11):4260–4262
tion to exogenous sources of DNA in plastic-
ware and water for the amplification of low 27. Chen WC, Kerr R, May A, Ndlovu B,
copy number DNA. J Forensic Sci 51(4): Sobalisa A, Duze ST, Joseph L, Mathew CG,
790–794 Babb de Villiers C (2018) The integrity and
yield of genomic DNA isolated from whole
17. Stevens AJ, Appleby S, Kennedy MA (2016) blood following long-term storage at- 30°
Many commercial hot-start polymerases dem- C. Biopreserv Biobank 16(2):106–113
onstrate activity prior to thermal activation.
BioTechniques 61(6):293–296 28. Thermo Fisher Scientific Inc (2022) Thermal
cycler features—6 key considerations.
18. Green MR, Sambrook J (2019) Analysis of Available from: https://www.thermofisher.
DNA by agarose gel electrophoresis. Cold com/nz/en/home/life-science/cloning/clon
Spring Harb Protoc 2019(1):pdb-top100388 ing-learning-center/invitrogen-school-of-
19. Lee PY, Costumbrado J, Hsu CY, Kim YH molecular-biology/pcr-education/pcr-ther
(2012) Agarose gel electrophoresis for the sep- mal-cyclers/pcr-thermal-cyclers-con
aration of DNA fragments. JoVE 62:e3923 siderations.html. Accessed 27 Sept 2022
20. Integrated DNA Technologies Inc (2022) My 29. SantaLucia J Jr (1998) A unified view of poly-
oligos have arrived: Now what? Resuspension, mer, dumbbell, and oligonucleotide DNA
dilution, storage, and other tips. nearest-neighbor thermodynamics. Proc Natl
Available from: https://sg.idtdna.com/ Acad Sci U S A 95(4):1460–1465
pages/education/decoded/ar ticle/my- 30. Chua EW, Miller AL, Kennedy MA (2015)
oligos-have-arrived-now-what-. Accessed Choice of PCR microtube can impact on the
27 Sept 2022 success of long-range PCRs. Anal Biochem
21. PCRBiosystems Inc (2022) PCRBIO HS Ver- 477:115–117
iFi™ Polymerase & Mixes. Available from:
 Chapter 16

Megaprimer-Based PCR to Synthesize Fusion Genes

for Cloning
Tatiana Q. Aguiar, Carla Oliveira, and Lucı́lia Domingues

Abstract
Megaprimer-based polymerase chain reaction (PCR) strategies allow the versatile and fast assembly and
amplification of a myriad of tailor-made or random DNA sequences readily available for conventional or
restriction-free (RF) cloning.
In this chapter, we present a megaprimer-based PCR protocol that enables the expeditious construction
of customized fusion genes ready for cloning into commercial expression plasmids. With the expanding use
of protein tag technology in the most diverse application fields, this protocol remains a versatile and
affordable solution for the synthesis and fusion of peptide tags/domains of interest.

Key words Megaprimers, PCR, Fusion genes, Molecular cloning, Restriction enzymes, Expression
plasmids

1 Introduction

The polymerase chain reaction (PCR) is the most important basic

methodology used to obtain DNA fragments for nearly all cloning
procedures available [1, 2]. PCR is typically used to isolate and
amplify DNA fragments/genes of interest from appropriate tem-
plates before they can be cloned into cloning/expression vectors.
For this, it is necessary to design primers containing 17–30 base
pair (bp)-long sequences complementary to the fragment/gene of
interest at their 3′-end. To their 5′ region, it can be additionally
added one or several of the following elements, noncomplementary
to the template DNA: (a) restriction sites for cloning into plasmid
vectors [3–5]; (b) some nucleotides (typically 2–10) upstream of
the restriction site, necessary to increase the cleavage efficiency of
enzymes that generally have low cleavage efficiency close to the end
of a DNA fragment [3–5]; (c) start, stop, or modified codons [3, 4,

Tatiana Q. Aguiar and Carla Oliveira contributed equally to this work.

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_16,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

193
194 Tatiana Q. Aguiar et al.

6]; (d) DNA sequences encoding linkers, specific chemical or enzy-

matic cleavage sites, fusion tags, and/or peptides/proteins [3, 4,
6]; (e) overlap sequences to DNA regions of interest (typically
20–40 bp long), necessary in PCR-based and in vivo DNA assembly
and cloning methods [6–10], and for the construction of
PCR-based genomic integration/disruption cassettes [11]; etc.
Megaprimers contain long extra 5′ sequences and are therefore
larger (typically up to 300 bp) than conventional primers. In a
PCR, they can be used together or coupled with conventional
primers to define the 5′-, 3′-, or both ends of a PCR product, as
long as the difference between the melting temperature (Tm) of the
complementary region of the two primers is within 5 °C (see
reference [1] for basic rules in primer design).
Megaprimers are typically obtained using PCR-based strategies
[12], but they can also be obtained by chemical synthesis at an
affordable price. Megaprimers have been mainly used for
PCR-based site-directed mutagenesis [12] and restriction-free
(RF) cloning [2, 6–8]. In protein engineering, megaprimer-based
PCR strategies have been also used to circularly permute proteins
[6], to fuse small functional domains to proteins [4], and to swap or
shuffle protein domains [7, 8]. In protein tag technology, the use of
megaprimers allows the expeditious synthesis and fusion of purifi-
cation/immobilization tags to proteins of interest [4, 13, 14].
In this chapter, we revisit and update megaprimer-based PCR
protocols designed and used to construct gene fusions for
subsequent cloning by restriction digestion and ligation into com-
mercially available expression plasmids [15]. The presented
megaprimer-based PCR strategies allow the synthesis of genes
encoding small- to large-sized peptides (10–100 amino acids) at a
price 50–70% lower than that currently charged by commercial
gene synthesis services.
The first presented case study refers to the synthesis, fusion, and
amplification of the complete gene sequence of the carbohydrate-
binging module 1 (CBM1) from Trichoderma reesei Cel7A (cello-
biohydrolase I), with (180 bp) and without (108 bp) its native
linker (NL), to the gene sequence of the reporter Emerald Green
Fluorescent Protein (EmGFP; 717 bp) by PCR, using manually
designed megaprimers. The EmGFP-TrCBM1Cel7A fusion genes,
with and without the CBM1 NL, were assembled and amplified
by two-step primer extension PCR with megaprimers containing
partial CBM1-coding sequences with codons optimized for use in
the yeast expression host Pichia pastoris (Table 1), using as initial
template the EmGFP-coding gene from plasmid pPCG [16]. In the
designed megaprimers, a sequence encoding a recognition site for
the tobacco etch virus (TEV; 21 bp) protease was included between
the genes, to allow the obtainment of free EmGFP and CBM1
when necessary, and a histidine tag (18 bp) was fused to the
C-terminal of the CBM1 sequence, to allow subsequent purifica-
tion by immobilized metal affinity chromatography (IMAC). Other
Table 1
Primers used in this work. The melting temperature (Tm) indicated for each primer is the Tm of the sequence complementary to the corresponding
template DNA

Length Tm
Primer Sequence (5‘ → 3‘)a (bp) (°C)
P1 EmGFP _FW cggaattcatggtgagcaagggcgag 26 59
P2 TrCBM1Cel7A_RV1.1 CCACCACATTGACCGTAATGAGATTGAGTACCTTGAAAGTACAAGTTTTCcttgtacagctcg 70 56
tccatgc
P3 TrCBM1Cel7A_RV1.2 CCACCACATTGACCGTAATGAGATTGAGTTGGACCTGGAGAAGAACCAGTAGTA 142 56
GTAGCTGGTCTTCTAGTAGTAGTAGTACCTCTGTTACCACCTGGTGGACCTT
GAAAGTACAAGTTTTCcttgtacagctcgtccatgc
P4 TrCBM1Cel7A_RV2 ggggtaccTCAatgatgatgatgatgatgCAAACATTGAGAGTAGTATGGGTTCAAAACTTGACAAG 131 57
TAGTACCAGAAGCACAAACAGTTGGACCAGAGTAACCAATAccaccacattgaccgtaatgaga
T7 T7_FW GATCCCGCGAAATTAATACGACTCACTATAG 31 56
MR EGFP-NdeI-Car9- ccgctcgagTTAACGTTTACCCGGTTTTTTGAAACCACGAGCAGAGTC 81 56
XhoI_R catatgtttgtaaagttcatccatacccagggt
a
Simple lower and UPPER case refer to the sequences complementary to the EmGFP- and CBM1-coding regions, respectively. BOLD UPPER CASE refers to the sequence
encoding the CBM1 native linker. Underlined UPPER and lower case refer to the sequence encoding a TEV recognition site and a six histidine tag, respectively. The stop codon is
indicated in UPPER CASE ITALICS. The recognition sites for the selected restriction enzymes are indicated in lower case bold (EcoRI, gaattc; KpnI, ggtacc; NdeI, catatg; and
XhoI, ctcgag), and the nucleotides added upstream of them are in lower case italics
Megaprimer-Based PCR
195
196 Tatiana Q. Aguiar et al.

Fig. 1 Illustration of the megaprimer-based PCR strategy used to assemble the fusion genes EmGFP-
TrCBM1Cel7A (a) and EmGFP-NL-TrCBM1Cel7A (b), with indication of the location of primers and of all the
extra sequence elements added after each PCR. TEV, TEV protease recognition site; S, stop codon

sequences of interest, such as restriction sites and stop codon, were

also added to the primers. The strategy used is schematized in
Fig. 1. As described herein, this strategy is adequate to synthesize
and fuse genes with up to 250 bp to a given template gene, but it
may be easily adapted to synthesize and fuse motifs of any molecular
weight to any template gene, by using as many megaprimers and
PCR rounds as necessary.
A more simplified megaprimer-based protocol that encom-
passes a single PCR round is also presented, which allows the fast
and versatile fusion of short purification/immobilization tags to
desired proteins. This second case study refers to the use of a single
megaprimer (81 bp) containing a Car9-coding sequence with
codons optimized for use in the expression host Escherichia coli
(Table 1), for fusion of this silica-binding tag to EGFP [4]. Addi-
tional elements of interest, such as restriction sites and stop codon,
were also added to the megaprimer. The strategy used is schema-
tized in Fig. 2.

2 Materials

2.1 Equipment 1. Thermal cycler.

2. Agarose gel electrophoresis apparatus.
3. Microwave.
 Megaprimer-Based PCR 197

Fig. 2 Illustration of the megaprimer-based PCR strategy used to assemble the fusion gene EGFP-Car9, with
indication of the location of primers and of all the extra sequence elements added after the PCR. S, stop codon

4. UV transilluminator with a gel documentation unit.

5. Microvolume UV-Vis spectrophotometer for nucleic acid
quantification.
6. Tabletop centrifuge.
7. Pipettes and pipette tips.
8. Microtubes (0.2 mL PCR tubes and 1.5 mL microcentrifuge
tubes).
9. Temperature-controlled water bath.

2.2 Supplies and 1. Sterile ultrapure water.

Reagents 2. Template DNA: Plasmid DNA (from pPCG [16] or pET-
M20_EGFP [4]) isolated using GenElute™ Plasmid Miniprep
Kit (Sigma-Aldrich), or equivalent, and purified PCR products.
3. Oligonucleotide primers: Ordered from a local supplier at a
20 nmol synthesis scale and without HPLC or gel purification.
Aliquots of 20 or 25 μM working solution were prepared from
100 μM stock solution and stored at -20 °C to prevent con-
tamination of stock and repeated freeze-thaw cycles.
4. Proofreading DNA polymerase: In this protocol we used Vent®
DNA polymerase, supplied with 10× ThermoPol® Reaction
Buffer and 100 mM MgSO4 solution (New England Biolabs).
5. dNTPs, 10 mM each.
6. 1× Tris-acetate-EDTA (TAE) buffer: 40 mM Tris, 20 mM
acetic acid, 1 mM EDTA, pH 8.3.
198 Tatiana Q. Aguiar et al.

7. 1% (w/v) agarose gels (in 1x TAE buffer) with 0.05% (v/v)

GreenSafe Premium (NZYTech), or equivalent.
8. 10 kb DNA ladder.
9. 6× DNA loading buffer: 30% (w/v) glycerol, 0.25% (w/v)
bromophenol blue.
10. Commercial kits for DNA purification: QIAquick® Gel Extrac-
tion and PCR Purification Kit (Qiagen), or equivalent.
11. Vector cloning: Plasmids pPICZαA (Invitrogen), pETM20
(EMBL); restriction enzymes EcoRI-HF, KpnI-HF, XbaI,
XhoI and 10× CutSmart® buffer (New England Biolabs), or
equivalent; T4 DNA ligase and 10× ligation buffer; E. coli
chemically competent cloning cells and SOC medium; LB
agar plates containing appropriate antibiotics.

3 Methods

3.1 Primer Design Rational primer design is a critical step for the success of this
protocol, which requires prior knowledge of the DNA sequences
of the genes and elements that we desire to fuse, as well as the maps
of the expression vectors where we intend to clone the constructed
fusions:
1. Assemble the final base pair sequence of the desired fusion
genes, and optimize their codons according to the preferential
codon usage of the host where they are going to be expressed.
For the first case study, the codons of the sequences that were
fused to the EmGFP-coding gene were optimized for expres-
sion in the yeast P. pastoris using the online software GENEius
(Eurofins Genomics) (Fig. 3). For the second case study, the
same software was used to optimize the codons of the Car9-
coding sequence for expression in the bacterium E. coli (see
Note 1).
2. Select the appropriate enzymes for cloning. Analyze the multi-
ple cloning site of the selected expression vector and the restric-
tion map of each fusion gene (e.g., with the online NEBcutter
tool, New England Biolabs). Select two enzymes that do not
cut in the fusion genes, and allow their directional cloning into
the desired vector region in frame with the existing reading
frame (see Note 2). For the first case study, the enzymes EcoRI
and KpnI were selected to directionally clone the EmGFP-
TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A fusions in frame
with the Saccharomyces cerevisiae α-factor signal peptide-coding
sequence in the commercial expression plasmid pPICZαA
(Invitrogen). For the second case study, the restriction
enzymes XbaI and XhoI were selected to directionally clone
the Car9 tag in frame with the EGFP-coding sequence in the
E. coli expression plasmid pETM20 (EMBL).
 Megaprimer-Based PCR 199

Fig. 3 Sequences of the customized fusion genes EmGFP-TrCBM1Cel7A (a) and EmGFP-NL-TrCBM1Cel7A (b)
with the codons optimized for expression in P. pastoris. The EmGFP and CBM1 regions are highlighted in green
and gold, respectively. The CBM1 NL region is highlighted in gray. The TEV recognition site and the histidine
tag are highlighted in pink and blue, respectively. The stop codon is indicated in red, and the priming sites for
the designed primers are underlined and highlighted in bold
200 Tatiana Q. Aguiar et al.

3. After analyzing the sequences of the customized fusion genes,

select appropriate priming regions (Figs. 1, 2, and 3). For this,
standard primer design rules should be applied [1, 15], includ-
ing minimum of 17 bp complementary to template DNA, GC
content between 40 and 60%, Tm preferably between 52 and
62 °C, Tm difference between primer pairs <5 °C, presence of
1–3 Gs or Cs within the last five bases from the 3′-end of
primers, avoid potential primer dimmer (ΔG > -7.5 kcal/
mol) and hairpin formation (ΔG > -3 kcal/mol) as well as
false priming sites. Use computational tools to help you esti-
mate the Tm of the selected priming regions (for Vent® DNA
polymerase, use the online NEB Tm calculator, New England
Biolabs), and change their length (always respecting the stan-
dard primer design rules) until you reach a satisfactory
Tm. Note that this estimated Tm is only for the primer region
complementary to the template DNA and not for the full-
length primer.
4. For the full-length primers, check for GC content, potential
primer dimer, and hairpin formation (e.g., with one of the
following online primer analysis tools: OligoAnalyzer,
Integrated DNA Technologies; NetPrimer, PREMIER Bio-
soft; or OligoEvaluator, Sigma-Aldrich). If any of these para-
meters are outside of the recommended guidelines, proceed to
the necessary adjustments (see Note 3).
5. In the first case study, the EmGFP-coding gene served as initial
template to assemble each of the fusion genes. Thus, we
designed one conventional forward primer (P1), complemen-
tary to the 5′-end region of the EmGFP-coding gene, which
could be used in combination with different reverse megapri-
mers (Table 1, Fig. 1). The reverse megaprimers P2 and P3 were
designed to anneal at the same priming site in the 3′-end region
of the EmGFP-coding gene and to have equal 5′-end
sequences that were used as priming site for primer P4
(Table 1, Figs. 1 and 3). However, while primer P3 was
designed to include a coding sequence for a TEV recognition
site plus the CBM1 NL between its 3′- and 5′-ends, in primer
P2 only the first sequence was included (Table 1, Figs. 1 and 2).
The megaprimer P4 was designed to contain a 3′-end sequence
complementary to the 3′ region of the PCR products gener-
ated with primes P1 and P2/P3 and to include in its 5′ region
the remaining coding sequence for CBM1 plus six histidine
codons and a stop codon (see Note 4). Restriction sites for
EcoRI and KpnI were added to the 5′-end of primers P1 and P4,
respectively, preceded by two nucleotides to increase the cleav-
age efficiency of the final PCR products by these enzymes.
 Megaprimer-Based PCR 201

6. In the second case study, the plasmid pETM20_EGFP [4]

served as template to assemble the EGFP-Car9 fusion gene.
For this strategy, the conventional forward primer T7, comple-
mentary to the T7 promoter of pET series E. coli expression
plasmids, was used in combination with a reverse megaprimer
(MR) designed to anneal at the 3′-end region of the EGFP-
coding gene and to include in its 5′ region the coding sequence
for Car9 between a NdeI recognition site, to subsequently
allow the cloning of other genes in fusion with the Car9 tag,
a stop codon, and a restriction site for XhoI preceded by three
nucleotides, to increase the cleavage efficiency of the final PCR
product by these enzymes (Table 1, Fig. 2).

3.2 Double-Step A two-step PCR was performed to synthesize the fusion genes
Primer Extension PCR: EmGFP-TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A, in which
Case Study 1 the PCR products from the first PCR round served as template
for the second PCR (Table 2).
1. To obtain the PCR1 and PCR3 products (Table 2, Fig. 1), mix
the following components in PCR tubes:
• Template DNA—100–300 ng (in 1 μL)
• Primer P1 (25 μM)—1 μL
• Primer P2 for PCR1 and P3 for PCR3 (25 μM)—1 μL
• dNTPs (10 mM each)—1.5 μL
• 10× ThermoPol® Reaction Buffer—5 μL
• 100 mM MgSO4—1 μL
• Ultrapure H2O—39 μL
• Vent® DNA Polymerase—0.5 μL

Table 2
Primers, template DNA, and annealing temperature (Ta) used for the assembly and amplification of
the fusion genes EmGFP-TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A in case study 1

Fusion gene PCR products Primers Template Ta (°C)

a
EmGFP-TrCBM1Cel7A PCR1 P1 pPCG 55
P2
PCR2 P1 PCR1 product 53
P4
EmGFP-NL-TrCBM1Cel7A PCR3 P1 pPCGa 50
P3
PCR4 P1 PCR3 product 53
P4
a
Plasmid harboring the EmGFP-coding gene Ref. [16]
202 Tatiana Q. Aguiar et al.

2. Step up the thermal cycler using the following parameters:

Number of cycles PCR step Temperature (°C) Time

1 Initial denaturation 95 2 min
30 Denaturation 95 2 min
Annealing (see Table 2) 45 s
Extension 72 1 min/kb
1 Final extension 72 10 min

3. After the amplification, assess the DNA fragments’ size and

quality by running 5 μL of each PCR sample on 1% (w/v)
agarose gel. If the expected PCR products are not observed,
refer to Note 5. If the PCR products are the right size, but a
primer dimer band is also present (typically, below 200 bp), or
unspecific PCR products are formed, perform agarose gel puri-
fication of the PCR products with the QIAquick® Gel Extrac-
tion Kit (spin protocol) before proceeding to the next step (see
Note 6). If the PCR products are the right size and are present
as a single band, perform silica-column purification of the
products with the QIAquick® PCR Purification Kit (see Note
6). Determine the DNA concentration.
4. To obtain the PCR2 and PCR4 products, mix the components
described in step 1, using the same amounts, but replace
primers P2 and P3 with primer P4, and use as template DNA
the adequate purified PCR product from step 3 (Table 2).
Since the DNA purification procedure reduces the PCR prod-
uct yield, a high volume of PCR product (up to 15 μL) is
generally needed as template DNA (see Note 7).
5. Purify the PCR products as described in step 3 (Fig. 4) (see
Note 8).

Fig. 4 Final PCR products from the amplification of the fusion genes EmGFP-
TrCBM1Cel7 (A, PCR2 product) and EmGFP-NL-TrCBM1Cel7A (B, PCR4 product) in
case study 1 and EGFP-Car9 (C) in case study 2. MW, molecular weight
standards
 Megaprimer-Based PCR 203

3.3 Standard PCR: A standard PCR was performed to synthesize the fusion gene
Case Study 2 EGFP-Car9:
1. To obtain the PCR product (Table 2, Fig. 2), mix the following
components in a PCR tube:
• Template DNA—100–300 ng (in 1 μL)
• Primer T7 (20 μM)—1.25 μL
• Primer MR (20 μM)—1.25 μL
• dNTPs (10 mM each)—1 μL
• 10× ThermoPol® Reaction Buffer—5 μL
• 100 mM MgSO4—1 μL
• Ultrapure H2O—39 μL
• Vent® DNA Polymerase—0.5 μL
2. Step up the thermal cycler using the following parameters:

Number of cycles PCR step Temperature (°C) Time

1 Initial denaturation 95 3 min
35 Denaturation 95 30 s
Annealing 56 30 s
Extension 72 1 min/kb
1 Final extension 72 5 min

3. After the amplification, follow the instructions described in

step 3 of 3.2 to assess the DNA fragment’s size and quality
(Fig. 4), and to purify the PCR product

3.4 Vector Cloning The final PCR products can be digested with the planned restric-
and Confirmation of tion enzymes and cloned directly into the expression vector or can
the Fusion Genes’ alternatively be cloned into an intermediate cloning vector, propa-
Sequence gated, excised by restriction digestion, and finally cloned into the
expression vector. Many convenient commercial systems for clon-
ing of PCR products are available, either for blunt-ended (e.g.,
pMOS®, GE healthcare) or A-ended products (e.g., pGEM®-T,
Promega). Thermostable DNA polymerases with proofreading
activity, such as Vent®, generate blunt-ended fragments, but these
can be modified using an A-tailing procedure (see Note 9) and thus
cloned in any type of PCR cloning vectors. However, direct cloning
is a faster and less expensive approach:
1. Digest overnight at 37 °C the purified PCR2 and PCR4 pro-
ducts from case study 1 with the cloning enzymes EcoRI-HF
and KpnI-HF and the purified PCR product from case study
2 with the cloning enzymes XbaI and XhoI, using the following
reaction mixture:
• Purified PCR product—25 μL
204 Tatiana Q. Aguiar et al.

• Restriction enzyme 1—1 μL

• Restriction enzyme 2—1 μL
• 10× CutSmart® buffer—3 μL
2. Purify the digested products with the QIAquick® PCR Purifi-
cation Kit (see Note 6).
3. Ligate the digested products from case study 1 to the pPICZαA
expression plasmid (previously digested with the same enzymes
and gel purified) and from case study 2 to the pETM20 expres-
sion plasmid (previously digested with the same enzymes and
gel purified) with T4 DNA ligase, following the instructions of
the manufacturer and using a molar ratio of 1:3–1:10 (see Note
10).
4. Transform E. coli chemically competent cells with the entire
ligation mixture according to the manufacturer’s instructions.
5. Screen for positive clones (e.g., by colony PCR [17]), propa-
gate cells from one of these clones, and isolate plasmid DNA to
subsequently confirm the sequence of the inserted fusion genes
by sequencing (see Note 11). If the sequence and reading frame
of the fusion genes are correct, the recombinant plasmids are
ready to be transformed into the final expression host (in the
presented cases P. pastoris or E. coli). If not, review your strat-
egy and repeat these protocols from the step you consider most
adequate.

4 Notes

1. There are several codon optimization tools freely available for

adapting DNA sequences to the codon preference of a particu-
lar expression host (for some examples consult Table 4.3 in
[1]). Codon usage tables for several host organisms are also
available from public databases (e.g., Codon Usage Database).
2. When cloning genes into a commercial expression vector, special
care must be taken to maintain the existing reading frame so that
the ultimately expressed protein has the desired sequence. This is
particularly critical when the restriction enzymes used for clon-
ing have within their recognition sequence a start codon, as is
the case for NcoI (5’ C/CATGG 3′). The ATG within this site
can be used directly to create the ATG start codon and/or the
ATG codon for a methionine residue. However, this restriction
site dictates that the first nucleotide of the next triplet codon
must be a G and that two extra bases are necessary to maintain
the reading frame, which can be added in primer design. Thus,
an extra amino acid will be added to the protein. One way to
overcome this limitation is to use enzymes that, while
 Megaprimer-Based PCR 205

recognizing different nucleotide sequences, are able to generate

ends compatible with those generated by the NcoI enzyme (e.g.,
BsaI).
3. The design of primers for gene cloning into expression plas-
mids has several constraints, such as limited flexibility in the
location of priming regions (the primers must anneal at the 5′
and 3′ extremities of the coding region) and difficulty in fulfill-
ing the requirements for secondary structure formation when
restriction sites or other extra sequences are added to the
5′-end of primers. Therefore, several adjustments generally
have to be manually performed using a trial-and-error method
until the most satisfactory parameters for the designed primers
can be obtained, which many times are not the optimal ones.
4. We could have constructed longer megaprimers P2 and P3,
instead of constructing megaprimer P4, but it would have
been cheaper to order the synthesis of the entire fusion genes
than ordering the synthesis of oligos >150 bp. Moreover, the
bigger the primer, the higher the probability of secondary
structure formation, which has a negative impact on PCR
efficiency. Therefore, we chose to order shorter (and cheaper)
megaprimers and perform a two-step PCR to fuse the desired
genes.
5. Run a higher volume of the PCR sample (>5 μL) to verify if
you can then observe the expected PCR product. Otherwise, it
may be necessary to experimentally optimize the PCR condi-
tions. As initial steps, a gradient of annealing temperatures and
different concentrations of template DNA may be tested, as
well as a superior number of PCR cycles (up to 40). Subse-
quently, different concentrations of primers and of Mg2+ may
also be tested. The addition of dimethyl sulfoxide (DMSO)
may also be considered to inhibit secondary structures in the
DNA template or primers, but if used in high concentration
(>3–5%), it affects the melting point of the primers, and there-
fore it may be necessary to decrease the annealing temperature.
6. In both DNA purification protocols, elute the products from
the columns with the minimum amount of warm ultrapure
water (typically 30 μL), and repeat the elution step with the
30 μL eluate to increase DNA recovery and maximize the
concentration of the eluate.
7. The volume of the PCR product to use as template should be
sufficiently high to allow amplification, but it should not inhibit
the PCR. We have obtained good results using template
volumes ≤30% of the final reaction volume.
8. Although in Fig. 4 several unspecific products (such as primer
dimers) are observed along with the expected PCR product, in
this case, it was not necessary to optimize the PCR conditions.
The band corresponding to the product with the desired
206 Tatiana Q. Aguiar et al.

molecular weight could be easily isolated from the others, and

the amount of the purified product was sufficient for cloning.
However, to reduce primer dimer formation, lower primer
concentration could have been tested. Additionally, touch-
down PCR could have been performed to reduce nonspecific
amplification.
9. At the end of the PCR, add to the reaction mixture 1 μL of Taq
DNA polymerase, and perform a 10-min extension step at
72 °C.
10. Since several rounds of purification reduce the amount of DNA
available for the cloning procedure, sometimes it is necessary to
use a final ligation reaction volume higher than the standard
10 μL indicated by the manufacturer. We have obtained good
results with ligation reactions with up to 20 μL.
11. Alternatively, the sequence of the fusion genes can be con-
firmed by direct sequencing of the final PCR product. How-
ever, when sequencing from the expression plasmid, it is also
possible to confirm if the direction and reading frame of the
sequences are correct.

Acknowledgments

This study was supported by the Portuguese Foundation for Sci-

ence and Technology (FCT) under the scope of the strategic fund-
ing of UIDB/04469/2020 unit and project ESSEntial (PTDC/
BII-BTI/1858/2021).

References
1. Oliveira C, Aguiar TQ, Domingues L (2017) 5. Baptista SL, Romanı́ A, Oliveira C, Ferreira S,
Principles of genetic engineering. In: Rocha CMR, Domingues L (2021) Galactose
Pandey A, Teixeira JA (eds) Current develop- to tagatose isomerization by the L-arabinose
ments in biotechnology and bioengineering: isomerase from Bacillus subtilis: a biorefinery
foundations of biotechnology and bioengi- approach for Gelidium sesquipedale valorisa-
neering, 1st edn. Elsevier, Oxford tion. LWT-Food Sci Technol 151:112199
2. Li X, Jin J, Guo Z, Liu L (2022) Evolution of 6. Bandyopadhyay B, Peleg Y (2018) Facilitating
plasmid-construction. Int J Biol Macromol circular permutation using restriction free
209(Pt a):1319–1326 (RF) cloning. Protein Eng Des Sel 31(3):
3. Oliveira C, Sepúlveda G, Aguiar TQ, Gama 65–68
FM, Domingues L (2015) Modification of 7. Sonnendecker C, Zimmermann W (2019)
paper properties using carbohydrate-binding Domain shuffling of cyclodextrin glucano-
module 3 from the Clostridium thermocellum transferases for tailored product specificity and
CipA scaffolding protein produced in Pichia thermal stability. FEBS Open Bio 9:384–395
pastoris: elucidation of the glycosylation effect. 8. Binte Muhammad Jai HS, Dam LC, Tay LS,
Cellulose 22:2755–2765 Koh JJW, Loo HL, Kline KA, Goh BC (2020)
4. Freitas AI, Domingues L, Aguiar TQ (2022) Engineered lysins with customized lytic activ-
Bare silica as an alternative matrix for affinity ities against enterococci and staphylococci.
purification/immobilization of His-tagged Front Microbiol 11:574739
proteins. Sep Pur Technol 286:120448
 Megaprimer-Based PCR 207

9. Costa CE, Møller-Hansen I, Romanı́ A, Teix- proteins. Appl Microbiol Biotechnol 102(1):
eira JA, Borodina I, Domingues L (2021) Res- 81–92
veratrol production from hydrothermally 14. Freitas AI, Domingues L, Aguiar TQ (2021)
pretreated Eucalyptus wood using recombi- Tag-mediated single-step purification and
nant industrial Saccharomyces cerevisiae strains. immobilization of recombinant proteins
ACS Synth Biol 10(8):1895–1903 toward protein-engineered advanced materials.
10. Baptista SL, Cunha JT, Romanı́ A, Domingues J Adv Res 36:249–264
L (2018) Xylitol production from lignocellu- 15. Aguiar TQ, Oliveira C, Domingues L (2017)
losic whole slurry corn cob by engineered Synthesis of fusion genes for cloning by
industrial Saccharomyces cerevisiae PE-2. Bior- megaprimer-based PCR. In: Domingues L
esour Technol 267:481–491 (ed) PCR: methods and protocols, Methods
11. Silva R, Aguiar TQ, Coelho C, Jiménez A, in molecular biology, vol 1620. Springer,
Revuelta JL, Domingues L (2019) Metabolic New York, NY
engineering of Ashbya gossypii for deciphering 16. Wan W, Wang DM, Gao XL, Hong J (2011)
the de novo biosynthesis of γ-lactones. Microb Expression of family 3 cellulose-binding mod-
Cell Factories 18:62 ule (CBM3) as an affinity tag for recombinant
12. Forloni M, Liu AY, Wajapeyee N (2019) Mega- proteins in yeast. Appl Microbiol Biotechnol
primer polymerase chain reaction (PCR)-based 91:789–798
mutagenesis. Cold Spring Harb Protoc 2019:6 17. Azevedo F, Pereira H, Johansson B (2017)
13. Oliveira C, Domingues L (2018) Guidelines to Colony PCR. In: Domingues L (ed) PCR:
reach high-quality purified recombinant methods and protocols, Methods in Molecular
Biology, vol 1620. Springer, New York, NY
 Chapter 17

Bacteria and Yeast Colony PCR

Humberto Pereira, Paulo César Silva, and Björn Johansson

Abstract
The bacteria Escherichia coli and the yeast Saccharomyces cerevisiae are currently the two most important
organisms in synthetic biology. E. coli is almost always used for fundamental DNA manipulation, while yeast
is the simplest host system for studying eukaryotic gene expression and performing large-scale DNA
assembly. Yeast expression studies may also require altering the chromosomal DNA by homologous
recombination. All these studies require the verification of the expected DNA sequence, and the fastest
method of screening is colony PCR, which is direct PCR of DNA in cells without prior DNA purification.
Colony PCR is hampered by the difficulty of releasing DNA into the PCR mix and by the presence of PCR
inhibitors. We hereby present one protocol for E. coli and two protocols for S. cerevisiae differing in
efficiency and complexity as well as an overview of past and possible future developments of efficient
S. cerevisiae colony PCR protocols

Key words PCR, Colony, Yeast, Saccharomyces cerevisiae, Escherichia coli, Direct lysis

1 Introduction

Colony or whole-cell PCR is the direct PCR amplification of target

sequences inside cells without prior isolation or purification of
DNA. Colony PCR is possible if enough cells lyse as a consequence
of the high temperature in the initial template denaturation step
alone or in combination with extra procedures to make DNA more
accessible. The material containing the cells or the cells themselves
must also not present PCR inhibition to an extent that prevents
PCR amplification. The advantage of colony PCR over using pur-
ified DNA is savings in time and cost, as the time-consuming DNA
extraction step is omitted. Minimizing sample handling by omit-
ting DNA purification can also increase sensitivity if the starting
material is limiting as it might be in, for example, forensic applica-
tions. Very low amounts of starting material may prohibit DNA
purification as all purification procedures are associated with a loss.
Less sample handling also lowers the risk of cross-contamination of

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_17,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

209
210 Humberto Pereira et al.

samples, an important consideration since PCR is a sensitive tech-

nique prone to false-positive results.
The need for detecting the presence or absence of specific
sequences within cells is routinely needed in a wide range of dis-
ciplines, such as clinical microbiology, genetic engineering, and
forensic sciences. The most common application of colony PCR
in genetic engineering is probably the amplification of ligation
product sequences within Escherichia coli transformants after cut-
and-paste cloning. This procedure is straightforward with few asso-
ciated problems. The first report on E. coli colony PCR describes
the resuspension of one colony in half a mL of water and
subsequent boiling for 5 min [1]. After centrifugation for 2 min
at maximum speed in a microcentrifuge (15–20,000 g), 5 μL of the
supernatant was used as the template for PCR. The authors later
succeeded in using E. coli directly without prior dilution or boiling.
Few variations of this simple protocol have been published, indicat-
ing that it is generally applicable with a reasonable rate of success.
The current iteration of the protocol simply involves adding a small
amount of an E. coli colony to a PCR which is thereafter handled as
if an amplification from pure DNA.
Another common application of colony PCR is the analysis of
transformants of the yeast Saccharomyces cerevisiae after genetic
engineering or DNA assembly experiments. S. cerevisiae can assem-
ble large and complex constructs through homologous recombina-
tion in one step [2]. This technique has found many applications in
the field of synthetic biology [3–7].
Colony PCR from S. cerevisiae is unfortunately nontrivial,
which is evident from the myriad of available protocols, both
published under peer review and available online (see www.bit.ly/
pcr_prot for a compilation). This indicates that there may not be
one protocol that is optimal for all use cases. False-negative results
are a general problem affecting yeast colony PCR. Factors that seem
to affect yeast colony PCR efficiency are the chronological age of
the culture, growth phase, growth rate, size of the desired PCR
product, the copy number of the target sequence, and media com-
ponents [8]. Fresh cultures of rapidly growing yeast, where the
target amplicon is short and present in multiple copies, seem to
present the least problems. Early published yeast colony PCR pro-
tocols were essentially E. coli protocols adapted for yeast, where
yeast cells are simply added to the PCR mixture and the cells are
presumably lysed in the initial denaturation step [9].
We have adapted one protocol for E. coli colony PCR (Sub-
heading 3.1) and two different protocols for S. cerevisiae (Subhead-
ings 3.2 and 3.3) that are routinely used in our laboratory. The
protocol in Subheading 3.2 is very simple and rapid, involving only
a short preincubation step in a microwave oven, while the protocol
in Subheading 3.3 is a version of the LiAc-SDS protocol [10],
which is more sensitive and robust in our hands, but also more
laborious.
 Bacteria and Yeast Colony PCR 211

The LiAc-SDS protocol [10] stands out in another respect.

Most publications describing yeast colony PCR protocols have a
relatively low number of citations, often in publications describing
different yeast colony PCR protocols or publications from the
laboratory where the protocol originated. The LiAc-SDS has
162 PubMed citations as of January 2023 from a wide range of
laboratories, indicating that it is generally applicable.
Future developments of yeast colony PCR protocols should
separate the effects of DNA release and PCR inhibition, and how
these effects vary with variables such as culture medium, age, and
growth phase of the cultures, and then systematically apply the
relevant conditions based on the results for other direct PCR
protocols.

1.1 DNA Release The addition of preincubation with a yeast lytic enzyme such as
zymolyase or lyticase can improve efficiency [11, 12]. Lyticase usu-
ally refers to pure β-1,3-glucanase, while zymolyase is a mixture of
lytic enzymes. The factor targeted by this enzyme is the strong yeast
cell wall which is weakened or removed. The downside is the
enzyme cost and potentially the addition of phosphate in the incu-
bation buffer, which may lead to PCR inhibition by interaction with
the magnesium ions in the PCR buffer. Recombinant lyticase from
the bacteria Oerskovia xanthineolytica is easily produced by the
cultivation of cells harboring a plasmid carrying the glucanase
structural gene [13]. The resulting lyticase is cost-effective, but
PCR strategies should be designed with care since the resulting
enzyme is often contaminated with the expression plasmid and
E. coli chromosomal DNA. We previously used a protocol based
on homemade recombinant lyticase, but while effective, not ulti-
mately considered worth the extra work unless lyticase has some
other use in the laboratory.
A brief treatment of cells with sodium hydroxide [14] is a
method that has several potential targets. The authors suggest
that the modes of action could be increased cell wall permeability,
dissociation of DNA from bound proteins, or degradation of RNA.
Additionally, sodium hydroxide might neutralize intercalated PCR
inhibitors by denaturing DNA [15]. The addition of the strong
anionic detergent sodium dodecyl sulfate (SDS) alone [16] or in
combination with ethanol [17] or lithium acetate (LiAc) [10] has
also been described as a method for achieving PCR amplification
from whole yeast cells. SDS efficiently dissolves membrane lipids
but is also a potent PCR inhibitor [18]. The presence of SDS also
potentially eliminates DNA-protein interactions as SDS is used to
prevent gel shifts in the electrophoresis of DNA. Ethanol would
precipitate DNA as soon as it is liberated from the cells and may be a
way to selectively wash away inhibitors and concentrate DNA
[17]. LiAc is commonly used in yeast transformation [19], where
the mode of action may be to turn the cell wall more porous [20],
which probably improves cell lysis.
212 Humberto Pereira et al.

Physical methods such as heating, boiling, grinding with glass

beads, or rapid freeze-thaw cycles [21] have also been employed
but may be more laborious if the number of samples is large. Glass
beads in combination with the metal chelating resin Chelex
100 have been reported to permit PCR from whole yeast cells
[22]. The role of the chelator is to remove metal ions necessary
for nucleases, thereby protecting DNA. The use of chelating resins
has also been reported to allow PCR amplification from forensic
samples [23]. Sonication has proved beneficial for colony PCR of
Gram-positive bacteria [24] and protein extraction in S. cerevisiae
[25]. However, its effectiveness for yeast colony PCR is yet to be
established.

1.2 Future There is substantial development of techniques for direct amplifica-

Developments tion of DNA in complex matrixes with as few or no manipulation
steps involved. Rapid genetic typing of human blood or tissue and
detection of human pathogens, as well as forensic science, are likely
the strongest motivation for this development. It is possible that at
least some of these new procedures could benefit new methods for
direct colony PCR from difficult sources such as S. cerevisiae.
One of the most attractive recent developments is thermostable
DNA polymerases engineered for higher PCR inhibitor tolerance
[26]. Examples of these are the addition of DNA binding domains
[27] and polymerases developed through gene shuffling or com-
partmentalized self-replication. The last approach has yielded DNA
polymerases resistant to the potent PCR inhibitor heparin [28] and
a broad range of environmentally derived inhibitors [29].
PCR enhancers are another area of development that could
potentially aid colony PCR protocols. Common PCR enhancers
include N,N,N-trimethylglycine (betaine), bovine serum albumin
(BSA), dithiothreitol (DTT), glycerol, and dimethyl sulfoxide
(DMSO). DMSO was first reported as improving Sanger DNA
sequencing quality [30] of PCR products, possibly by preventing
reannealing of the strands. Formamide, glycerol, DMSO, Tween-
20, and NP-40 are suggested as remedies for difficulties in the
amplification of GC-rich templates [31] as well as betaine at 1 M
[32], 1.3 M [33], and 2 M [34] or at 1 M in combination with
DMSO [35, 36]. DMSO disrupts DNA base pairing without
affecting fidelity [37], while betaine has been reported to affect
the base pair composition dependence of DNA strand
composition [38].
Trehalose [39], protein BSA, and gelatin stabilize the DNA
polymerase during thermal cycling. Nonionic detergents Tween-20
and NP-40 might have a beneficial effect in this respect as they are
added to Taq DNA polymerase purification protocols for this rea-
son [40]. Triton X-100 is thought to have the same effect
[41, 42]. Tween-20 and NP-40 alone or in combination with
DMSO also have been reported to improve specificity and raise
 Bacteria and Yeast Colony PCR 213

the yield of PCR in general [43] and also neutralize the negative
effects of sodium dodecyl sulfate (SDS) [44]. Several mono- and
disaccharides were recently reported to be effective PCR enhancers,
with sucrose surpassing trehalose and DMSO for the conditions
tested [45].
Relatively new PCR enhancers are nanoparticles from gold
(AuNPs) [46, 47], titanium dioxide (TiO2) [48], and graphene
oxide (GO) or reduced graphene oxide (rGO) [49]. The mode of
action of nanoparticles has not been elucidated in detail. Finally,
attempts have been made to combine several enhancers in an
attempt to find synergistic positive effects [50–52].
The PCR reagents can be altered in order to enhance PCR
specificity. This was observed when locked nucleic acid (LNA)-
modified primers were used instead of unmodified oligonucleotides
[53]. Replacing the canonical dNTPs with 2′-deoxynucleoside
5′-(alpha-P-seleno)-triphosphates (dNTPαSe) [54] was capable of
increasing PCR specificity by over 240-fold [55].

2 Materials

2.1 E. coli Colony 1. Water. PCR components and other solutions should be
PCR prepared using the best available water. We routinely use
double-deionized water with a specific conductance of
18.2 MΩ/cm at 25 °C.
2. 2× PCR master mix with DMSO (Table 1). We have found it
practical to prepare a two times concentrated PCR master mix
containing all components except PCR primers and template
DNA, as this minimizes pipetting errors and improves consis-
tency across PCR experiments. The PCR master mix can be
stored at -20 °C without a noticeable loss of efficiency. We
routinely include 1% DMSO in the final PCR mixture.

Table 1
Recipe for 1 mL twice concentrated PCR master mix containing 2% DMSO
suitable for colony PCR

Component Volume (μL)

Water 650
Taq buffer with NH4SO4 (x10) 200
MgCl2 (50 mM) 80
dNTPs (10 mM each) 40
DMSO (100%) 20
Taq DNA polymerase (5 U/μL) 10
214 Humberto Pereira et al.

Table 2
Recipe for 5× PCR compatible loading buffer

Component Volume
25% Ficoll 10 mL
Tartrazine food coloring 1 mL
Xylene cyanol 125 mg/mL 10 μL

3. 5× PCR-compatible loading buffer (Table 2). A PCR-compatible

loading buffer can be added directly into the PCR mix, saving
post-PCR pipetting steps that might potentially contaminate the
laboratory. We have adopted such a loading buffer made in-house
to lower PCR costs. Tartrazine food coloring is a commercial
food coloring sold in grocery stores.
4. Thermocycler.
5. Electrophoresis running buffer. We use 1X Tris-acetate-EDTA
(TAE) made from a 50X TAE (2 M Tris base, 5.71% (v/v)
glacial acetic acid, 50 mM EDTA) stock solution. This 50X
TAE is prepared by dissolving 242 g Tris base, 18.61 g EDTA,
and 57.1 mL glacial acetic acid in 500 mL of water and adding
water up to 1 L.
6. Agarose gel 1%. Add 100 mL of the chosen running buffer for
each gram of agarose, and heat it until the agarose melts
completely. After adding a pre-staining DNA dye, pour the
gel into an appropriate mold and let it solidify.
7. Electrophoresis equipment, including power supply and elec-
trophoresis tank.

2.2 S. cerevisiae All the items listed on Subheading 2.1 plus:

Colony PCR Using a
1. Microwave oven.
Microwave Oven

2.3 PCR Using S. All the items listed on Subheading 2.1 plus:
cerevisiae LiAc
1. 1 M lithium acetate stock solution. The lithium acetate solu-
Permeabilized Cells
tion is prepared as a 1 M stock in water. Add 10.2 g lithium
acetate dihydrate (LiOAc*2H2O, Mw 102.02 g/mol) in
80 mL water and dissolve. Add water to 100 mL and autoclave.
2. SDS stock solution 20% (w/v). Add 10 g SDS to 40 mL
H2O. Heat to 60 °C to dissolve the SDS. Adjust pH to 7–8
using sodium hydroxide. Adjust volume to 50 mL with water.
Do not autoclave as SDS will precipitate.
3. LiOAc-SDS solution. Mix 75 μL water, 20 μL 1 M LiOAc, and
5 μL 20% (w/v) SDS for each DNA extraction. Aliquot 100 μL
in 1.5 mL microcentrifuge tubes.
 Bacteria and Yeast Colony PCR 215

4. TE buffer. Add 10 mL 1 M Tris–HCl pH 8.0 and 2 mL 0.5 M

EDTA pH 8.0 to 988 mL water. The resulting solution will be
10 mM Tris–HCl and 1 mM EDTA. Autoclave to sterilize. This
buffer is used to resuspend DNA in the last step. Other recipes
of TE buffer can probably also be used.

3 Methods

Carry out all procedures at room temperature unless otherwise

specified. PCR master mixes should be kept on ice at all times,
but PCR tubes can be handled at room temperature during the
preparation of the mix.

3.1 E. coli Colony This protocol can be used to amplify new constructs in E. coli
PCR transformants. We have found it efficient to use a three-primer
strategy using two vector-specific primers flanking the insertion
location of the insert and one gene-specific primer, usually one of
the primers used to amplify the insert (Fig. 1). The two vector-
specific primers should differ in the distance to the insertion site by
200–400 bp. Using this strategy, an empty clone will produce a
short PCR product corresponding to the distance between the
vector-specific primers, while one of two longer bands will arise
from a successful clone, depending on the orientation of a cloned
insert (see Note 1):
1. Prepare a 1× PCR master mix containing all PCR components
except template DNA. We use a homemade 2× PCR master
mix containing DNA polymerase, buffer, Mg2+, dNTPs, and
DMSO to which PCR primers are added to a final concentra-
tion of 1 μM and water. We prepare 110% of the theoretical

Fig. 1 Illustration of three-primer strategy for confirming cloning results. The annealing primer locations
(represented in purple) will be different depending on the outcome: (a) plasmid containing an insert with the
desired orientation; (b) plasmid containing an insert with the inverse orientation; (c) plasmid without insert
216 Humberto Pereira et al.

required volume, which is calculated as the total volume of each

PCR times the number of clones including two negative con-
trols (no cells and cells with the empty vector, i.e., vector
without the insert) and a positive control if available. The
cells are assumed to take up no volume in the calculation.
2. Prepare the appropriate number of tubes containing 1× PCR
master mix. We keep the tubes open before adding the E. coli
cells as we have found that the proximity to a Bunsen
burner provides a sufficiently clean environment to avoid
contamination.
3. Add a part of the E. coli colony to the inside of the tube,
by swirling the toothpick against the wall of the tube (see
Notes 2–4).
4. Transfer the remaining cells on the toothpick to fresh liquid or
solid medium for preserving the clone and possibly preparing
plasmid DNA.
5. Vortex and place the PCR tubes in a preheated thermal cycler as
soon as possible.
6. Run the PCR program (see Note 5); time periods and tempera-
tures depend on the polymerase used, size of the expected PCR
product, and the melting temperature of the primers. We have
found that 5-min initial denaturation (94–98 °C), 35 cycles of
the main program, and 5 min of post-extension at 72 °C are
sufficient.
7. Analyze 5–10 μL of the PCR amplification by gel electropho-
resis. We add dyes to the loading buffer, in which case we can
omit the addition of a loading buffer to the PCR products.

3.2 S. cerevisiae This protocol usually represents the best compromise between cost,
Colony PCR Using a work, and success rate and should probably be the first protocol
Microwave Oven tested for a laboratory wishing to implement S. cerevisiae colony
PCR. We have found it to be efficient for PCR products up to 2 kb,
with occasional success for products up to 3 kb in size:
1. Prepare 1× PCR master mix according to the same principles as
for the E. coli protocol (Subheading 3.1).
2. Pick a small, well-isolated colony with a sterile toothpick or a
sterile 200 μL pipette tip (see Notes 3 and 6).
3. Transfer part of the colony to the side of a PCR tube. The most
common mistake is to transfer too much cell material to the
tube. We usually swirl the toothpick on the inside of the tube.
4. Transfer the remaining cells on the toothpick to fresh solid or
liquid medium.
5. Incubate the tubes for 1–2 min at full power (800–1000 W)
using a stock domestic microwave oven.
 Bacteria and Yeast Colony PCR 217

6. Cool the tubes by placing them on ice or by a 3–5-min incuba-

tion at -20 °C in a freezer.
7. Add the PCR master mix; we use a total PCR volume of 20 μL
to save on reagents. A larger scale such as 50 μL will be less
sensitive to excess biomass in the PCR which might be useful
for optimization.
8. Run the PCR program (see Note 7) and analyze 5–10 μL of the
PCR product by gel electrophoresis.

3.3 PCR Using S. This protocol may not qualify as colony PCR, as DNA is effectively
cerevisiae LiAc purified from the cells. However, this protocol is considerably less
Permeabilized Cells laborious than methods relying on any combination of glass beads,
phenol, and chloroform. In our hands, this protocol has succeeded
where the microwave oven protocol (Subheading 3.2) failed. This
protocol has given more stable results, especially in the hands of less
experienced workers. This protocol was first described by Lõoke
et al. [10]:
1. Prepare one tube of 100 μL LiOAc-SDS mix for each colony.
2. Transfer a small colony from a plate using a sterile toothpick
(see Note 6). The toothpick can also be used to inoculate liquid
or solid medium to preserve the clone.
3. Vortex the tubes briefly and incubate at >70 °C for 10 min (see
Note 8).
4. Add 300 μL of 96% ethanol and vortex briefly to
precipitate DNA.
5. Spin tubes at least 15,000 g in a microcentrifuge for 3–5 min to
precipitate DNA. The cells and cell debris will coprecipitate
with the DNA at this point.
6. Remove liquid by inverting the tubes.
7. Add 500 μL 70% ethanol to each tube.
8. Spin tubes like in step 5.
9. Remove liquid by inverting the tubes. Try to remove as much
of the liquid as possible in this step (see Note 9).
10. Resuspend the DNA in 100 μL TE buffer (see Note 10).
11. Spin down the cell debris for 1 min at top speed in a
microcentrifuge.
12. Use 1 μL of the supernatant for 20 μL of total PCR volume.
13. Transfer about half of the supernatant to a fresh tube and store
the DNA at -20 °C.
14. Run the PCR program and analyze 5–10 μL of the PCR
product by gel electrophoresis.
218 Humberto Pereira et al.

4 Notes

1. The choice of PCR primers can be important. PCR primers

should be specific for both vector and insert, as false-positive
detection may arise by using PCR primers that are specific only
for the insert or vector. The explanation for this surprising
phenomenon is that DNA from the ligation mixture may
adsorb onto the surface of the cells and serve as a PCR template
masking the absence of the correct DNA construct inside the
cells [56].
2. Each colony must be transferred to both culture medium and
PCR. Since many clones are usually screened, keeping track of
PCR tubes and clones may be a logistical issue. We have found
that stabbing a gridded LB plate with the tip and leaving it
there is a good way of keeping track of the picked clones.
3. Many published protocols rely on the use of sterile toothpicks
for transferring clones to the PCR tubes. It should be noted
that toothpicks have been associated with PCR inhibitors
[57]. If this is a concern, sterile pipet tips can be used instead.
4. We have found that toothpicks may absorb some of the PCR
mix if cells are added into the master mix. Pipette tips used in
the same way may also remove some PCR mix by capillary
action. We deposit the cells above the surface of the PCR mix
in the tube and vortex the tubes prior to PCR. This has the
added benefit of not allowing interaction between PCR mix
and template prior to PCR.
5. We provide a web service (http://pydna.pythonanywhere.com)
where PCR can be simulated prior to PCR to ensure that PCR
primers bind to the template DNA.
6. We usually keep an open petri dish with a suitable solid selective
yeast medium nearby to preserve the clones. The petri dish is
gridded with 8×8 to 10×10 squares using a marker pen or by
placing it on a printable petri dish grid [58]. The toothpicks
can be left standing in the agar as a help to keep track of
processed clones.
7. This protocol is sensitive to the amount of yeast cells in the
PCR tube. During the setup of this protocol, it is useful to use a
PCR test case. We use primers 19_D-DFR1 (5’ GAC TCA
GAC AGG TTG AAA AGA AGA C 3′) and 18_A-DFR1
(5’ CAA AGG TTT GGT TTT CAG TTA AGA A 3′) to
amplify a 1288 bp PCR product from the DFR1 locus in
S. cerevisiae using a program consisting of initial denaturation
for 4 min at 94 °C, followed by 30 cycles of 94 °C for 30 s,
50 °C for 30 s, and 72 °C for 45 s, and a final extension at 72 °C
for 5 min. This PCR is very robust and any yeast colony PCR
protocol should do it with success.
 Bacteria and Yeast Colony PCR 219

8. The original protocol also states that a 10-min incubation at

room temperature can be performed instead of the incubation
at 70 °C, but the high temperature should inactivate nucleases
that can potentially degrade DNA. This might be an issue since
DNA and cell debris are present together until the last step.
9. It is important to remove as much as possible of the ethanol in
step 9 of Subheading 3.2, as ethanol could be a PCR inhibitor.
The tubes can be incubated in a 37 °C heat block for 3–5 min in
order to evaporate traces of ethanol.
10. Unlysed cells and cell debris will also be resuspended in
this step.

Acknowledgments

This work was supported by the Fundação para a Ciência e Tecno-

logia Portugal (FCT) through Project FatVal PTDC/EAM-AMB/
032506/2017 funded by national funds through the FCT I.P. and
by the ERDF through the COMPETE2020 – Programa Operacio-
nal Competitividade e Internacionalizacão (POCI). CBMA was
supported by the strategic program UIDB/04050/2020 funded
by national funds through the FCT I.P. Humberto Pereira
acknowledges FCT for the Ph.D. scholarship, SFRH/BD/
148722/2019.

References
1. Güssow D, Clackson T (1989) Direct clone compartments for increased production of the
characterization from plaques and colonies by lipophilic natural products ginsenosides.
the polymerase chain reaction. Nucleic Acids Metab Eng 67:104–111
Res 17:4000 6. Wang S, Xu X, Lv X, Liu Y, Li J, Du G, Liu L
2. Gibson DG, Benders GA, Axelrod KC, (2022) Construction and Optimization of the
Zaveri J, Algire MA, Moodie M, Montague de novo Biosynthesis Pathway of Mogrol in
MG, Venter JC, Smith HO, Hutchison CA Saccharomyces Cerevisiae. Front Bioeng Bio-
(2008) One-step assembly in yeast of 25 over- technol 10:919526
lapping DNA fragments to form a complete 7. Pereira H, Azevedo F, Domingues L, Johans-
synthetic Mycoplasma genitalium genome. son B (2022) Expression of Yarrowia lipolytica
Proc Natl Acad Sci 105:20404–20409 acetyl-CoA carboxylase in Saccharomyces cerevi-
3. Pereira F, Azevedo F, Parachin NS, Hahn- siae and its effect on in-vivo accumulation of
H€agerdal B, Gorwa-Grauslund MF, Johansson Malonyl-CoA. Comput Struct Biotechnol J 20:
B (2016) Yeast Pathway Kit: A Method for 779–787
Metabolic Pathway Assembly with Automati- 8. Bonnet C, Rigaud C, Chanteclaire E,
cally Simulated Executable Documentation. Blandais C, Tassy-Freches E, Arico C, Javaud
ACS Synth Biol 5:386–394 C (2013) PCR on yeast colonies: an improved
4. Cataldo VF, Salgado V, Saa PA, Agosin E method for glyco-engineered Saccharomyces
(2020) Genomic integration of unclonable cerevisiae. BMC Res Notes 6:201
gene expression cassettes in Saccharomyces cer- 9. Sathe GM, O’Brien S, McLaughlin MM,
evisiae using rapid cloning-free workflows. Watson F, Livi GP (1991) Use of polymerase
Microbiologyopen 9:e978 chain reaction for rapid detection of gene inser-
5. Shi Y, Wang D, Li R, Huang L, Dai Z, Zhang X tions in whole yeast cells. Nucleic Acids Res 19:
(2021) Engineering yeast subcellular 4775
220 Humberto Pereira et al.

10. Lõoke M, Kristjuhan K, Kristjuhan A (2011) 23. Walsh PS, Metzger DA, Higuchi R (1991)
Extraction of genomic DNA from yeasts for Chelex 100 as a medium for simple extraction
PCR-based applications. BioTechniques 50: of DNA for PCR-based typing from forensic
325–328 material. BioTechniques 10:506–513
11. Ling M, Merante F, Robinson BH (1995) A 24. Jamal MAHM, Sharma SP, Chung H-J, Kim
rapid and reliable DNA preparation method for H-J, Hong S-T, Lee S (2017) Ultra-High Effi-
screening a large number of yeast clones by cient Colony PCR for High Throughput
polymerase chain reaction. Nucleic Acids Res Screening of Bacterial Genes. Indian J Micro-
23:4924–4925 biol 57:365–369
12. Kwiatkowski TJ Jr, Zoghbi HY, Ledbetter SA, 25. Liu D, Zeng X-A, Sun D-W, Han Z (2013)
Ellison KA, Chinault AC (1990) Rapid identi- Disruption and protein release by ultrasonica-
fication of yeast artificial chromosome clones tion of yeast cells. Innov Food Sci Emerg Tech-
by matrix pooling and crude lysate PCR. nol 18:132–137
Nucleic Acids Res 18:7191–7192 26. Kermekchiev MB, Kirilova LI, Vail EE, Barnes
13. Shen SH, Chrétien P, Bastien L, Slilaty SN WM (2009) Mutants of Taq DNA polymerase
(1991) Primary sequence of the glucanase resistant to PCR inhibitors allow DNA amplifi-
gene from Oerskovia xanthineolytica. Expres- cation from whole blood and crude soil sam-
sion and purification of the enzyme from ples. Nucleic Acids Res 37:e40
Escherichia coli. J Biol Chem 266(1991): 27. Wang Y, Prosen DE, Mei L, Sullivan JC,
1058–1063 Finney M, Horn PBV (2004) A novel strategy
14. Wang H, Kohalmi SE, Cutler AJ (1996) An to engineer DNA polymerases for enhanced
improved method for polymerase chain reac- processivity and improved performance
tion using whole yeast cells. Anal Biochem 237: in vitro. Nucleic Acids Res 32:1197–1207
145–146 28. Ghadessy FJ, Ong JL, Holliger P (2001)
15. Bourke MT, Scherczinger CA, Ladd C, Lee Directed evolution of polymerase function by
HC (1999) NaOH treatment to neutralize compartmentalized self-replication. Proc Natl
inhibitors of Taq polymerase. J Forensic Sci Acad Sci U S A 98:4552–4557
44:1046–1050 29. Baar C, d’Abbadie M, Vaisman A, Arana ME,
16. Akada R, Murakane T, Nishizawa Y (2000) Hofreiter M, Woodgate R, Kunkel TA, Holli-
DNA extraction method for screening yeast ger P (2011) Molecular breeding of poly-
clones by PCR. Biotechniques 28(2000): merases for resistance to environmental
668–670, 672, 674 inhibitors. Nucleic Acids Res 39:e51
17. Linke B, Schröder K, Arter J, Gasperazzo T, 30. Winship PR (1989) An improved method for
Woehlecke H, Ehwald R (2010) Extraction of directly sequencing PCR amplified material
nucleic acids from yeast cells and plant tissues using dimethyl sulphoxide. Nucleic Acids Res
using ethanol as medium for sample preserva- 17:1266
tion and cell disruption. BioTechniques 49: 31. Varadaraj K, Skinner DM (1994) Denaturants
655–657 or cosolvents improve the specificity of PCR
18. Rossen L, Nørskov P, Holmstrøm K, Rasmus- amplification of a G + C-rich DNA using genet-
sen OF (1992) Inhibition of PCR by compo- ically engineered DNA polymerases. Gene 140:
nents of food samples, microbial diagnostic 1–5
assays and DNA-extraction solutions. Int J 32. Henke W, Herdel K, Jung K, Schnorr D, Loen-
Food Microbiol 17:37–45 ing SA (1997) Betaine improves the PCR
19. Gietz RD, Schiestl RH (2007) High-efficiency amplification of GC-rich DNA sequences.
yeast transformation using the LiAc/SS carrier Nucleic Acids Res 25:3957–3958
DNA/PEG method. Nat Protoc 2:31–34 33. Hengen PN (1997) Optimizing multiplex and
20. Pham TA, Kawai S, Murata K (2011) Visuali- LA-PCR with betaine. Trends Biochem Sci 22:
zation of the synergistic effect of lithium ace- 225–226
tate and single-stranded carrier DNA on 34. Mytelka DS, Chamberlin MJ (1996) Analysis
Saccharomyces cerevisiae transformation. Curr and suppression of DNA polymerase pauses
Genet 57:233–239 associated with a trinucleotide consensus.
21. Harju S, Fedosyuk H, Peterson KR (2004) Nucleic Acids Res 24:2774–2781
Rapid isolation of yeast genomic DNA: Bust 35. Frackman S, Kobs G, Simpson D, Storts D
n’ Grab. BMC Biotechnol 4:8 (1998) Others, Betaine and DMSO: enhancing
22. Blount BA, Driessen MRM, Ellis T (2016) GC agents for PCR. Promega Notes 65:27–29
Preps: Fast and Easy Extraction of Stable Yeast 36. Kang J, Lee MS, Gorenstein DG (2005) The
Genomic DNA. Sci Rep 6:26863 enhancement of PCR amplification of a
 Bacteria and Yeast Colony PCR 221

random sequence DNA library by DMSO and Enhancement in the efficiency of polymerase
betaine: application to in vitro combinatorial chain reaction by TiO 2 nanoparticles: crucial
selection of aptamers. J Biochem Biophys role of enhanced thermal conductivity. Nano-
Methods 64:147–151 technology. 21:255704
37. Hardjasa A, Ling M, Ma K, Yu H (2010) Inves- 49. Jia J, Sun L, Hu N, Huang G, Weng J (2012)
tigating the effects of DMSO on PCR fidelity Graphene enhances the specificity of the poly-
using a restriction digest-based method. J Exp merase chain reaction. Small 8:2011–2015
Microbiol Immunol (JEMI) 14:161–164 50. Musso M, Bocciardi R, Parodi S, Ravazzolo R,
38. Rees WA, Yager TD, Korte J, von Hippel PH Ceccherini I (2006) Betaine, dimethyl sulfox-
(1993) Betaine can eliminate the base pair ide, and 7-deaza-dGTP, a powerful mixture for
composition dependence of DNA melting. amplification of GC-rich DNA sequences. J
Biochemistry 32:137–144 Mol Diagn 8:544–550
39. Spiess A-N, Mueller N, Ivell R (2004) Treha- 51. Ralser M, Querfurth R, Warnatz H-J,
lose is a potent PCR enhancer: lowering of Lehrach H, Yaspo M-L, Krobitsch S (2006)
DNA melting temperature and thermal stabili- An efficient and economic enhancer mix for
zation of taq polymerase by the disaccharide PCR. Biochem Biophys Res Commun 347:
trehalose. Clin Chem 50:1256–1259 747–751
40. Desai UJ, Pfaffle PK (1995) Single-step purifi- 52. Zhang Z, Kermekchiev MB, Barnes WM
cation of a thermostable DNA polymerase (2010) Direct DNA amplification from crude
expressed in Escherichia coli. BioTechniques clinical samples using a PCR enhancer cocktail
19:780–782. 784 and novel mutants of Taq. J Mol Diagn 12:
41. Adlimoghadam A, Hedayati MH, Siadat SD, 152–161
Nejati HAM, Vandyousefi J, Norouzion D 53. Pan J, Zhang C, Teng Y, Zeng S, Chen S,
(2008) Optimization of PCR conditions for Liang D, Li Z, Wu L (2021) Detection of
detection of human brucellosis from human Spinal Muscular Atrophy Using a Duplexed
serum samples. Res J Microbiol 3:352–358 Real-Time PCR Approach With Locked
42. Lorenz TC (2012) Polymerase chain reaction: Nucleic Acid-Modified Primers. Ann Lab Med
basic protocol plus troubleshooting and opti- 41:101–107
mization strategies. J. Vis. Exp. 63:e3998 54. Hu B, Wang Y, Sun S, Yan W, Zhang C, Luo D,
43. Bachmann B, Lüke W, Hunsmann G (1990) Deng H, Hu LR, Huang Z (2019) Synthesis of
Improvement of PCR amplified DNA sequenc- Selenium-Triphosphates (dNTPαSe) for More
ing with the aid of detergents. Nucleic Acids Specific DNA Polymerization. Angew Chem
Res 18:1309 Int Ed Engl 58:7835–7839
44. Wilson IG (1997) Inhibition and facilitation of 55. Hu B, Wang Y, Li N, Zhang S, Luo G, Huang
nucleic acid amplification. Appl Environ Z (2021) Highly convenient and highly
Microbiol 63:3741–3751 specific-and-sensitive PCR using Se-atom
45. Sakhabutdinova AR, Chemeris AV, Garafutdi- modified dNTPs. Chem Commun 57:57–60
nov RR (2020) Enhancement of PCR effi- 56. Dallas-Yang Q, Jiang G, Sladek FM (1998)
ciency using mono- and disaccharides. Anal Avoiding false positives in colony PCR. Bio-
Biochem 606:113858 Techniques 24:580–582
46. Li H, Huang J, Lv J, An H, Zhang X, Zhang Z, 57. Lee AB, Cooper TA (1995) Improved direct
Fan C, Hu J (2005) Nanoparticle PCR: PCR screen for bacterial colonies: wooden
Nanogold-Assisted PCR with Enhanced Speci- toothpicks inhibit PCR amplification. Bio-
ficity. Angew Chem Int Ed 44:5100–5103 Techniques 18:225–226
47. Yang W, Li X, Sun J, Shao Z (2013) Enhanced 58. Lehti T, Westerlund-Wikström B (2013) Col-
PCR amplification of GC-rich DNA templates ony immunoblotting assay for detection of bac-
by gold nanoparticles. ACS Appl Mater Inter- terial cell-surface or extracellular proteins, Bio
faces 5:11520–11524 Protoc. 3:e888
48. Khaliq A, Sonawane RPJ, Sasi BK, Sahu BS,
Pradeep T, Das SK, Mahapatra NR (2010)
 Chapter 18

Inverse PCR for Site-Directed Mutagenesis

Diogo Silva, Gustavo Santos, Mário Barroca, Diogo Costa,
and Tony Collins

Abstract
Inverse PCR is a powerful tool for the rapid introduction of desired mutations at desired positions in a
circular double-stranded DNA sequence. In this technique, custom-designed mutant primers oriented in
the inverse direction are used to amplify the entire circular template with incorporation of the required
mutation(s). By careful primer design, it can be used to perform such diverse modifications as the
introduction of point or multiple mutations, the insertion of new sequences, and even sequence deletions.
Three primer formats are commonly used, nonoverlapping, partially overlapping, and fully overlapping
primers, and here we describe the use of nonoverlapping primers for introduction of a point mutation. Use
of such a primer setup in the PCR, with one of the primers containing the desired mismatch mutation,
results in the amplification of a linear, double-stranded, mutated product. Methylated template DNA is
removed from the non-methylated PCR product by DpnI digestion, and the PCR product is then
phosphorylated by polynucleotide kinase treatment before being recircularized by ligation and transformed
to E. coli. This relatively simple site-directed mutagenesis procedure is of major importance in biology and
biotechnology where it is commonly employed for the study and engineering of DNA, RNA, and proteins.

Key words Site-directed mutagenesis, Inverse PCR, Nonoverlapping primers, Protein engineering

1 Introduction

Site-directed mutagenesis (SDM) is a powerful method for making

targeted, predetermined changes in a DNA sequence. It is invalu-
able in molecular biology and protein engineering for investigating
the role of specific nucleotides and amino acids and for engineering
desired properties into protein, DNA, and RNA molecules
[1–7]. The original, relatively inefficient, SDM methods based on
primer extension with single-stranded DNA templates [8–10] have
evolved over the years and have been supplanted by the plethora of
versatile, highly efficient SDM methods available today. Indeed,
currently, a large variety of specific, high-throughput, in vitro
[11, 12], and in vivo [13–15] techniques and manufactured kits

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_18,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

223
224 Diogo Silva et al.

Fig. 1 Illustration of primer design formats for inverse PCR with nonoverlapping (a), partially overlapping (b),
and fully overlapping (c) primers. The hatched sections show the overlapping regions of the primers

(e.g., the GeneArt, EasyChange, Q5, Phusion, and QuikChange

SDM kits) with efficiencies in some cases up to almost 100% for the
site-specific mutation of almost any sequence, are available.
The most commonly used in vitro SDM methods employ PCR
and are based on either overlap extension PCR [12, 16] or inverse
PCR (iPCR) [17, 18] as well as modifications and combinations of
these. Overlap extension PCR is more appropriate for linear
sequences and requires multiple rounds of PCR, whereas iPCR is
designed for circular templates such as vector insert sequences and
uses a simplified protocol necessitating only one PCR. Inverse PCR
was first reported in 1988 for the identification of flanking regions
of a known DNA sequence [17, 18]. Its designation, inverse, comes
from the fact that the primers are oriented in the reverse direction,
facing “outward,” away from each other, in contrast to regular PCR
where “in-facing” flanking primers are employed.
Nonoverlapping, partially overlapping, or fully overlapping
primers can be used for SDM by iPCR. Nonoverlapping, “back-
to-back” primers (Fig. 1a) produce a linear mutated sequence
which must then be recircularized before transformation to E. coli
[19]. Partially overlapping primers (Fig. 1b) yield a product with
short homologous ends which can be directly transformed for
in vivo recombination in E. coli [20–22]. Completely overlapping,
complementary, inverse primers (Fig. 1c) form part of the widely
used QuikChange SDM kit (StrateGene), but the exact mechanism
of action of this has been under discussion. It had initially been
proposed to progress by linear amplification of template to give a
circular product and not by exponential amplification as for a true
PCR [22]. However, another study [23] indicated exponential
amplification of a linear product with short homologous ends for
recombination, as with partially overlapping primers. Use of par-
tially or fully overlapping primers allows for a more simplified SDM
procedure than with nonoverlapping primers, but frequently
 Site-Directed Mutagenesis by iPCR 225

necessitates longer more complex primers and is sometimes char-

acterized by poor or no amplification of PCR product, formation of
primer dimers, and a reduced transformation efficiency [21–23].
In this chapter, we focus on the iPCR method with nonover-
lapping primers for the introduction of a point mutation into a
DNA sequence. This is composed of three principal steps (Fig. 2):
(1) iPCR mutant amplification (including primer design, PCR, and
agarose gel confirmation), (2) template removal and product recir-
cularization (including template digestion, mutant phosphoryla-
tion, and ligation), and (3) transformation and mutant
confirmation (transformation, plasmid construct isolation, and
sequencing). iPCR is relatively easy and rapid to employ, and by
simple modification of primer design, not only single base changes
(point mutations) but also multiple base changes, deletions, and
insertion can be carried out (see Fig. 2). Currently, a variety of
optimized kits based on iPCR with nonoverlapping primers are
available, e.g., the Phusion (Thermo Scientific), Q5 (New England
Biolabs), and KOD-Plus (Toyobo) site-directed mutagenesis kits.
The iPCR protocol presented herein is an update of that pre-
sented in the first edition of this book series [24]. The protocol is
essentially the same, but the modifications included herein enable
for a more streamlined and successful process due in particular to a
more rapid competent cell preparation and improved primer
design.

2 Materials

2.1 iPCR Mutant 1. PCR thermal cycler.

Amplification 2. Thin-walled PCR tubes.
3. Circular, double-stranded, template DNA. Approximately
1 ng/μL stock in autoclaved, ultrapure water is recommended,
but may vary from 0.1 to 10 ng/μL depending on plasmid size,
sequence, and quality (see Note 1).
4. PCR primers (see Note 2). For highest SDM efficiency, HPLC-
or PAGE-purified primers are recommended. Resuspend lyo-
philized primers in 1.2 g/L (10 mM) Tris–HCl (tris
(hydroxymethyl)aminomethane, adjust pH with HCl, pH 7)
to a concentration of 100 μM, and prepare 20 μM working
stock solutions by dilution of aliquots in 1.2 g/L (10 mM)
Tris–HCl, pH 7. All primer solutions should be stored at -20 °
C and repeated freezing and thawing should be avoided.
5. High-fidelity DNA polymerase with proofreading activity (see
Note 3), as supplied, e.g., Phusion High-Fidelity DNA Poly-
merase (2 U/μL). Store at -20 °C.
Fig. 2 Flowchart of the protocol for site-directed mutagenesis by inverse PCR with nonoverlapping primers.
The primer design formats for introduction of a point mutation, multiple mutations, insertions, and deletions
into a double-stranded circular DNA template are shown. Following primer design, the protocol employed for
each type of mutation is identical. CH3, methyl group of methylated DNA; PO42-, phosphate group of
5’phosphorylated DNA
 Site-Directed Mutagenesis by iPCR 227

6. DNA polymerase buffer (as supplied with the polymerase

used), e.g., 5× concentrated Phusion HF buffer (see Note 4).
Store at -20 °C.
7. Deoxyribonucleoside triphosphate (dNTP) mix, a stock solu-
tion of 10 mM is recommended. Store at -20 °C.
8. Autoclaved, ultrapure water (see Note 5).

2.2 Agarose Gel 1. Agarose, molecular biology grade.

Electrophoresis 2. 50× (50 times concentrated) TAE solution (see Note 6):
242 g/L (2 M) Tris base, 60 g/L (1 M) glacial acetic acid,
14.6 g/L (50 mM) EDTA (ethylenediaminetetraacetic acid).
Store at room temperature. Dilute in deionized water to 1×
(i.e., 50-fold dilution) prior to use.
3. 6× loading buffer: 500 g/L glycerol, 58 g/L (0.2 M) EDTA,
0.5 g/L bromophenol blue, pH 8.3. Store at room tempera-
ture. Prepare 50 mL and store at room temperature for a
maximum of 6 months (see Note 7).
4. Nucleic acid staining solution, e.g., Midori Green Advance
(20,000×): 5 μL in 100 mL 1× TAE solution. While being
significantly less mutagenic than the traditionally used ethi-
dium bromide stain, appropriate care should be taken to
avoid direct contact with Midori Green or similar nucleic acid
stains. Store at -20 °C (see Note 8).
5. Molecular weight marker, as supplied. Store at -20 °C (see
Note 9).
6. Gel casting trays and sample combs.
7. Electrophoresis chamber and power supply.
8. Transilluminator. Always use appropriate safety procedures and
wear protective eyewear when using a transilluminator to pre-
vent UV light damage.

2.3 Template 1. Restriction enzyme DpnI (as supplied, typically 10–20 U/μL).
Removal and Product Store at -20 °C (see Note 10).
Recircularization 2. DpnI digestion buffer (as supplied with DpnI, typically 10×).
Store at -20 °C.
3. T4 DNA ligase buffer (as supplied with T4 DNA Ligase, typi-
cally 10×, ensure this contains 5–10 mM ATP and 50–100 mM
DTT) (see Note 11). Store at -20 °C.
4. T4 polynucleotide kinase (as supplied, typically 10 U/μL).
Store at -20 °C (see Note 12).
228 Diogo Silva et al.

5. T4 DNA ligase (as supplied, typically 5 U/μL). Store at

-20 °C (see Note 13).
6. Incubators at 37 °C and 25 °C (or room temperature).

2.4 Preparation of 1. E. coli XL1-Blue cells stored at -70 °C in 15% glycerol (see
Chemically Competent Note 14).
E. coli XL1-Blue 2. Transformation buffer: 3 g/L (10 mM) PIPES, 3.4 g/L
(30 mM) CaCl2, 18.6 g/L (250 mM) KCl, 9.9 g/L
(50 mM) MnCl2·4H2O. Mix all components except MnCl2
and adjust pH to 6.7 with 112 g/L (2 M) KOH. Add MnCl2
and mix, and sterilize solution through a 0.22 μm membrane.
3. 100% dimethyl sulfoxide (DMSO).
4. SOC (Super Optimal broth with Catabolite repression):
20 g/L bacto-tryptone, 5 g/L yeast extract, 0.6 g/L
(10 mM) NaCl, 0.75 g/L (2.5 mM) KCl, 0.95 g/L
(10 mM) MgCl2, 1.2 g/L (10 mM) MgSO4, 3.6 g/L
(20 mM) D-glucose.

2.5 Transformation 1. 100 μL aliquots of chemically competent E. coli XL1-Blue cells

(see Note 14). Store at -70 °C.
2. pUC18 control plasmid (1 pg/μL). Store at -20 °C.
3. Luria-Bertani broth (LB): 10 g/L bacto-tryptone, 5 g/L yeast
extract, 10 g/L NaCl. Adjust pH to 7 with a 200 g/L (5 M)
NaOH solution. Autoclave to sterilize.
4. Ampicillin (see Note 15): 100 mg/mL stock solution in water.
Filter sterilize through a 0.22 μm membrane and store at -20 °
C or at 4 °C for no more than 1 month.
5. LB agar plates containing antibiotic (100 μg/mL ampicillin).
Prepare LB as described above with addition of 18 g/L agar.
Autoclave to sterilize, cool to 50–55 °C, add 1 mL/L of
100 mg/mL ampicillin stock, mix, and aseptically pour to
petri dishes.

2.6 Mutant 1. LB (prepared as described above) + antibiotic (100 μg/mL

Confirmation ampicillin) (see Note 15).
2. 50 mL polypropylene falcon tubes.
3. Plasmid DNA purification kit, as supplied by manufacturer.

3 Methods

The protocol given is for the introduction of a single point muta-

tion with Phusion High-Fidelity DNA Polymerase in a construct
with a total size of 6500 bp and with ampicillin resistance as the
selection marker. Nevertheless, any templates up to ~10 kb in size
 Site-Directed Mutagenesis by iPCR 229

and any rapid, high-fidelity polymerase can be used with appropri-

ate protocol modification according to the manufacturer’s recom-
mendations (namely, modifications in the buffer and polymerase
concentrations, the PCR cycle, and/or the antibiotic used) (see
Note 3). PCR process optimization may be required in some cases.

3.1 iPCR Mutant 1. Primer Design. Inversed primers should anneal to opposite
Amplification strands of the plasmid, be nonoverlapping and aligned back
to back with apposing 5’ends. Ideally, the targeted mismatch
mutation should be located in the middle of the primer with
10–15 perfectly matched nucleotides on either side. Mutations
can be incorporated closer to the 5′ end, but at least ten
complementary nucleotides are required at the 3’end (see
Note 16). Normal considerations for PCR primer design
should be adhered to (see Note 17). Phosphorylation of pri-
mers is not required (see Note 2). For best results, at least
HPLC grade purification of primers is required; for primers
greater than 40 nucleotides in length, PAGE purification is
recommended (see Note 2).
2. PCR Setup (See Note 18). Add the following components in
the order given to a thin-walled PCR tube on ice: 13.4 μL
autoclaved ultrapure water (for a total final reaction volume of
20 μL), 4 μL of 5× concentrated Phusion HF buffer (1X buffer)
(see Note 4), 0.4 μL of 10 mM stock dNTP mix (200 μM of
each dNTP), 0.5 μL of each 20 μM primer stock (0.5 μM of
each primer) (see Note 2), 1 μL of 1 ng/μL plasmid template
stock (1 ng) (see Note 1), and 0.2 μL of 2 U/μL Phusion DNA
polymerase (0.4 U) (see Note 3). Gently mix, briefly centrifuge,
and immediately place in the thermal cycler. A negative control
reaction with all components except the primers, which are
substituted with an equal volume of water, should also be
set up.
3. PCR Cycle (See Note 19): 1 cycle at 98 °C for 2 min, 25 cycles
of denaturation, annealing, and extension at, respectively, 98 °
C for 20 s, the calculated primer annealing temperature for
20 s, and 72 °C for 2 min (~20 s/kb of the template). A final
extension is then carried out at 72 °C for 10 min before cooling
to 4–10 °C. The same conditions are used for the sample and
negative control.
4. Agarose Gel Confirmation. The results of the PCR are verified
by visualizing 5 μL of the sample and negative controls on a 1%
agarose gel using the following protocol. To 1 g of agarose, add
1X TAE buffer to 100 mL and boil until the agarose is
completely dissolved. When cooled to ~50–60 °C, pour into
the casting tray, insert comb, and leave until completely poly-
merized. Remove the comb, place the gel in the electrophoresis
chamber, and add 1× TAE buffer until the gel is covered with
230 Diogo Silva et al.

the solution. To 5 μL of sample and negative control, add 1 μL

of 6× loading buffer, mix, and carefully pipette into agarose gel
wells. Load molecular weight marker (see Note 9) into an
adjacent well. Run the gel at 7–8 V/cm for 45 to 60 min,
carefully remove, and place it in nucleic acid staining solution
for 30 min (see Note 8) before visualizing under a UV transil-
luminator. A strong band should be visible at 6500 bp for the
sample and no band should be observed for the negative con-
trol (see Note 20).

3.2 Template 1. Template Digestion. Add 1 μL of DpnI (10–20 U), 2 μL of 10×

Removal and Product DpnI buffer, and 2 μL of autoclaved, ultrapure water directly to
Recircularization the PCR (15 μL reaction volume remaining). Mix by gently
pipetting up and down, centrifuge briefly, and incubate for 1 h
at 37 °C (see Note 10).
2. Phospho-ligation. To a new Eppendorf tube, add 11 μL of
autoclaved, ultrapure water, 2 μL of 10× T4 DNA ligase buffer
(see Note 11), 5 μL of DpnI-treated PCR product (see Note
21), 1 μL of PNK (10 U/μL) (see Note 12), and 1 μL of T4
DNA ligase (5 U/μL) (see Note 13). Mix by gently pipetting
up and down, centrifuge briefly to spin down, and incubate for
90 min at 25 °C. Store on ice until transformation or store at -
20 °C.

3.3 Transformation 1. Preparation of chemically competent E. coli XL1-Blue cells for

and Mutant transformation (see Note 14).
Confirmation Allow a glycerol stock of E. coli XL1-Blue to thaw on ice,
add 50 μL of this suspension to 40 mL of sterile SOC medium
in a 250 mL Erlenmeyer flask, and incubate at 37 ºC, 200 rpm
until OD600nm = 0.6 (~8 h). Incubate the culture on ice for
10 min, centrifuge at 4 ºC for 10 min at 2500 × g, and decant
the supernatant. Gently resuspend the pellet in 16 mL of
ice-cold transformation buffer by swirling on ice (care should
be taken as cells are susceptible to mechanical disruption), and
incubate on ice for 10 min. Centrifuge at 4 ºC for 10 min at
2500 × g and decant the supernatant. Gently resuspend the
pellet in 8 mL of ice-cold transformation buffer by swirling on
ice. Centrifuge at 4 ºC for 10 min at 2500 × g and decant the
supernatant. Gently resuspend the pellet in 4 mL of ice-cold
transformation buffer by swirling on ice and add 300 μL of
DMSO 100% stock, swirl gently, and place on ice for 30 min.
Dispense 100 μL aliquots in ice-cold 1.5 mL microcentrifuge
tubes and immediately freeze in liquid nitrogen. Store at -70
ºC for up to 1 month.
2. Transformation (see Note 14). Defrost the competent cells on
ice (10 to 20 min), and add 5 μL (see Note 22) of the phospho-
ligation reaction mix (see Subheading 3.2, step 2, phospho-
 Site-Directed Mutagenesis by iPCR 231

ligation). Swirl the tubes gently and incubate on ice for 30 min.
Swirl the tubes gently and heat-shock cells in a water bath at
42 °C for 45 s and immediately transfer to ice for 10 to 15 min.
Add 900 μL of fresh SOC medium and incubate for 1 h at 37 °
C, 1.1 × g. Centrifuge for 1 min at 5000×g, at room tempera-
ture, remove 850 μL of the supernatant, and gently resuspend
the pellet in the remaining solution. Spread-plate the remain-
ing ~150 μL solution on LB + ampicillin agar plates and incu-
bate overnight at 37 °C. A positive transformation control with
1 μL of 1 pg/μL pUC18 plasmid and a negative process control
with 1 μL of the PCR negative control should also be
carried out.
3. Select three transformant colonies and inoculate into 5 mL
LB + ampicillin medium (see Note 15) in a 15 mL Falcon
tube. Incubate at 37 °C, 1.1 × g overnight. No colonies should
be visible for the negative process control. The LB + ampicillin
plate for the positive transformation control should have at
least approximately 50 colonies.
4. Isolate plasmid from cultures with a commercial plasmid puri-
fication kit, and forward for sequencing of the insert in both
directions. > 80% of the sequences should contain the desired
mutation and no other undesired mutation (see Note 23).

4 Notes

1. It is essential that the template used for iPCR is purified,

circular, double-stranded DNA isolated from a dam+ E. coli
strain. The majority of commonly used E. coli strains are dam+,
including E. coli XL1-Blue, DH5α, and JM109. E. coli JM110
and SCS110 are examples of dam- strains and should not be
used. dam+ E. coli strains contain the enzyme Dam methylase
which methylates adenine residues in the sequence GATC. This
methylated sequence is the target for digestion by DpnI and
allows for later removal of template DNA from the
non-methylated in vitro produced iPCR product.
While best results are achieved with small templates, iPCR
of templates up to 10 kb is commonplace, with some reports of
successes with even larger plasmid constructs.
2. We have successfully used desalted primers for SDM but did
encounter an increased number of incomplete product
sequences with missing nucleotides at the ligation site. To
enhance the yield of full-length sequences, HPLC- or PAGE-
purified sequences are recommended. The former augments
the content of full-length primers (≥ 85% are full length), while
the latter, PAGE, is more apt for ensuring the full length (≥
90% are full length) of longer primers (> 40 bp).
232 Diogo Silva et al.

Primers are frequently resuspended in water or Tris buffer

supplemented with EDTA. Non-supplemented Tris buffer is
preferred as the pH of water is often slightly acidic and can lead
to depurination, while EDTA can interfere with downstream
processes by sequestering essential cations. Do not store oligo-
nucleotides in water at 4 °C. Prepare aliquots of 20 μM work-
ing stock, store at – 20 °C, and avoid repeated freezing and
thawing.
Phosphorylation of the iPCR product with polynucleotide
kinase (see Subheading 3.2, step 2, phospho-ligation) elimi-
nates the need for phosphorylated primers. Nevertheless, if
preferred, these may be used and the polynucleotide kinase
treatment omitted by substitution of this enzyme with 1 μL
water during the phospho-ligation step.
3. While the polymerase used here is Phusion High-Fidelity DNA
Polymerase, any high-fidelity DNA polymerase with a high
extension rate and proofreading activity (3′ → 5′ exonuclease
activity) may be used, e.g., Q5 High-Fidelity DNA polymerase,
Pfu Turbo DNA polymerase, KOD DNA polymerase, etc.
Nevertheless, one should be aware of the particular template
size limitations of the polymerase chosen, e.g., KOD DNA
polymerase is recommended for templates ≤6kbp, and Pfu
Turbo and Phusion DNA polymerases are reported to be able
to amplify plasmids up to 15 kb. For best PCR results, use the
hot start variants of these polymerases where incorporation of
automatic hot start technology permits polymerase activity at
high temperatures only. This minimizes nonspecific amplifica-
tion and primer dimer formation at low temperatures during
reaction setup and during the initial PCR cycle and allows for
room temperature reaction setup. Currently commercialized
examples include Platinum SuperFi DNA Polymerase, Phusion
Hot Start High-Fidelity DNA Polymerase, and Q5 Hot Start
High-Fidelity DNA Polymerase. In all cases, modify the proto-
col given in this manuscript according to the manufacturers’
recommendations for the particular polymerase used.
4. Two buffers are provided with Phusion Polymerase, a HF and a
GC buffer. The former is used as the default buffer for high-
fidelity amplification as the error rate with this is lower than
with the latter. However, GC buffer can improve the perfor-
mance with certain difficult or long templates, such as GC-rich
templates or templates with complex secondary structures. For
amplification of GC-rich templates, the use of 3% DMSO with
HF buffer should be initially investigated. The GC buffer
should only be used when the HF buffer gives unsatisfactory
results.
5. Autoclave ultrapure water to ensure sterility and inactivate
residual nucleases (DNase).
 Site-Directed Mutagenesis by iPCR 233

6. The most popular buffers for DNA electrophoresis are TAE

and TBE (1 M Tris base, 1 M boric acid, and 0.02 M EDTA).
Either may be used here and should give similar results.
7. Bromophenol blue is used as a tracking dye and has an approx-
imate position on a 1% agarose gel equivalent to a 370 bp (TAE
buffer) or 220 bp (TBE buffer) fragment. Xylene cyanol FF
(0.03% in 6× loading buffer stock) may also be used and has an
approximate position on a 1% agarose gel equivalent to a
4160 bp (TAE buffer) or 3030 bp (TBE buffer) fragment.
8. We describe a DNA post-staining technique using Midori
Green, in which, following electrophoresis, the agarose gel is
incubated in a TAE-Midori Green solution. Any of a variety of
commercial DNA stains may be used, e.g., GreenSafe Premium
and Xpert Green, which may employ either pre-staining, post-
staining, or direct staining techniques. The post-staining
method is generally more sensitive and can be used for staining
multiple gels. Pre-staining of the gel before casting enables use
of lower quantities of stain, while the “direct sample staining”
method using a dye preloaded with loading buffer is simpler to
use and negates the necessity for a separate loading buffer
solution.
9. Use a molecular weight marker with component DNA of sizes
similar to the expected iPCR product size. We commonly use
the GeneRuler 1 kb DNA Ladder.
10. The restriction enzyme DpnI digests template DNA (from
dam+ strains) at the methylated sequence Gm6ATC, thereby
“enriching for” the non-methylated in vitro amplified iPCR
product. DpnI is active in the majority of commonly used
polymerase reaction buffers (Phusion, Q5, etc.), and therefore
the digestion can be performed directly in the PCR mix with-
out purification of the DNA but with addition of DpnI buffer.
Ten to twenty units of DpnI is recommended. Enzyme volume
should be maintained below 10% of the total volume so as to
avoid an altered specificity (“star activity”) related to high
glycerol concentrations. Note also that recently, an optimized,
three-enzyme mix (DpnI, polynucleotide kinase, and ligase)
has been reported for a more rapid (5-min) enrichment and
phospho-ligation of iPCR products in one step (New England
Biolabs).
11. ATP, DTT, and Mg2+ are essential buffer components for
phospho-ligation. We commonly use T4 DNA ligase buffer
for the double T4 polynucleotide kinase-T4 DNA ligase reac-
tion. Other buffers, such as the T4 polynucleotide kinase
buffer, FastDigest Buffer, or even many of the standard low
salt restriction enzyme buffers supplemented with 1 mM
riboATP, may also be used. Oxidized DTT leads to reduced
enzyme activity, avoid repeated freezing and thawing, and
234 Diogo Silva et al.

avoid using solutions more than 1 year old. Addition of 5%

polyethylene glycol (PEG) may enhance phospho-ligation, but
in this case extended ligation should be avoided.
12. T4 polynucleotide kinase phosphorylates the 5′-hydroxyl ter-
minus of double- and single-stranded DNA and RNA. It is
inhibited by ammonium ions and by high salt and high phos-
phate concentrations; do not use DNA precipitated with
ammonium ions.
13. T4 DNA ligases join the 5′ phosphorylated and 3′ hydroxyl
ends of the linear product to give a recircularized iPCR prod-
uct. It is sensitive to high salt and high EDTA concentrations.
Rapid ligases (Quick Ligase) which are reported to enable
reaction completion in as little as 5 min have recently been
marketed.
14. We commonly use in-house prepared chemically competent
E. coli XL1-Blue as the cloning host. The preparation proce-
dure described here allows for transformation efficiencies of
107–108 cfu/μL which is normally sufficient for our SDM
protocol. In some protocols for the preparation of competent
E. coli XL1-Blue cells, the first step involves the inoculation of
250 mL sterile medium in a 2 L Erlenmeyer flask with a single
colony and incubation at 18 °C, 150 rpm until OD600
nm = 0.6. We have found that our protocol results in similar
and sometimes higher cell competency, in addition to being
much more rapid (~8-h growth as opposed to ~3–4-day
growth).
E. coli XL1-Blue is resistant to tetracycline and hence is not
suited for plasmids with tetracycline resistance markers. Other,
commercial, higher-efficiency cloning hosts and supercompe-
tent cells may also be used for higher numbers of transfor-
mants. In addition, the use of electrocompetent hosts for
transformation by electroporation allows for higher transfor-
mation efficiencies and is especially suited for large plasmids
(~10 kbp and higher). In this latter case, it is essential that the
phospho-ligated circular DNA sample is purified (e.g., with a
commercial DNA purification kit) to remove salts, etc. prior to
electroporation.
15. Ensure that the antibiotic/selection agent used is appropriate
for the selective marker of the plasmid.
16. The description given is for a point mutation, but a similar
primer design strategy may be used for short (1–3 bp) multiple
base pair mutations or insertions, which may be included on
one or both primers (see Fig. 2). Large insertions may be made
by adding the nucleotides to be inserted on the 5′ ends of one,
or both, of the inverse primers (see Fig. 2). Here, the perfectly
 Site-Directed Mutagenesis by iPCR 235

matched portion of the primers should be 24–30 bp in length

and should be used for calculation of the primer melting tem-
perature. For deletions, the inverse primers should be designed
to be perfectly matched to the sequences flanking the fragment
to be deleted (see Fig. 2). All remaining steps of the iPCR SDM
procedure for these different types of mutations are similar to
that described.
17. Normal considerations for PCR primer design should be
adhered to, i.e., forward and reverse primers should have simi-
lar (< 5 °C difference) melting temperatures (see Note 12), a
GC content of 40–60%, 1 or 2 Gs or Cs at the 3’end, and direct
repeats, secondary structures, primer dimers, and mispriming
should be avoided. When designing mutations for introduc-
tion of an amino-acid change, codon usage tables for the
expression host (e.g., the Codon Usage Database at Kazusa)
should be consulted for selection of the codon most favored by
the host and/or that which requires the least number of base
changes. It is recommended to use bioinformatics tools such as
SnapGene, NEBaseChanger, PrimerX, or Benchling, to facili-
tate primer selection and design. In addition, primer quality
should be assessed using programs such as Primer3Plus, Oli-
goAnalyser, Oligo Calc, etc., so as to minimize secondary
structure formation and mispriming (to self and template)
and to optimize primer length, GC content, 3’stability, and
melting temperatures.
18. The optimum reaction conditions vary considerably with the
polymerase and buffer system used; therefore the reaction
conditions recommended by the supplier of the chosen poly-
merase should always be employed. Mainly, this involves altera-
tions in the amount of polymerase and buffer used.
19. The optimum PCR cycle conditions vary with the polymerase
and buffer system used, e.g., the Phusion DNA polymerase
system is characterized by elevated denaturation and annealing
temperatures and high extension rate as compared to the
majority of other polymerases. Therefore, the reaction tem-
peratures and times recommended by the manufacturers of
the chosen polymerase should always be employed.
Usually, high-fidelity polymerases are thermostable at tem-
peratures higher than 98 °C. Therefore, denaturation tempera-
tures from 95 to 98 °C can be used. The shortest denaturation
time should be used so as to avoid template damage. For most
templates a 30-s initial denaturation from 95 to 98 °C is
enough. Some templates, due to higher complexity, may
require up to 3 min or up to 5 min for GC-rich templates
(>70% GC content).
236 Diogo Silva et al.

The most appropriate annealing temperature varies widely

with the polymerase system employed and should be calculated
as recommended by the supplier. Free online calculators for
determination of the annealing temperatures are provided for
the various DNA polymerase systems being currently commer-
cialized, e.g., the Phusion Tm Calculator at Thermo Fisher
Scientific. For primers with calculated annealing temperatures
≥72 °C with Phusion, a two-step thermocycling protocol is
recommended in which the annealing step is eliminated.
The extension time and temperature depend on the exten-
sion rate and optimal temperature of the polymerase utilized,
as well as the amplicon length and complexity. Most com-
monly, 72 °C is used. The extension time employed should
ensure adequate full-length product synthesis, and 15–60 s per
kb is usually sufficient.
We recommend using 25 cycles. A higher number of cycles
(up to 35) may increase product yield but also increases the
probability of secondary, unwanted mutations.
20. If, in addition to a DNA band of the desired size, other non-
specific DNA bands are visible for the sample, then all the
remaining 15 μL of the reaction should be run on a 1% agarose
gel and the desired DNA band size excised and purified with a
commercial gel extraction DNA purification kit. The purified
DNA fragment can then be used directly in the step “Template
Removal and Product Recircularization” (Subheading 3.2).
The absence of any visible bands indicates PCR failure, and
hence typical PCR troubleshooting procedures should be fol-
lowed, e.g., check primer design, reduce the annealing temper-
ature by 3 to 5 °C increments, optimize Mg2+ concentration in
0.5 mM increments, increase denaturation and extension
times, and repeat experiment with various concentrations of
template. In the case of Phusion polymerase, use of both HF
and GC buffers as well as addition of 3% DMSO should first be
investigated (see Note 4). A weak band may be visible for the
negative control if higher template concentrations were used
(≥10 ng), but this should be manyfold weaker than the
sample band.
21. Avoid using large volumes of PCR product as this may interfere
with the subsequent phospho-ligation and transformation. If a
poor PCR yield leads to the need for larger volumes of PCR
product, this should first be purified using a commercially
available DNA purification kit.
Improved phospho-ligation may be attained by use of 5%
PEG. Also, following polynucleotide kinase addition, the sam-
ple may be incubated at 37 °C for 30 min before cooling to
room temperature, adding the T4 DNA ligase, and further
incubating at room temperature for 90 min.
 Site-Directed Mutagenesis by iPCR 237

22. Avoid using phospho-ligation mix volumes that are more than
10% of the competent cell volume as this leads to a reduced
transformation efficiency. Purify phospho-ligation mix by use
of a commercial DNA purification kit if transforming by
electroporation.
23. The insert sequence should contain the desired mutation only.
While it is not feasible to sequence the entire plasmid con-
struct, the use of a high-fidelity polymerase reduces the risk
of secondary mutations in the vector sequence. To ensure the
absence of such mutations, the insert sequence may be
re-cloned into the original non-PCR-amplified vector.

Acknowledgments

The European Regional Development Fund (ERDF) is thanked for

funding in the scope of Programa Operacional Regional do Norte
(NORTE 2020) through the project ATLANTIDA (NORTE-01-
0145-FEDER-000040). The FCT (Fundação para a Ciência e a
Tecnologia) is thanked for funding through the “Contrato-Pro-
grama” UIDB/04050/2020.
All the technical staff at the CBMA are thanked for their skillful
technical assistance.

References
1. Burdick JP, Basi RS, Burns KS, Weers PMM 5. Sanguinetti M, Silva Santos LH, Dourron J,
(1865) The role of C-terminal ionic residues in Alamón C, Idiarte J, Amillis S, Pantano S,
self-association of apolipoprotein A-I. Biochim Ramón A (2022) Substrate recognition prop-
Biophys Acta Biomembr 2023:184098. erties from an intermediate structural state of
https://doi.org/10.1016/j.bbamem.2022. the UreA transporter. Int J Mol Sci 23:16039.
184098 https://doi.org/10.3390/ijms232416039
2. Dahhas MA, Alsenaidy MA (2022) Role of 6. Wang K-D, Dughbaj MA, Nguyen TTV,
site-directed mutagenesis and adjuvants in the Nguyen TQY, Oza S, Valdez K, Anda P,
stability and potency of anthrax protective anti- Waltz J, Sacco MA (2023) Systematic muta-
gen. Saudi Pharm J 30:595–604. https://doi. genesis of Polerovirus protein P0 reveals dis-
org/10.1016/j.jsps.2022.02.011 tinct and overlapping amino acid functions in
3. Wang L, Gu J, Zhao W, Wang M, Ng KR, Nicotiana glutinosa. Virology 578:24–34.
Lyu X, Yang R (2022) Reshaping the binding https://doi.org/10.1016/j.virol.2022.
pocket of cellobiose 2-epimerase for improved 11.005
substrate affinity and isomerization activity for 7. Collins T, De Vos D, Hoyoux A, Savvides SN,
enabling green synthesis of lactulose. J Agric Gerday C, Van Beeumen J, Feller G (2005)
Food Chem 70:15879–15893. https://doi. Study of the active site residues of a glycoside
org/10.1021/acs.jafc.2c06980 hydrolase family 8 xylanase. J Mol Biol 354:
4. Chen K, Zhang M, Gao B, Hasan A, Li J, 425–435. https://doi.org/10.1016/j.jmb.
Bao Y, Fan J, Yu R, Yi Y, Ågren H, Wang Z, 2005.09.064
Liu H, Ye M, Qiao X (2022) Characterization 8. Hutchison CA, Phillips S, Edgell MH,
and protein engineering of glycosyltransferases Gillam S, Jahnke P, Smith M (1978) Mutagen-
for the biosynthesis of diverse hepatoprotective esis at a specific position in a DNA sequence. J
cycloartane-type saponins in Astragalus mem- Biol Chem 253:6551–6560
branaceus. Plant Biotechnol J 21:698. https:// 9. Edgell MH, Hutchison CA 3rd, Sclair M
doi.org/10.1111/pbi.13983 (1972) Specific endonuclease R fragments of
238 Diogo Silva et al.

bacteriophage phiX174 deoxyribonucleic acid. 18. Ochman H, Gerber AS, Hartl DL (1988)
J Virol 9:574–582 Genetic applications of an inverse polymerase
10. Hutchison CA 3rd, Edgell MH (1971) Genetic chain reaction. Genetics 120:621–623
assay for small fragments of bacteriophage phi 19. Hemsley A, Arnheim N, Toney MD,
X174 deoxyribonucleic acid. J Virol 8:181– Cortopassi G, Galas DJ (1989) A simple
189 method for site-directed mutagenesis using
11. Reeves AR (2016) In Vitro Mutagenesis. the polymerase chain reaction. Nucleic Acids
Methods Protocol:1–796 Res 17:6545–6551
12. Ho SN, Hunt HD, Horton RM, Pullen JK, 20. Qi D, Scholthof KB (2008) A one-step
Pease LR (1989) Site-directed mutagenesis by PCR-based method for rapid and efficient
overlap extension using the polymerase chain site-directed fragment deletion, insertion, and
reaction. Gene 77:51–59 substitution mutagenesis. J Virol Methods
13. Das N, Ghosh Dhar D, Dhar P (2022) Editing 149:85–90. https://doi.org/10.1016/j.
the genome of common cereals (rice and jviromet.2008.01.002
wheat): techniques, applications, and industrial 21. Zheng L, Baumann U, Reymond JL (2004) An
aspects. Mol Biol Rep:1–9. https://doi.org/ efficient one-step site-directed and site-
10.1007/S11033-022-07664-Y/TABLES/2 saturation mutagenesis protocol. Nucleic
14. Forner J, Kleinschmidt D, Meyer EH, Acids Res 32:e115. https://doi.org/10.
Fischer A, Morbitzer R, Lahaye T, Schöttler 1093/nar/gnh110
MA, Bock R (2022) Targeted introduction of 22. Liu H, Naismith JH (2008) An efficient
heritable point mutations into the plant mito- one-step site-directed deletion, insertion, sin-
chondrial genome. Nat Plants 8:245–256. gle and multiple-site plasmid mutagenesis pro-
https://doi.org/10.1038/s41477-022- tocol. BMC Biotechnol 8:91. https://doi.org/
01108-y 10.1186/1472-6750-8-91
15. Guo J, Zeng L, Chen H, Ma C, Tu J, Shen J, 23. Xia Y, Chu W, Qi Q, Xun L (2015) New
Wen J, Fu T, Yi B (2022) CRISPR/Cas9- insights into the QuikChange process guide
mediated targeted mutagenesis of BnaCOL9 the use of Phusion DNA polymerase for site-
advances the flowering time of Brassica napus directed mutagenesis. Nucleic Acids Res 43:
L. Int J Mol Sci 23:14944. https://doi.org/ e12. https://doi.org/10.1093/nar/gku1189
10.3390/ijms232314944 24. Silva D, Santos G, Barroca M, Collins T (2017)
16. Higuchi R, Krummel B, Saiki RK (1988) A Inverse PCR for point mutation
general method of in vitro preparation and introduction. In: Domingues L (ed) PCR.
specific mutagenesis of DNA fragments: study Methods and protocols, Springer protocols.
of protein and DNA interactions. Nucleic Methods in molecular biology, 1st edn.
Acids Res 16:7351–7367 Springer New York, New York, pp 87–100.
17. Triglia T, Peterson MG, Kemp DJ (1988) A https://doi.org/10.1007/978-1-4939-
procedure for in vitro amplification of DNA 7060-5_5
segments that lie outside the boundaries of
known sequences. Nucleic Acids Res 16:8186
 Chapter 19

Optimized Design of Degenerate Primers for PCR Based

on DNA or Protein Sequence Comparisons
Maria Jorge Campos, Alejandro Gallardo, and Alberto Quesada

Abstract
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to
detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different
oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the
amplification of a sequence of interest by the introduction of mismatches with the target sequence and
balancing their position toward the primers 5′- or 3′-ends. In this work, we explain in detail examples of
rational design of primers in three different applications, including the use of specific determinants at the
3′-end, to (i) improve PCR efficiency with related sequences for members of a protein family by complete
degeneration at a core box of conserved genetic information at the 3′-end with the reduction of degenera-
tion at the 5′-end, (ii) optimize specificity of allelic discrimination of closely related DNA sequences of
orthologous by 5′-end fully degenerate primers, and (iii) increase the PCR efficiency of primers by targeting
DNA sequences belonging to specific phylogenetic groups, within a large and diverse gene family, allowing
the use of multiplex/degenerate PCR.

Key words PCR, Degenerate primers, 5′-end, 3′-end, PCR specificity, PCR efficiency, Sequence
alignment

1 Introduction

PCR or polymerase chain reaction is a molecular biology technique

first developed by Kary B. Mullis that allows the amplification of a
segment of DNA in theory from as little as a single DNA molecule
[1]. To carry out a PCR and produce double-stranded DNA mole-
cules, the four building blocks of the DNA (the deoxynucleotides
or dNTPs) must be present together with oligonucleotides (also
called mers or primers), a DNA polymerase, and a DNA template
chain. The use of thermoresistant enzymes enables the production
of large amounts of polymers of DNA, flanked by primer
sequences, after repetition of cycles of high and low temperature
that denature the double-stranded DNA chain, and allows the
annealing of the primers to the template DNA and the DNA

Lucı́lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8_19,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

239
240 Maria Jorge Campos et al.

extension [2]. Primers must be complementary to the upper and

lower chains and can be easily designed when the target DNA
sequence is well known. However, sometimes the DNA target
sequence is unknown or presents variability. Usually, when a DNA
sequence is unknown for one organism, its protein sequence might
be deduced from orthologous that belong to the same protein
family, since the conservation of structure-function relationships
relies on amino acid sequence homology [3]. In these cases, it is
possible to infer the DNA target sequence through the reverse
translation of the amino acid sequence to the coding DNA,
although the redundancy of the genetic code imposes a degree of
uncertainty on the DNA sequence. This can be overcome by pro-
ducing sequences of primers, called degenerate, made of a collec-
tion of sequences instead of one single sequence as in specific
primers [4]. The International Union of Pure and Applied Chem-
istry (IUPAC) has established a nomenclature for incompletely
specified bases in nucleic acid sequences [5] (Table 1). Since only
a few sequences within a degenerate oligonucleotide might be
functional for every particular DNA template, strategies to reduce
its complexity are strongly recommended in order to set an optimal
PCR efficiency. Different roles for the 5′- and 3′-ends of primer
molecules can be predicted. Thus, whereas the 5′-end contributes
marginally, a match of the 3′-end is critical for PCR efficiency
during DNA synthesis, since it is where the 3’-OH substrate
needed for DNA polymerase activity is located in a double helix
template [6]. It has been shown that one single mismatch in the last
three nucleotides counting from the 3′-end is acceptable, but a
second impaired position drops efficiency below the detectable
level on agarose gel electrophoresis [7].

2 Materials

2.1 Sequence 1. Text processor, e.g., Microsoft Word, OpenOffice Text Docu-
Manipulation and ment or Pages for Mac.
Primer Design 2. Multiple alignment programs, e.g., http://www.ebi.ac.uk/
Tools/msa/ or https://www.expasy.org/resources/uniprot-
clustalo.
3. Primer design algorithms, e.g., http://www.ncbi.nlm.nih.
gov/tools/primer-blast/, https://www.thermofisher.com/
es/es/home/life-science/oligonucleotides-primers-probes-
genes/custom-dna-oligos/oligo-design-tools/oligoperfect.
html, and https://eurofinsgenomics.eu/en/ecom/tools/pcr-
primer-design/, or commercial informatics program as
OLIGO Primer Analysis Software (Molecular Biology Insight).
 Design of Degenerate Primers 241

Table 1
Genetic code and compressed notation code according to IUPAC [5]

Compressed
Amino acid Codons notation codon Nucleotide Base
A Alanine GCT, GCC, GCA, GCG GCN A Adenine
R Arginine CGT, CGC, CGA, CGG, AGA, AGG CGN, MGR C Cytosine
N Asparagine AAT, AAC AAY G Guanine
D Aspartic acid GAT, GAC GAY T Thymine
C Cysteine TGT, TGC TGY R A or G
Q Glutamine CAA, CAG CAR Y C or T
E Glutamic acid GAA, GAG GAR S G or C
G Glycine GGT, GGC, GGA, GGG GGN W A or T
H Histidine CAT, CAC CAY K G or T
I Isoleucine ATT, ATC, ATA ATH M A or C
L Leucine TTA, TTG, CTT, CTC, CTA, CTG YTR, CTN B C or G or T
K Lysine AAA, AAG AAR D A or G or T
M Methionine ATG H A or C or T
F Phenylalanine TTT, TTC TTY V A or C or G
P Proline CCT, CCC, CCA, CCG CCN N Any base
S Serine TCT, TCC, TCA, TCG, AGT, AGC TCN, AGY
T Threonine ACT, ACC, ACA, ACG ACN
W Tryptophan TGG
Y Tyrosine TAT, TAC TAY
V Valine GTT, GTC, GTA, GTG GTN
Start ATG
Stop TAA, TGA, TAG TAR, TRA

2.2 PCR, Gel 1. 200 μL and 1.5 mL DNase-free plastic microtubes (see
Electrophoresis, and Note 1).
Image Acquisition 2. Thermocycler.
3. Gel electrophoresis system.
4. UV transilluminator or gel acquisition system.

2.3 Reagents 1. DreamTaq Green DNA Polymerase (Thermo Fisher) and

buffer (see Note 2) or GoTaq® Green Master Mix (Promega).
2. dNTPs (see Note 3).
3. Degenerate primers (see Note 4).
242 Maria Jorge Campos et al.

4. Nuclease-free water or autoclaved to sterility ultrapure water

obtained by a water purification system.
5. DNA staining solution, e.g., GreenSafe (NZYTech) or GelRed
(Biotium).
6. Gel electrophoresis agarose.
7. DNA molecular weight marker, e.g., GeneRuler 1 kb Plus
DNA ladder (Thermo Scientific) or 1 kb DNA Ladder
(Promega).
8. Gel electrophoresis buffer TAE (see Note 5).

3 Methods

3.1 Primer Design Fully conserved motifs of 4–6 consecutive amino acids, the core
from Protein Family box, are required to design the oligonucleotide 3′-end with, at
Alignment: Reduction least, 11 nucleotide positions. This is considering that the first
of 5′-End Complexity position, in the reverse primer, or the last position, in the forward
primer, leading to ambiguity, is omitted from the oligonucleotide
sequence to start reducing its complexity. In general terms, a good
principle for designing highly efficient degenerate primers would be
to establish a limit of degeneracy up to 64 (the number of different
sequences within the mixture primer), meaning that the core box
should not contain at all amino acid residues encoded by six codons
(L, R, or S) and very few encoded by three (I) or four codons (A, G,
P, V, or T). In contrast, amino acids encoded by two (C, D, E, F,
H, K, N, T, or Y) or particularly only one codon (M or W) are
strongly recommended (Table 1). The remaining sequence of pri-
mers, typically 7–12 nucleotides toward the 5′-end, is less critical
for DNA synthesis and, thus, is the region where efforts to reduce
degeneration should be focused. An example of core box selection
for primer design is shown in Fig. 1, where relationships between

CepA1 CepA2
Bfra 110…PQGGIEMSIADLLKYTLQQSDNNACDI……92……VTMGHKTGTGDRNAKG…55
Bun1 109…PDQDFTITLRELMQYSISQSDNNACDI……92……TVVGHKTGSSDRNADG…53
Bthe 105…PQGGFNIDIADLLNYTLQQSDNNACDI……92……VTIGHKTGTGDRNAKG…53
Bun2 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGYVNENG…57
Pden 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGDVNENG…57
Coch 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGDVNENG…57
. : : : :*:.*:: ******.:: ..:.****:. * .*

Fig. 1 Protein alignment and core box selection for primer design. Sequences shown are: Bfra, AAA22905.1;
Bun1, AAA66962; Bthe, NP_813418.1; Bun2, AAB17891; Pden, AAM48119.1; Coch, AAL79549.2. Multiple
alignement was performed by Clustal Omega. Bold characters represent strongly conserved positions. Grey
boxes indicate identical residues. Black boxes represent CepA characteristic residues used to design primers
with 3’-end specific determinants for discriminatory PCR. The expected size of cepA fragments amplified by
PCR with cepA1/A2 primers is 329 bp [8]
 Design of Degenerate Primers 243

Table 2
Primer design for detection of cepA orthologous from Bacteroides and
related anaerobic Gram-negative bacteria
Forward Primer
Amino acids S D N N A C D
Coding sequence TCN GAC AAC AAC GCN TGC GAC
AGC T T T T T
T
Abbreviated WSN GAY AAY AAY GCN TGY GAY

CepA1 (x64) AGC GAY AAY AAY GCN TGY GA

Reverse Primer
Amino acids G H K T G T/S G/S
Coding sequence GGN CAC AAA ACN GGN ACN GGN
T G TCN TCN
AGC AGC
T T
Abbreviated GGN CAY AAR ACN GGN WSN BSN

Complementary NSH NSW NCC NGT YTT RTG NCC

CepA2 (x64) GA AGA TCC NGT YTT RTG NCC

the two class A β-lactamases found in Bacteroides and related micro-

organisms, encoded by cepA and cfxA genes, are shown. Two
primers were designed for cepA selective PCR from core boxes
containing 3′-end specificity determinants (Table 2), allowing gen-
otyping of β-lactam-resistant strains of Gram-negative anaerobes
isolated from human and animals [8, 9].
The strategies to reduce primer complexity at the 5′-end
include consideration of the codon usage bias, which is particular
for every organism [10]. So, when the core box is extended toward
the 5′-end of the oligonucleotide, the information contained in the
protein sequence might be reverse translated by using the genetic
code and the particular codon usage bias of the target organism,
reducing to a minimum the degeneration of its DNA sequence.
Another possible approach would be to combine the reverse
translation of core box and the multiple alignment of DNA
sequences encoding homologue sequences. The 5′-end sequence
of primers could be assumed directly from the alignment, consider-
ing the organism codon usage and, further, the particular evolution
of DNA sequences within the gene family. However, when the
genetic variability extends toward the 5′-end of oligonucleotides
and there is no rational way to reduce primer degeneracy to a value
lower than 64 or in extreme circumstances to 128 (very few pub-
lished reports have signaled success by using primer degeneracy
higher than 128), we recommend the design of different primer
sequence variants that might be used separately in different PCR.
This strategy should result better than using inosine phosphate as a
244 Maria Jorge Campos et al.

degenerate base, since although this permissive nucleotide can

base-pair with any nucleotide without increasing sequence com-
plexity [11], in our experience its presence confers low reliability to
PCR primers. The core boxes selected for oligonucleotide design
shown in Fig. 1 constitute an example of managing the 5′-end of
degenerate oligonucleotides to reduce their complexity. Whereas
reverse primer lacks strongly specific 3′-end (only one position is
fully variable among homologous), a fully specific PCR was
expected to be determined by the forward primer (Fig. 1). The
fully degenerated 3′-ends deduced from both core boxes present
the complexity threshold for efficient PCR (64) from 6 amino acid
residues for the forward primer (17 nucleotides) and from 5 resi-
dues for the reverse primer (15 nucleotides), which are nearly 3/4
of a typical 21-base oligonucleotides. Since specificity and efficiency
requirements were fulfilled, the remaining sequences toward the
5′-ends were taken randomly from a DNA sequence alignment (not
shown) to balance the GC content near 50%, which is also
recommended.

3.2 Primer Design In primer design for allelic discrimination, the number of mis-
from DNA Alignment matches at the last positions from the 3′-end of the primer is crucial
(I): Reduction of for annealing and specific elongation by the DNA polymerase,
Specificity by which supports the mismatch amplification mutation assay or
Degeneration of 5′-End MAMA-PCR [7]. The discriminatory capability of this technique
is based on the fact that each particular allele of a polymorphic
position is complementary to the 3′-end of its corresponding pri-
mers, where annealing is further weakened by an additional mis-
match with its target sequences, allowing amplification with one
but not two mismatches. The technique is so sensitive that addi-
tional mispairing of primers produced by genetic variability of
sequences would give rise to false negatives. To solve that, in a
particular case that requires the use of DNA from closely related
species as target sequences, we designed degenerate primers with
allele-specific determinant at their 3′-ends that allow discrimination
of the C-257-T polymorphism of gyrA sequence, responsible for
quinolone resistance of Campylobacter isolates [12]. This primer
design, shown in Fig. 2, was performed by including degeneration
toward the primer 5′-ends, increasing the target recognition to
both major species of thermophilic Campylobacter isolated from
humans, C. jejuni and C. coli, without compromising the allele-
specific amplification of gyrA for both species.

3.3 Primer Design Many protein families are too large and/or diverse to support
from DNA Alignment specific primer design, knowing that the efficiency limit for product
(II): Reduction of detection by agarose gel electrophoresis should be 128–256 primer
Degeneration by sequences in the PCR mix (see Subheading 3.1). This situation has
Sequence Clustering been addressed to detect the occurrence, in enterobacteria, of mcr
genes [13], which are plasmid determinants, conferring colistin
 Design of Degenerate Primers 245

Primer gJC-F GAGATGGYTTAAAGCCTGTTCA

Target sequence 122-GAGATGGTTTAAAGCCTGTTCA
C

Primer sWT-F GGTATCAYCCACATGGMGATTC

Target sequence 236-GTTATCACCCACATGGAGATAT
AG T C C

Primer sMu-R ACCGWCAAATRCTACGRAAYCA-5’

Target sequence 257-TAGCAGTTTATGATGCTTTGGT
CT T C C A

Primer gJC-R TCTATGCCAKCTAAAAYAAGGT-5’

Target sequence 429-AGATACGGTCGATTTTGTTCCA
A A

Fig. 2 gyrA sequence variability in human thermophilic Campylobacter: primer

design for discrimination the C-257-T polymorphism. Primers are shown above
their target sequence, the gyrA gene from C. jejuni. Residues in grey boxes
represent primers degenerate positions (IUPAC code), according to the polymor-
phism of gyrA that exists among described sequences from C. jejuni and C. coli
that is shown below the target sequence. Residues in black boxes are critical for
MAMA-PCR. In the target sequence they represent the allele-specific polymor-
phism whereas in primer sequence indicate the mismatch that weakens the
annealing and enable discriminatory PCR. The expected product sizes, for
multiple PCR with the four primers, are 157 plus 329 bp, for T-257 gyrA linked
to quinolone resistant isolates, or 215 plus 329 bp, for C-257 gyrA of quinolone
sensitive Campylobacter [12]

resistance with origin in chromosomal genes encoding ethanol-

amine phosphotransferases (eptA genes) for lipid A modification
[14]. Ten different mcr genes have been described so far, among
which only mcr-1, mcr-2, mcr-3, mcr-4, mcr-5, mcr-7, and mcr-8
are true mobilizable colistin resistance determinants [15]. Consid-
ering the phylogenetic relationships existing among related mcr
and enterobacterial eptA genes, four sequence clusters and one
singleton could be distinguished (Fig. 3a). Primers were devised
to target PCR amplification of mcr-1 and mcr-2 (cluster 1), mcr-3
and mcr-7 (cluster 2), mcr-4 and mcr-8 (cluster 3), and mcr-5
(singleton) (Table 3), selecting DNA regions that present low
degeneration (inside every group) and more than one mismatch
(outside every group) as efficiency and specificity determinants,
respectively (Fig. 3b).

3.4 Protocol for 1. Gather all the DNA or protein sequences of interest from
Protein or DNA online databases as the National Center for Biotechnology
Sequence Analysis Information (NCBI, http://www.ncbi.nlm.nih.gov/nuccore
for nucleotides or http://www.ncbi.nlm.nih.gov/protein/ for
proteins) in FASTA format (see Note 6).
2. Paste the sequences in a text processor document.
246 Maria Jorge Campos et al.

A B
> ATGATGCAG----------CATAC 13… …GGA--TTA---TCCGACTTGGGGCAAGG 457
> ---ATGACA----------TCACA 10… …CAA--TTA---TCCAACATGGGGCAAAG 451
> ---ATGACA----------CAGCA 10… …GGA--TTA---TCCGACATTGGGTAAGA 451
> ATGCGGTTGTCTGCATTTATCACT 24… …ACG--------AACGGGCTGGAAACAAG 466
> ATGTTCAAG--------------T 9 … …AGACAATAAGCGGGGAGCTTTTAGAATT 459
> ------GTG--------------A 4 … …TCA--TTA---TCAGCCCTTTTTTAAGG 445
> -----------------------A 1 … …TGA—-ATATGAGGAAAAATGGTTCAAAG 445
> ------------------------ -6… …GCG—-CTATCCGGCAAACTGGTACAAGG 439
> -----------------------A 1 … …TCA-—ATATCCTGAAAAATGGTATAAAG 445
> -----------------------A 1 … …TGA—-ATATGCAGACAAATGGTACAAAG 445
> -----------------------A 1 … …CCG-—TTATCCTGAGACATGGATAAAGG 445
> ATGTGGT----------------T 8 … …CAT-—TCGCACCGGAAAATGGTGGTATG 445
> ATGTCGTTATT-----------GC 13… …CCG-—TAAGCCCGCCACACGGTGGCGCG 457
> ATGTTGAAGCG-----------CC 13… …CAA-—ACCCACCACCTCACGCCTGCGCA 457
> ATGTTAAAGCG-----------CT 13… …CCG—-CCCGGCGACGCCGCGCTTACGTA 457

B (cont.)
TGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTA 884… …AACGAATGCCGCGATGTCGGTAT 1106… …AGCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCAT 1398
TGTGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTA 878… …AACGAATGCCGTGATGTCGGTAT 1100… …GAAGCGAACTACGATGTCGCCATGCTCTATGTCAGTGACCAC 1392
TGTGGCACATCGACGGCGTACTCTGTGCCGTGTATGTTCAGTTA 878… …AACGAATGTCGTGATGTCGGTAT 1100… …CAGGCCAACTATGATGTTGCCATGCTCTATGTCAGCGACCAC 1392
TGCGGGACGGATACGGCTACATCCCTTCCCTGCATGTTTTCCCT 887… …GAGCGCTGCCTGGATGAAATTCT 1091… …-TCCGCTCACACGACACGGCGCTGCTGTACGTTTCCGATCAT 1377
TGCGGAACGGCTACCGCAATATCACTACCCTGCATGTTCTCGCG 875… …GGTACATGCTTTGATGAGGTGTT 1088… …TCCGGGATGCGTGACGTTGCTATGATATATCTTTCTGATCAT 1377
TGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACG 863… …CAATATTGTTTTGACCAAGTATT 1067… …CAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCAT 1359
TGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAA 860… …AACACATGCTATGACGAGGTTGT 1064… …GAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCAT 1353
TGCGGCACGGCCACAGCGGTGTCGGTGCCCTGCATGTTCTCCAA 854… …AACACCTGCTATGACGAGGTTGT 1058… …GAAGATAAGTACAACACGGCGTTGATCTACCTCTCTGATCAC 1347
TGCGGTACCGCTACCGCAATATCCGTTCCGTGCATGTTCTCGAA 860… …AAAACGTGCCATGACGAGGTGAT 1064… …AGCGATCAGTACAACACCGTGCTGCTTTATGTGTCCGATCAT 1353
TGTGGCACGGCGACCGCAGTCTCGGTGCCCTGTATGTTCTCGGA 860… …AAAACCTGCTATGACGATGTTAT 1064… …AGCGAACAGTACAACACCGTACTGCTGTATGTGTCCGATCAC 1353
TGTGGCACATCCACAGCCATATCTGTTCCATGCATGTTTTCAGA 860… …AACTCATGTTATGATGAGGTTAT 1067… …AAAGATGAGTATGATACTGTTTTATTATATGTCTCTGACCAT 1356
TGTGGCACGGAAACCGCTGTTTCCGTCCCCTGCATGTTCTCCGG 866… …AAATCCTGTATCGACGACGTTAA 1070… …CAGGCCAACATGAACACGGCGCTCATTTACCTCTCCGATCAC 1359
TGCGGCACGGCAACTGCGGTTTCCGTCCCCTGTATGTTCTCTAA 875… …GGCGAGTGCTACGATGAGGTCCT 1079… …CAGGATAAATTTACCACTAGCCTGGTTTATTTGTCCGACCAC 1368
TGCGGCACAGCAACAGCCGTCTCAGTGCCGTGCATGTTCTCGGA 875… …GGCGAATGCTATGACGAAGTGCT 1079… …CAGGATAAATTTACCACCAGCCTGGTTTATCTTTCTGACCAC 1368
TGCGGTACGGCGACCGCGATCTCCGTTCCCTGCATGTTTTCTGA 875… …GGCGAGTGCTACGATGAGGTGTT 1079… …CAGGATAAATTCACAACCAGCCTGGTCTATCTTTCCGATCAC 1368
** ** ** ** ** ** * ** ** ***** ** ** * * ** * ** **

Fig. 3 Phylogenetic analysis of colistin resistance genes and their multiple alignment of sequences to design
cluster-specific primers. (a) Neighbor joining tree of the mcr-gene family, with multiple sequence alignment
performed by Clustal X 2 and the phylogeny emulated by NJPlot 2.3 (bootstrap values indicated close to the
corresponding nodes). eptA sequences representative of enterobacterial groups presenting acquired colistin
resistance are indicated: E, Enterobacter spp.; K, Klebsiella spp.; E, Escherichia coli; S, Salmonella enterica.
hPET corresponds to a chromosomal gene encoding a hypothetical phosphoethanolamine transferase located
in the chromosome of some enterobacterial strains, which genome have been made available but their colistin
resistance phenotype remains unknown. (b) Selection of primer sequences for cluster-specific mcr genes
from the multiple sequence alignment. For every pair of forward and reverse primer (right and left sequences,
respectively), the same color code shown in the phylogenetic tree is utilized, and variants included in
degeneration are indicated in green (final sequences of primers in Table 3). Sequences shown are: mcr-1,
AP026796.1; mcr-2, LT598652.1; mcr-3, CP053734.1; mcr-4, NG_057470.1; mcr-5, MK731977.1; mcr-6,
NG_055781.1; mcr-7, NG_056413.1; mcr-8, CP049891.1; mcr-9, CP049986.1; mcr-10, LC548754.1; hPET,
CP044315.2; eptA-E, CP073771.1; eptA-K, CP044050.1; eptA-C, CP054230.1; eptA-S, CP049308.1

Table 3
Primer design for specific detection of mobilizable colistin resistance (mcr) determinants from
enterobacteria

Product
Cluster Forward primer Reverse primer (pb)
Cluster 1 (mcr- TGYGGCACATCGACGGCG ATACCGACATCRCGRCATTCG 266
1/-2) TA TT
Cluster 2 (mcr- GTSCCCTGCATGTTC AACGCSGTGTTGTACTTATC 494
3/-7) TCCAA TTC
Cluster 3 (mcr- ACGGCYACSGCRRTRTCWC ATGRTCAGARAGATAYAKCA 534
4/-8) TAC TWGCA
Singleton (mcr-5) GCGGTTGTCTGCATTTA CTTGTTTCCAGCCCGTTCGT 464
TCACT
 Design of Degenerate Primers 247

3. Copy all the sequences and use the algorithm Clustal on online
platforms to align the multiple DNA or protein sequences.
Clustal can be found in the EBI multi Sequence Alignment
(http://www.ebi.ac.uk/Tools/msa/), the Swiss Institute of
Bioinformatics (https://www.expasy.org/resources/uniprot-
clustalo), the Kyoto University Bioinformatics Center
(http://www.genome.jp/tools/clustalw/), or other
platforms.
4. Look for a core box of successive and conserved amino acid
residues in the protein alignment (Fig. 1) or an 18 to 24 con-
served DNA sequence around the target polymorphism (see
Note 7) (Fig. 2). Protein sequences must be reverse translated
to their genetic code (Table 2). This can be done on platforms
as the Sequence Manipulation Suit (http://www.bioinformat
ics.org/sms2/) or BioPHP (http://www.biophp.org/
minitools/protein_to_dna/demo.php). It is possible to obtain
the codon usage of several organisms on online platforms like
the Codon Usage Database (http://www.kazusa.or.jp/
codon/ ) or EMBL-EBI (http://www.ebi.ac.uk/Tools/st/
emboss_backtranseq/).
5. Consider a conserved region that has at the penultimate or
ultimate position of the 3′-end of the possible primer a con-
served position that can be used to distinguish a desirable trait
and design the primer considering degenerate positions
between target sequences, preferably at the primer 5′-ends
(Table 1). An extra and obligated mismatch of the 3′-end
should be included to weak primer annealing and increase
specificity toward allele-specific (Fig. 2).
6. Primer design quality can be assessed by checking the forma-
tion of hairpins and primer dimerization. This information
might be obtained by using the PCR Primer Stats option at
the Sequence Manipulation Suite (https://www.bioinformat
ics.org/sms2/).
7. Once primers are designed, they can be ordered using an online
service from an oligonucleotide synthesis company.

3.5 PCR A successful PCR relies on a number of factors some related to the
quality of the primer design. Primer length should be between
16 and 28 nucleotides, which depending on the GC content should
produce primers melting temperatures (Tm) between 50 and 62 °
C. It is not judicious to have Tm difference, between the two
primers, greater than 5 °C [16], and the annealing temperature
can be empirically determined as being 5 °C lower than the primer
with the lowest Tm. Since for degenerate primers the working
sequence(s) of primers is(are) unknown, a good approach is to set
annealing temperature between 50 and 55 °C, although specific
primers corresponding to one known homologue could be used to
estimate more accurately the PCR conditions.
248 Maria Jorge Campos et al.

Other important aspect in the success of the PCR is the quality

of the genomic DNA that includes the target sequence. Due to
contamination problems, isolated areas in the laboratory should be
dedicated to the DNA extraction process and PCR examination
area, where gels are run, while PCR master mix and all PCR
reagents should be handled in a laminar flow cabinet:
1. Bacterial DNA suitable for PCR can be obtained by the boiling
method (see Note 8) or by using any commercial DNA
extraction kit.
2. Prepare a PCR master mix. For a PCR with a final volume of
20 μL, mix in a 1.5 mL microtube the following (see Note 9):
(a) 1 to 1000 ng of genomic DNA or 1 to 1000 pg of plasmid
DNA (usually 1 to 2 μL of DNA).
(b) 2 μL of Taq polymerase buffer (usually comes 10 × con-
centrated and is used 1× concentrated).
(c) 0.4 μL of dNTPs solution with the concentration of
10 μM.
(d) 1 μL of forward primer solution with the concentration of
10 mM.
(e) 1 μL of reverse primer solution with the concentration of
10 mM.
(f) 0.2 μL Taq polymerase at the concentration of 5 U/μL.
(g) Water up to the volume of 20 μL.
3. Mix gently.
4. Add to each 200 μL PCR microtubes the sample DNA plus the
amount of master mix to obtain a final volume of 20 μL.

3.6 Thermocycling Incubate the 200 μL PCR microtubes containing the DNA and the
master mix in a thermocycler with the following program: initial
denaturation 95 °C for 2 min, 35 cycles of denaturation at 95 °C for
30 s, primer annealing between 50 °C and 60 °C for 1 min, exten-
sion at 72 °C for 1 min, and a final extension at 72 °C for 10 min.
The PCR can be maintained at room temperature indefinitely.

3.7 Gel Analysis 1. Prepare a 0.75 to 1.0% agarose gel (see Note 10).
2. Load 10 μL of each PCR product in each gel well.
3. Connect the power supply to 80 V and wait approximately 1 h
or until the fastest moving band in the PCR buffer is close to
the gels hedge.
4. Observe the gel in the UV transilluminator or gel acquisition
system, and look for the presence of the expected size
amplified band.
 Design of Degenerate Primers 249

4 Notes

1. If tubes are not DNase-free, sterilization at 121 °C for 15 min

is suitable to DNase elimination.
2. DreamTaq Green Buffer allows direct loading of PCR products
in gel wells since it has a density reagent and two tracking dyes.
3. dNTPs are available as mixtures of all the dNTP or as single
solutions of dATP, dCTP, dGTP, and dTTP.
4. Primers can be ordered online from several commercial ser-
vices, e.g., StabVida, Caparica, Portugal (https://www.
stabvida.com); TriLink BioTechnologies, CA, USA (https://
www.trilinkbiotech.com); or Metabion International, Ger-
many (https://www.metabion.com).
5. TAE buffer is commercialized concentrated 50× or can be
prepared with the following composition (1x concentration
composition): 40 mM Tris base, 20 mM acetic acid and
1 mM EDTA, pH 8.3. Should be used x1 concentrated for
gel preparation and in electrophoresis systems.
6. Nucleotide or protein sequences can be used in the FASTA
format. This format is text-based and widely used in bioinfor-
matics with each dNTP being represented with the letters A,
T, C, and G and each amino acid represented by the IUPC
single letter code [5]. Each FASTA file begins with the symbol
“>” followed by a description line which can be used as an
identifier of the sequence. The NCBI FASTA format recom-
mends lines of text to be shorter than 80 characters in length
(http://blast.ncbi.nlm.nih.gov/blastcgihelp.shtml).
7. At the bottom of a DNA sequence alignment, the symbol “*”
indicates a perfect alignment, and a lack of symbol represents a
non-conserved sequence. In protein sequence alignments, two
other symbols are presented. “:” indicates a position with con-
served amino acids with strong similarity, whereas “.” indicates
a position with conserved amino acids with weak similarity.
8. To use the boiling method, bacterial cells should be grown on
solid media. One isolated colony is suspended in 200 μL of
sterile ultrapure water or sterile TE buffer in a microtube. The
tube is heated in a thermo bloc at 100 °C for 10 min. After that
the tube is centrifuged at 10000 × g for 5 min. The supernatant
can be directly used in PCR and can be stored at -20 °C for
further use.
9. Multiply the amounts of each reagent by the number of sam-
ples reaction plus two. This will guarantee enough volume
since handling loss may occur. Make sure to include one nega-
tive control (water instead of DNA) and one positive control
250 Maria Jorge Campos et al.

(a sample known to be positive for the presence of the target

sequence) in your samples. All reagents and tubes should be
kept on ice until placed in the thermocycler to guarantee the
polymerase activity.
10. Bigger amplicons are better resolved in lower concentration of
agarose gels (0.7 to 1%), while smaller amplicons are better
resolved in higher concentrations of agarose gels (1 to 1.5%).

Acknowledgments

This work was funded by national funds through FCT, Fundação

para a Ciência e a Tecnologia, I.P., under the project MARE
(UIDB/04292/2020 and UIDP/04292/2020), the project
LA/P/0069/2020 granted to the Associate Laboratory ARNET
to Maria J Campos, and projects from the Spanish Ministry of
Science and Innovation (Grant PID2020-118405RB-I00) and
the Regional Government of Extremadura, also funded by the
European Regional Development Funds (FEDER, research pro-
jects IB20181 and research group CTS059) to Alberto Quesada
(integrated in INBIOG+C Institute).

Bibliography
1. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn 7. Cha RS, Zarbl H, Keohavong P, Thilly WG
GT, Erlich HA, Arnheim N (1985) Enzymatic (1992) Mismatch amplification mutation assay
amplification of beta-globin genomic (MAMA): application to the c-H-ras gene.
sequences and restriction site analysis for diag- PCR Methods Appl 2(1):14–20
nosis of sickle cell anemia. Science 4732:1350– 8. Garcı́a N, Gutiérrez G, Lorenzo M, Garcı́a JE,
1354 Pı́riz S, Quesada A (2008) Genetic determi-
2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, nants for cfxA expression in Bacteroides strains
Higuchi R, Horn GT, Mullis KB, Erlich HA isolated from human infections. J Antimicrob
(1988) Primer-directed enzymatic amplifica- Chemother 5:942–947
tion of DNA with a thermostable DNA poly- 9. Lorenzo M, Garcı́a N, Ayala JA, Vadillo S,
merase. Science 4839:487–491 Pı́riz S, Quesada A (2012) Antimicrobial resis-
3. Chothia C, Lesk AM (1986) The relation tance determinants among anaerobic bacteria
between the divergence of sequence and struc- isolated from footrot. Vet Microbiol 157(1–2):
ture in proteins. EMBO J 4:823–826 112–118
4. Iserte JA, Stephan BI, Goñi SE, Borio CS, 10. Ikemura T (1985) Codon usage and tRNA
Ghiringhelli PD, Lozano ME (2013) Family- content in unicellular and multicellular organ-
specific degenerate primer design: a tool to isms. Mol Biol Evol 1:13–34
design consensus degenerated oligonucleo- 11. Ben-Dov E, Shapiro OH, Siboni N, Kushmaro
tides. Biotechnol Res Int 2013:383646 A (2006) Advantage of using inosine at the 3′
5. Nomenclature Committee of the International termini of 16S rRNA gene universal primers for
Union of Biochemistry (NC-IUB) (1985) the study of microbial diversity. Appl Environ
Nomenclature for incompletely specified bases Microbiol 11:6902–6906
in nucleic acid sequences. Recommendations. 12. Hormeño L, Palomo G, Ugarte-Ruiz M, Por-
Biochem J 229(2):281–286 rero MC, Borge C, Vadillo S, Pı́riz S,
6. Haras D, Amoros JP (1994) Polymerase chain Domı́nguez L, Campos MJ, Quesada A
reaction, cold probes and clinical diagnosis. (2016) Identification of the main quinolone
Sante 4(1):43–52 resistance determinant in campylobacter jejuni
 Design of Degenerate Primers 251

and campylobacter coli by MAMA-DEG PCR. Emergence of plasmid-mediated colistin resis-

Diagn Microbiol Infect Dis 3:236–23913 tance mechanism MCR-1 in animals and
13. Gallardo A, Iglesias MR, Ugarte-Ruiz M, human beings in China: a microbiological and
Hernández M, Miguela-Villoldo P, molecular biological study. Lancet Infect Dis
Gutiérrez G, Rodrı́guez-Lázaro D, 16(2):161–168
Domı́nguez L, Quesada A (2021) The 15. Khedher MB, Baron SA, Riziki T, Ruimy R,
plasmid-mediated Kluyvera-like arnBCAD- Raoult D, Diene SM, Rolain JM (2020) Mas-
TEF operon confers Colistin (hetero) resis- sive analysis of 64,628 bacterial genomes to
tance to Escherichia coli. Antimicrob Agents decipher water reservoir and origin of mobile
Chemother 65(5):e00091–e00021 colistin resistance genes: is there another role
14. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, for these enzymes? Sci Rep 10(1):5970
Spencer J, Doi Y, Tian G, Dong B, Huang X, 16. Chuang LY, Cheng YH, Yang CH (2013) Spe-
Yu LF, Gu D, Ren H, Chen X, Lv L, He D, cific primer design for the polymerase chain
Zhou H, Liang Z, Liu JH, Shen J (2016) reaction. Biotechnol Lett 10:1541–1549
 INDEX

A DNA polymerase ....................................6, 45, 46, 49, 88,

92, 93, 160, 161, 163, 175, 181, 182, 186, 188,
Adeno-associated virus (AAV).................... 161, 164, 170 197, 200, 203, 206, 212, 213, 215, 225, 227–
Agarose gel electrophoresis .................88, 119, 153, 155, 229, 232, 235, 236, 239–241, 243
162, 163, 167, 168, 175, 183, 186, 196, 227,
DNase treatment .................................................. 135–137
240, 243
Allergen-encoding genes ................................... 86, 88, 96 E
B Emulsion PCR-DGGE ...................................... 32, 35–37
Escherichia coli ........................................ 63–72, 117, 118,
Bacterial biofilms .................................106, 110, 133–147
124, 125, 151, 196, 198, 201, 204, 210, 211,
Bacterial populations............................................ 105–114 213–216, 224, 228, 230, 231, 234
Exogenous control..............................107, 111, 112, 114
C
Expression plasmids ............................................ 194, 198,
Calibration curves .............................................18, 87, 96, 201, 204–206, 211
97, 102, 106, 107, 109–111, 119–125, 127,
128, 156 F
Cashew nut ...............................87, 90, 91, 93, 95–97, 99 Fluorescence .........................................10, 11, 15, 24, 42,
Chloroplast DNA (cpDNA) ........................................... 26 45, 48, 56, 58, 60, 68, 83, 94, 96, 101, 105–107,
Chocolate ........................................................... 75–78, 86
113, 114, 136, 139, 154
Cloning ................................................. 79, 124, 193–206, Food adulteration ................................................ 173–179
210, 215, 234 Food allergen detection.................................................. 86
Cocoa authentication................................................75–83
Food allergy..................................................................... 85
Colony PCR .................................................204, 209–219 Food authentication........................................................ 76
Complementary DNA synthesis......................... 133–137, Food quality .................................................................. 173
140, 141, 146 Food safety ........................................................... 159, 173
COVID-19 pandemic ....................................................... 2
Free energy (ΔG) .........................................164–166, 170
Fungi detection ..................................................................v
D
Fusion genes......................................................... 193–206
Dairy authentication ..................................................... 173
Degenerate PCR ................................................................v G
Degenerate primers
Gene expression quantification ..........133, 134, 137, 144
3’-end......................................................................... 99 Gene family.................................................................... 243
5’-end......................................................................... 99 Genotyping.............................41, 42, 45–47, 49, 51, 243
Detection .............................................. 18, 27, 28, 41–51,
63–72, 76, 78, 81, 82, 85–101, 118, 125, 128, H
136, 137, 147, 154, 156, 164, 165
Detection of foodborne pathogens .........................41–51 Herbal products authentication ...............................17–29
Digital PCR (dPCR).........................1–11, 13, 14, 17–29 High-resolution melting (HRM)
Disruptor .................................... 135, 137, 144, 159–170 post-melt....................................................... 42, 48, 50
DNA extraction.......................................... 19, 21, 25, 26, pre-melt ........................................................ 42, 48, 50
33, 34, 59, 65, 70, 76, 77, 81, 82, 88, 90, 91, 98, protocol ..................................................................... 44
105, 106, 111, 112, 175, 178, 179, 209, 214, 248 saturating dye ............................................................ 41

Lucilia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967,
https://doi.org/10.1007/978-1-0716-3358-8,
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer
Nature 2023

253
 PCR: METHODS AND PROTOCOLS
254 Index
I Q
Internal amplification control (IAC) ..........45, 64, 66–72 Quantification .................................................2, 5, 11, 19,
Intramolecular secondary structure ................... 160–162, 21, 26–28, 57, 62, 66, 86, 87, 89, 92, 96, 101,
164, 165, 169, 170 105–114, 118, 121–123, 128, 133–147,
Inverse PCR (iPCR) ............................................ 223–237 151–157, 197
Inverted terminal repeat (ITR) ...................................161, Quantitative PCR (qPCR).........................................2, 18,
162, 164, 170 28, 29, 53–66, 68–72, 105–114, 118–121, 123,
126, 127, 133–147, 151–157, 167, 168
L
R
Lactococcus lactis................................................... 151–157
Long amplicons............................................................. 190 Reaction efficiency ..............................106, 109, 113, 147
Long-range PCR.................................................. 181–191 Real-time PCR ..................................................18, 41, 42,
44–49, 54, 63–72, 75–83, 86–91, 94–96, 98, 100,
M 101, 118, 120, 121, 123, 124, 126, 129
Megaprimers...............................194, 196, 200, 201, 205 Real-time qPCR ..................................151–157, 163, 168
Melting .................................... 26, 32, 34, 41–51, 53–62, Recombination efficiency..................................... 117–129
Restriction enzymes ..........................................20, 22, 23,
99, 111, 119, 121, 123, 126, 127, 147, 154, 156,
157, 183, 185, 189, 194, 195, 205, 216, 235, 247 27, 129, 195, 198, 203, 204, 227, 233
Microbial diversity studies .............................................. 32 RNA isolation.........................5, 133, 135–137, 144, 145
RNA quality......................................... 133–135, 137–140
Milk adulteration.................................................. 173–179
Minicircles (MCs) ................................................ 117–129
S
Mitochondrial D-loop DNA ............................... 173–179
Mixed bacterial cultures................................................ 106 Saccharomyces cerevisiae.............. 198, 210, 212, 214–218
Multiplex real-time PCR ..........................................63–72 Sample collection ................................3–5, 133, 135, 136
SARS-CoV-2 ............................................................... 1–11
N Sequence alignment ..................................... 94, 100, 177,
Nonoverlapping primers ...................................... 224–226 244, 247, 249
Nuclear DNA .................................................................. 76 Shiga toxin-producing Escherichia coli
(STEC).................................................... 63–67, 70
P Single nucleotide polymorphism (SNP) ................ 42, 43,
46, 48, 50, 51, 164
ParA resolvase....................................................... 124, 125 Site-directed mutagenesis (SDM) ............. 124, 165, 194,
PCR additives ............................................................44, 46 223–237
PCR efficiency ............................................ 62, 86, 87, 96, Species differentiation .......................................v, 173–179
101, 127, 178, 205, 210, 240 Species-specific PCR assay .............................................. 17
PCR enhancers ...........................182, 183, 188, 212, 213
PCR specificity .............................................................. 213 T
Pentaplex qPCR assay ...............................................64, 66
Theobroma cacao........................................................75, 76
Plasmid copy number determination..........151–153, 155
Polyacrylamide gel ....................................................33–35 Thermal cycling.......................................... 2, 4, 9–10, 22,
Polymerase chain reaction (PCR) .............................2, 17, 28, 29, 164, 185, 186, 189, 212
Third-generation PCR.................................................... 18
31, 41, 63, 76, 118, 159, 173, 181, 193, 209,
224, 239
W
Primer design .......................................44, 48, 88, 98, 99,
119, 127, 152, 153, 156, 169, 183–185, 189, Wastewater based epidemiology (WBE) ...................... 1, 2
194, 198–201, 204, 224–226, 229, 234–236,
240, 242–247 Y
Proofreading enzyme .................................................... 182
Yeast ..................................... 70, 194, 198, 209–219, 228
Protein engineering ............................................. 194, 223