Experience Seamless Full Ebook Downloads for Every Genre at textbookfull.

com

RNA Abundance Analysis : Methods and Protocols

Hailing Jin

https://textbookfull.com/product/rna-abundance-analysis-
methods-and-protocols-hailing-jin/

OR CLICK BUTTON

DOWNLOAD NOW

Explore and download more ebook at https://textbookfull.com

 Recommended digital products (PDF, EPUB, MOBI) that
you can download immediately if you are interested.

RNA Editing: Methods and Protocols Ernesto Picardi

https://textbookfull.com/product/rna-editing-methods-and-protocols-
ernesto-picardi/

textboxfull.com

RNA Remodeling Proteins: Methods and Protocols Marc

Boudvillain

https://textbookfull.com/product/rna-remodeling-proteins-methods-and-
protocols-marc-boudvillain/

textboxfull.com

The Eukaryotic RNA Exosome: Methods and Protocols John

Lacava

https://textbookfull.com/product/the-eukaryotic-rna-exosome-methods-
and-protocols-john-lacava/

textboxfull.com

RNA Imaging Methods and Protocols 1st Edition Zdravka

Medarova (Eds.)

https://textbookfull.com/product/rna-imaging-methods-and-
protocols-1st-edition-zdravka-medarova-eds/

textboxfull.com
Double Stranded RNA Methods and Protocols Xiaofei Cheng
Guanwei Wu

https://textbookfull.com/product/double-stranded-rna-methods-and-
protocols-xiaofei-cheng-guanwei-wu/

textboxfull.com

Reverse Genetics of RNA Viruses Methods and Protocols

Methods in Molecular Biology 2733 2nd Edition Daniel R.
Perez
https://textbookfull.com/product/reverse-genetics-of-rna-viruses-
methods-and-protocols-methods-in-molecular-biology-2733-2nd-edition-
daniel-r-perez/
textboxfull.com

Microbiome Analysis Methods and Protocols Robert G. Beiko

https://textbookfull.com/product/microbiome-analysis-methods-and-
protocols-robert-g-beiko/

textboxfull.com

Single Cell Analysis: Methods and Protocols Miodrag Gužvi■

https://textbookfull.com/product/single-cell-analysis-methods-and-
protocols-miodrag-guzvic/

textboxfull.com

Transcriptome Data Analysis Methods and Protocols 1st

Edition Yejun Wang

https://textbookfull.com/product/transcriptome-data-analysis-methods-
and-protocols-1st-edition-yejun-wang/

textboxfull.com
Methods in
Molecular Biology 2170

Hailing Jin
Isgouhi Kaloshian Editors

RNA
Abundance
Analysis
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-
bystep fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
 RNA Abundance Analysis

Methods and Protocols

Second Edition

Edited by

Hailing Jin
Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute
for Integrative Genome Biology, University of California, Riverside, CA, USA

Isgouhi Kaloshian
Department of Nematology, University of California, Riverside, CA, USA
Editors
Hailing Jin Isgouhi Kaloshian
Department of Plant Pathology Department of Nematology
and Microbiology, Center for Plant University of California
Cell Biology and Institute Riverside, CA, USA
for Integrative Genome Biology
University of California
Riverside, CA, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-0742-8 ISBN 978-1-0716-0743-5 (eBook)
https://doi.org/10.1007/978-1-0716-0743-5

© Springer Science+Business Media, LLC, part of Springer Nature 2021

All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of
translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical
way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or
dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface

We are pleased to have this opportunity to edit the Second Edition of RNA Abundance
Analysis. RNA abundance is one of the most important measurements for gene expression
analysis in the field of molecular biology. Continuous progress in modern technology has
empowered us to examine RNA expression more accurately and efficiently, with precision at
the cellular and subcellular levels. A new collection of the rapid advances of methodology in
RNA abundance analysis is important and timely. This book covers a wide range of techni-
ques on RNA extraction, detection, quantification, visualization, and genome-wide
profiling, from conventional methods to state-of-the-art high-throughput approaches. We
include detailed techniques to examine mRNAs, small noncoding RNAs, protein-associated
small RNAs, organelle RNAs, endosymbiont RNAs, and alternatively spliced RNA variants
from various organisms. RNA editing and the computational data processing for genome-
wide datasets are also discussed. Collectively, these methods should provide helpful guidance
to biologists in their gene expression and regulation studies.
The beginning of many RNA studies is the isolation of RNAs. We have included
methods for extracting RNAs from specific cells and tissues of plants, fungi, insect endo-
symbiont, and parasites (Chapters 3, 8, 13, and 14). Furthermore, we included detailed
protocols on isolating RNAs from specific subcellular structures, such as chloroplasts and
extracellular vesicles (Chapters 10 and 16). Isolating RNAs could be challenging if one
wishes to address a process that is limited to a few cells within a tissue or organism, or a
specific organelle or subcellular fraction of a cell. These chapters have provided excellent
tools to achieve these goals.
Once high-quality RNAs of specific cells, tissues, or subcellular structures have been
extracted, the spatial and temporal expression patterns of an individual gene or the whole
genome could be established. Therefore, Chapters 2, 5, 6, 7, 10, 11, 12, 13, and 14 present
a set of diverse technologies to examine and analyze the expression of mRNAs and small
RNAs. In particular, Chapters 2, 5, 6, 14, and 16 describe the application of high-
throughput genome-wide next-generation sequencing approaches to study RNA-related
parameters in organisms. While generating vast amounts of sequence data has become
routine and increasingly economical, the bottleneck continues to be the computational
analysis of the data. This edition therefore includes a chapter on bioinformatics methods
to analyze high-throughput RNA and small RNA expression data collected by next-
generation sequencing.
RNAs function mostly through association with various proteins; the study of
RNA-protein interaction is a key focus for understanding RNA regulation and gene expres-
sion. Chapters 4, 7, and 15 describe the methods to identify RNAs associated with specific
protein or protein complexes and to understand the gene expression regulation mediated by
RNA-protein interaction.
In this edition, we have also included innovative emerging techniques, such as CRISPR-
Cas-mediated RNA editing (Chapter 1) and titanium oxide nanofiber-mediated small RNA
extraction (Chapter 8).

v
vi Preface

Finally, we hope this new edition provides a comprehensive set of techniques and
methods on isolating and analyzing mRNAs, small RNAs, and other RNA variants, which
can assist you in your gene expression studies.

Riverside, CA, USA Hailing Jin

Isgouhi Kaloshian
Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

1 CRISPR-Cas RNA Targeting Using Transient Cas13a

Expression in Nicotiana benthamiana . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Veerendra Sharma, Wenguang Zheng, Jun Huang, and David E. Cook
2 Strand-Specific RNA-Seq Applied to Malaria Samples . . . . . . . . . . . . . . . . . . . . . . . 19
Xueqing Maggie Lu and Karine Le Roch
3 Laser Microdissection of Cells and Isolation of High-Quality
RNA After Cryosectioning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Marta Barcala, Carmen Fenoll, and Carolina Escobar
4 Detection of RNA in Ribonucleoprotein Complexes by Blue
Native Northern Blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Lena Krüßel, Steffen Ostendorp, Anna Ostendorp, and Julia Kehr
5 Quantitative Analysis of Plant miRNA Primary Transcripts . . . . . . . . . . . . . . . . . . . 53
Jakub Dolata, Andrzej Zielezinski, Agata Stepien, Katarzyna Kruszka,
Dawid Bielewicz, Andrzej Pacak, Artur Jarmolowski, Wojciech Karlowski,
and Zofia Szweykowska-Kulinska
6 A Revised Adaptation of the Smart-Seq2 Protocol for Single-Nematode
RNA-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Dennis Chang, Lorrayne Serra, Dihong Lu, Ali Mortazavi,
and Adler Dillman
7 Analysis of RBP Regulation and Co-regulation of mRNA 30 UTR
Regions in a Luciferase Reporter System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Erin L. Sternburg and Fedor V. Karginov
8 Extraction of Small RNAs by Titanium Dioxide Nanofibers . . . . . . . . . . . . . . . . . . 117
Luis A. Jimenez and Wenwan Zhong
9 Identification of MicroRNAs and Natural Antisense Transcript-Originated
Endogenous siRNAs from Small-RNA Deep Sequencing Data . . . . . . . . . . . . . . . 125
Weixiong Zhang, Xuefeng Zhou, Xiang Zhou, and Jing Xia
10 Purification and Analysis of Chloroplast RNAs in Arabidopsis . . . . . . . . . . . . . . . . 133
Huan Wang and Hailing Jin
11 In Situ Detection of Mature miRNAs in Plants Using LNA-Modified
DNA Probes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
Xiaozhen Yao, Hai Huang, and Lin Xu
12 Northern Blotting Technique for Detection and Expression
Analysis of mRNAs and Small RNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
Ankur R. Bhardwaj, Ritu Pandey, Manu Agarwal,
and Surekha Katiyar-Agarwal

vii
viii Contents

13 Isolation of Insect Bacteriocytes as a Platform for Transcriptomic

Analyses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Mélanie Ribeiro Lopes, Pierre Simonet, Gabrielle Duport,
Karen Gaget, Séverine Balmand, Akiko Sugio,
Jean-Christophe Simon, Nicolas Parisot, and Federica Calevro
14 Small RNA Isolation and Library Construction for Expression
Profiling of Small RNAs from Neurospora crassa and Fusarium
oxysporum and Analysis of Small RNAs in Fusarium
oxysporum-Infected Plant Root Tissue . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Shou-Qiang Ouyang, Gyungsoon Park, Hui-Min Ji,
and Katherine A. Borkovich
15 Studying RNA–Protein Interaction Using Riboproteomics. . . . . . . . . . . . . . . . . . . 213
Sonali Chaturvedi and A. L. N. Rao
16 Small RNA Extraction and Quantification of Isolated Fungal Cells
from Plant Tissue by the Sequential Protoplastation. . . . . . . . . . . . . . . . . . . . . . . . . 219
Qiang Cai and Hailing Jin

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231
Contributors

MANU AGARWAL • Department of Botany, University of Delhi North Campus, Delhi, India
SÉVERINE BALMAND • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
MARTA BARCALA • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de Castilla-
La Mancha, Toledo, Spain; International Research Organization for Advanced Science
and Technology (IROAST), Kumamoto University, Kumamoto, Japan
ANKUR R. BHARDWAJ • Department of Botany, Ramjas College, University of Delhi North
Campus, Delhi, India
DAWID BIELEWICZ • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
KATHERINE A. BORKOVICH • Department of Microbiology and Plant Pathology, Institute for
Integrative Genome Biology, University of California, Riverside, CA, USA
QIANG CAI • Department of Plant Pathology and Microbiology, Center for Plant Cell Biology
and Institute for Integrative Genome Biology, University of California, Riverside, CA,
USA
FEDERICA CALEVRO • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
DENNIS CHANG • Department of Nematology, University of California, Riverside, CA, USA
SONALI CHATURVEDI • Gladstone Institute of Virology and Immunology, Gladstone Institutes,
San Francisco, CA, USA
DAVID E. COOK • Department of Plant Pathology, Kansas State University, Manhattan, KS,
USA
ADLER DILLMAN • Department of Nematology, University of California, Riverside, CA,
USA
JAKUB DOLATA • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
GABRIELLE DUPORT • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
CAROLINA ESCOBAR • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de
Castilla-La Mancha, Toledo, Spain; International Research Organization for Advanced
Science and Technology (IROAST), Kumamoto University, Kumamoto, Japan
CARMEN FENOLL • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de
Castilla-La Mancha, Toledo, Spain
KAREN GAGET • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne,
France
HAI HUANG • National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant
Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of
Sciences, Shanghai, China
JUN HUANG • Department of Plant Pathology, Kansas State University, Manhattan, KS,
USA
ARTUR JARMOLOWSKI • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland

ix
x Contributors

HUI-MIN JI • College of Horticulture and Plant Protection, Yangzhou University,

Yangzhou, China
LUIS A. JIMENEZ • Program in Biomedical Sciences, University of California, Riverside, CA,
USA
HAILING JIN • Department of Plant Pathology and Microbiology, Center for Plant Cell
Biology and Institute for Integrative Genome Biology, University of California, Riverside,
CA, USA
FEDOR V. KARGINOV • Department of Molecular, Cell and Systems Biology, Institute for
Integrative Genome Biology, University of California, Riverside, CA, USA
WOJCIECH KARLOWSKI • Department of Computational Biology, Institute of Molecular
Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań,
Poznań, Poland
SUREKHA KATIYAR-AGARWAL • Department of Plant Molecular Biology, University of Delhi
South Campus, New Delhi, India
JULIA KEHR • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science
and Microbiology, Hamburg, Germany
LENA KRÜßEL • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science
and Microbiology, Hamburg, Germany
KATARZYNA KRUSZKA • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
KARINE LE ROCH • Department of Cell Biology and Neuroscience, Institute for Integrative
Genome Biology, Center for Disease Vector Research, University of California, Riverside,
CA, USA
DIHONG LU • Department of Nematology, University of California, Riverside, CA, USA
XUEQING MAGGIE LU • Department of Cell Biology and Neuroscience, Institute for
Integrative Genome Biology, Center for Disease Vector Research, University of California,
Riverside, CA, USA
ALI MORTAZAVI • Department of Developmental and Cell Biology, Center for Complex
Biological Systems, University of California, Irvine, CA, USA
ANNA OSTENDORP • Molecular Plant Genetics, Universit€ a t Hamburg, Institute of Plant
Science and Microbiology, Hamburg, Germany
STEFFEN OSTENDORP • Molecular Plant Genetics, Universit€ a t Hamburg, Institute of Plant
Science and Microbiology, Hamburg, Germany
SHOU-QIANG OUYANG • College of Horticulture and Plant Protection, Yangzhou University,
Yangzhou, China; Joint International Research Laboratory of Agriculture and Agri-
Product Safety of Ministry of Education of China and Key Laboratory of Plant Functional
Genomics of the Ministry of Education, Yangzhou University, Yangzhou, China
ANDRZEJ PACAK • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
RITU PANDEY • Department of Botany, SGTB Khalsa College, University of Delhi North
Campus, Delhi, India
NICOLAS PARISOT • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
GYUNGSOON PARK • Department of Electrical and Biological Physics, Plasma Bioscience
Research Institute, Kwangwoon University, Seoul, Republic of Korea
A. L. N. RAO • Department of Microbiology and Plant Pathology, University of California,
Riverside, CA, USA
 Contributors xi

MÉLANIE RIBEIRO LOPES • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
LORRAYNE SERRA • Department of Developmental and Cell Biology, Center for Complex
Biological Systems, University of California, Irvine, CA, USA
VEERENDRA SHARMA • Department of Plant Pathology, Kansas State University, Manhattan,
KS, USA
JEAN-CHRISTOPHE SIMON • Agrocampus Ouest, Université Rennes 1, INRAE, IGEPP, UMR
1349, BP 35327, Le Rheu, France
PIERRE SIMONET • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621,
Villeurbanne, France
AGATA STEPIEN • Department of Gene Expression, Institute of Molecular Biology and
Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
ERIN L. STERNBURG • Department of Molecular, Cell and Systems Biology, Institute for
Integrative Genome Biology, University of California, Riverside, CA, USA
AKIKO SUGIO • Agrocampus Ouest, Université Rennes 1, INRAE, IGEPP, UMR 1349, BP
35327, Le Rheu, France
ZOFIA SZWEYKOWSKA-KULINSKA • Department of Gene Expression, Institute of Molecular
Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań,
Poznań, Poland
HUAN WANG • Department of Plant Pathology and Microbiology, Center for Plant Cell
Biology and Institute for Integrative Genome Biology, University of California, Riverside,
CA, USA
JING XIA • Department of Computer Science and Engineering, Washington University, St.
Louis, MO, USA
LIN XU • National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant
Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of
Sciences, Shanghai, China
XIAOZHEN YAO • National Laboratory of Plant Molecular Genetics, Shanghai Institute of
Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy
of Sciences, Shanghai, China
WEIXIONG ZHANG • Department of Computer Science and Engineering, Fudan University,
Shanghai, China; Department of Computer Science and Engineering, Washington
University, St. Louis, MO, USA; Department of Genetics, Washington University School of
Medicine, St. Louis, MO, USA
WENGUANG ZHENG • Department of Plant Pathology, Kansas State University, Manhattan,
KS, USA
WENWAN ZHONG • Department of Chemistry, University of California, Riverside, CA, USA
XIANG ZHOU • Department of Computer Science and Engineering, Washington University,
St. Louis, MO, USA
XUEFENG ZHOU • Department of Computer Science and Engineering, Washington
University, St. Louis, MO, USA
ANDRZEJ ZIELEZINSKI • Department of Computational Biology, Institute of Molecular Biology
and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań,
Poland
 Chapter 1

CRISPR-Cas RNA Targeting Using Transient Cas13a

Expression in Nicotiana benthamiana
Veerendra Sharma, Wenguang Zheng, Jun Huang, and David E. Cook

Abstract
Application of the CRISPR-Cas prokaryotic immune system for single-stranded RNA targeting will have
significant impacts on RNA analysis and engineering. The class 2 Type VI CRISPR-Cas13 system is an
RNA-guided RNA-nuclease system capable of binding and cleaving target single-stranded RNA substrates
in a sequence-specific manner. In addition to RNA interference, the Cas13a system has application from
manipulating RNA modifications, to editing RNA sequence, to use as a nucleic acid detection tool. This
protocol uses the Cas13a ortholog from Leptotrichia buccalis for transient expression in plant cells
providing antiviral defense. We cover all the necessary information for cloning the Cas13 protein, crRNA
guide cassette, performing transient Agrobacterium-mediated expression of the necessary Cas13a compo-
nents and target RNA-virus, visualization of virus infection, and molecular quantification of viral accumu-
lation using quantitative PCR.

Key words CRISPR-Cas13, RNA targeting, mRNA interference, RNA editing, Transcriptome edit-
ing, Antiviral protection, Plant biotechnology, Plant virus

1 Introduction

Understanding gene function, through the manipulation of DNA

and subsequent experimental determination of phenotypic effects
(i.e., functional genomics) remains a grand challenge across
biological disciplines. Application of the clustered regularly inter-
spaced short palindromic repeats (CRISPR) and CRISPR asso-
ciated protein (Cas) prokaryotic immune system for eukaryotic
DNA manipulation has ushered in a new approach for functional
genomics and genome engineering [1–3]. A strength of using
CRISPR-Cas systems for genome engineering is their general
organism-agnostic function, plethora of homologs, ease of use,
and their amenability to be redesigned to carry out novel functions
[4]. The use of class 2 CRISPR-Cas systems, such as Cas9 and
Cas12, for genome editing have been applied and previously

Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology,
vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1
2 Veerendra Sharma et al.

detailed across a range of organisms and is not the focus of this

methods chapter [5, 6].
The method in this chapter focuses on the use of class 2 type VI
CRISPR-Cas systems referred to as Cas13, which target RNA as
their substrate, delivering programmable single-stranded RNA
interference [7, 8]. This approach opens new opportunities to
manipulate and study gene function by targeting transcribed
RNA. Also, while Cas13 has an inherent function as a RNA nucle-
ase, research has shown it can also be engineered to carry-out novel
functions which can aid in the study of RNA or address societal
challenges [9, 10]. At this time, the RNA-targeting Cas13 systems
have been subdivided into four families, termed Cas13a, Cas13b,
Cas13c, and Cas13d [11–13]. While the Cas13 systems described
to-date all require a crRNA and Cas13 effector protein, their
sequence, structure, and mechanistic details can vary. Conse-
quently, there is variation across the Cas13 systems for attributes
such as target RNA binding affinity, guide processing and target
RNA nuclease activity [10, 11]. There are also reports of additional
helper proteins that are not required, but modulate target RNA
degradation through various mechanisms [14, 15]. Significant
mechanistic questions remain regarding Cas13a/b/c/d function
in general and function within specific groups of organisms.
This method will focus on Cas13a from Leptotrichia buccalis
(Lbu) for transient expression in the plant Nicotiana benthamiana.
We detail the use of Cas13a for targeted reduction of Turnip Mosaic
Virus (TuMV), a single-stranded RNA virus of the largest plant
infecting family, Poytviridae [16, 17]. Plant infecting viruses cause
significant economic losses annually and threaten global food secu-
rity. The method described here provides the plant with a new
antiviral immune response, which has significant implications for
improving crop production through biotechnology. More gener-
ally, the approach can be modified to study any cellular single-
stranded RNA for a variety of experiments in planta.

2 Materials

2.1 Synthetic DNA 1. pGWB413 gateway cloning vector (Addgene plasmid ID:
and Vectors 74807).
2. Leptotrichia buccalis Cas13a DNA fragment including pro-
moter and terminator (Integrated DNA Technologies)
(Table 1 for sequence, see Notes 1–3).
3. NEBuilder HiFi DNA Assembly Master Mix (New England
Biolabs).
4. pENTR/D-TOPO vector and cloning kit (Invitrogen).
 Cas13a RNA-Targeting in Plants 3

Table 1
Synthetic Cas13a cassette

Sequence (50 ! 30 )
Sequence overlapping pGWB413, 50 of Gtacaaagtggttgataacagcgggttaat
CaMV 35S promoter
Lbu (Leptotrichia buccalis) Cas13a coding NCBI protein accession number WP_015770004, codon
sequence optimized on IDT website
HSP terminator TATGAAGATGAAGATGAAATATTTGGTGTGTCAAA
TA
AAAAGCTAGCTTGTGTGCTTAAGTTTGTG
TTTTTTTCT
TGGCTTGTTGTGTTATGAATTTGTGGCTTTTTC
TAATA
TTAAATGAATGTAAGATCTCATTATAATGAA
TAAACA
AATGTTTCTATAATCCATTGTGAATGTTTTGTTGGA
TC
TCTTCGCATATAACTACTGTATGTGCTATGGTA
TGGAC
TATGGAATATGATTAAAGATAAG
Sequence overlapping pGWB413, 30 of Ggcccgatcatattgtcgctcaggatcgtg
HSP terminator

Table 2
Empty crRNA cassette and target mRNA guide oligos
Name of oligos Sequence of oligos (5’ 3’) Note
crRNA adaptor CACCtctagatGGAGTGATCAAAAGTCCCACATCGATCAGGTG U6 promoter italic,
ATATATAGCAGCTTAGTTTATATAATGATAGAGTCGACATAG Direct repeat
CGATTgGATTTAGACCACCCCAAAAATGAAGGGGACTAAAA shaded grey, BsaI
CAaGAGACCcagctGGTCTCgTTTTTTagcccggg sites bold
HCPro guide-F AACACTGGGAAATCTTGTTGCGAAAGGACTTC
HCPro guide-R AAAAGAAGTCCTTTCGCAACAAGATTTCCCAG

5. crRNA cloning adaptor (Integrated DNA Technologies)

(Table 2 for sequence).
6. TuMV HCPro guide RNA oligos (Integrated DNA Technol-
ogies) (Table 3 for sequence).
7. 2
Annealing buffer: 20 mM Tris, 2 mM EDTA, 100 mM
NaCl, pH 8.0.
8. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0.
9. Gateway LR Clonase (Invitrogen).
10. Agarose (VWR).
11. Gel fragment extraction kit (Promega).
4 Veerendra Sharma et al.

Table 3
Oligos used to screen vectors for positive colonies and to perform qPCR

Name of Oligo Sequence of oligos (50 ! 30 ) Purpose

Cas13a-F GCGAGGGTCGATTAGTGAAAT Colony screening
Cas13a-R CCAGGATGTCCGTTTCTGAATA Colony screening
U6-F GGAGTGATCAAAAGTCCCACATCG Colony screening
BsaI-R AAACGAGACCAGAACTAAGGGT Colony screening
35S-R TACGTCAGTGGAGATATCACATCA Colony screening
TuMV_P1-F TAGAGCGCAGCAACCAATTA TuMV qPCR
TuMV_P1-R CGAACCTCTTCTGCTTCGATTA TuMV qPCR
EF1a-F AGCTTTACCTCCCAAGTCATC EF1a qPCR
EF1a-R AGAACGCCTGTCAATCTTGG EF1a qPCR

12. One Shot™ ccdB Survival™ 2 T1R Competent Cells (Thermo

Fisher).
13. T4 DNA ligase (New England Biolabs).
14. PacI, PspOMI, KpnI, BsaI restriction enzymes (New England
Biolabs).
15. Hotplate and water bath.
16. DNA oligos used for PCR identification during cloning
(Integrated DNA Technologies) (Table 3 for sequence).
17. Luria Bertani (LB) medium: for LB broth, 0.5% yeast extract,
1% tryptone, 1% NaCl in deionized water. For LB agar, add
1.5% agar in LB broth. Autoclave at 121  C for 20 min to
sterilize.

2.2 Agrobacterium- 1. Seeds of Nicotiana benthamiana plants.

Mediated Transient 2. Agrobacterium tumefaciens strain GV3101.
Transformation
3. Turnip Mosaic Virus, TuMV infectious clone pCBTuMV-GFP
(GenBank EF028235.1, [18]).
4. Infiltration buffer: 10 mM MgCl2, 10 mM MES buffer, pH 5.7
and 100 μM acetosyringone (prepared in DMSO).
5. 1.0 mL needleless syringes.
6. Spectrophotometer.
7. 50 mL conical tubes with screw top.
8. Table top centrifuge with rotor for 50 mL conical tubes.
9. Temperature controlled laboratory shaker.
 Cas13a RNA-Targeting in Plants 5

2.3 Visualizing Virus 1. Hand held high-intensity UltraViolet lamp (Analytik Jena).
Infection 2. Nikon DSLR camera with stand.
3. Black cloth.

2.4 qPCR for Virus 1. TRIzol (Invitrogen).

Quantification 2. Liquid Nitrogen.
3. Chloroform (Sigma-Aldrich).
4. Isopropanol (Fisher).
5. Ethanol.
6. Reinforced 2 mL tubes with screw tops.
7. 2.3 mm Zirconia/Silica beads (BioSpec).
8. Bead Ruptor Elite (Omni International).
9. NanoDrop ND1000 (Thermo Fisher).
10. Turbo DNA-free kit (Ambion).
11. 10 mM dNTP mix (New England Biolabs).
12. SuperScript II reverse transcriptase (Thermo Fisher).
13. RNaseOUT inhibitor (Thermo Fisher).
14. Random hexamer (Thermo Fisher).
15. 0.2 and 0.5 mL PCR tubes.
16. Thermocycler (MJ Research).
17. SYBR Select Master Mix for CFX (Applied Biosystems).
18. 96-well microplate.
19. Microplate sealing tape.
20. Centrifuge with rotor for 96-well plate.
21. CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

3 Methods

3.1 Cas13a 1. Synthesize the coding sequence for Cas13a from Leptotrichia
Expression Vector buccalis (Lbu) following NCBI protein accession number
WP_015770004.1 (see Notes 1–3).
2. Linearize pGWB413 vector by double digestion with PacI and
PspOMI restriction enzymes (NEB) in a 20 μL reaction. To set
up the reaction, add 2 μL of 10
CutSmart buffer (NEB), 5 U
of PacI, 5 U of PspOMI, 800 ng of pGWB413 DNA, and use
deionized water to make final volume of 20 μL. Incubate the
reaction at 37  C for 2 h.
3. Run the digested products on 1% agarose gel, cut the agarose
gel containing the vector fragment of about 10 kb and use a gel
fragment extraction kit to purify the vector DNA.
6 Veerendra Sharma et al.

4. Combine the synthesized DNA fragments and linearized vec-

tor using NEBuilder HiFi DNA Assembly Master Mix. To
prepare the assembly reaction system, add 0.1 pmol of linear-
ized vector, 0.2 pmol of gene fragments, 10 μL of NEB HiFi
DNA Assembly Master Mix, and deionized water to bring the
final volume to 20 μL. Incubate the reaction at 50  C in a
thermocycler for 60 min (Fig. 1a).
5. Take 10 μL of the assembly reaction, add to 50 μL of chemically
competent E. coli ccdB survival cells. Incubate the reaction on
ice for 30 min, heat shock at 42  C in a water bath for 90 s, and
then cool promptly on ice. After 2 min on ice, add 250 μL of
LB broth, incubate the cells at 37  C for 60 min with shaking at
200 rpm, and then coat the cells on LB agar plate with 75 μg/
mL spectinomycin and 50 μg/mL chloramphenicol. Incubate
the plate overnight in 37  C incubator for the transformed cells
to form single colonies.
6. Inoculate single colony to 5 mL of LB broth in a culture tube,
shake the culture tube at 37  C for about 16 h. Select the
positive colonies by PCR using primer set Cas13a-F and
Cas13a-R and 1 μL of cell culture as template. The expected
size of the amplicon is 255 bp (see Note 4).
7. Miniprep the plasmid DNA from the putative positive colonies,
then perform enzyme digestion of the construct with KpnI and
PspOMI at 37  C for 2 h. Run the digestion products on 1%
agarose gel. The expected release from the construct is about
2150 bp (see Note 4). After verification, the pGWB413 vector
harboring Lbu-Cas13a expression cassette will be used as des-
tination vector for gateway cloning of crRNA.

3.2 Guide crRNA 1. Synthesize the empty crRNA cassette for Lbu-Cas13a (see
Cloning Notes 5 and 6).
2. Clone the synthesized empty crRNA cassette into pENTR/D-
TOPO. Add 4 μL of crRNA adaptor DNA (about 100 ng),
1 μL of pENTR/D-TOPO vector, 1 μL of salt solution (avail-
able from the kit), incubate at room temperature for 30 min
(Fig. 1b).
3. Clone into chemically competent E. coli following procedure
described in Subheading 3.1, step 5. The selection antibiotic is
50 μg/mL kanamycin.
4. Screen E. coli colonies for the presence of the insert using PCR
with the primer pair U6-F and BsaI-R. Positive colonies will
yield a band of 143 bp.
5. Digest the positive pENTR/D-TOPO vector carrying the
empty crRNA cassette using BsaI restriction enzyme at 37  C
for 2 h. Run the digestion products on 1% agarose gel and clean
 Cas13a RNA-Targeting in Plants 7

a 13 att R
2
e att R
s 3 2
s1
Ca

att

Ca

att
R1

R1
pGWB413
RB
Gibson
RB f
crR
LB 3
Assembly LB s1 N

A
Ca
b set
te id
e ide att L
as
att L2 att L
2 gu 2
gu

+
c

RB

A
crRNA

crRN
pENTR
LB

L1
att L1

L1

att
att

Directional Gateway
Golden Gate
TOPO cloning Cloning
Cloning

c d
1 CACCtctagatggagTGATCAAAAGTCCCACATC 30
HCPro guide F
U6 Promoter AACACTGGGAAATCTTGTTGCGAAAGGACTTC
Topo-D

HCPro guide R
31 G ATC AG G TG ATATATAG C AG C T TAG T T TAT 60 AAAAGAAGTCCTTTCGCAACAAGATTTCCCAG
A. thaliana U6 polymerase III promoter
Boil sample
61 ATAATGATAGAGTCGACATAGCGAT TgGAT 90 Cool to RT
U6 Promoter DR
Annealed HCPro-crRNA ready to clone
91 TTAGACCACCCCAAAAATGAAGGGGACTAA 120 into BsaI digested crRNA cassette
Lbu crRNA direct repeat AACACTGGGAAATCTTGTTGCGAAAGGACT T C
GACCCTT TAGAACAACGCT T T CCTGAAGAAAA
BsaI BsaI
121 A AC A a G AG ACC c t t a g t t c t G G TC TC gT T T 150
DR DNA removed
guide crRNA target cloning site

151 T T Tagcccggg 161

Fig. 1 Schematic overview of Cas13a and associated crRNA cloning. (a) Plant codon optimized Lbu-Cas13a
containing additional 30 bp overlapping DNA sequences was assembled with linearized pGWB413 by Gibson
Assembly. (b) Synthesized crRNA cassette was inserted pENTR/D-TOPO vector by directional TOPO cloning.
The Golden Gate cloning method was used for cloning the guide sequences into the pENTR/D-TOPO vector
containing Empty-crRNA. (c) Sequence details for the empty Lbu-crRNA cassette are shown with annotation.
The 50 end contains the sequence CACC (highlighted with a black to white gradient bar) to ensure directional
TOPO cloning. The RNA polymerase III U6 promoter (indicated by a solid black bar beneath the sequence) is
used to direct transcription of the crRNA. A guanine (g) nucleotide is added between the end of the U6
promoter and start of the Lbu-Cas13a crRNA direct repeat (DR) based on observations of a (g) requirement for
PolIII promoters. Two BsaI sites (sequence shaded in green) after the Lbu-Cas13a direct repeat are used for
cloning the guide target sequence into the empty-crRNA. The DNA region highlighted in grey is removed during
8 Veerendra Sharma et al.

up the linearized vector DNA from gel using gel fragment

extraction kit.
6. Synthesize the oligos HCPro guide-F and HCPro guide-R
needed for target mRNA binding (see Notes 7 and 8).
7. Anneal oligos obtained from step 6 in 1
annealing buffer
with final concentration of 1 μM by boiling for 5 min and
gradually cooling down to room temperature in 400 mL of
water on a hotplate (Fig. 1d; see Note 9).
8. Ligate the annealed HCPro guide into the BsaI-digested empty
crRNA cassette with T4 DNA ligase (NEB) at room tempera-
ture for 30 min, and transform the ligated products into chem-
ically competent E. coli cells as described in Subheading 3.1,
step 5.
9. Select positive colonies using PCR with the primers of U6-F
and HCPro guide-R. Positive colonies are expected to generate
a DNA band of size 149 bp. Isolate plasmid from PCR positive
colonies containing crRNA + guide in pENTR/D-TOPO
vector.
10. Clone the crRNA cassette contained in the pENTR/D-TOPO
vector to the destination vector pGWB413 harboring
Lbu-Cas13a by gateway LR reaction (Fig. 1). In a reaction
tube, add 1 μL of pENTR plasmid DNA (about 150 ng),
1 μL of pGWB413 vector DNA (about 150 ng), 5 μL of TE
buffer, 2 μL of 5
LR reaction buffer, and 1 μL of LR Clonase
enzyme mix. Incubate the reaction at 25  C for 1 h in water
bath, and then add 1 μL of proteinase K and incubate at 37  C
for 10 min in water bath (see Note 10).
11. Transform 2 μL of the gateway reaction product into 50 μL of
chemically competent E. coli cells and incubate the coated LB
agar plate at 37  C overnight allowing the formation of single
colonies. Use 75 μg/mL spectinomycin for selection.
12. Identify positive single colonies by PCR using primers U6-F
and 35S-R. Positive colonies containing both Lbu-Cas13 and
the crRNA + guide will produce a PCR DNA band of about
500 bp. Miniprep the plasmid DNA from positive colony. The
resulting construct carries both Lbu-Cas13a and HCPro-
crRNA (Fig. 1f).
ä

Fig. 1 (continued) this cloning step and replaced by the target-specific guide sequence. A series of thymine
nucleotides serve as a transcriptional termination sequence for PolIII (highlighted in red) (d) Representation of
target guide oligo annealing. The two single-stranded DNA oligos are combined and heated in a water bath
and then cooled to room temperature. Following annealing, the 50 end contains an AACA overhang, while the
30 contains an AAAA overhang to produce compatible sticky ends with BsaI digested Empty-guide. (e) Gateway
LR reaction takes place between attL1and attL2 sites in HCPro-crRNA cassette and attR1 and attR2 sites in
pGWB413 destination vector containing Lbu-Cas13a. (f) Final vector following gateway LR reaction, containing
the HCPro-crRNA cassette and Lbu-Cas13a
 Cas13a RNA-Targeting in Plants 9

3.3 Agrobacterium- 1. Transform the confirmed vector from Subheading 3.2, step
Mediated Transient 12, containing Lbu-Cas13a and HCPro-crRNA, into compe-
Expression of Cas13a tent cells of A. tumefaciens strain GV3101. Transform by add-
and TuMV-GFP ing 2.0 μL of plasmid DNA to thawed A. tumefaciens cells and
in N. benthamiana mix gently by tapping.
2. Incubate cells on ice for another 20 min, then transfer the tubes
to liquid nitrogen for 1 min (see Note 11).
3. Transfer the tube(s) to 37  C and allow to thaw. Move thawed
cells to ice and incubate for 5 min.
4. Add 0.5 mL of LB broth to each tube and incubate at 28  C,
220 rpm for 2–3 h.
5. Spin tubes at 6000 rpm (3,500
g) for 5 min to pellet cells and
discard LB broth, leaving 100 μL in the tube. Suspend the cells
in the remaining LB broth and spread the cells with the help of
spreader on LB-agar medium plate containing selection. For
Lbu-Cas13a vectors: 75 μg/mL spectinomycin, 30 μg/mL
rifampicin, 30 μg/mL gentamycin; TuMV-GFP vector:
50 μg/mL kanamycin, 30 μg/mL rifampicin, 30 μg/mL
gentamycin.
6. Incubate the plates at 28  C in incubator for 48 h, at which
time single colonies should be present and visible (see Note
12).
7. In 50 mL tubes, inoculate a single colony of A. tumefaciens
containing Lbu-Cas13a + HCPro-crRNA in one tube and
another with Lbu-Cas13a + Empty-crRNA in 10 mL of LB
broth with selective antibiotics as indicated in Subheading 3.3,
step 5. Incubate overnight in a shaker at 28  C and 220 rpm
(Fig. 2, step 1).
8. Measure the optical density of the A. tumefaciens cultures using
the 600 nm setting of a spectrophotometer. Let grow until the
OD600 is 0.8–1.2.
9. Spin down A. tumefaciens cultures at 4  C and 4000 rpm
(~1,800
g) for 15 min, discard the supernatant and put
tubes upside down on paper towels to drain the remaining
LB broth.
10. Re-suspend the A. tumefaciens cells in infiltration buffer,
adjusting the optical density (OD600) of bacterial cells to 1.0
(see Note 13). Incubate at room temperature for 2–3 h.
11. Cover the surface of a large laboratory tray with 2–4 sheets of
newspaper and perform Agro-infiltration inside the large tray
to contain the A. tumefaciens.
12. Using a 1.0 mL needleless syringe, infiltrate the A. tumefaciens
suspension into the abaxial side of N. benthamiana leaves.
Inject the A. tumefaciens suspension into the leaf surface
10 Veerendra Sharma et al.

1) Grow A. tumefaciens for 20 h

28oC
220 rpm

2) Infiltrate abaxial side of leaf with separate A. tumefaciens

strains carrying different vectors

Wait 72 h

3) Visualize viral infection and collect samples for molecular

analysis of viral accumulation

Image GFP Collect Samples

Fig. 2 General workflow for Agrobacterium-mediated expression of Cas13a and

TuMV-GFP in N. benthamiana. (Step 1) requires A. tumefaciens be grown to the
appropriate cell density to optimize virulence and transfer of vector DNA. (Step 2)
involves the delivery of the A. tumefaciens into the plant leaf using a syringe and
physical force. The syringe is held firmly against the abaxial side of the leaf, and
using gently pressure, the A. tumefaciens is infiltrated into the intercellular
compartments of the leaf. A dark, water soaked ring will be visible present
corresponding to the region in which A. tumefaciens was successfully infiltrated.
This region should be marked with a marker as it will not be visible during
subsequent steps. For this protocol, A. tumefaciens strains carrying the
Lbu-Cas13a vectors are infiltrated 48 h prior to infiltration of A. tumefaciens
strains carrying TuMV-GFP. The two components are then allowed to
accumulate for an additional 72 h before proceeding. In (Step 3), virus
accumulation is approximated using a high-intensity UV lamp, which allows
visualization of GFP, which is a surrogate for virus accumulation. Following
visualization, the infiltrated tissue is collected for further analysis

while applying the counter pressure from the other side (see
Notes 14 and 15). After agroinfiltration, mark the boundary
of the infiltrated area with a permanent marker (see Note 16)
(Fig. 2, step 2).
 Cas13a RNA-Targeting in Plants 11

13. 48 h after infiltration of a Lbu-Cas13a vector, follow Subhead-

ing 3.3, steps 7–13 to infiltrate A. tumefaciens containing
TuMV-GFP. A. tumefaciens carrying TuMV-GFP should be
delivered at an OD600 of 0.3 (see Note 13).

3.4 Visualizing Virus To assess the effect of Lbu-Cas13a and crRNA expression on
Infection TuMV-GFP infection, the agroinfiltrated leaves are visualized
using a hand-held UV lamp (see Note 17). Keep the plant in dark
and illuminate the infiltrated leaf with UV light and capture the
GFP fluorescence with a digital camera.
1. Hang a dark cloth along a wall or bench.
2. Position the plant so that the abaxial side of the infiltrated leaf
can be photographed.
3. Uniformly illuminate the infiltrated leaf with the UV light. As
TuMV is expressing GFP, bright green fluorescence can be seen
with the naked eye in the areas expressing TuMV-GFP. The rest
of the leaf will be red to purple due to chloroplast auto-
fluorescence (Fig. 3a). The infiltrated area expressing Lbu--
Cas13a + HCPro-crRNA should have significantly less GFP
fluorescence than the area infiltrated the Lbu--
Cas13a + Empty-crRNA vector (Fig. 3a, b).

a b
Leaf One
1.00
TuMV quantification normalized to

0.75
1 2
host EF1a expression

0.50
Leaf Two

0.25

1 2
0.00
1: Lbu-Cas13a + Empty-crRNA Lbu-Cas13a + Lbu-Cas13a +
2: Lbu-Cas13a + HCPro-crRNA Empty-crRNA HCPro-crRNA

Fig. 3 TuMV accumulation is significantly reduced in the presence of Cas13a with a crRNA targeting the virus.
(a) Photographs of N. benthamiana leaves visualized under UV light. Leaf One and Leaf Two are replicates
showing the effect of targeting the TuMV-GFP virus with Lbu-Cas13a. The regions of agroinfiltration are
outlined by a white dashed line. The two regions labeled with a 1 were infiltrated with the Lbu-Cas13a vector
carrying an Empty-crRNA, while the regions marked with a 2 were infiltrated with the Lbu-Cas13a vector
carrying the HCPro-crRNA targeting the TuMV genome. Both samples expressing the TuMV-targeting crRNA
show less GFP fluorescence, indicating less virus accumulates in the samples. (b) Quantitative assessment of
TuMV accumulation from leaf samples expressing Lbu-Cas13a and either the Empty-crRNA or the HCPro-
crRNA targeting TuMV. The expression values were normalized to N. benthamiana EF1a and TuMV levels in the
Empty-crRNA sample was set to 1
12 Veerendra Sharma et al.

3.5 qPCR for Virus 1. Collect leaf tissue corresponding to the area where
Quantification A. tumefaciens was infiltrated. The area marked at the time of
infiltration serves as a guide. Add the tissue to a 2.0 mL screw
top tube containing 4–6 2.3 mm beads. Immediately flash-
freeze the samples in liquid nitrogen (see Note 18). Samples
can be stored at 80  C until ready to extract RNA.
2. Remove the samples from liquid nitrogen and place in a
chilled holder. Quickly unscrew the tops and add 1 mL of
TRIzol to the frozen sample. Secure the cap back on the tube
(see Note 19).
3. Place samples in the Bead Ruptor Elite, secure the lid and run
the machine at speed 5, for 2 cycles of 30 s. Immerse the
samples in liquid nitrogen between grinding cycles to ensure
they remain frozen.
4. Spin tubes at 12,000
g for 10 min at 4  C to remove beads
and tissue debris. Transfer supernatant to new 2.0 mL tubes.
5. Add 0.2 mL chloroform for each 1.0 mL of TRIzol added and
mix vigorously for 15 s. Incubate samples for 5 min at RT (see
Note 20).
6. Spin tubes at 12,000
g for 15 min at 4  C and carefully
transfer the upper layer to a new tube (see Note 21).
7. Add 0.5 mL isopropanol to tubes, mix well and incubate at RT
for 10 min. Spin tubes at 12,000
g for 30 min at 4  C.
8. Discard supernatant and wash the pellet with 75% ethanol. Spin
at 12,000
g for 10 min and discard the supernatant. Remove
remaining ethanol with the help of pipetting and dry the pellet
at room temperature for 5–10 min.
9. Add 70 μL of RNase free water to the samples and incubate at
55–60  C for 10 min to dissolve the pellet.
10. Quantify RNA samples using NanoDrop ND1000. Addition-
ally, check the integrity of the RNA samples by separating
1.0 μg of RNA on a 1.2% agarose gel (see Note 22). Store
samples at 80  C until further analysis.
11. Use 1.0 μg of total RNA and treat with 1.0 μL Turbo DNase in
1
Turbo DNase buffer in 10 μL final volume and incubate at
37  C for 30 min.
12. Add 2.0 μL of DNase inactivation reagent and incubate at
room temperature for 5 min with occasional mixing.
13. Spin tubes at 10,000
g for 5 min. Carefully transfer the
supernatant ~10 μL to new tubes without disturbing inactiva-
tion beads.
14. Add 1.0 μL of random hexamers (200 ng/μL) to DNase
treated RNA, mix well by pipetting and incubate at 65  C for
5 min, immediately place samples on ice.
 Cas13a RNA-Targeting in Plants 13

15. Add 1.0 μL of 10 mM dNTPs, 4.0 μL of 5
First-Strand

Buffer, 1.0 μL of RNaseOUT (40 U/μL), 2.0 μL of 0.1 M
DTT mix well and incubate at room temperature for 2 min.
Add 1.0 μL of SuperScript II Reverse transcriptase, mix well by
pipetting and spin briefly.
16. Incubate samples at room temperature for 10 min and then
incubate at 42  C for 50 min, followed by incubation at 70  C
for 15 min to inactivate SuperScript II reverse transcriptase.
Chill samples on ice and proceed to qPCR analysis. Alterna-
tively, cDNA can be store at 20  C for weeks or 80  C for
months.
17. Dilute an aliquot of cDNA three times with nuclease free water
for qPCR analysis.
18. For qPCR analysis using three biological replicates and two
qPCR technical replicates for each sample primer pair, calculate
the number of reactions using following equation:
Total number of treatments
3biological replicates
2technical replicates
Total number of reactions ¼
number of reactions for a primer pair
number of primer pairs

19. Prepare the master mix for the total number of calculated
reactions. A separate master mix is prepared for each primer
pair (i.e., target gene and reference gene). Add and mix all the
components except for cDNA as detailed in Table 4 (see Note
23).
20. Aliquot 38 μL of master mix in separate tubes for each cDNA
sample and add 2.0 μL of cDNA template to the corresponding
tubes, mix several times by pipetting, briefly spin and pipette
20 μL of each reaction mixture into two wells of microplate,
which corresponds to two technical replicates. Complete the
plate setup for all the samples (see Note 24).
21. Cover the microplate with microplate sealing tape and spin the
plate briefly to ensure samples are at the bottom of the wells.

Table 4
Components for qPCR Master Mix

Components Volume (μL)

qPCR master mix (2
) 10.0
cDNA 1.0
Forward primer (10 μM) 1.0
Reverse primer (10 μM) 1.0
Nuclease-free water 7.0
Final volume 20.0
14 Veerendra Sharma et al.

Table 5
Three step amplification program for thermocycler during qPCR

Number Steps Temperature Duration


1 Initial incubation 50 C 2 min
2 Enzyme activation 95  C 2 min
3 Denaturation 95  C 15 s
4 Annealing 52  C 15 s (39 cyclesa)
5 Extension 72  C 45 s
a
At the end of each cycle, set the thermocycler camera to capture the fluorescent signal
for each well

22. Insert the covered plate containing the reaction mixtures into
the thermocycler and perform qPCR using the cycling condi-
tions specified in Table 5 (see Note 24).

4 Notes

1. The coding sequence for Lbu-Cas13a was optimized on IDT

website using Codon Optimization Tool (www.idtdna.com/
CodonOpt) to be expressed in plant system.
2. CaMV 35S promoter was used to drive the Lbu-Cas13a gene
expression with HSP18 terminator downstream of the coding
sequence. The choice of promoter for Cas13a should be con-
sidered depending on the users system and desired expression
pattern.
3. The synthesized DNA fragment including CaMV 35S pro-
moter, optimized coding sequence for Lbu-Cas13a and
HSP18 terminator should additionally contain 30 base pairs
of DNA sequence overlapping with the linearized pGWB413
vector.
4. The use of primers Cas13a-F and Cas13a-R and digestion by
KpnI and PspOMI is based on the Lbu-Cas13a sequence used
here. Different coding sequences require appropriate primer
design and restriction enzymes.
5. crRNA adaptor includes U6 promoter, direct repeat specific to
Lbu-Cas13a protein, BsaI cloning sites for insertion of guide/
spacer complementary to the gene targeting site, and TTTTT
downstream of the cloning sites as transcription termination
signal (Fig. 1c). For different Cas13a proteins, the direct repeat
needs to be changed accordingly.
6. BsaI is one of many type IIS restriction enzymes, commonly
used in Golden Gate cloning. Other type IIS restriction
 Cas13a RNA-Targeting in Plants 15

enzymes, such as BaeI could be used but needs to be designed

with the entire cloning process in mind to achieve compatibility
between vectors.
7. For guide RNA, the length of spacer sequence and the target-
ing site of choice need to be optimized regarding specific
Cas13a and the target gene. The PFS (protospacer flanking
sequence) of the targeting site might be a consideration during
the guide RNA designing based on the functional property of
Cas13a [7, 14]. In this method, we used 28 bp region of
HCPro with flanking T downstream of the targeting site. To
synthesize the guide RNA, the top strand of the guide RNA
needs to be reverse complementary to the targeting site.
8. We have observed significant target mRNA reduction com-
pared to empty guide control when expressing some guide
crRNA in the absence of Cas13. That is, some guide crRNA
have been observed to produce Cas13-independent target
mRNA interference. Care should be taken to include a negative
control agroinfiltration expressing the guide crRNA without
Cas13.
9. Larger volume of water in a beaker for boiling is acceptable.
After boiling for 5 min, turn off the hotplate and leave the
beaker on the hotplate. Let the water cool gradually to room
temperature for 3 h or overnight. Alternatively, oligo annealing
can also be performed on a thermocycler with 95  C for 5 min
and then ramp down to 25  C with rate of 0.1  C/s.
10. This method uses gateway LR Clonase enzyme mix to perform
the LR recombination reaction. If gateway LR Clonase II is
used, skip the 5
reaction buffer as it is included in the LR
Clonase II enzyme mix.
11. Do not touch or handle liquid nitrogen with your bare hand, it
can burn your skin. Use forceps or protect your hands with
thick gloves.
12. If you already have a glycerol stock of the desired
A. tumefaciens, prepare a fresh streak. It is important to use
A. tumefaciens from plates that are not older than 7 days. Older
plates should be discarded and fresh A. tumefaciens should be
re-streaked. This is necessary to maintain efficient plant infec-
tion and delivery of the transgene.
13. A. tumefaciens cultures should be grown to the log phase,
which can be approximated to occur around OD600 of
0.8–1.2. Overgrown cells lose competency to deliver the gene
of interest. In case of A. tumefaciens strain GV3101, 20 h of
growth is optimal. To analyze the effect of Lbu-Cas13a
mediated silencing of TuMV-GFP, the OD600 ratio of effec-
tor:target is 1.0:0.3. We have observed that infiltrating
Lbu-Cas13a constructs before infiltrating TuMV-GFP
16 Veerendra Sharma et al.

significantly increases Cas13a-mediated reduction of TuMV-

GFP. Additionally, the ratio of effector (Lbu-Cas13a and
crRNA) and target (TuMV-GFP) impacts the amount of target
mRNA reduction observed. These details should be considered
depending on the experiment.
14. During agroinfiltration, care should be taken to avoid damag-
ing the leaves. It is common to have dead plant cells at the site
where the syringe contacts the leaves, but too much damage
can compromise the infiltration.
15. To avoid cross contamination between A. tumefaciens strains
carrying different vectors during infiltration, it is important to
disinfect one’s gloves with 70% ethanol or change gloves before
handling different constructs.
16. It is important to mark the boundary of agro-infiltrated area
during the infiltration of Lbu-Cas13a constructs. For the sec-
ond infiltration with TuMV-GFP, try to overlap the infiltrated
area as much as possible. Virus infiltration that extends beyond
the region of Lbu-Cas13a infiltration will not have virus reduc-
tion. Care should be taken to mark these areas to aid in later
tissue collection.
17. High-intensity UV light is hazardous to unprotected eyes.
Always wear protective glasses while working with a UV light
source. Capturing images of GFP fluorescence in a low light
setting requires longer exposure times with the camera set-
tings. Take care to equally shine the UV lamp across the leaf
surface.
18. To obtain high quality intact RNA from leaf tissues, it is
important to avoid excessive handling and damage to the tissue
during sample collection. Collected leaf tissue should be imme-
diately frozen in liquid nitrogen. During the grinding process,
the tissue should be kept frozen to avoid RNA degradation.
19. This is considered “wet” grinding, in which the samples are
ground in the presence of TRIzol. It is also possible to perform
“dry” pulverization depending on the researchers needs and
equipment. The critical point is to not let the samples thaw
during grinding. Additionally, the bead beater can be placed in
a cold room to minimize sample-heating and samples can be
placed back into liquid nitrogen between rounds of bead
beating.
20. TRIzol and chloroform are hazardous chemicals. Always work
in a fume hood while handling TRIzol and chloroform and
follow proper hazardous chemical disposal.
21. While transferring the upper phase containing RNA to new
tubes it is important to avoid the interphase which contains
unwanted molecules and chloroform.
 Cas13a RNA-Targeting in Plants 17

22. A 260/280 ratio of 2.0 is an indicator of good quality RNA.

The integrity of RNA samples should be checked on agarose
gel before proceeding for cDNA synthesis. On a 1.5% agarose
gel, the two bands corresponding to the largest size should be
sharp and bright. These correspond to intact 28S and 18S
ribosomal RNA. Additional bands can also be seen, but they
should not be smeared. Smeared bands or weak 28S and 18S
bands indicates the samples have undergone RNA degradation.
23. To account for pipetting error during qPCR, it is advisable to
prepare master mix with two additional reactions added. Care
should be taken to minimize pipetting variation and mixing
variation. It is advisable to always mix the components the same
number of times (i.e., 10) and to pipette using the same
stopping point (i.e., the first stopping point, do not push
pipette plunger all the way down). qPCR is sensitive to changes
in handling and pipetting and minimizing variation between
samples will help ensure robust results.
24. Always make a replica qPCR microplate layout on paper to
keep track of your samples while setting up qPCR plate.
25. The qPCR profile for your target gene and housekeeping gene
may vary depending upon the primer specifications and should
be standardized before performing qPCR.

Acknowledgments

Funding related to the development of this protocol is provided to

DEC by the Defense Advanced Research Projects Agency
(DARPA) through a Young Faculty Award (DP17AP00034). The
content does not necessarily reflect the position or the policy of the
Government and does not imply an official endorsement.

References

1. Čermák T, Baltes NJ, Čegan R et al (2015) 4. Qi LS, Larson MH, Gilbert LA et al (2013)
High-frequency, precise modification of the Repurposing CRISPR as an RNA-guided plat-
tomato genome. Genome Biol 16:232. form for sequence-specific control of gene
https://doi.org/10.1186/s13059-015-0796- expression. Cell 152:1173–1183. https://doi.
9 org/10.1016/j.cell.2013.02.022
2. Xie K, Minkenberg B, Yang Y (2015) Boosting 5. Baltes NJ, Voytas DF (2015) Enabling plant
CRISPR/Cas9 multiplex editing capability synthetic biology through genome engineer-
with the endogenous tRNA-processing system. ing. Trends Biotechnol 33:120–131. https://
Proc Natl Acad Sci U S A 112:3570–3575. doi.org/10.1016/j.tibtech.2014.11.008
https://doi.org/10.1073/pnas.1420294112 6. Sadhu MJ, Bloom JS, Day L et al (2018)
3. Tang X, Lowder LG, Zhang T et al (2017) A Highly parallel genome variant engineering
CRISPR-Cpf1 system for efficient genome with CRISPR-Cas9. Nat Genet 50:510–514.
editing and transcriptional repression in plants. https://doi.org/10.1038/s41588-018-0087-
Nat Plants 3:17103. https://doi.org/10. y
1038/nplants.2017.103
Another Random Scribd Document
with Unrelated Content
 + Boston Transcript p6 Je 23 ’20 260w

“The truth is that the pamphlet is mostly dull, a ponderous parody.

Its merit today is that it has served Mr Jackson for an excellent and
entertaining piece of detective work. In its present form, with this
foreword, ‘English notes’ must have a place on the shelves of every
collector of Dickens or of Poe.”

+ − Nation 111:382 O 6 ’20 410w

N Y Times p9 Ag 1 ’20 2800w

“Unfortunately, the attribution of the work to Poe is sustained by

neither internal nor external evidence.”

− Springf’d Republican p6 Jl 19 ’20 600w

The Times [London] Lit Sup p305 My
13 ’20 160w
+ The Times [London] Lit Sup p595 S 16
’20 600w

QUILLER-COUCH, SIR ARTHUR THOMAS

(Q., pseud.). On the art of reading. *$2.75 Putnam
028

20–16869
 The spirit of the volume can perhaps best be illustrated by two
extracts from the preface: “The real battle for English lies in our
elementary schools, and in the training of our elementary teachers. It
is there that the foundations of a sound national teaching in English
will have to be laid, as it is there that a wrong trend will lead to
incurable issues,” and “that a liberal education is not an appendage
to be purchased by the few; that humanism is, rather, a quality which
can, and should, condition all our teaching; which can, and should,
be impressed as a character upon it all, from a poor child’s first
lesson in reading up to a tutor’s last word to his pupil on the eve of a
tripos.” Contents: Apprehension versus comprehension; Children’s
reading; On reading for examinations; On a school of English; The
value of Greek and Latin in English literature; On reading the Bible;
On selection; On the use of masterpieces; Index.

“We find it as hard to conceive that undergraduates did not enjoy

hearing these lectures on ‘The art of reading’ as that ‘Q’ did not enjoy
delivering them. The elements of an ideal professor were always in
him. To communicate a gusto, a vivid and thrilling delight in
literature for its own sake, as a delectable duchy where no passport,
save the fact of your own enjoyment, is required, is a gift given to
few. ‘Q’ is among them.” J. M. M.

+ Ath p234 Ag 20 ’20 2000w

“Especially useful to elementary teachers.”

+ Booklist 17:147 Ja ’21

+ Dial 70:108 Ja ’21 50w

“As an advocate of books, I know of none so well equipped in

perspective to give advice as Quiller-Couch; as a precepter, I have
met with no one on whom the burden of his task has rested so lightly,
so agreeably, so sympathetically, as on him. Out of the fullness of his
enjoyment he speaks, and it is refreshing to observe how jealously he
tries to rescue the books he loves from the palsied grasp of the
pedagog.” M. J. Moses

+ N Y Times p5 Ja 2 ’21 2650w

“Original points of view, apt quotations, and genial play with the
subject characterize the volume.”

+ Outlook 126:690 D 15 ’20 60w

Sat R 130:219 S 11 ’20 1500w
+ Spec 125:472 O 9 ’20 1050w

“The style is too discursive, there is too much quoting, some of the
long sentences puzzle one on first reading. And yet what a professor
of literature! Why do not all universities secure men like this King
Edward VII professor?”

+ − Springf’d Republican p8 Ja 6 ’21 570w

“Sir Arthur Quiller-Couch in his lectures shows that he has the

interests of the children and of the young men strongly at heart. His
are not the accustomed utterances of the professor of literature at an
ancient university. They are not in the great style nor, in their form,
are they learned. They abound in irrelevances, with a touch of
facetiousness that is often tiresome, and occasionally they breathe
the unction of the pulpit rather than the gravity of the chair. The
lectures were doubtless more effective in their delivery than in their
printed form.”
+ − The Times [London] Lit Sup p557 S 2
’20 3350w
 R

RADICE, SHEILA (JAMIESON) (MRS

ALFRED HUTTON RADICE). New children; talks
with Dr Maria Montessori. *$1.50 (4c) Stokes 371.4

20–15392

The object of the book is to sketch in broad outline the Montessori

system of teaching, for which and for Dr Montessori’s insight into
child psychology, the author has a profound admiration. She holds
that with a full recognition and adoption of the Montessori methods,
the psycho-analyst’s vocation will be gone. Contents: Dr Montessori
in England; Two Montessori schools; The Montessori apparatus; Dr
Montessori herself; Dr Montessori as a lecturer; The ethical basis;
The psychological basis; What is psychology? The psychology of the
new-born; What is suggestion? What is music? Montessori and
Bergson; Training for citizenship; Training for vision; Liberal
education; A new theory of work; The education of the adolescent;
The new children; The English nursery school; Appendices;
Bibliography.

“In spite of a good deal of vague romanticism and loose writing the
book leaves the impression that Dr Montessori herself is an
unusually sane and sensible personality, who regards her own
methods as not necessarily final.”

+ − Review 3:480 N 17 ’20 250w

 “Her book is quite entertaining. It is also exceedingly combative.
Like many of those who believe in Mme Montessori, she regards any
criticism of the Dottoressa’s methods as almost blasphemous and
quite wanton and unnecessary.”

+ − Spec 124:619 My 8 ’20 900w

“The book is fragmentary and, as the author herself admits,

‘somewhat hastily done.’ Since the range of topics is so wide, the
argument is brief and sketchy, giving glimpses of vistas for possible
exploration rather than settling the discussion.” A. E. Morey

+ − Survey 45:136 O 23 ’20 510w

RADZIWILL, CATHERINE (RZEWUSKA),

princess (COUNT PAUL VASSILI, pseud.).
Secrets of dethroned royalty. il *$3 (6c) Lane 920

20–9932

These secrets pertain to the love affairs of royal personages and the
book is accordingly divided into three parts, Russia, Austria, and
Germany. The author seems possessed of much intimate knowledge
and the book is well illustrated.

Boston Transcript p6 Ag 4 ’20 350w

 “There is not much, of course, in all this that is new, but some of
the instances are not well known, and now and then the author
throws a light upon familiar incidents that makes them more
intelligible to the American reader.”

+ − N Y Times 25:25 Jl 18 ’20 490w

RAEBURN, HAROLD. Mountaineering art. il

*$3.75 Stokes 796

“In this volume an endeavour has been made to trace and indicate
the broad principles of climbing and mountaineering, from
‘bouldering’ to the conquest of the highest summits of the earth. The
book is the outcome of more than twenty years’ experience as a
climbing leader in many parts of the Asio-European continent, and
on almost every kind of rock, snow, and ice formation. In
preparation for it, almost every published work on climbing and
mountaineering, in English, and in the principal continental
languages, has been consulted.” (Introd.) The book is in five sections:
Mountaineering art; British mountaineering; Alpine
mountaineering; For the lady mountaineer; General principles. The
chapter on dress for women climbers is contributed by Ruth
Raeburn. The work closes with a short list of books, glossary, and
index.

“In general Mr Raeburn’s technical chapters are first-rate. His

remarks on rock, snow and ice work are stamped by the seal of
expert and up-to-date knowledge. Of exploration, bivouacs and
camps he writes with the knowledge that many years of wandering in
unexplored ranges have yielded him. On equipment he has also
much to say which is new and needed saying. The book, as a whole,
suffers a little from redundant chapters.” Arnold Lunn
 + − Ath p579 O 29 ’20 1050w
+ Boston Transcript p3 D 4 ’20 250w

“It is severely practical and written for use, not for entertainment.
The numerous illustrations have all been chosen with regard to their
instructional rather than their pictorial value. Mr Raeburn writes
with conviction and refreshing candour.”

+ Spec 125:819 D 18 ’20 900w

“Apart from the instruction he gives to the novice, Mr Raeburn has

done the mountaineering public a service by composing a work
which sets forth the latest views on the best mode of ‘climbing and
mountaineering.’”

+ The Times [London] Lit Sup p529 Ag

19 ’20 820w

RAGOZIN, ZÉNAÏDE ALEXEÏEVNA, ed. and

tr. Little Russian masterpieces. 4v *$7.70; ea *$1.25
Putnam 891.7

20–18302

A collection of Russian stories brought together with the object of

presenting American readers “with a selection which may not only
prove acceptable in itself, but reveal to them some less familiar
aspects of Russian thought and character.” There is an introduction,
repeated in each of the four volumes, by S. N. Syromiatnikof, who
also contributes biographical notes. There is one volume devoted to
the work of Pushkin and Lermontof. Authors represented in the
others are: Lesskof, Dombrovsky, Dostoyefsky, and Tolstoi; Saltykof-
Stchedrin, Mamin-Sibiriak, Slutchefsky, Niedzwiecki, Uspensky and
Helen Zeisinger; Staniukovitch and Korolenko.

“The stories that she presents are fresh, original, and full of
dramatic incident. It is one of the most interesting collections ever
got together. Her translation reads with exemplary smoothness and
accuracy; she is a mistress of English style.” N. H. D.

+ Boston Transcript p5 N 13 ’20 500w

“That there are here many names not familiar to the casual reader
of Russian literature is not among the least attractions of the
collection.”

+ Springf’d Republican p9a O 31 ’20 180w

RAGSDALE, LULAH. Next-besters. *$1.75

Scribner

20–11498

“Robert Lee Poindexter—‘The boss’—was of the old South, the

courtly and sweet-natured master of the ancient and impoverished
plantation of Cherokee in Mississippi. But Pat and Polly, the Misses
Poindexter, were very modern, up-and-coming young people, who
shouldered both hard work and responsibility and evolved an
energetic philosophy, though Patricia was only twenty and Polly was
just eighteen. The story of their work and responsibility, and of how
their philosophy resulted in action is the story of ‘Next-besters.’”—N
Y Times

Booklist 17:73 N ’20

“A pretty and amusing little story that is always entertaining, and

not without charm. Assuredly, ‘Next-besters’ is a pleasant piece of
‘light reading’ for a summer day.”

+ N Y Times 25:26 Jl 25 ’20 390w

“An excellent story for young people.”

+ Outlook 125:541 Jl 21 ’20 40w

[2]
RAINE, WILLIAM MACLEOD. Big-town
round-up. il *$2 (3c) Houghton

20–19181

This is the story of one of those bronzed, big-hearted westerners,

whom fiction so often presents to us riding over the plains of
Arizona. But in this novel, Clay Lindsay is functioning in the very
heart of civilization, in no less a metropolis than New York city, but
the traditional characteristics of the wild-west story are all here.
There is the bad-man, Clay’s natural enemy, personified in Jerry
Durand; there is the beautiful heroine, Beatrice Whitford; and there
is the weak easterner, Clay’s rival in love, Clarendon Bromfield. All
these and various minor characters play their accepted parts in the
drama of romance and gun-play, with the inevitable happy ending
for the deserving.

“Full of exciting situations, profanity and crude humor.”

+ − Booklist 17:160 Ja ’21

“They used to put these stories into paper covers with the luridest
scene in red and yellow on the jacket. Now—but it’s Diamond Dick
just the same, sandpapered a little, but otherwise not much
changed.”

− N Y Evening Post p10 N 27 ’20 190w

“Mr Raine has written many another good story of the West, which
he knows so well, but he will find it hard to beat this one.”

+ N Y Times p23 Ja 30 ’21 580w

“The story has ‘punch.’”

+ Outlook 126:558 N 24 ’20 30w

RAINE, WILLIAM MACLEOD. Oh, you Tex! il

*$1.90 (2c) Houghton

20–6711
 A story of the Texas Panhandle in the period following the Civil
war. Jack Roberts, a line-rider for Clint Wadley, one of the big
cattlemen, gets into trouble with Wadley’s son Rutherford and gives
him a well-deserved trouncing. This is unfortunate, for Jack has just
been promoted and is in love with Wadley’s daughter Ramona. A few
hours after his dismissal, he enlists with the Texas Rangers.
Rutherford Wadley, who has become involved with a band of cattle
rustlers and outlaws, is shot by one of them. Suspicion falls on a
young Mexican and to save him from a lynching mob, led by the real
murderer, Jack puts up a brilliant bluff and risks his own life. His
later adventures have to do with the pursuit and capture of the
Dinsmore gang and the winning of Ramona.

Booklist 16:350 Jl ’20

Cleveland p72 Ag ’20 40w

“A fascinating story from beginning to end—in spite of its well-

worn material.”

+ N Y Times 25:326 Je 20 ’20 700w

“An exciting, old-fashioned tale of the western cattle country.”

+ Springf’d Republican p7a N 21 ’20 100w

[2]
RAINSFORD, W. H. That girl March. *$1.50
(*8s 6d) (1c) Lane
 20–20431

Curiosity draws Philip Gray to Blaisham. Some thirty years before,

his mother, falling in love with the chapel minister, had defied her
family, run away with her lover and been disowned in consequence.
And now, father and mother dead, the son had returned to look on
her old home. He does not reveal his identity and does not learn that
his aunt, Lady Delwyn, has set her lawyers on his track, bent on
reconciliation. In the meantime he meets and falls in love with Edith
March, niece of one of the neighborhood farmers. The reconciliation
with the aunt takes place, but in his new position Philip finds that his
wooing does not proceed smoothly. However he has some of his
mother’s spirit and “that girl March” stands in no awe of Lady
Delweyn and it ends well.

“If this tale is representative of Mr Lane’s selection of first novels,

that selection must be astonishingly excellent, for Mr Rainsford, or
possibly Miss Rainsford, spins an enchanting yarn. The only fault of
the novel is its length. Here and there, it drags a trifle.”

+ − Boston Transcript p7 D 4 ’20 240w

“This book is not cheap or unsuccessful in an ordinary sense. It is

simply 366 pages with the book not there. One constantly
apprehends cleverness, vividness—but gets not one clear
visualization in much description.”

− N Y Evening Post p10 N 20 ’20 170w

N Y Times p26 Ja 2 ’21 330w
 “‘W. H. Rainsford’ adopts a method that irresistibly recalls the
seaside acrobat courting attention by means of ridiculous
somersaults as a prelude to the display of more special powers. These
affectations being suddenly discarded, to reappear only
intermittently, it becomes possible to take a mild—a very mild—
interest in the fortunes of Philip Gray.”

− + The Times [London] Lit Sup p583 S 9

’20 510w

RAINSFORD, WALTER KERR. From Upton to

the Meuse with the Three hundred and seventh
infantry. il *$2 (4c) Appleton 940.373

20–2288

The volume is a history of the 77th division and of the 307th

regiment. This division Colonel J. R. R. Hannay in the introduction
calls the cosmopolitan division of New York city, “New York’s own.”
He also states that this division consisting of men unused to the
sturdy activity of outdoor life conducted itself as the most perfectly
trained and disciplined army in the world. The sketches and
photographs in the book are of the best, the author being a graduate
from the École des beaux arts, Paris, in 1911. Besides the introduction
by Colonel Hannay, the foreword by General Alexander, and two
poems by the author, the contents are: Camp Upton; With the
British; Lorraine; The chateau du diable; Across the Vesle; Merval;
Sheets and bandages; The forest of Argonne; The dépôt de machines;
The surrounded battalion; Grand Pré; The advance to the Meuse;
The home trail; Appendix.
 “Very telling photographs and drawings which suggest a beauty
which is the antithesis of war.”

+ Booklist 16:238 Ap ’20

+ Boston Transcript p11 Ap 24 ’20 850w
+ Cath World 112:116 O ’20 370w
+ Outlook 125:223 Je 2 ’20 200w

“Captain Rainsford has succeeded in making his narrative clear,

expressive, and entertaining—thanks in good part to a never failing
sense of humor. We must give credit, too, for his having provided the
maps necessary to follow his narrative—a too unusual provision in
books about the war.”

+ Review 2:464 My 1 ’20 460w

R of Rs 61:445 Ap ’20 170w

RAMSAY, ROBERT E. Effective house organs. il

*$3.50 (3c) Appleton 659

20–2516

A book treating of “the principles and practice of editing and

publishing successful house organs.” (Sub-title) Chapter one
describes a house organ as “a small magazine or newspaper
published once a month, sometimes more frequently, sometimes
less, and made up wholly or in part of advertising from the house
sending it out.” The treatise which is profusely illustrated with
specimen pages of typical house organs, falls into three parts. “Part 1
lays down the underlying principles of editing and publishing house
organs of all classes. Part 2 gives you the actual practice among
successful house organs in applying principles previously laid down.
Part 3 is made up of appendices containing valuable reference data
on the general subject of house organs which may be of use to both
student and practitioner.” There is an index.

“A book much needed by the amateur editor in business

organizations.”

+ Booklist 16:228 Ap ’20

“His style is easy and readable.”

+ Boston Transcript p6 Jl 28 ’20 240w

“The book contains many interesting examples of how a sound

knowledge of psychology is valuable in producing a successful house
organ.”

+ N Y Times 25:296 Je 6 ’20 160w

+ The Times [London] Lit Sup p585 S 9
’20 220w

RAPEER, LOUIS WIN, ed. Consolidated rural

school. il *$3 Scribner 379.17

20–4557
 This is the first comprehensive treatment of the subject and
contains articles by leading specialists and successful workers in this
field. Its object is to elucidate the general aim of the consolidated
school: social efficiency, with its subordinate aims of vital,
vocational, avocational, civic, moral efficiency. It shows how the new
method fosters cooperation, and socialization, how children may be
physically and mentally changed by suitable methods and how the
consolidated school can furnish opportunity for a school farm,
homes for teachers and a community centre. The first chapter,
National and rural consolidation, and many of the subsequent
chapters are by the editor, Louis W. Rapeer. Other chapters are: The
American rural school, by Philander P. Claxton; Community
organization and consolidation, by Warren H. Wilson; Rural
economics and consolidation, by T. N. Carver; The growth of
consolidation, and Transportation of pupils at public expense, by A.
C. Monahan; A visit to a consolidated school, and The country girl
and the consolidated school, by Katherine M. Cook; Methods and
facts of consolidation, by W. S. Fogarty; The difficulties of
consolidation, by L. J. Hanifan. The book is indexed and has a
bibliography.

+ Booklist 17:14 O ’20

“The book is to be commended on its attempt to use the problem

approach to the various topics.”

+ El School J 21:231 N ’20 450w

School R 28:796 D ’20 240w
 RASHDALL, HASTINGS. Idea of atonement in
Christian theology. (Bampton lectures, 1915) *$5.50
Macmillan 232.3

20–9571

“Mr Rashdall traces the history of the doctrine of the atonement

down from its pre-Christian origins through the New Testament, and
then by way of the Apostolic fathers, the Latin theology, the
Schoolmen, and the Reformers down to modern times. His main
interest lies in the controversy between the subjective and the
objective types of atonement doctrines.”—Nation

− Ath p412 Mr 26 ’20 420w

“Even so competent and scholarly a discussion as this of Mr

Rashdall’s carries with it a suggestion of belonging to a stage which
we have left behind us. Those who are acquainted with Mr Rashdall’s
work will find the sincerity and thoroughness of discussion which
they have learned to expect from him.” R: Roberts

+ − Nation 110:624 My 8 ’20 750w

“This is one of the most important theological works that have

appeared for more than a generation. Its quality is scientific.”

+ Spec 124:311 Mr 6 ’20 1750w

 “It is probably the most important constructive treatise on
systematic theology which has been published by an English divine
during the present century. Parts of it will be found difficult by
readers who are not experts in theology, for it deals with problems of
great complexity. But it is both subtle and lucid; it is a unity and not
patchwork; and, as compared with the reticence of some fairly recent
work, it is remarkably outspoken.”

+ The Times [London] Lit Sup p250 Ap

22 ’20 1550w

RASKIN, PHILIP M. Songs and dreams. *$1.25

Stratford co. 811

20–9428

In a foreword the author tells something of the conditions under

which his poems have been written. He learned English after the age
of nineteen, published his first book of verse in English, with an
introduction by Israel Zangwill, in London in 1914, and has since
come to New York where he now makes his home. The poems are in
five groups: Love and longing; Autumn flowers; Echoes of exile;
Chequered shadow; The dawn of a nation. Some of the poems in the
third group, such as To free Russia (1917), The Torah and “No news”
are racial in theme, but the one purely Jewish section of the book is
the concluding one, devoted to the Zionist ideal.

“Despite Israel Zangwill’s opinion that ‘the best of Mr Raskin’s

poems might have been written by Robert Browning,’ there is much
in them that is merely ‘pretty work’—though the same thing might be
said, heaven knows, of the famous Victorian poet. In fact, the first of
this volume, dealing, as it does, with love, is fairly puerile. But
toward the end of the volume we happen upon a collection of poems
entitled ‘The dawn of a nation’ which contains one or two verses
worth while. The one poem which makes the collection notable is
that called ‘After the British declaration.’”

+ − Boston Transcript p6 S 8 ’20 380w

RAVEN, CHARLES E. Christian socialism,

1848–1854. *$6.50 Macmillan 335.7

“This work is based on the Donellan lectures delivered by the

author, who is dean of Emmanuel college, Cambridge, at Trinity
college, Dublin, in May, 1919. It traces the ‘Christian socialist’
movement from its origin in the reaction against the ‘laissez faire’
principles of the early 19th century to the apparent failure of the
effects of Maurice, Neale and Ludlow in 1853, after the passing of
Slaney’s act, which gave recognition to the cooperative movement.
The concluding chapter deals with the ‘Foundation of the working
men’s college’ after the breakdown of the earlier hopes of the
Christian socialists.”—The Times [London] Lit Sup

“The volume as a whole is a genuine contribution to English

economic history and will doubtless be received as such. Mr Raven
would have been a little more convincing in some parts if he had
been less profuse in praising his heroes and at the same time had
shown more charity for Mrs Sidney Webb and other critics of the
Christian Socialists.”

+ Nation 112:sup247 F 9 ’21 410w

Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade

Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.

Let us accompany you on the journey of exploring knowledge and

personal growth!

textbookfull.com