Download the Full Version of textbook for Fast Typing at textbookfull.

com

Patient Specific Induced Pluripotent Stem Cell

Models Generation and Characterization 1st Edition
Andras Nagy

https://textbookfull.com/product/patient-specific-induced-
pluripotent-stem-cell-models-generation-and-
characterization-1st-edition-andras-nagy/

OR CLICK BUTTON

DOWNLOAD NOW

Download More textbook Instantly Today - Get Yours Now at textbookfull.com

 Recommended digital products (PDF, EPUB, MOBI) that
you can download immediately if you are interested.

Pluripotent Stem Cell Therapy for Diabetes 1st Edition

Lorenzo Piemonti

https://textbookfull.com/product/pluripotent-stem-cell-therapy-for-
diabetes-1st-edition-lorenzo-piemonti/

textboxfull.com

Studies of Pluripotency in Embryonic Stem Cells and

Induced Pluripotent Stem Cells 1st Edition Xiaoyang Zhao
(Auth.)
https://textbookfull.com/product/studies-of-pluripotency-in-embryonic-
stem-cells-and-induced-pluripotent-stem-cells-1st-edition-xiaoyang-
zhao-auth/
textboxfull.com

Stem Cell Derived Models in Toxicology 1st Edition Mike

Clements

https://textbookfull.com/product/stem-cell-derived-models-in-
toxicology-1st-edition-mike-clements/

textboxfull.com

Stem Cell Proliferation and Differentiation 1st Edition

Thomas G. Fazzio

https://textbookfull.com/product/stem-cell-proliferation-and-
differentiation-1st-edition-thomas-g-fazzio/

textboxfull.com
Stem Cell Manufacturing 1st Edition Joaquim M. S. Cabral

https://textbookfull.com/product/stem-cell-manufacturing-1st-edition-
joaquim-m-s-cabral/

textboxfull.com

Human stem cell toxicology 1st Edition James L Sherley

https://textbookfull.com/product/human-stem-cell-toxicology-1st-
edition-james-l-sherley/

textboxfull.com

Stem Cell Research : Hope or Hype? 1st Edition Alt

https://textbookfull.com/product/stem-cell-research-hope-or-hype-1st-
edition-alt/

textboxfull.com

Stem Cell Renewal and Cell Cell Communication Methods and

Protocols Methods in Molecular Biology 2346 Kursad Turksen
Editor
https://textbookfull.com/product/stem-cell-renewal-and-cell-cell-
communication-methods-and-protocols-methods-in-molecular-
biology-2346-kursad-turksen-editor/
textboxfull.com

Computational Stem Cell Biology Methods and Protocols

Patrick Cahan

https://textbookfull.com/product/computational-stem-cell-biology-
methods-and-protocols-patrick-cahan/

textboxfull.com
Methods in
Molecular Biology 1353

Andras Nagy
Kursad Turksen Editors

Patient-Specific
Induced
Pluripotent
Stem Cell Models
Generation and Characterization
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

 Patient-Specific Induced
Pluripotent Stem Cell Models

Generation and Characterization

Edited by

Andras Nagy
Lunenfeld-Tanenbaum Research Institute, Toronto, ON, Canada

Kursad Turksen
Ottawa Hospital Research Institute, Ottawa, ON, Canada
Editors
Andras Nagy Kursad Turksen
Lunenfeld-Tanenbaum Research Institute Ottawa Hospital Research Institute
Toronto, ON, Canada Ottawa, ON, Canada

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-3033-3 ISBN 978-1-4939-3034-0 (eBook)
DOI 10.1007/978-1-4939-3034-0
Library of Congress Control Number: 2015951804

Springer New York Heidelberg Dordrecht London

# Springer Science+Business Media New York 2016
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface

Rapid developments in the field of induced pluripotent stem (iPS) cells have provided novel
opportunities and approaches, both for better understanding a number of human diseases
and for developing new platforms for drug development and screening for such diseases.
To complement our volume on methods for establishing iPS cells, we have also collected
representative protocols on various disease models. We are grateful to all the contributors
who shared the details of their protocols for this volume; without their generous efforts,
this volume would not have been possible.
Dr. John Walker, Editor in Chief of Methods in Molecular Biology, was instrumental in
getting this volume off the ground, and we thank him for it. Patrick Marton, Editor of
Springer Protocols, was also very supportive as we put together this volume. We also thank
David Casey and Monica Suchy for helping us to correct missing details during book
production.

Toronto, ON, Canada Andras Nagy

Ottawa, ON, Canada Kursad Turksen

v
Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
Generation of Patient-Specific induced Pluripotent Stem Cell
from Peripheral Blood Mononuclear Cells by Sendai
Reprogramming Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Oscar Quintana-Bustamante and Jose C. Segovia
A Doxycycline-Inducible System for Genetic Correction of iPSC
Disease Models . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Xiuli Sim, Fabian L. Cardenas-Diaz, Deborah L. French
and Paul Gadue
Generation and Characterization of Patient-Specific Induced
Pluripotent Stem Cell for Disease Modeling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Renuka Sivapatham and Xianmin Zeng
Modeling Genomic Imprinting Disorders Using Induced
Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Stormy J. Chamberlain, Noelle D. Germain, Pin-Fang Chen,
Jack S. Hsiao, and Heather Glatt-Deeley
Generation and Characterization of Induced Pluripotent
Stem Cells from Patients with mtDNA Mutations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Riikka H. H€ a m€a l€a inen and Anu Suomalainen
Skin Biopsy and Patient-Specific Stem Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Yao Li, Huy V. Nguyen, and Stephen H. Tsang
Directed Myogenic Differentiation of Human Induced
Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Emi Shoji, Knut Woltjen, and Hidetoshi Sakurai
Using Human Induced Pluripotent Stem Cells
to Model Skeletal Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Emilie Barruet and Edward C. Hsiao
Modeling Cardiovascular Diseases with Patient-Specific
Human Pluripotent Stem Cell-Derived Cardiomyocytes . . . . . . . . . . . . . . . . . . . . . . . . 119
Paul W. Burridge, Sebastian Diecke, Elena Matsa,
Arun Sharma, Haodi Wu, and Joseph C. Wu
Calcium Imaging in Pluripotent Stem Cell-Derived
Cardiac Myocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Anna Walter, Tomo Šarić, Jürgen Hescheler
and Symeon Papadopoulos
Patient-Specific Induced Pluripotent Stem Cell Models:
Generation and Characterization of Cardiac Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Fabian Zanella and Farah Sheikh

vii
viii Contents

Differentiation of Human Pluripotent Stem Cells to Cardiomyocytes

Under Defined Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
Cathelijne W. van den Berg, David A. Elliott, Stefan R. Braam,
Christine L. Mummery, and Richard P. Davis
Generation of Cardiomyocytes from Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . 181
Hiroko Nakahama and Elisa Di Pasquale
Generation and Characterization of Patient-Specific iPSC
Model for Cardiovascular Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Yee Ki Lee, X. Ran, K.W.H. Lai, V.Y.M. Lau,
D.C.W. Siu, and H.F. Tse
Transgene-Free Disease-Specific iPSC Generation from Fibroblasts
and Peripheral Blood Mononuclear Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
Kerem Fidan, Ayyub Ebrahimi, Özlem H. Çağlayan,
Burcu Özçimen, and Tamer T. Önder
Generation and Neuronal Differentiation of Patient-Specific
Induced Pluripotent Stem Cells Derived from Niemann-Pick
Type C1 Fibroblasts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233
Michaela Trilck, Rayk Hübner, and Moritz J. Frech
Multisystemic Disease Modeling of Liver-Derived Protein
Folding Disorders Using Induced Pluripotent Stem Cells (iPSCs) . . . . . . . . . . . . . . . 261
Amy Leung and George J. Murphy
In Vitro Modeling of Alcohol-Induced Liver Injury Using Human-Induced
Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Lipeng Tian, Neha Prasad, and Yoon-Young Jang
Generation of Human Induced Pluripotent Stem Cells Using
RNA-Based Sendai Virus System and Pluripotency Validation
of the Resulting Cell Population. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
Valeria Chichagova, Irene Sanchez-Vera, Lyle Armstrong,
David Steel, and Majlinda Lako
Modeling Axonal Phenotypes with Human Pluripotent Stem Cells . . . . . . . . . . . . . . 309
Kyle R. Denton, Chong-Chong Xu, and Xue-Jun Li
Mitochondrial Disease-Specific Induced Pluripotent Stem
Cell Models: Generation and Characterization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 323
Xuan Zhang, Shishi Li, Wei Yang, Huaye Pan, Dajiang Qin,
Xufen Zhu, and Qingfeng Yan
Patient-Specific Induced Pluripotent Stem Cell Models:
Characterization of iPS Cell-Derived Cardiomyocytes . . . . . . . . . . . . . . . . . . . . . . . . . . 343
Toru Egashira, Shinsuke Yuasa, Shugo Tohyama, Yusuke Kuroda,
Tomoyuki Suzuki, Tomohisa Seki, and Keiichi Fukuda
Generation of Integration-Free Patient Specific iPS Cells Using
Episomal Plasmids Under Feeder Free Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355
Sara Caxaria, Susanne Arthold, Amit C. Nathwani
and Pollyanna Agnes Goh

Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
Contributors

LYLE ARMSTRONG  Institute of Genetic Medicine, Newcastle University,

Newcastle-upon-Tyne, UK
SUSANNE ARTHOLD  UCL Cancer Institute, University College London, London, UK
EMILIE BARRUET  Division of Endocrinology and Metabolism, Department of Medicine,
Institute for Human Genetics, University of California, San Francisco, CA, USA
CATHELIJNE W. VAN DENBERG  Department of Anatomy and Embryology, Leiden University
Medical Center, Leiden, The Netherlands
STEFAN R. BRAAM  Pluriomics BV, Leiden, The Netherlands
ÖZC¸IMEN BURCU  School of Medicine, Koç University, Istanbul, Turkey
PAUL W. BURRIDGE  Department of Medicine (Division of Cardiology), Stanford
Cardiovascular Institute, Institute for Stem Cell Biology and Regenerative Medicine,
Stanford University School of Medicine, Stanford, CA, USA
ÖZLEM H. ČAĞLAYAN  School of Medicine, Koç University, Istanbul, Turkey
FABIAN L. CARDENAS-DIAZ  Center for Cellular and Molecular Therapeutics, The
Children’s Hospital of Philadelphia, Philadelphia, PA, USA
SARA CAXARIA  UCL Cancer Institute, University College London, London, UK
STORMY J. CHAMBERLAIN  University of Connecticut Health Center, Farmington, CT, USA
PIN-FANG CHEN  University of Connecticut Health Center, Farmington, CT, USA
VALERIA CHICHAGOVA  Institute of Genetic Medicine, Newcastle University,
Newcastle-upon-Tyne, UK
RICHARD P. DAVIS  Department of Anatomy and Embryology, Leiden University
Medical Center, Leiden, The Netherlands
KYLE R. DENTON  Department of Neuroscience, University of Connecticut Health Center,
Farmington, CT, USA
SEBASTIAN DIECKE  Max Delbrück Center, Berlin Institute of Health, Berlin, Germany
AYYUB EBRAHIMI  School of Medicine, Koç University, Istanbul, Turkey; Molecular Biology
and Genetics Department, Faculty of Science, Istanbul University, Istanbul, Turkey
TORU EGASHIRA  Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
DAVID A. ELLIOTT  Murdoch Childrens Research Institute, The Royal Children’s Hospital,
Parkville, VIC, Australia
KEREM FIDAN  School of Medicine, Koç University, Istanbul, Turkey
MORITZ J. FRECH  Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
Rostock, Rostock, Germany
DEBORAH L. FRENCH  Center for Cellular and Molecular Therapeutics, The Children’s
Hospital of Philadelphia, Philadelphia, PA, USA
KEIICHI FUKUDA  Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
PAUL GADUE  Center for Cellular and Molecular Therapeutics, The Children’s Hospital
of Philadelphia, Philadelphia, PA, USA; Department of Pathology and Laboratory
Medicine, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA
NOELLE D. GERMAIN  University of Connecticut Health Center, Farmington, CT, USA
HEATHER GLATT-DEELEY  University of Connecticut Health Center, Farmington, CT, USA

ix
x Contributors

POLLYANNA AGNES GOH  Centre for Paediatrics, Barts and The London Medical School,
Blizard Institute, Queen Mary University of London, London, UK
RIIKKA H. H€aM€aL€aINEN  Research Program of Molecular Neurology, Biomedicum-Helsinki,
University of Helsinki, Helsinki, Finland; A.I.Virtanen Institute for Molecular Sciences,
University of Eastern Finland, Kuopio, Finland
JÜRGEN HESCHELER  Center for Physiology and Pathophysiology, Institute for
Neurophysiology, Medical Faculty, University of Cologne, Cologne, Germany
JACK S. HSIAO  University of Connecticut Health Center, Farmington, CT, USA
EDWARD C. HSIAO  Division of Endocrinology and Metabolism, Department of Medicine,
Institute for Human Genetics, University of California, San Francisco, CA, USA
RAYK HÜBNER  Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
Rostock, Rostock, Germany
YOON-YOUNG JANG  Institute for Cell Engineering, Johns Hopkins University School of
Medicine, Baltimore, MD, USA; Cellular and Molecular Medicine Graduate Program,
Johns Hopkins University School of Medicine, Baltimore, MD, USA; Department of
Oncology, The Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University
School of Medicine, Baltimore, MD, USA
YUSUKE KURODA  Department of Cardiovascular Research, Research Institute of
Environmental Medicine, Nagoya University, Aichi, Japan
K. W. H. LAI  Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China
MAJLINDA LAKO  Institute of Genetic Medicine, Newcastle University, Newcastle-upon-
Tyne, UK
V. Y. M. LAU  Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China
YEE KI LEE  Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China
AMY LEUNG  School of Medicine and the Center for Regenerative Medicine (CReM),
Boston University, Boston, MA, USA
SHISHI LI  Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
XUE-JUN LI  Department of Neuroscience, University of Connecticut Health Center,
Farmington, CT, USA; The Stem Cell Institute, University of Connecticut Health Center,
Farmington, CT, USA
YAO LI  Barbara and Donald Jonas Laboratory of Stem Cell and Regenerative Medicine,
Department of Ophthalmology, Columbia University, New York, NY, USA; Bernard and
Shirlee Brown Glaucoma Laboratory, Department of Ophthalmology, Columbia
University, New York, NY, USA
ELENA MATSA  Department of Medicine (Division of Cardiology), Stanford
Cardiovascular Institute, Institute for Stem Cell Biology and Regenerative Medicine,
Stanford University School of Medicine, Stanford, CA, USA
CHRISTINE L. MUMMERY  Department of Anatomy and Embryology, Leiden University
Medical Center, Leiden, The Netherlands
GEORGE J MURPHY  School of Medicine and the Center for Regenerative Medicine (CReM),
Boston University, Boston, MA, USA
HIROKO NAKAHAMA  Humanitas Clinical and Research Center, Rozzano, MI, Italy
AMIT C. NATHWANI  UCL Cancer Institute, University College London, London, UK
 Contributors xi

HUY V. NGUYEN  Columbia University College of Physicians and Surgeons, New York, NY,
USA
TAMER T. ÖNDER  School of Medicine, Koç University, Istanbul, Turkey
HUAYE PAN  Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
SYMEON PAPADOPOULOS  Center for Physiology and Pathophysiology, Institute for Vegetative
Physiology, Medical Faculty, University of Cologne, Cologne, Germany
ELISA DI PASQUALE  Humanitas Clinical and Research Center, Rozzano, MI, Italy;
Istituto di Ricerca Genetica e Biomedica, National Research Council of Italy, Milan,
Italy; Humanitas Clinical and Research Center, Rozzano, MI, Italy
NEHA PRASAD  Department of Oncology, The Sidney Kimmel Comprehensive Cancer
Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA
DAJIANG QIN  Guangzhou Institutes of Biomedicine and Health, Chinese Academy of
Sciences, Guangzhou, China
OSCAR QUINTANA-BUSTAMANTE  Differentiation and Cytometry Unit, Hematopoietic
Innovative Therapies Division, Centro de Investigaciones Energéticas, Medioambientales y
Tecnológicas (CIEMAT) – Centro de Investigaciones Biomédicas en Red de Enfermedades
Raras (CIBERER) – Instituto de Investigación Sanitaria Fundación Jiménez Dı́az
(IIS-FJD), Madrid, Spain
X. RAN  Cardiology Division Department of Medicine, Li Ka Shing Faculty of Medicine,
The University of Hong Kong, Hong Kong, China
HIDETOSHI SAKURAI  Center for iPS Cell Research and Application (CiRA), Kyoto
University, Kyoto, Japan
IRENE SANCHEZ-VERA  Institute of Genetic Medicine, Newcastle University, Newcastle-
upon-Tyne, UK
TOMO ŠARIC´ • Center for Physiology and Pathophysiology, Institute for Neurophysiology,
Medical Faculty, University of Cologne, Cologne, Germany
JOSE C. SEGOVIA  Differentiation and Cytometry Unit, Hematopoietic Innovative
Therapies Division., Centro de Investigaciones Energéticas, Medioambientales y
Tecnológicas (CIEMAT) - Centro de Investigaciones Biomédicas en Red de Enfermedades
Raras (CIBERER) - Instituto de Investigación Sanitaria Fundación Jiménez Dı́az
(IIS-FJD), Madrid, Spain
TOMOHISA SEKI  Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
ARUN SHARMA  Department of Medicine (Division of Cardiology), Stanford
Cardiovascular Institute, Institute for Stem Cell Biology and Regenerative Medicine,
Stanford University School of Medicine, Stanford, CA, USA
FARAH SHEIKH  Cardiology Division, Department of Medicine, University of
California-San Diego, La Jolla, CA, USA
EMI SHOJI  Center for iPS Cell Research and Application (CiRA), Kyoto University,
Kyoto, Japan
XIULI SIM  School of Medicine, University of Pennsylvania, Philadelphia, PA, USA;
Center for Cellular and Molecular Therapeutics, The Children’s Hospital of Philadelphia,
Philadelphia, PA, USA
D. C. W. SIU  Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China; Research Center of Heart,
Brain, Hormone and Healthy Aging, Li Ka Shing Faculty of Medicine, The University of
Hong Kong, Hong Kong, SAR, China; Shenzhen Institutes of Research and Innovation,
xii Contributors

University of Hong Kong, Hong Kong, China; Division of Cardiology, Queen Mary
Hospital, Hong Kong, China
RENUKA SIVAPATHAM  Buck Institute for Research on Aging, Novato, CA, USA
DAVID STEEL  Institute of Genetic Medicine, Newcastle University, Newcastle-upon-Tyne,
UK
ANU SUOMALAINEN  Research Program of Molecular Neurology, Biomedicum-Helsinki,
University of Helsinki, Helsinki, Finland; Department of Neurology, Helsinki University
Central Hospital, Helsinki, Finland; Neuroscience Centre, University of Helsinki,
Helsinki, Finland
TOMOYUKI SUZUKI  Department of Cardiovascular Research, Research Institute of
Environmental Medicine, Nagoya University, Aichi, Japan
LIPENG TIAN  Department of Oncology, The Sidney Kimmel Comprehensive Cancer Center,
Johns Hopkins University School of Medicine, Baltimore, MD, USA
SHUGO TOHYAMA  Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
MICHAELA TRILCK  Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
Rostock, Rostock, Germany
STEPHEN H. TSANG  New York Presbyterian Hospital/Columbia University Medical
Center, New York, NY, USA; Department of Pathology and Cell Biology, Columbia
University, New York, NY, USA; Edward Harkness Eye Institute, New York, NY, USA
H. F. TSE  Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China; Research Center of Heart,
Brain, Hormone and Healthy Aging, Li Ka Shing Faculty of Medicine, The University of
Hong Kong, Hong Kong, SAR, China; Shenzhen Institutes of Research and Innovation,
University of Hong Kong, Hong Kong, China; Hong Kong-Guangdong Joint Laboratory
on Stem Cell and Regenerative Medicine, Hong Kong, China; Division of Cardiology,
Queen Mary Hospital, Hong Kong, China
ANNA WALTER  Center for Physiology and Pathophysiology, Institute for Vegetative
Physiology, Medical Faculty, University of Cologne, Cologne, Germany
KNUT WOLTJEN  Center for iPS Cell Research and Application (CiRA), Kyoto University,
Kyoto, Japan
JOSEPH C. WU  Department of Medicine (Division of Cardiology), Stanford
Cardiovascular Institute, Institute for Stem Cell Biology and Regenerative Medicine,
Stanford University School of Medicine, Stanford, CA, USA
HAODI WU  Department of Medicine (Division of Cardiology), Stanford Cardiovascular
Institute, Institute for Stem Cell Biology and Regenerative Medicine, Stanford University
School of Medicine, Stanford, CA, USA
CHONG-CHONG XU  Department of Neuroscience, University of Connecticut Health
Center, Farmington, CT, USA
QINGFENG YAN  Institute of Genetics, College of Life Sciences, Zhejiang University,
Hangzhou, Zhejiang, China
WEI YANG  Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
SHINSUKE YUASA  Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
FABIAN ZANELLA  Cardiology Division, Department of Medicine, University of California-
San Diego, La Jolla, CA, USA
XIANMIN ZENG  Buck Institute for Research on Aging, Novato, CA, USA
 Contributors xiii

XUAN ZHANG  Institute of Genetics, College of Life Sciences, Zhejiang University,

Hangzhou, Zhejiang, China
XUFEN ZHU  Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
Methods in Molecular Biology (2016) 1353: 1–11
DOI 10.1007/7651_2014_170
© Springer Science+Business Media New York 2014
Published online: 19 December 2014

Generation of Patient-Specific induced Pluripotent Stem

Cell from Peripheral Blood Mononuclear Cells by Sendai
Reprogramming Vectors
Oscar Quintana-Bustamante and Jose C. Segovia

Abstract
Induced pluripotent stem cells (iPSC) technology has changed preclinical research since their generation
was described by Shinya Yamanaka in 2006. iPSCs are derived from somatic cells after being reprogrammed
back to an embryonic state by specific combination of reprogramming factors. These reprogrammed cells
resemble all the characteristic of embryonic stem cells (ESC). The reprogramming technology is even more
valuable to research diseases biology and treatment by opening gene and cell therapies in own patient’s
iPSC. Patient-specific iPSC can be generated from a large variety of patient cells by any of the myriad of
reprogramming platforms described. Here, we describe the generation of patient-specific iPSC from patient
peripheral blood mononuclear cells by Sendai Reprogramming vectors.

Keywords: Patient-Specific induced Pluripotent Stem Cell, Peripheral blood mononuclear cells,
Sendai vectors, Reprogramming, Pluripotency, Self-renewal

1 Introduction

The generation of induced pluripotent stem cells (iPSC) described

by Shinya Yamanaka (1–3) has meant a new stage in biomedicine.
Although somatic cells can be reprogrammed back to an embryonic
state by cell fusion or nuclear transfer since long time ago, only few
laboratories had cell reprogramming technology applied to a limit
number of cell types from a reduce variety of species. However, when
Shinya Yamanaka described for the first time a simple method to
reprogram mouse (1, 2) and human fibroblasts (2) back to a plurip-
otent state by the delivery of four embryonic transcription factors
(OCT4, SOX2, KLF4, and cMYC), cell reprogramming was broadly
opened to the research community. This newly described technology
was widely expanded by its high reproducibility and easy implemen-
tation. Quickly, the original iPSC technology was modified regard-
ing combinations of reprogramming factors (4–6), their delivery
method (7–12), or the cell type to be reprogrammed (3, 13–16).
More importantly, iPSC platforms were used to reprogram back
somatic cells from patients of numerous genetic diseases (17).

1
2 Oscar Quintana-Bustamante and Jose C. Segovia

These patient-specific iPSCs show self-renewal and pluripotency

similar to embryonic stem cells (ESC), which are leading up the
development of new autologous cell and gene therapy approaches
(17) and compelling disease models (18). Here, we described a
simple method to generate patient-specific iPSC from peripheral
blood mononuclear cells (PB-MNC) by Sendai Reprogramming
vectors (SeV). PB-MNC means a noninvasive, easily accessible, and
routine somatic cell source in the clinic. SeV implies an integration-
free and self-erasable reprogramming system, since these viruses are
no genotoxic, are able to infect a wide range of cell types with high
transduction efficiency, and are eliminated from the cell once repro-
grammed because of their lower replication rate compared to the
iPSC one. We have successfully reprogrammed PB-MNC samples
from healthy donors and from anemic patients, indicating the effi-
cacy of the reprogramming protocol described here.

2 Materials

All the procedures described here are based on our feeder-

dependent iPSC culture; however, this system can be adapted to
other iPSC culture conditions.

2.1 General 1. Biohazard safety cabinet certified for handling of biological

Equipment materials.
2. Incubator set at 37  C with 5 % CO2 and 95 % humidity.
3. Standard light microscope for cell counting.
4. Stereomicroscope equipped with a zoom from 1 to 6.3 and
thermo plate able to heat at 37  C. The stereomicroscope has to
be placed in a biological safety cabinet.
5. Laboratory centrifuge.
6. Vortex.
7. Laboratory water bath.
8. Pipette-aid.
9. Micropipettors.
10. Stripper (MidAtlantic Diagnostics, Inc., Marlton, NJ, USA)
equipped with 200 μm stripper tips.
11. Neubauer hemocytometer.
12. 15 mL conical tubes.
13. 50 mL conical tubes.
14. Tissue culture treated 6-well plates.
15. Tissue culture treated 24-well plates.
16. Tissue culture treated p100 plates.
 Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 3

17. Tissue culture treated p150 plates.

18. Cryotubes.
19. Mr. Frosty Freezing container (Thermo Fisher Scientific, Wal-
tham, MA, USA).
20. Cryogenic tank.

2.2 Peripheral Blood 1. PBE buffer: Dulbecco’s phosphate buffered saline without
Mononuclear Cell calcium chloride and magnesium chloride (PBS, Sigma-
Aldrich, St. Louis, MO, USA)/0.5 % v/v bovine serum albu-
min (BSA, Sigma-Aldrich)/2 mM ethylenediaminetetraacetic
acid (EDTA, Sigma-Aldrich). Filtered through a 0.22 μm filter.
2. Ficoll-Paque Plus (density 1.077, GE Healthcare Life Science,
Madrid, Spain).
3. T€urk’s solution: 1 mL of 1 % w/v aqueous methylene blue
solution (Sigma-Aldrich)/2 % acetic acid in water.
4. Trypan Blue Solution (Life Technologies, Madrid, Spain).
5. Dimethyl sulfoxide (DMSO, Sigma-Aldrich).
6. Hyclone Fetal Bovine Serum (FBS, GE Healthcare Life Science).
7. Penicillin-Streptomycin (PS, Life Technologies).

2.3 SeV 1. StemSpan™ SFEM (STEMCELL Technologies, Vancouver,

Reprogramming Canada).
2. Human Stem Cell Factor (hSCF, EuroBiosciences, Friesoythe,
Germany).
3. Human Fms-related tyrosine kinase 3 ligand (hFLT3L,
EuroBiosciences).
4. Human thrombopoietin (hTPO, EuroBiosciences).
5. Human granulocyte colony-stimulating factor (G-CSF, Neu-
lasta, Amgen, Barcelona, Spain).
6. Human interleukin 3 (hIL3, EuroBiosciences).
7. PB-MNC medium: 0.22 μm filtered StemSpan™ SFEM/
100 ng/mL hSCF/100 ng/mL hFLT3L/20 ng/mL
hTPO/10 ng/mL G-CSF/2 ng/mL hIL3/0.5 % PS.
8. CytoTune®-iPS Sendai Reprogramming Kit (Life
Technologies).

2.4 Human-Induced 1. Dulbecco’s Modified Eagle Medium (DMEM, Life

Pluripotent Cell Technologies).
Culture 2. hFGF-basic (154 aa) (Peprotech, Rocky Hill, NJ, USA).
3. Knockout™ DMEM medium (KO-DMEM, Life Technologies).
4. MEM Nonessential Amino Acids Solution (NEAA, Life
Technologies).
4 Oscar Quintana-Bustamante and Jose C. Segovia

5. GlutaMAX™ supplement (Life Technologies).

6. Knockout™ Serum Replacement (KO-SR, Life Technologies).
7. 2-Mercaptoethanol (Life Technologies).
8. Gelatin solution: 0.22 μm filtered 0.1 % gelatin (Sigma-
Aldrich) in water.
9. TrypLE™ Select (Life Technologies).
10. Feeder medium: 0.22 μm filtered DMEM/20 % FBS/1 %
GlutaMAX/1 % NEAA/1 % PS.
11. hES medium: 0.22 μm filtered KO-DMEM/1 % NEEA/1 %
GlutaMAX/0.5 % PS/20 % KO-SR/50 μM 2-mercaptoetha-
nol/10 ng/mL hFGF-basic.
12. Human foreskin fibroblast (HFF-1, ATCC, Barcelona, Spain).
13. Mouse embryonic fibroblast CF-1 (MEF, ATCC).
14. Collagenase IV solution: dissolve 10 mg/mL of Collagenase
IV (Life Technologies) in KO-DMEM. Dilute this first solu-
tion to 1 mg/mL Collagenase IV and filter it by 0.22 μm filter.
Collagenase IV concentration can be kept at 20  C; however,
they lose activity very quickly at 4  C.
15. Y-27632 (Rock Inhibitor, Reagents Direct, Encinitas, CA).

3 Methods

All procedures for cell processing should be performed using sterile

technique and universal handling precautions in a biological safety
cabinet. ESC/iPSC culture skills are required.

3.1 Peripheral Blood 1. Collect 5–10 mL peripheral blood (PB) by standard proce-
Mononuclear Cell dures. Keep it at room temperature in the presence of an
Purification anticoagulant.
2. Mix the PB with twice the volume of PBE buffer.
3. Add 5 mL of Ficoll-Paque Plus to a 15 mL conical tube (see
Note 1).
4. Slowly layer 10 mL of PB on top of the Ficoll-Paque Plus (see
Note 2) (Fig. 1). Avoid disturbing the two layers (see Note 3).
5. Centrifuge at 400  g for 25 min at room temperature with
the centrifuge brake off.
6. The sample will be separated in different layers by a density
gradient (Fig. 1). Handle the tube very carefully not to alter the
layer distribution.
7. Remove the plasma upper layer by a sterile pipette. Care not to
disturb the white layer of PB-MNC underneath. Keep part of
this plasma to analyze mycoplasma contamination in the sample
(see Note 4).
 Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 5

Plasma
Peripheral
Blood PB-MNC
400 x g
Ficoll-Paque
25 minutes
Ficoll-Paque
Granulocytes
Red Blood Cells

Fig. 1 Diagram shows the layer distribution before and after Ficoll-Paque
gradient is formed by centrifugation. Different cell layers are indicated

8. Take off thoroughly with the tip of a pipette 5 mL any cell

clump stuck in the tube wall in the PB-MNC layer.
9. Remove the PB-MNC layer and transfer it to a 15 mL conical
tube.
10. Wash this cell suspension by adding enough PBE volume to
dilute any Ficoll-Paque Plus still present. Centrifuge at
300  g at room temperature for 7 min with brake on.
11. Discard the supernatant without disrupting the PB-MNC
pellet.
12. Resuspend the PB-MNC pellet by adding 1 mL of PBE.
13. Dilute a small aliquot of cell suspension with T€
urk’s solution
(see Note 5). Count it in the Neubauer hemacytometer.
14. PB-MNC can be used freshly in the next step or can be frozen
(see Note 6).

3.2 Irradiated HFF-1 1. Grow primary fibroblast in gelatin-coated p150 plate with
(irHFF-1) or Irradiated feeder medium (25 mL/p150 plate).
MEF (irMEF) 2. When the feeder is close to confluence, wash it with PBS
Preparation (Sigma-Aldrich) and detach the cells from the plate by adding
10 mL of TrypLE™ Select/plate and treatment at 37  C for
5–7 min.
3. Collect the cells in a 15 mL conical and wash the plate with
5 mL of PBS/5 % FBS. Centrifuge the cell suspension at
300  g for 7 min.
4. Resuspend the cells in feeder medium and seed into new
gelatin-coated p150 at 1.7  104 cell/cm2 cell density with
22–25 mL feeder medium.
5. Expand the primary feeders up to four to five passage. To
irradiate the primary fibroblasts, wash the cells with PBS and
treat by TrypLE™ Select to detach them.
6 Oscar Quintana-Bustamante and Jose C. Segovia

6. Collect the cells in 50 mL conical tube and centrifuge. Resus-

pend the cells in fresh feeder medium.
7. Irradiate the cell suspension with 45 Gy using a Philips MG324
X-ray equipment (Philips, Hamburg, Germany) set at 300 kV,
10 mA, delivering a dose rate of 1.03 Gy/min.
8. Centrifuge the irradiated fibroblasts at 300  g for 7 min.
Resuspend in feeder medium and count cell concentration.
Adjust cell concentration to get 8  106 cells/mL.
9. Distribute 4  106 irradiated fibroblasts per each cryotube.
Add 500 μL of chill 20 % DMSO/80 % FBS in each cryotube.
Keep all the cryotubes in a Mr. Frosty Freezing container at
80  C. After 24–48 h, transfer the cryotubes to a cryogenic
tank.

3.3 Plate Coating by 1. Cover the plate surface with gelatin solution, and keep at 37  C
Irradiated Feeder for at least 30 min.
2. Thaw an irradiated fibroblast cryotube in a 37  C water bath.
Transfer thawed cell to 15 mL conical tube. Dilute cell suspen-
sion by adding 10 mL of feeder medium. Centrifuge at
300  g for 7 min. Resuspend the cells in feeder medium.
Count by treating with Trypan Blue to exclude dead cells.
3. Remove gelatin solution from the 37  C warm plate and add
feeder medium containing the cells. Add enough volume of cell
suspension to the plate to get 0.7–1.5  104 cell/cm2. Allow
cells to attach for at least 12 h. Keep at 37  C until using.
4. Before adding hiPSC, wash the plate with KO-DMEM. Dis-
card nonused feeder-coated plates after 4 days to be seeded.

3.4 Generation of 1. Culture PB-MNC up to 5  105 cells per mL in PB-MNC

PB-MNC hiPSC by SeV medium (see Notes 7 and 8).
2. Keep the cells at 37  C for 4 days (see Note 9).
3. Transfer the cell suspension into a 15 mL conical tube. Wash
the plate thoroughly with StemSpan™ SFEM to collect the
remained cells.
4. Centrifuge cells at 300  g at room temperature for 7 min.
5. Aspirate supernatant (being careful not to disturb the cell
pellet).
6. Dilute the cell pellet in StemSpan™ SFEM/0.5 % PS.
7. Count by T€
urk’s or Trypan Blue solution.
8. Adjust the cell concentration to 1  106 cells per mL in PB-
MNC medium.
 Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 7

9. Mix SeV from CytoTune®-iPS Sendai Reprogramming Kit in a

same volume of PB-MNC medium as the cell suspension vol-
ume (see Note 10).
10. Keep the cells at 37  C overnight.
11. Wash the cells by transferring to a 15 mL conical tube and
spinning down at 300  g at room temperature for 7 min.
12. Resuspend the infected PB-MNC in PB-MNC medium at
5  105 cells per mL.
13. Keep the cells at 37  C for 4 days.
14. Observe the cells dairy (Fig. 2) (see Note 11).
15. Supplement the medium with 10 ng/mL hFGF-basic after 4
days of infection.

Cytokine
Reprogramming PB-MNC iPSC expansion
instruction

Day: 0 4 5 8 9 20-40
PB-MNC
PB-MNC
iPS
irHFF-1
SeV hFGF-basic

Fig. 2 Scheme of the PB-MNC reprogramming by SeV. Representative images of each stage are showed.
Initial heterogeneous population of PB-MNC are instructed by a specific cytokine combination (left panel).
Reprogramming process, where the SeV-infected PB-MNCs proliferate and change their morphology (middle
panel). Complete PB-MNC iPSC clone generated by SeV reprogramming (right panel). Azami Green SeV was
added to the SeV reprogramming cocktail to be able to track the reprogramming process. All the pictures were
taken at 100 magnification
8 Oscar Quintana-Bustamante and Jose C. Segovia

16. Next day, collect the cells and transfer to 15 mL conical tube,-
centrifuge at 200  g at room temperature for 5 min (see
Note 12).
17. Resuspend the cells in hES medium.
18. Transfer 5  104 SeV-infected PB-MNC to an irHFF-coated
p100 plate and add up to 10 mL of hES medium (see Note 13).
19. Replace hES medium every 2 days for warm fresh hES medium;
avoid to disturb the cells.
20. Some hES-like colonies will appear on the irHFF. Pick these
hES-like colonies under the stereomicroscope by the stripper
and transfer the colony fragments to an irHFF-coated p24 well
with hES medium (see Notes 14 and 15).

3.5 PB-MNC hiPSC 1. Passage these PB-MNC hiPS clones every 5–7 days using con-
Culture ventional hES procedures:
2. Manual picking: under the stereomicroscope break up the
colonies by the stripper tip or by a 10 μL tip. Transfer to a
15 mL conical tube and centrifuge at 200  g for 2 min.
Discard the supernatant carefully without disturbing the cell
pellet. Resuspend the cells with fresh hES medium, mix by a
soft twice to three times pipetting. Transfer to a new irHFF-1-
coated plate.
3. Collagenase IV treatment: wash the hiPSC culture by KO-
DMEM. Incubate for 5 min at 37  C with Collagenase IV
solution. Pick up the colonies by stripper tip or by a 10 μL tip
under the stereomicroscope. Transfer to a 15 mL conical tube
and centrifuge at 200  g for 2 min. Discard the supernatant
carefully without disrupting the cell pellet. Resuspend the cells
with fresh hES medium, mix by a soft pipetting for five to six
times to divide the colonies in a small fragments without break-
ing up them to a single cell suspension. Transfer to a new
irHFF-1-coated plate.
4. Expand each PB-MNC iPSC clone independently (see Notes
16–18).
5. Cryopreserve part of each PB-MNC iPSC clone when there are
enough number of iPSC colonies (around 15–20 colonies). To
cryopreserve iPSC, the culture has to be pretreated by hES
medium supplemented by 10 μM Rock inhibitor for at least
1 h. Then, break up the colonies in large fragments. Collect the
iPSC fragments in a 15 mL conical tube. Spin down at 200  g
for 2 min. Discard the supernatant. Resuspend in 500 μL of
chill FBS and transfer to a cryotube. Mix in the cryotube with
500 μL of freshly prepared 20 % FBS/80 % DMSO. Keep for
24 h at 80  C. Transfer for a long storage to a cryogenic tank
(see Note 19).
 Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 9

6. The rest of each PB-MNC iPSC clone will be expanded by

further pluripotency characterization and SeV clearance (see
Notes 20 and 21).

4 Notes

1. Ficoll-Paque Plus should be warmed to room temperature

before using.
2. Different PB volumes can be used while PB:Ficoll-Paque Plus
ratio will be kept.
3. If the layers are disturbed, different layers will not form after
centrifugation.
4. Mycoplasma contamination in a sample avoids iPSC genera-
tion. Everything involved in iPSC generation/culture must be
mycoplasma-free.
5. The acetic acid present in the T€
urk’s solution destroys red
blood cells (RBC) from the PB-MNC suspension, facilitating
the cell counting.
6. Hematopoietic cells are frozen by diluting 1:1 the cell suspen-
sion with 20 % DMSO/80 % Hyclone FBS at 2  106–2  107
cell per 1 mL cryotube. The cryotubes have to be kept in a Mr.
Frosty Freezing (Thermo Scientific) container at 80  C for
24 h and then transfer to a cryogenic tank.
7. Cytokine combination is a key factor to lead reprogramming
from a specific hematopoietic lineage (19). The cytokine com-
bination described here promotes cell reprogramming by SeV
from hematopoietic progenitors and/or myeloid cells, avoiding
T or B lymphocytes. Other cytokines can be tested to address
reprogramming of different cell types.
8. PB-MNC should be placed in the central wells of the plate, and
surrounding wells must be filled with PBS or water to avoid the
evaporation of PB-MNC medium.
9. Either massive cell death or cell proliferation can be observed.
Washing of cells is recommended when cell death occurs or
addition of fresh medium to maintain cell concentration when
proliferation happens.
10. SeV must be kept on dry ice until addition to the medium.
Avoid repeated freezing and thawing of SeV. The multiplicity
of infection (MOI) of each SeV carrying each Yamanaka’s
factor should be 3, meaning three SeV infectious particles of
each reprogramming factor per cell. Additionally a SeV coding
for a reporter gene (i.e., Azami Green) can be included to
visualize the percentage of transduction.
10 Oscar Quintana-Bustamante and Jose C. Segovia

11. 24–48 h post SeV infection, some fluorescent green cells will
appear if Azami Green SeV was added to the reprogramming
SeV cocktail. During these 4 days after SeV infection, morpho-
logical changes will be observed, such as the presence of highly
proliferative large cells (Fig. 2).
12. Since some cells are being reprogrammed, the centrifugation
speed must be reduced to avoid the killing of these fragile cells.
13. Irradiated feeder must be prepared the day before. irHFF-1 or
irMEF can be used. Before adding the cells, feeder density
has to be checked, and feeder medium must be washed by
KO-DMEM.
14. The first hES-like colonies will appear around day 5–7 post
infection; however, these colonies are usually unstable, and
they are not able to be expanded as hES-like cells. The more
stable and with correct morphology, hES-like colonies will
appear 2 weeks after SeV infection.
15. In our experience, when SeV reprogramming is successful, one
hiPSC-derived PB-MNC was generated per 6,000 PB-MNCs.
16. We were able to maintain around one sixth of the picked
colonies when SeV reprogramming was successful.
17. The PB-MNC iPSC culture has to reach a 50–60 % confluence,
and then the cells can be split from one plate to four to six
plates.
18. To expand hiPSC quickly, Rock inhibitor can be added to the
hES medium in each passage for few passages, because if iPSCs
get used to Rock inhibitor, they lessen their properties.
19. To thaw the frozen iPSC clones, introduce the frozen cryovial
in a 37  C water bath. Transfer the cell suspension to a 15 mL
conical tube and add slowly 10 mL of hES medium. Spin down
at 200  g for 2 min. Resuspend the cell softly with hES
medium/10 μM Rock inhibitor, and seed the hiPSC in a new
HFF-1-coated 6-well plate with hES medium/10 μM Rock
inhibitor. Keep at 37  C for 48 h without disturbing. Change
the medium daily.
20. Standard pluripotency test will consist in analysis of embryonic
gene expression, such as OCT4, NANOG, SSEA4, Tra-1-60,
SOX2, cMYC, and REX-1, by qRT-PCR and immunofluores-
cence, karyotype, embryo body, and teratoma formation.
21. SeV clearance will be assessed by disappearance of Azami Green
fluorescence, when Azami Green SeV is added to the SeV
reprogramming cocktail, and by RT-PCR using specific primers
(SeV F GGATCACTAGGTGATATCGAGC and SeV R
ACCAGACAAGAGTTTAAGAGATATGTATC).
 Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 11

Acknowledgments

This work was supported by the following grants: Dirección

General de Investigación de la Comunidad de Madrid (CellCAM;
Ref S2010/BMD-2420), Fondo de Investigaciones Sanitarias,
Instituto de Salud Carlos III (RETICS-RD12/0019/0023), and
MINECO (SAF2011-30526-C02-01).

References

1. Takahashi K, Yamanaka S (2006) Induction of Hashimoto H, Kodaira M et al (2010) Genera-

pluripotent stem cells from mouse embryonic tion of induced pluripotent stem cells from
and adult fibroblast cultures by defined factors. human terminally differentiated circulating T
Cell 126:663–676 cells. Cell Stem Cell 7:11–14
2. Okita K, Ichisaka T, Yamanaka S (2007) Gen- 11. Park HY, Noh EH, Chung HM, Kang MJ, Kim
eration of germline-competent induced plurip- EY, Park SP (2012) Efficient generation of
otent stem cells. Nature 448:313–317 virus-free iPS cells using liposomal magneto-
3. Takahashi K, Tanabe K, Ohnuki M, Narita M, fection. PLoS One 7:e45812
Ichisaka T, Tomoda K, Yamanaka S (2007) 12. Kaji K, Norrby K, Paca A, Mileikovsky M,
Induction of pluripotent stem cells from adult Mohseni P, Woltjen K (2009) Virus-free induc-
human fibroblasts by defined factors. Cell tion of pluripotency and subsequent excision of
131:861–872 reprogramming factors. Nature 458:771–775
4. Yu J, Vodyanik MA, Smuga-Otto K, 13. Wernig M, Meissner A, Foreman R, Brambrink
Antosiewicz-Bourget J, Frane JL, Tian S, Nie T, Ku M, Hochedlinger K, Bernstein BE, Jae-
J, Jonsdottir GA, Ruotti V, Stewart R et al nisch R (2007) In vitro reprogramming of
(2007) Induced pluripotent stem cell lines fibroblasts into a pluripotent ES-cell-like state.
derived from human somatic cells. Science Nature 448:318–324
318:1917–1920 14. Aoi T, Yae K, Nakagawa M, Ichisaka T, Okita
5. Judson RL, Babiarz JE, Venere M, Blelloch R K, Takahashi K, Chiba T, Yamanaka S (2008)
(2009) Embryonic stem cell-specific micro- Generation of pluripotent stem cells from adult
RNAs promote induced pluripotency. Nat Bio- mouse liver and stomach cells. Science
technol 27:459–461 321:699–702
6. Hou P, Li Y, Zhang X, Liu C, Guan J, Li H, 15. Haase A, Olmer R, Schwanke K, Wunderlich S,
Zhao T, Ye J, Yang W, Liu K et al (2013) Merkert S, Hess C, Zweigerdt R, Gruh I,
Pluripotent stem cells induced from mouse Meyer J, Wagner S et al (2009) Generation of
somatic cells by small-molecule compounds. induced pluripotent stem cells from human
Science 341:651–654 cord blood. Cell Stem Cell 5:434–441
7. Sommer CA, Stadtfeld M, Murphy GJ, Hoche- 16. Loh YH, Agarwal S, Park IH, Urbach A, Huo
dlinger K, Kotton DN, Mostoslavsky G (2009) H, Heffner GC, Kim K, Miller JD, Ng K, Daley
Induced pluripotent stem cell generation using GQ (2009) Generation of induced pluripotent
a single lentiviral stem cell cassette. Stem Cells stem cells from human blood. Blood
27:543–549 113:5476–5479
8. Cho HJ, Lee CS, Kwon YW, Paek JS, Lee SH, 17. Garate Z, Davis BR, Quintana-Bustamante O,
Hur J, Lee EJ, Roh TY, Chu IS, Leem SH et al Segovia JC (2013) New frontier in regenerative
(2010) Induction of pluripotent stem cells medicine: site-specific gene correction in
from adult somatic cells by protein-based patient-specific induced pluripotent stem cells.
reprogramming without genetic manipulation. Hum Gene Ther 24:571–583
Blood 116:386–395 18. Saha K, Jaenisch R (2009) Technical challenges
9. Warren L, Manos PD, Ahfeldt T, Loh YH, Li in using human induced pluripotent stem cells
H, Lau F, Ebina W, Mandal PK, Smith ZD, to model disease. Cell Stem Cell 5:584–595
Meissner A et al (2010) Highly efficient repro- 19. Staerk J, Dawlaty MM, Gao Q, Maetzel D,
gramming to pluripotency and directed differ- Hanna J, Sommer CA, Mostoslavsky G, Jae-
entiation of human cells with synthetic nisch R (2010) Reprogramming of human
modified mRNA. Cell Stem Cell 7:618–630 peripheral blood cells to induced pluripotent
10. Seki T, Yuasa S, Oda M, Egashira T, Yae K, stem cells. Cell Stem Cell 7:20–24
Kusumoto D, Nakata H, Tohyama S,
Methods in Molecular Biology (2016) 1353: 13-23
DOI 10.1007/7651_2014_179
© Springer Science+Business Media New York 2014
Published online: 29 January 2015

A Doxycycline-Inducible System for Genetic Correction

of iPSC Disease Models
Xiuli Sim*, Fabian L. Cardenas-Diaz*, Deborah L. French, and Paul Gadue

Abstract
Patient-derived induced pluripotent stem cells (iPSCs) are valuable tools for the study of developmental
biology and disease modeling. In both applications, genetic correction of patient iPSCs is a powerful
method to understand the specific contribution of a gene(s) in development or diseased state(s). Here, we
describe a protocol for the targeted integration of a doxycycline-inducible transgene expression system in a
safe harbor site in iPSCs. Our gene targeting strategy uses zinc finger nucleases (ZFNs) to enhance
homologous recombination at the AAVS1 safe harbor locus, thus increasing the efficiency of the
site-specific integration of the two targeting vectors that make up the doxycycline-inducible system.
Importantly, the use of dual-drug selection in our system increases the efficiency of positive selection for
double-targeted clones to >50 %, permitting a less laborious screening process. If desired, this protocol can
also be adapted to allow the use of tissue-specific promoters to drive gene expression instead of the
doxycycline-inducible promoter (TRE). Additionally, this protocol is also compatible with the use of
Transcription-Activator-Like Effector Nucleases (TALENs) or Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR)-Cas9 system in place of ZFNs.

Keywords: Genetic correction, Disease modeling, Homologous recombination, Doxycycline-

inducible expression, Gene targeting, Zinc finger nucleases

1 Introduction

In the characterization of iPSC disease models, a commonly used

strategy is to genetically manipulate the patient-derived iPSCs to
correct the disease phenotype, thus ascertaining the role of a spe-
cific gene in the disease. One way to genetically correct defects in
iPSC-based disease models is by the site-specific targeting of trans-
genes into a safe harbor locus. In human iPSCs, the AAVS1 gene
has been identified as a putative safe harbor locus (1–4), where we
have expressed a number of transgenes (5, 6).
This chapter describes a protocol for the generation of iPSC
lines with a doxycycline-inducible transgene expression system tar-
geted into both alleles of the AAVS1 safe harbor locus. To enhance

*Author contributed equally with all other contributors.

13
14 Xiuli Sim et al.

Donor plasmid SV40

CAG-rtTA NEO CAG rtTA PolyA
PolyA
Screening Primer Set2
SphI
1920bp
6.5Kb

AAVS1 SphI
Probe
SphI Screening Primer
Set 2-3
locus Zn Finger Nuclease site

Screening Primers
Set1 1380bp
SphI
Screening Primer Set3
Donor plasmid Rabbit Glob
TRE-GFP
PURO TRE GFP PolyA

Fig. 1 Design of targeting vectors. ZFNs specific to the AAVS1 locus will cut the DNA in intron 1 of AAVS1.
Integration of both targeting vectors will confer dual drug resistance to ESCs/iPSCs. The location of PCR
screening primers and Southern blot probe is indicated

Table 1
Percentage of selected clones that are correctly double-targeted from
three independent transfections

Number of Percentage of
Transfection Number of double-targeted double-targeted
attempt clones screened clones clones (%)
1 12 8 67
2 6 5 83
3 10 5 50
Overall 28 18 64

homologous recombination (7, 8), a pair of ZFNs are used to

induce a double-stranded break specifically in the AAVS1 locus.
The two targeting vectors with arms of homology to AAVS1
express reverse tet activator (rtTA) driven by a constitutive
promoter and a tet-response element (TRE) driving the gene of
interest (Fig. 1). If knock down of a gene is desired, short hairpins
directed against the gene of interest can be cloned downstream of
the TRE in the targeting construct. The two targeting vectors are
designed to confer dual-drug resistance to double-targeted clones.
Clones are screened using PCR to confirm the integration of the
targeting vectors and Southern blotting to identify the presence of
off-target integration. With the use of dual drug selection, on
average >50 % of selected clones are correctly double-targeted
(Table 1). The entire process takes about 3 weeks, excluding the
time needed for the clones to expand (Fig. 2). This protocol can
 Doxycycline-Inducible Transgene Expression in iPSCs 15

DAY
-2 -1 0 2 6 18
Plate Matrigel1/3 Plate ES Cells Transfection Start puro Start G418 Pick colonies
+ DR4 MEFS selection for 48h selection for 10d and
(Puro 0.5ug/ml) (G418 40ug/ml) PCR screening

Puro G418

Fig. 2 Schematic outlining the processes involved in the generation of a doxycycline-inducible transgene
expression system in hESCs/iPSCs

a b
1400

1200

intensity of GFP
1000
% of cells

No dox 800
2 days in dox 600
Mean

8 days in dox 400

200

0
0 0.25 0.5 1 2
GFP
doxycycline ( g/ml)

Fig. 3 GFP expression in hematopoietic progenitors differentiated from hESC line with doxycycline-inducible
GFP expression under different conditions. (a) GFP expression in hematopoietic progenitors treated with
doxycycline for different lengths of time. Untreated hematopoietic progenitors (red ) do not express GFP.
Treatment with doxycycline for 2 days during differentiation is sufficient to induce GFP expression in
hematopoietic progenitors (blue). When doxycycline was given for 8 days, the induction of GFP expression
is stronger (black), suggesting that transgene expression does not get silenced when hESCs undergo
hematopoietic differentiation. (b) The level of GFP expression in hematopoietic progenitors increases with
the concentration of doxycycline added

also be adapted to accommodate the use of TALENs (8, 9) or

(CRISPR)-Cas9 system (8, 10–12) in place of ZFNs.
As a proof of concept, we have generated a doxycycline-
inducible human embryonic stem cell (hESC) line expressing
GFP. This line was generated using an earlier version of this proto-
col, which utilized single drug selection. We have differentiated this
line into hematopoietic progenitors or pancreatic beta cells and
observed that GFP expression is visible 2 days after the addition
of doxycycline and is maintained as long as doxycycline is present in
the system. Importantly, the expression of GFP is proportional to
the amount of doxycycline added and the length of time doxycy-
cline is present in the medium (Fig. 3). This implies that we can
induce a suitable, physiological level of transgene expression by
16 Xiuli Sim et al.

titrating different doses of doxycycline. Since then, we have devel-

oped an improved protocol described here, which uses dual drug
selection to increase the specificity of selection and decrease the
need to screen large numbers of clones.

2 Materials

2.1 Reagents and 1. PGK-AAVS1-ZFN-Left (addgene cat. no. #60915).

Supplies 2. PGK-AAVS1-ZFN-right (addgene cat. no. #60916).
2.1.1 Vectors Encoding
Zinc Finger Nucleases
Specific to the AAVS1
Locus

2.1.2 Targeting Vectors 1. AAVS1-SA-2A-NEO-CAG-RTTA3 (addgene cat. no. #60431).

To Be Integrated into the 2. AAVS1-SA-2A-PURO-TRE-eGFP (addgene cat. no. #22074)
AAVS1 Locus (GFP can be replaced by any gene of interest).

2.1.3 Transfection 1. Lipid transfection reagent: X-tremeGENE 9 DNA transfection

Reagent reagent (Roche Cat. no. 06 365 787 001).

2.1.4 Cell Culture Media 1. Dulbecco’s Modified Eagle’s Medium/Ham’s F12 50/50
and Reagents mix (DMEM/F12 50/50) (Corning Cellgro Cat. no.
10-092-CV).
2. Knockout™ Serum Replacement (Knockout™ SR) (Life Tech-
nologies Cat. no. 10828-028).
3. Penicillin Streptomycin Solution (Pen-Strep), 100 (Corning
Cellgro Cat. no. 30-002-Cl).
4. L-Glutamine Solution, 100 (Corning Cellgro Cat. no.
25-005-Cl).
5. MEM Nonessential Amino Acids (NEAA), 100 (Life Tech-
nologies Cat. no. 11140-050).
6. 2-Mercaptoethanol (55 mM) (Life Technologies Cat. no.
21985-023).
7. Iscove’s Modification of DMEM (IMDM) (Corning Cellgro
Cat. no. 10-016-CV).
8. PES Sterilizing 0.22 μm Filter System, Low Protein binding
(250 ml) (Corning Cat. no. 431096).
9. Dimethyl sulfoxide (DMSO) (Sigma Cat. no. D2650).
10. Fetal Bovine Serum (Tissue Culture Biologicals Cat. no. 101).
11. TrypLE™ Express (1), phenol red (Life Technologies Cat.
no. 12605-010).
Exploring the Variety of Random
Documents with Different Content
 "Ei viisastella nyt, vaan mennään", keskeytti Brovall jyrkästi.

Metsänhoitaja Brovallin äkilliset käytännölliset toimenpiteet

hämmästyttävät paroni Gyllenmarckia, mutta eivät saa häntä
suunniltaan.

"Et suinkaan sinä voi hoitoaluettasi noin jättää, ilman muuta",

sanoo hän.

"Minä uskon, että asia on sinun veljellisellä avullasi

järjestettävissä", vastaa Brovall kerkeästi ja toimellisesti.

Gyllenmarck katseli häntä pitkään ja tutkivasti: mieheen oli äkkiä

tullut jotakin nuorekasta ja joustavaa, joka ei johtunut pienestä
humalasta.

"Mutta pitäähän lesken saada pitää lainmukainen surukautensa",

väitti hän kuitenkin kuivasti. "Ymmärrät itsekin, ettei sinun äkillinen
ilmestymisesi vaikuta erikoisen tahdikkaalta. — Minä en väitä", jatkoi
hän hiukan vaivautuneesti, "että se hänessä herättäisi turhia luuloja,
ei tietystikään, mutta…"

"Kuule, veli Gyllenmarck", keskeytti Brovall hänet, "tällä kaikella

sinä et horjuta minua vähääkään. Minä olen yli kahdenkymmenen
vuoden joka päivä ajatellut häntä, ja sen pitäisi riittää…"

Eikä paroni Gyllenmarck enää vastustellut. Hän ymmärsi tai koetti

ymmärtää. Kentiespä Brovall matkan varrella huomaa, ettei ole
mikään nuorukainen, ja palaa takaisin. Mutta ellei huomaa, niin
minkäpä ihminen oikeastaan voi patoutuneille ajatuksilleen, joita
ympäristö ei ole kyennyt kuluttamaan pois; voihan olla, että hän oppii
ajattelemaan ja toimimaan yksipuolisesti. Ja lopuksi: menköön vain,
kenties hän oli nähnyt unta niin kauan aikaa, että oli hyvä aika
herätä.

"Herran nimessä", sanoi paroni Gyllenmarck, "jos sillä tavalla

ajattelet, niin minunkaan mielestäni ei ole muuta kuin kohtuullista,
että suoriudut matkaan".

Ja niin lähti metsänhoitaja, maisteri Brovall, huonokulkuisilla

kyytihevosilla koluamaan etelää kohti. Ei hän huomannut sitä, että
hän oli vanha ja juoppo, ei hän huomannut sitä, että hänen
vaatteensa olivat vanhanaikaiset ja hänen juhlapukunsa kiiltävä ja
kulunut, — eihän hän ollut sitä vuosikausiin nähnytkään, — eikä hän
osannut muistella vanhanpojanpuustellinsa puutteellisuuksia. Ei hän
nyt riidellyt ylikyytimaksuista eikä haukkunut kievarinemännille
huoneitten siivottomuudesta, vaan hän ajeli yöt päivät eteenpäin kuin
unissaan ja makseli kyytipojille runsaat juomarahat, jotta nämä
ajaisivat nopeammin.

"Mikähän meidän hosmestariin on mennyt", sanoivat ihmiset

toisilleen, "ei ollut mies entisellään".

"Arvaa sen, vähemmästäkin juomisesta", arvelivat toiset.

Vasta rautatieasemalle tultua hän säpsähti. Omien laskujensa

mukaan hänen olisi vielä ollut ajettava kolmetoista peninkulmaa
eteläänpäin, mutta nyt tulikin rautatie vastaan. Kas, kuinka
ennättävätkin niiden kulkuneuvojensa kanssa, ja kas, kun ei tullut
tuota tarkemmin ajatelleeksi. Vaikka muistelihan hän selostukset
niistä suurista vihkiäisistä ja tiesihän hän sitäpaitsi, mikä on lähin
asema. "Mutta sitä käy vähän hajamieliseksi."

Ja kyytipoika nauraa tirskutti.

 *****

Niin Carl Eneas Brovall meni, ja syystalvesta hän palasi. Se uusi

forstmestarinna oli kuluneen näköinen, hermostunut ja laiha eikä
lainkaan salannut kärsimättömyyttään. Mutta maisteri Brovall ei
nähnyt eikä huomannut. Häneltä meni koreat rahat puustellin
uudelleensisustamiseen, mutta mitä siitä: olihan hänellä rahaa,
perittyä ja säästettyä. Häneltä meni yhtä kauniit rahat toisen miehen
lasten kouluttamiseen, mutta sehän kuului asiaan. Hän tuli
hyvänsävyiseksi, ukkomaiseksi ja kiltiksi, ja ihmiset sanoivat, että
hän tylsistyi. Mutta hän ei ollut tylsistynyt, hän oli onnellinen omalla
vaatimattomalla tavallaan, olihan hänellä nyt omansa, — "Fenix-
lintu", niinkuin paroni Gyllenmarck, ylimetsänhoitaja, sanoi.
SARA-NIILAN LAPSEN KUOLEMA

Ulkona on helteinen heinäkuun päivä, mutta pirtissä on varjoisaa,

joskin tukahduttavan kuumaa. Ovenvieruspöydällä venyy vielä
ruoanjätteitä: kalvettu poronluu ja lihamurenoita, leivänkappaleita,
puoleksi tyhjennetty viilipunkka. Tyhjä, rievuilla täytetty komssio
riippuu kattohirressä, ilmassa on oksennuksen, kosteiden vaatteiden
ja ruoan lemua, kärpäset pörräävät ikkunaruuduilla, silloin tällöin
katkaisee hiljaisuuden sairaan lapsen valitus tai sääsken ohut surina.

— On se ikävää, kun lapsi on sairas.

— On, — vastaa Kulkuri hetken kuluttua yksikantaan. Mitäpä hän

muuta osaisi sanoa.

Hiljaisuus, entistä pitempi. Jos kuolema on helteisenä heinäkuun

päivänä tullakseen keskelle paahtavaa, auringonpaisteista
erämaata, niin se tulee. Sille ei voi mitään.

Kaijalla, lapsen äidillä, on syvät, ruskeat silmät ja säännölliset

piirteet. Kulkuri tulee itsestään ajatelleeksi, että jos hän joskus
hoitelisi itseään eivätkä jalkaterät olisi sisäänpäin kääntyneet, voisi
häntä pitää oikein kauniina.
 — Onko se jo kauan ollut sairaana?

— On se… viikon toista…

— Hm. Missä miehet ovat?

— Tunturilla.

— Jaa, tunturilla.

Kulkuri toistaa tietoisesti sanan, aivan kuin hän sanomatta

käsittäisi, mitä tekemistä miehillä on tunturilla keskellä heinäkuuta.
Hän on vielä nuori ja turmeltumaton, mutta hänellä on kulkijan
vaistot: kaikki miehet ovat tunturilla, ja ellei lapsi olisi sairas, niin…
Hetkisen hänen mielikuvituksensa luo ja askartelee, mutta äkkiä hän
pysähtyy järkkymättömän, edessä olevan tosiseikan eteen, ja hän
tuntee, että hänessä jokin aivan kuin sammuu.

Kaijalla on kirjava puku ja punavalkoinen hartiahuivi, jota rinnan

kohdalta pitää kiinni kullanvärinen solki. Mies, Sara-Niila, on joskus
hakenut uutistaloa, nyt hän elää Eerik Eiran, pororuhtinaan,
huonemiehenä ja pororenkinä. Sara-Niila on tunturilla, lapsi kotona
kuolemaisillaan. Ja minkäpä hän sille voisi, jos kotona olisikin.
Tapahtukoon Ibmelin tahto.

Sairas lapsi vingahtaa ja antaa äsken juotetun maidon juustona

ylen. Kulkurilla itsellään on sisar ja nuorempia veljiä, hän muistaa
heidät, hätkähtää ja koettaa olla asiassa mukana.

— Annatteko te sille keittämätöntä maitoa? — kysyy hän.

— Annamme.
 Äiti luo pitkän, kysyvän katseen Kulkuriin.

— Eiköhän olisi paras keittää ja sitten jäähdyttää. Voisi pysyä

paremmin sisällä.

Lappalaisäiti näyttää vilkastuvan ja rupeaa tekemään tulta

takkaan.

— Sinä taidat olla lukenut? — sanoo hän.

— Et kai sinä näistä sairausasioista ole lukenut?

— En, enkä paljon muutakaan.

— Mutta kyllä sinä sentään tiedät niistä enemmän kuin me.

Kulkuri ei vastaa mitään. Tuli takassa viriää ja tuo

synkäntuntuiseen huoneeseen jonkunlaista eloa.

Tunti, toista sitten Kulkuri ajatteli kaikenlaisia muita asioita, vaan ei

kuolemaa. Ilma oli polttava ja näytti ikäänkuin väreilevän
auringonpaisteessa. Luonto tuntui pysähtyneen, jäkälä kahisi
jalkojen alla, vesi joessa virtasi haaleana ja laiskana, sääskien surina
oli väsynyttä ja melkein olematonta, tunturien huiput näyttivät
ystävällisiltä kirkkaassa kilossa. Helteisenä, hehkuvana heinäkuun
päivänä ei ajatella kuolemaa, sillä ajatus pysähtyy ja vain vaistot
ovat vireillä.

Pororuhtinaan tuvan portailla akat punovat poronjänteitä. Hiki

valuu pitkin ruskeita kasvoja, kädet tekevät koneellisesti työtään.
Puhe ei nyt luista, kuumuus on ylivoimainen, ja sisällä tuvassa tekee
Sara-Kaijan poika, kaksivuotias, kuolemaa. Kuivamassa olevat
poronlihat lemuavat ulkohuoneiden katolla. Oli se hyvä, että tuo
Kulkuri tuli, lantalainen, herra, mihinpä ne naiset kuoleman kanssa.

Kangasaukealle, valkealle jäkälikölle, on sijoittunut kaksi vähäistä

tönöä, ja siellä, missä kankaannokka päättyy suohon, nousee savu
Marjaanan turvekodasta. Pian se alkaa nousta myöskin lähimmästä
tönöstä. Kulkurille pitää keittää kahvia, ei kai se Kaija sairaan lapsen
kanssa … Hyvä että tuli…

*****

Niinpä niin, kuolema se tulee itsekullekin aikanaan.

Kulkuri on jo vajoutunut siihen ajatukseen, että tuo lapsi on

ehdottomasti kuoleva, mutta että hänen puolestaan on tehtävä,
minkä hän voi, sen estämiseksi. Hän on muutattanut sille puhtaat
vaatteet, hän on juonut kahvia ja tuntee itsensä niinkuin talonväkeen
kuuluvaksi. Edustaa korkeinta arvovaltaa lappalaiskylässä.

— Jos se nyt pääsisi nukkumaan, niin ehkäpä se hiukan

voimistuisi…

Äidin silmät välähtävät, ja hän katsoo Kulkuria kiitollisesti ja

luottavaisesti.

Kadja, pororuhtinaan vanhin tytär, on tullut huoneeseen, Kadja,

jolla on kapeat kasvot, siniset, levottomat silmät, kauniisti piirtynyt
suu ja hennot, kapeat kädet. Kulkurin silmät seuraavat hänen
hiljaisia liikkeitään, ja taas hänen aivoissaan välähtää mielikuva siitä,
että hänellä, kenties, voisi olla joitakin ennen kokemattomia
mahdollisuuksia… Mutta mielikuvat sykehtyvät taas siihen.
Tunnotonta ajatellakaan sellaista. Ja epäritarillista.
 Lapsi parahtaa heikosti, ja äiti rientää sitä hyssyttelemään.
Kulkurista näyttävät äidin liikkeet aroilta ja epävarmoilta.

Kun oltaisiin jossakin muualla, niin lääkäri olisi jo tehnyt

tehtävänsä, lapsi paranisi ja pelko olisi poissa. Mutta viepäs täällä
sairas yhdentoista peninkulman päähän lääkärille, kanna ensin neljä
sylissäsi ja souda sitten seitsemän. Miks'eivät ne rakenna teitä…

Kulkuri nousee ja katsoo ikkunasta ulos, äänetön erämaa

tirkistelee vastaan joka taholta. Hohoijaa!

— Et suinkaan sinä aio lähteä? — kysyy lapsen äiti pelästyneesti.

— Niin, kun minusta vain olisi apua…

— Ole nyt sentään.

Itse asiassa ei Kulkuri ole aikonutkaan lähteä, mutta hän pelkää

näyttää saamattomuuttaan. Minnekkäpä hän sitäpaitsi lähtisi? Hänet
viedään maitokamariin ja hänen eteensä kannetaan paistettua
poronkieltä, tuoretta leipää ja viilipytty. Niin juuri, vähitellen hän on
tullut tärkeäksi, määrääväksi henkilöksi pororuhtinaan talossa.

Ovensuuhun kerääntyneet akat katselevat häntä hiljaisella

kunnioituksella.

— Luuletko sinä, että se paranee? — kysyvät he.

— En tiedä, saahan toivoa.

— Ibmelistähän se kaikki sentään lopuksi riippuu.

— Niinpä, Ibmelistä.
 Mutta kituvan lapsen hengitys käy yhä hiljaisemmaksi ja valitus
vaisummaksi. Äiti on jo valvonut monet päivät ja yöt, hän on ehtinyt
turtua, mutta hänen silmiinsä nousevat kyynelet.

— Kuolee se, kuolee…

— Älä nyt, Kaija, eihän sitä…

Akat saavat sen päähänpiston, että viina mahdollisesti auttaa,

panee veret liikkeelle.

— Onko sinulla viinaa?

— Ei.

Ihmettelyä. Millainen Kulkuri se on, jolla ei laukussaan ole viinaa.

Kaikki herrat pitävät viinaa mukanaan, jos sattuisivat vilustumaan.
Vilustunut se on tämä Kaijankin poika.

— Missä se heinäkuussa olisi vilustunut, ellei ole vesisateessa

pidetty?

— Ei ole. Mutta mistä sen tietää, lapsen… Kyllä viina hyvinkin…

— Olkaa vaiti. Liian väkevääkin se olisi.

Puhelu herkeää vähitellen, lapset seisovat sormi suussa, ja toinen

toisensa jälkeen menevät akat tönöihinsä. Kulkuri tulee ajatelleeksi,
että jotakin todellakin saisi olla, ellei viinaa, niin jotakin muuta sitten.

— Kun te nyt olette syöttäneet sille raakaa maitoakin, — sanoo

hän kärsimättömästi. Tiesi, ovatko elukatkaan täysin terveitä…
 — En minä ymmärtänyt, — vastaa äiti avuttomasti ja kysyy sitten
itku kurkussa: — Ei suinkaan se sitä tapa?

Kulkuri huomaa varomattomasti koskettaneensa arkaa kohtaa ja

näkee velvollisuudekseen lohduttaa.

— Ei nyt sentään, — myöntää hän, — vaikka keitetty luonnollisesti

olisi ollut parempaa.

*****

Illansuussa alkaa auringon polte heiketä, ja talon pikku pojat

tulevat sisään jokirannasta. Tytär on siistinyt pirtin, takassa räiskyy
valkea. Sairaan lapsen tilassa ei ole tapahtunut huomattavaa
muutosta, kenties hengitys on vieläkin ohennut ja valitukset käyneet
entistäkin hiljaisemmiksi. Kun Kulkuri ohimennen luo siihen
katseensa, valtaa hänet tukahduttava säälin tunne ja hän tulee
ajatelleeksi, että joku hänen nuoremmista veljistään mahdollisesti
samaan aikaan… No, mitäpä heistä, terveitä poikia ne ovat. Ja
Kulkuri koettaa näyttää karskilta ja tunteettomalta.

Aurinko käy yhä kalpeammaksi, vaikka se näihin aikoihin ei

laskeudu lainkaan. Silloin tällöin pistäytyy joku akka pirtissä, mutta
menee pois nähtyään, että kaikki on entisellään.

Talon pikku pojat käyvät levolle porontaljoille rankisen alle.

Silloin se tapahtuu, niin, ettei sitä oikein havaitakaan. Äiti on juuri

ruvennut syömään talon tyttären kanssa, hän on, tiesi mistä syystä,
virkistynyt ja vapautunut kuoleman ajatuksesta; kenties kaikki
lopultakin käy hyvin ja ehkä miehetkin pian tulevat tunturilta. Kulkuri
sytyttää savukkeen, ja Kadja, pororuhtinaan tytär, tahtoo myöskin
yhden: hän on poroaidalla monasti polttanut paperosseja.

— Et kai sinä sentään viinaa ole ryypännyt?

— En.

Kas vain, keskustellaan aivan maallisia asioita, ja sillävälin on

laiha rinta herennyt hengittämästä ja tuoni siepannut omansa.
Kulkuri, joka istuu lapsen vieressä, huomaa sen ensiksi, häkeltyy
eikä uskalla sanoa mitään. Salavihkaa hän pitää kättään kuolleen
suun edessä: ei, hengitystä ei tule, mutta antaa noiden syödä
loppuun.

Vasta sitten hän sanoo:

— Kyllä se nyt on kaikki.

Hän sanoo sen hiljaisesti ja lempeästi, aivan kuin maanitellen: se

on nyt kaikki, ikävä kyllä, mutta sehän oli toiselta puolen
odotettavissakin ja toiselta puolen, niin, parempi on, ettei tarvitse
kärsiä ja kitua.

Äiti kalpenee ja katsoo häneen suurin, lasittunein silmin, sitten hän

parahtaa ja vaipuu tuskalliseen itkuun. Kulkuri tuntee asemansa
tuskalliseksi ja noloksi, hän ei ole ennen ollut saapuvilla
tämäntapaisessa kohtauksessa. Jotakin tehdäkseen menee hän ja
taputtaa äitiä olalle.

— Mitäpäs… — sanoo hän, — sehän se kuitenkin joskus tulee

meille kaikille.
 Huoneessa on nyt hetken hiljaisuus, äiti nielee kyyneleitänsä ja
koettaa päästä selville ajatuksistaan.

— Onko sillä edes silmät kiinni, — kysyy hän äkkiä. — Sulkekaa

sen silmät.

Ja Kulkuri koettaa painaa yhteen luomet, joiden alta katse on

ainaiseksi sammunut.

Mitäpä hän voi enempää tehdä? Kuolema on käynyt, sillä hyvä.

Mutta häntä odottavat uudet, ennen kokemattomat kokemukset.

Alkaa jo olla keskiyö, mutta aurinko paistaa. Tähän vuodenaikaan

mennään levolle milloin väsymys tulee, kellon lyönneistä ei pidetä
vaaria. Akat tönöistä ovat taas kokoontuneet ovensuuhun, mutta he
eivät siunaile eivätkä surkuttele, vaan lohduttelevat.

Joku sanoo, että nyt olisi veisattava, ja kaikkien katseet kääntyvät

Kulkuriin. Tupakkahyllyllä on raamattu, katkismus ja kaksi
vanhanaikaista virsikirjaa.

— Veisaa sinä edellä, lannan mies.

Mutta nyt ei "lannan mies", Kulkuri, osaa yhtään hautavirttä, ei

uudesta eikä myöskään vanhasta virsikirjasta. "Ah autuasta, näin
hän pääsi varhain" — se menisi kyllä, mutta kun hän ei
kuolemakseenkaan muista säveltä. Tilanne on kieltämättä jonkun
verran piinallinen.

— Jos minä ensin luen jotakin, — ratkaisee hän.

— No niin, lue nyt sitten. Ensiksi.

 Hän alkaa olla siinä vireessä ja mielentilassa, että hän voisi pitää
vaikka pienet seurat. Lukemista kuunnellaan hartaudella, mutta virsi
puuttuu.

Ah nyt — "Integer vitæ", se sopii.

— Minä osaan kyllä virren, mutta se on vierasta kieltä. Ette te voi

sitä seurata.

— Veisaa vain. Kyllä me kuuntelemme.

— No niin sitten.

Akat kuuntelevat uteliaisuudensekaisella hartaudella. Joku ei

malta olla kuiskailematta toiselle. Mutta Kulkuri veisaa, veisaa
sellaisella antaumuksella, että unohtaa olevansa jonkunlainen
esiintyjä.

— Mitä kieltä se oli?

— Latinaa.

— Latinaa. Missä sellaista kieltä puhutaan?

— Ei sitä enää missään puhuta.

— No mutta kuinka sinä osaat sellaista kieltä, jota ei kukaan

puhu?

— Olen joskus lukenut.

— Kirjoista?

— Niin.
 — Mutta kuinka osataan kirjoihin painaa sellaista kieltä, jota ei
missään puhuta?

Hartaus uhkaa ellei haihtua, niin saada jonkunlaisen

sivutunnelman. Kulkuri antaa pitkiä, tyhjentäviä selityksiä, jotka
näyttävät ainakin osaksi tyydyttävän. Sairaus on päättynyt
kuolemaan, jännitys on lauennut, mieliala on vississä määrin
vapautunut. Kuoleehan niitä, varsinkin pieniä lapsia.

— Osaisitteko te virren "Autuas, ken sydämensä"?

Osataan. Naisten äänet kaikuvat kimeinä ja epävarmoina

laakeassa pirtissä.

Nyt katsoo Kulkuri kaiken olevan lopussa. Tapaus on kieltämättä

ollut surullinen, mutta muuta päätöstä tuskin olisi voinut odottaakaan.
Hyvä, että näinkin on päästy ohi. Ja Kulkuri sorvailee mielessään
mietelmiä kuolemasta ja kaiken katoamisessa ylimalkaan, hän
tuntee itsensä väsyneeksi ja rasittuneeksi ja päättää mennä levolle.

Mutta naiset hätääntyvät. Ruumis on pestävä ja sitten se on

vietävä pois. Ei kuolleesta ole elävien toveriksi.

— Niin kai se on. Alkakaa pestä sitten, minä katselen.

Naiset alkavat katsella toinen toistansa, ja vähän aikaa vallitsee

epävarma hiljaisuus. Lopuksi he alkavat puhua. Ei heistä ole ruumiin
kanssa tekemisiin. Kernaammin he paikkaisivat rannassa olevan
turvekodan, jonne ruumis voitaisiin viedä talvikeliin asti.

Kulkuri luo katseensa lapsen äitiin ja talon tyttäreen.

— Minkäpä se teille tekee, pikkuraukka, — sanoo hän.

 — Niin, mutta vainaja on sentään aina vainaja, — vastaa yksi
eukoista.

— Mutta kuka teille sitten pesee ruumiit?

— Me haemme jonkun lannan kylistä.

Kulkuri alkaa arvata heidän ajatustensa juoksun, mutta hän ei

hermostu. Tarkoitus on, että hänen on suoritettava peseminen.
Ajatusta ei uskalleta lausua julki, vai pidättäisikö sitä jonkunlainen
hienotunteisuus, mutta se siinä kuitenkin on pohjalla.

— Te kai tarkoitatte, että minun olisi pestävä tämä pikku vainaja,

— sanoo hän vihdoin.

Hänen ajatuksiaan ja mielialaansa koetetaan arvailla silmien

katseesta. Viimein yksi rohkaisee itsensä, — onhan mies mukavan
ja alhaisen näköinen.

— Jos sinä vain viitsisit, — lausuu hän epävarmasti, ja toinen lisää

kerkeästi:

— Kyllä me maksamme, mitä vain tahdot.

Vastausta odotetaan jännityksellä, ja Kulkuri, josta tämä kaikki

rikkoo tunnelman, alkaa tulla tyytymättömäksi.

— Hakekaa vettä ja saippua, — komentaa hän viimein, — ja te

muut: menkää paikkaamaan kotaa. Ei tässä vieraitamiehiä tarvita.

Äiti on koko ajan istunut kuin kuollut. Kun hän kuulee viimeiset
sanat, alkaa hän hiljaa itkeä.

— Saanko minä mennä pois? — kysyy hän itkunsa lomassa.

 — Kyllä minä autan minkä voin, — ehdottaa talon tytär.

Pirttiin tulee vähitellen hiljaisuus. Tuli loimuaa takassa, talon tytär

alkaa hiljaa ja epävarmasti riisua ruumista. Työ on outoa, eikä hän
tahdo uskaltaa oikein suoraan katsoa ruumiiseen.

— Et suinkaan sinäkin pelkää? — kysyy Kulkuri.

— En, — vastaa puhuteltu, mutta jatkaa tovin kuluttua:

— Vaikka kaameahan se on ruumis, pienikin.

Kulkuri ei löydä aihetta vastata. Vaatekappale toisensa jälkeen

irtautuu, pian on pieni, kangistuva ruumis alastomana.

Juuri silloin pistää äiti päänsä oven raosta sisään.

— Joko se on riisuttu? — tiedustelee hän.

Ja odottamatta vastausta hän ottaa kuolleen vaatteet kainaloonsa,

käy vielä vuoteen ääressä ja ottaa hänen vuodevaatteensa ja rientää
kuin peläten ulos.

— Mitähän se niillä? — ajattelee Kulkuri.

Alastoman ruumiin käsitteleminen vaikuttaa häneenkin

vastenluontoiselta. Hän tietää, ettei mikään vaara ole uhkaamassa,
mutta sittenkin hän pitelee sitä varovaisesti ja kuin itseään varoen.

Mutta ulkona kankaalla palaa räiskyvä nuotio. Ja nuotion ääressä

seisoo äiti kyyneleet silmissä ja heittää vaatekappaleen toisensa
jälkeen tulen omaksi. Joskus hän nähtävästi on kuullut puhuttavan
"tartunnasta", nyt se on hänen mielessään kammottavana
käsitteenä, ja hän koettaa varjella itseään ja muita niin hyvin kuin voi.
 Ja sisällä pestään ruumista…

*****

On siinä kokemuksia yhden päivän osaksi.

Aurinko ei laske, uusi päivä on tullut huomaamatta, ja Kulkuri istuu

yksin pirtin ikkunan luona ja johdattelee mieleensä päivän tapauksia.
Pieni vainaja on talvikeliä odottamassa turvekodassa, kaikki on nyt
lopullisesti ohi, on vain odotettava talvea ja käytävä kylältä
tilaamassa arkku. Niin, äidillä on vielä jäljellä ilmoittaa miehelleen,
kun tämä tulee tunturilta, että kuolema on käynyt. Mutta se on hänen
huolensa, Kulkurilta ovat huolet tähän asiaan nähden loppuneet.

Toisen rankisen alla nukkuvat lapset rauhallisesti hengittäen,

toisen alta kuuluu supatusta ja silloin tällöin tukahdutettu nyyhkytys,
äiti ja Kadja, talon tytär. Kulkurille on laitettu vuode maitokamariin,
äsken hän oli väsynyt, melkein uupunut, aamun tullen on tunne
hävinnyt. Ruumis on turtana, mutta ajatukset kiertelevät sitä
vilkkaammin. Mutta vaistot, ne aamulliset, eivät ota palatakseen. On
niinkuin olisi suuri pyhäpäivä ja kaiken yli lepäisi äänetön rauha.
Miksi hän ylimalkaan oli jäänyt tähän istumaan vai odottaako hän
kenties jotakin uutta kokemusta, kolkon totista, mutta ei ilman
surullisen humoristista sivumakua.

Hän kävelee ovea kohden ja ennättää lattian puoliväliin. Silloin

rankisessa liikahtaa.

— Menetkö sinä pois?

— Kyllä, nukkumaan.
 Äänetön epätietoisuus. Kulkuri seisoo siinä keskellä permantoa, ja
äkkiä hän tuntee melkein toivovansa, että nuo tuolla rankisessa
pelkäisivät.

— Pelkäättekö te? — kysyy hän.

— Kyllä me vähän pelkäämme, — tulee rehellisesti ja avuttomasti.

Hm. He luottavat häneen kuin johonkin Isä-Jumalaan. Äskeinen

toivomus tuntuu taas käden käänteessä vastenmieliseltä, melkein
raa'alta. Hän on näkevinään oman itsensä syrjästäpäin.

— Turhaa pelkoa se on, — sanoo hän viimein.

— Kyllä hän antaa teidän nukkua rauhassa.

Taas hiljaisuus, sitten pientä, kiihkeää supatusta. Kulkuri ottaa pari

empivää askelta ovea kohden.

— Älä mene.

Jälleen supatusta. Viimein tulee melkein rukoilevasti:

— Etkö sinä voisi tulla tänne?

— Hm… mahtaneeko se oikein sopia.

— Emme me tiedä, mutta…

No niin. Tilanne on jo itse asiassa selvä. Kulkuri nostaa rankisen

reunan taljan alta ja kömpii sisään. Mitäpä hän oikeastaan
muutakaan voi. Vilkaisee naisten avoimia silmiä ja heidän
säikähtyneitä kasvojaan ja paneutuu sitten pitkäkseen
mahdollisimman kauas heistä.
 Siinä hän makaa, katselee rankisen valkeata kangasta, katsahtaa
ohimennen vierustovereitansakin ja miettii. Toinen on nukkunut
pitkistä valvomisistaan ja suureen suruunsa, toinen nukkuu niinkuin
väsyneen, nuoren ihmislapsen on tapana nukkua. Unissaan hän
liikahtaa lähemmäksi Kulkuria, ja Kulkuri vetäytyy loitommaksi,
kunnes taljan vierestä tapaa kovan lattian. Hänen mielensä on tällä
kertaa vakavassa vireessä, päivällä on ollut monta vaihetta, ja hän
miettii ja aprikoi, kuinka monta niitä eilisenkin kohdalle kaiken
kaikkiaan on sattunut.
PORORUHTINAS KUOLEE

Nyt pitäisi surukellojen soida yli lumipeitteisten aapojen, yli tunturien,

yli vaarojen ja kiveliöiden, sillä Eerik Nikonpoika, pororuhtinas, on
kuolemaisillansa. Vielä hän hengittää, mutta pian, aivan pian, on
viikatemies tehnyt tehtävänsä, eivätkä surukellot soi. Kuinka ne
voisivatkaan soida, — vasta neljän päivän kuluttua ehtii
kuolinsanoma kirkolle.

Mikäpäs oikeastaan on Eerik Nikonpojan erota tästä maailmasta ja

sen hyörinästä. Ei ole hän koskaan kukkaronsa kurenauhoja
kiristänyt tarvitsevan edessä, ei ole hän yösijaa kieltänyt väsyneeltä
matkamieheltä, ei ole hän itsetietoisesti vääryyttä tehnyt, ei korkoja
kiskonut eikä poroja varastanut, ei myöskään käräjöinyt eikä antanut
ahneuden pistää nenäänsä asiallisiin asioihin. Neljättätuhatta poroa
tolvaa pitkin maita ja tuntureita, uudistila on perinnöksi lunastettu, ja
rahaakin on pankossa, on rahaa kotona kiisussa, on maailmalla, ja
povella on rahakiisun avain. Äsken sinne juuri pisti kuutisentuhatta.
Kyllä varmaan on elämistä ja olemista.

Eerik Nikonpoika, pororuhtinas, on täysissä pukineissaan

heittäytynyt pirtin sänkyyn, ja hengitys käy puuskutellen. Ruumis on
hiessä, kasvot ovat hiessä, ja kuuma, vapiseva käsi tapailee
Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade

Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.

Let us accompany you on the journey of exploring knowledge and

personal growth!

textbookfull.com