Scribd
Upload
8 views

Experiment_1_SP_25_Report_Guidelines (1)

The lab report for Experiment 1 is due on January 28th/30th and focuses on analyzing the 372 class data regarding the effectiveness of designed primers and the genetic equilibrium of Alu alleles at the TPA-25 locus. Required sections include Title, Results, Discussion, and References, with specific guidelines for gel images and data analysis. The report should also include primer sequences, chi-squared calculations, and a discussion on the findings in relation to existing literature.

Uploaded by

kaivanminab
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
8 views

Experiment_1_SP_25_Report_Guidelines (1)

The lab report for Experiment 1 is due on January 28th/30th and focuses on analyzing the 372 class data regarding the effectiveness of designed primers and the genetic equilibrium of Alu alleles at the TPA-25 locus. Required sections include Title, Results, Discussion, and References, with specific guidelines for gel images and data analysis. The report should also include primer sequences, chi-squared calculations, and a discussion on the findings in relation to existing literature.

Uploaded by

kaivanminab
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 5

Experiment 1: Lab Report Guidelines

Due Date: Jan 28th/Jan 30th 3:00pm.

This is the analysis of a population so you will be discussing the 372 class data rather than your
individual data. There are two purposes to this lab. One, to evaluate how effective the designed
primers for your respective labs successfully amplified the desired fragment. Two, to evaluate
whether the Alu alleles at the TPA-25 locus for the class are in genetic equilibrium. Please
remember to discuss both in your reports.

Sections required:
Title
Results
Discussion
References

For gel images:


Clearly label the ladder on the gel and assess the approximate size of your bands. i.e. “Using the
ladder as a reference, in lane X, the two bands are ~700bp and ~400bp, respectively.”

Primer 1F/1R (Original Alu Primers) Tm: 55C Fragment length without insert: 113bp F:
GTAAGAGTTCCGTAACAGGACAGCT
R: CCCCACCCTAGGAGAACTTCTCTTT

Primer 2019F/2019R Tm: 59C Fragment length without insert: 192bp


F: GTCCTCAGCTGTTCTCCTGAC
R: GAGGGAGGACACCGAGTTCA

Lab 1:
Primer 2F/2R Tm: 58CFragment length without insert: 224bp
F: CCCAAGTTAAGGGTCCTGGC
R: AGGGAGGACACCGAGTTCAT

Do not forget to include the primer sequences in your report!

Alu data analysis (goes in results):


Follow the instructions given to you in lab in the PowerPoint and in the Bloom pages, (Bloom et
al., 1996) pg 355-357; Follow steps #1-6 (NOT #7-8). Is the sample donation population in
Hardy-Weinberg equilibrium (HWE)? Justify your answer based on the statistics.

1
Figures and Tables

Figure 1. The gel displaying the Alu genotypes of some of the donation population (your
analysis should be of all the gels but only need to include one gel as a sample). Note that the
molecular weight standard used a NEB 1kb Plus Ladder. The sizes of the bands in the ladder are
as follows: https://international.neb.com/products/n3200-1-kb-plus-dna-ladder

Indicate what is loaded in each lane using a legend, either in the figure, or as part of the figure
description. Identify clearly and accurately the bands in the ladder. If the ladder bands are too
close together, you may choose to just identify key bands for reference.

2
Table 1. Geneotype and Allelic frequency of the TPA-25 Alu insert in L1+L2. Use the data from
both classes to complete these calculations. Do not include samples in your count if no bands
appeared.

To determine the allele frequency, a Google doc has been assembled for the values.
https://docs.google.com/spreadsheets/d/1IpnJBW3bar1Jjdwu31O_E4k6ilwDSEO7-
PYD61ujeAo/edit?usp=sharing
- Fill in your corresponding frequency if you haven’t already done so

Table 2. Chi Squared Data for both the class data (this year) and class data + previous year’s
data.

In this section, you will calculate one chi squared value for this year’s class and one chi squared
value for this year’s class data + previous year’s data. You will end up with 2 chi squared values.

Show a sample calculation


__________________________________________________________________________

For Example (with a population of 50 people):


Observed Observed Expected
Freq of + allele Freq of - allele
Genotype Genotype Genotype
(p) (q)
Distributions Frequency* Frequencies *
+/+ 10 .2 0.2025
+/- 25 .5 0.45 0.55 0.495
-/- 15 .3 0.3025

3
*all frequencies should add to 1.0

p (allelic frequency for + ) = (2x10) + 25 = 0.45


2 x 50
q (allelic frequency for - ) = (2x15) + 25 = 0.55
2 x 50
Expected Genotype frequencies:
p2+2pq+q2
+/+ = p2 = (0.45)2 = 0.2025
+/- = 2pq = 2(0.45)(0.55) = 0.495
2 2
-/- = q = (0.55) = 0.3025

Example of Chi Squared Data Table


Observed Expected Deviation
Genotype Genotype Genotype o–e d2/e χ2 (sum of all d2/e)
Distribution (o) Distribution (e) (d)
+/+ 20 20.25 -0.25 0.003086
+/- 50 49.50 0.50 0.005051 0.010203
-/- 30 30.25 -0.25 0.002066

Look up chi-squared values in the Bloom Expt Scan to identify the probability values of your
data. In this example data, the chi squared value of 0.010203 falls between the probability
values of 0.90 and 0.95.

If you have taken statistics, you will understand that the chi-squared value is a test of whether
there is a difference between the groups. The null hypothesis in this case is there is no
difference between the expected and the observed values. If the expected is in HWE, then
accepting the null hypothesis means the observed population is in HWE.

Based on the example, 0.90-0.95 probability means 90-95% of the time, the data will deviate
from the expected by chance alone. This means the chi-squared test fails to reject the null,
which means the null hypothesis (no difference between expected and observed) is true, in the
absence of other data (based on this data set alone). We can then conclude that the observed
data is in Hardy-Weinberg Equilibrium.

In your results, state the probability value result of the chi-square test and the conclusion of the
calculations (is the population in HWE?). Then in the discussion, talk about WHY the data would
be in HWE (or why not) – see questions below.

Discussion Notes:
I will require you to discuss how your data/results relates to what is already known in the field
as a whole. So your discussion should be weighed 50/50. 50% talks about technical errors, and

4
50% to talk about what is known in the literature about Alu frequencies and compare that with
our donation data.

There will be less and less of these discussion questions as we move on in the course to guide
you into thinking of how to write your own discussions. If you need ideas, please come see me.
 How successful were the designed primers at amplifying the TPA-25 locus? What factors
could have contributed to a poor amplification?
 Which primer set was better at amplifying the Alu region? What reasons can you think
of that would have made it better?
 Is the class data in Hardy-Weinberg equilibrium? Why or why not? If the donors are not
in equilibrium, which factors could have contributed to this?
 Is the overall 372 population over all years in Hardy-Weinberg equilibrium? Why or why
not? Is this different than the 2025 class data? Which factors could have contributed to
the difference, if there is one?

You might also like