0% found this document useful (0 votes)

21 views

bisc 101 notes

Uploaded by

tseheitung029

Available Formats

Download as PDF, TXT or read online on Scribd

0% found this document useful (0 votes)

21 views

bisc 101 notes

Uploaded by

tseheitung029

Available Formats

Download as PDF, TXT or read online on Scribd

You are on page 1/ 628

SFU

BISC 101
Fall 2024, Course Notes

© Wizedemy Inc. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, or sorted in a data
base or retrieval system, without the prior written permission of Wizedemy Inc.
Welcome to Wizeprep

These notes were created on Nov 1st, 2024

We're always updating our content. Check back for more.

👋 Welcome to Your Course Notes

I'm Isaura, your Wizeprep biology tutor. I put these notes and the
corresponding online course together especially for BISC 101 at SFU. It's
formulated to tell you everything you need to know, in a quick and easy
format so you can get better grades, spend less time studying, and more
time living.
Isaura 4.7/5
Biology

Find Your Course Online

These course notes correspond to an online course full of video lectures, practice
problems, instructor Q&A and more. Access it with this QR code or at
wizeprep.com/in-course-experience/Bisc101-SFU

98% After discovering Wizeprep at the

beginning of my second semester, my
grades have gone up significantly. I feel
Of Wizeprep so much more confident when taking

Students Get my exams.

Better Grades Emily, Undergraduate Student

Get Better Grades Really Understand Concepts Cut Your Study Time in Half
98% of students who study Our instructors know how to Quick, curated lessons allow
with Wizeprep reported make complex topics you to focus your study time
higher grades feel simple where it matters

Find in These Course Notes Find Online

Relevant Theory Bite-Sized Video Lessons

All the theory and expert knowledge you need to Each section corresponds to a minutes-long video
fully understand your course. explanation by your expert instructors.

Practice Questions Solutions to Problems

Tons of practice problems, similar to those See the solutions to the practice problems as well
expected on your exam. as a step-by-step breakdown of the answers.

Exam Tips 24/7 Instructor Q&A

Unique exam writing tips proven to help you Need help clarifying a concept? You have direct
score higher. access to your instructor.

Not subscribed yet?

Get started for free on Wizeprep.com

Table of Contents
I. Welcome 1.6. Proteins
1.6.1. Proteins
Chapter 1. Molecules of Life
1.6.2. Protein Folding
1.1. Types of Bonds and Intermolecular Forces
1.6.3. Functions of Proteins
1.1.1. Types of Chemical Bonds
1.6.4. Example
1.1.2. Practice 1
1.6.5. Practice 1
1.1.3. Practice 2
1.6.6. Practice 2
1.2. Intermolecular Forces: Hydrogen Bond 1.6.7. Practice 3
1.2.1. Intermolecular Forces: Hydrogen Bonding 1.6.8. Practice 4
1.2.2. Example
1.7. Carbohydrates
1.2.3. Practice 1
1.7.1. Carbohydrates (Sugars)
1.2.4. Practice 2
1.7.2. Polysaccharides
1.2.5. Practice 3
1.7.3. Practice 1
1.3. Intermolecular Forces: Van der Waals 1.7.4. Practice 2
Interactions
1.7.5. Practice 3
1.3.1. Intermolecular Forces: Van der Waals
1.8. Lipids
Interactions
1.8.1. Lipids: Fats
1.3.2. Practice 1
1.8.2. Lipids: Phospholipids
1.3.3. Practice 2
1.8.3. Lipids: Steroids
1.4. Properties of Water and Carbon
1.8.4. Example
1.4.1. Important Elements that Make Up Life
1.8.5. Practice 1
1.4.2. Unique Properties of Water
1.8.6. Practice 2
1.4.3. Practice 1
1.8.7. Practice 3
1.4.4. Practice 2
1.8.8. Practice 4
1.5. From Monomers to Polymers
1.9. Nucleic Acids
1.5.1. From Monomers to Polymers
1.9.1. Nucleic Acids
1.5.2. Practice 1
1.9.2. The DNA Double Helix
1.5.3. Practice 2
1.9.3. Example
1.5.4. Practice 3
1.9.4. Practice 1

1.9.5. Practice 2 2.4.9. The Nucleus

1.9.6. Practice 3 2.5. The Cytoskeleton
1.9.7. Practice 4 2.5.1. Cytoskeleton Overview [short lesson]

Chapter 2. Cell Structure and 2.5.2. Microtubules

2.5.3. Actin Microfilaments
Function
2.5.4. Intermediate Filaments
2.1. Prokaryotic Cells
2.5.5. Example
2.1.1. Prokaryotic Cells
2.5.6. Practice 1
2.1.2. Practice 1
2.5.7. Practice 2
2.1.3. Bacteria and Archaea Cell Wall
2.5.8. Illustrations of the Cytoskeleton
Composition
2.1.4. Practice 2 2.6. Motor Proteins: Cilia and Flagella

2.1.5. Practice 3 2.6.1. Motor Proteins

2.6.2. Flagella and Cilia
2.2. Eukaryotic Cells
2.6.3. Practice 1
2.2.1. Eukaryotic Cells
2.6.4. Practice 2
2.2.2. Practice 1
2.2.3. Practice 2 2.7. Connections between Cells and their
Environment
2.2.4. Plant versus Animal Cells
2.7.1. Extracellular Matrix
2.3. Endosymbiont Theory
2.7.2. Junctions and Adhesions
2.3.1. Endosymbiont Theory
2.7.3. Practice 1
2.3.2. Example 1
2.7.4. Practice 2
2.3.3. Practice 1
2.7.5. Practice 3
2.3.4. Practice 2
2.3.5. Practice 3 Chapter 3. Membranes/Transport
2.4. The Endomembrane System 3.1. Components and Structure
2.4.1. The Endomembrane System 3.1.1. The Fluid Mosaic Model
2.4.2. Lysosomes, Vacuoles and Vesicles 3.1.2. Factors Affecting Membrane Fluidity
2.4.3. Example 1 3.1.3. Practice 1
2.4.4. Practice 1 3.1.4. Practice 2
2.4.5. The Golgi Apparatus 3.1.5. Practice 3
2.4.6. Practice 3 3.2. Thermodynamics of Membrane Formation
2.4.7. The Endoplasmic Reticulum (ER) 3.2.1. Thermodynamics of membrane formation
2.4.8. MOVE Practice 1 3.2.2. Practice 1

3.3. Passive Transport 4.4. Control of Cell Cycle

3.3.1. Membrane Permeability 4.4.1. Cell cycle Control
3.3.2. Introduction and Passive Transport 4.4.2. Putting the Breaks on the Cell Cycle
3.3.3. Practice 1 4.4.3. Example
3.3.4. Practice 2 4.4.4. Practice 1
3.4. Active Transport 4.4.5. Practice 2
3.4.1. Active Transport 4.5. Prokaryotic Cell Division: Life Cycle &
3.4.2. Example Growth
3.4.3. Practice 1 4.5.1. Prokaryotic Growth Phases

3.5. Osmosis 4.5.2. Practice 1

3.5.1. Osmosis and Osmolarity 4.5.3. Practice 2

3.5.2. Practice 1 4.6. Binary Fission

3.5.3. Practice 2 4.6.1. Binary Fission: Prokaryotic Cytokinesis

3.6. Bulk Transport 4.6.2. Practice 1

3.6.1. Endocytosis and Exocytosis Chapter 5. DNA Replication

3.6.2. Practice 1 5.1. DNA Structure and Sequence
3.6.3. Practice 2 5.1.1. Review of DNA Structure
Chapter 4. Cell Cycle 5.1.2. Practice 1

4.1. The Genome & Chromosomal Structure 5.1.3. Practice 2

4.1.1. The Gene and the Genome 5.2. Meselson-Stahl Experiment

4.1.2. Practice 1 5.2.1. Meselson-Stahl Experiment

4.2. The Cell Cycle 5.2.2. Example: Applying the Meselson-Stahl

Experiment
4.2.1. Phases of the Cell Cycle
5.2.3. Practice 1
4.2.2. Practice 1
5.3. In vivo DNA Replication
4.3. Mitotic Phase of Cell Cycle
5.3.1. DNA Replication in Cells
4.3.1. Mitosis and Cytokinesis
5.3.2. Example: Leading and Lagging Strands
4.3.2. Cytokinesis
5.3.3. Practice 1
4.3.3. Ploidy & C-value coefficients
5.3.4. Practice 2
4.3.4. Practice 1
5.3.5. Example: Complete the Replication Bubble
4.3.5. Practice 2
4.3.6. Practice 3 5.4. Telomerase

4.3.7. Practice 4 5.4.1. Telomerase

5.4.2. Practice 1 6.2.5. Practice 1

5.4.3. Practice 2 6.2.6. Practice 2
5.5. Types of DNA Mutations 6.2.7. Practice 3
5.5.1. Types of DNA Mutations 6.2.8. Practice 4
5.5.2. Practice 1 6.2.9. Summary of Genes and mRNA
5.5.3. Practice 2 6.3. Prokaryotic Transcription
5.5.4. Sources of Mutation: Tautomeric Shifts 6.3.1. Initiation
5.5.5. Example: Tautomeric Shifts 6.3.2. Elongation
5.5.6. Sources of Mutation: DNA Slippage 6.3.3. Termination
5.5.7. Sources of Mutation: Copy Number 6.3.4. Practice 1
Variations 6.3.5. Practice 2
5.5.8. Sources of Mutation: Mobile Elements 6.3.6. Practice 3
5.6. Repair of DNA Mutations 6.4. Eukaryotic Transcription
5.6.1. Repair of Mutations During Replication 6.4.1. Transcription In Eukaryotes
[Exonuclease Activity and Mismatch Repair] 6.4.2. Practice 1
5.6.2. Repair of Mutations by Mutagens
6.5. RNA Maturation in Eukaryotes
[Nucleotide Excision Repair]
6.5.1. RNA Maturation in Eukaryotes
5.6.3. Practice 1
6.5.2. Example
5.7. Repair of Double Stranded DNA Breaks
6.5.3. Practice 1
5.7.1. Repair of DNA Double Stranded Breaks
6.5.4. Practice 2
[detailed]
6.5.5. mRNA Maturation - Theory
5.7.2. Practice 1
6.6. Translation into Proteins
Chapter 6. Gene to Protein 6.6.1. Translation into Proteins
6.1. The Central Dogma of Biology 6.6.2. Differences in Eukaryotic and Prokaryotic
6.1.1. The Central Dogma of Biology Translation
6.1.2. Practice 1 6.6.3. Example 1
6.1.3. Practice 2 6.6.4. Example 2
6.1.4. Practice 3 6.6.5. Transcription vs. Translation Chart
6.2. Genes and mRNA 6.6.6. Practice 1
6.2.1. Genes and mRNA 6.6.7. Practice 2
6.2.2. General Structure of mRNA
Chapter 7. Plant Cells and
6.2.3. The Genetic Code
Photosynthesis
6.2.4. Reading Frame

7.1. Plant Structures for Photosynthesis 8.1. Plant Characteristics

7.1.1. Plant Structures for Photosynthesis 8.1.1. Plant Characteristics
7.1.2. Practice 1 8.1.2. Practice
7.1.3. Practice 2 8.2. Plant Tissues
7.2. Photosynthesis: Light and Dark Reactions 8.2.1. Plant Tissues
7.2.1. Photosynthesis [short] 8.2.2. Practice
7.2.2. Practice 1 8.2.3. Practice
7.2.3. Practice 2 8.2.4. Practice
7.3. Light-Dependent Reactions of 8.3. Plant Tissue Systems and Organs
Photosynthesis [detailed] 8.3.1. Plant Tissue Systems
7.3.1. Light-Dependent Reactions of 8.3.2. Plant Organs
Photosynthesis [detailed] 8.3.3. Practice
7.3.2. Non-Cyclic and Cyclic Versions of Light- 8.3.4. Practice
Dependent Reactions
8.4. Reproduction
7.3.3. Practice 1
8.4.1. Angiosperm Reproduction
7.3.4. Practice 2
8.4.2. Advantages of Angiosperm Reproduction
7.4. Calvin Cycle [Carbon Fixation]
8.4.3. Angiosperm Pollination
7.4.1. Calvin Cycle [Carbon Fixation]
8.4.4. Practice
7.4.2. Example
8.4.5. Practice
7.4.3. Practice 1
8.4.6. Practice
7.4.4. Practice 2
8.4.7. Practice
7.5. Photorespiration
7.5.1. Photorespiration
Chapter 9. Plant Nutrition and
7.5.2. Practice 1 Transport Processes
7.6. C4 Plants 9.1. Water Transport
7.6.1. C4 Plants 9.1.1. Water Transport
7.6.2. Practice 1 9.1.2. Practice
9.1.3. Practice
7.7. CAM Plants
7.7.1. CAM Plants Chapter 10. DNA Technology
7.7.2. Practice 1 10.1. In Vitro DNA Replication: Polymerase
Chain Reaction (PCR)
Chapter 8. Plant Form, Function,
10.1.1. Polymerase Chain Reaction (PCR)
Growth, and Development
10.1.2. Primer Design

10.1.3. Example 1 11.5. Coupled Reactions

10.1.4. Practice 1 11.5.1. Coupled Reactions
10.1.5. Practice 2 11.5.2. Example
10.2. Agarose Gel Electrophoresis 11.5.3. Practice 1
10.2.1. (Agarose) Gel Electrophoresis 11.5.4. Practice 2

10.3. Gene Cloning 11.6. ATP Energy and the Proton Motive Force
10.3.1. Gene Cloning (PMF)
11.6.1. ATP and the Proton Motive Force (PMF)
Chapter 11. Metabolism and 11.6.2. Example
Enzymes 11.6.3. Practice
11.1. Overview of Metabolism 11.7. Enzymes
11.1.1. Overview of Metabolism 11.7.1. Enzymes
11.1.2. Nutrients Required by Cells 11.7.2. Enzyme Activity
11.1.3. Practice 1 11.7.3. Example
11.1.4. Practice 2 11.7.4. Practice
11.1.5. Practice 3 11.8. Enzyme Regulation
11.2. Redox Reactions 11.8.1. Enzyme Regulation
11.2.1. Redox (Reduction-Oxidation) Reactions 11.8.2. Feedback Inhibition
11.2.2. Practice 1 11.8.3. Example 1
11.2.3. Practice 2 11.8.4. Example 2
11.3. Laws of Thermodynamics 11.8.5. Practice 1
11.3.1. The Laws of Thermodynamics
Chapter 12. Cellular Respiration
11.3.2. Example
12.1. Overview of Cellular Respiration
11.3.3. Practice
12.1.1. Overview of Cellular Respiration
11.4. Types of Energy [Potential, Kinetic, Free
12.2. Glycolysis
& Activation]
12.2.1. Glycolysis
11.4.1. Potential and Kinetic Energies
12.2.2. Practice 1
11.4.2. Practice 1
12.2.3. Practice 2
11.4.3. Energy in Reactions
12.2.4. Practice 3
11.4.4. Example 1
11.4.5. Activation Energy 12.3. Energy of Glucose Metabolism
11.4.6. Gibbs Free Energy 12.3.1. Energy of Glucose Metabolism
11.4.7. Practice 2 12.3.2. Practice 1

12.4. Glycolysis Regulation 13.1. Overview of Animals

12.4.1. Glycolysis Regulation 13.1.1. Overview of Animal Structure
12.4.2. Practice 1 13.1.2. Animal Reproduction and Development
12.4.3. Practice 2 13.1.3. Practice
12.5. Glycolysis: Important Takeaways 13.1.4. Cell Structure and Specialization
12.5.1. Glycolysis Full Sequence of Reactions 13.1.5. Practice
and Summary [detailed] 13.1.6. Practice
12.6. Pyruvate Processing [Oxidation] 13.1.7. Practice
12.6.1. Pyruvate Processing 13.2. Overview of Animal Physiology
12.6.2. Practice 1 13.2.1. Overview of Animal Physiology
12.6.3. New Practice Question 13.2.2. Practice
12.6.4. Stage 2: Pyruvate Processing 13.3. Animal Tissue Types
12.7. The TCA [Citric Acid / Krebs] Cycle 13.3.1. Animal Tissue Types
12.7.1. The Citric Acid Cycle 13.3.2. Practice
12.7.2. Practice 1 13.3.3. Practice
12.7.3. Practice 2 13.4. Animal Body Cavities
12.7.4. Practice 3 13.4.1. Animal Body Cavities
12.8. Utilization of TCA [Citric Acid / Krebs] 13.4.2. Practice
Cycle Intermediates
Chapter 14. Animal Homeostasis
12.8.1. Utilization of TCA Intermediates
and Thermoregulation
12.9. The Electron Transport Chain
12.9.1. Electron Transport Chain Overview 14.1. Thermoregulation

12.9.2. Example 14.1.1. Thermoregulation

12.9.3. Practice 1 14.1.2. Practice

14.1.3. Practice
12.9.4. Practice 2
12.10. Fermentation Chapter 15. Animal Osmoregulation
12.10.1. Fermentation and Excretion
12.10.2. Practice 1 15.1. Osmoregulation
12.10.3. Practice 2 15.1.1. Osmoregulation
12.10.4. Practice 3 15.1.2. Practice
Chapter 13. Animal Form and 15.1.3. Practice

Function

Chapter 16. Animal Nutrition and Chapter 17. Animal Gas Exchange
Digestion and Circulation
16.1. The human digestive system 17.1. Respiration
16.1.1. The mouth & Esophagus 17.1.1. Respiration
16.1.2. The Stomach 17.1.2. Practice
16.1.3. The Small Intestine 17.1.3. Practice
16.1.4. The Large Intestine 17.2. Circulation
16.1.5. Practice Problem 1 17.2.1. Circulation
16.1.6. Practice problem 2 17.2.2. Practice
16.2. Digestion in other organisms 17.2.3. Practice
16.2.1. Digestion in Birds 17.2.4. Practice
16.2.2. Digestion in Insects

I. Welcome
I

Welcome to BISC 101!

Feel free to go through this resource at your own pace.

📃 on the left to skip to parts you need help with

● Use the table of contents

● Watch the video ▶ or read the written lessons 📖

● Speed up ⏩ or slow down ⏪ the videos

● Use the "Ask a question"❓ feature below each lesson/question any time!

This resource includes the following activities:

●
Theory lessons: I will explain and summarize new concepts

●
Examples: I will walk you through how to solve problems involving these new concepts

●
Practice questions: These are for you to try out on your own. Don't worry, if you get stuck,
you can watch the video solutions or read the suggested written answers

Let's get started! 🚀

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=94717&activity_type=CourseLesson

1. Molecules of Life
1.1 Types of Bonds and Intermolecular
Forces
1.1.1

Types of Chemical Bonds

Elements (atoms) can bond to other elements of the periodic table to form molecules by donating,
accepting or sharing electrons. This helps the individual elements to become more stable. Different
types of bonds are found in this lesson.

What determines bond type?

● Elements all have inherent properties; one important property is electronegativity.

● Electronegativity can be thought of as "how much an element wants to hold on to electrons."
○ Values for electronegativity can be found in the period table.
● When two elements combine to form a molecule, whether one atom steals the electron from the
other, or whether the electrons are shared (almost) equally, depends on the electronegativity of
each element.

Photo adapted from DMacks / CC BY

Covalent Bonds

● Electrons are shared between two atoms with similar electronegativities.

Example: Water (H2O) results from the covalent bonding of 2 hydrogen (H) atoms to one oxygen
(O) atom.
● They are more common and stronger than ionic bonds.

Photo by CNX OpenStax / CC BY

Ionic Bonds

● One element gains an electron and the other loses an electron to the other.
● Each element becomes an ion (charged).
Example: Sodium chloride (table salt!) is made from the ionic bonding of sodium (Na) to chlorine
(Cl). Because Cl is much more electronegative than Na, it steals one of its electrons. This causes
both of the atoms to become ions (Na+ and Cl-), where the positive (+) charge indicates that Na
has one less electron than it normally has, and the negative (-) charge indicates that Cl has one
more electron than it normally has.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (4:38)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68300&activity_type=CourseLesson

1.1.2

Practice: Ionic Bonding

Ionic Bonding occurs:

A) When electrons are shared between two atoms

B) When an electron is taken from one atom and given to another

C) When closely packed positive metal ions form a strong interaction with a delocalized “sea of
electrons.”

D) There is a dipole moment

View Solutions on Wizeprep.com

Solutions to these questions, as well as step-by-step breakdowns of the answers at:
https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=106572&activity_type=QuizQuestion

1.1.3

Practice: Types of Intramolecular Bonds

What type of bonding would be expected in the following compounds?

Part 1
Table salt (NaCl)

A) Ionic bonding

B) Polar covalent bond

C) Non-polar covalent bond

D) Metallic bond

Practice: Types of Intramolecular Bonds

What type of bonding would be expected in the following compounds?

Part 2
Water (H2O)

A) Ionic bonding

B) Polar covalent bond

C) Non-polar covalent bond

D) Metallic bond

Practice: Types of Intramolecular Bonds

What type of bonding would be expected in the following compounds?

Part 3
Nitrogen (N2)

A) Ionic bonding

B) Polar covalent bond

C) Non-polar covalent bond

D) Metallic bond

View Solutions on Wizeprep.com

1.2 Intermolecular Forces: Hydrogen Bond

1.2.1

Intermolecular Forces: Hydrogen Bonding

Other than forming actual bonds between atoms, molecules can also interact with one another. The
main types of these intermolecular forces are as follows.

● Involves a H atom that is covalently bonded to a highly electronegative atom (F, O, N) causing
it to be partially stripped of its electrons by that atom.

● This causes a transient attractive interaction to form between the partially positive H with
another partially negative (electronegative) atom.
Example: water (two Hs bound to one O) loves to interact with other water molecules in that
way.

*Breaking bonds requires energy, forming bonds creates energy.

Watch the video tutorial for this lesson (5:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68169&activity_type=CourseLesson

1.2.2

Example: Strength of Bonds and Forces

What are the types of bonds or forces represented by A and B? Which is the strongest?

Photo adapted from OpenStax College / CC BY

Solution available online

Watch the video tutorial for this lesson (2:03)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68194&activity_type=CourseLesson

1.2.3

Practice: Hydrogen Bonding

Which of the following is not capable of hydrogen bonding?

A. Water

B. CH3COOH

C. CH3

D. NH3

View Solutions on Wizeprep.com

1.2.4

Practice: Ionic Bonds

Which of the following is true about ionic bonds?

A. The electrons are shared equally between atoms

B. Most biologically-relevant molecules have ionic bonds

C. Hydrogen bonding does not commonly occur between molecules with ionic bonds

D. Water is a great example of this type of bond

E. They are much stronger than covalent bonds

View Solutions on Wizeprep.com

1.2.5

Practice: Hydrogen Bonding

Which of the circled atoms below could form hydrogen bonds with water? Select all that apply.

none

View Solutions on Wizeprep.com

1.3 Intermolecular Forces: Van der Waals

Interactions
1.3.1

Intermolecular Forces: Van der Waals Interactions

Van der Waals interactions is a general term given to the interaction between partial positive and
partial negative regions of different molecules. These are relatively weak forces and there are a few
different types.

Permanent Dipole - Permanent Dipole (PD-PD)

When a molecule has a polar covalent bond it is said that the molecule has a permanent dipole.

● When two elements with different electronegativities form a covalent bond, this bond will be
polar.

● This causes the atoms sharing the electrons to have partial charges because one is "pulling the
electrons to itself" a little more.

● When two such molecules come close together, an attraction between those partial charges
occurs.

Example: The bond between hydrogen (H) and chlorine (Cl) is polar because chlorine has higher
electronegativity than hydrogen. This means that when bound, Cl has a partial negative charge,
and H has a partial positive charge. The opposing partial charges on these molecules can
interact with one another. This is a PD-PD interaction.

Permanent Dipole - Induced Dipole (PD-ID)

● When a permanent dipole is in close proximity to a molecule without any polar bonds, it is
possible for the permanent dipole to induce a dipole across the non-polar covalent bond in the
other molecule.

Example: For example, the O-H bond in water is polar, therefore, it has a permanent dipole.
When water approaches a molecule with a non-polar C-H bond, the partially charged oxygen
atom can induce a dipole to form on this C-H bond. This is called a PD-ID interaction.

● PD-ID interactions are weaker than PD-PD interactions.

Induced Dipole - Induced Dipole (ID-ID)

Also known as London Dispersion Forces, it occurs between two molecules with non-polar bonds.

● Since electrons fluctuate, temporary asymmetrical distributions of electrons can generate

partial charges on the atoms involved in the non-polar covalent bond.

● This is the weakest intermolecular interaction.

● The molecule with the partial charge can induce a dipole on its neighbor.

Example: The bond between two chlorine atoms is non-polar since they have the exact same
electronegativity. However, one of the two chlorines may become temporarily partially charged,
affecting the Cl2 molecule next to it. This temporary attractive force is the ID-ID interaction.

Strength Comparison

Watch the video tutorial for this lesson (11:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68832&activity_type=CourseLesson

1.3.2

Practice: Non-Covalent Interactions

What is the strongest type of non-covalent interaction that could form between the two molecules
below?

A) Ionic

B) Ion - PD

C) PD - PD

D) PD - ID

E) ID - ID

View Solutions on Wizeprep.com

1.3.3

Practice: Strength of Van Der Waals

Which molecule has the strongest van der Waals forces?

View Solutions on Wizeprep.com

1.4 Properties of Water and Carbon

1.4.1 Important Elements that Make Up Life

Important Elements that Make Up Life

The main elements that make up living organisms are carbon (C), hydrogen (H), oxygen (O),
phosphorous (P), sulphur (S), and nitrogen (N) in addition to a few ions and trace elements (e.g.
magnesium (Mg), manganese (Mn), iron (Fe)).

Carbon

When differentiating organic versus inorganic chemistry, we often refer to organic chemistry as that
involving carbon-based molecules. Some of carbon's unique properties are:

● Can bind to 4 other atoms (often hydrogen).

○ When it is bound to 4 atoms, the molecule forms a tetrahedral shape.

● Can bind to other carbon atoms to form chains (polymers).

● Can form various different bond types (i.e. single, double, triple).

● Carbon-Hydrogen (C-H) bonds are non-polar, where electrons are shared equally because
carbon and hydrogen have similar electronegativities.

Photo by Rice University / CC BY

Watch the video tutorial for this lesson (4:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68168&activity_type=CourseLesson

1.4.2 Unique Properties of Water

Unique Properties of Water

Water is the solvent of life. Naturally, our cells are mainly composed of water. Some of its special
properties are:

1. Polar molecule (uneven distribution of electrons).

2. Oxygen is electronegative
a. It pulls electrons to itself in its covalent bond with hydrogen having a partial negative
charge;
b. This uneven distribution of electrons creates a dipole.

3. Water molecules can interact with each other via hydrogen bonding (aka H-bonds). Due to
H-bonds:
a. Water molecules are cohesive;
b. Water has a high heat capacity and boiling point;
c. Water will associate with other uncharged molecules that have polar covalent bonds and/or
full charges on ions.

Photo by Rice University / CC BY

4. Solid less dense than liquid

a. Water assumes a lattice structure when solid;
b. This orderly arrangement allows for spaces between molecules;
c. Ice is 10% less dense than water.

Photo by P99am / CC BY

5. "Universal solvent"
a. Water can surround polar or charged molecules to dissolve them.
Example: in water, NaCl is broken into Na+ and Cl- ions, with water's negative partial
charge surrounding the Na+, and positive partial charge surrounding the Cl-.
b. Substances that easily dissolve in water are hydrophilic: water loving.
c. Substances that do not dissolve well in water are hydrophobic.

Watch the video tutorial for this lesson (6:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68581&activity_type=CourseLesson

1.4.3

What makes carbon an important element?

A. Carbon has 6 valence electrons

B. Carbons make the skeleton backbone of many organic compounds

C. Carbon can form up to 4 single bonds

D. Carbon is an important functional group

View Solutions on Wizeprep.com

1.4.4

What are 3 properties of water that make it unique as a life-bearing molecule?

View Solutions on Wizeprep.com

1.5 From Monomers to Polymers

1.5.1

From Monomers to Polymers

There are four types of major macromolecules in a cell:

1. Proteins
2. Nucleic Acids
3. Polysaccharides
4. Lipids

Macromolecules are made out of smaller units:

● Macromolecules are polymers, which are molecules made out of two or more repeating building
blocks called monomers.

How are monomers joined together to form polymers?

● Monomers are linked together by a type of reaction called a dehydration or condensation

reaction.

● In this type of reaction, a water molecule is lost and a bond is formed between the two
monomers.
● The type of bond that forms between the monomers is different depending on the types of
molecules involved, but the type of reaction that forms the bond is always a dehydration /
condensation reaction.

How are polymers broken apart?

● Polymers are broken back down into their monomers by the opposite type of reaction, called a
hydrolysis reaction.
● A hydrolysis reaction involves adding a water molecule in order to break the bond between the
monomers.
● The monomers can then be recycled to form new polymers.

Watch the video tutorial for this lesson (3:47)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68582&activity_type=CourseLesson

1.5.2

Practice: Polymer Breakdown

What type of reaction breaks down polymers?

Answer

View Solutions on Wizeprep.com

1.5.3

Practice: Water Molecules

Water molecules:

i. Are large ionic molecules

ii. Are small polar molecules
iii. Are polar and therefore have difficulty entering a cell
iv. Are removed during the synthesis of polymers
v. Are able to enter the cell using aquaporin channels

i, iii, iv

ii, iv, v

i, v

i, iv, v

View Solutions on Wizeprep.com

1.5.4

Practice: Protein Formation

Proteins are formed in the cells of our body through what reaction?

A) Hydrolysis

B) Proteinase Replication

C) Hydrogenation

D) Condensation Polymerization

E) DNA replication

View Solutions on Wizeprep.com

1.6 Proteins

1.6.1

Proteins
The monomers of proteins are called amino acids. Amino acids have a conserved structure consisting
of three main parts:

1. An amino group
2. A carboxyl group
3. An "R group"

● There are 20 different "R groups" that can be attached to the amino acid.

○ This diversity in possible R-groups is what leads to the diverse array of proteins within a
cell, each with its own particular structure and function.

● Interactions between R-groups give proteins their overall 3-dimensional structure.

● Different R-groups have different biochemical properties:

○ Some are hydrophobic;
○ Others are positively charged;
○ Or negatively charged;
○ Some are "special cases."

Photo by Dan Cojocari / CC BY

Reactions Between Amino Acids

● Amino acids are joined together by a dehydration / condensation reaction in order to form a
peptide bond.

● The peptide bond forms between the carboxyl group of one amino acid and the amino group of
the other amino acid.

● Once amino acids are joined together into a long chain, a repeating backbone of N-C-C atoms
forms. Each individual "N-C-C" is one amino acid in the chain.

● The amino group of the first amino acid in the chain is on one end, while the carboxyl group of
the last amino acid is on the other end of the chain.

○ The end with the amino group is called the N-terminus, while the end with the carboxyl
group is called the C-terminus.

Watch the video tutorial for this lesson (6:18)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68583&activity_type=CourseLesson

1.6.2

The Four Levels of Protein Structure

● Primary Structure: the sequence of amino acids.

● Secondary Structure: hydrogen bonding between backbone atoms, leading to the formation of
alpha-helices or beta-sheets.

● Tertiary Structure: interactions between R groups (e.g. hydrogen bonds, Van der Waals
interactions).

● Quaternary Structure: interactions between two or more fully folded proteins.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (3:34)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69490&activity_type=CourseLesson

1.6.3

Functions of Proteins
Proteins are the products of what's encoded in our DNA and cells produce proteins to carry out
functions. Some of the functions of proteins are:

1. Enzymes - catalyze (increase the speed of) reactions.

Example: breakdown of lactose during digestion is carried out by the enzyme lactase.

2. Transportation - proteins can shuttle things around/in/out of the cell.

Example: ion channels allow for electrolytes to enter and leave cells.

3. Support - maintaining cell structure.

Example: cytoskeleton of cells.

4. Signaling - communication between different parts of the cell or the entire body.
Example: insulin is a short protein (peptide) hormone that facilitates glucose entry into certain
cells.

5. Movement - movement of things in the cell or movement of the cell itself (e.g. cilia or flagella).
Example: the airways keep themselves clean from pollution by moving cilia.

6. Defense - proteins that are active in the immune system.

Example: antibodies are proteins.

WIZE CONCEPT

STRUCTURE DETERMINES FUNCTION. In order for proteins to function properly they need to
maintain their structure.

Protein Folding

Some proteins need to assume a specific shape in order to be functional and carry out their roles
properly.

● This shape is dictated by the sequence of amino acids and the chemical interactions between
their side groups, resulting in secondary, tertiary or quaternary structures.

● Protein folding can occur naturally as proteins are produced in the cell or they may require
assistance from other proteins called chaperones.
Example: antibodies fold in a such a way that pockets form where antigens can fit in and bind.

Photo by OpenStax College / CC BY

Denaturation

Maintenance of protein structure is essential for function.

● When proteins lose their natural shape they are said to be denatured.

● Note that in this case the actual protein sequence does not change.

● Proteins can be denatured by:

○ Changes in pH

○ High temperatures
○ Chemicals

Watch the video tutorial for this lesson (6:42)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68590&activity_type=CourseLesson

1.6.4

Example: Absence of Amino Acids

You are growing bacterial culture in a petri dish under conditions where all nutrients are available for
growth except for glycine.

a) What macromolecule would be the most affected by these conditions?

Solution available online

b) What process within the cell is affected?

Solution available online

Watch the video tutorial for this lesson (1:17)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68585&activity_type=CourseLesson

1.6.5

Practice: Protein Structure and Bonding

What kinds of chemical bonds form during protein synthesis in its primary structure, secondary
structure, tertiary structure, and quaternary structure?

A) Primary Structure (covalent bonds, hydrogen bonds, or non-covalent bonds)

B) Secondary Structure (covalent bonds, hydrogen bonds, or non-covalent bonds)

C) Tertiary Structure (covalent bonds, hydrogen bonds, or non-covalent bonds)

D) Quaternary Structure (covalent bonds, hydrogen bonds, or non-covalent bonds)

View Solutions on Wizeprep.com

1.6.6

Practice: Building Blocks of Proteins

The building blocks of proteins are composed of which of the following?

A) An amino group, a hydroxyl group, and an R group

B) A hydroxyl group, an R group, and a sugar

C) A phosphate, a carboxyl group, and an amino group

D) An R group, a carboxyl group, and an amino group

E) An amino group, a nitrogenous base, and a hydroxyl group

View Solutions on Wizeprep.com

1.6.7

Practice: Beta Sheet

A beta sheet is an example of what?

A) Protein primary structure

B) Protein secondary structure

C) Protein tertiary structure

D) Protein quaternary structure

View Solutions on Wizeprep.com

1.6.8

Practice: Protein 3D Folding

Which of the following dictates the 3D protein folding structure?

A) The pH of the surrounding environment

B) The temperature of the surrounding environment

C) The location of polar/ nonpolar amino acid residues on the primary chain structure

D) The location of hydrophobic/ hydrophilic amino acid residues on the primary chain structure

E) All of the above

View Solutions on Wizeprep.com

1.7 Carbohydrates

1.7.1

Carbohydrates (Sugars)
Sugars are essential for life and energy in the human body. They receive their name for being
hydrates (meaning, containing water molecules) of carbon; as such, their general formula is (CH2O)n.

● Can be simple sugars (monosaccharides), disaccharides, or polysaccharides.

○ A disaccharide is two monosaccharides joined together;
○ A polysaccharide is many monosaccharides joined together.

Structure of Monosaccharides

These are simple sugars made of 3-7 carbons with functional groups. Their general structure is as
follows:

1. Carbon chain or ring

2. Functional groups off the side:

a. Hydroxyl (OH)
b. Carbonyl (C = O)
i. At end of chain: aldehyde
ii. In the middle of chain: ketone
Example: glucose (C6H12O6)

Photo by Rice University / CC BY

● Sometimes monosaccharides have the same chemical formula, but their functional groups are
located in different places. We call all of these monosaccharides with the same formula isomers.

○ Structural isomers have functional groups located on different carbons.

Example: glucose vs fructose.

○ Stereoisomers have functional groups are on the same carbon but different arrangements.
Example: glucose vs galactose.

● Monosaccharides can be found as straight lines (linear) or rings.

Photo CNX OpenStax / CC BY

Disaccharides

● Monosaccharides are joined together by a dehydration or condensation reaction to form a

glycosidic linkage.

● Common disaccharides include lactose (milk), and sucrose (table sugar).

Photo by Rice University / CC BY

Watch the video tutorial for this lesson (5:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68586&activity_type=CourseLesson

1.7.2

Polysaccharides
● Oligosaccharides: multiple monosaccharides attached together (3-10).
● Polysaccharides: more than 10 monosaccharides attached together.
● Examples of polysaccharides include: starch, glycogen, cellulose and chitin.
● Polysaccharides can have structural roles (cellulose and chitin), or they may be used for energy
storage (starch and glycogen).

Storage Polysaccharides

● Starch – main sugar storage of plants and some algae (helical shape).
○ Amylose: linear glucose polymer with glycosidic linkages
○ Amylopectin: amylose with additional branches every 24-30 carbons

● Glycogen – main sugar storage of animals.

○ Similar structure to amylopectin (branched).

Photo by Rice University / CC BY

Structural Polysaccharides

● Cellulose – main component of plant cell walls.

○ Most abundant polysaccharide in nature.
○ Glucose molecules linked together like in starch, but it uses a different isomer of glucose.
○ Cellulase is the enzyme needed to break down cellulose, which very few organisms have;
confers strong layer of protection to plant cells.

Photo by Rice University / CC BY

● Chitin – found in cell walls of fungi and in some animal exoskeletons.

○ Doesn't use glucose, but instead uses the monomer acetylglucosamine.

Photo by Rice University/ CC BY

Watch the video tutorial for this lesson (5:35)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68589&activity_type=CourseLesson

1.7.3

Practice: Amylose
Which of the following is NOT true about amylose?

A) It is a branched polysaccharide

B) It is a type of starch

C) It has a similar overall structure to cellulose, but it uses a different monosaccharide isomer

D) It is made using glucose monomers

View Solutions on Wizeprep.com

1.7.4

Practice: Monosaccharide Functional Groups

Which of the following could be a monosaccharide functional group?

A) Carbonyl

B) Aldehyde

C) Ketone

D) All of the above

E) None of the above

View Solutions on Wizeprep.com

1.7.5

Practice: Glycosidic Linkages

Which of the following sugars contains a glycosidic linkage?

A) Maltose

B) Fructose

C) Galactose

D) Linear glucose

View Solutions on Wizeprep.com

1.8 Lipids

1.8.1

Lipids
Lipids are important biological components with a variety of roles. They can be used as structural
components, as energy storage ("burning fat"), or even as part of signaling molecules (hormones).
There are three main types of lipids we will discuss:

1. Fats and Oils (Triglycerides)

2. Phospholipids
3. Steroids

Structure of Fats

● There is more diversity in the overall structure of lipids compared to the other three major types
of macromolecules.
● The lipid group of macromolecules instead share a common biochemical property: they are all
hydrophobic.
● The main component of fats are fatty acids and glycerol.
○ They are joined together by a dehydration or condensation reaction to form an ester
linkage.
○ The main function of triglycerides (or triacylglycerides) is energy storage.

Photo by Rice University / CC BY

Fatty Acids

They are composed of:

1. Carboxyl head - polar part of the molecule (hydrophilic).

2. Hydrocarbon tail - non-polar part of the molecule (hydrophobic). Usually 16 to 18 carbons
long. Tails can be:

a. Saturated - all single bonds between carbons: straight string of carbons.

i. More commonly made in animals and solid at room temperature.
Examples: bacon fat, coconut oil.

b. Unsaturated - one or more double bonds between carbons.

i. More commonly made in plants and liquid at room temperature.
Examples: canola oil or olive oil.
ii. Cis or trans configuration around the double bond. If cis, the tails have a kink (not
straight).

Photo by OpenStax College / CC BY

WIZE TIP

To remember this type of lipid, just

think of a chubby cat named Lily.

Watch the video tutorial for this lesson (9:48)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68587&activity_type=CourseLesson

1.8.2

Phospholipids
These are also called membrane lipids as they are found in cell membranes. Phospholipids have a
phosphate head group (polar) that confers them special characteristics.

● They are amphipathic: has both hydrophobic

and hydrophilic parts.
○ Hydrophobic tail: fatty acid with carbon tail
○ Hydrophilic head: glycerol plus phosphate

● They naturally form membranes in water that

"protect" their hydrophobic parts.

Photo by OpenStax / CC BY

Types of Phospholipid Membranes

1. Sphere or liposome
2. Micelle
3. Bilayer sheet

Photo by Rice University / CC

Watch the video tutorial for this lesson (5:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68609&activity_type=CourseLesson

1.8.3

Steroids
Steroids are important components of membranes and make up important molecules with key
physiologic functions.

● Their structure is composed of four fused carbon

rings.

● They are rigid and planar due to this chemistry.

Examples: Cholesterol is a steroid found in
membranes. Estrogen and testosterone are derived
from cholesterol and function as hormones.

Cholesterol

● Important component of animal cell membranes.

● Prevents extremes in membrane fluidity, acting as a buffer.
○ Stabilizes at high temperatures by restraining phospholipids;
○ Maintains fluidity at low temperature by preventing clustering.

Watch the video tutorial for this lesson (3:17)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68610&activity_type=CourseLesson

1.8.4 Example

Example: Lipids in Water

In an aqueous solution, phospholipids form either micelles, or lipid bilayers. Sketch these structures in
the space below (label the hydrophobic tails and polar heads, as well as the intracellular/extracellular
environments). What is the reasoning for the formation of these structures and what interactions are
present?

Solution available online

Watch the video tutorial for this lesson (2:54)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68638&activity_type=CourseLesson

1.8.5

Practice: Macromolecule Building Blocks

A fat (triacylglycerol) could be formed as a result of a dehydration reaction between:

A. One molecule of 9 and three molecules of 10

B. Three molecules of 9 and one molecule of 10

C. One molecule of 5 and three molecules of 9

D. Three molecules of 5 and one molecules of 9

E. One molecule of 5 and three molecules of 10

View Solutions on Wizeprep.com

1.8.6

Practice: Fatty Acids

Which statement about fatty acids is false?

A) Fatty acids can be saturated (with double bonds) or unsaturated (no double bonds)

B) Double bonds within the fatty acid chain can either hold a cis conformation or a trans
conformation

C) The longer the carbon chain, the higher the melting point of the fatty acid

D) The fewer the double bonds in the carbon chain the higher the melting point of the fatty acid

E) None of the above

View Solutions on Wizeprep.com

1.8.7

Practice: Cholesterol
Which statement is FALSE about cholesterol?

A) Cholesterol is amphipathic, allowing it to interact with both the exterior of the membrane and the
interior

B) Cholesterol is a precursor to all steroid hormones

C) The four ring structure provides cholesterol with rigidity and aids in modulating membrane fluidity

D) Cholesterol affects the packing of lipids in the membrane

E) None of the above

View Solutions on Wizeprep.com

1.8.8

Practice: Liposomes
Which of the following best describes a liposome?

A) A micelle of phosphoglycerides

B) A micelle of sphingolipids

C) Three fatty acids chains linked to a glycerol head group

D) Sphere of lipid bilayer enclosing an aqueous compartment

E) A glycolipid

View Solutions on Wizeprep.com

1.9 Nucleic Acids

1.9.1

Nucleic Acids
Nucleic acids are what constitutes our genetic code. The monomers of nucleic acids, which includes
both DNA and RNA, are called nucleotides. Nucleotides have three key ingredients:

1. Phosphate
2. Sugar
3. Base

Photo by OpenStax / CC BY

Difference Between RNA and DNA

DNA and RNA nucleotides differ in the structure of the sugar group.

● The nucleotide shown above would be found in DNA.

● In RNA, there are two -OH groups attached to the sugar

molecule while in DNA there is only one (this is why it is
called "deoxyribonucleic acid", because one oxygen has
been removed).

Diversity of Nucleotides

● There are five possible nitrogenous bases that may be attached to a nucleotide.

● These nitrogenous bases can be divided into two groups: purines and pyrimidines:

○ Purines have a two-ring structure, while pyrimidines are composed of just one ring.

○ Adenine, Guanine, Cytosine, and Thymine can be found in DNA (A,G,C,T).

○ Adenine, Guanine, Cytosine, and Uracil can be found in RNA (A,G,C,U).

Photo by Blausen / CC BY

● Nucleotides are joined together to form long chains through a dehydration / condensation
reaction to form a phosphodiester bond between the phosphate group of one nucleotide and
the hydroxyl group on the sugar of another nucleotide.

○ When joined together, one end of the chain will have a free phosphate group, while the other
end of the chain will have a free carboxyl group.

○ The end with the free phosphate group is called the 5' end, because the phosphate is
attached to the 5' carbon of the sugar.

○ The end with the free carboxyl group is called the 3' end, because the carboxyl is attached to
the 3' carbon of the sugar.

Watch the video tutorial for this lesson (5:16)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68611&activity_type=CourseLesson

1.9.2

The DNA Double Helix

Two long strands of DNA come together to for the DNA double helix.

● The two strands are arranged to have their sugar and phosphate groups along the outside,
with their nitrogenous bases pointing inward.

● The nitrogenous bases of the two strands form hydrogen bonds with each other, holding the
two strands together.

● The strands will be arranged in a complementary and antiparallel fashion.

○ Complimentary means that A will always pair up with T, and C will always pair up with G.
In RNA, T is not present so A pairs up with U instead.

○ Two hydrogen bonds form between A and T base pairs, and three hydrogen bonds form
between C and G base pairs.

○ The strands are antiparallel, meaning that one strand will be running from the 5' end to the
3' end, while the strand it is paired up with will be running in the opposite direction.

Photo by OpenStax / CC BY

Watch the video tutorial for this lesson (4:51)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69492&activity_type=CourseLesson

1.9.3

Example: Growing Nucleic Acid Chain

In the synthesis of a nucleic acid polymer from nucleotide monomers, to which end of the growing
chain are monomers added?

Solution available online

Watch the video tutorial for this lesson (1:46)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68584&activity_type=CourseLesson

1.9.4

Practice: Bonds in DNA

Describe the kinds of chemical bonds that make up the DNA double-helix. (i.e. what bonds form in the
backbone, between bases).

A) What type of bond is formed in the backbone?

B) What type of bond is formed between the bases?

View Solutions on Wizeprep.com

1.9.5

Practice: Making Nucleic Acids

Which of the following combinations could be linked together to form a nucleotide?

A. 1, 2, and 11

B. 3, 7, and 8

C. 5, 9, and 10

D. 11, 12, and 13

E. 12, 14, and 15

View Solutions on Wizeprep.com

1.9.6

Practice: Macromolecular Bonds

Fill in the table below:

View Solutions on Wizeprep.com

1.9.7

Practice: Nucleic Acid Building Block

Which macromolecule does the molecule below belong to?

Answer

View Solutions on Wizeprep.com

2. Cell Structure and

Function
2.1 Prokaryotic Cells

2.1.1

Prokaryotic Cells
Prokaryotes are very primitive living organisms that came about before eukaryotes. Their key
characteristics are:

● No nucleus
● Mostly unicellular organisms
● They have no membrane bound organelles

General Structure of Prokaryotic Cells

● Ribosomes are organelles that are responsible for producing proteins.

● The prokaryotic DNA is not protected by a nuclear membrane and is found in the cytoplasm.

● The cytoskeleton are long polymer proteins that form thin fibers.

○ The cytoskeleton is responsible for: cell shape, cell division, transportation of plasmids,
organization of cell interior.

● Flagella are located on the surface of the cell and allow for bacteria to move.

● Cell walls surround the plasma membrane and function to protecting the organism, giving
shape and rigidity.

● Capsule enables cell attachment.

● Pili allows for exchange of genetic information with other bacteria.

● Fimbriae (not shown) can also be found and are used to attach to surfaces such as a cell the
bacteria might infect.

Watch the video tutorial for this lesson (5:25)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68648&activity_type=CourseLesson

2.1.2

Practice: Parts of Prokaryotes

Which of the following are part of a prokaryotic cell?

A) DNA and RNA

B) Nucleus

C) Cell wall

D) Ribosomes

View Solutions on Wizeprep.com

2.1.3

Bacteria and Archaea Cell Wall Composition

Bacteria

Bacteria are the most commonly discussed organisms when talking about prokaryotes.

● They are ubiquitous (can be found everywhere) and are smaller than eukaryotic cells.

● They have a cell wall composed of a large polymer called peptidoglycan, which is made up of
polysaccharides and amino acids.

● Bacterial membrane lipids have ester bonds.

Archaea

Archaea are another type of prokaryote.

● They are often extremophiles (live in extreme environments such as extremely high
temperatures, salt concentration, etc.).

● Their cells walls are composed of pseudo-peptidoglycan (different from bacterial

peptidoglycan).

● Their membrane lipids have ether bonds.

Watch the video tutorial for this lesson (4:12)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=72248&activity_type=CourseLesson

2.1.4

Practice: Function of Cell Wall

Which of the following are functions of the cell wall?

A) Protect the organism

B) Give shape to the organism

C) Help with movement

D) Provide rigidity to the organism

View Solutions on Wizeprep.com

2.1.5

Practice: Archaea and Bacteria

Label the following statements as true or false:

A. Only Archaea have plasma membranes that are lipid monolayers

B. One feature the differentiates Bacteria and Archaea is their shape
C. Bacteria have circular DNA, while Archaea have linear DNA
D. No Archaea are known to cause human disease.

D. Are actually correct in terms of. Says a model would have a resistor with. To.....

View Solutions on Wizeprep.com

2.2 Eukaryotic Cells

2.2.1

Eukaryotes
Eukaryotes are much more complex than prokaryotes. Some of its key characteristics are:

● Eukaryotic cells are 10-100x larger than prokaryotic cells.

● Basic cell structure is very complex:

○ Membranes found inside of the cells to hold organelles together: membrane bound
organelles.

● Eukaryotic cells are often built into multicellular organisms.

Example: Humans, any other animal/plant, fungi and protists.

Composition of an Animal Cell

Photo by Rice University / CC BY

Components of a Plant Cell

Photo by Rice University / CC BY

Roles of Different Organelles

● Ribosomes synthesize proteins.

● Endoplasmic Reticulum (ER) - sacs that are continuous with the nuclear envelope.
○ Rough ER:
■ Is "decorated" with ribosomes;
■ Interior is called the lumen: new proteins are processed here;
■ Ribosomes synthesize proteins in the rough ER that will later be exported elsewhere.

○ Smooth ER:
■ Lacks ribosomes;
■ Functions as a lipid-processing center.

● Nucleus contains chromosomes and is the genetic information storage and processing center
for eukaryotes.
○ The nucleus is surrounded by a double-membrane known as the nuclear envelope.
○ The nucleolus is where the ribosome is assembled.

● Golgi Apparatus: many flattened sacs called cisternae.

○ Sort and package proteins for transport;
○ Transportation of lipids.

● Cytosol: Aqueous fluid portion of cytoplasm.

Photo by BruceBlaus / CC BY

● Peroxisomes
○ Center for oxidation reactions.

● Lysosomes
○ In animal cells functions as a major digestive center;
○ Contains hydrolytic enzymes.

● Vacuoles
○ Takes up much of the volume of a plant cell;
○ Are also found in fungi, and certain other groups.

● Mitochondria
○ Powerhouse of the cell!
○ Has its own small chromosome that encodes its own genes and manufactures its own
ribosomes;
○ Contains the ATP required to build organelles.

● Chloroplast
○ Have a double membrane and contain their own DNA;
○ Perform photosynthesis.

Eukaryotes vs Prokaryotes

WIZE TIP

Instead of memorizing everything in the table, just memorize what BOTH the eukaryotes and
prokaryotes have. Everything else will be present in a eukaryote but not in a prokaryote.

Watch the video tutorial for this lesson (10:47)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68649&activity_type=CourseLesson

2.2.2

Practice: Prokaryotes vs Eukaryotes

Which of the following is the same about prokaryotes and eukaryotes?

A) They both have a membrane-bound nucleus

B) They can both possibly have cell walls

C) They are both often the basic building block of multicellular organisms

D) They both have ERs

View Solutions on Wizeprep.com

2.2.3

Practice: DNA in Plant Cells

Where is DNA found in a plant cell?

A) Ribosomes

B) Nucleus

C) Peroxisome

D) Mitochondria

E) Chloroplast

F) Plasma membranes

View Solutions on Wizeprep.com

2.2.4

Plant versus Animal Cells

Both plant and animal cells are eukaryotic. However, they have some key differences:

1. Plant cells have chloroplasts, in addition to mitochondria.

a. They contain a green pigment called chlorophyll that captures light.

2. Plant cells have a cell wall:

a. Provides rigidity, shape and protection;
b. Composed of cellulose: a polysaccharide made up of glucose monomers.

3. Only animal cells have lysosomes.

a. This is where digestive processes occur;
b. The plant cell equivalent is the vacuole.

Photo by ethan davison / CC BY

Vacuoles

We have three main types of vacuoles:

1. Central vacuole
2. Food vacuole
3. Contractile vacuole

Their different roles are:

● Central vacuole: large, occupies most of the volume of mature plant and many fungal cells.
○ Maintains proper pressure to support growing plants;
○ Performs hydrolytic functions, stores wastes, toxins etc.
● Food vacuoles: contain phagocytosed food.
● Contractile vacuoles: present only in protists/algae, expels water out of cell.

Photo by Rozzychan at English Wikibooks / CC BY

Watch the video tutorial for this lesson (3:03)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68692&activity_type=CourseLesson

2.3 Endosymbiont Theory

2.3.1

Endosymbiont Theory
The endosymbiont theory is an evolutionary theory that suggests several key organelles in
eukaryotes (such as mitochondria and chloroplasts) were taken inside another cell to function in the
host. It is believed that some prokaryotes were able to phagocytose ("eat") others. The prokaryotes
that were eaten up were able to continue living inside the phagocytic cell, giving rise to these
organelles.

Photo by Kelvinsong / CC BY

● Evidence supporting that mitochondria and chloroplast have prokaryotic origins:

○ Both organelles proliferate through a process similar to binary fission seen in prokaryotes;

○ Mitochondria and chloroplast have similar morphologies to bacteria and their genome/DNA is
in the form of a circular plasmid, much like bacteria, that can act independently of the
nuclear DNA found in the cell.

● Endosymbionts (organisms that live within the body or cell of another organism) are naturally
occurring in modern time.

Example: Mixotricha paradoxa is a protist living within the digestive tract of termites. It contains
endosymbiotic bacteria instead of mitochondria.

Watch the video tutorial for this lesson (5:18)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68686&activity_type=CourseLesson

2.3.2

Example: Mitochondria
Why are mitochondria thought to come from prokaryotic origin? Name 2 reasons.

Solution available online

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71895&activity_type=CourseLesson

2.3.3

Practice: Support of Endosymbiont Theory

Which of the following supports endosymbiont theory?

A) Mitochondria lack their own DNA

B) Ribosomes are completely different in prokaryotes and eukaryotes

C) Mitochondria are of similar size to bacteria

D) None of the above

View Solutions on Wizeprep.com

2.3.4

Practice: Origin of Mitochondria

According to the endosymbiont theory of the origin of eukaryotic cells, how did mitochondria
originate?

A) From the endoplasmic reticulum of the first eukaryotic cells

B) From an engulfed prokaryotic cell that was anaerobic

C) From an engulfed prokaryotic cell that lacked most of the DNA it needed to live on its own

D) From an engulfed prokaryotic cell that was an aerobic heterotroph

E) From an engulfed chloroplast that was modified to help oxidize glucose

View Solutions on Wizeprep.com

2.3.5

Practice: Endosymbiosis
Which of the following statements are correct regarding the evidence supporting the theory of
endosymbiosis?

A. The DNA found in mitochondria and chloroplasts share many sequence homologies with each
other.
B. The plasma membranes of chloroplasts and mitochondria has a lipid monolayer just like in Archaea.
C. The chromosomes in most mitochondria and chloroplasts is circular.
D. Mitochondria and chloroplast divide similarly to their proposed prokaryotic ancestors

View Solutions on Wizeprep.com

2.4 The Endomembrane System

2.4.1

The Endomembrane System

The endomembrane system is a group of membranes in eukaryotic cells which forms a network. The
different components of the endomembrane system work together by sharing membranes and/or
contents of organelles.

● Membrane-bound vesicles bud off of one component of the endomembrane system, and fuse
with others.
○ These vesicles transport proteins, other biomolecules, and membrane lipids.

● Transport through the endomembrane system is highly regulated. Vesicles are marked for
specific destinations in the cell.

Components of the endomembrane system:

● Nucleus
● Endoplasmic Reticulum (rough and smooth ER)
● Golgi Apparatus
● Lysosomes & Vacuoles
● Plasma Membrane

Photo by OpenStax / CC BY

Watch the video tutorial for this lesson (2:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68688&activity_type=CourseLesson

2.4.2

Lysosomes, Vacuoles, and Vesicles

● Lysosomes contain digestive enzymes and have a low pH.
○ They fuse with vesicles that have taken contents into the cell through endocytosis, allowing
the ingested components to be broken down.
Example: bacteria that are taken up by immune cells are broken down in lysosomes.

● Vacuoles store water and waste products in plant cells; they cannot merge with the cell
membrane.

● Vesicles are membrane-bound compartments that transport cellular contents between

organelles and in/out of the cell.

WIZE TIP

Remember the lysosome as Lice-osome: they eat up and break down things.

The Cell Membrane

Vesicles from the Golgi fuse with the cell membrane, allowing for the contents to be released outside
of the cell and membrane proteins to be embedded in the cell membrane.

● It envelopes the cell's contents.

● It is the site of endocytosis and exocytosis.

Photo by OpenStax / CC BY

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68689&activity_type=CourseLesson

2.4.3

Example: Vacuoles vs Vesicles

What is the difference between vacuoles and vesicles?

Solution available online

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68697&activity_type=CourseLesson

2.4.4

Practice: Name the Structures

Select the option that has the correct match between structure indicated below and its name:

A: Endoplasmic Reticulum

B: Nuclear Envelope

C: Golgi Apparatus

D: Vacuoles

View Solutions on Wizeprep.com

2.4.5

The Golgi Apparatus

The Golgi apparatus is a series of flattened membrane discs which acts as the cell's sorting center.

● The cis face faces the nucleus (i.e. reCISving side), while the trans face faces away from the
nucleus;

● Contents are received from the ER as vesicles fuse with the cis face;

● The proteins received by the Golgi are then modified, packaged, and sorted into vesicles
destined for other cellular locations or outside the cells.

Photo by Kelvinsong / CC BY

WIZE TIP

Think of the Golgi Apparatus as a girl dressed in gold that modifies ("tags"), sorts and packages
things!

Watch the video tutorial for this lesson (2:43)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71876&activity_type=CourseLesson

2.4.6

Practice: Endoplasmic Reticulum

The smooth endoplasmic reticulum is responsible for ________ synthesis, while the rough endoplasmic
reticulum is responsible for __________ synthesis.

A) Hormone, lipid

B) Protein, lipid

C) Protein, hormone

D) Lipid, protein

View Solutions on Wizeprep.com

2.4.7

The Endoplasmic Reticulum (ER)

The ER branches off of the nuclear envelope and its membrane is also a phospholipid bilayer. There
are two different types:

● The Rough ER is studded with ribosomes.

○ Proteins which are destined to be transmembrane proteins, secreted proteins, or proteins

which reside within certain organelles are synthesized by the ribosomes on the rough ER and
secreted into it.

○ Proteins are also modified in the rough ER, for example by having side chains added to them
or being folded.

● The Smooth ER is not studded with ribosomes.

○ Continuous with the rough ER.

○ Enzymes responsible for synthesizing lipids, steroids, and carbohydrates reside within the
smooth ER which is the location of their production.

○ Can also do detoxification of drugs or poisons.

Photo by CNX OpenStax / CC BY

WIZE TIP

Remember the ER as twins with different characteristics...

● One rough-looking:
○ Dressed with polka dots like ribosomes.
○ Thin and more muscular = protein synthesis.

● One smooth-looking:
○ Heavier in weight = lipids and carbohydrate synthesis.

Watch the video tutorial for this lesson (4:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71875&activity_type=CourseLesson

2.4.8

Practice: Lysosomes
Which of the following is FALSE about lysosomes?

A) They have a high pH value

B) They perform autophagy

C) They perform heterophagy

D) If they break open, they will destroy the cell.

View Solutions on Wizeprep.com

2.4.9

The Nucleus
The nucleus is often the largest cellular compartment; it stores, protects, replicates and expresses
genetic information.

Nucleus Components

Photo by CNX OpenStax / CC BY

○ Nuclear Envelope – has a double membrane, contains nucleoplasm.

○ Perinuclear Space – space between membranes.

○ Nuclear Pore Complexes – transmit traffic between nucleoplasm and cytosol.

Photo by Boumphreyfr / CC BY

○ Nucleoplasm – similar to the cytoplasm of the cell, but in this case it contains DNA and
proteins.

○ Nucleolus – contains machinery necessary for assembling ribosomal RNA (rRNA); then, rRNA
is exported through the nuclear pores to the cytoplasm to be part of ribosomes.

■ Recall that ribosomes are made of rRNA and proteins!

■ No chromosomes are found here.

○ Nuclear Lamina – close to inner nuclear membrane, gives nucleus shape and mechanical
support.

■ Meshwork of lamins which are intermediate filaments proteins.

■ Make up chromosome attachment sites for organizing nuclear contents.

Adapted from photo by CNX OpenStax / CC BY

○ Nuclear Matrix – framework of fibers throughout nucleus, somewhat similar to cell's

cytoskeleton.

Watch the video tutorial for this lesson (5:22)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71869&activity_type=CourseLesson

2.5 The Cytoskeleton

2.5.1

The Cytoskeleton

The cytoskeleton is a network of protein filaments that extends throughout the cytoplasm.
Cytoskeletal filaments are dynamic, and can re-organize; this allows cells to change shape, interact
with the environment, move, and organize cellular compartments.

There are three types of protein filaments in the cytoskeleton, and these are often classified by the size
of each filament:

Intermediate filaments: rope-like filaments composed of a family of keratin proteins.

● Provide mechanical strength;

● Named for their intermediate size, relative to actin and microtubules.

Microtubules: hollow cylinders made of tubulin dimers.

● Involved in organization of organelles and vesicles;

● Form the mitotic spindle;
● Major component of flagella and cilia.

Actin Microfilaments: helical polymers of actin protein.

● Involved in cellular movement;

● Involved in skeletal muscle contraction;
● In plants, involved in organization of organelles and vesicles.

Photo by OpenStax / CC BY

Watch the video tutorial for this lesson (5:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68702&activity_type=CourseLesson

2.5.2

Microtubules
Microtubules are crucial for the interior organization of cells: during interphase, they associate with
motor proteins that transport or position organelles and vesicles.

● During cell division, they form the mitotic spindle, ensuring that chromosomes are correctly
divided between the two daughter cells.

● They also form the core of flagella and cilia.

● They are dynamic, i.e. they are able to rapidly disassemble and reassemble. Their ability to
switch between phases of assembly and disassembly is called dynamic instability.

● There are two main categories of microtubules:

○ Cytoplasmic: more dynamic; located throughout cytosol.

○ Axonemal: located in cilia in flagella; less dynamic and more stable.

● Microtubules originate/grow outward from microtubule organizing centers (MTOCs):

○ Centrosomes are a type of MTOC found in animal cells and are considered cell organelles;

○ Consist of a pair of centrioles that are perpendicular to each other, surrounded by various
proteins;

○ The centrioles are made up of 9 triplets of microtubules.

Photo by Kelvinsong / CC BY

Microtubule Structure

● Protofilament: a single chain of tubulin dimers, alternating between α- and β-tubulin.

● Microtubule: 13 protofilaments bind laterally to form a hollow, tube-like structure (see cross
section).

● Larger (~10 - 25 nm) than actin microfilaments and intermediate filaments.

Photo by Thomas Splettstoesser / CC BY

Microtubule Function

● Provide structural support.

● Organization of cytoplasm: positioning of organelles.

● Transport ("roads" for motor proteins).

● Segregation of chromosomes during cell division (mitotic spindle).

Photo by Lordjuppiter / CC BY

WIZE TIP

Remember the microtubule as micro-tubular...

● Composed of α- and β-tubulin;

● They split the cell in half by forming the mitotic spindle.

Watch the video tutorial for this lesson (6:25)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68716&activity_type=CourseLesson

2.5.3

Actin Microfilaments
Actin microfilaments are involved in cellular movements, and are required for phagocytosis and cell
division.

● They are usually located just below the cell membrane.

● They are the smallest of the cytoskeletal components (~6 nm in diameter).

● Like microtubules, actin microfilaments are polar, and can also assemble and disassemble
(dynamic instability).

● Filamentous actin (f-actin) is composed of monomers of globular actin (g-actin).

● They are the tracks where motor proteins "walk".

Photo by Rice University / CC BY

Actin Filament Functions

● Structural support;
● Movement of organelles and vesicles;
● Cell division;

● Muscle contraction.

Photo by Rice University / CC BY

WIZE TIP

Remember actin as someone who is acting...

● Involved in muscle contraction;

● Forms a contractile ring (belt) around the cells for division.

Watch the video tutorial for this lesson (3:51)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68717&activity_type=CourseLesson

2.5.4

Intermediate Filaments
Intermediate filaments enable cells to withstand mechanical stress, by distributing the effects of
locally applied force.

● They do not have a role in cell movement.

○ They are located throughout the cell and have roles in cell junctions, and maintaining nuclear
structure.

● They consist of long, twisted strands of fibrous proteins.

● They are ~10 nm in diameter and are composed of various helical protein types.
Example: keratin.

● Unlike microtubules and actin filaments, intermediate filaments are not as dynamic.

Photo by Rice University / CC BY

WIZE TIP

Think of intermediate filaments as someone with twisted braids holding a structure...

Watch the video tutorial for this lesson (2:39)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68718&activity_type=CourseLesson

2.5.5

Which cytoskeleton element is the most rigid?

Solution available online

Watch the video tutorial for this lesson (0:31)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=49408&activity_type=CourseLesson

2.5.6

Practice: Cytoskeleton
Complete the following table:

View Solutions on Wizeprep.com

2.5.7

Practice: Intermediate Filaments

Which of the following are true about intermediate filaments:

A) They are made of tubulin subunits

B) They are not defined by composition

C) They are defined by size

D) Only one type of protein makes up intermediate filaments

View Solutions on Wizeprep.com

2.5.8

Illustrations of the Cytoskeleton: Dinner at the Motor Dine In

Watch the video tutorial for this lesson (4:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=72399&activity_type=CourseLesson

2.6 Motor Proteins: Cilia and Flagella

2.6.1

Motor Proteins
Motor proteins are a class of proteins capable of moving along a surface. In the cell, motor proteins
move along components of the cytoskeleton and transport cellular components throughout the
cytoplasm. The energy for their movement comes from ATP. Examples:

● Kinesin: moves along microtubules in the (+) direction.

● Myosin: moves along actin filaments.

● Dynein: moves along microtubules in the (-) direction.

The Three Types of Movement

1. Motor proteins "walk" along the cytoskeleton transporting cargo

● Head proteins attach to the cytoskeleton;

● Tail proteins attach to the cargo;

● The head proteins alternate attaching and detaching from the cytoskeleton, taking "steps"
forward every time they re-attach.

Photo by Ccl005 / CC BY

2. Motor proteins cause a filament to move

● Head proteins attach to a filament (e.g. actin filament);

● Tail proteins are anchored to a surface;

● As the head proteins carry out "walking motion", the tail remains anchored. The head proteins
therefore push the filament along, causing it to move.

Photo by Jeff16 / CC BY

3. Motor proteins cause a "bend"

● Tails attached to one microtubule;

● Heads attached to another microtubule;

● The two microtubules are held together by a linking protein;

● As the heads carry out their "walking" motion, it causes a bend to form.

Watch the video tutorial for this lesson (5:06)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68720&activity_type=CourseLesson

2.6.2

Cilia & Flagella

● Cilia and flagella are composed largely of microtubules, and move through the action of dynein.

● Composed of a 9 + 2 arrangement: 9 fused pairs of microtubules surrounding 2 central

microtubules.

Cilia

Cilia are hair-like structures that protrude from the plasma membrane of many eukaryotic cells. Cilia
beat in a whip-like fashion to move fluid across the cell surface; some protists use cilia for
locomotion.

Example: some cells of the lungs have cilia.

Flagella

Flagella are similar in structure to cilia, but longer; their main role is in locomotion.

Photo by Urutseg / CC BY

Watch the video tutorial for this lesson (2:31)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68721&activity_type=CourseLesson

2.6.3

Practice: Dyneins and Kinesins

Dyneins and kinesins are associated with which component of the cytoskeleton?

A) Microtubules

B) Microfilaments

C) Intermediate filaments

D) Intermediate tubules

E) Myosins

View Solutions on Wizeprep.com

2.6.4

Practice: Cilia and Flagella

What type of proteins make up flagella and cilia?

A) Microtubules

B) Actin microfilaments

C) Intermediate filaments

D) All of the above

View Solutions on Wizeprep.com

2.7 Connections between Cells and their

Environment
2.7.1

The Extracellular Matrix

Animal cells synthesize an extracellular matrix (ECM) on the outside of the cell membrane. The ECM is
composed of proteins and carbohydrates:

● The protein collagen forms long collagen fibers;

● These collagen fibers are modified with carbohydrates and interwoven with proteoglycan;
○ Proteoglycan is a protein heavily modified with carbohydrates and form branched
proteoglycan complexes.

● ECM components attach to membrane proteins called integrins and also connects to
surrounding cells.

● The ECM provides strength and structure to tissues.

Photo by Rice University / CC BY

Watch the video tutorial for this lesson (2:29)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68722&activity_type=CourseLesson

2.7.2

Cell Junctions and Adhesions

Cells need to stick together! There are different types of junctions and adhesions that hold cells in our
tissues together:

● Gap junctions
● Tight junctions
● Desmosomes
● Plasmodesmata

Gap Junctions

● From channels between cells.

● Allows the passage of fluid and molecules between their borders through the channel.

● The channels are called connexons and each one is composed of six connexin proteins.

Tight Junctions

● Form a tight seal between cells, preventing the passage of fluids and molecules between their
border.

● Cells are held together by tight junction proteins.

○ Main proteins are claudins and occludins.

Desmosomes

● Form links between cells (not water tight) and give strength to tissues.

● Cadherins are proteins located on the cell membrane.

○ They connect with intermediate filaments on the inside of the cells and with other cadherins
on the neighbor cell.

Plasmodesmata

● Neighboring plant cells are separated by two thick cell walls and the middle lamellae.

● Plasmodesma is a channel between the cell walls of two plant cells adjacent to each other.

● Allows for the sharing of cytoplasm between plant cells.

Watch the video tutorial for this lesson (5:02)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68723&activity_type=CourseLesson

2.7.3

Practice: Extracellular Matrix

The extracellular matrix consists of all of the following EXCEPT...

A) Plasmodesmata

B) Integrins

C) Collagen

D) Proteoglycans

View Solutions on Wizeprep.com

2.7.4

Practice: Type of Cell Junction

Which of the types of cell junctions allow passage of cellular contents from one cell to another?

A) Tight junctions

B) Gap junctions

C) Loose junctions

D) Desmosomes

E) Plasmodesmata

View Solutions on Wizeprep.com

2.7.5

Practice: Gap Junctions

Where can you expect to find gap junctions and are ions permeable through them?

A) In a plant cell, yes ions are permeable

B) In an animal cell, yes ions are permeable

C) In a bacterial cell (near the cell wall), no ions are not permeable

D) In a plant cell, no ions are not permeable

View Solutions on Wizeprep.com

3. Membranes/Transport
3.1 Components and Structure

3.1.1 The Fluid Mosaic Model

The Fluid Mosaic Model

The plasma membrane is fluid. That

means that its components are
constantly in motion, rearranging.

The term fluid mosaic came from the

fact that the membrane is composed of
so many different molecules put
together like in a mosaic. However,
unlike in this mosaic, the components of
the membrane are constantly shuffling.

Components of the Cell Membrane

The cell membrane forms the barrier between the inside and outside of the cell. It is composed of a
phospholipid bilayer and many other proteins, glycolipids and cholesterol.

● The phosphate head groups of the phospholipids are hydrophilic and face the aqueous
environment inside and outside the cell.

● The lipid tails are hydrophobic and face one another, away from the aqueous environment.

● Cholesterol is another lipid found in cell membranes.

● Glycoproteins are proteins modified with carbohydrates (prefix "glyco-" refers to sugars).
Sometimes, the carbohydrates are attached directly to the lipids: these are glycolipids.
○ These carbohydrates are always facing the outside of the cell, forming the glycocalix.

Membrane Proteins

● Proteins can be part of the membrane itself (integral) or only be on the outer edges of the lipid
bilayer (peripheral).
○ Integral proteins go through the lipid bilayer (transmembrane portion is not charged);
○ Peripheral proteins can be located on the cell interior or exterior by associating with integral
proteins or phospholipids.

● These proteins have many important functions, which include:

○ Catalyzing reactions (enzymes);
○ Transporting molecules through the lipid bilayer;
○ Receptors for signaling between internal and external environment;
○ Anchor internal structures to the cell membrane;
○ Attach adjacent cells to one another;
○ Serve as a marker for cell identification.

Watch the video tutorial for this lesson (5:25)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68639&activity_type=CourseLesson

3.1.2

Factors Affecting Membrane Fluidity

Phospholipids can move around and switch positions: (1) laterally, (2) rotate, (3) flex their fatty acid
chains and (4) flip-flop (via enzymes called flipases). The more phospholipids, the less mobility they
have and the less permeable the membrane is (imagine being in a crowded room versus an empty
one!).

Some of the factors affecting the degree of membrane fluidity are:

● Temperature: at higher temperatures, the membrane has more fluidity than at lower
temperatures.

● Tail length: longer fatty acid tails allow for more intermolecular interactions between
phospholipids, leading to less fluidity.

● Degree of unsaturation: Unsaturated fatty acids have one or more double bonds in the fatty
acid tails. Double bonds lead to a "bend", pushing the adjacent phospholipids further apart. The
increased spacing reduces the number of intermolecular interactions and increases fluidity.

● Cholesterol: the presence of cholesterol in the phospholipid bilayer affects fluidity depending on
the temperature; it acts as a buffer:
○ High temperature: cholesterol decreases fluidity.
○ Low temperature: cholesterol increases fluidity.

Watch the video tutorial for this lesson (5:28)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69525&activity_type=CourseLesson

3.1.3

Practice: Membrane Fluidity

Which of the following cell processes depend on the movement of membrane components and would
probably not be possible if membranes were rigid, nonfluid structures?

A. Cell division

B. Diffusion

C. Endocytosis

D. All of the above

View Solutions on Wizeprep.com

3.1.4

Practice: Membrane Protein Functions

Cellular membrane proteins can:

A. Directly alter gene expression

B. Serve as transporters
C. Signal the cell regarding activity in the extracellular environment
D. Perform translation of mRNA into protein

A, B and C are correct

A and B are correct

B and C are correct

Only D is correct

All or none are correct

View Solutions on Wizeprep.com

3.1.5

Practice: Cholesterol
Cholesterol:

A. Is a hydrophilic molecule

B. Can be inserted in the lipid bilayer of a cell

C. Provides fluidity and rigidity to the cell membrane

D. Helps transport molecules across the membrane

E. All of the above are correct

View Solutions on Wizeprep.com

3.2 Thermodynamics of Membrane

Formation
3.2.1

Thermodynamics of Membrane Formation

The bilayer formation is stabilized by the hydrophobic effect. By preventing the interaction of non-
polar groups with water (which is unfavorable) the entropy of water is increased.

● Enthalpic (ΔH) and Entropic (TΔS) stability contribute to membrane formation.

○ Enthalpy refers to bonds that are formed (the more negative, the greater the stability) and
entropy refers to molecular motion (the more positive, the greater the stability).

● Gibbs Free Energy (ΔG) can be determined by the formula can be thought of as a measure of
instability: all systems tend to minimize ΔG. It is given by the following formula:

ΔG = ΔH + (−TΔS)

● Bilayer formation is spontaneous when ΔG is negative.

Favorability of Bilayer Formation

ΔG = ΔH + (-TΔS)

More freedom of movement = more entropy = bigger TΔS = more negative

ΔG = thermodynamically favorable

● Why is bilayer formation thermodynamically favorable in terms of ΔH?

Solution available online

● Why is there a large ΔS when bilayers form?

Solution available online

Watch the video tutorial for this lesson (8:37)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68850&activity_type=CourseLesson

3.2.2 Practice 1
Which enthalpic and entropic combinations will result in a spontaneous bilayer formation?

Spontaneous (yes/no/depends) ∆H T∆S

<0 >0

<0 <0

>0 >0

>0 <0

View Solutions on Wizeprep.com

3.3 Passive Transport

3.3.1

Membrane Permeability
Cell membranes are said to have selective permeability. This is the idea that it will allow only certain
molecules through, while others need assistance to get into the cell. Which molecules manage to
squeeze through the lipid bilayer depends on the molecule's properties:

● Size and polarity affect the permeability of molecules through the phospholipid bilayer.

● The lipid bilayer has a largely non-polar interior, therefore, non-polar molecules are more
permeable than polar molecules.

● The smaller the molecule, the easier it can cross the membrane.

● Exception: polar water can cross the membrane very quickly due to numerous aquaporins
(water channels) in the membrane.

Watch the video tutorial for this lesson (3:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68857&activity_type=CourseLesson

3.3.2

Introduction and Passive Transport

In order for molecules or ions to get into a cell they must face the cell membrane. There are a few
mechanisms by which they can get through this barrier:

(Simple) Diffusion

Simple diffusion occurs due to random thermal motion of molecules. When you add a drop of red dye
to a glass of water, some time later the drop will have spread and the entire water will be pink. This is
diffusion!

● Diffusion always occurs from high to low concentration regions (driving force), also known as
the concentration gradient.

● When the concentrations are equal throughout, this system is said to be at equilibrium.

● In order for diffusion to occur across a membrane, the membrane must be permeable to the
molecule.

Diffusion of Non-Electrolytes

Small, uncharged and lipophilic molecules can cross right through the lipid bilayer.

Photo by Rice University / CC BY

Facilitated Diffusion

Molecules that cannot diffuse through the membrane require additional help of transport proteins to
get into a cell.

● No energy required just like simple diffusion but instead uses the help of a membrane protein.

● Down the concentration gradient (i.e. molecules go from areas of high to low concentration).

● Two types of membrane proteins that help in facilitated diffusion: Channel Proteins and Carrier
Proteins
○ Channel proteins
■ Specific for a certain molecule;
■ Can be open all the time or need a trigger ("gated").
Example: channels for Na+ or Cl- ions.

○ Carrier proteins

■ Not just a hollow channel: when its specific molecule binds, it changes shape
(conformation) and enables the passage of the molecule inside.
Example: glucose transporters.

Watch the video tutorial for this lesson (6:52)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68853&activity_type=CourseLesson

3.3.3

Practice: Types of Passive Transport

Which of the following statement(s) are FALSE?

A. Ions like Na+ are small enough to cross the cell membrane through the lipid bilayer

B. Facilitated diffusion requires the input of energy

C. Small, uncharged and lipophilic molecules can enter the cell by diffusing through the lipid bilayer

D. Ion channels are selective and can be gated

E. Availability of channels is not important in the ability of an ion to diffuse into a cell

View Solutions on Wizeprep.com

3.3.4 Practice 2

Practice: Molecules Crossing the Lipid Bilayer

Place the following compounds under the appropriate category on their ability to cross a phospholipid
bilayer: Fast, Slow, Can't Cross.

View Solutions on Wizeprep.com

3.4 Active Transport

3.4.1

Active Transport
Also involves a carrier or transporter. There are two types: primary and secondary active transport.

● Can transport solutes against its concentration gradient.

● Therefore, requires the input of energy.

● When there's no energy available, this cannot occur.

Primary Active Transport

● ATP is used as the source of energy.

● The transporter/carrier itself is an ATPase enzyme.

● Carrier takes a phosphate from ATP, changing its conformation.

Examples: Na+/K+ ATPase, Ca2+ ATPase, H+ ATPase, H+/K+ ATPase

Secondary Active Transport

● Also known as co-transport. Energy used is from the movement of one ion down its
electrochemical gradient, while another ion moves up its gradient.

● When both solutes move in the same direction, the carrier molecule is called a symporter
(hitching a ride).
Example: Na+/glucose cotransporter, Na+/amino acid cotransporter.

● When solutes move in opposite directions, the carrier molecule used is called an antiporter (club
is at capacity).
Example: Na+/H+ exchanger, Cl-/HCO3-exchanger, Na+/Ca2+ exchanger.

Summary

● Both require input of energy.

● Both move solutes against their electrochemical gradients

● Primary active transport uses ATPases.

● Secondary active transport uses another molecule that moves down its gradient.

Watch the video tutorial for this lesson (6:32)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68860&activity_type=CourseLesson

3.4.2

Example: Build Your Own Transporter

Imagine you have to design a carrier to transport molecule X into a cell against its concentration
gradient (it cannot cross the membrane through the phospholipid bilayer or a channel). The cellular
environment in question has low ATP but abundant levels of Na+ ions in the extracellular space. How
would you design this carrier to transport this molecule? What kind of transport would this be? Do you
know any examples of this type of transport?

Solution available online

Watch the video tutorial for this lesson (3:05)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69489&activity_type=CourseLesson

3.4.3 Practice 1

Practice: Predict Entry Method

By what method would you predict that these molecules would enter the cell?

a) Oxygen:

b) Potassium:

c) Water:

d) Glucose:

View Solutions on Wizeprep.com

3.5 Osmosis

3.5.1

Osmosis and Osmolarity

Simply put, osmosis is the diffusion of water.

● Water is a polar molecule that diffuses into the cell through aquaporins (channels).

● There must exist a concentration gradient.

Example: Solute is added to intracellular or extracellular space.

● Degree to which the concentration of water is decreased depends on the number of particles of
solute.
○ Osmolarity is the number of particles a solute dissociates into when in solution (per liter).

Photo by Rice University / CC BY

Osmolarity and Cell Volume

Water can always diffuse through the membrane to establish diffusion equilibrium (intracellular =
extracellular osmolarity).

● In an isotonic solution: the movement of water is even across the membrane in either direction
(cell volume maintained).

● In a hypertonic solution: a gradient created by a molecule results in a net movement of water

out of the cell resulting in shriveling.
Example: a cell is put in a solution with a lot of salt.

● In a hypotonic solution: a gradient created by a molecule results in a net movement of water

into the cell resulting in swelling.
Example: a cell is put in a solution with no salt.

Watch the video tutorial for this lesson (6:02)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68861&activity_type=CourseLesson

3.5.2 Practice 1

Practice: Shrink or Not to Shrink?

Sea urchin eggs are isotonic to seawater. Consider these conditions:

a) Eggs are in seawater.

b) Eggs are in 65% seawater (35% distilled water).
c) Eggs are in pure distilled water.

True or False?

i. Under condition b, the egg will not change size.

ii. Under condition a, the egg will not shrink.

iii. Under condition c, the egg will increase in size.

Under condition b, the egg will not change size.

Under condition a, the egg will not shrink.

Under condition c, the egg will increase in size.

View Solutions on Wizeprep.com

Solutions to these questions, as well as step-by-step breakdowns of the answers at:

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=104576&activity_type=QuizQuestion

3.5.3

Practice: Change in Cell Volume

When a cell (osmolarity = 300 mOsm) is placed in a solution containing 300 mOsm KCl and 200
mOsm NaCl (osmolarity = 500 mOsm). Which of the following are true?

A. The solution is hypertonic compared to the cell

B. The solution is hypotonic compared to the cell

C. The cell will swell because the solution is hypotonic

D. The cell will shrink because the solution is hypertonic

E. The cell volume will remain the same

View Solutions on Wizeprep.com

3.6 Bulk Transport

3.6.1

Endocytosis and Exocytosis

A way for molecules to enter or exit the cell without requiring them to pass through the membrane
structure. Both require energetic input and utilize the cell membrane.

Exocytosis

Membrane-bound intracellular vesicles merge with the cell membrane to expel its contents into the
extracellular space.

Endocytosis:

Can be thought of as the opposite of exocytosis. Membrane folds into the cell (invaginates) and pinch
off to produce membrane-bound vesicles inside the cell containing extracellular components/fluids.
There are three main types:

1. Pinocytosis: fluid endocytosis ("cell drinking")

a. Most cells can do this.

2. Phagocytosis: solid endocytosis ("cell eating")

a. Cell engulfs bacteria, other cell debris from tissue death, etc.

b. Pseudopodia ("sham feet") are created to surround material;

c. Usually specialized cells such as macrophages/other immune cells.

3. Receptor-mediated endocytosis: specific uptake triggered by receptor binding

a. Clathrin-dependent
i. Formation of a clathrin-coated vesicle
Example: cholesterol binds to LDL receptor in liver and clathrin is recruited in cytoplasm
and coats the vesicles from the inside.

b. Potocytosis: clathrin-independent
i. Formation of tiny vesicles called caveolae that deliver their contents to cytosol.

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68864&activity_type=CourseLesson

3.6.2

Practice: Phagocytosis
Which of the following statement(s) are false regarding phagocytosis?

A. All cells can do phagocytosis

B. Requires the formation of pseudopodia

C. It is a type of exocytosis

D. It is when intracellular vesicles merge with the cell membrane to expel its contents extracellularly

E. Bacteria and cell debris can be "eaten" by the cell in this process

View Solutions on Wizeprep.com

3.6.3

Practice: Pinocytosis
Pinocytosis:

A. Results in the formation of a clathrin-coated vesicle

B. Can be performed even by cells that cannot do phagocytosis

C. Is a type of receptor-mediated endocytosis

D. Vesicles are formed inside the cell and merge with the membrane

E. None are true

View Solutions on Wizeprep.com

4. Cell Cycle
4.1 The Genome & Chromosomal Structure

4.1.1

The Gene and the Genome

The genome is all of the genetic material of an organism. The genome is encoded on one or more
chromosomes (humans have 23 pairs of chromosomes – 46 total).

● Prokaryotic chromosomes are circular and are arranged into a nucleoid consisting of
supercoiled DNA and protein.

● Eukaryotic chromosomes are linear.

○ It is condensed by being wound around proteins called histones to form nucleosomes, which
are then arranged into chromatin fiber. This is further condensed by coiling.

○ If the DNA in the cell wasn't well organized, it would be like a huge pile of spaghetti will
super long noodles that you can't get apart (or imagine 5 pairs of headphones in your pocket
at once... but way, way worse).

Photo by Thomas Splettstoesser / CC BY

Genes

Polypeptides (proteins), and different kinds of RNA are encoded by genes.

● Genes are sequences of DNA nucleotides. A gene contains the following information:

○ The sequence of nucleotides required for the initiation and termination of transcription of the
gene (i.e. the promoter and the terminator).

○ The sequence of nucleotides that code for a mature RNA molecule, called exons, plus introns
(regions that are removed before protein is made).

Chromosomes

Each species has a specific number of chromosomes. Humans have 46 chromosomes in a somatic cell
(that is, 23 pairs), while dogs for example, have 78.

● Humans, along with many other species, are diploid, meaning we have two copies of each of
our chromosomes (2n).

○ This means that our cells contain 23 pairs of chromosomes, giving 46 chromosomes total.

○ In humans, one copy of each chromosome comes from your mom, while the other copy of
each chromosome comes from your dad.

● Some organisms contain only one copy of each chromosome, and they are said to be haploid
(1n).

● It is possible for organisms to have more than two copies of each chromosome. This is called
polyploidy.

The pair of chromosomes that came from each parent is called a homologous pair.

● The homologous pairs of chromosomes contain the same types of genes, but usually different
alleles of each gene.

○ An allele can be thought of as a different version of a gene.

Example: Let's say chromosome 16 has a gene that encodes for hair color. Each individual
has two chromosomes #16, let's call them M and D (for Mom and Dad). At the same location
on both chromosomes (locus), there will be a sequence of nucleotides that encodes for a
protein that determines your hair color. While on the M chromosome this sequence may be
for blonde hair, on the D chromosome it may be for red hair. These two different versions of
the same gene are called alleles.

● The sex chromosomes determine if a person will be male or female.

○ Two X chromosomes: female.

○ One X and one Y chromosome: male.

● Non-sex chromosomes are called autosomes.

● When a cell divides, the chromosomes need to be replicated.

○ When the DNA is replicated, each identical copy of a chromosome is called a sister
chromatids, and are attached to one another by a centromere.

DNA replication and division

● After the DNA is replicated, it becomes condensed, and the sister chromatids are attached by
the centromere.

● In this state, they two sister chromatids are still considered 1 chromosome.

● When the cell starts to divide into two cells, each sister chromatid is pulled apart. Once
separated, they are now considered two chromosomes.

WATCH OUT!

Homologous chromosomes and sister chromatids are not the same thing!

Watch the video tutorial for this lesson (10:20)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69095&activity_type=CourseLesson

4.1.2

Practice: Chromosome Number

You believe you and your friend have found a new species. You want to test its DNA to be sure. You
find that a single cell of the animal contains 24 sister chromatids and the animal is haploid. How many
chromosomes does this cell have?

View Solutions on Wizeprep.com

4.2 The Cell Cycle

4.2.1

Phases of The Cell Cycle

The central feature of life is that organisms grow, reproduce and die. Just like humans go through
different stages in our growth and development, so do each of our cells.

● The cell cycle is like the lifecycle of a cell – from the beginning of a new cell, through growth,
and finally division.

○ Some cells are capable of dividing many times, while others are not.

● In order to divide, a cell must go through its "stages of life". In this time, the following things will
happen:

○ The cell will grow;

○ It will replicate its DNA;

○ It will produce new organelles;

○ As it nears cell division, it will sort the DNA so that each daughter cell receives one copy of
each chromosome;

○ Split into two cells (twin daughter cells).

The cell cycle can be divided into 2 major phases:

○ Interphase: Cell growth and DNA replication.

■ G1 phase (1st gap)
■ S phase (Synthesis)
■ G2 phase (2nd gap)

○ Mitotic (M) Phase: Replicated DNA and cell contents are separated.
■ Mitosis
■ Cytokinesis (partitioning of the cytoplasm)

Photo by CNX OpenStax / CC BY

WIZE TIP

Think about it like this: cells can only think about reproduction! The cell is either waiting and
preparing to divide (interphase), or is dividing (dividing).

Interphase

Interphase can be split into three separate phases:

1. G1 phase: Gap phase 1.

a. The cell is stocking up on nucleotides, proteins and energy to replicate its DNA. That is, it
increases abundance of molecules involved in replication.

2. S phase: Synthesis phase.

a. The cell replicates its DNA to form sister chromatids, and replicates the microtubules
organizing center called the centrosome.

b. DNA remains in semi-condensed chromatin form.

3. G2 phase: Gap phase 2.

a. The cell may grow in size and increases abundance of proteins involved in mitosis (i.e.
chromosome movement and manipulation).

b. It also replenishes energy stores and some organelles are duplicated.

● There may also be a G0 phase, in which the cells exist in a quiescent state (quiet) and they are
not in the process of dividing or preparing to divide. This can sometimes be seen as an extended
G1 phase.

○ May be temporary (e.g. due to lack of nutrients);

○ May be permanent (e.g. adult heart cells usually do not divide).

Photo by Histidine / CC BY

Watch the video tutorial for this lesson (5:25)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69096&activity_type=CourseLesson

4.2.2

Practice: Cell Cycle

Draw a somatic cell that is n = 5 in G1 phase and G2 phase.

View Solutions on Wizeprep.com

4.3 Mitotic Phase of Cell Cycle

4.3.1 Mitosis and Cytokinesis

Mitotic Phase
Mitosis (M Phase) is the part of the cell cycle in which a cell divides into two identical daughter cells,
which are genetically identical to each other as well as the "mother" cell.

● Recall that the M Phase of the cell cycle can be subdivided into mitosis and cytokinesis.

○ The first portion is also called karyokinesis, which literally just means division of the nuclear
contents.

○ The second portion, cytokinesis, means separation of the cytoplasmic components into two
daughter cells.

● Most of the cell division in our bodies occurs through mitosis.

● Mitosis is for growth, and to replace old and dying cells.

WIZE TIP

Remember that "-kinesis" just means motion.

Phases of Mitosis

1. Prophase

○ Chromosomes start to condense.

○ Centrosome begins to form the mitotic spindle structure composed

of microtubules which organize chromosomes and move them to the
appropriate locations during mitosis.

○ The spindle gets longer as the centrosomes move to opposite poles

of the cell.

○ The nucleolus disappears and nuclear envelope breaks down.

Photo by OpenStax / CC BY

2. Prometaphase

○ Chromosomes continue to further condense.

○ The mitotic spindle grows and begin to attach to the kinetochore of

the chromosomes' centromere.

■ The kinetochore is a protein located at the centromere of the

sister chromatids.

Photo by OpenStax / CC BY

3. Metaphase

○ Chromosomes align at the metaphase plate (also sometimes called

the equatorial plane).

○ The two kinetochores of each chromosome (one for each sister

chromatid) are attached to microtubules – each attached to an
opposite centrosome.

○ Maximal condensation of chromosomes, but chromatids are still

attached to one another.

Photo by OpenStax / CC BY

WIZE TIP

Chromatids align like the stars in order for the cell to divide... that's so meta!

4. Anaphase

○ Sister chromatids separate and are pulled towards opposite ends of

the cell towards the two centrosomes.
■ Now they are each one chromosome!

○ The microtubules that are not attached to chromosomes push apart,

causing the cell to elongate and the poles to move away from each
other.

Photo by OpenStax / CC BY

5. Telophase

○ The mitotic spindle is broken down into tubulin monomers that will
form the cytoskeleton of daughter cells.

○ Chromosomes start to decondense.

○ Nuclear envelope begins to form.

Photo by OpenStax / CC BY

WIZE TIP

Cells are telling each other good bye!

Photo by OpenStax / CC BY

Watch the video tutorial for this lesson (7:29)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69109&activity_type=CourseLesson

4.3.2

Cytokinesis
This is sometimes seen as the second stage of M phase. Is very different for animals and plants.

● Physical separation of cytoplasmic components occurs in this phase.

● Usually starts to occur in late anaphase or telophase.

In animal cells

● The cell "pinches in" at the metaphase plate due to a band of filaments that act like a
drawstring. These filaments are composed of a protein called actin.

○ The pinching forms a crease called the cleavage furrow.

○ Two daughter cells are formed when cytokinesis is complete.

In plant cells

● Remember that plants have cell walls, composed of cellulose, so a new one must form between
the daughter cells.

● Vesicles formed from the Golgi apparatus that contain the components necessary for this
process (e.g. glucose) go to the metaphase plate.

● A cell plate forms down the middle, splitting the cell into two and forming a cell wall between
them.

Photo by MathildaBrinton / CC BY

Watch the video tutorial for this lesson (1:52)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69692&activity_type=CourseLesson

4.3.3

Ploidy & C-value coefficients

● Ploidy = n = # of chromosomes in a single set
○ Example: Humans
■ Have 23 distinct chromosomes
■ Have 2 sets of chromosomes
■ 2n = 2(23) = 46 total chromosomes
● C-value = C = the physical amount of DNA across a single set of chromosomes in pg
○ Example: Human cell at Interphase
■ Has 23 distinct chromosomes that holds "C" pg of DNA
■ Have 2 sets of chromosomes
■ 2C = total amount of DNA within the cell

Example: Fill in the table for a diploid cell

Watch the video tutorial for this lesson (4:38)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95860&activity_type=CourseLesson

4.3.4

Practice 1: Number of Chromosomes and Chromatids

Complete the following table based on a cell that is 2n = 12.

# Chromosomes # Chromatids # DNA strands

G1 Phase

G2 Phase

Metaphase

Anaphase

After cytokinesis
(per cell)

View Solutions on Wizeprep.com

4.3.5

Practice: Lack of Actin

A human cell has received a mutation and is unable to produce actin. What would be the result after
mitosis?

A. One cell containing 23 pairs of homologous chromosomes within a nucleus

B. A haploid cell containing 23 chromosomes

C. One cell containing 23 pairs of homologous chromosomes, each replicated and paired with a
sister chromatid

D. One cell with two nuclei, each nucleus containing 23 pairs of homologous chromosomes

E. A gamete

View Solutions on Wizeprep.com

4.3.6

Practice: Chromosomes and Chromatid Number

If a cell contained 4 chromosomes during prophase, how many chromosomes and chromatids would it
have during prometaphase?

A) 4 chromosomes, 4 chromatids

B) 8 chromosomes, 16 chromatids

C) 8 chromosomes, 8 chromatids

D) 4 chromosomes, 8 chromatids

E) None of the above

View Solutions on Wizeprep.com

4.3.7

Practice: Chromosomes During Metaphase and Anaphase

Dogs are 2n = 78. A somatic dog cell undergoes mitosis. How many chromosomes are there during
metaphase and anaphase, respectively?

A) 78, 156

B) 78, 78

C) 39, 78

D) 39, 156

E) 39, 39

View Solutions on Wizeprep.com

4.4 Control of Cell Cycle

4.4.1

Cell Cycle Checkpoints

In order to avoid damaged cells to continue replicating and potentially causing harm to the body, there
are several "checkpoints" that the cell must pass in order to proceed through the cell cycle. If these
checkpoints are not respected, the most likely outcome is a cancerous cell!

● G1 checkpoint: The cell will only pass this checkpoint if the cell is in good health (no DNA
damage, cell size and material reserves) and in a good environment for reproduction. Growth
factors may help cells pass.

○ This is the point of no return: cells commit to division process here.

● G2 checkpoint: Determines if all DNA has been replicated and is not damaged. If not, the cell
can't enter mitosis until it is.

● M checkpoint (aka spindle checkpoint): Occurs in metaphase, makes sure all centromeres are
“attached” to spindle. Cell cannot continue with mitosis until this is complete.

Photo by WassermanLab / CC BY

How does the cell "pass" or "fail" a checkpoint?

If necessary conditions are not met (i.e. the checkpoint is failed), the cell will produce a signal to
change protein regulation within the cell and inhibit proteins needed to move to the next phase.

Molecules that Regulate the Cell Cycle

Progression through the cell cycle is dependent on two main proteins:

1. Cyclins: Proteins that bind to and activate Cdks.

a. Concentration of these proteins rise and fall in a cyclical fashion.

b. Increase in concentration results from increased transcription.

c. Decrease in concentration results from targeted proteolysis.

Photo by Rob Hurt / CC BY

2. Cyclin-dependent kinases (Cdks): enzymes that phosphorylate other proteins involved in the
cell cycle.

a. Phosphorylation status regulates the activity of various proteins.

b. There is a unique cyclin-Cdk pair for each phase of the cell cycle.

c. When the pair forms, the cyclin-Cdk complex can phosphorylate proteins that help cells
advance stages of the cell cycle.

Photo by CNX OpenStax / CC BY

Depending on where the cell cycle is in its cycle, different cyclins will be produced. There are 4 main
types of Cdk's that regulate the cell cycle. They are each made by attaching a different cyclin to a Cdk.

1. G1-Cdk: Made from Cdk and cyclin D.

2. G1/S-Cdk: Made from Cdk and cyclin E.

3. S-Cdk: Made from Cdk and cyclin A.

4. M-Cdk: Made from Cdk and cyclin B.

WIZE CONCEPT

Mitogens are extracellular signals that promote progression from G1 to S phase by stimulating
synthesis of G1 cyclins, G1/S cyclins, and other proteins associated with DNA replication. Be
careful though, overproduction of these can lead to cancer.

Watch the video tutorial for this lesson (6:32)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69101&activity_type=CourseLesson

4.4.2

Putting the Breaks on the Cell Cycle

By adding or removing cyclins from the cell, we can control what stage of the cell cycle the cell
remains in. There are 2 main ways to control these cyclins:

1. Changing the concentration of the cyclins: if they are removed, they cannot bind to Cdk and it
will be inactive.

2. Adding or removing cyclin inhibitors: molecules that halt the cell cycle.

a. p53 - "guardian of the genome."

i. A transcription factor protein that is activated when DNA is damaged. Once active, it
binds to DNA altering transcription.

ii. Halts cells at G1/S.

iii. Allows for production of Cdk inhibitor proteins so the cell cycle is stopped at a
checkpoint (different checkpoints depending on the inhibitor made).
Examples: p21, p27, p16.

iv. Can trigger apoptosis if repairs cannot be made.

b. p21

i. Rises when p53 also rises to reinforce its breaks on cell cycle progression.

ii. Directly inhibits Cdk/cyclin complexes.

c. Retinoblastoma (Rb)

i. Monitors cell size.

ii. Inhibits transcription factors (E2F) that enable production of proteins for G1/S phase
progression.

iii. Phosphorylation of Rb causes it to dissociate from E2F, allowing for progression of the
cell cycle.

Photo by Victor Aguilar and Lluis Fajas / CC BY

WIZE CONCEPT

All three of these molecules are called tumor suppressor genes. They are key to prevent cells
from forming tumors due to uncontrolled division leading to cancer.

Watch the video tutorial for this lesson (4:00)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69696&activity_type=CourseLesson

4.4.3

Example: Cell Cycle

When cell extract from Xenopus (frog) eggs in S-phase is injected into a cell in G1, the G1 cell enters S-
phase. Explain why this happens.

Solution available online

Watch the video tutorial for this lesson (1:03)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69156&activity_type=CourseLesson

4.4.4

Practice: Only Certain Cdks Present

What would happen if S-Cdk was present during mitosis initiation but M-Cdk was not?

A. The cell would continue growing and replicating its DNA

B. The cell would replicate more DNA but stop growing

C. The cell would not be able to divide

D. The cell cycle would continue as normal

View Solutions on Wizeprep.com

4.4.5

Practice: Checkpoint Function

Which of the following is not correctly matched with its function?

A. G1 checkpoint - consideration of environmental factors

B. G2 checkpoint - has DNA been replicated?

C. M checkpoint - detects if mitotic spindle has formed

D. G1 checkpoint - detection of DNA damage

View Solutions on Wizeprep.com

4.5 Prokaryotic Cell Division: Life Cycle &

Growth
4.5.1 Prokaryotic Growth Phases

Phase of Growth in a Bacterial Culture

Bacteria have 4 general growth phases. Not based on an individual cell but a population of cells.

Phase 1: Lag phase

● It takes the cells a while to get accustomed to their environment before they can start dividing.

● The cells are in a non-growing shock phase.

● No change in population size.

Phase 2: Exponential Phase

● Active growth. Every cell is dividing.

● There is sufficient nutrients available to support division by all cells.

● Number of dividing cells outnumber the dying cells significantly.

● Population size increases exponentially.

Phase 3: Stationary phase

● Nutrients are just enough to support some growth.

● Dividing cells are equal to dying cells.

● Population size is not changing.

Phase 4: Death phase

● Nutrients are depleted. Waste product accumulation becomes toxic.

● More dying cells than newly dividing cells.

● Population is declining.

Photo by Michał Komorniczak / CC BY

Watch the video tutorial for this lesson (3:06)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69113&activity_type=CourseLesson

4.5.2

Practice: Bacterial Growth

You add 10 bacterial cells into nutrient culture and you let them grow for 90 minutes. You know that
this bacterial species takes 15 minutes to divide. How many cells do you have after 90 minutes?

Answer

View Solutions on Wizeprep.com

4.5.3

Practice: Bacterial Growth Curve

Label the bacterial growth curve: (one word each)

A: _____ phase

B: _____ phase

C: _____ phase

D: _____ phase

T: What should this label be?

L: What should this label be? (Hint: Number of _____)

View Solutions on Wizeprep.com

4.6 Binary Fission

4.6.1 Binary Fission: Prokaryotic Cytokinesis

Binary Fission: Prokaryotic Cytokinesis

A form of asexual reproduction (daughter cells are identical to parent cell).

● Occurs mainly in single-celled organisms.

● All genetic material in the cell is replicated before cytokinesis (bacteria have extrachromosomal
DNA like plasmids that are also replicated).

○ When DNA is replicated, the origins (Ori site) are attached to the poles of the cells by the
partitioning proteins ParA/ParB. This enables chromosomal segregation.

● Cytokinesis:

○ Constriction of cells into two daughter cells is done by a cytoskeletal protein know as FtsZ.

○ FtsZ proteins form a ring at the constriction site.

○ The ring contracts to pinch the two cells apart.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (2:47)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69114&activity_type=CourseLesson

4.6.2

Practice: Binary Fission

Which of the following is NOT true about binary fission?

A) It is a form of asexual reproduction

B) Occurs in bacteria and mitochondria of eukaryotes

C) Produces two daughter cells that are not identical to the parent

D) Involves a contractile ring of proteins that split cells apart

View Solutions on Wizeprep.com

5. DNA Replication
5.1 DNA Structure and Sequence

5.1.1

Review of DNA Structure

DNA encodes our genetic information which eventually gives rise to RNA and proteins. Important
features of DNA are:

● Double helix.

● Composed of a sugar-phosphate backbone and nucleotide bases.

● Complementary strands are anti-parallel to one another.

○ Runs from 5’→3’

● Nucleotide bases are connected by hydrogen bonds.

○ Adenine (A) with Thymine (T)

○ Guanine (G) with Cytosine (C)

○ Purines hydrogen bond with pyrimidines:

■ Purines = A & G

■ Pyrimidines = T & C

○ In RNA, Uracyl (U) replaces T

○ C and G have 3 hydrogen bonds between one another, while A and T have only two.

■ This makes the bonds between C and G harder to break, requiring more energy (i.e.
higher temperature).

WIZE TIP

Remember the mnemonic below to memorize which nucleotides are purines and which are
pyrimidines:

1. CUT the Py = Cytosine, Uracil and Thymine are Pyrimidines.

2. Pure As Gold = Purines are adenine and Guanine.

Photo by OpenStax / CC BY

How is the DNA backbone elongated?

● Phosphodiester bonds form between the 3' -OH group of one nucleoside to the 5' phosphate
group of an incoming nucleoside.

Photo by Mykhal / CC BY

Watch the video tutorial for this lesson (10:08)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69186&activity_type=CourseLesson

5.1.2

Practice: Levels of DNA Structure

Select the three levels of DNA structure.

A) Primary: sequence of nucleotides

B) Secondary: double helix

C) Higher order: chromatin (DNA/protein complex)

D) Quaternary: DNA strands interacting with one another

View Solutions on Wizeprep.com

5.1.3

Practice: Nucleotide Base Pairing

Which of the following is the correct 5' to 3' sequence of the complimentary strand to: 5'-
AGGTCTGATTCGTA-3' ?

A) AGGTCTGATTCGTA

B) TCCAGACTAAGCAT

C) TACGAATCAGACCT

D) ATGCTTAGTCTGGA

View Solutions on Wizeprep.com

5.2 Meselson-Stahl Experiment

5.2.1

The Meselson-Stahl Experiment

In 1953, there were 3 theories as to how DNA might replicate:

● Conservative: The entire DNA molecule is copied making a second, completely new DNA
molecule.

● Semi-conservative: The two strands of DNA separate, with each strand acting as a template to
copy a new strand.

● Dispersive: The DNA was cleaved into small fragments, the fragments were copied and then re-
attached.

Photo by Mike Jones / CC BY

Matthew Meselson and Franklin Stahl designed an experiment in Escherichia Coli (E. coli) bacteria to
determine which of the 3 was happening in cells. The procedure was as follows:

1. Grow E. coli in "heavy" nitrogen (15N) so that all the DNA in the bacterial was labelled with
15N.

○ When DNA was extracted and centrifuged (separated by weight), all DNA= "heavy."

2. Transfer cells to "light" nitrogen (14N) and let DNA replicate once.

○ When DNA was extracted and centrifuged, all DNA= 50% "heavy"/ 50% "light."

○ This rules out the conservative theory which predicted that template DNA molecule would
be all "heavy" and the new DNA would be all "light."

3. Let DNA replicate in "light" nitrogen (14N) one more time.

○ When DNA was centrifuged, DNA was either 50% "heavy"/ 50% "light" OR all "light."

○ This rules out the dispersive theory which predicts that all the DNA would continue to be
50% "heavy"/ 50% "light."

WIZE CONCEPT

The Meselson-Stahl Experiment showed that DNA replicated using the semi-conservative
mechanism.

Watch the video tutorial for this lesson (9:12)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69193&activity_type=CourseLesson

5.2.2

Example: Applying the Meselson-Stahl Experiment

You are culturing bacteria cells. For one round of replication, you culture these bacteria in the presence
of fluorescently tagged adenines. On the below daughter strands of this round of replication, where
would you draw the incorporation of the fluorescently tagged nucleotides?

Watch the video tutorial for this lesson (1:48)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95902&activity_type=CourseLesson

5.2.3

Practice: Meselson-Stahl Experiment

Which of the following statements is true regarding the Meselson-Stahl experiment?

A) The experiment used the same nitrogen isotope to label both the template and newly formed
DNA.

B) Scientists used SV40 viruses as a model in which to study DNA replication.

C) The semi-conservative hypothesis stated that the DNA molecule is separated into single strands
and each strand acts as a template for a new strand.

D) The experiment showed that DNA replication likely occurs via the conservative mechanism.

View Solutions on Wizeprep.com

5.3 In vivo DNA Replication

5.3.1 DNA Replication in Cells

DNA Replication in Cells

Because DNA within eukaryotic cells is very large, the two strands are not completely separated prior
to replication. Instead, replication begins at specific locations designated origins of replication.

● The replication bubbles extend out and eventually the multiple new strands of DNA meet one
another and come together to form a brand new strand.

● Prokaryotic chromosomes have one origin of replication and eukaryotic chromosomes have
multiple.

● DNA replication is semi-conservative: the newly double stranded DNA contains one strand from
the original DNA and one newly synthesized strand.

Photo by CNX OpenStax / CC BY

● The origin of replication in prokaryotes has a special name and is called Ori.

Photo by Bootan68 / CC BY

Synthesis of New DNA: Prokaryotic Cells Example

1. At the origin of replication, the enzyme helicase begins to unwind the DNA, leaving two anti-
parallel strands and creating a replication fork. There are single stranded binding proteins
(ssb) that keep the strands apart.

2. Topoisomerase is responsible for "relaxing" the supercoiling of DNA.

3. The enzyme responsible for grabbing new nucleotides and matching them to the original DNA
to create a new strand is DNA polymerase III.

a. It can only bind to the parental DNA and start creating a new strand if there is an RNA
primer (short RNA sequence) bound to the original strand. This primer is created by an
enzyme called primase.

b. It can only read DNA in the 3' to 5' direction and creates a new strand in the 5' → 3'
direction)

c. However, DNA goes both ways (3' to 5' is matched with 5' to 3'); therefore, for one strand
the polymerase will move towards the replication fork (leading strand), and for the other
strand the polymerase will be moving away from the replication fork (lagging strand).

d. Sliding clamp protein tethers DNA polymerase to the strand and replication continues until
the adjacent replication bubble is met.

Photo by CNX OpenStax / CC BY

● Leading strand: As the helicase unwinds the DNA at the replication fork, the DNA polymerase
III for the leading strand will continue adding more nucleotides to the newly forming strand.

● Lagging strand: The newly exposed parental DNA at the replication fork will require a new
primer and DNA polymerase III in order for that region to be replicated. The lagging strand, thus,
has multiple primers and polymerases that are added as the DNA unwinds, creating Okazaki
Fragments.

● DNA polymerase I removes the primer and replaces it with deoxyribonucleotides and a DNA
Ligase moves along the lagging strand and ties the Okazaki fragments together.

WATCH OUT!

The process of DNA replication is understood super well in prokaryotes, which is why it is
typically taught in detail. This process in eukaryotes is very similar, the main difference is that
some enzymes are called different names. See the chart below for the comparisons.

Watch the video tutorial for this lesson (14:25)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69195&activity_type=CourseLesson

5.3.2 Example: Leading and Lagging Strands

Example: Leading and Lagging Strands

Label the following diagram and include the DNA strand directionalities.

Solution available online

Watch the video tutorial for this lesson (2:22)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69223&activity_type=CourseLesson

5.3.3

Practice: DNA Replication

On the leading strand of the replication fork, new DNA synthesis occurs:

A. In the 3'--> 5' direction.

B. In the same direction as the replication fork movement.

C. Slower than the lagging strand.

D. Without DNA polymerase activity.

E. Independently of an RNA primer.

View Solutions on Wizeprep.com

5.3.4

Practice: Okazaki Fragments

Okazaki fragments are:

A) Found on the leading strand of the DNA replication fork.

B) Allow DNA to be elongated in the 3'--> 5' direction.

C) Attached together by the enzyme DNA helicase to form the new DNA strand.

D) Usually ~100-200 base pairs long before being attached together.

E) Able to form independently from an RNA primer.

View Solutions on Wizeprep.com

5.3.5

Example: Complete the Replication Bubble

Complete the replication bubble if the top strand reads 3' to 5' from left to right.

Watch the video tutorial for this lesson (4:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95861&activity_type=CourseLesson

5.4 Telomerase

5.4.1

Telomerase
● In the linear DNA of eukaryotic cells, RNA primers cannot be added to the 3' end of the DNA
(lagging strand) in order to allow DNA polymerase to replicate the very end of the strand.

● The enzyme telomerase extends the 3' end of the lagging strand by adding a DNA sequence to
which a primer can attach. DNA polymerase III can now replicate the 3' end of the lagging
strand.

● Prokaryotic cells don't have this problem and therefore don't have telomerase because they
have circular chromosomes and during replication both replication forks meet in the middle.

Photo by Fatma Uzbas / CC BY

Watch the video tutorial for this lesson (4:23)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69225&activity_type=CourseLesson

5.4.2

Practice: Prokaryote Telomerase?

Why don't prokaryotic chromosomes require a telomerase during replication?

A) Because their DNA is double stranded

B) Because they have circular chromosomes

C) Because their mechanism of replication uses completely different enzymes than eukaryotes

D) Because they do not require an RNA primer for replication

View Solutions on Wizeprep.com

5.4.3

Practice: Absence of Telomerase

What would happen to a eukaryotic chromosome after repeated rounds of replication if the
telomerase was not functioning properly?

A) The ends of the chromosomes would become longer and longer

B) Nothing would happen since telomerases help with DNA unwinding

C) The telomeres would become shorter each time the cell divides

D) The lifespan of a cell would be longer

View Solutions on Wizeprep.com

5.5 Types of DNA Mutations

5.5.1

Types of DNA Mutations

Mutations in DNA occur when there is a change in the normal DNA sequence.

Point Mutations or Base Substitutions

The term point mutation means that only one base pair is mutated. Point mutations can arise due to:

● Errors in DNA replication.

● Environmental exposure to damaging agents like UV light, radiation, etc.

● Harmful chemicals/ toxins.

● Byproducts of normal cell metabolism (e.g. lipid oxidation).

There are 3 types of point mutations:

● Nonsense mutation: a premature stop codon is introduced into a sequence

Example: UGC (Cysteine) --> UGA (stop)

● Missense mutation: a change to the amino acid sequence

Example: UGC (Cysteine) --> UGG (Tryptophan)

● Silent mutation: no change to the amino acid sequence

Example: UGC (Cyteine) --> UGU (Cysteine)

WIZE CONCEPT

Mutations can be:

● BENEFICIAL: improves the fitness of an organism (e.g. resistance to a virus, lactose

tolerance)

● BENIGN: does not change the overall fitness of an organism (e.g. change in eye color or
silent mutations)

● HARMFUL: negatively impacts the fitness of an organism (e.g. development of diseases like
cancer and birth defects)

Photo by Jonsta247 / CC BY

EXAM TIP

To remember that nonsense mutations cause stop codons, just remember the mnemonic: STOP
the NONSENSE!

When a nucleotide is replaced by another this is called a base substitution. Most commonly, point
mutations are base substitution.

● There are two different kinds of substitutions: transitions and transversions.

○ Transitions: purine for purine, pyrimidine for pyrimidine.

Example: A for G, C for T.

○ Transversion: purine for pyrimidine and vice-versa.

Example: A for T, C for G.

Frameshift Mutations

Other mutations have the potential of causing changes in the reading frame of the nucleotide
sequence. These are called frameshift mutations. They can be caused by mutations such as
insertions or deletions of fragments of DNA.

WIZE CONCEPT

You may not have covered what "reading frame" means yet in your biology course, so here's a
quick explanation.

● The DNA sequence codes for proteins.

● Every 3 nucleotides codes for one amino acid.
● Therefore, when nucleic acids are translated into proteins, the triplets of nucleotides that are
read can make a huge difference in the outcome of a protein.

Example: consider the following sequence: TGTGAA. Reading in triplets, TGT codes for
cysteine, while GAA is glutamic acid. So this sequence of amino acids is a cysteine linked
to a glutamic acid.

Now, consider I insert a random nucleotide in the middle of this sequence: TGTTGAA. Again,
reading in triplets from left to right, now this codes for TGT = still cysteine, but the next
triplet will be TGA = STOP. Turns out TGA is a stop codon, which tells the cellular machinery
to STOP making this protein.

○ Due to this single base insertion, the rest of the protein is now missing.

○ This is an example of an insertion causing a shift in reading frame and a premature

stop codon.

Watch the video tutorial for this lesson (8:40)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69226&activity_type=CourseLesson

5.5.2

Practice: DNA Mutations

You are studying a DNA sequence and find a spontaneous mutation that has occurred, resulting in a
nonsense mutation. Which of the following is true?

A) This mutation could not have resulted due to an error in replication by DNA polymerase.

B) This mutation will result in a premature stop codon in the amino acid sequence.

C) This mutation will not change affect the folding structure of the encoded protein.

D) This mutation will result in the substitution of an amino acid in the sequence.

E) This mutation must have arisen from the failure to repair a G-T mismatch.

View Solutions on Wizeprep.com

5.5.3

Practice: Type of Mutation

a) What type of point mutation occurred in the DNA sequence below, substitution, insertion, or
deletion?

Initial sequence: 3’ ATGCGATTATCTAGTATT 5’

Mutated sequence: 3’ ATGCGATTATCTAGGTATT 5’

b) Does the mutation cause a frameshift, synonymous, missense, or nonsense mutation in the
amino acid sequence?

View Solutions on Wizeprep.com

5.5.4

Tautomeric Shifts
● DNA nucleotides have inherent instability = are in equilibrium between 2 forms
○ Thymine & Guanine = keto vs. enol
○ Adenine & Cytosine = Amino vs. imino
● The equilibrium lies heavy towards the more common form that gives the usual base-pairing C-
G & A-T
● When in their alternate form, the base pairing changes to T-G & C-A
● Some mutagens, like 5-bromouracil, are in an equal equilibirum between their two forms
○ This makes it equally likely to base pair with G or A
● A source of single nucleotide polymophisms (SNPs)

Watch the video tutorial for this lesson (6:39)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95863&activity_type=CourseLesson

5.5.5

Example: Tautomeric Shifts

Draw the steps showing how a tautomeric shift of cytosine from its amino to its imino form leads to an
SNP given the sequence: 5'-TGCT-3'

Watch the video tutorial for this lesson (4:22)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95889&activity_type=CourseLesson

5.5.6

DNA Slippage
In highly repetitive regions of the genome, DNA polymerase falls off the template strand and when it
comes back together it can do:

Backwards Slippage

● The newly synthesized strand "slips" backward 1 bp

● Results in a 1 bp insertion

Forward Slippage

● The template strand "slips" forward 1 bp

● Results in a 1 bp deletion

Watch the video tutorial for this lesson (5:17)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95864&activity_type=CourseLesson

5.5.7

Copy Number Variations

Individuals have differences in the number of copies of genes or genetic information, having a different
number of copies of those genes/gene regions.

Sources of Copy Number Variation:

● Unequal cross-over during homologous recombination in prophase I of meiosis

● Non-homologous end joining causing loss of large chromosome regions
● Mobile elements

Curran919, CC BY-SA 4.0 via Wikimedia Commons

Watch the video tutorial for this lesson (3:05)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95903&activity_type=CourseLesson

5.5.8

Mobile Elements
● Regions of the genome that are considered to be "trapped" viruses
● Retain the ability to move within the genome, but cannot leave the cell
● Do NOT increase copy number variations if they just "jump"
● The increase copy number variations if they move through a copy & paste mechanism

Mobile Elements & Disease

● Transposons in the human genome are called Alu elements

○ LINEs = Long interspersed elements
○ SINEs = Short interspersed elements
● Alu elements represent approximately 11% of the human genome = millions of copies!
● They move through a retrotransposon copy & paste mechanism
○ The "paste" process causes insertional mutagenesis
○ Insertional mutagenesis can disrupt genes, causing changes in gene expression or regulation
and can cause recombination events to occur where they shouldn't
● Diseases attributed to Alu elements: Hemophilia, leukaemia, muscular dystrophy and MANY
more!

Watch the video tutorial for this lesson (6:43)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=95904&activity_type=CourseLesson

5.6 Repair of DNA Mutations

5.6.1

Repair of Mutations During Replication

When the cellular machinery is working to replicate a DNA strand, errors can occur. When this occurs,
it is called a mutation. Types of mutations include:

● Point mutations (base-pair substitutions);

● Insertion and deletion mutations (addition or removal of base pairs).

DNA Polymerase Exonuclease Activity

In addition to catalyzing the polymerization of a new strand of DNA, DNA polymerase III can
proofread the newly synthesized strand and correct mistakes. This is used to prevent mutations from
staying in the DNA and being passed on to daughter cells.

● It can do so due to its exonuclease activity. This means that it can break phosphodiester bonds
to correct mistakes.
○ Synthesizes 5' -> 3'
○ Corrects 3' -> 5'

● It can recognize improper placements of bases by detecting changes in geometry of improper

base pairing as it polymerizes the complementary strand.

WIZE CONCEPT

Exonucleases are enzymes that cut nucleotide chains at either the 5' or 3' end.
Endonucleases are enzymes that cut bonds of nucleotides within a chain.

DNA Mismatch Repair

If DNA Polymerase does not correct mismatched bases during DNA polymerization, other
mechanisms are in place to prevent those mutations from prevailing.

● Specific DNA repair enzymes (endonucleases) recognize the incorrect geometry and repair the
DNA by excising the incorrect nucleotide.

○ The gap is filled in later by DNA polymerase.

○ The nick is sealed by DNA ligase.

● There are mechanisms in place to enable these enzymes to know which strand is the parental
versus daughter strands.

○ In bacteria, the parent strand usually has methylated adenines.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (10:13)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69220&activity_type=CourseLesson

5.6.2

Repair of Mutations by Mutagens

Nucleotide Excision Repair

This repair mechanism repairs damaged DNA rather than incorrectly paired ones. This mechanism is
readily at play whenever cells are exposed to environmental mutagens, such as ultraviolet (UV)
radiation, which causes covalent bonding of two adjacent pyrimidines within DNA (e.g. thymine
dimers).

● Enzymes (endonucleases) detect the improper geometry of the DNA and remove the damaged
nucleotides.

● New nucleotides are added via DNA polymerase and the old and new nucleotides are bonded
by DNA ligase.

Photo by Boumphreyfr / CC BY

Watch the video tutorial for this lesson (3:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70123&activity_type=CourseLesson

5.6.3

Practice: DNA Repair During Replication

What is the primary method by which DNA polymerase fixes errors while it is actively replicating the
DNA?

A. Homologous Recombination

B. Base Excision Repair

C. Proofreading

D. Non-homologous End joining

E. Mismatch Excision Repair

View Solutions on Wizeprep.com

5.7 Repair of Double Stranded DNA Breaks

5.7.1

Repair of DNA Strand Breaks

Double-stranded breaks in DNA are particularly damaging because incorrect joining of the strands
cause mass reorganization of the genes and the affect the structure of chromosomes. There are two
main systems for repairing double stranded DNA breaks: non-homologous end joining and
homologous recombination.

Non-homologous End Joining (NHEJ)

Joins two non-homologous ends of DNA together. Usually, after a double stranded break, the two
ends of DNA are still close enough together that they will be ligated back together.

Problems with Non-homologous End Joining:

● Causes minor deletions as base pairs from either ends of the DNA fragments are lost (usually
this is not harmful as the majority of DNA is non-coding or intronic DNA).

● Genes can end up joined together resulting in a chimeric genes. This can in turn result in
changes to cell function or even cancer.

Homologous Recombination

The damaged DNA sequence is copied from an undamaged or highly similar (homologous) copy of
the DNA. The break is repaired by an exchange of two different DNA strands, referred to as
recombination.

● Homologous recombination can be used to repair nicks in replication forks as well as double
stranded breaks in DNA and is error free!

● The Holliday structure can be resolved in two different ways, yielding two different products.
Therefore, double-stranded breaks repaired through homologous recombination has potentially
FOUR different outcomes.

● Homologous recombination also provides a mechanism for creating genetic diversity in the
offspring of two parents.

Photo by Emw2012 / CC BY

Watch the video tutorial for this lesson (8:46)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69228&activity_type=CourseLesson

5.7.2

Practice: Double Stranded Break Repairs

Which of the following statements is true regarding Non-homologous End Joining and Homologous
Recombination?

A) Both are methods for repairing double-stranded DNA breaks.

B) Both are error-free.

C) Both form Holliday structures as an intermediary structure.

D) Both result in the loss of several base pairs.

E) Both are essential mechanisms for creating genetic diversity.

View Solutions on Wizeprep.com

6. Gene to Protein
6.1 The Central Dogma of Biology

6.1.1

The Central Dogma of Biology

This is a central point of biology. It explains how our genome can encode the information for proteins
that ultimately carry out functions in biological systems.

● DNA stores information in genes.

● Genes are transcribed by RNA Polymerase to messenger RNA (mRNA). mRNA is an

intermediate between the gene and the protein.

○ There are other kinds of RNA that can be transcribed from DNA that are capable of carrying
out functions themselves, without being translated into proteins. They include ribosomal
RNA (rRNA) and tRNA (involved in translation).

● The mRNA is translated by the ribosome into a protein. Proteins then carry out many of the
essential functions within a cell.

Photo by Daniel Horspool / CC BY

EXAM TIP

TL;DR: DNA encodes RNA, RNA encodes protein.

Watch the video tutorial for this lesson (4:20)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69242&activity_type=CourseLesson

6.1.2

Practice: Central Dogma of Biology

What are the different types of RNA molecules that are transcribed from DNA?

A) tRNA

B) mRNA

C) fRNA

D) rRNA

View Solutions on Wizeprep.com

6.1.3

Practice: RNA Preparation

When purifying RNA in the lab, special precautions need to be taken such as using a clean,
designated RNA room, gloves, and special cleaning solutions. Why do you think such precautions are
necessary?

A) RNA is normally double stranded which makes it hard to clean off

B) RNA is super stable so we must be careful not to contaminate surfaces with it

C) RNA is single stranded and can be easily degraded by RNase enzymes found in the environment

D) DNA and RNA both have the same stability and should be treated the same

View Solutions on Wizeprep.com

6.1.4

Practice: Base Percentage

The base composition of a virus was found to be 11% A, 32% G, 18% U and 39% C. Is this a DNA or
RNA virus (Explain)? Is it single-stranded or double-stranded (Explain)?

A) DNA, single stranded

B) RNA, single stranded

C) DNA, double stranded

D) RNA, double stranded

View Solutions on Wizeprep.com

6.2 Genes and mRNA

6.2.1

Genes and mRNA

According to the central dogma, first genes within DNA get transcribed into mRNA. But before we
understand more about mRNA, it's important to know the basic components of a gene.

The structure of a gene

A gene generally consists of 3 basic elements:

● Promoter: a region of DNA just before a gene (upstream) that initiates transcription. RNA
polymerase binds DNA in this region.

● Coding region: the part of the gene that codes for a particular RNA molecule (mRNA, rRNA,
tRNA).

● Terminator: a region of DNA just after a gene (downstream) that signals transcription to stop.

● There are a couple of differences between eukaryotes and prokaryotes that will be addressed
later.

Photo by Joan L. Slonczewski and John W. Foster / CC BY

mRNA Synthesis

Remember, there are many genes on a chromosome. These genes are not always oriented in the
same direction.

● The DNA strand that is to be transcribed is referred to as the template strand. The
complementary strand is known as the coding strand, which is identical to the mRNA that is
transcribed (except the Thymines are Uracils in mRNA).

● DNA is read in the 3' to 5' direction, which means that the complementary RNA strand is
synthesized in the 5' to 3' direction.

○ This is similar to how DNA Polymerase synthesized a new strand of DNA!

The General Structure of mRNA

Bacterial mRNA contains the following elements:

● 5’ untranslated region (UTR): contains the ribosome binding site.

● Start codon: codon at which the ribosome begins translation.

● Stop codon: codon at which the ribosome stops translation.

● 3’ untranslated region (UTR): region downstream of stop codon that is not translated.

WIZE CONCEPT

Note that bacterial mRNA is often polycistronic, meaning more than one protein can be encoded
in a single strand of mRNA.

Watch the video tutorial for this lesson (8:00)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69243&activity_type=CourseLesson

6.2.2

The General Structure of mRNA

Bacterial mRNA contains the following elements:

● 5’ untranslated region (UTR): contains the ribosome binding site.

● Start codon: codon at which the ribosome begins translation.

● Stop codon: codon at which the ribosome stops translation.

● 3’ untranslated region (UTR): region downstream of stop codon that is not translated.

WIZE CONCEPT

Note that bacterial mRNA is often polycistronic, meaning more than one protein can be encoded
in a single strand of mRNA.

Watch the video tutorial for this lesson (4:13)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71610&activity_type=CourseLesson

6.2.3

The Genetic Code

Three consecutive nucleotides on a strand of mRNA represent a codon, which codes for a particular
amino acid. The genetic code is said to be redundant or degenerate because more than one codon
codes for each amino acid.

Photo by Genomics Education Programme / CC BY

● AUG is the codon for the amino acid methionine and is the start codon.

● The reading frame of the RNA strand is set by the start codon.

● Though there's only one start codon, there are three possible stop codons.

Photo by Scott Henry Maxwell / CC BY

Each mRNA codon is recognized by the complimentary anticodon of a tRNA that carries the
corresponding amino acid.

● The enzyme that "loads" the amino acids onto the appropriate matching tRNAs is called
aminoacyl tRNA synthetase.

● The mRNA and tRNA interact in an antiparallel orientation via hydrogen bonds.

● There is looser pairing between the 5’ nucleotide of the anticodon and the 3’ nucleotide of the
codon, which gives rise to the wobble effect.

Photo by Yikrazuul / CC BY

What is a reading frame and how is it important?

From start to stop codon, one full protein is made. The sequence between the start codon and the stop
codon is called a reading frame.

Photo by Hornung Ákos / CC BY

Usually, a sequence has only one reading frame. If the reading frame is changed, a different
polypeptide chain will be made and one of two things will happen:

1. A mutated protein will be produced that is nonfunctional: usually occurs because of a deletion
or another mutation in the mRNA or in the DNA itself.

2. A different functional protein will be made.

Watch the video tutorial for this lesson (8:05)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69244&activity_type=CourseLesson

6.2.4

Reading Frame
What is a reading frame and how is it important? From start to stop codon, one full protein is made.
The sequence between the start codon and the stop codon is called a reading frame.

Photo by Hornung Ákos / CC BY

Usually, a sequence has only one reading frame. If the reading frame is changed, a different
polypeptide chain will be made and one of two things will happen:

1. A mutated protein will be produced that is nonfunctional: usually occurs because of a deletion
or another mutation in the mRNA or in the DNA itself.

2. A different functional protein will be made.

Watch the video tutorial for this lesson (3:28)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71803&activity_type=CourseLesson

6.2.5

Practice: mRNA Synthesis

Write the first 10 nucleotides of the mRNA from the gene sequence given below. Make sure to label
the 5’ and 3’ ends. The gene is read left to right. Label the template and coding strands.

5’ – CGGGCTATTGTCATTTGCATGACTCCGTGGA – 3’
3’ – GCCCGATAACAGTAAACGTACTGAGGCACCT – 5’

A) 5’ – CGGGCUAUUG – 3’

B) 3’ – CGGGCUAUUG – 5’

C) 5’ – AATGCUAUUG – 3’

D) 3’ – CGGGCUGGGC – 5’

View Solutions on Wizeprep.com

6.2.6

Practice: Genetic Code Theory

The Genetic Code is said to be universal, redundant, and non-overlapping. What does that mean, and
why is it important?

A. Same code used in all organisms

B. Each codon codes for only one amino acid

C. More than one codon for a particular amino acid

Universal

Redundant

Non-overlapping

View Solutions on Wizeprep.com

6.2.7

Practice: DNA to RNA Parts

Label the parts of the gene and the resulting RNA in the diagram below. Assume the gene is read left
to right.

View Solutions on Wizeprep.com

6.2.8

Practice: tRNA vs mRNA

An anticodon of a tRNA has the sequence 5'-GCA-3'.

a) What amino acid does the tRNA carry?

b) What is a complimentary mRNA codon?

c) What is the DNA sequence encoding the codon in a complimentary mRNA codon?

b) Type out the sequence in the form 1'-AAA-1' (with no spaces in between)

c) Type out the template strand and non-template strand, separated by a comma (for example 1'-AAA-1', 1'-AAA-1')

View Solutions on Wizeprep.com

6.2.9

Summary of Genes and mRNA

Photo by Thomas Splettstoesser / CC BY

Photo by Becky Boone / CC BY

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69281&activity_type=CourseLesson

6.3 Prokaryotic Transcription

6.3.1

Transcription in Bacteria (Prokaryotes)

Transcription can be broken down into three steps: initiation, elongation, and termination. The
enzyme that synthesizes the complementary RNA strand is RNA Polymerase.

● The site at which transcription should start is designated "+1."

● RNA Polymerase has a subunit called Sigma factor that can bind to specific DNA sequences
within the promoter region of a gene.

Initiation

1. The sigma subunit binds to the -35 box (~35 bases upstream from the +1 site, where
transcription begins) and the -10 box (~10 bases upstream from the +1 site) in the promoter
region.

2. The remaining subunits of RNA polymerase can then bind to the promoter. The RNA
polymerase complex is referred to as a holoenzyme.

3. The RNA polymerase is able to orient itself near the +1 site and to move in the direction of
transcription.

a. Binds to template strand.

b. It reads DNA 3' to 5'.

c. It synthesizes RNA in 5' to 3'.

Photo by CNX OpenStax / CC BY

Consensus sequence:

● The promoter sequence, including the -35 box and -10 box, can vary between genes and
bacteria, but are still recognized by Sigma because they are relatively similar.

● Comparing the sequences for the -35 box and -10 box of different genes can yield a consensus
sequence, or the most common nucleotide at a particular position.

○ The -35 region has the consensus sequence TTGACG and the -10 region has the sequence
TATAAT.

● The closer to consensus a sequence is, the higher the affinity the Sigma has for the promoter.

Watch the video tutorial for this lesson (8:03)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69247&activity_type=CourseLesson

6.3.2

Elongation
● Elongation can start when the polymerase releases the sigma subunit can move forward.

● The RNA polymerase, orientated at the +1 site, moves along the template strand in the 3' to 5'
direction and creates a complementary RNA copy by base pairing (because RNA nucleotides
are used, uracil replaces thymine).

● The RNA strand is created complementary to the template strand and is identical to the coding
(non- template) strand.

Photo by Genomics Education Programme / CC BY

If the idea of template versus coding strand seems confusing...

Watch the video tutorial for this lesson (6:41)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71082&activity_type=CourseLesson

6.3.3

Termination
There are two types of termination signals depending on the specific gene:

1. Rho-dependent termination: uses a protein called Rho that binds to the new RNA strand and
causes RNA Polymerase to fall off upon their encounter.

2. Formation of a hairpin (Rho-independent):

a. The RNA polymerase reaches a termination sequence in the DNA; this is typically a region
with lots of C and G nucleotides and a poly A sequence.

b. The region with C-G folds onto itself to form a hairpin loop. This causes polymerase to
pause.

c. The region with a run of A-U is not very stable, and in combination with the hairpin, causes
the polymerase to dissociate.

Photo by Oalnafo1 / CC BY

WIZE CONCEPT

Remember that prokaryotes do not have a separate compartment for their nucleus. That means
that RNA transcription and translation can occur simultaneously! That is, as the RNA is being
transcribed, the ribosome can already bind to it and start making the protein.

Watch the video tutorial for this lesson (4:26)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71083&activity_type=CourseLesson

6.3.4

Practice: Transcription in Bacteria

Consider the following nucleotide sequences for the -35 box of five different genes. Determine the
consensus sequence, and rank their affinities for the Sigma subunit (from highest to lowest).

A) 5'-T-T-C-A-A-A-3'
B) 5'-T-A-G-C-A-A-3'
C) 5'-T-T-G-G-A-C-3'
D) 5'-T-T-G-A-C-A-3'
E) 5'-A-T-G-A-C-C-3'

Part 1
What's the consensus sequence?

a) 5’ – TACAAA – 3’

b) 5’ – TTGACA – 3’

c) 5’ – TAGAAA – 3’

d) 5’ – TTGAAA – 3’

Practice: Transcription in Bacteria

Consider the following nucleotide sequences for the -35 box of five different genes. Determine the
consensus sequence, and rank their affinities for the Sigma subunit (from highest to lowest).

A) 5'-T-T-C-A-A-A-3'
B) 5'-T-A-G-C-A-A-3'
C) 5'-T-T-G-G-A-C-3'
D) 5'-T-T-G-A-C-A-3'
E) 5'-A-T-G-A-C-C-3'

Part 2
Rank their affinities for the Sigma subunit from highest to lowest.

a) B, C, D, A, E

b) A and D (same affinity), B and C (same affinity), E

c) A and E (same affinity), D and C (same affinity), B

d) B, C and D (same affinity), A, E

View Solutions on Wizeprep.com

6.3.5

Practice: DNA encoding

Given the mRNA strand below, determine the DNA encoding this region (template and non-template
strand).

5'-AUGGCAGGAC-3'

Template (3 to 5)

Coding (5 to 3)

View Solutions on Wizeprep.com

6.3.6

Practice: Transcription
During transcription, which strand is not read by RNA polymerase?

A. Non-coding strand

B. Template strand

C. Coding strand

D. Cannot determine

View Solutions on Wizeprep.com

6.4 Eukaryotic Transcription

6.4.1

Transcription in Eukaryotes
Transcription in eukaryotic cells is fundamentally the same as that process in prokaryotic cells. Here
we will point out some more key differences between the two.

1. Eukaryotic DNA is packaged into chromatin, which in the condensed state (default state)
results in a promoter that is inaccessible to RNA polymerase. Transcription can only occur when
DNA is decondensed and dissociated from the histones around which it is wound.

2. Transcription and translation cannot occur at the same time because eukaryotes have a
separate compartment for the DNA (nucleus).

3. Prokaryotic cells: genes with common function are arranged linearly and are transcribed
together on a single mRNA (polycistronic).

a. Eukaryotic cells: genes with common functions can be scattered throughout the genome, on
different chromosomes and can therefore be transcribed and regulated separately from one
another.

b. Eukaryotic mRNA is always monocistronic: one mRNA = one protein.

4. Eukaryotes have three types of RNA polymerase:

○ RNAP I: transcribes rRNA

○ RNAP II: transcribes mRNA
○ RNAP III: transcribes tRNA

5. Messenger RNA requires extensive modification before being translated into protein (maturing
of RNA).

6. Promoters are more complex but also have a consensus sequence similar to that in
prokaryotes. This is called the TATA box and is located about -30 nucleotides upstream of the
transcriptional start site.

7. RNA polymerase needs the help of transcription factors to bind to DNA and start transcribing.
Instead of a simple sigma factor, several transcription factors (TFs) bind to the promoter to
recruit RNA Polymerase II. See below for more details on this.

Photo by CNX OpenStax / CC BY

8. Elongation is similar to prokaryotes but termination can be different (depends on RNA

Polymerase type).

Transcriptional Control

● The equivalent of sigma proteins in prokaryotic transcription are basal transcription factors in
eukaryotic cells.

● Basal transcription factors include a TATA-binding protein (TBP) that binds to the TATA box in
the promoter of eukaryotic genes. Following TBP binding, the RNA polymerase is recruited.

● Other transcription factors (such as enhancers) bind to different areas within the gene and
interact with the polymerase to initiate transcription.

○ Enhancers can even be located far away from the genes they affect.

● Transcription factors help to coordinate gene expression. Genes located on different

chromosomes can be controlled simultaneously through the use of the same transcription factor.

Photo by Luttysar / CC BY

Watch the video tutorial for this lesson (8:33)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69248&activity_type=CourseLesson

6.4.2

Practice: Transcription in Eukaryotes

Which of the following is required only by eukaryotes for transcription?

A. Uracil

B. Transcription factors

C. Promoter

D. Terminator

View Solutions on Wizeprep.com

6.5 RNA Maturation in Eukaryotes

6.5.1

RNA Maturation in Eukaryotes

After transcription of eukaryotic pre-mRNA, three modifications occur before translation:

● 5’ capping
● Polyadenylation
● Splicing

5’ capping

A modification to the 5’ end of the pre-mRNA, which consists of a methylated guanosine (7-
methylguanosine). This cap allows for efficient translation and prolongs the stability of the mRNA.

Polyadenylation

A modification to the 3’ end of the pre-mRNA, which consists of several hundred “A” nucleotides to
give a poly-A tail. Like the 5’ cap, the poly-A tail helps prevent RNA degradation and helps export
pre-mRNA to cytoplasm.

Splicing

Eukaryotic genes contain introns and exons. The resulting mRNA is spliced to join together exons and
remove introns. (Hint: think “exons are expressed; introns are in between.”)

Photo by CNX OpenStax / CC BY

WIZE CONCEPT

After these modifications, the pre-mRNA is now fully matured and can be called mRNA.

Splicing occurs in the nucleus and is conducted by proteins called spliceosomes. This has to be a very
precise process since leaving nucleotides in can cause frameshift mutations that generate
nonfunctional proteins.

Photo by OpenStax / CC BY

Watch the video tutorial for this lesson (7:46)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69250&activity_type=CourseLesson

6.5.2

Example: mRNA Transcription

Transcribe the following template strand of DNA. Identify where the cap and poly-A tail appear on the
mRNA.

DNA:
3'- ATACCTCGACTAG-5'

Solution available online

Watch the video tutorial for this lesson (2:36)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69279&activity_type=CourseLesson

6.5.3

Practice: Gene Splicing

The diagram represents regions around a gene encoding a mRNA. The translation initiation codon
(AUG) is present in exon 1 of the mRNA. The stop codon (UGA) is present in exon 4.

What region of the primary transcript is removed from the mature mRNA?

View Solutions on Wizeprep.com

6.5.4

Practice: Transcription In Eukaryotes

The diagram represents an mRNA with exons (shaded regions) and introns (white regions).

Part 1
a) In order to create a protein with the regions I, II, IV, what splicing pattern is required?

A) 1 joins with 4 and 5 joins with 6

B) 2 joins with 3 and 5 joins with 6

C) 1 joins with 2 and 3 joins with 6

D) 3 joins with 4 and 4 joins with 5

Practice: Transcription In Eukaryotes

The diagram represents an mRNA with exons (shaded regions) and introns (white regions).

Part 2
b) If the splicing pattern included sites '1 and 4', and '5 and 6', what protein would result?

A) I-IV

B) II-III-IV

C) I-II-IV

D) I-III-IV

View Solutions on Wizeprep.com

6.5.5

mRNA maturation
● Adding the 5’ cap and poly-A-tail during/after transcription
● Splicing out introns of pre-mRNA
○ spRNA is bound by proteins to form snRNPS (small nuclear riboproteins)
○ snRNPs recognize intron-exon boundaries, loop the intron into a lariat shape
○ snRNPs cut out the intron and ligate the exons together
■ 5’ splice site (5’-CAG/GUAAGU-3’) base pairs with the U1 snRNA
■ 3’splice site (5’-CAG-3’) is cut after the U2 snRNA base pairs with it’s recognition
sequence (5’-UACUAC-3’) in the intron

What is alternative splicing?

● Alternative splicing = different mature mRNAs produced from a single pre-mRNA

transcript/gene
○ Often happens when proteins are produced in different cell types
○ The same sequence but different protein products

Watch the video tutorial for this lesson (3:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=37309&activity_type=CourseLesson

6.6 Translation into Proteins

6.6.1

Translation into Proteins

Recall that translation of mRNA into proteins is done by a cellular organelle called the ribosome.

● The ribosome is composed of a small subunit and a large subunit made from rRNA and
proteins.

● The ribosome contains three sites:

○ A (aminoacyl) site: the acceptor site for an aminoacyl-tRNA.

○ P (peptidyl) site: the site where the peptide bond forms between the amino acid and the
growing polypeptide chain.

○ E (exit) site: the site where the tRNAs exit the ribosome.

● Translation occurs in three steps: (1) initiation, (2) elongation, and (3) termination.

Initiation

1. When the mRNA enters the cytosol, the 5' end of the mRNA binds to the small subunit of the
ribosome.

2. A tRNA carrying the amino acid methionine arrives at the P site (peptidyl site) of the ribosome
and binds to the start codon (AUG).

3. Next, the large subunit binds and completes the initiation complex.

Elongation

1. A tRNA for the next codon attaches to the A site (aminoacyl site). The carboxyl end (C-
terminus) of the methionine forms a peptide bond with the amine end (N-terminus) of the
amino acid at the A site (catalyzed by peptidyl transferase).

2. The ribosome shifts three nucleotides toward the 3' end of the mRNA in a step called
translocation, shifting the tRNA that held the methionine to the E site (exit site), and the tRNA
carrying the dipeptide moves from the A site to the P site.

3. The A site is now available for another tRNA.

Termination

When a stop codon is reached, release factor proteins bind to the A site, releasing the polypeptide
from the tRNA and ribosome.

Watch the video tutorial for this lesson (8:42)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69251&activity_type=CourseLesson

6.6.2 Differences in Eukaryotic and Prokaryotic Translation

Differences in Eukaryotic and Prokaryotic Translation

Differences

● Ribosomes

○ Eukaryote: 80S ribosome: made up of a 60S subunit bound to a 40S subunit.

○ Prokaryote: 70S ribosome: made up of a 50S subunit bound to a 30S subunit.

Similarities

● Relatively the same process (initiation, elongation, and termination).

● Same codon codes and amino acids, including start and stop codons.

● Occurs in the cytoplasm.

● Involves ribosomes, rRNA and tRNA.

Watch the video tutorial for this lesson (2:32)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69268&activity_type=CourseLesson

6.6.3

Example: Translation and Reading Frame

Given the following sequence, translate the three possible reading frames assuming the first reading
frame starts with the first A, the second reading frame starts with the first G and the third reading
frame starts with the first U.

AGU UCC CGU AUC AAG GCC CGA

Solution available online

Watch the video tutorial for this lesson (4:49)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69269&activity_type=CourseLesson

6.6.4

Example: Transcription
The DNA strand of a hypothetical genome is shown below. Transcription begins at the Transcription
Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at
the end of the Transcription Terminator.

a) Which strand of DNA shown, the top or bottom, is the coding strand?

Solution available online

b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends.

Solution available online

c) What is the sequence of the protein produced from the mRNA which is produced from this gene
Label the N and C terminals.

Solution available online

d) If a mutation is found where a G/C (top/bottom) base pair were added immediately after the T/A
base
pair in bold, what would be the sequence of the mRNA? What would be the sequence of the
protein?

Solution available online

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71091&activity_type=CourseLesson

6.6.5

Transcription vs Translation Chart

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69270&activity_type=CourseLesson

6.6.6

Practice: Components for Protein Translation

Which of the following is not necessary for protein translation to occur?

A) mRNA

B) tRNA

C) rRNA

D) Amino acids

E) All of the above are necessary

View Solutions on Wizeprep.com

6.6.7

Practice: Translation
Match the correct options.

A. Peptide bond-tRNA binding site

B. Exit site

C. Wobble position

D. Stop codon

E. Met (start codon)

F. Amino acid-tRNA binding site

AUG

UAA, UAG, UGA

Position 3 of the codon

E site

P site

A site

View Solutions on Wizeprep.com

Solutions to these questions, as well as step-by-step breakdowns of the answers at:

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=106629&activity_type=QuizQuestion

7. Plant Cells and

Photosynthesis
7.1 Plant Structures for Photosynthesis

7.1.1

Plant Structures for Light-Dependent Reactions

The main organelle responsible for the light-dependent reactions of photosynthesis is the chloroplast.
It harvests energy light to produce sugar. Chloroplasts are separated into three compartments by
three membranes:

● Outer Chloroplast Membrane – Highly permeable.

● Intermembrane Space – Space found between the inner and outer membranes.

● Inner Chloroplast Membrane – Highly impermeable except where specific transporters are
present. Impermeable to ATP and NADPH.

● Stroma – The aqueous fluid within the inner chloroplast membrane; analogous to the matrix of
mitochondria. Site of sugar production.

● Thylakoid Membrane – Highly folded membrane which forms a set of flattened, disc-like sacs
(thylakoids) which are arranged in stacks (grana). Contains chlorophyll, site of electron
transport chain, and ATP synthase.

● Thylakoid Space – Internal compartment of thylakoid.

Chlorophyll

● Chlorophyll – Light-capturing pigments found in chloroplast, are responsible for the first step in
photosynthesis.
○ When pigment absorbs light an electron jumps to a higher energy level; as it returns to its
ground state, the released energy is transferred to the neighboring chlorophyll molecule.
○ Pigments are organized into antennae complexes that associate with the two photosystems
of photosynthesis.

Watch the video tutorial for this lesson (3:46)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69624&activity_type=CourseLesson

7.1.2

Practice: Light Absorption Location

Where does light absorption occur in plants?

A) Thylakoid membrane

B) Stroma

C) Outer membrane

D) Inner mitochondrial membrane

E) Matrix

View Solutions on Wizeprep.com

7.1.3

Practice: Plant Structures

The pigment called ___________ present in chloroplasts is able to absorb light from the sun. They are
organized in ___________ complexes on the ____________ membrane.

A) Chlorophyll; thykaloid; outer

B) Chlorophyll; antennae; thykaloid

C) Porphyrin; antennae; photosystem

D) Porphyrin; thykaloid; thykaloid

View Solutions on Wizeprep.com

7.2 Photosynthesis: Light and Dark

Reactions
7.2.1

Photosynthesis Overview
Photosynthesis is a series of light-driven reactions which converts atmospheric CO2 to organic
molecules and O2.

Stage I: Light Reactions

● The overall goal of the light reactions is to convert light energy into chemical energy in the form
of ATP and NADPH.

● Using light energy harnessed by pigments (such as chlorophyll), electrons are excited and
passed along the electron transport chain (ETC) to set up an electrochemical proton gradient
which is used to drive ATP synthesis.

● The final electron acceptor is NADP+ which becomes NADPH.

Photosystems

● Pigments are organized in photosystems.

● A photosystem has two parts: the light harvesting (antenna) complex + the reaction center.

● They both:
○ Absorb light energy;
○ Pass it from pigment to pigment in the light harvesting complex;
○ Energy ends up exciting chlorophyll a in the reaction center;
○ Chlorophyll a gives off an electron to an electron acceptor.

● In photosystem II:
○ Chlorophyll a regains electrons it lost by splitting water (releases O2).
○ The excited electron is passed down members of the electron transport chain (ETC).
○ Its energy is used to drive protons (H+) into the lumen.
○ The electron ends up in chlorophyll a of photosystem I.

Photo by CNX OpenStax / CC BY

● In photosystem I:
○ Absorbs light energy, gives off an electron and passes it to an enzyme which uses the
electrons to reduce NADP+ to NADPH.
○ The electrons donated by the reaction center are replaced by photosystem II.

● Proton gradient is used to generate ATP by ATP Synthase.

Photo by CNX OpenStax / CC BY

Stage II: Dark Reactions (Calvin Cycle)

● Happens in the stroma.

● ATP and NADPH that result from Stage I are used for carbon fixation (production of organic
molecules from CO2).

● Rubisco is the main enzyme responsible for combining CO2 with an organic molecule.

● Glyceraldehyde-3-phosphate (G3P) is made. G3P is used to produce other sugars such as

glucose.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (9:13)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69625&activity_type=CourseLesson

7.2.2

Practice: The Chloroplast

About the chloroplast:

A) They are the equivalent of mitochondria in animal cells.

B) They are responsible for a plant's ability to do oxidative phosphorylation.

C) Rubisco takes part in the Calvin cycle so it is not present in the chloroplast.

D) Light-dependent reactions occur on the thykaloid membrane.

View Solutions on Wizeprep.com

7.2.3

Practice: Overall Photosynthesis Reaction

Given the following overall photosynthesis reaction, fill in the missing components (left to right):

6 H2O + --> __ + 6 O2

A) 3 CO2 ; 3 C6H12O6

B) 1 C6H12O6 ; 6 CO2

C) 2 C6H12O6 ; 6 CO2

D) 6 CO2; 1 C6H12O6

View Solutions on Wizeprep.com

7.3 Light-Dependent Reactions of

Photosynthesis [detailed]
7.3.1

Light-Dependent Reactions of Photosynthesis

Photosynthesis is a series of light-driven reactions which converts atmospheric CO2 to organic
molecules and O2. After the light-dependent reactions, the molecules produced enter the Calvin Cycle,
which does not require light. Here, we will focus on the light-dependent reactions.

Photosynthesis locations:

○ Light reactions occur in the thylakoid membrane.

■ A stack of thykaloids is called grana.

○ Dark Reactions (Calvin Cycle) occur in the stroma (fluid between grana).

Light absorbing pigments

Pigments absorb as certain visible light wavelength.

● Chlorophylls a and b
○ Absorb 70% of red and blue wavelength; highest O2 production at these wavelengths.
○ Only present in green plants and green algae.

● Carotenoids
○ Absorb violet and blue-green light.

● Phycobilins – present in algae.

Photochemistry Components

● Chlorophyll contains a porphyrin ring

○ Light absorbing head containing magnesium and many double bonds that can be excited.

● Light harvesting complexes (aka antenna complex) – link pigments together and are
connected to reaction centers.
○ Electrons transferred to primary electron acceptor.

● Photosystem (PS) = light harvesting complexes + reaction center embedded in thylakoid

membrane.

Photosynthesis Steps

Photosynthesis starts with light photons striking the pigments. Follow the steps below:

Remember that the combination of a light harvesting complex with the reaction center makes up a
photosystem. There are two relevant photosystems that differ in (1) which molecules they split (i.e.
what they oxidize) and (2) where they deliver their electrons (i.e. what they reduce).

● Photosystem II (P680): Obtains an electron by splitting water (H2O) and releasing oxygen (O2)
as a waste product.
○ Note that electron energy is also used to pump H+ from the stromal side to the lumen of the
thykaloid.
○ These hydrogen atoms will be used to produce ATP later.
○ Since the traveling electrons loose energy, they must be "reenergized" by photosystem I.

● Electron Transport Chain (ETC): Passing of electrons between PS II and PS I.

● Photosystem I (P700): Similar to PS II, it absorbs a photon from light, which passes through
pigments, to chlorophyll a and then the reaction center.
○ In this case, an electron came from PS II to replace that one given away by chlorophyll a.
○ PS I becomes oxidized and sends an electron to NADP+, reducing it to NADPH.

● ATP Synthase:
○ The buildup of H+ in the thykaloid lumen creates a gradient that drives the production of
ATP as the ions rush through ATP synthase.
○ This is called chemiosmosis.

WIZE TIP

This process of using light energy to produce ATP is called photophosphorylation.

Watch the video tutorial for this lesson (9:57)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69626&activity_type=CourseLesson

7.3.2

Non-Cyclic and Cyclic Versions of Light-Dependent Reactions

1. Non-Cyclic Photophosphorylation
a. What was discussed so far was the non-cyclic version of the light-dependent reactions, also
known as Z-scheme. It is called that because the energy of the electrons involved goes up
and down, in a pattern that resembles a "Z".

Photo by Govindjee, Dmitriy Shevela / CC BY

WIZE CONCEPT

Note that in this scheme 1 ATP is formed for every 1 NADPH. Therefore, their ratio is 1:1
ATP:NADPH.

2. Cyclic Photophosphorylation
a. If ATP and NADPH are needed at different ratios, electrons can be cycled through
photosystem I only.
b. Instead of going to reduce NADP+, the electron goes through the ETC, driving H+ into the
lumen.
c. This gradient is used to produce ATP from ADP.

Watch the video tutorial for this lesson (3:23)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69627&activity_type=CourseLesson

7.3.3

Practice: Light Reactions Product

What is one of the products of the light reactions?

CO2

G3P

NADPH

Water

View Solutions on Wizeprep.com

7.3.4

Practice: Types of Photophosphorylation

Which of the following is correct?

A) In cyclic photophosphorylation, the ATP to NADPH ratio is 1

B) Non-cyclic photophosphorylation only uses one type of photosystem

C) In both cyclic and non-cyclic photophosphorylation, the H+ gradient is used to drive ATP
production

D) ATP produced by cyclic photophosphorylation cannot be used in the Calvin cycle

View Solutions on Wizeprep.com

7.4 Calvin Cycle [Carbon Fixation]

7.4.1

Calvin Cycle
A series of reactions occurring in the stroma of plant cells which results in the production of sugar
(glyceraldehyde-3-phosphate) from atmospheric CO2.

Photo by Mike Jones / CC BY

WATCH OUT!

To start off, we should note that for every one molecule of G3P that leaves the Calvin cycle, 5
remain in the cycle. Therefore, in order to get 6 molecules of G3P, 3 turns of the cycle are
required. This is why you will see the reactions multiplied by 3!

ANALOGY: Imagine you take a revolving door that will only allow you to exit if you go through it 3
times.

Phase 1: Carbon Fixation

● The central enzyme of the Calvin cycle is Ribulose Bisphosphate Carboxylase (RuBisCo).
○ Catalyzes the reaction between atmospheric CO2 and Ribulose 1,5-bisphosphate.
○ Ribulose 1,5-Bisphosphate is replenished by using the energy and reductive power of ATP.

Phase 2: Reduction

● Energy from ATP and NADPH are used to convert six 3PGA into six glyceraldehyde 3-
phosphate (G3P).
● ATP becomes ADP and NADPH becomes NADP+ (can return to light-dependent reactions!).
● Note that 6 ATP and 6 NADPH are used in total.

Phase 3: Regeneration

● Only one G3P leaves the cycle to take part in other compounds.
● Five continue in the cycle and regenerate other compounds within.
● Another 3 molecules of ATP (3 turns of the cycle) are used in this process.

WIZE TIP

NET USAGE: 9 ATP and 6 NADPH

The fate of the sugar produced from the Calvin cycle depends on the current conditions:

● Day (excess photosynthetic activity) → G3P is stored as starch or fat in the stroma.
● Night (No photosynthetic activity) → Stored starch and fat are broken down to sugars and
fatty acids and exported to the cytosol to be metabolized.

Photosynthesis Reactions Summary

Photo by CNX OpenStax / CC BY

WATCH OUT!

G3P is a three carbon molecule, so in order to make glucose, two G3P must leave the cycle. That
means that the cycle must proceed SIX TIMES to make 12 molecules of G3P such that 2 can leave
and make one glucose.

ANALOGY: Turns out you had a friend with you when you went through that revolving door. Even
though you got through it after 3 turns, you still have to wait for your friend to go through his 3 turns
for both of you to leave.

Watch the video tutorial for this lesson (8:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68983&activity_type=CourseLesson

7.4.2

Example: Turns Required for Glucose

How many turns of the Calvin cycle does it take to make one molecule of glucose?

Solution available online

Watch the video tutorial for this lesson (2:51)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69685&activity_type=CourseLesson

7.4.3

Practice: Calvin Cycle Variations

An expedition to planet X makes the discovery that plants there use 12-carbon sugars as their main
source of energy. Everything else about the plants on planet X is the same as the ones on Earth with
respect to the light-dependent reactions and the Calvin cycle. How many turns of the Calvin cycle
does it take to make one molecule of sugar that plants can use for energy on planet X?

A) 6 turns

B) 8 turns

C) 12 turns

D) 10 turns

View Solutions on Wizeprep.com

7.4.4

Practice: Calvin Cycle Molecules

Which of the following is true about the Calvin cycle?

A) For every molecule of CO2 consumed, 1 molecule of NADPH is also consumed

B) The ratio of ATP to NADPH used is 1:1

C) NADPH is reduced to NADP+ when it is used for energy

D) The ratio of 3-PGA to G3P produced is 1:1

View Solutions on Wizeprep.com

7.5 Photorespiration

7.5.1

Photorespiration
Before we talk about photorespiration, let's review where photosynthesis occurs in plants:

● Guard cells open and close pores called stomata depending on the environmental conditions
including light intensity, humidity, and CO2 concentration.

● Stomata let CO2 enter and and O2 to leave and also lead to water loss through transpiration.

● Stomata close during hot, dry conditions to prevent water loss, but this leads to a build up of
O2.

Photo by Zephyris / CC BY Photo by Ali Zifan / CC

Why is build up of O2 a problem?

● Rubisco, the enzyme that usually fixes CO2 can also use O2 as a substrate.

○ Photorespiration, also known as oxidative photosynthetic carbon cycle or C2

photosynthesis, is the process in which Rubisco adds an O2 to RuBP, rather than a CO2 as in
the Calvin Cycle.

○ This wastes energy and decreases sugar production.

● Under hot, dry conditions, photorespiration increases.

WATCH OUT!

Don't be alarmed that this cycle is showing the required amount of CO2 (6) to make a full
molecule of glucose instead of 3 which is required amount to allow one molecule of G3P to
leave.

● Some plants - C4 plants and CAM plants - have strategies to minimize this problem

● In C3 plants, 6 molecules of phosphoglycolate are produced in photorespiration.

○ Three of these go through a salvage pathway, recovering half of the 3-PGA. The other 3 are
lost to CO2.

Watch the video tutorial for this lesson (4:38)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68944&activity_type=CourseLesson

7.5.2

Practice: Problem of Photorespiration

Why is photorespiration a problem for plants?

A) The excess of oxygen prevents them from making O2 in the light-dependent reactions

B) The product of photorespiration makes the Calvin cycle inefficient

C) Two molecules of phosphoglycolate are made for every O2 consumed

D) The salvage pathway, although effective, is toxic to plants

View Solutions on Wizeprep.com

7.6 C4 Plants

7.6.1

C4 Plants
C4 plants have a mechanism to deal with photorespiration: they physically separate the light and
dark reactions.

● The light-dependent reactions occur in the mesophyll.

● The Calvin cycle occurs in the bundle sheath cells.

○ The result is no build up of O2 near Rubisco.

Photo by Kelvinsong / CC BY

Reminder of Light-Dependent Reactions

The Strategy of C4 Plants

● CO2 fixation occurs in the mesophyll by PEP carboxylase to produce oxaloacetate.

● Oxaloacetate is converted to malate and transported to the bundle sheath cells.
● Malate is broken down to release CO2 which then feeds into the Calvin cycle.
● A 3-carbon molecule called pyruvate is returned to the mesophyll and converted back to PEP.

Examples of C4 Plants:

Usually found in hot, dry climates: sugar cane, certain types of grass, maize (corn).

Watch the video tutorial for this lesson (2:23)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68945&activity_type=CourseLesson

7.6.2

Which of the following is true about the mechanism that C4 plants use to prevent photorespiration?

A) They separate light and dark reactions by time

B) They separate light and dark reactions physically in different cell types

C) They separate light and dark reactions physically in different compartments within the same cell

D) None of the above

View Solutions on Wizeprep.com

7.7 CAM Plants

7.7.1

CAM Plants
CAM plants also have a mechanism for dealing with photorespiration.

● Stomata open at night: CO2 enters, is fixed by PEP carboxylase and converted to malate.

● Malate is stored in vacuoles until daytime.

● Stomata close during the day: malate is broken down into CO2 which enters the Calvin cycle.

Examples of CAM Plants

Pineapple, cacti, succulents.

Watch the video tutorial for this lesson (3:41)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68946&activity_type=CourseLesson

7.7.2

Which of the following is correct about C4 and CAM plants?

A) These plants have adapted to live under wet, humid conditions

B) They have the same mechanisms for separating carbon fixation from the light-dependent
reactions

C) They both rely on maintaining a high concentration of CO2 near Rubisco

D) Malate is only a key molecule in C4 plants

View Solutions on Wizeprep.com

8. Plant Form, Function,

Growth, and
Development
8.1 Plant Characteristics

8.1.1 Plant Characteristics

Plant Characteristics

● Photoautotrphs: receive energy from the sun and carbon from CO2
○ Chlorophyll: specialized organs that generate sugars from sunlight, CO2 and water

● Immobile
○ Rooted producers

● Unlimited growth

Plant Cell Walls

● Rigid cell walls

○ Cellulose, Hemicellulose: rigid carbohydrates around outside of plant cell

○ Pectin: glues adjacent cells together

○ Provides structural support and protection

○ Prevents mobility

● Plasmodermata: channels that run through cells

○ Allows transport of materials throughout the plant

Watch the video tutorial for this lesson (1:20)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69655&activity_type=CourseLesson

8.1.2

Which of the following is used to glue adjacent plant cells together?

A) Cellulose

B) Hemicellulose

C) Pectin

D) Plasmodermata

View Solutions on Wizeprep.com

8.2 Plant Tissues

8.2.1

Plant Tissues
Simple Tissues

Parenchyma

● Perform most metabolic functions

in the plant

● Create and store organic products

Example: these cells contain the
Chlorophyll in leaves
Example: these cells store the
starch in roots

● Thin cell wall

● Alive at maturity

● Most cells can differentiate into other types of plant cells when needed

Collenchyma

● Groups of flexible elongated cells (strands)

● Provides flexible support for young plants

Sclerenchyma

● Rigid cells that provide structural support

● Contains Lingin: strong polymer for support

● Many are dead at maturity

○ Unable to grow / elongate

● Specialized cells for structural support

○ Sclerids: boxy, thick and irregular

○ Fibers: long slender groups of strands

Example: Hemp fibers are used to make rope and clothing

Photo by CNX OpenStax | CC BY

Complex Tissues

Xlyem

● Water-conducting cells

● Specialized elongated cells

● Dead at maturity

● Hollow cell walls transport

water throughout plant

● Tracheids: long, thin and

tapered cells with pits for
water to move to other cells

● Vessel elements: wider and

thicker cells for long distance
water transport

Phloem

● Sugar-conducting cells

● Specialized elongated cells

● Alive at maturity

● Composed of sieve-tube elements

○ lack nucleus, ribosomes, vacuole and cytoskeleton
○ improves movement of sugars through cell

○ Sieve Plates: ends of the cells with pores to allow fluid to pass through

○ Companion Cells: surround the sieve-tube elements and facilitate sugar loading

Photo by CNX OpenStax | CC BY

Photo by Kelvin Song | CC BY

Watch the video tutorial for this lesson (4:12)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69656&activity_type=CourseLesson

8.2.2

Sclerids and Fibers are specialized ____________ cells.

View Solutions on Wizeprep.com

8.2.3

The _____________ transports water inside the plant. These cells are ___________ at maturity.

View Solutions on Wizeprep.com

8.2.4

Explain why Phloem cells lack many essential components including nuclei, ribosomes, vacuole and
cytoskeleton.
Why are xylem cells not equally bare?

View Solutions on Wizeprep.com

8.3 Plant Tissue Systems and Organs

8.3.1

Tissue Systems

Dermal Tissue System

● Epidermis: outer protective

layer of dense cells

● Cuticle: waxy coating on

leaves and stems
○ Prevents water loss
○ Reduces disease
transmission

● Periderm: replaces epiderm

in older woody plants

● Specialized in different organs

○ Example: root epidermal cells form root hairs

Photo by Zephyris | CC BY

Vascular Tissue
System

● Transport of
water and
nutrients through
plant

● Xylem: water
transport

● Phloem: nutrient
transport

● Stele: vascular
tissue in the roots

● Symplastic:
transfer of fluids
through the living
cell

● Apoplastic: transfer of fluids through dead cell wall

Photo by KI3580 | CC BY

Ground Tissue System

● Tissues that are not Dermal

or Vascular

● Represents most of the

plant tissues
○ Parenchyma,
collenchyma and
sclerenchyma

● Pith: ground tissue inside

vascular system

● Cortex: ground tissue outside of vascular system

● Specialized for specific functions

Example: photosynthesis in the leaves or nutrient storage in the roots

Photo by Frank Vincentz | CC BY

Watch the video tutorial for this lesson (2:41)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69658&activity_type=CourseLesson

8.3.2

Plant Organs
Roots

● Anchors plants to the ground

● Absorbs minerals and water

● Epidermis lacks cuticle

○ Helps to absorb water

● Taproot: main vertical root

○ Penetrates hard soil to access
water and nutrients
○ Provides strong anchor for tall
plants

● Lateral Roots: branch off of

taproot, absorb most water and
nutrients

○ Root Hairs: modified

epidermis increases surface
area to improve absorption

Stems

● Provides structure for leaves to

attach

● Positions leaves to maximize

photosynthesis

● Nodes: branches where leaves attach

● Internodes: stem sections between nodes

● Apical Bud: tip of the shoot where most growth occurs

Photo by KelvinSong | CC BY

Leaves

● Main site for

photosynthesis

● Highly variable depending

on which function
○ Exchange gases
○ Control plant
temperature
○ Defend plant from
herbivores and
diseases

● Blade: flattened part of the

leaf

● Petiole: leaf stalk that

attaches to the stem

● Veins: vascular tissue of the leaf

Photo by KelvinSong | CC BY

Watch the video tutorial for this lesson (2:33)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70755&activity_type=CourseLesson

8.3.3

Describe the function of the cuticle on leaves and stems. What would happen if this were missing?

View Solutions on Wizeprep.com

8.3.4

_____________ describes the movement of fluids through dead cells, whereas __________________

describes movements of fluids through living cells.

View Solutions on Wizeprep.com

8.4 Reproduction

8.4.1

Angiosperm Reproduction

Angiosperm
Structures

● Flowers:
modified
leaves
(sporophylls)

○ Sepal and
Petals:
attract
pollinators,
non-
reproductive

○ Stamen:
filament
+ anther
■ Produces Microspore => male Gametophyte => pollen grain (sperm)
■ Anther: produces the pollen

○ Pistil: stigma + style + ovary

■ Produces Megaspore => female Gametophyte => egg
■ Each has 1 stigma, but may have many ovules

Angiosperm Life Cycle

● Anther produces the male gametophyte (pollen)

● Ovule produces the female gametophyte (megaspore)

● Pollen lands on stigma

○ pollen tube grows into ovary

● Double Fertilization: Pollen tube releases 2 sperm

○ 1 sperm fertilizes egg
○ 1 sperm initiates development of endosperm: stored food
■ Triploid Endosperm: 1 sperm + 2 female nuclei combine

Watch the video tutorial for this lesson (2:11)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=58907&activity_type=CourseLesson

8.4.2

Advantages of Angiosperm Reproduction

● Costly endosperm only created

after successful fertilization

● Female gametophytes are

smaller (cheaper and faster to
produce)
Recall: much less costly than
moss or fern female
gametophytes

● Fruit: Mature ovary with seed

○ May look very different from
original plant
○ Protects dormant seed
○ Attracts animals - aids in dispersal

● Types of seed dispersal

○ Wind: seed has "wings"
○ Adhesive: seed can stick (plants or animals)
○ Fleshy: seeds are tasty, eaten by animals

Importance to humans

○ Large portion of human diet

■ 80% of calories from just
six species
□ Wheat
□ Rice
□ Corn
□ Potatoes
□ Cassava
□ Sweet Potatoes

■ Typically all parts are

edible
Examples: Seed, Fruit,
Leaves, Roots, Tubers,
Flowers

○ Grown for other culinary purposes

Examples: Oil, Spices, Flavoring, Sugar

○ Drugs
■ Medicinal
■ Recreational

Watch the video tutorial for this lesson (2:09)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=58911&activity_type=CourseLesson

8.4.3

Angiosperm Pollination

Pollination is an incredibly important ecosystem function that can easily be disrupted with habitat loss
and development.

● Gymnosperms mostly wind pollinated

● Angiosperms 80% pollinated by animals

○ Some completely dependent on animals
○ Evolved mechanisms to attract
pollinators
■ Bright flowers: daytime, visual
attraction
■ Smelly flowers: nighttime, usually
colorless

● Co-Evolution (plant + pollinator)

○ Reciprocal relationship: diversification
of plants occurred at the same time as
pollinator diversification
■ Both exert selective pressures on
each other (selective agents)
□ Co-evolve

○ Symbiotic Relationship:
■ Plants spend less energy producing less pollen
■ Instead, plants produce flowers, nectar etc. to attract pollinators to spread gametes
■ Pollinators receive nectar / pollen (food)

Darwins Orchid Example

● Moth pollinated plant

● Plant has long tube to access nectar

● Moth's tongue was not long enough, so it rubbed its face against pollen (thus spreading pollen
between plants)

● Moth evolved longer tongue to reach nectar more easily

● Plant responded by evolving longer tube

● Cycle continues until both species have exaggerated traits

● Also an example of Directional Selection

Photo by Esculapio | CC BY Photo by Bernard Dupont | CC

Watch the video tutorial for this lesson (2:54)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=58913&activity_type=CourseLesson

8.4.4

Practice: Angiosperms
Which of the following are NOT part of angiosperm flowers?

Sepals

Stamen

Apical Meristem

Carpels

View Solutions on Wizeprep.com

8.4.5

Practice: Angiosperms
Which of the following DOES NOT occur during double fertilization?

Pollen releases two sperm

One sperm fertilizes egg

One sperm begins endosperm development

Sperm travels to egg through water

View Solutions on Wizeprep.com

8.4.6

Practice: Angiosperms
Which of the following are NOT advantages of fruit production?

Protects the seed

Can aid in dispersal

Attracts animals which eat it

Cheaper to produce fruit

View Solutions on Wizeprep.com

8.4.7

Practice: Angiosperms
Which term best describes the example of the Darwins Orchid and the Moth pollinator?

Disruptive Selection

Co-Evolution

Double Fertilization

Sexual Selection

View Solutions on Wizeprep.com

9. Plant Nutrition and

Transport Processes
9.1 Water Transport

9.1.1

Water Transport

Short Distance Water Transport

● Plants use active and passive transport of solutes

○ Plants use primarily Hydrogen pumps
■ Not Sodium pumps as in animals

■ Plants use ATP to pump Hydrogen against its

gradient
■ Use this Hydrogen gradient to take in neutral
solutes (e.g. sucrose) through cotransport

□ Cotransport: coupled transport of

substance A using the energy from the
favorable movement of substance B down
its concentration gradient

● Plants gain or lose water through osmosis

○ Osmosis: diffusion of free water across a membrane

○ Water Potential: physical property that predicts which way water will move across a
membrance

■ Depends on solute concentration and pressure

■ Water moves from high water potential to low water potential

Example: If a plant is put into a solution with a lower water potential than the plant,
water will move out of the plant

■ The greek letter Psi (Ψ) is used to symbolize water potential

■ Ψ uses the units MPa (megapascal), a unit of force

Water Potential Equation

● Water potential is determined using

the water potential equation:

Ψ = ΨS + ΨP

● Ψ = Water potential
○ Describes which way the water
will move
○ Negative values = water leaving
the cell
○ Positive values = water entering
the cell

● ΨS = Solute potential

○ Proportional to the molarity

○ Also called osmotic potential

● ΨP = Pressure potential

○ Physical pressure of the water

○ Can be positive or negative

Photo by Katiestu | CC BY

WIZE TIP

Water potential refers to the waters potential energy, so if a solution has HIGH water potential,
that means the solution can do work (like push water into or out of a cell). This is the same as a
ball on a hill, the ball has high potential energy and can use that energy to roll down the hill.

Effects of water on plant cells

● Flaccid: plant is limp, wilted

○ Water has left the cell

○ Occurs when you put a plant in a solution with greater solute concentration
Example: when you forget to water your plants and they become wilted

○ Plasmolysis: the act of the plant cell shrinking and pulling away from the rigid cell wall

● Turgid: plant is firm

○ Water has entered the cell

○ Occurs when you put a plant in a solution with less solute concentration
Example: when you put wilted flowers in a vase with pure water and they perk up

Photo by LadyofHats | CC BY

Long Distance Water Transport

● Bulk Flow: water travels long distance due to a pressure gradient

○ Does not rely on solute concentration

● Moves through the Xylem and Phloem

Watch the video tutorial for this lesson (5:57)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69665&activity_type=CourseLesson

9.1.2

Calculate the water potential of a plant cell where the solute potential is -0.5 MPa and the pressure
potential is -0.3MPa.
What direction will water move?

View Solutions on Wizeprep.com

9.1.3

When placed into an unkown solution, a plant went from being flaccid to turgid.
What was the solution?

A) Hypertonic

B) Isotonic

C) Hypotonic

D) Osmolarity

View Solutions on Wizeprep.com

10. DNA Technology

10.1 In Vitro DNA Replication: Polymerase
Chain Reaction (PCR)
10.1.1 Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction

In vitro method of replicating/amplifying DNA which means that this lab technique uses the same
concepts of DNA replication to amplify a region of choice from a target DNA in a tube.

● Within a test tube there is a thermostable DNA polymerase (Taq polymerase),

deoxyribonucleotides of all varieties, the DNA template to be amplified, and primers for both
strands of the DNA.

● A thermocycler cycles through various temperature to carry out the process.

● 3 steps involved:

○ Denaturation

○ Annealing

○ Elongation

Adapted from photo by Enzoklop / CC BY

Differences from DNA Replication in the Cell

● Using heat to unwind DNA strands instead of helicase.

○ Completely denatures DNA into single strands (not a progressive unwinding).

● Primers are artificially designed and already provided in the test tube.

○ These primers are made of DNA, instead of RNA like in the cell.

○ Primers dictate where the replication reaction will occur to allows us to specify the region of
interest.

● Only a small region is amplified as opposed to the whole DNA template.

● Millions of copies of the target region is made as opposed to only two copies that occur in the
cell before it divides.

● No lagging or leading strands involved.

Primer Design

Primers are required in order to amplify only the region of the genome that is required.

● These primers must be flank the region of DNA that we want to amplify and be complementary
to the strands.

● They are usually 18-22 base pairs.

Adapted from photo by Richard Wheeler / CC BY

WATCH OUT!

Exam questions often ask for both primers to be listed in the 5' to 3' direction. In this case, the
reverse primer must be listed as the reverse of the bottom strand.

Watch the video tutorial for this lesson (10:08)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69230&activity_type=CourseLesson

10.1.2

Primer Design
Primers are required in order to amplify only the region of the genome that is required.

● These primers must be flank the region of DNA that we want to amplify and be complementary
to the strands.

● They are usually 18-22 base pairs.

Adapted from photo by Richard Wheeler / CC BY

WATCH OUT!

Exam questions often ask for both primers to be listed in the 5' to 3' direction. In this case, the
reverse primer must be listed as the reverse of the bottom strand.

Watch the video tutorial for this lesson (3:29)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70270&activity_type=CourseLesson

10.1.3 Example 1

Example: PCR Products

Consider the following DNA template where the region of interest that you want to amplify is
highlighted in red.

1. Draw arrows were primers would bind and in what orientation.

Solution available online

2. Draw out the PCR products that result after 3 divisions.

Solution available online

3. How many double stranded molecules of DNA do you have after 3 division? How many are ones
that match up to only the area of interest?

Solution available online

Watch the video tutorial for this lesson (5:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69236&activity_type=CourseLesson

10.1.4

Practice: Steps of PCR

Explain the reasons for using a thermocycler? Why is the temperature raised and lowered at certain
points?

A) To ensure that the DNA will not be damaged if it's heated for too long

B) To ensure that the DNA polymerase used does not get denatures

C) Different temperatures are required for different steps of PCR

D) To prevent the formation of any hydrogen bonds during the entire PCR

View Solutions on Wizeprep.com

10.1.5

Practice: Designing Primers

Given the following DNA sequence, list the 6-base primer you can use to amplify the pink region.
Please give directionality.

3'-AGCTGAGTATCGGTCCTAACAGTCAACCGCCT-5'
5'-TCGACTCATAGCCAGGATTGTCAGTTGGCGGA-3'

View Solutions on Wizeprep.com

10.2 Agarose Gel Electrophoresis

10.2.1

(Agarose) Gel Electrophoresis

This technique is often coupled with PCR to check whether the expected nucleotide fragment was
generated during PCR. The molecules of DNA are mobilized through a layer of gel (made of agarose)
by an electric current, the molecules separate according to size.

● RNA/DNA are negatively charged molecules.

● The nucleic acids are placed in a small hole called a well on an agarose gel.

● An electrical current is then applied to the gel.

● The negatively charged nucleic acids move through the gel towards the positive end.

● The gel acts like a matrix.

● Smaller sized nucleic acids move more quickly through the matrix, while larger nucleic acids
move more slowly.

● This separates nucleic acids based on size.

Photo by Jennifer0328 / CC BY

● A DNA ladder (standard sample) is usually used so that the size of the DNA molecules produced
by the PCR can be measured/compared.

● Below is how a 600 base pair (bp) fragment produced by PCR would look like on gel
electrophoresis.

Photo by Mckenzielower / CC BY

Watch the video tutorial for this lesson (3:27)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71699&activity_type=CourseLesson

10.3 Gene Cloning

10.3.1

Overview of Gene Cloning

Gene cloning can be done when scientists want a gene to be expressed in a bacterial host. This is
done in a series of steps:

1. Amplify gene of interest

2. Put gene in plasmid
3. Put plasmid in bacteria
4. Bacteria expresses gene
5. Purify protein

Step 1: PCR with restriction sites

Restriction sites are sequences of DNA that are recognized by specific enzymes (endonucleases).
These sites can be added to the gene of interest by designing primers.

● Primers partly match the DNA to be amplified.

● The "hanging end" has the sequence we want to introduce and ends up amplified during PCR.

Step 2: Digestion and ligation

Plasmid and PCR product are cut with restriction enzymes or endonucleases (REs).

● Digestion with restriction enzymes creates complementary sticky ends.

● DNA ligase sticks them together.

Steps 3 & 4: Introduction of DNA in bacteria and gene expression.

Plasmids are inserted in bacterial cells.

● Bacteria transcribe and translate the gene.

● Protein is produced and can be purified.

Watch the video tutorial for this lesson (5:07)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71887&activity_type=CourseLesson

11. Metabolism and

Enzymes
11.1 Overview of Metabolism

11.1.1

Overview of Metabolism
Metabolism is the collection of all chemical reactions that take place inside the cell.

● Anabolism refers to the metabolic pathways that synthesize complex molecules from simpler
ones, using up energy.
Example: making glucose from photosynthesis; proteins from amino acids.

● Catabolism refers to the metabolic pathways that break down complex molecules to simpler
ones, releasing energy.
Example: cellular respiration (breaking down glucose).

Photo by Muessig / CC BY

Watch the video tutorial for this lesson (4:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70438&activity_type=CourseLesson

11.1.2

Nutrients Required by Cells

Cells require several nutrients in order to engage in catabolic and anabolic processes.

● Major bioelements (C, N, P, S, O, H)

● Minor bioelements (Fe, Ca, Mg, Zn, etc.)
● Vitamins
● Electrons
● Energy

Metabolic Classification

Organisms are grouped on the basis of their sources of energy, electrons, and carbon.

Watch the video tutorial for this lesson (3:54)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70553&activity_type=CourseLesson

11.1.3

Practice: Organism Classifications

Describe the energy, electron and carbon source of the following organisms

a) Photoorganoheterotroph:

Energy source is (sunlight/ preformed molecules) .

Electron donor is (organic/ inorganic) compound.

Carbon source is (organic/ inorganic) compound.

b) Chemolithoheterotroph:

Energy source is (sunlight/ preformed molecules) .

Electron donor is (organic/ inorganic) compound.

Carbon source is (organic/ inorganic) compound.

View Solutions on Wizeprep.com

Solutions to these questions, as well as step-by-step breakdowns of the answers at:

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=105346&activity_type=QuizQuestion

11.1.4

Practice: Anabolism
Define anabolism:

A) Breaking down complex molecules to simpler ones

B) Pumping ATP from the inner mitochondrial membrane

C) Joining two glucose molecules through a glycosidic linkage

D) Synthesizing complex molecules from simpler ones

E) None of the above

View Solutions on Wizeprep.com

11.1.5

Practice: Major Bioelements

Which one of the following is not a MAJOR bioelement?

View Solutions on Wizeprep.com

11.2 Redox Reactions

11.2.1

Redox (Reduction-Oxidation) Reactions

These types of reactions are important in biology and occur very often in the cell.

● An oxidation reaction is always coupled with a reduction reaction.

● Oxidation is the loss of electrons by an atom (said atom is oxidized);

● Reduction is the gaining of electrons by an atom (said atom is reduced).

WIZE CONCEPT

Oxidized atoms can be seen as either losing bonds with hydrogen atoms (e-) or gaining bonds
to oxygen atoms;
Reduced atoms can be seen as gaining bonds to hydrogen atoms or losing bonds to oxygen
atoms.

Watch the video tutorial for this lesson (7:21)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70452&activity_type=CourseLesson

11.2.2

Practice: Redox (Reduction-Oxidation) Reactions

Rank compounds 1-5 from least to most oxidized:

A) 5, 2, 3, 1, 4

B) 5, 3, 4, 1, 2

C) 2, 1, 4, 3, 5

D) 3, 4, 5, 2, 1

View Solutions on Wizeprep.com

11.2.3

Practice: Redox Reactions 2

Looking at the reaction below, what is true for the 4 numbered carbons?

A) Carbons 1 and 2 are reduced, whereas carbons 3 and 4 are oxidized

B) Carbon 1 is oxidized, carbon 2 is reduced and carbons 3 and 4 are unchanged

C) Carbon 1 and 2 are unchanged, and carbons 3 and 4 are reduced

D) Carbon 1 is reduced, carbon 2 is reduced and carbons 3 and 4 are unchanged

E) Carbons 1, 2, 3, and 4 are reduced

View Solutions on Wizeprep.com

11.3 Laws of Thermodynamics

11.3.1

The Laws of Thermodynamics

The First Law of Thermodynamics

The first law of thermodynamics is that energy cannot be created or destroyed, only transferred
from one form to another.

The energy of an isolated system such as the universe is constant.

The Second Law of Thermodynamics

The second law states that a system naturally moves toward more disorder. That is, its entropy
always increases.

● Entropy is denoted by the letter S.

● This can also be related to the first law by thinking of the energy transfer. Every transfer of
energy from one form to the other increases the universe's entropy.

● If a system is naturally moving toward more disorder, then it will take work to keep or create
order.
Example: Once you clean your bedroom, it doesn't take long to make a mess again. In order to
keep it clean and in order, we need to do work.

Photo by CNX OpenStax / CC BY

Energy In Biology

● Sometimes the energy used in a reaction is not equal to the energy of the structure in the end.

○ Where does the energy go? ––> it can be released as heat, light, sound, or movement for
example. This means not all the energy is harnessed into the structure of the molecule or in a
usable/useful way.

Example: ATP hydrolysis reaction results in a lower energy molecule of ADP. The energy
generated by breaking phosphate bonds in ATP releases energy that can be used for other
reactions.

Photo by Muessig / CC BY

Watch the video tutorial for this lesson (7:44)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70495&activity_type=CourseLesson

11.3.2

Example: Entropy
Consider the following reaction. Did the entropy of this system increase or decrease by creating these
products?

AB(l) --> A(g) + B(g)

Solution available online

Watch the video tutorial for this lesson (2:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70500&activity_type=CourseLesson

11.3.3

Practice: Laws of Thermodynamics

According to the laws of thermodynamics:

A) The entropy of the universe always tends to decrease

B) Energy cannot be created or destroyed, only transformed

C) The enthalpy of processes always decreases

D) Work is not usually required to maintain order

View Solutions on Wizeprep.com

11.4 Types of Energy [Potential, Kinetic, Free

& Activation]
11.4.1

Types of Energy
Energy is key in biological systems. There are two basic types or forms of energy: kinetic and potential
energy.

● Kinetic energy (KE) is energy due to motion.

● Potential energy (PE) is energy that is stored.

○ Untapped energy stored in chemical bonds or excited chlorophyll.

● Energy transduction is the change of one form of energy into another form.

Watch the video tutorial for this lesson (3:05)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70497&activity_type=CourseLesson

11.4.2

Practice: Kinetic and Potential Energy

Which of the following is not correct?

A) Electrons moving around a nucleus is an example of kinetic energy

B) Flagella pushing cells forward is an example of kinetic energy

C) A skydiver jumping from an airplane has potential energy

D) A high energy ATP bond is an example of kinetic energy

View Solutions on Wizeprep.com

11.4.3

Energy in Reactions
Energy changes in chemical reactions are usually measured as changes in enthalpy (H). It can be
thought of as the energy flow between a system and surroundings.

● Energy stored in chemical bonds is a type of potential energy.

● In a chemical reaction, some bonds may break and others may form.

○ Breaking bonds always requires energy, forming bonds releases energy.

● This system may absorb energy or release energy in the form of heat.

○ Exothermic →Heat content of the product is less than the reactants (heat is released) =
−ΔH .

Photo by Brazosport College / CC BY

○ Endothermic →Heat content of the product is more than the reactants (heat is required) =
+ΔH .

Photo by Brazosport College / CC BY

WATCH OUT!

Exothermic ≠ spontaneous!
Spontaneity is measured by Gibbs free energy, not enthalpy.

Biological systems are open systems. A negative ΔH means that energy within the system decreased
and was released into the surroundings as heat. A positive ΔH means that energy within the system
increased and was added from the surroundings as heat.

Watch the video tutorial for this lesson (7:19)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70554&activity_type=CourseLesson

11.4.4

Example: Enthalpy of a Reaction

Bond energies for bonds between many elements can be found. They represent the amount of energy
required to break a bond, in the case of reactants, or the energy released when a bond is formed, in
the case of products. Given the bond energies for the reactants and products, what is the enthalpy of
this reaction? Is it endothermic or exothermic?

H2 + I2 --> 2 HI
H-H bond energy: 436 kJ/mol
I-I bond energy: 151 kJ/mol
H-I bond energy: 297 kJ/mol

Solution available online

Watch the video tutorial for this lesson (4:53)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70521&activity_type=CourseLesson

11.4.5

Activation Energy
Because bonds always require energy to break, naturally reactions require some energy input to
start. This is called the activation energy of a reaction.

Enzymes help to lower the activation energy of a reaction, making them more likely to occur.

Photo by Brazosport College / CC BY

WATCH OUT!

Even exothermic reactions have activation energy barriers!

Watch the video tutorial for this lesson (3:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70555&activity_type=CourseLesson

11.4.6

Gibbs Free Energy

Is a measure of the amount of a usable energy of a system. It includes both enthalpy and entropy.

● The change in free energy is shown in an equation as ΔG and it relates to enthalpy and entropy
as follows:

ΔG = ΔH - TΔS

● Gibbs was able to show that at constant temperature and pressure we can estimate whether a
process will be favorable or not.

● If a process is favorable, we say it will happen spontaneously without any extra work. This is
called an exergonic reaction and ΔG is negative.

● If a process is not favorable, we say it requires an input of energy in order to take place. This is
called an endergonic reaction and ΔG is positive.

Photo by CNX OpenStax / CC BY

Standard Free Energy Change (ΔGo) is sometimes used.

● It is the change in free energy under standard conditions (298 K, 1 atm partial pressure of each
gas, 1 M concentration of each solute). Note that ΔG which might occur intracellularly, is
sometimes different than ΔGo.

WIZE CONCEPT

Spontaneous reactions have an overall negative ΔGo. If a reaction is spontaneous, then under
the same conditions, it would be non-spontaneous in the reverse direction.

● If ΔG < 0 the process is irreversible (exergonic) and proceeds forward.

● If ΔG > 0 the process is (endergonic) which means it will proceed "backwards".

● If ΔG = 0 the process is reversible and can go in either direction.

Watch the video tutorial for this lesson (8:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70498&activity_type=CourseLesson

11.4.7

Practice: Types of Energy

Select the correct statement:

A) If a reaction is exothermic, it must be spontaneous

B) Exergonic reactions do not have activation energies because they are spontaneous

C) Regardless of whether a reaction is spontaneous or releases energy, it always takes energy to

break bonds

D) Gibbs free energy only takes entropy into account to determine reaction spontaneity

View Solutions on Wizeprep.com

11.5 Coupled Reactions

11.5.1

Coupled Reactions
In our cells, some reactions can happen spontaneously (exergonic) while others do not (endergonic).
However, we often need both types of reactions to happen for basic cells processes. How can we get
those non-spontaneous reactions to occur?

● Two reactions that happen together: one helps the other.

● An energetically unfavorable reaction (endergonic - positive ΔG) is coupled with a favorable

reaction (exergonic - negative ΔG), making the overall process favorable.

Example: In the first reaction of glycolysis, glucose becomes phosphorylated (1), and ATP loses a
phosphate (2). ATP hydrolysis into ADP always releases energy. Addition of phosphate to
glucose requires energy.

Think of ATP as a hiker who wants to come down from the top of a mountain. He can jump onto a
seesaw and propel another hiker up.

WIZE CONCEPT

ATP is considered the "energy currency" of the cell because it is so often used to drive other
reactions forward.

● Each individual reaction has its own value of ΔG.

● Coupled reactions have a NET change in energy that is still exergonic (negative ΔG and
favorable).

Photo by Muessig / CC BY

Watch the video tutorial for this lesson (6:11)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70480&activity_type=CourseLesson

11.5.2

Example: Endergonic or Exergonic?

The ΔG for the following equation is +34 kcal.

1. Is this reaction exergonic or endergonic?

2. Which direction should the arrow go? (will the reaction proceed to the left or right?)

CH4 + 2 O2 ------- CO2 + 2 H2O

Solution available online

Watch the video tutorial for this lesson (1:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70491&activity_type=CourseLesson

11.5.3

Practice: Biosynthesis Coupling

Endergonic biosynthesis reactions become spontaneous when couple with:

A) ADP dehydration

B) ATP hydrolysis

C) Exergenesis

D) Endergenesis

E) Phosphorylation

View Solutions on Wizeprep.com

11.5.4

Practice: Reactions that Require Coupling

Which of the following reactions would likely requires ATP coupling to occur?

A) Ice melting into liquid water

B) Monosaccharides becoming complex sugars

C) Nucleic acids breaking into nucleotides

D) Pyruvate being processed in the TCA cycle

View Solutions on Wizeprep.com

11.6 ATP Energy and the Proton Motive

Force (PMF)
11.6.1

ATP and the Proton Motive Force (PMF)

Adenosine TriPhosphate is an energy storage molecule. It stores potential energy (PE) between the
negative charges of the phosphate groups.

Photo by OpenStax College / CC BY

WIZE TIP

Keeping those negatively charged phosphates next to one another is like keeping three people
who really hate each other locked in a small closet.

ATP hydrolysis releases free energy (negative ΔG).

AT P(aq) + H2O(l) → ADP(aq) + P i(aq)

How Does the Cell Create ATP?

● ATP is not the only way cells store energy. Another way is by generating an electrochemical
gradient.

Example: During cellular respiration in our cells, electron energy is used to pump H+ across the
plasma membrane to generate an electrochemical gradient called the proton motive force
(PMF).

● The PMF can then be used to synthesize ATP.

The amount of energy stored across a membrane can be calculated using the formula:

ΔG = RTln([x]f inal /[x]initial )

R = gas constant (8.314 J/mol K)

T = temperature in K
[x]initial = molar concentration of X on the outside of the membrane

[x]f inal = molar concentration of X on the inside of the membrane

Watch the video tutorial for this lesson (6:07)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70508&activity_type=CourseLesson

11.6.2

Example: ATP Synthesis

Sketch and estimate the Gibbs free energy required to create an ATP molecule from ADP.

Solution available online

Watch the video tutorial for this lesson (1:23)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70561&activity_type=CourseLesson

11.6.3

Practice: ATP Energy

Which of the following is true?

A) Since ATP hydrolysis is exergonic, no energy is required to break its bonds

B) ADP has no more phosphate bonds

C) ATP production is often coupled with protons moving down their electrochemical gradient

D) ATP synthase removes a phosphate from ADP

View Solutions on Wizeprep.com

11.7 Enzymes

11.7.1

Enzymes
Enzymes are proteins that catalyze biochemical reactions.

● They have the ability to change the rate of the reaction (i.e. they make slow reactions faster).

● Enzymes are types of catalysts. This means they help a reaction, but they are not used up in the
process of the reaction.

● The name of an enzyme ends with "ase."

Example: Synthase, lactase.

● Enzymes lower the activation energy of reactions (EA) which means they lower the energy
required for the reaction to occur.

○ They DO NOT change a reactions free energy (ΔG).

○ They work by stabilizing the transition state:

A + B − C → A...B...C → A − B + C
(transition state)

Photo by Muessig / CC BY

Enzymes Specificity

Enzymes are specific to one (or a few) substrates, and have an active site that binds to its particular
substrate.

● Induced fit – active site changes upon substrate binding for better fit/catalysis.

● The active site holds the molecules in a position that promotes a reaction to occur.

Watch the video tutorial for this lesson (6:22)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70513&activity_type=CourseLesson

11.7.2

Enzyme Activity
Enzyme Activity And Its Effect On the Rate of a Reaction

The activity of an enzyme can be affected by other factors in the body.

● Substrate concentration ––> the more substrate (substance reacting), the faster the reaction
rate is going to be.
Analogy: a cashier is only busy when there are customers around.

● Temperature and pH ––> Enzymes often only work at a specific temperature and pH. If they
don't have the correct environment, they will denature (loose its shape).
Example: pepsin (stomach enzyme) works best at pH 2.0.

● Enzyme activity can be helped by cofactors or coenzymes (small helper molecules).

Example: cofactors include vitamin B6, zinc, and magnesium (these are NOT proteins).

Watch the video tutorial for this lesson (4:10)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71134&activity_type=CourseLesson

11.7.3

Example: Enzyme Catalysis

Which line below represents the enzyme-catalyzed reaction, blue or pink?

Solution available online

Watch the video tutorial for this lesson (1:03)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70517&activity_type=CourseLesson

11.7.4

Practice: Enzymes and Delta G

Enzymes lower the overall delta G of a reaction, true or false?

Answer

View Solutions on Wizeprep.com

11.8 Enzyme Regulation

11.8.1

Enzyme Regulation
The rate at which enzymes work or how well they function can be regulated by other molecules that
are not their substrate. An enzyme inhibitor is any chemical which binds to an enzyme and inhibits its
function without producing gross alterations to its 3D structure. Inhibition of an enzyme will slow the
rate of reaction.

1. Irreversible inhibitors – Enzyme inhibitors that permanently inactivate enzymes. Usually form
covalent bonds with the enzyme.

2. Reversible inhibitors – Enzyme inhibitors that reversibly inactivate enzymes. These include
competitive and non-competitive inhibitors.

a. Competitive Inhibitors – Compete with the substrate for active-site binding, thereby
reducing the rate that a “real” substrate binds.

b. Non-Competitive Inhibitors - Molecule binds non-covalently to an allosteric site (location

other than the active site), causing the enzyme to change shape and decreasing its affinity
for the substrate.

Effect of Inhibitors on Reaction Rate

Different types of inhibitors affect an enzyme's rate of reaction differently.

● Note that in the presence of competitive inhibitors, enzyme can still reach its maximum rate if
enough substrate is added.

● With non-competitive inhibitors, the maximum reaction rate is decreased.

Photo by CNX OpenStax / CC BY

Watch the video tutorial for this lesson (10:22)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70516&activity_type=CourseLesson

11.8.2

Feedback Inhibition
Enzymes should only be effective or active when they are truly needed. If an enzyme is there to
produce a certain molecule, it doesn't have to keep producing it when the cell already has enough of it.
So, the final product can often bind to that enzyme allosterically to prevent it from endlessly
making more.

Example:

● An enzyme breaks down sugar into individual glucose molecules for the cell to use.

● Once it starts to produce a certain level of glucose which is sufficient for the cell, the glucose
molecules themselves will bind to the enzyme, change the shape of its active site so it doesn't
recognize sugar and stops producing glucose.

● Once the levels are low, there will be more unbound enzyme so more glucose can be made.

Watch the video tutorial for this lesson (3:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70518&activity_type=CourseLesson

11.8.3

Example: Non-Competitive Inhibitors

Non-competitive inhibitors block the binding of the substrate to the active site. Is this statement true
or false? Draw how they affect an enzyme's overall reaction rate.

Solution available online

Watch the video tutorial for this lesson (2:30)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70519&activity_type=CourseLesson

11.8.4

Example: Inhibitor Effects

Enzyme X is allosterically regulated by inhibitor Y. Inhibitor Y is present in high concentrations when
the cell is under stress conditions.

a) How would the activity of enzyme X under normal cellular conditions compare to the activity of
enzyme
X under stress conditions?

Solution available online

b) If the gene coding for enzyme X is mutated and the enzyme is no longer able to bind to inhibitor
Y,
how would this affect the activity of enzyme X (i) under normal cellular conditions and (ii) under
stress
conditions?

Solution available online

c) Would increasing concentrations of the substrate of enzyme X increase its activity under stress
conditions? Why or why not?

Solution available online

d) If inhibitor Y was a competitive, reversible inhibitor instead of an allosteric inhibitor, would

increasing
concentrations of the substrate increase the enzyme’s activity under stress conditions? Why or
why not?

Solution available online

e) If inhibitor Y was a competitive, irreversible inhibitor instead of an allosteric inhibitor, would

increasing

concentrations of the substrate increase the enzyme’s activity under stress conditions? Why or
why not?

Solution available online

Watch the video tutorial for this lesson (6:04)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70520&activity_type=CourseLesson

11.8.5

Practice: Enzyme Inhibitors

lnvirase and Nevirapine are both drugs used to treat HIV. Invirase is a competitive inhibitor of HIV
protease and nevirapine is a non-competitive inhibitor of reverse transcriptase. If the blue line in the
graph below represents uninhibited enzyme activity, which line represents Invirase activity (orange or
green)?

Answer

View Solutions on Wizeprep.com

12. Cellular Respiration

12.1 Overview of Cellular Respiration

12.1.1

Overview of Cellular Respiration

Cellular respiration is a set of catabolic reactions that allows organisms to convert biochemical
energy from nutrients into ATP. Aerobic (meaning, in the presence of oxygen) cellular respiration can
be broken down into 4 stages:

1. Glycolysis
2. Pyruvate processing / oxidation
3. Citric acid cycle / Kreb’s cycle / tricarboxylic acid (TCA) cycle
4. Electron transport chain (ETC) and ATP synthesis

Molecules that can store energy

1. ATP - energy carried via a phosphate group

2. NADH or NADPH - energy carried via electrons and hydrogen
3. FADH2 - energy carried via electrons and hydrogen

There are two types of cellular respiration: aerobic respiration (requires oxygen; redox reaction) and
anaerobic respiration (does not require oxygen).

Watch the video tutorial for this lesson (4:08)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68881&activity_type=CourseLesson

12.2 Glycolysis

12.2.1

Glycolysis
Glycolysis is a catabolic process in which ATP is produced through the extraction of chemical energy
from glucose to produce pyruvate.

● Glycolysis is split into two main phases: the investment phase (ATP is spent to phosphorylate)
and the payout phase (ATP is produced).

Glycolysis Products

At the end of glycolysis, the energy from glucose has been stored in:

1. 2 pyruvate
2. 2 ATP
3. 2 NADH

Pyruvate produced by glycolysis has 2 possible fates → cellular respiration if oxygen is present, or
fermentation if it is not.

Watch the video tutorial for this lesson (3:35)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68882&activity_type=CourseLesson

12.2.2

Practice: First Five Steps of Glycolysis

What is the yield of the first 5 steps of glycolysis? Select all that apply.

A) Plus 2 ATP

B) 2 high-energy three carbon molecules, containing phosphate groups

C) Minus 2 ATP

D) 2 NADH

View Solutions on Wizeprep.com

12.2.3

Which of the following processes occurs in the cytosol of eukrayotes?

A) Krebs cycle

B) Glycolysis

C) ETC

D) Chemiosmosis

View Solutions on Wizeprep.com

12.2.4

Practice: Product of Glycolysis

What is the carbohydrate product of glycolysis in the cytosol?

A) Acetyl CoA

B) NADH

C) Pyruvate

D) FADH2

E) G3P

View Solutions on Wizeprep.com

12.3 Energy of Glucose Metabolism

12.3.1

Energy of Glucose Metabolism

Glucose is metabolized via several connected and coupled reactions. The potential energy in glucose
bonds are converted into potential energy in the bonds of ATP and electron carriers.

● Glycolysis has an overall negative ΔG, and the energy is transferred to energy-storing molecules
ATP, NADH, and FADH2.

● ATP produced in glycolysis is called Substrate Level Phosphorylation and occurs in the
cytoplasm.

WIZE TIP

Reminder: Oxidized atoms are losing electrons (or losing bonds with hydrogen atoms) and
reduced atoms can be seen as gaining electrons (or gaining bonds to hydrogen atoms).

Watch the video tutorial for this lesson (6:41)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=69687&activity_type=CourseLesson

12.3.2

Practice: Glycolysis Electron Carriers

This/These electron carriers are produced during glycolysis (select all that apply)

A) NADH

B) FADH2

C) Water

D) GTP

View Solutions on Wizeprep.com

12.4 Glycolysis Regulation

12.4.1

Regulation of Glycolysis

● Glycolysis is regulated at 3 steps that are the most exergonic and irreversible.

● These 3 reactions are catalyzed by enzymes that are allosterically regulated.

○ This means they are regulated by a molecule binding to another site that is not its active site.

The following three enzymes are allosterically regulated in glycolysis:

1. Hexokinase
2. Phosphofructokinase
3. Pyruvate Kinase

Hexokinase

Photo by YassineMrabet / CC BY

● Inhibited by the product it makes: G6P.

○ Enzyme active when G6P levels are low (when glycolysis is active).
○ Enzyme inhibited when G6P levels are high (when glycolysis slows down).

Phosphofructokinase (PFK)

Photo by YassineMrabet / CC BY

● The key regulator of carbohydrate metabolism in the cell.

● PFK inhibitors:
○ High levels of ATP
■ When too much ATP is present, it can bind to the regulatory site on the enzyme and lower
its affinity for the substrate.

○ High levels of citrate

■ As citrate builds up form TCA cycle, it causes glycolysis to slow down by inhibiting PFK.

○ Protons (H+)
■ Prevents excessive formation of lactic acid.
■ Low pH (acidic conditions) will inhibit PFK.

● PFK activators:
○ High levels of AMP
■ AMP competes with ATP for binding the PFK regulatory site.
■ AMP binding at the regulatory site prevents ATP binding → no inhibition of PFK by ATP.
■ Think about it like this: if there's a lot of AMP, there's low ATP. Therefore, we need more
glycolysis.

○ High levels of Fructose-2,6-Bisphosphate (F-2,6-BP)

■ Enhances PFK activity by increasing the affinity of PFK to its substrate F6P.

Pyruvate Kinase

● Main function is to produce pyruvate + ATP.

● Pyruvate kinase inhibitors:

○ High levels of ATP
○ The amino acid alanine

● Pyruvate kinase activators:

○ High levels of Fructose-1,6-Bisphosphate (F-1,6-BP)

Photo by YassineMrabet / CC BY

Watch the video tutorial for this lesson (8:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68908&activity_type=CourseLesson

12.4.2

Practice: PFK regulation

What effect does Fructose-2,6-bisphosphate have on glycolysis?

Effect

View Solutions on Wizeprep.com

12.4.3

Practice: Regulation of PFK-1

Which statement is FALSE about the PFK-1 reaction in glycolysis?

A) PFK-1is activated by F-2,6-BP

B) PFK-1 is activated by AMP

C) PFK-1 is activated by ATP

D) None of the above

E) More than one of the above

F) All of the above

View Solutions on Wizeprep.com

12.5 Glycolysis: Important Takeaways

12.5.1

Glycolysis Full Sequence of Reactions and Summary

Photo by YassineMrabet / CC BY

● Three irreversible steps:

○ 1. Glucose to glucose 6-phosphate
○ 2. Fructose 1,6-biphosphate
○ 3. Phosphoenolpyruvate (PEP) to pyruvate

● ATP Balance:
○ Two ATP consumed in the first half
○ Two ATP produced in the second half x 2 = 4 ATP

● NADH, H+ produced x 2 = 2 NADH, H+

● Three highly regulated enzymes:

○ Hexokinase
○ Phosphofructokinase ("pacemaker enzyme")
○ Pyruvate kinase

● Occurs in the cytoplasm.

Watch the video tutorial for this lesson (8:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68912&activity_type=CourseLesson

12.6 Pyruvate Processing [Oxidation]

12.6.1

Pyruvate Processing
Pyruvate produced by glycolysis can go one of two ways: fermentation (in the absence of oxygen) or
cellular respiration (in the presence of oxygen).

Pyruvate Processing or Oxidation

In eukaryotes, cellular respiration occurs in the mitochondrial matrix. Pyruvate is transported into the
mitochondrial matrix and is converted to acetyl-CoA. In prokaryotes, it remains in cytosol.

● Pyruvate is converted to acetyl-CoA by pyruvate dehydrogenase.

● The reaction produces 1 NADH and therefore 2 NADH per molecule of glucose.

Photo by CNX OpenStax / CC BY

Balance after Glycolysis + Pyruvate Processing

After glycolysis and pyruvate processing, acetyl-CoA produced is ready to enter the Citric Acid or
Krebs cycle (stage 3).

Watch the video tutorial for this lesson (3:44)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68883&activity_type=CourseLesson

12.6.2

Practice: Addition of CoA

When does coenzyme A (coA) become attached to pyruvate?

A) During the citric acid cycle

B) Prior to glycolysis

C) In the cytosol

D) Upon transport into the mitochondria

View Solutions on Wizeprep.com

12.6.3

Write out the reaction for when Pyruvate enters the Mitochondria

View Solutions on Wizeprep.com

12.6.4

Watch the video tutorial for this lesson (7:24)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=90920&activity_type=CourseLesson

12.7 The TCA [Citric Acid / Krebs] Cycle

12.7.1

The Citric Acid Cycle

Acetyl-CoA enters the citric acid cycle where it is oxidized to CO2. Remember that the Citric Acid cycle
is a loop that requires entry of acetyl-CoA to keep going.

● Oxaloacetate combines with acetyl to produce citrate, releasing CoA.

● Each round of the citric acid cycle produces: 3 NADH, 1 FADH2, and 1 GTP.

● All reactions are catalyzed in the mitochondrial matrix, each by a different enzyme.

● The products of the cycle are high energy molecules that can now participate in the electron
transport chain to produce lots of ATP.

Balance After Glycolysis + Pyruvate Processing + Citric Acid Cycle

1. Glycolysis: 2 pyruvate, 2 ATP, 2 NADH

2. Pyruvate processing: 2 acetyl-CoA, 2 NADH
3. Citric acid cycle: 6 NADH, 2 FADH2, 2 GTP

NET REACTION: 4 ATP, 10 NADH, 2 FADH2

Watch the video tutorial for this lesson (2:47)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68885&activity_type=CourseLesson

12.7.2

Where does the Krebs Cycle occur?

A) Within the inner mitochondrial membrane

B) In the mitochondrial matrix

C) The cytosol

D) Within the thylakoid membrane

E) In the stroma

View Solutions on Wizeprep.com

12.7.3

Practice: Products of TCA/Citric Acid/Krebs Cycle

What is generated through one turn of the citric acid cycle?

A)ATP , CO2 , N ADH, F ADH2

B) ATP , CO2 , N AD + , F ADH2

C)2pyruvate, 2ADP + Pi , 2N ADH; and 4ATP

D) 2pyruvate, 2ADP + Pi , 2N ADH and 2ATP

E) 30 or 32ATP

View Solutions on Wizeprep.com

12.7.4

Practice: CO2 Released by Krebs Cycle

How many CO2 molecules are released per acetyl group that passes through the Krebs cycle?

A) 0

B) 1

C) 2

D) 4

View Solutions on Wizeprep.com

12.8 Utilization of TCA [Citric Acid / Krebs]

Cycle Intermediates
12.8.1

Utilization of TCA Intermediates

Many of the substrates in the TCA cycle can be used in other areas of the cell for other reactions as
well.

1. Oxaloacetate (OAA) can go through gluconeogenesis and make glucose again, or it can form
aspartate and join the amino acid crowd.

2. Citrate can be converted to a fatty acid.

3. Alpha-ketoglutarate can be modified into glutamate and joint the amino acid crowd like OAA.

4. Succinyl CoA can become a slew of different things including heme groups or chlorophyll in a
plant cell.

Photo by Yikrazuul / CC BY

Watch the video tutorial for this lesson (1:33)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68916&activity_type=CourseLesson

12.9 The Electron Transport Chain

12.9.1

Electron Transport Chain Overview

Occurs at the inner mitochondrial membrane and uses electron donor molecules NADH and FADH2
produced from glycolysis and the citric acid cycle. Steps involved:

1. Electrons from NADH and FADH2 are used by membrane proteins to pump hydrogen ions
across the membrane.
a. This creates a hydrogen ion gradient on the outside of the membrane (between the outer
and inner membrane of the mitochondria).

2. The H+ gradient (potential energy) is used by ATP synthase to make ATP.

a. The movement of hydrogen ions down their gradient is called chemiosmosis.

What happens to the extra electrons at the end of ETC?

● They are accepted by oxygen molecules.

● This generates water upon electron accepting.

Photo by Uf.hun2201 / CC BY

Products of ETC

● Uses all the NADH and FADH2 from the rest of cellular respiration and produces ATP from them.

● Net ATP production (entire process from glucose to O2) = 30 - 32 ATP.

○ Lack of O2 causes a build up of electrons. This happens because there is nothing available to
accept the electrons, so they just end up sitting and waiting.
○ Poisons (such as cyanide) dissipate H+ ions and block ATP synthesis. If this happens, the
body will be starved of energy. The process is fatal within minutes.

Watch the video tutorial for this lesson (3:17)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68920&activity_type=CourseLesson

12.9.2

Explain how the ETC uses the energy of electrons to indirectly make ATP.

Solution available online

●
●
●
●

View this lesson online

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68922&activity_type=CourseLesson

12.9.3

Letter A is pointing to the location of:

A) Glycolysis site

B) Calvin cycle

C) Electron transport chain

D) Citric acid cycle

View Solutions on Wizeprep.com

12.9.4

You are testing a drug that causes the inner mitochondrial membrane to become permeable to H+.
How would this drug affect mitochondrial ATP output?

A) Increases ATP output

B) Decreases ATP output

C) No effect on ATP output

D) Depends on the situation

View Solutions on Wizeprep.com

12.10 Fermentation

12.10.1

Fermentation
Fermentation occurs when oxygen is not present.

● Ethanol fermentation is used by anaerobic prokaryotes and yeast. NADH is oxidized back to
NAD+ so that it can be recycled in another round of glycolysis. The NAD+ is needed to keep
glycolysis running. The product is ethanol.

● Lactic acid fermentation is used by humans and other mammals. NADH is oxidized back to
NAD+ just like in alcohol fermentation. The product is lactic acid. Compared to oxidative
phosphorylation, it is inefficient.

Example: You might have experienced exercise fatigue. This is thought to be due partly to the
production of lactic acid in the muscle. It occurs when the muscle needs more oxygen to keep
functioning than is available at the moment, so it starts producing lactic acid as a way to get
energy from glycolysis.

Photo by Vtvu / CC BY

Watch the video tutorial for this lesson (2:53)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=68890&activity_type=CourseLesson

12.10.2

Practice: Production of Acetaldehyde

is a byproduct of turning pyruvate into acetaldehyde during

fermentation.

View Solutions on Wizeprep.com

12.10.3

Practice: Alcohol Fermentation

Which statement is TRUE about alcohol fermentation?

A) It requires one enzyme to convert pyruvate to ethanol, alcohol dehydrogenase

B) It occurs in the liver

C) It occurs only in the presence of oxygen

D) It generates CO2 and NAD+

View Solutions on Wizeprep.com

12.10.4

Practice: Lactate Fermentation

What statement is FALSE about the lactate?

A) Lactate can be converted to glucose via gluconeogenesis

B) The conversion of pyruvate to lactate releases CO2

C) The conversion of pyruvate to lactate is a redox reaction

D) Conversion form lactate to glucose occurs in the liver

View Solutions on Wizeprep.com

13. Animal Form and

Function
13.1 Overview of Animals

13.1.1

Overview of Animals
Animals represent a massive radiation of mobile creatures that we interact with every day, from
worms to whales.

● All animals are multicellular eukaryotes

● No cell walls

● Collagen: protein holds bodies and tissues together

● Tissues: Group of cells that function together to perform a specific task

○ Unique animal tissues: Nervous Tissue and Muscle Tissue

● All Chemoheterotrophic (get energy by breaking down other cells)

● Sexual reproduction
○ motile haploid sperm
○ non-motile haploid egg
○ Egg is much larger than sperm

Photo by MathKnight | CC BY

Watch the video tutorial for this lesson (1:32)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=61451&activity_type=CourseLesson

13.1.2

Reproduction and Embryonic Development

● Most animals show similar embryonic development

● Cleavage: diploid zygote goes through mitotic cell divisions

● Blastula: Multicellular ball of cells

○ Blastula is hollow, the center cavity is called the Blastocoel

● Gastrulation: forms the Gastrula

○ Gastrula contains different layers of tissue

● Animal development
○ Direct: embryo to adult form directly
○ Indirect: develops in stages
Example: Frogs, moths, butterflies

Photo by CNX OpenStax | CC BY

Watch the video tutorial for this lesson (1:32)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71115&activity_type=CourseLesson

13.1.3

Animal Overview
Which of the following are true for all animal cells? (Select all that apply)

Lack cell wall

Can have Prokaryotic or Eukaryotic cells

All are chemheterotrophs

Sperm is much larger than the egg

View Solutions on Wizeprep.com

13.1.4

Cell Structure and Specialization

Eumetozoa

● Eumetozoa = "True Animals"

○ All animals except for sponges

Body Plans

● Symmetry
○ Radial: No front/back or left/right
Example: Sea Star, Sea Urchin

○ Bilateral: Has a left and right side, both sides are mirrored across the center line (chiral)

■ Typically active movement

■ Have Central Nervous System (CNS)

■ Have directionality:

□ left / right
□ dorsal / ventral (bottom / top)
□ posterior / anterior (back / front)
Example: Humans, dogs, squid etc.

● Cephalization: development of a head (or CNS)

Embryonic Development

● Protostomia: First fold becomes the mouth

● Dueterostomia: Second fold becomes the mouth

Photo by Yassine Mrabet | CC BY

Cell cleavage

● Protostomes: New cells develop in spiral pattern = Spiral Cleavage

○ Determinant cells: Cells are already differentiated and WILL become a part of the embryo's
body plan
■ If you remove one cell, the embryo will be missing that body part

● Deuterosomes: New cells develop in radial pattern = Radial Cleavage

○ Indeterminate cells: Call are NOT differentiated.
■ Cells can be split / removed and embryo will make more

Photo by M. J. Farabee | CC BY

Germ Layer

● The development of tissues

● 3 types of tissue layers

○ Endo: "inner"
gastrointestinal tract (GI
tract)
○ Meso: "middle" muscles
and organs
○ Ecto: "outer" outer
protection (skin, nerves)

● Radiata: only 2 cell layer

○ Diploblastic
○ Endo and Ecto (missing the Meso layer)

● Bilateria: 3 cell layers

○ Triploblastic
○ Endo, Meso and Ecto

Photo by CNX OpenStax | CC BY

Photo by CNX | CC BY

Watch the video tutorial for this lesson (4:30)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=70268&activity_type=CourseLesson

13.1.5

Animal Embryo Development

What is the first step in animal embryonic development?

Blastula

Direct development

Cleavage

Gastrulation

View Solutions on Wizeprep.com

13.1.6

Animal Symmetry
Fill in the blanks.
Starfish have ______________ symmetry, whereas frogs have _______________ symmetry.

Bilateral, Radial

Radial, Bilateral

Pentagonal, Bilateral

Pentagonal, No symmetry

View Solutions on Wizeprep.com

13.1.7

Animal Development
During gastrulation in _________________ the second fold becomes the _____________________.

Protostomes, Anus

Protostomes, Mouth

Deuterostomes, Anus

Deuterostomes, Mouth

View Solutions on Wizeprep.com

13.2 Overview of Animal Physiology

13.2.1

Overview of Animal Physiology

● Anatomy: the body structure of living things

○ Form

● Physiology: the function and mechanisms of

living things
○ Function

● Animal bodies have hierarchical structure

○ Small < Large
○ Cells < Tissues < Organs < Organ Systems

● Tissues: groups of similar cells that perform

single function
Example: Muscle tissue

● Organs: group of tissues that perform specific function

Example: Heart

● Organ Systems: groups of organs working together for greater function

Example: Circulatory system

Watch the video tutorial for this lesson (1:36)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71580&activity_type=CourseLesson

13.2.2

Which of the following represents the correct order of animal body organization from smallest to
largest?

B) Cells < Tissues < Organ Systems < Organs

C) Tissues < Cells < Organ Systems < Organs

A) Cells < Tissues < Organs < Organ Systems

D) Organs Systems < Organs < Tissues < Cells

View Solutions on Wizeprep.com

13.3 Animal Tissue Types

13.3.1

Animal Tissue Types

Epithelial Tissue

● Sheets of densely packed

cells

● Covers outside of body and

organs

● Protection
○ Physical damage
○ Disease
○ Water-loss

● Interacts with environment

Example: Epithelium lines
small intestines. It secretes
digestive fluid and absorbs
nutrients

Nervous Tissue

● Movement of information

● Neurons: specialized cells

that make up the nervous
system
○ Neurons receive and transmit impulses

● Glial Cells: support neurons

Muscle Tissue:

● Three main types

● Skeletal Muscle: allows voluntary movement

Example: Lifting your arm

● Smooth Muscle: Involuntary movement

Example: Stomach churning to digest food

● Cardiac Muscle: forms the heart muscle

Example: Heartbeats

Photo by OpenStax College | CC BY

Watch the video tutorial for this lesson (1:52)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71581&activity_type=CourseLesson

13.3.2

What type of tissue is your stomach?

A) Skeletal Muscle

B) Cardiac Muscle

C) Smooth Muscle

D) Glial Cells

View Solutions on Wizeprep.com

13.3.3

What type of tissue protects the body from disease and water-loss?

A) Nervous Tissue

B) Muscle Tissue

C) Epithelial Tissue

D) Endodermal Tissue

View Solutions on Wizeprep.com

13.4 Animal Body Cavities

13.4.1

Body Cavities
● Coelomates
○ Most triploblastic animals have fluid-filled body cavity
○ Coelom: True body cavity
■ derived from mesoderm

● Pseudocoelomates
○ Triploblastic animals that lack mesoderm lining
■ Have a hollow cavity, but it is not fully lined with mesoderm

● Aceolomates
○ Triploblastic animals that lack a body cavity

Photo by CNX OpenStax | CC BY

Function of Coelom

● Coelom cushions internal organs from physical damage

● Allows organs to shift

Examples: Gut digesting, heart beating etc.

● Some fluid filled cavities used as a hydrostatic skeleton

○ Fluid is incompressible
○ allows muscle to flex using the fluid as an anchor (instead of bones)

● Some animals lost / gained coelom cavities throughout evolutionary history

Watch the video tutorial for this lesson (2:15)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=61456&activity_type=CourseLesson

13.4.2

Germ Layer
Order these germ layers from inner-most to outer-most.
A.) Mesoderm
B.) Ectoderm
C.) Outerderm
D.) Endoderm

D, A, B, C

D, B, A

D, A, B

B, A, D

View Solutions on Wizeprep.com

14. Animal Homeostasis

and Thermoregulation
14.1 Thermoregulation

14.1.1

Thermoregulation

Overview of Homeostasis

● Homeostatic Systems: maintain an equilibrium (balance)

● Negative Feedback (-): a change triggers the system to counteract this change

● Positive Feedback (+): a change triggers the system to amplify this change

● Thermoregulation: body temperature regulation

● Osmoregulation: solute and water regulation

Types of heat exchange

● Conduction: direct transfer of heat between molecules in direct contact

● Convection: mass movement of warm air or fluid to or from a body/object

● Radiation: emission of electromagnetic waves

● Evaporation: loss of
heat energy from the
surface of a liquid
losing molecules as gas

Photo by Bruce Blaus | CC BY

Ectotherms

● Ectothermic:
Do not use
metabolism
to regulate
body
temperature

○ Most
reptiles

○ Behavioral
thermoregulation:
Move between
sun and shade to
maintain optimal
temp

○ Requires far less energy to support ectotherm (10%)

Endotherms

● Endothermic: Do use metabolism to

regulate body temperature

● Hypothalmus: sensors in brain that

regulate internal temperature
○ Thermostat of the body

● Countercurrent exchange: the

transfer of heat between fluids
(blood) moving in opposite directions
○ helps reduce heat-loss to cold
environment
Example: Cold blood heading to
the heart is heated by warm
blood leaving the heart

Photo by Ekann | CC BY

Watch the video tutorial for this lesson (4:54)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71584&activity_type=CourseLesson

14.1.2

Describe how a lizard may use behavioral thermoregulation on a hot day.

View Solutions on Wizeprep.com

14.1.3

Describe a Negative Feedback system (you can make it up).

View Solutions on Wizeprep.com

15. Animal
Osmoregulation and
Excretion
15.1 Osmoregulation

15.1.1

Osmoregulation
It is necessary to keep the concentration of water and solutes constant in animal bodies

● Osmoregulation: controlling the solute and water concentration in bodies

● Osmolarity: the concentration of solutes in a solution

● Excretion: getting rid of toxic waste (nitrogen)

● Animals fall into two catergories

○ Osmoregulator: controls internal solute concentrations
■ Most vertebrates

○ Osmoconformer: does not control solutes, body is the same as the environment
■ Most invertebrates

Photo by Kare Kare | CC BY

Controlling Osmotic Balance

● Stenohaline: Can not tolerate large shifts in outside

osmolarity

● Euryhaline: can tolerate large shifts in outside

osmolarity

● Transport epithelium: layers of specialized cells that

regulate solute movements
○ Tight junctions: prevent fluid leaks between transport epithelial cells
○ Transport into tubular networks (countercurrent exchanges)

● Anhydrobiosis: ability to survive in a dormant state when environment dries up -

Example: Tardigrades (water bears) can even survive in space

Photo by Willow Gabriel | CC BY

Osmotic Balance on Land

● Adaptations to reduce
desiccation
○ Desiccation: water lost to
the environment
Examples: Body coverings,
nocturnal activity

● Kidneys
○ Organs that are essential to
mammalian water-balance
and osmoregulation
○ Reduce water-loss
○ Excrete nitrogenous waste

Photo by OpenStax College | CC BY

Watch the video tutorial for this lesson (4:41)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=71585&activity_type=CourseLesson

15.1.2

What type of osmoregulation best describes vertebrates?

A) Ectothermic

B) Osmoconformer

C) Osmoregulator

D) Endothermic

View Solutions on Wizeprep.com

15.1.3

Describe a scenario where Anhydrobiosis would be beneficial.

View Solutions on Wizeprep.com

16. Animal Nutrition and

Digestion
16.1 The human digestive system

16.1.1
The mouth:

● Digestion begins at the oral cavity (the mouth) where food is ingested.
● Mechanical digestion by the teeth increases the surface area of the food, allowing for increased
exposure to digestive enzymes. This process is called mastication.
● Chemical digestion also occurs in the mouth due to the secretion of enzymes such as salivary
amylase, which breaks down carbohydrates.
● The tongue, one of the strongest muscles in the body, pushes food around into a ball called a
bolus, which passes to the pharynx.
● To prevent food from entering the trachea when we swallow, the epiglottis folds over the
opening, ensuring the bolus enters the esophagus.

The esophagus:

● A ~24 cm long tube connecting the mouth to the stomach

● Circular and longitudinal muscles allow for peristalsis, which mediates the pushing of food
through the digestive tract.
● At the end of the esophagus, the bolus reaches the lower esophageal sphincter, a ring of
muscles that prevents stomach acid from entering the esophagus, through which food must be
pushed to reach the stomach.

Watch the video tutorial for this lesson (3:17)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=39639&activity_type=CourseLesson

16.1.2

The stomach

● The stomach is a muscular pouch which provides mechanical digestion by churning the bolus
● Gastric juices contain acid and digestive enzymes, providing chemical digestion
● Hydrochloric acid (HCl) is secreted into the stomach by parietal cells, giving a pH ~1 - 2.5. The
acidic pH kills viruses and bacteria and helps with chemical digestion
● The parietal cells produce H+ and Cl- ions separately, to prevent the accumulation of HCl
intracellularly. They produce these ions in response to the peptide hormone gastrin.
● To prevent damage to the cells lining the stomach, goblet cells secrete a thick mucus layer
● The enzyme pepsin is a protease – it breaks down proteins into smaller peptides.
● Pepsin is secreted as pepsinogen and is converted to pepsin upon exposure to HCl. This
prevents the proteins of the stomach lining from being degraded.

Stomach Ulcers

● Caused by the bacterium Helicobacter pylori

● The bacterium burrows into the mucus layer to protect itself from the acidic pH, and then
adheres to the epithelial cells beneath the mucus.
● To further protect itself from the acidic pH, the bacterium produced urease, which helps to
neutralize the stomach
● Urease leads to the production of ammonia, which damages the epithelial cells.
● An immune response is triggered, leading to inflammation of the stomach lining, eventually
leading to ulcer formation

Watch the video tutorial for this lesson (4:13)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=39640&activity_type=CourseLesson

16.1.3

The small intestine

● After being further digested in the stomach, the food is now called chyme, which is passed to
the small intestine
● The small intestine is where the majority of nutrient absorption occurs
● It can be divided into three sections:

1. The duodenum: location of bile duct.

2. The jejunum: where the majority of the abosroption takes place.
3. The ileum: involved in absorption and compaction of what is left over, passing it on to the large
intestine.

Digestive enzymes and chemicals are secreted into the intestine to allow for chemical digestion of the
chyme:

● Bile is produced by the liver and aids in chemical digestion by emulsifying the lipids, exposing
them to digestive enzymes.
● The pancreas secretes HCO3- to neutralize the pH of the chyme
● The pancreas also produced digestive enzymes: pancreatic proteases (eg. Trypsin and
chymotrypsin), pancreatic amylase (breaks down carbohydrates), and pancreatic lipase (breaks
down fats) and nucleases (break down nucleic acids)
● The intestinal glads produce digestive enzymes: maltase and protease (enterokinase,
aminopeptidase, dipeptidase).

● The lining of the small intestine has tiny, finger-like projections called villi, which increase the
surface area of the intestine for absorption of nutrients
● Each vilus itself has microvilli, further increasing surface area

Watch the video tutorial for this lesson (4:05)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=39641&activity_type=CourseLesson

16.1.4

The large intestine

● Once all of the nutrients have been absorbed, the colon is responsible for the absorption of any
remaining water and minerals
● Water crosses the membranes of the cells lining the colon by osmosis (movement of water along
its concentration gradient)
● The colon is home to many different species of bacteria
● Once the rectum is full of fiber and undigested material, the anal sphincter loosens and the
waste can be excreted

Watch the video tutorial for this lesson (1:09)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=39642&activity_type=CourseLesson

16.1.5

Complete the following table:

View Solutions on Wizeprep.com

16.1.6

You set up an experiment in the lab, and you add the following ingredients to 5 different tubes. For
each tube, name which type of macromolecule, if any, would be digested if added.

Water, Pepsin:
Water, Trypsin, HCl:
Water, Pepsin, HCl:
Water, Amylase, HCl:
Water, Amylase:

View Solutions on Wizeprep.com

16.2 Digestion in other organisms

16.2.1

Digestion in Birds

Birds have digestive systems that are evolved for seed consumption

● Beaks allow for cracking open of seeds, and picking them out of small compartments
● Crop stores food. Very little digestion occurs in the crop.
● Proventriculus is where chemical digestion begins. HCl and digestive enzymes are secreted here
● Gizzard is where mechanical digestion occurs. Birds usually eat small stones, which are stored
in the gizzard and aid in digestion.
● Small intestine is where more chemical digestion and nutrient absorption takes place
● Cecum is where where fermentation of any remaining course material occurs, leading to the
production of fatty acids and vitamins
● Large intestine absorbs water
● Cloaca is where digestive waste is mixed with waste of the urinary tract and then excreted

Watch the video tutorial for this lesson (2:31)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=34990&activity_type=CourseLesson

16.2.2

Digestion in Insects

● Insects have a complete digestive tract which can be divided into three compartments: the
foregut, the midgut, and the hindgut
● Insects have a pair of salivary glands which produce saliva and enzymes
● Pepsin is not produced by insects as their digestive tracts are not acidic enough to convert
pepsinogen to pepsin

Watch the video tutorial for this lesson (0:58)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=39644&activity_type=CourseLesson

17. Animal Gas Exchange

and Circulation
17.1 Respiration

17.1.1

Respiration
Gas Exchange

● Gas Exchange: taking in O2 and releasing CO2

● Ventilation: movement of air or water over respiratory surface

● Surface must be moist

● Uses diffusion
○ Larger surface area = more gas exchange
○ Thinner membrane = more gas exchange

Types of Respiratory Systems

Gills

● Aquatic animals often use gills

● Countercurrent exchange: maximizes gas exchange

○ Blood and water flow in opposite directions

Photo by CNX OpenStax | CC BY

Tracheal Systems

● Tracheal System: a
network of tubes that
carry air throughout the
body
○ Largest tube is the
Trachea, which is
open to air

● Insects have many

trachea that contact
every cell directly
○ Enables expensive
movements (i.e.
flight)

● Most mammals use

Lungs: a specialized
respiratory organ
○ Lungs are open to
the air
○ Have many pockets
to increase gas
exchange
○ Must use circulatory system to transport O2 to the body

Photo by BruceBlaus | CC BY

Mammalian
Respiratory System

● Air enters the

Trachea

● The trachea splits

into Bronchi
which lead into
each lung

● Bronchi branch
into smaller
Bronchioles

● Bronchioles end in
Alveoli: air sacs
where gas
exchange occurs

● Alveoli are covered in Surfactant: which prevents them from collapsing

Photo by OpenStax College | CC BY

Watch the video tutorial for this lesson (4:30)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=72272&activity_type=CourseLesson

17.1.2

Explain how countercurrent exchange increases the rate of gas exchange in fish.

View Solutions on Wizeprep.com

17.1.3

What is the order of Respiratory elements from largest to smallest?

B) Trachea > Bronchioles > Bronchi > Alveoli

C) Trachea > Alveoli > Bronchioles > Bronchi

D) Trachea > Alveoli > Bronchi > Bronchioles

A) Trachea > Bronchi > Bronchioles > Alveoli

View Solutions on Wizeprep.com

17.2 Circulation

17.2.1

Circulation
● Every cell must get rid of CO2 and receive O2

● Circulatory Systems: connect the gas-exchange surfaces to the body

○ Allows organisms to grow larger

Circulatory systems

Three Main Components

● Circulatory Fluid: fluid that transports O2

and CO2
Examples: Hemolymph, Blood

● Vessels: structure that allows the

hemolymph to move throughout the body
Example: Blood veins

● Muscular Pump: contracts to pump the

hemolymph
Example: Heart

Open vs Closed Circulatory systems

● Open Circulatory System: hemolymph

pools in body cavity and contacts organs
directly
○ Hemolymph is pumped from the
sinuses through the heart

○ Hemolymph is not always in vessels!

Examples: Arthropods, Clams

● Closed Circulatory System: blood remains in vessels, does not surround organs
Examples: Cephalopods, all vertebrates

Photo by Tomas Kebert | CC BY

Vertebrate Circulatory
Systems

● Cardiovascular
system: a name for the
circulatory system in
humans and
vertebrates

● Three types of blood

vessels
○ Arteries: carry
blood from heart to
organs
○ Capillaries: thin
branching veins
that allow blood to
enter tissues and
organs
○ Veins: carry blood from organs to heart

● Hearts
○ Atria: chamber the receives blood into heart
○ Ventricle: larger, muscular chamber, pumps blood out of heart

Photo by Gccwang | CC BY

Single vs Double Circulation

● Single Circulation:
○ Heart has only 1 Atrium and 1
Ventricle
○ Blood only enters heart ONCE
per cycle
○ Blood travels
■ Heart > Gills > Body (Organs)
> Heart
Examples: Fish and Sharks

Photo by Lennert B. | CC BY

● Double Circulation:
○ Heart has 2 Atria and 2
Ventricles
○ Blood enters the heart TWICE
per cycle
○ Blood travels
■ Heart > Lungs > Heart >
Body > Heart
Examples: Humans and
Amphibians

Photo by Gccwang | CC BY

Watch the video tutorial for this lesson (5:19)

https://www.wizeprep.com/in-course-experience/Bisc101-SFU?
activity_id=72271&activity_type=CourseLesson

17.2.2

What are the three main components of the circulatory system?

View Solutions on Wizeprep.com

17.2.3

What type of blood vessels contact the organs directly?

A) Capillaries

B) Arteries

C) Veins

D) Atria

View Solutions on Wizeprep.com

17.2.4

Describe the main difference between Single Circulation and Double Circulation systems.

View Solutions on Wizeprep.com

Find this, and much, much more on

Wizeprep.com

Bite-Sized Video Lessons Solutions to Problems 24/7 Instructor Q&A

Each section corresponds to a See the solutions to the Need help clarifying a concept?
minutes-long video explanation practice problems as well as a You have direct access to your
by your expert instructors. step-by-step breakdown of the instructor.
answers.

Crash Courses
A live review of all testable concepts, exam-like practice problems, tips & tricks, and Q&A.
Led by an instructor who is an expert on your course.

Live Online Session Booklet Solutions Recording

Weekly Tutorials
A weekly, live review of lecture topics led by an instructor who knows your course inside
and out.

Live Online Session Booklet Solutions Recording

First week free!

Mock Exam Walkthroughs

A realistic practice exam based on past exams from your course. An instructor experienced
with your course will walk through the solutions.

Live Online Session Booklet Solutions Recording

Biology Chemistry Org Chem Biochem Physics CARS Psych

Two Plans Both Plans Include...

ELITE 515 LIVE 144 hrs of expert All AAMC materials

Flexible live schedules, face-time with instruction
Personalized study plan
our MCAT instructors. 15 full-length practice
515+ performance guarantee exams 6 top-quality textbooks

SELF-PACED 100+ practice passages Unlimited Q&A with

MCAT experts
Watch 144 hours of expert MCAT 405+ passage-based
instruction whenever you have time. questions

Performance Guarantee

The Elite 515 program promises you a score of at

least 515 on the MCAT or money back. A 515
puts you within the top 2% of scores!

Find Free MCAT Resources on Wizeprep.com/MCAT

Free Live Events Free Diagnostic Exam Free Trial

Learn about the med school Predict your MCAT score and Don’t just take our word for it.
application process and assesses strengths and Try out the first few lessons
more. weaknesses. yourself.
© Wizedemy Inc. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, or sorted in a data
base or retrieval system, without the prior written permission of Wizedemy Inc.
Other Courses at SFU

CHEM 121 ECON 103

General Chemistry and Laboratory I Principles of Microeconomics

MATH 157 MATH 154

Calculus I for the Social Sciences Mathematics for the Life Sciences I

PHYS 100 CHEM 122

Introduction to Physics General Chemistry 2

PHYS 101 MATH 150

Physics for the Life Sciences I Calculus I with Review

BUS 251 BISC 102

Financial Accounting I General Biology

Find more on Wizeprep.com

Speed Reading: Learn to Read a 200+ Page Book in 1 Hour: Mind Hack, #1
From Everand
Speed Reading: Learn to Read a 200+ Page Book in 1 Hour: Mind Hack, #1
Kam Knight
4.5/5 (24)
Use of Robotics and Automation in Construction
No ratings yet
Use of Robotics and Automation in Construction
5 pages
Classroom Instruction Delivery Alignment Map General Biology 1 Grade 11 (STEM)
67% (3)
Classroom Instruction Delivery Alignment Map General Biology 1 Grade 11 (STEM)
6 pages
Course Outline General Biology II: Course Code (S) and Mesrs Objectives Science (200.B0), Registered in 101-LCU-05
No ratings yet
Course Outline General Biology II: Course Code (S) and Mesrs Objectives Science (200.B0), Registered in 101-LCU-05
12 pages
Faculty of Science Course Syllabus: Department of Biology BIOL 1011.03 Principles of Biology Part II Winter 2020
No ratings yet
Faculty of Science Course Syllabus: Department of Biology BIOL 1011.03 Principles of Biology Part II Winter 2020
9 pages
2HL100 Lecture
100% (10)
2HL100 Lecture
21 pages
Bisc 100 Online Note
No ratings yet
Bisc 100 Online Note
1,464 pages
Ap Biology Portfolio 2019 - 2020 Ashrika Dudeja
No ratings yet
Ap Biology Portfolio 2019 - 2020 Ashrika Dudeja
44 pages
BSC Zoology Revised Syllabus 080920
No ratings yet
BSC Zoology Revised Syllabus 080920
10 pages
Living Env - 2009 LE Curriculum
No ratings yet
Living Env - 2009 LE Curriculum
6 pages
BISC Lab Manual
No ratings yet
BISC Lab Manual
209 pages
BCHM661-201708 Syllabus
No ratings yet
BCHM661-201708 Syllabus
4 pages
Learning Objectives
No ratings yet
Learning Objectives
15 pages
Biology Study Guide 2024
No ratings yet
Biology Study Guide 2024
11 pages
Biology AS Term 1 Plan
No ratings yet
Biology AS Term 1 Plan
4 pages
0610 Y05 SW 1
No ratings yet
0610 Y05 SW 1
5 pages
4ef8447a-6800-4719-a6f0-21b8e922a0da
No ratings yet
4ef8447a-6800-4719-a6f0-21b8e922a0da
12 pages
Life Sciences Grade 10 ATP 2024
No ratings yet
Life Sciences Grade 10 ATP 2024
19 pages
AP Biology Review Guide 2020-2021 @apbiopenguins
No ratings yet
AP Biology Review Guide 2020-2021 @apbiopenguins
245 pages
Fall Review Slides 2015
No ratings yet
Fall Review Slides 2015
71 pages
Bio101Lec00 Introduction To Class
No ratings yet
Bio101Lec00 Introduction To Class
3 pages
AP Biology Summer Assignment 2018
No ratings yet
AP Biology Summer Assignment 2018
32 pages
How To Prepare For Apbio Exam 5able
No ratings yet
How To Prepare For Apbio Exam 5able
7 pages
Biology Grade 10 Unit Plan
No ratings yet
Biology Grade 10 Unit Plan
4 pages
ОШ ФО Биология ЕМН 10 англ
No ratings yet
ОШ ФО Биология ЕМН 10 англ
27 pages
EzyScience EdExcel Guide FINAL
No ratings yet
EzyScience EdExcel Guide FINAL
20 pages
Student Copy of 09700 AS Checklists
No ratings yet
Student Copy of 09700 AS Checklists
22 pages
A1 Biology Assessement Plan 2022-23
No ratings yet
A1 Biology Assessement Plan 2022-23
20 pages
Bio f4 Eng-1
No ratings yet
Bio f4 Eng-1
63 pages
midterm prep
No ratings yet
midterm prep
8 pages
AP Biology Test in Learning Targets
No ratings yet
AP Biology Test in Learning Targets
10 pages
Biology Questions
No ratings yet
Biology Questions
19 pages
Bio Topics
No ratings yet
Bio Topics
35 pages
Read First - Curriculum Map
No ratings yet
Read First - Curriculum Map
8 pages
Science
No ratings yet
Science
80 pages
Ib Biology List of Objectives
No ratings yet
Ib Biology List of Objectives
6 pages
Week Date Topic/Sub Topic Descriptions Learning Outcomes
No ratings yet
Week Date Topic/Sub Topic Descriptions Learning Outcomes
8 pages
BSCMSC
No ratings yet
BSCMSC
1 page
Faculty of Science Course Syllabus: Department of Biology BIOL 1010.03 Principles of Biology Part I Fall 2019
No ratings yet
Faculty of Science Course Syllabus: Department of Biology BIOL 1010.03 Principles of Biology Part I Fall 2019
10 pages
Electrical Syllabus Final
No ratings yet
Electrical Syllabus Final
48 pages
Biology Unit1
No ratings yet
Biology Unit1
14 pages
BIO-101
No ratings yet
BIO-101
11 pages
Separate Biology-Year 11-Nov PPE Revision Checklist
No ratings yet
Separate Biology-Year 11-Nov PPE Revision Checklist
4 pages
Biology Course Outline
No ratings yet
Biology Course Outline
10 pages
16 Honsbiologysyllabus
No ratings yet
16 Honsbiologysyllabus
4 pages
AP Biology – Notes and Study Guides
No ratings yet
AP Biology – Notes and Study Guides
15 pages
Science 8 (Biology) Course Pack AY22-23
No ratings yet
Science 8 (Biology) Course Pack AY22-23
60 pages
Marietta City Schools 2023-2024 District Unit Planner: IB Biology Y1 Logue PLC Logue/Trotter Group 4/IB Biology Y1 SL
No ratings yet
Marietta City Schools 2023-2024 District Unit Planner: IB Biology Y1 Logue PLC Logue/Trotter Group 4/IB Biology Y1 SL
12 pages
10i Biology CS
No ratings yet
10i Biology CS
8 pages
Biochemistry, 7th ed: The Molecular basis of life 7th Edition James R. Mckee - The newest ebook version is ready, download now to explore
100% (1)
Biochemistry, 7th ed: The Molecular basis of life 7th Edition James R. Mckee - The newest ebook version is ready, download now to explore
58 pages
Life Sciences Grade 10 Lesson Plans
No ratings yet
Life Sciences Grade 10 Lesson Plans
36 pages
BIO 100 Syllabus
No ratings yet
BIO 100 Syllabus
14 pages
SHS IB Biology Unit List
No ratings yet
SHS IB Biology Unit List
9 pages
Daily Lesson Plans Biomed Academy-Mr. Rabold Unit 1-Biochemistry and Scientific Research Protocol
No ratings yet
Daily Lesson Plans Biomed Academy-Mr. Rabold Unit 1-Biochemistry and Scientific Research Protocol
8 pages
Biology
No ratings yet
Biology
12 pages
Principles of Biology 1592953983
No ratings yet
Principles of Biology 1592953983
926 pages
BISC 1403 R04 Fall 2024 V2
No ratings yet
BISC 1403 R04 Fall 2024 V2
6 pages
Edexcel International GCSE Biology Chapter 1 Learning Plan
No ratings yet
Edexcel International GCSE Biology Chapter 1 Learning Plan
3 pages
Traffic light ALL topics for essays
No ratings yet
Traffic light ALL topics for essays
6 pages
General Biology I [Topic List and Schedule]
No ratings yet
General Biology I [Topic List and Schedule]
3 pages
BIOLOGY 10 TERM 1
No ratings yet
BIOLOGY 10 TERM 1
9 pages
Achieve Exam Zen
From Everand
Achieve Exam Zen
Robert Smith
No ratings yet
01 Mock New 85 Question
No ratings yet
01 Mock New 85 Question
23 pages
RM Model For The Tourism Industry
No ratings yet
RM Model For The Tourism Industry
292 pages
FHM Philippines 200804 (Alessandra de Rossi)
72% (32)
FHM Philippines 200804 (Alessandra de Rossi)
81 pages
Bhavarlal Jain
No ratings yet
Bhavarlal Jain
3 pages
Encoder Check PLC Programs
No ratings yet
Encoder Check PLC Programs
3 pages
Resume 16 06 2023 07 17 10 AM
No ratings yet
Resume 16 06 2023 07 17 10 AM
1 page
Bond Energy Algorithm1
No ratings yet
Bond Energy Algorithm1
48 pages
Instant ebooks textbook Advanced Pharmacology for Prescribers 1st Edition Theodore Kendris download all chapters
100% (3)
Instant ebooks textbook Advanced Pharmacology for Prescribers 1st Edition Theodore Kendris download all chapters
55 pages
LA1185
No ratings yet
LA1185
5 pages
VACUTAP® VM® VMS® Technical Data 2332907 07 en
No ratings yet
VACUTAP® VM® VMS® Technical Data 2332907 07 en
96 pages
Retail Receipt ORDER202305D4Snan
No ratings yet
Retail Receipt ORDER202305D4Snan
1 page
Methods of Foreign Language Education Syllabus
No ratings yet
Methods of Foreign Language Education Syllabus
11 pages
Dissertation GVHD
100% (2)
Dissertation GVHD
9 pages
Pneumatic System Location PW1100
100% (2)
Pneumatic System Location PW1100
14 pages
VSphere Operations Management - Datasheet
No ratings yet
VSphere Operations Management - Datasheet
4 pages
Management Accounting 2
No ratings yet
Management Accounting 2
2 pages
Technický Manuál Rimini
100% (1)
Technický Manuál Rimini
30 pages
Understanding InfiniBand
No ratings yet
Understanding InfiniBand
4 pages
MMMMM
No ratings yet
MMMMM
89 pages
Earthquake Simulations of Large Scale Structures Using Opensees Software On Grid and High Performance Computing in India
No ratings yet
Earthquake Simulations of Large Scale Structures Using Opensees Software On Grid and High Performance Computing in India
4 pages
Tcs - Rim Alliance - Tcs BRMS' - Final
No ratings yet
Tcs - Rim Alliance - Tcs BRMS' - Final
34 pages
Ultrasound Exercise Booklet
No ratings yet
Ultrasound Exercise Booklet
8 pages
06. ArcFlash Example6-Solution
No ratings yet
06. ArcFlash Example6-Solution
4 pages
Global Venture Capital Landscape
No ratings yet
Global Venture Capital Landscape
18 pages
#Formula Sheet Chemistry
No ratings yet
#Formula Sheet Chemistry
14 pages
1
No ratings yet
1
3 pages
Chapter 02 Test Bank - Static - Version1
No ratings yet
Chapter 02 Test Bank - Static - Version1
34 pages
Grid Search Optimization (GSO) Based Future Sales Prediction For Big Mart
No ratings yet
Grid Search Optimization (GSO) Based Future Sales Prediction For Big Mart
7 pages