Scribd
Upload
11 views7 pages

Chem Bio HW2r

Uploaded by

lparker1357911
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
11 views7 pages

Chem Bio HW2r

Uploaded by

lparker1357911
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 7

Chem Bio HW addi onal Problerms

I.Qengturahoni ONA strands are heuted to 5e Seperahiny them no Single strnds


-DNH mt be con ver led o Singe strand to qlow gnnedliny of primers
in order aiow binding of primtrs
to sinyte- strunded ONA templutes,
-Temge rahe is dependent on primer compes,n
3Exension: temgerature i's inefeused to TAL, ophm'zin9 DNA olymrase's abiti'y
to Syathese DNA from the primer Site
Steps |-3 are eyeahedd0-30 time's (yues)

b.Compk ke fuiture coud be due to a mylh'hute of reqs0n s

I.Failute to denyture MA: En°eusihy denghurution temgeruture mey esat in


sHand seyeruhion qilowing prmef qnnealhy and tensjoy
, InnuproFtiute temgeruhie of 4nnetny, Aevst T fer annealiny ay optmze
primer anneuliny resyltiny DNA amoWftion
3, Inreaje ertensbn tme Inade quate extension inCormglehe
ONA polymerizaton and nd amplfation
2. A.

atggagga gccgcagtca gatcctagcg tcgagccccc


181 tctgagtcag gaaacatttt cagacctatg gaaactactt cctgaaaaca acgttctgtc
241 ccccttgccg tcccaagcaa tggatgattt gatgctgtcc ccggacgata ttgaacaatg
301 gttcactgaa gacccaggtc cagatgaagc tcccagaatg ccagaggctg ctccccccgt
361 ggcccctgcaccagcagctc ctacaccggc ggcccctgca ccagccccct cctggcccct
421 gtcatcttct gtcccttccc agaaaaccta ccagggcagc tacggtttcc gtctgggct
481 cttgcattct gggacagcca agtctgtgac ttgcacgtac tcccctgccc tcaacaagat
541 gttttgCcaactggccaaga cctgccctgt gcagctgtgg gttgattcca caccccogcc
601 cggcacccgc gtccgcgcca tggccatcta caagcagtca cagcacatga cggaggttgt
661 gaggcgctgc ccccaccatg agcgctgctc agatagcgat ggtctggccc ctactcagca
21 tcitatccga gtggaaggaa atttgcgtgt ggagtatttg gatgacagaa acaattttcg
761 acatagigg gggigccctatgagccgcc tgaggttggc tctgactgta ccaccatcca
841 ctacaactac atgtgtaaca gttcctgcat gggcggcatg aaccggaggc ccatcctcao
901 catcatcaca ctggaagact ccagtggtaa tctactg8gacggaacagct ttgaggtgcg
961 tgtttgtgcc tgtcctggga gagaccggcg cacagaggaa gagaatctcc gcaagaaagg
1021 ggagcctcaccacgagctgc ccccagggag cactaagcga gcactgcccaacaacaccag
1081 ctcctctccc cagccaaaga agaaaccact ggatggagaa tatttcaccc ttcagatccg
1141 tgggcgtgag cgcttcgaga tgttccgaga gctgaatgag gccttggaac tcaaggatgc
1201 ccaggctggg aaggagccag gggggagcag ggctcactcc agccacctga agtccaaaaa
1261 gggtcagtct acctcccgcc ataaaaaact catgttcaag acagaagggc ctgactcaga
1321 ctga
B. 17
C. Forward: CATATGatggaggagcc
5 3T 7G 4C
2(5+3) + 4(3+6) =62 °C

Reverse: tctgagtcaggccCTCGAG
3T 3A 5C 6G
2(4+3) + 4(6+6) = 62 °C
3,Unike eplicqhon, tånscrlghonto RNA iy then truns lubecd to prohein, A worst
ansryhion emors woyld esylt in non- funuhion protein whih wonld likely not
be hugely detnimentl to cell quttu'ty one th In replkution, NA polymease
Syathe sizes new to be MSc fermglate er tremeithen, leadiny
propaahon of the. enOG

1 uniike DNA, RWA hus a a' Mydroayl gfoup CQusiny


I.» formatbn of doube heli'x due b disuptian of prefered geomehy
a.con lead o hydrolisof the Ducleotides

fA

electron

*Hydroxyls electron-i hdrawing pPopertes pftvent the glycesdie bond Lleavaye


by prevnthy CN bond from convertiny to mine

Buse
Base Pretne à' hydroxyl
enourue hydrolysis neeus
0-pEo
Sumg le deg (edution ever hme

J
Monsensei Sequene chune thut nesyls in terminqtion of tran slqtbn
ex. CGA CUGA (Stop)
Missense ! Seguence chunge Hhut resulbs in u Chunge qmino qeid

ex. cGA(R)’CAA (a)


"SilentiScq Mence chunge thut resyls in no trenskyton change
ex,CGA (R)’ CGc (Arg)
6. DNA is held tn relatvely iytd do4 ble due to base perring,
heli'y
Con formahional fredom. bg the other hund, RANAS hgeyso, a' hycoxy
grovp prevents base fuiriny, remon'ny Such r'giHy

Because RwA is not restruheel doubie helix, its foldns patHern relles
lurge 4noynt of fuitors
'Transcigthion direutienatty amd speed
Lntera hions with churged purtiches de to the negyhey charge d buc ko Che
"RNA bindtny grotein) fofminy stucturyl noes

1. Enhun cersi inruse transcrigtien rate Dy athmy binding s/ke foY trynser'phn

fucors, Bo not neressenly need to be naar codiny egion


Promotor: Jnitue tr4nsurlgton by signahy he bindiny site of RNA Poly nerese
-foun sliy hly bekre codhy eyion
Chem Blo HW Boo's Problem s
Shcky erd's
GATC
3.18 a. AA CTGAA TTTCAbGEGATCOGCATLGCUT GATI
TTGACTTAA AGTCCqcc TAoTACCGCA CTAGG

b. i, Dipest plasmid with Baml to lineize it qnd form

, CoaRe Syathesize oliyonucleokde wh Bum H resticion Gle


-Digest oligonuc leoide with BamHi to folm iDmgyt.bie Sieky ends
3, add olyo mucleonde o plusmid wih lWgase to fraqmen t anel

C, Form A3 fruyments bCATLCTTAA GT G6 TbG ATCCCCATTCdArc


Liyutien woutel reselt t n 6 diEferent rodycts
-Ligutiays non-speck qnd
6 itteren qrtAngeehts
3.34 C!7 q'3 A:1 Ti
3.35 a. tGACCG6LAL CAAAAT6TTGCAT (G CATGATGCAT6 CAM GCA TGCATG(ATGcA TGCt

b, TGALGALAAAATGTTGCA

2,
O,1875

3. uATGA
4 TeCATGCHToCA 0, 10S4

b, Fofwury; G6GAGAA TT(CCA GA(C


Revere GbbAGAA TTuccTCAG
d.
4.8 In order to syn Hhesize RNA 3' to s the fynhongty of she 3
and s carbon must be fligeuy placimg the Hip hosphute tlese e
2' hyotroy yroup, Because of his rate of hydrolisis
would dmakally tnceuse

Base MO

Lnton
Larist

W:Hhont fuHher nfornahtn it is impo ssible to redet whilh phosnhyte bond


wl be clea ved, Thia woyd rehy on iny thys aclding an'erent
naleohdes, bend ang le and the
guess, the 3 plhosghte woyd be moht Jetiye as a lineqt
chuin unlike Hhe yhospute Vid's ot the lanar
b. s'G4AccACA 3

4, Chemical bydrolysis resuls Horn nycleophilic attuck of the degrotongted


hydoxy goup. Chanyiny this methoxy group would exttemely edue
the likelhood ok nucleoghili atack, makiy -0-Methyl fur less reactie
b, the p4Fose of RNaseA is to deçrade ANA hrouyh q conerhedd reacton
abstruhing fhe proon from
involviny Nisla eHbond tth Ahe a' hydroxy gfouy in order to sabylizt

the atiack on he ghosphorous qlom. Absachion of the


proton NOMld be imyos5 ble sustttutecd by a-o-me thyl
reduclny reactiv'ty

You might also like