International Dairy Journal 117 (2021) 105019

Contents lists available at ScienceDirect

International Dairy Journal

journal homepage: www.elsevier.com/locate/idairyj

Simultaneous enumeration of Cronobacter sakazakii and

Staphylococcus aureus in powdered infant foods through duplex
TaqMan real-time PCR
Xueqin Xie a, *, Zhou Liu a, b, c
a
Department of Basic Medical Science, Xiamen Medical College, Xiamen 361023, China
b
Provincial Key Laboratory of Functional and Clinical Translational Medicine of Universities in Fujian, Xiamen 361023, China
c
Institute of Respiratory Disease, Xiamen Medical College, Xiamen 361023, China

a r t i c l e i n f o a b s t r a c t

Article history: Cronobacter sakazakii and Staphylococcus aureus are important pathogens. Targeting the species-specific
Received 2 December 2020 macromolecular synthesis (MMS) operon and thermostable nuclease gene (nuc), a duplex TaqMan real-
Received in revised form time PCR (dRT-PCR) assay was developed for their simultaneous enumeration within two kinds of
22 January 2021
powdered infant foods (PIFs). The assay was highly specific, producing fluorescent signals exclusively
Accepted 23 January 2021
Available online 8 February 2021
from target bacteria. The quantification limits were 29.10 and 8.97 copies mL
1 for standard plasmids
containing MMS and nuc fragments. Without enrichment, the dRT-PCR could quantify as low as 102 and
101 cfu mL
1 C. sakazakii and S. aureus in both pure culture and spiked PIFs. Quantitative linearity ranged
from 102 to 107 cfu mL
1 for C. sakazakii and from 101 to 107 cfu mL
1 for S. aureus. Bacterial counts
derived from dRT-PCR were consistent with those calculated from plating for randomly spiked PIFs. The
dRT-PCR assay provides a promising culture-independent alternative enabling direct, simultaneous and
robust pathogen quantification.
© 2021 Elsevier Ltd. All rights reserved.

1. Introduction polluted PIFs are reconstituted at improper temperature and stored

for extended period (Bogdanovi
cova, Necidova , Haru
stiakova, &
Powdered infant foods (PIFs) such as powdered formula milk Jan
stova
, 2017). There are reports of outbreak associated with S.
and rice cereal serve as important components of a healthy and aureus contaminated reconstituted milk in Japan (Asao et al., 2003)
balanced diet for infants worldwide. However, such dry infant foods and PIFs in China (http://www.dairyreporter.com/Markets/Baby-
are not sterile and may intrinsically contain pathogens despite the milk-poisoning). Therefore, it is important to detect and quantify
pasteurisation process during manufacture. Notable outbreaks of these two pathogenic factors in PIFs and thus prevent related illness.
illness in infants associated with consumption of contaminated PIFs Conventionally, the detection of foodborne pathogens typically
have been reported (Cahill, Wachsmuth, Costarrica, & Ben Embarek, relies on culture-based methods, which take 5e7 days to accom-
2008; Caubilla-Barron et al., 2007; Centers for Disease Control and plish steps such as enrichment, selective growth, biochemical test,
Prevention, 2002; Jones et al., 2019). serological confirmation and/or toxin testing (Rajapaksha et al.,
Cronobacter sakazakii is the most frequently reported pathogen 2019). Such traditional methods are not only laborious and time-
in infant foods. It can cause life-threatening meningitis, necrotising consuming, but also unable to detect viable but non-culturable
enterocolitis and septicaemia with high fatality rates of 40e80% (VBNC) and dormant cells that still have virulence (Ramamurthy,
(Norberg et al., 2012). As one of most common foodborne pathogen Ghosh, Pazhani, & Shinoda, 2014; Zhao, Zhong, Wei, Lin, & Ding,
worldwide (Kadariya, Smith, & Thapaliya, 2014), Staphylococcus 2017). Hence, rapid, reliable and culture-free methods for detec-
aureus also threatens infant health due to its high contamination tion and quantification of foodborne pathogen are urgently needed.
rate in PIFs (Wang et al., 2012) and increased infection risk when To better monitor microbiological safety of infant foods, various
molecular methods have been established for rapid identification of
pathogens such as Cronobacter, Listeria monocytogenes, Salmonella, S.
* Corresponding author. Tel.: þ086 592 6365069. aureus, Bacillus cereus, etc., in PIFs (Fu et al., 2020; Hong et al., 2020;
E-mail address: [email protected] (X. Xie). Jiang et al., 2020; Li et al., 2016). Due to its overwhelming superiority

https://doi.org/10.1016/j.idairyj.2021.105019
0958-6946/© 2021 Elsevier Ltd. All rights reserved.
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

such as high specificity, simplicity, low cost and capability of multi- Table 1
plexing several targets in a single reaction system, real-time PCR (RT- Bacterial strains used in this study.a

PCR) has been widely applied recently in detection of bacteria asso- Bacterial strains Strain ID Duplex TaqMan RT-PCR Ct values
ciated with foods (Garrido-Maestu, Tomas, & Prado, 2019; Law, Ab MMS nuc
Mutalib, Chan, & Lee, 2015; Postollec, Falentin, Pavan, Combrisson,
Cronobacter sakazakii ATCC 51329* 19.11 ± 1.07
& Sohier, 2011; Zeng, Chen, Jiang, Xue, & Li, 2016). Through
e
C. sakazakii CICC 10295 20.07 ± 1.24 e
combining different primers and/or probes, RT-PCR is capable of C. sakazakii CICC 21645 19.91 ± 1.12 e
identifying or even quantifying two or more pathogens in a single C. sakazakii CS_F_1# 21.21 ± 0.82 e
analysis. The robustness of RT-PCR for quantify microbes and con- Staphylococcus aureus ATCC 25923* e 14.12 ± 0.91
S. aureus CICC 10145 15.25 ± 0.73
sistency of its results with traditional plate counting method has been e
S. aureus CICC 10201 e 14.26 ± 1.21
well proved in various research (Aparecida de Oliveira, Abeid Ribeiro, S. aureus SA_F_1# e 16.06 ± 0.87
Morato Bergamini, & Pereira De Martinis, 2010; Takahashi et al., 2017, Enterobacter aerogenes ATCC 51697 e e
2018; Vital, Van Ha, Tuyet, & Widmer, 2017). However, most RT-PCR Vibrio parahaemolyticus ATCC 17802 e e
assays described in the literature for these pathogens are qualita- Pseudomonas aeruginosa ATCC 27853 e e
P. fluorescens CGMCC 1.6279
tive. Their objective is pathogen identification rather than quantifi-
Listeria monocytogenes ATCC 19115 e e
cation. To our knowledge, there are no reports focusing on the L. innocua ATCC 33090
simultaneous and quantitative detection of C. sakazakii and S. aureus L. ivanovii ATCC 19119 e e
in PIFs through RT-PCR. Shigella flexneri CMCC 51571 e e
Salmonella typhimurium CMCC 50040
Taking all these into consideration, we aimed to develop a e e
Bacillus cereus CICC 21261 e e
duplex TaqMan RT-PCR (dRT-PCR) based method for direct and Streptococcus pyogenes CMCC 32201 e e
specific enumeration of C. sakazakii and S. aureus within two most Enterococcus faecalis ATCC 14506 e e
commonly consumed PIF products (powdered formula milk and Clostridium perfringens ATCC 13124 e e
rice cereal) in this study. The specificity, sensitivity and quantitative a
Abbreviations: ATCC, American Type Culture Collection (Manassas, USA); CMCC,
range of the new enumeration method were analysed with kinds of China Medical Culture Collection (Beijing, China); CICC, China Industrial Culture
templates. Its reliability in quantifying target pathogens in real food Collection (Beijing, China); CGMCC, China General Microbiological Culture Collec-
tion (Beijing, China). MMS, the macromolecular synthesis (MMS) operon sequence
matrices was also evaluated through comparing the quantitative
specific for Cronobacter sakazakii; nuc, thermostable nuclease gene specific for
results deduced from Ct value of dRT-PCR with that derived from Staphylococcus aureus. An asterisk indicates reference strains in this study; a hatch
plate counting for natural and artificially spiked PIFs. symbol indicates field strains isolated from powdered milk (C. sakazakii CS_F_1) and
sausage (S. aureus SA_F_1); a dash indicates undetermined Ct values.
2. Materials and methods

2.1. Bacterial strains and culture conditions Reference Dye II, 0.5 mL of each primer (10 mM), 0.5 mL of each probe
(10 mM) and 2 mL of target bacterial genomic DNA. Sterile distilled
The bacterial strains used in this study are listed in Table 1, water was used to replace the genomic DNA as template for
among which C. sakazakii ATCC 51329 and S. aureus ATCC 25923 negative control. The thermal cycling conditions of dRT-PCR were
were used as reference strains for establishment of dRT-PCR assay. as follows: 95  C for 30 s, followed by 40 cycles of 95  C for 5 s and
All strains were cultured overnight (12e18 h) at 37  C in tryptic 60  C for 34 s. The experiments were repeated three times with
soybean broth (TSB, Beijing Luqiao technology Co. Ltd., Beijing, cycle threshold (Ct) values determined using ABI 7500 system SDS
China). software (version 2.3).

2.2. DNA extraction and dRT-PCR conditions 2.3. Preparation of standard plasmids

Genomic DNA from bacteria within both pure culture and spiked Standard plasmids pGEMT-MMS and pGEMT-nuc (Xie, 2016)
PIF products was extracted using a QIAamp DNA Mini Kit (QIAGEN, containing partial sequence of MMS and nuc respectively were
Hilden, Germany) following the manufacturer's instructions. For constructed. A fragment of MMS sequence (242 bp) covering that
spiked milk powder suspension, the fat residue in the top layer targeted by dRT-PCR was amplified from genomic DNA of C. saka-
after centrifugation should be discarded together with the super- zakii ATCC 51329 with primers MMS-PCR-F and R1 (Table 2).
natant (second layer), leaving the precipitate (bacterial cell pellets Fragment of nuc was obtained with F2 and R2 (Table 2) as primers
and milk particles) for DNA extraction. The concentration and pu- and genomic DNA of S. aureus ATCC 25923 as template. PCR reac-
rity of the DNA solutions were measured spectrophotometrically tion was performed in a Veriti thermocycler (Life technology) with
with NanoDrop 2000 (Thermo Scientific, MA, USA). The extracted a total reaction volume of 50 mL containing 1  Taq DNA polymerase
DNA samples were stored at
20  C till use. buffer, 2.5 mM MgCl2, 0.2 mM of each primer, 0.2 mM of each dNTP
The primers and probes used in this study are shown in Table 2. (TIANGEN, Beijing, China), 2.5 U Taq polymerase and 2 mL of
Using primers (F1 and R1) and probe (P1) described by Seo and genomic DNA. The PCR cycling conditions were as following: initial
Brackett (2005), the macromolecular synthesis (MMS) operon denaturation at 94  C for 5 min, followed by 30 cycles of denatur-
sequence was targeted for specific detection of C. sakazakii. As for S. ation at 94  C for 30 s, annealing at 60  C for 30 s, and elongation at
aureus, thermostable nuclease gene (nuc) was chosen as target with 72  C for 20 s, and a final elongation step at 72  C for 7 min.
primers (F2 and R2) and probe (P2) designed with Beacon Designer After gel purification, the PCR products were cloned into the
software (version 7.0) (Xie, 2016). All these primers and probes pGEM-T vector (Promega, Madison, USA) and transformed into
were synthesised by Invitrogen (Shanghai, China). Top10 competent cells. Positive clones were selected by PCR iden-
To evaluate the specificity of the primers and probes, DNA from tification and confirmed by sequencing. The recombinant plasmids
bacterial strains listed in Table 1 were tested by dRT-PCR assay. The were then extracted using Plasmid Mini Kit I (Promega) with con-
dRT-PCR was performed in ABI 7500 real-time PCR cycler (Life centration determined by spectrophotometer. The number of
Technologies). A reaction mixture (25 mL) contained 12.5 mL plasmid copies were calculated by their length (3257 bp for
2  Premix Ex Taq (Takara, Dalian, China), 0.5 mL 50  ROX pGEMT-MMS and 3181 bp for pGEMT-nuc, respectively).
2
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Table 2
Primers (F, forward, R, reverse) and probes (P) used in the study.

Target bacteria Target gene Primer and probe sequence (50 -30 )

Cronobacter sakazakii MMS MMS-PCR-F: CGTTCCTGCGAGAAAGCG

F1: GGGATATTGTCCCCTGAAACAG
R1: CGAGAATAAGCCGCGCATT
P1: JOE-AGAGTAGTAGTTGTAGAGGCCGTGCTTCCGAAAG-BHQ2
Staphylococcus aureus nuc F2: CCTGAAGCAAGTGCATTTACGA
R2: CTTTAGCCAAGCCTTGACGAACT
P2: FAM-CATCAGCATAAATATACGCTAAGCCACGTCCA-BHQ1

2.4. Preparation of artificially spiked PIFs compared the enumeration results calculated from dRT-PCR and
conventional plate counting for natural (n ¼ 10) and artificially
Two kinds of PIFs, powdered formula milk (Yili, Inner Mongolia, spiked (n ¼ 12) powdered milk and rice cereal samples. Among
China) and rice cereal (Heinz, Guangdong, China), purchased from spiked PIF samples, ten samples were spiked with reference strains
local supermarket in Xiamen, were used for manual spiking. Both while 2 others were spiked with field isolates (Table 2). For dRT-PCR
products were confirmed to be free of C. sakazakii and S. aureus based enumeration, the Ct values were interpolated on the linear
according to the national food safety standard methods for food quantification curves generated from DNA extracted from serially
microbiological examination in China (NHFP, NFD, 2016a,b). diluted PIFs spiked with targeted bacteria.
Twenty-five grams of powdered milk and rice cereal was respec-
tively homogenised in 225 mL sterile physiological saline by bag- 2.8. Statistical analysis
mixer (Interscience, France) and used as food matrix for artificial
spiking. Manual spiked PIFs were then prepared by inoculating All experiments were performed in triplicate and data were
target bacteria to the above homogenate. expressed as means ± standard deviations. Counts from both con-
ventional plating and RT-PCR were calculated as log10 cfu mL
1 and
2.5. Evaluation of sensitivity of dRT-PCR assay for standard plasmid, compared for difference by paired t test of two-way ANOVA. The
pure culture and spiked PIFs agreement of such two methods for quantification was further
evaluated by BlandeAltman analysis (Bland & Altman, 2007, 2012).
For standard plasmids, pGEMT-MMS and pGEMT-nuc were All data were analysed using GRAPHPAD PRISM V.7.0 software
tenfold serially diluted with sterile distilled water to a final con- (GraphPad Software, La Jolla, CA, USA).
centration varied from 100 to 108 copies mL
1.
For pure bacteria and artificially spiked PIFs, fresh overnight 3. Results
cultures were tenfold continuously diluted with sterile physiolog-
ical saline and PIF homogenates as described above at final con- 3.1. Specificity of the dRT-PCR assay
centrations ranging from 101 to 107 cfu mL
1.
Bacterial genomic DNA was extracted from 1 mL of each diluted The specificity of the dRT-PCR assay was evaluated using 8 tar-
pure culture and spiked PIF suspensions. Two microliters of the geted strains and 13 non-targeted bacterial species belongs to 10
obtained genomic DNA and plasmid DNA samples were subjected different genera (Table 1). It was revealed that significant MMS-
to dRT-PCR assay with Ct values determined. and nuc-specific fluorescent signals were produced exclusively for
Meanwhile, the bacterial concentrations of pure culture and the tested C. sakazakii and S. aureus isolates while no exponential
spiked PIFs were determined by plating the diluents (100 mL) on amplification curves were obtained within 40 thermal cycles for all
two separate chromogenic agars for S. aureus and C. sakazakii other 13 strains. These results indicated that the developed dRT-
(Qingdao Hightech Industrial Park Haibo Biotechnology Co. Ltd., PCR assay is highly specific for targeted bacteria with no cross-
Qingdao, China), respectively, and incubating at 37  C for 24 h reactivity observed.
before enumeration.
3.2. Fitted curves and the sensitivity of dRT-PCR for standard
2.6. Construction of standard curves for quantification plasmids

Standard linear curves were generated by plotting the Ct values As shown in Fig. 1a,b, a good linear correlation was found be-
of the dRT-PCR performed on dilution series of DNA against the log tween log transferred plasmid concentrations and the correspond-
input cfu mL
1 of target bacteria. From the slope of the standard ing Ct values in dRT-PCR, with coefficients of determination (R2)
curve, the amplification efficiency (E) was estimated by formula higher than 0.98. The linearity range covered from 101 to 108 copies
E ¼ 10
1/slope-1 (Conte, Potoczniak, & Tobe, 2018). The limits of mL
1 pGEMT-MMS while that for its nuc fragment-harbouring
quantification (LOQ) for the dRT-PCR assay were defined as the counterpart was one log unit wider, extending to 100 copies mL
1
lowest concentration of cell count at which linearity was main- in its lowest quantification limit. Thus the LOQs of dRT-PCR assay for
tained. The standard curves derived from manually spiked PIFs pGEMT-MMS and pGEMT-nuc were determined to be 29.10 and 8.97
were used for quantification of C. sakazakii and S. aureus within copies mL
1, respectively. Moreover, a good amplification efficiency
corresponding food matrices. was obtained for both plasmids in the developed dRT-PCR assay,
being 0.79 for pGEMT-MMS and 0.90 for pGEMT-nuc.
2.7. Enumeration of target bacteria within PIFs in parallel with
plate counting and dRT-PCR assay 3.3. Fitted curves and the sensitivity of dRT-PCR for pure culture

To test the robustness of the developed dRT-PCR method in When genomic DNA from tenfold serially diluted fresh pure
quantification of C. sakazakii and S. aureus within PIF products, we culture of target pathogens was used as template for dRT-PCR assay,
3
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Fig. 1. Standard curves for duplex real-time PCR derived from 10-fold continuously diluted (a) standard plasmid pGEMT-MMS at concentrations of 2.91  108 to 2.91  101 copies
mL
1 (b) standard plasmid pGEMT-nuc at concentrations of 8.97  108 to 8.97  100 copies mL
1 (c) pure culture of Cronobacter sakazakii at concentrations of 1.3  107 to
1.3  102 cfu mL
1 (d) pure culture of Staphylococcus aureus at concentrations of 2.4  107 to 2.4  101 cfu mL
1 (e) 2.1  107 to 2.1  102 cfu mL
1 C. sakazakii-spiked rice cereal (f)
6.7  107 to 6.7  101 cfu mL
1 S. aureus-spiked rice cereal (g) 3.1  107 to 3.1  102 cfu mL
1 C. sakazakii-spiked powdered milk (h) 4.5  107 to 4.5  101 cfu mL
1 S. aureus-spiked
powdered milk. Each point represents the average cycle threshold (Ct) value of three duplex real-time PCR assays. Error bars indicate standard deviations.

4
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Ct values were also revealed to be in good linear correlation to the 107 cfu mL
1, with an amplification efficiency of 0.96 and 0.82,
corresponding bacterial concentrations (Fig. 1c and d). The devel- respectively. In the case of S. aureus, the linear coverage of quan-
oped assay was able to quantify as low as 102 cfu mL
1 C. sakazakii tification was wider, covering 7 orders of magnitude from 101 to
and 101 cfu mL
1 S. aureus, with linearity ranging over 6 and 7 logs 107 cfu mL
1 in such two PIFs. As for the PCR efficiency of S. aureus
for each. Deduced from the equations fitted with log transferred in the two tested matrices, it was comparable with that of C.
bacterial concentrations against their Ct values, we can found a PCR sakazakii in milk powder, being 0.83.
efficiency of 0.91 for C. sakazakii and 0.79 for S. aureus in pure The good linear correlation (R2  0.98) of Ct values with the log-
culture. transformed targeted bacterial counts and high amplification effi-
ciency (0.82) in artificially contaminated samples indicated that
3.4. Quantification curves and sensitivity of dRT-PCR for artificially the established qRT-PCR assay could be applied for simultaneous
spiked PIFs enumeration of C. sakazakii and S. aureus in both infant powdered
milk and rice cereal products.
To ensure consistency in DNA extraction and PCR amplification
efficiency for samples used for standard curve establishment with 3.5. Comparison of dRT-PCR with plate counting in enumerating
those encountered in real application, the linear equations pro- target bacteria in PIF samples
duced through dRT-PCR conducted with genomic DNA extracted
from continuously diluted artificially spiked PIFs were used as For ten PIF products (5 rice cereal and 5 powdered milk sam-
quantification curves. Thus four standard quantification curves ples) bought from local supermarket, they were all found to be free
corresponding to food matrixepathogen combination of rice of the two targeted pathogens through both traditional plate
cereal-C. sakazakii (Fig. 1e), rice cereal-S. aureus (Fig. 1f), powdered counting and dRT-PCR method established in this study.
formula milk-C. sakazakii (Fig. 1g) and powdered formula milk -S. Thereafter, twelve PIF samples randomly inoculated with C.
aureus (Fig. 1h) were established for practical application in path- sakazakii and S. aureus were then subjected to enumeration in
ogen quantification within PIFs. parallel with the two methods for comparison. As shown in Fig. 2a,
No matter whether in rice cereal or powdered formula milk, the in the six artificially spiked rice cereal samples, the bacterial
sensitivity of the dRT-PCR assay for both target pathogens was numbers deduced from dRT-PCR and plate counting were not sta-
comparable with that in pure culture, with LOQ of 102 cfu mL
1 for tistically different for both C. sakazakii (t ¼ 0.8162, P > 0.05) and S.
C. sakazakii and 101 cfu mL
1 for S. aureus. The quantification curve aureus (t ¼ 0.6252, P > 0.05). Similarly, there was also no significant
for C. sakazakii in both rice cereal and milk powder exhibited a good difference found for the quantitative results of the two pathogens
linearity within bacterial concentrations ranging from 102 to (P > 0.05) in manually spiked powdered milk samples (Fig. 2b). To

Fig. 2. Enumeration of Cronobacter sakazakii and Staphylococcus aureus in artificially spiked infant rice cereal (a) and powdered milk (b) using the established duplex RT-PCR assay
( , Cronobacter sakazakii; , Staphylococcus aureus) and plate counting method ( , Cronobacter sakazakii; , Staphylococcus aureus). Error bars indicate standard deviations.

5
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Fig. 3. Bland-Altman plots for comparison of enumeration of Cronobacter sakazakii in manually spiked infant rice cereal samples (RC; a) and infant milk powder samples (MP; c),
Staphylococcus aureus in RC (b) and MP (d) through plating and dRT-PCR. The difference between the two methods (y) is plotted against the mean value of bacterial counts derived
from such two methods (x). The limits of agreement are presented as dotted lines. The bias is the average difference between the values (log10 cfu mL
1) of the two methods.

further confirm the agreement of the two methods in quantifica- Without the need for steps of laborious manipulation and
tion of targeted bacterial pathogens, a Bland-Altman plot with analysis, the new molecular quantification method exhibited great
limits of agreement was constructed for each pathogen-food matrix advantage in the time and cost efficiency. As estimated by Malorny,
combination. As shown in Fig. 3, all data points were located within € fstro
Lo €m, Wagner, Kra €mer, and Hoorfar (2008), duration and cost
the limits of agreement, while the average discrepancy between the for quantification of Salmonella in food samples can be reduced by
two methods (the bias) was close to zero, demonstrating a signif- 87.5e90% (from 4e5 days to 12 h) and 40e60% (from 500e750 V to
icant agreement between the new developed dRT-PCR method and 300 V), respectively, through using the real-time PCR method
conventional plating. These results confirmed that the established compared with the MPN method. The rapidity and simplicity of
dRT-PCR assay is robust for quantitative detection of C. sakazakii quantification can be further enhanced when multiplex RT-PCR
and S. aureus in the two tested PIF matrices. assay targeting more than one microbes was used.
As presented in this study, rapid and simultaneous enumeration
4. Discussion of S. aureus and C. sakazakii in rice cereal and powdered milk was
successfully achieved in a single reaction within 2 h versus 3e4
To date, kinds of foodborne microbes including hygienic in- days for each pathogen with the standard method. Furthermore,
dicators (Takahashi et al., 2017; Vital et al., 2017), pathogenic bac- problem of one cfu on plate might be generated by more than one
teria (Aparecida de Oliveira et al., 2010; Kadiroglu, Korel, & Ceylan, cell and thus led to underestimate of cell number can also be cir-
2014; Qin et al., 2020), beneficial microbial populations (Ilha et al., cumvented by the new quantification method. Thirdly, the new
2016; Kim, Bae, Seong, & Han, 2020; Verruck et al., 2020), etc., have method counts all cells which is or has been present in the sample,
been rapidly enumerated with RT-PCR method. In comparison with offering the advantage of a retrospective analysis even of processed
traditional microbial enumeration methods such as plate counting samples to aid food poisoning-related risk assessment. For toxi-
and most-probable-number (MPN) test, RT-PCR-based quantitation genic pathogen like S. aureus, since the toxins are still exist though
is easier, more rapid and high-throughput. As there may exist cell death, enumeration of total cell number through RT-PCR
different background flora in various food matrices that can inter- method can provide an even more realistic impact assessment
fere with the interpretation of target colonies, not only time- with regards to toxin-related public health implication than plating
consuming inoculation and incubation but also labour-intensive does.
confirmation of typical colonies are required for culture-based When RT-PCR was harnessed as a quantitative tool for microbial
quantification methods. In contrast, through developing highly enumeration, a good consistency with plate counts and linear
specific primers and/or probes, RT-PCR has been proven to be able correlation ranging over 5 logs have been well reported in various
to concisely quantify target microbes in spite of the presence of microbes within different matrices (Clais et al., 2015; Graber, Casey,
much dominant background microbiota (Qin et al., 2020; Wolffs, Naskova, Steiner, & Schaeren, 2007; Longin, Guilloux-Benatier, &
Glencross, Norling, & Griffiths, 2007; Zago, Bonvini, Carminati, & Alexandre, 2016; Martins et al., 2020; Shell et al., 2017). Our results
Giraffa, 2009). were in good accordance with previous researches with linearity

6
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

range of quantification covered 6 logs for C. sakazakii and 7 logs for aureus without enrichment in spiked PIF whose sensitivity can well
S. aureus. Although methods for rapid identification of C. sakazakii meet the microbiological criteria for such products and thus can be
in food have been explored previously in multiple research studies applied directly for rapid and accurate microbiological risk analysis.
(Hu, Yu, & Xiao, 2018; Pan et al., 2018; Shukla et al., 2018; Yuan As for C. sakazakii, a short enrichment or concentration step will be
et al., 2020), limited studies focused on its fast and reliable needed before test using our method if the pathogen is lower than
enumeration has been carried out to date. Targeting palE gene, the LOQ of 102 cfu mL
1. In comparison with the analytical reference
Krascsenicsova , Trn
cíkova
, and Kaclíkova
 (2008) developed a real- method of C. sakazakii (ISO, 2017) and S. aureus (ISO, 1999a,b), the
time 50 -nuclease PCR system for rapid quantification of Entero- new develop method showed great superiority in rapidity, conve-
bacter sakazakii. The fact that its quantification was based on nience, cost-efficiency and higher sensitivity.
standard curve derived from pure culture but not real food may Overall, the robustness and superiority of RT-PCR in rapid
lead to inaccurate colony counting (Malorny et al., 2008). A LOQ of quantification of bacterial targets in food was once more confirmed
103 cfu mL
1 and linear range over 8 logs for C. sakazakii in both in our study. For the problem of overestimate of cell number by RT-
pure culture and powdered infant milk were found in a RT-PCR PCR due to its inability to discriminate between live versus dead
assay simultaneously targeting Salmonella and Cronobacter cell, it can be circumvented through the use of chemicals such as
(Hyeon, Park, Choi, Holt, & Seo, 2010). As it mainly focused on propidium or ethidium monoazide during sample preparation
qualitative detection of target pathogens, the reliability of the fitted before RT-PCR (Chai et al., 2020; Zhai et al., 2019). However, such
curve for cell enumeration within real food products was not chemicals should be used with caution as it has been proved that
verified. The higher sensitivity for C. sakazakii in our research over their effectiveness depended on not only the treatment used on the
this report may be attributed to the better DNA extraction efficiency cells but also the ratio of live/dead cells (Takahashi et al., 2018).
through use of merchandised kit rather than simply boiling. Based
on the quantification curve with linearity covering 105 to 5. Conclusions
107 cfu mL
1 generated by serial dilution of pure culture of C.
sakazakii, Brucella melitensis and L. monocytogenes, Tutar, Akinci, In this study, a new duplex RT-PCR-based, culture-free method
and Akyol (2018) used the RT-PCR assay to quantify the three was developed for the first time to realise rapid and robust quan-
pathogens in raw milk and cheese without verification of the tification of C. sakazakii and S. aureus in two kinds of most
robustness of the quantification curve in food samples. Except for commonly consumed PIFs, rice cereal and powdered milk. Through
RT-PCR, PCR-ELISA based quantification of C. sakazakii were also plotting the Ct values against their corresponding bacterial counts
developed by Li et al. (2013), with LOQ of 102 and 103 cfu mL
1 for in artificially contaminated PIFs, linear regression equations with
pure culture and PIF without enrichment, respectively. Compared high determination coefficients were established for rapid quanti-
with PCR-ELISA, RT-PCR assay based enumeration explored in this fication of target pathogens. The developed dRT-PCR assay was
study bore superiority in higher sensitivity, lower risks of cross- proved to be highly specific, with no cross-reactivity in non-
contamination and simplicity. targeted bacteria. Without enrichment, it is able to simulta-
Compared with C. sakazakii, more research has been carried out neously enumerate as low as 102 cfu mL
1 C. sakazakii and
to explore the RT-PCR-based quantification of S. aureus. Using mainly 101 cfu mL
1 S. aureus in both pure culture and tested PIF matrices
nuc gene as target, S. aureus was rapidly enumerated in foods within 2 h. Furthermore, quantification results derived from the
through linear standard curve with sensitivity varied from 101 to new method was revealed to be statistically in parallel with that
104 cfu mL
1 (Alarco n, Vicedo, & Aznar, 2006; Aprodu et al., 2011; from traditional plate counting in testing natural and artificially
Botaro et al., 2013; Goto et al., 2007; Hein et al., 2001; Hein, spiked PIF products. Therefore, the new established dRT-PCR assay
Jørgensen, Loncarevic, & Wagner, 2005; Takahashi et al., 2018). was simple, rapid and robust, providing a valuable alternative for
Among such studies, varied correlation between the cell number direct quantification of C. sakazakii and S. aureus in infant foods.
derived from RT-PCR and that from traditional plating method was
revealed, which may be attributed to presence of VBNC or dead cells, Authors' contribution
cell aggregation when plating or different methodology in quanti-
fication curve development and quantitative results comparison. Zhou Liu and Xueqin Xie conceived and designed research.
Though tested in duplex assay, the sensitivity for S. aureus Xueqin Xie conducted experiments and wrote manuscript. All au-
(101 cfu mL
1) was not reduced in this study compared with the thors read and approved the manuscript.
previous single-targeted systems. Targeting the nuc gene which has
been proved to be highly correlated to the cfu number of S. aureus
Declaration of competing interest
(Hein et al., 2001), a good consistency of bacterial number obtained
from RT-PCR and plate count was achieved in our study. Further-
The authors declare that they have no known competing
more, considering the fact that difference in DNA extracting and
financial interests or personal relationships that could have
PCR amplification efficiency greatly influence the quantification
appeared to influence the work reported in this paper.
robustness by RT-PCR (Postollec et al., 2011), we used the standard
curve based on real food matrix rather than pure culture for
Acknowledgement
enumeration. The unsuitable application of quantification curve
may also lead to discrepancy of the RT-PCR enumeration from that
This work was supported by the National Natural Science
of traditional count method reported in some publication (Aprodu
Foundation of China (Grants: 31801710, 31101489) and Natural
et al., 2011; Hein et al., 2005).
Science Foundation of Fujian Province of China (Grants: 2014D010,
Internationally agreed microbiological criteria established by
2014J01118).
Codex Alimentarius Commission (2008) for C. sakazakii in powdered
infant formula was not detected in 10 g product with up to 30
sampling units. Though no microbiological limit for S. aureus was References
included in the code, a low levels of <100 cfu g
1 was thought to be
 n, B., Vicedo, B., & Aznar, R. (2006). PCR-based procedures for detection and
Alarco
safe according to the recommendations of FAO/WHO (2004, 2006). quantification of Staphylococcus aureus and their application in food. Journal of
The LOQ of the dRT-PCR based rapid method was 101 cfu mL
1 S. Applied Microbiology, 100, 352e364.

7
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Aparecida de Oliveira, M., Abeid Ribeiro, E. G., Morato Bergamini, A. M., & Pereira De Ilha, E. C., Scariot, M. C., Treml, D., Pereira, T. P., Sant'Anna, E. S., Prude ^ncio, E. S., et al.
Martinis, E. C. (2010). Quantification of Listeria monocytogenes in minimally (2016). Comparison of real-time PCR assay and plate count for Lactobacillus
processed leafy vegetables using a combined method based on enrichment and paracasei enumeration in yoghurt. Annals of Microbiology, 66, 597e606.
16S rRNA real-time PCR. Food Microbiology, 27, 19e23. ISO. (1999a). Microbiology of food and animal feeding stuffs d Horizontal method for
Aprodu, I., Walcher, G., Schelin, J., Hein, I., Norling, B., Radstro €m, P., et al. (2011). the enumeration of coagulase-positive staphylococci (Staphylococcus aureus and
Advanced sample preparation for the molecular quantification of Staphylo- other species) d Part 1: Technique using Baird-Parker agar medium (ISO Standard
coccus aureus in artificially and naturally contaminated milk. International No. 6888-1:1999). Geneva, Switzerland: International Organisation for Stand-
Journal of Food Microbiology, 145, S61eS65. ardisation. https://www.iso.org/standard/23036.html.
Asao, T., Kumeda, Y., Kawai, T., Shibata, T., Oda, H., Haruki, K., et al. (2003). An ISO. (1999b). Microbiology of food and animal feeding stuffs d Horizontal method for
extensive outbreak of staphylococcal food poisoning due to low-fat milk in the enumeration of coagulase-positive staphylococci (Staphylococcus aureus and
Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim other species) d Part 2: Technique using rabbit plasma fibrinogen agar medium
milk. Epidemiology and Infection, 130, 33e40. (ISO Standard No. 6888-2:1999). Geneva, Switzerland: International Organisa-
Bland, J. M., & Altman, D. G. (2007). Agreement between methods of measurement tion for Standardisation. https://www.iso.org/standard/25571.html.
with multiple observations per individual. Journal of Biopharmaceutical Statis- ISO. (2017). Microbiology of the food chain d Horizontal method for the detection of
tics, 17, 571e582. Cronobacter spp. (ISO Standard No. 22964:2017). Geneva, Switzerland: Interna-
Bland, J. M., & Altman, D. G. (2012). Agreed statistics: Measurement method com- tional Organisation for Standardisation. https://www.iso.org/standard/64708.
parison. Anesthesiology, 116, 182e185. html.
Bogdanovi
cova , K., Necidova, L., Haru
stiakova
, D., & Jan
stova
, B. (2017). Milk powder Jiang, Y., Chen, S., Zhao, Y., Yang, X., Fu, S., McKillip, J. L., et al. (2020). Multiplex loop-
risk assessment with Staphylococcus aureus toxigenic strains. Food Control, 73, mediated isothermal amplification-based lateral flow dipstick for simultaneous
2e7. detection of 3 food-borne pathogens in powdered infant formula. Journal of
Botaro, B. G., Cortinhas, C. S., Março, L. V., Moreno, J., Silva, L., Benites, N. R., et al. Dairy Science, 103, 4002e4012.
(2013). Detection and enumeration of Staphylococcus aureus from bovine milk Jones, G., Pardos de la Gandara, M., Herrera-Leon, L., Herrera-Leon, S., Varela
samples by real-time polymerase chain reaction. Journal of Dairy Science, 96, Martinez, C., Hureaux-Roy, R., et al. (2019). Outbreak of Salmonella enterica
6955e6964. serotype Poona in infants linked to persistent Salmonella contamination in an
Cahill, S. M., Wachsmuth, I. K., Costarrica, M., & Ben Embarek, P. K. (2008). Powdered infant formula manufacturing facility, France, August 2018 to February 2019.
infant formula as a source of Salmonella infection in infants. Clinical Infectious Euro Surveillance Bulletin, 24, Article 1900161.
Diseases, 46, 268e273. Kadariya, J., Smith, T. C., & Thapaliya, D. (2014). Staphylococcus aureus and staphy-
Caubilla-Barron, J., Hurrell, E., Townsend, S., Cheetham, P., Loc-Carrillo, C., Fayet, O., lococcal food-borne disease: An ongoing challenge in public health. BioMed
et al. (2007). Genotypic and phenotypic analysis of Enterobacter sakazakii Research International, 2014, Article 827965.
strains from an outbreak resulting in fatalities in a neonatal intensive care unit Kadirog lu, P., Korel, F., & Ceylan, C. (2014). Quantification of Staphylococcus aureus in
in France. Journal of Clinical Microbiology, 45, 3979e3985. white cheese by the improved DNA extraction strategy combined with TaqMan
Centers for Disease Control and Prevention. (2002). Enterobacter sakazakii in- and LNA probe-based qPCR. Journal of Microbiological Methods, 105, 92e97.
fections associated with the use of powdered infant formula–Tennessee, 2001. Kim, S., Bae, J., Seong, H. B., & Han, N. S. (2020). Development of Leuconostoc lactis-
Morbidity and Mortality Weekly Report, 51, 297e300. specific quantitative PCR and its application for identification and enumeration
Chai, A. L., Ben, H. Y., Guo, W. T., Shi, Y. X., Xie, X. W., Li, L., et al. (2020). Quantifi- in fermented foods. Food Analytical Methods, 13, 992e999.
cation of viable cells of Pseudomonas syringae pv. Tomato in tomato seed using Krascsenicsova , K., Trn
, T., & Kaclíkov
cíkova a, E. (2008). Detection and quantification
propidium monoazide and a real-time PCR assay. Plant Disease, 104, of Enterobacter sakazakii by real-time 5’-nuclease polymerase chain reaction
2225e2232. targeting the palE Gene. Food Analytical Methods, 1, 85e94.
Clais, S., Boulet, G., Van Kerckhoven, M., Lanckacker, E., Delputte, P., Maes, L., et al. Law, J. W., Ab Mutalib, N. S., Chan, K. G., & Lee, L. (2015). Rapid methods for the
(2015). Comparison of viable plate count, turbidity measurement and real-time detection of foodborne bacterial pathogens: Principles, applications, advantages
PCR for quantification of Porphyromonas gingivalis. Letters in Applied Microbi- and limitations. Frontiers in Microbiology, 5, Article 770.
ology, 60, 79e84. Li, Y. H., Cao, L., Zhang, C., Chen, Q. M., Lu, F. X., Bie, X. M., et al. (2013). Development
Codex Alimentarius Commission. (2008). Code of hygienic practice for powdered infant and evaluation of a PCR-ELISA assay for the detection and quantification of
formula for infants and young children (CAC/RCP 66-2008). Joint FAO/WHO Food Cronobacter spp. International Dairy Journal, 33, 27e33.
Standards Programme. Rome, Italy: Food and Agriculture Organization of the Li, F., Xie, G. Y., Zhou, B. Q., Yu, P., Yu, S., Aguilar, Z. P., et al. (2016). Rapid and
United Nations. www.fao.org/input/download/standards/11026/CXP_066e.pdf. simultaneous detection of viable Cronobacter sakazakii, Staphylococcus aureus,
Conte, J., Potoczniak, M. J., & Tobe, S. S. (2018). Using synthetic oligonucleotides as and Bacillus cereus in infant food products by PMA-mPCR assay with internal
standards in probe-based qPCR. Biotechniques, 64, 177e179. amplification control. LWT-Food Science and Technology, 74, 176e182.
FAO/WHO. (2004). Enterobacter sakazakii and other microorganisms in powdered Longin, C., Guilloux-Benatier, M., & Alexandre, H. (2016). Design and performance
infant formula: meeting report, Microbiological Risk Assessment Series 6. Rome, testing of a DNA extraction assay for sensitive and reliable quantification of
Italy: Food and Agriculture Organization of the United Nations. https://www. acetic acid bacteria directly in red wine using real time PCR. Frontiers in
who.int/foodsafety/publications/mra6-enterobacter-sakazakii/en/. Microbiology, 7, Article 831.
FAO/WHO. (2006). Enterobacter sakazakii and Salmonella in powdered infant for- Malorny, B., Lo €fstro€m, C., Wagner, M., Kr€ amer, N., & Hoorfar, J. (2008). Enumeration
mula: meeting report, Microbiological Risk Assessment Series 10. Rome, Italy: Food of salmonella bacteria in food and feed samples by real-time PCR for quanti-
and Agriculture Organization of the United Nations. https://www.who.int/ tative microbial risk assessment. Applied and Environmental Microbiology, 74,
foodsafety/publications/micro/mra10/en/. 1299e1304.
Fu, S., Jiang, Y., Qin, X., Yang, T., Chen, S., Yang, X., et al. (2020). Electricity-free Martins, W. F., Longhi, D. A., de Araga ~o, G., Melero, B., Rovira, J., & Diez, A. M. (2020).
amplification and visual detection of Cronobacter species in powdered infant A mathematical modeling approach to the quantification of lactic acid bacteria
formula. Journal of Dairy Science, 103, 6882e6893. in vacuum-packaged samples of cooked meat: Combining the TaqMan-based
Garrido-Maestu, A., Toma s Forne s, D., & Prado Rodríguez, M. (2019). The use of quantitative PCR method with the plate-count method. International Journal
multiplex real-time PCR for the simultaneous detection of foodborne bacterial of Food Microbiology, 318, Article 108466.
pathogens. Methods in Molecular Biology, 1918, 35e45. NHFP, NFD. (2016a). National food safety standardefood microbiological examination:
Goto, M., Takahashi, H., Segawa, Y., Hayashidani, H., Takatori, K., & Hara-Kudo, Y. examination of Cronobacter (Enterobacter sakazakii) (GB 4789.40-2016). Beijing,
(2007). Real-time PCR method for quantification of Staphylococcus aureus in China: National Health and Family Planning Commission of the People's Re-
milk. Journal of Food Protection, 70, 90e96. public of China and National Food and drug Administration of the People's
Graber, H. U., Casey, M. G., Naskova, J., Steiner, A., & Schaeren, W. (2007). Devel- Republic of China.
opment of a highly sensitive and specific assay to detect Staphylococcus aureus NHFP, NFD. (2016b). National food safety standardefood microbiological examination:
in bovine mastitic milk. Journal of Dairy Science, 90, 4661e4669. examination of Staphylococcus aureus (GB 4789.10-2016). Beijing, China: National
Hein, I., Jørgensen, H. J., Loncarevic, S., & Wagner, M. (2005). Quantification of Health and Family Planning Commission of the People's Republic of China and
Staphylococcus aureus in unpasteurised bovine and caprine milk by real-time National Food and drug Administration of the People's Republic of China.
PCR. Research in Microbiology, 156, 554e563. Norberg, S., Stanton, C., Ross, R. P., Hill, C., Fitzgerald, G. F., & Cotter, P. D. (2012).
Hein, I., Lehner, A., Rieck, P., Klein, K., Brandl, E., & Wagner, M. (2001). Comparison of Cronobacter spp. in powdered infant formula. Journal of Food Protection, 75,
different approaches to quantify Staphylococcus aureus cells by real-time 607e620.
quantitative PCR and application of this technique for examination of cheese. Pan, R., Jiang, Y., Sun, L., Wang, R., Zhuang, K., Zhao, Y., et al. (2018). Gold
Applied and Environmental Microbiology, 67, 3122e3126. nanoparticle-based enhanced lateral flow immunoassay for detection of Cro-
Hong, H. L., Sun, C. Z., Wei, S., Sun, X., Mutukumira, A., & Wu, X. Y. (2020). Devel- nobacter sakazakii in powdered infant formula. Journal of Dairy Science, 101,
opment of a real-time recombinase polymerase amplification assay for rapid 3835e3843.
detection of Salmonella in powdered infant formula. International Dairy Journal, Postollec, F., Falentin, H., Pavan, S., Combrisson, J., & Sohier, D. (2011). Recent ad-
102, 104579. vances in quantitative PCR (qPCR) applications in food microbiology. Food
Hu, S. F., Yu, Y. G., & Xiao, X. L. (2018). Stress resistance, detection and disinfection of Microbiology, 28, 848e861.
Cronobacter spp. in dairy products: A review. Food Control, 85, 400e415. Qin, H., Shi, X. Q., Yu, L., Li, K., Wang, J. W., Chen, J. H., et al. (2020). Multiplex real-
Hyeon, J. Y., Park, C., Choi, I. S., Holt, P. S., & Seo, K. H. (2010). Development of time PCR coupled with sodium dodecyl sulphate and propidium monoazide for
multiplex real-time PCR with internal amplification control for simultaneous the simultaneous detection of viable Listeria monocytogenes, Cronobacter saka-
detection of Salmonella and Cronobacter in powdered infant formula. Interna- zakii, Staphylococcus aureus and Salmonella spp. in milk. International Diary
tional Journal of Food Microbiology, 144, 177e181. Journal, 108, Article 104739.

8
X. Xie and Z. Liu International Dairy Journal 117 (2021) 105019

Rajapaksha, P., Elbourne, A., Gangadoo, S., Brown, R., Cozzolino, D., & Chapman, J. Vital, P. G., Van Ha, N. T., Tuyet, L. T., & Widmer, K. W. (2017). Application of
(2019). A review of methods for the detection of pathogenic microorganisms. quantitative real-time PCR compared to filtration methods for the enumeration
Analyst, 144, 396e411. of Escherichia coli in surface waters within Vietnam. Journal of Water and Health,
Ramamurthy, T., Ghosh, A., Pazhani, G. P., & Shinoda, S. (2014). Current perspectives 15, 155e162.
on viable but non-culturable (VBNC) pathogenic bacteria. Frontiers in Public Wang, X., Meng, J., Zhang, J., Zhou, T., Zhang, Y., Yang, B., et al. (2012). Character-
Health, 2, Article 103. ization of Staphylococcus aureus isolated from powdered infant formula milk
Seo, K. H., & Brackett, R. E. (2005). Rapid, specific detection of Enterobacter sakazakii and infant rice cereal in China. International Journal of Food Microbiology, 153,
in infant formula using a real-time PCR assay. Journal of Food Protection, 68, 142e147.
59e63. Wolffs, P. F., Glencross, K., Norling, B., & Griffiths, M. W. (2007). Simultaneous
Shell, W. S., Sayed, M. L., Samy, A. A., Al-Sadek, G. M., El-Hamid, G., & Ali, A. (2017). Using quantification of pathogenic Campylobacter and Salmonella in chicken rinse
real-time polymerase chain reaction as an alternative rapid method for enumer- fluid by a flotation and real-time multiplex PCR procedure. International Journal
ation of colony count in live Brucella vaccines. Veterinary World, 10, 610e615. of Food Microbiology, 117, 50e54.
Shukla, S., Haldorai, Y., Bajpai, V. K., Rengaraj, A., Hwang, S. K., Song, X., et al. (2018). Xie, X. Q. (2016). Development of TaqMan real-time PCR method for quantitative
Electrochemical coupled immunosensing platform based on graphene oxide/ detection of Staphylococcus aureus in powdered infant formula (In Chinese).
gold nanocomposite for sensitive detection of Cronobacter sakazakii in Food and Fermentation Industries, 42, 223e229.
powdered infant formula. Biosensors and Bioelectronics, 109, 139e149. Yuan, Y., Wu, X., Liu, Z., Ning, Q., Fu, L., & Wu, S. (2020). A signal cascade amplifi-
Takahashi, H., Kasuga, R., Miya, S., Miyamura, N., Kuda, T., & Kimura, B. (2018). Ef- cation strategy based on RT-PCR triggering of a G-quadruplex DNAzyme for a
ficacy of propidium monoazide on quantitative real-time PCR-based enumer- novel electrochemical detection of viable Cronobacter sakazakii. Analyst, 145,
ation of Staphylococcus aureus live cells treated with various sanitizers. Journal 4477e4483.
of Food Protection, 81, 1815e1820. Zago, M., Bonvini, B., Carminati, D., & Giraffa, G. (2009). Detection and quantification
Takahashi, H., Saito, R., Miya, S., Tanaka, Y., Miyamura, N., Kuda, T., et al. (2017). of Enterococcus gilvus in cheese by real-time PCR. Systematic & Applied Micro-
Development of quantitative real-time PCR for detection and enumeration of biology, 32, 514e521.
Enterobacteriaceae. International Journal of Food Microbiology, 246, 92e97. Zeng, D., Chen, Z., Jiang, Y., Xue, F., & Li, B. (2016). Advances and challenges in
Tutar, E., Akinci, K. S., & Akyol, I. (2018). Development and application of a new viability detection of foodborne pathogens. Frontiers in Microbiology, 7, Article
multiplex real-time PCR assay for simultaneous identification of Brucella meli- 1833.
tensis, Cronobacter sakazakii and Listeria monocytogenes in raw milk and cheese. Zhai, L., Li, J., Tao, T., Lu, Z., Lv, F., & Bie, X. (2019). Propidium monoazide real-time
International Journal of Dairy Technology, 71, 1e8. PCR amplification for viable Salmonella species and Salmonella Heidelberg in
Verruck, S., Silva, K. J., de Oliveira Santeli, H., Scariot, M. C., Venturelli, G. L., pork. Canadian Journal of Microbiology, 65, 477e485.
Prudencio, E. S., et al. (2020). Bifidobacterium animalis ssp. lactis BB-12 Zhao, X., Zhong, J., Wei, C., Lin, C. W., & Ding, T. (2017). Current perspectives on
enumeration by quantitative PCR assay in microcapsules with full-fat goat viable but non-culturable state in foodborne pathogens. Frontiers in Microbi-
milk and inulin-type fructans. Food Research International, 133, Article 109131. ology, 8, Article 580.