Page 1 Sample Paper 18 CBSE Biology Class 12

Sample Paper 18
Biology (044)
Class XII Session 2023-24
Time: 3 Hours Max. Marks: 70
General Instructions:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has
7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3
questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labeled diagrams should be drawn.

SECTION - A
1. The permissible use of the technique amniocentesis is for
(a) detecting sex of the unborn fetus
(b) artificial insemination
(c) transfer of embryo into the uterus of a surrogate mother
(d) detecting any genetic abnormality

2. The primary producers of the deep-sea hydrothermal vent ecosystem are

(a) green algae (b) chemosynthetic bacteria
(c) blue-green algae (d) coral reefs

3. Two closely related different species cannot live for long duration in the same niche or habitat. This law is called
(a) Allen’s law (b) Gloger rule
(c) Competitive exclusion principle (d) Weismann’s theory

4. Find the correct palindromic sequence for the given DNA segment.
5l ATTGCAAT 3l
(a) 5l GAACGTTA 3l (b) 3l TAACGTTA 5l
(c) 5l AAACGTTT 3l (d) 3l ATTGCAAT 5l

5. Productivity at the second trophic level is always

(a) greater than the productivity at the first trophic level
(b) less than the productivity at the first trophic level
(c) equal to the productivity at the first trophic level
(d) extremely variable compared to the productivity at the first trophic level.

Continue on next page....

Install NODIA App to See the Solutions.

Click Here To Install
Page 2 Sample Paper 18 CBSE Biology Class 12

6. Match column I with column II and select the correct option from the given codes.

Column I Column II
A. Dihybrid test cross (i) 9:3:3:1
B. Law of segregation (ii) Dihybrid cross
C. Law of independent assortment (iii) 1:1:1:1
D. ABO blood group in man (iv) Purity of gametes
(v) Multiple allelism

(a) A-(iii), B-(iv), C-(ii), D-(v)

(b) A-(i), B-(iv), C-(ii), D-(v)
(c) A-(iii), B-(ii), C-(iv), D-(v)
(d) A-(ii), B-(v), C-(iii), D-(i)

7. Identify A, B, C and D in the flow chart given below that represents the process of recombinant

(a) A-Restriction endonuclease, B-Restriction exonuclease, C-DNA ligase, D-Transformation

(b) A-Restriction endonuclease, B-Restriction endonuclease, C-DNA ligase, D-Transformation
(c) A-Restriction endonuclease, B-Restriction endonuclease, C-Hydrolase, D-Transformation
(d) A-Restriction endonuclease, B.-Restriction endonuclease, C-Hydrolase, D-Transduction

8. Statin, a blood-cholesterol lowering agent, is commercially obtained from

(a) Trichoderma polysporum
(b) Acetobacter aceti
(c) Clostridium butyricum
(d) Monascus purpureus

Install NODIA App to See the Solutions.

Click Here To Install
Page 3 Sample Paper 18 CBSE Biology Class 12

9. The age pyramid with broad base indicates

(a) high percentage of old individuals
(b) low percentage of young individuals
(c) a stable population
(d) high percentage of young individuals

10. A sewage treatment process in which a part of decomposer bacteria present in the wastes is recycled into the
starting of the process is called
(a) primary treatment (b) activated sludge treatment
(c) tertiary treatment (d) none of these

11. The term ‘immunity’ refers to

(a) mutualism between host and parasite
(b) ability of the host to fight the disease causing organisms
(c) ability of the parasite to survive within a host
(d) a fatal disease

12. Refer to the given table of contrasting traits in pea plants studied by Mendel.

Which of the given traits is correctly placed?

(a) (i), (ii) and (iii) only
(b) (ii), (iii) and (iv) only
(c) (ii) and (iii) only
(d) (i), (ii), (iii) and (iv)

Install NODIA App to See the Solutions.

Click Here To Install
Page 4 Sample Paper 18 CBSE Biology Class 12

13. Assertion : Production ecology deals with the productivity.

Reason : Desert has lowest productivity.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.

14. Assertion : The endometrium undergoes cyclical changes during menstrual cycle.
Reason : The myometrium exhibits strong contractions during delivery of the baby.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.

15. Given below is the karyotype of a patient.

It depicts the arrangement of different sets of chromosome arranged in numerical order. It is basically used to
look for abnormalities in chromosome number or structure. Study the given karyotype and comment upon the
appropriateness of the Assertion and the Reason.

Assertion : The given karyotype shows that patient is suffering from Down’s syndrome.
Reason : In patient, the chromosome abnormality is caused due to the absence of one of the sex chromosomes,
i.e., 45 + X.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.

16. Assertion : The development of embryo sac from a single functional megaspore is termed as monosporic development.
Reason : In monosporic (Polygonum) type of embryo sac development, usually the megaspore which is situated
towards micropylar end remains functional.
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is false but R is true.

Install NODIA App to See the Solutions.

Click Here To Install
Page 5 Sample Paper 18 CBSE Biology Class 12

SECTION - B
17. State the role of thymus as a lymphoid organ. Name the cells that are released from it and mention their function.

18. Two different types of population growth curves are used to measure population density. Study the two growth
curves and answer the corresponding question.

A forest having unlimited food resource hardly has any carnivores. Identify the curve that will explain the
population growth of herbivores in that forest. Also give the equation representing the graph.

19. How does EcoRI specifically act on DNA molecule? Explain.

20. “Australian marsupials exhibit adaptive radiation but they along with placental mammals show convergent
evolution” . Justify the statement.

21. Describe the process of megasporogenesis in angiosperms until 8 nucleate stage.

22. What do oral pills contain and how do they act as effective contraceptives?


O
When is sterilisation technique advised to married couples? How is it carried out in a human male and a female,
respectively?

SECTION - C
23. (a) What are the transcriptional products of RNA polymerase III?
(b) Differentiate between capping and tailing.
(c) Expand hnRNA.

24. (a) Explain parasitism with the help of one example.

(b) State Gause’s competitive exclusion principle.

Install NODIA App to See the Solutions.

Click Here To Install
Page 6 Sample Paper 18 CBSE Biology Class 12

25. Work out a cross upto F2 generation between two pure breed pea plants, one bearing purple flowers and the other
white flowers.

26. (a)

Read the graph given above and correlate the uterine events that take place according to the hormonal levels on
(i) 6-15 days
(ii) 16-25 days
(iii) 26-28 days (if the ovum is not fertilised)
(b) Specify the sources of the hormones mentioned in the graph.

O

Draw a sectional view of human ovary. Label the following parts :

(i) Primary follicle
(ii) Ovum
(iii) Graafian follicle
(iv) Corpus luteum

27. (a) Mention the cause of ADA deficiency in humans.

(b) How is gene therapy carried out to treat the patients suffering from this disease?
(c) State the possibility of a permanent cure of this disease.

28. (a) What makes some viruses cause cancer in humans?

(b) How do benign tumors turn malignant? How does the latter harm the human body?

Install NODIA App to See the Solutions.

Click Here To Install
Page 7 Sample Paper 18 CBSE Biology Class 12

SECTION - D


DIRECTION : Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.

29. BOD is a measure of organic matter present in the water. The data below shows the concentration of BOD in
different samples obtained from the primary effluent, secondary effluent, untreated sewage and river water.

(a) With reference to the above graph, identify the source of different samples A, B, C and D.
(b) What would happen if D is disposed off in B directly?
(c) Which among the given samples will contain large number of pathogenic microbes?


O

(c) What would be the reason for the higher value of BOD in sample D?

30. From a number of studies on the metabolism of bacterium Escherichia coli, two French scientists Jacob and
Monod in 1961 found that the genetic material possesses regulated gene units called operons. Study the given
below operon system operating in E.coli and answer the questions that follow:

Continue on next page....

Install NODIA App to See the Solutions.

Click Here To Install
Page 8 Sample Paper 18 CBSE Biology Class 12

(a) On the basis of the given operon system, what conclusion can you draw about case I and case II?
(b) What would happen in the presence of X in case II?
(c) What type of regulation can be seen in the given operon system by the repressor?


O

(c) Which structural gene codes for permease in both the cases and what is its function?

SECTION - E
31. A large number of married couples over the world are childless. It is shocking to know that in India the female
partner is often blamed for the couple being childless.
(a) Why in your opinion the female partner is often blamed for such situations in India? Is it correct? Justify.
(b) State any two reasons responsible for the cause of infertility.
(c) “Intra-Cytoplasmic Sperm Injection” and ‘Gamete Intra Fallopian Transfer’ are two assisted reproductive
technologies. How is one different from other?


O

(a) Arrange the following hormones in sequence of their secretion in a pregnant woman. hCG; LH; FSH; Relaxin
(b) Mention their source and the function they perform.

32. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each
molecule is cut and these ends have regions of single stranded DNA. BamHI is one such restriction enzyme which
binds at the recognition sequence, 5l -GGATCC- 3l and cleaves these sequences just after the 5l - guanine on each
strand.
(a) What is the objective of this action?
(b) Explain how the gene of interest is introduced into a vector.
(c) You are given the DNA shown below.
5l ATTTTGAGGATCCGTAATGTCCT 3l
3l TAAAACTCCTAGGCATTACAGGA 5l
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these
double-stranded DNA fragments with their respective polarity.
(d) A gene M was introduced into E.coli cloning vector pBR322 at BamHI site. What will be its impact on
the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant from
recombinant plasmids.


O

(a) Write the palindromic nucleotide for the following DNA segment : 5l -GAATTC- 3l
(b) Name the restriction endonuclease that recognises this sequence.
(c) How are ‘sticky-ends’ produced? Mention their role.

Install NODIA App to See the Solutions.

Click Here To Install
Page 9 Sample Paper 18 CBSE Biology Class 12

33. (a) Dihybrid cross between two garden pea plants one homozygous tall with round seeds and the other dwarf
with wrinkled seeds was carried.
(i) Write the genotype and phenotype of the F1 progeny obtained from this cross.
(ii) Give the different types of gametes of the F1 progeny.
(iii) Write the phenotypes and its ratios of the F2 generation obtained in this cross along with the
explanation provided by Mendel.
(b) How were the observations of F2 progeny of dihybrid crosses in Drosophila by Morgan different from that of
Mendel carried in pea plants? Explain giving reasons.


O
How do “pleiotropy”, “incomplete dominance”, “co-dominance” and “polygenic inheritance” deviate from the
observation made by Mendel? Explain with the help of one example for each.

******

Install NODIA App to See the Solutions.

Click Here To Install