Agrobacterium Mediated Transformation of
Agrobacterium Mediated Transformation of
Agrobacterium-mediated transformation of upland rice is established in few numbers of cultivars due to the high cultivar-
specificity of regeneration from transformed explants. Further, dehalogenase E (dehE) gene had been characterized in
Pseudomonas putida and it produces an enzyme that degrades dalapon. This study aimed to transform Turkish upland rice with
the dehE herbicide resistant gene and addresses the challenges of transgenic rice recovery by identifying explant and
transformation method. Constructed vector pCAMdehE carrying dehE gene was transferred into the rice shoot apex by
Agrobacterium-mediated transformation. The transformed rice was analyzed for expression of the transgenes by polymerase
chain reaction (PCR). Herbicide resistance leaf painting assay was carried out at different dalapon herbicide concentrations to
the transgenic rice leaves. Transformation efficiency percentage (putative) was highest (32.66%) in 5 days old explants. PCR
analysis resulted in the amplification of the dehE, T-DNA border endonuclease (virD2) and hygromycin phosphotransferase
(hpt) genes from the transgenic rice. In addition, dehalogenase activity was proved with higher dalapon tolerance in the rice.
Dalapon effects started to appear in the transformed rice at 180 mg/l, while in non-transformed ones at 60 mg/l concentration.
The results showed that transformed plants have more tolerance to the herbicide than the non-transformed ones.
been confirmed to be used-up in sugarcane, sugar beets, Gene Construct and Agrobacterium Transformation
corn, potatoes, asparagus, grapes, rice, citrus, nut trees In this research, Agrobacterium tumefaciens LBA
and non-crop lands13-14. It was also recorded for usage in 4404 and pCAMBIA1301 binary expression vector
many non-crops applications including lawns, drainage was used. The vector is carrying hygromycin
ditches along railroad tracks and in industrial areas15. phosphotransferase (hpt) and kanamycin (KAN)
According to Hilton et al16 dalapon breaks down the resistant genes, β-glucuronidase (GUS) reporter gene
pantothenate-synthesis enzyme in the biosynthesis from E. coli with an intron, driven by cauliflower
pathway of plants and inhibits synthesis of pantothenate mosaic virus (CaMV) 35S promoter and nos poly-A
by competing with pantoate, a precursor of pantothenate. terminator sequences27. Earlier, dehE gene isolated
Herbicide tolerance is one of the most important traits from Pseudomonas putida strain TF4 (GenBank
that have been applied to manage unwanted plants accession No. MG518568.1) were amplified by PCR
efficiently for rice agriculture17. Some bacterial group using gene specific primers (Table 1). The specific
capable of using the herbicide dalapon has been primers were designed by incorporating BglII and
identified by continuous flow enrichment culture18-19. BsteII restriction sites (Table 1) for easy ligation with
Genes from the bacteria are being engineered to develop pCAMBIA1301 vector. Gene double digestion with
herbicide tolerant plants, including the dehalogenase E restriction endonuclease (BglII and BsteII) enzymes
(dehE) gene20 and bromoxynil (bxn) gene21. As well, was performed according to the instructions of
bialaphos resistance (bar) gene exists broadly in all manufacturer for pCAMBIA1301 vector. The
Streptomyces hygroscopius, which plays an important amplified dehE gene flanked with BglII and BsteII
role in detoxifying herbicide phosphinothricin (PPT) in was constructed into pCAMBIA1301. The band
crop plant21. equivalent to 900 bp is dehE gene was successfully
Dehalogenase genes have been incorporated into inserted into pCAMBIA1301
plants as reported by Buchanon-Wallostan et al22. The Agrobacterium transformation was planned
They introduced dehE gene into the tobacco as described by Sambrook et al28 with slight
genome that resulted in the production of transgenic modification as described by Kaya et al (2013).
tobacco Nicotiana plumbaginifolia. Different types Competent A. tumefaciens strain LBA 4404 was
of dehalogenase genes were genetically transformed transformed with constructed pCAMBIA1301 vector
viz., Agrobacterium-mediated transformation22, through freeze-thaw transformation method29.
23
electroporation and particle bombardment24 into Recombinant A. tumefaciens were grown for 2 days
several plants including rice, Arapidopsis thaliana and on Agrobacterium (AB) medium with containing
tobacco. All these studies focused on the type of 50 mg/l kanamycin30 at 28°C by shaker at 250 rpm.
explants used like embryogenic callus, immature The overnight culture (1 ml) was transferred to
embryo and shoot apex25. So far no report is available on 100 ml of fresh AB medium containing 50 mg/l
genetic transformation of Turkish upland rice with dehE kanamycin. The cells were pelleted by centrifugation
gene using shoot apex as an explant. Therefore, the after reaching OD600 0.3 and re-suspended in 20 ml
current research is the first to report on the dehE gene infection MS media containing B5 vitamin, 15 g/L
transformation into Turkish upland rice toward maltose, 10 g/L glucose and 100 μM acetosyringone
improving herbicide resistance. at pH 5.6. The inoculated strain LBA 4404 were
pelleted at 2500 rpm for 15 min, then, re-suspended in
Materials and Methods equal volume of pre-induction medium31
Rice Cultivar and Shoot Apex Regeneration supplemented with 20 g/l sucrose, 1 mg/l 2, 4-D,
Turkish upland rice variety, namely Kırçeltiği acotesyringone 50 μM, pH 5.6). The culture was
was used throughout the research which obtained shaken for an hour’s under same condition for
from Ondokuz Mayis University, Samsun, Turkey. infection of the shoot apex explant.
The variety mature seeds were surface sterilized
as described by Karakütük26. The sterilized seed Table 1 — The dehalogenase gene specific primers.
were inoculated onto Murashige and Skoog Primer Primer sequence
name
(MS) media and kept at 25oC. Three, four and
dehE1 F 5’GGAGCAGATCTTATGTTAAACGCTGCG3’
five days old shoot apices (3 - 4 mm) were dehE2 R 5’AGAAGGTAACCTGGTATTCATAAGTAGTCC3’
excise from the seedling and used for genetic
transformation. Bold letters show BglII and BsteII restriction site
KAYA et al: AGROBACTERIUM- MEDIATED TRANSFORMATION OF TURKISH UPLAND RICE 239
Co-cultivation, Agrobacterium-Mediated Transformation and was as previously described by Supari et al and VirD2
Transgenic Rice Regeneration gene as described by Arockiasamy and Ignacimuthu33
To study the effect of hygromycin on shoot apices from leaves of To and control plants. The amplicons
explant, the in vitro regenerated plantlets were were subjected to gel electrophoresis on 1% agarose
initially inoculated into the culture media gel in 1X TAE buffer at 70 V for 40 min. The gel
supplemented with 0.5 mg/l BAP and 0.1 mg/l NAA bands at the expected sizes were cut and purified using
and various concentrations of hygromycin (0, 25, 50, Zymogen TM Gel Recovery Kit (Zymo Research
75, 100 mg/l). A total randomized design experiment D4001) for future use.
was performed and repeated each three times. Three
replicate each with a total of 50 explants were used as Herbicide Bioassay
treatments and control. Herbicide dalapon was obtained from Merck
Shoot apices (3, 4 and 5 days old) were introduced (Germany). Transgenic plants and control were
into the A. tumefaciens suspension for 12 min with analyzed for herbicide resistance (herbicide assay) as
shaking. The transformed explants were blot dried on modified by Kaya et al. Dalapon serial dilutions was
sterile filter paper for few minutes to remove excess made at 20, 40, 60, 120, 180 and 240 mg/ml. Solutions
bacterium before inoculating onto co-cultivation of dalapon were applied to the leaf section of the plants
medium (MS, 30 g/l sucrose, 7 g/l agar, 500 mg/l L- for one week period at one day interval in the plant
proline, pH 5.8, 800 μM acetosyringone). After co- growth chamber by rubbing the middle part of the rice
cultivation for 3 days at 26°C in the dark, the explants leaves with a swab. The transformed and non-
were rinsed 4 - 5 times with sterile water containing transformed leaf was exposed to dalapon by a sponge
500 mg/l cefotaxine, blot dried on sterile paper to brush over one week period with daily exposure.
remove excess A. tumefaciens. The transformed shoot
apices were transferred to regeneration medium Results and Discussion
A (MS, 30 mg/l sucrose, 1 mg/l BAP, 0.1 mg/l NAA, Dehalogenase E (dehE) Gene Isolation and pCAMdehE
Expression Construct
8 g/l agar, pH 5.8 with 500 mg/l cefotaxime and PCR analysis resulted in the amplification of dehE
50 mg/l hygromycin) and incubated in the light gene from Pseudomonas putida strain TF5 genomic
condition under 16 h light photo period for 15 days. DNA using its specific primers as designated by
The shoot apices subsequently were washed with Kaya et al. The gel band is around 900 bp expected
500 mg/l cefotaxime and transferred to regeneration
medium B (MS, 30 mg/l sucrose, 1 mg/l BAP, Table 2 — The hpt gene and VirD2 gene specific primers.
0.1 mg/l NAA, 4 g/l pyhtagel, 8 g/l agar, pH 5.8 with Primer Primer sequence
250 mg/l cefotaxime and 100 mg/l dalapon) and kept name
hpt F 5’GAT GTA GGA GGG CGT GGA TA3’
in plant growth chamber for further regeneration and
hpt R 5’ATA GGT CAG GCT CTC GCT GA3’
selection. Afterwards, shoots of about 2 - 3 cm length
Vir D2 F 5’ATG CCC GAT CGA GCT CAA GT3’
were moved to root induction medium (MS, 30 g/l Vir D2 R 5’CCT GAC CCA AAC ATC TCG GCT GCC CA3’
sucrose, 0.1 mg/l NAA, 4, 0 g/l phytagel, pH 5.8 with
30 mg/l hygromycin and 100 mg/l cefotaxime) for
root formation then roots of about 4 - 5 cm length
were moved to plastic cups for hardening.
size (Fig. 1A). Dehalogenase E enzyme has Agrobacterium is of paramount importance in genetic
been proven to have some activity on 2, 2- transformation of rice. pCAMBIA1301 has been
dichloropropionic acid. Mesri et al34 showed that most recognized to be efficient in genetic modification
wild habitats with diverse population of bacteria Oryza sativa using A. tumefaciens LBA 440439-41.
survive in close proximity to each other can use Therefore, effect of hygromycin on shoot apices prior
similar chemicals in the natural habitats and play a to transformation was evaluated at different
significant function in the microbial bioremediation of concentrations. At 50 μg/L hygromycin one of the
polluted area with dalapon herbicide. explant was germinated which considered suitable
Restriction enzyme BgIII and BsteII sites were used concentration for the analysis of transformants. After
to ensure simple cloning of dehE gene into the plant the transformation the proliferating shoot apex
expression vector. The dehE gene was incorporated into continues to grow in the co-cultivation medium. In the
pCAMBIA1301 to give pCAMdehE. Now, the T-DNA regeneration medium A, several shoot apices that were
of the pCAMBIA1301 contains dehE from P. putida co-cultivated indicate transient expression of dehE
and hpt gene with intron driven by cauliflower mosaic gene and remained green after 15 days of treatment
virus (CaMV 35 S) and nos poly-A terminator with hygromycin as a selective marker. The shoot
sequences (Fig. 2). To ensure that pCAMdehE carries explants that were not infected with transformed
the dehE gene, double digestion analysis using BglII and A. tumefaciens did not proliferate in the regeneration
BsteII was conducted and analyzed on agarose gel medium A, but only in regeneration medium without
(Fig. 1b). The size of the pCAMdehE is 9375 bp hygromycin. Similar finding was reported by
(Lane 2) after the double digestion analysis. Arockiasamy and Ignacimuthu33 and Sarangi et al42.
Chen et al35, Baesi et al36, Kaya et al20 and Malik et al37 Our study indicates the hygromycin and dalapon
also reported on the cloning of genes in pCAMBIA resistance, PCR analysis of transient expression of
vector using same restriction sites. The cloning position transgenes and transformation efficiency in 3, 4 and 5
is exactly within the GUS gene which was excised by days old shoot explants (Table 3). The result showed
the respective enzymes to allow for incorporation of that hygromycin expression efficiency was higher in 5
the dehE gene. The GUS gene serves as an important days old explants (42.66%) compared to 4 days
tool for confirmation of plant transformation studies (25.33%) and 3 days (18.66%) old. The antibiotic
but it is not desired in this current research. As reported showed clear difference between the transformed and
by Kaya et al and Mohamed et al38, GUS gene was non-transformed plantlets. After 30 days in in vitro
removed to allow for proper incorporation of the other condition, some of the putative transgenic plant
gene of interest but not dehE. shoots were analyzed for the presence of the
Agrobacterium-Mediated Transformation of Turkish Upland transgenes and they were indicated positive in
Rice Shoot Apex with pCAMdehE selective medium. This indicated that the putative
Selection of transformation vector and its selectable shoots were successfully transformed with the
marker gene for plant selection as well as strain of pCAMdehE T-DNA containing hpt and dehE gene.
Table 3 — Transformation efficiency of Turkish upland rice as calculated on the basis of dalapon resistance.
Explant age Number of shoot Explants grow on Explants grown on Number of plants Bioassay Transformation
(day old) apices during co- selective medium selective medium positive for PCR results efficiency (%)
cultivation (hygromycin) (dalapon)
3 150 18.66 10.66 12.00 10.66 12.00
4 150 25.33 14.66 14.66 13.66 14.66
5 150 42.66 32.66 32.66 32.66 32.66
KAYA et al: AGROBACTERIUM- MEDIATED TRANSFORMATION OF TURKISH UPLAND RICE 241
Further, more the To putative transgenic lines were selectable marker46-48. The results indicated that
examined for tolerance to dalapon considering the 50 mg/L hygromycin influenced the growth and
successful integration of the dehE gene. development of rice at any stage of development49.
The result shows that the To line has the inhibitory The outcomes were similar to the findings of
effect of dalapon and continue to grow. The toxic Arockiasamy and Ignacimuthu who proved the
effect of the different concentration of dalapon varied Agrobacterium transformation efficiency using shoot
depending on the line and age of the explant. In apex explant.
dalapon selective medium, 5 days old explants was
the best (32.66%). For rice genetic transformation, Transgene Stable Expression
efficient selection involves a substantial level of the The T transgenic rice plants were verified by
marker genes43-44. This is in connection with dalapon leaf paint assay for their resistance to the
integration and expression of the selectable marker herbicide. Different concentrations of the herbicide
and transgenes in the transformants. The were applied on the leaves of both non-transgenic and
dehalogenase genes has been used as an herbicide transgenic upland rice and kept for seven days at 24oC
marker for selection of transformed plant tissues. in green house (16 hrs light, 8 hrs dark). Dalapon
dehE selectable marker gene has been demonstrated herbicide effects begin at 60 mg/L concentration in
in N. tabacum20,38. non-transformed leafs, while the transformed
Putative and non-transformed shoots were excised Turkish upland rice leaves resist up to 180 mg/L
from each culture for genomic DNA isolation. (Fig. 4). This indicated that the dehE transgene has
Dehalogenase gene fragments was amplified at been successfully transformed, integrated and
expected size of 900 bp from 2 putative lines expressed by the Turkish upland rice. The gene
(Fig. 3a), while no amplification from non- provides tolerance to the new variety of Turkish
transformed ones. Those lines demonstrated the stable upland rice against dalapon.
expression of dehE gene. Likewise, the genomic DNA The benefit of shoot apex as explant over
was used as template for hpt gene presence. This other regeneration structures such as callus,
resulted in the amplification of the hpt gene (700 bp) protoplast culture includes genotype independence50.
only from putative plants (Fig. 3b). Since VirD2 is Yuzbasi et al51 reported that retrotransposons led to
existing outside the pCAMdehE T-DNA, it was used mutations which are induced by cell culture and the
to confirm for existence of any contaminating copy numbers due to longer time of incubation. They
Agrobacteriums in the culture (data is not shown). further described that transgenic plants produced
The result of VirD2 PCR showed that the tissues were through use of callus and protoplast display
totally free of bacterial contamination. Equally, higher somaclonal difference. Interestingly, using shoot
transformation efficiency was obtained in 5 days old meristem was possible and goal for direct and
explants (32.66%) compared to 3 and 4 days old. indirect genetic transformation was achieved52.
Many antibiotics were used in plant transformation Using shoot apex explants optimal regeneration
methods the most frequently applied is hgyromycin45. was obtained in rice transformation with limited
The hygromycin (hpt) gene remain the plant number of subculture.
Fig. 3 — (A) PCR amplification of dehE gene from gDNA isolated from putative transgenic upland rice. Lane M; Marker 1 kb ladder
(promega), Lane; 1, 2, 3, 4, 5 DNA of putative transformed rice, Lane 6; Negative control, Lane 7; Positive control. (B) Amplification of
hygromycin gene from putative transgenic upland rice. Lane M; Marker 1 plus kb (promega), Line 1-7; Putative transformed rice, Lane 8;
Positive control, Lane 9; Negative control.
242 INDIAN J BIOTECHNOL, OCTOBER 2020
22 Buchanan W V, Snape A & Cannon F, A plant selectable 39 Hoekema A, Hirsch R, Hooykaas R & Schilperoort R A,
marker gene based on detoxification of the herbicide A binary plant vector strategy based on separation of vir and
dalapon, Plant Cell Rep, 11 (1992) 627-631. T-region of Agrobacterium tumefaciencs Ti-plasmid, Nature,
23 Naested H, Fennema M, Hao L, Andersen M, 303 (1983) 177-180.
Jansen D B et al, A bacterial haloalkane dehalogenase gene 40 Hiei Y, Ohta S, Komari T & Kumashiro T, Efficient
as a negative selectable marker in Arabidopsis, Plant J, transformation of rice mediated by Agrobacterium and
18 (1999) 571-576. sequence analysis of the boundaries of the T-DNA, Plant J, 6
24 Moore K S & Vibha S, A bacterial haloalkane dehalogenase (1994) 271-282.
(dhIA) gene as conditional negative selection marker for rice 41 Rajesh S, Krishnaveni D, Raveendran S, Sivakumar M,
callus cells, In vitro Cell Dev Biol Plant, 44 (2008) 468-473. Gnanam P et al, Agrobacterium-mediated transformation of
25 Dey M S, Bakshi G, Sahoo L & Panda S K, Development of indica rice (Oryza sativa L.), IR64 with mumgbean LEA
a genotype independent and transformation amenable protein gene for water stress tolerance, Am J Plant Physiol, 3
regeneration system from shoot apex in rice (Oryza sativa (2008) 101-110.
spp. indica) using TDZ, 3 Biotech, 3 (2012) 233-240. 42 Sarangi S, Jayeeta G, Anjana B, Sonali D & Mandal A B,
26 Karakutuk S, Determination of the tissue culture parameters Agrobacterium mediated genetic transformation of indica
and drought tolerance in vitro conditions of the varieties of rice varieties involving Am-SOD gene, Indian J Biotechnol,
Turkish upland rice cultivated in Turkey. Master Thesis. 10 (2011) 9-18.
Ondokuz Mayis University, Samsun, Turkey, 2017. 43 Zha Y, Qian Q, Wang H & Huang D, Hereditary behavior of
27 Jefferson R A, Kavanagh T A & Bevan M W, GUS fusions: bar gene cassette is complex in rice mediated by particle
Beta-glucuronidase as a sensitive and versatile gene fusion bombardment, J Genet Genomics, 34 (2007) 824-835.
marker in higher plants, EMBO J, 6 (1987) 3901-3907. 44 Mohammed S, Azman A S & Rahmat Z, Agrobacterium-
28 Sambrook J, Fritsch E F & ManiatisT, Molecular cloning: mediated transformation of rice: Constraints and possible
A laboratory manual, 2nd ed, Cold Spring Harbor Press, solutions, Rice Sci, 26 (2019) 133-146.
Cold Spring Harbor, N. Y.1989, 130-200. 45 Yu H X, Lu M F, Chen X H, Gong Z Y, Liu Q Q et al,
29 Chen H, Nelson R S & Serwood J L, Enhanced recovery of Efficiencies of generating selectable marker free transgenic
transformants of Agrobacterium tumefaciens after freeze- rice with different transformation methods, Rice Sci,
thaw transformation and drug selection, Biotechniques, 16 (2009) 254-260.
16 (1994) 664-670.
46 Ahmed T, Biswas S, Elias S M, Sazzadur R, Narendra T et
30 Chilton M D, Currier T C, Farrand S K, Bendich A J, Gordon
al, In planta transformation for conferring salt tolerance to a
M P et al, Agrobacterium tumefaciens DNA and PS8
tissue-culture unresponsive indica rice (Oryza sativa L.)
bacteriophage DNA not detected in crown gall tumours,
cultivar, In Vitro Cell Dev Biol Plant, 54 (2018) 154–165.
Pro Natl Acad Sci, 71 (1974) 3672-3676.
31 Toriyama K & Hinata K, Cell suspension and protoplast 47 Balaji V, Rajamuni P, Sridevi G & Veluthambi K,
culture in rice, Plant Sci, 41 (1985) 179-183. Agrobacterium-mediated transformation efficiency in black
32 Supari N, Yilmaz K, Maral B & Muhammad A J, Molecular gram and rice enhanced by multiple copies of pTiBo542 virB
characterization of Malaysian rice cultivars using SSR and vir G, Indian J Biotechnology, 2 (2003)
markers, AIP Conference Proceedings (Bali, Indoneasia). 138-146.
2019 2155 (020016). 48 Mukhtar Z & Shahida H, Optimization of particle
33 Arockiasamy I & Ignacimuthu S, Regeneration of transgenic bombardment conditions for rice (Oryza Sativa L.)
plants from two indica rice (Oryza sativa) cultivars using transformation, Pak J Agri Sci, 55 (2018) 271-278.
shoot apex explants, Plant Cell Rep, 26 (2007) 1745-1753. 49 Park S J, Agrobacterium tumefaciens-mediated
34 Mesri S, Roswanira A W & Huyop F, Degradation of transformation of tobacco (Nicotiana tabacum L.) leaf disks:
3-chloropropionic acid (3CP) by Pseudomonas sp. B6P isolated Evaluation of the co-cultivation conditions to increase-
from a rice paddy field, Anl Microbiol, 59 (2009) 447-451. glucuronidase gene activity. M.S. Thesis, Louisiana State
35 Chen P Y, Wang C K, Soong S C & To K Y, Complete University, Baton Rouge, 2006.
sequence of the binary vector pBI121 and its application in 50 Park S H, Pinson S R M & Smith R H, T-DNA integration
cloning T-DNA insertion from transgenic plants, Mol Breed, into genomic DNA of rice following Agrobacterium
11 (2003) 287-293. inoculation of isolated shoot apices, Plant Mol Biol,
36 Baesi M, Nabati A D, Rajabi-Memari H, Siahpoosh MR, 32 (1996) 1135-1148.
Abdollahi M R et al, Cloning and transformation of hepatitis 51 Yuzbasioglu G, Sibel Y, Sevgi M & Nermin G, Analysis of
B surface surface antigene (HBsAg) gene to tomato, Hopi/Osr27 and Houba/Tos5/Osr13 retrotransposons in rice,
Jundishapur J Nat Pharm Prod, 6 (2011) 32-41. Biotechnol Biotechnol Equip, 30 (2016) 213-218.
37 Malik S, Abuzar I & Samra A, Cloning of tomato SUMO1 52 Ulian E, Smith R H, Gould J & McKright T D,
and development of a CaMV 35S based gene construct for Transformation of plants via the shoot apex, In Vitro Cell
plant transformation, Int J Biosci, 9 (2016) 86-96. Dev Biol, 24 (1988) 951-954.
38 Mohamed E, Rahiman F, Wahab R, Zain C, Javed M A et al, 53 Prasetyo F H H, Bambang S & Netty E, Cloning,
A plant transformation vector containing the gene dehd for transformation and expression of cell cycle-associated
the development of cultivars resistant to monochloroacetic protein kinase OsWee1 in indica rice (Oryza sativa L.),
acid, J Anim Plant Sci, 26 (2016) 1133-1139. J Genet Eng Biotechnol, 16 (2018) 573-579.