Methods in

Molecular Biology 2685

Catherine Cupples Connon Editor

Forensic DNA
Analysis
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
 Forensic DNA Analysis

Methods and Protocols

Edited by

Catherine Cupples Connon

Department of Forensic Science, Virginia Commonwealth University, Richmond, VA, USA
Editor
Catherine Cupples Connon
Department of Forensic Science
Virginia Commonwealth University
Richmond, VA, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-3294-9 ISBN 978-1-0716-3295-6 (eBook)
https://doi.org/10.1007/978-1-0716-3295-6
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface

This volume of the well-known Methods in Molecular Biology series will focus exclusively
on methods specific to forensic DNA analysis. Included in this series is a comprehensive
collection of extraction, quantification, STR amplification, and detection methods for
routine forensic samples, including a variety of manual, semi-automated, and automated
procedures using both home-brew and commercial products. Also included are protocols
for a probabilistic modeling software and specialized start-to-finish procedures for mito-
chondrial DNA analysis, archived latent fingerprints, latent DNA, rapid DNA profiling, and
next-generation sequencing. This is truly a one-of-a-kind compilation of forensic DNA
analysis procedures that will be the definitive laboratory protocol resource for all forensic
DNA laboratories.

Richmond, VA, USA Catherine Cupples Connon

v
Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

PART I INTRODUCTION

1 Forensic DNA Analysis: An Overview of the Laboratory Process. . . . . . . . . . . . . . 3

Catherine Cupples Connon

PART II DNA EXTRACTION AND PURIFICATION

2 Organic Extraction of Nucleic Acids Using Ethanol Precipitation
or Microcon® Centrifugal Filter Purification Methods . . . . . . . . . . . . . . . . . . . . . . . 23
Carolyn A. Lewis
3 Manual Silica-Based DNA Extractions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Catherine Cupples Connon
4 Applied Biosystems™ PrepFiler™ Forensic DNA Extraction
Kit (Manual and Semi-automated via AutoMate Express™). . . . . . . . . . . . . . . . . . . 53
Megan M. Foley
5 Robotic DNA Extraction Utilizing Qiagen BioSprint® 96 Workstation . . . . . . . . 83
Brittany Ziencik
6 DNA Extraction of Bone Through Demineralization . . . . . . . . . . . . . . . . . . . . . . . . 93
Brandi L. Iorio and Ashley M. Cooley
7 Differential Extraction with Purification via Organic/Microcon®
and Promega DNA IQ™ Methods. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
Jonathan Forsberg and Caitlin Ayoub
8 DNA Purification from Bloodstains and Buccal Cells/Saliva
on FTA® Cards . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
Brittany C. Hudson and Catherine Cupples Connon

PART III DNA QUANTIFICATION

9 Yield Gel via Quantitative Gel Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129

Victoria R. Parks and Dayanara A. Torres
10 Quantitative PCR of Alu Repeats Using PowerUp™ SYBR® Green
Master Mix. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
Sierra L. Laveroni and Victoria R. Parks
11 Quantitation of DNA Using the Applied Biosystems Quantifiler®
Trio DNA Quantification Kit. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
Kelly L. Knight, Angelina Mauriello, and Georgia Williams
12 QIAGEN’s Investigator® Quantiplex® Pro Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189
Michelle D. Bonnette

vii
viii Contents

PART IV STR AMPLIFICATION

13 DNA Amplification Using Promega’s PowerPlex® Fusion Systems

(5C and 6C) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207
Caitlin McCaughan and Kristy A. Lenz
14 Amplification of Extracted DNA and Direct Amplification
with the PowerPlex® Y23 System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
Jonelle M. Thompson
15 Applied Biosystems’ GlobalFiler™ PCR Amplification Kit . . . . . . . . . . . . . . . . . . . 241
Georgia Williams, Megan M. Foley, and Kelly L. Knight
16 QIAGEN’s Investigator® 24plex QS and GO! PCR Amplification . . . . . . . . . . . . 253
Michelle D. Bonnette
17 Low Volume STR Amplification Options: Coupling with Standard
or Fast PCR, Traditional or Normalized DNA Extraction,
and/or Traditional or Alternative Capillary Electrophoresis . . . . . . . . . . . . . . . . . . 263
Catherine Cupples Connon

PART V STR PROFILE DETECTION AND INTERPRETATION

18 Capillary Electrophoresis with Applied Biosystems’ 3500 Genetic

Analyzer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
Kara Kovach
19 Likelihood Ratio Calculation Using LRmix Studio . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Megan M. Foley

PART VI SPECIALIZED SAMPLES

20 Mitochondrial DNA Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331

Ashley M. Cooley
21 An Optimized Forensic DNA Analysis Workflow for Obtaining
STR Results from Archived Latent Fingerprints . . . . . . . . . . . . . . . . . . . . . . . . . . . . 351
April D. Solomon
22 Detection of Latent DNA Using a DNA Binding Dye. . . . . . . . . . . . . . . . . . . . . . . 359
Adrian Linacre and Piyamas Petcharoen
23 Rapid DNA Profile Development with Applied Biosystems
RapidHIT™ ID System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
Megan M. Foley
24 Next-Generation Sequencing: ForenSeq™ DNA Signature
Prep Kit with the Illumina MiSeq FGx . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 397
Megan M. Foley

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 429
Contributors

CAITLIN AYOUB • Virginia Department of Forensic Science, Richmond, VA, USA

MICHELLE D. BONNETTE • InVita Healthcare Technologies, Jacksonville Beach, FL, USA
CATHERINE CUPPLES CONNON • Department of Forensic Science, Virginia Commonwealth
University, Richmond, VA, USA
ASHLEY M. COOLEY • Virginia Department of Forensic Science, Richmond, VA, USA
MEGAN M. FOLEY • Department of Forensic Sciences, The George Washington University,
Washington, DC, USA
JONATHAN FORSBERG • Virginia Department of Forensic Science, Richmond, VA, USA
BRITTANY C. HUDSON • Department of Forensic Science, Virginia Commonwealth
University, Richmond, VA, USA; Integrative Life Sciences, Virginia Commonwealth
University, Richmond, VA, USA
BRANDI L. IORIO • Virginia Department of Forensic Science, Richmond, VA, USA
KELLY L. KNIGHT • Forensic Science Program, George Mason University, Fairfax, VA, USA
KARA KOVACH • Erie County Central Police Services Forensic Laboratory, Buffalo, NY, USA
SIERRA L. LAVERONI • Department of Forensic Science, Virginia Commonwealth University,
Richmond, VA, USA
KRISTY A. LENZ • Promega Corporation, Madison, WI, USA
CAROLYN A. LEWIS • Department of Forensic Science, Virginia Commonwealth University,
Richmond, VA, USA; Integrative Life Sciences, Virginia Commonwealth University,
Richmond, VA, USA
ADRIAN LINACRE • Forensic DNA Technology, College of Science and Engineering, Flinders
University, Adelaide, SA, Australia
ANGELINA MAURIELLO • Forensic Science Program, George Mason University, Fairfax, VA,
USA
CAITLIN MCCAUGHAN • Bexar County Criminal Investigation Lab, San Antonio, TX, USA
VICTORIA R. PARKS • Department of Forensic Science, Virginia Commonwealth University,
Richmond, VA, USA
PIYAMAS PETCHAROEN • Forensic Technology and Innovation Module, School of Biology,
Institute of Science, Suranaree University of Technology, Nakhon Ratchasima, Thailand
APRIL D. SOLOMON • Jefferson Parish Sheriff’s Office Regional DNA Laboratory, Harvey,
LA, USA
JONELLE M. THOMPSON • Promega Corporation, Madison, WI, USA
DAYANARA A. TORRES • Department of Forensic Science, Virginia Commonwealth University,
Richmond, VA, USA
GEORGIA WILLIAMS • Forensic Science Program, George Mason University, Fairfax, VA, USA
BRITTANY ZIENCIK • Virginia Department of Forensic Science, Richmond, VA, USA

ix
 Part I

Introduction
 Chapter 1

Forensic DNA Analysis: An Overview of the Laboratory

Process
Catherine Cupples Connon

Abstract
Developing a suitable DNA profile from forensic evidence has long been a lengthy, multi-step laboratory
process. Over the last couple of decades, the “process” has exploded into a plethora of numerous options
for each of the individual steps, including different manufacturers and commercial kits, as well as options for
manual, semi-automated, and automated processing. Despite these options, the heart of the big picture
process remains fairly consistent with its early 2000s counterpart and is deeply embedded with a wide variety
of precautions to help prevent contamination and ensure integrous results. This includes habitual cleaning,
wearing personal protective equipment (PPE), using sterile products and reagents, processing controls, and
employing strategic laboratory practices. This chapter serves to briefly introduce new audiences to the
forensic DNA process, particularly from a laboratory perspective. Invaluable information regarding routine
precautions is included here, and it is highly recommended that this chapter be read first, as much of the
information applies to nearly all the chapters of this text.

Key words Forensic DNA, Quality assurance, Quality control, Personal protective equipment, Pre-
cautions, Controls, Contamination

1 Introduction

The typical, modern laboratory process used to develop a DNA

profile for human identification purposes from forensic evidence
takes about a day or two—a vast improvement from decades earlier.
Following an initial screening process, items that are deemed likely
to yield a probative DNA profile are continued on to DNA extrac-
tion and purification, quantification, amplification of short tandem
repeat (STR) loci, and profile detection via capillary electrophore-
sis. The resulting DNA—or more specifically, STR—profiles are
then analyzed for accuracy, followed by comparison to profiles of
other evidentiary items to form conclusions about the origins of
DNA located on such items. Given that items of this nature tend to
be highly compromised (e.g., little and/or low-quality DNA) and
we are dealing with an alleged criminal act, it is of the utmost

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

3
4 Catherine Cupples Connon

importance for the forensic scientist to do everything possible to

ensure the integrity of the evidence. This includes handling it with
care so as not to waste, lose, contaminate, degrade, or otherwise
further compromise the precious DNA. Many of these precautions
are common laboratory practices for similar fields (e.g., a clinical
setting), and their importance is made extremely clear by the fact
that the forensic DNA community has strict, thorough quality
assurance standards [1–3].
Furthermore, as technology has advanced, a variety of proce-
dural options have come to the forefront, and laboratories have the
benefit of piecing together the extraction, quantitation, amplifica-
tion, detection, and even analysis software methods of their choos-
ing. This includes not only a variety of manual, semi-automated,
and automated procedures, but also the selection of commercial
products and instruments from a variety of well-established manu-
facturers, such as Applied Biosystems, Promega, and Qiagen.

2 Universal Precautions Against Contamination and Compromise

Technological advancements have made the DNA profiling process

extremely sensitive, furthering the need to take extreme precau-
tions against contamination. General “universal precautions” are
taken such that the analyst should assume that they will (inadver-
tently) contaminate the evidence item if they are not immensely
careful and that the evidence itself is highly infectious with a life-
threatening agent. Yes, all very extreme scenarios; however, they are
intended to make the analyst recognize not only how important
these precautions are but also to strictly adhere to them.
There is a laundry list of precautions that we always adhere to as
forensic DNA analysts: restrict access to work areas to authorized
personnel only; physically partition work areas based on tasks per-
formed (e.g., pre-amplification and post-amplification); wear PPE;
clean our workspace, equipment, and instrumentation before and
after use; use sterile plastics, reagents, etc.; handle one sample at a
time; and utilize controls. It is the laboratory’s responsibility to not
only precisely define how these precautions will be employed but
also ensure that analysts are trained and monitored appropriately.
Laboratory space needs to be secure and restricted to labora-
tory staff and other authorized users. The more human traffic there
is in such spaces, the more likely someone will leave their DNA
behind (see Note 1). Physical separation of work areas may also be
necessary—or at least beneficial—depending on what procedures
are being performed. Forensic standards require physical separation
(i.e., different rooms) of routine DNA casework from DNA data-
basing, as well as separation of rapid DNA profiling from both of
these other testing laboratory spaces [1, 2]. Additionally,
pre-amplification procedures (e.g., sample accessioning, screening,
 Forensic DNA Analysis: An Overview of the Laboratory Process 5

extraction, polymerase chain reaction (PCR) setup, etc.) must be

conducted at different times or in separate spaces from one another,
while the generation and further processing of PCR amplified
product must reside in a completely separate room(s) from
pre-amplification activities [1, 2]. These are routinely referred to
as “pre-amplification” and “post-amplification” laboratory spaces.
Utilizing separate laboratories for different profiling techniques—
such as STR, mitochondrial DNA, and next-generation sequencing
(NGS)—is also highly recommended.
When in the laboratory, individuals should always wear PPE,
including but not limited to lab coat and gloves. No one should
ever touch anything in the laboratory without gloves, as they can
leave trace amounts of their genetic material behind, which could
later be transferred to someone else’s gloves if they happen to come
in contact with the same surface. Once genetic material is on their
gloves, there is a risk that it could then be transferred to an item of
evidence, a reagent, etc., and contaminate the resulting DNA pro-
file. Even when wearing gloves, analysts are not completely safe-
guarded and need to be mindful of what they touch. They should
not touch their face, hair, clothing/shoes, etc. They should be
careful about not touching doorknobs, telephones, personal
items, chair backs, etc. For any of these “touching” events, their
gloves must be changed immediately. Additionally, hair must be
secured, and, in some settings (e.g., mitochondrial DNA analysis),
hair nets must be worn. Legs and feet must be appropriately cov-
ered by pants and shoes (e.g., closed-toe shoes that also cover the
top of the foot, no shorts, etc.). Many laboratories will find it
advantageous to require face coverings/masks, as talking over
and/or near evidence without a face covering can result in inadver-
tent transfer of DNA from small droplets/aerosols of saliva. On a
related note, excessive talking in the laboratory can be distracting
and result in an analyst(s) making some kind of procedural error.
Additionally, sleeve guards and/or shoe coverings may need to be
worn. The latter two items are not as often encountered in a typical
forensic DNA laboratory but may be necessary depending on the
laboratory itself. Safety glasses are also a common form of PPE, but
when employed in a forensic DNA setting, they are usually worn to
protect the wearer from harmful chemicals, infectious agents, etc.,
rather than to protect the evidence from contamination.
DNA laboratories should also have a clear policy regarding a
cleaning/decontamination routine. These can be broken up into
different types of cleaning associated with performing a procedure
versus periodic cleaning (e.g., daily, weekly, monthly, quarterly,
etc.) that is scheduled regardless of whether a laboratory procedure
is going to be/was performed on a given day. If a procedure is to be
performed, the surfaces, equipment (including pipettes, tip boxes,
forceps/tweezers, scissors, etc.), and instruments (e.g., doors, key-
pads/user interface screens/touchpads, etc.) should be
6 Catherine Cupples Connon

decontaminated by thoroughly wiping down with 10% bleach,

followed by 70% ethanol, using a fresh laboratory paper towel for
each. Bench pads (also known as lab soak, lab diapers, etc.) should
be used as a disposable workspace for the procedure, rather than
working directly on the bench itself. These should be changed on
an as-needed basis during the procedure. At the end of the proce-
dure, the bench pad should be discarded, and the bench top,
equipment, and instruments disinfected again with bleach and
ethanol. Equipment (e.g., pipettes, forceps, and scissors) can be
exposed to ultraviolet (UV) light as an additional decontamination
measure; autoclaving is also a decontamination option for some
items (e.g., forceps and scissors).
Plastics, reagents, and other consumables used for forensic
DNA laboratory testing must be sterile—or more precisely, free of
DNA/genetic material—before beginning any procedure. Just
because pipette tips, microcentrifuge tubes, etc., come in a secured
container from the vendor, they are not necessarily free of extrane-
ous DNA. They may have been inappropriately handled at any one
(or more) of numerous stages prior to use in the forensic labora-
tory. The most responsible action is to autoclave these plastics prior
to use and limit handling after that. Never handle these items
without gloves, and never reach into a container of autoclaved
tubes, even when wearing gloves; instead, gently pour out the
number of tubes needed onto a clean lab wipe, cap them, and
arrange them in your tube rack. Never handle a pipette tip directly;
insert the end of the pipette shaft into the opening of the tip while it
is still racked in the tip box and tap down to secure it on to the end
of the pipette. Use of aerosol-barrier pipette tips are also recom-
mended because they protect against small particles (like dust and
aerosols) from falling into the tips and ending up in your reagent/
sample, as well as to protect the end of the pipette shaft itself from
coming into contact with a reagent/sample due to accidental over-
pipetting, bubbles, etc. You should likewise be confident that the
reagents you are using are sterile. These can be purchased sterile
from the vendor or autoclaved after recipient/in-house preparation
(if acceptable for that reagent/container; see Subheading 4.1).
Prior to the use of a critical reagent (see Note 2) with a lot number
that has not been used before, it must be tested to ensure it is not
contaminated and yields the expected results; this is part of the
quality control process [1–3]. It is best practice to make a small
aliquot of a reagent (e.g., ~1–50 mL) for your own personal use
rather than pipetting from the larger stock reagent. This reduces
the risk of contaminating the larger stock reagent; if your small
aliquot becomes contaminated, the contamination is isolated to
that small container and your samples alone. It is good practice to
discard personal aliquots after about a month, or sooner, if needed.
Other consumables, such as cotton swabs for sample collection,
should be sterilized prior to use; it is best to purchase these sterile,
 Forensic DNA Analysis: An Overview of the Laboratory Process 7

rather than attempting to sterilize them in-house. The bottom line

with respect to these consumables is that if you are ever in doubt,
throw it out! It is not worth compromising one or more of your
samples if you suspect you many have contaminated a tip, tube,
reagent, etc.
While working with samples, handle only one sample at a time.
If working with the actual item of evidence, the gloves, scissors,
forceps, bench pad, etc., should be changed/decontaminated
between each item, and the item should be securely returned to
its packaging before proceeding to another item. As cuttings of
these samples are transferred to individual microcentrifuge tubes
for DNA testing, those tubes should be labeled appropriately so
that they can be identified at any given time. Laboratory-approved
worksheets should be prepared for these samples prior to starting a
multi-sample procedure to help guide you along the way and make
sure all samples are processed; these worksheets also help document
in what order samples are processed, as well as where they are
located in a multi-sample plate (e.g., a 96-well plate) or on an
instrument. Individual sample tubes should be checked as you
progress through the procedure to ensure you are always working
with the correct sample. It is a helpful habit to physically move a
sample tube to a different column/row/location of the tube rack
after you have completed a step so that you can keep track of where
you are in the process at any given time. All of these measures help
prevent sample switches.
Handle and pipette into/out of the sample tubes with care.
This includes opening each tube slowly and carefully to prevent
small droplets of liquids (aerosols) from spraying out into the air or
onto your gloves. If this occurs, immediately decontaminate the
affected surface(s) and/or change your gloves. Only one tube
should be open at a time; when opening/closing it, be careful not
to touch the inside of the cap with your glove. If that happens,
change your glove(s) immediately. While the tube is open, be
careful not to spill its contents (immediately clean up, change
bench pad, etc., if this happens) or allow unintended particles to
enter the tube. Working in a chemical fume hood or biosafety
cabinet can help prevent the latter. Never reach over an open
tube, uncovered/exposed sample plate, open box of tips, etc., as
particles from your lab coat could fall into any of these containers or
you could knock the container over and spill its contents. When
pipetting to/from a tube (again, with only one tube open at a
time), pipette slow and steady; be mindful of the first and second
stops of the pipette plunger. Prior to pipetting, it is common
practice to allow the sample/reagent you are pipetting from to
come to room temperature (if previously stored at
20  C, 4  C,
etc.), followed by vortexing and a quick spin. After aspirating
(drawing up liquid into the tip) from that tube, check the volume
of the liquid in the pipette tip to make sure it looks about right for
8 Catherine Cupples Connon

the intended volume, that there are no air bubbles present, etc.
After dispensing the reagent/sample to its intended location, check
the pipette tip again to make sure all was dispensed; pipette just past
the first stop if needed, but be careful not to introduce bubbles. At
this point, it is often appropriate to vortex and quick spin the tube
in which sample/reagent was added (but follow the protocol, as
sometimes this is not the case). Change pipette tips between each
sample/reagent (to help prevent sample-to-sample contamina-
tion), and always keep the tip box closed when not getting a tip
(to help prevent contamination of the tips). If your pipette tip ever
accidently touches something it shouldn’t (e.g., the bench pad,
counter, another tube, your lab coat/glove/hand, etc.), change it
immediately.
The final general precaution that we utilize in forensic DNA
testing is the use of controls. Controls are of known origin and
serve two basic purposes: to ensure that no reagent, other consum-
able, piece of equipment, etc., used in the procedure is contami-
nated and that the procedure worked as expected. The former are
generally categorized as negative controls, while the latter are cate-
gorized as positive controls. Specific controls are introduced at each
step of the DNA analysis process, and many, but not all, are carried
through to the final step.

3 Routine Guidance for DNA Processing

3.1 Separation of Forensic DNA samples can be placed into two broad categories:
Question and question/unknown and reference/known. As the names imply,
Reference Samples some items are of unknown, or questioned, origin, like a red/-
brownish stain suspected to be blood that was collected from a
knife or article of clothing, or a yellowish stain suspected to be a
mixture of semen and vaginal fluid that was collected from the
underwear of a sexual assault victim. On the other hand, some
items are of known origin, as they are collected as reference samples
from a person (hopefully of known identity) either to be used for
comparison purposes in a specific case or to be entered into a DNA
database; these are typically buccal swabs collected from the cheek
area of the inside of the individual’s mouth or as venous blood
collected from their arm. In forensic DNA casework, the DNA
profiles obtained from the question samples are compared to
those obtained from the reference samples in an attempt to deter-
mine the origin of the genetic material from the question samples.
For forensic DNA databasing, the profiles will be stored in a
restricted-access database for subsequent comparisons.
Given the nature of these ultimate goals, it is customary that
question samples are processed prior to and separate from reference
samples. Additionally, question samples tend to be more compro-
mised compared to the generally high-quality and high-quantity
 Forensic DNA Analysis: An Overview of the Laboratory Process 9

reference samples, the latter of which tend to yield high-quality

DNA profiles without as much effort as compared to the lower-
quality question samples. Thus, laboratory procedures for question
samples tend to be designed and optimized for a particular sample
type, whereas the procedures used for reference samples tend to
work for most reference samples (see Note 3).

3.2 DNA Extraction Following screening (see Note 4) and the selection of suitable/
and Purification promising DNA samples, samples should be grouped together by
sample type (question separate from reference), and further
sub-grouped by the extraction process to be utilized. This grouping
is often referred to as a “batch” or a “run” and must contain its own
set of extraction controls [1, 2]. The positive control is of known
origin, and the negative control is a reagent blank; both are pro-
cessed as if they were any other sample, except no DNA/substrate is
added to the reagent blank. The positive control is not required by
the forensic DNA quality assurance standards, but many labora-
tories still choose to process one (see Note 5), while the reagent
blank must be carried through the entire process to capillary elec-
trophoresis detection [1, 2].
A variety of manual and semi-automated extraction methods
are available. Batch sizes are generally limited by the subsequent
DNA quantification step (typically performed on a 96-well format),
equipment (e.g., centrifuge space), and/or semi-automated instru-
ment space (usually 6–16 samples for low-throughout options and
96 samples for high-throughput options).
All of the routine laboratory techniques and universal precau-
tions should be followed (see Subheading 2), especially having only
one tube open at a time. The initial step of nearly all of the
extraction procedures is a cell lysis step that is dependent on
numerous reagents. Rather than adding each reagent one at a
time to each tube, an extraction buffer master mix/cocktail of all
of the reagents can be made. If utilizing this strategy, be sure to
make enough for all samples in the batch (including controls and
accounting for a small amount of extra volume needed due to
pipetting errors) and mix/vortex thoroughly prior to dispensing
to each sample. Moreover, this is a fairly high-risk part of the overall
process with regards to contamination and sample switches. The
lysis process utilizes a detergent, which tends to be bubbly and can
make a mess when pipetting—potentially resulting in reagent com-
ing out of the tube when it is capped—if not careful. There are
many vortexing steps, so it is important to ensure that tubes are
securely closed. Many of the extraction or purification protocols call
for tube transfers, so it is imperative that samples are not only
labeled correctly but also transferred correctly.
10 Catherine Cupples Connon

3.3 DNA Following extraction and purification, the amount of human DNA
Quantification must be determined for question samples prior to continuing on to
profile development [1]. Reference samples can also be quantified
with a human-specific method, bypassing this process entirely, or
use a non-human quantitation method (see Note 6); whichever
option a laboratory chooses, they must validate it [1, 2]. At this
stage, the controls initiated at the extraction process must also be
processed, as well as DNA standards (or a calibrator, if using a
virtual standard curve) [1, 2]. Laboratories can choose to initiate
additional controls at this point, such as a calibrator (positive
control) and/or no template control (NTC; negative control),
which should be processed concurrently with the associated batch
samples. A calibrator is of known origin and DNA concentration.
An NTC is another type of reagent blank that consists of all of the
reagents for the quantitation method but lacks DNA template; no
water or buffer is added in its place. If either of these controls are
employed at this step, they stop here; they are not processed
beyond quantitation.
A variety of commercial products are available for quantifica-
tion of human DNA. Nearly all of these utilize real-time quantita-
tive PCR (qPCR) with a 96-well format thermal cycler enhanced
with an optical filter to detect fluorescence; this is often simply
referred to as a real-time PCR instrument. These “quant” plates
tend to be as close to 96 samples/controls as possible, if not entirely
full, and can be setup manually or via a liquid handler instrument to
pipette the reagents. This is often the result of combining smaller
extraction batches together for a single “quant run.” As a cost-
savings measure, half reactions are often used in place of full
reactions.
All of the routine laboratory techniques and universal precau-
tions should be followed (see Subheading 2), especially avoiding
reaching over an open/exposed 96-well plate. Given the extremely
sensitive nature of PCR, this process should be setup in the protec-
tion of a biological safety cabinet or hood. Additionally, since these
batches tend to fill or nearly fill a 96-well plate, a PCR master mix is
made that consists of all of the necessary components, except for
the DNA template (extract). It is imperative that all reagents are
brought to room temperature, vortexed, and quick-spun prior to
making the master mix (see Note 7). The master mix should be
enough for all samples/controls in the batch and have enough extra
for pipetting error. Similar to the master mix reagents, the DNA
extracts should have time to come to room temperature and should
be vortexed and quick-spun prior to addition to the reaction plate.
Sealing the plate securely with an adhesive film is essential to
prevent evaporation. The plate should be spun in a plate spinner/
centrifuge prior to being loaded on the real-time instrument to
remove bubbles that may have formed during setup. These last two
 Forensic DNA Analysis: An Overview of the Laboratory Process 11

precautions help to ensure that each well of the 96-well plate

undergoes an efficient PCR reaction.

3.4 STR Following quantitation, samples are normalized to a concentration

Amplification that allows a specific nanogram amount (~0.25–1.0) of DNA to be
PCR amplified in order to develop an STR profile that aids in
human identification. Similar to the quantitation step, the reagent
blank from the extraction step must be amplified under the same
conditions as the DNA extracts (see Note 8), and a new set of
controls are initiated at this point, which must be amplified at the
same time as the associated batch samples [1, 2]. The positive
amplification control is of known origin and DNA concentration.
The negative amplification control is another type of reagent blank
that consists of all of the reagents for the amplification method but
lacks a DNA template; whatever is used to normalize/dilute the
DNA extracts for this step (e.g., Type I water or TE
4) is added in
place of DNA to the amplification negative control. Like the
reagent blank from the extraction control, both of these amplifica-
tion controls are carried through the entire process.
Similar to extraction and quantitation, there are numerous
commercial kits available for STR amplification. Most of the auto-
somal STR amplification kits that are currently available target all
20 of the CODIS loci, plus more. Like qPCR, these amplification
batches are limited by the number of wells in the thermal cycler in
which they will be amplified—typically 96 or 384 wells. As a cost-
savings measure, half reactions are often used in place of full reac-
tions for question and/or reference samples. Due to the high-
quality nature of reference samples, reaction volumes as low as
3 μL have been successfully implemented (~1/8th reaction)
[4, 5]. Less than half reactions are generally not suitable for ques-
tion samples due to their compromised nature and potential to
contain DNA from more than one contributor (i.e., a mixture);
both of these lead to peak height imbalances, which are further
exacerbated by low volume reactions, making them unreliable for
such samples.
All of the routine laboratory techniques and universal precau-
tions should be followed (see Subheading 2), especially avoiding
reaching over open tubes or an exposed 96-well plate. Many of the
additional precautions specific to qPCR also apply here (see Sub-
heading 3.3): setting up the reactions in a biological safety cabinet
or hood; strategically preparing a master mix for all samples/con-
trols; securely sealing the amplification plate or individual tubes;
and spinning down the plate/tubes prior to loading on the thermal
cycler.
12 Catherine Cupples Connon

3.5 STR Profile Following STR amplification, the amplification (“amp”) product
Detection needs to be separated based on sized and detected so that the
resulting STR profile can be further reviewed; this takes place via
capillary electrophoresis. At this point, the extraction and amplifi-
cation controls are processed along with the samples (see Note 9).
The positive and negative amplification controls typically serve as
the detection controls as well.
The other specialized reagents for separation and detection are
linked directly to the STR amplification method that was used;
these are typically provided as part of the purchased amplification
STR kit, including an allelic ladder and internal size standard,
though sometimes the size standard is purchased separately. The
most current amplification kits for human identification typically
rely on the use of a 5- or 6-dye system.
All of the routine laboratory techniques and universal precau-
tions should be followed (see Subheading 2), especially avoiding
reaching over an open/exposed 96-well plate. Many of the addi-
tional precautions specific to amplification also apply here (see Sub-
headings 3.3 and 3.4): preparing the amplification product for
detection in a biological safety cabinet or hood; strategically pre-
paring a master mix for all samples/controls; securely sealing the
detection plate with a plate septa; and spinning down the plate prior
to loading on the capillary electrophoresis instrument.

4 Additional Guidance

4.1 Water Water is necessary for a variety of laboratory procedures, including

reagent preparation, sample storage and dilution, etc. Despite its
apparent simplicity, it is imperative that the appropriate water is
used for forensic DNA testing.
Reagent water is classified based on its purity with respect to
properties such as resistivity, conductivity, total organic carbon
(TOC), and bacteria count [6]. The American Society for Testing
and Materials (ASTM) takes most of these properties into consid-
eration when classifying water as Type I, Type II, Type III, and
Type IV, but classifies based on bacteria count separately using
Type A, Type B, and Type C (see Table 1). Each type of water can
be used for various laboratory applications; classifications of A, B,
and C are only assessed on an as-needed basis. For forensic DNA
analysis, Type A is always needed for any application in which the
water is used in conjunction with sample collection or subsequent
testing that leads to a genetic profile. The primary focus here will be
in the discussion of Types I–IV. Of these four types of water, Type I
is the most pure—virtually pure, in fact—with a resistivity of
18–18.3 MΩ-cm at 25  C, conductivity of <0.055 μS/cm, and
total organic carbons (TOC) <10 parts per billion (ppb)
[6, 7]. This type of water is often denoted as ultrapure, analytical
 Forensic DNA Analysis: An Overview of the Laboratory Process 13

Table 1
ASTM classifications of reagent water

Reagent Resistivity Conductivity Total organic Heterotrophic

water (MΩ-cm at 25  C) (μS/cm) carbons (ppb) bacterial count
Type I 18–18.3 <0.056 <50 –
Type II 1–15 <1.0 <50 –
Type III >4 <0.25 <200 –
Type IV >0.2 <5.0 No limit –
Type A – – – <10/1000 mL
Type B – – – <10/100 mL
Type C – – – <100/10 mL
A partial summary of the properties used to classify water by the American Society for Testing and Materials is displayed,
including those most relative to forensic DNA analysis. It should be noted that bacteria count has a separate classification
from the majority of the other properties and is assessed on an as-needed basis. Type I water is the purest reagent water
and is reserved for advanced analytical and molecular applications. Type II water is highly pure but reserved for general
laboratory use. Type III and Type IV water can be used for non-critical laboratory applications

grade, molecular biology grade, amplification grade, etc., and is

reserved for use as a critical reagent in advanced analytical and
molecular biology applications, including PCR amplification and
sequencing [7–9]. Thus, it is the type of water that should be used
for any forensic DNA assay/protocol in which water is considered a
critical reagent (e.g., sample collection, dilutions, and any extrac-
tion, quantification, amplification, detection, or similar assay that
requires the addition of water to the sample substrate, extract,
amplification product, etc.). Type I water is achieved by a complex
combination of purification techniques, such as carbon filtration,
ion exchange, microfiltration, ultrafiltration, and/or ultraviolet
(UV) irradiation [6, 10].
Type II water is highly pure—but not as pure as Type I (see
Table 1)—and is often denoted as general laboratory grade water
[6–9]. In general, it can be utilized for use as a non-critical reagent
(e.g., buffers, pH solutions, culture media, etc.) or as feedwater
that is further purified to produce Type I water. It should not be
used for forensic DNA assays/protocols when water is added
directly to a sample substrate, extract, amplification product, etc.
Type II water is typically produced through a combination of two
forms of purification (e.g., distilled-distilled, reverse osmosis-
deionization, etc.) [6, 11].
Type III water is often denoted as primary grade water and is
suitable for basic, non-critical laboratory applications, such as rins-
ing/washing glassware, water baths, autoclaves, or as feedwater for
Type I/II [7–9]. Type III water is typically achieved after one form
of purification, such as reverse osmosis, deionization, or distillation.
14 Catherine Cupples Connon

Fig. 1 Overview of common names for laboratory water. There are many common names for laboratory water,
which can be confusing when trying to align them with standardized classifications. This figure attempts to
summarize common names used for laboratory water, the methods used to achieve them, and how they are
classified based on the ASTM

Type IV water is the least pure of the reagent water classifica-

tions, and it is typically used only as feedwater to yield a purer form
of water [7–9]. Similar to Type III water, Type IV is often achieved
after one form of purification, such as reverse osmosis, deioniza-
tion, or distillation.
There are a variety of common names by which water goes by in
a laboratory setting; these are typically tied to the water purification
process used (see Fig. 1). These methods are often used in combi-
nation with one another to achieve higher levels of purity. Common
purification methods include sterilization, distillation, reverse
osmosis, and deionization. Sterile water, as the name implies, can
be achieved via sterilization processes like boiling, autoclaving,
ozonation, chlorination, and/or UV irradiation, which result in
killing living microorganisms (viruses, bacteria, fungi, spores,
etc.), denaturing proteins, and degrading DNA to small fragments
[10, 12, 13]. Note that sterilization does not remove these particles
but rather makes them non-viable. If water is only sterilized, it likely
would not even classify as Type IV (but depends on the feedwater
source) and is highly susceptible to contamination because bacteria
can easily thrive on the content in the water and reproduce.
Though “sterile” water is often listed for use in forensic DNA
assays/protocols, this typically isn’t the only form of purification
the water was subjected to. When referred to in such protocols, it’s
 Forensic DNA Analysis: An Overview of the Laboratory Process 15

likely asking for a Type I water that has also been subsequently
autoclaved (i.e., sterilized) to safeguard against microorganism
contamination that could have been introduced during the bottling
process.
Distilled water (aka dH2O) is produced via distillation, which is
the process of boiling water into vapor and then condensing it back
into a liquid form in a separate container [6, 14]. This form of
purification leaves water free of most organic and inorganic con-
taminants, but volatile impurities remain (e.g., CO2, ammonia,
silicon dioxide, some organics, etc.). Similar to sterile water, it is
at high risk for bacterial contamination, as bacteria can easily repro-
duce given the impurities that remain. This water is also conductive.
Though it is more pure than sterile water, it is not a great long-
term, pure water source. The distillation process usually yields Type
III or IV water, which is a good feedwater source for additional
purification measures to achieve higher levels of purity. In fact,
double-distilled (aka distilled-distilled, distillation-distillation, or
ddH2O) water undergoes a second round of distillation to yield
water that has very low levels of organic/inorganic contaminants,
microorganisms, soluble gases, and volatile impurities. It is more
pure than sterile, distilled, and reverse osmosis water and is classi-
fied as Type II water.
Reverse osmosis (RO) water is produced via a process that relies
on the principles of osmosis through a fine membrane with pore
sizes of ~10–100 Å [6, 14]. This purification process removes
90–99% of organic and inorganic impurities. Though it is more
pure than distilled water, it typically results in Type III or even Type
IV water. RO water is a typical feedwater source for Type I and II
water and is often suitable for non-critical laboratory applications.
Deionized water that is available from a “DI” tap in a labora-
tory has actually undergone more than just a deionization process
so that it can achieve Type II purity and be suitable for a variety of
laboratory applications that do not require Type I purity. Also
known as DI water or diH2O, the process begins with a relatively
pure feedwater source (e.g., RO water) and subjects that to an ion
exchange purification process [6, 11, 14]. Though there are a
variety of ion exchange processes, they all work under the same
basic principles to attract, remove, and replace ions with H+ and
OH
, which ultimately combine to form more water molecules.
This leaves the water free of nearly all organic and inorganic con-
taminants. It should be noted that the deionization process alone
does not generate DI water as we know it (a Type II water), but
rather it is achieved through the deionization of an already purified
feedwater source.
Another common misconception about DI water is that it can
be collected from the DI tap and autoclaved to make Type I-sterile
water with the intent of using it as a critical reagent for forensic
DNA assays like PCR amplification. This is incorrect, as the act of
16 Catherine Cupples Connon

autoclaving DI water will not make its purity increase from Type II
to Type I, as defined by the ASTM. Instead, it would remain Type
II and, therefore, would not be suitable for advanced molecular
applications such as PCR amplification due to the presence of
inorganic impurities. This should not discourage laboratories
from autoclaving DI water that is bottled for use from the DI tap.
This is indeed a good practice to ensure that microorganisms and
other organic contaminants that were introduced during the bot-
tling process were in turn rendered non-viable. However, the purity
of the water will remain as Type II.
This leads us to ultrapure water, the highly sought after, purest
form of water that we can use with our precious DNA samples.
However, there is not one pathway to ultrapure water. Ultrapure
water can be achieved through a variety of ways, but the common-
ality between all of these possibilities is that they all utilize a com-
plex combination of several forms of water purification, such as
carbon filtration, ion exchange, microfiltration, ultrafiltration,
and/or UV irradiation [6–10]. This pathway to ultra-purity often
begins with RO water as the feedwater source and, in the end, can
be classified as both Type I and Type A water, as defined by the
ASTM. Similar to autoclaving DI water after bottling it out of the
DI tap, it is good laboratory practice to autoclave ultrapure water
after it has been collected from the filtration system to safeguard
against contaminants that may have been introduced during the
bottling process.
Achieving water that is pure for our laboratory standards is a
lengthy and complex task, especially when we seek Type I, ultrapure
water. In addition to autoclaving after the bottling process, best
practices include using small aliquots of the purified water to help
reduce the risk of contamination to the stock bottle that is in use for
the laboratory. Each user should have their own aliquot, which
should be discarded after about a month.

4.2 Tris-EDTA (TE) Tris-EDTA (TE) buffer is a common buffer used in molecular
Buffer Versus Water biology applications, including forensic DNA assays. It is a stable
buffer and offers DNA as good or better protection during storage
compared to (Type I) water. There are two common preparations
of TE buffer: TE (aka TE
1), which is 10 mM Tris-HCl and 1 mM
EDTA; and low TE (aka low EDTA TE, TE low EDTA, TE
4,
etc.), which is 10 mM Tris-HCl and 0.1 mM EDTA. The main
difference is that the amount of EDTA is tenfold higher in TE
compared to low TE. It can be confusing when referring to the
buffer as TE
1 or TE
4, as the tenfold difference in EDTA is not
readily apparent with these notations. The “–1” in the former
indicates that the concentration of EDTA is tenfold less than Tris-
HCl in that preparation, whereas the “–4” in the latter indicates the
final concentration of EDTA relative to the entire buffer.
 Forensic DNA Analysis: An Overview of the Laboratory Process 17

Sometimes these preparations can be interchanged without

much harm, but other times not. EDTA is a chelating agent;
depending on the assay, sometimes more or less EDTA is needed,
and the appropriate buffer needs to be used. EDTA’s chelating
properties are often helpful, like when it chelates Mg++ and prevents
the activation of many enzymes, including general nucleases,
DNases, and RNases that degrade DNA/RNA. On the other
hand, sometimes EDTA’s chelating properties work against the
assay—e.g., when Mg++ is needed to activate other enzymes, like
polymerases that are necessary for PCR amplification. In this situa-
tion, less EDTA is better so that Mg++ is free to interact with the
polymerases. In situations like the former, use of TE is more appro-
priate, whereas situations like the latter, use of low TE (or just
water!) is better suited. In fact, use of TE instead of low TE in
assays such as PCR amplification can lead to PCR inhibition due to
insufficient polymerase activation.
For assays that could be sensitive to the presence of EDTA in a
TE/low TE buffer, some laboratories have chosen to use water
instead to eliminate the potential impacts of EDTA. However, if the
stability of the DNA is in question, this may not be the best choice.
DNA is often more stable in a TE/low TE buffer compared to
water, but time and temperature also play an important role in
stability. DNA can be stable in water for short periods of time at
2–8  C or even room temperature, as well as long periods of time at

20  C to
80  C. Its stability is generally as good or better if
stored in TE/low TE in all of these conditions, but it is difficult to
ascertain how much better, if at all.
It is common practice to elute DNA in TE during the final steps
of a DNA extraction to offer stability to the DNA while it is being
stored (
20 or 2–8  C) and awaiting further testing. Laboratories
have also demonstrated that high-quality DNA (e.g., single-source
reference samples) can be eluted in water at the end of the extrac-
tion process if the extracts will be processed very quickly (less than a
week, with storage at 2–8  C when not in use) and discarded after
use. It is also common practice to utilize low TE or Type I water for
assays involving PCR amplification (e.g., diluting samples and/or
as part of the amplification master mix); TE should not be used
with amplification assays. If in doubt, inquire whether TE, low TE,
or Type I water should be used for a particular assay.

5 Summary

In summary, the forensic DNA analysis process has become more

advanced and complex over the decades, leading to an increased
need to safeguard against further compromising DNA samples, as
well as selecting methods (and reagents) that work in concert with
one another. It is vital for a laboratory to have appropriate quality
18 Catherine Cupples Connon

assurance and quality control measures in place to ensure the

production of integrous results. If a laboratory desires to make a
change to any part of their overall process, the entire process must
be examined to confirm that there are no negative impacts.

6 Notes

1. In the event that unauthorized individuals enter the laboratory

space, or individuals enter without appropriate PPE, a thor-
ough decontamination must be performed before casework
can be processed again. This includes cleaning all surfaces,
door/drawer pulls, etc., with 10% bleach, followed by 70%
ethanol. The same decontamination practice can be employed
for any equipment or instrumentation that may have been
touched. Ideally, the laboratory will be equipped with overhead
ultraviolet (UV) lighting, and the entire room can be UV
sterilized for 15–60 min, depending on the strength of the
lighting. After the decontamination has taken place, the room
should be spot-checked for trace amounts of DNA by ran-
domly sampling a variety of surfaces, handles, etc., and
attempting to develop a DNA profile from them. Assuming
that all of these come back clean, casework can resume. If not
all clean, repeat the decontamination process and check for
genetic material again.
2. A critical reagent is defined as “those whose performance is
vital to the success of the DNA testing and require testing on
known samples before use” on forensic casework or database
samples [1, 2].
3. Different protocols for reference samples tend to arise based on
the collection substrate (swab versus lytic/non-lytic punch)
rather than due to the quality of the sample. However, blood
introduces some other minor challenges, such as the
PCR-inhibitor heme, but this is easy to remedy.
4. Screening is a term used in the forensic biology/DNA process
that is associated with examining question/unknown eviden-
tiary items to assess whether body fluids are (potentially) pres-
ent and whether they are good candidates for DNA testing.
Screening can also be more precisely described as “serological”
screening since there is a heavy emphasis on body fluid detec-
tion/identification.
5. The FBI quality assurance standards do not require that a
positive extraction control be processed at the extraction
stage. A laboratory can still decide to include this as part of
their standard operating procedure (SOP). If using a positive
extraction control, the relevant SOPs must clearly define
 Forensic DNA Analysis: An Overview of the Laboratory Process 19

through which processes the control is carried through. Some

laboratories have chosen to only carry this control through to
the DNA quantification step to confirm that DNA was recov-
ered during the extraction, while other laboratories process this
control all the way through profile detection via capillary
electrophoresis.
6. Reference samples (from casework or databasing) do not nec-
essarily need to undergo a human-specific (or any, for that
matter) DNA quantitation method if the laboratory has a
validated process that skips over this step; this does not apply
to question/unknown evidentiary items. This would include,
but is not limited to, direct amplification workflows or those
that utilize samples deposited on FTA® Cards.
7. These PCR reagents are light and temperature sensitive. Han-
dle with care and do not expose to light or room temperature
for too long. Exposure to these conditions for about an hour is
okay, which is plenty of time to manually setup a full 96-well
plate.
8. The reagent blank does not have to be amplified at the same
time as the DNA extracts it is associated with, although it is
ideal to do so; it must be amplified using the same amplification
chemistry (kit), PCR parameters, etc., and detected using the
same detection parameters as the evidence samples it corre-
sponds to. If utilized, the positive control from the extraction
step can be amplified (if the laboratory decides that is their
policy), but it is not required by the FBI quality assurance
standards [1, 2].
9. This includes the reagent blank, positive amplification control,
and negative amplification control [1, 2]. If a laboratory
employs a positive extraction control and chooses to amplify
it per their standard process, then it should be carried through
detection as well so that the STR profile can be reviewed.

References

1. Federal Bureau of Investigation (2020) Quality 3. Federal Bureau of Investigation (2020) Stan-
Assurance Standards for Forensic DNA Testing dards for the Operation of Rapid DNA Book-
Laboratories. Available via the Federal Bureau ing Systems by Law Enforcement Booking
of Investigation. https://www.fbi.gov/file- Agencies. Available via the Federal Bureau of
repository/quality-assurance-standards-for- Investigation. https://www.fbi.gov/file-reposi
forensic-dna-testing-laboratories.pdf/view. tory/standards-for-operation-of-rapid-dna-
Accessed 19 July 2022 booking-systems-by-law-enforcement-book
2. Federal Bureau of Investigation (2020) Quality ing-agencies-eff-090120.pdf. Accessed
Assurance Standards for Forensic DNA Data- 19 July 2022
basing Laboratories. Available via the Federal 4. Connon CC, LeFebvre AK, Benjamin RC
Bureau of Investigation. https://www.fbi.gov/ (2016) Validation of low volume, fast PCR
file-repository/quality-assurance-standards- amplification of STR loci for DNA reference
for-dna-databasing-laboratories.pdf. Accessed samples. J Forensic Legal Investig Sci.
19 July 2022
20 Catherine Cupples Connon

https://doi.org/10.24966/FLIS-733X/ pure-water-lab-what-you-need-know.
100008 Accessed 21 July 2022
5. Connon CC, LeFebvre AK, Benjamin RC 10. SMACgig Technologies (2022) Methods for
(2016) Development of a normalized extrac- making Type1 (Ultrapure) water. Available via
tion to further aid in fast, high-throughput SMAC g i g Technologies. https://www.
processing of forensic DNA reference samples. smacgigworld.com/blog/methods-for-
Forensic Sci Int Genet 25:112–124. https:// making-ultrapure-type1-water.php. Accessed
doi.org/10.1016/j.fsigen.2016.07.019 21 July 2022
6. American Society for Testing and Materials 11. PureTec Industrial Water (2022) What is Deio-
(2017) Standard specification for reagent nized Water? Available via PureTec Industrial
water. Available via ASTM International. Water. https://puretecwater.com/deionized-
https://www.astm.org/d1193-99e01.html. water/what-is-deionized-water#:~:
Accessed 21 July 2022 text¼Demineralization%20therefore%20
7. Burdg J (2015) Infographic: What water type requires%20using%20at,is%20always%20first%
should I use? Available via LabConco. https:// 20in%20line. Accessed 21 July 2022
www.labconco.com/articles/water-type-differ 12. Grainger (2020) How Does Autoclave
ence. Accessed 21 July 2022 Sterilization Work? Available via Grainger.
8. Red T (2017) Ultra pure vs feed water, com- https://www.grainger.com/know-how/equip
paring the 4 types of laboratory water. Avail- ment-information/kh-how-does-autoclave-
able via Technology Networks. https://www. sterilization-work. Accessed 21 July 2022
technologynetworks.com/immunology/ 13. Environmental Protection Agency (1999)
lists/4-types-of-laboratory-water-made-sim Wastewater Technology Fact Sheet: Ozone
ple-293547. Accessed 21 July 2022 Disinfection. Available via Environmental Pro-
9. ELGA LabWater (2021) Different types of tection Agency. https://www3.epa.gov/
pure water for the lab: what you need to npdes/pubs/ozon.pdf. Accessed 21 July 2022
know. Available via ELGA LabWater. https:// 14. Wikipedia (2022) Purified water. Available via
www.elgalabwater.com/blog/different-types- Wikipedia. https://en.wikipedia.org/wiki/
Purified_water. Accessed 21 July 2022
 Part II

DNA Extraction and Purification

 Chapter 2

Organic Extraction of Nucleic Acids Using Ethanol

Precipitation or Microcon® Centrifugal Filter Purification
Methods
Carolyn A. Lewis

Abstract
The use of organic solvents to separate nucleic acids from other cell components is a common practice
among many scientific fields, including molecular biology and biochemistry. The advantage of performing
organic extractions in forensic DNA analysis is the ability to purify DNA from heavily degraded or
inhibitory sample types, such as skeletal remains. These sample types require special care to ensure that
the DNA is contaminant-free since they often contain PCR inhibitors that negatively impact downstream
DNA analysis, resulting in unobtainable or uninterpretable short tandem repeat (STR) profiles. Purification
of DNA after an organic isolation procedure is essential for improving the likelihood of obtaining valid STR
profile from a challenging evidence sample. This chapter describes the methodology for extracting and
purifying DNA from various types of challenging samples that are often encountered in forensic casework.

Key words Forensic science, DNA extraction, Organic extraction, Ethanol precipitation, Microcon®
centrifugal filter purification, Differential extraction

1 Introduction

Organic solvents have long been used to isolate nucleic acids from
other cell components for downstream analyses. In general, the
method involves the use of heat, detergents, chelating agents, and
proteolytic enzymes followed by phenol:chloroform and aqueous
phase separation [1, 2]. Cell components are separated into layers
based on solubility, and thus, the organic layer contains lipids and
proteins while nucleic acids (RNA and DNA) remain in the aque-
ous layer [3]. However, the aqueous layer may also contain water-
soluble PCR inhibitors; therefore, additional purification is often
performed to ensure downstream analyses are feasible. Ethanol
precipitation of DNA is a traditional purification method used to
remove salts or other possible contaminants; however, size-based

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_2,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

23
24 Carolyn A. Lewis

centrifugal filtration has become increasingly popular in the foren-

sic community due to its ease of use in high-throughput workflows.
In forensic DNA analysis, organic extraction methods are most
commonly used for challenging samples that contain trace amounts
of DNA or that likely contain PCR inhibitors, such as skeletal
remains (bones and teeth) [4]. It is also common practice to
perform a “differential” organic extraction on evidence samples
that are thought to contain a mixture of epithelial and sperm
cells, often observed in sexual assault cases. While the main purpose
of using organic solvents for challenging samples is to remove
impurities, an additional goal of a differential extraction procedure
is a manual attempt to separate sperm cells from non-sperm cells,
which can ease the downstream interpretation of DNA profiles of
multiple contributors [5].
It is important to keep in mind that this protocol was written
for general use in the forensic molecular biology community and
that each forensic laboratory has specific quality assurance, quality
control, and methodology protocols that have been internally vali-
dated for processing evidentiary samples.

2 Materials

Some materials are only required for certain sample types (bones
and teeth). Prior to starting the procedure, review the protocol for
sample type being extracted to determine which materials are
needed and carefully read all precautions that should be taken
during this procedure (see Notes 1–5). All plastic consumables
should be autoclaved prior to use to sterilize. All reagents should
be prepared with sterile, Type I water.

2.1 Equipment 1. Microcentrifuge: Needs a rotor compatible with 2.0 mL tubes

and a maximum centrifugal force of
17,000  g. Temperature
control (4  C) is needed for the ethanol precipitation
procedure only.
2. Biosafety cabinet/hood.
3. Chemical fume hood.
4. Hammer and rotary tool with flexible shaft and heavy cut-off
wheel (for teeth only).
5. High-speed electric drill with drill bits (for bone only).

2.2 Consumables 1. Spin baskets.

2. Microcon® 100 kDa centrifugal filters.
 Organic Extraction—Ethanol and Microcon Purification 25

2.3 Reagents 1. 95–100% ethanol: Ice cold, for ethanol precipitation only.
Store between 2  C and 8  C.
2. Stain extraction buffer: Prepare 10 mM Tris-HCl, 10 mM
EDTA, 0.1 M NaCl, and 2% SDS. Mix until dissolved, and
adjust to pH 8.0 with NaOH. Store at room temperature for
up to 1 year.
3. TNE buffer, pH 8.0: Store at room temperature for up to
1 year.
4. 20% Sarkosyl: Store at room temperature for up to 5 years.
5. Sterile water: Autoclaved Type I water. Store at room
temperature.
6. 20 mg/mL Proteinase K: Store in freezer between 5  C and
30  C.
7. PCR digestion buffer: Prepare 10 mM Tris-HCl, 10 mM
EDTA, 50 mM NaCl, and 1% SDS. Mix until dissolved, and
adjust to pH 7.5 with dilute HCl. Store at room temperature
for up to 1 year.
8. 25:24:1 Phenol:Chloroform:Isoamyl Alcohol: Store between
2  C and 8  C for up to 5 years.
9. 24:1 Chloroform:Isoamyl Alcohol: Store at room temperature
for up to 5 years.
10. 0.39 M Dithiothreitol (DTT): Store at 20  C.
11. TE buffer: 10 mM Tris-HCl and 1 mM EDTA, pH 7.5–8.0.
Store at room temperature for up to 1 year.
12. 3 M sodium acetate, pH 5.2: For ethanol precipitation proce-
dure only. Store at room temperature for up to 3 years.

3 Methods

Subheadings 3.1, 3.2, 3.3, 3.4, and 3.5 describe sample preparation
and lysis for various sample types. The organic extraction procedure
begins in Subheading 3.6.

3.1 Sample 1. Use sterile forceps and scissors to cut a small section the stained
Preparation and Lysis: material or swab into a 2.0 mL tube (see Note 6).
Swabs and Stains 2. To each sample, add 400 μL stain extraction buffer and 15 μL
Proteinase K (see Note 7).
3. Mix by inverting or light vortex mixing and pulse spin so that
the sample is fully immersed into the liquid.
4. Incubate at 56  C in a heat block or incubator for a minimum
of 2 h up to 12 h. Mix by inverting or vortex mixing periodi-
cally when possible.
26 Carolyn A. Lewis

5. Vortex thoroughly for 10–15 s, pulse spin, and transfer the

cutting into a spin basket using sterile forceps. Place the spin
basket back into the same tube with the liquid and centrifuge
for 5 min at
9000  g to collect any residual liquid from the
cutting. Remove and discard the spin basket with the cutting or
swab (see Note 8).
6. Proceed to Organic Isolation of DNA (see Subheading 3.6,
step 1).

3.2 Sample 1. Use sterile forceps and scissors to cut a small piece of tissue
Preparation and Lysis: (~10–50 mm3) into a 2.0 mL tube.
Tissue Samples 2. To each sample, add 400 μL stain extraction buffer and 15 μL
Proteinase K (see Note 7).
3. Mix by inverting or light vortex mixing and pulse spin so that
the tissue sample is fully immersed into the liquid.
4. Incubate at 56  C in a heat block or incubator for 2 h. If the
tissue sample has been preserved in formaldehyde or formalin,
add an additional 10 μL of Proteinase K after 2 h and return to
incubation at 56  C for an additional 2 h.
5. Centrifuge at approximately 14,000  g for 5 min to pellet any
undigested material.
6. Proceed to Organic Isolation of DNA (see Subheading 3.6,
step 1).

3.3 Sample 1. Clean an electric drill and 3/3200 drill bit with 10% bleach,
Preparation and Lysis: followed by 95% ethanol.
Bones 2. Prepare the cleaning solution by mixing 1.2 mL TNE, 7.5 μL
20% Sarkosyl, and 225 μL sterile water in a 2.0 mL tube.
3. Place the cleaning solution in a heat block or incubator set to
56  C.
4. Remove the cleaning solution from heat and add 15 μL of
Proteinase K. Mix by inverting or vortex mixing.
5. Fold several Kimwipes into a pad thick enough to absorb the
entire volume of cleaning solution. Add the cleaning solution
to the padded Kimwipes and wrap them around the outer
surface of the bone.
6. Place the wrapped bone in a plastic Ziploc bag large enough to
fit the entire bone sample, and place it in an incubator pre-set
to 56  C for 30 min.
7. Remove the bone from the plastic bag, and unwrap the Kim-
wipes. Discard the bag and Kimwipes.
8. Apply 95% ethanol to a new Kimwipe, and clean the area of the
bone that the cleaning solution was exposed to (see Note 9).
 Organic Extraction—Ethanol and Microcon Purification 27

9. Allow the bone to briefly dry in a hood until any residual

ethanol has evaporated.
10. In the hood, drill a 1–2 mm deep section out of the cleaned
bone using the cleaned electric drill and bit (see Subheading
3.3, step 1).
11. Tap the bone gently onto a Kimwipe or Wypall to collect any
dislodged bone powder from the bone surface. Wrap the Kim-
wipe or Wypall around the loose powder and discard (see Note
10).
12. Place a new Kimwipe or Wypall under the bone, and clean the
drill bit with 10% bleach, followed by 95% ethanol.
13. Drill into the same hole about 3–5 mm deeper, and collect the
bone powder into a weigh boat.
14. Using a sterile spatula, transfer a pea-sized amount of the
powder into a 1.5 mL tube (see Note 11).
15. Proceed to Organic Isolation of DNA (see Subheading 3.6,
step 1).

3.4 Sample 1. Clean the outer surface of the tooth with 10% bleach, followed
Preparation and Lysis: by 70% ethanol (see Note 12).
Teeth 2. Clean the rotary tool and heavy-duty cut-off wheel with 10%
bleach, and remove any bleach residue using 70% ethanol.
3. In a clean biosafety cabinet, cut away the upper crown area of
the tooth until the pulp chamber becomes visible. Small knicks
can be made in the side of the tooth to assist in breaking down
the lower portion of the tooth in subsequent steps.
4. Once the crown has been removed, insert the tooth into a
small, sterile plastic Ziploc bag. Place the bag with the tooth
into a second Ziploc bag and then into a third bag. While
removing as much air as possible, securely seal all of the bags.
5. Insert a clean hammer head into several plastic Ziploc bags. On
a hard and durable surface, carefully use the hammer to crush
the tooth into powder. Take caution not to puncture the plastic
bag with the pulverized tooth sample.
6. While holding the seal upward, shake the tooth powder to a
corner of the Ziploc bag. Cut the same corner with sterile
scissors, and transfer the pulverized sample into a 1.5 mL or
2.0 mL microcentrifuge tube (see Note 13).
7. Proceed to Organic Isolation of DNA (see Subheading 3.6,
step 1).
28 Carolyn A. Lewis

3.5 Sample 1. To each stain or swab cutting, add 400 μL TNE, 25 μL 20%
Preparation and Lysis: Sarkosyl, 75 μL sterile water, and 5 μL Proteinase K (see Notes
Differential Procedure 6 and 7).
for Mixed Body Fluid 2. Mix by inverting or light vortex mixing, and pulse spin so that
Stains the cutting is fully immersed in the liquid.
3. Incubate at 37  C using a heat block or incubator for 2 h (see
Note 14).
4. Vortex thoroughly for 10–15 s, pulse spin, and transfer cutting
into a spin basket using sterile forceps. Place the spin basket
back into the same tube with the liquid, and centrifuge for
5 min at
9000  g to collect any residual liquid from the
cutting. Remove and discard the spin basket with the cutting or
swab (see Note 8).
5. Without disturbing the sperm pellet, carefully transfer all but
approximately 50 μL of supernatant (“non-sperm fraction”)
into a new 1.5 or 2.0 mL tube (see Note 15).
6. Set aside the non-sperm fraction while washing and lysing the
sperm fraction (see Subheading 3.5, steps 7–11; Note 16).
7. Gently wash the pellet by adding 500 μL of PCR digestion
buffer, and resuspend it by slowly pipetting up and down
several times or briefly vortex mixing on a low speed (see
Note 17). Centrifuge for 5 min at
9000  g and remove/
discard all but approximately 50 μL of supernatant.
8. Repeat the wash (see Subheading 3.5, step 7) at least two more
times. This can be performed up to five times (see Note 18).
After the final wash, resuspend the pellet in the remaining
50 μL of supernatant by slowly pipetting up and down. This
is now the “sperm fraction” (see Note 19).
9. To each sperm fraction, add 150 μL TNE, 50 μL 20% Sarkosyl,
40 μL 0.39 M DTT, 150 μL sterile water, and 10 μL
Proteinase K.
10. Mix by inverting or light vortex mixing, and incubate at 56  C
for 2 h (see Note 20).
11. Pulse spin so that any condensation is forced to the bottom of
the tube.
12. Perform Organic Isolation of DNA (see Subheading 3.6, step
1) on both non-sperm and sperm fractions.

3.6 Organic Isolation This procedure should be performed in a chemical fume hood due
of DNA to the use of hazardous chemical reagents.
1. Add an equal volume (~500 μL) of Phenol:Chloroform:Isoa-
myl Alcohol (25:24:1) to the sample lysate (see Subheadings
3.1, 3.2, 3.3, 3.4, or 3.5). Briefly mix by inverting or lightly
vortex mixing at a low speed until a milky emulsion is obtained.
 Organic Extraction—Ethanol and Microcon Purification 29

Centrifuge at full speed (~17,000  g) for 5 min to separate

phases.
2. Carefully remove the aqueous (top) layer containing the DNA,
and transfer it to a new 1.5 mL tube (see Notes 21 and 22).
3. Add an equal volume (~500 μL) of Cholorform:Isoamyl Alco-
hol (24:1) to each sample, and vortex briefly to mix phases.
Centrifuge at full speed (~17,000  g) for 5 min to separate
phases.
4. Carefully remove the aqueous layer, and transfer it to a new
2.0 mL tube (see Notes 22 and 23).
5. Proceed to the preferred DNA purification method (see Sub-
heading 3.7, step 1 or Subheading 3.8, step 1).

3.7 Microcon 1. Assemble and label a Microcon 100 kDa centrifugal filter unit
Purification for each sample, and add 100 μL of TE to the top of each filter
device.
2. Transfer the aqueous layer from the end of the organic isolation
protocol (see Subheading 3.6, step 4) to the top of the filter
device (see Note 24).
3. Centrifuge at 500  g for 10–15 min (see Notes 25 and 26).
4. Discard liquid flowthrough by carefully removing the filter
device from the assembly and pouring it into a waste container.
Return the filter device to the filtrate tube.
5. Add 200 μL of TE to the top of the filter device, and centrifuge
at 500  g for 10–15 min, ensuring that all the liquid has spun
through the filter.
6. Add 20–200 μL of TE to the filter device, depending on the
anticipated size and quality of the DNA sample (see Note 27).
Let it stand at room temperature for 5 min.
7. Remove the filter device and invert into a new, labeled filtrate
tube. Discard the used filtrate tube.
8. Centrifuge the assembly for 5 min at 1000  g.
9. Discard the filter device unit and store purified DNA in a new
1.5 mL tube at 4  C short-term or 20  C long-term.

3.8 Ethanol 1. Estimate the volume of DNA extract.

Precipitation 2. Add 1/10th volume of 3 M sodium acetate (pH 5.2) and two
Purification volumes of ice cold 95–100% ethanol.
3. Mix well and store on ice or at 20  C for at least 1 h to
precipitating DNA (see Note 28).
4. Recover precipitated DNA by centrifuging at maximum speed
for 10 min at 4  C.
30 Carolyn A. Lewis

5. Carefully remove the ethanol supernatant without disturbing

the DNA pellet (see Note 29).
6. Wash the DNA pellet with 500–700 μL of room-temperature
70% ethanol, and centrifuge at 4  C for 2 min at maximum
speed (see Note 30).
7. Repeat the wash twice (see Subheading 3.8, steps 5–6) to wash
the pellet a total of three times.
8. Allow the pellet to air-dry at room temperature with the tube
lid open for 15 min or until all residual ethanol has evaporated
(see Note 31).
9. Resuspend the DNA pellet in an appropriate volume
(20–200 μL) of TE buffer, and store purified DNA at 4  C
short term or 20  C long term.

4 Notes

1. Biological samples may contain infectious agents, such as HIV

or hepatitis-causing virus; therefore, proper personal protective
equipment (PPE) must be worn at all times during the proce-
dure. This includes eye/nose/mouth protection, lab coat, and
disposable latex or nitrile gloves (double glove, if necessary).
Gloves should be changed frequently to avoid sample-to-sam-
ple DNA contamination. A clean Kimwipe can be used to open
microcentrifuge tubes to minimize DNA transfer onto gloves.
If it is suspected that any DNA has come into contact with a
glove, it should be changed immediately prior to handling
subsequent samples.
2. Biohazardous waste is to be disposed of according to
laboratory-specific biohazard waste management protocols.
Biohazardous waste should never be placed in a
non-biohazardous waste container.
3. All work surfaces and applicable equipment are to be cleaned
thoroughly with a 10% bleach solution, followed by 70% etha-
nol to degrade DNA and remove chemical residue, respectively.
4. At least one reagent blank (and substrate control, where appli-
cable) must be processed alongside every batch of samples to
ensure there is no reagent contamination at the extraction step
of the DNA workflow. Differential procedures include at least
two reagent blanks that are processed alongside each fraction.
5. To reduce the risk of sample and/or reagent contamination, all
liquid is to be centrifuged to the bottom prior to opening a
tube. Reagents should be aliquoted into smaller working
volumes, and different lot numbers of the same reagent should
never be combined. All reagent lot numbers used to process a
 Organic Extraction—Ethanol and Microcon Purification 31

batch of casework samples should be the same as the

corresponding reagent blank. If there is a small volume of
reagent remaining and a different lot number is needed to
process casework samples, a separate reagent blank must be
included.
6. Cut the tip of the swab or approximately 1 cm  1 cm of
stained material.
7. These volumes may be altered in proportionate amounts to
accommodate sample size. The sample should be fully—but
not overly—saturated.
8. Refer to specific laboratory guidelines for discarding eviden-
tiary material.
9. Wipe the surface of the bone with 95% ethanol 1–2 times to
ensure that all active residual Proteinase K is removed.
10. DNA should NOT be obtained from the outer surface of the
bone as it has been exposed to environmental conditions and
likely to be more degraded or contaminated than the inner
surface of the bone.
11. In the event that low DNA yield is observed during DNA
quantification, multiple 1.5 mL tubes can be prepared from
the same bone powder. The powder can be combined later if
re-extraction is required.
12. If available, molars and/or premolars are the best tooth choice
for DNA extraction.
13. Depending on the amount of powder, the pulverized tooth can
be placed into a weigh boat and subsequently transferred into a
microcentrifuge tube using a sterile spatula.
14. This incubation step is lysing epithelial cells while sperm cells
remain intact at this lower temperature.
15. The new tube containing the supernatant should be labeled
with the sample ID and “NSF” for non-sperm fraction, as this
will be subsequently processed as its own evidentiary sample.
The pellet contains the sperm cells and will later become the
“sperm fraction.”
16. Once separated, the sperm and non-sperm fractions should be
processed in different batches with their own reagent blanks. A
common practice is to continue processing the non-sperm
fraction during the 2-h incubation (see Subheading 3.5, step
10).
17. It is important to perform this step very gently in order to keep
the sperm heads intact, as the microscopic identification of
sperm cells is based on the cell morphology.
18. The goal is to remove any remaining non-sperm cells; there-
fore, more washes are recommended if it is anticipated that
32 Carolyn A. Lewis

there are high levels of non-sperm fraction. For example, a

vaginal/cervical swab from a sexual assault case likely contains
high non-sperm fraction cell counts and lower sperm cell
counts; therefore, more than two washes should be performed.
19. If desired, pipette 3–5 μL of sperm fraction onto a glass micro-
scope slide for microscopic examination of sperm cells.
20. The addition of DTT and a higher incubation temperature
causes the sperm cell heads to lyse and release DNA into the
sperm fraction lysis buffer. DTT is a detergent that reduces
disulfide bonds in the acrosomal caps of sperm cells.
21. Additional organic extractions (see Subheading 3.6, steps 1–2)
may be performed prior to the addition of Chloroform:Isoa-
myl Alcohol (see Subheading 3.6, step 3) if layer separation is
still observed. The aqueous layer should appear clear and
homogenous.
22. It is important to not transfer any of the organic layer and/or
the white interphase. The organic layer contains inhibitory
solvents and lipids, while the white interphase contains inhibi-
tory proteins.
23. The aqueous layer may be directly transferred to the
pre-moistened Microcon® membrane (see Subheading 3.7,
step 1) to minimize tube transfers and potential loss of DNA.
24. Ensure that only the aqueous layer is added since organic
solvents can damage the filter membrane, resulting in holes
through which DNA can pass through and is lost.
25. Centrifugal force greater than 3000  g may damage the
concentrator.
26. Ensure that all liquid has spun through the filter. If necessary,
repeat centrifugation until the filter is moist but not
completely dry.
27. For low quality samples, approximately 20 μL is recommended.
For reference or high molecular weight samples, approximately
200 μL is recommended.
28. DNA in ethanol solutions can be stored indefinitely at 20  C.
29. The DNA pellet may not be visible; therefore, the supernatant
may be retained and stored at 4  C short term or 20  C long
term until DNA recovery has been verified, particularly for
nearly consumed evidence samples.
30. Since the DNA is not always visible, a good tip is to dispense
the 70% ethanol down the sides of the tube to ensure that any
DNA stuck against the tube wall is washed.
31. If necessary, the open tube can be incubated at 45  C for
2–3 min to fully evaporate any ethanol that may inhibit down-
stream analyses.
 Organic Extraction—Ethanol and Microcon Purification 33

References
1. Green MR, Sambrook J (2016) Precipitation of 4. Köchl S, Niederstätter H, Parson W (2005)
DNA with ethanol. Cold Spring Harb Protoc DNA extraction and quantitation of forensic
12:1116–1120. https://doi.org/10.1101/ samples using the phenol-chloroform method
pdb.prot093377 and real-time PCR. In: Carracedo A
2. Zeugin JA, Hartley JL (1985) Ethanol precipi- (ed) Forensic DNA typing protocols, Methods
tation of DNA. BRL-focus 7:1–2 in molecular biology, vol 297. Humana Press,
3. Kurosaki K, Matsushita IT, Ueda S (1993) Indi- Clifton, pp 13–29
vidual DNA identification from ancient human 5. Gill P, Jeffreys AJ, Werrett DJ (1985) Forensic
remains. Am J Hum Genet 53(3):638–643 application of DNA fingerprints. Nature 318:
577–579. https://doi.org/10.1038/318577a0
 Chapter 3

Manual Silica-Based DNA Extractions

Catherine Cupples Connon

Abstract
There are several silica-based extraction methods that utilize silica-packed columns or silica-coated para-
magnetic resin and are suitable for the needs of forensic DNA analysis and/or human identification. These
rely on the use of chaotropic salts to alter the affinity of DNA such that it binds strongly to silica. A variety of
samples can be successfully processed with these procedures, including buccal swabs, dried or liquid blood,
saliva, semen, and other typical forensic-type samples. This chapter will describe the manual extraction
process for Promega’s DNA™ IQ System, as well as Qiagen’s QIAamp® DNA Blood Mini Kit, QIAamp®
DNA Mini Kit, and QIAamp® DNA Investigator Kit.

Key words DNA extraction, DNA IQ System, QIAamp DNA Blood Mini Kit, QIAamp DNA Mini
Kit, QIAamp DNA Investigator Kit, Silica, Paramagnetic resin

1 Introduction

1.1 Background DNA extraction is an important beginning step of the overall

forensic DNA analysis process. The key goals are typically to isolate
and purify DNA so that it is of suitable quality and quantity for
downstream methods—like PCR amplification and capillary elec-
trophoresis—with the end goal being the development of a high-
quality STR profile.
Silica-based extraction methods have proven to be the method
of choice by the forensic DNA community for well over a decade,
with some laboratories consistently employing them since the early
2000s [1, 2]. These methods initially won over the community by
offering an alternative to the long-standing, health-hazardous
organic extraction that had been the primary go-to method for
decades. In addition, they offered improved DNA yields and the
ability to remove PCR inhibitors that had shown to be problematic
with older methods, such as Chelex [1, 3]. These methods also
proved to be easily adapted to the differential extraction procedure
for mixed stains containing sperm and non-sperm cells [4].

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_3,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

35
36 Catherine Cupples Connon

Table 1
Common silica-based extraction chemistries

Manual Automated

Kit Column Resin Instrument Column Resin

® ®
BioSprint DNA Blood Kit – – BioSprint 96 – ✓
KingFisher Flex – ✓
ChargeSwitch® Forensic DNA – – iPrep™ Purification – ✓
Purification Kit Instrument
DNA IQ™ System – ✓ Maxwell® 16 – ✓
® ®
EZ1 & 2 DNA Investigator Kit – – EZ1 series instruments – ✓
EZ2® Connect Fx – ✓
PrepFiler® Forensic DNA Extraction Kit – – AutoMate Express™ – ✓
QIAamp® DNA Blood Mini Kit ✓ – QIAcube® ✓ –
® ®
QIAamp DNA Mini Kit ✓ – QIAcube ✓ –
® ®
QIAamp DNA Investigator Kit ✓ – QIAcube ✓ –
QIAcube® Connect ✓ –
Numerous silica-based extraction chemistries have been commercially available dating back to the early 2000s. This table
includes some of the options that have been utilized for forensic casework and/or human identification. Most of the
paramagnetic resin options were quickly adapted for automation on a variety of instruments. Additionally, the resin/
bead-based options were also easily amenable for use with several high-throughput liquid handling instruments (not
shown here)

Initially on the market as a silica column-based extraction (i.e.,

silica packed into a flow-through column), these procedures also
offered some decrease in processing time compared to organic
extractions, coupled with a process that eliminated tube-to-tube
transfers, which effectively prevented sample switches due to erro-
neously transferring the retenant from one tube to that of another
(which is a routine step when transferring the aqueous phase in
organic extractions). The method was quickly improved thereafter
when the silica was coupled with a paramagnetic resin, which—
compared to its silica column-based counterparts—made the pro-
cess (1) quicker, (2) even less susceptible to contamination/sample
switches, and (3) more amenable to semi-automated/automated
extraction, all of which were accomplished by eliminating centrifu-
gation and reducing tube-to-tube transfers to a single transfer. The
latter were accomplished through the novel idea of securing the
DNA-bound, silica-wrapped paramagnetic resin (aka beads) to the
back of the microcentrifuge tube via a magnetic separation stand,
effectively pulling the DNA aside to remove and discard liquid
waste. This action was translated to automated instruments/liquid
handlers by retaining the beads inside the instrument pipette tips
(rather than the sample tubes/wells) and moving/washing the
beads from/with one location/reagent to another. In fact, most
 Manual Silica-Based DNA Extractions 37

of the current DNA extraction instruments utilize silica-coated

paramagnetic resin; silica column-based extractions have also been
automated, but doing so requires the instrument to house a centri-
fuge (see Table 1) [5–17]. Automation itself—including semi-
automated instruments—has offered added benefits, like reduced
hands-on time and labor, as well as increased reproducibility of
DNA yields [1, 2, 4, 18].
The first criticism of the silica bead-based extraction methods
was that they had an upper limit for the DNA yield. Promega’s
DNA IQ™ System specifically advertised a maximum DNA yield of
100 ng [19]. Though initially viewed as a disadvantage compared
to organic and silica column-based methods, this was quickly
squashed, as routine forensic samples often have nowhere near
100 ng of DNA, and if they did, 100 ng of DNA is more than
enough for any combination of downstream forensic analyses.
Additionally, the method becomes more efficient as sample quan-
tity decreases—and is most efficient with samples containing less
than 100 ng of DNA [19]. If for some reason more DNA is needed,
the yield can be increased by increasing the volume of paramagnetic
beads used [20].
A legitimate concern arose when it was discovered that bead
carryover in the DNA extract led to PCR inhibition. This was more
of a problem with the early qPCR quantification kits (e.g., Applied
Biosystem’s Quantifiler® Human DNA Quantification Kit) and
made it difficult to obtain an accurate DNA estimation. The STR
amplification kits at the time (e.g., AmpFlSTR® Identifiler® PCR
Amplification Kit) were often able to overcome the level of PCR
inhibition imposed by the beads. Current qPCR and STR amplifi-
cation kits have seen vast improvements and typically are not sub-
jected to inhibition if beads are present in the extract, though it is
still strongly recommended to prevent bead carryover into the
DNA extract.

1.2 Silica DNA Regardless of the commercial kit, all silica-based extractions utilize
Extraction Chemistry a chaotropic salt (e.g., guanidinium or some form of it) and an
alcohol (e.g., ethanol and/or isopropanol) to change the affinity of
DNA such that it will strongly bind to silica; this is also referred to
as silica adsorption. At the end of the process, the chemistry is
reversed such that DNA is released from the silica in a purified form.
To begin, the sample is incubated with a proprietary lysis buffer
containing a chaotropic salt and typically some type of protease—
proteinase K is very common, but DNA IQ utilizes dithiothreitol
(DTT)—for
2 h to lyse cells. During this time, the chaotropic salt
disrupts the hydrogen bonding of water and denatures proteins
(including nucleases), the latter of which is aided by the protease
(or DTT, if using). In addition to having a high salt concentration,
a low pH also helps to prepare for the upcoming DNA-silica
binding. After the lysis incubation, the sample substrate is removed
38 Catherine Cupples Connon

and the lysate is either added to a silica column or paramagnetic

resin is added to the lysate, depending on which extraction method
is used. Either way, the DNA is exposed to silica and will bind to it
under these conditions. The binding affinity is improved with the
addition of an alcohol. Next, as DNA is securely bound to the silica
(either in the silica-packed column or the free-floating silica-coated
beads), impurities are removed through a series of wash steps.
These wash steps are slightly different depending on the commer-
cial kit used, but in general, they begin with high salt and alcohol
concentrations to keep the DNA tightly bound to the silica. As the
washes progress, the concentration of salt and/or alcohol
decreases. At the final elution step, an elution buffer free of salt
and alcohol (e.g., low EDTA TE buffer) changes the binding
affinity such that DNA is released from the silica and is retained in
a highly pure form as the sample extract.
Qiagen (Hilden, Germany) offers a variety of silica-based
extraction chemistries that are suitable for forensic DNA analysis,
including: QIAamp® DNA Blood Mini Kit (Blood Mini kit),
QIAamp® DNA Mini Kit (DNA Mini kit), and QIAamp® DNA
Investigator Kit (Investigator kit) [12, 13]. When processing these
extraction methods manually, all utilize silica columns. The Blood
Mini and DNA Mini kits are more suitable for high-quality refer-
ence samples rather than evidentiary samples and also use the same
silica columns when processed with the QIAcube® instrument
[14]. Comparatively, the Investigator kit is better equipped to
handle forensic evidentiary samples and is available as a silica
column-based extraction when used with the QIAcube® or QIA-
cube® Connect instruments, as well as a silica bead-based extraction
when used with the EZ1® series or EZ2® Connect Fx instruments
[11, 14, 15]. All of these are semi-automated instruments from
Qiagen. The QIAcube series are more automated than the
EZ1/EZ2 instruments, given that the lysis step is performed on
the instrument for the former (but still requires the user to remove
the sample substrate following lysis); lysis is performed
off-instrument for the EZ1/EZ2 instruments, after which the
lysate is transferred to the instrument for further processing.
Promega (Madison, WI) offers the DNA IQ™ System, a silica
bead-based extraction that can be performed manually, via a semi-
automated platform, or on a variety of liquid handling instruments
[1, 9, 10, 18]. This method yields a combination of single-stranded
and double-stranded DNA (ssDNA and dsDNA, respectively). The
ratio of ssDNA to dsDNA is controlled by the incubation tempera-
ture of the lysis step: 70  C for a higher ratio of ssDNA and 56  C
for a higher ratio of dsDNA [21].
There are various other silica bead-based DNA extractions that
have been used/targeted for forensic/human identity samples,
including the PrepFiler® Forensic DNA Extraction Kit (Applied
Biosystems, Waltham, MA) and ChargeSwitch® Forensic DNA
 Manual Silica-Based DNA Extractions 39

Purification Kit (Invitrogen, Waltham, MA), which can be semi-

automated with the AutoMate Express™ Forensic DNA Extraction
System (Applied Biosystems) and iPrep™ Purification Instrument
(Invitrogen), respectively.
Given the vast number of combinations of kits and manual/
semi-automated/automated procedures available, this chapter’s
focus is on manual extraction using the DNA IQ System, as well
as three QIAamp DNA kits (Blood Mini, DNA Mini, and
Investigator).

2 Materials

All methods should utilize molecular grade reagents and materials.

Plastic consumables (i.e., tips, tubes, and spin baskets) must be
autoclaved for sterilization; aerosol-barrier pipette tips are highly
recommended.

2.1 DNA Extraction 1. QIAamp DNA Blood Mini Kit: Contains QIAamp Mini Spin
via QIAamp® DNA Columns, Collection Tubes (2 mL), Buffer AL, Buffer AW1,
Blood Mini Kit or Buffer AW2, Buffer AE, QIAGEN® Protease, and Protease
QIAamp® DNA Mini Kit solvent (see Note 1). Upon receipt, all components can be
stored at room temperature for up to 1 year (see Note 2).
When ready for use, reconstitute the Protease in the provided
solvent, and add the specified volume of 95–100% ethanol to
Buffer AW1 and Buffer AW2 (see Notes 3 and 4). Prevent
Buffer AL and Buffer AW1 from coming into contact with
bleach, including dilute forms (see Note 5).
2. QIAamp DNA Mini Kit: Contains QIAamp Mini Spin Col-
umns, Collection Tubes (2 mL), Buffer AL, Buffer AW1,
Buffer AW2, Buffer AE, and Proteinase K (see Note 1). Upon
receipt, all components can be stored at room temperature for
up to 1 year (see Note 2). When ready for use, add the specified
volume of 95–100% ethanol to Buffer AW1 and Buffer AW2
(see Note 4). Prevent Buffer AL and Buffer AW1 from coming
into contact with bleach, including dilute forms (see Note 5).
3. 95–100% ethanol.
4. Phosphate-buffered saline (PBS).
5. Heat block: A thermomixer is beneficial but not required.

2.2 DNA Extraction 1. QIAamp DNA Investigator Kit: Contains QIAamp MinElute®
via QIAamp® DNA Columns, Collection Tubes (2 mL), Buffer ATL, Buffer AL,
Investigator Kit Buffer AW1, Buffer AW2, Buffer ATE, Carrier RNA (cRNA),
and Proteinase K. Upon receipt, QIAamp MinElute Columns
should be stored at 2–8  C (room temperature is okay if they
will be used within 4 weeks); all other components can be
40 Catherine Cupples Connon

stored at room temperature for up to 1 year (see Note 2). When

ready for use, add the specified volume of 95–100% ethanol to
Buffer AW1 and Buffer AW2, and add 310 μL Buffer ATE to a
single tube of cRNA to obtain a concentration of 1 μg/μL (see
Notes 4 and 6). Prevent Buffer AL and Buffer AW1 from
coming into contact with bleach, including dilute forms (see
Note 5).
2. 95–100% ethanol.
3. Spin baskets: Needs to be compatible with 1.5 mL tubes.
4. Heat block: A thermomixer is beneficial but not required.

2.3 DNA Extraction 1. DNA IQ System: Contains Resin, Lysis Buffer, 2X Wash
via DNA IQ System Buffer, and Elution Buffer. Upon receipt, all components can
be stored at room temperature (see Note 2). When ready for
use, add the specified volume of 95–100% ethanol and isopro-
pyl alcohol to 2X Wash Buffer to prepare the working stock
Wash Buffer (see Note 4). Prevent Lysis Buffer from coming
into contact with bleach, including dilute forms (see Note 5).
2. 1 M Dithiothreitol (DTT): Aliquot and store at 20  C. Limit
to one freeze/thaw event.
3. Spin baskets: Needs to be compatible with 1.5 mL tubes.
4. Heat block: A thermomixer is beneficial but not required.
5. Magnetic separation stand: Must hold 1.5 mL tubes.

3 Methods

Universal precautions should be followed at all times to prevent the

contamination of evidence and to the safeguard the analyst from
chemical and biological hazards. This includes the use of personal
protective equipment (PPE; gloves, lab coat, etc.) and disinfecting
workspaces and tools (e.g., scissors, forceps, etc.) before and after
use with 10% bleach followed by 70% ethanol. Appropriate positive
and negative controls should be processed with each extraction
batch, as defined by your laboratory (see Note 7). The methods
included here are for manual extraction of routine forensic samples
such as blood, buccal, saliva, or touch DNA samples, the latter of
which is best processed with the QIAamp® DNA Investigator Kit or
DNA IQ™ System (see Notes 8–10). Prior to starting the extrac-
tion, check the lysis buffer for precipitate (see Note 11).

3.1 Extraction of 1. Using a set of sterile scissors (and sterile forceps to assist, if
Reference Blood or needed), cut an appropriate-sized portion of a sample swab or
Buccal Samples Using other substrate and place it into a 1.5 or 2 mL tube (see Note
QIAamp DNA Blood 12). Prepare extraction controls as well (see Note 7).
Mini Kit or QIAamp
DNA Mini Kit
 Manual Silica-Based DNA Extractions 41

Table 2
Composition of lysis mix

QIAamp DNA
QIAamp DNA Blood Mini Kit QIAamp DNA Mini Kit Investigator Kit DNA IQ System
400 μL Buffer AL 400 μL Buffer AL 400 μL Buffer ATL 300 μL Lysis Buffer
20 μL Protease 20 μL Proteinase K 20 μL Proteinase K 3 μL 1 M DTT
400 μL PBS 400 μL PBS – –
Each silica-based extraction begins with an incubation to facilitate lysis. The lysis mix is similar per method, containing a
proprietary lysis buffer with a chaotropic salt and some type of protease or DTT. All components are supplied in the
commercial kits, except for the PBS and 1 M DTT required for the QIAamp DNA Kits and DNA IQ System, respectively.
It is important for the sample substrate to be fully saturated and immersed in the reagents during the lysis step. Volumes
of at least 300–400 μL are usually sufficient to provide adequate immersion of up to one cotton swab or 1 cm2 of other
material substrate

2. To each sample, add: 400 μL Buffer AL, 20 μL Protease/

Proteinase K, and 400 μL PBS (see Notes 13 and 14;
Table 2). Vortex thoroughly for 10–15 s and quick spin.
3. Incubate at 56  C for 10 min (see Note 15). Centrifuge tubes
briefly to remove condensation.
4. Add 400 μL ethanol to each sample. Vortex thoroughly for
10–15 s and quick spin.
5. Obtain one QIAamp Mini Spin Column (provided in a 2 mL
collection tube) per sample (see Note 16). Add 700 μL of the
lysate/ethanol mixture to the corresponding column and
securely close the column (see Note 17). Do not transfer the
substrate. Save the remaining lysate.
6. Centrifuge the column assembly at 6000  g for 1 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
7. Add the remaining lysate (see Subheading 3.1, step 5) to the
corresponding column (see Note 17). Use the pipette to
remove as much liquid from the substrate as possible, but do
not transfer the substrate itself to the column. Discard the tube
containing the substrate.
8. Centrifuge the column assembly at 6000  g for 1 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
9. Carefully open each column and add 500 μL Buffer AW1.
Securely close the column (see Note 17).
10. Centrifuge the column assembly at 6000  g for 1 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
42 Catherine Cupples Connon

11. Carefully open each column and add 500 μL Buffer AW2.
Securely close the column (see Note 17).
12. Centrifuge the column assembly at 10,000  g for 3 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 1.5 mL tube (see Note 19).
13. Carefully open each column and add 150 μL Buffer AE. Se-
curely close the column (see Note 17), but do not try to close
the 1.5 mL tube. Incubate at room temperature for 5 min (see
Note 20).
14. Centrifuge the column assembly at 15,000–20,000  g for
1 min to complete the elution step. Confirm that each tube
contains sample extract, then discard the collection tube and
securely close the extract tube.
15. Samples may proceed immediately to DNA quantitation, may
be stored at 2–8  C for a few days, or may be stored at 20  C
if they will not be used again within roughly a week.

3.2 Extraction of 1. Using a set of sterile scissors (and sterile forceps to assist, if
Blood, Buccal, Saliva, needed), cut an appropriate-sized portion of a sample swab or
or Touch DNA Samples other substrate and place it into a 1.5 or 2 mL tube (see Note
Using QIAamp DNA 12). Prepare extraction controls as well (see Note 7).
Investigator Kit 2. To each sample, add: 400 μL Buffer ATL and 20 μL Proteinase
K (see Notes 13 and 14; Table 2). Vortex thoroughly for
10–15 s and quick spin.
3. Incubate at 56  C for 1–2 h (see Notes 15 and 21). Centrifuge
tubes briefly to remove condensation.
4. To each sample, add 400 μL Buffer AL and 1 μL cRNA (see
Note 22). Vortex thoroughly for 10–15 s and quick spin.
5. Incubate at 70  C for 10 min (see Note 15). Centrifuge tubes
briefly to remove condensation.
6. For samples with anticipated low DNA yields, use sterile for-
ceps to transfer the substrate to a spin basket and new 1.5 mL
tube; retain the lysate in the original 1.5/2 mL tube. Centri-
fuge the spin basket assembly at 10,000  g for 3 min. Remove
and discard the spin basket containing the substrate, then
transfer the lysate back to its original 1.5/2 mL lysate tube
(see Note 23).
7. Add 200 μL ethanol to each sample. Vortex thoroughly for
10–15 s and quick spin.
8. Obtain one QIAamp MinElute Column (provided in a 2 mL
collection tube) per sample (see Note 16). Transfer the entire
lysate/ethanol mixture to the corresponding column and
securely close the column (see Note 17). If the substrate was
not previously removed (see Subheading 3.2, step 6), do not
 Manual Silica-Based DNA Extractions 43

transfer it to the column. Discard the empty 1.5/2 mL lysate

tube and any remaining substrate.
9. Centrifuge the column assembly at 6000  g for 1 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
10. Carefully open each column and add 500 μL Buffer AW1.
Securely close the column (see Note 17).
11. Centrifuge the column assembly at 6000  g for 1 min (see
Note 18). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
12. Carefully open each column and add 700 μL Buffer AW2.
Securely close the column (see Note 17).
13. Centrifuge the column assembly at 6000  g for 1 min (see
Notes 18 and 24). Discard the filtrate and the collection tube.
Place the column into a new, clean 2 mL collection tube.
14. Carefully open each column and add 700 μL ethanol. Securely
close the column (see Note 17).
15. Centrifuge the column assembly at 6000  g for 1 min (see
Notes 18 and 24). Discard the filtrate and the collection tube.
Place the column into a new, clean 2 mL collection tube.
16. Centrifuge the column assembly at 10,000  g for 3 min (see
Note 25). Discard the filtrate and the collection tube. Place the
column into a new, clean 1.5 mL tube (see Note 19).
17. Carefully open each column and incubate in a secure location
at room temperature for 10 min or at 56  C for 3 min to allow
for complete evaporation of ethanol (see Notes 25 and 26).
18. Add 20–150 μL Buffer ATE to each column. Securely close the
column (see Note 17), but do not try to close the 1.5 mL tube.
Incubate at room temperature for 5 min (see Note 27).
19. Centrifuge the column assembly at 15,000–20,000  g for
1 min to complete the elution step. Confirm that each tube
contains sample extract, discard the collection tube, and
securely close the extract tube.
20. Samples may proceed immediately to DNA quantitation, may
be stored at 2–8  C for a few days, or may be stored at 20  C
if they will not be used again within roughly a week.

3.3 Extraction of 1. Using a set of sterile scissors (and sterile forceps to assist, if
Blood, Buccal, Saliva, needed), cut an appropriate-sized portion of a sample swab or
or Touch DNA Samples other substrate and place it into a 1.5 mL tube (see Note 12).
Using DNA IQ™ Prepare extraction controls as well (see Note 7).
System 2. Prepare a lysis mix consisting of 500 μL Lysis Buffer and 5 μL
1 M DTT per sample, plus an additional 10–15% for pipetting
error (see Note 28). Vortex thoroughly and quick spin.
44 Catherine Cupples Connon

3. Add 300 μL lysis mix to each sample (see Note 14; Table 2);
retain the remainder mix for after the incubation (see Subhead-
ing 3.3, steps 6 and 10). Vortex each sample thoroughly for
10–15 s and quick spin.
4. Incubate at 56  C for 1–2 h (see Notes 15, 21, and 29).
Centrifuge tubes briefly to remove condensation.
5. For samples with anticipated low DNA yields, use sterile for-
ceps to transfer the substrate to a spin basket and place it back
into its corresponding 1.5 mL tube with the lysate. Centrifuge
the spin basket assembly at 10,000  g for 3 min. Remove and
discard the spin basket containing the substrate (see Note 30).
For samples not processed with a spin basket (i.e., reference
samples), squeeze out as much of the lysate from the substrate
as possible as it is being removed from the tube and discard.
6. Add 100 μL of the retained lysis mix (see Subheading 3.3, step
3) to each sample. Vortex thoroughly for 10–15 s and
quick spin.
7. Vortex the Resin bottle thoroughly for 10 s. Add 8 μL Resin to
each sample. Vortex thoroughly for 10–15 s and let stand at
room temperature for 5 min (see Note 31).
8. Briefly vortex each sample and place on the magnetic separation
stand. The resin will be pulled to the back of the tube, at the
point closest to the magnet (see Note 32).
9. Carefully open each tube, and remove and discard the lysis mix.
Do not disturb the resin (see Note 33).
10. Add an additional 100 μL of the retained lysis mix (see Sub-
heading 3.3, step 3) to each sample. Briefly vortex each sample
and place on the magnetic separation stand (see Note 32).
11. Carefully open each tube and remove and discard the lysis mix.
Do not disturb the resin (see Note 33).
12. Wash the DNA-bound resin by adding 100 μL of Wash Buffer
to each sample. Briefly vortex each sample and place on the
magnetic separation stand (see Note 32).
13. Carefully open each tube and remove and discard the Wash
Buffer. Do not disturb the resin (see Note 33).
14. Repeat the wash two times (see Subheading 3.3, steps 12 and
13) for a total of three washes. Make sure all of the liquid is
removed following the last wash.
15. While still on the magnetic separation stand and with the lids
open, allow the tubes to air-dry in a secure location for 5 min
(see Notes 26 and 34).
16. Add 20–150 μL Elution Buffer to each sample. Securely close
the tube, vortex briefly, and incubate at 65  C for 5 min (see
Note 35).
 Manual Silica-Based DNA Extractions 45

17. Briefly vortex each sample and place on the magnetic separa-
tion stand (see Notes 32 and 36). Transfer the eluted DNA to a
new 1.5 mL tube (see Notes 19 and 37).
18. Samples may proceed immediately to DNA quantitation, may
be stored at 2–8  C for a few days, or may be stored at 20  C
if they will not be used again within roughly a week.

4 Notes

1. The kits contain many of the same components; differences are

noted here [12]. The Blood Mini kit does not contain Buffer
ATL, whereas the DNA Mini kit does. However, Buffer ATL is
not utilized in the protocols provided in this chapter. Addition-
ally, the Blood Mini kit contains QIAGEN® Protease (and the
accompanying solvent), whereas the DNA Mini kit contains
Proteinase K. The Protease is a lyophilized (dry) powder that is
temperature-sensitive after reconstitution, compared to
Proteinase K, which is in solution and stable at room tempera-
ture [12, 13, 22]. As an added note, the Protease is not
compatible with Buffer ATL, but Proteinase K is compatible
with that buffer (not relevant here because Buffer ATL is not
utilized in the protocols in this chapter).
2. Room temperature is considered 15–25  C per Qiagen and
15–30  C per Promega; temperatures on the low end of this
range may cause precipitate to form in the lysis buffers
(QIAamp Buffer AL/ATL and DNA IQ Lysis Buffer) (see
Note 11). If the Protease (Blood Mini kit) is to be stored for
longer than 1 year prior to being reconstituted in the provided
solvent, then it should be stored dry at 2–8  C. The life of the
Proteinase K (DNA Mini and Investigator kits) is prolonged to
beyond 1 year if stored at 2–8  C [9, 12, 13].
3. Store the reconstituted Protease at 2–8  C for up to 12 months.
Avoid exposing Protease to room temperature for prolonged
periods of time. To prolong its life, aliquot into smaller
volumes and store at 20  C [12]. Limit to two freeze/thaw
events.
4. The volume of alcohol(s) added depends on the size extraction
kit purchased. (For ethanol specifically, Qiagen specifies the use
of 96–100% ethanol, whereas Promega specifies 95–100%; the
latter is fine for any of the kits used in this chapter.) See
instructions provided with the kit. After alcohol(s) has been
added, these buffers are stable for 1 year at room temperature
[9, 12, 13]. Be sure to close the lids tightly to avoid
evaporation.
46 Catherine Cupples Connon

5. Buffer AL (Qiagen), Buffer AW1 (Qiagen), and Lysis Buffer

(Promega) contain a chaotropic salt (guanidine hydrochloride
for the Qiagen buffers and guanidium thiocyanate for Prome-
ga’s), which is not compatible with bleach or any product
containing bleach. Exposure to bleach can result in the forma-
tion of a toxic gas [9, 12, 13, 23].
6. Dissolve the contents of the cRNA tube thoroughly. Reconsti-
tuted cRNA should be aliquoted and stored at 20  C. Limit
to three freeze/thaw events [13].
7. The FBI Quality Assurance Standards (QAS) require the use of
a reagent blank as a negative control during extraction. Positive
controls for the extraction procedure are not required per the
QAS, but laboratories can choose to implement them as part of
their standard operating procedure if they deem fit [24].
8. The protocols for extraction of blood or buccal samples with
the QIAamp DNA Blood Mini Kit and QIAamp DNA Mini Kit
are basically the same, except for the use of QIAGEN® Protease
versus Proteinase K, respectively (see Note 1) [12, 13].
9. More challenging sample types—such as hair, teeth, bone, and
urine, as well as those contaminated with fingerprint powder
and/or collected from a firearm (including swabs of the weapon,
shells/casings, or bullets)—are likely better suited for a modified
extraction and/or a different procedure altogether. Samples sus-
pected of containing sperm must be subjected to DTT, whereas
those suspected of containing sperm and non-sperm cells must be
subjected to a differential extraction. Such protocols are not
included in this chapter [9, 12, 13].
10. Automated and/or semi-automated extraction procedures are
available for these kits in combination with instruments/liquid
handlers from various manufacturers, but such protocols are
not included in this chapter [1, 2, 4, 9–15, 18].
11. If precipitate has formed in the lysis buffer (e.g., Buffer AL,
Buffer ATL, or Lysis Buffer), the buffer can be warmed to
37–70  C for ~5–10 min to force the precipitate back into
solution [9, 12, 13]. If this becomes a habitual problem, the
ambient temperature of the room may be too cold (
20  C).
12. Approximately 0.25–0.5 swab is recommended for a buccal
(reference) swab and 0.5–1 swab for non-reference samples;
for low copy number samples, up to two swabs can be used,
but reagent volumes may need to be adjusted (see Note 14). If
possible, use the exterior portion of the swab and leave the
interior portion behind (if unstained) to prevent overloading
the tube with material. For other substrates (e.g., clothing,
linens, etc.), cut approximately 0.5–1 cm2 of the material,
depending on its thickness. Denim and other heavily dyed
 Manual Silica-Based DNA Extractions 47

materials can be inhibitory during PCR if the dyes are not

removed adequately during extraction/purification, so taking
smaller cuttings—or swabbing the stain rather than cutting the
material—tends to work better. Cut the substrate into 2–4
smaller pieces before adding them to the sample tube. Sterilize
the scissors and forceps in between sample cuttings.
13. It is recommended to use a repeater pipette to add these
components individually to each sample tube. Make sure all
tubes are spaced far apart (they will all be open at the same
time, which is generally frowned upon due to the risk of
contamination) and be careful to prevent splashing/aerosol
formation. Alternatively, a lysis master mix can be made in a
conical tube that contains enough of all of the reagents for all
of the samples, plus extra (~10–15%) for pipetting error. Make
sure the lysis mix is thoroughly vortexed to reach homogeneity,
then spin it down. Due to the nature of the lysis buffer and the
detergents present, the lysis mix will have bubbles that will be
hard to remove, even when spun down.
14. Ensure that the sample substrate is saturated and fully
immersed. Additional buffer may be added, if needed. Addi-
tional Protease/Proteinase K is not needed for the QIAamp
kits but additional 1 M DTT is necessary in proportion to any
additional Lysis Buffer for the DNA IQ System [9, 12, 13].
15. Use of a thermomixer set to 900 rpm during the initial incuba-
tion will aid lysis. It is recommended but not required. Alter-
natively, samples can be intermittently vortexed during the
incubation period (e.g., every 3 min for a 10-min incubation,
every 10 min for a 1-h incubation, etc.) [13].
16. These are the silica columns. Only the top of the column needs
to be labeled. They are designed to be transferred from one
collection tube to another during this protocol. (The sample
itself is not transferred via pipetting from one tube to another,
hence the “elimination of tube-to-tube transfers.”) Do not wet
the rim of the collection tube as the column is transferred, as
this can be a source of contamination. If your glove gets con-
taminated with lysate, change it immediately before touching
something else.
17. Only one sample should be open at a time. When opening, be
careful not to generate aerosols. When adding to the column,
do not wet the rim of the column and avoid touching the
pipette tip to the packed silica at the bottom of the column.
Close the column carefully, yet securely, to avoid aerosol for-
mation during centrifugation [12, 13].
18. If the lysate has not completely passed through the column
after centrifugation, centrifuge again at a higher speed until the
column is empty [12, 13].
48 Catherine Cupples Connon

19. This will be the final elution tube and should be labeled
appropriately.
20. This incubation is helping to release the DNA from the silica.
Reduced incubation times could result in lower DNA yields.
Final elution volumes can be adjusted, if desired, in anticipa-
tion of the sample’s DNA concentration. Using lower volumes
will increase concentration but often reduces overall yield,
especially if less than 100 μL is applied. Some volume will be
lost to the column [12].
21. For reference samples, incubation time may be reduced to
10 min for QIAamp DNA Investigator or 30 min for DNA
IQ [9, 13].
22. A white precipitate may form when Buffer AL is added to
Buffer ATL. The precipitate does not interfere with the proce-
dure and will dissolve during incubation (see Subheading 3.2,
step 5) [13].
23. This step is highly susceptible to introducing contamination;
proceed carefully and cautiously, so as to not add the lysate
from the spin basket’s 1.5 mL tube to the wrong 1.5/2 mL
lysate tube and/or introduce contamination from gloves com-
ing into contact with lysate. Only have one tube open at a time
and change gloves whenever necessary to minimize these risks.
If the risks are deemed too high, this step can be eliminated.
This step is not needed for reference samples, as they tend to
contain higher quantities of DNA.
24. Be cautious when working with this increased volume to avoid
contact between the column and the flow-through in the
collection tube. Some centrifuge rotors may vibrate upon
deceleration, resulting in the flow-through, which contains
ethanol, coming into contact with the column. Take care
when removing the column and collection tube from the
rotor, so that flow-through does not come into contact with
the column. If this occurs, centrifuge the column assembly
again [13].
25. This step is necessary to prevent ethanol carryover, which is a
potential problem for downstream applications [13].
26. This step is high risk for potential contamination, as all tubes
are open at one time for several minutes. This incubation
should be performed in a safe, secure location, like a biosafety
cabinet or hood.
27. This incubation is helping to release the DNA from the silica.
Reduced incubation times could result in lower DNA yields.
Final elution volumes can be adjusted, if desired, in anticipa-
tion of the sample’s DNA concentration. Using lower volumes
 Manual Silica-Based DNA Extractions 49

will increase concentration but often reduces overall yield. Up

to 5 μL will be lost to the column [13].
28. Since the volume of DTT added per sample is relatively small, it
is recommended to make a master mix for the lysis step. If
components were added individually, there is a greater risk that
an insufficient amount of DTT (or none at all) would be
dispensed into the sample tube, which would have disastrous
effects on the extraction process.
29. This extraction yields a combination of ssDNA and dsDNA,
which is primarily influenced at this incubation step. Incubat-
ing at 56  C will result in predominantly dsDNA in the final
extract. If predominantly ssDNA is desired, increase the incu-
bation to 70  C [21].
30. This step is highly susceptible to introducing contamination;
proceed carefully and cautiously, so as to not add the spin
basket containing sample substrate to the wrong tube and/or
introduce contamination from gloves coming into contact with
lysate. Only have one tube open at a time and change gloves
whenever necessary to minimize these risks. If the risks are
deemed too high, this step can be eliminated. This step is not
needed for reference samples, as they tend to contain higher
quantities of DNA.
31. The step is facilitating the binding of DNA to the silica beads.
Quick spinning samples at this time may interfere with the
process [9]. If needed, individual tubes can be tapped down
on the benchtop to help remove liquid from the top and/or
side of the tube.
32. If a distinct pellet does not form on the back of the tube, vortex
the tube and quickly place it back in the stand [9].
33. If the resin is disturbed or accidentally removed, dispense the
removed liquid/resin back to the tube. Vortex the sample and
return it to the magnetic separation stand to induce separation
again. Carefully remove and discard the lysis mix without dis-
rupting the resin.
34. Do not exceed 20 min for drying. Doing so can reduce the
ability of the DNA to be eluted from the beads, resulting in
lower DNA yields [9].
35. This incubation is helping to release the DNA from the silica.
Reduced incubation times could result in lower DNA yields
[9]. Final elution volumes can be adjusted, if desired, in antici-
pation of the sample’s DNA concentration. Using lower
volumes will increase concentration but often reduce overall
yield [12, 13].
36. DNA yield will decrease if the tube cools prior to being placed
on the magnetic separation stand [9].
50 Catherine Cupples Connon

37. Do not disturb or remove the resin. Check the transferred

extract to ensure that no beads were carried over. If they
were, vortex, quick spin, and immediately return the final
elution tube to the magnet stand. Transfer the extract to a
new 1.5 mL tube, ensuring not to carryover any resin.

References
1. Greenspoon SA, Ban JD, Sykes K et al (2004) Available via Promega. https://www.promega.
Application of the BioMek 2000 Laboratory com/-/media/files/resources/protocols/
Automation Workstation and the DNA IQ Sys- technical-bulletins/101/dna-iq-system-small-
tem to the extraction of forensic casework sam- sample-casework-protocol.pdf. Accessed
ples. J Forensic Sci 49(1):29–39. https://doi. 6 Aug 2022
org/10.1520/JFS2003179 10. Promega Corporation (2016) DNA IQ™
2. Frégeau CJ, De Moors A (2012) Competition Casework Pro Kit for Maxwell® 16. Available
for DNA binding sites using Promega DNA via Promega. https://www.promega.com/-/
IQ™ paramagnetic beads. Forensic Sci Int media/files/resources/protocols/technical-
Genet 6(5):511–522. https://doi.org/10. manuals/101/dna-iq-casework-pro-kit-for-
1016/j.fsigen.2011.12.003 maxwell-16-protocol.pdf?rev¼70c3fc19ed8f4
3. Ip SCY, Lin S, Lai K (2015) An evaluation of 921ac2f5614cbd4cdcf&sc_lang¼en. Accessed
the performance of five extraction methods: 6 Aug 2022
Chelex® 100, QIAamp® DNA Blood Mini 11. QIAGEN (2022) EZ1 & 2® DNA Investiga-
Kit, QIAamp® DNA Investigator Kit, QIA- tor® Kit Handbook. Available via Qiagen.
symphony® DNA Investigator® Kit and DNA https://www.qiagen.com/us/resources/
IQ™. Sci Justice 55(3):200–208. https://doi. resourcedetail?id¼46064856-1b88-4b27-a82
org/10.1016/j.scijus.2015.01.005 5-d3f616e06c08&lang¼en. Accessed
4. Goldstein MC, Cox JO, Seman LB et al (2020) 6 Aug 2022
Improved resolution of mixed STR profiles 12. QIAGEN (2016) QIAamp® DNA Mini and
using a fully automated differential cell lysis/ Blood Mini Handbook, 5th edn. Available via
DNA extraction method. Forensic Sci Res Qiagen. https://www.qiagen.com/us/res
5(2):106–112. https://doi.org/10.1080/ ources/resourcedetail?id¼62a200d6-faf4-4
20961790.2019.1646479 69b-b50f-2b59cf738962&lang¼en. Accessed
5. QIAGEN (2012) BioSprint® 96 DNA hand- 6 Aug 2022
book. Available via Qiagen. https:// 13. QIAGEN (2020) QIAamp® DNA Investigator
wwwqiagencom/us/resources/ Handbook. Available via Qiagen. https://
resourcedetail?id¼64902c5d-9c3c-4fe3-a3f7- www.qiagen.com/us/resources/download.
668c4704d9eb&lang¼en, 6 Aug 2022 aspx?id¼26ef8f2c-7c2a-49e6-b2d2-39d4e130
6. Thermo Scientific (2010) Thermo Scientific b3cc&lang¼en. Accessed 6 Aug 2022
KingFisher Flex User Manual, Revision 1.2. 14. QIAGEN (2018) QIAcube® User Manual,
Available via Themo Fisher Scientific. https:// Version 1.3. Available via Qiagen. https://
static.thermoscientific.com/images/D014 w w w. q i a g e n . c o m / u s / r e s o u r c e s /
75~.pdf. Accessed 6 Aug 2022 resourcedetail?id¼f7d77c6e-0479-4b2b-a2
7. Invitrogen Corporation (2005) ChargeS- e0-5ca747114e34&lang¼en. Accessed
witch® Forensic DNA Purification Kits 6 Aug 2022
Instruction Manual, Version A. Available via 15. QIAGEN (2022) QIAcube® Connect User
Thermo Fisher Scientific. https://www. Manual. Available via Qiagen. https://www.
thermofisher.com/document-connect/docu qiagen.com/us/resources/download.aspx?
ment-connect.html?url¼https://assets. id¼40c8ffa5-8662-434d-ba70-5a098d1294
thermofisher.com/TFS-Assets%2FLSG%2 c4&lang¼en. Accessed 6 Aug 2022
Fmanuals%2Fchargeswitch_forensicdna_man. 16. Applied Biosystems (2017) PrepFiler® and Pre-
pdf. Accessed 6 Aug 2022 pFiler® BTA Forensic DNA Extraction Kits
8. Invitrogen Corporation (2007) iPrep™ Purifi- Quick Reference, Revision B. Available via
cation Instrument user manual, Version B, Thermo Fisher Scientific. https://www.
Carlsbad thermofisher.com/document-connect/docu
9. Promega Corporation (2021) DNA IQ™ Sys- ment-connect.html?url¼https://assets.
tem—small sample casework protocol. thermofisher.com/TFS-Assets%2FLSG%2
 Manual Silica-Based DNA Extractions 51

Fmanuals%2Fcms_099065.pdf. Accessed 21. Truman A, Wieczorek D (2013) Quantifying

6 Aug 2022 dsDNA and ssDNA Isolated by Manual and
17. Applied Biosystems (2019) Automate Automated Methods Using a Fluorescent
Express™ Instrument User Guide, Revision Nucleic Acid Dye. Available via Promega Cor-
G. Available via Thermo Fisher Scientific. poration. https://www.promega.com/res
https://www.thermofisher.com/document- ources/pubhub/quantifying-dsdna-and-
connect/document-connect.html? ssdna-isolated-by-manual-and-automated-met
url¼https://assets.thermofisher.com/TFS- hods-using-a-fluorescent-dye/. Accessed
Assets%2FLSG%2Fmanuals%2F4441982_ 21 Mar 2022
AutoMateExp_UG.pdf. Accessed 6 Aug 2022 22. QIAGEN (2022) QIAGEN Protease and
18. Frégeau CJ, Lett M, Fourney RM (2010) Vali- Proteinase K: For protease digestion during
dation of a DNA IQ-based extraction method DNA and RNA preparation. Available via Qia-
for TECAN robotic liquid handling worksta- gen. https://www.qiagen.com/us/products/
tions for processing casework. Forensic Sci Int discover y-and-translational-research/lab-
Genet 4(5):292–304. https://doi.org/10. essentials/enzymes/qiagen-protease-and-
1016/j.fsigen.2009.11.001 proteinase-k/. Accessed 6 Aug 2022
19. Huston K (2002) Technical tips: DNA IQ Sys- 23. Promega Corporation (2020) Safety Data
tem “Frequently Asked Questions”. Available Sheet: Lysis Buffer. Available via Promega Cor-
via Promega Corporation. https://www.pro poration. https://www.promega.com/res
mega.com/products/forensic-dna-analysis- ources/msds/msdss/a8000/a8261/.
ce/dna-isolation/dna-iq-system/. Accessed Accessed 7 Aug 2022
21 Mar 2022 24. Federal Bureau of Investigation (2020) Quality
20. Connon CC, LeFebvre AK, Benjamin RC Assurance Standards for forensic DNA testing
(2016) Development of a normalized extrac- laboratories. Available via the Federal Bureau
tion to further aid in fast, high-throughput of Investigation. https://www.fbi.gov/file-
processing of forensic DNA reference samples. repository/quality-assurance-standards-for-
Forensic Sci Int Genet 25:112–124. https:// forensic-dna-testing-laboratories.pdf. Accessed
doi.org/10.1016/j.fsigen.2016.07.019 21 Mar 2022
 Chapter 4

Applied Biosystems™ PrepFiler™ Forensic DNA Extraction

Kit (Manual and Semi-automated via AutoMate Express™)
Megan M. Foley

Abstract
The PrepFiler™ Forensic DNA Extraction Kits allow for optimal genomic DNA isolation and purification
from forensic samples through a bind-wash-elute-based technique that can be performed manually or
robotically using the Applied Biosystems AutoMate Express™ Forensic DNA Extraction System. The
extraction kits come in two formats: the standard kit used for common case type samples, like bodily
fluid swabs or stains, and a BTA kit for more challenging evidence sample types that can be submitted for
analysis, like bones, teeth, and adhesive-type samples. Both forms of extraction, manual and semi-
automated, require an initial manual incubation step using a lysis buffer to release the DNA into solution.
If following the semi-automated protocol, the lysate can be purified and eluted on the AutoMate Express™.
After lysis, the DNA binds to magnetic beads in the presence of a chaotropic salt and is washed multiple
times with an ethanol-based wash buffer to purify the sample and remove potential PCR inhibitors. After
removing the wash liquid, elution buffer is added to the tube containing the DNA-bound magnetic beads
and heated, which disrupts the bonding between the DNA and beads. The DNA is then concentrated in the
final tube and can be moved forward through the DNA analysis workflow. This chapter describes a manual
DNA isolation method and the extraction procedures following both manual and robotic methods using
the PrepFiler™ chemistries in conjunction with the AutoMate Express™ Forensic DNA Extraction System.

Key words DNA Extraction, PrepFiler™, PrepFiler™ BTA, PrepFiler Express™, PrepFiler Express™
BTA, AutoMate Express™, Forensic Genetics, Forensic Biology, DNA analysis

1 Introduction

1.1 Background The protocols for PrepFiler™ Forensic DNA Extraction Kit (e.g.,
PrepFiler™, PrepFiler™ BTA, PrepFiler Express™, and PrepFiler
Express™ BTA) made by Applied Biosystems™ utilize similar tech-
nologies and reagents to perform genomic DNA extraction, which
includes a lysis step, a purification step, and a concentration/elu-
tion step. Both the manual and automated PrepFiler™ methods
can be used for commonly encountered forensic samples, including
buccal swabs, bodily fluid swabs, small tissue samples, hair roots,
touch swabs, or other biological stains found on substrates. The

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_4,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

53
54 Megan M. Foley

PrepFiler™ BTA kits have enhanced steps to extract more challeng-

ing sample types, including bones (B), teeth (T), and adhesives (A),
as well as tape lifts, cigarette butts, and chewing gum [1–3].

1.2 Sample Lysis Regardless of whether the manual or semi-automated procedures

are followed, the basic techniques and methodologies are the same.
After sample collection, all samples and controls are subjected to a
lysis step. Cell lysis is performed by using the PrepFiler™ Lysis
Buffer(s) mixed with dithiothreitol (DTT) [1, 3]. The proprietary
buffer contains reagents like guanidine thiocyanate (GTC), a chao-
tropic salt that acts as a denaturant to disrupt both cell and nuclear
membranes in order to release the DNA into solution [4, 5]. It is
believed that chaotropic salts have this effect because they disrupt
the hydrogen bonds of water found in the lysis buffer, making the
nucleic acids more stable throughout the procedure [6]. GTC also
has reductant properties, which break disulfide bonds in proteins,
thus inactivating nucleases present in the sample [7, 8]. Samples
that are considered challenging (e.g., paraffin-embedded tissue and
BTA samples) are subjected to additional reagents like Proteinase K
and Sodium Dodecyl Sulfate (SDS) [1, 3]. The addition of these
two reagents further helps the breakdown of the cellular membrane
and proteins present in the sample [5]. The samples and controls
are subjected to heat and agitation during the first incubation, often
at 70 °C, to further encourage membrane lysis. More difficult
sample types, like aged bones and teeth, require longer incubation
times due to the challenging nature of the sample types [1–3].
After incubation, the sample is centrifuged in a spin basket to
remove any lysate that may be within the substrate into the bottom
of the tube. The PrepFiler™ LySep Column provided in the semi-
automated method allows for a more streamlined version of this
process by eliminating multiple transfer steps that could lead to
contamination and other errors [9, 10]. The column also allows for
an increase in lysate recovery since the sample stays in one tube
throughout the entire incubation and spin-down processes
[11]. The column contains a membrane and a frit layer, a porous
layer that allows passage of liquid, that remains intact during incu-
bation, allowing the substrate to be submerged in the lysis master
mix throughout the duration of the incubation. After this lysis
incubation, the assembly is centrifuged. Through high-speed cen-
trifugation, the membrane housed in the column bursts, allowing
the supernatant to flow through the frit to the bottom of the tube.
Since the frit only allows the passage of the liquid containing
cellular material, the substrate remains on top of the filter and can
be removed prior to processing [1, 10]. If performing the semi-
automated method with the AutoMate Express™, lysis is the only
manual step. The remaining steps of the extraction are performed
on the instrument [1].
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 55

1.3 DNA Isolation The first step of the DNA isolation and purification in the PrepFi-
and Purification ler™ methods is to separate the DNA from the cellular and sub-
strate material remaining in the lysate. Before any isolation occurs,
BTA samples have additional buffer added to ensure proper salt
concentration for DNA binding [3]. The PrepFiler™ technology
can be described as a solid-phase extraction [5]. Magnetic silica
beads are introduced to the lysate and bind to the DNA, allowing
the separation of DNA from unwanted material present in the
sample, like polymerase chain reaction (PCR) inhibitors. Adsorp-
tion of DNA onto the magnetic beads is enhanced through the
presence of the chaotropic salts, like GTC, in the lysis buffer [5, 8,
12, 13]. The liquid lysate is mixed with the silica magnetic beads
and isopropanol, then incubated again to allow enough time for the
DNA to reversibly bind [1, 3]. The beads used in PrepFiler™ have a
high surface area available to bind to a definable amount of DNA
due to the smaller sized beads, which allows for a higher yield [5].
After sufficient time is allowed for proper binding, a magnet is
introduced to the DNA-bound beads, either through the outside
of the tube (if following the manual method) or through the
sample pipette tip (if following the automated method). This allows
the DNA to be separated from the lysis supernatant, which is then
removed and discarded. Under the appropriate conditions, the
beads remain on one side of the plastic through the attraction
with the magnet. Both methods then follow a multi-step washing
procedure. The PrepFiler™ Wash Buffers A and B (includes etha-
nol) are dispensed into the tube/pipette, and the magnet is
removed to allow the DNA-bound particles to mix in order to
remove any leftover unwanted material or contaminants [1, 3]. Inhi-
bitors are common in forensic samples, either present due to the
substrate material or through exposure to other known inhibitors,
like humic acid in soil or hematin in blood. It is crucial that the
extraction method removes all inhibitors to decrease the chance of
inefficient amplification and poor STR profile generation [11, 14].
After mixing with the wash buffer, the magnet is applied again
to the sample (the DNA-bound beads) and the supernatant is
removed and discarded. This procedure occurs for a total of three
washes following the standard procedures and is recommended a
fourth time for dirtier samples that contain a large amount of
protein. Wash Buffer B is added during the third wash step in
order to decrease the chance of carrying over any wash buffer into
the eluant, which is an inhibitor itself [1, 3]. The developmental
validation for both systems and additional studies conclude that the
reagents do not add inhibitors to the extract and successfully
remove inhibitors present in the sample through the evaluation of
quantitation and genotyping results of extraction blanks and sam-
ples. The PrepFiler™ developmental validation tested compro-
mised samples that included an inhibitor mixture (a mixture of
indigo, hematin, humic acid, and urban dust), blood on denim,
56 Megan M. Foley

and blood on cloth exposed to the outdoors for 10 min. The

PrepFiler Express™ developmental validation extracted prepared
compromised samples containing denim, a prepared inhibitor mix-
ture (a mixture of indigo, hematin, humic acid, and urban dust),
and a pulverized tooth and bones [1, 9, 10, 15].

1.4 DNA Once the DNA-bound silica beads have been thoroughly washed
Concentration and and the last supernatant discarded, the sample is left to dry for
Elution around 10 min to evaporate any wash buffer that is still present in
the tube/tip. This is necessary as leftover buffer can further dilute
out the sample and lead to less-than-optimal STR results. Lastly,
the elution buffer is added to the sample to remove the DNA—with
the assistance of heat—from the magnetic beads, allowing for con-
centration of the DNA sample [1, 3]. The binding of the DNA to
the magnetic beads is reversible under the appropriate conditions.
Elution with the PrepFiler™ kits occurs through the heating of the
beads under alkaline conditions and the removal of any salts that
were present [5, 8, 15]. Elution volumes between 20 μL and
250 μL are available using the AutoMate Express™ workflow. It
should be noted that the 20 μL elution volume showed less recov-
ery than larger volumes when evaluated using blood samples in a
study performed by Applied Biosystems™ [1].

1.5 The AutoMate As mentioned above, the methods and techniques for extraction
Express™ Forensic using the AutoMate Express™ System are identical to the manual
DNA Extraction System extraction. The enhancement of the semi-automated procedure is
that the purification and concentration/elution steps are auto-
mated by using the AutoMate Express™ Forensic DNA Extraction
System (see Fig. 1), also manufactured by Applied Biosystems™
[10]. The robotic system is able to process a total of 13 samples and
decreases the purification/elution time to 30 min. A protocol card
is inserted within the instrument that is preprogrammed specifically
to the extraction kit utilized. After the lysate tubes have been
inserted into the instrument and the run started, steps performed
in the manual process are automated by the robot. This includes
mixing of lysate with the various reagents, including the magnetic
beads and isopropanol, separation of the magnetic particles bound
to the DNA, washing of the DNA-bound magnetic beads, the
removal of the ethanol wash buffer, and finally, the elution of the
purified DNA. The system contains a magnet unit that uses Mag-
tration™ technology that pulls magnetic beads present in a sample
towards the magnetic strip housed in the instrument while remain-
ing in the pipette tip, instead of mixing within the tube, like in the
manual method [1, 2].
The wash buffer is aspirated and dispensed while the
DNA-bound beads are held to the side of the pipette tip, which
helps increase the yield of DNA. This also decreases the chance that
magnetic beads are eluted with the DNA in the final elution step.
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 57

Fig. 1 The AutoMate Express™ Forensic DNA Extraction System and the PrepFiler Express™ Extraction Kit.
(Reproduced from ref. [16]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher Scientific
Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)

Additionally, the chance for contamination is decreased using this

system as the tubes, reagents, and tips for each sample stay within
the same axis line within the instrument. All purification and elu-
tion reagents are prepackaged into a single sample reagent car-
tridge. Each cartridge contains additional lysis buffer for BTA
extractions, a suspension of the magnetic particles, isopropanol to
promote proper binding, three separate wells for wash buffer, and
the elution buffer. See Fig. 2 for a visual representation of the
reagent cartridge. The lysate tubes, a set of pipette tips and tip
holders, and the elution tube are lined up for each sample to a
reagent cartridge. One tip/tip holder and one cartridge are used
per sample [1, 2, 10].

2 Materials

Reusable instruments, like forceps, scissors, etc., should be steri-

lized prior to use and decontaminated in between use. Plastics
(pipette tips and tubes) should be DNase- and RNase-free. Aero-
sol-resistant/barrier pipette tips are highly recommended for
extraction procedures. All reagents should be prepared with molec-
ular biology grade DNA-free water.
58 Megan M. Foley

Fig. 2 Visual representation of the single-sample reagent cartridge used for the AutoMate Express™ semi-
automated workflow. The cartridge contains 12 wells: 10 are sealed with extraction reagents/empty and 2 are
left open for heating. Tubes labeled 1 and 0 represent the sample tube which contains the lysate and the
empty elution tube. Slots 8–10 will be empty. (Reproduced from ref. [17]. Figure owned by Life Technologies
Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific
Inc. Used under permission)

2.1 Manual 1. Isopropanol.

PrepFiler™ 2. 1X Phosphate-Buffered Saline (PBS) (see Note 1).
Extractions
3. 20 mg/mL Proteinase K: Store at the manufacturer indicated
temperature. If the preparation requires freezing, store as ali-
quots at -20 °C and limit freeze/thaw events. This is for use
with the PrepFiler™ Forensic DNA Extraction Kit only, when
required (see Note 2). Samples processed with the PrepFiler™
BTA Forensic DNA Extraction Kit will utilize Proteinase K
supplied with the kit.
4. Low-TE Buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0; aka
TE-4 (see Note 2).
5. 10% Sodium Dodecyl Sulfate (SDS) (see Note 3).
6. PrepFiler™ Forensic DNA Extraction Kit: Contains PrepFi-
ler™ Lysis Buffer (see Note 4); PrepFiler™ Magnetic Particles;
PrepFiler™ Wash Buffer A Concentrate (×2 bottles); PrepFi-
ler™ Wash Buffer B Concentrate (×2 bottles); PrepFiler™
Elution Buffer; PrepFiler™ Filter Columns; PrepFiler™ Spin
Tubes; 1.5 mL non-stick RNase-free microcentrifuge tubes;
and 2.0 mL microcentrifuge tubes with screw caps. Store all
components at room temperature upon receipt, except the
magnetic particles. These should be stored at 4–8 °C until
first use, then at room temperature. To prepare a working
stock of the concentrated wash buffers, add 93 mL of 95%
ethanol to one of the Wash Buffer A concentrate bottles and
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 59

19.5 mL of 95% ethanol to one of the Wash Buffer B concen-

trate bottles. Diluted wash buffers expire 6 months after prep-
aration when stored at room temperature (see Note 5).
7. PrepFiler™ BTA Forensic DNA Extraction Kit: Contains Pre-
pFiler™ Lysis Buffer (see Note 4); PrepFiler™ BTA Lysis
Buffer (see Note 4); PrepFiler™ Magnetic Particles; PrepFi-
ler™ Wash Buffer A Concentrate (×2 bottles); PrepFiler™
Wash Buffer B Concentrate (×2 bottles); PrepFiler™ Elution
Buffer; PrepFiler™ Filter Columns; PrepFiler™ Spin Tubes;
20 mg/mL Proteinase K; 1.5 mL non-stick RNase-free micro-
centrifuge tubes; 2.0 mL microcentrifuge tubes with screw
caps. Store all components at room temperature upon receipt,
except the magnetic particles. These should be stored at 4–8 °C
until first use, then at room temperature. Prepare a working
stock of the concentrated wash buffers as described for the
standard PrepFiler™ kit (see Subheading 2.1, item 9).
8. Oven for heating buffer containers.
9. Magnetic stand(s): Recommend those that hold 16 microcen-
trifuge tubes.

2.2 Semi-automated 1. PrepFiler Express™ Forensic DNA Extraction Kit: Contains

PrepFiler™ PrepFiler™ LySep Columns; Hingeless 1.5 mL PrepFiler™
Extractions Using the Sample Tubes (no caps); PrepFiler™ Elution Tubes; PrepFi-
AutoMate Express™ ler™ Lysis Buffer (see Note 4); PrepFiler Express™ Cartridges;
and Automate Express™ Tips and Tip Holders. Store all com-
ponents at room temperature.
2. PrepFiler Express BTA™ Forensic DNA Extraction Kit: Con-
tains PrepFiler ™ LySep Columns; Hingeless 1.5 mL PrepFi-
ler™ Sample Tubes (no caps); PrepFiler™ Elution Tubes;
PrepFiler™ BTA Lysis Buffer (see Note 4); PrepFiler Express™
Cartridges; AutoMate Express™ Tips and Tip Holders; PrepFi-
ler™ Bone and Tooth Lysate Tubes; PrepFiler™ Bone and
Tooth Lysate Tube Caps; and 20 mg/mL Proteinase K. Store
all components at room temperature.
3. AutoMate Express™ Forensic DNA Extraction System: Con-
tains PrepFiler Express™ and/or PrepFiler Express™ BTA Pro-
tocol Card; AutoMate Express™ Tip and Tube Rack; AutoMate
Express™ Cartridge Rack; and D-ring Exchange Tools, Silicone
Greats, and D-rings.

2.3 Shared Materials 1. Thermomixer (see Note 6) or heat block for microcentrifuge
for Manual and tubes (see Note 7).
Robotic Extractions 2. PCR hood.
3. Sterile forceps.
60 Megan M. Foley

4. 1.0 M solution DL-Dithiothreitol (DTT): Molecular weight is

154 g/mol. Store as aliquots at -20 °C and limit freeze/thaw
events (see Note 8).

3 Methods

Before beginning extraction, ensure that all reagents are within

expiration and that all necessary equipment and consumables are
stocked. Prepare all documentation worksheets with appropriate
information (e.g., sample names, elution volumes, etc. (see Note
9)). A reagent blank should be included in each extraction batch,
and, if desired, a positive extraction control containing DNA from a
known source. Hair nets, a face mask, and gloves must be worn
throughout this procedure, changing gloves often and when neces-
sary, like before touching any sample tubes, or when a sample may
have contaminated the glove.

3.1 Preparation for 1. To prepare the magnetic beads, set a thermomixer or heat bath
Manual Extraction to 37 °C. Once up to temperature, incubate the bead tube for
10 min (see Note 10). Allow the DTT and Proteinase K (if fro-
zen and if processing paraffin-embedded tissue) to come to
room temperature.
2. If precipitate is visible in the lysis buffer, preheat an oven or
heat bath to 37 °C and incubate the bottle for 15 min. Vortex
for at least 5 s.
3. For the standard PrepFiler™ kit, preheat the thermomixer to
70 °C. If extracting DNA from nail clippings, preheat one
thermomixer to 37 °C and a second to 50 °C (see Note 11).
For PrepFiler™ BTA kit and paraffin-embedded samples, pre-
heat the thermomixer to 56 °C.
4. For bone, tooth, or tape samples using the BTA kit, label a
2.0 mL screw-cap tube with the appropriate sample informa-
tion. For all other BTA samples and the standard kit, label a
1.5 mL microcentrifuge tube or a PrepFiler™ Spin Tube.
Carefully transfer the sample into the appropriately labeled
tube, utilizing sterile forceps if necessary (see Note 12). For
recommended sample input size based on sample type, see
Table 1.

3.2 Sample Lysis for 1. Blood/soil mixture samples and paraffin-embedded tissue samples
Manual Extraction must go through an additional preparation step (see Subhead-
ing 3.2, steps 2 and 3–5, respectively). Epithelial and sperm
fractions from differential extractions do not need this step and
can proceed to manual DNA isolation and purification (see
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 61

Table 1
PrepFiler™/BTA manual extraction sample types and recommended sample input

Protocol
type Sample type Recommended sample input
Standard Liquid samples ≤40 μL
Standard Blood on a substrate Punch or 5 × 5 mm cutting
(e.g., FTA card)
Standard Saliva or semen on substrate Punch or 5 × 5 mm cutting
(e.g., fabric)
Standard Bodily fluid swabs One swab or less
Standard Tissue fragment One swab or less
Modified Blood/soil mixture ≤50 mg
Modified Differentially separated samples—epithelial and sperm Epithelial fraction ≤150 μL
fractionsa Sperm fraction ≤200 μL
Modified Hair root 3 mm cutting from root
Modified Nail ≤5 mm clipping
Modified Paraffin-embedded tissue 3 × 3 mm of tissue or 5 × 5 tissue
slide
BTA Bone—powdered ≤50 mg
BTA Tooth—powdered ≤50 mg
BTA Cutting of envelope flaps 1 × 1.5 cm
BTA Chewing gum ≤50 mg (or 3 × 5 × 5 mm)
BTA Tissue fragment One swab or less
BTA Cigarette butt filter paper 5 × 5 mm cutting
BTA Tape lift—saliva or blood 5 cm2 cutting
Recommended sample inputs are ideal sample amounts. Based on state laws for sample preservation, consumption of the
full amount of sample may not be allowed. Additional factors should be considered and the above table used as a guide
(e.g., degraded/aged samples, presence of inhibitors, or the nature of the substrate). Samples labeled as protocol type
“Standard” can be extracted following the common sample PrepFiler™ protocol. Samples labeled as “Modified” are
extracted following steps that deviate from the standard PrepFiler™ protocol. Samples labeled as protocol type “BTA”
should follow any procedural steps specific to the BTA kit
a
For differential samples, follow validated procedures for differential separation of epithelial and sperm cells. The large
volume sample protocol can be followed for any common sample type that isn’t fully covered by 300 μL of master mix. An
example sample type that may require the large volume protocol is a touch DNA swab that requires three swabs for
sample collection due to the large surface area collected

Subheading 3.3, step 1). For all other samples, prepare the
specified extraction master mix (see Subheading 3.2, step 6).
2. For blood/soil mixture samples, aliquot 100 μL of 1X
phosphate-buffered saline to each sample/control tube and
close the cap. Vortex for 10 s and centrifuge for 30 s. Do not
exceed 30 s (see Note 13). Transfer the supernatant to a newly
62 Megan M. Foley

labeled 1.5 mL microcentrifuge tube, carefully avoiding any of

the sediment at the bottom of the tube. Proceed to Subheading
3.2, step 7.
3. For paraffin-embedded tissue sample, prepare a minimum of
1 mL of Proteinase K lysis master mix in an appropriately
sized tube (e.g., 5 mL, 15 mL conical tubes, etc.) composed
of 980 μL of low-TE Buffer, 5 μL of 10% SDS, and 15 μL of
Proteinase K (see Note 14).
4. Aliquot 100 μL of the master mix to each tube. Incubate for
60 min at 56 °C at 900 RPM (see Notes 15 and 16). During
this time, preheat a second thermomixer to 95 °C. After the
first incubation is finished, transfer the tubes to the second
thermomixer and incubate for another 15 min at 95 °C at
900 RPM.
5. Remove the tubes from the thermomixer and cool for at least
5 min. Centrifuge for 30 s at 16,000 × g. Proceed to Subhead-
ing 3.2, step 7.
6. For all other samples, prepare an extraction master mix in an
appropriately sized tube (e.g., 5 mL, 15 mL conical tubes,
etc.). See Table 2 for reagent volume specifications for the
different sample types (see Note 17). Proceed to Subheading
3.2, step 7.
7. Add the master mix (or indicated reagent) to each sample (see
Note 15 and Table 2). Vortex each sample/control for 5 s and
pulse spin to remove any liquid from the cap.
8. Perform the first incubation (see Notes 16 and 18). Place each
tube into the pre-heated thermomixer. See Table 3 for incuba-
tion parameters specific for each sample type. For nail clippings,
preheat a second thermomixer for 70 °C. After the first incu-
bation is complete, centrifuge the nail clippings at 16,000 × g
for 5 s and transfer the supernatant to a new labeled 1.5 mL
microcentrifuge tube (leave the nail clipping in the initial tube).
Cap and incubate the transferred supernatant for an additional
20 min at 70 °C at 900 RPM.
9. While the samples are incubating, prepare for the next incuba-
tion (see Note 19). For the standard kit, prepare an assembly for
each sample/control tube by placing a PrepFiler™ Filter Col-
umn into a labeled PrepFiler™ Spin Tube and close the cap.
For the BTA kit, prepare a new set of labeled 1.5 mL micro-
centrifuge tubes for all sample types. For non-bone and tooth
samples with the BTA kit, also prepare an assembly for each
sample/control tube by placing a PrepFiler™ Filter Column
into a labeled PrepFiler™ Spin Tube and close the cap.
10. Once the first incubation is complete, set the thermomixer to
room temperature (see Note 19) and briefly centrifuge or pulse
spin all tubes to remove any condensation from the top and
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 63

Table 2
PrepFiler™/BTA manual extraction master mix specifications

PrepFiler™/BTA Proteinase Master mix dispensed

Sample type Lysis Buffer DTT K per sample
Common samples (non-semen) or 300 μL 3 μL Not used 300 μL
nail clippings
Semen (non-differential) 300 μL 5 μL Not used 300 μL
Hair 100 μL 3 μL Not used 103 μL
Blood/soil mixtures Pipette 500 μL of PrepFiler™ Lysis Buffer into each tube
Paraffin-embedded tissue Pipette 500 μL of PrepFiler™ Lysis Buffer into each tube
Large volume samples 500 μL 5 μL Not used 500 μL
(non-semen)
Large volume semen samples 500 μL 8 μL Not used 503 μL
BTA samples 220 μL 3 μL 7 μL 230 μL
This table displays the volumes of reagents per sample in the preparation of the master mix per sample type. For BTA
samples, use the kit supplied PrepFiler™ BTA Lysis Buffer and Proteinase K. For all other sample types, use the standard
PrepFiler™ Lysis Buffer. The final volume of the master mix that will be aliquoted into each sample/control tube is
designated in the final column

Table 3
PrepFiler™/BTA manual extraction lysis incubation specifications

Temperature Mix settings Duration

Sample type (°C) (RPM) (min)
Liquid bodily fluid (standard or large) and paraffin- 70 900 20
embedded tissue samples
Dried stain (standard or large) and hair samples 70 900 40
Non-differential semen samples (standard or large) 70 900 90
Blood/soil mixture samples 70 900 30
Nail clippings (first incubation) 37 900 20
Nail clippings (next incubation) 70 900 20
BTA bone and teeth samples 37 1100 120
Other BTA samples 37 900 40
The incubation parameters and time based on sample type

sides. Transfer the lysate into the corresponding filter column

assembly using a 1000 μL pipette. Next, transfer the substrate
(if present) into the filter using sterile forceps, and cap the
assembly.
64 Megan M. Foley

11. Centrifuge according to sample type (see Note 20). For the
standard kit and extraction of all common samples (standard or
large), hair samples, nail clippings, or paraffin-embedded tissue
samples, centrifuge for 2 min at 14,000 × g or 5 min at
4000 × g. For the standard kit and extraction of blood/soil
mixture samples, centrifuge for 5 min at maximum speed,
ideally 16,000 × g. For the BTA kit and extraction of bone,
tooth, or chewing gum samples, centrifuge for 90 s at
10,000 × g. For any remaining BTA sample types, centrifuge
for 90 s at 8000 × g.
12. After centrifugation, ensure that each lysate is at a total volume
of at least 180 μL. Any samples less than 180 μL should be
centrifuged again for 5 min. If the sample is still below 180 μL,
bring it up to a volume of 300 μL with PrepFiler™/BTA Lysis
Buffer. Retain or dispose of the cutting/substrate based on
laboratory procedures. Standard samples must be between
180 μL and 300 μL for proper extraction.
13. For blood/soil mixtures, paraffin-embedded tissue samples, and
all BTA samples, transfer the supernatant to a new labeled
1.5 mL microcentrifuge tube without transferring any sedi-
ment (see Note 21).
14. Let the samples/controls come to room temperature after
incubation. This step takes around 5 min (see Note 22).
15. For all BTA samples, add 300 μL of PrepFiler™ Lysis Buffer
(not BTA Lysis Buffer) to each sample/control, cap, vortex,
and pulse spin.
16. Proceed to manual DNA isolation and purification (see Sub-
heading 3.3, step 2; Note 23).

3.3 DNA Isolation 1. For epithelial and sperm fractions processed via a differential
and Purification for extraction procedure (not processed through Subheading 3.2),
Manual Extraction add 300 μL or 500 μL of PrepFiler™ Lysis Buffer, respectively.
If following the input sizes in Table 1, add an additional 150 μL
or 100 μL of buffer, respectively.
2. Vortex the PrepFiler™ Magnetic Particles and invert the tube
multiple times to mix the beads into the solution. Do not
centrifuge; flick the tube downwards if liquid remains on the
cap. During storage, the beads settle at the bottom of the tube
(see Note 24).
3. Add the appropriate volume of beads to each sample/control
based on sample type (see Table 4) and close the lid.
4. Vortex each tube for 10 s at a low speed (500–1200 RPM) and
pulse spin (see Note 25). Add isopropanol based on the sample
types listed in Table 4 below.
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 65

Table 4
PrepFiler™/BTA manual extraction magnetic reagent incubation volume specifications

Sample type Volume of magnetic beads Volume of isopropanol

Standard common samples 15 μL 180 μL
Differential epithelial fraction 15 μL 180 μL
Differential sperm fraction 15 μL 300 μL
Hair samples 15 μL 100 μL
Paraffin-embedded tissue samples 15 μL 300 μL
Nail clippings 15 μL 180 μL
Large volume samples 15 μL 300 μL
Blood/soil mixture samples 20 μL 300 μL
BTA samples 15 μL 300 μL
The magnetic bead and isopropanol volumes based on sample type

5. Vortex the samples at low speed and place them on the thermo-
mixer. Incubate the samples on the thermomixer for 10 min at
room temperature at 1000 RPM.
6. After the second incubation, vortex each sample at maximum
speed for 10 s and pulse spin (see Note 26). Set the thermo-
mixer to 70 °C for the next incubation step.
7. Place each tube in a slot of the magnetic stand. For the standard
kit, wait 1–2 min for a pellet to form towards the magnet of the
stand. For the BTA kit, wait 10 min for a pellet to form (see
Note 27 and Fig. 3).
8. Remove the supernatant and discard using a 100 μL pipette.
Do not remove any of the magnetic particles (see Note 28).
9. Wash the DNA-bound magnetic particles by adding 600 μL of
the diluted PrepFiler™ Wash Buffer A to each tube (see Notes
29–31). Vortex each tube and pulse spin. Place each tube back
into a slot in the magnetic stand. Wait 60 s for a pellet to form
towards the magnet of the stand (see Note 32). Remove and
discard the supernatant using a 100 μL pipette, again ensuring
that the pellet is not disturbed. Repeat this wash procedure
using 300 μL of the diluted PrepFiler™ Wash Buffer A, fol-
lowed by 300 μL of the diluted PrepFiler™ Wash Buffer B, for
a total of three washes.
10. After the third wash, centrifuge all samples for 30 s at a low
speed to pull any residual wash buffer to the bottom of the
tube. Place back on the magnetic stand and remove any leftover
supernatant.
11. Proceed to manual DNA concentration and elution (see Sub-
heading 3.4, step 1).
66 Megan M. Foley

Fig. 3 Formation of pellet. A visualization of the tube placement within the

magnetic stand with the bead pellet forming towards the magnet. The magnet in
the top picture will be behind the tube and in the bottom picture will be on the left
side. (Reproduced from ref. [3]. Figure owned by Life Technologies Corporation,
a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo
Fisher Scientific Inc. Used under permission)

3.4 DNA 1. Once the third wash supernatant has been removed, open the
Concentration and tube(s), and air-dry the particles for 7–10 min. To decrease the
Elution for Manual chance of contamination, ensure that the rack is placed in a
Extraction sterile space like a PCR hood and closed off during this time so
that nothing is passed over the open tubes (see Note 33).
2. Add 50 μL of the PrepFiler™ Elution Buffer to each sample/
control (see Note 34). Vortex for 5 s and pulse spin. Ensure
that the magnetic beads have been resuspended in the buffer
(see Note 35). Then immediately place each tube in the pre-
heated thermomixer (see Note 36). For the standard kit, incu-
bate for 5 min at 70 °C at 900 RPM. For the BTA kit, incubate
for 10 min at 70 °C at 900 RPM. During the incubation, label a
set of 1.5 mL elution tubes.
3. After incubation, vortex samples for 2 s and pulse spin. Imme-
diately place the tubes in the magnetic stand. Wait 1–5 min for
a pellet to form towards the magnet of the stand.
4. Remove the supernatant (contains the DNA) carefully to avoid
disturbing the pellet and place it into the appropriately labeled
1.5 mL elution tube (see Note 37). If the eluant is cloudy,
centrifuge the sample for 5 min at 10,000 × g, return the tube
to the magnet stand, and transfer the supernatant into a labeled
1.5 mL microcentrifuge tube (see Note 38).
5. Purified extracts may proceed immediately to DNA quantita-
tion or should be stored at -20 °C for long-term storage or
4 °C for short-term storage (up to 1 week).
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 67

3.5 Preparation for 1. Preheat the thermomixer. For standard samples, heat the ther-
the Semi-automated momixer to 70 °C. For BTA samples, heat the thermomixer to
PrepFiler Express™ 56 °C.
Standard and BTA 2. Check the PrepFiler™ (or BTA) Lysis Buffer for crystals. If
Extraction Using the precipitate is visible, heat the bottle to 37 °C in an oven. Vortex
AutoMate Express™ the bottle to ensure all crystals have resolubilized.
3. Insert a PrepFiler™ LySep Column into a hingeless PrepFi-
ler™ Sample Tube. Close the cap to decrease the chance of
contamination (see Note 39). This assembly should be
prepared for each sample/control to be extracted. Label the
top of the column and side of the tube with the appropriate
sample information (see Note 40). If extracting bone and/or
teeth, utilize the supplied PrepFiler™ Bone and Tooth Lysate
tubes and caps. No column is utilized for this sample type.
4. Carefully transfer the sample into the appropriately labeled
tube, utilizing sterile forceps if necessary (see Note 41).
5. For recommended sample input based on sample type, see
Table 5.
6. Label the top and sides of a PrepFiler™ Elution Tube for each
sample/control for later use.

Table 5
PrepFiler/BTA Express™ semi-automatic extraction sample types and recommended sample input

Protocol/Kit type Sample type Recommended sample input

PrepFiler Express™ Liquid samples ≤40 μL
PrepFiler Express™ Blood on a substrate (e.g., FTA card) Punch or 5 × 5 mm cutting
PrepFiler Express™ Saliva or semen on substrate (e.g., Punch or 5 × 5 mm cutting
fabric)
PrepFiler Express™ Bodily fluid swabs One swab or less
PrepFiler Express™ Hair root 5 mm cutting from root
PrepFiler Express Bone—powdered ≤50 mg
BTA™
PrepFiler Express Tooth—powdered ≤50 mg
BTA™
PrepFiler Express Chewing gum ≤50 mg or a 3 × 3 × 5 mm
BTA™ section (see Note 41)
PrepFiler Express Cigarette butt filter paper 5 × 5 mm cutting split into 2–3
BTA™ pieces
PrepFiler Express Tape lifts 2 × 2 cm cutting (see Note 42)
BTA™
Recommended sample inputs are ideal sample amounts. Based on state laws for sample preservation, the full amount may
not be allowed. Additional factors should be considered and the above table used as a guide (e.g., degraded/aged
samples, presence of inhibitors, or the nature of the substrate). The Protocol/Kit column informs what type of kit and
protocol card should be used for the specific sample types
68 Megan M. Foley

7. Proceed to sample lysis using the AutoMate Express™ (see

Subheading 3.6, step 1).

3.6 Sample Lysis for 1. Allow the DTT to come to room temperature.
Semi-automated 2. Prepare an extraction master mix in an appropriately sized tube
PrepFiler Express™ (e.g., 5 mL, 15 mL conical tubes, etc.) (see Note 17). For
Standard and BTA standard samples, combine 500 μL of PrepFiler™ Lysis Buffer
Extraction Using the and 5 μL of DTT per sample. For BTA samples, combine
AutoMate Express™ 220 μL of PrepFiler™ Lysis Buffer, 3 μL of DTT, and 7 μL
of Proteinase K per sample.
3. For standard samples, add 500 μL of master mix to each sam-
ple/control assembly and close the lid. For BTA samples, add
230 μL of master mix to each sample/control assembly and
close the tube by screwing on the supplied cap. Vortex and
pulse spin for 5 s (see Notes 15, 17, and 42–44).
4. For standard samples, place each assembly into the pre-heated
thermomixer (70 °C). Incubate for 40 min at 750 RPM (see
Note 45); the master mix and sample/control sit in the upper
part of the LySep column for the incubation. For bone and
teeth samples, place each tube into the pre-heated thermomixer
(56 °C). Incubate for 2–18 h at 1100 RPM. For adhesive
samples, place each assembly into the pre-heated thermomixer
(56 °C). Incubate for 40 min at 750 RPM (see Note 45).
5. Prepare the sample and reagent racks during incubation. Open
the instrument by sliding the front door upwards. Remove the
two racks from within. The AutoMate Express™ Cartridge
Rack is located towards the back of the instrument, and the
AutoMate Express™ Tip and Tube Rack is located nearest the
door (see Fig. 6). Lift each rack straight up and remove it from
the instrument (see Note 46).
6. Load the Reagent Cartridge Rack. Remove a reagent cartridge
from the plastic container. Before loading a reagent cartridge,
ensure that all reagents and appropriate volumes are visible. Do
not remove the foils. If any precipitation is observed, incubate
the cartridge for around 30 min at 37 °C the day of the run
until no crystals are observed. Load the cartridge by sliding
along the groove in the direction of the arrow etched into the
rack. Once the cartridge is in all of the way, it should click into
place. Each cartridge contains a notch that should directly line
up with the notches on the Reagent Cartridge Rack (see Fig. 4).
A maximum of 13 samples/controls can be processed at a time
(see Note 47).
7. Load the Tip and Tube Rack (see Fig. 5) as described.
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 69

Correct

Slide cartridge until

notches align and
cartridge clicks into place

Fig. 4 Proper insertion of reagent cartridge into the reagent rack. A visualization of the lineup of the notches of
the reagent cartridge and the cartridge rack. If a reagent cartridge is not properly inserted, this can result in an
instrument error. For example, because the instrument follows an exact axis alignment, if the reagent
cartridge is not lined up correctly, the tip may hit the plastic instead of entering into the reagent. This can
lead to severe issues and instrument down-time. (Reproduced from ref. [17]. Figure owned by Life Technol-
ogies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher
Scientific Inc. Used under permission)

8. Row S (last row towards the back of the instrument): capless

labeled lysate PrepFiler™ sample tubes only, no columns—
insert during Subheading 3.6, step 14.
9. Row T2: One pair of AutoMate Express™ tips and tip holders
per sample.
10. Row T1: Empty, used for other applications.
11. Row E (first row closest to the window of the instrument):
labeled PrepFiler™ 1.5 mL elution tubes. Caps can remain
closed during this step to decrease the chance of contamina-
tion. They can be removed before inserting the tray into
instrument.
12. Centrifugation of incubated samples. For common and adhesive
samples, remove all samples/controls from the thermomixer
and centrifuge the assemblies for 2 min at 10,000 × g. For
bone and tooth samples, remove all samples/controls from the
thermomixer and centrifuge the assemblies for 90 s at
10,000 × g.
13. If there is any liquid lysate in the column section after centrifu-
gation, re-centrifuge for 5 min or pipette into the sample tube.
70 Megan M. Foley

Fig. 5 Tip and tube holder rack. A visualization of the placement of consumables into the tip and tip holder
rack. Row 1—sample lysate tubes; this is towards the back of the instrument. Row 2—tips and tip holders.
Row 3—empty. Row 4—elution tubes; this is the closest to the door of the instrument. (Reproduced from ref.
[2]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.
com). © 2023 Thermo Fisher Scientific Inc. Used under permission)

For standard samples, an optimal volume of at least 300 μL

should be extracted. If the volume is still below 300 μL, bring it
to volume with additional PrepFiler™ Lysis Buffer. For BTA
samples, a minimum of 200 μL should be extracted. Bring it to
volume with additional PrepFiler™ BTA Lysis Buffer. Less
than the optimal volume can cause issues with the DNA bind-
ing to the magnetic beads, air bubbles, or improper mixing (see
Note 48).
14. Transfer the assembly into the appropriate column of the Tip
and Tube Rack in row “S.” Remove the columns/caps one at a
time (see Note 49). Retain the cutting or dispose based on
laboratory’s procedures.
15. Before loading into the instrument, verify that all samples line
up with the appropriately labeled elution tube and each sample
has a corresponding tip, tip holder, and reagent cartridge.
16. Immediately proceed to DNA extraction with the AutoMate
Express™ (see Subheading 3.7, step 1).
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 71

3.7 DNA Extraction 1. Prepare the AutoMate Express™. Confirm that the appropriate
on the AutoMate card is loaded into the instrument. The power switch should be
Express™ Robot turned to OFF (see Notes 50 and 51).
2. On the front of the instrument in the lower left quadrant is a
black protocol card slot. To remove the installed card, lift the
cover and push the black button. This pushes the card out. If
the card is not the appropriate protocol, remove and insert the
appropriate card.
3. Press the appropriate protocol card into the slot. The arrow
should be pointing towards the instrument. The label side
should be facing to the left side. Once the card is inserted,
the door to the card slot can be closed.
4. Power the instrument to the ON position (see Note 52). The
instrument begins reading the protocol card and should display
protocol information. Once the protocol has been loaded, the
“Main Menu” is visible.
5. Open the AutoMate Express ™ door. First, insert the loaded
Reagent Cartridge Rack (see Note 53).
6. Check each reservoir that contains the magnetic beads to
ensure that they are resuspended (see Note 54).
7. Next, insert the loaded Tip and Tube Rack into the front
position of the instrument. Row “E” should be closest to the
door (see Fig. 6). At this time, open each elution tube and settle
the cap into the open slot at the front of the tray (see Note 55).
Slide the instrument door closed.

Fig. 6 Loading of the AutoMate Express™. A visualization of the placement of

the Reagent Cartridge Rack and the Tip and Tube Rack for extraction inside of
the AutoMate Express™. (Reproduced from ref. [2]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.
thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)
72 Megan M. Foley

8. Start the extraction run. From the “Main Menu” on the digital
display, press “START.”
9. Next, a series of prompts are available to help verify the kit type
and position of the different consumables. Step through each
of these prompts by pressing the Enter key (icon of a down and
left arrow at the bottom right corner of the keypad) and double
check that each of the commands is correct.
10. The next display asks which script is being used. Press the
appropriate option: “1” for PF Express, “2” for PF
Express BTA.
11. The next display asks for elution volume settings. Press the
appropriate option: “1” for 20 μL, “2” for 30 μL, “3” for
40 μL, “4” for 50 μL, “5” for 100 μL, “6” for 200 μL, or
“7” for 250 μL (see Note 56).
12. The last display repeats the options chosen. Verify that each is
correct. If any information is incorrect, press “ESC” until the
parameter screen appears and choose the correction option. To
cancel the run, press “STOP” twice to return to the
main menu.
13. Press “START” to begin the extraction. During the extraction
process, a timer provides an estimated time until the run is
complete and a short description is displayed of the step being
performed by the instrument.
14. Once the run has finished, there is a beep and the display
switches to “Finished Protocol.” Press “Enter” to return to
the main menu.
15. Open the instrument door and close each of the elution tubes.
Remove the Tip and Tube Rack. Replace the elution caps
and move elution tubes to an appropriate location and discard
remaining contents into the appropriate biohazard location.
Remove the Reagent Cartridge Rack and discard used reagent
cartridges into the appropriate biohazard location.
16. If the eluant is cloudy, centrifuge the sample for 5 min at
10,000 × g, return the tube to the magnet stand, and transfer
the supernatant into a labeled 1.5 mL microcentrifuge tube (see
Note 38).
17. Before turning the instrument off, make sure the proper main-
tenance is performed (see Subheading 3.8, steps 2–6).
18. Purified extracts may proceed immediately to DNA quantita-
tion or should be stored at -20 °C for long-term storage or
4 °C for short-term storage (up to 1 week).
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 73

3.8 Post-Run 1. The following procedures should be performed after every run.
Instrument 2. Clean the inside of the instrument, including the syringe unit,
Maintenance using deionized water on a disposable laboratory wipe, fol-
lowed by 70% ethanol on another laboratory wipe. Do not
utilize acidic or basic reagents, like bleach, to clean the instru-
ment. PrepFiler™ reagents utilize guanidine thiocyanate,
which when mixed with these reagents, may create toxic gases.
3. At the bottom of the inside of the robot is a removable metal
tray that sits underneath the racks. Remove the tray and wipe its
surface clean with a disposable laboratory wipe moistened with
deionized water, followed by another wipe moistened with 70%
ethanol. This should only be performed when the instrument is
off. Reinsert the tray properly.
4. The clear door panel can be wiped with a disposable laboratory
wipe moistened with deionized water.
5. The Reagent Cartridge Rack, the Tip and Tube Rack, and the
magnets within the instrument should be wiped with a dispos-
able laboratory wipe moistened with deionized water, followed
by another wipe moistened with 70% ethanol.
6. The piercing units should be cleaned in the same manner as
above. To access the piercing units, turn the instrument
on. From the main menu, press “1” to display the “Man”
screen. From here, press “3” for “Clean,” and then “1” to
lower the piercing unit. Wipe the tips (see Note 57). Once
finished, press “ESC” to return the piercing unit to the running
position.

3.9 Bi-weekly 1. On a bi-weekly basis, perform maintenance on the D-rings (see

Instrument Note 58). With gloves, apply vacuum-type silicon grease to the
Maintenance tip of a finger. Apply the grease on the surface of the D-rings on
each nozzle of the syringe unit (see Note 59). Wipe off excess
grease that can be seen on the edge of the nozzles utilizing
either a disposable laboratory wipe or dust-free cloth.

3.10 Monthly 1. The following procedures should be performed monthly.

Instrument 2. Perform the Axis test (see Note 60): before beginning, load
Maintenance empty reagent cartridges into the Reagent Cartridge Rack.
Load the Tip and Tube Rack with empty tips/tip holders and
tubes into each position (see Note 61). Although the extraction
run only requires one row of tips and tip holders, fill Row T1
and T2 for the axis test. Place the racks back into their posi-
tions. Press “3” on the main menu to pull up the “Tests”
screen. Press “1:Axis” to choose the axis test. Press “Start.”
The estimated run time is 3 min. If no problem is detected, the
screen displays “All OK.” If a problem is detected, an error
74 Megan M. Foley

code is displayed. Contact Thermo Fisher with the error code.

Once finished, press “ESC” to return.
3. Perform the temperature test (see Note 62): Press “3” on the
main menu to pull up the “Tests” screen. Press “2:Temp” to
choose the temperature test. Press the up-arrow button to
increase the temperature to 60 °C; the default is 25 °C when
first turned on. Press “Start.” The temperature slowly rises
within the heating block, displayed as “Now Temp.” When
the temperature reaches the “Set Temp” of 60 °C, the
“Alarm Value” turns to “00.” The estimated heating time is
about 5 min. Verify that this has occurred. Contact Thermo
Fisher if any errors occurred. Once finished, press “ESC” to
return.

3.11 Yearly 1. The following procedures should be performed yearly or every

Instrument 200 extractions (see Note 63).
Maintenance 2. Replace the D-rings: remove each D-ring from the nozzle of
the syringe unit by pulling the ring out using sterile forceps or
pliers, and then slide it from under the nozzle. Grease each
nozzle by applying a small dab of silicon grease to a gloved
finger and gently apply. Next, take a new D-Ring and slide back
onto a greased nozzle (see Fig. 7). Verify that the D-ring is
correctly inserted. Using a lint-free laboratory wipe, wipe off
excess grease that is on each nozzle.

Fig. 7 D-ring maintenance. A visualization of the addition of a new D-ring to the

nozzle using the tool supplied in the installation package. (Reproduced from ref.
[2]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher
Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc.
Used under permission)
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 75

4 Notes

1. Only needed if processing blood/soil mixture samples.

2. Only needed if processing paraffin-embedded tissue samples.
Additionally, low-TE may be used as an elution matrix in place
of the kit-supplied elution buffer.
3. Only needed if processing paraffin-embedded tissue samples.
4. Author recommends having a separate biohazard container for
kit contents and consumables for materials containing the Pre-
pFiler™/BTA Lysis Buffer. Components of the buffer (e.g.,
guanidine thiocyanate) can react with bleach/acid to create a
toxic gas. Handle with appropriate safety protective
equipment.
5. Only prepare one wash bottle at a time to lengthen the expira-
tion of the unopened bottle. Mark the bottle with “diluted,”
initials, and date prepared to avoid future confusion.
6. The manufacturer recommends a thermomixer, as the proce-
dure was not fully evaluated using a heat block, and DNA
recovery may be decreased without agitation. Author recom-
mends having at least two thermomixers for this procedure as
there are multiple incubation steps at a range of temperatures.
Only having one requires additional time between steps in
order to cool or heat up to the next required temperature.
7. Because of the additional height of the column, the assembly
may not fit in all standard microcentrifuges. Before performing
the first extraction, make sure that the lab has an appropriately
sized microcentrifuge.
8. If a large batch is made, smaller aliquots can be prepared of
100 μL or greater and stored in individual 0.5 mL microcen-
trifuge tubes in the freezer (around -20 °C). Once a tube has
been thawed for use, the tube should be thrown away even if
liquid is left. Aliquoting into smaller tubes allows for more
efficient usage. DTT begins to degrade after 6 months; there-
fore, a new fresh batch should be prepared and aliquoted.
9. Samples should be batched based on the sample type. Some
samples require additional sample preparation. Reagent
volumes and incubation times vary depending on the
sample type.
10. Never leave the magnetic bead tubes open. This leads to evap-
oration of the buffer, which leads to an improper ratio of the
magnetic beads to buffer. Additionally, the reagent will run out
before the intended sample number.
11. Laboratories should conduct internal validation studies if they
wish to adjust the temperature. The manufacturer
76 Megan M. Foley

recommends a range of 50–80 °C and emphasizes that tem-

peratures should not exceed this range.
12. To save a step, the author recommends collecting the sample in
a 1.5 mL microcentrifuge tube or the kit’s Spin Tube during
sample collection for storage until extraction. The extraction
master mix can be directly added to this tube.
13. This causes the sediment to clump at the bottom of the tube
and doesn’t allow for thorough mixing to extract DNA.
14. Even though 100 μL of the Proteinase K lysis master mix is
added to each paraffin-embedded tissue sample, a minimum of
1 mL of the mix should be prepared to avoid pipetting low
volumes of SDS and proteinase K. If more than nine samples/
controls are being processed, prepare an appropriate overall
volume to maintain the reagent ratios and include extra for
pipetting overages. Be sure to use an external proteinase K
source (see Subheading 2.1, item 3), as this reagent is not
supplied with the PrepFiler™ kit. After combing the necessary
reagents, vortex the master mix and flick the tube downward to
get any liquid off of the cap.
15. Make sure that a new pipette tip is used for each sample and
that the entire substrate is covered in liquid. Close the lid
tightly to ensure that no liquid leaks out during incubation.
16. If using a heat block, the same temperature and times should
be followed. Vortex and pulse spin the tubes every 5 min
during the incubation for optimal extraction.
17. When preparing the designated master mix, multiply these
reagent volumes by the total number of samples and controls
being processed, plus two additional. An additional two sam-
ples have been added to the calculations for overage to account
for pipetting error for this example, but the analyst/laboratory
can modify based on their discretion. Be sure to use the appro-
priate proteinase K source: for samples extracted with the
standard PrepFiler™ kit, use an external source (see Subhead-
ing 2.1, item 3); for samples extracted with the PrepFiler™
BTA kit, use the proteinase K supplied with the kit. After
combining the necessary reagents, vortex the master mix and
flick the tube downward to get any liquid off of the cap.
18. Discard residual master mix after incubation has begun. Do not
reuse leftover master mix or DTT. Master mix should be made
fresh every batch for the most efficient extraction.
19. The author recommends having more than one thermomixer
for this procedure, since it takes some time for the thermo-
mixer to reach room temperature after being heated. This leads
to samples sitting until the temperature is reached. If two
thermomixers are available, set the other to room temperature
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 77

during the initial incubation (see Subheading 3.2, step 8).

Once the first incubation is complete, that thermomixer can
remain at an elevated temperature, given that later in the
procedure, the samples are incubated again at 70 °C. Other-
wise, if only one thermomixer is accessible, its temperature will
need to be lowered to room temperature after the first incuba-
tion is complete.
20. Speeds and times are dependent on the maximum setting of the
centrifuge.
21. If at this point, the caps of tubes are not staying closed, transfer
to a new labeled 1.5 mL centrifuge tube using a pipette to
avoid possible contamination events.
22. Ensure that the samples/controls come to room temperature
prior to DNA isolation and purification (see Subheading 3.3).
If quantitation volumes are lower than expected, it may be that
efficient binding did not occur because this step was not
completed.
23. For extraction of any sample using the standard kit, proceed
directly to DNA isolation and purification (see Subheading 3.3,
step 2). For BTA samples, the extraction can be paused and
samples may be left at room temperature for up to 24 h. Do not
chill. By storing the unextracted lysates in cold temperatures,
precipitation occurs.
24. Depending on the number of samples within the batch, the
magnetic particles may need to be re-vortexed in order to
ensure homogeneity, about every 5 min. Author recommends
vortexing after every five samples.
25. If quantitation values are lower than expected for the sample
type being analyzed, it may be that efficient binding did not
occur because this step was not performed.
26. If magnetic beads are seen on the sides of the tube above the
meniscus of the lysis buffer, invert several times. All particles
should be within the solution before the next step.
27. Samples with a large abundance of proteins can cause the beads
to move slower. Sample types that contain a higher amount of
proteins include vaginal or oral sexual assault swabs. A pellet
may be formed after centrifugation. Wait an additional 2 min if
necessary.
28. Using a 100 μL pipette tip decreases the chance that the
magnetic particles are removed because the tip has a smaller
bore size. The best way to not disturb the particle pellet is to
depress the plunger of the pipette, then insert the pipette tip to
the opposite side of the pellet without disturbing it, and slowly
aspirate the liquid all the way to the bottom of the tube. Do not
press down on the pipette plunger while the tip is submerged
78 Megan M. Foley

in the liquid, as this could create bubbles and/or disturb the

pellet.
29. The tubes remain in the magnetic stand during any aspiration
or dispensing into the tube.
30. Only one tube should be opened and closed at a time to
decrease the chance of contamination. Additionally, use a new
pipette tip for each sample/wash.
31. After vortexing, the pellet should have dispersed back into the
solution. Small aggregates are acceptable.
32. This pellet should form faster than in the binding step.
33. For room temperatures greater than 25 °C, incubate only for
5 min. Do not exceed a 10-min incubation for any tempera-
ture. This can cause inefficient elution of the DNA and
decrease yield. If samples yield unexpectedly low quantitation
values, check this step.
34. Low-TE (TE-4) Buffer can be used instead of the kit-supplied
elution buffer if validated by the laboratory. The manufacturer
warns against using water as an elution matrix.
35. If the pellet has not completely resuspended, the sample may
have dried for too long. Vortex vigorously for an additional
15 s, and if needed, flush the liquid with a pipette or tap the
tube externally. If the beads are still clumped, proceed to the
next step with intermittent vortexing. Make a note of this
occurrence in case the quantitation results are lower than
expected.
36. If using a heat block, the same temperature and times should
be followed. Vortex and pulse spin the tubes every 2–3 min
during the incubation for optimal extraction.
37. If any of the pellet is aspirated, pipette the sample back into the
tube and let it sit for an additional minute on the magnetic
stand. Check that no beads have stuck to the side of the tip. If
beads are visualized when the sample is removed for quantita-
tion, place it on the magnetic stand and move the supernatant
to a new tube before quantifying; ensure that no beads are
transferred to the new tube.
38. The author has found that samples that are initially “dirty” and
result in a colored eluant often benefit from an additional wash
step to help further purify the sample. Make note of these
sample types and apply an additional wash step with 300 μL
of Wash Buffer B for future extractions.
39. Do not press the column all the way down into the tube. If
pressed too far, this causes the seal between the two plastics to
break, and leakage of the sample during incubation may occur.
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 79

40. Preprinted labels can be utilized except for on the tops of the
tube caps of the assemblies, which can cause leakage. Use
marker only for the tops.
41. To save a step, the author recommends using a column/tube
assembly during sample collection and placing the sample
directly into the assembly for storage until extraction.
42. For optimal sample collection, gum can be flattened onto a
small sterile surface and frozen for 2 h (ideally -80 °C).
43. When transferring to the column, do not let the tape stick to
the column, as this can result in less-than-optimal DNA
recovery.
44. Do not pulse spin beyond 5 s. Additional spinning can cause a
pellet to form, which can cause issues further on in the process.
45. Incubation over 40 min can lead to precipitation of the reagent
salts. This can be seen before and after the centrifugation step
after incubation. Salt can cause instrumental problems, includ-
ing tip clogging, tip filter wetting, and/or an instrument crash.
If precipitate is observed, flush the lysate with a pipette or
vortex to mix.
46. Close the door to AutoMate Express™ until ready to run. This
helps protect the internal parts from too much exposure to the
outside environment.
47. Thirteen samples are not required to perform an extraction. If
the whole rack is not being used, ensure that each cartridge
lines up with a sample tube in the Tip and Tube Rack.
48. If a physical pellet is visible, transfer the lysate into a new
labeled PrepFiler™ Sample Tube. Sediment may cause instru-
mental problems like liquid handling errors. If precipitate is
seen, heat the sample back to 37 °C to avoid instrument errors.
49. Remove the columns/caps in a manner that avoids reaching
over an open tube. For example, place the tray at an angle and
remove the first sample with your right arm, working across the
tray from left to right.
50. Do not remove protocol cards from the instrument when it is
on. It stops any current runs and may lead to data file losses.
51. All protocol cards should be stored out of the light. Addition-
ally, do not apply any reagents or decontamination methods to
the card.
52. Make sure that the protocol card is fully inserted, and the
instrument door is completely closed before turning on. The
instrument beeps if the door is open while it is trying to read
the protocol; the door must be closed before it continues.
53. The reagents must be inverted and mixed before being placed
into the instrument. To do this, pick up the rack with two
80 Megan M. Foley

hands, one hand on each side, and invert the rack five times.
Make sure that inversion of the rack occurs with the back tilting
downwards. If it is tilted with the front side down, the car-
tridges can fall out.
54. The beads should be in suspension and not settled at the
bottom of the well. Repeat inversion if necessary or tap the
top of the reagent cartridge that is not mixed. Tap the tray at
the end to pull any liquid from the top of the cartridges. Insert
the rack containing the mixed cartridges into the back position
of the instrument.
55. If the hinge is causing the cap to drift upwards, take the tube
out of the tray and bend the hinge back slightly. Replace the
tube into the correct slot.
56. 40 μL is recommended for low quantity samples, like touch
DNA. However, if there is permission to consume the sample,
choose a lower volume option to concentrate the sample fur-
ther. 100 μL is recommended for blood samples. 200 μL is
recommended for reference samples. 250 μL is recommended
for epithelial fraction of differential samples.
57. These tips are sharp on the end and can cut through a glove.
Use caution when cleaning for both safety and contamination
purposes.
58. Proper D-ring care ensures the attachment of the tips remains
secure and prevents leakage.
59. Make sure grease is not applied into the nozzles. If grease is
suspected in the nozzle, wipe the area with a disposable labo-
ratory wipe or dust-free cloth. Excess grease can interfere with
the operation and lead to instrument errors.
60. The axis test verifies all of the axis movements by checking each
well position by moving tips up and down into the positions.
61. Empty cartridge and tips/tip holders are included within the
instrument install kit. Sample tubes should be gathered from
the kits.
62. The temperature test verifies the functionality of the heat
block.
63. This step is performed yearly to ensure proper seal of tips to
nozzles and that no leakage occurs during extraction.

References
1. Thermo Fisher Scientific (2017) PrepFiler content/sfs/manuals/cms_081933.pdf.
Express™ and PrepFiler Express BTA™ Accessed 14 April 2022
Forensic DNA Extraction Kits User Guide, 2. Thermo Fisher Scientific (2019) AutoMate
Revision D. Available via Thermo Fisher Scien- Express Instrument User Guide, Revision
tific . https://tools.ther mofisher.com/ G. Available via Thermo Fisher Scientific.
https://assets.thermofisher.com/TFS-Assets/
 PrepFiler™ Forensic DNA Extraction—Manual/Semi-automated 81

LSG/manuals/4441982_AutoMateExp_UG. biological samples. J Forensic Sci 57:1022–

pdf. Accessed 14 April 2022 1 0 3 0 . h t t p s : // d o i . o r g / 1 0 . 1 1 1 1 / j .
3. Thermo Fisher Scientific (2012) PrepFiler® 1556-4029.2012.02084.x
and PrepFiler® BTA Forensic DNA Extraction 11. Stangegaard M, Hjort B, Hansen T et al (2013)
Kits User Guide, Revision C. Available via Automated extraction of DNA from biological
Thermo Fisher Scientific. https://www. stains on fabric from crime cases. A comparison
ther mofisher.com/order/catalog/prod of a manual and three automated methods.
uct/4463352. Accessed 14 April 2022 Forensic Sci Int Genet 7:384–388. https://
4. Thermo Fisher Scientific (2019) Safety Data doi.org/10.1016/j.fsigen.2012.12.009
Sheet—PrepFiler Lysis Buffer. Available via 12. Vogelstein B, Gillespiet D (1979) Preparative
Thermo Fisher Scientific. https://www. and analytical purification of DNA from aga-
thermofisher.com/document-connect/docu rose. Proc Natl Acad Sci U S A 76:615–619.
ment-connect.html?url=https%3A%2F%2Fptop.only.wip.la%3A443%2Fhttps%2Fas https://doi.org/10.1073/pnas.76.2.615
sets.thermofisher.com%2FTFS-Assets%2FLSG 13. Marko M, Chipperfield R, Birnboim H (1982)
%2FSDS%2F4441405_MTR-NALT_EN.pdf. A procedure for the large-scale isolation of
Accessed 14 April 2022 highly purified plasmid DNA using alkaline
5. Butler JM (2012) DNA extraction. In: extraction and binding to glass powder. Anal
Advanced topics in forensic DNA typing: Biochem 121:382–387. https://doi.org/10.
methodology. Elsevier, Waltham, pp 29–47 1016/0003-2697(82)90497-3
6. Tereba AM, Bitner RM, Koller SC et al (2004) 14. Alaeddini R (2012) Forensic implications of
Simultaneous isolation and quantitation of PCR inhibition—a review. Forensic Sci Int
DNA. US Patent 6673631, 6 Jan 2004 Genet 6:297–305. https://doi.org/10.1016/
7. Chirgiwin J, Przbyla A, MacDonald R et al j.fsigen.2011.08.006
(1979) Isolation of biologically active ribonu- 15. Brevnov M, Pawar H, Mundt J et al (2009)
cleic acid from sources enriched in ribonucle- Developmental validation of the PrepFilerTM
ase. Biochemistry 18:5294–5299. https://doi. Forensic DNA Extraction Kit for extraction of
org/10.1021/bi00591a005 genomic DNA from biological samples. J
8. Boom R, Sol J, Salimans M et al (1990) Rapid Forensic Sci 54:599–607. https://doi.org/
and simple method for purification of nucleic 10.1111/j.1556-4029.2009.01013.x
acids. J Clin Microbiol 28:495–503. https:// 16. Thermo Fisher Scientific (2022) AutoMate
doi.org/10.1128/jcm.28.3.495-503.1990 Express™ Forensic DNA Extraction System.
9. Davis C, King J, Budowle B et al (2012) Available via Thermo Fisher Scientific.
Extraction platform evaluations: A comparison https://www.thermofisher.com/order/cata
of Automate ExpressTM, EZ1® Advanced XL, log/product/4441763?SID=srch-srp-4441
and Maxwell® 16 Bench-top DNA extraction 763. Accessed 14 April 2022
systems. Legal Med 14:36–39. https://doi. 17. Jeremy Boone (2022) Thermo Fisher Scientific
org/10.1016/j.legalmed.2011.09.005 Training: AutoMate Express™, PrepFiler
10. Liu J, Zhong C, Holt A et al (2012) AutoMate Express™, and PrepFiler Express BTA™
ExpressTM Forensic DNA Extraction System Forensic DNA Extraction Kits, 8 Apr 2022
for the extraction of genomic DNA from
 Chapter 5

Robotic DNA Extraction Utilizing Qiagen BioSprint®

96 Workstation
Brittany Ziencik

Abstract
After an examination of evidentiary or reference samples has been performed, the next step is DNA
extraction. This crucial step allows for deoxyribonucleic acid (DNA) to be released from a substrate by
use of a series of chemicals and allows the DNA from lysed cells to be taken forward for DNA typing. To
allow processing of the increased number of forensic samples submitted for DNA typing, automated
systems have become more commonplace within forensic laboratories. The Qiagen BioSprint® 96 worksta-
tion utilizes magnetic particle technology (Qiagen, BioSprint® 96 DNA Handbook, 2012) to process a
variety of samples, such as liquid blood, blood stain cards, and buccal (saliva) swabs. The following methods
outlined within this chapter are based upon the automated DNA extraction of three commonly received
types of reference samples (liquid blood, bloodstain cards, and buccal swabs) utilizing the Qiagen BioS-
print® 96 DNA Blood Kit.

Key words Extraction, Qiagen BioSprint® 96 (BioSprint® workstation), Automation, MagAttract

Suspension G

1 Introduction

Automated DNA extraction systems, like the Qiagen BioSprint®

96 (BioSprint® workstation), utilize magnetic bead technology for
DNA purification [1] while minimizing human error and allowing
for high-throughput reproducibility, higher DNA quality, and
higher DNA yield [2, 3]. Traditional DNA extraction processes
include detergent and proteinase treatments for cell lysis, followed
by purification with organic solvents or chelating-resin suspension
[4]. These traditional methods of extraction require direct applica-
tion to a sample followed by exposing the sample to high tempera-
tures to disrupt the cellular structure to release the DNA [5]. These
methods require human sample manipulation and handling, which
are more time-consuming and increase the chance of contamina-
tion or sample switching. By using magnetic bead technology, in
theory, only the negatively charged DNA will bind with the

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_5,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

83
84 Brittany Ziencik

magnetic beads, leaving any debris present unbound and free in the
solution. This step is followed by a series of wash steps to remove
any inhibitors to produce a DNA lysate that can be taken forward
for polymerase chain reaction (PCR) processing and that is more
adaptable to automation [6]. Utilizing robotic systems enables the
following steps to be performed in a shorter period of time: (1) lysis
of the cell membrane releasing the DNA within the lysis solution,
(2) digestion and/or denaturation of proteins, and (3) separation
of DNA from other cellular material and/or PCR inhibitors [6].

2 Materials

The following two sections provide a list of reagents and equipment

needed to perform DNA extractions using the BioSprint® worksta-
tion. All reagents and plastics utilized by the BioSprint® worksta-
tion should be stored at room temperature. All reagents should be
prepared while wearing proper personal protective equipment
(PPE)—such as a laboratory coat, mask, disposable gloves, and
eye protection—in a designated clean space in order to prevent
contamination. All plastics and buffers need to be cross-linked
prior to use (see Note 1).

2.1 Reagents and 1. Qiagen BioSprint® 96 DNA Blood Kit: Contains Buffer AL,
Supplies Buffer AW1, Buffer AW2, Buffer AE, MagAttract Suspension
G (MagAttract), 96-well S-blocks (S-blocks), 96-well micro-
plate, and 96-well rod cover.
2. Buffer ATL: Sold separately from Qiagen BioSprint® 96 DNA
Blood Kit.
3. 20 mg/mL Proteinase K: Stable up to 1 year at room tempera-
ture; recommended to store at 2–8 °C.
4. DNA grade, RNase-free, or sterile water (water).
5. 100% ethanol and 100% isopropanol.
6. Plate seals: For example, silver seal, tape pad, etc.
7. Plastic reagent troughs to be used for a multichannel pipette.
8. Surface decontaminant: For example, DNA-off™ of DNA
Away™.

2.2 Equipment 1. Desktop or laptop computer with compatibility to download

and contain Qiagen BioSprint® 96 software.
2. BioSprint® 96 workstation.
3. Centrifuge capable of holding S-block deep well plates.
 DNA Extraction—Qiagen BioSprint® 96 Workstation 85

4. Heat block: Needs to be compatible with the 96-well S-blocks.

A shaker-heat block is needed for the extraction of bloodstain
cards and buccal swabs but not liquid blood.
5. Pierce plate that fits 96-well plates to produce openings allow-
ing pipette tips to enter individual wells.
6. Multichannel pipette (P1000, P200, P100, P20, and P10).

2.3 Reagent 1. Prior to performing DNA extractions using the BioSprint®

Preparation workstation, prepare the AW1 and AW2 buffers using 100%
ethanol according to the product label or insert. Table 1 is
based upon the two different volume options of AW1 and
AW2 provided with the Qiagen BioSprint® 96 DNA Blood
Kit [1] (see Note 2). The prepared AW1 and AW2 buffers
should be stored at room temperature.
2. When using a new, unopened bottle of MagAttract Suspension
G, thoroughly shake and then vortex the bottle for 3 min to
ensure the magnetic silica beads have resuspended. Prior to
using a previously opened bottle, vortex for 1 min [1].

3 Methods

The following procedures outline the extraction methods for

100 μL of liquid blood, a ~ 1/4″ diameter from a bloodstain
card, and one buccal swab (or combined cuttings of multiple
swabs equivalent to one swab) based upon the outlined methods
and procedures within the Qiagen BioSprint® 96 DNA Handbook
[1]. For each of the extraction methods outlined, all extraction
controls (i.e., positive and/or negative controls) will be processed
simultaneously alongside the samples being extracted. This chapter
does not cover how to create programs on the BioSprint® 96 work-
station robot.

3.1 DNA Extraction of 1. Pipette 100 μL of liquid blood into individual wells of a labeled
Liquid Blood S-block. Once the samples have been added into the individual
wells of a labeled S-block, verify the sample and sample name to
the extraction layout along with corresponding controls. This
step should be performed prior to any steps in the extraction
method.
2. Prior to use, incubate the Buffer AL for 30 min at 37 °C with
occasional inverting of the bottle to dissolve any precipitate.
3. Prepare five S-blocks and two 96-well microplates with the
necessary reagent, and seal with a temporary seal; these will
be added to the BioSprint® workstation in the specified posi-
tions (see Notes 3 and 4; Table 2) [1].
86 Brittany Ziencik

Table 1
Buffer AW1 and AW2 preparation

Buffer Volume of concentrated buffer Volume of 100% ethanol to be added Final volume (mL)
AW1 27 mL 35 mL 62 mL
98 mL 130 mL 228 mL
AW2 17 mL 40 mL 57 mL
81 mL 190 mL 271 mL
This table outlines the amount of 100% ethanol (mL) that is to be added at the two different concentrations of Buffer
AW1 and AW2. The final volume (mL) of each of the buffers is dependent on the starting volume (mL) of the
concentrated buffer and the amount of 100% ethanol (mL) added (see Note 2) [1]

Table 2
BioSprint® workstation reagent plate setup for DNA extraction

Volume per well (μL)

BioSprint slot
position # Reagent + plate used Liquid blood Bloodstain card Buccal swab
8 96-well microplate with rod cover – – –
7 Buffer AE in 96-well microplate 100 200 200
6 Water in S-block 500 500 500
5 Buffer AW2 in S-block 500 500 500
4 Buffer AW2 in S-block 500 500 500
3 Buffer AW1 in S-block 500 500 500
2 Buffer AW1 in S-block 500 650 650
1 Lysate in 96-well microplate 325 640 620
This table outlines the overall volume (μL) of liquid (i.e., lysate, reagent, etc.) that is required for each plate being used for
the three extraction methods discussed in this chapter [1]. Prior to placing the UV cross-linked 96-well rod cover into the
96-well microplate, carefully bend the sides of the rod cover back so that it slightly flares outward

4. Prepare a digestion buffer master mix of Buffer AL and Pro-

teinase K in a 50 mL conical tube and add to each sample in the
S-block (see Subheading 3.1, step 1; Notes 3 and 5; Table 3).
When adding the master mix of digestion buffer to each liquid
blood sample, ensure to mix the liquid blood sample and
master mix thoroughly via pipette. Seal the S-block with a silver
seal and briefly centrifuge.
5. Incubate at 70 °C for 10 min.
6. During the incubation, prepare a master mix of isopropanol
and MagAttract in a 50 mL conical tube (see Note 5; Table 4).
 DNA Extraction—Qiagen BioSprint® 96 Workstation 87

Table 3
Digestion buffer preparation

Volume per sample (μL)

Reagent Liquid blood Bloodstain cards Buccal swabs

Buffer ATL – 200 –
Buffer AL 100 – 400
Proteinase K 10 20 20
Total 110 220 420
This table outlines the overall volume (μL) of the digestion buffer master mix needed for
each sample type. Each reagent volume should be multiplied by the number of samples
being processed, plus an additional 10% to account for pipetting error, to calculate the
total volume needed for the extraction batch. It is important to remember that the
maximum number of samples/controls that can be run per plate is 96

Table 4
MagAttract mix preparation

Volume per sample (μL)

Reagent Liquid blood Bloodstain cards Buccal swabs

Buffer AL – – 200
Isopropanol 100 200 200
MagAttract 15 20 20
Total 115 220 420
This table outlines the overall volume (μL) of the MagAttract master mix needed for each
sample type. Each reagent volume should be multiplied by the number of samples being
processed, plus an additional 10% to account for pipetting error, to calculate the total
volume needed for the extraction batch. It is important to remember that the maximum
number of samples/controls that can be run per plate is 96

7. After incubation, briefly centrifuge the S-block to remove any

condensation from the seal.
8. Wipe the seal with a Kimwipe moistened with ethanol to clean
off the seal. Pierce the seal with a sterile pierce plate.
9. Add the prepared MagAttract mix (see Subheading 3.1, step 6;
Note 3) to each sample in the S-block. When adding the
MagAttract mix to each liquid blood sample, ensure to mix
the liquid blood sample and master mix thoroughly via pipette.
After the MagAttract mix has been added to each sample, the
total volume of lysate for each sample is 325 μL.
10. Proceed to the robotic processing steps (see Subheading 3.4,
step 1).
88 Brittany Ziencik

3.2 DNA Extraction 1. Cut a ~ 1/4″ diameter or single hole punch from the blood-
from Bloodstain Cards stain card and place into individual wells of a labeled S-block.
Once the samples have been added into the individual wells of a
labeled S-block, verify the sample and sample name to the
extraction layout along with the corresponding controls. This
step should be performed prior to any steps in the extraction
method.
2. Prior to use, incubate the Buffer AL and Buffer ATL for 30 min
at 37 °C with occasional inverting of the bottle to dissolve any
precipitate.
3. Prepare five labeled S-blocks and two labeled 96-well micro-
plates that will be added to the BioSprint® workstation (see
Notes 3 and 4; Table 2) [1].
4. For digestion of the bloodstain card samples, prepare a diges-
tion buffer master mix of Buffer ATL and Proteinase K in a
50 mL conical tube (see Note 5; Table 3). Seal the S-block with
a silver seal and briefly centrifuge.
5. Incubate at 56 °C for a minimum of 1 h in a shaker-heat block,
shaking at 900 rpm. After incubation, briefly centrifuge the
S-block to remove any condensation from the seal.
6. Wipe the seal with a Kimwipe moistened with ethanol to clean
off the seal. Pierce the seal with a sterile pierce plate.
7. Add 200 μL of Buffer AL to each sample (see Note 3), seal the
S-block with a new piece of silver seal, and pulse vortex for 10 s.
After the pulse vortex, briefly centrifuge to remove any liquid
from the seal.
8. Incubate at 56 °C for 10 min in a shaker incubator, shaking at
900 rpm.
9. During the incubation, prepare a master mix of isopropanol
and MagAttract in a 50 mL conical tube (see Note 5; Table 4).
10. After incubation, briefly centrifuge the S-block to remove any
condensation from the seal.
11. Wipe the seal with a Kimwipe moistened with ethanol to clean
off the seal. Pierce the seal with a sterile pierce plate.
12. Add the prepared MagAttract mix (see Subheading 3.2, step 9;
Note 3) to each sample in the S-block. When adding the
MagAttract mix to each bloodstain card sample, ensure to
mix thoroughly via pipette. After the MagAttract mix has
been added to each sample, the total volume of lysate for
each sample is 640 μL.
13. Proceed to the robotic processing steps (see Subheading 3.4,
step 1).
 DNA Extraction—Qiagen BioSprint® 96 Workstation 89

3.3 DNA Extraction 1. Cut one buccal swab (or combined cuttings of multiple swabs
from Buccal Swabs equivalent to one swab) from each sample and place into indi-
vidual wells of a labeled S-block. Once the samples have been
added into the individual wells of a labeled S-block, verify the
sample and sample name to the extraction layout along with
corresponding controls. This step should be performed prior
to any steps in the extraction method.
2. Prior to use, incubate the Buffer AL and Buffer ATL for 30 min
at 37 °C with occasional inverting of the bottle to dissolve any
precipitate.
3. Prepare five labeled S-blocks and two labeled 96-well micro-
plates that will be added to the BioSprint® workstation (see
Notes 3 and 4; Table 2) [1].
4. For digestion of the buccal samples, prepare a digestion buffer
master mix of Buffer ATL and Proteinase K in a 50 mL conical
tube (see Note 5; Table 3). When adding the master mix of
digestion buffer to each buccal sample, ensure to saturate the
cutting(s) of the buccal sample thoroughly. Seal the S-block
with a silver seal and briefly centrifuge.
5. Incubate at 56 °C for a minimum of 1 h in a shaker-heat block,
shaking at 900 rpm.
6. During the incubation, prepare a master mix of Buffer AL,
isopropanol, and MagAttract in a 50 mL conical tube (see
Note 5; Table 4).
7. After incubation, briefly centrifuge the S-block to remove any
condensation from the tape.
8. Wipe the seal with a Kimwipe moistened with ethanol to clean
off the seal. Pierce the seal with a sterile pierce plate.
9. Using a multichannel pipette, transfer 200 μL of the lysate
from each well to a new S-block. Do not transfer the swabs to
the new S-block.
10. Add the prepared MagAttract mix (see Subheading 3.3, step 6;
Note 3) to each sample in the new S-block that contains the
transferred 200 μL lysate from the buccal swabs. When adding
the MagAttract mix to each lysate, ensure to mix thoroughly
via pipette. After the MagAttract mix has been added to each
sample, the total volume of lysate for each sample is 620 μL.
11. Proceed to the robotic processing steps (see Subheading 3.4,
step 1).

3.4 Robotic 1. Decontaminate the instrument prior to each run with DNA-off
Processing Steps or 70% ethanol. Do not use bleach (see Note 6).
2. Turn on the workstation. The deck will rotate, and the mag-
netic head will move into position.
90 Brittany Ziencik

3. Determine the appropriate protocol (see Note 7). Select the

appropriate protocol using the up and down arrow keys on the
BioSprint® workstation, then press “Start.”
4. Prior to loading the following required S-blocks and 96-well
microplate (elution plate), carefully remove the seal.
5. The robot will display the selected protocol on the LCD panel
and will prompt the user when to load each of the seven
previously prepared 96-well reagent plates (see Subheading
3.1, step 3; Subheading 3.2, step 3; or Subheading 3.3, step
3). The deck should have rotated so that slot 8 is immediately
inside the sliding door and alternate between displaying
“Paused” and “Load Rod Cover” on the LCD panel.
6. Load the 96-well rod cover that is inserted into the microplate
onto the rotating table in the position immediately inside the
door. After loading, press “Start.”
7. The workstation will rotate, and a new message will appear,
asking the user to load slot 7 with the elution plate. Load slot
7, and press “Start” again. Continue this process of loading a
particular slot until all slots are loaded (see Note 8; Table 2) [1].
8. Slide the door shut to protect samples from contamination, and
press “Start” to process the samples [1].
9. After the samples are processed, place a tape pad over the
96-well microplate (elution plate) located in slot 7 containing
the purified samples, and remove the plate from the BioSprint®
(see Note 9).
10. Remove the rest of the S-blocks as instructed by the display of
the BioSprint®, disposing of biological and chemical liquid or
solid waste into appropriate containers. Press “Stop” after
removing each plate or block.
11. Switch off the BioSprint® at the power switch.
12. Decontaminate the BioSprint® workstation with a surface
decontaminant (see Note 6) or 70% ethanol. Do not use
bleach.

4 Notes

1. In order to prepare for extractions performed using the BioS-

print®, UV crosslink all plastics (e.g., S-blocks, 96-well micro-
plates, rod covers, etc.) and buffers being used in order to
prevent contamination. If UV crosslinking multiple sets of
plastics and reagents, ensure a secure and sterile storage area.
2. Once the 100% ethanol has been added to the AW1 and AW2
bottles, mark the bottles using the date and the initials of the
individual who added the ethanol.
 DNA Extraction—Qiagen BioSprint® 96 Workstation 91

3. When adding the same reagent or same master mix into multi-
ple wells, it is more time-efficient to pour the measured amount
of reagent or master mix being used into a trough and, using a
multichannel pipette, pipette the measured amount into multi-
ple individual wells.
4. For each S-block or 96-well microplate, the number of wells to
fill with buffer should match the number of samples to be
processed (e.g., for 25 liquid blood samples, fill 25 wells per
S-block or 96-well microplate) [1].
5. When preparing the digestion buffer or MagAttract mix, cap
the 50 mL conical tube and invert at least 10 times to mix; do
not vortex.
6. Buffers within the Qiagen BioSprint® 96 DNA Blood Kit
contain guanidine salts, which can form highly reactive, harm-
ful compounds when combined with bleach.
7. Protocols should have been pre-programed based on the
laboratory’s needs. Any issues with programming extraction
methods to the BioSprint® workstation should seek aid from
Qiagen’s customer support team.
8. Each slot is labeled with a number from 1 to 8. Load each
96-well plate or S-block so that well A1 is aligned with the slot
label (e.g., well A1 faces inward) [1].
9. Once the extraction process is complete, the 96-well micro-
plate (elution plate) can either be sealed securely with silver seal
and stored under refrigeration or can be directly taken forward
for quantitation.

References

1. Qiagen (2012) BioSprint® 96 DNA Handbook. 4. Montpetit SA, Fitch IT, O’Donnell PT (2005) A
Available via Qiagen. https://www.qiagen.com/ simple automated instrument for DNA extrac-
us/resources/resourcedetail?id=64902c5d-9c3 tion in forensic casework. J Forensic Sci 50(3):
c-4fe3-a3f7-668c4704d9eb&lang=en. 1–9
Accessed 10 Feb 2022 5. Butler JM (2009) Chapter 5: DNA
2. Witt S, Neumann J, Zierdt H et al (2012) Estab- extraction. In: Fundamentals of forensic DNA
lishing a novel automated magnetic bead-based typing. Elsevier Academic Press,
method for the extraction of DNA from a variety Burlington, MA
of forensic samples. Forensic Sci Int Genet 6(5): 6. Chong KWY, Thong Z, Syn CK-C (2021)
539–547. https://doi.org/10.1016/j.fsigen. Recent trends and developments in forensic
2012.01.002 DNA extraction. WIREs Forensic Sci 3:e1395.
3. Lee SB, Shewale JG (2017) DNA extraction https://doi.org/10.1002/wfs2.1395
methods in forensic analysis. In: Encyclopedia
of analytical chemistry. https://doi.org/10.
1002/9780470027318.a1104m.pub2
 Chapter 6

DNA Extraction of Bone Through Demineralization

Brandi L. Iorio and Ashley M. Cooley

Abstract
In the field of forensic science, the DNA extraction of bone is utilized in investigations involving mass
disasters, unidentified remains, and missing persons. However, bone samples can be challenging samples
due to their exposure to extreme environmental conditions over long periods of time. The use of an
effective DNA extraction method to properly isolate and purify the DNA is essential for bone samples. This
chapter describes the DNA extraction of bone samples through a total demineralization protocol, which
aims to entirely dissolve the bone matrix in order to access the DNA molecules.

Key words DNA extraction, Demineralization, Bone extraction, Organic extraction, DNA analysis,
Forensic science

1 Introduction

Bone samples are commonly collected in missing persons investiga-

tions, mass disasters, and unidentified remains cases [1]. In these
types of investigations, bones are typically the only biological sam-
ples available for DNA analysis and may be highly degraded due to
the bone samples being subjected to extreme environmental con-
ditions over long periods of time [2]. However, bones are able to
withstand exposure to contaminants in the environment, such as
microorganisms and fungi, which make these samples the most
suitable for DNA analysis in these types of cases [3]. For some
bone samples, the presence of humic acid from soil can pose as a
potential inhibitor and can affect downstream DNA analysis, creat-
ing a need for an extraction protocol that effectively isolates and
purifies the DNA [2]. Bone consists primarily of collagen and
minerals, and these areas with substantial mineralization create
robust barriers to DNA extraction chemicals, thus preventing the
successful release of DNA [1]. For bone samples, the greatest
success at developing DNA profiles is accomplished utilizing
demineralization procedures, which work to entirely dissolve the
bone matrix [4]. By entirely dissolving the bone matrix in these

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_6,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

93
94 Brandi L. Iorio and Ashley M. Cooley

demineralization protocols, high-quality endogenous DNA stored

in the crystal aggregates of the bone matrix is made easily accessible
[1]. This chapter describes a highly effective demineralization pro-
tocol for bone samples that provides high yields of DNA for even
the most challenging of samples.

2 Materials

2.1 Equipment 1. Centrifuge: Including fixed-angle or swinging bucket rotor.

2. Chisel.
3. Rotary tool.
4. Hammer.
5. Laminar flow hood.
6. Incubator: 56  C with nutator inside.
7. Ultraviolet (UV) crosslinker.
8. Blender.
9. Blender cup and lids: If not already prepared, clean an appro-
priate number of blender cups and lids. Fill each cup approxi-
mately 1/3 full with 10% Liquinox, attach the lid, and run the
blender for 10–20 s. Remove the lid and rinse both the lid and
cup with water, followed by 10% bleach, then water, and etha-
nol. Drain excess ethanol and allow surfaces to dry. Irradiate in
a UV crosslinker for the same amount of time required for a
50 mL conical tube.

2.2 Supplies 1. Amicon® Ultra-4 concentrators.

2. Cutting disc.
3. 2.0 mL or 1.5 mL microcentrifuge tubes, screw-top, or flip-
cap: It is recommended to irradiate all tubes in a UV crosslinker
prior to the DNA extraction process. It is also recommended to
avoid autoclaving the tubes, as it may affect proper closure of
the tubes and compromise the integrity of the tubes.
4. 15 mL and 50 mL conical tubes.
5. Sanding/grinding bits.
6. Sleeve protectors.
7. Tips, aerosol-resistant (for pipettes).

2.3 Reagents 1. Demineralization buffer: Prepare 0.5 M EDTA and 1% lauryl

sarcosine [5]. Mix until dissolved and adjust to pH 8.0 with
NaOH. Autoclave, cool, and filter through 0.2 μm filter to
sterilize. Store at room temperature. Irradiate in a UV cross-
linker before use.
 Demineralization Extraction of Bone 95

2. Absolute ethanol.
3. Isopropanol.
4. 10% Liquinox.
5. n-Butanol.
6. 25:24:1 Phenol/Chloroform/Isoamyl Alcohol (PCIAA).
7. 20 mg/mL Proteinase K: Store at 20  C.
8. Low EDTA TE Buffer (TE 4 Buffer): Prepare 10 mM Tris-
HCl and 0.1 mM EDTA [5]. Mix until dissolved and adjust to
pH 7.5 with HCl. Autoclave, cool, and filter through 0.2 μm
filter to sterilize. Store at room temperature. TE 4 will expire
3 years after the preparation date. Irradiate in a UV crosslinker
before use.
9. Ultrapure water: Filter Type I water with a 0.2 μm filter and
then autoclave [5]. Subject 15–50 mL conical tube aliquots to
15 J/cm2 exposure time. Store at room temperature. Ultrapure
water will not expire.

3 Methods

The following methods have been adapted from the Virginia

Department of Forensic Science Mitochondrial DNA
Section Procedures and the Forensic Biology Procedures Manual:
Extraction of DNA [5, 6]. All steps should be performed in a
laminar flow hood while wearing proper personal protective equip-
ment (PPE)—including a laboratory coat, disposable gloves, a
surgical mask, a hair net, and eye protection—in a properly disin-
fected space in order to prevent contamination. It is recommended
to perform this protocol with a single bone sample at a time. If
multiple bone samples are processed at the same time, each bone
sample will require its own reagent blank.
1. In a hood, sand the exposed surfaces of the bone with a clean
sanding bit fitted to a rotary tool (see Notes 1–4).
2. Cut approximately a 1.0 g piece from the evidence using a
cutting disc, if necessary (see Notes 5 and 6). If needed, a chisel
and hammer can be used to assist in obtaining an appropriately
sized window of bone (see Fig. 1).
3. Clean the powdered debris off of the sample by placing the
sanded sample into a 50 mL conical tube containing approxi-
mately 25 mL of ultrapure water, shaking back and forth several
times, and decanting into a waste container (see Note 7).
4. Repeat the ultrapure water wash twice.
96 Brandi L. Iorio and Ashley M. Cooley

Fig. 1 The sampling of bone. The sampling of the bone is performed using a rotary tool with a cutting disc

5. Cover the sample in the conical tube with absolute ethanol,

shake back and forth several times, and decant into a waste
container.
6. Repeat the absolute ethanol wash twice.
7. Remove the sample from the conical tube, place it in a labeled
weigh boat, and allow it to air dry in the laminar flow hood.
8. Initiate a reagent blank by swabbing the inside surfaces of a
clean blender cup and lid with a sterile cotton swab. The
reagent blank will be the last sample processed for the remain-
ing steps of the extraction.
9. Place the sample into the same blender cup used to initiate the
reagent blank, attach the lid, and run the blender until the
sample is finely ground (see Note 8).
10. Place the powder into a clean weigh boat or funnel to transfer it
to an appropriately labeled, sterile, pre-weighed or tared 15 mL
conical tube (see Notes 9 and 10).
11. Determine the weight of the sample in the conical tube.
Approximately 0.2 g of powdered bone is needed for extrac-
tion. The excess powder can be stored at 20  C.
12. Add 3 mL demineralization buffer and 200 μL Proteinase K to
the sample and reagent blank, making sure that the sample is
thoroughly suspended in the reagents.
 Demineralization Extraction of Bone 97

Fig. 2 Addition of PCIAA. This depicts the bone sample and the reagent blank
following the addition of PCIAA once it has been centrifuged. Note the upper,
clear aqueous phase, the middle interface, and the lower organic phase. The
upper, clear aqueous layer should be collected with a pipette, but take care to
avoid the middle interface containing cellular debris

13. Wrap the conical tubes tightly with parafilm, focusing primarily
on the cap and upper portion, to ensure the liquid does not
leak (see Note 11).
14. Incubate overnight at 56  C on a nutator.
15. To the sample, add 3 mL PCIAA, vortex thoroughly, and
centrifuge for 10 min at approximately 10,000  g using a
fixed-angle rotor or 3270  g using a swinging bucket rotor
centrifuge (see Fig. 2).
16. Transfer the upper aqueous layer to an appropriately labeled
sterile 15 mL conical tube (see Note 12).
17. Dispose of the lower layer (phenol waste) in the appropriate
waste container.
18. Repeat extraction with PCIAA until the interface is clean (see
Subheading 3, steps 15–18), disposing of waste in the appro-
priate waste container.
98 Brandi L. Iorio and Ashley M. Cooley

Fig. 3 Addition of n-butanol. This depicts the bone sample and the reagent blank
following the addition of n-butanol once it has been centrifuged. Note the upper
n-butanol phase and the lower aqueous phase. The lower aqueous phase should
be collected with a pipette and transferred to the sample reservoir of the Amicon
Ultra-4 concentrator

19. To the aqueous layer, add 3 mL n-butanol.

20. Vortex thoroughly and centrifuge for 10 min at approximately
10,000  g using a fixed-angle rotor or 3270  g using a
swinging bucket rotor centrifuge (see Fig. 3).
21. Remove and discard the upper n-butanol layer and the inter-
face into an appropriate waste container (see Note 13).
22. Label a sufficient number of pre-assembled, irradiated Ami-
con® Ultra-4 concentrators.
23. Transfer the lower aqueous layer to the sample reservoir of the
Amicon® Ultra-4 concentrator, avoiding the pipetting of any
residual n-butanol if not completely removed (see Subheading
3, step 21, and Fig. 4).
24. Centrifuge for approximately 10–30 min at 2000  g using a
swinging bucket rotor and discard the filtrate.
 Demineralization Extraction of Bone 99

Fig. 4 Transfer to Amicon Ultra-4 concentrator. This depicts the transfer of the
aqueous phase of the bone sample and the reagent blank to the sample reservoir
of each Amicon Ultra-4 concentrator

25. Add 2 mL of TE 4 buffer to the sample reservoir of the

Amicon® assembly, centrifuge for approximately 10–30 min
at 2000  g using a swinging bucket rotor, and discard the
filtrate.
4
26. Repeat the TE buffer wash at least once (see Note 14).
27. Taking extreme care in not allowing the pipette to touch the
sides of the sample reservoir, pipette the retentate directly from
the sample reservoir and transfer it to an appropriately labeled
sterile 1.5 mL tube (see Fig. 5).
28. Measure the volume of the retentate with a pipette, and add
TE 4 buffer, as necessary, to bring the volume up to 100 μL.
29. The samples may be stored at 4  C if amplified within 3 weeks
or used routinely. Store at 20  C for long-term storage.
100 Brandi L. Iorio and Ashley M. Cooley

Fig. 5 Collection of retentate. This depicts the retentate of the bone sample and
the reagent blank in the upper sample reservoir of the Amicon assembly that
should be transferred to sterile tubes. Note that there is approximately 40 μL of
each sample that should be transferred to a new sterile tube. The sample should
then have the TE 4 added to create a final volume of 100 μL

4 Notes

1. When sampling the bone using a cutting disc, clean the hood
appropriately with 10% bleach and ethanol; change bits/discs,
gloves, and disposable sleeves between each specimen.
2. During the sampling of the bone, it is recommended to
double-mask in the hood or wear a higher-filtration grade
mask, such as a N95, since there is excessive bone dust released
into the air during the grinding process, especially with drier
samples. Respirators are also highly encouraged due to the
airborne particles that are released into the air during the
grinding and sanding processes.
3. The most suitable samples from adult bone specimens that are
likely to yield successful DNA results include the femur, the
tibia, and the pelvis (if these sample types are available). If
 Demineralization Extraction of Bone 101

sampling the femur or tibia, collect samples from either the

proximal anterior shaft or the distal anterior shaft of the long
bone for optimal DNA results [7].
4. Different shapes and sizes of sanding bits may be utilized for
various bone types, sizes, and shapes. For example, a pointed,
conical, tapered Dremel bit is useful for smaller pieces of bone
with a smaller surface area. Similarly, a rounded bit is useful for
larger pieces of bone as it can cover a larger surface area more
effectively.
5. Generally, take care to avoid sampling any areas where the bone
exhibits discoloration. This discoloration may indicate high
levels of metals or humidity from the surrounding environ-
ment, which could result in DNA degradation [7]. Ensure
that the entire first layer of the bone is sanded off, since this
layer of the bone is exposed to the environmental elements.
The depth needed to sand will vary by sample. Once this initial
layer of bone is sanded off, there should be white, creamy bone
underneath. This white, creamy bone devoid of any staining
from the environmental elements is what you should sample for
DNA extraction. Additionally, take care to sand off and
completely remove any extraneous tissue or other foreign
material on the surface of the bone.
6. When removing a section of bone, it is recommended to take at
least a 1 cm by 3 cm piece of bone, if possible. These dimen-
sions will ensure that only one sampling is necessary.
7. It is imperative to always use ultrapure water when cleaning the
external surface of the bone.
8. When starting the blender, the sample may become wedged
between a blade and the wall of the cup. If this occurs, shut off
the power, remove the cup, and dislodge the sample by tapping
or rotating the blade spindle. If the sample is not completely
ground after 1 min, shut off the power, tap the container, and
repeat until the sample is completely ground.
9. It is important to check that the conical tubes are suitable for a
range of temperatures from 20 to 56  C. The conical tubes
should be suitable for freezer temperatures, room temperature,
and higher temperature incubations.
10. Once the bone powder is transferred to a conical tube, the
extraction procedure may be stopped at this point for the day, if
desired, by storing the sample in the 20  C freezer.
11. During the overnight incubation in the nutator, the parafilm
may crack in the heat. Prior to leaving the samples incubating
overnight, check the tubes and parafilm for any cracks. Addi-
tionally, check that the tubes are tightly screwed. If the sample
leaks, wipe the outside of the tube with 10% bleach, change
gloves, re-tighten the cap, and re-wrap with parafilm.
102 Brandi L. Iorio and Ashley M. Cooley

12. During the step involving the removal of the aqueous layer
following the addition of PCIAA, take care to avoid aspiration
of the interface. During this process, the interface is where
completely digested proteins with both hydrophobic and
hydrophilic domains get trapped between the two layers.
With the extraction of bone samples, the interface can be
thicker and murkier.
13. Following the addition and centrifugation of the n-butanol
layer, take care to avoid pipetting the interface and n-butanol
when collecting the lower aqueous layer. Prior to inserting
the pipette tip into the lower aqueous layer, press down on
the plunger halfway into the liquid to avoid collecting any of
the interface or n-butanol. Once your pipette tip has reached
the lower aqueous layer, press entirely down onto the plunger
to displace any liquid that may have accumulated in the tip.
Then, you may aspirate as normal. You may also choose to
completely remove the n-butanol and interface layer
completely.
14. If you suspect that the sample may be inhibited, perform more
washes with the TE 4 as needed.

References

1. Loreille OM, Diegoli TM, Irwin JA et al (2007) rev. 5. Available via the Virginia Department of
High efficiency DNA extraction from bone by Forensic Science. https://www.dfs.virginia.gov/
total demineralization. Forensic Sci Int Genet wp-content/uploads/2020/10/212-D100-
1(2):191–195. https://doi.org/10.1016/j. Mitochondrial-DNA-Section-Procedures-
fsigen.2007.02.006 Manual.pdf
2. Jakubowska J, Maciejewska A, Pawłowski R 6. Virginia Department of Forensic Science (2021)
(2012) Comparison of three methods of DNA Forensic biology procedures manual extraction
extraction from human bones with different of DNA, rev. 7. Available via the Virginia
degrees of degradation. Int J Legal Med 126: Department of Forensic Science. https://www.
173–178. https://doi.org/10.1007/s00414- dfs.virginia.gov/wp-content/uploads/2021/0
011-0590-5 6/210-D2004-FB-PM-Extraction-of-DNA.pdf
3. Baubliene J, Daugnora L, Miceikiene I (2003) 7. International Commission on Missing Persons
Evaluation of the DNA extraction method from (2015) Standard operating procedure for sam-
ancient animal bones. Ekologija 1:8–11 pling bone and tooth specimens from human
4. Duijs FE, Sijen T (2020) A rapid and efficient remains for DNA testing at the ICMP. Available
method for DNA extraction from bone powder. via the International Commission on Missing
Forensic Sci Int: Reports 2:100099. https://doi. Persons. https://www.icmp.int/wp-content/
org/10.1016/j.fsir.2020.100099 uploads/2015/04/icmp-sop-aa-136-2-doc.pdf
5. Virginia Department of Forensic Science (2020)
Mitochondrial DNA section procedures manual,
 Chapter 7

Differential Extraction with Purification via

Organic/Microcon® and Promega DNA IQ™ Methods
Jonathan Forsberg and Caitlin Ayoub

Abstract
The differential extraction method allows for the separation of sperm cell DNA from non-sperm cell DNA
by incorporating two separate lysis steps. This is crucial in forensic casework, as sexual assault samples
frequently deal with a mixture of seminal fluid and other body fluids. After performing a differential lysis,
DNA extraction can be completed through a variety of methods. In addition to the differential lysis, two
methods will be described in this chapter for DNA purification: Organic (Phenol)/Microcon® purification
and purification with the Promega DNA IQ™ System.

Key words Differential extraction, Spermatozoa, Epithelial cells, Sexual assault evidence, DNA,
Organic extraction, Microcon®, Phenol, Promega DNA IQ™ System

1 Introduction

In the majority of sexual assault cases, seminal fluid, if present, will

provide the greatest opportunity for obtaining a usable DNA pro-
file from the forensic evidence. The differential extraction method
allows for the separation of sperm cell DNA from non-sperm cell
DNA when working with mixed body fluid samples [1, 2]. While
seminal fluid also includes epithelial cells from the donor, the
separation of DNA from sperm cells from that of other cell types
(especially vaginal epithelial cells) maximizes the likelihood of
developing a probative DNA profile from forensic evidence samples
while potentially aiding in DNA interpretation by separating the
DNA sample into two fractions, often avoiding DNA mixture
profiles altogether. This method accomplishes this by exploiting
the strength of the disulfide bonds in the cellular membranes of
spermatozoa via two lysis steps. The first lysis is intended to expose
only non-sperm cell DNA. This non-sperm lysate is set aside in a
separate tube to be extracted before performing several washes of
the sperm pellet. Then a second lysis, through the inclusion of

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_7,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

103
104 Jonathan Forsberg and Caitlin Ayoub

dithiothreitol (DTT), exposes the DNA of any spermatozoa

remaining in the sample.
Many DNA purification techniques can be adapted for com-
patibility with a differential extraction. Two manual DNA purifica-
tion techniques for differentially lysed samples were selected and
described which allow for the completion of the DNA extraction
process. The organic (phenol-chloroform-isoamyl alcohol
(PCIAA))/Microcon® method is a more traditional method, espe-
cially useful for challenging samples. This method purifies DNA by
trapping hydrophobic contaminants such as lipids and protein frag-
ments in the lower organic phase or at the interface (protein layer),
while retaining hydrophilic DNA in the upper aqueous phase
[2]. Once removed, the DNA from the aqueous phase is further
purified via a Microcon® centrifugal filter [3]. The second purifica-
tion described, DNA IQ™, is a more modern, silica-based method
that uses paramagnetic beads (resin) to bind the DNA from lysed
cells while non-DNA sample components are washed away
[4, 5]. After disassociating the DNA from the DNA IQ™ Resin,
the DNA is then eluted into the final purified extract.

2 Materials

2.1 General 1. 1.5 mL microcentrifuge tubes and compatible spin baskets.

Reagents and Supplies 2. 15 mL conical tubes.
3. 20 mg/mL Proteinase K: Prepare in sterile Type 1 Water. Store
frozen in small aliquots to avoid excessive freeze/thaw cycles.
Thaw immediately prior to use. Can be purchased premade.
4. TNE: 10 mM Tris-HCl, 0.1 M NaCl, and 1 mM EDTA;
prepare in sterile Type 1 Water and mix until completely dis-
solved. Can be purchased premade.
5. 20% Sarkosyl: Add N-Lauroylsarcosine to sterile Type 1 Water
and mix until completely dissolved. Filter-sterilize and store at
room temperature. Can be purchased premade.
6. 0.39 M Dithiothreitol (DTT): Add DTT to sterile Type
1 Water and mix until completely dissolved. Filter-sterilize.
Store frozen in small aliquots to avoid excessive freeze/thaw
cycles; thaw immediately prior to use.
7. Sterile Type 1 Water.
8. PCR Digestion Buffer: 10 mM Tris-HCl, 10 mM EDTA,
50 mM NaCl, and 1% SDS; prepare in sterile Type 1 Water
and mix until dissolved. Store at room temperature.
9. Low EDTA TE Buffer (1X TE
4 Buffer): 10 mM Tris-HCl and
0.1 mM EDTA; prepare in sterile Type 1 Water and adjust pH
to 8.0 using 37.1% HCl. Autoclave for 20 min and store at
room temperature. Can be purchased premade.
 Differential Extraction and DNA Purification Methods 105

2.2 Organic 1. Biological Safety Hood.

Differential Extraction 2. Microcon® DNA Fast Flow Device.
3. 25:24:1 Phenol-chloroform-isoamyl alcohol (PICAA): Adding
8-Hydroxyquinoline to a final concentration of 5 mM (in a
biological safety hood) is optional—this will increase the con-
trast seen between phases (see Subheading 3.2, steps 5 and 6).
Store refrigerated. This reagent is caustic; open/use only in
ventilated biological safety hood.

2.3 DNA IQ™ System 1. Magnetic Separation Stand.

Differential Extraction 2. DNA IQ™ System: Contains Lysis Buffer, Resin, 2X Wash
Buffer, and Elution Buffer. To make 1X Wash Buffer, dilute
the provided 2X Wash Buffer with equal parts reagent grade
ethanol and isopropyl alcohol (2:1:1). Each reagent should be
stored at room temperature. If a precipitate forms in the
provided Lysis Buffer, warm to 37–60  C.
3. DNA IQ™ Lysis Buffer with DTT: Add 250 μL 0.39 M DTT
to every 10 mL Lysis Buffer. Can be stored at room tempera-
ture for up to 1 month if tightly capped.

3 Methods

All methods are intended to be performed/processed using appro-

priate personal protective equipment (lab coat, gloves, hair net,
mask, and safety glasses), extraction control (reagent blank), and
universal precautions for clean technique and appropriate decon-
tamination procedures (decontamination of surfaces using 10%
bleach solution followed by 70% ethanol, decontamination of twee-
zers between samples using 10% bleach solution followed by 70%
ethanol, and changing tips between manipulation of or addition of
chemicals to each sample). The methods outlined in this chapter
have been adapted from those used at the Virginia Department of
Forensic Science [6].

3.1 Differential Lysis 1. Add 400 μL TNE, 25 μL 20% Sarkosyl, 75 μL Sterile Type I
Procedure Water, and 5 μL 20 mg/mL Proteinase K in proportional
amounts to saturate the substrate in a 1.5 mL microcentrifuge
tube (see Note 1).
2. Mix by light vortexing and then pulse spin to force the cutting
into the liquid.
3. Place the tube into a 37  C incubator or heat block for a
minimum of 2 h (see Note 2).
4. Vortex vigorously for 20–30 s and pulse spin the tube (see Note
3). Remove the substrate from the liquid with sterile or fully
106 Jonathan Forsberg and Caitlin Ayoub

Fig. 1 Sperm pellet wash. Depiction of microcentrifuge tube before (left) and after (right) removal of the
supernatant during removal of the non-sperm fraction and subsequent sperm wash steps of the differential
extraction. Minimal supernatant remains to avoid disturbance of the sperm pellet

decontaminated forceps or tweezers and place into a new,

unused spin basket. Place the basket in the tube and close the
lid. Spin the tube for 5 min in a microcentrifuge at a minimum
of 9400  g to remove the excess liquid from the cutting (see
Note 4).
5. Remove and discard the spin basket containing the substrate
(see Note 5).
6. Using a pipette, carefully transfer all but ~50 μL of the super-
natant into a new labeled microcentrifuge tube with a lid (see
Note 6). The supernatant removed from the pellet is the “non-
sperm fraction.” The pellet on the bottom of the tube will
become the “sperm fraction” (see Fig. 1).
7. Set the “non-sperm fraction” tube aside until the sperm frac-
tion is also ready for DNA extraction and purification (see
Subheading 3.1, step 14; Note 7). Store at room temperature
if completing the DNA extraction process on the same day, or
store refrigerated until extraction will be completed.
8. Wash the sperm pellet as follows: Add 500 μL PCR Digestion
Buffer and resuspend the pellet by vortexing briefly. Spin the
 Differential Extraction and DNA Purification Methods 107

tube for 5 min in a microcentrifuge at a minimum of 9400  g.

Remove and discard all but ~50 μL of the supernatant.
9. Repeat the wash an additional two times (see Note 8).
10. After the final wash, remove and discard all but ~50 μL of the
PCR Digestion Buffer. Resuspend the pellet in the remaining
50 μL of PCR Digestion Buffer by pipetting or light vortexing.
This is the “sperm fraction” (see Note 9).
11. To each sperm fraction: Add 150 μL TNE, 50 μL 20% Sarkosyl,
40 μL 0.39 M DTT, 150 μL Sterile Type I Water, and 10 μL
Proteinase K (see Note 10).
12. Mix by inverting by hand or light vortexing and place the tube
into a 56  C incubator or heat block for a minimum of 2 h, not
to exceed an overnight incubation.
13. Pulse spin the tube to force the condensate to the bottom of
the tube.
14. Proceed with both the sperm fraction and the non-sperm
fraction to organic extraction with Microcon® DNA purifica-
tion (see Subheading 3.2, step 1) or to Promega DNA IQ™
extraction and purification (see Subheading 3.3, step 1) (see
Note 11). Option: refrigerate sperm and non-sperm fractions
for up to 24 h for purification on the following day.

3.2 Organic 1. Start with the sperm fraction and non-sperm fraction lysate (see
Extraction with Subheading 3.1). If samples had been temporarily refrigerated,
Microcon® DNA allow them to come to room temperature before proceeding.
Purification 2. To both the sperm fraction and non-sperm fraction: Add
500 μL phenol-chloroform-isoamyl alcohol to each tube (see
Notes 12–14).
3. Cap the tube tightly and mix thoroughly by hand or light
vortexing until the solution has a milky appearance (see Note
15).
4. Spin the tube for 3 min at a minimum of 9400  g to separate
the two phases.
5. In a newly labeled Microcon® vial (provided with the Micro-
con® MRCF0R100 assembly), insert a Microcon® concentra-
tor and add 100 μL sterile Type I Water to the concentrator (see
Note 16).
6. Transfer the aqueous phase (see Fig. 2) to the Microcon®
concentrator and place the cap from the filtrate vial on the
concentrator (see Notes 17 and 18).
7. Spin the Microcon® assembly in a microcentrifuge for
10–40 min at a maximum of 2350  g until the volume is
reduced (see Note 19).
108 Jonathan Forsberg and Caitlin Ayoub

Fig. 2 Organic extraction layers. Depiction of microcentrifuge tube before (left) and after (right) removal of the
aqueous phase during organic extraction. Some aqueous phase remains after pipetting to avoid disturbance of
the interface or pipetting from the organic phase

8. Carefully remove the concentrator unit from the Microcon®

assembly and discard the fluid from the filtrate vial. Return the
concentrator to the top of the filtrate vial.
9. Add 200 μL sterile Type I Water to the concentrator. Replace
the cap and spin the Microcon® assembly in a microcentrifuge
for 10–30 min at approximately 2350  g until the volume is
completely reduced (see Notes 19 and 20).
10. Remove the cap from the concentrator and add 30 μL 1X TE
4
Buffer (see Note 21).
11. Remove the concentrator from the filtrate vial and discard the
vial. Carefully invert the concentrator and place it into a new
labeled Microcon® vial.
12. Spin the Microcon® assembly with the inverted concentrator in
a microcentrifuge tube for 5 min at 2350  g.
13. Verify the DNA extract is now present in the bottom of the vial,
then discard the concentrator unit and tightly close the cap on
the vial.
 Differential Extraction and DNA Purification Methods 109

14. The extract can be taken directly to quantitation or refrigerated

at 2–8  C until quantitation is performed (up to 1 week). If the
sample will be retained after processing and/or for long-term
storage of remaining DNA extracts, freeze at
10  C or lower
indefinitely or air-dry for future reconstitution.

3.3 DNA IQ™ 1. Start with the sperm fraction and non-sperm fraction lysate (see
Extraction and Subheading 3.1). If samples had been temporarily refrigerated,
Purification allow them to come to room temperature before proceeding.
2. For the non-sperm fraction, remove 100 μL of the lysate, place
it into a new, labeled 1.5 mL microcentrifuge tube (see Note
22), and then add 220 μL DNA IQ™ Lysis Buffer with DTT
to that new tube. If more than 100 μL of the non-sperm
fraction is used, add proportional volumes of DNA IQ™
Lysis Buffer with DTT. For the sperm fraction, add 220 μL
DNA IQ™ Lysis Buffer with DTT (see Note 23).
3. Vigorously vortex the bottle of DNA IQ™ Resin for 30 s. Then
add 8 μL DNA IQ™ Resin to each tube (see Notes 24 and 25).
4. After adding resin, vigorously vortex each sample for several
seconds (see Note 26).
5. Place the tubes in a microcentrifuge rack and allow the samples
to incubate at room temperature for 5 min, allowing the DNA
to adhere to the resin. After incubation, pulse spin in a micro-
centrifuge (see Note 27).
6. Transfer the sample tubes to a magnet separation stand. Open
the caps one at a time and, without disturbing the resin pellet,
remove and discard the liquid in each tube (see Fig. 3; Notes 28
and 29).
7. Add 100 μL of the prepared DNA IQ™ Lysis Buffer with DTT
into each tube. Remove the tubes from the magnetic stand and
vortex vigorously for several seconds. Pulse spin in a
microcentrifuge.
8. Place the tubes back into the magnet separation stand and,
without disturbing the resin pellet, remove and discard the
liquid in each tube (see Notes 28 and 29).
9. Add 100 μL 1X DNA IQ™ Wash Buffer (see Note 30) to each
tube. Remove the tubes from the magnetic stand and vortex
vigorously for several seconds. Pulse spin in a microcentrifuge.
Place the tubes back into the magnet separation stand and,
without disturbing the resin pellet, remove and discard the
liquid in each tube (see Notes 28 and 29).
10. Repeat the wash step (see Subheading 3.3, step 9) two addi-
tional times.
110 Jonathan Forsberg and Caitlin Ayoub

Fig. 3 DNA IQ™ Resin movement. Depiction of microcentrifuge tube before (left) and after (right) placing the
tube on the magnet stand during DNA IQ™ extraction/purification. DNA IQ™ Resin is seen pelleting on the
magnet side of the tube (right)

11. After the last wash step, open the cap on each tube and allow
the samples to completely air-dry (see Note 31).
12. Add 40 μL DNA IQ™ Elution Buffer to each tube to remove
the DNA from the resin. Vortex each tube vigorously for 5 s
(to avoid pelleting the resin, do not centrifuge at this step) (see
Note 32).
13. Place the tubes in a 56  C incubator or heat block for 5 min and
then pulse spin in a microcentrifuge (see Note 33).
14. Place the tubes back into the magnet separation stand and
transfer the supernatant (being careful to avoid any DNA
IQ™ Resin) into a clean, labeled microcentrifuge tube. This
new tube (of supernatant) contains the isolated DNA sample
and is the final DNA extract (see Note 34).
15. The extract can be taken directly to quantitation or refrigerated
at 2–8  C until quantitation is performed (up to 1 week). If the
sample will be retained after processing, for long-term storage
of remaining DNA extracts, freeze at
10  C or lower indefi-
nitely or air-dry for future reconstitution.
 Differential Extraction and DNA Purification Methods 111

4 Notes

1. A master mix of these chemicals can be made in a 15 mL conical

tube and aliquoted out to each sample. To do this, calculate the
number of samples (accounting for a reasonable overage of
10–20%) and multiply by the volume of each component to
be added to each sample, then add these together and mix prior
to distributing to the samples. Adding too much volume
(in excess of 600 μL) can cause the spin basket to sit in the
flow-through volume (see Subheading 3.1, step 4). Having
enough volume to saturate the substrate is important for
proper cell lysis. This should be considered during sample
collection. Under most circumstances, only up to two swabs/
swab shells or approximately 0.5–1 cm2 would be recom-
mended for extraction in a single 1.5 mL microcentrifuge
tube. To facilitate placement in the tube and allow for necessary
agitation during later steps, cut the substrate into smaller
pieces, as needed, and do not tightly pack the sample into the
bottom of the tube. Having sufficient volume to allow agita-
tion of the substrate in this lysis mixture will also maximize the
effect of vortexing (see Subheading 3.1, step 4) to successfully
remove as many sperm cells from the substrate as possible after
the initial lysis.
2. During this step, non-sperm cells are targeted for lysis. Incuba-
tion can be conducted overnight, if necessary. Longer incuba-
tion times are more likely to result in inadvertent lysis of sperm
cells. Agitation (e.g., periodic vortexing or use of a thermo-
mixer) during the incubation is beneficial but optional.
3. While DNA from lysed cells is already exposed and suspended
in the lysis mixture at this point, vortexing rigorously is crucial
for releasing the intact sperm cells from the substrate, as sperm
cells can be very resistant to release.
4. Positioning the tubes in a consistent orientation in the centri-
fuge will ensure the sperm pellet can most easily be avoided
when removing the supernatant (see Subheading 3.1, steps 6
and 8). Positioning each microcentrifuge tube with the hinges
facing out, for example, will cause the sperm pellet (which is
often not visible) to concentrate on that side of the tube (see
Fig. 1).
5. If you desire to keep the substrate, the spin basket containing
the substrate may be placed into a new tube instead of discard-
ing. Leaving the substrate tube open in a hood overnight or
longer will allow any moisture remaining in the substrate to dry
and prevent mold or bacterial growth.
6. To avoid disturbing or dislodging the sperm pellet, it is best to
remove the supernatant by positioning the pipette tip as close
112 Jonathan Forsberg and Caitlin Ayoub

to the meniscus as possible (see Fig. 1), keeping the tip

submerged. Follow the meniscus down as the supernatant is
drawn up the pipette tip. Keeping the sperm pellet intact is
crucial to ensuring maximum sperm recovery from the sample.
If disturbance of the sperm pellet is noticed or suspected, the
sample can be re-centrifuged at the same parameters prior to
completing this step.
7. Be sure the tube labels for the “sperm fraction” and “non-
sperm fraction” differ to prevent downstream sample switches
of the fractions.
8. In addition to the typical three washes, one or two additional
washes may be desirable if exceptionally high non-sperm con-
tent is expected (such as internal body samples). Additional
washes will not only further dilute any remaining non-sperm
DNA present in the sample but also add an additional risk of
inadvertently disturbing the sperm pellet (visible or invisible).
If disturbance of the sperm pellet is noticed or suspected during
a wash, the centrifuge step can be repeated prior to removing
the supernatant.
9. Optional: ~3 μL of the sperm fraction can be pipetted onto a
glass microscope slide for fixation and staining. The pellet
should be resuspended by pipetting or light vortexing, fol-
lowed by a pulse spin (if needed) prior to slide preparation.
10. A master mix of these chemicals can be made in a 15 mL conical
tube and aliquoted to each sample in the appropriate amounts.
The DTT present in this lysis mixture will reduce the disulfide
bonds of the sperm head to expose sperm cell DNA when
combined with the increased temperature of the incubation
and presence of Proteinase K and sarkosyl.
11. Subheadings 3.2 and 3.3 each accomplish the purification of
the DNA released during the differential lysis methods out-
lined in Subheading 3.1. Organic/Microcon® DNA purifica-
tion described in Subheading 3.2 is a very effective purification
method regardless of DNA concentration and is especially
robust in dealing with difficult or dirty samples. The largest
downsides to this purification method include the time-
consuming nature of this technique and caustic nature of
PCIAA (which demands use only in a ventilated fume hood)
[7]. This technique also requires more exact dexterity com-
pared to DNA IQ™ (see Note 18). The manual DNA IQ™
purification method described in Subheading 3.3 is simple and
effective for a wide range of DNA concentrations typically
encountered in forensic casework [4]. A primary drawback to
DNA IQ™ is that it does have lower recovery rates when
dealing with DNA concentrations that exceed the capacity of
the DNA IQ™ Resin (100 ng) or when excessive non-human
DNA is present in the sample [8, 9].
 Differential Extraction and DNA Purification Methods 113

12. The volume of PCIAA added should be approximately equal to

the volume of the sample at this time. A higher volume of
PCIAA should be added if higher volumes are present.
13. At a minimum, the early portion of the organic extraction (see
Subheading 3.2, steps 1–6) should be performed in a
biological safety hood to minimize exposure to PCIAA (caustic
chemical; see the manufacturer’s Safety Data Sheet before
handling). Completing the bulk of the protocol (see Subhead-
ing 3.2, steps 1–12) in the hood could further lessen exposure
to minute residual phenol.
14. Allow PCIAA to come to room temperature prior to use.
15. Ensure that the sample tube is completely closed during this
step. If a leak occurs, in addition to leaked PCIAA (hazardous),
aerosolized DNA can escape during vortexing/agitation, caus-
ing DNA loss and potential contamination. Screw top tubes are
not necessary but can be considered to help ensure that the risk
of leakage is minimized. The agitation does not need to be for a
prolonged period; a light vortex or a few shakes will generally
achieve this “milky” appearance. This step is necessary to
ensure that maximum exposure of all sample components
(lipids, DNA, partially digested proteins, etc.) to the hydro-
phobic phenol now present in the sample is achieved, allowing
proper sorting based on polarity.
16. This step can be performed prior to adding PCIAA to
the sample lysate (see Subheading 3.2, step 2), if desired. The
Microcon® concentrator should be seated in the vial with the
filter facing up and the narrow white portion oriented towards
the bottom of the vial [3]. The concentrator remains in this
configuration when in the tube until inversion (see Subheading
3.2, step 11).
17. At this stage of the process, the tube contains two phases: the
aqueous phase on the top contains hydrophilic DNA and the
phenol (organic) phase on the bottom contains hydrophobic
contaminants. The interface (also commonly referred to as
interphase) exists in the middle of this mixture where the two
layers meet. This thin layer may contain partially digested
proteins with hydrophobic and hydrophilic regions and can
often extend slightly into the aqueous layer, appearing
“fuzzy” at times.
18. The interface and the organic phase contain contaminants that
can cause downstream inhibition and complications. Phenol
itself is a known PCR inhibitor and can also damage the Micro-
con® filter in the concentrator. The proteins at the interface can
plug the Microcon® filter used during the remainder of this
protocol, limiting the effectiveness of the wash steps. As a
result, it is important to avoid pulling from these layers when
114 Jonathan Forsberg and Caitlin Ayoub

removing the aqueous phase. The best technique for avoiding

the interface and lower organic layer is to begin pipetting with
the pipette tip as close to the top of the aqueous layer as
possible, following it down as you remove the aqueous layer,
leaving a small portion of the aqueous layer behind (see Fig. 2).
Removal of the aqueous layer can also be accomplished with a
transfer pipette, based on individual preference. If the interface
or organic phase is believed to have been pipetted with the
aqueous layer, it can be returned to the tube, followed by
repeating the corresponding mixing and centrifugation steps
(see Subheading 3.2, steps 3 and 4). If a final extract is identi-
fied as containing phenol (by observed inhibition or smell), the
extract can be brought up to a larger volume (~400–500 μL)
with an appropriate solvent, such as TNE, and the entire
extraction and purification process may be repeated (see Sub-
heading 3.2), ensuring better avoidance of the organic phase
(see Subheading 3.2, step 6).
19. This protocol calls for speeds exceeding the manufacturer
recommended maximum speed of 500  g. A speed of 2350
 g was chosen due to the difficulty of some samples to pass
through the concentrator at lower speeds. While the speed in
this protocol is above that which is recommended by the
manufacturer, it has been used with much success. Excessive
speeds may damage the filter or cause the DNA to embed itself
in the filter, so further exceeding these recommendations is not
advised. Spin times may need to be adjusted if lower speeds are
used. Once the volume has adequately passed through (see
Subheading 3.2, steps 7 and 9), no significant volume will
remain; however, the surface of the filter should still appear
shiny with moisture, and there may be a very small ring
(of negligible volume) along the outer rim of the filter. The
goal is not to completely “dry” the filter. Samples with extraor-
dinarily high concentrations of DNA will frequently take lon-
ger to fully flow through (see Subheading 3.2, steps 7 and 9).
Consider rotating the assembly if this is causing issues, as this
will allow the volume to pass through more readily on the
opposite side of the filter by avoiding the more saturated pores.
20. If the concentrator filter was stained by the lysate and the
staining has not yet been removed, the water wash (see Sub-
heading 3.2, steps 8 and 9) may be repeated additional times
to reduce the potential of the dye or colored material from
inhibiting the subsequent PCR amplification.
21. If a high concentration of DNA is expected or regularly noticed
for specific sample types (far exceeding the appropriate concen-
tration per amplification kit), up to 100 μL may be used as the
final elution volume. Non-sperm fractions for internal body
samples are the most likely to recover the highest amounts of
 Differential Extraction and DNA Purification Methods 115

DNA. To ensure DNA is not overdiluted at this step, it would

generally be more desirable to perform small sample dilutions
rather than overdiluting up front. Ensure the reagent blank
utilizes the smallest final elution volume of the associated
samples to allow maximum sensitivity to potential
contaminants.
22. The remainder of the non-sperm fraction lysate can be retained
in the refrigerator for up to 24 h or discarded.
23. Resuspend the pellet with a quick vortex or pipetting before
proceeding. This ensures that the sample is well mixed prior to
beginning.
24. If the stock bottle of DNA IQ™ Resin has settled between
samples, re-vortex before further use. Avoiding separation of
the resin from the liquid is important to prevent unequal
amounts, or a complete lack of resin, from being added to
the samples. The incorrect amount of resin can cause inconsis-
tent DNA yields between samples, due to aggregate clumps or
insufficient resin [9, 10].
25. The resin beads have an approximate maximum capacity of
100 ng per sample [9]. Since the DNA extracted with DNA
IQ™ is not human-specific, if there is any bacterial, fungal, or
animal DNA present in a sample, that DNA will also be isolated
and compete with human DNA for the resin beads [8, 9].
26. Tap the tube on the bench a few times to force the liquid to the
bottom, if needed. Do not centrifuge at this time.
27. The proprietary DNA IQ™ Lysis Buffer contains a detergent
(which breaks open cells and separates the DNA from cellular
debris) as well as guanidinium thiocyanate (which is a chaotro-
pic agent). The purpose of a chaotropic agent is to allow the
DNA to bind to the paramagnetic silica-coated beads through
a series of hydrophobic interactions and hydrogen bonding.
During this step, the DNA is beginning to adhere to the silica-
coated resin, while the remainder of the cellular debris and
molecules stay in solution to be later removed.
28. Once on the magnetic stand, if the resin doesn’t have a distinct
pellet on the side of the tube (see Fig. 3), try vortexing again
and place it back on the magnetic stand.
29. This is best achieved by pipetting at an angle away from the
resin to avoid disturbing the pellet. At this step, the DNA has
adhered to the resin and the liquid being discarded contains
cellular waste and extraneous material.
30. With its alcohol and low salt content, the DNA IQ™ Wash
Buffer keeps the DNA adhered to the resin while removing
excess salt, detergents, and cellular debris. These wash steps
116 Jonathan Forsberg and Caitlin Ayoub

help to purify the DNA from any potential inhibitors, con-

taminants, and unwanted material that may affect downstream
processing.
31. Space out tubes as much as possible to minimize any risk of
contamination, opening each tube carefully. This will take
approximately 5 min depending on the volume of liquid
remaining in the tube. The purpose of this drying step is to
evaporate the remaining alcohol in the sample, as that is what
helps DNA adhere to the resin beads but can also act as an
inhibitor of downstream DNA testing. Do not exceed a drying
time of 20 min, as it is important to prevent the resin from
completely drying out, which can prevent successful elution of
the DNA. If the resin dries up, then the DNA will be bound
irreversibly to the resin, thereby causing inconsistent DNA
yields.
32. The DNA IQ™ Elution Buffer is a non-salt, non-alcohol solu-
tion that helps change the stringency conditions, allowing the
DNA to dissociate from the resin beads and re-enter solution.
33. The isolated DNA will be single-stranded due to the heat at the
elution step, so this method is not compatible with traditional
gel methods but is compatible with the STR typing more
frequently conducted nowadays.
34. If DNA IQ™ Resin is removed with the supernatant, this may
cause inhibition during PCR amplification, including quantita-
tive PCR (qPCR) or STR amplification. If DNA IQ™ Resin is
present in the DNA extract, pulse spin the tube in a microcen-
trifuge, place it back on the magnet separation stand, and
transfer the supernatant to a new, clean, labeled microcentri-
fuge tube [9].

References

1. Yoshida K, Sekiguchi K, Mizuno N et al (1995) 4. Mandrekar PV, Krenke BE, Tereba A (2001)
The modified method of two-step differential DNA IQ™: the intelligent way to purify DNA.
extraction of sperm and vaginal epithelial cell Available via Promega Corporation. https://
DNA from vaginal fluid mixed with semen. w w w. p r o m e g a . c o m / - / m e d i a / fi l e s / r e s
Forensic Sci Int 72(1):25–33. https://doi. ources/profiles-in-dna/403/dna-iq-the-intelli
org/10.1016/0379-0738(94)01668-u gent-way-to-purify-dna.pdf?rev¼f700c4481
2. Butler JM (2012) Chapter 2: DNA extraction a4243739f23570f6834cd37&sc_lang¼en.
methods. In: Advanced topics in forensic DNA Accessed 31 May 2022
typing: methodology. Elsevier Academic Press, 5. Hu Q, Liu Y, Yi S et al (2015) A comparison of
Waltham four methods for PCR inhibitor removal.
3. Merck Millipore Ltd (2018) Microcon® cen- Forensic Sci Int Genet 16:94–97. https://doi.
trifugal filter devices user guide. Available via org/10.1016/j.fsigen.2014.12.001
Millipore Sigma. https://www.emdmillipore. 6. Department of Forensic Science (2021) Foren-
com/US/en/product/Microcon-Centrifu sic biology procedures manual: extraction of
gal-Filters,MM_NF-C113861#documenta DNA. Available via Virginia Department of
tion. Accessed 31 May 2022 Forensic Science. https://www.dfs.virginia.
gov/wp-content/uploads/2021/06/210-
 Differential Extraction and DNA Purification Methods 117

D2004-FB-PM-Extraction-of-DNA. in DNA 5(1):11–12. Available via Promega

pdf. Accessed 31 May 2022 Corporation. https://www.promega.com/-/
7. Köchl S, Niederstätter H, Parson W (2005) media/files/resources/profiles-in-dna/501/
DNA extraction and quantitation of forensic dna-iq-system-frequently-asked-questions.pdf?
samples using the phenol-chloroform method rev¼d20abf9fb6b34dedade70d22901d1
and real-time PCR. In: Carracedo A c51&sc_lang¼en. Accessed 31 May 2022
(ed) Forensic DNA typing protocols, Methods 10. Promega Corporation (2021) Technical bulle-
in molecular biology, vol 297. Humana Press, tin: DNA IQ™ System—small sample case-
Totowa, pp 13–29. https://doi.org/10.1385/ work protocol. Available via Promega
1-59259-867-6:013 Corporation. https://www.promega.com/-/
8. Frégeau CJ, De Moors A (2012) Competition media/files/resources/protocols/technical-
for DNA binding sites using Promega DNA bulletins/101/dna-iq-system-small-sample-
IQ™ paramagnetic beads. Forensic Sci Int casework-protocol.pdf?rev¼90e98272389c4
Genet 6(5):511–522. https://doi.org/10. c8389b0d2b29011a342&sc_lang¼en.
1016/j.fsigen.2011.12.003 Accessed 31 May 2022
9. Huston K (2002) Technical tips: DNA IQ™
System “frequently asked questions”. Profiles
 Chapter 8

DNA Purification from Bloodstains and Buccal Cells/Saliva

on FTA® Cards
Brittany C. Hudson and Catherine Cupples Connon

Abstract
FTA® cards enable efficient, long-term storage of blood and buccal cells/saliva samples for future forensic
DNA analysis; these are typically collected as known reference samples, as opposed to evidentiary, crime
scene samples. Upon contact with the FTA® card, cells are lysed and the DNA is immobilized. Different
FTA® cards are available and have been specially formulated based on sample type: bloodstains are added to
the traditional FTA® Card, while colorless sources (e.g., buccal cells/saliva) are added to the FTA®
Indicating Card. The main difference between these cards is the presence of a pink dye embedded in the
indicating cards that becomes white when exposed to colorless fluids, like saliva; this aids in location
confirmation of the stain for future sampling. Although DNA can be eluted/extracted from FTA® punches
using various methods or, alternatively, direct STR amplification from unpurified punches can be per-
formed, the protocol herein describes a simple purification method for bloodstained punches from FTA®
Cards as well as buccal/saliva-stained punches from FTA® Indicating Cards. Following this purification,
STR amplification can be performed via the “punch-in” method.

Key words DNA purification, FTA® Card, FTA® Indicating Card, Blood, Saliva, Buccal cells

1 Introduction

With the increased submission of reference and evidence samples

related to criminal investigations, the need for their efficient storage
and preservation has become imperative. Blood and buccal cells/
saliva routinely serve as known reference samples that are utilized
for comparison with other evidentiary samples collected in associa-
tion with a suspected crime. Traditionally, blood samples are col-
lected in anticoagulant-containing tubes to obtain reference DNA
from known individuals. Moreover, buccal swab samples are per-
haps the most commonly encountered reference sample type from
living individuals, even more so than blood, and are traditionally
collected by swabbing the inside of an individual’s cheeks to obtain
buccal cells. While both sample types can take up unnecessary space
within a lab, refrigeration/climate control is also necessary for the

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_8,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

119
120 Brittany C. Hudson and Catherine Cupples Connon

storage of blood vials to ensure sample preservation. Buccal swabs

can be stored at room temperature for the short term but will need
temperature/climate control to prevent bacterial/fungal growth if
long-term storage is desired.
The development of FTA® paper by Lee Burgoyne in the late
1980s provided an ideal solution to this storage dilemma. FTA®
(FTA), originally standing for “Fitzco/Flinder Technology Agree-
ment,” is a cellulose-based material impregnated with four propri-
etary chemicals (e.g., a surfactant, chelating agent, buffer, and free
radical trap) that help to release, protect, and preserve DNA for
long periods [1, 2]. These flat cards enable space-efficient and
stable storage of DNA at room temperature for years. In addition
to these benefits, the use of a punching tool to collect a sample from
the card results in a fairly consistent recovery of DNA from blood—
roughly 5–20 ng for a 1.2 mm punch [3, 4]. Yields are often similar
from saliva punches of the same size but are subject to higher
variability due to the nature of that particular body fluid [5, 6]. Fur-
thermore, studies have demonstrated that DNA profiles can be
successfully obtained from blood or saliva stored on FTA for as
long as 16 or 11 years, respectively [5, 7]. Upon contact with FTA
paper, cells are lysed, proteins are denatured, DNA becomes immo-
bilized within the cellulose matrix, and bacteria and viruses are
inactivated. Downstream DNA analysis (i.e., STR amplification
and profile generation) can be performed either directly on a por-
tion of the FTA card or the DNA can be eluted from the punch and
carried forward. In fact, a variety of DNA extraction and elution
methods have been evaluated for use with both blood and saliva
stored on FTA [6, 8–10]. Regardless, wash steps are necessary for
both sample types to remove cell debris—as well as heme inhibitors
from blood—to ensure efficient STR amplification [11–13]. Typi-
cally, washes are performed with QIAcard® FTA® Wash Buffer
(formerly known as FTA® Purification Reagent; Qiagen, Hilden,
Germany) and either a Tris-EDTA (TE) buffer (10 mM Tris-HCl
with either 1 mM or 0.1 mM EDTA, referred to as TE/TE
1 or
low TE/TE
4, respectively) or water [3, 4, 10, 14–17]. Blood
samples can also undergo an additional wash with a dilute sodium
hydroxide or ammonium hydroxide solution [10, 17, 18].
Since buccal cells (and saliva) are essentially colorless, FTA®
Indicating Cards (FTA indicating cards; Qiagen) were developed as
an alternative to the traditional FTA® Cards (FTA cards; Qiagen)
for use with this and other colorless sample types. The proprietary
pink dye embedded in the card becomes white upon application of
a colorless body fluid, which aids in subsequent sampling for DNA
analysis [14, 19]. A variety of FTA card sizes have also been made
available, including the Classic, Mini, and Micro formats, with four,
two, and one sample area(s) per card, respectively [14]. Labora-
tories can choose the option(s) that best fit their needs.
 DNA Purification from FTA® Cards 121

This chapter will describe a simple method for the purification

of DNA from blood or buccal cells/saliva stored on FTA cards or
FTA-indicating cards, respectively, that can then be carried forward
to “punch-in” STR amplification.

2 Materials

All solutions should be prepared with Type I water. It is good

laboratory practice to aliquot reagents for short-term use
(~1 month), rather than pulling from the stock solution each
time; this reduces the risk of contaminating the stock solution.
1. Blood on FTA® Cards or buccal cells/saliva on FTA® Indicat-
ing Cards: Stains must be dry before proceeding (see Note 1).
2. 1.2 mm punching tool (see Note 2).
3. Punch mat.
4. Biosafety cabinet or hood.
5. QIAcard® FTA® Wash Buffer: Purchase ready-to-use and store
at room temperature.
6. Type I water: May be purchased ready-to-use as Type I, ultra-
pure, amplification grade, molecular biology grade water, etc.
(or prepared in-house). Prepare in-house by autoclaving
reverse osmosis (RO) water that has been subjected to an
additional filtration system to achieve a resistivity of
18–18.3 MΩ-cm at 25  C. Store at room temperature. Expires
within 1 year after preparation.
7. 5–7% ammonium hydroxide (NH4OH): Prepare fresh prior to
use; do not store. Stock solutions of ammonium hydroxide are
generally purchased as a 29% solution and need to be diluted
further to ~5–7%. This is only needed for bloodstains on FTA
cards.
8. Tris-EDTA (TE) Buffer: This is also referred to as TE
1 (with
respect to the concentration of EDTA relative to Tris-HCl).
May be purchased ready-to-use or prepared in-house. Prepare
in-house to a final concentration of 10 mM Tris-HCl and
1 mM EDTA; adjust to pH 7.5–8.0. Autoclave and store at
room temperature. Expires within 1 year after preparation.

3 Method

This protocol can be utilized to simultaneously process multiple

FTA samples of the same type (see Note 1; Fig. 1), along with a
single reagent blank. Users can choose to process more than one
reagent blank, if needed. Universal precautions should be taken
122 Brittany C. Hudson and Catherine Cupples Connon

Fig. 1 Overview of DNA purification from FTA punches. The typical workflow for DNA purification from blood on
FTA cards and saliva/buccal cells on FTA indicating cards using a 1.2 mm punch is shown above. A reagent
blank is collected from an unstained area and processed alongside the other samples of the batch
1
Formerly known as FTA Purification Reagent
2
TE
4 and Type I water have also proven to be effective for this wash step [3, 10, 14–16]

regarding the handling of biohazardous materials (e.g., human

body fluids), including decontamination of laboratory surfaces/
equipment with 10% bleach followed by 70% ethanol before and
after each use; changing pipette tips in between each sample/
reagent; and wearing personal protective equipment (PPE), as
defined by your laboratory policy. Basic PPE includes a lab coat,
gloves, and safety glasses.

3.1 Purification from 1. Add 100 μL QIAcard FTA Wash Buffer to a 1.5 mL micro-
Blood on FTA Cards centrifuge tube (see Note 3).
2. Using a 1.2 mm punching tool, punch a single, bloodstained
circle from the FTA card and dispense it into the microcentri-
fuge tube (see Note 2). When implementing reduced volume
protocols for STR amplification, smaller punches or punches
containing less sample should be used to prevent over-
amplification (see Note 4). Clean the punching tool and mat
between samples (see Note 5).
3. For the reagent blank, punch an unstained area of the FTA card
and dispense it into the corresponding microcentrifuge tube
containing QIAcard FTA Wash Buffer (see Note 6).
4. Incubate the tubes containing FTA punches and buffer at room
temperature for 15 min.
5. Using a new tip for each sample, pipette the solution up and
down 3–4 times to thoroughly mix (see Note 7). Discard the
solution; be careful to retain the punch in its tube.
 DNA Purification from FTA® Cards 123

6. Add 100 μL QIAcard FTA Wash Buffer to each tube and repeat
the wash step (see Subheading 3.1, steps 4–5) one time, for a
total of two washes.
7. Add 100 μL fresh 5–7% ammonium hydroxide to each tube and
incubate at room temperature for 15 min. Then mix and dis-
card the solution (see Subheading 3.1, step 5).
8. Add 100 μL TE to each tube and incubate at room temperature
for 5 min. Then mix and discard the solution, being sure to
remove all TE before proceeding (see Subheading 3.1, step 5;
Notes 8 and 9).
9. Place the tubes (with lids open) in a biosafety cabinet or hood
and allow the punches to dry at room temperature for a mini-
mum of 3 h, up to overnight (see Note 10).
10. Resuspend the punches in 5 μL Type I water. Punches can
proceed immediately to STR amplification or can be stored at

20  C until STR amplification (see Note 11).

3.2 Purification from 1. Add 100 μL QIAcard FTA Wash Buffer to a 1.5 mL micro-
Buccal Cells/Saliva on centrifuge tube (see Note 3).
FTA Indicating Cards 2. Using a 1.2 mm punching tool, punch a single, white-stained
circle from the FTA indicating card and dispense it into the
microcentrifuge tube. Larger and/or duplicate punches may
prove beneficial to improve first-pass DNA profiling success,
whereas smaller punches or punches containing less sample
may prove beneficial for reduced volume amplifications (see
Notes 2 and 4). Clean the punching tool and mat between
samples (see Note 5).
3. Prepare a reagent blank from an unstained (i.e., pink) area of
the FTA indicating card and continue through the two QIA-
card FTA Wash Buffer washes, as described for bloodstains on
FTA cards (see Subheading 3.1, steps 3–6).
4. Continue with the TE wash and final steps as described for
bloodstains on FTA cards (see Subheading 3.1, steps 8–10).
The ammonium hydroxide wash is not needed for buccal cells/
saliva samples and should be eliminated for this sample type.

4 Notes

1. Only process samples of the same type together; do not process

blood and buccal/saliva samples at the same time.
2. The punching tool needs to be suitable for use with body fluids
on FTA cards (e.g., the Harris Uni-Core Punch). A 1.2 mm
punching tool is used in this protocol, but various sizes can be
purchased and utilized. Studies have demonstrated different
124 Brittany C. Hudson and Catherine Cupples Connon

punch sizes may be optimal depending on the body fluid,

sample age, and STR amplification kit [3–7, 10, 15, 16]. Addi-
tionally, buccal samples have historically produced greater
variability in DNA yield, likely due to the nature of the sample
and the clumping of epithelial cells on the matrix [5, 6]; there-
fore, studies have shown that larger punches and/or duplicate
punches per extraction or “punch-in” amplification improve
STR profiling results [5, 6].
3. The small size of FTA punches enables their tendency to
“jump” because of static electricity or air flow [1, 4,
20]. Given this, it is helpful to eject the FTA punch as close
to the bottom of the microcentrifuge tube as possible. Adding
reagent prior to the FTA punch also reduces the possibility of
static electricity and punch “jumping.” Alternatively, imple-
menting a static gun could prove useful in preventing the
punches from moving out of their respective tubes. Lastly,
QIAcard FTA Wash Buffer can be added after the punch is
dispensed into the tube (see Subheading 3.1, step 2 and Sub-
heading 3.2, step 2), but this is not recommended because
doing so increases the possibility of the punch “jumping” due
to static electricity.
4. Since reduced volume amplifications typically result in higher
sensitivity, adding too much sample can overwhelm the reac-
tion and lead to general over-amplification of the STR profile,
including increased artifacts and peak heights. Utilizing a
25–50% bloodstained 1.2 mm punch has shown to be ideal
for quarter-volume reactions (~6 μL) for a variety of STR
amplification kits [17]. Utilizing a 50–75% bloodstained
1.2 mm punch, or a fully stained 1.0 mm punch, will likely
work well for half reactions (~12–13 μL). The punch/stain size
of buccal samples for reduced volume amplifications should be
assessed by individual laboratories given their increased varia-
bility in yields (see Note 3).
5. Equipment and workspaces are typically sterilized between
samples using 10% bleach and 70% ethanol. However, studies
have demonstrated that punching (and discarding) a clean/
unstained area of FTA paper in between samples is sufficient
for preventing the carryover of DNA from the punching tool
itself [18, 20]. Should a laboratory choose to implement this
practice, it would need to be assessed as part of their internal
validation. Regardless of the cleaning method used for the
punching tool, the punching mat must be decontaminated
with bleach and ethanol.
6. The reagent blank punch should be the same size as the sample
punch. Additionally, if two punches are used (e.g., for buccal
samples), the reagent blank should also consist of two
unstained punches.
 DNA Purification from FTA® Cards 125

7. Pipetting up and down can introduce bubbles; thus, extreme

caution must be taken not to get reagent bubbles onto/into
the shaft of the pipette within the pipette tip (if this happens,
the pipette must be taken out of commission until it can be
professionally serviced). Using a slow, steady pipetting tech-
nique can prevent the formation of bubbles, but the use of
aerosol-barrier pipette tips is highly recommended to further
protect the pipette itself from contamination. Alternatively,
aspirating a volume greater than 100 μL with a larger pipette
tip (e.g., using a P1000 pipette set to 500 μL) will more
efficiently remove the reagent and any bubbles, as compared
to exactly 100 μL, while also preventing reagent bubbles from
contacting the shaft of the pipette.
8. Delays in the removal of TE at this step can lead to excess
leaching of DNA from the FTA punch into the TE and may
result in poor amplification/STR profile development due to
insufficient amounts of DNA being retained on the punch.
9. A second TE wash is necessary for reduced volume amplifica-
tion of bloodstains on FTA [17]. Failure to perform a second
wash for such samples leads to over-amplification and poor
STR profiles. If over-amplification is routinely seen in full-
volume reactions of bloodstains (or other combinations of
reaction volumes and sample types), a second TE wash should
also be added.
10. Alternatively, punches can be incubated at 56  C for 10 min to
assist with drying [14].
11. DNA is retained on the FTA punch, but some also elutes into
the water. Generally, only the punch is STR amplified (addi-
tional Type I water is added to the reaction to bring it up to the
required volume). However, both the punch and 5 μL water in
which it was initially resuspended (see Subheading 3.1, step 10)
can be added to the amplification reaction, if deemed necessary.
Some amplifications may be sensitive enough to generate STR
profiles from the water alone, without the punch. It is the
laboratory’s responsibility to validate the exact parameters for
the amplification of FTA-purified samples.

References
1. Butler JM (2012) Chapter 2: DNA extraction Sci Int Genet 6(2):176–179. https://doi.org/
methods. In: Advanced topics in forensic DNA 10.1016/j.fsigen.2011.04.008
typing: methodology. Elsevier Academic Press, 4. Vun Onn Liew P, Riccardi LN, Afolabi AO et al
Waltham (2018) Optimization of a reduced volume
2. Burgoyne LA (1999) Solid medium and PCR amplification for PowerPlex® Fusion kit
method for DNA storage. US Patent using FTA cards and generation of population
5,985,327, 16 Nov 1999 genetic data for Brunei population. Electro-
3. Wong HY, Seng E, Lim S et al (2012) Amplifi- phoresis 39(23):2979–2990. https://doi.
cation volume reduction on DNA database org/10.1002/elps.201800256
samples using FTA™ classic cards. Forensic
126 Brittany C. Hudson and Catherine Cupples Connon

5. Corradini B, Alù M, Magnanini E et al (2019) 39(2):485–493. https://doi.org/10.1128/

The importance of forensic storage support: JCM.39.2.485-493.2001
DNA quality from 11-year-old saliva on FTA 13. Sidstedt M, Hedman J, Romsos EL et al
cards. Int J Legal Med 133:1743–1750. (2018) Inhibition mechanisms of hemoglobin,
https://doi.org/10.1007/s00414-019- immunoglobulin G, and whole blood in digital
02146-6 and real-time PCR. Anal Bioanal Chem 410:
6. Millipore Sigma (2022) Reliable DNA extrac- 2569–2583. https://doi.org/10.1007/
tion from Whatman® FTA® cards. Available via s00216-018-0931-z
Millipore Sigma. https://www.sigmaaldrich. 14. Qiagen (2021) QIAcard® FTA® product sheet.
com/US/en/technical-documents/proto Available via Qiagen. https://www.qiagen.
col/genomics/dna-and-rna-purification/ com/us/resources/resourcedetail?id¼8fe393
whatman-reliable-extraction-of-dna. Accessed 6f-4948-487a-8a1e-35d92776cdba&
31 May 2022 lang¼en. Accessed 31 May 2022
7. Rahikainen A, Palo JU, de Leeuw W et al 15. Parsons L, Bright J (2012) A manual and auto-
(2016) DNA quality and quantity from up to mated method for the forensic analysis of DNA
16 years old post-mortem blood stored on from buccal samples on Whatman indicating
FTA cards. Forensic Sci Int 261:148–153. FTA elute cards. Aust J Forensic Sci 44(4):
https://doi.org/10.1016/j.forsciint.2016. 3 9 3 – 4 0 2 . h t t p s : // d o i . o r g / 1 0 . 1 0 8 0 /
02.014 00450618.2012.693949
8. Miles M, Saul D (2019) Improved elution of 16. Srisiri K, Jaroenwattana R, Panvisavas N et al
DNA from Whatman FTA cards using (2017) Optimisation of DNA recovery and
prepGEM and forensicGEM Universal extrac- analysis of urine samples stored on FTA® card.
tion kits. MicroGEM. https://microgembio. Forensic Sci Int Genet Suppl Ser 6:e520–e522.
com/m_resource/improved-elution-of-dna- https://doi.org/10.1016/j.fsigss.2017.
from-whatman-fta-cards-using-prepgem-for 09.206
ensicgem-universal-extraction-kits. Accessed 17. Connon CC (2022) Developing effective and
04 Aug 2022 sustainable teaching labs for forensic DNA
9. Burgos G, Flores-Espinoza R, Ruiz-Pozo VA, courses. In: Proceedings of the American Acad-
Villacrés Granda I (2019) Efficient preserva- emy of Forensic Sciences 74th Annual Scien-
tion of DNA extracted from blood in FTA tific Conference, Seattle, 2022
cards by Chelex method. Forensic Sci Int 18. Smith LM, Burgoyne LA (2004) Collecting,
Genet Suppl Ser 7:539–541. https://doi.org/ archiving and processing DNA from wildlife
10.1016/j.fsigss.2019.10.082 samples using FTA® databasing paper. BMC
10. Tack LC, Thomas M, Reich K (2007) Auto- Ecol 4:1–11. https://doi.org/10.1186/
mated forensic DNA purification optimized for 1472-6785-4-4
FTA card punches and Identifiler™ STR-based 19. Moran N, Tatnell P (2016) Identification of
PCR analysis. Clin Lab Med 27(1):183–191. colored dyes that are resistant to fading on
https://doi.org/10.1016/j.cll.2006.12.009 exposure to ethylene oxide; use with indicating
11. Akane A, Matsubara K, Nakamura H et al FTA™ sample collection cards. J Forensic Sci
(1994) Identification of the heme compound Med 2(2):67–73. https://doi.org/10.4103/
copurified with deoxyribonucleic acid (DNA) 2349-5014.184191
from bloodstains, a major inhibitor of polymer- 20. Ogden SJ, Horton JK, Stubbs SL et al (2015)
ase chain reaction (PCR) amplification. J Performance testing of a semi-automatic card
Forensic Sci 39(2):362–372 punch system, using direct STR profiling of
12. Al-Soud WA, Rådström P (2001) Purification DNA from blood samples on FTA™ cards. J
and characterization of PCR-inhibitory com- Forensic Sci 60(S1):S207–S212. https://doi.
ponents in blood cells. J Clin Microbiol org/10.1111/1556-4029.12622
 Part III

DNA Quantification
 Chapter 9

Yield Gel via Quantitative Gel Electrophoresis

Victoria R. Parks and Dayanara A. Torres

Abstract
Quantitative gel electrophoresis, also referred to as yield gel via gel electrophoresis, is an early quantification
method that was developed to provide an estimate of the quality and the quantity of DNA extracted from
evidence or reference samples. To conduct quantitative gel electrophoresis, an agarose gel that is combined
with a nucleic acid gel stain is prepared. The gel stain intercalates between double-stranded DNA and can be
visualized using UV light. DNA extract samples, along with DNA standards (ranging from 250 to 5 ng),
and a 1 KB ladder are combined with a 6X loading dye and loaded on the agarose gel. Voltage is applied to
facilitate DNA migration through the gel from the negative to the positive electrode, separating DNA
fragments by size. After electrophoresis is complete, the results are visualized using UV light, and an image
is captured for analysis. High-quality and -quantity DNA should contain a compact band comparable to
that of the high molecular weight standards and ladder, with some smearing down the sample well. If a
DNA extract sample does not produce a compact band and presents with only a smear, this is an indication
that DNA degradation has occurred. This chapter provides instructions on how to successfully prepare an
agarose gel, load DNA extract samples and corresponding controls, appropriately set up and run quantita-
tive gel electrophoresis, interpret the results, and ensure comprehension of the method so troubleshooting
can be performed if needed.

Key words Yield gel, Quantitative gel electrophoresis, Forensic DNA quantification, Agarose gel,
DNA migration, GelRed® Nucleic Acid Stain, Molecular sieve

1 Introduction

When processing biological evidentiary and known reference sam-

ples, forensic scientists use the Federal Bureau of Investigation
Quality Assurance Standards (FBI QAS) to determine what steps
should be taken [1]. Samples are collected, the deoxyribonucleic
acid (DNA) is extracted and purified, followed by the quantification
of evidence samples. When necessary, reference samples may also be
quantified. The quantification step is imperative given that down-
stream polymerase chain reaction (PCR) processing has a small
input concentration range of 0.5–2.0 ng DNA, so it is necessary
to determine the quality of the DNA and how much DNA is
obtained [1, 2]. If too much or not enough DNA is available, or

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_9,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

129
130 Victoria R. Parks and Dayanara A. Torres

if the DNA is degraded, then the profile produced will be adversely

affected [2].
One early method developed for quantification is quantitative
gel electrophoresis, also referred to as yield gel via gel electropho-
resis. This method utilizes an agarose gel that acts as a molecular
sieve, which separates DNA fragments by size, allowing for smaller
fragments to migrate faster than larger fragments [3]. During
quantitative gel electrophoresis, voltage is applied, which facilitates
the migration of the negatively charged DNA through the gel from
the negative to positive electrode. Larger DNA fragments will
remain closer to where they were loaded on the agarose gel, and
smaller fragments will migrate through the agarose gel, closer to
the opposite end of the sample well. This method is quick, inex-
pensive, and easy to learn and implement in the laboratory, and it
provides a crude estimate of DNA quantity and quality. It is impor-
tant to note that this method is not human-specific and is a whole
genomic quantification method [2, 4, 5].
The procedure outlined in this chapter is based on a quantita-
tive gel electrophoresis protocol utilized at Virginia Common-
wealth University [6]. DNA extract samples, DNA standards, and
1 KB ladders are prepared and loaded on the agarose gel. All of
these components are combined with 6X loading dye, which con-
sists of glycerol, bromophenol blue, and ethylenediaminetetraacetic
acid (EDTA) [7]. Glycerol adds density to the samples and allows it
to sink to the bottom of the well on the agarose gel, preventing it
from escaping into the buffer during loading [3, 7]. Bromophenol
blue provides a way to track DNA migration during gel electropho-
resis because it runs at approximately the same rate as a 370 base
pairs (bp) size fragment [7], which is much smaller than the sample
DNA (assuming it is not significantly degraded). Bromophenol
blue also provides color to the DNA extract sample during prepa-
ration, which allows the scientist to visualize the loading of the
DNA extract samples into sample wells of the agarose gel
[3, 7]. Finally, EDTA inhibits nucleases that could break down
DNA [7].
DNA standards, prepared and loaded on the agarose gel at the
same time as the DNA extract samples, are composed of varying
concentrations (commonly ranging from approximately 300 ng
down to 5 ng) and are of known high-quality molecular weight
[4, 5]. The DNA standards used represent varying amounts, so the
intensity of the DNA standard bands will differ from each other
[5]. The DNA standard band intensity that is most akin to that of
the DNA extract sample represents a crude estimate of how much
DNA the extracted sample contains, allowing for the extrapolation
of an estimated concentration [4, 5].
A molecular weight ladder which contains known base pair size
fragments is also loaded onto the agarose gel and is used to deter-
mine if the sample is high quality. A DNA extract sample that
 Yield Gel 131

contains high-quality and high-quantity DNA should produce a

compact band that is comparable to that of the high molecular
weight DNA standards and ladder, with some smearing down the
entire sample well [4, 5]. If a sample presents without a high
molecular weight compact band and only a smear that runs along
the entire gel sample well is observed, this is an indication that the
DNA has degraded; the DNA is no longer in a whole genome form
but broken into smaller fragments [4, 5]. If downstream processing
were performed, this could adversely affect the results produced.
To visualize the gel electrophoresis results, a fluorescent nucleic
acid gel stain is added directly to the agarose during preparation.
The fluorescent gel stain intercalates, or inserts, between all double-
stranded DNA (dsDNA) in any part of the genome. This technique
is different from the current real-time quantitative PCR method, in
which primers facilitate the amplification of targeted human DNA
fragments. An intercalating dye or probe marker is then used to
detect and quantify only the targeted human DNA fragments
[2]. Traditionally, ethidium bromide (EtBr) was used for detection
[4, 5]; however, this reagent is considered toxic and a mutagen [8],
so safer and more sensitive alternatives—such as GelRed® Nucleic
Acid Stain (GelRed® stain; Biotium, Fremont, CA)—have been
developed. The GelRed® stain cannot penetrate the cell membrane
or bind to DNA in living cells, and it is non-mutagenic [9]. The
fluorescent nucleic acid gel stain intercalates between any dsDNA
during electrophoresis and is visualized using ultraviolet (UV) light
after electrophoresis is complete. An image of the agarose gel is
captured after applying appropriate filters, ensuring that the best
image with clear bands is shown [4]. The results are then inter-
preted to estimate the quality and quantity of DNA.

2 Materials

2.1 Agarose Gel 1. Gel Rig: tray, combs, buffer tank, and lid with attached power
Equipment and supply leads.
Supplies 2. Gel Imaging System: There are numerous imaging systems
available; this protocol describes use of the Gel Imaging UVP
Transilluminator System.

2.2 Agarose Gel 1. Agarose: Store at room temperature.

Reagents 2. 1 KB DNA ladder: Store at -20 °C.
3. Nucleic acid gel stain: Keep out of light.
4. Human genomic DNA standard: Store stock and prepared
serial dilutions of DNA standard at -20 °C. Serial dilutions
of DNA standard are prepared with 1X Tris-EDTA (TE).
5. 1X Tris-acetate-EDTA (TAE): Store at room temperature.
132 Victoria R. Parks and Dayanara A. Torres

6. 6X loading dye: prepare by combining 0.02 g Bromophenol

Blue, 10 mL Glycerol, 4 mL 0.5 M EDTA, and 6 mL sterile 1X
Tris-EDTA (TE) buffer (pH 7.5). Mix well and divide into
1 mL aliquots. Store aliquots at -20 °C.

3 Methods

This quantitative gel electrophoresis method is optimized for use

with DNA extract samples that contain dsDNA after extraction is
complete (see Note 1). When quantifying the dsDNA extract sam-
ples, ensure to also quantify all corresponding controls associated
with the samples, including reagent blank(s). To prevent contami-
nation of gloves and other samples, ensure that only one tube is
open at a time and that the tubes are properly handled. Do not
touch the tube by the inside of the cap or reach over open tubes.
Verify that the appropriate pipette and corresponding tips are being
used at each step. Confirm the correct settings on the pipette to
ensure that the appropriate volume is being used. Tips should be
changed after each new reagent or sample addition to prevent
contamination. Carry out all procedures at room temperature
unless otherwise specified.

3.1 Agarose Gel 1. Prepare a 1% agarose gel in an Erlenmeyer flask by mixing

agarose with TAE buffer (see Notes 2 and 3).
2. In a microwave, heat the agarose preparation in small incre-
ments to solubilize the agarose (see Notes 4 and 5).
3. Using insulated gloves, carefully remove the Erlenmeyer flask
from the microwave.
4. Let the flask cool at room temperature until the bottom of the
flask can be handled without insulated gloves (approximately
50–55 °C). To ensure even cooling, gently swirl the agarose
solution approximately every 2 min (see Note 6).
5. While the agarose solution is cooling, prepare the gel casting
tray (see Note 7).
6. Place gel electrophoresis combs in the notches of the prepared
gel casting tray (see Note 8 and Fig. 1).
7. Once the Erlenmeyer flask can easily be handled without insu-
lated gloves (approximately 50–55 °C), add a nucleic acid gel
stain to the cooled agarose solution, swirl to create a homoge-
nous mixture, and pour immediately into the prepared casting
tray. Be careful to avoid the formation of bubbles (see Notes 9
and 10).
8. Leave the casting tray at room temperature to allow the agarose
solution to solidify. It can take approximately 30 min for the
 Yield Gel 133

Gasketed gel tray Comb with 20 teeth

a) Gasketed gel tray b)
Comb with 20 teeth

Silicone rubber gasket Buffer tank

Buffer tank

Fig. 1 Gel rig casting tray. The casting tray is arranged in the buffer tank before the cooled agarose gel with
GelRed® Nucleic Acid Stain is added. The silicone rubber gasket is lined up against the buffer tank wall,
forming a tight seal ensuring that the cooled agarose gel does not leak when poured into the gel tray. Combs
with 20 teeth (approximately 1.5 mm thick) are placed towards the top of the agarose gel. (a) The casting tray
configuration in the buffer tank is shown so that the gasket side of the gel tray is visible. (b) The casting tray
configuration in the buffer tank is shown from the top, looking down on the gel rig

agarose gel to solidify, and it will appear opaque instead of clear

when it is ready for use.
9. Once the gel has solidified, carefully remove the comb(s) by
slowly pulling it straight up and out of the gel, leaving empty
wells into which samples will be loaded (see Note 11).
10. If using a gasketed casting tray, carefully remove the casting tray
from the bottom of the tank. If using a non-gasketed tray, remove
the tape from the casting tray. Re-orient the tray so that the sample
wells of the gel are located near the negative electrode (cathode, -
) on the buffer tank. This is the appropriate orientation for
electrophoresis within the gel rig (see Note 12; Fig. 2).
11. Gently pour 1X TAE buffer until the gel and sample wells are
completely covered. Start by adding 1X TAE buffer to the
empty area of the buffer tank; continue to add until the buffer
level is only a few millimeters above the gel, scarcely covering
the sample wells. The 1X TAE buffer should not be poured
directly onto the gel (see Fig. 2).

3.2 DNA Standard 1. Prepare six DNA standards (250 ng, 125 ng, 60 ng, 30 ng,
Preparation 15 ng, and 5 ng) via serial dilution in sterile microcentrifuge
tubes (see Note 13). Use Table 1 below as an example of how
to prepare the DNA standards.
2. Thaw the stock human genomic DNA standard tube at room
temperature. The human genomic DNA standard is considered
thawed when the liquid appears clear and free from solid reagents
134 Victoria R. Parks and Dayanara A. Torres

Negative Electrode
(cathode,-)

Wells on gel loaded with

sample, ladder, or
standard/loading dye mixture

Empty wells on gel

Buffer tank filled Positive Electrode

with 1X TAE (anode,+)

Fig. 2 Prepared gel rig with samples. The agarose gel is oriented so that the sample wells of the gel are
located near the negative electrode (cathode, -) on the buffer tank, which is the appropriate orientation for
electrophoresis within the gel rig. This agarose gel had two combs added so a total of 40 wells were produced.
The buffer tank is filled with 1X TAE buffer until the agarose gel and sample wells are completely covered
(a few millimeters above the wells of agarose gel), then the 1 KB ladder/loading dye, standard/loading dye,
and DNA extract sample/dye mixtures are loaded on the agarose gel. Empty wells are also observed on the
agarose gel

floating in the tube. Vortex the human genomic DNA standard

before starting the dilution series (see Notes 14 and 15).
3. Ensure to vortex and centrifuge each newly prepared standard
tube thoroughly before making the next standard.
4. Prepare all standards first, then add the 6X loading dye (1 μL of
6X loading dye for every 5 μL of DNA standard) to the appro-
priate DNA standard tube and mix thoroughly. Before use,
gently vortex the 6X loading dye and quick-spin in a mini-
centrifuge to spin down any condensation that may have
formed (see Notes 16).
5. Store prepared DNA standards at -20 °C for no longer than
approximately 5 days. Also, ensure to limit freeze-thaw events
to less than four times (see Note 15).

3.3 Sample and 1. Prepare DNA extract samples and 1 KB DNA ladder to be
Control Preparation loaded on the agarose gel. Gently vortex and quick-spin the
DNA extract samples, 1 KB ladder, and 6X loading dye in a
mini-centrifuge to spin down any condensation that may have
formed.
 Yield Gel 135

Table 1
Example DNA standard preparation table

DNA standard Volume of DNA Volume of TE Volume of 6X loading dyea

250 ng 50 μL of stock human 50 μL 10 μL
genomic DNA
(Concentration: 100 ng/μL)
125 ng 50 μL of 250 ng std 50 μL 10 μL
(50 ng/μL)
60 ng 50 μL of 125 ng std 50 μL 10 μL
(25 ng/μL)
30 ng 50 μL of 60 ng std 50 μL 10 μL
(12.5 ng/μL)
15 ng 50 μL of 30 ng std 50 μL 16 μL
(6.25 ng/μL)
5 ng 20 μL of 15 ng std 40 μL 12 μL
(3.125 ng/μL)
a
Prepare all DNA standards first, then add specified amount of 6X loading dye to tube
This table provides step by step instructions to prepare DNA standards that will be loaded on the agarose gel and used to
determine how much DNA the extract samples contain. The stock human genomic DNA concentration should be
confirmed before beginning the serial dilution. For this example, the stock genomic DNA concentration was verified to
be 100 ng/μL. The DNA standards range from 250 to 5 ng and are prepared using a serial dilution. The table lists
examples of DNA and TE volumes that could be used to make each standard. Prepare all DNA standards first, then add
the specified volume of 6X loading dye to the corresponding tube (add 1 μL of 6X loading dye for every 5 μL of DNA
standard). DNA standards prepared utilizing this table will produce enough product for all standards (6 μL of each DNA
standard) to be loaded on approximately six to eight gel runs. Store prepared standards at -20 °C for no longer than
approximately 5 days. Also, ensure to limit freeze-thaw events to less than four times

2. Ladder: combine 4 μL of 6X loading dye and 1 μL of 1 KB

ladder in a new microcentrifuge tube. If adding more than one
1 KB ladder to the gel, multiply the component volumes
(6X loading dye and 1 KB ladder) by the number of 1 KB
ladders to be added to the gel (see Notes 16 and 17).
3. DNA extract samples (and controls): add 3 μL of 6X loading
dye to an appropriately labeled and empty microcentrifuge
tube for each DNA extract, including the extraction controls
(see Note 16). Using a new pipette tip for each sample
(or control), add 15 μL of DNA extract sample (or control)
to the corresponding appropriately labeled microcentrifuge
tube. Gently mix up and down two to three times to mix the
sample with 6X loading dye.
4. Quick spin all samples and controls to remove bubbles.

3.4 Loading on 1. Load 5 μL of 1 KB ladder/loading dye mixture onto the

Agarose Gel and agarose gel by carefully dispensing the mixture into one indi-
Electrophoresis vidual well. Add one 1 KB ladder/loading dye mixture per well
and change the pipette tip after each addition (see Notes
17–19; Fig. 2).
136 Victoria R. Parks and Dayanara A. Torres

2. Load 6 μL of each known DNA standard/loading dye mixture

(250 ng, 125 ng, 60 ng, 30 ng, 15 ng, and 5 ng) onto the gel.
It is suggested that DNA standards are loaded in order from
largest to smallest concentration. This should be done one
DNA standard at a time, making sure to add one DNA stan-
dard mixture per well and to change the pipette tip after each
addition (see Notes 18 and 19).
3. Load 18 μL of each DNA extract sample (or control)/loading
dye mixture onto the gel by carefully dispensing each sample
(or control) into an individual well. This should be done one
sample at a time, making sure to change the pipette tip after
each sample addition (see Notes 18 and 19).
4. Prepare the gel rig and power supply for electrophoresis by
covering the gel rig with the lid containing attached black and
red power supply leads. Connect the black cable (cathode, -)
to the negative electrode (cathode, -) of the gel rig, located
near the sample wells of the gel. Connect the red cable (anode,
+) to the positive electrode (anode, +), located at the opposite
end of the gel rig. Plug the other ends of the black and red cable
leads to the power supply box, ensuring that the color of the
power supply lead connects to the corresponding power supply
location (see Fig. 3).
5. On the power supply box, set the run time and voltage (V).
Select “Run/Start” to start gel electrophoresis (see Note 20).
6. Check to confirm that small bubbles form near the negative
electrode (cathode, -) of the gel rig. This indicates that the
current is flowing properly and electrophoresis has started
successfully (see Fig. 4).
7. Use the dye front migration to determine if the gel needs to
run longer. Make sure the dye front does not run off the gel (see
Note 20 and Fig. 5).
8. After the quantitative gel electrophoresis run is complete, stop
the gel run by pressing the power button on the power supply
box, disconnect the cables, and remove the lid. Carefully
remove the casting tray with the agarose gel and set the tray
on a flat surface while preparing the gel imaging UVP transil-
luminator system (UV transilluminator) (see Note 21).

3.5 Capture Gel 1. Ensure that an appropriate SD card is inserted into the UV
Image transilluminator (see Fig. 6).
2. Power on the UV transilluminator and wait for the image
preview screen to complete the process check. The screen on
top of the UV transilluminator instrument will appear blank
when the UV transilluminator is ready for use (see Fig. 6).
 Yield Gel 137

Gel rig covered with lid that contains

attached power supply leads

Negative black power

supply lead (cathode,-)

Agarose gel with well

loaded with ladder,
Power supply box
standard, and samples

Positive red power

supply lead (anode,+)

Fig. 3 Complete gel rig and power supply. The gel rig is set up for electrophoresis. The buffer tank is filled with
1X TAE buffer until the agarose gel and gel sample wells are completely covered (a few millimeters above the
wells of agarose gel). The agarose gel is oriented so that the sample wells are located near the negative
electrode (cathode, -). The 1 KB ladder/loading dye, standard/loading dye, and DNA extract sample/dye
mixtures are loaded on the agarose gel. The buffer tank is covered with a lid containing attached power supply
leads. The black power supply lead connects to the negative electrode (cathode, -). The red power supply
lead connects to the positive electrode (anode, +). The other ends of the power supply leads are connected to
the power supply box, ensuring that the color of the power supply lead connects to the corresponding power
supply location. The power supply box is turned on. The suggested time (75 min) and voltage (120 volts) are
set for the quantitative gel electrophoresis run

3. Open the UV transilluminator door and turn ON the white

light switch at the top of the instrument (see Fig. 6).
4. Lightly wet a dry lab cleaning wipe with reverse osmosis water
(RO), distilled water (dH2O), or double distilled water
(ddH2O) and wipe the inside platform of the UV
transilluminator.
5. To the middle of the UV transilluminator platform, add
approximately a quarter-sized amount of RO, dH2O, or
ddH2O, and place the agarose gel onto the water, with the
sample well openings and bands facing upwards towards the
top of the instrument (see Note 22).
6. Confirm that the gel is centered and that there are no bubbles
present under the gel. To remove any bubbles, reposition the gel
by sliding it around the UV transilluminator platform (see Note
23).
7. Switch off the white light and close the instrument door.
Switch on the UV power light and ensure that the appropriate
wavelength for the agarose gel is selected (see Note 24; Fig. 6).
138 Victoria R. Parks and Dayanara A. Torres

Gel rig covered with lid

that contains attached
power supply leads

Positive red power

supply lead (anode,+)
Power supply box Bubbles at cathode
electrode (-) wires

Negative black power

supply lead (cathode,-)

Fig. 4 Gel rig with bubbles. The quantitative gel electrophoresis setup is complete. The lid containing attached
power supply leads is connected to the gel rig and the other end of the power supply leads are plugged into the
power supply box. The power supply box is on, and electrophoresis has started. Bubbles form near the
negative electrode (cathode, -) wire inside the buffer tank, which is located towards the back of the gel rig,
near the sample wells of the gel. As the run continues, a smaller number of bubbles also form near the positive
electrode (anode, +) wires, which are located near the front of the gel rig. The formation of bubbles indicates
that the current is flowing properly, and electrophoresis has started successfully

8. Observe the agarose gel fluorescence by opening the instru-

ment’s UV-blocking viewing window (see Fig. 6). Close the
UV-blocking viewing window after evaluating the gel.
9. Prior to capturing the gel image, press the “Live” button on
the UV transilluminator instrument screen. This will display
the gel on the UV transilluminator screen in real time.
10. On the screen, verify that all bubbles have been removed and
the entire gel is being captured. If any bubbles are present or
the location of the gel needs to be adjusted, turn off the UV
light, and open the UV transilluminator door. Remove any
bubbles by sliding the agarose gel around the UV transillumi-
nator platform or reposition the agarose gel in the center. Close
the UV transilluminator door, turn on the UV power light, and
press the “Live” button. Again, verify the entire gel is being
captured on the screen and all bubbles have been removed (see
Note 25).
11. Press the “+” button to increase the exposure of your gel in the
image preview screen. The normal exposure is between 0.400
and 0.600 s. The gel in the image preview screen is properly
 Yield Gel 139

Negative electrode
(cathode,-)

Empty gel wells

Dye front migration

Positive electrode
(anode,+)

Fig. 5 Yield gel dye front. During electrophoresis, samples migrate from the negative electrode (cathode, -) to
the positive electrode (anode, +). To track migration, the 1 KB ladder, DNA standards, and DNA extract
samples are combined with 6X loading dye, which migrates at approximately the same rate as a 370 bp-sized
DNA fragment. The gel sample wells that are closest to the negative electrode (cathode, -) are empty
because the DNA extract samples and controls have migrated through the agarose gel. In this example,
samples were not loaded in the bottom row of wells, so dye front migration from this row is not observed.
Bubbles are observed near the electrode wires because electrophoresis is occurring

exposed when the ladder and sample bands appear clear and
focused, in addition to the bands being clearly distinct from the
background.
12. Press the “Capture” button, and then press the “Save” button.
This will save the gel image onto the SD card.
13. Print the gel image.

3.6 Data 1. Label wells of the gel image with DNA extract sample, DNA
Interpretation standards, and 1 KB ladder names (see Note 19).
2. Document whether each DNA extract sample produced a band
or not, then determine the DNA extract sample bands’ approx-
imate size in base pairs by comparing them to the 1 KB ladder
(see Note 26 and Fig. 7).
3. Assess the quality of the DNA extract sample. High quality
DNA extract samples are not degraded, and will produce a
compact band that migrates similar to that of the high molecu-
lar weight DNA standards and ladder. The compact band
140 Victoria R. Parks and Dayanara A. Torres

a) b)

Preview Screen
Power

SD card

White light
UV blocking viewing window

UV power light
Wavelength setting
UV transilluminator platform

c) d) e)
Preview Screen UV blocking
viewing window
White light
SD card UV power light

UV blocking
viewing window
Power

Wavelength setting

Fig. 6 UV transilluminator. A suggested imaging system, BioDoc-It™ Gel Imaging System UVP Transillumina-
tor was utilized as an example for this protocol. (a) UV transilluminator is turned on with the preview screen
shown after the process check is complete. The SD card is used to save the final gel image. The top of the UV
transilluminator contains the white light and power switch. The UV power light and wavelength setting switch
can be found at the bottom of the UV transilluminator. The UV-blocking viewing window is closed. (b) The door
of the UV transilluminator is open, indicating where the agarose gel should be placed in the middle of the
platform. (c) Top of the UV transilluminator showing the location of the white light and power switch, the
preview screen, and control panel. (d) Bottom of the UV transilluminator, showing the UV power light switch,
the wavelength setting button (302 nm or 365 nm), and the closed UV blocking viewing window. (e) UV
transilluminator with the UV blocking viewing window open, allowing for review of the agarose gel without
opening the instrument door

should be observed towards the top of the gel, close to the

sample loading wells. Some smearing in the sample lane will
also be present. If the DNA extract sample is degraded and of
poor quality, only a smear with NO visible band towards the
top of the gel will be observed (see Note 26 and Fig. 7).
4. To estimate the quantity (ng) of DNA present in each DNA
extract sample well, visually compare the thickness and bright-
ness of the band to those of the DNA standards. The DNA
standard that is the most akin to the DNA extract sample band
corresponds to an estimate of that DNA extract sample
amount. Interpolations may be necessary if the DNA extract
sample band appears to be an amount that is between two
standards (see Notes 27 and 28).
5. To determine DNA concentration (ng/μL), divide the amount
of DNA (ng) (see Subheading 3.6, step 4) by the volume of
DNA loaded on the gel (15 μL) (see Note 29).
 Yield Gel 141

Fig. 7 Yield gel results. The image above is an example of a yield gel obtained after electrophoresis has
concluded. The gel was stained with the GelRed® stain. Wells 1–7 contain a 1 KB DNA ladder and DNA
standards. All standards are high quality with compact bands and some smearing down the sample well. Wells
8–18 contain DNA extract samples or reagent blanks. Wells 19 and 20 are empty and not labeled. Thermo
Scientific™ 1 KB DNA ladder identifying the base pair size for each fragment can be used to determine the
1 KB ladder bands on the agarose gel (Thermo Scientific™ Gene Ruler™ 1 KB DNA ladder is the copyright
property owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. (Reproduced from
Ref. [13] with permission from Thermo Fisher Scientific)

6. To determine total DNA yield (ng), multiply the sample con-

centration (ng/μL) (see Subheading 3.6, step 5) by the final
elution volume obtained at the end of extraction (see Note 30).

4 Notes

1. Make sure to verify that the method used for extraction pro-
duces dsDNA as the final product. If samples are extracted
utilizing a method that produces single-stranded DNA
(ssDNA), then reliable quantification results will not be
obtained using this quantitative gel electrophoresis method.
The fluorescent nucleic acid gel stain functions by inserting,
or intercalating, between the dsDNA to produce optimal quan-
tification results.
2. For quantitative gel electrophoresis, the whole genome or
larger DNA fragments are being targeted, so a lower agarose
concentration (1%) is ideal. If the agarose concentration is
increased (for example, to 2%), the pore size will decrease,
allowing for better separation of smaller fragments [3]. If
DNA fragments are smaller than 100 bp, then it is
142 Victoria R. Parks and Dayanara A. Torres

recommended that a polyacrylamide gel is used because it

allows for better resolution of the smaller fragments [3].
3. If a casting tray with an approximate length of 14 cm and width
of 12 cm is utilized, then a 1% agarose gel can be prepared by
mixing 1.75 g of agarose with 175 mL of TAE buffer. Various
gel rigs with varying casting tray sizes are available. Ensure to
calculate the appropriate volumes needed to create a 1% agarose
gel for the gel rig being utilized. The length of the casting tray
mentioned in this example will create an agarose gel that is long
enough to allow for two rows of samples to be loaded (see
Fig. 2).
4. It is suggested that the initial microwave time should be a total
of approximately 1 min, divided into two 30-s increments. A
potential consequence of prolonged microwaving is that the
agarose preparation can boil over the top of the Erlenmeyer
flask. To limit this, firmly cover the top of the Erlenmeyer flask
with a paper towel or other available dry lab cleaning wipes.
5. The agarose preparation is considered solubilized when the
solution appears clear. Use an insulated glove to remove the
Erlenmeyer flask from the microwave. If the solution appears
cloudy, that indicates that the solution is not solubilized. Con-
tinue to heat the solution in 30-s increments and swirl to mix
and melt. Repeat until the agarose goes completely into the
solution and appears clear.
6. While the agarose is cooling, it is important to swirl the agarose
to prevent uneven cooling. If the agarose is too hot when it is
poured into the gel casting tray, it can warp the casting tray and
damage it for future use. If the agarose is allowed to overcool, it
will begin to solidify in the Erlenmeyer flask. The agarose
would then need to be reheated and appropriately cooled
before being poured into the casting tray.
7. Gel casting trays (which hold the gel) are available with or
without silicone rubber gaskets on the sides. If utilizing a
gasketed gel tray, place the tray in the buffer tank so the gasket
side of the tray lines up against the buffer tank walls and creates
a tight seal (see Fig. 1). It may be necessary to run the gasket
side of the gel tray under deionized water so the tray can more
easily slide into place within the gel buffer tank without the
silicone rubber gasket slipping out. If the gel tray is not gas-
keted, laboratory tape can be used to form a tight seal around
the gel tray. Ensure that the tape forms a tight seal around the
bottom of the gel tray and that the tape is high enough around
the open ends of the gel tray. This will ensure that the agarose
will not leak out of the bottom or over the top of the tape. Place
the taped gel tray on a flat surface and not into the buffer tank
before adding the cooled agarose. Continue to follow the
 Yield Gel 143

instructions outlined in Subheading 3.1, and remember to

remove the laboratory tape before placing the gel tray with
the solidified agarose gel in the buffer tank.
8. The gel rig utilized will determine the length of the agarose gel
produced and the number of gel electrophoresis combs that
can be placed on the gel. Various-sized combs are available for
gel electrophoresis. Ensure to use the appropriately sized
comb, which will produce wells that allow for the entire sample
amount to be loaded into the well of the agarose gel. This will
help to produce results with optimal resolution, where DNA
bands are sharp and bright. The width and depth of the wells
created by the combs determine how much sample volume can
be loaded on the agarose gel [10]. The width of the comb also
affects the resolution of the bands. Thin wells can produce
sharper bands but allow for less sample volume to be added.
Thick wells allow more sample volume to be loaded on the
agarose gel, but the bands produced will be broader and the
resolution will not be as sharp [10].
9. One available nucleic acid stain is the GelRed® Nucleic Acid
Stain (GelRed® stain), which is utilized to help visualize DNA
on the agarose gel. Other nucleic acid gel stains may be avail-
able and can be substituted. Traditionally, ethidium bromide
was utilized; however, this is a known carcinogen and mutagen.
Appropriate precautions, including wearing personal protective
equipment (PPE) should be taken [8]. GelRed® stain and other
nucleic acid stains are considered safer and more sensitive alter-
natives. If GelRed® stain is utilized, ensure to add 1 μL of
GelRed® stain for every 10 mL of agarose solution prepared.
If utilizing another nucleic acid gel stain, ensure to abide by
manufacturer instructions.
10. If bubbles form while pouring the agarose solution into the
casting tray, use an unfiltered pipette tip to pop them. Make
sure to remove all of the bubbles because they could interfere
with the sample run and distort results.
11. If the comb(s) is removed before the agarose gel is solidified,
the wells will collapse, and a new agarose gel will need to be
prepared.
12. To confirm which side of the buffer tank is the negative elec-
trode (cathode, -) and positive electrode (anode, +), place the
lid with attached power supply leads on top of the buffer tank.
The black power supply lead connects to the negative electrode
(cathode, -), which, if oriented correctly, should be the elec-
trode on the top right-hand corner of the gel rig. Make sure to
orient the sample wells of the agarose gel towards the negative
electrode (cathode, -) before loading samples. DNA is nega-
tively charged and will migrate towards the positive electrode
144 Victoria R. Parks and Dayanara A. Torres

(anode, +). If the agarose gel is incorrectly oriented when

placed in the buffer tank, then the samples will run in the
wrong direction or the samples will be lost due to immediately
running off the agarose gel. Quantitative gel electrophoresis
will need to be restarted.
13. A serial dilution is when the DNA standards undergo a series of
dilutions (six for this protocol) from a higher to a lower con-
centration (250–5 ng), utilizing a predetermined dilution fac-
tor throughout the process to decrease the concentration.
Table 1 provides an example of how to prepare the DNA
standard serial dilution. Based on laboratory requirements,
the volumes needed could vary. Ensure to recalculate volumes
for each standard dilution accordingly.
14. One available human genomic DNA standard is the Pro-
mega™ Human Genomic DNA G3041 Standard. Other
human genomic standards may be available and can be sub-
stituted. Verify the starting stock concentration for the chosen
standard by quantification (for example, real-time PCR or
UV-Spectrometry) before preparing the serial dilution neces-
sary for quantitative gel electrophoresis.
15. Avoid multiple or unnecessary DNA standard freeze-thaw
events. This can degrade the DNA standards, which will have
an adverse effect on the quantification results. Ensure to only
thaw the DNA standards if intending to use them shortly
thereafter. Glycerol can be added during DNA standard prepa-
ration (50% glycerol + 50% ddH2O) to facilitate DNA stability
and limit DNA degradation [11, 12]. Glycerol helps to ensure
that the prepared DNA standards do not freeze entirely at -
20 °C, thereby reducing the likelihood of ice crystal formation,
which could shear and degrade the DNA standards [11, 12].
16. 6X loading dye consists of glycerol, bromophenol blue, and
EDTA [7]. If 6X loading dye is added to the stock human
genomic DNA standard tube, stock 1 KB ladder, or DNA
extract sample tube, then those controls or samples cannot be
used for further processing (for example, amplification, addi-
tional quantification). Adding 6X loading dye to any sample or
stock control tube will inhibit downstream processing.
17. A minimum of two 1 KB ladders should be loaded on each row
of the quantitative gel electrophoresis. It is suggested to load
one ladder in the first well before adding any samples or DNA
standards and one in the last well after all DNA extract samples
have been added to the agarose gel. If a large number of DNA
extract samples will be loaded on the agarose gel, then addi-
tional ladders can be added as needed.
18. When adding extract samples or controls to the agarose gel,
ensure that the bottom of the gel is not punctured with the
pipette tip. Stop if the tip touches the bottom of the gel. Pull
 Yield Gel 145

the pipette tip up slightly, but not out of the well, and slowly
dispense the sample. Ensure to only press down to the “first”
stop on the pipette when dispensing the sample. Do not press
down to the “second” stop of the pipette because that can
create bubbles and push the sample/loading dye mixture out
of the well. Confirm that the sample/loading dye mixture is in
the well and does not escape into the buffer before proceeding.
If the sample/loading dye mixture is inadvertently pushed out
of the well and escapes into the buffer, load a new aliquot of
that sample/loading dye mixture into the next available well.
Document the affected well to ensure it is not analyzed on the
gel image.
19. Document the well location of each DNA extract sample, DNA
standard, and 1 KB ladder added to the agarose gel. One
possibility of how to load samples and controls on the agarose
gel is to add the 1 KB ladder into the first well of the gel,
followed by DNA standards (from the highest to lowest con-
centration), and then DNA extract samples. The last compo-
nent added should be another 1 KB ladder. If following the
suggested loading order, well numbering can be recorded from
left to right, in consecutive order, with the top left well into
which the first 1 KB ladder is added being considered “well 1.”
This information is used to identify the location of each DNA
extract sample or control on the gel image.
20. The suggested gel electrophoresis time for this protocol is
approximately 75 min and a voltage of 120 V. The dye front
is used to track DNA migration during gel electrophoresis. It is
recommended that the dye front migrate approximately three
quarters of the way through the agarose gel. The 6X loading
dye contains bromophenol blue, which migrates at approxi-
mately the same rate as a 370 bp size fragment. Note that other
dyes with varying migration rates may be available and can be
substituted. The dye should travel far enough to ensure that
the 1 KB ladder and DNA fragments separate sufficiently
enough to analyze. If the quantitative gel electrophoresis
does not run long enough, then the 1 KB ladder and DNA
extract sample separation will not be sufficient to interpret
results correctly. If the quantitative gel electrophoresis runs
too long, then the 1 KB ladder fragments and DNA extract
samples could be lost due to it migrating off the agarose gel or
into the next sample row, if more than one row was set up on a
single agarose gel. Time and voltage can be increased or
decreased, if needed. Increasing the voltage can allow the
DNA to migrate through the agarose gel faster, but voltage
that is too high can cause the agarose gel to melt. Decreasing
the voltage can allow for better separation of DNA fragments
but takes longer to complete the quantitative gel
electrophoresis run.
146 Victoria R. Parks and Dayanara A. Torres

21. One available UV transilluminator that is used as an example in

this protocol is the BioDoc-It™ Gel Imaging System UVP
Transilluminator, manufactured by Thermo Fisher Scientific.
Other UV transilluminators are available and can be substi-
tuted. Ensure to abide by manufacturer instructions and labo-
ratory standard operating procedures (SOP).
22. Avoid placing the agarose gel on the UV transilluminator
upside down. The well openings should not face the bottom
of the UV transilluminator but should face up towards the top.
If the agarose gel is placed upside down on the UV transillumi-
nator, then the image captured will show the results of the
agarose gel in reverse order from how it was documented and
added to the agarose gel. It will make interpreting results
extremely difficult, likely resulting in errors.
23. If bubbles are observed under the gel and not removed, they
will appear as bright spots on the instrument’s image preview
screen, which could obstruct the data and make interpreting
results difficult.
24. Standard agarose gels often use 302 nm wavelength. Use cau-
tion and verify the appropriate UV setting. An incorrect setting
could damage the DNA and result in poor gel images.
25. The UV light will automatically turn off when the door of the
BioDoc-It™ Gel Imaging System UVP Transilluminator is
opened. Not all UV transilluminators have this feature, so if a
different UV transilluminator is substituted for this process, be
sure to review the instrument manual and laboratory SOP to
confirm appropriate steps pertaining to UV function and safety.
26. Example to interpret data for Sample 1 (see Fig. 7): make sure
to use the 1 KB ladder that is closest in proximity to the DNA
extract sample band. Sample 1 quality and size (bp) is deter-
mined to be high quality because a compact band is observed at
“>10,000 bp” with some smearing down the sample well.
27. Example to interpret data for Sample 1 (see Fig. 7): To deter-
mining the quantity (ng) of DNA, Sample 1 was visually com-
pared to all DNA standards (250 ng, 125 ng, 60 ng, 30 ng,
15 ng, and 5 ng) to determine an estimated amount of DNA in
the well of Sample 1. This sample produced a compact band
that is comparable to 30 ng.
28. The DNA standard quantity used for this protocol ranges from
250 to 5 ng. The smallest estimate of DNA quantity that can be
determined is 5 ng. Samples that appear to have a slight com-
pact band indicating that DNA could be present, but less than
5 ng of DNA, should be documented as “<5 ng” of DNA,
not zero.
29. Example to interpret data for Sample 1 (see Fig. 7): The con-
centration (ng/μL) of Sample 1 is determined by dividing the
 Yield Gel 147

quantity of Sample 1 (30 ng) by the volume of Sample 1 loaded

on the agarose gel (15 μL). Ensure that the volume corre-
sponds to only the amount of Sample 1 loaded on the gel.
Do not include the total volume of Sample 1/loading dye
mixture (18 μL) that was loaded on the gel. The concentration
is determined to be 2 ng/μL.
30. Example to interpret data for Sample 1 (see Fig. 7): The total
DNA yield (ng) is determined by multiplying Sample 1 concen-
tration (2 ng/μL) by the final elution volume obtained at the
end of extraction (for this example the final elution volume was
100 μL but can vary based on extraction method performed.
Ensure to use the appropriate final elution volume for this
calculation). The total DNA yield is determined to be 200 ng.

References

1. Federal Bureau of Investigation (2020) Quality 8. Sigma-Aldrich (2022) Ethidum bromide safety
Assurance Standards for forensic DNA testing data sheet, Revision 6.2. Available via Sigma-
laboratories. Available via Federal Bureau of Aldrich. https://www.sigmaaldrich.com/US/
Investigation. https://www.fbi.gov/file-reposi en/sds/sigma/e7637. Accessed 3 Feb 2022
tory/quality-assurance-standards-for-forensic- 9. Biotium Safety Report for GelRed® and Gel-
dna-testing-laboratories.pdf/view. Accessed Green® (2013) A summary of mutagenicity
3 Feb 2022 and environmental safety test results from
2. Butler JM (2012) DNA Quantitation. In: three independent laboratories for the nucleic
Advanced topics in forensic DNA typing: acid gel stains GelRed® and GelGreen®. Avail-
methodology. Academic/Elsevier, Waltham, able via Biotium. https://biotium.com/wp-
Massachusetts content/uploads/2013/07/GelRed-and-
3. Lee PY, Costumbrado J, Hsu C et al (2012) GelGreen-Safety-Report.pdf. Accessed
Agarose gel electrophoresis for the separation 3 Feb 2022
of DNA fragments. J Vis Exp 62:1–5. https:// 10. Lee SV, Bahaman AR (2012) Discriminatory
doi.org/10.3791/3923 power of agarose gel electrophoresis in DNA
4. Lee SB (2014) Advances in forensic DNA fragments analysis. In: Magdeldin S (ed) Gel
quantification: a review. Electrophoresis 45: electrophoresis—principles and basics. InTe-
3044–3052. https://doi.org/10.1002/elps. chOpen, London, pp 41–56. https://doi.
201400187 org/10.5772/36891
5. Baechtel FS (1989) The extraction, purifica- 11. Schaudien D, Baumg€artner W, Herden C
tion, and quantification of DNA. Proceedings (2007) High preservation of DNA standards
of the international symposium on the forensic diluted in 50% glycerol. Diagn Mol Pathol 16:
aspects of DNA analysis. United States Gov- 153–157. https://doi.org/10.1097/PDM.
ernment Printing Office, Washington, DC 0b013e31803c558a
6. Connon CC (2022) DNA quantification #1: 12. Röder B, Frühwirth K, Vogl C et al (2010)
yield gel & UV spectrophotometry. In: FRSZ Impact of long-term storage on stability of
438 Forensic Molecular Biology Lab. Virginia standard DNA for nucleic acid-based methods.
Commonwealth University—Department of J Clin Microbiol 48:4260–4262. https://doi.
Forensic Science, Richmond org/10.1128/JCM.01230-10
7. ThermoFisher Scientific (2022) Loading dyes 13. Thermo Fisher Scientific (2019) GeneRuler
and buffers. Available via ThermoFisher. 1 kb DNA Ladder. Available via Thermo Fisher
https://www.thermofisher.com/us/en/ Scientific. https://assets.fishersci.com/TFS-
home/brands/thermo-scientific/molecular- A s s e t s / L SG / m a n u a l s / M A N 0 0 1 3 0 0 4 _
biology/thermo-scientific-nucleic-acid-electro GeneRuler_1kb_DNALadder_250ug_UG.
phoresis-purification/dna-electrophoresis- pdf. Accessed 31 Jan 2022
thermo-scientific/loading-dyes-buf fers.
html#dyes. Accessed 9 Apr 2022
 Chapter 10

Quantitative PCR of Alu Repeats Using PowerUp™ SYBR®

Green Master Mix
Sierra L. Laveroni and Victoria R. Parks

Abstract
Quantitative PCR is one of the fundamental steps performed when processing routine casework in a
forensic laboratory. Quantitative PCR of Alu repeats using a SYBR® Green master mix can produce
calculated estimates of how much DNA was extracted from a sample. This process offers more efficiency,
human specificity, and can be performed faster than other outdated quantification methods, such as slot
blot or yield gel. A qPCR master mix is prepared and consists of Alu-F primers, Alu-R primers, water, and
SYBR® Green master mix. The Alu-F and Alu-R primers target Alu sequences that are present hundreds of
thousands of times throughout the human genome and are effective markers for human DNA quantifica-
tion. During qPCR, the 7500 system facilitates the amplification of target Alu repeats. The SYBR® Green I
fluorescent dye intercalates between the amplified dsDNA targets. During each amplification cycle, the
7500 system agitates the SYBR® Green I dye, resulting in a fluorescence signal that is recorded when it
passes a specified Ct value. After qPCR amplification is complete, a standard curve is created and used to
determine how much DNA a sample contains. This chapter provides instructions on how to accurately
prepare a 96-well plate for qPCR, use the 7500 system and associated software to set up the qPCR
amplification, and interpret the corresponding results produced.

Key words Quantitative PCR, PowerUp™ SYBR® Green Master Mix, SYBR® Green I dye, 7500
Real-Time PCR instrument, SDS software, Standard curve, Alu repeats

1 Introduction

The Federal Bureau of Investigation Quality Assurance Standards

(FBI QAS) mandate that evidentiary samples must be quantified to
determine the amount of human deoxyribonucleic acid (DNA)
present prior to downstream processing, including amplification
and short tandem repeat (STR) profile analysis [1]. The accuracy
and reliability of this step is an integral part of obtaining a full STR
profile.
Quantitative polymerase chain reaction (qPCR) using the
Applied Biosystems 7500 Real-Time PCR System (7500 system;
Applied Biosystems, Waltham, MA) is the most common way to

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_10,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

149
150 Sierra L. Laveroni and Victoria R. Parks

quantify DNA extract samples [2, 3]. There are three main phases
of qPCR amplification: denaturation, annealing, and extension.
During the first phase, double-stranded template DNA is sepa-
rated, or denatured, by heating the DNA to approximately 95 °C.
The second phase cools the qPCR reaction to approximately 60 °C,
which facilitates annealing, or addition, of primers to the denatured
DNA strands. The primers bind to targeted locations on the
genome and facilitate the amplification of that region. Finally, the
temperature is increased to approximately 72 °C so that the DNA
polymerase can efficiently extend the formation of the new DNA
strand by adding deoxyribose nucleotide triphosphates (dNTPs) to
the template strands of DNA [4].
The qPCR amplification method outlined in this protocol is
optimized for use with high-quality DNA samples, including
single-source database samples, and targets numerous Alu repeats
utilizing the PowerUp™ SYBR® Green Master Mix (SYBR® Green
master mix; Applied Biosystems). The SYBR® Green master mix
contains a DNA-binding fluorescent marker, SYBR® Green I dye,
which intercalates between double-stranded DNA (dsDNA) during
qPCR amplification and produces a fluorescent signal that is
detected by the 7500 system [5–7]. Another essential component
of the SYBR® Green master mix is the hot start polymerase—Dual-
Lock Taq DNA polymerase [5–8]. The purpose of Taq polymerase
is to attach nucleotides to the existing template strand of DNA
during qPCR amplification, forming a new target DNA strand
[4]. The Dual-Lock Taq was introduced to maximize specificity
and reproducibility of the master mix by better controlling the Taq
enzyme, preventing early activation, which can lead to nonspecific
binding [6, 8].
For qPCR amplification to successfully proceed, Alu forward
(Alu-F) and Alu reverse (Alu-R) primers are utilized to target
human and higher primate specific Alu repeats. These primers
have proven to be useful at quantifying human DNA alongside
intercalating reagents such as the SYBR® Green I dye [9, 10]. Alu
repeats were targeted for qPCR amplification because there are
roughly 500,000 to 1,000,000 copies of Alu sequences approxi-
mately 124 bp long throughout the entire human genome. This
allows for a large number of targets to be amplified in a single qPCR
reaction utilizing a single set of primers [9, 10]. This is beneficial
because forensic evidentiary samples are susceptible to degradation.
If numerous human genome targets are amplified during qPCR, it
is likely that quantification results can still be obtained [9].
Finally, to create optimal conditions for qPCR amplification
and assist in new DNA template formation, the SYBR® Green
master mix contains deoxyribonucleoside triphosphates (dNTPs)
with a deoxyuridine triphosphate/deoxythymidine triphosphate
(dUTP/dTTP) blend, heat-labile uracil-DNA glycosylase (UDG),
ROX passive reference dye, and optimized buffer components
 SYBR Green qPCR of Alu Repeats 151

[6, 8]. The building blocks of DNA are comprised of dNTPs, which
are nucleotides bonded to three phosphate groups: Adenine (A),
Guanine (G), Thymine (T), and Cytosine (C) [4]. Heat-labile
UGD is an enzyme that prevents reamplification of carryover
PCR products by removing any uracil that has been added to either
the single or double stranded DNA [6, 8]. Nucleotides dUTP/
dTTP are utilized in the master mix to support activity from UDG
and maintain optimal PCR results [6]. In addition, the ROX passive
reference dye is added to provide a consistent fluorescent signal that
is used to normalize the SYBR® Green I dye signal by correcting the
fluorescence fluctuation that can occur from well to well due to
minor pipetting or reading discrepancies during the qPCR process
[4, 6, 7]. Finally, proprietary buffer components have been opti-
mized to facilitate stable and successful amplification.
To ensure accurate quantification, DNA standards consisting of
known concentrations are amplified along with DNA extract sam-
ples. The DNA standards are prepared using a serial dilution where
the standards are diluted from higher to lower concentration using
a consistent dilution factor. During qPCR amplification, a cycle
threshold (Ct) value is captured for each DNA standard. The Ct
values indicate the number of cycles required for the sample fluo-
rescent signal to overcome background fluorescence so that it can
be distinguished as being contributed by the sample [5, 6]. These
known DNA standard concentrations and their corresponding Ct
values are used to generate a standard curve, represented by a linear
regression line of best fit (y = mx + b), where y is the Ct value, m is
the slope, b is the y-intercept, and x is the log of the initial DNA
concentration [7]. As the qPCR amplification process advances, the
amount of sample target dsDNA produced increases exponentially.
This generates a positive correlation between fluorescent signal and
concentration. If a DNA extract sample has a high concentration of
DNA, then it will produce a stronger fluorescent signal earlier in the
amplification process and overcome background noise to cross the
Ct earlier. This means that the amount of fluorescent signal pro-
duced is inversely proportional to the Ct value [3, 10, 11]. The
DNA extract sample Ct values are plotted on the standard curve,
and using the linear regression equation allows for the sample
concentration to be determined (quantity = 10(y–b)/m) [7].
The 7500 system is used to initiate qPCR amplification and
then detect the fluorescent signal during each cycle of the amplifi-
cation. The 7500 system utilizes a tungsten-halogen lamp to direct
light through five excitation filters before passing through the
optical adhesive cover of the 96-well plate and into each well. The
light excites the fluorescent dyes. A system of lenses, emission
filters, and mirrors focus the emitted fluorescent dye signal onto
the charge-coupled device (CCD) camera based on wavelength
[12, 13]. The sequence detection software (SDS) captures the
fluorescent emission data from the CCD camera and applies analysis
152 Sierra L. Laveroni and Victoria R. Parks

algorithms to determine the contribution of each dye [12]. The

SDS software displays the data every cycle as a normalized reporter
signal (Rn), which is calculated by dividing the fluorescence emis-
sion intensity of the SYBR® Green I dye by the fluorescence emis-
sion intensity of the ROX passive reference dye [4, 13]. Once all of
the quantification data is compiled by the software, qPCR data
analysis can proceed.
It is important to note that unlike some commercially available
kits, the SYBR® Green master mix assay does not include an inter-
nal positive control (IPC), which is used to determine if the qPCR
amplification reaction is working properly and detect if inhibition is
present. In addition, this assay does not target multiple locations
with varying lengths on the genome, which could be used to
determine if degradation is present. This assay also does not contain
primers that specifically target male Y-STR regions that could be
used to assess if a mixture is present by comparing the ratio of male
DNA to total human DNA. As noted previously, the SYBR® Green
master mix assay only utilizes a single primer set that targets Alu
repeats. One additional difference to note is that most commercial
kits utilize a TaqMan™ probe assay, not an intercalating dye, for
the detection of a fluorescent signal. The TaqMan™ probe contains
a fluorescent reporter dye located near a quencher dye, preventing
it from producing a signal. During amplification, the Taq DNA
polymerase cleaves the TaqMan™ probe, releasing the fluorescent
reporter dye, which produces a fluorescent signal that is detected by
the 7500 system [4, 7]. Despite these differences, the SYBR®
Green assay is still considered to be a preferable option for quanti-
fying high-quality DNA samples due to its low cost when compared
to other commercial kits.

2 Materials

Prepare solutions using sterile, Type I water and analytical grade

reagents. Prepare all reagents under an amplification hood at room
temperature.
1. Applied Biosystems 7500 Real-Time PCR System with SDS
software.
2. 96-well plate centrifuge.
3. 96-well plate base: This is a protective base that the plate sits in
so that the bottom of the wells do not come into direct contact
with surfaces.
4. 96-well plate: The plate needs to be an optical plate with a
notched corner at A12 so that it is compatible with the real-
time PCR instrument used in this protocol.
5. Adhesive film applicator tool.
 SYBR Green qPCR of Alu Repeats 153

6. Adhesive film for 96-well plate.

7. PowerUp™ SYBR® Green Master Mix: Store at 4 °C.
8. Human genomic DNA: Aliquot and store at -20 °C; limit
freeze/thaw events.
9. Tris-ethylenediaminetetraacetic (EDTA) buffer (TE-4):
10 mM Tris-HCl and 0.1 mM EDTA, at a final pH of 8.0.
Store at room temperature.
10. Alu-F primer (GTCAGGAGATCGAGACCATCCC): custom
order. Resuspend the dried down primers with TE-4 to create a
100 μM stock primer solution; aliquot and store at -20 °C (see
Notes 1 and 2). For the working stock, further dilute the stock
solution to 24 pmol/μL, preparing only the volume needed.
The working stock is not intended to be stored; if prepared in
advance, it can be stored short term at -20 °C.
11. Alu-R primer ( TCCTGCCTCAGCCTCCCAAG ): custom
order. Resuspend the dried down primers with TE-4 to create
a 100 μM stock primer solution; aliquot and store at -20 °C
(see Notes 1 and 2). For the working stock, further dilute the
stock solution to 24 pmol/μL, preparing only the volume
needed. The working stock is not intended to be stored; if
prepared in advance, it can be stored short term at -20 °C.

3 Methods

Carry out all procedures using sterile, Type I water, under a clean
amplification hood, and at room temperature unless otherwise
noted. To prevent contamination of gloves or other samples, ensure
that only one tube is open at a time and hold the tubes properly.
Never touch the inside of the tube or cap and avoid reaching over
open tubes. At each step, confirm that the appropriate pipette and
corresponding tips are used. Verify the setting on the pipette to
ensure that the appropriate volume is used. Ensure to utilize ster-
ilized consumables.

3.1 Plate Layout 1. Determine the total number of reactions that will be amplified,
Form Setup including all DNA extract samples and controls.
2. Print a 96-well plate layout form and document the well loca-
tion where DNA extract samples and controls will be added.
The DNA standards can be added in duplicate or singlicate to
the 96-well plate layout form (see Notes 3 and 4; Fig. 1).

3.2 SDS Plate 1. Turn on the computer corresponding to the 7500 system and
Document Setup wait for it to power on completely (see Fig. 2a). The 7500
system does not need to be turned on to create the SDS plate
document (see Note 5).
154 Sierra L. Laveroni and Victoria R. Parks

1 2 3 4 5 6 7 8 9 10 11 12
DNA DNA Standard Standard
A Sample Sample
NTC
1 1
Standard Standard
DNA DNA
B Sample Sample
2 2

Standard Standard
DNA DNA
C Sample Sample
3 3

Standard
DNA DNA Standard
D Sample Sample
4
4

Standard Standard
DNA DNA
E Sample Sample
5 5

Standard Standard
DNA DNA
F Sample Sample
6 6

Standard Standard
DNA DNA
G Sample Sample
7 7

Standard Standard
DNA DNA
H Sample Sample
8 8

Fig. 1 Example of a suggested 96-well plate layout form. Utilizing a plate layout form such as this, the DNA
extract samples, DNA standards (in duplicate or singlicate), and an optional NTC are documented analogous to
how they will be added to the 96-well plate for qPCR amplification

Fig. 2 7500 Real-Time PCR System and computer orientation. An example setup of the 7500 Real-Time PCR
System, including laptop computer and instrument, is displayed. (a) The 7500 system is set up with the
corresponding laptop computer. (b) The 7500 system power button that is pressed to turn on the instrument.
(c) A slight indentation on the tray door of the 7500 system that is pushed to unlatch the tray door and allow
the plate holder to slide out. This indentation should also be gently pushed to close the tray door
 SYBR Green qPCR of Alu Repeats 155

Fig. 3 SDS quick startup document window. The “Quick Startup Document” window appears when the SDS
software is opened. This window is used to create a new document or open an existing document. (a) The
“Create New Document” button is selected to launch a new document. This option allows the scientist to set
up a new plate with unique specifications. (b) After the qPCR amplification is completed, data is ready to
be analyzed. If the software was closed between the end of qPCR and the start of data analysis, the saved files
can be reopened by using the “Open Existing Document” button and navigating to the file location within the file
explorer. The same process can be followed if the data was transferred to a different device for analysis

2. On the computer, select the ABI Prism 7500 SDS software

(SDS software) icon. When the “Quick Startup” window
opens, select “Create New Document” (Fig. 3a) or select
“New” from the “File” menu to open a new document (see
Notes 6 and 7).
3. A “Define Document” window will open. Ensure that “Assay”
is set to “Standard curve,” “Container” is set to “96-Well
Clear,” “Template” is set to “Blank Document,” and “Run
Mode” is set to “Standard 7500” (see Note 8; Fig. 4).
4. “Operator,” “Comments,” and “Plate Name” are optional and
up to the individual laboratory to determine.
5. Click “Next.”
6. A “Select Detectors” window will appear. Select the necessary
detector for the SYBR green assay from the list on the left side
of the window and select “Add” to assign the appropriate
detector to the “Detectors in Document” box. On the top
right side of the window, select “ROX” from the “Passive
Reference” drop down list (see Notes 9 and 10).
156 Sierra L. Laveroni and Victoria R. Parks

Fig. 4 SDS define document window. The “Define Document” window allows the user to specify conditions in
the SDS software so that it reads the data and runs the protocol appropriately. The following selections should
be made for the qPCR amplification protocol—Assay: Standard Curve (Absolute Quantitation); Container:
96-Well Clear; Template: Blank Document; and Run Mode: Standard 7500. The operator, comments, and plate
name are optional

7. Click “Finish” (see Note 6).

8. A blank 96-well plate document will open. Reference the
96-well plate layout form (see Subheading 3.1, step 2) that
documents the locations of all DNA extract samples and
controls.
9. At the top of the open 96-well plate document window, select
the “Setup” tab, and then double-click on any well to bring up
the “Well Inspector” window (see Fig. 5).
10. In the “Well Inspector” window, enter “Sample Name.”
Ensure that the DNA extract sample or control name corre-
sponds to the appropriate well location and check the
“Use” box.
11. The “Detector,” “Reporter,” and “Quencher” for each well
should already be populated from the options set up previously
(see Note 10 and Subheading 3.2, step 6).
 SYBR Green qPCR of Alu Repeats 157

Fig. 5 SDS well inspector window. The “Well Inspector” settings define the content of each well of the 96-well
plate. This will ensure the SDS software reports accurate information for each well once the qPCR amplifica-
tion is complete. Add the sample name in the designated field. Ensure that the “Use” box is checked. The
detector, reporter, and quencher options will be assigned during the plate file setup. Under task, select
“Standard” for DNA standards and “Unknown” for DNA extract samples. If an optional NTC was added, the
“NTC” or “Unknown” option can be selected. Ensure that the passive reference is ROX

12. Under the Task drop down menu, select “Standard” for the
DNA standards, “Unknown” for all DNA extract samples, and
“NTC” for an optional NTC sample (see Notes 3 and 11–13).
13. Select “Quantity” for each of the DNA standards and enter
their corresponding concentration (ng/μL). Leave this selec-
tion empty for DNA extract samples.
14. Once all selections have been made, select the “Close” button.
15. Confirm that the sample name and appropriate “Task” appears
in the assigned well location of the “Plate” document tab. On
the top left of the well location, ensure that the DNA extract
samples display a “U” and sample name; the DNA standards
display an “S,” standard name, and corresponding assigned
concentration. If an optional NTC was added, ensure it dis-
plays an “N” or “U,” and control name (see Note 13).
16. Repeat the sample entry process (see Subheading 3.2, steps
9–15) for all wells of the “Plate” document tab that will
contain a DNA extract sample or control. This should corre-
spond to the 96-well plate layout form (see Subheading 3.1,
step 2).
17. Once all sample wells have been assigned, select the “Instru-
ment” tab at the top of the screen. Under the “Thermal Cycler
Protocol,” select the “Thermal Profile” tab. Verify the PCR
parameters are set with one initial cycle of 95 °C for 5 min,
158 Sierra L. Laveroni and Victoria R. Parks

Table 1
Example of how to prepare DNA standard serial dilution

Standard DNA standard Volume of DNA Volume of TE-4

1 16 ng/μL 5.0 μL of human genomic DNA (e.g., 160 ng/μL) 45.0 μL
2 4 ng/μL 12.5 μL of 16 ng/μL std 37.5 μL
3 1 ng/μL 12.5 μL of 4 ng/μL std 37.5 μL
4 0.25 ng/μL 12.5 μL of 1 ng/μL std 37.5 μL
5 0.063 ng/μL 12.5 μL of 0.25 ng/μL std 37.5 μL
6 0.016 ng/μL 12.5 μL of 0.063 ng/μL std 37.5 μL
7 0.0039 ng/μL 12.5 μL of 0.016 ng/μL std 37.5 μL
8 0.001 ng/μL 12.5 μL of 0.0039 ng/μL std 37.5 μL
In this example, eight DNA standards (Standards 1–8) are prepared via serial dilution for use with the qPCR assay. The
volumes used in this example are only one option and should be adjusted depending on each laboratory’s needs. The
human genomic DNA concentration should be verified before beginning the serial dilution. For this example, the
concentration was determined to be 160 ng/μL. DNA standards are added at the same time as DNA extract samples
during qPCR amplification setup and are used to create a standard curve, which allows for determination of the DNA
extract sample concentration. DNA standards originate from a stock solution that is serially diluted, with concentrations
ranging from 16 to 0.001 ng/μL. After the first standard is prepared, each subsequent standard is prepared from a four-
fold dilution of the previous standard. This example will produce enough of each DNA standard so that approximately
eight plates with DNA standard added in duplicate can be prepared

followed by 35 cycles of 95 °C for 15 s, 68 °C for 30 s, and

72 °C for 45 s.
18. Select “Save As” and save the file as a .sds file (see Note 14).

3.3 DNA Standards 1. Label microcentrifuge tubes with identifying information. It is

Preparation suggested that at a minimum the DNA standard name (for
example, Standard 1, Standard 2, Standard 3, etc.), concentra-
tion, and date prepared are included.
2. Thaw an aliquot of the human genomic DNA at room temper-
ature, then vortex and centrifuge briefly before starting the
serial dilution (see Note 2).
3. Use Table 1 as an example of how to prepare the DNA stan-
dards via serial dilution by combining human genomic DNA
and TE-4. Each newly prepared standard tube should be vor-
texed and centrifuged before making the next standard. Add
each dilution to the appropriately labeled microcentrifuge tube
(see Notes 3, 15, and 16).
4. Store prepared DNA standards at -20 °C for approximately
5 days and limit freeze-to-thaw events to less than four.
 SYBR Green qPCR of Alu Repeats 159

Table 2
Volume of qPCR reagents needed per reaction

Component Volume per reaction

®
PowerUp™ SYBR Green Master Mix 12.5 μL
Water 8.5 μL
Alu-F primers 1 μL
Alu-R primers 1 μL
Total volume 23 μL
Use of a qPCR master mix chart outlining each component of the qPCR master mix and
the volumes of each component required for a single reaction helps to ensure that all
components are added correctly. This should be used to create a single tube of master
mix based on the number of total reactions expected (DNA extract samples, DNA
standards, NTC, and pipetting error). The volumes for each component will be multi-
plied by the total number of reactions plus the additional reactions needed for pipetting
error. After the master mix is prepared, 23 μL will be added to the corresponding wells of
the 96-well plate.

3.4 qPCR 96-Well 1. Calculate the volume needed for each component of the qPCR
Plate Preparation master mix, which consists of SYBR® Green PCR Master Mix,
water, Alu-F primer, and Alu-R primer. Use Table 2 to calculate
the needed volumes of each reagent by multiplying each com-
ponent by the total number of reactions. Include one or more
extra reactions to account for pipetting error (see Note 17).
2. Obtain SYBR® Green master mix, Alu-F primers, Alu-R pri-
mers, DNA extract samples, corresponding controls, and
water. Place these on ice or in an ice block (except the SYBR®
Green master mix); they must remain cold throughout the
qPCR amplification setup process. Make sure to only remove
them from ice when ready to use. The SYBR® Green master
mix can remain at room temperature.
3. Prepare a qPCR tray by placing a 96-well plate into a 96-well
plate base. Avoid touching the sides or bottom of the wells and
do not place the plate directly on the bench top (see Note 18).
4. Ensure that all reagents, samples, and standards have
completely thawed (see Note 2). Gently vortex and quick spin
each, when applicable (if the SYBR® Green master mix was
purchased in a 5 mL quantity, the bottle should be swirled,
not vortexed, given that it cannot be centrifuged).
5. Transfer the calculated reagents from Table 2 into the labeled
qPCR master mix tube (see Note 19).
6. Vortex the master mix tube for 3–5 s, followed by brief centri-
fugation to pull liquid from the top and sides of the tube.
7. Following the 96-well plate layout form (see Subheading 3.1,
step 2), add 23 μL of the qPCR master mix into the bottom of
160 Sierra L. Laveroni and Victoria R. Parks

Fig. 6 Correct and incorrect addition of liquid to plate well. When adding qPCR master mix, DNA extract
samples, or controls to the 96-well plate, ensure that the liquid is correctly deposited to the bottom of a well of
the reaction plate. The left pane (a) is an example of how to correctly pipette liquid into a well of the reaction
plate. All of the liquid is at the bottom of the well. The middle pane (b) is an example of how to incorrectly add
liquid into a well of the reaction plate. The liquid is on the side of the well instead of the bottom of the well. The
right pane (c) is also an example of how to incorrectly add liquid into a well of the reaction plate. An air bubble
is present at the bottom of the well, prohibiting the liquid from getting to the bottom of the well. (Copyrighted
properties are owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. www.
thermofisher.com. © 2021 Thermo Fisher Scientific Inc. Used under permission. Reproduced from Ref. [15])

each well that will contain a DNA extract sample or control (see
Note 20 and Fig. 6).
8. Following the 96-well plate layout form, add 2 μL of each
DNA extract sample and control to the plate. Ensure to change
the pipette tips after each addition (see Notes 21 and 22).
9. Once all of the DNA extract samples and controls have been
added to the 96-well plate, seal the plate by placing an adhesive
film on top of the plate, ensuring all wells are completely
covered with the adhesive film. Do not touch the optical adhe-
sive film and only handle it by the removable tabs. Use a film
applicator or a plastic sealing tool to tightly seal the plate. The
plastic sealing tool should be firmly run over the entire adhesive
film and in-between all the rows and columns. Remove the tabs
once the plate is completely sealed (see Note 23).
10. Centrifuge the reaction plate in a 96-well plate centrifuge at
approximately 500 × g for 20 s to remove any bubbles that may
have been introduced and spin down reagents that might be on
the side of the well (see Note 24).

3.5 Running the 1. If powered off, turn on the computer corresponding to the
Reaction Plate on the 7500 system and wait for it to power on completely (see
7500 Real-Time Fig. 2a). Then turn on the 7500 system by pressing the
System power button on the lower right corner and wait for approxi-
mately 2 min for the instrument to warm up (see Note 5 and
Fig. 2b).
 SYBR Green qPCR of Alu Repeats 161

Fig. 7 Proper orientation of 96-well plate in the 7500 Real-Time PCR System. The plate holder of the 7500
system is circled in red. When the 96-well plate is placed into the plate holder, the notched corner of the plate
should be in the top right-hand corner, and well A1 of the plate will be in the top left corner. (Copyrighted
properties are owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. www.
thermofisher.com. © 2021 Thermo Fisher Scientific Inc. Used under permission. Reproduced from Ref. [15])

2. On the computer, select the SDS software icon. When the

“Quick Startup” window opens, select “Open Existing Docu-
ment” (see Fig. 3b) or select “File” then “Open” to navigate to
the previously saved SDS plate document (see Note 6 and
Subheading 3.2, step 18). Ensure all sample names and para-
meters meet specified conditions.
3. On the 7500 system, press the indentation on the bottom right
side of the tray door to open the slide out plate holder and place
the sealed 96-well plate in the plate holder. The A1 position of
the reaction plate should match the A1 position marker on the
top left corner of the slide out plate holder. The notched corner
of the reaction plate should be positioned on the top right
corner of the slide out plate holder (see Figs. 2c and 7).
4. Close the tray door by pressing the indentation on the bottom
right-hand side of the drawer until there is a slight click (see
Fig. 2c).
5. In the SDS software, select the “Instrument” tab and click
“Start.” This will initiate the qPCR amplification. Do not
leave the 7500 system until the “Estimated Time” window
appears. This indicates that the qPCR amplification has suc-
cessfully started and that there were no errors while initiating.
6. The qPCR amplification takes approximately 1 h and 45 min to
complete. After qPCR amplification is complete, a window will
appear indicating successful completion; click OK and turn off
the instrument by pressing the button on the bottom right (see
Fig. 2b).
162 Sierra L. Laveroni and Victoria R. Parks

Fig. 8 Amplification plot of standards loaded in duplicate. Reviewing the amplification plot of the DNA
standards showing all of the Ct values for the various standard concentrations is a helpful way to assess
whether the standards amplified as expected. The Ct values are approximately two cycles apart, which is
expected for these standards [13]. The parameters outlined in red to the right of the plot represent the
appropriate settings that should be selected to ensure the amplification plot is displayed correctly. In addition,
Standard 1 (16 ng/μL) and Standard 2 (4 ng/μL) are noted with red arrows as an example of expected results
for DNA standards that were accurately pipetted during the serial dilution setup. The x-axis represents the
cycle number of the qPCR amplification, while the y-axis represents Delta Rn. Delta Rn is the fluorescence
emission intensity of the normalized reported signal (Rn) minus the baseline (which includes the initial cycles
of qPCR reaction where there is minimal change in fluorescence signal [15]). The Rn represents the ratio of the
fluorescence emission intensity of the reporter dye (SYBR® Green) divided by passive reference dye (ROX). The
red line across the graph represents the Auto Ct threshold set by the 7500 system

3.6 qPCR Data 1. Review the “Instrument” tab to verify that the “Estimated
Analysis and Time Remaining” and “Status” values are grayed out. The
Interpretation green analysis button should also be enabled. At this point,
the qPCR amplification is complete but the data has not been
analyzed.
2. Select the “Results” tab, then select the “Amplification Plot”
tab. Verify that the analysis settings on the right side of the
screen have the “Data” drop down set to “Delta Rn vs Cycle,”
the “Detector” drop down set to “All,” and the “Analysis
Settings” set to “Auto Ct” (see Note 25 and Fig. 8).
3. Under the “Results” tab, select the “Standard Curve” tab and
click the green arrow at the top of the screen, or select “Ana-
lyze” under the “Analysis” menu. This will analyze the data and
display the standard curve (see Note 26).
4. Once the standard curve is generated, review the “Slope,”
“Intercept,” and “R2” values in the bottom right-hand corner
of the screen to ensure that they fall within the appropriate
ranges. Slope should be between -3.7 and -3.3, and R2
should be greater than or equal to 0.98. Acceptable y-intercept
 SYBR Green qPCR of Alu Repeats 163

Fig. 9 Passing and failing SDS standard curves. Eight DNA standards are plotted on the graph to create a
regression line. The x-axis represents the log of the concentration while the y-axis represents the cycle
threshold. The upper pane (a) displays an image of a passing standard curve plot. The graph formatting
options circled in red at the top right of the standard curve plot are formatting tools that will enable the user to
adjust the scale and position of the graph to ensure all the data points can be seen on the plot. The standard
curve values circled in red at the bottom right of the plot represent passing standard curve values with the
slope (-3.44), y-intercept (16.06), and R2 (0.994) falling within the appropriate ranges. One set of data points
has been circled as an example, but all DNA standards on this curve follow what is described in this example.
The circled data points represent DNA Standard 8 located in wells H11 and H12. Standard 8 has the lowest
concentration (0.001 ng/μL) of the standards and therefore has the highest Ct value (approximately 26). The
data points for wells H11 and H12 appear to be overlapping, which indicates the fluorescent signals crossed at
similar Ct values for both DNA standards and that those standards were pipetted precisely. The lower pane (b)
displays an image of a failing standard curve plot. The standard curve values circled in red at the bottom right
of the plot represent a failing standard curve, where the value for R2 (0.93) is not within the acceptable range.
This standard curve has several DNA standards that are not overlapping and spaced apart. This indicates that
the standards with the same concentrations (circled data points in red are wells D11 and D12, both of which
are Standard 4, with a concentration of 0.25 ng/μL) crossed at different Ct values, indicating poor pipetting or
other issues. Because of this and other poor-quality standards, the R2 value was adversely affected, resulting
in a failing standard curve. This means that qPCR amplification was not optimally performed and did not meet
validated requirements for what is considered a passing qPCR amplification. The data produced will be
unreliable and the qPCR amplification must be repeated
164 Sierra L. Laveroni and Victoria R. Parks

values are determined by each laboratory during the validation

of the 7500 system (see Notes 3, 27–29, and Fig. 9a).
5. If a standard curve does not meet the passing parameters (see
Subheading 3.6, step 4), then individual standard points must
be evaluated to determine if there are outliers that are affecting
the regression line. These outlier data points can be removed
from the standard curve (see Fig. 9b). No more than two DNA
standards can be omitted from the standard curve when stan-
dards are added in duplicate and only one of each DNA stan-
dard duplicate should be omitted (see Note 30).
6. If removing a standard point is necessary, select the “Results”
tab, then select the “Plate” tab. Double-click the
corresponding well to open the “Well Inspector” window,
check the box “Omit Well,” and then press “Close.” Select
the green “Analyze” arrow at the top of the screen or select
“Analyze” from the “Analysis” menu to apply the changes to
the standard curve. The well that was omitted will be crossed
out, and the data will no longer be included in the data inter-
pretation (see Note 31). Confirm the standard curve para-
meters are within the acceptable range (see Note 32 and
Subheading 3.6, step 4).
7. Review the amplification plot by selecting the “Results” tab,
and then the “Amplification Plot” tab.
8. At the bottom of the page, select the DNA standards by click-
ing and dragging through the desired wells. This will bring up
the amplification plot for the selected wells. For the DNA
standards, the spacing between each amplification curve should
be uniform and approximately two cycle number values apart
(x-axis) when crossing the threshold. This indicates that the
DNA standard concentrations were diluted uniformly and that
the DNA standards were prepared correctly (see Fig. 8).
9. Once the standard curve and amplification plot have been
reviewed and determined to meet acceptable passing para-
meters, then the sample data can be reviewed by navigating to
the “Plate” document tab or the “Report” tab (see Note 33).
10. Data from the qPCR process can be exported by selecting the
“Export” option from the “File” menu and then selecting
“Results.” When the “Export File” window opens, navigate
to the appropriate save location and press “Save.” An “Export
Settings” window will open after the file save location is
selected. Check one of the following: “Export only selected
wells,” “Apply Report Settings for Data Columns,” or click
“OK” to bypass either export option (see Note 34). Once a
selection has been made, the data file will be saved as a .csv file
in the specified location and can be opened using Excel or
other spreadsheet programs.
 SYBR Green qPCR of Alu Repeats 165

11. Review all sample “Qty” (quantity) values to determine how to

accurately prepare the samples for STR amplification in an
effort to generate a full human STR profile (see Note 35).
12. To estimate the total yield of a sample, multiply the “Qty”
value by the final elution volume (see Note 36).

4 Notes

1. Primers can be prepared and aliquoted into smaller volumes.

This will limit the number of freeze-to-thaw events the primers
undergo. Aliquots can be stored at -20 °C for up to 1 year.
Thermo Fisher Scientific is one available manufacturer of the
custom Alu-F and Alu-R primers used in this protocol. Other
suitable manufacturers that produce custom Alu primers nec-
essary for qPCR amplification may be utilized.
2. If reagents are not allowed to thaw completely to room tem-
perature, then the incorrect concentration of reagents may be
added to the qPCR master mix (either too much or too little)
and the quantification reaction will not work accurately. This
could adversely affect qPCR amplification, resulting in a failed
quantification. The reagents are considered thawed when the
liquid appears clear and free from solid reagents floating in the
tube. Once the reagents have completely thawed, vortex and
centrifuge the tubes to pull down any liquid on the sides of the
tubes.
3. DNA standards are amplified along with DNA extract samples.
The suggested DNA standards concentrations values can range
from 16 to 0.001 ng/μL and will be used to generate a stan-
dard curve at the end of the qPCR amplification. The standard
curve consists of the log concentrations plotted on the x-axis
and their respective Ct value plotted on the y-axis.
4. DNA standards can be loaded in singlicate or duplicate on the
96-well plate; the laboratory needs to validate the option they
plan to implement (both can be validated for increased flexibil-
ity). For analysts with precise pipetting skills, loading in singli-
cate will give comparable results to loading in duplicate. DNA
standards loaded in singlicate allow for more samples to be
added to the 96-well plate and save on reagent costs since
fewer DNA standards are required.
5. The 7500 system contains a tungsten-halogen lamp that has a
half-life of approximately 2000 h [14]. If the instrument is on
(regardless of whether it is running or not), then the lamp’s life
is being consumed. Do not turn the instrument on until imme-
diately before use and turn the instrument off once qPCR
amplification is complete.
166 Sierra L. Laveroni and Victoria R. Parks

6. If the 7500 system is not turned on before opening the SDS

software program, an error message will appear stating the
program could not detect the SDS instrument. The 7500
system does not need to be turned on to create an SDS plate
document. When the error message appears, select “Cancel”
and proceed with the SDS plate document setup.
7. SDS software version 1.4 was utilized for the figures and
method outlined in this protocol. Newer versions of the soft-
ware are available and can be utilized with the 7500 system or
for analysis. The SDS software can be downloaded from the
Thermo Fisher website.
8. In order to minimize possible errors and time spent preparing
the electronic plate map, a template can be developed and saved
in the SDS software. The template can contain defined loca-
tions for DNA standards, optional NTC, and additional con-
trols. When the template file is opened, only the DNA extract
samples will need to be added. This template file can be opened
when creating a new file instead of generating a blank new
document each time. Select the “Browse” button to the right
of the “Template” drop down menu in the “Define Docu-
ment” window. Navigate to the appropriate file on the com-
puter and select “Open” to add the previously created
electronic template to the “Define Document” window
selection.
9. If the proper detector is not available, click the “New Detec-
tor” box at the bottom of the window and input the name,
description, reporter dye, quencher dye, color, and any notes
relevant to the detector being added, then click “OK.” This will
add the new detector to the list. A detector is a virtual repre-
sentation specific to each DNA target fluorescent marker used
for analysis on the 7500 system [15]. The detector and its
defining conditions will be dictated by the laboratory validation
of reporter dye SYBR® Green I.
10. ROX is a passive reference dye that is not affected by the
amplification process and will maintain a consistent fluores-
cence signal throughout the qPCR amplification [4, 6, 7,
11]. ROX is a component of the qPCR master mix and thus
added to each well. When ROX is paired with another fluores-
cent molecule such as the SYBR® Green I dye, the software will
use the ROX signal to normalize variations in the fluorescence
signal from well to well that could be caused by factors such as
minor pipetting discrepancies, different amounts of condensa-
tion, or uneven illumination [11, 16]. Normalization helps to
create more precise data from every cycle on the 7500 system.
Although ROX helps to improve data from non-PCR related
issues, it cannot correct bad data or poor pipetting technique
 SYBR Green qPCR of Alu Repeats 167

[16]. “ROX” should be selected when the “Detector” is

assigned (see Subheading 3.2, step 6). The passive reference
designation can be verified in the “Well Inspector” window (see
Subheading 3.2, step 9), ensuring “ROX” is selected. If this
setting needs to be modified, select the “Passive Reference”
drop down list found at the bottom right side of the “Well
Inspector” window and select the appropriate designation.
11. “Unknown” indicates that the well contains a sample with an
unknown amount of DNA that must be determined through
qPCR. A label of “Unknown” signals the software to calculate
an approximate DNA concentration “quantity” based on the
standard curve [11].
12. An optional NTC, or no template control, can be used during
qPCR amplification to identify contamination from qPCR
master mix reagents. The NTC well of the 96-well plate will
contain all qPCR master mix reagents (SYBR® Green master
mix, Alu-F primers, Alu-R primers, and water), but it will not
contain a DNA extract sample. Instead, water will be added to
the master mix to bring the reaction up to the required volume.
If qPCR reagents are free from contamination, then DNA
should not be detected, or the Ct value should be greater
than the laboratory-specified conditions. If a DNA concentra-
tion value is obtained for the NTC or the NTC Ct value is
below the laboratory-specified conditions, that indicates con-
tamination has occurred and the subsequent sample data can-
not be analyzed. Quantification must be performed again with
reagents that are free of contamination to troubleshoot what
may have caused reagent contamination.
13. If an NTC is assigned as an “NTC” in the “Well Inspector”
window, then the only time a concentration will be produced is
when the NTC crosses the quantification conditions validated
by the laboratory (acceptable numerical or Ct value) [6, 11]. If
the laboratory wants to consistently propagate a quantity for
the NTC results (either a numerical value or “UND” (unde-
termined)), even if the NTC has not crossed the validated Ct
value, then an option is to assign the NTC as an “Unknown” in
the well inspector window. This option will ensure a result is
obtained, and the scientist will determine if it falls within an
acceptable range.
14. The file must be saved as the file type “.sds.” If the file is
inadvertently saved as “.sdt” (template file), then the file can-
not be read by the SDS software, preventing qPCR amplifica-
tion from starting.
15. At each step of the serial dilution, the concentration will
undergo a four-fold dilution. This means that the concentra-
tion will be reduced by a factor of four from the previous
168 Sierra L. Laveroni and Victoria R. Parks

dilution, or the concentration will be diluted 1:4. A 1:4 dilu-

tion means that for each 1 μL of DNA standard that is added,
3 μL of TE-4 will also be added to dilute the concentration
appropriately.
16. Human Genomic DNA (G3041) is manufactured by Promega,
which is one of many human genomic DNA available for qPCR
amplification. Other suitable manufacturers produce human
genomic DNA that may be purchased. It is important to note
that the concentration of each human genomic DNA tube
should be verified using UV-spectrometry or qPCR prior to
preparing the serial dilution. In addition, to limit degradation
due to numerous freeze-to-thaw events, it is suggested that the
DNA standards are prepared using a 50% glycerol and 50%
water mixture [17, 18]. The glycerol in the mixture will keep
the standards from completely freezing while in long-term
storage at -20 °C, minimizing degradation from freeze-to-
thaw events [17, 18]. If DNA standards are degraded, that
will have an adverse effect on the quantification results, so
ensure to limit the freeze-to-thaw events to less than four.
17. Additional pipetting error reactions should be added to all
qPCR master mix calculations. The pipetting error can be
adjusted based on the number of samples that will be quanti-
fied by calculating approximately 5% of the total reaction vol-
ume. For example, if performing a quantification of a full plate
that will be 96 samples total (inducing controls), then the
pipetting error should be about five additional reactions. The
pipetting error is added to account for user mistakes or possible
minor discrepancies when pipetting master mix into the wells
of the 96-well plate.
18. A 96-well plate base keeps the bottom of the 96-well plate from
coming into contact with any surface, including the amplifica-
tion hood. It also prevents the scientist from touching the
outside or bottom of the plate wells. Utilizing a 96-well plate
base also limits the transfer of dust or debris onto the plate,
which could inhibit accurate fluorescence detection during
qPCR amplification and adversely affect the results. Applied
Biosystems manufactures the MicroAmp™ Splash-Free
96-Well Base, which is just one option for qPCR bases. Other
suitable manufacturers produce bases for qPCR amplification
and may be purchased.
19. A larger qPCR master mix tube will be needed if a substantial
number of samples are quantified. Since 23 μL of master mix
will be added into each well of the 96-well plate that contains a
DNA extract sample or controls, this value should be multi-
plied by the number of reactions that are loaded on the plate.
For example, if quantifying 96 samples and including a
 SYBR Green qPCR of Alu Repeats 169

pipetting error of five, then 23 μL should be multiplied by 101.

This equates to a total of 2323 μL of qPCR master mix;
therefore, a tube larger than 1.5 mL would be needed. The
qPCR master mix volume should be calculated before prepar-
ing the qPCR master mix tube to ensure that the appropriately
sized tube is used.
20. If qPCR master mix is the first reagent being added to the
plate, then it is not necessary to change the pipette tip between
each well, but it is suggested that the pipette tip be changed at a
minimum every column. When dispensing reagents, ensure
that the pipette tip is at a slight angle and the liquid is dispensed
to the bottom of the well. This will help avoid introducing air
bubbles. If liquid is left on the side of the well or air bubbles are
present, then it could have an adverse effect on the qPCR
amplification (see Fig. 6).
21. The pipette tip must be changed between each DNA extract
sample and control addition to avoid contamination. While
pipetting samples or controls into the 96-well plate, place the
pipette tip into the previously deposited qPCR master mix to
ensure the sample is accurately deposited into the well. Also,
make sure to press the plunger of the pipette to the first stop
only; do not press to the second stop of the pipette plunger
because that could cause excess bubbles to form within the
wells. These bubbles could be difficult to remove, adversely
affecting the qPCR amplification.
22. It is strongly suggested that a method is created to track the
addition of DNA extract samples or controls into the 96-well
plate. One suggestion is to have another scientist witness the
sample addition into the 96-well plate, noting the addition on
the 96-well plate layout form (see Subheading 3.1, step 2).
Another option is to set up a box of pipette tips so it is
analogous to the 96-well plate layout form. Use the box of
pipette tips to track wells that had DNA extract samples or
controls added. Wells of the 96-well plate that had a sample
added to it will not have a tip in the corresponding location of
the tip box. Wells that still need a DNA extract sample or
control added will have a tip in the corresponding location of
the tip box. One final option is to set up a tube rack with all
samples and controls that will be added to the 96-well plate.
Ensure that the tube rack setup corresponds to the 96-well
plate layout form. Once a sample is added to the 96-well plate,
that sample should be placed separately from the remaining
samples that still need to be added.
23. Ensure that the optical adhesive film is applied appropriately
and that all 96 wells of the reaction plate are tightly sealed. The
adhesive film should be centered on all 96 wells of the reaction
170 Sierra L. Laveroni and Victoria R. Parks

plate so that each edge has an appropriate amount of film to

seal the wells tightly when the sealing tool is firmly run over the
top of the adhesive film, between each row or column of wells,
and along the outer edges of the plate. If it appears that some
wells are not properly covered, or if a well is inadvertently left
partially open, then reactions (qPCR master mix combined
with DNA extract samples or controls) could be lost due to
evaporation during the amplification process. If this occurs, the
reaction will not work properly and the results produced will be
unreliable or unusable. Applied Biosystems is the manufacturer
for the MicroAmp™ Optical Adhesive Film and the Micro-
Amp™ Adhesive Film Applicator. Other suitable manufac-
turers produce optical adhesive film and sealing tools used for
qPCR and may be purchased.
24. Confirm that all bubbles have been removed from the bottom
of the 96-well plate and the reagents have been pulled to the
bottom of the wells. If bubbles are not removed, they could
interfere with proper amplification and will impact the quality
of the data produced. If bubbles are observed after the first
centrifugation, then repeat the centrifuge step using the same
parameters. Bubbles positioned at the top of the reagents in a
well are okay, as they will pop during the initial denaturation
step of qPCR.
25. Cycle threshold (Ct) is the cycle at which the DNA extract
samples fluorescence can be distinguished from the back-
ground fluorescence. Any signal that is considered to be back-
ground fluorescence falls below the specified threshold and
cannot be distinguished as being contributed by the DNA
extract sample, other qPCR components, or the 7500 system.
The more DNA an extract sample contains, the earlier that
sample fluorescence will cross the Ct threshold. This means
that the sample can be distinguished from the background
fluorescence much faster. DNA extract samples with a lower
concentration of DNA will take longer to produce a strong
enough fluorescent signal to overcome background fluores-
cence. It will take longer for that sample to cross the Ct
threshold, resulting in higher Ct value. Unless specified, the
SDS software will assign the analysis setting to Auto Ct. The
SDS software determines this value by calculating the baseline
start and end values, in addition to determining the optimal
threshold in the amplification plot. Based on those values, the
SDS software will then calculate the Auto Ct value [11].
26. It is not necessary to analyze the qPCR data using the 7500
system. Data can be transferred to another computer that
contains the SDS software and analyzed. To export the SDS
file so it can be transferred to another computer, select “Save
as” from the “File” menu and choose the appropriate location
 SYBR Green qPCR of Alu Repeats 171

to store the SDS file. Transfer the file to a new computer and
then open the SDS software. Wait for the “Quick Startup”
screen to appear and select the “Open Existing Document”
button (see Fig. 3b). Do not select the “Create New Docu-
ment” button. Select the appropriate data file that was stored
on the computer.
27. If the scale of the standard curve cuts off data points, the six
graph formatting buttons in the top right-hand corner of the
“Standard Curve” tab will allow for manipulation of the scale
and placement of the graph to ensure all data points are cap-
tured on the screen (see Fig. 9a).
28. Slope represents how efficient the PCR reaction was. Accept-
able slope values range from -3.3 to -3.7. A slope of -3.3
indicates that a reaction was 100% efficient, meaning the quan-
tity of DNA was doubled each cycle. A slope value of greater
than -3.3 means that PCR was more than 100% efficient [7]. A
slope value of -3.7 or less indicated that PCR was not as
efficient (approximately 85% or less), and extraneous factors
might be affecting qPCR. The y-intercept represents the
expected Ct value for a sample with concentration of 1.0 ng/
μL (example of an acceptable range is 14.5–17.5 but varies
based on laboratory validation of each 7500 system). The R2
value measures how well the regression line fits the data points.
If the regression line fits the data points perfectly, then R2 will
equal 1. If R2 is less than 0.98, this indicates that the data does
not follow a cohesive linear trend and the data is not consistent.
29. The acceptable y-intercept range is affected by the Ct threshold
value. Each 7500 system is validated according to laboratory
guidelines. Each instrument could potentially contain a differ-
ent Ct threshold value, resulting in varying acceptable y-inter-
cept ranges.
30. If DNA standards are added to the 96-well plate in duplicate,
then no more than two DNA standards total and only one of
each duplicate pair can be omitted during analysis. For exam-
ple: wells A11 and A12 (Standard 1 in both wells) should not
be omitted from the standard curve. However, well A11 (Stan-
dard 1) and well C12 (Standard 3) can be omitted (see Fig. 1).
If the DNA standards are added to the 96-well plate in singli-
cate, then only one DNA standard may be removed during
analysis.
31. If a DNA standard point is removed, then the qPCR data must
be reanalyzed. If two DNA standard points were removed and
the standard curve is still failing the specified conditions (see
Subheading 3.6, step 4), then re-quantification must be per-
formed to obtain an accurate concentration value. If the ampli-
fication continues to produce failing results, this indicates that
172 Sierra L. Laveroni and Victoria R. Parks

a DNA standard, consumables, instrument, or pipetting issue

has occurred. Troubleshooting must be performed and each
possibility needs to be reviewed one at a time to determine the
cause of the failing quantifications.
32. If the standard curve does not meet the validated passing
parameters, then the Ct threshold value can be adjusted manu-
ally in conjunction with or instead of omitting standard points.
This is only performed in an attempt to obtain sample quanti-
fication data, and it is important to note that this data is still
considered failing because it does not meet the validated pass-
ing parameters. All samples should be re-quantified to obtain
accurate results. To manually adjust the Ct threshold, select the
“Amplification Plot” tab and set the “Analysis Settings” to
“Manual Ct.” This option will allow for manual adjustment
of the threshold numerical value, which will adjust the place-
ment of the threshold line on the amplification curve. Adjust-
ing the threshold manually will change how the cycle number
and level of fluorescence correspond to each other on the
standard curve, therefore changing the slope, y-intercept, and
R2 values. To achieve the optimal results when adjusting the
manual threshold, ensure that it is assigned within the expo-
nential phase of the amplification curve and above the baseline
[15]. This change will also affect the sample quantification data
by over- or under-estimating the results.
33. To review only the DNA extract sample name and concentra-
tion, select the “Plate” document tab. The value shown for
each sample represents concentration in nanograms per one
microliter (ng/μL). The data can also be reviewed by navigat-
ing to the “Results” tab and then selecting the “Report” tab.
The data is presented in a table format and includes informa-
tion such as sample name, detector, task, Ct, quantity, and
mean quantity. Quantity refers to the concentration of DNA
for a specific sample in nanograms per microliter (ng/μL).
Mean quantity refers to the average concentration of DNA
between identical samples (such as standards that are loaded
in duplicate). The “Report” table can make it easier to deter-
mine the correlation between data points. When reviewing the
data, a general inverse relationship should be observed between
concentration of a sample and its Ct value. The higher the
“Quantity” of a DNA extract sample, the lower the “Ct”
value will be.
34. When exporting data, checking the option to “Export only
selected wells” will only export data for the highlighted wells.
These wells must be selected before choosing this export
option. Checking the option to “Apply Report Settings for
Data Columns” will apply the previously specified report set-
tings, which define the columns that are included on the export
 SYBR Green qPCR of Alu Repeats 173

file for all samples (for example, the column can be limited to
only sample name, Ct, and Quantity). To change the report
settings, select “Report Settings” from the “Tools” menu. To
bypass all export setting options mentioned above, do not
check any of the boxes and select “OK.” This will export all
data columns associated with all sample wells.
35. Most commercially available STR amplification kits have been
optimized for a DNA concentration input range of
0.3–1.0 ng/μL. If too much DNA is added to the STR ampli-
fication reaction, then it could overload the amplification reac-
tion, resulting in an over-saturated or inhibited profile. If too
little DNA is added to the amplification reaction, then a poor
partial or no profile could be produced. Once samples are
quantified, the initial volume may need to be diluted so that
the individual sample(s) can achieve the proper concentration
for amplification. Sample(s) that exhibit too little DNA may
need to be concentrated using a centrifugal filter unit or the
maximum amount of sample may need to be added to the
amplification reaction.
36. Final elution volume is the volume obtained at the end of the
extraction procedure.

References
1. Federal Bureau of Investigation (2020) Quality bacteria. Microbiology 149(1):269–277.
Assurance Standards for forensic DNA testing https://doi.org/10.1099/mic.0.25975-0
laboratories. Available via the Federal Bureau 6. Applied Biosystems (2016) PowerUp™
of Investigation. https://www.fbi.gov/file- SYBR™ Green Master Mix user guide: univer-
repository/quality-assurance-standards-for- sal 2X master mix for real-time PCR workflows,
forensic-dna-testing-laboratories.pdf. Accessed revision C.0. Available via Thermo Fisher.
23 Apr 2022 https://www.thermofisher.com/document-
2. Thornton B, Basu C (2015) Rapid and simple connect/document-connect.html?url=https%
method of qPCR primer design. In: Basu C 3A%2F%2Fassets.thermofisher.com%2FTFS-
(ed) PCR primer design, Methods in molecular Assets%2FLSG%2Fmanuals%2FMAN0013
biology, vol 1275, 2nd edn. Humana Press, 511_PowerUp_mastermix_UG.pdf. Accessed
New York, pp 173–179. https://doi.org/10. 6 Apr 2022
1007/978-1-4939-2365-6_13 7. Bio Rad Laboratories (2006) Real-time PCR
3. Zhang Q, Wang J, Deng F et al (2015) applications guide. Available via Bio Rad.
TqPCR: a touchdown qPCR assay with signifi- https://www.bio-rad.com/webroot/web/
cantly improved detection sensitivity and pdf/lsr/literature/Bulletin_5279.pdf.
amplification efficiency of SYBR green qPCR. Accessed 18 Apr 2022
PLoS One 10(7):1–19. https://doi.org/10. 8. Applied Biosystems (2020) PowerUp SYBR
1371/journal.pone.0132666 Green Master Mix product bulletin available
4. Butler JM (2009) DNA Quantification. In: via Thermo Fisher. https://assets.thermofisher.
Fundamentals of forensic DNA typing. Aca- com/TFS-Assets/GSD/Product-Bulletins/
demic Press Elsevier, Burlington, MA PowerUp-SYBR-Green-Product-Bulletin-201
5. Malinen E, Kassinen A, Rinttil€a T et al (2003) 8.pdf. Accessed 27 Feb 2022
Comparison of real-time PCR with SYBR 9. Shewale JG, Schneida E, Wilson J et al (2007)
gGreen I or 5′-nuclease assays and dot-blot Human genomic DNA quantitation system,
hybridization with rDNA-targeted oligonucle- H-quant: development and validation for use
otide probes in quantification of selected fecal in forensic casework. J Forensic Sci 52(2):
174 Sierra L. Laveroni and Victoria R. Parks

364–370. https://doi.org/10.1111/j. system maintenance, revision D. Available via

1556-4029.2006.00369.x Thermo Fisher. https://tools.thermofisher.
10. Nicklas J, Buel E (2003) Development of an com/content/sfs/manuals/4387777d.pdf.
Alu-based, real-time PCR method for quanti- Accessed 18 July 2022
tation of human DNA in forensic samples. J 15. Applied Biosystems (2010) Absolute quantifi-
Forensic Sci 48(5):1–9. https://doi.org/10. cation getting started guide, revision
1520/JFS2002414 B. Available via Thermo Fisher. http://tools.
11. Applied Biosystems (2010) Applied Biosystems thermofisher.com/content/sfs/manuals/43
7500/7500 Fast Real-Time PCR System: stan- 78656b.pdf. Accessed 20 July 2022
dard curve experiments, revision C. Available 16. Applied Biosystems (2015) ROX passive refer-
via Thermo Fisher. https://assets.fishersci. ence dye for troubleshooting real-time PCR.
com/TFS-Assets/LSG/manuals/7500_ Available via Thermo Fisher. https://assets.
7500_fastreal_pcr_stdcurve_ug.pdf. Accessed thermofisher.com/TFS-Assets/GSD/Applica
18 Apr 2022 tion-Notes/co016741-rox-dye-for-qqpcr-
12. Ong Y, Irvine A (2016) Quantitative real-time- app-note.pdf. Accessed 16 Apr 2022
PCR: a critique of method and practical con- 17. Schaudien D, Baumg€artner W, Herden C
siderations. Hematology 7(1):59–67. https:// (2007) High preservation of DNA standards
doi.org/10.1080/10245330290015573 diluted in 50% glycerol. Diag Mol Pathol
13. Applied Biosystems (2004) Applied Biosystems 16(3):153–157. https://doi.org/10.1097/
7500 Real-Time PCR System and Applied Bio- PDM.0b013e31803c558a
systems 7500 Fast Real-Time PCR System: a 18. Röder B, Frühwirth K, Vogl C et al (2010)
real fast and real versatile approach to real-time Impact of long-term storage on stability of
PCR. Available via Thermo Fisher. https:// standard DNA for nucleic acid-based methods.
www.gene-quantification.de/abi7500.pdf. J Clin Microbiol 48(11):4260–4262. https://
Accessed 18 Apr 2022 doi.org/10.1128/JCM.01230-10
14. Applied Biosystems (2010) Applied Biosystems
7500/7500 Fast Real-Time PCR Systems:
 Chapter 11

Quantitation of DNA Using the Applied Biosystems

Quantifiler® Trio DNA Quantification Kit
Kelly L. Knight, Angelina Mauriello, and Georgia Williams

Abstract
Following the isolation of deoxyribonucleic acid (DNA) from biological samples, the quantitation of
amplifiable human DNA is a critical next step in the process of DNA analysis. The Quantifiler® Trio kit
provides a simple way to accurately estimate the quantity of human and male DNA with concentrations as
low as 5 pg/μL or less. Not only can the Quantifiler® Trio kit determine the quantity of human DNA
present, but it can also give an indication of the quality of the sample, which is essential information to have
in the decision-making process regarding any downstream testing being done. In this chapter, we describe
how to prepare and process quantitation reactions using the Quantifiler® Trio kit. We also provide basic
information on how to interpret the results.

Key words DNA quantitation, Quantifiler Trio, Quantification, DNA degradation, DNA inhibition,
Degradation index, Forensic DNA, Quantitative real-time PCR, qPCR, RT-qPCR

1 Introduction

Following the isolation of deoxyribonucleic acid (DNA) from

biological samples, the quantitation of amplifiable human DNA is
a critical next step in the process of DNA analysis. Current quanti-
tation kits used in DNA laboratories, such as the Quantifiler® Trio
DNA Quantification Kit (Quantifiler® Trio; Applied Biosystems,
Waltham, MA), can provide a wealth of information about the
samples being tested. Not only can the Quantifiler® Trio kit deter-
mine the quantity of human DNA present, but it can also provide
information regarding the presence of a mixture of male and female
DNA, as well as give an indication of the quality of the sample.
More specifically, the results can indicate whether a sample is possi-
bly inhibited or degraded. This information is essential to the
decision-making process regarding any downstream testing
being done.

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_11,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

175
176 Kelly L. Knight et al.

The Quantifiler® Trio kit is made by Applied Biosystems® and

is optimized for use with the Applied Biosystems® 7500 Real-Time
PCR system, as well as their new PCR systems (e.g., the Quant-
Studio® 5 Real-Time PCR System). The kit contains four reagents:
Quantifiler® THP PCR Reaction Mix, Quantifiler® Trio Primer
Mix, Quantifiler® THP DNA Dilution Buffer, and Quantifiler®
THP DNA Standard [1]. The reaction mix contains dNTPs, buffer,
Taq DNA polymerase enzyme, passive reference standard, and
stabilizers. Because the Quantifiler® Trio assay combines four 5’
nuclease assays, the primer mix contains four sets of target-specific
primers and four different dye-labeled TaqMan® probes. The inter-
nal PCR control (IPC) template is a synthetic DNA template,
which is also included in the primer mix. Evaluating the IPC is a
way to confirm whether a sample is truly negative or whether a
reaction has been negatively affected either by the presence of PCR
inhibitors or if there has been an instrument or assay setup failure.
In addition to the IPC (130 bases), the other targets in this
assay include a small autosomal human target (80 bases), a large
autosomal human target (214 bases), and a human male target
(75 bases) [1]. The human male target on the Y-chromosome
quantifies the amount of male DNA present, which is particularly
useful in mixed samples containing both male and female DNA.
The size of the small autosomal target allows for improved amplifi-
cation and quantitation of degraded samples. In samples that are
degraded, it is expected that there will be increased amplification
success of smaller fragments in comparison to larger fragments.
Therefore, by comparing the relationship between the large and
small autosomal target DNA concentrations, an indication of deg-
radation can be determined.
Each TaqMan® probe has a reporter dye on the 5’ end and a
nonfluorescent quencher at the 3’ end. During the reaction, the
probe anneals to the complementary sequence between the forward
and reverse primer. The proximity of the quencher to the reporter
dye prevents the reporter from fluorescing. As the Taq polymerase
extends and creates the complementary strand, it will eventually
cleave the reporter dye from the probe. Once the reporter dye and
the quencher are no longer in close proximity, the reporter dye will
fluoresce. As the process continues with each of the 40 cycles of
amplification, the fluorescence for a particular sample will continue
to accumulate. Once this fluorescence has exceeded the established
baseline, the cycle threshold (CT) value will be measured, which is
the cycle number at which a sample crosses the threshold of detec-
tion. The fewer cycles it takes for a sample to cross the CT, the more
DNA is present in the sample.
The Quantifiler Trio® kit uses the real-time quantitative PCR
(qPCR) method. In comparison to historical methods of DNA
quantitation, qPCR is more accurate, more sensitive, and less
labor-intensive [2–4]. qPCR allows you to monitor the products
 Quantitation of DNA Using Quantifiler®Trio 177

in real time as the polymerase chain reaction is occurring [4]. The

qPCR reaction has three phases of product growth: exponential,
linear, and plateau [1]. During the exponential phase of growth,
there is a doubling of the PCR product. This is the phase in which
the qPCR measurements are taken and the CT values are deter-
mined. In the linear phase, one or more of the reaction components
are beginning to decrease, so there is less than doubling growth. In
the final phase, plateau, the PCR product growth slows dramatically
and begins to stop as the reaction components are consumed.
To determine the quantity of DNA present in each sample, the
CT value of the unknown samples is compared to a standard curve,
which is prepared by making a set of standards with known amounts
of DNA using the Quantifiler® THP DNA Standard and the Quan-
tifiler® THP dilution buffer. The Applied Biosystems® User Guide
for Quantifiler® Trio recommends preparing a standard dilution
series ranging from 50.000 ng/μL to 0.005 ng/μL [1]. Each
standard is processed in duplicate on every plate. The cycle thresh-
old (CT) and known DNA concentration of the standard dilution
series are plotted against each other to generate the standard curve.
The unknown samples can then be compared to the standard values
by using a formula generated from the curve. The software uses the
regression line formula CT = m[log(Qty)] + b to calculate the best
fit of the standard data points, with m indicating the slope of the
equation, which represents the PCR amplification efficiency; Qty is
the starting DNA quantity; and b is the y-intercept, which repre-
sents the expected CT value for a 1 ng/μL sample [2]. Each target
will have different regression formulas based on the standards
[2]. The target concentration for each extracted DNA sample is
calculated through extrapolation by plotting a log of the standard
curve using the known concentrations of the standards and their CT
values.
Overall, Quantifiler® Trio provides a simple way to accurately
estimate the quantity of human and male DNA with concentrations
as low as 5 pg/μL or less. After the reactions and software have
been set up, the samples are PCR amplified, analyzed, and the
results are then interpreted. Quantifiler® Trio has been thoroughly
validated and is currently being used in forensic laboratories around
the world to reliably quantitate human DNA samples [5–11].

2 Materials

1. Extracted DNA samples.

2. Quantifiler® Trio DNA Quantification Kit: Quantifiler® THP
PCR Reaction Mix, Quantifiler® Trio Primer Mix, Quantifiler®
THP DNA Standard, and Quantifiler® THP DNA Dilution
Buffer.
178 Kelly L. Knight et al.

3. Real-time Quantitative PCR instrument.

4. 96-well optical reaction plate.
5. Optical adhesive film.
6. Adhesive film applicator.
7. Applied Biosystems MicroAmp 96-Well Base.
8. HID Real-Time PCR Analysis Software.

3 Methods

The methods that follow are based on the manufacturer’s guide-

lines, as described in the Applied Biosystems® User Guide for
Quantifiler® Trio [1]. All procedures should be performed at
room temperature. The standards and reactions should be prepared
in an area away from samples that have been amplified, ideally in a
separate pre-amplification space. It is also recommended to prepare
the standards and reactions in a PCR Workstation with HEPA-
filtered air to protect samples and minimize contamination. Other
preventative measures should be taken as well to minimize contam-
ination, such as wearing personal protective equipment and work-
ing in a clean space. Prior to running reactions, the HID Real-Time
PCR Analysis Software and instrument should be set up/calibrated.

3.1 Preparation of 1. Calculate the volume of each component needed to prepare the
DNA Quantification standard curve dilution series (see Table 1).
Standards

Table 1
Example preparation of DNA standards

Concentration
Standard (ng/μL) Volumes
Std. 1 50.000 10 μL [100 ng/μL 10 μL Quantifiler® THP DNA Dilution
stock] Buffer
Std. 2 5.000 10 μL [Std. 1] 90 μL Quantifiler® THP DNA Dilution
Buffer
Std. 3 0.500 10 μL [Std. 2] 90 μL Quantifiler® THP DNA Dilution
Buffer
Std. 4 0.050 10 μL [Std. 3] 90 μL Quantifiler® THP DNA Dilution
Buffer
Std. 5 0.005 10 μL [Std. 4] 90 μL Quantifiler® THP DNA Dilution
Buffer
This table provides an example of how to prepare the DNA standards for the standard curve. Individual users can modify
the volumes to best suit their laboratory’s specific needs
 Quantitation of DNA Using Quantifiler®Trio 179

2. Label five microcentrifuge tubes with the appropriate

standard name: Standard 1, Standard 2, Standard 3, Standard
4, or Standard 5.
3. Vortex and centrifuge the Quantifiler® THP DNA Dilution
Buffer, and then dispense the required amount to each micro-
centrifuge tube (see Table 1).
4. To make Standard 1, vortex the Quantifiler® THP DNA Stan-
dard for 3–5 s. Using a new pipette tip, add the appropriate
volume of Quantifiler® THP DNA Standard for your dilution
series to the tube for Standard 1 (see Table 1). Vortex to mix the
dilution thoroughly, and then either tap the tube or centrifuge
to bring the liquid back to the bottom.
5. To prepare Standard 2, use a new pipette tip to add the appro-
priate volume of the previously prepared standard to the tube
to make the next standard (see Table 1). Vortex to mix the
dilution thoroughly, and then either tap the tube or centrifuge
to bring the liquid back to the bottom. Repeat these steps for
each subsequent standard until you complete the dilution series
(see Note 1). Diluted DNA quantification standards can be
stored for up to 2 weeks at 2–8 °C. Longer-term storage is
not recommended.

3.2 Preparation of 1. Calculate the volume of each component needed to prepare the
the Reaction Plate reactions. For each occupied well of the plate, there should be
8 μL of Quantifiler® Trio Primer Mix and 10 μL of Quantifiler®
Trio THP PCR Reaction Mix (see Note 2).
2. Vortex the Quantifiler® Trio Primer Mix for 3–5 s and then
centrifuge briefly before opening the tube.
3. Gently vortex and centrifuge the Quantifiler® THP PCR Reac-
tion Mix before use.
4. Pipet the required volumes of each component into a micro-
centrifuge tube labeled “Master Mix” as calculated (see Sub-
heading 3.2, step 1).
5. Vortex the Master Mix for 3–5 s, then centrifuge briefly.
6. Dispense 18 μL of the Master Mix into each applicable well of a
96-well optical reaction plate (see Notes 3 and 4).
7. Add 2 μL of sample, standard, or control to the applicable wells
(see Note 4).
8. Seal the reaction plate with an optical adhesive cover using an
adhesive film applicator (see Note 5).
9. Place the plate in a plate centrifuge to spin the plate at 867 ×
g for about 20 s. If using a mini-plate spinner, spin for 30–60 s.
Inspect for bubbles. If bubbles are present, tap the plate while
still in the base holder on the benchtop to bring the bubbles to
the liquid surface and centrifuge again, if necessary (see Note
6).
180 Kelly L. Knight et al.

3.3 Processing the 1. Turn on the instrument computer and the instrument. Launch
Reaction Plate the HID Real-Time PCR Analysis Software and select the
Quantifiler Trio assay.
2. Start a new experiment. In the Experiment Properties screen
(see Fig. 1), enter a name for the experiment. All of the other
properties on this screen should be defined (see Note 7).
3. Click Plate Setup from the toolbar on the left side to create a
plate map by adding the sample names and their appropriate
sample type. Click Add New Sample and type the sample name.
Repeat for each sample. Click Assign Targets and Samples. The
targets are automatically assigned. Select the well and then
select the sample from the Assign column.

Fig. 1 Experiment properties screen. This is the Experiment Properties window. Once you select your
instrument, the other settings should already be pre-selected for you, including the Experiment Type,
Reagents, and Ramp Speed. You will use this window to name your experiment. Many analysts choose to
include the experiment date and their initials in the experiment name but confirm the proper naming
convention with your individual laboratory
 Quantitation of DNA Using Quantifiler®Trio 181

Fig. 2 Run method parameters. These are the standard run parameters. Always verify that your run
parameters are correct before beginning your run

4. Verify that the run method is correct under the following

parameters (see Fig. 2): number of cycles—40; holding
stage—95 °C for 2 min; initial cycling stage—95 °C for 9 s;
and final cycling stage—60 °C for 30 s.
5. Save the experiment.
6. Load the plate onto the instrument plate adapter to correspond
with the labeled corners of the instrument.
7. Start the run by clicking on the Start Run button on the upper
right side of the software window. When the run ends, remove
the plate and allow it to cool to room temperature before
handling. The plate should be discarded after use in the appro-
priate waste container.

3.4 Evaluation of the 1. After the run is complete, open the experiment for analysis (if it
Standard Curve and is not already open) and click the green Analyze button on the
Interpretation of Data upper right side of the software window.
182 Kelly L. Knight et al.

Fig. 3 Example of standard curve with all target. The standard curve can be evaluated with all targets
overlapping as shown in this figure or you can select a specific target and evaluate the individual standard
curves

2. Verify that the standard curves for all three targets (large auto-
somal, small autosomal, and Y) passed by clicking Analysis in
the left panel and then click on Standard Curve (see Fig. 3). To
view all three targets on the standard curve, select All from the
Target drop-down list in the Plot Settings. View the CT values
for the standards, slope, y-intercept, and R2 values. Figure 3
shows an example of a standard curve with all three targets
displayed. Verify that your standard curve is within the appro-
priate range (see Table 2 and Note 8).
3. View the analysis summary (see Fig. 4) and evaluate the QC
Flags Detail in the specified tab (see Fig. 5 and Note 9).
4. View the amplification plot by clicking Analysis, followed by
Amplification Plot (see Fig. 6).
 Quantitation of DNA Using Quantifiler®Trio 183

Table 2
Parameters for a good quantitation standard curve

Slope Y-intercept R2
Large autosomal -3.00 to -3.70 25.00–27.00a ≥0.980
Small autosomal -3.00 to -3.60 25.00–27.00a ≥0.980
Male -3.00 to -3.60 25.00–27.00a ≥0.980
This table shows the generally accepted ranges for a standard curve to be considered
suitable; however, each individual user should follow the guidelines established by their
validation studies done in their laboratories and put forth in their protocols
a
While the manufacturer has not provided a specified range for the y-intercept value, our
laboratory validation studies have shown that an acceptable range is between 25.00 and
27.00. Again, these guidelines should be established by each individual laboratory

5. Export the results by clicking Analysis, followed by View Plate

Layout. Select the desired well(s) to export and then click
Export. Select Results as the type of data to export, select
whether you want separate files or one file, and then click
Start Export.
6. Review and assess the quality of the results (see Fig. 7 and Note
10).

4 Notes

1. This is a ten-fold (1:10) dilution series with five concentration

points, as recommended by the manufacturer. DNA quantifi-
cation standards are important for the accurate analysis of run
data. Pipetting accuracy and consistency are critical in these
steps.
2. Including an additional 2–3 samples in your calculations will
provide excess volume for the loss that occurs during pipet-
ting/reagent transfers. It is helpful to create a plate setup
worksheet to do these calculations. Make sure you account
for standards and controls, such as reagent blanks, that were
created during other steps prior to quantitation. It is recom-
mended to load standards in duplicate and to also include a
non-template control that has no extracted sample in it. This is
an additional measure to confirm there is no contamination or
issue with your master mix.
3. It is helpful to use a 96-well plate map for setting up how you
will load your plate. Also, while preparing the reactions, keep
the 96-well optical reaction plate free from scratches and par-
ticulate matter, and avoid touching the bottom of the plate.
This can interfere with fluorescence detection. Place your plate
into a base such as the Applied Biosystems MicroAmp 96-Well
Base to protect the bottom of the plate.
184 Kelly L. Knight et al.

Fig. 4 Example of analysis summary. This is an example of the analysis summary after a run is completed. It is
important to evaluate any thresholds that were not met. A green square indicates a threshold has been
passed. Red hexagons indicate a threshold has not been met

4. As you begin to load the plate, pay careful attention again to

the way you are pipetting. Make the decision before beginning
whether you will stop at the first pipette stop when you eject
the liquid or if you will “blow it out” by completely depressing
the pipette plunger. Whichever method you decide, stay con-
sistent. Keep in mind that if you decide to completely depress
the plunger, while it may ensure that all of the liquid is ejected,
you also increase the potential for bubbles, which may affect
fluorescence and aerosol production, the latter of which may
lead to potential contamination.
5. This is an important step to reduce well-to-well contamination
and sample evaporation. The cover should be carefully placed
evenly over the entire plate, and then use the applicator to go
through every column and row to ensure the adhesive is stick-
ing to the plate. Pay careful attention to the outer edges as well.
 Quantitation of DNA Using Quantifiler®Trio 185

Fig. 5 Example of QC flags detail. By clicking on the QC Flags Detail tab, you can evaluate how many wells
(frequency) as well as which specific wells had a QC flag

6. Bubbles in reaction wells can cause noise in the fluorescence

signal and can affect results. If a centrifuge or plate spinner is
not available, you can try lightly tapping the plate while in the
base holder to remove the bubbles. Avoid scratching or
smudging the outer areas of the plate wells while doing this.
7. The HID Real-Time PCR Analysis Software User Guide [12]
should be referred to for specific details on how to create a new
experiment. After selecting your instrument, the following
settings are standard: Experiment Type—Quantitation HID
Standard Curve; Reagents—TaqMan® Reagents; and Ramp
Speed—Standard (~1 h to complete a run).
8. A slope of -3.3 indicates 100% amplification efficiency, and an
R2 value of 1.00 indicates a perfect fit between the regression
line and the data points. If the R2 value is <0.98, some labora-
tory protocols will allow for the removal of one or more data
points, but caution should be taken if removing points from the
standard curve, as doing so will affect the CT values of the
186 Kelly L. Knight et al.

Fig. 6 Example of amplification plot display. By highlighting all samples in the plate layout, you can get an
overview of the amplification plot for all of the samples together. You can also click on individual samples to
evaluate each sample’s amplification plot

samples and may decrease the accuracy of the results. If the

standard curve fails, the quantitation values for the samples are
inconclusive. Depending on how much sample extract you
have to work with and where you think the error occurred,
you will need to redo the plate and possibly remake the stan-
dards. If you believe the standard dilution series was made
incorrectly, remake the standards. If you believe it was a pipet-
ting error when loading the plate or some other plate-specific
error, remake the plate with the previously made standards.
9. The degradation index value flags can be used to evaluate the
quality of a sample. The degradation index is automatically
calculated in the software by dividing the small autosomal
target DNA concentration (ng/μL) by the large autosomal
target DNA concentration (ng/μL). This index can be affected
by both degraded samples and the presence of inhibitors, which
may disproportionately affect the amplification of the large
 Quantitation of DNA Using Quantifiler®Trio 187

Fig. 7 Example of exported results. After the data is exported, you can easily review the results and the quality
of the data, specifically any QC flags that did not pass. Use this information to help make decisions as to
whether the results are reliable or whether certain samples (or perhaps even the entire plate) need to be rerun

autosomal target. A degradation index less than 1 indicates that

a sample is not likely degraded or inhibited. An index between
1 and 10 indicates slight to moderate degradation and possible
inhibition. An index greater than 10 indicates significant
degradation.
10. The IPC CT value flags can also be used to evaluate the quality
of a sample. When reviewing the results, the IPC CT values
should be evaluated to determine whether the samples are truly
negative or if something has negatively impacted the reactions.
Samples that are truly negative will have successful amplifica-
tion of the IPC and no signal detected for the other three
targets. Samples that are potentially inhibited will have no
amplification or suppressed amplification when compared
against the average IPC CT values of the samples. Also, by
comparing the degradation index (see Note 9) to the IPC CT
flag, you can evaluate whether your sample is more likely
degraded or inhibited. The IPC values of samples should be
compared to the IPC CT values of standards with similar con-
centrations. The values should be relatively consistent; how-
ever, it should be noted that a higher-than-average IPC CT
value is not always an indication of inhibition. Samples with
concentrations of DNA may have higher IPC CT values with-
out the presence of inhibitors. Laboratories should develop
their own interpretation guidelines by performing validation
188 Kelly L. Knight et al.

studies. However, samples with IPC CT values that are two

cycles higher than the average should be considered for possi-
ble inhibition.

Acknowledgment

We thank the George Mason University College of Science and the

Forensic Science Program for supporting the forensic DNA
laboratory.

References
1. Thermo Fisher Scientific (2018) Quantifiler™ HP and Trio kits for human DNA quantifica-
HP and Trio DNA Quantification Kits user tion in forensic samples. Forensic Sci Int Genet
guide, revision H. Available via Thermo Fisher 21:145–157. https://doi.org/10.1016/j.
Scientific. https://assets.thermofisher.com/ fsigen.2015.12.007
TFS-Assets/LSG/manuals/4485354.pdf. 8. Janssen K, Olsen M, Olsen GH et al (2015)
Accessed 05 May 2022 Validation of automated PCR-setup of the
2. Horsman KM, Hickey JA, Cotton RW et al Quantifiler® Trio DNA Quantification Kit on
(2006) Development of a human-specific real- the Biomek® 4000 laboratory automation
time PCR assay for the simultaneous quantita- workstation. Forensic Sci Int Genet Suppl Ser
tion of total genomic and male DNA. J Foren- 5:e587–e589. https://doi.org/10.1016/j.
sic Sci 51(4):758–765. https://doi.org/10. fsigss.2015.09.232
1111/j.1556-4029.2006.00183.x 9. Vieira-Silva C, Afonso-Costa H, Ribeiro T et al
3. Westring CG, Kristinsson R, Gilbert DM et al (2015) Quantifiler® Trio DNA validation and
(2007) Validation of reduced-scale reactions usefulness in casework samples. Forensic Sci Int
for the Quantifiler® Human DNA kit. J Foren- Genet Suppl Ser 5:e246–e247. https://doi.
sic Sci 52(5):1035–1043. https://doi.org/10. org/10.1016/j.fsigss.2015.09.098
1111/j.1556-4029.2007.00525.x 10. Cho Y, Kim HS, Kim M et al (2017) Validation
4. Butler JM (2005) Forensic DNA typing: biol- of reduced reagent volumes in the implemen-
ogy, technology, and genetics of STR markers, tation of the Quantifiler® Trio quantification
2nd edn. Elsevier Academic Press, London, pp kit. J Forensic Sci 63(2):517–525. https://
111–124 doi.org/10.1111/1556-4029.13578
5. Green RL, Roinestad IC, Boland C et al (2005) 11. Ballantyne J, Hanson E, Green R et al (2013)
Developmental validation of the Quantifiler® Enhancing the sexual assault workflow: testing
real-time PCR kits for the quantification of of next generation DNA assessment and Y-STR
human nuclear DNA samples. J Forensic Sci systems. Forensic Sci Int Genet Suppl Ser 4(1):
50(4):1–17. https://doi.org/10.1520/ e228–e229. https://doi.org/10.1016/j.fsigss.
jfs2004478 2013.10.117
6. Gouveia N, Brito P, Serra A et al (2015) Vali- 12. Thermo Fisher Scientific (2018) HID real-time
dation of Quantifiler® Trio DNA Quantifica- PCR analysis software user guide. Available via
tion Kit in forensic samples. Forensic Sci Int: Thermo Fisher Scientific. https://assets.
Genet Suppl Ser 5:e24–e25. https://doi.org/ t h e r m o fi s h e r. c o m / T F S - A s s e t s / L S G /
10.1016/j.fsigss.2015.09.010 manuals/MAN0009819_HID_
7. Holt A, Wootton SC, Mulero JJ et al (2016) PCRAnalysisSoftware_UG.pdf. Accessed
Developmental validation of the Quantifiler® 05 May 2022
 Chapter 12

QIAGEN’s Investigator® Quantiplex® Pro Kit

Michelle D. Bonnette

Abstract
The QIAGEN Investigator® Quantiplex® Pro Kit is a real-time quantitative PCR assay utilized by forensic
DNA laboratories to determine the amount of amplifiable human and male DNA in a sample prior to
downstream amplification of specific STR markers for human identity testing. This quantification method
includes two internal controls that assist the analyst in a preliminary evaluation of the sample in regard to
both inhibition or degradation that may be present in the sample and subsequently affect the more targeted
downstream amplification of specific markers for identity testing. The internal controls are analogous to the
quality sensors contained in QIAGEN’s Investigator® 24plex line of amplification kits, ensuring that the
sample’s performance in the quantitation step can accurately predict the success of the STR amplification
results. This chapter describes the physical plate setup of a quantitative PCR assay utilizing the QIAGEN
Investigator® Quantiplex® Pro Kit as well as the steps and software configurations involved in running such
a plate on the Applied Biosystems 7500 Real-Time PCR System for Human Identification using HID Real-
Time PCR Analysis Software v1.1 or 1.2.

Key words Forensic DNA, Quality sensors, Quantification, Real-time qPCR, DNA degradation,
DNA inhibition

1 Introduction

It is essential to assess the quantity of DNA present in an extract

prior to amplification in order to obtain the appropriate results.
The Investigator® Quantiplex® Pro Kit (Quant Pro; QIAGEN,
Hilden, Germany) is a real-time quantitative polymerase chain
reaction (qPCR) simultaneously running four assays designed to
use a small portion of an extract to estimate the total quantity of
amplifiable human DNA and male DNA present in the sample. The
results obtained can also aid in determining the quantity of extract
needed for an STR reaction, the ratio of male to female DNA
present in a sample, and the level of DNA degradation, as well as
the presence of possible PCR inhibitors in the extract. This robust
assay can produce accurate results for low quantities of male DNA

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_12,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

189
190 Michelle D. Bonnette

even in the presence of abundant female DNA (up to 2,500,000:1),

which is often the case with sexual assault evidence [1].
The kit consists of sequence-specific primers, sequence-specific
TaqMan® probes labeled with fluorescent dyes, and a reaction mix
containing deoxyribonucleotide triphosphates (dNTPs) [2]. The
reagents are mixed with a small volume of sample extract and then
placed in a real-time qPCR instrument, such as an Applied Biosys-
tems® 7500 Real-Time PCR System (7500), for analysis. At the
start of PCR thermal cycling, the TaqMan® probes are intact and
the proximity of the quencher on the 3’ end of the probe and the
reporter fluorescent dye on the 5’ end prevents the emission of
fluorescence [3]. During synthesis, the QuantiNova® DNA Poly-
merase, a novel hot-start enzyme, hydrolyzes the probes, thereby
separating the quenchers from the reporter dyes [2]. A CCD
camera enclosed within the real-time instrument records the result-
ing fluorescence. The amount of fluorescence emitted from each
sample is proportional to the amount of DNA that is amplified
through each cycle of the PCR process. The analysis software plots
the amount of fluorescence emitted with each cycle number from
each dye, compares it to a series of known quantity standards, and
estimates the amount of human and male DNA present in each
sample extract. This estimate is based upon the value of the cycle
threshold (CT). The sooner it takes a sample to cross the fluores-
cence threshold (i.e., fewer cycles), the greater the initial number of
DNA molecules present in the sample extract.
The shorter of the autosomal targets in this kit is a 91-base pair
(bp) proprietary region of the 4NS1C® locus, which is present on
numerous autosomes in the human genome [2]. This target region
is detected using the FAM™ dye channel on the real-time instru-
ment. In addition to this 91 bp target, a longer 353 bp region of the
4NS1C® locus is amplified as the longer autosomal target
[2]. Because of its increased length, this longer target is more
susceptible to degradation and can therefore provide a helpful
assessment of the overall degradation of each sample. This target
is visualized in the TAMRA dye channel, while the male target is an
81 bp fragment visualized using the Cy®5 dye channel, and the
434 bp internal [positive] control (IC) is detected in the JOE™ dye
channel [2].

2 Materials

1. Applied Biosystems 7500 Real-Time PCR System.

2. 96-well optical reaction plate and compatible base.
3. Optical adhesive film.
4. Adhesive film applicator.
 Quantiplex® Pro 191

5. Investigator® Quantiplex® Pro Kit: Contains Quantiplex Pro

Reaction Mix, Quantiplex Pro Primer Mix, Male Control DNA
M1 (50 ng/μL), QuantiTect® Nucleic Acid Dilution Buffer,
and Quick-Start Protocol. Store at -30 °C to -15 °C imme-
diately upon receipt (see Note 1).

3 Methods

This protocol is based on the manufacturer’s recommendations for

the Investigator® Quantiplex® Pro Kit [2]. One duplicate set of
four standards ranging from 0.0025 ng/μL to 50 ng/μL is pro-
cessed with each plate. These standards establish the standard
curve, which is utilized to estimate the quantity of DNA in each
sample. The standard curve should be evaluated after each run
using the values in Table 1 as a guideline (see Note 2). Present in
the master mix, and thus each sample, is an internal control (IC).
This control is added in a fixed concentration and should demon-
strate that amplification occurred properly within each sample (see
Note 3). A No-Template Control (NTC) consisting of master mix
and 2 μL QuantiTect Nucleic Acid Dilution Buffer should be run
with each plate. The NTC sample should be evaluated after each
run and should quantify as a negative sample, and its IC should be
in the appropriate range (see Note 4). Lastly, any extraction reagent
blanks associated with the samples being quantified should also be
taken through this quantification step. The quantitation plate
should be set up in a hood or biological safety cabinet while wearing
appropriate personal protective equipment (see Note 5).

3.1 Preparation of 1. There are four concentration points in the standard curve for
DNA Standards each assay. The control DNA contains pooled male DNA at a
concentration of 50 ng/μL. To ensure pipetting accuracy, the
minimum input volume of DNA for dilutions should be 5 μL.
The standard curve is designed to be set up using a 1:27
dilution series (see Note 6). Table 2 shows an example of the
standard dilution series with concentrations ranging from
50 ng/μL to 0.0025 ng/μL.

Table 1
Recommended guidelines for acceptable ranges of standard curve values
by target

Total human target Male target Degradation target

Slope -3.362 to -3.059 -3.426 to -3.107 -3.331 to -2.997
Y-intercept 25.357 to 26.419 23.508 to 24.762 24.600 to 27.034
R2 ≥0.99 ≥0.99 ≥0.99
Evaluate the standard curves using these recommended values and adjust upon further
internal validation at your laboratory
192 Michelle D. Bonnette

Table 2
Quantification standards preparation guide

QuantiTect Nucleic Acid Standard DNA

Standard DNA standard amount Dilution Buffer amount concentration (ng/μL)
Standard 1 130 μL of undiluted Male Control N/A 50
DNA M1 (50 ng/μL)
Standard 2 5 μL of standard 1 130 μL 1.8519
Standard 3 5 μL of standard 2 130 μL 0.0686
Standard 4 5 μL of standard 3 130 μL 0.0025
This table depicts the smallest final volumes for standards preparation. To ensure pipetting accuracy, the minimum input
volume of DNA for dilutions should be 5 μL. These volumes provide approximately 30 plates worth of standard curves
and are stable for 1 week after preparation. Volumes may be scaled up to accommodate laboratories with higher expected
usage

2. Label four microcentrifuge tubes as Standard 1, Standard

2, Standard 3, and Standard 4.
3. Vortex and pulse spin both the Male Control DNA M1 and
QuantiTect Nucleic Acid Dilution Buffer thoroughly.
4. Aliquot 130 μL undiluted Male Control DNA M1 into the
Standard 1 tube.
5. Aliquot 130 μL of QuantiTect Nucleic Acid Dilution Buffer
into each of Standard tubes 2 through 4.
6. Pipette 5 μL of Standard 1 into Standard 2.
7. Vortex for at least 5 s and pulse spin this dilution briefly before
removing an aliquot for the next dilution.
8. Pipette 5 μL of Standard 2 into Standard 3.
9. Vortex for at least 5 s and pulse spin this dilution briefly before
removing an aliquot for the next dilution.
10. Pipette 5 μL of Standard 3 into Standard 4.
11. Vortex for at least 5 s and pulse spin this dilution briefly (see
Note 7).

3.2 Quantification 1. Determine the amount of each reagent needed for the master
Setup mix by calculating the total number of samples, standards, and
controls on the plate multiplied by the amount of each reagent
needed per reaction (see Note 8). The master mix should
consist of 9 μL Quantiplex Pro Reaction Mix and 9 μL Quan-
tiplex Pro Primer Mix per reaction (see Table 3).
2. If not already thawed, thaw the primer and reaction mixes
completely. Vortex and pulse spin prior to use.
3. Add the calculated volumes to an appropriately sized tube.
Vortex and pulse spin the master mix prior to use.
 Quantiplex® Pro 193

Table 3
qPCR reaction composition

Component Volume per reaction (μL)

Quantiplex Pro Primer Mix 9
Quantiplex Pro Reaction Mix 9
DNA 2
Total volume 20
It is recommended to add at least 5% extra samples in your calculations for the master mix
preparation (Quantiplex Pro Primer Mix and Quantiplex Pro Reaction Mix) to account
for any loss during the transfer steps. 18 μL of the master mix will be added to the 2 μL of
DNA, standard, or control sample for a total reaction volume of 20 μL

4. Obtain a 96-well optical reaction plate, place it in a base, and

dispense 18 μL of master mix into each sample well to be used
(see Notes 5 and 9).
5. Add 2 μL of each sample, standard, or control (use the Quan-
tiTect® Nucleic Acid Dilution Buffer for NTCs) to the appro-
priate wells (the standards are run in duplicate) (see Note 5).
6. Seal the plate with an optical adhesive cover (see Note 10).
Avoid touching the center of the optical cover. Fingerprints or
smudges can affect fluorescence, leading to erroneous readings.
If a print or smudge occurs, clean the area with at least 70%
ethanol or isopropanol and a clean, lint-free lab wipe.
7. Vortex and centrifuge the plate to ensure all liquid is in the
bottom of each well and to remove any bubbles in the bottom
of the wells (see Note 11).

3.3 Creating an 1. Turn on the computer with the HID Real-Time PCR Analysis
Instrument Plate Software v1.1 or 1.2 and log on.
Record and Starting a 2. Turn on the instrument by pressing the blue power button on
Run on the 7500 the lower right front of the instrument.
3. Open the HID Real-Time PCR Analysis Software in the Cus-
tom Assays mode.
4. If you are using a template file, then select New Experiment -
> From Template (see Fig. 1), select the correct template file
from its stored location, and proceed to assign the samples,
standards, and controls to the plate setup (see Subheading 3.3,
step 8). If you are not using a template file, proceed with the
next step (see Subheading 3.3, step 5) (see Note 12).
5. If you are not using a template file, select the Advanced Setup
by clicking on the arrow below the Design Wizard (see Figs. 2
and 3).
194 Michelle D. Bonnette

Fig. 1 Home screen for the HID Real-Time PCR Analysis Software v1.1 or 1.2. This screenshot shows how to
start a new experiment from a template. (Reproduced from Ref. [2] with permission from QIAGEN)

Fig. 2 Starting a new experiment. If not using a template, the user will need to select Advanced Setup by
clicking the arrow button directly below the Design Wizard. (Reproduced from Ref. [2] with permission from
QIAGEN)
 Quantiplex® Pro 195

Fig. 3 Starting a new experiment using Advanced Setup. The Advanced Setup option becomes available and
will be utilized if not using a template. (Reproduced from Ref. [2] with permission from QIAGEN)

6. Once the new window opens, enter a new Experiment Name in

the appropriate field. Select the following settings: Instrument:
7500 (96 Wells); Experiment Type: Quantitation—Standard
curve; Reagents: TaqMan Reagents; Ramp Speed: Standard;
and unselect the Include Melt Curve option (see Fig. 4).
7. Click on Plate Setup from the menu on the left and define the
four targets in the Define Targets section (see Note 13). Select
the following Reporter settings: Human: FAM; IC: JOE; Deg-
radation: TAMRA; and Male: Cy5. Select “None” for all four
of the targets’ Quencher settings (see Fig. 5).
8. If an import file was generated in the QIAGEN Quantification
Assay Data Handling Tool, go to File, Import, and browse to
the .txt import file to import the plate setup with standards,
sample names, and targets (see Notes 14 and 15). If the plate
setup is imported, proceed to (1) programming the thermal
cycler if you did not use a template or (2) saving and starting
the run if a template was used (see Subheading 3.3, step 14 or
16, respectively).
9. If an import file was not generated, define the names of the
samples, controls, and standards (e.g., Standard 1 or Std1,
Standard 2 or Std2, etc.) using the Define Samples tool on
the right panel (see Note 16).
10. If replicates are needed, they should be assigned before pro-
ceeding to the next step. Define replicates by using the same
196 Michelle D. Bonnette

Fig. 4 Selecting the correct “Experiment Properties” settings. The specific properties of the experiment, like
the instrument used and experiment type, are defined in this screen. (Reproduced from Ref. [2] with
permission from QIAGEN)

Fig. 5 Selecting the correct “Target” settings. This screen allows the user to define and configure the four
targets specific to the Investigator® Quantiplex® Pro DNA Quantification Kit. (Reproduced from Ref. [2] with
permission from QIAGEN)
 Quantiplex® Pro 197

Fig. 6 Assigning the Targets. This screen allows the user to assign the targets to the wells in use, as well as
specify which wells are to contain unknown samples, controls, or standards and specify the quantity of those
standards. (Reproduced from Ref. [2] with permission from QIAGEN)

sample name or by using the Define Biological Replicate

Groups panel. Switch to the tab Assign Targets and Samples.
In the Plate Layout, select the wells in use and assign all four
Targets by checking the boxes (see Fig. 6 and Note 17).
11. Select the wells for the no-template controls (NTC) and flag
them as Negative Control using the gray N button. Leave the
IC (JOE) Task for NTC reactions set to Unknown. Enter the
sample name.
12. Select the wells for the standard curve and flag them as Stan-
dard using the orange S button. Select Quantity for the appro-
priate detector and enter the quantity of DNA in the well in
accordance with the DNA standards (see Table 1). Although
units are not entered for Quantity, a common unit must be
used for all standard quantities (e.g., ng/μL). The units used
for standard quantities define the quantification units for the
analysis of results. Leave the IC (JOE) Task for standard reac-
tions set to Unknown.
13. Assign the samples to the plate layout by clicking on the wells
and checking the appropriate box on the left panel (see Fig. 7).
14. Click Run Method from the menu on the left. Program the
cycler according to Table 4.
198 Michelle D. Bonnette

Fig. 7 Entering the sample names and assigning the samples. To assign the samples to the plate layout, click
the appropriate well and check the appropriate box(es) on the left side of the screen. (Reproduced from Ref. [2]
with permission from QIAGEN)

Table 4
Thermal cycling parameters

Number of
Step Temperature Time cycles Comment
Initial PCR activation 95 °C 3 min 1 Hot-start to activate DNA
polymerase
2-step cycling:
Denaturation 95 °C 5s 40
Combined annealing/ 60 °C 35 s 1 Perform fluorescence data
extension collection
Program the thermal cycler according to these specifications

15. On the thermal profile, verify the holding times against those in
Table 4 and ensure the sample volume is set to 20 μL (see
Fig. 8).
16. To save the plate document, select File > Save As.
17. Select the location for the plate document.
18. Enter a file name.
19. For file type, select Experiment Document Single files (*.eds).
20. Click Save.
 Quantiplex® Pro 199

Fig. 8 Adjusting the thermal profile (HID Real-Time PCR Analysis Software v1.2). The thermal profile should be
adjusted to match what is displayed in this figure. (Reproduced from Ref. [2] with permission from QIAGEN)

21. Open the instrument’s plate holder tray by pressing on the

depressed circle in the blue strip on the front of the instrument.
22. Once the plate holder tray opens, position the plate so that well
A1 is in the upper left corner and the notched corner is in the
upper right.
23. Gently push the plate holder closed.
24. Click the green Start Run button at the top right of the screen
in the HID Real-Time PCR Analysis Software. The run takes
approximately 1 h to complete.

3.4 Analyzing a Run 1. Open the completed run file using the HID Real-Time PCR
Analysis Software by opening the software in the Custom
Assays Mode, then go to Open, and then Browse to locate
the saved file.
2. In the Amplification Plot tab (found in the Analysis tab of the
menu on the left), select all sample wells in the View Plate
Layout tab. Click the Analysis Settings button (on the right
side of the window, next to Analyze/Reanalyze). Set all the
analysis thresholds: Male to 0.2, Degradation to 0.2, and IC to
0.05 (see Fig. 9 and Notes 18 and 19).
3. Use a Manual Baseline with Start Cycle set to 3 and End Cycle
set to 15 for all targets.
200 Michelle D. Bonnette

Fig. 9 Sample analysis for the QPP_FAM, QPP_JOE, QPP_ATTO550, and QPP_ATTO647N channels. From the
Amplification Plot tab, you can cycle through the various detectors to set the thresholds and baseline.
(Reproduced from Ref. [2] with permission from QIAGEN)

4. Verify that options for Auto Threshold and Auto Baseline are
deselected for all targets.
5. To view the standard curve, select the Standard Curve tab
(found in the Analysis section of the menu on the left).
6. View the calculated regression line, slope, y-intercept, and R2
values (see Fig. 10). Evaluate the standard curve for each Target
using the values listed in Table 1. At the top of the Standard
Curve graph is a dropdown menu where you can toggle
between the various Targets and the values below the graph
update accordingly. The slope indicates the amplification effi-
ciency of the standard reactions. The R2 (correlation coeffi-
cient) indicates the closeness of fit between the regression line
and the individual data points. The Y-intercept indicates the
expected CT value for a sample with a quantity of 1 ng/μL (see
Notes 20 and 21).
7. View the concentrations of the unknown samples by clicking
on the View Well Table tab on the right half of the screen (see
Fig. 11) to display data for the selected wells. This summarizes
the data from the four targets in the unknown samples. The
Human Target shows the quantity of DNA present with the
same units as used for the standards (i.e., if ng/μL was used for
the definition of the standards, then the quantities for the
unknowns will be reported in ng/μL). The Male and Degrada-
tion Targets show the quantity of male and human DNA
 Quantiplex® Pro 201

Fig. 10 Standard curve. The standard curve for each detector is visualized via the Standard curve tab. Users
can cycle through the various detectors via the Target dropdown in the upper left side of the tab. (Reproduced
from Ref. [2] with permission from QIAGEN)

Fig. 11 Unknown sample concentrations. The View Well Table tab displays results data for each well
separated by Target. (Reproduced from Ref. [2] with permission from QIAGEN)
202 Michelle D. Bonnette

present, respectively, with the same units as used for the stan-
dards (see Note 22). The IC Target shows the CT value for the
internal control (see Note 23).
8. To export and save the results report, go to File, followed by
Export, and then Results. The analysis settings must be saved
first, and then the results may be saved in either .txt or .csv
format.
9. A run report may also be generated by clicking on Print Report
at the top of the screen. Select the desired information to be
included in the report in the window that opens. Click Print
Report.
10. Remove the plate from the instrument, discard, and power
down the instrument.

4 Notes

1. Kit reagents should be stored immediately upon receipt at -30

°C to -15 °C in a constant-temperature freezer. After first use,
store the kit components at 2–8 °C. Avoid re-freezing the kit
components. The QuantiTect Nucleic Acid Dilution Buffer
may also be stored at -30 °C to -15 °C, if desired. Quantiplex
Pro Primer Mix must be stored protected from light. Each lot
of kits must be evaluated prior to use in casework.
2. These values are a general guideline. Internal validation within
your laboratory will dictate the best performance standards to
be utilized in your laboratory’s setting.
3. If the CT value of the IC is shifted by greater than or equal to
1 cycle (as compared to the ICs of the standards), it is possible
inhibition may have occurred during the PCR process.
4. If an NTC exhibits a quantity value for the human, male, or
degradation target, none of the data associated with the run can
be used. The assay must be repeated.
5. Extra care must be taken to be certain that the proper orienta-
tion of the plate is used. It is necessary to keep the reaction
plate in a base (such as a MicroAmp™ 96-Well Base) at all times
and to utilize a plate map.
6. If using QuantiTect Nucleic Acid Dilution Buffer to dilute the
Control DNA, the dilutions are stable for at least 1 week at
2–8 °C.
7. The final volumes of the standards may be increased to fit the
laboratory’s needs. Additionally, other standard curve config-
urations including more points can also be utilized—see
“Appendix: Alternative Standard Curves” in the Investigator®
Quantiplex® Pro Handbook.
 Quantiplex® Pro 203

8. It is recommended to add at least 5% extra samples to the

calculations to account for any loss during pipetting.
9. Placing the 96-well plate directly on a counter/surface or
touching the outside of the wells in any way may interfere
with subsequent fluorescent readings.
10. Ensure the plate is securely sealed around the outer edges and
between wells using an adhesive film applicator tool, such as
the MicroAmp™ Adhesive Film Applicator tool. A proper seal
is vital to preventing evaporation during thermal cycling or
cross-contamination between wells.
11. If all the well contents are not at the bottom of the well, the
reaction may yield faulty results. Likewise, having a bubble in
the bottom of the well can adversely affect the fluorescent
readings, also yielding inaccurate results.
12. The template file loads all of the settings needed to start an
Investigator Quantiplex Pro run, including the standard curve
settings, the cycling profile, and the targets needed for fluores-
cence acquisition. Download the template files from the prod-
uct resources page [4].
13. By default, only two targets are shown. Click on Add New
Target to add the additional two targets.
14. Download the QIAGEN Quantification Assay Data Handling
Tool from the product resources page [5].
15. If using the QIAGEN Quantification Assay Data Handling
Tool (strongly recommended for easy to visualize quantifica-
tion results), use the import sheet rather than manually enter-
ing all data in the HID Real-Time PCR Analysis Software. The
Quantification Setup tab in the QIAGEN Quantification Assay
Data Handling Tool allows users to select their quantification
instrument, enter sample IDs, arrange standards in the orien-
tation of your choice, and automatically generate a batch
import file with all of this information configured appropriately
for the instrument chosen.
16. Naming of Standards is required for proper subsequent analysis
with the QIAGEN Quantification Assay Data Handling Tool.
17. Important: Do not highlight the wells that are not in use (i.e.,
those without reaction mix). Including unused wells will sig-
nificantly impact the scale of the X and Y axes when viewing
the data.
18. These threshold values are a general guideline. Internal valida-
tion within your laboratory will dictate the best threshold
settings to be utilized in your laboratory’s setting.
19. These thresholds are also pre-defined in the template file found
on the product resources page [4].
204 Michelle D. Bonnette

20. If the standard curve values fall outside the guidelines, one
non-concordant point may be removed from the standard
curve. To remove a point, click on the appropriate well to
highlight it, then right-click and select Omit, then select
Well. Once a point has been removed, click the green Analyze
button at the top right of the screen to recalculate the standard
curve.
21. If the slope, y-intercept, and/or R2 values are still out of range
after one point has been deleted, all samples should be inter-
preted with caution or re-quantified. QIAGEN does not rec-
ommend the use of the Auto Threshold or Auto Baseline
features, even when the standard curves do not pass using the
conditions supplied in this chapter.
22. If the quantity of the smaller autosomal Human Target is
significantly larger than that of the larger autosomal Degrada-
tion Target, this is indicative of degradation in the sample. For
example, if using the Qiagen Quant Assay Data Handling Tool
to import your quantitation results, the tool is defaulted to flag
samples for possible degradation when there is a ten-fold
increase in value of the Human target.
23. When the sample IC CT is significantly greater than expected
(at least 1 cycle), this is a possible sign of PCR inhibition and
such samples should be interpreted with caution. It may be
beneficial to re-quantify using a set of dilutions to dilute out
any inhibitors present in the sample. Possible inhibition
detected by the IC is not an absolute indicator that there will
be inhibition observed with amplification used in association
with the development of STR profiles for human identification.

References

1. Vraneš M, Scherer M, Elliott K (2017) Develop- Investigator Quantiplex Pro RGQ Kit and com-
ment and validation of the Investigator® Quan- parison with the Quantifiler Trio DNA Quanti-
tiplex Pro Kit for qPCR-based examination of fication Kit. Dissertation, University of Porto
the quantity and quality of human DNA in 4. QIAGEN (2022) Investigator Quantiplex Pro
forensic samples. Forensic Sci Int Genet Suppl template files ABI 7500. Available via QIAGEN.
Ser 6:e518–e519. https://doi.org/10.1016/j. www.qiagen.com/QPpro-template-files.
fsigss.2017.09.207 Accessed 31 July 2022
2. QIAGEN (2018) Investigator® Quantiplex® 5. QIAGEN (2022) QIAGEN Quantification
Pro handbook. Available via QIAGEN. Assay Data Handling and STR Setup Tool
https://www.qiagen.com/us/resources/ v4.0. Available via QIAGEN. www.qiagen.
resourcedetail?id=901fab34-fae8-4247-bc24-0 com/QIAGEN Quantification Assay Data
57840b27c50&lang=en. Accessed Handling Toolhttps://www.qiagen.com/us/
31 July 2022 resources/resourcedetail?id=ba2c4611-5a06-4
3. Quintas Gonçalves JA (2021) Quantitative and 842-a9f6-827f8b54848e&lang=en. Accessed
qualitative evaluation of human and male DNA 31July2022
in sexual assault cases: validation of the
 Part IV

STR Amplification
 Chapter 13

DNA Amplification Using Promega’s PowerPlex® Fusion

Systems (5C and 6C)
Caitlin McCaughan and Kristy A. Lenz

Abstract
Multiplex amplification and typing of short tandem repeat (STR) loci enable the rapid characterization of
forensic samples for human identification purposes with the potential for high discriminatory power. Many
commercial multiplex kits are available for consideration and purchase by DNA testing laboratories,
including the PowerPlex® Fusion 5C and PowerPlex® Fusion 6C Systems offered by Promega Corporation.
Herein we describe full-volume and half-volume amplification protocols utilizing extracted DNA for these
respective multiplex kits, as well as procedures for direct amplification of lytic and nonlytic storage card
punches and swabs.

Key words DNA amplification, Forensic science, Polymerase chain reaction (PCR), Short tandem
repeat (STR), PowerPlex® Fusion, CODIS

1 Introduction

DNA amplification utilizing polymerase chain reaction (PCR) and

subsequent typing of short tandem repeat (STR) loci offers a highly
discriminatory method for forensic human identification. PCR
enables the targeting of specific regions of DNA via primers and
employs a cycling process to exponentially amplify the input DNA.
The current method for forensic DNA analysis is the amplification
and detection of STR loci. STR loci are highly variable and consist
of short repeat sequences in which alleles can be distinguished by
the number of copies of the repeat sequence [1, 2]. The highly
polymorphic nature of STR loci enables them to be informative of
PCR-based genetic markers for forensic human identification,
providing strong discriminatory power [3].
In order to effectively deploy a national DNA database for
forensic purposes, DNA testing laboratories needed to employ a
standard set of STR loci that could be compared. Originally,
13 core Combined DNA Index System (CODIS) loci were

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_13,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

207
208 Caitlin McCaughan and Kristy A. Lenz

selected, with the Federal Bureau of Investigation increasing this

requirement to 20 core STR loci in 2017 [4, 5]. Following the
expansion of the CODIS core loci, several commercial STR multi-
plex kits became available for consumer purchase that included
these 20 loci and additional discriminatory loci. Multiplex kits
allow the simultaneous amplification and fluorescent detection of
multiple STR loci in a single reaction. Two such kits offered include
the PowerPlex® Fusion 5C and PowerPlex® Fusion 6C Systems
from Promega Corporation (Madison, WI).
The PowerPlex® Fusion 5C (Fusion 5C) System is a five-dye
multiplex consisting of 22 autosomal STR loci, 1 Y-chromosome
STR (Y-STR) locus, and Amelogenin as a sex-indicating locus.
Fusion 5C includes the following core CODIS loci: CSF1PO,
FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820,
D8S1179, D13S317, D16S539, D18S51, D21S11, D1S1656,
D2S441, D10S1248, D12S391, D22S1045, D2S1338, and
D19S443, as well as Penta E, Penta D, Amelogenin, and DYS391
(see Fig. 1) [1, 6, 7]. Three years after the release of the Fusion 5C
System, Promega released PowerPlex® Fusion 6C (Fusion 6C), a
six-dye STR multiplex. Fusion 6C enables the inclusion of more
loci, a total of 27, within a single reaction because of the addition of
the purple (TOM) dye channel, increasing the overall discrimina-
tory power. The included loci consist of the core 20 CODIS loci;
3 Y-STRs (DYS391, DYS576, and DYS570); and Amelogenin,
Penta D, Penta E, and SE33 (see Fig. 1) [7–9]. Both Fusion 5C
and Fusion 6C provide accurate, robust, and sensitive STR geno-
typing suitable for forensic casework [10, 11]. In addition, the
PowerPlex® Fusion Systems are compatible with both full- and
half-volume reactions, as well as direct amplification reactions
from several common sample substrates including DNA storage
cards and swabs [12, 13]. Half-volume reactions allow for similar
amplification performance, while utilizing less reagents, enabling a
more cost-effective method for laboratories purchasing large
amounts of consumables. Direct amplification allows laboratories
to perform amplification with minimal pre-processing of buccal and
blood samples and is generally used for databasing purposes.

2 Materials

Per manufacturer recommendations, the following protocols were

developed for use with previously extracted and purified DNA or
direct amplification samples. The optimal concentration of template
DNA per full-volume reaction is 0.25–0.5 ng for Fusion 5C and 1 ng
for Fusion 6C [1, 8]. For half-volume reactions, studies have shown an
optimal DNA input of 0.5 ng for Fusion 5C and 0.5–0.75 ng for
Fusion 6C [14, 15]. Template DNA input amount is best determined
on a per-laboratory basis and depends on a variety of factors. This
should be optimized based on internal validation results.
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 209

Fig. 1 PowerPlex® Fusion 5C and 6C Loci. The configuration of loci included in the PowerPlex® Fusion 5C
System (top) and the PowerPlex® Fusion 6C System (bottom) are displayed. Fusion 5C allows the
co-amplification and subsequent fluorescent detection of 24 loci, while Fusion 6C includes 27 loci within a
single reaction utilizing an additional dye channel. (Reproduced from Ref. [7] with permission from the
Promega Corporation)A* = Amelogenin

2.1 PowerPlex® 1. Pre-amplification Components Box: PowerPlex® Fusion 5X

Fusion 5C System Master Mix, PowerPlex® Fusion 5X Primer Pair Mix, 2800M
Control DNA, and Amplification Grade Water (see Note 1).
2. Post-amplification Components Box: PowerPlex® Fusion Alle-
lic Ladder Mix and WEN Internal Lane Standard 500 (see
Note 1).
210 Caitlin McCaughan and Kristy A. Lenz

2.2 PowerPlex® 1. Pre-amplification Components Box: PowerPlex® Fusion 6C 5X

Fusion 6C System Master Mix, PowerPlex® Fusion 6C 5X Primer Pair Mix, 2800M
Control DNA, and Amplification Grade Water (see Note 2).
2. Post-amplification Components Box: PowerPlex® Fusion 6C
Allelic Ladder Mix and WEN Internal Lane Standard 500 (see
Note 2).

2.3 All Amplification 1. TE-4 buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0. To

Protocols prepare TE-4 buffer, mix together 10 mL of 1 M Tris-HCl
(pH 8.0), 0.2 mL of 0.5 M EDTA (pH 8.0), and 990 mL of
deionized water. Alternatively, dissolve 1.21 g Tris base and
0.037 g EDTA (Na2EDTA • 2H2O) in 900 mL deionized
water. Adjust to pH 8.0 with HCl. Bring the final volume to 1 L
with deionized water. Autoclave after combining all components
(see Note 3).
2. Thermal Cycler: GeneAmp® PCR System 9700 with a gold-
plated silver or silver sample block; Veriti® 96-Well Thermal
Cycler; or ProFlex® PCR System (see Note 4).
3. Centrifuge compatible with 96-well plates or reaction tubes.
4. Aerosol-resistant pipette tips (see Note 5).
5. Microcentrifuge tubes: non-stick, RNAse-free, 1.5 mL.
6. PCR reaction plate or tubes: 0.2 mL 96-well plate, 8-tube
strips, or individual tubes.
7. 8-cap strips or foil seal.
8. PCR Cooler: this is a 96-well cooling block that may be used to
house the reaction plate or individual tubes during amplifica-
tion setup.

2.4 Direct 1. 5X AmpSolution™ Reagent (pre-amplification reagent).

Amplification of Lytic 2. 1.2 mm punching tool: 1.2 mm Harris Uni-Core Punch (or e-
Storage Cards (see quivalent manual punch) and cutting mat.
Note 6)

2.5 Direct 1. PunchSolution™ Reagent: pre-amplification reagent.

Amplification of 2. 5X AmpSolution™ Reagent: pre-amplification reagent.
Nonlytic Storage Cards
3. 1.2 mm punching tool: 1.2 mm Harris Uni-Core Punch (or e-
(see Note 7)
quivalent manual punch) and cutting mat.
4. Heat block: needs insert capable of accepting 96-well plate, or a
96-well thermal cycler can be used. Must be in the
pre-amplification room. Set to 70 °C.
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 211

2.6 Direct 1. SwabSolution™ Reagent: pre-amplification reagent.

Amplification of 2. Microcentrifuge tubes or deep-well plate: 1.5 mL ClickFit
Swabs Microtube or other 1.5 mL microcentrifuge tube with locking
cap or screw top; or 2.2 mL, square, deep, 96-well plate.
3. Heat block: set to 70 °C for 1.5 mL tubes or 90 °C for a deep-
well plate. An adapter is required for use with the 96-well plate.

3 Methods

3.1 Amplification of 1. Completely thaw the PowerPlex® Fusion 5X Master Mix,

Extracted DNA Using PowerPlex® Fusion 5X Primer Pair Mix, and Amplification
PowerPlex® Fusion 5C Grade Water.
in a Full Reaction 2. Centrifuge tubes briefly to bring contents to the bottom and
Volume then vortex reagents for at least 15 s (see Note 8).

Table 1
Amplification setup for Fusion 5C and Fusion 6C

Volume per reaction (μL)

Full-volume DNA
Amplification of extracted DNA Fusion 5C: 0.25–0.5 ng Up to 15
Fusion 6C: 1 ng Up to 15
5X Master Mix 5.0
5X Primer Pairs 5.0
Amplification Grade Water To final volume of 25
Total volume 25
Half-volume DNA
Amplification of extracted DNA Fusion 5C: 0.5 ng 5.0
Fusion 6C: 0.5–0.75 ng 5.0
5X Master Mix 2.5
5X Primer Pairs 2.5
Amplification Grade Water 2.5
Total volume 12.5
Half-volume 5X Master Mix 2.5
Direct amplification of storage card punches 5X Primer Pairs 2.5
Amplification Grade Water 5.0
5X AmpSolution™ Reagent 2.5
Total volume 12.5
Half-volume 5X Master Mix 2.5
Direct amplification of swabs 5X Primer Pairs 2.5
Amplification Grade Water 5.5
Swab Extract 2.0
Total volume 12.5
This table provides the amplification setup, including reagent components, for Fusion 5C and Fusion 6C 25 μL and
12.5 μL reactions for extracted DNA and 12.5 μL reactions for direct amplification of storage card punches and swabs.
This table was adapted from the PowerPlex® Fusion Technical Manual, PowerPlex® Fusion 6C Technical Manual, and
the Virginia Department of Forensic Science Procedure Manual [1, 8, 14].
212 Caitlin McCaughan and Kristy A. Lenz

Table 2
PCR parameters for PowerPlex® Fusion 5C amplification

Extracted DNA amplification

Direct amplification
Full-volume Half-volume Half-volume
96 °C for 1 min 96 °C for 1 min 96 °C for 1 min
94 °C for 10 s 94 °C for 10 s 94 °C for 10 s
59 °C for 1 min 59 °C for 1 min 59 °C for 1 min
72 °C for 30 s 72 °C for 30 s 72 °C for 30 s
For 30 cycles, then: For 28 cycles, then: For 26 cycles, then:
60 °C for 10 min, then: 60 °C for 10 min, then: 60 °C for 20 min, then:
4 °C soak 4 °C soak 4 °C soak
Incorporated here are the PCR conditions optimized by the Promega Corporation (full-volume extracted DNA reactions
and half-volume direct amplification reactions) and the Virginia Department of Forensic Science (half-volume extracted
DNA reactions) using Fusion 5C. Ramp modes vary based on the thermal cycler. Use Max Mode if cycling on a
GeneAmp® PCR System 9700; use the 9700 Simulation Mode if cycling on a ProFlex® PCR System; use a ramping
rate of 100% if cycling on a Veriti® 96-Well Thermal Cycler [1, 14]

3. Calculate the number of reactions by adding the number of

samples, plus a positive and negative control. Table 1 provides
an example of amplification setup for a full-volume PCR reac-
tion (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 2 for a full-volume
extracted DNA amplification reaction (see Note 10).
5. Add the final volume of each reagent (excluding the Amplifica-
tion Grade Water, as volumes will differ based on quantity of
sample DNA) to a clean tube and vortex the PCR amplification
mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 10 μL of the PCR amplification
mix into each reaction well or tube for the number of samples,
including the positive and negative controls (see Note 12).
7. Add up to 15 μL of template DNA (targeting 0.25–0.5 ng
total) for each sample to its respective well or tube (see Note
13). Add Amplification Grade Water or TE-4 buffer to bring
the total volume of each well or tube to 25 μL.
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
0.1 ng/μL. Add 5 μL (0.5 ng) to its respective well or tube.
Add 10 μL of Amplification Grade Water or TE-4 buffer to
bring the total volume to 25 μL.
9. Prepare the negative amplification control by pipetting 15 μL
of either Amplification Grade Water or TE-4 buffer into its
respective well or tube (see Note 14).
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 213

10. Seal the plate or cap the tubes and place in the thermal cycler.
11. Run the protocol for a full-volume extracted DNA amplifica-
tion reaction (see Table 2). When complete, samples are ready
for electrophoretic detection or can be stored at -20 °C pro-
tected from light (see Note 15).

3.2 Amplification of 1. Completely thaw the PowerPlex® Fusion 5X Master Mix,

Extracted DNA Using PowerPlex® Fusion 5X Primer Pair Mix, and Amplification
PowerPlex® Fusion 5C Grade Water.
in a Half Reaction 2. Centrifuge tubes briefly to bring contents to the bottom and
Volume then vortex reagents for at least 15 s (see Note 8).
3. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of amplification setup for a half-volume PCR reac-
tion (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 2 for a half-volume
extracted DNA amplification reaction (see Note 10).
5. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 7.5 μL of the PCR amplification
mix into each reaction well or tube for the number of samples,
including the positive and negative controls (see Note 12).
7. Add 5 μL of template DNA (targeting 0.5 ng total) for each
sample to its respective well or tube (see Note 13).
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
0.1 ng/μL. Add 5 μL (0.5 ng) to its respective well or tube.
9. Prepare the negative amplification control by pipetting 5 μL of
either Amplification Grade Water or TE-4 buffer into its
respective well or tube (see Note 14).
10. Seal the plate or cap the tubes and place in the thermal cycler.
11. Run the protocol for a half-volume extracted DNA amplifica-
tion reaction (see Table 2 and Note 16). When complete,
samples are ready for electrophoretic detection or can be stored
at -20 °C protected from light (see Note 15).

3.3 Amplification of 1. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,

Extracted DNA Using PowerPlex® Fusion 6C 5X Primer Pair Mix, and Amplification
PowerPlex® Fusion 6C Grade Water for the first use. After the first use, components
in a Full Reaction should be stored at 2–10 °C (see Note 2).
Volume 2. Centrifuge tubes briefly to bring contents to the bottom and
then vortex reagents for at least 15 s (see Note 8).
214 Caitlin McCaughan and Kristy A. Lenz

Table 3
PCR parameters for PowerPlex® Fusion 6C amplification

Extracted DNA amplification

Direct amplification
Full-volume Half-volume Half-volume
96 °C for 1 min 96 °C for 1 min 96 °C for 1 min
96 °C for 5 s 96 °C for 5 s 96 °C for 5 s
60 °C for 1 min 60 °C for 1 min 60 °C for 1 min
For 29 cycles, then: For 28 cycles, then: For 25 cycles, then:
60 °C for 10 min, then: 60 °C for 10 min, then: 60 °C for 10 min, then:
4 °C soak 4 °C soak 4 °C soak
Incorporated here are the PCR conditions optimized by Promega Corporation (full-volume extracted DNA reactions
and half-volume direct amplification reactions) and in a study (half-volume extracted DNA reactions) using Fusion 6C.
Ramp modes vary based on the thermal cycler. Use Max Mode if cycling on a GeneAmp® PCR System 9700; use the
9700 Simulation Mode if cycling on a ProFlex® PCR System; use a ramping rate of 100% if cycling on a Veriti® 96-Well
Thermal Cycler [8, 15]

3. Calculate the number of reactions by adding the number of

samples, plus a positive and negative control. Table 1 provides
an example of amplification setup for a full-volume PCR reac-
tion (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 3 for a full-volume
extracted DNA amplification reaction (see Note 10).
5. Add the final volume of each reagent (excluding the Amplifica-
tion Grade Water, as volumes will differ based on quantity of
sample DNA) to a clean tube and vortex the PCR amplification
mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 10 μL of the PCR amplification
mix into each reaction well or tube for the number of samples,
including the positive and negative controls (see Note 12).
7. Add up to 15 μL of template DNA (targeting 1 ng total) for
each sample to its respective well or tube (see Note 13). Add
Amplification Grade Water or TE-4 buffer to bring the total
volume of each well or tube to 25 μL.
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a quantity of 0.1 ng/μ
L. Add 10 μL (1 ng) to its respective well or tube. Add 5 μL of
Amplification Grade Water or TE-4 buffer to bring the total
volume to 25 μL.
9. Prepare the negative amplification control by pipetting 15 μL
of either Amplification Grade Water or TE-4 buffer into its
respective well or tube (see Note 14).
10. Seal the plate or cap the tubes and place in the thermal cycler.
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 215

11. Run the protocol for a full-volume extracted DNA amplifica-

tion reaction (see Table 3). When complete, samples are ready
for electrophoretic detection or can be stored at -20 °C pro-
tected from light (see Note 15).

3.4 Amplification of 1. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,

Extracted DNA Using PowerPlex® Fusion 6C 5X Primer Pair Mix, and Amplification
PowerPlex® Fusion 6C Grade Water for the first use. After the first use, components
in a Half Reaction should be stored at 2–10 °C (see Note 2).
Volume 2. Centrifuge tubes briefly to bring contents to the bottom and
then vortex reagents for at least 15 s (see Note 8).
3. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of amplification setup for a half-volume PCR reac-
tion (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 3 for a half-volume
extracted DNA amplification reaction (see Note 10).
5. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 7.5 μL of the PCR amplification
mix into each reaction well or tube for the number of samples,
including the positive and negative controls (see Note 12).
7. Add 5 μL of template DNA (targeting 0.5–0.75 ng total) for
each sample to its respective well or tube (see Note 13).
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
0.1 ng/μL. Add 5 μL (0.5 ng) to its respective well or tube.
9. Prepare the negative amplification control by pipetting 5 μL of
either Amplification Grade Water or TE-4 buffer into its
respective well or tube (see Note 14).
10. Seal the plate or cap the tubes and place in the preheated
thermal cycler.
11. Run the protocol for a half-volume extracted DNA amplifica-
tion reaction (see Table 3 and Note 16). When complete,
samples are ready for electrophoretic detection or can be stored
at -20 °C protected from light (see Note 15).

3.5 Direct 1. Completely thaw the PowerPlex® Fusion 5X Master Mix,

Amplification of Lytic PowerPlex® Fusion 5X Primer Pair Mix, 5X AmpSolution™
Storage Cards Using Reagent, and Amplification Grade Water (see Note 17).
PowerPlex® Fusion 5C 2. Centrifuge tubes briefly to bring contents to the bottom and
in a Half Reaction then vortex reagents for 15 s before each use (see Note 8).
Volume
216 Caitlin McCaughan and Kristy A. Lenz

3. Calculate the number of reactions by adding the number of

samples, plus a positive and negative control. Table 1 provides
an example of direct amplification setup for a half-volume PCR
reaction (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 2 for a half-volume direct
amplification reaction (see Notes 10, 18, and 19).
5. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 12.5 μL of the PCR amplifica-
tion mix into each reaction well or tube for the number of
samples, including the positive and negative controls.
7. Add one 1.2 mm punch from a lytic storage card containing
buccal or blood cells (see Notes 20 and 21).
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
5 ng/μL. Add 1 μL (5 ng) to its respective well or tube (see
Notes 22 and 23).
9. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
10. Seal the plate or cap the tubes, and briefly centrifuge to bring
storage card punches to the bottom of the wells and remove
any air bubbles.
11. Place samples in the thermal cycler.
12. Run the protocol for a half-volume direct amplification reac-
tion (see Table 2 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

3.6 Direct 1. Completely thaw PunchSolution™ Reagent and mix by gentle

Amplification of inversion. After thawing, store at 2–10 °C.
Nonlytic Storage Cards 2. Place one 1.2 mm nonlytic storage card punch per sample into
Using PowerPlex® the wells of a labeled 0.2 mL 96-well reaction plate or labeled
Fusion 5C in a Half 0.2 mL reaction tubes.
Reaction Volume 3. Add 10 μL of PunchSolution™ Reagent to each 1.2 mm punch
(see Note 24).
4. Incubate the plate or tubes at 70 °C for 30 min or until wells
are dry (see Notes 25 and 26).
5. Completely thaw the PowerPlex® Fusion 5X Master Mix,
PowerPlex® Fusion 5X Primer Pair Mix, 5X AmpSolution™
Reagent, and Amplification Grade Water (see Note 17).
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 217

6. Centrifuge tubes briefly to bring contents to the bottom and

then vortex reagents for 15 s before each use (see Note 8).
7. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of direct amplification setup for a half-volume PCR
reaction (see Note 9).
8. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 2 for a half-volume direct
amplification reaction (see Notes 10, 18, and 19).
9. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
10. Pipette 12.5 μL of the PCR amplification mix into each reac-
tion well or tube containing samples, including the positive and
negative controls, changing pipette tips between each addition
of amplification mix to prevent cross-contamination.
11. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
5 ng/μL. Add 1 μL (5 ng) to its respective well or tube (see
Notes 22 and 23).
12. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
13. Seal the plate or cap the tubes, and briefly centrifuge to bring
storage card punches to the bottom of the wells and remove
any air bubbles.
14. Place samples in the thermal cycler.
15. Run the protocol for a half-volume direct amplification reac-
tion (see Table 2 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

3.7 Direct 1. Completely thaw SwabSolution™ Reagent in a 37 °C water bath

Amplification of and mix by gentle inversion. After thawing, store at 2–10 °C.
Swabs Using 2. Set a heat block capable of accepting 1.5 mL tubes to 70 °C.
PowerPlex® Fusion 5C The heat block must reach 70 °C prior to the incubation (see
in a Half Reaction Subheading 3.7, step 5; samples can also be processed in a
Volume deep-well plate (see Note 27)).
3. Place buccal swab head only in a 1.5 mL ClickFit (or other
locking cap) tube, discarding the swab handle.
4. Add 1 mL of SwabSolution™ Reagent to each buccal swab
head. Close the tube (see Note 28).
5. Incubate samples at 70 °C for 30 min (see Note 29).
218 Caitlin McCaughan and Kristy A. Lenz

6. Completely thaw the PowerPlex® Fusion 5X Master Mix,

PowerPlex® Fusion 5X Primer Pair Mix, and Amplification
Grade Water.
7. Centrifuge tubes briefly to bring contents to the bottom and
then vortex reagents for 15 s before each use (see Note 8).
8. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of direct amplification setup for a half-volume PCR
reaction (see Note 9).
9. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 2 for a half-volume direct
amplification reaction (see Notes 10, 18, and 19).
10. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
11. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 10.5 μL of the PCR amplifica-
tion mix into each reaction well or tube for the number of
samples, including the positive and negative controls.
12. Pipette 2 μL of swab extract for each sample into the appropri-
ate well of the reaction plate or appropriate reaction tube.
13. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
2.5 ng/μL. Add 2 μL (5 ng) to its respective well or tube (see
Note 22).
14. Prepare the negative amplification control by pipetting 2 μL of
Amplification Grade Water or TE-4 buffer into its respective
well or tube (see Note 30).
15. Seal the plate or cap the tubes, and briefly centrifuge to bring
contents to the bottom of the wells and remove any air
bubbles.
16. Place samples in the thermal cycler.
17. Run the protocol for a half-volume direct amplification reac-
tion (see Table 2 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

3.8 Direct 1. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,

Amplification of Lytic PowerPlex® Fusion 6C 5X Primer Pair Mix, 5X AmpSolu-
Storage Cards Using tion™ Reagent, and Amplification Grade Water (see Notes
PowerPlex® Fusion 6C 2 and 17).
in a Half Reaction 2. Centrifuge tubes briefly to bring contents to the bottom and
Volume then vortex reagents for 15 s before each use (see Note 8).
3. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 219

an example of direct amplification setup for a half-volume PCR

reaction (see Note 9).
4. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 3 for a half-volume direct
amplification reaction (see Notes 10 and 31).
5. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 12.5 μL of the PCR amplifica-
tion mix into each reaction well or tube for the number of
samples, including the positive and negative controls.
7. Add one 1.2 mm punch from a lytic storage card containing
buccal or blood cells (see Notes 20 and 21).
8. Prepare the positive amplification control by vortexing the
2800M Control DNA and adding 1 μL (10 ng) to its respective
well or tube (see Notes 22 and 23).
9. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
10. Seal the plate or cap the tubes, and briefly centrifuge to bring
storage card punches to the bottom of the wells and remove
any air bubbles.
11. Place samples in the preheated thermal cycler.
12. Run the protocol for a half-volume direct amplification reac-
tion (see Table 3 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

3.9 Direct 1. Completely thaw PunchSolution™ Reagent and mix by gentle

Amplification of inversion. After thawing, store at 2–10 °C.
Nonlytic Storage Cards 2. Place one 1.2 mm nonlytic storage card punch per sample into
Using PowerPlex® the wells of a labeled 0.2 mL 96-well reaction plate or labeled
Fusion 6C in a Half 0.2 mL reaction tubes.
Reaction Volume 3. Add 10 μL of PunchSolution™ Reagent to each 1.2 mm punch
(see Note 24).
4. Incubate the plate or tubes at 70 °C for 30 min or until wells
are dry (see Notes 25 and 26).
5. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,
PowerPlex® Fusion 6C 5X Primer Pair Mix, 5X AmpSolu-
tion™ Reagent, and Amplification Grade Water (see Notes
2 and 17).
220 Caitlin McCaughan and Kristy A. Lenz

6. Centrifuge tubes briefly to bring contents to the bottom and

then vortex reagents for 15 s before each use (see Note 8).
7. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of direct amplification setup for a half-volume PCR
reaction (see Note 9).
8. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 3 for a half-volume direct
amplification reaction (see Notes 10 and 31).
9. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
10. Pipette 12.5 μL of the PCR amplification mix into each reac-
tion well or tube containing samples, including the positive and
negative controls, changing pipette tips between each addition
of amplification mix to prevent cross-contamination.
11. Prepare the positive amplification control by vortexing the
2800M Control DNA and adding 1 μL (10 ng) to its respective
well or tube (see Notes 22 and 23).
12. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
13. Seal the plate or cap the tubes, and briefly centrifuge to bring
storage card punches to the bottom of the wells and remove
any air bubbles.
14. Place samples in the preheated thermal cycler.
15. Run the protocol for a half-volume direct amplification reac-
tion (see Table 3 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

3.10 Direct 1. Completely thaw SwabSolution™ Reagent in a 37 °C water bath

Amplification of and mix by gentle inversion. After thawing, store at 2–10 °C.
Swabs Using 2. Set a heat block capable of accepting 1.5 mL tubes to 70 °C.
PowerPlex® Fusion 6C The heat block must reach 70 °C prior to the incubation (see
in a Half Reaction Subheading 3.10, step 5; samples can also be processed in a
Volume deep-well plate (see Note 27)).
3. Place buccal swab head only in a 1.5 mL ClickFit (or other
locking cap) tube, discarding the swab handle.
4. Add 1 mL of SwabSolution™ Reagent to each buccal swab
head. Close the tube (see Note 28).
5. Incubate samples at 70 °C for 30 min (see Note 29).
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 221

6. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,

PowerPlex® Fusion 6C 5X Primer Pair Mix, and Amplification
Grade Water (see Note 2).
7. Centrifuge tubes briefly to bring contents to the bottom and
then vortex reagents for 15 s before each use (see Note 8).
8. Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides
an example of a direct amplification setup for a half-volume
PCR reaction (see Note 9).
9. Turn on the thermal cycler and ensure the amplification para-
meters are set up according to Table 3 for a half-volume direct
amplification reaction (see Notes 10 and 31).
10. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
11. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 10.5 μL of the PCR amplifica-
tion mix into each reaction well or tube for the number of
samples, including the positive and negative controls.
12. Pipette 2 μL of swab extract for each sample into the appropri-
ate well of the reaction plate or appropriate reaction tube.
13. Prepare the positive amplification control by vortexing the
2800M Control DNA and diluting to a concentration of
5 ng/μL. Add 2 μL (10 ng) to its respective well or tube (see
Note 22).
14. Prepare the negative amplification control by pipetting 2 μL of
Amplification Grade Water or TE-4 buffer into its respective
reaction well or tube (see Note 30).
15. Seal the plate or cap the tubes, and briefly centrifuge to bring
contents to the bottom of the wells and remove any air
bubbles.
16. Place samples in the preheated thermal cycler.
17. Run the protocol for a half-volume direct amplification reac-
tion (see Table 3 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at -20 °C
protected from light (see Note 15).

4 Notes

1. Store all Fusion 5C components in a freezer between -30 °C

and -10 °C with the exception of the 2800M Control DNA
and the WEN Internal Lane Standard 500. Ensure the 2800M
control DNA is stored at 2–10 °C at least 24 h prior to use and
do not refreeze after opening. The WEN Internal Lane
222 Caitlin McCaughan and Kristy A. Lenz

Standard 500 should also be stored at 2–10 °C after first use.

Optionally, all Fusion 5C components may be stored for up to
1 year at 2–10 °C. Do not store reagents in the refrigerator
door, where the temperature can fluctuate. Storing reagents in
the refrigerator door can compromise stability. The Primer Pair
Mix, Allelic Ladder Mix, and WEN ILS 500 are light-sensitive
and must be stored in the dark. It is best to store
pre-amplification and post-amplification components
separately.
2. Store all Fusion 6C components in a freezer between -30 °C
and -10 °C initially. All components should be stored at
2–10 °C after first use and will remain stable for approximately
6 months. Ensure the 2800M Control DNA is stored at
2–10 °C at least 24 h prior to use. Do not store reagents in
the refrigerator door, where the temperature can fluctuate.
Storing reagents in the refrigerator door can compromise sta-
bility. The Primer Pair Mix, Allelic Ladder Mix, and WEN ILS
500 are light-sensitive and must be stored in the dark. It is best
to store pre-amplification and post-amplification components
separately.
3. If the DNA template is stored in TE buffer that is not pH 8.0
or contains a higher EDTA concentration, the volume of DNA
added should not exceed 20% of the final reaction volume.
PCR amplification efficiency and quality can be greatly altered
by changes in pH (due to added Tris-HCl), available magne-
sium concentration (due to chelation by EDTA) or other PCR
inhibitors, which may be present at low concentrations
depending on the source of the template DNA and the extrac-
tion procedure used.
4. Other thermal cyclers may be compatible with the PowerPlex®
Fusion Systems, and an internal validation can determine if
another is suitable. An aluminum block is not recommended
for use because the material is not compatible with the recom-
mended Max Mode for ramping.
5. PCR amplification is a very sensitive technique that can be
contaminated by extraneous sources of DNA. Proper personal
protective equipment (PPE) is highly recommended, including
disposable gloves, lab coats, and face masks. Additionally,
aerosol-resistant pipette tips are encouraged to prevent con-
tamination of the pipette shaft that can occur due to aerosols
generated during aspiration of the liquid. Contamination
events have also been limited by the use of separate pre- and
post-amplification setup areas.
6. Lytic storage card sample types include buccal cells collected
with swabs or Whatman EasiCollect™ devices transferred to
DNA Amplification Using Promega’s PowerPlex® Fusion Systems 223

FTA® or FTA® Indicating Cards, or liquid blood spotted onto

FTA® Cards.
7. Nonlytic storage card sample types include buccal samples on
Bode Buccal DNA Collector™ devices and blood or buccal
samples on Whatman® 903 cards or other nonlytic storage
cards.
8. Do not centrifuge Primer Pair Mix and Master Mix after vor-
texing, as the heavier components of the mixes may settle to the
bottom and not distribute evenly.
9. When calculating the volume of reagent for the number of
samples, always include extra samples in the calculations to
account for pipetting errors. We have had success in including
two (2) extra samples in the calculation per every ten.
10. Turning the thermal cycler on prior to amplification setup
allows the instrument to warm up and the lid to heat, enabling
startup of the protocol as soon as samples are in place.
11. Failure to vortex the PCR amplification mix sufficiently can
result in poor amplification or locus-to-locus imbalance.
12. We have had success in limiting the number of PCR artifacts
detected during electrophoretic separation by utilizing a PCR
cooler to prepare PCR reactions. An alternative to an ice bath, a
PCR cooler will keep samples cold during PCR setup. The risk
of contamination is lessened with a dry incubation method.
13. To limit possible DNA transfer from tube top to tube top,
utilize a clean Kimwipe (or similar delicate task wiper) to open
each tube containing DNA.
14. The negative control should always be prepared last and capped
last, as the purpose of this control is to determine if contami-
nation was introduced during PCR setup.
15. Long-term storage of amplified samples at 4 °C or higher may
produce artifacts.
16. The thermal cycler may prompt the user to enter total sample
volume and decimal numbers may not be possible. If so, enter
13 μL as total sample volume.
17. The 5X AmpSolution™ Reagent should be thawed completely,
mixed by vortexing and stored at 2–10 °C. The reagent may be
turbid after thawing or storage at 2–10 °C. If this occurs, warm
the buffer briefly at 37 °C and then vortex until clear.
18. Testing at Promega shows 26 cycles work well for a variety of
sample types used for direct amplification. Cycle number opti-
mization is recommended to get the most desirable results for
the sample types tested. To optimize the cycle number, choose
several samples that represent typical sample types encountered
in the laboratory and prepare according to the laboratory’s
224 Caitlin McCaughan and Kristy A. Lenz

workflow. Prepare three identical reaction plates using the same

samples. Amplify samples using the provided thermal cycling
protocol but subject each plate to a different cycle number (for
example, 25, 26, and 27 cycles). Following amplification, use
your laboratory’s validated separation and detection protocols
to determine the optimal cycle number for the sample type.
19. The final extension for direct amplification is 20 min compared
to 10 min for the extracted DNA protocol to allow sufficient
time for adenylation of large amounts of amplicon, reducing
the appearance of N–1 artifact peaks.
20. The lytic storage card punch can be added to the reaction plate
or tubes prior to the PCR amplification mix. The order of
adding storage card punches and PCR amplification mix to a
tube or well is interchangeable and can depend on the pre-
ferred workflow of the laboratory. Adding storage card
punches to empty wells can result in issues with static
electricity.
21. Lytic storage card punches can also be treated with PunchSo-
lution™ Reagent if poor amplification results are obtained
following the protocol for lytic storage cards. If cells are not
lysed when deposited on the lytic storage card, additional lysis
is required to release sufficient DNA for successful
amplification.
22. The mass of 2800M should be adjusted depending on the
number of amplification cycles used. The mass of DNA should
be reduced if the cycle number is increased and increased if the
cycle number is decreased. Increase or decrease the mass of
2800M Control DNA by two-fold for every one-cycle decrease
or increase, respectively.
23. Do not include blank storage card punches in the positive
control reactions.
24. Though it is preferred to add punches to the plate first, adding
punches to empty wells can be problematic. Adding PunchSo-
lution™ Reagent to the well before adding the punch is accept-
able and may help alleviate static problems.
25. Do not cover the plate with a lid or sealer or place the plate in a
thermal cycler with a closed, heated lid. A closed, heated lid will
prevent evaporation, even with an open plate. If using a ther-
mal cycler with a heated lid, leave the lid open to allow efficient
evaporation.
26. Incubation for the full 30 min is recommended to ensure
complete evaporation. Shorter incubation times may result in
poor performance caused by PunchSolution™ Reagent
carryover.
27. Place the heat block adapter on a heat block that is set to 90 °C.
The adapter sits on top of the heat block and allows efficient
 DNA Amplification Using Promega’s PowerPlex® Fusion Systems 225

heat transfer to the plate. The heat block must reach 90 °C

prior to the incubation. Place each buccal swab head in an
empty well of a deep-well plate. Add 1 mL of SwabSolution™
Reagent to each buccal swab head. Place the deep-well plate on
the preheated heat block adapter. You do not need to seal the
plate.
28. It is not necessary to vortex samples after adding SwabSolu-
tion™ Reagent prior to incubation or after the 30-min incu-
bation is complete.
29. Buccal swab extracts may be stored at 4 °C for 4 years.
30. Additional negative controls can be included. Assemble a reac-
tion containing the swab extract prepared from a blank swab or
assemble a reaction where the SwabSolution™ Reagent is pro-
cessed as a blank without a swab.
31. Testing at Promega shows 25 cycles work well for a variety of
sample types used for direct amplification. Cycle number opti-
mization is recommended to get the most desirable results for
the sample types tested. To optimize the cycle number, choose
several samples that represent typical sample types encountered
in the laboratory and prepare according to the laboratory’s
workflow. Prepare three identical reaction plates using the
same samples. Amplify samples using the provided thermal
cycling protocol but subject each plate to a different cycle
number (for example, 24, 25, and 26 cycles). Following ampli-
fication, use your laboratory’s validated separation and detec-
tion protocols to determine the optimal cycle number for the
sample type.

References
1. Promega Corporation (2017) PowerPlex® loci and the European Standard Set loci. J
Fusion System for use on the Applied Biosys- Forensic Leg Med 52:16–23. https://doi.
tems™ Genetic Analyzers technical manual. org/10.1016/j.jflm.2017.07.017
Available via Promega. https://www.promega. 5. Hares DR (2015) Selection and implementa-
com/~/media/files/resources/protocols/ tion of expanded CODIS core loci in the
technical%20manuals/101/powerplex%20 United States. Forensic Sci Int Genet 17:33–
fusion%20system%20protocol.pdf. Accessed 34. https://doi.org/10.1016/j.fsigen.2015.
04 Apr 2022 03.006
2. Panneerchelvam S, Norazmi MN (2003) 6. Oostdik K, Lenz K, Nye J et al (2014) Devel-
Forensic DNA profiling and database. Malays opmental validation of the PowerPlex® Fusion
J Med Sci 10(2):20–26 System for analysis of casework and reference
3. Budowle B, Moretti TR, Baumstark AL et al samples: a 24-locus multiplex for new database
(1999) Population data on the thirteen standards. Forensic Sci Int Genet 12:69–76.
CODIS core short tandem repeat loci in Afri- https://doi.org/10.1016/j.fsigen.2014.
can Americans, US Caucasians, Hispanics, 04.013
Bahamians, Jamaicans, and Trinidadians. J 7. Promega Corporation (2022) STR amplifica-
Forensic Sci 44(6):1277–1286 tion. Available via Promega. https://www.
4. Tan JYY, Tan YP, Ng S et al (2017) A prelimi- promega.com/products/forensic-dna-analy
nary evaluation study of new generation multi- sis-ce/str-amplification/ Accessed
plex STR kits comprising of the CODIS core 30 Apr 2022
226 Caitlin McCaughan and Kristy A. Lenz

8. Promega Corporation (2015) PowerPlex® 12. Promega Corporation (2016) PunchSolu-

Fusion 6C System for use on the Applied Bio- tion™ Kit technical manual. Available via Pro-
systems® Genetic Analyzers technical manual. mega. https://www.promega.com/resources/
Available via Promega. https://www.promega. protocols/technical-manuals/101/
com/~/media/files/resources/protocols/ punchsolution-kit-protocol/. Accessed
technical%20manuals/101/powerplex%20 16 Apr 2022
fusion%206c%20system%20protocol.pdf. 13. Promega Corporation (2016) SwabSolution™
Accessed 04 Apr 2022 Kit technical manual. Available via Promega.
9. Ensenberger MG, Lenz KA, Matthies LK et al https://www.promega.com/resources/
(2016) Developmental validation of the protocols/technical-manuals/101/
PowerPlex® Fusion 6C System. Forensic Sci swabsolution-kit-protocol/. Accessed
Int Genet 21:134–144. https://doi.org/10. 16 Apr 2022
1016/j.fsigen.2015.12.011 14. Virginia Department of Forensic Science
10. Pfoser K, Owen S (2013) Evaluation of the (2020) Forensic biology procedures manual
PowerPlex® Fusion System for use on the ABI 210-D2007. PowerPlex® Fusion amplification
PRISM® 310 Genetic Analyzer. Promega Cor- and long term storage. Available via Virginia
poration. https://www.promega.com/res Department of Forensic Science. https://
ources/profiles-in-dna/2013/evaluation-of- w w w. d f s . v i r g i n i a . g o v / w p - c o n t e n t /
the-powerplex-fusion-system-for-use-on-the- uploads/2020/07/210-D2007-FB-PM-PP-
abi-prism-310-genetic-analyzer/. Accessed FUSION-Amp-and-Storage.pdf. Accessed
04 Apr 2022 04 Apr 2022
11. Cisana C, Cerri N, Bosetti A et al (2017) 15. McCaughan CM (2021) PowerPlex® Fusion
PowerPlex® Fusion 6C System: evaluation 6C System versus PowerPlex® Fusion 5C: a
study for analysis of casework and database comparison of performance metrics. Thesis,
samples. Croat Med J 58:26–33. https://doi. Virginia Commonwealth University
org/10.3325/cmj.2017.58.26
 Chapter 14

Amplification of Extracted DNA and Direct Amplification

with the PowerPlex® Y23 System
Jonelle M. Thompson

Abstract
The PowerPlex® Y23 System offered by Promega Corporation contains 23 Y-STR loci (DYS19, DYS385a/
b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456,
DYS458, DYS481, DYS533, DYS549, DYS570, DYS576, DYS635, DYS643, and Y-GATA-H4). The
PowerPlex® Y23 System is designed to amplify DNA from purified extracts as well as direct amplification
from substrates used to collect database samples (e.g., swabs and storage cards). Protocols are provided for
full-volume reactions for DNA extracts, as well as half-volume reactions for direct amplifications from
different substrates.

Key words PowerPlex® Y23, DNA typing, Short tandem repeat (STR), Y-STR, Polymerase chain
reaction (PCR), Direct amplification

1 Introduction

The PowerPlex® Y23 System is made up of STR (short tandem

repeat) loci that are specific to the Y chromosome. STR loci consist
of repetitive sequence elements 3–7 base pairs in length [1–
4]. These areas of the human genome are highly polymorphic and
can be detected using polymerase chain reaction (PCR) [5–
9]. Alleles of STR loci are differentiated by the number of copies
of the repeat sequence contained within the amplified region. STR
markers on the Y chromosome (Y-STR) have qualities that are
distinct from autosomal markers and are useful for human identifi-
cation [10–16]. Y-STR markers are found on the non-recombining
region of the Y chromosome (NRY) and produce a haploid profile
when amplified from male DNA. This quality simplifies male/
female mixture interpretation by removing the female contribution
from a DNA profile [17, 18].
The PowerPlex® Y23 System is a 5-dye system. The blue (fluo-
rescein) channel consists of DYS576, DYS389I, DYS448,

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_14,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

227
228 Jonelle M. Thompson

DYS389II, and DYS19. The green (JOE) channel consists of

DYS391, DYS481, DYS549, DYS533, DYS438, and DYS437.
The yellow (TMR-ET) channel consists of DYS570, DYS635,
DYS390, DYS439, DYS392, and DYS643. DYS393, DYS458,
DYS385a/b, DYS456 and Y-GATA-H4 are in the red (CXR-ET)
channel [19, 20]. Fragments included in the internal lane standard
are detected in the orange channel and are labeled with WEN
(WEN Internal Lane Standard 500 Y23) (see Fig. 1).
The PowerPlex® Y23 buffer was optimized for amplification of
extracted DNA samples and can accommodate direct amplification
from a variety of substrates, including blood and buccal samples on
lytic and nonlytic storage cards, as well as samples collected on
swabs [21, 22].

2 Materials

2.1 Materials 1. PowerPlex® Y23 System: Pre-amplification reagents include

Necessary for All PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X Primer
Amplification Pair Mix, 2800M Control DNA (10 ng/μL), and Amplifica-
Protocols tion Grade Water; post-amplification reagents include Power-
Plex® Y23 Allelic Ladder Mix and WEN Internal Lane
Standard 500 Y23 (see Note 1).
2. Stabilizer Reagent: Post-amplification reagent.
3. PowerPlex® 5C Matrix Standard: Post-amplification reagent.
4. Thermal cycler: GeneAmp® PCR System 9700 with a gold-
plated or silver sample block, or ProFlex® PCR System.
5. Centrifuge compatible with 96-well plates or PCR tubes.
6. Microcentrifuge tubes: Non-stick, RNAse-free, 1.5 mL.
7. 96-well reaction plate (see Note 2) or PCR tubes.

Fig. 1 PowerPlex® Y23 System Layout. PowerPlex Y23 allows the co-amplification and four-color detection of
23 loci. (Reproduced from Ref. [23] with permission from the Promega Corporation)
 DNA Amplification Using Promega’s PowerPlex® Y23 System 229

8. 8-cap strips (see Note 2) or foil seal.

9. TE-4 Buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0. To
prepare TE-4 buffer, mix together 10 mL of 1 M Tris-HCl
(pH 8.0), 0.2 mL of 0.5 M EDTA (pH 8.0), and 990 mL of
deionized water. Alternatively, dissolve 1.21 g Tris base and
0.037 g EDTA (Na2EDTA • 2H2O) in 900 mL of deionized
water. Adjust to pH 8.0 with HCl. Bring the final volume to
1 L with deionized water. Autoclave after combining all
components.
10. 95 °C dry heating block, water bath, or thermal cycler for post
PCR.

2.2 Direct 1. 5X AmpSolution™ Reagent: Pre-amplification reagent.

Amplification of Lytic 2. 1.2 mm punching tool: 1.2 mm Harris Uni-core Punch (or e-
Storage Cards (see quivalent manual) punch and cutting mat.
Note 3)

2.3 Direct 1. PunchSolution™ Reagent: Pre-amplification reagent.

Amplification of 2. 5X AmpSolution™ Reagent: Pre-amplification reagent.
Nonlytic Storage Cards
3. 1.2 mm punching tool: 1.2 mm Harris Uni-core Punch (or e-
(see Note 4)
quivalent manual punch) and cutting mat.
4. Heat block: Needs insert capable of accepting 96-well plate, or
a 96-well thermal cycler can be used. Must be in the
pre-amplification room. Set to 70 °C.

2.4 Direct 1. SwabSolution™ Reagent: Pre-amplification reagent.

Amplification of 2. Microcentrifuge tubes or deep-well plate: 1.5 mL ClickFit
Swabs Microtube or other 1.5 mL microcentrifuge tube with locking
cap or screw top; or 2.2 mL, square, deep, 96-well plate.
3. Heat block: Set to 70 °C for 1.5 mL tubes or 90 °C for a deep-
well plate. An adapter is required for use with the 96-well plate
(see Note 5).

3 Methods

Prior to starting the amplification setup, ensure all proper personal

protective equipment is available. The use of gloves and aerosol-
resistant pipette tips are highly recommended to prevent cross-
contamination. In addition, keep all pre-amplification and post-
amplification reagents in separate rooms, and prepare amplification
reactions in a room with dedicated equipment, supplies, and space
for amplification reaction setup. Do not store reagents in the refrig-
erator door where the temperature can fluctuate, as this can com-
promise stability.
230 Jonelle M. Thompson

Table 1
Reaction mix setup

Volume per reaction

PCR amplification Extracted DNA Direct amplification of lytic and Direct amplification
mix component amplification non-lytic storage cards from swabs
Amplification Grade Up to 17.5 μL 6.25 μL 6.75 μL
Water
PowerPlex® Y23 5X 5.0 μL 2.5 μL 2.5 μL
Master Mix
PowerPlex® Y23 10X 2.5 μL 1.25 μL 1.25 μL
Primer Mix
5X AmpSolution™ N/A 2.5 μL N/A
Reagent
Total reaction 25.0 μL 12.5 μL 12.5 μL
volume
Full reactions are used for amplification of extracted DNA, while half reactions are used for the various direct amplifica-
tions. The reaction mix is prepared by combining the Amplification Grade Water, PowerPlex® Y23 5X Master Mix, and
the PowerPlex® Y23 10X Primer Mix. The volume of amplification grade water is dependent on the volume of DNA
extract desired. The total volume of water and DNA extract will be 17.5 μL to bring the total reaction for extracted DNA
to 25 μL. Direct amplification of swabs also requires the addition of 2 μL of SwabSolution™ extract

3.1 Amplification of 1. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23
Extracted DNA 10X Primer Pair Mix, and Amplification Grade Water
completely.
2. Use a clean 96-well reaction plate and label it appropriately, for
example, with the experiment name, date, and your initials.
PCR tubes can also be used.
3. Centrifuge reagent tubes briefly to bring contents to the bot-
tom and then vortex for 15 s before each use (see Note 6).
4. Determine the number of reactions to be set up. This should
include positive and negative control reactions (see Note 7).
5. Calculate the final volumes needed for each reagent (see
Table 1).
6. Assemble the PCR amplification reaction mix using the final
volume of each reagent. Add Amplification Grade Water to the
1.5 mL tube first, followed by PowerPlex® Y23 5X Master Mix
and PowerPlex® Y23 10X Primer Pair Mix (see Note 8).
7. Vortex the PCR amplification mix for 5–10 s and then pipette
the PCR amplification mix into each reaction well or PCR tube
(see Note 9).
8. Add 0.5 ng template DNA for each sample to the respective
well or tube containing PCR amplification mix (see Notes 10
and 11).
 DNA Amplification Using Promega’s PowerPlex® Y23 System 231

Table 2
Amplification cycling parameters

Extracted DNA amplification Direct amplification

(full reaction) (half reaction)
96 °C for 2 min, then: 96 °C for 2 min, then:
94 °C for 10 s 94 °C for 10 s
61 °C for 1 min 61 °C for 1 min
72 °C for 30 s 72 °C for 30 s
For 30 cycles, then: For 25 cycles, then:
60 °C for 20 min 60 °C for 20 min
4 °C soak 4 °C soak
Cycling parameters for both extracted DNA full volume reactions and direct amplifica-
tion half reactions are the same except for the number of cycles

9. For the positive amplification control, vortex the tube of

2800M Control DNA and then dilute an aliquot to 0.5 ng in
the desired template DNA volume.
10. Add desired volume of the diluted 2800M DNA to a reaction
well or tube containing PCR amplification mix.
11. For the negative amplification control, pipette Amplification
Grade Water or TE-4 buffer instead of template DNA into a
reaction well or tube containing PCR amplification mix.
12. Seal or cap the reaction plate or PCR tubes (see Note 12).
13. Briefly centrifuge the plate or PCR tubes to bring contents to
the bottom of the wells (see Note 13).
14. Place the reaction plate or PCR tubes in the thermal cycler.
15. Run the recommended protocol for amplification of extracted
DNA (see Table 2). Adjustments to the ramp rates are needed
for different thermal cycler models (see Note 14).
16. After completion of the thermal cycling protocol, proceed with
fragment analysis or store amplified samples at -20 °C pro-
tected from light (see Notes 15 and 16).

3.2 Direct 1. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23
Amplification of Lytic 10X Primer Pair Mix, 5X AmpSolution™ Reagent, and Ampli-
Storage Cards Using fication Grade Water completely (see Note 17).
Half Reaction Volume 2. Use a clean 96-well reaction plate and label it appropriately, for
example, with the experiment name, date, and your initials.
PCR tubes can also be used.
3. Centrifuge reagent tubes briefly to bring contents to the bot-
tom and then vortex for 15 s before each use (see Note 6).
232 Jonelle M. Thompson

4. Determine the number of reactions to be set up. This should

include positive and negative control reactions (see Note 7).
5. Calculate the final volumes needed for each reagent (see
Table 1).
6. Assemble the PCR amplification reaction mix using the final
volume of each reagent. Add Amplification Grade Water to the
1.5 mL tube first, and then add PowerPlex® Y23 5X Master
Mix, PowerPlex® Y23 10X Primer Pair Mix, and 5X AmpSolu-
tion™ Reagent (see Note 8).
7. Vortex the PCR amplification mix for 5–10 s and then pipette
12.5 μL of PCR amplification mix into each reaction well or
PCR tube (see Note 9).
8. Add one 1.2 mm punch from a lytic storage card containing
buccal or blood cells to the respective well or tube containing
PCR amplification mix (see Note 18).
9. For the positive amplification control, vortex the tube of
2800M Control DNA and then dilute an aliquot to 5 ng/μL
(see Notes 19 and 20).
10. Add 1 μL (5 ng) of the 2800M Control DNA to a reaction well
or tube containing 12.5 μL of PCR amplification mix.
11. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
12. Seal or cap the reaction plate or PCR tubes (see Note 12).
13. Briefly centrifuge the plate or PCR tubes to bring storage card
punches to the bottom of the wells (see Note 13).
14. Place the reaction plate or PCR tubes in the thermal cycler (see
Note 21).
15. Run the recommended protocol for direct amplification of lytic
storage cards (see Table 2). Adjustments to the ramp rates are
needed for different thermal cycler models (see Note 14).
16. After completion of the thermal cycling protocol, proceed with
fragment analysis or store amplified samples at -20 °C pro-
tected from light (see Notes 15 and 16).

3.3 Direct 1. Thaw PunchSolution™ Reagent (see Note 22).

Amplification of 2. Use a clean 96-well reaction plate and label it appropriately, for
Nonlytic Storage Cards example, with the experiment name, date, and your initials.
PCR tubes can also be used.
3. Place one 1.2 mm nonlytic storage card punch per sample into
a well of the 96-well reaction plate or PCR tube.
4. Add 10 μL of PunchSolution™ Reagent to each 1.2 mm punch
(see Note 23).
 DNA Amplification Using Promega’s PowerPlex® Y23 System 233

5. Incubate plate at 70 °C for 30 min or until wells are dry (see

Notes 24 and 25).
6. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23
10X Primer Pair Mix, 5X AmpSolution™ Reagent, and Ampli-
fication Grade Water completely (see Note 17).
7. Centrifuge reagent tubes briefly to bring contents to the bot-
tom and then vortex for 15 s before each use (see Note 6).
8. Determine the number of reactions to be set up. This should
include positive and negative control reactions (see Note 7).
9. Calculate the final volumes needed for each reagent (see
Table 1).
10. Assemble the PCR amplification reaction mix using the final
volume of each reagent. Add Amplification Grade Water to the
tube 1.5 mL first, and then add PowerPlex® Y23 5X Master
Mix, PowerPlex® Y23 10X Primer Pair Mix, and 5X AmpSolu-
tion™ Reagent (see Note 8).
11. Vortex the PCR amplification mix for 5–10 s and then pipette
12.5 μL of PCR amplification mix into each reaction well or
PCR tube (see Note 9).
12. Change pipette tips between each addition of amplification mix
to prevent cross-contamination.
13. For the positive amplification control, vortex the tube of
2800M Control DNA and then dilute an aliquot to 5 ng/μL
(see Notes 19 and 20).
14. Add 1 μL (5 ng) of the 2800M Control DNA to a reaction well
or tube containing 12.5 μL of PCR amplification mix.
15. Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control
with a blank punch may be performed to detect contamination
from the storage card or punch device.
16. Seal or cap the reaction plate or PCR tubes (see Note 12).
17. Briefly centrifuge the plate or PCR tubes to bring storage card
punches to the bottom of the wells (see Note 13).
18. Place the reaction plate or PCR tubes in the thermal cycler (see
Note 21).
19. Run the recommended protocol for direct amplification of
nonlytic storage cards (see Table 2). Adjustments to the ramp
rates are needed for different thermal cycler models (see Note
14).
20. After completion of the thermal cycling protocol, proceed with
fragment analysis or store amplified samples at -20 °C pro-
tected from light (see Notes 15 and 16).
234 Jonelle M. Thompson

3.4 Direct 1. Thaw SwabSolution™ in a 37 °C water bath and mix by gentle

Amplification of inversion (see Note 26).
Swabs 2. Set a heat block capable of accepting 1.5 mL tubes to 70 °C.
The heat block must reach 70 °C prior to the incubation step
(samples can also be processed in a deep-well plate; see Note
27).
3. Place buccal swab head in a 1.5 mL tube.
4. Add 1 mL of SwabSolution™ Reagent to each buccal swab
head. Close the tube (see Note 28).
5. Incubate samples for 30 min (see Note 29).
6. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23
10X Primer Pair Mix, and Amplification Grade Water
completely.
7. Centrifuge reagent tubes briefly to bring contents to the bot-
tom and then vortex for 15 s before each use (see Note 6).
8. Use a clean 96-well reaction plate and label it appropriately. For
example, the experiment name, date, and your initials. PCR
tubes can also be used.
9. Determine the number of reactions to be set up. This should
include positive and negative control reactions (see Note 7).
10. Calculate the final volumes needed for each reagent (see
Table 1).
11. Assemble the PCR amplification reaction mix using the final
volume of each reagent. Add Amplification Grade Water to the
1.5 mL tube first, followed by PowerPlex® Y23 5X Master Mix
and PowerPlex® Y23 10X Primer Pair Mix (see Note 8).
12. Vortex the PCR amplification mix for 5–10 s and then pipette
10.5 μL of PCR amplification mix into each reaction well or
tube (see Note 9).
13. Pipette 2 μL of swab extract for each sample into the appropri-
ate well of the reaction plate or PCR tube.
14. For the positive amplification control, vortex the tube of
2800M Control DNA and then dilute an aliquot to 2.5 ng/μ
L (see Note 19).
15. Add 2 μL (5 ng) of the diluted 2800M to a reaction well or
tube containing 10.5 μL of PCR amplification mix.
16. For the negative amplification control, pipette 2 μL of Ampli-
fication Grade Water or TE-4 buffer instead of swab extract
into a reaction well or tube containing PCR amplification mix
(see Note 30).
17. Seal or cap the reaction plate or PCR tubes (see Note 12).
18. Briefly centrifuge the plate to bring contents to the bottom of
the wells (see Note 13).
 DNA Amplification Using Promega’s PowerPlex® Y23 System 235

19. Place the reaction plate or PCR tubes in the thermal cycler (see
Note 21).
20. Run the recommended protocol for direct amplification of
swabs (see Table 2). Adjustments to the ramp rates are needed
for different thermal cycler models (see Note 14).
21. After completion of the thermal cycling protocol, proceed with
fragment analysis or store amplified samples at -20 °C pro-
tected from light (see Notes 15 and 16).

4 Notes

1. Store all components in a freezer between -30 °C to -10 °C in

a non-frost-free freezer upon receipt. Ensure that the 2800M is
stored at 2–10 °C for 24 h prior to use. The Primer Pair Mix,
Allelic Ladder Mix, and WEN ILS 500 are light-sensitive and
must be stored in the dark. All components may be stored for
up to 1 year at 2–10 °C after the initial thaw. Do not refreeze
the WEN ILS 500 Y23.
2. MicroAmp® from Applied Biosystems is recommended.
3. Lytic storage card sample types include buccal cells collected
with swabs or Whatman EasiCollect™ devices transferred to
FTA® or FTA® Indicating Cards, or liquid blood spotted onto
FTA® Cards.
4. Nonlytic storage card sample types include buccal samples on
Bode Buccal DNA Collector™ devices and blood or buccal
samples on Whatman™ 903 cards or other nonlytic storage
cards.
5. The heat block adapter will be needed if processing buccal
swabs in a deep-well plate. The heat block adapter sits on top
of the heat block and allows efficient heat transfer to the plate.
6. Do not centrifuge the 10X Primer Pair Mix or 5X Master Mix
after vortexing, as this may cause the reagents to be concen-
trated at the bottom of the tube.
7. Add 10–15% to the reaction number to compensate for pipet-
ting error. While this approach does consume a small amount
of each reagent, it ensures that you will have enough PCR
amplification mix for all samples. It also ensures that each
reaction contains the same PCR amplification mix.
8. Do not store the PCR amplification mix for a prolonged
period. Add the mix to the wells of the reaction plate or PCR
tubes as soon as the mix is prepared. Add DNA as soon as
possible to each well or PCR tube and follow immediately by
thermal cycling.
236 Jonelle M. Thompson

9. Failure to vortex the PCR amplification mix sufficiently can

result in poor amplification, including locus-to-locus
imbalance.
10. Store DNA templates in TE-4 buffer. If the DNA template is
stored in TE-4 buffer that is not pH 8.0 or contains a higher
EDTA concentration, the volume of DNA added should not
exceed 20% of the final reaction volume. PCR amplification
efficiency and quality can be greatly altered by changes in pH
(due to added Tris–HCl), available magnesium concentration
(due to chelation by EDTA), or other PCR inhibitors, which
may be present at low concentrations depending on the source
of the template DNA and the extraction procedure used.
11. Apparent DNA concentrations can differ, depending on the
DNA quantification method used. Perform experiments to
determine the optimal DNA amount based on your DNA
quantification method and internal validation.
12. Seal or cap the reaction plate or PCR tubes to prevent evapora-
tion. Excessive evaporation changes the concentration of PCR
components in the reaction which can negatively impact ampli-
fication of some or all loci.
13. Briefly centrifuge the plate or PCR tubes to ensure all reaction
components are at the bottom of the tube and remove any air
bubbles that may have formed at the bottom of the tube. This
ensures the DNA is fully accessible to PCR components.
14. Ramp modes vary based on thermal cycler. Use Max Mode if
cycling on a GeneAmp® PCR System 9700; use the 9700
Simulation Mode if cycling on a ProFlex® PCR System.
15. Long-term storage of amplified samples at 4 °C or higher may
produce artifacts.
16. Following amplification and setup for running on the capillary
electrophoresis (CE) instrument, the CE plate should be pro-
cessed soon. If the CE plate will not be injected immediately,
we strongly recommend including Stabilizer Reagent in the
loading cocktail and injecting the samples within 48 h. Omit-
ting Stabilizer Reagent from the loading cocktail may result in
loss of signal in the amplified samples.
17. The 5X AmpSolution™ Reagent should be thawed completely,
mixed by vortexing and stored at 2–10 °C. The reagent may be
turbid after thawing or storage at 2–10 °C. If this occurs, warm
the buffer briefly at 37 °C and then vortex until clear.
18. The lytic storage card punch can be added to the reaction plate
prior to the PCR amplification mix. This may result in static
electricity issues depending on the environmental conditions in
the laboratory.
 DNA Amplification Using Promega’s PowerPlex® Y23 System 237

19. The mass of 2800M should be adjusted depending on the

number of amplification cycles used. This mass of DNA should
be reduced if the cycle number is increased and increased if the
cycle number is decreased. Increase or decrease the mass of
2800M Control DNA by two-fold for every one-cycle decrease
or increase, respectively.
20. Do not include blank storage card punches in the positive
control reactions.
21. Testing at Promega shows 25 cycles work well for a variety of
sample types used for direct amplification. Cycle number opti-
mization is recommended to get the most desirable results for
the sample types tested. To optimize the cycle number, choose
several samples that represent typical sample types encountered
in the laboratory and prepare according to the laboratory’s
workflow. Prepare three identical reaction plates using the
same samples. Amplify samples using the provided thermal
cycling protocol but subject each plate to a different cycle
number (for example, 24, 25, and 26 cycles). Following ampli-
fication, use your laboratory’s validated separation and detec-
tion protocols to determine the optimal cycle number for the
sample type.
22. After initial thawing of PunchSolution™ Reagent, store at
2–10 °C.
23. In this protocol, the punch is added to the empty well and then
the PunchSolution™ Reagent is added. Though it is preferred
to add punches to the plate first, doing so can be problematic.
Adding PunchSolution™ Reagent to the well before adding
the punch is acceptable and may help alleviate static problems.
24. Do not cover the plate with a lid or sealer or place the plate in a
thermal cycler with a closed, heated lid. A closed, heated lid will
prevent evaporation, even with an open plate. If you use a
thermal cycler with a heated lid, leave the lid open to allow
efficient evaporation.
25. Promega strongly recommends incubating for the full 30 min.
Shorter incubation times may result in poor performance.
26. After initial thawing of SwabSolution™ Reagent, store at
2–10 °C.
27. Place the heat block adapter on a heat block that is set to 90 °C.
The heat block must reach 90 °C prior to the incubation. Place
each buccal swab head in an empty well of a deep-well plate.
Add 1 mL of SwabSolution™ Reagent to each buccal swab
head. Place the deep-well plate on the preheated heat block
adapter. You do not need to seal the plate.
238 Jonelle M. Thompson

28. You do not need to vortex samples after addition of SwabSolu-

tion™ Reagent prior to incubation or after the 30-min incu-
bation is complete.
29. Buccal swab extracts may be stored at 4 °C up to 4 years.
30. Additional negative controls can be included. Assemble a reac-
tion containing the swab extract prepared from a blank swab or
assemble a reaction where the SwabSolution™ Reagent is pro-
cessed as a blank without a swab.

References
1. Edwards A, Civitello A, Hammond HA et al 9. Butler J (2005) Forensic DNA typing, 2nd
(1991) DNA typing with trimeric and tetra- edn. Elsevier Academic Press, London
meric tandem repeats: polymorphic loci, detec- 10. Gusmao L, Carracedo A (2003) Y
tion systems, and population genetics. In: chromosome-specific STRs. Profiles in DNA
Proceedings from the second international 6(1):3–6
symposium on human identification 1991: 11. Jobling MA, Pandya A, Tyler-Smith C (1997)
new technologies, standardization of methods, The Y chromosome in forensic analysis and
and data sharing for DNA typing laboratories. paternity testing. Int J Legal Med 110(3):
Promega Corporation, Madison, pp 31–52 1 1 8 – 1 2 4 . h t t p s : // d o i . o r g / 1 0 . 1 0 0 7 /
2. Edwards A, Civitello A, Hammond HA et al s004140050050
(1991) DNA typing and genetic mapping with 12. Gill P, Brenner C, Brinkmann B et al (2001)
trimeric and tetrameric tandem repeats. Am J DNA Commission of the International Society
Hum Genet 49(4):746–756 of forensic genetics: recommendations on
3. Edwards A, Civitello A, Hammond HA et al forensic analysis using Y-chromosome STRs.
(1992) Genetic variation at five trimeric and Int J Legal Med 114(6):305–309. https://
tetrameric tandem repeat loci in four human doi.org/10.1007/s004140100232
population groups. Genomics 12(2):241–253. 13. Roewer L, Krawczak M, Willuweit S et al
https://doi.org/10.1016/0888-7543(92) (2001) Online reference database of
90371-X European Y-chromosomal short tandem repeat
4. Warne D, Watkins C, Bodfish P et al (1991) (STR) haplotypes. Forensic Sci Int 118(2):
Tetranucleotide repeat polymorphism at the 106–113. https://doi.org/10.1016/S0379-
human beta-actin related pseudogene 0738(00)00478-3
2 (ACTBP2) detected using the polymerase 14. Butler J, Schoske R, Vallone P et al (2002) A
chain reaction. Nucleic Acids Res 19(24): novel multiplex for simultaneous amplification
6980. https://doi.org/10.1093/nar/19.24. of 20 Y chromosome STR markers. Forensic
6980 Sci Int 129(1):10–24. https://doi.org/10.
5. Ausubel F, Brent R, Kingston R et al (1996) 1016/S0379-0738(02)00195-0
Unit 15: the polymerase chain reaction. In: 15. Kayser M, Caglia A, Corach D et al (1997)
Current protocols in molecular biology, vol Evaluation of Y-chromosomal STRs: a multi-
2. John Wiley and Sons, New York center study. Int J Legal Med 110(3):125–133.
6. Sambrook J, Fritsch E, Maniatis T (1989) https://doi.org/10.1007/s004140050051
Chapter 14: in vitro amplification of DNA by 16. Ruitberg C, Reeder D, Butler J (2001)
the polymerase chain reaction. In: Molecular STRBase: a short tandem repeat DNA database
cloning: a laboratory manual, 2nd edn. Cold for the human identity testing community.
Spring Harbor Laboratory Press, Cold Spring Nucleic Acids Res 29(1):320–322. https://
Harbor doi.org/10.1093/nar/29.1.320
7. Erlich H (ed) (1989) PCR technology: princi- 17. Prinz M, Boll K, Baum H et al (1997) Multi-
ples and applications for DNA amplification. plexing of Y chromosome specific STRs and
Stockton Press, New York performance for mixed samples. Forensic Sci
8. Innis M, Gelfand D, Sninsky J et al (eds) Int 85(3):209–218. https://doi.org/10.
(1990) PCR protocols: a guide to methods 1016/S0379-0738(96)02096-8
and applications. Academic Press, San Diego
 DNA Amplification Using Promega’s PowerPlex® Y23 System 239

18. Prinz M, Ishii A, Coleman A et al (2001) Vali- 21. Promega Corporation (2021) PunchSolu-
dation and casework application of a Y chro- tion™ Kit technical manual. Available via Pro-
mosome specific STR multiplex. Forensic Sci mega Corporation. https://www.promega.
Int 120(3):177–188. https://doi.org/10. com/resources/protocols/technical-
1016/S0379-0738(00)00467-9 manuals/101/punchsolution-kit-protocol/.
19. Thompson J, Ewing M, Frank W et al (2013) Accessed 14 July 2022
Developmental validation of the PowerPlex 22. Promega Corporation (2021) SwabSolution™
Y23 System: a single multiplex Y-STR analysis Kit technical manual. Available via Promega
system for casework and database samples. Corporation. https://www.promega.com/res
Forensic Sci Int Genet 7(2):240–250. ources/protocols/technical-manuals/101/
https://doi.org/10.1016/j.fsigen.2012. swabsolution-kit-protocol/. Accessed 14 July
10.013 2022
20. Promega Corporation (2021) PowerPlex® Y23 23. Promega Corporation (2022) PowerPlex® Y23
technical manual TMD035. Available via Pro- System. Available via Promega Corporation.
mega Corporation. https://www.promega. https://www.promega.com/products/foren
com/resources/protocols/technical- s i c - d n a - a n a l y s i s - c e/ s t r- a m p l i fi c a t i o n /
manuals/101/powerplex-y23-system-for-use- powerplex-y23-system/?catNum=DC2305.
on-the-applied-biosystems-genetic-analyzers- Accessed 14 July 2022
protocol/. Accessed 14 July 2022
 Chapter 15

Applied Biosystems’ GlobalFiler™ PCR Amplification Kit

Georgia Williams, Megan M. Foley , and Kelly L. Knight

Abstract
The GlobalFiler™ PCR Amplification Kit is one of the most sensitive kits that exist today that makes the
PCR amplification of human DNA possible. PCR amplification using this specific kit makes millions of
copies of 24 specific target sequences in the DNA, called markers or loci. This kit is a 6-dye, short tandem
repeat (STR) multiplex assay kit that has a synthetic mix of primers and single-stranded oligonucleotides
that are combined with DNA samples and then subjected to 29 or 30 cycles of denaturing, annealing, and
extension, as per laboratory protocol. Methods for instrument operation will vary depending on the
thermal cycler instrument model that is used. Nevertheless, the GlobalFiler™ PCR Amplification Kit has
proven to be a very useful tool to DNA analysts, amplifying extremely low quantities of DNA, making it
possible to detect partial, if not full, genetic profiles from a wide range of sample types. This chapter
discusses the typical preparation and PCR amplification of human forensic DNA samples, using the
GlobalFiler™ PCR Amplification Kit.

Key words GlobalFiler™, PCR, Amplification, STR, DNA polymerase, Multiplex, Loci, CODIS,
ThermoFisher, Forensic Genetics

1 Introduction

The GlobalFiler™ PCR Amplification Kit (GlobalFiler™; Applied

Biosystems, Waltham, MA) is a sensitive and useful kit for forensic
scientists, specifically DNA analysts, as it was developed specifically
for casework [1]. It is used to conduct Polymerase Chain Reaction
(PCR) of specific target sequences of the human genome in
unknown/questioned samples and known/reference high quantity
samples. An advantage of conducting PCR in forensics is that only a
small quantity of sample is necessary because the reaction is essen-
tially “xeroxing” the template DNA millions to billions of times,
which allows profiles to be generated from minute quantities of
DNA. This PCR product is often referred to as an amplicon [2],
and its production ensures that analysts have enough DNA for not
only immediate testing but also future testing.

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_15,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

241
242 Georgia Williams et al.

Fig. 1 Layout of the 24 GlobalFiler™ PCR amplification kit loci. The target loci that are amplified during PCR
amplification are arranged by dye color and base pair size. Loci of smaller base pair size are positioned to the
right and the larger sized loci are found on the left. In the green dye channel, “Y” is representative of the
Y-indel (deletion/insertion marker on the Y-chromosome) and “A” represents Amelogenin (sex-determining
marker). (Reproduced from Ref. [3] with permission from Catherine C. Connon)

GlobalFiler™ is a 6-dye, short tandem repeat (STR) multiplex

assay for the amplification of human genomic DNA. This kit
amplifies the original 13 loci used for the Combined DNA Index
System (CODIS), as well as seven loci from the expanded Euro-
pean Standard Set of Loci (ESSL) and SE33—a highly discriminat-
ing locus [1]. The kit delivers a 24-locus multiplex, high
discrimination power, high sensitivity, tolerance to inhibitors, and
maximization of performance on degraded samples, as well as
completion of amplification in a relatively quick period of time—
approximately 75 min.
The 24 loci amplified by GlobalFiler™ include 21 autosomal
STR loci (D3S1358, vWA, D16S539, CSF1PO, TPOX, D8S1179,
D21S11, D18S51, D2S441, D19S433, TH01, FGA, D22S1045,
D5S818, D13S317, D7S820, SE33, D10S1248, D1S1656,
D12S391, and D2S1338); one Y-STR locus (DYS391); one poly-
morphic insertion/deletion marker on the Y-chromosome
(Y indel); and one sex-determining marker (Amelogenin) (see
Fig. 1) [3].
GlobalFiler™ contains two sets of reagents (pre-amplification
and post-amplification), which are housed separately after initial
thaw and use. The first set of reagents is the one discussed in this
chapter and is used to conduct PCR amplification. These reagents
are housed in the pre-amplification “clean” space and include Glo-
balFiler™ Master Mix (GMM), GlobalFiler™ Primer Mix (GPM),
and the DNA Control 007 (positive control) (see Fig. 2).
The GlobalFiler™ Master Mix contains enzymes (including
DNA polymerase), deoxyribonucleotide triphosphates (dNTPs),
salts, and buffer. The GlobalFiler™ Primer Mix contains the for-
ward and reverse primers specific to the chosen STR sequences.
 GlobalFiler PCR Amplification 243

Fig. 2 GlobalFiler™ pre-amplification reagents. Reagents include (from left to right): GlobalFiler™ Primer Mix,
GlobalFiler™ Master Mix, and DNA Control 007. The GlobalFiler™ Primer Mix and GlobalFiler™ Master Mix
are combined to make an overall PCR amplification master mix, and the DNA Control 007 is used to make PCR
amplification positive control samples

DNA Control 007 is a known human male DNA sample used as a

positive amplification control with a concentration of 0.1 ng/μL
[4]. The DNA profile that is generated for the positive control
indicates whether the amplification and/or capillary electrophore-
sis processes worked properly.
It is extremely important that all equipment, reagents, and
supplies used to prepare amplification reactions are stored and
remain in designated “clean” pre-amplification areas at all times.
These items should not be used to handle amplified DNA or other
potential sources of DNA contamination. Also, amplified DNA and
the equipment, reagents, and supplies used to handle the amplified
DNA (e.g., thermal cyclers, pipettes, allelic ladders, etc.) should not
be brought into the designated “clean” pre-amplification area. A
carryover of trace amounts of amplified DNA into other samples
before amplification can lead to unreliable and inaccurate results
that can be misinterpreted [5]. The second set of reagents in
GlobalFiler™ simply includes the allelic ladder for capillary electro-
phoresis. The allelic ladder should be transferred and stored sepa-
rately in a post-amplification area upon receipt, as it is not used in
the amplification process, and therefore, will not be discussed fur-
ther in this chapter.
244 Georgia Williams et al.

In this chapter, full reaction volume methods are discussed and

are applicable to both questioned (unknown) and reference
(known) samples. GlobalFiler™ and similar kits are typically expen-
sive, and as a result, to reduce costs, some laboratories perform half
reactions, which essentially cut the required volumes of the
reagents in half. This ensures that more value is achieved from
each kit by being able to process two times as many samples. This
is a more cost-efficient method but is generally utilized only when
processing reference samples.
Applied Biosystems also manufactures other versions of Glo-
balFiler™, including the GlobalFiler™ IQC PCR Amplification
Kit, the GlobalFiler™ Express Kit, and the CLA GlobalFiler™
PCR Amplification Kit, which should not be confused with the
version discussed in this chapter. The GlobalFiler™ IQC Kit has
two Internal Quality Control (IQC) markers that are amplified in
addition to the 24 loci from the original GlobalFiler™ PCR Ampli-
fication Kit. The IQC version of the kit is used when analysts are
handling extremely challenging samples and sample quality is in
question; this version of the kit can help to distinguish if sample
inhibition or degradation has occurred. The GlobalFiler™ Express
Kit is used primarily to direct amplify from single-source samples
collected using treated and untreated paper, as well as swabs.
Finally, the CLA GlobalFiler™ Kit is typically used for cell line
authentication. It is extremely important to note that the primer
set and the allelic ladder in each of the three versions of this kit are
different and as a result must not be interchanged.
GlobalFiler™ has proven to be an overall effective tool in
Forensic DNA analysis and as a result, it is routinely used in many
forensic laboratories across the world.

2 Materials

Forensic DNA analysis typically involves the investigation of low

quantity and unknown samples. As a result, the materials—specifi-
cally the plastics that are used to handle and store DNA samples
(e.g., PCR tubes, 96-well plate and pipette tips, etc.)—must be
sterile or autoclaved to ensure that there are no contaminants or
inhibitors present. In addition to being sterile, pipette tips must
also be optimally designed to prevent cross contamination (e.g.,
accompanied with aerosol resistant tips). Finally, all reagents must
be within expiration.
1. DNA extracts.
2. 0.2 mL PCR tubes or 96-well plate (see Notes 1 and 2).
3. Strip caps or adhesive seal and sealing tool: Needed if not using
individual PCR tubes with caps (see Note 3).
 GlobalFiler PCR Amplification 245

4. Amplification tube rack or 96-well plate holder.

5. Nuclease-free water or low Tris-EDTA buffer: the latter is
prepared from 10 mM Tris-HCl and 0.1 mM EDTA; pH 8.0
(see Note 4). Store at room temperature after preparation. It
expires on the date that the individual reagents expire or 1 year
after it is made (whichever comes first).
6. GlobalFiler™ PCR Amplification Kit: GlobalFiler™ Master
Mix (GMM), GlobalFiler™ Primer Mix (GPM), and DNA
Control 007 (positive control). Store all reagents at 25  C
to 15  C upon receipt and 2–8  C after initial use.
7. Thermal cycler (see Note 5).

3 Methods

It is very important to adhere to laboratory precautions not only to

ensure the safety of the analysts, but most importantly to reduce, if
not completely prevent, contamination of samples. One such pre-
caution is wearing proper personal protective equipment (PPE),
which includes lab coat, gloves, and hair net. A second precaution is
to decontaminate work areas by wiping them down with 10%
bleach solution, followed by 70% ethanol, before and after handling
samples. Thirdly, all materials that are used to collect and handle
samples must be autoclaved and/or sterilized. Additionally, it is also
important to work in a biosafety cabinet to keep a clean flow of air
and prevent contaminants from being introduced into the samples
and reagents. Also, the pipette tips that are recommended for use in
a forensic DNA lab are the aerosol barrier pipette tips, which due to
the barrier filter inside the tips prevents contamination of the
pipette shaft and cross-contamination of samples. In addition to
wearing proper PPE and ensuring that the immediate work area,
equipment, and supplies are contaminant-free, it is imperative that
two separate spaces are designated pre-amplification (where the
preparation of samples for amplification occurs) and
post-amplification (where actual PCR amplification and subsequent
procedures occur). Finally, to further ensure that there is no con-
tamination of samples, analysts must always include controls with
every thermal cycler run set of samples. These controls include a
reagent blank, which is subjected to the same amplification reagents
and procedures as a regular sample, but it has no DNA. A positive
control and a negative control should also be included in each run
set of samples. Collectively, the controls assess for contamination
and whether the instruments are working properly. The methods
presented in this chapter are derived from a variety of sources [1–5].
246 Georgia Williams et al.

3.1 Preparing DNA 1. In the designated pre-amplification “clean” area, allow DNA
Samples and PCR extracts to come to room temperature (include the
Amplification Master corresponding reagent blank from the extraction procedure),
Mix then vortex and quick spin (see Note 6). Prepare each DNA
extract such that ~1.0 ng DNA can be added to the PCR
reaction using a volume of 15 μL; this equates to a concentra-
tion of 0.0667 ng/μL (see Notes 7–11). Extracts can be
diluted/prepared using nuclease-free water or TE 4 buffer
(see Note 12).
2. Allow the GlobalFiler™ reagents to come to room temperature
(see Note 13).
3. Secure the required number of sterile amplification tubes in a
rack and label them with the appropriate sample identifiers.
Include two tubes for the positive (DNA Control 007) and
negative (nuclease-free water or TE 4, whichever was used to
prepare DNA extractions; see Subheading 3.1, step 1) amplifi-
cation controls. If using a 96-well plate, label the plate with the
appropriate identifier and retain it in a 96-well base.
4. Calculate the required volume of each GlobalFiler™ compo-
nent needed to prepare the PCR amplification master mix by
multiplying the volume needed in each reaction, by the number
of samples—include controls and additional reactions to com-
pensate for any pipetting error (see Notes 14 and 15 and
Table 1).
5. Vortex the GlobalFiler™ Master Mix and the GlobalFiler™
Primer Mix for 10 s, then centrifuge briefly to remove liquid
from the caps.
6. Using an appropriately sized tube, prepare the master mix as
calculated. Pipette the GlobalFiler™ Master Mix first, followed
by the GlobalFiler™ Primer Mix.
7. Vortex and briefly centrifuge the master mix.

Table 1
GlobalFiler™ master mix reaction composition

Amplification kit component Volume per reaction

GlobalFiler™ Master Mix (GMM) 7.5 μL
GlobalFiler™ Primer Mix (GPM) 2.5 μL
Total volume of PCR amplification mix (master mix) 10 μL
The volumes in this table are representative of a full volume reaction. When preparing the master mix, prepare enough for
all samples/controls being processed and include extra reactions to account for pipetting error (about one extra for every
15 samples/controls). In addition to 10 μL of master mix, 15 μL of DNA is added per reaction to achieve a total reaction
volume of 25 μL
 GlobalFiler PCR Amplification 247

3.2 Preparing 1. Pipette 10 μL of the master mix into each PCR tube or well (see
Amplification Notes 16 and 17).
Reactions 2. Vortex and briefly centrifuge all samples (see Note 18).
3. Add 15 μL of a sample into the corresponding tube/well (see
Note 19).
4. Add 15 μL of the reagent blank “extract” to the corresponding
tube/well (see Note 20).
5. For the positive amplification control, add 10 μL of the DNA
Control 007 and 5 μL of nuclease-free water or TE 4 buffer
(whichever was used for the DNA samples; see Subheading 3.1,
step 1) to the corresponding tube/well. This achieves the
1.0 ng target amount (see Note 9).
6. For the negative amplification control, add 15 μL of nuclease-
free water or TE 4 buffer (whichever was used for the DNA
samples; see Subheading 3.1, step 1) to the corresponding
tube/well.
7. Cap/seal the tubes/plate (see Notes 21 and 22). Vigorously
flick the tubes once or spin down the plate for 60 s. Ensure that
all bubbles have been removed (see Note 23).
8. Transfer the prepared amplification tubes or plate to the post-
amplification area.

3.3 Thermal Cycler 1. Turn the thermal cycler on and select the appropriate run
Instrument Operation method (see Notes 24 and 25).
2. Verify the appropriate PCR amplification parameters (see Fig. 3)
for the appropriate instrumentation used.
3. Place tubes (see Note 26) or plate into the heat block of the
thermal cycler, secure the lid, and then start the instrument (see
Note 27).
4. Once amplification is complete (after approximately 1 h and
15 min), gently remove the tubes or plate (see Note 28).
5. Immediately proceed to capillary electrophoresis detection
(not covered in this chapter) or store the amplification product
in the dark at 2–8  C for up to 2 weeks or 25  C to 15  C
for more than 2 weeks.

4 Notes

1. Some thermal cyclers require a 0.1 mL tube, so be sure to

confirm the compatibility of the tubes with the thermal cycler
before beginning.
2. PCR tubes can be individual tubes (with caps) or strip tubes
(with strip caps).
248 Georgia Williams et al.

Fig. 3 Applied Biosystems™ ProFlex™ 96-well PCR System display screen. The screen is showing the PCR
amplification parameters for GlobalFiler™, 29 cycles. The times and temperatures for each stage of
amplification, as well as the overall reaction volume and temperature of the heated cover, are also shown.
This should be verified before starting a run

3. The adhesive seal and sealing tool are only applicable if a

96-well plate is used.
4. The low Tris-EDTA (aka low-TE or TE 4) buffer has ten times
lower concentration of EDTA than regular TE buffer.
5. Examples of thermal cyclers that can be used to amplify samples
include, but are not limited to, Applied Biosystems’ Gen-
eAmp® PCR System 9700 and its successors—the VeritiPro™
or ProFlex™ PCR System.
6. Questioned and reference samples should always be prepared
separately, with the questioned samples prepared first. This will
help to decrease the chance of cross contamination between
known and unknown samples. Each set of samples (questioned
and reference) must have its own reagent blank and amplifica-
tion controls. The negative amplification control MUST be last
in this sequence, as this will provide a final control check for
contamination during the PCR set up.
7. Making a 0.0667 ng/μL dilution is the most effective approach
for extracts with concentrations >1.0 ng. Alternatively, if the
undiluted extract has a concentration of 0.0667–1.0 ng/μL, it
may be more efficient at this point to only calculate the volume
of undiluted extract needed to achieve an input of 1.0 ng in
combination with the volume of water/TE 4 needed to bring
 GlobalFiler PCR Amplification 249

that volume up to 15 μL; with this approach, the volumes of

DNA extract and water/TE 4 will be added directly to the
PCR reaction (see Subheading 3.2, steps 1–3). For either of
these approaches, the author recommends pipetting no less
than 1 μL for either DNA extract or water/TE 4.
8. DNA extracts that have a concentration less than 0.0667 ng/μ
L should not be combined with water or TE 4 buffer, as doing
so will further dilute the sample. Instead, the maximum volume
of 15 μL of undiluted extract should be added directly to the
PCR reaction (see Subheading 3.2, step 3).
9. Per manufacturer recommendation, the input/target amount
of DNA is 1.0 ng if using a 29-cycle PCR reaction; this includes
the amplification of the positive control via DNA Control
007, which is supplied at a concentration of 0.1 ng/μL. The
manufacturer recommends a decrease to 0.5 ng if using a
30-cycle reaction. Laboratories must perform an internal vali-
dation to identify the range of input DNA that is reliable for
their workflow. Laboratories may find that the parameters for
question versus known samples need to be optimized
separately.
10. For each sample, be sure to document the volumes needed, to
be able to easily reference during the amplification setup
process.
11. Excel, although not required, may be used to record volumes
and concentrations to aid in quick calculations.
12. Although nuclease-free water can be used to dilute samples,
TE 4 buffer is more effective in protecting DNA from degra-
dation. Whichever is selected should be utilized for all DNA
samples (when applicable), as well as the positive and negative
amplification controls. The reagent blank from the extraction
procedure will not have water or TE 4 added to its PCR
reaction.
13. GlobalFiler™ reagents are light and temperature sensitive.
Keeping the reagents in the kit box or in the refrigerator
when not in use is effective in protecting them from light.
These reagents should not remain at room temperature for an
extended period of time.
14. The combination of the GlobalFiler™ Master Mix and the
GlobalFiler™ Primer Mix will result in an overall PCR amplifi-
cation master mix, which is simply referred to as “master mix”
in this chapter.
15. The volume of additional master mix that is used to compen-
sate for pipetting error will be determined by the number of
samples. That is, one extra reaction should be added for every
15 samples, including controls.
250 Georgia Williams et al.

16. A plate map with an identical setup to the thermal cycler

instrument should be used to document sample location.
This will prove extremely useful especially when using a
96-well plate.
17. If nuclease-free water or TE 4 is being added directly to a
reaction (see Note 7), add that to the applicable tubes/wells
after the master mix has been added to all tubes/wells. Be sure
to add components of the amplification to the tubes/wells in
the following order: master mix, nuclease-free water or TE 4
buffer (if needed), and then samples, which include DNA
extracts, reagent blank, and amplification controls. This will
help decrease the likelihood of cross contaminating pipette tips
and samples. Standard precaution is to change tips in between
each DNA source.
18. Pipette samples directly into the reagents already in the tubes/
wells to prevent samples from sticking to the sides of the
tubes/wells.
19. Be sure to reduce the volume of DNA being added to a given
tube/well if water or TE 4 was added directly (see Notes 7 and
17).
20. If multiple reagent blanks were processed during extraction, it
is suggested to select the reagent blank with the highest quan-
titation signal to proceed with amplification. If all of the
reagent blanks have no/the same quantitation signal, ran-
domly select one to proceed with. This guideline is optional
but if incorporated, needs to be made clear in the laboratory’s
standard operating procedures (SOP).
21. The final overall reaction volume in each tube/well is 25 μL.
22. It is extremely important to ensure that tubes/plates are
capped/sealed appropriately. Failure to do so can lead to evap-
oration and inefficient amplification. Furthermore, amplified
samples contain billions of copies (or more) of the targeted
DNA regions. As a result, improperly capped or sealed tubes/
plates will cause samples to leak out and cause significant
contamination of the lab, instrumentation, and most impor-
tantly, other samples.
23. Bubbles prevent efficient amplification.
24. Creating and saving a run method on the thermal cycler instru-
ment helps analysts to avoid re-entering amplification para-
meters each time that samples are to be amplified. These
parameters are based on the kit manufacturer’s guidelines and
recommendations.
 GlobalFiler PCR Amplification 251

Fig. 4 Applied Biosystems™ ProFlex™ 96-well PCR System. (a) This figure displays the single heat block and
heated cover model of the ProFlex™ 96-well PCR System instrument. (b) Displayed in this figure is the
retainer base apparatus that is placed on the heat block prior to loading amplification tubes to prevent them
from melting during a run

25. Review the manufacturer’s guidelines regarding ramp rates for

the thermal cycler being used.
26. If using amplification tubes, be sure to sit them in a retainer
base before placing them in the thermal cycler to prevent the
tubes from melting (see Fig. 4).
27. Manufacturers of thermal cyclers sometimes produce different
models with varying numbers of heat blocks. For example, the
ProFlex™ 96-well PCR System has one heat block (see Fig. 4),
while the ProFlex™ 2  96-well PCR System has two different
heat blocks; if using the latter, the user must verify which block
will be used before beginning a run.
28. After a PCR amplification run is complete, the tubes/plate
tend to get slightly stuck in the heat block, so it is important
to remove the retainer base/plate gently and carefully to avoid
disrupting the amplified product or flinging individual tubes.
252 Georgia Williams et al.

References
1. Ludeman MJ, Zhong C, Mulero JJ et al (2018) User Guide, Revision F. Available online via
Developmental validation of GlobalFiler™ PCR https://assets.thermofisher.com/TFS-Assets/
Amplification Kit: a 6-dye multiplex assay LSG/manuals/4477604.pdf. Accessed
designed for amplification of casework samples. 20 May 2022
Int J Legal Med 132(6):1555–1573 5. Federal Bureau of Investigation (2020) Quality
2. Butler M, John (2005) Forensic DNA typing, Assurance Standards for forensic DNA testing
2nd edn. Elsevier Academic Press, MA laboratories. Available via the Scientific Working
3. Connon CC (2022) STR biology & modern Group on DNA Analysis Methods (SWGDAM).
DNA detection techniques [PowerPoint slides]. https://www.swgdam.org/_files/ugd/4344
Virginia Commonwealth University, FRSC b0_d73afdd0007c4ed6a0e7e2ffbd6c4eb8.pdf.
438 Forensic Molecular Biology Accessed 07 Sept 2022
4. Thermo Fisher Scientific (2019) GlobalFiler™
and GlobalFiler™ IQC PCR Amplification Kits
 Chapter 16

QIAGEN’s Investigator® 24plex QS and GO! PCR

Amplification
Michelle D. Bonnette

Abstract
The Investigator® 24Plex kits are multiplex PCR kits utilized by forensic laboratories to simultaneously
amplify 22 of the most commonly utilized STR markers for human identity testing, including the 20 core
CODIS loci, along with the sex marker Amelogenin and 2 novel quality sensors. These quality sensors are
unique internal PCR controls that provide useful insight to the analyst regarding possible inhibition or
degradation within the sample. This chapter describes the use of the QS version of the kit designed for use
with extracted DNA from casework samples, as well as the use of the GO! version of the kit designed for
direct amplification of reference samples.

Key words Forensic DNA, Investigator 24plex GO!, Investigator 24plex QS, Quality Sensor
(QS) markers, Short tandem repeat (STR) typing, Direct amplification, CODIS loci

1 Introduction

In order to ascertain if genetic material is present in a sample,

purified DNA must be replicated and labeled for detection in
order to develop an STR profile. The Investigator® 24plex Kits
are six-dye short tandem repeat (STR) multiplex kits that utilize the
enzymatic process of Polymerase Chain Reaction (PCR) to amplify
21 autosomal STR loci, one Y-STR (DYS391), the sex determining
marker (Amelogenin), and two quality sensors—one large (QS2 at
475 base pairs) and one small (QS1 at 74 base pairs)—that provide
a unique tool to help interpret STR profile results. The six fluores-
cence dye labels are 6-FAM, BTG, BTY, BTR2, BTO, and BTP (see
Fig. 1) [1]. These 23 loci include the original 13 core CODIS loci
and seven markers from the expanded European Standard Set of
Loci (ESSL) that make up the newly expanded core CODIS loci
(20 loci total) to increase the discriminatory power, reduce the
possibility of adventitious matches, and improve data sharing across
countries using different loci. The quality sensors are a component

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_16,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

253
254 Michelle D. Bonnette

Fig. 1 Investigator® 24plex kit loci. QIAGEN provides commercially available STR kits for a single amplification
of the 20 core CODIS loci (which includes the European Standard Set) plus SE33, DYS391, Amelogenin (A),
Quality Sensor 1 (*1), and Quality Sensor 2 (*2). The layout of loci by dye channel as they appear in an
electropherogram are displayed in this illustration. (Reproduced from Ref. [1] with permission from Catherine
C. Connon)

of the kit’s primer mix and are amplified simultaneously with the
sample’s DNA to help determine if the PCR reaction was success-
ful, as well as to differentiate between failed PCR due to the absence
of DNA, inhibition, or degradation [2]. Each kit is comprised of a
fluorescent dye-labeled, locus-specific primer mix, PCR fast reac-
tion mix (which includes the enzyme Taq DNA polymerase), 9948
positive control DNA, allelic ladder, DNA size standard (BTO),
and nuclease-free water (QS kit only) [3, 4].
Direct PCR is often employed in high-throughput settings,
such as databasing laboratories processing convicted offender and
arrestee samples, as well as in casework laboratories for the proces-
sing of known samples [5]. Direct amplification reduces the time to
process samples and fewer steps in the DNA analysis can mitigate
the risks of cross-over contamination [6, 7]. However, there is
often less control over the precise amount of DNA template
being input into a direct amplification workflow. Low levels of
input DNA can result in stochastic effects, like peak imbalance
and/or complete allele drop-out, while excess template DNA can
lead to increased stutter, non-specific amplification, and/or incom-
plete adenylation [8]. For these reasons, it is recommended that the
Investigator® 24plex QS Kit be utilized for processing questioned
casework samples that often result in mixtures and/or originate
from more challenging sample sources.

2 Materials

2.1 General 1. 0.1–0.2 mL thin-walled reaction tubes (individual or strips

Materials with strip caps) or 96-well amplification plate with bubble
strip caps or adhesive seal (see Note 1).
 24plex Amplification 255

2. Amplification cover: Needed if using adhesive seal.

3. Thermal cycler.

2.2 Amplification 1. Investigator® 24plex QS Kit: Fast Reaction Mix 2.0, Nuclease-
with Investigator® Free water, Primer Mix 24plex QS, Control DNA 9948
24plex QS (0.1 ng/μL), DNA size standard 500 (BTO), Allelic Ladder
24plex, and Protocol Card (see Note 2).
2. Low Tris-EDTA (TE) Buffer: 10 mM Tris-HCl, 0.1 mM
EDTA, pH 8.0; aka TE
4 buffer or low-EDTA TE buffer.

2.3 Direct 1. Investigator® 24plex GO! Kit: Fast Reaction Mix 2.0, Primer
Amplification with Mix 24plex GO!, Control DNA 9948 (5 ng/μL), DNA size
Investigator® 24plex standard 24plex (BTO), Allelic Ladder 24plex, and Quick-
GO! Start Protocol (see Note 2).
2. Investigator STR GO! Punch Buffer.
3. Investigator STR GO! Lysis Buffer.
4. 1.2 mm punching tool (see Note 3).
5. 2.2 mL deep well plate (optional).
6. Thermomixer (see Note 4).
7. Type I water.

3 Methods

Wear appropriate personal protective equipment (at a minimum:

lab coat, gloves, and face mask) when carrying out the following
procedures and handling materials. Refer to Safety Data Sheets
(SDS) to determine the safety hazards for chemicals and reagents
used in the standard operating procedures. The amplification posi-
tive (9948) and negative controls are incorporated into the sample
set following all other samples. One set of controls must be tested
with each sample set (see Notes 5–8). The Investigator® 24plex QS
Kit should be used with DNA extracts from routine forensic case-
work, while the Investigator® 24plex GO! Kit should be used for
direct amplification of reference samples (casework or databasing).
Half reaction volumes are sufficient when amplifying buccal sam-
ples with the Investigator® 24plex GO! Kit. However, full reaction
volumes may be used when necessary. Inhibited blood samples may
require a water wash prior to direct amplification (see Note 9).

3.1 Amplification 1. Using the estimated quantities of DNA obtained from the
with Investigator® applicable quantification kit, calculate the number of microli-
24plex QS Kit ters (and/or the necessary dilution) to be added to the ampli-
fication reaction in order to obtain a concentration of
0.033–0.067 ng/μL. The combined volume of TE
4 buffer
256 Michelle D. Bonnette

Table 1
Recommended normalization parameters

If you are preparing the. . . Then. . .

DNA sample and the Add 15 μL of sample to the PCR tube/wella
concentration is  desired target
DNA sample and the Dilute a portion of the sample with TE
4 buffer so that only 0.5 ng
concentration is > desired target of total DNA is in a volume of 15 μL. Add 15 μL of sample to the
PCR tube/well.
Positive control Add 5 μL of 9948 and 10 μL TE
4 buffer to the PCR tube/well
Negative control Add 15 μL TE
4 buffer to the PCR tube/well
These guidelines require dilution of samples prior to their addition to the amplification plate/tubes. This allows for a
more streamlined and less error prone amplification setup. After master mix addition, 15 μL of each sample, whether it is
neat or has been diluted, will be added to each well
a
If the sample volume is significantly greater than 15 μL, it is advised to concentrate the sample using your laboratory’s
validated concentration protocol

and sample DNA should equal 15 μL. A typical target amount

of DNA comprised within the 15 μL is 0.5–1.0 ng; however,
this may vary based on analyst discretion and nature of the
sample (see Note 10). Table 1 displays examples of how to set
up samples for a 0.5 ng target.
2. Obtain and label an appropriate quantity of 0.1 or 0.2 mL thin-
walled amplification tubes or a 96-well amplification plate.
3. Place the tubes/plate in an appropriate retainer for stability.
4. Obtain the following components from refrigerated storage:
Fast Reaction Mix 2.0, Primer Mix 24plex QS, and Control
DNA 9948 (0.1 ng/μL).
5. Vortex the PCR components well and centrifuge briefly prior
to use.
6. Prepare the PCR reaction mix by adding the following volumes
per reaction to a labeled microcentrifuge tube: 7.5 μL Fast
Reaction Mix 2.0 and 2.5 μL Primer Mix 24plex QS (see
Notes 11 and 12).
7. Vortex well and pulse spin. Primer Mix 24plex QS is much less
dense than Fast Reaction Mix 2.0 and will float on top if not
thoroughly vortexed.
8. Allow the sample extracts to equilibrate to room temperature.
Vortex and pulse spin all tubes.
9. Dispense 10 μL of PCR reaction mix into each sample’s ampli-
fication tube/well.
10. Dispense the calculated volume of neat extract/diluted extract
and/or TE
4 buffer to each sample’s associated tube/well (see
Note 13).
 24plex Amplification 257

11. Add the 9948 Positive Control and the TE
4 buffer Negative
Control, in that order, as the last two samples of the batch. All
tubes/wells should now contain a total volume of 25 μL.
12. Visually check the bottom of each tube/well to see that each
one contains the same volume of liquid (see Note 14). If so,
make sure that all caps are secure. Alternatively, add an adhesive
seal and make sure the seal is adequately secure over the entire
plate.
13. Vortex and centrifuge the tubes/plate.
14. Turn on the thermal cycler. Load the samples onto the thermal
cycler. Gently push the tubes/plate completely down into the
heat block. Pull the lid closed over the samples until it clamps
(see Note 4).
15. Select and confirm the 29-cycle thermal cycler program for full
reactions of DNA extracts (see Table 2 and Note 15).
16. Press Start.
17. When amplification is complete, the samples can remain at
10  C (in the thermal cycler) for up to 24 h. Pulse spin the
tubes/plate after removal and freeze at
25  C to
15  C or
proceed to preparation for capillary electrophoresis.

Table 2
Thermal cycling parameters

24plex QS 24plex GO! 24plex GO!

DNA extracts FTA/Non-FTA blood samples Buccal swabs

Temperature Time Number of cycles Time Number of cycles Time Number of cycles
98  C 30 s 3 cycles 30 s 3 cycles 30 s 3 cycles
64  C 55 s 40 s 40 s
72  C 5s 5s 5s
96  C 10 s 26 cycles 10 s 23 cycles 10 s 24 cycles
61  C 55 s 40 s 40 s
72  C 5s 5s 5s
68  C 2 min – 2 min – 2 min –

60 C 2 min – 2 min – 2 min –
10  C 1 – 1 – 1 –
The thermal cycling parameters differ slightly between kits and between substrate types with regards to direct amplifica-
tion. The Investigator® 24plex QS Kit should be used with DNA extracts from routine forensic casework, while the
Investigator® 24plex GO! Kit should be used for direct amplification of reference samples (casework or databasing).
Nonetheless, all thermal cycling parameters must first begin with a 98  C hot-start to activate the DNA polymerase
258 Michelle D. Bonnette

3.2 Direct 1. Obtain and label an appropriate quantity of 0.1 or 0.2 mL thin-
Amplification walled amplification tubes or a 96-well amplification plate.
(Investigator® 24plex 2. Place the tubes/plate in an appropriate retainer for stability.
GO! Kit) with FTA or
3. If water wash is needed, add 20 μL Type I water to the tubes/
Non-FTA Blood wells (see Note 9). Otherwise, proceed directly to preparing the
Samples PCR reaction mix (see Subheading 3.2, step 7).
4. Punch samples into the tubes/wells by taking a 1.2 mm punch
from the center of the blood spot with a suitable punching tool
(see Note 3). Do not use more than one punch at a time [4].
5. Spin down the tubes/plate to ensure punches are submerged in
water.
6. Remove water from tubes/wells using a mechanical pipette.
7. Obtain the following components from refrigerated storage:
Fast Reaction Mix 2.0, Primer Mix 24plex GO!, and Control
DNA 9948 (5 ng/μL). For FTA blood samples only, also
obtain Investigator STR GO! Punch Buffer; the latter is not
needed for non-FTA blood samples (see Note 16).
8. Vortex the PCR components well and centrifuge briefly prior
to use.
9. Prepare the PCR reaction mix by adding the following volumes
per reaction to a labeled microcentrifuge tube: 7.5 μL Fast
Reaction Mix 2.0, 12.5 μL Primer Mix 24plex GO!, and
2.0 μL Investigator STR GO! Punch Buffer, if using (see
Notes 11, 12, and 16).
10. Vortex well and pulse spin. Primer Mix 24plex GO! is much
less dense than Fast Reaction Mix 2.0 and will float on top if
not thoroughly vortexed.
11. Dispense 22 μL of PCR reaction mix for FTA samples
(or 20 μL for non-FTA samples) into each sample’s amplifica-
tion tube/well.
12. If the water wash was not performed (i.e., punches have not
been added; see Subheading 3.2, steps 3–6), punch samples
into the appropriate tubes/wells by taking a 1.2 mm punch
from the center of the blood spot with a suitable punching tool
(see Notes 3 and 13). Do not use more than one punch at a
time [4].
13. Spin down the tubes/plate to ensure punches are submerged
in the PCR reaction mix and verify all punches are present in
the appropriate tubes/wells.
14. For each amplification set, add 1 μL of positive control to the
appropriate tube(s)/well(s).
15. For each amplification set, include a negative control in the
appropriate tube(s)/well(s). The negative control should not
 24plex Amplification 259

include any template DNA. Do not add a blank punch or water

to the negative control tube/well [4].
16. Visually check the bottom of each tube/well to see that each
one contains the same volume of liquid (see Note 14). If so,
make sure that all caps are secure. Alternatively, add an adhesive
seal and make sure the seal is adequately secure over the entire
plate.
17. Vortex and centrifuge the tubes/plate.
18. Turn on the thermal cycler. Load the samples onto the thermal
cycler. Gently push the tubes/plate completely down into the
heat block. Pull the lid closed over the samples until it clamps
(see Note 4).
19. Select and confirm the 26-cycle thermal cycler program for full
reactions of FTA/non-FTA blood samples (see Table 2 and
Note 15).
20. Press Start.
21. When amplification is complete, the samples can remain at
10  C (in the thermal cycler) for up to 24 h. Pulse spin the
tubes/plate after removal and freeze at
25  C to
15  C or
proceed to preparation for capillary electrophoresis.

3.3 Half Reaction, 1. Place swab head(s) in a microcentrifuge tube or deep well plate.
Direct Amplification 2. Add 500 μL STR GO! Lysis Buffer to each sample.
(Investigator® 24plex
3. Seal the plate or cap the tubes and place in a thermomixer at
GO! Kit) with Buccal 95  C shaking at 1200 rpm for 5 min.
Swab Samples
4. Obtain and label an appropriate quantity of 0.1 or 0.2 mL thin-
walled amplification tubes or a 96-well amplification plate.
5. Place the tubes/plate in an appropriate retainer for stability.
6. Obtain the following components from refrigerated storage:
Fast Reaction Mix 2.0, Primer Mix 24plex GO!, and Control
DNA 9948 (5 ng/μL).
7. Vortex the PCR components well and centrifuge briefly prior
to use.
8. Prepare the PCR reaction mix by adding the following volumes
per reaction to a labeled microcentrifuge tube: 3.75 μL Fast
Reaction Mix 2.0 and 6.25 μL Primer Mix 24plex GO! (see
Notes 11 and 12).
9. Vortex well and pulse spin. Primer Mix 24plex GO! is much less
dense than Fast Reaction Mix 2.0 and will float on top if not
thoroughly vortexed.
10. Dispense 10 μL of PCR reaction mix into each sample’s ampli-
fication tube/well.
11. Add 1 μL of swab lysate to each tube/well containing PCR
reaction mix (see Notes 13 and 17).
260 Michelle D. Bonnette

12. For each amplification set, add 1 μL of positive control to the

appropriate tube(s)/well(s) in the amplification plate.
13. For each amplification set, include a negative control (blank
swab lysate) in the appropriate tube(s)/well(s) [4].
14. Visually check the bottom of each tube/well to see that each
one contains the same volume of liquid (see Note 14). If so,
make sure that all caps are secure. Alternatively, add an adhesive
seal and make sure the seal is adequately secure over the entire
plate.
15. Vortex and centrifuge the tubes/plate.
16. Turn on the thermal cycler. Load the samples onto the thermal
cycler. Gently push the tubes/plate completely down into the
heat block. Pull the lid closed over the samples until it clamps
(see Note 4).
17. Select and confirm the 27-cycle thermal cycler program for half
reactions of buccal swabs (see Table 2 and Note 15).
18. Press Start.
19. When amplification is complete, the samples can remain at
10  C (in the thermal cycler) for up to 24 h. Pulse spin the
tubes/plate after removal and freeze at
25  C to
15  C or
proceed to preparation for capillary electrophoresis.

4 Notes

1. Lower throughput scenarios (generally associated with smaller

casework laboratories or reamplification instances) may find the
0.1–0.2 mL reaction tube option more cost-effective and less
wasteful while high-throughput scenarios (typical of larger
casework laboratories or databasing laboratories) will more
frequently utilize 96-well PCR plates. Consult your thermal
cycler’s manufacturer recommendation for compatibility with
0.1 and/or 0.2 mL reaction tubes.
2. It is important to minimize the number of freeze-thaw cycles
for the kit reagents to fewer than 20 freeze-thaw cycles. Kit
reagents should be stored at
20  C until first use. After first
use (i.e., initial thaw), reagents should be stored between 2 and
8  C for up to 6 months or can be placed back in storage at
temperatures below
20  C if they will not be used for an
extended period of time. It is recommended to only thaw
what you need. Keep the kit components protected from direct
exposure to light. Excessive exposure can affect fluorescent
probes. Each lot of kits must be evaluated prior to use. Ampli-
fication reagents must be stored separately from evidentiary
samples.
 24plex Amplification 261

3. Manual and automated punching tools are available. The Har-

ris Uni-Core Punch (1.2 mm) and accompanying punching
mat can be utilized for manual punching. Alternatively, the
BSD 600 puncher with accompanying instrument, computer,
and appropriate software can be utilized for automated punch-
ing directly into the 96-well amplification plate.
4. Extreme temperatures may affect the performance of instru-
ments. The ideal temperature range for a room housing instru-
mentation is 20–25  C.
5. 9948 is amplified as a positive control. This control is used to
evaluate the performance of the amplification and subsequent
typing procedures. See the Investigator® 24plex Kit User
Handbooks (product overview) for the known profile that is
generated from 9948.
6. TE
4 buffer is amplified as the negative control in the Investi-
gator® 24plex QS Kit. This control contains all chemical com-
ponents of the amplification reaction in addition to TE
4
buffer and should exhibit no profile except for the large and
small quality sensor peaks.
7. Extraction reagent blanks must be amplified at a volume equal
to the highest preparation volume of any sample in its asso-
ciated batch. In other words, the same concentration condi-
tions as the forensic samples that contain the least amount of
DNA. This control contains all of the chemical components of
both the extraction and amplification reactions and should
exhibit no profile except for the quality sensors. Furthermore,
the reagent blank must be amplified using the same primers and
instrument as its associated forensic sample(s).
8. For the Investigator 24plex GO! Kit only, blood plates have a
combined reagent blank/amplification negative control.
9. This wash is often required if the blood card was made from a
very low-volume blood tube or if the initial amplification was
done without a water wash and the resulting DNA profile
exhibited signs of inhibition.
10. For samples that have either been through quantification or an
initial amplification and exhibit a high level of degradation, a
target template of greater than 1 ng may be necessary to
generate a complete DNA profile. If –A peaks are observed,
the samples can be re-amplified using less template DNA.
11. Additional samples may be added to the calculation to account
for volume lost during pipetting.
12. It is highly recommended to dispense immediately after prepa-
ration. Otherwise, store at 2–8  C until ready to dispense into
reaction tubes/wells.
262 Michelle D. Bonnette

13. Individual tubes should be capped immediately after sample

addition. If strip caps are utilized, cap after each completed
column to reduce the risk of cross contamination. Alterna-
tively, an adhesive plate seal may be applied after all samples/
controls have been added.
14. If there is a noticeable difference in sample volume, this may
indicate a pipetting error or an omission in adding the extract
or master mix. If the cause of the volume difference is not
readily obvious or able to be remedied, this tube/well may
need to be omitted from the assay and set up again.
15. Ramp rates should be assigned as follows: Veriti® 96-Well Fast
Thermal Cycler—“100%”; GeneAmp™ PCR System 9700
with an aluminum block—“Std Mode”; or GeneAmp™ PCR
System 9700 with a silver block or gold-plated silver block—
“Max Mode”. Do not use “9600 Emulation Mode” [3, 4].
16. When amplifying non-FTA samples, do not add Investigator
STR GO! Punch Buffer.
17. Anywhere from 0.5–3.0 μL of swab lysate may be used if 1 μL
does not yield desirable results in the initial amplification
attempt.

References

1. Connon CC (2022) STR biology & modern 523-aea8-ae6c38de3ff2&lang¼en. Accessed

DNA detection techniques [PowerPoint slides]. 14 June 2022
Virginia Commonwealth University, FRSC 5. Myers BA, King JL, Budowle B (2012) Evalua-
438 Forensic Molecular Biology tion and comparative analysis of direct amplifica-
2. Kraemer M, Prochnow A, Bussmann M et al tion of STRs using PowerPlex® 18D and
(2017) Developmental validation of QIAGEN Identifiler® Direct systems. Forensic Sci Int
Investigator® 24plex QS Kit and Investigator® Genet 6(5):640–645. https://doi.org/10.
24plex GO! Kit: two 6-dye multiplex assays for 1016/j.fsigen.2012.02.005
the extended CODIS core loci. Forensic Sci Int 6. Caputo M, Bobillo MC, Sala A et al (2017)
Genet 29:9–20. https://doi.org/10.1016/j. Optimizing direct amplification of forensic com-
fsigen.2017.03.012 mercial kits for STR determination. J Forensic
3. Qiagen (2021) Investigator® 24plex QS hand- Legal Med 47:17–23. https://doi.org/10.
book for multiplex amplification of the CODIS 1016/j.jflm.2017.01.003
core loci, the European standard set of loci, plus 7. Ambers A, Wiley R, Novroski N et al (2018)
SE33, DYS391, and Amelogenin. Available via Direct PCR amplification of DNA from human
Qiagen. https://www.qiagen.com/us/res bloodstains, saliva, and touch samples collected
ources/resourcedetail?id¼debe09ab-5483-4 with MicroFLOQ® swabs. Forensic Sci Int
78b-aeb3-e5c128e78a92&lang¼en. Accessed Genet 32:80–87. https://doi.org/10.1016/j.
14 June 2022 fsigen.2017.10.010
4. Qiagen (2021) Investigator® 24plex GO! hand- 8. Cavanaugh SE, Bathrick A (2018) Direct PCR
book for multiplex amplification of the CODIS amplification of forensic touch and other chal-
core loci, the European standard set of loci, plus lenging DNA. Forensic Sci Int Genet 32:40–49.
SE33, DYS391, and Amelogenin. Available via https://doi.org/10.1016/j.fsigen.2017.
Qiagen. https://www.qiagen.com/us/res 10.005
ources/resourcedetail?id¼97fbda9a-d69a-4
 Chapter 17

Low Volume STR Amplification Options: Coupling

with Standard or Fast PCR, Traditional or Normalized DNA
Extraction, and/or Traditional or Alternative Capillary
Electrophoresis
Catherine Cupples Connon

Abstract
STR amplification leads directly to profile development, which is also impacted by DNA extraction and
capillary electrophoresis detection. Amplification for forensic human identification purposes is inherently a
costly process; reduced volume reactions have long been an effective cost-savings measure. Processing
known, high-quality, single-source DNA samples (i.e., buccal samples) allows for the use of even lower
reaction volumes. This chapter provides examples of 3 μL and 6 μL reactions for a variety of commercial
amplification kits for use with buccal samples, including standard and fast PCR using KAPA2G™ Multiplex
Mix. These reactions can be utilized with traditional DNA extracts or those obtained from a normalized
extraction with the ChargeSwitch® Forensic DNA Purification Kit. They can be detected via traditional
capillary electrophoresis using POP-4™ polymer and a 36 cm array, or an alternative method using
POP-6™ polymer and a 22 cm array on the 3130 series Genetic Analyzer instruments. This chapter also
includes protocols for the normalized extraction and alternative detection method.

Key words PCR, STR profiles, Amplification, Low volume, Fast PCR, KAPA2G™ Multiplex Mix,
Normalized extraction, ChargeSwitch® Forensic DNA Purification Kit, Capillary electrophoresis

1 Introduction

STR profile development is a critical, and complex, process for

forensic human identification purposes. As the field experiences
technological advancements, it is often fruitful to revisit long-
standing protocols to incorporate these advancements in an effort
to improve such methods. PCR reaction volumes have dramatically
decreased over the decades, originally beginning with 100 μL reac-
tions when first developed in the 1980s and currently reaching
down to just a few microliters for high-quality, single-source sam-
ples [1, 2]. As a comparison, typical forensic evidentiary samples
(which are more challenging than single-source buccal samples) are

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_17,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

263
264 Catherine Cupples Connon

routinely amplified using 15–25 μL reactions; using today’s stan-

dards, a “full” reaction for forensic amplification kits is usually
25 μL [3–12]. These reductions served as a cost-savings measure
for the expensive commercial amplification kits used for forensic
human identification purposes but also resulted in the added
benefit of increased sensitivity. High-quality, single-source refer-
ence samples, such as buccal swabs, have been successfully amplified
with lower reaction volumes compared to evidentiary samples
because the former are not subject to complications arising from
potential mixtures of DNA, degradation, and/or inhibition and
can thereby still yield high-quality STR profiles using very low
reaction volumes [2].
In addition to striving to reduce costs, PCR amplification pro-
tocols have also been modified over the decades to reduce overall
processing time. The traditional reaction for forensic purposes
generally takes 3–3.5 h for roughly 30 PCR cycles—give or take a
few cycles [3, 6, 8, 9]. Various efforts have been pursued to reduce
processing time, including, but not limited to, use of (1) faster
cycling thermal cycler instruments (“fast,” “ultra-fast,” or “rapid”
thermal cyclers) that employ faster ramp rates to ramp between the
various temperatures in a PCR cycle (this is partially achieved
through the use of heat block materials that are better conductors,
like gold-plated or silver, as compared to traditional materials like
aluminum); (2) shorter PCR phases (i.e., less time allotted for
denaturation, annealing, and extension); (3) a 2-step PCR cycle,
as compared to the traditional 3-step cycle (the annealing and
extension steps are combined); (4) a shorter final extension for
adenylating polymerases or complete removal of this step via the
use of a non-adenylating polymerase; (5) faster acting polymerases;
(6) a reduced hot-start activation step; (7) a reduced reaction
volume (the increased sensitivity of reduced volume reactions
results in fewer PCR cycles); and (8) thin-walled PCR tubes to
help with faster ramp rates and reduced times allotted for denatur-
ation and annealing/extension [2, 13–19]. Fast, low volume ampli-
fication has been achieved with a Veriti® 384-well thermal cycler
(Applied Biosystems, Waltham, MA) with run times of about 1 h or
less for several commercial amplification kits supplemented with
KAPA2G™ Fast Multiplex Mix (KAPA Biosystems, Wilmington,
MA) [2].
Additional efforts to reduce overall processing time outside of
amplification have included direct amplification and normalized
extraction [5, 7–12, 14, 20, 21]. Both of these eliminate the need
to quantify the DNA sample prior to amplification, which is cur-
rently acceptable for reference samples only per the FBI Quality
Assurance Standards [22]. However, direct amplification has the
added benefit of bypassing the extraction step as well (though often
needs some kind of brief pre-amplification processing), whereas
normalized extraction has the added benefit of being compatible
 Low Volume STR Amplification Options 265

with very low reaction volumes for amplification due to the lack of a
substrate present in the reaction. A normalized extraction has been
specifically developed using the ChargeSwitch® Forensic DNA
Purification Kit (Invitrogen, Waltham, MA) that is compatible
with fast, low volume amplifications [20].
One additional noteworthy strategy to reduce processing time
via the 3130 series Genetic Analyzers has been to modify the
electrophoresis setup with a combination of POP-6™ polymer
(Applied Biosystems) and a 22 cm capillary array, as compared to
the traditional POP-4™ polymer, 36 cm array setup [23]. Use of
this more viscous polymer combined with the shorter array pro-
vides sufficient resolution (as long as the amplicons are not too
long) accompanied by a shorter run time (reduced from ~45 min to
~25 min), and leads to increased sensitivity (i.e., higher peak
heights) such that injection voltage can be reduced from 3 kV to
2 kV. The 3500 series Genetic Analyzers have already incorporated
modifications to reduce electrophoresis time to ~30 min, thus the
modifications applied to the 3130 series are not necessary for the
newer Genetic Analyzers.
Depending upon a laboratory’s needs and their instrumenta-
tion, there are indeed a variety of options that exist to incorporate
low volume amplifications to develop STR profiles for forensic
human identification purposes.

2 Materials

All solutions should be prepared with Type I water. It is good

laboratory practice to aliquot reagents for short-term use
(~1 month), rather than pulling from the stock solution each
time; this reduces the risk of contaminating the stock solution.
Plastic consumables (i.e., tips, tubes, etc.) must be autoclaved for
sterilization (or purchased sterile); aerosol-barrier pipette tips are
highly recommended.

2.1 STR 1. DNA extracts: These can be prepared via a traditional DNA
Amplification extraction/purification method of the user’s choice (must be
quantified) or from a normalized DNA extraction procedure
(no quantification required) (see Subheading 3.2). The amplifi-
cation protocols included in this chapter have not been opti-
mized for direct amplification.
2. STR amplification kit: User can select the STR amplification kit
of their choice. Examples include AmpFlSTR® Identifiler®,
Identifiler® Plus,
Yfiler®, and Yfiler® Plus PCR Amplification Kits; GlobalFiler™
PCR Amplification Kit; and the PowerPlex®16, 16 HS, Fusion,
Fusion 6C, and Y23 Systems. Store as indicated.
266 Catherine Cupples Connon

3. 96-well or 384-well plate (see Note 1).

4. Adhesive sealing film for PCR.
5. Thermal cycler: Needs to be equipped with a heat block com-
patible with the amplification plate (96- versus 384-well) and
kit (some protocols require gold-plated, silver, etc. and are not
compatible with aluminum blocks). Program the thermal
cycling parameters in advance, so that the instrument is ready
at the time of amplification.
6. KAPA2G™ Fast Multiplex PCR Kit: Contains KAPA2G™ Fast
Multiplex Mix (see Note 2). Store at -15 °C to -20 °C upon
receipt.

2.2 Normalized DNA 1. Buccal samples: Buccal cells collected on sterile cotton swabs,
Extraction Buccal DNA Collectors™ (buccal collector), etc.
2. ChargeSwitch® Forensic DNA Purification Kit: Contains Char-
geSwitch® Lysis Buffer, ChargeSwitch® Magnetic Beads, Char-
geSwitch® Purification Buffer, ChargeSwitch® Wash Buffer,
ChargeSwitch® Elution Buffer, and 20 mg/mL Proteinase
K. Prepare a working stock of 50% Lysis Buffer by combining
the desired volume of buffer with an equal volume of Type I
water. Upon receipt, store Proteinase K at 2–8 °C and all other
components at room temperature. If stored properly, all com-
ponents are stable for 6 months.
3. Magnetic particle separator (MPS): Author recommends the
BioSprint® 96 workstation or KingFisher® 96.
4. 96-well rod cover.
5. 96-well microplate.
6. 96-well S-blocks: This plate has square, deep wells.
7. Sterile, pierceable foil seal.
8. Sterile tape seal.
9. Sealing tool.
10. Piercing tool.
11. Plate centrifuge: Must be compatible with 96-well S-blocks
and 96-well microplates.
12. Sonicator.
13. Oven incubator.

2.3 Capillary 1. 3130 or 3500 series Genetic Analyzer and compatible Data
Electrophoresis Collection software version. All reagents and consumables that
Detection get loaded directly onto the instrument need to be compatible
with the specific model.
2. POP-4™ or POP-6™ polymer: Store at 2–8 °C upon receipt
(see Note 3).
 Low Volume STR Amplification Options 267

3. 36 cm or 22 cm capillary array (see Note 3).

4. MicroAmp® Optical 96-well or 384-well reaction plate.
5. 96-Well or 384-well plate septa.
6. Plate base and retainer.
7. Formamide: Aliquot and store at 2–8 °C upon receipt; once
thawed, do not re-freeze.
8. Internal size standard: Store as instructed by manufacturer.
9. Allelic ladder: Store as instructed by manufacturer.

3 Method

This low volume amplification protocol is general and can be

adapted for a variety of commercial amplification kits. It is described
here for high-throughput processing and can be used with DNA
extracts generated from traditional extraction procedures or using
the supplied normalized extraction procedure (see Subheading 3.2)
for buccal samples on swabs or buccal collectors. Appropriate con-
trols need to be processed at the amplification stage, including any
associated extraction controls (e.g., reagent blanks), as well as the
amplification positive and negative controls. STR profile detection
options also include use of various capillary electrophoresis instru-
ments (e.g., 3130 or 3500 series Genetic Analyzers), as well as a
traditional (see Subheading 3.3) or alternative method specifically
crafted for the 3130 series (see Subheading 3.4). Amplification and
capillary electrophoresis detection setup should be performed in a
biological specimen hood. Furthermore, universal precautions
should be taken regarding the handling of biohazardous materials
(e.g., human body fluids), including decontamination of laboratory
surfaces/equipment with 10% bleach followed by 70% ethanol
before and after each use; changing pipette tips in between each
sample/reagent; and wearing personal protective equipment
(PPE), as defined by your laboratory policy. Basic PPE includes a
lab coat, gloves, and safety glasses.

3.1 3 μL or 6 μL STR 1. Retrieve DNA extracts of the samples being amplified. If frozen
Amplification or refrigerated, allow them to come to room temperature.
Samples being amplified from traditional DNA extraction pro-
tocols must be quantified prior to amplification to determine
their concentration of human DNA. Samples being amplified
from the ChargeSwitch® normalized extraction (see Subhead-
ing 3.2) do not need to be quantified.
2. Retrieve the amplification kit components from the freezer/
refrigerator and allow them to come to room temperature.
Keep reagents protected from light and do not leave them at
room temperature for an extended period of time.
268 Catherine Cupples Connon

3. If processing DNA extracts from a traditional extraction

method, all extracts need to be diluted appropriately for ampli-
fication (~0.375–1.500 ng or ~0.500–1.500 ng input DNA for
3 μL or 6 μL, respectively; see Note 4) based on the reaction
volume and kit used (see Tables 1 and 2). DNA extracts from
the ChargeSwitch® normalized extraction (see Subheading 3.2)
do not need to be further diluted but are only suitable for use
with 3 μL reaction volumes (see Note 5).
4. Vortex and quick spin each amplification reagent (see Note 6).
5. Using an appropriately sized tube, prepare enough amplifica-
tion master mix for all samples/controls, including an extra
10% for pipetting error (see Tables 1 and 2). Dispense the
specified volume of master mix into the appropriate wells of
an amplification plate (see Notes 1 and 7).
6. Add the appropriate amount of DNA extract: 0.900 μL nor-
malized extract for 3 μL reactions (includes older kits modified
for fast PCR with KAPA2G™); 1.000 μL or 1.200 μL tradi-
tional extract for 3 μL reactions; or 2.000 μL or 2.400 μL
traditional extract for 6 μL reactions (see Tables 1 and 2). Add
the positive amplification control (supplied with the kit) and
negative amplification control (water). All samples/controls
should be added to their designated wells (see Note 7).
7. Apply and securely seal the plate with an adhesive seal for PCR
(see Note 8).
8. Centrifuge the plate for ~5 s.
9. Transfer the plate to the thermal cycler, securely close the lid,
and begin the appropriate PCR program (see Tables 3 and 4 and
Note 9).
10. Once amplification is complete, remove the amplification plate
from the thermal cycler. Proceed immediately to capillary elec-
trophoresis detection (see Subheading 3.3 or Subheading 3.4)
or store the plate at 4 °C until ready to do so (see Note 10).

3.2 Normalized DNA 1. For each sample being processed, add ~¼ of a buccal swab or a
Extraction via 6 mm punch from a buccal collector to the corresponding well
ChargeSwitch® of a 96-well S-block; only process one type of sample (see Notes
7 and 11). Reserve an empty well for a reagent blank; a positive
extraction control can also be processed but is not required (see
Note 12). This plate is referred to as the “sample plate” in this
protocol.
2. Using an appropriately sized tube (e.g., 50 mL conical tube),
prepare a lysis buffer mixture consisting of 300 μL 50% Char-
geSwitch® Lysis Buffer and 5 μL Proteinase K per sample (see
Table 5). Include an extra 10–15% for pipetting error. Gently
mix by inversion (see Note 13).
Table 1
Examples of 3 μL and 6 μL amplification reactions

Identifiler® PowerPlex® PowerPlex® PowerPlex® PowerPlex® Yfiler® PowerPlex®

® ®
Component Identifiler Plus 16 16 HS GlobalFiler™ Fusion Fusion 6C Yfiler Plus Y23
3 μL Rxn mix 1.145 1.200 0.300 0.600 1.500 0.600 0.600 1.100 1.200 0.600
Reactions Polymerase 0.055 – 0.100 – – – – 0.100 – –
Primer set 0.600 0.600 0.300 0.300 0.500 0.600 0.600 0.600 0.600 0.300
Water T: – T: – T: 1.100 T: 0.900 T: – T: 0.600 T: 0.600 T: – T: – T: 0.900
N: 0.300 N: 0.300 N: 1.400 N: 1.200 N: 0.100 N: 0.100 N: 0.100 N: 0.300 N: 0.300 N: 1.200
Total MM T: 1.800 T: 1.800 T: 1.800 T: 1.800 T: 2.000 T: 1.800 T: 1.800 T: 1.800 T: 1.800 T: 1.800
N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100
DNA T: 1.200 T: 1.200 T: 1.200 T: 1.200 T: 1.000 T: 1.200 T: 1.200 T: 1.200 T: 1.200 T: 1.200
extract N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900
6 μL Rxn mix 2.290 2.400 0.600 1.200 3.000 1.200 1.200 2.200 2.400 1.200
Reactions Polymerase 0.110 – 0.200 – – – – 0.200 – –
Primer set 1.200 1.200 0.600 0.600 1.000 1.200 1.200 1.200 1.200 0.600
Water – – 2.200 1.800 – 1.200 1.200 – – 1.800
Total MM 3.600 3.600 3.600 3.600 4.000 3.600 3.600 3.600 3.600 3.600
DNA 2.400 2.400 2.400 2.400 2.000 2.400 2.400 2.400 2.400 2.400
extract
This table provides examples of master mix preparation and DNA extract volumes (μL) for a variety of commercially available STR amplification kits. Since exact reagent names may vary from kit
to kit, generic reagent names are used here for each of the components. PCR reaction mix, polymerase, and primer sets are all supplied in the kit; Type I water may be supplied in the kit or may
need to be supplied separately. If no polymerase volume is listed, it is included in the PCR reaction mix by the manufacturer. These amplifications are suitable for DNA extracts obtained from
traditional methods as well as those obtained from the ChargeSwitch® normalized extraction procedure. Volumes included are per sample and an extra 10% should be prepared for pipetting error
Rxn mix = PCR reaction mix
Total MM = Total master mix; includes PCR reaction mix, polymerase, primer set, and water
T = traditional DNA extract; quantitation is required, and the reaction should target ~0.375–1.500 or ~0.500–1.500 ng DNA for 3 μL or 6 μL reactions, respectively
N = normalized DNA extract; only suitable for 3 μL reactions in these settings
270 Catherine Cupples Connon

Table 2
Examples of 3 μL fast amplification reactions

Component Identifiler® Identifiler® Plus PowerPlex® 16 PowerPlex® 16 HS Yfiler®

KAPA2G™ Fast 1.500 1.500 1.500 1.500 1.500
Multiplex Mix
Primer set 0.600 0.600 0.300 0.300 0.600
Type I water – – 0.900 0.900 –
Total master mix 2.100 2.100 2.100 2.100 2.100
DNA extract 0.900 0.900 0.900 0.900 0.900
Older amplification kits had not yet incorporated fast PCR technology. This table provides examples of how to modify the
3 μL reaction reagents to include KAPA2G™ Fast Multiplex Mix in place of the manufacturer-supplied PCR reaction mix
and polymerase. Traditional DNA extracts (targeting ~0.375–1.500 ng DNA) or those obtained from the Charge-
Switch® normalized extraction procedure can be used. Volumes (μL) included are per sample and an extra 10% should be
prepared for pipetting error.

3. Using a multichannel pipette and a reagent trough, add 305 μL

of the prepared lysis buffer mixture to the respective wells of
the sample plate.
4. Apply and securely seal the sample plate with a foil seal using a
sealing tool (see Note 14).
5. Vortex the sample plate for 5 s, followed by a 1 min
centrifugation.
6. Sonicate the sample plate for 2 min.
7. Incubate the sample plate in a 56 °C oven for 1–2 h for buccal
swabs or overnight for buccal collector punches.
8. During the last 30 min or so of the incubation, prepare both
wash plates and the elution buffer plate needed for the MPS by
adding the necessary reagent volumes (see Table 6 and Note
15). After each reagent plate is prepared, apply a temporary
tape seal and quick spin (see Note 16).
9. For the lysate plate, add 100 μL ChargeSwitch® Purification
Buffer to the corresponding wells of a clean 96-well S-block
(see Notes 15 and 17). Apply a temporary tape seal and centri-
fuge the plate for a few seconds (see Note 16).
10. Thoroughly vortex the ChargeSwitch® Magnetic Beads for
15 s. Quickly transfer the necessary volume of beads to a
reagent trough, including an extra 10–15% for pipetting
error. Using a multichannel pipette, add 0.5 μL (for buccal
swabs) or 1.0 μL (for buccal collector punches) of beads to the
appropriate wells of the lysate plate (see Note 18). Apply a
temporary tape seal and quick spin the lysate plate (see Note
16).
Table 3
Examples of PCR thermal cycling parameters for 3 μL and 6 μL amplification reactions

Identifiler® PowerPlex® PowerPlex® PowerPlex® PowerPlex® Yfiler® PowerPlex®

®
PCR step Identifiler Plus 16 16 HS GlobalFiler™ Fusion Fusion 6C Yfiler® Plus Y23
Polymerase 95 °C 95 °C 96 °C 96 °C 95 °C 96 °C 96 °C 95 °C 95 °C 96 °C
activation 11 min 11 min 2 min 2 min 1 min 1 min 1 min 11 min 1 min 2 min
# of cycles
(3 μL) 26 26 10/18 10/18 27 28 27 28 28 28
(6 μL) 27 27 10/19 10/19 28 29 28 29 29 29
Denaturation 94 °C 94 °C 20 s 94/90 °C 94/90 °C 94 °C 10 s 94 °C 10 s 94 °C
96 °C 5 s 94 °C 4 s 94 °C 10 s
1 min 30 s 30 s 1 min
Annealing 59 °C 59 °C 3 min 60 °C 30 s 60 °C 30 s 59 °C 90 s 59 °C 1 min 60 °C 1 min 61 °C 61.5 °C 61 °C 1 min
1 min 1 min 1 min
Extension 72 °C – 70 °C 45 s 70 °C 45 s – 72 °C 30 s – 72 °C – 72 °C 30 s
1 min 1 min
Final 60 °C 60 °C 60 °C 60 °C 60 °C 60 °C 60 °C 60 °C 60 °C 60 °C
extension 60 min 10 min 30 min 30 min 10 min 10 min 10 min 80 min 22 min 20 min
Hold 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C
Total time ~2.75 h ~2 h ~2 h ~2 h ~1 h ~1 h ~0.75 h ~3 h ~1 h ~1.25 h
This table provides examples of PCR thermal cycling parameters for each of the STR amplification reactions shown in Table 1. All of these low volume reactions use slightly fewer
cycles compared to the standard volume reaction for each kit. For 3 μL reactions, the thermal cycler used must be compatible with a 384-well plate. Review the PowerPlex® 16/16
HS technical manuals for more information regarding ramp rates
Low Volume STR Amplification Options
271
272 Catherine Cupples Connon

Table 4
Examples of PCR thermal cycling parameters for 3 μL fast amplification reactions

Identifiler® PowerPlex® PowerPlex®

®
PCR step Identifiler Plus 16 16 HS Yfiler®
Polymerase 95 °C 1 min 95 °C 1 min 96 °C 1 min 96 °C 1 min 95 °C 1 min
activation
# of cycles 26 26 10 / 18 10 / 18 28
Denaturation 95 °C 5 s 95 °C 10 s 94/90 °C 15 s 94/90 °C 15 s 95 °C 5 s
Annealing 63 °C 40 s 63 °C 50 s 60 °C 15 s 60 °C 15 s 63 °C 40 s
Extension – – 70 °C 30 s 70 °C 30 s –
Final extension 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min
Hold 25 °C 25 °C 25 °C 25 °C 25 °C
Total time ~42 min ~50 min ~50 min ~50 min ~44 min
This table supplements Table 2 to demonstrate how the PCR thermal cycling parameters can be altered for older
amplification kits to achieve fast PCR. Most of the kits are able to utilize a 2-step PCR process, which helps facilitate
fast PCR. The thermal cycler used needs to be compatible with a 384-well plate and have a gold-plate or silver heat block.
Review the PowerPlex® 16/16 HS technical manuals for more information regarding ramp rates

Table 5
Lysis for normalized extraction

Reagent Swab Punch

®
50% ChargeSwitch Lysis Buffer 300 μL 300 μL
Proteinase K 5 μL 5 μL
Incubation at 56 °C 1–2 h overnight
®
A normalized extraction using the ChargeSwitch Forensic DNA Purification Kit is
suitable for use with buccal swabs or buccal collector punches, followed by low volume
amplification (quantitation not required). The lysis buffer mixture described in the table
above consists of 50% ChargeSwitch® Lysis Buffer and Proteinase K and is added to the
corresponding wells of the prepared sample plate. The volumes used for sample lysis are
the same for the each of the buccal samples, but the incubation times are different

11. Retain each of the reagent plates in a safe location until all
plates are ready for loading on the MPS.
12. After the incubation of the sample plate is complete (see Sub-
heading 3.2, step 7), remove the sample plate from the oven
and centrifuge it for ~30 s.
13. Use a (clean) manual plate piercer to pierce through the foil
seal of the sample plate (see Note 19). Remove the temporary
tape seal from the lysate plate and use a multichannel pipette to
transfer the lysate from the sample plate to the respective wells
of the lysate plate; do not transfer the substrate (see Note 20).
Apply a temporary tape seal and quick spin the lysate plate (see
Note 16).
 Low Volume STR Amplification Options 273

Table 6
Supplies and reagent plates for the MPS

Volume (μL) per well

Position Plate name Reagent + plate used Swab Punch

5 N/A 96-well microplate with rod cover N/A N/A
®
4 Elution plate ChargeSwitch Elution Buffer in S-block 60 80
3 Wash 2 plate ChargeSwitch® Wash Buffer in S-block 125 125
®
2 Wash 1 plate ChargeSwitch Wash Buffer in S-block 125 125
®
1 Lysate plate ChargeSwitch Purification Buffer + 100 100
ChargeSwitch® Magnetic Beads in S-block 0.5 1.0
The above table defines which reagents and plates are needed for DNA purification using the ChargeSwitch® Forensic
DNA Purification Kit on a 96-well magnetic particle separator (MPS). The plates are loaded in reverse order, starting with
position 5 and ending with position 1

14. Turn on the MPS and select the protocol for DNA purification
using the ChargeSwitch® kit; press “Start”. Load the rod cover
and reagent plates when prompted in positions 1–5 (loaded in
reverse order; see Table 6).
15. After the MPS is prepared, press “Start” to begin the purifica-
tion process. Purification takes ~20 min.
16. Once the purification process is complete, remove the elution
plate from position 4 of the MPS. If proceeding immediately to
amplification (see Subheading 3.1), apply a temporary tape seal
(see Note 16). Otherwise, securely seal the plate with a foil seal
using a sealing tool and store the plate at 4 °C for up to 1 week
or at -20 °C for long-term storage.
17. Remove and discard the rod cover and other reagent plates
from the MPS.

3.3 Traditional 1. Prepare enough formamide/size standard mixture for all sam-
Capillary ples/controls from the amplification plate, as well as the allelic
Electrophoresis ladders that will be processed (see Table 7 and Notes 21 and
Detection 22). Vortex thoroughly for 5–10 s.
2. Carefully remove the adhesive seal from the amplification plate
and add 4 μL water to each well containing amplification
product (see Note 23).
3. Transfer 10 μL of the prepared formamide/size standard mix-
ture to the necessary wells of a MicroAmp® Optical 96-Well or
384-Well Reaction Plate (see Notes 7 and 24).
4. Transfer 1 μL of the diluted amplification product to the
corresponding wells of the detection plate.
274 Catherine Cupples Connon

Table 7
Preparing amplification product for detection

PCR step GeneScan™ 500 LIZ®a GeneScan™ 600 LIZ® v2.0b ILS 600c WEN ILS 500d
Formamide 10 μL 10 μL 10 μL 10 μL
Size standard 0.2 μL 0.4 μL 0.5 μL 0.4 μL
A mixture of formamide and size standard is prepared as specified in the above table, of which 10 μL is combined with
1 μL diluted amplification product in the detection plate. Select the appropriate size standard for the amplification kit
used; some kits are compatible with more than one size standard
a
For use with Identifiler®, Identifiler® Plus, and Yfiler®
b
For use with Identifiler®, Identifiler® Plus, GlobalFiler™, Yfiler®, and Yfiler® Plus
c
For use with PowerPlex® 16 and PowerPlex® 16 HS
d
For use with PowerPlex® Fusion, PowerPlex® Fusion 6C, and PowerPlex® Y23

5. Transfer 1 μL of the manufactured-supplied allelic ladder to the

corresponding wells of the detection plate.
6. Carefully cover the plate with the corresponding septa (96-well
or 384-well).
7. Centrifuge the plate for 10–20 s. Ensure that all necessary wells
contain reagent.
8. Denature the plate for 5 min at 95 °C. Immediately snap freeze
for 5 min.
9. While the plate is denaturing and/or snap freezing, prepare the
instrument for electrophoresis: replace/replenish any reagents
(anode/cathode buffer, water, and/or polymer), as necessary;
preheat the oven to 60 °C; and prepare the plate map in the
Data Collection software, using a 3 kV 7 s or a 1.2 kV 15 s
injection with the 3130 or 3500 series instrument, respectively
(see Note 25). The protocol used should be standard for frag-
ment analysis using POP-4 polymer and a 36 array.
10. Once the denature/snap freeze step is complete (see Subhead-
ing 3.3, step 8), secure the detection plate in a base and
retainer. Load it on the capillary electrophoresis instrument,
link the plate map, and start the run.
11. Once the plate has been processed, the data files can be
imported into the STR profile analysis software of choice,
such as GeneMapper™ ID-X.
12. The detection plate can be discarded or stored at -20 °C for up
to 1 month if future reprocessing is desired.

3.4 Alternative 1. To prepare the 3130 series Genetic Analyzer for alternative
Capillary capillary electrophoresis, ensure that a 22 cm array and
Electrophoresis POP-6 polymer are installed (see Note 26). If not, perform
Detection (POP-6 and the Change Polymer Type Wizard first (selecting POP-6 as the
22 cm Array) polymer type), followed by the Install Array Wizard (selecting
a 22 cm array as the array length) (see Note 27).
 Low Volume STR Amplification Options 275

Fig. 1 Creating new run modules for alternative capillary electrophoresis. Both a regular and spectral run
module need to be created for alternative capillary electrophoresis. Any existing run module (of the same type)
can be selected from the drop-down list to be used as a template, after which the necessary settings can be
altered. Settings need to coincide with the amplification kits (see Table 8), or more precisely, with the dye sets
used. The regular and spectral run modules displayed above are for use with the Identifiler®, Identifiler® Plus,
and Yfiler® amplification kits (all of these use Dye Set G5 from Applied Biosystems)

2. Next, prepare run modules in the Data Collection software.

Click on Module Manager in the navigation pane on the left.
Click New to prepare a new run module. Complete the infor-
mation requested in the Run Module Editor (see Fig. 1); the
type of module should be designated as “regular” from the
drop-down list (see Note 28). The module settings from the
template selected should be modified to match those displayed
in Table 8 for the desired amplification kit (see Notes 29 and
30). Repeat this process for the accompanying spectral run
module (designate as “spectral” from the drop-down list)
needed for the kit (see Notes 31 and 32).
3. Once the run modules have been prepared, new instrument
protocols need to be created as well (see Note 33). Click on
Protocol Manager in the navigation pane, then click New.
276 Catherine Cupples Connon

Table 8
Creating run modules for alternative capillary electrophoresis

Identifiler® PowerPlex® 16,

Identifiler® Plus, Yfiler® PowerPlex® 16 HS

Parameter Regular Spectral Regular Spectral

Oven temperature 63 °C 63 °C 63 °C 63 °C
Polymer fill volume 5900 5900 5900 5900
Current stability 5 5 5 5
PreRun voltage 14 14 14 14
PreRun time 60 180 60 180
Injection voltage 2 1.2 2 3
Injection time 7 18 7 18
Voltage # of steps 10 40 10 40
Voltage step interval 20 15 20 15
Data delay time 175 1 175 1
Run voltage 14 14 14 14
Run time 905 480 1150 480
If desired, the 3130 series Genetic Analyzer can be used for detection of STR profiles
using modified conditions (POP-6 polymer and a 22 cm array) to reduce the detection
time. To do so, the instrument needs modified run modules and instrument protocols
that are compatible with this setup. Use the table above to modify the run module
settings accordingly for the desired amplification kit. Once the run modules are defined,
instrument protocols can be set up to utilize the new run modules. Regular and spectral
run modules/protocols are needed for a kit

Complete the information requested in the Protocol Editor (see

Fig. 2). Select the newly created, regular run module (it should
appear in the drop-down list) and the corresponding dye set
(see Note 34). Repeat this process for the spectral instrument
protocol, selecting the newly created, spectral run module.
Only the spectral protocol has the polymer and array length
designated.
4. Once the instrument and Data Collection software have been
set up for detection using POP-6 polymer and a 22 cm array,
prepare the detection plate as described for traditional detec-
tion (see Subheading 3.3). When preheating the oven (see Sub-
heading 3.3, step 9), set it to 63 °C. Using the run modules
displayed in Table 8, these samples will undergo a 2 kV 7 s
injection (see Note 25).
 Low Volume STR Amplification Options 277

Fig. 2 Creating new instrument protocols for alternative capillary electrophoresis. Once the regular and
spectral run modules have been created, corresponding instrument protocols need to be created for each type
as well. The newly created run modules will appear in the drop-down list and can be selected for the specific
type of protocol (regular versus spectral). Notice that only the spectral protocol has fields to designate the
polymer type and array length. The regular and spectral protocols displayed above are for use with the
Identifiler®, Identifiler® Plus, and Yfiler® amplification kits, as these all use Dye Set G5

4 Notes

1. A 96-well plate is needed for 6 μL amplifications and a 384-well

plate is needed for 3 μL amplifications.
2. This reagent is only needed for fast PCR protocols for kits that
were not originally designed for fast PCR, such as AmpFlSTR
Identifiler/Identifiler Plus and PowerPlex 16/16 HS. Newer
kits like GlobalFiler and PowerPlex Fusion/Fusion 6C have
already been optimized for fast PCR and are sold as such.
3. POP-6 and the 22 cm array are only used for the alternative
detection method for the 3130 series Genetic Analyzer.
4. DNA input is relative and based on the quantification method
used. The overall workflow also impacts the amount of DNA
that is targeted. Laboratories will need to evaluate what range
of input DNA yields optimal STR profiles for each of the
amplification kits they plan on using. Minor adjustments to
cycle number (increasing or decreasing by one cycle) may also
prove fruitful.
278 Catherine Cupples Connon

5. Use of a normalized extraction procedure allows extracts to

proceed immediately to amplification, without the need for
quantification. A specific volume of extract is added to the
reaction. If the resultant STR profiles are routinely not high
quality, the volume of extract added to the reaction can be
modified per kit, with modifications made to the volume of
water added to the master mix to compensate for the change in
DNA volume. If more significant changes are needed for a
specific kit, alterations can be made to the volume of beads
and/or Elution Buffer used in the normalized extraction,
and/or the number of PCR cycles for amplification, the vol-
ume of PCR product used for capillary electrophoresis detec-
tion, and/or the injection parameters (injection voltage
and/or time). There are many opportunities for fine tuning
and customization of the process for individual laboratories.
Once a suitable combination of parameters is identified, it is
reasonable to expect >95% first-pass success rate for buccal
samples.
6. Manufacturers advise against centrifugation of some highly
concentrated reagents (e.g., some PowerPlex® reagents).
Read manufacturer protocols carefully.
7. Follow appropriate documentation practices (e.g., use of a
plate map designating the identification and location of each
sample/control).
8. Make sure the seal is secure—especially around the corners and
edges—and devoid of creases. A poorly sealed plate is suscepti-
ble to evaporation, which can lead to poor amplification, espe-
cially for these very low reaction volumes.
9. It is good practice to turn the thermal cycler on in advance to
allow it to initialize. The PCR program should also be entered
and stored in advance.
10. The fluorescent signal decreases over time, so the plate should
be processed within roughly 12–24 h following amplification.
If necessary, the plate can be store at -20 °C for future detec-
tion. Freezing should help deter the loss of fluorescent signal
somewhat, but loss will still occur.
11. The protocols are different for buccal swabs versus buccal
collectors, so do not process a plate with both types of samples.
12. Though no longer required by the FBI Quality Assurance Stan-
dards [22], a laboratory can choose to process a positive extrac-
tion control in their standard operating procedure (SOP).
13. Mixing should be thorough to create a homogenous solution,
but if too aggressive, bubbles may result, in which case 10–15%
extra for pipetting error may not be enough.
 Low Volume STR Amplification Options 279

14. It is imperative that the plate is securely sealed, otherwise

contamination will occur when the plate is vortexed (see Sub-
heading 3.2, step 5).
15. Use a multichannel pipette and a reagent trough for each
reagent/plate. Include 10–15% extra volume for pipetting
error.
16. The temporary plate seals can be applied by (a gloved) hand.
They will only be on the plates for a short period of time and do
not need to be thoroughly sealed using a sealing tool.
17. Do not make a mixture of purification buffer and magnetic
beads. These components need to be added separately to
ensure that the required amount of beads is added to each well.
18. Gently and slowly pipette the beads up and down in the reagent
trough to ensure that they are mixed prior to transferring the
required volume to the lysate plate. Also check that each tip of
the multichannel pipette has the appropriate volume of beads
immediately prior to transferring them to the lysate plate. Once
the beads have been added to the lysate plate, gently and slowly
pipette up and down a few times in the purification buffer that
is already present in the wells to ensure that all of the beads are
transferred from the tips. Tips may need to be changed
between additions of beads.
19. The plate piercer must be decontaminated in between each use.
It is suggested to soak it in a detergent for several minutes,
scrub the piercers with a scrubbing tool (wire brush), soak in
10% bleach for several minutes, and then thoroughly rinse with
Type I water. Air dry prior to its next use.
20. Be sure to transfer all of the liquid lysate from the sample plate
to the lysate plate. There should be ~300 μL transferred to each
well. It is recommended to set the pipette to something higher
than 300 (e.g., 400) to ensure that all lysate is transferred. Be
mindful of bubble formation during the transfer.
21. The formamide/size standard preparation in Table 7 includes a
very small amount of overage. An additional 5–10% extra
should be prepared to account for pipetting error.
22. A minimum of two allelic ladders should be processed. For a
full plate, three ladders may be beneficial—especially if your
particular capillary electrophoresis instrument is subject to
run-to-run migration/separation variability—but is not
required. Instruments with low levels of run-to-run variability
should be fine with two ladders.
23. Given the low volume reactions, the amplification product
needs to be diluted in preparation for detection.
24. Ensure that there are no empty wells in the set of wells that will
be injected together.
280 Catherine Cupples Connon

25. Injection time may need to be altered slightly given

instrument-to-instrument sensitivity.
26. This alternative process is for 3130 series Genetic Analyzers, not
the 3500. The latter already has decreased electrophoresis run
times.
27. The Wizards drop-down menu is located along the toolbar at
the top of the Data Collection window. For more information,
see the reference guides supplied by the manufacturer [24, 25].
28. A regular run module is used for STR profile detection. A
separate spectral run module is needed for spectral calibration.
29. The oven temperature has been increased to 63 °C compared
to that used in traditional capillary electrophoresis for this
instrument type and amplification product to help reduce pro-
cessing time with the more viscous POP-6 polymer [14, 23].
30. The injection voltage has been reduced from that used in tradi-
tional capillary electrophoresis for this instrument type and ampli-
fication product given the increased sensitivity under these
conditions. The injection parameters can be further adjusted via
slight changes to the injection time to fine-tune the resulting STR
profiles (most notably to adjust peak heights).
31. For more information regarding creating/modifying new
modules, see the reference guides supplied by the manufacturer
[24, 25].
32. A new spectral calibration needs to be performed using the new
run module. The instrument must have POP-6 polymer and a
22 cm array installed at the time of the spectral calibration.
33. Instrument protocols use a specific run module, so run mod-
ules must be created first.
34. For the Identifiler, Identifiler Plus, and Yfiler Plus kits, Dye Set
G5 is used. For PowerPlex 16 and PowerPlex 16 HS, select the
dye set that has been customized for these kits in the instru-
ment being used.

References
1. Mullis KB, Faloona FA (1987) Specific synthe- revision K. Available via Thermo Fisher Scien-
sis of DNA in vitro via a polymerase-catalyzed tific. https://www.thermofisher.com/docu
chain reaction. Methods Enzymol 155:335– ment-connect/document-connect.html?url=
350. https://doi.org/10.1016/0076-6879 https://assets.thermofisher.com/TFS-Assets%
(87)55023-6 2FLSG%2Fmanuals%2Fcms_041201.pdf.
2. Connon CC, LeFebvre AK, Benjamin RC Accessed 18 July 2022
(2016) Validation of low volume, fast PCR 4. Thermo Fisher Scientific (2018) AmpFlSTR™
amplification of STR loci for reference DNA Identifiler™ Plus PCR Amplification Kit user
samples. J Forensic Leg Investig Sci 2:008. guide, revision H. Available via Thermo Fisher
https://doi.org/10.24966/FLIS-733X/ Scientific. https://www.thermofisher.com/
100008 document-connect/document-connect.html?
3. Thermo Fisher Scientific (2018) AmpFlSTR™ url=https://assets.thermofisher.com/TFS-
Identifiler™ PCR Amplification Kit user guide, Assets%2FLSG%2Fmanuals%2F4440211_
 Low Volume STR Amplification Options 281

AmpFlSTR_IdentifilerPlus_UG.pdf. Accessed Genetic Analyzers technical manual. Available

18 July 2022 via Promega. https://www.promega.com/-/
5. Thermo Fisher Scientific (2019) GlobalFiler™ media/files/resources/protocols/technical-
and GlobalFiler™ IQC PCR Amplification Kits manuals/101/powerplex-y23-system-proto
user guide, revision F. Available via Thermo col.pdf. Accessed 18 July 2022
Fisher Scientific. https://www.thermofisher. 13. Connon CC, LeFebvre AK, Benjamin RC
com/document-connect/document-connect. (2016) Assessment of four polymerases for
html?url=https://assets.thermofisher.com/ low volume, fast PCR amplification of STR
TFS-Assets%2FLSG%2Fmanuals%2F4477604. loci for DNA reference samples. J Forensic
pdf. Accessed 18 July 2022 Leg Investig Sci 2:009. https://doi.org/10.
6. Thermo Fisher Scientific (2014) AmpFlSTR® 24966/FLIS-733X/100009
Yfiler® PCR Amplification Kit user guide, revi- 14. Connon CC (2015) Improving processing effi-
sion J. Available via Thermo Fisher Scientific. ciency for forensic DNA samples. Dissertation,
https://www.thermofisher.com/document- University of North Texas
connect/document-connect.html?url= 15. Verheij S, Harteveld J, Sijen T (2012) A proto-
https://assets.thermofisher.com/TFS-Assets% col for direct and rapid multiplex PCR amplifi-
2FLSG%2Fmanuals%2F4358101_ cation on forensically relevant samples.
AmpflstrYfilerKit_UG.pdf. Accessed Forensic Sci Int Genet 6(2):167–175.
18 July 2022 https://doi.org/10.1016/j.fsigen.2011.
7. Thermo Fisher Scientific (2019) Yfiler™ Plus 03.014
PCR Amplification Kit user guide, revision 16. Laurin N, Frégeau C (2012) Optimization and
D. Available via Thermo Fisher Scientific. validation of a fast amplification protocol for
https://www.thermofisher.com/document- AmpFlSTR® Profiler Plus® for rapid forensic
connect/document-connect.html?url= human identification. Forensic Sci Int Genet
https://assets.thermofisher.com/TFS-Assets% 6(1):47–57. https://doi.org/10.1016/j.
2FLSG%2Fmanuals%2F4485610_YfilerPlus_ fsigen.2011.01.011
UG.pdf. Accessed 18 July 2022 17. Foster A, Laurin N (2012) Development of a
8. Promega Corporation (2022) PowerPlex® fast PCR protocol enabling rapid generation of
16 System technical manual. Available via Pro- AmpFlSTR® Identifiler® profiles for genotyp-
mega. https://www.promega.com/-/media/ ing of human DNA. Investig Genet 3:1–11.
fi l e s / r e s o u r c e s / p r o t o c o l s / t e c h n i c a l - https://doi.org/10.1186/2041-2223-3-6
manuals/101/powerplex-16-system-protocol. 18. Vallone PM, Hill CR, Butler JM (2008) Dem-
pdf. Accessed 18 July 2022 onstration of rapid multiplex PCR amplifica-
9. Promega Corporation (2022) PowerPlex® tion involving 16 genetic loci. Forensic Sci Int
16 HS System for use on the Applied Biosys- Genet 3(1):42–45. https://doi.org/10.1016/
tems® Genetic Analyzers technical manual. j.fsigen.2008.09.005
Available via Promega. https://www.promega. 19. Hedman J, Albinsson L, Ansell C et al (2008) A
com/-/media/files/resources/protocols/ fast analysis system for forensic DNA reference
technical-manuals/101/powerplex-16-hs-sys samples. Forensic Sci Int Genet 2(3):184–189.
tem-protocol.pdf. Accessed 18 July 2022 https://doi.org/10.1016/j.fsigen.2007.
10. Promega Corporation (2020) PowerPlex® 12.011
Fusion System for use on the Applied Biosys- 20. Connon CC, LeFebvre AK, Benjamin RC
tems® Genetic Analyzers technical manual. (2016) Development of a normalized extrac-
Available via Promega. https://www.promega. tion to further aid in fast, high-throughput
com/-/media/files/resources/protocols/ processing of forensic DNA reference samples.
technical-manuals/101/powerplex-fusion-sys Forensic Sci Int Genet 25:112–124. https://
tem-protocol.pdf. Accessed 18 July 2022 doi.org/10.1016/j.fsigen.2016.07.019
11. Promega Corporation (2020) PowerPlex® 21. Gray K, Crowle D, Scott P (2014) Direct
Fusion 6C System for use on the Applied Bio- amplification of casework bloodstains using
systems® Genetic Analyzers technical manual. the Promega PowerPlex® 21 PCR amplifica-
Available via Promega. https://www.promega. tion system. Forensic Sci Int Genet 12:86–92.
com/-/media/files/resources/protocols/ https://doi.org/10.1016/j.fsigen.2014.
technical-manuals/101/powerplex-fusion-6c- 05.003
system-protocol.pdf. Accessed 18 July 2022
22. FBI (2020) Quality Assurance Standards for
12. Promega Corporation (2021) PowerPlex® Y23 forensic DNA testing laboratories. Available
System for use on the Applied Biosystems® via Scientific Working Group on DNA Analysis
282 Catherine Cupples Connon

Methods (SWGDAM). https://www.swgdam. started guide, revision D. Available via Thermo

org/_files/ugd/4344b0_d73afdd0007c4 Fisher Scientific. https://assets.thermofisher.
ed6a0e7e2ffbd6c4eb8.pdf com/TFS-Assets/LSG/manuals/cms_0414
23. Connon CC, LeFebvre AK, Benjamin RC 68.pdf. Accessed 18 July 2022
(2016) Validation of alternative capillary elec- 25. Thermo Fisher Scientific (2021) Applied Bio-
trophoresis detection of STRs using POP-6 systems 3500/3500xL Genetic Analyzer: user
polymer and a 22 cm array on a 3130xl Genetic guide, revision E. Available via Thermo Fisher
Analyzer. Forensic Sci Int Genet 22:113–127. Scientific. https://assets.thermofisher.com/
https://doi.org/10.1016/j.fsigen.2016. TFS-Assets/LSG/manuals/100031809_3
02.006 500_3500xL_Software_v3_1_UG.pdf.
24. Applied Biosystems (2010) Applied Biosystems Accessed 18 July 2022
3130/3130xl Genetic Analyzers: getting
 Part V

STR Profile Detection and Interpretation

 Chapter 18

Capillary Electrophoresis with Applied Biosystems’ 3500

Genetic Analyzer
Kara Kovach

Abstract
The Applied Biosystems® 3500/3500xL Genetic Analyzer is a capillary electrophoresis system used to
perform fragment analysis of forensic samples (Thermo Fisher Scientific, Applied Biosystems 3500/
3500xL Genetic Analyzer User Guide, Revision C, 2010). In this chapter, a procedure is described that
details how to load reagents, set up the software, and prepare and process a sample plate.

Key words Applied Biosystems, Genetic Analyzer, Capillary electrophoresis, Fragment analysis, 3500,
3500xL

1 Introduction

The Applied Biosystems® 3500/3500xL Genetic Analyzer is a

capillary electrophoresis system used to perform fragment analysis
of forensic samples using either an 8-capillary array (3500) or a
24-capillary array (3500xL) [1]. Polymer fills each of the capillaries
and acts as a sieve that separates fluorescently labeled DNA frag-
ments by size. In the detection cell of the instrument, a laser excites
the fluorescent labels causing them to emit light of different wave-
lengths, which is then captured by a CCD camera [1]. The 3500
Data Collection Software collects the data from the camera and
generates an electropherogram. While the 3500 Data Collection
Software is capable of basic data analysis, it needs to be transferred
to a secondary software program (such as GeneMapper™ ID-X) for
further analysis [1]. The 3500 and 3500xL Genetic Analyzers are
fully automated and can process 96 samples in approximately 6 or
2 hours, respectively (however, this is subject to variation depend-
ing on the amplification kit utilized) [1]. Additionally, the instru-
ment is capable of performing electrophoresis of a 364-well plate.

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_18,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

285
286 Kara Kovach

In this chapter, a procedure is described that details how to load

reagents, set up the software, and prepare and process a sample
plate.

2 Materials

The materials required for instrument setup and capillary electro-

phoresis (CE) plate setup are:
1. Anode Buffer Container (ABC) (see Notes 1–4).
2. Cathode Buffer Container (CBC) (see Notes 1–4).
3. Capillary Array (8-capillary for the 3500 and 24-capillary for
the 3500xL).
4. Polymer Pouch (see Notes 1, 2, 4, and 5).
5. Conditioning Reagent (see Notes 1, 2, and 6).
6. CBC septa.
7. Internal lane standard (ILS).
8. Amplification kit-specific allelic ladder.
9. PCR amplification products.
10. Formamide (see Notes 7 and 8).
11. MicroAmp™ Optical 96-Well plates.
12. 96-well plate septa.
13. Plate base and retainer.
14. Plate centrifuge.
15. Heat block or thermocycler.
16. 96-well ice block.
17. Distilled or deionized water.
18. Pump syringe.
19. Fragment analysis HID standard, or Sequencing standard (see
Note 9).

3 Methods

The protocols below are based on the manufacturer’s user guide for
the instrument and on-site training provided by an Applied Biosys-
tems representative [1, 2].

3.1 Turning the 1. Turn on the computer and wait for the login screen to appear.
Instrument On 2. Turn on the instrument and wait for the indicator light to turn
green.
3. Log into the computer.
 3500(xL) Capillary Electrophoresis 287

Fig. 1 3500 server monitor. When starting up the instrument, it is important to

wait for the 3500 Server Monitor to show “Y” for all indicators prior to opening
the 3500 Data Collection Software

4. Wait for the 3500 Server Monitor to indicate “Y” for all
indicators (see Fig. 1).
5. Log into the 3500 Data Collection Software.

3.2 Turning the 1. Exit the 3500 Data Collection Software.

Instrument Off 2. Turn off the instrument.
3. Turn off the computer.

3.3 Loading the 1. Remove the ABC from storage and bring to room temperature.
Anode Buffer 2. Tilt the ABC so that most of the buffer is in the larger side of
Container (ABC) the container, verifying that it is at the fill line. Remove the seal.
3. Slide the ABC into place underneath the pump (see Note 10
and Fig. 2).
4. Close the instrument door and click “Refresh” on Dashboard
to update (see Fig. 3).

3.4 Loading the 1. Remove the CBC from storage and bring to room
Cathode Buffer temperature.
Container (CBC) 2. Tilt the container back and forth until the buffer reaches the fill
line on both sides. Place on a flat surface and remove the seal.
3. Carefully wipe off any liquid that is on the top of the container
with a laboratory wipe.
4. Place the appropriate septa on both sides of the CBC. The septa
with the collar are placed on the left side (or the side with
24 larger holes). The flat septa are placed on the right side
(the side with 48 smaller holes) (see Note 11 and Fig. 4).
288 Kara Kovach

Fig. 2 3500 interior components: pump block. The pump block contains some of the consumables used by the
instrument, as well as the polymer delivery pump, which is responsible for pumping polymer into the array.
The areas of particular importance are indicated on the figure: (a) Anode Buffer Container (ABC); (b) polymer
pouch; (c) arm that raises and lowers the polymer pouch during installation of a new pouch; (d) the Polymer
Delivery Pump, which contains thin channels in which bubbles may arise; (e) port to inject water into the pump
channels to eliminate bubbles that remain after running the Remove Bubbles wizard

Fig. 3 Consumables pane on the dashboard. This information pane on the Dashboard keeps track of important
information on the 3500 consumables that are currently loaded on the instrument. (a) Prior to each run, check
to ensure that reagents are not expired and that there are enough consumables remaining to run your sample
plate. (b) After loading new reagents onto the instrument, click the “Refresh” button to update the information
in the system
 3500(xL) Capillary Electrophoresis 289

Fig. 4 Autosampler with CBC and plate retainer loaded. The autosampler is home
to the CBC and is the area onto which sample plates are loaded. (a) The CBC
(with septa) is installed at the front of the autosampler. (b) When installing the
CBC, squeeze the middle part of the CBC. (c) Additionally, when loading sample
plates onto the instrument, the notched edge of the plate retainer should face out
and to the right

5. Carefully load the CBC onto the autosampler. The side with
24 holes should be on the “A” side of the autosampler (see
Note 12 and Fig. 4).
6. Close the instrument door and click “Refresh” on the Dash-
board to update (see Fig. 3).

3.5 Maintenance 1. The 3500 Data Collection Software has “Maintenance

Wizards Wizards” (see Fig. 5) that have detailed instructions on how
to perform a variety of functions. After performing each wiz-
ard, click “Refresh” on the Dashboard to update the reagent
information (see Fig. 3).
2. Use the “Install a capillary array” wizard to install or change a
capillary array (15–45 min) (see Note 13).
3. Use the “Remove bubbles from the polymer pump” wizard
when bubbles have been identified in the polymer pump
(5–15 min). These should be removed prior to running the
instrument.
4. Use the “Wash the pump chamber and channels” wizard when
there is dried polymer present in the polymer delivery pump
(>40 min). Dried polymer should be removed from these areas
prior to running the instrument.
5. Use the “Fill the array with fresh polymer” wizard when instal-
ling a new array on the instrument.
6. Use the “Replenish the polymer installed on the instrument”
wizard when installing a polymer pouch of the same polymer
type (10–20 min) (see Note 14).
290 Kara Kovach

Fig. 5 Maintenance wizard home screen. The 3500 Data Collection Software has wizards that perform
common maintenance tasks. These wizards are located within the “Maintenance” tab, under the “Mainte-
nance” header in the navigation pane

7. Use the “Change the type of polymer installed on the instru-

ment” wizard when changing the type of polymer installed on
the instrument (60–70 min).
8. Use the “Shutdown the instrument” wizard if the instrument
will not be used for more than 2 weeks, or if the instrument is
being moved and requires the conditioning reagent (60 min).
9. Use the “Reactivate the instrument” wizard after an instru-
ment has been shut down using the “Shutdown the instru-
ment” wizard (45 min).

3.6 Spatial 1. Go to the “Maintenance” tab and in the “Calibration” naviga-

Calibrations tion pane, select Spatial (see Note 15 and Fig. 6).
2. In the “Options” pane, select whether to perform the calibra-
tion with or without filling the array with fresh polymer from
the polymer pouch by selecting either “Fill” or “No Fill,”
respectively (see Notes 16 and 17).
3. Click “Start Calibration”.
4. Evaluate the results. Ensure that each capillary has one sharp
peak. The “+” needs to be at the point/top of every peak. All
peaks should be approximately the same height. “Accept
Results” or “Reject Results” based on these criteria.
 3500(xL) Capillary Electrophoresis 291

Fig. 6 Spatial and spectral calibration wizards. The 3500 Data Collection
Software has wizards to aid in performing spatial and spectral calibrations.
These can be found within the “Maintenance” tab, under the “Calibrate” header
in the navigation pane. (a) Select “Spatial” to perform a spatial calibration.
(b) Select “Spectral” to perform a spectral calibration

3.7 Spectral 1. Prior to performing a spectral calibration, check the status of

Calibrations the reagents in the Dashboard to ensure that they are not
expired (see Note 18). Additionally, check the status of the
pouch and the capillary array to ensure that there are more
“Samples Remaining” and “Injections Remaining” than will be
used by your plate (see Fig. 3).
2. Check for bubbles in the polymer pump and run the “Remove
Bubble” wizard if any are identified (see Note 19).
3. Set the oven temperature to either 60 °C (POP-7™ and
POP-4™) or 50 °C (POP-6™) and click “Start Pre-heat”
prior to setting up the spectral calibration plate (see Note 20).
4. Calibration standards should be prepared according to the
product insert (see Note 21).
5. Set up your spectral calibration plate according to Fig. 7.
292 Kara Kovach

Fig. 7 Spectral calibration plate. This guide indicates how to set up the spectral calibration plate according to
the number of capillaries and plate capacity of your 3500 instrument. (a) For a 96-well plate on an 8-capillary
instrument, use wells A1 through H1. (b) For a 96-well plate on a 24-capillary instrument, use wells A1
through H1, A2 through H2, and A3 through H3. (c) For a 384-well plate on a 24-capillary instrument, use
columns 1, 3, and 5 in rows A, C, E, G, I, K, M, and O. The 8-capillary instrument does not support 384-well
plates [1]

6. Place septa on the plate (see Note 11).

7. Centrifuge your plate at maximum speed for 3 min. Ensure that
the liquid is at the bottom of each loaded well.
8. Place the plate into the plate base (blue). Attach the plate
retainer (white) to the base (see Note 22 and Fig. 8).
9. Press the “Tray” button on the instrument.
10. Wait until the autosampler tray finishes its movement. Open
the door. The indicator light on the instrument will blink
yellow.
11. Place the plate onto the autosampler tray in either position A
or B, noting which position is used. The labels on the plate
retainer should face you and the notched corners of the plate
and the autosampler should line up (see Fig. 4).
12. Close the door. Wait until the autosampler tray finishes its
movement and the indicator light is green.
13. Go to the “Maintenance” tab, and in the “Calibration” navi-
gation pane, select Spectral (see Fig. 6).
14. In the “Calibration Settings” pane, choose the number of
wells, plate position, chemistry standard, and dye set (see
Note 21 and Fig. 9).
15. Select “Allow Borrowing” (see Note 23 and Fig. 9).
16. Click “Start Run”.
 3500(xL) Capillary Electrophoresis 293

Fig. 8 Plate assembly. The 96-well plate with septa (shown on the right) is secured within the plate base (blue;
middle) and the plate retainer (white; left) prior to loading onto the instrument

17. After the run is complete, review the data. Green indicates a
passing capillary, red a failing capillary, and yellow a borrowed
capillary with an arrow pointed to the capillary that was bor-
rowed from (see Fig. 10). Click on each capillary to display the
data and ensure that it meets the criteria established in Table 1.
18. If the criteria in Table 1 is met for all capillaries, click “Accept
Results.” If any capillaries do not meet the criteria, click
“Reject Results.”

3.8 Preparing the 1. In the Dashboard, check the status of the reagents to ensure
Instrument for that they are not expired. Additionally, check the status of the
Electrophoresis pouch and the capillary array to ensure that there are more
“Samples Remaining” and “Injections Remaining” than will be
used by your plate (see Fig. 3).
2. Check for bubbles in the polymer pump and run the “Remove
Bubble” wizard if any are identified (see Note 19).
3. Click “Create Plate from Template” located on the Dashboard
(see Fig. 11).
4. Choose the appropriate template from the list for your plate
(see Note 24). Select the chosen template and click “Open.”
5. Enter a plate name and your initials in the “Owners” box, and
click “Save.” The number of wells, plate type, capillary length,
and polymer should be pre-set by your template (see Fig. 12).
6. Click “Assign Plate Contents” (see Fig. 12).
294 Kara Kovach

Fig. 9 Spectral calibration set up screen. (a) When running a spectral calibration, the software requires you to
indicate the number of wells of your plate and its position on the autosampler, (b) the chemistry standard and
dye set being used, and (c) whether you want to “Allow Borrowing” (which enables the software to use data
from an adjacent capillary). (d) Once this information is entered, click “Start Run” to begin the calibration [1]

7. Using either the “Plate View” or the “Table View,” enter your
sample names in their assigned wells.
8. In “Plate View,” assign assays, file name conventions, and
results group by highlighting the wells to be injected and
clicking the checkbox next to the chosen settings. Multiple
assays can be used in a single plate by assigning different
settings to different wells (see Note 24 and Fig. 13).
9. (Optional) You can specify the sample type (sample, controls,
allelic ladder, etc.) at this stage by changing it either on the
“Table View” screen or by expanding the “Customize Sample
Info” pane on the “Plate View” screen (see Note 25 and
Fig. 13).
 3500(xL) Capillary Electrophoresis 295

Fig. 10 Spectral calibration capillary run data. This is an example of a passing spectral calibration. The green
squares indicate that the capillaries passed. If a capillary failed during a run, the square for that capillary in
that run column would be red. If the instrument was able to borrow data from an adjacent capillary, the square
for the failed capillary in the “Overall” row would be yellow with an arrow indicating which capillary the data
was borrowed from [1]

Table 1
Acceptance criteria for a spectral calibration

4- Dye 4-Dye Fragment 5-Dye Fragment

Sequencing analysis/HID analysis/HID
Order of peak in the spectral Blue-green- Blue-green- Blue-green-yellow-
profile from left to right yellow-red yellow-red red-orange
Order of the peaks in the raw Red-yellow- Red-yellow- Orange-red-yellow-
data profile from left to right blue-green green-blue green-blue
Extraneous peaks in the raw data file None None None
Use this table to assess the results of the spectral calibration for each capillary. Pay attention to whether you are looking at
the spectral profile or the raw data profile as the expected peak color order is different.

10. Save your plate (see Fig. 13). Stay on this screen until you have
loaded your plate onto the instrument (see Subheading 3.10).
11. (Optional) You can print the plate map for reference while
loading your sample plate by clicking “View Plate Grid
Report” and selecting “Print.” You can also choose to print
this in list format by clicking “Export.” These different formats
contain the same information.
12. Continue on to set up the sample plate (see Subheading 3.9).

3.9 Sample Plate Set 1. Set the oven temperature to either 60 °C (POP-7™ and
Up POP-4™) or 50 °C (POP-6™) and click “Start Pre-heat”
prior to setting up the sample plate (see Note 20).
2. Prepare a formamide:ILS master mix for all samples, controls,
and allelic ladders that will be processed. Aliquot specified
296 Kara Kovach

Fig. 11 Dashboard shortcuts and tabs. The shortcuts located on the Dashboard contain most of the functions
you will need to perform. The “Create Plate from Template” option is circled and is the shortcut you would
click to begin setting up a sample plate run. Additionally, you can navigate to the maintenance wizards with
one of these shortcuts. The tabs at the top help you to navigate between screens in the software. The main
tabs to be aware of are the “Dashboard” tab, which functions as a home button; the “Workflow” tab, which is
where you will find your current plate setup and run information; and the “Maintenance” tab, which is where
you will find the maintenance wizards and spectral/spatial calibration wizards

Fig. 12 “Define Plate Properties” screen. The “Define Plate Properties” screen is the first screen you will
encounter when setting up a sample plate in the 3500 Data Collection Software. (a) Fill out the plate name and
owner’s initials, (b) save the plate by clicking the “Save Plate” button, and (c) then click the “Assign Plate
Contents” button to navigate to the next screen

volume of master mix into every well of the 96-well plate that
will be used on the instrument (see Notes 26–28 and Fig. 14).
3. Add 1 μL of DNA amplification product into the assigned
wells.
 3500(xL) Capillary Electrophoresis 297

Fig. 13 “Assign Plate Contents” screen. The “Assign Plate Contents” screen is where you input information
about your sample plate into the 3500 Data Collection Software. (a) You can do this using either the “Plate
View” or the “Table View” and can toggle between them using the tabs towards the top. (b) Once you have
added your samples, assign appropriate assays, file name convention, and results group as determined by
your laboratory’s protocols. (c) Then, assign the appropriate sample type (Allelic Ladder, Sample, Positive
Control, etc.) to the wells by expanding the “Customize Sample Info” pane and (d) using the drop-down menu
labeled “Sample Type”. (e) When complete, load your physical sample plate onto the autosampler and click
the “Link Plate for Run” button

Fig. 14 Injection capacity of the 3500 versus 3500xL. The outlines demonstrate
the number of wells one injection of the 3500 (blue) versus the 3500xL (orange)
would encompass. Ensure that all wells within an injection are loaded with a
suitable liquid (do not use water)
298 Kara Kovach

4. Add 1 μL of the appropriate allelic ladder into the assigned

wells (see Notes 29 and 30).
5. Once all samples and allelic ladders are added, place septa on
the plate (see Note 11).
6. Centrifuge the plate at maximum speed for 3 min. Check to
ensure that all liquid is at the bottom of each well.
7. (Optional but recommended) Denature the plate at 95 °C for
3 min. Follow by placing the plate on ice for 3 min (see Notes
31 and 32).
8. Place the plate into the plate base (blue). Attach the plate
retainer (white) to the base (see Note 22 and Fig. 8).
9. Continue on to process the plate on the instrument (see Sub-
heading 3.10, step 1).

3.10 Processing the 1. Confirm that the oven has reached the run temperature. If the
Plate on the oven was not preheated, complete this step described previ-
Instrument ously (see Subheading 3.9, step 1; and Notes 33 and 34).
2. Press the “Tray” button on the instrument.
3. Wait until the autosampler tray finishes its movement. Open
the door. The indicator light on the instrument will blink
yellow.
4. Place the plate onto the autosampler tray in either position A
or B, noting which position is used. The labels on the plate
retainer should face you and the notched corners of the plate
and the autosampler should line up (see Fig. 4).
5. Close the door. Wait until the autosampler tray finishes its
movement and the indicator light is green.
6. Assuming the Data Collection Software is as you left it follow-
ing the creation of the plate map (see Subheading 3.8, step 10),
resume the process by clicking “Link Plate for Run” at the
bottom of the screen (see Notes 35 and 36; and Fig. 13).
7. The plate will be automatically linked and should be in the
correct position (A or B). If it is not, click “Switch Plates” to
switch autosampler positions in the software (see Note 37 and
Fig. 15).
8. From this screen, either click “Create Injection List” to preview
the run and modify the injections (see Note 38) or click “Start
Run” to begin running the instrument (see Fig. 15). The
indicator light on the instrument will blink green to indicate
that it is running.
 3500(xL) Capillary Electrophoresis 299

Fig. 15 “Load Plate for Run” screen. On the “Load Plate for Run” screen, ensure that your plate name is
appearing under the correct autosampler position. (a) If the plate is listed in the wrong spot, click the “Switch
Plates” button. (b) If the software does not automatically register the plate, you can usually find it in the
“Recent Plates” pane and drag and drop it into the correct autosampler position. (c) From here you can either
click the “Create Injection List” button to view the injection prior to starting your run, or (d) you can click the
“Start Run” button to begin electrophoresis

3.11 Monitoring 1. The “Monitor Run” screen will appear automatically after
Electrophoresis in electrophoresis begins. Injections that are currently being ana-
Progress lyzed will be highlighted in green on the plate view and will
have a green arrow symbol in the “Injection” column on the
table. This symbol will change to a blue check mark once the
injection is complete. If the 3500 Data Collection Software
detects a problem with the data (e.g., off scale or low quality),
the symbol will be a flag (see Note 39).
2. Once all the injections are complete, the instrument will enter a
pause mode. Examine the data and determine if any samples
need to be re-injected.
3. If samples need to be re-injected, return to the “Monitor Run”
screen and highlight the wells that need to be re-injected. Click
the “Re-inject” button on the ribbon at the top (see Fig. 16).
300 Kara Kovach

Fig. 16 “Monitor Run” screen. Select any samples that need to be re-injected and (a) then click the “Re-inject”
button. (b) You will then need to click the “Resume Run” button. (c) If no re-injections are necessary, click the
“Terminate Injection List” button to end the run

Select the “Instrument Protocol Options” (see Note 40).

Select “Following all injections.” Click “Ok.” Click “Resume.”
4. When finished with all injections, click “Terminate Injection
List” to end the run (see Note 41 and Fig. 16).

4 Notes

1. These reagents are purchased from Applied Biosystems and

arrive in ready-to-use containers equipped with a radio fre-
quency identification (RFID) tag in the label that allows the
instrument to track reagent use, expiration date, lot numbers,
and serial numbers [1]. RFID tags should be facing back,
toward the instrument when being installed on the instrument
to ensure they can be read properly [1]. These reagents are
necessary for each run on the 3500, but they do not need to be
changed between each run. Once loaded, many injections can
be performed before the reagents need to be changed.
 3500(xL) Capillary Electrophoresis 301

2. Reagents cannot be re-installed on an instrument that is differ-

ent from its original type. For example, a polymer pouch can be
moved between two different 3500s. However, you cannot
take a pouch off a 3500 and install it on a 3500xL and vice
versa. The RFID tag on the reagents keeps track of the reagent
usage and will be inaccurate if this happens [1].
3. Both the anode and cathode buffer containers are prefilled with
1X running buffer. While the anode buffer container is a singu-
lar compartment, the cathode buffer container has two separate
compartments. The left side (24 holes) contains the running
buffer needed for electrophoresis, whereas the right side
(48 holes) serves as the waste receptacle for the capillary washes
that occur between injections [1].
4. There is often abundant reagent remaining when the manufac-
turer’s expiration date is reached. Reagents can be used past the
manufacturer’s expiration date according to your laboratory’s
guidelines by ignoring the warning notifications [2].
5. The polymers available for purchase are POP-4™, POP-6™,
and POP-7™. The polymer pouches are ready-to-load and
available in multiple volumes enabling labs to choose the size
that best suits their throughput needs [1].
6. The conditioning reagent is a pre-packaged consumable that is
used to maintain the polymer pump between polymer changes
and during long periods of disuse [1].
7. High quality formamide is essential to obtaining a quality STR
profile and maintaining the life of the capillary array. With this
in mind, it is highly suggested that Hi-Di Formamide from
Applied Biosystems be used for electrophoresis.
8. Formamide should be aliquoted into smaller quantities appro-
priate for typical run sizes to avoid multiple freeze-thaw cycles.
Thaw the aliquots immediately prior to use.
9. The spectral calibration standard used will depend on the
amplification kit used by your laboratory [1].
10. When installing the ABC, lower the container slightly so that
the clear diamond shaped part of the instrument is just barely
above the large section of the container. Raise the container up
and fit the lip of the container into the corresponding groove
on the instrument. Slide the container back into its place.
11. Gently position the septa to approximately align with the holes
of the CBC, or plate, and let the septa fall into the holes on its
own. Once in place, push down firmly to ensure proper fit.
Improperly aligned septa can cause damage to electrodes, thus
preventing electrophoresis.
12. Pinching the center part of the CBC makes installation and
removal of the container easier.
302 Kara Kovach

13. The electrodes should be exposed to air for no more than

30 min during this process, as prolonged air exposure can
cause the polymer to harden, creating a blockage rendering
the array unusable [2].
14. Used when installing a new pouch of the same lot number [2].
15. A spatial calibration must be performed whenever the capillary
is changed, the instrument is moved, or the detection door/
cell is handled [1].
16. When performing spatial calibrations, the wizard will fill the
array with polymer so you can choose “no fill” when the wizard
prompts to save on polymer. However, in practice, error mes-
sages can often occur, and this can be corrected or avoided by
choosing the “fill” option.
17. Optionally, the user can also select “Perform QC Checks” to
have the system check that each capillary is within a specific
range for spacing, peak height, and peak height uniformity.
18. A spectral calibration should be performed whenever the capil-
lary is changed, the polymer type is changed, a new dye set is
used, service is performed on the optical components, or there
is an increase in spectral artifacts in the data [1].
19. If you see a bubble in the polymer pump area but the “Remove
bubbles from the polymer pump” wizard is unsuccessful, try
flushing the water trap using a syringe filled with distilled or
deionized water (see Fig. 2). The method to do so is described
in the 3500 User Manual [1].
20. You should pre-heat the oven approximately 30 min prior to
the start of your run, which will help avoid any migration issues
on the first injection. Once preheated, the oven will remain at
temperature for 2 h of inactivity before shutting down [1].
21. The chemistry standard and dye set you choose will be depen-
dent on the spectral standards used.
22. When attaching the retainer, attach the side with the two clips
first at an angle and then lower the other side until it clips into
place. The sample plate will only fit in the base in one direction
(the angled corners at A12 should line up). Ensure that the
plate is fully seated to avoid injection issues, such as damage to
the ends of the capillaries [1].
23. If a capillary fails, “Allow Borrowing” allows the instrument to
use the data from an adjacent capillary. For an 8-capillary
instrument, one borrowing event is allowed; for a
24-capillary instrument, up to three borrowing events are
allowed. If “Allow Borrowing” is not checked, all capillaries
must pass in order for the spectral calibration to pass [1].
 3500(xL) Capillary Electrophoresis 303

24. The software will have manufacturer generated templates,

assays, file name conventions, and results groups to use. How-
ever, most laboratories will have developed their own as part of
the instrument’s validation.
25. Alternatively, you can leave all wells as samples and change this
in your analysis software (e.g., GeneMapper™ ID-X).
26. The specific ratio of formamide to ILS, as well as which ILS
used, in the master mix will be dependent on the amplification
kit employed. Refer to the kit’s user manual for these instruc-
tions. In most instances, this will be 9 μL of formamide and
1 μL of ILS.
27. Every capillary in the array is used in each injection. The 3500
has an 8-capillary array and will inject one column (8 wells) of
the plate with each injection. The 3500xL has a 24-capillary
array and will inject three columns (24 wells) at a time with
each injection [1]. If you do not have formamide in a well that
is part of an injection, air will be injected into the capillary,
causing it to dry out and become unusable. If this happens, you
will have to replace the entire array. Therefore, if you do not
have enough samples to fill an entire injection, you will need to
load master mix (or formamide alone) into the empty wells (see
Fig. 14).
28. It is suggested to load master mix into the blank wells of the
injections instead of formamide to allow for an alternate well
for a sample in the event of a pipetting error. If you had loaded
formamide alone into all empty wells of an injection, then none
of those extra wells would be suitable for the sample because
they lack the ILS. Thus, you would need to set up an additional
injection.
29. For the 3500 (8 capillaries), it is recommended to use one
ladder per every 3 injections; for the 3500xL (24 capillaries),
it is recommended to use one ladder per injection [1].
30. Load allelic ladders into different capillaries. This ensures that if
there is a problem with a capillary, rendering that ladder unus-
able, you can still use the data from the other ladders loaded in
other capillaries.
31. You can make a denature protocol on your thermal cycler to do
this for you.
32. Denaturing your samples prior to loading on the instrument
ensures that the DNA does not reanneal and remains single-
stranded [1].
33. Navigate back to the “Dashboard” via the tabs at the top to
check that the instrument has completed the pre-heat (see
Fig. 17). To return to your run, click the “Workflow” tab at
the top.
304 Kara Kovach

Fig. 17 Oven pre-heat from the dashboard. (a) Prior to beginning your run, click the “Star Pre-Heat” button in
the “Pre-Heat the Oven” panel to bring the oven up to the temperature required for electrophoresis. (b) Check
to ensure that the oven turned on. (c) You can also check what the current oven temperature is in this area to
ensure that the pre-heat has completed (see Note 34). (d) Finally, to navigate between the Dashboard and
Workflow during plate set up, use the tabs at the top

34. If the instrument is still pre-heating, you can still load your
plate and start the run. The instrument will wait until the
pre-heat is finished before starting the first injection.
35. When linking the plate, the software may take a while.
36. To run a plate that has already been created in the software, go
to the “Load Plates for Run” screen via the navigation pane. In
the appropriate autosampler position, click “Link,” search for
the plate name and click “Ok.” Alternatively, if the plate
appears in the “Recent Plates” window on the right of this
screen, simply drag and drop to the correct position (see
Fig. 15).
37. Be sure to unlink any plates that are not loaded on the instru-
ment, or that are loaded but do not need to be run.
38. You can modify an injection by moving it up or down on the
injection list, or by deleting it from the run. This allows you to
run injections in order of priority [2].
39. Just because there is a flag, it does not mean that the data is not
usable. Upload the data into your analysis software (e.g., Gen-
eMapper™ ID-X) before making any decisions as to next steps.
40. “Reuse the existing protocol” is typically selected.
 3500(xL) Capillary Electrophoresis 305

41. Although the software has a re-injection button, it can only be

used while the original plate setup is running. If you terminate
the run and then decide to re-inject samples after, you will need
to create a new plate map in the software. The name of the plate
will need to be different in order to avoid overwriting your
data. You can do this by adding “_2” to the end of the plate
name, for example [2].

References
1. Thermo Fisher Scientific (2010) Applied Biosys- 2. Abernathy J (2018) 3500 Genetic Analyzer
tems 3500/3500xL Genetic Analyzer User install training. Jefferson Parish Regional DNA
Guide, Revision C. Available via Thermo Fisher Laboratory, 10 October 2018
Scientific. https://tools.thermofisher.com/con
tent/sfs/manuals/4401661.pdf. Accessed
29 April 2022
 Chapter 19

Likelihood Ratio Calculation Using LRmix Studio

Megan M. Foley

Abstract
LRmix Studio performs statistical analyses on forensic casework samples by calculating a likelihood ratio
(LR) following a semi-continuous, unrestricted approach. The software utilizes a basic probabilistic model
allowing the comparison of two alternative hypotheses regarding the evidence profile to include known
and/or unknown contributors, for a maximum of a 4-person mixture. Other statistical factors that are
included in this model are the incorporation of multiple probability of drop-out values, probability of drop-
in, a correction factor for population substructure, assumed contributor inclusion, and inclusion of an
unknown relative in the defense hypothesis. A range of plausible probability of drop-out values can be
calculated for various contributors and hypotheses based on a Monte Carlo probability method and
included in the likelihood ratio calculation. The software also includes several ways to test the validity
and robustness of the probabilistic model. A sensitivity analysis can be performed by calculating likelihood
ratios for the given profile against a range of drop-out values. Additionally, a non-contributor test can be
performed on the crime scene sample and the chosen LR parameters to test the robustness of the model.
This can give a point of comparison of the likelihood ratio generated for the person of interest (POI)
compared to “random man” profiles generated from uploaded allelic frequencies. Finally, the analysis can be
printed in a well-structured and user-friendly report that includes all analysis parameters. Within this
chapter, the reader will learn the steps to calculate a likelihood ratio using the semi-continuous software,
LRmix Studio. Additional tools supplied through the software will also be explained and demonstrated.

Key words Likelihood ratio, LRmix Studio, Mixture interpretation, Forensic statistical analysis,
Forensic genetics, Probability of drop-out, Probabilistic modeling

1 Introduction

1.1 Background Current interpretation of DNA profiles generated from forensic

casework includes the calculation of a statistic in order to give
weight to an inclusion of a person of interest in comparison to an
evidence profile [1, 2]. For mixture interpretations, the likelihood
ratio (LR) is the preferred method [3]. This approach compares the
likelihood of observing the evidence DNA profile generated given
two competing, mutually exclusive hypotheses, often written as:

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_19,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

307
308 Megan M. Foley

PrðEjH 1 Þ
LR =
PrðEjH 2 Þ
where Pr(E|H1) = the probability of the DNA profile given H1 and
Pr(E|H2) = the probability of the DNA profile given H2.
An example of two competing hypotheses for a mixture
profile is:
• H1 = The DNA originated from the victim and suspect.
• H2 = The DNA originated from the victim and one unknown,
unrelated individual.
The resulting value gives weight to the hypothesis the data
supports more. If the LR value is >1, the DNA evidence supports
the H1 hypothesis. If the LR value is <1, the DNA evidence
supports the H2 hypothesis [3, 4].
In comparison to more historically used binary approaches
(e.g., the Random Man Not Excluded (RMNE) method), likeli-
hood ratios are more informative and are able to process more
challenging sample types that contain multiple indistinguishable
contributors and/or are generated from low template DNA sam-
ples [5]. With complex or low-level DNA mixtures, common inter-
pretation occurrences like stochastic effects, allele sharing,
degradation, or inhibition can lead to uncertainty of inclusion of
an individual. To accurately interpret these complex profiles, para-
meters such as allelic drop-out or drop-in must be considered.
Allelic drop-out occurs when one allele, or the entire locus, falls
below the analytical or limit of detection threshold due to low copy
number and stochastic effects. Drop-in occurs when an allele is
typed in a genetic profile that did not come from the crime scene
and its origin cannot be explained in the competing hypothesis
[3, 6]. Binary methods mostly consider whether alleles are present
or not and, therefore, do not use all of the information that can be
observed in a profile. Instead, these methods may just omit loci
where these stochastic effects are observed, which leads to an
underestimation of the weight of the evidence [3, 7]. By including
probabilistic modeling, likelihood ratios are able to analyze a sam-
ple while taking into consideration varying levels of these occur-
rences [8–10].

1.2 Likelihood Ratio Various software programs have been developed to calculate likeli-
Calculations Using hood ratios for DNA profiles utilizing different modeling
LRmix Studio approaches [11–14]. LRmix Studio—a free, downloadable, open-
source system—performs semi-continuous/unrestricted likelihood
ratio calculations. This software is designed for autosomal STR
profiles, single source up to four contributor mixtures. The
LRmix Studio software approach allows for the removal of the
inclusion versus exclusion determination step when comparing a
reference profile to the evidence sample [6, 15, 16]. The basic
 Likelihood Ratio Calculation Using LRmix Studio 309

exploratory LR model assumes that each locus is in Hardy Wein-

berg and linkage equilibrium, which allows basic genotypic fre-
quency calculations to be used at each locus and multiplication of
each locus to generate the overall genotype likelihood ratio. The
calculation considers all possible contributing genotypes of an
unknown individual, including an allele that has dropped out due
to stochastic effects [6, 17]. The probabilistic model incorporates
probability of drop-in (pDI) and probability of drop-out (pDO)
that can be varied for different contributor’s and hypotheses [16–
18]. Replicate amplifications of a single extract can be incorporated
into the software for analysis. Developers validated this tool for up
to five replicates, comparing across three reference profiles, using a
joint probability approach [19, 20].
The software performs qualitative continuous modeling or
semi-continuous modeling. Therefore, the software assesses the
alleles present in a qualitative way, considering all possible genotype
combinations equally, and does not include peak heights into the
modeling [6, 21]. The software incorporates a variety of parameters
that allow for exploratory analysis including:
• Number of contributors (NoC) for both hypotheses.
• Varying NoC between the two hypotheses (e.g., a total of two
NoC in H1 versus a total of three NoC in H2).
• Consideration of known, assumed, and unknown contributors
for both hypotheses.
• Varying probability of drop-out values for different contributors
and hypotheses.
• Incorporation of probability of drop-in.
• Incorporation of an adjustable theta value to adjust for popula-
tion substructure uncertainty.
• Incorporation of an adjustable rare allele frequency when the
allele is not observed in the uploaded allelic frequency database.
• Inclusion of a related unknown individual in the defense
hypothesis.
– The different relationship types that can be incorporated
include: parent/child, siblings, half-sibling, grandparent/
grandchild, uncle/aunt/nephew/niece, or cousins [18, 20].

1.3 Additional The software includes a sensitivity analysis that can be used to
Analyses Available in estimate the probability of drop-out and evaluate the model used
LRmix Studio to generate the overall likelihood ratio. For the sensitivity analysis
feature, the likelihood ratio parameters set are used to plot the
log10(LR) when the pDO varies between set values, defaulted
from 0 to 0.99. This can be evaluated for different contributors
or for the profile as a whole. Sensitivity analysis can also be sepa-
rated out into individual loci for a more in-depth evaluation. The
310 Megan M. Foley

range for the likelihood ratio overall and the individual likelihoods
for the two hypotheses are shown separately. When a model fits the
parameters chosen, the curves generated should be generally flat
throughout the entire range of pDO showing that these plausible
pDOs do not have a substantial effect on the resulting LR value. If
the opposite is observed, the model chosen by the user should be
evaluated and readjusted [20].
The sensitivity feature also calculates a probability of drop-out
to use for the LR calculation using a Monte Carlo (MC) simulation
approach. A range of drop-out values, defaulted from 0 to 0.99, is
available. The number of iterations can be changed per the user’s
discretion. This model is a qualitative estimator of the drop-out
probability of the whole profile, based on the average numbers of
alleles observed in the profile. By viewing the number of alleles per
profile, the model can also take into consideration allele sharing
[6]. The model is based on work described by developer’s research
from Gill and Curran. A random sampling of the crime-sample
alleles is generated with each MC iteration, while varying levels of
drop-out probabilities are applied. The purpose of this method is to
see which drop-out probabilities in the given range lead to mixtures
with the same amount of alleles as the profile in question. The
process simulates a given number of mixtures that have identical
properties to the profile in question. This generates an empirical
distribution and highlights the most likely probability of drop-out
range [5, 17, 18]. A probability of drop-out can be determined per
contributor, for the profile as a whole, or for the prosecution or
defense hypotheses. The drop-in probability can also be adjusted
during this simulation for evaluation in a similar format [20].
The non-contributor tool demonstrates the robustness of the
calculated likelihood ratio [4, 16]. The software generates a set
amount of random DNA profiles based on random sampling of
the allelic frequencies included in the analyses. These random pro-
files take the place of the person of interest in the hypothesis as a
“random, unrelated man” and a likelihood ratio is generated for
each profile. The LR generated in the case sample is compared to
values generated from the random profiles, as a performance test to
put the LR value into perspective for the analyst or jury members.
The maximum LR calculated by a random individual is used as a
direct comparison. Additionally, 1%, 50%, and 99% percentile
ranges are shown of all of the LRs generated. The results display
how many of the simulated profiles generated LRs greater than the
casework analysis, as well as how many generated a log10(LR)
greater than one. The number of LRs greater than one can act as
a false positive error rate. For more complex samples—e.g., those
that contain more contributors or have a higher level of drop-out—
it is more likely to obtain a false positive where a simulated individ-
ual generates an LR supporting inclusion [16, 20].
 Likelihood Ratio Calculation Using LRmix Studio 311

2 Materials

1. Reference DNA Profile(s).

2. Allelic frequency tables.
3. Unknown/question DNA profile(s).
4. Computer with Windows operating system, Microsoft®
Excel®, Java (version >8), and internet access (see Note 1).

3 Methods

Before using this software, ensure that the laboratory has properly
validated the program. Certain parameters required to calculate a
likelihood ratio are based off of the laboratories’ validation includ-
ing: allelic drop-in (per amplification kit) and the method used to
calculate probability of drop-out. The appropriate allelic frequency
files should be downloaded and properly formatted. Additionally,
ensure that Java has been downloaded.

3.1 Preparation of 1. Download LRmix Studio from https://github.com/

DNA Profile Files smartrank/lrmixstudio/releases. Once on the webpage, deter-
mine the latest version (see Note 2). Click the file under the
appropriate version, “lrmixstudio-VERSION-CommunityEdi-
tion-distribution.zip” to download. For the example-only file,
download “example.zip”. For the replicate example-only file,
download “Replicates.example.LRmix.Studio.zip”.
2. The .zip file will be downloaded onto the computer. Move the
zip file to the appropriate location on the desktop and extract
the zip file. This folder can be moved to the laboratory’s
recommended location (see Note 3).
3. Ensure that java is installed on the computer. To download, go
to https://www.java.com/download/ie_manual.jsp ad find
the correct file to download based on the computer type (see
Note 1).
4. If entering the sample alleles manually, skip to Subheading 3.1,
step 10. If using files for the profile upload, follow these steps
(see Subheading 3.1, steps 4–9). To prepare the unknown/
question sample profile file(s) for upload to LRmix Studio,
begin by opening the “example” folder from within the zip
file downloaded from GitHub and open the “sample.csv” file
(see Notes 4 and 5).
5. The top columns should be labeled “SampleName”, “Marker”,
“Allele1”, “Allele2” up to “Allele8.” Do not edit the column
headers (see Fig. 1).
312 Megan M. Foley

Fig. 1 Example .csv file layout in Excel. Row 1 contains specific column headers recognized by LRmix Studio.
Verify that “Marker” names and allele values are accurate before uploading

6. Change the sample name “Rep1” under “SampleName” to

reflect the evidence sample identifier used during analysis. If
performing replicate analysis, add the numerical value after the
sample name. This can be typed in for each row or typed in the
row of the first locus of the replicate, followed by highlighting
that cell and copying/pasting (or using the fill down function)
to apply the same name to all rows corresponding to that
replicate (see Note 6).
7. The “Marker” column may need to be updated from the
example based on the STR panel targeted during genotyping.
Ensure that there are no spaces or characters other than letters,
numbers, hyphens, or underscores (see Note 7).
8. Alleles can be manually entered into the appropriate locus or
exported from the analysis software used by the laboratory.
Enter all called alleles into the appropriate locus from smallest
to largest from left to right. A maximum of eight alleles can be
added to account for a 4-person mixture. Each cell should
contain one allele only. If only one allele is detected at a
locus, enter the allele only once. Additionally, all stutter arti-
facts should be removed before analysis. LRmix Studio will
treat a stutter allele as a true allele. Double check all entries
for accuracy before uploading into the LRmix software (see
Note 8).
 Likelihood Ratio Calculation Using LRmix Studio 313

9. Save the spreadsheet as a .csv (comma separated values) file. A

small window appears warning that some features are incom-
patible with “.csv” and asks for permission to keep the work-
book in this format. Click “Yes.” Close out of the Excel file. A
second pop-up appears; click “Don’t Save.” Save all profiles in a
folder labeled with the case number. The software will use the
folder name to automatically fill out sample information when
the file is loaded.
10. Download and prepare allelic frequency tables. For this exam-
ple, allelic frequencies were downloaded from NIST; https://
strbase.nist.gov/NISTpop.htm, and “Excel file of 1036
revised Allele Frequencies” was chosen. Each population
should be saved as a separate .csv file. Only transfer the loci,
allele numbers, and the allelic frequencies. The additional
information in the downloaded Excel is not necessary and
may cause errors in the LRmix analysis. Before saving the
final .csv, ensure that all loci names are identical to what is
used in the sample and reference files.
11. Prepare reference sample profile document(s) for upload to
LRmix Studio (see Note 9). Within the zip file that can be
downloaded from GitHub, example .csv files have been
provided by the developers. Open the “example” folder and
the .csv file that is labeled as “suspect.csv.”
12. The top columns should be labeled “SampleName”,
“Marker”, “Allele1”, “Allele2”. Do not edit the column head-
ers. Repeat the file preparation steps used to prepare the ques-
tion sample files (see Subheading 3.1, steps 6–7). When
entering homozygous alleles, enter the allele twice. Once
under “Allele1” and under “Allele2” (see Note 10).
13. Save the spreadsheet as a .csv (comma separated values) file. A
small window appears warning that some features are incom-
patible with “.csv” and asks for permission to keep the work-
book in this format. Click “Yes.” Close out the Excel file. A
second pop-up appears, click “Don’t Save.”

3.2 Set Up of LRmix 1. Open the LRmix Studio software from the unzipped folder (see
Studio for Statistical Note 11) by clicking the “lrmixstudio-VERSION-Communi-
Analysis tyEdition” (.jar file).
2. The first tab that opens in the start-up window is the “Sample
Files” tab (see Fig. 2).
3. Click the “Load from file. . .” button on the far right (see “i.” in
Fig. 2). It opens a window. Navigate to the appropriate
unknown/question .csv file set up (see Subheading 3.1, steps
4–9). Alternatively, the sample can be added manually by click-
ing the “Add replicate” box (see “ii.” in Fig. 2) and manually
enter the same name, along with its alleles at each locus. If
314 Megan M. Foley

Fig. 2 The “Samples Files” tab in LRmix Studio. This tab is used to upload unknown/evidence and replicate
profiles. (i) Load a previously prepared sample file. (ii) Add a replicate DNA profile. (iii) Case Number. (iv)
Displays profiles added to the software and allows user to choose which profiles should be active in the
calculation. (v) Displays loci and alleles once a profile has been uploaded or manually entered

analyzing replicates, ensure that the appropriate samples are

checked as “Active” in the top window (see “iv.” in Fig. 2).
Any samples that should not be analyzed, uncheck “Active.”
The list of loci appears in a random order compared to any
allelic frequency tables used.
4. The box next to the right of the red “Case Number” should
automatically fill in with the case number if provided in the
uploaded sample file. It can be manually edited by the user if
necessary (see “iii.” in Fig. 2). If this is not done, the software
will not continue to the “Reference Files” tab.
5. Additional actions from the “Sample Files” tab include:
“Restore session from Log”—Whenever an analysis is com-
pleted, a log file is produced and automatically saved to the
computer. To locate the log file, return to the LRmix Studio
 Likelihood Ratio Calculation Using LRmix Studio 315

Fig. 3 The “Reference Files” tab in LRmix Studio. This tab is used to upload reference profiles. (i) Load a
previously prepared reference file. (ii) Manually add a reference profile. (iii) Displays profiles added to the
software and allows user to choose which profiles should be active in the calculation. (iv) Displays loci and
alleles once a profile has been uploaded or manually entered

folder, unless a specific location is specified during installation.

A new folder is created under the case number. The log files
contain text files with all settings and results of the previous
analysis. These files can be uploaded to restore previous ana-
lyses so that the analysis can be re-performed, or modified, if
necessary. “Restart”—Restarts the software, which clears the
previous run. A new run can be set up. Previous analyses are
saved in the “log” folder.
6. Once a sample has been added, the alleles are visible in the
“Locus” portion of the screen (see “v.” in Fig. 2) and the sample
appears in the top screen. Additionally, the tab labeled “Refer-
ence Files” is now available to select.
7. Click on the tab labeled “Reference Files” that is now available.
Click “Load from file. . .” (see “i” in Fig. 3). It opens a window.
316 Megan M. Foley

Navigate to the appropriate reference sample .csv file

(s) previously set up (see Subheading 3.1, steps 11–13) and
select the appropriate .csv file(s) for the reference(s) to be run.
Multiple .csv files may be added at the same time if there are
multiple references being compared to the question sample (see
Note 9).
8. To add the samples manually, click “Add Profile. . .” (see “ii.” in
Fig. 3). Before continuing to the next step, check that the
references uploaded are meant to be used during analysis (see
“iii.” in Fig. 3). The LR is affected if multiple references are
present regardless of whether the sample is checked in the
“Analysis” tab. The software assumes the individual is a
non-contributor (see Note 12).
9. Once a sample has been added, the alleles are visible in the
“Locus” portion of the screen (see “iv.” in Fig. 3) and the
sample appears in the top screen, checked as active (“iii.”).
Additionally, all remaining tabs are visible with the exception
of the “Reports” tab.
10. Click on the next tab on the top labeled “Profile Summary”.
Here the user can view different formats of allele sharing
between reference and question profiles.
11. Under the “Select” column (see “i.” in Fig. 4), uncheck any loci
where there are no alleles in either the question or reference
sample, or which contain a “0” (see Note 13) in the “Distinct
Alleles” column (see “ii.” in Fig. 4). By unchecking the box, the
locus is excluded from the LR calculation (see Note 14). Addi-
tionally, the Distinct Alleles column can be used to determine
the minimum number of contributors, if not determined using
an alternative method. If using the maximum allele count
method, the locus with the most amount of alleles can be
divided by two to determine the minimum number of
contributors.
12. This page can be printed in the format chosen by the laboratory
to include the emphasis of various information including (see
“iii.” in Fig. 4): “Alleles in the replicate that are not present in
the reference profiles” emphasizes alleles that may be coming
from an unknown contributor or from the workflow process.
“Alleles in the reference profiles that are not present in the
replicate” emphasizes location of potential allelic drop-out in
the question sample. “Matching alleles in the replicate and
[reference sample]” emphasizes potential allele sharing in con-
tributors, indicating a possible biological relationship. Empha-
sis can occur by color, bold, italics, or underlined based on
what is checked on the right-hand side of the screen (see “iv.” in
Fig. 4).
 Likelihood Ratio Calculation Using LRmix Studio 317

Fig. 4 The “Profile Summary” tab in LRmix Studio. This tab is used to determine which loci to include in the LR
calculation and minimum number of contributors. (i) Select/Deselect loci for inclusion in the LR calculation. (ii)
Distinct Allele column can be used to determine minimum number of contributors. (iii) Formatting options. (iv)
Font options

3.3 Probability of 1. In order to calculate the pDO, the LR hypotheses must first be
Drop-Out Calculation filled out. Click the next tab labeled “Analysis”. If including
any contributors under either hypothesis, check the “Contrib-
utor” box to the left of the corresponding “ID” under the
“Prosecution Hypothesis” and “Defense Hypothesis” sections
(see “i.” and “ii.”, respectively, in Fig. 5). If no contributors are
being assumed under the defense hypothesis, there should be
no checked boxes. Set the “Unknown Contributors” under
both the prosecution and defense hypotheses by clicking the
arrow buttons (see “iii.” and “iv.,” respectively, in Fig. 5).
2. In the “Parameters” section, click the “. . .” box to the right of
“Allele Frequencies” (see “v.” in Fig. 5). Navigate to the saved
allelic frequency documents (.csv files) used by the laboratory
(see Subheading 3.1, step 10). Choose the appropriate popula-
tion frequencies and click “Open”.
318 Megan M. Foley

Fig. 5 The “Analysis” tab in LRmix Studio. This tab is used to set the model parameters and calculate the
likelihood ratio. (i) Prosecution Hypothesis Parameters Box. (ii) Defense Hypothesis Parameters Box. (iii)
Unknown Contributor for prosecution hypothesis. (iv) Unknown Contributor for defense hypothesis. (v) Click to
upload or change allelic frequency table. (vi) Options to include a relative in the defense hypothesis. (vii)
Change the drop-in probability, rare allele frequency, and theta value. viii. Calculate a likelihood ratio

3. Click on the “Sensitivity Analysis” tab at the top. Within this

tab, click the “Drop-out Estimation Settings” tab halfway
down the screen (see “i.” in Fig. 6).
4. Drop-out can be determined for different combinations of the
contributors included (knowns/assumed or unknowns) by
checking the boxes next to the appropriate contributor file
(see “ii.” In Fig. 6). As an example, include all contributors.
Make sure that all contributors are checked.
5. If assuming a known contributor like a victim, and there is no
evidence of drop-out seen in the profile, uncheck the contribu-
tor box for the victim. These contributors must be unchecked if
they are fixed in the hypothesis and no allelic drop-out was
observed in the profile. Change the “Drop-In” value to the
appropriate value based on validation or “0.01” as a default (see
“iii.” in Fig. 6) (see Note 15). The various settings can be
changed by using the up and down arrows until the value
reaches the intended number. For this example, all values are
left at default besides “Drop-In”; “Drop-Out variation”: “0”
to “0.99” in “99” steps. “Iterations”: “1000.”
 Likelihood Ratio Calculation Using LRmix Studio 319

Fig. 6 The “Sensitivity Analysis” tab in LRmix Studio to determine dropout. The “Dropout Estimation Settings”
tab is used to determine plausible probability of drop-out(s) to use for the LR model. (i) “Dropout Estimation”
tab. (ii) Check which profiles should be included in the drop-out analysis. (iii) Change Drop-in. (iv) Click to start
analysis. (v) Results of the sensitivity analysis

6. Next, click the “Run Drop-out Estimation for [X] alleles”

button (see Note 16) on the right side of the screen (see “iv.”
in Fig. 6). If an error appears stating “drop-out estimation
resulted in no matching attempts under prosecution,” check
that the number of contributors is correct in each hypothesis in
the “Analysis” tab. If they are as expected, re-evaluate the
profile as a whole for number of contributors.
7. Once the analysis is completed, a range of drop-out estimation
values are generated (see “v.” in Fig. 6). For this example, the
highest value in the range, 0.39, is used (see Note 17). The
drop-out estimation analysis must be performed with every
allele frequency database used for generation of the likelihood
ratio (see Note 18).
8. Return to the analysis tab to set-up of the likelihood ratio
hypotheses and calculation. If not performed previously, define
the defense and prosecution hypotheses—including number of
contributors (maximum is four), known and unknown contri-
butors, probability of drop-out (see Subheading 3.2, steps 1–
8 above for an example method).
320 Megan M. Foley

9. In the two hypotheses boxes (see “i.” and “ii.,” respectively, in

Fig. 5), ensure that all known contributors to be used in the
Prosecution Hypothesis (HP) and Defense Hypothesis (HD)
have a checkmark. Set the probability drop-out based on the
sensitivity analysis performed by either typing it in or using the
up and down arrows. For this example, the same number is
used in all places where “Drop-Out Probability” is entered (see
Fig. 5). If varying the drop-out depending on contributors,
etc., ensure that the correct pDO is entered for each section. If
an individual is set as a known, a “0” drop-out probability value
can be used.
10. The software has the ability to calculate if one of the unknowns
is a relative in the defense hypothesis. Check the “One of the
unknowns is a relative” box in the Defense Hypothesis section
(see “vi.” in Fig. 5) and fill out the appropriate relationship
choice to the correct contributor. Options for relationship type
include, parent/child, sibling, half-sibling, grandparent/
grandchild, uncle/nephew, and cousin.
11. Ensure that the number of contributors (NoC) remains the
same from before the sensitivity analysis. The NoC should be
established prior to any reference sample comparisons. If the
NoC changes, the probability of drop-out should be
recalculated.
12. Ensure that the appropriate allelic frequency file in the calcula-
tion is loaded (see Note 19).
13. In the parameters section (see “vii.” in Fig. 5), change the
“Drop-in Probability” to “0.01” or the laboratories validated
value.
14. Update the Theta value and the rare allele frequency value to
use in the calculation if an allele is not present in the allelic
frequency database used (see Note 20). Leave the “Theta
Value” at “0.01,” and the “Rare Allele Frequency” at
“0.001.” The “Max Threads” value relates to the speed and
performance of the calculation. Leave at default (see Note 21).
15. Click “Run” (see “viii.” in Fig. 5). A value appears in the box
under “Overall Likelihood Ratio” (see Note 22). To the left of
this box, the user can view the likelihood ratios calculated at
each locus. An LR value >1 supports the H1 hypothesis. An LR
value <1 supports the H2 hypothesis.

3.4 Additional 1. A sensitivity analysis should accompany every likelihood ratio

Analyses in LRmix calculated to test the sensitivity of the parameters chosen for
Studio this calculation. Click the tab labeled “Sensitivity Analysis.”
This is the same tab used to calculate pDO.
 Likelihood Ratio Calculation Using LRmix Studio 321

2. First, determine if the contributors should have the same prob-

ability of drop-out or if one should have a varied drop-out
probability during the sensitivity analysis performed. Any con-
tributors left unchecked will remain at a consistant probability
of drop-out during the analysis (see “i.” in Fig. 7).
3. Do not change the value in the box next to “Set drop-out of
select profiles to” during the sensitivity analysis. This should
remain as “0” (see “ii.” in Fig. 7).
4. In the “Sensitivity Analysis Settings” tab on the bottom half of
the screen, check the following parameters and change if nec-
essary: “Drop-out variation”: “0” to “0.99” in “99”, “Steps at
locus”: “All Loci” (see Note 23), “Drop-In”: “0.01”, and
“Theta”: “0.01”.
5. Click the “Run” button with a green start sign (see “iii.” in
Fig. 7). The run time varies depending on number of contri-
butors and complexity of the DNA profile.
6. If an error message stating: “The Sensitivity Analysis did not
result in any numerical results. All LRs were either 0, Infinity or
not representable as a number. Please check your hypothesis.”
appears, check that the number of contributors is correct in
each hypothesis on the “Analysis” tab. If they are as expected,
re-evaluate the profile as a whole for number of contributors.
7. The results display the resulting log10(LR) values for the range
of pDOs set for the different analyses, separated by color. To
zoom in/out of sections, right click on the plot. To view
different analyses, check the appropriate option from the list
on the right (see “iv.” in Fig. 7).
8. A non-contributor test should accompany every likelihood
ratio calculated to give weight to the resulting LR when ana-
lyzed with simulated unknown contributors. Open the tab
labeled “Non-contributor Test”. Select the “Person of Inter-
est” (see “i.” in Fig. 8) that the user would like to replace with
random profiles by checking the box next to the appropriate
contributor.
9. Set the iterations (see “ii.” in Fig. 8) based on the likelihood
ratio generated under the “Analysis” tab. For the example in
this document, iterations would be changed to 62,000,
rounded to the nearest 1000 (see Note 24). If the likelihood
ratio generated is >1,000,000, a max of 1,000,000 can be
calculated. If the likelihood ratio is <1000, perform 1000
iterations.
10. Click “Run” (see “iii.” in Fig. 8) to start the calculation. This
can take several minutes up to several hours depending on the
complexity of the mixture and how many iterations are being
tested.
322 Megan M. Foley

Fig. 7 The “Sensitivity Analysis” tab in LRmix Studio. The “Sensitivity Analysis Settings” tab is used to
evaluate the probabilistic model and determine the sensitivity of the likelihood ratio over a range of drop-out
probabilities. (i) Check which profiles should be included in the sensitivity analysis. (ii) “Set dropout of selected
profiles” setting. (iii) Click to start analysis. (iv) Choose to view different analyses

11. The log10(LR) generated during the analysis with the profile of
interest is displayed in red (see “iv.” in Fig. 8). The remaining
gray bars display the minimum (“v.”), maximum (“ix.”), 1%
(“vi.”), 50% (“vii.”), and 99% (“viii.”) percentiles of the calcu-
lated values for the randomly generated comparison profile (see
Fig. 8). Within the text, the software also counts how many
LRs generated were greater than one (“x.”) and how many LRs
generated were greater than the profile of interest LR (“xi.”).
12. Ensure that both the drop-in and drop-out values are filled in
appropriately in the “Analysis” tab. If any of the values are set
to zero, no results are obtained from the non-contributor test.
13. Repeat this process for each allelic frequency database used in
analysis.

3.5 Printing a LRmix 1. Open the “Reports” tab. There should be one report for time
Studio Report an analysis was conducted, i.e., each time the “Run” button
was clicked in the “Analysis” tab, during the current session.
See the report(s) to be exported (multiple reports can be
selected for simultaneous export by using the Ctrl key) (see
Note 25).
 Likelihood Ratio Calculation Using LRmix Studio 323

Fig. 8 The “Non-contributor Test” tab in LRmix Studio. This tab is used to replace the POI with randomly
generated profiles using the same allelic frequency files and LR parameters to provide relative robustness of
the model and LR generated with the POI. (i) Choose which reference to compare. (ii) Set the number of
iterations to run. (iii) Click to start analysis. (iv) The log10 (LR) calculated with the chosen reference. (v) The
minimum log10 (LR) calculated. (vi) The 1% percentile log10 (LR) calculated. (vii) The 50% percentile log10 (LR)
calculated. (viii) The 99% percentile log10 (LR) calculated. (ix) The maximum log10 (LR) calculated. (x) The
percentage of LRs greater than zero. (xi) The percentage of LRs greater than the LR calculated with the
reference

2. Click the “Export” button at the bottom of the window (see

Fig. 9). A window appears asking for “Reporting Officer’s
remarks to be included in the report.” Remarks can be added,
if desired, or the box can be left blank. Click “OK” to proceed.
Reports are saved as a .pdf format on the desktop and can be
moved into the designated case folder where the .csv sample
profile files were saved. An example of the first page of a report
can be seen in Fig. 10.
324 Megan M. Foley

Fig. 9 The “Reports” tab in LRmix Studio. This tab is used to export analysis reports

4 Notes

1. LRmix Studio does not currently work on Mac computers.

2. For this example, the latest version is 2.1.5. The latest version is
typically at the top of the page. The “Version” in the .zip file
will change.
3. Retain all files in the folder in the same locations. If any files are
moved, a Java exception error may occur upon startup.
4. Within the .zip file that can be downloaded from GitHub,
example .csv files have been provided by the developers.
Open the “example” folder and the .csv file that is labeled as
“sample.”
5. Additionally, GeneMapper® ID-X exported files can be format-
ted to be uploaded straight into LRmix Studio. Ensure that the
report template configured in GeneMapper® ID-X matches the
example .csv file.
 Likelihood Ratio Calculation Using LRmix Studio 325

Fig. 10 An example of an exported report. The report will contain all data and analyses conducted including the
likelihood ratio, sensitivity analyses, drop-out analyses, and non-contributor tests
326 Megan M. Foley

6. Check that the alleles associated with these replicates are also
deleted. If only analyzing one profile replicate, delete out the
replicate examples from the template labeled “Rep2” and
“Rep3”. If replicates are being analyzed, one file can be created.
Stack the profiles in the Excel file identical to the example. As
long as the “SampleName” is different between the replicate
profiles, the software recognizes that replicates are being
analyzed.
7. Check that the spelling of the loci in the .csv file matches the
spelling of the loci in the allelic frequency tables used, including
any spaces or hyphens. This will depend on the database the
allelic frequencies are downloaded from. Example: “PentaE”
and “Penta E” are not considered the same marker. Capitaliza-
tion of letters, however, is not considered by the software. “E”
and “e” are considered the same character.
8. Peak heights do not need to be included in the file. If they are,
the software ignores the columns.
9. Author recommends only uploading the references being used
in the analysis. For example, if two suspects are being compared
separately to an unknown sample, upload the references one at
a time and clear the software before performing the second
analysis. If a victim and a suspect are being considered in the
same hypothesis set, upload both at the same time [17].
10. If only one allele is entered for a homozygous location, LRmix
Studio displays an error window when the reference is loaded.
The warning will ask the user to double check that the entry is
right, and then will automatically add this locus in as a
homozygous.
11. If an error is received during start-up, verify that Java has been
downloaded and that the file has been extracted. Additionally,
verify that the software file remains in the folder with the other
downloaded documents. These files include code that is
required for proper functioning of the software. The author
has also found that the software is not compatible with Mac
computers.
12. If there is only one allele at a locus, the software triggers a
warning window stating: “At least one locus in [SampleName]
contains only one allele. Do you want to convert these loci to
homozygotic?” Click “Yes” if it is a homozygous location (the
allele is then duplicated and highlighted red, with a note at the
bottom of the software window). Otherwise, click “No” and
go back to the file to fill in the appropriate allele in the .csv file.
The author recommends starting a new analysis and starting
over to ensure that all incorrect profiles have been removed
from the analysis.
 Likelihood Ratio Calculation Using LRmix Studio 327

13. This occurs when there are no alleles detected at a particular

locus.
14. If a partial profile is used as a comparison profile, loci not
present in the reference must be unchecked within the evidence
profile. If these loci are not unchecked, the LR calculated by
LRmix Studio is inaccurate.
15. This value should be determined for each laboratory during
internal validation of the software.
16. The value of alleles (“X”) within this button is based on the
number of alleles in the unknown profile.
17. The value within the range to be used for analysis should be
determined for each laboratory during internal validation of
the software.
18. For example, if the laboratory performs statistics for three
populations (each requiring their own allelic frequency data-
base), such as Caucasian, African American, and Hispanic, the
allelic frequency database in the “Analysis” tab should be
changed for each pDO determination. The lab should then
use the pDO in the LR calculation of the matching allelic
frequency database.
19. If the allelic frequency file is changed, make sure the correct
probability of drop-out is included.
20. If any of the hypothesis information changes, make sure the
probability of drop-out is recalculated.
21. For more information on these parameters, see the User
Manual [20].
22. After an LR has been generated, the user can now view the run
log or print a report.
23. Analysis can be performed for specific loci if the user would like
to analyze the model at each locus.
24. The goal is to set the iterations close to the resulting LR. This
gives more confidence in the model.
25. Once LRmix Studio is closed, the reports tab is cleared.

References
1. Federal Bureau of Investigation (2020) Quality https://www.swgdam.org/_files/ugd/4344
Assurance Standards for Forensic DNA Testing b0_3f94c9a6286048c3924c58e2c230e74e.
Laboratories. Available via Federal Bureau of pdf. Accessed 12 Dec 2022
Investigation. https://ucr.fbi.gov/lab/biomet 3. Gill P, Brenner CH, Buckleton JS et al (2006)
ric-analysis/codis/quality-assurance- DNA commission of the International Society
standards-for-forensic-dna-testing-labor of Forensic Genetics: recommendations on the
atories. Accessed 12 Dec 2022 interpretation of mixtures. Forensic Sci Int
2. SWGDAM (2017) Interpretation Guidelines 160:90–101. https://doi.org/10.1016/j.
for Autosomal STR Typing by Forensic DNA forsciint.2006.04.009
Testing Laboratories. Accessed via SWGDAM.
328 Megan M. Foley

4. Gill P, Curran J, Neumann C et al (2008) 13. Bright JA, Stevenson KE, Curran JM et al
Interpretation of complex DNA profiles using (2015) The variability in likelihood ratios due
empirical models and a method to measure to different mechanisms. Forensic Sci Int
their robustness. Forensic Sci Int Genet 2:91– Genet 14:187–190. https://doi.org/10.
103. https://doi.org/10.1016/j.fsigen.2007. 1016/j.fsigen.2014.10.013
10.160 14. Benschop CCG, Nijveld A, Duijs FE et al
5. Haned H, Egeland T, Pontier D et al (2011) (2019) An assessment of the performance of
Estimating drop-out probabilities in forensic the probabilistic genotyping software EuroFor-
DNA samples: a simulation approach to evalu- Mix: trends in likelihood ratios and analysis of
ate different models. Forensic Sci Int Genet 5: Type I & II errors. Forensic Sci Int Genet 42:
525–531. https://doi.org/10.1016/j.fsigen. 31–38. https://doi.org/10.1016/J.FSIGEN.
2010.12.002 2019.06.005
6. Haned H, Slooten K, Gill P (2012) Explor- 15. Clayton TM, Whitaker JP, Sparkes R et al
atory data analysis for the interpretation of (1998) Analysis and interpretation of mixed
low template DNA mixtures. Forensic Sci Int forensic stains using DNA STR profiling.
Genet 6:762–774. https://doi.org/10.1016/ Forensic Sci Int 91:55–70. https://doi.org/
j.fsigen.2012.08.008 10.1016/s0379-0738(97)00175-8
7. Brenner CH (1997) What’s wrong with the 16. Gill P, Haned H (2013) A new methodological
“exclusion probability.” Accessed via https:// framework to interpret complex DNA profiles
www.dna-view.com/exclusn.htm. Accessed using likelihood ratios. Forensic Sci Int Genet
25 Apr 2022 7:251–263. https://doi.org/10.1016/j.
8. Buckleton J, Triggs C (2006) Is the 2p rule fsigen.2012.11.002
always conservative? Forensic Sci Int 159:206– 17. Curran JM, Gill P, Bill MR (2005) Interpreta-
209. https://doi.org/10.1016/j.forsciint. tion of repeat measurement DNA evidence
2005.08.004 allowing for multiple contributors and popula-
9. Gill P, Sparkes B, Buckleton JS (1998) Inter- tion substructure. Forensic Sci Int 148:47–53.
pretation of simple mixtures of when artefacts https://doi.org/10.1016/j.forsciint.2004.
such as stutters are present—with special refer- 04.077
ence to multiplex STRs used by the Forensic 18. Gill P, Kirkham A, Curran J (2007) LoComa-
Science Service. Forensic Sci Int 95:213–224. tioN: a software tool for the analysis of low
https://doi.org/10.1016/S0379-0738(98) copy number DNA profiles. Forensic Sci Int
00094-2 166:128–138. https://doi.org/10.1016/j.
10. Gill P, Whitaker J, Flaxman C et al (2000) An forsciint.2006.04.016
investigation of the rigor of interpretation rules 19. Buckleton JS, Triggs CM, Walsh SJ (2005)
for STRs derived from less than 100 pg of Forensic DNA evidence interpretation. CRC
DNA. Forensic Sci Int 112:17–40. https:// Press
doi.org/10.1016/s0379-0738(00)00158-4 20. Haned H, de Jong J (2016) LRmix Studio
11. Perlin MW, Legler MM, Spencer CE et al 2.1.1 User Manual
(2011) Validating TrueAllele® DNA mixture 21. Coble MD, Buckleton J, Butler JM et al (2016)
interpretation. J Forensic Sci 56:1430–1447. DNA Commission of the International Society
https://doi.org/10.1111/j.1556-4029.2011. for Forensic Genetics: recommendations on
01859.x the validation of software programs performing
12. Inman K, Rudin N, Cheng K et al (2015) Lab biostatistical calculations for forensic genetics
Retriever: a software tool for calculating likeli- applications. Forensic Sci Int Genet 25:191–
hood ratios incorporating a probability of 197. https://doi.org/10.1016/j.fsigen.2016.
drop-out for forensic DNA profiles. BMC 09.002
Bioinform 16:298. https://doi.org/10.
1186/s12859-015-0740-8
 Part VI

Specialized Samples
 Chapter 20

Mitochondrial DNA Analysis

Ashley M. Cooley

Abstract
Mitochondrial DNA (mtDNA) is a 16,569 base pair (bp) circular genome that is passed from generation to
generation through the maternal line. mtDNA analysis in the context of the forensic science field usually
involves unidentified human remains or missing persons. These cases tend to have more challenging sample
types (e.g., rootless hairs, bone, blood, and saliva), and mtDNA analysis can be an additional method to
assist in identification efforts. Due to the multifaceted protection of mtDNA within cells, mtDNA is able to
be extracted even in cases of extreme degradation. mtDNA analysis for forensic science has been both peer-
reviewed in academic journals and has been testified to in criminal court procedures since the late 1990s,
allowing for consistent and reliable usage in casework. This chapter describes the general methodology of
extracting, amplifying, quantifying, and analyzing an mtDNA sequence for use in forensic casework,
specifically for these common items of evidence.

Key words Mitochondrial DNA, Forensic science, Forensic DNA analysis, DNA sequencing, DNA
typing, Hair analysis, Bone analysis

1 Introduction

Mitochondrial DNA (mtDNA) is a genome, separate and different

from the nuclear genome, within each cell’s mitochondria, that has a
mutation rate approximately 10 times that of nuclear DNA, which
gives rise to its distinguishing polymorphisms [1–3]. Additionally,
mtDNA is in cells at a higher copy number than nuclear DNA since
a single cell can have multiple mitochondria, but only one nucleus.
Forensic nuclear DNA analysis utilizes short tandem repeat (STR)
locations that are extracted from the DNA strand, amplified, and
visualized. Each cell has two alleles (types) at each STR locus (location)
that are inherited from the mother and the father (e.g., a person may
have a 6 and a 7 allele at the STR locus TH01). Due to the wide range
of alleles that can occur at each locus, a full STR profile (typically
consisting of over 20 loci) developed from a sample can have a statistic
that makes it rare in the human population [1]. In comparison, the
mtDNA genome is solely maternally inherited. Maternal inheritance is

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_20,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

331
332 Ashley M. Cooley

particularly helpful for cases of human identification because a mater-

nal relative’s mtDNA is rather easy to obtain. However, this means that
the mtDNA profile developed is not unique and can be found more
frequently in the population [1].
Mitochondrial DNA analysis of hair [4–8] and bone [9–18] is
particularly successful in part due to the encapsulation of DNA by
the exterior of the tissue and protection of mtDNA within layers of
keratin (hair) [4–8] and hydroxyapatite (bone) [9–18]. These char-
acteristics have led to mtDNA becoming a popular yet reliable
identification method for challenged samples. For example, bones
that have been subjected to environmental conditions over time
(e.g., UV, humidity, temperature, and soil conditions) tend to have
a lower success rate of developing a nuclear DNA profile. However,
the hydroxyapatite protecting the mtDNA within the bone can
allow for mtDNA to be obtained. For cases involving hairs, the
root of the hair contains a higher concentration of nuclear DNA,
while the shaft contains a higher concentration of mtDNA.
Depending on the length, condition, and section of the hair that
was collected at a crime scene, both nuclear DNA and mtDNA
analysis may occur [4–8].
Mitochondrial DNA analysis relies upon a strategy of multiple
polymerase chain reaction (PCR) amplifications that focus on the
control region (1122 total bp) or smaller regions of interest within
the control region [19, 20]. Primarily for forensic DNA purposes,
these regions of interest have been described as hypervariable
region 1 (HV1) (16,024–16,365 bp), hypervariable region
2 (HV2) (73–340 bp), and hypervariable region 3 (HV3)
(438–574 bp), which contain a large majority of the polymorph-
isms [1, 21–26]. Primarily, HV1 and HV2 regions are used; HV3 is
optional for testing. The control region is not a coding region, and
therefore, mutations (additions, deletions, or changes to each base
pair) can arise without causing any cell failure. These mutations/
polymorphisms allow for limited differentiation between people
and allow us to use mtDNA for purposes. A primer set strategy of
PCR amplification isolates the control region with overlapping
regions by creating specific amplicons that can be sequenced.
After sequencing, analysts will compile the amplicons and visually
verify each base developed.
This sequence data is then compared to the Revised Cambridge
Reference Sequence (rCRS) [27, 28] to produce a summary of the
polymorphisms or differences in sequence from the reference. The
combination of polymorphisms from these sequences is the mito-
chondrial haplotype (mitotype) for the sample [21–26, 29]. This
mitotype can then be used to directly compare references from a
family looking for a loved one, or to upload into the National DNA
Index System (NDIS) located within the Combined DNA Index
System (CODIS) to be compared to the DNA database of missing
persons and family reference samples [24].
 mtDNA Analysis 333

2 Materials

Prepare all reagents using ultra-pure water (18 MΩ-cm) that has
been autoclaved and ensure purchased reagents are molecular
biology-grade. It is recommended to UV-irradiate all tubes prior
to using for maximum contamination prevention [30].

2.1 General 1. Centrifuge: Fixed angle rotor, capable of 10,000 × g; rotor

Materials must fit 1.5 mL microcentrifuge tubes. Temperature control
is not needed.
2. Microcentrifuge tubes: 1.5 mL, screw-top and flip-cap (with
associated spin baskets).
3. Ultraviolet Crosslinker.
4. Water, ultra-pure.
5. Thermal cycler: Capable of hot-start PCR conditions and hold-
ing 0.1 mL thin-walled tubes.
6. 0.1 mL thin-walled sterile tubes.

2.2 Extraction 1. Compound Microscope or Stereomicroscope.

2. Ultrasonic Cleaner.
3. Microcon® YM-30 Concentrators [31].
4. Tissue Grinders.
5. 5% Chelex® 100 in ultra-pure water [32].
6. 1 M Dithiothreitol (DTT): Store at -20 °C.
7. Absolute Ethanol.
8. Extraction Buffer: 7.6 mM Tris-HCl, 100 mM NaCl, 10 mM
EDTA, 2% sodium dodecyl sulfate (SDS). Store at room
temperature.
9. Isopropanol.
10. n-Butanol.
11. 25:24:1 Phenol/Chloroform/Isoamyl Alcohol (PCIAA):
Store at 4 °C. A fume hood should be utilized when pipetting
PCIAA.
12. 20 mg/mL Proteinase K: Store at -20 °C.
13. Low EDTA TE Buffer (TE-4 Buffer): 10 mM Tris-HCl and
0.1 mM EDTA; pH 7.5. Store at room temperature.
14. 5% Terg-a-zyme™.
15. Xylene.
334 Ashley M. Cooley

2.3 Amplification 1. 0.625 μg/μL Bovine Serum Albumin (BSA): Store at -20 °
C [33].
2. 2.5 mM Deoxynucleotide triphosphate (dNTP) mix: Store at
-20 °C.
3. 10X PCR Buffer I with 15 mM MgCl2: Store at -20 °C.
4. Positive control DNA (HL60): Store at -20 °C.
5. 10 μM Primers: Store at -20 °C (see Subheading 2.4).
6. 5 U/μL Taq Gold™ DNA Polymerase: Store at -20 °C.

2.4 Primer 1. F15971 5′ TTA ACT CCA CCA TTA GCA CC 3′.
Sequences 2. F15989 5′ CCC AAA GCT AAG ATT CTA AT 3′.
3. F16190 5′ CCC CAT GCT TAC AAG CAA GT 3′.
4. R16251 5′ GGA GTT GCA GTT GAT GT 3′.
5. R16410-m19 5′ GAG GAT GGT GGT CAA GGG A 3′.
6. F15 5′ CAC CCT ATT AAC CAC TCA CG 3′.
7. F155 5′ TAT TTA TCG CAC CTA CGT TC 3′.
8. R285 5′ GTT ATG ATG TCT GTG TGG AA 3′.
9. R389 5′ CTG GTT AGG CTG GTG TTA GG 3′.
10. R599 5′ TTG AGG AGG TAA GCT ACA TA 3′.

2.5 Product 1. DC power supply.

Evaluation 2. UV Transilluminator with camera.
3. Gel beds.
4. Gel lane combs.
5. Gel tank, cover and electrodes.
6. Orbital platform shaker.
7. 10X TAE buffer.
8. 5X Loading buffer.
9. DNA Molecular Weight Marker XIV.
10. 3:1 agarose.
11. SYBR® Safe DNA gel stain.
12. Microtiter plate.
13. 250 mL flat-bottom boiling flask.

2.6 Purification and 1. Speedvac concentrator.

Sequencing 2. Optical plate, 96 well.
3. Performa® DTR Gel Filtration Cartridge: Store at 4 °C.
4. BigDye® dilution buffer [34].
 mtDNA Analysis 335

5. BigDye® Terminator 1.1 Ready Reaction Mix: Store at -20 °

C.
6. dGTP BigDye® Terminator Ready Reaction Mix: Store at -
20 °C [35].
7. ExoSAP-IT®: Store at -20 °C.
8. ExoSAP-IT® dilution buffer: 50 mM Tris-HCl, pH 8.0. Store
at room temperature.
9. Hi-Di™ Formamide: Store at -20 °C.
10. 10 μM Primers: Store at -20 °C (see Subheading 2.4).

2.7 Capillary 1. 96-well plate retainer and base.

Electrophoresis 2. Sequencing Analysis Software v5.2 or higher.
3. Capillary electrophoresis instrument: Need accompanying col-
lection software and consumables.

2.8 Sequence 1. Sequence Scanner v1.0 or higher.

Assembly 2. Sequencher™ software v4.8 or higher [36].

3 Methods

A laboratory coat, gloves, sleeves, and a surgical mask are utilized

during all pre-amplification steps. A laboratory coat and gloves
should be worn during post-amplification steps. Gloves should be
changed frequently (e.g., between samples, when soiled, and after
touching other high-touch surfaces) (see Note 1).

3.1 Chelex® 1. Pipette 1.0 mL ultra-pure water into an appropriately labeled

Extraction Method for sterile tube and initiate a reagent blank.
Reference Bloodstains 2. Add an appropriately sized piece (approximately 3 mm × 3 mm)
[37] of blood-stained material (including FTA cards) to the tube.
3. Vortex at high speed for 10 s.
4. Incubate at room temperature (or 95 °C for samples on FTA
cards) for a minimum of 15 min, vortexing several times during
the incubation.
5. Centrifuge for 3 min at approximately 10,000 × g.
6. Discard all but 20–30 μL of the supernatant, leaving the sub-
strate and pelleted material in the tube.
7. Proceed to DNA isolation (see Subheading 3.3, step 1).
336 Ashley M. Cooley

3.2 Chelex® 1. Using a sterile, disposable scalpel, cut and add an appropriately
Extraction Method for sized piece of sample (approximately 1/3 of a swab tip) to the
Reference Buccal lower portion of an appropriately labeled sterile tube.
Swabs 2. Add 1.0 mL ultra-pure water to the sterile tube and initiate a
reagent blank.
3. Vortex at high speed for 10 s.
4. Incubate at room temperature for 30 min.
5. Centrifuge for 3–15 min at approximately 10,000 × g.
6. Remove and discard the top 0.5 mL of supernatant.
7. Transfer the cutting into a spin basket and place the basket into
the tube (see Note 2).
8. Centrifuge for 3 min at approximately 10,000 × g, remove the
basket.
9. Remove and discard all but 50 μL of supernatant.
10. Proceed to DNA isolation (see Subheading 3.3, step 1).

3.3 Chelex® Isolation 1. After completing the Chelex extraction for reference samples
of DNA (see Subheading 3.1, step 6 or Subheading 3.2, step 9), pro-
ceed by adding 5% Chelex® to a final volume of 200 μL and
vortex gently to re-suspend the pellet (see Note 3).
2. Incubate at 56 °C for 30 min.
3. Vortex briefly.
4. Incubate in a boiling water bath for 8 min.
5. Vortex briefly.
6. Centrifuge for 3 min at approximately 10,000 × g.
7. Transfer the supernatant from the Chelex® beads to an appro-
priately labeled sterile tube and store at -20 °C (see Note 4).
8. Proceed to mitochondrial DNA amplification (see Subheading
3.7, step 1).

3.4 Organic 1. Clean micro tissue grinders with 10% bleach, then ultra-pure
Extraction Method for water, then ethanol, and allow to dry completely before use.
Loose Hairs 2. Irradiate the micro tissue grinders in the UV crosslinker.
3. Carefully remove approximately 2 cm of hair shaft material
from the proximal end of the hair and place in an appropriately
labeled sterile tube (see Note 5).
4. Add 1.0 mL 5% Terg-a-zyme™ solution and place the tube in
the ultrasonic cleaner for 20 min.
5. Remove the tube from the ultrasonic cleaner and carefully
remove the 5% Terg-a-zyme™ solution.
6. Repeat the Terg-a-zyme™ wash process three times for a total
of four washes.
 mtDNA Analysis 337

7. Add 1.0 mL absolute ethanol, recap the tube, and gently

agitate several times.
8. Remove the absolute ethanol, add 1.0 mL ultra-pure water,
recap the tube, and gently agitate several times.
9. Remove the water.
10. Initiate a reagent blank at this time by adding 187 μL extrac-
tion buffer to a clean, UV-irradiated micro tissue grinder and
briefly simulate grinding.
11. Transfer the extraction buffer to a labeled sterile tube (this is
the reagent blank).
12. To the same micro tissue grinder used to create the reagent
blank, add 130 μL extraction buffer and the washed/prepared
hair shaft(s).
13. Grind until fragments of hair are no longer visible.
14. Transfer the solution into a labeled sterile tube.
15. Add an additional 57 μL extraction buffer to the micro tissue
grinder to rinse and transfer it to the tube with the sample.
16. Add 5 μL Proteinase K and 8 μL DTT, vortex, and pulse spin.
17. Incubate at 56 °C for a minimum of 2 h and a maximum of
24 h. It does not need to be vortexed during this
incubation time.
18. Add 200 μL PCIAA, vortex thoroughly, and centrifuge for
2 min at approximately 10,000 × g.
19. Transfer the upper aqueous layer to an appropriately labeled
sterile tube (see Note 6).
20. Dispose of the lower layer (phenol waste) in the appropriate
waste container.
21. Repeat extraction with PCIAA until the interface is clean (see
Note 7).
22. To the aqueous layer, add 200 μL n-butanol.
23. Vortex thoroughly and centrifuge for 2 min at approximately
10,000 × g.
24. Remove and discard the upper n-butanol layer into an appro-
priate waste container.
25. Label a sufficient number of pre-assembled UV irradiated
Microcon® YM-30 concentrators.
26. Add 300 μL TE-4 buffer to each sample reservoir of the
Microcon® YM-30 concentrators.
27. Transfer the lower aqueous layer to the sample reservoir of the
Microcon® YM-30 concentrators, avoiding the pipetting of
any residual n-butanol.
338 Ashley M. Cooley

28. Centrifuge the concentrator at a maximum of 1000 × g for

15–30 min or until the sample has spun through (see Note 8).
29. Discard the filtrate.
30. Add 300 μL TE-4 buffer to the sample reservoir of the Micro-
con® YM-30 concentrators.
31. Centrifuge the concentrator at a maximum of 1000 × g for
15–30 min or until the sample has spun through.
32. Add 60 μL TE-4 buffer to the filter side of the sample reservoir
of the Microcon® YM-30 concentrators.
33. Place a retentate cup on the top of each concentrator and
briefly vortex with the retentate cup pointing upward.
34. Invert each concentrator sample reservoir with its retentate cup
and centrifuge at approximately 10,000 × g for 3 min.
35. Discard the concentrators and measure the volume of the
retentate with a pipette.
36. Add TE-4 buffer, if necessary, to bring the retentate volume up
to 100 μL.
37. Proceed to mitochondrial DNA amplification (see Subheading
3.7, step 1).

3.5 Organic See Chapter 6: DNA Extraction of Bone through Demineralization

Extraction Method for in this book for this protocol.
Bone

3.6 Organic 1. Add an appropriately sized piece (approximately 3 mm × 3 mm)

Extraction Method for of blood-stained material (including FTA cards) or approxi-
Bloodstains and mately 1/3 of a swab tip, in an appropriately labeled
Buccal Swabs sterile tube.
2. Add to the sample tube and to a separately labeled sterile tube
for the reagent blank: 400 μL extraction buffer and 10 μL
Proteinase K.
3. Vortex, pulse spin, and incubate at 56 °C for a minimum of 2 h
and a maximum of 24 h. It is not necessary to vortex during
incubation.
4. Transfer the cutting to a basket and place the basket in the tube
and close the lid. Centrifuge for 3 min at approximately
10,000 × g to remove the excess liquid from the cutting.
5. Retain the cutting, if necessary, to be dried and repackaged.
6. Add 400 μL PCIAA, vortex thoroughly, and centrifuge for
2 min at approximately 10,000 × g.
7. Transfer the upper aqueous layer to an appropriately labeled
sterile tube (see Note 6).
 mtDNA Analysis 339

8. Dispose of the lower layer (phenol waste) in the appropriate

waste container.
9. If necessary, repeat extraction with PCIAA until the interface is
clean (see Note 7).
10. To the aqueous layer obtained (see Subheading 3.6, step 7),
add 400 μL n-butanol.
11. Vortex thoroughly and centrifuge for 2 min at approximately
10,000 × g.
12. Remove and discard the upper n-butanol layer into an appro-
priate waste container.
13. Label a sufficient number of pre-assembled UV irradiated
Microcon® YM-30 concentrators.
14. Add 100 μL TE-4 buffer to each sample reservoir of the
Microcon® YM-30 concentrators.
15. Transfer the lower aqueous layer to the sample reservoir of the
Microcon® YM-30 concentrators, avoiding the pipetting of
any residual n-butanol.
16. Centrifuge the concentrator at a maximum of 1000 × g for
15–30 min or until the sample has spun through (see Note 8).
17. Discard the filtrate.
18. Add 400 μL TE-4 buffer to the sample reservoir of the Micro-
con® YM-30 concentrators.
19. Centrifuge the concentrator at a maximum of 1000 × g for
15–30 min or until the sample has spun through.
20. Discard the filtrate and repeat the 400 μL TE-4 buffer wash.
21. Add 60 μL TE-4 buffer to the filter side of the sample reservoir
of the Microcon® YM-30 concentrator.
22. Place a retentate cup on the top of each concentrator and
briefly vortex with the retentate cup pointing upward.
23. Invert each concentrator sample reservoir with its retentate cup
and centrifuge at approximately 10,000 × g for 3 min.
24. Discard the concentrators and measure the volume of the
retentate with a pipette.
25. Add TE-4 buffer, if necessary, to bring the retentate volume up
to 100 μL.
26. Transfer the 100 μL of retentate to an appropriately labeled
sterile tube.
27. Proceed to mitochondrial DNA amplification (see Subheading
3.7, step 1).
340 Ashley M. Cooley

Table 1
Primer pairs for both reference and evidence samples

Targeted primer set Primers used

Primer Set 1 (HV1) F15989/R16251
Primer Set 2 (HV1) F16190/R16410-m19
Primer Set 3 (HV2) F15/R285
Primer Set 4 (HV2) F155/R389
Control Region (HV1 and HV2) F15971/ R599
Primer pairs are used for both mitochondrial DNA amplification and sequencing. “F”
indicates it is a forward primer, “R” indicates it is a reverse primer

Table 2
Composition of mtDNA amplification reaction master mix

Component Volume per reaction

10X PCR buffer 5 μL
2.5 mM dNTPs 4 μL
0.625 μg/μL BSA 2 μL
Forward primer (10 μM) 2 μL
Reverse primer (10 μM) 2 μL
Taq Gold (5 U/μL) 1 μL
Ultra-pure water 24 μL
Total Volume 40 μL
Numerous components are required for a mtDNA amplification. It is advised that an
“n + 1” strategy be used, where n is the number of samples (e.g., if you have 16 samples
to make a master mix for, make enough for 17 to allow for pipetting variability)

3.7 Mitochondrial 1. After DNA extraction and isolation, prepare an amplification

DNA Amplification master mix in a UV irradiated, sterile tube for each of the
regions to be evaluated (see Tables 1 and 2 and Note 9).
2. Aliquot 40 μL master mix into each appropriately labeled UV
irradiated, sterile, thin-walled PCR tube.
3. Pipette the sample and control volumes (as appropriate) one at
a time to the corresponding PCR tubes (see Table 3).
4. Vortex the PCR tubes briefly and pulse spin prior to placing the
tubes in the thermal cycler (see Note 10).
5. Select and start the PCR program on the thermal cycler based
on whether you are amplifying the entire control region or one
or more of the primer set regions (see Table 4).
6. Proceed to mitochondrial DNA product evaluation (see Sub-
heading 3.8, step 1).
 mtDNA Analysis 341

Table 3
Composition of sample and control input for mtDNA amplification reaction

Component Volume
Amplification negative control 10 μL ultra-pure water
Sample DNA extracts 1–10 μL of sample
(qs to 10 μL with ultra-pure water)
Amplification positive control 10 μL HL60 (200 pg / 10 μL primer sets)
10 μL HL60 (500 pg / 10 μL control region)
Reagent blank volume is equal to the maximum 1–10 μL of the reagent blank
sample volume added (qs to 10 μL with ultra-pure water)
The appropriate addition of water or DNA sample/control is crucial to maintaining the correct ratio to the master mix
added to the tube. qs (quantum satis) your volume so that 10 μL of water, DNA sample/control, or a combination of the
two are added to make a final volume of 50 μL

Table 4
Thermal cycler amplification parameters

Control region reaction Primer set reaction

96 °C for 10 min 96 °C for 10 min
36 cycles of: 38 cycles of:
94 °C for 30 s, 56 °C for 30 s, 72 °C for 60 s 94 °C for 20 s, 56 °C for 20 s, 72 °C for 30 s
72 °C for 7 min 4 °C soak
4 °C soak
Parameters are provided for amplification of either the control region or one or more of the primer set regions

3.8 Mitochondrial 1. Each 3% (w/v) gel contains 1.5 g 3:1 agarose in a 50 mL 1X

DNA Product TAE buffer (see Note 11).
Evaluation 2. Measure the volume (50 mL per gel) of 1X TAE buffer with a
graduated cylinder and add to a 250 mL flat-bottom boiling
flask.
3. Slowly add the 1.5 g 3:1 agarose to the flask while swirling the
buffer to avoid clumping of the agarose.
4. Place the weigh boat upside down on the top of the flask to use
as a lid and heat in the microwave oven for approximately 1 min
and 30 s on 50% power (see Note 12).
5. Pulse spin the SYBR® Safe DNA gel stain 10,000X concentrate
in a microcentrifuge.
6. Add 5 μL of the concentrate to the 50 mL of agarose solution
and place the glass flask on an orbital shaker for approximately
15 min at ~100 rpm to cool the agarose solution enough to
handle it without hand protection.
342 Ashley M. Cooley

7. Assemble the gel bed(s) in either the casting tray or by placing

the gel bed sideways in the electrophoresis tank so that the
agarose solution will not spill out of the bed (see Note 13).
8. When the flask is cool enough to handle, the agarose gel can be
poured into the prepared gel beds.
9. Ensure the gel bed is level and pour the molten agarose gel into
the center of the gel bed. Remove any bubbles with a
pipette tip.
10. Place the comb(s) in position and allow the gel to solidify for
approximately 15 min at room temperature.
11. Once the gel has solidified and the comb(s) have been
removed, the gel is ready to be used (see Note 14).
12. Ensure the gel tank is situated so that the red (positive) elec-
trode is farthest from the loading wells.
13. Load the product gel into the tank and add a sufficient volume
of 1X TAE buffer to the tank to cover the product gel at least
1 mm.
14. Add 4 μL 5X loading buffer to the first well of a microtiter plate
for use with the DNA MW Marker XIV.
15. Add 2 μL 5X loading buffer into the wells of the microtiter
plate to correspond to the amplified samples that will be loaded
into the product gel.
16. Add 2 μL DNA MW Marker XIV to the first well of the
microtiter plate containing 5X loading buffer.
17. Add 4 μL of the amplified sample to the appropriate well of the
microtiter plate containing 5X loading buffer. Store the
remainder of the sample at 4 °C.
18. Load the entire amount of either ladder or sample from the
microtiter plate into the designated well of the gel, continuing
until all of the wells have been loaded.
19. Place the cover on the gel tank.
20. Plug the red (positive) electrode into the positive plug of the
power supply; then, plug the black (negative) electrode into
the negative plug of the power supply.
21. Turn on the power supply and set the voltage to 150 volts.
22. Run the gel for a minimum of 45 min, or until the loading
buffer moves approximately 4 cm.
23. When electrophoresis is complete, slide the gel onto the UV
transilluminator and place the digital camera/gel hood over
the transilluminator (see Note 15).
24. Turn on the UV transilluminator and, while using the macro
setting on the camera, zoom into the gel to take the photo.
 mtDNA Analysis 343

Table 5
Composition of ExoSAP-IT® master mix

Component Volume per reaction

®
ExoSAP-IT 1.5 μL
®
ExoSAP-IT dilution buffer 18.5 μL
Total Volume 20 μL
It is advised that an “n + 1” strategy be used, where n is the number of samples (e.g., if
you have 16 samples to make a master mix for, make enough for 17 to allow for pipetting
variability)

Table 6
Thermal cycler enzymatic purification and cycle sequencing parameters

Enzymatic purification Cycle sequencing

37 °C for 30 min 96 °C for 1 min
85 °C for 15 min 25 cycles of:
4 °C soak 96 °C for 10 s, 50 °C for 5 s, 60 °C for 4 min
4 °C soak
Parameters are provided for both the enzymatic purification and cycle sequencing steps

25. Turn the UV transilluminator off and dispose of the gel (see
Notes 16 and 17).
26. Proceed to purification/sequencing of mitochondrial DNA
(see Subheading 3.9, step 1).

3.9 Enzymatic 1. Prepare a master mix of ExoSAP-IT® and ExoSAP-IT® dilu-

Purification/ tion buffer (see Table 5).
Sequencing of 2. Add 20 μL of the master mix to each amplification tube previ-
Mitochondrial DNA ously created (samples and corresponding controls) (see Sub-
heading 3.7, step 4) to move forward with purification and
sequencing.
3. Briefly vortex and pulse spin the PCR tubes, and then place
them into the thermal cycler.
4. Select and start the PCR program on the thermal cycler for
enzymatic purification (see Table 6).
5. While the thermal cycler program is running, prepare a
sequencing reaction master mix for each primer used for ampli-
fication (see Subheading 3.7, step 1) (see Table 7 and Note 18).
6. Add 7 μL of master mix to each new appropriately labeled
sterile PCR tube.
344 Ashley M. Cooley

Table 7
Composition of cycle sequencing mtDNA reaction

Component Volume per reaction

Primer (10 μM) 1.0 μL
®
BigDye Terminator 1.1 RR Mix 3.6 μL
dGTP BigDye® Terminator RR Mix 0.4 μL
®
BigDye dilution buffer 2.0 μL
Total Volume 7 μL
It is advised that an “n + 1” strategy be used, where n is the number of samples (e.g., if
you have 16 samples to make a master mix for, make enough for 17 to allow for pipetting
variability)

7. After the sample(s) have finished in the thermal cycler for

enzymatic purification (see Subheading 3.9, step 4), add the
appropriate volume to the corresponding PCR tubes one at a
time (see Note 19).
8. Select and start the PCR program on the thermal cycler for
cycle sequencing (see Note 20 and Table 6).
9. After the sample(s) have finished in the thermal cycler, spin the
Performa® DTR Gel Filtration Cartridges for 1 min at 750 × g.
10. Transfer the cartridge to the manufacturer-provided 1.5 mL
tube and add the sequenced sample(s) (see Subheading 3.9,
step 8) to the packed column, ensuring that the fluid is placed
in the center of the gel.
11. Close the cap and spin at 750 × g for 2 min.
12. Remove and discard the cartridge from each tube.
13. Transfer the sample(s) to a 96 well optical plate.
14. Spin the plate in a speedvac until dry (approximately 1–2 h).
15. Pipette 10 μL Hi-Di™ Formamide into any well of the optical
plate that contains the dried sequence product.
16. Pipette 10 μL Hi-Di™ Formamide into any unused wells of the
plate that will be injected by the instrument (e.g., on the AB
3500xL, three columns are injected at a time, so ensure that
columns are filled with Hi-Di™ Formamide in groups of
three).
17. Place a 96 well septa on the plate and vortex to help re-suspend
the samples.
18. Pulse spin the plate.
19. Place the plate onto a plate base and then snap the plate
retainer over the top of the plate, plate septa, and plate base.
20. Place plate onto the capillary electrophoresis instrument’s
autosampler for analysis (see Note 21).
 mtDNA Analysis 345

Fig. 1 Example of a contig using the primer set amplification strategy. Primer sets 1 and 2 comprise the HV1
region, and primer sets 3 and 4 comprise the HV2 region

Fig. 2 Sequencher™ software viewer. The top half shows each individual mtDNA sequence developed and
their overlapping regions. The bottom half shows each nucleotide represented by different colors (adenine
[A] is green, thymine [T] is red, guanine [G] is black, cytosine [C] is blue). The sequences from the sample are
shown in relation to the rCRS

3.10 Sequence The Sequencher™ software [38] is used to edit and assemble the
Assembly and Analysis sequences developed to produce a contiguous consensus sequence
(contig) (see Fig. 1). The consensus sequence can then be compared
to the Revised Cambridge Reference Sequence (rCRS) to report the
differences to the reference. There are other software available to
purchase that can edit and compile mtDNA sequences (see Fig. 2
and Note 22).
Once sample sequences have been compiled into a contig, contigs
can be compared between evidence and references to evaluate for any
differences. When comparing sequences obtained from samples, only
the regions with a common range will be evaluated. For example, if a
partial sequence (16,024–16,365 and 73–284) is obtained for a sam-
ple of questioned origin (Q) and a full sequence is obtained for the
sample of known origin (K), the comparison will be conducted on
positions 16,024–16,365 and 73–284. In addition, sequences before
and after the defined HV1 and HV2 regions will also be used for
comparison purposes, provided this range is common to both samples.
346 Ashley M. Cooley

4 Notes

1. Exceptional care must be taken when performing mtDNA

analysis. Due to the challenging nature of the samples, there
is an extremely high chance of contamination from either the
analyst or other samples in the laboratory. It is not advisable to
work on more than one sample at a time.
2. Alternatively, sterile forceps can be used to remove the cutting
(s) from the water in the tube and squeezed to remove excess
water from the cutting(s).
3. When pipetting Chelex® solutions, the resin beads must be
distributed evenly in solution.
4. Great care should be taken to avoid pipetting any Chelex®
beads into your final eluate. The beads are clear and translu-
cent. They should be easy to see in appropriate light.
5. A stereo or compound microscope may be used in making the
determination of the proximal end of the hair by observing the
root end (if present) or the directionality of the scales of the
hair or hair fragment.
6. When the PCIAA is added and vortexed into the solution, the
DNA is separated into the aqueous, upper layer. The proteins
and lipids are separated into the organic, lower layer. The point
at which these two layers meet is called the interface, where
additional proteins and debris will lie. It is visible to the naked
eye and is similar to the phenomenon when oil and water are
mixed. Care must be taken not to disturb the layers or to
pipette up the interface to ensure your extract is as clean as
possible.
7. Some samples that are dirtier or have potential contaminants
may need more than one PCIAA extraction. If you notice that
the interface is thick, or that the aqueous, upper layer is not
clear, you may want to repeat this step.
8. Only spin the concentrator enough so that the sample spins
through but the membrane within the reservoir is still wet. You
do not want to over-dry the membrane or the DNA may bind
to the membrane and prevent the DNA from eluting into your
final solution.
9. An amplification master mix must be made for each pair of
primers you are wanting to amplify. For example, if you are
using a primer set approach, you will need to amplify each of
the four primer sets (and subsequently, make four master
mixes) for HV1 and HV2 for full coverage of those regions.
The appropriate forward and reverse primers for each set are
listed in Table 1.
 mtDNA Analysis 347

10. Vortexing the PCR tubes ensures that the master mix and
sample are evenly distributed. Pulse spinning the PCR tubes
ensures that all of the liquid is in the bottom of the tubes.
Ensure that the lids are completely closed before placing the
tubes into the thermal cycler and take care to remove all
bubbles in solution.
11. This 50 mL gel can fit into a mini gel electrophoresis system.
Different systems are available through different manufac-
turers, and the gel trays can typically fit between 8 and 49 sam-
ple wells on 1–2 combs (row of wells). At least one ladder
should be loaded for each comb for easy comparison between
samples.
12. The gel preparation is ready when all of the agarose has dis-
solved into solution. Use caution and hand protection when
removing from the microwave oven—the flask will be
extremely hot and the gel preparation may be boiling.
13. Two opposite sides of the gel tray will be open ended and have
gaskets. Position the gel tray in the chamber so that the gaskets
are tight against the walls of the buffer chamber so that when
the gel solution is poured in, it will not leak.
14. If the gel will not be used on the same day of preparation, the
gel and gel bed may be stored in a plastic zip-top bag along
with a moistened wipe and refrigerated at 4 °C. If you are
running the gel now, the gel tray can be rotated 90° in the
chamber and the rest of the 1X TAE buffer can be poured into
the buffer chamber filling 1 cm over the top of the
solidified gel.
15. UV light is hazardous and may cause damage to eyes. Ensure
proper safety glasses are in place prior to turning on UV light.
16. Primer set amplification products should show a band around
200–300 bp. Control region amplification products should
show a band around 1000–1500 bp. mtDNA amplification is
known to be difficult, especially for degraded or environmen-
tally compromised samples. Many different amplifications at
different dilutions may need to be attempted.
17. At this point, it will be at your discretion to decide how much
product to take forward for cycle sequencing. Keep in mind
that you will want to aim for 5–20 ng of product. The higher
the intensity of the product band, the higher the concentration
of the product. A key for determining intensity is usually
included with the DNA MW Marker XIV ladder you purchase.
18. You will make a separate master mix for each primer you are
using in the cycle sequencing step (a total of eight master mixes
will be made if you amplified all four primer sets at once).
348 Ashley M. Cooley

19. After determining how much product you want to add, qs

(quantum satis) the remaining volume so that the final reaction
volume is 20 μL.
20. Samples can be left at 4 °C either in the thermal cycler or in a
refrigerator until you are ready to move on.
21. See the user guide for the maintenance and operation of your
capillary electrophoresis instrument.
22. Tutorials and instructions specifically for mtDNA typing using
Sequencher™ can be found on their website (genecodes.com).

Acknowledgments

This work was adapted from and supported by the Virginia Depart-
ment of Forensic Science, specifically the Mitochondrial DNA
Section [38].

References

1. Butler JM (2005) Mitochondrial DNA 8. Wilson MR, DiZinno JA, Polanskey D et al

analysis. In: Forensic DNA typing: biology, (1995) Validation of mitochondrial DNA
technology, and genetics of STR markers, 2nd sequencing for forensic casework analysis. Int
edn. Elsevier, Burlington J Legal Med 108:68–74
2. Budowle B, Allard MW, Wilson MR et al 9. Baubliene J, Daugnora L, Miceikiene I (2003)
(2003) Forensic and mitochondrial DNA: Evaluation of the DNA extraction method
applications, debates, and foundations. Annu from ancient animal bones. Ekologija 1:8–11
Rev Genomics Hum Genet 4:119–141 10. Edson SM, Ross JP, Coble MD et al (2004)
3. Carracedo A, B€ar W, Lincoln P et al (2000) Naming the dead—confronting the realities of
DNA Commission of the International Society rapid identification of degraded skeletal
for Forensic Genetics: guidelines for mitochon- remains. Forensic Sci Rev 16:63–90
drial DNA typing. Forensic Sci Int 110:79–85 11. Fisher DL, Holland MM, Mitchell LG et al
4. Linch CA, Whiting DA, Holland MM (2001) (1993) Extraction, evaluation, and amplifica-
Human hair histogenesis for the mitochondrial tion of DNA from decalcified and undecalcified
DNA forensic scientist. J Forensic Sci 46:844– United States Civil War bone. J Forensic Sci
853 38:60–68
5. Wilson MR, Polanskey D, Butler J et al (1995) 12. Hochmeister MN, Budowle B, Borer UV et al
Extraction, PCR amplification and sequencing (1991) Typing of deoxyribonucleic acid
of mitochondrial DNA from human hair shafts. (DNA) extracted from compact bone from
BioTechniques 18:662–669 human remains. J Forensic Sci 36:1649–1661
6. Wilson MR, Allard MW, Monson KL et al 13. Holland MM, Fisher DL, Mitchell LG et al
(2002) Further discussion of the consistent (1993) Mitochondrial DNA sequence analysis
treatment of length variants in the human of human skeletal remains: identification of
mitochondrial DNA control region. Forensic remains from the Vietnam war. J Forensic Sci
Science Communications 4(4), Available via 38:542–553
the Federal Bureau of Investigation. https:// 14. Holland MM, Parsons TJ (1999) Mitochon-
archivesfbigov/archives/about-us/lab/foren drial DNA sequence analysis—validation and
sic-science-communications/fsc/oct2002/ use for forensic casework. Forensic Sci Rev
wilsonhtm. Accessed 11 July 2022 11:22–50
7. Wilson MR, Allard MW, Monson KL et al 15. Loreille OM, Diegoli TM, Irwin JA et al
(2002) Recommendations for consistent treat- (2007) High efficiency DNA extraction from
ment of length variants in the human mito- bone by total demineralization. Forensic Sci
chondrial DNA control region. Forensic Sci Int 1:191–195
Int 129:35–42
 mtDNA Analysis 349

16. Nelson K, Melton T (2007) Forensic mito- Available via SWGDAM. https://swgdam.
chondrial DNA analysis of 116 casework skele- org/publications. Accessed 13 July 2022
tal samples. J Forensic Sci 52:557–561 27. Anderson S, Bankier AT, Barrell BG et al
17. Pruvost M, Schwarz R, Correia VB et al (2007) (1981) Sequence and organization of the
Freshly excavated fossil bones are best for human mitochondrial genome. Nature 290:
amplification of ancient DNA. Proc Natl Acad 457–465
Sci U S A 104:739–744 28. Andrews RM, Kubacka I, Chinnery P et al
18. Salamon M, Tuross N, Arensburg B et al (1999) Reanalysis and revision of the Cam-
(2005) Relatively well preserved DNA is pres- bridge Reference Sequence for human mito-
ent in the crystal aggregates of fossil bones. chondrial DNA. Nat Genet 23:147
Proc Natl Acad Sci U S A 102:13783–13788 29. Tully G, B€ar W, Brinkmann B et al (2001)
19. Gabriel MN, Huffine EF, Ryan JH et al (2001) Considerations by the European DNA
Improved mtDNA sequence analysis of foren- Profiling (EDNAP) group on the working
sic remains using a ‘mini-primer set’ amplifica- practices, nomenclature and interpretation of
tion strategy. J Forensic Sci 46:247–253 mitochondrial DNA profiles. Forensic Sci Int
20. Hawes JW, Knudtson KL, Escobar H et al 124:83–91
(2006) Evaluation of methods for sequence 30. Tamariz J, Voynarovska K, Prinz M et al (2006)
analysis of highly repetitive DNA templates. J The application of ultraviolet irradiation to
Biomol Tech 17:138–144 exogenous sources of DNA in plasticware and
21. Melton T (2004) Mitochondrial DNA hetero- water for the amplification of low copy number
plasmy. Forensic Sci Rev 16:268–286 DNA. J Forensic Sci 51:790–794
22. Scientific Working Group on DNA Analysis 31. Millipore Corporation (2005) Microcon®
Methods (SWGDAM) (2013) Interpretation Centrifugal Filter Devices User Guide,
guidelines for mitochondrial DNA analysis by Revision M
forensic DNA Testing Laboratories. Available 32. Bio-Rad Laboratories (1996) Chelex® 100 and
v i a S W G D A M . h t t p : // s w g d a m . o r g / Chelex® 20 Chelating Ion Exchange Resin,
SWGDAM%20mtDNA_Interpretation_ Instruction Manual, Revision B
Guidelines_APPROVED_073013.pdf. 33. Kreader C (1996) Relief of amplification inhi-
Accessed 13 July 2022 bition in PCR with bovine serum albumin or
23. Scientific Working Group on DNA Analysis T4 Gene 32 protein. Appl Environ Microbiol
Methods (SWGDAM) (2019) Interpretation 6:1102–1106
guidelines for mitochondrial DNA analysis by 34. Applied Biosystems (2002) ABI Prism® Big-
forensic DNA Testing Laboratories. Available Dye® Terminator v1.1 Cycle Sequencing Kit
v i a S W GD A M . ht t ps ://s wg d a m .o r g/ Protocol, Revision A
publications. Accessed 13 July 2022 35. Applied Biosystems (2003) ABI Prism® dGTP
24. Scientific Working Group on DNA Analysis BigDye® Terminator Ready Reaction Kit Pro-
Methods (SWGDAM) (2014) Guidelines for tocol, Revision D
missing persons casework. Available via 36. Gene Codes Corporation (2007)
SWGDAM. http://swgdam.org/publications. Sequencher™ 4.8 User Manual for Windows
Accessed 13 July 2022
37. Walsh PS, Metzger DA, Higuchi R (1991)
25. Scientific Working Group on DNA Analysis Chelex® 100 as a medium for simple extraction
Methods (SWGDAM) (2003) Guidelines for of DNA for PCR-based typing from forensic
mitochondrial DNA (mtDNA) nucleotide material. BioTechniques 10:506–513
sequence interpretation. Forensic Sci Commun
5(2). Available via the Federal Bureau of Inves- 38. Virginia Department of Forensic Science
tigation. https://archives.fbi.gov/archives/ (2020) Mitochondrial DNA
about-us/lab/forensic-science-com Section Procedures Manual. Available via Vir-
munications/fsc/april2003/swgdammitodna. ginia Department of Forensic Science. https://
htm. Accessed 13 July 2022 w w w. d f s . v i r g i n i a . g o v / w p - c o n t e n t /
uploads/2020/10/212-D100-Mitochon
26. Scientific Working Group on DNA Analysis drial-DNA-Section-Procedures-Manual.pdf.
Methods (SWGDAM) (2014) Mitochondrial Accessed 1 May 2022
DNA nomenclature examples document.
 Chapter 21

An Optimized Forensic DNA Analysis Workflow for Obtaining

STR Results from Archived Latent Fingerprints
April D. Solomon

Abstract
Since the initial introduction of forensic DNA analysis in the 1980s, advancements have been made within
the forensic biology community that have improved the success rate of obtaining DNA profiles. Finger-
prints that were originally intended for latent examination could be a potential source of DNA. Archived
latent fingerprints contain touch DNA between an adhesive barrier of tape and a paper substrate. Collect a
DNA sample by separating the tape and paper material, then cut each substrate into small pieces (approxi-
mately 3 mm × 3 mm). Extract DNA samples using the QIAamp® DNA Investigator Kit (QIAGEN®), a
silica-column based method, and follow the manufacturer’s protocol for “paper and other similar materi-
als.” Pair it with the Centri-Sep™ spin column (Thermo Fisher Scientific) concentration method to
optimize the biological workflow for DNA profiling.

Key words Forensic biology, Touch DNA, Archived latent fingerprints, Short tandem repeats

1 Introduction

DNA analysis on touch DNA was introduced in the late 1990s [1],
and great emphasis is still placed on these low template DNA type
samples [2–7]. Touch DNA is a mixture of sweat gland secretions
and corneocytes that have been transferred to another object [1–
3]. If human DNA can be detected at all, these samples often
provide low quality short tandem repeat (STR) profiles that are
difficult to interpret [5–7]. Nevertheless, they are a common source
of evidence in forensic laboratories due to the advancements that
have been made in forensic biology and STR analysis. Laboratory
protocols, therefore, utilize techniques that are catered for low
sources of DNA in order to increase their success of developing a
valuable DNA profile [5–7].
Archived latent fingerprints are not a traditional source of
DNA. Their routine collection began well before the introduction
of forensic DNA analysis because they were initially collected for

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_21,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

351
352 April D. Solomon

Fig. 1 Archived latent fingerprint. Typical archived latent fingerprints have been stored and protected between
tape and paper

latent fingerprint examination. Oftentimes, fingerprints were

brushed with powder prior to being tape-lifted, then affixed to a
paper backing card for long-term, room temperature storage [8–
10]. Although not collected specifically for STR profiling, archived
latent fingerprints contain touch DNA between two protective
barriers of tape and paper (see Fig. 1). Studies have shown the
potential to detect DNA from fingerprints [8, 10–12]. Regarding
archived latent fingerprints, full STR profiles have been developed
from samples stored up to 28 years [13, 14]. The use of a silica
column-based DNA extraction led to an average detection of
0.45 g of DNA [13], and when paired with a re-purification step
using a gel spin column, improvements greater than 300% were
seen in STR allele detection [14]. Furthermore, limitations were
seen in the detection of secondary contributors so re-purification
could assist with higher quality STR data [14].
Multiple studies have shown improvements in data collection
from the additional use of Centri-Sep™ spin columns [14–16], but
pristine DNA profiles should not be expected. Touch DNA samples
are challenging by nature. They can vary from having undetectable
human DNA levels to low quality profiles involving multiple con-
tributors [4–7]. Mixtures, allelic drop-out, and artifacts are com-
monplace for DNA samples in general [4–7]. Performing a DNA
analysis method specific to archived latent fingerprints will not
elude such data characteristics, but they could improve the quality
of the data that is obtained [13, 14].

2 Materials

All solutions should be at room temperature and all tubes should be

labeled before performing laboratory procedures. Be sure to wear
personal protective equipment throughout the process and to use
sterilized equipment to maintain the integrity of the sample. Mea-
sures to avoid cross-contamination should always be considered.
Discard waste products responsibly as biohazard products.
 DNA Analysis on Archived Latent Fingerprints 353

2.1 DNA Extraction 1. Metal forceps (see Note 1).

2. QIAamp® DNA Investigator Kit: Contains Buffer ATL, Buffer
AL, Buffer AW1, Buffer AW2, Buffer ATE, Carrier RNA
(cRNA), 20 mg/mL Proteinase K, QIAamp® MinElute® col-
umns, and 2 mL collection tubes. Add 25 mL 96–100% etha-
nol to Buffer AW1 and 30 mL to Buffer AW2, as instructed by
the manufacturer to dilute these buffers prior to use; store at
room temperature. Add 310 μL Buffer ATE to the 1 μg/μL
cRNA tube. Mix the components by shaking the tube several
times to achieve a homogenous solution. Aliquot and store at
-20 °C (see Note 2).
3. 96–100% Ethanol.
4. Shaking platform and incubator (see Note 3).

2.2 Re-purification 1. Centri-Sep™ spin columns and accompanying collection

with Centri-Sep™ tubes.
Spin Columns 2. Nuclease-free water.

3 Methods

3.1 DNA Sampling 1. Outline the fingerprint area to be sampled with a marker on the
surface of the tape (see Note 4). Disassemble the archived latent
fingerprint sample by pulling the adhesive tape away from the
paper (see Note 5).
2. Using a pair of forceps and scissors, carefully cut the fingerprint
area on the tape into small cuttings, approximately
3 mm × 3 mm, and place them in a corresponding 1.5 mL
microcentrifuge tube (see Notes 6 and 7). Repeat the cutting
process with the paper side and place the cuttings in a separate
1.5 mL microcentrifuge tube (see Note 8).

3.2 DNA Extraction 1. Add 300 μL Buffer ATL and 20 μL Proteinase K to each sample
with QIAamp DNA tube. Vortex the tubes for at least 10 s.
Investigator Kit [17] 2. Incubate on a shaking platform (900 rpm) for at least 1 h at
56 °C (see Notes 3 and 9).
3. Briefly centrifuge each sample to pool all of the liquid down to
the bottom of the tube (see Note 10). Add 300 μL Buffer AL
and 1 μL cRNA. Vortex the tubes for at least 10 s.
4. Incubate at 70 °C for 10 min on a shaking platform (900 rpm)
(see Note 3). Briefly centrifuge the sample tubes prior to add-
ing 150 μL 96–100% ethanol. Vortex the tubes for at least 15 s
(see Note 11).
354 April D. Solomon

5. Briefly centrifuge the sample tubes. Using both the tape and
paper sample tubes, transfer 600 μL of the sample lysate to a
corresponding QIAamp MinElute column.
6. Centrifuge the sample tubes at 6000 × g for 1 min. Discard the
filtrate and reuse the collection tube. Add up to 450 μL of
lysate from the tape and paper sample tubes to the QIAamp
MinElute column. Centrifuge the sample tubes again at
6000 × g for 1 min. Repeat this step until all of the lysate is
combined into one tube (see Note 12).
7. Transfer the QIAamp MinElute column to a new 2 mL collec-
tion tube. Add 500 μL Buffer AW1. Centrifuge the sample
tubes at 6000 × g for 1 min.
8. Transfer the QIAamp MinElute column to a new 2 mL collec-
tion tube. Add 700 μL Buffer AW2. Centrifuge the sample
tubes at 6000 × g for 1 min.
9. Transfer the QIAamp MinElute column to a new 2 mL collec-
tion tube. Add 700 μL of 96–100% ethanol. Centrifuge the
sample tubes at 6000 × g for 1 min.
10. Transfer the QIAamp MinElute columns to a new 2 mL col-
lection tube. Centrifuge at 20,000 × g for 3 min.
11. Transfer the QIAamp MinElute column to a new 1.5 mL tube.
Open the sample tube and allow the QIAamp MinElute col-
umn to incubate at room temperature for at least 10 min (see
Note 13).
12. Add 20 μL Buffer ATE. Incubate the samples at room temper-
ature for 1 min (see Note 14). Centrifuge the tubes at
20,000 × g for 1 min. Use a final elution volume of 20–50 μL.

3.3 Re-purification 1. Label one Centri-Sep spin column for each sample. Tap the
with Centri-Sep Spin spin column to settle the dry gel. Add 800 μL of nuclease-free
Columns [18] water. Briefly vortex the spin columns for a few seconds then
invert them several times to mix the solution (see Note 15).
2. Leave the gel to hydrate at room temperature for 2 h (see Note
16).
3. Tap the spin columns to release any air bubbles. Remove the
top cap first. Remove the bottom cap next to drain the excess
water. Let the Centri-Sep spin column sit for 5 min.
4. Centrifuge the spin columns for 800 × g for 2 min to get rid of
any excess water. Remove any remaining water with sterile
paper material.
5. Add the DNA sample extract to the corresponding Centri-Sep
spin column. Transfer the spin column to a 1.5 mL tube and
centrifuge it for 800 × g for 2 min.
6. Proceed with the remainder of your DNA analysis.
 DNA Analysis on Archived Latent Fingerprints 355

4 Notes

1. Sharp metal forceps are integral during the sampling process.

Having extra sterilized forceps on hand is highly recom-
mended. Troublesome adhesive may be handled better with
multiple tools.
2. It is important to add cRNA to low-level DNA samples to assist
with extraction efficiency. cRNA helps to bind DNA to the
silica column during the cleaning stage. It is sensitive to tem-
perature, so avoid multiple freezing and thawing stages by
making single-use aliquots (approximately 10–20 μL per tube).
3. A shaking platform housed inside an incubator is highly recom-
mended. A vortex mixer can be used in place of the shaking
platform by agitating the sample throughout the extraction
process.
4. It is beneficial to apply pressure while outlining the fingerprint
area on top of the tape. This results in an indentation on the
paper substrate and allows you to outline both substrates
at once.
5. If there is a grip of tape folded in on itself, you can use your
hands to peel the tape back from the paper baking. Scalpels
and/or forceps may also be used during this step if the adhesive
needs help from coming off of the paper.
6. Fine pointed forceps help to tug tape off of the scissors and
place the cuttings into 1.5 mL tubes. The use of two forceps
can also be helpful with troublesome adhesive. Be sure to keep
the tape from folding in on itself and from sticking back to the
paper substrate.
7. Try to place the cuttings of tape in the tube so the sticky side is
exposed.
8. Separating the adhesive cuttings from the paper cuttings and
placing them in two separate sample tubes ensures the entire
sample is submerged during lysis.
9. If time allows, overnight incubation is highly recommended.
Archived latent fingerprint samples are likely to be older sam-
ples that could have been stored for years. Additional incuba-
tion time, up to 24 h, will increase the potential of obtaining
more DNA. Periodically agitating the samples could also assist
with higher DNA detection.
10. Always ensure all of the liquid is sitting at the bottom of the
tube before opening it. Condensation will build during
incubation.
11. Be sure you have a homogenous mixture after adding ethanol
and using the vortex mixer. Vortex for a bit longer if it does not
appear completely mixed.
356 April D. Solomon

12. Ensure all of the sample lysate is passing through the mem-
brane of the QIAamp MinElute column. If the membrane does
not appear to be dry after spinning your sample down, you can
centrifuge it again at an increased speed. The paper lysate can
become slurry and remain after centrifugation. If cloudy lysate
remains after spinning the sample down, briefly heat the sample
at 70 °C then repeat centrifugation again.
13. Ensure the membrane is completely dry. Extend the room
temperature drying period if it is not. You can incubate the
samples for a few minutes at 56 °C to speed the drying process
and to ensure the membrane is dry and ready for the
elution step.
14. The samples can remain at room temperature with the eluent
for a few minutes longer to potentially increase extraction
efficiency of DNA retrieval.
15. Ensure there are no dry spots in the gel powder before leaving
it to hydrate.
16. Allowing the gel powder to dry for such a long time creates
smaller pores for the DNA sample to pass through. This should
increase the re-purification efficiency.

References

1. van Oorschot RAH, Jones MK (1997) DNA 7. Aditya S, Sharma AK, Bhattacharyya CN et al
fingerprints from fingerprints. Nature 387: (2011) Generating STR profile from “Touch
767. https://doi.org/10.1038/42838 DNA”. J Forensic Legal Med 18(7):295–298.
2. Lowe A, Murray C, Whitaker J et al (2002) The https://doi.org/10.1016/j.jflm.2011.05.007
propensity of individuals to deposit DNA and 8. Van Hoofstat DEO, Deforce DLD, Hubert De
secondary transfer of low level DNA from indi- Pauw IP et al (1999) DNA typing of finger-
viduals to inert surfaces. Forensic Sci Int prints using capillary electrophoresis—effect of
129(1):25–34. https://doi.org/10.1016/ dactyloscopic powders. Electrophoresis
S0379-0738(02)00207-4 20(14):2870–2876
3. Wickenheiser RA (2002) Trace DNA: a review, 9. Lee HC, Palmbach T, Miller MT (2001)
discussion of theory, and application of the Henry Lee’s crime scene handbook, 1st edn.
transfer of trace quantities of DNA through Academic Press, San Diego
skin contact. J Forensic Sci 47(3):442–450. 10. Bhoelai B, de Jong BJ, de Puit M et al (2011)
https://doi.org/10.1520/JFS15284J Effect of common fingerprint detection tech-
4. Djuric M, Varljen T, Stanojevic A et al (2008) niques on subsequent STR profiling. Forensic
DNA typing from handled items. Forensic Sci Sci Int 3(1):e429–e430. https://doi.org/10.
Int Genet 1(1):411–412. https://doi.org/10. 1016/j.fsigss.2011.09.076
1016/j.fsigss.2007.10.161 11. Thamnurak C, Bunakkharasawat W, Riengroj-
5. Templeton J, Ottens R, Paradiso V et al (2013) pitak S et al (2011) DNA typing from fluores-
Genetic profiling from challenging samples— cent powder dusted latent fingerprints.
direct PCR of touch DNA. Forensic Sci Int Forensic Sci Int Genet 3(1):e524–e525.
Genet 4(1):e224–e225. https://doi.org/10. https://doi.org/10.1016/j.fsigss.2011.
1016/j.fsigss.2013.10.115 10.009
6. Barbaro A, Cormaci P, Barbaro A (2006) LCN 12. Zech WD, Malik N, Thali M (2012) Applica-
DNA typing from touched objects. Int Con- bility of DNA analysis on adhesive tape in
gress Series 1288:553–555. https://doi.org/ forensic casework. J Forensic Sci 57(4):
10.1016/j.ics.2005.09.114 1036–1041. https://doi.org/10.1111/j.
1556-4029.2012.02105.x
 DNA Analysis on Archived Latent Fingerprints 357

13. Solomon AD, Hytinen ME, McClain AM et al 16. Weitz S, Ricci LA, Davoren J et al (2009) DNA
(2018) An optimized DNA analysis workflow profiling of skeletal samples from the disap-
for the sampling, extraction, and concentration peared in Latin America. Forensic Sci Int
of DNA obtained from archived latent finger- 2(1):245–247. https://doi.org/10.1016/j.
prints. J Forensic Sci 63(1):47–57. https://doi. fsigss.2009.08.135
org/10.1111/1556-4029.13504 17. Qiagen (2020) QIAamp® DNA Investigator
14. Menchhoff SI, Solomon AD, Cox JO et al Handbook. Available via Qiagen. https://
(2020) Effects of storage time on DNA w w w. q i a g e n . c o m / u s / r e s o u r c e s /
profiling success from archived latent finger- resourcedetail?id=26ef8f2c-7c2a-49e6-b2d2-
print samples using an optimised workflow. 39d4e130b3cc&lang=en. Accessed
Forensic Sci Res 7(1):61–68. https://doi. 29 April 2022
org/10.1080/20961790.2020.1792079 18. Princeton Separations Inc (2016) Centri-
15. Glenn TC, Schable NA (2005) Isolating Sep™ Columns. Available via Princeton
microsatellite DNA loci. Methods Enzymol Separations Inc. https://www.prinsep.com/
395:202–222. https://doi.org/10.1016/ sites/prinsep.rpdesign.com/files/Centri-Sep%
S0076-6879(05)95013-1 20Procedure_0.pdf. Accessed 29 April 2022
 Chapter 22

Detection of Latent DNA Using a DNA Binding Dye

Adrian Linacre and Piyamas Petcharoen

Abstract
Latent DNA can be deposited every time a person holds or touches an item. This “touch DNA” can be
crucial evidence if the item is of forensic significance. Until very recently, there were no means to visualize
this DNA. The advent of using a dye that binds to DNA has opened up this possibility. The application of
the dye is simple to perform, and a mobile microscope allows rapid visualization of the cellular material,
even in ambient light. The dye can be applied in a solution of either 75% ethanol or water. As this is a
solution-based dye, the application works best on non-absorbent surfaces.
DNA within cellular material, such as dead skin cells, appears as green dots under 50X magnification;
zooming to 220X magnification confirms that these are cells. The location and number of these cells can be
photographed allowing a record of the presence of otherwise latent DNA.
This chapter details the processes involved in the detection of latent DNA using Diamond™ Nucleic Acid
Dye with both control samples (that act as very effective training samples) and the staining of evidential
items. By developing skills in determining cell locations, a targeted approach to crime scene collection is
now possible.

Key words Corneocytes, Diamond Dye, Latent DNA, Microscopy, Touch DNA

1 Introduction

Every time a person touches or holds an item, they have the

potential to transfer skin cells. Skin cells are commonly called
keratinocytes or corneocytes and are on the exterior of the dermis.
These dead cells contain variable amounts of chromosomal DNA,
as the DNA is degraded in once living cells by nucleases. The latent
cellular material may be highly informative in a forensic investiga-
tion, yet there was, until recently, no test for this transferred DNA.
Taking samples for DNA is therefore performed “blind” and based
on best assumption. The possibility to visualize DNA within cells
using DNA staining dyes allows a targeted approach [1, 2]. Any
such dyes must be: safe to use, inexpensive, easy to apply, able to
permeate cell membranes, usable in ambient light and not confined
to a dark room, stable over time, and sensitive allowing minimal

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_22,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

359
360 Adrian Linacre and Piyamas Petcharoen

Fig. 1 Dino-Lite microscope set-up. An example of the set-up showing the Dino-Lite digital microscope
connected to an 11” MacBook Air laptop

magnification. Additionally, the dye cannot inhibit further DNA

analyses. These attributes are found in Diamond™ Nucleic Acid
Dye (DD) [3]. DD is commercially available from the Promega
Corporation and was designed to stain DNA in an agarose gel. The
use of DD has very recently been shown to detect DNA outside of
gels, as in the case of cellular material deposited on a wide range of
surfaces [1, 2, 4]. A rapid means to determine shedder status [5, 6],
and assess how many corneocytes are needed to generate DNA
profiles [7], has also been reported. This chapter details the use of
this dye to stain DNA within corneocytes allowing the cells depos-
ited by touch to be visualized, localized, counted, and recorded.
The dye can be applied either to a defined small area by use of a
pipette or over a greater area using a compressed airgun. The use of
a mobile hand-held microscope allows recording cells in ambient
light and is possible to do remotely from a laboratory. An example
of the set-up is shown in Fig. 1.

2 Materials

The list below is of the items and reagents needed. In addition,

items touched by donors are needed to test and gain experience in
DD staining (see Note 1). Ensure that there is full ethics approval
prior to conducting any tests using touched items from known
persons. Use of Type I water for reagent preparation is required.
 Seeing the Location of Latent DNA 361

2.1 Reagents and 1. Diamond Dye is available from the Promega Corporation and
Supplies sold at a concentration of 10,000X. A working solution of 20X
is prepared using 75% ethanol (see Notes 2–4). This working
solution can be stored at room temperature and is stable for up
to 4 weeks (the solution can be stored at 4 °C, if preferred). It is
best to keep tubes in the dark or cover with foil to prevent light
affecting the dye.
2. Glass microscope slides.
3. DNA-free tape suitable for cell collection.

2.2 Equipment 1. Compressed airgun.

2. Dino-Lite microscope equipped with an emission filter of
510 nm and a blue LED excitation light source 480 nm.
3. Stand for the microscope: the Dino-Lite RK-10A universal
stand is recommended.
4. Dino-Lite Software downloaded on to a PC, tablet, or Mac.
5. Cell counting software available from authors on request.

3 Methods

3.1 Reference 1. Ask the donor to wash their hands under running water and
Samples dry using a paper towel. Wait for 15 min; during this time, light
office work can be conducted but the donor should refrain
from shaking hands with others or eating and drinking.
2. After 15 min, the donor should press one part of their hand,
usually the last part of the digit of the finger or thumb of either
the left or right hand, onto a precleaned microscope slide.
Medium pressure should be used: do not place the digit lightly
on the slide or press hard, rather use a pressure in between
these two (see Note 5).
3. Pipette ~5 μL of 20X DD solution onto the area where contact
was made. You may need to spread the solution over the area
gently using the pipette tip (see Note 4).
4. After 10 s, place the slide under the Dino-Lite microscope.
Record the number of cells at 50X magnification (see Fig. 2a as
an example). Cells can also be recorded at 220X (see Fig. 2b as
an example). Viewing cells at 220X can assist in the confirma-
tion of the morphology (see Note 6). In the top left of the
software, there is a camera icon—click on this to take an image.
Images can be named and stored.
5. Collect at least five images in representative regions of the
stained slide where cells are present.
362 Adrian Linacre and Piyamas Petcharoen

Fig. 2 Cellular material stained with Diamond Dye. Diamond Dye-stained cellular material within a thumbprint
deposited on a glass slide under 50X (left) and 220X (right) magnifications

6. If using this approach to determine shedder status [5, 6], then

repeat steps 1–5 but add an additional 30-min time period at
step 1. Repeat this process at time points 15 and 30 min at least
three times.

3.2 Evidential Items 1. If the item is the size of a credit card, cartridge case, or smaller,
then the use of a pipette may be easiest to apply DD. If the item
is any larger than a credit card, the compressed airgun is the
better option (see Notes 7 and 8).
2. The DNA within cellular material should be visible to record
after 10 s, or after the dye has dried completely. If cells are not
visible, then a second application may be performed but do not
overspray (see Note 8).
3. The Dino-Lite microscope can be attached to a flexible arm to
allow many areas of any item to be searched for cellular mate-
rial. Images should be collected at 50X magnification. Collect
as many images as needed to ensure a representative record of
the location of cellular material, or its absence, has been
obtained.
4. Cells can be collected using whichever media (swab or tape) is
favored by the forensic science provider and then images can be
taken from the point of collection. This will provide a record of
before collection and after cell collection.
5. If the substrate is highly absorbent, then the DD solution may
be absorbed before effective staining. The optimum means to
view cellular material is to apply DNA-free tape (see Note 9).
Turn the tape over to expose the surface that collected the cells
and apply 20X DD. Wait for 10 s and place the tape under the
 Seeing the Location of Latent DNA 363

microscope. Cells should be present if they were on the item

examined. Collect images at 50X magnification over represen-
tative regions of the tape. The tape can be examined subse-
quently for DNA profiling (see Note 9) [8–10].
6. If the substrate is three-dimensional when viewed at 50X mag-
nification such that images of cellular material cannot be col-
lected, then perform the collection of cells using a DNA-free
tape as outlined in step 5.
7. The detection of cellular material using DD is based on the
contrast between the background fluorescence of the substrate
and the emission of DD. If these are similar, then autofluores-
cence may prevent recording of the cells (see Note 1) [4]. An
option is to perform the tapelift process as outlined in step 5.
8. Following cell collection (see steps 5 and 6), proceed to a direct
amplification procedure to yield an STR DNA profile. Given
the low cell count, this is highly recommended over the tradi-
tional extraction-quantitation-amplification workflow.

4 Notes

1. As will be outlined, the application of DD is straightforward

and can be mastered easily. The greater challenge is to gain
confidence in determining whether what appears to be human
cells are true cells. Artifacts with similar fluorescence, such as on
fired cartridge cases or applied in some fingerprint enhance-
ment methods (see Fig. 3) [11], can complicate human cell
identification. The item’s background also affects stained cell
detection. It would be easier to decide which are cells, or not, if
it is possible to have DD staining of negative control (cleaned
items) to compare the item’s background and cell characteris-
tics (see Fig. 4). Differentiating cells deposited by touch from
artifacts that have similar fluorescence is a skill and best learned
by building up a repository of reference material.
2. When applying DD using a pipette, make 1 mL by combining
750 μL 100% ethanol, 248 μL water, and 2 μL 10,000X DD.
When applying DD using an airgun, make 20 mL by combin-
ing 15 mL 100% ethanol, 4.96 mL water, and 40 μL 10,000X
DD.
3. The addition of 0.01% Triton-X to DD made in water can help
release cells from the substrate. Triton-X is a surfactant and may
affect the binding of cells and/or DNA [12].
4. When pipetting onto a small area, DD can be diluted in water
rather than 75% ethanol.
364 Adrian Linacre and Piyamas Petcharoen

Fig. 3 Staining artifacts. Artifacts on a pre-treated fired cartridge with cyanoacrylate fuming are shown at 50X
fired cartridge cases (left) and a pre-treated photo with green-fluorescent fingerprint enhancement powder
(right) at 220X. The white arrows indicate stained cells among the fluorescent powder

5. Many of the papers published note that medium pressure was

used by the digit on the substrate to collect reference material
[2, 4–6, 10, 11]. This is not easy to quantify without the use of
a pressure-gauge. The authors note that medium pressure is
between light contact, such as lying the digit on the slide, and
heavy pressure, such as pressing firmly onto the slide.
6. It is easiest to see the cells at lower magnification, such as 50X.
The use of higher magnification, such as 220X, can aid in
seeing the morphology to confirm that the fluorescent “green
dots” are most likely cellular.
7. Pipetting 5 μL of DD onto the back of a 0.22 cartridge case
maybe be sufficient. More volume may be needed if applying to
a credit card or shotgun cartridge case.
8. Applying DD solution using the compressed airgun requires
only one covering. Initially, it is better to under-spray rather
than to saturate the item, as it is always easier to add more if
there is weak fluorescence [12].
9. Fabrics are an example of commonly encountered forensically
relevant items. If the fabric is highly absorbent, then the DD
solution may be absorbed too quickly for the dye to bind to the
DNA [4]. If cells are trapped in the mesh of the fabric, then
they will also not be seen easily using the microscope. Auto-
fluorescence and absorption are the two major drawbacks to
the use of this dye. A simple option is to collect the cells by
removal using a standard DNA-free tape. The side on which
the cells are present can be stained easily and cell numbers
recorded. If autofluorescence is a problem, then the best
option may be to use a different dye, in which case a
 Seeing the Location of Latent DNA 365

Fig. 4 Comparison to negative controls. DD staining of a negative control (cleaned items) compared to touched
items is recommended, if it is possible, such as Nickle cartridge case (top), plastic zip-lock bag (middle) at
50X, and silver-gray color credit card (bottom) at 220X. The artifacts with similar fluorescence were clearly
detected on the cleaned credit card

microscope with fluorescence capability at different wave-

lengths will be needed.

Acknowledgments

Funding for much of this work came from the Attorney General’s
Department of South Australia via Forensic Science SA. We would
like to thank the Development and Promotion of Science and
Technology Talent Project (DPST), Royal Thai Government
Scholarship for supporting Piyamas (Kanokwongnuwut) Petchar-
oen. We would like to thank Dr. Elaine Kellett for proofreading the
chapter. We would also like to thank all the volunteers that partici-
pated in these studies.
366 Adrian Linacre and Piyamas Petcharoen

References
1. Haines A, Linacre A (2016) A rapid screening 7. Kanokwongnuwut P, Martin B, Taylor D et al
method using DNA binding dyes to determine (2021) How many cells are required for suc-
whether hair follicles have sufficient DNA for cessful DNA profiling? Forensic Sci Int Genet
successful profiling. Forensic Sci Int 262:190– 51:102453–102455. https://doi.org/10.
195. https://doi.org/10.1016/j.forsciint. 1016/j.fsigen.2020.102453
2016.03.026 8. Haines A, Linacre A (2019) Detection of latent
2. Kanokwongnuwut P, Kirkbride P, Linacre A DNA on tapelifts using fluorescent in situ
(2018) Latent DNA detection. Forensic Sci detection. Aust J Forensic Sci 51(4):455–465.
Int Genet 37:95–101. https://doi.org/10. https://doi.org/10.1080/00450618.2017.
1016/j.fsigen.2018.08.004 1416174
3. Haines A, Tobe S, Kobus H et al (2015) Prop- 9. Kanokwongnuwut P, Kirkbride P, Linacre A
erties of nucleic acid staining dyes used in gel (2020) An assessment of tapelifts. Forensic Sci
electrophoresis. Electrophoresis 36(6): Int Genet 47:102292–102297. https://doi.
941–944. https://doi.org/10.1002/elps. org/10.1016/j.fsigen.2020.102292
201400496 10. Martin B, Taylor D, Linacre A (2022) Explor-
4. Champion J, Kanokwongnuwut P, van ing tapelifts as a method for dual workflow STR
Oorschot R et al (2021) Evaluation of a fluo- amplification. Forensic Sci Int Genet 57:
rescent dye to visualise touch DNA on various 102653. https://doi.org/10.1016/j.fsigen.
substrates. J Forensic Sci 66(4):1435–1442. 2021.102653
https://doi.org/10.1111/1556-4029.14695 11. Kanokwongnuwut P, Kirkbride P, Kobus H
5. Kanokwongnuwut P, Martin B, Kirkbride P et al (2019) Enhancement of fingermarks and
et al (2018) Shedding light on shedders. visualizing DNA. Forensic Sci Int 300:99–105.
Forensic Sci Int Genet 36:20–25. https://doi. https://doi.org/10.1016/j.forsciint.2019.
org/10.1016/j.fsigen.2018.06.004 04.035
6. Kaesler T, Kirkbride P, Linacre A (2022) DNA 12. Young J, Linacre A (2020) Use of a spray
deposited in whole thumbprints: a reproduc- device to locate touch DNA on casework sam-
ibility study. Forensic Sci Int Genet 58: ples. J Forensic Sci 65(4):1280–1288. https://
102683. https://doi.org/10.1016/j.fsigen. doi.org/10.1111/1556-4029.14304
2022.102683
 Chapter 23

Rapid DNA Profile Development with Applied Biosystems

RapidHIT™ ID System
Megan M. Foley

Abstract
The RapidHIT™ ID System by Applied Biosystems allows the generation of a CODIS compatible STR
profile in 90 min. The preloaded cartridges, fully automated workflow, and user-friendly computer interface
allow for quick and simple single sample processing both in the laboratory and outside by non-laboratory
personnel, like law enforcement officers. DNA processing utilizes a direct amplification workflow to
generate an STR profile targeting the CODIS or ESS core loci. In conjunction with the RapidLINK™
Software, the system performs an initial analysis, flagging any profiles that do not meet single-source full
profile parameters. Additionally, the RapidLINK™ allows for users to manage a multi-instrument/multi-
location Rapid DNA system and view results in real-time. This gives users off-site the ability to track and
even analyze results. The system allows for rapid reference sample analysis in locations like booking stations
and national or border security agencies to obtain quick feedback of database hits for investigative leads
while the subject is still in custody. RapidHIT™ ID DNA systems can also be set up at sites to aid in victim
identification during mass disasters. The following chapter describes the process of generating a forensic
DNA profile using the RapidHIT™ ID instrumentation from start to finish. Additionally, basic use and
analysis using the RapidLINK™ and GeneMarker™ HID software is included.

Key words Rapid DNA, RapidHIT™ ID, RapidLINK™, GeneMarker™ HID, Rapid STR Analysis,
FBI DISC, GlobalFiler™ Express, RapidINTEL™, NGM SElect™ Express

1 Introduction

1.1 Background The formation of the Rapid DNA Initiative by the FBI in 2006 led
to the introduction, development, and implementation of Rapid
DNA in the USA. The initiative has allowed forensic DNA analysis
to assist law enforcement agencies by generating investigative infor-
mation without the aid of a full crime laboratory. One of the Rapid
DNA Initiative’s first goals was to evaluate commercial instruments
that were developed to perform Rapid DNA analysis to generate a
Combined DNA Index System (CODIS) compatible DNA profile
within 2 h. This would allow the profile to be searched in CODIS
against submitted genotypes of unsolved crimes while the arrestee

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_23,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

367
368 Megan M. Foley

remains in custody [1–3]. The RapidHIT™ ID System by Applied

Biosystems™ is one of the accepted platforms that performs a
Rapid DNA analysis protocol in ~90 min. Rapid DNA analysis is
defined by the FBI Quality Assurance Standards (QAS) as “the fully
automated (hands-free) process of developing a CODIS acceptable
STR profile from a casework reference sample. The ‘swab in—
profile out’ process consists of automated extraction, amplification,
separation, detection and allele calling without human interven-
tion” [4]. The overall goal of this initiative and implementation is
to use Rapid DNA technologies to solve crimes faster by uploading
and searching arrestee profiles against the database while they are
still in custody. This not only helps solve crimes from the past but
also helps prevent future crimes from occurring by separating these
individuals from society before they are given a chance to evade
prosecution or commit additional offenses [1, 5, 6].
The Rapid DNA Act of 2017 was signed to authorize the FBI
to begin setting standards for the use of Rapid DNA instrumenta-
tion outside of the laboratory in decentralized locations like book-
ing stations. Since the introduction of Rapid DNA to the forensic
field, CODIS has expanded to allow the upload of arrestee Rapid
DNA profiles to search NDIS within 24 h from upload within
qualifying states. Currently, these profiles can be generated within
a booking station or an accredited laboratory, though not yet by
law enforcement outside of these environments. Additionally, refer-
ences collected for comparison to casework and processed using
Rapid DNA can be uploaded only by an accredited lab at this time
[7]. This helps alleviate the stress that current forensic laboratories
are facing with the ever-growing number of cases and samples
submitted for analysis [6]. The DNA Index of Special Concern
(DISC) has also been developed to contain profiles generated
from evidence samples from unsolved cases of homicides, sexual
assaults, and kidnapping, as well as from terrorist events. Rapid
arrestee profiles can be searched against the DISC index
[1, 7]. Additional applications of Rapid DNA include the use at
border crossings, high DNA quantity crime scene samples for
investigative lead generation, bone fragments and relatives of miss-
ing persons from mass disasters, and human trafficking victims
[6, 8–12].
The first generation of the instrument, RapidHIT™ 200, was
developed by IntegenX—now a part of Thermo Fisher Scientific—
to develop an STR profile from 1 to 7 samples in 90 min and was
validated for use on casework [8, 13, 14]. The current generation
system, the RapidHIT™ ID System, is made up of the Applied
Biosystems™ RapidHIT™ ID instrument and system software,
and the RapidLINK™ Software for data management, consumable
tracking, and profile analysis [8, 15, 16]. The instrument allows for
the extraction of swabs or cuttings of bodily fluid stains, and even
bone fragments [9]. Each sample is analyzed using a single-use
 DNA Profile Development with RapidHIT™ ID System 369

sample cartridge and a primary cartridge that contains all reagents

and consumables necessary for short tandem repeat (STR) analysis
through capillary electrophoresis (CE) for 100 samples. Addition-
ally, each sample cartridge contains an internal size standard for
tandem electrophoresis, which allows for more accurate allele size
determination. The hands-on time with the instrument is minimal.
The sample is loaded into the cartridge and inserted into the
instrument. The computer system is a touch screen that is user-
friendly, requiring minimal typing by the user, and includes several
on-screen prompts and visualizations that can be followed for each
step. The instrument can be accessed through a PIN code but also
can be configured for fingerprint and facial recognition logins. The
system allows for a streamlined workflow for reference samples for a
laboratory, but due to its ease of use and automation,
non-laboratory personnel can utilize these instruments in decen-
tralized locations [8, 15, 16].

1.2 STR Profile Run time on the RapidHIT™ ID instrument is between 90 and
Generation on the 110 min depending on the analysis type. Samples can be run on
RapidHIT™ ID three different cartridge types, including the RapidHIT™ ID ACE
GlobalFiler™ Express (GFE), RapidINTEL™ (RI), or Rapid-
HIT™ ID ACE NGM SElect™ Express (NGM) sample cartridges
[16]. Both the GlobalFiler™ Express and NGM SElect™ amplifi-
cation kits allow the targeting of DNA database core loci, including
CODIS and ESS. This allows for increased potential for data shar-
ing across borders and reduces adventitious matches by targeting
20+ STRs to increase the discrimination power of the panel [5, 17,
18]. The GFE cartridge is optimized for single source buccal swab-
like samples and allows for optimized data thresholds. The NGM
cartridge is optimized for single source buccal swabs and includes a
systematic allelic library. The RI cartridge is intended for casework
type samples (excluding touch DNA, which is not recommended
by Thermo Fisher), as well as single source blood or saliva samples.
Run parameters of the RI cartridge allow for increased sensitivity in
order to optimize the data generated from casework type samples,
especially for investigative lead purposes. The RI run utilizes the
same cartridges as the GFE run targeting GlobalFiler™ STR loci,
but modifications have been made in the processing [16, 19]. See
Table 1 for additional parameter differences between the GFE and
RI cartridges. The RI cartridge can also be used for bone samples.
Bone fragments can be collected through various methods and
placed into the sample cartridge for analysis [9].
The sample cartridges allow for a single run and contain a slot
for sample introduction. All reagents needed for extraction and
amplification are housed in the sample cartridge. Through the use
of microfluidic technology, the cell lysis reagents are pumped into
the sample chamber for extraction. The primary cartridge contains
Prep-N-Go™ Buffer by Applied Biosystems™, which lyses cells
370 Megan M. Foley

Table 1
Run parameters of sample cartridges

System GlobalFiler™
specification Express RapidINTEL™
Validated sample Single source buccal Casework single source blood or
types swabs saliva samples

Lysis buffer 500 μL 300 μL

volume
Thermal cycling Initial denaturation: Initial denaturation:
95 °C for 60 s 95 °C for 60 s
28 cycles of: 32 cycles of:
94 °C for 3 s, 94 °C for 3 s,
61 °C for 30 s, 61 °C for 30 s,
61.5 °C for 30 s 61.5 °C for 30 s
Final extension: Final extension:
60 °C for 480 s 60 °C for 480 s
Injection 8 s, 5 kV 8 s, 5 kV
Run time 90 min 95 min
Run parameter comparison between the GlobalFiler™ Express cartridge and the Rapi-
dINTEL™ Cartridge [16, 20, 22]. This table compares the validated sample types for
each cartridge, as well as extraction, amplification, and electrophoresis parameters

and nuclei to release the DNA into solution. The sample is heated
at 75 °C in 500 μL of buffer for 10 min. The DNA workflow
follows a direct amplification procedure [8, 20, 21]. The Prep-N-
Go™ Buffer is a reagent commonly used in direct amplification
systems and workflows in order to streamline testing of high quan-
tity samples by eliminating the isolation and purification steps of
extraction and quantitation [6, 20–22]. The volume of the lysis
buffer used for incubation is dependent on the cartridge type (see
Table 1).
Using the microfluidic system, primers and an amplification
reagent mix are added to the lysate. The mixed liquid is pumped
to the PCR chamber of the sample cartridge where amplification
occurs. Components of the amplification are optimized for direct
amplification. Optimization focuses on performing an efficient
amplification in the presence of the inhibitors still present in the
sample. There are various changes that can be made to amplification
components for a successful direct amplification. First, the DNA
polymerase can be modified. Examples of polymerase modifications
include enhancing the affinity for binding to DNA and increasing
the tolerance in the presence of inhibitors. Additionally, alternative
polymerases have been developed to allow faster binding to nucleo-
tides with an increase in accuracy which results in a decrease in the
number of binding events needed for elongation and a decrease in
 DNA Profile Development with RapidHIT™ ID System 371

error rates [23–27]. Adjusting components or parameters of buf-

fers is another modification that direct amplification kits can imple-
ment [28]. For example, increasing the pH of buffers can help
overcome the presence of inhibitors. One technology looked at
increasing pH of the solution, which led to a change in the net
charge of the protein inhibitors. Because the charges were more
negative, this resulted in weakening or even suppressing the attrac-
tion between the proteins and the negatively charged DNA [29].
Within the PCR chamber is a small paper disc that traps the
lysate in place. The chamber holds about 12 μL, and equal parts of
the reaction and primer mix are added to the sample for amplifica-
tion [8, 21]. The GlobalFiler™ Express cartridge targets the
following loci: D3S1358, vWA, D16S539, CSF1PO, TPOX,
D8S1179, D21S11, D18S51, D2S441, D19S433, TH01, FGA,
D22S1045, D5S818, D13S317, D7S820, SE33, D10S1248,
D1S1656, D12S391, D2S1338, Amelogenin, DYS391, and
Y-indel [22]. The NGM SElect™ Express cartridge targets the
following loci: D10S1248, vWA, D16S539, D2S1338, Amelo-
genin, D8S1179, D21S11, D18S51, D22S1045, D19S433,
TH01, FGA, D2S441, D3S1358, D1S1656, D12S391, and
SE33 [30].
The capillary and the gel polymer are housed within the pri-
mary cartridge for capillary electrophoresis. Within the unit, there
is a six-dye detection window in order to capture the dye-labeled
amplified fragments [5, 16]. An internal size standard is contained
within the sample cartridge and is pumped into the PCR chamber
with the amplicon after amplification. The DY632 500 base size
standard is run with each sample to determine the base size of each
sample peak, with the inclusion of additional oligonucleotide frag-
ments for greater accuracy. Before injection into the capillary, the
amplicon/size standard mix passes through a denaturation zone
that is heated to 95 °C to ensure that single stranded DNA is
injected [8]. Allelic ladders are either processed when a new pri-
mary cartridge is installed and added to an internal ladder library
(GFE and RI cartridges) or are compared to the sample based on an
empirical allelic ladder library housed within the system (NGM).
The allelic ladders stored in the system show a variety of run
migrations to account for any migration variables that can
occur during sample runs, which allows for more accurate and
reproducible genotyping results. The variables are based on differ-
ent temperatures and gel ages that a sample could be run on to
generate an appropriate model to apply to interpretation [16, 18,
19].

1.3 STR Profile After a run has been completed, the instrument performs a primary
Generation on with the analysis on the sample, focusing on the quality of the profile and
RapidLINK™ Software passing parameters predetermined by Thermo Fisher through a
multicomponent analysis [8, 15]. The system looks at the genetic
profile for information including peak height ratios, stutter peak
372 Megan M. Foley

percentages, mixture indicators, etc. to determine a quality score

that can be used by the analyst as a quick review of success of a
sample. The primary analysis employs thresholds per locus using a
receiver-operator curve [8]. Data is viewed on the RapidLINK™
Software, which allows for quick analysis and review of the DNA
profile. The software also acts as an interface for data management
for all instruments within one laboratory or Rapid DNA depart-
ment system. The RapidLINK™ Software is embedded with the
analysis software GeneMarker™ HID STR Human Identity Soft-
ware by SoftGenetics®. GeneMarker™ contains panels for all three
run types with preloaded analysis settings that each laboratory can
validate [16].
The RapidLINK™ Software includes applications for sample
matching, internal database searching, kinship analysis, and familial
searching, and can house an elimination database of staff members.
The sample matching application performs match statistics on two
profiles to determine the likelihood that they are from the same
contributor. Calculations that can be performed are the combined
probability of concurrent alleles using formulas from the American
Association of Blood Bank (AABB) and likelihood ratios at the
locus and genotype level using Identity by Descent formulas with
allelic frequencies published by NIST. Familial matching searches
the database for possible familial relations of a selected sample based
on set search parameters. The kinship application searches and
calculates likelihood ratios for specific relations within the database,
including parent-child, sibling, grandparent-grandchild, cousin,
and uncle/aunt-niece/nephew [15].

2 Materials

2.1 Consumables 1. Sterile cotton swab(s) (see Note 1).

2. FTA card(s) (see Note 1).
3. FTA card punch tool and mat.

2.2 RapidHIT™ ID 1. RapidHIT™ ID Primary Cartridge GlobalFiler™ Express (see

Kits Note 2): 100 sample kit. Box 1 contains the Primary Cartridge
(GlobalFiler™ Express 100) and the Utility Cartridge (for
primary cartridge replacement); store at room temperature
(15–30 °C). Box 2 contains the Gel Cartridge (for primary
cartridge replacement), the ACE GlobalFiler™ Express control
cartridge, and the RapidHIT™ ID ACE GlobalFiler™ Express
positive control cartridge; store at 4–10 °C.
2. RapidHIT™ ID Primary Cartridge NGM SElect™: 100 sample
kit. Box 1 contains the Primary Cartridge (NGM SElect™
Express 100) and the Utility Cartridge (for primary cartridge
replacement); store at room temperature (15–30 °C). Box 2 con-
tains the Gel Cartridge (for primary cartridge replacement), the
 DNA Profile Development with RapidHIT™ ID System 373

NGM control cartridge, and the NGM Express positive control

cartridge; store at 4–10 °C.
3. Sample Cartridges: Contents are specific to cartridge type.
Each kit type contains 50 sample cartridges, two positive con-
trol cartridges, and two negative control cartridges. The Rapid-
HIT™ ACE GlobalFiler™ Express Kit, RapidHIT™ ACE
NGM SElect™ Express Kit, or RapidINTEL™ Kit.

2.3 Equipment 1. RapidHIT™ ID Instrument.

2. RapidLINK™ Software.
3. Barcode Scanner: must be compatible with GS2–128, Indus-
trial 2 of 5, Interleaved 2 of 6, Code 128, or Code 39 (see
Note 3).

3 Methods

Before beginning the method, ensure that all reagents are within
expiration and that all necessary equipment and consumables are
stocked. Prepare all worksheets with appropriate information, e.g.,
sample names, elution volumes, etc. Hair nets, a face mask, and
gloves must be worn throughout this procedure, changing gloves
when necessary.

3.1 Set-Up of a 1. Prepare or collect the sample to be analyzed (buccal swabs,

Sample Run on the blood/saliva references on FTA cards, fabric cuttings, etc.).
RapidHIT™ ID System 2. Login to the RapidHIT™ System (see Note 4). If the instru-
ment screen is off, press the circular power button located on
the bottom right side on the front of the instrument (see Fig. 1,
labeled as “i.”). When the instrument has fully turned on, the
button is a blue color. It is green when idle (see Note 5). Tap
the “Lock” screen in the center (see Fig. 2a for a visual of the
lock screen). Sign in using the method chosen during configu-
ration (facial recognition, fingerprint scanning, or PIN). To
configure the sign-in methods, see Subheading 3.5, step 4.
3. To use the facial recognition, stand in front of the camera at the
top left of the instrument (see Fig. 1, labeled as “ii.”). To use
the fingerprint reader, press the appropriate finger onto the
scanner under the screen (see Fig. 1, labeled as “iii.”). To use
the PIN, press the “Lock” screen and press the keypad icon in
the lower part of the screen and then the pointer icon (hand
with an arrow) in the upper right corner (see Fig. 2b). This
allows typing on the screen. Select the appropriate username
from the dropdown and enter the PIN using the keypad.
374 Megan M. Foley

Fig. 1 The RapidHIT™ ID System. (i) Power Button; (ii) Camera; (iii) Fingerprint
reader; (iv) Cartridge Port; (v) USB Port. (Reproduced from Ref.
[16]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher
Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc.
Used under permission)

4. Once successfully logged in, the username briefly appears, and

then the screen switches to the “Sample Identification” screen
(see Fig. 2c) (see Note 6).
 DNA Profile Development with RapidHIT™ ID System 375

Fig. 2 Various RapidHIT™ ID screen prompts. (a) Lock screen; (b) Login screen; (c) Sample Identification
screen; (d) Add Sample screen; (e) Insert Sample Cartridge screen; (f) Remove Sample Cartridge screen; (g)
Remove Primary Cartridge; (h) Insert Primary Cartridge. (Reproduced from Ref. [16]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo
Fisher Scientific Inc. Used under permission)

5. Fill out the appropriate sample information either through

barcode scanning (see Subheading 3.1, step 6) or manual
entering (see Subheading 3.1, step 7). If the “Sample Identifi-
cation” screen has disappeared, click the back arrow button
until visible (see Note 7).
6. For the scanning method, the barcode present on the sample
packaging can be scanned one of two ways. First, if the labora-
tory has a barcode scanner configured, scan the barcode using
the scanner (see Note 3). Second, using the camera in the front
left side of the screen, hold the sample package with the bar-
code facing the camera. Once recognized by the instrument,
the barcode is displayed on the instrument.
7. To manually enter a sample, press the “Sample ID” screen and
then the keypad icon to begin typing. Type the sample ID
name or the barcode on the sample package. Then press
“ENTER”. The entered sample ID name/number is visible
on the screen. Verify that this is correct before continuing (see
Note 8).
376 Megan M. Foley

8. Remove a sample cartridge from storage and open the small cap
that opens to the swab chamber. Insert the sample swab to be
processed (cotton tip down) all of the way into the sample
cartridge and close (see Note 9). The screen displays a visuali-
zation of this action (see Fig. 2d). If the sample is a cutting of a
swab, FTA card punch, or other material, place it into the
chamber, and use a sterile clean cotton swab to push it down
to the bottom. Do not remove the swab (see Note 10).
9. After the sample ID has been loaded, the “Insert Cartridge”
(see Fig. 2e) screen appears with a picture of the sample car-
tridge and a white arrow toward the instrument. Load the
loaded sample cartridge, caps toward you and flat side down,
into the “Sample Cartridge Port” above the screen (see Fig. 1,
labeled as “iv.”) (see Note 11). The run begins automatically as
soon as the sample cartridge is inserted correctly.
10. The run lasts between 90 and 110 min (see Note 12). For the
RapidHIT™ ID ACE GlobalFiler™ Express and NGM
SElect™ Express cartridges, the run lasts ~90 min. For the
RapidINTEL™ cartridge, the run lasts ~95 min.
11. The cartridge must remain in the instrument until prompted to
be removed after the run has finished. During the run, a clock
shows the time remaining and automatically stops when fin-
ished. The run stops before the timer reaches “0”.
12. Once the run is finished, the current “Sample Cartridge”
screen is visible for 30 s only, and then the instrument logs
the current user out of the system. If logged out, log back in
before moving on to the next step.
13. Remove the cartridge from the instrument when the screen is
displaying the “Remove Sample Cartridge” screen, which dis-
plays the cartridge with a white arrow leading away from the
instrument (see Fig. 2f). Pull the cartridge straight out at the
same angle it was inserted (see Note 13). Discard the used
cartridge when finished in an appropriate biohazard container.
Retain the swab if required by the laboratory guidelines (see
Note 14).
14. The “Result” screen appears with the sample name and an
indication of the quality of the results generated (see Table 2).
Press the “DONE” button under the quality status to dismiss.
The software automatically logs out and locks (see Note 15).

3.2 Viewing and 1. To review the quality results on the RapidHIT™ ID instru-
Exporting the Results ment after the software has been logged out, log back in (see
in the RapidHIT™ ID Subheading 3.1, step 2), and press the menu icon. Once in the
Software menu section, click the run data icon located on the right side
of the top row (icon contains a folder with a strand of DNA; see
Fig. 3). From this location, the quality status of a run can be
 DNA Profile Development with RapidHIT™ ID System 377

Table 2
RapidHIT™ ID profile results

RapidHIT™ ID results Definition

Green check mark Profile was generated with no quality flags. The profile can be analyzed
in RapidLINK™.
Yellow check mark Profile was generated with some quality flags or only size standard
was detected. The profile can be analyzed in RapidLINK™.
Red “X” No allelic peaks or size standard peaks were observed. No profile
was detected. The profile is not analyzed in RapidLINK™.
RapidHIT™ ID indicates the quality of a profile based on pre-determined settings. Profile information evaluated includes
presence of alleles, possible presence of a mixture, and size standard results

viewed along with the user who performed the run and the
date/time of the run.
2. To export sample data, insert a USB into the USB port located
on the front left side of the bottom of the instrument under the
screen (see Fig. 1, labeled as “v.”). Press the menu icon, fol-
lowed by the run data icon. All previous runs and the run
statuses are displayed on the screen. Select the run(s) to be
exported. Press the “Export” button, which automatically
transfers a copy of the run file to the USB device inserted (see
Note 16).
3. All runs can be exported at once if the user signed in has
administrator or supervisor rights.
4. To sign out, press the back arrow button until the sign-out lock
icon is available. Press the lock icon to sign-out.

3.3 General 1. The instrument must be run, at a minimum, every 7 days. If a

Instrument Usage and run has not been performed that week, perform a sample
Maintenance cartridge run (see Subheading 3.1, step 1). This can be done
either with a blank swab or a known control swab for perfor-
mance check purposes.
2. Clean the surfaces of the instrument as needed following the
laboratory decontamination procedure.
3. Clean the screen as needed with a glass cleaner and disposable
laboratory wipe. This should only be performed when the
internal computer is off.
4. Routinely power off the internal computer and restart the
system; this can also be done on an as-needed basis. Press the
power button on the front of the instrument and hold until the
computer switches off. Turn off the main power switch at the
back of the instrument. Let sit for a few minutes. Power on the
378 Megan M. Foley

Fig. 3 Menu screen highlighting the Primary Cartridge Icon. (1) Primary
Cartridge; (2) Run Data; (3) Settings; (4) Users. (Reproduced from Ref.
[16]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher
Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc.
Used under permission)

main switch first, then power on the internal computer (see

Note 17).
5. Periodically check the run statistics of the current primary
cartridge to determine if it needs to be replaced (see Note
17). To do this, log in and view the “Sample Identification”
screen (see Subheading 3.1, steps 2–4). Select the option to
view the remaining run count of the primary cartridge (see
Fig. 2c, bottom middle icon). If needed, click the back button
until displayed. The primary cartridge and gel need to be
replaced if any of the following occur: the outer circle of the
gel volume icon is red, the gel or primary cartridge has expired,
or the number of runs remaining has reached zero (see Note 18
and Subheading 3.4, step 1).

3.4 Replacing the 1. Replacing the primary cartridge takes ~5 h total, including
Primary Cartridge control runs.
2. To change the primary cartridge, prepare the appropriate
reagents and let all components come to room temperature.
This includes a new unexpired primary cartridge (see Note 19),
the provided gel cartridge, the three control cartridges, and the
provided utility cartridge. Once logged in and on the “Sample
Identification” screen (see Subheading 3.1, steps 2–4), open
the “Menu” screen (see Fig. 2c, bottom left icon) and press the
primary cartridge button (see Fig. 3, top middle icon). A
pop-up screen appears prompting the user to confirm: “Do
you want to eject the primary cartridge?” Press “Yes”.
 DNA Profile Development with RapidHIT™ ID System 379

Fig. 4 Primary Cartridge Replacement screen prompts displayed on the RapidHIT™ ID. The display shows the
prompt for Step 1 of the replacement procedure to remove the shipping plugs from the primary cartridge.
(Reproduced from Ref. [16]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher Scientific
Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)

3. The instrument displays a step-by-step series of prompts with

pictures to instruct the user on the appropriate procedure for
each step (see Fig. 4). Press the number on the screen that is
associated with the current step to see a visualization of the
procedure.
4. Pressing “1” on the screen instructs how to remove the
shipping plug on the check valve of the primary cartridge (see
Fig. 5). A small arrow can be visualized around the valve on the
cartridge and the plug is white in color next to the gel cartridge
380 Megan M. Foley

Fig. 5 The primary cartridge. (1) Capillary; (2) Gel Cartridge; (3) Shipping Plug; (4)
second Shipping Plug. (Reproduced from Ref. [16]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.
thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)

slot. Turn the plug 90 degrees counterclockwise following the

direction of the arrow and remove it from the cartridge. Press
“DONE” at the bottom of the screen once this step has been
completed.
5. Pressing “2” on the screen instructs how to remove another
white shipping plug from the primary cartridge; this is visible
toward the front of the cartridge that leads to the cathode block
(see Fig. 5). Unscrew counterclockwise and remove the plug.
Press “DONE” at the bottom of the screen once this step has
been completed.
6. Pressing “3” on the screen instructs how to remove the
shipping plug out of the gel cartridge inlet. This plug should
be pulled straight out. Do not twist as it is removed (see Note
20). Press “DONE” at the bottom of the screen once this step
has been completed.
7. Pressing “4” on the screen instructs how to insert the gel
cartridge into the primary cartridge (see Fig. 5). The newly
exposed tip of the gel cartridge should face the inlet on the
primary cartridge with the other end facing the square marker
at the top. Do not twist the cartridge in any direction. The
black window of the gel cartridge should be facing up. An
audible click can be heard when inserted completely. Press
“DONE” at the bottom of the screen once this step has been
completed.
8. Pressing “5” on the screen instructs how to remove the
shipping cover over the capillary from the primary cartridge;
this is located on the back side of the cartridge (see Fig. 5). Press
the brackets inward and remove the cover by slowly raising the
end with the brackets upwards and away from the capillary (see
 DNA Profile Development with RapidHIT™ ID System 381

Note 21). Press “DONE” at the bottom of the screen once

this step has been completed.
9. The cartridge prep is now complete. A timer starts (~9 min).
During this time, the instrument begins to disengage the used
primary cartridge in the instrument.
10. The next screen shows proper insertion of the utility cartridge
(red label) into the instrument. Remove the utility cartridge
from the packaging. By holding the red part of the cartridge,
insert the utility cartridge so the flat side is down and the red
tag is facing outwards. The utility cartridge is blank and pumps
fluids through the system. This lasts about ~5 min.
11. About 3 min into the countdown, the screen switches to the
“Remove Primary Cartridge” screen, which displays the car-
tridge in blue with a white arrow pointing away from the
instrument (see Fig. 2g). Pull the used primary cartridge out
of the bottom of the instrument by sliding it out. The screen
changes to the “Insert Primary Cartridge” screen, similar to
the previous screen but with the arrow pointing inwards (see
Fig. 2h). Before inserting the primary cartridge, remove the
allelic ladder, positive, and negative control cartridge from the
packaging.
12. To insert the prepared primary cartridge, press the newly
prepared cartridge into the instrument as displayed on the
screen. Press in gently to avoid hitting the capillary on any
part of the instrument. Once fully inserted, the instrument
starts a full run (~90 min).
13. Once the utility cartridge run is complete, the screen prompts
the user to remove the utility cartridge by displaying the
“Remove Utility Cartridge” screen, with the arrow pointing
away from the instrument.
14. Next, run the controls—allelic ladder, positive control, and
negative control—as described (see Subheading 3.4, steps
15–18). The controls are processed like regular samples; there-
fore, the screen displays the run status checkmarks when fin-
ished (see Table 2).
15. First, perform an allelic ladder control run (see Note 22). Open
the “Sample ID” screen. Insert the allelic ladder cartridge (see
Note 23). The software immediately assigns the sample ID as
“LADDER” by scanning the associated RFID tag on the car-
tridge. Process the allelic ladder (~60 min). Once complete,
review the results; ensure that a green check mark was obtained
(see Note 24). Remove the allelic ladder cartridge when
prompted by the instrument through the display of the
“Remove Allelic Ladder Cartridge” screen.
382 Megan M. Foley

16. Next, run the positive control cartridge to ensure proper

migration of DNA fragments. Open the “Sample ID” screen.
Insert the positive control cartridge (see Note 23). The soft-
ware immediately assigns the sample ID as “POSCTRL” by
scanning the associated RFID tag on the cartridge. Process the
positive control (~90 min). Once complete, review the results;
ensure that a green check mark was obtained (see Note 24).
Remove the positive control cartridge when prompted by the
instrument.
17. Last, run the negative control cartridge to ensure no contami-
nation has occurred in the system or reagents. Open the “Sam-
ple ID” screen. Insert the negative control cartridge (see Note
23). The software immediately assigns the sample ID as
“NEGCTRL” by scanning the associated RFID tag on the
cartridge. Perform the negative control run (~90 min). Once
complete, review the results; ensure that a green check mark
was obtained (see Note 24). Remove the negative control
cartridge when prompted by the instrument.
18. Once all three control types have received a green check mark,
dispose of all of the used cartridges appropriately.

3.5 RapidHIT™ ID 1. After logging into the instrument (see Subheading 3.1, steps 2–
Software 4), press the “Menu” icon from the “Sample Identification”
Configuration (Only for screen (see Fig. 2c, bottom left icon). Once in the menu, click
Supervisor and/or the “Settings” icon (icon with gear; see Fig. 3, labeled as “3”).
Administrator Login) 2. The Settings menu offers several items of information (e.g., the
name of the removable drive, if inserted; the IP address of the
RapidLINK™ Software; current data and time; etc.). There are
several settings that can be configured from this menu, includ-
ing backup/ restore/recovery options, enabling/disabling the
connection to the RapidLink™ Software, changing the soft-
ware’s IP address, providing contact information, allowing for
double sample entry, setting the date and time, etc. Refer to
Table 3 to see which user role has permission to configure
specific settings.
3. Add, delete, or manage users by pressing the “Manage Users”
icon—outline of two people and the settings gear (see Fig. 3,
labeled as “4”) (see Note 25). To add a user, press the add user
icon located on the bottom row on the left (icon contains one
person with a plus sign). Fill out the appropriate information
for the user—including user role (either supervisor, admin, or
operator) and name—and press “ENTER”. The permissions of
each user role are described in Table 3 (see Note 26).
4. The next screen prompts the user to choose which identifica-
tion method (face recognition, fingerprint scan, or password/
PIN) should be prompted during login. To scan the user’s face
 DNA Profile Development with RapidHIT™ ID System 383

Table 3
The permissions of each user role in the RapidHIT™ ID software

Action Operator Supervisor Admin

Perform a Run

View Run Logs

Only of User All Users All Users
Replace Primary
Cartridge

Recover Instrument

Export Run Data

Using USB

Create a User

Back Up and Restore

Instrument
Enable/Disable
RapidLINK
Connection
Change Date and
Time Zone

The ability to change/update parameters and information in the RapidHIT™ ID instrument is based on
the role of the user

for the face recognition option, stand in front of the instrument

camera in the center of the view (see Fig. 1). To configure a
user’s fingerprint for the fingerprint scan option, press the
designated finger onto the finger pad on the front of the
instrument (see Fig. 1). The instrument instructs the user to
press the appropriate finger multiple times until it has been fully
captured and stored. To configure a password/PIN, type in the
appropriate PIN (must be six characters). The instrument
prompts the user to enter the PIN twice.
5. Additionally, an email or phone number can be added for
messaging from this screen by pressing the icons at the bottom,
“EMAIL ID OR SMS”.
6. Press the save icon (floppy disc icon). Once the profile has been
saved, a large blue check mark is displayed with the lettering
“PIN SUCCESSFULLY CREATED”. Press “DONE” to close
the screen.
384 Megan M. Foley

Fig. 6 The RapidLINK™ home screen. (i) Instrument List; (ii) DNA Profile Library; (iii) Profile Matching; (iv)
Familial Searching; (v) Kinship Matching; (vi) Employee Database; (vii) Runs Per Day; (viii) Consumables
Remaining; (ix) Instrument Details; (x) User Settings. (Reproduced from Ref. [15]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo
Fisher Scientific Inc. Used under permission)

7. Once saved, the user’s profile can be updated by going into the
“Manage Users” menu and choosing the specific user.
8. A user can be deleted from an instrument via the RapidLINK™
Software (see Subheading 3.6, step 22). The instrument must
be connected to the network in order to disable user access to
that particular instrument.

3.6 Analyzing 1. To open the RapidLINK™ Software, double-click on the DNA

Samples in icon on the desktop. The first screen includes a list of the
RapidLINK™ instruments within the system. From this screen, various infor-
mation can be viewed and/or a variety of functions can be
performed.
2. To view the instrument list, click the “Instrument” icon—the
first icon at the top of a map with a pin (see Fig. 6, labeled as
“i.”). Here, the different instruments can be managed and
viewed in either a list format (default) or a map. Information
regarding errors, temperature, humidity, or connectivity can be
reviewed. To change the default display to a map view from this
 DNA Profile Development with RapidHIT™ ID System 385

screen, click the “Settings” icon (two gears) and select the
“Show map view” checkbox at the bottom of the screen.
3. From the map, choose a pin based on the location of the
instrument(s) and choose the specific instrument to view. If
the pin is green, all instruments at this site are online, yellow is
>51% are online, red is >51% are offline or inactive, and gray is
inactive. Instruments offline are colored in red. Instrument
errors/out-of-range settings also show next to the appropriate
instrument icon (stethoscope appears).
4. The user is able to monitor a specific instrument by clicking on
the instrument name through either the list or map format. By
clicking on the “Open screen viewer” icon (top left), the user
can view the live screen of that specific instrument. Click “X”
to exit.
5. To generate a run summary report for this instrument, one of
three report options can be chosen—“Export to PDF”,
“Export to CSV”, or “Custom Report”. Custom report allows
the user to select parameters including runs by instrument
and/or user, runs by run status, runs by location, and runs
by date.
6. To generate an audit report, click the “Audit” icon at the top
left of the screen. This can be printed or saved as a .pdf.
7. To view the DNA profile library results, click the second icon at
the top of a folder with a DNA helix (see Fig. 6, labeled as “ii.”).
Here, the list of runs can be searched or filtered to find the
appropriate run using the filters at the top of the screen, current
run status, or by typing in the run name. Each sample/control
has an associated status for review based on the automatic
analysis performed by GeneMarker™ HID. Only samples
with green checks are added to the database for matching.
There are six status possibilities: “Pass”, “Requires Review”,
“Pass with Review”, “Reviewed”, “Fail”, or “Uploaded to
CODIS” (see Fig. 7).
8. The user is able to view each sample that has been uploaded to
the Match database. By clicking on the “DNA” icon (two DNA
strands in the column next to sample ID), a match report is
generated showing DNA profiles that match the current sam-
ple selected. The report includes information regarding the run
and a likelihood ratio for each locus. The match settings can be
adjusted by pressing the “Settings” icon. Settings that can be
adjusted include minimum number of matching loci, maxi-
mum number of allowed mismatches, minimum stringency
match percentages, and the allelic frequency table used (see
Note 27).
386 Megan M. Foley

Fig. 7 List of current status options of a RapidHIT™ ID profile in the RapidLINK™

Software. Pass—passed initial quality review; Requires Review—received a
yellow check from the initial quality review; Pass with Review—analyst passed
the sample after review; Reviewed—analyst applied the setting; Fail—failed RH
quality review; Uploaded to CODIS—analyst applied setting. (Reproduced from
Ref. [15]. Figure owned by Life Technologies Corporation, a part of Thermo
Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific
Inc. Used under permission)

9. The last column of the DNA profile library screen indicates if a

sample has matched a profile stored in the Staff Elimination
Database.
10. The user can also generate a run summary report for this
instrument within the DNA profile library screen. One of
three report options can be chosen: “Export to PDF”, “Export
to CSV”, or “Custom Report”. Custom report allows the user
to select parameters, including runs by instrument and/or
user, runs by run status, runs by location, and runs by date.
11. To perform profile matching, click the third icon at the top with
two DNA helices (see Fig. 6, labeled as “iii.”). This function
performs match statistics on two profiles.
12. To perform familial searching, click the fourth icon at the top
with an outline of three people (see Fig. 6, labeled as “iv.”).
From this application, choose the sample to be searched. To
focus the search, the “Relationship” and “Gender” fields can
be updated. Within the settings, the allelic frequency table and
the likelihood ratio threshold can be specified (see Note 27).
13. To perform kinship analysis, click the fifth icon with a pedigree
(see Fig. 6, labeled as “v.”). From this application, choose the
samples to be compared. Drag the sample into the relation
 DNA Profile Development with RapidHIT™ ID System 387

location in the pedigree on the right side of the screen. Click

the “Report” icon at the bottom of the screen on the left,
which includes a likelihood ratio of the comparison and a
probability of relationship. Within the settings, the allelic fre-
quency table can be specified.
14. To view the staff elimination database, click the last icon of a
DNA helix crossed out (see Fig. 6, labeled as “vi.”). From this
application, match settings can be adjusted in the “Settings”
icon. Settings include minimum number of matching loci,
maximum number of allowed mismatches, high stringency
match percentage, moderate stringency match percentages,
likelihood ratio threshold, and the allelic frequency table used
(see Note 27).
15. To import a profile into the staff elimination database, click the
“Import” icon. Specific formats are needed for .txt and .csv files
(see Subheading 3.6, steps 16 and 17, respectively). Select the
file type the profile is saved as (see Note 28) and click “Open”.
16. For .txt files, the first line/row includes the column headers.
The first column header must be “NAME”. The remaining
column headers include the locus names (order doesn’t mat-
ter). The second line/row includes the sample name (first
column) and alleles for each locus in the corresponding col-
umns (e.g., 12,13 in the same cell with no spaces). Homozy-
gous alleles only need to be entered once, for example, “16”.
17. For .csv files, the first line/row includes the column headers.
The first column header must be “NAME”. The remaining
column headers include the locus names, but these must be
listed twice for each locus (see Note 29). The second line/row
includes the sample name (first column) and alleles for each
locus in the corresponding columns, with only one allele listed
per cell (homozygous alleles are only typed once).
18. For profiles generated on the RapidHIT™ ID: Find the appro-
priate .xml file in the run folder and click “Open”.
19. To remove a profile, select the profile from the list and click the
“Delete” icon (trash bin).
20. To view a snapshot of runs performed over the previous 2 weeks,
review the “Runs Per Day” graph at the bottom of the screen
(see Fig. 6, labeled as “vii.”). The value of each bar is the
number of runs performed that day for all instruments on the
network. The color is based on the quality statuses for each
run—blue for green or yellow check marks and red if a red “X”
was called. By clicking on each bar, the user can view the runs
per hour.
21. To view a snapshot of the consumables remaining, review the
“Consumables Remaining” graph at the bottom of the screen
388 Megan M. Foley

(see Fig. 6, labeled as “viii.”). The number of runs left for each
primary cartridge can be viewed, as well as an estimated date for
cartridge replacement. The estimated date is based on the
average usage of that specific instrument over the past
20 days. The color of the bar indicates how many runs are
remaining—white if >30 runs and red if ≤30.
22. To view the status and configuration of each instrument, click on
the “Settings” icon on the left of the screen (see Fig. 6, labeled
as “ix.”). A new window with a list of instruments opens. Click
on the “Instrument” icon to display the instrument details.
From here, a variety of tasks can be completed, including
adding an instrument site, displaying sensor information, edit-
ing instrument information, and/or adding a site location.
23. To add an instrument to a site (see Note 30), click on the site
and then the plus sign at the bottom of the screen. Enter the
instrument’s serial number, host name, and location. Click
“Save”. Display sensor information of a specific instrument
and make an instrument inactive by clicking on the appropriate
box. Information about an instrument can be edited by click-
ing the “Edit” icon (pencil icon). Once the information has
been changed, click “Update” to save the changes.
24. Click the plus sign at the bottom of the screen to add a new
location. The name of the site (“Enter Location field”) and
address or latitude/longitude (see Note 31) must be entered in
their appropriate fields. Click “Save”.
25. To view user settings, click the “User Settings” icon—outline of
two people and the settings gear (see Fig. 6, labeled as “x.”).
The user can visualize all current users and their privileges. To
edit a user’s access, click on the user name and the instrument.
Use the arrows to move instruments into the “Authorized” or
“Unauthorized” boxes (see Note 32).

3.7 Secondary 1. GeneMarker™ can be opened one of two ways. The first is
Analysis with through opening the GeneMarker™ HID software. Open the
GeneMarker™ HID run folder that has been exported via a network or USB drive.
Select the “GM Analysis” file in the run folder. This automati-
cally opens GeneMarker™ HID.
2. The second way to open GeneMarker™ is through the Rapi-
dLINK™ Software. Open the software. Select the DNA profile
library icon (see Fig. 6, labeled as “ii.”) from the Main Menu.
This opens a list of all runs saved on the instrument the user is
logged into. Find the appropriate run and double-click the
sample ID to be analyzed. This automatically opens GeneMar-
ker™ HID. If the run was performed on an instrument at a
 DNA Profile Development with RapidHIT™ ID System 389

Fig. 8 GeneMarker™ HID initial screen. (i) Show Chart/Table; (ii) Browse by All Color; (iii) Size Calibration.
(Reproduced from Ref. 15. Figure owned by Life Technologies Corporation, a part of Thermo Fisher Scientific
Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)

different location, open the managing instrument icon (see

Fig. 6, labeled as “i.”), and choose the appropriate site pin.
This generates a list of instruments at this site. Choose the
appropriate instrument, which displays all runs performed on
the chosen instrument. Double-click the sample ID to be
analyzed. This automatically opens GeneMarker™ HID.
3. When GeneMarker™ HID is opened, the screen displays the
raw electropherogram of the sample ID chosen with overlap-
ping dyes (see Fig. 8).
4. Analysis preferences should be updated based on the labora-
tory’s validation of the instrument and software before analyz-
ing samples (see Note 33). Steps to update analysis preference
settings for GlobalFiler™ Express are outlined in Table 4.
5. To access the analysis preferences, click “View” from the tool-
bar and select “Preferences. . .” from the drop-down. When
finished setting the parameters, click “OK”. Once the analysis
preferences for a particular method have been set, this step
should not have to be performed for future analysis.
6. Next, the samples can be analyzed. First view the quality flags of
a sample. Click the “Show Chart/Table” icon (see Fig. 8,
labeled as “i.”). The screen displays a table that includes allele
390 Megan M. Foley

Table 4
Example analysis parameter settings for GlobalFiler™ Express in GeneMarker HID

Window tab Recommended analysis parameters

Start up Check: “Classic” for Run Method, “Show Navigator, and “Show Report”
settings Under Display Settings Set: Decimal Precision to “1” and Font Size to “6”
Under Allele Label Box Check: “Mark Off-Marker as ‘OL’”, “Mark Off-Bin as ‘OB’”, and
“Show All Allele Labels”
Under Chart Settings Box Check: “Max Allele Label Layers”, set to “10”, “Show Loci Box
with Multi-line”
Under Peak Label Box Check: “Size”, “Height”, Position as “Allele Label”, and “Vertical”
Under Gel Image Uncheck: All boxes
Under Sample Tree Check: “Consider Gender for Flag ‘?’”
Forensic Check: “Mark Deleted/Edited Peaks with Symbols,” and “Auto-Delete Alleles in Virtual
settings Bins in Allelic Ladders”
Set Identifiers as follows: Ladder to “LADDER”, Positive Control to “PC”, and Negative
Control to “NC”
Report Check: “Automatically Scroll Chart to Alleles When Selected in Report”
settings
Other Under Folder Settings Check: “Each” and “Using Default Folder of Panel, SizeStd, and
Template”
The recommended analysis parameter settings for analyzing samples in GeneMarker HID are displayed here. Settings are
separated out by window tab

calls, base pair size, relative fluorescent units (RFU) values, and
quality reasons for flags. If viewing the electropherogram, the
flagged alleles are highlighted in yellow. To confirm an allele
that has been flagged, right-click the allele and select “Con-
firm” (or Ctrl+M) from the drop-down. The allele is now
marked as “E” in the electropherogram.
7. To review the remaining allele calls, select the icon “Browse by
All Color” (see Fig. 8, labeled as “ii.”) that pictures an EPG
with the dyes separated. At this point, the analyst can toggle
between samples and controls using the up and down arrows
on the right side of the screen. To zoom into a peak, left-click
the mouse/pad and drag the box over the area to be viewed
(must go from upper left to lower right). To zoom out, per-
form the same action but from lower right to upper left. View
each locus by scrolling the screen or choose a specific marker
using the “Marker” drop-down menu listed on the toolbar
(furthest to the right).
8. If an artifact is identified, it can be deleted by right-clicking on
the peak and choosing “Delete” from the menu (or the Del
button on the keyboard). At this time, the peak displays with an
“X” above the apex and is displayed as such in the chart/table.
Comments can be added to an allele by the “Edit Comments”
 DNA Profile Development with RapidHIT™ ID System 391

in the drop-down. To edit a peak, right-click and choose “Edit

Allele” from the menu. An “Edit Allele” box appears and
information can be updated. The peak then displays an “E”
above the apex and is displayed as such in the chart/table.
9. To save edits, open the drop-down list on the right side of the
screen at the top, and choose the correct .fsa file. Close the
window “All Color Browser” by clicking the “X” at the top
right corner of the screen. From the main screen, click the
“Save Peak Table” icon (three icons to the right of the Marker
drop-down). Open the “REQUIRES ANALYST REVIEW”
folder within the run folder. From the “Save as type:” drop-
down, choose “Text File (*.txt)” and click the “GM_Analysis_-
PeakTable.txt” file. A pop-up appears asking if the user wants
to override the existing file. Click “Yes”.
10. To save within GeneMarker™, click “File” from the menu and
choose “Save Project” from the drop-down.
11. Once a profile has been analyzed, save any edits performed in
GeneMarker™ in the RapidLINK™ Software by clicking the
review status of the specific sample in RapidLINK™. From
here, the menu of all statuses is available (see Subheading 3.6,
step 7). Click the appropriate status from the drop-down and
click “Submit”.
12. Analyze the controls for a run (internal lane standard or allelic
ladder). Click the size calibration icon (see Fig. 8, labeled as
“iii.”).
13. To analyze the allelic ladder, first check that an allelic ladder has
been chosen in GeneMarker™ and that this allelic ladder
passed according to the system. If any artifact peaks were
detected, they appear as an “X”.
14. To analyze the internal lane standard, check that all peaks are
called: 80, 90, 100, 120, 129.8, 135.2, 139.3, 144, 147.8,
151.8, 156, 160, 170, 180, 190, 200, 220, 240, 260, 280,
300, 320, 340, 360, 380, 390, 400, 410, 420, 425, 430, 440,
450, 475, 490, and 500.
15. To export a profile for CODIS upload, click “Applications”
from the menu and choose “Export CODIS” from the drop-
down. In the next window, type in the appropriate “Source
ORI” and “Destination ORI” and click “OK”. In the “Save
As” window that appears, change the .xml file name to include
the sample ID and click “Save”. Change the status in Rapi-
dLINK™ to “Uploaded to CODIS” (see Subheading 3.6, step
7).
16. To print the electropherogram in the GeneMarker™ HID
Report, choose the sample to print by double-clicking the
sample ID in the list on the left side of the screen. Once
392 Megan M. Foley

selected, there should be a green check mark next to the

selected sample. Choose “Project” from the toolbar and select
“Print Report” from the drop-down. An existing template can
be chosen or a new one created. Click “OK” to print or save as
a PDF.
17. To close GeneMarker™ HID, choose “File” from the menu
and select “Exit” from the drop-down.

4 Notes

1. For swabs, the manufacturer recommends Puritan 3” Sterile

Standard Cotton Swab w/ Semi-Flexible Polystyrene Handle
for the GlobalFiler™ Express Cartridge. For FTA cards, the
manufacturer recommends the Whatman™ OmniSwab for the
NGM SElect™ Cartridge. Other sample matrices can be vali-
dated. The listed products were validated by the manufacturer.
Examples that have been tested by external users include 4 N6-
FLOQSwab™ samples and the MacroPur™ swab [6].
2. This cartridge is used for both GlobalFiler™ Express and
RapidINTEL™ runs.
3. Thermo Fisher must enable barcode scanning on the
instrument.
4. The main power switch located on the back panel should always
be turned on. The gel within the primary cartridge is held at a
constant temp when ON. Do not turn off unless instructed
during maintenance.
5. The boot-up process takes about 15 min. The instrument is
performing various system primes and checks. Once complete,
the lock screen is available.
6. If this leads to an error message, something may be wrong with
the instrument. Contact Thermo Fisher for troubleshooting
with the error code displayed on the screen.
7. If the screen shows the phrase “The primary cartridge is not
engaged”, there may be an instrumental or cartridge error.
Contact Thermo Fisher for troubleshooting.
8. The software automatically recognizes the labeling “LAD-
DER”, “POSCTRL”, and “NEGCTRL”, in either all caps or
lowercase as a control sample. Do not include these phrases
within sample names, otherwise errors occur during analysis.
For certain characters, the software automatically changes to an
underscore (“_”). Specifically, ^ ? % * : | ’ . < > and space. The
underscore is also displayed in the RapidLINK™ Software.
Letters always appear in capitalized format.
 DNA Profile Development with RapidHIT™ ID System 393

9. If the swab is >3 inches, the handle needs to be snapped or cut

with sterile scissors or a scalpel.
10. The chamber fills with liquid and the sample may not stay
submerged. The sterile swab helps anchor it to the bottom to
allow for optimal extraction.
11. If the screen shows the cartridge with a red “X”, the cartridge is
either expired or has been inserted improperly. If the latter,
remove the cartridge and reinsert. If expired, obtain a new
cartridge. All components have an RFID tag that is read by
the instrument that identifies the component, the lot number,
and the expiration date.
12. If priming of the instrument occurs during this particular run,
expect run times of ~110 min. This does not occur every run.
13. If the cartridge appears to be stuck, it may still be locked in the
instrument. An admin or supervisor needs to perform a recov-
ery function (see Subheading 3.4, step 1).
14. Studies have been performed that show reprocessing of the
sample may still yield another profile [5, 6, 8]. Evaluate and
validate if this procedure is to be used.
15. If the results screen does not appear, the cartridge may have
been removed too early. Insert the cartridge back in the instru-
ment and repeat the step (see Subheading 3.1, step 14).
16. If the “Export” button is not visible after the USB device has
been inserted, check that the USB device has been properly
inserted. Remove and reinsert if needed. Additionally, check
the configuration for run deletion. The user is able to choose
the option to delete the run once it has been transferred to the
RapidLINK™ Software through the use of the system’s net-
work, and it may no longer be available in the RapidHIT™ ID
System.
17. Perform this step on a routine schedule—once a week,
biweekly, or monthly based on the usage of the instrument.
18. Primary cartridge replacement can only be performed by users
with admin or supervisor privileges. Primary cartridge mainte-
nance may also need to be performed if there is an instrument
or reagent error.
19. If the instrument is used for RapidINTEL™ purposes, use a
GlobalFiler™ Express primary cartridge.
20. Do not remove the foam casing around the gel cartridge. This
remains during insertion into the primary cartridge.
21. Once this is removed, the capillary is exposed. Handle with
care!
22. If using a RapidINTEL™ Cartridge, run the GFE allelic
ladder.
394 Megan M. Foley

23. If the screen shows the cartridge with a red “X”, the cartridge is
either expired or has been inserted improperly. If the latter,
remove the cartridge and reinsert. If expired, obtain a new
cartridge.
24. A green check mark means the profile was generated with no
quality flags and expected alleles were detected in the positive
control; no alleles were detected in the negative control; or the
allelic ladder profile was generated with no flags, all expected
alleles were detected, and the ladder has been uploaded to the
instrument’s library for allelic ladders. A red “X” means that
the positive control profile was not as expected (e.g., no profile
was generated, not all alleles were detected, or too many alleles
were detected); alleles were detected in the negative control; or
not all alleles were detected for the allelic ladder. The affected
control(s) must be re-processed; if contamination in the nega-
tive control persists, contact Thermo Fisher.
25. Must be signed in as an administrator.
26. If multiple instruments within the laboratory are on the same
network, this procedure adds this user to all instruments
connected.
27. Settings should be validated and determined for each labora-
tory based on the usage of their instruments.
28. Only .txt, .csv, and .xml CODIS files can be uploaded.
29. Each allele is listed in a separate cell. Y-specific loci should be
removed from the file.
30. To perform this action, the instrument must be active and the
user needs the host name of the instrument.
31. If connected to the network, Google Maps can fill in this
information.
32. The instrument must be connected to the network. If the user
still has access, repeat this action after confirming connection.
33. These settings can be used for the GFE runs. The Intel and
NGM runs require different settings based on validation.

References
1. Federal Bureau of Investigation (2022) Rapid 3. Kartasińska E, Jurga A (2020) Rapid DNA—a
DNA. Available via Federal Bureau of Investi- technology for rapid automated DNA profile
gation. https://www.fbi.gov/services/labora analysis based on STR loci polymorphism.
tory/biometric-analysis/codis/rapid-dna. Issues Forensic Sci 309(3):33–40. https://
Accessed 21 Apr 2022 doi.org/10.34836/pk.2020.309.1
2. Hess AS (2015) FBI’s plans for the use of rapid 4. Federal Bureau of Investigation (2020) Quality
DNA technology in CODIS. Available via Fed- Assurance Standards for forensic DNA testing
eral Bureau of Investigation. https://www.fbi. laboratories. Available via Federal Bureau of
gov/news/testimony/fbis-plans-for-the-use- Investigation. https://www.fbi.gov/file-reposi
of-rapid-dna-technology-in-codis. Accessed tory/quality-assurance-standards-for-forensic-
21 Apr 2022
 DNA Profile Development with RapidHIT™ ID System 395

dna-testing-laboratories.pdf/view. Accessed 14. Date-Chong M, Hudlow WR, Buoncristiani

21 Apr 2022 MR (2016) Evaluation of the RapidHIT™
5. Hennessy LK, Mehendale N, Chear K et al 200 and RapidHIT GlobalFiler® Express kit
(2014) Developmental validation of the Glo- for fully automated STR genotyping. Forensic
balFiler® Express kit, a 24-marker STR assay, Sci Int Genet 23:1–8. https://doi.org/10.
on the RapidHIT® System. Forensic Sci Int 1016/j.fsigen.2016.03.001
Genet 13:247–258. https://doi.org/10. 15. Thermo Fisher Scientific (2018) RapidLINK™
1016/j.fsigen.2014.08.011 Software v1.0 user guide. Available via Thermo
6. Wiley R, Sage K, LaRue B et al (2017) Internal Fisher Scientific. https://assets.thermofisher.
validation of the RapidHIT® ID System. com/TFS-Assets/LSG/manuals/MAN001
Forensic Sci Int Genet 31:180–188. https:// 8038_RapidLinkSW1_UG.pdf. Accessed
doi.org/10.1016/j.fsigen.2017.09.011 21 Apr 2022
7. Federal Bureau of Investigation (2022) Guide 16. Applied Biosystems (2021) RapidHIT™ ID
to all things rapid DNA, Version 1.0. Available System v1.3.1 user guide. Available via Thermo
via Federal Bureau of Investigation. http:// Fisher Scientific. https://assets.thermofisher.
www.lsp.org/pdf/FBI_Guide_to_All_Things_ com/TFS-Assets/LSG/manuals/MAN001
Rapid_DNA_01_27_2022.pdf. Accessed 8938_RapidHIT_ID_System_v1_3_1_UG.
21 Apr 2022 pdf. Accessed 21 Apr 2022
8. Salceda S, Barican A, Buscaino J et al (2017) 17. Gill P, Fereday L, Morling N et al (2006) The
Validation of a rapid DNA process with the evolution of DNA databases—recommenda-
RapidHIT® ID System using GlobalFiler® tions for new European STR loci. Forensic Sci
Express chemistry, a platform optimized for Int 156:242–244. https://doi.org/10.1016/
decentralized testing environments. Forensic j.forsciint.2005.05.036
Sci Int Genet 28:21–34. https://doi.org/10. 18. Shackleton D, Gray N, Ives L et al (2019)
1016/j.fsigen.2017.01.005 Development of RapidHIT® ID using
9. Applied Biosystems (2020) APPLICATION NGMSElect™ Express chemistry for the pro-
NOTE—RapidHIT ID System: bone sample cessing of reference samples within the UK
processing on the RapidHIT ID System with criminal justice system. Forensic Sci Int 295:
RapidINTEL cartridges. Available via Thermo 179–188. https://doi.org/10.1016/j.
Fisher Scientific. https://assets.thermofisher. forsciint.2018.12.015
com/TFS-Assets/GSD/Application-Notes/ 19. Applied Biosystems (2019) RapidINTEL™
Bone-sample-processing-RapidHIT-ID-sys sample cartridge for blood and saliva samples
tem-RapidINTEL-cartridges-application- validation user bulletin, revision A. Available
note.pdf. Accessed 21 Apr 2022 via Thermo Fisher Scientific. https://assets.
10. Watherston J, Watson J, Bruce D et al (2022) t h e r m o fi s h e r. c o m / T F S - A s s e t s / L S G /
An in-field evaluation of rapid DNA instru- manuals/MAN0018979_RapidINTEL_
ments for disaster victim identification. Int J RHIT_v1_1_3_Validation_UB.pdf. Accessed
Legal Med 136:493–499. https://doi.org/ 21 Apr 2022
10.1007/s00414-021-02748-z 20. Gomes C, Martı́nez-Gómez J, Dı́ez-Juárez L
11. Bowman Z, Daniel R, Gerostamoulos D et al et al (2017) Prep-n-Go™: a new and fast
(2022) Rapid DNA from a disaster victim iden- extraction method for forensic blood samples.
tification perspective: is it a game changer? Forensic Sci Int 6:e265–e266. https://doi.
Forensic Sci Int Genet 58:102684. https:// org/10.1016/j.fsigss.2017.09.089
doi.org/10.1016/j.fsigen.2022.102684 21. Applied Biosystems (2014) GlobalFiler™
12. Watherston J, McNevin D, Gahan ME et al Express PCR Amplification Kit user guide,
(2018) Current and emerging tools for the revision G. Available via Thermo Fisher Scien-
recovery of genetic information from post mor- tific. https://assets.thermofisher.com/TFS-
tem samples: new directions for disaster victim Assets/LSG/manuals/4477672_
identification. Forensic Sci Int Genet 37:270– GlobalFilerExpress_UG.pdf. Accessed
282. https://doi.org/10.1016/j.fsigen.2018. 21 Apr 2022
08.016 22. Applied Biosystems (2018) AmpFlSTR™
13. Holland M, Wendt F (2015) Evaluation of the Identifiler™ Direct PCR Amplification Kit
RapidHIT™ 200, an automated human iden- user guide, revision K. Available via Thermo
tification system for STR analysis of single Fisher Scientific. https://assets.thermofisher.
source samples. Forensic Sci Int Genet 14:76– com/TFS-Assets/LSG/manuals/cms_0
85. https://doi.org/10.1016/j.fsigen.2014. 65522.pdf. Accessed 21 Apr 2022
08.010 23. Romsos E, Vallone P (2015) Rapid PCR of
STR markers: applications to human
396 Megan M. Foley

identification. Forensic Sci Int Genet 18:90– Forensic Sci Int Genet 6:167–175. https://
99. https://doi.org/10.1016/j.fsigen.2015. doi.org/10.1016/j.fsigen.2011.03.014
04.008 28. Yang Y, Kim J, Song Y et al (2007) A novel
24. Kermekchiev M, Kirilova L, Vail E et al (2009) buffer system, AnyDirect, can improve poly-
Mutants of Taq DNA polymerase resistant to merase chain reaction from whole blood with-
PCR inhibitors allow DNA amplification from out DNA isolation. Clin Chim Acta 380:112–
whole blood and crude soil samples. Nucleic 117. https://doi.org/10.1016/j.cca.2007.
Acids Res 37(5):e40. https://doi.org/10. 01.019
1093/nar/gkn1055 29. Bu Y, Huang H, Zhou G (2008) Direct poly-
25. Spitaleri S, Piscitello D, di Martino D et al merase chain reaction (PCR) from human
(2004) Experimental procedures comparing whole blood and filter-paper-dried blood by
the activity of different Taq polymerases. using a PCR buffer with a higher pH. Anal
Forensic Sci Int 146S:S167–S169. https:// Biochem 375:370–372. https://doi.org/10.
doi.org/10.1016/j.forsciint.2004.09.051 1016/j.ab.2008.01.010
26. Butler J (2012) Advanced topics in forensic 30. Applied Biosystems (2015) AmpFlSTR® NGM
DNA typing: methodology. Academic Press SElect™ PCR Amplification Kit, revision
Elsevier, Waltham, MA F. Available via Thermo Fisher Scientific.
27. Verheij S, Harteveld J, Sijen T (2012) A proto- https://tools.thermofisher.com/content/sfs/
col for direct and rapid multiplex PCR amplifi- manuals/cms_089008.pdf. Accessed
cation on forensically relevant samples. 21 Apr 2022
 Chapter 24

Next-Generation Sequencing: ForenSeq™ DNA Signature

Prep Kit with the Illumina MiSeq FGx
Megan M. Foley

Abstract
Sequencing forensic DNA samples that are amplified and prepared with the ForenSeq™ DNA Signature
Prep Kit allows for the simultaneous targeting of forensically relevant STR and SNP markers. The MiSeq™
FGx system allows massively parallel sequencing of these markers in a single analysis. The library preparation
targets autosomal, Y-, and X-STRs, as well as identity SNPs. The kit can also be used to generate
investigative information regarding the DNA contributor by analyzing phenotypic SNPs to predict hair
color, eye color, and ancestry SNPs.
Through two rounds of amplification, all loci are amplified and tagged with individualizing barcodes for
sequencing capture and identification. Using bead-based technology, the libraries are purified by the
removal of left-over amplification reagents and then normalized to ensure equal representation of all
samples during sequencing. The individual libraries are then pooled for insertion into the MiSeq FGx.
The pooled libraries are then added to a pre-packaged cartridge that contains all reagents necessary for
optimal sequencing. Libraries are captured on a flow cell and undergo bridge amplification for the
generation of individual clusters. Sequencing of each cluster is performed using a Sequence-By-Synthesis
technology. The following chapter describes the methodology and process of library preparation of samples
using the ForenSeq™ DNA Signature Prep Kit Primer Set A and B. Once completed, the chapter then
focuses on the setup of a sequencing run on the MiSeq FGx and the sequencing methodology employed by
the instrument.

Key words ForenSeq™ DNA Signature Prep Kit, MiSeq FGx, Forensic DNA Sequencing, Next
Generation Sequencing, Massively Parallel Sequencing, STR Sequencing, SNP Analysis, Phenotypic
SNPs, Ancestry SNPs

1 Introduction

1.1 Background Verogen’s ForenSeq™ DNA Signature Prep Kit is one of the first
commercial sequencing assays manufactured for forensic purposes
[1, 2]. In tandem with the Illumina MiSeq™ FGx instrument, this
system allows for enhanced multiplexing capabilities by utilizing
massively parallel sequencing (MPS) for common forensic short
tandem repeats (STRs) and a variety of single nucleotide poly-
morphisms (SNPs) for analysis of crime scene and reference

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6_24,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

397
398 Megan M. Foley

Table 1
Primer Set A and Primer Set B locus specifications

STRs SNPs

Genetic marker type Autosomal Y X Identity Ancestral Phenotypic

Primer Set A 27 24 7 94 – –
Primer Set B 27 24 7 94 56 22
Displayed is a breakdown of the number of genetic loci per target type in the Primer Set A and Primer Set B options. Two
SNPs are common between the ancestral and phenotypic groupings

samples. Two separate data sets can be generated based on the

sample type or a laboratory’s preference. Primer Set A can be used
for identity or kinship purposes. A total of 58 STRs are targeted,
including autosomal (including Amelogenin), Y-, and X-STRs; and
a total of 94 identity SNPs. Primer Set B is an alternative to set A
that can be used for identity purposes—using the same 152 markers
as Set A—and to generate possible investigative leads based on
predicted phenotypic features, including hair and eye color, as
well as predicted ancestral features, using an additional 78 SNPs
(see Tables 1 and 2) [1–4].
The Verogen system allows for a large increase in the amount of
genetic information that can be gathered from a forensic or refer-
ence sample compared to the typical genetic profile generated from
a megaplex STR kit designed for capillary electrophoresis (CE)
detection. Through current CE procedures, the fragment size of
the STR repeat is reported and utilized for analysis. Sequencing
allows forensic analysts to observe and utilize the entire sequence of
the STR repeat, which allows for the identification of isoalleles.
Isoalleles can be observed when two fragments of DNA have the
same length but are different in sequence. Current CE methods are
unable to detect this sequence variation, making isoalleles indistin-
guishable from one another on that detection platform. Addition-
ally, through the identification of isoalleles, it is possible to separate
out stutter fragments that are the same length as minor contribu-
tors with differing sequences. Following current analysis and inter-
pretation methods, stutter filter percentages and peak height ratios
only indicate the possible stacking of stutter peaks with low level
contributors. Sequencing can allow for further verification of this
occurrence in a profile, which allows for more accurate DNA inter-
pretation when deducing mixtures or comparing a reference to a
mixture profile [2]. Although not currently used for forensic case-
work purposes, the ForenSeq™ kit also has the ability to sequence
flanking regions for identity or comparison purposes in the future,
which also can add additional variability to a profile [5]. Additional
benefits of the kit include the ability to sequence the above-
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 399

Table 2
ForenSeq™ Signature Prep Kit targeted loci

DNA target List of loci

Autosomal STR D1S1656, TPOX, D2S441, D2S1338, D3S1358, D4S2408, FGA, D5S818,
loci CSF1PO, D6S1043, D7S8201, D8S1179, D9S1122D10S1248, TH01, vWA,
D12S391, D13S317, Penta E, D16S539, D17S1301, D18S51, D19S433,
D20S482, D21S11, Penta D, D22S10452
Y-STR loci DYF387S1, DYS19, DYS385a-b, DYS389I, DYS389II, DYS390, DYS391, DYS392,
DYS437, DYS438, DYS439, DYS448, DYS460, DYS481, DYS505, DYS522,
DYS533, DYS549, DYS570, DYS576, DYS612, DYS635, DYS643, Y-GATA-H4
X-STR loci DXS10074, DXS10103, DXS10135, DXS7132, DXS7423, DXS8378, HPRTB
Identity SNPs rs10495407, rs1294331, rs1413212, rs1490413, rs560681, rs891700, rs1109037,
rs12997453, rs876724, rs907100, rs993934, rs1355366, rs1357617, rs2399332,
rs4364205, rs6444724, rs1979255, rs2046361, rs279844, rs6811238,
rs13182883, rs159606, rs251934, rs338882, rs717302, rs13218440, rs1336071,
rs214955, rs727811, rs321198, rs6955448, rs737681, rs917118, rs10092491,
rs2056277, rs4606077, rs763869, rs1015250, rs10776839, rs1360288,
rs1463729, rs7041158, rs3780962, rs735155, rs740598, rs826472, rs964681,
rs10488710, rs1498553, rs2076848, rs901398, rs10773760, rs2107612,
rs2111980, rs2269355, rs2920816, rs1058083, rs1335873, rs1886510,
rs354439, rs1454361, rs4530059, rs722290, rs873196, rs1528460, rs1821380,
rs8037429, rs1382387, rs2342747, rs430046, rs729172, rs740910, rs8078417,
rs938283, rs9905977, rs1024116, rs1493232, rs1736442, rs9951171, rs576261,
rs719366, rs1005533, rs1031825, rs1523537, rs445251, rs221956, rs2830795,
rs2831700, rs722098, rs914165, rs1028528, rs2040411, rs733164, rs987640
Ancestral SNPs rs2814778, rs3737576, rs7554936, rs10497191, rs1834619, rs1876482, rs260690,
rs3827760, rs6754311, rs798443, rs12498138, rs1919550, rs1229984,
rs3811801, rs4833103, rs7657799, rs7722456, rs870347, rs16891982,
rs192655, rs3823159, rs917115, rs1462906, rs1871534, rs2196051, rs6990312,
rs3814134, rs4918664, rs1079597, rs174570, rs2238151, rs671, rs1572018,
rs2166624, rs7326934, rs7997709, rs9522149, rs200354, rs12439433,
rs1426654, rs1800414, rs735480, rs12913832, rs459920, rs11652805,
rs17642714, rs2593595, rs4411548, rs4471745, rs2042762, rs3916235,
rs4891825, rs7226659, rs7251928, rs310644, rs2024566
Phenotypic rs28777, rs12203592, rs4959270, rs683, rs1042602, rs1393350, rs12821256,
SNPs rs12896399, rs2402130, rs1800407, N29insA, rs1110400, rs11547464,
rs1805005, rs1805006, rs1805007, rs1805008, rs1805009,
rs201326893_Y152OCH, rs2228479, rs885479, rs2378249
All loci targeted by either Primer Set A and/or B are broken down by DNA target type [1]

mentioned markers in one analysis, which would require more

time, money, analyses, and sample volume to perform on the CE
[6]. Also, because of the decreased size of the STR fragments, and
especially because of the minimal sizes of the identity SNP markers,
more information can be gathered from a degraded sample [2, 7–
10].
400 Megan M. Foley

1.2 Library Sample types that can be processed using the ForenSeq™ kit
Preparation Using the include purified extracts that have been previously extracted and
ForenSeq™ DNA quantified, crude lysates that have undergone a direct quantifica-
Signature Prep Kit tion process, and FTA® Card punches. The procedure includes two
amplification steps, a bead-based purification step, a bead-based
normalization step, and pooled library preparation for sequencing.
Altogether, it takes around 9 h total of processing and hands on
time. The first round of amplification is similar to CE-based proce-
dures and targets the STRs and SNPs to be sequenced utilizing
oligonucleotide primers that surround the targeted DNA sequence.
The primers contain forward and reverse tags to identify the ampli-
fied strands in later processes. The second round of amplification
additionally enhances these targets and adds indexed adapters to
each sequence that are complementary to the tag sequence added
to the DNA fragments during Amplification 1 [1].
Later in the process, the samples and controls are combined into
one tube as a pooled library. In order to separate out the sequenced
fragments, each sample needs to be uniquely labeled. The reaction for
Amplification 2 includes the addition of two indices, Index 1 (i7) and
Index 2 (i5). Each index fragment contains two parts: a unique index
sequence and a common adapter sequence. The indices are utilized to
provide a unique combination of various i7 and i5 index pairings for
each sample and allow for the sample multiplexing capacity that
sequencing allows. Each index is made up of a unique combination
of eight base pairs. The specific indices link with the sample name
during run setup and act as a unique barcode, which allows the
instrument to identify which sequences belong to each sample and
separate data that belongs to that specific sample. The adapter
sequences (120 bp) are identical on each fragment, regardless of the
index portion of the tag, and are utilized for capture purposes for
sequencing on the flow cell. The unique combination and the sample
name are imported into the sequencing instrument for bioinformatics
purposes (see Fig. 1) [1, 11].
After the second amplification step, samples need to be purified
in order to remove any leftover amplification reagents that interfere
with sequencing (e.g., leftover nucleotides, primers, etc.). The
purification step utilizes magnetic beads that attract and bind to
the DNA. The beads are removed from the solution through the
use of a magnetic stand, leaving the DNA-free supernatant and any
leftover reagents, which are subsequently removed and discarded.
The beads are then washed twice utilizing an ethanol-based wash
procedure in order to ensure a pure sample. After the wash steps
have been performed and all residual ethanol is removed, a resus-
pension buffer is added to the samples that release the DNA from
the magnetic beads, releasing it back into the solution. The mag-
netic stand can be used once again to draw the beads to the side, but
this time the supernatant containing the DNA can be removed and
further processed [1].
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 401

Fig. 1 A representation of products from Amplification 1 and 2. The amplicon from Amplification 1 contains the
amplified STR sequence (dark blue), flanking regions (green), forward and reverse primers (yellow), and the
forward and reverse primer tags (orange for i5 and purple for i7). Amplification 2 includes the addition of i5 and
i7 Index/Adapter strands. The i5 indices start with a region complementary to the forward primer tag and the i7
indices start with a region complementary to the reverse primer tag and binds (orange for i5 and purple for i7).
The next section will contain the unique sequence specific to the index added to the sample (blue). Lastly, the
indices have an i5 and i7 adapter sequence that is complementary to a stationary oligonucleotide on the flow
cell and binds during sequencing

This library preparation procedure does not require the quan-

tification of individual libraries but instead utilizes a DNA concen-
tration normalization step with beads. Similar to the purification
step, magnetic beads are added at equal concentrations, initially
attracting and binding DNA. The beads for this step have a binding
capacity, which limits the amount of sample added to the flow cell
for sequencing. This is to create a pool of equally represented
samples by limiting the amount of DNA library for larger quantity
samples so that they do not overshadow any lower-level samples.
The washing procedure is performed twice and utilizes a mixture
that includes formamide and 2-mercaptoethanol (aka
β-mercaptoethanol) [12]. A resuspension reagent is added to
remove the DNA from the beads and the DNA is released back
into solution. The liquid containing the DNA is removed for the
next step [1].
The last step before preparing the sample for processing is the
pooling of the libraries for sequencing. The number of samples that
can be processed on one flow cell depends on the primer set used
and the size of the flow cell (see Table 8) [1, 13]. Verogen manu-
factures two flow cell types that can be utilized in conjunction with
the ForenSeq™ kit: the Standard Flow Cell and the Micro Flow
Cell. All reagents are identical between the two flow cell kits and
both perform a total of 600 sequencing cycles. The standard flow
cell allows for more samples to be processed at once (up to 96 sam-
ples from Primer Set A or 32 samples from Primer Set B) and takes
around 30 h because of the increase in fluorescence imaging time.
The micro flow cell is best for laboratories that do not intend to
have a large amount of samples processed using sequencing (up to
402 Megan M. Foley

36 samples from Primer Set A or 12 samples from Primer Set B),

which allows for decreased processing time (reduced by ~6 h) and a
decrease in cost per sample [13].
To prepare the pooled libraries for sequencing, it must first
undergo a denaturation process similar to CE-based methods.
The pooled libraries are first diluted out in a hybridization buffer.
At this stage, a sequencing control is added that is used by the
instrument’s software for quality checks and can be used to deter-
mine if the run was successful or may contain errors. Denaturation
of DNA occurs through a heating process and a snap-cool proce-
dure. Once this process is complete, the sample can be loaded into a
sequencing reagent cartridge and loaded into the instrument. Each
cartridge is single use and contains all necessary reagents required
for cluster generation [1, 11].

1.3 Sequencing on Sequencing on the Illumina MiSeq FGx™ occurs on a glass flow
the MiSeq FGx™ cell and can be broken down into multiple stages. The first is
bridge-amplification to form amplified clusters. The flow cell con-
tains oligonucleotides bound to the bottom. These oligonucleo-
tides are complementary to the adapters that are attached to each
DNA fragment during the index/adapter addition in Amplification
2. Each fragment binds to the flow cell through these adapters. The
adapter on the reverse side of the fragment bends over and binds to
an additional oligonucleotide. All DNA fragments are now bound
at both ends and forms an upside-down U shape or a “bridge.”
Polymerase enzymes and nucleotides are flushed through the flow
cell. Through the addition of a primer, each strand is replicated.
One adapter on each fragment (the template and the new amplified
strand) will be released and two identical strands are present. Dur-
ing the next cycle, both strands bend over to form a new bridge and
the amplification repeats. This occurs over and over again until
individual clusters of each amplified product are formed. Each
cluster contains 1000+ of copies of one DNA target for one unique
amplicon. Since we have undergone multiple rounds of amplifica-
tion, we expect each unique DNA target to be present in multiple
clusters, which allows for optimal sequencing reads and results
[11].
Next, the amplified clusters are sequenced through a process
called “Sequencing-By-Synthesis” or SBS. A new primer attaches to
each fragment that is once again complementary to the adapter.
The instrument floods the flow cell with a mixture of all four
dideoxynucleotides that are fluorescently labeled with different
molecules based on nucleotide. A blocking agent present
will restrict the addition of another nucleotide to the growing
strand, which allows detection of stretches of the same nucleotide.
The instrument then uses an imaging system to capture the fluo-
rescence of the dye. The wavelength that is captured by the system
indicates which nucleotide has been added. The imaging process
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 403

uses various combinations of LED and filters and occurs multiple

times during each cycle. A flow cell is broken up into different
imaging sections, or tiles, and each tile is imaged separately. The
standard flow cell is made up of 19 tiles, while the micro flow cell
has eight, leading to a decrease in processing time by ~6 h
[11, 13]. A deblocking agent is then flooded over the flow cell to
expose the previously attached nucleotide for the next base pair
addition. This occurs over and over until both indices, the flanking
region, the forward and reverse tags, and target regions have been
sequenced. After image analysis, the software performs a series of
bioinformatic analyses that includes base calling, filtering, and cal-
culating a quality score for each strand. Further analysis on the
genotypes is performed in the ForenSeq™ Universal Analysis Soft-
ware for forensic analysis [11, 14].

2 Materials

For pipetting reagents and samples, utilize aerosol-barrier pipette

tips. Any plastics utilized should be RNase/DNase free (microcen-
trifuge tubes, conical tubes, reagent reservoirs, etc.). The tempera-
ture ranges for storage indicated for each reagent include:
refrigerator (2 to 8 °C), freezer (-25 to -15 °C), and room
temperature (15 to 30 °C).

2.1 Library 1. Sample sources: acceptable types of samples for this assay
Preparation include purified DNA, crude lysate, or blood/saliva on FTA®
Cards (see Note 1).
2. Pipettes: multi-channel [8], single channel, and repeater pip-
ettes, plus corresponding tips (see Note 2).
3. PCR tubes: 8-tube strips and caps.
4. 96-well 0.3 mL skirted or semi-skirted PCR plates.
5. 96-well storage plates: round well, 0.8 mL; also referred to as a
“midi plate.”
6. Disposable reagent reservoirs for multi-channel pipettes.
7. Microseal “A” film (see Note 3).
8. Microseal “B” adhesive seals (see Notes 3).
9. Index Adapter Replacement Caps.
10. 200 proof (absolute) ethanol: molecular-biology grade.
11. Water: nuclease-free, molecular-biology grade.
12. FTA® Card extraction buffer (see Notes 4 and 5).
13. 1X Tris-Borate-EDTA (TBE) buffer (see Note 4).
14. ForenSeq™ DNA Signature Prep Kit: available as a 96 or
384 reaction kit.
404 Megan M. Foley

15. ForenSeq™ DNA Signature Prep Kit—Pre-Amplification

1 Reagents: contains 2800M Control DNA, DNA Primer
Mix A (DPMA), DNA Primer Mix B (DPMB), Enzyme Mix
(FEM), and PCR1 Reaction Mix (PCR1). Store all compo-
nents in a freezer upon receipt. 2800M Control DNA can be
stored in a refrigerator after the first use.
16. ForenSeq™ DNA Signature Prep Kit—Pre-Amplification
2 Reagents: contains PCR2 Reaction Mix, i7 index orange
capped tubes (12 total), i5 index white capped tubes
(8 total), and additional i7/i5 index tube caps. Store all com-
ponents in a freezer upon receipt, except the additional
tube caps.
17. ForenSeq™ DNA Signature Prep Kit—Purification Reagents:
contains Resuspension Buffer (RSB) and Sample Purification
Beads (SPB). Store all components in a refrigerator upon
receipt.
18. ForenSeq™ DNA Signature Prep Kit—Normalization
Reagents: contains HP3 (2 N NaOH), Library Normalization
Additives 1 (LNA1), Library Normalization Beads 1 (LNB1),
Library Normalization Storage Buffer 2 (LNS2), and Library
Normalization Wash 1 (LNW1) (see Note 6). Store all compo-
nents in a freezer upon receipt. LNB1, LNS2, and LNW1 can
be stored in a refrigerator after the first use.
19. ForenSeq™ DNA Signature Prep Kit—Denaturation/Dilute
Reagents: contains Human Sequencing Control (HSC) and
MiSeq FGx™ Reagent Kit (Hybridization Buffer (HT1) and
Reagent Cartridge). Store all components in a freezer upon
receipt.
20. Plate seal applicator.
21. 1.2 mm FTA® Card punching tool (see Note 4).
22. 96-well plate base (see Note 7).
23. ForenSeq™ Index Plate Fixture.
24. Magnetic stand (see Note 8).
25. 1.5 mL tube benchtop cooler.
26. 1.5 mL 96-well micro-heating system/heat block.
27. High-speed thermal mixers (see Note 9).
28. 96-well thermal cycler: must be approved by Verogen (see
Table 4).
29. 96-well plate shaker (see Note 9).

2.2 Sequencing 1. MiSeq disposable wash tubes.

Specific Materials 2. Water: nuclease-free, molecular-biology grade.
3. 6% Sodium Hypochlorite.
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 405

4. MiSeq FGx Reagent Kit: This 380-cycle kit comes in two

sizes—standard and micro. The standard kit can process
96 samples with Primer Set A and 32 samples with Primer Set
B; the micro kit can process 36 samples with Primer Set A and
12 samples with Primer Set B. Each kit contains Hybridization
Buffer (HT1), Reagent Cartridges, Flow Cell Containers, and
SBS Solution (PR2); the first two components are stored in the
freezer, while the latter two are stored refrigerated.
5. 1.5 mL tube benchtop cooler.
6. Large volume repeat pipettor (>5 mL) and appropriate tips.

3 Methods

The complete NGS process is a very lengthy procedure; be sure to

allot ample time for each portion of the assay (see Table 3). Before
beginning each section of the method, ensure that all reagents are
within expiration and that all necessary equipment and/or con-
sumables are stocked. Prepare all worksheets with appropriate
information (e.g., sample names, assigned index adapters, extract
volumes needed, master mix calculations, etc.). Any extraction

Table 3
Time and storage conditions following each step of the NGS process

Total time to Hands-

Process complete on time Okay to pause after completion?
Amplification 1: amplification 3 h 35 min 15 min Yes, amplification product can be stored at
and tagging of loci targets 2–8 °C for up to 2 days.
Amplification 2: enrichment of 1 h 30 min 10 min Yes, amplification product can be stored at
targets 2–8 °C for up to 7 days.
Sample purification 30 min 15 min Yes, purified samples can be stored at -25
to -15 °C for up to 1 year.
Sample normalization 1 h 20 min 30 min Yes, normalized samples can be stored at
-25 to -15 °C for up to 30 days.
Pooling of sample libraries 10 min 10 min Yes, pooled samples can be stored at -25
to -15 °C for up to 30 days.
Denaturation and dilution of 10 min 10 min No, immediately proceed to instrument
pooled libraries setup and performing a run.
Instrument setup and performing 10 min 10 min N/A
a run
The overall process of next-generation sequencing is lengthy. The entire process can be completed in one day or it can be
broken up into smaller sections. This table outlines where natural breaks occur, whether the process can be paused after
these individual steps, and if so, how to store the samples before proceeding. If pausing after a step that leaves the samples
in a 96-well format, ensure that the plate is securely sealed with a Microseal “B” or cap strips
406 Megan M. Foley

controls should be processed alongside samples. A sequencing

amplification positive and negative control should be prepared.
Additionally, a sequencing control should be added when sequenc-
ing the samples. Batch samples with similar primer targets and
sample type (i.e., reference samples, high quality reference-like
samples, and low quantity samples).
While performing each section, it is crucial to avoid chances of
contamination and decrease pipetting variability between samples.
Pipette tips should be aerosol-resistant and should be changed
between reagents, samples, and rows/columns if using a multi-
channel pipette. With each aspiration using a multi-channel pipette,
ensure that equal volumes of liquid are present in each tip, since
some variability can exist between the channels. Additionally,
reagents and consumables for Amplification 1 should be stored in
pre-amplification (pre-amp) work areas. Preparation for Amplifica-
tion 1 should also be performed in pre-amp; all other subsequent
steps should be performed in post-amplification (post-amp) work
areas to prevent contamination of pre-amp areas.

3.1 Library 1. Thaw all necessary Amplification 1 reagents to room tempera-

Preparation—Amplifi- ture (~30 min for the 2800M standard) (see Note 10).
cation 1: Amplification 2. Label a 96-well plate “FSP” for ForenSeq™ Sample Plate (see
and Tagging of Loci Notes 11 and 12).
Targets 3. Create a thermal cycler program for Amplification 1 (see
Tables 4 and 5). The total amplification time is ~3.5 h.

Table 4
Verogen recommended thermal cyclers and amplification settings

Ramp mode for Lid temperature Temperature

Thermal cycler amp 1 and 2 settings mode settings Other notes
Veriti™ 96-well 4% Heated at a constant Standard
Thermal Cycler temp of 105 °C
ProFlex™ 96-well 0.2 °C per second Heated at a constant None Provided
PCR System temp of 105 °C
GeneAmp PCR 8% Heated 9600 emulation Only supports
System 9700a gold heat block
Bio-Rad 4% Heated at a constant Calculated
temp of 100 °C
Eppendorf® 2% Heated Gradient S,
Mastercycler® Simulated tube
Pro S
Verify that ramp mode and temperature settings match the listed thermal cycler type. All thermal cyclers allow for plates
and tubes made of polypropylene, except the Eppendorf® Mastercycler® Pro S, which only allows for plates
a
Also referred to as the ABI LTI Thermal Cycler 9700
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 407

Table 5
Amplification 1 and 2 thermal cycler parameters

Step Amplification 1 Amplification 2

Preheat lid option 100 °C 100 °C
Initial heat 98 °C for 3 min 98 °C for 30 s
PCR cycling 8 cycles of: 15 cycles of:
96 °C for 45 s 98 °C for 20 s
80 °C for 30 s 66 °C for 30 s
54 °C for 2 min* 68 °C for 90 s*
68 °C for 2 min*
PCR cycling 10 cycles of:
96 °C for 30 s
68 °C for 3 min*
Final extension 68 °C for 10 min 68 °C for 10 min
Indefinite hold 10 °C 10 °C
Each step is broken down into temperature, duration, and cycle numbers. For steps
marked with an “*”, ensure the ramping mode chosen is the appropriate mode for the
thermal cycler based on Table 4

Amplification 1 can be run during the day or overnight

depending on the workflow of the laboratory.
4. Prepare the samples for purified DNA extracts (see Subheading
3.1, step 5) or FTA® Cards (see Subheading 3.1, steps 6–8).
Crude lysate samples do not require additional preparation.
5. For purified DNA, the manufacturer recommends a total of
1 ng in 5 μL total human DNA for optimal sequencing results
(see Note 1). Using the quantitation values in ng/μL, calculate
the appropriate volume of extract and nuclease-free water
required to create a dilution with a final concentration of
0.2 ng/μL (see Note 13). These prepared samples will be
added to the amplification plate after the master mix has been
dispensed (see Subheading 3.1, step 15). Proceed to prepare
the positive control (see Subheading 3.1, step 9).
6. For FTA® Card samples, use a single 1.2 mm punch of the
dried stain from the card, ensuring to follow laboratories
decontamination procedures after each punch is taken.
7. Aliquot 100 μL 1X TBE buffer to each well. Seal the plate with
Microseal “B” or cap strips. Place the 96-well plate on an
appropriately sized rack and shake for 2 min at 1800 rpm.
8. Centrifuge the plate using a plate spinner for 30 s at 1000 × g.
Carefully remove the seal or caps. Remove and discard all
supernatant using a 100 μL multi-channel pipette.
408 Megan M. Foley

Table 6
Composition of Amplification 1 reaction for various sample types for library preparation

FTA® Cards

Component Purified DNA Crude lysate Samples Controls

®
DNA input 5.0 μL (1 ng) 2.0 μL FTA punch 5.0 μL (1 ng)
Master mix total 10.0 μL 13.0 μL 15.0 μL 10.0 μL
PCR1 4.7 μL 4.7 μL 4.7 μL 4.7 μL
FEM 0.3 μL 0.3 μL 0.3 μL 0.3 μL
DPMA or DPMB 5.0 μL 5.0 μL 5.0 μL 5.0 μL
Nuclease-free water – 3.0 μL 5.0 μL –
Total reaction volume 15.0 μL 15.0 μL 15.0 μL 15.0 μL
The composition of the Amplification 1 PCR reaction varies slightly based upon the sample type being processed, but the
overall reaction volume for all is 15 μL, with a target of 1 ng of DNA for purified DNA and the positive amplification
control

9. Similar to purified DNA samples, 1 ng of DNA is targeted for

the amplification of the positive control, but the volume allot-
ted is dependent on the type of sample being processed (see
Table 6). To prepare the positive control, begin by vortexing
and pulse spinning the 2800M Control DNA. If processing
purified DNA and/or FTA® Card samples, dilute 2800M with
nuclease-free water to a final concentration of 0.2 ng/μL. If
processing crude lysate, dilute 2800M to 0.5 ng/μL. The
diluted 2800M positive control will be added to the amplifica-
tion plate after the master mix has been dispensed (see Sub-
heading 3.1, step 15).
10. The composition of the amplification master mix depends on
the type of sample being processed (see Table 6). The volume
needed for each component should be multiplied by the total
number of samples and controls (including extraction reagent
blanks, as well as a positive and negative amplification control),
plus an additional 10% for pipetting error (see Notes 14–16).
11. Label an appropriately sized microcentrifuge tube (e.g.,
1.5 mL or 2.0 mL) as “Master Mix.”
12. Before pipetting PCR1 or DPMA/B, be sure to vortex these
tubes and pulse spin them to remove any liquid from the cap.
Do not vortex FEM, which is unstable. Instead, using a 100 μL
pipette, pipette the liquid up and down gently to mix before
adding the appropriate amount into the master mix.
13. Once all components have been added, pipette the master mix
to mix and pulse spin to remove any liquid from the cap.
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 409

14. Add the appropriate master mix volume per well based on the
sample type (see Table 6). Depending on the capabilities of the
lab, the master mix can be distributed into each well multiple
ways (see Note 17).
15. Next, add prepared purified DNA samples (see Subheading 3.1,
step 5) and/or crude lysate samples (if processing), as well as
the amplifications controls, to the corresponding wells of the
96-well plate already containing master mix; if processing
FTA® punches, these should already have been added (see
Subheading 3.1, steps 6–8). Use nuclease-free water for the
amplification negative control. Vortex and pulse spin all sam-
ples/controls before aliquoting. Specific volumes to be added
for each are dependent on the sample type being processed (see
Table 6). Once added, flush the tip to mix (see Note 18).
16. Seal the plate with a Microseal “A” using a plate seal applicator
or cap strips for amplification (see Note 19). For fewer samples,
cap strips can be utilized or Microseal “A” strips can be cut to
fit the plate. Microseal “B” seals should not be used during
thermal cycling.
17. Using a plate centrifuge, spin the plate for 30 s at around
1000 × g.
18. Transfer the plate to the post-amplification area and run the
pre-programmed amplification as defined for Amplification
1 (see Table 5).
19. The plate can be left on the thermal cycler overnight. The
expiration of the plate is 2 days. It can be processed immedi-
ately for the second amplification (see Subheading 3.2, step 1)
or stored in a refrigerator (2–8 °C) until ready to proceed. If
storing, remove Microseal “A” and replace with a Microseal
“B” or strip caps. Microseal “B” or strips can be cut to fit the
plate.

3.2 Library 1. Thaw all necessary Amplification 2 reagents to room tempera-

Preparation—Amplifi- ture (~20 min for the adapters) (see Note 10).
cation 2: Enrichment of 2. Remove the FSP plate from the thermal cycler or refrigerator
Targets— (if stored) (see Subheading 3.1, step 19) and allow to come to
Amplification and room temperature. Cross out any labeling on the plate to
Attachment of Indices ensure no confusion and relabel the plate as “FSP2” for Fore-
nSeq™ Sample Plate Amplification 2 (see Notes 11 and 12).
3. Create a thermal cycler program for Amplification 2 (see Table 4
and Table 5). The total amplification time is ~1 h. Amplifica-
tion 2 can be run during the day or overnight depending on the
workflow of the laboratory.
4. Centrifuge the FSP2 plate for 30 s at 1000 × g to remove any
liquid that has gathered on the seal or caps.
410 Megan M. Foley

5. To set up the ForenSeq™ Index Plate Fixture, begin by vortex-

ing and pulse spinning the Index 1 (i7) and Index 2 (i5) tubes
(see Note 20).
6. Place the i7 tubes (orange caps) within the appropriate column
holders (1–12 of a 96-well plate) of the plate fixture and the i5
(white caps) within the appropriate column holders (A–H of a
96-well plate) of the plate fixture (see Notes 21 and 22).
7. Gently unscrew each of the i7 caps to the point where it can just
be lifted off but do not remove.
8. Place the FSP2 plate in the center of the plate fixture (see Note
23). Carefully remove and discard the seal or cap strips.
9. Once all index tube caps are unscrewed, remove and discard the
i7 caps (orange). To decrease the chance of contamination,
start on one side of the plate to remove the caps and work
across the row without reaching over an open tube or plate.
10. Aspirate 4 μL Index 1 (orange i7) into each row using a multi-
channel pipette. Check all tips after drawing up the liquid to
ensure that equal volumes are present before adding to the
wells. Pipette into the bottom of the well. Dispose of the
used tips with every row. Cap each i7 tube with a new orange
cap (see Note 24). Check that each well has a yellow tint (due
to the i7 index reagent) and appears to contain the same
volume, which can be viewed through the bottom of the plate.
11. Gently unscrew, remove, and discard the i5 caps (white). To
decrease the chance of contamination, start on one side of the
plate to remove the caps and work across the row without
reaching over an open tube or plate.
12. Aliquot 4 μL Index 2 (white i5) into each column using a
multi-channel pipette. Check all tips after drawing up the
liquid to ensure that equal volumes are present before adding
to the wells. Pipette into the bottom of the wells. Dispose of
the used tips with every column. Cap each i5 tube with a new
white cap (see Note 24). Looking at the underside/bottom of
the plate, check that each well appears to contain the same
volume.
13. Vortex and pulse spin PCR2. Aliquot 27 μL into each well
using a separate pipette tip for each sample (see Note 25).
14. Seal the plate with a Microseal “A” using a plate seal applicator
or cap strip for amplification (see Note 19).
15. Using a plate centrifuge, spin the plate for 30 s at around
1000 × g.
16. Amplify the plate using the pre-programmed amplification as
defined for Amplification 2 (see Table 5).
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 411

17. The plate can be left on the thermal cycler overnight. The
expiration of the plate is 7 days. It can be processed immedi-
ately to purify the samples (see Subheading 3.3, step 1) or
stored in a refrigerator (2–8 °C) until ready to proceed. If
storing, remove Microseal “A” and replace with a Microseal
“B” or cap strips.

3.3 Library 1. Thaw all necessary Purification Reagents to room temperature

Preparation—Sample (~30 min for both SPB and RSB). Make sure to allow sufficient
Purification—Removal time before beginning to allow all contents to thaw and reso-
of Left-over lubilize (see Note 10).
Amplification 2. Remove the FSP2 plate from the thermal cycler or refrigerator
Reagents (if stored) (see Subheading 3.2, step 17) and allow to come to
room temperature.
3. Label a new midi plate “PBP” for Purification Bead Plate (see
Note 12).
4. To prepare the Sample Purification Beads (SPB) and midi plate,
begin by vortexing the beads thoroughly (see Note 26). When
pipetting, aspirate and dispense gently to ensure the appropri-
ate amount of beads are drawn up/dispensed (see Note 27).
5. Calculate the volume of SPB based on the number of samples/
controls being processed (see Table 7). Vortex frequently to
ensure equal distribution of beads. Pipette 45 μL into each well
of the PBP midi plate with a single channel or multi-channel.
Ensure that the liquid is dispensed directly into the bottom of
the well with no liquid on the side.

Table 7
Volume of SPB needed for sample purification

# Samples/
controls Volume of SPB (μL) Comments
<16 # samples/controls × Use a single-channel pipette to add SPB to each well of the PBP
50 midi plate
16–96 (# samples/controls To help facilitate transfer of SPB to the individual wells of the PBP
× 50) + 5 mid plate, equally divide the volume of SPB into a column of
8 wells of a new midi plate or into an empty column of the midi
plate being used (if applicable). Or the entire volume of SPB can
be added to a reagent reservoir. Use a multi-channel pipette to
transfer the SPB to the wells of the PBP midi plate
>96 (# samples/controls Add the entire volume of SPB to a reagent reservoir and then use a
× 50) + 200 multi-channel pipette to transfer to the wells of the PBP midi
plate
It is essential that the correct volume of SPB is added to each sample during the sample purification process. As with many
routine laboratory procedures, additional reagent should be included in the aliquot to account for pipetting error, and in
this case, the mode of delivery to the samples (e.g., single-channel vs multi-channel pipette with reagent reservoir) also
impacts how much overrage to include. This table serves as a guide for the amount of SPB overrage likely needed for this
procedural step but should be adjusted as needed for individual practice
412 Megan M. Foley

6. Centrifuge the FSP2 plate for 30 s at 1000 × g to remove any

condensation from the seal or caps.
7. Using a multi-channel pipette, transfer 45 μL of each sample/
control from the FSP2 plate to the corresponding wells of the
PBP midi plate. Ensure that the liquid is dispensed directly into
the bottom of the well with no liquid on the side (see Note 28).
The FSP2 plate will not have enough volume for additional
processing and can be discarded.
8. Seal the PBP midi plate with a Microseal “B” using a plate
sealer and shake for 2 min at 1800 rpm.
9. Once shaking is complete, let the plate sit at room temperature
for 5 min (no shaking).
10. Place the PBP midi plate on the magnetic stand. Carefully
remove the seal. Let the plate sit for 2 min or until the liquid
is clear and all beads have gathered toward the magnet. Beads
gather in opposite directions every other row based on where
the magnet is located (see Note 29).
11. Using a 100 μL multi-channel pipette, remove and discard any
supernatant from each well (see Note 30). To avoid disrupting
the beads, insert the pipette into the opposite side of the beads
(plunger pressed down). Touch the tips to the opposite side at
the top of the well and slowly move the tips downwards until it
reaches the bottom. Once at the bottom, gently straighten the
pipette tip. Lift up gently and slowly aspirate the liquid (see
Note 31). Discard the liquid.
12. Prepare 440 μL fresh 80% ethanol (EtOH) per sample/control
in a 15 mL or 50 mL conical tube (see Note 32). Vortex or
invert to mix thoroughly and then pour the ethanol into a
reagent reservoir.
13. While the PBP midi plate remains on the magnetic stand,
perform an EtOH wash two times. Using a multi-channel
pipette, add 200 μL 80% EtOH into each well. Let the plate
incubate for 30 s on the magnetic stand. Remove and discard
all supernatant with a multi-channel pipette; use clean tips for
each column. Repeat for the second wash.
14. Seal the midi plate with a Microseal “B” and centrifuge for 30 s
at 1000 × g. This should draw any leftover EtOH to the
bottom of the wells.
15. Carefully remove the seal and place the PBP midi plate back on
the magnetic stand. Let the plate sit until beads have once again
accumulated toward the magnet.
16. Remove and discard any leftover liquid from each well using a
20 μL multi-channel pipette. Check that no liquid remains at
the bottom of the plate (see Note 33). If liquid is still present,
individual wells can be targeted using a single-channel pipette.
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 413

17. Invert the Resuspension Buffer (RSB) conical tube a few times
and remove the PBP midi plate from the magnetic stand.
18. If using a multi-channel pipette to dispense RSB to each sam-
ple, multiply the amount of samples/controls by 58 μL
(includes extra for pipetting error). Pipette this amount of
RSB into a reagent reservoir and then pipette 52.5 μL into
each applicable well of the PBP midi plate. Otherwise, for a
small number of samples/controls, use a single-channel pipette
to add 52.5 μL to each applicable well. Check that each well is
holding equal volumes after the addition.
19. Seal the plate with a Microseal “B” using the plate sealer and
shake for 2 min at 1800 rpm. After 2 min has elapsed, check
that all beads have been resuspended in each well. If not, the
shake may be repeated, or individual wells can be mixed using a
pipette.
20. Let sit for 2 min with no shaking. Place the PBP midi plate on
the magnetic stand. Carefully remove the seal. Let sit for 2 min
or until the liquid is clear and all beads have gathered towards
the magnet.
21. Label a new 96-well plate “PLP” for Purified Library Plate (see
Notes 11 and 12). Using a multi-channel pipette, remove
50 μL of each sample from the PBP midi plate and transfer to
the corresponding well of the new PLP 96-well plate (see Note
34).
22. Seal the PLP plate with Microseal “B” or cap strips and centri-
fuge for 30 s at 1000 × g.
23. The expiration of the purification plate is 1 year. It can be
processed immediately to normalize the samples (see Subhead-
ing 3.4, step 1) or stored in a freezer (-25 to -15 °C) until
ready to proceed.

3.4 Library 1. Thaw all necessary reagents to room temperature (LNB1 and
Preparation—Sample LNW1 will take longer than the other reagents, at ~30 min
Normalization—To total for both). Make sure to allow sufficient time before
Create Equal Sample beginning (see Note 10).
Representation During 2. Continue processing the room temperature PLP plate or if
Sequencing stored, remove from the freezer and allow to come to room
temperature (see Subheading 3.3, step 23).
3. Label a new midi plate “NWP” for Normalized Working Plate
(see Note 12).
4. To prepare the LNA1/LNB1 master mix, begin by vortexing
the LNB1 beads thoroughly for at least 1 min, and invert at
least 5 times every 15 s until beads are aspirated to the master
mix tube (see Notes 26, 27, and 35).
414 Megan M. Foley

5. Calculate the volume needed of LNA1 and LNB1 for the

master mix by multiplying the number of samples/controls
by 46.8 μL and 8.5 μL, respectively (these volumes include
extra for pipetting error).
6. Label an appropriately sized tube as “Master Mix” and add the
calculated volumes of LNA1 and LNB1. When pipetting
LNB1, aspirate and dispense gently to ensure the appropriate
volume of beads is drawn up (see Note 27).
7. Vortex the master mix and invert to thoroughly mix the beads.
Immediately pipette the contents into a reagent reservoir using
a 1000 μL pipette (see Note 36).
8. Transfer 45 μL master mix into each well of the midi plate using
a 100 μL or similar multi-channel pipette (see Notes 35).
Ensure that the liquid is dispensed directly into the bottom of
the well with no liquid on the side (see Note 37). To maintain
homogeneity of the master mix in the reagent reservoir, gently
pipette the remaining master mix up and down a few times in
between the addition of master mix to each column of the midi
plate.
9. Centrifuge the PLP plate for 30 s at 1000 × g to remove any
condensation from the seal or caps.
10. Place the PLP plate on the magnetic stand. Carefully remove
the seal or caps. Let sit for 2 min or until the liquid is clear and
all beads have gathered towards the magnet (see Note 38).
11. Using a multi-channel pipette, transfer 20 μL of the samples
from the PLP plate to the corresponding wells of the NWP
midi plate. Ensure that the liquid is dispensed directly into the
bottom of the well with no liquid on the side (see Note 37). Do
not discard the PLP plate. There is enough volume for an
additional normalization process. Re-seal with Microseal “B”
or strips caps and place the PLP plate back into the freezer for
storage.
12. Seal the NWP midi plate with a Microseal “B” using the plate
sealer and shake for 30 min at 1800 rpm.
13. Preparation of 0.1 N HP3 and the NLP plate can be performed
during the NWP incubation.
14. To prepare 0.1 N HP3 reagent, begin by calculating the vol-
ume needed of nuclease-free water and HP3 by multiplying the
number of samples/controls by 33.3 μL and 1.8 μL, respec-
tively (these volumes include extra for pipetting error).
15. Label an appropriately sized microcentrifuge tube “HP3.”
16. Prepare 0.1 N HP3 using the calculated reagent volumes. To
mix, invert the tube several times. Set aside the 0.1 N HP3
until ready to add it to the NWP plate after the LNW1 washes
(see Subheading 3.4, step 31).
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 415

17. Label a new 96-well plate “NLP” for Normalization Library

Plate (see Notes 11 and 12).
18. To prepare the NLP plate, begin by inverting the LNS2 tube
several times. Aliquot 30 μL LNS2 into the appropriate wells of
the NLP plate. This can be performed with a repeater pipette, if
available. Cover the wells with a Microseal “B” or strip caps to
reduce contamination risk and set the plate aside until the
NWP plate is ready for transfer to the NLP plate (see Subhead-
ing 3.4, step 35).
19. Once the 30-min shaking incubation of the NWP plate is
complete, immediately place the NWP midi plate on the mag-
netic stand. Carefully remove the seal. Let sit for 2 min or until
the liquid is clear and all beads have gathered towards the
magnet (see Note 39). Beads gather in opposite directions
every other row based on where the magnet is located.
20. Using a 100 μL or similar multi-channel pipette, remove and
discard any supernatant from each well (see Note 30).
21. Take the plate off of the magnetic stand and set on a flat
surface.
22. Aliquot 100 μL LNW1 per sample/control into a reagent
reservoir (this includes enough for two washes and includes
extra for pipetting error).
23. Using a 100 μL multi-channel pipette, add 45 μL LNW1 into
each well of the NWP midi plate. The plate should not be on
the magnetic stand. Retain the remaining LNW1 in the reagent
reservoir for the second wash.
24. Seal the NWP midi plate with a Microseal “B” using a plate
sealer and shake for 5 min at 1800 rpm.
25. Once shaking is complete, immediately place the NWP midi
plate on the magnetic stand. Carefully remove the seal. Let sit
for 2 min or until the liquid is clear and all beads have gathered
toward the magnet (see Note 39).
26. Using a 100 μL multi-channel pipette, remove and discard any
supernatant from each well (see Note 30). Remove the plate
from the magnetic stand.
27. Perform a second wash with LNW1 (see Subheading 3.4, steps
23–26).
28. Once two washes have been performed, remove the plate from
the magnetic stand, seal the NWP midi plate with a Microseal
“B” using a plate sealer, and centrifuge for 30 s at 1000 × g.
This should draw any leftover liquid to the bottom of the wells.
29. Carefully remove the seal and place the NWP midi plate back
on the magnetic stand. Let sit for 2 min or until the liquid is
clear and all beads have gathered toward the magnet (see Note
39).
416 Megan M. Foley

30. Remove and discard any leftover liquid from each well using a
20 μL multi-channel pipette. Check that no liquid remains at
the bottom of the plate (see Note 33). If liquid is still present,
individual wells can be targeted using a single-channel pipette.
31. Invert the prepared 0.1 N HP3 tube a few times and remove
the NWP midi plate from the magnetic stand.
32. Dispense 32 μL 0.1 N HP3 into each well of the NWP midi
plate. Check that each well is holding equal volumes after
pipetting. If using a multi-channel pipette, the 0.1 N HP3
can be dispensed into a reagent reservoir and then added to
the NWP plate.
33. Seal the NWP midi plate with a Microseal “B” using a plate
sealer and shake for 5 min at 1800 rpm. After 5 min has
elapsed, check that all beads have been resuspended in each
well. If not, the shake step can be repeated, or individual wells
can be mixed using a pipette.
34. Place the NWP midi plate on the magnetic stand. Carefully
remove the seal. Let sit for 2 min or until the liquid is clear and
all beads have gathered towards the magnet (see Note 39).
35. Remove the cover from the NLP plate that has been set aside.
Using a multi-channel pipette, remove 30 μL of each sample
from the NWP midi plate and transfer to the corresponding
wells of the NLP plate (see Note 34). Mix using the pipette.
36. Seal the NLP plate with a Microseal “B” using a plate sealer or
cap strips and centrifuge for 30 s at 1000 × g.
37. The expiration of the normalized plate is 30 days. It can be
processed immediately to pool the sample libraries (see Sub-
heading 3.5, step 1) or stored in a freezer (-25 to -15 °C)
until ready to proceed.

3.5 Library 1. Continue processing the room temperature NLP plate or if

Preparation—Pooling stored, remove from the freezer and allow to come to room
of Sample Libraries temperature (see Subheading 3.4, step 37).
2. Determine the maximum number of samples that can be
sequenced based on the primer set and the flow cell used (see
Table 8 and Note 40).

Table 8
Maximum number of samples for each flow cell kit

Flow cell Primer Set A Primer Set B

Micro flow cell kit 36 12
Standard flow cell kit 96 32
The standard flow cell and micro flow cell kits each allow a separate maximum number of samples depending on the
primer set used
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 417

3. If processing a small sample number of samples/controls from

the NLP plate, label a single 1.5 mL microcentrifuge as “PNL”
for Pooled Normalized Libraries (see Note 12). For a large
number of samples/controls, label a single 8-tube strip instead.
4. Vortex and centrifuge the NLP plate for 30 s at 1000 × g to
remove any condensation from the seal or caps.
5. Place the NLP plate on the magnetic stand. Carefully remove
the seal. Let sit for 2 min or until the liquid is clear and all beads
have gathered toward the magnet (see Note 41). Beads gather
in opposite directions every other row based on where the
magnet is located.
6. Aliquot 5 μL of each sample into the labeled PNL tube/8-tube
strip, changing tips between each sample/row. If sequencing a
small number of samples, all samples are added to the single
1.5 mL tube using a single-channel pipette. If sequencing a
larger number of samples, use a multi-channel pipette to trans-
fer one column of samples from the NLP plate at a time to the
8-tube strip, repeating for each column into the same strip.
This will effectively transfer all samples from a single row of the
NLP into the corresponding tube of the 8-tube strip. Lastly,
combine each tube in the strip into a final 1.5 mL
microcentrifuge tube.
7. Vortex the PNL tube and pulse spin.
8. Do not discard the NLP plate. There is enough volume for
additional sequencing. Re-seal and place the NLP plate back
into the freezer for storage.
9. The expiration of PNL tube/tube-strip is 30 days. It can be
processed immediately to denature and dilute the pooled
libraries (see Subheading 3.6, step 1) or stored in a freezer (-
25 to -15 °C) until ready to proceed.

3.6 Denaturation and 1. Thaw the denaturation/dilution reagents (~90 min for the
Dilution of Pooled Reagent Cartridge, but less for HT1 and HSC). Remove the
Libraries and Cartridge MiSeq FGx™ Reagent Kit from the freezer; wait to thaw the
Loading for HSC (see Subheading 3.6, step 3). Remove the HT1 box from
Sequencing the underside of the handle of the reagent cartridge and set it
aside to thaw at room temperature. Fill an appropriately sized
container with room temperature water and place the reagent
cartridge in the water for ~90 min to thaw (see Notes 42
and 43).
2. Set the micro-heating system/heat block to 96 °C. This step
can take some time depending on the system. Let the system
heat while the reagents are thawing.
3. During the remaining ~15 min needed to thaw the reagent
cartridge, remove the HSC (and PNL tube/tube strip, if stored
418 Megan M. Foley

from Subheading 3.5, step 9) from the freezer and allow to

thaw to room temperature.
4. Before continuing, ensure that all reagents are thawed and
there are no ice chunks visible within the reagent cartridge.
Once completely thawed, remove the cartridge from the water
bath and tap it on the bench to remove water droplets from the
surface of the cartridge. Make sure that the base is dry and that
no water has pooled on the top of the cartridge.
5. If a benchtop cooler or ice bucket is not available, prepare an ice
water bath at this time by mixing 1 part nuclease-free water and
3 parts ice.
6. Label a 1.5 mL microcentrifuge tube as “HSC” for Human
Sequencing Control.
7. Vortex and pulse spin the HSC tube from the kit. Add 2 μL
HSC, 2 μL HP3, and 36 μL nuclease-free water to the newly
labeled HSC tube (see Note 44). Vortex the prepared HSC
tube and centrifuge briefly. Let stand at room temperature for
5 min.
8. While the HSC is incubating, label a 1.5 mL microcentrifuge
tube as “DNL” for Denatured Normalized Libraries and trans-
fer 591 μL HT1 (hybridization buffer) to the DNL tube.
9. Vortex and pulse spin the PNL tube to remove liquid from the
cap. Transfer 7 μL of the PNL to the DNL tube. Flush the tip
to mix. Do not discard the PNL tube. There is enough volume
left for additional sequencing. Place the PNL tube back in the
freezer for storage.
10. After the HSC is done incubating, transfer 4 μL to the DNL
tube. Flush the tip to mix and pulse spin. Incubate for 2 min on
the preheated micro-heating system set at 96 °C (see Note 45).
11. After incubation, invert the DNL tube several times and imme-
diately place it into the benchtop cooler, ice bucket, or
prepared water bath to snap-cool (see Note 46). Incubate for
5 min.
12. During the snap-cool, prepare the reagent cartridge for load-
ing. Invert the cartridge gently 10 times in order to mix the
reagents within. Tap the cartridge on a counter gently to
remove bubbles and water from the outside of the cartridge.
Inspect wells 1, 2, and 4 to make sure they are thoroughly
mixed. Using an empty 1000 μL pipette tip, pierce the foil of
the well labeled 17. This is to prevent sample loss during the
addition of the denatured libraries. Well 17 is highlighted in a
deep orange color and is labeled “Load Samples.”
13. After the snap-cool incubation, remove all contents from the
bottom of the tube with a pipette set to 600 μL (see Note 47).
Slowly (to avoid air bubbles) load all contents into the reagent
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 419

cartridge in the marked well “17”. Once loaded, gently tap the
cartridge to ensure all liquid is at the bottom.
14. Immediately proceed to instrument setup and loading (see
Subheading 3.7, step 1).

3.7 Instrument Setup 1. Login to the ForenSeq™ Universal Analysis Software (UAS)
and Performing a Run and click “Create New Run”. The next screen prompts to
choose “Standard” or “Micro”. Choose the appropriate option
and click “BEGIN”.
2. Type in the Run Name in the white box under “Run” on the
left side of the screen (see Note 12). A run description can be
added in the box under “Description” in the middle of the
screen. This is not required to save the run. Choose “Forensic
Application” from the drop-down menu in the box under
“Application” on the right side of the screen.
3. Add samples to the run manually (see Subheading 3.7, step 4),
using a tab-delimited (.txt) import file (see Subheading 3.7,
steps 5–15), or to an existing run file (see Subheading 3.7,
step 16).
4. To manually add samples, click the “ADD NEW SAMPLES”
button in blue under the “Name” box. Fill in the “Sample
Name” and “Project Name” fields. A “Sample Description”
may be chosen but is not required. Choose the appropriate “i7
Index”, “i5 Index”, “Sample Type”, and “Primer Mix” from
the respective drop-down menus. Once complete, click the “+
ADD NEW SAMPLE” blue box at the right side of the screen.
Complete this action for each sample (see Note 48). Click the
blue “Save Run” button at the bottom of the screen. Continue
to prepare the instrument for the sequencing run (see Subhead-
ing 3.7, step 17).
5. To import a pre-filled samples file, begin by creating a tab
delimited (.txt) file using an application such as Microsoft®
Excel® (Excel). In the first row, enter the following row headers
exactly in the specified cell: “SampleName” (A1); “Project”
(B1); “i7Index” (C1); “i5Index” (D1); “SampleType” (E1);
“SampleDescription” (F1); and “MixType” (G1) (see Fig. 2;
Notes 49 and 50).
6. In column A, type the user-defined sample/control names.
7. In column B, type the user-defined same project name for each
sample/control.
8. In column C, type the appropriate i7 Index for each sample/
control, choosing from: “R701”, “R702”, “R703”, “R704”,
“R705”, “R706”, “R707”, “R708”, “R709”, “R710”,
“R711”, or “R712” (see Note 50).
420 Megan M. Foley

Fig. 2 UAS sample file. Displayed is an example of a pre-filled sample file for upload into the UAS software

9. In column D, type the appropriate i5 Index for each sample/

control, choosing from: “A501”, “A502”, “A503”, “A504”,
“A505”, “A506”, “A507”, or “A508” (see Note 50).
10. In column E, type the appropriate sample type for each sam-
ple/control, choosing from: “Positive Amplification Control”,
“Negative Amplification Control”, “Sample”, or “Reagent
Blank” (see Note 50).
11. In column F, type the user-defined sample descriptions. These
are not required.
12. In column G, type the appropriate primer mix for each sample/
control, choosing from “A” or “B” (see Note 50).
13. After completing the appropriate information for each sample,
save the Excel file as a tab-delimited (*.txt) file for upload.
14. To import the file, return to the UAS software and click
“IMPORT SAMPLES” directly under the “Name” box. Either
drag the .txt file into the box labeled “DROP FILES TO
UPLOAD”, or click on the box, navigate to the appropriate
.txt file, and click “Open”.
15. Review the information and edit any errors. Click the blue
“Save Run” button at the bottom of the screen. Continue to
prepare the instrument for the sequencing run (see Subheading
3.7, step 17).
16. To add to an existing sample run, click the “Add Existing
Samples” button and type in the sample name to add or the
project name of the previous run to find the sample. Fill in the
remaining information as described for manual input (see Sub-
heading 3.7, step 4). Click the blue “Save Run” button at the
bottom of the screen. Continue to prepare the instrument for
the sequencing run (see Subheading 3.7, step 17).
17. Select “Sequence” from the home screen on the MiSeq FGx.
Next, select “Forensic Genomics”. The next screen requires
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 421

the correct run folder to be chosen. Click the arrow and a list of
loaded runs are available (see Note 51). Choose the correct run
file and click “Next”, which initiates a sequence of prompts
explained below.
18. Remove the flow cell from the liquid storage container with
forceps or drain some of the liquid and manually remove it
wearing a glove. Rinse the flow cell with nuclease-free water to
remove the storage buffer salts. Dry the flow cell using a lint-
free wipe. Make sure the entire flow cell is dry. This may require
very careful drying between the glass and plastic areas (see Note
52). Once it is dried, an alcohol wipe can be used to clean the
glass of the flow cell. Inspect the flow cell to ensure there is no
remaining lint or streaks on the surface. If the gasket has
moved, gently push it back into place.
19. Load the flow cell by following the software prompts. Open the
flow cell compartment and gently push the white flow cell latch
release button, which opens the flow cell latch. The flow cell
should be at the top. The notched side of the flow cell should
be at the upper right. Close the compartment door. An audible
click occurs when the latch is secure. Click “Next”.
20. Load the PR2 bottle following the software prompts. Open the
door to the reagent compartment under the screen. Lift up the
sipper handle. Remove any bottles currently on the instrument
in the PR2 bottle location and replace with a fresh bottle of
PR2: invert the new PR2 bottle to mix, remove the lid, and
insert. If needed, empty the waste bottle into a biohazard bin
and place it back into the instrument. Pull the handle to bring
the sipper back down. Click “Next”.
21. Load the loaded reagent cartridge following the software
prompts. Lower the reagent chiller door and insert the loaded
cartridge. Slide the cartridge on the bottom of the tray until it
stops. The handle of the cartridge should be pointed outwards.
Close both the reagent chiller door and the reagent compart-
ment door. Click “Next”.
22. The next screen asks to confirm the run name and type of run
that will be performed. Check this information and click
“Next” if everything is correct. The next screen displays a list
of run parameters and performs a run pre-check. Once all
parameters have been tested and are in working order, the
“Start Run” button is available. Click “Start Run” to begin.
23. Basic run parameters can be monitored during the run from
the “Sequencing” screen, including run progress, fluorescence
intensity, quality information, as well as current actions and
temperatures of the instrument and components. The run can
also be stopped and paused from this window [14].
24. After a run is completed, a post-wash option is available on the
screen. Complete a wash immediately after the sequencing is
422 Megan M. Foley

complete for the best maintenance of the instrument (see Sub-

heading 3.8, step 1).

3.8 Perform a Post- 1. After a run is completed, leave the used flow cell in the instru-
Run Wash ment for the wash run, which is required to complete the wash.
2. Prepare a 1:30 dilution of 6% sodium hypochlorite. Vortex to
mix. In a MiSeq wash tube, further dilute the 1:30 to prepare
1000 μL of 0.01% sodium hypochlorite solution. Pipette to mix
using a 1000 μL pipette.
3. To load the wash tray, use a large volume repeater pipette to
add 6 mL nuclease-free water to each well, except to well
17 (Sample Well). Insert the prepared MiSeq wash tube with
0.01% sodium hypochlorite into well 17 of the wash tray. The
tube should be flush with the lip of the well in the tray.
4. Fill an empty PR2 bottle with 350 μL nuclease-free water.
5. Return to the instrument. Click “Start Wash” (see Note 53).
Wait a few seconds before opening any doors. The instrument
raises the sippers in the used cartridge.
6. Wait until the sippers are fully raised (see Note 54) and replace
the used run cartridge with the prepared wash cartridge (see
Subheading 3.8, step 3) by opening both the reagent compart-
ment and reagent chiller doors. Close the chiller door after the
wash cartridge is completely inserted. Lift up the handle to the
sippers on the right side. The wash bottle will replace the
leftover PR2 reagent bottle from the run. Remove the previous
PR2 bottle and replace it with the wash bottle (see Subheading
3.8, step 4). Empty the waste bottle into a biohazard bin and
place it back into the instrument. Lower the sipper handle back
down and close all doors.
7. Click “Next” and allow the wash to complete. It lasts about
30 min.
8. Once the wash run is complete, leave all consumables within
the instrument, including the wash containers, until the next
run is performed.
9. During storage, the wash tray should always be cleaned and
turned upside down to decrease the chance of mold growth in
the tray.

4 Notes

1. DNA concentration must be known for purified DNA before

beginning this process. Quantify the amount of total human
DNA using validated qPCR or fluorometric-based assays.
2. The size of tip depends on the brand of pipettes utilized; ensure
that the appropriately sized tips are used. It is also best to match
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 423

up the brands of pipette tips and pipettes. Using unmatched

tips can cause changes in the volume pipetted/aspirated.
3. Verogen recommends Bio-Rad brand.
4. Only needed for FTA® Card processing.
5. Examples include QuickExtract DNA Extraction Solution or
SwabSolution Kit.
6. Normalization reagents are hazardous. Both formamide and
2-mercaptoethanol are used. Handle with caution and dispose
of properly.
7. Author uses a ThermoFisher MicroAmp™ Splash-Free
96-Well Base.
8. Author uses a magnetic stand for a 96-well plate.
9. The laboratory can purchase a unit that also is able to heat
samples at the same time. Manufacturers recommend BioShake
iQ or BioShake XP.
10. Make sure to allow sufficient time before beginning to allow all
contents to thaw and resolubilize. This is especially important
for the SPB and LNB1 tubes and may affect the binding of
DNA to the beads if thawing is incomplete. For LNA1,
reagents may crystallize during storage. Vortex thoroughly
and check that there are no crystals present. If present, let
thaw further and vortex again. Crystals can be best seen if the
tube is held up to a light.
11. If processing one column of samples (eight, including all con-
trols), this step can be performed using an 8-tube strip and
accompanying 8-cap strip. Ensure that the laboratory has a
pulse spinner or microcentrifuge that can fit 8-tube strips.
12. Follow the labeling/naming system for the laboratory. An
example labeling system can include the plate/tube type
(or analyst initials) and process date. For example,
“FSP_011022,” using a two-digit month, two-digit date, and
two-digit year. For storage and organization purposes, write
the expiration date of the plate, if applicable.
13. If the sample concentration is <0.2 ng/μL, then obtaining
1 ng of DNA in a volume of 5 μL is not possible. The sample
could be concentrated if such a method is validated. Otherwise,
only use a maximum allowable volume (5 μL) for the amplifi-
cation reaction.
14. If processing different types of samples together, e.g., DNA
extracts and FTA® Cards, two separate master mixes should be
made. Make sure that the tubes are labeled appropriately in
order to decrease any chance of confusion.
15. It is possible to prepare a batch of Primer Set A and Primer Set
B samples together, but they must be sequenced separately.
424 Megan M. Foley

There are specific run and analysis parameters for each

primer set.
16. A minimum of six samples (including reagent blank or other
controls laboratory uses), positive amplification control, and
negative amplification control (eight total) should be pro-
cessed. This is to ensure that the volumes of reagents for the
master mix are large enough to reduce pipetting inaccuracies
due to small volumes.
17. Use of a single-channel pipette is recommended for ≤8 sam-
ples. Use of a repeater or multi-channel pipette is recom-
mended for >8 samples, in which case the master mix should
be equally distributed into an 8-tube strip and dispensed into
each column of the 96-well amplification plate. Author recom-
mends utilizing a new pipette tip for each well to ensure an
even distribution.
18. Flush the tip by pipetting the liquid up and down into the tip,
gently, to avoid saturating the barrier.
19. To seal Microseal “A,” push with enough pressure to ensure
that the plate has been thoroughly sealed, but not too much
pressure that the seal is no longer viable. A clear shadow outline
should be visible around each well. If the seal is not flush with
each well due to overpressure, gently remove and apply a
new seal.
20. These tubes are narrower than the average microcentrifuge
tube. It helps to place empty 1.7 or 2.0 mL microcentrifuge
tubes into the pulse spinner (caps removed/cut off at the
hinge) and place the index tubes inside these empty tubes.
21. The order and number of the indices used depends on the
number of samples being sequenced. This should be deter-
mined before library prep.
22. The author recommends keeping track of the volume of each
index and rotating out the i5 and i7 indices throughout
different runs.
23. The FSP2 plate is not secured within the ForenSeq™ Index
Plate Fixture. The plate can be placed in a plate holder during
pipetting to better stabilize.
24. New caps are used for each assay to ensure that no contamina-
tion occurs between index tubes. If sequencing smaller
batches, the kit does not contain enough caps and additional
caps should be purchased.
25. To avoid air bubbles, pipette PCR2 slowly. For >8 samples,
PCR2 can be distributed into an 8-tube strip and dispensed
using a multi-channel pipette. For ≤8 samples, use a single-
channel pipette.
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 425

26. During storage, the SPB/LNB1 beads accumulate at the bot-

tom of the tube. During vortexing, it helps to invert the tube
multiple times and re-vortex to unclump.
27. When pipetting into the midi plate, the SPB or LNB1 may
require additional mixing if the beads have not been in use; this
ensures homogeneity.
28. This must be done in order to ensure that all leftover amplifi-
cation reagents have been removed.
29. This step may last longer than 2 min. If at any point beads are
drawn up into the pipette tips inadvertently, dispense the liquid
back into the appropriate wells and let sit for approximately
2 min to rebind.
30. Ensure that all liquid has been removed to allow for sufficient
washing and sample transfer later in the process.
31. Ensure that there is a space between the tip and the bottom;
otherwise, not all liquid is removed. Barely lift up the pipette
tip to make sure there is space to draw up all of the liquid. To
avoid interacting with the beads, insert the pipette to the
opposite side of the beads (plunger down). Touch the tips to
the opposite side at the top of the well and slowly move the tips
downwards until it reaches the bottom. Once at the bottom,
gently straighten the pipette tip. Lift up gently and slowly to
aspirate the liquid.
32. Prepare fresh 80% EtOH for every preparation to ensure opti-
mal results. The formula contains overage.
33. It is crucial that no liquid remains. Otherwise, the sample is
diluted and less than optimal results may be obtained.
34. Author has observed beads sticking to the side of the pipette
tips at this point during this transfer step. It has not been
shown to have an impact on the amount of DNA template
sequenced, although no published research has been per-
formed at this time to verify.
35. It is crucial that an equal amount of beads are added to each
sample so that each sample has an equal representation in the
pooled library. Too many beads added can lead to an overabun-
dance of reads generated for that sample, and too little can lead
to a decreased read count.
36. It is important to use a pipette tip with a larger bore size so that
all beads are transferred.
37. This must be done in order to ensure that all beads are available
for the DNA to bind.
38. This is to remove any beads remaining from the purification
step from the supernatant.
39. This step tends to clear faster than the purification step and
does not always require the full 2 min.
426 Megan M. Foley

40. It is recommended to include the sequencing amplification

positive and negative controls on each run performed, even if
previously sequenced on a different run. If an error has
occurred during the sequencing process, and a positive and
negative control were not included, the ability to appropriately
troubleshoot is lessened, as well as the assistance that Verogen
can provide in determining the reason for the problem.
41. This is to remove any beads from the supernatant that are
remaining from the normalization step.
42. Denaturation and dilution of the pooled libraries should occur
the day of the sequencing run. Once this section is complete,
the loaded cartridge must be immediately processed on the
instrument to avoid instrument and sequencing errors.
43. The water does not have to be nuclease-free and should not go
above the “Fill Line” on the cartridge once it is placed in the
bath. Author recommends drawing a line on the container to
the appropriate fill line during the first thaw for future uses.
Alternatively, the reagent cartridge can be thawed in the refrig-
erator, which will take ~5–6 h. Once the cartridge is thawed, it
can sit on ice or at room temperature for up to 6 h, but it is best
practice to load the sample immediately.
44. Do not begin this step until the heating system is up to tem-
perature. Once this step begins, the subsequent steps are
timed.
45. Once the sequencing run has started, the HSC tube can be
discarded. The manufacturers advise against storage and
repeated use of this reagent, as it can lead to less-than-optimal
results.
46. Remove the cooler from the freezer right before use. The
temperature should be -25 to -15 °C. If removed too early,
the temperature may be too warm, and incomplete denatur-
ation may occur.
47. Do not remove any of the contents that may have condensed at
the top of the DNL tube during the cooling step. Incomplete
denaturation/dilution may have occurred and leads to less-
than-optimal results.
48. Each sample is added to a growing list at the bottom of the
screen. If the initial sample setup was done incorrectly, the
indices, sample type, and/or primer mix type can be fixed
using the appropriate drop-down menus.
49. The author finds this is easiest to set up in Excel.
50. This must be exact, otherwise the instrument does not recog-
nize the content.
 Sequencing with ForenSeq™ DNA Sig. Prep on the MiSeq FGx 427

51. The instrument only displays runs that have not been
completed.
52. The author has found the easiest way to do this is to work from
the underside of the flow cell and slide the edge of the wipe up
to the area to dry. Capillary action pulls the liquid out from
under the edge onto the wipe. Use extra care around the port
gasket.
53. This option becomes available after a sequencing run has been
completed.
54. For an indication that the sippers are fully raised, the noise will
stop and the action on the screen disappears.

References
1. Verogen (2022) ForenSeq DNA Signature 8. Fattorini P, Previderé C, Carboni I et al (2017)
Prep Kit reference guide. Available via Vero- Performance of the ForenSeq™ DNA Signa-
gen. https://verogen.com/wp-content/ ture Prep Kit on highly degraded samples.
uploads/2022/01/forenseq-dna-signature- Electrophoresis 38:1163–1174. https://doi.
prep-reference-guide-PCR1-vd2018005-d. org/10.1002/elps.201600290
pdf. Accessed 31 March 2022 9. Bornman D, Hester M, Schuetter J et al (2012)
2. Xavier C, Parson W (2017) Evaluation of the Short-read, high-throughput sequencing tech-
Illumina ForenSeq™ DNA Signature Prep nology for STR genotyping. Biotech Rapid
Kit—MPS forensic application for the MiSeq Dispatches 2012:1–6
FGx™ benchtop sequencer. Forensic Sci Int 10. Sharma V, van der Plaat DA, Liu Y et al (2020)
Genet 28:188–194. https://doi.org/10. Analyzing degraded DNA and challenging
1016/j.fsigen.2017.02.018 samples using the ForenSeq™ DNA Signature
3. J€ager A, Alvarez M, Davis C et al (2017) Devel- Prep Kit. Sci Justice 60:243–252. https://doi.
opmental validation of the MiSeq FGx Forensic org/10.1016/j.scijus.2019.11.004
Genomics System for targeted next generation 11. Verogen (2021) MiSeq FGx Sequencing Sys-
sequencing in forensic DNA casework and tem reference guide (VD2018006). Available
database laboratories. Forensic Sci Int Genet via Verogen. https://verogen.com/wp-con
28:52–70. https://doi.org/10.1016/j.fsigen. tent/uploads/2021/02/miseq-fgx-system-ref
2017.01.011 erence-guide-vd2018006-f.pdf. Accessed
4. Moreno L, Galusha M, Just R (2018) A closer 31 Mar 2022
look at Verogen’s Forenseq™ DNA Signature 12. Verogen (2017) Library Normalization Wash
Prep Kit autosomal and Y-STR data for stream- 1 safety data sheet, revision A. Available via
lined analysis of routine reference samples. Verogen. https://verogen.com/wp-content/
Electrophoresis 39:2685–2693. https://doi. uploads/2020/06/LP-LNW1-VD202001
org/10.1002/elps.201800087 7-A.pdf. Accessed 31 Mar 2022
5. Churchill J, Novroski N, King J et al (2017) 13. Verogen (2021) Introducing the MiSeq FGx
Population and performance analyses of four Reagent Micro Kit for forensics technical note
major populations with Illumina’s FGx Foren- (VD2018016). Available via Verogen. https://
sic Genomics System. Forensic Sci Int Genet verogen.com/wp-content/
30:81–92. https://doi.org/10.1016/j.fsigen. uploads/2021/02/introducing-miseq-fgx-
2017.06.004 reagent-micro-kit-technical-note-vd2018016-
6. Köcher S, Müller P, Berger B et al (2018) b.pdf. Accessed 31 Mar 2022
Inter-laboratory validation study of the Fore- 14. Verogen (2018) ForenSeq™ Universal Analy-
nSeq™ DNA Signature Prep Kit. Forensic Sci sis Software guide. Available via Verogen.
Int Genet 36:77–85. https://doi.org/10. h t t p s : // v e r o g e n . c o m / w p - c o n t e n t /
1016/j.fsigen.2018.05.007 uploads/2018/08/ForenSeq-Univ-Analysis-
7. Gettings K, Kiesler K, Vallone P (2015) Perfor- SW-Guide-VD2018007-A.pdf. Accessed
mance of a next generation sequencing SNP 31 Mar 2022
assay on degraded DNA. Forensic Sci Int
Genet 19:1–9. https://doi.org/10.1016/j.
fsigen.2015.04.010
 INDEX

A 232, 233, 243–245, 248, 250, 254, 262, 279,

333, 346, 382, 394, 406, 410, 415, 424
Agarose gel ..........................................130–147, 342, 360 Controls.................................................... 4, 8–12, 18, 19,
Alu repeats ............................................................ 149–173 24, 30, 40, 41, 43, 46, 54, 60–65, 67–69, 76, 77,
Amplification ...................................................3, 4, 11–13,
85, 87–89, 105, 119, 120, 132, 134–136, 139,
15–17, 19, 35, 37, 55, 114, 116, 121, 123–125, 140, 144, 145, 152, 153, 156, 157, 159, 160,
131, 144, 149–159, 161–164, 166–173, 176, 166–170, 176, 179, 182, 190–193, 195, 197,
177, 182, 185–187, 189, 191, 195, 200, 204,
200, 202, 209, 210, 212, 214, 216–225, 228,
207–212, 214, 216–225, 228–237, 241–251, 230–234, 237, 238, 242, 243, 245–250,
253–262, 264–280, 286, 301, 303, 311, 332, 254–262, 267, 268, 270, 278, 294, 297,
334, 340–342, 345–347, 368, 370, 371, 400,
332–334, 340–342, 347, 363, 365, 372, 373,
401, 405–410, 420, 423–426 377, 378, 381, 382, 385, 389–391, 394, 400,
Ancestry SNPs ...................................................... 398, 399 402, 404–415, 417, 418, 420, 423, 424, 426
Applied Biosystems ................................ 4, 37–39, 53–80,
Corneocytes................................................. 351, 359, 360
149, 150, 152, 168, 170, 175–188, 190, 235,
241–251, 264, 265, 275, 285–305, 367–394 D
Archived latent fingerprints ................................. 351–356
AutoMate Express™ ....................................36, 39, 53–80 Degradation index ............................................... 186, 187
Automation ............................................... 36, 37, 84, 369 Demineralization............................................93–102, 337
Diamond™ Nucleic Acid Dye (DD) .................. 360–365
B Differential extraction .......................................24, 35, 46,
61, 103–116
Blood ................................................8, 18, 36, 38–44, 46, Direct amplification ............................. 19, 208, 210–212,
55, 56, 60, 61, 63–65, 67, 75, 80, 84–87, 91,
214, 216–221, 223–225, 227, 229–235, 237,
119–123, 208, 216, 219, 223, 228, 232, 235, 254, 255, 257–259, 264, 265, 363, 370, 371
255, 257–259, 261, 368, 370, 372, 373, 403 DNA ....................................... 3, 23, 35, 53, 83, 93, 103,
Bone analysis ................................................................. 332 120, 129, 149, 175, 189, 207, 227, 241, 253,
Bone extraction ....................................... 64, 93–102, 337
264, 285, 307, 331, 351, 359, 367, 397
Buccal cells.................................. 119–125, 222, 235, 266 DNA amplification ..................................... 207–224, 227,
231, 296, 336, 338–340
C
DNA analysis ...........................3–19, 24, 35, 38, 93, 120,
Capillary array ............................................ 265, 267, 286, 175, 207, 244, 254, 331–348, 351–356, 367, 368
289, 291, 292, 301 DNA degradation ....................................... 101, 144, 189
Capillary electrophoresis (CE) .......................3, 9, 12, 19, DNA extraction...............................................3, 9, 17, 31,
35, 236, 243, 247, 257, 259, 260, 263–280, 35–50, 53–80, 83–91, 93, 94, 101, 104, 106,
285–305, 335, 344, 348, 369, 398 120, 263–280, 337, 340, 352, 353, 423
ChargeSwitch® Forensic DNA Purification Kit .... 36, 38, DNA IQ™ System.............................. 36–38, 40–43, 105
265, 266, 272, 273 DNA migration .................................................... 130, 145
CODIS loci ...........................................11, 208, 253, 254 DNA polymerase ........................................ 150, 152, 176,
Combined DNA Index System (CODIS) ..................207, 190, 198, 242, 254, 257, 334, 370
208, 242, 332, 367, 368, 385, 386, 391, 394 DNA purification ................................... 29, 83, 103–116,
Contamination ..........................................4–9, 14–16, 30, 119–125, 273
36, 40, 47–49, 54, 57, 65, 67, 69, 77, 78, 80, 83, DNA quantification/quantitation ..................... 9–11, 19,
84, 90, 95, 113, 116, 125, 132, 153, 167, 169, 31, 37, 42, 43, 45, 65, 72, 175–188, 236
178, 182, 184, 216, 217, 219, 220, 222, 223, DNA typing................................................................... 348

Catherine Cupples Connon (ed.), Forensic DNA Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2685,
https://doi.org/10.1007/978-1-0716-3295-6,
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer
Nature 2023

429
 FORENSIC DNA ANALYSIS: METHODS AND PROTOCOLS
430 Index
E L
Epithelial cells.................................................31, 103, 124 Latent DNA ......................................................... 359–365
Ethanol precipitation ................................................23–32 Likelihood ratio (LR) ......................................... 307–311,
Extraction ..................................................4, 9–13, 17–19, 316–323, 325, 327, 385–387
25, 26, 30, 35–44, 46, 47, 49, 54–65, 67, 68, Locus .............. 190, 208, 242, 308, 309, 312, 315, 316,
71–80, 83, 85–91, 93–102, 105–108, 110, 111, 320, 321, 326, 327, 331, 372, 385, 387, 390, 398
114, 124, 132, 135, 140, 141, 147, 173, 191, Low volume amplification ..................264, 265, 267, 272
222, 236, 246, 249, 250, 261, 264, 267, 268, LRmix Studio ............................................. 307–309, 311,
278, 333, 335–337, 339, 346, 355, 356, 368, 312, 314, 315, 317–319, 321–324, 326, 327
370, 393, 403, 405, 408
M
F
MagAttract Suspension G.........................................84, 85
Fast PCR............................................................... 263–280 Massively parallel sequencing (MPS) ................. 266, 270,
FBI DISC ...................................................................... 368 272, 273, 397
ForenSeq™ DNA Signature Prep Kit................ 397, 400, Microcon® centrifugal filter purification .................23–32
403, 404 Microscopy ......................................................31, 32, 112,
Forensic biology ...............................................18, 95, 351 333, 346, 360–362, 364
Forensic DNA ..................................3–19, 24, 35, 36, 38, MiSeq FGx .................................401, 404, 405, 417, 420
39, 53–80, 207, 244, 245, 332, 351–356, 367 Mitochondrial DNA (mtDNA)....................... 5, 331–348
Forensic DNA analysis ..................................3–19, 24, 35, Mixture interpretation .................................................. 227
38, 207, 244, 351–356, 367 Molecular sieve .............................................................. 130
Forensic DNA sequencing................................... 397–427 Multiplex ........................... 208, 242, 253, 264, 266, 270
Forensic Science ........................... 95, 105, 211, 212, 362
Fragment analysis ....................................... 231–233, 235, N
274, 285, 286, 295 Next generation sequencing (NGS) ........................5, 405
FTA® Cards .......................................... 19, 119–125, 223, NGM SElect™ Express ......................368, 371–373, 376
235, 400, 403, 404, 407, 408, 423
Normalized extraction ........................................ 264, 265,
FTA® Indicating Cards .......................120, 121, 223, 235 267–270, 272, 278
G O
®
GelRed Nucleic Acid Stain ....................... 131, 133, 143 Organic extraction ..................................... 23–32, 35, 36,
GeneMarker™ HID ..................372, 385, 389, 391, 392
106–109, 113, 336–339
3500 Genetic Analyzer ........................................ 285–305
3500xL Genetic Analyzer ............................................. 285 P
Genetic Analyzer ........................................ 265–267, 274,
276, 277, 280, 285 Paramagnetic resin ....................................................36–38
GlobalFiler™.............................................. 241–251, 265, Personal protective equipment (PPE) ................. 4, 5, 18,
269, 271, 274, 368 30, 40, 84, 95, 122, 143, 178, 222, 229, 245,
GlobalFiler™ Express (GFE) ............................. 244, 368, 255, 267, 352
370–373, 376, 389, 390, 393, 394 Phenol......................................................... 23, 25, 28, 95,
97, 113, 114, 333, 337, 339
H Phenotypic SNPs........................................................... 399
Polymerase chain reaction (PCR) ...................... 5, 10, 11,
Hair analysis................................................................... 332 13, 15–17, 19, 23–25, 28, 35, 37, 47, 55, 59, 65,
84, 104, 106, 107, 113, 114, 116, 129, 144, 149,
I
151, 152, 157, 159, 171, 176–180, 185, 189,
Investigator 24plex GO!............................................... 261 190, 193–195, 198–200, 203, 204, 207, 210,
Investigator 24plex QS ........................................ 253–262 212, 214, 216–224, 227–236, 241–251,
253–266, 268–272, 274, 278, 286, 332–334,
K 340, 342, 344, 347, 370, 371, 403, 406–408
PowerPlex® Fusion .................... 207–224, 269, 271, 274
KAPA2G™ Multiplex Mix ......................... 264, 266, 270
 FORENSIC DNA ANALYSIS: METHODS AND PROTOCOLS
Index 431
PowerPlex® Y23 .................................................. 227, 228, RapidLINK™............................................. 368, 370, 372,
230–234, 269, 271, 274 373, 377, 379, 383–389, 391, 393
PowerUp™ SYBR® Green Master Mix .............. 149–173 Rapid STR analysis ........................................................ 369
Precautions ....................................................4–12, 24, 40, 7500 Real-Time PCR System ............................ 149, 152,
105, 121, 143, 245, 250, 267 154, 176, 190
PrepFiler™ ................................................................53–80 Real-time qPCR ............................................................ 190
PrepFiler™ BTA............................. 53, 58–60, 63, 70, 76
PrepFiler Express™...............................56, 57, 59, 67, 68 S
PrepFiler Express™ BTA ..........................................53, 59
Saliva ....................................................... 5, 40–43, 61, 67,
Probabilistic modeling .................................................. 308 119–125, 368, 370, 373, 403
Probability of drop-in (pDI) ........................................ 309 SDS software .............................................. 152, 155–157,
Probability of drop-out (pDO) .......................... 309–311,
161, 166, 167, 170, 171
317, 319–321, 327 Sexual assault evidence.................................................. 190
Promega DNA IQ™ System............................... 103–116 Short tandem repeat (STR) .................................. 3, 5, 12,
37, 116, 124, 125, 149, 189, 207, 208, 227, 242,
Q
253–255, 258, 259, 262, 312, 331, 351–356,
QIAamp DNA Blood Mini Kit ...................38, 40–42, 46 363, 368, 369, 372, 398, 399, 401
QIAamp DNA Investigator Kit........38, 40–43, 353, 354 Silica .........................36–39, 47–49, 55, 56, 85, 352, 355
QIAamp DNA Mini Kit ..............................38, 40–42, 46 Single nucleotide polymorphism (SNP) ...................... 399
QIAGEN BioSprint® 96 SNP analysis................................................................... 397
(BioSprint® workstation) ..............................83–91 Spermatozoa......................................................... 103, 104
Quality assurance ..................................... 4, 9, 17–19, 24, Standard curve.............................10, 151, 155, 156, 158,
46, 129, 149, 264, 368 162–164, 167, 171, 172, 177, 178, 181–183,
Quality control ............................................ 6, 18, 24, 244 185, 186, 191, 192, 195, 197, 200, 201, 203, 204
Quality sensors (QS) markers.............................. 253, 254 STR amplification..................................... 11–12, 37, 116,
Quantification .......................................... 3, 9, 10, 13, 19, 120–124, 165, 173, 263–280
31, 37, 129, 130, 140, 144, 150–152, 164, 167, STR profiles ..........................................11, 12, 19, 35, 55,
168, 172, 175–188, 191–193, 195–197, 203, 124, 125, 149, 165, 204, 253, 264, 265, 267,
236, 255, 261, 265, 277, 278, 400, 401 274, 276–278, 280, 301, 308, 331, 352, 368–372
Quantifiler Trio .................................................... 176, 180 STR sequencing ................................................... 242, 401
Quantitation ...........................................4, 10, 11, 19, 42, SYBR® Green I dye......................................150–152, 166
43, 45, 55, 65, 72, 77, 78, 91, 109, 110, 156,
175–188, 191, 195, 204, 250, 269, 272, 370, 407 T
Quantitative gel electrophoresis .......................... 129–147
Thermo Fisher Scientific...................................57, 58, 66,
Quantitative PCR (qPCR)................................10, 11, 37, 69–71, 74, 141, 146, 160, 161, 164, 368, 374,
116, 131, 149–173, 176–178, 189, 193, 420 375, 378–380, 384, 386, 389
Touch DNA....................... 40–43, 61, 80, 351, 352, 368
R
Rapid DNA....................................................... 4, 367–394 Y
RapidHIT™ ......................................................... 367–394 Yield gel ....................................................... 130, 139, 141
RapidINTEL™ ................. 368, 370, 373, 376, 389, 393 Y-STR ................................ 152, 208, 227, 242, 253, 399