0% found this document useful (0 votes)
17 views6 pages

Symptoms Fusarium Oxysporum - Potato Iraq

Uploaded by

Ghozi Hafish
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
17 views6 pages

Symptoms Fusarium Oxysporum - Potato Iraq

Uploaded by

Ghozi Hafish
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 6

NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

DOI: https://doi.org/10.56286/ntujavs.v2i2

Fusariumoxysporum f. sp. tuberosi causing wilt disease on potato


plants in Iraq.
1st Ahmed Younes Khalil, 2nd Ali HamoodThanoon
1. 2 Plant Protection Department, Agriculture and Forestry College, Mosul University, Mosul, Iraq.

Article Informations ABSTRACT

Received: 07-08- 2023, Fusarium species are causing postharvest stem-end rot and dry rot throughout
Accepted: 19-10-2023, the potato growing season. At the current study, the causative wilt agent was
Published online: 28-12-2023
identified in potatoes which were grown in Nineveh province, northern of Iraq,
Corresponding author: in autumn season of 2020. The disease manifests through symptoms like
Name: Ali Hamood Thanoon partial yellowing between the veins on the leaves of potatoes or overall
Affiliation : Plant Protection wilting of the plant. Fungal species isolated from the infected potato
Department, Agriculture and plants were subsequently grown on potato dextrose agar, resulting in
Forestry College, Mosul developing aerial mycelia appeared as white along violet-dark
University, Mosul, Iraq. pigmentation. The fungus was identified from the phenotypic diagnosis as
Email:
[email protected]
Fusariumoxysporum, and the pathogen was confirmed by Koch's hypotheses as
well as affirmed through molecular test identification, where methodology
Key Words: proved it. Molecular based pathogen identification was carried out through an
Potato, application of conserved DNA ribosomal region of internal transcribed spacer
Wilt. (ITS). Moreover, the complete verified ITS sequences are homologous to the
Solanumtubersum L., isolates of Fusariumoxysporum in GenBank database having 99% similarity. At
Fusariumoxysporum f. sp. Gen-Bank, isolated one in Iraq was given #: MH859948.1 being an Accession.
tuberosi, The best to the available knowledge, such is Fusariumoxysporum f. sp. tuberosi
1st molecular Potato record in Iraq.

©2023 NTU JOURNAL OF AGRICULTURAL AND VETERINARY SCIENCES, NORTHERN TECHNICAL UNIVERSITY.
THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY LICENSE: https://creativecommons.org/licenses/by/4.0/

199
Corresponding author /NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

Introduction samples were collected with symptoms of wilting


through visits to the affected potato fields. They
Solanaceae is the family potato (Solanumtubersum were stored in clean bags of plastic and conveyed
L.) is belonging to; it is considered as one of the to the Department of Plant Protection, “laboratories
mostly important and worldwide grown crops and of Agriculture and Forestry College” – University
has a vital function in nutrition of human. Potato is of Mosul. In order to remove soil, samples were
the 4th mostly essential food crop following rice, washed with running water for 30 minutes, then
wheat, and corn in terms of human consumption parts of the root system were taken with the crown
(Muthoni and Nyamongo,2009). potato production area. cut into small parts with a length of
exceeded 376 million tons globally, harvested from approximately 4-5 mm. These parts were surface
an area of 19.25 million hectares (Fawstat,2018). In sterilized with NaClO at 1% concentration for 3
2019, potato was grown in Iraq on a land of 4.56 min and then washing was done with sterilized DW
thousand donums to produce a sum of 392.3 to remove the excess of the substance. The
thousand tons of potato for the spring and autumn sterilization was dried between filter paper sterile
crops (Central Bureau of Statistics,2020). Potatoes folds, and the parts were distributed on 9 cm
as staple food is utilized directly or being managed diameter Petri dishes comprising media of dextrose
as industrial starch, ingredients of food or into PDA and potato which was previously sterilized in
other food products. Also, for the subsequent the autoclave at 1.5 kg / cm2 pressure and 121 ° C
season, potatoes as seed tubers are re-utilized for temperature for twenty min, after sterilization
growing the crop(Aktaruzzamam et al,2014). termination period, and the pressure fell to zero.
Potato crop cultivation is threatened by several The flasks were left to reduce the temperature of
fungal diseases including vascular wilt caused by the mediumand the antibiotic Amoxicillin was
Fusariumoxysporum, followed by other wilt added to it at a 250 ml / liter concentration for
pathogens Verticilliumdahliae, V. alboatrum and V. preventing bacterial growth. Incubation for the
tricorpus(Jabnoum-Khiareddine et al 2005 and plates was done at 25 ° C for five days, and then
Daami-Remadi et al ,2011).Fusarium genus the isolates were purified test of Pathogenicity
contains a complex species which has numerous Pathogenicity test of F. oxysporumf. sp. tuberosi .
clonal lineages(Michielse and Rep,2009). Thus, A pathogen’s pathogenicity was carried out
this is distributed on a worldwide basis and utilizing method of suspension spores using plastic
comprise a responsibility for powerful wilts as pots (25 cm) in diameter containing soil after
vascular, and capable of causing various rots of sterilization with formalin 37% at a concentration
plant structures for instance, corms, bulbs, of 5%. The tubers were surface sterilized with 10%
seedlings, tubers, cobs, roots and stalks of a NaClO solution then planted in post after
widespread range of plants(Michielse and contaminating the soil with the pathogenic fungus
Rep,2009 and Enya et al,2008). Furthermore, 1x 107 spore’s.ml-1. one tuber per pots at a depth of
species of Fusarium are causing postharvest stem- 10 cm. The same process was carried out using
end rot and dry rot throughout the potato growing water in the control and then directly planted.
season (Bayona et al,2011 and Pont ,1976).Growth Symptoms were monitored and the infected plants
of F. oxysporum for infection is preferred by were re-isolated to confirm the pathogenicity of the
conditions of dry soil and 15o C is soil optimum fungus and to apply Koch's hypotheses.
temperature (MacMillan and Meckstroth , 1925). In Extraction of Genomic DNA and Amplification
the last couple years, Fusarium potatoes wilt has of PCR
turned to be prevalent in all cultivation areas and Single spore isolation of F. oxysporum was grown
has been often connected to symptoms of early at 25–28°C in broth of dextrose potato (PDB) in
death causing large losses of yield up to 30-50% dark for 10 days. Mycelia harvesting was
and reduced quality of tubers(Daami-Remadi et al performed through filtration using Whitman filter
,2011and Kerkeni et al,2013 and Ommati et al paper 1. Further, the mycelia being harvested were
,2013). The Fusarium wilt disease occurrence utilized instantaneously for the extraction of DNA
caused by F. oxysporum in potato fields in some while utilizing Fungal/Bacterial/ DNA MiniPrep™
regions of the world has reached 15- Yeast, Catalog ،D6005. This was accomplished
70%(Gachango et al ,2012). Moreover, the fungus conferring to the protocol factory methods provided
F.oxysporumf. sp. tuberose causing dry rot on stem underneath:
and end rot the tubers as the vascular potato wilts 1. Wet weight of 50 – 100 mg (bacterial or fungal
(Shrivastava , 1970 and Daami-RemadiMejda and cells1) that has been re-suspended was added to
Mahjoub,2004). water of 200 of or tissue addition of 200 mg to
Lysis Tube (which is of 0.1 mm & 0.5 mm) in form
Materials and Methods of as ZR Bashing Bead™ or isotonic buffer (e.g.,
Isolation and Diagnosis PBS). Addition of 750 μl as LysisSolutionto tube
Isolation was obtained from potato fields infected # 2 was done.
with wilt disease in Nineveh province, northern of
Iraq, during the spring season of 2019. Potato

200
Corresponding author /NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

2. Bead beater securing as fitted was done along a gently removed. In the EP’s horizontal unit, the
tube holder of 2 ml having association and process plate was fixed to a stand exemplified through the
at a speed as maximum for ≥ five min. utilized tank in EP. Moreover, TBE buffer filled the
3. In a microcentrifuge, Centrifugation was done tank while covering the gel surface.
for the Lysis Tube of ZR BashingBead™ at 10,000 Sample preparation
x g for one min. Following the mixing process, loading is processed
4. The 400 μl of supernatant was transferred to a to the gel pores. Three microliters of processor
Zymo-Spin™ IV Spin Filter (Orange Top) was loading buffer (Intron/Korea) and five liters of
carried out in collection tubes, after that fictitious DNA for EP (loading dye) were prepared.
centrifugation was performed at 7,000 x g for 1 Moreover, the electricity current of 7 V\C2 was
min. exposed for a time period of 1-2 hour as long as the
5. Further, 1,200 μl Fungal/Bacterial Binding movement of tincture took place to the other side of
Buffer of DNA was incorporated to the filtrate in gel. Thus, gel was further inspected through a UV
collection tubes from step # 4. source of 336 nm and after that gel was placed in
6. Mixture of 800 μl was transferred from step # 5 pool containing a staining solution of 500 ml DW
to a Zymo-Spin™ IIC Column 3in all collection and 3µl Red safe Nucleic acid.
tubes and then centrifugation was performed at ITC Gene Detection through PCR Utilizing
10,000 x g for one min. The ITS gene detection procedure is carried out
7. Flow discarding was done from tube of using amplification primers. Additionally, the ITS
collection and repeating to step # 6. segment was amplified using the ITS1 F: 5′-
8. To the column of Zymo-Spin™ IIC, DNApre- TCCGTAGGTGAACCTGCGG-3′ and ITS4 R: 5′
wash buffer addition of 200 μl was done in a new TCCTCCGCTTATTGATATGC-3′ forward and
tube of collection and centrifugation for one min at reverse primers. IDT (Integrated DNA
10,000 x g. Technologies Company, Canada) provided these
9. To the column of Zymo-Spin™ IIC, primer sets. Similar to that, PCR amplification was
Fungal/Bacterial DNA Wash Buffer addition of performed in a 25 µl total volume that contained
500 μlandcentrifugtion for one min at 10,000 x g. 1.5 µl DNA, 5 µl Taq PCR PreMix (Intron, Korea),
10. After moving the Zymo-SpinTM IIC column to and 1µl of every primer (10 pmol). After that
a clean 1.5 ml microcentrifuge tube, the column addition of DW into a 25 µl tube of a total volume.
matrix was immediately infused with 100 μl (at Thus, the cycling conditions as thermal were
least 35 μl) of DNA elution buffer. Therefore, a performed as following: Denaturation for three
10,000 x g centrifugation for 30 seconds was used minutes at 94 °C, after that 35 cycles for 45s
to elute the DNA. whereas, at 52°C, 94 °C, for 1 minute along with
For initial denaturation and annealing, the 72 °C for one minute. However, the final step
condition being optimal has recognized following incubation was done at 72 °C for seven minutes
preforming numerous experiments for gaining such with the help of a thermal Cycler (named as: Gene
condition, the temperature has changed during the Amp, PCR system 9700; Applied Bio-system).
Gradient PCR operation for all samples to choose Hence, PCR products were isolated from 1.5%
the best setting, and the DNA template agarose gel EP, further these were projected via
concentration has changed from 1.5-2 μl, which are UV exposure at 302 nm while following the
thought to be the two most important variables in process of red stain staining (Intron Korea).
primer annealing with complement.
Table 1. F. oxysporum isolate's RNA gene
DNA Agarose gel electrophoresis (EP) polymorphism
In order to assess the pieces of DNA, EP was Gene: 18S ribosomal RNA gene
performed following the procedure of extraction. No. Substituti Locati Nucleo Sequence Source Identit
As well as to perceive outcomes of PCR on type on tide ID with ies
interaction, where presence of standard DNA compare
distinguished PCR interaction result’s bundle size 1 Transvert 174 C\A ID: MH8 Fusariumo 99%
on the Agarose gel. ion 59948.1 xysporum f.
Agarose gel preparation Transvert 176 T\A sp. tuberosi
Based on (Sambrook et al ,1989),the agarose gel ion
was prepared in 1.5% condensation via agarose Sequencing and Sequence Alignment
melting of 1.5 g in formerly prepared TBE buffer Via 2% agarose gel EP, the products of PCR were
of 100 ml. Agarose was boiled then kept to cool at separated and envisioned through UV exposure at
(45-50 ᵒC). In the pour plate, the gel was poured (302 nm) following red stain staining or ethidium
where the agarose support plate has been prepared bromide.
following comb fixing to create holes that were Gene sequencing was done online biotechnology
holding the samples. Gently, the gel was poured to lab through (NICEM) website
avoid air bubbles formation and kept for thirty min (http://nicem.snu.ac.kr/main/?en_skin=index.html)
to cool. Of the agarose as solid, the comb was while machine used was Applied Biosystem DNA

201
Corresponding author /NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

sequencer 3730XL). Furthermore, the homology


search was completed with the usage of program
(BLAST) available online at (NCBI) website
(http:// www.ncbi.nlm.nih.gov) as well as BioEdit
program.

RESULTS
Isolation and Diagnosis
On PDA, the colonies of fungi were isolated and
comprised of aerial mycelia eing white in which
afterword formed pigments as dark violet which are
F. oxysporumcharacteristic (Figure 1, D). F.
oxysporumhas 3 conidia types: microconidia,
macroconidia, and chlamydospores. In contrast,
other Fusariumspp. have just 2 conidia types:
chlamydospora and macroconidia. Shapes of
microconidia, macroconidia, chlamydospores and
conidiophores (Figure 1, A-C) represent the
exclusive F. oxysporum characteristics. Fig 1. A, Conidiophores; B, Macroconidia and
microconidia; C, Chlamydospores; D, 1-week-old F.

oxysporum colony growing on agar media of potato


dextrose; E, Disease-symptoms on potato plant
showing yellowing between the veins; F, Potato
which was inoculated with F. oxysporum
established symptoms of stem-end rot following
incubation of seven 7 weeks.
The conidiophors and monophialialides were the
morphological traits of the isolate of F. oxysporum
that was under study. Microconidia are ellipsoidal
to slightly curved or cylindrically straight, with
recorded dimensions of 1.9 11.2 μm, 2.3 3.3 μm,
and Macroconidia Shape Fusiform, slightly
curved, with 2–5 points on both ends, measuring
27.7–35.6(μm) in length and 3.4–3.3(μm) in width.
Globose-ellipsoidal, in pairs or singly, are the
chlamydospores' shape. Length: 7.219.3 μm, width:
6.729.5 μm. This trait is consistent with what
Booth stated(Booth,1971).
Pathogenicity test
The first symptoms of the disease appeared on the
potato plant 33 days following fungus inoculation
in the form of yellowing between the veins of the
lower leaves of the plant. After that, the lower
leaves wither and dry completely and appear
attached to the stem. Other symptoms associated
with wilting may appear, such as stunting and leaf
curl. Then it was re-isolated from infected plant to
prove the hypotheses of Koch, where it was
confirmed that the cause of the wilt disease was the
fungus Fusariumoxysporum(Fig 1, E).
Sequencing and Sequence Alignment
For confirming the identification morphologicaly,
the F. oxysporum (ITS) isolate region was
amplified with ITS primers being universal. The
isolate was diagnosed partially following
conformism with the gene bank copies present at
(NCBI) genes which provide the (diagnostic
accuracy of) 99% match with that of isolation: thus,

202
Corresponding author /NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

the MH859948.1 Query sequence cover was TAATTCGCGTTCCTCAAATTGATTGGCGGT


observed to be 99% (Figure 1). 360
Table 2. Conformism ratio amongst copies particularly Sbjct 351 ............................................................
diagnosed and others copies at NCBI 410
Score Expect Identities Gaps Strand Query 361
872 bits 0.0 486/488 0/488 Plus/Plus CACGTCGAGCTTCCATAGCGTAGTAGTAAA
(966) (99%) (0%) ACCCTCGTTACTGGTAATCGTCGCGGCCAC
420
The outcomes demonstrated the genetically
Sbjct 411 ............................................................
association amongst F. oxysporumisolated in form
470
of black prism) and are saved in Gen-Bank
Query 421
database globally. Moreover, figure 2 implies
GCCGTTAAACCCCAACTTCTGAATGTTGAC
comparison amongst the local Iraqi F.
CTCGGATCAGGTAGGAATACCCGCTGAACT
oxysporumf.sp.tuberosistrain isolate with that of
480
the F. oxysporumf.sp. tuberose strain documented
Sbjct 471 ............................................................
in (NCBI) which have been isolated from various
530
countries. Further, this exhibited a compatibility of
Query 481 TAAGCATA 488
99% having an Iranian accession #: MH859948.1
Sbjct 531 ........ 538
as well as 99% with Poland accession #
Figure 1. Sense flanking of partial ITS gene
MW776326.1: Poznan and 99% with accession #
sequencing in comparison to the gene
MW704331.1from India, 99% # MW600442.1
MH859948.1standard from Gene Bank. Here, the
,MW533013.1and MW429367.1form China,
sample query signifies; Subject signify (NCBI)
Brazil: Parana and Mexico, respectively. The ITS
database
sequence nucleotide of an Iraqi isolate was
assigned a GenBank Accession # MW811385.1. In
Iraq, such is the 1st potato wilt disease report caused
by F. oxysporum.
Query 1
ACTCCCAAACCCCTGTGAACATACCACTTG
TTGCCTCGGCGGATCAGCCCGCTCCCGGTA
60
Sbjct 51
...................................................................................
............................................................. 110
Query 61
AAACGGGACGGCCCGCCAGAGGACCCCTA
AACTCTGTTTCTATATGTAACTTCTGAGTaa Fig. 2: Phylogenetic tree constructed through a
120 neighbor-joining method presenting the
Sbjct 111 phylogenetic relationships of F. oxysporumf.sp.
................................................................................... tuberosi associating to the gene bank’s reference
............................................................ 170 sequences.
Query 121
aacaaaaaataaatcaaaaCTTTCAACAACGGATCTC Conclusion
TTGGTTCTGGCATCGATGAAGAA 180 The results exhibited that the F.oxysporumf. sp.
Sbjct 171 tuberosiwas identified as an agent of causative
...C.T......................................................................... Potato wilt in Iraq. According to our knowledge,
............................................................ 230 the Fusariumoxysporumf. sp. tuberosiis is being =
Query 181 recorded for the first time of molecular Potato in
CGCAGCAAAATGCGATAAGTAATGTGAATT Iraq.
GCAGAATTCAGTGAATCATCGAATCTTTGA
240 Acknowledgements
Sbjct 231 ............................................................ The authors thank the Mosul University and
290 Agriculture and Forestry College for their kindly
Query 241 aid in conducting the undertaken study.
ACGCACATTGCGCCCGCCAGTATTCTGGCG
GGCATGCCTGTTCGAGCGTCATTTCAACCC References
300 [1] Aktaruzzaman, M., Xu, S. J., Kim, J. Y., Woo,
Sbjct 291 ............................................................ J. H., Hahm, Y. I., & Kim, B. S. (2014). First
350 report of potato stem-end rot caused by
Query 301 Fusariumoxysporum in Korea. Mycobiology,
TCAAGCACAGCTTGGTGTTGGGACTCGCGT 42 (2), 206-209.

203
Corresponding author /NTU Journal of Agricultural and Veterinary Sciences (2023) 3 (4) : 199-204

[2] Bayona, L. G., Grajales, A., Cardenas, M. E., tuberosi. African Journal of Plant Sciences
Sierra, R., de Garcia, M. C., Bernal, A., ... and Biotechnology, 7, 36-41.
&Restrepo, S. (2011). First report of
[12] MacMillan, H. G., &Meckstroth, G. A. (1925).
Fusariumoxysporum causing potato dry rot in
The critical temperature for infection of the
Solanumtuberosum in Colombia. New Disease
potato seed piece by Fusariumoxysporum. J
Reports, 24(1), 14-14.
Agric Res, 32, 917-21.
[3] Booth C (1971) The genus Fusarium.
[13] Michielse C. B., & Rep M. 2009. Pathogen
Commonwealth Mycological Institute, Kew
profile update: Fusariumoxysporum. Mol
[4] Central Bureau of Statistics. 2020. Production Plant Pathol;10:311-24.
of Cotton, Yellow Corn and Potatoes for the
[14] Muthoni, J., &Nyamongo, D. O. (2009). A
year 2019. Ministry of Planning, Republic of
review of constraints to ware Irish potatoes
Iraq
production in Kenya. Journal of horticulture
[5] Daami-Remadi, M., Jabnoun-Khiareddine, H., and forestry, 1(7), 98-102.
Ayed, F., & El Mahjoub, M. (2011).
[15] Ommati, F., Zaker, M., &Mohammadi, A.
Comparative aggressiveness of
(2013). Biological control of Fusarium wilt of
Verticilliumdahliae, V. albo-atrum and V.
potato (Fusariumoxysporum f. sp. tuberosi)
tricorpus on potato as measured by their
by Trichoderma isolates under field condition
effects on wilt severity, plant growth and
and their effect on yield.
subsequent yield loss. Functional Plant
Science and Biotechnology, 5, 1-8. [16] Pont, W. (1976). Studies on tuber stem end rot
and stem rot of potato in north Queensland
[6] Daami‐RemadiMejda, M., &Mahjoub, E. M. E.
caused by Fusariumsolani and
(2004). Emergence en Tunisie de
Fusariumoxysporum [fungi]. Queensland
Fusariumoxysporum f. sp. tuberosi agent de
Journal of Agricultural and Animal Sciences.
flétrissurevasculaire des plants et de
pourrituresèche des tubercules de pomme de [17] Sambrook, J., E.F. Fritsch and T. Maniatis
terre. EPPO Bulletin, 34(3), 407-411 (1989). Molecular Cloning: A Laboratory
Manual, 2nd ed. Cold Spring Harbor
[7] Enya, J., Togawa, M., Takeuchi, T., Yoshida,
Laboratory, Cold Spring Harbor, NY
S., Tsushima, S., Arie, T., & Sakai, T. (2008).
Biological and phylogenetic characterization [18] Shrivastava, S. (1970). Fusarium wilt of Potato
of Fusariumoxysporum complex, which in India. I. Occurrence and
causes yellows on Brassica spp., and proposal pathogenicity. Indian Phytopathology, 23(3),
of F. oxysporum f. sp. rapae, a novel forma 503-510.
specialis pathogenic on B. rapa in
Japan. Phytopathology, 98(4), 475-483.
[8] Fawstat, 2018
[9] Gachango, E., Kirk, W., Schafer, R., &
Wharton, P. (2012). Evaluation and
comparison of biocontrol and conventional
fungicides for control of postharvest potato
tuber diseases. Biological control, 63(2), 115-
120.
[10] Jabnoun‐Khiareddine, H., Daami‐Remadi, M.,
& El Mahjoub, M. (2005). Emergence en
Tunisie de nouveaux pathotypes de
Verticilliumtricorpuspouvantattaquer la
tomate, l’aubergine et la pomme de
terre. EPPO Bulletin, 35(3), 497-503.( 3 )
Michielse, C. B., & Rep, M. (2009). Pathogen
profile update:
Fusariumoxysporum. Molecular plant
pathology, 10 (3), 311-324.
[11] Kerkeni, A., Daami-Remadi, M., &Khedher,
M. B. (2013). In vivo evaluation of compost
extracts for the control of the potato Fusarium
wilt caused by Fusariumoxysporum f. sp.

204

You might also like