International Journal of

Molecular Sciences

Article
Development and Evaluation of a Shrimp Virus (IHHNV)-Mediated
Gene Transfer and Expression System for Shrimps
Yiwen Tao 1,2,† , Jinwu Wang 1,2,† , Rui Xiao 1,2 , Qingli Zhang 3 and Huarong Guo 1,2, *

1 Key Laboratory of Marine Genetics and Breeding (Ministry of Education), College of Marine Life Sciences,
Ocean University of China, Qingdao 266003, China; [email protected] (Y.T.); [email protected] (J.W.);
[email protected] (R.X.)
2 Key Laboratory of Evolution & Marine Biodiversity (Ministry of Education), Institute of Evolution & Marine
Biodiversity, Ocean University of China, Qingdao 266003, China
3 Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China;
[email protected]
* Correspondence: [email protected]
† These authors contributed equally to this work.

Abstract: An efficient gene transfer and expression tool is lacking for shrimps and shrimp cells. To
solve this, this study has developed a shrimp DNA virus-mediated gene transfer and expression
system, consisting of insect Sf9 cells for viral packaging, the shrimp viral vector of pUC19-IHHNV-
PH-GUS and the baculoviral vector of Bacmid or Bacmid-VP28 encoding the shrimp WSSV envelope
protein VP28. The pUC19-IHHNV-PH-GUS vector was constructed by assembling the genomic DNA
of shrimp infectious hypodermal and hematopoietic necrosis virus (IHHNV), which has shortened
inverted terminal repeats, into a pUC19 backbone, and then an expression cassette of baculoviral
polyhedron (PH) promoter-driven GUS (β-glucuronidase) reporter gene was inserted immediately
downstream of IHHNV for proof-of-concept. It was found that the viral vector of pUC19-IHHNV-
PH-GUS could be successfully packaged into IHHNV-like infective virions in the Sf9 cells, and the
gene transfer efficiency of this system was evaluated and verified in three systems of Sf9 cells, shrimp
hemolymph cells and tissues of infected shrimps, but the GUS expression could only be detected
in cases where the viral vector was co-transfected or co-infected with a baculovirus of Bacmid or
Bacmid-VP28 due to the Bacmid-dependence of the PH promoter. Moreover, the packaging and
Citation: Tao, Y.; Wang, J.; Xiao, R.;
infection efficiencies could be significantly improved when Bacmid-VP28 was used instead of Bacmid.
Zhang, Q.; Guo, H. Development and
Evaluation of a Shrimp Virus
Keywords: shrimp; infectious hypodermal and hematopoietic necrosis virus (IHHNV); virus-
(IHHNV)-Mediated Gene Transfer
and Expression System for Shrimps.
mediated gene transfer and expression system; viral packaging; shrimp hemolymph cells; insect
Int. J. Mol. Sci. 2024, 25, 8999. Sf9 cells
https://doi.org/10.3390/ijms25168999

Academic Editor: Laura Menotti

Received: 26 June 2024

1. Introduction
Revised: 15 August 2024 Penaeid shrimp is an economically important aquaculture species in China. However,
Accepted: 17 August 2024 an efficient gene transfer and expression tool is lacking for both shrimp individuals and
Published: 19 August 2024 in vitro cultured shrimp cells. At the very beginning, many attempts had been made to
introduce foreign genes into the eggs or early embryos of penaeid shrimp by physical
methods like microinjection, electroporation and particle bombardment, but these attempts
failed [1–3]. This can be attributed to the inherent problems, including the injection-induced
Copyright: © 2024 by the authors.
burst, especially for homolecithal eggs, the quick cleavage, and the low integration and
Licensee MDPI, Basel, Switzerland.
survival rates. Later, chemical methods like lipofection and biological methods of virus-
This article is an open access article
mediated gene transfer and expression systems, including mammalian-sourced modified
distributed under the terms and
retrovirus, lentivirus and adeno-associated virus (AAV), as well as insect-sourced modified
conditions of the Creative Commons
Attribution (CC BY) license (https://
baculovirus, were successively tried in in vitro cultured shrimp cells, but they achieved
creativecommons.org/licenses/by/
limited success, with very low transfection or infection efficiencies in comparison with
4.0/).
the results from mammalian tumor cells or insect cells due to the lack of actively dividing

Int. J. Mol. Sci. 2024, 25, 8999. https://doi.org/10.3390/ijms25168999 https://www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2024, 25, 8999 2 of 22

shrimp cells and the extremely low tropism of the viruses used [4–9]. Thus, an efficient
gene transfer and expression tool is urgently needed for shrimps and shrimp cells.
It has been well recognized that a lot of great success in the biological field can be
attributed to a great degree to the use of mammalian virus-mediated gene transfer and
expression systems such as retrovirus, lentivirus, adenovirus and AAV because of their
high infectivity and high gene delivery efficiency as well as their low cytotoxicity [10–13].
However, all of the aforementioned mammalian virus-mediated expression systems had
extremely low tropism in shrimp cells, even though they were improved to be pantropic
by pseudo-typing with a foreign envelope glycoprotein of vesicular stomatitis virus (VSV-
G) [4–8,14]. For example, Pu et al. [4] and Chen et al. [5] further improved the tropism of
the pantropic retrovirus and lentivirus expression systems in shrimp cells by introducing
two envelope proteins of VP28 and VP19 of shrimp white spot syndrome virus (WSSV)
into the envelope of the corresponding virions packaged via the co-transfection method,
respectively; however, the infection and expression efficiencies obtained in shrimp cells
were far lower than what was achieved in mammalian tumor cells. Recently, Tao et al. [8]
modified the capsid of the packaged AAV-2 by introducing the shrimp WSSV-sourced
tegument protein of VP26 or shrimp infectious hypodermal and hematopoietic necrosis
virus (IHHNV)-sourced capsid protein (IHCP) via the co-transfection method and signif-
icantly improved the tropism of the modified AAV-2 in shrimp cells, but the infection
and expression efficiencies obtained in shrimp cells were still much lower than those in
mammalian cells.
Attempts have also been made in terms of the improvement of Bac-to-Bac insect
baculovirus expression systems since unmodified baculovirus could not efficiently in-
fect shrimps and shrimp cells [9,15]. For example, Puthumana et al. [15] modified the
baculovirus vector by insertion of shrimp virus-sourced promoters of Ie1 (WSSV) and P2
(IHHNV) and found that the modified baculovirus could successfully infect the adult shrimp
tissues, although the infection efficiency was still low (<20%). In contrast, Wu et al. [9] devel-
oped a shrimp WSSV envelope protein VP28-pseudo-typed baculovirus expression system
and found that the improved baculovirus could infect the primarily cultured shrimp
hemolymph cells at a very low efficiency (1.2%) but adult shrimp tissues at an extremely
high efficiency of nearly 100%, suggesting the better performance of the insect baculovirus
in shrimps in contrast to mammalian viruses [4–7].
Compared with mammalian and insect viruses, shrimp virus has an incomparable ad-
vantage in the tropism to shrimp cells. Thus, we believe that efficient infection and foreign
gene expression in shrimp cells can be expected from the development of a shrimp virus-
mediated gene transfer and expression system. Recently, based on a shrimp RNA virus of
Macrobrachium rosenbergii nodavirus (MrNV), Alenton et al. [16] developed a shrimp viral
vector, a replication-incompetent mutant MrNV(∆RdRp)-GFP, for RNA delivery, paving
the way for the oral delivery of antiviral therapeutics in farmed crustaceans. However,
to date, no shrimp DNA virus-mediated gene transfer and expression system have ever
been established.
The infectious hypodermal and hematopoietic necrosis virus (IHHNV) belongs to
the genus Penstylhamaparvovirus, family Parvoviridae and subfamily Hamaparvovirinae.
It was also called PstDV because it was first found from Penaeus stylirostris in Hawaii
(USA) [17,18], and later found in other shrimp species, crabs and bivalves [19–23]. IHHNV
was found to be an unenveloped icosahedral DNA virus containing a linear single-stranded
genomic DNA of no more than 4.1 kb in size, the smallest known penaeid shrimp virus [24].
This makes it feasible for the genomic DNA of shrimp IHHNV to be engineered into an
expression vector. The genomic DNA of IHHNV contains three open reading frames of
ORF1, ORF2 and ORF3, driven by three promoters of P2, P11 and P61 in their upstream,
respectively [25,26]. These three promoters were found to be active not only in shrimp
cells but also in insect and fish cells. Moreover, the capsid protein (ORF3) of IHHNV
had been over-expressed in bacterial or insect cells and then self-assembled in vitro into
virus-like particles (VLPs) and successfully used as a nanocarrier to deliver foreign genes
Int. J. Mol. Sci. 2024, 25, 8999 3 of 22

into shrimp cells [27–29]. However, the use of VLPs as a gene delivery tool is limited due
to the high cost and extensive labor involved in the production of VLPs and the relatively
low DNA-loading efficiency.
Suitable packaging cells are essential for a virus-mediated expression system. In
consideration of the lack of an immortalized shrimp cell line and the accumulated evidence
of the infectivity of several shrimp viruses in insect cells [30–34] and the successful propa-
gation of IHHNV in shrimp–insect hybrid cells of PmLyO-Sf9 [35], in this study, the insect
Sf9 cell line was chosen as a packaging cell line for the IHHNV-based expression vector,
although electron microscopy evidence on the formation of shrimp viral particles in the
infected insect cells has not yet been reported.
This study aims to develop a shrimp virus (IHHNV)-mediated gene transfer and
expression system using insect Sf9 cells as packaging cells. To achieve this, the near
full-length genomic DNA of shrimp IHHNV had been isolated and then inserted into
a prokaryotic pUC19 backbone to obtain the cyclized plasmid of pUC19-IHHNV. Af-
ter that, an IHHNV-based expression vector was constructed by inserting an expression
cassette of PH-GUS-SV40 pA, the baculoviral polyhedron (PH) promoter-driven GUS (β-
glucuronidase) gene, into pUC19-IHHNV immediately downstream of IHHNV and then
packaged into IHHNV-like viral particles in the insect Sf9 cells by lipofection. And then
the gene transfer and expression efficiency of this shrimp IHHNV-mediated expression
system were evaluated and further improved in three systems of insect Sf9 cells, shrimp
hemolymph cells and adult tissues of infected shrimps via the expression of the GUS
reporter gene for proof-of-concept.

2. Results
2.1. Cloning and Cyclizing of the Genomic DNA of Shrimp IHHNV
As shown in Figure 1, two overlapped fragments, located at positions 1–1910 bp and
1870–3833 bp in the isolated genomic DNA of shrimp IHHNV, had been successfully ampli-
fied from the total genomic DNAs of IHHNV-infected shrimps and sequenced (Figure 1A).
Moreover, the two overlapped IHHNV fragments were head-to-tail jointed together and
connected with the Hind III- and BamH I- linearized pUC19 vector correctly, and thus a
circular plasmid, named pUC19-IHHNV, was successfully constructed, consisting of a
genomic DNA of shrimp IHHNV, which had shortened inverted terminal repeats (ITR)
in its both ends, and a prokaryote cloning vector pUC19 (Figure 1B–D). The genomic
DNA of shrimp IHHNV obtained was 3833 bp and that of pUC19 was 2.7 kb in size; thus,
the plasmid of pUC19-IHHNV derived from the head-to-tail connection of pUC19 and
IHHNV is 6.5 kb in size. It has also been found that the newly constructed plasmid of
pUC19-IHHNV could be transformed into competent E. coli cells and multiplied within
the bacterial cells; in other words, the successful construction of pUC19-IHHNV made
it possible that the genomic DNA of shrimp IHHNV can be duplicated in bacterial cells
(Figure 1B–D).

2.2. Construction of Shrimp IHHNV-Based Expression Vector of pUC19-IHHNV-PH-GUS

As shown in Figure 2, a viral expression vector of pUC19-IHHNV-PH-GUS was
successfully constructed by inserting an exogenous expression cassette of PH-GUS-MCS-
SV40 pA (i.e., PH-GUS in abbreviation) into the BamH I and Sac I sites of the cyclized
plasmid of pUC19-IHHNV. The PH-GUS-MCS-SV40 pA fragment was composed of an
insect baculovirus-sourced promoter of PH (polyhedron), a reporter gene of GUS (β-
glucuronidase), an MCS (multiple cloning site) and a transcriptional terminator of SV40
pA. It is 2413 bp in size, with a 30 bp pUC19-IHHNV-sourced homologous arm included in
both ends. Thus, the shrimp IHHNV-based expression vector of pUC19-IHHNV-PH-GUS
is 8.9 kb in size and can be used for the expression of the GUS gene and/or other genes in
insect cells due to the presence of the PH promoter-driven GUS gene and the associated
multiple cloning sites (MCS). The PH promoter was chosen here because of its high activity
in Sf9 cells.
 Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 4
Int. J. Mol. Sci. 2024, 25, 8999 4 of 22

Figure 1. Plasmid construction

Figure 1. Plasmidofconstruction
pUC19-IHHNV by cloning and
of pUC19-IHHNV byinserting
cloning and theinserting
genomicthe DNA of DNA o
genomic
the shrimp IHHNV into IHHNV
shrimp a prokaryotic
into acloning plasmid
prokaryotic of pUC19
cloning via of
plasmid a head-to-tail
pUC19 via linkage. (A) The
a head-to-tail linkage. (A
agarose gel result
agarose gel electrophoresis electrophoresis
of the tworesult of thefragments
genomic two genomic fragments
amplified fromamplified from
the anterior the anterio
and
posterior part of posterior
the genomicpartDNA
of theofgenomic DNA of respectively.
shrimp IHHNV, shrimp IHHNV, Lanerespectively. Lane
1, the anterior 1, the anterior
fragment of frag
1–1910 bp. Lane of2, 1–1910 bp. Lane
the posterior 2, the posterior
fragment fragment
of 1870–3833 bp. of 1870–3833
Lane M, DNA bp.Marker.
Lane M,(B)
DNATheMarker.
agarose(B) The ag
gel electrophoresis result of the cyclized plasmid of pUC19-IHHNV. Lane 3, pUC19-IHHNV
gel electrophoresis result of the cyclized plasmid of pUC19-IHHNV. Lane 3, pUC19-IHHNV. (C) The
The cyclized plasmid map of pUC19-IHHNV (6.5 kb). (D) The sequencing result of the cyc
cyclized plasmid map of pUC19-IHHNV (6.5 kb). (D) The sequencing result of the cyclized plasmid
plasmid of pUC19-IHHNV. The restriction endonuclease sites are underlined.
of pUC19-IHHNV. The restriction endonuclease sites are underlined.
2.2. Construction
2.3. GUS Expression of Shrimp IHHNV-Based
of Shrimp IHHNV-Based Expression
Expression Vector Vector of pUC19-IHHNV-PH-GUS
of pUC19-IHHNV-PH-GUS in
Sf9 Cells Was Dependent on the Presence
As shown in Figureof2,Insect Baculovirus
a viral expressionofvector
BacmidoforpUC19-IHHNV-PH-GUS
Bacmid-VP28 was
As shown cessfully
in Figure constructed
3(B1), it was by inserting
found that theanover-expression
exogenous expression
of the GUScassette of PH-GUS-M
gene could
not be detectedSV40
in thepA Sf9 (i.e.,
cells PH-GUS
transfected in by
abbreviation) into the BamHexpression
the shrimp IHHNV-based I and Sac vector
I sites of
of the cyc
plasmid of pUC19-IHHNV. The PH-GUS-MCS-SV40
pUC19-IHHNV-PH-GUS alone; that is, no blue signal could be observed in the transfectedpA fragment was composed o
insect baculovirus-sourced promoter of PH (polyhedron), a
Sf9 cells after X-gluc staining. The sequencing result confirmed that the construction of thereporter gene of GUS (β
above-mentioned curonidase),
expressionanvector
MCS (multiple cloning site) and a was
of pUC19-IHHNV-PH-GUS transcriptional
successful. terminator
Thus, we of SV40
It istranscriptional
think the specific 2413 bp in size, with a 30pattern
activation bp pUC19-IHHNV-sourced
for the insect baculovirushomologous
(Autographa arm include
both ends.
californica multicapsid Thus, the shrimp IHHNV-based
nucleopolyhedrovirus, AcMNPV) late expression
promotervector
of PHof(polyhedron)
pUC19-IHHNV-PH-
might contribute is 8.9
to akb in size
great and to
degree canthe
befailure
used for of the
the expression of the of
over-expression GUSthegene
GUSand/or
gene inother gen
insect cells due to the
the pUC19-IHHNV-PH-GUS-transfected Sf9 cells. presence of the PH promoter-driven GUS gene and the assoc
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 5 of 24

Int. J. Mol. Sci. 2024, 25, 8999 multiple cloning sites (MCS). The PH promoter was chosen here because of its high activ-
5 of 22
ity in Sf9 cells.

Figure 2. Construction of the viral expression vector of pUC19-IHHNV-PH-GUS by inserting an

exogenous concatemer of PH-GUS-MCS-SV40 pA into the cyclized plasmid of pUC19-IHHNV. (A) The
Int. J. Mol. Sci. 2024, 25, 8999 6 of 22

agarose gel electrophoresis result of the PCR product of PH-GUS-MCS-SV40 pA carrying a 30 bp

pUC19-IHHNV-sourced homology arm in both ends. Lane 1, PH-GUS-MCS-SV40 pA. Lane M, DNA
Marker. (B) The agarose gel electrophoresis result of the viral expression plasmid of pUC19-IHHNV-
PH-GUS. Lane 2, pUC19-IHHNV-PH-GUS (8.9 kb). (C) The plasmid map of pUC19-IHHNV-PH-GUS.
(D) The sequencing result of the expression plasmid of pUC19-IHHNV-PH-GUS. The restriction
endonuclease sites of BamH I and Sac I are lowercase and underlined. The sequence of the PH
promoter is shaded in a gray color. The sequence of the GUS gene is boxed in a larger size, and the
start and stop codons are boxed in a smaller size. The terminator of SV40 pA is underlined with a
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 7 of 24
dotted line and the poly(A) signal is double underlined with a dotted line. The multiple cloning site
(MCS) is indicated in vertical lines.

Figure3.3.GUS
Figure GUSexpression
expression ofof
thethe shrimp
shrimp IHHNV-based
IHHNV-based expression
expression vector
vector of pUC19-IHHNV-PH-
of pUC19-IHHNV-PH-GUS
GUS in Sf9 cells was dependent on the presence of insect baculovirus of Bacmid or Bacmid-VP28.
in Sf9 cells was dependent on the presence of insect baculovirus of Bacmid or Bacmid-VP28. The
The expression of the GUS gene was detected by X-gluc staining at 120 h post transfection. (A1–A4)
expression of the GUS gene was detected by X-gluc staining at 120 h post transfection. (A1–A4) The
The un-transfected Sf9 cells (control). (B1) The Sf9 cells transfected by pUC19-IHHNV-PH-GUS. (C1)
un-transfected Sf9 cells (control). (B1) The Sf9 cells transfected by pUC19-IHHNV-PH-GUS. (C1) The
The Sf9 cells transfected by Bacmid. (B2–F2) The Sf9 cells co-transfected by pUC19-IHHNV-PH-
GUS and Bacmid at varying co-transfection ratios of 1:1/3 (B2), 1:1/2 (C2), 1:1 (D2), 1:2 (E2) and 1:3
(F2) but at the same transfection reagent ratio of 5 µL Cellfectin II per µg DNA. Panels B3, C3 and
D3 are the Sf9 cells co-transfected by pUC19-IHHNV-PH-GUS and Bacmid at varying transfection
reagent ratio of 4 (B3), 5 (C3) and 6 (D3) µL Cellfectin II per µg DNA but at the same co-transfection
ratio of 1:1. (B4) The Sf9 cells co-transfected by pUC19-IHHNV-PH-GUS and Bacmid-VP28 at the
optimized co-transfection ratio of 1:1 and transfection reagent ratio of 6 µL Cellfectin II per µg DNA.
Scale bar, 100 µm.

2.4. Verification of the Packaging Capacity of Shrimp IHHNV-Based Expression Vector of

pUC19-IHHNV-PH-GUS into Infective Virions in Sf9 Cells
Int. J. Mol. Sci. 2024, 25, 8999 7 of 22

Sf9 cells transfected by Bacmid. (B2–F2) The Sf9 cells co-transfected by pUC19-IHHNV-PH-GUS
and Bacmid at varying co-transfection ratios of 1:1/3 (B2), 1:1/2 (C2), 1:1 (D2), 1:2 (E2) and 1:3 (F2)
but at the same transfection reagent ratio of 5 µL Cellfectin II per µg DNA. Panels (B3,C3,D3) are
the Sf9 cells co-transfected by pUC19-IHHNV-PH-GUS and Bacmid at varying transfection reagent
ratio of 4 (B3), 5 (C3) and 6 (D3) µL Cellfectin II per µg DNA but at the same co-transfection ratio of
1:1. (B4) The Sf9 cells co-transfected by pUC19-IHHNV-PH-GUS and Bacmid-VP28 at the optimized
co-transfection ratio of 1:1 and transfection reagent ratio of 6 µL Cellfectin II per µg DNA. Scale bar,
100 µm.

To test our hypothesis and to improve the transfection and expression efficiencies of
pUC19-IHHNV-PH-GUS in the Sf9 cells, two viral expression plasmids of pUC19-IHHNV-
PH-GUS and Bacmid were co-transfected into the Sf9 cells. It was found that the GUS
expression signals (i.e., blue cells) were successfully detected in the co-transfected Sf9 cells,
as expected (Figure 3(B2–F2,B3–D3)). In consideration of the fact that high transfection
and expression efficiency is very important for efficient viral packaging, the co-transfection
ratio of pUC19-IHHNV-PH-GUS to Bacmid (by mass, µg) and the transfection reagent
ratio of Cellfectin II (µL) per µg plasmid DNAs were further optimized. As shown in
Figure 3(B2–F2), it was found that the best transfection and expression efficiency was
obtained when the co-transfection ratio of the above-mentioned two plasmids was 1:1.
Also, the optimal transfection reagent ratio was 6 µL Cellfectin II per µg total plasmid
DNA (Figure 3(B3–D3)). In a word, the optimal transfection and packaging conditions for
pUC19-IHHNV-PH-GUS and Bacmid in Sf9 cells had been developed.
In consideration of the low tropism of Bacmid in shrimp cells, as reported previously
by Wu et al. [9], the co-transfection of pUC19-IHHNV-PH-GUS and Bacmid-VP28 was also
tested using the previously optimized co-transfection condition in this study. As shown
in Figure 3(A4,B4), strong GUS expression signals were detected in the co-transfected Sf9
cells, suggesting a significantly higher transfection and expression efficiency when the
recombinant baculovirus expression plasmid of Bacmid-VP28 was used instead of Bacmid
in the co-transfection assay.

2.4. Verification of the Packaging Capacity of Shrimp IHHNV-Based Expression Vector of

pUC19-IHHNV-PH-GUS into Infective Virions in Sf9 Cells
The over-expression of the shrimp IHHNV-based expression vector of pUC19-IHHNV-
PH-GUS in Sf9 cells had been confirmed when it was co-transfected with an insect bac-
ulovirus vector of Bacmid or Bacmid-VP28. But it was still unknown whether or not the
shrimp IHHNV-based expression vector of pUC19-IHHNV-PH-GUS could be packaged
into an infectious virion in Sf9 cells. To solve this problem, a reinfection assay was first
carried out. As shown in Figure 4, a lot of blue Sf9 cells could be observed in the Sf9 cells
infected by the viral supernatant of co-transfected Sf9 cells by pUC19-IHHNV-PH-GUS
and Bacmid (or Bacmid-GUS), indicating that the shrimp IHHNV-based expression vector
of pUC19-IHHNV-PH-GUS had been successfully packaged into infective virions (i.e., viral
particles) in the Sf9 cells (Figure 4E,F). In contrast, no blue cells could be detected in the
uninfected and Bacmid (negative control)-infected Sf9 cells (Figure 4A,B), and many more
blue cells could be found in the Bacmid-GUS (positive control)-infected Sf9 cells (Figure 4C).
No blue cells could be observed in the Sf9 cells infected by the viral supernatant of pUC19-
IHHNV-PH-GUS-transfected Sf9 cells, too. However, based on the fact that the activity of
the PH promoter is Bacmid-dependent, from this negative result of the reinfection assay
in the single plasmid of pUC19-IHHNV-PH-GUS-transfected Sf9 cells, we still did not
know if the viral vector of pUC19-IHHNV-PH-GUS could be successfully packaged into
infective virions.
 IHHNV-PH-GUS-transfected Sf9 cells, with a similar size to the wild-type shrimp
IHHNV, which had been reported to be an icosahedral viral particle with an average
diameter of 22–27 nm [18,24,35].
Taken together, the results obtained from the reinfection and electron microscopy
Int. J. Mol. Sci. 2024, 25, 8999 analysis confirmed the packaging capacity of the insect Sf9 cells to produce infectious shrimp
8 of 22
IHHNV-like viral particles after transfection of the viral vector of pUC19-IHHNV-PH-GUS.

Figure 4. Verification of the packaging capacity of the shrimp IHHNV-based expression vector of
pUC19-IHHNV-PH-GUS in Sf9 cells by reinfection assay. All the infected Sf9 cells were stained by X-
gluc at 120 h post infection. (A) Control Sf9 cells treated by the medium supernatant of un-transfected
Sf9 cells. (B) Sf9 cells infected by the medium supernatant of Bacmid-transfected Sf9 cells. (C) Sf9
cells infected by the medium supernatant of Bacmid-GUS-transfected Sf9 cells. (D) Sf9 cells infected
by the medium supernatant of pUC19-IHHNV-PH-GUS-transfected Sf9 cells. (E) Sf9 cells infected by
the medium supernatant of co-transfected Sf9 cells by pUC19-IHHNV-PH-GUS and Bacmid. (F) Sf9
cells infected by the medium supernatant of co-transfected Sf9 cells by pUC19-IHHNV-PH-GUS and
Bacmid-GUS. Scale bar, 100 µm in panels (A–E) and 50 µm in panel (F).

The packaging capacity of the shrimp IHHNV-based expression vector of pUC19-

IHHNV-PH-GUS in Sf9 cells was further verified by electron microscopy observation. As
shown in Figure 5, transmission electron microscopy analysis of the Sf9 cells infected
by the medium supernatant of pUC19-IHHNV-PH-GUS-transfected Sf9 cells indicated
that there were a plenty of IHHNV-like icosahedral particles piled up, in aggregates or
separately, in the infected Sf9 cells (Figure 5B). In contrast, no viral particles could be
detected in the uninfected Sf9 cells (Figure 5A). Only Bacmid virions could be found
to gather and line up in rows in the Sf9 cells infected by the medium supernatant of
Bacmid-transfected Sf9 cells (Figure 5C). Both IHHNV-like and Bacmid virions could be
observed in the Sf9 cells infected by the medium supernatant of pUC19-IHHNV-PH-GUS
and Bacmid-co-transfected Sf9 cells (Figure 5D), suggesting that the insect Sf9 cells co-
transfected with two viral vectors of pUC19-IHHNV-PH-GUS and Bacmid were able to
package two kinds of viruses simultaneously. As shown in Figure 5E, the results of the
electron microscopy negative staining analysis confirmed that IHHNV-like viral particles
of pUC19-IHHNV-PH-GUS could be detected from the medium supernatant of pUC19-
IHHNV-PH-GUS-transfected Sf9 cells, with a similar size to the wild-type shrimp IHHNV,
which had been reported to be an icosahedral viral particle with an average diameter of
22–27 nm [18,24,35].
Taken together, the results obtained from the reinfection and electron microscopy analysis
confirmed the packaging capacity of the insect Sf9 cells to produce infectious shrimp IHHNV-
like viral particles after transfection of the viral vector of pUC19-IHHNV-PH-GUS.
 X-gluc at 120 h post infection. (A) Control Sf9 cells treated by the medium supernatant of un-
transfected Sf9 cells. (B) Sf9 cells infected by the medium supernatant of Bacmid-transfected Sf9
cells. (C) Sf9 cells infected by the medium supernatant of Bacmid-GUS-transfected Sf9 cells. (D) Sf9
cells infected by the medium supernatant of pUC19-IHHNV-PH-GUS-transfected Sf9 cells. (E) Sf9
cells infected by the medium supernatant of co-transfected Sf9 cells by pUC19-IHHNV-PH-GUS
Int. J. Mol. Sci. 2024, 25, 8999 9 of 22
and Bacmid. (F) Sf9 cells infected by the medium supernatant of co-transfected Sf9 cells by pUC19-
IHHNV-PH-GUS and Bacmid-GUS. Scale bar, 100 µm in panels A–E and 50 µm in panel F.

Figure
Figure5.5. Verification
Verificationofofthe
the packaging
packagingcapacity
capacityof ofthe
the shrimp
shrimp IHHNV-based
IHHNV-based expression
expression vector
vector ofof
pUC19-IHHNV-PH-GUS
pUC19-IHHNV-PH-GUSinto intoinfective
infectivevirions
virionsinin
Sf9Sf9
cells byby
cells electron microscopy
electron microscopy assay. Panels
assay. A–
Panels
D are the
(A–D) areresults of theof
the results transmission electron
the transmission microscopy
electron assay. assay.
microscopy Panel EPanel
is the(E)
result of result
is the the electron
of the
microscopy negative staining assay. (A) Uninfected Sf9 cells without any virions detected.
electron microscopy negative staining assay. (A) Uninfected Sf9 cells without any virions detected. (B) Sf9
cells reinfected by the medium supernatant of pUC19-IHHNV-PH-GUS-transfected Sf9 cells, only
(B) Sf9 cells reinfected by the medium supernatant of pUC19-IHHNV-PH-GUS-transfected Sf9 cells,
IHHNV-like virions could be observed. (C) Sf9 cells reinfected by the medium supernatant of
only IHHNV-like virions could be observed. (C) Sf9 cells reinfected by the medium supernatant of
Bacmid-transfected Sf9 cells, only Bacmid virions could be found. (D) Sf9 cells reinfected by the
Bacmid-transfected
medium supernatantSf9 cells,
of the only BacmidSf9
co-transfected virions
cells could be found. (D) Sf9 cells and
by pUC19-IHHNV-PH-GUS reinfected
Bacmid, byand
the
medium
both supernatant
IHHNV-like andofBacmid
the co-transfected
virions couldSf9 be
cells by pUC19-IHHNV-PH-GUS
detected. (E) The packaged virions and Bacmid,
of pUC19-and
both IHHNV-like and
IHHNV-PH-GUS Bacmid
detected virions
from could be supernatant
the medium detected. (E)of The packaged virions of pUC19-IHHNV-
pUC19-IHHNV-PH-GUS-transfected
Sf9 cells. The
PH-GUS insetsfrom
detected in panels B–D aresupernatant
the medium enlargements of of the blue square box in the dotted line.
pUC19-IHHNV-PH-GUS-transfected Sf9Scale
cells.
bars were 2inµm
The insets in Panels
panels (B–D)A–D and 100 nm inofPanel
are enlargements E. square box in the dotted line. Scale bars were
the blue
2 µm in Panels (A–D) and 100 nm in Panel (E).
2.5. Infection and GUS Expression in Shrimp Hemolymph Cells by Mixed Viruses of pUC19-
2.5. Infection and GUS
IHHNV-PH-GUS Expression
and Bacmid in Shrimp Hemolymph Cells by Mixed Viruses of
(or Bacmid-VP-28)
pUC19-IHHNV-PH-GUS and Bacmid (or Bacmid-VP-28)
First, the mixed virus of pUC19-IHHNV-PH-GUS and Bacmid was successfully
First, the mixed virus of pUC19-IHHNV-PH-GUS and Bacmid was successfully pack-
packaged and titrated in Sf9 cells, and the titer of the mixed viruses packaged was up to 4
aged and titrated in Sf9 cells, and the titer of the mixed viruses packaged was up to
× 108 TU/mL after purification and concentration. However, as shown in Figure 6, when
4 × 108 TU/mL after purification and concentration. However, as shown in Figure 6, when
this kind of mixed virus was used to infect the shrimp hemolymph cells at an infection
this kind of mixed virus was used to infect the shrimp hemolymph cells at an infection
dose of 8 × 106 TU/well in a 96-well culture plate, no GUS expression or blue cells could
be observed in the infected shrimp hemolymph cells, no matter whether they were cul-
tured in the gelatin-containing 1 × L-15-based medium or gelatin-free 1.5 × L-15-based
medium (Figure 6(D,D1)). The extremely low tropism of the baculovirus of Bacmid in
shrimp hemolymph cells might have contributed to a great degree to the failure of the
GUS expression of the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid [10]. In other
words, the baculovirus of Bacmid failed to infect and enter into the shrimp hemolymph
cells; thus, it could not activate the PH promoter activity of the IHHNV-based vector of
Int. J. Mol. Sci. 2024, 25, 8999 10 of 22

pUC19-IHHNV-PH-GUS and eventually resulted in the failure of GUS expression within

the shrimp hemolymph cells. In the uninfected, Bacmid-infected and single virus of pUC19-
IHHNV-PH-GUS-infected shrimp hemolymph cells, as expected, no GUS expression or
blue cells were detected. Noteworthily, obvious cell hypertrophy was detected in the
pUC19-IHHNV-PH-GUS-infected shrimp cells (Figure 6B), and slight cell hypertrophy
was observed in the mixed virus-infected shrimp cells instead (Figure 6D), both cultured
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW
in gelatin-containing 1 × L-15-based medium. The reasons for the occurrence 11 of ofcell
24

hypertrophy in the infected shrimp cells were uncertain.

Figure 6.6.Infection
Figure Infectionand
and GUS
GUS expression
expression of mixed
of the the mixed viruses
viruses of pUC19-IHHNV-PH-GUS
of pUC19-IHHNV-PH-GUS and
and Bacmid
Bacmid (or Bacmid-VP-28) in the primarily cultured shrimp hemolymph cells cultured in gelatin-
(or Bacmid-VP-28) in the primarily cultured shrimp hemolymph cells cultured in gelatin-containing
containing 1 × L-15-based medium or gelatin-free 1.5 × L-15-based medium. The GUS expression
was detected by X-gluc staining at the 5th day post infection. (A,A1) Uninfected cells. (B) Cells
infected by IHHNV-like viruses of pUC19-IHHNV-PH-GUS. (C) Cells infected by the baculovirus
of Bacmid. (D,D1,D2) Cells infected by varied doses of mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid but cultured in gelatin-containing (D) or gelatin-free (D1, D2) medium. (E) Cells
infected by mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid-VP28 and cultured in gelatin-
free medium. The white arrows show the cell hypertrophy. The blue arrow indicates the positive
cells with GUS expression. Scale bar, 50 µm.
Int. J. Mol. Sci. 2024, 25, 8999 11 of 22

1 × L-15-based medium or gelatin-free 1.5 × L-15-based medium. The GUS expression was detected
by X-gluc staining at the 5th day post infection. (A,A1) Uninfected cells. (B) Cells infected by
IHHNV-like viruses of pUC19-IHHNV-PH-GUS. (C) Cells infected by the baculovirus of Bacmid.
(D,D1,D2) Cells infected by varied doses of mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid
but cultured in gelatin-containing (D) or gelatin-free (D1,D2) medium. (E) Cells infected by mixed
viruses of pUC19-IHHNV-PH-GUS and Bacmid-VP28 and cultured in gelatin-free medium. The white
arrows show the cell hypertrophy. The blue arrow indicates the positive cells with GUS expression.
Scale bar, 50 µm.

To improve the tropism and infectivity of Bacmid in shrimp cells, an alternative

recombinant baculovirus vector of Bacmid-VP28 was used to produce the mixed viruses of
pUC19-IHHNV-PH-GUS and Bacmid-VP28 by the co-transfection method in Sf9 cells. The
titer of the above-mentioned mixed virus was up to 2 × 108 IU/mL after purification and
concentration, which was only half of the obtained titer of mixed viruses of pUC19-IHHNV-
PH-GUS and Bacmid. As shown in Figure 6E, when the mixed viruses of pUC19-IHHNV-
PH-GUS and Bacmid-VP28 were used to infect the shrimp hemolymph cells cultured
in gelatin-free 1.5 × L-15-based medium at an infection dose of 8 × 105 TU/well in a
96-well culture plate, the GUS expression or blue cells were successfully observed in the
infected shrimp hemolymph cells, but in a very low infection and expression efficiency,
suggesting the higher infection efficiency of the recombinant baculovirus Bacmid-VP28
in the shrimp hemolymph cells. In other words, the improved GUS expression efficiency
could be attributed to the use of Bacmid-VP28 and the driving activity of the PH promoter
is highly dependent on the presence of Bacmid-VP28.

2.6. Infection and GUS Expression in Adult Shrimps by Mixed Viruses of pUC19-IHHNV-PH-GUS
and Bacmid (or Bacmid-VP-28)
First, the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid was intramuscularly
injected into the second abdominal segment of the adult shrimps at varied infection doses
of 7 × 104 , 7 × 105 and 7 × 106 TU per shrimp. Five days later, to detect the expression
of the GUS gene, the tissues of the hearts, gills, Oka organs, muscles and intestines of
the injected shrimps were dissected, respectively, and first stained by X-gluc in a 1.5 mL
centrifuge tube and then photographed under an inverted phase contrast microscope. As
shown in Figure 7, it was found that GUS expression could be detected in the tissues
of most of the injected shrimps, with an infection efficiency of 70–80%, and showed an
obvious tissue-specificity. In detail, a strong blue signal could be detected in the hearts
and gills, but a weak blue signal in Oka organs and no blue signal in the intestines and
muscles after X-gluc staining. Moreover, the intensity of the blue signals in the hearts, gills
and Oka organs increased with the increase of the infection doses, showing an obvious
dose-dependent relation. For example, a weak blue signal could be observed in the Oka
organs only at the highest infection dose of 7 × 106 TU per shrimp. Noteworthily, there was
a visible background blue signal in the hearts and gills of the PBS-injected control shrimps,
showing a tissue-specific background GUS expression (Figure 7(A0,A0’,B0,B0’)).
Second, the infection and GUS expression capability of the mixed viruses of pUC19-
IHHNV-PH-GUS and Bacmid-VP28 in the adult tissues of shrimps were further examined
by intramuscular injection at a relatively lower infection dose of 4 × 106 TU per shrimp. As
shown in Figure 8, it was found that, unlike the mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid, strong blue signals could be detected not only in the hearts and gills but
also in the Oka organs and intestines of the shrimps infected by the mixed viruses of
pUC19-IHHNV-PH-GUS and Bacmid-VP28, suggesting a much higher infection and GUS
expression capability of the mixed viruses when Bacmid-VP28 was included. One possible
explanation for this is that Bacmid-VP28 had much higher infectivity in shrimp tissues
than Bacmid did. Similarly, no blue signal could be detected in the muscles of the infected
shrimps, inferring that muscle tissue was the most difficult tissue to be infected or that a
higher infection dose was needed. It could also be noted that an obvious background blue
Int. J. Mol. Sci. 2024, 25, 8999 12 of 22

Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW

signal was 13 were
detected in the hearts, while weaker but visible background blue signals of 24
observed in the gills, Oka organs and intestines.

Figure 7. Infection
Infection and
and GUS expression analysisanalysis in different
different tissues of adult shrimps infected by
varied doses
varied doses ofofmixed
mixedviruses
virusesofofpUC19-IHHNV-PH-GUS
pUC19-IHHNV-PH-GUS and
and Bacmid.
Bacmid. TheThe sampled
sampled adult
adult tissues
tissues of
of the infected shrimps were first stained by X-gluc in a 1.5 mL centrifuge tube (right)
the infected shrimps were first stained by X-gluc in a 1.5 mL centrifuge tube (right) and then observed and then
observed under an inverted phase contrast microscope (left). (A0–E0) and (A0’–E0’) Results of the
under an inverted phase contrast microscope (left). (A0–E0) and (A0’–E0’) Results of the hearts, gills,
hearts, gills, Oka organs, muscles and intestines of the shrimps after injection of PBS, respectively.
Oka organs, muscles and intestines of the shrimps after injection of PBS, respectively. (A1–E1)4and
(A1–E1) and (A1’–E1’) Results of the five tested tissues of the shrimps after injection of 7 × 10 TU
(A1’–E1’) Results
mixed viruses, of the five tested
respectively. (A2–E2) tissues
and of the shrimps
(A2’–E2’) after
Results ofinjection
the five tested 104 TU of
of 7 × tissues mixed viruses,
the shrimps
respectively. (A2–E2) and (A2’–E2’) Results of the five tested tissues of the shrimps after
after injection of 7 × 10 TU mixed viruses. (A3–E3) and (A3’–E3’) Results of the five tested tissues
5 injection of
7of×the 5
10shrimp
TU mixedafterviruses.
injection(A3–E3)
of 7 × 10andTU
6 (A3’–E3’) Results of the five tested tissues of the shrimp after
mixed viruses.
injection of 7 × 106 TU mixed viruses.

Finally, to confirm the infection and over-expression of the GUS gene in the tested
tissues, semi-quantitative RT-PCR analysis was performed. It was found that the heart
tissues had a strong background GUS expression level, whereas the other four tested
tissues of the gills, Oka organs, intestines and muscles had a relatively low background
GUS expression level (Figure 9). This is reasonable because the GUS gene encodes a kind
of hydrolytic enzyme of β-glucuronidase, which can degrade glucuronide esters [36,37].
Although there was a strong background GUS expression level in the hearts, the semi-
quantitative RT-PCR analysis results could still confirm the successful infection and over-
expression of the GUS gene in the other tissues of the gills, Oka organs and intestines of
the shrimps infected by the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid-VP28
(Figure 9).
Int.
Int. J.J.
J. Mol.
Mol. Sci.
Sci. 2024, 25,
25, x8999
x FOR
FOR PEER
PEER REVIEW 14
14 of
of 24
Int. Mol. Sci. 2024,
2024, 25, REVIEW 24
13 of 22

Figure
Figure
Figure 8. 8.Infection
8. Infectionand
Infection andGUS
and GUS
GUS expression
expression
expressionanalysis
analysis
analysisin different
in tissues
in different
different of adult
tissues
tissues of shrimps
of adult
adult infected
shrimps
shrimps by mixed
infected
infected by
by
mixed
viruses viruses of pUC19-IHHNV-PH-GUS
of pUC19-IHHNV-PH-GUS
mixed viruses of pUC19-IHHNV-PH-GUS and
and Bacmid-VP28. Bacmid-VP28.
and Bacmid-VP28. The
The sampled sampled adult
adult tissues
The sampled tissues
adultoftissues of
of the
the infected the
infected
infected shrimps
shrimps were firstwere
shrimps first
stained
were stained
firstby X-glucby
stained inX-gluc
by a 1.5 mL
X-gluc in
in acentrifuge
a 1.5
1.5 mL
mL centrifuge
tube (right)
centrifuge tubeand
tube (right)
then and
(right) and then
then observed
observed under
observed an
under
inverted an
under anphase inverted
inverted phase
phase
contrast contrast microscope
contrast microscope
microscope (left). (A0–E0)(left).
(left). (A0–E0)
and(A0–E0) and
(A2–E2)and (A2–E2)
(A2–E2)
Results Results
of theResults of the
hearts,ofOka hearts,
hearts, Oka
theorgans, Oka
gills,
organs,
organs, gills,
gills, intestines and muscles ofof the shrimp after injection of of PBS, respectively. (A1–E1) and
intestines andintestines
muscles ofand the muscles
shrimp after the shrimpof
injection after
PBS,injection
respectively. PBS, respectively.
(A1–E1) and (A3–E3) (A1–E1) and
Results
(A3–E3)
(A3–E3) Results
Results of
of the
the hearts,
hearts, Oka
Oka organs,
organs, gills,
gills, intestines
intestines and
and muscles
muscles of
of the
the shrimp
shrimp after
after injection
injection
6
of the hearts, Oka organs, gills, intestines and muscles of the shrimp after injection of 4 × 10 TU
of
of 44 ×× 10
10
6 TU mixed viruses, respectively. Scale bar, 500 µm.
6 TU mixed viruses, respectively. Scale bar, 500 µm.
mixed viruses, respectively. Scale bar, 500 µm.

Figure
Figure 9.
9. Semi-quantitative
Semi-quantitative RT-PCR
RT-PCR analysis
analysis ofof the
the GUS
GUS gene
gene expression
expression inin different
different tissues
tissues of
of the
the
Figure 9. Semi-quantitative RT-PCR analysis of the GUS gene expression in different tissues of the
adult
adult shrimps
shrimps uninfected
uninfected (control)
(control) and
and infected
infected by
by mixed
mixed viruses
viruses of
of pUC19-IHHNV-PH-GUS
pUC19-IHHNV-PH-GUS and
and
adult shrimps uninfected
Bacmid-VP28. (control)DNA
and infected by mixed viruses of pUC19-IHHNV-PH-GUS and
Bacmid-VP28. M, M, Trans
Trans 2K
2K plus
plus DNA marker.
marker. G, G, gill.
gill. H,
H, heart.
heart. O,
O, Oka
Oka organ.
organ. I,I, intestine.
intestine. Mu,
Mu,
Bacmid-VP28.
muscle. M, Trans 2K plus DNA marker. G, gill. H, heart. O, Oka organ. I, intestine. Mu,
muscle. GUS,
GUS, β-glucuronidase
β-glucuronidase gene.
gene. β-actin,
β-actin, internal
internal reference
reference gene,
gene, from
from shrimp
shrimp (P.
(P. vannamei).
vannamei).
muscle. GUS, β-glucuronidase gene. β-actin, internal reference gene, from shrimp (P. vannamei).
Int. J. Mol. Sci. 2024, 25, 8999 14 of 22

3. Discussion
In this study, the genomic DNA of the shrimp IHHNV had been successfully isolated
and inserted into a prokaryotic cloning plasmid of pUC19-IHHNV. This made it possible
for the genomic DNA of a shrimp virus to be multiplied in bacterial cells. Subsequently,
a shrimp IHHNV-based expression vector of pUC19-IHHNV-PH-GUS was constructed
by introducing a eukaryotic expression cassette of PH-GUS-MCS-SV40 pA into the afore-
mentioned cyclized plasmid immediately after the IHHNV genome. It was also found
that insect Sf9 cells could be used as a packaging cell line for the shrimp IHHNV-based
expression vector of pUC19-IHHNV-PH-GUS, as confirmed by the reinfection, transmission
electron microscopy and electron microscopy negative staining assays. Shrimp IHHNV-like
icosahedral virus particles with a similar size to wild-type IHHNV could be observed
both in the Sf9 cells and in the medium supernatant of pUC19-IHHNV-PH-GUS-infected
Sf9 cells.
The PH promoter was chosen in the IHHNV-based expression vector of pUC19-
IHHNV-PH-GUS because it has a strong activity and can produce high-level protein
expression in Sf9 cells, thus proving beneficial for the viral packaging. However, as it is
a late-stage promoter of insect baculovirus, its activation is dependent on the expression
products of some early genes of baculovirus [38–40]. The absence of Bacmid (genetically
modified from AcMNPV) might result in the over-expression failure of the PH promoter-
driven GUS gene. As expected, no GUS expression or blue signal could be detected in
the single plasmid of the pUC19-IHHNV-PH-GUS-transfected Sf9 cells, but many blue
cells could be detected in the co-transfected Sf9 cells by pUC19-IHHNV-PH-GUS and
Bacmid (or Bacmid-VP28). Moreover, a significantly higher transfection and expression
efficiency was obtained when the baculoviral plasmid of Bacmid-VP28 encoding the shrimp
WSSV-sourced envelope protein VP28 was used instead of Bacmid.
It is well known that the host range (i.e., tropism) of an enveloped virus is usually
dependent on its outermost envelope proteins, which can recognize and bind the shrimp
cell surface receptors and mediate the viral entry into the host cells [41]. The recombinant
baculovirus of Bacmid-VP28 encoded an important envelope protein of VP28 from shrimp
white spot syndrome virus (WSSV), which can bind to shrimp cells as an attachment protein
and help the virus enter the cytoplasm, and it had been confirmed that the introduction
of the VP28 protein into the envelope of pseudo-typed baculovirus, lentivirus and retro-
virus could significantly improve their tropism to shrimp cells [4,6,10]. Thus, it can be
expected that the baculovirus of Bacmid-VP28 will have higher tropism in shrimp cells than
Bacmid. In this study, when the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid (or
Bacmid-VP28) were used to infect the primarily cultured shrimp hemolymph cells, no GUS
expression or blue cells could be detected after infection by the mixed viruses of pUC19-
IHHNV-PH-GUS and Bacmid, possibly due to the extremely low tropism and infectivity of
Bacmid in the shrimp hemolymph cells. Instead of this, obvious blue cells were observed
in the shrimp hemolymph cells infected by the mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid-VP28, possibly due to the higher infectivity and cell entry of Bacmid-VP28 in
shrimp hemolymph cells. In a word, the infection and GUS expression capability of the
mixed viruses could be greatly improved when Bacmid-VP28 was used to replace Bacmid.
In addition, the prerequisite for GUS expression was the successful co-infection and cell
entry of the two mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid-VP28 into the
same shrimp hemolymph cell. However, the co-infection efficiency of the above-mentioned
mixed viruses in shrimp hemolymph cells was still unclear and more work is needed on
it. Anyway, the use of a higher infection dose should be a better choice to increase the
infection and expression efficiency of the mixed viruses of pUC19-IHHNV-PH-GUS and
Bacmid-VP28 in the shrimp hemolymph cells.
Unlike shrimp hemolymph cells, both of these two kinds of mixed viruses could infect
the adult tissues of most of the injected shrimps with an infection efficiency of 70–80% and in
tissue-specific and dose-dependent manners, and this was confirmed by semi-quantitative
RT-PCR analysis. One possible reason for the significantly higher infection efficiencies of the
Int. J. Mol. Sci. 2024, 25, 8999 15 of 22

above-mentioned two kinds of mixed viruses is the higher dividing capacity of live shrimp
tissues in comparison with the in vitro cultured shrimp cells. Of note, unlike the mixed
viruses of pUC19-IHHNV-PH-GUS and Bacmid, strong blue signals could be detected not
only in the hearts and gills but also in the Oka organs and intestines of the shrimps infected
by the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid-VP28, suggesting the much
higher infection and GUS expression capability of the mixed viruses when Bacmid-VP28
was included, confirming that Bacmid-VP28 had much higher infectivity in shrimp tissues
than Bacmid did.
In addition, VP28 is the most abundant major envelope protein of WSSV, but it is not
the only one. In fact, the WSSV envelope consists of at least 35 different proteins, and more
than 23 of them are denoted as envelope proteins (GenBank No. AF332093.3). The high
diversity of envelope proteins in WSSV may to a great degree contribute to its wide tissue
distribution; in other words, WSSV can be detected in almost all the tissues of the infected
shrimps. Thus, we think the introduction of other kinds of WSSV envelope proteins into
the recombinant baculovirus might change its tissue-specific tropism and confer a crucial
factor to influence the tissue-specific tropism of the above mixed viruses [42].
Taken together, a shrimp virus (IHHNV)-mediated gene transfer and expression
system was successfully developed in this study, which consisted of a shrimp IHHNV-
based expression vector of pUC19-IHHNV-PH-GUS, a helper baculovirus of Bacmid-VP28
and one packaging cell line of insect Sf9. This useful research tool for efficient gene transfer
and expression in shrimps will greatly promote future works on the molecular breeding of
transgenic shrimps with merit traits as well as the immortalization of the in vitro cultured
shrimp cells, although it still needs more improvements in terms of the gene delivery
efficiency and biosafety assessment, for example, the use of IHHNV with full-length 5′ and
3′ ITR, or the production of replication-defective IHHNV by splitting up of the capsid gene
(ORF3) from the IHHNV genomic DNA.

4. Materials and Methods

4.1. Shrimps
Actively swimming shrimps (Metapenaeus ensis), 12 ± 3 cm in length and 15 ± 5 g in
weight, were purchased from a local seafood market in Nanshan, Qingdao, China. They
were acclimatized in aerated seawater at an ambient temperature of 18–25 ◦ C for at least
two days before being used for viral infection and primary cell culture. The infectious
hypodermic and hematopoietic necrosis virus (IHHNV)-infected shrimps were sampled
from the local shrimp farm in Qingdao, China, immediately frozen and transported in
liquid nitrogen to laboratory, and then stored at −80◦ C until used for the isolation of
the genomic DNA of IHHNV. The care and use of the shrimps were performed under
supervision and approved by the scientific ethics committee of Ocean University of China.

4.2. Cells and Cell Culture

A continuous insect cell line of Sf9, derived from the ovarian tissues of the pupa of fall
army worm, Spondoptera frugiperda, was used for the packaging and titration of the shrimp
IHHNV-based recombinant viruses, the baculoviruses of Bacmid (i.e., bMON14272, from
the Bac-to-Bac baculovirus expression system, Cat. No. 10360-014, Invitrogen, Carlsbad,
CA, USA), Bacmid-GUS encoding β-glucuronidase (GUS), and Bacmid-VP28 encoding the
envelope protein (VP28) of shrimp WSSV. The Sf9 cells were maintained in SIM medium
(Sino Biological, Beijing, China) supplemented with 10% fetal bovine serum (FBS, Biological
Industries, Kibbutz Beit Haemek, Israel, ISR) at 28 ◦ C in a 3% CO2 incubator.
Primarily cultured shrimp hemocytes were isolated from the circulating hemolymph
of M. ensis and then cultured in a 1.5 × L-15-based or gelatin-containing 1.0 × L-15-
based growth medium, as described previously by Han et al. [43] and Zhao et al. [44],
respectively, until used for the infectivity analysis of the shrimp IHHNV-based recombinant
viruses or the baculoviruses of Bacmid, Bacmid-GUS and Bacmid-VP28. In brief, the
shrimps were pre-treated overnight in aerated boiling-disinfected seawater containing
Int. J. Mol. Sci. 2024, 25, 8999 16 of 22

1200 IU/mL penicillin and 1200 IU/mL streptomycin. Then, the shrimps were individually
anesthetized by immersion in 75% ethanol for 3–5 min. Next, after sequential disinfection
of the body surface of the shrimps by iodophor (INOHV, Qingdao, China) and 75% ethanol,
the circulating hemolymphs were drawn out from the thoracic sinus of the shrimp using
a 1 mL aseptic injection syringe preloaded with 200 µL 1.5 × L-15-based shrimp growth
medium, then mixed and seeded into a 96-well culture plate (100 µL/well) and cultured at
28 ◦ C in a 3% CO2 incubator for 4 h. After that, the old medium in each well was replaced
with fresh 1.5 × L-15-based or 1 × L-15 gelatin-containing growth medium and cultured
until used.

4.3. Cloning and Cyclizing of the Genomic DNA of Shrimp IHHNV

The published full-length genomic DNA of shrimp infectious hypodermic and hematopoi-
etic necrosis virus (IHHNV) was 4.1 kb in size, which had two highly variable inverted
terminal repeats (ITR) in both ends. After many attempts, only 3833 bp of the length of
the genomic DNA of IHHNV, with shortened ITR in both ends, had been cloned in this
study. In detail, the genomic DNA of IHHNV was amplified by PCR in two overlapped
fragments, 1–1910 bp and 1870–3833 bp, respectively. In order to link them together, these
two fragments had a 40 bp overlap located in position 1870–1910 bp, which served as
a homology arm for recombinase-based assembly. The genomic DNA of IHHNV was
cyclized by head-to-tail joining with a linearized prokaryotic cloning plasmid of pUC19,
which was pre-digested with double restriction endonucleases of Hind III and BamH I.
Thus, an IHHNV-containing shuttle plasmid of pUC19-IHHNV was constructed to be used
to multiply the genomic DNA of IHHNV in bacteria.
To clone and cyclize the genomic DNA of IHHNV, the anterior fragment of 1–1910 bp
was amplified by a forward primer of 5′ -TCACACAGGAAACAGCTATGACCATGATTAC
GCCAAGCTTTCGGAGCGCTTCGCAGGAAACCGTTACAA-3′ , which had a 40 bp homol-
ogous arm (underlined) in the 5′ -end corresponding to the 40 bp sequence in the upstream of
the Hind III restriction endonuclease site in the plasmid of pUC19, and a reverse primer of 5′ -
GCATATTGTCGTAGTCTGGT-3′ . The posterior fragment of 1870–3833 bp was amplified by
a forward primer of 5′ -GTCACTAATTACAAACCTGCAG-3′ and the reverse primer of 5′ -
AACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCCTTCGCAGAAACCGT
TAAC-3′ , which had a 40 bp homologous arm (underlined) in the 5′ -end, too, but this
homologous arm corresponded to the 40 bp complement sequence in the downstream of
the BamH I restriction endonuclease site in the plasmid of pUC19. Finally, the linearized
plasmid of pUC19 and the homology arm-carrying IHHNV fragments of 1–1910 bp and
1870–3833 bp were connected head to tail into one cyclized recombinant plasmid of pUC19-
IHHNV using a large fragment homologous recombination kit (Gibson Assembly® Ultra
Kit, SGI-DNA, CA, USA) according to the manual’s instructions. In brief, a 40 ng anterior
fragment, 40 ng posterior fragment and 50 ng linearized pUC19 were first mixed in a 200 µL
PCR tube and then 5 µL GA Ultra Master Mix A (2×) was added and mixed again. After
that, the mixture was incubated and run under the following PCR program: 37 ◦ C for 5 min,
75 ◦ C for 20 min, and then decreased to 60 ◦ C at a rate of 0.1 ◦ C per second, then 60 ◦ C for
30 min, and finally decreased to 4 ◦ C at a rate of 0.1 ◦ C per second. Next, 10 µL GA Ultra
Master Mix B (2×) was added and run at 45 ◦ C for 15 min. Finally, the ligation product
was immediately transformed into the T1 competent bacteria cells for the screening and
sequencing of positive clones.

4.4. Construction of Shrimp IHHNV-Based Expression Vector of pUC19-IHHNV-PH-GUS

First, an expression cassette of PH-GUS-MCS-SV40 pA, 2383 bp in size, consisting
of an insect baculovirus polyhedron (PH) promoter, the GUS (β-glucuronidase) gene, a
downstream MCS (multiple cloning site) and the SV40 poly (A) signal (pA), was amplified
by a forward primer of 5′ -TCTGCGAAGGGATCCATCATGGAGATAATTAAAATGA-3′
and a reverse primer of 5′ -AGTGAATTCGAGCTCGATCCAGACATGATAAGAT-3′ using
a donor plasmid of pFastBacTM 1-GUS as a template. The pFastBacTM 1-GUS plasmid was
Int. J. Mol. Sci. 2024, 25, 8999 17 of 22

purchased along with the Bac-to-Bac baculovirus expression system (Invitrogen, catalog No.
10359-016 and 10360-014, Carlsbad, CA, USA). For recombinase-based assembly, the above
forward primer was augmented with a 15 bp homologous arm in its 5′ -end (underlined)
corresponding to the 15 bp sequence in the upstream of the BamH I restriction endonuclease
site in the plasmid of pUC19-IHHNV, and the above reverse primer was augmented with
a 15 bp homologous arm in its 5′ -end (underlined), which corresponded to the 15 bp
complement sequence in the downstream of the Sac I restriction endonuclease site in the
plasmid of pUC19-IHHNV, respectively. Next, to construct the shrimp IHHNV-based
expression vector of pUC19-IHHNV-PH-GUS, the homologous arm-containing fragment
of PH-GUS-MCS-SV40 pA was inserted into the pUC19-IHHNV vector, which had been
linearized by BamH I and Sac I, using a universal homologous recombination kit (Pro
Ligation-Free Cloning Kit, ABM Inc., VAN, Vancouver, BC, Canada) according to the
manual’s instruction. In brief, the PH-GUS-MCS-SV40 pA fragment, the linearized plasmid
of pUC19-IHHNV and 2 × Pro Ligation-Free Mix were mixed and then incubated at 50 ◦ C
for 2 h. Then, the ligation product was immediately transformed into DH5α competent
bacterial cells for the screening and sequencing of positive clones.

4.5. Viral Packaging

The packaging of pUC19-IHHNV-PH-GUS, Bacmid and Bacmid-GUS were carried
out as described previously by Wu et al. [9] with minor modifications. In brief, Sf9 cells
were seeded into a 48-well culture plate at a seeding density of 1 × 105 cells/well at about
16 h ahead of transfection, and when the cell confluency reached 70%, the old medium
in each well was replaced with a diluted SIM medium containing 13.5% SIM medium,
1.5% FBS and 85% serum-free Grace medium (Gibco, Carlsbad, CA, USA). After that, for
each well, a total of 1.875 µL transfection reagent of Cellfectin II (Gibco, Carlsbad, CA,
USA) and 0.375 µg viral plasmid DNA were separately diluted in 25 µL serum-free Grace
medium in two tubes and incubated at room temperature for 10 min. After that, they were
combined and vortexed and incubated at room temperature for another 20–30 min. Next,
the liposome–DNA transfection complex was evenly added into the well drop by drop
and cultured at 28 ◦ C for 4 h, and then the transfection reagent-containing medium was
replaced with normal serum-containing SIM medium. Then, 120 h later, the expression
of the GUS reporter gene was assayed by X-gluc staining (Solarbio, Beijing, China) as
described previously by Wu et al. [9]. The baculoviruses of Bacmid and Bacmid-GUS were
chosen as negative and positive controls, respectively, to verify the expression of the GUS
gene of the shrimp virus (IHHNV)-based expression vector of pUC19-IHHNV-PH-GUS in
the Sf9 cells. Baculoviral plasmids of Bacmid and Bacmid-GUS were prepared according
to the manual’s instruction for the Bac-to-Bac baculovirus expression system (Invitrogen,
Carlsbad, CA, USA).
A total of two kinds of mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid (or
pUC19-IHHNV-PH-GUS and Bacmid-VP28) were packaged in this study. Compared with
the baculovirus of Bacmid, the recombinant baculovirus of Bacmid-VP28 encoded an
important envelope protein of VP28 of the shrimp WSSV and thus was reported to have
better tropism to shrimp cells [10]. Before packaging, firstly, the optimal co-transfection
ratio of pUC19-IHHNV-PH-GUS to Bacmid was examined in a 48-well culture plate. In
consideration of the cytotoxicity of plasmid DNAs, the tested co-transfection ratios of the
pUC19-IHHNV-PH-GUS (0.375 µg) to Bacmid were 1:1/3 (0.125 µg), 1:1/2 (0.1875 µg),
1:1 (0.375 µg), 1:2 (0.75 µg) and 1:3 (1.125 µg) using a transfection reagent ratio of 5 µL
Cellfectin II per µg DNA, as reported by Wu et al. [9]. As shown in Figure 3, it was found
that the optimal co-transfection ratios of pUC19-IHHNV-PH-GUS to Bacmid were 1:1 (µg).
Secondly, the optimal ratio of transfection reagent to the mixed plasmid DNAs was further
examined in a 48-well culture plate with a co-transfection ratio of 1:1 (pUC19-IHHNV-PH-
GUS to Bacmid in µg). The tested ratios of the mixed plasmid DNAs (µg) to Cellfectin II
(µL) were 1:4, 1:5 and 1:6, respectively, based on the work by Wu et al. [9].
Int. J. Mol. Sci. 2024, 25, 8999 18 of 22

Finally, the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid (or pUC19-IHHNV-

PH-GUS and Bacmid-VP28) were first packaged under the optimized co-transfection ratio
and transfection reagent ratio in a 24-well culture plate. In detail, 1 µg pUC19-IHHNV-PH-
GUS, 1 µg Bacmid (or Bacmid-VP28) and 12 µL transfection reagent of Cellfectin II were
used in the co-transfection of Sf9 cells. Then, at 120 h post co-transfection, the medium
containing detached Sf9 cells and cell debris was collected and then clarified twice by
centrifugation at 12,000× g, 4 ◦ C for 15 min, and finally, the medium supernatant of the
mixed viruses was saved and used to further infect the Sf9 cells cultured in 10 cm petri
dishes by 400 µL viral supernatant per dish for the purpose of the multiplication of the
mixed viruses.

4.6. Purification, Concentration and Titration of the Viruses

To purify the single virus of pUC19-IHHNV-PH-GUS, the transfected Sf9 cells were
collected by trypsinization and centrifugation at 2000× g, 4 ◦ C for 15 min and then frozen
and thawed for three rounds. Next, the lysed cells were resuspended in sterile PBS (8.0 g
NaCl, 0.2 g KCl, 0.2 g KH2 PO4 and 3 g Na2 HPO4 ·12H2 O in 1 L dH2 O, pH 7.0) and
then clarified twice by centrifugation at 12,000× g, 4 ◦ C for 15 min. Finally, the viral
supernatant was collected and concentrated by ultracentrifugation at 140,000× g, 4 ◦ C for
2 h. After ultracentrifugation, the supernatant was discarded and the viral precipitate was
resuspended with PBS, aliquoted and stored at −80 ◦ C.
To purify the mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid (or pUC19-
IHHNV-PH-GUS and Bacmid-VP28), the medium supernatant was first collected and saved,
and then the co-transfected Sf9 cells were collected by trypsinization and centrifugation
and then frozen and thawed for three rounds. Next, the lysed cells were resuspended in the
saved medium supernatant and then clarified twice by centrifugation at 12,000× g, 4 ◦ C for
15 min. Finally, the viral supernatant was collected and concentrated by ultracentrifugation
at 140,000× g, 4 ◦ C for 2 h. After ultracentrifugation, the virus precipitate was collected
and resuspended with PBS, aliquoted and stored at −80 ◦ C.
For the viral titration, Sf9 cell monolayers were prepared in a 96-well culture plate
at a seeding density of 4 × 104 cells per well at 16 h ahead of viral infection. Then, the
tested stock solutions of the mixed viruses were serially diluted tenfold, ranging from
10 to 107 , in serum- and antibiotic-free SIM medium. And then the old medium in each
well was removed and 100 µL viral dilutions were added into each well. Five hours
post-infection, the old medium was replaced with normal SIM medium. At 120 h post
infection, the expression of the GUS reporter gene was detected by X-gluc staining as
described previously by Wu et al. [9]. The virus titers were calculated by the following
formula: TU/mL (transduction units per mL) = percentage of positive cell colonies × total
cell numbers seeded/volume of viral stock (mL).
In consideration of the failure of the PH promoter to drive the expression of the GUS
gene in the case of single viral vector transfection, the titration of the single virus of pUC19-
IHHNV-PH-GUS was determined by the simultaneous co-transfection and titration of the
mixed viruses of pUC19-IHHNV-PH-GUS and Bacmid. The purification, concentration
and titration of the single baculoviruses of Bacmid-GUS and Bacmid were carried out as
described previously by Wu et al. [9].

4.7. Verification of the Packaging Capacity of IHHNV-Based Expression Vector of

pUC19-IHHNV-PH-GUS into Infective Virions in Sf9 Cells
The successful packaging of the shrimp IHHNV-based expression vector of pUC19-
IHHNV-PH-GUS in Sf9 cells was verified by the three methods of reinfection, transmission
electron microscopy (TEM) and electron microscopy negative staining assay in this study.
For the reinfection assay, the viral expression plasmid of pUC19-IHHNV-PH-GUS
was transfected alone or co-transfected with Bacmid (or Bacmid-VP28) into the Sf9 cells as
described previously under the optimized transfection conditions. At 120 h post transfec-
tion, the medium supernatant was collected and clarified by centrifugation as described
Int. J. Mol. Sci. 2024, 25, 8999 19 of 22

previously and then used to reinfect the Sf9 cells cultured in serum- and antibiotic- free SIM
medium by an infection dose of 100 µL medium supernatant tested per well in a 48-well
culture plate. The next day, the old medium was replaced with normal SIM medium. At
120 h post infection, the expression of GUS gene was detected by X-gluc staining. The
successful detection of the GUS signal can verify the successful packaging of the mature
virions of pUC19-IHHNV-PH-GUS in Sf9 cells.
For the TEM and electron microscopy negative staining assay, Sf9 cells were inoculated
into a 10 cm petri dish at a density of 6 × 106 cells per dish at 16 h ahead of transfection,
and the old medium was replaced with 10 mL of diluted SIM medium containing 1.35 mL
SIM, 0.15 mL FBS and 8.5 mL Grace medium when the confluency reached 70%. Then,
the plasmids of pUC19-IHHNV-PH-GUS and Bacmid were transfected individually or co-
transfected into Sf9 cells using the transfection reagent of Cellfectin II (Gibco, Carlsbad, CA,
USA). In brief, in one tube, 15 µg pUC19-IHHNV-PH-GUS plasmid, or 15 µg Bacmid, or a
30 µg mixture of the above two plasmids, and in another tube 90 or 180 µL Cellfectin II, was
diluted in 500 µL serum- and antibiotic-free Grace medium, respectively, and incubated
at room temperature for 10 min. Then, the two tubes containing DNA or Cellfectin II
were combined accordingly, mixed and then incubated at room temperature for another
20–30 min. The transfection complex was added drop by drop into the culture dish and
then replaced to normal SIM medium at 4 h post transfection. At 120 h post transfection,
the medium supernatant was collected and clarified by centrifugation and used to reinfect
the Sf9 cells, which were freshly seeded in another 10 cm petri dish and the medium was
replaced with serum- and antibiotic- free SIM medium, with an infection dose of 400 µL
medium supernatant per dish. At 120 h post infection, the medium supernatant of the
pUC19-IHHNV-PH-GUS-transfected Sf9 cells was collected, clarified and saved at 4 ◦ C for
electron microscopy negative staining analysis by Savile Biotechnology (Shanghai, China).
Next, two mL of 2.5% glutaraldehyde was added into each dish after the medium has
been removed, and the fixed Sf9 cells were removed by a cell scraper and collected by
centrifugation. The supernatant was discarded and the cell pellet was carefully resuspended
in a new fixative solution and incubated at room temperature for another 30 min and
then stored at 4 ◦ C until the TEM assay and photographing by Saville Biotechnology
(Shanghai, China).

4.8. Analysis of Infection and GUS Expression of Aforementioned Mixed Viruses in Primarily
Cultured Shrimp Hemolymph Cells
The primarily cultured shrimp hemolymph cells in a 96-well culture plate were
infected with 100 µL viral solution per well containing 8 × 106 TU viruses of Bacmid
(negative control) or pUC19-IHHNV-PH-GUS, or 8 × 106 TU mixed viruses of pUC19-
IHHNV-PH-GUS and Bacmid, or 8 × 105 TU mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid-VP28, all diluted in 1.5 × L-15 basic medium. At 4 h post infection, the
virus-containing medium was replaced with 1.5 × L-15-based growth medium or gelatin-
containing 1 × L-15-based growth medium and cultured at 28 ◦ C for another 120 h. Then,
the expression of the GUS gene was detected by X-gluc staining and observed under
inverted phase contrast microscope (Nikon, Tokyo, Japan).

4.9. Analysis of Infection and GUS Expression of Aforementioned Mixed Viruses in the Adult
Tissues of Shrimps
For the infection and GUS expression of the mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid, firstly, the mixed virus stock solution was serially diluted by 10, 102 and
103 folds in PBS, respectively, and then injected into the second abdominal segment of
the shrimps by three different doses of 7 × 104 , 7 × 105 and 7 × 106 TU per shrimp in
an injection volume of 10 µL. The control shrimps were injected by the same volume of
PBS instead. After injection, the injection site was immediately pressed with the thumb
for several seconds to prevent the viruses and hemolymphs from flowing out. After that,
the injected shrimp was put back into the seawater and cultured for another 5 days. On
the fifth day, various adult tissues of the heart, gill, Oka organ, muscle and intestine of the
Int. J. Mol. Sci. 2024, 25, 8999 20 of 22

injected shrimp were dissected out and the expression of GUS gene was detected by X-gluc
staining, as described previously by Wu et al. [9], respectively. In detail, the tested tissue
was placed in a 1.5 mL centrifuge tube after being washed three times in 2 × PBS, and then
incubated in the X-Gluc staining solution containing 1 M sodium phosphate (pH 7.0), 0.5 M
Na2 EDTA (pH 8.0), 10% Triton X-100, 50 mM K3 Fe (CN)6 and 0.1 M 50 mg/mL X-gluc
overnight in a 28 ◦ C incubator, and then the expression of the GUS gene was detected by
the intensity of the blue color. After that, the stained tissues were further photographed
under an inverted phase contrast microscope (Nikon, Japan).
For the infection and expression of the mixed viruses of pUC19-IHHNV-PH-GUS
and Bacmid-VP28, only one infection dose of 4 × 106 TU per shrimp in the same injection
volume of 10 µL was tested and the expression of the GUS gene in the different tissues of
the infected shrimps was detected by X-gluc staining as described previously and further
confirmed by semi-quantitative RT-PCR analysis using GUS gene-specific primer pairs. For
the semi-quantitative RT-PCR analysis, first, the total RNAs of the tested adult tissues of the
hearts, gills, Oka organs, muscles and intestines of the infected and uninfected shrimps were
isolated using the TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, China) and then
reversely transcribed into cDNAs using the PrimeScript™ RT reagent Kit (TaKaRa, Beijing,
China), respectively, and used as the RT-PCR templates. Then, a 499 bp cDNA fragment of
the GUS gene was amplified using a forward primer of 5′ -GCGTTACAAGAAAGCCGGGC-
3′ and a reverse primer of 5′ -AGTCAACAGACGCGTGGTTA-3′ . RT-PCR was performed
in a 20 µL reaction volume, including 10 µL of 2× Hieff PCR Master Mix, 1 µL forward
primer (10 µM), 1 µL reverse primer (10 µM), 1 µL cDNA template and 7 µL H2 O. The
RT-PCR reaction was run for 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s and
72 ◦ C for 45 s, one cycle of 72 ◦ C for 10 min. A 438 bp shrimp (P. vannamei) β-actin fragment
was amplified using a forward primer of 5′ -CCCAGAGCAAGCGAGGTA-3′ and a reverse
primer of 5′ -CGGTGGTCGTGAAGGTGT-3′ and used as an internal reference.

Author Contributions: Conceptualization, H.G.; formal analysis, Y.T. and J.W.; funding acquisition,
H.G.; methodology, Y.T., J.W. and R.X.; project administration, H.G.; resources, Q.Z.; writing—original
draft, Y.T.; writing—review and editing, H.G. All authors have read and agreed to the published
version of the manuscript.
Funding: This research was funded by the “National Natural Science foundation of China, Grant No.
32273116”, “Natural Science foundation of Shandong Province, Grant No. ZR2020MC189” and “Key
Research & Development Program of Shandong Province, Grant No. 2023CXGC010710”.
Institutional Review Board Statement: The animal study protocol was approved by the Ethics
Committee of Ocean University of China (protocol code OUC-AE-2022-010, date of approval:
7 March 2022).
Informed Consent Statement: Not applicable.
Data Availability Statement: The original contributions presented in the study are included in the
article; further inquiries can be directed to the corresponding author.
Acknowledgments: We thank Meiling Sun (Ocean University of China) for the kind assistance with
the electron microscopy negative staining assay.
Conflicts of Interest: The authors declare no conflicts of interest.

References
1. Preston, N.P.; Baule, V.J.; Leopold, R.; Henderling, J.; Atkinson, P.W.; Whyard, S. Delivery of DNA to early embryos of the Kuruma
prawn, Penaeus japonicus. Aquaculture 2000, 181, 225–234. [CrossRef]
2. Tseng, F.S.; Tsai, H.J.; Liao, I.C.; Song, Y.L. Introducing foreign DNA into tiger shrimp (Penaeus monodon) by electroporation.
Theriogenology 2000, 54, 1421–1432. [CrossRef]
3. Yazawa, R.; Watanabe, K.; Koyama, T.; Ruangapan, L.; Tassanakajon, A.; Hirono, I.; Aoki, T. Development of gene transfer
technology for black tiger shrimp, Penaeus monodon. J. Exp. Zool. Part A Comp. Exp. Biol. 2005, 303, 1104–1109. [CrossRef]
4. Pu, L.J.; Wang, J.; Zhang, X.; Guo, H.R. Development of pseudo-typed retroviral system for effective gene transfer and expression
in penaeid shrimp cells. Aquaculture 2017, 467, 198–210. [CrossRef]
Int. J. Mol. Sci. 2024, 25, 8999 21 of 22

5. Chen, X.M.; Chen, Y.R.; Shen, X.T.; Zuo, J.W.; Guo, H.R. The improvement and application of lentivirus-mediated gene transfer
and expression system in penaeid shrimp cells. Mar. Biotechnol. 2019, 21, 9–18. [CrossRef]
6. Han, Q.; Dong, D.; Guo, H.R. Problems with the use of liposome and retrovirus-mediated gene transfer methods in the primary
lymphoid cells of the Oka organs of the greasyback shrimp, Metapenaeus ensis (De Haan, 1844). Crustaceana 2015, 88, 1351–1365.
[CrossRef]
7. Tao, Y.W.; Zhang, Q.L.; Guo, H. R Improvement and applications of adeno-associated virus 2 (AAV-2) system for efficient gene
transfer and expression in penaeid shrimp cells. Aquacult. Rep. 2023, 32, 101700. [CrossRef]
8. Shike, H.; Shimizu, C.; Klimpel, K.S.; Burns, J.C. Expression of foreign genes in primary cultured cells of the blue shrimp Penaeus
stylirostris. Mar. Biol. 2000, 137, 605–611. [CrossRef]
9. Wu, M.X.; Hu, Q.; Zhou, Y.; Guo, H.R. Development of a VP28-pseudotyped baculovirus expression system for efficient gene
transfer in penaeid shrimps. Aquaculture 2021, 541, 736–741. [CrossRef]
10. Lana, M.G.; Strauss, B.E. Production of lentivirus for the establishment of CAR-T Cells. Methods Mol. Biol. 2020, 2086, 61–67.
[CrossRef] [PubMed]
11. Santin, Y.; Parini, A.; Mialet-Perez, J. Expression and function of MAO A in cardiac cells by means of adenovirus-mediated gene
transfer. Methods Mol. Biol. 2023, 2558, 163–170. [CrossRef]
12. Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined
factors. Cell 2006, 126, 663–676. [CrossRef] [PubMed]
13. Zaman, H.; Khan, A.; Khan, K.; Toheed, S.; Abdullah, M.; Zeeshan, H.M.; Hameed, A.; Umar, M.; Shahid, M.; Malik, K.; et al.
Adeno-Associated Virus-Mediated Gene Therapy. Crit. Rev. Eukaryot. Gene Expr. 2023, 33, 87–100. [CrossRef] [PubMed]
14. Burns, J.C.; Friedmann, T.; Driever, W.; Burrascano, M.; Yee, J.K. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral
vectors: Concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad.
Sci. USA 1993, 90, 8033–8037. [CrossRef] [PubMed]
15. Puthumana, J.; Philip, R.; Bright Singh, I.S. Transgene expression in Penaeus monodon cells: Evaluation of recombinant baculoviral
vectors with shrimp specific hybrid promoters. Cytotechnology 2015, 68, 1147–1159. [CrossRef]
16. Alenton, R.R.R.; Mai, H.N.; Dhar, A.K. Engineering a replication-incompetent viral vector for the delivery of therapeutic RNA in
crustaceans. PNAS Nexus. 2023, 2, 1–9. [CrossRef]
17. Lightner, D.V.; Redman, R.M.; Bell, T.A. Infectious hypodermal and hematopoietic necrosis, a newly recognized virus disease of
penaeid shrimp. J. Invertebr. Pathol. 1983, 42, 62–70. [CrossRef]
18. Lightner, D.V.; Redman, R.M.; Bell, T.; Brock, J. Detection of IHHN virus in Penaeys stylirostris and P. vannamei imported into
Hawaii. J. World Maric. Soc. 1983, 225, 212–225. [CrossRef]
19. Cavalli, L.S.; Batista, C.R.; Nornberg, B.F.S.; Mayer, F.Q.; Seixas, F.K.; Romano, L.A.; Marins, L.F.; Abreu, P.C. Natural occurrence
of white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus in Neohelice granulata crab. J. Invertebr.
Pathol. 2013, 114, 86–88. [CrossRef]
20. Kalagayan, H.; Godin, D.; Kanna, R.; Hagino, G.; Sweeney, J.; Wyban, J.; Brock, J. IHHN virus as an etiological factor in
runt-deformity syndrome (RDS) of Juvenile Penaeus vannamei cultured in Hawaii. J. World Aquacult. Soc. 1991, 22, 235–243.
[CrossRef]
21. Motte, E.; Yugcha, E.; Luzardo, J.; Castro, F.; Leclercq, G.; Rodriguez, J.; Miranda, P.; Borja, O.; Serrano, J.; Terreros, M.; et al.
Prevention of IHHNV vertical transmission in the white shrimp Litopenaeus vannamei. Aquaculture 2003, 219, 57–70. [CrossRef]
22. Tang, K.F.J.; Poulos, J.W.; Redman, R.M.; Shih, H.H. Geographic variations among infectious hypodermal and hematopoietic
necrosis virus (IHHNV) isolates and characteristics of their infection. Dis. Aquat. Org. 2003, 53, 91–99. [CrossRef] [PubMed]
23. Yang, B.; Song, X.L.; Huang, J.; Shi, C.Y.; Liu, L. Evidence of existence of infectious hypodermal and hematopoietic necrosis virus
in penaeid shrimp cultured in China. Vet. Microbiol. 2007, 120, 63–70. [CrossRef] [PubMed]
24. Bonami, J.R.; Trumper, B.; Mari, J.; Brehelin, M.; Lightner, D.V. Purification and characterization of the infectious hypodermal and
hematopoietic necrosis virus of penaeid shrimps. J. Gen. Virol. 1990, 71, 2657–2664. [CrossRef] [PubMed]
25. Dhar, A.K.; Lakshman, D.K.; Natarajan, S.; Allnutt, F.C.T.; van Beek, N.A.M. Functional characterization of putative promoter
elements from infectious hypodermal and hematopoietic necrosis virus (IHHNV) in shrimp and in insect and fish cell lines. Virus
Res. 2007, 127, 1–8. [CrossRef] [PubMed]
26. Dhar, A.K.; Kaizer, K.N.; Lakshman, D.K. Transcriptional analysis of Penaeus stylirostris densovirus genes. Virology 2010, 402,
112–120. [CrossRef]
27. Hou, L.H.; Lin, F.Y. Construction of fluorescent virus-like particles of infectious hypodermal and hematopoietic necrosis virus. J.
Oceanogr. 2015, 34, 411–418.
28. Kiatmetha, P.; Chotwiwatthanakun, C.; Jariyapong, P.; Santimanawong, W.; Ounjai, P.; Weerachatyanukul, W. Nanocontainer
designed from an infectious hypodermal and hematopoietic necrosis virus (IHHNV) has excellent physical stability and ability to
deliver shrimp tissues. PeerJ 2018, 6, e6079. [CrossRef] [PubMed]
29. Zhu, Y.P.; Li, C.; Wan, X.Y.; Yang, Q.; Xie, G.S.; Huang, J. Delivery of plasmid DNA to shrimp hemocytes by Infectious hypodermal
and hematopoietic necrosis virus (IHHNV) nanoparticles expressed from a baculovirus insect cell system. J. Invertebr. Pathol.
2019, 166, 107231. [CrossRef] [PubMed]
30. Arunrut, N.; Phromjai, J.; Gangnonngiw, W.; Kanthong, N.; Sriurairatana, S.; Kiatpathomchai, W. In vitro cultivation of shrimp
Taura syndrome virus (TSV) in a C6/36 mosquito cell line. J. Fish Dis. 2011, 34, 805–810. [CrossRef]
Int. J. Mol. Sci. 2024, 25, 8999 22 of 22

31. Gangnonngiw, W.; Kanthong, N.; Flegel, T.W. Successful propagation of shrimp yellow head virus in immortal mosquito cells.
Dis. Aquat. Org. 2010, 90, 77–83. [CrossRef] [PubMed]
32. Madan, N.; Nambi, K.S.N.; Majeed, S.A.; Taju, G.; Raj, N.S.; Farook, M.A.; Vimal, S.; Hameed, A.S.S.H. In vitro propagation of
hepatopancreatic parvo-like virus (HPV) of shrimp in C6/36 (Aedes albopictus) cell line. J. Invertebr. Pathol. 2013, 112, 229–235.
[CrossRef] [PubMed]
33. Sriton, A.; Kanthong, N.; Gangnonngiw, W.; Sriurairatana, S.; Ubol, S.; Flegel, T. Persistent expression of shrimp-virus antigens in
two insect cell lines challenged with two shrimp viruses. Fish Pathol. 2009, 44, 86–93. [CrossRef]
34. Sudhakaran, R.; Parameswaran, V.; Hameed, A.S.S. In vitro replication of Macrobrachium rosenbergii nodavirus and extra small
virus in C6/36 mosquito cell line. J. Virol. Methods. 2007, 146, 112–118. [CrossRef] [PubMed]
35. Dominic, D.V.D.; Sajeevan, T.P.; Ameer, A.; Muneer, A.; Eldho, L.; Anoop, B.S.; Jayesh, P.; Joseph, V.; Philip, R.; Singh, I.S.B.
In vitro propagation of infectious hypodermal hematopoietic necrosis virus (Penaeus stylirostris penstyldensovirus) in PmLyO-Sf9
cells. Arch. Virol. 2023, 168, 211. [CrossRef] [PubMed]
36. Bracey, L.T.; Paigen, K. Changes in translational yield regulate tissue-specific expression of beta-glucuronidase. Proc. Natl. Acad.
Sci. USA 1987, 84, 9020–9024. [CrossRef] [PubMed]
37. Sperker, B.; Mürdter, T.E.; Backman, J.T.; Fritz, P.; Kroemer, H.K. Expression of active human beta-glucuronidase in Sf9 cells
infected with recombinant baculovirus. Life Sci. 2002, 71, 1547–1557. [CrossRef] [PubMed]
38. Knebel, D.; Lübbert, H.; Doerfler, W. The promoter of the late p10 gene in the insect nuclear polyhedrosis virus Autographa
californica: Activation by viral gene products and sensitivity to DNA methylation. EMBO J. 1985, 1301–1306. [CrossRef]
39. Lin, C.H.; Jarvis, D.L. Utility of temporally distinct baculovirus promoters for constitutive and baculovirus-inducible transgene
expression in transformed insect cells. J. Biotechnol. 2013, 165, 11–17. [CrossRef]
40. Luckow, V.A.; Summers, M.D. Signals important for high-level expression of foreign genes in Autographa californica nuclear
polyhedrosis virus expression vectors. Virology 1988, 167, 56–71. [CrossRef]
41. Yi, G.; Wang, Z.; Qi, Y.; Yao, L.; Qian, J.; Hu, L. Vp28 of shrimp white spot syndrome virus is involved in the attachment and
penetration into shrimp cells. J. Biochem. Mol. Biol. 2004, 37, 726–734. [CrossRef] [PubMed]
42. Sánchez-Paz, A. White spot syndrome virus: An overview on an emergent concern. Vet. Res. 2010, 41, 43. [CrossRef] [PubMed]
43. Han, Q.; Li, P.T.; Lu, X.B.; Guo, Z.J.; Guo, H.R. Improved primary cell culture and subculture of lymphoid organs of the greasyback
shrimp Metapenaeus ensis. Aquaculture 2013, 410-411, 101–113. [CrossRef]
44. Zhao, Y.Q.; Guo, L.W.; Guo, H.R. Routine development of long-term primary cell culture and finite cell line from the peripheral
hemolymph of greasyback shrimp (Metapenaeus ensis) and virus susceptibility. Aquaculture 2023, 563, 739007. [CrossRef]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.