The document discusses genetic engineering techniques related to sickle cell disease, focusing on manipulating recombinant DNA using tools like restriction enzymes, ApE, and Primer3. It outlines exercises for creating restriction maps, designing PCR primers, and conducting recombinant DNA experiments. The document emphasizes the importance of these techniques in molecular biology for analyzing gene expression and cloning DNA sequences.
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0 ratings0% found this document useful (0 votes)
9 views2 pages
11.21.24 - Worksheet 1st Biotech class
The document discusses genetic engineering techniques related to sickle cell disease, focusing on manipulating recombinant DNA using tools like restriction enzymes, ApE, and Primer3. It outlines exercises for creating restriction maps, designing PCR primers, and conducting recombinant DNA experiments. The document emphasizes the importance of these techniques in molecular biology for analyzing gene expression and cloning DNA sequences.
ticated “scissors” that molecu- lar biologists use to cut DNA, and they are routinely used in genetics and molecular biology laboratories for Copy the HBB coding sequence shown below and paste it into ApE.
Human HBB CDS
ATGGTGCATCTGACTCCTGAGGA 1. On the second page is a plasmid DNA sequence. Copy this sequence into a new window in ApE, toggle the linear/circular button to circular, and identify cutting sites for the same recombinant DNA experiments. Yet enzymes you used in Exercise I. Then GAAGTCTGCCGTTACTGCCCTGT another advantage of the genomics answer the following questions: GGGGCAAGGTGAACGTGGATGA revolution has been the development of a AGTTGGTGGTGAGGCCCTGGGCA a. What is the total size of the plas- wide variety of tools to assist scientists GGCTGCTGGTGGTCTACCCTTGG mid DNA analyzed in ApE? Why did working with restriction enzymes and ACCCAGAGGTTCTTTGAGTCCTT you toggle to circular? manipulating recombinant DNA for TGGGGATCTGTCCACTCCTGATG different applications, such as restriction b. Which enzyme(s) could be used in CTGTTATGGGCAACCCTAAGGTG mapping, designing primers for PCR a recombinant DNA experiment to AAGGCTCATGGCAAGAAAGTGCT experiments, and DNA cloning. Here we ligate the plasmid to the largest DNA CGGTGCCTTTAGTGATGGCCTGG explore ApE and Primer3, two tools that fragment from the human gene? Brief- CTCACCTGGACAACCTCAAGGGC make recombinant DNA experiments ly explain your answer. ACCTTTGCCACACTGAGTGAGCT much easier. GCACTGTGACAAGCTGCACGTGG c. What size recombinant DNA mol- Exercise I – Creating a Restriction ATCCTGAGAACTTCAGGCTCCTG ecule will be created by ligating these Map in ApE GGCAACGTGCTGGTCTGTGTGCT fragments? GGCCCATCACTTTGGCAAAGAAT Suppose you had cloned and sequenced d. Draw a simple diagram showing the TCACCCCACCAGTGCAGGCTGCC the hemoglobin beta (HBB) gene and wanted cloned DNA inserted into the plasmid TATCAGAAAGTGGTGGCTGGTGT to design a roughly 300bp long probe that and indicate the restriction enzyme GGCTAATGCCCTGGCCCACAAGT could be used to analyze expression of cutting site(s) used to create this ATCACTAA this gene in different human tissues by recombinant plasmid. Try to clone in Northern blot analysis. Not too long ago, 2. In the ApE toolbar, choose “Enzymes” ApE using “Tools” and Restriction- you had primarily two ways to approach and “Enzyme selector”. A new window Ligation Assembler. this task. You could digest the cloned will open, select the enzymes DNA with whatever restriction enzymes mentioned before and click below on were in your freezer, then run agarose “Digest”. gels and develop restriction maps in the hope of identifying cutting sites that 3. After examining the digestion results would give you the size fragment you provided by ApE, describe what you wanted. Or you could scan the sequence see. with your eyes, looking for restriction sites of interest— a very time-consuming Exercise II – Designing a and eye-straining effort! Bioinformatic Recombinant DNA tools such as ApE take the guesswork Experiment out of developing restriction maps and Now that you have created a restriction make it relatively easy to design map of your HBB CDS, you need to experiments for manipulating ligate the DNA into a plasmid DNA recombinant DNA. In this exercise, you vector that you can use to make your will use ApE to create a restriction map probe (molecular biologists often refer to with the enzymes BamHI and EcoRI. this as subcloning). To do this, you will 1. https://jorgensen.biology.utah.edu/way need to determine which restriction ned/ape/ Go to the site, download and enzymes would best be suited for cutting install ApE, and open it. both the plasmid and the human DNA. CGTTGGGAACCGGAGCTGAATGAAGCCAT annealing—or having primers bind to each Plasmid DNA sequence ACCAAACGACGAGCGTGACACCACGATGC other—among many other consider- TATAAATATAGAATAATGAATCATATAA CTGTAGCAATGCCAACAACGTTGCGCAAA ations. AACATATCATTATTCATTTATTTACATTT CTATTAACTGGCGAACTACTTACTCTAGCT Fortunately, primer design is another task AAAATTATTGTTTCAGTATCTTTAATTTA TCCCGGCAACAATTAATAGACTGGATGGA made much easier by the Internet. In this TTATGTATATATAAAAATAACTTACAATT GGCGGATAAAGTTGCAGGACCACTTCTGC exercise, you will use Primer3, a PCR primer TTATTAATAAACAATATATGTTTATTAAT GCTCGGCCCTTCCGGCTGGCTGGTTTATT design site from the Whitehead Institute TCATGTTTTGTAATTTATGGGATAGCGA GCTGATAAATCTGGAGCCGGTGAGCGTGG for Biomedical Research. TTTTTTTTACTGTCTGTATTTTTCTTTTTT GTCTCGCGGTATCATTGCAGCACTGGGGC AATTATGTTTTAATTGTATTTTATTTTTA CAGATGGTAAGCCCTCCCGTATCGTAGTTA 1. Access Primer3 at http://bioinfo.ut.ee/ TTATTGTTCTTTTTATAGTATTATTTTAA TCTACACGACGGGGAGTCAGGCAACTATG primer3/. Copy the human DNA AACAAAATGTATTTTCTAAGAACTTATA GATGAACGAAATAGACAGATCGCTGAGAT sequence from Exercise I into the text ATAATAATAAATATAAATTTTAATAAAAA AGGTGCCTCACTGATTAAGCATTGGTAACT box, then click “Pick Primers.” TTATATTTATCTTTTACAATATGAACATA GTCAGACCAAGTTTACTCATATATACTTTA AAGTACAACATTAATATATAGCTTTTAA GATTGATTTAAAACTTCATTTTTAATTTAAA 2. On the next page, the sequences for TATTTTTATTCCTAATCATGTAAATCTTA AGGATCTAGGTGAAGATCCTTTTTGATAAT the best recommended primers will AATTTTTCTTTTTAAACATATGTTAAATA CTCATGACCAAAATCCCTTAACGTGAGTTT appear at the top of the screen. An- TTTATTTCTCATTATATATAAGAACATAT TCGTTCCACTGAGCGTCAGACCCCGTAGA swer the following: TTATTAAATCTAGAATTCTATAGTGAGT AAAGATCAAAGGATCTTCTTGAGATCCTTT a. What is the length, in base pairs, of CGTATTACAATTCACTGGCCGTCGTTTT TTTTCTGCGCGTAATCTGCTGCTTGCAAAC the left (forward) primer and right (re- ACAACGTCGTGACTGGGAAAACCCTGG AAAAAAACCACCGCTACCAGCGGTGGTTT verse) primer? Where does each of these CGTTACCCAACTTAATCGCCTTGCAGC GTTTGCCGGATCAAGAGCTAC primers bind in the gene sequence? ACATCCCCCTTTCGCCAGCTGGCGTAA As you prepare to carry out this sub- b. The hybridization temperature for TAGCGAAGAGGCCCGCACCGATCGCC cloning experiment, you find that the a PCR reaction is often set around CTTCCCAACAGTTGCGCAGCCTGAATG expiration dates on most of your 5 degrees below the melting temper- GCGAATGGCGCCTGATGCGGTATTTTC restriction enzymes have long since ature, or Tm (refer to Chapter 10 for TCCTTACGCATCTGTGCGGTATTTCACA passed. Rather than run an experiment a discussion of melting temperature). CCGCATATGGTGCACTCTCAGTACAAT with old enzymes, you decide to purchase Based on the Tm for these primers, CTGCTCTGATGCCGCATAGTTAAGCCA new enzymes. Fortunately, a site called what might be the optimal hybridiza- GCCCCGACACCCGCCAACACCCGCTG REBASE®: The Restriction Enzyme tion temperature for this experiment? ACGCGCCCTGACGGGCTTGTCTGCTCC Database can help you. Over 300 CGGCATCCGCTTACAGACAAGCTGTGA c. What size PCR product would you restriction enzymes are commercially CCGTCTCCGGGAGCTGCATGTGTCAGA expect these primers to generate if you available rather inexpensively, but GGTTTTCACCGTCATCACCGAAACGCG ran the DNA amplified by this PCR re- scientists are always looking for ways to CGAGACGAAAGGGCCTCGTGATACGCC action on an agarose gel? stretch their research budgets as far as TATTTTTATAGGTTAATGTCATGATAATA possible. REBASE is excellent for ATGGTTTCTTAGACGTCAGGTGGCACTT locating enzyme suppliers and enzyme TTCGGGGAAATGTGCGCGGAACCCCTA specifics, particularly if you need to TTTGTTTATTTTTCTAAATACATTCAAAT work with an enzyme that you are ATGTATCCGCTCATGAGACAATAACCCT unfamiliar with. Visit REBASE® at GATAAATGCTTCAATAATATTGAAAAAG http://rebase.neb.com/rebase/ GAAGAGTATGAGTATTCAACATTTCCGT rebase.html to identify companies that GTCGCCCTTATTCCCTTTTTTGCGGCAT sell the restriction enzyme(s) you need TTTGCCTTCCTGTTTTTGCTCACCCAGA for this experiment. Click on one of the AACGCTGGTGAAAGTAAAAGATGCTGA companies and search for the enzyme AGATCAGTTGGGTGCACGAGTGGGTTA EcoRI. How expensive is it? CATCGAACTGGATCTCAACAGCGGTAA GATCCTTGAGAGTTTTCGCCCCGAAGA Exercise III – Designing PCR Primers ACGTTTTCCAATGATGAGCACTTTTAAA Giving this experiment more thought, GTTCTGCTATGTGGCGCGGTATTATCC you decide to try reverse transcriptase CGTATTGACGCCGGGCAAGAGCAACTC PCR (RT-PCR) first instead of GGTCGCCGCATACACTATTCTCAGAAT Northern blotting because RT-PCR is a GACTTGGTTGAGTACTCACCAGTCACA faster and more sensitive way to detect GAAAAGCATCTTACGGATGGCATGACA gene expression. Picking correct GTAAGAGAATTATGCAGTGCTGCCATA primers for a PCR experiment is not a ACCATGAGTGATAACACTGCGGCCAAC trivial process. You have to be sure the TTACTTCTGACAACGATCGGAGGACCG primers can amplify the gene of interest, AAGGAGCTAACCGCTTTTTTGCACAAC and you need to avoid primer self- ATGGGGGATCATGTAACTCGCCTTGAT