PHP TH4 Cuf
PHP TH4 Cuf
R5
IGUDR
Corporate Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 | Ph.: 011-47623456
NEET (UG)-2024
Important Instructions :
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple-choice questions (four
options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology). 50 questions
in each subject are divided into two Sections (A and B) as per details given below:
(a) Section-A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos-1 to 35, 51 to 85, 101 to
135 and 151 to 185). All Questions are compulsory.
(b) Section-B shall consist of 15 (Fifteen) questions in each subject (Question Nos- 36 to 50, 86 to 100, 136 to
150 and 186 to 200). In Section B, a candidate needs to attempt any 10 (Ten) questions out of 15 (Fifteen)
in each subject.
Candidates are advised to read all 15 questions in each subject of Section B before they start attempting the
question paper. In the event of a candidate attempting more than ten questions, the first ten questions answered
by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect
response, one mark will be deducted from the total scores. The maximum marks are 720.
3. Use Blue / Black Ball Point Pen only for writing particulars on this page / marking responses on Answer Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must hand over the Answer Sheet (ORIGINAL and OFFICE copy) to
the Invigilator before leaving the Room / Hall. The candidates are allowed to take away this Test Booklet with
them.
6. The CODE for this Booklet is R5. Make sure that the CODE printed on the Original Copy of the Answer
Sheet is the same as that on this Test Booklet. In case of discrepancy, the candidate should immediately report
the matter to the Invigilator for replacement of both the Test Booklet and the Answer sheet.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the Answer
Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test Booklet/Answer Sheet.
8. Use of white fluid for correction is NOT permissible on the Answer Sheet.
9. Each candidate must show on-demand his/her Admission Card to the Invigilator.
10. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her seat.
11. Use of Electronic/Manual Calculator is prohibited.
12. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in the
Examination Room / Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
13. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
14. The candidates will write the Correct Test Booklet Code as given in the Test Booklet / Answer Sheet in the
Attendance Sheet.
-1-
NEET (UG)-2024 (Code-R5)
PHYSICS
SECTION-A
1. Consider the following statements A and B and identify the correct answer:
A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measured in (A), is due to majority charge carriers.
(1) A is incorrect but B is correct (2) Both A and B are correct
(3) Both A and B are incorrect (4) A is correct but B is incorrect
Answer (4)
Sol. A: Solar cell characteristics
B: In reverse biased pn junction diode, the current measured in (A), is due to minority charge carrier.
2. A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in figure. It
travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the
prism is:
5 3
(1) (2)
2 4
3 5
(3) (4)
2 4
Answer (1)
Sol. A = 90°
In prism, r1 + c = A
r1 = 90° – c (1)
1 −1
2
sinc = cosc =
-2-
NEET (UG)-2024 (Code-R5)
Apply Snell's law, on incidence surface
1
1·sin30° = sin(r1) 1 = sin(90 − c )
2
1 2 − 1
=
2
1
On squaring = 2 − 1
4
5 5
2 = =
4 2
3. A particle moving with uniform speed in a circular path maintains:
(1) Constant acceleration (2) Constant velocity but varying acceleration
(3) Varying velocity and varying acceleration (4) Constant velocity
Answer (3)
Sol. A particle moving with uniform speed in a circular path maintains varying velocity and varying
acceleration. It is because direction of both velocity as well as acceleration will change continuously.
4. NP 1
In an ideal transformer, the turns ratio is = . The ratio VS : VP is equal to (the symbols carry their usual
NS 2
meaning) :
(1) 2 : 1 (2) 1:1
(3) 1 : 4 (4) 1:2
Answer (1)
Sol. According to transformer ratio,
VS NS
= = 2 :1
VP NP
5. At any instant of time t, the displacement of any particle is given by 2t – 1 (SI unit) under the influence of force
of 5 N. The value of instantaneous power is (in SI unit):
(1) 5 (2) 7
(3) 6 (4) 10
Answer (4)
Sol. x = 2t – 1
dx
v= = 2 m s−1
dt
P = F. v
= 2 × 5 = 10 W
6. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is
2400 g cm2. The length of the 400 g rod is nearly:
(1) 17.5 cm (2) 20.7 cm
(3) 72.0 cm (4) 8.5 cm
Answer (4)
m 2
Sol. Moment of inertia of rod = I =
12
2
2400 = 400
12
72 = 2
= 72 = 8.48 cm 8.5 cm
-3-
NEET (UG)-2024 (Code-R5)
7. Match List I with List II.
List I List II
(Spectral Lines of (Wavelengths (nm))
Hydrogen for
transitions from)
A. n2 = 3 to n1 = 2 I. 410.2
B. n2 = 4 to n1 = 2 II. 434.1
C. n2 = 5 to n1 = 2 III. 656.3
D. n2 = 6 to n1 = 2 IV. 486.1
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-II, D-I (2) A-IV, B-III, C-I, D-II
(3) A-I, B-II, C-III, D-IV (4) A-II, B-I, C-IV, D-III
Answer (1)
hc
Sol. Energy difference E =
1
E
( E )6−2 ( E )5−2 ( E )4−2 ( E )3−2
Sol.
T = m 2
T = m (2)2
T = 4T
9. An unpolarised light beam strikes a glass surface at Brewster's angle. Then
(1) The refracted light will be completely polarised.
(2) Both the reflected and refracted light will be completely polarised.
(3) The reflected light will be completely polarised but the refracted light will be partially polarised.
(4) The reflected light will be partially polarised.
Answer (3)
-4-
NEET (UG)-2024 (Code-R5)
Sol.
According to Brewster's law, reflected rays are completely polarized and refracted rays are partially
polarized.
10. The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 , when connected through
an external resistance of 4 as shown in the figure is:
(1) 6V (2) 8V
(3) 10 V (4) 4V
Answer (2)
Sol.
10
Current in circuit i = = 2A
4 +1
Terminal voltage = E – iR
= 10 – 2 × 1 = 8 V
11. The output (Y) of the given logic gate is similar to the output of an/a
-5-
NEET (UG)-2024 (Code-R5)
Sol.
Y1 = A A
=A
Y2 = B + B
=B
Y = Y1 + Y2
=A+B
= AB
= A.B is similar to output of AND Gate
12. In the following circuit, the equivalent capacitance between terminal A and terminal B is :
CAB = 1 + 1
= 2 F
13. 290 e+ − e−
82 X ⎯⎯→Y ⎯⎯⎯
→ Z ⎯⎯⎯
→ P ⎯⎯⎯
→Q
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are
(1) 286, 80 (2) 288, 82
(3) 286, 81 (4) 280, 81
Answer (3)
290 286 e+ − e−
Sol. 82 X ⎯⎯→ 80 Y ⎯⎯⎯ → 286
79 Z ⎯⎯⎯ → 286
80 P ⎯⎯⎯ → 286
81Q
A → 286
Z = 81
-6-
NEET (UG)-2024 (Code-R5)
14. The quantities which have the same dimensions as those of solid angle are:
(1) stress and angle (2) strain and arc
(3) angular speed and stress (4) strain and angle
Answer (4)
dA
Sol. Solid angle d = has dimensions [M0L0T0]
r2
l
Strain = has dimensions [M0L0T0]
l
Angle measured in radians is also dimensionless [M0L0T0]
l
=
r
15. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is in the
direction shown, which one of the following options is correct (P and Q are any highest and lowest points on
the wheel, respectively)?
(1) Point P moves faster than point Q (2) Both the points P and Q move with equal speed
(3) Point P has zero speed (4) Point P moves slower than point Q
Answer (1)
The topmost point will have velocity 2v while point Q i.e. lowest point will have zero velocity.
Hence point P moves faster than point Q.
16. A wire of length ‘l’ and resistance 100 is divided into 10 equal parts. The first 5 parts are connected in series
while the next 5 parts are connected in parallel. The two combinations are again connected in series. The
resistance of this final combination is:
(1) 52 (2) 55
(3) 60 (4) 26
Answer (1)
-7-
NEET (UG)-2024 (Code-R5)
Sol.
-8-
NEET (UG)-2024 (Code-R5)
Sol. The magnitude of magnetic field due to circular coil of N turns is given by
0 iN
BC =
2R
4 10−7 7 100
=
2 0.1
= 4.4 × 10–3 T
= 4.4 mT
20. In a vernier callipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD
represents 0.1 mm, the vernier constant (in cm) is:
1
(1) (2) 100N
100(N + 1)
1
(3) 10(N + 1) (4)
10N
Answer (1)
Sol. V.C = MSD – VSD ...(1)
given : (N + 1) VSD = N MSD
N
VSD = MSD ...(2)
N + 1
From (1) and (2)
N
V .C = (MSD ) − (MSD)
N +1
N MSD
= MSD 1 − =
N + 1 N + 1
0.01 1
= =
N + 1 100(N + 1)
21. A logic circuit provides the output Y as per the following truth table :
A B Y
0 0 1
0 1 0
1 0 1
1 1 0
The expression for the output Y is :
(1) A.B + A (2) B
(3) B (4) A.B + A
Answer (2)
A B Y
0 0 1
Sol. 0 1 0
1 0 1
1 1 0
-9-
NEET (UG)-2024 (Code-R5)
22. If c is the velocity of light in free space, the correct statements about photon among the following are:
A. The energy of a photon is E = h.
B. The velocity of a photon is c.
h
C. The momentum of a photon, p = .
c
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses positive charge.
Choose the correct answer from the options given below:
(1) A, B, C and D only (2) A, C and D only
(3) A, B, D and E only (4) A and B only
Answer (1)
Sol. (A) If c is the velocity of light
so, E = h (Energy of photon)
(B) Velocity of photon is equal to velocity of light i.e. c.
h
(C) =
p
h
p=
h
p=
c
(D) In photon-electron collision both total energy and total momentum are conserved.
23. A thin spherical shell is charged by some source. The potential difference between the two points C and P
(in V) shown in the figure is:
1
(Take = 9 109 SI units)
40
- 10 -
NEET (UG)-2024 (Code-R5)
24.
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of
induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:
Sol.
North of magnet is moving away from solenoid 1 so end B of solenoid 1 is South and as south of magnet is
approaching solenoid 2 so end C of solenoid 2 is South.
25. 1
The graph which shows the variation of and its kinetic energy, E is (where is de Broglie wavelength
2
of a free particle):
(1) (2)
(3) (4)
Answer (3)
h h h 1 2
Sol. de-Broglie wavelength = = = where E = mv
P mv 2 mE 2
h2
2 =
4m 2 E
1
= (constant) E
2
Graph passes through origin with constant slope.
- 11 -
NEET (UG)-2024 (Code-R5)
26. In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as
shown. The moment of inertia of the needle is 9.8 x 10 –6 kg m2. If the magnitude of magnetic moment of the
needle is x × 10–5 Am2, then the value of ‘x’ is :
1 9.8 10−6
= 2
4 M 0.049
1 9.8 10−6
= 4 2
16 M 49 10−3
42 9.8 10 −6
M= 16
49 10 −3
42 9.8 16 10−3
=
49
= 12.82 × 10–3 × 10–2 × 102
= 12802 × 10–5 Am2
27. Match List-I with List-II.
List-I List-II
(Material) (Susceptibility ())
A. Diamagnetic I. =0
B. Ferromagnetic II. 0 –1
C. Paramagnetic III. 1
D. Non-magnetic IV. 0 (a small positive number)
Choose the correct answer from the options given below
(1) A-II, B-I, C-III, D-IV (2) A-III, B-II, C-I, D-IV
(3) A-IV, B-III, C-II, D-I (4) A-II, B-III, C-IV, D-I
Answer (4)
Sol.
(Material) (Susceptibility ())
Diamagnetic (II) 0 –1
Ferromagnetic (III) 1
- 12 -
NEET (UG)-2024 (Code-R5)
28.
If x = 5 sin t + m represents the motion of a particle executing simple harmonic motion, the amplitude
3
and time period of motion, respectively, are
(1) 5 m, 2 s (2) 5 cm, 1 s
(3) 5 m, 1 s (4) 5 cm, 2 s
Answer (1)
Sol. x = 5 sin t + m
3
Amplitude = 5 m
2
==
T
2
T = =2s
29. Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below.
(1) Both Statement I and Statement II are incorrect (2) Statement I is correct but Statement II is incorrect
(3) Statement I is incorrect but Statement II is correct (4) Both Statement I and Statement II are correct
Answer (2)
Sol. Statement I is true as atoms are electrically neutral because they contain equal number of positive and
negative charges.
Statement II is wrong as atom of most of the elements are stable and emit characteristic spectrum. But
this statement is not true for every atom.
30. If the monochromatic source in Young’s double slit experiment is replaced by white light, then
(1) There will be a central dark fringe surrounded by a few coloured fringes
(2) There will be a central bright white fringe surrounded by a few coloured fringes
(3) All bright fringes will be of equal width
(4) Interference pattern will disappear
Answer (2)
Sol. At central point on screen, path difference is zero for all wavelength. So, central bright fringe is white and
D
other fringes depend on wavelength as = .
d
Therefore, other fringes will be coloured.
31. A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and
3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :
(1) 4N (2) 6N
(3) 10 N (4) Zero
Answer (2)
Sol. F = (M1 + M2)a
10
a= = 2 ms–2
2+3
F = M2(2) = 3 × 2 N = 6 N
- 13 -
NEET (UG)-2024 (Code-R5)
32. Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves
with velocity v1 while body B is at rest before collision. The velocity of the system after collision is v2. The ratio
v1 : v2 is
(1) 2:1 (2) 4:1
(3) 1:4 (4) 1:2
Answer (1)
33. A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:
- 14 -
NEET (UG)-2024 (Code-R5)
35. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole
moment vector P of magnitude, 4 × 10–6 C m, is ± 9 × 103 V.
1
(Take = 9 × 109 SI units)
4 0
2P
Reason R: V = , where r is the distance of any axial point, situated at 2 m from the centre of the
4 0 r 2
dipole.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both A and R are true and R is NOT the correct explanation of A.
(2) A is true but R is false.
(3) A is false but R is true.
(4) Both A and R are true and R is the correct explanation of A.
Answer (2)
KP cos
Sol. The potential V at any point, at distance r from centre of dipole =
r2
KP 9 109 4 10−6
At axial point where = 0°, V = = = 9 103 V
r2 22
−KP
At axial point where = 180°, V = 2
= − 9 103 V
r
SECTION-B
36. A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The
magnifying power of telescope for viewing a distant object is:
(1) 28 (2) 17
(3) 32 (4) 34
Answer (1)
Sol. f0 = 140 cm and fe = 5 cm
For distant object,
f 140
m= 0 = = 28
fe 5
37. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius
R in a circular orbit at an altitude of 2R from the surface of the earth is:
2GmM GmM
(1) (2)
3R 2R
GmM 5GmM
(3) (4)
3R 6R
Answer (4)
Sol. Apply energy conservation,
Ui + Ki = Uf + Kf
GMm GMm 1
− + Ki = − + mv 2
R 3R 2
GMm GMm 1 GM
− + Ki = − + m
R 3R 2 3R
1 GMm GMm
Ki = − +
6 R R
5 GMm
Ki =
6 R
- 15 -
NEET (UG)-2024 (Code-R5)
38. Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in
series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
V2
Sol. Power Consumed = P =
R
PA RB
=
PB RA
RA = 2RB
For Series Combination
V2
PS =
3RB
3V 2
PP =
2RB
PS 2
=
PP 9
39. A 10 F capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is
nearly ( = 3.14):
1000
=
3.14
Vrms = 210 V
Vrms 210
irms = =
XC XC
210
Peak current = 2irms = 2 3.14 = 0.932
1000
0.93 A
- 16 -
NEET (UG)-2024 (Code-R5)
40. Choose the correct circuit which can achieve the bridge balance.
(1) (2)
(3) (4)
Answer (4)
Sol. In option (4),
10 10
=
15 5 + RD
The diode can conduct and have resistance RD = 10 because diode have dynamic resistance. In that case
bridge will be balanced.
41. If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then
A. the charge stored in it, increases.
B. the energy stored in it, decreases.
C. its capacitance increases.
D. the ratio of charge to its potential remains the same.
E. the product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
(1) A, C and E only (2) B, D and E only
(3) A, B and C only (4) A, B and E only
Answer (1)
Sol. Given V = V = Constant
A A
(i) C = 0 , C = 0
d d
d < d
C > C
Hence, final capacitance greater than initial capacitance,
1
(ii) U = C V 2
2
1
U= CV 2
2
U > U
Hence final energy is greater than initial energy
Q Q
(iii) = C and = C
V V
Q Q
V V
- 17 -
NEET (UG)-2024 (Code-R5)
(iv) Product of charge and voltage
X = QV = CV2
X = QV = CV2
X > X
42. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the
circuit, then in the gap between the plates:
Sol.
B. dl = 0 (IC + ID )
For Loop L1 IC 0 and ID = 0
For Loop L2 IC = 0 and ID 0
Due to KCL IC = ID
43. The property which is not of an electromagnetic wave travelling in free space is that:
(1) The energy density in electric field is equal to energy density in magnetic field
1
(2) They travel with a speed equal to
0 0
44. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half
x
its original length, then the new time period of oscillation is times its original time period. Then the value of
2
x is:
(1) 2 (2) 2 3
(3) 4 (4) 3
Answer (1)
- 18 -
NEET (UG)-2024 (Code-R5)
Sol. T = 2 where =
g 2
T = 2
g
x
T = T
2
x
2 = 2
2g 2 g
1 x
= x= 2
2 2
45. A force defined by F = t2 + t acts on a particle at a given time t. The factor which is dimensionless, if and
are constants, is:
(3)
(4)
t
t
Answer (1)
Sol. From principle of homogeneity
[F] = [t2] = [t]
[F ] [F ]
[] = and [] =
2 [t ]
[t ]
[] [t] = []
t
= dimensionless
46. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. hold the sheet there if it is magnetic.
B. hold the sheet there if it is non-magnetic.
C. move the sheet away from the pole with uniform velocity if it is conducting.
D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
- 19 -
NEET (UG)-2024 (Code-R5)
47. A metallic bar of Young’s modulus, 0.5 × 10 11 N m–2 and coefficient of linear thermal expansion 10–5 °C–1,
length 1 m and area of cross-section 10–3 m2 is heated from 0°C to 100°C without expansion or bending. The
compressive force developed in it is :
10
= 5 104
10
= 50 × 103 N
48. An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms
make an angle 60° with each other. The magnetic moment of this new magnet is :
M
(1) (2) 2M
2
M
(3) (4) M
3
Answer (1)
Sol.
M = ml.
l
l = 2 sin30
2
l
=
2
M = ml/2
= M/2
- 20 -
NEET (UG)-2024 (Code-R5)
49. The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume)
at three pressures P1, P2 and P3 compared with those of Charles’s law represented as dotted lines.
The acceleration (a) – time (t) graph that best suits this motion is :
(1) (2)
(3) (4)
Answer (2)
Sol. Initially, the body has zero velocity and zero slope. Hence the acceleration would be zero initially. After
that, the slope of v-t curve is constant and positive.
After some time, velocity becomes constant and acceleration is zero.
After that, the slope of v-t curve is constant and negative.
- 21 -
NEET (UG)-2024 (Code-R5)
CHEMISTRY
SECTION-A
51. Match List I with List II.
List-I List-II
(Process) (Conditions)
A. Isothermal process I. No heat exchange
B. Isochoric process II. Carried out at constant temperature
C. Isobaric process III. Carried out at constant volume
D. Adiabatic process IV. Carried out at constant pressure
Choose the correct answer from the options given below:
(1) A-IV, B-II, C-III, D-I (2) A-I, B-II, C-III, D-IV
(3) A-II, B-III, C-IV, D-I (4) A-IV, B-III, C-II, D-I
Answer (3)
Li 520
Be 899
B 801
C 1086
N 1402
- 22 -
NEET (UG)-2024 (Code-R5)
- 23 -
NEET (UG)-2024 (Code-R5)
56. The compound that will undergo SN1 reaction with the fastest rate is
(1) (2)
(3) (4)
Answer (3)
- 24 -
NEET (UG)-2024 (Code-R5)
(1) Both Statement I and Statement II are false
Answer (4)
Sol. • Aniline does not undergo Friedel-Crafts alkylation reaction due to salt formation with aluminium
chloride, the Lewis acid, which is used as a catalyst.
• Aniline (aromatic primary amine) cannot be prepared by Gabriel phthalimide synthesis because
aryl halides do not undergo nucleophilic substitution with anion formed by phthalimide.
List I List II
A. 1 mol of H2O to O2 I. 3F
(1) A-III, B-IV, C-I, D-II (2) A-II, B-III, C-I, D-IV
(3) A-III, B-IV, C-II, D-I (4) A-II, B-IV, C-I, D-III
Answer (4)
4F
for 1 mole of H2O = = 2F required
2
7 2 2
Mn O 4 Mn
2
1.5 mole Ca2+ ion required = 1.5 = 3F
1
2 3
FeO Fe2O3
- 25 -
NEET (UG)-2024 (Code-R5)
60. 1
Which plot of ln k vs is consistent with Arrhenius equation?
T
(1) (2)
(3) (4)
Answer (3)
Sol. The Arrhenius equation is given as
Ea
k Ae RT
Ea
ln k ln A
RT
1 E
ln k v/s gives a straight line graph with slope = a and intercept = ln A
T R
- 26 -
NEET (UG)-2024 (Code-R5)
As branching increases molecules attain the shape of a sphere results in smaller area of contact thus
weak intermolecular forces between spherical molecules, which are overcome at relatively lower
temperature. Leading to decrease in boiling point.
62. Match List I with List II.
List I (Complex) List II (Type of isomerism)
A. [Co(NH3)5(NO2)]Cl2 I. Solvate isomerism
B. [Co(NH3)5(SO4)]Br II. Linkage isomerism
C. [Co(NH3)6][Cr(CN)6] III. Ionization isomerism
D. [Co(H2O)6]Cl3 IV. Coordination isomerism
Choose the correct answer from the options given below:
(1) A-I, B-III, C-IV, D-II
(2) A-I, B-IV, C-III, D-II
(3) A-II, B-IV, C-III, D-I
(4) A-II, B-III, C-IV, D-I
Answer (4)
Sol. A. [Co(NH3)5(NO2)]Cl2 II. Linkage isomerism due to ‘N’ and ‘O’ linkage by
NO2
B. [Co(NH3)5(SO4)]Br III. Ionization isomerism
C. [Co(NH3)6][Cr(CN)6] IV. Coordination isomerism
D. [Co(H2O)6]Cl3 I. Solvate isomerism
63. 1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide
left unreacted is equal to
(1) 250 mg
(2) Zero mg
(3) 200 mg
(4) 750 mg
Answer (1)
W 1000
Sol. M
M2 V (in mL)
- 27 -
NEET (UG)-2024 (Code-R5)
64. Which one of the following alcohols reacts instantaneously with Lucas reagent?
(1) (2)
Answer (3)
Sol. Tertiary alcohols react instantaneously with Lucas reagent and gives immediate turbidity.
In case of tertiary alcohols, they form halides easily with Lucas reagent (conc. HCl and ZnCl 2)
65. The E° value for the Mn3+/Mn2+ couple is more positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to change of
(1) d5 to d2 configuration (2) d4 to d5 configuration
(3) d3 to d5 configuration (4) d5 to d4 configuration
Answer (2)
Sol. EMn3
/Mn2
ECr 3
/Cr 2
or EFe 3
/Fe2
(1)
(2)
(3) HF
(4)
Answer (4)
Sol. In o-nitrophenol intramolecular H-bonding is present.
- 28 -
NEET (UG)-2024 (Code-R5)
68. Among Group 16 elements, which one does NOT show –2 oxidation state?
(1) Se (2) Te
(3) Po (4) O
Answer (3)
Sol. Oxygen shows –2, –1, +1 and +2 oxidation states
Selenium shows –2, +2, +4 and +6 oxidation states
Tellurium shows –2, +2, +4 and +6 oxidation states
Polonium shows +2 and +4 oxidation states
- 29 -
NEET (UG)-2024 (Code-R5)
Sol. Statement I is correct, because boiling point of hydrides of group 16 follows the order
H2O > H2Te > H2Se > H2S.
Statement II due to intermolecular H-bonding H2O shows higher boiling point than respective hydrides
of group 16.
(Both Statement are true)
Order from H2Te to H2S is due to decreasing molar mass.
70. ‘Spin only’ magnetic moment is same for which of the following ions?
A. Ti3+ B. Cr2+
C. Mn2+ D. Fe2+
E. Sc3+
Choose the most appropriate answer from the options given below.
(1) A and E only (2) B and C only
(3) A and D only (4) B and D only
Answer (4)
Sol.
Ions No. of unpaired electrons Configuration
Ti3+ 1 3d1
Cr2+ 4 3d4
Mn2+ 5 3d5
Fe2+ 4 3d6
Sc3+ 0 3d0
Cr2+ and Fe2+ will have same spin only magnetic moment.
71. The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH2OH
E. NaHSO3
Choose the correct options from the given below:
(1) A and D
(2) B and E
(3) E and D
(4) B and C
Answer (2)
Sol. Despite having the aldehyde group glucose does not give Schiff’s test and it does not form the
hydrogen sulphite addition product with NaHSO3.
- 30 -
NEET (UG)-2024 (Code-R5)
In presence of NH3 ligand, pairing of electrons takes place and it becomes diamagnetic complex ion.
In presence of NH3 ligand :
In presence of F– ligands :
In [CoF6]3–, Co3+ is sp3d2 hybridised with four unpaired electrons, so it is paramagnetic in nature.
(1) (2)
(3) (4)
Answer (3)
Sol. The stability of carbocation can be described by the hyperconjugation. Greater the extent of
hyperconjugation, more is the stability of carbocation.
(1) 5 -H
(2) 1 -H
- 31 -
NEET (UG)-2024 (Code-R5)
(3) 7 -H
(4) 3 -H
Stability order of carbocations = (3) > (1) > (4) > (3)
74. Fehling’s solution ‘A’ is
(1) alkaline copper sulphate
(2) alkaline solution of sodium potassium tartrate (Rochelle’s salt)
(3) aqueous sodium citrate
(4) aqueous copper sulphate
Answer (4)
Sol. Fehling solution ‘A’ = Aqueous copper sulphate
Fehling solution ‘B’ = Alkaline sodium potassium tartrate (Rochelle salt)
Answer (4)
n g
Sol. K p K c RT
for Kp Kc,
ng 0
ng = np – nr
(1) ng = 2 – 1 = 1 (2) ng = 2 – 2 = 0
(3) ng = 2 – 2 = 0 (4) ng = 2 – 2 = 0
A. I.
B. II. CrO3
- 32 -
NEET (UG)-2024 (Code-R5)
C. III. KMnO4/KOH,
D. IV. (i) O3
(ii) Zn-H2O
Choose the correct answer from the options given below:
(1) A-III, B-I, C-II, D-IV (2) A-IV, B-I, C-II, D-III
(3) A-I, B-IV, C-II, D-III (4) A-IV, B-I, C-III, D-II
Answer (2)
Sol. (A)
It is reductive ozonolysis
(B)
(C)
(D)
77. A compound with a molecular formula of C6H14 has two tertiary carbons. Its IUPAC name is :
(1) 2-methylpentane (2) 2,3-dimethylbutane
(3) 2,2-dimethylbutane (4) n-hexane
Answer (2)
Sol. CH3 – CH2 – CH2 – CH2 – CH2 – CH3 has no tertiary carbon
(n-Hexane)
(2-Methylpentane)
(2, 3-Dimethylbutane)
(2, 2-Dimethylbutane)
- 33 -
NEET (UG)-2024 (Code-R5)
78. Activation energy of any chemical reaction can be calculated if one knows the value of
(1) probability of collision
(2) orientation of reactant molecules during collision
(3) rate constant at two different temperatures
(4) rate constant at standard temperature
Answer (3)
Sol. To calculate value of Ea
Equation used is
k Ea 1 1
log 2 –
k1 2.303R T1 T2
Hence Ea can be calculated if value of rate constant k is known at two different temperatures T 1 and
T 2.
79. On heating, some solid substances change from solid to vapour state without passing through liquid state.
The technique used for the purification of such solid substances based on the above principle is known as
(1) Sublimation (2) Distillation
(3) Chromatography (4) Crystallization
Answer (1)
Sol. (1) Sublimation : It is the purification technique based on principle that on heating, some solid
substances change from solid to vapour state without passing through liquid state.
(2) Distillation : It is used to separate volatile liquids from non-volatile impurities and the liquids
having sufficient difference in their boiling point.
(3) Chromatography : It is based on separation by using stationary and mobile phase.
(4) Crystallization : It is based on difference in the solubilities of the compound and impurities in a
suitable solvent.
80. The energy of an electron in the ground state (n = 1) for He+ ion is –x J, then that for an electron in n = 2
state for Be3+ ion in J is
x
(1) (2) –4x
9
4
(3) x (4) –x
9
Answer (4)
Z2
Sol. En RH 2 J
n
For He+ (n = 1),
22
En x R H 2 4RH
1
x
RH
4
- 34 -
NEET (UG)-2024 (Code-R5)
For Be3+ (n = 2),
Z2
En R H 2 J
n
x 44
x J
4 2 2
Sol. (1)
(2)
2 1 2 1
(3) BaCl21 Na2SO42 BaSO4 2Na Cl1
(4)
82. Identify the correct reagents that would bring about the following transformation.
(iii) PCC
(2) (i) BH3
(ii) H2 O2 / OH
(iii) alk.KMnO4
(iv) H3O
- 35 -
NEET (UG)-2024 (Code-R5)
Sol.
Mechanism :
- 36 -
NEET (UG)-2024 (Code-R5)
84. For the reaction 2A B + C, KC = 4 × 10–3. At a given time, the composition of reaction mixture is:
[A] = [B] = [C] = 2 × 10–3 M.
Then, which of the following is correct?
(1) Reaction has a tendency to go in forward direction.
(2) Reaction has a tendency to go in backward direction.
(3) Reaction has gone to completion in forward direction.
(4) Reaction is at equilibrium.
Answer (2)
Sol. 2A B + C, KC = 4 × 10–3
At a given time t, QC is to be calculated and been compared with KC.
[B][C] (2 103 )(2 103 )
QC
[A]2 (2 103 )2
QC = 1
As QC > KC, so reaction has a tendency to move backward.
85. The highest number of helium atoms is in
(1) 4 u of helium (2) 4 g of helium
(3) 2.271098 L of helium at STP (4) 4 mol of helium
Answer (4)
4u
Sol. (1) 4 u of He = = 1 He atom
4u
4g
(2) 4 g of Helium = mole = 1 mole = NA He atom
4g
2.271
(3) 2.2710982 of He at STP = mole
22.710982
= 0.1 mole
= 0.1 NA He atom
(4) 4 mol of He = 4 NA He atoms
SECTION-A
Yb2+ (Xe) 4f 14
µ=0 Diamagnetic
- 37 -
NEET (UG)-2024 (Code-R5)
Ce3+ (Xe) 4f 1
µ= 3 Paramagnetic
Eu2+ (Xe) 4f 7
µ= 63 Paramagnetic
Gd3+ (Xe) 4f 7
µ= 63 Paramagnetic
Eu3+ (Xe) 4f 6
µ= 48 Paramagnetic
Pm3+ (Xe) 4f 4
µ= 24 Paramagnetic
Sm3+ (Xe) 4f 5
µ= 35 Paramagnetic
Hence Ce4+ and Yb2+ are only diamagnetic.
87. The products A and B obtained in the following reactions, respectively, are
3ROH + PCl3 3RCl + A
ROH + PCl5 RCl + HCl + B
(1) POCl3 and H3PO4 (2) H3PO4 and POCl3
(3) H3PO3 and POCl3 (4) POCl3 and H3PO3
Answer (3)
Sol. These reactions are preparation of haloalkanes from alcohols.
- 38 -
NEET (UG)-2024 (Code-R5)
Sol. [Co(NH3)6]3+ is a homoleptic complex as only one type of ligands (NH3) is coordinated with Co3+ ion.
While [Co(NH3)4Cl2]+ is a heteroleptic complex in which Co3+ ion is ligated with more than one type of
ligands, i.e., NH3 and Cl–.
89. Identify the major product C formed in the following reaction sequence:
NaCN
CH3 CH2 CH2 I A
OH NaOH
Partial hydrolysis
B
Br
C
2 (major)
- 39 -
NEET (UG)-2024 (Code-R5)
(2)
(3)
‘P’ is
(1) (2)
(3) (4)
Answer (1)
Sol.
93. During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is
added to prevent hydrolysis of Fe2+ ion?
(1) concentrated sulphuric acid
(2) dilute nitric acid
(3) dilute sulphuric acid
(4) dilute hydrochloric acid
Answer (3)
Sol. During the preparation of Mohr’s salt, dilute sulphuric acid is added to prevent the hydrolysis of Fe 2+
ion.
- 40 -
NEET (UG)-2024 (Code-R5)
94. Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group
number from 0 to VI.
A. Al3+ B. Cu2+
C. Ba2+ D. Co2+
E. Mg2+
Choose the correct answer from the options given below.
(1) B, C, A, D, E (2) E, C, D, B, A
(3) E, A, B, C, D (4) B, A, D, C, E
Answer (4)
Sol.
Group Cations
Group-II Cu2+
Group-III Al3+
Group-IV Co2+
Group-V Ba2+
Group-VI Mg2+
The correct order of group number of ions is Cu2 Al3 Co2 Ba2 Mg2
B A D C E
95. Consider the following reaction in a sealed vessel at equilibrium with concentrations of
If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what will be degree of dissociation () of NO(g) at
equilibrium?
Answer (3)
[N2 ][O2 ]
Kc
[NO]2
= 1.607
- 41 -
NEET (UG)-2024 (Code-R5)
t=0 0.1 0 0
0.1 – 0.1 0.05 0.05
0.05 0.05
Kc
(0.1 0.1 )2
0.05 0.05
Kc
0.01(1 )2
(0.05)2 2
1.607 =
0.01(1 )2
2 1.607 (0.1)2
(1 )2 (0.05)2
1.27 0.1
1 0.05
2.54
1
= 2.54 – 2.54
3.54 = 2.54
2.54
0.717
3.54
96. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper
sulphate solution for 100 seconds is (Given : Molar mass of Cu : 63 g mol–1, 1 F = 96487 C)
(1) 0.315 g (2) 31.5 g
(3) 0.0315 g (4) 3.15 g
Answer (1)
Sol. Cu2+ (aq) + 2e– Cu(s)
Mi t
Mass of Cu deposited (w) =
nF
63 9.6487 100
=
2 96487
= 0.315 g
97. The plot of osmotic pressure () vs concentration (mol L–1) for a solution gives a straight line with slope
25.73 L bar mol–1. The temperature at which the osmotic pressure measurement is done is
(Use R = 0.083 L bar mol–1 K–1)
(1) 310°C (2) 25.73°C
(3) 12.05°C (4) 37°C
Answer (4)
- 42 -
NEET (UG)-2024 (Code-R5)
Sol. = CRT
Slope = RT
25.73 = 0.083 × T
25.73
T 309.47 310 K
0.083
= 37°C
98. Major products A and B formed in the following reaction sequence, are
(1)
(2)
(3)
(4)
Answer (4)
Sol.
- 43 -
NEET (UG)-2024 (Code-R5)
99. The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of
activation.
Given R = 8.314 J K–1 mol–1, log4 = 0.6021
(1) 380.4 kJ/mol
(2) 3.80 kJ/mol
(3) 3804 kJ/mol
(4) 38.04 kJ/mol
Answer (4)
k Ea 1 1
Sol. log 2 = –
k1 2.303R T1 T2
4 Ea 1 1
log = –
1 2.303R 300 330
Ea =
log 4 2.303 8.314 300 330
30
= 3.804 × 104 J/mol
= 38.04 kJ/mol
100. A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of
X is :
(Given atomic masses of A = 64; B = 40; C = 32 u)
(1) ABC3
(2) AB2C2
(3) ABC4
(4) A2BC2
Answer (1)
Sol.
A 32% 32 1 1 =1
2
64 2 2
B 20% 20 1 1 =1
2
40 2 2
C 48% 48 3 3 =3
2
32 2 2
A : B : C
So, empirical formula of X
1 : 1 : 3
- 44 -
NEET (UG)-2024 (Code-R5)
w
BOTANY
SECTION-A
101. List of endangered species was released by
(1) WWF (2) FOAM
(3) IUCN (4) GEAC
Answer (3)
102. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to
upstream and down stream end;
Answer (3)
Sol. A transcription unit of DNA is defined primarily by the three regions in the DNA:
(i) A promoter
(iii) A terminator
The promoter is said to be located towards 5-end (upstream) of the structural gene (the reference is
made with respect to the polarity of coding strand)
103. Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
(1) Phospholipids
(2) Glycerides
(3) Carbohydrates
(4) Amino acids
Answer (1)
Sol. The correct answer is option (1).
Some lipids have phosphorous and a phosphorylated organic compound in them. These are
phospholipids. They are found in cell membrane. Lecithin is one example.
Option (2) is incorrect as glycerides are another group of lipids in which both glycerol and fatty acids
are present.
Option (3) and (4) are incorrect as carbohydrates and amino acids are separate groups of biomolecules.
- 45 -
NEET (UG)-2024 (Code-R5)
104. Which of the following are required for the dark reaction of photosynthesis?
A. Light B. Chlorophyll
C. CO2 D. ATP
E. NADPH
Choose the correct answer from the options given below:
(1) B, C and D only (2) C, D and E only
(3) D and E only (4) A, B and C only
Answer (2)
Sol. For dark reaction of photosynthesis there are the requirement of
CO2
ATP
NADPH
Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both Statement I and Statement II are false
(2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true
(4) Both Statement I and Statement II are true
Answer (4)
Sol. • During leptotene stage the chromosomes become gradually visible under the light microscope.
• The beginning of diplotene is recognised by the dissolution of the synaptonemal complex and the
tendency of the recombined homologous chromosomes of the bivalents to separate from each
other except at the site of crossover.
- 46 -
NEET (UG)-2024 (Code-R5)
107. A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of
phenotype/s is/are expected in the progeny?
(1) Red flowered as well as pink flowered plants
(2) Only pink flowered plants
(3) Red, Pink as well as white flowered plants
(4) Only red flowered plants
Answer (1)
Sol. Pink colour flower in snapdragon have genotype Rr
Red flowered snapdragon have genotype RR when they both are crossed
♂ R R Phenotype
♀
r Rr Rr 2 2 0
So the progeny that we get are red and pink flowered plants only
108. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
(1) promotes abscission of mature leaves only.
(2) does not affect mature monocotyledonous plants.
(3) can help in cell division in grasses, to produce growth.
(4) promotes apical dominance.
Answer (2)
Sol. Auxin does not affect mature monocot plants. In monocots, especially grasses show limited
translocation and cause rapid degradation of external auxin.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below.
Answer (3)
Sol. Flowers of Vallisneria are not colourful and do not produce nectar. Waterlily is pollinated by insect or
wind. In water-pollinated species, pollen grains are protected from wetting by a mucilaginous covering.
In some hydrophytes such as Vallisneria pollen grains are carried passively by water current.
- 47 -
NEET (UG)-2024 (Code-R5)
110. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
(1) B (2) C
(3) D (4) A
Answer (2)
Sol. Radicle is destined to form root.
In the given diagram ‘C’ represent radicle
113. In the given figure, which component has thin outer walls and highly thickened inner walls?
(1) D (2) A
(3) B (4) C
Answer (4)
Sol. Guard cells of stomata have thin outer wall and highly thickened inner walls.
- 48 -
NEET (UG)-2024 (Code-R5)
114. Formation of interfascicular cambium from fully developed parenchyma cells is an example for
(1) Redifferentiation (2) Dedifferentiation
(3) Maturation (4) Differentiation
Answer (2)
Sol. The phenomenon of formation of interfascicular cambium from fully differentiated parenchyma cells is
called dedifferentiation.
115. What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiply and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromosome.
E. It shows ability to replicate.
Choose the correct answer from the options given below:
(1) D and E only (2) B and C only
(3) A and E only (4) A and B only
Answer (2)
Sol. Correct answer is option (2) because
The fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism
are:
(B) It may get integrated into the genome of the recipient
(C) It may multiply and be inherited along with the host DNA
This piece of DNA would not be able to multiply itself in the progeny cells of the organism but when
gets integrated into the genome of the recipient, it may multiply and be inherited along with the host
DNA.
116. Match List I with List II
List-I List-II
A. Rhizopus I. Mushroom
(1) A-I, B-III, C-II, D-IV (2) A-III, B-II, C-I, D-IV
(3) A-IV, B-III, C-II, D-I (4) A-III, B-II, C-IV, D-I
Answer (4)
Sol. Rhizopus is a bread mould fungus. Ustilago is a smut fungi. Puccinia is known as rust fungi. Agaricus
is commonly called mushroom.
A-III, B-II, C-IV, D-I
- 49 -
NEET (UG)-2024 (Code-R5)
117. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
(1) 6 bp
(2) 4 bp
(3) 10 bp
(4) 8 bp
Answer (1)
Sol. The correct answer is option (1).
The first restriction endonuclease – Hind II, whose functioning depends on a specific DNA nucleotide
sequence was isolated. It was found that Hind II always cut DNA molecules at a particular point by
recognising sequence of six base pairs.
Option (2), (3) and (4) are incorrect because they have either more than 6 or less than 6 bp.
118. The type of conservation in which the threatened species are taken out from their natural habitat and placed
in special setting where they can be protected and given special care is called
(1) Biodiversity conservation
(2) Semi-conservative method
(3) Sustainable development
(4) in-situ conservation
Answer (1)
Sol. The type of conservation in which threatened species are taken out from their natural habitat and placed
in special setting where they can be protected and given special care is called ex-situ conservation
which is a type of biodiversity conservation.
119. Given below are two statements:
Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect
the inactive protoxin gets converted into active form due to acidic pH of the insect gut.
In the light of the above statements, choose the correct answer from the options given below:
Answer (2)
Sol. The correct answer is option (2) as specific Bt toxin genes were isolated from Bacillus thuringiensis
and incorporated into the several crop plants such as cotton. The choice of genes depends upon the
crop and the targeted pest as most Bt toxins are insect-group specific. The toxin is coded by a gene
named cry. There are a number of them, for example, the proteins encoded by the genes cry IAc and
cry IIAb control the cotton bollworms, that of cry IAb controls corn borer.
- 50 -
NEET (UG)-2024 (Code-R5)
List I List II
recessive parent
Answer (2)
121. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary
from the given figures (a) and (b)
Answer (3)
Sol. If gynoecium is situated in the centre and other parts of the flower are located on the rim of the thalamus
almost at the same level, it is called perigynous.
- 51 -
NEET (UG)-2024 (Code-R5)
122. Which one of the following is not a criterion for classification of fungi?
Answer (1)
Sol. The morphology of the mycelium, mode of spore formation and fruiting bodies form the basis for the
division of the kingdom fungi into various classes.
(1) Over-exploitation
(3) Co-extinctions
- 52 -
NEET (UG)-2024 (Code-R5)
125. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype
of the black seed plant, with which of the following genotype will you cross it?
(1) bb
(2) Bb
(3) BB/Bb
(4) BB
Answer (1)
Sol. To determine the genotype of a black seed colour at F2, the black seed from F2 is crossed with the
white seed colour. This is called a test cross.
To determine the genotype of (BB/Bb) black seed we need to cross them with white seed i.e. bb.
List-I List-II
(3) A-I, B-II, C-III, D-IV (4) A-III, B-II, C-IV, D-I
Answer (4)
• Both the centrioles in a centrosome lie perpendicular to each other in which each has an
organisation like the cartwheel.
• Leucoplasts are the colourless plastids of varied shapes and sizes with stored nutrients.
• Golgi apparatus is the important site for formation of glycoproteins and glycolipids.
- 53 -
NEET (UG)-2024 (Code-R5)
128. Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in F2 generation.
Law of segregation is based on the fact that the alleles do not show any expression and both the
characters are recovered as such in F2 generation
130. How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
(1) 2 molecules of ATP and 2 molecules of NADPH
(2) 3 molecules of ATP and 3 molecules of NADPH
(3) 3 molecules of ATP and 2 molecules of NADPH
(4) 2 molecules of ATP and 3 molecules of NADPH
Answer (3)
Sol. For fixation of 1 molecule of CO2 in Calvin cycle 3 ATP molecules and 2 NADPH molecules are required.
- 54 -
NEET (UG)-2024 (Code-R5)
131. dN K − N
The equation of Verhulst-Pearl logistic growth is = rN .
dt K
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was
available for species diversification.
Answer (4)
Sol. Only statement B is incorrect because tropical environments unlike temperate ones, are less seasonal,
relatively more constant and predictable.
133. The lactose present in the growth medium of bacteria is transported to the cell by the action of
(1) Acetylase
(2) Permease
(3) Polymerase
(4) Beta-galactosidase
Answer (2)
Sol. The y gene lac operon codes for permease enzyme, which increase the permeability of cell to
-galactosides.
So, the lactose present in the growth medium of bacteria is transported into the cell by the action of
permease.
- 55 -
NEET (UG)-2024 (Code-R5)
(1) Niacin
(2) Flavin
(3) Haem
(4) Zinc
Answer (4)
Sol. The correct answer is option (4) as the cofactor of the enzyme carboxypeptidase is zinc.
Niacin is associated with coenzyme NAD and NADP.
Option (3) is incorrect as haem is the prosthetic group in peroxidase and catalase.
135. The capacity to generate a whole plant from any cell of the plant is called:
(1) Micropropagation
(2) Differentiation
(3) Somatic hybridization
(4) Totipotency
Answer (4)
Sol. Totipotency is defined as the capacity to generate a whole plant from any cell of the plant.
SECTION-B
136. Match List I with List II
List I List II
B. Alexander von Humboldt II. Long term ecosystem experiment using out door
plots
Answer (1)
Sol. Robert May places the global species diversity at about 7 million.
Paul Ehrlich used an analogy “Rivet popper hypothesis” to explain the role of species in the ecosystem.
David Tilman performed long term ecosystem experiments using out door plots.
- 56 -
NEET (UG)-2024 (Code-R5)
List I List II
(Types of Stamens) (Example)
A. Monoadelphous I. Citrus
138. Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
(1) B, C, D and E only (2) A, C, D and E only
(3) A, B, C and E only (4) A, B, C and D only
Answer (2)
Sol. In members of Phaeophyceae sexual reproduction is by oogamous, isogamous or anisogamous
methods.
Therefore correct set of statements are A, C, D and E.
139. The DNA present in chloroplast is:
(1) Circular, double stranded
(2) Linear, single stranded
(3) Circular, single stranded
(4) Linear, double stranded
Answer (1)
Sol. The DNA present in chloroplast is circular double stranded.
- 57 -
NEET (UG)-2024 (Code-R5)
Match List I with List II
140.
List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson & Stahl IV. Lac operon
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II (2) A-II, B-III, C-IV, D-I
(3) A-IV, B-I, C-II, D-III (4) A-III, B-II, C-I, D-IV
Answer (1)
Sol. Frederick Griffith series of experiment witness miraculous transformation in the bacteria.
The elucidation of Lac operon was a result of a close association between geneticist, Francois Jacob
and a biochemist, Jacques Monod.
Meselson and Stahl gave semi-conservative mode of DNA replication.
Har Gobind Khorana developed chemical method to define combination of bases in genetic code.
141. Which of the following statement is correct regarding the process of replication in E.coli?
(1) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
(2) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
(4) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
Answer (3)
Sol. In Prokaryotes, like E.coli during replication, the DNA dependent DNA polymerase catalyse
polymerization only in one direction, that is 5’ → 3’
143. Which of the following are fused in somatic hybridization involving two varieties of plants?
(1) Somatic embryos
(2) Protoplasts
(3) Pollens
(4) Callus
Answer (2)
Sol. In C3 plant, some O2 bind to RuBisCO, and hence CO2 fixation is decreased. Statement II is incorrect,
photorespiration does not occur in C 4 plants as they lack RuBisCO in mesophyll. Hence statement I is the
only correct option.
List I List II
- 59 -
NEET (UG)-2024 (Code-R5)
146. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m–2) yr–1, what would
be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
(1) x ( kcal m –2 ) yr –1
(3)
100 x
(kcal m–2 ) yr –1
3x
(4)
x
(kcal m–2 ) yr –1
10
Answer (2)
Sol. NPP at first trophic level would be the GPP for second trophic level. NPP at second trophic level would
be GPP for third trophic level. Therefore, 100x (kcal/m2/yr) would be GPP at second trophic level and 100x
× 10% (kcal/m2/yr) i.e., 10x (kcal/m2/yr) energy would be GPP at third trophic level.
147. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
(1) Succinic acid → Malic acid
(2) Succinyl-CoA → Succinic acid
(3) Isocitrate → -ketoglutaric acid
(4) Malic acid → Oxaloacetic acid
Answer (2)
Sol. Oxidation involves the loss of electrons (often as part of hydrogen) from a molecule, leaving to an
increase in its oxidation state. This process is typically associated with the transfer of electrons to an
electron acceptor which is reduced in the process.
The conversion of succinyl CoA to succinic acid does not involve oxidation of substrate.
A. GLUT-4 I. Hormone
- 60 -
NEET (UG)-2024 (Code-R5)
Sol. Correct answer is option (4)
B. Insulin I. Hormone
List I List II
Answer (1)
150. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem,
thus, increasing the yield?
(1) Gibberellin
(2) Cytokinin
(4) Auxin
Answer (1)
Sol. Sugarcanes store carbohydrate as sugar in their stems. Spraying sugarcane crop with gibberellins
increases the length of the stem, thus increasing the yield.
- 61 -
NEET (UG)-2024 (Code-R5)
ZOOLOGY
SECTION-A
151. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in
male human being.
In the light of the above statements, choose the correct answer from the options given below :
(1) Both A and R are true but R is NOT the correct explanation of A
(2) A is true but R is false
(3) A is false but R is true
(4) Both A and R are true and R is the correct explanation of A
Answer (3)
Sol. The correct answer is option (3) as FSH is a gonadotropin affects ovarian follicles in females and causes
their growth but in males LH affects Leydig cells leading to secretion of androgens.
Growing ovarian follicles secrete estrogen in females while interstitial cells secrete androgen in male
human being.
Hence, Assertion is false and Reason is true.
152. Match List I with List II :
List-I List-II
A. Lipase I. Peptide bond
B. Nuclease II. Ester bond
C. Protease III. Glycosidic bond
D. Amylase IV. Phosphodiester bond
Choose the correct answer from the options given below :
(1) A-III, B-II, C-I, D-IV (2) A-II, B-IV, C-I, D-III
(3) A-IV, B-I, C-III, D-II (4) A-IV, B-II, C-III, D-I
Answer (2)
Sol. The correct answer is option (2) as
A. Lipase – Digests ester bond found in lipids.
B. Nuclease – Helps in digestion of phosphodiester bonds found in nucleic acids.
C. Protease – Helps in digestion of peptide bond found in proteins.
D. Amylase – Digests/breaks the glycosidic bonds found in carbohydrates i.e., digest
starch into smaller molecules, ultimately yielding maltose, which in turn is
cleaved into two glucose molecules by maltase.
153. Following are the stages of pathway for conduction of an action potential through the heart
A. AV bundle B. Purkinje fibres
C. AV node D. Bundle branches
E. SA node
Choose the correct sequence of pathway from the options given below
(1) A-E-C-B-D (2) B-D-E-C-A
(3) E-A-D-B-C (4) E-C-A-D-B
- 62 -
NEET (UG)-2024 (Code-R5)
Answer (4)
Sol. Correct answer is option (4) because the correct pathway of conduction of action potential is
SA → AV node → AV bundle → Bundle branches → Purkinje fibres
154. Match List I with List II :
List I List II
A. Pons I. Provides additional space for Neurons, regulates posture
and balance.
B. Hypothalamus II. Controls respiration and gastric secretions.
C. Medulla III. Connects different regions of the brain.
D. Cerebellum IV. Neuro secretory cells
Choose the correct answer from the options given below :
(1) A-III, B-IV, C-II, D-I
(2) A-I, B-III, C-II, D-IV
(3) A-II, B-I, C-III, D-IV
(4) A-II, B-III, C-I, D-IV
Answer (1)
Sol. The correct answer is option (1) as
A. Pons – Part of hindbrain, it connects different regions of the brain.
B. Hypothalamus – Also have neuro secretory cells which secrete hormones.
C. Medulla oblongata – Part of hindbrain which controls respiration and gastric
secretions.
D. Cerebellum – Part of hindbrain with convoluted surface which provides
additional space for neurons, also regulates posture and balance.
155. Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
(1) Genetic drift
(2) Gene migration
(3) Constant gene pool
(4) Genetic recombination
Answer (3)
Sol. The correct answer is option (3) as a constant gene pool will not disturb the Hardy-Weinberg equilibrium.
Option (1), (2) & (4) will affect the equilibrium leading to evolution.
156. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
(1) 10th segment
(2) 8th and 9th segment
(3) 11th segment
(4) 5th segment
Answer (1)
Sol. Correct answer is option (1), because in both sexes of cockroach, 10th segment bears a pair of jointed
filamentous structures called anal cerci.
Options (2), (3) and (4) are incorrect because 5th, 8th and 9th segments do not bear such structures. In
adult cockroaches only 10th segments are present in abdomen. 11th abdominal segment is absent.
- 63 -
NEET (UG)-2024 (Code-R5)
157. Match List I with List II :
List I List II
A. Expiratory capacity I. Expiratory reserve volume + Tidal volume +
Inspiratory reserve volume
B. Functional residual II. Tidal volume + Expiratory reserve volume
capacity
C. Vital capacity III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume
Choose the correct answer from the options given below :
(1) A-III, B-II, C-IV, D-I
(2) A-II, B-I, C-IV, D-III
(3) A-I, B-III, C-II, D-IV
(4) A-II, B-IV, C-I, D-III
Answer (4)
Sol. Expiratory capacity = Tidal volume + Expiratory reserve volume
Functional residual capacity = Expiratory reserve volume + Residual volume
Vital capacity = Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
Inspiratory capacity = Tidal volume + Inspiratory reserve volume
158. The flippers of the Penguins and Dolphins are the example of the
(1) Natural selection (2) Convergent evolution
(3) Divergent evolution (4) Adaptive radiation
Answer (2)
Sol. The correct answer is option (2), because the flippers of the Penguins and Dolphins perform similar
function but they are not anatomically similar structures. This is example of analogous structures.
• Option (1) is incorrect as natural selection is a key mechanism of evolution.
• Option (3) is incorrect as divergent evolution results in the formation of homologous structures.
• Option (4) is incorrect as adaptive radiation is the process of evolution of different species in a given
geographical area starting from a point and literally radiating to the other areas of geography.
159. Match List I with List II :
List I List II
- 64 -
NEET (UG)-2024 (Code-R5)
Answer (2)
Sol. The correct answer is option (2) as
– I antitrypsin → Is used for treatment of Emphysema
Cry I Ab gene → Controls corn borer
Cry I Ac gene → Controls cotton bollworms
Enzyme replacement therapy → Can be used as treatment option in ADA deficiency.
160. Match List I with List II :
List I List II
A. Down’s syndrome I. 11th chromosome
B. -Thalassemia II. ‘X’ chromosome
C. -Thalassemia III. 21st chromosome
D. Klinefelter’s syndrome IV. 16th chromosome
Choose the correct answer from the options given below :
(1) A-II, B-III, C-IV, D-I (2) A-III, B-IV, C-I, D-II
(3) A-IV, B-I, C-II, D-III (4) A-I, B-II, C-III, D-IV
Answer (2)
Sol. Down’s syndrome is due to presence of an additional copy of chromosome number 21. Klinefelter’s
syndrome is caused due to presence of an additional copy of X-chromosome. -Thalassemia is
controlled by two closely linked genes on chromosome 16 of each parent. -Thalassemia is controlled
by a single gene HBB on chromosome 11 of each parent.
161. Given below are two statements:
In the light of the above statements, choose the correct answer from the options given below :
(1) Both Statement I and Statement II are false (2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true (4) Both Statement I and Statement II are true
Answer (2)
Sol. The correct answer is option no. (2) because the presence or absence of hymen is not a reliable indicator
of virginity because hymen can also be broken by a sudden jolt, insertion of a vaginal tampon, active
participation in some sports and in some women the hymen persists even after coitus.
- 65 -
NEET (UG)-2024 (Code-R5)
Answer (2)
Sol. Correct answer is option (2) because
• Common cold is caused by Rhinoviruses
• Haemozoin is released in blood due to ruptured RBCs after Plasmodium infection.
• Widal test is used to confirm the typhoid fever.
• Allergy is caused due to dust mites.
163. Which of the following is not a component of Fallopian tube?
(1) Isthmus
(2) Infundibulum
(3) Ampulla
(4) Uterine fundus
Answer (4)
Sol. The correct answer is option (4) as uterine fundus is the upper, dome-shaped part of the uterus, above
the opening of fallopian tubes.
• Option (1) is incorrect as isthmus is the last and narrow part of the oviduct that links to the uterus.
• Option (2) is incorrect as infundibulum is the part of oviduct which is closer to the ovary.
• Option (3) is incorrect as ampulla is the wider part of the oviduct.
164. Following are the stages of cell division :
A. Gap 2 phase B. Cytokinesis
C. Synthesis phase D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :
(1) E-B-D-A-C (2) B-D-E-A-C
(3) E-C-A-D-B (4) C-E-D-A-B
Answer (3)
Sol. The correct sequence of stages of cell division is
Gap 1 phase → Synthesis phase → Gap 2 phase
(E) (C) (A)
→ Karyokinesis → Cytokinesis
(D) (B)
The correct sequence will be → E → C → A → D → B
165. Match List I with List II :
List I List II
A. Axoneme I. Centriole
B. Cartwheel pattern II. Cilia and flagella
C. Crista III. Chromosome
D. Satellite IV. Mitochondria
Choose the correct answer from the options given below :
(1) A-IV, B-II, C-III, D-I (2) A-II, B-IV, C-I, D-III
(3) A-II, B-I, C-IV, D-III (4) A-IV, B-III, C-II, D-I
- 66 -
NEET (UG)-2024 (Code-R5)
Answer (3)
Sol. • Axoneme is seen in cilia and flagella
• Centriole shows cartwheel appearance
• Crista is found in mitochondria
• Satellite is present in chromosomes
166. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a
healthy baby.
Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new
born baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Both A and R are correct but R is NOT the correct explanation of A
(2) A is correct but R is not correct
(3) A is not correct but R is correct
(4) Both A and R are correct and R is the correct explanation of A
Answer (4)
Sol. Correct answer is option (4)
Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy
baby as colostrum contains several antibodies absolutely essential to develop resistance for the new
born baby.
167. Match List I with List II :
List I (Sub Phases of Prophase I) List II (Specific Characters)
A. Diakinesis I. Synaptonemal complex formation
B. Pachytene II. Completion of terminalisation of chiasmata
C. Zygotene III. Chromosomes look like thin threads
D. Leptotene IV. Appearance of recombination nodules
Choose the correct answer from the options given below
(1) A-I, B-II, C-IV, D-III (2) A-II, B-IV, C-I, D-III
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer (2)
Sol. (A) Diakinesis – Completion of terminalisation of chiasmata
(B) Pachytene – Appearance of recombination nodules
(C) Zygotene – Synaptonemal complex formation
(D) Leptotene – Chromosomes look like thin threads
A-II, B-IV, C-I, D-III
168. Match List I with List II :
List I List II
A. Fibrous joints I. Adjacent vertebrae, limited movement
B. Cartilaginous joints II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints III. Skull, don’t allow any movement
D. Ball and socket joints IV. Knee, help in locomotion
- 67 -
NEET (UG)-2024 (Code-R5)
Choose the correct answer from the options given below :
(1) A-I, B-III, C-II, D-IV (2) A-II, B-III, C-I, D-IV
(3) A-III, B-I, C-IV, D-II (4) A-IV, B-II, C-III, D-I
Answer (3)
Sol. The correct answer is option no. (3) as
• Fibrous joints do not allow any movement. This type of joint is shown by the flat skull bones which fuse
end-to-end with the help of dense fibrous connective tissues in the form of sutures.
• Cartilaginous joint is present between the adjacent vertebrae in the vertebral column and this permits
limited movements.
• Hinge joint is a type of synovial joint present in knee, help in locomotion
• Ball and socket joint is also a type of synovial joint present between humerus and pectoral girdle and
allows rotational movement.
169. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
(1) High pO2 and Lesser H+ concentration (2) Low pCO2 and High H+ concentration
(3) Low pCO2 and High temperature (4) High pO2 and High pCO2
Answer (1)
Sol. The correct answer is option (1) as
Conditions favourable for formation of oxyhaemoglobin in alveoli are high pO2, less H+ concentration low
pCO2 and low temperature.
Option (2), (3) and (4) are not correct as they do not favour the formation of oxyhaemoglobin.
170. Which of the following is not a natural/traditional contraceptive method?
(1) Periodic abstinence (2) Lactational amenorrhea
(3) Vaults (4) Coitus interruptus
Answer (3)
Sol. The correct answer is option (3) as
Vault is a barrier method of contraception which is made of rubber that is inserted into the female
reproductive tract to cover the cervix during the coitus.
• Option (1) is incorrect as periodic abstinence is also a natural method of contraception in which
couples avoid coitus during the fertile period.
• Option (2) is incorrect as lactational amenorrhea is also a natural method of contraception which is
based on the fact that ovulation and therefore the cycle do not occur during the period of intense
lactational following parturition.
• Option (4) is incorrect as coitus interruptus is a natural method of contraception in which male partner
withdraws his penis from the vagina just before ejaculation so as to avoid insemination.
171. Which of the following are Autoimmune disorders?
A. Myasthenia gravis B. Rheumatoid arthritis
C. Gout D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
(1) A, B & E only (2) B, C & E only
(3) C, D & E only (4) A, B & D only
Answer (1)
- 68 -
NEET (UG)-2024 (Code-R5)
Sol. The correct answer is option (1) as Myasthenia gravis, Rheumatoid arthritis and Systemic Lupus
Erythematosus (SLE) are autoimmune disorders.
Muscular dystrophy is a genetic disorder which progressively affects the skeletal muscles.
Gout is the inflammation of joints due to deposition of uric acid crystals.
Option (2), (3) and (4) are not the correct answer because all of them are not autoimmune disorders.
172. The “Ti plasmid” of Agrobacterium tumefaciens stands for
(1) Tumor independent plasmid (2) Tumor inducing plasmid
(3) Temperature independent plasmid (4) Tumour inhibiting plasmid
Answer (2)
Sol. The correct answer is option (2) as Ti plasmid of Agrobacterium tumefaciens is tumor inducing plasmid,
containing T-DNA which causes tumor in several dicot plants.
Options (1), (3) and (4) are not correct.
173. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
(1) 5’AUGUAAAGUUUAUAGGUAAGU3’ (2) 5’AUGUACCGUUUAUAGGGAAGU3’
(3) 5’ATGTACCGTTTATAGGTAAGT3’ (4) 5’AUGUACCGUUUAUAGGUAAGU3’
Answer (4)
Sol. Template DNA is :
3’TACATGGCAAATATCCATTCA5’
5’AUGUACCGUUUAUAGGUAAGU3’ m-RNA
174. Which of the following statements is incorrect?
(1) Most commonly used bio-reactors are of stirring type
(2) Bio-reactors are used to produce small scale bacterial cultures
(3) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
(4) A bio-reactor provides optimal growth conditions for achieving the desired product
Answer (2)
Sol. Correct answer is option (2)
The statement (2) is incorrect because bioreactors are used for processing of large volumes (100 – 1000
litres) of culture.
Small volume cultures cannot yield appreciable quantities of products. To produce in large quantities the
development of bioreactors is required.
175. Match List I with List II :
List I List II
A. Cocaine I. Effective sedative in surgery
B. Heroin II. Cannabis sativa
C. Morphine III. Erythroxylum
D. Marijuana IV. Papaver somniferum
Choose the correct answer from the options given below:
(1) A-I, B-III, C-II, D-IV (2) A-II, B-I, C-III, D-IV
(3) A-III, B-IV, C-I, D-II (4) A-IV, B-III, C-I, D-II
- 69 -
NEET (UG)-2024 (Code-R5)
Answer (3)
Sol. The correct option is (3) as
A. Cocaine – Obtained from plant Erythroxylum coca, stimulating action on CNS.
B. Heroin – Formed by the acetylation of morphine which is obtained from plant Papaver somniferum.
C. Morphine – Obtained from Papaver somniferum, is an effective sedative in surgery.
D. Marijuana – Obtained from Cannabis sativa, produces hallucinogenic effect and affects
cardiovascular system of the body.
176. Which of the following is not a steroid hormone?
(1) Testosterone (2) Progesterone
(3) Glucagon (4) Cortisol
Answer (3)
Sol. The correct answer is option (3) as glucagon is a proteinaceous hormone secreted from pancreas.
Options (1), (2) and (4) are not correct as they are steroid in nature.
177. Match List I with List II
List I List II
A. Non-medicated IUD I. Multiload 375
B. Copper releasing IUD II. Progestogens
C. Hormone releasing IUD III. Lippes loop
D. Implants IV. LNG-20
Choose the correct answer from the option given below:
(1) A-I, B-III, C-IV, D-II (2) A-IV, B-I, C-II, D-III
(3) A-III, B-I, C-IV, D-II (4) A-III, B-I, C-II, D-IV
Answer (3)
Sol. Correct answer is option (3) because
• Lippes loop is a non-medicated IUD.
• Multiload 375 is a copper releasing IUD.
• LNG -20 is a hormone releasing IUD.
• Progestogens are used as implants.
178. Given below are two statements :
Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable
to electrolytes.
Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and
increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the option given below :
(1) Both Statement I and Statement II are false (2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true (4) Both Statement I and Statement II are true
Answer (1)
Sol. Correct answer is option (1) because
Statement I is false as the descending limb of loop of Henle is permeable to water and almost
impermeable to electrolytes.
- 70 -
NEET (UG)-2024 (Code-R5)
Statement II is false as proximal convoluted tubule is lined by simple cuboidal brush border epithelium
which increases the surface area for reabsorption.
179. Given below are some stages of human evolution.
Arrange them in correct sequence. (Past to Recent)
A. Homo habilis B. Homo sapiens
C. Homo neanderthalensis D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
(1) B-A-D-C (2) C-B-D-A
(3) A-D-C-B (4) D-A-C-B
Answer (3)
Sol. Correct answer is option (3) because the correct sequence of stages of human evolution from past to
recent is
Homo habilis → Homo erectus → Homo neanderthalensis → Homo sapiens
180. Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in
human body:
Name of muscle/location
(1) (a) Skeletal - Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart
(2) (a) Skeletal - Biceps
(b) Involuntary – Intestine
(c) Smooth – Heart
(3) (a) Involuntary – Nose tip
(b) Skeletal – Bone
(c) Cardiac – Heart
(4) (a) Smooth - Toes
(b) Skeletal – Legs
(c) Cardiac – Heart
Answer (1)
Sol. The correct answer is option (1) as
Figure (a) represents skeletal muscle fibres which are closely attached to skeletal bones. In a typical
muscle such as triceps and biceps, striated muscle fibres are bundled together in a parallel fashion.
Figure (b) represents smooth muscle fibres which are present in the wall of internal organs such as the
blood vessels, stomach and intestine.
Figure (c) represents cardiac muscle fibres which are exclusively present in the heart.
- 71 -
NEET (UG)-2024 (Code-R5)
181. Match List I with List II :
List I List II
A. Pleurobrachia I. Mollusca
B. Radula II. Ctenophora
C. Stomochord III. Osteichthyes
D. Air bladder IV. Hemichordata
Choose the correct answer from the options given below :
(1) A-II, B-I, C-IV, D-III (2) A-II, B-IV, C-I, D-III
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer (1)
Sol. The correct answer is option (1) as
A. Pleurobrachia – is a member of phylum Ctenophora.
B. Radula – is a rasping feeding organ present in phylum Mollusca.
C. Stomochord – Rudimentary structure similar to notochord found in the collar region of
members of phylum Hemichordata.
D. Air bladder – is found in Osteichthyes which provides them buoyancy.
182. Match List I with List II :
List I List II
A. Pterophyllum I. Hag fish
B. Myxine II. Saw fish
C. Pristis III. Angel fish
D. Exocoetus IV. Flying fish
Choose the correct answer from the options given below :
(1) A-III, B-I, C-II, D-IV
(2) A-IV, B-I, C-II, D-III
(3) A-III, B-II, C-I, D-IV
(4) A-II, B-I, C-IIII, D-IV
Answer (1)
Sol. The correct option is option no. (1) as
Pterophyllum is the scientific name for Angel fish.
Myxine is the scientific name for Hag fish.
Pristis is the scientific name for Saw fish.
Exocoetus is the scientific name for Flying fish.
183. Match List I with List II :
List I List II
A. Typhoid I. Fungus
B. Leishmaniasis II. Nematode
C. Ringworm III. Protozoa
D. Filariasis IV. Bacteria
- 72 -
NEET (UG)-2024 (Code-R5)
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-I, D-II (2) A-III, B-I, C-IV, D-II
(3) A-II, B-IV, C-III, D-I (4) A-I, B-III, C-II, D-IV
Answer (1)
Sol. The correct answer is option (1) as
Typhoid – Caused by Salmonella typhimurium (Bacteria)
Leishmaniasis – Caused by protozoan i.e., Leishmania donovani
Ringworm – Caused by fungi belonging to the genera Microsporum, Trichophyton and Epidermophyton
Filariasis – Caused by Wuchereria bancrofti and Wuchereria malayi (Nematode)
184. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’
genes :
(1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved
in the replication of Plasmid.
(2) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
(3) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
(4) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of
Plasmid.
Answer (1)
Sol. Correct answer is option (1), because
‘X’ in the given diagram is ori while ‘Y’ is rop.
‘X’ which is ori is responsible for controlling the copy number of the linked DNA and ‘Y’ which is rop codes
for protein involved in the replication of plasmid.
Options (2), (3) and (4) are incorrect as ‘X’ and ‘Y’ are not related to these functions.
185. Consider the following statements :
A. Annelids are true coelomates B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below :
(1) A only (2) C only
(3) D only (4) B only
Answer (1)
Sol. The correct answer is option no. (1), because annelids are true coelomate animals. Options (2), (3) and
(4) are incorrect because poriferans are acoelomates, aschelminths are pseudocoelomates and
platyhelminthes are acoelomates.
- 73 -
NEET (UG)-2024 (Code-R5)
SECTION-B
186. Choose the correct statement given below regarding juxta medullary nephron.
(1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
(2) Loop of Henle of juxta medullary nephron runs deep into medulla.
(3) Juxta medullary nephrons outnumber the cortical nephrons.
(4) Juxta medullary nephrons are located in the columns of Bertini.
Answer (2)
Sol. The correct answer is option no, (2) because the length of loop of Henle of juxta medullary nephron is
longer than the length of loop of Henle of cortical nephron and runs deep into medulla.
Option (1) is incorrect because renal corpuscle of juxta medullary nephron lies in inner cortical region.
Option (3) is incorrect as juxta medullary nephrons are lesser in number than cortical nephrons.
Option (4) is incorrect as juxta medullary nephron are not present in columns of Bertini.
187. Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are
produced.
Statement II : Both bone marrow and thymus provide micro environments for the development and maturation
of T-lymphocytes.
In the light of above statements, choose the most appropriate answer from the options given below :
(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.
Answer (4)
Sol. The correct answer is option no. (4) as both statements I and II are correct.
In humans, the bone marrow is the main lymphoid organ where all blood cells including lymphocytes are
produced.
Both bone-marrow and thymus provide micro-environments for the development and maturation of T-
lymphocytes.
Options (1), (2) and (3) are incorrect.
188. Match List I with List II related to digestive system of cockroach.
List I List II
A. The structures used for storing of food I. Gizzard
B. Ring of 6-8 blind tubules at junction of foregut and midgut. II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction III. Malpighian tubules
of midgut and hindgut.
D. The structures used for grinding the food. IV. Crop
Choose the correct answer from the options given below:
(1) A-I, B-II, C-III, D-IV (2) A-IV, B-III, C-II, D-I
(3) A-III, B-II, C-IV, D-I (4) A-IV, B-II, C-III, D-I
Answer (4)
- 74 -
NEET (UG)-2024 (Code-R5)
Sol. The correct answer is option no. (4) as
The structure used for griding the food particles – Gizzard
The structure used for storing of food – Crop
Ring of 6-8 blind tubules at junction of foregut and midgut which assists – Gastric Caeca
in secretion of digestive juices
Ring of 100-150 yellow coloured thin filaments at junction of midgut – Malpighian tubules
and hindgut which assists in elimination of nitrogenous wastes
189. Match List I with List II :
List I List II
A. P wave I. Heart muscles are electrically
silent.
B. QRS complex II. Depolarisation of ventricles.
C. T wave III. Depolarisation of atria.
D. T-P gap IV. Repolarisation of ventricles.
Choose the correct answer from the options given below :
(1) A-III, B-II, C-IV, D-I
(2) A-II, B-III, C-I, D-IV
(3) A-IV, B-II, C-I, D-III
(4) A-I, B-III, C-IV, D-II
Answer (1)
Sol. The correct answer is option no. (1) as
A. P wave - III. Depolarisation of atria.
B. QRS complex - II. Depolarisation of ventricles.
C. T wave - IV. Repolarisation of ventricles.
D. T-P gap - I. Heart muscles are electrically silent.
190. As per ABO blood grouping system, the blood group of father is B +, mother is A+ and child is O+. Their
respective genotype can be
A. IBi/IAi/ii B. IBIB/IAIA/ii
C. IAIB/iIA/IBi D. IAi/IBi/IAi
E. iIB/iIA/IAIB
Choose the most appropriate answer from the options given below :
(1) B only
(2) C & B only
(3) D & E only
(4) A only
Answer (4)
Sol. Genotype of father with blood group B+ = IBi/iIB
Genotype of mother with blood group A+ = IAi/iIA
Genotype of child with blood group O+ = ii
Hence only ‘A’ is correct.
- 75 -
NEET (UG)-2024 (Code-R5)
191. Match List I with List II:
List I List II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA
Choose the correct answer from the options given below :
(1) A-III, B-II, C-IV, D-I
(2) A-III, B-IV, C-I, D-II
(3) A-IV, B-III, C-I, D-II
(4) A-II, B-IV, C-I, D-III
Answer (3)
Sol. • In eukaryotes, RNA polymerase III codes for snRNAs, tRNA and 5s rRNA.
• Splicing of exons is performed by snRNPs.
• TATA box is present in promoter region of transcription unit.
• Rho factor is responsible for termination of transcription.
192. Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.
In the light of the above statements, choose the mis appropriate answer from the options given below:
(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement Il is incorrect.
(3) Statement I is incorrect but Statement Il is correct.
(4) Both Statement I and Statement II are correct.
Answer (2)
Sol. Both mitochondria and chloroplasts are double membrane bound cell organelles.
Transport of ions occurs across the inner membrane of mitochondria. The inner membrane of chloroplast
is impermeable to ions and metabolites. Therefore, it is said that inner membrane of mitochondria is
relatively more permeable to that of chloroplast.
193. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
- 76 -
NEET (UG)-2024 (Code-R5)
Answer (4)
Sol. The correct answer is option no. (4) as
- 77 -
NEET (UG)-2024 (Code-R5)
196. Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below :
(1) A, E, B, D, C
(2) B, A, C, D, E
(3) E, D, C, B, A
(4) E, A, D, C, B
Answer (4)
Sol. The correct answer is option (4) which is E, A, D, C, B.
The catalytic cycle of an enzyme action can be described in the following steps.
(1) The binding of the substrate induces the enzyme to alter its shape, fitting more tightly around the
substrate.
(2) The active site of the enzyme, now in close proximity of the substrate breaks the chemical bonds of the
substrate and the new enzyme-product complex is formed.
(3) The enzyme releases the products of the reaction and the free enzyme is ready to bind to another
molecule of the substrate and run through the catalytic cycle once again.
(4) First, the substrate binds to the active site of the enzyme, fitting into the active site.
Options (1), (2) and (3) are incorrect as the steps mentioned are in the wrong sequence.
197. Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.
Answer (2)
Sol. The correct answer is option (2) as statement I is correct but statement II is incorrect.
In human brain, a deep cleft divides the cerebrum longitudinally into two halves, which are termed as the
left and right cerebral hemispheres. The cerebral hemispheres are connected by a tract of nerve fibres
called corpus callosum.
Three major regions make up the brain stem i.e. mid brain, pons and medulla oblongata.
Cerebrum is a part of forebrain which does not form brain stem.
Options (1), (3) and (4) are incorrect.
- 78 -
NEET (UG)-2024 (Code-R5)
198. Match List I with List II :
List I List II
A. Exophthalmic goiter I. Excess secretion of cortisol, moon face & hypergylcemia.
B. Acromegaly II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing’s syndrome III. Hyper secretion of thyroid hormone & protruding eye
balls.
D. Cretinism IV. Excessive secretion of growth hormone.
Choose the correct answer from the options given below :
(1) A-IV, B-II, C-I, D-III
(2) A-III, B-IV, C-II, D-I
(3) A-III, B-IV, C-I, D-II
(4) A-I, B-III, C-II, D-IV
Answer (3)
Sol. The correct answer is option no. (3) as
(A) Exophthalmic goiter (III) Hyper secretion of thyroid
hormone and characterized by protruding eye
balls
(B) Acromegaly (IV) Excessive secretion of growth hormone
(C) Cushing’s syndrome (I) Excess secretion of cortisol, moon face and
hyperglycaemia
(D) Cretinism (II) Hypo-secretion of thyroid hormone and
characterized by stunted growth
199. Match List I with List II:
List I List II
A. Unicellular glandular epithelium I. Salivary glands
B. Compound epithelium II. Pancreas
C. Multicellular glandular epithelium III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium IV. Moist surface of buccal cavity
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-I, D-II
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-I, C-IV, D-III
(4) A-II, B-I, C-III, D-IV
Answer (2)
Sol. The correct answer is option no. (2) as
A. Unicellular glandular epithelium (III) Goblet cells of alimentary canal
B. Compound epithelium (IV) Lines moist surface of buccal cavity
C. Multicellular glandular epithelium (i) Salivary glands
D. Endocrine glandular epithelium (II) Pancreas
- 79 -
NEET (UG)-2024 (Code-R5)
200. Match List I with List II:
List I List II
A. Mesozoic Era I. Lower invertebrates
B. Proterozoic Era II. Fish & Amphibia
C. Cenozoic Era III. Birds & Reptiles
D. Paleozoic Era IV. Mammals
Choose the correct answer from the options given below :
(1) A-III, B-I, C-II, D-IV
(2) A-I, B-II, C-IV, D-III
(3) A-III, B-I, C-IV, D-II
(4) A-II, B-I, C-III, D-IV
Answer (3)
Sol. The correct answer is option no. (3)
(A) Mesozoic Era – (III) Birds & Reptiles
(B) Proterozoic Era – (I) Lower invertebrates
(C) Cenozoic Era – (IV) Mammals
(D) Paleozoic Era – (II) Fish & Amphibia
❑ ❑ ❑
- 80 -